U.S. patent application number 15/659568 was filed with the patent office on 2018-06-28 for ceacam1 mediated protective immunity.
The applicant listed for this patent is GAL MARKEL. Invention is credited to GAL MARKEL.
Application Number | 20180177902 15/659568 |
Document ID | / |
Family ID | 38092631 |
Filed Date | 2018-06-28 |
United States Patent
Application |
20180177902 |
Kind Code |
A1 |
MARKEL; GAL |
June 28, 2018 |
CEACAM1 MEDIATED PROTECTIVE IMMUNITY
Abstract
The presently described technology relates to the modulation of
specific immune responses to create a protective immunity in the
treatment of autoimmune diseases and diseases requiring the
transplantation of tissue. In particular, the present technology
relates to the suppression of immune responses in a targeted
fashion, by increasing the functional concentration of the CEACAM1
protein in a target tissue to create a localized protective
immunity for the treatment of autoimmune diseases and diseases
requiring the transplantation of tissue.
Inventors: |
MARKEL; GAL; (HAIFA,
IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MARKEL; GAL |
HAIFA |
|
IL |
|
|
Family ID: |
38092631 |
Appl. No.: |
15/659568 |
Filed: |
July 25, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14287901 |
May 27, 2014 |
9731036 |
|
|
15659568 |
|
|
|
|
11423395 |
Jun 9, 2006 |
8735157 |
|
|
14287901 |
|
|
|
|
60689316 |
Jun 9, 2005 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 49/0056 20130101;
A61K 49/0004 20130101; A61P 35/00 20180101; A61K 38/1774 20130101;
C07K 2317/732 20130101; A61K 49/0058 20130101; A61K 51/04 20130101;
G01N 33/56972 20130101; G01N 33/574 20130101; A61K 35/17 20130101;
G01N 2333/70596 20130101; A61K 51/088 20130101; C12N 5/0636
20130101; G01N 33/57492 20130101; A61K 51/10 20130101; C07K
14/70503 20130101; A61K 2035/122 20130101; C12N 5/0635 20130101;
A61K 49/0052 20130101; C07K 2317/54 20130101; C07K 16/3007
20130101 |
International
Class: |
A61K 51/10 20060101
A61K051/10; A61K 35/17 20060101 A61K035/17; A61K 38/17 20060101
A61K038/17; A61K 49/00 20060101 A61K049/00; A61K 51/04 20060101
A61K051/04; A61K 51/08 20060101 A61K051/08; C07K 14/705 20060101
C07K014/705; C07K 16/30 20060101 C07K016/30; C12N 5/0781 20060101
C12N005/0781; C12N 5/0783 20060101 C12N005/0783; G01N 33/569
20060101 G01N033/569; G01N 33/574 20060101 G01N033/574 |
Claims
1. A method for inducing a protective immunity in a target tissue,
wherein said method comprises the induction of CEACAM1 protein
production in said target tissue.
2. The method of claim 1, wherein said target tissue comprises
tissue afflicted by an autoimmune disease.
3. The method of claim 1, wherein said target tissue comprises
tissue being prepared for transplantation.
4. The method of claim 1, wherein said induction of CEACAM1 protein
production comprises the activation of CEACAM1 gene expression,
said activation comprising contacting said target tissue with a
signal transduction protein, transcriptional activator protein,
nucleic acid, small molecule compound, or combination thereof.
5. The method of claim 1, wherein said induction of CEACAM1 protein
production comprises the transfer of a nucleic acid sequence into
the cells of said target tissue, said nucleic acid encoding the
CEACAM1 protein.
6. The method of claim 1, wherein said induction of CEACAM1 protein
production comprises the transfer of a nucleic acid sequence into
the cells of said target tissue, said nucleic acid encoding a
protein that induces CEACAM1 mRNA expression.
7. The methods of claims 5 and 6, wherein said transfer of nucleic
acid into the cells of said target tissue comprises viral-mediated
transfer, particle-mediated transfer, or magnetic cationic liposome
mediated transfer.
8. A method for inducing a protective immunity in a target tissue,
wherein said method comprises the induction of CEACAM1 protein
production in said target tissue.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS/INCORPORATION BY
REFERENCE
[0001] The present application is a continuation of U.S. patent
application Ser. No. 14/287,901, which was filed May 27, 2014. U.S.
patent application Ser. No. 14/287,901 relates to and claims
priority benefits from U.S. patent application Ser. No. 11/423,395,
filed Jun. 9, 2006. U.S. patent application Ser. No. 11/423,395
relates to and claims priority benefits from U.S. Provisional
Application Ser. No. 60/689,316, with attorney docket number
16667US01, filed Jun. 9, 2005, and titled "MODULATION OF IMMUNITY
AND CEACAM1 ACTIVITY," the contents of which are hereby
incorporated herein by reference in their entirety. Additionally,
all cited references in the present application are incorporated by
reference in their entirety.
FIELD OF THE INVENTION
[0002] The invention relates to the modulation of the immune system
in general. More specifically, certain aspects of the present
invention relate to the modulation of specific immune responses to
create a protective immunity in the treatment of autoimmune
diseases and diseases requiring the transplantation of tissue.
BACKGROUND OF THE INVENTION
[0003] The human carcinoembryonic Ag (CEA)3 protein family
encompasses several forms of proteins with different biochemical
features. These proteins are encoded by 29 genes tandemly arranged
on chromosome 19q13.2. CEA family genes have been classified into
two major subfamilies, the CEA cell adhesion molecule (CEACAM) and
the pregnancy-specific glycoprotein subgroups. The CEACAM proteins,
which are part of the larger Ig superfamily, include CEACAM1, -3,
-4, -5, -6, -7, and -8. They share a common basic structure of
sequentially ordered different Ig-like domain(s) and are able to
interact with each other. For example, it has been reported that
various CEACAM proteins, such as CEACAM1 or CEACAM5, exhibit both
homophilic and heterophilic interactions.
[0004] CEACAM1 (CD66a), a transmembrane protein and member of the
carcinoembryonic Ags family, contains two ITIM sequences located
within its cytosolic tail. CEACAM1 interacts with other known CD66
proteins, including CD66a, CD66c, and CD66e proteins. It is
expressed on a wide spectrum of cells, ranging from epithelial to
hemopoietic origin. Among CD66 proteins tested, only the CD66a
protein is expressed on the surface of activated CD16-negative NK
cells.
[0005] The various CEACAM proteins have different biochemical
features, including but not limited to anchorage to cell surface
(GPI-linked, transmembrane or secreted forms), length of
cytoplasmic tail (long or short), and the presence or absence of
various signal transduction motifs. These proteins are actively
involved in numerous physiological and pathological processes.
[0006] CEACAM1 is a transmembrane protein that can be detected on
some immune cells as well as on epithelial cells. Many different
functions have been attributed to the CEACAM1 protein. It was shown
that the CEACAM1 protein exhibits antiproliferative properties in
carcinomas of colon, prostate, as well as other types of cancer.
Additional data support the central involvement of CEACAM1 in
angiogenesis and metastasis. CEACAM1 also has a role in the
modulation of innate and adaptive immune responses. The present
inventor has shown that CEACAM1 homophilic interactions inhibit
NK-mediated killing activity independently of MHC class I
recognition. This novel mechanism plays a pivotal role in the
inhibition of activated decidual lymphocytes in vitro and most
likely also in vivo after infection, including for example CMV
infections. The CEACAM1 homophilic interactions are possibly
important in some cases of metastatic melanoma, as increased
CEACAM1 expression was observed on NK cells derived from some
patients compared with healthy donors. There is an association of
CEACAM1 expression on primary cutaneous melanoma lesions with the
development of metastatic disease and poor survival. The present
inventor has demonstrated the role of CEACAM1-mediated inhibition
in maintaining NK self-tolerance in TAP2-deficient patients.
Additional reports have indicated that CEACAM1 engagement either by
TCR cross-linking with mAb or by Neisseria gonorrhoeae Opa proteins
inhibits T cell activation and proliferation.
[0007] The CEACAM1 protein interacts with other CEACAM protein
family members, such as CEACAM1 itself and CEACAM5. At least part
or the entire binding site of human CEACAM1 is located at the
N-terminal Ig-V-type domain of the CEACAM1 protein. In particular,
amino acids 39V and 40D and the salt bridge between 64R and 82D may
play an important role in this binding. Most amino acid sequences
of the N-terminal domain of CEACAM1, -3, -5, and -6 are identical,
and predicted binding residues are conserved among the four
proteins. These proteins might interact with each other. This is of
particular importance, because in certain tumors the CEACAM1
protein is down-regulated, followed by upregulation of CEACAM6
protein expression.
[0008] The present inventor has demonstrated the inability of
CEACAM1 to bind CEACAM6. The present inventor has also directly
shown that the presence of both residues 43R and 44Q in the CEACAM1
is crucial for the homophilic CEACAM1 interaction and that
substitution of these residues with the 43S and 44L residues that
are present in CEACAM6 abolishes the inhibitory effect. The
reciprocal substitution of 43S and 44L of CEACAM6 to the 43R and
44Q residues, respectively, results in the gain of inhibitory
heterophilic interactions with the CEACAM1 protein. The dichotomy
of CEACAM family members by recognition of CEACAM1 is determined by
the presence of R and Q at positions 43 and 44.
[0009] Natural killer (NK) cells belong to the innate immune system
and efficiently kill virus-infected and tumor cells. NK killing is
generally restricted mainly to cells that have lost class I MHC
expression, a phenomenon known as the missing self. NK cell
cytotoxicity is tightly regulated by various inhibitory class I
MHC-recognizing receptors. The inhibitory signal is delivered via
the immuno-receptor tyrosine-based inhibitory motif (ITIM)
sequences found within the cytosolic tail of these receptors.
Families of class I MHC binding inhibitory receptors include
members of the Ig superfamily, namely killer Ig-related two-domain
long-tail (p58) and three-domain long-tail (p70) receptors, the
C-type lectin complex CD94/NKG2A, and the leukocyte Ig-like
receptor (Ig-like transcript) family.
[0010] There are also other NK-specific receptors, termed natural
cytotoxicity receptors (NCRs), which are directly involved in
triggering NK cell cytotoxicity. The NCR group consists of several
proteins, including NKp30, NKp44, NKp46, NKp80, and CD16. The
cellular lysis ligands for all the NCRs have yet to be identified.
A viral ligand (hemagglutinin) was shown to interact with the NKp46
receptor, and this interaction resulted in the enhancement of lysis
of certain virus-infected cells. Indeed, the killing activity of
target cells by human natural killer (NK) cells is mediated via a
panel of lysis receptors of which is included CD16, NKp30, NKp44,
NKp46, and NKG2D. These receptors recognize viral ligands such as
hemagglutinin, stress-induced ligands such as MHC class I
chain-related antigen A (MICA) and MICB, or other as-yet-undefined,
cellular ligands. As mentioned, cells are protected from lysis by
NK cells mainly owing to the interactions between class I MHC
proteins and the appropriate inhibitory NK receptors.
[0011] The present inventor has identified a novel class I
MHC-independent inhibitory mechanism of human NK cytotoxicity,
mediated via the carcinoembryonic antigen-related cell adhesion
molecule 1 (CEACAM1) homophilic interactions. Furthermore, the
present inventor has found that the CEACAM1 protein plays a pivotal
role in the inhibition of killing, proliferation, and cytokine
secretion of interleukin 2 (IL-2)-activated decidual NK, T, and NKT
cells, respectively.
[0012] Once class I MHC proteins are removed from the cell surface,
these cells become susceptible to NK cell attack. It was surprising
to learn that patients with transporter associated with antigen
processing (TAP2) deficiency do not frequently suffer from
autoimmune manifestations at early stages of their life. Activated
NK cells derived from such patients may either be expressing an
unknown inhibitory mechanism or are missing an unidentified lysis
receptor. NK tolerance toward self-cells might be controlled by
similar mechanisms.
[0013] The present inventor has demonstrated that the expression of
the NKp46 receptor is severely impaired in a newly identified
TAP2-deficient family and that the vast majority of activated NK
cells derived from these patients use the CEACAM1 protein
interactions to avoid tumor and autologous cell killing.
[0014] The present inventor has also found that CD16-negative NK
clones inefficiently kill 1106mel cells because of the CD66a
homotypic interactions The inhibition of NK cell cytotoxicity by
CD66a was dependent on the level of CD66a expression on both
effector and target cells. 721.221 cells expressing CD66a protein
were protected from lysis by CD66a-expressing NK and YTS cells.
Redirected lysis experiments performed by the present inventors
showed that the strength of the inhibition is dependent on the
level of CD66a expression on NK cells. A dramatic increase in CD66a
expression was observed among NK cells isolated from melanoma
patients. As stated above, a novel class I MHC-independent
inhibitory mechanism of human NK cell cytotoxicity has been
demonstrated by the present inventors. Some melanoma tumors may use
this mechanism to avoid attack by NK cells.
[0015] Human natural killer (NK) cells are able to eliminate a
broad spectrum of tumors and virus-infected cells by using several
receptors, such as CD16, NKp30, NKp44, NKp46 and NKG2D. These
receptors recognize either viral ligands, such as hemagglutinin,
stress induced ligands, such as MICA and MICB, or other
yet-undefined cellular ligands. Other NK receptors mediate
inhibition of the killing activity following interaction with MHC
class I proteins present on normal cells. Removal of MHC class I
proteins from the cell surface renders it susceptible to NK cell
attack through the phenomenon known as the "missing self".
[0016] Additional receptors are also able to manipulate NK cell
cytotoxicity and the present inventors have shown a novel MHC class
I independent inhibitory mechanism of human NK cytotoxicity that is
mediated by the CEACAM1 homophilic interactions. This
CEACAM1-mediated inhibition might play an important role in the in
vivo development of melanoma in human patients. A 10-year follow-up
study correlated the presence of CEACAM1 on primary melanoma
lesions with poor survival. In addition, the present inventors have
demonstrated the pivotal role of the CEACAM1 in the inhibition of
killing, cytokine secretion and proliferation of activated decidual
NK, NKT and T cells, respectively. The present inventors have also
provided substantial evidence for a major role of the inhibitory
CEACAM1 interactions in controlling NK cell autoreactivity in
TAP2-deficient patients.
[0017] The presence of human soluble CEACAM1 protein can be
observed in the serum of healthy donors. Furthermore, variations in
serum levels of the soluble CEACAM1 protein are observed in various
pathologies. For example, increased CEACAM1 levels were observed in
the sera of patients with various hepatic diseases such as
obstructive jaundice, primary billiary cirrhosis, autoimmune
hepatitis and cholangiocarcinoma. A decrease in the soluble CEACAM1
level has not been reported.
[0018] The present inventor has shown that the soluble CEACAM1
protein blocks the CEACAM1-mediated inhibition of NK cell killing
activity in a dose-dependent manner. Moreover, the present
inventors have demonstrated that serum CEACAM1 levels among the
TAP2-deficient patients are decreased when compared to normal
individuals. These findings concur with the dominant role of the
CEACAM1-mediated inhibition in controlling NK autoreactivity in
TAP2-deficient patients. Thus, the maximal compensatory effect of
CEACAM1-mediated inhibition is attained.
[0019] At least one object of the present invention is the
modulation of CEACAM1 activity to effect control over the immune
system and in particular specific immune responses in the treatment
of disease. In particular, the present invention relates to the
supression of specific immune responses, by increasing the
functional concentration of the CEACAM1 protein, to create a
protective immunity in the treatment of certain disease states,
including but not limited to autoimmune diseases and diseases
requiring the transplantation of tissue.
[0020] Autoimmune disease results when the immune system mistakes
self tissues for nonself and mounts an inappropriate attack. There
are many different autoimmune diseases. Autoimmune disease can
affect many parts of the body, including but not limited to nerves,
muscles, the endocrine system (system that directs your body's
hormones and other chemicals), and the digestive system. Some
examples are Wegener's granulomatosis, multiple sclerosis, type 1
diabetes mellitus, rheumatoid arthritis, and Crohn's disease.
[0021] Transplant rejection occurs when the immune system of the
recipient of a transplant attacks the transplanted organ or tissue.
This is because a normal healthy human immune system can
distinguish foreign tissues and attempts to destroy the transplant,
just as it attempts to destroy infective organisms such as bacteria
and viruses.
[0022] At present, regimens to treat both autoimmune diseases and
tissue transplant rejection employ general immunosuppressant drugs.
The present invention relates to the supression of immune responses
in a specific fashion, by increasing the functional concentration
of the CEACAM1 protein in a target tissue to create a localized
protective immunity for the treatment of autoimmune diseases and
diseases requiring the transplantation of tissue.
BRIEF SUMMARY OF THE INVENTION
[0023] One object of the present invention is to provide methods
and compositions for the modulation of the immune system and/or one
or more specific immune responses. Another object of the present
invention is to provide methods and compositions for the regulation
of lymphocyte activity. A further object of the present invention
is to provide methods and/or compositions for inducing a
tolerogenic state (immunologic tolerance or protective immunity) in
a specified tissue, including but not limited to tissue affected by
autoimmune disease or tissue being prepared for transplantation. A
still further object of the present invention is to provide methods
and compositions for the regulation of the immune system and
specific immune responses in the treatment of disease, including
but not limited to autoimmune diseases and diseases requiring organ
transplantation.
[0024] One or more of the preceding objects, or one or more other
objects which will become plain upon consideration of the present
specification, are satisfied by the invention described herein.
[0025] One aspect of the present invention that satisfies one or
more of the preceding objects provides methods for inducing a
protective immunity in a target tissue. A further aspect of the
present invention provides methods for the induction of CEACAM1
protein production in the tissue targeted for induction of a
protective immunity. One embodiment of this aspect of the present
invention comprises methods for the induction of CEACAM1 protein
production in the tissue targeted for induction of a protective
immunity.
BRIEF DESCRIPTION OF SEVERAL VIEWS OF THE DRAWINGS
[0026] FIG. 1. CEACAM1-Ig does not recognize the CEACAM6 protein.
Stable .221/CEACAM1 and .221/CEACAM6 were generated as described.
The expression level was monitored with the Kat4c mAb (empty
histograms). Binding of CEACAM1 was assessed with the CEACAM1-Ig
fusion protein (empty histograms). The reagents used are indicated
in each histogram. The background (shaded histograms) is the
corresponding staining of .221 parental cells. This figure shows
one representative experiment of 20 performed.
[0027] FIG. 2. CEACAM1 and the CEACAM6 proteins do not functionally
interact. A, The amount of mIL-2 in culture supernatant of
Kat4ctreated and control 12E7 BW/CEACAM1-_ cells as measured by
ELISA. The x-axis is the amount of immobilized mAb per reaction,
and the y-axis is the optic density at a wavelength of 650 nm. This
figure shows the mean of three independent experiments. B, mIL-2
secretion by BW parental cells or by BW/CEACAM1-_ cells co
incubated for 48 h with irradiated .221, 0.221/CEACAM1, or with
.221/CEACAM6 cells. The y-axis is the optic density at a wavelength
of 650 nm. The average of four independent experiments is
shown.
[0028] FIG. 3. Substitution of the GPI link of CEACAM6 with the
transmembrane and tail of CEACAM1 does not induce heterophilic
binding. A, Staining of .221/CCM6-TailCCM1 cells with Kat4c (empty
histogram) mAb or CEACAM1-Ig (empty histogram). The reagents used
are indicated in each histogram. The background is the staining of
.221 parental cells (shaded histogram). This figure shows one
representative experiment of 10 performed. B, mIL-2 secretion by
BW/CEACAM1-cells co incubated for 48 h with irradiated .221 or with
.221 transfectants. The y-axis indicates the optic density at a
wavelength of 650 nm. The average of four independent experiments
is shown.
[0029] FIG. 4. Sequence alignment of CEACAM family members. Letters
in bold indicate amino acid residue 1. Identical residues of the
known motifs crucial for binding are underlined. Different residues
in the binding motifs are highlighted with black (for RQ residues)
or gray (for SL residues) backgrounds.
[0030] FIG. 5. Recognition of CEACAM1 is dependent on the presence
of 43R44Q. A, Staining of .221/CCM1-RQ43,44SL or
.221/CCM6-SL43,44RQ cells with Kat4c mAb or CEACAM1-Ig fusion
protein as indicated in each histogram. The corresponding staining
of .221 parental cells was used as background (shaded histograms).
This figure shows one representative experiment of six performed.
B, Staining of .221/CCM1-RQ43,44SL or .221/CCM6-SL43,44RQ cells
with the conformation-dependent 5F4 mAb (thick lines). The
corresponding staining of .221 parental cells was used as
background (thin lines). This figure shows one representative
experiment of six performed. C, mIL-2 secretion by BW/CEACAM1-_
cells co incubated for 48 h with irradiated .221 or .221
transfectants. The y-axis indicates the optic density at a
wavelength of 650 nm. The average of five independent experiments
is shown.
[0031] FIG. 6. NK-mediated cytotoxicity. CEACAM1-positive NK clones
were obtained as described in Materials and Methods. NK clones were
tested in killing assays against the indicated cells in an E:T cell
ratio of 2:1. When rabbit polyclonal Abs were included in the
assays, the final concentration was 20 _ g/ml. This figure shows
the results of a representative NK clone.
[0032] FIG. 7. Both the 43 and 44 residues of CEACAM1 are crucial
for the interaction. A, Staining of .221 and various .221 stable
transfectants with 5F4 mAb (u) or with Kat4c (f). The staining of
the secondary reagent FITC-conjugated goat anti-mouse F(ab_)2 of
each cell type was used as background (_). The y-axis indicates the
median fluorescence intensity (MFI). This figure shows one
representative experiment of four performed. B, Staining of .221
and various .221 stable transfectants with CEACAM1-Ig fusion
protein. The y-axis indicates the median fluorescence intensity
(MFI). This figure shows one representative experiment of four
performed. C, YTS cells expressing the CEACAM1 protein (YTS/CCM1)
or mock-transfected (YTS/control) were tested in killing assays
against .221 and .221 transfectants. The E:T cell ratio was 2:1.
This figure shows the average of three independent experiments. D,
Staining of .221/CEACAM5 cells with 5F4, Kat4c, or CEACAM1-Ig was
performed as indicated in each histogram. The corresponding
staining of .221 parental cells was used as background (thin
lines). This figure shows one representative experiment of six
performed.
[0033] FIG. 8. Family pedigree of the TAP2-deficient patients.
Patients are indicated as black symbols, the parents as gray
symbols and all other healthy family members as white symbols.
Cousin marriage is represented by a double line. Roman numerals
indicate the generations, whereas Arabic numerals indicate
individuals.
[0034] FIG. 9. PBL characterization of TAP2-deficient patients. (A)
PBL obtained from the patients and from the healthy sister was
stained for CD3 and CD56. (B) Staining of PBL obtained from the
patients and from the healthy sister for CD3, CD56 and CD16. The
dot plots analysis presented shows CD16 and CD56 expression on
already gated NK cells. The vertical dashed lines discriminate
CD56dim from CD56bright. For (A) and (B) one representative
experiment out of three performed is shown.
[0035] FIG. 10. Lack of recognition of the patients' cells by
KIR2DL2-Ig and LIR1-Ig. The various EBV cell lines were stained
with mAbW6/32 or with various Ig-fusion proteins. The secondary
F(ab')2 detection antibodies alone were used as background. One
representative experiment out of four performed is shown.
[0036] FIG. 11. High expression of CEACAM1 on activated
TAP2-deficient NK cells. NK clones expressing CEACAM1 were divided
into groups according to expression level of CEACAM1 (indicated on
the left). CEACAM1 expression on one representative NK clone of
each group is shown. The percentages of the NK clones similar to
the NK clone presented in each donor are indicated in each
histogram.
[0037] FIG. 12. CEACAM1-mediated inhibition of NK killing activity
is blocked by the soluble CEACAM1-Ig. (A) Bulk NK cultures were
stained for CD16, CD56 and CEACAM1. Contour plot X-axis is CEACAM1
log fluorescence and Y-axis is CD16 or CD56 log fluorescence. One
representative experiment out of two performed is shown. (B-D)
Killing of .221 and .221/CEACAM1 cells, incubated with various
amounts of the CEACAM1-Ig (CCM1-Ig) fusion protein or the
anti-CEACAM antibodies. Killing assays were performed with NK-B
cells (B), CEACAM1-NK-M cells (C) or CEACAM1+NK-Y cells (D). The
E:T ratio was 2:1. For (B-D), the average of three independent
experiments is shown.
[0038] FIG. 13. Decreased level of soluble CEACAM1 protein in the
serum of TAP2-deficient patients. (A) Serum samples were analyzed
for the presence of soluble CEACAM1 by ELISA. X-axis indicates the
amount of detected soluble CEACAM1. The mean of three independent
experiments is shown. (B-D) Killing of .221 and .221/CEACAM1
pre-incubated either with no serum, with serum derived from patient
B (Serum B) or from a healthy donor (Serum Healthy). Killing assays
were performed with NK-B (B), NKHealthy (C) and with NK-Sister (D).
The E:T was 2:1.
[0039] FIG. 14. Cell surface CEACAM1 level is not regulated by MBMP
activity. Surface expression of the MHC class I (A, B) on NK cells
derived from the mother (NK M), healthy donor (NK Y) or patient B
(NK B), NKp46 (C) and the CEACAM1 protein (D). Cells were analyzed
by FACS using the W6/32 (A, B), 461-G1 (C) and the Kat4c mAb (D).
The tested protein is indicated on the Y-axis of each plot.
Expression was analyzed following stimulation with PMA and Ca2+
ionophore. These experiments were performed either with or without
the MBMP inhibitor BB-94 (indicated in the bottom of each plot).
Average results of three independent experiments are shown.
[0040] FIG. 15. The reduction in class I MHC expression is due to
TAP2 deficiency. Fusion of EBV-A, EBV-B, and EBV-C with various
B-cell lines defective either for the TAP1 and TAP2 subunits
(0.174) or none of them (0.45). Total mixture of cells was analyzed
by FACS. Fused cells were identified by HLA-A3 expression. Staining
with HLA-A3 is on the y-axis, and forward scatter is on the x-axis.
One representative experiment is shown of 3 performed.
[0041] FIG. 16. Impaired expression and function of NKp46 on
freshly isolated NK cells. (A) NKp46 expression on freshly isolated
bulk NK cells. Staining was detected by mAb 461-G1 in the form of
F(ab').sub.2, and the MFI staining is indicated in each histogram.
One representative experiment is shown of 3 performed. (B) Killing
of .221 cells by freshly isolated NK cells derived from indicated
donors. The mean results of 3 independent experiments are shown.
The data represent means of the percentage of killing.+-.SDs.
[0042] FIG. 17. Inhibition of NK-mediated killing by homophilic
CEACAM1 interactions. Killing of .221 and .221/CEACAM1 cells,
incubated with or without polyclonal anti-CEACAM antibodies, by a
representative CEACAM1.sup.+ NK clone (panel A) or by a
CEACAM1.sup.- NK clone (panel B). As control, anti-glutathion
S-transferase (GST)-ABL polyclonal antibodies were used. The
effector-to-target (E/T) ratio was 2:1. All antibodies used were in
the form of F(ab').sub.2. Figures show the average of 3 independent
experiments. The data represent means of the percentage of
killing.+-.SDs.
[0043] FIG. 18. Killing of PHA-induced T-cell blasts. (A) Staining
of PHA-induced T-cell blasts with various mAbs. Staining of
PHA-induced T-cell blasts derived from patient A and from the
healthy sister was performed with the F(ab').sub.2 fragments of
anti-CD3, anti-CEACAM1, and anti-MHC class I mAb HP-1F7. (B)
Staining of PHA-induced T-cell blasts and of the LnCap cell line
with various fusion proteins. Staining was performed with the
NKp46-Ig, NKp30-Ig, NKp44-Ig, and the control CD99-Ig fusion
proteins. (C) NK clones derived from patients A, B, and C were
assayed for cytotoxic activity against autologous PHA-induced
T-cell blasts. The NK clones obtained from the healthy sister were
assayed against PHA-induced T-cell blasts derived from patient A.
NK clones were preincubated with or without F(ab').sub.2 fragments
of polyclonal anti-CEACAM or the control polyclonal antiubiquitin
antibodies. The targets, autologous PHA-induced T-cell blasts, were
incubated with or without the F(ab').sub.2 fragments of HP-1F7 or
the control 12E7 mAb. Assays were performed at an E/T ratio of 2:1.
Shown are the mean results of several NK clones that were obtained
from 3 independent experiments. The data represent the mean
percentage of killing.+-.SD. (D) NK clones derived either from the
healthy sister or from patients A, B, and C were assayed for
killing of PHA-induced T-cell blasts derived from the healthy
sister. NK clones and target PHA-induced T-cell blasts were
pretreated as described for panel C. Assays were performed at an
E/T ratio of 2:1. Shown are the mean results of several NK clones
that were obtained from 3 independent experiments. All mAbs used
were in the form of F(ab').sub.2. The data represent the mean
percentage of killing.+-.SD.
[0044] FIG. 19. Killing of melanoma lines by NK clones. Lysis of
1106mel cells (A-D) and 1259mel cells (E) by CD16.sup.+CD66a.sup.-
NK clone (A and B) or CD16.sup.-CD66a.sup.+ NK clone (C-E) was
performed as described in Materials and Methods of this section.
The anti-CD99 mAb (12E7) and anti-CD66a polyclonal Abs were
incubated with the target cells (A and C) or with the effector
cells (B, D, and E). The E:T cell ratio was 3:1.
[0045] FIG. 20. Expression of CD66a on various cell types.
Transfectants were generated as described in Materials and Methods
of this section. Shown is CD66a staining of transfected .221 and
YTS cells with the anti-CD66a mAb Kat4c (dark line) overlaid on the
staining of the parental cells (.221 and YTS) with the same mAb
(light line). Staining of a representative NK clone by Kat4c (dark
line) overlaid on the staining of the same NK clones with the
control FITC-conjugated goat anti-mouse Abs (light line) is also
shown. The figure shows one representative experiment of three
performed.
[0046] FIG. 21. Killing of various 721.221 transfectants by various
YTS transfectants. Killing assays were performed as described in
this section. The various YTS transfectants are indicated in each
histogram. The figure shows one representative experiment of six
performed.
[0047] FIG. 22. Killing of .221/CD66a.sup.high cells by NK clones.
Killing of target cells by YTS/CD66a (A), CD66-positive NK clone
(B), and CD66-negative NK clone (C) incubated with or without
anti-CD66a polyclonal Abs. The figure shows one representative
experiment of five performed.
[0048] FIG. 23. The high level of CD66a expression on NK clones
correlates with efficient inhibition of redirected lysis of P815
cells. The CD66a expression on NK clones was monitored by FACS. To
correctly compare the level of CD66a expression among different NK
clones, and because the background staining F(ab)'.sub.2 of
FITC-conjugated goat anti-mouse IgG Abs of each NK clone might be
different, the level of CD66a expression in each clone was
determined by dividing the MFI of the CD66a staining on a given
clone with the MFI of the background staining of the same clone.
The fold increase in CD66a staining above the background of each
clone is indicated in brackets. The percent inhibition of each
clone was calculated by dividing the percentage of specific lysis
of the NK clone incubated with anti-CD66 mAb by that of the clone
incubated with no mAb. Similar results were obtained when the
specific lysis of each NK clone incubated with anti-CD66 mAb was
divided by the percent specific lysis of the same NK clone
incubated with control mAb. The NK clones are presented in the
figure in the order of the fold increase in CD66a above background.
The figure shows CD16.sup.-CD66.sup.- clones (24, 89, and 98),
CD16.sup.-CD66.sup.+ clones (21, 79, 84, and 100),
CD16.sup.+CD66.sup.- clones (25, 47, 48, 63, and 64), and
CD16.sup.+CD66.sup.+ clones (1, 2, 3, 9, 10, 13, 17, 30, 32, 34,
43, 44, 49, 58, 61, 65, 69, 70, 71, 73, 75, and 96). When
CD16.sup.- NK clones were used, anti-NKp44 and NKp46 sera were
included to stimulate the redirected lysis experiments. When
CD16.sup.+ NK clones were used, anti-CD16 mAb was included in the
redirected lysis experiments. The figure shows NK clones generated
from one healthy donor YF that contains an unusually high number of
CD16.sup.+CD66.sup.+ NK clones.
[0049] FIG. 24. CD66a expression on NK cells derived from healthy
donors and melanoma patients. Lymphocytes were obtained from
surgically removed lymph nodes derived from two different melanoma
patients, infiltrated with melanoma metastases positive (A) or
negative (C) for CD66a expression. Lymphocytes were also obtained
from peripheral blood of another melanoma patient (B) or from
peripheral blood of representative healthy donor (D). Lymphocytes
were stained for expression of CD3, CD16, CD56, and CD66 as
described in Materials and Methods of this section. The figure
shows CD66a expression on NK cells.
[0050] FIG. 25. CEACAM1 staining of decidual lymphocytes. Decidual
lymphocytes were isolated and quadruple-stained as described in
Methods. (a-c) CEACAM1 staining on nonactivated decidual NK cells
(a), T cells (b), and NKT cells (c). One representative experiment
is shown out of three performed. Decidual lymphocytes were cultured
in the presence of IL-2 as described (20) and then screened for
CEACAM1 expression with the 5F4 mAb. (d-f) CEACAM1 staining for
activated decidual NK clone (d), T clone (e), and NKT clone (f).
Similar results were obtained when other lymphocyte clones were
used. (g and h) Staining of EVTs for HLA-G and CEACAM1,
respectively. Bold lines represent mAb staining and thin lines show
background staining.
[0051] FIG. 26. Staining of .221 cells expressing various members
of the CEACAM family using specific anti-CEACAM antibodies. .221
transfectants were generated as described in Methods. Each row
shows the staining performed on a particular transfectant
(indicated at left), and each column shows the staining with a
particular antibody (indicated at top). Bold lines represent
antibody staining and thin lines show background staining on .221
cells. One representative experiment is shown out of three
performed.
[0052] FIG. 27. CEACAM1-mediated inhibition of decidual NK
cytotoxicity. Decidual NK clones were stained for CEACAM1
expression. (a) CEACAM1 staining of decidual NK clone 17 using the
anti-CEACAM1 mAb 5F4 (bold line). The thin line shows the control
staining. (b) Killing and inhibition of NK clone 17 by .221 cells
and by .221 cells transfected with CEACAM1 (.221/CEACAM1). Blocking
experiments were performed using 40 .quadrature.l/ml of anti-CEACAM
antibodies. Average of three independent experiments is shown.
Similar results were obtained when other CEACAM1+NK clones were
used.
[0053] FIG. 28. CEACAM1-mediated interactions inhibit SEB-induced T
cell proliferation. Decidual T cell clones were tested for
expression of CD4 (a), V.quadrature.17 (b), and CEACAM1 (c) by flow
cytometry. Bold lines indicate mAb staining and thin lines indicate
control staining. (d) Fifty thousand cells of the presented T cell
clone were incubated for 2 days with 25,000 irradiated .221 cells
or with .221 cells transfected with CEACAM1 (.221/CEACAM1), in the
presence of decreasing SEB concentrations as indicated in the
figure. Proliferation was measured with 3H-thymidine incorporation.
The figure represents the average of ten independent experiments.
Similar results were obtained when other T cell clones were
used.
[0054] FIG. 29. CEACAM1-mediated inhibition of
IFN-.quadrature..quadrature. secretion from NKT cells. (a) CEACAM1
expression on isolated activated NKT clone. The bold line shows the
staining with 5F4 mAb, and the thin line shows the control
staining. (b) The amount of IFN-.quadrature..quadrature. in culture
supernatant of mAb-treated and untreated NKT clone cells measured
by ELISA. The average of two independent experiments is shown.
Cross-linking of surface CEACAM1 was performed without (c) or with
(d) the Kat4c mAb, and intracellular staining for
IFN-.quadrature..quadrature. was performed. One representative
experiment is shown out of two performed. Similar results were
obtained when other NKT cell clones were used.
[0055] FIG. 30. CEACAM1-Ig specifically binds to CMV-infected
fibroblasts. (a) Binding of CEACAM1-Ig to .221/CEACAM1 cells (bold
line) but not to parental .221 (thin line). The figure shows a
representative experiment out of three performed. (b) Day-by-day
staining of uninfected and CMV-infected HFF cells in the presence
or absence of 300 .quadrature.g/ml of the antiviral agent PFA.
Cells were stained with CEACAM1-Ig and with the control CD99-Ig
fusion protein as described in Methods. Data are presented as fold
increase above the staining of uninfected cells. The average of two
independent experiments is shown.
[0056] FIG. 31. The functional interactions between
BW/CEACAM1.quadrature..quadrature. and CMV-infected HFFs elicit
IL-2 secretion. (a) Spontaneous IL-2 secretion by BW and various BW
transfectants after 48 hours of incubation. The average of 20
independent experiments is shown. (b) IL-2 secretion by
BW/CEACAM1.quadrature..quadrature. cells coincubated for 24 hours
with irradiated .221 or with .221/CEACAM1 cells. The average of six
independent experiments is shown. (c) IL-2 secretion after
coincubation of BW or BW/CEACAM1.quadrature..quadrature. cells with
uninfected or CMVinfected HFF cells for 48 hours. No IL-2 secretion
above background levels was observed when PFA was included in the
assay (only day 6 is shown). Experiments were performed
concomitantly with the flow cytometry binding assays of CEACAM1-Ig
shown in FIG. 29. The average of two independent experiments is
shown.
[0057] FIG. 32. CMV isolated from infected decidua induces a ligand
for the CEACAM1 on infected HFF cells. (a) Staining of HFF cells
infected with clinical CMV strain with CD99-Ig or with CEACAM1-Ig.
No staining was observed when proteins were omitted, indicated by
the horizontal line. FSC, forward scatter. (b) IL-2 secretion from
BW or BW/CEACAM1.quadrature..quadrature. cells coincubated with
HFF-infected cells for 48 hours. The average of two experiments is
shown.
DETAILED DESCRIPTION OF THE INVENTION
[0058] While the present invention has been described with
reference to certain embodiments, it will be understood by those
skilled in the art that various changes may be made and equivalents
may be substituted without departing from the scope of the present
invention. In addition, many modifications may be made to adapt a
particular situation or material to the teachings of the present
invention without departing from its scope. Therefore, it is
intended that the present invention not be limited to the
particular embodiment disclosed, but that the present invention
will include all embodiments falling within the scope of the
appended claims.
[0059] One aspect of the present invention provides methods for
inducing a protective immunity in a target tissue. One embodiment
of this aspect of the present invention comprises methods for the
induction of CEACAM1 protein production in the tissue targeted for
induction of a protective immunity. The target tissue includes but
is not limited to tissue afflicted by an autoimmune disease and/or
tissue being prepared for transplantation. In preferred embodiments
of this aspect of the present invention the induction of CEACAM1
protein production comprises the activation of CEACAM1 gene
expression. activation of CEACAM1 gene expression can be
accomplished any number of techniques known to those skilled in the
art for the induction of gene expression, including but not limited
to those techniques comprising contacting the target tissue with a
signal transduction protein, transcriptional activator protein,
nucleic acid, small molecule compound, or combination thereof. In
preferred embodiments of this aspect of the present invention, the
induction of CEACAM1 protein production comprises the transfer of a
nucleic acid sequence into the cells of the target tissue encoding
the CEACAM1 protein, or another protein that directly or indirectly
increases CEACAM1 gene expression. The transfer of nucleic acid
into a selected target tissue pursuant to this embodiment of the
present invention can be accomplished by any number of techniques
known to those skilled in the art including but not limited to
viral-mediated transfer, particle-mediated transfer, or magnetic
cationic liposome mediated transfer.
[0060] The presently described technology provides methods and
compositions for the regulation of the immune system and specific
immune responses, and in particular to methods and compositions for
the regulation of lymphocyte activity. One aspect of the present
invention is the functional modulation of at least one member of
the CEACAM protein family, said CEACAM protein being either
membrane bound or free. The CEACAM protein family, which are part
of the larger Ig superfamily, include without limitation CEACAM 1,
-3, -4, -5, -6, -7, and -8. The CEACAM protein family share a
common basic structure of sequentially ordered different Ig-like
domain(s) and are able to interact with each other.
[0061] In certain embodiments of the presently described invention,
regulation of the immune system and/or one or more specific immune
responses comprises the positive modulation of CEACAM1 gene
expression or translation of CEACAM1 mRNA. The positive modulation
of CEACAM1 gene expression or CEACAM1 mRNA translation can comprise
any number of techniques know to those skilled in the art for the
modulation of gene expression, and can involve contacting any cell
or grouping of cells (e.g. tissue) with a protein, peptide,
peptidomimetic, nucleic acid, nucleic acid analog, small molecule,
or some combination thereof.
[0062] In a further aspect of the presently described invention,
there are provided methods and/or compositions for modulating the
immune system and/or one or more specific immune responses in the
course of treating a disease. Exemplar diseases include but are not
limited to autoimmune conditions, and those diseases requiring
tissue transplantation.
[0063] Certain aspects of the present invention can be performed in
any environment including but not limited to in situ, in vivo, or
in vitro environments. For example, the methods and/or compositions
of the present invention can be employed in a cell culture or in
the living body of an animal, such as a human.
[0064] In a still further aspect of the presently described
invention, methods and/or materials are provided for inducing a
tolerogenic state (immunologic tolerance) in a specified tissue. As
used herein, one exemplar definition for tissue includes any
aggregate of cells. The specified tissue may include tissue
affected by an autoimmune disease or tissue being prepared for
transplantation. In one preferred embodiment thereof, the induction
of the tolerogenic state includes the stimulation of CEACAM1 gene
expression and protein production. This can be accomplished by any
number of techniques know to those skilled in the art for the
enhancement of gene expression and protein production.
[0065] At least one of the objects of the present invention is to
induce a tolerogenic state in a specified tissue. This aspect of
the present invention for example includes the induction of CEACAM1
protein production. The specified tissue may be tissue affected by
an autoimmune disease or tissue being prepared for transplantation.
The induction of CEACAM1 protein production includes, for example,
the generation of CEACAM1 gene expression. In at least on aspect of
the present invention, induction of CEACAM1 protein production
includes the transfer of genetic material into the cells of the
specified tissue for which a protective immunity is to be
generated. The genetic material, for example, can be composed of a
CEACAM1 family gene. Cis acting genetic elements may also be added
to facilitate, for example, the integration of the genetic material
into the genome of the specified cells, or the production of
CEACAM1 protein, or both. The cis acting genetic elements may
include genetic material effective in inducing efficient gene
expression, efficient translation, increased recombination
frequency, increased targeted recombination, or some combination
thereof.
[0066] In an additional aspect of the invention, materials and/or
methods are provided for inducing a protective immunity or
tolorogenic state in a specified tissue, which includes the
induction of CEACAM1 protein production by transferring genetic
material that includes a gene whose protein product induces the
increased production of a CEACAM1 family protein. For example, the
gene whose protein product induces the increased production of a
CEACAM1 family protein may be a transcription factor, including for
example a transcriptional activator.
[0067] One aspect of the present invention provides methods and/or
materials for imparting a tolerogenic state (i.e.--immunologic
tolerance or protective immunity) upon a specified tissue. One
embodiment of this aspect of the present invention provides methods
and/or materials for imparting a tolerogenic state upon a specified
tissue by imparting upon or inducing within a specified tissue
CEACAM1 function. The specified tissue may be any tissue upon which
it is desirable to create a tolerogenic state. For example, the
tissue may be tissue that is being prepared for transplantation, or
the tissue may be tissue which is afflicted by autoimmune disease.
One definition of a tolerogenic state is a state characterized by
an immunologic tolerance.
[0068] A further aspect of the present invention provides methods
and/or materials for preparing tissue for grafting or
transplantation. In one embodiment, the present invention provides
materials and/or methods for mitigating the potential for
immunological rejection of grafted or transplanted tissue. For
example, the present invention provides for increased transplant
tolerance strategies that would thwart the immunological rejection
of transplanted or grafted tissue by imparting upon the
transplanted tissue a tolerogenic state (immunologic tolerance),
while preserving a body's general immune competence, including for
example normal immune responses to pathogens and cancer risks. This
aspect of the present invention may be accomplished, at least in
part, by conveying or imparting CEACAM1 function or activity upon
tissue to be transplanted or grafted. For example, tissue to be
transplanted or grafted can be transformed or transfection of with
genetic material effective in facilitating or inducing the
production of CEACAM1 protein. This can be performed, for example,
by the transfer of genetic material that is effective in inducing
CEACAM1 protein production to tissue being prepared for
transplantation or grafting. The genetic material that is
transferred may include, for example, one or more functional
CEACAM1 family genes, or some derivative thereof, including for
example genetic material encoding specific CEACAM1 protein domains.
The genetic material may also contain any cis acting genetic
elements that may augment CEACAM1 protein production, including for
example genetic elements that facilitate transcription (gene
expression) and/or translation (protein synthesis). The transfer of
genetic material may be accomplished by any method known in the
art.
[0069] One exemplar aspect of transplantation includes an act,
process, or instance of transplanting tissue; especially the
removal of tissue from one part of the body or from one individual
and its implantation or insertion in another especially by surgery.
The transplantation of tissue can be allogeneic (allograft), which
includes transplantation of tissue between genetically different
members of the same species. For example, nearly all organ and bone
marrow transplants are allografts. These may be between brothers
and sisters, parents and children, or between donors and recipients
who are not related to each other. The transplantation can also be
autologous (autograft), which includes transplantation of an
organism's own tissues. A graft or transplantation of tissue from
one site to another on the same individual is called an autograft.
Autologous transplantation may be used to repair or replace damaged
tissue. For example, autologous bone marrow transplantation permits
the usage of more severe and toxic cancer therapies by replacing
bone marrow damaged by the treatment with marrow that was removed
and stored prior to treatment. The transplantation of tissue can
also be syngeneic, which includes transplantation of tissue between
genetically identical members of the same species (e.g., identical
twins). The transplantation can also be xenogeneic (xenograft),
which includes transplantation between members of different
species; for example, the transplantation of animal tissues into
humans.
[0070] One exemplar characterization of immunological rejection of
transplanted tissue includes include those events by which a body's
immune system attacks transplanted or grafted tissue, reacting to
them as if they were harmful. Graft or transplant rejection
generally involves the destruction of the grafted or transplanted
tissue by attacking lymphocytes. In clinical transplantation, the
types of transplant rejection may be classified into three main
types: hyperacute, acute, and chronic.
[0071] The present invention also provides materials and/or methods
for imparting a tolerogenic state upon engineered tissues. This
aspect of the present invention can be achieved, at least in part,
by imparting upon the engineered tissue CEACAM1 protein function.
For example, one embodiment of the present invention involves the
purification of a specific cell type of interest, followed by a
transformation of the cell to produce CEACAM1 protein. These cells
are then expanded in cell culture and seeded onto a scaffold of any
desirable shape or rigidity prepared from a suitable biomaterial
(or biocompatible material, or some combination) to form a
scaffold/biological composite, or tissue engineered construct, that
has decrease susceptibility to immunological rejection upon
transplantation or grafting as replacement tissue.
[0072] A further aspect of the present invention provides methods
and/or materials for imparting a tolerogenic state to tissue
afflicted by autoimmune disease, while preserving a body's general
immune competence, including for example normal immune responses to
pathogens and cancer risks. This aspect of the present invention
may be accomplished, at least in part, by conveying or imparting
CEACAM1 function or activity upon tissue afflicted by autoimmune
disease. For example, the present invention provides for the
targeted transformation of tissue afflicted by autoimmune disease
to express CEACAM1 protein. This can be accomplished, for example,
by transfer of genetic information effective in inducing CEACAM1
protein production directly to tissue afflicted with an autoimmune
disease, subsequent to any required exposure of the afflicted
tissue. The genetic material that is transferred may include, for
example, one or more functional CEACAM1 family genes, or some
derivative thereof, including for example genetic material encoding
specific CEACAM1 protein domains. The genetic material may also
contain any cis acting genetic elements that may augment CEACAM1
protein production, including for example genetic elements that
facilitate transcription (gene expression) and/or translation
(protein synthesis). The transfer of genetic material may be
accomplished by any method known in the art, and may be performed
subsequent to exposure of the afflicted tissue by surgery, or if
surgery is not an option, the effected tissue may be targeted
utilizing receptor-mediated gene transfer technology.
[0073] Autoimmune diseases are generally characterized by the
body's immune responses being directed against its own tissues,
causing prolonged inflammation and subsequent tissue destruction.
For example, autoimmune disorders can cause immune-responsive cells
to attack the linings of the joints--resulting in rheumatoid
arthritis--or trigger immune cells to attack the insulin-producing
islet cells of the pancreas leading to insulin-dependent diabetes.
A healthy immune system recognizes, identifies, remembers, attacks,
and destroys bacteria, viruses, fungi, parasites, and cancer cells
or any health-damaging agents not normally present in the body. A
defective immune system, on the other hand, directs antibodies
against its own tissues. Any disease in which cytotoxic cells are
directed against self-antigens in the body's tissues is considered
autoimmune in nature. Such diseases include, but are not limited
to, celiac disease, Crohn's disease, pancreatitis, systemic lupus
erythematosus, Sjogren's syndrome, Hashimoto's thyroiditis, and
other endocrinopathies. Allergies and multiple sclerosis are also
the result of disordered immune functioning.
[0074] Examples of different types of viruses used as vectors for
the transfer of genetic material include, without limitation:
retroviruses; adenoviruses; adeno-associated viruses; and herpes
simplex viruses. Besides virus-mediated genetic material delivery
systems, there are several nonviral options for delivery. The
simplest method is the direct introduction of the genetic material
into target cells. Another nonviral approach involves the creation
of an artificial lipid sphere with an aqueous core. This liposome,
which carries the genetic material, is capable of passing the
genetic material through the target cell's membrane. Genetic
material can also get inside target cells by chemically linking the
genetic material to a molecule that will bind to special cell
receptors. Once bound to these receptors, the genetic material
constructs are engulfed by the cell membrane and passed into the
interior of the target cell.
[0075] Particle mediated transfer of genetic material is also a
viable method to introduce genetic material according to some
aspects of the present invention. Any method regarding the particle
mediated transfer of genetic material known in the art may be used.
For example, the gene gun is part of a method sometimes called the
biolistic (also known as bioballistic) method. Under certain
conditions, DNA (or RNA) becomes "sticky," adhering to biologically
inert particles such as metal atoms (usually tungsten or gold). By
accelerating this DNA-particle complex in a partial vacuum and
placing the target tissue within the acceleration path, DNA is
effectively introduced (Gan, Carol. "Gene Gun Accelerates
DNA-Coated Particles To Transform Intact Cells". The Scientist;
Sep. 18, 1989, 3[18]:25. This reference is herein incorporated by
reference.). Uncoated metal particles could also be shot through a
solution containing DNA surrounding the cell thus picking up the
genetic material and proceeding into the living cell. A perforated
plate stops the shell cartridge but allows the slivers of metal to
pass through and into the living cells on the other side. The cells
that take up the desired DNA, identified through the use of a
marker gene (in plants the use of GUS is most common), are then
cultured to replicate the gene and possibly cloned. The biolistic
method is most useful for inserting genes into plant cells such as
pesticide or herbicide resistance. Different methods have been used
to accelerate the particles: these include for example pneumatic
devices; instruments utilizing a mechanical impulse or
macroprojectile; centripetal, magnetic or electrostatic forces;
spray or vaccination guns; and apparatus based on acceleration by
shock wave, such as electric discharge.
[0076] The following invention also provides for the control and/or
modulation of a cellular signal transduction pathway(s) designed to
transduce and amplify signals emanating from the cell surface and
resulting in some cellular effector function. One exemplar
characterization of effector function as used herein may include
responses resulting in cellular growth, differentiation, or the
production (and sometimes release or transport out of the cell) of
growth factors and/or other substances that have biological
activity. For example, the following invention also provides for
the stimulation of IL-2 production in a specified cell. This aspect
of the invention can be achieved by modifying a specified cell to
produce a chimeric protein having the ectodomain of the CEACAM1
receptor joined to a non-CEACAM1 adaptor portion capable of
transducing signals effective in producing a response resulting in
IL-2 production. One exemplar embodiment of the present invention
provides chimeric constructs consisting of the extracellular
portion of the human CEACAM1 protein fused to the transmembrane and
cytosolic tail of the mouse zeta chain. Generation of BW cells
(murine thymoma that lack ab chains of TCR, but have an intact
mIL-2 secretion machinery) transfected with CEACAM1-mouse zeta
construct resulted in the production of IL-2 upon addition of
CEACAM1. The engagement of CEACAM1 in these cells activates the
zeta chain. The BW cells are T cells, which respond to signals
delivered by the zeta chain by secretion of mIL-2. The amount of
mIL-2 detected in the medium correlates with CEACAM1
engagement.
Example 1
Residues 43R and 44Q of Carcinoembryonic Antigen Cell Adhesion
Molecules-1 (CEACAM1) are Critical in the Protection from Killing
by Human NK Cells
[0077] The present inventors have shown that the CEACAM1 (CD66a)
homophilic interactions inhibit the killing activity of NK cells.
This novel inhibitory mechanism plays a key role in melanoma immune
evasion, inhibition of decidual immune response, and controlling NK
autoreactivity in TAP2-deficient patients. These roles are mediated
mainly by homophilic interactions, which are mediated through the
N-domain of the CEACAM1. The N-domain of the various members of the
CEACAM family shares a high degree of similarity. The present
inventors have addressed which of the CEACAM family members are
able to interact with CEACAM1 and what amino acid residues control
this interaction. In this section it is shown that CEACAM1
interacts with CEACAM5, but not with CEACAM6. The present inventors
have demonstrated the inability of CEACAM1 to bind CEACAM6.
Importantly, the present inventors provide the molecular basis for
CEACAM1 recognition of various CEACAM family members. Sequence
alignment reveals a dichotomy among the CEACAM family members: both
CEACAM1 and CEACAM5 contain the R and Q residues in positions 43
and 44, respectively, whereas CEACAM3 and CEACAM6 contain the S and
L residues, respectively. Mutational analysis revealed that both
.sup.43R and .sup.44Q residues are necessary for CEACAM1
interactions. The inventors have considered the implications for
differential expression of CEACAM family members in tumors.
[0078] The inventors in this section directly show that the
presence of both residues 43R and 44Q in the CEACAM1 is crucial for
the homophilic CEACAM1 interaction and that substitution of these
residues with the 43S and 44L residues that are present in CEACAM6
abolishes the inhibitory effect. Importantly, the reciprocal
substitution of 43S and 44L of CEACAM6 to the 43R and 44Q residues,
respectively, results in the gain of inhibitory heterophilic
interactions with the CEACAM1 protein. The dichotomy of CEACAM
family members by recognition of CEACAM1 is determined by the
presence of R and Q at positions 43 and 44. (Gal Markel et al., The
Critical Role of Residues 43R and 44Q of Carcinoembryonic Antigen
Cell Adhesion Molecules-1 in the Protection from Killing by Human
NK Cells, The Journal of Immunology, 2004, 173: 3732-3739. This
reference is herein incorporated by reference.)
Materials and Methods
Cells
[0079] The cell lines used were the MHC class I-negative
721.221human cell line, the murine thymoma BW cell line that lacks
expression of_- and _-chains of the TCR, and the NK tumor line YTS.
Primary NK cells were isolated from PBL using the human NK
isolation kit and the autoMACS instrument (Miltenyi Biotec, Auburn,
Calif.). For the enrichment of CEACAM1-positive NK cells, isolated
NK cells were further purified by depletion of CD16-positive NK
cells, using the anti-CD16 mAb B73.1.1 and the auto MACS
instrument. NK cells were grown in culture as previously described
(16). CEACAM1-positive NK clones were identified by flow cytometry
using the anti-CEACAM1 mAb 5F4 and were tested for inhibition in
killing assays against .221/CEACAM1 cells.
Antibodies
[0080] The Abs used in this work were mAb Kat4c (DakoCytomation,
Carpenteria, Calif.), directed against CEACAM1, -5, -6, and -8; the
anti-CD99 mAb12E7; the rabbit polyclonal anti-CEACAM
(DakoCytomation); and the specific anti-CEACAM1 mAb 5F4 (10).
Rabbit polyclonal Abs against purified ubiquitin were used as the
control.
Generation of CEACAM1-Ig Fusion Protein
[0081] The extracellular portion of the CEACAM1 protein was
amplified by PCR using the following primers: the 5' primer
CCCAAGCTTGGGGCCGC CACCATGGGGCACCTCTCAGCC (including the HindIII
restriction site) and the 3' primer GCGGATCCCCAGGTGAGAGGC
(including the BamHI restriction site). A silent mutation,
adenine885guanidine (no change in glycine281) was performed by
site-directed mutagenesis to cancel the BamHI site in the amplified
sequence. The production of the CEACAM1-Ig and CD99-Ig fusion
proteins by COS-7 cells and purification on a protein G column were
previously described (8, 17). The fusion proteins were periodically
analyzed for degradation by SDS-PAGE.
Generation of Transfectants
[0082] The 721.221 cells expressing CEACAM1 and CEACAM6 proteins
were generated as previously described (7). The CEACAM5 cDNA was
subcloned into pcDNA3 vector. This construct was permanently
transfected to 721.221 cells. For the generation of 721.221 cells
expressing the CEACAM6 protein fused to the tail of CEACAM1, the
extracellular portion of the CEACAM6 was first amplified without
the GPI-anchoring sequence using the 5' primer
CCCAAGCTTGCCGCCACCATGGGAC CCCCCTCAGCC (including the HindIII
restriction site) and the 3' primer AATGGCCCCTCCAGAGACTGTGATCATCGT
(including the first nine nucleotides of the CEACAM1 transmembrane
portion). The transmembrane and tail of the CEACAM1 protein were
amplified with the 5' primer GTCTCTGGAGGGGCCATTGCTGGCATTG
(including the last nine nucleotides of the CEACAM6 extracellular
portion before the GPI anchor motif) and the 3' primer
GGAATTCCTTACTGCTTTTTTACTTCTGAATA (including the EcoRI restriction
site). Amplified fragments were mixed and fused by an additional
PCR that was performed with the 5'-HindIII primer and the 3'-EcoRI
primer. The construct was cloned into pcDNA3 vector (Invitrogen
Life Technologies, Carlsbad, Calif.) and permanently transfected to
721.221 cells. For the generation of BW cells expressing the
chimeric CEACAM1-.sub.-- protein, the same technique was used. The
extracellular portion of the human CEACAM1 protein was amplified by
PCR using the 5' primer CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC
(including HindIII restriction site) and the 3' primer GTAGCAGAGAG
GTGAGAGGCCATTTTCTTG (including the first nine nucleotides of the
mouse _-chain transmembrane portion). The mouse _-chain was
amplified by PCR using the 5' primer CTCTCACCTCTCTGCTACT
TGCTAGATGGA (including last nine nucleotides of human CEACAM1
extracellular portion) and the 3' primer GGAATTCCTTA
GCGAGGGGCCAGGGTCTG (including EcoRI restriction site). The two
amplified fragments were mixed, and PCR was performed with the 5'
HindIII primer and the 3' EcoRI primer for generation of the
CEACAM1-.sub.-- construct. The CEACAM1-.sub.-- construct was cloned
into pcDNA3 expression vector (Invitrogen Life Technologies) and
was stably transfected into BW cells. All transfectants were
periodically monitored for expression by staining with the
appropriate mAb.
Generation of 721.221 Cells Expressing Mutated CEACAM1 or CEACAM6
Proteins
[0083] For generation of the mutated CEACAM proteins, two
overlapping fragments of the gene were amplified by PCR. The
upstream fragment was amplified by using a gene-specific 5'-edge
primer (including the HindIII restriction site) and an internal 3'
primer bearing the mutation. The downstream fragment was amplified
using an internal 5' primer bearing the mutation and a
gene-specific 3'-edge primer (including EcoRI restriction site).
Next, both purified fragments were mixed together with the 5'-edge
primer and the 3'-edge primer to generate the mutated full-gene
cDNA. All different mutants of the same CEACAM gene were generated
using the same appropriate edge primers and different internal
primers. The various cDNAs were then cloned into the pcDNA3
mammalian expression vector and stably transfected into the .221
cell line. All transfectants were periodically monitored for
expression by staining with the appropriate mAb. For
CEACAM1-RQ43,44SL, the 5_-CEACAM1 edge primer was
CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC, the 3'-CEACAM1 edge primer
was GGAATTCCTTACTGCTTTTTTACT TCTGAATA, the 5' internal primer was
GCCAACAGTCTAATTGTA GGA, and the 3' internal primer was
TCCTACAATTAGACTGTTGCC. For CEACAM1-R43A, the 5' internal primer was
GATGGCAACGCTCAAAT TGTA, and the 3' internal primer was
TACAATTTGAGCGTTGCCATC. For CEACAM1-Q44L, the 5' internal primer was
ATGGCAACCGTCTA ATTGTAG, and the 3' internal primer was
CTACAATTAGACGGTTGC CAT. For CEACAM6-SL43,44RQ, the 5'-CEACAM6 edge
primer was CCCAAGCTTGCCGCCACCATGGGACCCCCCTCAGCC, the 3'-CEACAM6
edge primer was GGAATTCCCTATATCAGAGCCACCCTGG, the 5' internal
primer was GGCAACCGTCAAATTGTAGGA, and the 3' internal primer was
TCCTACAATTTGACGGTTGCC. For CEACAM6-S43R, the 5' internal primer was
GATGGCAACCGTCTAAT TGTA, and the 3' internal primer was
TACAATTAGACGGTTGCCATC. For CEACAM6-L44Q, the 5' internal primer was
GATG GCAACAGTCAAATTGTA, and the 3' internal primer was
TACAATTTGACTGTTGCCATC.
Cytotoxicity Assays
[0084] The cytotoxic activity of YTS and NK cells against various
targets was assayed in 5-h [35S]Met release assays, as described
previously (16). In experiments in which rabbit polyclonal Abs were
included, the final concentration was 20 _g/ml. In all cytotoxicity
assays performed, spontaneous release did not exceed 20% of maximal
labeling.
Cross-Linking of BW/CEACAM1 Cells
[0085] BW/CEACAM1 cells (0.5_105/well) were incubated with various
amounts of Kat4c mAb on ice for 1 h in 96-well, round-bottom
microplates (Nalge Nunc, Rochester, N.Y.). Treated BW/CEACAM1-_
cells, present in 200 _l of RPMI 1640 complete medium, were then
cultured in 96-well, flat-bottom microplates (Nalge Nunc) precoated
with 1 _g/well sheep anti-mouse IgG Abs (ICN Biomedicals, Costa
Mesa, Calif.) for 24 h at 37.degree. C. Supernatant was harvested,
and the amount of murine IL-2 (mIL-2) was determined by ELISA.
CEACAM1 Protein does not Recognize CEACAM6
[0086] The surface expression of the CEACAM1 protein on tumors is
associated with poor prognosis in melanoma and lung adenocarcinoma
patients. Moreover, the CEACAM1 homophilic interactions confer
protection from human NK-mediated cytotoxicity, and in some
melanoma patients bearing CEACAM1-positive tumors, a dramatic
increase in the proportion of CEACAM1-positive NK cells was
observed. Because heterophilic interactions of the CEACAM1 protein
with the CEACAM6 protein were reported previously (12), and because
some CEACAM1-positive tumors down-regulate the CEACAM1 protein
expression and instead replace it with CEACAM6 (14, 15), it was
investigated whether CEACAM1 can interact with CEACAM6.
[0087] 721.221 (.221) cells were transfected with the CEACAM1 cDNA
(.221/CEACAM1) and with the CEACAM6 cDNA (.221/CEACAM6) as
described in Materials and Methods. The expression level was
monitored with the Kat4c mAb (FIG. 1). For measuring direct binding
of CEACAM1 to the transfected cells, the extracellular portion of
the CEACAM1 fused to the Fc portion of human IgG1 (CEACAM1-Ig) was
used in flow cytometry binding assays. The production and
purification of the CEACAM1-Ig fusion protein were performed as
described in Materials and Methods. Homophilic binding of the
CEACAM1-Ig fusion protein was observed only in the .221/CEACAM1
cells (FIG. 1). In contrast, despite a slightly higher expression
level of the CEACAM6 protein (detected by Kat4c mAb, FIG. 1),
CEACAM1-Ig did not bind to .221/CEACAM6 cells (FIG. 1). The control
CD99-Ig fusion protein did not stain any of the transfectants.
[0088] The potential heterophilic interactions between the CEACAM1
and CEACAM6 proteins were further investigated using the BW cell
system. BW cells were stably transfected with the extracellular
portion of the CEACAM1 fused to mouse _-chain (BW/CEACAM1-_) as
described in Materials and Methods. The specific functionality of
BW/CEACAM1-_ was assessed by crosslinking the CEACAM1 receptor
using different amounts of immobilized Kat4c mAb as described in
Materials and Methods. Engagement of the CEACAM1 protein elicited
the synthesis and secretion of mIL-2 in a dose dependent manner
(FIG. 2A). Treatment with the control anti-CD99 12E7 gave no
response (FIG. 2A). Next, BW parental cells and BW/CEACAM1-_ were
co cultured with irradiated .221, 0.221/CEACAM1, or .221/CEACAM6
cells for 48 h. Significant amounts of mIL-2 were detected in the
supernatant of BW/CEACAM1-_ cells co incubated with .221/CEACAM1
cells (FIG. 2B). In contrast, no mIL-2 was detected when
BW/CEACAM1-_ cells were co incubated with .221 or .221/CEACAM6
cells (FIG. 2B). No secretion of mIL-2 was observed when parental
BW cells were used (FIG. 2B). These combined results suggest that
the CEACAM1 and CEACAM6 proteins do not bind or functionally
interact.
GPI Anchorage of CEACAM6 is not Responsible for the Lack of
Heterophilic Interactions with the CEACAM1
[0089] Several explanations may account for the potential lack of
heterophilic interactions between CEACAM1 and CEACAM6 proteins.
CEACAM1 is a transmembrane protein, whereas CEACAM6 is GPI-anchored
to the cell membrane. It is possible that the GPI anchor of CEACAM6
and the absence of transmembrane and cytosolic portions weaken the
interaction. Furthermore, it is possible that other transmembrane
elements play a key role in the interactions. For example, a
cysteine residue located in the transmembrane domain of HLA-C was
reported to be crucial for the inhibition mediated by an unknown
inhibitory NK receptor. To test whether the GPI anchor of CEACAM6
protein is responsible for the lack of CEACAM1 binding, a chimeric
construct comprised of the entire extracellular portion of CEACAM6
fused to the transmembrane and tail portions of CEACAM1
(CCM6-TailCCM1) was generated. The .221 cells were stably
transfected with the CCM6-TailCCM1 construct (.221/CCM6-TailCCM1).
The expression level of the CCM6-TailCCM1 chimeric protein,
detected by Kat4c mAb, was similar to that of the other .221/CEACAM
stable transfectants (FIGS. 1 and 3A). Importantly, no binding of
CEACAM1-Ig was observed to .221/CCM6-TailCCM1cells (FIG. 3A). In
agreement with the binding results, the presence of mIL-2 was not
detected in the supernatant of BW/CEACAM1 cells co incubated with
.221/CCM6-TailCCM1cells (FIG. 3B). These results suggest that the
lack of heterophilic interactions of CEACAM1 and CEACAM6 may not be
due to the transmembrane and cytosolic tail portions of the
proteins.
Residues 43R and 44Q are Critical for CEACAM1 Binding
[0090] CEACAM-related proteins share a common basic structure of
several sequential Ig-like domains. The Ig-like domains serve as
fundamental building blocks of the various CEACAM-related proteins,
and they differ only slightly from one protein to another.
Importantly, the binding site of the CEACAM1 is located in the
N-domain (13). Sequence alignment of the N-domains of
CEACAM-related proteins, including CEACAM1, CEACAM3, CEACAM5, and
CEACAM6, revealed exceptional homology (FIG. 4). Within the CEACAM1
N-domain, several amino acid residues may be crucial for binding.
These include amino acids 39V and 40D (13) and the salt bridge
between 64R and 82D (13). All of the above-reported amino acid
residues are present in the N-domain of CEACAM6 (FIG. 4), implying
that they may not account for the lack of heterophilic interactions
with the CEACAM1 protein.
[0091] Three short sequences located in the N-domain of CEACAM5 are
critical for CEACAM5 homophilic interactions (Taheri et al. (20)).
These short sequences include 30GYSWYK, 42NRQII, and 80QNDTG.
Importantly, these three short sequences are present in the
N-domain of the CEACAM1 protein. However, only the 30GYSWYK and
80QNDTG short sequences are preserved in the N-domain of the
CEACAM6 protein, whereas the 43R44Q residues are replaced with
43S44L residues within the 42NRQII sequence (FIG. 4). A mutated
construct was generated of the CEACAM6 gene that includes amino
acids R and Q at positions 43 and 44 instead of S and L,
respectively (CCM6-SL43,44RQ). In addition, the reciprocal mutation
in CEACAM1 was generated that includes amino acids S and L at
positions 43 and 44 instead of R and Q, respectively
(CCM1-RQ43,44SL). The .221 cells were stably transfected with the
various constructs and tested for expression using Kat4c mAb (FIG.
5A). The expression levels of the mutated proteins were similar to
those of CEACAM1 and CEACAM6 (FIGS. 1 and 5A).
[0092] Next, .221/CCM6-SL43,44RQ and .221/CCM1-RQ43,44SL were
tested in flow cytometry binding assays using CEACAM1-Ig.
Remarkably, substitution of 43R44Q with 43S44L in
.221/CCM1-RQ43,44SL abolished homophilic binding (FIG. 5A). This
abolishment was probably not merely due to a steric disturbance of
the CEACAM1 N-domain structure, because the reciprocal mutation,
43S44L with 43R44Q in .221/CCM6-SL43,44RQ, conferred strong binding
of the CEACAM1-Ig fusion protein (FIG. 5A). The CD99-Ig fusion
protein did not stain any of the transfectants. Strikingly,
recognition of the mutated CEACAM1 protein by the
conformation-dependent anti-CEACAM1 mAb 5F4 (10, 13), was
abolished, whereas specific staining of .221/CCM6-SL43,44RQ was
observed (FIG. 5B). These results imply that the 43R and 44Q
residues are critically involved in conferring the appropriate
conformation required for recognition by CEACAM1.
[0093] The binding results were also confirmed by functional assays
using the BW cell system. Significant amounts of mIL-2 were
detected only in supernatants of BW/CEACAM1-_ cells co incubated
with irradiated .221/CCM6-SL43,44RQ or .221/CEACAM1 cells (FIG.
5C). The stronger mIL-2 induction after incubation of BW/CEACAM1-_
cells with the .221/CCM6-SL43,44RQ cells compared with .221/CEACAM1
cells might be due to the higher protein expression measured by
Kat4c mAb (FIGS. 1 and 5A). The presence of mIL-2 could not be
detected in the supernatants of BW/CEACAM1-_ cells co incubated
with irradiated .221/CEACAM6 cell or .221/CEACAM1 RQ43,44SL (FIG.
5C). Mouse IL-2 was not detected when BW parental cells were used.
These results show that residues 43R44Q are critical for the
functional CEACAM1 interactions.
Residues 43R and 44Q are Critical for CEACAM1-Mediated Inhibition
of Nk Cell Cytotoxicity
[0094] CEACAM1 plays a major role in regulation of NK cell
cytotoxicity (7), inhibition of decidual immune responses after
activation (8), and conferring protection from NK autoreactivity in
TAP2-deficient patients (9). To test whether residues 43R44Q would
also be important in the inhibition of NK killing, NK cells from
several healthy donors were isolated, depleted the CD16-positive NK
cells, activated NK clones were then cultured as described in
Materials and Methods, and stained for CEACAM1 expression.
[0095] CEACAM1-positive NK clones were assayed for cytotoxic
activity against .221 parental cells and various stable
transfectants, including 221/CEACAM1, 0.221/CEACAM6,
0.221/CCM6-Tail-CCM1, 0.221/CCM1-RQ43,44SL, and .221/CCM6-SL43,44RQ
cells. NK cytotoxicity assays were performed with no Ab included,
in the presence of anti CEACAM polyclonal Abs, or with the control
anti-ubiquitin polyclonal Abs. All NK clones efficiently killed
parental .221 cells regardless of whether Abs were included
(representative clone NK23 is presented in FIG. 6). As previously
reported (7-9), inhibition of NK killing was observed when
.221/CEACAM1 cells were used. This inhibition was the result of
CEACAM1 inhibition, because anti-CEACAM Abs abrogated this effect
(FIG. 6). The lack of heterophilic interactions between CEACAM1 and
CEACAM6 was evident in the NK killing assays, because .221/CEACAM6
and .221/CCM6-TailCCM1 cells were killed as efficiently as parental
.221 cells (FIG. 6). In agreement with the above results (FIG. 5),
no inhibition was observed when .221/CCM1 RQ43,44SL cells were used
(FIG. 6). Remarkably, a strong inhibition of killing was observed
when CCM6-SL43,44RQ cells were used as targets (FIG. 6). The
inhibition was even stronger than that observed with the homophilic
CEACAM1 interactions, probably due to the higher CCM6-SL43,44RQ
expression. This inhibition was the result of heterophilic
interactions with CEACAM1 protein on NK cells, because killing was
restored when anti-CEACAM Abs were included in the assay (FIG. 6).
The control anti-ubiquitin had little or no effect when included in
the assays (FIG. 6).
Specificity of CEACAM1 Binding to CEACAM6 is Controlled by the
Presence of Both 43R and 44Q Residues
[0096] To determine whether both residues are required for binding,
the amino acid residues in positions 43 and 44 in CEACAM1 (contains
43R44Q) and CEACAM6 (contains 43S44L) were mutated. Using
site-directed mutagenesis in the CEACAM1, the 43R residue was
changed to 43A (CCM1-R43A) and the 44Q residue was changed to 44L
(CCM1-Q44L). In CEACAM6, the 43S was changed to 43R (CCM6-S43R) and
44L was changed to 44Q (CCM6-L44Q). All mutants were generated as
described in Materials and Methods and stably transfected into .221
cells. The expression level was monitored by Kat4c mAb, and
conformation was monitored by 5F4 mAb (FIG. 7A). Importantly,
substitution for 44Q in CEACAM1 protein by 44L in .221/CCM1-Q44L
completely abrogated 5F4 binding, whereas the Kat4c binding
observed was similar to that of wild type CEACAM1 (FIG. 7A). This
suggests that the 44Q residue is essential for maintaining
appropriate conformation, which is crucial for binding of 5F4 mAb.
Indeed, this mutation also resulted in a lack of recognition by the
CEACAM1-Ig (FIG. 7B). Similar results were obtained when both 44Q
and 43R residues in CEACAM1 were mutated (FIG. 5). The reciprocal
mutant .221/CCM6-L44Q was not recognized by 5F4 mAb, suggesting
that it is not the only factor crucial for conferring the
appropriate conformation for 5F4 (FIG. 7A). Compatible with the
latter observation, no binding of CEACAM1-Ig to .221/CCM6-L44Q
could be detected (FIG. 7B). Point mutation in the 43R residue of
CEACAM1 did not affect 5F4 mAb binding (FIG. 7A), suggesting that
by itself the 43R residue had no significant effect on conformation
of 5F4-recognized epitope. Despite that, the CEACAM1-Ig fusion
protein did not recognize .221/CEACAM1-R43A cells (FIG. 7B).
Elements of CEACAM1 other than the presence of the 5F4 epitope and
the presence of the 44Q residue may play a crucial role in CEACAM1
binding. In this regard, it should be noted that the expression
level of .221/CCM1-R43A obtained was lower than the expression
levels of the other transfectants (FIG. 7A), which might account
for the lack of efficient binding of CEACAM1-Ig. Therefore, to test
whether the 43R residue by itself can confer CEACAM1 binding, the
43S of CEACAM6 was replaced with 43R. The .221/CCM6-S43R cells were
not stained by either the 5F4 mAb (FIG. 7A) or the CEACAM1-Ig
fusion protein (FIG. 7B). Gain-of-binding of CEACAM1-Ig to CEACAM6
was evident only when both 43S and 44L residues were replaced with
43R and 44Q, respectively (FIG. 5A). Thus, both 43R and 44Q
residues are critical for interaction with CEACAM1.
[0097] These binding results were also confirmed in functional
killing assays. To optimize the isolation of the experimental
variables, the YTS NK tumor line was used. The NK tumor line YTS
was either mock-transfected (YTS/control) or transfected with
CEACAM1 protein (YTS/CCM1) as previously described (7) and tested
in killing assays against the various .221 transfectants. The
function of CEACAM1 protein in YTS/CCM1 cells was confirmed,
because killing of .221/CEACAM1 cells was inhibited compared with
killing by YTS/control cells, whereas .221/CEACAM6 and
.221/CCM6-TailCCM1 cells were killed with similar efficiency (FIG.
7C). In agreement with the CEACAM1-Ig binding results, the
inhibition of YTS/CCM1 cells was abolished when the
.221/CCM1-RQ43,44SL and .221/CCM1-Q44L transfectants were used as
targets (FIG. 7C), demonstrating the critical role of residue 44Q.
In agreement with the above observation, the presence of 44Q only
is not enough to confer inhibition, and only a mild inhibitory
effect was observed when the .221/CCM1-R43A cells were used (FIG.
7C). This result was also supported by the observation that
inhibition of YTS/CCM1 cells by heterophilic interactions with
CEACAM6 was observed only with the .221/CCM6-SL43,44RQ double
mutation, whereas no inhibition was observed when .221/CCM6-S43R or
.221/CCM6-L44Q cells were used (FIG. 7C). Similar results were
obtained with primary NK clones. Both R and Q residues in positions
43 and 44, respectively, are required for functional interaction
with CEACAM1.
[0098] CEACAM1 can heterophilically interact with the CEACAM5
protein (12). The CEACAM5 protein is the only CEACAM family member
other than CEACAM1 that contains 43R44Q residues (FIG. 4). The
interactions between CEACAM1 and CEACAM5 was also examined. The
expression level of .221/CEACAM5 transfectant was monitored with
Kat4c and was similar to that of the other CEACAM transfectants
(FIG. 7D). The .221/CEACAM5 cells were not stained by the
anti-CEACAM1-specific 5F4 mAb (FIG. 7D). Efficient heterophilic
binding of the CEACAM1-Ig fusion protein to .221/CEACAM5 was
observed (FIG. 7D).
Modulation of CEACAM1 Activity in Adoptive Immunotherapy
[0099] Adoptive immunotherapy is a general term describing the
transfer of immunocompetent cells (i.e. lymphocytes) to a patient
for the treatment of a disease, such as cancer. For example, a
cancer patient's immune system is sometimes capable of delaying
tumor progression and on rare occasions can eliminate the tumor
altogether. A variety of immunologic therapies designed to
stimulate the patient's own immune system exist. For example,
passive non-specific immunotherapy might involve the transfer of
lymphokine activated killer cells. Another example is passive
specific immunotherapy, including the transfer of specific immune
cells such as cytotoxic T-lymphocytes or lymphocytes producing
specific antibodies.
[0100] One example of adoptive immunotherapy involves removing
lymphocytes from the patient, boosting their anti-cancer activity,
growing them in large numbers, and then returning them to the
patient. For example, stronger response against tumor cells is
obtained using lymphocytes isolated from the tumor itself. These
tumor-infiltrating lymphocytes (TILs) are grown in the presence of
IL-2 and returned to the body to attack the tumor. Researchers are
also using radiolabeled monoclonal antibodies for tumor antigens to
even more closely identify lymphocytes specific for tumor
cells.
[0101] One object of the present invention provides materials
and/or for enhancing the efficacy of Tumor Infiltrating Lymphocyte
based therapy in the treatment of cancer, which includes the
modulation of CEACAM1 function in a population of Tumor
Infiltrating Lymphocytes. The method may involve, for example, the
disruption of a CEACAM1 protein-protein interaction, that may be
either homotypic or heterotypic. The method may also involve, for
example, the negative modulation of CEACAM1 gene expression and/or
translational efficiency in a population of Tumor Infiltrating
Lymphocytes.
Strategies and Protocals for TIL Isolation, Expansion and
Treatment
[0102] One major challenge in adoptive immunotherapy is to develop
immune cells with specific antitumor reactivity that could be
generated in large enough quantities for transfer to tumor bearing
patients. The lymphocytes infiltrating a tumor (TILs) are both
cytotoxic and helper T cells and have specific antitumor activity,
presumably because they recognize specific tumor antigens. TIL
therapy involves harvesting the tumor-infiltrating lymphocytes from
the tumor itself and then isolating the cells by growing single
cell suspensions from the tumor. After several weeks of culture in
the presence of IL-2, the activated TIL cells are transfused back
into the patient [Rosenberg S A, Lotze M T, Yang J C et al.
Prospective randomized trial of high-dose interleukin-2 alone or in
conjunction with lymphokine-activated killer cells for the
treatment of patients with advanced cancer. J Nat Cancer Inst 1993;
85:622-32. This reference is herein incorporated by reference.]
This technique may require an additional biopsy procedure for the
sole purpose of harvesting a portion of tumor for subsequent
isolation of the TILs.
[0103] When cultured in the presence of IL-2, TILs can be activated
and expanded in great numbers. TILs can be prepared from primary or
metastatic tumors. The specimens are excised and digested in an
enzyme solution, and the sterile, single-cell suspension is
incubated in the presence of IL-2. In three to four weeks, an
activated T-lymphocyte population is generated, and approximately
1011 cells are reinfused into the patient together with IL-2. The
lymphocyte subpopulations vary according to the histology of the
original tumor, culture conditions, IL-2 concentration, and other
variables. The expansion of Human Tumor-Infiltrating Lymphocytes
has been characterized under different conditions. There are many
strategies and protocols for TIL isolation, expansion and
treatment, including for example, the following references, which
are herein incorporated by reference: [0104] [Yannelli J R,
Wroblewski J M., On the road to a tumor cell vaccine: 20 years of
cellular immunotherapy., Vaccine. 2004 Nov. 15; 23(1):97-113. This
reference is herein incorporated by reference.] [0105] [Yamaguchi Y
et al., Adoptive immunotherapy of cancer using activated autologous
lymphocytes--current status and new strategies., Hum Cell. 2003
December; 16(4):183-9. This reference is herein incorporated by
reference.] [0106] [Colin C. Malone et al. Characterization of
Human Tumor-Infiltrating Lymphocytes Expanded in Hollow-Fiber
Bioreactors for Immunotherapy of Cancer. Cancer Biotherapy &
Radiopharmaceuticals. October 2001, Vol. 16, No. 5: 381-390. This
reference is herein incorporated by reference.] [0107] [Whiteside T
L, Miescher S, Hurlimann J, Moretta L, von Fliedner V. Separation,
phenotyping and limiting dilution of T lymphocytes infiltrating
human solid tumors. Int J Cancer 1986; 37:803-11. renal cell
carcinoma. J Urol 1993; 150:1384-90. This reference is herein
incorporated by reference.] [0108] [Rosenberg S A, Speiss P,
Lafreniere R. A new approach to adoptive immunotherapy of cancer
with tumor-infiltrating lymphocytes. Science 1986; 233:1318-21.
This reference is herein incorporated by reference.] [0109] [Knazek
R A, Wu Y W, Aebersold P A, Rosenbeg S A. Culture of tumor
infiltrating lymphocytes in hollow fiber bioreactors. J Immunol
Methods 1990; 127:29-37. This reference is herein incorporated by
reference.] [0110] [Bukowski R M, Sharfman W, Murthy S, et al.
Clinical results and characterization of tumor-infiltrating
lymphocytes with or without recombinant interleukin-2 in human
metastatic renal cell carcinoma. Cancer Res 1991; 51:4199-4205.
This reference is herein incorporated by reference.] [0111] [Lewko
W M, Good R W, Bowman D, Smith T K, Oldham R K. Growth of tumor
derived activated T-cells for the treatment of cancer. Cancer
Biother 1994; 9:211-24. This reference is herein incorporated by
reference.] [0112] [Hillman G G, Wolf M L, Montecillo E, Younes E,
Ali E, Pontes J E, Haas G P. Expansion of activated lymphocytes
obtained from renal cell carcinoma in an automated hollow fiber
bioreactor. Cell Transplant 1994; 3:263-271. This reference is
herein incorporated by reference.] [0113] [Yannelli J R, Hyatt C,
McConnell, et al. Growth of tumor-infiltrating lymphocytes from
human solid cancers: summary of a 5-year experience. Int J Cancer
1996; 65: 413-22. This reference is herein incorporated by
reference.] [0114] [Schiltz P M, Beutel L D, Nayak S K, Dillman R
O. Characterization of tumor infiltrating lymphocytes derived from
human tumors for use as adoptive immunotherapy of cancer. J
Immunother 1997; 20:377-386. This reference is herein incorporated
by reference.] [0115] [Topalian S L, Solomon D, Avis F P, et al.
Immunotherapy of patients with advanced cancer using
tumor-infiltrating lymphocytes with recombinant interleukin-2: a
pilot study. J Clin Oncol 1988; 6:839-53. This reference is herein
incorporated by reference.] [0116] [Rosenberg S A, Packard B S,
Aebersold P M, et al. Use of tumor infiltrating lymphocytes and
interleukin-2 in the immunotherapy of patients with metastatic
melanoma: a preliminary report. N Engl J Med 1988; 319: 1676-80.
This reference is herein incorporated by reference.] [0117] [Kradin
R L, Kurnick J T, Lazarus D S, et al. Tumor-infiltrating
lymphocytes and interleukin-2 in treatment of advanced cancer.
Lancet 1989; 18:577-80. This reference is herein incorporated by
reference.] [0118] [Dillman R O, Oldham R K, Barth N M, et al.
Continuous interleukin-2 and tumor-infiltrating lymphocytes as
treatment of advanced melanoma; a National Biotherapy Study Group
trial. Cancer 1991; 68:1-8. This reference is herein incorporated
by reference.] [0119] [Oldham R K, Dillman R O, Yannelli J R, et
al. Continuous infusion interleukin-2 and tumor-derived activated
cell as treatment of advanced solid tumors; a National Biotherapy
Study Group. Molec Biother 1991; 3:68-73. This reference is herein
incorporated by reference.] [0120] [Belldegrun A, Pierce W, Kaboo
R, et al. Interferon-a primed tumor-infiltrating lymphocytes
combined with interleukin-2 and interferon-a as therapy for
metastatic renal cell carcinoma. J Urol 1993; 150:1384-90. This
reference is herein incorporated by reference.] [0121] [Rosenberg S
A, Yannelli J R, Yang J C, et al. Treatment of patients with
metastatic melanoma with autologous tumor infiltrating lymphocytes
and interleukin-2. J Natl Cancer Inst 1994; 86:1159-66. This
reference is herein incorporated by reference.] [0122]
[Goedegebuure P S, Douville L M, Li H, et al. Adoptive
immunotherapy with tumor-infiltrating lymphocytes and interleukin-2
in patients with metastatic malignant melanoma and renal cell
carcinoma: a pilot study. J Clin Oncol 1995; 13:1939-49.] [0123]
[Fuji K, Karachi H, Takakuwa K, et al. Prolonged disease-free
period in patients with advanced epithelial ovarian cancer after
adoptive transfer of tumor-infiltrating lymphocytes. Clin Cancer
Res 1995; 1:501-7.] [0124] [Queirolo P, Ponte M, Gipponi M, et al.
Adoptive immunotherapy with tumor infiltrating lymphocytes and
subcutaneous recombinant interleukin-2 plus interferon alfa-2a for
melanoma patients with nonresectable distant disease: a phase I/II
pilot trial. Ann Surg Oncol 1999; 6:272-278.] [0125] [Semino C,
Martini L, Queirolo P, et al. Adoptive immunotherapy of advanced
solid tumors: an eight year clinical experience. Anticancer
Research 1999; 19: 5645-5650.]
Example 2
Biological Function of the Soluble CEACAM1 Protein and Implications
in TAP2-Deficient Patients
[0126] Interactions of natural killer (NK) cells with MHC class I
proteins provide the main inhibitory signals controlling NK killing
activity. However, TAP2-deficient patients suffer from autoimmune
manifestations only occasionally in later stages of life. The
present inventors have demonstrated that the CEACAM1-mediated
inhibitory mechanism of NK cytotoxicity plays a major role in
controlling NK autoreactivity in three newly identified
TAP2-deficient siblings. This novel mechanism probably compensates
for the lack of MHC class I mediated inhibition. The CEACAM1
protein can also be present in a soluble form and the biological
function of the soluble form of CEACAM1 with regard to NK cells was
investigated by the present inventors. In this section, the present
inventors will show that the homophilic CEACAM1 interactions are
abrogated in the presence of soluble CEACAM1 protein in a
dose-dependent manner. Importantly, the amounts of soluble CEACAM1
protein detected in sera derived from the TAP2-deficient patients
were dramatically reduced as compared to healthy controls. This
dramatic reduction does not depend on the membrane-bound
metalloproteinase activity. The present inventors demonstrated that
the expression of CEACAM1 and the absence of soluble CEACAM1
observed in the TAP2-deficient patients practically maximize the
inhibitory effect and probably help to minimize autoimmunity in
these patients.
[0127] In this section, the present inventors will show that the
soluble CEACAM1 protein blocks the CEACAM1-mediated inhibition of
NK cell killing activity in a dose-dependent manner. Moreover, the
present inventors will demonstrate that serum CEACAM1 levels among
the TAP2-deficient patients are decreased when compared to normal
individuals, in agreement with the dominant role of the
CEACAM1-mediated inhibition in controlling NK autoreactivity in
TAP2-deficient patients. (Gal Markel et al., Biological function of
the soluble CEACAM1 protein and implications in TAP2-deficient
patients, Eur. J. Immunol. 2004. 34: 2138-2148. This reference is
herein now incorporated by reference.)
Materials and Methods
Cells
[0128] The cell lines used in this work were 721.221 (.221) cells
and .221 cells stably transfected with the CEACAM1 protein
(.221/CEACAM1) [17]. Primary human NK cells were isolated and
cultures maintained as described [30]. An Institutional Review
Board approved these studies and informed consent was provided
according to the Declaration of Helsinki.
Antibodies and Fusion Proteins
[0129] The following mAb were used: anti-CEACAM1, 5, 6, 8 mAb Kat4c
(DAKO), anti-NKp46 mAb 461-G1 [9, 20] and pan anti-MHC class I mAb
W6/32. In addition, several fluorochrome conjugated mAb were used,
including the anti-CD3-CyChrome (clone HIT3a, PharMingen),
anti-CD4-FITC (clone MT310, DAKO), anti-CD8-PE (clone DK25, DAKO),
anti-CD16-Biotin (clone LNK16, Serotec), anti-CD56-PE (clone B159,
PharMingen) and the Kat4c-FITC (DAKO). Polyclonal rabbit anti-human
CEACAM (DAKO) antibodies were used for blocking in killing assays
and the rabbit anti-ubiquitin antibodies were used as control. The
production and purification of the LIR1-Ig [48], KIR2DL2-Ig [49],
CEACAM1-Ig [19] and CD99-Ig [7] were performed as described
[19].
Flow Cytometry
[0130] Multiple staining analyses of PBL were performed with the
following fluorochrome-conjugated antibodies: anti-CD3-CyChrome,
anti-CD16-Biotin followed by streptavidin-Cy5 (Jackson
ImmunoResearch), anti-CD56-PE and anti-CEACAM-FITC. Another set of
antibodies used, included the anti-CD3-CyChrome, anti-CD4-FITC and
the anti-CD8-PE. Cells were pretreated with 20% human serum to
block nonspecific binding and control antibodies matching in
isotype as well as in the fluorochrome were used as background.
Staining with the various Ig-fusion proteins was performed as
previously described [17, 19].
Detection of Serum CEACAM1 Level by ELISA
[0131] A standard sandwich ELISA protocol was used to quantify the
amount of soluble CEACAM1 protein in the serum. The specific
anti-CEACAM1 5F4 mAb was used as capturing antibody. For detection,
biotinylated Kat4c mAb was used, followed by
streptavidin-horseradish peroxidase (Jackson ImmunoResearch).
Biotinylation of the Kat4c mAb was performed with
Sulfo-NHS-SS-Biotin (Pierce) according to the manufacturer's
instructions. The quantification was calculated according to
standard samples of CEACAM1-Ig fusion proteins.
Killing Assays
[0132] The cytotoxic activity of NK cells against the various
targets was assayed in 5-h 35S-release assays, as described [17].
In experiments where antibodies were included, the final Ab
concentration was 20 ug/ml. In all assays performed, the
spontaneous release did not exceed 25% of the maximal labeling.
MBMP Assays
[0133] Cells were tested for surface expression of various proteins
following activation of MBMP with PMA [34-36]. Tested cells were
distributed at 5.times.104 cells/well in 96-well U-bottom plates in
200 ul RPMI 1640 (Sigma) supplemented with 10% heat-inactivated
FCS. When PMA was included the final concentration was 4 ng/ml. The
final concentration of the metalloproteinase inhibitor BB-94 was 2
uM. The cells were incubated in a 5% CO2 humidified incubator at
37.degree. C. for 2 hours, washed twice and analyzed by FACS.
Characterization of PBL Subpopulations in TAP2-Deficient
Patients
[0134] Three new siblings were identified that suffer from a
deficiency in the TAP2 subunit [20]. This deficiency is inherited
in an autosomal recessive pattern (FIG. 8). The siblings, patients
A, B and C (19-year-old female, 14 and 9 years old males,
respectively) displayed several clinical manifestations, similar to
those displayed by other TAP2-deficient patients [24-26]. The other
five sisters, as well as the parents, who are first cousins, showed
no clinical symptoms and are considered healthy (FIG. 8).
[0135] PBL were obtained from the three patients, as well as from a
healthy sister. All three patients had normal values of lymphocytes
among their peripheral blood. The cells were stained for CD56 and
CD3 expression to differentiate between various lymphocyte
subpopulations, including NK cells (CD56+ CD3-), T cells (CD56-
CD3+) and NKT cells (CD56+ CD3+). Normal distribution of these
subpopulations could be observed among the three patients (FIG.
9A), implying that even the low level of MHC class I expression
observed in the patients [20] is still sufficient to select for
proper development of lymphocyte subpopulations.
[0136] Expression analysis of various MHC class I recognizing NK
inhibitory receptors on NK cells obtained from the patients
revealed marked changes [20]. Therefore, the expression pattern of
the CD16 and the CD56 on the freshly isolated NK cells were further
characterized. Patient A exhibited an increase in the percentage of
CD16- subpopulation (22%) as compared to the healthy sister (5%)
(FIG. 9B), whereas patients B and C displayed a milder trend (8%
and 11%, respectively) (FIG. 9B). Moreover, double staining showed
a skewing in the different subpopulations between the three
patients and the healthy sister; the CD56dim CD16- subset was
increased in patients A (7%) and C (9%) compared to the healthy
sister (3%) (FIG. 9B), the CD56bright CD16- subset was markedly
increased in patients A (15%) and B (6%) compared to the healthy
sister (2%) (FIG. 9B) and the CD56bright CD16+ subset was increased
only in patient A (8%) compared to the healthy sister (1%) (FIG.
9B). The NKp46 expression on NK cells was impaired in all patients
as compared to the healthy sister, most prominently in patient A
(Table 1). A remarkable difference in the CD4/CD8 ratio was
observed among the T cell subpopulations; 65% of the T cells from
the healthy sister expressed the CD4 receptor and 35% the CD8.
There were no double-positive CD4+CD8+ T cells. In contrast, CD4
was detected on the surface of 91%, 92% and 87% of the T cells
analyzed from patients A, B and C, respectively (Table 1). CD8 was
detected on the surface of 9%, 8% and 13% of the T cells analyzed
from patients A, B and C, respectively (Table 1). A similar skew in
the CD4/CD8 ratio was also observed among T cells in other
TAP2-deficient patients [24].
TABLE-US-00001 TABLE 1 Receptor expression.sup.a) Sub- Subject
population CD4 CD8 NKp46 Patient A NK -- -- <5% T 91% 9% 0%
Patient B NK -- -- 60% T 92% 8% 0% Patient C NK -- -- 20% T 87% 13%
0% Sister NK -- -- 100% T 68% 35% 0% .sup.a)Percentages of the
expression of the indicated receptors on NK cells derived from
patients A, B, C and their healthy sister.
Loss of MHC Class I Mediated Inhibition in TAP2-Deficient
Patients
[0137] Polyclonal EBV-transformed B cell lines were generated from
patients A, B and C (EBV-A, -B and -C, respectively) as well as
from the healthy mother (EBV-M). These cells were stained for MHC
class I expression using W6/32 mAb. A 30-fold reduction in the
expression of MHC class I proteins was observed on EBV-A, -B and -C
as compared to EBV-M (FIG. 10). Nevertheless, despite the
deficiency in the TAP2 subunit, some MHC class I alleles were still
expressed on cell surface (FIG. 10). The MHC haplotype of all
patients is HLA-A*03, B*07, Bw6, Cw*07, DRB1*15, DRB5 and DQB1*06.
The low expression of MHC class I proteins in the patients' cells
is allele specific, as no expression was observed when an mAb
specific for HLA-A*03 was used [20]. Next, it was tested whether
the low levels of MHC class I proteins are still sufficient for
interactions with inhibitory NK receptors. EBV-A, -B, -C and -M
cells were stained with the KIR2DL2-Ig, recognizing HLA-Cw7 [27]
that is present on the patients' cells, and with the LIR1-Ig that
recognizes a broad spectrum of HLA proteins [28]. As expected,
EBV-M cells were efficiently stained by both the KIR2DL2-Ig and
LIR1-Ig (FIG. 10). In contrast, little or no staining was observed
on EBV-A, -B or -C cells (FIG. 10).
Unusual CEACAM1 Expression on NK Cells Derived from TAP2-Deficient
Patients
[0138] Fresh NK cells derived from the three TAP2-deficient
patients as well as from the healthy sister were negative for
CEACAM1 expression [20]. The purified NK cells were next activated
with IL-2 and grown either as bulk cultures or as NK clones.
CEACAM1 expression was monitored using the 5F4 mAb [29]. As
reported [17, 19], around 90% of the NK clones obtained from the
healthy sister or the mother did not express CEACAM1 (FIG. 11).
Strikingly, all of the NK clones (100%) obtained from patient A
expressed the CEACAM1 in unusually high levels (30-fold above
background). (see for example NK clone 2 in the healthy sister in
FIG. 11, and [17, 19]). Of the NK clones obtained from patient B,
52% expressed the CEACAM1 protein in low or high levels (FIG. 11),
whereas 69% of the NK cells derived from patient C expressed
CEACAM1 in low or high levels (FIG. 11).
[0139] Activated bulk NK cultures were next assessed for the
expression of CD3, CD16, CD56 and CEACAM1. The minor
CEACAM1-positive population could not be observed when the
activated bulk NK cultures derived either from the healthy sister
or from an unrelated healthy donor (NK-Y) were analyzed (FIG. 12A).
In contrast, an up-regulation of CEACAM1 was observed on the bulk
activated NK cells derived from patient B. An up-regulation in the
CEACAM1 expression was observed on bulk activated NK cells derived
from patient C that was associated with a moderate down-regulation
in the expression of the CD16 and a reduction in the CD56
expression (FIG. 12A). The CD16 expression on the surface of NK
cells obtained from the healthy sister was lower than in the
unrelated healthy donor; nevertheless, no CEACAM1 expression was
observed (FIG. 12A).
CEACAM1-Mediated Inhibition of NK Cytotoxicity is Abrogated by
Soluble CEACAM1
[0140] CEACAM1 controls NK autoreactivity in TAP2-deficient
patients [20]. Therefore, the maintenance of the CEACAM1-inhibitory
interactions is critical in these patients. CEACAM1-Ig was used to
investigate the effect of soluble CEACAM1 on NK-mediated killing.
NK clones and bulk cultures were tested in killing assays against
the 721.221 (.221) cells and the CEACAM1-transfected .221 cells
(.221/CEACAM1) as described [30]. The bulk NK cultures obtained
from patient B (NK-B) efficiently killed the .221 cells (FIG. 12B),
but were inhibited by the .221/CEACAM1 cells (FIG. 12B). This is in
agreement with the unusually high expression of the CEACAM1 protein
on the surface of NK cells derived from the TAP2-deficient patients
(FIG. 11, 12A, and [20]). The inhibition observed with the bulk NK
cells derived from the patients was the result of the homophilic
CEACAM1 interactions, as lysis was restored in the presence of
blocking anti-CEACAM antibodies (FIG. 12B). Remarkably, the
CEACAM1-mediated inhibition was abrogated in the presence of the
soluble CEACAM1-Ig in a dose-dependent manner, reaching maximal
effect in 5 ?g/well (FIG. 12B). In addition, the presence of either
CEACAM1-Ig or CD99-Ig did not affect the killing activity of
CEACAM1- bulk NK cultures obtained from a healthy donor, thus
ruling out nonspecific increased killing due to antibody-dependent
cellular cytotoxicity (FIG. 12C). Similar results were obtained
with CEACAM1+ NK cells pooled from other healthy donors (FIG.
12D).
TAP2-Deficient Patients have Decreased Level of Serum CEACAM1
[0141] The amount of the soluble CEACAM1 protein is normally around
300 ng/ml [22], but in pathologies such as obstructive jaundice it
increases to 1,500 ng/ml [22]. Induction of liver diseases in
animal models leads to increased soluble CEACAM1 protein in the
serum [31]. Based on the blocking activity of CEACAM1-Ig (FIG. 12B,
D), it is possible that serum CEACAM1 levels might be altered in
TAP2-deficient patients. This is supported by other receptors that
are also biologically active in soluble forms such as the
Semaphorin CD100/Sema4D [32].
[0142] The levels of soluble CEACAM1 protein were tested in the
patients' sera. CEACAM1 levels detected in the sera derived from
unrelated healthy donors were similar to those previously described
[22, 23] (FIG. 13A). In contrast, a striking decrease in the
soluble CEACAM1 amount was observed in the sera derived from all
three patients (FIG. 13A). Interestingly, although the amount of
soluble CEACAM1 in the serum derived from the healthy mother was
indeed significantly higher than that of the three patients, it was
still significantly lower than normal (FIG. 13A). The TAP2
deficiency described here probably results from an autosomal
recessive inherited defect, like other TAP2 deficiencies [24, 33].
Hence, the patients are probably homozygous for the defect causing
the TAP2 deficiency and the mother is heterozygous. Therefore, the
above significant differences in serum CEACAM1 levels between
unrelated healthy donors, the healthy mother and the patients might
be linked to zygocity.
[0143] The bulk NK cultures were next tested against .221 cells and
against the .221/CEACAM1 pre-incubated either with no serum, with
patient-derived serum or with serum derived from a healthy donor.
The NK-B cells were inhibited by the .221/CEACAM1 cells either in
the presence of the autologous serum or when no serum was included
in the assay (FIG. 13B). This inhibition was abrogated in the
presence of serum derived from a healthy donor (FIG. 13B),
suggesting that the serum soluble CEACAM1 is able to block
CEACAM1-mediated inhibition in vivo. No inhibition was observed
when the CEACAM1-negative bulk NK cultures derived either from an
unrelated healthy donor or from the healthy sister were used (FIG.
13C, D). The presence of serum from the healthy donor caused a
marked increase in the killing activity of all NK cells tested
(FIG. 13B-D). Similar activation of NK killing was observed with
sera derived from other healthy donors, whereas sera derived from
patient C had no effect. Additional differences other than the
presence of CEACAM1 exist may exist.
Soluble CEACAM1 Protein is not Generated Via Membrane-Bound
Metalloproteinasemediated Cleavage
[0144] The combination of increased expression of membrane-bound
CEACAM1 protein on cells derived from the TAP2-deficient patients
[20], together with the significantly lower amounts of soluble
CEACAM1 in the sera of the patients (FIG. 13A), suggests that NK
cells in the TAP2-deficient patients have developed special
mechanisms to inhibit NK activity. The soluble CEACAM1 protein
found in the serum might be generated either from alternative
splicing of CEACAM1 or from a cleavage of the membrane-bound
CEACAM1 by membrane-bound metalloproteinase (MBMP). Whether MBMP is
involved in the cleavage of CEACAM1 was tested. MBMP activity is
augmented in response to cell stimulation, e.g. by PMA [34, 35],
and inhibited in the presence of the inhibitor BB-94 [36]. Previous
reports have demonstrated that MHC class I proteins are susceptible
to external cleavage by MBMP [37]. Incubation of the NK-M or the
NK-Y cells with the PMA resulted in decreased MHC class I
expression (FIG. 14A). This reduction in MHC class I expression was
the result of MBMP activity, because MHC class I expression level
was restored in the presence of the BB-94 inhibitor (FIG. 14A). As
shown above and previously (FIGS. 10, 14B and [20]), the MHC class
I protein expression level on NK-B cells was significantly lower
compared with the healthy donors. Surprisingly however, expression
of MHC class I on the patient cells did not decrease in response to
PMA (FIG. 14B). Similar results were obtained with bulk NK cultures
derived from patients A and C. This may suggest that the specific
MHC class I alleles expressed on TAP2-deficient cells are resistant
to extracellular cleavage by MBMP. Alternatively, the activity or
expression of the MBMP might be impaired in the TAP2- deficient
cells.
[0145] To test the latter option, the NK-B, -M and -Y cells for the
NKp46 receptor with the 461-G1 mAb were stained [9, 20]. As
reported [20], expression of NKp46 was detected on the normal NK
cells, NK-M and -Y. However, the NK-B cells displayed a much weaker
expression (FIG. 14C). Reduction in the NKp46 expression level was
observed on NK cells derived from both healthy donors and patients
following incubation with PMA (FIG. 14C). The reduction in 461-G1
staining was induced by MBMP activity as NKp46 expression was
restored in the presence of the BB-94 inhibitor (FIG. 14C). MBMP is
active and functional in the TAP2-deficient patients.
[0146] Whether the surface CEACAM1 protein is regulated by
MBMP-mediated cleavage was also tested. The NK-Y bulk culture was
obtained after pooling more than 30 CEACAM1.sup.+ NK clones
obtained from a healthy donor. Incubation of the various bulk NK
cultures with PMA did not alter the CEACAM1 expression level (FIG.
14D). This indicated that the membrane-bound CEACAM1 protein
expression level is not regulated by MBMP mediated cleavage.
Example 3
The Mechanisms Controlling NK Cell Autoreactivity in TAP2-Deficient
Patients
[0147] The killing of natural killer (NK) cells is regulated by
activating and inhibitory NK receptors that recognize mainly class
I major histocompatibility complex (MHC) proteins. In transporter
associated with antigen processing (TAP2)-deficient patients,
killing of autologous cells by NK cells is therefore expected.
However, none of the TAP2-deficient patients studied so far have
suffered from immediate NK-mediated autoimmune manifestations. The
present inventors have demonstrated the existence of a novel class
I MHC-independent inhibitory mechanism of NK cell cytotoxicity
mediated by the homophilic carcinoembryonic antigen-related cell
adhesion molecule 1 (CEACAM1) interactions. In this section the
present inventors identify 3 new siblings suffering from TAP2
deficiency. NK cells derived from these patients express unusually
high levels of the various killer cell inhibitory receptors (KIRs)
and the CEACAM1 protein. Importantly, the patients' NK cells use
the CEACAM1 protein to inhibit the killing of tumor and autologous
cells. The inventors further show that the function of the main NK
lysis receptor, NKp46, is impaired in these patients. In this
section the present inventors will show that the expression of the
NKp46 receptor is severely impaired in a newly identified
TAP2-deficient family and that the vast majority of activated NK
cells derived from these patients use the CEACAM1 protein
interactions to avoid tumor and autologous cell killing. These
results indicate that NK cells in TAP2-deficient patients have
developed unique mechanisms to reduce NK killing activity and to
compensate for the lack of class I MHC-mediated inhibition. These
mechanisms prevent the attack of self-cells by the autologous NK
cells and explain why TAP2-deficient patients do not suffer from
autoimmune manifestations in early stages of life. (Gal Markel et
al., The mechanisms controlling NK cell autoreactivity in
TAP2-deficient patients, Blood, 1 Mar. 2004, Vol. 103, No. 5, pp.
1770-1778. Pre-published online as a Blood First Edition Paper on
Nov. 6, 2003; DOI 10.1182/blood-2003-06-2114. This reference is
herein now incorporated by reference.)
Materials and Methods
Patients
[0148] Patients A, B, and C are siblings (19, 14, and 9 years old,
respectively). All patients share the same human leukocyte antigen
(HLA) haplotype (A*03, B*07, Bw6, Cw*07, DRB1*15, DRB5, DQB1*06).
They presented with severe diffuse bronchiectasis, sinusitis, and
serous otitis media with no history of severe viral infections. The
Institutional Review Board of Schneider Children's Medical Center
of Israel approved these studies, and informed consent was provided
according to the Declaration of Helsinki.
Generation of NK Clones and Phytohemagglutinin (PHA)-Induced T-Cell
Blasts
[0149] Isolation and culturing of NK clones and bulk NK cultures
were performed as described..sup.22 Isolation and culturing of
T-cell populations were performed as described. 18
Antibodies and Immunoglobulin-Fused Proteins
[0150] The following monoclonal antibodies were used: monoclonal
antibody (mAb) W6/32 and HP-1F7 directed against class I MHC
molecules; anti-.beta..sub.2-microglobulin mAb BBM-1, anti-CEACAM1
mAb 5F4,.sup.23 anti-HLA-A3 GAP A3 mAb, anti-CD16 mAb B73.1.1, and
anti-CD94 mAb HP-3D9 (Dako, Hamburg, Germany); the rabbit
polyclonal anti-CEACAM1, CEACAM5, and CEACAM6 antibodies (Dako)
that block the CEACAM1 interactions.sup.15,18; anti-killer cell
inhibitory receptor 2DL1 (anti-KIR2DL1) mAb EB6 (ImmunoTech,
Westbrook, Me.); anti-KIR2DL2 mAb GL183 (ImmunoTech);
anti-leukocyte immunoglobulin-like receptor 1 (anti-LIR1) mAb HP-F1
(a kind gift from Dr Lopez-Botet; Immunologica, Barcelona, Spain);
anti-HLA-DQ mAb G46-6 (Pharmingen, San Diego, Calif.); anti-HLA-DR
mAb TU36 (Pharmingen); and the anti-NKG2D mAb (R&D Systems,
Minneapolis, Minn.). The specificity of all anti-CEACAM antibodies
was confirmed previously..sup.18 The anti-NKp46 mAb 461-G1
(immunoglobulin G1 [IgG1]) was generated by immunizing mice with
the NKp46-Ig fusion protein. The specificity of this mAb was
determined by fluorescence-activated cell sorter (FACS) analysis on
NKp46 transfectants and on NK cells (freshly isolated and IL-2
activated) (Table 4). The generation and production of fusion
proteins KIR2DL2-Ig, CD99-Ig, NKp46-Ig, NKp30-Ig, and NKp44-Ig were
previously described..sup.3,7,8
Restoration of Class I MHC Expression by Transient B-Cell Line
Fusion
[0151] Epstein-Barr virus (EBV)-transformed B-cell lines derived
from the patients were mixed either with the 721.174 (a TAP.sup.-
cell line),.sup.24 with the 721.45 (a TAP.sup.+ cell line with
hemizygous MHC class I haplotype of HLA-A2, HLA-B5, and
HLA-Cw1),.sup.25 or with EBV-transformed B-cell lines derived from
other TAP1- or TAP2-deficient patients. Cells to be fused were
mixed together at a 1:1 ratio at a final concentration of
10.times.10.sup.6/mL and incubated for 1 hour in RPMI containing
10% fetal calf serum (FCS) and 25 .mu.g/mL PHA-P (Sigma, St Louis,
Mo.). Cells were pelleted and resuspended in phosphate-buffered
saline (PBS) containing 50% polyethylene glycol (PEG) 1500 (Sigma),
and 5% dimethyl sulfoxide (DMSO) (Sigma). After incubation at
37.degree. C. for 1 minute, cells were washed, resuspended in PBS,
and incubated for a further 30 minutes at 37.degree. C. After
overnight incubation in RPMI containing 10% FCS, total fusion
products were stained with GAP A3 monoclonal antibody. Cell
mixtures without addition of PEG were used as negative control to
rule out humoral effect.
FACS Staining, Generation of F(AB').sub.2 Fragments
[0152] FACS multistaining was performed as described..sup.15,18
Conjugated antibodies included Kat4c-fluorescein isothiocyanate
(Kat4c-FITC) (IgG1; Dako), anti-CD56-phycoerythrin (PE) (IgG1;
Dako), anti-CD3-CyChrome (IgG1; Pharmingen), anti-CD16-biotin
(IgG1; Serotec, Raleigh, N.C.), and anti-NKG2D-PE (IgG1; R&D
Systems). Controls were nonbinding isotype-matched
fluorochrome-matched mAbs. Detection of immunoglobulin-fusion
proteins was performed by means of the PE-conjugated secondary goat
antihuman IgG antibodies with minimal cross-reaction (Jackson
ImmunoResearch Laboratories, Bar Harbor, Me.), as
described..sup.15,18 All FACS data in all of the figures and tables
presented in this article were obtained with antibodies in the form
of F(ab').sub.2. Digestion and purification of the F(ab').sub.2
fragments were performed with the ImmunoPure F(ab').sub.2
preparation kit (Pierce, Rockford, Ill.) according to the
manufacturer's instructions.
Cytotoxicity Assays
[0153] The cytotoxic activity of NK cells against the various
targets was assayed in 5-hour .sup.35S-release assays, as
described..sup.26 In experiments in which antibodies were included,
the final mAb concentration was 20 .mu.g/mL. In all assays
performed, the spontaneous release did not exceed 25% of the
maximal labeling.
Identification of a New Family of TAP2-Deficient Patients
[0154] A genetic defect in the class I MHC expression was
identified in an Arab-Israeli family. Patients A, B, and C
(19-year-old female, 14- and 9-year-old males, respectively)
displayed clinical manifestations similar to those displayed by
other TAP2-deficient patients..sup.27 The other 5 sisters as well
as the parents, who are first cousins, showed no clinical symptoms.
NK clones were purified from all of the patients as well from a
healthy sister. Forty NK clones from each individual were analyzed
by FACS for presence of class I MHC, class II MHC, and
.beta..sub.2-microglobulin by use of the W6/32 mAb, the TU36 mAb,
and the BBM-1 mAb, respectively. A decrease in expression of class
I MHC proteins and of .beta..sub.2-microglobulin (approximately
20-fold) was observed on the surface of NK clones derived from the
patients as compared with those derived from the healthy sister
(Table 2). Analysis of class II MHC protein expression revealed
only 3-fold (patient A) or 2-fold (patients B and C) reduction
compared with the healthy sister (Table 2). Similar results were
obtained when different types of cells, such as T cells and
monocytes, were used.
[0155] To identify the genetic defect responsible for the impaired
expression of class I MHC proteins observed in these patients, an
EBV-transformed B-cell line was made from each patient (EBV-A,
EBV-B, and EBV-C) and from their healthy mother (EBV-mother). The
EBV-transformed B-cell lines were further analyzed for the
expression of class I MHC, class II MHC,
.beta..sub.2-microglobulin, and HLA-A3 by using the W6/32 mAb, the
TU36 and G46-6 mAbs, BBM-1 mAb, and the GAP A3 mAb, respectively.
In agreement with the results described in the preceding paragraph,
a dramatic down-regulation (approximately 20-fold) of class I MHC
proteins and of .beta..sub.2-microglobulin surface expression was
observed on EBV-A, EBV-B, and EBV-C as compared with EBV-mother
(Table 3). There was no significant difference in the expression of
class II MHC proteins, such as HLA-DQ and HLA-DR (Table 3).
Notably, the HLA-A3 protein was completely absent from the surface
of EBV-A, EBV-B, and EBV-C, but not from EBV-mother (all patients
and their mother express HLA-A3; see "methods this section"). There
is a slight expression of class I MHC detected by W6/32, indicating
that class I MHC proteins other than HLA-A3 are still expressed in
low levels on the patient EBV cells (Table 3).
[0156] Since HLA-A3 was not detected on the patients' EBV cells, an
assay that is based on the restoration of HLA-A3 expression
following correction of the class I MHC biosynthetic pathway via
PEG-mediated fusion of EBV-A, EBV-B, or EBV-C with various cell
lines was next employed. The 721.45 cells that were used in some of
the fusion experiments were hemizygous for class I MHC expression
(HLA-A2, HLA-B5, and HLA-Cw1). Therefore, specific monitoring was
required to discriminate between the class I MHC reconstitution
(monitored by GAP A3) and the endogenous expression of the class I
MHC proteins on 721.45 cells.
[0157] Cells were fused, and the total cell mixture was analyzed
with the use of the GAP A3 mAb. As not all mixed cells were fused,
the fused cells were identified by the presence of HLA-A3 protein.
Fusion of EBV-A, EBV-B, or EBV-C either with the 721.45 cell line
that expresses both TAP1 and TAP2 subunits or with cells deficient
in TAP1, resulted in the emergence of an HLA-A3.sup.+ population
(FIG. 15). In contrast, fusion of EBV-A, EBV-B, or EBV-C with
721.174 cell line (0.174), deficient for TAP1 and TAP2 or with B
cells derived from other TAP2-deficient patients, failed to restore
HLA-A3 expression (FIG. 15). The fact that mixture of EBV-A, EBV-B,
or EBV-EBV-C with the various cell lines without addition of PEG
failed to reconstitute HLA-A3 expression and in addition to the
fact that some of the fusions performed did not restore HLA-A3
expression (FIG. 15) rule out the possibility of humoral effect.
The genetic defect is in the TAP2 protein.
Impaired Expression and Function of NKp46
[0158] NKp46 is considered to be the main NK killing receptor for
NK cells and is uniquely expressed on all NK cells..sup.23
Expression of NKp46 on freshly isolated NK cells was monitored by
using an anti-NKp46 mAb (461-G1). Relatively low levels of NKp46
were observed on the bulk NK cells isolated from the healthy sister
(MFI=24) (FIG. 16A). At this stage blood samples could no longer be
obtained from patient C owing to the severity of his clinical
conditions. The NKp46 receptor could hardly be detected on the
surface of more than 85% of the NK cells isolated from patient A
(MFI=7) and on more than 60% of the NK cells isolated from patient
B (MFI=10) (FIG. 16A). The function of the NKp46 receptor was
assayed concomitantly against 721.221 cells, in which the lysis is
controlled by the NKp46 receptor..sup.5 In accordance with the
staining results (FIG. 16A), very low killing was observed with
bulk freshly isolated NK cells derived from patient A; relatively
moderate killing was observed with NK cells from patient B; and
relatively efficient killing was observed with NK cells from the
healthy sister (FIG. 16B).
[0159] IL-2-activated NK clones from the patients and from the
healthy sister were next generated. No major difference in the
NKp46 expression was observed between freshly isolated and
IL-2-activated NK cells (FIG. 16A; Table 4). Activated NK clones
were analyzed for NKp46 expression and for cytotoxicity against
.221 target cells. A reduction in the NKp46 expression was observed
in NK clones derived from all of the patients as compared with the
healthy sister. All 30 NK clones (100%) derived from patient A did
not express the NKp46 protein; 19 (39%) of 49 clones and 56 (80%)
of 70 clones derived from patient B and patient C, respectively,
were also NKp46.sup.- (Table 4). The absence of the NKp46 receptor
on these NK clones was correlated with poor cytolytic activity
against .221 cells (Table 4). NKp46.sup.- clones were not observed
in the healthy sister (Table 4). On the other hand, 29 (61%) of 49
NK clones derived from patient B, 14 (20%) of 70 from patient C,
and 30 (100%) of 30 from the healthy sister were NKp46.sup.+ (Table
4). The level of the NKp46 expression was similar in all positive
clones (Table 4). Accordingly, the NKp46.sup.+ NK clones displayed
efficient cytotoxic activity against .221 target cells (Table 4).
Efficient killing of other cells types such as EBV-A, EBV-B, EBV-C,
293T, or RPMI 8866 was also observed when assayed against the
NKp46.sup.+ clones.
Activated NK Clones Derived from the TAP2-Deficient Patients
Express Unusually High Levels of CEACAM1- and Class I
MHC-Recognizing Receptors
[0160] The killing of targets by NK cells derived from the
TAP2-deficient patients can be reduced by the diminished NKp46
expression. However, 61% and 20% of the clones in patients B and C,
respectively, still expressed NKp46 (Table 4). The present
inventors hypothesized the existence of a class I MHC-independent
inhibitory mechanism in their patients that controls NK
autoreactivity and examined whether CEACAM1 interactions were
involved in controlling the killing activity of activated NK cells
in TAP2-deficient patients.
[0161] Peripheral blood lymphocytes (PBLs) were isolated from all 3
patients and the healthy sister and analyzed by multistaining for
the expression of the CD3, CD16, CD56, and CEACAM1. All patients
had normal values of lymphocytes in their peripheral blood and a
normal lymphocyte distribution, including T, NK, and NKT cells.
Thus, the low levels of class I MHC proteins (Tables 2, 3) were
probably sufficient to select for the development of normal numbers
of lymphocytes. PBLs from all 4 donors were also tested for the
expression of the CEACAM1 protein. Little or no expression of the
CEACAM1 protein was observed among all fresh PBLs.
[0162] Activated NK clones were generated from the 3 patients and
from the healthy sister. Sixty NK clones from each individual were
assessed for CEACAM1 expression by using the 5F4 mAb. The NK clones
from each individual were sub grouped according to the CEACAM1
expression level (negative, low, or high). Low levels of CEACAM1
expression (MFI around 8) had already been observed on NK clones
and proved sufficient to confer protection..sup.15,16 The high
expression level of CEACAM1 (MFI around 30) observed on the surface
of NK clones had not been observed before. 53 (88%) of 60 NK clones
obtained from the healthy sister were negative for CEACAM1 (Table
5). In contrast, virtually all of the NK clones (98%) obtained from
patient A expressed the CEACAM1 protein in unusually high levels.
Of the 60 NK clones obtained from patient B, 43 (71%) expressed the
CEACAM1 protein in low or high levels (43% and 28%, respectively;
Table 5) whereas 44 (73%) of 60 NK cells derived from patient C
expressed CEACAM1 in low or high levels (23% and 50%, respectively;
Table 5).
[0163] In addition, all of the NK clones were stained for the
presence of CD16, KIR2DL1, KIR2DL2, CD94, or LIR1. In each
individual, the total NK clones were further sub classified in each
CEACAM1 subgroup according to the staining intensity of each
receptor (negative, dim, and bright), and the mean MFI.+-.SD was
calculated accordingly. The overall percentages of NK clones from
each individual expressing KIR2DL1, KIR2DL2, and LIR1 was compared.
KIR2DL1 was expressed on 62%, 77%, and 72% of the NK clones
obtained from patients A, B, and C, respectively, compared with
only 25% of the NK clones from the healthy sister (Table 5).
KIR2DL2 was expressed on 65%, 65%, and 85% of the NK clones
obtained from patients A, B, and C, respectively, compared with
only 35% of the NK clones from the healthy sister (Table 5).
Finally, the LIR1 was expressed on 67%, 68%, and 60% of the NK
clones obtained from patients A, B, and C, respectively, compared
with only 15% of the NK clones from the healthy sister (Table 5).
Expression of all inhibitory NK receptors tested was up-regulated
on the NK cells derived from the patients. The increase in the
percentage of NK clones derived from the patients that express
class I MHC-recognizing inhibitory receptors is statistically
significant when compared with the healthy sister: KIR2DL1
(P=0.01), KIR2DL2 (P=0.04), and LIR1 (P=0.02). Further analysis
reveals that the receptor expression level is also increased among
NK clones obtained from the patients as compared with those
obtained from the healthy sister. Bright expression of KIR2DL1 was
observed on 24 of 60, 32 of 60, and 33 of 60 NK clones obtained
from patients A, B, and C, respectively, but not on any of the 60
NK clones obtained from the healthy sister (P=0.003) (Table 5).
Similarly, bright expression of KIR2DL2 was observed on 21 of 60,
34 of 60, and 37 of 60 NK clones obtained from patients A, B, and
C, respectively, as opposed to only 16 of 60 obtained from the
healthy sister (P=0.06) (Table 5). Patients of in the present
section express the Cw7 protein, which is recognized by
KIR2DL2..sup.30 A statistically significant bright expression of
KIR2DL1 but not KIR2DL2 was observed in the patients' NK clones,
suggesting that the expression level of the various NK receptors is
somehow shaped by the appropriate MHC proteins (Table 5). Thus, the
low levels of class I MHC proteins in the patients have resulted in
an impaired repertoire of inhibitory receptors, manifested not only
in the increased percentages of positive clones but also in the
higher expression levels.
[0164] Expression of the CD94 receptor was observed on 95%, 97%,
and 92% of the NK clones obtained from patients A, B, and C,
respectively, and on 100% of the NK clones from the healthy sister
(P=0.66) (Table 5). The expression of CEACAM1 is confined mainly to
the CD16.sup.- subset of NK cells..sup.15,18 Expression of CD16 was
observed on 83%, 98%, and 87% of the NK clones obtained from
patients A, B, and C, respectively, and on 90% of the NK clones
from the healthy sister (P=0.29) (Table 5). CEACAM1 expression on
NK clones derived from the healthy sister was restricted mainly to
the CD16.sup.- cells (6 of 7 CEACAM1.sup.dim NK clones; Table 5).
In contrast, 50 of 59, 42 of 43, and 37 of 44 NK clones derived
from patients A, B, and C, respectively, expressed both CD16 and
CEACAM1 (P=0.007) (Table 5). There was observed expression of
CEACAM1 on both CD16.sup.- and CD16.sup.+ NK clones derived from
the patients (Table 5).
[0165] 3.5 CEACAM1 interactions protect autologous PHA-induced
T-cell blasts from NK cell-mediated killing
[0166] The functional significance of CEACAM1 expression was
assayed with clones capable of killing .221 cells (Table 4). As the
CEACAM1 protein binds via homophilic interactions to other CEACAM1
proteins,.sup.15,18,31,32 the various NK clones were tested for
killing against .221 cells expressing the CEACAM1
protein..sup.15,18 Inhibition of killing was observed when
CEACAM1.sup.+ NK clones were used (representative clone in FIG.
17A). This inhibition was the result of CEACAM1 interactions, as
lysis was restored when anti-CEACAM F(ab').sub.2 antibodies were
included in the assay (FIG. 17). No inhibition was observed when
CEACAM1.sup.- NK clones were used (FIG. 17B).
[0167] It was nest determined whether normal, nonvirally infected,
PHA-induced T-cell blasts will be killed by the patients' NK cells.
In agreement with reports demonstrating that activated T cells
express the CEACAM1 protein,.sup.23, 29 expression of CEACAM1 was
observed on all PHA-induced T-cell blasts derived from all patients
(FIG. 18A). The expression level of the CEACAM1 protein on the
PHA-induced T-cell blasts derived from the TAP2-deficient patients
was approximately 5-fold higher as compared with the PHA-induced
T-cell blasts obtained from the healthy sister (FIG. 18A). Low
levels of class I MHC protein expression were observed on
PHA-induced T-cell blasts derived from patients compared with the
healthy sister (FIG. 18A). Staining of the various PHA-induced
T-cell blasts for the presence of ligands for the NKp46, NKp44, and
NKp30 receptors with the use of immunoglobulin-fusion proteins was
negative (FIG. 18B). NKp46-Ig, NKp30-Ig, and NKp44-Ig did, however,
recognize tumor targets such as LnCap (FIG. 18B) or other cell
lines..sup.7,8 The cellular ligands for these receptors may be
either not expressed or may be expressed in low levels on the
surface of the PHA-induced T-cell blasts. The expression of other
lysis ligands such as MICA is present on the PHA-induced T-cell
blasts..sup.33
[0168] CEACAM1.sup.+ NK clones from each patient were assayed for
lysis against the various PHA-induced T-cell blasts. All
CEACAM1.sup.- NK clones and bulk cultures derived from the healthy
sister killed the TAP2-deficient PHA-induced T-cell blasts (see,
e.g., "NK Sister CEACAM1.sup.-" in FIG. 18C). Similar results were
obtained with bulk NK cells and clones obtained from other healthy
donor. None of the tested NK clones or bulk cultures derived from
the patients killed their autologous PHA-induced T-cell blasts
(see, e.g., NK A, NK B, and NK C in FIG. 18C). Blocking antibodies
were included in the assay to test whether the lack of self-killing
is because of CEACAM1- or class I MHC-mediated inhibition. The
PHA-induced T-cell blasts were preincubated with or without the
anti-CEACAM antibodies, the control antiubiquitin antibodies,
HP-1F7 mAb, or the control 12E7 mAb. A significant enhancement of
the killing activity of the patients' NK clones (A, B, and C) was
observed when the F(ab').sub.2 fragments of anti-CEACAM antibodies
were included in the assay, either alone or in combination with the
anti-class I MHC mAb HP-1F7 (FIG. 18C). Similar results were
obtained regardless of whether the NK clones tested expressed the
NKp46 receptor. No effect was observed when the F(ab').sub.2
fragments of the anti-class I MHC mAb HP-1F7 were included (FIG.
18C). The low expression level of class I MHC proteins was not
enough to confer protection. Killing was not restored when the
control F(ab').sub.2 fragments of either the polyclonal
antiubiquitin antibodies or the 12E7 mAb were used (FIG. 18C).
These results indicate that self-attack of the autologous
PHA-induced T-cell blasts by NK clones derived from the patients is
prevented by the homophilic CEACAM1 inhibitory interactions.
[0169] Autologous NK clones negative for CEACAM1 expression were
unable to kill the autologous PHA-induced T-cell blasts (see, e.g.,
patient C's CEACAM1.sup.- NK cells, which express NKp46; FIG. 18C).
This property is unique to NK cells derived from the patients, as
CEACAM1.sup.- NK cells from the healthy sibling efficiently
attacked self-cells following MHC class I blocking (FIG.
18C-D).
[0170] The NK clones and bulk cultures obtained from patients A, B,
and C and the healthy sister were next tested in killing assays
against PHA-induced T-cell blasts derived from the healthy sister.
The various cells were treated as described in the text discussion
of FIG. 18C. CEACAM1.sup.- NK clones derived from the healthy
sister were unable to kill the autologous PHA-induced T-cell
blasts. The inhibition was the result of class I MHC interactions,
as the F(ab').sub.2 fragments of HP-1F7 mAb included in the assay,
either alone or in combination with the F(ab').sub.2 fragments of
anti-CEACAM antibodies, abolished this inhibition (FIG. 18D). When
CEACAM1.sup.+ NK clones derived from the TAP2-deficient patients
were used, lysis of the sister's PHA-induced T-cell blasts could be
completely restored only when the F(ab').sub.2 fragments of both
the HP-1F7 and anti-CEACAM antibodies were used (FIG. 18D). Partial
restoration of killing was observed when either the CEACAM1 or the
class I MHC interactions were disrupted, indicating that both
inhibitory mechanisms prevent the killing of normal PHA-induced
T-cell blasts. Similar results were obtained when CEACAM1.sup.+ NK
clones derived from the healthy sister were used.
[0171] CEACAM1 protein is up-regulated on NK cells derived from
some melanoma patients and from decidua..sup.15,18 The vast
majority of activated NK cells derived from TAP2-deficient patients
express the CEACAM1 protein in high levels, the expression of the
CEACAM1 protein is restricted to patient-derived NK cells with the
ability to kill self-cells, and the CEACAM1 protein is capable of
inhibiting NK killing. NK cells derived from TAP2-deficient
patients have developed or acquired a unique mechanism to control
the killing of self-cells by using the CEACAM1 interactions.
TABLE-US-00002 TABLE 2 Expression of MHC proteins on NK clones
Antibody Patient A Patient B Patient C Healthy sister Secondary
F(ab').sub.2 3.2 .+-. 0.7 2.2 .+-. 0.3 2.8 .+-. 0.4 3.4 .+-. 0.8
background W6/32 F(ab').sub.2 36.7 .+-. 8.2 23 .+-. 6.5 30.7 .+-.
8.0 629 .+-. 183 BBM-1 F(ab').sub.2 7.7 .+-. 2.5 5.3 .+-. 1.7 7.1
.+-. 1.6 130 .+-. 30 MHC class II 33.1 .+-. 3.6 54.3 .+-. 9.6 54.6
.+-. 7.7 94.7 .+-. 9.1 F(ab').sub.2
[0172] Forty NK clones were isolated from each of the 3 patients
and from the healthy sister. Clones were stained by various mAbs as
indicated and analyzed by FACS. All antibodies used were in the
form of F(ab').sub.2 fragments. Background was the secondary mAb in
the form of F(ab').sub.2. Data are presented as the median
fluorescence intensity (MFI) of 40 clones.+-.standard deviation
(SD). All 160 clones were stained at the same time.
TABLE-US-00003 TABLE 3 Expression of MHC proteins on
EBV-transformed B-cell lines Cells Background W6/32 BBM-1 HLA-DQ
HLA-DR HLA-A3 EBV-A 2.5 .+-. 0.5 122.5 .+-. 4.9 12.5 .+-. 2.1 22.5
.+-. 2.1 91.5 .+-. 23.3 2.5 .+-. 0.5 EBV-B 3 .+-. 0.5 106.5 .+-.
2.1 8 .+-. 4.2 24 .+-. 2.8 99.5 .+-. 14.8 2.8 .+-. 0.6 EBV-C 2 .+-.
0.4 76 .+-. 1.4 7.35 .+-. 2.9 29.5 .+-. 4.9 114.5 .+-. 17.7 3.0
.+-. 0.5
EBV-transformed B-cell lines were made from the indicated
individuals. Cell lines were stained by various mAbs in the form of
F(ab').sub.2 as indicated and analyzed by FACS. Background was the
secondary mAb in the form of F(ab').sub.2. Data are presented as
the average MFI of 3 independent experiments.+-.SD.
TABLE-US-00004 TABLE 4 Impaired expression and function of NKp46 on
activated NK clones Patient A Patient B Patient C Healthy sister
.221 .221 .221 .221 NKp46, cells NKp46, cells NKp46, cells NKp46,
cells MFI killed, % MFI killed, % MFI killed, % MFI killed, %
NKp46.sup.- 2.2 .+-. 0.9 6.7 .+-. 2.9 1.7 .+-. 0.6 7.2 .+-. 3.7 1.8
.+-. 0.7 4.8 .+-. 2.1 N/O N/O (30/30) (30/30) (19/49) (19/49)
(56/70) (56/70) NKp46.sup.+ N/O N/O 16.5 .+-. 6.3 25 .+-. 5.9 13.5
.+-. 6 20.9 .+-. 6 16.9 .+-. 5 26.5 .+-. 5.3 (29/49) (29/49)
(14/70) (14/70) (40/40) (40/40)
[0173] Activated NK clones were prepared from each individual as
indicated. Clones were stained for NKp46 expression by means of the
461-G1 mAb in the form of F(ab').sub.2 and concomitantly tested for
cytotoxic activity against .221 cells. NKp46 expression is
presented as the mean MFI of different NK clones.+-.SD. Cytotoxic
activity is presented as the mean percentage of .221 cells killed
by NK clones. The data represent mean percentage of cells
killed.+-.SD. The number of NK clones included in the analysis out
of total NK clones tested in each group are indicated in
parentheses.
N/O indicates not observed.
Example 4
CD66A Interactions Between Human Melanoma and NK Cells: A Novel
Class I MHC-Independent Inhibitory Mechanism of Cytotoxicity
[0174] NK cells are able to kill virus-infected and tumor cells via
a panel of lysis receptors. Cells expressing class I MHC proteins
are protected from lysis primarily due to the interactions of
several families of NK receptors with both classical and
nonclassical class I MHC proteins. The present inventors show that
a class I MHC-deficient melanoma cell line (1106mel) is stained
with several Ig-fused lysis receptors, suggesting the expression of
the appropriate lysis ligands. This melanoma line was not killed by
CD16-negative NK clones. The lack of killing is shown to be the
result of homotypic CD66a interactions between the melanoma line
and the NK cells. Furthermore, 721.221 cells expressing the CD66a
protein were protected from lysis by YTS cells and by NK cells
expressing the CD66a protein. Redirected lysis experiments
demonstrated that the strength of the inhibitory effect is
correlated with the levels of CD66a expression. Finally, the
expression of CD66a protein was observed on NK cells derived from
patients with malignant melanoma. These findings suggest the
existence of a novel class I MHC-independent inhibitory mechanism
of human NK cell cytotoxicity. This may be a mechanism that is used
by some of the class I MHC-negative melanoma cells to evade attack
by CD66a-positive NK cells. (Gal Markel et al., CD66a Interactions
Between Human Melanoma and NK Cells: A Novel Class I
MHC-Independent Inhibitory Mechanism of Cytotoxicity, The Journal
of Immunology, 2002, 168: 2803-2810. This reference is herein
incorporated by reference.)
Materials and Methods
Cells and MAB
[0175] The cell lines used in this section are the class I
MHC-negative human cell line 721.221, the YTS NK tumor line, and
various MHC class I-negative and -positive human melanoma cell
lines. NK cells were isolated from PBL using the human NK cell
isolation kit and the autoMACS instrument (Miltenyi Biotec, Auburn,
Calif.). For the enrichment of CD66a-positive NK cells, isolated NK
cells were further purified by depletion of CD16-positive NK cells
using anti-CD16 mAb 3G8 and the autoMACS instrument. NK cells were
grown in culture as described. The production and specificity of
anti-NKp44 and NKp46 sera were as described. The mAbs used in this
section were mAb W632, directed against class I MHC molecules, the
mAb anti-CD66 a,b,c,e Kat4c (purchased from DAKO, Carpenteria,
Calif.), anti-CD66a mAb 5F4, and the rabbit polyclonal
anti-CD66a,c,e Abs (purchased from DAKO). The anti-CD99 mAb 12E7,
used as a control, was from the Hopital de L'Archet, Nice, France.
The anti-CD56 mAb (BD PharMingen, San Diego, Calif.) was also used
as control.
Cytotoxicity Assay and Ig Fusion Proteins
[0176] The cytotoxic activity of YTS and NK cells against the
various targets was assayed in 5-h .sup.35S release assays as
described. In experiments in which mAb were included, the final mAb
concentration was 10 .mu.g/ml, or 40 .mu.l/ml in cases where rabbit
polyclonal Abs were used. Redirected lysis experiments were
performed as described. The production of CD99-Ig, CD16-Ig,
NKp30-Ig, NKp44-Ig, and NKp46-Ig fusion proteins by COS-7 cells and
purification on a protein G column were as described.
Quadruple Staining
[0177] For quadruple staining, the following
fluorochrome-conjugated mAbs were used: FITC-conjugated anti-CD66
Kat4c mAb (DAKO), PE-conjugated anti-CD56 mAb (BD PharMingen), and
CyChrome-conjugated anti-CD3 (BD PharMingen). As the fourth color,
biotinylated anti-CD16 mAb (Serotec, Oxford, U.K.) was used,
followed by streptavidin-Cy5 (Jackson ImmunoResearch Laboratories,
West Grove, Pa.) as a second reagent. To block nonspecific binding,
cells were first incubated for 1 h on ice with 25% human serum and
then incubated with the various Abs.
Generation of YTS and 721.221 Cells Expressing CD66A
[0178] The primers used for the amplification of CD66a cDNA needed
for the transfection of 721.221 cells were as follows: 5' primer,
CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including the HindIII
restriction site), and 3' primer, GGAATTCCTTACTGCTTTTTTACTTCTGAATA
(including the EcoRI restriction site). cDNA was cloned into the
pCDNA3 vector (Invitrogen, San Diego, Calif.) and transfected into
721.221 cells as described. For transfection into YTS cells, CD66a
cDNA was amplified by PCR using the 5' primer
GGAATTCCGCCGCCACCATGGGGCACCTCTCAGCC (including the EcoRI
restriction site) and the 3' primer
GCGTCGACTTACTGCTTTTTTACTTCTGAATA (including the SalI restriction
site). For amplification of the CD66aTrunc cDNA, the same 5' primer
was used, with the 3' primer GCGTCGACATCTTGTTAGGTGGGTCATT.
Amplified fragments were cloned into the pBABE retroviral vector
and transfected into YTS cells as described.
Expression of Various Lysis Ligands, CD66A, and Class I MHC
Proteins on Human Melanoma Cells
[0179] The roles of NKp30, NKp44, NKp46, and CD16 receptors in NK
recognition of various melanoma cells deficient in class I MHC
expression (except from LB33melA1, used as a control) were studied
by production of fusion proteins in which the extracellular domains
of NKp30 NKp44, NKp46, and CD16 were fused to the Fc portion of Ig.
cDNA encoding the extracellular domains of CD99 fused to the human
IgG1 DNA was used as a control. The Ig fusion proteins were
incubated with the various melanoma cells and analyzed for binding
by indirect immunostaining as previously described (15). In
general, the highest staining of the melanoma cells was observed
with the NKp30-Ig and NKp44-Ig fusion proteins (Table 6). Little
staining of all Ig fusion proteins was observed with LB33melA1
cells, a cell line that is hardly killed by NK cells. All other
cell lines that can be killed by NK cells were stained to various
degrees with the Ig fusion proteins (Table 6).
[0180] IL-2-activated CD16-negative NK cells inefficiently kill
1106mel cells. Surprisingly, 1106mel cells probably express the
ligands for all the NK lysis receptors tested, including CD16,
NKp30, NKp44, and NKp46 (Table 6). Thus, killing of 1106mel cells
was expected to occur even when CD16-negative NK cells, which
express the NKp44 and NKp46 receptors, were used. The present
inventors hypothesized the existence of a class I-independent
mechanism of inhibition of NK cell cytotoxicity that controls the
lysis of 1106mel cells. The present inventors hypothesized that
this inhibitory mechanism should include a protein that is
expressed mainly on the surface of IL-2-activated CD16-negative NK
cell and is expected to deliver an inhibitory signal via the ITIM.
The CD66a (carcinoembryonic Ag CAM1) protein is expressed primarily
on CD16-negative NK cells, it contains ITIM sequences, and it can
bind in a homotypic/heterotypic manner to various CD66 proteins.
The inhibitory effect of the CD66a protein on human NK cell
cytotoxicity was investigated by the present inventors.
[0181] The present inventors tested whether the expression of CD66a
molecule can be detected on the surface of various melanoma cell
lines and NK cells. Remarkably, all seven class I MHC-negative
melanoma cell lines tested expressed the CD66a protein at moderate
or high levels (Table 7). No expression of MHC class I protein
(detected with the W632 mAb) was observed among these cell lines,
except from the LB33melB1 cell line that expresses the HLA-A24
protein only. In contrast, 40% of the class I MHC-positive melanoma
lines tested showed little or no staining for the CD66a protein
(Table 7).
Recognition of CD66A Expressed on 1106mel by CD66A on CD16-Negative
NK Cells Leads to Inhibition of Lysis
[0182] The CD66a isoform is expressed on CD16-negative NK cells.
Whether 1106mel cells would be protected from lysis by
CD16-negative NK cells expressing the CD66a protein was tested. For
the generation of CD16-negative NK cells expressing CD66a, NK cells
were first isolated from PBL of various healthy donors and then
depleted from CD16-positive NK cells by using the anti-CD16 mAb 3G8
(as described in Materials and Methods of this section). Of 63
CD16-negative clones tested, 28 (45%) expressed the CD66a protein.
In rare cases (2%) CD66a expression could be detected on the
surface of CD16-positive NK clones (see FIG. 23). The percentage of
CD16-negative, CD66a-positive NK cells can vary among different
donors after activation. Various NK clones were then tested in
killing assays against 1106mel cells. Efficient killing of 1106mel
cells was observed with CD16.sup.+CD66a.sup.- NK clones (FIG. 19, A
and B). The addition of anti-CD66 polyclonal Abs or the control
12E7 mAb (incubated with either effector or target cells) had
little or no effect (FIG. 19.dwnarw., A and B). Similar results
were obtained when CD16.sup.-CD66a.sup.- NK clones were used (see
FIG. 23.dwnarw.). In agreement with other observations, little
killing of 1106mel cells was observed when CD16.sup.-CD66a.sup.+ NK
cells (for example, clone 163) were used (FIG. 19.dwnarw., C and
D), whereas effective killing (32.4%) of the CD66-deficient
NK-sensitive 721.221 cell line was observed. The low rate of
1106mel killing observed was the result of the inhibition mediated
by the CD66a homotypic interactions, as lysis of 1106mel cells was
restored when either the effector or the target cells were
incubated with anti-CD66a polyclonal Abs (FIGS. 19, C and D). The
anti-CD66 polyclonal Abs specifically stained all cells that were
positive for CD66a expression (NK clones, melanomas, and various
transfectants) and did not stain cells that were negative for CD66a
expression (for example, CD66a-negative NK clone). The controls,
12E7 mAb or polyclonal Abs from rabbit immunized with purified
ubiquitin, had little or no effect (FIG. 19). Similar results were
obtained when CD16.sup.+CD66a.sup.+ NK clones were used (see FIG.
23). Reversal of the CD66a-mediated inhibition was also observed
even when the LB33melB1 cell line was used as a target. This cell
line expressed the lowest levels of CD66a proteins among all seven
class I-negative melanoma cells tested (Table 7). No inhibition of
lysis by CD66a-positive NK cells was observed when these clones
were incubated with the 1259mel melanoma line, a cell line that is
efficiently killed by CD16-negative NK cells (FIG. 19E). The
expression levels of the lysis ligands for CD16, NKp30, NKp44, and
NKp46, detected by the Ig fusion proteins were similar to those of
1106mel cells. One possible explanation is that other lysis ligands
for other lysis receptors exist on the surface of 1259mel cells,
and the combined effect of all lysis receptors overcomes the
CD66a-mediated inhibition.
The 721.221 Cells Expressing the CD66A Protein are Protected from
Lysis by CD66A-Positive NK and YTS Cells
[0183] To directly test the role of the CD66a protein in inhibition
of NK cell cytotoxicity, 721.221 target cells and YTS effector
cells (both deficient for CD66a expression; FIG. 20.) were
transfected with the CD66a cDNA. Several clones of 721.221 cells
expressing various levels of CD66a protein (.221/CD66a) were
obtained. Two representative clones, expressing either low
(.221/CD66a.sup.low) or high (.221/CD66a.sup.high) levels, are
shown in FIG. 20. YTS cells expressing either CD66a (YTS/CD66a) or
CD66a in which the cytoplasmic tail of the molecule was truncated
not to include the ITIMs (YTS/CD66aTrunc) were also generated (FIG.
20). The expression level of the CD66a protein on YTS cells was
similar to the physiological level of expression on an average
primary NK clone (median fluorescence intensity (MFI) was
>2-fold over the background; a representative clone is shown in
FIG. 20). YTS transfectants expressing higher levels of CD66a
protein could not be obtained. Transfectants were next tested in
cytotoxicity assays. Inhibition of YTS/CD66a killing was observed
when cells were incubated with .221/CD66a.sup.high in all E:T cell
ratios tested (FIG. 21). The percentages of killing of other
targets, including the parental 721.221 or the .221/CD66a.sup.low
may be considered similar. Similar results were obtained with other
YTS and 721.221 cells expressing similar levels of CD66a.
[0184] Lysis of all target cells tested against YTS cells
transfected with the pBABE vector alone (YTS/MOCK) was similar. The
CD66a inhibitory signal is probably transduced via the ITIM
sequences, as no inhibition of lysis by YTS/CD66aTrunc was
observed, even when these cells were incubated with
721.221/CD66a.sup.high cells (FIG. 21). The low level of CD66a
expression on target cells (.221/CD66a.sup.low) did not confer
protection (FIG. 21). The inhibition of lysis of
.221/CD66a.sup.high cells by YTS/CD66a was the result of the CD66a
interactions, as lysis was restored when anti-CD66 Abs were
included in the assays (incubated either with the effector cells
(FIG. 22A) or with the target cells. The controls, 12E7 mAb or
rabbit polyclonal Abs directed against ubiquitin, had no
effect.
[0185] Lysis experiments were also performed with NK clones
positive or negative for the expression of CD66a. NK clones were
prepared as described above and tested against .221/CD66a.sup.high
cells. CD66a-dependent inhibition of lysis of .221/CD66a.sup.high
cells was observed when CD66a-positive NK cells were used (a
representative clone is shown in FIG. 22B). No inhibition of lysis
of .221/CD66a.sup.high cells was observed when CD66a-negative NK
clones were used (representative clone is shown in FIG. 22C).
Levels of CD66A Expression on Both Effector and Target Cells are
Important for Effective Inhibition
[0186] One potential explanation for the moderate inhibition
observed when .221/CD66a.sup.high cells were incubated either with
YTS/CD66a or with CD66a.sup.+ NK cells is the level of CD66a
expression on both target and effector cells. Indeed, no inhibition
of lysis was observed when .221/CD66a.sup.low cells were used (FIG.
21), moderate inhibition was observed when .221/CD66a.sup.high
cells were used (FIG. 21), and strong inhibition of lysis was
observed when 1106mel cells were used (FIGS. 19, C and D). The
1106mel cell line expresses the CD66a protein at a level 10-fold
higher than that of the .221/CD66a.sup.high transfectants (Table 7
and FIG. 20). 721.221 cells expressing the CD66a protein at a
higher level than the transfectant presented in FIG. 20 could not
be obtained. Thus, the level of CD66a expression on target cells is
important for effective inhibition of both YTS and NK cells.
[0187] To correlate the level of expression of CD66a on NK cells
and the strength of inhibition, various NK clones (positive or
negative for CD16) expressing different levels of CD66a were used.
The redirected lysis of P815 cells was induced with either
anti-CD16 mAb or anti-NKp44 and -NKp46 sera depending whether the
NK clone tested expressed the CD16 protein. A direct correlation
was observed between the level of CD66 expression on the surface of
the NK clones and the percentage of inhibition of redirected lysis
(FIG. 23). The level of CD66a expression had to be at least 2-fold
above the background staining for efficient inhibition to occur
(FIG. 23).
Elevation of CD66A Expression on NK Cells Derived from Melanoma
Patients
[0188] The in vivo significance of the CD66a interactions was
studied by the staining of NK cells derived from either
metastasized lymph nodes or peripheral blood. The lymph node of
patient M-169 was infiltrated with melanoma cells, highly positive
for the CD66a expression (MFI, 247). The lymph node was surgically
removed, and lymphocytes in direct contact with the tumor cells
were obtained after digestion and density gradient separation.
Quadruple staining of the lymphocytes was performed for the
expression of the CD16, CD3, CD56, and CD66 receptors. Remarkably,
12.85% of the NK cells (CD56.sup.+CD3.sup.-) obtained from M-169
lymph node expressed the CD66a protein (FIG. 24A). A total of 10.5%
of the NK cells obtained were CD16.sup.-CD66.sup.+, and 2.35% were
CD16.sup.+CD66.sup.+. The MFI of the CD66a-positive NK population
was 8-fold above background, which is sufficient for effective
inhibition (an MFI>2-fold above background is needed; see FIG.
23). Similar results were obtained when peripheral blood NK cells
derived from patient 3 were analyzed with the same quadruple
staining; 14.8% of the NK cells were CD66a positive, and the MFI of
this NK population was 7.5-fold above background (FIG. 24B).
[0189] In contrast, little or no CD66a expression was observed
among NK cells derived from the metastasized lymph node of patient
M-172 (FIG. 24C). Strikingly, the infiltrating M-172 melanoma cells
did not express the CD66a protein. Furthermore, no CD66a expression
was observed among NK cells derived from the peripheral blood of 10
other melanoma patients with no clinical evidence of active
disease.
[0190] PBL from eight healthy donors were also obtained, and the
expression of CD66a on NK cells was analyzed using the same
quadruple staining as that described above. Very little or no CD66a
staining was observed among all NK cells tested (a representative
healthy donor OM is shown in FIG. 24.uparw.D). This is in agreement
with an other observation demonstrating the expression of the CD66a
molecule on activated NK clones only.
[0191] CD66a interactions are used by some melanoma cells as a
mechanism of defense to avoid attack by CD66a-positive NK
cells.
TABLE-US-00005 TABLE 6 Expression of various putative lysis ligands
on human melanoma cell lines Melanoma Cell Lines CD99-Ig CD16-Ig
NKp30-Ig NKp44-Ig NKp46-Ig L33melA1 0.0 0.20 2.71 3.28 0.52
L33melB1 0.0 1.14 8.76 6.41 1.45 1106mel 0.0 3.70 39.1 15.22 3.05
FO-1 0.0 2.44 12.32 13.47 2.26 1259mel 0.0 1.24 13.81 11.63 6.01
1074mel 0.0 1.16 12.42 24.35 2.44 1612mH 0.0 0.0 4.49 20.15 9.75
1612mel 0.0 0.1 2.53 15.28 2.71
Melanoma cell lines were stained with various Ig fusion proteins as
described in Materials and Methods of this section. Data are
presented as MFI after subtraction of the background PE-conjugated
anti-human Fc staining and are representative of one experiment of
three performed.
TABLE-US-00006 TABLE 7 Expression of class I MHC and CD66a proteins
on human melanoma cell lines Melanoma Cell Lines Background W632
Kat4c 1106mel 2.97 3.25 200 1074mel 3.25 3.25 137.7 1259mel 1.60
1.60 108.3 1612mel 3.13 3.79 35.5 FO-1 2.60 2.44 25.9 1612mH 3.79
3.82 25.4 L33melB1 2.89 78.4 15.5 M-77 3.59 257 120 M-112 2.19 154
91 M-21 3.55 449 84.6 M-5 3.55 1555 67.5 M-139/1 4.68 1286 49.7
M-128 1.67 226 39 M-147 2.39 518 26.9 M-145 5.1 1715 23.1 M-117
4.66 143 15.6 M-144 2.97 159 6.3 M-82 2.79 109 6.0 M-139/2 5 1000
5.0 M-133 2.48 2308 3.02 L33melA1 2.81 132 3.16 M-90 1.89 1382
2.23
Staining of class I MHC-negative and -positive melanoma cell lines
was performed with the pan anti-class I mAb W632 and the anti-CD66
mAb Kat4c. Similar staining levels of all melanoma cell lines were
observed when the anti-CD66a mAb 5F4 was used. Data (MFI) are
representative of one experiment of three performed.
Example 5
Pivotal Role of CEACAM1 Protein in the Inhibition of Activated
Decidual Lymphocyte Functions
[0192] Lymphocytes in direct contact with embryonic extravillous
trophoblasts constitute more than 40% of decidual cells and appear
to play major roles in implantation and early gestation. A unique
subset of NK cells, making up 70-80% of decidual lymphocytes,
express high levels of CD56 but lack CD16. The present inventors
have demonstrated a novel class I MHC-independent inhibitory
mechanism of NK cell cytotoxicity that is mediated by CEACAM1
homotypic interactions. This mechanism is used by some melanoma
cells to avoid attack, mainly by CD16-NK cells. The present
invention demonstrate that CEACAM1 is expressed on primary
extravillous trophoblasts and is upregulated on the vast majority
of IL-2-activated decidual lymphocytes, including NK, T, and NKT
cells. In this section it is shown that CEACAM1 interactions
inhibit the lysis, proliferation, and cytokine secretion of
activated decidual NK, T, and NKT cells, respectively. In vivo
analysis of decidual lymphocytes isolated from
cytomegalovirus-infected (CMV-infected) pregnant women revealed a
dramatic increase in the expression of CEACAM1. It is possible that
a novel ligand for this adhesion molecule is present on the surface
of CMV-infected fibroblasts. This section demonstrates a major role
for the CEACAM1 protein in controlling local decidual immune
responses. [Gal Markel et al., Pivotal role of CEACAM1 protein in
the inhibition of activated decidual lymphocyte functions, The
Journal of Clinical Investigation, 110:943-953 (2002). This
reference is herein incorporated by reference.]
[0193] During embryonic implantation, the extravillous trophoblast
(EVT) cells invade the uterine endometrium. At this site, a
direct-contact interface forms between maternal and embryonic
cells, which locally modifies the properties of the uterine mucosa.
Embryonal-maternal interface together with specialized ECM
constitutes the decidua basalis. Remarkably, more than 40% of
decidual cells are immune cells. This suggests that the maternal
immune system is involved in the modulation of maternal-embryonal
interactions. The decidual lymphocyte composition differs
significantly from that of peripheral blood lymphocytes. More than
70% of decidual lymphocytes are CD56bright CD16- (FcR.gamma.III) NK
cells, while T cells constitute only 10%. In contrast, only 10% of
the peripheral blood lymphocytes are NK cells that are
characterized by a moderate expression level of the CD56 protein
and the expression of the CD16 receptor. It is currently believed
that decidual lymphocytes are important for control of normal
trophoblastic growth, differentiation, and invasion. However, their
role in combating pathogens in the context of pregnancy is only
poorly understood.
[0194] The gentle balance between immune tolerance and immune
activation that might lead to the rejection of the embryo by the
decidual lymphocytes is maintained via several mechanisms,
involving both decidual lymphocytes and EVTs. EVT invasion might be
controlled by the modulation of the local cytokine profile, and
therefore the cytokine release of decidual lymphocytes must be
tightly regulated. The killing activity of both NK cells and CTLs,
belonging to the innate and adaptive branches of the immune system,
respectively, is regulated by the class I MHC proteins. While the
recognition of the class I MHC proteins by the T cell receptors
(TCRs) of CTLs activates T cell-mediated killing, the interactions
between NK cells and the same proteins suppress NK cell
cytotoxicity. It was reported that EVTs express an unusual
combination of two nonclassical class I MHC proteins, the HLA-E and
HLA-G, along with the classical HLA-C protein, but that they do not
express the HLA-A and HLA-B proteins. As most of the CTLs are
directed against HLA-A and -B proteins, this unique pattern of
expression of class I MHC proteins probably prevents rejection of
the semiallogeneic fetus by CTLs. The HIV virus uses a similar
mechanism of specific downregulation of HLA-A and -B proteins,
mediated by the Nef protein, to avoid attack by CTL.
[0195] NK cells compose the vast majority of decidual lymphocytes
that are in contact with EVTs. The fetus is protected from
rejection by maternal NK cells for several reasons. First, decidual
NK cell inhibition appears skewed toward HLA-C recognition,
compared with peripheral blood NK cells. Fifty to eighty percent of
decidual NK cells are inhibited by HLA-C, compared with only 5-20%
of the peripheral blood NK cells. Second, virtually all decidual NK
cells express the HLAE-binding inhibitory receptor complex
CD94/NKG2A five times more than do peripheral blood NK cells.
Furthermore, the HLA-E protein, which is expressed on cell surface
upon binding of peptides derived from the leader sequence of
various class I MHC proteins, binds, with the greatest affinity,
the leader peptides of HLA-G and HLA-C proteins, which are both
expressed on the EVT cells. Third, all decidual NK cells express
the inhibitory LIR1 (ILT2) or KIR2DL4 receptors, both of which are
able to interact with the HLA-G proteins. Fourth, decidual NK cells
have decreased killing activity against class I MHC-negative target
cells. This wide spectrum of mechanisms aimed at controlling the
cytolytic function of decidual NK cells further demonstrates the
importance of these cells in the rejection of allogeneic
transplants. It also implies that other mechanisms with the ability
to control the function of decidual lymphocytes might exist.
[0196] The CEACAM1 protein, a member of the CEACAM family, is
expressed on a broad spectrum of cells (13). It belongs to the Ig
superfamily and interacts in both a homotypic manner and a
heterotypic manner with other variants of the CEACAM family,
including the CEACAM6 and CEACAM5 proteins. The CEACAM1 homotypic
interactions between NK cells and various target cells inhibit NK
cytotoxicity. This novel class I MHC-independent mechanism appears
to be used mainly by CD16-NK cells and might play an important role
in the development of various pathologies, such as melanoma.
[0197] It is shown that CEACAM1 is expressed by EVTs as well as by
the majority of IL-2-activated decidual lymphocyte subsets. The
engagement of the CEACAM1 protein leads to the inhibition of NK
killing, T cell proliferation, and IFN-.gamma. secretion by NKT
cells. The in vivo upregulation of the CEACAM1 protein on the
majority of decidual lymphocytes might have an important role in
controlling local immune response. This is demonstrated by the
analysis of decidual lymphocyte subsets obtained from decidua of
cytomegalovirusinfected (CMV-infected) women, which revealed a
dramatic upregulation of surface CEACAM1 expression. In addition,
evidence is provided that CEACAM1 binds and functionally interacts
with an unidentified molecule present on human primary fibroblasts
infected with the laboratory AD169 CMV strain or with a clinical
CMV strain isolated from infected decidua. These combined results
suggest a major role for the CEACAM1 protein in controlling local
decidual immune responses.
Methods
Cells, Transfections, Virus Propagation, and Antiviral Agent
[0198] The cell lines used in this section were the class I
MHC-negative Epstein-Barr virus-transformed B cell line 721.221
(.221), .221 cells transfected with the CEACAM1 cDNA, and the
murine thymoma BW cell line, which lacks expression of .alpha. and
.beta. chains of the TCR. Stable transfection of .221 cells
expressing CEACAM6 and CEACAM5 was performed by electroporation
(0.23 kV, Cap uF] 250 uF). The cDNA for CEACAM6 was amplified by
RT-PCR and cloned into pcDNA3 expression vector, and the CEACAM5
cDNA was a kind gift from W. Zimmermann,
Ludwig-Maximilians-University, Muenchen, Germany) Human foreskin
fibroblasts (HFFs) were used for propagation and infection of human
CMV strain AD169 (American Type Culture Collection, Manassas, Va.,
USA), as previously described. After a 1-hour period of virus
adsorption to cells, 300 ug/ml of the CMV DNA polymerase inhibitor
phosphonoformate (PFA; Sigma-Aldrich, St. Louis, Mo., USA) was
added for inhibition of virus replication.
Primary CMV Infection, Definition of Congenital CMV Infection, and
Termination of Pregnancy
[0199] Primary CMV infection during pregnancy was diagnosed by
documentation of maternal seroconversion, with appearance of CMV
antibodies during pregnancy in women known to be CMVseronegative
before gestation. Diagnosis of CMV fetal infection was based on
viral isolation (by shell viral culture and conventional culture)
from amniotic fluid obtained at the 22nd week of gestation, along
with PCR detection of viral DNA in the amniotic fluid. Congenital
disease could be predicted by the presence of characteristic
ultrasonographic findings including cerebral calcifications and
microcephaly. Decision to terminate pregnancy was based on
documentation of fetal infection and disease. Deciduae from
first-trimester elective terminations were obtained by
scraping.
Antibodies
[0200] The mAb's used in this section were FITCconjugated Kat4c mAb
directed against CEACAM1, -5, and -6 (DAKO, Glostrup, Denmark),
phycoerythrinconjugated anti-CD56 mAb (BD Pharmingen, San Diego,
Calif., USA), CyChrome-conjugated anti-CD3 mAb (BD Pharmingen), and
biotinylated anti-CD16 mAb (Serotec, Oxford, United Kingdom),
followed by Cy5-streptavidin (Jackson ImmunoResearch Laboratories
Inc., West Grove, Pa., USA). The anti-CD4 mAb (DAKO), anti-V.beta.3
(BD Pharmingen), anti-V.beta.17 (BD Pharmingen), and the
anti-CEACAM1 5F4 mAb were also used. For blocking assays, rabbit
polyclonal anti-CEACAM1, -5, and -6 (DAKO) antibodies and the
control rabbit polyclonal antibodies against purified ubiquitin
were used. The following anti-IFN-.gamma. mAb's were purchased from
BD Pharmingen: mAb B27, used for measuring intracellular IFN-y
production; and biotinylated mAb 4S.B3 (detection) and purified mAb
HIB42 (capture), both used in the ELISA assays. The production of
mouse IL-2 from BW/CEACAM1.xi.-transfected cells was detected by
ELISA using purified anti-mouse IL-2 mAb JES6-1A12 (capture) and
biotinylated anti-mouse IL-2 mAb JES6-5H4 (detection) (both from BD
Pharmingen). ELISA assays were performed according the
manufacturer's instructions (BD Pharmingen).
Isolation of Decidual Lymphocytes
[0201] The Hadassah Medical Organization Institutional Board
approved obtaining deciduae from elective pregnancy-termination
procedures, from induced labors, and from caesarian sections, in
keeping with the principles of the Helsinki Declaration. The tissue
was trimmed into 1-mm pieces and enzymatically digested for 20
minutes, using vigorous shaking, with 1.5 mg type I DNase and 24 mg
type IV collagenase present in 15 ml of RPMI-1640 medium. This
procedure was repeated three times. After an additional 5 minutes'
incubation at room temperature without shaking, the supernatants
were collected and incubated overnight in a tissue culture dish.
Nonadherent cells were collected and loaded on Ficoll density
gradient to purify the lymphocyte population. Cells were further
analyzed by flow cytometry. NK and NKT cells were purified using
anti-CD56 mAb followed by incubation with microbeads of conjugated
goat anti-mouse IgG antibodies (Miltenyi Biotec Inc., Auburn,
Calif., USA). Separation was performed with the AutoMACS instrument
(Miltenyi Biotec Inc.). Positive (NK and NKT cells) and negative (T
cells) fractions were collected and cloned (one cell per well) in
the presence of IL-2.
Quadruple Staining
[0202] For quadruple staining, the following
fluorochrome-conjugated mAb's were used: FITCconjugated anti-CEACAM
Kat4c mAb (DAKO), phycoerythrin-conjugated anti-CD56 mAb (BD
Pharmingen), and CyChrome-conjugated anti-CD3 mAb (BD Pharmingen).
As the fourth color, biotinylated anti-CD16 mAb (Serotec) was used,
followed by Cy5-streptavidin (Jackson ImmunoResearch Laboratories
Inc.) as a second reagent. To block nonspecific binding, cells were
first incubated for 1 hour on ice with 25% human serum, and then
incubated with the various antibodies.
Cytotoxicity Assays
[0203] The cytotoxic activity of NK cells against the various
targets was assayed in 5-hour 35Srelease assays, as described
previously. Briefly, cells were labeled overnight with
35S-methionine and washed, and 5103 labeled target cells were
incubated at various effector-to-target ratios. The killing rate
was calculated as percent 35S-methionine release=(cpm
sample-cpm-spontaneous release)/(cpm total-cpm spontaneous
release).times.100. Total 35S-methionine release was measured after
incubation of the cells with 0.1 M NaOH. In all presented cytotoxic
assays, the spontaneous release was less than 25% of maximal
release. In experiments where mAb's were included, the final mAb
concentration was 10 ug/ml, or 40 ul/ml in those cases where rabbit
polyclonal antibodies were used.
Staphylococcal Enterotoxin B-Induced T Cell Proliferation
[0204] These assays were performed as previously described.
Briefly, target .221 and .221/CEACAM1 cells were irradiated (60
Gy). Thereafter, 50,000 T cells, 25,000 target cells, and various
concentrations of superantigen were mixed in a total volume of 200
ul of RPMI-10% FCS in each well of a 96-well plate. After
incubation at 37.degree. C. and 5% CO2 for 2 days, 1 uCi of
3H-thymidine was added to each well and the cells were further
incubated at 37.degree. C. overnight. The cells were then harvested
and counted on a liquid scintillation counter (1450 Micro-Beta
PLUS; Wallac, Turku, Finland). In analysis of the cpm from each
well, the background cpm from wells in which identical reagents and
target cells were placed in the absence of any T cells was
subtracted.
Generation of IG Fusion Proteins
[0205] The extracellular portion of the CEACAM1 protein was
amplified by PCR using the following primers:
5'-CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including HindIII
restriction site) and 3'-GCGGATCCCCAGGTGAGAGGC (including BamHI
restriction site). A silent mutation, adenine 885 guanidine (no
change in glycine 281), was performed by site-directed mutagenesis
to cancel the BamHI site in the amplified sequence. The generation,
production, and staining procedures of the Ig fusion proteins were
previously described. [Gal Markel et al., Pivotal role of CEACAM1
protein in the inhibition of activated decidual lymphocyte
functions, The Journal of Clinical Investigation, 110:943-953
(2002). This reference is herein incorporated by reference.]
Briefly, the PCR-generated fragments were cloned into a mammalian
expression vector containing the Fc portion of human IgG1 (a kind
gift from B. Seed, Massachusetts General Hospital, Department of
Molecular Biology, Boston, Mass., USA). Sequencing of the
constructs revealed that all cDNAs were in frame with the human Fc
genomic DNA and were identical to the reported sequences. COS-7
cells were transiently transfected with the plasmids containing
cDNAs using FuGENE6 reagent (Roche Molecular Biochemicals,
Indianapolis, Ind., USA) according to the manufacturer's
instructions, and supernatants were collected and purified on a
protein G column. SDS-PAGE analysis revealed that all Ig fusion
proteins were approximately 95% pure and of the proper molecular
mass. To assay for the CEACAM binding, various cells were incubated
with 50 ug/ml of fusion protein for 2 hours on ice. The cells were
washed and incubated with Fc fragment-specific (minimal
cross-reaction to bovine, horse, and mouse serum proteins),
phycoerythrin-conjugated affinity-purified F(ab2)2 fragment of goat
anti-human IgG (Jackson ImmunoResearch Laboratories Inc.).
Incubation was performed for 1 hour and analyzed by flow cytometry
with a FACScan (Becton Dickinson Immunocytometry Systems, San Jose,
Calif., USA).
Generation of BW Cells Expressing the Chimeric Ceacam1 Protein and
the Production of IL-2
[0206] The extracellular portion of the human CEACAM1 protein was
amplified by PCR using the following primers:
5'-CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including HindIII
restriction site) and 3'-GTAGCAGAGAGGTGAGAGGCCATTTTCTTG (including
first nine nucleotides of mouse .xi. chain transmembrane portion).
The mouse .xi. chain was amplified by PCR using the following
primers: 5'-CTCTCACCTCTCTGCTACTTGCTAGATGGA (including last nine
nucleotides of human CEACAM1 extracellular portion) and
3'-GGAATTCCTTAGCGAGGGGCCAGGGTCTG (including EcoRI restriction
site). The two amplified fragments were mixed, and PCR was
performed with the 52 HindIII primer and the 32 EcoRI primer for
the generation of the CEACAM1 construct. The CEACAM1 construct was
cloned into pcDNA3 expression vector (Invitrogen Corp., Carlsbad,
Calif., USA) and stably transfected into BW cells. For measurement
of IL-2 production resulting from the homotypic CEACAM1
interactions, 50,000 BW or BW-transfected cells were incubated in
RPMI-10% FCS medium for 48 hours at 37.degree. C. and 5% CO2.
Supernatants were collected and the presence of IL-2 was monitored
by using anti-IL-2 mAb and standard ELISA assays (BD Pharmingen).
For measurement of IL-2 production resulting from the CEACAM1
interactions of different cell types, 50,000 BW or BW-transfected
cells were incubated in RPMI-10% FCS with irradiated .221 or with
.221/CEACAM1 cells for 24 hours or with CMVinfected HFF cells for
48 hours at 37.degree. C. and 5% CO2. The presence of mouse IL-2 in
cell supernatants was measured as above.
Cross-Linking of NKT Cells
[0207] NKT cells (105 per well) were incubated with or without 0.5
g of Kat4c mAb on ice for 1.5 hours in 96 round bottom microplates
(Nalge Nunc, Rochester, N.Y., USA). Treated NKT cells, present in
200 ul of IL-2-containing medium, were then cultured in 96 flat
bottom microplates (Nalge Nunc) precoated with 1 ug/well of sheep
antimouse IgG antibodies (ICN Biomedicals Inc., Costa Mesa, Calif.,
USA) for 24 hours at 37.degree. C. Cells were then analyzed by
FACS.
Permeabilization and Intracellular IFN-.gamma. Staining
[0208] The permeabilization and intracellular IFN-.COPYRGT.
staining were performed using the Cytofix/Cytoperm Plus (with
GolgiStop) kit (BD Pharmingen) according to the manufacturer's
instruction.
Results
CEACAM1 is Expressed on Different Decidual Lymphocytes after
Activation
[0209] To test the possible role of CEACAM1 in controlling decidual
lymphocyte functions, decidual lymphocytes from first-trimester
elective pregnancy terminations were isolated as described in
Methods. Obtained tissues were identified as decidua by histologic
analysis. Lymphocytes were isolated from nine different deciduae
and quadruple-stained using flow cytometry for the expression of
CD3, CD16, CD56, and CEACAM. In agreement with previous
observations, the total decidual lymphocyte population contained
mainly CD16- NK cells (70-80%, characterized by CD3- CD56bright),
but T (characterized by CD3+CD56-) and NKT (characterized by
CD3+CD56+) cells were also identified (5.3% and 3.2%,
respectively). Little or no staining for the CEACAM1 protein was
observed among all decidual lymphocyte populations tested (FIG. 25,
a-c).
[0210] Various lymphocytes were cloned and cultured for 3 weeks in
the presence of IL-2 (50 U/ml). Remarkably, staining with the 5F4
anti-CEACAM1 mAb (see FIG. 26) revealed a dramatic increase in the
CEACAM1 protein expression on the surface of the vast majority of
NK, T, and NKT cell clones tested (85%, 86%, and 95%, respectively;
surface expression of CEACAM1 on representative clones is shown in
FIG. 25, d-f). This is in marked contrast to NK cells derived from
peripheral blood, in which surface CEACAM1 expression could be
detected on only 2-3% of IL-2-activated CD16+NK clones and on about
45% of the IL-2-activated CD16- clones. Notably, the expression
levels of the CEACAM1 on the surface of all tested clones were more
than threefold above background. This level of expression was
reported to be sufficient for effective inhibition of NK
cytotoxicity.
[0211] As the CEACAM1 protein interacts homotypically with other
CEACAM1 proteins (see FIGS. 30 and 31) and decidual lymphocytes are
in direct contact with embryonic EVT cells in vivo, it was
important to test whether EVT cells express the CEACAM1 protein.
EVT cells were obtained from the same elective pregnancy
terminations from which decidual lymphocytes were isolated and were
tested for the expression of HLA-G and CEACAM1. As the expression
of HLA-G is restricted to EVT cells only, isolated cells were
identified as EVT cells by using specific staining with the
anti-HLA-G specific mAb MEM-G/13B. The mAb MEMG/13B specifically
stains the class I MHC-negative .221 cells transfected with HLA-G;
it did not stain .221 cells transfected with other class I MHC
cDNA. FACS staining analysis of isolated EVT cells showed that
these cells express the HLA-G (FIG. 25g) and the CEACAM1 (FIG. 25h)
proteins. These findings suggest that CEACAM1 might mediate direct
interactions between activated decidual lymphocytes and EVTs and
thus might display a novel control mechanism protecting the embryo
from sustaining damage.
CEACAM1 Interactions Inhibit Decidual NK Cytotoxicity
[0212] It has been demonstrated that the CEACAM1-mediated
inhibition of NK cells can be blocked by using rabbit polyclonal
anti-CEACAM antibodies and not by the mAb 5F4 or the mAb Kat4c
[Markel, G., et al. 2002. CD66a interactions between human melanoma
and NK cells: a novel class I MHC-independent inhibitory mechanism
of cytotoxicity. J. Immunol. 168:2803-2810.158:11-25. This
reference is incorporated by reference.]. It is shown that the
CEACAM1 protein interacts with other CEACAM proteins, such as
CEACAM5 and CEACAM6, and that the binding site of CEACAM1 was
located at the N-terminal Ig-V-type domain of the CEACAM1 protein
(23). The N-terminal Ig-V-type domain of the CEACAM family reveals
70-90% sequence similarity among the different variants. It was
therefore important to determine the specificity of all
anti-CEACAM1 antibodies used in this work. .221 cells were
transfected with CEACAM1, CEACAM6, and CEACAM5 and stained for
surface expression using the various anti-CEACAM antibodies.
[0213] FIG. 26 shows that all anti-CEACAM antibodies specifically
recognized members of the CEACAM family. This is because no
staining was observed on either nontransfected .221 cells or the
control HLAB27-transfected .221 cells. The 5F4 mAb recognized the
CEACAM1 protein only, whereas the Kat4c mAb and the rabbit
polyclonal antibodies directed against CEACAM recognized CEACAM1,
CEACAM6, and CEACAM5 proteins (FIG. 26).
[0214] To investigate whether the CEACAM1 protein is functional,
IL-2-activated decidual NK clones, expressing the CEACAM1 protein
(a representative clone is shown in FIG. 27a), were tested in
killing assays against .221 cells and .221 cells transfected with
CEACAM1 (.221/CEACAM1). The generation of these transfectants was
described previously (15). The CEACAM1+NK clones effectively killed
.221 cells, whereas inhibition of lysis was observed when
.221/CEACAM1 cells were used (FIG. 27b). The inhibition of NK
killing by .221/CEACAM1 cells was the result of the CEACAM1
homotypic interactions, as lysis of .221/CEACAM1 cells was restored
when rabbit anti-human CEACAM antibodies were included in the
assay. The addition of a control rabbit serum derived from
ubiquitin-immunized rabbit had no effect. No difference in the
lysis of .221 or .221/CEACAM1 cells was observed when CEACAM1- NK
clones were used. Most decidual NK clones displayed only limited
cytotoxicity against the .221 target cells (10-20% lysis). The
killing of .221/CEACAM1 cells by "low killer" decidual NK clones
was also decreased because of the homotypic CEACAM1 interactions,
and the addition of anti-CEACAM polyclonal antibodies restored
lysis.
CEACAM1 Interactions Inhibit Staphylococcal Enterotoxin B-Induced
Decidual T Cell Proliferation
[0215] As the expression of CEACAM1 protein was also demonstrated
on the vast majority of T lymphocytes activated by IL-2, the effect
of CEACAM1 interactions on T cell proliferation was also tested.
Superantigens can induce T cell proliferation by binding to class
II MHC proteins and specific TCR VP chains. The staphylococcal
enterotoxin B (SEB) superantigen interacts with various TCR VP
chains, including V.beta.3 and V.beta.17. Decidual T cell clones
were obtained as described in Methods and screened by flow
cytometry for the expression of CD4, V.beta.3, and V.beta.17 by
using specific mAb's. A representative T cell clone, no. 1, stained
brightly for both CD4 and V.beta.17 (FIG. 28, a and b), and
moderately for CEACAM1 (FIG. 28c). The SEB-induced proliferation of
this T cell clone was assayed as described in Methods. A dramatic
increase in the T cell proliferation was observed when cells were
incubated with .221 cells in the presence of 250 ng/ml of SEB
(50-fold above the background proliferation without SEB; data not
shown). Efficient inhibition of the T cell proliferation (around
50%) was observed in all SEB concentrations tested when cloned T
cells were incubated with .221/CEACAM1 cells (FIG. 28d). The
expression levels of the class II MHC proteins were similar on both
.221 and .221/CEACAM1 cells.
CEACAM1 Interactions Inhibit Secretion of Cytokines From Decidual
NKT Cells
[0216] Cytokines might play an important role in fetus development.
NKT cells that are present among the decidual lymphocyte population
(see FIG. 25) are able to produce large amount of cytokines. The
functional effect of CEACAM1 interactions on cytokine secretion of
decidual NKT cells has never been investigated. Decidual NKT clones
were cultured as described in Methods and screened for CEACAM1
expression by flow cytometry, using the anti-CEACAM1 5F4 mAb (a
representative NKT cell clone, no. 3, is shown in FIG. 29a). NKT
clone 3 spontaneously secreted IFN-.gamma. into the media, as
measured by ELISA (FIG. 29b). Other cytokines such as IL-4, IL-5,
IL-13, TNF, and macrophage inflammatory protein-1.alpha. could not
be detected in culture supernatant of this clone. Cross-linking of
CEACAM1 for 24 hours with the Kat4c mAb dramatically decreased the
amount of IFN-.gamma. detected in the medium of this NKT cell clone
(FIG. 29b). In order to determine whether the inhibitory effect
observed after cross-linking of CEACAM1 on NKT cells is the result
of decreased secretion or decreased production of IFN-.gamma., the
presence of intracellular IFN-.gamma., before and after
cross-linking of CEACAM1, was tested by staining as described in
Methods. Untreated NKT cells showed little staining for
intracellular IFN-.gamma. (median fluorescence intensity twofold
above background; FIG. 29c). After cross-linking with the Kat4c
mAb, the staining for intracellular IFN-.gamma. increased
significantly (median fluorescence intensity 4.5-fold above
background; FIG. 29d). These findings suggest that CEACAM1
engagement on NKT cells suppresses the cytokine secretion machinery
and not de novo synthesis.
In Vivo Upregulation of CEACAM1 on Decidual Lymphocytes
[0217] The above observations suggest a major role for the CEACAM1
protein in the regulation of decidual lymphocyte functions after
IL-2 activation. In vivo activation of decidual lymphocytes might
occur as a result of viral infection. CMV is the leading cause of
congenital viral infections in Western countries. It was therefore
tested whether CEACAM1 expression could be detected on the surface
of lymphocytes obtained from deciduae of women who had primary CMV
infection during gestation with documented intrauterine
manifestations. Second and third-trimester pregnancy terminations
of women diagnosed with primary CMV infection necessitate the
administration of labor-promoting agents that might have some
immunological effects. To control the experiment, the expression of
CEACAM1 protein on the surface of lymphocytes obtained either from
third-trimester caesarian sections with labor (Table 1; this
section) or from the deciduae taken from caesarian sections without
labor (Table 1; this section) were analyzed. Decidual lymphocytes
were obtained and stained for the presence of CEACAM1 on NK, NKT,
and T cells as above. Only very limited numbers of NKT cells were
isolated, and therefore the expression of CEACAM1 on NKT cells
could not be determined. Remarkably, a significant elevation of
CEACAM1 expression was observed in NK and T cells obtained from
deciduae of CMV-infected women, whereas little or no expression of
CEACAM1 was observed in the two control groups (Table 1; this
section). CEACAM1 expression can vary significantly between
different CMV-infected deciduae. In one patient, 90% and 95% of the
NK and T cells, respectively, expressed the CEACAM1 protein,
whereas in the second patient the expression of the CEACAM1 protein
was limited to 10% and 10.2% of NK and T cells, respectively.
However, the expression of the CEACAM1 protein, even in the second
patient, was still very significant compared with that of the
control groups, and it was similar to the expression level of other
class I MHC inhibitory receptors, which vary between 5% and 20%.
There are several possible reasons for the differences in the level
of CEACAM1 expression, such as subjective local immune response,
course of CMV infection, and the time of pregnancy termination
after the initiation of infection. The mild expression of the
CEACAM1 protein on trophoblasts obtained from normal decidua (FIG.
25h) was still maintained on trophoblasts obtained from infected
decidua.
CMV-Infected Fibroblasts Express a Novel Ligand for CEACAM1
[0218] The results presented above demonstrate that CEACAM1
expression is upregulated in vivo in lymphocytes obtained from
CMV-infected deciduae. Expression of CEACAM1 was observed on EVT
cells obtained from either normal or CMV-infected deciduae (FIG.
25). CEACAM1 homotypic interactions might occur in vivo, leading to
lymphocyte inhibition.
[0219] Only two cases of CMV-infected deciduae are presented here,
as studies in vivo are limited for several reasons. In addition to
the fact that primary CMV infection during pregnancy is quite rare,
the detection and diagnosis are quite difficult. Furthermore,
deciduae from CMV-infected women were used only if they
spontaneously detached, to avoid unnecessary additional procedures.
However, in both presented cases, CEACAM1 upregulation was
observed. To further establish the effect of CMV infection with
regard to CEACAM1 inhibition and to test whether the CMV uses the
CEACAM1 inhibitory mechanism to avoid attack by the immune system,
CMV-infected HFFs were used. HFF cells were infected with CMV
strain AD169 with moi 2-3. No staining of either infected or
uninfected HFF cells with anti-CEACAM1, -5, and -6 Kat4c mAb was
observed at any time point before or after the infection. Infected
cells were harvested at different time points at 24-hour intervals
after the infection and stained for the presence of CEACAM1 ligand
using CEACAM1-Ig fusion protein, as described in Methods of this
section.
[0220] The CEACAM1-Ig fusion protein specifically stained the
.221/CEACAM1 cells and did not stain the .221 cells (FIG. 30a),
indicating that CEACAM1 homotypic interactions are strong enough to
be detected by this method. No staining of CEACAM1-Ig was observed
in the first 4 days after the infection (FIG. 30b). CEACAM1-Ig
staining was observed starting on day 5 and reaching maximum on day
6 after the infection. All infected cells were positively stained
with anti-pp65 mAb. The CEACAM1-Ig binding observed was only to the
HFF-infected cells, not to the uninfected cells. No changes in the
level of the control CD99-Ig fusion protein staining were observed
at any time point (FIG. 30b). As CEACAM1 can interact only with the
CEACAM1, -5, and -6 variants, and as it was also reported that
CEACAM variants cannot be detected on the surface of human
fibroblasts, suggesting the existence of a novel ligand for CEACAM1
on the surface of CMV-infected HFF cells. This novel ligand appears
late after the infection. To further test this hypothesis, similar
experiments in the presence of the antiviral agent PFA, which is
known to block viral DNA synthesis and earlylate-phase transition
were performed. Progeny virus titers in culture supernatants were
determined on day 4 after infection by a standard plaque titration
assay on HFFs. In the absence of PFA, virus titer was 3.times.106
plaque-forming units/ml, whereas in the presence of PFA no virus
could be detected. In agreement with the above observations
demonstrating the appearance of CEACAM1 ligand on the surface of
CMV-infected HFFs, the addition of PFA completely abolished the
binding of CEACAM1-Ig to the infected HFF cells (FIG. 30b).
[0221] Whether the CEACAM1 interactions with the CMV-infected HFFs
are functional was tested. Mouse BW cells were stably transfected
with a chimeric molecule composed of the extracellular portion of
CEACAM1 fused to mouse chain (as described in Methods). Engagement
of CEACAM1 leads to the secretion of mouse IL-2, mediated by the
chain. The IL-2 amounts in the cell supernatants can be measured by
ELISA. Secretion of IL-2 could be detected in the culture
supernatants of the BW cells transfected with CEACAM1, but not in
the culture supernatants of the BW cells or BW cells transfected
with CD16 (FIG. 31a). Moreover, IL-2 secretion was also detected in
the supernatants of BW/CEACAM1 cells when cells were incubated with
.221/CEACAM1 cells, but not with they were incubated with .221
cells (FIG. 31b). Thus, homotypic CEACAM1 interactions are strong
enough to induce IL-2 secretion in this system. In agreement with
the CEACAM1-Ig staining data, efficient secretion of IL-2 was
observed (on days 5 and 6 after the infection) in the supernatants
of BW/CEACAM1 cells cultured with infected HFFs. This IL-2
secretion was blocked by the addition of PFA (FIG. 31c). No IL-2
secretion was observed in the culture supernatants of BW/CD16 cells
incubated with uninfected or infected HFF cells.
[0222] To further substantiate the above results, the clinical CMV
strain isolated from the infected decidua was cultured (patient 6;
Table 1 of this section) with infected HFF cells. The propagation
of the virus was much slower than that of the laboratory AD169
strain. Consistent microscopic monitoring of infected HFF cells
revealed that even after prolonged propagation time, only partial
infection could be achieved. One month after initiation of
infection, infected HFF cells were analyzed for recognition by
CEACAM1. HFF cells were stained with Ig-fused proteins, including
CEACAM1-Ig and the control CD99-Ig. No staining of uninfected HFF
cells was observed. Specific staining of the infected HFF cells
could be observed with the CEACAM1-Ig but not with the CD99-Ig (20%
and 2% staining, respectively; FIG. 32a). No staining was observed
when anti-CEACAM antibodies were used, suggesting that CEACAM1-Ig
recognizes a novel CMV-induced ligand on infected HFFs. Whether
this recognition is capable of eliciting IL-2 secretion from
BW/CEACAM1 cells was tested. IL-2 levels were measured in the
supernatants of BW or BW/CEACAM1 cells cocultured with HFF cells
infected with the clinical CMV strain isolated from patient 6. In
agreement with the CEACAM1-Ig staining, increased IL-2 secretion
could be detected only in the supernatants of the BW/CEACAM1 cells
coincubated with infected HFF cells (FIG. 32b). The moderate
elevation of IL-2 secretion and the partial staining of CEACAM1-Ig
(FIG. 32, a and b) are correlated with the low infection levels of
this clinical CMV strain observed in vitro, and with the moderate
percentages of CEACAM1+ lymphocytes isolated from infected decidua
no. 2 (patient 6; Table 1 of this section). Similar results were
obtained with another clinical CMV strain, isolated from a
neonate's urine.
TABLE-US-00007 TABLE 1 CEACAM1 expression is upregulated on
decidual lymphocytes from women with primary CMV infection Patient
no. Decidua source NK cells T cells NKT cells 1 With labor 0.5%
1.9% Not detected 2 With labor 1% .sup. 0% Not detected 3 Without
labor 1.7% 2.5% Not detected 4 Without labor 0% 0.4% Not detected 5
With CMV 95% 90% Not detected 6 With CMV 10% 10.2% Not detected
Cells were isolated from deciduae from different groups and
quadruplestained for CD3, CD16, CD56, and CEACAM1 as described in
Methods. The percentage of CEACAM1+ cells of each indicated
lymphocyte subset is shown.
Sequence CWU 1
1
47139DNAArtificial5' PCR primer employed to amplify the
extracellular portion of the CEACAM1 protein, and incorporating a
HindIII restriction site. 1cccaagcttg gggccgccac catggggcac
ctctcagcc 39221DNAArtificial3' PCR primer employed to amplify the
extracellular portion of the CEACAM1 protein, and incorporating a
BamHI restriction site 2gcggatcccc aggtgagagg c
21336DNAArtificial5' PCR primer employed to amplify the
extracellular portion of the CEACAM6 without the GPI-ancoring
sequence, and incorporating a HindIII restriction site. 3cccaagcttg
ccgccaccat gggacccccc tcagcc 36430DNAArtificial3' PCR primer
employed to amplify the extracellular portion of the CEACAM6
without the GPI-anchoring sequence, and incorporating the first
nine nucleotides of the CEACAM1 transmembrane portion 4aatggcccct
ccagagactg tgatcatcgt 30528DNAArtificial5' PCR primer employed to
amplify the transmembrane and tail of CEACAM1, including the last
nine nucleotides of the CEACAM6 extracellular portion before the
GPI anchor motif. 5gtctctggag gggccattgc tggcattg
28632DNAArtificial3' PCR primer employed to amplify the
transmembrane and tail of CEACAM1, and incorporating the EcoRI
restriction site. 6ggaattcctt actgcttttt tacttctgaa ta
32739DNAArtificial5' PCR primer employed to amplify the
extracellular portion of the human CEACAM1 protein, and
incorporating a HindIII restriction site 7cccaagcttg gggccgccac
catggggcac ctctcagcc 39830DNAArtificial3' PCR primer used to
amplify the extracellular portion of the human CEACAM1 protein,
including the the first nine nucleotides of the mouse chain
transmembrane portion 8gtagcagaga ggtgagaggc cattttcttg
30930DNAArtificial5' PCR primer used to amplify the mouse chain,
including the last nine nucleotides of the human CEACAM1
extracellular portion. 9ctctcacctc tctgctactt gctagatgga
301029DNAArtificial3' PCR primer used to amplify the mouse chain,
including an EcoRI restriction site. 10ggaattcctt agcgaggggc
cagggtctg 291139DNAArtificial5' edge primer for the generation of
CEACAM1- RQ43,44SL mutant. 11cccaagcttg gggccgccac catggggcac
ctctcagcc 391232DNAArtificial3' edge primer for the generation of
CEACAM1- RQ43,44SL mutant. 12ggaattcctt actgcttttt tacttctgaa ta
321321DNAArtificial5' internal primer for the generation of
CEACAM1-RQ43,44SL mutant. 13gccaacagtc taattgtagg a
211421DNAArtificial3' internal primer for the generation of
CEACAM1-RQ43,44SL mutant. 14tcctacaatt agactgttgc c
211521DNAArtificial5' internal primer for the generation of
CEACAM1-R43A mutant. 15gatggcaacg ctcaaattgt a
211621DNAArtificial3' internal primer for the generation of
CEACAM1-R43A mutant. 16tacaatttga gcgttgccat c
211721DNAArtificial5' internal primer for the generation of
CEACAM1-Q44L mutant. 17atggcaaccg tctaattgta g
211821DNAArtificial3' internal primer for the generation of
CEACAM1-Q44L mutant. 18ctacaattag acggttgcca t
211936DNAArtificial5' edge primer for the generation of CEACAM6-
SL43,44RQ mutant. 19cccaagcttg ccgccaccat gggacccccc tcagcc
362028DNAArtificial3' edge primer for the generation of CEACAM6-
SL43,44RQ mutant. 20ggaattccct atatcagagc caccctgg
282121DNAArtificial5' internal primer for the generation of
CEACAM6-SL43,44RQ mutant. 21ggcaaccgtc aaattgtagg a
212221DNAArtificial3' internal primer for the generation of
CEACAM6-SL43,44RQ mutant. 22tcctacaatt tgacggttgc c
212321DNAArtificial5' internal primer for the generation of For
CEACAM6-S43R mutant. 23gatggcaacc gtctaattgt a
212421DNAArtificial3' internal primer for the generation of For
CEACAM6-S43R mutant. 24tacaattaga cggttgccat c
212521DNAArtificial5' internal primer for the generation CEACAM6-
L44Q mutant. 25gatggcaaca gtcaaattgt a 212621DNAArtificial3'
internal primer for the generation CEACAM6- L44Q mutant.
26tacaatttga ctgttgccat c 212739DNAArtificial5' PCR primer for the
amplification of CD66a cDNA needed for the transfection of 721.221
cells, incorporating a HindIII restriction site. 27cccaagcttg
gggccgccac catggggcac ctctcagcc 392832DNAArtificial3' PCR primer
for the amplification of CD66a cDNA needed for the transfection of
721.221 cells, incorporating an EcoRI restriction site.
28ggaattcctt actgcttttt tacttctgaa ta 322935DNAArtificial5' PCR
primer for the amplification of used for the amplification CD66a
cDNA needed for the transfection YTS cells, incorporating an EcoRI
restriction site. 29ggaattccgc cgccaccatg gggcacctct cagcc
353032DNAArtificial3' PCR primer for the amplification of CD66a
cDNA needed for the transfection of YTS cells, incorporating an
SalI restriction site. 30gcgtcgactt actgcttttt tacttctgaa ta
323128DNAArtificial3' PCR primer for the amplification CD66a
truncated cDNA. 31gcgtcgacat cttgttaggt gggtcatt
283239DNAArtificial5' PCR primer for the amplification of the
extracellular portion of CEACAM1, and incorporating a HindIII
restriction site. 32cccaagcttg gggccgccac catggggcac ctctcagcc
393321DNAArtificial3' PCR primer for the amplification of CEACAM1,
and incorporating a BamHI site. 33cggagagtgg acccctaggc g
213439DNAArtificial5' PCR primer for the amplification of the
extracellular portion of CEACAM1, and incorporating a HindIII
restriction site. 34cccaagcttg gggccgccac catggggcac ctctcagcc
393530DNAArtificial3' PCR primer for the amplification of human
CEACAM1 protein, including the first nine nucleotides of the mouse
chain transmembrane portion. 35gttcttttac cggagagtgg agagacgatg
303630DNAArtificial5' PCR primer for the amplification of the mouse
chain, including the last nine nucleotides of the human CEACAM1
extracellular portion. 36ctctcacctc tctgctactt gctagatgga
303729DNAArtificial3' PCR primer for the amplification mouse chain,
incorporating an EcoRI restriction site. 37gtctgggacc ggggagcgat
tccttaagg 2938108PRTHomo SapiensMISC_FEATURECEACAM1 N-terminal
domain. 38Gln Leu Thr Thr Glu Ser Met Pro Phe Asn Val Ala Glu Gly
Lys Glu 1 5 10 15 Val Leu Leu Leu Val His Asn Leu Pro Gln Gln Leu
Phe Gly Tyr Ser 20 25 30 Trp Tyr Lys Gly Glu Arg Val Asp Gly Asn
Arg Gln Ile Val Gly Tyr 35 40 45 Ala Ile Gly Thr Gln Gln Ala Thr
Pro Gly Pro Ala Asn Ser Gly Arg 50 55 60 Glu Thr Ile Tyr Pro Asn
Ala Ser Leu Leu Ile Gln Asn Val Thr Gln 65 70 75 80 Asn Asp Thr Gly
Phe Tyr Thr Leu Gln Val Ile Lys Ser Asp Leu Val 85 90 95 Asn Glu
Glu Ala Thr Gly Gln Phe His Val Tyr Pro 100 105 39108PRTHomo
SapiensMISC_FEATURECEACAM3 N-terminal domain. 39Lys Leu Thr Ile Glu
Ser Met Pro Leu Ser Val Ala Glu Gly Lys Glu 1 5 10 15 Val Leu Leu
Leu Val His Asn Leu Pro Gln His Leu Phe Gly Tyr Ser 20 25 30 Trp
Tyr Lys Gly Glu Arg Val Asp Gly Asn Ser Leu Ile Val Gly Tyr 35 40
45 Val Ile Gly Thr Gln Gln Ala Thr Pro Gly Ala Ala Tyr Ser Gly Arg
50 55 60 Glu Thr Ile Tyr Thr Asn Ala Ser Leu Leu Ile Gln Asn Val
Thr Gln 65 70 75 80 Asn Asp Ile Gly Phe Tyr Thr Leu Gln Val Ile Lys
Ser Asp Leu Val 85 90 95 Asn Glu Glu Ala Thr Gly Gln Phe His Val
Tyr Gln 100 105 40108PRTHomo SapiensMISC_FEATURECEACAM5 N-terminal
domain. 40Lys Leu Thr Ile Glu Ser Thr Pro Phe Asn Val Ala Glu Gly
Lys Glu 1 5 10 15 Val Leu Leu Leu Val His Asn Leu Pro Gln His Leu
Phe Gly Tyr Ser 20 25 30 Trp Tyr Lys Gly Glu Arg Val Asp Gly Asn
Arg Gln Ile Ile Gly Tyr 35 40 45 Val Ile Gly Thr Gln Gln Ala Thr
Pro Gly Pro Ala Tyr Ser Gly Arg 50 55 60 Glu Ile Ile Tyr Pro Asn
Ala Ser Leu Leu Ile Gln Asn Ile Ile Gln 65 70 75 80 Asn Asp Thr Gly
Phe Tyr Thr Leu His Val Ile Lys Ser Asp Leu Val 85 90 95 Asn Glu
Glu Ala Thr Gly Gln Phe Arg Val Tyr Pro 100 105 41108PRTHomo
SapiensMISC_FEATURECEACAM6 N-terminal domain. 41Lys Leu Thr Ile Glu
Ser Thr Pro Phe Asn Val Ala Glu Gly Lys Glu 1 5 10 15 Val Leu Leu
Leu Ala His Asn Leu Pro Gln Asn Arg Ile Gly Tyr Ser 20 25 30 Trp
Tyr Lys Gly Glu Arg Val Asp Gly Asn Ser Leu Ile Val Gly Tyr 35 40
45 Val Ile Gly Thr Gln Gln Ala Thr Pro Gly Pro Ala Tyr Ser Gly Arg
50 55 60 Glu Thr Ile Tyr Pro Asn Ala Ser Leu Leu Ile Gln Asn Val
Thr Gln 65 70 75 80 Asn Asp Thr Gly Phe Tyr Thr Leu Gln Val Ile Lys
Ser Asp Leu Val 85 90 95 Asn Glu Glu Ala Thr Gly Gln Phe His Val
Tyr Pro 100 105 426PRTHomo SapiensMISC_FEATUREAmino acid sequence
starting from position 30 of the N-terminal domain of CEACAM1,
CEACAM3, CEACAM5, and CEACAM6. 42Gly Tyr Ser Trp Tyr Lys 1 5
435PRTHomo SapiensMISC_FEATUREAmino acid sequence starting from
position 42 of the N-terminal domain of CEACAM1 43Asn Arg Gln Ile
Val 1 5 445PRTHomo SapiensMISC_FEATUREAmino acid sequence starting
from position 42 of the N-terminal domain of CEACAM3 and CEACAM6.
44Asn Ser Leu Ile Val 1 5 455PRTHomo SapiensMISC_FEATUREAmino acid
sequence starting from position 42 of the N-terminal domain of
CEACAM5. 45Asn Arg Gln Ile Ile 1 5 465PRTHomo
SapiensMISC_FEATUREAmino acid sequence starting from position 80 of
the N-terminal domain of CEACAM1, CEACAM5, and CEACAM6. 46Gln Asn
Asp Thr Gly 1 5 475PRTHomo SapiensMISC_FEATUREAmino acid sequence
starting from position 80 of the N-terminal domain of CEACAM3.
47Gln Asn Asp Ile Gly 1 5
* * * * *