U.S. patent application number 15/836520 was filed with the patent office on 2018-06-07 for systems and methods for epigenetic sequencing.
The applicant listed for this patent is The General Hospital Corporation, President and Fellows of Harvard College. Invention is credited to Bradley E. Bernstein, Oren Ram, Assaf Rotem, David A. Weitz.
Application Number | 20180155778 15/836520 |
Document ID | / |
Family ID | 49117256 |
Filed Date | 2018-06-07 |
United States Patent
Application |
20180155778 |
Kind Code |
A1 |
Weitz; David A. ; et
al. |
June 7, 2018 |
SYSTEMS AND METHODS FOR EPIGENETIC SEQUENCING
Abstract
The present invention generally relates to microfluidics and/or
epigenetic sequencing. In one set of embodiments, cells contained
within a plurality of microfluidic droplets are lysed and the DNA
(e.g., from nucleosomes) within the droplets are labeled, e.g.,
with adapters containing an identification sequence. The adapters
may also contain other sequences, e.g., restriction sites, primer
sites, etc., to assist with later analysis. After labeling with
adapters, the DNA from the different cells may be combined and
analyzed, e.g., to determine epigenetic information about the
cells. For example, the DNA may be separated on the basis of
certain modifications (e.g., methylation), and the DNA from the
separated nucleosomes may be sequenced using techniques such as
chromatin immunoprecipitation ("ChIP"). In some cases, the DNA
sequences may also be aligned with genomes, e.g., to determine
which portions of the genome were epigenetically modified, e.g.,
via methylation.
Inventors: |
Weitz; David A.; (Bolton,
MA) ; Rotem; Assaf; (Newton, MA) ; Ram;
Oren; (Chestnut Hill, MA) ; Bernstein; Bradley
E.; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
President and Fellows of Harvard College
The General Hospital Corporation |
Cambridge
Boston |
MA
MA |
US
US |
|
|
Family ID: |
49117256 |
Appl. No.: |
15/836520 |
Filed: |
December 8, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15670929 |
Aug 7, 2017 |
|
|
|
15836520 |
|
|
|
|
14478672 |
Sep 5, 2014 |
|
|
|
15670929 |
|
|
|
|
PCT/US2013/029123 |
Mar 5, 2013 |
|
|
|
14478672 |
|
|
|
|
61634744 |
Mar 5, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
B01L 3/502784 20130101;
C12Q 1/6869 20130101; B01F 13/0071 20130101; C12Q 1/6869 20130101;
C12Q 2521/301 20130101; C12Q 2523/301 20130101; C12Q 2525/131
20130101; C12Q 2525/161 20130101; C12Q 2563/179 20130101; C12Q
2565/629 20130101; C12Q 1/6869 20130101; C12Q 2521/301 20130101;
C12Q 2525/131 20130101; C12Q 2525/161 20130101; C12Q 2563/159
20130101; C12Q 2563/179 20130101 |
International
Class: |
C12Q 1/6869 20180101
C12Q001/6869; B01F 13/00 20060101 B01F013/00 |
Claims
1-111. (canceled)
112. A method comprising: providing a solution comprising a
plurality of nucleic acid sequences originating from a plurality of
cells, at least some of the nucleic acid sequences being attached
to an adapter, the adapter comprising an identification sequence,
wherein sequences originating from the same cell contain identical
identification sequences, and sequences originating from different
cells contain different identification sequences, the adapter
further comprising a primer site and a cleavage site, which is
cleavable by a restriction endonuclease, wherein the adapters are
present on a solid support; and amplifying at least some of the
sequences.
113. The method of claim 112, comprising cleaving the adapter at
the cleavage site.
114. The method of claim 112, wherein the solution is contained
within a droplet.
115. The method of claim 112, wherein the plurality of nucleic acid
sequences comprises DNA.
116. The method of claim 112, wherein the plurality of nucleic acid
sequences comprises RNA.
117. The method of claim 116, wherein the RNA molecules are
barcoded or ligated with an identification sequence using
adaptors.
118. The method of claim 112, wherein the primer site comprises a
universal primer.
119. The method of claim 112, wherein the primer site comprises a
PCR primer site.
120. The method of claim 112, wherein the identification sequences
are added to each droplet and added to the fragmented DNA
sequences, providing a unique identifier for each individual
cell.
121. The method of claim 112, wherein the cleavage site is a
restriction site cleavable by a restriction endonuclease.
122. A method comprising: providing a solution comprising a
plurality of nucleic acid sequences originating from a plurality of
cells, at least some of the nucleic acid sequences being attached
to an adapter, the adapter comprising an identification sequence,
wherein sequences originating from the same cell contain identical
identification sequences, and sequences originating from different
cells contain different identification sequences; and sequencing at
least some of the sequences.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of Int. Patent
Application No. PCT/US2013/029123, filed Mar. 5, 2013, entitled
"Systems and Methods for Epigenetic Sequencing," which claims the
benefit of U.S. Provisional Patent Application Ser. No. 61/634,744,
filed Mar. 5, 2012, entitled "Systems and Methods for Epigenetic
Sequencing," by Rotem, et al., each incorporated herein by
reference.
FIELD OF INVENTION
[0002] The present invention generally relates to microfluidics
and/or epigenetic sequencing.
BACKGROUND
[0003] Epigenetics is the study of the transmission of genetic
information by mechanisms other than the DNA sequence of
nucleotides. For example, epigenetic information may be transmitted
via methylation of nucleotides within DNA (e.g., cytosine to
5-methylcytosine), or by histone modifications such as histone
acetylation or deacetylation, methylation, ubiquitylation,
phosphorylation, sumoylation, etc. Such epigenetic modifications
may affect the structure of chromatin, which is a higher-order
structure of protein, DNA and RNA within cells. Chromatin structure
is known to play an important role in regulating genome function
and in particular, its varied structure across cell types helps
ensure that the correct genes are expressed in the correct cell
types.
[0004] Most techniques for studying epigenetics typically require
large populations of cells, e.g., thousands of cells. For example,
histone modifications can be mapped by immunoprecipitating
chromatin with antibodies to a modified histone and then sequencing
the DNA (ChIP-Seq). However, this method typically requires
.about.100,000 cells or more. Furthermore, the analysis is carried
out on the entire population and is blind to differences among
cells.
[0005] In contrast, however, systems and methods for studying the
epigenomes in single cells or small numbers of cells are becoming
increasingly important for understanding the principles of
chromatin and genome regulation. Moreover, such approaches could
have many clinical applications in cancer biology, immunology,
neuroscience or other fields in which subject tissues are complex,
heterogeneous and/or limited in size. For example, tumors represent
heterogeneous mixtures of cells that may be driven by
sub-populations of cancer stem cells. Single cell epigenomic
profiling methods could improve understanding of critical
epigenomic changes in cancer stem cells. They might also enable
early detection or surveillance of disease.
SUMMARY
[0006] The present invention generally relates to microfluidics
and/or epigenetic sequencing. The subject matter of the present
invention involves, in some cases, interrelated products,
alternative solutions to a particular problem, and/or a plurality
of different uses of one or more systems and/or articles.
[0007] In one set of embodiments, the present invention is
generally directed to a method comprising acts of providing a
plurality of cells contained within a plurality of microfluidic
droplets, lysing the cells contained within the microfluidic
droplets to produce cell lysates therein, exposing at least some of
the cell lysates contained within the microfluidic droplets to a
non-nucleosome-cleaving nuclease to produce a plurality of
nucleosome sequences within the microfluidic droplets, ligating
adapters to at least some of the nucleosome sequences, the adapters
comprising an identification sequence and a restriction site, and
sequencing the nucleosome sequences containing ligated
adapters.
[0008] In another set of embodiments, the present invention is
generally directed to a method of providing a solution comprising a
plurality of nucleosome sequences originating from a plurality of
cells, at least some of the nucleosome sequences being ligated to
an adapter, the adapter comprising an identification sequence and a
restriction site, wherein nucleosome sequences originating from the
same cell contain identical identification sequences, and
nucleosome sequences originating from different cells contain
different identification sequences, and sequencing at least some of
the nucleosome sequences.
[0009] The present invention, in yet another set of embodiments, is
generally directed to a composition comprising a plurality of
droplets, at least some of which each contain a nucleosome sequence
ligated to an adapter, the adapter comprising an identification
sequence and a restriction site, wherein nucleosome sequences
originating from the same cell contain identical identification
sequences, and nucleosome sequences originating from different
cells contain different identification sequences.
[0010] In still another set of embodiments the present invention is
generally directed to a composition comprising a nucleic acid
sequence comprising an identification sequence, a restriction site,
an inversion of the restriction site, and an inversion of the
identification sequence.
[0011] In another set of embodiments, the present invention is
generally directed to a composition comprising a plurality of
palindromic or substantially palindromic nucleic acid sequence
comprising a plurality of different identification sequences each
having the same length, and a substantially identical restriction
site.
[0012] In another aspect, the present invention encompasses methods
of making one or more of the embodiments described herein. In still
another aspect, the present invention encompasses methods of using
one or more of the embodiments described herein.
[0013] Other advantages and novel features of the present invention
will become apparent from the following detailed description of
various non-limiting embodiments of the invention when considered
in conjunction with the accompanying figures. In cases where the
present specification and a document incorporated by reference
include conflicting and/or inconsistent disclosure, the present
specification shall control. If two or more documents incorporated
by reference include conflicting and/or inconsistent disclosure
with respect to each other, then the document having the later
effective date shall control.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Non-limiting embodiments of the present invention will be
described by way of example with reference to the accompanying
figures, which are schematic and are not intended to be drawn to
scale. In the figures, each identical or nearly identical component
illustrated is typically represented by a single numeral. For
purposes of clarity, not every component is labeled in every
figure, nor is every component of each embodiment of the invention
shown where illustration is not necessary to allow those of
ordinary skill in the art to understand the invention. In the
figures:
[0015] FIGS. 1A-1C illustrate a method of epigenetic sequencing in
accordance with certain embodiments of the invention;
[0016] FIGS. 2A-2B illustrate cells that are lysed and "tagged"
with adapters, in another embodiment of the invention;
[0017] FIG. 3 illustrates the structure of an adapter,
corresponding to SEQ ID NOs:5-8 top to bottom, in accordance with
another embodiment of the invention;
[0018] FIGS. 4A-4D illustrate cell preparation in another
embodiment of the invention;
[0019] FIGS. 5A-5D illustrate unique barcodes within a population
of cells, in yet another embodiment of the invention;
[0020] FIG. 6 illustrates ChIP sequencing technique, in accordance
with still another embodiment of the invention;
[0021] FIGS. 7A-7B illustrate adapters according to another
embodiment of the invention; and
[0022] FIGS. 8A-8C illustrate the study of different populations of
cells, in yet another embodiment of the invention.
DETAILED DESCRIPTION
[0023] The present invention generally relates to microfluidics
and/or epigenetic sequencing. In one set of embodiments, cells
contained within a plurality of microfluidic droplets are lysed and
the DNA (e.g., from nucleosomes) within the droplets are labeled,
e.g., with adapters containing an identification sequence. The
adapters may also contain other sequences, e.g., restriction sites,
primer sites, etc., to assist with later analysis. After labeling
with adapters, the DNA from the different cells may be combined and
analyzed, e.g., to determine epigenetic information about the
cells. For example, the DNA may be separated on the basis of
certain modifications (e.g., methylation) using techniques such as
chromatin immunoprecipitation ("ChIP"), and the DNA from the
separated nucleosomes may be sequenced and aligned with genomes,
e.g., to determine which portions of the genome were epigenetically
modified, e.g., via methylation.
[0024] Thus, various aspects of the present invention are generally
directed through DNA sequencing to determine epigenetic
information. For instance, in one set of embodiments, cells
contained within microfluidic droplets are lysed and their DNA is
exposed to certain enzymes, such as non-nucleosome-cleaving
nucleases or other enzymes that are able to cleave the DNA for
later analysis without destroying certain types of epigenetic
information, e.g., the interaction of the DNA with the histones,
the methylation patterns within DNA, etc. The DNA (still contained
within the microfluidic droplets) is then barcoded or tagged using
a ligation step with specific "adapters" that can be used to later
identify the source, down to a single cell level in some cases, of
the DNA.
[0025] After ligation of the adapters to the DNA, the DNA may then
be sequenced. In certain embodiments, droplets containing the
lysate of different cells may be combined together prior to
analysis. Due to the presence of the ligated adapters, the DNA
originating from the same cell may contain identical identification
sequences, while DNA originating from different cells may contain
different identification sequences, thereby allowing the DNA of
each cell within a sample to be separately identified and
determined. In some cases, for instance, the identification
sequences may be selected such that a certain number of cells taken
from a plurality of cells can be readily identified. For example,
an identification sequence of n nucleotides may allow for up to
4.sup.n distinct cells to be studied. Thus, even relatively small
identification sequences (e.g., 4, 5, 6, 7, 8, 9, etc. nucleotides
long) may allow for relatively large populations of cells to be
separately determined, e.g., at a single-cell level.
[0026] One non-limiting example is illustrated with reference to
FIG. 6. In this figure, a cell (containing chromatin) is contained
within a microfluidic droplet. The cell is lysed and exposed to an
enzyme such as MNase, which cleaves the DNA released from the lysed
cell into smaller fragments without substantially affecting those
portions of the DNA that interact with the histones within the
nucleosome structures. Barcodes or other adapters, which may be
formed from certain types of sequences as is discussed herein, are
added to the droplet and ligated together. Next, ChIP analysis is
performed and the DNA sequenced.
[0027] Another example of an embodiment of the invention is now
described with respect to FIG. 1. In FIG. 1A, part 1, and in FIG.
2A, a plurality of cells are contained within droplets using a
microfluidic droplet maker, e.g., within an aqueous environment
contained within an oil. Typically, the cells are encapsulated
within droplets at a density such that on average, each droplet
contains one cell (or less). Within a droplet, a cell may be lysed,
then exposed to an enzyme such as MNase, which cleaves the DNA
released from the lysed cell into smaller fragments without
substantially affecting those portions of the DNA that interact
with the histones within the nucleosome structures. Droplets
containing an adapter (as discussed below), a ligase, and/or other
components such as buffers or the like are also created separately,
as shown in FIG. 1A, part 2. Similar to FIG. 1A, part 1, the
adapters may be contained in a droplet within an aqueous
environment, contained within an oil.
[0028] A schematic diagram of an example of an adapter is shown in
FIG. 1B, part 1, and FIG. 3. The adapter in this example comprises
a sequence recognizable by a primer (e.g., a PCR primer), a
"barcode" or other identification sequence, and a restriction site
that can be cleaved by a suitable restriction endonuclease. The
identification site typically has 4-15 nucleotides, and for a
population of adapters to be used to identify a population of
cells, the identification sequence of the adapter may differ while
the rest of the adapter is substantially constant. Accordingly,
because each cell is exposed to an adapter containing a different
identification sequence, the nucleic acids arising from these cells
may be subsequently distinguished. In this example, the adapter is
palindromic or at least substantially palindromic, so that the
adapter further contains inverses of these, e.g., as part of a
double-stranded structure.
[0029] For example, FIG. 3 shows the structure of a typical adapter
attached to a length of DNA 5, including an identification region
10, a restriction site (including a recognition sequence 22 and a
cleavage sequence 24), and a primer sequence 30. Note that DNA 5 in
this example actually has two adapters, one on either side, having
the same structure. Due to the generally palindromic nature of
these adapters, the adapters cannot be added to the DNA
incorrectly, as either orientation would be correct. In addition,
in some embodiments, additional adapters could potentially be
ligated onto the ends of the adapters. However, due to subsequent
cleavage by a suitable restriction endonuclease at the cleavage
site, any unwanted or extra adapters can be readily separated from
the DNA itself, leaving just the identification sequence remaining
on one or both ends, for subsequent determination or analysis.
[0030] The droplets containing the cells may be merged with the
droplets containing the adapters, as is shown in FIG. 1B, part 2,
as well as FIG. 2B (where the tag library is formed from the
adapters). Various techniques may be used to fuse the droplets
together, and typically, the droplets are fused in a 1:1 ratio such
that a single cell (contained within a single droplet) is exposed
to a unique adapter (i.e., containing a unique identification
sequence). Within the droplets, the adapters are ligated to the DNA
released from the lysed cells. As each droplet typically contains a
unique adapter, the DNA in each droplet is uniquely identified by a
unique identification sequence. A plurality of DNA molecules is
typically found within each droplet, some or all of which are thus
labeled by the same adapter.
[0031] Next, the DNA within the droplets may be sequenced or
analyzed, as is shown in FIG. 1C, part 1. In some cases, DNA from
different droplets may be combined together prior to analysis. As
noted above, the presence of unique identification sequences on the
adapters on the DNA may allow the DNA from each of the droplets to
be analyzed and distinguished. Accordingly, for example, the DNA
(and the epigenetic profile) from a first cell can be distinguished
from the DNA from a second cell. Examples of unique identification
sequences include those discussed in U.S. Pat. Apl. Ser. No.
61/703,848, incorporated herein by reference in its entirety.
[0032] In one set of embodiments, ChIP ("chromatin
immunoprecipitation") may be used to analyze the DNA. For example,
the DNA may be amplified (e.g., using PCR via the primer
sequences), cleaved (e.g., using a restriction endonuclease that
cleaves the adapter site, for instance, BciVI as is shown in this
example), and/or ligated (e.g. using Illumina) such that the DNA is
sequenced. A non-limiting example of such analysis is shown
schematically in FIG. 1C, part 2. In this example, a plurality of
cells may each be uniquely identified (for instance, upon selection
of a suitable of nucleotides within the identification sequence),
e.g., even for populations of 100 cells, 1 million cells, etc.
However, it should be understood that other techniques could also
be used for sequencing.
[0033] The above discussion is a non-limiting example of an
embodiment of the present invention that can be used to determine
an epigenetic profile of a cell. However, other embodiments are
also possible. Accordingly, more generally, various aspects of the
invention are directed to various systems and methods for
sequencing the DNA of cells (typically contained within droplets)
to determine epigenetic information.
[0034] In one aspect, microfluidic droplets are used, for example,
to contain cells. Microfluidic droplets may be used to keep the
cells of a plurality of cells separate and identifiable, e.g., such
that epigenetic or genetic differences between the different cells
may be identified. In contrast, in many prior art techniques, a
plurality or a population of different cells may be studied for
epigenetic differences, but there is no ability to determine those
epigenetic differences on the level of an individual cell; instead,
only average epigenetic profiles of those cells can be determined.
In contrast, in certain embodiments of the present invention, a
plurality of cells, some or all of which may contain individual
epigenetic differences, may be studied, at resolutions down to the
single-cell level, for example, within microfluidic droplets or
other compartments or solutions such as those discussed herein.
[0035] The cells may arise from a human, or from a non-human
animal, for example, an invertebrate cell (e.g., a cell from a
fruit fly), a fish cell (e.g., a zebrafish cell), an amphibian cell
(e.g., a frog cell), a reptile cell, a bird cell, or a mammal cell,
such as a monkey, ape, cow, sheep, goat, horse, donkey, camel,
llama, alpaca, rabbit, pig, mouse, rat, guinea pig, hamster, dog,
cat, etc. If the cell is from a multicellular organism, the cell
may be from any part of the organism. In some embodiments, a tissue
may be studied. For example, a tissue from an organism may be
processed to produce cells (e.g., through tissue homogenization or
by laser-capturing the cells from the tissue), such that the
epigenetic differences within the tissue may be determined, as
discussed herein.
[0036] The cells or tissues may arise from a healthy organism, or
one that is diseased or suspected of being diseased. For example,
blood cells from an organism may be removed and studied to
determine epigenetic differences or changes in the epigenetic
profile of those cells, e.g., to determine if the animal is healthy
or has a disease, for example, if the animal has cancer (e.g., by
determining cancer cells within the blood). In some cases, a tumor
may be studied (e.g., using a biopsy), and the epigenetic profile
of the tumor may be determined. For instance, the cells may be
studied to determine if any of the cells are cancer stem cells.
[0037] The cells may also be determined using other techniques, in
addition to the ones discussed herein, which may assist in
determining the epigenetic profile of the cells. For example, the
cells may be studied using flow cytometry, microscopy, the cells
may be cultured, etc., to determine whether the epigenetic profile
(or changes in the epigenetic profile) correlate to other changes
in the cell, for example, expression levels of a protein, changes
in morphology, ability to reproduce or differentiate, etc.
[0038] In some aspects of the invention, a plurality of cells is
contained within a plurality of droplets or other compartments. In
some cases, the encapsulation rate may be kept low, for example,
such that the average density is about 1 cell/droplet or
compartment, or less. (In other cases, higher densities are also
possible, of course, e.g., greater than 1 cell/droplet or
compartment.) For example, the average density may be less than
about 0.95 cells/droplet or compartment, less than about 0.9
cells/droplet or compartment, less than about 0.8 cells/droplet or
compartment, less than about 0.7 cells/droplet or compartment, less
than about 0.6 cells/droplet or compartment, less than about 0.5
cells/droplet or compartment, less than about 0.4 cells/droplet or
compartment, less than about 0.3 cells/droplet or compartment, or
less than about 0.2 cells/droplet or compartment. In some cases,
the cells are contained such that no more than about 25%, no more
than about 15%, no more than about 10% no more than about 5%, no
more than about 3%, or no more than about 1% of the droplets or
compartments contains more than one cell therein. Such relatively
low densities may be useful, e.g., to avoid confusion of having
more than one cell labeled with the same identification sequence
(e.g., such that the DNA of the cell is ligated to an adapter), as
discussed below.
[0039] The droplets may be contained in a microfluidic channel. For
example, in certain embodiments, the droplets may have an average
dimension or diameter of less than about 1 mm, less than about 500
micrometers, less than about 300 micrometers, less than about 200
micrometers, less than about 100 micrometers, less than about 75
micrometers, less than about 50 micrometers, less than about 30
micrometers, less than about 25 micrometers, less than about 10
micrometers, less than about 5 micrometers, less than about 3
micrometers, or less than about 1 micrometer in some cases. The
average diameter may also be at least about 1 micrometer, at least
about 2 micrometers, at least about 3 micrometers, at least about 5
micrometers, at least about 10 micrometers, at least about 15
micrometers, or at least about 20 micrometers in certain instances.
The droplets may be spherical or non-spherical. The average
diameter or dimension of a droplet, if the droplet is
non-spherical, may be taken as the diameter of a perfect sphere
having the same volume as the non-spherical droplet.
[0040] The droplets may be produced using any suitable technique.
For example, a junction of channels may be used to create the
droplets. The junction may be, for instance, a T-junction, a
Y-junction, a channel-within-a-channel junction (e.g., in a coaxial
arrangement, or comprising an inner channel and an outer channel
surrounding at least a portion of the inner channel), a cross (or
"X") junction, a flow-focus junction, or any other suitable
junction for creating droplets. See, for example, International
Patent Application No. PCT/US2004/010903, filed Apr. 9, 2004,
entitled "Formation and Control of Fluidic Species," by Link, et
al., published as WO 2004/091763 on Oct. 28, 2004, or International
Patent Application No. PCT/US2003/020542, filed Jun. 30, 2003,
entitled "Method and Apparatus for Fluid Dispersion," by Stone, et
al., published as WO 2004/002627 on Jan. 8, 2004, each of which is
incorporated herein by reference in its entirety. In some
embodiments, the junction may be configured and arranged to produce
substantially monodisperse droplets.
[0041] In some cases, the cells may be encapsulated within the
droplets at a relatively high rate. For example, the rate of cell
encapsulation in droplets may be at least about 10 cells/s, at
least about 30 cells/s, at least about 100 cells/s, at least about
300 cells/s, at least about 1,000 cells/s, at least about 3,000
cells/s, at least about 10,000 cells/s, at least about 30,000
cells/s, at least about 100,000 cells/s, at least about 300,000
cells/s, or at least about 10.sup.6 cells/s.
[0042] The droplets may be substantially monodisperse in some
embodiments, or the droplets may have a homogenous distribution of
diameters, e.g., the droplets may have a distribution of diameters
such that no more than about 10%, no more than about 5%, no more
than about 3%, no more than about 2%, or no more than about 1% of
the droplets have a diameter less than about 90% (or less than
about 95%, less than about 97%, or less than about 99%) and/or
greater than about 110% (or greater than about 101%, greater than
about 103%, or greater than about 105%) of the overall average
diameter of the plurality of droplets. In some embodiments, the
plurality of droplets has an overall average diameter and a
distribution of diameters such that the coefficient of variation of
the cross-sectional diameters of the droplets is less than about
10%, less than about 5%, less than about 2%, between about 1% and
about 10%, between about 1% and about 5%, or between about 1% and
about 2%. The coefficient of variation may be defined as the
standard deviation divided by the mean, and can be determined by
those of ordinary skill in the art.
[0043] In some embodiments, the fluid forming the droplets is
substantially immiscible with the carrying fluid surrounding the
droplets. For example, the fluid may be hydrophilic or aqueous,
while the carrying fluid may be hydrophobic or an "oil," or vice
versa. Typically, a "hydrophilic" fluid is one that is miscible
with pure water, while a "hydrophobic" fluid is a fluid that is not
miscible with pure water. It should be noted that the term "oil,"
as used herein, merely refers to a fluid that is hydrophobic and
not miscible in water. Thus, the oil may be a hydrocarbon in some
embodiments, but in other embodiments, the oil may be (or include)
other hydrophobic fluids (for example, octanol). It should also be
noted that the hydrophilic or aqueous fluid need not be pure water.
For example, the hydrophilic fluid may be an aqueous solution, for
example, a buffer solution, a solution containing a dissolved salt,
or the like. A hydrophilic fluid may also be, or include, for
example, ethanol or other liquids that are miscible in water, e.g.,
instead of or in addition to water.
[0044] In one aspect, after the cells are contained or encapsulated
within droplets or other compartments, the cells may be lysed or
otherwise processed to release the DNA within the cells, e.g., as a
plurality of nucleosome sequences. Typically, the nucleosome
sequences are those regions of the DNA that interact with the
histones. The nucleosome sequence of the DNA typically winds around
one or more histones to produce the basic nucleosome structure,
which is subsequently packaged within the chromatin of the cell.
For example, the cells may be lysed within the droplets by
sonication (exposure to ultrasound), temperature or osmotic
changes, exposure to certain types of enzymes or chemicals (for
example, detergents such as Triton, e.g., Triton X-100), or the
like. Those of ordinary skill in the art will be aware of suitable
techniques for lysing cells to produce a cell lysate. Typically,
the cells are lysed within the droplets without breaking down the
droplets themselves, e.g., such that the cell lysate that is
subsequently produced remains within the droplets.
[0045] The DNA may also be exposed to enzymes which are able to
process the DNA without substantially affecting the epigenetic
information of interest, e.g., without substantially altering the
methylation of nucleotides within the DNA, without altering any
histone modifications that might be present, etc. For example, in
one set of embodiments, the DNA may be exposed to a
non-nucleosome-cleaving nuclease able to cleave the DNA at regions
other than where the DNA is contained within a nucleosome. Such a
nuclease may accordingly be able to cleave the DNA into smaller
fragments that can be subsequently analyzed (e.g., as discussed
herein), without substantially affecting those portions of the DNA
that interact with the histones within the nucleosome structures
(i.e., the nucleosome sequences within the DNA). Accordingly,
epigenetic information contained within the nucleosome structures
may be preserved for subsequent determination. One example of a
suitable enzyme is MNase (S7 nuclease or micrococcal nuclease),
which is available commercially. In some cases, a restriction
enzyme that targets a specific sequence may be used to digest
genomic regions having particular sequence contents, such as
GC-rich euchromatic loci.
[0046] In certain aspects, one or more adapters may be ligated or
otherwise bonded onto the DNA (or RNA, in some embodiments). The
adapter may be formed from DNA and/or RNA. The adapter may be
single-stranded or double-stranded, and in some cases, the adapters
may be palindromic or substantially palindromic, or in some cases
the adapter can be single stranded. In one set of embodiments, the
adapter may include an identification sequence and a restriction
site (and/or a portion of a restriction site), and optionally a
primer sequence. If the adapter is at least substantially
palindromic, the adapter may also contain inversions of these,
e.g., the adapter may contain an identification sequence, a
restriction site, an inversion of the restriction site, and an
inversion of the identification sequence.
[0047] One example of an adapter is shown in FIG. 7. In this
example, adapter 70 includes a portion of a restriction site 71
("site"), a first "barcode" or identification sequence 72, a second
complete restriction site 73, a second "barcode" or identification
sequence 74, and a second portion of a restriction site 75
("restriction"). Adapter 70 also includes a region 76 that can be
recognized by a primer. The adapter is joined to a stretch of
nucleic acid, such as DNA 77, to be studied (e.g., containing a
nucleosome 80 as is shown in FIG. 7, although this is just for
explanatory purposes). In some cases, the first and second portions
of the restriction site have the same sequence, e.g., for
restriction sites that are palindromic in nature.
[0048] A restriction site is a site that is recognized by a
restriction endonuclease. When the adapter is exposed to a
restriction endonuclease that recognizes the restriction site, the
restriction endonuclease may cleave the adapter within the
restriction site. Those of ordinary skill in the art will be
familiar with restriction endonucleases and restriction sites. The
restriction endonuclease may cleave the restriction site to leave
behind blunt ends or "sticky" ends (e.g., leaving an overhang with
one or more nucleotides lacking a complement). The restriction
site, in some cases, includes a recognition sequence (a specific
sequence of nucleotides, e.g., 4, 5, 6, 7, or 8 nucleotides long)
and a cleavage sequence that may be part of, or be separate from,
the recognition sequence. For instance, with the BciVI restriction
site, the restriction site includes a recognition sequence (which
is 6 nucleotides in length as is shown in FIG. 3), where the
restriction endonuclease recognizes the adapter, and a separate
cleavage sequence where the restriction endonuclease actually
cleaves the adapter (indicated by the jagged lines in FIG. 3).
Those of ordinary skill in the art will be able to identify
suitable restriction endonucleases and their restriction sites.
Over 3000 restriction enzymes have been studied in detail, and more
than 600 of these are available commercially. Non-limiting examples
include BamHI, BsrI, NotI, XmaI, PspAI, DpnI, MboI, MnlI, Eco57I,
Ksp632I, DraIII, AhaII, SmaI, MluI, HpaI, ApaI, BclI, BstEII, TaqI,
EcoRI, SacI, HindII, HaeII, DraII, Tsp509I, Sau3AI, PacI, etc.
[0049] In one set of embodiments, an adaptor may contain a portion
of a restriction site, e.g., first portions and second portions
such that, when the first portion and the second portion are
ligated or otherwise joined together, a complete restriction site.
This may be useful, for example, in cases where an adapter is
ligated to another adapter; the joined adapters, having a completed
restriction site, may be exposed to a suitable corresponding
restriction endonuclease that is able to cleave at the restriction
site, thereby removing the extraneous adapters. A non-limiting
example is shown schematically in FIG. 7. In FIG. 7A, a first
portion of the restriction site is labeled "site" and a second
portion is labeled "restriction." A corresponding restriction
endonuclease will not recognize either portion, unless the portions
are joined together to from a complete restriction site that can be
recognized by the restriction endonuclease (i.e., forming the
phrase "restriction site" in FIG. 7B).
[0050] As mentioned, in one set of embodiments, the adapter is
substantially or completely palindromic in nature. For example, in
some embodiments, at least 30%, at least 35%, at least 40%, at
least 45%, at least 50%, at least 55%, at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, or at least 95% of the adapter may be palindromic. With a
palindromic adapter, the adapter cannot be added in an incorrect
orientation to the nucleic acid. Similarly, if an adapter is added
to another adapter, the two adapters will form a complete
restriction site that can be cleaved using a suitable restriction
endonuclease, especially if the restriction site portions are also
palindromic. However, in some cases, the adapter is not fully
palindromic, and there may be "bubble" regions that are not
palindromic. For example, identification sequences 72 and/or 74
within the adapter may be chosen to not be palindromic.
[0051] One non-limiting example of an adapter is the following
sequence:
TABLE-US-00001 (SEQ ID NO: 1)
TTAAGGGCTTTCGTATCCGGGGGACCTTAATTAAGGTGGGGGGGATACCT TTCGGGTTAA
It should be noted that this sequence is not fully palindromic, as
certain regions (such as the underlined portions) are not
palindromic. In this example, the two outer underlined regions may
be used as identification sequences within the adapter. It should
be noted that these regions are mirror images of each other, e.g.,
for ease of identification, rather than palindromes of each other
(although this is not necessarily a requirement of the adapter).
Other sequences (such as the repeating GGGGG portions in this
particular example) may also be selected to be nonpalindromic,
e.g., so that the adapter does not readily form stem-loop
structures. In addition, the primer TAAGGTGGGGGGGATAC (SEQ ID NO:
2) may be used with this adapter.
[0052] The identification sequence may comprise any suitable number
of nucleotides (for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, or more nucleotides). In some cases, a plurality of adapters is
prepared, containing identical (or substantially similar)
restriction sites but different identification sequences. The
different adapters may all thus be of the same length, in some
embodiments. Depending on the number of nucleotides chosen to be
the identification sequence, a number of unique adapter sequences
can be created. For example, if the identification sequence is 4
nucleotides long, then up to 4.sup.4 unique adapters may be
created; if the identification sequence is 5 nucleotides long, then
up to 4.sup.5 unique adapters may be created; etc. (e.g., up to
4.sup.n unique sequences where n is the number of nucleotides in
the identification sequence).
[0053] In some cases, the adapter may also contain a suitable
primer sequence, e.g., such that the adapter may be recognized by
an enzyme used in PCR ("Polymerase Chain Reaction"). Typically, the
length of primer sequence is not more than about 30 nucleotides.
Such a primer may be used, for example, to amplify the DNA (or RNA,
in some cases) that the adapter is bound to.
[0054] A variety of techniques may be used to prepare the library
of adapters. For example, microwell plates, containing wells
containing the members of the library could be fabricated, e.g.,
using automated techniques, then encapsulated into droplets or
other compartments. As another example, a randomized oligomer
population could be encapsulated no more than one in a drop and
amplified within each droplet or compartment. In some cases, a
library of adapters may be present on a solid support. Examples
include particles such as magnetic particles, hydrogel beads,
agarose beads, or sepharose beads.
[0055] Any suitable ligase may be used to ligate the adapter to DNA
or RNA. Many such ligases are commercially available, e.g.,
Epicentre.RTM.. In addition, enzymes such as End-It.TM. may be
used, e.g., to repair DNA ends that were subjected to MNase
degradation.
[0056] In some cases, the cell lysate is exposed to a solution
containing adapters (e.g., with ligases) to cause the adapters to
bind to the DNA. The solution may be contained within a droplet or
other compartment. The action of the ligases may cause the adapters
to be added randomly to the DNA. For example, an adapter may be
ligated to one or both ends of a DNA strand, more than one adapter
may be ligated to one end of a strand (e.g., ligated to each
other), one or more adapters can be ligated to one or both ends of
the DNA and to each other to produce a circular DNA fragment, and
in some cases, adapters may be ligated directly to each other
without any DNA in between. However, in a subsequent step, the DNA
may be exposed to a restriction endonuclease that is able to cleave
the adapters at a cleavage site. Doing so effectively causes the
only half of the adapter to stay behind on the DNA (containing the
identification sequence), while the rest of the adapters (and any
other adapters that may have been connected to the first adapter)
will be cleaved away. Accordingly, at the end of this step, at
least some of the DNA will have an end labeled with a unique
identification sequence at one or both ends, and thus, the DNA can
be determined using the identification sequence, even if later
mixed with DNA similarly processed but containing different
identification sequences. Shorter fragments (e.g., the cleaved ends
of the adapters, remains of adapters bound to each other that also
been cleaved into small fragments, etc.) can be subsequently
removed through regular DNA purification methods (size cut off), or
left in solution but ignored. Thus, by tracking the different
identification sequences, the genetic or epigenetic of cells can
each be separately determined, e.g., potentially at a single cell
level.
[0057] In one set of embodiments, the cell lysate (contained within
droplets or other compartments) are fused or coalesced with other
droplets containing adapters. In some cases, substantially each of
the droplets or compartments contain unique adapters (i.e., the
adapters may be substantially similar, but contain different
identification sequences). Accordingly, the cell lysate of each
droplet or compartment can be uniquely identified by determining
the identification sequences.
[0058] Any suitable technique may be used to fuse a first droplet
and a second droplet together to create a combined droplet. For
example, the first and second droplets each be given opposite
electric charges (i.e., positive and negative charges, not
necessarily of the same magnitude), which may increase the
electrical interaction of the two droplets such that fusion or
coalescence of the droplets can occur due to their opposite
electric charges, e.g., to produce the combined droplet. For
instance, an electric field may be applied to the droplets, the
droplets may be passed through a capacitor, a chemical reaction may
cause the droplets to become charged, etc.
[0059] In another set of embodiments, the separate droplets may not
necessarily be given opposite electric charges (and, in some cases,
may not be given any electric charge), and the droplets may instead
be fused through the use of dipoles induced in the fluidic droplets
that causes the fluidic droplets to coalesce. The dipoles may be
induced using an electric field which may be an AC field, a DC
field, etc., and the electric field may be created, for instance,
using one or more electrodes. The induced dipoles in the fluidic
droplets may cause the fluidic droplets to become electrically
attracted towards each other due to their local opposite charges,
thus causing the droplets to fuse.
[0060] Still other examples of fusing or coalescing separate
droplets to produce combined droplets are described in
International Patent Application No. PCT/US2004/010903, filed Apr.
9, 2004, entitled "Formation and Control of Fluidic Species," by
Link, et al., published as WO 2004/091763 on Oct. 28, 2004, and
International Patent Application No. PCT/US2004/027912, filed Aug.
27, 2004, entitled "Electronic Control of Fluidic Species," by
Link, et al., published as WO 2005/021151 on Mar. 10, 2005, each
incorporated herein by reference in its entirety.
[0061] After ligation of the adapter, the various droplets or
compartments containing DNA may be combined together in some
aspects of the invention, e.g., to produce a common solution
containing the DNA. Although the DNA may have arisen from different
cells or compartments, due to the presence of the ligated adapters
(e.g., containing unique identification sequences), the DNA is now
distinguishable. The droplets may be combined by removing
surfactant, removing the continuous fluid containing the droplets,
or any other suitable technique.
[0062] The DNA may be processed or sequenced using any suitable
technique, in accordance with certain aspects of the invention. For
example, techniques such as Chromatin Immunoprecipitation ("ChIP"),
ChIP-Sequencing, ChIP-on-chip, fluorescent in situ hybridization,
methylation-sensitive restriction enzymes, DNA adenine
methyltransferase identification (DamID), or bisulfite sequencing
may be used to analyze the labeled DNA. Optionally, the DNA may be
amplified, e.g., using PCR techniques known to those of ordinary
skill in the art.
[0063] In one set of embodiments, some of the DNA may be analyzed
or sequenced to determine a certain feature or characteristic. For
example, in one set of embodiments, some of the DNA, still attached
to nucleosomal structure, may be immunoprecipitated by exposing the
fragments to an antibody, for example, a histone-recognizing
antibody such as H3-lysine-4-methyl, or the naked DNA to a
methylcytosine antibody, or a hydroxymethylcytosine antibody. Thus,
for example, DNA having a certain feature (e.g., methylated
histones or deacylated histones) may be removed and analyzed or
sequenced. Other examples of histone modifications that may be
studied include acetylation, methylation, ubiquitylation,
phosphorylation and sumoylation.
[0064] In some cases, the DNA that is sequenced may be aligned with
a genome (e.g., a known genome, such as a human genome) to
determine locations of the DNA within the genome (e.g., of a
particular cell) that exhibit such features (e.g., methylated
histones or deacylated histones). Thus, for example, certain
nucleosomes within the genome may be identified as exhibiting such
features. An example of such a study is discussed below in Example
1.
[0065] In other embodiments, RNA molecules, e.g., from individual
cells, could be "barcoded" or otherwise ligated with an
identification sequence in droplets (or other compartments) using
single stranded indexed adaptors. The adaptors may be coupled to
the RNA molecules, for example, by direct ligation, by poly-T or
random primer-based reverse transcription methods, or by other
methods known to those of ordinary skill in the art. In some
embodiments, selected RNA sequences could be interrogated by
introducing a collection of single-stranded adaptors each
comprising a barcode or other identification sequence (e.g.,
indexed to a single cell) and known sequences complementary to the
RNA species of interest, followed by reverse transcription in
single-cell-containing droplets. Template switching may be used in
some embodiments. Accordingly, it should be understood that in the
embodiments and examples discussed herein using DNA, this is by way
of example only, and that in other embodiments, RNA could be used
instead of and/or in addition to DNA.
[0066] A variety of materials and methods, according to certain
aspects of the invention, can be used to produce fluidic systems
and microfluidic systems such as those described herein. In some
cases, the various materials selected lend themselves to various
methods. For example, various components of the invention can be
formed from solid materials, in which the channels can be formed
via micromachining, film deposition processes such as spin coating
and chemical vapor deposition, laser fabrication, photolithographic
techniques, etching methods including wet chemical or plasma
processes, and the like. See, for example, Scientific American,
248:44-55, 1983 (Angell, et al). In one embodiment, at least a
portion of the fluidic system is formed of silicon by etching
features in a silicon chip. Technologies for precise and efficient
fabrication of various fluidic systems and devices of the invention
from silicon are known. In another embodiment, various components
of the systems and devices of the invention can be formed of a
polymer, for example, an elastomeric polymer such as
polydimethylsiloxane ("PDMS"), polytetrafluoroethylene ("PTFE" or
Teflon.RTM.), or the like.
[0067] Different components can be fabricated of the same or
different materials. For example, a base portion including a bottom
wall and side walls can be fabricated from an opaque material such
as silicon or PDMS, and a top portion can be fabricated from a
transparent or at least partially transparent material, such as
glass or a transparent polymer, for observation and/or control of
the fluidic process. Components can be coated so as to expose a
desired chemical functionality to fluids that contact interior
channel walls, where the base supporting material does not have a
precise, desired functionality. For example, components can be
fabricated as illustrated, with interior channel walls coated with
another material. Material used to fabricate various components of
the systems and devices of the invention, e.g., materials used to
coat interior walls of fluid channels, may desirably be selected
from among those materials that will not adversely affect or be
affected by fluid flowing through the fluidic system, e.g.,
material(s) that is chemically inert in the presence of fluids to
be used within the device.
[0068] In one embodiment, various components of the invention are
fabricated from polymeric and/or flexible and/or elastomeric
materials, and can be conveniently formed of a hardenable fluid,
facilitating fabrication via molding (e.g. replica molding,
injection molding, cast molding, etc.). The hardenable fluid can be
essentially any fluid that can be induced to solidify, or that
spontaneously solidifies, into a solid capable of containing and/or
transporting fluids contemplated for use in and with the fluidic
network. In one embodiment, the hardenable fluid comprises a
polymeric liquid or a liquid polymeric precursor (i.e. a
"prepolymer"). Suitable polymeric liquids can include, for example,
thermoplastic polymers, thermoset polymers, or mixture of such
polymers heated above their melting point. As another example, a
suitable polymeric liquid may include a solution of one or more
polymers in a suitable solvent, which solution forms a solid
polymeric material upon removal of the solvent, for example, by
evaporation. Such polymeric materials, which can be solidified
from, for example, a melt state or by solvent evaporation, are well
known to those of ordinary skill in the art. A variety of polymeric
materials, many of which are elastomeric, are suitable, and are
also suitable for forming molds or mold masters, for embodiments
where one or both of the mold masters is composed of an elastomeric
material. A non-limiting list of examples of such polymers includes
polymers of the general classes of silicone polymers, epoxy
polymers, and acrylate polymers. Epoxy polymers are characterized
by the presence of a three-membered cyclic ether group commonly
referred to as an epoxy group, 1,2-epoxide, or oxirane. For
example, diglycidyl ethers of bisphenol A can be used, in addition
to compounds based on aromatic amine, triazine, and cycloaliphatic
backbones. Another example includes the well-known Novolac
polymers. Non-limiting examples of silicone elastomers suitable for
use according to the invention include those formed from precursors
including the chlorosilanes such as methylchlorosilanes,
ethylchlorosilanes, phenylchlorosilanes, etc.
[0069] Silicone polymers are preferred in one set of embodiments,
for example, the silicone elastomer polydimethylsiloxane.
Non-limiting examples of PDMS polymers include those sold under the
trademark Sylgard by Dow Chemical Co., Midland, Mich., and
particularly Sylgard 182, Sylgard 184, and Sylgard 186. Silicone
polymers including PDMS have several beneficial properties
simplifying fabrication of the microfluidic structures of the
invention. For instance, such materials are inexpensive, readily
available, and can be solidified from a prepolymeric liquid via
curing with heat. For example, PDMSs are typically curable by
exposure of the prepolymeric liquid to temperatures of about, for
example, about 65.degree. C. to about 75.degree. C. for exposure
times of, for example, about an hour. Also, silicone polymers, such
as PDMS, can be elastomeric, and thus may be useful for forming
very small features with relatively high aspect ratios, necessary
in certain embodiments of the invention. Flexible (e.g.,
elastomeric) molds or masters can be advantageous in this
regard.
[0070] One advantage of forming structures such as microfluidic
structures of the invention from silicone polymers, such as PDMS,
is the ability of such polymers to be oxidized, for example by
exposure to an oxygen-containing plasma such as an air plasma, so
that the oxidized structures contain, at their surface, chemical
groups capable of cross-linking to other oxidized silicone polymer
surfaces or to the oxidized surfaces of a variety of other
polymeric and non-polymeric materials. Thus, components can be
fabricated and then oxidized and essentially irreversibly sealed to
other silicone polymer surfaces, or to the surfaces of other
substrates reactive with the oxidized silicone polymer surfaces,
without the need for separate adhesives or other sealing means. In
most cases, sealing can be completed simply by contacting an
oxidized silicone surface to another surface without the need to
apply auxiliary pressure to form the seal. That is, the
pre-oxidized silicone surface acts as a contact adhesive against
suitable mating surfaces. Specifically, in addition to being
irreversibly sealable to itself, oxidized silicone such as oxidized
PDMS can also be sealed irreversibly to a range of oxidized
materials other than itself including, for example, glass, silicon,
silicon oxide, quartz, silicon nitride, polyethylene, polystyrene,
glassy carbon, and epoxy polymers, which have been oxidized in a
similar fashion to the PDMS surface (for example, via exposure to
an oxygen-containing plasma). Oxidation and sealing methods useful
in the context of the present invention, as well as overall molding
techniques, are described in the art, for example, in an article
entitled "Rapid Prototyping of Microfluidic Systems and
Polydimethylsiloxane," Anal. Chem., 70:474-480, 1998 (Duffy, et
al.), incorporated herein by reference.
[0071] In some embodiments, certain microfluidic structures of the
invention (or interior, fluid-contacting surfaces) may be formed
from certain oxidized silicone polymers. Such surfaces may be more
hydrophilic than the surface of an elastomeric polymer. Such
hydrophilic channel surfaces can thus be more easily filled and
wetted with aqueous solutions.
[0072] In one embodiment, a bottom wall of a microfluidic device of
the invention is formed of a material different from one or more
side walls or a top wall, or other components. For example, the
interior surface of a bottom wall can comprise the surface of a
silicon wafer or microchip, or other substrate. Other components
can, as described above, be sealed to such alternative substrates.
Where it is desired to seal a component comprising a silicone
polymer (e.g. PDMS) to a substrate (bottom wall) of different
material, the substrate may be selected from the group of materials
to which oxidized silicone polymer is able to irreversibly seal
(e.g., glass, silicon, silicon oxide, quartz, silicon nitride,
polyethylene, polystyrene, epoxy polymers, and glassy carbon
surfaces which have been oxidized). Alternatively, other sealing
techniques can be used, as would be apparent to those of ordinary
skill in the art, including, but not limited to, the use of
separate adhesives, thermal bonding, solvent bonding, ultrasonic
welding, etc.
[0073] As mentioned, in some, but not all embodiments, the systems
and methods described herein may include one or more microfluidic
components, for example, one or more microfluidic channels. The
"cross-sectional dimension" of a microfluidic channel is measured
perpendicular to the direction of fluid flow within the channel.
Thus, some or all of the microfluidic channels may have a largest
cross-sectional dimension less than 2 mm, and in certain cases,
less than 1 mm. In one set of embodiments, the maximum
cross-sectional dimension of a microfluidic channel is less than
about 500 micrometers, less than about 300 micrometers, less than
about 200 micrometers, less than about 100 micrometers, less than
about 50 micrometers, less than about 30 micrometers, less than
about 10 micrometers, less than about 5 micrometers, less than
about 3 micrometers, or less than about 1 micrometer. In certain
embodiments, the microfluidic channels may be formed in part by a
single component (e.g. an etched substrate or molded unit). Of
course, larger channels, tubes, chambers, reservoirs, etc. can also
be used to store fluids and/or deliver fluids to various components
or systems in other embodiments of the invention.
[0074] A microfluidic channel can have any cross-sectional shape
(circular, oval, triangular, irregular, square or rectangular, or
the like) and can be covered or uncovered. In embodiments where it
is completely covered, at least one portion of the channel can have
a cross-section that is completely enclosed, or the entire channel
may be completely enclosed along its entire length with the
exception of its inlet(s) and/or outlet(s). A channel may also have
an aspect ratio (length to average cross sectional dimension) of at
least 2:1, more typically at least 3:1, 5:1, 10:1, 15:1, 20:1, or
more.
[0075] In some embodiments, at least a portion of one or more of
the channels may be hydrophobic, or treated to render at least a
portion hydrophobic. For example, one non-limiting method for
making a channel surface hydrophobic comprises contacting the
channel surface with an agent that confers hydrophobicity to the
channel surface. For example, in some embodiments, a channel
surface may be contacted (e.g., flushed) with Aquapel.RTM. (a
commercial auto glass treatment) (PPG Industries, Pittsburgh, Pa.).
In some cases, a channel surface contacted with an agent that
confers hydrophobicity may be subsequently purged with air. In some
embodiments, the channel may be heated (e.g., baked) to evaporate
solvent that contains the agent that confers hydrophobicity.
[0076] Thus, in some aspects of the invention, a surface of a
microfluidic channel may be modified, e.g., by coating a sol-gel
onto at least a portion of a microfluidic channel. As an example,
the sol-gel coating may be made more hydrophobic by incorporating a
hydrophobic polymer in the sol-gel. For instance, the sol-gel may
contain one or more silanes, for example, a fluorosilane (i.e., a
silane containing at least one fluorine atom) such as
heptadecafluorosilane, or other silanes such as methyltriethoxy
silane (MTES) or a silane containing one or more lipid chains, such
as octadecylsilane or other CH.sub.3(CH.sub.2).sub.n-silanes, where
n can be any suitable integer. For instance, n may be greater than
1, 5, or 10, and less than about 20, 25, or 30. The silanes may
also optionally include other groups, such as alkoxide groups, for
instance, octadecyltrimethoxysilane. In general, most silanes can
be used in the sol-gel, with the particular silane being chosen on
the basis of desired properties such as hydrophobicity. Other
silanes (e.g., having shorter or longer chain lengths) may also be
chosen in other embodiments of the invention, depending on factors
such as the relative hydrophobicity or hydrophilicity desired. In
some cases, the silanes may contain other groups, for example,
groups such as amines, which would make the sol-gel more
hydrophilic. Non-limiting examples include diamine silane, triamine
silane, or N-[3-(trimethoxysilyl)propyl] ethylene diamine silane.
The silanes may be reacted to form oligomers or polymers within the
sol-gel, and the degree of polymerization (e.g., the lengths of the
oligomers or polymers) may be controlled by controlling the
reaction conditions, for example by controlling the temperature,
amount of acid present, or the like. In some cases, more than one
silane may be present in the sol-gel. For instance, the sol-gel may
include fluorosilanes to cause the resulting sol-gel to exhibit
greater hydrophobicity, and/or other silanes (or other compounds)
that facilitate the production of polymers. In some cases,
materials able to produce SiO.sub.2 compounds to facilitate
polymerization may be present, for example, TEOS (tetraethyl
orthosilicate). It should be understood that the sol-gel is not
limited to containing only silanes, and other materials may be
present in addition to, or in place of, the silanes. For instance,
the coating may include one or more metal oxides, such as
SiO.sub.2, vanadia (V.sub.2O.sub.5), titania (TiO.sub.2), and/or
alumina (Al.sub.2O.sub.3).
[0077] In some instances, the microfluidic channel is constructed
from a material suitable to receive the sol-gel, for example,
glass, metal oxides, or polymers such as polydimethylsiloxane
(PDMS) and other siloxane polymers. For example, in some cases, the
microfluidic channel may be one in which contains silicon atoms,
and in certain instances, the microfluidic channel may be chosen
such that it contains silanol (Si--OH) groups, or can be modified
to have silanol groups. For instance, the microfluidic channel may
be exposed to an oxygen plasma, an oxidant, or a strong acid cause
the formation of silanol groups on the microfluidic channel.
[0078] If compartments are used, the compartments may be wells of a
microwell plate (e.g., a 96-well, a 384-well, a 1536-well, a
3456-well microwell plate, etc.). In yet other embodiments, the
compartments may be individual tubes or containers, test tubes,
microfuge tubes, glass vials, bottles, petri dishes, wells of a
plate, or the like. In some cases, the compartments may have
relatively small volumes (e.g., less than about 1 microliter, less
than about 300 nl, less than about 100 nl, less than about 30 nl,
less than about 10 nl, less than about 3 nl, less than about 1 nl,
etc.). In some cases, the compartments may be individually
accessible.
[0079] The following documents are incorporated herein by reference
in their entireties: International Patent Application No.
PCT/US2004/010903, filed Apr. 9, 2004, entitled "Formation and
Control of Fluidic Species," by Link, et al., published as WO
2004/091763 on Oct. 28, 2004; International Patent Application No.
PCT/US2003/020542, filed Jun. 30, 2003, entitled "Method and
Apparatus for Fluid Dispersion," by Stone, et al., published as WO
2004/002627 on Jan. 8, 2004; International Patent Application No.
PCT/US2006/007772, filed Mar. 3, 2006, entitled "Method and
Apparatus for Forming Multiple Emulsions," by Weitz, et al.,
published as WO 2006/096571 on Sep. 14, 2006; International Patent
Application No. PCT/US2004/027912, filed Aug. 27, 2004, entitled
"Electronic Control of Fluidic Species," by Link, et al., published
as WO 2005/021151 on Mar. 10, 2005; International Patent
Application No. PCT/US2007/002063, filed Jan. 24, 2007, entitled
"Fluidic Droplet Coalescence," by Ahn, et al., published as WO
2007/089541 on Aug. 9, 2007; International Patent Application No.
PCT/US2008/013912, filed Dec. 19, 2008, entitled "Systems and
Methods for Nucleic Acid Sequencing," by Weitz, et al., published
as WO 2009/085215 on Jul. 9, 2009; and International Patent
Application No. PCT/US2008/008563, filed Jul. 11, 2008, entitled
"Droplet-Based Selection," by Weitz, et al., published as WO
2009/011808 on Jan. 22, 2009. Also incorporated by reference in its
entirety is U.S. Provisional Patent Application Ser. No.
61/634,744, filed Mar. 5, 2012, entitled "Systems and Methods for
Epigenetic Sequencing," by Rotem, et al.
[0080] The following examples are intended to illustrate certain
embodiments of the present invention, but do not exemplify the full
scope of the invention.
Example 1
[0081] This example illustrates certain systems and methods for
profiling epigenomes of single cells within populations using
droplet based microfluidics.
[0082] All cell types in the human contain essentially identical
genomes (i.e., the DNA sequence). However they vary in terms of how
the DNA is organized by chromatin, a higher order structure of
protein, DNA and RNA. Chromatin structure plays an important role
in regulating genome function and in particular its varied
structure across cell types helps ensure that the correct genes are
expressed in the correct cell types. Chromatin structure is
regulated by histone modifications and DNA methylation. Thus,
genomewide maps of histone modifications or DNA methylation in a
given cell type are a valuable research tool. These maps are
collectively referred to as epigenomic profiles or "epigenomes." In
addition to their value for understanding normal development,
epigenomic profiles have clinical relevance as they can identify
defects in genome regulation in cancer or other diseases, propose
therapeutic strategies or serve as diagnostic or early detection
biomarkers.
[0083] Current methods for profiling epigenomes require thousands
of cells. For example, histone modifications can be mapped by
immunoprecipitating chromatin with antibodies to a modified histone
and then sequencing the DNA (ChIP-seq). However, this method
requires .about.100,000 cells or more. Furthermore, the analysis is
carried out on the entire population and is blind to differences
among cells. Approaches capable of profiling epigenomes in single
cells are important for understanding the principles of chromatin
and genome regulation. Moreover, such approaches could have many
clinical applications in cancer biology, immunology, neuroscience
or other fields in which subject tissues are complex, heterogeneous
and/or limited in size. For example, tumors represent heterogeneous
mixtures of cells that may be driven by sub-populations of cancer
stem cells. Single cell epigenomic profiling methods could improve
understanding of critical epigenomic changes in cancer stem cells.
They might also enable early detection or surveillance of
disease.
[0084] This example describes an epigenomic profiling method that
can be used to map histone modifications in hundreds, thousands or
more individual cells in a population. This example uses
microfluidic devices to capture single cells in single droplets.
The cells are then lysed and the genome is fragmented by enzymatic
digestion in the droplets. Finally, DNA oligonucleotides with
unique "barcodes" or identification sequences are added to each
droplet and ligated to the fragmented genomic DNA sequences, thus
providing a unique identifier for each individual cell. The
materials now includes DNA fragments wrapped around histones and
"bar coded" according to the cell from which they originated. The
materials can now be combined (e.g., "combined and indexed
chromatin matter") and subjected to epigenomic profiling.
[0085] In some embodiments, profiling can be performed by using
chromatin immunoprecipitation using an antibody against a modified
histone (e.g., histone H3 lysine 4 trimethyl). After "pull-down" or
separation of nucleosomes associated with this modified histone
form (e.g., on a substrate), the DNA is isolated and bar-coded
fragments are selectively introduced into a sequencing library. The
DNA is then sequenced, for example, using next-generation
sequencing instruments (e.g., Illumina HiSeq).
[0086] After sequencing, data may be processed in the following
succession: (i) each read is assigned to an original cell based on
its bar code; (ii) each read is aligned to the genome based on the
sequence attached to the bar code; (iii) genomewide profiles are
generated for each cell, based on the union of reads with the same
bar code--specifically, the profiles reflect the density of reads
as a function of genomic position. Furthermore, (iv) clustering
algorithms can be applied to the individual profiles and used to
identify dominant patterns characteristic of different cellular
states in a heterogeneous population.
[0087] As a specific example, using a microfluidic device, cells
may be encapsulated in drops at a density of at most one cell per
drop. The cells are lysed and chromatin is fragmented by MNase
enzymatic digestion into its single units, called nucleosomes
(special buffer was optimized, including Triton, MNase and
CaCl.sub.2 to complement MNase requirements). Each nucleosome
included a segment of DNA wound around a histone protein core. By a
process of droplet fusion, each droplet containing cells is fused
with a droplet containing a cocktail of enzymes, including EndIt
(Epicentre: repairs DNA ends that were subjected to MNase
digestion), ligase (Epicentre), modified buffer including EGTA that
stops the MNase digestion, and double-stranded, barcoded
oligonucleotide adapters.
[0088] The oligonucleotide adapter comprised a barcode that is
unique, specific to each droplet (or individual cell). It also
contains a universal PCR primer sequence and a restriction site
(i.e., the oligonucelotides vary in terms of their barcodes, but
are constant in terms of the primer sequence and restriction site).
The enzyme cocktail effectively ligates barcoded adapters to the
ends of the DNA fragments in the droplet. Thus, after barcoding,
each piece includes a fragment of genome flanked by barcoded
adapters and wrapped around histones. Before breaking the droplets
and merging them to form one aqueous volume, dilution buffer is
supplemented, including both EGTA and EDTA in concentrations that
will stop any enzymatic reaction and maintain detergent levels.
[0089] Since these complexes are "bar-coded" with identification
sequences by their cell of origin, they may now be combined for
epigenomic profiling. Specifically, the droplets are pooled
together and broken down to form one aqueous volume. This combined
and indexed chromatin matter is then subjected to
immunoprecipitation or "ChIP" using an antibody, e.g., an antibody
against a histone modification (e.g., H3 lysine 4 trimethyl or H3
lysine 4 methyl). This enriches for fragments associated with
histones having this modification. The enriched DNA is then
isolated using any suitable technique.
[0090] Fragments within the enriched DNA sample that have
"bar-coded" adapters attached can be selected by amplification
followed by restriction, using the universal primer and the
restriction sites on the adapters. The restriction event leaves an
end that is compatible with a next round of ligation to sequencing
adapters. The result is a sequencing library that contains
"bar-coded" sequences from the epigenomic enrichment assay. The
"bar-codes" may serve as indexes that allow DNA fragments to be
assigned to individual single cells. The fragments can also be
aligned to a genome. For example, a computational pipeline design
including demultiplexing of the sequenced DNA can be aligned to a
genome using known techniques such as a Bowtie algorithm, a
Peak-calling using Scripture algorithm, and/or clustering to
elucidate different population profiles.
[0091] The cells may be encapsulated in drops at rates of thousands
per second, or millions per hour. To prepare a library of unique
barcodes, the contents of a micro-titer well plate containing
oligonucleotides (e.g., an oligonucleotide library) may be
sequenced. In some cases, a randomized oligomer population can be
encapsulated at no more than one in a drop and amplified inside
each drop to create a homogenized oligomer drop catalog.
Example 2
[0092] This example illustrates various techniques useful for
epigenetic sequencing in accordance with certain embodiments of the
invention
[0093] Cell culture. K562 erythrocytic leukaemia cells (ATCC
CCL-243) were grown according to standard protocols in RPMI 1640
media (Invitrogen, 22400105) supplemented with 10% fetal bovine
serum (FBS, Atlas Biologicals, F-0500-A) and 10%
penicillin/streptomycin (Invitrogen, 15140122).
[0094] Cell lysis and chromatin digestion in droplets. Using a
microfluidic device, cells were encapsulated in droplets at a
density of at most one cell per dropret.
[0095] The cells were lysed and chromatin was fragmented in 1%
Triton, 0.1% sodium deoxycholate, 50 mM Tris-HCl pH 7.5, 150 mM
NaCl supplemented with 10 units/ml of MNase (Thermo scientific,
88216), 1 mM CaCl.sub.2 and EDTA-free protease inhibitor (Roche,
13015000). The cells were incubated for 10 min at 4.degree. C., 15
min at 37.degree. C., and put back at 4.degree. C. until the next
step.
[0096] Adapter ligation in droplets. Each nucleosome was formed
from a segment of DNA wound around a histone protein core. By a
process of droplet fusion, the droplets (typically containing a
single cell) was fused with a droplet contains unique barcoded
adaptor in a final concentration of 500 micromolar. Additional
buffer was pico-injected into the fused droplets at the same time.
This buffer had a total volume of 104 microliters and contained 8
microliters End-It.TM. (Epicentre, ER81050) that repairs DNA ends
that were subjected to MNase digestion, 20 microliters End-It.TM.
buffer, 8 Fast link ligase (Epicentre, LK6201H), 20 microliters
fast link ligation buffer, 20 microliters dNTPs, 12 microliters
from 10 mM ATP, and 8 microliters EGTA to a final concentration of
40 mM that stopped the MNase digestion.
[0097] The cells may be encapsulated in droplets at rates of
thousands per second, or millions per hour. To prepare a library of
unique barcodes, the contents of a micro-titer well plate
containing the oligo-library could be encapsulated in droplets.
Alternatively, a randomized oligomer population could be
encapsulated no more than one in a droplet and amplified inside
each droplet to create a homogenized oligomer droplet catalog.
[0098] Adapter design. The oligomer adapters used in this example
comprised an 8-mer identification sequence (or "barcode") that was
unique to each droplet (individual cell). The adapters also
contained a universal PCR primer sequence (forward:
ACACGCAGTATCCCTTCG (SEQ ID NO: 3), reverse: ACTGCGTGTATCCGACTC (SEQ
ID NO: 4)) and a restriction site for BciVI (NEB, R0596S) that cuts
at a 3' overhang. Thus, the oligomers varied in terms of their
identification sequences, but were constant in terms of the primer
sequence and restriction site. The enzyme cocktail effectively
ligated blunt ended barcoded adaptors to the ends of the repaired
DNA fragments in the droplet. Thus, after ligating the adapter, the
nucleic acids typically included a fragment of genome flanked by
barcoded adaptors and wrapped about histones.
[0099] Breaking droplets. Since the nucleic acids were uniquely
labeled with the adapters by their cell of origin, they could
subsequently be combined for epigenomic profiling. The droplets
were pooled together and broken into one aqueous volume. Before
breaking the droplets into one aqueous volume, dilution buffer (50
mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton, 20 mM EGTA, and 20 mM
EDTA) was added. The concentrations of EGTA, EDTA, and detergent
were thus maintained (i.e., at 20 mM, 10 mM, and 1%, respectively).
1H,1H,2H,2H-perfluoro-1-octanol, 97% (Sigma, 370533-25G) was used
to break the droplets.
[0100] Chromatin imunoprecipitation. Next 5 to 10 micrograms of
H3K4me3 antibody (Millipore, 17-614) were pre-bound by incubating
with a mix of Protein-A and Protein-G Dynabeads (Invitrogen,
100-02D and 100-07D, respectively) in blocking buffer (PBS
supplemented with 0.5% TWEEN and 0.5% BSA) for 2 hours. Washed
beads were added to the chromatin lysate (aqueous phase of broken
droplets) for overnight incubation. The samples were washed 6 times
with RIPA buffer, twice with RIPA buffer supplemented with 500 mM
NaCl, twice with LiCl buffer (10 mM TE, 250 mM LiCl, 0.5% NP-40,
0.5% DOC), twice with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA), and
then eluted with 0.5% SDS, 300 mM NaCl, 5 mM EDTA, 10 mM Tris-HCl
pH 8.0 at 65.degree. C. The eluant was incubated in 65.degree. C.
for 1 hour, then treated sequentially with RNaseA (Roche,
11119915001) for 30 min and Proteinase K (NEB, P8102S) for two
hours. The DNA was purified using Agencourt AMPure XP beads
(Beckmangenomics, A63881).
[0101] Sequencing library preparation. Fragments within the
enriched DNA sample that had ligated adapters were selected by
amplification followed by restriction using the universal primer
and the restriction sites on the adapters as described herein. The
restriction event leaves a 3' A overhang that was compatible with a
next round of Ilumina adapter ligation. The result was a sequencing
library that was enriched with nucleic acids from the epigenomic
enrichment assay. The identification sequences or "barcodes" within
the nucleic acids then served as indexes that allowed the DNA
fragments to be assigned to individual single cells.
[0102] Computational pipeline. The first step included
de-multiplexing of the sequenced reads, first, according to the
Ilumina indexes and then for the 8-mer indexes implemented on each
read and hold cell origin information for each fragment. Next, the
Bowtie algorithm was used to align the reads to the genome and a
peak-caller (Scripture algorithm) to find regions with significant
signal to noise ratios. Finally, panning was performed by
clustering single cell epigenome profiles to elucidate the
heterogeneity in cell population, detect different cell types in
mixed population, and/or extract other information from the
cells.
Example 3
[0103] This is an example of profiling cellular populations at the
single cell level with drop-based microfluidics. Populations of
cells have substantial heterogeneity that is important for their
function and understanding. This variability is reflected in cell
to cell variations of epigenetic features such as DNA methylation,
chromatin organization, mRNA levels, and protein expression. When
characterizing a pool of cells by conventional methods, these
variations are quickly averaged and cannot be detected. To detect
these variations, populations can be sorted by phenotype prior to
characterization but ideally, cells could be characterized
one-by-one. The problem of averaging over multiple cells is
exacerbated when a small number of cells differ from the majority
of the population. An example is the case of rare variants that are
increasingly realized to underlie tumor biology and therapeutic
resistance. Since the phenotype of these rare cells is yet to be
discovered, presorting them is not an option. Thus, a method for
characterizing multiple single cells at very high throughput is
needed for understanding the behavior and function of biological
systems ranging from developing blood cells to human tumors.
Accordingly, this example illustrates scalable and flexible
microfluidics methodology capable of profiling chromatin state and
RNA expression in thousands of single cells, and thereby capturing
the nature of population heterogeneity at unprecedented scale.
[0104] Characterizing the genetic and epigenetic states of single
cells is a challenge because the effective concentration of the
contents of a single cell is a million times smaller than that of
typical samples that pool many cells, and hence the rate of
reactions becomes impractically slow. In some cases, the content of
the cell may be amplified prior to its characterization, as was
previously used to measure single cell genetic variations or single
cell RNA expression levels. However, amplifying the contents of
single cells in wells is time consuming, expensive and thus not
scalable to large numbers of cells; moreover, this solution is not
relevant for assays involving proteins, which are denatured during
amplification. Instead, this example restores the effective
concentration in single cell assays by drastically decreasing the
reaction volume using drop-based microfluidics.
[0105] Droplet-based microfluidics use drops of water immersed in
an inert carrier fluid as minute reaction vessels that can be
precisely controlled by microfluidic devices. As an example, the
droplets may be roughly 10 micrometers in diameter, each containing
about 1 .mu.L of fluid surrounded by a surfactant that both
stabilizes the droplet to prevent coalescence with other droplets,
and protects its interface to prevent loss of reagents through
surface adsorption. The reagents within the droplets never touch
the walls of the microfluidic device and fluidic control may be
achieved with the inert carrier fluid, totally independent of the
droplets. The droplets can be formed, refilled, thermo-cycled,
merged, split, sorted, etc. at rates of up to millions per hour
with exquisite control over individual droplets. Thus, droplets can
be used to compartmentalize millions of single cells per hour at
high concentrations, allowing measurements of millions of single
cells.
[0106] In these examples, a flexible platform for high through
profiling of single cells is demonstrated. These examples thus show
a general method that combines droplet-based microfluidics with
genomics and DNA barcoding to profile genetic and epigenetic
features of single cells. To analyze diverse populations, cells are
encapsulated at about one per droplet, and then each droplet is
fused with another droplet containing billions of copies of a
unique barcode used to tag the contents of the cell, e.g.,
contained within an adaptor. After tagging each cell, the droplets
are merged and downstream assays can be performed on the mix of
barcoded cellular information before being sequenced. Upon
sequencing, the cell of origin for each fragment can be identified
by reading the barcode. The platform is compatible with both DNA
and RNA, uses ligation or hybridization to attach the barcodes and
can be scaled up to a large number of cells.
[0107] This general method can be used, for example, to study
epigenetic heterogeneity. Gene regulation in eukaryotes relies on
the functional packaging of DNA into chromatin, a higher-order
structure composed of DNA, RNA, histones and associated proteins.
Chromatin structure and function is regulated by post-translational
modifications of the histones, including acetylation, methylation
and ubiquitinylation. Histone modifications (HM) can be mapped
genome-wide, revealing type-specific regulation states of cells
that reflect lineage-specific gene expression, developmental
programs or disease processes. Given the central role of HM in stem
and cancer cells, it is likely that epigenetic states differ
between tumor cells and underlie their functional heterogeneity. To
map histone modifications across the genome, antibodies are used to
bind to specific modification of the chromatin complex units, or
nucleosomes, and then the bound DNA is sequenced in a protocol that
is known as Chromatin Immuno-Precipitation sequencing (ChIP-Seq).
However, mapping HM in single cells is not currently possible in
other systems due to a low signal to noise ratio when performing
ChIP on genomic material from less than 10,000 cells. These
limitations can be overcome, for example, by uniquely barcoding the
DNA of multiple cells and then performing ChIP-Seq on a pool rather
than on a single cell. Thus, the high signal to noise ratio typical
of ChIP is maintained and single cell information is restored by
reading the barcodes.
[0108] To perform ChIP-Seq on single cells, cells are encapsulated
one in a drop together with lysis buffer and Micrococcal Nuclease
enzyme (MNase) that digests inter-nucleosomal DNA. After digestion,
each droplet containing fragmentized nucleosomes from a single cell
is merged with a drop containing billions of copies of a unique DNA
adapter and a ligation buffer as shown in FIG. 4. The merging
transpires by applying an electric field through an electrode
positioned within the device. To allow adequate sequencing coverage
for the information obtained from the barcoded cells, only 100
merged droplets are collected per ChIP-Seq experiment. To ensure
that each cell is tagged with a unique barcode, the barcode library
contains at least 10 times more unique barcodes than the number of
cells collected. Thus when collecting 100 cells, a library
containing 1152 different barcodes is used, ensuring that the
probability of barcoding two different cells with the same barcode
is lower than 5%. Barcoded nucleosomes can be merged with
additional non-barcoded nucleosomes used as a biological buffer to
ensure high signal to noise ratios during the Immuno-Precipitation
step. To enrich for barcoded nucleosomal fragments, the adapters
may be designed with additional DNA sequences that are used as
specific priming regions for amplification and as restriction sites
for selection during the preparation of the library for Illumina
sequencing. Thus, although initially the barcoded fragments make a
negligible fraction of the DNA in the sample, the majority of
sequenced reads are barcoded on both ends, as shown in FIG. 5A.
[0109] FIG. 4 shows microfluidics of a single cell ChIP-seq. FIG.
4A shows cells are encapsulated in drops together with lysis buffer
and digestive enzyme. FIG. 4B shows that, after incubation,
droplets are re-injected into another microfluidic device where
they are fused with drops containing barcodes. FIG. 4C is an image
of single cells being encapsulated in a microfluidic droplet maker.
FIG. 4D shows droplets containing barcodes are fused with drops
containing cell lysate. Scale bars are 100 micrometers.
[0110] To demonstrate that the epigenetic profiles of single cells
could be measured, two distinct murine cell lines, mES and mEF,
were encapsulated. Each cell line was separately tagged with
different barcodes and then 50 merged drops from each cell line
were collected and pooled together to undergo H3K4me3 ChIP-Seq.
Thus, the cell type of each barcoded fragment was known a priori
and could be compared to the separation obtained from analyzing the
sequenced data. Although only 50 barcodes from each cell type are
expected to be found in the sequenced data, all barcodes were
present when analyzing the data, as shown in FIG. 5A. This is
believed to be a result of cross-contamination between droplets
that may occur during droplet merging due to electro-wetting of the
microfluidic channel near the electrodes that were used to merge
the droplets. Thus, to analyze our cellular information, barcodes
that were used to tag cells were identified as those possessing the
largest number of DNA fragments in the sample.
[0111] After aligning and filtering the reads, each of the chosen
barcodes typically tagged 2-5,000 distinct DNA fragments from each
single cell, representing a sparse binary vector spanning the
murine genome with enrichment for positive entries in genomic
regions that were wrapped around H3K4me3 marked nucleosomes. The
complete set of chosen barcodes was represented as a sparse binary
matrix, in which only 15,000 out of the 1 million genomic bins have
reads from more than one cell and can therefore be used to compare
between them. Despite the sparseness of the data, when aggregating
all mES cells and all mEF cells the known profile measured in many
cells in bulk was restored as shown in FIG. 5B; moreover, it was
possible to separate the two types of cells from each other in an
unsupervised way based on the correlations between the vectors of
the different cells, as shown in FIGS. 5C and 5D. All but one
barcode, each representing the data of a single cell, were
successfully classified as originating from either mES or mEF cell
lines demonstrating that biologically relevant data could be
measured from single cells using ChIP-Seq.
[0112] Thus, FIG. 3A shows the number of unique reads per barcode
is presented for a sample of 50 mES cells and 50 mEF cells after
ChIP-Seq with H3K4me3. Lighter shades indicate reads with the same
barcode on both sides, while darker shades indicates reads with
non-matching barcodes on both sides. FIG. 3B shows representative
reads from 8 different mES cells and the aggregated data of 50 mESs
at the top. FIG. 3C is a correlation matrix between genomic bins of
114 cells (50 mES, 64 mEF). The mES were the first 50 vectors while
mEF were last 64, and their separation into two blocks of
correlation was observed. After just 3 iterations, an unsupervised
algorithm based on the correlations between each cell and two
aggregates of cells could separate the two populations, as is shown
in FIG. 3D.
Example 4
[0113] In this example, mouse embryonic stem cells (mES) were
compared with mouse embryonic fibroblasts (mEF), using an
embodiment of the invention. As shown in FIG. 8A, mESs were encoded
with identification sequences 1-576 ("barcodes") while mEFs were
encoded with identification sequences 577-1152. (See previous
examples for how cells can be encapsulated in droplets with
adapters containing suitable identification sequences). In these
experiments, the identification sequences were arbitrarily chosen
and numbered 1-1152. After ligation, the populations of droplets
were combined together.
[0114] The droplets were then analyzed using ChIP-sequencing, as is
shown in FIG. 8B. The H3K4me3 histone was studied in this example.
4.6 million cells were studied, with 1 million distinct reads after
alignment and filtering. It was found that each of the relevant
barcodes typically tagged 2,000-5,000 distinct DNA fragments from a
single cell, representing a sparse binary vector spanning the mouse
genome. Of these, about 70% contained adapters on both ends of the
DNA. About 10-20% included "cross talk," i.e., the DNA was
incorrectly labeled. For each barcode, there were about
3,000-10,000 cells or "reads" that were identified. In addition,
the separate reads could be pooled together to restore the
epigenomic profile that was measured in a population of cells using
more conventional techniques, as is shown in FIG. 8C, where
aggregates of 50 single-cell profiles for both mESs and mEFs were
compared to traditional protocols for detecting histones.
[0115] While several embodiments of the present invention have been
described and illustrated herein, those of ordinary skill in the
art will readily envision a variety of other means and/or
structures for performing the functions and/or obtaining the
results and/or one or more of the advantages described herein, and
each of such variations and/or modifications is deemed to be within
the scope of the present invention. More generally, those skilled
in the art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the teachings of the present invention
is/are used. Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. It is, therefore, to be understood that the foregoing
embodiments are presented by way of example only and that, within
the scope of the appended claims and equivalents thereto, the
invention may be practiced otherwise than as specifically described
and claimed. The present invention is directed to each individual
feature, system, article, material, kit, and/or method described
herein. In addition, any combination of two or more such features,
systems, articles, materials, kits, and/or methods, if such
features, systems, articles, materials, kits, and/or methods are
not mutually inconsistent, is included within the scope of the
present invention.
[0116] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0117] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0118] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0119] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of," will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e. "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of," "only one of,"
or "exactly one of." "Consisting essentially of," when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0120] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0121] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0122] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03.
Sequence CWU 1
1
8160DNAArtificial SequenceSynthetic Polynucleotide 1ttaagggctt
tcgtatccgg gggaccttaa ttaaggtggg ggggatacct ttcgggttaa
60217DNAArtificial SequenceSynthetic Polynucleotide 2taaggtgggg
gggatac 17318DNAArtificial SequenceSynthetic Polynucleotide
3acacgcagta tcccttcg 18418DNAArtificial SequenceSynthetic
Polynucleotide 4actgcgtgta tccgactc 18546DNAArtificial
SequenceSynthetic Polynucleotidemisc_feature(1)..(1)n is a, c, g,
or tmisc_feature(3)..(8)n is a, c, g, or tmisc_feature(39)..(46)n
is a, c, g, or t 5ncnnnnnngt atcctcagca cccgggtatg tcggatacnn
nnnnnn 46646DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(1)..(8)n is a, c, g, or
tmisc_feature(39)..(44)n is a, c, g, or tmisc_feature(46)..(46)n is
a, c, g, or t 6nnnnnnnnca taggagtcgt gggcccatac agcctatgnn nnnngn
46746DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(1)..(1)n is a, c, g, or
tmisc_feature(3)..(8)n is a, c, g, or tmisc_feature(39)..(46)n is
a, c, g, or t 7ncnnnnnngt atcctcagca cccgggtatg tcggatacnn nnnnnn
46846DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(1)..(8)n is a, c, g, or
tmisc_feature(39)..(44)n is a, c, g, or tmisc_feature(46)..(46)n is
a, c, g, or t 8nnnnnnnnca taggagtcgt gggcccatac agcctatgnn nnnngn
46
* * * * *