U.S. patent application number 15/576923 was filed with the patent office on 2018-06-07 for kit for together detecting multiple target nucleic acids differing from each other and detection method using the same.
This patent application is currently assigned to MIZUHO MEDY CO., LTD.. The applicant listed for this patent is MIZUHO MEDY CO., LTD.. Invention is credited to Kensuke MIYAJIMA, Takashi NAGANO, Kenji NARAHARA.
Application Number | 20180155764 15/576923 |
Document ID | / |
Family ID | 57439990 |
Filed Date | 2018-06-07 |
United States Patent
Application |
20180155764 |
Kind Code |
A1 |
NAGANO; Takashi ; et
al. |
June 7, 2018 |
KIT FOR TOGETHER DETECTING MULTIPLE TARGET NUCLEIC ACIDS DIFFERING
FROM EACH OTHER AND DETECTION METHOD USING THE SAME
Abstract
Provided is a kit for detecting multiple target nucleic acids
capable of simultaneously amplifying and detecting multiple genes
by means of one reaction vessel containing one kind of reaction
solution and one kind of labels. Solution may contain first target
nucleic acid (10) and second target nucleic acid (20) each of which
dissociates at denaturation temperature T0. The solution further
contains: DNA polymerase (30); a first target's primer (13) at
annealing temperature T1 bonding with first single strands derived
from the first target nucleic acid; a second target's primer (23)
at annealing temperature T1 bonding with second single strands
derived from the second target nucleic acid; a first target's probe
(15) at annealing temperature TI bonding with the first single
strands derived from the first target nucleic acid; and a second
target's probe (25) at second target detection temperature T3 which
is lower than the annealing temperature T1 and elongation
temperature T2 bonding with the second single strands derived from
the second target nucleic acid. A condition that: T0 is higher than
T2; T2 is not lower than T1; and T1 is higher than T3 is
satisfied.
Inventors: |
NAGANO; Takashi; (Saga,
JP) ; MIYAJIMA; Kensuke; (Saga, JP) ;
NARAHARA; Kenji; (Saga, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MIZUHO MEDY CO., LTD. |
Saga |
|
JP |
|
|
Assignee: |
MIZUHO MEDY CO., LTD.
Saga
JP
|
Family ID: |
57439990 |
Appl. No.: |
15/576923 |
Filed: |
May 10, 2016 |
PCT Filed: |
May 10, 2016 |
PCT NO: |
PCT/JP2016/063831 |
371 Date: |
November 27, 2017 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/68 20130101; C12Q
1/689 20130101; C12Q 1/686 20130101; C12Q 1/6816 20130101 |
International
Class: |
C12Q 1/686 20060101
C12Q001/686; C12Q 1/689 20060101 C12Q001/689 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 4, 2015 |
JP |
2015-113979 |
Claims
1. A kit for together detecting multiple target nucleic acids
differing from each other, the kit comprising: solution, the
multiple target nucleic acids including a first target nucleic acid
and a second target nucleic acid; defining: T0 as denaturation
temperature; T1 as annealing temperature; T2 as elongation
temperature; and T3 as second target detection temperature, T0
through T3 being set up such that a condition that: T0 is higher
than T2; T2 is not lower than T1; and T1 is higher than T3 is
satisfied; the solution being capable of containing the first
target nucleic acid and the second target nucleic acid therein, at
the denaturation temperature T0, first double-stranded hydrogen
bond of the first target nucleic acid being cut off to be
dissociate into first two single strands, second double-stranded
hydrogen bond of the second target nucleic acid being cut off to be
dissociate into second two single strands, respectively, the
solution further containing therein: a first target's primer at the
annealing temperature T1 specifically bonding with either of the
first two single strands into which the first target nucleic acid
has been dissociated; a second target's primer at the annealing
temperature T1 specifically bonding with either of the second two
single strands into which the second target nucleic acid has been
dissociated; a first target's probe at the annealing temperature T1
specifically bonding with either of the first two single strands
into which the first target nucleic acid has been dissociated, the
first target's probe including a first labeling substance changing
first fluorescent signals thereof when the first target's probe
specifically bonds with either of the first two single strands; DNA
polymerase; deoxyribonucleoside triphoshate at the elongation
temperature T2 bonding by action of the DNA polymerase with both of
the first two single strands into which the first target nucleic
acid has been dissociated and the second two single strands into
which the second target nucleic acid has been dissociated; and a
second target's probe at the annealing temperature T1 bonding with
neither the first two single strands into which the first target
nucleic acid has been dissociated nor the second two single strands
into which the second target nucleic acid has been dissociated, the
second target's probe at the second target detection temperature T3
bonding with the second two single strands into which the second
target nucleic acid has been dissociated, the second target's probe
including a second labeling substance changing second fluorescent
signals thereof when the second target's probe specifically bonds
with either of the second two single strands.
2. The kit for together detecting multiple target nucleic acids
differing from each other as defined in claim 1, wherein each of
the first labeling substance and the second labeling substance is
selected from a group consisting of: a QProbe (registered
trademark) probe; an Eprobe (registered trademark) probe; and a
TaqMan (registered trademark) probe.
3. The kit for together detecting multiple target nucleic acids
differing from each other as defined in claim 1, wherein the
fluorescent signals are shown by quenching light when the annealing
occurs.
4. The kit for together detecting multiple target nucleic acids
differing from each other as defined in claim 1, wherein the
fluorescent signals are shown by emitting light when the annealing
occurs.
5. The kit for together detecting multiple target nucleic acids
differing from each other as defined in claim 1, wherein the first
target nucleic acid is a Mycoplasma pneumoniae P1 genes and the
second target nucleic acid is internal control composition.
6. The kit for together detecting multiple target nucleic acids
differing from each other as defined in claim 1, wherein the first
target nucleic acid is a Chlamydia trachomatis endogeneous plasmid
gene and the second target nucleic acid is a Nisseria gonorrhoeae
CMT gene.
7. A detection method, comprising: using the kit for together
detecting multiple target nucleic acids differing from each other
as defined in claim 1; a dissociating step of increasing
temperature of the solution to the denaturation temperature T0 so
as to dissociate the first target nucleic acid into the first two
single strands, and to dissociate the second target nucleic acid
into the second two single strands respectively; a first target
nucleic acid detecting step of decreasing the temperature of the
solution to the annealing temperature T1 so as to detect whether or
not the first target nucleic acid is contained in the solution
based on the first fluorescent signals shown by the first target's
probe; an amplification step of setting up the temperature of the
solution to the elongation temperature T2 so as to amplify the
first two single strands into which the first target nucleic acid
has been dissociated and the second two single strands into which
the second target nucleic acid has been dissociated, respectively;
and a second target nucleic acid detecting step of decreasing the
temperature of the solution to the second target detection
temperature T3 so as to detect whether or not the second target
nucleic acid is contained in the solution based on the second
fluorescent signals shown by the second target's probe.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
[0001] The present invention relates to a detection kit for
improving the PCR method and further for measuring multiple target
nucleic acids, and art related to the same.
2. Description of the Related Art
[0002] In genetic screening, it is necessary to measure multiple
target nucleic acids in many cases.
[0003] For example, the multiple target nucleic acids may be: a
first pair of influenza A viruses and influenza B viruses; a second
pair of influenza and RSV/human metapneumovirus; a third pair of
Chlamydia trachomatis and Nisseria gonorrhoeae, which may cause
sexually transmitted diseases; a fourth pair of Mycoplasma
pneumoniae and resistance factor thereof; and so on.
[0004] Regarding the multiple target nucleic acids in some pairs of
the above, the conditions of patients are similar to each other and
also infection of the same expands simultaneously. So, it is
conceivable to distinguish the multiple target nucleic acids from
each other to make a diagnosis, thereby deciding on a course of
treatment.
[0005] Considering the resistance factor is effective for
selecting/judging medication against thereto, or the like.
[0006] As for only one measurement item, it is also helpful to set
up internal control composition as means for confirming whether or
not the measurement itself has been well done.
[0007] This is performed by: beforehand preparing a nucleic acid
sequence to be amplified, the sequence not concerning a target gene
of a detection object; and enabling to confirm whether or not the
reaction has been well processed notwithstanding the existence or
nonexistence of the target nucleic gene.
[0008] In this way, whether or not whether the reagent and the
device for the measurement have acted effectively can be checked
within the measurement system.
[0009] As mentioned above, in order to detect the multiple target
nucleic acids, a first process of performing independent
measurement for each of the multiple target nucleic acids,
respectively, and a second process of distinguishing the multiple
target nucleic acids from each other by means of different pilot
dyes or the like, respectively can be conceived.
[0010] Alternatively, it is also possible to carry out the melting
curve analysis method after having simultaneously processed
amplification reaction. In this method after the amplification
reaction, temperature is gradually increased/decreased to make
distinction and judgment with respect to the multiple target
nucleic acids based on both of first temperature wherein a change
rate of fluorescent signals shows a peak and second temperature
wherein the target nucleic acid is melt (the melting curve analysis
method).
[0011] The first process of performing the independent measurement
requires long time and high costs. The second process of
distinguishing different labeling substances from each other costs
too much because the second process needs not only preparing plural
kinds of labeled reagents but also complicated wavelength-setting
in an analyzer.
[0012] A case by means of the melting curve analysis method costs
less than the above. However, since the temperature must be
gradually changed, it is necessary to take about 5 to 10 minutes
for changing the temperature in order to conduct precise
analysis.
[0013] Reference 1 (Japanese application Laid-open No. 2002-136300)
discloses: preparing a plurality of reaction vessels containing
different reaction solution from each other; and performing
amplification and detection with the plurality of reaction vessels,
respectively.
[0014] So, reagent preparation and dispensing operations must be
conducted for every item of the plurality of reaction vessels.
There is a problem that it requires a long time.
[0015] Reference 2 (Japanese application Laid-open No. 2004-203)
discloses simultaneously amplifying multiple genes by means of one
reaction vessel containing one kind of reaction solution.
[0016] Distinction is carried out by using different pilot dyes for
each of the multiple genes. So, a plurality of optical systems
installed in an analyzer are needed as many as the used pilot dyes.
In other words, the analyzer costs too much. This is a serious
problem.
[0017] Reference 3 (Japanese application Laid-open No. 2008-173127)
discloses simultaneously amplifying multiple genes by means of one
reaction vessel containing one kind of reaction solution.
[0018] Dissociation temperature of PCR products and labeled probes
should be changed for every gene. After amplification, while
temperature is gradually increased from a lower temperature side to
a higher temperature side, dissociation curve analysis, which is a
synonym of "melting curve analysis", of monitoring fluorescence
values is carried out. Distinction is carried out by monitoring
existence or nonexistence of a peak depending on base sequence at
the respective dissociation temperature.
[0019] If temperature is changed speedily upon the melting curve
analysis, it becomes difficult to identify melting temperature for
each gene. Accordingly, there is a problem that extra time of about
5 to 10 minutes after PCR is required.
[0020] Reference 4 (Japanese unexamined patent application
publication <Translation of PCT application> No. 2012-513215)
discloses simultaneously amplifying multiple genes by means of one
reaction vessel.
[0021] Dissociation temperature of PCR products and melting
temperature of primers are changed for every gene. Distinction is
carried out by monitoring fluorescence at the respective melting
temperature.
[0022] In an ordinary PCR profile, one cycle includes: a
denaturation step; and an annealing and elongation step. In
Reference 4, the melting temperature of PCR products is changed for
every gene. Accordingly, too many conditions should be taken into
consideration, design of the profile is also difficult, and time
for measurement must be too long.
[0023] Furthermore, there is another problem that temperature must
be drastically changed to task the device.
LIST OF CITED REFERENCES
[0024] Reference 1: Japanese application Laid-open No. 2002-136300;
[0025] Reference 2: Japanese application Laid-open No. 2004-203;
[0026] Reference 3: Japanese application Laid-open No. 2008-173127;
[0027] Reference 4: Japanese unexamined patent application
publication (Translation of PCT application) No. 2012-513215; and
[0028] Reference 5: Japanese registered patent No. 4724380.
OBJECTS AND SUMMARY OF THE INVENTION
[0029] In view of the above, an object of the present invention is
to provide a kit for detecting multiple target nucleic acids
capable of simultaneously amplifying and detecting multiple genes
by means of one reaction vessel containing one kind of reaction
solution and one label.
[0030] A first aspect of the present invention provides a kit for
together detecting multiple target nucleic acids differing from
each other, comprising: solution, the multiple target nucleic acids
including a first target nucleic acid and a second target nucleic
acid; defining: T0 as denaturation temperature; T1 as annealing
temperature; T2 as elongation temperature; and T3 as second target
detection temperature, T0 through T3 being set up such that a
condition that T0 is higher than T2; T2 is not lower than T1; and
T1 is higher than T3 is satisfied, the solution being capable of
containing the first target nucleic acid and the second target
nucleic acid therein, at the denaturation temperature T0, first
double-stranded hydrogen bond of the first target nucleic acid
being cut off to be dissociate into first two single strands,
second double-stranded hydrogen bond of the second target nucleic
acid being cut off to be dissociate into second two single strands,
respectively, the solution further containing therein: a first
target's primer at the annealing temperature T1 specifically
bonding with either of the first two single strands into which the
first target nucleic acid has been dissociated; a second target's
primer at the annealing temperature T1 specifically bonding with
either of the second two single strands into which the second
target nucleic acid has been dissociated; a first target's probe at
the annealing temperature T1 specifically bonding with either of
the first two single strands into which the first target nucleic
acid has been dissociated, the first target's probe including a
first labeling substance changing first fluorescent signals thereof
when the first target's probe specifically bonds with either of the
first two single strands; DNA polymerase; deoxyribonucleoside
triphoshate at the elongation temperature T2 bonding by action of
the DNA polymerase with both of the first two single strands into
which the first target nucleic acid has been dissociated and the
second two single strands into which the second target nucleic acid
has been dissociated; and a second target's probe at the annealing
temperature T1 bonding with neither the first two single strands
into which the first target nucleic acid has been dissociated nor
the second two single strands into which the second target nucleic
acid has been dissociated, the second target's probe at the second
target detection temperature T3 bonding with the second two single
strands into which the second target nucleic acid has been
dissociated, the second target's probe including a second labeling
substance changing second fluorescent signals thereof when the
second target's probe specifically bonds with either of the second
two single strands.
[0031] It is preferable that each of the first labeling substance
and the second labeling substance is selected from a group
consisting of: a QProbe (registered trademark) probe; an Eprobe
(registered trademark) probe; and a TaqMan (registered trademark)
probe.
[0032] The fluorescent signals may be shown by quenching light when
the annealing occurs. Alternatively, the fluorescent signals may be
shown by emitting light when the annealing occurs.
[0033] It is preferable that the first target nucleic acid is at
least one of a Mycoplasma pneumoniae P gene and a Chlamydia
trachomatis endogeneous plasmid gene, and the second target nucleic
acid is at least one of internal control composition and a Nisseria
gonorrhoeae CMT gene, respectively.
Effect of Invention
[0034] As mentioned above, according to the present invention, the
multiple target nucleic acids can be detected by means of one kind
of mixed-solution and one kind of labeling substances.
[0035] Distinction of the multiple target nucleic acids can be
carried out without melting curve analysis. Accordingly, measuring
time can be remarkably shortened, thereby providing excellent
practical performance.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0036] The present inventors have developed a kit for detecting
nucleic acids by means of one kind of fluorescent labels and one
reaction vessel containing one kind of reaction solution. Condition
setting with respect to annealing temperature of probes and
temperature change profiles in the PCR method has been incorporated
within the present kit.
[0037] As shown in FIG. 35, the present kit uses four kinds of
temperature including: denaturation temperature T0 (95 Centigrade);
annealing temperature T1 (70 Centigrade); elongation temperature T2
(72 Centigrade); and second target detection temperature T3 (55
Centigrade).
[0038] The four kinds of temperature are set up such that a
condition that T0>T2>=T1>T3 is satisfied.
[0039] Of course, the above temperature vales are mere examples,
and may be variously changed as mentioned later.
[0040] Herein, the multiple target nucleic acids are a first target
nucleic acid and a second target nucleic acid. However if needed, a
third target nucleic acid or more can be added thereto by adding
further setting such as third target detection temperature T4
(T3>T4), or the like.
[0041] Referring now to FIG. 36, elements of the present kit will
now be explained.
[0042] First, in the present kit, it is assumed that a first target
nucleic acid 10 and a second target nucleic acid 20 are targets to
be detected.
[0043] Hereinafter for the simplicity of explanation, only a case
where both of the first target nucleic acid 10 and the second
target nucleic acid 20 are contained in solution 2 within a vessel
1, that is, a case of positive and positive will be explained
below. Details of the solution 2 will be mentioned later.
[0044] Needless to say, in another case where at least one target
is negative, the solution 2 does not contain the at least one of
the first target nucleic acid 10 and the second target nucleic acid
20. Therefore, fluorescent signals and amplification regarding the
not contained target nucleic acid will not be carried out in the
following explanation.
[0045] As shown in FIG. 37 (a), when temperature of the solution 2
is increased to reach the denaturation temperature T0, hydrogen
bonds of double strands of the first target nucleic acid 10 and the
second target nucleic acid 20 are respectively cut off to be
dissociated into respective first and second two single strands
(from the first target nucleic acid 10 to a first single strand 11
and a second single strand 12, from second target nucleic acid 20
to a first single strand 21 and a second single strand 22).
[0046] As shown in FIG. 37 (b), the temperature is decreased from
the denaturation temperature T0 to reach the annealing temperature
T1, regarding the first target nucleic acid 10, a first target's
F-primer 13 specifically bonds with a complementary sequence of the
first single strand 11, and a first target's R-primer 14
specifically bonds with another complementary sequence of the
second single strand 12, respectively.
[0047] Furthermore, similar to the above, regarding the second
target nucleic acid 20, a second target's F-primer 23 specifically
bonds with a complementary sequence of the first single strand 21,
and a second target's R-primer 24 specifically bonds with another
complementary sequence of the second single strand 22,
respectively.
[0048] At the annealing temperature T1 shown in FIG. 37 (b), the
first target's probe 15 labeled by means of the first labeling
substance 16 specifically bonds with a specific part of the first
single strand 11 derived from the first target nucleic acid 10,
thereby the first labeling substance 16 outputs first fluorescence
signals.
[0049] On the other hand, the annealing temperature T1 is higher
than the second target detection temperature T3. For this reason,
the second target's probe 25 labeled by means of the second
labeling substance 26 does not bond with the first single strand 21
derived from the second target nucleic acid 20, thereby the second
labeling substance 26 outputs no fluorescence signal at this
time.
[0050] As shown in FIG. 37 (c), when the temperature is increased
from the annealing temperature T1 to the elongation temperature T2,
amplification reaction progresses advances as follows. This is
because the solution 2 contains an amount sufficient for repeating
PCR cycles of DNA polymerase 30 and deoxyribonucleoside triphoshate
31.
[0051] Regarding the first target nucleic acid 10, from the first
target's F-primer 13 bonding with the first single strand 11, and
from the first target's R-primer 14 bonding with the second single
strand 12, the deoxyribonucleoside triphoshate 31 bonds therewith
to elongate, respectively.
[0052] Regarding the second target nucleic acid 20, from the second
target's F-primer 23 bonding with the first single strand 21, and
from the second target's R-primer 24 bonding with the second single
strand 22, the deoxyribonucleoside triphoshate 31 bonds therewith
to elongate, respectively.
[0053] As clear comparing FIG. 37 (d) with FIG. 36, upon the
amplification reaction has been completed, both of the first target
nucleic acid 10 and the second target nucleic acid 20 have been
doubled.
[0054] Returning to a step shown in FIG. 37 (a) again to repeat the
above steps of FIG. 37 (a) through FIG. 37 (d) enables to repeat
the amplification reaction and changes of fluorescent signals by
means of the first labeling substance 16.
[0055] Next referring now to FIG. 38, a case where the temperature
is decreased from the denaturation temperature T0 to the second
target detection temperature T3 will now be explained.
[0056] As shown in FIG. 38 (a), at the denaturation temperature T0,
the situation is the same as that of FIG. 37 (a).
[0057] However, upon the temperature is decreased to reach the
second target temperature detection temperature T3, the situation
is as shown in FIG. 38 (b) differing from FIG. 37 (b).
[0058] Namely, as shown in FIG. 38 (b), the first target's probe 15
labeled by the first labeling substance 16 specifically bonds with
a specific part of the first single strand 11 derived from the
first target nucleic acid 10, and the first fluorescent signals of
the first labeling substance 16 change. This is the same as that of
FIG. 37 (b).
[0059] However, the temperature is the second target detection
temperature T3. Accordingly, also the second target's probe 25
labeled by the second labeling substance 26 bonds with the first
single strand 21 derived from the second target nucleic acid 20,
and the second fluorescent signals of the second labeling substance
26 also change.
Herein, it is preferable that the first labeling substance 16 and
the second labeling substance 26 are identical.
[0060] As a result, capturing the difference caused by the changes
of the first and second fluorescent signals according to the second
labeling substance 26 enables to judge the existence or
nonexistence (positivity/negativity) of the second target nucleic
acid 20.
[0061] In addition as clear from the above-mentioned, it may be
understood that the multiple target nucleic acids can be
respectively detected during a series of continuing steps by means
of the reaction vessel containing one kind of reaction
solution.
[0062] Hereinafter, Embodiments of detecting multiple nucleic acids
by means of three kinds of probes will now be explained more
concretely. In the Embodiments, the QProbe (registered trademark)
method, the Eprobe (registered trademark) method, and the TaqMan
(registered trademark) method have been used.
[0063] Necessary information for operation including: primer
sequences; base sequences of the respectivEprobes; and material of
nucleic acid samples will be also shown.
Embodiment 1
<Detection of Mycroplasma Pneumoniae P1 Genes and Internal
Control Composition According to the QProbe Method>
[0064] Detection of Mycoplasma pneumoniae P1 genes and internal
control composition according to the QProbe method has been
performed.
<Material and Steps>
(Primer)
[0065] A pair of primers used for the PCR method in Embodiment 1
are as shown in Table 1.
TABLE-US-00001 TABLE 1 Primers used for PCR in this Embodiment
Primer Length name Sequence (5'.fwdarw.3') (bp) MYC F
GCCACCCTCGGGGGCAGTCAG 21 (SEQ ID No. 1) MYC F
GAGTCGGGATTCCCCGCGGAGG 22 (SEQ ID No. 2)
[0066] As sequence No. 1 and sequence No. 2, (primer pair for P
adhesin gene) sequences recited in the report (The Journal Of
Infectious Diseases, 1996; 173; 1445-52) by leven et al. have been
used.
(Nucleic Acid Sample)
[0067] Nucleic acid samples used for the PCR method in Embodiment 1
are shown below.
(pMYC)
[0068] Mycoplasma pneumnoniae is a pathogenic organism of
Mycoplasma pneumonia. P protein is membrane protein derived from
Mycoplasma pneumoniae. Gene fragments (sequences amplified by a
pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2) encode the P1
protein. pMYC is a plasmid DNA produced by artificial synthesizing
the gene fragments to be incorporated into a pMD20T vector.
Production of the plasmid DNA has been performed by requesting
custom synthesis to the Takara Bio Inc.
(pICM5)
[0069] In order to be capable of amplifying pICM5 plasmid by means
of common primers of the pair of primers of SEQ ID NO: 1 and SEQ ID
NO: 2, pICM5 is a plasmid DNA produced by artificial synthesizing a
sequence including a complementary sequence to the pair of the
primers to be incorporated into a pMD20T vector. Production of the
plasmid DNA has been performed by requesting custom synthesis to
the Takara Bio Inc.
(Preparation of Nucleic Acid Sample)
[0070] First length of the pMYC plasmid is 2942 [bp], and second
length of the pICM5 plasmid is 2886 [bp].
[0071] Based on the first and second length and the concentration
[.mu.g/.mu.l] of plasmid solution, the number of copies per 1
[.mu.l] has been calculated. After that, by means of TE buffer
solution (10 [mM] Tris-HCl, 1.0 [mM] EDTA pH: 8.0), the pMYC
plasmid has been diluted to be 1.times.10 [copies/.mu.l], and the
pICM5 plasmid has been diluted to be 1.times.10 [copies/.mu.l],
respectively.
(Probe)
[0072] Information of thEprobe used for the PCR method in
Embodiment 1 is as shown in Table 2.
TABLE-US-00002 TABLE 2 Probes used for PCR in this Embodiment Probe
Length name Sequence (5'.fwdarw.3') (bp) MYC QP
CCCTCGACCAAGCCAACCTCCAGCTC 26 (SEQ ID No. 3) IC QP
AGTGGGACTCACCAACC 17 (SEQ ID No. 4)
[0073] Based on a basic sequence of PCR products capable of being
amplified by means of the pair of primers in Table 1, a specific
region for SEQ ID NO: 3 and SEQ ID NO: 4 has been selected
referring to Tm values calculated with a QProbe design support tool
on the J-Bio21 Center home pages.
[0074] "MYC QP" is one QProbe specifically annealing the pMYC
plasmid, and "IC QP" is another QProbe specifically annealing the
pICM5 plasmid. As fluorescent dye for both of "MYC QP" and "IC QP",
"BODIPY FL" (registered trademark) has been used to label "C" at 3'
ends, respectively. Production of the QProbes has been performed by
requesting custom synthesis to the NIPPON STEEL & SUMIKIN
Eco-Tech Corporation.
(Conditions of PCR and Fluorescence Measurement)
[0075] In Embodiment 1, among two kinds of target nucleic acids to
be amplified within one vessel containing one kind of reaction
liquid, a first Tm value for "MYC QP" that is the QProbe
specifically annealing the pMYC plasmid of the first target is set
up to be higher than another Tm value for the primers to perform
first detection during amplification reaction.
[0076] In addition, a second Tm value for "IC QP" that is the
QProbe specifically annealing the pICM5 plasmid of the second
target is set up to be lower than changes (70 Centigrade to 95
Centigrade) of temperature during the amplification reaction to
perform second detection after the amplification reaction.
[0077] Table 3 and Table 4 show composition of the PCR reaction
solution and the reaction conditions respectively, and FIG. 1 shows
a graph of the changes of temperature of the mixed solution.
TABLE-US-00003 TABLE 3 Composition of PCR solution in QProbe method
Solution composition Final concentration MilliQ(TM) water -- PCR
buffer x1 dNTP Mix 150 .mu.M MYC F 0.20 .mu.M MYC R 0.60 .mu.M MYC
QP 0.15 .mu.M IC QP 0.15 .mu.M KOD exo (-) DNA Polymerase 0.0125
U/.mu.l Target nucleic acid -- The above has been prepared to be 20
.mu.L
TABLE-US-00004 TABLE 4 Reaction conditions in QProbe method
Reaction steps Temperature (.degree. C.) Time(s) Initial
denaturation 95 T.sub.0 120 Amplification 95 T.sub.0 10 (FL
measurement) (1-44 cycles) 70 T.sub.1 10 72 T.sub.2 10 (FL
measurement) Second target NA detecting 95 T.sub.0 10 (FL
measurement) 55 T.sub.3 10 (FL measurement)
[0078] For the PCR and the fluorescence measurement, "Light Cycler
nano system" (registered trademark of the Roche Diagnostics K.K.)
has been used.
[0079] The combination of 510 to 528 [nm] has been selected for
excitation wavelength and fluorescent wavelength upon fluorescence
measurement. Fluorescence values have been measured at the
denaturation step (95 Centigrade) and the elongation step (72
Centigrade) for every cycle. Furthermore, after the amplification
reaction has been completed, at a step for detecting the second
target (95 Centigrade and 55 Centigrade), fluorescence measurement
has been performed.
[0080] FIG. 2 shows fluorescent measurement conditions at the final
cycle of the amplification reaction and at the second target
detection step.
(How to Process Data)
[0081] Analysis software provided with the Light Cycler nano system
does not support an analysis method of using the QProbes.
Accordingly, correction calculation has been performed on obtained
raw data as follows, referring to a method disclosed in Reference 5
(Japanese registered patent No. 4724380).
[0082] For every cycle of the amplification reaction and the second
target detection step, calculation has been carried out according
to the following formulae.
fn=fhyb.n/fden.n (Formula 1)
fe=thyb.e/fden.e (Formula 1')
herein, fn: fluorescence intensity value in n cycle calculated
according to Formula 1; fhyb.n: fluorescence intensity value at the
elongation step in n-th cycle; fden.n: fluorescence intensity value
at the denaturation step in n-th cycle; fe: fluorescence intensity
value at the second target detection step calculated according to
Formula 1'; fhyb.e: fluorescence intensity value (55 Centigrade) at
the second target detection step; and fden.e: fluorescence
intensity value (95 Centigrade) at the second target detection
step.
[0083] Next, for every cycle of the amplification reaction and the
second target detection step, calculation has been carried out
according to the following formulae.
Fn=fn/f10 (Formula 2)
Fe=fe/f10 (Formula 2')
herein, Fn: relative value in n-th cycle assuming that the
fluorescence intensity value in the tenth cycle obtained according
to Formula 1 is equal to a value of "1"; and Fe: relative value at
the second target detection step assuming that the fluorescence
intensity value in the tenth cycle obtained according to Formula 1'
is equal to a value of "1".
[0084] F44 which is a value of Fn at the final cycle of the
amplification reaction has been used for judgment of the existence
or nonexistence of the first target nucleic acid.
[0085] Further calculation has been carried out according to the
following formula.
Fs=Fe-F44 (Formula 3)
herein, Fs: measured value regarding the second target.
[0086] The value of Fs has been used for determination of the
existence or nonexistence of the second target nucleic acid.
[0087] Determination according to the QProbe method has been
performed using the method shown below.
[0088] The F44 value of the measurement sample has been compared
with Threshold 1. And, when the F44 value of the measurement sample
is lower than Threshold 1, it has been determined that the first
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0089] As Threshold 1, an average of F44 values of the negative
reference (reagent TE buffer added thereto instead of DNA) minus
three times the standard deviation (hereinafter, called as
"mean-3SD") has been used.
[0090] Notwithstanding the first target nucleic acid is positive or
negative, the Fs value has been compared with Threshold 2, and when
the Fs value is lower than Threshold 2 it has been determined that
the second target nucleic acid is positive (existence), otherwise
negative (nonexistence).
[0091] As Threshold 2, the value of "mean-3SD" of a sample to which
only the pMYC plasmid is added has been used. FIG. 3 shows a flow
chart of the determination method related thereto.
[0092] As nucleic acid samples, the pMYC plasmid has been used for
Mycoplasma pneumoniae P1 genes, the pICM5 plasmid has been used for
the internal control composition, and the PCR has been performed
thereon.
[0093] A first Tm value of 72.5 Centigrade has been set for a
sequence of MYC QP, and a second Tm value of 57.5 Centigrade has
been set for a sequence of IC QP. For this reason, it has been
estimated that probes anneal only MYC QP during the temperature
range (from 70 Centigrade to 95 Centigrade) in the PCR.
[0094] Since the fluorescence measurement with respect to the
second target detection step has been carried out at 95 Centigrade
and 55 Centigrade which is lower than the Tm value of IC QP, it has
been estimated that extinction of both of MYC QP and the IC QP has
been simultaneously detected according to measured values at the
second target detection step.
[0095] Regarding an amplification curve of the negative reference,
extinction has not observed until 44 cycles when the PCR ends. This
is because a value 0.998 of F44 is not lower than a value 0.997 of
Threshold 1. At this time, "mean-3SD" is equal to 0.997 to be
regarded as Threshold 1 for the first target detection in
Embodiment 1, thereby being shown in Table 5. The amplification
curve related thereto is also shown in FIG. 4.
[0096] Regarding another amplification curve of the pMYC plasmid of
the first target nucleic acid, extinction caused by annealing of
MYC QP has been observed from about 28 cycles.
[0097] It has been revealed that a value 0.913 of F44 has been
lower than Threshold 1, and further that a first objective region
of the pMYC plasmid has been amplified. At this time, "mean-3SD" of
Fs has been equal to -0.056 to be regarded as Threshold 2 for the
second target detection, thereby being shown in Table 5. The
amplification curve related thereto is also shown in FIG. 5.
[0098] Regarding an amplification curve of the pICM5 plasmid of the
second target nucleic acid, no extinction has been observed during
the amplification reaction. This is because a value 0.997 of F44 is
not lower than a value 0.997 of Threshold 1. A value -0.118 of Fs
has been lower than Threshold 2.
[0099] The above-mentioned results have revealed that the objective
region of the pMYC plasmid has been not amplified, further that the
objective region of the pICM5 plasmid has been amplified.
[0100] Table 5 shows the value of the Fs. The amplification curve
is shown in FIG. 6.
TABLE-US-00005 TABLE 5 Values used for determination in QProbe
method TE pMYC pICM5 pMYC pICM5 F44 0.998 0.913 0.997 0.912 F44
0.997 .asterisk-pseud.1 -- -- -- (Average - 3SD) Fe 0.971 0.862
0.879 0.796 Fs -0.027 -0.051 -0.118 -0.116 Fs -- .sup. -0.056
.asterisk-pseud.2 -- -- (Average - 3SD) .asterisk-pseud.1 Threshold
1 .asterisk-pseud.2 Threshold 2
[0101] Regarding an amplification curve upon both the pMYC plasmid
of the first target nucleic acid and the pICM5 plasmid of the
second target nucleic acid have been added to the solution,
extinction caused by annealing of MYC QP has been observed from
about 28 cycles as the same as the above-mentioned amplification
curve of the pMYC plasmid. A value 0.912 of F44 has been lower than
Threshold 1, and it has been revealed that the objective region of
the pMYC plasmid has been amplified.
[0102] The value -0.116 of Fs is lower than Threshold 2, and it has
been revealed that the 1.5 objective region of the pICM5 plasmid
has been amplified. Table 5 shows the value of the Fs. The
amplification curve related thereto is shown in FIG. 7.
[0103] After the PCR has been completed, agarose electrophoresis
has been performed onto these PCR products. First objective PCR
products with respect to the pMYC plasmid-added sample have been
confirmed at near 206 [bp], and second objective PCR products with
respect to the pICM5 plasmid-added sample have been confirmed at
near 150 [bp].
[0104] According to the above-mentioned results, it has been
revealed that Mycoplasma pneumoniae P1 genes and internal control
composition can be detected by means of one reaction vessel
containing one kind of reaction solution and one kind of
fluorescent labels when the method of designing probes and
temperature profiles are incorporated with the QProbe method.
Embodiment 2
[0105] <Detection of Mycopiasma Pneumoniae P1 Genes and Internal
Control Composition Based on QProbe Method while Changing Profile
at Second Detection Step>
[0106] According to a method of changing the profiles at the second
detection step in Embodiment 1, Mycoplasma pneumoniae P1 genes and
internal control composition have been detected based on the QProbe
method.
[0107] The primers, probes, reaction solution composition, and
nucleic acids have been used for the PCR method as the same as
Embodiment 1. Table 6 shows reaction conditions in Embodiment
2.
TABLE-US-00006 TABLE 6 Reaction conditions after profile at second
NA target detecting step is changed Reaction steps
Temperature(.degree. C.) Time(s) Initial denaturation 95 T.sub.0
120 Amplification 95 T.sub.0 10 (FL measurement) (1-44 cycles) 70
T.sub.1 10 72 T.sub.2 10 (FL measurement) Second target NA
detecting 55 T.sub.3 10 (FL measurement)
[0108] At the second target detection step in Embodiment 2,
fluorescence measurement has been conducted at 55 Centigrade. FIG.
8 shows fluorescent measurement conditions at the final cycle of
the amplification reaction and at the second target detection
step.
[0109] In Embodiment 2, fe has been calculated as follows.
Calculation other than fe has been carried out as the same as
Embodiment 1.
fe=fhyb.e/fden.44
herein, fe: fluorescence intensity value at the second target
detection step; fhyb.e: fluorescence intensity value (55
Centigrade) at the second target detection step; fden. 44:
fluorescence intensity value (95 Centigrade) at the final cycle of
amplification reaction.
[0110] Determination in Embodiment 2 has been performed as
below.
[0111] The F44 value of the measurement sample has been compared
with Threshold 3. And, when the F44 value of the measurement sample
is lower than Threshold 3, it has been determined that the first
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0112] As Threshold 3, an average of F44 values of the negative
reference minus three times the standard deviation (hereinafter,
called as "mean-3SD") has been used.
[0113] Notwithstanding the first target nucleic acid is positive or
negative, the Fs value has been compared with Threshold 4, and when
the Fs value is lower than Threshold 4 it has been determined that
the second target nucleic acid is positive (existence), otherwise
negative (nonexistence).
[0114] As Threshold 4, the value of "mean-3SD" of a sample to which
only the pMYC plasmid is added has been used.
[0115] Regarding an amplification curve of the negative reference,
extinction has not observed until 44 cycles when the PCR ends. This
is because a value 0.998 of F44 is not lower than a value 0.997 of
Threshold 3. At this time, "mean-3SD" is equal to 0.997 to be
regarded as Threshold 3 for the first target detection in this
Embodiment, thereby being shown in Table 7. The amplification curve
related thereto is also shown in FIG. 9.
[0116] Regarding another amplification curve of the pMYC plasmid of
the first target nucleic acid, extinction caused by annealing of
MYC QP has been observed from about 28 cycles. It has been revealed
that a value 0.912 of F44 has been lower than Threshold 3, and
further that the objective region of the pMYC plasmid has been
amplified.
[0117] At this time, "mean-3SD" of Fs has been equal to -0.052 to
be regarded as Threshold 4 for the second target detection, thereby
being shown in Table 7. The amplification curve related thereto is
also shown in FIG. 10.
[0118] Regarding an amplification curve of the pICMS plasmid, no
extinction has been observed during the amplification reaction.
This is because a value 0.997 of F44 is not lower than a value
0.997 of Threshold 3. A value -0.170 of Fs has been lower than
Threshold 4.
[0119] The above-mentioned results have revealed that the objective
region of the pMYC plasmid has been not amplified, further that the
objective region of the pICM5 plasmid has been amplified. Table 7
shows the value of Fs. The amplification curve is shown in FIG.
11.
TABLE-US-00007 TABLE 7 Values used for determination in QProbe
method after profile at second NA target detecting step is changed
TE pMYC pICM5 pMYC pICM5 F44 0.998 0.912 0.997 0.911 F44 0.997
.asterisk-pseud.1 -- -- -- (Average - 3SD) Fe 0.961 0.869 0.827
0.797 Fs -0.037 -0.043 -0.170 -0.114 Fs -- .sup. -0.052
.asterisk-pseud.2 -- -- (Average - 3SD) .asterisk-pseud.1 Threshold
3 .asterisk-pseud.2 Threshold 4
[0120] Regarding an amplification curve upon both the pMYC plasmid
of the first target nucleic acid and the pICM5 plasmid of the
second target nucleic acid have been added to the solution as the
above-mentioned amplification curve of the pMYC plasmid, extinction
caused by annealing of MYC QP has been observed from about 28
cycles. A value 0.911 of F 44 has been lower than Threshold 3, and
it has been revealed that the objective region of the pMYC plasmid
has been amplified.
[0121] The value -0.114 of Fs is lower than Threshold 4, and it has
been revealed that the objective region of the pICM5 plasmid has
been amplified. Table 7 shows the value of the Fs. The
amplification curve related thereto is shown in FIG. 12.
[0122] According to the above results, it has been revealed that
upon using the fluorescence intensity value (95 Centigrade) at the
final cycle of the amplification reaction (fden.44) the second
target can be detected.
Embodiment 3
[0123] <Detection of Mycoplasma pneumoniae P1 Genes and Internal
Control Composition Based on Eprobe Method>
[0124] Mycoplasma pneumoniae P1 genes and internal control
composition have been detected based on the Eprobe method.
[0125] The same primers and nucleic acid samples for PCR as
Embodiment 1 have been used. Table 8 shows probe information used
for the PCR in Embodiment 3.
TABLE-US-00008 TABLE 8 Probes used for PCR in this Embodiment Probe
Length name Sequence (5'.fwdarw.3') (bp) MYC EP
CCCTCGACCAAGCCAACCTCCAGCTC 26 (SEQ ID No. 3) IC EP AGTGGGACTCACCAAC
16 (SEQ ID No. 5)
[0126] A specific region for Eprobe has been selected referring to
Tm values calculated by means of "Edesign" software produced by the
K. K. Dnaform.
[0127] "MYC EP" is one Eprobe specifically annealing the pMYC
plasmid, and "IC EP" is another Eprobe specifically annealing the
pICM5 plasmid. As fluorescent dye for both of "MYC EP" and "IC EP",
"D514" has been used. The nineteenth "T" from 5' end of "MYC EP"
and the ninth "T" from 5' end of "IC EP" have been labeled,
respectively.
[0128] Production of the Eprobes has been performed by requesting
custom synthesis to the Eurofins Genomics K.K. The PCR reaction
solution composition and the reaction conditions are shown in Table
9 and Table 10.
TABLE-US-00009 TABLE 9 Composition of PCR solution in EProbe method
Solution composition Final concentration MilliQ(TM) water -- PCR
buffer .times.1 dNTP Mix 150 .mu.M MYC F 0.20 .mu.M MYC R 0.80
.mu.M MYC EP 0.40 .mu.M IC EP 0.40 .mu.M KOD exo (-) DNA Polymerase
0.0125 U/.mu.l Target nucleic acid -- The above has been prepared
to be 20 .mu.L
TABLE-US-00010 TABLE 10 Reaction conditions in EProbe method
Reaction steps Temperature(.degree. C.) Time(s) Initial
denaturation 95 T.sub.0 120 Amplification 95 T.sub.0 10 (FL
measurement) (1-40 cycles) 70 T.sub.1 10 72 T.sub.2 10 (FL
measurement) Second target NA detecting 95 T.sub.0 10 (FL
measurement) 55 T.sub.3 10 (FL measurement)
[0129] The combination of 530 to 548 [nm] has been selected for
excitation wavelength and fluorescent wavelength upon fluorescence
measurement.
[0130] Fs in Embodiment 3 has been calculated with the following
Formula. The other calculations have been carried out as the same
as Embodiment 1.
Fs=Fe-F40
[0131] Determination in Embodiment 3 has been performed using the
method shown below. The F40 value of the measurement sample has
been compared with Threshold 5. And, when the F40 value of the
measurement sample is higher than Threshold 5, it has been
determined that the first target nucleic acid is positive
(existence), otherwise negative (nonexistence).
[0132] As Threshold 5, an average of F40 values of the negative
reference plus three times the standard deviation (hereinafter,
called as "mean+3SD") has been used.
[0133] Notwithstanding the first target nucleic acid is positive or
negative, the Fs value has been compared with Threshold 6, and when
the Fs value is higher than Threshold 6, it has been determined
that the second target nucleic acid is positive (existence),
otherwise negative (nonexistence).
[0134] As Threshold 6, the value of "mean+3SD" of a sample to which
only the pMYC plasmid is added has been used. FIG. 13 shows a flow
chart of the determination method related thereto.
[0135] A first Tm value of 76.4 Centigrade has been set for a
sequence of MYC EP, and a second Tm value of 59.8 Centigrade has
been set for a sequence of IC EP. For this reason, it has been
estimated that probes anneal only MYC EP during the temperature
range (from 70 Centigrade to 95 Centigrade) in the PCR.
[0136] Since the fluorescence measurement with respect to the
second target detection step has been carried out at 95 Centigrade
and 55 Centigrade which is lower than the Tm value of IC EP, it has
been estimated that emission of both of MYC EP and the IC EP has
been simultaneously detected according to measured values at the
second target detection step.
[0137] Regarding an amplification curve of the negative reference,
emission has not observed until 40 cycles when the PCR ends. This
is because a value 1.007 of F40 is not higher than a value 1.013 of
Threshold 5. At this time, "mean+3SD" is equal to 1.013 to be
regarded as Threshold 5 for the first target detection, thereby
being shown in Table 11. The amplification curve related thereto is
also shown in FIG. 14.
[0138] Regarding another amplification curve of the pMYC plasmid of
the first target nucleic acid, emission caused by annealing of MYC
EP has been observed from about 29 cycles. It has been revealed
that a value 2.314 of F40 has been higher than Threshold 5, and
further that the objective region of the pMYC plasmid has been
amplified.
[0139] At this time, "mean+3SD" of Fs has been equal to 3.695 to be
regarded as Threshold 6 for the second target detection, thereby
being shown in Table 11. The amplification curve related thereto is
also shown in FIG. 15.
[0140] Regarding an amplification curve of the pICM5 plasmid of the
second target nucleic acid, no emission has been observed during
the amplification reaction. This is because a value 1.012 of F40 is
not higher than a value 1.013 of Threshold 5. A value 4.012 of Fs
has been higher than Threshold 6.
[0141] The above-mentioned results have revealed that the objective
region of the pMYC plasmid has been not amplified, further that the
objective region of the pICM5 plasmid has been amplified. The value
of Fs is shown in Table 11, and the amplification curve related
thereto is also shown in FIG. 16.
TABLE-US-00011 TABLE 11 Values used for determination in EProbe
method TE pMYC pICM5 pMYC pICM5 F40 1.007 2.314 1.012 2.355 F40
1.013 .asterisk-pseud.1 -- -- -- (Average + 3SD) Fe 3.149 5.837
5.024 6.609 Fs 2.142 3.523 4.012 4.254 Fs -- 3.695
.asterisk-pseud.2 -- -- (Average + 3SD) .asterisk-pseud.1 Threshold
5 .asterisk-pseud.2 Threshold 6
[0142] Regarding an amplification curve upon both the pMYC plasmid
of the first target nucleic acid and the pICM5 plasmid of the
second target nucleic acid have been added to the solution,
emission caused by annealing of MYC EP has been observed from about
29 cycles as the same as the above-mentioned amplification curve of
the pMYC plasmid. A value 2.355 of F40 has been higher than
Threshold 5, and it has been revealed that the objective region of
the pMYC plasmid has been amplified.
[0143] A value 4.254 of Fs is higher than Threshold 6, and it has
been revealed that the objective region of the pICM5 plasmid has
been amplified. Table 11 shows the value of the Fs. The
amplification curve related thereto is shown in FIG. 17.
[0144] According to the above-mentioned results, it has been
revealed that Mycoplasma pneumoniae P1 genes and internal control
composition can be detected by means of one reaction vessel
containing one kind of reaction solution and one kind of
fluorescent labels when the method of designing probes and
temperature profiles are combined even with the Eprobe method.
Embodiment 4
[0145] <Detection of Mycoplasma pneumoniae P1 Genes and Internal
Control Composition Based on TaqMan Probe Method>
[0146] According to the TaqMan probe method, Mycoplasma pneumoniae
P1 genes and internal control composition have been detected. The
primers and nucleic acid samples have been used for the PCR method
as the same of Embodiment 1.
[0147] Table 12 shows information of the probes used for the PCR
method in Embodiment 4.
TABLE-US-00012 TABLE 12 Probes used for PCR in this Embodiment
Probe Length name Sequence (5'.fwdarw.3') (bp) MYC Taq
CCCTCGACCAAGCCAACCTCCAGCTC 26 (SEQ ID No. 3) IC Taq
AGTGGGACTCACCAACC 17 (SEQ ID No. 4)
[0148] A specific region for the TaqMan probe has been selected
referring to Tm values calculated according to the nearest neighbor
method.
[0149] "MYC Taq" is one TaqMan probe specifically annealing the
pMYC plasmid, and "IC Taq" is another TaqMan probe specifically
annealing the pICM5 plasmid. As fluorescent dye for both of "MYC
Taq" and "IC Taq", "FAM" (registered trademark) has been used to be
labeled at 5' end and "TAMRA" (registered trademark) has been used
to be labeled at 3' end, respectively.
[0150] Production of the TaqMan probes has been performed by
requesting custom synthesis to the Takara Bio Inc. Table 13 and
Table 14 show composition of PCR solution and reaction conditions
related thereto, respectively.
TABLE-US-00013 TABLE 13 Composition of PCR solution in TaqMan Probe
method Solution composition Solution composition MilliQ(TM) water
-- PCR buffer .times.1 dNTP Mix 150 .mu.M MYC F 0.50 .mu.M MYC R
0.50 .mu.M MYC Taq 0.30 .mu.M IC Taq 0.30 .mu.M TaKaRa Ex Taq (TM)
0.025 U/.mu.l Target nucleic acid -- The above has been prepared to
be 20 .mu.L
TABLE-US-00014 TABLE 14 Reaction conditions in TaqMan probe method
Reaction steps Temperature(.degree. C.) Time(s) Initial
denaturation 95 T.sub.0 120 Amplification 95 T.sub.0 5 (FL
measurement) (1-44 cycles) 70 T.sub.1 15 72 T.sub.2 0 (FL
measurement) Second target NA detecting 95 T.sub.0 5 (FL
measurement) 50 T.sub.3 15 (FL measurement)
[0151] The combination of 530 to 548 [nm] has been selected for
excitation wavelength and fluorescent wavelength upon fluorescence
measurement.
[0152] At a step for detecting the second target (95 Centigrade and
50 Centigrade) after amplification reaction, fluorescence
measurement has been performed.
[0153] In Embodiment 4, thyb.e has been defined as a fluorescence
intensity value (50 Centigrade), and the same calculation except
this point as Embodiment 1 has been conducted.
[0154] Determination in Embodiment 4 has been performed as
below.
[0155] The F44 value of the measurement sample has been compared
with Threshold 7. And, when the F44 value of the measurement sample
is higher than Threshold 7, it has been determined that the first
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0156] As Threshold 7, an average of F44 values of the negative
reference plus three times the standard deviation (hereinafter,
called as "mean+3SD") has been used.
[0157] Notwithstanding the first target nucleic acid is positive or
negative, the Fs value has been compared with Threshold 8, and when
the Fs value is higher than Threshold 8, it has been determined
that the second target nucleic acid is positive (existence),
otherwise negative (nonexistence).
[0158] As Threshold 8, the value of "mean+3SD" of a sample to which
only the pMYC plasmid is added has been used.
[0159] A first Tm value of 75.8 Centigrade has been set for a
sequence of MYC Taq, and a second Tm value of 53.7 Centigrade has
been set for a sequence of IC Taq. For this reason, it has been
estimated that probes anneal only MYC Taq during the temperature
range (from 70 Centigrade to 95 Centigrade) in the PCR.
[0160] Since the fluorescence measurement with respect to the
second target detection step has been carried out at 95 Centigrade
and 50 Centigrade which is lower than the Tm value of IC Taq, it
has been estimated that emission of both of MYC Taq and the IC Taq
has been simultaneously detected according to measured values at
the second target detection step.
[0161] Regarding an amplification curve of the negative reference,
emission has not observed until 44 cycles when the PCR ends. This
is because a value 1.028 of F44 is not higher than a value 1.028 of
Threshold 7. At this time, "mean+3SD" is equal to 1.028 to be
regarded as Threshold 7 for the first target detection, thereby
being shown in Table 15. The amplification curve related thereto is
also shown in FIG. 18.
[0162] Regarding another amplification curve of the pMYC plasmid of
the first target nucleic acid, emission caused by annealing of MYC
Taq has been observed from about 28 cycles. It has been revealed
that a value 1.427 of F44 has been higher than Threshold 7, and
further that the objective region of the pMYC plasmid has been
amplified.
[0163] At this time, "mean+3SD" of Fs has been equal to 0.110 to be
regarded as Threshold 8 for the second target detection, thereby
being shown in Table 15. The amplification curve related thereto is
also shown in FIG. 19.
TABLE-US-00015 TABLE 15 Values used for determination in TagMan
Probe method TE pMYC pICM5 pMYC pICM5 F44 1.028 1.427 1.028 1.348
F44 1.028 .asterisk-pseud.1 -- -- -- (Average + 3SD) Fe 1.060 1.536
1.158 1.525 Fs 0.032 0.109 0.130 0.177 Fs -- 0.110
.asterisk-pseud.2 -- -- (Average + 3SD) .asterisk-pseud.1 Threshold
7 .asterisk-pseud.2 Threshold 8
[0164] Regarding an amplification curve of the pICM5 plasmid of the
second target nucleic acid, no emission has been observed during
the amplification reaction. This is because a value 1.028 of F44 is
not higher than a value 1.028 of Threshold 7. A value 0.130 of Fs
has been higher than Threshold 8.
[0165] The above-mentioned results have revealed that the objective
region of the pMYC plasmid has been not amplified, further that the
objective region of the pICM5 plasmid has been amplified.
[0166] Table 15 shows the value of the Fs. The amplification curve
is shown in FIG. 20.
[0167] Regarding an amplification curve upon both the pMYC plasmid
of the first target nucleic acid and the pICM5 plasmid of the
second target nucleic acid have been added to the solution,
emission caused by annealing of MYC EP has been observed from about
29 cycles as the same as the above-mentioned amplification curve of
the pMYC plasmid. A value 1.348 of F40 has been higher than
Threshold 7, and it has been revealed that the objective region of
the pMYC plasmid has been amplified.
[0168] A value 0.177 of Fs is higher than Threshold 8, and it has
been revealed that the objective region of the pICM5 plasmid has
been amplified. Table 15 shows the value of the Fs. The
amplification curve related thereto is shown in FIG. 21.
[0169] According to the above-mentioned results, it has been
revealed that Mycoplasma pneumoniae P1 genes and internal control
composition can be detected by means of one reaction vessel
containing one kind of reaction solution and one kind of
fluorescent labels when the method of designing probes and
temperature profiles are incorporated with even the TaqMan probe
method.
Embodiment 5
[0170] <Detection of Mycoplasma Pneumoniae P1 Genes and Internal
Control Composition Based on QProbe Method with Actual
Specimen>
[0171] According to the QProbe method, Mycoplasma pneumoniae P1
genes and internal control composition have been detected by means
of actual specimens.
[0172] As Mycoplasma pneumoniae P1 genes, first total DNA has been
used, the first total DNA having been extracted from first pharynx
wiping liquid of which Mycoplasma pneumoniae has been determined to
be positive (tested by the BML, Inc.) according to the LAMP method
(Japanese registered patent No. 3313358) by means of a "QIAamp" DNA
mini Kit (registered trademark of the QIAGEN).
[0173] As negative samples, second total DNA has been used, the
second total DNA having been extracted from second pharynx wiping
liquid of which Mycoplasma pneumoniae has been determined to be
negative according to the LAMP method by means of the "QIAamp" DNA
mini Kit. PCR has been carried out under the same conditions other
than this point as those of Embodiment 1.
[0174] The same calculation as Embodiment 1 has been performed on
obtained raw data related thereto.
[0175] Determination in Embodiment 5 has been performed as
below.
[0176] The F44 value of the measurement sample has been compared
with Threshold 9. And, when the F44 value of the measurement sample
is lower than Threshold 9, it has been determined that the first
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0177] As Threshold 9, an average of F44 values of the negative
reference minus three times the standard deviation (hereinafter,
called as "mean-3SD") has been used.
[0178] Notwithstanding the first target nucleic acid is positive or
negative, the Fs value has been compared with Threshold 10, and
when the Fs value is lower than Threshold 10, it has been
determined that the second target nucleic acid is positive
(existence), otherwise negative (nonexistence). As Threshold 10,
the value of "mean-3SD" with respect to Fs of the positive sample
has been used.
[0179] Regarding an amplification curve of the negative reference,
extinction has not observed until 44 cycles when the PCR ends. This
is because a value 0.997 of F44 is not lower than a value 0.997 of
Threshold 9. At this time, "mean-3SD" is equal to 0.997 to be
regarded as Threshold 9 for the first target detection in this
Embodiment, thereby being shown in Table 16. The amplification
curve related thereto is also shown in FIG. 22.
[0180] Regarding another amplification curve of the positive
reference of the first target nucleic acid, extinction caused by
annealing of MYC QP has been observed from about cycles. It has
been revealed that a value 0.951 of F44 has been lower than
Threshold 9, and further that the objective region of the pMYC
plasmid has been amplified.
[0181] At this time, "mean-3SD" of Fs has been equal to -0.132 to
be regarded as Threshold for the second target detection, thereby
being shown in Table 16. The amplification curve related thereto is
also shown in FIG. 23.
[0182] Regarding an amplification curve of the pICM5 plasmid of the
second target nucleic acid, no extinction has been observed during
the amplification reaction. This is because a value 0.998 of F44 is
not lower than a value 0.997 of Threshold 9. A value -0.227 of Fs
has been lower than Threshold 10.
[0183] The above-mentioned results have revealed that the objective
region of the pMYC plasmid has been not amplified, further that the
objective region of the pICM5 plasmid has been amplified. A value
of Fs is shown in Table 16, and the amplification curve related
thereto is also shown in FIG. 24.
[0184] Regarding an amplification curve upon the positive reference
of the first target nucleic acid has been added to the pICM5
plasmid of the second target nucleic acid, extinction caused by
annealing of MYC QP has been observed from about 35 cycles as the
same as the amplification curve of the positive reference. A value
0.953 of F44 has been lower than Threshold 9, and it has been
revealed that the objective region of the pMYC plasmid has been
amplified.
[0185] A value -0.235 of Fs is lower than Threshold 10, and it has
been revealed that the objective region of the pICM5 plasmid has
been amplified. Table 16 shows the value of the Fs. The
amplification curve related thereto is shown in FIG. 25.
TABLE-US-00016 TABLE 16 Values used for determination in QProbe
method with actual specimen positive negative positive sample
sample sample pICM5 pICM5 F44 0.997 0.951 0.998 0.953 F44 0.997
.asterisk-pseud.1 -- -- -- (Average - 3SD) Fe 0.920 0.824 0.771
0.718 Fs -0.077 -0.127 -0.227 -0.235 Fs -- .sup. -0.132
.asterisk-pseud.2 -- -- (Average - 3SD) .asterisk-pseud.1 Threshold
9 .asterisk-pseud.2 Threshold 10
[0186] According to the above-mentioned results, it has been
revealed that Mycoplasma pneumoniae P1 genes and internal control
composition can be detected by means of one reaction vessel
containing one kind of reaction solution and one kind of
fluorescent labels when the method of designing probes and
temperature profiles are incorporated with the actual clinical
specimens.
[0187] The present invention is also applicable for identifying
subtypes and/or single nucleotide polymorphism of pathogenic
organisms causing infectious diseases.
Embodiment 6
<Detection of Chlamydia Trachomatis Endogeneous Plasmid Gene and
Neisseria Gonorrhoeae CMT Gene Based on QProbe Method>
[0188] According to the QProbe method, detection of Chlamydia
trachomatis endogeneous plasmid genes and Neisseria gonorrhoeae CMT
genes has been carried out.
(pCT)
[0189] Production of pCT plasmids has been performed by requesting
custom synthesis to the Hokkaido System Science Co., Ltd. Gene
fragments of common endogenous plasmids (pLGV440) of Chlamydia
trachomatis which are pathogenic organisms causing Chlamydia
infection have been artificially synthesized into plasmid DNA to be
incorporated into a pUC57 vector, thereby having prepared the pCT
plasmids.
(pNG)
[0190] Production of pNG plasmids has also been performed by
requesting custom synthesis to the Hokkaido System Science Co.,
Ltd. Gene fragments of cytosine DNA methyl transferase (CMT) of
Neisseria gonorrhoeae which is a pathogenic organism causing
gonorrhea have been artificially synthesized into plasmid DNA to be
incorporated into a pUCS7 vector, thereby having prepared the pNG
plasmids.
[0191] First length of the pCT plasmid is 3064 [bp], and second
length of the pNG plasmid is 3059 [bp].
[0192] Based on the first and second length and the concentration
(.mu.g/.mu.l) of plasmid solution, the number of copies per 1
[.mu.l] has been calculated. After that, by means of TE buffer
solution (10 [mM] Tris-HCl, 1.0 [mM] EDTA pH: 8.0), both of the pCT
plasmids and the pNG plasmids have been diluted to be
1.times.10.sup.5 [copies/.mu.l].
[0193] Primer pairs used in the PCR method in Embodiment 6 are as
shown in Table 17.
TABLE-US-00017 TABLE 17 Primers used for PCR in this Embodiment
Probe Length name Sequence (5'.fwdarw.3') (bp) CT F
TGAGCACCCTAGGCGTTTGTACTCCGTCAC 30 (SEQ ID No. 6) CT R
GCACTTTCTACAAGAGTACATCGGTCAACGAAGAGG 36 (SEQ ID No. 7) NG F
GGGCGTGGTTGAACTGGCAAAAAGC 25 (SEQ ID No. 8) NG R
CAGTGATTTTGGCATTGGCGATATTGG 27 (SEQ ID No. 9)
[0194] Information of thEprobes used in the PCR method in
Embodiment 6 is as shown in Table 18.
TABLE-US-00018 TABLE 18 Probes used for PCR in this Embodiment
Probe Length name Sequence (5'.fwdarw.3') (bp) CT QP
TGCGGGCGATTTGCCTTAACCCCACC 26 (SEQ ID No. 10) NG QP
CTAAGCAAAATTCGAGGGGGAAAAC 25 (SEQ ID No. 11)
[0195] Based on a basic sequence of PCR products capable of being
amplified by means of the pair of primers of SEQ ID NO: 6 and SEQ
ID NO: 7, a specific region for CT QP has been selected referring
to Tm values calculated with a QProbe design support tool on the
J-Bio21 Center home pages.
[0196] Based on a basic sequence of PCR products capable of being
amplified by means of the pair of primers of SEQ ID NO: 8 and SEQ
ID NO: 9, a specific region for NG QP has been selected referring
to Tm values calculated with the QProbe design support tool on the
J-Bio21 Center home pages.
[0197] "CT QP" is one QProbe specifically annealing the pCT
plasmid, and "NG QP" is another QProbe specifically annealing the
pNG plasmid. As fluorescent dye for both of "CT QP" and "NG QP",
"BODIPY FL" (registered trademark) has been used to label "C" at 3'
ends, respectively.
[0198] Production of the QProbes has been performed by requesting
custom synthesis to the NIPPON STEEL & SUMIKIN Eco-Tech
Corporation. Table 19 and Table 20 show composition of PCR solution
and reaction conditions related thereto, respectively.
TABLE-US-00019 TABLE 19 Composition of PCR solution Solution
composition Final concentration MilliQ(TM) water -- PCR buffer
.times.1 dNTP Mix 150 .mu.M CT F 0.20 .mu.M CT R 0.60 .mu.M CT QP
0.15 .mu.M NG F 0.20 .mu.M NG R 0.60 .mu.M NG QP 0.15 .mu.M KOD exo
(-) DNA Polymerase 0.0125 U/.mu.l Target nucleic acid -- The above
has been prepared to be 20 .mu.L
TABLE-US-00020 TABLE 20 Reaction conditions of CT NG in QProbe
method Reaction steps Temperature(.degree. C.) Time(s) Initial
denaturation 95 T.sub.0 120 Amplification 95 T.sub.0 5 (FL
measurement) (1-44 cycles) 68 T.sub.1, T.sub.2 15 (FL measurement)
Second target NA detecting 95 T.sub.0 5 (FL measurement) 55 T.sub.3
12 (FL measurement)
[0199] The combination of 510 to 528 [nm] has been selected for
excitation wavelength and fluorescent wavelength upon fluorescence
measurement.
[0200] Fluorescence values have been measured at the denaturation
step (95 Centigrade) and the elongation step (68 Centigrade) for
every cycle. Furthermore, after the amplification reaction has been
completed, at a step for detecting the second target (95 Centigrade
and 55 Centigrade), fluorescence measurement has been
performed.
[0201] The same calculation as that of Embodiment 1 has been
performed on obtained raw data related thereto.
[0202] Determination according to the QProbe method has been
performed using the method shown below.
[0203] The F44 value of the measurement sample has been compared
with Threshold 1. And, when the F44 value of the measurement sample
is lower than Threshold 11, it has been determined that the first
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0204] As Threshold 11, an average of F44 values of the negative
reference minus three times the standard deviation (hereinafter,
called as "mean-3SD") has been used.
[0205] Notwithstanding the first target nucleic acid is positive or
negative, the Fs value has been compared with Threshold 12, and
when the Fs value is lower than Threshold 12, it has been
determined that the second target nucleic acid is positive
(existence), otherwise negative (nonexistence).
[0206] As Threshold 12, the value of "mean-3SD" of a sample to
which only the pNG plasmid is added has been used.
[0207] A first Tm value of 73.4 Centigrade has been set for a
sequence of CT QP, and a second Tm value of 62.5 Centigrade has
been set for a sequence of NG QP. For this reason, it has been
estimated that probes anneal only CT QP during the temperature
range (from 68 Centigrade to 95 Centigrade) in the PCR.
[0208] Since the fluorescence measurement with respect to the
second target detection step has been carried out at 95 Centigrade
and 55 Centigrade which is lower than the Tm value of NG QP, it has
been estimated that extinction of both of CT QP and the NG QP has
been simultaneously detected according to measured values at the
second target detection step.
[0209] Regarding an amplification curve of the negative reference,
extinction has not observed until 44 cycles when the PCR ends. This
is because a value 0.998 of F44 is not lower than a value 0.996 of
Threshold 11. At this time, "mean-3SD" is equal to 0.996 to be
regarded as Threshold 11 for the first target detection in this
Embodiment, thereby being shown in Table 21. The amplification
curve related thereto is also shown in FIG. 26.
[0210] Regarding another amplification curve of the pCT plasmid of
the first target nucleic acid, extinction caused by annealing of CT
QP has been observed from about 28 cycles. It has been revealed
that a value 0.720 of F44 has been lower than Threshold 11, and
further that the objective region of the pCT plasmid has been
amplified.
[0211] At this time, "mean-3SD" of Fs has been equal to -0.039 to
be regarded as Threshold 12 for the second target detection,
thereby being shown in Table 21. The amplification curve related
thereto is also shown in FIG. 27.
[0212] Regarding an amplification curve of the pNG plasmid of the
second target nucleic acid, no extinction has been observed during
the amplification reaction. This is because a value 0.998 of F44 is
not lower than a value 0.996 of Threshold 11. A value -0.065 of Fs
has been lower than Threshold 12.
[0213] The above-mentioned results have revealed that the objective
region of the pCT plasmid has been not amplified, further that the
objective region of the pNG plasmid has been amplified. Table 21
shows the value of the Fs. The amplification curve is shown in FIG.
28.
TABLE-US-00021 TABLE 21 Values used for determination of second
item in QProbe method TE pCT pNG pCT pNG F44 0.998 0.720 0.998
0.729 F44 0.996 .asterisk-pseud.1 -- -- -- (Average - 3SD) Fe 1.009
0.681 0.933 0.618 Fs 0.011 -0.039 -0.065 -0.111 Fs -- .sup. -0.039
.asterisk-pseud.2 -- -- (Average - 3SD) .asterisk-pseud.1 Threshold
11 .asterisk-pseud.2 Threshold 12
[0214] Regarding an amplification curve upon both the pCT plasmid
of the first target nucleic acid and the pNG plasmid of the second
target nucleic acid have been added to the solution, extinction
caused by annealing of CT QP has been observed from about 28 cycles
as the same as the above-mentioned amplification curve of the pCT
plasmid. A value 0.729 of F44 has been lower than Threshold 11, and
it has been revealed that the objective region of the pCT plasmid
has been amplified.
[0215] A value -0.111 of Fs is lower than Threshold 12, and it has
been revealed that the objective region of the pNG plasmid has been
amplified. Table 21 shows the value of the Fs. The amplification
curve related thereto is shown in FIG. 29.
[0216] According to the above-mentioned results, it has been
revealed that Mycoplasma pneumoniae P1 genes and internal control
composition can be detected by means of one reaction vessel
containing one kind of reaction solution and one kind of
fluorescent labels when the method of designing probes and
temperature profiles are incorporated with two items of genes.
Embodiment 7
[0217] <Detection of Mycoplasma pneumoniae P1 Genes and Internal
Control Composition Based on QProbe Method to Detect Plural Times
the Second Target in Amplification Reaction>
[0218] Not only after the final cycle but also during the
amplification reaction, the second target detection step has been
carried out in an inserted manner, and detection of Mycoplasma
pneumoniae P1 genes and internal control composition has been
performed based on the QProbe method.
[0219] The primers, probes, reaction solution composition, and
nucleic acids have been used for the PCR method as the same as
Embodiment 1. Table 22 shows reaction conditions thereof.
TABLE-US-00022 TABLE 22 Reaction conditions of second target
detecting step in QProbe method in Embodiment 7 Reaction steps
Temperature(.degree. C.) Time(s) Initial denaturation 95 T.sub.0
120 Amplification 95 T.sub.0 10 (FL measurement) (1-20 cycles) 70
T.sub.1 10 72 T.sub.2 10 (FL measurement) Second target NA 95
T.sub.0 10 (FL measurement) detecting first time 55 T.sub.3 10 (FL
measurement) Amplification 95 T.sub.0 10 (FL measurement) (21-27
cycles) 70 T.sub.1 10 72 T.sub.2 10 (FL measurement) Second target
NA 95 T.sub.0 10 (FL measurement) detecting second time 55 T.sub.3
10 (FL measurement) Amplification 95 T.sub.0 10 (FL measurement)
(28-34 cycles) 70 T.sub.1 10 72 T.sub.2 10 (FL measurement) Second
target NA 95 T.sub.0 10 (FL measurement) detecting third time 55
T.sub.3 10 (FL measurement) Amplification 95 T.sub.0 10 (FL
measurement) (35-41 cycles) 70 T.sub.1 10 72 T.sub.2 10 (FL
measurement) Second target NA 95 T.sub.0 10 (FL measurement)
detecting fourth time 55 T.sub.3 10 (FL measurement)
[0220] FIG. 30 is a graph of changes of temperature in the
amplification reaction.
[0221] In analysis of Embodiment 7, the same steps as Embodiment 1
except the following calculation have been carried out.
fen.sup.=fhyb.en/fden.en (Formula 4)
herein, fen: fluorescence intensity value in n times second target
detection step calculated according to Formula 4; fhyb.en:
fluorescence intensity value (55 Centigrade) in n times second
target detection step; and fden.en: fluorescence intensity value
(95 Centigrade) in n times second target detection step.
Fen=fen/f10 (Formula 5)
herein, Fen: relative value in n times second target detection step
assuming that the fluorescence intensity value in the tenth cycle
obtained according to Formula 4 is equal to a value of "1."
Fs1=Fe1-F20 (Formula 6)
Fs2=Fe2-F27 (Formula 6')
Fs3=Fe3-F34 (Formula 6'')
Fs4=Fe4-F41 (Formula 6''')
herein, Fs1: measurement value in first time second target
detection step; Fs2: measurement value in second time second target
detection step; Fs3: measurement value in third time second target
detection step; and Fs4: measurement value in fourth time second
target detection step.
[0222] Determination has been performed using the method shown
below.
[0223] The F41 value of the measurement sample has been compared
with Threshold 13. And, when the F41 value of the measurement
sample is lower than Threshold 13, it has been determined that the
first target nucleic acid is positive (existence), otherwise
negative (nonexistence).
[0224] As Threshold 13, an average of F41 values of the negative
reference minus three times the standard deviation (hereinafter,
called as "mean-3SD") has been used.
[0225] In the first time second target detection step, the Fs1
value has been compared with Threshold 14, and when the Fs1 value
is lower than Threshold 14, it has been determined that the second
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0226] As Threshold 14, the value of "mean-3SD" regarding the Fs1
value of a sample to which only the pMYC plasmid is added has been
used.
[0227] In the second time second target detection step, the Fs2
value has been compared with Threshold 15, and when the Fs2 value
is lower than Threshold 15 it has been determined that the second
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0228] As Threshold 15, the value of "mean-3SD" regarding the Fs2
value of a sample to which only the pMYC plasmid is added has been
used.
[0229] In the third time second target detection step, the Fs3
value has been compared with Threshold 16, and when the Fs3 value
is lower than Threshold 16 it has been determined that the second
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0230] As Threshold 16, the value of "mean-3SD" regarding the Fs3
value of a sample to which only the pMYC plasmid is added has been
used.
[0231] In the fourth time second target detection step, the Fs4
value has been compared with Threshold 17, and when the Fs4 value
is lower than Threshold 17 it has been determined that the second
target nucleic acid is positive (existence), otherwise negative
(nonexistence).
[0232] As Threshold 17, the value of "mean-3SD" regarding the Fs4
value of a sample to which only the pMYC plasmid is added has been
used.
[0233] Regarding an amplification curve of the negative reference,
extinction has not observed until 41 cycles when the PCR ends. This
is because a value 0.999 of F41 is not lower than a value 0.998 of
Threshold 13. At this time, "mean-3SD" is equal to 0.998 to be
regarded as Threshold 13 for the first target detection in this
Embodiment, thereby being shown in Table 23. The amplification
curve related thereto is also shown in FIG. 31.
[0234] Regarding another amplification curve of the pMYC plasmid of
the first target nucleic acid, extinction caused by annealing of
MYC QP has been observed from about 30 cycles. It has been revealed
that a value 0.892 of F41 has been lower than Threshold 13, and
further that the objective region of the pMYC plasmid has been
amplified.
[0235] At this time, "mean-3SD" of Fs1 has been equal to -0.058,
"mean-3SD" of Fs2 has been equal to -0.070, "mean-3SD" of Fs3 has
been equal to -0.080, and "mean-3SD" of Fs4 has been equal to
-0.087 to be regarded as Threshold 14, Threshold 15, Threshold 16,
and Threshold 17 for the second target detection, respectively,
thereby being shown in Table 23. The amplification curve related
thereto is also shown in FIG. 32.
TABLE-US-00023 TABLE 23 Values used for determination at second
target detecting step in QProbe method in Embodiment 7 TE pMYC
pICM5 pMYC pICM5 F20 0.999 0.999 0.999 0.999 Fe1 0.941 0.941 0.941
0.941 Fs1 -0.058 -0.058 -0.058 -0.058 Fs1 -- .sup. -0.058
.asterisk-pseud.2 -- -- (Average - 3SD) F27 0.999 0.999 1.000 0.999
Fe2 0.941 0.930 0.943 0.930 Fs2 -0.058 -0.068 -0.057 -0.068 Fs2 --
.sup. -0.070 .asterisk-pseud.3 -- -- (Average - 3SD) F34 0.999
0.949 1.000 0.951 Fe3 0.941 0.870 0.916 0.842 Fs3 -0.058 -0.079
-0.084 -0.109 Fs3 -- .sup. -0.080 .asterisk-pseud.4 -- -- (Average
- 3SD) F41 0.999 0.892 0.999 0.897 F41 0.998 .asterisk-pseud.1 --
-- -- (Average - 3SD) Fe4 0.940 0.812 0.805 0.743 Fs4 -0.058 -0.080
-0.192 -0.154 Fs4 -- .sup. -0.087 .asterisk-pseud.5 -- -- (Average
- 3SD) .asterisk-pseud.1 Threshold 13 .asterisk-pseud.2 Threshold
14 .asterisk-pseud.3 Threshold 15 .asterisk-pseud.4 Threshold 16
.asterisk-pseud.5 Threshold 17
[0236] Regarding an amplification curve of the pICM5 plasmid of the
second target nucleic acid, no extinction has been observed during
the amplification reaction except in the respective second target
detection steps. This is because a value 0.999 of F41 is not lower
than a value 0.998 of Threshold 13. A value -0.058 of Fs1 has been
higher than Threshold 14, and it has been revealed that the
objective region of the pICM5 plasmid has not been amplified up to
an identification limit until the first time second target
detection step.
[0237] A value -0.057 of Fs2 has been higher than Threshold 15, and
it has been revealed that the objective region of the pICM5 plasmid
has not been amplified up to the identification limit until the
second time second target detection step.
[0238] A value -0.084 of Fs3 has been lower than Threshold 16, and
it has been revealed that the objective region of the pICM5 plasmid
has been amplified beyond the identification limit until the third
time second target detection step.
[0239] A value -0.192 of Fs4 has also been lower than Threshold 17.
Table 23 shows the values of the Fs1, Fs2, Fs3 and Fs4. The
amplification curves are shown in FIG. 33.
[0240] Regarding an amplification curve upon both the pMYC plasmid
of the first target nucleic acid and the pICM5 plasmid of the
second target nucleic acid have been added to the solution,
extinction caused by annealing of MYC QP has been observed from
about 30 cycles as the same as the amplification curve of the pMYC
plasmid. A value 0.897 of F41 has been lower than Threshold 13, and
it has been revealed that the objective region of the pMYC plasmid
has been amplified.
[0241] A value -0.058 of Fs1 has been higher than Threshold 14, and
it has been revealed that the objective region of the pICM5 plasmid
has not been amplified beyond the identification limit until the
first time second target detection step.
[0242] A value -0.068 of Fs2 has been also higher than Threshold
15, and it has been revealed that the objective region of the pICM5
plasmid has not been amplified beyond the identification limit
until the second time second target detection step.
[0243] A value -0.109 of Fs3 has been lower than Threshold 16, and
it has been revealed that the objective region of the pICM5 plasmid
has been amplified beyond the identification limit until the third
time second target detection step.
[0244] A value -0.154 of Fs4 has also been lower than Threshold 17.
Table 23 shows the values of the Fs1, Fs2, Fs3 and Fs4. The
amplification curves are shown in FIG. 34.
[0245] According to the above-mentioned results, also in a case
where the second target detection step has been carried out in the
inserted manner not only after the final cycle but also within the
amplification reaction, it has been revealed that Mycoplasma
pneumoniae P genes and internal control composition can be
detected.
BRIEF DESCRIPTION OF THE DRAWINGS
[0246] FIG. 1 is a graph showing changes of temperature within
mixed-solution in Embodiment 1 according to the present
invention;
[0247] FIG. 2 is a timing explanatory diagram of fluorometry in
Embodiment 1 according to the present invention;
[0248] FIG. 3 is a flow chart showing a determination method in
Embodiment 1 according to the present invention;
[0249] FIG. 4 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 1 according to the
present invention;
[0250] FIG. 5 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 1 according to
the present invention;
[0251] FIG. 6 is a graph showing changes of fluorescence intensity
regarding a second target nucleic acid in Embodiment 1 according to
the present invention;
[0252] FIG. 7 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 1 according to the present
invention;
[0253] FIG. 8 is a timing explanatory diagram of fluorometry in
Embodiment 2 according to the present invention;
[0254] FIG. 9 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 2 according to the
present invention;
[0255] FIG. 10 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 2 according to
the present invention;
[0256] FIG. 11 is a graph showing changes fluorescence intensity
regarding a second target nucleic acid in Embodiment 2 according to
the present invention;
[0257] FIG. 12 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 2 according to the present
invention;
[0258] FIG. 13 is a flow chart showing a determination method in
Embodiment 3 according to the present invention;
[0259] FIG. 14 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 3 according to the
present invention;
[0260] FIG. 15 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 3 according to
the present invention;
[0261] FIG. 16 is a graph showing changes of fluorescence intensity
regarding a second target nucleic acid in Embodiment 3 according to
the present invention;
[0262] FIG. 17 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 3 according to the present
invention;
[0263] FIG. 18 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 4 according to the
present invention;
[0264] FIG. 19 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 4 according to
the present invention;
[0265] FIG. 20 is a graph showing changes of fluorescence intensity
regarding a second target nucleic acid in Embodiment 4 according to
the present invention;
[0266] FIG. 21 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 4 according to the present
invention;
[0267] FIG. 22 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 5 according to the
present invention;
[0268] FIG. 23 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 5 according to
the present invention;
[0269] FIG. 24 is a graph showing changes of fluorescence intensity
regarding a second target nucleic acid in Embodiment 5 according to
the present invention;
[0270] FIG. 25 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 5 according to the present
invention;
[0271] FIG. 26 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 6 according to the
present invention;
[0272] FIG. 27 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 6 according to
the present invention;
[0273] FIG. 28 is a graph showing changes of fluorescence intensity
regarding a second target nucleic acid in Embodiment 6 according to
the present invention;
[0274] FIG. 29 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 6 according to the present
invention;
[0275] FIG. 30 is a graph showing changes of temperature within
mixed-solution in Embodiment 7 according to the present
invention;
[0276] FIG. 31 is a graph showing changes of fluorescence intensity
regarding a negative reference in Embodiment 7 according to the
present invention;
[0277] FIG. 32 is a graph showing changes of fluorescence intensity
regarding a first target nucleic acid in Embodiment 7 according to
the present invention;
[0278] FIG. 33 is a graph showing changes of fluorescence intensity
regarding a second target nucleic acid in Embodiment 7 according to
the present invention;
[0279] FIG. 34 is a graph showing changes of fluorescence intensity
regarding the first target nucleic acid and the second target
nucleic acid in Embodiment 7 according to the present
invention;
[0280] FIG. 35 is an enlarged view of changes of temperature in
Embodiment 1 according to the present invention;
[0281] FIG. 36 is an explanatory diagram of mixed-solution
composition in Embodiment 1 according to the present invention;
[0282] FIG. 37(a) is an explanatory diagram of a denaturation step
in Embodiment 1 according to the present invention;
[0283] FIG. 37(b) is an explanatory diagram of an annealing step in
Embodiment 1 according to the present invention;
[0284] FIG. 37(c) is an explanatory diagram of an elongation step
in Embodiment 1 according to the present invention;
[0285] FIG. 37(d) is an explanatory diagram of an
elongation-completed step in Embodiment 1 according to the present
invention;
[0286] FIG. 38(a) is an explanatory diagram of the denaturation
step in Embodiment 1 according to the present invention; and
[0287] FIG. 38(b) is an explanatory diagram of the annealing step
in Embodiment 1 according to the present invention.
BRIEF DESCRIPTION OF SYMBOLS
[0288] 1: Vessel [0289] 2: Solution [0290] 10: First target nucleic
acid [0291] 13: First target's F-primer [0292] 14: First target's
R-primer [0293] 15: First target's probe [0294] 16: First labeling
substance [0295] 20: Second target nucleic acid [0296] 23: Second
target's F-primer [0297] 24: Second target's R-primer [0298] 25:
Second target's probe [0299] 26: Second labeling substance [0300]
30: DNA polymerase [0301] 31: Deoxyribonucleoside triphoshate
[0302] T0: Denaturation temperature [0303] T1: Annealing
temperature [0304] T2: Elongation temperature [0305] T3: Second
target detection temperature
Sequence CWU 1
1
11121DNAMycoplasma pneumoniae 1gccaccctcg ggggcagtca g
21222DNAMycoplasma pneumoniae 2gagtcgggat tccccgcgga gg
22326DNAMycoplasma pneumoniae 3ccctcgacca agccaacctc cagctc
26417DNAArtificial Sequencerandom sequence 4agtgggactc accaacc
17516DNAArtificial Sequencerandom sequence 5agtgggactc accaac
16630DNAChlamydia trachomatis 6tgagcaccct aggcgtttgt actccgtcac
30736DNAChlamydia trachomatis 7gcactttcta caagagtaca tcggtcaacg
aagagg 36825DNANeisseria gonorrhoeae 8gggcgtggtt gaactggcaa aaagc
25927DNANeisseria gonorrhoeae 9cagtgatttt ggcattggcg atattgg
271026DNAChlamydia trachomatis 10tgcgggcgat ttgccttaac cccacc
261125DNANeisseria gonorrhoeae 11ctaagcaaaa ttcgaggggg aaaac 25
* * * * *