U.S. patent application number 15/668824 was filed with the patent office on 2018-05-17 for methods of treatment using ctla4 mutant molecules.
The applicant listed for this patent is BRISTOL-MYERS SQUIBB COMPANY. Invention is credited to Jurgen Bajorath, Peter S. Linsley, Joseph Naemura, Robert James PEACH.
Application Number | 20180134764 15/668824 |
Document ID | / |
Family ID | 34990150 |
Filed Date | 2018-05-17 |
United States Patent
Application |
20180134764 |
Kind Code |
A9 |
PEACH; Robert James ; et
al. |
May 17, 2018 |
METHODS OF TREATMENT USING CTLA4 MUTANT MOLECULES
Abstract
The present invention provides soluble CTLA4 mutant molecules
which bind with greater avidity to the CD80 and/or CD86 antigen
than wild type CTLA4 or non-mutated CTLA4Ig. The soluble CTLA4
molecules have a first amino acid sequence comprising the
extracellular domain of CTLA4, where certain amino acid residues
within the S25-R33 region and M97-G107 region are mutated. The
mutant molecules of the invention may also include a second amino
acid sequence which increases the solubility of the mutant
molecule.
Inventors: |
PEACH; Robert James; (San
Diego, CA) ; Naemura; Joseph; (Bellevue, WA) ;
Linsley; Peter S.; (Seattle, WA) ; Bajorath;
Jurgen; (Bonn, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BRISTOL-MYERS SQUIBB COMPANY |
Princeton |
NJ |
US |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20170369549 A1 |
December 28, 2017 |
|
|
Family ID: |
34990150 |
Appl. No.: |
15/668824 |
Filed: |
August 4, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14289715 |
May 29, 2014 |
9758565 |
|
|
15668824 |
|
|
|
|
13277425 |
Oct 20, 2011 |
8785398 |
|
|
14289715 |
|
|
|
|
12694327 |
Jan 27, 2010 |
|
|
|
13277425 |
|
|
|
|
11725762 |
Mar 20, 2007 |
7700556 |
|
|
12694327 |
|
|
|
|
10980742 |
Nov 3, 2004 |
7439230 |
|
|
11725762 |
|
|
|
|
09865321 |
May 23, 2001 |
7094874 |
|
|
10980742 |
|
|
|
|
60214065 |
Jun 26, 2000 |
|
|
|
60287576 |
May 26, 2000 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07H 21/04 20130101;
A61P 37/06 20180101; C07K 14/7051 20130101; C07K 2319/30 20130101;
A61P 3/10 20180101; C12N 2501/51 20130101; A61P 35/00 20180101;
C07K 14/70521 20130101; C12N 5/0636 20130101; A61K 38/00 20130101;
A61P 35/02 20180101; A61K 39/39 20130101; A61K 39/3955 20130101;
A61K 2039/505 20130101; A61P 17/06 20180101; A61K 38/1774 20130101;
A61P 37/00 20180101 |
International
Class: |
C07K 14/725 20060101
C07K014/725; C07H 21/04 20060101 C07H021/04; A61K 38/17 20060101
A61K038/17; A61K 39/395 20060101 A61K039/395; C07K 14/705 20060101
C07K014/705; C12N 5/0783 20100101 C12N005/0783 |
Claims
1. A method for inhibiting graft versus host disease in a subject
which comprises administering to the subject a soluble CTLA4 mutant
molecule comprising an extracellular domain as shown in SEQ ID NO:6
beginning with alanine at position 26 or methionine at position 27
and ending with aspartic acid at position 150.
2. The method of claim 1 wherein the soluble CTLA4 mutant molecule
further comprising an amino acid sequence which alters the
solubility, affinity or valency of the soluble CTLA4 mutant
molecule.
3. The method of claim 2, wherein the soluble CTLA4 mutant molecule
comprises a human immunoglobulin constant region.
4. The method of claim 3 wherein the immunoglobulin constant region
is mutated to reduce effector function.
5. The method of claim 3 wherein the immunoglobulin constant region
comprises a hinge, CH2 and CH3 regions of an immunoglobulin
molecule.
6. The method of claim 5, wherein any or all of the cysteine
residues within the immunoglobulin hinge are substituted with
serine.
7. The method of claim 6 wherein a cysteine at position 156 is
substituted with a serine, a cysteine at position 162 is
substituted with a serine, and a cysteine at position 165 is
substituted with a serine, as shown in SEQ ID NO:6.
8. The method of claim 1, wherein the soluble CTLA4 mutant molecule
further comprising a junction amino acid residue and an
immunoglobulin, where the junction amino acid residue is located
between the amino acid sequence which ends with aspartic acid at
position +150 and the immunoglobulin.
9. The method of claim 8, wherein the junction amino acid residue
is glutamine.
10. A method for inhibiting graft versus host disease in a subject
which comprises administering to the subject a soluble CTLA4 mutant
molecule comprising the amino acid sequence shown in SEQ ID NO:6
beginning with alanine at position 26 or methionine at position 27
and ending with lysine at position 383.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 14/289,715, filed May 29, 2014, now allowed; which is a
continuation of U.S. application Ser. No. 13/277,425, filed Oct.
20, 2011, issued as U.S. Pat. No. 8,785,398; which is a divisional
of U.S. application Ser. No. 12/694,327, filed Jan. 27, 2010, now
abandoned; which is a divisional of U.S. application Ser. No.
11/725,762, filed Mar. 20, 2007, issued as U.S. Pat. No. 7,700,556;
which is a divisional of U.S. application Ser. No. 10/980,742,
filed Nov. 3, 2004, issued as U.S. Pat. No. 7,439,230; which is a
divisional of U.S. application Ser. No. 09/865,321, filed May 23,
2001, issued as U.S. Pat. No. 7,094,874; which claims priority to
U.S. Ser. Nos. 09/579,927, filed May 26, 2000, now abandoned;
60/287,576, filed May 26, 2000, now abandoned; and 60/214,065,
filed Jun. 26, 2000, now abandoned. The contents of all of the
foregoing applications in their entireties are incorporated by
reference into the present application.
[0002] Throughout this application various publications are
referenced. The disclosures of these publications in their
entireties are hereby incorporated by reference into this
application in order to more fully describe the state of the art to
which this invention pertains.
FIELD OF THE INVENTION
[0003] The present invention relates to the field of soluble CTLA4
molecules that are mutated from wild type CTLA4 to retain the
ability to bind CD80 and/or CD86.
BACKGROUND OF THE INVENTION
[0004] Antigen-nonspecific intercellular interactions between
T-lymphocytes and antigen-presenting cells (APCs) generate T cell
costimulatory signals that generate T cell responses to antigen
(Jenkins and Johnson (1993) Curr. Opin. Immunol. 5:361-367).
Costimulatory signals determine the magnitude of a T cell response
to antigen, and whether this response activates or inactivates
subsequent responses to antigen (Mueller et al. (1989) Annu. Rev.
Immunol. 7:445-480).
[0005] T cell activation in the absence of costimulation results in
an aborted or anergic T cell response (Schwartz, R. H. (1992) Cell
71:1065-1068). One key costimulatory signal is provided by
interaction of the T cell surface receptor CD28 with B7 related
molecules on antigen presenting cells (e.g., also known as B7-1 and
B7-2, or CD80 and CD86, respectively) (P. Linsley and J. Ledbetter
(1993) Annu. Rev. Immunol. 11:191-212).
[0006] The molecule now known as CD80 (B7-1) was originally
described as a human B cell-associated activation antigen (Yokochi,
T. et al. (1981) J. Immunol. 128:823-827; Freeman, G. J. et al.
(1989) J. Immunol. 143:2714-2722), and subsequently identified as a
counterreceptor for the related T cell molecules CD28 and CTLA4
(Linsley, P., et al. (1990) Proc. Natl. Acad. Sci. USA
87:5031-5035; Linsley, P. S. et al. (1991a) J. Exp. Med.
173:721-730; Linsley, P. S. et al. (1991b) J. Exp. Med.
174:561-570).
[0007] More recently, another counterreceptor for CTLA4 was
identified on antigen presenting cells (Azuma, N. et al. (1993)
Nature 366:76-79; Freeman (1993a) Science 262:909-911; Freeman, G.
J. et al. (1993b) J. Exp. Med. 178:2185-2192; Hathcock, K. L. S.,
et al. (1994) J. Exp. Med. 180:631-640; Lenschow, D. J. et al.,
(1993) Proc. Natl. Acad. Sci. USA 90:11054-11058; Ravi-Wolf, Z., et
al. (1993) Proc. Natl. Acad. Sci. USA 90:11182-11186; Wu, Y. et al.
(1993) J. Exp. Med. 178:1789-1793). This molecule, now known as
CD86 (Caux, C., et al. (1994) J. Exp. Med. 180:1841-1848), but also
called B7-0 (Azuma et al., (1993), supra) or B7-2 (Freeman et al.,
(1993a), supra), shares about 25% sequence identity with CD80 in
its extracellular region (Azuma et al., (1993), supra; Freeman et
al., (1993a), supra, (1993b), supra). CD86-transfected cells
trigger CD28-mediated T cell responses (Azuma et al., (1993),
supra; Freeman et al., (1993a), (1993b), supra).
[0008] Comparisons of expression of CD80 and CD86 have been the
subject of several studies (Azuma et al. (1993), supra; Hathcock et
al., (1994) supra; Larsen, C. P., et al. (1994) J. Immunol.
152:5208-5219; Stack, R. M., et al., (1994) J. Immunol.
152:5723-5733). Current data indicate that expression of CD80 and
CD86 are regulated differently, and suggest that CD86 expression
tends to precede CD80 expression during an immune response.
[0009] Soluble forms of CD28 and CTLA4 have been constructed by
fusing variable (v)-like extracellular domains of CD28 and CTLA4 to
immunoglobulin (Ig) constant domains resulting in CD28Ig and
CTLA4Ig. CTLA4Ig binds both CD80 positive and CD86 positive cells
more strongly than CD28Ig (Linsley, P. et al. (1994) Immunity
1:793-80). Many T cell-dependent immune responses are blocked by
CTLA4Ig both in vitro and in vivo. (Linsley, et al., (1991b),
supra; Linsley, P. S. et al., (1992a) Science 257:792-795; Linsley,
P. S. et al., (1992b) J. Exp. Med. 176:1595-1604; Lenschow, D. J.
et al. (1992), Science 257:789-792; Tan, P. et al., (1992) J. Exp.
Med. 177:165-173; Turka, L. A., (1992) Proc. Natl. Acad. Sci. USA
89:11102-11105).
[0010] Peach et al., (J. Exp. Med. (1994) 180:2049-2058) identified
regions in the CTLA4 extracellular domain which are important for
strong binding to CD80. Specifically, a hexapeptide motif (MYPPPY,
SEQ ID NO:9) in the complementarity determining region 3
(CDR3)-like region was identified as fully conserved in all CD28
and CTLA4 family members. Alanine scanning mutagenesis through the
MYPPPY motif (SEQ ID NO:9) in CTLA4 and at selected residues in
CD28Ig reduced or abolished binding to CD80.
[0011] Chimeric molecules interchanging homologous regions of CTLA4
and CD28 were also constructed. Molecules HS4, HS4-A and HS4-B were
constructed by grafting CDR3-like regions of CTLA4, which also
included a portion carboxy terminally, extended to include certain
nonconserved amino acid residues onto CD28Ig. These homologue
mutants showed higher binding avidity to CD80 than did CD28Ig.
[0012] In another group of chimeric homologue mutants, the
CDR1-like region of CTLA4, which is not conserved in CD28 and is
predicted to be spatially adjacent to the CDR3-like region, was
grafted, into HS4 and HS4-A. These chimeric homologue mutant
molecules (designated HS7 and HS8) demonstrated even greater
binding avidity for CD80 than did CD28Ig.
[0013] Chimeric homologue mutant molecules were also made by
grafting into HS7 and HS8 the CDR2-like region of CTLA4, but this
combination did not further improve the binding avidity for CD80.
Thus, the MYPPPY motif of CTLA4 and
[0014] CD28 was determined to be critical for binding to CD80, but
certain non-conserved amino acid residues in the CDR1-and CDR3-like
regions of CTLA4 were also responsible for increased binding
avidity of CTLA4 with CD80.
[0015] CTLA4Ig was shown to effectively block CD80-associated T
cell co-stimulation but was not as effective at blocking
CD86-associated responses. Soluble CTLA4 mutant molecules,
especially those having a higher avidity for CD86 than wild type
CTLA4, were constructed as possibly better able to block the
priming of antigen specific activated cells than CTLA4Ig.
[0016] There remains a need for improved CTLA4 molecules to provide
better pharmaceutical compositions for immune suppression and
cancer treatment than previously known soluble forms of CTLA4.
SUMMARY OF INVENTION
[0017] Accordingly, the invention provides soluble CTLA4 mutant
molecules that bind CD80 and/or CD86. Mutant molecules of the
invention include those that can recognize and bind either of CD80,
CD86, or both. In some embodiments, mutant molecules bind CD80
and/or CD86 with greater avidity than CTLA4.
[0018] One example of a CTLA4 mutant molecule is L104EA29YIg (FIG.
7), as described herein. Another example of a CTLA4 mutant molecule
is L104EIg (FIG. 8), as described herein. L104EA29YIg and L104EIg
bind CD80 and CD86 more avidly than CTLA4Ig.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1 shows the equilibrium binding analysis of
L104EA29YIg, L104EIg, and wild-type CTLA4Ig to CD86Ig.
[0020] FIGS. 2A & 2B illustrate data from FACS assays showing
binding of L104EA29YIg, L104EIg, and CTLA4Ig to human CD80- or
CD86-transfected CHO cells as described in Example 2, infra.
[0021] FIGS. 3A & 3B depicts inhibition of proliferation of
CD80-positive and CD86-positive CHO cells as described in Example
2, infra.
[0022] FIGS. 4A & 4B shows that L104EA29YIg is more effective
than CTLA4Ig at inhibiting proliferation of primary and secondary
allostimulated T cells as described in Example 2, infra.
[0023] FIGS. 5A-C illustrate that L104EA29YIg is more effective
than CTLA4Ig at inhibiting IL-2 (FIG. 5A), IL-4 (FIG. 5B), and
y-interferon (FIG. 5C) cytokine production of allostimulated human
T cells as described in Example 2, infra.
[0024] FIG. 6 demonstrates that L104EA29YIg is more effective than
CTLA4Ig at inhibiting proliferation of phytohemaglutinin-(PHA)
stimulated monkey T cells as described in Example 2, infra.
[0025] FIG. 7 depicts a nucleotide (SEQ ID NO: 3) and amino acid
sequence (SEQ ID NO:4) of a CTLA4 mutant molecule (L104EA29YIg)
comprising a signal peptide; a mutated extracellular domain of
CTLA4 starting at methionine at position +1 and ending at aspartic
acid at position +124, or starting at alanine at position -1 and
ending at aspartic acid at position +124; and an Ig region as
described in Example 1, infra.
[0026] FIG. 8 depicts a nucleotide (SEQ ID NO:5) and amino acid
sequence (SEQ ID NO:6) of a CTLA4 mutant molecule (L104EIg)
comprising a signal peptide; a mutated extracellular domain of
CTLA4 starting at methionine at position +1 and ending at aspartic
acid at position +124, or starting at alanine at position -1 and
ending at aspartic acid at position +124; and an Ig region as
described in Example 1, infra.
[0027] FIG. 9 depicts a nucleotide (SEQ ID NO:7) and amino acid
sequence (SEQ ID NO:8) of a CTLA4Ig having a signal peptide; a wild
type amino acid sequence of the extracellular domain of CTLA4
starting at methionine at position +1 to aspartic acid at position
+124, or starting at alanine at position -1 to aspartic acid at
position +124; and an Ig region.
[0028] FIGS. 10A-C are an SDS gel (FIG. 10A) for CTLA4Ig (lane 1),
L104EIg (lane 2), and L104EA29YIg (lane 3A); and size exclusion
chromatographs of
[0029] CTLA4Ig (FIG. 10B) and L104EA29YIg (FIG. 10C).
[0030] FIG. 11A illustrates a ribbon diagram of the CTLA4
extracellular Ig V-like fold generated from the solution structure
determined by NMR spectroscopy. FIG. 11B shows an expanded view of
the S25-R33 region and the MYPPPY region (SEQ ID NO:9) indicating
the location and side-chain orientation of the avidity enhancing
mutations, L104 and A29.
[0031] FIG. 12 depicts a schematic diagram of a vector,
piLN-L104EA29Y, having the L104EA29YIg insert.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0032] As used in this application, the following words or phrases
have the meanings specified.
[0033] As used herein "wild type CTLA4" has the amino acid sequence
of naturally occurring, full length CTLA4 (U.S. Pat. Nos.
5,434,131, 5,844,095, 5,851,795), or the extracellular domain
thereof, which binds CD80 and/or CD86, and/or interferes with CD80
and/or CD86 from binding their ligands. In particular embodiments,
the extracellular domain of wild type CTLA4 begins with methionine
at position +1 and ends at aspartic acid at position +124, or the
extracellular domain of wild type CTLA4 begins with alanine at
position -1 and ends at aspartic acid at position +124. Wild type
CTLA4 is a cell surface protein, having an N-terminal extracellular
domain, a transmembrane domain, and a C-terminal cytoplasmic
domain. The extracellular domain binds to target antigens, such as
CD80 and CD86. In a cell, the naturally occurring, wild type CTLA4
protein is translated as an immature polypeptide, which includes a
signal peptide at the N-terminal end. The immature polypeptide
undergoes post-translational processing, which includes cleavage
and removal of the signal peptide to generate a CTLA4 cleavage
product having a newly generated N-terminal end that differs from
the N-terminal end in the immature form. One skilled in the art
will appreciate that additional post-translational processing may
occur, which removes one or more of the amino acids from the newly
generated N-terminal end of the CTLA4 cleavage product. The mature
form of the CTLA4 molecule includes the extracellular domain of
CTLA4, or any portion thereof, which binds to CD80 and/or CD86.
[0034] "CTLA4Ig" is a soluble fusion protein comprising an
extracellular domain of wild type CTLA4, or a portion thereof that
binds CD80 and/or CD86, joined to an Ig tail. A particular
embodiment comprises the extracellular domain of wild type CTLA4
starting at methionine at position +1 and ending at aspartic acid
at position +124; or starting at alanine at position -1 to aspartic
acid at position +124; a junction amino acid residue glutamine at
position +125; and an immunoglobulin portion encompassing glutamic
acid at position +126 through lysine at position +357 (FIG. 9).
[0035] As used herein, a "fusion protein" is defined as one or more
amino acid sequences joined together using methods well known in
the art and as described in U.S. Pat. No. 5,434,131 or 5,637,481.
The joined amino acid sequences thereby form one fusion
protein.
[0036] As used herein a "CTLA4 mutant molecule" is a molecule that
can be full length CTLA4 or portions thereof (derivatives or
fragments) that have a mutation or multiple mutations in CTLA4
(preferably in the extracellular domain of CTLA4) so that it is
similar but no longer identical to the wild type CTLA4 molecule.
CTLA4 mutant molecules bind either CD80 or CD86, or both. Mutant
CTLA4 molecules may include a biologically or chemically active
non-CTLA4 molecule therein or attached thereto. The mutant
molecules may be soluble (i.e., circulating) or bound to a surface.
CTLA4 mutant molecules can include the entire extracellular domain
of CTLA4 or portions thereof, e.g., fragments or derivatives. CTLA4
mutant molecules can be made synthetically or recombinantly.
[0037] As used herein, the term "mutation" is a change in the
nucleotide or amino acid sequence of a wild-type polypeptide. In
this case, it is a change in the wild type CTLA4 extracellular
domain. The change can be an amino acid change which includes
substitutions, deletions, additions, or truncations. A mutant
molecule can have one or more mutations. Mutations in a nucleotide
sequence may or may not result in a mutation in the amino acid
sequence as is well understood in the art. In that regard, certain
nucleotide codons encode the same amino acid. Examples include
nucleotide codons CGU, CGG, CGC, and CGA encoding the amino acid,
arginine (R); or codons GAU, and GAC encoding the amino acid,
aspartic acid (D). Thus, a protein can be encoded by one or more
nucleic acid molecules that differ in their specific nucleotide
sequence, but still encode protein molecules having identical
sequences. The amino acid coding sequence is as follows:
TABLE-US-00001 One Letter Amino Acid Symbol Symbol Codons Alanine
Ala A GCU, GCC, GCA, GCG Cysteine Cys C UGU, UGC Aspartic Acid Asp
D GAU, GAC Glutamic Acid Glu E GAA, GAG Phenylalanine Phe F UUU,
UUC Glycine Gly G GGU, GGC, GGA, GGG Histidine His H CAU, CAC
Isoleucine Ile I AUU, AUC, AUA Lysine Lys K AAA, AAG Leucine Leu L
UUA, UUG, CUU, CUC, CUA, CUG Methionine Met M AUG Asparagine Asn N
AAU, AAC Proline Pro P CCU, CCC, CCA, CCG Glutamine Gln Q CAA, CAG
Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Serine Ser S UCU, UCC,
UCA, UCG, AGU, AGC Threonine Thr T ACU, ACC, ACA, ACG Valine Val V
GUU, GUC, GUA, GUG Tryptophan Trp W UGG Tyrosine Tyr Y UAU, UAC
[0038] As used herein "the extracellular domain of CTLA4" is a
portion of CTLA4 that recognizes and binds CD80 and/or CD86. For
example, an extracellular domain of CTLA4 comprises methionine at
position +1 to aspartic acid at position +124 (FIG. 9).
Alternatively, an extracellular domain of CTLA4 comprises alanine
at position -1 to aspartic acid at position +124 (FIG. 9). The
extracellular domain includes fragments or derivatives of CTLA4
that bind CD80 and/or CD86.
[0039] As used herein a "non-CTLA4 protein sequence" or "non-CTLA4
molecule" is defined as any molecule that does not bind CD80 and/or
CD86 and does not interfere with the binding of CTLA4 to its
target. An example includes, but is not limited to, an
immunoglobulin (Ig) constant region or portion thereof. Preferably,
the Ig constant region is a human or monkey Ig constant region,
e.g., human C(gamma)1, including the hinge, CH2 and CH3 regions.
The Ig constant region can be mutated to reduce its effector
functions (U.S. Pat. Nos. 5,637,481; and 6,132,992).
[0040] As used herein a "fragment of a CTLA4 mutant molecule" is a
part of a CTLA4 mutant molecule, preferably the extracellular
domain of CTLA4 or a part thereof, that recognizes and binds its
target, e.g., CD80 and/or CD86.
[0041] As used herein a "derivative of a CTLA4 mutant molecule" is
a molecule that shares at least 70% sequence similarity with and
functions like the extracellular domain of CTLA4, i.e., it
recognizes and binds CD80 and/or CD86.
[0042] As used herein, a "portion of a CTLA4 molecule" includes
fragments and derivatives of a CTLA4 molecule that binds CD80
and/or CD86.
[0043] In order that the invention herein described may be more
fully understood, the following description is set forth.
COMPOSITIONS OF THE INVENTION
[0044] The present invention provides soluble CTLA4 mutant
molecules that recognize and bind CD80 and/or CD86. In some
embodiments, the soluble CTLA4 mutants have a higher avidity to
CD80 and/or CD86 than CTLA4Ig.
[0045] Examples of CTLA4 mutant molecules include L104EA29YIg (FIG.
7). The amino acid sequence of L104EA29YIg can begin at alanine at
amino acid position -1 and end at lysine at amino acid position
+357. Alternatively, the amino acid sequence of L104EA29YIg can
begin at methionine at amino acid position +1 and end at lysine at
amino acid position +357. The CTLA4 portion of L104EA29YIg
encompasses methionine at amino acid position +1 through aspartic
acid at amino acid position +124. L104EA29YIg comprises a junction
amino acid residue glutamine at position +125 and an immunoglobulin
portion encompassing glutamic acid at position +126 through lysine
at position +357 (FIG. 7). L104EA29YIg binds approximately 2-fold
more avidly than wild type CTLA4Ig (hereinafter referred to as
CTLA4Ig) to CD80 and approximately 4-fold more avidly to CD86. This
stronger binding results in L104EA29YIg being more affective than
CTLA4Ig at blocking immune responses.
[0046] CTLA4 mutant molecules comprise at least the extracellular
domain of CTLA4, or portions thereof that bind CD80 and/or CD86.
The extracellular portion of a CTLA4 mutant molecule comprises an
amino acid sequence starting with methionine at position +1 through
aspartic acid at position +124 (FIG. 7 or 8). Alternatively, the
extracellular portion of the CTLA4 can comprise an amino acid
sequence starting with alanine at position -1 through aspartic acid
at position +124 (FIG. 7 or 8).
[0047] In one embodiment, the soluble CTLA4 mutant molecule is a
fusion protein comprising the extracellular domain of CTLA4 having
one or more mutations in a region of an amino acid sequence
beginning with serine at +25 and ending with arginine at +33
(S25-R33). For example, the alanine at position +29 of wild type
CTLA4 can be substituted with tyrosine (codons: UAU, UAC).
Alternatively, alanine can be substituted with leucine (codons:
UUA, UUG, CUU, CUC, CUA, CUG), phenylalanine (codons: UUU, UUC),
tryptophan (codon: UGG), or threonine (codons: ACU, ACC, ACA, ACG).
As persons skilled in the art will readily understand, the uracil
(U) nucleotide of the RNA sequence corresponds to the thymine (T)
nucleotide of the DNA sequence.
[0048] In another embodiment, the soluble CTLA4 mutant molecule is
a fusion protein comprising the extracellular domain of CTLA4
having one or more mutations in or near a region of an amino acid
sequence beginning with methionine at +97 and ending with glycine
at +107 (M97-G107). For example, leucine at position +104 of wild
type CTLA4 can be substituted with glutamic acid (codons: GAA,
GAG). A CTLA4 mutant molecule having this substitution is referred
to herein as L104EIg (FIG. 8).
[0049] In yet another embodiment, the soluble CTLA4 mutant molecule
is a fusion protein comprising the extracellular domain of CTLA4
having one or more mutations in the S25-R33 and M97-G107 regions.
For example, in one embodiment, a CTLA4 mutant molecule comprises
tyrosine at position +29 instead of alanine; and glutamic acid at
position +104 instead of leucine. A CTLA4 mutant molecule having
these substitutions is referred to herein as L104EA29YIg (FIG. 7).
The nucleic acid molecule that encodes L104EA29YIg is contained in
pD16 L104EA29YIg and was deposited on Jun. 20, 2000 with the
American Type Culture Collection (ATCC), 10801 University Blvd.,
Manassas, Va. 20110-2209 (ATCC No. PTA-2104). The pD16 L104EA29YIg
vector is a derivative of the pcDNA3 vector (INVITROGEN).
[0050] The invention further provides a soluble CTLA4 mutant
molecule comprising an extracellular domain of a CTLA4 mutant as
shown in FIG. 7 or 8, or portion(s) thereof, and a moiety that
alters the solubility, affinity and/or valency of the CTLA4 mutant
molecule.
[0051] In accordance with a practice of the invention, the moiety
can be an immunoglobulin constant region or portion thereof. For in
vivo use, it is preferred that the immunoglobulin constant region
does not elicit a detrimental immune response in the subject. For
example, in clinical protocols, it may be preferred that mutant
molecules include human or monkey immunoglobulin constant regions.
One example of a suitable immunoglobulin region is human C(gamma)1,
comprising the hinge, CH2, and CH3 regions. Other isotypes are
possible. Further, other immunoglobulin constant regions are
possible (preferably other weakly or non-immunogenic immunoglobulin
constant regions).
[0052] Other moieties include polypeptide tags. Examples of
suitable tags include but are not limited to the p97 molecule, env
gp120 molecule, E7 molecule, and ova molecule (Dash, B., et al.
(1994) J. Gen. Virol. 75:1389-97; Ikeda, T., et al. (1994) Gene
138:193-6; Falk, K., et al. (1993) Cell. Immunol. 150:447-52;
Fujisaka, K. et al. (1994) Virology 204:789-93). Other molecules
for use as tags are possible (Gerard, C. et al. (1994) Neuroscience
62:721-739; Byrn, R. et al. J. Virol. (1989) 63:4370-4375; Smith,
D. et al., (1987) Science 238:1704-1707; Lasky, L., (1996) Science
233:209-212).
[0053] The invention further provides soluble mutant CTLA4Ig fusion
proteins preferentially more reactive with the CD80 and/or CD86
antigen compared to wild type CTLA4. One example is L104EA29YIg as
shown in FIG. 7.
[0054] In another embodiment, the soluble CTLA4 mutant molecule
includes a junction amino acid residue, which is located between
the CTLA4 portion and the immunoglobulin portion. The junction
amino acid can be any amino acid, including glutamine. The junction
amino acid can be introduced by molecular or chemical synthesis
methods known in the art.
[0055] In another embodiment, the soluble CTLA4 mutant molecule
includes the immunoglobulin portion (e.g., hinge, CH2 and CH3
domains), where any or all of the cysteine residues, within the
hinge domain of the immunoglobulin portion are substituted with
serine, for example, the cysteines at positions +130, +136, or +139
(FIG. 7 or 8). The mutant molecule may also include the proline at
position +148 substituted with a serine, as shown in FIG. 7 or
8.
[0056] The soluble CTLA4 mutant molecule can include a signal
peptide sequence linked to the N-terminal end of the extracellular
domain of the CTLA4 portion of the mutant molecule. The signal
peptide can be any sequence that will permit secretion of the
mutant molecule, including the signal peptide from oncostatin M
(Malik, et al., (1989) Molec. Cell. Biol. 9: 2847-2853), or CD5
(Jones, N. H. et al., (1986) Nature 323:346-349), or the signal
peptide from any extracellular protein.
[0057] The mutant molecule can include the oncostatin M signal
peptide linked at the N-terminal end of the extracellular domain of
CTLA4, and the human immunoglobulin molecule (e.g., hinge, CH2 and
CH3) linked to the C-terminal end of the extracellular domain of
CTLA4. This molecule includes the oncostatin M signal peptide
encompassing an amino acid sequence having methionine at position
-26 through alanine at position -1, the CTLA4 portion encompassing
an amino acid sequence having methionine at position +1 through
aspartic acid at position +124, a junction amino acid residue
glutamine at position +125, and the immunoglobulin portion
encompassing an amino acid sequence having glutamic acid at
position +126 through lysine at position +357.
[0058] The soluble CTLA4 mutant molecules of the invention can be
obtained by molecular or chemical synthesis methods. The molecular
methods may include the following steps: introducing a suitable
host cell with a nucleic acid molecule that expresses and encodes
the soluble CTLA4 mutant molecule; culturing the host cell so
introduced under conditions that permit the host cell to express
the mutant molecules; and isolating the expressed mutant molecules.
The signal peptide portion of the mutant molecule permits the
protein molecules to be expressed on the cell surface and to be
secreted by the host cell. The translated mutant molecules can
undergo post-translational modification, involving cleavage of the
signal peptide to produce a mature protein having the CTLA4 and the
immunoglobulin portions. The cleavage may occur after the alanine
at position -1, resulting in a mature mutant molecule having
methionine at position +1 as the first amino acid (FIG. 7 or 8).
Alternatively, the cleavage may occur after the methionine at
position -2, resulting in a mature mutant molecule having alanine
at position -1 as the first amino acid.
[0059] A preferred embodiment is a soluble CTLA4 mutant molecule
having the extracellular domain of human CTLA4 linked to all or a
portion of a human immunoglobulin molecule (e.g., hinge, CH2 and
CH3). This preferred molecule includes the CTLA4 portion of the
soluble molecule encompassing an amino acid sequence having
methionine at position +1 through aspartic acid at position +124, a
junction amino acid residue glutamine at position +125, and the
immunoglobulin portion encompassing glutamic acid at position +126
through lysine at position +357.
[0060] The portion having the extracellular domain of CTLA4 is
mutated so that alanine at position +29 is substituted with
tyrosine and leucine at position +104 is substituted with glutamic
acid. The immunoglobulin portion of the mutant molecule can be
mutated, so that the cysteines at positions +130, +136, and +139
are substituted with serine, and the proline at position +148 is
substituted with serine. This mutant molecule is designated herein
as L104EA29YIg (FIG. 7).
[0061] Another embodiment of L104EA29YIg is a mutant molecule
having an amino acid sequence having alanine at position -1 through
aspartic acid at position +124, a junction amino acid residue
glutamine at position +125, and the immunoglobulin portion
encompassing glutamic acid at position +126 (e.g., +126 through
lysine at position +357). The portion having the extracellular
domain of CTLA4 is mutated so that alanine at position +29 is
replaced with tyrosine; and leucine at position +104 is replaced
with glutamic acid. The immunoglobulin portion of the mutant
molecule is mutated so that the cysteines at positions +130, +136,
and +139 are replaced with serine, and the proline at position +148
is replaced with serine. This mutant molecule is designated herein
as L104EA29YIg (FIG. 7). After the signal sequence has been
cleaved, L104EA29YIg can either begin with a methionine at position
+1, or begin with alanine at position -1.
[0062] Another mutant molecule of the invention is a soluble CTLA4
mutant molecule having the extracellular domain of human CTLA4
linked to the human immunoglobulin molecule (e.g., hinge, CH2 and
CH3). This molecule includes the portion of the amino acid sequence
encoding CTLA4 starting with methionine at position +1 through
aspartic acid at position +124, a junction amino acid residue
glutamine at position +125, and the immunoglobulin portion
encompassing an amino acid sequence having glutamic acid at
position +126 through lysine at position +357.
[0063] The portion having the extracellular domain of CTLA4 is
mutated so that leucine at position +104 is substituted with
glutamic acid. The hinge portion of the mutant molecule is mutated
so that the cysteines at positions +130, +136, and +139 are
substituted with serine, and the proline at position +148 is
substituted with serine. This mutant molecule is designated herein
as L104EIg (FIG. 8).
[0064] Alternatively, an embodiment of L104EIg is a soluble CTLA4
mutant molecule having an extracellular domain of human CTLA4
linked to a human immunoglobulin molecule (e.g., hinge, CH2 and
CH3). This preferred molecule includes the CTLA4 portion
encompassing an amino acid sequence beginning with alanine at
position -1 through aspartic acid at position +124, a junction
amino acid residue glutamine at position +125, and the
immunoglobulin portion encompassing glutamic acid at position +126
through lysine at position +357. The portion having the
extracellular domain of CTLA4 is mutated so that leucine at
position +104 is substituted with glutamic acid. The hinge portion
of the mutant molecule is mutated so that the cysteines at
positions +130, +136, and +139 are substituted with serine, and the
proline at position +148 is substituted with serine. This mutant
molecule is designated herein as L104EIg (FIG. 8).
[0065] Further, the invention provides a soluble CTLA4 mutant
molecule having: (a) a first amino acid sequence of a membrane
glycoprotein, e.g., CD28, CD86, CD80, CD40, and gp39, which blocks
T cell proliferation, fused to a second amino acid sequence; (b)
the second amino acid sequence being a fragment of the
extracellular domain of mutant CTLA4 which blocks T cell
proliferation, such as, for example an amino acid molecule
comprising methionine at position +1 through aspartic acid at
position +124 (FIG. 7 or 8); and (c) a third amino acid sequence
which acts as an identification tag or enhances solubility of the
molecule. For example, the third amino acid sequence can consist
essentially of amino acid residues of the hinge, CH2 and CH3
regions of a non-immunogenic immunoglobulin molecule. Examples of
suitable immunoglobulin molecules include, but are not limited to,
human or monkey immunoglobulin, e.g., C(gamma)1. Other isotypes are
also possible.
[0066] The invention further provides nucleic acid molecules
comprising nucleotide sequences encoding the amino acid sequences
corresponding to the soluble CTLA4 mutant molecules of the
invention. In one embodiment, the nucleic acid molecule is a DNA
(e.g., cDNA) or a hybrid thereof. Alternatively, the nucleic acid
molecules are RNA or a hybrids thereof.
[0067] Additionally, the invention provides a vector, which
comprises the nucleotide sequences of the invention. A host vector
system is also provided. The host vector system comprises the
vector of the invention in a suitable host cell. Examples of
suitable host cells include, but are not limited to, prokaryotic
and eukaryotic cells.
[0068] The invention includes pharmaceutical compositions for use
in the treatment of immune system diseases comprising
pharmaceutically effective amounts of soluble CTLA4 mutant
molecules. In certain embodiments, the immune system diseases are
mediated by CD28- and/or CTLA4-positive cell interactions with CD80
and/or CD86 positive cells. The soluble CTLA4 mutant molecules are
preferably CTLA4 molecules having one or more mutations in the
extracellular domain of CTLA4. The pharmaceutical composition can
include soluble CTLA4 mutant protein molecules and/or nucleic acid
molecules, and/or vectors encoding the molecules. In preferred
embodiments, the soluble CTLA4 mutant molecules have the amino acid
sequence of the extracellular domain of CTLA4 as shown in either
FIG. 7 or 8 (L104EA29Y or L104E, respectively). Even more
preferably, the soluble CTLA4 mutant molecule is L104EA29YIg as
disclosed herein. The compositions may additionally include other
therapeutic agents, including, but not limited to, drug toxins,
enzymes, antibodies, or conjugates.
[0069] The pharmaceutical compositions also preferably include
suitable carriers and adjuvants which include any material which
when combined with the molecule of the invention (e.g., a soluble
CTLA4 mutant molecule, such as, L104EA29Y or L104E) retains the
molecule's activity and is non-reactive with the subject's immune
system. Examples of suitable carriers and adjuvants include, but
are not limited to, human serum albumin; ion exchangers; alumina;
lecithin; buffer substances, such as phosphates; glycine; sorbic
acid; potassium sorbate; and salts or electrolytes, such as
protamine sulfate. Other examples include any of the standard
pharmaceutical carriers such as a phosphate buffered saline
solution; water; emulsions, such as oil/water emulsion; and various
types of wetting agents. Other carriers may also include sterile
solutions; tablets, including coated tablets and capsules.
Typically such carriers contain excipients such as starch, milk,
sugar, certain types of clay, gelatin, stearic acid or salts
thereof, magnesium or calcium stearate, talc, vegetable fats or
oils, gums, glycols, or other known excipients. Such carriers may
also include flavor and color additives or other ingredients.
Compositions comprising such carriers are formulated by well known
conventional methods. Such compositions may also be formulated
within various lipid compositions, such as, for example, liposomes
as well as in various polymeric compositions, such as polymer
microspheres.
[0070] The pharmaceutical compositions of the invention can be
administered using conventional modes of administration including,
but not limited to, intravenous (i.v.) administration,
intraperitoneal (i.p.) administration, intramuscular (i.m.)
administration, subcutaneous administration, oral administration,
administration as a suppository, or as a topical contact, or the
implantation of a slow-release device such as a miniosmotic pump,
to the subject.
[0071] The pharmaceutical compositions of the invention may be in a
variety of dosage forms, which include, but are not limited to,
liquid solutions or suspensions, tablets, pills, powders,
suppositories, polymeric microcapsules or microvesicles, liposomes,
and injectable or infusible solutions. The preferred form depends
upon the mode of administration and the therapeutic
application.
[0072] The most effective mode of administration and dosage regimen
for the compositions of this invention depends upon the severity
and course of the disease, the patient's health and response to
treatment and the judgment of the treating physician. Accordingly,
the dosages of the compositions should be titrated to the
individual patient.
[0073] The soluble CTLA4 mutant molecules may be administered to a
subject in an amount and for a time (e.g. length of time and/or
multiple times) sufficient to block endogenous B7 (e.g., CD80
and/or CD86) molecules from binding their respective ligands, in
the subject. Blockage of endogenous B7/ligand binding thereby
inhibits interactions between B7-positive cells (e.g., CD80- and/or
CD86-positive cells) with CD28- and/or CTLA4-positive cells. Dosage
of a therapeutic agent is dependant upon many factors including,
but not limited to, the type of tissue affected, the type of
autoimmune disease being treated, the severity of the disease, a
subject's health, and a subject's response to the treatment with
the agents. Accordingly, dosages of the agents can vary depending
on the subject and the mode of administration. The soluble CTLA4
mutant molecules may be administered in an amount between 0.1 to
20.0 mg/kg weight of the patient/day, preferably between 0.5 to
10.0 mg/kg/day. Administration of the pharmaceutical compositions
of the invention can be performed over various times. In one
embodiment, the pharmaceutical composition of the invention can be
administered for one or more hours. In addition, the administration
can be repeated depending on the severity of the disease as well as
other factors as understood in the art.
[0074] The invention further provides methods for producing a
protein comprising growing the host vector system of the invention
so as to produce the protein in the host and recovering the protein
so produced.
[0075] Additionally, the invention provides methods for regulating
functional CTLA4- and CD28-positive T cell interactions with CD80-
and/or CD86-positive cells. The methods comprise contacting the
CD80- and/or CD86-positive cells with a soluble CTLA4 mutant
molecule of the invention so as to form mutant CTLA4/CD80 and/or
mutant CTLA4/CD86 complexes, the complexes interfering with
reaction of endogenous CTLA4 antigen with CD80 and/or CD86, and/or
the complexes interfering with reaction of endogenous CD28 antigen
with CD80 and/or CD86. In one embodiment of the invention, the
soluble CTLA4 mutant molecule is a fusion protein that contains at
least a portion of the extracellular domain of mutant CTLA4. In
another embodiment, the soluble CTLA4 mutant molecule comprises: a
first amino acid sequence including the extracellular domain of
CTLA4 from the amino acid sequence having methionine at position +1
to aspartic acid at position +124, including at least one mutation;
and a second amino acid sequence including the hinge, CH2, and CH3
regions of the human immunoglobulin gamma 1 molecule (FIG. 7 or
8).
[0076] In accordance with the practice of the invention, the CD80-
or CD86-positive cells are contacted with fragments or derivatives
of the soluble CTLA4 mutant molecules of the invention.
Alternatively, the soluble CTLA4 mutant molecule is a
CD28Ig/CTLA4Ig fusion protein having a first amino acid sequence
corresponding to a portion of the extracellular domain of CD28
receptor fused to a second amino acid sequence corresponding to a
portion of the extracellular domain of CTLA4 mutant receptor and a
third amino acid sequence corresponding to the hinge, CH2 and CH3
regions of human immunoglobulin C-gamma-1.
[0077] The soluble CTLA4 mutant molecules are expected to exhibit
inhibitory properties in vivo. Under conditions where T cell/APC
cell interactions, for example T cell/B cell interactions, are
occurring as a result of contact between T cells and APC cells,
binding of introduced CTLA4 mutant molecules to react to CD80-
and/or CD86-positive cells, for example B cells, may interfere,
i.e., inhibit, the T cell/APC cell interactions resulting in
regulation of immune responses.
[0078] The invention provides methods for downregulating immune
responses. Down regulation of an immune response by soluble CTLA4
mutant molecules may be by way of inhibiting or blocking an immune
response already in progress or may involve preventing the
induction of an immune response. The soluble CTLA4 molecules of the
invention may inhibit the functions of activated T cells, such as T
lymphocyte proliferation and cytokine secretion, by suppressing T
cell responses or by inducing specific tolerance in T cells, or
both.
[0079] The present invention further provides methods for treating
immune system diseases and tolerance induction In particular
embodiments, the immune system diseases are mediated by CD28-
and/or CTLA4-positive cell interactions with CD80/CD86-positive
cells. In a further embodiment, T cell interactions are inhibited.
Immune system diseases include, but are not limited to, autoimmune
diseases, immunoproliferative diseases, and graft-related
disorders. These methods comprise administering to a subject the
soluble CTLA4 mutant molecules of the invention to regulate T cell
interactions with the CD80- and/or CD86-positive cells.
Alternatively, a CTLA4 mutant hybrid having a membrane glycoprotein
joined to a CTLA4 mutant molecule can be administered. Examples of
graft-related diseases include graft versus host disease (GVHD)
(e.g., such as may result from bone marrow transplantation, or in
the induction of tolerance), immune disorders associated with graft
transplantation rejection, chronic rejection, and tissue or cell
allo- or xenografts, including solid organs, skin, islets, muscles,
hepatocytes, neurons. Examples of immunoproliferative diseases
include, but are not limited to, psoriasis; T cell lymphoma; T cell
acute lymphoblastic leukemia; testicular angiocentric T cell
lymphoma; benign lymphocytic angiitis; and autoimmune diseases such
as lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's
thyroiditis, primary myxedema, Graves' disease, pernicious anemia,
autoimmune atrophic gastritis, Addison's disease, diabetes (e.g.
insulin dependent diabetes mellitis, type I diabetes mellitis),
good pasture's syndrome, myasthenia gravis, pemphigus, Crohn's
disease, sympathetic ophthalmia, autoimmune uveitis, multiple
sclerosis, autoimmune hemolytic anemia, idiopathic
thrombocytopenia, primary biliary cirrhosis, chronic action
hepatitis, ulceratis colitis, Sjogren's syndrome, rheumatic
diseases (e.g., rheumatoid arthritis), polymyositis, scleroderma,
and mixed connective tissue disease.
[0080] The present invention further provides a method for
inhibiting solid organ and/or tissue transplant rejections by a
subject, the subject being a recipient of transplant tissue.
Typically, in tissue transplants, rejection of the graft is
initiated through its recognition as foreign by T cells, followed
by an immune response that destroys the graft. The soluble CTLA4
mutant molecules of this invention, by inhibiting T lymphocyte
proliferation and/or cytokine secretion, may result in reduced
tissue destruction and induction of antigen-specific T cell
unresponsiveness may result in long-term graft acceptance without
the need for generalized immunosuppression. Furthermore, the
soluble CTLA4 mutant molecules of the invention can be administered
with other pharmaceuticals including, but not limited to,
corticosteroids, cyclosporine, rapamycin, mycophenolate mofetil,
azathioprine, tacrolismus, basiliximab, and/or other biologics.
[0081] The present invention also provides methods for inhibiting
graft versus host disease in a subject. This method comprises
administering to the subject a soluble CTLA4 mutant molecule of the
invention, alone or together, with further additional ligands,
reactive with IL-2, IL-4, or .gamma.-interferon. For example, a
soluble CTLA mutant molecule of this invention may be administered
to a bone marrow transplant recipient to inhibit the alloreactivity
of donor T cells. Alternatively, donor T cells within a bone marrow
graft may be tolerized to a recipient's alloantigens ex vivo prior
to transplantation.
[0082] Inhibition of T cell responses by soluble CTLA4 mutant
molecules may also be useful for treating autoimmune disorders.
Many autoimmune disorders result from inappropriate activation of T
cells that are reactive against autoantigens, and which promote the
production of cytokines and autoantibodies that are involved in the
pathology of the disease. Administration of a soluble CTLA4 mutant
molecule in a subject suffering from or susceptible to an
autoimmune disorder may prevent the activation of autoreactive T
cells and may reduce or eliminate disease symptoms. This method may
also comprise administering to the subject a soluble CTLA4 mutant
molecule of the invention, alone or together, with further
additional ligands, reactive with IL-2, IL-4, or
.gamma.-interferon.
[0083] The invention further encompasses the use of the soluble
CTLA4 mutant molecules together with other immunosuppressants,
e.g., cyclosporin (see Mathiesen, in: "Prolonged Survival and
Vascularization of Xenografted Human Glioblastoma Cells in the
Central Nervous System of Cyclosporin A-Treated Rats" (1989) Cancer
Lett., 44:151-156), prednisone, azathioprine, and methotrexate (R.
Handschumacher "Chapter 53: Drugs Used for Immunosuppression" pages
1264-1276). Other immunosuppressants are possible. For example, for
the treatment of rheumatoid arthritis, soluble CTLA4 mutant
molecules can be administered with pharmaceuticals including, but
not limited to, corticosteroids, nonsteroidal antiinflammatory
drugs/Cox-2 inhibitors, methotrexate, hydroxychloroquine,
sulphasalazopryine, gold salts, etanercept, infliximab, anakinra,
azathioprine, and/or other biologics like anti-TNF. For the
treatment of systemic lupus eryhtemathosus, soluble CTLA4 mutant
molecules can be administered with pharmaceuticals including, but
not limited to, corticosteroids, cytoxan, azathioprine,
hydroxychloroquine, mycophenolate mofetil, and/or other biologics.
Further, for the treatment of multiple sclerosis, soluble CTLA4
mutant molecules can be administered with pharmaceuticals
including, but not limited to, corticosteroids, interferon beta-1a,
interferon beta-1b, glatiramer acetate, mitoxantrone hydrochloride,
and/or other biologics.
[0084] The soluble CTLA4 mutant molecules (preferably, L104EA29YIg)
can also be used in combination with one or more of the following
agents to regulate an immune response: soluble gp39 (also known as
CD40 ligand (CD40L), CD154, T-BAM, TRAP), soluble CD29, soluble
CD40, soluble CD80, soluble CD86, soluble CD28, soluble CD56,
soluble Thy-1, soluble CD3, soluble TCR, soluble VLA-4, soluble
VCAM-1, soluble LECAM-1, soluble ELAM-1, soluble CD44, antibodies
reactive with gp39, antibodies reactive with CD40, antibodies
reactive with B7, antibodies reactive with CD28, antibodies
reactive with LFA-1, antibodies reactive with LFA-2, antibodies
reactive with IL-2, antibodies reactive with IL-12, antibodies
reactive with IFN-gamma, antibodies reactive with CD2, antibodies
reactive with CD48, antibodies reactive with any ICAM (e.g.,
ICAM-2), antibodies reactive with CTLA4, antibodies reactive with
Thy-1, antibodies reactive with CD56, antibodies reactive with CD3,
antibodies reactive with CD29, antibodies reactive with TCR,
antibodies reactive with VLA-4, antibodies reactive with VCAM-1,
antibodies reactive with LECAM-1, antibodies reactive with ELAM-1,
antibodies reactive with CD44. In certain embodiments, monoclonal
antibodies are preferred. In other embodiments, antibody fragments
are preferred. As persons skilled in the art will readily
understand, the combination can include the soluble CTLA4 mutant
molecules of the invention and one other immunosuppressive agent,
the soluble CTLA4 mutant molecules with two other immunosuppressive
agents, the soluble CTLA4 mutant molecules with three other
immunosuppressive agents, etc. The determination of the optimal
combination and dosages can be determined and optimized using
methods well known in the art.
[0085] Some specific combinations include the following:
L104EA29YIg and CD80 mAbs; L104EA29YIg and CD86 mAbs; L104EA29YIg,
CD80 mAbs, and CD86 mAbs; L104EA29YIg and gp39 mAbs; L104EA29YIg
and CD40 mAbs; L104EA29YIg and CD28 mAbs; L104EA29YIg, CD80 and
CD86 mAbs, and gp39 mAbs; L104EA29YIg, CD80 and CD86 mAbs and CD40
mAbs; and L104EA29YIg, anti-LFA1 mAb, and anti-gp39 mAb. A specific
example of a gp39 mAb is MR1. Other combinations will be readily
appreciated and understood by persons skilled in the art.
[0086] The soluble CTLA4 mutant molecules of the invention, for
example L104EA29Y, may be administered as the sole active
ingredient or together with other drugs in immunomodulating
regimens or other anti-inflammatory agents e.g. for the treatment
or prevention of allo- or xenograft acute or chronic rejection or
inflammatory or autoimmune disorders, or to induce tolerance. For
example, it may be used in combination with a calcineurin
inhibitor, e.g. cyclosporin A or FK506; an immunosuppressive
macrolide, e.g. rapamycine or a derivative thereof; e.g.
40-O-(2-hydroxy)ethyl-rapamycin, a lymphocyte homing agent, e.g.
FTY720 or an analog thereof; corticosteroids; cyclophosphamide;
azathioprene; methotrexate; leflunomide or an analog thereof;
mizoribine; mycophenolic acid; mycophenolate mofetil;
15-deoxyspergualine or an analog thereof, immunosuppressive
monoclonal antibodies, e.g., monoclonal antibodies to leukocyte
receptors, e.g., MHC, CD2, CD3, CD4, CD 11a/CD18, CD7, CD25, CD 27,
B7, CD40, CD45, CD58, CD 137, ICOS, CD150 (SLAM), OX40, 4-1BB or
their ligands; or other immunomodulatory compounds, e.g.
CTLA4/CD28-Ig, or other adhesion molecule inhibitors, e.g. mAbs or
low molecular weight inhibitors including LFA-1 antagonists,
Selectin antagonists and VLA-4 antagonists. The compound is
particularly useful in combination with a compound which interferes
with CD40 and its ligand, e.g. antibodies to CD40 and antibodies to
CD40-L, e.g. in the above described indications, e.g the induction
of tolerance.
[0087] Where the soluble CTLA4 mutant molecules of the invention
are administered in conjunction with other
immunosuppressive/immunomodulatory or anti-inflammatory therapy,
e.g as hereinabove specified, dosages of the co-administered
immunosuppressant, immunomodulatory or anti-inflammatory compound
will of course vary depending on the type of co-drug employed, e.g.
whether it is a steroid or a cyclosporine, on the specific drug
employed, on the condition being treated and so forth.
[0088] In accordance with the foregoing the present invention
provides in a yet further aspect methods as defined above
comprising co-administration, e.g. concomitantly or in sequence, of
a therapeutically effective amount of soluble CTLA4 mutant
molecules of the invention, L104EA29YIg, in free form or in
pharmaceutically acceptable salt form, and a second drug substance,
said second drug substance being an immunosuppressant,
immunomodulatory or anti-inflammatory drug, e.g. as indicated
above. Further provided are therapeutic combinations, e.g. a kit,
e.g. for use in any method as defined above, comprising a
L104EA29YIg, in free form or in pharmaceutically acceptable salt
form, to be used concomitantly or in sequence with at least one
pharmaceutical composition comprising an immunosuppressant,
immunomodulatory or anti-inflammatory drug. The kit may comprise
instructions for its administration.
Methods for Producing the Molecules of the Invention
[0089] Expression of CTLA4 mutant molecules can be in prokaryotic
cells. Prokaryotes most frequently are represented by various
strains of bacteria. The bacteria may be a gram positive or a gram
negative. Typically, gram-negative bacteria such as E. coli are
preferred. Other microbial strains may also be used.
[0090] Sequences encoding CTLA4 mutant molecules can be inserted
into a vector designed for expressing foreign sequences in
prokaryotic cells such as E. coli. These vectors can include
commonly used prokaryotic control sequences which are defined
herein to include promoters for transcription initiation,
optionally with an operator, along with ribosome binding site
sequences, include such commonly used promoters as the
beta-lactamase (penicillinase) and lactose (lac) promoter systems
(Chang, et al., (1977) Nature 198:1056), the tryptophan (trp)
promoter system (Goeddel, et al., (1980) Nucleic Acids Res. 8:4057)
and the lambda derived P.sub.L promoter and N-gene ribosome binding
site (Shimatake, et al., (1981) Nature 292:128).
[0091] Such expression vectors will also include origins of
replication and selectable markers, such as a beta-lactamase or
neomycin phosphotransferase gene conferring resistance to
antibiotics, so that the vectors can replicate in bacteria and
cells carrying the plasmids can be selected for when grown in the
presence of antibiotics, such as ampicillin or kanamycin.
[0092] The expression plasmid can be introduced into prokaryotic
cells via a variety of standard methods, including but not limited
to CaCl.sub.2-shock (Cohen, (1972) Proc. Natl. Acad. Sci. USA
69:2110, and Sambrook et al. (eds.), "Molecular Cloning: A
Laboratory Manual", 2nd Edition, Cold Spring Harbor Press, (1989))
and electroporation.
[0093] In accordance with the practice of the invention, eukaryotic
cells are also suitable host cells. Examples of eukaryotic cells
include any animal cell, whether primary or immortalized, yeast
(e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, and
Pichia pastoris), and plant cells. Myeloma, COS and CHO cells are
examples of animal cells that may be used as hosts. Particular CHO
cells include, but are not limited to, DG44 (Chasin, et la., 1986
Som. Cell. Molec. Genet. 12:555-556; Kolkekar 1997 Biochemistry
36:10901-10909), CHO-K1 (ATCC No. CCL-61), CHO-K1 Tet-On cell line
(Clontech), CHO designated ECACC 85050302 (CAMR, Salisbury,
Wiltshire, UK), CHO clone 13 (GEIMG, Genova, IT), CHO clone B
(GEIMG, Genova, IT), CHO-K1/SF designated ECACC 93061607 (CAMR,
Salisbury, Wiltshire, UK), and RR-CHOK1 designated ECACC 92052129
(CAMR, Salisbury, Wiltshire, UK). Exemplary plant cells include
tobacco (whole plants, cell culture, or callus), corn, soybean, and
rice cells. Corn, soybean, and rice seeds are also acceptable.
[0094] Nucleic acid sequences encoding the CTLA4 mutant molecules
can also be inserted into a vector designed for expressing foreign
sequences in a eukaryotic host. The regulatory elements of the
vector can vary according to the particular eukaryotic host.
[0095] Commonly used eukaryotic control sequences for use in
expression vectors include promoters and control sequences
compatible with mammalian cells such as, for example, CMV promoter
(CDM8 vector) and avian sarcoma virus (ASV) (.pi.LN vector). Other
commonly used promoters include the early and late promoters from
Simian Virus 40 (SV40) (Fiers, et al., (1973) Nature 273:113), or
other viral promoters such as those derived from polyoma,
Adenovirus 2, and bovine papilloma virus. An inducible promoter,
such as hMTII (Karin, et al., (1982) Nature 299:797-802) may also
be used.
[0096] Vectors for expressing CTLA4 mutant molecules in eukaryotes
may also carry sequences called enhancer regions. These are
important in optimizing gene expression and are found either
upstream or downstream of the promoter region.
[0097] Examples of expression vectors for eukaryotic host cells
include, but are not limited to, vectors for mammalian host cells
(e.g., BPV-1, pHyg, pRSV, pSV2, pTK2 (Maniatis); pIRES (Clontech);
pRc/CMV2, pRc/RSV, pSFV1 (Life Technologies); pVPakc Vectors, pCMV
vectors, pSG5 vectors (Stratagene)), retroviral vectors (e.g., pFB
vectors (Stratagene)), pCDNA-3 (Invitrogen) or modified forms
thereof, adenoviral vectors; Adeno-associated virus vectors,
baculovirus vectors, yeast vectors (e.g., pESC vectors
(Stratagene)).
[0098] Nucleic acid sequences encoding CTLA4 mutant molecules can
integrate into the genome of the eukaryotic host cell and replicate
as the host genome replicates. Alternatively, the vector carrying
CTLA4 mutant molecules can contain origins of replication allowing
for extrachromosomal replication.
[0099] For expressing the nucleic acid sequences in Saccharomyces
cerevisiae, the origin of replication from the endogenous yeast
plasmid, the 2.mu. circle can be used. (Broach, (1983) Meth. Enz.
101:307). Alternatively, sequences from the yeast genome capable of
promoting autonomous replication can be used (see, for example,
Stinchcomb et al., (1979) Nature 282:39); Tschemper et al., (1980)
Gene 10:157; and Clarke et al., (1983) Meth. Enz. 101:300).
[0100] Transcriptional control sequences for yeast vectors include
promoters for the synthesis of glycolytic enzymes (Hess et al.,
(1968) J. Adv. Enzyme Reg. 7:149; Holland et al., (1978)
Biochemistry 17:4900). Additional promoters known in the art
include the CMV promoter provided in the CDM8 vector (Toyama and
Okayama, (1990) FEBS 268:217-221); the promoter for
3-phosphoglycerate kinase (Hitzeman et al., (1980) J. Biol. Chem.
255:2073), and those for other glycolytic enzymes.
[0101] Other promoters are inducible because they can be regulated
by environmental stimuli or the growth medium of the cells. These
inducible promoters include those from the genes for heat shock
proteins, alcohol dehydrogenase 2, isocytochrome C, acid
phosphatase, enzymes associated with nitrogen catabolism, and
enzymes responsible for maltose and galactose utilization.
[0102] Regulatory sequences may also be placed at the 3' end of the
coding sequences. These sequences may act to stabilize messenger
RNA. Such terminators are found in the 3' untranslated region
following the coding sequences in several yeast-derived and
mammalian genes.
[0103] Exemplary vectors for plants and plant cells include, but
are not limited to, Agrobacterium T.sub.i plasmids, cauliflower
mosaic virus (CaMV), and tomato golden mosaic virus (TGMV).
[0104] General aspects of mammalian cell host system
transformations have been described by Axel (U.S. Pat. No.
4,399,216 issued Aug. 16, 1983). Mammalian cells can be transformed
by methods including but not limited to, transfection in the
presence of calcium phosphate, microinjection, electroporation, or
via transduction with viral vectors.
[0105] Methods for introducing foreign DNA sequences into plant and
yeast genomes include (1) mechanical methods, such as
microinjection of DNA into single cells or protoplasts, vortexing
cells with glass beads in the presence of DNA, or shooting
DNA-coated tungsten or gold spheres into cells or protoplasts; (2)
introducing DNA by making cell membranes permeable to
macromolecules through polyethylene glycol treatment or subjection
to high voltage electrical pulses (electroporation); or (3) the use
of liposomes (containing cDNA) which fuse to cell membranes.
[0106] Expression of CTLA4 mutant molecules can be detected by
methods known in the art. For example, the mutant molecules can be
detected by Coomassie staining SDS-PAGE gels and immunoblotting
using antibodies that bind CTLA4. Protein recovery can be performed
using standard protein purification means, e.g., affinity
chromatography or ion-exchange chromatography, to yield
substantially pure product (R. Scopes in: "Protein Purification,
Principles and Practice", Third Edition, Springer-Verlag
(1994)).
[0107] The invention further provides soluble CTLA4 mutant
molecules produced above herein.
CTLA4IG Codon-Based Mutagenesis
[0108] In one embodiment, site-directed mutagenesis and a novel
screening procedure were used to identify several mutations in the
extracellular domain of CTLA4 that improve binding avidity for
CD86. In this embodiment, mutations were carried out in residues in
the regions of the extracellular domain of CTLA4 from serine 25 to
arginine 33, the C' strand (alanine 49 and threonine 51), the F
strand (lysine 93, glutamic acid 95 and leucine 96), and in the
region from methionine 97 through tyrosine 102, tyrosine 103
through glycine 107 and in the G strand at positions glutamine 111,
tyrosine 113 and isoleucine 115. These sites were chosen based on
studies of chimeric CD28/CTLA4 fusion proteins (Peach et al., J.
Exp. Med., 1994, 180:2049-2058), and on a model predicting which
amino acid residue side chains would be solvent exposed, and a lack
of amino acid residue identity or homology at certain positions
between CD28 and CTLA4. Also, any residue which is spatially in
close proximity (5 to 20 Angstrom Units) to the identified residues
is considered part of the present invention.
[0109] To synthesize and screen soluble CTLA4 mutant molecules with
altered affinities for CD80 and/or CD86, a two-step strategy was
adopted. The experiments entailed first generating a library of
mutations at a specific codon of an extracellular portion of CTLA4
and then screening these by BIAcore analysis to identify mutants
with altered reactivity to CD80 or CD86. The Biacore assay system
(Pharmacia, Piscataway, N.J.) uses a surface plasmon resonance
detector system that essentially involves covalent binding of
either CD80Ig or CD86Ig to a dextran-coated sensor chip which is
located in a detector. The test molecule can then be injected into
the chamber containing the sensor chip and the amount of
complementary protein that binds can be assessed based on the
change in molecular mass which is physically associated with the
dextran-coated side of the sensor chip; the change in molecular
mass can be measured by the detector system.
ADVANTAGES OF THE INVENTION
[0110] Because CTLA4 binding to CD80 and CD86 is characterized by
rapid "on" rates and rapid dissociation ("off") rates, and because
CTLA4Ig-CD86 complexes dissociate approximately 5- to 8-fold more
rapidly than CTLA4Ig-CD80 complexes, it was reasoned that slowing
the rate of dissociation of CTLA4Ig from CD80 and/or CD86 would
result in molecules with more potent immunosuppressive properties.
Thus, soluble CTLA4 mutant molecules having a higher avidity for
CD80- or CD86-positive cells compared to wild type CTLA4, or
non-mutated forms of CTLA4Ig, are expected to block the priming of
antigen specific activated cells with higher efficiency than wild
type CTLA4 or non-mutated forms of CTLA4Ig.
[0111] Further, production costs for CTLA4Ig are very high. The
high avidity mutant CTLA4Ig molecules having higher potent
immunosuppressive properties can be used in the clinic, at
considerably lower doses than non-mutated CTLA4Ig, to achieve
similar levels of immunosuppression. Thus, soluble CTLA4 mutant
molecules, e.g., L104EA29YIg, may be very cost effective.
[0112] The following examples are presented to illustrate the
present invention and to assist one of ordinary skill in making and
using the same. The examples are not intended in any way to
otherwise limit the scope of the invention.
EXAMPLES
Example 1
[0113] This example provides a description of the methods used to
generate the nucleotide sequences encoding the soluble CTLA4 mutant
molecules of the invention. A single-site mutant L104EIg was
generated and tested for binding kinetics for CD80 and/or CD86. The
L104EIg nucleotide sequence was used as a template to generate the
double-site mutant CTLA4 sequence, L104EA29YIg, which was tested
for binding kinetics for CD80 and/or CD86.
CTLA4Ig Codon Based Mutagenesis
[0114] A mutagenesis and screening strategy was developed to
identify mutant CTLA4Ig molecules that had slower rates of
dissociation ("off" rates) from CD80 and/or CD86 molecules.
Single-site mutant nucleotide sequences were generated using
CTLA4Ig (U.S. Pat. Nos. 5,844,095; 5,851,795; and 5,885,796; ATCC
Accession No. 68629) as a template. Mutagenic oligonucleotide PCR
primers were designed for random mutagenesis of a specific cDNA
codon by allowing any base at positions 1 and 2 of the codon, but
only guanine or thymine at position 3 (XXG/T; also known as NNG/T).
In this manner, a specific codon encoding an amino acid could be
randomly mutated to code for each of the 20 amino acids. In that
regard, XXG/T mutagenesis yields 32 potential codons encoding each
of the 20 amino acids. PCR products encoding mutations in close
proximity to -M97-G107 of CTLA4Ig (see FIG. 7 or 8), were digested
with SacI/XbaI and subcloned into similarly cut CTLA4Ig .pi.LN
(also known as piLN) expression vector. This method was used to
generate the single-site CTLA4 mutant molecule L104EIg (FIG.
8).
[0115] For mutagenesis in proximity to S25-R33 of CTLA4Ig, a silent
NheI restriction site was first introduced 5' to this loop, by PCR
primer-directed mutagenesis. PCR products were digested with
NheI/XbaI and subcloned into similarly cut CTLA4Ig or L104EIg
expression vectors. This method was used to generate the
double-site CTLA4 mutant molecule L104EA29YIg (FIG. 7). In
particular, the nucleic acid molecule encoding the single-site
CTLA4 mutant molecule, L104EIg, was used as a template to generate
the double-site CTLA4 mutant molecule, L104EA29YIg. The piLN vector
having the L104EA29YIg is shown in FIG. 12.
Example 2
[0116] The following provides a description of the screening
methods used to identify the single- and double-site mutant CTLA4
polypeptides, expressed from the constructs described in Example 1,
that exhibited a higher binding avidity for CD80 and CD86 antigens,
compared to non-mutated CTLA4Ig molecules.
[0117] Current in vitro and in vivo studies indicate that CTLA4Ig
by itself is unable to completely block the priming of antigen
specific activated T cells. In vitro studies with CTLA4Ig and
either monoclonal antibody specific for CD80 or CD86 measuring
inhibition of T cell proliferation indicate that anti-CD80
monoclonal antibody did not augment CTLA4Ig inhibition. However,
anti-CD86 monoclonal antibody did augment the inhibition,
indicating that CTLA4Ig was not as effective at blocking CD86
interactions. These data support earlier findings by Linsley et al.
(Immunity, (1994), 1:793-801) showing inhibition of CD80-mediated
cellular responses required approximately 100 fold lower CTLA4Ig
concentrations than for CD86-mediated responses. Based on these
findings, it was surmised that soluble CTLA4 mutant molecules
having a higher avidity for CD86 than wild type CTLA4 should be
better able to block the priming of antigen specific activated
cells than CTLA4Ig.
[0118] To this end, the soluble CTLA4 mutant molecules described in
Example 1 above were screened using a novel screening procedure to
identify several mutations in the extracellular domain of CTLA4
that improve binding avidity for CD80 and CD86. This screening
strategy provided an effective method to directly identify mutants
with apparently slower "off" rates without the need for protein
purification or quantitation since "off" rate determination is
concentration independent (O'Shannessy et al., (1993) Anal.
Biochem., 212:457-468).
[0119] COS cells were transfected with individual miniprep purified
plasmid DNA and propagated for several days. Three day conditioned
culture media was applied to BIAcore biosensor chips (Pharmacia
Biotech AB, Uppsala, Sweden) coated with soluble CD80Ig or CD86Ig.
The specific binding and dissociation of mutant proteins was
measured by surface plasmon resonance (O'Shannessy, D. J., et al.,
(1993) Anal. Biochem. 212:457-468). All experiments were run on
BIAcore.TM. or BIAcore.TM. 2000 biosensors at 25.degree. C. Ligands
were immobilized on research grade NCMS sensor chips (Pharmacia)
using standard N-ethyl-N'-(dimethylaminopropyl)
carbodiimidN-hydroxysuccinimide coupling (Johnsson, B., et al.
(1991) Anal. Biochem. 198: 268-277; Khilko, S. N., et al.(1993) J.
Biol. Chem. 268:5425-15434).
Screening Method
[0120] COS cells grown in 24 well tissue culture plates were
transiently transfected with DNA encoding mutant CTLA4Ig. Culture
media containing secreted soluble mutant CTLA4Ig was collected 3
days later.
[0121] Conditioned COS cell culture media was allowed to flow over
BIAcore biosensor chips derivatized with CD86Ig or CD80Ig (as
described in Greene et al., 1996 J. Biol. Chem. 271:26762-26771),
and mutant molecules were identified with "off" rates slower than
that observed for wild type CTLA4Ig. The cDNAs corresponding to
selected media samples were sequenced and DNA was prepared to
perform larger scale COS cell transient transfection, from which
mutant CTLA4Ig protein was prepared following protein A
purification of culture media.
[0122] BIAcore analysis conditions and equilibrium binding data
analysis were performed as described in J. Greene et al. 1996 Biol.
Chem. 271:26762-26771, and as described herein.
BIAcore Data Analysis
[0123] Senosorgram baselines were normalized to zero response units
(RU) prior to analysis. Samples were run over mock-derivatized flow
cells to determine background response unit (RU) values due to bulk
refractive index differences between solutions. Equilibrium
dissociation constants (K.sub.d) were calculated from plots of
R.sub.eq versus C, where R.sub.eq is the steady-state response
minus the response on a mock-derivatized chip, and C is the molar
concentration of analyte. Binding curves were analyzed using
commercial nonlinear curve-fitting software (Prism, GraphPAD
Software).
[0124] Experimental data were first fit to a model for a single
ligand binding to a single receptor (1-site model, i.e., a simple
langmuir system, A+B.revreaction.*AB), and equilibrium association
constants (K.sub.d=[A][B]\[AB]) were calculated from the equation
R=R.sub.maxC/(K.sub.d+C). Subsequently, data were fit to the
simplest two-site model of ligand binding (i.e., to a receptor
having two non-interacting independent binding sites as described
by the equation
R=R.sub.max1C\(K.sub.d1+C)+R.sub.max2C\(K.sub.d2+C)).
[0125] The goodness-of-fits of these two models were analyzed
visually by comparison with experimental data and statistically by
an F test of the sums-of-squares. The simpler one-site model was
chosen as the best fit, unless the two-site model fit significantly
better (p<0.1).
[0126] Association and disassociation analyses were performed using
BIA evaluation 2.1 Software (Pharmacia). Association rate constants
k.sub.on, were calculated in two ways, assuming both homogenous
single-site interactions and parallel two-site interactions. For
single-site interactions, k.sub.on values were calculated according
to the equation R.sub.t=R.sub.eq(1-exp.sup.-ks(t-t.sup.0), where
R.sub.t is a response at a given time, t; R.sub.eq is the
steady-state response; t.sub.0 is the time at the start of the
injection; and k.sub.s=dR/dt=k.sub.onCk.sub.off, and where C is a
concentration of analyte, calculated in terms of monomeric binding
sites. For two-site interactions k.sub.on values were calculated
according to the equation
R.sub.t=R.sub.eq1(1-exp.sup.-ks1(t-t.sup.0.sup.)+R.sub.eq2(1-exp.sup.ks2(-
t-t.sup.0.sup.). For each model, the values of k.sub.on were
determined from the calculated slope (to about 70% maximal
association) of plots of k.sub.s versus C.
[0127] Dissociation data were analyzed according to one site
(AB=A+B) or two sites (AiBj=Ai+Bj) models, and rate constants
(k.sub.off) were calculated from best fit curves. The binding site
model was used except when the residuals were greater than machine
background (2-10 RU, according to machine), in which case the
two-binding site model was employed. Half-times of receptor
occupancy were calculated using the relationship
t.sub.1/2=0.693/k.sub.off.
Flow Cytometry
[0128] Murine mAb L307.4 (anti-CD80) was purchased from Becton
Dickinson (San Jose, Calif.) and IT2.2 (anti-B7-0 [also known as
CD86]), from Pharmingen (San Diego, Calif.). For immunostaining,
CD80-positive and/or CD86-positive CHO cells were removed from
their culture vessels by incubation in phosphate-buffered saline
(PBS) containing 10 mM EDTA. CHO cells (1-10.times.10.sup.5) were
first incubated with mAbs or immunoglobulin fusion proteins in DMEM
containing 10% fetal bovine serum (FBS), then washed and incubated
with fluorescein isothiocyanate-conjugated goat anti-mouse or
anti-human immunoglobulin second step reagents (Tago, Burlingame,
Calif.). Cells were given a final wash and analyzed on a FACScan
(Becton Dickinson).
SDS-PAGE and Size Exclusion Chromatography
[0129] SDS-PAGE was performed on Tris/glycine 4-20% acrylamide gels
(Novex, San Diego, Calif.). Analytical gels were stained with
Coomassie Blue, and images of wet gels were obtained by digital
scanning. CTLA4Ig (25 .mu.g) and L104EA29YIg (25 .mu.g) were
analyzed by size exclusion chromatography using a TSK-GEL G300
SW.sub.XL column (7.8.times.300 mm, Tosohaas, Montgomeryville, Pa.)
equilibrated in phosphate buffered saline containing 0.02%
NAN.sub.3 at a flow rate of 1.0 ml/min.
CTLA4X.sub.C120S and L104EA29YX.sub.C120S.
[0130] Single chain CTLA4X.sub.C120S was prepared as previously
described (Linsley et al., (1995) J. Biol. Chem., 270:15417-15424).
Briefly, an oncostatin M CTLA4 (OMCTLA4) expression plasmid was
used as a template, the forward primer,
[0131] GAGGTGATAAAGCTTCACCAATGGGTGTACTGCTCACACAG was chosen to
match sequences in the vector; and the reverse primer,
[0132] GTGGTGTATTGGTCTAGATCAATCAGAATCTGGGCACGGTTC corresponded to
the last seven amino acids (i.e. amino acids 118-124) in the
extracellular domain of CTLA4, and contained a restriction enzyme
site, and a stop codon (TGA). The reverse primer specified a C120S
(cysteine to serine at position 120) mutation. In particular, the
nucleotide sequence GCA (nucleotides 34-36) of the reverse primer
shown above is replaced with one of the following nucleotide
sequences: AGA, GGA, TGA, CGA, ACT, or GCT. As persons skilled in
the art will understand, the nucleotide sequence GCA is a reversed
complementary sequence of the codon TGC for cysteine. Similarly,
the nucleotide sequences AGA, GGA, TGA, CGA, ACT, or GCT are the
reversed complementary sequences of the codons for serine.
Polymerase chain reaction products were digested with HindIII/XbaI
and directionally subcloned into the expression vector .pi.LN
(Bristol-Myers Squibb Company, Princeton, N.J.).
L104EA29YX.sub.C120S was prepared in an identical manner. Each
construct was verified by DNA sequencing.
Identification and Biochemical Characterization of High Avidity
Mutants
[0133] Twenty four amino acids were chosen for mutagenesis and the
resulting 2300 mutant proteins assayed for CD86Ig binding by
surface plasmon resonance (SPR; as described, supra). The
predominant effects of mutagenesis at each site are summarized in
Table II. Random mutagenesis of some amino acids in the S25-R33
apparently did not alter ligand binding. Mutagenesis of E31 and R33
and residues M97-Y102 apparently resulted in reduced ligand
binding. Mutagenesis of residues, S25, A29, and T30, K93, L96,
Y103, L104, and G105, resulted in proteins with slow "on" and/or
slow "off" rates. These results confirm previous findings that
residues in the S25-R33 region, and residues in or near M97-Y102
influence ligand binding (Peach et al., (1994) J. Exp. Med.,
180:2049-2058.
[0134] Mutagenesis of sites S25, T30, K93, L96, Y103, and G105
resulted in the identification of some mutant proteins that had
slower "off" rates from CD86Ig. However, in these instances, the
slow "off" rate was compromised by a slow "on" rate which resulted
in mutant proteins with an overall avidity for CD86Ig that was
apparently similar to that seen with wild type CTLA4Ig. In
addition, mutagenesis of K93 resulted in significant aggregation
which may have been responsible for the kinetic changes
observed.
[0135] Random mutagenesis of L104 followed by COS cell transfection
and screening by SPR of culture media samples over immobilized
CD86Ig yielded six media samples containing mutant proteins with
approximately 2-fold slower "off" rates than wild type CTLA4Ig.
When the corresponding cDNA of these mutants were sequenced, each
was found to encode a leucine to glutamic acid mutation (L104E).
Apparently, substitution of leucine 104 to aspartic acid (L104D)
did not affect CD86Ig binding.
[0136] Mutagenesis was then repeated at each site listed in Table
II, this time using L104E as the PCR template instead of wild type
CTLA4Ig, as described above. SPR analysis, again using immobilized
CD86Ig, identified six culture media samples from mutagenesis of
alanine 29 with proteins having approximately 4-fold slower "off"
rates than wild type CTLA4Ig. The two slowest were tyrosine
substitutions (L104EA29Y), two were leucine (L104EA29L), one was
tryptophan (L104EA29W), and one was threonine (L104EA29T).
Apparently, no slow "off" rate mutants were identified when alanine
29 was randomly mutated, alone, in wild type CTLA4Ig.
[0137] The relative molecular mass and state of aggregation of
purified L104E and L104EA29YIg was assessed by SDS-PAGE and size
exclusion chromatography. L104EA29YIg (.about.1 .mu.g; lane 3) and
L104EIg (.about.1 .mu.g; lane 2) apparently had the same
electrophoretic mobility as CTLA4Ig (.about.1 .mu.g; lane 1) under
reducing (.about.50 kDa; +.beta.ME; plus 2-mercaptoethanol) and
non-reducing (.about.100 kDa; -.beta.ME) conditions (FIG. 10A).
Size exclusion chromatography demonstrated that L104EA29YIg (FIG.
10C) apparently had the same mobility as dimeric CTLA4Ig (FIG.
10B). The major peaks represent protein dimer while the faster
eluting minor peak in FIG. 10B represents higher molecular weight
aggregates. Approximately 5.0% of CTLA4Ig was present as higher
molecular weight aggregates but there was no evidence of
aggregation of L104EA29YIg or L104EIg. Therefore, the stronger
binding to CD86Ig seen with L104EIg and L104EA29YIg could not be
attributed to aggregation induced by mutagenesis.
Equilibrium and Kinetic Binding Analysis
[0138] Equilibrium and kinetic binding analysis was performed on
protein A purified CTLA4Ig, L104EIg, and L104EA29YIg using surface
plasmon resonance (SPR). The results are shown in Table I. Observed
equilibrium dissociation constants (K.sub.d; Table I) were
calculated from binding curves generated over a range of
concentrations (5.0-200 nM). L104EA29YIg binds more strongly to
CD86Ig than does L104EIg or CTLA4Ig. The lower K.sub.d of
L104EA29YIg (3.21 nM) than L104EIg (6.06 nM) or CTLA4Ig (13.9 nM)
indicates higher binding avidity of L104EA29YIg to CD86Ig. The
lower K.sub.d of L104EA29YIg (3.66 nM) than L104EIg (4.47 nM) or
CTLA4Ig (6.51 nM) indicates higher binding avidity of L104EA29YIg
to CD80Ig.
[0139] Kinetic binding analysis revealed that the comparative "on"
rates for CTLA4Ig, L104EIg, and L104EA29YIg binding to CD80 were
similar, as were the "on" rates for CD86Ig (Table I). However,
"off" rates for these molecules were not equivalent (Table I).
Compared to CTLA4Ig, L104EA29YIg had approximately 2-fold slower
"off" rate from CD80Ig, and approximately 4-fold slower "off" rate
from CD86Ig. L104E had "off" rates intermediate between L104EA29YIg
and CTLA4Ig. Since the introduction of these mutations did not
significantly affect "on" rates, the increase in avidity for CD80Ig
and CD86Ig observed with L104EA29YIg was likely primarily due to a
decrease in "off" rates.
[0140] To determine whether the increase in avidity of L104EA29YIg
for CD86Ig and CD80Ig was due to the mutations affecting the way
each monomer associated as a dimer, or whether there were avidity
enhancing structural changes introduced into each monomer, single
chain constructs of CTLA4 and L104EA29Y extracellular domains were
prepared following mutagenesis of cysteine 120 to serine as
described supra, and by Linsley et al., (1995) J. Biol. Chem.,
270:15417-15424. The purified proteins CTLA4X.sub.C120S and
L104EA29YX.sub.C120S were shown to be monomeric by gel permeation
chromatography (Linsley et al., (1995), supra), before their ligand
binding properties were analyzed by SPR. Results showed that
binding affinity of both monomeric proteins for CD86Ig was
approximately 35-80-fold less than that seen for their respective
dimers (Table I). This supports previously published data
establishing that dimerization of CTLA4 was required for high
avidity ligand binding (Greene et al., (1996) J. Biol. Chem.,
271:26762-26771).
[0141] L104EA29YX.sub.C120S bound with approximately 2-fold higher
affinity than CTLA4X.sub.C120S to both CD80Ig and CD86Ig. The
increased affinity was due to approximately 3-fold slower rate of
dissociation from both ligands. Therefore, stronger ligand binding
by L104EA29Y was most likely due to avidity enhancing structural
changes that had been introduced into each monomeric chain rather
than alterations in which the molecule dimerized.
Location and Structural Analysis of Avidity Enhancing Mutations
[0142] The solution structure of the extracellular IgV-like domain
of CTLA4 has recently been determined by NMR spectroscopy (Metzler
et al., (1997) Nature Struct. Biol., 4:527-531. This allowed
accurate location of leucine 104 and alanine 29 in the three
dimensional fold (FIG. 11A-B). Leucine 104 is situated near the
highly conserved MYPPPY amino acid sequence (SEQ ID NO:9). Alanine
29 is situated near the C-terminal end of the S25-R33 region, which
is spatially adjacent to the MYPPPY region (SEQ ID NO:9). While
there is significant interaction between residues at the base of
these two regions, there is apparently no direct interaction
between L104 and A29 although they both comprise part of a
contiguous hydrophobic core in the protein. The structural
consequences of the two avidity enhancing mutants were assessed by
modeling. The A29Y mutation can be easily accommodated in the cleft
between the S25-R33 region and the MYPPPY region (SEQ ID NO:9), and
may serve to stabilize the conformation of the MYPPPY region (SEQ
ID NO:9). In wild type CTLA4, L104 forms extensive hydrophobic
interactions with L96 and V94 near the MYPPPY region (SEQ ID NO:9).
It is highly unlikely that the glutamic acid mutation adopts a
conformation similar to that of L104 for two reasons. First, there
is insufficient space to accommodate the longer glutamic acid side
chain in the structure without significant perturbation to the
S25-R33 region. Second, the energetic costs of burying the negative
charge of the glutamic acid side chain in the hydrophobic region
would be large. Instead, modeling studies predict that the glutamic
acid side chain flips out on to the surface where its charge can be
stabilized by solvation. Such a conformational change can easily be
accommodated by G105, with minimal distortion to other residues in
the regions.
Binding of High Avidity Mutants to CHO Cells Expressing CD80 or
CD86
[0143] FACS analysis (FIG. 2) of CTLA4Ig and mutant molecules
binding to stably transfected CD80+ and CD86+CHO cells was
performed as described herein. CD80-positive and CD86-positive CHO
cells were incubated with increasing concentrations of CTLA4Ig,
L104EA29YIg, or L104EIg, and then washed. Bound immunoglobulin
fusion protein was detected using fluorescein
isothiocyanate-conjugated goat anti-human immunoglobulin.
[0144] As shown in FIG. 2, CD80-positive or CD86-positive CHO cells
(1.5.times.10.sup.5) were incubated with the indicated
concentrations of CTLA4Ig (closed squares), L104EA29YIg (circles),
or L104EIg (triangles) for 2 hr. at 23.degree. C., washed, and
incubated with fluorescein isothiocyanate-conjugated goat
anti-human immunoglobulin antibody. Binding on a total of 5,000
viable cells was analyzed (single determination) on a FACScan, and
mean fluorescence intensity (MFI) was determined from data
histograms using PC-LYSYS. Data were corrected for background
fluorescence measured on cells incubated with second step reagent
only (MFI=7). Control L6 mAb (80 .mu.g/ml) gave MFI<30. These
results are representative of four independent experiments.
[0145] Binding of L104EA29YIg, L104EIg, and CTLA4Ig to human
CD80-transfected CHO cells is approximately equivalent (FIG. 2A).
L104EA29YIg and L104EIg bind more strongly to CHO cells stably
transfected with human CD86 than does CTLA4Ig (FIG. 2B).
Functional Assays
[0146] Human CD4-positive T cells were isolated by immunomagnetic
negative selection (Linsley et al., (1992) J. Exp. Med.
176:1595-1604). Isolated CD4-positive T cells were stimulated with
phorbal myristate acetate (PMA) plus CD80-positive or CD86-positive
CHO cells in the presence of titrating concentrations of inhibitor.
CD4-positive T cells (8-10.times.10.sup.4/well) were cultured in
the presence of 1 nM PMA with or without irradiated CHO cell
stimulators. Proliferative responses were measured by the addition
of 1 .mu.Ci/well of [3H]thymidine during the final 7 hours of a 72
hour culture. Inhibition of PMA plus CD80-positive CHO, or
CD86-positive CHO, stimulated T cells by L104EA29YIg and CTLA4Ig
was performed. The results are shown in FIG. 3. L104EA29YIg
inhibits proliferation of CD80-positive PMA treated CHO cells more
than CTLA4Ig (FIG. 3A). L104EA29YIg is also more effective than
CTLA4Ig at inhibiting proliferation of CD86-positive PMA treated
CHO cells (FIG. 3B). Therefore, L104EA29YIg is a more potent
inhibitor of both CD80- and CD86-mediated costimulation of T
cells.
[0147] FIG. 4 shows inhibition by L104EA29YIg and CTLA4Ig of
allostimulated human T cells prepared above, and further
allostimulated with a human B lymphoblastoid cell line (LCL) called
PM that expressed CD80 and CD86 (T cells at 3.0.times.10.sup.4/well
and PM at 8.0.times.10.sup.3/well). Primary allostimulation
occurred for 6 days, then the cells were pulsed with
.sup.3H-thymidine for 7 hours, before incorporation of radiolabel
was determined.
[0148] Secondary allostimulation was performed as follows. Seven
day primary allostimulated T cells were harvested over lymphocyte
separation medium (LSM) (ICN, Aurora, Ohio) and rested for 24
hours. T cells were then restimulated (secondary), in the presence
of titrating amounts of CTLA4Ig or L104EA29YIg, by adding PM in the
same ratio as above. Stimulation occurred for 3 days, then the
cells were pulsed with radiolabel and harvested as above. The
effect of L104EA29YIg on primary allostimulated T cells is shown in
FIG. 4A. The effect of L104EA29YIg on secondary allostimulated T
cells is shown in FIG. 4B. L104EA29YIg inhibits both primary and
secondary T cell proliferative responses better than CTLA4Ig.
[0149] To measure cytokine production (FIG. 5), duplicate secondary
allostimulation plates were set up. After 3 days, culture media was
assayed using ELISA kits (Biosource, Camarillo, Calif.) using
conditions recommended by the manufacturer. L104EA29YIg was found
to be more potent than CTLA4Ig at blocking T cell IL-2, IL-4, and
.gamma.-IFN cytokine production following a secondary allogeneic
stimulus (FIGS. 5A-C).
[0150] The effects of L104EA29YIg and CTLA4Ig on monkey mixed
lymphocyte response (MLR) are shown in FIG. 6. Peripheral blood
mononuclear cells (PBMC'S; 3.5.times.10.sup.4 cells/well from each
monkey) from 2 monkeys were purified over lymphocyte separation
medium (LSM) and mixed with 2 .mu.g/ml phytohemaglutinin (PHA). The
cells were stimulated 3 days then pulsed with radiolabel 16 hours
before harvesting. L104EA29YIg inhibited monkey T cell
proliferation better than CTLA4Ig.
TABLE-US-00002 TABLE I Equilibrium and apparent kinetic constants
are given in the following table (values are means .+-. standard
deviation from three different experiments): Immobilized K.sub.d
Protein Analyte k.sub.on (.times.10.sup.5) M.sup.-1 S.sup.-1
k.sub.off (.times.10.sup.-3) S.sup.-1 nM CD80Ig CTLA4Ig 3.44 .+-.
0.29 2.21 .+-. 0.18 6.51 .+-. 1.08 CD80Ig L104EIg 3.02 .+-. 0.05
1.35 .+-. 0.08 4.47 .+-. 0.36 CD80Ig L104EA29YIg 2.96 .+-. 0.20
1.08 .+-. 0.05 3.66 .+-. 0.41 CD80Ig CTLA4X.sub.C120S 12.0 .+-. 1.0
230 .+-. 10 195 .+-. 25 CD80Ig L104EA29YX.sub.C120S 8.3 .+-. 0.26
71 .+-. 5 85.0 .+-. 2.5 CD86Ig CTLA4Ig 5.95 .+-. 0.57 8.16 .+-.
0.52 13.9 .+-. 2.27 CD86Ig L104EIg 7.03 .+-. 0.22 4.26 .+-. 0.11
6.06 .+-. 0.05 CD86Ig L104EA29YIg 6.42 .+-. 0.40 2.06 .+-. 0.03
3.21 .+-. 0.23 CD86Ig CTLA4X.sub.C120S 16.5 .+-. 0.5 840 .+-. 55
511 .+-. 17 CD86Ig L104EA29YX.sub.C120S 11.4 .+-. 1.6 300 .+-. 10
267 .+-. 29
TABLE-US-00003 TABLE II The effect on CD86Ig binding by mutagenesis
of CTLA4Ig at the sites listed was determined by SPR, described
supra. The predominant effect is indicated with a "+" sign. Effects
of Mutagenesis No Apparent Slow "on" rate/slow Reduced ligand
Mutagenesis Site Effect "off rate binding S25 + P26 + G27 + K28 +
A29 + T30 + E31 + R33 + K93 + L96 + M97 + Y98 + P99 + P100 + P101 +
Y102 + Y103 + L104 + G105 + I106 + G107 + Q111 + Y113 + I115 +
[0151] As will be apparent to those skilled in the art to which the
invention pertains, the present invention may be embodied in forms
other than those specifically disclosed above without departing
from the spirit or essential characteristics of the invention. The
particular embodiments of the invention described above, are,
therefore, to be considered as illustrative and not restrictive.
The scope of the present invention is as set forth in the appended
claims rather than being limited to the examples contained in the
foregoing description.
Sequence CWU 1
1
9141DNAArtificial SequenceDescription of Artificial
SequenceOncostatin M CTLA4 (OMCTLA4) Forward Primer 1gaggtgataa
agcttcacca atgggtgtac tgctcacaca g 41242DNAArtificial
SequenceDescription of Artificial SequenceOncostatin M CTLA4
(OMCTLA4) Reverse Primer 2gtggtgtatt ggtctagatc aatcagaatc
tgggcacggt tc 4231152DNAHomo sapiens 3atgggtgtac tgctcacaca
gaggacgctg ctcagtctgg tccttgcact cctgtttcca 60agcatggcga gcatggcaat
gcacgtggcc cagcctgctg tggtactggc cagcagccga 120ggcatcgcta
gctttgtgtg tgagtatgca tctccaggca aatatactga ggtccgggtg
180acagtgcttc ggcaggctga cagccaggtg actgaagtct gtgcggcaac
ctacatgatg 240gggaatgagt tgaccttcct agatgattcc atctgcacgg
gcacctccag tggaaatcaa 300gtgaacctca ctatccaagg actgagggcc
atggacacgg gactctacat ctgcaaggtg 360gagctcatgt acccaccgcc
atactacgag ggcataggca acggaaccca gatttatgta 420attgatccag
aaccgtgccc agattctgat caggagccca aatcttctga caaaactcac
480acatccccac cgtccccagc acctgaactc ctggggggat cgtcagtctt
cctcttcccc 540ccaaaaccca aggacaccct catgatctcc cggacccctg
aggtcacatg cgtggtggtg 600gacgtgagcc acgaagaccc tgaggtcaag
ttcaactggt acgtggacgg cgtggaggtg 660cataatgcca agacaaagcc
gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 720gtcctcaccg
tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc
780aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg
gcagccccga 840gaaccacagg tgtacaccct gcccccatcc cgggatgagc
tgaccaagaa ccaggtcagc 900ctgacctgcc tggtcaaagg cttctatccc
agcgacatcg ccgtggagtg ggagagcaat 960gggcagccgg agaacaacta
caagaccacg cctcccgtgc tggactccga cggctccttc 1020ttcctctaca
gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca
1080tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct
ctccctgtct 1140ccgggtaaat ga 11524383PRTArtificial
SequenceDescription of Artificial SequenceL104EA29YIg 4Met Gly Val
Leu Leu Thr Gln Arg Thr Leu Leu Ser Leu Val Leu Ala 1 5 10 15 Leu
Leu Phe Pro Ser Met Ala Ser Met Ala Met His Val Ala Gln Pro 20 25
30 Ala Val Val Leu Ala Ser Ser Arg Gly Ile Ala Ser Phe Val Cys Glu
35 40 45 Tyr Ala Ser Pro Gly Lys Tyr Thr Glu Val Arg Val Thr Val
Leu Arg 50 55 60 Gln Ala Asp Ser Gln Val Thr Glu Val Cys Ala Ala
Thr Tyr Met Met 65 70 75 80Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser
Ile Cys Thr Gly Thr Ser 85 90 95 Ser Gly Asn Gln Val Asn Leu Thr
Ile Gln Gly Leu Arg Ala Met Asp 100 105 110 Thr Gly Leu Tyr Ile Cys
Lys Val Glu Leu Met Tyr Pro Pro Pro Tyr 115 120 125 Tyr Glu Gly Ile
Gly Asn Gly Thr Gln Ile Tyr Val Ile Asp Pro Glu 130 135 140 Pro Cys
Pro Asp Ser Asp Gln Glu Pro Lys Ser Ser Asp Lys Thr His 145 150 155
160Thr Ser Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val
165 170 175 Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser
Arg Thr 180 185 190 Pro Glu Val Thr Cys Val Val Val Asp Val Ser His
Glu Asp Pro Glu 195 200 205 Val Lys Phe Asn Trp Tyr Val Asp Gly Val
Glu Val His Asn Ala Lys 210 215 220 Thr Lys Pro Arg Glu Glu Gln Tyr
Asn Ser Thr Tyr Arg Val Val Ser 225 230 235 240Val Leu Thr Val Leu
His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys 245 250 255 Cys Lys Val
Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile 260 265 270 Ser
Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 275 280
285 Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu
290 295 300 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu
Ser Asn 305 310 315 320Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro
Pro Val Leu Asp Ser 325 330 335 Asp Gly Ser Phe Phe Leu Tyr Ser Lys
Leu Thr Val Asp Lys Ser Arg 340 345 350 Trp Gln Gln Gly Asn Val Phe
Ser Cys Ser Val Met His Glu Ala Leu 355 360 365 His Asn His Tyr Thr
Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 370 375 380
51152DNAArtificial SequenceDescription of Artificial
SequenceL104EIg 5atgggtgtac tgctcacaca gaggacgctg ctcagtctgg
tccttgcact cctgtttcca 60agcatggcga gcatggcaat gcacgtggcc cagcctgctg
tggtactggc cagcagccga 120ggcatcgcta gctttgtgtg tgagtatgca
tctccaggca aagccactga ggtccgggtg 180acagtgcttc ggcaggctga
cagccaggtg actgaagtct gtgcggcaac ctacatgatg 240gggaatgagt
tgaccttcct agatgattcc atctgcacgg gcacctccag tggaaatcaa
300gtgaacctca ctatccaagg actgagggcc atggacacgg gactctacat
ctgcaaggtg 360gagctcatgt acccaccgcc atactacgag ggcataggca
acggaaccca gatttatgta 420attgatccag aaccgtgccc agattctgat
caggagccca aatcttctga caaaactcac 480acatccccac cgtccccagc
acctgaactc ctggggggat cgtcagtctt cctcttcccc 540ccaaaaccca
aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg
600gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg
cgtggaggtg 660cataatgcca agacaaagcc gcgggaggag cagtacaaca
gcacgtaccg tgtggtcagc 720gtcctcaccg tcctgcacca ggactggctg
aatggcaagg agtacaagtg caaggtctcc 780aacaaagccc tcccagcccc
catcgagaaa accatctcca aagccaaagg gcagccccga 840gaaccacagg
tgtacaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc
900ctgacctgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg
ggagagcaat 960gggcagccgg agaacaacta caagaccacg cctcccgtgc
tggactccga cggctccttc 1020ttcctctaca gcaagctcac cgtggacaag
agcaggtggc agcaggggaa cgtcttctca 1080tgctccgtga tgcatgaggc
tctgcacaac cactacacgc agaagagcct ctccctgtct 1140ccgggtaaat ga
11526383PRTArtificial SequenceDescription of Artificial
SequenceL104EIg 6Met Gly Val Leu Leu Thr Gln Arg Thr Leu Leu Ser
Leu Val Leu Ala 1 5 10 15 Leu Leu Phe Pro Ser Met Ala Ser Met Ala
Met His Val Ala Gln Pro 20 25 30 Ala Val Val Leu Ala Ser Ser Arg
Gly Ile Ala Ser Phe Val Cys Glu 35 40 45 Tyr Ala Ser Pro Gly Lys
Ala Thr Glu Val Arg Val Thr Val Leu Arg 50 55 60 Gln Ala Asp Ser
Gln Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met 65 70 75 80Gly Asn
Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser 85 90 95
Ser Gly Asn Gln Val Asn Leu Thr Ile Gln Gly Leu Arg Ala Met Asp 100
105 110 Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr Pro Pro Pro
Tyr 115 120 125 Tyr Glu Gly Ile Gly Asn Gly Thr Gln Ile Tyr Val Ile
Asp Pro Glu 130 135 140 Pro Cys Pro Asp Ser Asp Gln Glu Pro Lys Ser
Ser Asp Lys Thr His 145 150 155 160Thr Ser Pro Pro Ser Pro Ala Pro
Glu Leu Leu Gly Gly Ser Ser Val 165 170 175 Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 180 185 190 Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu 195 200 205 Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys 210 215 220
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser 225
230 235 240Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu
Tyr Lys 245 250 255 Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu Lys Thr Ile 260 265 270 Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr Thr Leu Pro 275 280 285 Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu Thr Cys Leu 290 295 300 Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 305 310 315 320Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 325 330 335 Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 340 345
350 Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu
355 360 365 His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly
Lys 370 375 380 71152DNAArtificial SequenceDescription of
Artificial SequenceCTLA4Ig 7atgggtgtac tgctcacaca gaggacgctg
ctcagtctgg tccttgcact cctgtttcca 60agcatggcga gcatggcaat gcacgtggcc
cagcctgctg tggtactggc cagcagccga 120ggcatcgcta gctttgtgtg
tgagtatgca tctccaggca aagccactga ggtccgggtg 180acagtgcttc
ggcaggctga cagccaggtg actgaagtct gtgcggcaac ctacatgatg
240gggaatgagt tgaccttcct agatgattcc atctgcacgg gcacctccag
tggaaatcaa 300gtgaacctca ctatccaagg actgagggcc atggacacgg
gactctacat ctgcaaggtg 360gagctcatgt acccaccgcc atactacctg
ggcataggca acggaaccca gatttatgta 420attgatccag aaccgtgccc
agattctgat caggagccca aatcttctga caaaactcac 480acatccccac
cgtccccagc acctgaactc ctgggtggat cgtcagtctt cctcttcccc
540ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg
cgtggtggtg 600gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt
acgtggacgg cgtggaggtg 660cataatgcca agacaaagcc gcgggaggag
cagtacaaca gcacgtaccg ggtggtcagc 720gtcctcaccg tcctgcacca
ggactggctg aatggcaagg agtacaagtg caaggtctcc 780aacaaagccc
tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga
840gaaccacagg tgtacaccct gcccccatcc cgggatgagc tgaccaagaa
ccaggtcagc 900ctgacctgcc tggtcaaagg cttctatccc agcgacatcg
ccgtggagtg ggagagcaat 960gggcagccgg agaacaacta caagaccacg
cctcccgtgc tggactccga cggctccttc 1020ttcctctaca gcaagctcac
cgtggacaag agcaggtggc agcaggggaa cgtcttctca 1080tgctccgtga
tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct
1140ccgggtaaat ga 11528383PRTArtificial SequenceDescription of
Artificial SequenceCTLA4Ig 8Met Gly Val Leu Leu Thr Gln Arg Thr Leu
Leu Ser Leu Val Leu Ala 1 5 10 15 Leu Leu Phe Pro Ser Met Ala Ser
Met Ala Met His Val Ala Gln Pro 20 25 30 Ala Val Val Leu Ala Ser
Ser Arg Gly Ile Ala Ser Phe Val Cys Glu 35 40 45 Tyr Ala Ser Pro
Gly Lys Ala Thr Glu Val Arg Val Thr Val Leu Arg 50 55 60 Gln Ala
Asp Ser Gln Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met 65 70 75
80Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser
85 90 95 Ser Gly Asn Gln Val Asn Leu Thr Ile Gln Gly Leu Arg Ala
Met Asp 100 105 110 Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr
Pro Pro Pro Tyr 115 120 125 Tyr Leu Gly Ile Gly Asn Gly Thr Gln Ile
Tyr Val Ile Asp Pro Glu 130 135 140 Pro Cys Pro Asp Ser Asp Gln Glu
Pro Lys Ser Ser Asp Lys Thr His 145 150 155 160Thr Ser Pro Pro Ser
Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val 165 170 175 Phe Leu Phe
Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 180 185 190 Pro
Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu 195 200
205 Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys
210 215 220 Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val
Val Ser 225 230 235 240Val Leu Thr Val Leu His Gln Asp Trp Leu Asn
Gly Lys Glu Tyr Lys 245 250 255 Cys Lys Val Ser Asn Lys Ala Leu Pro
Ala Pro Ile Glu Lys Thr Ile 260 265 270 Ser Lys Ala Lys Gly Gln Pro
Arg Glu Pro Gln Val Tyr Thr Leu Pro 275 280 285 Pro Ser Arg Asp Glu
Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 290 295 300 Val Lys Gly
Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 305 310 315
320Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
325 330 335 Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser Arg 340 345 350 Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met
His Glu Ala Leu 355 360 365 His Asn His Tyr Thr Gln Lys Ser Leu Ser
Leu Ser Pro Gly Lys 370 375 380 96PRTHomo sapiens 9Met Tyr Pro Pro
Pro Tyr 1 5
* * * * *