U.S. patent application number 15/816454 was filed with the patent office on 2018-07-05 for methods and compositions for treating hiv.
The applicant listed for this patent is Prospect Chartercare, LLC. Invention is credited to Richard P. JUNGHANS, Nithianandan SELLIAH.
Application Number | 20180185416 15/816454 |
Document ID | / |
Family ID | 44799314 |
Filed Date | 2018-07-05 |
United States Patent
Application |
20180185416 |
Kind Code |
A1 |
JUNGHANS; Richard P. ; et
al. |
July 5, 2018 |
METHODS AND COMPOSITIONS FOR TREATING HIV
Abstract
The invention features nucleic acid constructs encoding chimeric
immune T-Cell receptors (CIRs) that are useful for treating HIV in
patients. In general, the CIRs contain an extracellular domain
which targets HIV or HIV infected cells (e.g., the extracellular
domain of CD4), a transmembrane domain, and a cytoplasmic domain
for mediating T-Cell activation (e.g. CD3 zeta and/or the partical
extracellular domain of CD28). The invention also features the use
of host cells expressing CIRs in the treatment of HIV.
Inventors: |
JUNGHANS; Richard P.;
(Boston, MA) ; SELLIAH; Nithianandan; (Providence,
RI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Prospect Chartercare, LLC |
Providence |
RI |
US |
|
|
Family ID: |
44799314 |
Appl. No.: |
15/816454 |
Filed: |
November 17, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13641245 |
Apr 5, 2013 |
9833480 |
|
|
PCT/US2011/032455 |
Apr 14, 2011 |
|
|
|
15816454 |
|
|
|
|
61324050 |
Apr 14, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/1774 20130101;
A61K 35/30 20130101; C07K 2319/33 20130101; C12N 2799/027 20130101;
C07K 2319/90 20130101; A61K 35/26 20130101; C07K 14/70514 20130101;
C07K 2319/735 20130101; C07K 2319/03 20130101; C07K 2319/74
20130101; A61K 48/00 20130101; C07K 14/70521 20130101; A61K
2035/124 20130101; C07K 14/7051 20130101; A61P 31/18 20180101 |
International
Class: |
A61K 35/30 20060101
A61K035/30; C07K 14/73 20060101 C07K014/73 |
Goverment Interests
STATEMENT AS TO FEDERALLY FUNDED RESEARCH
[0002] This work was supported by grant number NIH R21,
1R21AI076145-01 from the United States National Institutes of
Health. The Government has certain rights in the invention.
Claims
1. A nucleic acid construct encoding a chimeric protein comprising
(i) an extracellular domain of CD4, or a fragment thereof, (ii) a
transmembrane domain, and (iii) a cytoplasmic domain comprising a)
the cytoplasmic domain of the CD3 zeta chain, or a fragment thereof
and b) the cytoplasmic domain of CD28, or a fragment thereof.
2. The nucleic acid construct of claim 1, wherein said chimeric
protein is capable of forming a homodimer when expressed in a T
cell.
3. The nucleic acid construct of claim 2, wherein the dimerized
chimeric proteins are capable of forming at least one disulfide
bond.
4. The nucleic acid construct of claim 1, wherein said
transmembrane domain comprises a polypeptide selected from the
group consisting of the transmembrane domain of the CD3 zeta chain
and the transmembrane domain of CD28.
5. The nucleic acid construct of claim 4, wherein said
transmembrane domain comprises amino acids 7-30 of SEQ 10 NO:3.
6. (canceled)
7. The nucleic acid construct of claim 1, wherein said
extracellular domain of CD4 comprises amino acids 1-372 of SEQ 10
NO:1.
8. The nucleic acid construct of claim 1, wherein said cytoplasmic
domain of the CD3 zeta chain comprises amino acids 31-142 of SEQ 10
NO:3.
9. The nucleic acid construct of claim 1, wherein said cytoplasmic
domain of CD28 comprises amino acids 127-234 of SEQ 10 NO:2.
10. The nucleic acid construct of claim 1, wherein said cytoplasmic
domain comprises the amino acid sequence of SEQ ID NO:10.
11. A nucleic acid construct encoding a chimeric protein comprising
(i) an extracellular domain of CD4, or a fragment thereof, (ii) a
transmembrane domain, and (iii) a cytoplasmic domain of the CD3
zeta chain, or a fragment thereof, wherein said chimeric protein is
capable of forming a homodimer when expressed in a T cell.
12. The nucleic acid construct of claim 11, wherein the chimeric
protein, when in a homodimer, is capable of forming at least one
disulfide bond with the chimeric protein with which it is
dimerized.
13. The nucleic acid construct of claim 11, wherein said
transmembrane domain comprises the transmembrane domain of the CD3
zeta chain or the transmembrane domain of CD28.
14. The nucleic acid construct of claim 13, wherein said
transmembrane domain comprises amino acids 7-30 of SEQ ID NO:3.
15. (canceled)
16. The nucleic acid construct of claim 11, wherein said
extracellular domain of CD4 comprises amino acids 1-372 of SEQ ID
NO:1.
17. The nucleic acid construct of claim 11, wherein said
cytoplasmic domain of the CD3 zeta chain comprises amino acids
31-142 of SEQ ID NO:3.
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. A host cell comprising the nucleic acid construct of claim 1
and a nucleic acid construct encoding an siRNA.
26. The host cell of claim 25, wherein said siRNA is against
CCR5.
27. The host cell of claim 25, wherein said siRNA is against
Tat/Rev.
28. A method of treating a patient infected with HIV by
administering a composition comprising host cell of claim 22.
29. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional
Application No. 61/324,050, filed Apr. 14, 2010, which is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0003] The invention relates to the field of treating HIV with
modified T-cells.
[0004] In 1984, HIV was shown to be the etiologic agent of AIDS.
Since that time, the definition of AIDS has been revised a number
of times with regard to what criteria should be included in the
diagnosis. However, despite the fluctuation in diagnostic
parameters, the simple common denominator of AIDS is the infection
with HIV and subsequent development of persistent constitutional
symptoms and AIDS-defining diseases such as a secondary infections,
neoplasms, and neurologic disease.
[0005] HIV is a human retrovirus of the lentivirus group. The four
recognized human retroviruses belong to two distinct groups: the
human T lymphotropic (or leukemia) retroviruses, HTLV-1 and HTLV-2,
and the human immunodeficiency viruses, HIV-1 and HIV-2. The former
are transforming viruses whereas the latter are cytopathic
viruses.
[0006] HIV-1 has been identified as the most common cause of AIDS
throughout the world. Sequence identity between HIV-2 and HIV-1 is
about 40%, with HIV-2 being more closely related to some members of
a group of simian immunodeficiency viruses (SIV).
[0007] The main cause of the immune defect in AIDS has been
identified as a quantitative and qualitative deficiency in the
subset of thymus-derived (T) lymphocytes, the T4 population. This
subset of cells is defined phenotypically by the presence of the
CD4 surface molecule, which has been demonstrated to be the
cellular receptor for HIV. Although the T4 cell is the major cell
type infected with HIV, essentially any human cell that expresses
the CD4 molecule on its surface is capable of binding to and being
infected with HIV.
[0008] Previous attempts to treat patients with "designer" T-cells
expressing chimeric immune receptors (CIRs) proved unsuccessful.
There exists a need in the art for new therapies for HIV. The
present invention addresses this issue and offers advantages over
previous attempted therapies.
SUMMARY OF THE INVENTION
[0009] In one aspect, the invention features a nucleic acid
construct encoding a chimeric protein that includes (i) an
extracellular domain of CD4 (e.g., amino acids 1-372 of SEQ ID
NO:1) or a fragment thereof, (ii) a transmembrane domain, and (iii)
a cytoplasmic domain that includes the cytoplasmic domain of the
CD3 zeta chain (e.g., a polypeptide having the amino acids 31-142
of SEQ ID NO:3), or a fragment thereof, and the cytoplasmic domain
of CD28 (e.g., a polypeptide having amino acids 127-234 of SEQ ID
NO:2), or a fragment thereof. In one embodiment, the cytoplasmic
domain has the amino acid sequence of SEQ ID NO:10.
[0010] In another aspect, the invention features a nucleic acid
construct encoding a chimeric protein that includes (i) an
extracellular domain of CD4 (e.g., a polypeptide having amino acids
1-372 of SEQ ID NO:1) or a fragment thereof, (ii) a transmembrane
domain, and (iii) a cytoplasmic domain of the CD3 zeta chain (e.g.,
a polypeptide having the amino acids 31-142 of SEQ ID NO:3), or a
fragment thereof.
[0011] In either of the foregoing aspects, the chimeric protein can
be capable of forming a homodimer when expressed in a T-cell, e.g.,
through the formation of a disulfide bond.
[0012] Also in either of the foregoing aspects, the transmembrane
domain can be the transmembrane domain of the CD3 zeta chain (e.g,
a polypeptide having amino acids 7-30 of SEQ ID NO:3) or the
transmembrane/partial extracellular domain of CD28.
[0013] Also in either of the foregoing aspects, the chimeric
protein can include a c-myc tag (e.g., at the N-terminus).
[0014] In another aspect, the invention features a vector including
any of the nucleic acid constructs described above. This vector can
also include a nucleic acid construct encoding an siRNA (e.g.,
against CCR5 or against Tat/Rev).
[0015] In yet another aspect, the invention features a host cell
(e.g., a T-cell derived from an uninfected patient or T-cell
derived from a patient infected with HIV) containing any of the
above nucleic acid constructs or vectors. This host cell can also
include a nucleic acid construct encoding an siRNA (e.g., against
CCR5 or against Tat/Rev).
[0016] In another aspect, the invention features a method of
treating a patient infected with HIV (e.g., HIV-1 or HIV-2) by
administering a composition including any of the foregoing host
cells. In this aspect, the host cell can be isolated from the
patient being treated or from another patient.
[0017] By "specifically binds" is meant an extracellular domain
which recognizes and binds an HIV protein, but that does not
substantially recognize and bind other molecules in a sample, e.g.,
a human blood sample.
[0018] By "treating" is meant ameliorating a condition or
symptom(s) of the condition (e.g., the symptoms of HIV infection).
To "treat HIV" or refers to administering a treatment to a subject
infected with HIV to improve the subject's condition. As compared
with an equivalent untreated control, such amelioration or degree
of treatment is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 95%, 99%, or 100%, as measured by the subject's HIV viral
load.
[0019] By "vector" is meant a DNA molecule, usually derived from a
plasmid or bacteriophage, into which fragments of DNA may be
inserted or cloned. A recombinant vector will contain one or more
unique restriction sites, and may be capable of autonomous
replication in a defined host or vehicle organism such that the
cloned sequence is reproducible. A vector contains a promoter
operably-linked to a gene or coding region such that, upon
transfection into a recipient cell, an RNA or an encoded protein or
is expressed.
[0020] By "host T-cell" is meant a cell (e.g., a human T-cell
isolated from a subject) into which one or more nucleic acid
constructs is introduced.
[0021] By "chimeric immune T-cell receptor" or "CIR" is meant a
fusion protein which, when expressed in a host T cell, contains an
extracellular domain that specifically binds to a target protein
and a cytoplasmic domain that modulates activation of the host
T-cell.
[0022] By "CD4 extracellular domain" is meant a polypeptide having
the N-terminal region of CD4 that is located outside the cell
membrane when expressed in a T-cell, e.g., a polypeptide having the
amino acid sequence of amino acids 1-372 of SEQ ID NO:1. The term
"CD4 extracellular domain" is also meant to include any polypeptide
fragment that binds specifically to gp120 and is substantially
identical to amino acids 1-372 of SEQ ID NO:1 over the length of
the polypeptide fragment.
TABLE-US-00001 Human CD4 Amino Acid sequence SEQ ID NO: 1 LOCUS
NP_000607 458 aa linear PRI 18-MAR-2010 DEFINITION T-cell surface
glycoprotein CD4 precursor [Homo sapiens]. ACCESSION NP_000607
VERSION NP_000607.1 GI: 10835167 DBSOURCE REFSEQ: accession
NM_000616.3 1 MNRGVPFRHL LLVLQLALLP AATQGKKVVL GKKGDTVELT
CTASQKKSIQ FHWKNSNQIK 61 ILGNQGSFLT KGPSKLNDRA DSRRSLWDQG
NFPLIIKNLK IEDSDTYICE VEDQKEEVQL 121 LVFGLTANSD THLLQGQSLT
LTLESPPGSS PSVQCRSPRG KNIQGGKTLS VSQLELQDSG 181 TWTCTVLQNQ
KKVEFKIDIV VLAFQKASSI VYKKEGEQVE FSFPLAFTVE KLTGSGELWW 241
QAERASSSKS WITFDLKNKE VSVKRVTQDP KLQMGKKLPL HLTLPQALPQ YAGSGNLTLA
301 LEAKTGKLHQ EVNLVVMRAT QLQKNLTCEV WGPTSPKLML SLKLENKEAK
VSKREKAVWV 361 LNPEAGMWQC LLSDSGQVLL ESNIKVLPTW STPVQPMALI
VLGGVAGLLL FIGLGIFFCV 421 RCRHRRRQAE RMSQIKRLLS EKKTCQCPHR
FQKTCSPI
[0023] By "CD28 cytoplasmic domain" is meant a polypeptide having
the C-terminal region of CD28 that is located in the cytoplasm when
expressed in a T-cell, e.g., a polypeptide having the amino acid
sequence of amino acids 127-234 of SEQ ID NO:2. The term "CD28
cytoplasmic domain" is also meant to include any polypeptide
fragment that maintains the ability to modulate activation of
T-cells (e.g., as determined using the method titled "killing of
HIV infected cells by modified T-cells" below) and is substantially
identical to amino acids 127-234 of SEQ ID NO:2 over the length of
the polypeptide fragment.
TABLE-US-00002 Human CD28 Amino Acid sequence: SEQ ID NO: 2 LOCUS
NP_006130 220 aa linear PRI 11-APR-2010 DEFINITION T-cell-specific
surface glycoprotein CD28 precursor [Homo sapiens]. ACCESSION
NP_006130 VERSION NP_006130.1 GI: 5453611 DBSOURCE REFSEQ:
accession NM_006139.2 1 MLRLLLALNL FPSIQVTGNK ILVKQSPMLV AYDNAVNLSC
KYSYNLFSRE FRASLHKGLD 61 SAVEVCVVYG NYSQQLQVYS KTGFNCDGKL
GNESVTFYLQ NLYVNQTDIY FCKIEVMYPP 21 PYLDNEKSNG TIIHVKGKHL
CPSPLFPGPS KPFWVLVVVG GVLACYSLLV TVAFIIFWVR 181 SKRSRLLHSD
YMNMTPRRPG PTRKHYQPYA PPRDFAAYRS
[0024] By "CD3 zeta" is meant a polypeptide having the amino acid
sequence of SEQ ID NO:3. The term "CD3 zeta" is also meant to
include any polypeptide fragment that maintains the ability to
modulate activation of T-cells (e.g., as determined using the
method titled "killing of HIV infected cells by modified T-cells"
below) and is substantially identical to SEQ ID NO:3 over the
length of the protein fragment.
TABLE-US-00003 Human CD3 zeta Amino Acid sequence SEQ ID NO: 3
LOCUS NP_000725 163 aa linear PRI 11-APR-2010 DEFINITION T-cell
receptor zeta chain isoform 2 precursor [Homo sapiens]. ACCESSION
NP_000725 VERSION NP_000725.1 GI: 4557431 DBSOURCE REFSEQ:
accession NM_000734.3 1 MKWKALFTAA ILQAQLPITE AQSFGLLDPK LCYLLDGILF
IYGVILTALF LRVKFSRSAD 61 APAYQQGQNQ LYNELNLGRR EEYDVLDKRR
GRDPEMGGKP RRKNPQEGLY NELQKDKMAE 121 AYSEIGMKGE RRRGKGHDGL
YQGLSTATKD TYDALHMQAL PPR
[0025] By "small interfering RNA" or "siRNA" is meant an isolated
RNA molecule, either single-stranded or double stranded that is at
least 15 nucleotides, preferably, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides in length
and even up to 50 or 100 nucleotides in length (inclusive of all
integers in between). Preferably, the siRNA is capable of mediating
RNAi. As used herein the phrase "mediates RNAi" refers to
(indicates) the ability to distinguish which RNAs are to be
degraded by the RNAi machinery or process. siRNAs are processed
from long dsRNAs and are usually double-stranded (e.g., endogenous
siRNAs). siRNAs can also include short hairpin RNAs in which both
strands of an siRNA duplex are included within a single RNA
molecule. These terms include double-stranded RNA, single-stranded
RNA, isolated RNA, as well as altered RNA that differs from
naturally occurring RNA by the addition, deletion, substitution,
and/or alteration of one or more nucleotides.
[0026] By "substantially identical" is meant a nucleic acid or
amino acid sequence that, when optimally aligned, for example using
the methods described below, share at least 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
with a second nucleic acid or amino acid sequence. "Substantial
identity" may be used to refer to various types and lengths of
sequence, such as full-length sequence, epitopes or immunogenic
peptides, functional domains, coding and/or regulatory sequences,
exons, introns, promoters, and genomic sequences. Percent identity
between two polypeptides or nucleic acid sequences is determined in
various ways that are within the skill in the art, for instance,
using publicly available computer software such as Smith Waterman
Alignment (Smith and Waterman (1981) J Mol Biol 147:195-7);
"BestFit" (Smith and Waterman, Advances in Applied Mathematics,
(1981) 482-489) as incorporated into GeneMatcher Plus.TM., Schwarz
and Dayhof, Atlas of Protein Sequence and Structure, Dayhof, M.O.,
Ed (1979) 353-358; BLAST program (Basic Local Alignment Search
Tool; (Altschul et al. (1990) J Mol Biol 215: 403-10), BLAST-2,
BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, or
Megalign (DNASTAR) software. In addition, those skilled in the art
can determine appropriate parameters for measuring alignment,
including any algorithms needed to achieve maximal alignment over
the full length of the sequences being compared. In general, for
proteins or nucleic acids, the length of comparison can be any
length, up to and including full length (e.g., 5%, 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%). Conservative
substitutions typically include substitutions within the following
groups: glycine, alanine; valine, isoleucine, leucine; aspartic
acid, glutamic acid, asparagine, glutamine; serine, threonine;
lysine, arginine; and phenylalanine, tyrosine.
[0027] Other features and advantages of the invention will be
apparent from the following Detailed Description, the drawings, and
the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 is a diagram showing the structure of the indicated
chimeric immune T-cell receptors (CIRs).
[0029] FIG. 2 is a diagram showing the organization of an exemplary
nucleic acid construct encoding a 2.sup.nd generation CIR and siRNA
construct.
[0030] FIG. 3 is a series of graphs showing the cellular surface
expression of the indicated CIR. PBMCs were transduced with
retrovirus and stained with anti-CD4-FITC and anti-CD8-APC
antibodies after four days and analyzed by flow cytometry. % CD8+
cells expressing Hege CIR is 52%, 1.sup.st generation CIR is 44%,
and 2.sup.nd generation CIR is 39%. A representative experiment of
four is shown.
[0031] FIG. 4A is a pair of graphs showing survival of the
indicated cell type when incubated with HIV-infected CEM-SS cells
at the indicated ratio. Transduced PBMCs were co-cultured with
HIV-infected CEM-SS cells or uninfected CEM-SS cells at an Effector
to Target (E:T) ratio of 1:1 or 1:10. Aliquots of cells were taken
from the cultures at day three and stained with anti-CD4 and
anti-CD8 antibodies as described above. Data shown is % modified
cells (CD8+CIR+) at each time point. A representative of two
experiments is shown.
[0032] FIG. 4B is a pair of graphs showing flow cytometry analysis
from day three for Hege CIR cells. Hege CIR T-cells disappear
(Hege+HIV, upper right quadrant) when cultured at an E:T ratio of
1:10. % Modifed cells=(Q2/Q2+Q4) is shown in each plot. (Q2 is
upper right quadrant and Q4 is lower right quadrant.)
[0033] FIG. 5 is a graph showing survival of Hege CIR cells when
incubated with HIV-infected CEM-SS cells at the indicated ratio in
the presence and absence of AZT. Transduced PBMCs were co-cultured
with HIV-infected CEM-SS cells or uninfected CEM-SS cells at an
Effector to Target (E:T) ratio of 1:1 or 1:10. Aliquots of cells
were taken from the cultures at day three and stained with anti-CD4
and anti-CD8 antibodies as described for FIG. 3. Data shown is %
modified cells (CD8+CIR+ cells) from one experiment.
[0034] FIG. 6 is a series of graphs showing expression of the
indicated markers on the indicated cells when exposed to HIV.
Non-transduced or 1.sup.st and 2.sup.nd generation CIR transduced
T-cells were co-cultured with HIV infected CEM-SS cells for two
days and stained with anti-CD8 and anti-p24gag antibodies. An
aliquot of unstained cells were washed and continued to culture for
another nine days and stained with anti-CD8 and anti-p24gag
antibodies. A representative of two experiments is shown. At day
two, infected CD8+ cells show as a distinct population (circled) in
the 1.sup.st and 2.sup.nd generation T-cells compared to
non-transduced cells. There is no distinct population of cells seen
in non-Td CD8+ cells (day two, upper right quadrant). % modified
cells for this experiment is: 1.sup.st generation=67% and 2.sup.nd
generation=68%.
[0035] FIG. 7 is a graph showing the percent of specific killing as
a function of the ratio of Effector to Target cells. Hege CIR,
1.sup.st, and 2.sup.nd generation T-cells were cultured with
.sup.51Cr labeled uninfected or chronically infected with HIV-1
IIIB CEM-SS cells. Cytotoxicity is determined from .sup.51Cr
release to the culture media after 18 hrs of co-culture at the
indicated ratios of Effector to Target, and % specific killing is
calculated as follows:
(experimental-control)/(maximal-control).times.100. % modified
cells for Hege is 47%, for 1.sup.St generation is 25%, and for
2.sup.nd generation is 47%. Data shown is representative of two
experiments. This is calculated by taking mean value of CEM-SS
control as spontaneous release=(Expt-control)/(Max-control).
[0036] FIG. 8 is a pair of graphs showing the amount of secretion
of the indicated cytokine in the indicate cells types. 1.sup.st and
2.sup.nd generation T-cells were assayed for IL2 or interferon
gamma (IFN.gamma.) secretion by culturing for 24 hrs on anti-CD4 (5
.mu.g/ml) coated plates. Data represented as fold change over
1.sup.st generation. IL2 data shown is average.+-.SEM of three
experiments. IFN-.gamma. data shown is average.+-.SEM of two
experiments. % modified cells are similar for 1.sup.st and 2.sup.nd
generation T-cells.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The invention features nucleic acid constructs encoding
chimeric immune T-cell receptors (CIRs) that are useful for
treating HIV in patients. In general, the CIRs contain an
extracellular domain which targets HIV or HIV-infected cells (e.g.,
the extracellular domain of CD4), a transmembrane domain, and a
cytoplasmic domain for mediating T-cell activation (e.g., CD3 zeta
and/or the partial extracellular domain of CD28). The invention
also features the use of host cells expressing CIRs in the
treatment of HIV. When expressed in the host cells, the CIRs can be
engineered to homodimerize, thereby increasing their potency. These
host cells can also contain nucleic acid constructs encoding siRNA
against HIV genes in order to, e.g., disrupt HIV infection of the
host T-cells. The structure of a prior art CIR and the structures
of CIRs containing the transmembrane domain of CD3 zeta and
partially extracellular domain of CD28 are depicted in FIG. 1.
Extracellular Domains
[0038] The CIRs of the invention feature an extracellular domain
able to specifically bind HIV and cells infected with HIV. The HIV
protein gp120 binds human CD4. Therefore, the extracellular domain
of the CIRs of the invention can include the extracellular domain
of CD4 (e.g., human CD4 or fragments thereof). Alternatively, the
extracellular domain can include any binding moiety specific for
HIV and cells infected with HIV, including, HIV specific antibodies
(e.g., single-chain Fv antibody fragments that are specific to
gp120 or gp41).
[0039] The extracellular domain can optionally include a further
protein tag, e.g., a c-myc tag (EQKLISEEDL (SEQ ID NO:4) of human
origin, at the N-terminus. The c-myc tag does not obstruct CD4
binding to gp120. Inclusion of c-myc in the sFv based-CIR design
does not appear to affect CIR function, but can facilitate future
study of the construct.
Cytoplasmic Domains
[0040] The CIRs of the invention also feature a cytoplasmic domain
for signaling modulating activation of the host T-cells when bound
to HIV or HIV-infected cells. Cytoplasmic domains useful for use in
the CIRs of the invention include CD3 zeta, or fragments thereof,
and for the cytoplasmic domain of CD28, or fragments thereof. The
invention also features the fusion of polypeptides derived from
multiple extracellular domains for potentiating activation of
T-cells when bound to HIV or HIV-infected cells (e.g., a
cytoplasmic domain that includes both active fragments of CD3 zeta
and CD28).
Transmembrane Domains
[0041] The CIRs of the invention feature transmembrane domains
derived from CD4, CD28, CD3 zeta, or another protein. Furthermore,
the transmembrane domain (or the partial extracellular domains,
"pEC") can be engineered to facilitate homodimerization of the CIRs
when expressed in host T-cells. This can be accomplished, e.g.,
with the addition or substitution of cysteine residues capable of
forming disulfide bonds with a paired molecule.
[0042] The inclusion of the transmembrane region of the zeta chain
or the transmembrane and partial extracellular domain of CD28
provides the capability of intermolecular disulfide bonds. CIRs
containing these transmembrane/partial extracellular domains are
predicted to form disulfide-linked dimers through a cysteine
residue located in the transmembrane of zeta or in the proximal
cysteine residue located in the partial extracellular domain of
CD28 (position 123 of CD28), mimicking the dimer configuration of
native zeta and CD28.
siRNA Constructs
[0043] The DNA constructs and host cells of the invention also
optionally feature components to suppress HIV infection of host
T-cells. Such components include siRNA constructs for suppression
of HIV replication. These siRNA constructs can be specific for
various HIV targets (reviewed in Morris (2006) Gene Ther
13:553-558; Rossi (2006) Biotechniques Supp1:25-29; Nekhai (2006)
Curr Opin Mol Ther 8:52-61; and Cullen (2005) AIDS Rev 7:22-25).
One example is an siRNA targeting a highly conserved sequence in an
exon common to both tat and rev, has been shown to be effective to
prevent virus expression and replication (See, e.g., SEQ ID No. 1).
In order to prevent HIV infection of host T-cells, the invention
also features components to decrease expression of T cell
coreceptors (e.g., CCR5 and CCR4). Such suppression would be
expected to hinder infection of host T-cells as people with
CCR5.DELTA.32 mutation are resistant to HIV infection. The
invention also features the inclusion of multiple siRNA constructs
(e.g., constructs against HIV genes and T-cell receptors used for
HIV infection). Here, one siRNA construct can block infection and
while a second siRNA construct prevents progression of
infection.
[0044] Methods of designing and expressing siRNA constructs are
well known in the art. For example, the siRNA constructs of the
invention can utilize long-hairpin RNA (IhRNA) to express both CCR5
and Tat/Rev siRNAs. Use of a IhRNA is a viable approach in
controlling HIV-1 replication since a single long transcript can in
theory be processed into multiple siRNAs. Multiple targeting can be
achieved from a single long-hairpin precursor, suggesting that
multiple siRNAs can be processed from the long hairpins in vivo.
The siRNA constructs of the invention can also include a promoter
directing expression in host T-cells. Examples of such promoters
are U6 and tRNA promoters. Expressing shRNAs from tRNA promoters
has several advantages, compared to the more commonly used U6 and
H1 promoters: tRNA promoters are smaller, provide a variety of
options, and are typically expressed at lower levels. Smaller
promoters may be desirable in the nucleic acid constructs of the
invention to facilitate inclusion in a vector including a CIR
expression construct. An example of a nucleic acid construct
containing a CIR and siRNA is set forth in FIG. 2.
TABLE-US-00004 shRNA sequences SEQ ID NO: 5 tat/rev shRNA-sense
strand 5'-GCGGAGACAGCGACGAAGAGC-3' Ref: Scherer, L. J., R. Frank,
and J. J. Rossi. 2007. Nucleic Acids Res 35: 2620-2628. ccr5
shRNA-sense strand SEQ ID NO: 6 5'-GCCUGGGAGAGCUGGGGAA-3' Ref:
Ehsani, Mol Titer Epub ahead of print. shRNA within CIR (SEQ ID NO:
7)
-Myc-CD4-CD28-zeta-tcaggtggtggcggttcaggcggaggtggetctggcggtggcggatcg
Generic linker (G4S)3
GCCCGGATAGCTCAGTcGGTAGAGCACAGACTTTAATCTGAGGGTCCAGGGTCAAGTCCCTGTTCGGGC
GCCA tRNA promoter
GCCTGGGAGAGCTGGGGAATTTGTACGTAGTTCCCCAGCTCTCCCAGGC ccr5 shRNA sense
shRNA loop ccr5 shRNA antisense
ggtggcagtggctccggaggttcaggaagcggcggtagtgggagc generic linker
(GGSGS)3
GCGGAGACAGCGACGAAGAGCCTTCCTGTCAGAGCGGAGACAGCGACGAAGAGCTTTTTGAA
tat/rev shRNA sense shRNA loop tat/rev shRNA antisense terminator
sequence
Nucleic Acid Constructs
[0045] The nucleic acid constructs of the invention are useful for
expressing CIRs and siRNA constructs in host T-cells. CIRs and
siRNA constructs can be included in a single nucleic acid construct
or multiple nucleic acid constructs. In order to facilitate
transfection of host cells, the nucleic acid construct can be
included in a viral vector (e.g., a retroviral vector or adenoviral
vector) or be designed to be transfected into a host cell via
electroporation or chemical means (e.g., using a lipid transfection
reagent).
[0046] Examples of Nucleic Acid Constructs
TABLE-US-00005 Myc-CD4-zeta (1.sup.st generation (dimer)) SEQ ID
NO: 8 ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGC
GCTCCTCCCAGCAGCCACTCAGGGAGAGCAGAAGCTGATCTCCGAGGAGG myc (underline)
ACCTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACC CD4
TGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAA
CCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCAT
CCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGA
AACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTA
CATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCG
GATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACC
CTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAG
TCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGC
TGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAG
AAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGC
CTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCC
CACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGG
CAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAA
GAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGA
TGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAG
TATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAA
GTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGA
AAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTG
AGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGC
GGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAGTG
ACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGG
TCCACCCCGGTGCCTAGGCTGGATCCCAAACTCTGCTACCTGCTGGATGG zeta (Underline)
AATCCTCTTCATCTATGGTGTCATTCTCACTGCCTTGTTCCTGAGAGTGA
AGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAG
CTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGA
CAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGA
ACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAG
GCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCA
CGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACG CC
Myc-CD4-CD28-zeta (2.sup.nd generation) SEQ ID NO: 9
ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGC
GCTCCTCCCAGCAGCCACTCAGGGAGAGCAGAAGCTGATCTCCGAGGAGG myc (underline)
ACCTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACC CD4
TGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAA
CCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCAT
CCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGA
AACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTA
CATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCG
GATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACC
CTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAG
TCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGC
TGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAG
AAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGC
CTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCC
CACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGG
CAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAA
GAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGA
TGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAG
TATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAA
GTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAG
AAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGC
TGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAG
GCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAG
TGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACAT
GGTCCACCCCGGTGCCTAGGAAAATTGAAGTTATGTATCCTCCTCCTTAC CD28 (underline)
CTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACA
CCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGC
TGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTG
GCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAG
TGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATT
ACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTG zeta
AAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCA
GCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG
ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAG
AACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGA
GGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGC
ACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGAC GCC
[0047] The amino acid sequence for the CD28 and CD3 zeta portions
of the 2.sup.nd generation construct is
TABLE-US-00006 (SEQ ID NO: 10) K I E V Met Y P P P Y L D N E K S N
G T I I H V K G K H L C P S P L F P G P S K PF W V L V V V G G V L
A C Y S L L V T V A F I I F W V R S K R S R L L H S D Y Met N Met T
P R R P G P T R K H Y Q P Y A P P R D F A A Y R S R V K F S R S A D
AP A Y Q Q G Q N Q L Y N E L N L G R R E E Y D V L D K R R G R D P
E Met G G KP R R K N P Q E G L Y N E L Q K D K Met A E A Y S E I G
Met K G E R R R G K GH D G L Y Q G L S T A T K D T Y D A
Host T-Cells
[0048] The host T-cells of the invention can be isolated from,
e.g., a patient infected with HIV. The host T-cells are transfected
or infected with nucleic acid constructs of the invention (e.g.,
nucleic acid constructs encoding a CIR and, optionally, one or more
siRNA constructs). Prior to administration to a patient the T-cells
can be expanded in cell culture. In one embodiment, the modified
T-cells are administered to the patient from whom they were
originally isolated.
[0049] In one embodiment, PBMCs are isolated by standard techniques
and transduced with a CIR. Cells are administered to the patient in
a dose of between 10.sup.9 and 10.sup.10 cells (e.g., 10.sup.9,
5.times.10.sup.9, or 10.sup.10 cells). Cells can be isolated once
and expanded for multiple administrations or a separate isolation
and transduction can be performed with each round of treatment.
[0050] Treatment can be, e.g., a single treatment, monthly
treatment, semi-annual treatment, or annual treatment.
Additional Agents
[0051] Additional antiviral can be, for example, a protease
inhibitor, a reverse transcriptase inhibitor, an integrase
inhibitor, a CCR5 antagonist, a fusion inhibitor, or a second
maturation inhibitor. The additional antiviral agent can be,
without limitation, azidovudine (AZT), didanosine (dideoxyinosine,
ddI), d4T, zalcitabine (dideoxycytosine, ddC), nevirapine,
lamivudine (epivir, 3TC), saquinavir (Invirase), ritonavir
(Norvir), indinavir (Crixivan), and delavirdine (Rescriptor).
Additional Therapies
[0052] The methods of the invention can be combined with, e.g.,
lymphodepletion prior to administration of host T-cells.
Furthermore, treatment can also include the administration of one
or more cytokines, e.g., IL-2, IL-7, and IL-15.
Experimental Results
[0053] Construction of Retroviral Vectors
[0054] The chimeric immune T-cell receptor (CIR) of the prior
anti-HIV designer T cell trials had the structure of extracellular
domain of CD4 (a polypeptide corresponding to amino acids 1-372 of
SEQ ID NO:1), transmembrane domain of CD4 (a polypeptide
corresponding to amino acids 373-395 of SEQ ID NO:1) and
cytoplasmic domain of zeta (a polypeptide corresponding to amino
acids 31-142 of SEQ ID NO:3) (Deeks et al. (2002) Mol Ther
5:788-797, Mitsuyasu et al. (2000) Blood 96:785-793) (herein "Hege
CIR", FIG. 1). We also designed a signal one-only CIR that is
similar to the Hege CIR except that the transmembrane domain of
zeta (a polypeptide corresponding to amino acids residues 7-30 of
SEQ ID NO:3) was substituted (1.sup.st generation CIR, FIG. 1).
Lastly, we created a construct that integrates CD28 as well as zeta
signaling in a two signal format (2.sup.nd generation CIR, FIG. 1).
This employs the same extracellular domain of CD4 (a polypeptide
corresponding to amino acids 1-372 of SEQ ID NO:1) with a partial
extracellular doman/transmembrane domain/cytoplasmic domain of CD28
(a polypeptide corresponding to amino acids 127-234 of SEQ ID NO:2)
and is expressed as dimer.
[0055] In addition, a c-myc tag (EQKLISEEDL) of human origin is
also included in our constructs at the N-terminus of CD4.
[0056] 1.sup.st and 2.sup.nd generation CIRs were constructed in
the MFG retrovirus vector. Retrovirus was created by ping pong
between the E+86 ecotropic and PG13 amphotropic cell lines. PG13 is
a helper cell line derived from murine fibroblasts that is used to
create vector producer cells (VPC) for retroviral production. VPCs
were sorted for the highest transgene expression and viral
supernatants were harvested as described Beaudoin et al. ((2008) J
Virol Methods 148:253-259).
[0057] Expression of CIRs
[0058] Viral supernatants from PG13 VPCs were used to transduce
human PBMCs. PBMCs from normal healthy individuals were purified
and activated with anti-CD3 antibody (OKT3) and 100 U/ml IL2 for
two days and transduced with retrovirus by spinoculation on a
retronectin coated plate. We determined the surface expression of
CIRs on CD8+ T-cells by double staining for CD8 and CD4 and
determined the transduction rate (as % modified cells, FIG. 3).
Transduction of activated human T-cells routinely yield 40 to 70%
transduction rates with these anti-HIV CIRs.
[0059] We co-cultured transduced or non-transduced T-cells with
CEM-SS HIV+(chronically infected with HIV-1 IIIB) or HIV- cells (at
an E:T ratio of 1:1 or 1:10). We determined the presence of
transduced cells in the culture by staining with anti-CD4 and
anti-CD8 antibodies. Co-culture of Hege CIR T-cells with CEM-SS
HIV+ cells at an E:T ratio of 1:10 induced cell death and all the
Hege CIR cells disappeared from the culture by day 3 (FIG. 4). At
an E:T ratio of 1:1, Hege CIR T cells were still present in the
culture at day 13, with killing of all target cells in the culture
(observed by flow cytometry analysis). Cell death observed in the
Hege CIR designer T-cells could be either due to heightened
sensitivity to Activation Induced Cell Death (AICD) or to HIV
infection. To test this, Hege CIR cells were treated with
anti-retroviral drug AZT and co-cultured with HIV infected CEM-SS
cells. AZT treated Hege CIR cells did not die when co-cultured with
higher target ratio (1:10, FIG. 5). These data suggest that Hege
CIR cells become infected with HIV and die by either HIV induced
apoptosis or killed by other CIR containing T-cells (fratricide).
These data suggest and we hypothesize that one of the reasons for
the failure of Hege CIR in the clinical trials could be due to
highest susceptibility to HIV infection and elimination from the
patients.
[0060] Susceptibility of Designer T-Cells to HIV Infection
[0061] HIV infects CD4+ T-cells by binding to CD4 receptor and a
co-receptor (CXCR4 or CCR5). Since CIR has an extracellular CD4
domain, we postulated that this could be used by HIV to infect all
CIR+ T-cells, including CD8+ T-cells. HIV infection of CIR+CD8+
cells was determined by co-culturing CIR containing T-cells with
HIV+ CEM-SS cells and staining for p24-gag antigen, an indicator of
productive infection. After two days of culture, cells were stained
with anti-CD8 and anti-p24 gag antibodies. In contrast to
non-transduced cultures, CD8+ cells are infected with HIV in
transduced cultures (1.sup.st and 2.sup.nd generation) (FIG. 6). At
day 11 we did not detect any HIV infected CD8+ cells in either
1.sup.4 or 2.sup.nd generation CIR containing T-cells (FIG. 6).
[0062] Killing of HIV-Infected Cells by Modified T-Cells.
[0063] In order to compare the potencies of Hege CIR, 1.sup.st, and
2.sup.nd generation anti-HIV CIR in killing of target cells,
activated T-cells were transduced as described above. Target cells
(HIV-infected or uninfected CEM-SS cells) were labeled with
.sup.51Cr for 5 hrs (50 .mu.Ci for 1.times.10.sup.6 cells) and
co-cultured with transduced T-cells at indicated E:T ratios for 18
hrs. Hege CIR T-cells and our 1.sup.st and 2.sup.nd generation
designer T-cells were all equally potent in killing HIV+ target
cells (FIG. 7).
[0064] Cytokine Secretion by Modified T-Cells.
[0065] Human T-cells transduced with 1.sup.st and 2.sup.nd
generation CIR containing T-cells were tested for their ability to
secrete cytokines upon stimulation through the CIR. Transduced or
non-transduced T-cells were cultured on anti-CD4 antibody coated
plates for 24 hrs. IL2 secretion was measured with an ELISA kit.
2.sup.nd generation T-cells produced more IL2 than 1.sup.st
generation T-cells when stimulated with anti-CD4 antibody (FIG. 8).
In contrast, IFN.gamma. secretion is similar with anti-CD4
stimulation of 1.sup.st and 2.sup.nd generation designer T-cells,
as is typical for T cell signaling.
[0066] Conferring Resistance of Designer T-Cells to HIV
Infection
[0067] HIV infects CD4+ T-cells by binding to CD4 receptor and a
co-receptor (CXCR4 or CCR5). As shown above, CD8+CIR+ cells
(1.sup.st and 2.sup.nd generation) are susceptible to HIV infection
(day two, FIG. 6). At day 11 we did not detect any HIV infected
CD8+ cells in either 1.sup.st or 2.sup.nd generation T-cells (FIG.
6). These data suggest that modified T-cells could kill other HIV
infected modified T-cells. Nevertheless, this is a potential source
of loss of effector cells to combat HIV and provides a new
reservoir to increase patient HIV load. It is therefore becomes
important to eliminate or reduce the potential for HIV to infect
modified T-cells.
Other Embodiments
[0068] Various modifications and variations of the described
methods and compositions of the invention will be apparent to those
skilled in the art without departing from the scope and spirit of
the invention. Although the invention has been described in
connection with specific desired embodiments, it should be
understood that the invention as claimed should not be unduly
limited to such specific embodiments. Indeed, various modifications
of the described modes for carrying out the invention that are
obvious to those skilled in the fields of medicine, immunology,
pharmacology, endocrinology, or related fields are intended to be
within the scope of the invention.
[0069] All publications mentioned in this specification are herein
incorporated by reference to the same extent as if each independent
publication was specifically and individually incorporated by
reference.
Sequence CWU 1
1
121458PRTHomo sapiens 1Met Asn Arg Gly Val Pro Phe Arg His Leu Leu
Leu Val Leu Gln Leu 1 5 10 15 Ala Leu Leu Pro Ala Ala Thr Gln Gly
Lys Lys Val Val Leu Gly Lys 20 25 30 Lys Gly Asp Thr Val Glu Leu
Thr Cys Thr Ala Ser Gln Lys Lys Ser 35 40 45 Ile Gln Phe His Trp
Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn 50 55 60 Gln Gly Ser
Phe Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala 65 70 75 80 Asp
Ser Arg Arg Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile 85 90
95 Lys Asn Leu Lys Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu
100 105 110 Asp Gln Lys Glu Glu Val Gln Leu Leu Val Phe Gly Leu Thr
Ala Asn 115 120 125 Ser Asp Thr His Leu Leu Gln Gly Gln Ser Leu Thr
Leu Thr Leu Glu 130 135 140 Ser Pro Pro Gly Ser Ser Pro Ser Val Gln
Cys Arg Ser Pro Arg Gly 145 150 155 160 Lys Asn Ile Gln Gly Gly Lys
Thr Leu Ser Val Ser Gln Leu Glu Leu 165 170 175 Gln Asp Ser Gly Thr
Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys 180 185 190 Val Glu Phe
Lys Ile Asp Ile Val Val Leu Ala Phe Gln Lys Ala Ser 195 200 205 Ser
Ile Val Tyr Lys Lys Glu Gly Glu Gln Val Glu Phe Ser Phe Pro 210 215
220 Leu Ala Phe Thr Val Glu Lys Leu Thr Gly Ser Gly Glu Leu Trp Trp
225 230 235 240 Gln Ala Glu Arg Ala Ser Ser Ser Lys Ser Trp Ile Thr
Phe Asp Leu 245 250 255 Lys Asn Lys Glu Val Ser Val Lys Arg Val Thr
Gln Asp Pro Lys Leu 260 265 270 Gln Met Gly Lys Lys Leu Pro Leu His
Leu Thr Leu Pro Gln Ala Leu 275 280 285 Pro Gln Tyr Ala Gly Ser Gly
Asn Leu Thr Leu Ala Leu Glu Ala Lys 290 295 300 Thr Gly Lys Leu His
Gln Glu Val Asn Leu Val Val Met Arg Ala Thr 305 310 315 320 Gln Leu
Gln Lys Asn Leu Thr Cys Glu Val Trp Gly Pro Thr Ser Pro 325 330 335
Lys Leu Met Leu Ser Leu Lys Leu Glu Asn Lys Glu Ala Lys Val Ser 340
345 350 Lys Arg Glu Lys Ala Val Trp Val Leu Asn Pro Glu Ala Gly Met
Trp 355 360 365 Gln Cys Leu Leu Ser Asp Ser Gly Gln Val Leu Leu Glu
Ser Asn Ile 370 375 380 Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln
Pro Met Ala Leu Ile 385 390 395 400 Val Leu Gly Gly Val Ala Gly Leu
Leu Leu Phe Ile Gly Leu Gly Ile 405 410 415 Phe Phe Cys Val Arg Cys
Arg His Arg Arg Arg Gln Ala Glu Arg Met 420 425 430 Ser Gln Ile Lys
Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys Pro 435 440 445 His Arg
Phe Gln Lys Thr Cys Ser Pro Ile 450 455 2220PRTHomo sapiens 2Met
Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe Pro Ser Ile Gln Val 1 5 10
15 Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr
20 25 30 Asp Asn Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu
Phe Ser 35 40 45 Arg Glu Phe Arg Ala Ser Leu His Lys Gly Leu Asp
Ser Ala Val Glu 50 55 60 Val Cys Val Val Tyr Gly Asn Tyr Ser Gln
Gln Leu Gln Val Tyr Ser 65 70 75 80 Lys Thr Gly Phe Asn Cys Asp Gly
Lys Leu Gly Asn Glu Ser Val Thr 85 90 95 Phe Tyr Leu Gln Asn Leu
Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys 100 105 110 Lys Ile Glu Val
Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser 115 120 125 Asn Gly
Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro 130 135 140
Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly 145
150 155 160 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe
Ile Ile 165 170 175 Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His
Ser Asp Tyr Met 180 185 190 Asn Met Thr Pro Arg Arg Pro Gly Pro Thr
Arg Lys His Tyr Gln Pro 195 200 205 Tyr Ala Pro Pro Arg Asp Phe Ala
Ala Tyr Arg Ser 210 215 220 3163PRTHomo sapiens 3Met Lys Trp Lys
Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu 1 5 10 15 Pro Ile
Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys 20 25 30
Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala 35
40 45 Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala
Tyr 50 55 60 Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu
Gly Arg Arg 65 70 75 80 Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly
Arg Asp Pro Glu Met 85 90 95 Gly Gly Lys Pro Arg Arg Lys Asn Pro
Gln Glu Gly Leu Tyr Asn Glu 100 105 110 Leu Gln Lys Asp Lys Met Ala
Glu Ala Tyr Ser Glu Ile Gly Met Lys 115 120 125 Gly Glu Arg Arg Arg
Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu 130 135 140 Ser Thr Ala
Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu 145 150 155 160
Pro Pro Arg 410PRTHomo sapiens 4Glu Gln Lys Leu Ile Ser Glu Glu Asp
Leu 1 5 10 521RNAHuman immunodeficiency virus 5gcggagacag
cgacgaagag c 21619RNAHomo sapiens 6gccugggaga gcuggggaa
197277DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 7tcaggtggtg gcggttcagg cggaggtggc
tctggcggtg gcggatcggc ccggatagct 60cagtcggtag agcacagact ttaatctgag
ggtccagggt caagtccctg ttcgggcgcc 120agcctgggag agctggggaa
tttgtacgta gttccccagc tctcccaggc ggtggcagtg 180gctccggagg
ttcaggaagc ggcggtagtg ggagcgcgga gacagcgacg aagagccttc
240ctgtcagagc ggagacagcg acgaagagct ttttgaa 27781602DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
8atgaaccggg gagtcccttt taggcacttg cttctggtgc tgcaactggc gctcctccca
60gcagccactc agggagagca gaagctgatc tccgaggagg acctgaagaa agtggtgctg
120ggcaaaaaag gggatacagt ggaactgacc tgtacagctt cccagaagaa
gagcatacaa 180ttccactgga aaaactccaa ccagataaag attctgggaa
atcagggctc cttcttaact 240aaaggtccat ccaagctgaa tgatcgcgct
gactcaagaa gaagcctttg ggaccaagga 300aactttcccc tgatcatcaa
gaatcttaag atagaagact cagatactta catctgtgaa 360gtggaggacc
agaaggagga ggtgcaattg ctagtgttcg gattgactgc caactctgac
420acccacctgc ttcaggggca gagcctgacc ctgaccttgg agagcccccc
tggtagtagc 480ccctcagtgc aatgtaggag tccaaggggt aaaaacatac
agggggggaa gaccctctcc 540gtgtctcagc tggagctcca ggatagtggc
acctggacat gcactgtctt gcagaaccag 600aagaaggtgg agttcaaaat
agacatcgtg gtgctagctt tccagaaggc ctccagcata 660gtctataaga
aagaggggga acaggtggag ttctccttcc cactcgcctt tacagttgaa
720aagctgacgg gcagtggcga gctgtggtgg caggcggaga gggcttcctc
ctccaagtct 780tggatcacct ttgacctgaa gaacaaggaa gtgtctgtaa
aacgggttac ccaggaccct 840aagctccaga tgggcaagaa gctcccgctc
cacctcaccc tgccccaggc cttgcctcag 900tatgctggct ctggaaacct
caccctggcc cttgaagcga aaacaggaaa gttgcatcag 960gaagtgaacc
tggtggtgat gagagccact cagctccaga aaaatttgac ctgtgaggtg
1020tggggaccca cctcccctaa gctgatgctg agcttgaaac tggagaacaa
ggaggcaaag 1080gtctcgaagc gggagaaggc ggtgtgggtg ctgaaccctg
aggcggggat gtggcagtgt 1140ctgctgagtg actcgggaca ggtcctgctg
gaatccaaca tcaaggttct gcccacatgg 1200tccaccccgg tgcctaggct
ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 1260atctatggtg
tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac
1320gcccccgcgt accagcaggg ccagaaccag ctctataacg agctcaatct
aggacgaaga 1380gaggagtacg atgttttgga caagagacgt ggccgggacc
ctgagatggg gggaaagccg 1440agaaggaaga accctcagga aggcctgtac
aatgaactgc agaaagataa gatggcggag 1500gcctacagtg agattgggat
gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 1560taccagggtc
tcagtacagc caccaaggac acctacgacg cc 160291851DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
9atgaaccggg gagtcccttt taggcacttg cttctggtgc tgcaactggc gctcctccca
60gcagccactc agggagagca gaagctgatc tccgaggagg acctgaagaa agtggtgctg
120ggcaaaaaag gggatacagt ggaactgacc tgtacagctt cccagaagaa
gagcatacaa 180ttccactgga aaaactccaa ccagataaag attctgggaa
atcagggctc cttcttaact 240aaaggtccat ccaagctgaa tgatcgcgct
gactcaagaa gaagcctttg ggaccaagga 300aactttcccc tgatcatcaa
gaatcttaag atagaagact cagatactta catctgtgaa 360gtggaggacc
agaaggagga ggtgcaattg ctagtgttcg gattgactgc caactctgac
420acccacctgc ttcaggggca gagcctgacc ctgaccttgg agagcccccc
tggtagtagc 480ccctcagtgc aatgtaggag tccaaggggt aaaaacatac
agggggggaa gaccctctcc 540gtgtctcagc tggagctcca ggatagtggc
acctggacat gcactgtctt gcagaaccag 600aagaaggtgg agttcaaaat
agacatcgtg gtgctagctt tccagaaggc ctccagcata 660gtctataaga
aagaggggga acaggtggag ttctccttcc cactcgcctt tacagttgaa
720aagctgacgg gcagtggcga gctgtggtgg caggcggaga gggcttcctc
ctccaagtct 780tggatcacct ttgacctgaa gaacaaggaa gtgtctgtaa
aacgggttac ccaggaccct 840aagctccaga tgggcaagaa gctcccgctc
cacctcaccc tgccccaggc cttgcctcag 900tatgctggct ctggaaacct
caccctggcc cttgaagcga aaacaggaaa gttgcatcag 960gaagtgaacc
tggtggtgat gagagccact cagctccaga aaaatttgac ctgtgaggtg
1020tggggaccca cctcccctaa gctgatgctg agcttgaaac tggagaacaa
ggaggcaaag 1080gtctcgaagc gggagaaggc ggtgtgggtg ctgaaccctg
aggcggggat gtggcagtgt 1140ctgctgagtg actcgggaca ggtcctgctg
gaatccaaca tcaaggttct gcccacatgg 1200tccaccccgg tgcctaggaa
aattgaagtt atgtatcctc ctccttacct agacaatgag 1260aagagcaatg
gaaccattat ccatgtgaaa gggaaacacc tttgtccaag tcccctattt
1320cccggacctt ctaagccctt ttgggtgctg gtggtggttg gtggagtcct
ggcttgctat 1380agcttgctag taacagtggc ctttattatt ttctgggtga
ggagtaagag gagcaggctc 1440ctgcacagtg actacatgaa catgactccc
cgccgccccg ggcccacccg caagcattac 1500cagccctatg ccccaccacg
cgacttcgca gcctatcgct ccagagtgaa gttcagcagg 1560agcgcagacg
cccccgcgta ccagcagggc cagaaccagc tctataacga gctcaatcta
1620ggacgaagag aggagtacga tgttttggac aagagacgtg gccgggaccc
tgagatgggg 1680ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca
atgaactgca gaaagataag 1740atggcggagg cctacagtga gattgggatg
aaaggcgagc gccggagggg caaggggcac 1800gatggccttt accagggtct
cagtacagcc accaaggaca cctacgacgc c 185110211PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
10Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser 1
5 10 15 Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser
Pro 20 25 30 Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val
Val Val Gly 35 40 45 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr
Val Ala Phe Ile Ile 50 55 60 Phe Trp Val Arg Ser Lys Arg Ser Arg
Leu Leu His Ser Asp Tyr Met 65 70 75 80 Asn Met Thr Pro Arg Arg Pro
Gly Pro Thr Arg Lys His Tyr Gln Pro 85 90 95 Tyr Ala Pro Pro Arg
Asp Phe Ala Ala Tyr Arg Ser Arg Val Lys Phe 100 105 110 Ser Arg Ser
Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu 115 120 125 Tyr
Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp 130 135
140 Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys
145 150 155 160 Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp
Lys Met Ala 165 170 175 Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu
Arg Arg Arg Gly Lys 180 185 190 Gly His Asp Gly Leu Tyr Gln Gly Leu
Ser Thr Ala Thr Lys Asp Thr 195 200 205 Tyr Asp Ala 210
1115PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 11Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser 1 5 10 15 1215PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 12Gly Gly Ser Gly Ser Gly Gly
Ser Gly Ser Gly Gly Ser Gly Ser 1 5 10 15
* * * * *