U.S. patent application number 15/688497 was filed with the patent office on 2018-07-05 for monoamine oxidase inhibitors and methods for treatment and diagnosis of prostate cancer.
This patent application is currently assigned to UNIVERSITY OF SOUTHERN CALIFORNIA. The applicant listed for this patent is UNIVERSITY OF SOUTHERN CALIFORNIA. Invention is credited to Leland CHUNG, Bogdan Z. OLENYUK, Jean C. SHIH, Boyang Jason WU, Haiyen E. ZHAU.
Application Number | 20180185303 15/688497 |
Document ID | / |
Family ID | 46717931 |
Filed Date | 2018-07-05 |
United States Patent
Application |
20180185303 |
Kind Code |
A1 |
SHIH; Jean C. ; et
al. |
July 5, 2018 |
MONOAMINE OXIDASE INHIBITORS AND METHODS FOR TREATMENT AND
DIAGNOSIS OF PROSTATE CANCER
Abstract
A mechanism of monoamine oxidases (MAOs) driven
epithelium-to-mesenchymal transition (EMT) is disclosed. Also
disclosed are methods for treating cancer by inhibiting or
suppressing MAOs in cancer cells. Novel MAOs inhibitors, such as
small molecules, siRNA, shRNA, antisense oligonucleotides,
aptamers, decoys, and pharmaceutical compositions useful for
treating cancer by disrupting the workings of MAOs are provided. In
particular, a class of conjugates formed by covalently conjugating
near infrared dye 783, IR-780, and MHI-148 to a MAO inhibitor, such
as clorgyline, with and without encapsulation it in a nanoparticle
is provided. Other aspects of the invention include methods for
forming the nano-conjugates, method for monitoring treatment
progress in a cancer patient by monitoring the changes in MAO
activity, methods for screening patients who are at risk of cancer
or differentiating different forms of cancer by assaying the level
and location of MAO activity.
Inventors: |
SHIH; Jean C.; (Beverly
Hills, CA) ; CHUNG; Leland; (Los Angeles, CA)
; ZHAU; Haiyen E.; (Los Angeles, CA) ; WU; Boyang
Jason; (Los Angeles, CA) ; OLENYUK; Bogdan Z.;
(Sierra Madre, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY OF SOUTHERN CALIFORNIA |
Los Angeles |
CA |
US |
|
|
Assignee: |
UNIVERSITY OF SOUTHERN
CALIFORNIA
Los Angeles
CA
|
Family ID: |
46717931 |
Appl. No.: |
15/688497 |
Filed: |
August 28, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13559431 |
Jul 26, 2012 |
9771625 |
|
|
15688497 |
|
|
|
|
61511920 |
Jul 26, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/357 20130101;
A61K 49/0032 20130101; A61K 47/545 20170801; A61K 47/55 20170801;
A61K 31/137 20130101; C12N 15/1137 20130101; C12Y 104/03004
20130101; A61P 13/08 20180101; A61P 39/06 20180101; A61K 31/405
20130101; A61K 47/6929 20170801; C12N 2310/14 20130101; C12N
2310/531 20130101; A61P 43/00 20180101; A61K 31/352 20130101; A61P
35/04 20180101; A61P 35/00 20180101; A61K 31/5375 20130101; A61K
31/366 20130101; A61K 31/381 20130101; A61K 31/713 20130101 |
International
Class: |
A61K 31/137 20060101
A61K031/137 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND
DEVELOPMENT
[0002] This invention was made with government support under
Contract Nos. P01-CA98912, DAMD-17-03-02-0033, R01-CA122602,
R01-MH39085 awarded by the National Institute of Health. The
government has certain rights in the invention.
Claims
1-25. (canceled)
26. A method of treating prostate cancer comprising administering
to a subject in need thereof an effective amount of phenelzine.
27. The method of claim 26, wherein the subject has a high Gleason
grade prostate cancer.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/559,431 (now U.S. Pat. No. 9,771,625; issued Sep. 26, 2017)
filed on Jul. 26, 2012, which claims the benefit of priority of
U.S. Provisional Application No. 61/511,920 filed Jul. 26, 2011,
all of which are incorporated herein by reference in their
entirety.
FIELD OF THE INVENTION
[0003] The present invention relates generally to inhibition of
monoamine oxidases (MAOs) and their inhibitors (MAOIs) as
strategies to treat cancer, particularly prostate cancer. This
invention also relates to imaging, screening, diagnostics, and
therapeutic methods of cancer. In addition, this invention further
relates to cancer biomarkers and methods for differentiating
indolent from virulent prostate cancer.
BACKGROUND OF THE INVENTION
[0004] Prostate cancer is the third most common cause of death from
cancer in men of all ages and is the most common cause of death
from cancer in men over age of 75. Current treatments for prostate
cancer include (1) hormonal therapy, (2) chemotherapy, (3)
radiation therapy, and (4) surgery. However, they are only
effective for patients during the early stages of the disease.
There are also undesired side effects associated with each of these
treatment modalities. Moreover, for patients with advanced stages
of castration-resistant and metastatic prostate cancers, these
treatments are only partially effective.
[0005] Supplemental or combination therapies may improve the
outcome in advanced patients. For instance, patients subjected to
androgen ablation therapy with either chemical castration with a
LH-RH agonist or surgical castration have benefited by the
combination with an antiandrogen like bicalutamide. Patients who
failed these hormonal therapies are often benefited by selective
chemotherapy such as docetaxel and denosumab and additional
hormonal therapy to deplete residual endogenous androgen synthesis
(e.g. a CYP17 inhibitor, abiraterone). Despite the improvement,
these additional therapies, in general, are only capable of
prolonged survival by a few months.
[0006] Prognosis and staging of prostate cancer are typically
evaluated using the Gleason grading system. A Gleason score is
given to prostate cancer based on its microscopic appearance.
Cancers with a higher Gleason score are more aggressive and have a
worse prognosis. A Gleason score is determined by a pathologist who
visually inspects a biopsy sample and then assigning a score to the
observed tumor pattern. However, the Gleason system is entirely
reliant upon human visual examination, which is prone to error with
significant limitations on early detection.
[0007] In view of the above, there is an urgent, unmet need for
more effective mechanism-based therapies and noninvasive
early-stage diagnostic techniques to differentiate indolent from
virulent forms of prostate cancer so that overtreatment of this
disease can be avoided.
SUMMARY OF THE INVENTION
[0008] Briefly, the present invention is based, in part, on the
surprising discovery that monoamine oxidases exhibit differential
expressions/activities in cancerous cells and that inhibitors of
monoamine oxidases (MAOs) are capable of repressing the growth of
cancer cells in vitro and tumor xenografts in vivo.
[0009] MAOs are a family of enzymes that catalyze the oxidation of
monamines. They are bound to the outer membrane of mitochondria in
most cell types in the body. In humans, there are two isoforms of
MAO, MAO-A and MAO-B. The two forms of MAOs are a crucial pair of
oxidative enzymes that deaminate biogenic and dietary amines,
including monoamine neurotransmitters, resulting in the production
of hydrogen peroxide (H.sub.2O.sub.2). Both isoforms of MAO play
key roles and have diverse functions in normal physiology and
disease states, such as modulating emotions and behaviors. Because
of the vital role that MAOs play in the inactivation of
neurotransmitters, MAO dysfunction (too much or too little MAO
activity) is thought to be responsible for a number of psychiatric
and neurological disorders. For example, unusually high or low
levels of MAOs in the body have been associated with depression,
schizophrenia, substance abuse, attention deficit disorder,
migraines, and irregular sexual maturation. Therefore, MAO was
previously known as a target for psychiatric and neurological
disorders.
[0010] In the present invention, it was unexpectedly discovered
that increase of MAO-A activity or expression is correlated with
the progression of human prostate cancer. For example, it has been
demonstrated that clorgyline, a potent MAO-A inhibitor, is capable
of repressing the growth of human prostate cancer cells in vitro
and tumor xenografts in vivo. This finding establishes MAOs as a
target for cancer.
[0011] Accordingly, a first aspect of the present invention is
directed to a novel MAO inhibitor selected from the group
consisting of compounds 11-14 as shown below:
##STR00001##
and a salt thereof. These compounds are commercially available
compounds with newly discovered MAO inhibitory activities. They may
be purchased from commercial sources, including but not limited to,
Aurora Screening Library, Enamine HTS Collection and/or Interchim
Screening Library. Thus, this aspect of the invention provides
compositions comprising useful for inhibiting MAO activity,
comprising one or more compounds selected from the group consisting
of compounds 11-14. This aspect of the invention also provides a
method for inhibiting MAO activity by contacting a cell with one or
more MAO inhibitors selected from the group consisting of compounds
11-14.
[0012] In addition to the above disclosed inhibitors, the present
invention has also unexpectedly discovered that nanoparticles that
are preferential uptaken by cancer cells (e.g. near infrared dies)
may be used as a delivery vehicle to deliver a pharmaceutically
active agent (e.g. a cytotoxic compound) to cancer cells. For
example, the present invention has succeeded in conjugating
near-infrared dye nanoparticles such as IR-783 to an active agent
such as a MAO inhibitor described above and demonstrated that the
resulting nano-conjugates remain preferentially uptaken by cancer
cells.
[0013] Hence, a second aspect of the present invention is directed
to a nano-conjugate capable of preferentially or selectively
targeting cancer cells. Nano-conjugates in accordance with this
aspect of the invention will generally have an NIR dye nanoparticle
conjugated to a cytotoxic compound. Exemplary NIR dyes may include
conjugated polyene functional groups, such as one found in IR-783,
IR-780, IR-786, and MHI-148 but are not limited thereto. Exemplary
cytotoxic compound may include MAO inhibitors, docetaxel,
cisplatin, carboplatin, oxaliplatin, doxorubicin, temozolomide,
gemcitabine, anthramycin, camptothecin, topotecan, lonidamine,
mitomycin, imexon, dacarbazide, PK-11195, but are not limited
thereto. Conjugation of the NIR dye nanoparticle to the cytotoxic
compound may be achieved by any suitable chemical means known in
the art.
[0014] In one preferred embodiment, exemplary nano-conjugates of
the present invention will generally have at least two functional
groups with a cytotoxic element (e.g. an MAO inhibitor) attached to
a light emissive element (e.g. NIR dye nanoparticle) via a linker
containing at least one C and two H atoms. Preferably, at least two
unsaturated structures containing one unsaturated double or triple
bond are linked via a backbone chain of 1-3, 1-5, or 1-15 atoms to
one heterocycle.
[0015] An exemplary linker is one having the following general
formula:
##STR00002##
wherein M.sub.1 is O or S; and wherein at least two of X, Y, and Z
participate in bonds to unsaturated and/or aromatic groups A and B
(not shown) which proceed through additional carbon, oxygen or
nitrogen atoms. Any of X, Y, and Z not participating in a bond to
group A or B is substituted with hydrogen or lower aliphatic group,
such as C.sub.1-C.sub.6 alkyl.
[0016] As used herein, the term "backbone chain" refers to the
chain of atoms linking the two unsaturated structures together, not
taking into account said chain.
[0017] For example, a conjugate or nanoparticle-encapsulated
conjugate (herein referred to as nano-conjugate) in accordance with
embodiments of the invention may be one having the following
formula:
##STR00003## [0018] A, B, or C=F, Cl, Br, I [0019] X.dbd.NH, O, S
[0020] Y.dbd.Cl, Br, I, mesyl, tosyl [0021] m, n=1-15.
[0022] In another embodiment, X and Y are as above and Z is
selected from the group consisting of
##STR00004##
wherein the covalent link is attached to the aromatic ring. This
compound is herein referred to as MHI-moclobemide, a MAO-A specific
reversible inhibitor.
[0023] In another embodiment, X and Y are same as above, and Z
is
##STR00005##
wherein the covalent bond is also attached to the aromatic ring.
This compound is herein referred to as MHI-phenelzine, a MAO-A and
-B inhibitor.
[0024] In still another embodiment, X and Y are same as above, and
Z is (.+-.)-trans-2-phenylcyclopropan-1-amine having the
formula:
##STR00006##
wherein covalent attachment is through the aromatic ring. This
compound is herein referred to as MHI-tranylcypromine, which is a
MAO-A and -B inhibitor.
[0025] In still another embodiment, X and Y are same as above, and
Z is N-Benzyl-N-methylprop-2-yn-1-amine, having the following
formula:
##STR00007##
wherein covalent linkage is attached to the nitrogen as indicated
by the curly line. This compound is herein referred to as
MHI-pargyline, a MAO-A and -B inhibitor with a preference for
MAO-B.
[0026] In a preferred embodiment, Y is S; X is a group having the
following formula:
##STR00008##
and Z is a group having the following formula:
##STR00009##
This compound is referred to herein as
[0027] MHI-clorgyline, which is a MAO-A specific irreversible
inhibitor.
[0028] In yet another embodiment, X and Y are same as above, Z is
one selected from the following:
##STR00010##
wherein covalent linkage is attached to the aromatic rings. This
group of compounds is collectively referred to herein as MHI-MAOIs.
The MHI-MAOIs can be conveniently prepared in two steps from
MHI-148 and inhibitor through reduction of MHI-148 with lithium
aluminum hydride or diborane and subsequent conjugarion of the
resulting diol with the MAOI by, for example, but without being
limited to, Mitsunobu reaction, to give conjugate 11D.
##STR00011##
[0029] In still another embodiment, Y and Z are same as above, X is
one having the following formula:
##STR00012##
wherein the covalent linkage is attached to the cyclohexene ring of
the molecule. This group of compounds is collectively referred to
herein as NIR-MAOIs.
[0030] A third aspect of the present invention is directed to a
method for forming an NIR dye-based nano-conjugate capable of
preferentially targeting cancerous cells. Methods in accordance
with this aspect of the invention will generally include the steps
of chemically conjugating an NIR dye nanoparticle to a cytotoxic
compound. Suitable NIR dyes and cytotoxic compounds are as
described above.
[0031] A forth aspect of the present invention is directed to a
pharmaceutical composition useful for treating cancer, and methods
of treating cancer using the compositions. Compositions in
accordance with this aspect of the invention will generally include
an active agent capable of inhibiting MAO activity; and a
physiologically suitable carrier. In some preferred embodiments,
the active agent is a MAO inhibitor known in the art. Exemplary MAO
inhibitor may include, but not limited to moclobemide, phenelzine,
tranylcypromine, pargyline, and clorgyline. Nucleic acids capable
of inhibiting, down-regulating or silencing the expression of MAO
may also be advantageously used. Exemplary nucleic acid MAO
inhibitors may include siRNA, shRNA, antisense, or any other type
of nucleic acid-based gene silencing agents commonly known in the
art, such as decoys, ribozymes, and aptamers. Such preferred
embodiments can be used, either alone or in combination with the
described herein pharmaceutical compositions as cancer
therapeutics.
[0032] In one exemplary embodiment, gene silencing or knock-down of
MAO-A in human prostate cancer cells with shRNA can be exemplified
as follows: in a 48-well tissue culture plate, 6.times.10.sup.4
human prostate cancer cells per well in 250 ul normal culture
medium were seeded 24 hrs prior to viral infection, and the cells
should be approximately 50% confluent on the day of infection. A
mixture of 40 ul of human shMAOA lentiviral transduction particles
(5.times.10.sup.6 titer/ml) with polybrene (at a final
concentration of 5 ug/ml) in 100 ul medium (without FBS and
anti-biotics) was prepared and added into cells for a subsequent
incubation for 4 hrs to overnight. The culture medium was
replenished after 4 hrs to overnight. Cells were then treated with
2-10 ng/ml puromycin 48 hrs after infection for selection
consecutively for 2 weeks, and the medium supplemented with
puromycin was replenished every 3-4 days. Stable MAOA-KD cells were
validated by Western blot and real-time RT-PCR examination of MAOA
gene expression, and were maintained in the culture medium
supplemented with puromycin at the same concentrations for
selection. The shRNA sequence against human MAOA cDNA is:
CCGGCGGATATTCTCTGTCACCAATCTCGAGATTGGTGACAGAGAATATCCG TTTTTG (SEQ ID
NO:1), as adapted from a Sigma-Aldrich product (catalog #
NM_000240_TRCN0000046009).
[0033] In other preferred embodiments, the active agent is an NIR
dye-based conjugate as described above. In still other preferred
embodiments, the active agent is one selected from compounds 11-14
that are available from commercial sources, including but not
limited to, Aurora Screening Library, Enamine HTS Collection and/or
Interchim Screening Library.
##STR00013##
[0034] A fifth aspect of the present invention is directed to a
method of delivering a pharmaceutical agent to a cancer cell.
Methods in accordance with this aspect of the invention will
generally include the steps of conjugating the pharmaceutical agent
to an NIR dye; and contacting the conjugate with the cancer cell.
In some preferred embodiments, the pharmaceutical agent is a
cytotoxic agent. Exemplary cytotoxic agent may include an
alkylating agent, an inhibitor of microtubule formation, and an
aromatase inhibitor, but are not limited thereto.
[0035] A sixth aspect of the present invention is directed to a
method of inhibiting MAO activity in a cancer cell. Methods in
accordance with this aspect of the invention will generally include
the steps of contacting a cell with an inhibitory agent, wherein
said inhibitory agent is selected from the group consisting of a
MAO inhibitor, a nano-conjugate with a NIR dye conjugated to a MAO
inhibitor, and a combination thereof. Any MAO inhibitor known in
the art or herein disclosed, both pharmacological and nucleic-acid
based, may be advantageously used.
[0036] Where prostate cancer is concerned, it is a further
discovery of the present invention that MAO-A is associated with
chemo and radiation resistance in human prostate cancer whereas
MAO-B has a unique expression pattern in human prostate
cancer-associated stromal cells. As mentioned above, MAOs are
mitochondrial-bound enzymes that catalyze the degradation of
monoamine neurotransmitters and dietary amines via oxidative
deamination. They are encoded by their genes located in the X
chromosome [1, 2]. The by-product of MAO catalysis is hydrogen
peroxide, a major source of reactive oxygen species (ROS), which
can predispose cancer cells to DNA damage and promote tumor
initiation and progression [3]. Modulation of intracellular ROS
levels in prostate cancer cells could affect the sensitivity of
prostate cancer cells toward hormonal, chemo- and radiation therapy
[4]. Moreover, MAOs are responsible for the generation of ROS, in
the presence of their biogenic amine substrates from the diet or
physiological sources in an epithelial versus stromal cellular
compartments. In addition, since prostate stroma is known to drive
the progression of prostate cancer, by differentiating the forms,
the amount, and the physical location of MAOs in prostate cancer
tissue specimens, indolent forms of human prostate cancer may be
differentiated from virulent forms. In short, it is an unexpected
discovery of the present invention that MAOs are capable of serving
as biomarkers for screening, diagnosing, and differentiating
prostate cancer forms in patients. Based on the observation that
MAO-A and MAO-B differs in their localization, a treatment strategy
targeting both MAO-A in prostate cancer epithelium and MAO-B in
prostate cancer-associated stroma is also devised.
[0037] Accordingly, a seventh aspect of the present invention is
directed to a method of differentiating different forms of prostate
cancer, comprising assaying MAO activity and location patterns in
prostate tissues; and determining a cancer form characterization
according to said MAO activity and location patterns. The said MAO
activity can be determined, for example, by real-time PCR that
measures the MAO-A expression in prostate biopsy as described
below:
The biopsy samples should be homogenized in Trizol, and RNA
isolated. Next, 1 ug of total RNA will be reverse transcribed in 25
ul volume, then 2 ul of the sample (cDNA) is diluted 1/10 into 20
ul, 5 ul of this sample will be used as template for MAO A
measurement. Another 2 ul will be diluted 1/50 into 100 ul, 5 ul of
this sample is used for ribosomal RNA control template. The primer
sequence for human MAO A specific primer can be as follows:
TABLE-US-00001 MAO A E1F168 (SEQ ID NO: 2) GTG TCA GCC AAA GCA TGG
AGA 188 MAO A E2R281 (SEQ ID NO: 3) CAG TCA AGA GTT TGG CAG CAG
261
113 bp PCR product The primer sequence for 18s ribosomal RNA are as
follows:
TABLE-US-00002 F1565 (SEQ ID NO: 4) CAG CCA CCC GAG ATT GAG CA
R1816 (SEQ ID NO: 5) TAG TAG CGA CGG GCG GTG TG
253 bp PCR product PCR condition: 95 degrees C..times.4 min 1 cycle
95 degree.times.30 sec 60 degree.times.30 sec 72 degree.times.30
sec 40 cycles.
[0038] Those skilled in the art will recognize that the above
example is for illustration only and other currently known or
future invented methods of measurement may also be used to
determine MAO activity.
[0039] An eighth aspect of the present invention is directed to a
method of screening a patient for risk of cancer, comprising
assaying MAO activity in the patient; comparing said activity to a
reference; and determining a risk level based on the comparison.
The said MAO activity can be determined, for example, by real-time
PCR that measures the MAO-A expression in prostate biopsy as
described below:
The biopsy samples should be homogenized in Trizol, and RNA
isolated. Next, 1 ug of total RNA will be reverse transcribed in 25
ul volume, then 2 ul of the sample (cDNA) is diluted 1/10 into 20
ul, 5 ul of this sample will be used as template for MAO A
measurement. Another 2 ul will be diluted 1/50 into 100 ul, 5 ul of
this sample is used for ribosomal RNA control template. The primer
sequence for human MAO-A specific primer can be as follows:
TABLE-US-00003 MAO A E1F168 (SEQ ID NO: 2) GTG TCA GCC AAA GCA TGG
AGA 188 MAO A E2R281 (SEQ ID NO: 3) CAG TCA AGA GTT TGG CAG CAG
261
113 bp PCR product The primer sequence for 18s ribosomal RNA are as
follows:
TABLE-US-00004 F1565 (SEQ ID NO: 4) CAG CCA CCC GAG ATT GAG CA
R1816 (SEQ ID NO: 5) TAG TAG CGA CGG GCG GTG TG
253 bp PCR product PCR condition: 95 degrees C. x 4 min 1 cycle 95
degree.times.30 sec 60 degree.times.30 sec 72 degree.times.30 sec
40 cycles.
[0040] Those skilled in the art will also recognize that the above
example is for illustration only and other currently known or
future invented methods of measurement may also be used to
determine MAO activity.
[0041] A ninth aspect of the present invention is directed to a
method of treating cancer. Methods in accordance with this aspect
of the invention will generally include the steps of administering
to a subject a pharmaceutical agent capable of inhibiting MAOs in
cancer cells. The type of cancers that may be treated by methods in
accordance with this aspect of the invention may include prostate,
brain, colon, aggressive fibromatosis, but not limited thereto. The
pharmaceutical agent may be any of the above described
compositions, nano-conjugates, or inhibitors. In a preferred
embodiment, the cancer is prostate cancer. In a further preferred
embodiment, treatment of prostate cancer may include administering
a first pharmaceutically active agent targeting MAO-A in epithelium
with clorgyline and a second pharmaceutically active agent
targeting MAO-B in stroma with deprenyl. Said first and second
pharmaceutically active agent may be different agent or the same
agent, so long as they are effective in inhibiting the respective
MAO isoform in the respective tissue type.
[0042] An tenth aspect of the present invention is directed to a
method of monitoring treatment progress in a cancer patient being
treated with a pharmaceutical composition comprising a NIR
dye-based nano-conjugate. Methods in accordance with this aspect of
the invention will generally include the steps of obtaining
successive NIR image of the patient; and comparing said successive
NIR images to determine progression of said treatment. The effect
of conjugate on prostate tumor growth and metastasis can be
determined by imaging and IHC analysis. The said imaging can be
done, for example, with Xenogen IVIS 200 instrument. This system
allows researchers to use real-time, non-invasive imaging to
monitor and record cellullar and genetic activity in vivo.
Integrated into the system are both a bioluminescence system and a
fluorescence system and the capability to easily switch between
modalities. A laser scanner also provides 3D surface topography for
single-view diffuse tomographic reconstructions of internal
sources. Background noise is minimized while sensitivity is
maximized using a 26 mm square CCD which is cryogenically cooled.
Scans generally take 1-10 minutes to complete with five field of
view options ranging from 4 cms to 25 cms.
[0043] An eleventh aspect of the present invention is directed to a
method of modulating ROS levels in cells. Methods in accordance
with this aspect of the invention will generally include the steps
of contacting a cell with a MAO inhibitory agent. Suitable MAO
inhibitory agent may be any of the MAO inhibitors, nano-conjugates,
or pharmaceutical compositions described above. These agents can be
used either alone or in combination with mitochondria-directed
antioxidants, such as lipoic acid, N-acetyl-L-carnitine and
N-Acetyl-L-cysteine.
[0044] Other aspects and advantages of the present invention will
become apparent from the following detailed description and the
appended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1A and FIG. 1B show the tumor xenografts growth rates
were much reduced in mice injected with MCP3 cells (a mouse cell
lines with PTEN and p53 double KO, see filled circles) with MAO-A
knock down compared with WT MCP3 cells (open circles). There was no
tumor growth when MAO-A knock down MCP3 prostate cancer cells
(1.times.10.sup.6 cells) were injected in mice, whereas significant
number of tumors were found in WT MCP3 cell injected mice. FIG. 1C
shows that MAO-A expression is correlated with cell proliferation
profiles in human and murine cancer cells. 2.times.10.sup.4 human
or murine prostate cancer cells of manipulated MAO-A expression
were seeded, and cell numbers were counted consecutively over a
6-day period. Experiments were performed in triplicate. shMAO-A,
MAO-A knockdown by shRNA lentiviral infection.
[0046] FIG. 2 shows the synthetic scheme for clorgyline-NIR dye
conjugate and preparation of nano-clorgyline.
[0047] FIG. 3 shows examples of novel MAO-A inhibitors according to
the present invention.
[0048] FIG. 4A, FIG. 4B, FIG. 4C and FIG. 4D show that MAO-A
knockout in host impeded the growth of murine F9 teratocarcinoma
xenograft. 1.times.10.sup.5 murine F9 teratocarcinoma cells were
subcutaneously injected into WT (N=9) and MAO-A KO (N=9) mice. *,
p<0.05; **, p<0.01.
[0049] FIG. 5A and FIG. 5B show that MAO-A knockout in host
inhibited the growth of murine MCP3 prostatic carcinoma xenograft.
1.times.10.sup.5 murine MCP3 prostatic carcinoma cells were
subcutaneously injected into WT (N=4) and MAO-A neo KO (N=5) mice.
*, p<0.05; **, p<0.01.
[0050] FIG. 6 (A, B, C and D) show that MAO-A knockdown in murine
MCP3 prostatic carcinoma cells inhibited the growth of tumor
xenograft in vivo. 1.times.10.sup.6 WT and MAO-A-KD murine MCP3
prostatic carcinoma cells were subcutaneously injected into 6 (WT
cells) and 4 (MAO-A-KD cells) C57BL/6 mice, respectively. *,
p<0.05.
[0051] FIG. 7A, FIG. 7B, FIG. 7C, and FIG. 7D show that
immunohistochemical staining of MAO-A and MAO-B in a tissue
microarray consists of prostate cancer tissues from 88 patients (2
cores from each patient). FIG. 7A shows MAO-A, a basal cell
protein, expresses in cancer cells; minimal stromal reaction in the
benign and cancerous areas of the specimens. FIG. 7B, in contrast,
shows MAO-B, a mesenchymal cell protein, was only minimally
expressed in normal and cancerous prostate epithelial cells, but
with increased expression in prostate cancer-associated stromal
cells. Since prostate stromal cells are known to induce prostate
cancer epithelial growth and progression, and clonal evolution of
prostate epithelium, MAO-B could also be considered as an effective
stromal target for therapeutic intervention. FIG. 7C shows intense
MAO-A positive stained prostate cancer cells in human bone,
suggesting MAO-A may be an excellent target for prostate cancer
bone metastasis. FIG. 7D shows that normal prostate epithelial
cells also expressed MAO-A but not MAO-B (data not shown).
[0052] FIG. 8 shows a brief synthetic scheme of IR-783, a NIR dye,
-docetaxel conjugate.
[0053] FIG. 9 (A and B), FIG. 9C, FIG. 9D and FIG. 9E show that
IR-783-docetaxel was found to be uptaken into human prostate cancer
cells (C4-2, PC-3), pancreatic cancer cells (MIA-PaCa2) and renal
cancer cells (SN12C, see panel a); this NIR-docetaxel conjugate was
found not uptaken into human normal prostate epithelial cells (P69)
and a fetal human kidney 293 cells (see panel b). Cytotoxicity
assays shows that this NIR-docetaxel conjugate exerted growth
inhibitory effects on a panel of human cancer cell lines in vitro
in a concentration dependent manner (see panel c). Using human
renal cancer (SN12C) and normal fetal kidney cells (HFK293) as
models, we observed that this dye-drug conjugate has equal
effectiveness like the parental drug, docetaxel, in killing SN12C
but not HFK293 cells, a result consistent with the suggestion that
the dye-drug conjugate entered cancer but not normal cells.
[0054] FIG. 10 shows an exemplary synthetic route leading to
MHI-clorgyline.
[0055] FIG. 11 shows exemplary confocal images of C4-2B prostate
cancer cells treated with Mitotracker Green (top left), compound 10
(top right), DAPI (bottom left) and overlay (bottom center. The
brightfield image is in the top center.
[0056] FIG. 12 shows an exemplary MAO-A inhibition curve for
MHI-clorgyline 10.
[0057] Compound 10 was pre-incubated with 1.times.10.sup.6 prostate
C4-2B cells at 37.degree. C. for 20 min. Then, MAO A substrate C-14
serotonin was added to the incubation solution for 37.degree. C. 20
min. At the end of the incubation, the reaction product was
extracted and the radioactivity was counted. The MAO-A activity was
expressed as 69.6 nM product formed/20 min/mg protein. The activity
without the presence of inhibitor, compound 10, was taken as
100%.
[0058] FIG. 13 (A, B, C and D) show representative
immunohistochemical staining of normal (A), Gleason pattern 3 (B)
and 5 (C), and bone-metastatic (D) human prostate adenocarcinoma
clinical samples showed increased MAO-A expression in high grade
and bone metastatic PCa. Magnifications are .times.400 (A-C) and
.times.200 (D), respectively.
[0059] FIG. 14 (A, B, C, and D) MAO-A determines the growth of
human PCa tumor xenografts in vivo. Left panel (A-B), stable
overexpression of MAO-A in human PC-3 cells, which exhibit limited
MAO-A expression at baseline, enhanced the growth of tumor
xenografts (A) and tumor weight (B) in athymic nude mice (N=8).
Right panel (C-D), shMAO-A knockdown (KD) of MAO-A in human ARCaPM
cells eliminated the growth of tumor xenografts (C-D) in athymic
nude mice (N=5). shCon and shMAO-A, WT and MAO-A-KD cells. *,
p<0.05, **, p<0.01.
[0060] FIG. 15 (A, B and C) show effect of host MAO-A on prostate
cancer growth. 1.times.10.sup.5 of murine prostate carcinoma
TRAMPC-2 cells were subcutaneously injected into WT (N=6) and MAOA
KO (N=4) mice, 3 injection sites per mouse. Murine prostate
carcinoma TRAMPC-2 (neuroendocrine phenotype), subcutaneously
injected into the MAO-A neo mice, showed significantly reduced
growth rate of PCa, thereby suggesting a key role that host MAO-A
plays in determining the rate of prostate cancer growth. Tumor
incidence rate (A) and tumor volume (B) were determined along with
tumor progression, and tumor weight (C).
[0061] FIG. 16 (A and B) Representative X-ray (A) and Micro-CT (B)
of bone destruction (13-19 week) in mice intratibially injected
with scramble/MAO-A-KD human ARCaPM or C4-2 Pca cells. White arrows
point to osteolytic lesions.
[0062] FIG. 17 (A, B, C, D and E) MAO-A induces EMT in human PCa
cells. Left panel (A-B), overexpression of MAO-A in PC-3 cells
repressed E-cadherin and up-regulated Vimentin, N-cadherin and
Twist1 (A), and increased cell migration and invasion (B). Right
panel (C-E), shRNA knockdown of MAOA in ARCaPM cells increased
E-cadherin and down-regulated N-cadherin and Twist1 (C), reduced
cell migration and invasion (D), and changed cell morphology (E).
**, p<0.01. Magnifications are 200.times..
[0063] FIG. 18 (A and B) MAO-A enhances HIF1.alpha. expression in
human PCa cells. (A) Overexpression of MAO-A increased HIF1.alpha.
levels under hypoxia (0.5% 02), and (B) activated
HIF1.alpha.-regulated VEGFA, glucose transporter 1 (Glut1), Snail2
and Twist1 mRNA expression in response to 24-h hypoxia in PC-3
cells. Relative mRNA expression was all normalized with control
PC-3 cells under normoxia. **, p<0.01.
[0064] FIG. 19 (A and B) MAO-A enhanced NIR dye uptake in PC-3
tumor xenografts. (A) Representative in vivo MHI-148 NIR imaging
(i.p. injection, 10 nmol/20 g) of nude mice subcutaneously
implanted with control (left flank) and MAO-A-overexpressing (right
flank) PC-3 cells. Arrows point to tumor xenografts. (B) Tumor
tissues but not organs displayed strong signals by ex vivo NIR
imaging. (C) Quantitation of tumor NIR intensity in (A) by
determining total emission divided by tumor weight (5 mice). *,
p<0.05.
[0065] FIG. 20 (A, B, C, D, E and F) (A) shows immunohistochemistry
of E-cad, Vim and MAO-A in human patient samples of normal, G3 and
G5. (B) shows Western blot of MAO-A, E-cad, Vim, N-cad and Twist1
in MAO-A overexpressing PC-3 cells. (C) shows Luc assay of E-cad
promoter in control and MAO-A overexpressing PC-3 cells. (D) shows
Western blot of MAO-A and E-cad in MAO-KD LNCaP cells, real-time
PCR of Vim and N-cad in MAO-A-KD LNCaP cells. (E) shows migration
assays of MAO-A-manipulated PC-3 and LNCaP cells. (F) shows
invasion assays of MAO-A-manipulated PC-3 and LNCaP cells.
[0066] FIG. 21 (A, B, C, D and E) (A) shows Western blot of nuclear
HIF1a in MAO-A overexpressing PC-3 cells. (B) shows Western blot of
HIF1.alpha. in MAO-A overexpressing PC-3 cells in a time-dependent
manner. (C) shows real-time RT-PCR of Snail2, Twist1, VEGFA, Glut1
and HIF1.alpha. in MAO-A overexpressing PC-3 cells. (D) Western
blot of HIF1.alpha. in MAO-A-KD LNCaP cells in a time-dependent
manner. (E) shows real-time RE-PCR of Snail2, Twist1, VEGFA, Glut1
and HIF1.alpha. in MAO-A-KD LNCaP cells.
[0067] FIG. 22 (A, B, C, D, E, F and G) (A) Western blot of
HIF1.alpha.-OH and HIF1.alpha. in MAO-A overexpressing PC-3 cells
with the treatment of MG-132. (B) real-time PCR of VEGFA and Glut1
in MAO-A overexpressing PC-3 cells of DMOG treatment. (C) FACS of
ROS measurement in MAO-A expressing PC-3 cells under hypoxia. (D)
Western blot of HIF1.alpha. in MAO-A overexpressing PC-3 cells of
NAC treatment under hypoxia. (E) real-time RT-PCR of Twist1, VEGFA
and Glut1 in MAO-A overexpressing PC-3 cells of NAC treatment under
hypoxia. (F) shows Western blot of HIF1.alpha. in MAO-A
overexpressing PC-3 cells of both NAC and DMOG treatment. (G) shows
exemplary cells proliferation curves of MO-A overexpressing PC-3
cells under the treatment of NAC.
[0068] FIG. 23 (A, B, C, D, E, F, G and H) (A) shows real-time
RT-PCR and ELISA of VEGF in MAO-A manipulated PC-3 and LNCaP cells.
(B) shows Western blot of pAkt and pFoxO1 in PC-3 cells with VEGF
treatment. (C) shows Western blot of pAkt and pFoxO1 in MAO-A
manipulated PC-3 and LNCaP cells. (D) Western blot of NRP-1, pAkt
and pFoxO1 in MAO-A overexpressing/NRP-1-KD PC-3 cells. (E) shows
immunohistochemistry of H&E, VEGF and NRP-1 in MAO-A
overexpressing PC-3 tumor xenografts. (F) shows migration and
invasion assays of MAO-A overexpressing and NRP-1-KD PC-3 cells.
(G) shows exemplary cell proliferation curves of MAO-A
overexpressing PC-3 and NRP-1-KD PC-3 cells. (H) shows Western blot
of nuclear FoxO1 in MAO-A overexpressing PC-3 cells, PC-3 cells
with VEGF treatment, and NRP-1-KD PC-3 cells.
[0069] FIG. 24 (A, B, C, D, E, F, G and H) (A) real-time RT-PCR and
luc assay of Twist1 mRNA or promoter in MAO-A manipulated PC-3 and
LNCaP cells. (B) Western blot and real-time RT-PCR of Twist1 in
FoxO1 manipulated PC-3 cells. (C) shows luc assay of Twist1
promoter with WT/H215R AAA FoxO1 construct in PC-3 cells. (D) shows
characterization of a FoxO1-binding site in Twist1 promoter across
different species. (E) shows luc assay of WT/Mut Twist1 promoter
with FoxO1 construct in PC-3 cells. C/GA/TAAAC/AA is SEQ ID NO:6.
actgctgcccCCAAACTttccgcctgc is SEQ ID: NO:7.
aaaatatagaCCAAACTctaaggttct is SEQ ID: NO:8.
accgctgcccCCAAACTttccgcccgc is SEQ ID: NO:9.
actgctgcccCCAAACTttccgcccgc is SEQ ID: NO:10.
actgctgcccCCAAACTttccgcttgc is SEQ ID: NO:11. (F) shows luc assay
of WT/Mut Twist1 promoter in MAO-A overexpressing PC-3 cells. (G)
ChIP assay of the FoxO1-binding site in MAO-A overexpressing PC-3
cells. (H) shows a comparison of knock-down versus MOA-A
inhibition.
[0070] FIG. 25A, FIG. 25B, FIG. 25C, FIG. 25D and FIG. 25E (A)
shows tumor incidence, tumor volume and tumor weight of MAO-A-KD
LNCaP, C4-2, ARCaP.sub.m and MCP3 tumor xenograft. (B) shows MAO-A
activity of MAO-A-KD LNCaP and C4-2 tumor xenografts. (C)-(E) shows
immunohistochemistry of H&E, MAO-A, E-cad, Vim, HIF1.alpha.,
and VEGF in MAO-A-KD LNCaP and C4-2 tumor xenografts. (D) shows
tumor mitochondrial ROS measurement in MAO-A-KD LNCaP and C4-2
tumor xenografts.
[0071] FIG. 26 (A and B) (A) shows immunohistochemistry of MAO-A,
HIF1.alpha., VEGFA, FoxO1, pFoxO1 and Twist1 in human patient
samples of G3 and G5. (B) shows statistical analysis of
immunohistochemistry data.
[0072] FIG. 27 shows a schematic representation of the MAO-A driven
EMT mechanism.
DETAILED DESCRIPTION
Definition
[0073] Unless otherwise indicated herein, all terms used herein
have the meanings that the terms would have to those skilled in the
art of the present invention. Practitioners are particularly
directed to current textbooks for definitions and terms of the art.
It is to be understood, however, that this invention is not limited
to the particular methodology, protocols, and reagents described,
as these may vary.
[0074] "Treatment" refers to both therapeutic treatment and
prophylactic or preventative measures, wherein the object is to
prevent or slow down (lessen) the targeted pathologic condition or
disorder. Those in need of treatment include those already with the
disorder as well as those prone to have the disorder or those in
whom the disorder is to be prevented.
[0075] A "therapeutically effective amount" of a monoamine
inhibitor is an amount sufficient to carry out a specifically
stated purpose. An "effective amount" may be determined empirically
and in a routine manner in relation to the stated purpose.
[0076] A "Carrier" or "Carriers" as used herein include
pharmaceutically acceptable carriers, excipients, or stabilizers
which are nontoxic to the cell or mammal being exposed thereto at
the dosages and concentrations employed. The physiologically
acceptable carrier may be a sterile aqueous pH buffered solution.
Examples of physiologically acceptable carriers include buffers
such as phosphate, citrate, and other organic acids; antioxidants
including ascorbic acid; low molecular weight (less than about 10
residues) polypeptide; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, arginine or
lysine; monosaccharides, disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as
EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants.
[0077] Recent studies indicate that increased MAO-A is associated
with prostate cancer progression [5]; conversely, pharmacological
MAO-A inhibition or lentiviral shRNA-mediated silencing of MAO-A
significantly reduced the growth of prostate cancer cells in vitro
and tumor xenograft in vivo [6-8]. Furthermore, our data showed
that MAO-A induced epithelial-to-mesenchymal transition (EMT) in
human prostate cancer cells, by promoting the loss of E-cadherin
(an epithelial marker) expression, up-regulation of vimentin (a
mesenchymal marker) levels as well as increased invasion and
migration of prostate cancer cells. These results suggest that
MAO-A expression may be correlated with the metastatic potential of
prostate cancer cells. Taken together, this evidence strongly
supports the role of MAO-A as a potential novel target for the
treatment of human prostate cancer.
[0078] We have found that monoamine oxidase A (MAO-A) knock-down
(KD) prostate cancer cells did not grow when injected into mice.
This result was dramatically different from the WT prostate cancer
cells (See FIG. 1). A total of 10 wild-type (WT) mice in C57BL/6
background were used. Six mice were injected with WT MCP3 (PTEN/p53
double knockout) prostate carcinoma cells of C57 mouse strain
origin, 4 sites per mouse with a total of 24 sites. Four mice were
injected with MAO-A knock-down (KD) MCP3 cells, 4 sites per mouse
with a total 16 sites. The number of tumors was counted on the days
as indicated. The tumor incidence rate is defined as the total
number of detectable tumors divided by the total number of the
sites injected. As shown in FIG. 1, the tumor growth rate in mouse
tumor xenografts injected with MAO-A knock down MCP3 cells (filled
circles) compared with WT MCP3 cells (open circles). There was no
tumor growth when MAO-A knock down MCP3 (PTEN and p53 double KO)
prostate cancer cells (1.times.10.sup.6 cells) were injected in
mice, whereas significant number of tumors were found in WT MCP3
cell injected mice.
[0079] One aspect of the present invention is a method in which a
MAO-A inhibitor, clorgyline, can be delivered to cancer cells and
tissues by chemically conjugating clorgyline to a NIR dye. The
NIR-dye-clorgyline conjugate is expected to be uptaken by cancer
but not normal cells thus avoiding systemic toxicity of this MAOI.
Laser-scanning confocal microscopy can be used to determine
cellular uptake and localization of the nano-clorgyline within
cells (LNCaP, C4-2, and ARCaP.sub.M prostate cancer cell lines).
This class of NIR dyes can be readily uptake into cancer cells via
organic anion transporting peptides. FIGS. 10 and 11 show that NIR
dye (IR-783) conjugate of docetaxel, IR-783-docetaxel, was found to
be uptaken into human prostate cancer cells, pancreatic cancer
cells and renal cancer cells but not human prostate epithelial
cellsor fetal human kidney cells, suggesting such NIR
dye-chemotherapeutic agent conjugates enter cancer cells but not
normal cells.
[0080] To determine the ability of nano-clorgyline to inhibit
activity of MAO-A. MAO-A inhibition curve is obtained for prostate
cancer cells LNCaP, C4-2, and ARCaP.sub.M cell lines and compared
with that clorgyline itself. These cell lines have moderate to high
MAO-A activity. IC.sub.50 of nano-clorgyline is determined and
compared to that of clorgyline.
[0081] To study the effect of nano-clorgyline and NIR dyes (IR-783,
IR-780 and MHI-148)-clorgyline on MAO-A and MAO-B inhibition. MAO-A
and MAO-B inhibition curves is performed in mice. ICs.sub.50 are
determined.
[0082] To study the localization of nano-clorgyline, and NIR
dyes-clorgyline conjugates and its effect on tumor growth, prostate
cells are injected into mice. In one exemplary experiment, mice are
divided into 3 groups separately injected with (a) nano-clorgyline
of NIR dyes-clorgyline, (b) clorgyline itself, and (3) dye only,
respectively. The location of the nano-clorgyline was imaged, the
tumor's growth (size, number, and weight) was monitored, and the
results from the 3 groups were compared.
[0083] The result of the experiment demonstrated the effect of
nano-clorgyline on tumor growth. Having established the
effectiveness of the clorgyline nano-conjugate, it will be
appreciated by those skilled in the art that other parameters such
as the concentration required for inhibition of MAO-A activity and
tumor growth may be readily determined via routine
experimentation.
[0084] The MAO-A inhibitors, including the NIR dyes-MAOI conjugates
thereof, may be used alone or in combination with the existing
treatments on tumor growth and metastasis such as (a) surgical
castration; (b) radiation (c) docetaxel; (d) abiraterone.
[0085] Furthermore, this clorgyline-dye conjugate may be used in
connection with methods for treatment of prostate cancer and
methods for diagnosis and monitoring of the progression of the
prostate cancers by administering to a patient a composition
comprising an effective amount of the clorgyline-dye conjugate.
Design, Synthesis, Encapsulation and Testing of Clorgyline-Dye
Conjugate Nanoparticles (Nano-Clorgyline) in Cells.
1. IR-783 Nanoparticle Dye Conjugate
[0086] Preparation of Clorgyline-Dye Conjugate.
[0087] We have identified a class of near-infrared (NIR)
fluorescent heptamethine cyanine dyes, IR-783 (1) (see FIG. 2), as
a candidate for clorgyline conjugation. The near-infrared dye,
IR-783, is commercially available and can be readily converted to
precursor 3 in a single-step reaction with p-thioaniline 2. Based
on our modeling studies with crystal structure of clorgyline-MAO-A
complex [9], we determined that the amine nitrogen can be modified
by the linker needed to conjugate this compound to precursor 3, but
does not affects its inhibitory potency. The synthetic sequence for
the preparation of the derivative clorgyline acid 9 is outlined in
FIG. 2. The synthesis consists of a series of reductive amination
reactions that yield 9 from the commercially available
propargylamine 4 and 3-(2,4-dichlorophenoxy)propanal 5. Conjugation
of the two building blocks 3 and 9 can be accomplished by
well-established sequence of synthetic steps. Similarly to IR-783,
this conjugate is expected to have strong emission at 820-860 nm
upon excitation at 750-780 nm. It can be easily read by NIR
imaging.
[0088] Encapsulation of the Clorgyline-Dye Conjugates in
Nanoparticles.
[0089] In order to achieve water solubility of the clorgyline-dye
conjugates and enhance their delivery to tumors, we will
encapsulate them in calcium phosphate/silicate nanoparticles of
average size of 22 nm that are freely dispersible in water [10].
This encapsulation process results only in minor changes to the
photophysical properties of the dyes. Such an encapsulation method
has been reported by Adair as effective means of delivery of
hydrophobic dyes to cells [11]. Calcium phosphate is an excellent
matrix for nanoparticle encapsulation because moderate
concentrations of Ca.sup.2+ ions are not toxic to cells and in vivo
(found in human bone and teeth). It was shown that calcium
phosphate dissolves below pH 5.5, liberating the cargo, but it is
stable at pH 7.4 [12]. In addition, particles of this matrix
disperse freely in aqueous media.
[0090] Typically, such nanoparticles are prepared using aqueous
co-precipitation of calcium chloride and disodium hydrogen
phosphate in the presence of disodium silicate within water-in-oil
microemulsions [11, 13]. The encapsulation of the clorgyline-dye
conjugate in nanoparticles will be accomplished through its
addition into the microemulsion during precipitation. This process
will yield nano-clorgyline as a colloidal suspension of
nanoparticles of 22-30 nm in size. Its characterization will be
done through analysis of the size distribution, morphology, and
colloidal state of dispersion of the nanoparticle suspensions using
transmission electron microscopy (TEM).
[0091] To Determine the Inhibition of MAO-A Activity by
Nano-Clorgyline.
[0092] We will study the ability of nano-clorgyline to inhibit
MAO-A activity by performing the inhibitory curves in human
prostate cancel cell lines, LNCaP (non-metastatic cell line), C4-2
and ARCaPm, two metastatic cell lines. IC.sub.50 will be
determined. All these cell lines have moderate to high MAO-A
activity. Shih's lab routinely performs MAO-A inhibition assay in
vitro and in vivo.
[0093] To Determine if Nano-Clorgyline is Targeted to Mitochondria
of Cancer Cells.
[0094] We will use laser-scanning confocal microscopy to determine
cellular uptake and localization of the nano-clorgyline within
cells. The near-infrared dye moiety within the conjugate will serve
as a directing group, guiding the conjugate to mitochondria. It has
been shown that redox potential of mitochondria is different
between cancer and normal cells.
[0095] Human cancer cell lines (LNCaP, non-metastastic cell line,
C4-2, ARCaP.sub.M, two metastastic cell lines), will be tested. As
negative controls, normal human prostate epithelial cells (P69 and
NPE), normal human prostate fibroblasts (NPF), will be used.
[0096] It is anticipated the following studies will show that the
growth of prostate cancer will be significantly reduced after the
treatment with nano-clorgyline. The outcome will be determined by
reduced tumor growth in rate, size and weight. We expect
nano-clorgyline will be more effective with fewer side effects than
clorgyline itself. In addition, we will establish MAO-A as a
biomarker for prostate cancer, with nano-clorgyline to be used for
diagnostic tool; further, we will follow the progression of
prostate cancer during treatment through imaging of the uptake of
the nano-clorgyline.
2. MHI Dye Nanoparticle Conjugate
[0097] Synthesis of MHI-Corgyline:
[0098] MHI-clorgyline has been prepared through a series of
synthetic steps by conjugating dye MHI-148 and clorgyline as
outlined in FIG. 10. A linker of proper length was designed to
minimize negative impact of the dye on the inhibitory potency of
clorgyline.
[0099] Preparation of MHI-clorgyline started with commercially
available 2,4-dichlorophenol 1. This compound was alkylated under
standard conditions (NaOH, H.sub.2O) with 1,3-dibromopropane. The
product 2 was then reacted with NaN.sub.3 in DMF to yield the azide
3, which was subjected to the next step as a solution in MTBE
without further purification. The solution of 3 was hydrogenated
under low H.sub.2 pressure using Pd on activated charcoal as a
catalyst in the presence of Boc.sub.2O and resulting in the
formation of the carbamate 4. This compound was alkylated with
propargyl bromide using NaH in dry DMF, producing Boc-protected
alkyne 5. The Boc protecting group was removed under acidic
conditions using TFA in DCM. The product 6 was alkylated again with
1-bromo-3-thioacetylpropane 7, resulting in the formation of 8,
albeit in low yield. Removal of the acetyl protective group was
carried out in methanolic HCl and afforded intermediate 9. This
intermediate was then coupled with MHI-148 dye using EDC and 4-DMAP
to afford the product MHI-clorgyline 10. This product was purified
using reverse-phase HPLC and its identity was confirmed by mass
spectrometry.
[0100] Imagining of MHI-Clorgyline in Live Cells:
[0101] Previous study showed that the near-IR hepatamethine cyanine
dyes IR-783 and MHI-148 can be retained in cancer cells but not
normal cells in tumor xenografts and in spontaneous tumors in
transgenic mice. Moreover, the two dyes also have strong emission
at 820-860 nm upon excitation at 750-780 nm, which can be easily
detected and visualized by NIR imaging equipment and laser-scanning
confocal microscopes. Here, we resorted to the use of Zeiss LSM 510
confocal microscope as the imaging equipment. Although cellular
uptake of the conjugate was uncertain, due to the similarity in
structure, MHI-clorgyline conjugates were expected to have similar
fluorescence properties as the NIR dye itself. Therefore, NIR
imaging with laser-scanning confocal microscope was used to examine
the cellular uptake of MHI-clorgyline in human prostate epithelial
cancer cells (C4-2B). This cell line was selected due to its high
levels of the expressed MAO-A.
[0102] In the preliminary study we found that IR-783 dye
co-localized in mitochondria of the live cells. An imaging study
with the newly synthesized MHI-clorgyline 10 was carried out (FIG.
11). This compound also showed rapid accumulation in C4-2B PCa
cells and was localized in the mitochondria, as determined by the
co-staining with mitochondria-specific dye.
[0103] In order to test an inhibitory activity of the
MHI-clorgyline 10, a standard MAO A inhibition assay was carried
out in C4-2B cells using radiolabeled substrates. The results
clearly indicate that our designed conjugate 10 inhibits MAO A
activity with mean IC.sub.50 of 2.18.times.10.sup.-5 M (FIG. 12).
The activity of the conjugate 10, while lesser than that of
clorgyline itself (data not shown), is sufficient for the in vivo
studies, which are currently ongoing.
The Function of the Nano-Clorgyline In Vivo--its Location and
Inhibition of Tumor Growth in Mice.
[0104] To Study the Location of Nano-Clorgyline, and its Effect on
Tumor Progression in Mice.
[0105] We will inject human LNCAP non-metastatic prostate cancer
cells (1.times.10.sup.6) into immunodeficient nude mice with (1)
nano-clorgyline, concentration required to inhibit nearly 100% of
MAO-A activity using results from Specific Aim 1b; (2) clorgyline
itself (positive control, 10 mg/kg for 100% inhibition of MAO-A
activity); (3) dye itself (negative controls, same concentration as
nano-clorgyline). A total of 18 mice is required for this part of
the study (6 per each group).
[0106] Then, we will image the tumor location, monitor the tumor
growth (size, number) every other day for one month. The tumor will
be located by NIR imaging. The Olenyuk lab has an extensive
experience in NIR imaging and the needed equipment is available at
the Norris Cancer Center. If our hypothesis is correct, the
nano-clorgyline will be located in prostate cancer, and the tumor
growth will be reduced. At the end of 30 days, the mice will be
sacrificed, the MAO-A activity will be determined in the tumor (if
there is still tumor) and the normal prostate tissues. See FIG. 1
in prior work for details of this experiment). This study will
demonstrate the potential useful of nano-clorgyline for diagnosis
and therapy.
[0107] To Study the Effect of Nano-Clorgyline on the Metastasis of
Prostate Cancer in Mice.
[0108] Human prostate cancer cells with metastatic potential will
be injected to mice, human C4-2, ARCaPm, (1.times.10.sup.6 cells),
same three group of mice will be used, the procedure and the
experiments will be the same as described in Specific Aim 2a. The
tumor growth rate and size and locations will be determined. The
presence of absence of the tumor in the bone, will be examined and
as an indication of metastasis. A total of 36 mice will be used (18
mice per each cell line with 3 groups of treatment; 2 metastatic
cell lines).
[0109] The effects of nano-clorgyline alone or in combination with
the existing treatments on tumor growth and metastasis in mice.
[0110] First line treatment for advanced prostate cancer is
androgen ablation therapy (ADT). Unfortunately the duration of
response to ADT is limited (about 18 months) and the patients
eventually develop castration resistance. The first line treatment
for patients with castration resistant PCA is usually chemotherapy
with the microtubule inhibitor, docetaxel. Recently, FDA approved
the specific CYP17 inhibitor, abiraterone, for the treatment of
castration resistant patients who fail docetaxel therapy. This
study will evaluate the effects of nano clorgyline alone or in
combination with one of these treatment approaches on tumor growth.
Since the nano clorgyline can be read non-invasively by INR
imaging, the prognosis of each treatment can be easily
determined.
[0111] Human LNCAP cells (non-metastatic prostate cancer cell
line). Alternatively, ARCaPm (with potential for metastasis) will
be injected to immunodeficient nude. Next, mice will be divided to
three groups as described in A. The tumor location, size, number of
lesions will be determined every other day from day 1 to day 30. On
day 31 mice will be sacrificed, tumor and host MAO Activity will be
determined. [0112] A: (Group I) nano-chlorgyline (1 mg/kg*) with
androgen ablation therapy (castration)** [0113] (Group II)
nano-chlorgyline alone (1 mg/kg*) [0114] (Group III) castration
alone** [0115] B: (Group I) docetaxel (daily, 15 mg/kg) [0116]
(Group II) nano-chlorgyline alone 1 mg/kg*), [0117] (Group III)
docetaxel (15 mg/kg), nano-chlorgyline (1 mg/kg*) [0118] C: (Group
I) new drug (abiraterone, 180 mg/kg) daily [0119] (Group II)
nano-chlorgyline alone (1 mg/kg*), [0120] (Group III) new drug
(abiraterone, 180 mg/kg) and nano-clorgyline 1 mg/kg*) *The
concentration of nano-clorgyline to be used will be adjusted based
on the results obtained from specific aim 1b.
[0121] For the castration group, trans-scrotal castration will be
performed under isoflurane anesthesia with proper aseptic and
antiseptic technique. A total of 108 mice will be used.
[0122] Synthesis of Nanoparticle Conjugates with Other Novel MAO-A
Inhibitors Obtained from High Throughput Screening.
[0123] Optionally, other novel MAO-A inhibitors, disclosed herein
may be conjugated for use in the methods and treatments of the
present invention. Specifically, below are examples of four high
affinity novel MAO-A inhibitors 11-14. They may be conjugated with
the near-infrared dye, such as IR-783. The phenol functionality
(--OH) presents a viable choice for linker attachment and the
subsequent derivatization of these molecules with fluorescent
precursor 3 in order to generate novel nanoparticle based MAO-A
inhibitors.
MAO-A Confers Prostate Cancer EMT by Stabilizing H1F1.alpha. and
Enhancing VEGF-Mediated Twist1 Activation
[0124] High Gleason grade prostate carcinomas are aggressive,
poorly differentiated tumors that exhibit elevated MAO-A
expression. We have found that a key function of MAO-A is to
promote an epithelial-to-mesenchymal transition (EMT). EMT is the
process of cellular development characterized by loss of cell
adhesion, repression of E-cadherin expression, and increased cell
mobility. In the context of cancer, promotion of EMT correlates
with the increased cell invasion, migration and metastatic
potential, hence, the EMT-promoting effect of MAO-A connects MAO-A
activity to cancer. More specifically, we have found that
overexpression of MAO-A in human prostate cancer cells induces the
loss of E-cadherin (an epithelial marker), up-regulates
Vimentin/N-cadherin (mesenchymal markers) and increases cell
migration and invasion Conversely, knockdown of MAO-A impedes EMT
in human prostate cancer cells.
[0125] Without being bound to any particular theory, we offer the
following experimental observations (FIGS. 20-26). to explain in
mechanistic terms the corrections between MAO-A activity and its
various cancer promoting effects.
[0126] First, we found that MAO-A enhances HIF1.alpha. stability by
reducing prolyl hydroxylase (PHD) activities and increasing
intracellular ROS levels. We then found that by treating prostate
cancer cells with a ROS scavenger (N-acetylcysteine), MAO-A-induced
HIF1.alpha. expression is diminished, which in turn, also decreased
MAO-A-enhanced cell proliferation. Moreover, we also found that
MAO-A mediated the activation of VEGF and its receptor Neuropilin-1
(NRP1) in response to hypoxia, which in turn stimulated the
Akt/FoxO1 signaling pathway and reduced FoxO1 activity by promoting
its phosphorylation followed by nuclear export. We further
discovered that FoxO1 acts as a transcriptional repressor of Twist1
and binds to a response element in the proximal region of Twist1
promoter. Twist1 is known to be an oncogene in several cancers and
is involved in tumor metastasis. FIG. 27 summarizes the
mechanism.
[0127] Importantly, this mechanism is manifested in high Gleason
grade cancers, which exhibit significantly more HIF1.alpha., VEGF
and Twist1 expression, but less FoxO1 nuclear localization compared
to low Gleason grade cancers. Therefore, expression levels of
MAO-A, HIF1.alpha., VEGF and Twist1 serve as a biomarker for
objectively differentiating high Gleason grade cancers from low
Gleason grade cancers.
EXAMPLES
[0128] The following examples are provided in order to demonstrate
and further illustrate certain embodiments and aspects of the
present invention and are not to be construed as limiting the scope
thereof. While such examples are typical of those that might be
used, other procedures known to those skilled in the art may
alternatively be utilized. Indeed, those of ordinary skill in the
art can readily envision and produce further embodiments, based on
the teachings herein, without undue experimentation.
Example 1
MAO-A KO in Host Experiment 1: Murine F9 Teratocarcinoma Tumor
Xenograft in WT and MAO-A KO Mice
[0129] Cell # injected: 1.times.10.sup.5 Mice #: WT (N=9) and MAO-A
KO (N=9) Tumor injection site #: WT (2.times.9=18) and MAO-A KO
(2.times.9=18) Tumor incidence rate: WT (11/18=61.1%) and MAO-A KO
(3/18=16.7%) Tumor growth: WT>MAO-A KO (p<0.05) Tumor weight:
WT>MAO-A KO (p<0.05)
Example 2
MAO-A KO in Host Experiment 2: Murine MCP3 (pten/p53 Double KO)
Prostatic Tumor Xenograft in WT and MAO-A KO Mice
[0130] Cell # injected: 1.times.10.sup.6 Mice #: WT (N=3) and MAO-A
KO (N=3) Tumor injection site #: WT (4.times.3=12) and MAO-A KO
(4.times.3=12) Tumor incidence rate: WT (11/12=91.7%) and MAO-A KO
(10/12=83.3%) Tumor growth: WT>MAO-A KO (p<0.05) Tumor
weight: WT>MAO-A KO (p=0.25)
Example 3
MAO-A KO in Host Experiment 3: Murine MCP3 Prostatic Tumor
Xenograft in WT and MAOA KO Mice
[0131] Cell # injected: 1.times.10.sup.5 Mice #: WT (N=4) and MAO-A
KO (N=5) Tumor injection site #: WT (3.times.4=12) and MAO-A KO
(3.times.5=15) Tumor incidence rate: WT (10/12=83.3%) and MAO-A KO
(0/15=0) Tumor growth: No MCP3 tumor growth in MAO-A KO mice
Example 4
MAO-A KD in Tumor Experiment 1: Murine WT and MAO-A-KD MCP3
Prostatic Tumor Xenograft in C57BL/6 Mice
[0132] Cell # injected: 1.times.10.sup.6 Mice #: Mice for WT MCP3
cells (N=6) and mice for MAO-A-KD MCP3 cells (N=4) Tumor injection
site #: WT MCP3 cells (4.times.6=24) and MAO-A-KD MCP3 cells
(4.times.4=16) Tumor incidence rate: WT MCP3 cells (21/24=87.5%)
and MAO-A-KD MCP3 cells (0/16=0) Tumor growth: With MAO-A KD in
tumor, there is no tumor growth.
Example 5
MAO-A KD in Tumor Experiment 2: Murine WT and MAO-A-KD MCP3
Prostatic Tumor Xenograft in C57BL/6 Mice
[0133] Cell # injected: 1.times.10.sup.6 Mice #: Mice for WT MCP3
cells (N=6) and mice for MAO-A-KD MCP3 cells (N=6) Tumor injection
site #: WT MCP3 cells (3.times.6=18) and MAO-A-KD MCP3 cells
(3.times.6=18) Tumor incidence rate: As of July 16, WT MCP3 cells
(15/18=83.33%) and MAO-A-KD MCP3 cells (0/18=0).
Example 6
Synthesis of MHI-Clorgyline and the Role of MAO-A in Prostate
Cancer Progression
[0134] General Synthesis:
[0135] All reagents and solvents were obtained from commercial
sources and were used as received unless otherwise stated. All
reactions involving moisture-sensitive reagents were conducted
under argon atmosphere with anhydrous solvents and flame-dried
glassware. Hygroscopic liquids were transferred via a syringe and
were introduced into reaction vessels through rubber septa.
Reaction product solutions were concentrated using a rotary
evaporator at 30-150 mm Hg. Column chromatography was performed on
silica gel (230-400 mesh) using reagent grade solvents. Analytical
thin-layer chromatography (TLC) was performed on glass-backed,
pre-coated plates (0.25 mm, silica gel 60, F-254, EM Science).
Analytical HPLC were performed on Microsorb-MV C.sub.8
reverse-phase column (250.times.4.6 mm, Varian) using Shimadzu
LC-10A VP pump and Shimadzu SPD 10A VP UV-vis variable-wavelength
detector. Preparative HPLC purifications were carried out with
C.sub.8 reverse phase preparative column (Grace Davison). The flow
rate for preparative reverse-phase HPLC was 4 mL/min. In all cases,
5%-95% gradients of acetonitrile in 0.1% aqueous trifluoroacetic
acid (TFA) were used as eluents. Water (18 M.OMEGA.) was obtained
from a Barnstead water purification system, and all buffers were
0.2 .mu.m filtered. Nuclear magnetic resonance (NMR) spectra were
collected on Varian 400 MHz instruments in the indicated solvents.
The peak positions are reported with chemical shifts (.delta.) in
parts per million (ppm) downfield from the signal for
tetramethylsilane (0 ppm) and referenced to the signal resulting
from the incomplete deuteration of a solvent used in the experiment
(CDCl.sub.3: 7.26 ppm, or the center line of the multiplet of
DMSO-D.sub.6: 2.50 ppm). Carbon-13 chemical shifts are reported as
.delta. values in ppm and referenced to the cabon-13 signal of a
solvent used in the experiment (CDCl.sub.3: 77.0 ppm, or the center
line of the multiplet DMSO-D.sub.6: 39.51 ppm). The coupling
constants (J) are reported in Hertz (Hz). The following
abbreviations are used: singlet (s), doublet (d), triplet (t),
doublet of doublets (dd), multiplet (m). Mass spectra were obtained
from the Agilent 6520 time-of-flight mass spectrometer.
(1) Synthesis of MHI-Clorgyline:
Synthesis of 1-(3-bromopropoxy)-2,4-dichlorobenzen (2)
##STR00014##
[0137] A mixture of 2,4-dichlorophenol 1 (4.1 g, 25 mmol),
1,3-dibromopropane (10 g, 50 mmol) and a solution of sodium
hydroxide (1.0 g) in water (4 mL) was stirred at reflux for 1.5 h.
A solution of sodium hydroxide (1.0 g) in water (6 mL) was added
and the mixture was refluxed for an additional 1.5 h. After
cooling, the reaction mixture was extracted with chloroform (50 mL)
and washed with water (30 mL.times.3). The organic layer was dried
over sodium sulfate and evaporated in vacuo. Crude product was
obtained (10.49 g) and then purified by silica gel column (79.16
g). Yield 10.7% (0.794 g).
Synthesis of 1-(3-azidopropoxy)-2,4-dichlorobenzene (3)
##STR00015##
[0139] To a solution of 1-(3-bromopropoxy)-2,4-dichlorobenzene (600
mg, 2.11 mmol) in 6.0 mL DMF in a 25 mL round-bottom flask equipped
with a stir bar, a thermocouple in a thermowell and a rubber septum
stopper with sleeve, 234.0 mg (3.60 mmol) of NaN.sub.3 was added at
room temperature. Under N.sub.2 pressure, the mixture was stirred
overnight. The formation of off-white suspension was observed. 20
.mu.L of the reaction mixture was partitioned with 0.5 mL MTBE and
0.5 mL water, and the MTBE layer was used for TLC (silica gel, 100%
hexane). The rest of the reaction mixture was partitioned with MTBE
and water. The water layer was washed by MTBE. The MTBE layer were
washed sequentially with water and NaHCO.sub.3, and then used in
the next step without further purification.
Synthesis of tert-butyl 3-(2,4-dichlorophenoxy)propylcarbamate
(4)
##STR00016##
[0141] The MTBE layer obtained from the previous step was
transferred into a 500 mL round-bottom flask equipped with a stir
bar and a rubber septum stopper with sleeve. In N.sub.2 atmosphere,
Boc.sub.2 (571.0 mg, 2.616 mmol) and Pd/C (518 mg) was added.
N.sub.2 was carefully replaced by H.sub.2. A rubber balloon was
used to keep the system under positive gas pressure. TLC (silica
gel, 100% hexane to detect starting material and MTBE: hexane=1:1
to detect the product, ninhydrin stain) was used to follow the
process of the reaction. Under N.sub.2 pressure, the mixture was
stirred for 21 h. The reaction mixture was filtered under vacuum
through glass microfiber and Celite 545. The filtrate was partition
by MTBE and water. The water layer was washed by MTBE. The MTBE
layers were washed sequentially with water, saline and NaHCO.sub.3,
dried by MgSO.sub.4, filtered and evaporated. Crude product (991.2
mg) was obtained after work up and purified by silica gel column.
Yield 11.4% (77.3 mg).
Synthesis of tert-butyl
3-(2,4-dichlorophenoxy)propyl(prop-2-ynyl)carbamate (5)
##STR00017##
[0143] To a solution of tert-butyl
3-(2,4-dichlorophenoxy)propylcarbamate (77.3 mg, 0.24 mmol) in 0.8
mL DMF in a 20 mL vial equipped with a stir bar and a rubber septum
stopper with sleeve and under Ar pressure, NaH (11.9 mg, 0.30 mmol)
was added with cooling by ice bath. The reaction mixture was kept
under Ar atmosphere at all times. Propargyl bromide in toluene
(44.5 mg, 0.30 mmol) was added. The reaction mixture was stirred at
room temperature. Next, a small portion of the reaction mixture
(10-15 .mu.L) was partitioned with 350 .mu.L MTBE and 350 .mu.L
water, and the MTBE layer was used for TLC (silica gel, hexane:
MTBE=1:1). The rest of the reaction mixture was partitioned with 20
mL MTBE and 20 mL water. The water layer was washed by 20 mL MTBE.
The MTBE layers were washed sequentially with water, saline and
NaHCO.sub.3, dried by MgSO.sub.4, filtered and evaporated. Crude
product was purified by silica gel column (1.23 g). Yield 27.4%
(23.7 mg).
Synthesis of N-(3-(2,4-dichlorophenoxy)propyl)prop-2-yn-1-aminium
2,2,2-trifluoroacetate (6)
##STR00018##
[0145] To a solution of tert-butyl
3-(2,4-dichlorophenoxy)propyl(prop-2-ynyl)carbamate (23.7 mg, 66.1
.mu.mol) in 600 .mu.L DMF in a 20 mL vial equipped with a stir bar,
600 .mu.L TFA was added at room temperature while stirring. In 0.5
h, TLC (MTBE: hexane=1:1, ninhidrin stain) indicated the completion
of the reaction. The volatiles were evaporated. The residue was
co-evaporated with ACN for 3 times and then used in the next step
without further purification.
[0146] Structure of the product was proved by NMR and LC-MS.
Synthesis of S-3-bromopropyl ethanethioate (7)
##STR00019##
[0148] A 250 mL three-neck round-bottom flask equipped with a
thermocouple in a glass sleeve, a magnetic stirrer, a vigreux
column with an Argon inlet (middle stem) and a sleeved rubber
septum stopper was assembled and dried with a heat gun under flow
of Ar. Approximately 110-120 mL of anhydrous DMF was added via
cannula under Ar. AcSK (11.68 g, 102.3 mmol) was added by portions
into the flask while cooled with ice-MeOH bath. The reaction went
on for 7 h at about -10.degree. C. The ice-MeOH bath was removed
after quenching the reaction by adding 165 mL water. The reaction
mixture was partitioned with 300 mL MTBE and 700 mL water. The
water layer was washed by 200 mL MTBE. The MTBE layers were washed
sequentially with water, saline and NaHCO.sub.3, dried by
MgSO.sub.4, filtered and evaporated. Yield 98.7% (19.1 g).
Synthesis of
S-3-((3-(2,4-dichlorophenoxy)propyl)(prop-2-ynyl)amino)propyl
ethanethioate (8)
##STR00020##
[0150] To a solution of
N-(3-(2,4-dichlorophenoxy)propyl)prop-2-yn-1-aminium
2,2,2-trifluoroacetate (2.14 mg, 0.05 mmol) in 100 .mu.L ACN in a 5
mL vial equipped with a stir bar, 12.1 mg (0.09 mmol) of
K.sub.2CO.sub.3 and 142.4 mg (0.720 mmol) S-3-bromopropyl
ethanethioate was added. The mixture was stirred while heated to
50.degree. C. in an oil bath. TLC was performed (silica gel, MTBE:
hexane=9:1 to detect starting material and MTBE: hexane=1:9 to
detect the consumption of the thioacetate reagent) to follow the
process of the reaction. To a solution of
N-(3-(2,4-dichlorophenoxy)propyl)prop-2-yn-1-aminium
2,2,2-trifluoroacetate (17.1 mg, 0.05 mmol) in 800 .mu.L ACN in a
20 mL vial equipped with a stir bar, 120.0 mg (0.870 mmol) of
K.sub.2CO.sub.3 and 95.2 mg (0.48 mmol) S-3-bromopropyl
ethanethioate was added. The mixture was stirred while heated by
50.degree. C. oil bath for 5 h. The reaction mixtures of the two
reactions were combined, filtered and evaporated. Crude product
(168.4 mg) was obtained and co-evaporated with hexane for 3 times
to remove ACN. Silica gel column (1.25 g) was used to purify the
crude product. Yield 14% (2.6 mg).
[0151] Structure of the product was proved by NMR and LC-MS
Synthesis of
3-((3-(2,4-dichlorophenoxy)propyl)(prop-2-ynyl)amino)propane-1-thiol
(9)
##STR00021##
[0153] A solution of
S-3-((3-(2,4-dichlorophenoxy)propyl)(prop-2-ynyl)amino)propyl
ethanethioate (1.17 mg, 3.10 .mu.mol) in 200 .mu.L ACN was added
into a 20 mL vial equipped with a stir bar, evaporated and then
co-evaporated with MeOH for 3 times to remove ACN. MeOH/HCl (200
.mu.L) was added into the vial and then the vial was heated by
85.degree. C. oil bath for 6 h. The reaction mixture was
evaporated, co-evaporated sequentially by MeOH for 3 times and ACN
for 3 times, and then used in the next step without further
purification.
Synthesis of MHI 148-clorgyline conjugate (10)
##STR00022##
[0155] MHI-148 (4.7 mg, 6.2 mmol) and EDC (1.5-2.4 mg, 7.8-12
mmol), followed by 1.5 mg of DMAP (12 mmol) were added into a 20 mL
vial equipped with a stir bar. ACN (400 .mu.L) was added to make
solution. The reaction mixture of the previous step was transferred
dropwise to the vial with 200 .mu.L ACN at room temperature. The
reaction mixture was purified by HPLC (GRACE Davison Apollo C.sub.8
5 u column, 250 mm.times.10 mm).
Mechanistic Investigation of the Role of MAOA in PCa
Progression
[0156] Our preliminary data suggest that MAO-A is closely related
to prostate cancer (PCa) metastasis to bone and for the first time
demonstrate that MAO-A protein expression was elevated in PCa bone
metastasis relative to normal and low Gleason grade cancerous
epithelium (FIG. 13).
[0157] Manipulation of levels of MAO-A expression in human
bone-metastatic PC-3 and ARCaP.sub.M PCa cells resulted in altered
tumor growth in mice. PC-3 cells overexpressing wild-type MAO-A
enhanced its growth whereas ARCaP.sub.M cells with specific
lentiviral shRNA-mediated silencing completely abrogated the growth
of this invasive and bone-metastatic PCa tumor in mice (FIG. 14).
These results raise the possibility that MAO-A is an ideal
therapeutic target for the treatment of PCa tumors with high
propensity for bone and visceral organ metastases.
[0158] Our experiments with murine prostate carcinoma TRAMPC-2
(neuroendocrine phenotype), subcutaneously injected into the MAOA
neo mice, showed significantly reduced growth rate of PCa (FIG.
15), thereby suggesting a key role that host MAOA plays in
determining the rate of prostate cancer growth.
[0159] Specifically in the bone microenvironment, knockdown of
MAO-A in two castration-resistant human PCa cell lines, ARCaP.sub.M
and C4-2, also significantly reduced cancer-induced local bone
destruction by osteolytic lesions (FIG. 16).
[0160] Mechanistically, MAO-A was found to induce
epithelial-to-mesenchymal transition (EMT) in human PCa cells, by
promoting the loss of E-cadherin expression (an epithelial marker),
up-regulation of Vimentin-N-cadherin (mesenchymal markers) and
increased migration and invasion in PC-3 cells (FIG. 17A-B);
conversely, MAOA knockdown impeded EMT in human ARCaP.sub.M cells
(FIG. 17C-E). Activation of the EMT program can direct the local
growth and distant dissemination of PCa cells to skeletons and soft
tissues. These data suggest that MAO-A expression and its
downstream signaling axes might be highly relevant to the
development of metastatic PCa and its associated EMT
phenotypes.
[0161] We also observed that overexpression of MAO-A enhanced
hypoxia-inducible factor 1.alpha. (HIF1.alpha.) expression, and
select HIF1.alpha. target genes known to promote PCa progression
and metastasis, such as VEGF and EMT-promoting genes (Snail2 and
Twist1), are also influenced by MAO-A in PCa cells (FIG. 18).
Hypoxia increases tumor angiogenesis and survival responses as well
as invasion and metastasis through the up-regulation of
HIF1.alpha.-dependent relevant genes. Chronic hypoxia, a hallmark
of many solid tumors, often in conjugation with elevated levels of
reactive oxygen species, has been suggested to affect each step of
the metastasis process, from the initial EMT to the ultimate
organotropic colonization. Thus, this data further provides
important mechanistic insights into the roles of MAO-A in mediating
human PCa metastasis to bone and other soft tissues.
[0162] A class of fluorescent heptamethine cyanines with
near-infrared (NIR) emission maxima, such as MHI-148 dye, which has
been identified recently, are non-toxic and have dual functions as
tumor-specific targeting and imaging modalities. These dyes,
partially mediated by hypoxia, are specifically retained in cancer
but not normal cells, and also in tumor xenografts as well as
spontaneous tumors in transgenic mice. We have shown enhanced
uptake of MHI-148 NIR dye in MAO-A-overexpressing PC-3 tumor
xenografts (FIG. 19). This would allow the development and
validation of novel PCa-seeking MAO-A inhibitors with acquired
synergistic tumor-targeting abilities as new agents for PCa
therapies with minimal systemic host toxicity.
[0163] Although the present invention has been described in terms
of specific exemplary embodiments and examples, it will be
appreciated that the embodiments disclosed herein are for
illustrative purposes only and various modifications and
alterations might be made by those skilled in the art without
departing from the spirit and scope of the invention as set forth
in the following claims.
REFERENCES
[0164] The following references are incorporated herein by
reference: [0165] 1. Bortolato, M., Chen, K., and Shih, J. C.
(2008) Advanced Drug Delivery Reviews 60, 1527-1533 [0166] 2. Shih,
J. C., Chen, K., and Ridd, M. J. (1999) Annual Review of
Neuroscience 22, 197-217 [0167] 3. Josson, S., Nomura, T., Lin, J.
T., Huang, W. C., Wu, D. Q., Zhau, H. E., Zayzafoon, M., Weizmann,
M. N., Gururajan, M., and Chung, L. W. K. (2011) Cancer Research
71, 2600-2610 [0168] 4. Trachootham, D., Alexandre, J., and Huang,
P. (2009) Nature Reviews Drug Discovery 8, 579-591 [0169] 5. Peehl,
D. M., Coram, M., Khine, H., Reese, S., Nolley, R., and Zhao, H. J.
(2008) Journal of Urology 180, 2206-2211 [0170] 6. Zhao, H. J.,
Flamand, V., and Peehl, D. M. (2009) Bmc Medical Genomics 2, [0171]
7. Flamand, V., Zhao, H. J., and Peehl, D. M. (2010) Journal of
Cancer Research and Clinical Oncology 136, 1761-1771 [0172] 8.
True, L., Coleman, I., Hawley, S., Huang, C. Y., Gifford, D.,
Coleman, R., Beer, T. M., Gelmann, E., Datta, M., Mostaghel, E.,
Knudsen, B., Lange, P., Vessella, R., Lin, D., Hood, L., and
Nelson, P. S. (2006) Proceedings of the National Academy of
Sciences of the United States of America 103, 10991-10996 [0173] 9.
De Colibus, L., Li, M., Binda, C., Lustig, A., Edmondson, D. E.,
and Mattevi, A. (2005) Proceedings of the National Academy of
Sciences of the United States of America 102, 12684-12689 [0174]
10. Ueno, Y., Jose, J., Loudet, A., Perez-Bolivar, C., Anzenbacher,
P., Jr., and Burgess, K. (2011) J Am Chem Soc 133, 51-55 [0175] 11.
Barth, B. M., Sharma, R., Altinoglu, E. I., Morgan, T. T.,
Shanmugavelandy, S. S., Kaiser, J. M., McGovern, C., Matters, G.
L., Smith, J. P., Kester, M., and Adair, J. H. (2010) Acs Nano 4,
1279-1287 [0176] 12. Altinoglu, E. I., Russin, T. J., Kaiser, J.
M., Barth, B. M., Eklund, P. C., Kester, M., and Adair, J. H.
(2008) Acs Nano 2, 2075-2084 [0177] 13. Jose, J., Loudet, A., Ueno,
Y., Wu, L., Chen, H. Y., Son, D. H., Barhoumi, R., Burghardt, R.,
and Burgess, K. (2011) Org Biomol Chem 9, 3871-3877
Sequence CWU 1
1
11158DNAArtificial SequenceSynthetic oligonucleotide 1ccggcggata
ttctctgtca ccaatctcga gattggtgac agagaatatc cgtttttg
58221DNAArtificial SequenceSynthetic oligonucleotide 2gtgtcagcca
aagcatggag a 21321DNAArtificial SequenceSynthetic oligonucleotide
3cagtcaagag tttggcagca g 21420DNAArtificial SequenceSynthetic
oligonucleotide 4cagccacccg agattgagca 20520DNAArtificial
SequenceSynthetic oligonucleotide 5tagtagcgac gggcggtgtg
20610DNAArtificial SequenceCanonical Fox01-binding site 6cgataaacaa
10727DNAHomo sapiens 7actgctgccc ccaaactttc cgcctgc 27827DNAPan
troglodytes 8aaaatataga ccaaactcta aggttct 27927DNAMus musculus
9accgctgccc ccaaactttc cgcccgc 271027DNARattus norvegicus
10actgctgccc ccaaactttc cgcccgc 271127DNABos taurus 11actgctgccc
ccaaactttc cgcttgc 27
* * * * *