U.S. patent application number 15/898780 was filed with the patent office on 2018-07-05 for qsox1 as an anti-neoplastic drug target.
This patent application is currently assigned to Yeda Research and Development Co. Ltd.. The applicant listed for this patent is Arizona Board of Regents for and on behalf of Arizona State University, Yeda Research and Development Co. Ltd.. Invention is credited to Deborah FASS, Benjamin KATCHMAN, Douglas LAKE.
Application Number | 20180185477 15/898780 |
Document ID | / |
Family ID | 50728150 |
Filed Date | 2018-07-05 |
United States Patent
Application |
20180185477 |
Kind Code |
A1 |
LAKE; Douglas ; et
al. |
July 5, 2018 |
QSOX1 AS AN ANTI-NEOPLASTIC DRUG TARGET
Abstract
The present invention provides methods for tumor treatment by
administering an inhibitor of quiescin sulfhydryl oxidase 1
(QSOX1), compositions comprising such inhibitors, and methods for
identifying such inhibitors.
Inventors: |
LAKE; Douglas; (Scottsdale,
AZ) ; KATCHMAN; Benjamin; (Tempe, AZ) ; FASS;
Deborah; (Rehovot, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Yeda Research and Development Co. Ltd.
Arizona Board of Regents for and on behalf of Arizona State
University |
Rehovot
Scottsdale |
AZ |
IL
US |
|
|
Assignee: |
Yeda Research and Development Co.
Ltd.
Rehovot
AZ
Arizona Board of Regents for and on behalf of Arizona State
University
Scottsdale
|
Family ID: |
50728150 |
Appl. No.: |
15/898780 |
Filed: |
February 19, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15242646 |
Aug 22, 2016 |
|
|
|
15898780 |
|
|
|
|
14849013 |
Sep 9, 2015 |
|
|
|
15242646 |
|
|
|
|
14169612 |
Jan 31, 2014 |
|
|
|
14849013 |
|
|
|
|
13847930 |
Mar 20, 2013 |
8946186 |
|
|
14169612 |
|
|
|
|
61722396 |
Nov 5, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 39/3955 20130101;
G01N 33/5011 20130101; C12Q 2600/158 20130101; C12Y 108/03002
20130101; C12Q 1/26 20130101; A61K 38/44 20130101; C07K 16/40
20130101; C12N 2320/30 20130101; G01N 33/5008 20130101; C12N
2310/14 20130101; A61K 39/39558 20130101; C12N 15/1137 20130101;
C12N 2310/531 20130101; C12N 2310/11 20130101; C12Q 2600/118
20130101; A61K 2121/00 20130101; C12Q 1/6886 20130101; C12N 15/1135
20130101; C12N 2310/14 20130101; C12N 2310/531 20130101 |
International
Class: |
A61K 39/395 20060101
A61K039/395 |
Claims
1. A method for tumor treatment, comprising administering to a
subject having a tumor an amount effective of an anti quiescin
sulfhydryl oxidase 1 (QSOX1) antibody, or a pharmaceutically
acceptable salt thereof, to treat the tumor, wherein the tumor is a
pancreatic tumor that over-expresses QSOX1 compared to control.
2. A method for pancreatic tumor treatment, comprising
administering to a subject having a pancreatic tumor an amount
effective of an anti quiescin sulfhydryl oxidase 1 (QSOX1)
antibody, or a pharmaceutically acceptable salt thereof, to treat
the pancreatic tumor.
3. The method of claim 2, wherein the pancreatic tumor comprises a
pancreatic adenocarcinoma.
4. A method for breast tumor treatment, comprising administering to
a subject having a breast tumor an amount effective of an anti
quiescin sulfhydryl oxidase 1 (QSOX1) antibody, or a
pharmaceutically acceptable salt thereof, to treat the breast
tumor.
5. The method of claim 4, wherein the tumor is an estrogen receptor
positive (ER+) breast tumor.
6. The method of claim 4, wherein the breast tumor is a Luminal B
breast tumor.
7. The method of claim 2, wherein the method limits tumor
metastasis.
8. A method inhibiting tumor metastasis, comprising administering
to a subject having a breast tumor an amount effective of an anti
quiescin sulfhydryl oxidase 1 (QSOX1) antibody, or a
pharmaceutically acceptable salt thereof, to inhibit metastasis of
the breast tumor.
9. The method of claim 8, wherein the tumor is a cytokeratin 5/6
negative breast tumor, or a Luminal B breast tumor.
10. A method inhibiting tumor metastasis, comprising administering
to a subject having a pancreatic tumor an amount effective of an
anti quiescin sulfhydryl oxidase 1 (QSOX1) antibody, or a
pharmaceutically acceptable salt thereof, to inhibit metastasis of
the pancreatic tumor.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/242,646 filed on Aug. 22, 2016, which is a
continuation of U.S. patent application Ser. No. 14/849,013 filed
on Sep. 9, 2015, which is a continuation of U.S. patent application
Ser. No. 14/169,612 filed on Jan. 31, 2014, which is a
continuation-in-part (CIP) of U.S. patent application Ser. No.
13/847,930 filed on Mar. 20, 2013, now U.S. Pat. No. 8,946,186,
which claims the benefit of priority under 35 USC .sctn. 119(e) of
U.S. Provisional Patent Application No. 61/722,396 filed on Nov. 5,
2012, and is a continuation-in-part (CIP) of PCT Patent Application
No. PCT/US2011/052122 having International Filing Date of Sep. 19,
2011, which claims the benefit of priority under 35 USC .sctn.
119(e) of U.S. Provisional Patent Application No. 61/384,502 filed
on Sep. 20, 2010. The contents of the above applications are all
incorporated by reference as if fully set forth herein in their
entirety.
SEQUENCE LISTING STATEMENT
[0002] The ASCII file, entitled 73102SequenceListing.txt, created
on Feb. 19, 2018, comprising 25,906 bytes, submitted concurrently
with the filing of this application is incorporated herein by
reference.
BACKGROUND
[0003] Pancreatic ductal adenocarcinoma (PDA) is a disease that
carries a poor prognosis. It is often detected in stage III
resulting in an unresectable tumor at the time of diagnosis.
However, even if pancreatic cancer is surgically resected in stage
I or II, it may recur at a metastatic site (1, 2). Currently,
patients diagnosed with pancreatic ductal adenocarcinoma have less
than a 5% chance of surviving past five years (3).
Breast adenocarcinoma is the most common cancer diagnosed in women
throughout the world. In 2012, an estimated 226,870 new cases of
invasive breast cancer are expected to occur among US women, and an
estimated 39.510 breast cancer deaths.
SUMMARY OF THE INVENTION
[0004] In a first aspect, the present invention provides methods
for tumor treatment, comprising administering to a subject having a
tumor an amount effective of an inhibitor of quiescin sulfhydryl
oxidase 1 (QSOX1) expression and/or activity, or a pharmaceutically
acceptable salt thereof, to treat the tumor. In one embodiment, the
inhibitor of QSOX1 is selected from the group consisting of
anti-QSOX1 antibodies, QSOX1-binding aptamers, QSOX1 antisense
oligonucleotides, QSOX1 siRNA, and QSOX1 shRNA. In another
embodiment, the tumor is a tumor that over-expresses QSOX1 compared
to control. In a further embodiment, the subject is one from which
tumor-derived QSOX1 peptides can be obtained. In a further
embodiment, the tumor is a pancreatic tumor, and preferably a
pancreatic adenocarcinoma. In a still further embodiment, the
method is for limiting tumor metastasis.
[0005] In a second aspect, the present invention provides isolated
nucleic acids, comprising or consisting of antisense, siRNA, miRNA,
and/or shRNA molecules having a nucleic acid sequence that is
perfectly complementary at least 10 contiguous nucleotides of QSOX1
as shown in SEQ ID NO:1 and SEQ ID NO:2 or RNA equivalents thereof:
and/or fragments of the nucleic acid molecule. In a preferred
embodiment, the isolated nucleic acids comprising sequences from
the group consisting of
TABLE-US-00001 (SEQ ID NO: 11)
5'-A(T/U)C(T/U)ACA(T/U)GGC(T/U)GACC(T/U)GGAA-3' (SEQ ID NO: 12)
5'-AGGAAAGAGGG(T/U)GCCG(T/U)(T/U)C(T/U)(T/U)-3', (SEQ ID NO: 13)
5'-GCCAA(T/U)G(T/U)GG(T/U)GAGAAAG(T/U)(T/U)(T/U)- 3', (SEQ ID NO:
14) 5'-GCCAAGAAGG(T/U)GAAC(T/U)GGA(T/U)(T/U)-3'. (SEQ ID NO: 15)
5'-CCGGACAA(T/U)GAAGAAGCC(T/U)(T/U)(T/U)-3' (SEQ ID NO: 16)
5'-(T/U)C(T/U)AGCCACAACAGGG(T/U)CAA(T/U)-3' (SEQ ID NO: 17)
5'-ATCTACATGGCTGACCTGGAA-3', (SEQ ID NO: 18)
5'-AGGAAAGAGGGTGCCGTTCTT-3', (SEQ ID NO: 19)
5'-GCCAATGTGGTGAGAAAGTTT-3', (SEQ ID NO: 20)
5'-GCCAAGAAGGTGAACTGGATT-3', (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3'; (SEQ ID NO: 22)
5'-TCTAGCCACAACAGGGTCAAT-3'; and (SEQ ID NO: 26)
5'-CCGGGCCAATCTTGGTGAGAAAGTTTCTCGAGAAACTTT
CTCACCACATTGGCTTTTTG-3'.
[0006] In one embodiment of this second aspect of the invention,
the isolated nucleic acids present in a short hairpin RNA (shRNA).
In a further embodiment, the shRNA is of the general formula:
TABLE-US-00002 (SEQ ID NO: 23) CCGG-X1-CTCGAGAAACTTTCTCACCACATTGGC
TTTTTG-3'
[0007] wherein X1 is a nucleic acid sequence selected from the
group consisting of
TABLE-US-00003 (SEQ ID NO: 11)
5'-A(T/U)C(T/U)ACA(T/U)GGC(T/U)GACC(T/U)GGAA-3' (SEQ ID NO: 12)
5'-AGGAAAGAGGG(T/U)GCCG(T/U)(T/U)C(T/U)(T/U)-3', (SEQ ID NO: 13)
5'-GCCAA(T/U)G(T/U)GG(T/U)GAGAAAG(T/U)(T/U)(T/U)- 3', (SEQ ID NO:
14) 5'-GCCAAGAAGG(T/U)GAAC(T/U)GGA(T/U)(T/U)-3'. (SEQ ID NO: 15)
5'-CCGGACAA(T/U)GAAGAAGCC(T/U)(T/U)(T/U)-3' (SEQ ID NO: 16)
5'-(T/U)C(T/U)AGCCACAACAGGG(T/U)CAA(T/U)-3' (SEQ ID NO: 17)
5'-ATCTACATGGCTGACCTGGAA-3', (SEQ ID NO: 18)
5'-AGGAAAGAGGGTGCCGTTCTT-3', (SEQ ID NO: 19)
5'-GCCAATGTGGTGAGAAAGTTT-3', (SEQ ID NO: 20)
5'-GCCAAGAAGGTGAACTGGATT-3', (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3'; (SEQ ID NO: 22)
5'-TCTAGCCACAACAGGGTCAAT-3';
[0008] In a third aspect, the present invention provides
recombinant expression vectors comprising the isolated nucleic acid
of any embodiment of the second aspect of the invention operatively
linked to a promoter.
[0009] In a fourth aspect, the present invention provides
recombinant host cells comprising the recombinant expression vector
of the third aspect of the invention.
[0010] In a fifth aspect, the present invention provides
pharmaceutical compositions, comprising
[0011] (a) the isolated nucleic acid of any embodiment of the
second aspect of the invention, the recombinant expression vector
of any embodiment of the third aspect of the invention, or the
recombinant host cell of any embodiment of the fourth aspect of the
invention; and
[0012] (b) a pharmaceutically acceptable carrier.
[0013] In a sixth aspect, the present invention provides methods
for identifying candidate compounds for treating a tumor,
comprising
[0014] (a) contacting tumor cells capable of expressing QSOX1 with
one or more candidate compounds under conditions suitable for
expression of QSOX1;
[0015] (b) determining a level of QSOX1 expression and/or activity
in the tumor cells and comparing to control;
[0016] wherein a compound that decreases QSOX1 expression and/or
activity in the tumor cells relative to control is a candidate
compound for treating a tumor.
[0017] In one embodiment, the tumor cells are pancreatic tumor
cells, preferably pancreatic adenocarcinoma cells.
[0018] In another aspect, the invention provides methods for
prognosing a tumor, comprising
[0019] (a) determining a QSOX1 expression level in a sample from a
subject having a tumor;
[0020] (b) comparing the QSOX1 expression level to control; and
[0021] (c) prognosing the progression of the tumor in the
subject.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0022] FIGS. 1A-1D: QSOX1 is highly expressed in tumor cell lines
but is not expressed in adjacent normal cells. Previously, our lab
discovered a short peptide, NEQEQPLGQWHLS (SEQ ID NO:3), in patient
plasma through LC-MS/MS. We were able to map this short, secreted
peptide back to an understudied parent protein, QSOX1-L. FIG. 1A.)
Diagram showing the two splice variants of QSOX1, QSOX1-Short (S)
and -Long (L), both contains a thioredoxin 1 (Trx1) and ERV/ALR
functional domains as well as structural thioredoxin 2 (Trx2) and
helix rich region (HRR).
QSOX1-L contains a predicted transmembrane (TM) domain. The peptide
NEQEQPLGQWHLS (SEQ ID NO:3), maps back to QSOX1-L, and found to be
secreted in pancreatic cancer patients but not in normal samples.
The commercially available antibody recognizes the first 329 amino
acids of both QSOX1-S and -L. FIG. 1B.) Immunohistochemistry of
normal (left) and tumor (right) pancreatic tissue sections that
have been stained with the anti-QSOX1 showing tumor specific
staining in pancreatic ducts but not in adjacent non-tumor cells.
FIG. 1C.) Western blot analysis of patient tumor as well as
adjacent normal tissue indicates that QSOX1-S is the dominant
splice variant expressed. FIG. 1D.) Western blot showing QSOX1
expression in transformed normal pancreatic cells (HPDE6) and Human
Pancreatic Adenocarinoma Cells (Panc-1, CFPac-1, BxPC3, and Capan
1) shows that our in vitro system mimics that of the in vivo QSOX1
expression as shown above using IHC.
[0023] FIGS. 2A-2C: Reduced expression of QSOX1 in BxPC3 and Panc-1
cells leads to a significant decrease in cell growth. To determine
the phenotype presented due to the expression of QSOX1 in tumor
cells we employed shRNA specific t QSOX1 to reduce the expression
of QSOX1 in FIG. 2A.) BxPC3 (Percent Decrease in sh742--56%;
sh528--40%; sh616--28%) and FIG. 2B.) Panc-1 (Percent Decrease in
sh742--64%; sh528--46%; sh616--18%) cells and further evaluated
cell growth, cell cycle, apoptosis, and invasion/metastasis. FIG.
2C.) MTT assay on shRNA treated BxPC3 and Panc-1 cells assayed
on day 1, 2, and 5. Data represents averages.+-.standard deviation.
Significance *, P<0.05: **, P<0.01.
[0024] FIG. 3: Reduced expression of QSOX1 in BxPC3 and Panc-1
cells leads to an increase in annexin V/propidium iodide positive
cells. Apoptosis Analysis (Annexin V/Propidium Iodide) was
performed on BxPC3 and Panc-1 cells in which QSOX1 was reduced
using shRNA. Plots show representative data from one of three
individual experiments for gated samples of Untreated, Scramble,
sh742, sh528 and sh6I6. The percentages represent the number of
cells that are annexin V positive (Lower Right), annexin
V/propidium iodide double positive (Upper Left), or propidium
iodide positive (Upper Right). Data was calculated using Cell Quest
Pro software.
[0025] FIGS. 4A-4B: Reduced expression of QSOX1 in BxPC3 and Panc-1
cells leads to a significant decrease in cellular invasion. FIG.
4A.) Untreated BxPC3 and FIG. 4B.) Untreated Panc-1 cells were
treated with Scramble, sh742, sh528 and sh616 shRNA's specific for
QSOX1 and seeded in the top chamber of Matrigel.TM. invasion wells
and allowed to incubate for 18 hours. Representative 10.times.,
20.times., and 40.times. images are presented. In the BxPC3 sh742,
sh528 and sh6I6 treated cells there was an 84%, 84%, and 79%
decrease in cells that were able to break down the basement
membrane
components of the Matrigel.TM. and invade to the underside of the
membrane, respectively. While in Panc-1 sh742, sh528 and sh616
cells there was a 76%, 76%, and 63% decrease in cells that were
able to degrade the Matrigel.TM. and invade through the membrane.
Graphs represent average.+-.standard deviation (BxPC3 n=6: PANC-1
n=3), 30 significance *, P<0.05, **, P<0.005.
[0026] FIGS. 5A-5E: Reduced expression of QSOX1 leads to a decrease
in secreted proMMP-9 in BxPC3 and proMMP-2 Panc-1 cells. Gelatin
zymography of FIG. 5A.) BxPC3 and FIG. 5B.) Panc-1 conditioned
media showing a decrease in MMP-9 homodimers (MMP-9 Complex) (240
and 130 kDa), pro-MMP9 (92 kDa), pro-MMP2 (72 kDa) and active MMP-2
(a-MMP2, 66 kDa).
Using Image J we were able to quantify the percent decrease in
proMMP-9 expression in BxPC3 (Decrease in QSOX1, sh742--65%;
sh528--47%; sh616--10%) and Panc-1 proMMP-2 (Decrease in QSOX1,
sh742--70%; sh528--56%; sh616--15%). FIG. 5C.) Western blot
analysis of MMP-2 and -9 on conditioned serum free media from shRNA
treated BxPC3 and Panc-1 cells. FIG. 5D.) The effect of shRNA
mediated knockdown of QSOX1 on the expression of QSOX1-S, QSOX1-L,
MMP-2, and MMP-9 in BxPC3 and Panc-1 shRNA treated cells was
analyzed by quantitative real time PCR analysis. The graph
represents relative gene expression calculated as .DELTA..DELTA.Cq
using GAPDH as the endogenous reference gene.
[0027] FIG. 6. Cellular proliferation was measured by MTT assay 4
days post-transfection shows that knockdown of QSOX1 short and long
form expression by transient lipid-mediated transfection of shRNA
results in a decrease in tumor cell viability as measured by a
cellular mitochondrial respiration assay (MTT assay). This supports
the idea that shRNA or other RNAi species could be used as a drug
to suppress QSOX1 protein expression, and inhibit the growth,
invasion, and metastases of tumors over-expressing QSOX1. No
shRNA--Untreated BxPC3 Cells; Scrambled shRNA--Negative control.
BxPC3 cells transfected with scrambled shRNA control vector;
shRNA1--BxPC3 cells transfected with shRNA1 for 4 days;
shRNA2-BxPC3 cells transfected with shRNA2 for 4 days.
[0028] FIG. 7. Invasion Assay shows that by knocking down QSOX1
with the above shRNA we are able to see a decrease in tumor cell
invasion. Cells were transfected, allowed to recover for 4 days,
resuspended in serum free media and added to 8 um (pore size)
microwell inserts coated with Matrigel.TM.. The inserts were placed
in cell culture media containing I0% fetal bovine serum such that
the bottom half of the outside of the insert was exposed to the
media. After 24 hours incubation at 37.degree. C., 5% CO.sub.2, the
inserts were removed and washed in buffer.
[0029] Cells that were able to degrade the Matrigel.TM. coating and
invade through the 8 um pores in the insert were counted on the
underside of the well.
Using the Matrigel.TM. assay we are able to show that when we knock
down QSOX1 in BxPC3 (pancreatic cancer cells) the cells are no
longer able to degrade the basement membrane components resulting
in a decrease in cellular invasion. Untreated--Untreated BxPC3
Cells; Scrambled--BxPC3 cells transfected with scrambled shRNA
control vector. Invasion measured at 4 days post-transfection;
shRNA1--BxPC3 cells transfected with shRNA1 and invasion measured 4
days post-transfection; shRNA2--BxPC3 cells transfected with shRNA2
and invasion measured 4 days post-transfection; shRNA1/2--BxPC3
cells transfected with a combined shRNA1 and shRNA2. Cells were
measured for invasion properties 4 days post-transfection.
[0030] FIG. 8 is a graph showing MIAPaCa3 pancreatic tumor cell
xenograft growth rate as a result of shRNA knockdown assays
described in Example 3. Human pancreatic tumor cells (MIAPaCa2)
were transduced with a lentivirus encoding shQSOX1 (sh528 and
sh742) and shScramble (control). One million MIAPaCa2 cells were
mixed with Matrigel.TM. and used to inoculate nude mice (5
mice/group) on day 0. After day 12,
tumor growth was measured every 3 days (x-axis) and reported as
"Tumor volume" on the Y-axis. "Untreated" indicates that tumor
cells were not transduced.
[0031] FIG. 9 is a graph showing MIAPaCa3 pancreatic tumor cell
xenograft final tumor weights as a result of shRNA knockdown assays
described in Example 3.
[0032] FIGS. 10A-10F QSOX1 promotes tumor cell invasion. FIG. 10A)
MCF7, FIG. 10B) BT549 and FIG. 10C) BT474 cells transduced with
shScramble, sh742 and sh528 shRNAs were seeded at equal densities
in the top chamber of Matrigel.TM. invasion wells and allowed to
incubate for 48 (BT549 and BT474) and 72 (MCF7) hours, after which
cells that had digested Matrigel.TM. and migrated through the 8 um
pores were counted on the underside of the insert. Representative
20.times. images are presented. MCF7 cells transduced with sh742
and sh528 show a 65% and 71% decrease in invasion. BT549 cells
transduced with sh742 and sh528 showed a 60% and 40% decrease in
invasion. BT474 cells transduced with sh742 and sh528 show an 82%
decrease in invasion. Each knockdown was compared to shScramble
controls. The invasive phenotype of shQSOX-transduced MCF7 (FIG.
10D), BT549 (FIG. 10E) and BT474 (FIG. 10F) cells was rescued by
exogenous incubation with catalytically active rhQSOX1.
rhQSOX1 (AA) mutant is a mutant without enzymatic activity,
generously provided by Dr. Debbie Fass. Graphs represent
average.+-.standard deviation (MCF7, BT549 and BT474 n=3),
significance *, P<0.05, ** P<0.005.
[0033] FIGS. 11A-11D. Reduced expression of QSOX1 in MCF7 and BT549
cells leads to a decrease in functional MMP-9 activity. Gelatin
zymography of FIG. 11A) MCF7 and FIG. 11B) BT549 conditioned media
shows a decrease in MMP-9 homodimers (130 kDa) and MMP-9 (92 kDa).
The percent decrease in MMP-9 expression in MCF7 was: sh742: 70%
(p=0.0171); sh528: 77% (P=0.0182),
and in BT549 was: sh742: 34% (P=0.0531); sh528: 88% (P=0.0564)
compared to shScramble control. FIG. 11C) Western blots of total
cell lysate from shRNA treated MCF7 and BT549 probing for MMP-2 and
-9 show insignificant changes compared to shScramble control. Full
images can be seen in Additional file S3. FIG. 11D) QPCR of QSOX1
transcripts and MMP-2 and -9 transcripts. The graph represents
relative gene expression calculated as .DELTA..DELTA. Cq using
GAPDH as the endogenous reference gene. MMP-2--MCF7 sh742
(P=0.5294), sh528 (P=0.2112): BT549 sh742 (P=0.0054), sh528
(P=0.0019). MMP-9--MCF7 sh742 (P=0.3981), sh528 (P=0.3385); BT549
sh742 (P=0.4192), sh528 (P=0.0701). Average.+-.standard deviation;
significance was determined using a Student's two-tailed
t-Test.
[0034] FIGS. 12A-12D. GOBO analyses of QSOX1 transcript expression
among subtypes of breast cancer from over 1,800 cases. FIG. 12A)
Box plot analysis of QSOX1 mRNA expression in all tumors
ER+(n=1,225) and ER-tumors (n=395) (P<0.00001); FIG. 12B) Box
plot analyses of QSOX1 expression among HU subtypes, Basal (n=357),
HER2 (n=152). Luminal A (n=482), Luminal B (n=289), Normal-like
(n=257) and unclassified (n=344), (P<0.00001.
FIG. 12C) Kaplan Meier analysis over 10 years of relapse free
survival (RFS) in patients with Luminal B breast cancer expressing
high (red line) and low (gray line) QSOX1 mRNA; High (n=56), low
(n=74), (P=0.00062) and FIG. 12D) Overall survival (OS); High
(n=34), low (n=64), (P=0.00031). Data obtained using GOBO, Gene
expression based Outcome for Breast cancer Online.
[0035] FIGS. 13A-13F. Protein expression of QSOX1 is specific for
breast tumor cells in tissue. FIG. 13A) Graphical representation of
"High QSOX1 staining (n=65)" column from Table 1. Each graph
correlates with percentages of QSOX1 positive cells listed in Table
1 for the "High QSOX1 staining (n=65)" column FIG. 13B) normal
breast tissue showing no QSOX1 staining; FIG. 13C) grade 1 invasive
ductal carcinoma (IDC) ER+PR+breast tumor tissue showing low QSOX1
staining; FIG. 13D) grade 2 IDC ER+PR+breast tumor tissue showing
moderate QSOX1 staining;
FIG. 13E.) grade 3 IDC, ER+, PR+ showing high QSOX1 staining; FIG.
13F) grade 3 invasive lobular carcinoma (ILC), ER+, PR- showing
high QSOX1 staining. Polyclonal antibody recognizes residues 1-329
of both QSOX1-S and -L
[0036] FIGS. 14A-14J. Reduced expression of QSOX1 leads to a
significant decrease in tumor cell growth. FIG. 14A) Western blot
showing weak expression of QSOX1 in transformed, but
non-tumor-forming MCF 10A and human breast ductal carcinoma cell
lines Luminal A-like (MCF7 and MDA-MB-453), Luminal B-like (ZR75
and BT474) and Basal-like (BT549 and MDA-MB-231). .alpha.-Tubulin
loading control is shown below each lane. MCF7, BT549 and BT474
breast tumor cell lines were transduced with lentiviral shRNA QSOX1
(sh742 and sh528).
Western blots are shown using the same anti-QSOX1 polyclonal Ab as
in FIG. 2 on cell lysates from FIG. 14B) MCF7 (percent decrease in
sh742: 85% and sh528: 82%); FIG. 14C) BT549 (percent decrease in
sh742: 45% and sh528: 77%) and FIG. 14D) BT474 (percent decrease in
sh742: 40% and sh528 36%) cells. Western blots have been cropped.
(FIGS. 14E-14G MTT and (FIGS. 14H-14J) Trypan Blue growth assays on
MCF7, BT549 and BT474 cells transduced with shScramble, sh742 and
sh528 assayed on Days 1 through 5. Percent decrease sh742 and sh528
day 5: FIG. 14E) 66% (both); FIG. 14F) 78% and 69%; FIG. 14G) 52%
and 34%; FIG. 14H) 72% and 73%; FIG. 14I) 98% and 96%; FIG. 14J)
50% (both). Experiments were performed three times in triplicate;
error bars represent standard deviation from triplicate wells.
Significance **, P<0.01.
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0037] All references cited are herein incorporated by reference in
their entirety. Within this application, unless otherwise stated,
the techniques utilized may be found in any of several well-known
references such as: Molecular Cloning: A Laboratory Manual
(Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene
Expression Technology (Methods in Enzymology, Vol. 185, edited by
D. Goeddel, 1991. Academic Press, San Diego, Calif.), "Guide to
Protein Purification" in Methods in Enzymology (M. P. Deutshcer,
ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to
Methods and Applications (Innis, et al. 1990. Academic Press. San
Diego, Calif.), Culture of Animal Cells: A Manual of Basic
Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York,
N.Y.), Gene Transfer and Expression Protocols, pp. 109-128, ed. E.
J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion
1998 Catalog (Ambion, Austin, Tex.).
[0038] As used herein, the singular forms "a", "an" and "the"
include plural referents unless the context clearly dictates
otherwise. "And" as used herein is interchangeably used with "or"
unless expressly stated otherwise.
[0039] All embodiments of any aspect of the invention can be used
in combination, unless the context clearly dictates otherwise.
[0040] In a first aspect, the present invention provides methods
for tumor treatment, comprising contacting a subject having a tumor
with an amount effective of an inhibitor of QSOX1 expression and/or
activity, or pharmaceutically acceptable salt thereof, to treat the
tumor.
[0041] As demonstrated in the examples that follow, the inventors
of the present invention have discovered that inhibitors of QSOX1
expression and/or activity of QSOX1 can be used to treat
tumors.
[0042] As used herein, "QSOX1" is Quiescin Sulfhydryl Oxidase 1,
also called QSCN6. The protein accession number for the long
variant of QSOX1 on the NCBI database is NP_002817 (SEQ ID NO:24),
and the accession number for the short form is NP_001004128 (SEQ ID
NO:25). As used herein, "QSOX1" refers to both the long and short
variants of QSOX1.
[0043] The subject can be any mammal, preferably a human.
[0044] As used herein, any suitable "inhibitor of QSOX1 expression
and/or activity" can be used that is capable of reducing expression
of QSOX1 mRNA expression or protein synthesis (including, but not
limited to inhibiting QSOX1 promoter activity or reducing stability
of QSOX1 mRNA), or that can inhibit activity of QSOX1 protein via
any mechanism, including but not limited to binding to QSOX1
resulting in inhibition of QSOX1 activity. Such inhibitors can
include, but are not limited to small molecules, antibodies, and
aptamers that inhibit activity of QSOX1 protein, and antisense,
siRNA, shRNA, etc. that inhibit expression of QSOX1 mRNA and/or
protein. Inhibitors of QSOX1 expression may be identified through
any suitable means, including but not limited to the methods
described below. Any suitable method for determining QSOX1 activity
levels may be used, including but not limited to those described in
detail below.
[0045] As used herein, "inhibit" means at least a 10% reduction in
QSOX1 expression and/or activity; preferably at least a 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, or greater reduction in expression
and/or activity.
[0046] The methods of the invention can be used to treat any
suitable tumor type. In one preferred embodiment, the methods are
used to treat any tumor type that over-expresses QSOX1. Expression
of QSOX1 can be assessed by any suitable method, including but not
limited to immunohistochemistry of suitable tissue sample,
polymerase chain reaction, or detection of QSOX1 peptides in
suitable tissue, as disclosed, for example, in WO 2010/071788; WO
2010/01787; and WO 2010/077921, incorporated by reference herein in
their entirety. In various non-limiting embodiments, techniques
that can be used in the analysis include mass spectrometry (MS),
two dimensional gel electrophoresis, western blotting,
immunofluorescence, ELISAs, antigen capture assays (including
dipstick antigen capture assays) and mass spec immunoassay (MSIA).
In one preferred embodiment, ligands for the one or more peptides
are used to "capture" antigens out of the tissue sample. Such
ligands may include, but are not limited to, antibodies, antibody
fragments and aptamers. In one embodiment, the ligand(s) are
immobilized on a surface and the sample is passed over the surface
under conditions suitable for binding of any peptides in the sample
to the ligand(s) immobilized on the surface. Such antigen capture
assays permit determining a concentration of the peptides in the
tissue sample, as the concentration likely correlates with extent
of disease.
[0047] The tissue sample may be any suitable sample from which
tumor-derived peptides may be obtained. In various preferred
embodiments, the tissue sample is selected from the group
consisting of plasma, serum, urine, saliva, and relevant tumor
tissue. In various preferred embodiments for detecting QSOX1
peptides in tissue (preferably plasma or serum), the peptide to be
detected is selected from the group consisting of
TABLE-US-00004 (SEQ ID NO: 3) NEQEQPLGQWHLS, (SEQ ID NO: 4)
NEQEQPLGQWH, (SEQ ID NO: 5) EQPLGQWHLS, (SEQ ID NO: 6)
AAPGQEPPERMAELQR, (SEQ ID NO: 7) AAPGQEPPEHMAELQ, (SEQ ID NO: 8)
AAPGQEPPEHMAELQRNEQEQPLGQWHLS, (SEQ ID NO: 9) NEQEQPL, and (SEQ ID
NO: 10) GQWHLS.
[0048] As used herein, the phrase "an amount effective" refers to
the amount of inhibitor that provides a suitable treatment
effect.
[0049] Any suitable control can be used to compare with QSOX1
expression and/or activity in the subject's tissue. In one
embodiment, the control comprises an amount of one or more peptides
of interest from a tissue sample from a normal subject or
population (i.e. known not to be suffering from a tumor), or from a
subject or population of subjects suffering from a tumor, using the
same detection assay. The control tissue sample will be of the same
tissue sample type as that assessed from the test subject. In one
preferred embodiment, a standard concentration curve of one or more
peptides of interest in the control tissue sample is determined,
and the amount of the one or more peptides of interest in the test
subject's tissue sample is compared based on the standard curve. In
another preferred embodiment for use in monitoring progress of
tumor therapy, samples are obtained from patients over time, during
or after their therapy, to monitor levels of one or more peptides
in plasma as an indication about tumor burden in patients. The
control may comprise a time course of concentration of the one or
more peptides of interest in a given tissue type of the test
subject, to monitor the effect of treatment on the concentration;
this embodiment is preferred, for example, when assessing efficacy
of tumor treatments. Those of skill in the art will recognize that
similar controls can be used for immunohistochemical-based
analysis. Based on the teachings herein and the knowledge in the
art, those of skill in the art can design a variety of other
appropriate controls in assessing QSOX1 expression and/or activity
in identifying subjects most likely to respond to the treatment
methods of the invention, as well as to assess efficacy of the
treatment over time.
[0050] Thus, in one preferred embodiment, the method comprises
identifying subjects with tumors that over-express QSOX1, and
treating such patients according to the methods of the invention.
In one preferred embodiment, the method comprises measuring QSOX1
expression in blood plasma to identify tumors that over-express
QSOX1. Methods for preparing blood plasma are well known in the
art. In one embodiment, plasma is prepared by centrifuging a blood
sample under conditions suitable for pelleting of the cellular
component of the blood.
[0051] Non-limiting tumor types that can be treated using the
methods of the invention include pancreatic, lung, colon, breast,
and prostate tumors. In one embodiment, the tumor is a pancreatic
tumor, such as a pancreatic adenocarcinoma or a neuroendocrine
tumor. In a further embodiment, the tumor comprises a pancreatic
adenocarcinoma.
[0052] In a further embodiment, the tumor is a breast tumor. In one
such embodiment, the breast tumor is an estrogen receptor positive
(ER+) breast tumor. In another embodiment, the breast tumor is a
Luminal B tumor. For example, the Luminal B tumor is ER+ and/or
progesterone receptor positive (PR+). In another example, the
Luminal B tumor is highly positive for Ki67 and/or HER2-positive.
In another example, the Luminal B tumor is ER+, PR-, and
HER2-positive. In another example, the Luminal B tumor is ER+, PR+,
and HER2-positive. In these embodiments, the methods may further
comprise treating the patient with one or more of chemotherapy,
hormone therapy, and treatments targeted to HER2 (including but not
limited to pertuzumab, lapatinib, and trastuzumab emtansine
(T-DM1)).
[0053] As used herein, "treating tumors" means accomplishing one or
more of the following: (a) reducing tumor mass; (b) slowing the
increase in tumor mass; (c) reducing size of tumor metastases
and/or budding off of metastases; (d) slowing the incidence of
tumor metastases; (e) limiting or preventing development of
symptoms characteristic of cancer; (f) inhibiting worsening of
symptoms characteristic of cancer; (g) limiting or preventing
recurrence of symptoms of cancer in subjects that were previously
symptomatic; (i) increasing subject survival time; and (j) limiting
or reducing morbidity of therapy by enhancing current therapies
and/or permitting decreased dose of current standard of care
therapies.
[0054] For example, symptoms of pancreatic cancer include, but are
not limited to, pain in the upper abdomen, significant weight loss,
loss of appetite and/or nausea and vomiting, jaundice, and
Trousseau sign. Symptoms of breast cancer include, but are not
limited to, a breast lump or thickening that feels different from
the surrounding tissue, bloody discharge from the nipple, change in
the size or shape of a breast, changes to the skin over the breast,
such as dimpling, inverted nipple, peeling, scaling or flaking of
the nipple or breast skin; and redness or pitting of the skin over
the breast.
[0055] In a preferred embodiment, the methods limit tumor
metastasis, such as limiting pancreatic or breast tumor metastasis.
As shown in the examples that follow, the inventors have shown that
knockdown of QSOX11 expression in tumor cells leads to a dramatic
decrease in tumor cell invasive/migratory phenotype, thus making
the methods of the invention particularly useful for limiting tumor
metastasis. Silencing of QSOX1 protein expression with shRNA was
shown to inhibit breast tumor growth in vitro, and to suppress
breast tumor cell invasion through Matrigel.TM. (which can be
rescued by addition of exogenous recombinant QSOX1).
[0056] While not being limited by any particular mechanism of
action, the inventors believe that this inhibition of metastasis
may result from a decrease in the proteolytic activity of matrix
metalloproteases 2 and 9 (MMP-2 and MMP-9), as discussed in more
detail in the examples that follow.
[0057] In a preferred embodiment of all of the above embodiments,
the inhibitor is selected from the group consisting of antibodies,
antisense RNA, siRNA, miRNA, and shRNA. In a further preferred
embodiment, the inhibitor comprises or consists of antisense,
siRNA, miRNA, and/or shRNA molecules having a nucleic acid sequence
perfectly complementary to least 10 contiguous nucleotides of QSOX1
as shown in SEQ ID NO:1 and SEQ ID NO:2 or RNA equivalents thereof;
and/or fragments of the nucleic acid molecule. In various preferred
embodiments, the nucleic acid molecule is perfectly complementary
to at least 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25 or more contiguous nucleotides of QSOX1, or an RNA equivalent
thereof.
[0058] In another preferred embodiment, the inhibitor comprises or
consists of a nucleic acid selected from the group consisting
of
TABLE-US-00005 (SEQ ID NO: 11)
5'-A(T/U)C(T/U)ACA(T/U)GGC(T/U)GACC(T/U)GGAA-3' (SEQ ID NO: 12)
5'-AGGAAAGAGGG(T/U)GCCG(T/U)(T/U)C(T/U)(T/U)-3', (SEQ ID NO: 13)
5'-GCCAA(T/U)G(T/U)GG(T/U)GAGAAAG(T/U)(T/U)(T/U)- 3', (SEQ ID NO:
14) 5'-GCCAAGAAGG(T/U)GAAC(T/U)GGA(T/U)(T/U)-3'. (SEQ ID NO: 15)
5'-CCGGACAA(T/U)GAAGAAGCC(T/U)(T/U)(T/U)-3' (SEQ ID NO: 16)
5'-(T/U)C(T/U)AGCCACAACAGGG(T/U)CAA(T/U)-3'
wherein residues noted as "(T/U)" can be either "T" or "U". In
further preferred embodiments, the inhibitor comprises or consists
of
TABLE-US-00006 (SEQ ID NO: 17) 5'-ATCTACATGGCTGACCTGGAA-3', (SEQ ID
NO: 18) 5'-AGGAAAGAGGGTGCCGTTCTT-3', (SEQ ID NO: 19)
5'-GCCAATGTGGTGAGAAAGTTT-3', (SEQ ID NO: 20)
5'-GCCAAGAAGGTGAACTGGATT-3', (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3'; (SEQ ID NO: 22)
5'-TCTAGCCACAACAGGGTCAAT-3'; and (SEQ ID NO: 26)
5'-CCGGGCCAATCTTGGTGAGAAAGTTTCTCGAGAAACTTT
CTCACCACATTGGCTTTTTG-3'.
[0059] In a further preferred embodiment, the nucleic acids of SEQ
ID NO: 11-22 are part of a short hairpin RNA (shRNA). In this
embodiment, such an shRNA comprises flanking regions, loops, and
antisense and spacer sequences flanking a recited SEQ ID NO:
sequence responsible for the specificity of shRNA. There are no
specific sequence requirements for these various other shRNA
regions so long as a loop structure can be formed. Exemplary
constructs are shown in the examples below. ShRNA are thought to
assume a stem-loop structure with a 2 nucleotide 3' overhang that
is recognized by Dicer and processed in to small interfering RNA
(siRNA), siRNA are then recognized by RNA-Induced Silencing Complex
(RISC), which removes the sense strand from the stem structure and
leaves the guide strand to associate with target mRNA, QSOX1 mRNA
in this case, and cleave it. Full length protein cannot be
translated after cleavage.
[0060] In one exemplary embodiment, the shRNA comprise or consist
of a nucleic acid of the general formula:
TABLE-US-00007 (SEQ ID NO: 23)
CCGG-X1-CTCGAGAAACTTTCTCACCACATTGGCTTTTTG-3'
[0061] wherein X1 is a nucleic acid sequence selected from the
group consisting of
TABLE-US-00008 (SEQ ID NO: 11)
5'-A(T/U)C(T/U)ACA(T/U)GGC(T/U)GACC(T/U)GGAA-3' (SEQ ID NO: 12)
5'-AGGAAAGAGGG(T/U)GCCG(T/U)(T/U)C(T/U)(T/U)-3', (SEQ ID NO: 13)
5'-GCCAA(T/U)G(T/U)GG(T/U)GAGAAAG(T/U)(T/U)(T/U)- 3', (SEQ ID NO:
14) 5'-GCCAAGAAGG(T/U)GAAC(T/U)GGA(T/U)(T/U)-3'. (SEQ ID NO: 15)
5'-CCGGACAA(T/U)GAAGAAGCC(T/U)(T/U)(T/U)-3' (SEQ ID NO: 16)
5'-(T/U)C(T/U)AGCCACAACAGGG(T/U)CAA(T/U)-3' (SEQ ID NO: 17)
5'-ATCTACATGGCTGACCTGGAA-3', (SEQ ID NO: 18)
5'-AGGAAAGAGGGTGCCGTTCTT-3', (SEQ ID NO: 19)
5'-GCCAATGTGGTGAGAAAGTTT-3', (SEQ ID NO: 20)
5'-GCCAAGAAGGTGAACTGGATT-3', (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3'; (SEQ ID NO: 22)
5'-TCTAGCCACAACAGGGTCAAT-3';
[0062] These and other nucleic acid inhibitors may be modified for
a desired purpose, including but not limited to nucleic acid
backbone analogues including, but not limited to, phosphodiester,
phosphorothioate, phosphorodithioate, methylphosphonate,
phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal,
methylene(methylimino), 3'-N-carbamate, morpholino carbamate,
peptide nucleic acids (PNAs), methylphosphonate linkages or
alternating methylphosphonate and phosphodiester linkages
(Strauss-Soukup (1997) Biochemistry 36:8692-8698), and
benzylphosphonate linkages, as discussed in U.S. Pat. No.
6,664,057; see also Oligonucleotides and Analogues, a Practical
Approach, edited by F. Eckstein, IRL Press at Oxford University
Press (1991); Antisense Strategies, Annals of the New York Academy
of Sciences, Volume 600, Eds. Baserga and Denhardt (NYAS 1992);
Milligan (1993) J. Med. Chem. 36:1923-1937; Antisense Research and
Applications (1993, CRC Press). Nucleic acid inhibitors may also
comprise analogous forms of ribose or deoxyribose as are well known
in the art, including but not limited to 2' substituted sugars such
as 2'-O-methyl-, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar
analogs, .alpha..-anomeric sugars, epimeric sugars such as
arabinose, xyloses or lyxoses, pyranose sugars, sedoheptuloses,
acyclic analogs and a basic nucleoside analogs such as methyl
riboside. The oligonucleotides may also contain TNA (threose
nucleic acid; also referred to as alpha-threofuranosyl
oligonucleotides) (See, for example, Schong et al., Science 2000
Nov. 17, 290 (5495):1347-1351.)
[0063] The inhibitors for use in the present invention can be
administered via any suitable technique or formulation, including
but not limited to lipid, virus, polymer, or any other physical,
chemical or biological agent, but are generally administered as
part of a pharmaceutical composition together with a
pharmaceutically acceptable carrier, diluent, or excipient. Such
compositions are substantially free of non-pharmaceutically
acceptable components, i.e., contain amounts of
non-pharmaceutically acceptable components lower than permitted by
US regulatory requirements at the time of filing this application.
In some embodiments of this aspect, if the compound is dissolved or
suspended in water, the composition further optionally comprises an
additional pharmaceutically acceptable carrier, diluent, or
excipient. In other embodiments, the pharmaceutical compositions
described herein are solid pharmaceutical compositions (e.g.,
tablet, capsules, etc.). The isolated nucleic acids or shRNAs can
be present in a vector, such as a viral vector (ex: retrovirus,
lentivirus, adenovirus, adeno-associated virus, etc.), for delivery
via any suitable technique.
[0064] These compositions can be prepared in a manner well known in
the pharmaceutical art, and can be administered by a variety of
routes, depending upon whether local or systemic treatment is
desired and upon the area to be treated. Administration may be via
physical injection with a needle to, for example, a tumor in the
subject; topical (including ophthalmic and to mucous membranes
including intranasal, vaginal and rectal delivery), pulmonary
(e.g., by inhalation or insufflation of powders or aerosols,
including by nebulizer; intratracheal, intranasal, epidermal and
transdermal), ocular, oral or parenteral. Methods for ocular
delivery can include topical administration (eye drops),
subconjunctival, periocular or intravitreal injection or
introduction by balloon catheter or ophthalmic inserts surgically
placed in the conjunctival sac. Parenteral administration includes
intravenous, intraarterial, subcutaneous, intraperitoneal or
intramuscular injection or infusion; or intracranial, e.g.,
intrathecal or intraventricular, administration. Parenteral
administration can be in the form of a single bolus dose, or may
be, for example, by a continuous perfusion pump. Pharmaceutical
compositions and formulations for topical administration may
include transdermal patches, ointments, lotions, creams, gels,
drops, suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable.
[0065] Also, pharmaceutical compositions can contain, as the active
ingredient, one or more inhibitors described herein above in
combination with one or more pharmaceutically acceptable carriers,
and may further comprise one or more additional active agents as
appropriate for a given therapeutic treatment. In making the
compositions described herein, the active ingredient is typically
mixed with an excipient, diluted by an excipient or enclosed within
such a carrier in the form of, for example, a capsule, sachet,
paper, or other container. When the excipient serves as a diluent,
it can be a solid, semi-solid, or liquid material, which acts as a
vehicle, carrier or medium for the active ingredient. Thus, the
compositions can be in the form of tablets, pills, powders,
lozenges, sachets, cachets, elixirs, suspensions, emulsions,
solutions, syrups, aerosols (as a solid or in a liquid medium),
ointments containing, for example, up to 10% by weight of the
active compound, soft and hard gelatin capsules, suppositories,
sterile injectable solutions, and sterile packaged powders.
[0066] Some examples of suitable excipients include lactose,
dextrose, sucrose, sorbitol, mannitol, starches, gum acacia,
calcium phosphate, alginates, tragacanth, gelatin, calcium
silicate, microcrystalline cellulose, polyvinylpyrrolidone,
cellulose, water, syrup, and methyl cellulose. The formulations can
additionally include: lubricating agents such as talc, magnesium
stearate, and mineral oil; wetting agents; emulsifying and
suspending agents; preserving agents such as methyl- and
propylhydroxy-benzoates; sweetening agents; and flavoring agents.
The compositions described herein can be formulated so as to
provide quick, sustained or delayed release of the active
ingredient after administration to the patient by employing
procedures known in the art.
[0067] The compositions can be formulated in a unit dosage form,
each dosage containing from about 1 to about 1000 mg, more usually
about 10 to about 500 mg, of the active ingredient. The term "unit
dosage forms" refers to physically discrete units suitable as
unitary dosages for human subjects and other mammals, each unit
containing a predetermined quantity of active material calculated
to produce the desired therapeutic effect, in association with a
suitable pharmaceutical excipient. It will be understood, however,
that the amount of the compound actually administered will usually
be determined by a physician, according to the relevant
circumstances, including the condition to be treated, the chosen
route of administration, the actual inhibitor administered, the
age, weight, and response of the individual patient, the severity
of the patient's symptoms, and the like.
[0068] The inhibitors described herein can also be formulated in
combination with one or more additional active ingredients as
desired.
[0069] The present invention also provides methods for limiting
tumor metastasis, comprising contacting a subject having a tumor
with an amount effective of an inhibitor of QSOX1 expression and/or
activity, or pharmaceutically acceptable salt thereof, to limit
metastasis of the tumor in the subject. As shown in the examples
that follow and as discussed above, QSOX1 inhibitors slow tumor
growth and inhibit the metastatic process.
[0070] All embodiments of the first aspect of the invention are
equally applicable to this second aspect, unless the context
clearly dictates otherwise. As used herein, "limiting metastasis"
means any limitation over what would be seen in the absence of
administration of the QSOX1 inhibitor. In a preferred embodiment,
limiting metastasis comprises a statistically significant
limitation compared to control subjects not treated with the QSOX1
inhibitor. In another preferred embodiment, the tumor comprises a
pancreatic tumor; even more preferably a pancreatic
adenocarcinoma.
[0071] In a second aspect, the present invention provides isolated
nucleic acids, comprising or consisting of antisense, siRNA, miRNA,
and/or shRNA molecules having a nucleic acid sequence perfectly
complementary to least 10 contiguous nucleotides of QSOX1 as shown
in SEQ ID NO: 1 and SEQ ID NO:2 or RNA equivalents thereof: and/or
fragments of the nucleic acid molecule. In various preferred
embodiments, the nucleic acid molecule is perfectly complementary
to at least 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25 or more contiguous nucleotides of QSOX1, or an RNA equivalent
thereof.
[0072] In a further preferred embodiment, the isolated nucleic
acids comprise or consist of a nucleotide sequence selected from
the group consisting of
TABLE-US-00009 (SEQ ID NO: 11)
5'-A(T/U)C(T/U)ACA(T/U)GGC(T/U)GACC(T/U)GGAA-3' (SEQ ID NO: 12)
5'-AGGAAAGAGGG(T/U)GCCG(T/U)(T/U)C(T/U)(T/U)-3', (SEQ ID NO: 13)
5'-GCCAA(T/U)G(T/U)GG(T/U)GAGAAAG(T/U)(T/U)(T/U)- 3', (SEQ ID NO:
14) 5'-GCCAAGAAGG(T/U)GAAC(T/U)GGA(T/U)(T/U)-3'. (SEQ ID NO: 15)
5'-CCGGACAA(T/U)GAAGAAGCC(T/U)(T/U)(T/U)-3' (SEQ ID NO: 16)
5'-(T/U)C(T/U)AGCCACAACAGGG(T/U)CAA(T/U)-3' (SEQ ID NO: 17)
5'-ATCTACATGGCTGACCTGGAA-3', (SEQ ID NO: 18)
5'-AGGAAAGAGGGTGCCGTTCTT-3', (SEQ ID NO: 19)
5'-GCCAATGTGGTGAGAAAGTTT-3', (SEQ ID NO: 20)
5'-GCCAAGAAGGTGAACTGGATT-3', (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3'; (SEQ ID NO: 22)
5'-TCTAGCCACAACAGGGTCAAT-3'; and (SEQ ID NO: 26)
5'-CCGGGCCAATCTTGGTGAGAAAGTTTCTCGAGAAACTTT
CTCACCACATTGGCTTTTTG-3'.
[0073] The isolated nucleic acids can be used, for example, in the
methods of the invention. The isolated nucleic acids of this second
aspect of the present invention can be modified as described above
in the first aspect of the invention, including nucleic acid
backbone analogues and analogous forms of ribose or
deoxyribose.
[0074] As used herein, "isolated" means that the nucleic acids are
removed from their normal surrounding nucleic acid sequences in the
genome or in cDNA sequences, and are substantially free of
contaminating material used to isolate them (i.e. agarose,
polyacrylamide, column chromatography resins, and the like). The
isolated nucleic acids may be stored in any suitable state,
including but not limited to in solution or as a lyophilized
powder.
[0075] The isolated nucleic acids may be chemically synthesized
using means known in the art, or may be generated by recombinant
expression vectors.
[0076] As used herein, the isolated nucleic acids "comprising" the
recited nucleotide sequences means that the recited nucleotide
sequences can be present as part of a larger synthetic construct,
such as an antisense nucleic acid, siRNA, an shRNA, miRNA, or as
part of a construct in association (covalently bound or
non-covalently bound) with a lipid, virus, polymer, or any other
physical, chemical or biological agent. As used herein, the
isolated nucleic acids "comprising" the recited nucleotide
sequences does not include the isolated nucleic acid as part of a
naturally occurring or isolated full length QSOX1 transcript or
cDNA thereof.
[0077] In one embodiment, the isolated nucleic acid is present in a
short hairpin RNA (shRNA). As discussed above, such an shRNA
comprises flanking regions, loops, antisense and spacer sequences
flanking a recited SEQ ID NO: sequence responsible for the
specificity of shRNA. There are no specific sequence requirements
for these various other shRNA regions so long as a loop structure
can be formed. Exemplary constructs are shown in the examples
below. In one embodiment, the shRNA is of the general formula
TABLE-US-00010 (SEQ ID NO: 23) CCGG-X1-CTCGAGAAACTTTCTCACCACATTGGC
TTTTTG-3'
[0078] wherein X1 is a nucleic acid sequence selected from the
group consisting of
TABLE-US-00011 (SEQ ID NO: 11)
5'-A(T/U)C(T/U)ACA(T/U)GGC(T/U)GACC(T/U)GGAA-3' (SEQ ID NO: 12)
5'-AGGAAAGAGGG(T/U)GCCG(T/U)(T/U)C(T/U)(T/U)-3', (SEQ ID NO: 13)
5'-GCCAA(T/U)G(T/U)GG(T/U)GAGAAAG(T/U)(T/U)(T/U)- 3', (SEQ ID NO:
14) 5'-GCCAAGAAGG(T/U)GAAC(T/U)GGA(T/U)(T/U)-3'. (SEQ ID NO: 15)
5'-CCGGACAA(T/U)GAAGAAGCC(T/U)(T/U)(T/U)-3' (SEQ ID NO: 16)
5'-(T/U)C(T/U)AGCCACAACAGGG(T/U)CAA(T/U)-3' (SEQ ID NO: 17)
5'-ATCTACATGGCTGACCTGGAA-3', (SEQ ID NO: 18)
5'-AGGAAAGAGGGTGCCGTTCTT-3', (SEQ ID NO: 19)
5'-GCCAATGTGGTGAGAAAGTTT-3', (SEQ ID NO: 20)
5'-GCCAAGAAGGTGAACTGGATT-3', (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3'; (SEQ ID NO: 22)
5'-TCTAGCCACAACAGGGTCAAT-3';
[0079] In a third aspect, the present invention provides
recombinant expression vectors comprising the isolated nucleic acid
of any embodiment of the third aspect of the invention operatively
linked to a promoter. "Recombinant expression vector" includes
vectors that operatively link a nucleic acid coding region or gene
to any promoter capable of effecting expression of the gene
product. The vectors can be used, for example, for transfection of
host cells for large scale production of the isolated nucleic
acids, or may be used as vector delivery systems in the methods of
the invention. The promoter sequence used to drive expression of
the disclosed nucleic acid sequences in a mammalian system may be
constitutive (driven by any of a variety of promoters, including
but not limited to, utilizes the U6 or H1 promoter (to ensure that
the shRNA is always expressed), CMV, SV40, RSV, actin, EF) or
inducible (driven by any of a number of inducible promoters
including, but not limited to, tctracyclinc, cedysonc,
steroid-responsive). The construction of expression vectors for use
in transfecting eukaryotic and prokaryotic cells is also well known
in the art, and thus can be accomplished via standard techniques.
(See, for example, Sambrook, Fritsch, and Maniatis, in: Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press,
1989; Gene Transfer and Expression Protocols, pp. 109-128, ed. E.
J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion
1998 Catalog (Ambion, Austin, Tex.). The expression vector must be
replicable in the host organisms either as an episome or by
integration into host chromosomal DNA. In a preferred embodiment,
the expression vector comprises a viral vector or a plasmid. Any
suitable viral vector may be used, including but not limited to
retroviruses, lentiviruses, adenoviruses, adeno-associated viruses,
etc.
[0080] In a fourth aspect, the present invention provides host
cells comprising the recombinant expression vectors disclosed
herein, wherein the host cells can be either prokaryotic or
eukaryotic. The host cells can be used, for example, in large scale
production of the recombinant vectors of the invention. The cells
can be transiently or stably transfected if a plasmid vector is
used, or may be transiently or stably transduced when a viral
vector is used. Such transfection and transduction of expression
vectors into prokaryotic and eukaryotic cells can be accomplished
via any technique known in the art, including but not limited to
standard bacterial transformations, calcium phosphate
co-precipitation, electroporation, or liposome-mediated, DEAE
dextran-mediated, polycationic mediated, or viral mediated
transfection. (See, for example, Molecular Cloning: A Laboratory
Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory
Press; Culture of Animal Cells: A Manual of Basic Technique,
2.sup.nd Ed. (R.I. Freshney. 1987. Liss, Inc. New York, N.Y.).
[0081] In a fifth aspect, the present invention provides
pharmaceutical compositions, comprising
[0082] (a) the isolated nucleic acid of any embodiment of the
second aspect of the invention, the recombinant expression vector
of any embodiment of the third aspect of the invention, or the
recombinant host cell of any embodiment of the fourth aspect of the
invention; and
[0083] (b) a pharmaceutically acceptable carrier.
[0084] The pharmaceutical compositions can be used, for example, in
the methods of the invention. As used herein, the phrase
"pharmaceutically acceptable salt" refers to both pharmaceutically
acceptable acid and base addition salts and solvates. Such
pharmaceutically acceptable salts include salts of acids such as
hydrochloric, phosphoric, hydrobromic, sulfuric, sulfinic, formic,
fumaric, toluenesulfonic, methanesulfonic, nitric, benzoic, citric,
tartaric, maleic, hydroiodic, alkanoic such as acetic,
HOOC--(CH.sub.2).sub.n--COOH where n is 0-4, and the like.
Non-toxic pharmaceutical base addition salts include salts of bases
such as sodium, potassium, calcium, ammonium, and the like. Those
skilled in the art will recognize a wide variety of non-toxic
pharmaceutically acceptable addition salts. All embodiments of
pharmaceutical compositions discussed herein for the methods of the
invention can be used in this aspect of the invention.
[0085] In a sixth aspect, the present invention provides methods
for identifying candidate compounds for treating a tumor,
comprising
[0086] (a) contacting tumor cells capable of expressing QSOX1 with
one or more candidate compounds under conditions suitable for
expression of QSOX1;
[0087] (b) determining a level of QSOX1 expression and/or activity
in the tumor cells and comparing to control;
[0088] wherein a compound that decreases QSOX1 expression and/or
activity in the tumor cells relative to control is a candidate
compound for treating a tumor.
[0089] Any tumor cell that is capable of expressing QSOX1, either
inherently or as a result of transfecting the cell with a QSOX1
recombinant expression vector, can be used. In a preferred
embodiment, the tumor cell is selected from the group consisting of
pancreatic, lung, colon, breast, and prostate tumor cells. In one
embodiment, the tumor cells are pancreatic tumor cells, such as
pancreatic adenocarcinoma cells. In another embodiment, the tumor
cells are breast tumor cells, such as ER+breast cancer cells or
luminal B cancer cells.
[0090] Any suitable candidate compound can be used, including but
not limited to small molecules, antibodies, aptamers, antisense,
siRNA, and shRNA.
[0091] As used herein, "inhibit" means at least a 10% reduction in
expression and/or activity; preferably at least 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, or greater reduction in expression and/or
activity.
[0092] Any suitable control can be used, including but not limited
to tumor cells not treated with test compound, and average
expression product levels of QSOX1 in a control cell population. In
one embodiment, the control comprises a cell from a normal subject
or population (i.e. known not to be suffering from a tumor), or
from a subject or population of subjects suffering from a tumor,
using the same detection assay. In another preferred embodiment,
the control comprises a tumor cell contacted with the isolated
nucleic acid, shRNA, or expression vector of the invention, to
facilitate identifying compounds with increased QSOX1 inhibitory
activity than the nucleic acids disclosed herein. The control cell
will be of the same type as that assessed from the test subject. In
one exemplary embodiment where immunohistochemistry is used to
assess QSOX1 expression, a suitable control is normal tissue in a
pathological sample.
[0093] Any suitable method for determining QSOX1 expression levels
may be used, including but not limited to reverse
transcription-polymerase chain reaction (RT-PCR), western blot, in
situ hybridization, and immunohistochemical analysis (such as
fluorescence in situ hybridization)
[0094] Similarly, any suitable method for determining QSOX1
activity levels may be used, including but not limited to an oxygen
electrode assay, using the enzymatic activity of QSOX1 to detect
structures/compounds that inhibit the ability of QSOX1 to oxidize a
known substrate.
[0095] In another aspect, the invention provides methods for
prognosing a tumor, comprising
[0096] (a) determining a QSOX1 expression level in a sample from a
subject having a tumor;
[0097] (b) comparing the QSOX1 expression level to control; and
[0098] (c) prognosing the progression of the tumor in the
subject.
[0099] As shown in the examples that follow, subjects with tumors
that over-express QSOX1 have a poorer prognosis than patients that
do not over-express QSOX1. As shown in the examples that follow,
QSOX1 is associated with a highly invasive tumor phenotype and
correlates with poor prognosis, such as risk of relapse and poor
survival in patients with tumors, such as breast tumors, and
particularly Luminal B breast tumors. As further shown in the
examples, QSOX1 overexpression correlates with increasing tumor
grade, and is independent of and not associated with Her2
expression or cytokeratin 5/6 expression.
[0100] As used herein, "over-express" means at least a 10% increase
in QSOX1 mRNA or protein expression compared to control; in various
other embodiments, at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, or greater increase in expression.
[0101] Thus, the methods can be used to determine a likely
prognosis for a given subject, and thus allows the subject and
attending physician to tailor treatment accordingly. Thus, in a
further embodiment, the methods comprise determining a course of
treatment based in part on the prognosis.
[0102] The tissue sample may be any suitable sample from which
tumor-derived QSOX1 peptides or mRNA may be obtained. In various
embodiments, the tissue sample is selected from the group
consisting of plasma, serum, urine, saliva, and relevant tumor
tissue. In various embodiments for detecting QSOX1 peptides in
tissue (preferably plasma or serum), the peptide to be detected is,
or the mRNA to be detected encodes, one or more peptide selected
from the group consisting of NEQEQPLGQWHLS (SEQ ID NO:3),
NEQEQPLGQWH (SEQ ID NO:4), EQPLGQWHLS (SEQ ID NO:5),
AAPGQEPPEHMAELQR (SEQ ID NO:6), AAPGQEPPEHMAELQ (SEQ ID NO:7),
AAPGQEPPEHMAELQRNEQEQPLGQWHLS (SEQ ID NO:8), NEQEQPL (SEQ ID NO:9),
and GQWHLS (SEQ ID NO:10).
[0103] Any suitable control can be used to compare with QSOX1
expression and/or activity in the subject's sample. In one
embodiment, the control comprises an amount of one or more peptides
or mRNAs of interest from a tissue sample from a normal subject or
population (i.e.: known not to be suffering from a tumor), or from
a subject or population of subjects suffering from a tumor, using
the same detection assay. The control tissue sample will be of the
same tissue sample type as that assessed from the test subject. In
one embodiment, a standard concentration curve of one or more
peptides or mRNAs of interest in the control tissue sample is
determined, and the amount of the one or more peptides or mRNAs of
interest in the test subject's tissue sample is compared based on
the standard curve. In another embodiment samples are obtained from
patients over time, during or after their therapy, to monitor
levels of one or more peptides or mRNAs in plasma as an indication
about tumor burden in patients. The control may comprise a time
course of concentration of the one or more peptides or mRNAs of
interest in a given tissue type of the test subject, to monitor the
effect of treatment on the concentration; this embodiment is
preferred, for example, when assessing efficacy of tumor
treatments. Those of skill in the art will recognize that similar
controls can be used for immunohistochemical-based analysis. Based
on the teachings herein and the knowledge in the art, those of
skill in the art can design a variety of other appropriate controls
in assessing QSOX1 expression.
[0104] Non-limiting tumor types that can be prognosed using the
methods of the invention include pancreatic, lung, colon, breast,
and prostate tumors. In one embodiment, the tumor is a pancreatic
tumor, such as a pancreatic adenocarcinoma or a neuroendocrine
tumor. In a further embodiment, the tumor comprises a pancreatic
adenocarcinoma. In a further embodiment, the tumor is a breast
tumor. In one such embodiment, the breast tumor is an estrogen
receptor positive (ER+) breast tumor. In another embodiment, the
breast tumor is a Luminal B tumor. For example, the Luminal B tumor
is ER+ and/or progesterone receptor positive (PR+). In another
example, the Luminal B tumor is highly positive for Ki67 and/or
HER2-positive. In another example, the Luminal B tumor is ER+, PR-,
and HER2-positive. In another example, the Luminal B tumor is ER+,
PR+, and HER2-positive.
[0105] As used herein, "prognosing the progression of a tumor"
means assessing one or more of the following: (a) aggressiveness of
tumor growth; (b) likelihood of tumor metastases; (c) likelihood of
therapeutic benefit of a treatment course: (d) risk of tumor
relapse/recurrence post-treatment; and (e) patient survival.
Example 1
[0106] Pancreatic ductal adenocarcinoma (PDA) is a disease that
carries a poor prognosis. It is often detected in stage III
resulting in an unresectable tumor at the time of diagnosis.
However, even if pancreatic cancer is surgically resected in stage
I or II, it may recur at a metastatic site (1, 2). Currently,
patients diagnosed with pancreatic ductal adenocarcinoma have less
than a 5% chance of surviving past five years (3). Through
proteomic analysis of pancreatic cancer patient plasma, we
discovered a peptide from QSOX1 that maps back to the C-terminus of
the long isoform of QSOX1 (QSOX1-L) (4). Subsequently, we found
that QSOX1 is over-expressed in tumor tissue from pancreatic cancer
patients, but not adjacent normal tissue (FIGS. 1B & C). These
findings led us to hypothesize that over-expression of QSOX1 might
be functionally important for tumor cells, prompting further
exploration of the role that QSOX1 might play in pancreatic
cancer.
[0107] QSOX1 belongs to the family of FAD-dependent sulfhydryl
oxidases that are expressed in all eukaryotes sequenced to date. As
eloquently shown by the Thorpe and Fass laboratories, the primary
enzymatic function of QSOX1 is oxidation of sulfhydryl groups
during protein folding to generate disulfide bonds in proteins,
ultimately reducing oxygen to hydrogen peroxide (5-7). QSOX1 has
been reported to be localized to the Golgi apparatus and
endoplasmic reticulum (ER) in human embryonic fibroblasts where it
works with protein disulfide isomerase (PDI) to help fold nascent
proteins in the cell (8, 9).
[0108] In the human genome, QSOX1 is located on chromosome 1q24 and
alternative splicing in exon 12 generates a long (QSOX1-L) and
short (QSOX1-S) transcript (FIG. 1A) (10). Both, QSOX1-S and -L
have identical functional domain organization from the amino
terminus as follows: two thioredoxin-like domains (Trx1 &2), a
helix rich region (HRR) and an Erv/ALR FAD-binding domain (5, 11).
QSOX1-L contains a predicted transmembrane domain that is not
present in QSOX1-S due to alternative splicing (FIG. 1A) (12).
QSOX1 was originally discovered in quiescent human lung fibroblasts
and was hypothesized to aid in the transition from G.sub.0 to S
phase of the cell cycle (13, 14). Thorpe et al. revealed the
ability of QSOX1 to efficiently generate disulfide bonds into
proteins during folding at rate of 1000 per minute with a K.sub.M
of 150 uM per thiol (7). QSOX1 appears to play a significant role
in redox regulation within the cell, although the in vivo
biological substrates are undefined as well as the functional
significance associated with each splice variant.
[0109] In the present study, we have begun to analyze the role of
QSOX1 in pancreatic tumors using cell lines BxPC3 and Pane-1. We
knocked down QSOX1-S and L protein expression using short hairpin
RNAs (shRNA) in an attempt to reveal how pancreatic cancer cells
might be affected. We assessed cell growth, cell cycle, apoptosis,
invasion and matrix metalloprotcinase activity. QSOX1 knock-downs
affected tumor cell proliferation, cell cycle and apoptosis. We
observed a dramatic decrease in tumor cell invasion when QSOX1
expression was suppressed. Further investigation into the mechanism
of invasion revealed that QSOX1 is at least partially responsible
for MMP-2 and MMP-9 activity. This is the first report
demonstrating a role for QSOX1 in invasion and metastasis.
Material and Methods for Example 1
Cell Culture
[0110] Pancreatic adenocarcinoma BxPC3, PANC-1, CFPac-1, and Capan1
cancer cell lines were cultured in DMEM with 10% fetal bovine serum
(FBS) (Gibco). Immortal human non-tumorigenic pancreatic duct
epithelial cells (HPDE6) were cultured in Clontech KGM-2
karotinocyte media (Gibco) (19). All cell lines were grown at
37.degree. C. with 5% CO.sub.2. Cell lines are tested monthly for
mycoplasma contamination using, Venor GeM.TM. Mycoplasma Detection
Kit, PCR based from Sigma.
Immunohistochemistry (IHC)
[0111] Immunohostochemistry on patients who underwent surgical
resection was performed in the exact same manner as previously
described in Kwasi et al (4).
Generation of Short Hairpin (Sh) RNA and Lentiviruses
Production
[0112] Three different shRNA for QSOX1 were obtained through DNASU
(http://dnasu.asu.edu)(20) already in the lentiviral
pLKO.1-puromycin selection vector.
TABLE-US-00012 QSOX1 sh742, (SEQ ID NO: 26)
5'-CCGGGCCAATGTGGTGAGAAAGTTTCTCGAGAAACTTT CTCACCACATTGGCTTTTTG-3'
(sense), QSOX1 sh528, (SEQ ID NO: 21) 5'-CCGGACAATGAAGAAGCCTTT-3'
(sense), QSOX1 sh616, (SEQ ID NO: 22) 5'-TCTAGCCACAACAGGGTCAAT-3'
(sense) and shScramble with target sequence (SEQ ID NO: 29)
5'-TCCGTGGTGGACAGCCACATG-3'
was obtained from Josh LaBaer's laboratory at Arizona State
University. The target sequence is underlined and each vector
contains the same supporting sequence surrounding the target
sequence.
[0113] Lentiviruses containing sh742, sh528, sh616 and shScramble
were produced using 293T cells. 293T cells were seeded at
1.5.times.10.sup.6 cells per well in 2 mL media lacking antibiotics
using a 6 well plate format and incubated at 37.degree. C.,
5%0/CO.sub.2 for 24 hrs. The following day the 293T cells were
transfected with 2500 ng shRNA maxi-prepped plasmid DNA (Sigma
GeneElute.TM. HP Plasmid Maxiprep Kit), 500 ng VSVg, 2500 ng d8.91
(gag-pol) in LT1 transfection reagent from Mirus Bio (Madison,
Wis.) and centrifuged at 1000 g for 30 minutes and incubated as
37.degree. C., 5% CO.sub.2 for 24 hours at in media lacking
antibiotics. The next morning media containing lentivirus was
collected and replaced with complete media. Supernatants (2.5 ml)
from transfected 293T cells producing each lentivirus were
collected every 24 hours for a total of 72 hours, combined and
stored at -20.degree. C.
Generation of shQSOX1-Transduced Tumor Cell Lines
[0114] Stable transduction of sh742, sh528, sh616 and shScramble
into BxPC-3 and Panc-1 cell lines was performed by first seeding
the cells at 8.times.10.sup.5 cells/well in a 6 well plate and
incubating overnight. The next day the cells were transduced by
adding 8 ug/mL polybrene (Millipore) and 200 ul sh742, sh528, sh616
and shScramble lentivirus media from 293T cells to each well. The
cells were spun at 1000 rpm for 30 minutes and then incubated for
24 hours. The following day fresh DMEM with 10% FBS was added,
containing I ug/mL puromycin (Sigma), to select for the transduced
cells QSOX1 knockdown was measured by western blot.
SDS-PAGE-Western Blotting
[0115] Western blotting was performed using cell lysates from
HPDE6, BxPC3, Panc-1, Capan and CFPac 1 cells as well as patient
1010 and 1016 tumor and adjacent normal enzymatic supernatant. Cell
lysates were generated by harvesting 2.5.times.10.sup.6 cells by
centrifugation followed by lysis using RIPA buffer (50 mM Tris-HCl,
pH7.4, 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100) with 1.times.
SigmaFAST.TM. Protease Inhibitor Cocktail Tablet, EDTA Free.
Protein in the cell lysate was measured using the micro BCA protein
assay kit (Thermo Scientific). All samples were then normalized to
2 ug/mL (20 ug total protein per lane). Samples were run on 10%
SDS-polyacrylamide gels then transferred onto Immun-Blot.TM. PVDF
Membranes (Bio-Rad). Rabbit polyclonal anti-QSOX1 (ProteinTech),
rabbit polyclonal anti-Bactin and anti-alpha-tubulin (Cell
Signaling), and rabbit polyclonal anti-MMP-2 and -9 (Sigma)
antibody was diluted 1:1000, 1:1000, and 1:500 respectfully, in
0.1% BSA in 1.times.TBS+0.01% Tween-20 and incubated for overnight.
Goat anti-rabbit IgG-alkaline phospatase or HRP secondary antibody
was used at a 1:5000 dilution and incubated with the blot for 1
hour followed by washing. BCIP/NBT substrate (Pierce Chemical,
Rockford, Ill.) was added and the blot was developed at room
temperature (RT) for approximately 1 hour, in samples incubated in
alkaline phosphatase secondary antibody. For samples incubated in
goat anti-rabbit HRP secondary the blots were developed using Novex
ECL Chemiluminescent Substrate Reagent Kit. Quantification of band
intensity was measured using Image J and is presented as percent
change from the scrambled shRNA control. Full gel images are
available in the supplemental material. All gel images were
annotated and processed using Photoshop software.
MIT (3-(4, 5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)
Assay
[0116] Cells were seeded at 3.times.10' cell/well in a 96-well
plate in triplicate and incubated at 37.degree. C., 5% CO.sub.2
over the course of 5 days. The MTT assay was performed on days 1, 2
and 5 according to the manufacturers' instructions
(Invitrogen-Molecular Probes, Vybrant MTT Cell Proliferation Assay
Kit). Results are presented as average.+-.standard deviation.
Student's two-tailed t-Test was performed to determine
significance.
Annexin V/Propidium Iodide Apoptosis Analysis
[0117] Apoptosis analysis was performed according to the
manufacturer's instructions (FITC Annexin V Apoptosis Detection Kit
1, BD Pharmingen). Briefly, cells were seeded at equal densities in
a 25 cm.sup.2 flask until they reached 60-80% confluency. The cells
were then washed with cold PBS, counted, and normalized to
1.times.10.sup.6 cell/ml in 1.times. Annexin V Binding Buffer.
Next, 1.times.10.sup.5 cells were then transferred to a separate
tube and 5 ul of FITC Annexin V and 5 ul of Propidium Iodide were
added to each sample. The samples were gently vortexed and
incubated for 15 min at RT in the dark. Lastly, 400 ul of 1.times.
Binding Buffer was added to each sample and the samples were
analyzed by flow cytometer (Becton Dickinson FACScalibur.TM.
Flowcytometer) with 1 hour. Each sample was performed in
triplicate.
Gelatin Zymography
[0118] The identification of matrix metalloproteinases (MMP) was
performed using gelatin zymography. Zymography experiments were
performed as follows. Untreated BxPC3 and Panc-1 cells as well as
transduced cells were seeded at 5.times.10.sup.5 cells/well (12
well plates) in DMEM with 10% FBS. The next day, cells were then
washed with 1.times.PBS and the media was changed to serum free
DMEM and incubated for 24 hours before being collected and protein
concentrations determined using a BCA assay. Gelatin zymography was
performed with a 10% polyacrylamide gel containing gelatin solution
in place of water (0.8 mg/mL Gelatin, 0.15 M Tris pH8.8, 30%
acrylamide-bis, 50% glycerol, 10% SDS, 10% APS, and TEMED) (21). A
volume of equal concentrations of serum free conditioned media were
loaded under non-denaturing conditions into the 10%
polyacrylamide-gelatin gel to separate proteins secreted by the
tumor cells and to detect the presence of gelatin degrading MMPs.
Electrophoresis was performed at a constant voltage of 150 V for 60
min. Gels were washed in renaturing buffer (25% Triton X-100 in
water) for 30 min at RT with gentle shaking. The gels were then
equilibrated in developing buffer (50 mM Tris-base, 6.3 g/L
Tris-HCl, 0.2 M NaCl, 5 mM CaCl.sub.2, and 0.02% Triton X-100) for
30 min at RT with gentle shaking. Fresh developing buffer was then
added to the gels and they were incubated overnight at 37.degree.
C. The gels were then stained with SimplyBlue.TM. Safe Stain
(Invitrogen) for 20 min at RT, then destained overnight in
ddH.sub.2O at RT. The presence of MMP was detected by the lack of
staining indicating digestion of gelatin. The negative control was
performed by adding, 50 mM Ethylene Diamine Tetra Acetic Acid
(EDTA), to both the renaturing buffer and the developing buffer to
block the MMP activation. Quantification of band intensity was
measured using Image J and is presented as percent change from the
scrambled shRNA control.
RNA Isolation and cDNA Synthesis
[0119] Total RNA isolation was performed according to the
manufactures instructions for animal cells using spin technology
(RNeasy.TM. Mini Kit, Qiagen). After RNA was isolated from each
sample was reverse transcribed with qScript.TM. cDNA Sythesis Kit,
Quanta Biosciences according to the manufactures instructions.
Quantitative Real Time PCR (qPCR)
[0120] The relative level of GAPDH, QSOX1-L, QSOX1-S, MMP-2, and
MMP-9 were analyzed in each sample by qPCR. Each cDNA sample was
normalized to 100 ng/.mu.l in molecular grade water along with 100
nM final concentration of each primer and 1.times. final
concentration of PerfeCta.TM. SYBR Green Fast Mix, ROX to a final
volume of 20 .mu.l, qPCR was performed using, PerfeCTa.TM. SYBR
Green FastMix, ROX from Quanta Biosciences on a ABI7900HT
thermocycler, Applied Biosystems Inc. Reaction Protocol: Initial
Denaturation -95.degree. C. for 3 min; PCR Cycling (40 cycles) 1.)
95.degree. C., 30 sec. 2.) 55.degree. C., 30 sec. 3.) 72.degree.
C., 1 min; Melt Curve (Dissociation Stage). The primer sequences
for the genes analyzed are: GAPDH Forward 5'-GGCCTCCAAGGAGTAAGACC
(SEQ ID NO:30); GAPDH Reverse 5'-AGGGGTCTACATGGCAACTG (SEQ ID
NO:31); QSOX1-S Forward 5'-TGGTCTAGCCACAACAGGGTCAAT (SEQ ID NO:32);
QSOX1-S Reverse 5'-TGTGGCAGGCAGAACAAAGTTCAC (SEQ ID NO:33); QSOX1-L
Forward 5'-TTGCTCCTTGTCTGGCCTAGAAGT (SEQ ID NO:34); QSOX1-L Reverse
5'-TGTGTCAAAGGAGCTCTCTCTGTCCT (SEQ ID NO:35); MMP-2 Forward
5'-TTGACGGTAAGGACGGACTC (SEQ ID NO:36); MMP-2 Reverse
5'-ACTTGCAGTACTCCCCATCG (SEQ ID NO:37); MMP-9 Forward
5'-TTGACAGCGACAAGAAGTGG (SEQ ID NO:38); and MMP-9 Reverse
5'-CCCTCAGTGAAGCGGTACAT. (SEQ ID NO:39) Each reaction was performed
in triplicate with the data representing the averages of one
experiment.
[0121] In the shRNA experiment, expression of MMPs was normalized
to the non-targeted GAPDH to determine .DELTA.Cq. .DELTA.Cq
replicates were then exponentially transformed to the .DELTA.Cq
expression after which they were averaged.+-.standard deviation.
The average was then normalized to the expression of the shScramble
control to obtain the .DELTA..DELTA.Cq expression. Significance was
determined using the Student's two-tailed t-Test.
Matrigel.TM. Invasion Assay
[0122] Invasion assays were performed using BD BioCoat.TM. BD
Matrigel.TM. Invasion chambers with 8.0 .mu.m pore size
polyethylene terephthalate (PET) membrane inserts in 24-well
format. The assay was performed according to the manufacturers'
instructions (BD Bioscience). 4.times.10.sup.4 cells/well were
seeded into the inner Matrigel.TM. chamber in serum free DMEM. The
outer chamber contained 10% FBS in DMEM. BxPC3 and Panc-1 cells
were incubated for 24 hours at 37.degree. C., 5% CO.sub.2. Cells
that invaded through the Matrigel.TM. and migrated through the
pores onto the bottom of the insert were fixed in 100% methanol and
then stained in hematoxylin (Invitrogen). The total number of
invading cells were determined by counting the cells on the
underside of the insert from three wells (6 fields per insert) at
10.times., 20.times. and 40.times. magnification and the extent of
invasion was expressed as the average.+-.standard deviation.
Significance was determined using the Student's two-tailed t-Test.
Results presented are from one of three independent
experiments.
Results for Example 1
Detection of QSOX1 by Immunohistochemistry and Western Blot
[0123] To begin to determine the frequency of expression of QSOX1
in human PDA, QSOX1 expression was assessed in 4 different
pancreatic tumor cell lines, an immortal non-tumorigenic cell line,
HPDE6, 37 tumor tissue sections from patients with PDA, and tumor
and adjacent normal tissue from two patients, 1016 and 1010 (FIGS.
1B, C, and D). 29 of 37 tumor tissues were positive for QSOX1
expression, suggesting it is a commonly over-expressed protein. To
determine which splice variant was more prevalent in our IHC images
we analyzed tumor as well as adjacent normal tissue from 2 patients
by western blot (FIG. 1C). Our results revealed that QSOX1-S is the
dominant splice variant expressed also corroborating our IHC
results that revealed an increase in QSOX1 expression in tumor
samples. While our adjacent normal samples indicate a high level of
QSOX1 expression, it is hard to determine if there was any tumor
tissue contaminating our normal sample, which would account the
increase in QSOX1 expression. Western blotting analysis shows that
4 pancreatic tumor cell lines, BxPC3, Pane-1, Capan1 and CFPac 1
strongly express QSOX1-S and weakly express the longer splice
variant, QSOX1-L. HPDE6, an immortal, non-tumorigenic pancreas
epithelial cell line, shows weak expression of QSOX1-S and no
expression of QSOX1-L (FIG. 1D).
[0124] The results of this experiment begin to provide some
information about the frequency and distribution of QSOX1
expression. First, QSOX1 appears to be a commonly over-expressed
protein in PDA (FIG. 1B-C). Second, QSOX1 protein expression in
adjacent normal 1016, 1010, and HPDE6, a non-tumorigenic pancreatic
duct cell line, is much weaker than it is in the patient tumor
samples and four malignant pancreatic tumor cell lines. This may
suggest that QSOX1 provides some advantage to malignant cells that
non-malignant cells do not require.
QSOX1 Promotes Tumor Cell Proliferation
[0125] To examine the advantage that QSOX1 provides to tumor cells
we inhibited QSOX1 expression in BxPC3 and Pane-1 cells using 3
shRNA constructs: sh742, sh528 and sh616, shScrambled was
generously provided by Dr. Joshua LaBaer. Lentiviruses containing
each shRNA were generated as described in "Methods." BxPC3 and
Panc-1 cells were transduced with each sh-lentivirus (shQSOX1) to
evaluate the effects of QSOX1 knockdown on tumor cell growth. To
demonstrate that the shQSOX1 are active in both cell lines, FIG.
2A-B shows reduced protein expression of both isoforms of QSOX1 in
BxPC3 and Panc-1 tumor cell lines compared to scrambled shRNA in
western blot analysis. This experiment demonstrates that sh742,
sh528 and sh616 knock down of QSOX1-S expression in BxPC3 cells was
56%, 40% and 28%, respectively; for Panc-1 cells the knock down was
64%, 46% and 18%, respectively (FIG. 2A-B).
[0126] ShQSOX1-transduced BxPC3 and Panc-1 cells exhibited a
decrease in cell growth compared to shScrambled controls in an MTT
assay (FIG. 2C) and by Trypan blue viable cell dye (not shown). We
seeded an equal number of shScramble, sh742, sh528 and sh616 cells
in 96 well plates and quantified the proliferation rate by
measuring mitochondrial metabolism on days 1, 2 and 5. While on day
1 there was no change, day 2 presented a minor decrease in cell
growth by day 5 BxPC3 sh742, sh528 and sh616 showed a 65%, 60% and
37% decrease, while in Panc-1 sh742, sh528 and sh616 there was a
84%, 88% and 61% decrease. Live cell counts using Trypan blue
confirmed the MTT assay (not shown).
Cell Cycle and Apoptosis Analysis
[0127] Previous work has correlated QSOX1 expression with the
quiescent stage, G.sub.0, of the cell cycle (10), leading us to
hypothesize if the shQSOX1-mediate decrease in cell proliferation
was the result of abnormal regulation of the cell cycle or an
increase in apoptosis. To address this hypothesis, propidium iodide
(PI) was used in flow cytometry to evaluate the effects of shQSOX1
on cell cycle. Our results indicate that suppression of QSOX1
expression did modulate cell cycle in both BxPC3 and Panc-1
compared to our untreated and scrambled control (data not shown).
The results show that the reduced expression of QSOX1I on cell
cycle could be cell dependent. BxPC3 showed an increase in G.sub.1
and a significant decrease in S, while Panc-1 cells showed a
significant decrease in G.sub.1 but no changes in S.
[0128] We further evaluated if the decrease in cellular
proliferation mediated by shQSOX1 was due to an increase in
apoptotic cell death. To assess apoptosis, BxPC3 and Panc-1 cells
transduced with shScramble, sh742, sh528 and sh616 were stained
with annexin-V and PI. Compared to untreated and shScramble a
consistent increase of 2-8% in early and late apoptosis (Annexin-V
single and double positive) was observed for each of the shQSOX1
constructs in BxPC3 and Pane-1 cells. Indicating that the reduced
expression of QSOX1 does lead to cell death but does not entirely
account for the dramatic decrease in cellular proliferation. This
data also agrees with our viable cell count revealing a largely
nonsignificant decrease in shQSOX1 viable cells compared to
untreated and shScramble controls.
Role of QSOX1 in Tumor Cell Invasion
[0129] For a tumor cell to invade other tissues as part of the
metastatic process, the cell must first degrade basement membrane
components such as laminin, collagen and fibronectin before it can
migrate into the blood stream and re-establish itself in a distant
organ (3). To evaluate whether over-expression of QSOX1 in BxPC3
and/or Pane-1 cells plays a role in metastasis we performed
invasion assays over an 18-hour period.
[0130] Untreated, shScramble, sh742, sh528 and sh616-transduced
cells were plated in serum-free medium on Matrigel.TM.-coated, 8 um
pore inserts. Inserts were placed into wells containing 10% FBS in
DMEM. After 18 hours of incubation, tumor cells that had degraded
Matrigel.TM. and migrated through 8 um pores onto the underside of
the insert were counted (FIG. 4A-B). Our results clearly
demonstrate that knockdown of QSOX1 expression in tumor cells leads
to a dramatic decrease in the number of pancreatic tumor cells that
degrade Matrigel.TM. and migrate through the insert into nutrient
rich media.
Mechanism of Invasion
[0131] Since knock-down of QSOX1 protein expression in pancreatic
tumor cells lines decreases invasion through Matrigel.TM., it was
important to determine the mechanism of inhibition of the invasive
process. MMP-2 and -9 are key contributors of invasion and
metastasis in pancreatic cancer (2). Both, pro-MMP-2 and -9 mRNA
and protein levels are elevated in pancreatic tumors, and activated
MMP-2 (a-MMP2) appears to be key contributors of metastasis in PDA
(2, 22). Because QSOX1 has been suggested to be secreted into the
extracellular matrix where MMPs are thought to be activated, we
hypothesized that QSOX1 might help activate MMP-2 and -9 proteins.
Untreated BxPC3 and Panc-1 cells, as well as transduced shScramble,
sh742, sh528 and sh616 were incubated for 18-24 hours in serum free
media after which supernatants were collected and subjected to
gelatin-SDS-PAGE. Gelatin zymography was performed to determine if
QSOX1 plays a role in secretion and/or activation of MMPs.
[0132] Our first observation from this experiment is that BxPC3 and
Panc-1 have very different zymographic profiles. BxPC3 supernatants
contain MMP-9 homodimer (130 kDa), a large amount of
proteolytically active pro-MMP-9 (92 kDa) with lesser
concentrations of pro-MMP-2 (72 kDa) and a-MMP-2 (66 kDa). Pane-1
supernatants contain less prominent MMP-9 homodimer, pro-MMP-9 (92
kDa) and a large amount of proteolytically active pro-MMP-2 (72
kDa), unlike BxPC3 cells.
[0133] Supernatants from BxPC3 cells transduced with sh742, sh528
and sh616 showed a 65%, 47% and 10% decrease, respectfully, in
pro-MMP9 compared to shScramble (FIG. 5A). Supernatants from Panc-1
cells tranduced with sh742, sh528 and sh616 showed a 70%, 56% and
15% decrease, respectfully, in pro-MMP-2. Thus, decreases in the
proteolytic activity of MMP-2 and -9, using gelatin as a substrate,
provide a mechanism for the shQSOX1-mediated suppression of
invasion through Matrigel.TM..
[0134] To confirm our gelatin zymography results we used western
blot analysis of BxPC3 and Pane-1 serum free conditioned media to
probe for MMP-2 and -9 (FIG. 5C). While our results indicate a
slight decrease in MMP-2 and -9 (between 1 and 10% decrease using
densitometry analysis) in BxPC3 and Panc-1 shQSOX1 treated cells it
is nowhere near the level shown using gelatin zymography. This
could be explained as a difference between a functional assay,
gelatin zymography, and a purely quantitative assay such as western
blot.
[0135] To extend our hypothesis that QSOX1 is influencing MMPs
post-translationally, we performed quantitative real time PCR
(QRTPCR) on MMP-2 and MMP-9 comparing the transcripts from shQSOX1
transduced cell lines with shScrambled. FIG. 5 demonstrates that
MMP-2 and -9 RNA increased in the shQSOX1 transduced cells compared
to control cells. This result adds confidence to our hypothesis
that QSOX1 does not transcriptionally suppress MMP production,
rather it post-translationally suppresses MMP activity. It also
diminishes the possibility that shQSOX1 RNAs are suppressing MMP
transcription due to off-target effects.
Discussion for Example 1
[0136] The mortality rate for patients diagnosed with pancreatic
cancer has remained stagnant for the last five decades despite
advanced surgical procedures and improvements in chemotherapeutics
(23). Because most patients present with advanced metastatic
disease, it is critical to understand the properties of invasive
pancreatic tumors. Discovery and subsequent study of factors that
contribute to tumor cell invasion provide an opportunity to develop
therapeutics that could be used alone or in combination with other
anti-neoplastic agents. Prior to our report (4), it was not
previously known that QSOX1 was over-expressed in pancreatic
tumors. The results presented in FIG. 1 suggest that QSOX1 is a
commonly over-expressed protein in PDA, making it a potential
target. To extend those initial findings we began to investigate
why pancreatic tumors over-express QSOX1, and mechanistically, what
advantage it affords tumors.
[0137] Tumor cells in which QSOX1 protein expression was suppressed
by shQSOX1 grew more slowly than the shScrambled and untreated
controls as measured by an MTT assay, while the results with our
strongest shQSOX1, sh742, show a greater that 50% decrease in cell
growth in both BxPC3 and Panc-1 cells (FIG. 2C). Our attempt to try
and explain the decrease in proliferation as a result of abnormal
cell cycle regulation or an increase in apoptosis do not show a
similar level of change that can solely explain our MTT results
(FIG. 3, S2). Contrary to previous statements implicating QSOX1 as
a cell cycle regulator (24), our results suggest that while the
loss of QSOX1 in Pane-1 cells shows a consistent decrease in
G.sub.1, there is no where near that effect when we analyzed BxPC3
cells suggesting that the role of QSOX1 could be cell type and
tumor stage dependent, as a result of the different substrates
available (S2). Our results likely conflict because we assessed the
effect of QSOX1 on pancreatic tumor cell growth, not fibroblasts
where QSOX1 was initially described (5, 24).
[0138] The same statement can be made in regards to the loss of
QSOX1 directly affecting apoptosis. While our strongest knock-down,
sh742, does show at its greatest an 8% increase in annexin
V/propidium iodide double positive cells it is not enough to
explain the dramatic decrease in cellular proliferation (FIG. 3).
There are numerous proteins within the cell that assist in
disulfide bond formation that may compensate for the loss of QSOX1
such as protein disulfide isomerase (PDI), thioredoxin, glutathione
and members of the Erv family of sulfhydryl oxidases (25). There
are no known preferred substrates of QSOX1 although speculation
based on the function of QSOX1 as well as the known substrates that
correspond to QSOX1 functional domains, leads us to believe that
there are a broad spectrum of possible substrates and therefore the
role that QSOX1 plays in tumor cell progression would most likely
be influenced by the substrates with the greatest affinity for
QSOX1. Compensation by these other oxidases could help explain why
the loss of QSOX1 does not lead to significant alterations in the
cell cycle and apoptosis. It is also possible that suppression of
QSOX1 activity does not induce apoptosis, but results in other
phenomena such as anoikis or autophagy (26). We may investigate
these possibilities in future studies.
[0139] Another hallmark of cancer is invasion. Since suppression of
QSOX1 did not appear to play a major role in tumor cell growth, we
hypothesized that the over-expression of QSOX1 in pancreatic tumor
cells may contribute to their ability to degrade basement
membranes, leading to an invasive and metastatic phenotype. We
discovered that suppression of QSOX1 protein resulted in a dramatic
reduction in the ability of both BxPC3 and Panc-1 pancreatic tumor
cells to invade through Matrigel.TM. in vitro (FIG. 4). It is clear
through these results that there are clear differences between
BxPC3 and Panc-1 ability to degrade basement membrane components
and invade. This could be due to a myriad of factors such as the
proteases secreted, the stage of the tumor and genetic differences
between the two cells lines (27). To determine if this reasoning
was correct, we performed gelatin zymography as a way to analyze
the matrix metalloproteinase activity.
[0140] As a sulfhydryl oxidase, it is unlikely that QSOX1 would
directly degrade basement membrane components. Therefore, we
hypothesized that MMPs serve as a substrate of QSOX1 while the MMPs
are folding and undergoing activation as they are secreted from
tumor cells. If true, suppression of QSOX1 would lead to a decrease
in MMP functional activity, though not necessarily the amount of
MMPs produced or secreted. Although the MMP profiles of BxPC3 and
Pane-1 cells differ as seen in FIGS. 5A and B, we found that
suppression of QSOX1 leads to a decrease in pro-MMP-2 and -9
activity. MMPs are zinc-dependent proteolytic enzymes that degrade
ECM components (22). There are 23 known human MMPs as well as 4
known tissue inhibitors of MMPs (TIMP) that aid in regulating the
expression and activation of these proteolytic enzymes (22). The
expression patterns of MMPs are variable depending on tumor type,
and even individual cell line.
[0141] In pancreatic cancer the majority of MMPs are secreted in
their inactive form and activated extracellularly (28). Activation
of MMPs occurs either through the release of a covalent
Cys.sup.73-Zn.sup.2+ bond ("Cysteine Switch") or through cleavage
and activation by plasmin, serine proteases, and other MMPs or
TIMPs (21, 28). MMP-2 and -9 have been found to play an important
role in pancreatic cancer progression with 93% of tumors expressing
MMP-2 compared to normal tissue (28). While reports implicating
MMP-9 in the progression of pancreatic cancer are limited, Tian
reported the proteomic identification of MMP-9 in pancreatic juice
from patients with pancreatic ductal adenocarcinoma (29).
Pryczynicz et al. also found a relationship between MMP-9
expression and lymph node metastases (30). Numerous reports
implicate MMP-2 as a prominent protease responsible for pancreatic
tumor metastasis (2, 22, 28).
[0142] One of the benefits of gelatin zymography is that it a.)
provides a functional measure of the activities of MMPs able to
degrade gelatin and b.) differentiates each precursor and active
MMP by molecular weight (21, 31). A limitation of the zymography
shown here is that it is limited to MMPs whose substrate is
gelatin. It is possible that QSOX1 is involved in activation of
other MMPs with different substrates. This will be investigated in
future work.
[0143] Following up on our initial hypothesis regarding MMP
activation by QSOX1 we performed a western blot analysis on the
same serum free conditioned media that was used to perform gelatin
zymography. Our result revealed that the overall levels of secreted
MMP-2 and -9 are nearly equal among the untreated, shScramble and
shQSOX1 treated samples leading us to further hypothesize that
QSOX1 is involved in the proper folding of MMPs before they are
secreted and that the loss of QSOX1 leads to proteolytically
inactive MMPs as shown in FIGS. 5A, B and C. To further confirm
that what we are observing is a post-translational event we
performed qPCR on BxPC3 and Pane-1 shQSOX1 treated cells (FIG.
5D-E). Our observation was surprising in that we are able to show
that there is an overall increase in the transcription of MMP-2 and
-9. This result led us to hypothesize that the cell is
transcriptionally attempting to compensate for the proteolytically
inactive MMPs through an as yet undetermined mechanism.
[0144] QSOX1 was previously reported by our group to be
over-expressed in patients diagnosed with pancreatic cancer (4),
and that a peptide from the QSOX1 parent protein is present in
plasma from patients with PDA. In the present study we demonstrated
for the first time that expression of QSOX1 in pancreatic tumor
cells directly contributes to an invasive and potentially
metastatic phenotype through the activation of MMP-2 and -9 through
an as yet undetermined mechanism. It is not known if QSOX1 is
solely responsible for the proper folding of MMPs intracellularly,
or if it cooperates with protein disulfide isomerase while MMPs are
folding in the ER and golgi. Since MMPs are secreted
extracellularly where they may undergo autoactivation or cleavage
with proteases such as plasmin, it is possible that QSOX1-S
activates them in the extracellular environment.
[0145] At this point, the post-translational mechanism by which
QSOX1 activates MMPs is not clear. Our results indicate that MMP-2
and -9 RNA increased in shQSOX1 transduced cells. We expected no
difference in MMP levels, but an increase might suggest that the
cells are attempting to compensate for the lack of MMP activity
through a feedback loop (32, 33). Although we hypothesize that
QSOX1 may activate MMPs directly by involvement in the cysteine
switch activation mechanism (21, 28), ROS produced by QSOX1 may be
indirectly activating MMPs, as MMP activation has been reported to
depend on an oxidative environment (32, 33).
[0146] Our results underscore the need to further understand the
role that QSOX1 plays in tumor and normal cells, and how at the
molecular level, it activates MMPs. This information will be useful
during development of inhibitors of QSOX1 that may work upstream of
individual MMPs.
REFERENCES FOR EXAMPLE 1
[0147] 1. Bardeesy N, DePinho R A. Pancreatic cancer biology and
genetics. Nature Publishing Group 2002; 12:897-909. [0148] 2.
Koshiba T, Hosotani R, Wada M, Miyamoto Y, Fujimoto K, Lee J U, et
al. Involvement of matrix metalloproteinase-2 activity in invasion
and metastasis of pancreatic carcinoma. Cancer; 1998. p. 642-50.
[0149] 3. Strimpakos A, Saif M W, Syrigos K N. Pancreatic cancer:
from molecular pathogenesis to targeted therapy. Cancer Metastasis
Rev 2008; 3:495-522. [0150] 4. Antwi K, Hostetter G, Demeure M J,
Katchman B A, Decker G A, Ruiz Y, et al. Analysis of the plasma
peptidome from pancreas cancer patients connects a peptide in
plasma to overexpression of the parent protein in tumors. J
Proteome Res 2009; 10:4722-31. [0151] 5. Coppock D L, Cina-Poppe D,
Gilleran S. The quiescin Q6 gene (QSCN6) is a fusion of two ancient
gene families: thioredoxin and ERV1. Genomics 1998; 3:460-8. [0152]
6. Coppock D. Regulation of the Quiescence-induced Genes: Quiescin
Q6, Decorin, and Ribosomal Protein S29. Biochemical and Biophysical
Research Communications 2000; 2:604-10. [0153] 7. Heckler E J, Alon
A, Fass D, Thorpe C. Human quiescin-sulfhydryl oxidase, QSOX1:
probing internal redox steps by mutagenesis. Biochemistry 2008;
17:4955-63. [0154] 8. Coppock D L, Thorpe C. Multidomain
flavin-dependent sulfhydryl oxidases.
[0155] Antioxid Redox Sign 2006; 3-4:300-11. [0156] 9. Hoober K L,
Thorpe C. Flavin-dependent sulfhydryl oxidases in protein disulfide
bond formation. Methods Enzymol 200230-4. [0157] 10. Thorpe C,
Hoober K L, Raje S, Glynn N M, Burnside J, Turi G K, et al.
Sulfhydryl oxidases: emerging catalysts of protein disulfide bond
formation in eukaryotes. Arch Biochem Biophys 2002; 1:1-12. [0158]
11. Vitu E, Bentzur M, Lisowsky T, Kaiser C A, Fass D. Gain of
function in an ERV/ALR sulfhydryl oxidase by molecular engineering
of the shuttle disulfide. J Mol Biol 2006; 1:89-101. [0159] 12.
Alon A, Heckler E J, Thorpe C, Fass D. QSOX1 contains a
pseudo-dimer of functional and degenerate sulfhydryl oxidase
domains. FEBS Lett 2010; 8:1521-5. [0160] 13. Hoober K L, Joneja B,
White H B, 3rd, Thorpe C. A sulfhydryl oxidase from chicken egg
white. J Biol Chem 1996; 48:30510-6. [0161] 14. Hoober K L, Glynn N
M, Burnside J, Coppock D L, Thorpe C. Homology between egg white
sulfhydryl oxidase and quiescin Q6 defines a new class of
flavin-linked sulfhydryl oxidases. J Biol Chem 1999; 45:31759-62.
[0162] 15. Morel C, Adami P, Musard J, Duval D, Radom J, Jouvenot
M. Involvement of sulfhydryl oxidase QSOX1 in the protection of
cells against oxidative stress-induced apoptosis. Experimental Cell
Research 2007:19:3971-82. [0163] 16. Song H, Zhang B, Watson M A,
Humphrey P A, Lim H, Milbrandt J. Loss of Nkx3.1 leads to the
activation of discrete downstream target genes during prostate
tumorigenesis. Oncogene; 2009. p. 3307-19. [0164] 17. Ouyang X,
DeWeese T L, Nelson W G, Abate-Shen C. Loss-of-function of Nkx3.1
promotes increased oxidative damage in prostate carcinogenesis.
Cancer Research; 2005. p. 6773-9. [0165] 18. Bowen C, Bubendorf L,
Voeller H J, Slack R, Willi N, Sauter G, et al. Loss of NKX3.1
expression in human prostate cancers correlates with tumor
progression. Cancer Res 2000; 21:6111-5. [0166] 19. Ouyang H, Mou
L, Luk C, Liu N, Karaskova J, Squire J, et al. Immortal human
pancreatic duct epithelial cell lines with near normal genotype and
phenotype. Am J Pathol 2000; 5:1623-31. [0167] 20. Zuo D, Mohr S E,
Hu Y, Taycher E, Rolfs A, Kramer J, et al. PlasmlD: a centralized
repository for plasmid clone information and distribution. Nucleic
Acids Res 2007; Database issue:D680-4. [0168] 21. Snoek-van Beurden
PAM, Von den Hoff J W. Zymographic techniques for the analysis of
matrix metalloproteinases and their inhibitors. BioTechniques 2005;
1:73-83. [0169] 22. Kessenbrock K, Plaks V, Werb Z. Matrix
metalloproteinases: regulators of the tumor microenvironment. Cell
2010; 1:52-67. [0170] 23. Koorstra J B, Feldmann G, Habbe N, Maitra
A. Morphogenesis of pancreatic cancer: role of pancreatic
intraepithelial neoplasia (PaniNs). Langenbecks Arch Surg 2008;
4:561-70. [0171] 24. Coppock D L, Kopman C, Scandalis S, Gilleran
S. Preferential gene expression in quiescent human lung
fibroblasts. Cell Growth Differ 1993; 6:483-93. [0172] 25. Fass D.
The Erv family of sulfhydryl oxidases. Biochim Biophys Acta 2008;
4:557-66. [0173] 26. Evan G I, Vousden K H. Proliferation, cell
cycle and apoptosis in cancer. Nature 2001; 6835:342-8. [0174] 27.
Firpo M A, Deer E L, Gonzalez-Hernandez J, Coursen J D, Shea J E,
Ngatia J, et al. Phenotype and Genotype of Pancreatic Cancer Cell
Lines. Pancreas 2010; 4:425-35. [0175] 28. Bloomston M, Zervos E E,
Rosemurgy A S. Matrix metalloproteinases and their role in
pancreatic cancer: a review of preclinical studies and clinical
trials. Ann Surg Oncol 2002; 7:668-74. [0176] 29. Tian M, Cui Y Z,
Song G H, Zong M J, Zhou X Y, Chen Y, et al. Proteomic analysis
identifies MMP-9, DJ-1 and AlBG as overexpressed proteins in
pancreatic juice from pancreatic ductal adenocarcinoma patients.
BMC Cancer 2008241. [0177] 30. Pryczynicz A, Guzinska-Ustymowicz K,
Dymicka-Piekarska V, Czyzewska J, Kemona A. Expression of matrix
metalloproteinase 9 in pancreatic ductal carcinoma is associated
with tumor metastasis formation. Folia Histochem Cytobiol 2007;
1:37-40. [0178] 31. Kupai K, Szucs G, Cseh S, Hajdu I, Csonka C,
Csont T, et al. Matrix metalloproteinase activity assays:
Importance of zymography. Journal of Pharmacological and
Toxicological Methods 2010; 2:205-9. [0179] 32. Wu W S. The
signaling mechanism of ROS in tumor progression. Cancer Metast Rev
2006; 4:695-705. [0180] 33. Kar S, Subbaram S, Carrico P M,
Melendez J A. Redox-control of matrix metalloproteinase-1: a
critical link between free radicals, matrix remodeling and
degenerative disease. Respir Physiol Neurobiol 2010; 3:299-306.
Example 2
[0181] We designed two short hairpin RNAs (shRNA1 and shRHA2) to
knock-down QSOX1 protein expression in tumor cells.
TABLE-US-00013 shRNA1-Targeting QSOX1 sequence begins at the
970.sup.th base pair- (SEQ ID NO: 17) ATCTACATGGCTGACCTGGAA
shRA2-Targeting QSOX1 sequence begins at the 1207.sup.th base pair-
(SEQ ID NO: 18) AGGAAAGAGGGTGCCGTTCTT
[0182] QSOX1 shRNA1 hybridizes with nucleotides 970-989 of the
QSOX1 transcript. QSOX1I shRNA2 hybridizes to nucleotides 1207-1226
of the transcript. Both shRNAs, independently and together
suppressed the production of QSOX1 protein (data not shown) and
cell proliferation. Upon cloning the QSOX1 shRNA into a eukaryotic
expression vector (pCS2 mammalian overexpression vector with a CMV
promoter) and using it to transfect a pancreatic tumor cell line
(BxPC-3), a 30-40% decrease in cell viability was observed, over a
4 to 6 day period, compared to untreated and scrambled shRNA
controls. (FIG. 6) Using the same transfection protocol in a
separate experiment, we made an additional observation that QSOX1
shRNA-transfected BxPC-3 cells were inhibited from invading through
a Matrigel.TM. basement membrane composed of collagen, laminin and
fibronectin approximately 70% when both QSOX1 shRNAs were combined
(FIG. 7).
[0183] A summary of the data obtained from these studies is shown
in the table below:
TABLE-US-00014 Invasion of tumor % Decrease in cells through a
Viability/ QSOX1 protein basement mitochondrial Sample expression
membrane respiration shRNA1 37 63 39 shRNA2 10 69 48 shRNA1/2 41 77
50
[0184] Values in table represent % decreases in protein expression
or activity compared to scrambled shRNA in the same CMV driven pCS2
mammalian overexpression vector. Knockdown is transient in this
pCS2 vector.
Example 3
[0185] MIAPaCa2 and Panc-1 pancreatic tumor cells were transduced
with shRNA that specifically knocked down QSOX1 protein in the
tumor cells. The shRNAs used to knockdown QSOX1 in tumor cells
were
TABLE-US-00015 QSIX1 sh742
(5'-CCGGGCCAATGTGGTGAGAAAGTTTCTCGAGAAACTTT CTCACCACATTGGCTTTTTG- 3'
(SEQ ID NO: 26)) and shRNA QSOX1 sh528 (SEQ ID NO: 21)
5'-CCGGACAATGAAGAAGCCTTT-3' (sense),
Nude mice Human pancreatic tumor cells (MIAPaCa2) were transduced
with a lentivirus encoding shQSOX1 (sh528 and sh742) and shScramble
(control). One million MIAPaCa2 cells were mixed with Matrigel.TM.
and used to inoculate nude mice (5 mice/group) on day 0. After day
12, tumor growth was measured every 3 days (x-axis) and reported as
"Tumor volume" on the Y-axis. "Untreated" indicates that tumor
cells were not transduced. (see FIGS. 8 and 9). This in vivo
experiment thus validates QSOX1 as a potential target for
anti-neoplastic drugs. Any other type of inhibitor of QSOX1
expression or function would have a similar effect on tumor cell
growth.
Example 4
[0186] In this present study, we evaluated QSOX1 protein expression
in breast adenocarcinoma cell lines MCF7, BT474 and BT549 and in a
breast tumor tissue microarray. Using short hairpin RNA (shRNA)
specific for QSOX1-S and -L, we assessed the effects of QSOX1
knockdown on cell growth, cell cycle, apoptosis, invasion and
matrix metalloproteinase activity. The loss of QSOX1 significantly
affected tumor cell proliferation and dramatically suppressed tumor
cell invasion through Matrigel.TM.. The addition of exogenous
recombinant human QSOX1 (rhQSOX1) rescued the invasive capabilities
of MCF7, BT474 and BT549 validating the pro-invasive function of
QSOX1. We further report the mechanism of QSOX1-mediated invasion
in vitro is due in part, to elevated MMP-9 activity.
Expression of QSOX1 Correlates with Poor Prognosis in Patients with
Luminal B Breast Cancer
[0187] Bioinformatic analysis of QSOX1 transcript expression was
assessed using data from the Gene expression based Outcome for
Breast cancer Online algorithm (GOBO) [17]. GOBO is a web based
analysis tool that utilizes Affymetrics gene expression data
curated from 1,881 breast cancer patients with associated stage,
grade, nodal status and intrinsic molecular classification based on
the paradigm first reported by the Perou Laboratory [18].
Expression of QSOX1 was significantly higher in ER+ tumors compared
to ER- (P<0.00001), with the highest expression observed in
Luminal A, Luminal B and Normal-like subtypes (FIG. 12a, b). The
lowest QSOX1 transcript expression was observed in HER2-enriched
and basal tumors. Using the GOBO tool, we performed a series of
Kaplan Meier analyses to determine whether QSOX1 expression is
associated with relapse free survival (RFS) and overall survival
(OS) (FIG. 12c, d). While elevated QSOX1 expression is not
associated with survival when considering all breast tumor subtypes
together, it is highly associated with poor RFS (P=0.00062) and OS
(P=0.00031) in Luminal B tumors (FIG. 12c, d). The expression of
QSOX1 correlates with increasing tumor grade as well as poor
overall survival in patients diagnosed with grade 2 (P=0.04242) and
grade 3 (P=0.07095) breast tumors. Elevated QSOX1 was also
associated with reduced OS in Luminal A tumors and is a predictor
of poor OS for patients who did not receive systemic treatment
(data not shown).
Evaluation of QSOX1 Expression by Immunohistochemistry
[0188] Results from the GOBO transcript expression analysis fueled
investigation of QSOX1 at the protein level in breast tumors. A
breast tumor tissue microarray composed of breast tumors from over
150 different patients was stained with a rabbit anti-QSOX1
polyclonal antibody and scored by a board certified pathologist
(ITO). FIG. 13b shows no expression of QSOX1 in normal breast
tissue. FIGS. 13c-f represent a pattern of increasing QSOX1
expression observed in the TMA in grade 1, grade 2 and grade 3
invasive ductal carcinomas and a grade 3 invasive lobular
carcinoma. Statistical evaluation of QSOX1 expression by
immunohistochemistry (IHC) demonstrated an association with ER+
tumors, and a strong association with high Ki-67 expression in
patients with a high QSOX1 IHC score (FIG. 13a, Table 1). There was
no relationship observed for QSOX1 expression in HER2+ tumors or
cytokeratin markers (CK 5/6) positive tumors. These data are
consistent with the correlation observed in the GOBO data.
Interestingly, higher grade tumors were associated with a higher
QSOX1 IHC score (FIG. 13a, Table 1). Conversely, lower QSOX1
protein expression is significantly associated with lower grade
tumors. This is consistent with an association between QSOX1
expression and more aggressive ER+ tumors.
TABLE-US-00016 TABLE 1 Statistical assessment of QSOX1 protein
expression with molecular subtypes of breast cancer IHC Score High
No QSOX1 Low QSOX1 Intermediate QSOX1 staining staining QSOX1
staining staining (n = 17) (n = 47) (n = 24) (n = 65) % % % %
P-value Grade *0.0003 1 53.3 42.2 25 10.8 2 33.3 33.3 41.7 32.3 3
13.3 24.4 33.3 56.9 ER *0.0013 ER+ 80 89.1 73.9 55.4 ER- 20 10.9
26.1 44.6 HER2 0.0811 HER2+ 11.8 6.4 29.2 14.1 HER2- 88.2 93.6 70.8
85.9 CK5/6 0.0733 CK5/6- 100 95.7 87.5 83.1 CK5/6+ 0 4.3 12.5 17
KI-67 *0.0011 Low 33.3 33.3 41.1 18.5 Intermediate 44.4 45.5 17.7
16.7 High 22.3 21.2 41.2 64.8 ER & HER2 *0.0016 ER- HER2- 13.3
8.7 8.7 35.9 Others 86.7 91.3 91.3 64.1 ER, HER2 and 0.0923 CK5/6
ER- HER2-, 0 4.3 4.2 15.4 CK5/6: 1/2/3 Others 100 95.7 95.8
84.6
Evaluation of QSOX1 Expression by Western Blot
[0189] QSOX1 expression in human breast adenocarcinoma was assessed
in six different breast tumor cell lines, and a transformed
non-tumorigenic breast cell line, MCF10A [19, 20]. Similar to our
studies in pancreatic cancer, the short form of QSOX1 is expressed
as the predominant splice variant in each cell line examined (FIG.
14a). Consistent with the GOBO and IHC expression data, we found
that the expression of QSOX1-S protein was more highly expressed in
luminal-like cell lines MCF7 (ER+), MDA-MB-453 (ER-), ZR 75 (ER+)
and BT474 (ER+) compared to basal-like BT549 and MDA-MB-231 cell
lines. Interestingly, QSOX1 was most weakly expressed in
transformed normal MCF10A cells, which do not form tumors in
immunodeficient animals.
Expression of QSOX1 in Tumor Cells Promotes Cellular
Proliferation
[0190] To begin to assess the mechanistic role that QSOX1 plays in
tumor cells we stably knocked-down QSOX1 expression in MCF7, BT549
and BT474 cells using two lentiviral shRNA constructs, sh742 and
sh528 (data not shown). QSOX1 protein expression was assessed
following stable knock-down relative to isogenic parental cell
lines by western blotting. Densitometry of the QSOX1 protein
relative to alpha-tubulin expression indicates that sh742 and sh528
resulted in a knock-down of QSOX11-S expression in MCF7 cells by
85% and 82%, respectively. In BT549 cells the knock-down was 65%
and 77%, and for BT474 cells by 40% and 36%, respectively.
[0191] The growth rates of shQSOX1-transduced MCF7, BT549 and BT474
cells were then evaluated compared to isogenic controls. An equal
number of untransduced (parental), shScramble, sh742 and sh528
cells were seeded in 96 well plates and assayed for proliferation
over 5 days using the MTT assay. ShQSOX1-transduced MCF7, BT549 and
BT474 cells displayed a decrease in cell growth compared to
shScrambled and parental controls. In MCF7 cells, sh742 and sh528
showed a 66% decrease in cell growth, while sh742 and sh528
suppressed growth of BT549 by 78% and 69%, respectively, and sh742
and sh528 suppressed growth of BT474 by 52% and 29%, respectively
by day 5. We confirmed our MTT results by performing Trypan blue
staining over 5 days using the same incubation conditions as in the
MTT assay. These results suggest that QSOX1 helps drive tumor cell
growth.
Cell Cycle, Apoptosis and Autophagy Analysis
[0192] We hypothesized that a shQSOX1-mediated decrease in cell
proliferation could be the result of abnormal regulation of the
cell cycle, an increase in apoptosis or the result of autophagosome
formation. To address this, propidium iodide (PI) was used in flow
cytometry to evaluate the effects of shQSOX1 on cell cycle. In MCF7
cells, both shQSOX1 RNAs showed a slight decrease in G.sub.1 and an
increase (11-12%) in S phase, while in BT474 cells both shQSOX1
RNAs showed a slight 12% increase in G.sub.1 and a 26% decrease in
S phase but neither shQSOX1 RNA sequence had any effect in BT549
cells compared to untreated and shScramble controls (data not
shown).
[0193] Next we determined if the decrease in cellular proliferation
was due to an increase in apoptosis or autophagy. To assess
apoptosis, we analyzed MCF7 and BT474 transduced cells for Annexin
V/PI [18]. We subsequently probed MCF7 and BT549 transduced cells
for LC3, a protein that is necessary for auotphagosome formation
[19]. If the expression of QSOX1 prevented cellular apoptosis or
autophagy we would expect to see an increase in expression of
Annexin V and LC3 in shQSOX1 transduced cells, but we did not
observe any statistically significant increases in Annexin V
positive cells (data not shown). This correlates with our previous
results in pancreas cancer that the suppression of QSOX1 does not
lead to cell death or autophagy.
Suppression of QSOX1 Expression Inhibits Tumor Cell Invasion
[0194] The process of tumor cell invasion involves the degradation
of basement membrane (BM) components such as laminin, collagen and
fibronectin before a tumor cell is able to invade other tissues
[20]. We performed a modified Boyden chamber assay using
Matrigel.TM.-coated inserts in which tumor cells must degrade the
Matrigel.TM. and migrate through a membrane with 8 um pores to gain
access to nutrient rich media. Sh742 and sh528-transduced MCF-7,
BT549 and BT474 tumor cells were added to Matrigel.TM.-coated, 8 um
pore inserts in serum-free medium. After 72 (MCF7) and 48 (BT549
and BT474) hours of incubation, tumor cells that were able to
degrade Matrigel.TM. and migrate through 8 um pores onto the
underside of the insert were counted (FIGS. 10a, b and c). Our
results demonstrate that knockdown of QSOX1 expression in MCF7
leads to a 65% and 71% reduction in invasion of sh742 and sh528
transduced tumor cells, respectively. For BT549 sh742- and
sh528-transduced tumor cells, 60% and 40% decreases in invasion
through Matrigel.TM. were observed. Suppression of QSOX1 expression
in BT474 cells leads to an 85% reduction in invasion of both sh742-
and sh528-transduced tumor cells. These data suggest that QSOX1
plays a role in regulating invasive behavior in vitro irrespective
of breast tumor subtype and hormone receptor status.
[0195] To prove that suppression of QSOX1 protein expression was
responsible for loss of tumor cell invasion, we performed a rescue
experiment in which recombinant human QSOX1 (rhQSOX1, generously
provided by Dr. Colin Thorpe) was added to shQSOX1-MCF7,
shQSOX1-BT549 and shQSOX1-BT474 cells during the invasion assay. As
a control for the enzymatically active QSOX1, a mutant rhQSOX1 in
which the CxxC motif in the thioredoxin-1 domain was mutated to
AxxA (rhQSOX1(AA), generously provided by Dr. Debbie Fass) was
added to the invasion assay. Addition of enzymatically active
rhQSOX1I rescued the invasive phenotype of the shQSOX1-transduced
tumor cells (FIG. 10d-f), while the addition of the rhQSOX1(AA) did
not rescue invasion of the shQSOX1-transduced tumor cells.
Decrease in QSOX1 Leads to a Decrease in Matrix Metalloproteinase
Activity
[0196] Since knockdown of QSOX1 resulted in decreased breast tumor
cell invasion, it was important to determine a mechanism for how
QSOX1 might facilitate invasion. Matrix metalloproteinases (MMP)
have been shown to play key roles in breast tumor invasion and
metastasis [21]. Both MMP-2 and -9 mRNA and protein levels have
been shown to contribute to breast tumor invasion, metastasis and
angiogenesis [22]. Since previous work demonstrated that QSOX1-S is
secreted into the extracellular matrix where MMPs are activated, we
hypothesized that QSOX1 might help activate MMP-2 and -9 proteins.
MCF7 and BT549 cells transduced with shScramble, sh742 and sh528
were plated at equal densities and allowed to incubate in serum
free media for 48 hours, after which the supernatants were
collected and analyzed by gelatin zymography to determine if the
loss of QSOX1 leads to a decrease in the functional activity of
MMP-2 and -9.
[0197] Initial analysis of the results indicates that MCF7 and
BT549 possess similar MMP profiles even though it is known that
BT549 cells are more invasive. Luminal B-like breast tumor cell
lines BT474 and ZR75 express do not secrete detectable levels of
MMPs [23-25]. However, both MCF7 and BT549 supernatants contain
MMP-9 homodimer (130 kDa), a large amount of protcolytically active
pro-MMP-9 (92 kDa) with lesser concentrations of proteolytically
active pro-MMP-2 (72 kDa).
[0198] We found that supernatants from MCF7 cells transduced with
sh742 and sh528 showed a 70% and 77% decrease, respectively, in
pro-MMP9 activity compared to shScramble (FIG. 11a). MCF7
supernatants from cells transduced with sh742 and sh528 also showed
a 50% and 60% decrease in active MMP-9 (a-MMP-9) as well (FIG.
11a). Supernatants from BT549 cells transduced with sh742 and sh528
showed a 34% and 88% decrease, respectively, in MMP-9 (FIG. 11b).
Decreases in the proteolytic activity of MMP-9, using gelatin as a
substrate, provide a mechanism for the shQSOX1-mediated suppression
of invasion through Matrigel.
[0199] To extend our hypothesis that QSOX1 is activating or
modifying MMPs post-translationally, we performed a western blot on
total cell lysate from MCF7 and BT549 transduced cells as well as
performed quantitative real time PCR (qPCR) to determine if the
loss of QSOX1 affected MMP protein and RNA levels (FIG. 11c,d). Our
results indicate that the intracellular amount of MMP-2 and -9
protein is similar between the untreated, shScramble, sh742 and
sh528 samples in MCF7 and BT549 cells (FIG. 11c). FIG. 11d
demonstrates that the loss of QSOX1 also has no significant effect
on the transcriptional activity of MMP-2 and -9. These results add
confidence to our hypothesis that QSOX1 is involved in the
post-translational activation of MMPs.
Discussion for Example 4
[0200] To determine if QSOX1 was over-expressed in breast cancer, a
GOBO analysis was performed using data from over 1,800 breast
cancer cases. A prominent finding in this analysis is that the
highest levels of QSOX1 expression in Luminal B breast cancer
correlate with very poor RFS and OS (FIG. 12c, d). The median
survival in patients with Luminal B breast cancer who over-express
QSOX1 is approximately four years. The prognostic power of QSOX1
expression for RFS and OS increases when Luminal B breast cancer
cases are divided into quintiles using the GOBO analysis tool for
which patients with the highest fifth expression of QSOX1 have RFS
of less than two years and OS of less than three years. In support
of our GOBO analysis, showing that expression of QSOX1 is an
indicator of poor OS and RFS in Luminal B breast cancer patients,
we performed IHC on breast TMA samples. We were able to confirm
that expression of QSOX1 significantly correlates with ER+breast
tumor (P=0.0013) cells as well as correlating with high Ki-67
expression (P=0.0011), further supporting a role for QSOX1 in
cellular proliferation (FIG. 13a). Additionally, over-expression of
QSOX1 mRNA in the GOBO analysis and high levels of protein in IHC
correlate with increasing tumor grade in our breast tumor TMA
analyses (FIG. 13; Table 1). Expression of QSOX1 did not correlate
with survival in HER2 enriched tumors, ER- tumors or in tumors
subtyped as basal-like. Importantly, in patients who did not
receive systemic therapy (presumably due to diagnosis of very early
stage disease), QSOX1 appears to be a predictor of poor OS.
However, this association was not strong until more than five years
post diagnosis.
[0201] Tumor cells in which QSOX1 expression was suppressed using
shRNAs grew at less than half the rate of shScramble and untreated
controls in MCF7, BT549 and BT474 cells (FIG. 14e-j). The results
of the MTT and Trypan Blue assays confirm our breast TMA findings
showing that high expression of QSOX1 correlates with high Ki-67
expression. Our attempt to explain the decrease in cell growth by
abnormal cell cycle regulation, apoptosis and autophagy suggests
that QSOX1 is not involved in apoptosis, or autophagy, but may
marginally affect cell cycle, as we observed a stall in G.sub.1 and
an increase in S phase in MCF7 cells (luminal-like) and an
insignificant increase in G.sub.1 and a decrease in S phase in
BT474 (luminal-like) cells compared to shScramble controls.
However, there were no observable changes in BT549 cells
(basal-like). These results, combined with our findings in PDA
suggest that QSOX1 is unlikely to play a significant role in cell
cycle. Our analysis of apoptosis and autophagy as a second possible
mechanism contributing to the observed decrease in cell growth did
not reveal significant increases in Annexin V/PI or LC3 expression
(autophagy) in our shRNA treated cells. We also did not observe any
increases in Trypan Blue positive cells during our cell growth
assays compared to our shScramble control (data not shown).
[0202] The ability of a tumor cell to invade is one of several
hallmarks of cancer [27]. Based on our results showing that QSOX1
over-expression in pancreas tumor cells contributes to invasion, we
hypothesized that the over-expression of QSOX1 in breast
adcnocarcinoma would elicit a similar phenotype. MCF7, BT549 and
BT474 cells transduced with QSOX1 shRNAs exhibited significant
decreases in their ability to degrade basement membrane components
and invade through Matrigel.TM. (FIG. 10a-c). MCF7 cells are a
poorly invasive, Luminal A-like breast cancer cell line, while
BT549 (basal-like) and BT474 (Luminal B-like) cells are highly
invasive [28, 29]. Although the invasive capabilities are
dramatically different between these cell lines, QSOX1 knock-down
suppressed growth and invasion in all cell lines irrespective of
the level of QSOX1 expression (FIG. 13a) and molecular tumor
subtype. Addition of exogenous recombinant QSOX1 protein to shQSOX1
transduced tumor cells rescued their invasive properties (FIG.
10d-f), confirming data indicating that QSOX1 is secreted into the
extracellular matrix.
[0203] These findings indicate the advantage that QSOX1 provides to
breast and pancreas tumors may be highly conserved and universal
among other tumor types. What we can conclude from our human TMA
analysis of QSOX1 protein expression is that QSOX1 is a very
specific marker of tumor cells and that the expression of QSOX1
correlates with increased proliferation (high Ki-67) and an
increase in tumor grade consistent with the characteristics of
highly invasive tumors.
[0204] MMPs are a family of proteases that are involved in the
degradation of basement membrane components contributing to tumor
cell invasion and proliferation [34]. In breast tumors,
gelatinases, MMP-2 and MMP-9 have been shown to play a significant
role in growth and metastasis, as their expression is correlated
with aggressive forms of breast cancer [25, 34, 35]. Gelatinases
are secreted into the extracellular matrix in their inactive,
pro-form where they can be activated through either a cysteine
switch or shift in the prodomain mediated by integrins and laminin
in basement membranes and structural proteins, such as vimentin
[25]. Thiol binding proteins, such as glutathione, have also been
shown to help fold and activate MMPs [35]. Our data indicate that
MMPs could be one substrate of QSOX1. To address this we performed
gelatin zymography to assess functional activity MMPs. Our data
reveal that knockdown of QSOX1 protein expression in both MCF7 and
BT549 cells leads to a decrease in MMP-9 functional activity
compared to shScramble control (FIG. 11a, b). While the functional
activity of MMP-2 and -9 was suppressed, mRNA encoding MMP-2 and -9
remained relatively constant in MCF-7 cells and increased in BT549
cells (FIG. 11c, d). BT474 cells unfortunately do not express or
secrete levels of MMP-2 and -9 detectable by gelatin zymography
[25, 36]. Interestingly, when we knock down QSOX1 in BT474 cells we
observe the same phenotypic effects indicating that there are
multiple substrates of QSOX1 contributing to our observed decrease
in cellular proliferation and invasion. Taken together, the data
suggest that QSOX1 may post-translationally activate MMPs.
[0205] QSOX1 is expressed during embryonic development in mouse and
rat during key migratory stages [37]. This developmental data
combined with our results indicating that QSOX1 expression
facilitates degradation of basement membranes suggests that tumor
cells over-express QSOX1 to allow them to break down basement
membranes and invade into adjacent tissues or into circulation.
QSOX1 expression in Luminal B subtype can help further stratify
which tumors are likely to be more aggressive, leading to poor
overall survival. Notably from these data we can project that
targeting QSOX1 irrespective of tumor subtype could help to slow
tumor cell proliferation as well as tumor cell invasion. This
finding provides another tool for physicians and their patients to
decide whether to more aggressively treat patients with Luminal B
breast cancer whose tumors express high levels of QSOX1.
Material and Methods for Example 4
Cell Culture
[0206] Breast adenocarcinoma MCF7, MDA-MB-468, MDA-MB-453, BT474,
ZR75, BT549 and MDA-MB-231 cancer cell lines were cultured in DMEM
with 10% fetal bovine serum (FBS) (Gibco). Immortal human
non-tumorigenic breast epithelial cells (MCF10A) were cultured in
Clontech KGM-2 karotinocyte media (Gibco). All cell lines were
grown at 37.degree. C. with 5% CO.sub.2. All cell lines tested
negative for mycoplasma contamination using, Venor GeM Mycoplasma
Detection Kit, (Sigma).
Immunohistochemistry (IHC) and Scoring of Staining Intensity
[0207] Breast tumor microarray slides were generated from 153
different breast cancer patients. Each patient's tumor was
represented in triplicate on the slides. Immunohistochemistry on
breast tumor tissue microarray samples was performed exactly as
previously described [16]. After staining the TMA slides with
anti-QSOX1 rabbit polyclonal antibody, a board certified
pathologist (ITO) scored the staining pattern as i) the percentage
of cells with IHC staining for QSOX1 protein expression in the core
tumor tissue sample (0: no staining, 1 (Low): 1 to 33%, 2
(Intermediate): 34 to 66%, 3 (High): 67 to 100%), and ii) the
intensity of the antibody stain (0: no staining, 1: weak, 2:
moderate, 3: strong staining intensity).
[0208] All samples were pre-existing and de-identified and,
therefore, exempt from review by the human subjects Institutional
Review Board at Arizona State University.
Statistical Assessment of QSOX1 IHC with Molecular Subtypes of
Breast Cancer There were 153 patient tissue samples in triplicate
stained with anti-QSOX1 rabbit polyclonal Ab (Proteintech, Chicago,
Ill., USA). IHC staining was scored by a board certified
pathologist (ITO). The amount and intensity of QSOX1
staining/expression was scored on a scale of 0 to 3. The first IHC
score number represents the percentage of cells staining (0: No
staining, 1: 1 to 33%, 2: 34 to 66%, 3: 67 to 100%), and the second
represents intensity (0: No staining, 1: weak, 2: moderate, 3:
strong staining intensity). We grouped the scores into four
categories: 0 (No staining), 11/12/21 (Low staining), 22/13/31
(Intermediate staining) and 32/33/23 (High staining).
[0209] To evaluate the relationship between markers (Tumor grade,
Her2, CK5/6, and Ki-67) and QSOX1, Pearson's chi-square test was
performed. Using two-sided P-values, statistical significance will
be set at P 0.05.
Generation of Short Hairpin (Sh) RNA and Lentiviruses
Production
[0210] As described in previous examples.
Generation of shQSOX1-Transduced Tumor Cell Lines
[0211] Stable transduction of sh742, sh528, and shScramble into
MCF7, BT474 and BT549 cell lines was performed by first seeding the
cells at 6.times.10.sup.5 cells/well in a 6 well plate and
incubating overnight. The next day the cells were transduced by
adding 8 ug/mL polybrene (Millipore) and 200 ul sh742, sh528, and
shScramble lentivirus produced from 293T cells to each well. The
cells were then incubated for 24 hours. The following day fresh
DMEM with 10% FBS was added, containing 1 ug/mL puromycin (Sigma)
to select for the transduced cells. QSOX1 knockdown was measured by
western blot.
SDS-PAGE-Western Blotting
[0212] Western blotting was performed using cell lysates from
MCF10A, MCF7, MDA-MB-468, MDA-MB-453, BT474, ZR 75, BT549 and
MDA-MB-231. Cell lysates were generated by harvesting
2.5.times.10.sup.6 cells by centrifugation followed by lysis using
RIPA buffer (50 mM Tris-HCl, pH7.4, 150 mM NaCl, 1 mM EDTA, and 1%
Triton X-100) with 1.times. SigmaFAST Protease Inhibitor Cocktail
Tablet, EDTA Free. Protein in the cell lysate was measured using
the micro BCA protein assay kit (Thermo Scientific). All samples
were then normalized to 2 mg/mL (20 ug total protein per lane).
Samples were run on 10% SDS-polyacrylamide gels then transferred
onto Immun-Blot.TM. PVDF Membranes (Bio-Rad). Rabbit polyclonal
anti-QSOX1 (ProteinTech), rabbit polyclonal anti-alpha-tubulin
(Cell Signaling), rabbit polyclonal anti-MMP-2 and -9 (Sigma),
mouse monoclonal caspase 3 (Cell Signalling), and rabbit polyclonal
LC3 (Cell Signalling) antibodies were diluted according to the
manufacturers' instructions and as determined in preliminary
experiments, in 1% BSA in 1.times.TBS+0.01% Tween-20 and incubated
overnight. Goat anti-rabbit or anti-mouse IgG-alkaline phospatase
or HRP secondary antibody was used at a 1:5000 dilution and
incubated with the blot for 1 h followed by washing. BCIP/NBT
substrate (Pierce Chemical, Rockford, Ill.) was added and the blot
was developed at room temperature (RT) for approximately 10 minutes
for alkaline phosphatase secondary antibody. For samples incubated
in goat anti-rabbit or mouse HRP secondary the blots were developed
using Novex ECL Chemiluminescent Substrate Reagent Kit.
Quantification of band intensity was measured using Image J and is
presented as percent change from the scrambled shRNA control. All
gel images were annotated and processed using Photoshop CS3.
MIT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)
Assay
[0213] Cells were seeded at 3.times.10.sup.3 cell/well in a 96-well
plate in triplicate, and incubated at 37.degree. C., 5% CO.sub.2
over the course of 5 days. The MTT assay was performed over a 5 day
period according to the manufacturer's instructions
(Invitrogen-Molecular Probes, Vybrant MTT Cell Proliferation Assay
Kit). Results are presented as mean+/-S.D. Student's two-tailed
t-Test was performed to determine significance.
Trypan Blue Live/Dead Cell Growth Assay
[0214] Cells were seeded at 2.5.times.10.sup.4 cells/well in a
12-well plate in triplicate, and incubated at 37.degree. C., 5%
CO.sub.2 over the course of 5 days. The cells were removed with
Cell Stripper, pelleted and brought back up in 1 mL PBS. A 30 ul
aliquot was then used to determine total cell number. The cells
were stained at a 1:1 ratio with 0.1% Trypan Blue and are reported
as total number of live cells.
RN4 Isolation and cDN4 Synthesis
[0215] Total RNA isolation was performed according to the
manufacturer's instructions for animal cells using spin technology
(RNeasy Mini Kit, Qiagen). After RNA was isolated from each sample
was reverse transcribed with qScript cDNA Sythesis Kit, Quanta
Biosciences according to the manufacturer's instructions.
Quantitative Real Time PCR (qPCR)
[0216] The relative level of GAPDH, QSOX1-L, QSOX1-S, MMP-2 and
MMP-9 were analyzed in each sample by qPCR. Each cDNA sample was
normalized to 100 ng/.mu.l in molecular grade water along with 100
nM final concentration of each primer and 1.times. final
concentration of PerfeCta SYBR Green Fast Mix (Quanta Biosciences,
Gaithersburg, Md., USA). ROX to a final volume of 10 ul. qPCR was
performed using PerfeCTa SYBR Green FastMix, ROX from Quanta
Biosciences (Quanta Biosciences, Gaithersburg, Md., USA) on an
ABI7900HT thermocycler, Applied Biosystems Inc. (Life Technologies,
Grand Island, N.Y., USA) Reaction protocol: initial denaturation
was as follows--95.degree. C. for 3 minutes; PCR Cycling (40
cycles) 1.) 95.degree. C., 30 sec. 2.) 55.degree. C., 30 sec. 3.)
72.degree. C., 1 minute; Melt Curve (Dissociation stage). The
primer sequences for the genes analyzed are: GAPDH Forward
5'-GGCCTCCAAGGAGTAAGACC (SEQ ID NO:30); GAPDH Reverse
5'-AGGGGTCTACATGGCAACTG (SEQ ID NO:31); QSOX1-S Forward
5'-TGGTCTAGCCACAACAGGGTCAAT (SEQ ID NO:32); QSOX11-S Reverse
5'-TGTGGCAGGCAGAACAAAGTTCAC (SEQ ID NO:33); QSOX1-L Forward
5'-TIGCTCCTTGTCTGGCCTAGAAGT (SEQ ID NO:34); QSOX1-L Reverse
5'-TGTGTCAAAGGAGCTCTCTCTGTCCT (SEQ ID NO:35); MMP-2 Forward
5'-TTGACGGTAAGGACGGACTC (SEQ ID NO:36); MMP-2 Reverse
5'-ACTTGCAGTACTCCCCATCG (SEQ ID NO:37); MMP-9 Forward
5'-TTGACAGCGACAAGAAGTGG (SEQ ID NO:38); and MMP-9 Reverse
5'-CCCTCAGTGAAGCGGTACAT. (SEQ ID NO:39). Each reaction was
performed in triplicate with the data representing the averages of
one experiment.
[0217] In the shRNA experiment, expression of MMPs was normalized
to the non-targeted GAPDH to determine .DELTA.Cq. .DELTA.Cq
replicates were then exponentially transformed to the .DELTA.Cq
expression after which they were averaged.+-.standard deviation.
The average was then normalized to the expression of the shScramble
control to obtain the .DELTA..DELTA.Cq expression. Significance was
determined using the Student's two-tailed t-Test.
Boyden Chamber and Invasion Recover Assay
[0218] Invasion assays were performed using BD BioCoat.TM. BD
Matrigel.TM. and non-Matrigel.TM. control Invasion chambers with
8.0 .mu.m pore size polyethylene terephthalate (PET) membrane
inserts in 24-well format. The assay was performed according to the
manufacturer's instructions (BD Bioscience). 4.times.10.sup.4
cells/well were seeded into the inner Matrigel.TM. chamber in serum
free DMEM. The outer chamber contained 10% FBS in DMEM. MCF7, BT474
and BT549 cells were incubated for 72, 48 and 48 hours,
respectively at 37.degree. C., 5% CO.sub.2. For invasion rescue
assays MCF7, BT474 and BT549 cells were incubated with 50 nM rQSOX1
as well as catalytically inactive mutant rQSOX1 (rQSOX1-AA). Cells
that invaded through the Matrigel.TM. and migrated through the
pores onto the bottom of the insert were fixed in 100% methanol and
then stained in hematoxylin (Invitrogen). The total number of
invading cells was determined by counting the cells on the
underside of the insert from triplicate wells (6 fields per insert)
at 20.times. magnification. The extent of invasion was expressed as
the average.+-.standard deviation. Significance was determined
using the Student's two-tailed t-Test. Results presented are from
one of three independent experiments.
Gelatin Zymography
[0219] The identification of MMP was performed using gelatin
zymography. Zymography experiments were performed essentially as
previously described by Katchman et al. Minor changes in the
protocol are the inclusion of untreated MCF7 and BT549 cells as
well as short hairpin-transduced cells were seeded at
5.times.10.sup.5 cells/well (12 well plates) in DMEM with 10% FBS.
The next day, cells were then washed with 1.times.PBS and the media
was changed to serum-free DMEM and incubated for 48 hours instead
of 24 hours before being collected and protein concentrations
determined using a BCA assay. Quantification of band intensity was
measured using Image J and is presented as percent change from the
scrambled shRNA control.
REFERENCE FOR EXAMPLE 4
[0220] 1. Sgroi D C: Preinvasive breast cancer. Annu Rev Pathol
2010, 5:193-221. [0221] 2. Cancer Facts and Figures. American
Cancer Society (ACS); 2012. See the ACS web site
cancer.org/research/cancerfactsfigures/cancerfactsfigures/cancer-facts-fi-
gures-2012 [0222] 3. Siegel R, Naishadham D, Jemal A: Cancer
statistics, 2012. CA Cancer J Clin 2012, 62:10-29. [0223] 4. Antwi
K, Hostetter G, Demeure M, Decker G, Ruiz Y, Sielaff T, Koep L,
Lake D: Analysis of human plasma peptidome reveals potential
biomarker for pancreatic cancer. J Proteome Res 2009, 8:4722-4731.
[0224] 5. Katchman B A, Antwi K, Hostetter G, Demeure M J, Watanabe
A, Decker G A, Miller L J, Von Hoff D D, Lake D F: Qulescin
sulfhydryl oxidase 1 promotes Invasion of pancreatic tumor cells
mediated by matrix metalloproteinases. Mol Cancer Res 2011,
9:1621-1631. [0225] 6. Alon A, Heckler E J, Thorpe C. Fass D: QSOX1
contains a pseudo-dimer of functional and degenerate sulfhydryl
oxidase domains. FEBS Lett 2010, 584:1521-1525. [0226] 7. Coppock D
L, Thorpe C: Multidomain flavin-dependent sulfhydryl oxidases.
Antioxid Redox Signal 2006, 8:300-311. [0227] 8. Heckler E J, Alon
A, Fass D, Thorpe C: Human quiescin-sulfhydryl oxidase, QSOX1:
probing internal redox steps by mutagenesis. Biochemistry 2008,
47:4955-4963. [0228] 9. Chakravarthi S, Jessop C E, Willer M,
Stirling C J, Bulleid N J: Intracellular catalysis of disulfide
bond formation by the human sulfhydryl oxidase, QSOX1. Biochem J
2007, 404:403-411. [0229] 10. Mairet-Coello G, Tury A, Esnard-Feve
A, Fellmann D, Risold P Y, Griffond B: FAD-linked sulfhydryl
oxidase QSOX: topographic, cellular, and subcellular
immunolocalization in adult rat central nervous system. J Comp
Neurol 2004, 473:334-363. [0230] 11. Tury A, Mairet-Coello G,
Poncet F, Jacquemard C, Risold P Y, Fellmann D, Griffond B: QSOX1
sulfhydryl oxidase in rat adenohypophysis: localization and
regulation by estrogens. J Endocrinol 2004, 183:353-363. [0231] 12.
Coppock D L, Cina-Poppe D, Gilleran S: The quiescin Q6 gene (QSCN6)
is a fusion of two ancient gene families: thioredoxin and ERV1.
Genomics 1998, 54:460-468. [0232] 13. Alon A, Grossman I, Gat Y,
Kodali V K, DiMaio F, Mehlman T, Haran G, Baker D, Thorpe C, Fass
D: The dynamic disulphide relay of quiescin sulphydryl oxidase.
Nature 2012, 488:414-418. [0233] 14. Thorpe C, Hoober K L, Raje S,
Glynn N M, Burnside J, Turi G K, Coppock D L: Sulfhydryl oxidases:
emerging catalysts of protein disulfide bond formation in
eukaryotes. Arch Biochem Biophys 2002, 405:1-12. [0234] 15. Song H,
Zhang B, Watson M A, Humphrey P A, Lim H, Milbrandt J: Loss of
Nkx3.1 leads to the activation of discrete downstream target genes
during prostate tumorigenesis. Oncogene 2009, 28:3307-3319. [0235]
16. Sorlie T, Perou C M, Tibshirani R, Aas T, Geisler S. Johnsen H,
Hastie T, Eisen M B, van de Rijn M, Jeffrey S S, Thorsen T, Quist
H, Matese J C, Brown P O, Botstein D, Lonning P E, Borresen-Dale A
L: Gene expression patterns of breast carcinomas distinguish tumor
subclasses with clinical implications. Proc Natl Acad Sci USA 2001,
98:10869-10874. [0236] 17. Ringner M, Fredlund E, Hakkinen J, Borg
A, Staaf J: GOBO: gene expression-based outcome for breast cancer
online. PLoS One 2011, 6:e17911. [0237] 18. Perou C M, Sorlie T,
Eisen M B, van de Rijn M, Jeffrey S S, Rees C A, Pollack J R, Ross
D T, Johnsen H, Akslen L A, Fluge O, Pergamenschikov A, Williams C,
Zhu S X, Lonning P E, Borresen-Dale A L, Brown P O, Botstein D:
Molecular portraits of human breast tumours. Nature 2000,
406:747-752. [0238] 19. Soule H D, Maloney T M, Wolman S R,
Peterson W D Jr, Brenz R, McGrath C M, Russo J, Pauley R J, Jones R
F, Brooks S C: Isolation and characterization of a spontaneously
immortalized human breast epithelial cell line, MCF-10. Cancer Res
1990, 50:6075-6086. [0239] 20. Tait L, Soule H D, Russo J:
Ultrastructural and immunocytochemical characterization of an
immortalized human breast epithelial cell line, MCF-10. Cancer Res
1990, 50:6087-6094. [0240] 21. Morel C, Adami P, Musard J F, Duval
D, Radom J, Jouvenot M: Involvement of sulfhydryl oxidase QSOX1 in
the protection of cells against oxidative stress-Induced apoptosis.
Exp Cell Res 2007, 313:3971-3982. [0241] 22. Plati J, Bucur O,
Khosravi-Far R: Apoptotic cell signaling in cancer progression and
therapy. Integr Biol (Camb) 2011, 3:279-296. [0242] 23. Klionsky D
J: The molecular machinery of autophagy and its role in physiology
and disease. Semin Cell Dev Biol 2010, 21:663. [0243] 24. Radisky E
S, Radisky D C: Matrix metalloproteinase-induced
epithelial-mesenchymal transition in breast cancer. J Mammary Gland
Biol Neoplasia 2010, 15:201-212. [0244] 25. Kohrmann A, Kammerer U,
Kapp M, Dietl J, Anacker J: Expression of matrix metalloproteinases
(MMPs) in primary human breast cancer and breast cancer cell lines:
New findings and review of the literature. BMC cancer 2009, 9:188.
[0245] 26. Khoo B Y, Miswan N, Balaram P, Nadarajan K, Elstner E:
Modification of MCF-10A Cells with Pioglitazone and Serum-Rich
Growth Medium Increases Soluble Factors in the Conditioned Medium,
Likely Reducing BT-474 Cell Growth. Int J Mol Sci 2012,
13:5607-5627. [0246] 27. Hanahan D, Weinberg R A: Hallmarks of
cancer: the next generation. Cell 2011, 144:646-674. [0247] 28.
Polyak K: Heterogeneity in breast cancer. J Clin Invest 2011,
121:3786-3788. [0248] 29. Rizki A, Weaver V M, Lee S Y, Rozenberg G
I, Chin K, Myers C A, Bascom J L, Mott J D, Semeiks J R, Grate L R,
Mian I S, Borowsky A D, Jensen R A. Idowu M O, Chen F, Chen D J,
Petersen O W, Gray J W, Bissell M J: A human breast cell model of
preinvasive to invasive transition. Cancer Res 2008, 68:1378-1387.
[0249] 30. Hu M, Polyak K: Molecular characterisation of the tumour
microenvironment in breast cancer. Eur J Cancer 2008, 44:2760-2765.
[0250] 31. Michor F, Polyak K: The origins and implications of
intratumor heterogeneity. Cancer Prev Res (Phila) 2010,
3:1361-1364. [0251] 32. Bacac M, Stamenkovic I: Metastatic cancer
cell. Annu Rev Pathol 2008, 3:221-247. [0252] 33. Martin K J,
Patrick D R, Bissell M J, Fournier M V: Prognostic breast cancer
signature identified from 3D culture model accurately predicts
clinical outcome across independent datasets. PLoS One 2008,
3:e2994. [0253] 34. Kessenbrock K, Plaks V, Werb Z: Matrix
metalloproteinases: regulators of the tumor microenvironment. Cell,
141:52-67. [0254] 35. Bauvois B: New facets of matrix
metalloproteinases MMP-2 and MMP-9 as cell surface transducers:
outside-in signaling and relationship to tumor progression. Biochim
Biophys Acta 2012, 1825:29-36. [0255] 36. Jin Q, Yuan L X, Boulbes
D, Baek J M, Wang Y N, Gomez-Cabello D, Hawke D H, Yeung S C, Lee M
H, Hortobagyi G N, Hung M C, Esteva F J: Fatty acid synthase
phosphorylation: a novel therapeutic target in HER2-overexpressing
breast cancer cells. Breast Cancer Res 2010, 12:R96. [0256] 37.
Portes K F, Ikegami C M, Getz J, Martins A P, de Noronha L,
Zischler L F, Klassen G, Camargo A A, Zanata S M, Bevilacqua E,
Nakao L S: Tissue distribution of quiescin Q6/sulfhydryl oxidase
(QSOX) in developing mouse. J Mol Histol 2008, 39:217-225.
Sequence CWU 1
1
4111815DNAHomo sapiens 1atgaggaggt gcaacagcgg ctccgggccg ccgccgtcgc
tgctgctgct gctgctgtgg 60ctgctcgcgg ttcccggcgc taacgcggcc ccgcggtcgg
cgctctattc gccttccgac 120ccgctgacgc tgctgcaggc ggacacggtg
cgcggcgcgg tgctgggctc ccgcagcgcc 180tgggccgtgg agttcttcgc
ctcctggtgc ggccactgca tcgccttcgc cccgacgtgg 240aaggcgctgg
ccgaagacgt caaagcctgg aggccggccc tgtatctcgc cgccctggac
300tgtgctgagg agaccaacag tgcagtctgc agagacttca acatccctgg
cttcccgact 360gtgaggttct tcaaggcctt taccaagaac ggctcgggag
cagtatttcc agtggctggt 420gctgacgtgc agacactgcg ggagaggctc
attgacgccc tggagtccca tcatgacacg 480tggcccccag cctgtccccc
actggagcct gccaagctgg aggagattga tggattcttt 540gcgagaaata
acgaagagta cctggctctg atctttgaaa agggaggctc ctacctgggt
600agagaggtgg ctctggacct gtcccagcac aaaggcgtgg cggtgcgcag
ggtgctgaac 660acagaggcca atgtggtgag aaagtttggt gtcaccgact
tcccctcttg ctacctgctg 720ttccggaatg gctctgtctc ccgagtcccc
gtgctcatgg aatccaggtc cttctatacc 780gcttacctgc agagactctc
tgggctcacc agggaggctg cccagaccac agttgcacca 840accactgcta
acaagatagc tcccactgtt tggaaattgg cagatcgctc caagatctac
900atggctgacc tggaatctgc actgcactac atcctgcgga tagaagtggg
caggttcccg 960gtcctggaag ggcagcgcct ggtggccctg aaaaagtttg
tggcagtgct ggccaagtat 1020ttccctggcc ggcccttagt ccagaacttc
ctgcactccg tgaatgaatg gctcaagagg 1080cagaagagaa ataaaattcc
ctacagtttc tttaaaactg ccctggacga caggaaagag 1140ggtgccgttc
ttgccaagaa ggtgaactgg attggctgcc aggggagtga gccgcatttc
1200cggggctttc cctgctccct gtgggtcctc ttccacttct tgactgtgca
ggcagctcgg 1260caaaatgtag accactcaca ggaagcagcc aaggccaagg
aggtcctccc agccatccga 1320ggctacgtgc actacttctt cggctgccga
gactgcgcta gccacttcga gcagatggct 1380gctgcctcca tgcaccgggt
ggggagtccc aacgccgctg tcctctggct ctggtctagc 1440cacaacaggg
tcaatgctcg ccttgcaggt gcccccagcg aggaccccca gttccccaag
1500gtgcagtggc caccccgtga actttgttct gcctgccaca atgaacgcct
ggatgtgccc 1560gtgtgggacg tggaagccac cctcaacttc ctcaaggccc
acttctcccc aagcaacatc 1620atcctggact tccctgcagc tgggtcagct
gcccggaggg atgtgcagaa tgtggcagcc 1680gccccagagc tggcgatggg
agccctggag ctggaaagcc ggaattcaac tctggaccct 1740gggaagcctg
agatgatgaa gtcccccaca aacaccaccc cacatgtgcc ggctgaggga
1800cctgagctta tttga 181522244DNAHomo sapiens 2atgaggaggt
gcaacagcgg ctccgggccg ccgccgtcgc tgctgctgct gctgctgtgg 60ctgctcgcgg
ttcccggcgc taacgcggcc ccgcggtcgg cgctctattc gccttccgac
120ccgctgacgc tgctgcaggc ggacacggtg cgcggcgcgg tgctgggctc
ccgcagcgcc 180tgggccgtgg agttcttcgc ctcctggtgc ggccactgca
tcgccttcgc cccgacgtgg 240aaggcgctgg ccgaagacgt caaagcctgg
aggccggccc tgtatctcgc cgccctggac 300tgtgctgagg agaccaacag
tgcagtctgc agagacttca acatccctgg cttcccgact 360gtgaggttct
tcaaggcctt taccaagaac ggctcgggag cagtatttcc agtggctggt
420gctgacgtgc agacactgcg ggagaggctc attgacgccc tggagtccca
tcatgacacg 480tggcccccag cctgtccccc actggagcct gccaagctgg
aggagattga tggattcttt 540gcgagaaata acgaagagta cctggctctg
atctttgaaa agggaggctc ctacctgggt 600agagaggtgg ctctggacct
gtcccagcac aaaggcgtgg cggtgcgcag ggtgctgaac 660acagaggcca
atgtggtgag aaagtttggt gtcaccgact tcccctcttg ctacctgctg
720ttccggaatg gctctgtctc ccgagtcccc gtgctcatgg aatccaggtc
cttctatacc 780gcttacctgc agagactctc tgggctcacc agggaggctg
cccagaccac agttgcacca 840accactgcta acaagatagc tcccactgtt
tggaaattgg cagatcgctc caagatctac 900atggctgacc tggaatctgc
actgcactac atcctgcgga tagaagtggg caggttcccg 960gtcctggaag
ggcagcgcct ggtggccctg aaaaagtttg tggcagtgct ggccaagtat
1020ttccctggcc ggcccttagt ccagaacttc ctgcactccg tgaatgaatg
gctcaagagg 1080cagaagagaa ataaaattcc ctacagtttc tttaaaactg
ccctggacga caggaaagag 1140ggtgccgttc ttgccaagaa ggtgaactgg
attggctgcc aggggagtga gccgcatttc 1200cggggctttc cctgctccct
gtgggtcctc ttccacttct tgactgtgca ggcagctcgg 1260caaaatgtag
accactcaca ggaagcagcc aaggccaagg aggtcctccc agccatccga
1320ggctacgtgc actacttctt cggctgccga gactgcgcta gccacttcga
gcagatggct 1380gctgcctcca tgcaccgggt ggggagtccc aacgccgctg
tcctctggct ctggtctagc 1440cacaacaggg tcaatgctcg ccttgcaggt
gcccccagcg aggaccccca gttccccaag 1500gtgcagtggc caccccgtga
actttgttct gcctgccaca atgaacgcct ggatgtgccc 1560gtgtgggacg
tggaagccac cctcaacttc ctcaaggccc acttctcccc aagcaacatc
1620atcctggact tccctgcagc tgggtcagct gcccggaggg atgtgcagaa
tgtggcagcc 1680gccccagagc tggcgatggg agccctggag ctggaaagcc
ggaattcaac tctggaccct 1740gggaagcctg agatgatgaa gtcccccaca
aacaccaccc cacatgtgcc ggctgaggga 1800cctgaggcaa gtcgaccccc
gaagctgcac cctggcctca gagctgcacc aggccaggag 1860cctcctgagc
acatggcaga gcttcagagg aatgagcagg agcagccgct tgggcagtgg
1920cacttgagca agcgagacac aggggctgca ttgctggctg agtccagggc
tgagaagaac 1980cgcctctggg gccctttgga ggtcaggcgc gtgggccgca
gctccaagca gctggtcgac 2040atccctgagg gccagctgga ggcccgagct
ggacggggcc gaggccagtg gctgcaggtg 2100ctgggagggg gcttctctta
cctggacatc agcctctgtg tggggctcta ttccctgtcc 2160ttcatgggcc
tgctggccat gtacacctac ttccaggcca agataagggc cctgaagggc
2220catgctggcc accctgcagc ctga 2244313PRTArtificial
SequenceSynthetic 3Asn Glu Gln Glu Gln Pro Leu Gly Gln Trp His Leu
Ser 1 5 10 411PRTArtificial SequenceSynthetic 4Asn Glu Gln Glu Gln
Pro Leu Gly Gln Trp His 1 5 10 510PRTArtificial SequenceSynthetic
5Glu Gln Pro Leu Gly Gln Trp His Leu Ser 1 5 10 616PRTArtificial
SequenceSynthetic 6Ala Ala Pro Gly Gln Glu Pro Pro Glu His Met Ala
Glu Leu Gln Arg 1 5 10 15 715PRTArtificial SequenceSynthetic 7Ala
Ala Pro Gly Gln Glu Pro Pro Glu His Met Ala Glu Leu Gln 1 5 10 15
829PRTArtificial SequenceSynthetic 8Ala Ala Pro Gly Gln Glu Pro Pro
Glu His Met Ala Glu Leu Gln Arg 1 5 10 15 Asn Glu Gln Glu Gln Pro
Leu Gly Gln Trp His Leu Ser 20 25 97PRTArtificial SequenceSynthetic
9Asn Glu Gln Glu Gln Pro Leu 1 5 106PRTArtificial SequenceSynthetic
10Gly Gln Trp His Leu Ser 1 5 1121DNAArtificial
SequenceSyntheticmisc_feature(2)..(2)n is t or
umisc_feature(4)..(4)n is t or umisc_feature(8)..(8)n is t or
umisc_feature(12)..(12)n is t or umisc_feature(17)..(17)n is t or u
11ancnacangg cngaccngga a 211221DNAArtificial
SequenceSyntheticmisc_feature(12)..(12)n is t or
umisc_feature(17)..(18)n is t or umisc_feature(20)..(21)n is t or u
12aggaaagagg gngccgnncn n 211321DNAArtificial
SequenceSyntheticmisc_feature(6)..(6)n is t or
umisc_feature(8)..(8)n is t or umisc_feature(11)..(11)n is t or
umisc_feature(19)..(21)n is t or u 13gccaangngg ngagaaagnn n
211421DNAArtificial SequenceSyntheticmisc_feature(11)..(11)n is t
or umisc_feature(16)..(16)n is t or umisc_feature(20)..(21)n is t
or u 14gccaagaagg ngaacnggan n 211521DNAArtificial
SequenceSyntheticmisc_feature(9)..(9)n is t or
umisc_feature(19)..(21)n is t or u 15ccggacaang aagaagccnn n
211621DNAArtificial SequenceSyntheticmisc_feature(1)..(1)n is t or
umisc_feature(3)..(3)n is t or umisc_feature(17)..(17)n is t or
umisc_feature(21)..(21)n is t or u 16ncnagccaca acagggncaa n
211721DNAArtificial SequenceSynthetic 17atctacatgg ctgacctgga a
211821DNAArtificial SequenceSynthetic 18aggaaagagg gtgccgttct t
211921DNAArtificial SequenceSynthetic 19gccaatgtgg tgagaaagtt t
212021DNAArtificial SequenceSynthetic 20gccaagaagg tgaactggat t
212121DNAArtificial SequenceSynthetic 21ccggacaatg aagaagcctt t
212221DNAArtificial SequenceSynthetic 22tctagccaca acagggtcaa t
212358DNAArtificial SequenceSyntheticmisc_feature(5)..(25)n is any
nucleic acid 23ccggnnnnnn nnnnnnnnnn nnnnnctcga gaaactttct
caccacattg gctttttg 5824747PRTHomo sapiens 24Met Arg Arg Cys Asn
Ser Gly Ser Gly Pro Pro Pro Ser Leu Leu Leu 1 5 10 15 Leu Leu Leu
Trp Leu Leu Ala Val Pro Gly Ala Asn Ala Ala Pro Arg 20 25 30 Ser
Ala Leu Tyr Ser Pro Ser Asp Pro Leu Thr Leu Leu Gln Ala Asp 35 40
45 Thr Val Arg Gly Ala Val Leu Gly Ser Arg Ser Ala Trp Ala Val Glu
50 55 60 Phe Phe Ala Ser Trp Cys Gly His Cys Ile Ala Phe Ala Pro
Thr Trp 65 70 75 80 Lys Ala Leu Ala Glu Asp Val Lys Ala Trp Arg Pro
Ala Leu Tyr Leu 85 90 95 Ala Ala Leu Asp Cys Ala Glu Glu Thr Asn
Ser Ala Val Cys Arg Asp 100 105 110 Phe Asn Ile Pro Gly Phe Pro Thr
Val Arg Phe Phe Lys Ala Phe Thr 115 120 125 Lys Asn Gly Ser Gly Ala
Val Phe Pro Val Ala Gly Ala Asp Val Gln 130 135 140 Thr Leu Arg Glu
Arg Leu Ile Asp Ala Leu Glu Ser His His Asp Thr 145 150 155 160 Trp
Pro Pro Ala Cys Pro Pro Leu Glu Pro Ala Lys Leu Glu Glu Ile 165 170
175 Asp Gly Phe Phe Ala Arg Asn Asn Glu Glu Tyr Leu Ala Leu Ile Phe
180 185 190 Glu Lys Gly Gly Ser Tyr Leu Gly Arg Glu Val Ala Leu Asp
Leu Ser 195 200 205 Gln His Lys Gly Val Ala Val Arg Arg Val Leu Asn
Thr Glu Ala Asn 210 215 220 Val Val Arg Lys Phe Gly Val Thr Asp Phe
Pro Ser Cys Tyr Leu Leu 225 230 235 240 Phe Arg Asn Gly Ser Val Ser
Arg Val Pro Val Leu Met Glu Ser Arg 245 250 255 Ser Phe Tyr Thr Ala
Tyr Leu Gln Arg Leu Ser Gly Leu Thr Arg Glu 260 265 270 Ala Ala Gln
Thr Thr Val Ala Pro Thr Thr Ala Asn Lys Ile Ala Pro 275 280 285 Thr
Val Trp Lys Leu Ala Asp Arg Ser Lys Ile Tyr Met Ala Asp Leu 290 295
300 Glu Ser Ala Leu His Tyr Ile Leu Arg Ile Glu Val Gly Arg Phe Pro
305 310 315 320 Val Leu Glu Gly Gln Arg Leu Val Ala Leu Lys Lys Phe
Val Ala Val 325 330 335 Leu Ala Lys Tyr Phe Pro Gly Arg Pro Leu Val
Gln Asn Phe Leu His 340 345 350 Ser Val Asn Glu Trp Leu Lys Arg Gln
Lys Arg Asn Lys Ile Pro Tyr 355 360 365 Ser Phe Phe Lys Thr Ala Leu
Asp Asp Arg Lys Glu Gly Ala Val Leu 370 375 380 Ala Lys Lys Val Asn
Trp Ile Gly Cys Gln Gly Ser Glu Pro His Phe 385 390 395 400 Arg Gly
Phe Pro Cys Ser Leu Trp Val Leu Phe His Phe Leu Thr Val 405 410 415
Gln Ala Ala Arg Gln Asn Val Asp His Ser Gln Glu Ala Ala Lys Ala 420
425 430 Lys Glu Val Leu Pro Ala Ile Arg Gly Tyr Val His Tyr Phe Phe
Gly 435 440 445 Cys Arg Asp Cys Ala Ser His Phe Glu Gln Met Ala Ala
Ala Ser Met 450 455 460 His Arg Val Gly Ser Pro Asn Ala Ala Val Leu
Trp Leu Trp Ser Ser 465 470 475 480 His Asn Arg Val Asn Ala Arg Leu
Ala Gly Ala Pro Ser Glu Asp Pro 485 490 495 Gln Phe Pro Lys Val Gln
Trp Pro Pro Arg Glu Leu Cys Ser Ala Cys 500 505 510 His Asn Glu Arg
Leu Asp Val Pro Val Trp Asp Val Glu Ala Thr Leu 515 520 525 Asn Phe
Leu Lys Ala His Phe Ser Pro Ser Asn Ile Ile Leu Asp Phe 530 535 540
Pro Ala Ala Gly Ser Ala Ala Arg Arg Asp Val Gln Asn Val Ala Ala 545
550 555 560 Ala Pro Glu Leu Ala Met Gly Ala Leu Glu Leu Glu Ser Arg
Asn Ser 565 570 575 Thr Leu Asp Pro Gly Lys Pro Glu Met Met Lys Ser
Pro Thr Asn Thr 580 585 590 Thr Pro His Val Pro Ala Glu Gly Pro Glu
Ala Ser Arg Pro Pro Lys 595 600 605 Leu His Pro Gly Leu Arg Ala Ala
Pro Gly Gln Glu Pro Pro Glu His 610 615 620 Met Ala Glu Leu Gln Arg
Asn Glu Gln Glu Gln Pro Leu Gly Gln Trp 625 630 635 640 His Leu Ser
Lys Arg Asp Thr Gly Ala Ala Leu Leu Ala Glu Ser Arg 645 650 655 Ala
Glu Lys Asn Arg Leu Trp Gly Pro Leu Glu Val Arg Arg Val Gly 660 665
670 Arg Ser Ser Lys Gln Leu Val Asp Ile Pro Glu Gly Gln Leu Glu Ala
675 680 685 Arg Ala Gly Arg Gly Arg Gly Gln Trp Leu Gln Val Leu Gly
Gly Gly 690 695 700 Phe Ser Tyr Leu Asp Ile Ser Leu Cys Val Gly Leu
Tyr Ser Leu Ser 705 710 715 720 Phe Met Gly Leu Leu Ala Met Tyr Thr
Tyr Phe Gln Ala Lys Ile Arg 725 730 735 Ala Leu Lys Gly His Ala Gly
His Pro Ala Ala 740 745 25604PRTHomo sapiens 25Met Arg Arg Cys Asn
Ser Gly Ser Gly Pro Pro Pro Ser Leu Leu Leu 1 5 10 15 Leu Leu Leu
Trp Leu Leu Ala Val Pro Gly Ala Asn Ala Ala Pro Arg 20 25 30 Ser
Ala Leu Tyr Ser Pro Ser Asp Pro Leu Thr Leu Leu Gln Ala Asp 35 40
45 Thr Val Arg Gly Ala Val Leu Gly Ser Arg Ser Ala Trp Ala Val Glu
50 55 60 Phe Phe Ala Ser Trp Cys Gly His Cys Ile Ala Phe Ala Pro
Thr Trp 65 70 75 80 Lys Ala Leu Ala Glu Asp Val Lys Ala Trp Arg Pro
Ala Leu Tyr Leu 85 90 95 Ala Ala Leu Asp Cys Ala Glu Glu Thr Asn
Ser Ala Val Cys Arg Asp 100 105 110 Phe Asn Ile Pro Gly Phe Pro Thr
Val Arg Phe Phe Lys Ala Phe Thr 115 120 125 Lys Asn Gly Ser Gly Ala
Val Phe Pro Val Ala Gly Ala Asp Val Gln 130 135 140 Thr Leu Arg Glu
Arg Leu Ile Asp Ala Leu Glu Ser His His Asp Thr 145 150 155 160 Trp
Pro Pro Ala Cys Pro Pro Leu Glu Pro Ala Lys Leu Glu Glu Ile 165 170
175 Asp Gly Phe Phe Ala Arg Asn Asn Glu Glu Tyr Leu Ala Leu Ile Phe
180 185 190 Glu Lys Gly Gly Ser Tyr Leu Gly Arg Glu Val Ala Leu Asp
Leu Ser 195 200 205 Gln His Lys Gly Val Ala Val Arg Arg Val Leu Asn
Thr Glu Ala Asn 210 215 220 Val Val Arg Lys Phe Gly Val Thr Asp Phe
Pro Ser Cys Tyr Leu Leu 225 230 235 240 Phe Arg Asn Gly Ser Val Ser
Arg Val Pro Val Leu Met Glu Ser Arg 245 250 255 Ser Phe Tyr Thr Ala
Tyr Leu Gln Arg Leu Ser Gly Leu Thr Arg Glu 260 265 270 Ala Ala Gln
Thr Thr Val Ala Pro Thr Thr Ala Asn Lys Ile Ala Pro 275 280 285 Thr
Val Trp Lys Leu Ala Asp Arg Ser Lys Ile Tyr Met Ala Asp Leu 290 295
300 Glu Ser Ala Leu His Tyr Ile Leu Arg Ile Glu Val Gly Arg Phe Pro
305 310 315 320 Val Leu Glu Gly Gln Arg Leu Val Ala Leu Lys Lys Phe
Val Ala Val 325 330 335 Leu Ala Lys Tyr Phe Pro Gly Arg Pro Leu Val
Gln Asn Phe Leu His 340 345 350 Ser Val Asn Glu Trp Leu Lys Arg Gln
Lys Arg Asn Lys Ile Pro Tyr 355 360 365 Ser Phe Phe Lys Thr Ala Leu
Asp Asp Arg Lys Glu Gly Ala Val Leu 370 375 380 Ala Lys Lys Val Asn
Trp Ile Gly Cys Gln Gly Ser Glu Pro His Phe 385 390 395 400 Arg Gly
Phe Pro Cys Ser Leu Trp Val Leu Phe His Phe Leu Thr Val 405 410 415
Gln Ala Ala Arg Gln Asn Val Asp His Ser Gln Glu Ala Ala Lys Ala 420
425 430 Lys Glu Val Leu Pro Ala Ile Arg Gly Tyr Val His Tyr Phe Phe
Gly 435 440 445 Cys Arg Asp Cys Ala Ser His Phe Glu Gln Met Ala Ala
Ala Ser Met 450 455 460 His Arg Val Gly Ser Pro Asn Ala Ala Val Leu
Trp Leu Trp Ser Ser 465 470 475 480 His Asn Arg Val Asn Ala Arg Leu
Ala Gly Ala
Pro Ser Glu Asp Pro 485 490 495 Gln Phe Pro Lys Val Gln Trp Pro Pro
Arg Glu Leu Cys Ser Ala Cys 500 505 510 His Asn Glu Arg Leu Asp Val
Pro Val Trp Asp Val Glu Ala Thr Leu 515 520 525 Asn Phe Leu Lys Ala
His Phe Ser Pro Ser Asn Ile Ile Leu Asp Phe 530 535 540 Pro Ala Ala
Gly Ser Ala Ala Arg Arg Asp Val Gln Asn Val Ala Ala 545 550 555 560
Ala Pro Glu Leu Ala Met Gly Ala Leu Glu Leu Glu Ser Arg Asn Ser 565
570 575 Thr Leu Asp Pro Gly Lys Pro Glu Met Met Lys Ser Pro Thr Asn
Thr 580 585 590 Thr Pro His Val Pro Ala Glu Gly Pro Glu Leu Ile 595
600 2658DNAArtificial SequenceSynthetic 26ccgggccaat gtggtgagaa
agtttctcga gaaactttct caccacattg gctttttg 582721DNAArtificial
SequenceSynthetic 27ccggacaatg aagaagcctt t 212821DNAArtificial
SequenceSynthetic 28tctagccaca acagggtcaa t 212921DNAArtificial
SequenceSynthetic 29tccgtggtgg acagccacat g 213020DNAArtificial
SequenceSynthetic 30ggcctccaag gagtaagacc 203120DNAArtificial
SequenceSynthetic 31aggggtctac atggcaactg 203224DNAArtificial
SequenceSynthetic 32tggtctagcc acaacagggt caat 243324DNAArtificial
SequenceSynthetic 33tgtggcaggc agaacaaagt tcac 243424DNAArtificial
SequenceSynthetic 34ttgctccttg tctggcctag aagt 243526DNAArtificial
SequenceSynthetic 35tgtgtcaaag gagctctctc tgtcct
263620DNAArtificial SequenceSynthetic 36ttgacggtaa ggacggactc
203720DNAArtificial SequenceSynthetic 37acttgcagta ctccccatcg
203820DNAArtificial SequenceSynthetic 38ttgacagcga caagaagtgg
203920DNAArtificial SequenceSynthetic 39ccctcagtga agcggtacat
204021DNAArtificial SequenceSynthetic 40atctacatgg ctgacctgga a
214121DNAArtificial SequenceSynthetic 41aggaaagagg gtgccgttct t
21
* * * * *
References