U.S. patent application number 15/735197 was filed with the patent office on 2018-06-21 for inhibitors of nucleotidyl transferases and use in herpes and hepatitis viral infections therefor.
This patent application is currently assigned to Saint Louis University. The applicant listed for this patent is Saint Louis University. Invention is credited to Marvin MEYERS, Lynda Anne MORRISON, John Edwin TAVIS.
Application Number | 20180169083 15/735197 |
Document ID | / |
Family ID | 57504102 |
Filed Date | 2018-06-21 |
United States Patent
Application |
20180169083 |
Kind Code |
A1 |
TAVIS; John Edwin ; et
al. |
June 21, 2018 |
INHIBITORS OF NUCLEOTIDYL TRANSFERASES AND USE IN HERPES AND
HEPATITIS VIRAL INFECTIONS THEREFOR
Abstract
The present disclosure relates to identification of inhibitors
of hepatitis and herpesvirus replication including compounds of the
formula: wherein the variables are as defined herein. Also provided
are methods of treatment using agents so identified.
##STR00001##
Inventors: |
TAVIS; John Edwin;
(Kirkwood, MO) ; MORRISON; Lynda Anne; (Webster
Groves, MO) ; MEYERS; Marvin; (Wentzville,
MO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Saint Louis University |
St. Louis |
MO |
US |
|
|
Assignee: |
Saint Louis University
St. Louis
MO
|
Family ID: |
57504102 |
Appl. No.: |
15/735197 |
Filed: |
June 10, 2016 |
PCT Filed: |
June 10, 2016 |
PCT NO: |
PCT/US16/36994 |
371 Date: |
December 10, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62174385 |
Jun 11, 2015 |
|
|
|
62309303 |
Mar 16, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/122 20130101;
A61K 31/662 20130101; C12N 9/22 20130101; A61K 31/522 20130101;
C07C 2601/18 20170501; A61P 31/22 20180101; A61K 31/7076 20130101;
A61K 38/212 20130101; C07D 471/04 20130101; A61K 31/675 20130101;
A61K 31/4412 20130101; C12Y 301/26004 20130101; C07D 213/89
20130101; A61K 31/4375 20130101; A61K 31/52 20130101; C07C 50/28
20130101; A61K 31/513 20130101; A61K 31/7072 20130101; A61K 9/0019
20130101 |
International
Class: |
A61K 31/4412 20060101
A61K031/4412; A61P 31/22 20060101 A61P031/22; A61K 31/662 20060101
A61K031/662; A61K 9/00 20060101 A61K009/00; C07D 471/04 20060101
C07D471/04; C07D 213/89 20060101 C07D213/89; C07C 50/28 20060101
C07C050/28; A61K 31/122 20060101 A61K031/122; A61K 31/4375 20060101
A61K031/4375; A61K 31/522 20060101 A61K031/522; A61K 31/52 20060101
A61K031/52; A61K 38/21 20060101 A61K038/21; A61K 31/513 20060101
A61K031/513; A61K 31/675 20060101 A61K031/675; A61K 31/7072
20060101 A61K031/7072; A61K 31/7076 20060101 A61K031/7076; C12N
9/22 20060101 C12N009/22 |
Goverment Interests
[0002] The invention was made with government support under Grant
No. Grants No. R01 AI104494, U01 DK082871, and R03 AI109460 awarded
by the National Institutes of Health.
[0003] The government has certain rights in the invention.
Claims
1. A method of inhibiting a cellular or herpesvirus nucleic acid
metabolism enzyme comprising contacting said enzyme with a compound
having the formula: ##STR00042## or a compound of the formula:
##STR00043## wherein: R.sub.4 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; R.sub.5 and R.sub.8 are each independently hydrogen,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8);
R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C.ltoreq.8), or
substituted alkyl.sub.(C.ltoreq.8); and R.sub.7 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a compound of the formula: ##STR00044## wherein:
R.sub.9 is alkyl.sub.(C.ltoreq.12), aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups; R.sub.10 is hydrogen,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
R.sub.11 is hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12; wherein:
Y.sub.1 is alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt or tautomer
thereof.
2. The method of claim 1, wherein the compound is further defined
as: ##STR00045## wherein: R.sub.4 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(c.ltoreq.12), or a substituted version of any of
these groups; R.sub.5 and R.sub.8 are each independently hydrogen,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8);
R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C.ltoreq.8), or
substituted alkyl.sub.(C.ltoreq.8); and R.sub.7 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or or a pharmaceutically acceptable salt or tautomer
thereof.
3. The method of claim 1, wherein the compound is further defined
as: ##STR00046## wherein: R.sub.9 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; R.sub.10 is hydrogen, alkyl.sub.(C.ltoreq.8), or
substituted alkyl.sub.(C.ltoreq.8); and R.sub.11 is hydrogen or
Y.sub.1--O--X.sub.1--OR.sub.12; wherein: Y.sub.1 is
alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt or tautomer
thereof.
4. The method of claim 1, wherein the compound is further defined
as: ##STR00047## or a pharmaceutically acceptable salt or tautomer
thereof.
5. The method of claim 1, wherein the compound is further defined
as: ##STR00048## or a pharmaceutically acceptable salt or tautomer
thereof.
6. The method of claim 4, wherein the salt is an ethanolamine
salt.
7. The method of claim 1, further comprising contacting said enzyme
with a second inhibitor of said enzyme.
8. The method of claim 7, further comprising contacting said enzyme
with said compound a second time.
9. The method of claim 7, wherein said enzyme is located in a
cell.
10. The method of claim 9, wherein said cell is located in
vitro.
11. The method of claim 9, wherein said cell is located in a living
subject.
12. The method of claim 11, wherein said subject is a vertebrate
infected with a herpesvirus.
13. The method of claim 12, wherein said compound is administered
intravenously, intraarterially, orally, buccally, nasally,
ocularly, rectally, vaginally, topically, intramuscularly,
intradermally, cutaneously or subcutaneously.
14. The method of claim 12, wherein said subject is further
administered a second anti-herpesvirus therapy.
15. The method of claim 14, wherein said second anti-herpesvirus
therapy is foscarnet or a nucleoside analog.
16. The method of claim 15, wherein said nucleoside analog is
acyclovir, famciclovir, valaciclovir, penciclovir, or
ganciclovir.
17. The method of claim 15, wherein said second anti-herpesvirus
therapy is administered to said subject before or after said
compound.
18. The method of claim 15, wherein said second anti-herpesvirus
therapy is administered to said subject at the same time as said
compound.
19. The method of claim 1, wherein said subject has previously
received a first-line anti-herpesvirus therapy.
20. The method of claim 19, wherein said herpesvirus has developed
resistance to said first-line anti-herpesvirus therapy.
21. The method of claim 1, wherein said herpevirus is selected from
a human alpha herpesvirus, a human beta herpesvirus or a human
gamma herpesvirus.
22. The method of claim 21, wherein the human alpha herpesvirus is
selected from herpes simplex virus 1 (HSV-1), herpes simplex virus
2 (HSV-2), and Varicella-Zoster virus (VZV).
23. The method of claim 21, wherein the human beta herpesvirus is
selected from human cytomegalovirus (HCMV), human herpesvirus 6A
(HHV-6A), human herpesvirus 6B (HHV-6B), and human herpesvirus 7
(HHV-7).
24. The method of claim 21, wherein the human gamma herpesvirus is
selected from Epstein-Barr virus (EBV) and Kaposi's sarcoma
herpesvirus (KSHV).
25. The method of claim 1, wherein the herpesvirus is a non-human
herpesvirus.
26. The method of claim 25, wherein the herpesvirus is Marek's
disease virus, equine herpesviruses, Bovine herpeviruses, or
pseudorabies virus.
27. A pharmaceutical composition comprising a compound having the
formula: ##STR00049## or a pharmaceutically acceptable salt or
tautomer thereof, dispersed in a pharmaceutically acceptable
buffer, diluent, excipient or carrier.
28. The pharmaceutical composition of claim 27, wherein the
pharmaceutical composition is formulated for administration:
orally, nasally, buccally, corneally, rectally, vaginally, or
topically.
29. The pharmaceutical composition of claim 27, wherein the
pharmaceutical composition formulated for administration via
injection.
30. The pharmaceutical composition of claim 29, wherein the
injection is formulated for administration: intradermally,
cutaneously, ocularly, subcutaneously, intramuscularly,
intraperitoneally, intraarterially, or intravenously.
31. The pharmaceutical composition of claim 27, wherein the
pharmaceutically acceptable salt is an ethanolamine salt.
32. A compound of the formula: ##STR00050## wherein: R.sub.1 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.8),
heteroaryl.sub.(C.ltoreq.12), alkylamino.sub.(C.ltoreq.12),
dialkylamino.sub.(C.ltoreq.12), arylamino.sub.(C.ltoreq.12),
diarylamino.sub.(C.ltoreq.12), aralkylamino.sub.(C.ltoreq.18),
diaralkylamino.sub.(C.ltoreq.8), or a substituted version of any of
these groups; R.sub.2 is hydrogen, alkyl.sub.(C.ltoreq.8), or
substituted alkyl.sub.(C.ltoreq.8); and R.sub.3 is hydrogen, amino,
carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or
sulfonylamine; or alkyl.sub.(C.ltoreq.8), aryl.sub.(C.ltoreq.8),
acyl.sub.(C.ltoreq.8), alkoxy.sub.(C.ltoreq.8),
acyloxy.sub.(C.ltoreq.8), amido.sub.(C.ltoreq.8), or substituted
version of any of these groups; X.sub.2 is hydrogen or
--C(O)R.sub.a, wherein: R.sub.a is hydroxy,
alkoxy.sub.(C.ltoreq.8), or substituted alkoxy.sub.(C.ltoreq.8); or
a compound of the formula: ##STR00051## wherein: R.sub.4 is
alkyl.sub.(C.ltoreq.12), aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups; R.sub.5 and R.sub.8 are
each independently hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); R.sub.6 is hydrogen, hydroxy,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
R.sub.7 is aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a compound of the formula: ##STR00052## wherein:
R.sub.9 is alkyl.sub.(C.ltoreq.12), aryl(C.sub.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups; R.sub.10 is hydrogen,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
R.sub.11 is hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12; wherein:
Y.sub.1 is alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt thereof.
33. The compound of claim 32 further defined as: ##STR00053##
wherein: R.sub.1 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.18), heteroaryl.sub.(C.ltoreq.12),
alkylamino.sub.(C.ltoreq.12), dialkylamino.sub.(C.ltoreq.12),
arylamino.sub.(C.ltoreq.12), diarylamino.sub.(C.ltoreq.12),
aralkylamino.sub.(C.ltoreq.18), diaralkylamino.sub.(C.ltoreq.18),
or a substituted version of any of these groups; R.sub.2 is
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); and X.sub.2 is hydrogen or --C(O)R.sub.a,
wherein: R.sub.a is hydroxy, alkoxy.sub.(C.ltoreq.8), or
substituted alkoxy.sub.(C.ltoreq.8); or a pharmaceutically
acceptable salt thereof.
34. The compound of claim 32 further defined as: ##STR00054##
wherein: R.sub.5 is hydrogen, alkyl.sub.(C.ltoreq.8), or
substituted alkyl.sub.(C.ltoreq.8); R.sub.6 is hydrogen, hydroxy,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
R.sub.7 is aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt thereof.
35. The compound of claim 32 further defined as: ##STR00055##
wherein: R.sub.10 is hydrogen, alkyl.sub.(C.ltoreq.8), or
substituted alkyl.sub.(C.ltoreq.8); and R.sub.11 is hydrogen or
Y.sub.1--O--X.sub.1--OR.sub.12; wherein: Y.sub.1 is
alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt thereof.
36. The compound of claim 32, wherein R.sub.2, R.sub.5, or R.sub.10
is hydrogen.
37. The compound of claim 36, wherein R.sub.2, R.sub.5, and
R.sub.10 are hydrogen.
38. The compound of claim 33, wherein R.sub.1 is
aralky.sub.(C.ltoreq.18), aralkylamino.sub.(C.ltoreq.18), or a
substituted version of either group.
39. The compound of claim 34, wherein R.sub.6 is hydroxy.
40. The compound of claim 34, wherein R.sub.7 is
aryl.sub.(C.ltoreq.12).
41. The compound of claim 35, wherein R.sub.11 is
Y.sub.1--O--X.sub.1--OR.sub.12; wherein: Y.sub.1 is
alkanediyl.sub.(C.ltoreq.8); X.sub.1 is
arenediyl.sub.(C.ltoreq.12), or a substituted version of either of
these groups; R.sub.12 is aryl.sub.(C.ltoreq.12) or substituted
aryl.sub.(C.ltoreq.12).
42. The compound according to any one of claims 32-35, wherein the
compound is further defined as: ##STR00056## or a pharmaceutically
acceptable salt thereof.
43. A compound of the formula: ##STR00057## or a pharmaceutically
acceptable salt thereof.
44. A pharmaceutical composition comprising: (A) a compound
according to any one of claims 32-43; and (B) an excipient.
45. The pharmaceutical composition of claim 44, wherein the
pharmaceutical composition is formulated for administration:
orally, nasally, buccally, corneally, rectally, vaginally,
topically, intradermally, cutaneously, ocularly, subcutaneously,
intramuscularly, intraperitoneally, intraarterially, or
intravenously.
46. The pharmaceutical composition of claim 44, wherein the
pharmaceutical composition is formulated as a unit dose.
47. A method of inhibiting a hepatitis B virus RNaseH comprising
administering an effective amount of a compound or composition
according to any one of claims 32-46.
48. The method of claim 47, wherein the method is performed in
vitro.
49. The method of claim 47, wherein the method is performed in
vivo.
50. The method of claim 47, wherein the method is performed ex
vivo.
51. The method of claim 47, wherein the method is sufficient to
inhibit viral replication.
52. A method of inhibiting replication of a hepatitis B virus
comprising contacting the virus with an effective amount of a
compound or composition according to any one of claims 32-46.
53. The method of claim 52, wherein the method is performed in
vitro.
54. The method of claim 52, wherein the method is performed in
vivo.
55. The method of claim 52, wherein the method is performed ex
vivo.
56. The method of claim 52, wherein the method is sufficient to
treat an infection of a hepatitis B virus.
57. A method of treating an infection of a hepatitis B virus in a
patient comprising administering a therapeutically effective amount
of a compound or composition according to any one of claims
32-46.
58. The method of claim 57, wherein the method further comprises a
second antiviral treatment.
59. The method of claim 58, wherein the second antiviral therapy is
interferon alfa-2b, lamivudine, adefovir, telbivudine, entercavir,
or tenofovir.
Description
[0001] The present application claims benefit of priority to U.S.
Provisional Application Ser. No. 62/174,385, filed Jun. 11, 2015,
and U.S. Provisional Application Ser. No. 62/309,303, filed Mar.
16, 2016, the entire contents of which are hereby incorporated by
reference.
BACKGROUND
I. Field
[0004] The disclosure relates to the fields of pathology, virology,
molecular biology and pharmaceuticals. More specifically, the
disclosure relates to the identification of candidate inhibitors
for the treatment and prevention of herpesvirus and hepatitis B
diseases. Also provided are compounds having such activity.
II. Related Art
[0005] Herpesviridae is a large family of DNA viruses that cause
diseases in vertebrates, including humans. These viruses are
significant pathogens and, in addition to primary infections, cause
latent, recurring infections. At least six species of
Herpesviridae--herpes simplex virus 1 (HSV-1) and HSV-2 (both of
which can cause orolabial herpes and genital herpes),
Varicella-zoster virus (which causes chickenpox and shingles),
Epstein-Barr virus (which causes mononucleosis), Cytomegalovirus
(which causes mental retardation and deafness in neonates), and
Human herpesvirus 6B (which causes roseola infantum and febrile
seizures)--are extremely widespread among humans. More than 90% of
adults have been infected with at least one of these, and a latent
form of the virus remains in most people. Other viruses with human
tropism include human herpesvirus 6A, human herpesvirus 7 and
Kaposi's sarcoma-associated herpesvirus. There are more than 130
herpesviruses, including those that infect non-human mammals,
birds, fish, reptiles, amphibians, and mollusks.
[0006] The drugs, acyclovir and ganciclovir, are considered the
standard treatments and prophylactic agents for infections caused
by HSV, VZV and CMV. Until a decade ago, the impact of acyclovir on
the control of severe and life-threatening herpesvirus infections
was unprecedented. Recently, approval of new drugs (i.e.,
penciclovir and the oral prodrugs, valaciclovir, famciclovir,
cidofovir, fomivirsen, and foscamet) has increased the number of
therapeutic options for medical practitioners. Newer agents, such
as brivudin and benzimidavir, are in ongoing clinical development,
while others have been suspended because of safety concerns.
Regardless, new anti-herpes agents are needed to face clinical
issues such as drug resistance, increased use of anti-herpes
prophylaxis, and safety concerns in small children or pregnant
women.
[0007] Similarly, hepatitis B virus (HBV) is a hepatotropic DNA
virus that replicates by reverse transcription (Hostomsky et al.,
1993). It chronically infects >350 million people world-wide and
kills up to 1.2 million patients annually by inducing liver failure
and liver cancer (Steitz, 1995; Katayanagi et al., 1990; Yang et
al., 1990; Lai et al., 2000). Reverse transcription is catalyzed by
a virally-encoded polymerase that has two enzymatic activities: a
DNA polymerase that synthesizes new DNA and a ribonuclease H
(RNAseH) that destroys the viral RNA after it has been copied into
DNA (Hostomsky et al., 1993; Rice et al., 2001; Hickman et al.,
1994; Ariyoshi et al., 1994). Both activities are essential for
viral replication.
[0008] HBV infections are treated with interferon .alpha. or one of
five nucleos(t)ide analogs (Parker et al., 2004; Song et al., 2004;
Lima et al., 2001). Interferon .alpha. leads to sustained clinical
improvement in 20-30% of patients, but the infection is very rarely
cleared (Hostomsky et al., 1993; Katayanagi et al., 1990;
Braunshofer-Reiter et al., 1998). The nucleos(t)ide analogs are
used more frequently than interferon. They inhibit DNA synthesis
and suppress viral replication by 4-5 log.sub.10 in up to 70-90%
patients, often to below the standard clinical detection limit of
300-400 copies/ml (Braunshofer-Reiter et al., 1998; Nowotny et al.,
2005; Klumpp et al., 2003. However, treatment eradicates the
infection as measured by loss of the viral surface antigen (HBsAg)
from the serum in only 3-6% of patients even after years of therapy
(Braunshofer-Reiter et al., 1998; Nowotny et al., 2005; Klumpp et
al., 2003; Nowotny et al., 2006). Antiviral resistance was a major
problem with the earlier nucleos(t)ide analogs, but resistance to
the newer drugs entecavir and tenofovir is very low (Parker et al.,
2004; Keck et al., 1998; Goedken et al., 2001; Li et al., 1995).
This has converted HBV from a steadily worsening disease into a
controllable condition for most individuals (McClure, 1993). The
cost of this control is indefinite administration of the drugs
(probably life-long; (Song et al., 2004), with ongoing expenses of
$400-600/month (Poch et al., 1989; Hu et al. 1996; Hu et al., 1997)
and unpredictable adverse effects associated with decades-long
exposure to the drugs.
[0009] As such, there remains a need to develop new therapeutic
options for these diseases.
SUMMARY
[0010] Thus, in accordance with the present disclosure, there is
provided a method of inhibiting a cellular or herpesvirus nucleic
acid metabolism enzyme comprising contacting said enzyme with a
compound having the formula:
##STR00002##
or a compound of the formula:
##STR00003##
wherein: [0011] R4 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0012] R.sub.5 and R.sub.8 are each independently
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); [0013] R.sub.6 is hydrogen, hydroxy,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
[0014] R.sub.7 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups; or a compound of the
formula:
##STR00004##
[0014] wherein: [0015] R.sub.9 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0016] R.sub.10 is hydrogen, alkyl.sub.(C.ltoreq.8),
or substituted alkyl.sub.(C.ltoreq.8); and [0017] R.sub.11 is
hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12; wherein: [0018] Y.sub.1
is alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); [0019] X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; [0020] R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt or tautomer
thereof.
[0021] In some embodiments, the compound is further defined as:
##STR00005##
wherein: [0022] R.sub.4 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0023] R.sub.5 and R.sub.8 are each independently
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); [0024] R.sub.6 is hydrogen, hydroxy,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
[0025] R.sub.7 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups; or or a
pharmaceutically acceptable salt or tautomer thereof. In other
embodiments, the compound is further defined as:
##STR00006##
[0025] wherein: [0026] R.sub.9 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0027] R.sub.10 is hydrogen, alkyl.sub.(C.ltoreq.8),
or substituted alkyl.sub.(C.ltoreq.8); and [0028] R.sub.11 is
hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12; wherein: [0029] Y.sub.1
is alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); [0030] X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; [0031] R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt or tautomer
thereof.
[0032] In other embodiments, the compound is further defined
as:
##STR00007##
or a pharmaceutically acceptable salt or tautomer thereof. In other
embodiments, the compound is further defined as:
##STR00008##
or a pharmaceutically acceptable salt or tautomer thereof.
[0033] The salt maybe an ethanolamine salt. The method may further
comprise contacting said enzyme with a second inhibitor of said
enzyme, or further comprise contacting said enzyme with said
compound a second time. The enzyme may be located in a cell, which
cell may be located in vitro or located in a living subject. The
subject may be a vertebrate infected with a herpesvirus. The
compound may be administered intravenously, intraarterially,
ocularly, orally, buccally, nasally, rectally, vaginally,
topically, intramuscularly, intradermally, cutaneously or
subcutaneously. The subject may be further administered a second
anti-herpesvirus therapy distinct from the compound. The second
anti-herpesvirus therapy may be foscarnet or a nucleoside analog,
such as acyclovir, famciclovir, valaciclovir, penciclovir, or
ganciclovir. The second anti-herpesvirus therapy may be
administered to the subject before or after said compound. The
second anti-herpesvirus therapy may be administered to said subject
at the same time as said compound.
[0034] The subject may have previously received a first-line
anti-herpesvirus therapy, and further may have developed resistance
to said first-line anti-herpesvirus therapy. The herpevirus may be
selected from a human alpha herpesvirus, a human beta herpesvirus
or a human gamma herpesvirus. The human alpha herpesvirus may be
selected from herpes simplex virus 1 (HSV-1), herpes simplex virus
2 (HSV-2), and Varicella-Zoster virus (VZV). The human beta
herpesvirus may be selected from human cytomegalovirus (HCMV),
human herpesvirus 6A, (HHV-6A), human herpesvirus 6B (HHV-6B), and
human herpesvirus 7 (HHV-7). The human gamma herpesvirus may be
selected from Epstein-Barr virus (EBV) and Kaposi's sarcoma
herpesvirus (KSHV). The herpesvirus may be a non-human herpesvirus,
such as Marek's disease virus, equine herpesviruses, Bovine
herpeviruses, or pseudorabies virus.
[0035] In another aspect, the present disclosure provides a
pharmaceutical composition comprising a compound of the
formula:
##STR00009##
or a pharmaceutically acceptable salt or tautomer thereof. The salt
may be an ethanolamine salt. In some embodiments, the compound is
dispersed in a pharmaceutically acceptable buffer, diluent,
excipient or carrier. In some embodiments, the pharmaceutical
composition is formulated for administration: orally, nasally,
ocularly, buccally, corneally, rectally, vaginally, or topically.
In other embodiments, the pharmaceutical composition formulated for
administration via injection. In some embodiments, the injection is
formulated for administration: intradermally, cutaneously,
subcutaneously, intramuscularly, intraperitoneally,
intraarterially, or intravenously.
[0036] In still another aspect, the present disclosure provides
compounds of the formula:
##STR00010##
wherein: [0037] R.sub.1 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.18), heteroaryl.sub.(C.ltoreq.12),
alkylamino.sub.(C.ltoreq.12), dialkylamino.sub.(C.ltoreq.12),
arylamino.sub.(C.ltoreq.12), diarylamino.sub.(C.ltoreq.12),
aralkylamino.sub.(C.ltoreq.18), diaralkylamino.sub.(C.ltoreq.18),
or a substituted version of any of these groups; [0038] R.sub.2 is
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); and [0039] R.sub.3 is hydrogen, amino,
carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or
sulfonylamine; or [0040] alkyl.sub.(C.ltoreq.8),
aryl.sub.(C.ltoreq.8), acyl.sub.(C.ltoreq.8),
alkoxy.sub.(C.ltoreq.8), acyloxy.sub.(C.ltoreq.8),
amido.sub.(C.ltoreq.8), or substituted version of any of these
groups; [0041] X.sub.2 is hydrogen or --C(O)R.sub.a, wherein:
R.sub.a is hydroxy, alkoxy.sub.(C.ltoreq.8), or substituted
alkoxy.sub.(C.ltoreq.8); or compounds of the formula:
##STR00011##
[0041] wherein: [0042] R.sub.4 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0043] R.sub.5 and R.sub.8 are each independently
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); [0044] R.sub.6 is hydrogen, hydroxy,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
[0045] R.sub.7 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups; or compounds of the
formula:
##STR00012##
[0045] wherein: [0046] R.sub.9 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0047] R.sub.10 is hydrogen, alkyl.sub.(C.ltoreq.8),
or substituted alkyl.sub.(C.ltoreq.8); and [0048] R.sub.11 is
hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12; wherein: [0049] Y.sub.1
is alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); [0050] X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; [0051] R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt thereof. In
some embodiments, the compounds are further defined as:
##STR00013##
[0051] wherein: [0052] R.sub.1 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.8), heteroaryl.sub.(C.ltoreq.12),
alkylamino.sub.(C.ltoreq.12), dialkylamino.sub.(C.ltoreq.12),
arylamino.sub.(C.ltoreq.12), diarylamino.sub.(C.ltoreq.12),
aralkylamino.sub.(C.ltoreq.8), diaralkylamino.sub.(C.ltoreq.8), or
a substituted version of any of these groups; and [0053] R.sub.2 is
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); [0054] X.sub.2 is hydrogen or
--C(O)R.sub.a, wherein: R.sub.a is hydroxy,
alkoxy.sub.(C.ltoreq.8), or substituted alkoxy.sub.(C.ltoreq.8); or
a pharmaceutically acceptable salt thereof. In other embodiments,
the compounds are further defined as:
##STR00014##
[0054] wherein: [0055] R.sub.5 is hydrogen, alkyl.sub.(C.ltoreq.8),
or substituted alkyl.sub.(C.ltoreq.8); [0056] R.sub.6 is hydrogen,
hydroxy, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); and [0057] R.sub.7 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt thereof. In
other embodiments, the compounds are further defined as:
##STR00015##
[0057] wherein: [0058] R.sub.10 is hydrogen,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
[0059] R.sub.11 is hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12;
wherein: [0060] Y.sub.1 is alkanediyl.sub.(C.ltoreq.8) or
substituted alkanediyl.sub.(C.ltoreq.8); [0061] X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; [0062] R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or a pharmaceutically acceptable salt thereof.
[0063] In some embodiments, R.sub.2, R.sub.5, or R.sub.10 is
hydrogen. In some embodiments, R.sub.2, R.sub.5, and R.sub.10 are
hydrogen. In some embodiments, R.sub.1 is aralky.sub.(C.ltoreq.18),
aralkylamino.sub.(C.ltoreq.18), or a substituted version of either
group. In some embodiments, R.sub.6 is hydroxy. In some
embodiments, R.sub.7 is aryl.sub.(C.ltoreq.12). In some
embodiments, R.sub.11 is Y.sub.1--O--X.sub.1--OR.sub.12;
wherein:
[0064] Y.sub.1 is alkanediyl.sub.(C.ltoreq.8);
[0065] X.sub.1 is arenediyl.sub.(C.ltoreq.12), or a substituted
version of either of these groups;
[0066] R.sub.12 is aryl.sub.(C.ltoreq.12) or substituted
aryl.sub.(C.ltoreq.12).
[0067] In some embodiments, the compounds are further defined
as:
##STR00016##
or a pharmaceutically acceptable salt thereof.
[0068] In still yet another aspect, the present disclosure provides
a compound of the formula:
##STR00017##
or a pharmaceutically acceptable salt thereof.
[0069] In still yet another aspect, the present disclosure provides
pharmaceutical compositions comprising:
[0070] (A) a compound described herein; and
[0071] (B) an excipient.
[0072] In some embodiments, the pharmaceutical composition is
formulated for administration: orally, nasally, buccally,
corneally, rectally, vaginally, topically, intradermally,
cutaneously, ocularly, subcutaneously, intramuscularly,
intraperitoneally, intraarterially, or intravenously. In some
embodiments, the pharmaceutical composition is formulated as a unit
dose.
[0073] In yet another aspect, the present disclosure provides
methods of inhibiting a hepatitis B virus RNaseH comprising
administering an effective amount of a compound or composition
described herein. In some embodiments, the method is performed in
vitro. In other embodiments, the method is performed in vivo. In
other embodiments, the method is performed ex vivo. In some
embodiments, the methods are sufficient to inhibit viral
replication.
[0074] In still yet another aspect, the present disclosure provides
methods of inhibiting replication of a hepatitis B virus comprising
contacting the virus with an effective amount of a compound or
composition described herein. In some embodiments, the method is
performed in vitro. In other embodiments, the method is performed
in vivo. In other embodiments, the method is performed ex vivo. In
some embodiments, the methods are sufficient to treat an infection
of a hepatitis B virus.
[0075] In another aspect, the present disclosure provides methods
of treating an infection of a hepatitis B virus in a patient
comprising administering a therapeutically effective amount of a
compound or composition described herein. In some embodiments, the
method further comprises a second antiviral treatment. In some
embodiments, the second antiviral therapy is interferon alfa-2b,
lamivudine, adefovir, telbivudine, entercavir, or tenofovir. In
some embodiments, the patient is a mammal such as a human.
[0076] The use of the word "a" or "an," when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one."
[0077] Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects, or +/-5% of the
stated value.
[0078] Other objects, features and advantages of the present
disclosure will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the disclosure, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the disclosure will become apparent to those skilled in
the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0079] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present disclosure. The disclosure may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0080] FIG. 1. Structure of Piroctone Olamine.
[0081] FIG. 2. Compound #191 inhibits replication of HSV-2 primary
clinical isolates. Vero cell monolayers were infected with the
indicated patient isolates at moi of 0.1 in the presence of
piroctone olamine (#191) or DMSO control at 5 .mu.M. Cultures were
collected 24 hours post-infection and infectious virus titers were
determined by plaque assay. Titers in #191-treated samples were
subtracted from DMSO-treated samples. Values are the averages of
duplicate cultures.
[0082] FIG. 3. Sensitivity of thymidine kinase-deficient HSV-2 to
piroctone olamine. Vero cell monolayers were infected with the
indicated wild-type or mutant HSV-1 or HSV-2 strains at moi of 0.1
in the presence of DMSO control or piroctone olamine at 5 .mu.M.
Duplicate cultures were collected 24 hours post-infection and
infectious virus titers were determined by plaque assay. Titers in
compound-treated samples were subtracted from DMSO-treated samples.
Values are the averages.+-.one standard error of the mean.
[0083] FIGS. 4A & 4B. RNAseH inhibitors work synergistically
with Lamivudine against HBV replication. Chou-Talaly combination
indexes for compounds #1 (FIG. 4A) and #46 (FIG. 4B) together with
Lamivudine. Additive interactions are shown with the red line,
synergistic interactions below the line, and antagonistic
interactions are above the line.
[0084] FIGS. 5A & 5B. HBV's genetic variation is unlikely to
present a barrier to RNAseH drug development. Four variant
patient-derived RNAseH enzymes were expressed as recombinant
enzymes, purified, and tested in an RNAseH assay with compounds #1
(FIG. 5A) and #46 (FIG. 5B) at their respective IC.sub.50s.
DETAILED DESCRIPTION
[0085] The inventors have previously demonstrated that inhibitors
of nucleotidyl-transferase superfamily (NTS) enzymes can come from
multiple different chemical classes. The compounds described herein
may be used from a variety of different viral infections including
herpesvirus and hepatitis B virus. Inhibitors of NTS enzymes like
this compound may well have a high barrier to development of
antiviral resistance, and its unique mode of action suggests that
it should be a good candidate for combination therapy with the
existing antiviral drugs to improve overall efficacy of antiviral
therapy. These and other aspects of the disclosure are discussed in
detail below.
A. HERPESVIRUS
[0086] Herpesviruses are a diverse group of enveloped viruses
having a large, double-stranded DNA genome enclosed in an
icosahedral capsid (Pellet & Roizman 2013). The herpesviruses
rely on the host cell RNA polymerase II for transcription, but
encode all of the enzymes needed for replication of their genomes,
including DNA polymerase, helicase, primase, terminase,
ribonucleotide reductase, and thymidine kinase. All herpesviruses
share the capacity to establish latency in host cells, allowing
them to maintain the infection for the life of the host. Periodic
reactivation from latency in response to cues in the cellular
environment leads to lytic replication at mucosal surfaces, causing
recurrent disease and providing the opportunity for transmission to
uninfected individuals.
[0087] The herpesviruses are divided into three subclasses based
primarily on their cellular tropism and characteristics of the
latent infection. The human alpha herpesviruses herpes simplex
virus 1 (HSV-1) (Roizman et al., 2013), herpes simplex virus 2
(HSV-2) (Roizman et al., 2013) and Varicella-Zoster virus (VZV)
(Arvin & Gilden 2013) establish latency in sensory neurons
where they may remain quiescent for long periods of time. HSV-1 and
HSV-2 are similar viruses with colinear genomes and 83% nucleotide
sequence identity in protein coding regions (Dolan et al., 1998);
VZV contains a smaller, less homologous genome. The human beta
herpesviruses human cytomegalovirus (HCMV), human herpesvirus 6A
(HHV-6A), human herpesvirus 6B (HHV-6B) and human herpesvirus 7
(HHV-7) (Yamanishi et al., 2013) establish latency predominantly in
mononuclear cells. The human gamma herpesviruses Epstein-Barr virus
(EBV) (Longnecker et al., 2013) and Kaposi's sarcoma herpesvirus
(KSHV) (Damania & Cesarman 2013) stimulate cellular
proliferation upon infection. EBV infects B lymphocytes, where it
establishes latency, and also epithelial cells. By contrast,
endothelial cells harbor the latent reservoir of KSHV, although the
virus infects numerous other cell types as well. The genomes of
latent beta and gamma herpesviruses are replicated as the host cell
divides in order to maintain latent infection.
[0088] Herpesviruses related the human alpha, beta and gamma
herpesviruses infect numerous animal species, including several of
significant economic importance. Key among these are pseudorabies
virus which infects pigs, Marek's disease virus which infects
chickens, bovine herpesvirus, equine herpesvirus, and salmonid and
related herpesviruses that infect game fish.
1. Pathology
[0089] Primary infections with herpesviruses produce a broad
spectrum of disease. HSV-1 causes numerous maladies (Roizman et
al., 2013): gingivostomatitis; eczema herpeticum; herpes
gladiatorum; less common but frequently fatal encephalitis; and an
increasing proportion of ulcerative anogential lesions (Gilbert et
al., 2011; Horowitz et al., 2011; Pena et al., 2010; Smith &
Roberts 2009). Nearly two-thirds of the U.S. population has been
exposed to HSV-1 (Xu et al., 2006). HSV-2 infects approximately 17%
of Americans (Xu et al., 2006) and up to 75% of some demographics
world-wide (Obasi et al., 1999 and Kamali et al., 1999), with an
estimated global disease burden of more than half a billion people
(Looker, et al., 2008). HSV-2 is the primary cause of ulcerative
anogenital lesions. In addition, HSV-1 and HSV-2 may be transmitted
from a pregnant woman to her child during birth, often causing
potentially fatal disseminated disease in the newborn (Kimberlin
2007). HCMV is the most common in utero virus infection (Manicklal
et al., 2013), and approximately 8,000 HCMV-infected infants born
each year in the U.S. suffer sensorineural deafness,
chorioretinitis, and/or mental retardation (James et al., 2009). In
immunocompromised individuals, HCMV can cause mononucleosis,
retinitis, colitis, pneumonitis, and esophagitis. These serious
HCMV infections are associated with increased morbidity and
mortality (Komatsu et al., 2014). EBV causes the vast majority of
infectious mononucleosis, which strikes nearly half of young adults
(Luzuriaga & Sullivan 2010). Notably, of the eight human
herpesviruses, a vaccine is available only for VZV.
[0090] The novel capacity of herpesviruses to establish and
reactivate from latency is also associated with numerous
pathologies. HSV-1 causes recurrent cold sores; a significant
proportion of devastating viral encephalitis; and corneal scarring
known as herpetic stromal keratitis which is the most frequent
infectious cause of blindness, afflicting nearly 400,000 persons
annually in the U.S. (Roizman et al., 2013). HSV-2 frequently
reactivates to cause genital ulcers and prior HSV-2 infection is
associated with an increased risk of human immunodeficiency virus
(HIV) acquisition (Roizman et al., 2013). Infants who survive HSV-1
or HSV-2 infections often experience life-long sequellae and
periodic recurrent lesions (Kimberlin 2007 and James et al., 2009).
VZV reactivates in up to half of older adults (Cohen 2013), and
pain associated with the classic Zoster (shingles) rash and
post-rash neuralgia can be excruciating. HCMV reactivation is
associated with increased incidence of restenosis after angioplasty
(Popovic et al., 2012), and also causes significant morbidity and
mortality in recipients of bone marrow and solid organ transplants
(Snydman 2008). Latent EBV infection is associated with a variety
of cancers including Burkitt's lymphoma, two types of Hodgkin's
lymphoma, non-Hodgkin's lymphoma, nasopharyngeal carcinoma, and
post-transplant lymphoproliferative disease. Latent KSHV infection
can lead to three types of cancer: Kaposi's sarcoma, pleural
effusion lymphoma, and Castleman's disease (Damania & Cesarman
2013).
[0091] Veterinary herpesviruses also take a significant toll on
livestock. Marek's disease is highly contagious, spreading rapidly
through flocks of chickens that have not been vaccinated. It causes
T cell lymphoma with infiltration of nerves and somatic organs,
leading to paralysis and death in up to 80% of infected birds
(Hirari, 2001). In addition, vaccine efficacy has declined with a
concomitant increase in Marek's virus virulence (Gimeno, 2008).
Pseudorabies (PRV) is the second most economically important viral
disease of swine. Although PRV does not cause illness in adult
swine, infection of pregnant sows results in a high incidence of
abortion or resorption (Smith, 1997). Piglets infected with PRV
suffer coughing, sneezing, fever, constipation, and a variety of
neurologic symptoms. Mortality in piglets less than one month of
age is close to 100%, but declines rapidly with age (Nauwynck et
al., 2007). Ruminants and dogs and cats are also susceptible to
lethal PRV infection (Fenner et al., 1993). In cattle, symptoms
include intense itching followed by neurological signs and death.
In dogs, intense itching is accompanied by jaw and pharyngeal
paralysis and subsequent death (Decaro et al., 2008). In cats,
usually no symptoms are observed because the disease is so rapidly
fatal (Gaskell et al., 2007). Bovine herpesviruses (BHV) cause a
variety of illnesses in young cattle, and can also cause abortion.
Although the illnesses caused by BHV's are mostly not
life-threatening, they cause important diseases because infection
may trigger a decline in meat and milk production and affect trade
restrictions (Nandi et al., 2009). Equine herpesviruses typically
cause respiratory disease, but certain species also cause
myeloencephalopathy in horses, abortion and occasionally neonatal
mortality due to pneumonia (Fortier et al., 2010). The
herpesviruses of various fish species can cause significant
mortality in aquaculture settings, particularly at the fingerling
stage (Hanson et al., 2011). Importantly, all of these viruses
share the same basic genomic replication mechanisms, so if the
presumed mechanism by which the NTS enzymes inhibit HSV-1 and HSV-2
is correct, most of the other herpesvirus pathogens should also be
highly sensitive to NTS inhibitors. Development of NTS inhibitors
into anti-herpesvirus drugs would be particularly valuable in cases
like HCMV, where current antiviral therapies frequently drive
resistance and are plagued by toxicity issues (Weller and Kuchta,
2013). Finally, NTS inhibitors may be promising candidates for pan
anti-herpesvirus drug development due to similarities in
replication mechanisms of all the herpesviruses.
[0092] 2. Infection and Latency
[0093] Enveloped herpesvirus particles fuse with the plasma
membrane of a cell, releasing viral regulatory proteins and the
viral capsid containing the linear double-stranded DNA genome into
the cytoplasm. The capsids deliver the viral genome to the nucleus
via release through nuclear pores, whereupon the genome
circularizes and becomes transcriptionally active. Viral infection
at this point can proceed by two patterns, lytic or latent. In the
lytic cycle, coordinated phases of viral transcription lead to
expression of the viral regulatory proteins, viral enzymes, and
concurrently with the onset of DNA replication, the viral
structural proteins. Nascent viral capsids assemble in the nucleus
and then bud through the nuclear membranes to acquire their
envelope (Mettenleiter et al., 2009). Release from the cells is
primarily lytic, resulting in the death of the cell. Alternatively,
the virus may enter a latent state, where transcription is limited
to a few viral regulatory loci and viral DNA replication is
strictly limited. Upon recognition of appropriate cellular stimuli,
viral transcription reverts to the lytic pattern and productive
viral replication occurs.
[0094] Initial infections with alpha herpesviruses are lytic,
resulting in dispersion of the virus to other cells and organs.
These viruses establish latency in the unique environment of the
neuron, and also in satellite cells in the case of VZV. During
latency, replication of alpha herpesvirus DNA may occur at a low
level because latently infected neurons contain multiple copies of
the genome (Chen et al., 2002; Wang et al., 2005). Once latency is
established, DNA replication increases markedly only during a
reactivation event. Initial infections with beta herpesviruses are
typically non-lytic but may cause cell-cell fusion. The gamma
herpesviruses stimulate proliferation of infected cells,
replicating their DNA along with cellular DNA replication to
transmit copies of the viral genome to daughter cells (Longnecker
et al., 2013). All the herpesviruses cause episodic lytic infection
of at least some cell types, allowing them to be shed from mucosal
surfaces to facilitate transmission to uninfected individuals.
[0095] 3. Genomic Replication
[0096] Circularization of the linear double-stranded herpesvirus
DNA occurs in the nucleus shortly after viral uncoating, presumably
through a recombination-mediated event. Replication of the viral
DNA occurs in the nucleus within three-dimensional domains termed
replication compartments (Quinlan et al., 1984). DNA replication is
thought to employ a double-stranded rolling circle mechanism
[reviewed in (Weller & Coen 2012; Lehman & Boehmer 1999)].
In preparation for viral DNA replication, virus-encoded
transcriptional activators upregulate expression of proteins
involved in nucleic acid metabolism. DNA replication then initiates
at one of three viral origins of DNA replication and is mediated
through action of the viral ICP6 origin binding protein. (All viral
gene names in this section are for HSV-1). DNA synthesis is primed
by the viral helicase/primase complex (pUL5, pUL8, and pUL52). DNA
elongation occurs by coupled leading- and lagging-strand DNA
synthesis through formation of a replication fork that is grossly
similar to the forks that replicate cellular DNA. DNA synthesis is
catalyzed by the pUL30 DNA polymerase/UL42 processivity protein
complex that also possesses 5'-3' exonuclease, 3'-5' exonuclease,
and RNase H activities. Helical torsion is relieved by the viral
helicase/primase complex, and proper replication fork initiation,
architecture and dynamics are promoted by the ICP8 single-stranded
DNA binding protein. The initial product of DNA replication is a
head-to-tail concatamer, but later in the replication cycle complex
branched concatamers accumulate through recombination and/or
re-initiation mechanisms. The concatamer is cleaved to unit length
by the terminase complex (pUL15, pUL28, and pUL33) (Selvarajan et
al., 2013) during encapsidation of the viral genome into pre-formed
viral capsids. Without wishing to be bound by any theory, it is
believed that some of the compounds described herein inhibit the
activity of pUL15 terminase.
[0097] 4. Therapeutic Targets in the Herpesvirus Genome
[0098] Possible targets for nucleotidyl transferase superfamily
inhibitors in the herpesvirus genomes. The inhibitors screened here
function against HIV by binding to the viral RNase H or integrase
active sites and chelating the essential divalent cations within
the active site (Fuji et al., 2009; Su et al., 2010; Chung et al.,
2011; Billamboz et al., 2011; Himmel et al., 2009; Kirschberg et
al., 2009). Other compounds screened here are chemically related to
inhibitors of the HIV RNase H and integrase. Therefore, their
presumed mechanism of action is to inhibit one or more of the viral
and/or cellular NTS enzymes essential for herpesviral genomic
replication. This mechanism has not yet been tested.
[0099] For the herpes simplex viruses, candidate genes include the
RNase H activity of the pUL30 DNA polymerase (Liu et al., 2006),
the 3'-5' exonuclease activity of pUL30 (Coen 1996), the strand
transfer activity of ICP8 (Bortner et al., 1993; Nimonkar &
Boehmer, 2003), or the 5'-3' exonuclease activity of the pUL12
polymerase accessory protein (Schumacher et al., 2012) that are
directly involved in virus replication (Weller & Coen 2012).
The pUL15 terminase protein that cleaves the concatameric viral DNA
produced by DNA replication into the mature linear monomers is also
a prime candidate (Selvarajan et al., 2013).
[0100] Other herpesviruses encode proteins with functions
consistent with NTS enzymes that could be plausible targets. For
example, pUL98 is the HCMV ortholog of HSV pUL12 and is
functionally conserved, as demonstrated by trans-complementation
experiments (Gao et al., 1998). At least two of the seven HCMV
proteins involved in encapsidation form an essential terminase
complex which likely functions as both an endonuclease and a DNA
translocase during DNA cleavage and packaging (Bogner, 2002; Hwang
& Bogner, 2002; Scheffczik et al., 2002; Scholz et al., 2003).
These genes are conserved throughout the herpesvirus family (Alba
et al., 2001) and deletion of any of the seven results in
accumulation of empty capsids in the nucleus. The human
cytomegalovirus (HCMV) terminase subunits pUL56 and pUL89, encoded
by the UL56 and UL89 genes, have been extensively studied. Both
gene products form toroidal structures, bind DNA, and have nuclease
activity (Bogner et al., 1998; Scheffczik et al., 2002). While
pUL56 mediates the specific binding to pac sequences on DNA
concatamers and provides energy and structural assistance for DNA
translocation into the procapsids, pUL89 cleaves the DNA
concatomers (Bogner, 2002). These are the orthologs of HSV
terminase subunits pUL15 and pUL28.
[0101] Cellular proteins are also plausible targets for the action
of the NTS inhibitors, especially because DNA recombination events
appear to be important during productive replication (Weller &
Coen 2012). These proteins include the human RNase H1 that could
assist in removal of RNA primers for DNA synthesis. Other
candidates include the Fen1 endonuclease that may assist in removal
of primers (Zhu et al., 2010), and the double-stranded break repair
enzymes Mre11, Rad50, NBS1, Rad51 (Weizman & Weller 2011), and
Rad52 (Schumacher et al., 2012). The base-excision repair enzymes
SSH2 and MLH1 which form complexes that are recruited to viral
replication sites and contribute to HSV genomic replication (Mohni
et al., 2011) are also plausible targets.
[0102] 5. Treatments
[0103] Herpesvirus DNA polymerase inhibitors (nucleoside analogs),
including acyclovir, famciclovir, valaciclovir, penciclovir, and
ganciclovir are the most common forms of treatment. A pyrophosphate
analog, foscarnet, also inhibits the herpesvirus DNA polymerases. A
DNA helicase-primase inhibitor, AIC316 (pritelivir), was shown to
reduce HSV-2 shedding and number of days without lesions in a phase
2 clinical trial (Wald et al., 2014). However, a subsequent
double-blind trial by the same group was terminated by the sponsor
because of concurrent findings of toxicity in monkeys (De et al.,
2015). Similarly, the helicase-primase inhibitor Amenamevir
(ASP2151) is active against HSV-1 and HSV-2 in culture (Chono et
al., 2010) and significantly reduced the median time to lesion
healing in a phase II clinical trial (Tyring et al., 2012), but a
subsequent trial was terminated due to adverse effects (De et al.,
2015). CMX001 (brincidofovir), an orally bioavailable lipid
conjugate of cidofovir, potentiates the antiviral effect of
acyclovir in mice inoculated intranasally with HSV-1 or HSV-2
(Prichard et al., 2011). N-Methanocarbathymidine (N-MCT) reduces
lethality in a mouse model of HSV-2 infection (Quenelle et al.,
2011) and a guinea pig model of neonatal herpes (Bernstein et al.,
2011). N-MCT also reduces acute and recurrent disease caused by
HSV-2 in an adult guinea pig model. The monoamine oxidase inhibitor
tranylcypromine (TCP), which also blocks the activity of histone
demethylase LSD1, reduces HSV-1 infection of the cornea, trigeminal
ganglia and brain of mice, corneal disease, and percentage of mice
shedding virus upon induced reactivation (Yao et al., 2014). TCP
has also been tested in a rabbit eye model of recurrent infection
with HSV-1 and the mouse and guinea pig models of HSV-2 genital
infection. An acyclic nucleoside phosphonate, PMEO-DAPym, inhibits
HSV replication in a variety of cultured cell types by targeting
the viral DNA polymerase (Balzarini et al., 2013). The HIV
integrase inhibitor, Raltegravir, has a small amount of inhibitory
activity against replication of several herpesviruses in cultured
cells (Zhou et al., 2014; Yan et al., 2014) and appears to target
the polymerase processivity factor UL42 (Zhou et al., 2014). Two
other integrase inhibitors, XZ15 and XZ45, reduce replication of
HSV-1 in cell culture by approximately 800- to 8000-fold,
respectively (Yan et al., 2014). XZ45 also inhibits HCMV
replication and KSHV gene expression (Yan et al., 2014).
[0104] Therapy based on existing drugs such as acyclovir is
incompletely effective (Johnston et al., 2012), and viral
resistance to current nucleos(t)ide analog therapies is relatively
common. Acyclovir resistant variants are particularly prevalent
among children, the immunocompromised, and patients with herpetic
stromal keratitis (Duan et al., 2008; Wang et al., 2011; Field
& Vere Hodge, 2013; Morfin & Thouvenot, 2003; Andrei &
Snoeck, 2013). Ganciclovir-resistant variants occur in the
naturally circulating viral population (Drew et al., 1993) and can
be selected in patients over time (Marfori et al., 2007; Imai et
al., 2004; Drew et al., 2001; Drew et al., 1999).
B. HEPATITIS B VIRUS
[0105] 1. Biology
[0106] Hepatitis B virus, abbreviated HBV, is a species of the
genus Orthohepadnavirus, which is likewise a part of the
Hepadnaviridae family of viruses. This virus causes the disease
hepatitis B. In addition to causing hepatitis B, infection with HBV
can lead to hepatic fibrosis, cirrhosis and hepatocellular
carcinoma. It has also been suggested that it may increase the risk
of pancreatic cancer.
[0107] The hepatitis B virus is classified as the type species of
the Orthohepadnavirus, which contains at least five other species:
the pomona roundleaf bat hepatitis virus, long-fingered bat
hepatitis virus, the Ground squirrel hepatitis virus, Woodchuck
hepatitis virus, and the Woolly monkey hepatitis B virus. The genus
is classified as part of the Hepadnaviridae family along with
Avihepadnavirus. This family of viruses have not been assigned to a
viral order. Viruses similar to hepatitis B have been found in all
the Old World apes (orangutan, gibbons, gorillas and chimpanzees)
and from a New World woolly monkey suggesting an ancient origin for
this virus in primates.
[0108] The virus is divided into four major serotypes (adr, adw,
ayr, ayw) based on antigenic epitopes present on its envelope
proteins, and into eight genotypes (A-H) according to overall
nucleotide sequence variation of the genome. The genotypes have a
distinct geographical distribution and are used in tracing the
evolution and transmission of the virus. Differences between
genotypes affect the disease severity, course and likelihood of
complications, and response to treatment and possibly
vaccination.
[0109] The virus particle (virion) consists of an outer lipid
envelope and an icosahedral nucleocapsid core composed of protein.
The nucleocapsid encloses the viral DNA and a DNA polymerase that
has reverse transcriptase activity similar to retroviruses. The
outer envelope contains embedded proteins which are involved in
viral binding of, and entry into, susceptible cells. The virus is
one of the smallest enveloped animal viruses with a virion diameter
of 42 nm, but pleomorphic forms exist, including filamentous and
spherical bodies that both lack a core. These particles are not
infectious and are composed of the lipid and protein that forms
part of the surface of the virion, which is called the surface
antigen (HBsAg), and are produced in excess during the life cycle
of the virus. The HBV virus itself is called a Dane particle and
consists of HBsAg, a lipid envelope, the core protein (HBcAg), the
viral genome, and the Hepatitis B virus DNA polymerase. The
functions of the small regulatory protein (HBx) are not yet well
known but may be related to interfering with transcription, signal
transduction, signal transduction, cell cycle progress, protein
degradation, apoptosis, or chromosomal stability. The virus also
produces a secreted protein called HBeAg that is an amino-terminal
extension of HBcAg initiating from an upstream start codon that is
involved in suppressing antiviral immune responses.
[0110] The genome of HBV is made of circular DNA, but it is unusual
because the DNA is not fully double-stranded in the virion. One end
of the full length strand is linked to the viral DNA polymerase.
The genome is 3020-3320 nucleotides long (for the full length
strand) and 1700-2800 nucleotides long (for the short length
strand). The negative-sense, (non-coding), strand is the complete
strand and it is complementary to the viral mRNA. The viral DNA is
found in the nucleus soon after infection of the cell. The
partially double-stranded DNA is rendered fully double-stranded
shortly after infection of a cell by completion of the (+) sense
strand and removal of a protein molecule from the (-) sense strand
and a short sequence of RNA from the (+) sense strand. A short
terminal duplication of are removed from the ends of the (-) sense
strand and the ends are rejoined. The mature nuclear form of the
genome is called the "cccDNA." The cccDNA is the template for
transcription of all of the viral mRNAs.
[0111] There are four known genes encoded by the genome called C,
X, P, and S. The core protein (HBcAg) is coded for by gene C, and
its start codon is preceded by an upstream in-frame AUG start codon
from which the pre-core protein is produced. HBeAg is produced by
proteolytic processing of the pre-core protein. The DNA polymerase
is encoded by gene P. Gene S is the gene that codes for the surface
antigens (HBsAg). The HBsAg gene is one long open reading frame but
contains three in frame "start" (ATG) codons that divide the gene
into three sections, pre-S1, pre-S2, and S. Because of the multiple
start codons, polypeptides of three different sizes called large,
middle, and small (pre-S1+pre-S2+S, pre-S2+S, or S) are produced.
The function of the protein coded for by gene X is not fully
understood, but it has pleiotropic regulatory functions in both the
cytoplasm and nucleus.
[0112] There are at least eight known genotypes labeled A through
H. A possible new "I" genotype has been described, but acceptance
of this notation is not universal. Different genotypes may respond
to treatment in different ways. The genotypes differ by at least 8%
of the sequence and have distinct geographical distributions and
this has been associated with anthropological history. Type F which
diverges from the other genomes by 14% is the most divergent type
known. Type A is prevalent in Europe, Africa and South-east Asia,
including the Philippines. Type B and C are predominant in Asia;
type D is common in the Mediterranean area, the Middle East and
India; type E is localized in sub-Saharan Africa; type F (or H) is
restricted to Central and South America. Type G has been found in
France and Germany. Genotypes A, D and F are predominant in Brazil
and all genotypes occur in the United States with frequencies
dependent on ethnicity. The E and F strains appear to have
originated in aboriginal populations of Africa and the New World,
respectively. Within these genotypes, 24 subtypes have been
described which differ by 4-8% of the genome: [0113] Type A has two
subtypes: Aa (A1) in Africa/Asia and the Philippines and Ae (A2) in
Europe/United States. [0114] Type B has two distinct geographical
distributions: Bj/B1 (`j`--Japan) and Ba/B2 (`a`--Asia). Type Ba
has been further subdivided into four clades (B2-B4). [0115] Type C
has two geographically subtypes: Cs (C1) in South-east Asia and Ce
(C2) in East Asia. The C subtypes have been divided into five
clades (C1-C5). A sixth clade (C6) has been described in the
Philippines but only in one isolate to date. Type C1 is associated
with Vietnam, Myanmar and Thailand; type C2 with Japan, Korea and
China; type C3 with New Caledonia and Polynesia; C4 with Australia;
and C5 with the Philippines. A further subtype has been described
in Papua, Indonesia. [0116] Type D has been divided into 7 subtypes
(D1-D7). [0117] Type F has been subdivided into 4 subtypes (F1-F4).
F1 has been further divided in to 1a and 1b. In Venezuela subtypes
F1, F2, and F3 are found in East and West Amerindians. Among South
Amerindians only F3 was found. Subtypes Ia, III, and IV exhibit a
restricted geographic distribution (Central America, the North and
the South of South America respectively) while clades Ib and II are
found in all the Americas except in the Northern South America and
North America respectively.
[0118] The life cycle of hepatitis B virus is complex. Hepatitis B
is one of a few known non-retroviral viruses which use reverse
transcription as a part of its replication process: [0119]
Attachment--The virus gains entry into the cell by binding to a
receptor on the surface of the cell and enters it by endocytosis.
[0120] Penetration--The virus membrane then fuses with the host
cell's membrane releasing the DNA and core proteins into the
cytoplasm. [0121] Uncoating--Because the virus multiplies via RNA
made by a host enzyme, the viral genomic DNA has to be transferred
to the cell nucleus by host proteins. The core proteins dissociate
from the partially double-stranded viral DNA is then made fully
double-stranded and transformed into covalently closed circular DNA
(cccDNA) that serves as a template for transcription of four viral
mRNAs. [0122] Replication--The cccDNA is the transcriptional
template for all of HBV's RNAs. The largest of the mRNAs is called
the pre-core mRNA that encodes HBeAg. A slightly shorter mRNA is
called the pregenomic RNA that encodes the HBcAg and the viral DNA
polymerase. Both the precore and pregenomic RNAs are longer than
the viral genome, but only the pregenomic RNA is packaged into
nascent core particles along with the viral polymerase. Reverse
transcription within the capsids is catalyzed by the coordinate
activity of the viral DNA polymerase's reverse transcriptase and
ribonuclease H activities and results in the partially
double-stranded viral DNA found within HBV virions. [0123] Assembly
and Release--Progeny virions are formed budding of the viral capsid
particles containing the viral DNA into
endoplasmic-reticulum-derived membranes, where they pick up their
envelope and HBsAgs are released from the cell by non-cytolytic
secretion or are returned to the nucleus and re-cycled to produce
even more copies of the nuclear cccDNA.
[0124] 2. Treatment
[0125] Currently, there are seven FDA approved drugs in the U.S. to
treat chronic HBV: Intron A.RTM. (Interferon Alpha), Pegasys.RTM.
(Pegylated Interferon), Epivir HBV.RTM. (Lamivudine), Hepsera.RTM.
(Adefovir), Baraclude.RTM. (Entecavir), Tyzeka.RTM. (Telbivudine),
and Viread.RTM. (Tenofovir).
[0126] Adefovir, previously called bis-POM PMEA, with trade names
Preveon.RTM. and Hepsera.RTM., is an orally-administered nucleotide
analog reverse transcriptase inhibitor (ntRTI). It can be
formulated as the pivoxil prodrug adefovir dipivoxil. Adefovir
works by blocking reverse transcriptase, the enzyme that is crucial
for the hepatitis B virus (HBV) to reproduce in the body because it
synthesizes the viral DNA. It is approved for the treatment of
chronic hepatitis B in adults with evidence of active viral
replication and either evidence of persistent elevations in serum
aminotransferases (primarily ALT) or histologically active disease.
The main benefit of adefovir over drugs like lamivudine (below) is
that it takes a much longer period of time before the virus
develops resistance to it. Adefovir dipivoxil contains two
pivaloyloxymethyl units, making it a prodrug form of adefovir.
[0127] Lamivudine (2',3'-dideoxy-3'-thiacytidine, commonly called
3TC) is a potent nucleoside analog reverse transcriptase inhibitor
(nRTI). It is marketed by GlaxoSmithKline with the brand names
Zeffix.RTM., Heptovir.RTM., Epivir.RTM., and Epivir-HBV.RTM..
Lamivudine has been used for treatment of chronic hepatitis B at a
lower dose than for treatment of HIV. It improves the
seroconversion of HBeAg positive hepatitis B and also improves
histology staging of the liver. Long term use of lamivudine
unfortunately leads to emergence of a resistant hepatitis B virus
mutants with alterations to the key YMDD motif in the reverse
transcriptase active site. Despite this, lamivudine is still used
widely as it is well tolerated and as it is less expensive than the
newer drugs and is the only anti-HBV drug many people in emerging
economies can afford.
[0128] Lamivudine is an analogue of cytidine. It can inhibit both
types (1 and 2) of HIV reverse transcriptase and also the reverse
transcriptase of hepatitis B. It is phosphorylated to active
metabolites that compete for incorporation into viral DNA. It
inhibits the HIV reverse transcriptase enzyme competitively and
acts as a chain terminator of DNA synthesis. The lack of a 3'--OH
group in the incorporated nucleoside analogue prevents the
formation of the 5' to 3' phosphodiester linkage essential for DNA
chain elongation, and therefore, the viral DNA growth is
terminated. Lamivudine is administered orally, and it is rapidly
absorbed with a bio-availability of over 80%. Some research
suggests that lamivudine can cross the blood-brain barrier.
[0129] Entecavir, abbreviated ETV, is an oral antiviral drug used
in the treatment of hepatitis B infection. It is marketed under the
trade names Baraclude.RTM. (BMS) and Entaliv.RTM. (DRL). Entecavir
is a nucleoside analog (more specifically, a guanosine analogue)
that inhibits reverse transcription and DNA replication thus
preventing transcription in the viral replication process. The
drug's manufacturer claims that entecavir is more efficacious than
previous agents used to treat hepatitis B (lamivudine and
adefovir). Entecavir was approved by the U.S. FDA in March 2005 and
is used to treat chronic hepatitis B. It also helps prevent the
hepatitis B virus from multiplying and infecting new liver cells.
Entecavir is also indicated for the treatment of chronic hepatitis
B in adults with HIV/AIDS infection. However, entecavir is not
active against HIV.
[0130] Telbivudine is an antiviral drug used in the treatment of
hepatitis B infection. It is marketed by Swiss pharmaceutical
company Novartis under the trade names Sebivo.RTM. (Europe) and
Tyzeka.RTM. (United States). Clinical trials have shown it to be
significantly more effective than lamivudine or adefovir, and less
likely to cause resistance. Telbivudine is a synthetic thymidine
nucleoside analogue; it is the L-isomer of thymidine. It is taken
once daily.
[0131] Tenofovir disoproxil fumarate (TDF or PMPA), marketed by
Gilead Sciences under the trade name Viread.RTM., it is also a
nucleotide analogue reverse transcriptase inhibitor (nRTIs) which
blocks the HBV reverse transcriptase, an enzyme crucial to viral
production. Tenofovir disoproxil fumarate is a prodrug form of
tenofovir. Tenofovir is indicated in combination with other
antiretroviral agents for the treatment of HIV-1 infection in
adults. This indication is based on analyses of plasma HIV-1 RNA
levels and CD4 cell counts in controlled studies of tenofovir in
treatment-naive and treatment-experienced adults. There are no
study results demonstrating the effect of tenofovir on the clinical
progression of HIV. It also has activity against wild-type and
lamivudine-resistant HBV.
C. NUCLEOTIDYL TRANSFERASE SUPERFAMILY ENZYMES
[0132] The inhibitors screened in this project were selected for
their ability to inhibit the HIV RNAse H and/or integrase enzymes
(or to be close chemical analogs of known inhibitors). The RNAse H
and integrase are members of the nucleotidyl transferase
superfamily (NTS) whose members share a similar protein fold and
enzymatic mechanisms (Yang 1995). Therefore, the presumed targets
of the anti-herpesvirus compounds claimed here are viral and/or
cellular NTS enzymes. RNAse H enzymes (Hostomsky et al., 1993a;
1993b; 1993c) digest RNA when it is hybridized to DNA. Their
physiological roles include removal of RNA primers during DNA
synthesis, removal of abortive transcription products, and removal
of RNA strands following reverse transcription by viruses or
retrotransposons. Integrase enzymes cleave DNA strands and catalyze
the covalent insertion of another DNA strand at the cleavage site.
Consequently, the presumed mechanism of action for the herpesvirus
inhibitors is through suppression of one or more of the nucleolytic
or recombination-related activities essential for replication of
the herpesvirus DNA.
[0133] The NTS family of enzymes includes E. coli RNase H I and II
(Katayanagi et al., 1990, Yang et al., 1990 and Lai et al., 2000);
human RNase H 1 and 2 (Lima et al., 2001, Frank et al., 1998 and
Frank et al., 1998); the RuvC Holiday junction resolvase (Ariyoshi
et al., 1994); and the Argonaute RNAse (Parker et al., 2004 and
Song et al., 2004); retroviral RNase H enzymes including the HIV
enzyme (Nowotny 2009); retroviral integrases including the HIV
integrase (Dyda et al., 1994); and the hepatitis B virus (HBV)
RNase H (Tavis et al., 2013). These enzymes function in a wide
range of nucleic acid metabolic events, including RNA and DNA
digestion, DNA recombination, DNA integration, DNA excision,
replication fork repair, DNA repair, miRNA maturation, and
miRNA-directed RNA cleavage. The canonical RNase H structure
contains about 100 amino acids that fold into a 5-stranded
.beta.-sheet overlaid with 3 .alpha.-helices arranged like an "H".
Within the active site are four conserved carboxylates (the "DEDD"
motif) that coordinate two divalent cations (Nowotny et al.,
2005).
[0134] The RNase H enzymatic mechanism is believed to involve both
divalent cations (Klumpp et al., 2003; Yang and Steitz, 1995),
although a 1-ion mechanism has been proposed (Goedken and Marqusee,
2001; Keck et al., 1998). There are 3 classes of RNAse Hs
distinguished by how they bind to their substrates. RNA binding by
the "stand-alone" class typified by E. coli RNAse H I is promoted
by a basic "handle" region (Hostomsky et al., 1993; Kwun et al.,
2001). Eukaryotic RNase Hs typically contain a "RHBD" domain that
influences nucleic acid binding. Finally, substrate binding by the
retroviral enzymes can either be a property of the RNase H domain
itself (e.g., Moloney murine leukemia virus) or may require the
reverse transcriptase domain to provide sufficient affinity for the
nucleic acid substrate (e.g., HIV) (Hostomsky et al., 1993; Smith
et al., 1994).
[0135] The HBV RNase H is a NTS enzyme. Mutational analysis of the
HBV RNase H revealed the DEDD active site residues to be D702,
E731, D750, and D790 (numbering for HBV strain adw2) (Gerelsaikhan
et al., 1996; Tavis et al., 2013). Data obtained with the HBV RNase
H will be used as an example to establish how anti-RNase H drug
discovery can be conducted and to establish utility of the claimed
compounds against HBV replication.
[0136] HIV reverse transcription requires a virally encoded RNase H
activity to remove the viral RNA after it has been copied into DNA
(Freed and Martin, 2007). Consequently, the HIV RNase H activity
has attracted much attention as a drug target (Billamboz et al.,
2011; Bokesch et al., 2008; Budihas et al., 2005; Chung et al.,
2011; Chung et al., 2010; Di et al., 2010; Didierjean et al., 2005;
Fuji et al., 2009; Himmel et al., 2009; Himmel et al., 2006;
Kirschberg et al., 2009; Klarmann et al., 2002; Klumpp et al.,
2003; Klumpp and Mirzadegan, 2006; Shaw-Reid et al., 2003; Su et
al., 2010; Takada et al., 2007; Wendeler et al., 2008; Williams et
al., 2010). Over 100 anti-HIV RNase H compounds, based on a wide
variety of chemical scaffolds, have been reported (Chung et al.,
2011; Klumpp and Mirzadegan, 2006). They typically have inhibitory
concentration-50% (IC.sub.50) values in the low M range. The large
majority of these compounds inhibit the RNase H by chelating
divalent cations in the active site (Billamboz et al., 2011; Chung
et al., 2011; Fuji et al., 2009; Himmel et al., 2009; Kirschberg et
al., 2009; Su et al., 2010), but compounds that alter the enzyme's
conformation or its interaction with nucleic acids have also been
reported (Himmel et al., 2006; Wendeler et al., 2008). The
inhibitors typically have EC.sub.50 values .about.10.times. higher
than the IC.sub.50 values, and they often cause modest
cytotoxicity, leading to therapeutic indexes (TI) that are usually
<10. Second-generation inhibitors with substantially improved
efficacy have been reported, (Billamboz et al., 2011; Chung et al.,
2011; Williams et al., 2010), and compounds with efficacy and TI
values appropriate for a human drug exist (Himmel et al., 2006;
Williams et al., 2010).
[0137] None of the anti-HIV RNase H compounds have entered clinical
trials yet. This is due in part to their relatively low TI values
but also to the large number of approved and developmental anti-HIV
drugs, raising doubts about the marketability of anti-HIV RNase H
compounds. Despite these challenges, the HIV RNase H remains a
target of intensive ongoing drug development, as is evidenced by
the large number of groups working in the field (Billamboz et al.,
2011; Bokesch et al., 2008; Budihas et al., 2005; Chung et al.,
2011; Chung et al., 2010; Di et al., 2010; Didierjean et al., 2005;
Fuji et al., 2009; Himmel et al., 2009; Himmel et al., 2006;
Kirschberg et al., 2009; Klarmann et al., 2002; Klumpp et al.,
2003; Klumpp and Mirzadegan, 2006; Shaw-Reid et al., 2003; Su et
al., 2010; Takada et al., 2007; Wendeler et al., 2008; Williams et
al., 2010).
[0138] Because both the RNase H and integrase are NTS enzymes, some
anti-RNase H compounds can inhibit the HIV integrase, and some
anti-integrase compounds can inhibit the RNase H (Klarmann et al.,
2002, Williams et al., 2010 and Billamboz et al., 2011). Despite
this cross-inhibitory potential, resistance mutations to HIV DNA
polymerase or integrase drugs have not led to cross-resistance to
RNase H inhibitors (Billamboz et al., 2011 and Himmel et al.,
2006).
[0139] HBV reverse transcription requires two viral enzymatic
activities that are both located on the viral reverse transcriptase
protein. The DNA polymerase activity synthesizes new DNA and is
targeted by the nucleos(t)ide analogs. The RNase H destroys the
viral RNA after it has been copied into DNA. Inhibiting the RNAse H
would block DNA synthesis and consequently halt viral replication,
but anti-HBV RNase H drugs have not been developed because enzyme
suitable for drug screening could not be readily made. One of the
inventors recently produced active recombinant HBV RNase H and
identified 35 inhibitors of the RNase H (Table 1; Tavis et al.,
2013; Hu et al., 2013; Tavis and Lomonosova, 2015; Lu, et al.,
2015; and Cai, et al., 2014).
[0140] These examples of cross-inhibition of NTS enzymes by RNase H
and integrase inhibitors provide the precedent upon which the
studies with the herpesviruses rest.
D. CHEMICAL ENTITY
[0141] The compound of the present disclosure appears to inhibit a
different enzymatic activity than the existing anti-hepatitis or
anti-herpesvirus drugs, and does so with a striking capacity to
suppress virus replication at very low toxicity to uninfected
cells. This implies that it will be effective against viral
isolates resistant to the existing drugs and suggests that these
drugs could be combined effectively with the existing drugs to both
increase efficacy and to reduce the rate of resistance development
to either drug. Furthermore, the compound was more effective
against HSV-2 than a currently accepted first line therapy,
acyclovir, indicating that it may be more effective than the
existing drugs when formulated for pharmaceutical delivery. In
other embodiments, the present compounds may be used to treat
infections of hepatitis B virus or used in combination with other
hepatitis B virus therapies.
[0142] The compound of the present disclosure is represented by the
formula below:
##STR00018##
[0143] wherein: [0144] R.sub.1 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.18), heteroaryl.sub.(C.ltoreq.12),
alkylamino.sub.(C.ltoreq.12), dialkylamino.sub.(C.ltoreq.12),
arylamino.sub.(C.ltoreq.12), diarylamino.sub.(C.ltoreq.12),
aralkylamino.sub.(C.ltoreq.18), diaralkylamino.sub.(C.ltoreq.18),
or a substituted version of any of these groups; [0145] R.sub.2 is
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); and [0146] R.sub.3 is hydrogen, amino,
carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or
sulfonylamine; or [0147] alkyl.sub.(C.ltoreq.8),
aryl.sub.(C.ltoreq.8), acyl.sub.(C.ltoreq.8),
alkoxy.sub.(C.ltoreq.8), acyloxy.sub.(C.ltoreq.8),
amido.sub.(C.ltoreq.8), or substituted version of any of these
groups; [0148] X.sub.2 is hydrogen or --C(O)R.sub.a, wherein:
R.sub.a is hydroxy, alkoxy.sub.(C.ltoreq.8), or substituted
alkoxy.sub.(C.ltoreq.8); or
[0149] a compound of the formula:
##STR00019##
[0150] wherein: [0151] R.sub.4 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0152] R.sub.5 and R.sub.8 are each independently
hydrogen, alkyl.sub.(C.ltoreq.8), or substituted
alkyl.sub.(C.ltoreq.8); [0153] R.sub.6 is hydrogen, hydroxy,
alkyl.sub.(C.ltoreq.8), or substituted alkyl.sub.(C.ltoreq.8); and
[0154] R.sub.7 is aryl.sub.(C.ltoreq.12),
aralkyl.sub.(C.ltoreq.12), heteroaryl.sub.(C.ltoreq.12), or a
substituted version of any of these groups;
[0155] a compound of the formula:
##STR00020##
[0156] wherein: [0157] R.sub.9 is alkyl.sub.(C.ltoreq.12),
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; [0158] R.sub.10 is hydrogen, alkyl.sub.(C.ltoreq.8),
or substituted alkyl.sub.(C.ltoreq.8); and [0159] R.sub.11 is
hydrogen or Y.sub.1--O--X.sub.1--OR.sub.12; wherein: [0160] Y.sub.1
is alkanediyl.sub.(C.ltoreq.8) or substituted
alkanediyl.sub.(C.ltoreq.8); [0161] X.sub.1 is
arenediyl.sub.(C.ltoreq.12), heteroarenediyl.sub.(C.ltoreq.12), or
a substituted version of either of these groups; [0162] R.sub.12 is
aryl.sub.(C.ltoreq.12), aralkyl.sub.(C.ltoreq.12),
heteroaryl.sub.(C.ltoreq.12), or a substituted version of any of
these groups; or
##STR00021##
[0162] or a pharmaceutically acceptable salt or tautomer
thereof.
TABLE-US-00001 TABLE 1 Non-Limiting Examples of Compounds Com-
pound ID Structure #41 ##STR00022## #49 ##STR00023## #150
##STR00024## #151 ##STR00025## #191 ##STR00026## #208 ##STR00027##
#210 ##STR00028## #211 ##STR00029##
[0163] The compound of the disclosure contains one or more
asymmetrically-substituted carbon or nitrogen atoms, and may be
isolated in optically active or racemic form. Thus, all chiral,
diastereomeric, racemic form, epimeric form, and all geometric
isomeric forms of the chemical formula are intended, unless the
specific stereochemistry or isomeric form is specifically
indicated. The compound may occur as a racemate and racemic
mixtures, single enantiomers, diastereomeric mixtures and
individual diastereomers. In some embodiments, a single enantiomer
or diastereomer is obtained. The chiral centers of the compound of
the present disclosure can have the S or the R configuration.
[0164] Chemical formulas used to represent the compound of the
disclosure will typically only show one of possibly several
different tautomers. For example, many types of ketone groups are
known to exist in equilibrium with corresponding enol groups.
Regardless of which tautomer is depicted for a given compound, and
regardless of which one is most prevalent, all tautomers of a given
chemical formula are intended.
[0165] The compound of the disclosure may also have the advantage
of being more efficacious than, be less toxic than, be longer
acting than, be more potent than, produce fewer side effects than,
be more easily absorbed than, and/or have a better pharmacokinetic
profile (e.g., higher oral bioavailability and/or lower clearance)
than, and/or have other useful pharmacological, physical, or
chemical properties over, compounds known in the prior art, whether
for use in the indications stated herein or otherwise.
[0166] In addition, atoms making up the compound of the present
disclosure are intended to include all isotopic forms of such
atoms. Isotopes, as used herein, include those atoms having the
same atomic number but different mass numbers. By way of general
example and without limitation, isotopes of hydrogen include
tritium and deuterium, and isotopes of carbon include .sup.13C and
.sup.14C. Similarly, it is contemplated that one or more carbon
atom(s) of a compound of the present disclosure may be replaced by
a silicon atom(s). Furthermore, it is contemplated that one or more
oxygen atom(s) of a compound of the present disclosure may be
replaced by a sulfur or selenium atom(s).
[0167] The compound of the present disclosure may also exist in
prodrug form. Since prodrugs are known to enhance numerous
desirable qualities of pharmaceuticals (e.g., solubility,
bioavailability, manufacturing, etc.), the compound employed in
some methods of the disclosure may, if desired, be delivered in
prodrug form. Thus, the disclosure contemplates prodrugs of the
compound of the present disclosure as well as methods of delivering
prodrugs. Prodrugs of the compound employed in the disclosure may
be prepared by modifying functional groups present in the compound
in such a way that the modifications are cleaved, either in routine
manipulation or in vivo, to the parent compound. Accordingly,
prodrugs include, for example, compounds described herein in which
a hydroxy group is bonded to any group that, when the prodrug is
administered to a subject, cleaves to form a hydroxy group.
[0168] It should be recognized that the particular anion or cation
forming a part of any salt of this disclosure is not critical, so
long as the salt, as a whole, is pharmacologically acceptable.
Additional examples of pharmaceutically acceptable salts and their
methods of preparation and use are presented in Handbook of
Pharmaceutical Salts: Properties, and Use (2002), which is
incorporated herein by reference.
2. Definitions
[0169] When used in the context of a chemical group: "hydrogen"
means --H; "hydroxy" means --OH; "oxo" means .dbd.O; "carbonyl"
means --C(.dbd.O)--; "carboxy" means --C(.dbd.O)OH (also written as
--COOH or --CO.sub.2H); "halo" means independently --F, --Cl, --Br
or --I; "amino" means --NH.sub.2; "hydroxyamino" means --NHOH;
"nitro" means --NO.sub.2; imino means .dbd.NH; "cyano" means --CN;
"isocyanate" means --N.dbd.C.dbd.O; "azido" means --N.sub.3; in a
monovalent context "phosphate" means --OP(O)(OH).sub.2 or a
deprotonated form thereof; in a divalent context "phosphate" means
--OP(O)(OH)O-- or a deprotonated form thereof; "mercapto" means
--SH; and "thio" means=S; "sulfonyl" means --S(O).sub.2--; and
"sulfinyl" means --S(O)--.
[0170] In the context of chemical formulas, the symbol "--" means a
single bond, "=" means a double bond, and "" means triple bond. The
symbol "" represents an optional bond, which if present is either
single or double. The symbol "" represents a single bond or a
double bond. Thus, the formula
##STR00030##
covers, for example,
##STR00031##
And it is understood that no one such ring atom forms part of more
than one double bond. Furthermore, it is noted that the covalent
bond symbol "--", when connecting one or two stereogenic atoms,
does not indicate any preferred stereochemistry. Instead, it covers
all stereoisomers as well as mixtures thereof. The symbol "", when
drawn perpendicularly across a bond (e.g.,
##STR00032##
for methyl) indicates a point of attachment of the group. It is
noted that the point of attachment is typically only identified in
this manner for larger groups in order to assist the reader in
unambiguously identifying a point of attachment. The symbol ""
means a single bond where the group attached to the thick end of
the wedge is "out of the page." The symbol "" means a single bond
where the group attached to the thick end of the wedge is "into the
page". The symbol "" means a single bond where the geometry around
a double bond (e.g., either E or Z) is undefined. Both options, as
well as combinations thereof are therefore intended. Any undefined
valency on an atom of a structure shown in this application
implicitly represents a hydrogen atom bonded to that atom. A bold
dot on a carbon atom indicates that the hydrogen attached to that
carbon is oriented out of the plane of the paper.
[0171] When a group "R" is depicted as a "floating group" on a ring
system, for example, in the formula:
##STR00033##
then R may replace any hydrogen atom attached to any of the ring
atoms, including a depicted, implied, or expressly defined
hydrogen, so long as a stable structure is formed. When a group "R"
is depicted as a "floating group" on a fused ring system, as for
example in the formula:
##STR00034##
then R may replace any hydrogen attached to any of the ring atoms
of either of the fused rings unless specified otherwise.
Replaceable hydrogens include depicted hydrogens (e.g., the
hydrogen attached to the nitrogen in the formula above), implied
hydrogens (e.g., a hydrogen of the formula above that is not shown
but understood to be present), expressly defined hydrogens, and
optional hydrogens whose presence depends on the identity of a ring
atom (e.g., a hydrogen attached to group X, when X equals --CH--),
so long as a stable structure is formed. In the example depicted, R
may reside on either the 5-membered or the 6-membered ring of the
fused ring system. In the formula above, the subscript letter "y"
immediately following the group "R" enclosed in parentheses,
represents a numeric variable. Unless specified otherwise, this
variable can be 0, 1, 2, or any integer greater than 2, only
limited by the maximum number of replaceable hydrogen atoms of the
ring or ring system.
[0172] For the chemical groups and compound classes, the number of
carbon atoms in the group or class is as indicated as follows: "Cn"
defines the exact number (n) of carbon atoms in the group/class.
"C.ltoreq.n" defines the maximum number (n) of carbon atoms that
can be in the group/class, with the minimum number as small as
possible for the group/class in question, e.g., it is understood
that the minimum number of carbon atoms in the group
"alkenyl.sub.(C.ltoreq.8)" or the class "alkene.sub.(C.ltoreq.8)"
is two. Compare with "alkoxy.sub.(C.ltoreq.10)", which designates
alkoxy groups having from 1 to 10 carbon atoms. "Cn-n'" defines
both the minimum (n) and maximum number (n') of carbon atoms in the
group. Thus, "alkyl.sub.(C.ltoreq.10)" designates those alkyl
groups having from 2 to 10 carbon atoms. These carbon number
indicators may precede or follow the chemical groups or class it
modifies and it may or may not be enclosed in parenthesis, without
signifying any change in meaning. Thus, the terms "C5 olefin",
"C5-olefin", "olefin.sub.(C5)", and "olefin.sub.C5" are all
synonymous. When any of the chemical groups or compound classes
defined herein is modified by the term "substituted", any carbon
atom(s) in a moiety replacing a hydrogen atom is not counted. Thus
methoxyhexyl, which has a total of seven carbon atoms, is an
example of a substituted alkyl.sub.(C1-6).
[0173] The term "saturated" when used to modify a compound or
chemical group means the compound or chemical group has no
carbon-carbon double and no carbon-carbon triple bonds, except as
noted below. When the term is used to modify an atom, it means that
the atom is not part of any double or triple bond. In the case of
substituted versions of saturated groups, one or more carbon oxygen
double bond or a carbon nitrogen double bond may be present. And
when such a bond is present, then carbon-carbon double bonds that
may occur as part of keto-enol tautomerism or imine/enamine
tautomerism are not precluded. When the term "saturated" is used to
modify a solution of a substance, it means that no more of that
substance can dissolve in that solution.
[0174] The term "aliphatic" when used without the "substituted"
modifier signifies that the compound or chemical group so modified
is an acyclic or cyclic, but non-aromatic hydrocarbon compound or
group. In aliphatic compounds/groups, the carbon atoms can be
joined together in straight chains, branched chains, or
non-aromatic rings (alicyclic). Aliphatic compounds/groups can be
saturated, that is joined by single carbon-carbon bonds
(alkanes/alkyl), or unsaturated, with one or more carbon-carbon
double bonds (alkenes/alkenyl) or with one or more carbon-carbon
triple bonds (alkynes/alkynyl).
[0175] The term "aromatic" when used to modify a compound or a
chemical group refers to a planar unsaturated ring of atoms with
4n+2 electrons in a fully conjugated cyclic it system.
[0176] The term "alkyl" when used without the "substituted"
modifier refers to a monovalent saturated aliphatic group with a
carbon atom as the point of attachment, a linear or branched
acyclic structure, and no atoms other than carbon and hydrogen. The
groups --CH.sub.3 (Me), --CH.sub.2CH.sub.3 (Et),
--CH.sub.2CH.sub.2CH.sub.3 (n-Pr or propyl), --CH(CH.sub.3).sub.2
(i-Pr, .sup.iPr or isopropyl), --CH.sub.2CH.sub.2CH.sub.2CH.sub.3
(n-Bu), --CH(CH.sub.3)CH.sub.2CH.sub.3 (sec-butyl),
--CH.sub.2CH(CH.sub.3).sub.2 (isobutyl), --C(CH.sub.3).sub.3
(tert-butyl, t-butyl, t-Bu or .sup.tBu), and
--CH.sub.2C(CH.sub.3).sub.3 (neo-pentyl) are non-limiting examples
of alkyl groups. The term "alkanediyl" when used without the
"substituted" modifier refers to a divalent saturated aliphatic
group, with one or two saturated carbon atom(s) as the point(s) of
attachment, a linear or branched acyclic structure, no
carbon-carbon double or triple bonds, and no atoms other than
carbon and hydrogen. The groups --CH.sub.2-(methylene),
--CH.sub.2CH.sub.2--, --CH.sub.2C(CH.sub.3).sub.2CH.sub.2--, and
--CH.sub.2CH.sub.2CH.sub.2-- are non-limiting examples of
alkanediyl groups. The term "alkylidene" when used without the
"substituted" modifier refers to the divalent group .dbd.CRR' in
which R and R' are independently hydrogen or alkyl. Non-limiting
examples of alkylidene groups include: .dbd.CH.sub.2,
.dbd.CH(CH.sub.2CH.sub.3), and .dbd.C(CH.sub.3).sub.2. An "alkane"
refers to the class of compounds having the formula H--R, wherein R
is alkyl as this term is defined above. When any of these terms is
used with the "substituted" modifier one or more hydrogen atom has
been independently replaced by --OH, --F, --Cl, --Br, --I,
--NH.sub.2, --NO.sub.2, --CO.sub.2H, --CO.sub.2CH.sub.3, --CN,
--SH, --OCH.sub.3, --OCH.sub.2CH.sub.3, --C(O)CH.sub.3,
--NHCH.sub.3, --NHCH.sub.2CH.sub.3, --N(CH.sub.3).sub.2,
--C(O)NH.sub.2, --C(O)NHCH.sub.3, --C(O)N(CH.sub.3).sub.2,
--OC(O)CH.sub.3, --NHC(O)CH.sub.3, --S(O).sub.2OH, or
--S(O).sub.2NH.sub.2. The following groups are non-limiting
examples of substituted alkyl groups: --CH.sub.2OH, --CH.sub.2Cl,
--CF.sub.3, --CH.sub.2CN, --CH.sub.2C(O)OH,
--CH.sub.2C(O)OCH.sub.3, --CH.sub.2C(O)NH.sub.2,
--CH.sub.2C(O)CH.sub.3, --CH.sub.2OCH.sub.3,
--CH.sub.2OC(O)CH.sub.3, --CH.sub.2NH.sub.2,
--CH.sub.2N(CH.sub.3).sub.2, and --CH.sub.2CH.sub.2Cl.
[0177] The term "aryl" when used without the "substituted" modifier
refers to a monovalent unsaturated aromatic group with an aromatic
carbon atom as the point of attachment, said carbon atom forming
part of a one or more six-membered aromatic ring structure, wherein
the ring atoms are all carbon, and wherein the group consists of no
atoms other than carbon and hydrogen. If more than one ring is
present, the rings may be fused or unfused. As used herein, the
term does not preclude the presence of one or more alkyl or aralkyl
groups (carbon number limitation permitting) attached to the first
aromatic ring or any additional aromatic ring present. Non-limiting
examples of aryl groups include phenyl (Ph), methylphenyl,
(dimethyl)phenyl, --C.sub.6H.sub.4CH.sub.2CH.sub.3 (ethylphenyl),
naphthyl, and a monovalent group derived from biphenyl. The term
"arenediyl" when used without the "substituted" modifier refers to
a divalent aromatic group with two aromatic carbon atoms as points
of attachment, said carbon atoms forming part of one or more
six-membered aromatic ring structure(s) wherein the ring atoms are
all carbon, and wherein the monovalent group consists of no atoms
other than carbon and hydrogen. As used herein, the term does not
preclude the presence of one or more alkyl, aryl or aralkyl groups
(carbon number limitation permitting) attached to the first
aromatic ring or any additional aromatic ring present. If more than
one ring is present, the rings may be fused or unfused. Unfused
rings may be connected via one or more of the following: a covalent
bond, alkanediyl, or alkenediyl groups (carbon number limitation
permitting). Non-limiting examples of arenediyl groups include:
##STR00035##
An "arene" refers to the class of compounds having the formula
H--R, wherein R is aryl as that term is defined above. Benzene and
toluene are non-limiting examples of arenes. When any of these
terms are used with the "substituted" modifier one or more hydrogen
atom has been independently replaced by --OH, --F, --Cl, --Br, --I,
--NH.sub.2, --NO.sub.2, --CO.sub.2H, --CO.sub.2CH.sub.3, --CN,
--SH, --OCH.sub.3, --OCH.sub.2CH.sub.3, --C(O)CH.sub.3,
--NHCH.sub.3, --NHCH.sub.2CH.sub.3, --N(CH.sub.3).sub.2,
--C(O)NH.sub.2, --C(O)NHCH.sub.3, --C(O)N(CH.sub.3).sub.2,
--OC(O)CH.sub.3, --NHC(O)CH.sub.3, --S(O).sub.2OH, or
--S(O).sub.2NH.sub.2.
[0178] The term "aralkyl" when used without the "substituted"
modifier refers to the monovalent group -alkanediyl-aryl, in which
the terms alkanediyl and aryl are each used in a manner consistent
with the definitions provided above. Non-limiting examples are:
phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl
is used with the "substituted" modifier one or more hydrogen atom
from the alkanediyl and/or the aryl group has been independently
replaced by --OH, --F, --Cl, --Br, --I, --NH.sub.2, --NO.sub.2,
--CO.sub.2H, --CO.sub.2CH.sub.3, --CN, --SH, --OCH.sub.3,
--OCH.sub.2CH.sub.3, --C(O)CH.sub.3, --NHCH.sub.3,
--NHCH.sub.2CH.sub.3, --N(CH.sub.3).sub.2, --C(O)NH.sub.2,
--C(O)NHCH.sub.3, --C(O)N(CH.sub.3).sub.2, --OC(O)CH.sub.3,
--NHC(O)CH.sub.3, --S(O).sub.2OH, or --S(O).sub.2NH.sub.2.
Non-limiting examples of substituted aralkyls are:
(3-chlorophenyl)-methyl, and 2-chloro-2-phenyl-eth-1-yl.
[0179] The term "heteroaryl" when used without the "substituted"
modifier refers to a monovalent aromatic group with an aromatic
carbon atom or nitrogen atom as the point of attachment, said
carbon atom or nitrogen atom forming part of one or more aromatic
ring structures wherein at least one of the ring atoms is nitrogen,
oxygen or sulfur, and wherein the heteroaryl group consists of no
atoms other than carbon, hydrogen, aromatic nitrogen, aromatic
oxygen and aromatic sulfur. If more than one ring is present, the
rings may be fused or unfused. As used herein, the term does not
preclude the presence of one or more alkyl, aryl, and/or aralkyl
groups (carbon number limitation permitting) attached to the
aromatic ring or aromatic ring system. Non-limiting examples of
heteroaryl groups include furanyl, imidazolyl, indolyl, indazolyl
(Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl,
pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl,
quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl,
thienyl, and triazolyl. The term "N-heteroaryl" refers to a
heteroaryl group with a nitrogen atom as the point of attachment. A
"heteroarene" refers to the class of compounds having the formula
H--R, wherein R is heteroaryl. Pyridine and quinoline are
non-limiting examples of heteroarenes. When these terms are used
with the "substituted" modifier one or more hydrogen atom has been
independently replaced by --OH, --F, --Cl, --Br, --I, --NH.sub.2,
--NO.sub.2, --CO.sub.2H, --CO.sub.2CH.sub.3, --CN, --SH,
--OCH.sub.3, --OCH.sub.2CH.sub.3, --C(O)CH.sub.3, --NHCH.sub.3,
--NHCH.sub.2CH.sub.3, --N(CH.sub.3).sub.2, --C(O)NH.sub.2,
--C(O)NHCH.sub.3, --C(O)N(CH.sub.3).sub.2, --OC(O)CH.sub.3,
--NHC(O)CH.sub.3, --S(O).sub.2OH, or --S(O).sub.2NH.sub.2.
[0180] The term "acyl" when used without the "substituted" modifier
refers to the group --C(O)R, in which R is a hydrogen, alkyl,
cycloalkyl, or aryl as those terms are defined above. The groups,
--CHO, --C(O)CH.sub.3 (acetyl, Ac), --C(O)CH.sub.2CH.sub.3,
--C(O)CH(CH.sub.3).sub.2, --C(O)CH(CH.sub.2).sub.2,
--C(O)C.sub.6H.sub.5, and --C(O)C.sub.6H.sub.4CH.sub.3 are
non-limiting examples of acyl groups. A "thioacyl" is defined in an
analogous manner, except that the oxygen atom of the group --C(O)R
has been replaced with a sulfur atom, --C(S)R. The term "aldehyde"
corresponds to an alkyl group, as defined above, attached to a
--CHO group. When any of these terms are used with the
"substituted" modifier one or more hydrogen atom (including a
hydrogen atom directly attached to the carbon atom of the carbonyl
or thiocarbonyl group, if any) has been independently replaced by
--OH, --F, --Cl, --Br, --I, --NH.sub.2, --NO.sub.2, --CO.sub.2H,
--CO.sub.2CH.sub.3, --CN, --SH, --OCH.sub.3, --OCH.sub.2CH.sub.3,
--C(O)CH.sub.3, --NHCH.sub.3, --NHCH.sub.2CH.sub.3,
--N(CH.sub.3).sub.2, --C(O)NH.sub.2, --C(O)NHCH.sub.3,
--C(O)N(CH.sub.3).sub.2, --OC(O)CH.sub.3, --NHC(O)CH.sub.3,
--S(O).sub.2OH, or --S(O).sub.2NH.sub.2. The groups,
--C(O)CH.sub.2CF.sub.3, --CO.sub.2H (carboxyl), --CO.sub.2CH.sub.3
(methylcarboxyl), --CO.sub.2CH.sub.2CH.sub.3, --C(O)NH.sub.2
(carbamoyl), and --CON(CH.sub.3).sub.2, are non-limiting examples
of substituted acyl groups.
[0181] The term "alkoxy" when used without the "substituted"
modifier refers to the group --OR, in which R is an alkyl, as that
term is defined above. Non-limiting examples include: --OCH.sub.3
(methoxy), --OCH.sub.2CH.sub.3 (ethoxy),
--OCH.sub.2CH.sub.2CH.sub.3, --OCH(CH.sub.3).sub.2 (isopropoxy),
--OC(CH.sub.3).sub.3 (tert-butoxy), --OCH(CH.sub.2).sub.2,
--O-cyclopentyl, and --O-cyclohexyl. The terms "cycloalkoxy",
"alkenyloxy", "alkynyloxy", "aryloxy", "aralkoxy", "heteroaryloxy",
"heterocycloalkoxy", and "acyloxy", when used without the
"substituted" modifier, refers to groups, defined as --OR, in which
R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl,
heterocycloalkyl, and acyl, respectively. The term "alkylthio" and
"acylthio" when used without the "substituted" modifier refers to
the group --SR, in which R is an alkyl and acyl, respectively. The
term "alcohol" corresponds to an alkane, as defined above, wherein
at least one of the hydrogen atoms has been replaced with a hydroxy
group. The term "ether" corresponds to an alkane, as defined above,
wherein at least one of the hydrogen atoms has been replaced with
an alkoxy group. When any of these terms is used with the
"substituted" modifier one or more hydrogen atom has been
independently replaced by --OH, --F, --Cl, --Br, --I, --NH.sub.2,
--NO.sub.2, --CO.sub.2H, --CO.sub.2CH.sub.3, --CN, --SH,
--OCH.sub.3, --OCH.sub.2CH.sub.3, --C(O)CH.sub.3, --NHCH.sub.3,
--NHCH.sub.2CH.sub.3, --N(CH.sub.3).sub.2, --C(O)NH.sub.2,
--C(O)NHCH.sub.3, --C(O)N(CH.sub.3).sub.2, --OC(O)CH.sub.3,
--NHC(O)CH.sub.3, --S(O).sub.2OH, or --S(O).sub.2NH.sub.2.
[0182] The term "alkylamino" when used without the "substituted"
modifier refers to the group --NHR, in which R is an alkyl, as that
term is defined above. Non-limiting examples include: --NHCH.sub.3
and --NHCH.sub.2CH.sub.3. The term "dialkylamino" when used without
the "substituted" modifier refers to the group --NRR', in which R
and R' can be the same or different alkyl groups, or R and R' can
be taken together to represent an alkanediyl. Non-limiting examples
of dialkylamino groups include: --N(CH.sub.3).sub.2 and
--N(CH.sub.3)(CH.sub.2CH.sub.3). The terms "cycloalkylamino",
"alkenylamino", "alkynylamino", "arylamino", "aralkylamino",
"heteroarylamino", "heterocycloalkylamino", "alkoxyamino", and
"alkylsulfonylamino" when used without the "substituted" modifier,
refers to groups, defined as --NHR, in which R is cycloalkyl,
alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl,
alkoxy, and alkylsulfonyl, respectively. A non-limiting example of
an arylamino group is --NHC.sub.6H.sub.5. The term "amido"
(acylamino), when used without the "substituted" modifier, refers
to the group --NHR, in which R is acyl, as that term is defined
above. A non-limiting example of an amido group is
--NHC(O)CH.sub.3. The term "alkylimino" when used without the
"substituted" modifier refers to the divalent group .dbd.NR, in
which R is an alkyl, as that term is defined above. When any of
these terms is used with the "substituted" modifier one or more
hydrogen atom attached to a carbon atom has been independently
replaced by --OH, --F, --Cl, --Br, --I, --NH.sub.2, --NO.sub.2,
--CO.sub.2H, --CO.sub.2CH.sub.3, --CN, --SH, --OCH.sub.3,
--OCH.sub.2CH.sub.3, --C(O)CH.sub.3, --NHCH.sub.3,
--NHCH.sub.2CH.sub.3, --N(CH.sub.3).sub.2, --C(O)NH.sub.2,
--C(O)NHCH.sub.3, --C(O)N(CH.sub.3).sub.2, --OC(O)CH.sub.3,
--NHC(O)CH.sub.3, --S(O).sub.2OH, or --S(O).sub.2NH.sub.2. The
groups --NHC(O)OCH.sub.3 and --NHC(O)NHCH.sub.3 are non-limiting
examples of substituted amido groups.
[0183] The use of the word "a" or "an," when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one."
[0184] Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects, or +/-5% of the
stated value.
[0185] The terms "comprise," "have" and "include" are open-ended
linking verbs. Any forms or tenses of one or more of these verbs,
such as "comprises," "comprising," "has," "having," "includes" and
"including," are also open-ended. For example, any method that
"comprises," "has" or "includes" one or more steps is not limited
to possessing only those one or more steps and also covers other
unlisted steps.
[0186] The term "effective," as that term is used in the
specification and/or claims, means adequate to accomplish a
desired, expected, or intended result. "Effective amount,"
"Therapeutically effective amount" or "pharmaceutically effective
amount" when used in the context of treating a patient or subject
with a compound means that amount of the compound which, when
administered to a subject or patient for treating a disease, is
sufficient to effect such treatment for the disease.
[0187] As used herein, the term "IC.sub.50" refers to an inhibitory
dose which is 50% of the maximum response obtained. This
quantitative measure indicates how much of a particular drug or
other substance (inhibitor) is needed to inhibit a given
biological, biochemical or chemical process (or component of a
process, i.e. an enzyme, cell, cell receptor or microorganism) by
half.
[0188] An "isomer" of a first compound is a separate compound in
which each molecule contains the same constituent atoms as the
first compound, but where the configuration of those atoms in three
dimensions differs.
[0189] As used herein, the term "patient" or "subject" refers to a
living vertebrate organism, such as a human, monkey, cow, sheep,
goat, dog, cat, mouse, rat, guinea pig, bird, fish or transgenic
species thereof. In certain embodiments, the patient or subject is
a primate. Non-limiting examples of human subjects are adults,
juveniles, infants and fetuses.
[0190] As generally used herein, "pharmaceutically acceptable"
refers to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues, organs, and/or bodily
fluids of human beings and animals without excessive toxicity,
irritation, allergic response, or other problems or complications
commensurate with a reasonable benefit/risk ratio.
[0191] "Pharmaceutically acceptable salts" means salts of the
compound of the present disclosure which are pharmaceutically
acceptable, as defined above, and which possess the desired
pharmacological activity. Such salts include acid addition salts
formed with inorganic acids such as hydrochloric acid, hydrobromic
acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or
with organic acids such as 1,2-ethanedisulfonic acid,
2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid,
3-phenylpropionic acid,
4,4'-methylenebis(3-hydroxy-2-ene-1-carboxylic acid),
4-methylbicyclo[2.2.2]oct-2-ene-1-carboxylic acid, acetic acid,
aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids,
aromatic sulfuric acids, benzenesulfonic acid, benzoic acid,
camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid,
cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid,
glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid,
heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid,
laurylsulfuric acid, maleic acid, malic acid, malonic acid,
mandelic acid, methanesulfonic acid, muconic acid,
o-(4-hydroxybenzoyl)benzoic acid, oxalic acid,
p-chlorobenzenesulfonic acid, phenyl-substituted alkanoic acids,
propionic acid, p-toluenesulfonic acid, pyruvic acid, salicylic
acid, stearic acid, succinic acid, tartaric acid,
tertiarybutylacetic acid, trimethylacetic acid, and the like.
Pharmaceutically acceptable salts also include base addition salts
which may be formed when acidic protons present are capable of
reacting with inorganic or organic bases. Acceptable inorganic
bases include sodium hydroxide, sodium carbonate, potassium
hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable
organic bases include ethanolamine, diethanolamine,
triethanolamine, tromethamine, N-methylglucamine and the like. It
should be recognized that the particular anion or cation forming a
part of any salt of this disclosure is not critical, so long as the
salt, as a whole, is pharmacologically acceptable. Additional
examples of pharmaceutically acceptable salts and their methods of
preparation and use are presented in Handbook of Pharmaceutical
Salts: Properties, and Use (2002).
[0192] "Prevention" or "preventing" includes: (1) inhibiting the
onset of a disease in a subject or patient which may be at risk
and/or predisposed to the disease but does not yet experience or
display any or all of the pathology or symptomatology of the
disease, and/or (2) slowing the onset of the pathology or
symptomatology of a disease in a subject or patient which may be at
risk and/or predisposed to the disease but does not yet experience
or display any or all of the pathology or symptomatology of the
disease, including reactivation.
[0193] "Prodrug" means a compound that is convertible in vivo
metabolically into an inhibitor according to the present
disclosure. The prodrug itself may or may not also have activity
with respect to a given target protein. For example, a compound
comprising a hydroxy group may be administered as an ester that is
converted by hydrolysis in vivo to the hydroxy compound. Suitable
esters that may be converted in vivo into hydroxy compounds include
acetates, citrates, lactates, phosphates, tartrates, malonates,
oxalates, salicylates, propionates, succinates, fumarates,
maleates, methylene-bis-.beta.-hydroxynaphthoate, gentisates,
isethionates, di-p-toluoyltartrates, methanesulfonates,
ethanesulfonates, benzenesulfonates, p-toluenesulfonates,
cyclohexylsulfamates, quinates, esters of amino acids, and the
like. Similarly, a compound comprising an amine group may be
administered as an amide that is converted by hydrolysis in vivo to
the amine compound.
[0194] A "stereoisomer" or "optical isomer" is an isomer of a given
compound in which the same atoms are bonded to the same other
atoms, but where the configuration of those atoms in three
dimensions differs. "Enantiomers" are stereoisomers of a given
compound that are mirror images of each other, like left and right
hands. "Diastereomers" are stereoisomers of a given compound that
are not enantiomers. Chiral molecules contain a chiral center, also
referred to as a stereocenter or stereogenic center, which is any
point, though not necessarily an atom, in a molecule bearing groups
such that an interchanging of any two groups leads to a
stereoisomer. In organic compounds, the chiral center is typically
a carbon, phosphorus or sulfur atom, though it is also possible for
other atoms to be stereocenters in organic and inorganic compounds.
A molecule can have multiple stereocenters, giving it many
stereoisomers. In compounds whose stereoisomerism is due to
tetrahedral stereogenic centers (e.g., tetrahedral carbon), the
total number of hypothetically possible stereoisomers will not
exceed 2.sup.n, where n is the number of tetrahedral stereocenters.
Molecules with symmetry frequently have fewer than the maximum
possible number of stereoisomers. A 50:50 mixture of enantiomers is
referred to as a racemic mixture. Alternatively, a mixture of
enantiomers can be enantiomerically enriched so that one enantiomer
is present in an amount greater than 50%. Typically, enantiomers
and/or diasteromers can be resolved or separated using techniques
known in the art. It is contemplated that for any stereocenter or
axis of chirality for which stereochemistry has not been defined,
that stereocenter or axis of chirality can be present in its R
form, S form, or as a mixture of the R and S forms, including
racemic and non-racemic mixtures. As used herein, the phrase
"substantially free from other stereoisomers" means that the
composition contains .ltoreq.15%, more preferably .ltoreq.10%, even
more preferably .ltoreq.5%, or most preferably .ltoreq.1% of
another stereoisomer(s).
[0195] "Effective amount," "therapeutically effective amount" or
"pharmaceutically effective amount" means that amount which, when
administered to a subject or patient for treating a disease, is
sufficient to effect such treatment for the disease.
[0196] "Treatment" or "treating" includes (1) inhibiting a disease
in a subject or patient experiencing or displaying the pathology or
symptomatology of the disease (e.g., arresting further development
of the pathology and/or symptomatology), (2) ameliorating a disease
in a subject or patient that is experiencing or displaying the
pathology or symptomatology of the disease (e.g., reversing the
pathology and/or symptomatology), and/or (3) effecting any
measurable decrease in a disease in a subject or patient that is
experiencing or displaying the pathology or symptomatology of the
disease. In some embodiments, treatment of a patient afflicted with
one of the pathological conditions described herein comprises
administering to such a patient an amount of compound described
herein which is therapeutically effective in controlling the
condition or in prolonging the survivability of the patient beyond
that expected in the absence of such treatment. As used herein, the
term "inhibition" of the condition also refers to slowing,
interrupting, arresting or stopping the condition and does not
necessarily indicate a total elimination of the condition. It is
believed that prolonging the survivability of a patient, beyond
being a significant advantageous effect in and of itself, also
indicates that the condition is beneficially controlled to some
extent.
[0197] The above definitions supersede any conflicting definition
in any reference that is incorporated by reference herein. The fact
that certain terms are defined, however, should not be considered
as indicative that any term that is undefined is indefinite.
Rather, all terms used are believed to describe the disclosure in
terms such that one of ordinary skill can appreciate the scope and
practice the present disclosure.
E. THERAPEUTIC METHODS
[0198] 1. Pharmaceutical Formulations
[0199] In particular embodiments, where clinical application of an
active ingredient is undertaken, it will be necessary to prepare a
pharmaceutical composition appropriate for the intended
application. Generally, this will entail preparing a pharmaceutical
composition that is essentially free of pyrogens, as well as any
other impurities or contaminants that could be harmful to humans or
animals. One also will generally desire to employ appropriate
buffers to render the complex stable and allow for uptake by target
cells.
[0200] Aqueous compositions of the present disclosure comprise an
effective amount of the active compound, as discussed above,
further dispersed in pharmaceutically acceptable carrier or aqueous
medium. Such compositions also are referred to as inocula. The
phrase "pharmaceutically or pharmacologically acceptable" refers to
compositions that do not produce an adverse, allergic or other
untoward reaction when administered to an animal, or a human, as
appropriate, as well as the requisite sterility for in vivo
uses.
[0201] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents and the like. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active ingredient, its use in the therapeutic compositions is
contemplated. Supplementary active ingredients also can be
incorporated into the compositions.
[0202] Solutions of therapeutic compositions can be prepared in
water suitably mixed with a surfactant, such as
hydroxypropylcellulose. Dispersions also can be prepared in
glycerol, liquid polyethylene glycols, mixtures thereof and in
oils. Under ordinary conditions of storage and use, these
preparations contain a preservative to prevent the growth of
microorganisms.
[0203] The therapeutic compositions of the present disclosure are
advantageously administered in the form of injectable compositions
either as liquid solutions or suspensions; solid forms suitable for
solution in, or suspension in, liquid prior to injection may also
be prepared. These preparations also may be emulsified. A typical
composition for such purpose comprises a pharmaceutically
acceptable carrier. For instance, the composition may contain 10
mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per
milliliter of phosphate buffered saline. Other pharmaceutically
acceptable carriers include aqueous solutions, non-toxic
excipients, including salts, preservatives, buffers and the
like.
[0204] Examples of non-aqueous solvents are propylene glycol,
polyethylene glycol, vegetable oil and injectable organic esters
such as ethyloleate. Aqueous carriers include water,
alcoholic/aqueous solutions, saline solutions, parenteral vehicles
such as sodium chloride, Ringer's dextrose, etc. Intravenous
vehicles include fluid and nutrient replenishers. Preservatives
include antimicrobial agents, anti-oxidants, chelating agents and
inert gases. The pH and exact concentration of the various
components the pharmaceutical composition are adjusted according to
well-known parameters.
[0205] Additional formulations are suitable for oral
administration. Oral formulations include such typical excipients
as, for example, pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate and the like. The compositions take the form of
solutions, suspensions, tablets, pills, capsules, sustained release
formulations or powders. When the route is topical, the form may be
a cream, ointment, a controlled release patch, salve or spray. In
some embodiments, the topical formulation by used for
administration to the skin, to mucosa membranes such as the eye,
eye lids, the genitals, the anus, or the inside of the mouth or
nose, and in particular to the cornea.
[0206] An effective amount of the therapeutic composition is
determined based on the intended goal. The term "unit dose" or
"dosage" refers to physically discrete units suitable for use in a
subject, each unit containing a predetermined quantity of the
therapeutic composition calculated to produce the desired
responses, discussed above, in association with its administration,
i.e., the appropriate route and treatment regimen. The quantity to
be administered, both according to number of treatments and unit
dose, depends on the protection desired.
[0207] Precise amounts of the therapeutic composition also depend
on the judgment of the practitioner and are peculiar to each
individual. Factors affecting dose include physical and clinical
state of the patient, the route of administration, the intended
goal of treatment and the potency, stability and toxicity of the
particular therapeutic substance.
[0208] 2. Routes of Administration
[0209] Formulations of the present disclosure are suitable for oral
administration. However, the therapeutic compositions of the
present disclosure may be administered via any common route so long
as the target tissue is available via that route. This includes
nasal, buccal, corneal, ocularly, rectal, vaginal, or topical
administration, and intradermal, subcutaneous, intramuscular,
intraperitoneal or intravenous injection. As such, compositions
would be formulated pharmaceutically in route-acceptable
compositions that include physiologically acceptable carriers,
buffers or other excipients.
[0210] As with dosing amounts, the timing of delivery (including
intervals and total number of doses) depends on the judgment of the
practitioner and are peculiar to each individual. Factors affecting
dose include physical and clinical state of the patient, the route
of administration, the intended goal of treatment and the potency,
stability and toxicity of the particular therapeutic substance.
[0211] 3. Combination Therapy
[0212] In many clinical situations, it is advisable to use a
combination of distinct therapies. Thus, it is envisioned that, in
addition to the therapies described above, one would also wish to
provide to the patient more "traditional" pharmaceutical hepatitis
or herpesvirus therapies. Examples of standard therapies are
described above. Combinations may be achieved by administering a
single composition or pharmacological formulation that includes
both agents, or with two distinct compositions or formulations, at
the same time, wherein one composition includes the agents of the
present disclosure and the other includes the standard therapy.
Alternatively, standard therapy may precede or follow the present
agent treatment by intervals ranging from minutes to weeks to
months. In embodiments where the treatments are applied separately,
one would generally ensure that a significant period of time did
not expire between the time of each delivery, such that the agents
would still be able to exert an advantageously combined effect on
the subject. In such instances, it is contemplated that one would
administer both modalities within about 12-24 hours of each other
and, more preferably, within about 6-12 hours of each other, with a
delay time of only about 12 hours being most preferred. In some
situations, it may be desirable to extend the time period for
treatment significantly, however, where several days (2, 3, 4, 5, 6
or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the
respective administrations.
[0213] It also is conceivable that more than one administration of
either the agent of the present disclosure, or the standard therapy
will be desired. Various combinations may be employed, where the
present disclosure compound is "A" and the standard therapy is "B,"
as exemplified below:
TABLE-US-00002 A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B
A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A A/A/A/B
B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B
[0214] Other combinations are contemplated as well. Drugs suitable
for such combinations are described above and include, but are not
limited to, DNA polymerase inhibitors (nucleoside analogs),
including acyclovir, famciclovir, valaciclovir, penciclovir, and
ganciclovir. Additionally, it is contemplated that other antiviral
agents such as a pegylated interferon, interferon alfa-2b,
lamivudine, adefovir, telbivudine, entercavir, or tenofovir may be
used in combination with the compounds described herein.
E. EXAMPLES
[0215] The following examples are included to further illustrate
various aspects of the disclosure. It should be appreciated by
those of skill in the art that the techniques disclosed in the
examples which follow represent techniques and/or compositions
discovered by the inventors to function well in the practice of the
disclosure, and thus can be considered to constitute preferred
modes for its practice. However, those of skill in the art should,
in light of the present disclosure, appreciate that many changes
can be made in the specific embodiments which are disclosed and
still obtain a like or similar result without departing from the
spirit and scope of the disclosure.
[0216] 1. Materials and Methods
[0217] Cells and Viruses.
[0218] Vero cells were maintained in Dulbecco's modified Eagle's
medium (DMEM) containing 3% newborn calf serum, 3% bovine growth
serum, 2 mM L-glutamine and 100 IU/mL penicillin and 0.1 mg/mL
streptomycin (P/S). HSV-1 #6 and HSV-2 #1 are de-identified
clinical isolates from the Saint Louis University Hospital. Stocks
were prepared after a single passage in cell culture and were
titered by standard plaque assay (Knipe and Spang, 1982). Wild-type
HSV-2 used in FIG. 3 was laboratory strain 333. The TK-deficient
mutant of HSV-2 strain 333, .DELTA.TK-, contains a 180-bp KpnI-KpnI
deletion in the UL23 open reading frame that abrogates TK activity
(McDermott, et al, 1984). .DELTA.TK- was the generous gift of Jim
Smiley. Virus stocks were grown and titered on Vero cells (Morrison
and Knipe, 1996).
[0219] Compound Selection Strategy.
[0220] The compound was selected for evaluation of its ability to
inhibit HSV replication based on one or more of the following
criteria: [0221] close chemical relatives of compounds that inhibit
the HIV RNase H, the HIV integrase, or the HBV RNase H [0222]
availability from commercial sources and/or through the NCI
compound repository.
[0223] Anti-HSV-1 and -HSV-2 Replication Assay.
[0224] Compounds to be screened were diluted in PBS supplemented to
contain 2% newborn calf serum and 1% glutamine, and added in 100
.mu.L volume to confluent cell monolayers in 24-well cluster
plates. Immediately thereafter HSV-1 and HSV-2, diluted in the
supplemented PBS medium, were added to the wells in 50 .mu.l volume
such that the final concentration of compound was 50 .mu.M, 5 .mu.M
and 1 .mu.M and the multiplicity of infection was 0.1. The plates
were incubated at 37.degree. C. for 1 hour and then
virus-containing inoculum was removed and the wells were washed
once in PBS. Compound, diluted to 50 .mu.M, 5 .mu.M and 1 .mu.M in
DMEM supplemented to contain 2% newborn calf serum and 1% each
penicillin/streptomycin, was added at 0.5 mL/well. Plates were
incubated at 37.degree. C. an additional 23 hours, and then the
plates were visually inspected through a phase contrast microscope
for cytopathic effect, and for toxic effect. The entire contents of
each well were collected by scraping. Samples were frozen at
-80.degree. C., and then subsequently thawed, sonicated, and
infectious virus titer was determined by standard plaque assay on
Vero cell monolayers. Because the compounds were dissolved at 10 mM
in 100% DMSO, equivalent dilutions of DMSO were added to additional
wells as a control for effects of the diluent. Each experiment was
repeated once. EC.sub.50 values were determined as above except
that serial dilutions of the compound to be tested were prepared
starting at 50 .mu.M. The inhibitory values were calculated by
non-linear curve-fitting in GraphPad Prism.
[0225] Toxicity Assays.
[0226] Qualitative assessments of cytotoxicity were done visually
by inspecting the cells in the primary screening assays. For the
quantitative assays, cells were plated in 96-well plates at
1.0.times.10.sup.4 per well. The next day the compounds were added
at 0.78 to 100 .mu.M in a final concentration of 1% (v/v) DMSO, and
the cells were incubated for 24 hours under conditions identical to
those employed for the viral replication inhibition assays.
Mitochondrial toxicity was measured by incubating the cells with
0.25 mg/mL thiazolyl blue tetrazolium bromide (MTT, SigmaAldrich
Chemical Co.), the cultures were incubated for 60 min, metabolites
were solubilized in acidic isopropanol, and absorbance was read at
570 nm. CC.sub.50 values were calculated by non-linear curve
fitting using GraphPad Prism.
[0227] Mouse Liver Microsome Assays.
[0228] Microsomal incubations are run at a final P450 concentration
of 0.25 .mu.M. The microsomal mixture is composed of 0.1M potassium
phosphate containing 3.3 mM MgCl and 1 .mu.M compound (final
concentration). The mixture is prewarmed for 5 min at 37.degree. C.
To initiate the reaction a 12 mM stock of NAPDH (1.2 mM, final
concentration) is added to the warmed microsomal mixture and
aliquots are removed at 0, 5, 10, 20 and 30 min. Samples are
quenched with ice cold acetonitrile containing internal standard
and either 1.8 mM EDTA or EGTA (final concentration). Samples are
vortexed and spun down at 3200 rpm for 5 min. The supernant is
transferred to 96-deep well plates and run on LC/MS/MS.
[0229] RNaseH Expression and Purification.
[0230] Recombinant HBV RNaseH and human RNaseH1 were expressed in
E. coli and partially purified by nickel-affinity chromatography as
previously described in Tavis, et al. (2013). The enriched extracts
were dialyzed into 50 mM HEPES pH 7.3, 300 mM NaCl, 20% glycerol,
and 5 mM DTT and stored in liquid nitrogen.
[0231] Oligonucleotide-Directed RNA Cleavage Assay.
[0232] RNaseH activity was measured using an
oligonucleotide-directed RNA cleavage assay as previously described
in Hu, et al., Tavis, et al., and Cai, et al. (2013; 2013; and
2014, respectfully). Briefly, 6 .mu.L protein extract was mixed on
ice with an internally .sup.32P-labeled 264 nt RNA derived from the
Duck Hepatitis B Virus genome (DRF+ RNA) plus 3 .mu.g
oligonucleotide D2507- or its inverse-complement oligonucleotide
D2526+ as a negative control. This mixture was incubated with test
compounds in 50 mM Tris pH 8.0, 190 mM NaCl, 5 mM MgCl.sub.2, 3.5
mM DTT, 0.05% NP40, 6% glycerol, and 1% DMSO at 42.degree. C. for
90 minutes. Cleavage products were resolved by denaturing
polyacrylamide gel electrophoresis, detected by autoradiography,
and quantified using ImageJ. Non-specific background values were
determined from the incorrect oligonucleotide negative control lane
and subtracted from all experimental values. IC.sub.50 values were
then calculated with GraphPad Prism using three-parameter
log(inhibitor) vs. response non-linear curve fitting with the curve
minimum set to zero to reflect background subtraction.
[0233] HBV Replication Assay.
[0234] Inhibition of HBV replication was measured in HepDES19 cells
as previously described in Cai, et al. (2014). Cells were seeded
into 6-well plates and incubated in DMEM/F12, 10% fetal bovine
serum (FBS), 1% penicillin/streptomycin (P/S) with 1 .mu.g/mL
tetracycline. Tetracycline was withdrawn after 24 hours. The test
compound was applied to duplicate wells 48 hours later in medium
containing a final DMSO concentration of 1%, and medium containing
the compound was refreshed daily for the following two days. Cells
were harvested and non-encapsidated nucleic acids were digested
with micrococcal nuclease (New England Biolabs). HBV DNA was
purified from capsids using QIAamp Cador Pathogen Mini Kit (Qiagen)
with proteinase K incubation overnight at 37.degree. C. TaqMan PCR
was performed for 40 cycles at an annealing temperature of
60.degree. C. Primers and probe (IDT Inc.) for the plus-polarity
strand were: 5'CATGAACAAGAGATGATTAGGCAGAG3';
5'GGAGGCTGTAGGCATAAATTGG3';
5'/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/3IABkFQ. Primers and probe for
the minus-polarity strand were: 5' GCAGATGAGAAGGCACAGA3';
5'CTTCTCCGTCTGCCGTT3';
5'/56-FAM/AGTCCGCGT/ZEN/AAAGAGAGGTGCG/3IABkFQ.
[0235] MTT Cytotoxicity Assays.
[0236] 1.0.times.10.sup.4 HepDES19 cells per well were seeded in
96-well plates and incubated in DMEM with 10% FBS plus 1% P/S, 1%
non-essential amino acids, and 1% glutamine. Compounds were diluted
in medium to the indicated concentrations plus 1% DMSO and added to
cells 24 hours after plating, with each concentration tested in
triplicate. Medium containing the compound was refreshed daily for
the next two days. Thiazolyl blue tetrazolium bromide (MTT,
Sigma-Aldrich) was added to 0.25 mg/mL, the cultures were incubated
for 60 minutes, metabolites were solubilized in acidic isopropanol,
and absorbance was read at 570 nM.
[0237] 2. Results
[0238] Compound Selection Strategy.
[0239] This compound was selected based on its structural
similarity to polyoxygenated heterocycle compounds with
anti-microbial activity. Piroctone olamine (octopirox; #191) is an
approved antifungal in Europe. Its structure is shown in FIG. 1.
Nine napthyridinones were tested for capacity to inhibit the
nuclease activity of pUL15C (Masaoka et al., 2016). Seven of these
inhibited nuclease activity with IC.sub.50 values .ltoreq.2 .mu.M,
and two of the seven compounds (#151 and 155) strongly suppressed
HSV-1 and HSV-2 replication in cell culture at 5 .mu.M or less
(Table 2).
[0240] Primary Screening for Inhibition of HSV-1 and HSV-2
Replication.
[0241] Efficacy of this compound against both HSV-1 and HSV-2 was
initially assessed at 50, 5 and 1 .mu.M in a semi-quantitative
replication inhibition assay. Inhibition was categorized as
negligible (<1 log.sub.10 at 50 .mu.M relative to the
DMSO-treated control), intermediate (1 to 3 log.sub.10 suppression,
which equals 10- to 1,000-fold reduction), or strong (3 to 6
log.sub.10 suppression, or 1,000- to 1,000,000-fold reduction).
Compound #191 (piroctone olamine or octopirox) showed strong
inhibitory activity at 50 and 5 .mu.M against HSV-1 and HSV-2
(Table 2). Compound #191 maintained intermediate inhibition of
HSV-1 and HSV-2 even at 1 .mu.M (Table 2). Thus, it inhibited HSV-1
by 3.61 log.sub.10 (4,074-fold) and HSV-2 by 4.59 log.sub.10
(39,000-fold) at 5 .mu.M. For comparison, the approved anti-HSV
drug acyclovir inhibited HSV-1 replication in this assay by 4.22
log.sub.10 (16,600-fold) and HSV-2 by only 3.6 log.sub.10
(3,980-fold) at 5 .mu.M. Therefore, this polyoxygenated heterocycle
compound inhibits both HSV-1 and HSV-2 replication as well as or
better than acyclovir.
TABLE-US-00003 TABLE 2 HSV-1 HSV-2 Compound Number and Log.sub.10
suppression Log.sub.10 suppression Anti-human Reference 50 .mu.M 5
.mu.M 1 .mu.M EC.sub.50 50 .mu.M 5 .mu.M 1 .mu.M EC.sub.50 RNase H1
CC.sub.50 #191 (Piroctone olamine) 3.85 3.53 2.71 1.57 .mu.M 4.25
4.53 1.70 1.53 .mu.M -- >100 #208 2.63 0.15 0.26 0.11 #211 1.6
0.08 1.81 0.04 Acyclovir 5.39 3.61 nd 0.16 .mu.M 5.25 3.91 nd 1.44
.mu.M nd >100 nd, not determined.
[0242] Compound Toxicity.
[0243] Visual inspection of the infected cells at the end of the 24
hour infection window through a phase-contrast microscope revealed
substantially less cytopathic effect (CPE) than the DMSO-treated
control wells without appearance of apoptosis or necrosis.
[0244] A quantitative toxicity measurement was conducted. Toxicity
was assessed by measuring release of intracellular proteases into
the culture medium due to cellular lysis. Cells were plated in
96-well plates at 1.0.times.10.sup.4 per well. The next day
compound was added in concentrations ranging from 0.78 to 100 .mu.M
in a final concentration of 1% (v/v) DMSO. The cells were incubated
for 24 hours under conditions identical to those employed for the
viral replication inhibition assays, and then mitochondrial
activity was measured with the MTT assay (Sigma Aldrich) according
to the manufacturer's instructions. Percent viability was
determined for each compound concentration from the luminosity
data, and then 50% cytotoxic concentration (CC.sub.50) value was
calculated by non-linear curve fitting using GraphPad Prism.
Consistent with the subjective assessments of toxicity, #191 had a
CC.sub.50 value >100 .mu.M under these conditions (Table 1).
#191 did not inhibit the activity of human RNaseH1 (Table 1),
another indicator of low toxicity.
[0245] Quantitative HSV-1 and HSV-2 Replication Inhibition
Assays.
[0246] To obtain a more quantitative evaluation of the inhibitory
potential of compound #191, EC.sub.50 values were determined
against HSV-1 and HSV-2. For HSV-1, the EC.sub.50 value was 0.27
.mu.M. For HSV-2, the value was 0.60 .mu.M. For comparison,
acyclovir had an EC.sub.50 of 0.16 and 1.44 .mu.M versus HSV-1 and
HSV-2, respectively (Table 1). Overall, these quantitative data
confirmed the highly effective inhibition of HSV-1 and HSV-2 by
compound #191 in the semi-quantitative assay. They also reinforce
the observation that this compound can efficiently inhibit both
HSV-1 and HSV-2, and they strengthen the conclusion that the strong
inhibitor identified here has equivalent or superior activity
against the herpes simplex viruses than the approved drug
acyclovir.
[0247] Compound #191 suppressed replication of three primary
clinical isolates of HSV-2 by >4.7 log.sub.10 at 5 .mu.M (FIG.
2), indicating that it is active against a range of clinically
relevant virus strains.
[0248] Inhibition of an Acyclovir-Resistant HSV-2 Mutant.
[0249] ACV is a nucleoside analog prodrug that must be
phosphorylated by the viral thymidine kinase (TK) for it to become
a substrate for the viral DNA polymerase (Elion, et al., 1977). HSV
TK-deficient mutants are therefore insensitive to ACV. Because
viral resistance to ACV and other nucleoside analogs is a
significant medical problem (Field and Biron, 1994; Coen, 1991;
Wang, et al, 2011; Duan, et al., 2009; Duan, et al., 2008; Pelosi,
et al., 1992), especially in immunocompromised patients (Reyes, et
al., 2013; Levin, et al., 2004; Gilbert, et al., 2002; Schmit and
Boivin, 1999), the inventors considered whether defined
TK-deficient mutants of HSV-2 would be sensitive to other compounds
such as compound #191. Vero cells were infected with a laboratory
strain of HSV-2 and an engineered TK-deficient mutant of the same
strain. The cells were treated with 5 .mu.M ACV or compound #191 as
was done in the primary screening assays, and viral yields 24 hours
post-infection were measured by plaque assay. ACV 5 .mu.M inhibited
wild-type HSV-2 replication 100-fold, but it had little effect on
the TK- mutant (FIG. 3). In marked contrast, compound #191
efficiently inhibited the wild-type HSV-2 and the TK- mutant
strain. Therefore, this compound does not require phosphorylation
by the viral TK gene to be active, confirming that compound #191
suppress HSV-2 replication in a different manner than ACV. These
data also demonstrate that compound #191 are stronger inhibitors of
HSV-2 than ACV at 5 .mu.M.
[0250] Therapeutic Implications.
[0251] The high suppressive activities against the herpesviruses
observed with this compound (as much as 4.59 log.sub.10 at 5 .mu.M)
and its minimal short-term toxicity implies that it may be suitable
for use as an anti-viral drug. This is especially true for the
acute and/or topical therapies most commonly employed for the
herpes simplex viruses. The structure of this compound and its
already proven drugability implies that further improvements in the
inhibitory potential against the herpesviruses should be attainable
by standard medicinal chemistry approaches.
[0252] Elimination in Mouse Liver Microsomes.
[0253] Table 3 below shows the elimination profile of compounds
#191, #41, and #208. The table shows the half life, the intrinsic
clearance, the hepatic clearance, extraction ratio, and methods of
turnover. Several compounds tested in mouse liver microsomes had
long half-lives, low extraction ratios, and no evidence of non-P450
turnover (Table 3), suggesting their capacity to resist rapid
degradation and elimination by the liver.
TABLE-US-00004 TABLE 3 Polyoxygen heterocyclic compounds show
favorable resistance to elimination in mouse liver microsomes. t
1/2 CL'int CL 'hep Non-P450 Compound (min) (mL/min/kg) (mL/min/kg)
ER turn-over 208 >120 -201 163 <0.1 No 41 >120 17 14 0.16
No 191 >120 9 8 0.09 No
[0254] Summary.
[0255] The inventors here demonstrate that a polyoxygenated
heterocycle compound profoundly suppresses replication of HSV-1 and
HSV-2 with no measurable toxicity in a short-term cell culture
assay. Inhibition by this primary screening hit is equal or
superior to the approved anti-herpesvirus drug acyclovir,
particularly against HSV-2. Thus, the existing compound may already
be superior to the drugs that are used for HSV-2 infection, and
improved efficacy can readily be envisioned through standard
medicinal chemistry approaches. Its structural dissimilarity to the
nucleoside analogs implies a novel mode of action, suggesting it
would be a good candidate for combination therapy with the existing
anti-herpesvirus drugs to improve efficacy of antiviral
therapy.
[0256] 3. HBV Activity
[0257] HBV activity of some of the compounds described herein is
shown in Table 4 below.
TABLE-US-00005 TABLE 4 HBV Activity Com- Qualitative HBV pound
EC.sub.50 CC.sub.50 replication Number Compound (.mu.M) (.mu.M)
inhibition assay 151 ##STR00036## 4.7 15 ** 153 ##STR00037## 4.1 10
** 210 ##STR00038## 1.5 71 ** 208 ##STR00039## 0.69 15 ** 211
##STR00040## 13 30 ** 49 ##STR00041## ND 9 -- ** + DNA suppression
<25% and - DNA suppression >60% *+ DNA suppression <50% of
- DNA suppression ND - not determined
[0258] 4. Synergistic Activity of HBV RNAseH with Nucleoside Analog
Drug
[0259] Current nucleos(t)ide analog therapy for HBV has converted
hepatitis type B from an implacably progressing illness to a
controllable disease. However, patients are only very rarely cured,
in part due to the incomplete inhibition of HBV replication. The
inventors hypothesized that the novel RNaseH inhibitors would work
synergistically with the existing nucleos(t)ide analogs because the
two classes of drugs target physically distinct active sites on the
viral polymerase protein. Therefore, potential synergy between the
RNAseH inhibitors and the nucleoside analog Lamivudine was analyzed
using the Chou-Talalay method (Chou 2010). RNAseH inhibitors from
two different chemical classes were employed, compound #1
[2-hydroxyisoquinoline-1,3(2H,4H)-dione], an HID, and #46
(.beta.-thujaplicinol), an .alpha.-hydroxytropolone, were tested.
Chou-Talaly analysis yields a combination index (CI). CI values
<1.0 indicate synergy, CIs of approximately 1.0 indicate
additive interactions, and CI values >1.0 indicate antagonism.
CI values are calculated at various efficacy levels (EC.sub.50,
EC.sub.75, EC.sub.90, and EC.sub.95), and a weighted CI value
favoring higher efficacy levels is also generated. FIGS. 4A &
4B show the results of four experiments employing compound #1 and
three with compound #46. All experiments revealed synergistic
interactions between the RNAseH inhibitors and Lamivudine, and the
weighted CI values were 0.70.+-.0.1 for the HID compound #1 and
0.44.+-.0.3 for the .alpha.-hydroxytropolone #46. Therefore, RNAseH
inhibitors act strongly synergistically with an approved
nucleos(t)ide analog drug against HBV. This demonstrates
feasibility for employing RNAseH inhibitors in combination therapy
with the nucleos(t)ide analogs during HBV treatment.
[0260] 5. RNAseH Inhibitor Sensitivity is Insensitive to High
Genetic Variation
[0261] HBV has 8 genotypes differing in sequence by 8%. Genetic
diversity in the RNAseH domain is about 6%, which is easily high
enough to modulate viral sensitivity to RNAseH inhibitors.
Therefore, the inventors tested the RNAseH inhibitors #1
[2-hydroxyisoquinoline-1,3(2H,4H)-dione], an HID, and #46
(P3-thujaplicinol), an .alpha.-hydroxytropolone, for the ability to
inhibit variant RNAseHs. Twelve purified, patient-derived RNAseH
enzymes (4 from each genotypes B, C and D) were tested with the
compounds at their respective IC.sub.50 values in a biochemical
RNAseH assay. FIGS. 5A & 5B demonstrate that the four genotype
D enzymes each inhibited the HBV RNAseH by about 50% at the
compounds IC.sub.50 values as expected. Equivalent results were
obtained for all 12 enzymes against compounds #1 and #46.
Therefore, HBV's high genetic variation is unlikely to present a
substantial barrier to drug development.
[0262] All of the compositions and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this disclosure have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and methods, and in
the steps or in the sequence of steps of the methods described
herein without departing from the concept, spirit and scope of the
disclosure. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the disclosure as defined
by the appended claims.
F. REFERENCES
[0263] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference:
[0264] Alba et al., Genome Res., 11:43-54, 2001. [0265] Andrei and
Snoeck, Curr Opin Infect Dis. 26:551-560, 2013. [0266] Aoki et al.,
Antimicrob Agents Chemother. 39:846-849, 1995. [0267] Ariyoshi et
al., Cell 78:1063-1072, 1994. [0268] Arvin & Gilden,
Varicella-Zoster Virus, 2015-2057, 2013. [0269] Balzarini et al.,
PLoS Pathog. 9:e1003456, 2013. [0270] Bernstein et al., Antiviral
Res 92:386-388, 2011. [0271] Billamboz et al., J. Med. Chem.
54:1812-1824, 2011. [0272] Bogner et al., J Virol., 72:2259-2264,
1998. [0273] Bogner, Rev Med Virol., 12:115-127, 2002. [0274]
Bokesch et al., J. Nat. Prod. 71, 1634-1636, 2008. [0275] Bortner
et al., J Mol Biol. 231:241-250, 1993. [0276] Budihas et al.,
Nucleic Acids Res. 33, 1249-1256, 2005. [0277] Cai, et al.,
Antiviral Res., 108:48-55, 2014. [0278] Chen et al., J.
Neurovirology 8:204-210, 2002. [0279] Choi et al., Antiviral Res.
55: 279-290, 2002. [0280] Chono et al., J. Antimicrob. Chemother.
65:1733-1741, 2010. [0281] Chou, et al., Cancer Res., 70:440-446,
2010. [0282] Chung et al., J. Med. Chem. 54, 4462-4473, 2011.
[0283] Chung et al., Antimicrob. Agents Chemother. 54, 3913-3921,
2010. [0284] Clement et al., Int J Cancer 100:491-498, 2002. [0285]
Coen, Antiviral Res, 15:287-300, 1991. [0286] Coen, Viral DNA
polymerases, p. 495-523, 1996. [0287] Cohen, The New England
journal of medicine 369:255-263, 2013. [0288] Damania &
Cesarman, Kaposi's Sarcoma-Associated Herpesvirus, 2080-2128, 2013.
[0289] De et al., Curr. Opin. Infect. Dis., 28:589-595, 2015.
[0290] Decaro et al., The Veterinary clinics of North America.
Small animal practice 38:799-814, viii, 2008. [0291] Derse et al.,
J Biol Chem, 257:10251-10260, 1982. [0292] Di et al., Bioorg. Med.
Chem. Lett. 20, 398-402, 2010. [0293] Didierjean et al.,
Antimicrob. Agents Chemother. 49, 4884-4894, 2005. [0294] Drew et
al., Clin Diagn Virol. 1:179-185, 1993. [0295] Drew et al., J
Infect Dis. 179:1352-1355, 1999. [0296] Drew et al., Am J
Transplant 1:307-312, 2001. [0297] Dolan et al., J Virol
72:2010-2021, 1998. [0298] Duan et al., J Infect Dis,
200:1402-1414, 2009. [0299] Duan, et al., J Infect Dis,
198:659-663, 2008. [0300] Dyda et al., Science 266:1981-1986, 1994.
[0301] Eberhard et al., Blood 114:3064-3073, 2009. [0302] Elion et
al., Proc Natl Acad Sci USA, 74:5716-5720, 1977 [0303] Fenner et
al., Veterinary Virology, 2 ed. Academic Press, 1993. [0304] Field
and Biron, Clin Microbiol Rev, 7:1-13, 1994. [0305] Field and Vere
Hodge, Br Med Bull. 106:213-249, 2013. [0306] Fortier et al.,
Veterinary J. 186:148-156, 2010. [0307] Frank et al., Biol. Chem.
379:1407-1412, 1998. [0308] Frank et al., Proc. Natl. Acad. Sci.
USA 95:12872-12877, 1998. [0309] Freed et al., "HIVs and their
replication," in: Knipe, D. M., Howley, P. M., Griffin, D. E.,
Lamb, R. A., Martin, M. A., Roizman, B., Straus, S. E. (Eds.),
FIELDS VIROLOGY. Lippincott Williams & Wilkins, Philadelphia,
pp. 2107-2185, 2007. [0310] Fuji et al., J. Med. Chem. 52,
1380-1387, 2009. [0311] Gao et al., Virology 249:460-470, 1998.
[0312] Gaskell et al., Feline herpesvirus. Veterinary research
38:337-354, 2007. [0313] Gerelsaikhan et al., J. Virol. 70,
4269-4274, 1996. [0314] Gilbert et al., Canadian journal of public
health=Revue canadienne de sante publique, 2011. [0315] Gilbert, et
al., Drug Resist Updat, 5:88-114, 2002. [0316] Gimeno, Vaccine 26
Suppl 3:C31-41, 2008. [0317] Goedken et al., J. Biol. Chem. 276,
7266-7271, 2001. [0318] Hanauske-Abel et al., PloS One 8:e74414.
doi: 10.1371, 2013. [0319] Hanel et al., Mycoses 34 Suppl 1:91-93,
1991. [0320] Hanson et al., Viruses 3(11): 2160-2191, 2011. [0321]
Higaki et al., Cornea 25(10 Suppl 1):564-67, 2006. [0322] Himmel et
al., ACS Chem. Biol. 1:702-712, 2006. [0323] Himmel et al.,
Structure 17: 1625-1635, 2009. [0324] Hirari, Current Topics in
Microbiology and Immunology: Marek's Disease, 2001. [0325] Hoffman
et al., Cytometry 12:26-32, 1991. [0326] Horowitz et al., Journal
of American college health: J of ACH 59:69-74, 2011. [0327]
Hostomsky et al., Nulceases, vol. 2, 1993b. [0328] Hostomsky et
al., "Ribonuclease H," in: Linn, S. M., Lloyd, R. S., Roberts, R.
J. (Eds.), Nulceases. Cold Spring Harbor Laboratory Press,
Plainview, N.Y., pp. 341-376, 1993a. [0329] Hostomsky et al.,
Structure 3:131-134, 1993c. [0330] Hu et al., Antiviral Res
99:221-229, 2013. [0331] Hwang and Bogner, J Biol Chem.,
277:6943-6948, 2002. [0332] Imai et al., J Infect Dis. 189:611-615,
2004. [0333] James et al., Antiviral Res 83:207-213, 2009. [0334]
Johnston et al., Lancet 379:641-647, 2012. [0335] Kamali et al.,
Sexually transmitted infections 75:98-102, 1999. [0336] Katayanagi
et al., Nature 347: 306-309, 1990. [0337] Keck et al., J Biol.
Chem. 273, 34128-34133, 1998. [0338] Kim et al., In Vivo
25:887-893, 2011. [0339] Kimberlin, Seminars in perinatology
31:19-25, 2007. [0340] Kirschberg et al., J Med. Chem.
52:5781-5784, 2009. [0341] Klarmann et al., AIDS Rev 4: 183-194,
2002. [0342] Klumpp et al., Nucleic Acids Res. 31, 6852-6859, 2004.
[0343] Klumpp and Mirzadegan, Curr. Pharm. Des 12:1909-1922, 2006.
[0344] Knipe and Spang J Virol, 43:314-324, 1982. [0345] Ko et al.,
PLoS One 6:e27844. doi: 10.1371, 2011. [0346] Komatsu et al.,
Antiviral Res 101:12-25, 2014. [0347] Korom et al., J Virol,
87:5882-5894, 2013. [0348] Kwun et al., J Gen. Virol. 82,
2235-2241, 2001. [0349] Lai et al., Structure 8:897-904, 2000.
[0350] Levin et al., Clin Infect Dis, 39 Suppl 5:S248-257, 2004.
[0351] Li et al., Mol. Biol. Evol. 12:657-670, 1999. [0352] Lima et
al., Methods Enzymol. 341:430-440, 2001. [0353] Linden et al.,
Faseb J., 17:761-763, 2003. [0354] Liu et al., J Biol. Chem.
281:18193-18200, 2006. [0355] Longnecker et al., Epstein-Barr
Virus, 1898-1959, 2013. [0356] Looker, et al., Bull. World Health
Organ., 86:805-812, A, 2008. [0357] Lu, et al., Antimicrob. Agents
Chemother., 59(2):1070-1079, 2015. [0358] Luzuriaga & Sullivan,
N Eng J Med. 362:1993-2000, 2010. [0359] Manicklal et al., Clinical
Microbiology Rev. 26: 86-102, 2013. [0360] Marcellin et al., N
Engl. J. Med. 359: 2442-2455, 2008. [0361] Marchand, Tchesnokov,
and Gotte. J Biol Chem 282: 3337-3346, 2007. [0362] Marfori et al.,
J Clin Virol. 38:120-5, 2007. [0363] Masaoka, et al., Biochemistry,
55(5):809-819, 2016. [0364] McDermott et al., J Virol, 51:747-753,
1984. [0365] Mettenleiter et al., Virus Res. 143:222-234, 2009.
[0366] Mohni et al., J. Virol. 85:12241-12253, 2011. [0367] Morfin
and Thouvenot, J Clin Virol., 26:29-37, 2003. [0368] Morrison and
Knipe, Virology, 220:402-413, 1996. [0369] Nakagawa and Tayama,
Chem Biol Interact, 116:45-60, 1998. [0370] Nandi et al., Animal
health research reviews/Conference of Research Workers in Animal,
2009. [0371] Nauwynck et al., Veterinary Res. 38:229-241, 2007.
[0372] Nimonkar and Boehmer, J Biol Chem. 278:9678-9682, 2003.
[0373] Nowotny et al., Cell 121: 1005-1016, 2005. [0374] Nowotny,
EMBO Rep. 10:144-151, 2009. [0375] Obasi et al., J. Infectious Dis.
179:16-24, 1999. [0376] Parker et al., EMBO J. 23: 4727-4737, 2004.
[0377] Pellet & Roizman, Herpesviridae 1802-1822, 2013. [0378]
Pelosi et al., Adv Exp Med Biol, 312:151-158, 1992. [0379] Pena et
al., J. Clin. Microbiol. 48:150-153, 2010. [0380] Popovic et al.,
J. Thrombosis Thrombolysis 33:160-172, 2012. [0381] Potenza et al.,
Protein Expr. Purif 55: 93-99, 2007. [0382] Quenelle et al.,
Antivir Chem Chemother 22:131-137, 2011. [0383] Quinlan et al.,
Cell 36:857-868, 1984. [0384] Reyes et al., Arch Intern Med,
163:76-80, 2003. [0385] Roizman et al., Herpes Simplex Viruses,
1823-1897, 2013. [0386] Rosen et al., Int J Dermatol., 36:788-792,
1997. [0387] Scheffczik et al., Nucleic Acids Res., 30:1695-1703,
2002. [0388] Schmit and Boivin, J Infect Dis, 180:487-490, 1999.
[0389] Scholz et al., Nucleic Acids Res., 31:1426-1433, 2003.
[0390] Schumacher et al., PLoS Pathog. 8:e1002862, 2012. [0391]
Sehgal, Br J Dermatol. 95:83-88, 1976. [0392] Selvarajan et al., J.
Virol. 87:7140-7148, 2013. [0393] Semenova et al., Mol. Pharmacol.
69:1454-1460, 2006. [0394] Shaw-Reid et al., J. Biol. Chem. 278,
2777-2780, 2003. [0395] Smith & Roberts, J. ACH 57:389-394,
2009. [0396] Smith et al., J. Virol. 68, 5721-5729, 1994. [0397]
Smith, Veterinary J. 153:253-268, 1997. [0398] Snydman, Clin Infect
Dis. 47:883-884, 2008. [0399] Song et al., Science 305: 1434-1437,
2004. [0400] Su et al., J. Virol. 84:7625-7633, 2010. [0401] Takada
et al., J. Nat. Prod. 70, 1647-1649, 2007. [0402] Tavis and
Lomonosova, Antiviral Res., 118:132-138, 2015. [0403] Tavis et al.,
PLoS Pathogens 9:e1003125, 2013. [0404] Tavis, et al.,
Antimicrobial Agents and Chemotherapy, 58(12):7451-7461, 2014.
[0405] Tyring et al., J. Infect. Dis. 205:1100-1110, 2012. [0406]
Wald et al., N Engl J Med. 370:201-210, 2014. [0407] Wang et al.,
J. Virol. 79:14079-14087, 2005. [0408] Wang et al., J Clin Virol,
52:107-112, 2011. [0409] Weizman & Weller, Interactions between
HSV-1 and the DNA damage response, p. 257-268, 2011. [0410] Weller
& Coen, Cold Spring Harbor Perspectives in Biology 4:a013011,
2012. [0411] Weller and Kuchta, Expert Opin Ther Targets,
17:1119-1132, 2013. [0412] Wendeler et al., ACS Chem. Biol. 3,
635-644, 2008. [0413] Williams et al., Bioorg. Med. Chem. Lett.
20:6754-6757, 2010. [0414] Xu et al., JAMA 296:964-973, 2006.
[0415] Yamanishi et al., Human Herpesviruses 6 and 7, p. 2058-2079,
2013. [0416] Yan et al., M Bio 5:e01318-14, 2014. [0417] Yang et
al., Science 249: 1398-1405, 1990. [0418] Yang and Steitz,
Structure, 3, 131-134, 1995. [0419] Yao et al., Antimicrob Agents
Chemother. 58:2807-2815, 2014. [0420] Zhou et al., Int J Cancer
127:2467-2477, 2010. [0421] Zhou et al., J Virol. 88:11121-11129,
2014. [0422] Zhu et al., J. Virol. 84:7459-7472, 2010.
Sequence CWU 1
1
6126DNAArtificial sequenceSynthetic primer 1catgaacaag agatgattag
gcagag 26222DNAArtificial sequenceSynthetic primer 2ggaggctgta
ggcataaatt gg 22320DNAArtificial sequenceSynthetic primer
3ctgcgcacca gcaccatgca 20419DNAArtificial sequenceSynthetic primer
4gcagatgaga aggcacaga 19517DNAArtificial sequenceSynthetic primer
5cttctccgtc tgccgtt 17622DNAArtificial sequenceSynthetic primer
6agtccgcgta aagagaggtg cg 22
* * * * *