U.S. patent application number 15/703992 was filed with the patent office on 2018-05-03 for engineered nucleic acids-targeting nucleic acids.
The applicant listed for this patent is Caribou Biosciences, Inc.. Invention is credited to Paul Daniel Donohoue, Andrew Paul May.
Application Number | 20180119173 15/703992 |
Document ID | / |
Family ID | 57750577 |
Filed Date | 2018-05-03 |
United States Patent
Application |
20180119173 |
Kind Code |
A1 |
Donohoue; Paul Daniel ; et
al. |
May 3, 2018 |
ENGINEERED NUCLEIC ACIDS-TARGETING NUCLEIC ACIDS
Abstract
The present disclosure provides engineered polynucleotide
sequences that form scaffolds and nucleoprotein complexes
comprising such engineered polynucleotide sequences that form
scaffolds and nucleic acid binding proteins. Nucleic acid sequences
encoding the engineered polynucleotide sequences that form
scaffolds, as well as expression cassettes, vectors and cells
comprising such polynucleotide sequences, are described. A variety
of methods for making and using the engineered polynucleotide
sequences that form scaffolds are also disclosed.
Inventors: |
Donohoue; Paul Daniel;
(Berkeley, CA) ; May; Andrew Paul; (San Francisco,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Caribou Biosciences, Inc. |
Berkeley |
CA |
US |
|
|
Family ID: |
57750577 |
Appl. No.: |
15/703992 |
Filed: |
September 14, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15368570 |
Dec 2, 2016 |
9771600 |
|
|
15703992 |
|
|
|
|
62263232 |
Dec 4, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/10 20130101;
C12N 2310/51 20130101; C12N 15/902 20130101; C12N 2310/52 20130101;
C12N 2310/20 20170501; C12N 15/113 20130101; C12N 9/22
20130101 |
International
Class: |
C12N 15/90 20060101
C12N015/90; C12N 15/113 20060101 C12N015/113; C12N 9/22 20060101
C12N009/22 |
Claims
1-20. (canceled)
21. A complex of three engineered nucleic acids forming a scaffold,
comprising: a first engineered nucleic acid, having a 5' end and a
3' end, comprising, a first Class 2 Type II CRISPR element 1,
comprising, a first Class 2 Type II CRISPR protein binding
sequence, and a repeat nucleic acid sequence 1 located 5' of the
first Class 2 Type II CRISPR protein binding sequence, the repeat
nucleic acid sequence 1 comprising, in a 3' to 5' direction, a
linker element nucleic acid sequence 1-1, a repeat nucleic acid
sequence 1a, a linker element nucleic acid sequence 1-2, a repeat
nucleic acid sequence 1b, and, a linker element nucleic acid
sequence 1-3, and, a second Class 2 Type II CRISPR element 1,
comprising a nucleic acid sequence 1 located 5' of the repeat
nucleic acid sequence 1, wherein the nucleic acid sequence 1
comprises a spacer nucleic acid sequence 1; a second engineered
nucleic acid, having a 5' end and a 3' end, comprising, a first
Class 2 Type II CRISPR element 2, comprising a second Class 2 Type
II CRISPR protein binding sequence, and a repeat nucleic acid
sequence 2, located 5' of the second Class 2 Type II CRISPR protein
binding sequence, the repeat nucleic acid sequence 2 comprising, in
a 5' to 3' direction, a linker element nucleic acid sequence 2-3, a
repeat nucleic acid sequence 1bC, a linker element nucleic acid
sequence 2-4, a repeat nucleic acid sequence 2a, and a linker
element nucleic acid sequence 2-5, and, a second Class 2 Type 2
CRISPR element 2, comprising a nucleic acid sequence 2 located 5'
of the repeat nucleic acid sequence 2, wherein the nucleic acid
sequence 2 comprises a spacer nucleic acid sequence 2; and a third
engineered nucleic acid, having a 5' end and a 3' end, comprising,
a first Class 2 Type II CRISPR element 3, comprising, a third Class
2 Type II CRISPR protein binding sequence, and a repeat nucleic
acid sequence 3 located 5' of the third nucleic acid binding Class
2 Type II CRISPR protein binding sequence, the repeat nucleic acid
sequence 3 comprising, in a 3' to 5' direction, a linker element
nucleic acid sequence 3-1, a repeat nucleic acid sequence 2aC, a
linker element nucleic acid sequence 3-2, a repeat nucleic acid
sequence 1aC, and a linker element nucleic acid sequence 3-3, and,
a second Class 2 Type II CRISPR element 3, comprising a nucleic
acid sequence 3 located 5' of the repeat nucleic acid sequence 3,
wherein the nucleic acid sequence 3 comprises a spacer nucleic acid
sequence 3; wherein the repeat nucleic acid sequence la is
connected by base-pair hydrogen bonding to the repeat nucleic acid
sequence 1aC, the repeat nucleic acid sequence 1b is connected by
base-pair hydrogen bonding to the repeat nucleic acid sequence 1bC,
and the repeat nucleic acid sequence 2a is connected by base-pair
hydrogen bonding to the repeat nucleic acid sequence 2aC.
22. The complex of claim 21, wherein a region of hydrogen-bond
interactions between the repeat nucleic acid sequence la and the
repeat nucleic acid sequence 1aC comprises a first double-stranded
nucleic acid binding protein binding site, a region of
hydrogen-bond interactions between the repeat nucleic acid sequence
1b and the repeat nucleic acid sequence 1bC comprises a second
double-stranded nucleic acid binding protein binding site, a region
of hydrogen-bond interactions between the repeat nucleic acid
sequence 2a and the repeat nucleic acid sequence 2aC comprises a
third double-stranded nucleic acid binding protein binding site, or
a combination thereof.
23. The complex of claim 22, wherein the first double-stranded
nucleic acid binding protein site, the second double-stranded
nucleic acid binding protein site, the third double-stranded
nucleic acid binding protein site, or a combination thereof
comprises a Csy4 protein binding protein site.
24. The complex of claim 21, wherein the repeat nucleic acid
sequence la further comprises, in a 3' to 5' direction, a repeat
nucleic acid sequence 1a1, a bulge nucleic acid sequence 1a1, and a
repeat nucleic acid sequence 1a2; the repeat nucleic acid sequence
1aC further comprises, in a 3' to 5' direction, a repeat nucleic
acid sequence 1a2C, a bulge nucleic acid sequence 1a2, and a repeat
nucleic acid sequence 1a1C; the repeat nucleic acid sequence 1b
further comprises, in a 3' to 5' direction, a repeat nucleic acid
sequence 1b1, a bulge nucleic acid sequence 1b1, and a repeat
nucleic acid sequence 1b2; the repeat nucleic acid sequence 1bC
further comprises, in a 3' to 5' direction, a repeat nucleic acid
sequence 1b2C, a bulge nucleic acid sequence 1b2, and a repeat
nucleic acid sequence 1b1C; the repeat nucleic acid sequence 2a
further comprises, in a 3' to 5' direction, a repeat nucleic acid
sequence 2a1, a bulge nucleic acid sequence 2a1, and a repeat
nucleic acid sequence 2a2; and the repeat nucleic acid sequence 2aC
further comprises, in a 3' to 5' direction, a repeat nucleic acid
sequence 2a2C, a bulge nucleic acid sequence 2a2, and a repeat
nucleic acid sequence 2a1C; wherein the repeat nucleic acid
sequence 1a1 is connected by base-pair hydrogen bonding to the
repeat nucleic acid sequence 1a1C, the repeat nucleic acid sequence
1a2 is connected by base-pair hydrogen bonding to the repeat
nucleic acid sequence 1a2C, the repeat nucleic acid sequence 1b 1
is connected by base-pair hydrogen bonding to the repeat nucleic
acid sequence 1b1C, the repeat nucleic acid sequence 1b2 is
connected by base-pair hydrogen bonding to the repeat nucleic acid
sequence 1b2C, the repeat nucleic acid sequence 2a1 is connected by
base-pair hydrogen bonding to the repeat nucleic acid sequence
2a1C, and the repeat nucleic acid sequence 2a2 is connected by
base-pair hydrogen bonding to the repeat nucleic acid sequence
2a2C.
25. The complex of claim 24, wherein a region of hydrogen-bond
interactions between the repeat nucleic acid sequence 1a2 and the
repeat nucleic acid sequence 1a2C comprises a first double-stranded
nucleic acid binding protein binding site, a region of
hydrogen-bond interactions between the repeat nucleic acid sequence
1b 1 and the repeat nucleic acid sequence 1b1C comprises a second
double-stranded nucleic acid binding protein binding site, a region
of hydrogen-bond interactions between the repeat nucleic acid
sequence 2a1 and the repeat nucleic acid sequence 2a1C comprises a
third double-stranded nucleic acid binding protein binding site, or
a combination thereof.
26. The complex of claim 21, wherein the first engineered nucleic
acid comprises RNA, DNA, or a combination thereof; the second
engineered nucleic acid comprises RNA, DNA, or a combination
thereof; and the third engineered nucleic acid comprises RNA, DNA,
or a combination thereof.
27. The complex of claim 21, wherein a first Class 2 Type II
CRISPR-Cas9 protein is capable of binding the first Class 2 Type II
CRISPR protein binding sequence and a region of hydrogen-bond
interactions between the repeat nucleic acid sequence 1a and the
repeat nucleic acid sequence 1aC, a second Class 2 Type II
CRISPR-Cas9 protein is capable of binding the second Class 2 Type
II CRISPR protein binding sequence and a region of hydrogen-bond
interactions between the repeat nucleic acid sequence 1b 1 and the
repeat nucleic acid sequence 1b1C, and a third Class 2 Type II
CRISPR-Cas9 protein is capable of binding the third Class 2 Type II
CRISPR protein binding sequence a region of hydrogen-bond
interactions between the repeat nucleic acid sequence 2a and the
repeat nucleic acid sequence 2aC.
28. The complex of claim 27, wherein the first Class 2 Type II
CRISPR-Cas9 protein, the second Class 2 Type II CRISPR-Cas9
protein, and the third Class 2 Type II CRISPR-Cas9 protein, or a
combination thereof, comprises a Campylobacter jejuni Cas9
protein.
29. The complex of claim 25, wherein a first Class 2 Type II
CRISPR-Cas9 protein is capable of binding (i) the first Class 2
Type II CRISPR protein binding sequence, (ii) a region of
hydrogen-bond interactions between the repeat nucleic acid sequence
1a1 and the repeat nucleic acid sequence 1a1C, (iii) a bulge region
formed by the bulge nucleic acid sequence 1a1 and the bulge nucleic
acid sequence 1a2, and (iv) a region of hydrogen-bond interactions
between the repeat nucleic acid sequence 1a2 and the repeat nucleic
acid sequence 1a2C, a second Class 2 Type II CRISPR-Cas9 protein is
capable of binding (i) the second Class 2 Type II CRISPR protein
binding sequence, (ii) a region of hydrogen-bond interactions
between the repeat nucleic acid sequence 1b2 and the repeat nucleic
acid sequence 1b2C, (iii) a bulge region formed by the bulge
nucleic acid sequence 1b1 and the bulge nucleic acid sequence 1b2,
and (iv) a region of hydrogen-bond interactions between the repeat
nucleic acid sequence 1b1 and the repeat nucleic acid sequence
1b1C, and a third Class 2 Type II CRISPR-Cas9 protein is capable of
binding (i) the third Class 2 Type II CRISPR protein binding
sequence, (ii) a region of hydrogen-bond interactions between the
repeat nucleic acid sequence 2a2 and the repeat nucleic acid
sequence 2a2C, (iii) a bulge region formed by the bulge nucleic
acid sequence 2a1 and the bulge nucleic acid sequence 2a2, and (iv)
a region of hydrogen-bond interactions between the repeat nucleic
acid sequence 2a1 and the repeat nucleic acid sequence 2a1C.
30. The complex of claim 29, wherein the first Class 2 Type II
CRISPR-Cas9 protein, the second Class 2 Type II CRISPR-Cas9
protein, and the third Class 2 Type II CRISPR-Cas9 protein are each
selected from the group consisting of a Streptococcus pyogenes Cas9
protein, a Streptococcus thermophilus Cas9 protein, and a
Staphylococcus aureus Cas9 protein.
31. The complex of claim 21, wherein the spacer nucleic acid
sequence 1 is complementary to a target nucleic acid sequence 1,
the spacer nucleic acid sequence 2 is complementary to a target
nucleic acid sequence 2, and the spacer nucleic acid sequence 3 is
complementary to a target nucleic acid sequence 3.
32. The complex of claim 31, wherein the target nucleic acid
sequence 1, the target nucleic acid sequence 2, and the target
nucleic acid sequence 3 each comprises double-stranded DNA.
33. A nucleic acid/protein composition, comprising: the complex of
claim 21; and a first Class 2 Type II CRISPR-Cas9 protein, a second
Class 2 Type II CRISPR-Cas9 protein, and a third Type II
CRISPR-Cas9 protein.
34. The nucleic acid/protein composition of claim 33, wherein the
first Class 2 Type II CRISPR-Cas9 protein, the second Class 2 Type
II CRISPR-Cas9 protein, and the third Class 2 Type II CRISPR-Cas9
protein are each selected from the group consisting of a
Streptococcus pyogenes Cas9 protein, a Streptococcus thermophilus
Cas9 protein, a Staphylococcus aureus Cas9 protein, and a
Campylobacter jejuni Cas9 protein.
35. The nucleic acid/protein composition of claim 33, wherein at
least two of the first Class 2 Type II CRISPR-Cas9 protein, the
second Class 2 Type II CRISPR-Cas9 protein, and the third Class 2
Type II CRISPR-Cas9 protein are different Class 2 Type II
CRISPR-Cas9 proteins, and each Class 2 Type II CRISPR-Cas9 protein
is selected from the group consisting of a Streptococcus pyogenes
Cas9 protein, a Streptococcus thermophilus Cas9 protein, a
Staphylococcus aureus Cas9 protein, and a Campylobacter jejuni Cas9
protein.
36. The nucleic acid/protein composition of claim 33, wherein at
least one of the first Class 2 Type II CRISPR-Cas9 protein, the
second Class 2 Type II CRISPR-Cas9 protein, or the third Class 2
Type II CRISPR-Cas9 protein comprises a catalytically inactive Cas9
protein.
37. The nucleic acid/protein composition of claim 36, further
comprising a donor polynucleotide.
38. The nucleic acid/protein composition of claim 33, wherein the
complex comprises RNA, DNA, or RNA and DNA.
39. A kit, comprising: the complex of claim 21; and a buffer.
40. The kit of claim 39, further comprising one or more Class 2
Type II CRISPR-Cas9 proteins or one or more nucleic acid sequences
encoding one or more Class 2 Type II CRISPR-Cas9 proteins.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Patent Application Ser. No. 62/263,232, filed 4 Dec. 2015, now
pending, which application is herein incorporated by reference in
its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Not applicable.
SEQUENCE LISTING
[0003] The present application contains a Sequence Listing that has
been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. The ASCII copy, created
on 2 Dec. 2016 is named CBI020-10_ST25.txt and is 156 KB in
size.
TECHNICAL FIELD
[0004] The present disclosure relates generally to engineered
polynucleotide sequences that form scaffolds and nucleoprotein
complexes comprising such scaffolds and nucleic acid binding
proteins. Nucleic acid sequences encoding the scaffold
polynucleotide components, as well as expression cassettes,
vectors, and cells comprising the polynucleotide components are
described. The disclosure also relates to methods for making and
using the engineered nucleic acid sequences that form scaffolds and
the nucleoprotein complexes of the present invention.
BACKGROUND
[0005] Clustered regularly interspaced short palindromic repeats
(CRISPR) and CRISPR-associated proteins (Cas) constitute the
CRISPR-Cas system. The CRISPR-Cas system provides adaptive immunity
against foreign DNA in bacteria (see, e.g., Barrangou, R., et al.,
Science 315:1709-1712 (2007); Makarova, K. S., et al., Nature
Reviews Microbiology 9:467-477 (2011); Garneau, J. E., et al.,
Nature 468:67-71 (2010); Sapranauskas, R., et al., Nucleic Acids
Research 39:9275-9282 (2011)).
[0006] CRISPR-Cas systems have recently been reclassified into two
classes, comprising five types and sixteen subtypes (see Makarova,
K., et al., Nature Reviews Microbiology 13:1-15 (2015)). This
classification is based upon identifying all Cas genes in a
CRISPR-Cas locus and determining the signature genes in each
CRISPR-Cas locus, ultimately placing the CRISPR-Cas systems in
either Class 1 or Class 2 based upon the genes encoding the
effector module, i.e., the proteins involved in the interference
stage. Recently a sixth CRISPR-Cas system (Type VI) has been
identified (see Abudayyeh 0., et al., Science 353(6299):aaf5573
(2016)). Certain bacteria possess more than one type of CRISPR-Cas
system.
[0007] Class 1 systems have a multi-subunit crRNA-effector complex,
whereas Class 2 systems have a single protein, such as Cas9, Cpf1,
C2c1, C2c2, C2c3, or a crRNA-effector complex. Class 1 systems
comprise Type I, Type III, and Type IV systems. Class 2 systems
comprise Type II, Type V, and Type VI systems.
[0008] Type II systems have cas1, cas2, and cas9 genes. The cas9
gene encodes a multi-domain protein that combines the functions of
the crRNA-effector complex with DNA target sequence cleavage. Type
II systems are further divided into three subtypes, subtypes II-A,
II-B, and II-C. Subtype II-A contains an additional gene, csn2.
Examples of organisms with a subtype II-A systems include, but are
not limited to, Streptococcus pyogenes, Streptococcus thermophilus,
and Staphylococcus aureus. Subtype II-B lacks the csn2 protein, but
has the cas4 protein. An example of an organism with a subtype II-B
system is Legionella pneumophila. Subtype II-C is the most common
Type II system found in bacteria and has only three proteins, Cas1,
Cas2, and Cas9. An example of an organism with a subtype II-C
system is Neisseria lactamica.
[0009] Type V systems have a cpf1 gene and cas1 and cas2 genes (see
Zetsche, B., et al., Cell 163:1-13 (2015)). The cpf1 gene encodes a
protein, Cpf1, that has a RuvC-like nuclease domain that is
homologous to the respective domain of Cas9, but lacks the HNH
nuclease domain that is present in Cas9 proteins. Type V systems
have been identified in several bacteria including, but not limited
to, Parcubacteria bacterium, Lachnospiraceae bacterium,
Butyrivibrio proteoclasticus, Peregrinibacteria bacterium,
Acidaminococcus spp., Porphyromonas macacae, Porphyromonas
crevioricanis, Prevotella disiens, Moraxella bovoculi, Smithella
spp., Leptospira inadai, Franciscella tularensis, Franciscella
novicida, Candidatus methanoplasma termitum, and Eubacterium
eligens. Recently it has been demonstrated that Cpf1 also has RNase
activity and is responsible for pre-crRNA processing (see Fonfara,
I., et al., Nature 532(7600):517-521 (2016)).
[0010] In Class 2 systems, the crRNA is associated with a single
protein and achieves interference by combining nuclease activity
with RNA-binding domains and base-pair formation between the crRNA
and a nucleic acid target sequence.
[0011] In Type II systems, nucleic acid target sequence binding
involves Cas9 and the crRNA, as does nucleic acid target sequence
cleavage. In Type II systems, the RuvC-like nuclease (RNase H fold)
domain and the HNH (McrA-like) nuclease domain of Cas9 each cleave
one of the strands of the double-stranded nucleic acid target
sequence. The Cas9 cleavage activity of Type II systems also
requires hybridization of crRNA to a tracrRNA to form a duplex that
facilitates the crRNA and nucleic acid target sequence binding by
the Cas9 protein.
[0012] In Type V systems, nucleic acid target sequence binding
involves Cpf1 and the crRNA, as does nucleic acid target sequence
cleavage. In Type V systems, the RuvC-like nuclease domain of Cpf1
cleaves one strand of the double-stranded nucleic acid target
sequence, and a putative nuclease domain cleaves the other strand
of the double-stranded nucleic acid target sequence in a staggered
configuration, producing 5' overhangs, which is in contrast to the
blunt ends generated by Cas9 cleavage.
[0013] The Cpf1 cleavage activity of Type V systems does not
require hybridization of crRNA to tracrRNA to form a duplex, rather
the crRNA of Type V systems uses a single crRNA that has a
stem-loop structure forming an internal duplex. Cpf1 binds the
crRNA in a sequence and structure specific manner that recognizes
the stem loop and sequences adjacent to the stem loop, most notably
the nucleotides 5' of the spacer sequences that hybridizes to the
nucleic acid target sequence. This stem-loop structure is typically
in the range of 15 to 19 nucleotides in length. Substitutions that
disrupt this stem-loop duplex abolish cleavage activity, whereas
other substitutions that do not disrupt the stem-loop duplex do not
abolish cleavage activity. Nucleotides 5' of the stem loop adopt a
pseudo-knot structure further stabilizing the stem-loop structure
with non-canonical Watson-Crick base pairing, triplex interaction,
and reverse Hoogsteen base pairing (see Yamano, T., et al., Cell
165(4):949-962 (2016)). In Type V systems, the crRNA forms a
stem-loop structure at the 5' end, and the sequence at the 3' end
is complementary to a sequence in a nucleic acid target
sequence.
[0014] Other proteins associated with Type V crRNA and nucleic acid
target sequence binding and cleavage include Class 2 candidate 1
(C2c1) and Class 2 candidate 3 (C2c3). C2c1 and C2c3 proteins are
similar in length to Cas9 and Cpf1 proteins, ranging from
approximately 1,100 amino acids to approximately 1,500 amino acids.
C2c1 and C2c3 proteins also contain RuvC-like nuclease domains and
have an architecture similar to Cpf1. C2c1 proteins are similar to
Cas9 proteins in requiring a crRNA and a tracrRNA for nucleic acid
target sequence binding and cleavage but have an optimal cleavage
temperature of 50.degree. C. C2c1 proteins target an AT-rich
protospacer adjacent motif (PAM), similar to the PAM of Cpf1, which
is 5' of the nucleic acid target sequence (see, e.g., Shmakov, S.,
et al., Molecular Cell 60(3):385-397 (2015)).
[0015] Class 2 candidate 2 (C2c2) does not share sequence
similarity with other CRISPR effector proteins and was recently
identified as a Type VI system (see Abudayyeh, O., et al., Science
353(6299):aaf5573 (2016)). C2c2 proteins have two HEPN domains and
demonstrate single-stranded RNA cleavage activity. C2c2 proteins
are similar to Cpf1 proteins in requiring a crRNA for nucleic acid
target sequence binding and cleavage, although not requiring
tracrRNA. Also, similar to Cpf1, the crRNA for C2c2 proteins forms
a stable hairpin, or stem-loop structure, that aids in association
with the C2c2 protein. Type VI systems have a single polypeptide
RNA endonuclease that utilizes a single crRNA to direct
site-specific cleavage. Additionally, after hybridizing to the
target RNA complementary to the spacer, C2c2 becomes a promiscuous
RNA endonuclease exhibiting non-specific endonuclease activity
toward any single-stranded RNA in a sequence independent manner
(see East-Seletsky, A., et al., Nature 538(7624):270-273
(2016)).
[0016] Regarding Class 2 Type II CRISPR-Cas systems, a large number
of Cas9 orthologs are known in the art as well as their associated
polynucleotide components (tracrRNA and crRNA) (see, e.g., Fonfara,
I., et al., Nucleic Acids Research 42(4):2577-2590 (2014),
including all Supplemental Data; Chylinski K., et al., Nucleic
Acids Research 42(10):6091-6105 (2014), including all Supplemental
Data). In addition, Cas9-like synthetic proteins are known in the
art (see U.S. Published Patent Application No. 2014-0315985,
published 23 Oct. 2014).
[0017] Cas9 is an exemplary Type II CRISPR Cas protein. Cas9 is an
endonuclease that can be programmed by the tracrRNA/crRNA to
cleave, in a site-specific manner, a DNA target sequence using two
distinct endonuclease domains (HNH and RuvC/RNase H-like domains)
(see U.S. Published Patent Application No. 2014-0068797, published
6 Mar. 2014; see also Jinek, M., et al., Science 337:816-821
(2012)).
[0018] Typically, each wild-type CRISPR-Cas9 system includes a
crRNA and a tracrRNA. The crRNA has a region of complementarity to
a potential DNA target sequence and a second region that forms
base-pair hydrogen bonds with the tracrRNA to form a secondary
structure, typically to form at least one stem structure. The
region of complementarity to the DNA target sequence is the spacer.
The tracrRNA and a crRNA interact through a number of base-pair
hydrogen bonds to form secondary RNA structures. Complex formation
between tracrRNA/crRNA and Cas9 protein results in conformational
change of the Cas9 protein that facilitates binding to DNA,
endonuclease activities of the Cas9 protein, and crRNA-guided
site-specific DNA cleavage by the endonuclease Cas9. For a Cas9
protein/tracrRNA/crRNA complex to cleave a double-stranded DNA
target sequence, the DNA target sequence is adjacent to a cognate
PAM. By engineering a crRNA to have an appropriate spacer sequence,
the complex can be targeted to cleave at a locus of interest, e.g.,
a locus at which sequence modification is desired.
[0019] A variety of Type II CRISPR-Cas system crRNA and tracrRNA
sequences, as well as predicted secondary structures are known in
the art (see, e.g., Ran, F.A., et al., Nature 520(7546):186-191
(2015), including all Supplemental Data, in particular Extended
Data FIG. 1; Fonfara, I., et al., Nucleic Acids Research
42(4):2577-2590 (2014), including all Supplemental Data, in
particular Supplemental Figure S11). Predicted tracrRNA secondary
structures were based on the Constraint Generation RNA folding
model (Zuker, M., Nucleic Acids Research 31:3406-3415 (2003). RNA
duplex secondary structures were predicted using RNAcofold of the
Vienna RNA package (Bernhart, S. H., et al., Algorithms for
Molecular Biology 1(1):3 (2006); Hofacker, I. L., et al., Journal
of Molecular Biology 319:1059-1066 (2002)) and RNAhybrid
(bibiserv.techfak.uni-bielefeld.de/rnahybrid/). The structure
predictions were visualized using VARNA (Darty, K., et al.,
Bioinformatics 25:1974-1975 (2009)). Fonfara, I., et al., show that
the crRNA/tracrRNA complex for Campylobacter jejuni does not have
the bulge region; however, the complex retains a stem structure
located 3' of the spacer that is followed in the 3' direction with
another stem structure.
[0020] The spacer of Class 2 CRISPR-Cas systems can hybridize to a
nucleic acid target sequence that is located 5' or 3' of a PAM,
depending upon the Cas protein to be used. A PAM can vary depending
upon the Cas polypeptide to be used. For example, if Cas9 from S.
pyogenes is used, the PAM can be a sequence in the nucleic acid
target sequence that comprises the sequence 5'-NRR-3', wherein R
can be either A or G, N is any nucleotide, and N is immediately 3'
of the nucleic acid target sequence targeted by the nucleic acid
target binding sequence. A Cas protein may be modified such that a
PAM may be different compared with a PAM for an unmodified Cas
protein. If, for example, Cas9 from S. pyogenes is used, the Cas9
protein may be modified such that the PAM no longer comprises the
sequence 5'-NRR-3', but instead comprises the sequence 5'-NNR-3',
wherein R can be either A or G, N is any nucleotide, and N is
immediately 3' of the nucleic acid target sequence targeted by the
nucleic acid target sequence.
[0021] Other Cas proteins recognize other PAMs, and one of skill in
the art is able to determine the PAM for any particular Cas
protein. For example, Cpf1 has a thymine-rich PAM site that
targets, for example, a TTTN sequence (see Fagerlund, R., et al.,
Genome Biology 16:251 (2015)).
[0022] The RNA-guided Cas9 endonuclease has been widely used for
programmable genome editing in a variety of organisms and model
systems (see, e.g., Jinek M., et al., Science 337:816-821 (2012);
Jinek M., et al., eLife 2:e00471. doi: 10.7554/eLife.00471 (2013);
U.S. Published Patent Application No. 2014-0068797, published 6
Mar. 2014).
[0023] Genome engineering includes altering the genome by deleting,
inserting, mutating, or substituting specific nucleic acid
sequences. The alteration can be gene- or location-specific. Genome
engineering can use site-directed nucleases, such as Cas proteins
and their cognate polynucleotides, to cut DNA, thereby generating a
site for alteration. In certain cases, the cleavage can introduce a
double-strand break (DSB) in the DNA target sequence. DSBs can be
repaired, e.g., by non-homologous end joining (NHEJ),
microhomology-mediated end joining (MMEJ), or homology-directed
repair (HDR). HDR relies on the presence of a template for repair.
In some examples of genome engineering, a donor polynucleotide or
portion thereof can be inserted into the break.
SUMMARY OF THE INVENTION
[0024] The present invention relates generally to a nucleic acid
polynucleotide composition comprising a polynucleotide complex
forming a scaffold that is capable of binding a nucleic acid
binding protein. Typically, a NASC polynucleotide composition is a
complex of two or more engineered nucleic acid sequences forming a
scaffold comprising: a repeat element 1, a repeat element 2 a
nucleic acid binding protein binding element 1, a nucleic acid
binding protein binding element 2, a spacer element 1 (e.g.,
comprising a nucleic acid target binding sequence, and a spacer
element 2 (e.g., comprising a nucleic acid target binding sequence
2). The NASC polynucleotide composition is capable of associating
with a nucleic acid binding protein.
[0025] In an aspect, the present invention relates to a composition
of two or more engineered nucleic acid sequences forming a scaffold
("NASC") comprising a first engineered nucleic acid "NASC-PC1" and
a second engineered nucleic acid component ("NASC-PC2"). The
NASC-P1 comprises, in a 5' to 3' direction, a spacer element 1
comprising a nucleic acid target binding sequence 1, a repeat
element 1 comprising a repeat nucleic acid sequence 1, and a
nucleic acid binding protein binding element 1, wherein the spacer
element 1 is covalently connected with the repeat element 1, and
the repeat element 1 is covalently connected with the nucleic acid
binding protein binding element 1 comprising a nucleic acid binding
protein binding sequence 1. The second engineered nucleic acid
component ("NASC-PC2") comprises, in a 5' to 3' direction, a spacer
element 2 comprising a nucleic acid target binding sequence 2, a
repeat element 2 comprising a repeat nucleic acid sequence 2, and a
nucleic acid binding protein binding element 2 comprising a nucleic
acid binding protein binding sequence 2, wherein the spacer element
2 is covalently connected with the repeat element 2, and the repeat
element 2 is covalently connected with the nucleic acid binding
protein binding element 2. In some embodiments of the present
invention, the nucleic acid binding protein binding sequence 1
comprises a double-stranded nucleic acid binding protein binding
sequence 1, and the nucleic acid binding protein binding sequence 2
comprises a double-stranded nucleic acid binding protein binding
sequence 2. The repeat nucleic acid sequence 1 and the repeat
nucleic acid sequence 2 are connected through hydrogen-bonded base
pairs and the connection forms the NASC composition. The NASC
composition is capable of binding a first nucleic acid binding
protein (e.g., a first double-stranded nucleic acid binding
protein) and a second nucleic acid binding protein (e.g., a second
double-stranded nucleic acid binding protein).
[0026] Embodiments of the NASC composition include, but are not
limited to, the first double-stranded nucleic acid binding protein
being a Class 2 CRISPR protein and the second double-stranded
nucleic acid binding protein being a Class 2 CRISPR protein. In
preferred embodiments, a first double-stranded nucleic acid binding
protein is a Class 2 Type II CRISPR-Cas9 protein, and a second
double-stranded nucleic acid binding protein is a Class 2 Type II
CRISPR-Cas9 protein. Other embodiments include wherein the first
double-stranded nucleic acid binding protein is a Class 2 Type V
CRISPR-Cpf1 protein, and wherein the second double-stranded nucleic
acid binding protein is a Class 2 Type V CRISPR-Cpf1 protein. In
further embodiments, a first double-stranded nucleic acid binding
protein is a Class 2 Type II CRISPR-Cas9 protein, and a second
double-stranded nucleic acid binding protein is a Class 2 Type V
CRISPR-Cpf1 protein.
[0027] In some embodiments, the spacer element 1 and spacer element
2 comprise additional nucleic acid sequences. For example, the
spacer element 1 can further comprise a linker element nucleic acid
sequence 3' of the nucleic acid target binding sequence 1 and 5' of
the repeat element 1. The spacer element 2 can further comprise a
linker element nucleic acid sequence 3' of the nucleic acid target
binding sequence 1 and 5' of the repeat element 1.
[0028] In further embodiments, the repeat element 1 and the repeat
element 2 comprise additional sequences as follows. The repeat
element 1 further comprises, in a 5' to 3' direction, a repeat
nucleic acid sequence 1b, a linker element nucleic acid sequence 1,
and a repeat nucleic acid sequence 1a. The repeat element 2 further
comprises, in a 5' to 3' direction, a repeat nucleic acid sequence
1aC, a linker element nucleic acid sequence 2, and a repeat nucleic
acid sequence 1bC. The repeat nucleic acid sequence 1b and the
repeat nucleic acid sequence 1bC are connected through
hydrogen-bonded base pairs, and the repeat nucleic acid sequence 1a
and the repeat nucleic acid sequence 1aC are connected through
hydrogen-bonded base pairs.
[0029] In additional embodiments, the repeat nucleic acid sequence
1b and the repeat sequence 1a comprise additional components as
follows. The repeat nucleic acid sequence 1b can further comprise,
in a 5' to 3' direction, a repeat nucleic acid sequence 1b2, a
bulge nucleic acid sequence 1b1, and a repeat nucleic acid sequence
1b1. The repeat nucleic acid sequence 1a can further comprise, in a
5' to 3' direction, a repeat nucleic acid sequence 1a2, a bulge
nucleic acid sequence 1a1, and a repeat nucleic acid sequence 1a1.
The repeat nucleic acid sequence 1aC can further comprise, in a 5'
to 3' direction, a repeat nucleic acid sequence 1a1C, a bulge
nucleic acid sequence 2a2, and a repeat nucleic acid sequence 1a2C.
The repeat nucleic acid sequence 1bC can further comprise, in a 5'
to 3' direction, a repeat nucleic acid sequence 1b1C, a bulge
nucleic acid sequence 2b2, and a repeat nucleic acid sequence 1b2C.
The repeat nucleic acid sequence 1a1 and the repeat nucleic acid
sequence 1a1C are connected through hydrogen-bonded base pairs, the
repeat nucleic acid sequence 1a2 and the repeat nucleic acid
sequence 1a2C are connected through hydrogen-bonded base pairs, the
repeat nucleic acid sequence 1b1 and the repeat nucleic acid
sequence 1b1C are connected through hydrogen-bonded base pairs, and
the repeat nucleic acid sequence 1b2 and the repeat nucleic acid
sequence 1b2C are connected through hydrogen-bonded base pairs.
[0030] In additional embodiments, the linker element nucleic acid
sequence 1-2 and the linker element nucleotide sequence 2-2
comprise added nucleic acid sequences. The linker element 1-1 can
comprise further comprise, in a 5' to 3' direction, a linker
element nucleic acid sequence 1-2-2, a repeat nucleic acid sequence
1-2a, and a linker element nucleic acid sequence 1-2-1. The linker
element nucleic acid sequence 2-2 can further comprise, in a 5' to
3' direction, a linker element nucleic acid sequence 2-2-1, a
repeat nucleic acid sequence 1-2aC, and a linker element nucleic
acid sequence 2-2-2. The repeat nucleic acid sequence 1-2a and the
repeat nucleic acid sequence 1-2aC are connected through
hydrogen-bonded base pairs and form a double-stranded nucleic acid
region 1-2. In some embodiments, the double-stranded nucleic acid
region 1-2 further comprises an effector protein binding site 1.
The repeat nucleic acid sequence 1-2a further comprises an effector
protein binding site nucleic acid sequence 1-2a. The repeat nucleic
acid sequence 2 further comprises an effector protein binding site
nucleic acid sequence 1-2aC. The effector binding site is formed by
hydrogen base pair bonding between the effector protein binding
site nucleic acid sequence 1-2a and the effector protein binding
site nucleic acid sequence 1-2aC. The Csy4 protein binding site is
an example of an effector protein binding site. A Csy4 protein or
an enzymatically inactive Csy4 protein are capable of binding the
effector binding site.
[0031] In further embodiments, the repeat nucleic acid sequence 1
further comprises an affinity tag 1 and the repeat nucleic acid
sequence 2 further comprises an affinity tag 2, and the affinity
tag 1 is connected with affinity tag 2.
[0032] The NASC compositions can comprise, for example, RNA, DNA,
or RNA and DNA. In some embodiments, NASC-PC1, NASC-PC2, or
NASC-PC1 and NASC-PC2 comprises RNA, DNA, or RNA and DNA.
[0033] In another aspect, the present invention includes a nucleic
acid/protein composition comprising a NASC composition and one or
more nucleic acid binding proteins. In one embodiment, the nucleic
acid proteins can be a first Cas9 protein and a second Cas9
protein. For example, the first Cas9 protein is the same as the
second Cas9 protein, and the first Cas9 protein and the second Cas9
protein are selected from the group consisting of a S. pyogenes
Cas9 protein, a S. thermophilus Cas9 protein, a S. aureus Cas9
protein, and a C. jejuni Cas9 protein. In other embodiments, the
first Cas9 protein is different from the second Cas9 protein, and
the first Cas9 protein and the second Cas9 protein are selected
from the group consisting of a S. pyogenes Cas9 protein, a S.
thermophilus Cas9 protein, a S. aureus Cas9 protein, and a C.
jejuni Cas9 protein. Additionally, the first Cas9 protein and the
second Cas9 protein can be selected from the group consisting of
Cas9 protein/Cas9 protein, Cas9 protein/dCas9 protein, dCas9
protein/Cas9 protein, and dCas9 protein/dCas9 protein,
respectively.
[0034] In a further aspect, the present invention relates to kits
comprising one or more components of a NASC composition. In some
embodiments, the NASC composition comprises a NASC-PC1 and a
NASC-PC2, or one or more nucleic acid sequences encoding the
NASC-PC1 and the NASC-PC2, and a buffer. Kits can further comprise
one or more Cas9 proteins or one or more nucleic acid sequences
encoding the one or more Cas9 proteins. In further embodiments, a
kit can comprise nucleoprotein complexes comprising a NASC
composition and one or more Cas9 proteins.
[0035] In an additional aspect, the present invention relates to an
expression vector comprising one or more nucleic acid sequences
encoding one or more components of a NASC composition.
[0036] In yet another aspect, the present invention relates to a
recombinant cell comprising one or more nucleic acid sequences
encoding one or more components of a NASC composition.
[0037] Further aspects of the present invention include methods of
using NASC composition, as described herein. One method is a method
of binding DNA. The method comprises contacting a first DNA target
sequence in a DNA polynucleotide and a second DNA target sequence
in the DNA polynucleotide with a nucleic acid/protein composition
comprising NASC composition and a nucleic acid binding protein
(e.g., a Cas9 protein, and/or a Cpf1 protein), thereby facilitating
binding of the nucleic acid/protein composition to the first DNA
target sequence in the DNA and the second DNA target sequence in
the DNA. A NASC-PC1 spacer element of the NASC composition can be
complementary to the first DNA target sequence, and the NASC-PC2
spacer of the NASC composition can be complementary to the second
DNA target sequence.
[0038] Another method of the present invention is a method of
cutting DNA. The method comprises contacting a first DNA target
sequence in the DNA polynucleotide and a second DNA target sequence
in the DNA polynucleotide with a nucleic acid/protein composition
comprising a NASC composition and a nucleic acid binding protein
(e.g., a Cas9 protein, and/or a Cpf1 protein), thereby facilitating
binding of the nucleic acid/protein composition to the first DNA
target sequence and the second DNA target sequence. Binding results
in cutting of the first DNA target sequence and the second DNA
target sequence. A NASC-PC1 spacer element of the NASC composition
can be complementary to the first DNA target sequence, and the
NASC-PC2 spacer of the NASC composition can be complementary to the
second DNA target sequence.
[0039] These aspects and other embodiments of the present invention
using the NASC compositions and nucleoprotein particles comprising
the NASC compositions of the present invention will be readily
apparent to those of ordinary skill in the art in view of the
disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
[0040] The figures are not proportionally rendered, nor are the
figures to scale. The locations of indicators are approximate.
[0041] FIG. 1A, FIG. 1B, FIG. 1C, and FIG. 1D present examples of
dual-guide Class 2 Type II CRISPR-associated guide RNAs.
[0042] FIG. 2A, FIG. 2B, and FIG. 2C present examples of
single-guide Class 2 Type II CRISPR-associated guide RNAs.
[0043] FIG. 3A and FIG. 3B present examples of a Class 2 Type V
crRNA guide RNAs.
[0044] FIG. 4A, FIG. 4B, FIG. 4C, FIG. 4D, FIG. 4E, FIG. 4F, FIG.
4G, FIG. 4H, FIG. 4I, FIG. 4J, FIG. 4K, FIG. 4L, FIG. 4M, FIG. 4N,
and FIG. 4O (this lattermost figure is FIG. 4 "O" and not FIG. 4
"zero") illustrate examples of generic arrangements of engineered
nucleic acid scaffold polynucleotide compositions of the present
invention. The illustrated sequences are not rendered in a 5' to 3'
or 3' to 5' orientation and do not have polarity.
[0045] FIG. 5A, FIG. 5B, FIG. 5C, FIG. 5D, FIG. 5E, FIG. 5F, FIG.
5G, FIG. 5H, and FIG. 5I illustrate examples and elements of
engineered nucleic acid scaffold polynucleotide compositions of the
present invention.
[0046] FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D, FIG. 6E, FIG. 6F, FIG.
6G, FIG. 6H, FIG. 6I, FIG. 6J, FIG. 6K, FIG. 6L, and FIG. 6M
illustrate examples and elements of engineered nucleic acid
scaffold polynucleotide compositions of the present invention.
[0047] FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F, FIG.
7G, FIG. 7H, and FIG. 7I illustrate examples and elements of
engineered concatenated nucleic acid scaffold polynucleotide
compositions of the present invention.
[0048] FIG. 8A, FIG. 8B, FIG. 8C, FIG. 8D, FIG. 8E, FIG. 8F, FIG.
8G, FIG. 8H, FIG. 8I, FIG. 8J, FIG. 8K, FIG. 8L, FIG. 8M, and FIG.
8N illustrate examples and elements of engineered concatenated
split-nexus nucleic acid scaffold polynucleotide compositions of
the present invention.
[0049] FIG. 9A and FIG. 9B illustrate examples and elements of
engineered nucleic acid scaffold polynucleotide compositions of the
present invention.
[0050] FIG. 10 illustrates an example and elements of an engineered
nucleic acid scaffold polynucleotide composition of the present
invention.
[0051] FIG. 11 illustrates a nucleoprotein complex comprising an
engineered nucleic acid scaffold polynucleotide composition of the
present invention, formation of a nucleoprotein complex, and the
nucleoprotein complex binding two nucleic acid target
sequences.
[0052] FIG. 12 illustrates a nucleoprotein complex comprising an
engineered nucleic acid scaffold polynucleotide composition of the
present invention binding to a first nucleic acid target sequence
and binding to a second nucleic acid target sequence that is cut by
a nuclease of the complex.
[0053] FIG. 13 illustrates a nucleoprotein complex comprising an
engineered nucleic acid scaffold polynucleotide composition of the
present invention binding to three nucleic acid target sequences in
a polynucleotide.
[0054] FIG. 14 illustrates a nucleoprotein complex comprising an
engineered nucleic acid scaffold polynucleotide composition of the
present invention binding to a first nucleic acid target sequence
in a first polynucleotide and binding to a second nucleic acid
target sequence and a third nucleic acid target sequence in a
second polynucleotide, wherein the second and third nucleic acid
target sequences are cut by a nuclease of the complex.
[0055] FIG. 15 illustrates a nucleoprotein complex comprising an
engineered nucleic acid scaffold polynucleotide composition of the
present invention binding to a first nucleic acid target sequence
in a first polynucleotide, binding to a second nucleic acid target
sequence in a second polynucleotide, and binding a third nucleic
acid target sequence in a third polynucleotide, wherein the second
and third nucleic acid target sequences are cut by a nuclease of
the complex.
[0056] FIG. 16A, FIG. 16B, and FIG. 16C illustrate an engineered
nucleic acid scaffold polynucleotide composition of the present
invention forming a nucleoprotein complex with two different
proteins and binding to a first nucleic acid target sequence in a
first polynucleotide and a second nucleic acid sequence in a second
polynucleotide. Three combinations of binding and cleaving outcomes
are illustrated.
INCORPORATION BY REFERENCE
[0057] All patents, publications, and patent applications cited in
this specification are herein incorporated by reference as if each
individual patent, publication, or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety for all purposes.
DETAILED DESCRIPTION OF THE INVENTION
[0058] It is to be understood that the terminology used herein is
for the purpose of describing particular embodiments only, and is
not intended to be limiting. As used in this specification and the
appended claims, the singular forms "a," "an" and "the" include
plural referents unless the context clearly dictates otherwise.
Thus, for example, reference to "a polynucleotide" includes one or
more polynucleotides, and reference to "a vector" includes one or
more vectors.
[0059] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. Although
other methods and materials similar, or equivalent, to those
described herein can be useful in the present invention, preferred
materials and methods are described herein.
[0060] In view of the teachings of the present specification, one
of ordinary skill in the art can employ conventional techniques of
immunology, biochemistry, chemistry, molecular biology,
microbiology, cell biology, genomics, and recombinant
polynucleotides, as taught, for example, by the following standard
texts: Antibodies: A Laboratory Manual, Second edition, E. A.
Greenfield, Cold Spring Harbor Laboratory Press, ISBN
978-1-936113-81-1 (2014); Culture of Animal Cells: A Manual of
Basic Technique and Specialized Applications, 6th Edition, R. I.
Freshney, Wiley-Blackwell, ISBN 978-0-470-52812-9 (2010);
Transgenic Animal Technology, Third Edition: A Laboratory Handbook,
C. A. Pinkert, Elsevier, ISBN 978-0124104907 (2014); The Laboratory
Mouse, Second Edition, H. Hedrich, Academic Press, ISBN
978-0123820082 (2012); Manipulating the Mouse Embryo: A Laboratory
Manual, R. Behringer, et al., Cold Spring Harbor Laboratory Press,
ISBN 978-1936113019 (2013); PCR 2: A Practical Approach, M. J.
McPherson, et al., IRL Press, ISBN 978-0199634248 (1995); Methods
in Molecular Biology (Series), J. M. Walker, ISSN 1064-3745, Humana
Press; RNA: A Laboratory Manual, D. C. Rio, et al., Cold Spring
Harbor Laboratory Press, ISBN 978-0879698911 (2010); Methods in
Enzymology (Series), Academic Press; Molecular Cloning: A
Laboratory Manual (Fourth Edition), M. R. Green, et al., Cold
Spring Harbor Laboratory Press, ISBN 978-1605500560 (2012);
Bioconjugate Techniques, Third Edition, G. T. Hermanson, Academic
Press, ISBN 978-0123822390 (2013); Methods in Plant Biochemistry
and Molecular Biology, W. V. Dashek, CRC Press, ISBN 978-0849394805
(1997); Plant Cell Culture Protocols (Methods in Molecular
Biology), V. M. Loyola-Vargas, et al., Humana Press, ISBN
978-1617798177 (2012); Plant Transformation Technologies, C. N.
Stewart, et al., Wiley-Blackwell, ISBN 978-0813821955 (2011);
Recombinant Proteins from Plants (Methods in Biotechnology), C.
Cunningham, et al., Humana Press, ISBN 978-1617370212 (2010); Plant
Genomics: Methods and Protocols (Methods in Molecular Biology), D.
J. Somers, et al., Humana Press, ISBN 978-1588299970 (2009); Plant
Biotechnology: Methods in Tissue Culture and Gene Transfer, R.
Keshavachandran, et al., Orient Blackswan, ISBN 978-8173716164
(2008).
[0061] Clustered regularly interspaced short palindromic repeats
(CRISPR) and related CRISPR-associated proteins (Cas proteins)
constitute CRISPR-Cas systems (see, e.g., Barrangou, R., et al.,
Science 315:1709-1712 (2007)).
[0062] As used herein, "Cas protein" and "CRISPR-Cas protein" refer
to Cas proteins including, but not limited to, Class 1 Type I Cas
proteins, Class 1 Type III Cas proteins, Class 1 Type IV Cas
proteins, Class 2 Type II Cas proteins, Class 2 Type V Cas
proteins, and Class 2 Type VI Cas proteins. Class 2 Cas proteins
include Cas9 proteins, Cas9-like proteins encoded by Cas9
orthologs, Cas9-like synthetic proteins, Cpf1 proteins, proteins
encoded by Cpf1 orthologs, Cpf1-like synthetic proteins, C2c1
proteins, C2c2 proteins, C2c3 proteins, and variants and
modifications thereof. In some embodiments, Cas proteins are Class
2 Cas proteins, for example one or more Class 2 Type II Cas
proteins, such as Cas9, one or more Class 2 Type V Cas proteins,
such as Cpf1, or one or more Class 2 Type VI Cas proteins, such as
C2c2. In preferred embodiments, Cas proteins are one or more Class
2 Type II Cas proteins, such as Cas9, and one or more Class 2 Type
V Cas proteins, such as Cpf1. Typically, for use in aspects of the
present invention, a Cas protein is capable of interacting with one
or more cognate polynucleotides (most typically, RNA) to form a
nucleoprotein complex (most typically, a ribonucleoprotein
complex).
[0063] "Cas9 protein," as used herein, refers to a Cas9 wild-type
protein derived from Class 2 Type II CRISPR-Cas9 systems,
modifications of Cas9 proteins, variants of Cas9 proteins, Cas9
orthologs, and combinations thereof. Cas9 proteins include, but not
limited to, Cas9 from Streptococcus pyogenes (UniProtKB-Q99ZW2
(CAS9_STRP1)), Streptococcus thermophilus (UniProtKB-G3ECR1
(CAS9_STRTR)), and Staphylococcus aureus (UniProtKB-J7RUA5
(CAS9_STAAU)). Cas9 homologs can be identified using sequence
similarity search methods known to one skilled in the art. "dCas9,"
as used herein, refers to variants of Cas9 protein that are
nuclease-deactivated Cas9 proteins, also termed "catalytically
inactive Cas9 protein," "enzymatically inactive Cas9,"
"catalytically dead Cas9" or "dead Cas9." Such molecules lack all
or a portion of endonuclease activity and can therefore be used to
regulate genes in an RNA-guided manner (see Jinek M., et al.,
Science 337:816-821 (2012)). This is accomplished by introducing
mutations to catalytic residues, such as D10A in the RuvC-1 domain
and H840A in the HNH domain (numbered relative to S. pyogenes Cas9
protein), that inactivate Cas9 nuclease function. It is understood
that mutation of other catalytic residues to reduce activity of
either or both of the nuclease domains can also be carried out by
one skilled in the art. The resultant dCas9 is unable to cleave
double-stranded DNA but retains the ability to complex with a guide
nucleic acid and bind a DNA target sequence. The Cas9 double mutant
with changes at amino acid positions D10A and H840A inactivates
both the nuclease and nickase activities. Targeting specificity is
determined by Cas9 protein binding to the PAM sequence, and by
complementary base pairing of guide RNA (typically, a single-guide
RNA) to the genomic locus. Cas9 is the signature protein
characteristic for Class 2 Type II CRISPR systems.
[0064] "Cpf1 protein," as used herein, refers to a Cpf1 wild-type
protein derived from Class 2 Type V CRISPR-Cpf1 systems,
modifications of Cpf1 proteins, variants of Cpf1 proteins, Cpf1
orthologs, and combinations thereof. "dCpf1," as used herein,
refers to variants of Cpf1 protein that are nuclease-deactivated
Cpf1 proteins, also termed "catalytically inactive Cpf1 protein,"
or "enzymatically inactive Cpf1." Cpf1 proteins include, but not
limited to, Francisella novicida (UniProtKB-A0Q7Q2 (CPF1_FRATN)),
Lachnospiraceae bacterium (UniProtKB-A0A182DWE3
(A0A182DWE3_9FIRM)), and Acidaminococcus sp. (UniProtKB-U2UMQ6
(CPF1_ACISB)). Cpf1 is the signature protein characteristic for
Class 2 Type V CRISPR systems. Cpf1 homologs can be identified
using sequence similarity search methods known to one skilled in
the art.
[0065] "Nucleic-acid targeting nucleic acid" (NATNA), as used
herein, refers to one or more polynucleotides that guide a protein,
such as a Cas protein (e.g., a Cas9 protein or a Cpf1 protein), to
preferentially bind a nucleic acid target sequence in a
polynucleotide (relative to a polynucleotide that does not comprise
the nucleic acid target sequence). NATNAs can comprise
ribonucleotide bases (e.g., RNA), deoxyribonucleotide bases (e.g.,
DNA), combinations of ribonucleotide bases and deoxyribonucleotide
bases (e.g., RNA/DNA), nucleotides, nucleotide analogs, modified
nucleotides, and the like, as well as synthetic, naturally
occurring, and non-naturally occurring modified backbone residues
or linkages, for example, as described herein. Examples of
nucleic-acid targeting nucleic acids include, but are not limited
to, Cas9-crRNA/tracrRNA molecules (see, e.g., FIG. 1A, FIG. 1B,
FIG. 1C, and FIG. 1D), Cas9-sgRNA (see, e.g., FIG. 2A and FIG. 2B),
and Cpf1-crRNA (see, e.g., FIG. 3A and FIG. 3B).
[0066] As used herein, "dual-guide RNA" and "Cas9-dual-guide RNA"
typically refer to a two-component RNA system for a polynucleotide
component capable of associating with a cognate Cas9 protein. FIG.
1A and FIG. 1B present illustrative examples of Class 2 Type II
CRISPR-Cas9-associated dual-guide RNAs. FIG. 1A illustrates a Type
II CRISPR-Cas9 system two-component RNA comprising a Cas9-crRNA
(FIG. 1A, 101) and a Cas9-tracrRNA (FIG. 1A, 102). FIG. 1B
illustrates the formation of base-pair hydrogen bonds between the
Cas9-crRNA and the Cas9-tracrRNA to form secondary structure (see,
e.g., U.S. Published Patent Application No. 2014-0068797, published
6 Mar. 2014; see also Jinek M., et al., Science 337:816-21 (2012)).
FIG. 1B presents an overview of and nomenclature for secondary
structural elements of the Cas9-crRNA and Cas9-tracrRNA of the S.
pyogenes Cas9 including the following: a spacer element (FIG. 1B,
103) comprising a spacer sequence (also referred to herein as a
nucleic acid target binding sequence); a first stem element (FIG.
1B, 104, 105, 106) comprising a lower stem element (FIG. 1B, 104),
a bulge element comprising unpaired nucleotides (FIG. 1B, 105), and
an upper stem element (FIG. 1B, 106); a nexus element (FIG. 1B,
107) comprising a second stem element; a first 3' hairpin element
(FIG. 1B, 108) comprising a third stem element; and a second 3'
hairpin element (FIG. 1B, 109) comprising a fourth stem element. In
some Class 2 Type II CRISPR-Cas9 systems, the first stem element
does not have a bulge element (e.g., C. jejuni). FIG. 1C
illustrates a Type II CRISPR-Cas9 two-RNA component system
comprising a Cas9-crRNA (FIG. 1C, 101) and a Cas9-tracrRNA (FIG.
1C, 102). FIG. 1D illustrates the formation of base-pair hydrogen
bonds between the Cas9-crRNA and the Cas9-tracrRNA to form a
secondary structure. FIG. 1D presents an overview of and
nomenclature for the following: a spacer element (FIG. 1D, 103); a
first stem element (FIG. 1D, 110); a nexus element (FIG. 1D, 107)
comprising a second stem element; a first 3' hairpin element (FIG.
1D, 108) comprising a third stem element; and a second 3' hairpin
element (FIG. 1D, 109) comprising a fourth stem element. A
Cas9-dual-guide RNA is capable of forming a nucleoprotein complex
with a cognate Cas9 protein, wherein the complex is capable of
targeting a nucleic acid target sequence complementary to the
spacer sequence. Modifications of Cas9-dual-guides are known in the
art, including, deletion of one or more 3' hairpin elements (FIG.
1B, 108, 109; FIG. 1D, 108, 109), modifications of the first stem
element (FIG. 1B, 104, 105, 106; FIG. 1D 110), and modifications of
the upper stem, bulge, and lower stem (FIG. 1B, 106, 105, 104,
respectively) (see, e.g., U.S. Patent Publication No. 2014-0315985,
published 23 Oct. 2014; U.S. Patent Publication No. 2015-0376586,
published 31 Dec. 2015). As used herein, a "dual-guide Cas9
polynucleotide" refers to a two-component system having a
polynucleotide with the same structural elements as a crRNA (FIG.
1A, 101) and a polynucleotide with the same structural elements as
a tracrRNA (FIG. 1A 102). A dual-guide Cas9 polynucleotide system
is capable of associating with a cognate Cas9 protein.
[0067] As used herein, "single-guide RNA" (sgRNA) and "Cas9-sgRNA"
typically refer to a one-component RNA system as further described
herein, wherein the system is capable of associating with a cognate
Cas9 protein.
[0068] FIG. 2A, FIG. 2B and FIG. 2C show examples of Class 2 Type
II CRISPR-Cas9-associated RNA. These figures illustrate Cas9
single-guide RNAs (Cas9-sgRNA) wherein the Cas9-crRNA is covalently
joined to the Cas9-tracrRNA, often through a tetraloop, and forms a
RNA polynucleotide secondary structure through base-pair hydrogen
bonding (see, e.g., U.S. Published Patent Application No.
2014-0068797, published 6 Mar. 2014). FIG. 2A presents an overview
of and nomenclature for secondary structural elements of a
Cas9-sgRNA for S. pyogenes including the following: a spacer
element (FIG. 2A, 201) comprising a spacer sequence (also referred
to herein as a nucleic acid targeting nucleic acid sequence); a
first stem-loop element (FIG. 2A, 202, 205, 203, 204) comprising a
lower stem element (FIG. 2A, 202), a bulge element comprising
unpaired nucleotides (FIG. 2A, 205), and an upper stem element
(FIG. 2A, 203), and a loop element (FIG. 2A, 204) comprising
unpaired nucleotides; a nexus element (FIG. 2A, 206) comprising a
second stem-loop element; a first 3' hairpin element (FIG. 2A, 207)
comprising a third stem-loop element; and a second 3' hairpin
element comprising a third stem element (FIG. 2A, 208) comprising a
fourth stem-loop element. (See, e.g., FIGS. 1 and 3 of Briner, A.
E., et al., Molecular Cell 56(2):333-339 (2014)).
[0069] FIG. 2B presents an overview of and nomenclature for
secondary structural elements of a Cas9-sgRNA for C. jejuni
including the following: a spacer element (FIG. 2B, 201); a first
stem element (FIG. 2B, 209) and a loop element (FIG. 2B, 204)
comprising unpaired nucleotides (i.e., the first stem-loop element
comprises the first stem element and the loop element); a nexus
element (FIG. 2B, 206) comprising a second stem-loop element; a
first 3' hairpin element (FIG. 2B, 207) comprising a third
stem-loop element; and a second 3' hairpin element comprising a
third stem element (FIG. 2B, 208) comprising a fourth stem-loop
element. A Cas9-sgRNA is capable of forming a nucleoprotein complex
with a cognate Cas9 protein, wherein the complex is capable of
targeting a nucleic acid sequence complementary to the spacer
sequence.
[0070] Modifications of Cas9 single-guides are known in the art
including, but not limited to, deletion of one or more 3' hairpin
elements (FIG. 2, 207, 208), modifications of the first stem
element (FIG. 1B, 104, 105, 106; FIG. 1D 110), and modifications of
the upper stem, bulge, and lower stem (FIG. 1B, 106, 105, 104,
respectively) (see, e.g., U.S. Patent Publication No. 2014-0315985,
published 23 Oct. 2014; U.S. Patent Publication No. 2015-0376586,
published 31 Dec. 2015).
[0071] As used herein, a "Cas9 single-guide polynucleotide" refers
to a one-component system having the same structural elements as a
sgRNA (FIG. 2). A single-guide Cas9 polynucleotide system is
capable of associating with a cognate Cas9 protein.
[0072] FIG. 2C presents a more detailed illustration of FIG. 2A.
Table 1 presents a series of numerical indicators used to
illustrate regions of nucleic acid sequences associated with a
Class 2 Type II CRISPR-Cas9 sgRNA. In Table 1, ":" is the
equivalent of the term "comprising."
TABLE-US-00001 TABLE 1 Numerical Indicators Used to Illustrate
Regions of Nucleic Acid Sequences in a sgRNA Indicator
Corresponding Region Nucleic acid binding protein binding sequences
210 a 3' terminus 210-211 a linker element nucleic acid sequence: a
3' terminal linker element nucleic acid sequence 3' hairpin
elements (compare FIG. 2A, 207, 208) 211-214 a hairpin nucleic acid
sequence 1-2: a 3' hairpin 1-2 element 211-212 a 3' hairpin 1-2
stem element nucleic acid sequence 2 212-213 a 3' hairpin 1-2 loop
element nucleic acid sequence 213-214 a 3' hairpin 1-2 stem element
nucleic acid sequence 1 214-215 a linker element nucleic acid
sequence: a 3' hairpin 1-2 linker element nucleic acid sequence
215-218 a hairpin nucleic acid sequence 1-1: a 3' hairpin-1-1
element 215-216 a 3' hairpin 1-1 stem element nucleic acid sequence
2 216-217 a 3' hairpin 1-1 loop element nucleic acid sequence
217-218 a 3' hairpin 1-1 stem element nucleic acid sequence 1
218-219 a linker element nucleic acid sequence: a 3' hairpin 1-1
linker element nucleic acid sequence Nexus element 219-220 a nexus
element nucleic acid sequence 219-230 a split-nexus stem element
nucleic acid sequence 1-1 230-220 a split-nexus stem element
nucleic acid sequence 1-2 Stem 1 linker element 220-221 a
connective nucleic acid sequence 1: a linker element nucleic acid
sequence 1 221-228 first stem-loop element (see also FIG. 2A, 202,
203, 204, 205; FIG. 2B, 204, 209) 221-224/ first stem element (see
also, FIG. 1A, 104, 105, 106; 225-228 FIG. 1D, 110; 2A, 202, 205,
203) 221-222/ a lower stem element 1 227-228 222-223/ a bulge
element 1 226-227 223-224/ an upper stem element 1 225-226 221-224
a first stem element nucleic acid sequence 1-2 221-222 a lower stem
element nucleic acid sequence 1-2 222-223 a bulge element nucleic
acid sequence 1-2 223-224 an upper stem element nucleic acid
sequence 1-2 224-225 a loop element nucleic acid sequence 1 224-225
an upper stem element nucleic acid sequence 1-1 224-225 a bulge
element nucleic acid sequence 1-1 224-225 a lower stem element
nucleic acid sequence 1-1 225-228 a first stem element nucleic acid
sequence 1-1 228-229 a spacer element 1 comprising a nucleic acid
sequence 1: a spacer nucleic acid sequence: a nucleic acid target
binding sequence (e.g., a DNA target binding sequence) 229 a 5'
end
[0073] "Class 2 Type V guide crRNA" and "Cpf1-crRNA," as used
herein, typically refer to a one-component RNA system for a
polynucleotide component capable of associating with a cognate Cpf1
protein (see, e.g., Zetsche, B., et al., Cell 163:1-13 (2015)).
FIG. 3A presents an example of a Type V CRISPR-Cpf1-associated RNA
(Cpf1-crRNA), as well as an overview of and nomenclature for
secondary structural elements of a Cpf1-crRNA as follows: a
stem-loop element (FIG. 3A, 301) and a spacer element (FIG. 3A,
302) comprising a nucleic acid target binding sequence. The
stem-loop element comprises, in a 5' to 3' direction, a Cpf1-stem
RNA sequence 1C (FIG. 3A, 303), a loop element (FIG. 3A, 304), and
a complementary Cpf1-stem RNA sequence 1C (FIG. 3A, 305), wherein
the Cpf1-stem RNA sequence 1 and the complementary Cpf1-stem RNA
sequence 1C form a duplex. FIG. 3B presents a modification of the
Cpf1-crRNA wherein the loop element is removed from the stem-loop
element of FIG. 3A. FIG. 3B illustrates a stem element (FIG. 3B,
301) comprising, in a 5' to 3' direction, a Cpf1-stem nucleic acid
sequence 1 (FIG. 3B, 303); a complementary Cpf1-stem nucleic acid
sequence 1C (FIG. 3B, 305), wherein the Cpf1-stem nucleic acid
sequence 1 and the complementary Cpf1-stem nucleic acid sequence 1C
form a duplex; and a spacer element (FIG. 3A, 302) comprising a
nucleic acid target binding sequence. A guide crRNA is capable of
forming a nucleoprotein complex with a cognate Cpf1 protein,
wherein the complex is capable of targeting a nucleic acid target
sequence complementary to the nucleic acid target binding
sequence.
[0074] As used herein, "a nucleic acid target binding sequence" and
"spacer nucleic acid sequence" refer to nucleic acid sequences
capable of hybridizing to a nucleic acid target sequence in a
polynucleotide. A "spacer element" comprises a nucleic acid target
binding sequence.
[0075] As used herein, "a nucleic acid scaffold," "NASC," "a NASC
polynucleotide composition," "a NASC composition" and "a NASC
polynucleotide composition" all refer to a polynucleotide complex
forming a scaffold. In preferred embodiments, the scaffold is
capable of binding a nucleic acid binding protein. Typically, a
NASC polynucleotide composition is a complex of two or more
engineered nucleic acid sequences forming a scaffold comprising:
(i) a repeat element 1 (e.g., comprising a repeat nucleic acid
sequence 1) and a repeat element 2 (e.g., comprising a repeat
nucleic acid sequence 2); (ii) a nucleic acid binding protein
binding element 1 (e.g., comprising a nucleic acid binding protein
binding sequence 1) and a nucleic acid binding protein binding
element 2 (e.g., comprising a nucleic acid binding protein binding
sequence 2); and (iii) a spacer element 1 (e.g., comprising a
nucleic acid target binding sequence 1) and a spacer element 2
(e.g., comprising a nucleic acid target binding sequence 2). In a
NASC polynucleotide composition, the repeat element 1 is connected
with the repeat element 2.
[0076] The NASC polynucleotide composition is capable of
associating with a nucleic acid binding protein. In some
embodiments, the NASC polynucleotide composition is capable of
associating with two or more nucleic acid binding proteins (e.g.,
nucleic acid binding proteins having similar structural motifs and
functional motifs) to form a nucleoprotein complex. Examples of
nucleic acid binding proteins are discussed herein below.
[0077] In some embodiments of NASC polynucleotide compositions,
each of a first NASC polynucleotide component (e.g., a NASC-PC1
comprising a repeat element 1, a nucleic acid binding protein
binding element 1, and a spacer element 1) and a second NASC
polynucleotide component (e.g., NASC-PC2 comprising a repeat
element 2, a nucleic acid binding protein binding element 2, and a
spacer element 2) is capable of associating with the same kind of a
nucleic acid binding protein (e.g., nucleic acid binding proteins
having similar structural motifs and functional motifs) to form a
nucleoprotein complex.
[0078] In other embodiments of NASC polypeptide compositions, a
nucleoprotein complex is capable of being formed by a nucleic acid
binding protein binding to a macromolecule comprising a nucleic
acid target binding sequence 1, a repeat nucleic acid sequence 1, a
repeat nucleic acid sequence 2, and a nucleic acid target binding
sequence 1.
[0079] A NASC polynucleotide composition/nucleic acid binding
protein 1/nucleic acid binding protein 2 complex is capable of
preferentially binding a nucleic acid target sequence in a
polynucleotide (relative to a polynucleotide that does not comprise
the nucleic acid target sequence).
[0080] A NASC polynucleotide (NASC-PC) comprising multiple spacer
elements is generically referred to herein as "a NASC-PC-MTS," and
specifically referred to with reference to the number of spacer
elements "a NASC-PC-(number of spacer elements)TS" (e.g., for two
spacer elements, the designation used is a NASC-PC-2TS).
[0081] The components of a NASC-PC comprising multiple
polynucleotides are referred to herein with reference to the number
of polynucleotides "a NASC-PC-(number of polynucleotides)" (e.g.,
for two polynucleotides, the designation used is a NASC-PC1-1 and a
NASC-PC1-2).
[0082] A NASC-PC polynucleotide component comprising concatenated
elements is referred to herein as "NASC-PC-CE." In particular
embodiments comprising split-nexus polynucleotides, a NASC
polynucleotide component comprising concatenated split-nexus
elements is referred to herein as "NASC-PC-SCE."
[0083] As used herein, "a nucleic acid brace sequence" is a nucleic
acid sequence comprising at least two distinct nucleic acid target
sequences: a nucleic acid target sequence 1 complementary to a
nucleic acid target binding sequence 1 of a first NASC
polynucleotide composition, and a nucleic acid target sequence 2
complementary to a nucleic acid target binding sequence 2 of a
second NASC polynucleotide composition. An example of a nucleic
acid brace sequence is a DNA brace sequence.
[0084] As used herein, "a NASC-Cage Composition (NASC-CC)"
comprises at least a first NASC polynucleotide composition
connected by nucleic acid brace sequences to a second NASC
polynucleotide composition to form a cage-like structure typically
having an internal space for packaging molecules.
[0085] As used herein, the term "cognate" typically refers to a Cas
protein (e.g., Cas9 protein or a Cpf1 protein) and one or more Cas
polynucleotides (e.g., Class 2 Type II CRISPR-Cas9-associated NATNA
or Class 2 Type V CRISPR-Cpf1-associated NATNAs, respectively) that
are capable of forming a nucleoprotein complex capable of
site-directed binding to a nucleic acid target sequence
complementary to the nucleic acid target binding sequence present
in one of the one or more Cas polynucleotides.
[0086] The terms "wild-type," "naturally occurring," and
"unmodified" are used herein to mean the typical (or most common)
form, appearance, phenotype, or strain existing in nature; for
example, the typical form of cells, organisms, characteristics,
polynucleotides, proteins, macromolecular complexes, genes, RNAs,
DNAs, or genomes as they occur in, and can be isolated from, a
source in nature. The wild-type form, appearance, phenotype, or
strain serve as the original parent before an intentional
modification. Thus, mutant, variant, engineered, recombinant, and
modified forms are not wild-type forms.
[0087] As used herein, the terms "engineered," "genetically
engineered," "recombinant," "modified," "non-naturally occurring,"
"non-natural," and "non-native" are interchangeable and indicate
intentional human manipulation.
[0088] As used herein, "interrupted," "broken," and "discontinuous"
are used interchangeably to mean a break in continuity, for
example, in covalent bonds of a polynucleotide backbone. For
example, a first polynucleotide and a second polynucleotide that
are discontinuous each have a 5' terminus and a 3' terminus (5'
terminus-first polynucleotide-3' terminus and 5' terminus-second
polynucleotide-3' terminus). For example, the 5' terminus of a DNA
or RNA molecule is typically the fifth carbon in the sugar ring and
the 3' terminus is typically the hydroxyl group on the third carbon
in the sugar ring. Two polynucleotides each having a 5' terminus
and a 3' terminus are formed when the backbone of a single
polynucleotide is broken at one site. A 5' and/or 3' terminus can
be covalently modified, for example, by addition of a moiety (e.g.,
a moiety providing resistance to the degradative effects of
exonucleases).
[0089] "Covalent bond," "covalently attached," "covalently bound,"
"covalently linked," "covalently connected," and "molecular bond"
are used interchangeably herein, and refer to a chemical bond that
involves the sharing of electron pairs between atoms. Examples of
covalent bonds include, but are not limited to, phosphodiester
bonds and phosphorothioate bonds.
[0090] "Non-covalent bond," "non-covalently attached,"
"non-covalently bound," "non-covalently linked," "non-covalent
interaction," and "non-covalently connected" are used
interchangeably herein, and refer to any relatively weak chemical
bond that does not involve sharing of a pair of electrons. Multiple
non-covalent bonds often stabilize the conformation of
macromolecules and mediate specific interactions between molecules.
Examples of non-covalent bonds include, but are not limited to
hydrogen bonding, ionic interactions (e.g., Na.sup.+Cl.sup.-), van
der Waals interactions, and hydrophobic bonds.
[0091] As used herein, "hydrogen bonding," "hydrogen base pairing,"
"hydrogen bond base pairing," "hydrogen bonded," and
"hydrogen-bonded base pairs" are used interchangeably and refer to
canonical hydrogen bonding and non-canonical hydrogen bonding
including, but not limited to, "Watson-Crick-hydrogen-bonded base
pairs" (W--C-hydrogen-bonded base pairs or W--C hydrogen bonding);
"Hoogsteen-hydrogen-bonded base pairs" (Hoogsteen hydrogen
bonding); and "wobble-hydrogen-bonded base pairs" (wobble hydrogen
bonding). W--C hydrogen bonding, including reverse W--C hydrogen
bonding, refers to purine-pyrimidine base pairing, that is
adenine:thymine, guanine:cytosine, and uracil: adenine. Hoogsteen
hydrogen bonding, including reverse Hoogsteen hydrogen bonding,
refers to a variation of base pairing in nucleic acids wherein two
nucleobases, one on each strand, are held together by hydrogen
bonds in the major groove. This non-W--C hydrogen bonding can allow
a third strand to wind around a duplex and form triple-stranded
helices. Wobble hydrogen bonding, including reverse wobble hydrogen
bonding, refers to a pairing between two nucleotides in RNA
molecules that does not follow Watson-Crick base pair rules. There
are four major wobble base pairs: guanine:uracil, inosine
(hypoxanthine):uracil, inosine-adenine, and inosine-cytosine. Rules
for canonical hydrogen bonding and non-canonical hydrogen bonding
are known to those of ordinary skill in the art (see, e.g., The RNA
World, Third Edition (Cold Spring Harbor Monograph Series), R. F.
Gesteland, Cold Spring Harbor Laboratory Press, ISBN 978-0879697396
(2005); The RNA World, Second Edition (Cold Spring Harbor Monograph
Series), R. F. Gesteland, et al., Cold Spring Harbor Laboratory
Press, ISBN 978-0879695613 (1999); The RNA World (Cold Spring
Harbor Monograph Series), R. F. Gesteland, et al., Cold Spring
Harbor Laboratory Press, ISBN 978-0879694562 (1993) (see, e.g.,
Appendix 1: Structures of Base Pairs Involving at Least Two
Hydrogen Bonds, I. Tinoco); Principles of Nucleic Acid Structure,
W. Saenger, Springer International Publishing AG, ISBN
978-0-387-90761-1 (1988); Principles of Nucleic Acid Structure,
First Edition, S. Neidle, Academic Press, ISBN 978-01236950791
(2007)).
[0092] "Connect," "connected," and "connecting" are used
interchangeably herein, and refer to a covalent bond or a
non-covalent bond between two macromolecules (e.g.,
polynucleotides, proteins, and the like).
[0093] As used herein, "complementarity" refers to the ability of a
nucleic acid sequence to form hydrogen bond(s) with another nucleic
acid sequence (e.g., through canonical Watson-Crick base pairing).
A percent complementarity indicates the percentage of residues in a
nucleic acid molecule that can form hydrogen bonds with a second
nucleic acid sequence. If two polynucleotide sequences have 100%
complementarity, the two sequences are perfectly complementary,
i.e., all of the contiguous residues of a first polynucleotide
hydrogen bond with the same number of contiguous residues in a
second polynucleotide.
[0094] As used herein, "binding" refers to a non-covalent
interaction between macromolecules (e.g., between a protein and a
polynucleotide, between a polynucleotide and a polynucleotide, or
between a protein and a protein, and the like). Such non-covalent
interaction is also referred to as "associating" or "interacting"
(e.g., if a first macromolecule interacts with a second
macromolecule, the first macromolecule binds to second
macromolecule in a non-covalent manner). Some portions of a binding
interaction may be sequence-specific. "Sequence-specific binding,"
as used herein, typically refers to one or more NASC polypeptide
compositions capable of forming a complex with one or more proteins
(e.g., a Cas9 protein and/or a Cpf1 protein) to cause the proteins
to bind a nucleic acid sequence (e.g., a DNA sequence) comprising a
nucleic acid target sequence (e.g., a DNA target sequence)
preferentially relative to a second nucleic acid sequence (e.g., a
second DNA sequence) without the nucleic acid target binding
sequence (e.g., the DNA target binding sequence). All components of
a binding interaction do not need to be sequence-specific, such as
the protein binding with phosphate residues in a DNA backbone.
Binding interactions can be characterized by a dissociation
constant (Kd). "Binding affinity" refers to the strength of the
binding interaction. An increased binding affinity is correlated
with a lower Kd.
[0095] As used herein, a Cas protein (e.g., a Cas9 protein) is said
to "target" a polynucleotide if a site-directed nucleoprotein
complex comprising a Cas protein binds or cleaves a polynucleotide
at the nucleic acid target sequence within the polynucleotide.
[0096] As used herein, "double-strand break" (DSB) refers to both
strands of a double-stranded segment of DNA being severed. In some
instances, if such a break occurs, one strand can be said to have a
"sticky end" wherein nucleotides are exposed and not hydrogen
bonded to nucleotides on the other strand. In other instances, a
"blunt end" can occur wherein both strands remain fully base paired
with each other.
[0097] "Donor polynucleotide," "donor oligonucleotide," and "donor
template" are used interchangeably herein and can be a
double-stranded polynucleotide (e.g., a double-stranded DNA), a
single-stranded polynucleotide (e.g., single-stranded DNA), or a
combination thereof. Donor polynucleotides comprise homology arms
flanking the insertion sequence (e.g., DSBs in the DNA). The
homology arms on each side can vary in length. Parameters for the
design and construction of donor polynucleotides are well-known in
the art (see, e.g., Ran, F., et al., Nature Protocols
8(11):2281-2308 (2013); Smithies, O., et al., Nature 317:230-234
(1985); Thomas, K., et al., Cell 44:419-428 (1986); Wu, S., et al.,
Nature Protocols 3:1056-1076 (2008); Singer, B., et al., Cell
31:25-33 (1982); Shen, P., et al., Genetics 112:441-457 (1986);
Watt, V., et al., Proceedings of the National Academy of Sciences
of the United States of America 82:4768-4772 (1985); Sugawara, N.,
et al., Journal of Molecular Cell Biology 12(2):563-575 (1992);
Rubnitz, J., et al., Journal of Molecular Cell Biology
4(11):2253-2258 (1984); Ayares, D., et al., Proceedings of the
National Academy of Sciences of the United States of America
83(14):5199-5203 (1986); Liskay, R, et al., Genetics 115(1):161-167
(1987)).
[0098] As used herein, "homology-directed repair" (HDR) refers to
DNA repair that takes place in cells, for example, during repair of
a DSB in DNA. HDR requires nucleotide sequence homology and uses a
donor polynucleotide to repair the sequence wherein the DSB (e.g.,
within a DNA target sequence) occurred. The donor polynucleotide
generally has the requisite sequence homology with the sequence
flanking the DSB so that the donor polynucleotide can serve as a
suitable template for repair. HDR results in the transfer of
genetic information from, for example, the donor polynucleotide to
the DNA target sequence. HDR may result in alteration of the DNA
target sequence (e.g., insertion, deletion, or mutation) if the
donor polynucleotide sequence differs from the DNA target sequence
and part or all of the donor polynucleotide is incorporated into
the DNA target sequence. In some embodiments, an entire donor
polynucleotide, a portion of the donor polynucleotide, or a copy of
the donor polynucleotide is integrated at the site of the DNA
target sequence. For example, a donor polynucleotide can be used
for repair of the break in the DNA target sequence, wherein the
repair results in the transfer of genetic information (i.e.,
polynucleotide sequences) from the donor polynucleotide at the site
or in close proximity of the break in the DNA. Accordingly, new
genetic information (i.e., polynucleotide sequences) may be
inserted or copied at a DNA target sequence.
[0099] A "genomic region" is a segment of a chromosome in the
genome of a host cell that is present on either side of the nucleic
acid target sequence site or, alternatively, also includes a
portion of the nucleic acid target sequence site. The homology arms
of the donor polynucleotide have sufficient homology to undergo
homologous recombination with the corresponding genomic regions. In
some embodiments, the homology arms of the donor polynucleotide
share significant sequence homology to the genomic region
immediately flanking the nucleic acid target sequence site; it is
recognized that the homology arms can be designed to have
sufficient homology to genomic regions farther from the nucleic
acid target sequence site.
[0100] As used herein, "non-homologous end joining" (NHEJ) refers
to the repair of a DSB in DNA by direct ligation of one end of the
break to the other end of the break without a requirement for a
donor polynucleotide. NHEJ is a DNA repair pathway available to
cells to repair DNA without the use of a repair template. NHEJ in
the absence of a donor polynucleotide often results in nucleotides
being randomly inserted or deleted at the site of the DSB.
[0101] "Microhomology-mediated end joining" (MMEJ) is pathway for
repairing a DSB in DNA. MMEJ involves deletions flanking a DSB and
alignment of microhomologous sequences internal to the broken ends
before joining. MMEJ is genetically defined and requires the
activity of, for example, CtIP, Poly(ADP-Ribose) Polymerase 1
(PARP1), DNA polymerase theta (Pol .theta.), DNA Ligase 1 (Lig 1),
or DNA Ligase 3 (Lig 3). Additional genetic components are known in
the art (see, e.g., Sfeir, A., et al., Trends in Biochemical
Sciences 40:701-714 (2015)).
[0102] As used herein, "DNA repair" encompasses any process whereby
cellular machinery repairs damage to a DNA molecule contained in
the cell. The damage repaired can include single-strand breaks or
double-strand breaks. At least three mechanisms exist to repair
DSBs: HDR, NHEJ, and MMEJ. "DNA repair" is also used herein to
refer to DNA repair resulting from human manipulation, wherein a
target locus is modified, e.g., by inserting, deleting, or
substituting nucleotides, all of which represent forms of genome
editing.
[0103] As used herein, "recombination" refers to a process of
exchange of genetic information between two polynucleotides.
[0104] As used herein, the terms "regulatory sequences,"
"regulatory elements," and "control elements" are interchangeable
and refer to polynucleotide sequences that are upstream (5'
non-coding sequences), within, or downstream (3' non-translated
sequences) of a polynucleotide target to be expressed. Regulatory
sequences influence, for example, the timing of transcription,
amount or level of transcription, RNA processing or stability,
and/or translation of the related structural nucleotide sequence.
Regulatory sequences may include activator binding sequences,
enhancers, introns, polyadenylation recognition sequences,
promoters, transcription start sites, repressor binding sequences,
stem-loop structures, translational initiation sequences, internal
ribosome entry sites (IRES), translation leader sequences,
transcription termination sequences (e.g., polyadenylation signals
and poly-U sequences), translation termination sequences, primer
binding sites, and the like.
[0105] Regulatory elements include those that direct constitutive,
inducible, and repressible expression of a nucleotide sequence in
many types of host cells and those that direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). In some embodiments, a
vector comprises one or more pol III promoters, one or more pol II
promoters, one or more pol I promoters, or combinations thereof.
Examples of pol III promoters include, but are not limited to, U6
and H1 promoters. Examples of pol II promoters include, but are not
limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter
(optionally with the RSV enhancer), the cytomegalovirus (CMV)
promoter (optionally with the CMV enhancer; see, e.g., Boshart, M.,
et al., Cell 41:521-530 (1985)), the SV40 promoter, the
dihydrofolate reductase promoter, the .beta.-actin promoter, the
phosphoglycerol kinase (PGK) promoter, and the EF1.alpha. promoter.
It will be appreciated by those skilled in the art that the design
of an expression vector may depend on such factors as the choice of
the host cell to be transformed, the level of expression desired,
and the like. A vector can be introduced into host cells to thereby
produce transcripts, proteins, or peptides, including fusion
proteins or peptides, encoded by nucleic acids as described
herein.
[0106] "Gene," as used herein, refers to a polynucleotide sequence
comprising exon(s) and related regulatory sequences. A gene may
further comprise intron(s) and/or untranslated region(s)
(UTR(s)).
[0107] As used herein, the term "operably linked" refers to
polynucleotide sequences or amino acid sequences placed into a
functional relationship with one another. For example, regulatory
sequences (e.g., a promoter or enhancer) are "operably linked" to a
polynucleotide encoding a gene product if the regulatory sequences
regulate or contribute to the modulation of the transcription of
the polynucleotide. Operably linked regulatory elements are
typically contiguous with the coding sequence. However, enhancers
can function if separated from a promoter by up to several
kilobases or more. Accordingly, some regulatory elements may be
operably linked to a polynucleotide sequence but not contiguous
with the polynucleotide sequence. Similarly, translational
regulatory elements contribute to the modulation of protein
expression from a polynucleotide.
[0108] As used herein, "expression" refers to transcription of a
polynucleotide from a DNA template, resulting in, for example, a
messenger RNA (mRNA) or other RNA transcript (e.g., non-coding,
such as structural or scaffolding RNAs). The term further refers to
the process through which transcribed mRNA is translated into
peptides, polypeptides, or proteins. Transcripts and encoded
polypeptides may be referred to collectively as "gene product(s)."
Expression may include splicing the mRNA in a eukaryotic cell, if
the polynucleotide is derived from genomic DNA (gDNA).
[0109] As used herein, the term "modulate" refers to a change in
the quantity, degree or amount of a function. For example, a NASC
polynucleotide composition/first nucleic acid binding
protein/second nucleic acid binding protein (e.g., Class 2
CRISPR-Cas proteins) complex, as disclosed herein, may modulate the
activity of a promoter sequence by binding to two or more a nucleic
acid target sequences at or near the promoter. Depending on the
action occurring after binding, the NASC polynucleotide
composition/first nucleic acid binding protein/second nucleic acid
binding protein complex can induce, enhance, suppress, or inhibit
transcription of a gene operatively linked to the promoter
sequence. Thus, "modulation" of gene expression includes both gene
activation and gene repression.
[0110] Modulation can be assayed by determining any characteristic
directly or indirectly affected by the expression of the target
gene. Such characteristics include, e.g., changes in RNA or protein
levels, protein activity, product levels, expression of the gene,
or activity level of reporter genes. Accordingly, the terms
"modulating expression," "inhibiting expression," and "activating
expression" of a gene can refer to the ability of a NASC
polypeptide composition/nucleic acid binding protein(s) complex to
change, activate, or inhibit transcription of a gene.
[0111] "Vector" and "plasmid," as used herein, refer to a
polynucleotide vehicle to introduce genetic material into a cell.
Vectors can be linear or circular. Vectors can contain a
replication sequence capable of effecting replication of the vector
in a suitable host cell (i.e., an origin of replication). Upon
transformation of a suitable host, the vector can replicate and
function independently of the host genome or integrate into the
host genome. Vector design depends, among other things, on the
intended use and host cell for the vector, and the design of a
vector of the invention for a particular use and host cell is
within the level of skill in the art. The four major types of
vectors are plasmids, viral vectors, cosmids, and artificial
chromosomes. Typically, vectors comprise an origin of replication,
a multicloning site, and/or a selectable marker. An expression
vector typically comprises an expression cassette.
[0112] As used herein, "expression cassette" refers to a
polynucleotide construct generated using recombinant methods or by
synthetic means and comprising regulatory sequences operably linked
to a selected polynucleotide to facilitate expression of the
selected polynucleotide in a host cell. For example, the regulatory
sequences can facilitate transcription of the selected
polynucleotide in a host cell, or transcription and translation of
the selected polynucleotide in a host cell. An expression cassette
can, for example, be integrated in the genome of a host cell or be
present in a vector to form an expression vector.
[0113] As used herein, a "targeting vector" is a recombinant DNA
construct typically comprising tailored DNA arms, homologous to
gDNA, that flank elements of a target gene or nucleic acid target
sequence (e.g., a DSB). A targeting vector can comprise a donor
polynucleotide. Elements of the target gene can be modified in a
number of ways including deletions and/or insertions. A defective
target gene can be replaced by a functional target gene, or in the
alternative a functional gene can be knocked out. Optionally, the
donor polynucleotide of a targeting vector comprises a selection
cassette comprising a selectable marker that is introduced into the
target gene. Targeting regions (i.e., nucleic acid target
sequences) adjacent or within a target gene can be used to affect
regulation of gene expression.
[0114] As used herein, the terms "nucleic acid," "nucleic acid
sequence," "nucleotide sequence," "oligonucleotide," and
"polynucleotide" are interchangeable and refer to a polymeric form
of nucleotides. The nucleotides may be deoxyribonucleotides (DNA),
ribonucleotides (RNA), analogs thereof, or combinations thereof,
and may be of any length. Polynucleotides may perform any function
and may have any secondary and tertiary structures. The terms
encompass known analogs of natural nucleotides and nucleotides that
are modified in the base, sugar and/or phosphate moieties. Analogs
of a particular nucleotide have the same base-pairing specificity
(e.g., an analog of A base pairs with T). A polynucleotide may
comprise one modified nucleotide or multiple modified nucleotides.
Examples of modified nucleotides include fluorinated nucleotides,
methylated nucleotides, and nucleotide analogs. Nucleotide
structure may be modified before or after a polymer is assembled.
Following polymerization, polynucleotides may be additionally
modified via, for example, conjugation with a labeling component or
target binding component. A nucleotide sequence may incorporate
non-nucleotide components. The terms also encompass nucleic acids
comprising modified backbone residues or linkages, that are
synthetic, naturally occurring, and non-naturally occurring, and
have similar binding properties as a reference polynucleotide
(e.g., DNA or RNA). Examples of such analogs include, but are not
limited to, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral-methyl phosphonates, 2-O-methyl
ribonucleotides, peptide-nucleic acids (PNAs), Locked Nucleic Acid
(LNA.TM.) (Exiqon, Inc., Woburn, Mass.) nucleosides, glycol nucleic
acid, bridged nucleic acids, and morpholino structures.
[0115] Peptide-nucleic acids (PNAs) are synthetic homologs of
nucleic acids wherein the polynucleotide phosphate-sugar backbone
is replaced by a flexible pseudo-peptide polymer. Nucleobases are
linked to the polymer. PNAs have the capacity to hybridize with
high affinity and specificity to complementary sequences of RNA and
DNA.
[0116] In phosphorothioate nucleic acids, the phosphorothioate (PS)
bond substitutes a sulfur atom for a non-bridging oxygen in the
polynucleotide phosphate backbone. This modification makes the
internucleotide linkage resistant to nuclease degradation. In some
embodiments, phosphorothioate bonds are introduced between the last
3 to 5 nucleotides at the 5' or 3' end of a polynucleotide sequence
to inhibit exonuclease degradation. Placement of phosphorothioate
bonds throughout an entire oligonucleotide helps reduce degradation
by endonucleases as well.
[0117] Threose nucleic acid (TNA) is an artificial genetic polymer.
The backbone structure of TNA comprises repeating threose sugars
linked by phosphodiester bonds. TNA polymers are resistant to
nuclease degradation. TNA can self-assemble by base-pair hydrogen
bonding into duplex structures.
[0118] Linkage inversions can be introduced into polynucleotides
through use of "reversed phosphoramidites" (see, e.g.,
www.ucalgary.ca/dnalab/synthesis/-modifications/linkages). A 3'-3'
linkage at a terminus of a polynucleotide stabilizes the
polynucleotide to exonuclease degradation by creating an
oligonucleotide having two 5'-OH termini and no 3'-OH terminus.
Typically, such polynucleotides have phosphoramidite groups on the
5'-OH position and a dimethoxytrityl (DMT) protecting group on the
3'-OH position. Normally, the DMT protecting group is on the 5'-OH
and the phosphoramidite is on the 3'-OH.
[0119] Polynucleotide sequences are displayed herein in the
conventional 5' to 3' orientation unless otherwise indicated.
[0120] As used herein, "sequence identity" generally refers to the
percent identity of nucleotide bases or amino acids comparing a
first polynucleotide or polypeptide to a second polynucleotide or
polypeptide using algorithms having various weighting parameters.
Sequence identity between two polynucleotides or two polypeptides
can be determined using sequence alignment by various methods and
computer programs (e.g., BLAST, CS-BLAST, FASTA, HMMER, L-ALIGN,
and the like) available through the worldwide web at sites
including, but not limited to, GENBANK
(www.ncbi.nlm.nih.gov/genbank/) and EMBL-EBI (www.ebi.ac.uk.).
Sequence identity between two polynucleotides or two polypeptide
sequences is generally calculated using the standard default
parameters of the various methods or computer programs. A high
degree of sequence identity, as used herein, between two
polynucleotides or two polypeptides is typically between about 90%
identity and 100% identity, for example, about 90% identity or
higher, preferably about 95% identity or higher, more preferably
about 98% identity or higher. A moderate degree of sequence
identity, as used herein, between two polynucleotides or two
polypeptides is typically between about 80% identity to about 85%
identity, for example, about 80% identity or higher, preferably
about 85% identity. A low degree of sequence identity, as used
herein, between two polynucleotides or two polypeptides is
typically between about 50% identity and 75% identity, for example,
about 50% identity, preferably about 60% identity, more preferably
about 75% identity. For example, a Cas protein (e.g., a Cas9
comprising amino acid substitutions) can have a low degree of
sequence identity, a moderate degree of sequence identity, or a
high degree of sequence identity, over its length to a reference
Cas protein (e.g., a wild-type Cas9). As another example, a NATNA
can have a low degree of sequence identity, a moderate degree of
sequence identity, or a high degree of sequence identity, over its
length compared to a reference wild-type polynucleotide that
complexes with the reference Cas protein (e.g., a sgRNA that forms
a complex with Cas9).
[0121] As used herein, "hybridization" or "hybridize" or
"hybridizing" is the process of combining two complementary
single-stranded DNA or RNA molecules so as to form a single
double-stranded molecule (DNA/DNA, DNA/RNA, RNA/RNA) through
hydrogen base pairing. Hybridization stringency is typically
determined by the hybridization temperature and the salt
concentration of the hybridization buffer; e.g., high temperature
and low salt provide high stringency hybridization conditions.
Examples of salt concentration ranges and temperature ranges for
different hybridization conditions are as follows: high stringency,
approximately 0.01M to approximately 0.05M salt, hybridization
temperature 5.degree. C. to 10.degree. C. below T.sub.m; moderate
stringency, approximately 0.16M to approximately 0.33M salt,
hybridization temperature 20.degree. C. to 29.degree. C. below
T.sub.m; and low stringency, approximately 0.33M to approximately
0.82M salt, hybridization temperature 40.degree. C. to 48.degree.
C. below T.sub.m. T.sub.m of duplex nucleic acids is calculated by
standard methods well-known in the art (see, e.g., Maniatis, T., et
al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press: New York (1982); Casey, J., et al., Nucleic Acids
Research 4:1539-1552 (1977); Bodkin, D. K., et al., Journal of
Virological Methods 10(1):45-52 (1985); Wallace, R. B., et al.,
Nucleic Acids Research 9(4):879-894 (1981)). Algorithm prediction
tools to estimate T.sub.m are also widely available. High
stringency conditions for hybridization typically refer to
conditions under which a polynucleotide complementary to a target
sequence predominantly hybridizes with the target sequence, and
substantially does not hybridize to non-target sequences.
Typically, hybridization conditions are of moderate stringency,
preferably high stringency.
[0122] As used herein, a "stem element" or "stem structure" refers
to a polynucleotide comprising two strands that are known or
predicted to form a double-stranded region (the "stem element"). A
"stem-loop element" or "stem-loop structure" refers to a stem
structure wherein the 3' end of one strand is covalently bonded to
the 5' end of the second strand by a nucleotide sequence of
typically single-stranded nucleotides ("a stem-loop element
nucleotide sequence"). In some embodiments, the loop element
comprises a loop element nucleotide sequence of between about 3 and
about 20 nucleotides in length, preferably between about 4 and
about 10 nucleotides in length. In preferred embodiments, a loop
element nucleotide sequence is a single-stranded nucleotide
sequence of unpaired nucleic acid bases that do not interact
through hydrogen bond formation to create a stem element within the
loop element nucleotide sequence. The term "hairpin element" is
also used herein to refer to stem-loop structures. Such structures
are well known in the art. The base pairing may be exact; however,
as is known in the art, a stem element does not require exact base
pairing. Thus, the stem element may include one or more base
mismatches or non-paired bases.
[0123] A "linker element nucleotide sequence" and "linker
nucleotide sequence" are used interchangeably herein and refer to a
single-stranded sequence of one or more nucleotides covalently
attached to a 5' end, a 3' end, or to both the 5' and 3' ends of a
first polynucleotide sequence, and typically refer to a
single-stranded nucleic acid sequence connecting a first
polynucleotide sequence with a second polynucleotide sequence. In
preferred embodiments, the linker element nucleotide sequence is a
single-stranded nucleotide sequence of unpaired nucleic acid bases
that do not interact through hydrogen bond formation to create a
stem element within the linker element nucleotide sequence. In some
embodiments, a linker element nucleotide sequence is between about
1 and about 20 nucleotides in length, preferably between about 2
and about 10 nucleotides in length.
[0124] As used herein, the term "amino acid" refers to natural and
synthetic (unnatural) amino acids, including amino acid analogs,
modified amino acids, peptidomimetics, glycine, and D or L optical
isomers.
[0125] As used herein, the terms "peptide," "polypeptide," and
"protein" are interchangeable and refer to polymers of amino acids.
A polypeptide may be of any length. It may be branched or linear,
it may be interrupted by non-amino acids, and it may comprise
modified amino acids. The terms also refer to an amino acid polymer
that has been modified through, for example, acetylation, disulfide
bond formation, glycosylation, lipidation, phosphorylation,
pegylation, biotinylation, cross-linking, and/or conjugation (e.g.,
with a labeling component or ligand). Polypeptide sequences are
displayed herein in the conventional N-terminal to C-terminal
orientation, unless otherwise indicated.
[0126] Polypeptides and polynucleotides can be made using routine
techniques in the field of molecular biology (see, e.g., standard
texts discussed above). Furthermore, essentially any polypeptide or
polynucleotide is available from commercial sources.
[0127] The terms "fusion protein" and "chimeric protein," as used
herein, refer to a single protein created by joining two or more
proteins, protein domains, or protein fragments that do not
naturally occur together in a single protein. For example, a fusion
protein can contain a first domain from a Cas9 protein and a second
domain a Csy4 protein. The modification to include such domains in
fusion protein may confer additional activity on the modified
site-directed polypeptides. These activities can include nuclease
activity, methyltransferase activity, demethylase activity, DNA
repair activity, DNA damage activity, deamination activity,
dismutase activity, alkylation activity, depurination activity,
oxidation activity, pyrimidine dimer forming activity, integrase
activity, transposase activity, recombinase activity, polymerase
activity, ligase activity, helicase activity, photolyase activity,
glycosylase activity, acetyltransferase activity, deacetylase
activity, kinase activity, phosphatase activity, ubiquitin ligase
activity, deubiquitinating activity, adenylation activity,
deadenylation activity, SUMOylating activity, deSUMOylating
activity, ribosylation activity, deribosylation activity,
myristoylation activity or demyristoylation activity) that modifies
a polypeptide associated with nucleic acid target sequence (e.g., a
histone). A fusion protein can also comprise epitope tags (e.g.,
histidine tags, FLAG.RTM. (Sigma Aldrich, St. Louis, Mo.) tags, Myc
tags), reporter protein sequences (e.g., glutathione-S-transferase,
beta-galactosidase, luciferase, green fluorescent protein, cyan
fluorescent protein, yellow fluorescent protein), and/or nucleic
acid binding domains (e.g., a DNA binding domain, an RNA binding
domain). A fusion protein can also comprise activator domains
(e.g., heat shock transcription factors, NFKB activators) or
repressor domains (e.g., a KRAB domain). As described by Lupo, A.,
et al., Current Genomics 14(4): 268-278 (2013), the KRAB domain is
a potent transcriptional repression module and is located in the
amino-terminal sequence of most C2H2 zinc finger proteins (see,
e.g., Margolin, J., et al., Proceedings of the National Academy of
Sciences of the United States of America 91:4509-4513 (1994);
Witzgall, R., et al., Proceedings of the National Academy of
Sciences of the United States of America 91:4514-4518 (1994)). The
KRAB domain typically binds to co-repressor proteins and/or
transcription factors via protein-protein interactions, causing
transcriptional repression of genes to which KRAB zinc finger
proteins (KRAB-ZFPs) bind (see, e.g., Friedman J.R., et al., Genes
& Development 10:2067-2678 (1996)). In some embodiments, linker
nucleic acid sequences are used to join the two or more proteins,
protein domains, or protein fragments.
[0128] A "moiety," as used herein, refers to a portion of a
molecule. A moiety can be a functional group or describe a portion
of a molecule with multiple functional groups (e.g., that share
common structural aspects). The terms "moiety" and "functional
group" are typically used interchangeably; however, a "functional
group" can more specifically refer to a portion of a molecule that
comprises some common chemical behavior. "Moiety" is often used as
a structural description. In some embodiments, a 5' terminus, a 3'
terminus, or a 5' terminus and a 3' terminus (e.g., a non-native 5'
terminus and/or a non-native 3' terminus in a first stem
element).
[0129] The term "affinity tag," as used herein, typically refers to
one or more moieties that increases the binding affinity of a
polynucleotide component of a NASC polynucleotide composition, for
example, to facilitate formation of a NASC complex. Some
embodiments of the present invention use an "affinity sequence,"
which is a polynucleotide sequence comprising one or more affinity
tags. In some embodiments of the present invention, a
polynucleotide component further comprises an affinity sequence
located at the 5' end, the 3' end, or located between the 5' end
and the 3' end. Some embodiments of the present invention introduce
one or more affinity tags to the N-terminal of a Cas protein
sequence (e.g., a Cas9 protein sequence), to the C-terminal of a
Cas protein sequence, to a position located between the N-terminal
and C-terminal of a Cas protein sequence, or to combinations
thereof. In some embodiments of the invention, the Cas-polypeptide
is modified with an affinity tag or an affinity sequence. A wide
variety of affinity tags are disclosed in U.S. Published Patent
Application No. 2014-0315985, published 23 Oct. 2014.
[0130] As used herein, a "cross-link" is a bond that links one
polymer chain (e.g., a polynucleotide or polypeptide) to another.
Such bonds can be covalent bonds or ionic bonds. In some
embodiments, one polynucleotide can be bound to another
polynucleotide by cross linking the polynucleotides. In other
embodiments, a polynucleotide can be cross linked to a polypeptide.
In additional embodiments, a polypeptide can be cross linked to a
polypeptide.
[0131] The term "cross-linking moiety," as used herein, typically
refers to a moiety suitable to provide cross linking between
polynucleotide components of a NASC polynucleotide composition. A
cross-linking moiety is another example of an affinity tag.
[0132] The terms "ligand" and "ligand-binding moiety," as used
herein, refer to moieties that facilitate the binding of
polynucleotide components to form a NASC polynucleotide
composition. Ligands and ligand-binding moieties are paired
affinity tags.
[0133] As used herein, a "host cell" generally refers to a
biological cell. A cell is the basic structural, functional and/or
biological unit of an organism. A cell can originate from any
organism having one or more cells. Examples of host cells include,
but are not limited to, a prokaryotic cell, eukaryotic cell, a
bacterial cell, an archaeal cell, a cell of a single-cell
eukaryotic organism, a protozoal cell, a cell from a plant (e.g.,
cells from plant crops (such as soy, tomatoes, sugar beets,
pumpkin, hay, cannabis, tobacco, plantains, yams, sweet potatoes,
cassava, potatoes, wheat, sorghum, soybean, rice, corn, maize,
oil-producing Brassica (e.g., oil-producing rapeseed and canola),
cotton, sugar cane, sunflower, millet, and alfalfa), fruits,
vegetables, grains, seeds, flowering plants, conifers, gymnosperms,
ferns, clubmosses, hornworts, liverworts, mosses), an algal cell,
(e.g., Botryococcus braunii, Chlamydomonas reinhardtii,
Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens
C. agardh, and the like), seaweeds (e.g., kelp), a fungal cell
(e.g., a yeast cell or a cell from a mushroom), an animal cell, a
cell from an invertebrate animal (e.g., fruit fly, cnidarian,
echinoderm, nematode, and the like), a cell from a vertebrate
animal (e.g., fish, amphibian, reptile, bird, or mammal), a cell
from a mammal (e.g., a pig, a cow, a goat, a sheep, a rodent, a
rat, a mouse, a non-human primate, a human, and the like).
Furthermore, a cell can be a stem cell or a progenitor cell.
[0134] As used herein, "stem cell" refers to a cell that has the
capacity for self-renewal, i.e., the ability to go through numerous
cycles of cell division while maintaining the undifferentiated
state. Stem cells can be totipotent, pluripotent, multipotent,
oligopotent, or unipotent. Stem cells can be embryonic, fetal,
amniotic, adult, or induced pluripotent stem cells.
[0135] As used herein, "induced pluripotent stem cells" refers to a
type of pluripotent stem cell that is artificially derived from a
non-pluripotent cell, typically an adult somatic cell, by inducing
expression of specific genes.
[0136] "Plant," as used herein, refers to whole plants, plant
organs, plant tissues, germplasm, seeds, plant cells, and progeny
of the same. Plant cells include, without limitation, cells from
seeds, suspension cultures, embryos, meristematic regions, callus
tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen
and microspores. Plant parts include differentiated and
undifferentiated tissues including, but not limited to, roots,
stems, shoots, leaves, pollens, seeds, tumor tissue and various
forms of cells and culture (e.g., single cells, protoplasts,
embryos, and callus tissue). The plant tissue may be in plant or in
a plant organ, tissue or cell culture. "Plant organ" refers to
plant tissue or a group of tissues that constitute a
morphologically and functionally distinct part of a plant.
[0137] "Subject," as used herein, refers to any member of the
phylum Chordata, including, without limitation, humans and other
primates, including non-human primates such as rhesus macaques,
chimpanzees and other monkey and ape species; farm animals, such as
cattle, sheep, pigs, goats and horses; domestic mammals, such as
dogs and cats; laboratory animals, including rabbits, mice, rats
and guinea pigs; birds, including domestic, wild, and game birds,
such as chickens, turkeys and other gallinaceous birds, ducks, and
geese; and the like. The term does not denote a particular age or
gender. Thus, the term includes adult, young, and newborn
individuals as well as male and female. In some embodiments, a host
cell is derived from a subject (e.g., stem cells, progenitor cells,
or tissue-specific cells). In some embodiments, the subject is a
non-human subject.
[0138] As used herein, "transgenic organism" refers to an organism
whose genome is genetically modified. The term includes the progeny
(any generation) of a transgenic organism, provided that the
progeny has the genetic modification.
[0139] As used herein, "isolated" can refer to a nucleic acid or
polypeptide that, by human intervention, exists apart from its
native environment and is therefore not a product of nature. An
isolated nucleic acid or polypeptide can exist in a purified form
and/or can exist in a non-native environment such as, for example,
in a recombinant cell.
[0140] In a general aspect of the present invention, a NASC
polynucleotide composition comprises a repeat element 1 connected
with a repeat element 2, a nucleic acid binding protein binding
element 1 and a nucleic acid binding protein binding element 2, and
a spacer element 1 and a spacer element 2.
[0141] Repeat element 1 and repeat element two are typically
connected by covalent bonds, non-covalent bonds, or a combination
of covalent and non-covalent bonds. In some embodiments, repeat
element 1 and repeat element 2 are connected by hydrogen-bonded
base pairs.
[0142] The NASC polynucleotide composition is capable of
associating with nucleic acid binding protein(s) to form a
nucleoprotein complex. In some embodiments, two or more nucleic
acid binding proteins having similar structural motifs and
functional motifs are used to form nucleoprotein complexes with
NASC polynucleotide compositions. In preferred embodiments, the
nucleic acid binding proteins are Class 2 CRISPR-Cas proteins. In
some embodiments, the nucleic acid binding protein binds a
double-stranded nucleic acid binding protein binding sequence ("a
double-stranded nucleic acid binding protein").
[0143] A NASC polynucleotide composition/nucleic acid binding
protein 1/nucleic acid binding protein 2 complex is capable of
preferentially binding a nucleic acid target sequence in a
polynucleotide (relative to a polynucleotide that does not comprise
the nucleic acid target sequence).
[0144] FIG. 4A, FIG. 4B, FIG. 4C, FIG. 4D, FIG. 4E, FIG. 4F, FIG.
4G, FIG. 4H, FIG. 4I, FIG. 4J, FIG. 4K, FIG. 4L, FIG. 4M, FIG. 4N,
and FIG. 4O illustrate generic examples of different types of
nucleic acid scaffolds of the present invention. These figures
present relative locations of different elements in engineered
nucleic acid sequences for forming scaffolds.
[0145] In some embodiments, a complex of two or more engineered
nucleic acid sequences forming a scaffold comprises:
[0146] a first engineered nucleic acid comprising (i) a nucleic
acid binding protein binding element 1 comprising a nucleic acid
binding protein binding sequence 1 (e.g., a double-stranded nucleic
acid binding protein binding sequence 1) having a first end and a
second end, (ii) a repeat element 1 comprising a repeat nucleic
acid sequence 1 having a first end and a second end, and (iii) a
spacer element 1 comprising a nucleic acid target binding sequence
1; and
[0147] a second engineered nucleic acid comprising (i) a nucleic
acid binding protein binding element 1C comprising a nucleic acid
binding protein binding sequence 2 (e.g., a double-stranded nucleic
acid binding protein binding sequence 2) having a first end and a
second end, (ii) a repeat element 2 comprising a repeat nucleic
acid sequence 2 having a first end and a second end, and (iii) a
spacer element 2 comprising a nucleic acid target binding sequence
2.
[0148] Repeat nucleic acid sequence 1 and repeat nucleic acid
sequence 1C are complementary. Repeat nucleic acid sequence 1C is
also referred to as a repeat nucleic acid sequence 2. The repeat
nucleic acid sequence 1 is connected with the repeat nucleic acid
sequence 1C through hydrogen-bonded base pairs.
[0149] Table 2 presents a series of indicators used consistently in
FIG. 4A through 4O.
TABLE-US-00002 TABLE 2 Numerical Indicators Used to Illustrate
Regions of Complexes of Two or More Engineered Nucleic Acid
Sequences for Forming a Scaffold Indicator and Corresponding Region
Nucleic Example of acid element sequence General element Element
comprises component a first engineered nucleic acid 1-1 a repeat a
repeat nucleic a repeat nucleic element 1 acid sequence 1 acid
sequence 1-2 a nucleic acid a nucleic acid a double-stranded
binding protein binding protein nucleic acid binding element 1
binding sequence 1 binding protein binding sequence 1 1-3 a spacer
a nucleic acid a nucleic acid element 1 sequence 1 target binding
sequence 1 a second engineered nucleic acid 2-1 a repeat a repeat
nucleic a repeat nucleic element 2 acid sequence 2 acid sequence
2-2 a nucleic acid a nucleic acid a double-stranded binding protein
binding protein nucleic acid binding element 2 binding sequence 2
binding protein binding sequence 2 2-3 a spacer a nucleic acid a
nucleic acid element 2 sequence 2 target binding sequence 2 a third
engineered nucleic acid 3-1 a repeat a repeat nucleic a repeat
nucleic element 3 acid sequence 3 acid sequence 3-2 a nucleic acid
a nucleic acid a double-stranded binding protein binding protein
nucleic acid binding element 3 binding sequence 3 binding protein
binding sequence 3 3-3 a spacer a nucleic acid a nucleic acid
element 3 sequence 3 target binding sequence 3 additional
engineered nucleic acids # -1 a repeat a repeat nucleic a repeat
nucleic element # acid sequence # acid sequence # -2 a nucleic acid
a nucleic acid a double-stranded binding protein binding protein
nucleic acid binding element # binding sequence # binding protein
binding sequence # # -3 a spacer a nucleic acid a nucleic acid
element # sequence # target binding sequence # An arrow in the
figure corresponds to a site that can comprise additional nucleic
acid sequences, such as a linker element nucleic acid sequence, and
a pair of arrows illustrates boundaries of a particular element
(e.g., the arrows flanking region 1-1 in FIG. 4A). # = for
additional engineered nucleic acids, sequential numbering following
the number 3
[0150] FIG. 4A, FIG. 4C, FIG. 4E, FIG. 4G, FIG. 4I, and FIG. 4K,
each presents one example from a collection of six different
arrangements of region 1-1, region 1-2, and region 1-3 within a
first engineered nucleic acid, and region 2-1, region 2-2, and
region 2-3 within a second engineered nucleic acid, wherein the
repeat nucleic acid sequence 1-1 is associated with the repeat
nucleic acid sequence 2-1 through hydrogen bonding between the
repeat nucleic acid sequence 1-1 and the repeat nucleic acid
sequence 2-1. In these figures, the first engineered nucleic acid
is a single polynucleotide and the second engineered nucleic acid
is a single polynucleotide. Each polynucleotide has a first end and
a second end. In some embodiments, the first end is a 5' end and
the second end is a 3' end. In other embodiments, the first end is
a 3' end and the second end is a 5' end.
[0151] FIG. 4B, FIG. 4D, FIG. 4F, FIG. 4H, FIG. 4J, and FIG. 4L
each presents the same arrangement as FIG. 4A, FIG. 4C, FIG. 4E,
FIG. 4G, FIG. 4I, and FIG. 4K, respectively, wherein the first
engineered nucleic acid comprises multiple polynucleotides
associated by hydrogen bonding (indicated in these figures as
multiple straight lines between nucleic acid sequences) and the
second engineered nucleic acid comprises multiple polynucleotides
associated through hydrogen bonding. Each polynucleotide has a
first end and a second end. In some embodiments, the first end is a
5' end and the second end is a 3' end, wherein standard 5' to 3'
orientation among the polynucleotides is maintained. In other
embodiments, the first end is a 3' end and the second end is a 5'
end, wherein standard 5' to 3' orientation among the
polynucleotides is maintained.
[0152] FIG. 4M illustrates an example of a complex of three
engineered nucleic acid sequences forming a scaffold. In this
figure, the first, second, and third engineered nucleic acids are
each a single polynucleotide. The first and second engineered
nucleic acids correspond to the first and second engineered nucleic
acids presented in FIG. 4A, and the third engineered nucleic acid
corresponds to the second engineered nucleic acid of FIG. 4G.
[0153] FIG. 4N illustrates an example of a complex of three
engineered nucleic acid sequences forming a scaffold. In this
figure, the first and third engineered nucleic acids are each a
single polynucleotide. The second engineered nucleic acid comprises
multiple polynucleotides associated through hydrogen bonding. The
first engineered nucleic acid corresponds to the first engineered
nucleic acid presented in FIG. 4C. The second engineered nucleic
acid corresponds to the second engineered nucleic acid presented in
FIG. 4D. The third engineered nucleic acid corresponds to the
second engineered nucleic acid of FIG. 4E.
[0154] FIG. 4O illustrates an example of a complex of three
engineered nucleic acid sequences forming a scaffold. In this
figure, the first and third engineered nucleic acids are each a
single polynucleotide. The second engineered nucleic acid comprises
multiple polynucleotides associated through hydrogen bonding. The
first engineered nucleic acid corresponds to the first engineered
nucleic acid presented in FIG. 4I. The second engineered nucleic
acid corresponds to the second engineered nucleic acid presented in
FIG. 4F. The third engineered nucleic acid corresponds to the
second engineered nucleic acid of FIG. 4K.
[0155] The present invention comprises a wide variety of nucleic
acid-based scaffolds that are composed of a complex of two or more
engineered nucleic acid sequences. In preferred embodiments, the
engineered nucleic acid sequences comprise elements of Class 2
CRISPR nucleic acid targeting nucleic acids, for example, elements
encoding nucleic acid sequences based on the sequences of Type
2-crRNAs, Type 2 CRISPR-tracrRNAs, and Type 2 CRISPR single-guide
RNAs. Examples of Class 2 CRISPR-associated elements include, but
are not limited to, the elements presented in FIG. 1A, FIG. 1B,
FIG. 1C, FIG. 1D, FIG. 2A, FIG. 2B, FIG. 3A, and FIG. 3B.
[0156] In some embodiments, the nucleic acid scaffolds comprise
nucleic acid protein binding sequences including, but not limited
to, those associated with genome editing systems (e.g., zinc finger
nucleases (ZFNs), transcription activator-like effector-based
nucleases (TALENs), meganucleases, and CRISPR-Cas). Examples of
nucleic acid protein binding sequences include, but are not limited
to, those associated with the following nucleic acid binding
proteins: Type 2 CRISPR nucleic acid binding proteins (e.g., Cpf1
protein, dCpf1 protein (catalytically inactive), Cas9 protein,
and/or dCas9 protein (catalytically inactive)); Argonaute proteins;
double-stranded nucleic acid binding proteins (e.g., Csy4 protein
and/or Csy4* protein (catalytically inactive); see, e.g., Haurwitz,
R., et al., Science 329(5997):1355-1358 (2010); Sternberg, S., et
al., RNA 18(4):661-672 (2012); U.S. Pat. No. 9,115,348);
single-stranded RNA binding proteins (e.g., p19 siRNA Binding
Protein); single-stranded DNA binding proteins (e.g., adenovirus
DBP, Extreme Thermostable SSB (single-stranded DNA binding
protein); double-stranded RNA binding proteins (e.g., DICER);
double-stranded DNA binding proteins (e.g., ZFNs); and
double-stranded RNA/DNA hybrids (e.g., Ribonuclease H); as well as
catalytically inactive versions thereof In additional embodiments,
the nucleic acid scaffolds and the associated nucleic acid binding
proteins are in nucleic acid scaffold/nucleic acid binding protein
complexes, for example, nucleoprotein complexes and
ribonucleoprotein complexes.
[0157] In some embodiments, each of the nucleic acid binding
protein binding sequences of 1-2, 2-2, and/or 3-2, is, for example,
a double-stranded DNA binding protein binding sequence, a
single-stranded DNA binding protein binding sequence, a
double-stranded RNA binding protein binding sequence, a
single-stranded RNA binding protein binding sequence, or a
double-stranded DNA/RNA hybrid binding protein binding sequence. In
preferred embodiments, the nucleic acid binding protein that binds
the nucleic acid binding protein binding sequence is a Cas9 protein
or a Cpf1 protein.
[0158] In particular embodiments, each of the nucleic acid sequence
1-1, nucleic acid sequence 1-2, and/or nucleic acid sequence 1-3
comprises a nucleic acid sequence that binds to a target nucleic
acid sequence (e.g., a spacer element).
[0159] In a first aspect of the present invention, a NASC
polynucleotide composition comprises a NASC-PC1 and NASC-PC2. A
NASC-PC1/NASC-PC2 complex comprises a repeat element 1 connected
with a repeat element 2, a double-stranded nucleic acid binding
protein binding element 1 and a double-stranded nucleic acid
binding protein binding element 2, and a spacer element 1 and a
spacer element 2. The double-stranded nucleic acid binding proteins
that are capable of binding the NASC are one or more Class 2 Type V
CRISPR-Cpf1 proteins.
[0160] The NASC polynucleotide composition is capable of
associating with two Class 2 Type V CRISPR-Cpf1 proteins to form a
nucleoprotein complex. In some embodiments, each of NASC-PC1 and
NASC-PC2 of the NASC polynucleotide compositions is capable of
associating with two Class 2 Type V CRISPR-Cpf1 proteins to form a
nucleoprotein complex (e.g., FIG. 5A, FIG. 5B, FIG. 5C, FIG. 5D,
FIG. 5E, FIG. 5F, and FIG. 5G).
[0161] In the first aspect of the present invention, the repeat
element 1 comprises a repeat nucleic acid sequence 1, the repeat
element 2 comprises a repeat nucleic acid sequence 1C, the nucleic
acid binding protein binding element 1 comprises a double-stranded
nucleic acid binding protein binding sequence 1, the nucleic acid
binding protein binding element 2 comprises a double-stranded
nucleic acid binding protein binding sequence 2, the spacer element
1 comprises a nucleic acid target binding sequence 1, and the
spacer element 2 comprises a nucleic acid target binding sequence
2.
[0162] The arrangements of the elements are typically as follows:
(i) the repeat element 1 is 5' of the nucleic acid binding protein
binding element 1, the nucleic acid binding protein binding element
1 is 5' of the spacer element 1, and the repeat element 2 is 5' of
the nucleic acid binding protein binding element 2, and the nucleic
acid binding protein binding element 2 is 5' of the spacer element
2; or (ii) the nucleic acid binding protein binding element 1 is 5'
of the repeat element 1, the repeat element 1 is 5' of the spacer
element 1, the nucleic acid binding protein binding element 2 is 5'
of the repeat element 2, and the repeat element 2 is 5' of the
spacer element 2; or (iii) the nucleic acid binding protein binding
element 1 is 5' of the spacer element 1, the spacer element 1 is 5'
of the repeat element 1, the nucleic acid binding protein binding
element 2 is 5' of the spacer element 2, and the spacer element 2
is 5' of the repeat element 2.
[0163] In some embodiments of the first aspect, (i) the nucleic
acid binding protein binding element 1 comprises a first stem
element nucleic acid sequence 1-1 and a first stem element nucleic
acid sequence 1-2, and the first stem element nucleic acid sequence
1-1 and the first stem element nucleic acid sequence 1-2 form a
first stem element 1 through hydrogen-bonded base pairs, and/or
(ii) the nucleic acid binding protein binding element 2 comprises a
first stem element nucleic acid sequence 2-1 and a first stem
element nucleic acid sequence 2-2, and the first stem element
nucleic acid sequence 2-1 and the first stem element nucleic acid
sequence 2-2 form a first stem element 1 through hydrogen-bonded
base pairs (e.g., FIG. 5B, FIG. 5F, FIG. 5G). In further
embodiments, the first stem element nucleic acid sequence 1-1 and
the first stem element nucleic acid sequence 1-2 are connected by a
loop element nucleic acid sequence 1 to form a first stem-loop
element 1, and/or the first stem element nucleic acid sequence 2-1
and the first stem element nucleic acid sequence 2-2 are connected
by a loop element nucleic acid sequence 2 to form a first stem-loop
element 2 (e.g., FIG. 5A, FIG. 5C, FIG. 5D, FIG. 5E).
[0164] In additional embodiments, the repeat nucleic acid sequence
1 is connected with the repeat nucleic acid sequence 1C through
hydrogen-bonded base pairs between the repeat nucleic acid sequence
1 and the repeat nucleic acid sequence 1C.
[0165] In other embodiments, the repeat nucleic acid sequence 1
further comprises an affinity tag 1 and the repeat nucleic acid
sequence 2 further comprises an affinity tag 2, and the affinity
tag 1 is connected with affinity tag 2. For example, the repeat
nucleic acid sequence 1 further comprises an effector protein
binding site nucleic acid sequence 1 and the repeat nucleic acid
sequence 2 further comprises an effector protein binding site
nucleic acid sequence 2, and an effector binding site 1 is formed
by hydrogen base-pair bonding between the effector protein binding
site nucleic acid sequence 1 and the effector protein binding site
nucleic acid sequence 2. One example of an effector binding site is
a Csy4 protein binding site.
[0166] Table 3 presents a series of indicators used consistently in
FIG. 5A, FIG. 5B, FIG. 5C, FIG. 5D, FIG. 5E, FIG. 5F, FIG. 5G, FIG.
5H, and FIG. 5I.
TABLE-US-00003 TABLE 3 Numerical Indicators Used to Illustrate
Regions of Complexes of Two or More Engineered Nucleic Acid
Sequences for Forming a Scaffold Indicator and Corresponding Region
500-507 corresponds to a first engineered nucleic acid sequence
first engineered nucleic acid component a nucleic acid binding
protein binding element 1 a double-stranded nucleic acid binding
protein binding element 1 501-502 corresponds to a first stem
element nucleic acid sequence 1-1 501-520 corresponds to a Class 2
Type V CRISPR protein binding site half stem sequence 1-1a 520-502
corresponds to a Class 2 Type V CRISPR protein binding site half
stem sequence 1-1b 502-503 corresponds to a loop element nucleic
acid sequence 1 503-504 corresponds to a first stem element nucleic
acid sequence 1-2 a repeat element 1.sup.1 504-507 corresponds to a
repeat nucleic acid sequence 1 504-505 corresponds to a linker
element nucleic acid sequence 1-1 505-516 corresponds to a repeat
nucleic acid sequence 1a 516-517 corresponds to a linker element
nucleic acid sequence 1-2 517-506 corresponds to a repeat nucleic
acid sequence 1b 506-507 corresponds to a linker element nucleic
acid sequence 1-3 a spacer element 1 501-500 corresponds to a
nucleic acid target binding sequence 1 508-515 corresponds to a
second engineered nucleic acid sequence a second engineered nucleic
acid component a nucleic acid binding protein binding element 2 a
double-stranded nucleic acid binding protein binding element 2
514-513 corresponds to a first stem element nucleic acid sequence
2-1 521-513 corresponds to a Class 2 Type V CRISPR protein binding
site half stem sequence 2-1c 514-521 corresponds to a Class 2 Type
V CRISPR protein binding site half stem sequence 2-1b 513-512
corresponds to a loop element nucleic acid sequence 2 512-511
corresponds to a first stem element nucleic acid sequence 2-2 a
repeat element 2 511-508 corresponds to a repeat nucleic acid
sequence 1C.sup.2 510-511 corresponds to a linker element nucleic
acid sequence 1C- 1 519-510 corresponds to a repeat nucleic acid
sequence 1bC 518-519 corresponds to a linker element nucleic acid
sequence 1C- 2 509-518 corresponds to a repeat nucleic acid
sequence 2a 508-509 corresponds to a linker element nucleic acid
sequence 1C- 3 a spacer element 2 514-515 corresponds to a nucleic
acid target binding sequence 2 .sup.1= repeat element can include
an effector protein binding site .sup.2= "C" indicates a
complementary sequence
[0167] FIG. 5A presents an example of two engineered nucleic acids
forming a scaffold of the present invention (NASC-PC1 and
NASC-PC2). In some embodiments, the engineered nucleic acids are
Class 2 Type V CRISPR nucleic acid targeting nucleic acids, for
example, a Cpf1 nucleic acid targeting nucleic acid comprising a
repeat nucleic acid sequence covalently attached to the 5' end of
the Cpf1 nucleic acid targeting nucleic acid. FIG. 5A, 500 to 507,
illustrates a first engineered nucleic acid that comprises a first
nucleic acid binding Class 2 Type V CRISPR protein binding sequence
(FIG. 5A, 504 to 501), a nucleic acid target binding sequence 1
(FIG. 5A, 500 to 501) that is located 3' of the first nucleic acid
binding Class 2 Type V CRISPR protein binding sequence, and a first
repeat sequence 1 (FIG. 5A, 504-507) that is located 5' of the
first nucleic acid binding Class 2 Type V CRISPR protein binding
sequence. FIG. 5A, 508 to 515, illustrates a second engineered
nucleic acid that comprises a second nucleic acid binding Class 2
Type V CRISPR protein binding sequence (FIG. 5A, 514 to 511), a
nucleic acid target binding sequence 2 (FIG. 5A, 515 to 514) that
is located 3' of the second nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, and a first repeat sequence 2
(FIG. 5A, 511-508) that is located 5' of the second nucleic acid
binding Class 2 Type V CRISPR protein binding sequence.
[0168] The first engineered nucleic acid and the second engineered
nucleic acid can comprise additional elements such as effector
protein binding sequences, for example, a double-stranded nucleic
acid binding protein binding site (e.g., a Csy4 protein binding
site) created by the association of the repeat nucleic acid
sequence 1 (FIG. 5A, 505-506) and the repeat nucleic acid sequence
1C (FIG. 5A, 509-510) through hydrogen bond interactions.
[0169] FIG. 5B illustrates a modification of the example shown in
FIG. 5A, wherein the loop element nucleic acid sequence 1 (FIG. 5A,
502 to 503) of the first engineered nucleic acid and the loop
element nucleic acid sequence 2 (FIG. 5A, 513 to 512) of the second
engineered nucleic acid are absent.
[0170] FIG. 5C presents an example of two engineered nucleic acids
forming a scaffold of the present invention (NASC-PC1 and
NASC-PC2). In some embodiments, the engineered nucleic acids are
Class 2 Type V CRISPR nucleic acid targeting nucleic acids, for
example, a Cpf1 nucleic acid targeting nucleic acid comprising a
repeat nucleic acid sequence covalently attached to the 3' end of
the Cpf1 nucleic acid targeting nucleic acid. FIG. 5C illustrates a
modification of the engineered nucleic acids, wherein a repeat
sequence is added to the 3' end (FIG. 5C, 500) of a first
engineered nucleic acid (FIG. 5C, 500 to 507) and a complementary
repeat sequence is added to the 3' end (FIG. 5C, 515) of the second
engineered nucleic acid (FIG. 5C, 508 to 515). The repeat sequence
of the first engineered nucleic acid and the complementary repeat
sequence of the second nucleic acid interact through hydrogen
base-pair bonding.
[0171] FIG. 5D presents a modification of NASC-PC1 and NASC-PC2
depicted in FIG. 5A. In FIG. 5D the repeat nucleic acid sequence
covalently attached to the 5' end of each Cpf1 nucleic acid
targeting nucleic acid comprises two repeat elements separated by a
linker element nucleic acid sequence, wherein only one of the two
repeat elements of FIG. 5D, I, is complementary to and capable of
forming hydrogen bonds with one of the repeat elements of FIG. 5D,
II. FIG. 5D illustrates a version of two engineered nucleic acid
forming a scaffold, wherein the repeat sequence 1b (FIG. 5D,
506-517) of the first engineered nucleic acid (FIG. 5D, 500 to 507)
is capable of hydrogen base-pair bonding with the complementary
repeat sequence 1bC (FIG. 5D, 519 to 510) of the second engineered
nucleic acid (FIG. 5D, 515 to 508), wherein the repeat sequence 1b
of the first engineered nucleic acid and the complementary repeat
sequence 1bC of the second engineered nucleic acid interact through
hydrogen base-pair bonding.
[0172] FIG. 5E presents an example of four engineered nucleic acids
forming a scaffold based on two sets of the two engineered nucleic
acids of FIG. 5D. In this FIG. 5E, I, and FIG. 5E, II, provide
points of reference to facilitate comparison to the two engineered
nucleic acids shown in FIG. 5D (i.e., FIG. 5D, I, and II). FIG. 5E
illustrates a modified version of the example shown in FIG. 5D
wherein a repeat element of the first engineered nucleic acid (FIG.
5E, I; NASC-PC-1) interacts with a repeat element of the second
engineered nucleic acid (FIG. 5E, II; NASC-PC-2) through hydrogen
base-pair bonding, and a repeat element of the second engineered
nucleic acid (FIG. 5E, II) interacts with a repeat element of the
third engineered nucleic acid (FIG. 5E, III; NASC-PC-3) through
hydrogen base-pair bonding, and a repeat element of the third
engineered nucleic acid (FIG. 5E, III) interacts with a repeat
element of a fourth engineered nucleic acid (FIG. 5E, IV;
NASC-PC-4) through hydrogen base-pair bonding, and a repeat element
of the fourth engineered nucleic acid (FIG. 5E, IV) interacts with
a repeat element of the first engineered nucleic acid (FIG. 5E, I)
through hydrogen base-pair bonding.
[0173] FIG. 5F illustrates a modified version of the example shown
in FIG. 5D, wherein the loop element nucleic acid sequences (FIG.
5D, 502 to 503 and FIG. 5D, 513 to 512) are not present in the
first engineered nucleic acid sequence (FIG. 5F, VIII and FIG. 5F,
V), the second engineered nucleic acid sequence (FIG. 5G, VI), the
third engineered nucleic acid sequence (FIG. 5G, VI), and the
fourth engineered nucleic acid sequence (FIG. 5G, VII).
[0174] FIG. 5G presents an example of four engineered nucleic acids
forming a scaffold based on two sets of the two engineered nucleic
acids of FIG. 5F. In this FIG. 5G, V, and FIG. 5G, VIII, provide
points of reference to facilitate comparison to the two engineered
nucleic acids shown in FIG. 5F (i.e., FIG. 5F, V and VIII). FIG. 5G
illustrates a modified version of the example shown in FIG. 5F
wherein a repeat element of the first engineered nucleic acid (FIG.
5G, V; NASC-PC-1) interacts with a repeat element of the second
engineered nucleic acid (FIG. 5G, VI; NASC-PC-2) through hydrogen
base-pair bonding, and a repeat element of the second engineered
nucleic acid (FIG. 5G, VI; NASC-PC-2) interacts with a repeat
element of the third engineered nucleic acid (FIG. 5G, VII;
NASC-PC-3) through hydrogen base-pair bonding, and a repeat element
of the third engineered nucleic acid (FIG. 5G, VII) interacts with
a repeat element of a fourth engineered nucleic acid (FIG. 5G,
VIII; NASC-PC-4) through hydrogen base-pair bonding, and a repeat
element of the fourth engineered nucleic acid (FIG. 5G, VIII)
interacts with a repeat element of the first engineered nucleic
acid (FIG. 5G, V) through hydrogen base-pair bonding.
[0175] In other embodiments of the first aspect of the present
invention, a nucleoprotein complex can be formed by a nucleic acid
binding protein binding to a macromolecule comprising a nucleic
acid target binding sequence 1, a repeat nucleic acid sequence 1, a
repeat nucleic acid sequence 2, and a nucleic acid target binding
sequence 1 (e.g., FIG. 5H, FIG. 5I).
[0176] FIG. 5H illustrates a version of two engineered nucleic
acids forming a scaffold, wherein a Class 2 Type V CRISPR protein
binding site half stem sequence 1-1b (FIG. 5H, 520-502) of a first
engineered nucleic acid IX (FIG. 5H, 500 to 502; NASC-PC1) is
capable of hydrogen base-pair bonding with the complementary Class
2 Type V CRISPR protein binding site half stem sequence 2-1b (FIG.
5H, 514 to 521) of a second engineered nucleic acid X (FIG. 5H, 515
to 513; NASC-PC2), and wherein the Class 2 Type V CRISPR protein
binding site half stem sequence 1-1b of the first engineered
nucleic acid and the complementary Class 2 Type V CRISPR protein
binding site half stem sequence 2-1b of the second engineered
nucleic acid interact through hydrogen base-pair bonding. Sequence
variation between the half stem sequences that is sufficient to
provide sequence specific hybridization between specific pairs of
half stem sequences is possible because Class 2 Type V CRISPR
protein binding site recognition is tolerant of such sequence
variation, provided the secondary structure is maintained.
[0177] FIG. 5I illustrates a modified version of the example shown
in FIG. 5H, wherein a Class 2 Type V CRISPR protein binding site
half stem sequence of the first engineered nucleic acid (FIG. 5I,
IX) interacts with a Class 2 Type V CRISPR protein binding site
half stem sequence of the second engineered nucleic acid (FIG. 5I,
X); a Class 2 Type V CRISPR protein binding site half stem sequence
of the second engineered nucleic acid (FIG. 5I, X) interacts with a
Class 2 Type V CRISPR protein binding site half stem sequence of
the third engineered nucleic acid (FIG. 5I, XI); a Class 2 Type V
CRISPR protein binding site half stem sequence of the third
engineered nucleic acid (FIG. 5I, XI) interacts with a Class 2 Type
V CRISPR protein binding site half stem sequence of the fourth
engineered nucleic acid (FIG. 5I, XII); and a Class 2 Type V CRISPR
protein binding site half stem sequence of the fourth engineered
nucleic acid (FIG. 5I, XII) interacts with the Class 2 Type V
CRISPR protein binding site half stem sequence of the first
engineered nucleic acid (FIG. 5I, IX).
[0178] In a second aspect of the present invention, a NASC
polynucleotide composition comprises at least NASC-PC1 and
NASC-PC2. A NASC-PC1/NASC-PC2 complex comprises a repeat element 1
connected to a repeat element 2, a double-stranded nucleic acid
binding protein binding element 1 and a double-stranded nucleic
acid binding protein binding element 2, and a spacer element 1 and
a spacer element 2. Embodiments of the present invention include
NASC polynucleotide composition comprising double-stranded nucleic
acid binding protein binding elements corresponding to one or more
Class 2 CRISPR-Cas proteins.
[0179] In some embodiments, the NASC polynucleotide composition is
capable of associating with two Class 2 Type II CRISPR-Cas9
proteins to form a nucleoprotein complex. FIG. 6A, FIG. 6B, FIG.
6C, FIG. 6D, FIG. 6E, FIG. 6F, FIG. 6G, FIG. 6H, FIG. 6I, FIG. 6K,
FIG. 6L, and FIG. 6M illustrate elements and examples of engineered
nucleic acid scaffolds of the present invention typically
comprising a nucleic acid binding Class 2 CRISPR protein binding
sequence.
[0180] Table 4 presents a series of indicators used consistently in
FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D, FIG. 6E, FIG. 6F, and FIG.
6G.
TABLE-US-00004 TABLE 4 Numerical Indicators Used to Illustrate
Regions of Complexes of Two or More Engineered Nucleic Acid
Sequences for Forming a Scaffold Indicator and Corresponding Region
a first engineered nucleic acid component a first engineered
nucleic acid sequence (corresponds to 601-611) a nucleic acid
binding protein binding element 1 a double-stranded nucleic acid
binding protein binding element 1 601-602 corresponds a linker
element nucleic acid sequence 602-603 corresponds to a hairpin
nucleic acid sequence 1-2 603-604 corresponds to a linker element
nucleic acid sequence 604-605 corresponds to a hairpin nucleic acid
sequence 1-1 605-606 corresponds to a linker element nucleic acid
sequence 606-607 corresponds to a nexus element nucleic acid
sequence 1-1 607-608 corresponds to a linker element nucleic acid
sequence a repeat element 1.sup.1 608-609 corresponds to a repeat
nucleic acid sequence 1 608-623 corresponds to a linker element
nucleic acid sequence 1-1 623-624 corresponds to a repeat nucleic
acid sequence 1a 623-631 corresponds to a repeat nucleic acid
sequence 1a1 631-632 corresponds to a bulge nucleic acid sequence
1a1 632-624 corresponds to a repeat nucleic acid sequence 1a2
624-625 corresponds to a linker element nucleic acid sequence 1-2
624-647 corresponds to a linker element nucleic acid sequence 1-2-1
647-648 corresponds to a repeat nucleic acid sequence 1-2a 648-625
corresponds to a linker element nucleic acid sequence 1-2-2 625-626
corresponds to a repeat nucleic acid sequence 1b 625-633
corresponds to a repeat nucleic acid sequence 1b1 633-634
corresponds to a bulge nucleic acid sequence 1b1 634-626
corresponds to a repeat nucleic acid sequence 1b2 626-609
corresponds to a linker element nucleic acid sequence 1-3 609-610
corresponds to a linker element nucleic acid sequence a spacer
element 1 610-611 corresponds to a nucleic acid target binding
sequence 1 a second engineered nucleic acid component a second
engineered nucleic acid sequence (corresponds to 612-622) a nucleic
acid binding protein binding element 2 a double-stranded nucleic
acid binding protein binding element 2 612-613 corresponds a linker
element nucleic acid sequence 613-614 corresponds to a hairpin
nucleic acid sequence 2-2 614-615 corresponds to a linker element
nucleic acid sequence 615-616 corresponds to a hairpin nucleic acid
sequence 2-1 616-617 corresponds to a linker element nucleic acid
sequence 617-618 corresponds to a nexus element nucleic acid
sequence 2-1 618-619 corresponds to a linker element nucleic acid
sequence a repeat element 2 619-620 corresponds to a repeat nucleic
acid sequence 1C.sup.2 619-627 corresponds to a linker element
nucleic acid sequence 2-3 627-628 corresponds to a repeat nucleic
acid sequence 1bC 627-635 corresponds to a repeat nucleic acid
sequence 1b2C 635-636 corresponds to a bulge nucleic acid sequence
2b2 636-628 corresponds to a repeat nucleic acid sequence 1b1C
628-629 corresponds to a linker element nucleic acid sequence 2-2
628-649 corresponds to a linker element nucleic acid sequence 2-2-2
649-650 corresponds to a repeat nucleic acid sequence 1-2aC 650-629
corresponds to a linker element nucleic acid sequence 2-2-1 629-630
corresponds to a repeat nucleic acid sequence 1aC 629-637
corresponds to a repeat nucleic acid sequence 1a2C 637-638
corresponds to a bulge nucleic acid sequence 2a2 638-630
corresponds to a repeat nucleic acid sequence 1a1C 630-620
corresponds to a linker element nucleic acid sequence 2-1 620-621
corresponds to a linker element nucleic acid sequence a spacer
element 2 621-622 corresponds to a nucleic acid target binding
sequence 2 .sup.1= repeat element can include an effector protein
binding site .sup.2= "C" indicates a complementary sequence
[0181] Each of a first, a second and a third element can comprise
additional nucleic acid sequences, for example, 5' of the element,
3' of the element, or both 5' of the element and 3' of the
element.
[0182] Each of a first, a second and a third element can comprise
additional nucleic acid sequences, for example, 5' of the element,
3' of the element, or both 5' of the element and 3' of the
element.
[0183] FIG. 6A, 601-611, illustrates an example of first engineered
nucleic acid that comprises a first element comprising a Class 2
Type II CRISPR binding protein sequence (FIG. 6A, 601-607), a
second element comprising a repeat nucleic acid sequence 1 (FIG.
6A, 608-609), and a third element comprising a nucleic acid
sequence 1 (FIG. 6A, 610-611). No nucleic acid sequence within the
repeat nucleic acid sequence 1 associates with any nucleic acid
sequence within the repeat nucleic acid sequence 1 to form a stem
element through hydrogen bonding capable of binding to a Class 2
Type II CRISPR-Cas protein.
[0184] FIG. 6B illustrates a modification to FIG. 6A, wherein the
first engineered nucleic acid (FIG. 6B, 601-611) is associated with
the second engineered nucleic acid (FIG. 6B, 612-622) through
hydrogen base-pair bonding between the repeat nucleic acid sequence
1 (FIG. 6A, 608-609) and the repeat nucleic acid sequence 1C (FIG.
6A, 619-620).
[0185] A NASC polynucleotide composition similar to the composition
illustrated in FIG. 6B can be constructed for use with Class 2 Type
V CRISPR-Cas proteins to form a nucleoprotein complex. An example
of this type of NASC polynucleotide composition is illustrated in
FIG. 10, V.
[0186] FIG. 6C illustrates an example of a first engineered nucleic
acid, wherein the second element further comprises, in a 3' to 5'
orientation, a linker element nucleic acid sequence 1-1 (FIG. 6C,
608-623), a repeat nucleic acid sequence 1a (FIG. 6C, 623-624), a
linker element nucleic acid sequence 1-2 (FIG. 6C, 624-625), a
repeat nucleic acid sequence 1b (FIG. 6D, 625-626), and a linker
element nucleic acid sequence 1-3 (FIG. 6C, 626-609). No nucleic
acid sequence within the repeat nucleic acid sequence 1 associates
with any nucleic acid sequence within the repeat nucleic acid
sequence 1 to form a stem element through hydrogen bonding capable
of binding to a Class 2 Type II CRISPR-Cas protein.
[0187] FIG. 6D illustrates a modification to FIG. 6C in which two
engineered nucleic acids form a scaffold, wherein the first
engineered nucleic acid is associated with the second engineered
nucleic acid through hydrogen base-pair bonding between the repeat
nucleic acid sequence 1a (FIG. 6D, 623-624) and the repeat nucleic
acid sequence 1aC (FIG. 6D, 629-630) and through hydrogen base-pair
bonding between the repeat nucleic acid sequence 1b (FIG. 6D,
625-626) and the repeat nucleic acid sequence 1bC (FIG. 6D,
627-628).
[0188] FIG. 6E, illustrates an example of a first engineered
nucleic acid, wherein the second element further comprises, in a 3'
to 5' orientation, a linker element nucleic acid sequence 1-1 (FIG.
6C, 608-623), a repeat nucleic acid sequence 1a1 (FIG. 6C,
623-631), a bulge nucleic acid sequence (FIG. 6E, 631-632), a
repeat nucleic acid sequence 1a2 (FIG. 6E, 632-624), a linker
element nucleic acid sequence 1-2 (FIG. 6C, 624-625), a repeat
nucleic acid sequence 1b1 (FIG. 6D, 625-633), a bulge nucleic acid
sequence 1b1 (FIG. 6E, 633-634), and a repeat nucleic acids
sequence 1b2 (FIG. 6E, 634-626). No nucleic acid sequence within
the repeat nucleic acid sequence 1 associates with any nucleic acid
sequence within the repeat nucleic acid sequence 1 to form a stem
element through hydrogen bonding capable of binding to a Class 2
Type II CRISPR-Cas protein.
[0189] FIG. 6F illustrates a modification to FIG. 6E in which two
engineered nucleic acids form a scaffold, wherein the first
engineered nucleic acid is associated with the second engineered
nucleic acid through hydrogen base-pair bonding between the repeat
nucleic acid sequence 1a1 (FIG. 6F, 623-631) and the repeat nucleic
acid sequence 1a1C (FIG. 6F, 638-630), through hydrogen base-pair
bonding between the repeat nucleic acid sequence 1a2 (FIG. 6F,
632-624) and the repeat nucleic acid sequence 1a2C (FIG. 6F,
629-637), through hydrogen base-pair bonding between the repeat
nucleic acid sequence 1b1 (FIG. 6F, 625-633) and the repeat nucleic
acid sequence 1b1C (FIG. 6F, 636-628), and through hydrogen
base-pair bonding between the repeat nucleic acid sequence 1b2
(FIG. 6E, 634-626) and repeat nucleic acid sequence 1b2C (FIG. 6E,
627-635).
[0190] FIG. 6G is a variation of the NASC polynucleotide
composition illustrated in FIG. 6F. The linker element nucleic acid
sequence 1-2 is modified by insertion of an effector protein
binding site nucleic acid sequence 1 (FIG. 6G, 647-648) and the
linker element nucleic acid sequence 2-2 is modified by insertion
of an effector protein binding site nucleic acid sequence 2 (FIG.
6G, 649-650). The effector protein binding site nucleic acid
sequence 1 and the effector protein binding site nucleic acid
sequence 2 connect to form an effector protein binding site through
hydrogen-bonded base pairs. In one embodiment, the effector protein
binding site is a Csy4 binding site. An enzymatically inactive form
of the Csy4 protein can bind the site to further stabilize the NASC
polynucleotide composition structure. An enzymatically active form
of the Csy4 protein can bind the site to destabilize (e.g., through
endoribonuclease activity) the NASC polynucleotide composition
structure (e.g., to induce disruption of NASC polynucleotide
composition/nucleic acid binding proteins-based closed cage
structures). FIG. 6K illustrates a NASC polynucleotide composition
capable of associating with a first Class 2 Type II CRISPR-Cas9
ortholog protein and a second Class 2 Type II CRISPR-Cas9 ortholog
protein to form a nucleoprotein complex. FIG. 6K illustrates a NASC
polynucleotide composition comprising a NASC-PC1 and a NASC-PC2.
The NASC-PC1 (FIG. 6K, IX) comprises, in a 5' to 3' direction: a
nucleic acid target binding sequence 1; a linker nucleic acid
sequence 1 comprising, a repeat nucleic acid sequence 1a, a repeat
nucleic acid sequence 1b, a repeat nucleic acid 1c, and a repeat
nucleic acid 1d; and S. thermophilus Class 2 Type II CRISPR-Cas9
nucleic acid binding protein binding sequence 1. The NASC-PC2 (FIG.
6K, X) comprises, in a 5' to 3' direction: a nucleic acid target
binding sequence 2; a linker nucleic acid sequence 1 comprising, a
repeat nucleic acid sequence 1dC, a repeat nucleic acid sequence
1cC, a repeat nucleic acid 1bC, and a repeat nucleic acid sequence
1aC; and a S. pyogenes Class 2 Type II CRISPR-Cas9 nucleic acid
binding protein binding sequence 1. The NASC-PC1 and the NASC-PC2
connected through hydrogen-bonded base pairs between the repeat
nucleic acid sequence 1a/the repeat nucleic acid sequence 1aC, the
repeat nucleic acid sequence 1b/the repeat nucleic acid sequence
1bC, the repeat nucleic acid sequence 1c/the repeat nucleic acid
1cC, and the repeat nucleic acid sequence 1d/the repeat nucleic
acid 1dC to form a macromolecule. The macromolecule is capable of
binding a S. thermophilus Class 2 Type II CRISPR-Cas9 protein
(around the repeat nucleic acid sequence 1d/the repeat nucleic acid
sequence 1dC region and the repeat nucleic acid sequence 1c/the
repeat nucleic acid sequence 1cC region) and a S. pyogenes Class 2
Type II CRISPR-Cas9 protein (around the repeat nucleic acid
sequence 1b/the repeat nucleic acid sequence 1bC region, the repeat
nucleic acid sequence 1a/the repeat nucleic acid sequence 1aC
region). Use of such NASC polynucleotide composition/Cas9 ortholog
protein complexes provides, for example, an increased number of
available target sequences in view of PAM variability between the
Cas9 ortholog proteins (versus use of one guide nucleic acid/Cas9
protein complex comprising either Cas9 ortholog alone). Further,
NASC polynucleotide composition/Cas9 ortholog protein complexes may
improve specificity of targeting of a polynucleotide region by
providing greater flexibility in choosing nearby target sequences
in view of PAM variability between the Cas9 ortholog proteins
(versus use of one guide nucleic acid/Cas9 protein complex
comprising either Cas9 ortholog alone). In view of the teachings of
the present specification, one of ordinary skill in the art can
apply this use of two or more different Cas9 ortholog proteins by
combining different components of the NASC polynucleotide
compositions described herein.
[0191] In a further embodiment, the NASC-PC1 (FIG. 6K, IX) and
NASC-PC2 (FIG. 6K, X) are capable of associating with the same
Class 2 Type II CRISPR-Cas9 ortholog protein (see, e.g., Fonfara,
I., et al., Nucleic Acids Research 42(4):2577-2590 (2014)). In this
embodiment, the repeat nucleic acid sequence 1d/the repeat nucleic
acid sequence 1dC region, and the repeat nucleic acid sequence
1c/the repeat nucleic acid sequence 1cC region are capable of
associating with a S. mutans Class 2 Type II CRISPR-Cas9 protein
and are also capable of associating with a S. pyogenes Class 2 Type
II CRISPR-Cas9 protein. The repeat nucleic acid sequence 1b/the
repeat nucleic acid sequence 1bC region, and the repeat nucleic
acid sequence 1a/the repeat nucleic acid sequence 1aC region are
capable of associating with a S. pyogenes Class 2 Type II
CRISPR-Cas9 protein and are also capable of associating with a S.
mutans Class 2 Type II CRISPR-Cas9 protein. For example, although
the repeat regions of NASC-PC1 (FIG. 6K, IX) and the NASC-PC2 (FIG.
6K, X) are derived from different species containing Class 2 Type
II CRISPR loci (e.g., S. pyogenes or S. mutans), only one Class 2
Type II CRISPR-Cas9 protein (e.g., a S. pyogenes Class 2 Type II
CRISPR-Cas9 protein or a S. mutans Class 2 Type II CRISPR-Cas9
protein) is used to form a NASC polynucleotide composition/Cas9
complex. One advantage of this type of NASC polynucleotide
composition is the flexibility to use either of two Cas9 proteins
with the same NASC polynucleotide composition, and each of the Cas9
proteins recognize different PAM sequences. Thus, the number of
possible binding sites that can be targeted by the NASC
polynucleotide composition is increased.
[0192] In some embodiments of the second aspect of the present
invention, a NASC polynucleotide composition comprises at least
three polynucleotides, wherein the complex comprises a repeat
element 1 connected to a repeat element 1C, the repeat element 2
connected to a repeat element 2C, the repeat element 3 connected to
a repeat element 3C, a double-stranded nucleic acid binding protein
binding element 1 a spacer element 1, a spacer element 2, and a
spacer element 3, wherein the NASC polynucleotide composition is
capable of binding three nucleic acid binding proteins. In some
embodiments, the nucleic acid binding proteins are double-stranded
nucleic acid binding proteins. In preferred embodiments, the
nucleic acid binding proteins Class 2 CRISPR-Cas proteins.
[0193] Table 5 presents a series of additional indicators used in
FIG. 6H and FIG. 6I.
TABLE-US-00005 TABLE 5 Numerical Indicators Used to Illustrate
Regions of Complexes of Two or More Engineered Nucleic Acid
Sequences for Forming a Scaffold Indicator and Corresponding Region
a first engineered nucleic acid component (I) a first engineered
nucleic acid sequence a nucleic acid binding protein binding
element 1 a repeat element 1.sup.1 608-609 corresponds to a repeat
nucleic acid sequence 1 608-623 corresponds to a linker element
nucleic acid sequence 1-1 623-624 corresponds to a repeat nucleic
acid sequence 1a 624-625 corresponds to a linker element nucleic
acid sequence 1-2 625-626 corresponds to a repeat nucleic acid
sequence 1b 626-609 corresponds to a linker element nucleic acid
sequence 1-3 a spacer element 1 a second engineered nucleic acid
component (II) a second engineered nucleic acid sequence a nucleic
acid binding protein binding element 2 a repeat element 2 619-653
corresponds to a repeat nucleic acid sequence 2 619-627 corresponds
to a linker element nucleic acid sequence 2-3 627-628 corresponds
to a repeat nucleic acid sequence 1bC.sup.2 628-651 corresponds to
a linker element nucleic acid sequence 2-2 651-652 corresponds to a
repeat nucleic acid sequence 2a 652-653 corresponds to a linker
element nucleic acid sequence 2-4 a spacer element 2 a third
engineered nucleic acid component (III) a third engineered nucleic
acid sequence a nucleic acid binding protein binding element 3 a
repeat element 3 654-659 corresponds to a repeat nucleic acid
sequence 1 654-655 corresponds to a linker element nucleic acid
sequence 3-3 655-656 corresponds to a repeat nucleic acid sequence
2aC 656-657 corresponds to a linker element nucleic acid sequence
3-2 657-658 corresponds to a repeat nucleic acid sequence 1aC
658-659 corresponds to a linker element nucleic acid sequence 3-1 a
spacer element 3 .sup.1= repeat element can include an effector
protein binding site .sup.2= "C" indicates a complementary
sequence
[0194] FIG. 6H illustrates a modification to FIG. 6C where three
engineered nucleic acids form a scaffold, wherein a first
engineered nucleic acid (FIG. 6H, I) is associated with a second
engineered nucleic acid (FIG. 6H, II) through hydrogen base-pair
bonding between repeat nucleic acid sequence 1b (FIG. 6H, 625-626)
and repeat nucleic acid sequence 1bC (FIG. 6H, 627-628), and the
second engineered nucleic acid (FIG. 6H, II) is associated with the
third engineered nucleic acid (FIG. 6H, III) through hydrogen
base-pair bonding between repeat nucleic acid sequence 2a (FIG. 6H,
638-639) and repeat nucleic acid sequence 2aC (FIG. 6H, 642-643),
and the third engineered nucleic acid (FIG. 6H, III) is associated
with the first engineered nucleic acid (FIG. 6H, I) through
hydrogen base-pair bonding between repeat nucleic acid sequence 1aC
(FIG. 6H, 644-645) and repeat nucleic acid sequence 1a (FIG. 6H,
623-624).
[0195] FIG. 6I illustrates a modification to FIG. 6E where three
engineered nucleic acids form a scaffold using the engineered
nucleic acid described in FIG. 6E, wherein the first engineered
nucleic acid (FIG. 6I, IV) is associated with the second engineered
nucleic acid (FIG. 6I, V) through hydrogen base-pair bonding
between repeat sequences, and the second engineered nucleic acid
(FIG. 6I, V) is associated with the third engineered nucleic acid
(FIG. 6I, VI) through hydrogen base-pair bonding between repeat
sequences, and the third engineered nucleic acid (FIG. 6I, VI) is
associated with the first engineered nucleic acid (FIG. 6I, IV)
through hydrogen base-pair bonding between repeat sequences.
[0196] FIG. 6J illustrates a NASC polynucleotide composition
capable of associating with a Class 2 Type II CRISPR-Cas protein
and a Class 2 Type V CRISPR-Cpf1 protein to form a nucleoprotein
complex.
[0197] FIG. 6J illustrates a NASC polynucleotide composition
capable of associating with a Class 2 Type II CRISPR-Cas9 protein
and a Class 2 Type V CRISPR-Cpf1 protein to form a nucleoprotein
complex. FIG. 6J illustrates a NASC polynucleotide composition
comprising a NASC-PC1 comprising a spacer element 1 and a spacer
element 2 (NASC-PC-2TS; FIG. 6J, VII). The NASC-PC-2TS comprising,
in a 5' to 3' direction: a Class 2 Type II CRISPR-Cas9 nucleic acid
target binding sequence 1; a linker nucleic acid sequence 1
comprising a repeat nucleic acid sequence 1a, a repeat nucleic acid
sequence 1b, and a repeat nucleic acid sequence 1c; and a Class 2
Type V CRISPR-Cpf1 nucleic acid target binding sequence 1. The NASC
polynucleotide composition further comprises a NASC-PC2 comprising
a concatenate comprising a Class 2 Type II CRISPR-Cas9 nucleic acid
binding protein binding sequence 1 and a Class 2 Type V CRISPR-Cpf1
nucleic acid binding protein binding sequence 2 (NASC-PC-CE; FIG.
6J, VIII). The NASC-PC-CE further comprises a repeat nucleic acid
sequence 1aC, a repeat nucleic acid sequence 1bC, and a repeat
nucleic acid sequence 1cC through which the NASC-PC-CE is connected
to the NASC-PC-2TS through hydrogen-bonded base pairs to form a
macromolecule that is capable of binding a Class 2 Type II
CRISPR-Cas9 protein and a Class 2 Type V CRISPR-Cpf1 protein. Use
of such NASC polynucleotide composition/Cas9 protein/Cpf1 protein
complexes provides, for example, an increased number of available
target sequences in view of PAM variability and target sequence
length differences between the Cas9 protein and the Cpf1 protein
(versus use of one guide nucleic acid/Cas protein complex
comprising either Cas9 protein or Cpf1 protein alone). Furthermore,
NASC polynucleotide composition/Cas9 protein/Cpf1 protein complexes
may improve specificity of targeting of a polynucleotide region by
providing greater flexibility in choosing nearby target sequences
in view of PAM variability and target sequence lengths between the
Cas9 protein and the Cpf1 protein (versus use of one guide nucleic
acid/Cas protein complex comprising either Cas9 protein or Cpf1
protein alone). In view of the teachings of the present
specification, one of ordinary skill in the art can apply this use
of two or more different Cas proteins by combining different
components of the NASC polynucleotide compositions described
herein.
[0198] In other embodiments, a first repeat nucleic acid sequence
of a pair further comprises a first affinity tag and a second
repeat nucleic acid sequence of the pair further comprises a second
affinity tag, and the first affinity tag is connected with the
second affinity tag. For example, the repeat nucleic acid sequence
1 further comprises an effector protein binding site nucleic acid
sequence 1 and the repeat nucleic acid sequence 2 further comprises
an effector protein binding site nucleic acid sequence 2, and an
effector binding site 1 is formed by hydrogen base-pair bonding
between the effector protein binding site nucleic acid sequence 1
and the effector protein binding site nucleic acid sequence 2. One
example of an effector binding site is a Csy4 protein binding
site.
[0199] In a third aspect of the present invention, NASC
polynucleotide composition comprises an engineered concatenated
nucleic acid component ("NASC-PC-CT") and at least a NASC-PC1 and a
NASC-PC2.
[0200] In one embodiment of the third aspect of the present
invention, an engineered NASC polynucleotide concatenated element
(NASC-PC-CE) comprises, in a 3' to 5' direction: a first
concatenate element 1 comprising a nucleic acid binding protein
binding element 1, and a second concatenate element 1 comprising a
repeat element A1, wherein the repeat element A1 comprises a repeat
nucleic acid sequence A1; a first concatenate element 2 comprising
a nucleic acid binding protein binding element 2; and a second
concatenate element 2 comprising a repeat element 2, wherein the
repeat element 2 comprises a repeat nucleic acid sequence A2. The
first concatenate element 1 is connected to the second concatenate
element 1, the second concatenate element 1 is connected to the
first concatenate element 2, and the first concatenate element 2 is
connected to the second concatenate element 2 to form the
NASC-PC-CE.
[0201] A third concatenate element 1 (NASC-PC-CE3-1) comprises, in
a 3' to 5' direction a repeat element A1C comprising a repeat
nucleic acid sequence A1C, and a spacer element 1 comprising a
nucleic acid target binding sequence 1. A third concatenate element
2 (NASC-PC-CE3-2) comprises, in a 3' to 5' direction a repeat
element A2C comprising a repeat nucleic acid sequence A2C, and a
spacer element 2 comprising a nucleic acid target binding sequence
2. The repeat nucleic acid sequence A1 is connected with the repeat
nucleic acid sequence A1-C, the repeat nucleic acid sequence A2 is
connected with the repeat nucleic acid sequence A2-C to form the
NASC-PC-CE.
[0202] A first nucleic acid binding protein is capable of binding
the nucleic acid binding protein binding element 1 and a second
nucleic acid binding protein is capable of binding the nucleic acid
binding protein binding element 2. In some embodiments, the nucleic
acid binding protein binding element is a double-stranded nucleic
acid binding protein binding element that binds a double-stranded
nucleic acid binding protein.
[0203] In additional embodiments, a first repeat nucleic acid
sequence of a pair is connected with the second repeat nucleic acid
sequence of the pair through hydrogen-bonded base pairs.
[0204] FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F, FIG.
7G, FIG. 7H, and FIG. 7I, illustrate elements and examples of
engineered concatenated nucleic acid scaffolds of the present
invention.
[0205] Table 6 presents a series of indicators used consistently in
FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F, FIG. 7G, FIG.
7H, and FIG. 7I.
TABLE-US-00006 TABLE 6 Numerical Indicators Used to Illustrate
Regions of Complexes of Two or More Engineered Nucleic Acid
Sequences for Forming a Scaffold Indicator and Corresponding Region
an engineered NASC polynucleotide concatenated element
(corresponds- 700-717) (NASC-PC-CE) a first concatenate element 1
(NASC-PC-CE1-1) a nucleic acid binding protein binding element 1
700-701 corresponds to a linker element nucleic acid sequence 1-5
701-702 corresponds to a hairpin nucleic acid sequence 1-2 702-703
corresponds to a linker element nucleic acid sequence 1-4 703-704
corresponds to a hairpin nucleic acid sequence 1-1 704-705
corresponds to a linker element nucleic acid sequence 1-3 705-706
corresponds to a nexus element 1 706-707 corresponds to a linker
element nucleic acid sequence 1-2 a second concatenate element 1
(NASC-PC-CE1-2) a repeat element A1.sup.1 707-708 corresponds to a
repeat nucleic acid sequence A1 707-728 corresponds to a linker
element nucleic acid sequence A1-1 707-726 corresponds to a linker
element nucleic acid sequence A1-4 726-727 corresponds to a repeat
nucleic acid sequence A1-1 727-728 corresponds to a bulge nucleic
acid sequence A1-1 728-708 corresponds to a linker element nucleic
acid sequence A1-2 728-729 corresponds to a repeat nucleic acid
sequence A1-2 729-730 corresponds to a linker element nucleic acid
sequence A1-3 730-708 corresponds to a linker nucleic sequence A1-4
that can comprise an effector protein binding site nucleic acid
sequence A1 708-709 corresponds to a linker element nucleic acid
sequence A1 a first concatenate element 2 (NASC-PC-CE-1-2) a
nucleic acid binding protein binding element 2 (NASC-PC-CE2)
709-710 corresponds to a linker element nucleic acid sequence 2-5
709-710 corresponds to a linker element nucleic acid sequence 2-5
710-711 corresponds to a hairpin nucleic acid sequence 2-1 711-712
corresponds to a linker element nucleic acid sequence 2-4 712-713
corresponds to a linker element nucleic acid sequence 2-3 713-714
corresponds to a nexus element 2 714-715 corresponds to a linker
element nucleic acid sequence 2-2 a second concatenate element 2
(NASC-PC-CE2-2) a repeat element A2 715-716 corresponds to a repeat
nucleic acid sequence A2 715-731 corresponds to a linker element
nucleic acid sequence A2-4 715-733 corresponds to a linker element
nucleic acid sequence A2-1 731-732 corresponds to a repeat nucleic
acid sequence A2-1 732-733 corresponds to a bulge nucleic acid
sequence A2-1 733-716 corresponds to a linker element nucleic acid
sequence A2-2 733-734 corresponds to a repeat nucleic acid sequence
A2-2 734-735 corresponds to a linker element nucleic acid A2-3
716-735 corresponds to a linker nucleic sequence A2-4 that can
comprise an effector protein binding site nucleic acid sequence A2
716-717 corresponds to linker element nucleic acid sequence A2 a
third concatenate element 1 (NASC-PC-CE3-1) a repeat element
A1C.sup.2 718-719 corresponds to a repeat nucleic acid sequence A1C
719-737 corresponds to a linker element nucleic acid sequence A1-1n
719-736 corresponds to a repeat nucleic acid sequence A1-1C.sup.2
736-737 corresponds to a bulge nucleic acid sequence A1-1n.sup.3
737-718 corresponds to a linker element nucleic acid sequence A1-2n
737-748 corresponds to a repeat nucleic acid sequence A1-2C 738-748
corresponds to a linker element nucleic acid A1-3n 738-718
corresponds to a linker nucleic sequence A1-4n that can comprise an
effector protein binding site nucleic acid sequence A1C 719-720
corresponds to a linker element nucleic acid sequence A1-4n a
spacer element 1 720-721 corresponds a nucleic acid target binding
sequence 1 a third concatenate element 2 (NASC-PC-CE3-2) a repeat
element A2C 722-723 corresponds to a repeat nucleic acid sequence
A2-1C2 723-740 corresponds to a linker element nucleic acid
sequence A2-1n 723-739 corresponds to a repeat nucleic acid
sequence A2-1C 739-740 corresponds to a bulge nucleic acid sequence
A2-1n 722-740 corresponds to a linker element nucleic acid sequence
A2-2n 740-741 corresponds to a repeat nucleic acid sequence A2-2C
741-749 corresponds to a a linker element nucleic acid A2-3n
749-722 corresponds to a linker nucleic sequence A2-4 that can
comprise an effector protein binding site nucleic acid sequence A2C
723-724 corresponds to a linker element nucleic acid sequence A2-4n
a spacer element 2 724-725 corresponds to a nucleic acid target
binding sequence 2 .sup.1= repeat element can include an effector
protein binding site .sup.2= "C" indicates a complementary sequence
.sup.3= "n" indicates an opposite strand sequence (e.g.,
A2-1/A2-1n)
[0206] Each of a first, a second and a third element can comprise
additional nucleic acid sequences, for example, 5' of the element,
3' of the element, or both 5' of the element and 3' of the
element.
[0207] FIG. 7A, 700-717, illustrates an example of a NASC-PC-CE
that comprises a first concatenate element 1 comprising a Class 2
Type II CRISPR binding protein sequence (FIG. 7A, 700-706), a
second concatenate element 1 (FIG. 7A, 707-708) comprising a repeat
nucleic acid sequence A1, a first concatenate element 2 (FIG. 7A,
709-714) comprising a Class 2 Type II CRISPR binding protein
sequence (FIG. 7A, 710-714), a second concatenate element 2 (FIG.
7A, 715-717) comprising a repeat nucleic acid sequence A2 (FIG. 7A,
715-716), and a third concatenate element 1 (NASC-PC-CE3-1; FIG.
7A, 718-721) comprising a repeat nucleic acid sequence A1C (FIG.
7A, 718-719) and a nucleic acid target binding sequence 1 (FIG. 7A,
720-721), and a third concatenate element 2 (NASC-PC-CE3-2; FIG.
7A, 722-725) comprising a repeat nucleic acid sequence A2C (FIG.
7A, 722-723) and a nucleic acid target binding sequence 2 (FIG. 7A,
724-725). One or more of the repeat nucleic acid sequences is a
Class II Type II CRISPR protein binding sequence (e.g., a Cas9
protein binding sequence). Repeat nucleic acid sequence A1 is
connected to repeat nucleic acid sequence A1C. In one embodiment,
repeat nucleic acid sequence A1 is connected through
hydrogen-bonded base pairs to repeat nucleic acid sequence.
[0208] FIG. 7B illustrates an example of the formation of a
scaffold through association of the NASC-PC-CE (FIG. 7A, 700-717)
with the third concatenate element 1 (FIG. 7A, 718-721) through
hydrogen base-pair bonding between repeat nucleic acid sequence A1
(FIG. 7A, 707-708) and repeat nucleic acid sequence A1C (FIG. 7A,
718-719), and the association of the NASC-PC-CE (FIG. 7A, 700-717)
with the third concatenate element 2 (FIG. 7A, 722-725) through
hydrogen base-pair bonding between repeat nucleic acid sequence A2
(FIG. 7A, 715-716) and repeat nucleic acid sequence A2C (FIG. 7A,
722-723).
[0209] FIG. 7C illustrates a modification of a NASC-PC-CE wherein
the NASC-PC-CE (FIG. 7A, 700-717) further comprises a repeat
nucleic acid sequence A1-1 (FIG. 7C, 726-727), a bulge nucleic acid
sequence A1-1 (FIG. 7C, 727-728), a repeat nucleic acid sequence
A1-2 (FIG. 7C, 728-729) and a repeat nucleic acid sequence A2-1
(FIG. 7C, 731-732), a bulge nucleic acid sequence A2-1 (FIG. 7C,
732-733), and a repeat nucleic acid sequence A2-2 (FIG. 7C,
733-734). The third concatenate element 1 (FIG. 7C, 718-721)
further comprises a repeat nucleic acid sequence A1-1C (FIG. 7C,
719-736), a bulge nucleic acid sequence A1-1 (FIG. 7C, 736-737),
and a repeat nucleic acid sequence A1-2C (FIG. 7C, 737-748). The
third concatenate element 2 (FIG. 7C, 722-725) further comprises a
repeat nucleic acid sequence A2-1C (FIG. 7C, 723-739), a bulge
nucleic acid sequence A2-1 (FIG. 7C, 739-740), and a repeat nucleic
acid sequence A2-2C (FIG. 7C, 740-741).
[0210] FIG. 7D illustrates an example of the formation of a
scaffold through association of the NASC-PC-CE (FIG. 7D, 700-717)
with the third concatenate element 1 (FIG. 7D, 721-718) through
hydrogen base-pair bonding between: repeat nucleic acid sequence
A1-1 (FIG. 7C, 726-727) and repeat nucleic acid sequence A1-1C
(FIG. 7C, 719-736), and hydrogen base-pair bonding between repeat
nucleic acid sequence A1-2 (FIG. 7C, 728-729) and repeat nucleic
acid sequence A1-2C (FIG. 7C, 737-748); association of the
engineered concatenated element 1 (FIG. 7D, 700-717) with the third
concatenate element 2 (FIG. 7C, 722-725) through hydrogen base-pair
bonding between repeat nucleic acid sequence A2-1 (FIG. 7C,
731-732) and repeat nucleic acid sequence A2-1C (FIG. 7C, 723-739),
and through hydrogen base-pair bonding between repeat nucleic acid
sequence A2-2 (FIG. 7C, 733-734) and repeat nucleic acid sequence
A2-2C (FIG. 7C, 740-741).
[0211] FIG. 7E presents an example of a complex formed from four
engineered nucleic acid sequences to make a scaffold comprising a
circular NASC-PC-CE. In this figure, the NASC-PC-CE comprises two
copies of the NASC-PC-CE shown in FIG. 7D, 700-717 that are joined
5' end to 3' end to form the circular NASC-PC-CE. In this figure,
reference numbers relative to FIG. 7D are shown to help illustrate
the components of the circular concatenated nucleic acid
element.
[0212] FIG. 7F is an illustration of a modification to the example
shown in FIG. 7D, wherein the NASC-PC-CE (FIG. 7F, 700-717) further
comprises a first concatenate element 3 (FIG. 7F, 717-744)
covalently linked to the 5' end (FIG. 7F, 700-744). A second
concatenate element 3 is associated with the first concatenate
element 3 (FIG. 7F, 743-744).
[0213] FIG. 7G illustrates an example of a modification to the
NASC-PC-CE (FIG. 7F, 700-744) depicted in FIG. 7F, wherein the
NASC-PC-CE comprises a fourth concatenate element (FIG. 7G,
744-747) covalently linked to the 5' end (FIG. 7F, 700-747). In
this figure, the region, FIG. 7G, 744-745, is illustrated as a
white box to make the cross-over lines in FIG. 7H and FIG. 7I more
apparent. This region can also comprise a linker element nucleic
acid sequence.
[0214] FIG. 7H, 700-747, illustrate an example of a NASC-PC-CE,
wherein the second concatenate element 1 (FIG. 7H, 707-708) is
associated with the third concatenate element 1 (FIG. 7H, 744-747)
through hydrogen base-pair bonding.
[0215] FIG. 7I illustrates a modification to the example shown in
FIG. 7H, wherein a third concatenated element I associates with the
NASC-PC-CE though hydrogen base-pair bonding to form element III
(FIG. 7I, III) and a fourth concatenate element associates with the
NASC-PC-CE though hydrogen base-pair bonding to form element IV
(FIG. 7I, IV).
[0216] In other embodiments of the third aspect of the present
invention, the NASC-PC-CE comprises split-nexus
polynucleotides.
[0217] FIG. 8A, FIG. 8B, FIG. 8C, FIG. 8D, FIG. 8E, FIG. 8F, FIG.
8G, FIG. 8H, FIG. 8I, FIG. 8J, FIG. 8K, FIG. 8L, FIG. 8M, and FIG.
8N illustrate elements and examples of engineered concatenated
split-nexus nucleic acid scaffolds of the present invention.
[0218] Table 7 presents a series of indicators used consistently in
FIG. 8A through 8N.
TABLE-US-00007 TABLE 7 Numerical Indicators Used to Illustrate
Regions of Complexes of Two or More Engineered Nucleic Acid
Sequences for Forming a Scaffold Indicator and Corresponding Region
an engineered NASC split-nexus polynucleotide concatenated element
(corresponds to 800-835) (NASC-PC-SCE) a first concatenate element
1 (NASC-PC-SCE1-1) a nucleic acid binding protein binding element 1
800-801 corresponds to a nucleic acid binding protein binding
nucleic acid 1 801-802 corresponds to a split-nexus stem element
nucleic acid sequence 1-1 a repeat element 1-1.sup.1 802-816
corresponds an auxiliary polynucleotide 1-1 802-815 corresponds to
a repeat nucleic acid sequence 1-1 814-815 corresponds to a
double-stranded nucleic acid binding effector protein binding site
nucleic acid sequence 1 a second concatenate element 1
(NASC-PC-SCE1-2) a nucleic acid binding protein binding element 2
816-820 corresponds to a nucleic acid binding protein binding
nucleic acid 2 820-821 corresponds to a split-nexus stem element
nucleic acid sequence 2-1 a repeat element 2-1 821-835 corresponds
an auxiliary polynucleotide 2-1 821-834 corresponds to a repeat
nucleic acid sequence 2-1 833-834 corresponds to a double-stranded
nucleic acid binding effector protein binding site nucleic acid
sequence 2 a second concatenate element 1 (NASC-PC-SCE2-1) a repeat
element 1 808-807 corresponds to a first stem element nucleic acid
sequence 1-1 808-810 corresponds to a lower stem element nucleic
acid sequence 1-1 810-811 corresponds to a bulge element nucleic
acid sequence 1-1 811-807 corresponds to an upper stem element
nucleic acid sequence 1-1 807-806 corresponds to a loop element
nucleic acid sequence 1 806-805 corresponds to a first stem element
nucleic acid sequence 1-2 806-812 corresponds to an upper stem
element nucleic acid sequence 1-2 812-813 corresponds to a bulge
element nucleic acid sequence 1-2 813-805 corresponds to a lower
stem element nucleic acid sequence 1-2 805-804 corresponds to a
connective nucleic acid sequence 1 [805-806/808-807 corresponds a
first stem element 1] [811-807/806-812 corresponds to an upper stem
element 1] [810-811/812-813 corresponds to a bulge element 1]
[808-810/813-805 corresponds to a lower stem element 1] 804-803
corresponds to a split-nexus stem element nucleic acid sequence 1-2
[803-804/801-802 corresponds to a nexus element 1] 803-817
corresponds to an auxiliary polynucleotide 1-2 803-818 corresponds
to a repeat nucleic acid sequence 1-2 (in some embodiments
complementary to the repeat nucleic acid sequence 1-1) 818-819
corresponds to a double-stranded nucleic acid binding effector
protein binding site nucleic acid sequence 1C.sup.2 [the site
814-815/818-819 corresponds to a double-stranded nucleic acid
binding effector protein binding site 1] a spacer element 1 808-809
corresponds to a nucleic acid target binding sequence 1 a second
concatenate element 1 (NASC-PC-SCE2--2) a repeat element 2 827-826
corresponds to a first stem element nucleic acid sequence 2-1
832-827 corresponds to a lower stem element nucleic acid sequence
2-1 831-832 corresponds to a bulge element nucleic acid sequence
2-1 831-826 corresponds to an upper stem element nucleic acid
sequence 2-1 825-826 corresponds to a loop element nucleic acid
sequence 2 824-825 corresponds to a first stem element nucleic acid
sequence 2-2 825-830 corresponds to an upper stem element nucleic
acid sequence 2-2 829-830 corresponds to a bulge element nucleic
acid sequence 2-2 829-824 corresponds to a lower stem element
nucleic acid sequence 2-2 823-824 corresponds to a connective
nucleic acid sequence 2 [826-827/824-825 corresponds a first stem
element 2] [826-831/825-830 corresponds to an upper stem element 2]
[831-832/829-830 corresponds to a bulge element 2] [827-832/824-829
corresponds to a lower stem element 2] 822-823 corresponds to a
split-nexus stem element nucleic acid sequence 2-2 [822-823/820-821
corresponds to a nexus element 2] 822-836 corresponds to an
auxiliary polynucleotide 2-2 822-837 corresponds to a repeat
nucleic acid sequence 2-2 (in some embodiments complementary to the
repeat nucleic acid sequence 2-1) 837-838 corresponds to a
double-stranded nucleic acid binding effector protein binding site
nucleic acid sequence 2C [the site 837-838/833-834 corresponds to a
double-stranded nucleic acid binding effector protein binding site
2] a spacer element 2 827-828 corresponds to a nucleic acid target
binding sequence 2 .sup.1= a repeat element can include an effector
protein binding site .sup.2= "C" indicates a complementary
sequence
[0219] FIG. 8A illustrates an example of split-nexus
Cas9-associated polynucleotides. FIG. 2B presents an example of a
Cas9-associated single-guide polynucleotide. The split-nexus
Cas9-associated polynucleotides of FIG. 8A are generated by
splitting the polynucleotide backbone within the nexus element
(FIG. 2B, 206) of a Cas9-associated single-guide polynucleotide.
FIG. 8A shows the two resulting split-nexus polynucleotides when
not associated through hydrogen bond interactions. FIG. 8B presents
a view of the split-nexus polynucleotides when associated through
hydrogen bond interactions. The region of the hydrogen bond
interactions is illustrated by a broken-dash box in FIG. 8B.
[0220] FIG. 8C illustrates another example of split-nexus
Cas9-associated polynucleotides. FIG. 2A presents an example of a
Cas9-associated single-guide polynucleotide. The split-nexus
Cas9-associated polynucleotides of FIG. 8C are generated by
splitting the polynucleotide backbone within the nexus element
(FIG. 2A, 206) of a Cas9-associated single-guide polynucleotide.
FIG. 8C shows the two resulting split-nexus polynucleotides when
not associated through hydrogen bond interactions. FIG. 8D presents
a view of the split-nexus polynucleotides when associated through
hydrogen bond interactions. The region of the hydrogen bond
interactions is illustrated by a broken-dash box in FIG. 8D.
[0221] FIG. 8E illustrates the addition of an auxiliary
polynucleotide to the split-nexus Cas9-associated polynucleotide
illustrated in FIG. 8A. In this figure, the 5' end of a first
auxiliary polynucleotide (FIG. 8E, 803-817) is covalently attached
to the 3' end of one half of the split-nexus element (FIG. 8E, 803)
and the 3' end of a second auxiliary polynucleotide (FIG. 8E,
802-816) is covalently attached to the 5' end of the other half of
the split-nexus element (FIG. 8E, 802). In some embodiments, only
one auxiliary polynucleotide is included. In other embodiments, two
auxiliary polynucleotides of the same or different lengths are
included. FIG. 8E shows the two split-nexus polynucleotides when
not associated through hydrogen bond interactions.
[0222] FIG. 8F presents a view of the split-nexus polynucleotides
when associated through hydrogen bond interactions. The region of
the hydrogen bond interactions is illustrated by the broken-dash
box at FIG. 8D, 803-804/801-802. An auxiliary polynucleotide can
comprise additional elements such as effector protein binding
sequences, for example, a double-stranded nucleic acid binding
protein binding site can be created by the association of two
auxiliary polynucleotides through hydrogen bond interactions (e.g.,
such region of the hydrogen bond interactions is illustrated by the
broken-dash box at FIG. 8D, 818-819-804/814-815).
[0223] FIG. 8G illustrates another example of the addition of an
auxiliary polynucleotide to the split-nexus Cas9-associated
polynucleotide illustrated in FIG. 8C. In this figure, the 5' end
of a first auxiliary polynucleotide (FIG. 8G, 803-817) is
covalently attached to the 3' end of one half of the split-nexus
element (FIG. 8E, 803) and the 3' end of a second auxiliary
polynucleotide (FIG. 8G, 802-816) is covalently attached to the 5'
end of the other half of the split-nexus element (FIG. 8G, 802). In
some embodiments, only one auxiliary polynucleotide is included. In
other embodiments, two auxiliary polynucleotides of the same or
different lengths are included. FIG. 8G shows the two split-nexus
polynucleotides when not associated through hydrogen bond
interactions. FIG. 8H presents a view of the split-nexus
polynucleotides when associated through hydrogen bond interactions.
The region of the hydrogen bond interactions is illustrated by the
broken-dash box at FIG. 8H, 803-804/801-802. An auxiliary
polynucleotide can comprise additional elements such as effector
protein binding sequences, for example, a double-stranded nucleic
acid binding protein binding site can be created by the association
of two auxiliary polynucleotides through hydrogen bond interactions
(e.g., such region of the hydrogen bond interactions is illustrated
by the broken-dash box at FIG. 8H, 818-819-804/814-815).
[0224] In one embodiment, the third aspect of the present invention
is directed to an engineered NASC split-nexus polynucleotide
concatenated element (NASC-PC-SCE) polynucleotide composition
comprising, in a 3' to 5' direction, a first concatenate element 1
(NASC-PC-SCE1-1) comprising a nucleic acid binding protein binding
element 1, a split-nexus stem element nucleic acid sequence 1-1,
and a repeat element comprising a repeat nucleic acid sequence 1-1,
and a second concatenate element 1 (NASC-PC-SCE1-2) comprising a
nucleic acid binding protein binding element 2, a split-nexus stem
element nucleic acid sequence 2-1, and a repeat element comprising
a repeat nucleic acid sequence 2-1. The NASC-PC-SCE1-1 and the
NASC-PC-SCE1-2 are connected to form the NASC-PC-SCE. A second
concatenate element 1 (NASC-PC-SCE2-1) comprises a repeat element 1
comprising, in a 3' to 5' direction, a repeat nucleic acid sequence
1-2, a split-nexus stem element nucleic acid sequence 1-2, and a
first stem element, and a spacer element 1 comprising a nucleic
acid target binding sequence 1. A second concatenate element 2
(NASC-PC-SCE2-2) comprises a repeat element 2 comprising, in a 3'
to 5' direction, a repeat nucleic acid sequence 2-2, a split-nexus
stem element nucleic acid sequence 2-2, and a first stem element,
and a spacer element 2 comprising a nucleic acid target binding
sequence 2.
[0225] The repeat element 1-1 is connected to the repeat element
1-2, and the repeat element 2-1 is connected to the repeat element
2-2 to form the NASC-PC-SCE, and the NASC-PC-SCE is capable of
binding two nucleic acid binding proteins. In some embodiments, the
nucleic acid binding protein binding element is a double-stranded
nucleic acid binding protein binding element that binds a
double-stranded nucleic acid binding protein. In additional
embodiments, a first repeat nucleic acid sequence of a pair is
connected with the second repeat nucleic acid sequence of the pair
through hydrogen-bonded base pairs.
[0226] FIG. 8I presents an example of a NASC-PC-SCE comprising two
copies of the split-nexus polynucleotide shown in FIG. 8B, 800-802
forming a scaffold. In this figure, the NASC-PC-SCE is a first
split-nexus polynucleotide (FIG. 8I, 800-802) covalently attached
to a second split-nexus polynucleotide (FIG. 8I, 816-821) through
an auxiliary polynucleotide (FIG. 8I, 802-816). Each first half of
a split-nexus element (FIG. 8I, 801-802 and 820-821) is connected
with the complementary second half of its split-nexus element (FIG.
8I, 803-804, and 822-823, respectively), for example, through
hydrogen-bonded base pairs.
[0227] FIG. 8J presents an example of a NASC-PC-SCE comprising two
copies of the split-nexus polynucleotide shown in FIG. 8D, 800-802
forming a scaffold. In this figure, the NASC-PC-SCE is a first
split-nexus polynucleotide (FIG. 8J, 800-802) covalently attached
to a second split-nexus polynucleotide (FIG. 8J, 816-821) through
an auxiliary polynucleotide (FIG. 8J, 802-816). Each first half of
a split-nexus element (FIG. 8J, 801-802 and 820-821) is connected
with the complementary second half of its split-nexus element (FIG.
8J, 803-804, and 822-823, respectively), for example, through
hydrogen-bonded base pairs.
[0228] FIG. 8K presents an example of a NASC-PC-SCE comprising two
copies of the split-nexus polynucleotide shown in FIG. 8F, 800-816,
each comprising an auxiliary sequence, forming a scaffold. In this
figure, the NASC-PC-SCE is a first split-nexus polynucleotide (FIG.
8K, 800-816) covalently attached to a second split-nexus
polynucleotide (FIG. 8J, 816-835) through an auxiliary
polynucleotide (FIG. 8J, 802-816). Each first half of a split-nexus
element (FIG. 8K, 801-802 and 820-821) is connected with the
complementary second half of its split-nexus element (FIG. 8K,
803-804, and 822-823, respectively) and is also connected by the
auxiliary sequences (FIG. 8K, 802-815 and 803-818; FIG. 8K, 821-834
and 822-836). The connections are made, for example, through
hydrogen-bonded base pairs.
[0229] FIG. 8L presents an example of a NASC-PC-SCE comprising two
copies of the split-nexus polynucleotide shown in FIG. 8H, 800-816,
each comprising an auxiliary sequence, forming a scaffold. In this
figure, the NASC-PC-SCE is a first split-nexus polynucleotide (FIG.
8H, 800-816) covalently attached to a second split-nexus
polynucleotide (FIG. 8H, 816-835) through an auxiliary
polynucleotide (FIG. 8H, 802-816). Each first half of a split-nexus
element (FIG. 8H, 801-802 and 820-821) is connected with the
complementary second half of its split-nexus element (FIG. 8H,
803-804, and 822-823, respectively) and is also connected by the
auxiliary sequences (FIG. 8H, 802-815 and 803-818; FIG. 8K, 821-834
and 822-836). The connections are made, for example, through
hydrogen-bonded base pairs. The two components of the NASC-PC-SCE
are indicated in this figure as I and II.
[0230] FIG. 8M presents an example of a NASC-PC-SCE comprising
elements I and II as shown in FIG. 8L. NASC-PC-SCE comprises a
circular NASC-PC-SCE. In this figure, two sets of elements I and
II, shown in FIG. 8L, 800-835, are joined 5' end to 3' end to form
the circular NASC-PC-SCE. In this figure, reference numbers
relative to FIG. 8L are shown to help illustrate the components of
the circular NASC-PC-SCE.
[0231] FIG. 8N presents an example of a NASC-PC-SCE comprising
elements I and II as shown in FIG. 8L, with the exception that the
first stem element nucleic acid sequences are not joined by loop
element nucleic acid sequences (see, e.g., FIG. 8L, 806-807,
825-826). NASC-PC-SCE comprises a circular NASC-PC-SCE.
[0232] In other embodiments, a first repeat nucleic acid sequence
of a pair further comprises first affinity tag and the second
repeat nucleic acid sequence of the pair further comprises a second
affinity tag, and the first affinity tag is connected with the
second affinity tag. For example, the first repeat nucleic acid
sequence further comprises an effector protein binding site nucleic
acid sequence 1 and the second repeat nucleic acid sequence further
comprises an effector protein binding site nucleic acid sequence 2.
The effector protein binding site nucleic acid sequence 1 is
connected by hydrogen-bonded base pairs to the effector protein
binding site nucleic acid sequence 2 to form an effector protein
binding site 1. One example of an effector binding site is a Csy4
protein binding site.
[0233] In a fourth aspect of the present invention, a NASC
polynucleotide composition comprises a combination of nucleic acid
binding protein binding elements for two or more different nucleic
acid binding proteins. In some embodiments, one or more of the
nucleic acid binding protein binding elements is a double-stranded
nucleic acid binding protein binding element that binds a
double-stranded nucleic acid binding protein (e.g., a Class 2
CRISPR-Cas protein). Embodiments of the fourth aspect of the
present invention include a first NATNA covalently connected to a
second NATNA to form a NASC polynucleotide composition. In some
embodiments, a first NATNA covalently is connected to a second
NATNA to form a NASC-PC component and two or more NASC-PC
components are connected either covalently or non-covalently to
form a NASC polynucleotide composition. The NASC polynucleotide
composition is capable of binding at least two nucleic acid binding
proteins. Non-covalent connections include connecting the NASC-PC
components through hydrogen-bonded base pairs.
[0234] FIG. 9A presents an example of two NATNAs joined to form a
NASC polynucleotide composition comprising (i) a copy of the
engineered nucleic acid sequence shown in FIG. 5D, I, 500-507 (FIG.
9A, I), and (ii) a copy of an engineered nucleic acid sequence
corresponding to the single-guide polynucleotide shown in FIG. 2A
further comprising a linker element nucleic acid sequence
covalently attached to the 3' end of the single-guide
polynucleotide (FIG. 9A, II), wherein the linker element nucleic
acid sequence is covalently attached to the 5' end of the
engineered nucleic acid sequence shown in FIG. 5D, I, 500-507,
forming a scaffold.
[0235] FIG. 9B presents an example of a complex of two sets of the
components shown in FIG. 9A. In this figure, reference numbers
relative to FIG. 9A, I and II, are shown to help illustrate the
components. Furthermore, FIG. 9A, III, is provided to facilitate
comparison of the core structure of the complex of FIG. 9A to the
complex presented in FIG. 5D.
[0236] FIG. 10 presents a complex of a number of different
engineered nucleic acid sequences forming a scaffold. In this
figure, reference numbers are provided to help illustrate the
components of the scaffold: FIG. 10, I, compare to FIG. 7F; FIG.
10, II, compare to FIG. 6H; FIG. 10, III, compare to FIG. 8L; and
FIG. 10, IV, compare to FIG. 9A, wherein I and II are connected
through hydrogen-bonded base pairs instead of a covalent
connection; and FIG. 10, V compare to FIG. 5H.
[0237] The types of connections between one or more polynucleotide
components of a NASC polynucleotide composition include, for
example, covalent linkages and non-covalent linkages.
[0238] One example of a non-covalent linkage is hydrogen bonding.
Types of hydrogen bonds are discussed above. Embodiments of the
present invention include, but are not limited to, the following
types of hydrogen bonds in pairs of hydrogen-bonded nucleotides:
W--C hydrogen bonding, reverse W--C hydrogen bonding, Hoogsteen
hydrogen bonding, reverse Hoogsteen hydrogen bonding, wobble
hydrogen bonding, reverse wobble hydrogen bonding, or combinations
thereof.
[0239] NASC polynucleotide components are typically designed such
that paired repeat elements intended to connect with each other,
particularly if the connection is through hydrogen-bonded base
pairs, and only form connections (e.g., hydrogen bonds) between the
paired repeat elements. Formation of internal structures within
each repeat element that interfere with the two repeat elements
connecting typically avoided. Furthermore, connections (e.g.,
formation of hydrogen-bonded base pairs) between the repeat
elements and other regions of component NASC polynucleotides are
also avoided.
[0240] In addition to covalent linkages and non-covalent linkages,
other types of connections between one or more polynucleotide
components of a NASC polynucleotide composition can be used
including, but not limited to, ligand/ligand binding moiety
pairings, and/or cross-linking. Ligand/ligand binding moiety
pairings include, but are not limited to, a selected nucleic acid
sequence and a corresponding aptamer; and a nucleic acid secondary
structure/a small molecule, ion, or protein that binds to the
nucleic acid secondary structure. Typically, a first polynucleotide
component of a NASC polynucleotide composition is adapted to
comprise a ligand (e.g., the first polynucleotide component of a
NASC polynucleotide composition comprises at its 3' end a selected
nucleic acid sequence) and a second polynucleotide component of the
NASC polynucleotide composition is adapted to comprise a ligand
binding moiety (e.g., the second polynucleotide component of the
NASC polynucleotide composition comprises an aptamer at its 5' end
that binds the selected nucleic acid sequence).
[0241] Cross-linking agents useful to form connections between one
or more polynucleotide components of a NASC polynucleotide
composition include, but are not limited to, alkylating agents
(e.g., 1,3-bis(2-chloroethyl)-1-nitrosourea) and nitrogen mustard);
cisplatin (cis-diamminedichloroplatinum(II)) and its derivatives);
ionizing radiation; nitrous acid; reactive chemicals (e.g.,
malondialdehyde); psoralens (activated in the presence of UV); and
aldehydes (e.g., acrolein and crotonaldehyde).
[0242] In some embodiments of the present invention, affinity tags
are introduced into two or more polynucleotide components of a NASC
polynucleotide composition. For example, a nucleic acid sequence
within one polynucleotide component of a NASC polynucleotide
composition can be modified to comprise an affinity sequence.
Nucleic acid binding effector proteins and their corresponding
effector protein binding sequences are examples of affinity tags.
An affinity tag can be introduced into a first polynucleotide
components of a NASC polynucleotide composition. An affinity tag
can be an affinity sequences such as MS2 binding sequence, U1A
binding sequence, stem-loop sequence (e.g., a Csy4 protein binding
sequence, or Cas6 protein binding sequence), eIF4A binding
sequence, Transcription Activator-Like Effector (TALE) binding
sequence (see, e.g., Valton, J., et al., Journal of Biological
Chemistry 287(46):38427-38432 (2012)), or zinc finger domain
binding sequence (see, e.g., Font, J., et al., Methods Molecular
Biology 649:479-491 (2010); Isalan, M., et al., Nature
Biotechnology 19(7):656-660 (2001)). A second polynucleotide
component of the NASC polynucleotide composition can be modified to
comprise a corresponding affinity tag: an MS2 coding sequence, U1A
coding sequence, stem-loop binding protein coding sequence (e.g.,
an enzymatically (endoribonuclease) inactive Csy4 protein that
binds the Csy4 protein sequence), eIF4A coding sequence, TALE
coding sequence, or a zinc finger domain coding sequence,
respectively. Typically, enzymatically inactive nucleic acid
binding proteins that retain sequence specific nucleic acid binding
are used (e.g., an endoribonuclease-inactive Csy4 protein (dCsy4));
however, in some embodiments enzymatically active nucleic acid
binding proteins or nucleic acid proteins with altered enzymatic
activity are used. When more than two polynucleotide components of
a NASC polynucleotide composition are modified with an affinity
sequence, in preferred embodiments, the two affinity sequences
typically are not the same; thus, there are two different affinity
sequences associated with the Cas protein.
[0243] Example 1 describes production of exemplary components of
engineered NASC polynucleotide compositions. Example 1 describes in
silico design of NASC polynucleotide components corresponding to a
number of embodiments of the NASC polynucleotide compositions
described herein. Table 9 sets forth a correlation between NASC
polynucleotide components and structures illustrated in the
figures.
[0244] Example 2 describes production of NASC polynucleotide
components of the present invention. The NASC polynucleotide
components described in this Example were used in in vitro Cas
cleavage assays to evaluate cleavage percentages of nucleic acid
target sequences by the NASC polynucleotide compositions. Example 5
describes performance of in vitro Cas protein-mediated cleavage
assays. Example 3 and Example 4 describe methods that can be used
for production of double-stranded DNA target sequences for use in
in vitro Cas cleavage assays.
[0245] Example 6 presents a deep sequencing analysis for detection
of target modifications in eukaryotic cells using NASC
polynucleotide compositions/first nucleic acid binding
protein/second nucleic acid binding protein compositions
(comprising, for example, Class 2 CRISPR-Cas proteins) of the
present invention.
[0246] Example 9 presents an alternative analysis, the T7E1 assay,
for detection of target modifications in eukaryotic cells using
NASC polynucleotide composition/first nucleic acid binding
protein/second nucleic acid binding protein compositions
(comprising, for example, Class 2 CRISPR-Cas proteins).
[0247] Example 7 describes identification and screening of Class 2
crRNAs that can be engineered to make NASC polynucleotide
components of the present invention.
[0248] Example 8 describes identification and screening of Class 2
tracrRNAs that can be used to engineer NASC polynucleotide
components.
[0249] Example 10 describes the generation and testing of various
modifications of Class 2 Type V guide crRNAs and their suitability
for use in constructing NASC polynucleotide components.
[0250] Example 11 describes the generation and testing of various
modifications of Class 2 Type II guide RNAs and their suitability
for use in constructing NASC polynucleotide components.
[0251] Example 12 describes the use of NASC polynucleotide
compositions to modify nucleic acid target sequences present in
human gDNA and measure the level of cleavage activity and
specificity of cleavage at those sites. Measurement of the level of
cleavage percentage and/or cleavage specificity at a particular
site can provide options to identify the nucleic acid target
sequences having a desired cleavage percentage and/or
specificity.
[0252] In a fifth aspect, the present invention is directed to
nucleic acid/protein compositions comprising a NASC polynucleotide
composition complexed with a first nucleic acid binding protein and
a second nucleic acid binding protein. The first nucleic acid
binding protein can comprise one or more nuclease activities, and
the second nucleic acid binding protein can comprise one or more
nuclease activities. In some embodiments, the first nucleic acid
binding protein is catalytically inactive for one or more of the
nuclease activities, the second nucleic acid binding protein is
catalytically inactive for one or more of the nuclease activities,
or both the first nucleic acid binding protein is catalytically
inactive for one or more of the nuclease activities and the second
nucleic acid binding protein is catalytically inactive for one or
more of the nuclease activities. In other embodiments of the NASC
polynucleotide composition/first nucleic acid binding
protein/second nucleic acid binding protein complexes, either the
first nucleic acid binding protein or the second nucleic acid
binding protein is catalytically inactive, and the complexes can
further be connected with a donor polynucleotide via the
catalytically inactive protein. In preferred embodiments, the first
nucleic acid binding protein and the second nucleic acid binding
protein are Class 2 CRISPR-Cas proteins (e.g., a Cas9 protein, a
Cpf1 protein, or a Cas9 protein and a Cpf1 protein).
[0253] In some embodiments of the NASC polynucleotide
composition/first nucleic acid binding protein/second nucleic acid
binding protein composition, either the Cas9 protein or the Cpf1
protein is catalytically inactive (dCas9 or dCpf1) and the NASC
polynucleotide composition/first nucleic acid binding
protein/second nucleic acid binding protein composition further
comprises a donor polynucleotide wherein the donor polynucleotide
comprises a nucleotide sequence complementary to the Cpf1 spacer
element, or the regions adjacent to the Cpf1 spacer element, or a
nucleotide sequence complementary to the spacer element, or the
regions adjacent to the Cas9 spacer element. The donor
polynucleotide is capable of associating with the spacer element,
or the regions adjacent to the spacer element, through hydrogen
bonding between the donor polynucleotide nucleotide sequence
complementary to the spacer element, or the sequence adjacent to
the spacer element.
[0254] Mutations of the Cas9 protein that are enzymatically
inactive for RuvC-1-related nuclease activity, HNH-related nuclease
activity, and both RuvC-1-related nuclease activity and HNH-related
nuclease activity are known in the art. Mutations of the Cpf1
protein that are enzymatically inactive are known in the art (see,
e.g., Yamano, T., et al., Cell 165(4):949-962 (2016)); Zetsche, B.,
et al., Cell 163:1-13 (2015)).
[0255] Across CRISPR systems, "guide biogenesis" (also referred to
as "guide processing") involves endonuclease or exonuclease
truncation of the guide RNA sequence following transcription of the
CRISPR array. Enzymatic processing of the guide RNA can be carried
out by RNases encoded by the Cas operon (e.g., Cas6 of Class 1 Type
I-E systems) or by endogenous RNases (e.g., RNase III of Class 2
Type II-A systems).
[0256] In Class 2 Type V systems, guide biogenesis is performed by
the Cpf1 protein nuclease. The Cpf1 protein is also responsible for
sequence-specific double-stranded DNA target cleavage.
[0257] In the Type V system, cleavage of the pre-crRNA occurs in an
upstream region (e.g., in a 5' direction) from the pseudo-knot
secondary structure (see, e.g., FIG. 3A, 303) and results in the
generation of a guide Cpf1 crRNA. In some embodiments of the
present invention, preventing the Cpf1 protein from cleaving 5' of
the guide crRNA stem element is useful, for example, to prevent
separation of a NASC polynucleotide composition/Cas9 protein/Cpf1
protein complex by Cpf1-mediated cleavage. It has been demonstrated
that the sequence of Type V pre-crRNA can be modified to prevent
guide RNA processing by the Type V CRISPR Cpf1 protein (see
Fonfara, I., et al., Nature 532(7600):517-521 (2016)).
[0258] One method to prevent Cpf1 cleavage of sequences 5' of the
guide crRNA stem element is by modification (e.g., base mutations,
insertions, deletions, or chemical modifications) of the bases in
the region upstream of the pseudo-knot or within the pseudo-knot of
the pre-crRNA to prevent the processing of the pre-crRNA by the
Cpf1 protein. To evaluate the effect of such modifications on guide
processing, the modified pre-crRNA can be incubated in the presence
of a cognate Cpf1 protein for a period of time in a suitable
buffer. The mixture can be treated with Proteinase K (Denville
Scientific, South Plainfield, N.J.) to remove the protein and the
mixture can be analyzed by polyacrylamide gel electrophoresis to
evaluate whether cleavage of the modified pre-crRNA occurs. A
pre-crRNA not incubated in the presence of a cognate Cpf1 protein
can serve as a positive control (i.e., a control for the absence of
guide processing). If no single modification in the pre-crRNA is
sufficient to ablate guide processing, then combinations of
modifications exhibiting reduced processing of the pre-crRNA can be
combined into a pre-crRNA design and re-tested for the absence of
guide processing activity. Modifications of pre-crRNA that result
in the inability of the modified pre-crRNA to be processed can be
further evaluated for the ability of the Cpf1-pre-crRNA/Cpf1
protein complex to maintain sequence-specific binding and/or
cleavage of a DNA target nucleic acid comprising the pre-crRNA
spacer element.
[0259] A second method to prevent Cpf1 cleavage of sequences 5' of
the guide crRNA stem element is by modification of the Cpf1
protein. In this method, the amino acid residues of the Cpf1
protein are modified to perturb guide processing. X-ray
crystallography of guide crRNA/Cpf1 protein complexes has shown
that the pseudo-knot is bound by the interface of two protein
domains designated the wedge domain (WED) and the RuvC domain (see
Yamano, T., et al., Cell 165(4):949-962 (2016). Amino acid residues
of Cpf1 proximal to the region binding the 5' end of the guide
crRNA and/or the pseudo-knot structure are likely to be involved in
endonuclease catalysis of pre-crRNAs. Mutagenesis strategies, such
as alanine screening (see, e.g., Lefevre, F., et al., Nucleic Acids
Research 25(2):447-448 (1997); Lee, et al., Molecular Pharmacology
50(1):140-148 (1996)) can be used to modify regions within the WED
and RuvC domain, or other domains within the Cpf1 protein, to
identify residues in the protein responsible for guide crRNA
processing. In this method, Cpf1 proteins comprising alanine
mutations can be expressed and incubated with a cognate pre-crRNA
in a suitable buffer. After incubation, Proteinase K can be added
to the reaction mix to remove the Cpf1 protein and the reaction mix
can be analyzed by polyacrylamide gel electrophoresis to evaluate
whether cleavage of the modified pre-crRNA occurred. A pre-crRNA
not incubated in the presence of a cognate Cpf1 protein can serve
as a positive control (i.e., a control for the absence of guide
processing). If no single mutation in the Cpf1 protein is
sufficient to ablate guide processing, then combinations of
mutations exhibiting reduced processing of the pre-crRNA can be
combined into a single Cpf1 protein construct and re-tested for the
absence of guide processing activity. Candidate mutations or
combinations of mutations in the Cpf1 protein can be further
evaluated for the ability of the Cpf1-pre-crRNA complex to maintain
sequence-specific binding and/or cleavage of a DNA target nucleic
acid comprising the pre-crRNA spacer element.
[0260] In a sixth aspect, the present invention relates to nucleic
acid sequences encoding one or more polynucleotide components of a
NASC polynucleotide composition, as well as expression cassettes,
vectors, and recombinant cells comprising nucleic acid sequences
encoding one or more polynucleotide components of a NASC
polynucleotide composition. In some embodiments, such expression
cassettes, vectors, and recombinant cells further comprise
sequences encoding one or more nucleic acid binding proteins (e.g.,
Class 2 CRISPR-Cas proteins) with which the NASC polynucleotide
composition is capable of forming a complex.
[0261] A further embodiment of the present invention relates to
vectors, including expression vectors, comprising one or more
nucleic acid sequences encoding one or more polynucleotide
components of a NASC polynucleotide composition, and optionally one
or more nucleic acid sequences encoding nucleic acid binding
proteins (e.g., Class 2 CRISPR-Cas proteins) capable of forming a
complex with the NASC polynucleotide composition. Vectors can also
include sequences encoding selectable or screenable markers.
Furthermore, nuclear targeting sequences can also be added, for
example, to Cas9 protein and Cpf1 protein coding sequences. Vectors
can also include polynucleotides encoding protein tags (e.g.,
poly-His tags, hemagglutinin tags, fluorescent protein tags,
bioluminescent tags). The coding sequences for such protein tags
can be fused to, for example, one or more nucleic acid sequences
encoding a Cas9 protein and/or a Cpf1 protein.
[0262] General methods for construction of expression vectors are
known in the art; furthermore, expression vectors for host cells
are commercially available. There are several commercial software
products designed to facilitate selection of appropriate vectors
and construction thereof, such as insect cell vectors for insect
cell transformation and gene expression in insect cells, bacterial
plasmids for bacterial transformation and gene expression in
bacterial cells, yeast plasmids for cell transformation and gene
expression in yeast and other fungi, mammalian vectors for
mammalian cell transformation and gene expression in mammalian
cells or mammals, and viral vectors (including lentivirus,
retrovirus, adenovirus, herpes simplex virus I or II, parvovirus,
reticuloendotheliosis virus, and adeno-associated virus (AAV)
vectors) for cell transformation and gene expression and methods to
easily allow cloning of such polynucleotides. Illustrative plant
transformation vectors include those derived from a Ti plasmid of
Agrobacterium tumefaciens (Lee, L. Y., et al., Plant Physiology
146(2): 325-332 (2008)). Also useful and known in the art are
Agrobacterium rhizogenes plasmids. For example, SNAPGENE.TM. (GSL
Biotech LLC, Chicago, Ill.;
snapgene.com/resources/plasmid_files/your_time_is_valuable/)
provides an extensive list of vectors, individual vector sequences,
and vector maps, as well as commercial sources for many of the
vectors.
[0263] Lentiviral vectors are examples of vectors useful for
introduction into mammalian cells of one or more nucleic acid
sequences encoding one or more polynucleotide components of a NASC
polynucleotide composition, and optionally one or more nucleic acid
sequences encoding one or more nucleic acid binding proteins (e.g.,
Class 2 CRISPR-Cas proteins) with which the NASC polynucleotide
composition is capable of forming a complex. Lentivirus is a member
of the Retroviridae family and is a single-stranded RNA virus,
which can infect both dividing and non-dividing cells as well as
provide stable expression through integration into the genome. To
increase the safety of lentivirus, components necessary to produce
a viral vector are split across multiple plasmids. Transfer vectors
are typically replication incompetent and may additionally contain
a deletion in the 3'LTR, which renders the virus self-inactivating
after integration. Packaging and envelope plasmids are typically
used in combination with a transfer vector. For example, a
packaging plasmid can encode combinations of the Gag, Pol, Rev, and
Tat genes. A transfer plasmid can comprise viral LTRs and the psi
packaging signal. The envelope plasmid comprises an envelope
protein (usually vesicular stomatitis virus glycoprotein, VSV-GP,
because of its wide infectivity range).
[0264] Lentiviral vectors based on human immunodeficiency virus
type-1 (HIV-1) have additional accessory proteins that facilitate
integration in the absence of cell division. HIV-1 vectors have
been designed to address a number of safety concerns. These include
separate expression of the viral genes in trans to prevent
recombination events leading to the generation of
replication-competent viruses. Furthermore, the development of
self-inactivating vectors reduces the potential for transactivation
of neighboring genes and allows the incorporation of regulatory
elements to target gene expression to particular cell types (see,
e.g., Cooray, S., et al., Methods in Enzymology 507:29-57
(2012)).
[0265] Transformed host cells (or recombinant cells) are cells or
the progeny of cells that have been transformed or transfected,
using recombinant DNA techniques, with one or more nucleic acid
sequences encoding one or more polynucleotide components of a NASC
polynucleotide composition, and optionally one or more nucleic acid
sequences encoding one or more nucleic acid binding proteins (e.g.,
Class 2 CRISPR-Cas proteins) with which the NASC polynucleotide
composition is capable of forming a complex. Methods of introducing
polynucleotides (e.g., an expression vector) into host cells are
known in the art and are typically selected based on the kind of
host cell. Such methods include, for example, viral or
bacteriophage infection, transfection, conjugation,
electroporation, calcium phosphate precipitation,
polyethyleneimine-mediated transfection, DEAE-dextran mediated
transfection, protoplast fusion, lipofection, liposome-mediated
transfection, ballistic gene transfer technology (e.g., using a
gene gun or a biolistic particle delivery system), direct
microinjection, and nanoparticle-mediated delivery.
[0266] As an alternative to expressing one or more nucleic acid
sequences encoding one or more polynucleotide components of a NASC
polynucleotide composition, and optionally one or more nucleic acid
sequences encoding one or more nucleic acid binding proteins (e.g.,
Class 2 CRISPR-Cas proteins) with which the NASC polynucleotide
composition is capable of forming a complex, a NASC polynucleotide
composition and/or the one or more nucleic acid binding proteins
(e.g., Class 2 CRISPR-Cas proteins) can be directly introduced into
a cell, for example. Alternatively, one or more components can be
expressed by a cell and the other component(s) directly introduced.
Methods to introduce the components into a cell include
electroporation, lipofection, and ballistic gene transfer
technology.
[0267] A variety of host cells are disclosed herein that can be
used to produce recombinant cells by introduction of one or more
nucleic acid sequences encoding one or more polynucleotide
components of a NASC polynucleotide composition, and optionally one
or more nucleic acid sequences encoding one or more nucleic acid
binding proteins (e.g., Class 2 CRISPR-Cas proteins) with which the
NASC polynucleotide composition is capable of forming a complex.
Such host cells include, but are not limited to a plant cell, a
yeast cell, a bacterial cell, an insect cell, an algal cell, or a
mammalian cell.
[0268] Methods of introducing polynucleotides (e.g., an expression
vector) into host cells to produce recombinant cells are known in
the art and are typically selected based on the kind of host cell.
Such methods include, for example, viral or bacteriophage
infection, transfection, conjugation, electroporation, calcium
phosphate precipitation, polyethyleneimine-mediated transfection,
DEAE-dextran mediated transfection, protoplast fusion, lipofection,
liposome-mediated transfection, ballistic gene transfer technology,
direct microinjection, and nanoparticle-mediated delivery. For ease
of discussion, "transfection" is used below to refer to any method
of introducing polynucleotides into a host cell.
[0269] Preferred methods for introducing polynucleotides plant
cells include microprojectile bombardment and
Agrobacterium-mediated transformation. Alternatively, other
non-Agrobacterium species (e.g., Rhizobium) and other prokaryotic
cells that are able to infect plant cells and introduce
heterologous polynucleotides into the genome of the infected plant
cell can be used. Other methods include electroporation,
liposome-mediated transfection, transformation using pollen or
viruses, and chemicals that increase free DNA uptake, or free DNA
delivery using microprojectile bombardment. See, e.g., Narusaka,
Y., et al., Chapter 9, in Transgenic Plants--Advances and
Limitations, edited by Yelda, O., ISBN 978-953-51-0181-9
(2012).
[0270] In some embodiments, a host cell is transiently or
non-transiently transfected. In some embodiments, a cell is
transfected as it naturally occurs in a subject. In some
embodiments, a cell that is transfected is taken from a subject,
e.g., a primary cell or progenitor cell. In some embodiments, the
primary cell or progenitor cell is cultured and/or is returned
after ex vivo transfection to the same subject (autologous
treatment) or to a different subject.
[0271] The NASC polynucleotide composition/first nucleic acid
binding protein/second nucleic acid binding protein (comprising,
for example, Class 2 CRISPR-Cas proteins) complexes described
herein can be used to generate non-human transgenic organisms by
site-specifically introducing a selected polynucleotide sequence at
a DNA target locus in the genome to generate a modification of the
gDNA. The transgenic organism can be an animal or a plant.
[0272] A transgenic animal is typically generated by introducing
the system into a zygote cell. A basic technique, described with
reference to making transgenic mice (Cho, A., et al., "Generation
of Transgenic Mice," Current Protocols in Cell Biology,
CHAPTER.Unit-19.11 (2009)), involves five basic steps: first,
preparation of a system, as described herein, including a suitable
donor polynucleotide; second, harvesting of donor zygotes; third,
microinjection of the system into the mouse zygote; fourth,
implantation of microinjected zygotes into pseudo-pregnant
recipient mice; and fifth, performing genotyping and analysis of
the modification of the gDNA established in founder mice. The
founder mice will pass the genetic modification to any progeny. The
founder mice are typically heterozygous for the transgene. Mating
between these mice will produce mice that are homozygous for the
transgene 25% of the time.
[0273] Methods for generating transgenic plants are also well
known. A transgenic plant generated, e.g., using Agrobacterium
transformation methods, typically contains one transgene inserted
into one chromosome. It is possible to produce a transgenic plant
that is homozygous with respect to a transgene by sexually mating
(i.e., selfing) an independent segregant transgenic plant
containing a single transgene to itself, for example an F0 plant,
to produce F1 seed. Plants formed by germinating F1 seeds can be
tested for homozygosity. Typical zygosity assays include, but are
not limited to, single nucleotide polymorphism assays and thermal
amplification assays that distinguish between homozygotes and
heterozygotes.
[0274] As an alternative to using a system described herein for the
direct transformation of a plant, transgenic plants can be formed
by crossing a first plant that has been transformed with a system
with a second plant that has never been exposed to the system. For
example, a first plant line containing a transgene can be crossed
with a second plant line to introgress the transgene into the
second plant line, thus forming a second transgenic plant line.
[0275] Further aspects of the present invention relate to methods
of using nucleoprotein compositions comprising NASC polynucleotide
compositions and a nucleic acid binding protein (e.g., Class 2
CRISPR-Cas proteins) complexes. Embodiments of such nucleoprotein
compositions are described herein. Numerous uses of the engineered
nucleic acid sequences described herein, include, but are not
limited to, forming a scaffold of a complex of two or more
engineered nucleic acid sequences comprising a nucleic acid binding
Class 2 CRISPR protein binding sequence and a spacer nucleic acid
sequence complementary to a target nucleic acid sequence; precise
editing of gDNA regions (e.g., excision, insertion, modification);
tethering a donor polynucleotide in close proximity to a cut-site
(e.g., cleavage using a Cas9 protein or a Cpf1 protein); excision
of a gDNA region and simultaneous donor polynucleotide tethering at
the excision site; forming an artificial histone or introduction of
heterochromatin structure, for example, using dCas9; and tight
transcriptional control of gene expression (e.g., blocking
transcription of a gene). Additional uses of the engineered nucleic
acid sequence scaffolds described herein include, but are not
limited to, methods of use and methods of manufacturing
nucleoprotein particle sheets; flexible biomaterials, for example,
for use in tissue engineering; caged drug delivery vehicles;
vaccine delivery vehicles, for example, DNA or RNA vaccines;
size-gated porous membranes, for example, making and using
membranes having holes of fixed size; nanoparticles of selected
sizes; and protein nucleic acid polymers.
[0276] In one embodiment, the present invention includes a method
of binding a nucleic acid sequence (e.g., DNA) comprising
contacting a first nucleic acid target sequence in the nucleic acid
(e.g., DNA) and a second nucleic acid target sequence in the
nucleic acid sequence (e.g., DNA) with a NASC polynucleotide
composition/first nucleic acid binding protein/second nucleic acid
binding protein composition (comprising, for example, Class 2
CRISPR-Cas proteins), thereby facilitating binding of the
nucleoprotein to the first nucleic acid target sequence in the
nucleic acid sequence and the second nucleic acid target sequence
in the nucleic acid. The NASC polynucleotide composition/first
nucleic acid binding protein/second nucleic acid binding protein
composition (comprising, for example, Class 2 CRISPR-Cas proteins)
comprises a first spacer element that is complementary to the first
nucleic acid target sequence (e.g., DNA) and a second spacer
element that is complementary to the second nucleic acid target
sequence (e.g., DNA). In some embodiments, the nucleic acid target
sequence is gDNA. Such methods of binding a nucleic acid target
sequence can be carried in vitro (a biochemical assay), in cell (in
cultured cells), ex vivo (cells removed from a subject), or in vivo
(cells in an organism).
[0277] A variety of methods are known in the art to evaluate and/or
quantitate protein-nucleic acid interactions including, but not
limited to, the following: immunoprecipitation (ChIP) assays, DNA
electrophoretic mobility shift assays (EMSA), DNA pull-down assays,
and microplate capture and detection assays. Commercial kits,
materials, and reagents are available to practice many of these
methods from, for example, Thermo Scientific (Wilmington, Del.),
Signosis (Santa Clara, Calif.), Bio-Rad (Hercules, Calif.), and
Promega (Madison, Wis.). A common approach to detect
protein-nucleic acid interactions is EMSA (see, e.g., Hellman L.
M., et al., Nature Protocols 2(8):1849-1861 (2007)).
[0278] In another embodiment, the present invention includes a
method of cutting a nucleic acid sequence (e.g., DNA) comprising
contacting a first nucleic acid target sequence in the nucleic acid
(e.g., DNA) and a second nucleic acid target sequence in the
nucleic acid sequence (e.g., DNA) with a nucleoprotein composition
comprising a NASC polynucleotide composition/first nucleic acid
binding protein/second nucleic acid binding protein composition
(comprising, for example, Class 2 CRISPR-Cas proteins), thereby
facilitating binding of the nucleoprotein composition to the first
nucleic acid target sequence in the nucleic acid sequence and the
second nucleic acid target sequence in the nucleic acid. The
nucleoprotein composition comprises a first spacer element that is
complementary to the first nucleic acid target sequence (e.g., DNA)
and a second spacer element that is complementary to the second
nucleic acid target sequence (e.g., DNA). The first nucleic acid
binding protein (e.g., Class 2 CRISPR-Cas protein) of the bound
nucleoprotein composition cuts the first nucleic acid target
sequence, and the second nucleic acid binding protein (e.g., Class
2 CRISPR-Cas protein) of the bound nucleic acid/protein composition
cuts the second nucleic acid target sequence. In some embodiments,
the nucleic acid target sequence is gDNA. Such methods of binding a
nucleic acid target sequence can be carried in vitro, in cell, ex
vivo, or in vivo.
[0279] Methods of binding and of binding and cutting nucleic acid
target sequences using a NASC-PC1/NASC-PC2/S. thermophilus Cas9
protein/S. pyogenes protein composition are exemplified in FIG.
16A, FIG. 16B, and FIG. 16C. FIG. 16A illustrates a S. pyogenes
Cas9 protein (FIG. 16A, 1604) and a S. thermophilus Cas9 protein
(FIG. 16A, 1603), a NASC-PC1/NASC-PC2 composition (FIG. 16A, 1600)
(generally having the structure shown in FIG. 6K), a
double-stranded nucleic acid (FIG. 16A, 1605) comprising a first
DNA target binding sequence complementary to the NASC-PC1/NASC-PC2
S. pyogenes Cas9 spacer element (FIG. 16A, 1602), and a
double-stranded nucleic acid (FIG. 16A, 1607) comprising a second
DNA target binding sequence complementary to the NASC-PC1/NASC-PC2
S. thermophilus Cas9 spacer element (FIG. 16A, 1601). FIG. 16A,
1606, indicates the location of the S. pyogenes Cas9 PAM. FIG. 16A,
1608, indicates the location of the S. thermophilus Cas9 PAM.
[0280] FIG. 16A illustrates the formation of the S. pyogenes Cas9
protein (FIG. 16A, 1604; complex 1609) and S. thermophilus Cas9
protein (FIG. 16A, 1603; complex 1616) in complex with the
NASC-PC1/NASC-PC2 composition (FIG. 11A, 1600; complex 1610).
[0281] FIG. 16A illustrates hydrogen bonding of the nucleoprotein
complex to the double-stranded DNA target sequences (FIG. 16A,
1611). FIG. 16A, 1611, illustrates the binding of the
NASC-PC1/NASC-PC2/S. thermophilus Cas9 protein/S. pyogenes Cas9
protein composition to the double-stranded nucleic acid (FIG. 16A,
1605) comprising a first DNA target binding sequence complementary
to the NASC-PC1/NASC-PC2 S. pyogenes Cas9 spacer element (FIG. 16A,
1602) and a double-stranded nucleic acid (FIG. 16A, 1607)
comprising a second DNA target binding sequence complementary to
the NASC-PC1/NASC-PC2 S. thermophilus Cas9 spacer element (FIG.
16A, 1601). If the S. pyogenes Cas9 protein and the S. thermophilus
Cas9 protein are enzymatically inactive, the nucleoprotein complex
(FIG. 16A, 1610) may be used, for example, to bring two DNA
sequences (FIG. 16A, 1605, 1607) into proximity (e.g., FIG. 16A,
1607).
[0282] FIG. 16B illustrates cleavage of the FIG. 16B, 1605, DNA by
an enzymatically active S. pyogenes Cas9 protein and the tethering
of the FIG. 16B, 1607, DNA using an enzymatically inactive S.
thermophilus Cas9 protein to maintain DNA (FIG. 16B, 1607) in
proximity to the cleavage site (FIG. 16B, 1612, 1613). Such a
nucleoprotein complex may help improve the frequency of HDR using a
donor polynucleotide (FIG. 16B, 1607).
[0283] FIG. 16C illustrates cleavage of the FIG. 16C, 1605, DNA by
an enzymatically active S. pyogenes Cas9 protein to break both
strands of the FIG. 16C, 1605, DNA (FIG. 16C, 1612, 1613) and
cleavage of the FIG. 16C, 1607, DNA by an enzymatically active S.
thermophilus Cas9 protein to break both strands in the FIG. 16C,
1607, DNA (FIG. 16C, 1614, 1615). Such a nucleoprotein complex may
be used to facilitate chromosomal rearrangement (e.g.,
translocations).
[0284] In yet another embodiment, the present invention includes a
method of modifying DNA in a cell comprising contacting a first DNA
target sequence in the DNA and a second DNA target sequence in the
DNA with a NASC polynucleotide composition/first nucleic acid
binding protein/second nucleic acid binding protein composition
(comprising, for example, Class 2 CRISPR-Cas proteins such as Cas9
protein and/or Cpf1 protein), thereby facilitating binding of the
nucleoprotein complex to the first nucleic acid target sequence in
the nucleic acid sequence and the second nucleic acid target
sequence in the nucleic acid. The NASC polynucleotide
composition/first nucleic acid binding protein/second nucleic acid
binding protein composition (comprising, for example, Class 2
CRISPR-Cas proteins) comprises a first spacer element that is
complementary to the first nucleic acid target sequence and a
second spacer element that is complementary to the second nucleic
acid target sequence (e.g., DNA). The first protein of the bound
nucleoprotein complex cuts the first DNA target sequence, and the
second protein of the bound nucleoprotein complex cuts the second
DNA target sequence. The cell repairs both the first cut site and
the second cut site. Exemplary cell DNA repair pathways include
HDR, NHEJ, and MMEJ. In some embodiments, the nucleic acid target
sequence is gDNA. Such methods of binding a nucleic acid target
sequence can be carried out in vitro, in cell, ex vivo, or in vivo.
The contracting step may further comprise a donor polynucleotide
being present, wherein at least a portion of the donor
polynucleotide is incorporated between the first cut site and the
second cut site.
[0285] In another embodiment, the invention relates to a method to
bring a donor polynucleotide into proximity of a DSB in a nucleic
acid target, typically DNA, in a cell. The method comprises
contacting a first DNA target sequence in the DNA and a second DNA
target sequence in a donor polynucleotide with NASC polynucleotide
composition/first DNA binding protein/second DNA binding protein
composition (comprising, for example, Class 2 CRISPR-Cas proteins
such as Cas9 protein and/or Cpf1 protein) having a first DNA target
binding sequence complementary to the first DNA target and a second
DNA target binding sequence complementary to the second DNA target.
The first DNA binding protein is catalytically active and is
associated with the first DNA target binding sequence. The second
DNA binding protein is enzymatically inactive and is associated
with the second DNA target binding sequence. Contacting the
nucleoprotein complex with the first and second DNA target
sequences facilitates the binding of the nucleoprotein complex to
the first DNA target sequence in the DNA and the second DNA target
sequence in the donor polynucleotide. The catalytically active DNA
binding protein of the nucleoprotein complex cuts the first DNA
target sequence to form a cut site. The donor polynucleotide is in
proximity to the cut site (e.g., the DSB) because the catalytically
active DNA binding protein and the catalytically inactive DNA
binding protein are complexed with the NASC polynucleotide
composition, that is, they are part of the same nucleoprotein
complex. In some embodiments, at least a portion of the donor
polynucleotide is introduced into the cut site in the DNA (e.g., by
an HDR repair process) resulting in modifying the DNA.
[0286] FIG. 12 illustrates using NASC-PC1/NASC-PC2/active Cas9
protein/dCas9 Cas9 protein composition, wherein endonuclease
domains of the active Cas9 are active and the endonuclease domains
of the dCas9 are inactive, to bring a donor polynucleotide into
proximity of a DSB in a nucleic acid target sequence. FIG. 12
illustrates the active Cas9 protein (FIG. 12, 1211) and the dCas9
protein (FIG. 12, 1203), NASC-PC1/NASC-PC2 composition (FIG. 12,
1205; see also FIG. 6F); a double-stranded nucleic acid (FIG. 12,
1206/1207) comprising a first DNA target binding sequence
complementary to the active Cas9-NASC-PC1/NASC-PC2 composition
spacer element (FIG. 12, 1210); and a donor polynucleotide (FIG.
12, 1200/1201) comprising a second DNA target binding sequence
complementary to the dCas9-NASC-PC1/NASC-PC2 composition spacer
element (FIG. 12, 1204). FIG. 12 illustrates the
NASC-PC1/NASC-PC2/active Cas9 protein/dCas9 protein in complex and
the hydrogen bonding of the first DNA target binding sequence to
the first DNA target sequence upstream of a first Cas9 PAM (FIG.
12, 1209) and the second DNA target binding sequence to the second
target sequence upstream of a second Cas9 PAM (FIG. 12, 1202) in
the donor polynucleotide. FIG. 12, 1208, illustrates double-strand
blunt-end cuts made by Cas9 at the first DNA target binding
sequence, resulting in a second double-stranded nucleic acid (FIG.
12, 1213/1212), and shows the donor polynucleotide (FIG. 12,
1200/1201) in proximity to the double-strand blunt-end cuts. Having
the donor polynucleotide in close proximity to the double-strand
cuts increases the likelihood of integration of the donor
polynucleotide sequences, or portions thereof, into the DNA
comprising the first nucleic acid target.
[0287] In a further embodiment, the invention relates to a method
bringing a first nucleic acid target site, typically DNA, into the
proximity of a second nucleic acid target site, typically DNA, in a
cell. The method comprises contacting a first nucleic target
sequence and a second nucleic target sequence with a nucleoprotein
complex comprising NASC polynucleotide composition in a complex
with a nucleic acid binding protein, and a second nucleic acid
binding protein, thereby facilitating binding of the nucleoprotein
complex to the first nucleic acid target sequence and the second
nucleic acid target sequence. The first DNA target sequence is
complementary to a first nucleic acid binding sequence of the NASC
polynucleotide composition, wherein the associated first protein is
a catalytically inactive nucleic acid binding protein (e.g., a
dCpf1 protein or a dCas9 protein). The second DNA target sequence
is complementary to a second nucleic acid binding sequence of the
NASC polynucleotide composition, wherein the associated second
protein is a catalytically inactive nucleic acid binding protein
(e.g., a dCpf1 protein or a dCas9 protein). The first nucleic acid
target site is brought into proximity of a second nucleic acid
target site because the first and second catalytically inactive
nucleic acid binding proteins are complexed with the NASC
polynucleotide composition, that is, they are part of the same
nucleic acid/protein composition. In some embodiments, the first
nucleic acid target sequence and the second nucleic acid target
sequence are on separate polynucleotides (e.g., different
chromosomes) or a single polynucleotide comprises the first nucleic
acid target sequence and the second nucleic acid target sequence
(e.g., different sections of the same chromosome).
[0288] FIG. 13 illustrates an example of a NASC polynucleotide
composition/a first dCas9 protein/second dCas9 binding protein/a
third dCas9 protein composition binding to three sites within a
single DNA polynucleotide. The NASC polynucleotide composition is
also illustrated in FIG. 6I. This nucleoprotein complex can be used
to in a method of bringing a first nucleic acid target site,
typically DNA, into the proximity of a second nucleic acid target
site, typically DNA, into the proximity of a third nucleic acid
target site, typically DNA, in a cell. This method also can be
applied, for example, to detection of nucleic acid target sites in
proximity and modulating in vitro or in vivo transcriptional
modulation of a gene adjacent the three target sites. Indicators of
the components illustrated in FIG. 13 are presented in Table 8.
[0289] FIG. 14 illustrates an example of a NASC polynucleotide
composition/a first dCas9 protein/second active Cas9 binding
protein/a third active Cas9 protein composition binding to three
sites of multiple DNA polynucleotides. The NASC polynucleotide
composition is also illustrated in FIG. 6I. This nucleoprotein
complex can be used, for example, in a method to bring a donor
polynucleotide into proximity of two DSBs in a nucleic acid target,
typically DNA, in a cell to facilitate HDR integration of the donor
polynucleotide or portions of the donor polynucleotide into the
region between the two DNA target cleavage sites. Indicators of the
components illustrated in FIG. 14 are presented in Table 8. The
NASC polynucleotide composition is also illustrated in FIG. 6I.
[0290] FIG. 15 illustrates an example of a NASC polynucleotide
composition/a first dCas9 protein/second active Cas9 binding
protein/a third active Cas9 protein composition binding to three
sites in three different DNA polynucleotides. The NASC
polynucleotide composition is also illustrated in FIG. 6I. This
nucleoprotein complex can be used, for example, in a method to
improve ligation frequency of two DNA polynucleotides to the 5' and
3' ends of a third DNA polynucleotide. Indicators of the components
illustrated in FIG. 15 are presented in Table 8. The NASC
polynucleotide composition is also illustrated in FIG. 6I.
TABLE-US-00008 TABLE 8 Indicators and Corresponding Regions for
FIG. 13, FIG. 14, and FIG. 15 FIG. 13 FIG. 14 FIG. 15 Indi- Indi-
Indi- cator Component cator Component cator Component 1300 a 3' end
of 1400 a 3' end of 1500 a 3' end of a first strand a first strand
a first strand of a DNA of a first DNA of a first DNA 1301 a 5' end
of 1401 a 3' end of 1501 a 3' end of a first strand a second strand
a second strand of a DNA of a first DNA of a first DNA 1302 a first
Cas9 1402 a first Cas9 1502 a first Cas9 protein protein protein
1303 a first DNA 1403 a first DNA 1503 a first DNA target binding
target binding target binding sequence sequence sequence 1304 a
first 1404 a first 1504 a first nucleic acid nucleic acid nucleic
acid binding protein binding protein binding protein binding
binding binding sequence sequence sequence 1305 a first 1405 a
first 1505 a first Cas9 PAM Cas9 PAM Cas9 PAM 1306 a second 1408 a
second 1508 a second Cas9 protein Cas9 protein Cas9 protein 1307 a
second 1411 a second 1511 a second Cas9 PAM Cas9 PAM Cas9 PAM 1308
a second 1409 a second 1509 a second DNA target DNA target DNA
target binding binding binding sequence sequence sequence 1309 a
second 1410 a second DNA 1510 a second DNA nucleic acid target
binding target binding binding protein sequence sequence binding
protein binding protein binding sequence sequence sequence 1310 a
3' end of 1406/ 5'/3' ends of 1507/ 5'/3' ends of a first strand
1412 a first strand 1506 a second of a DNA of a second DNA DNA 1311
a 5' end of 1413/ 5'/3'ends of 1514/ 5'/3' ends of a first strand
1407 a second strand 1513 a third of a DNA of a second DNA DNA 1312
a third 1414 a third 1515 a third Cas9 protein Cas9 protein Cas9
protein 1313 a third 1417 a third 1518 a third Cas9 PAM Cas9 PAM
Cas9 PAM 1314 a third 1416 a third 1517 a third nucleic acid
nucleic acid nucleic acid binding protein binding protein binding
protein binding binding binding sequence sequence sequence 1315 a
third 1415 a third 1516 a third nucleic acid nucleic acid nucleic
acid target binding target binding target binding sequence sequence
sequence a first 1418 a double- 1512 a double- double- strand break
strand break strand break in the second in the second in the second
DNA DNA DNA a second 1419 a double- 1519 a double- double- strand
break strand break strand break in the third in the third in the
second DNA DNA DNA
[0291] In yet another embodiment, the present invention also
includes methods of modulating in vitro or in vivo transcription,
for example, transcription of a gene comprising regulatory element
sequences. The method comprises contacting at least a first nucleic
target sequence and a second nucleic target sequence with a NASC
polynucleotide composition/first nucleic acid binding
protein/second nucleic acid binding protein composition
(comprising, for example, catalytically inactive Class 2 CRISPR-Cas
proteins such as dCas9 and/or dCpf1), thereby facilitating binding
of the nucleoprotein composition to the first nucleic acid target
sequence and the second nucleic acid target sequence. At least one
of the first DNA target sequence and the second DNA target sequence
comprises the regulatory element sequences. The first DNA target
binding sequence of the NASC polynucleotide composition/first
nucleic acid binding protein/second nucleic acid binding protein
composition is complementary to a first nucleic acid target
sequence. The second DNA target binding sequence of the NASC
polynucleotide composition/first nucleic acid binding
protein/second nucleic acid binding protein composition is
complementary to a second DNA target sequence. In addition, the
first and/or second protein can be fusion proteins, for example,
dCas9 fused to a repressor or activator domain, and/or dCpf1 fused
to a repressor or activator domain. The binding of the nucleic
acid/protein composition to the first DNA target sequence and the
second DNA target sequence modulates transcription of the gene. In
some embodiments, the first DNA target sequence and the second DNA
target sequence comprise the regulatory element sequences, and the
first DNA target sequence comprises a promoter and the second DNA
target sequence comprises a transcription start site.
[0292] FIG. 11 illustrates a method of modulating in vitro or in
vivo transcription using NASC polynucleotide compositions of the
present invention. In this figure, a NASC polynucleotide
composition/a first dCas9 protein/a second dCsa9 protein complex is
formed (FIG. 11, 1111, 1110, 1103) by the association of a NASC
polynucleotide composition (FIG. 11, 1103) with a first dCas9
protein (FIG. 11, 1100) and a second dCsa9 protein (FIG. 11, 1101).
The complex comprises a first DNA target binding sequence (FIG. 11,
1102) complementary to a first nucleic target sequence that is
adjacent a first Cas9 PAM (FIG. 11, 1108) and a second DNA target
binding sequence (FIG. 11, 1104) that is complementary to a second
nucleic target sequence that is adjacent a second Cas9 PAM (FIG.
11, 1109) in a DNA polynucleotide (FIG. 11, 1105). The NASC
polynucleotide composition/first dCas9 protein/second dCsa9 protein
complex is contacted with the DNA polynucleotide comprising the DNA
target sequences, thereby facilitating binding of the nucleoprotein
composition through hydrogen-bonded base pairs (FIG. 11, 1112,
1113) to the first nucleic acid target sequence and the second
nucleic acid target sequence. At least one of the first DNA target
sequence and the second DNA target sequence comprise the regulatory
element sequences. The first DNA target binding sequence of the
NASC polynucleotide composition/first dCas9 protein/second dCsa9
protein composition is complementary to a first nucleic acid target
sequence. The second DNA target binding sequence of the NASC
polynucleotide composition/a first dCas9 protein/a second dCsa9
protein composition is complementary to a second DNA target
sequence.
[0293] The NASC polynucleotide compositions of the present
invention can be used to design nucleic acid/protein macromolecules
that self-assemble into complex architectures. Such macromolecules
have many uses in nanobiotechnology including, but not limited to,
drug delivery, design of nucleic acid/protein nanomaterials, and
formation of nanostructures such as nanotubes and closed-cage
structures. Example 13 illustrates the use of NASC polynucleotide
compositions of the present invention for formation of NASC
closed-cage compositions (NASC-CCs). NASC-CCs may be used for
packaging of small molecules. Example 14 describes methods that can
be used for characterization of NASC-CC/dCas protein complexes to
verify proper assembly and assess the size and volume of assembled
NASC-CC/dCas protein complexes. The NASC-CC described in Example 13
and Example 14 is illustrated in FIG. 6L. Two NASC polynucleotide
compositions corresponding to the NASC polynucleotide composition
illustrated in FIG. 6A (referred to in the Example as a
NASC-PC1-triplex) can be connected using double-stranded DNA brace
nucleic acid sequences. The double-stranded DNA brace nucleic acid
sequence can comprise a first DNA target sequence and a second DNA
target sequence. As described in Example 13, the NASC-CC is
self-assembling because a first NASC-PC1-triplex/dCas9 protein
nucleoprotein complex comprises DNA target binding sequences that
will specifically bind the first DNA target sequence of the brace
nucleic acid sequence. A second NASC-PC1-triplex/dCas9 protein
comprising DNA target binding sequences will specifically bind the
second DNA target sequence of the brace nucleic acid sequence to
form a closed cage structure. FIG. 6M illustrates the NASC-CC with
six associated Cas9 proteins forming a nucleoprotein cage.
[0294] A wide variety of molecules are candidates for incorporation
into NASC-CC polynucleotide compositions to facilitate delivery of
the molecules include, but not limited to, vaccines (e.g.,
inactivated vaccines, attenuated vaccines, protein subunit
vaccines, and nucleic acid vaccines); monoclonal antibodies;
antibiotics; small molecule drugs; cancer therapeutics; recombinant
proteins, biologics, and the like. Such molecules are also referred
to herein as "payload."
[0295] Fusions of targeting proteins and nucleic acid binding
proteins (e.g., Cas9, Cpf1) can be used to achieve tissue, organ,
or cell type targeted delivery of NASC-CC polynucleotide
compositions. For example, landscape phage peptides specific for
specific tumors can be obtained by affinity selection and purified
peptides specific for specific tumors can be fused to a Cas9
protein. The Cas9 fusion protein can then be used to assemble a
NASC-CC polynucleotide composition to obtain tumor-targeted
nanocarriers. Production of phage peptides specific for specific
tumors has been described by Jayanna, P., et al., Nanomedicine.
5(1):83 (2009).
[0296] Alternative modes of delivery of NASC-CC to cells can be
achieved through the linkage, packaging, or association of NASC-CC
RNAs, DNAs, or proteins ("NASC-CC/Cas") components with various
ligands or chemical agents. Packaging techniques include
NASC-CC/Cas packaging into self-assembling liposomes, micelles,
dendrimers, nanospheres, or nanocapsules.
[0297] Covalent and noncovalent attachment of polyethelyne glycol
(PEG; PEGylation) to molecules and macrostructures has been
employed for the packaging of payloads for target delivery to cells
and can be adapted for the encapsulation of NASC-CC/Cas by one of
ordinary skill in the art in view of the teachings of the present
specification. Furthermore, protein PEGylation is a widely
practiced form of conjugation chemistry for delivery of
macromolecules to tissues, cells, and organelles. PEGylated
structures can be further modified with molecular attachment of
moieties that facilitate cellular uptake (e.g., a folate moiety).
Selection of these moieties relies on the unique properties of
cells targeted for directed delivery of NASC-CC/Cas and the
encapsulated payload (i.e., extracellular matrix, receptors, or
antibody composition). These moieties can be attached to the
NASC-CC/Cas, NASC-CC packaging agent, or both the NASC-CC/Cas and
NASC-CC packaging agent. Moieties that can be used include, but are
not limited to, antibodies, ligands, transferrins, glycoproteins,
aptamers, cell penetrating peptides, matrix
metalloprotease-cleavable peptides, integrins, protein transduction
domains, epitopes, cell adhesion molecules, and other compounds
known in the art (see, e.g., Steichen, S. et. al., European Journal
of Pharmaceutical Sciences. 48(3):416-27 (2013); Dashpande, P., et
al., Nanomedicine. 8(9):1509-28 (2013)).
[0298] Trigger release of NASC-CC/Cas encapsulated agents can be
facilitated by the incorporation of distinct chemical moieties or
sequence motifs into the NASC-CC/Cas composition or within the
NASC-CC packaging agent. Attachment of biodegradable polymeric
compositions (e.g., a modified PEG composition) to a NASC-CC/Cas or
a NASC-CC packaging agent can allow for the breakdown of the
NASC-CC/Cas or NASC-CC packaging agent upon cellular uptake.
Engineered sensitive sites (i.e., proteolytic sensitive peptide
sequences, pH sensitive copolymers, redox sensitive linkages, etc.)
or combinations of engineered sensitive sites may be employed to
facilitate release of NASC-CC encapsulated agents. Labile linkages
between the NASC-CC and NASC-CC packaging agent, such as a pH
sensitive linkages, can be utilized to encourage disassociation
from the NASC-CC and the NASC-CC packaging agent in high pH
environments (e.g., an endocytic vacuole). NASC-CC/Cas complexes
can be further modified with organelle specific epitopes (i.e., a
nuclear localization signal) for delivery of payload to specific
organelles.
[0299] One of ordinary skill in the art, in view of the teachings
of the specification, can use a variety of different NASC
polynucleotide compositions to form a variety of
nanostructures.
[0300] Any of the components of the nucleoprotein compositions
comprising a NASC polynucleotide composition of the present
invention or nucleic acid sequences encoding such components, as
described above, can be incorporated into a kit, optionally
including one or more reagents. In some embodiments, a kit includes
a package with one or more containers holding the kit elements, as
one or more separate compositions or, optionally, as admixture
wherein the compatibility of the components will allow. In some
embodiments, kits also comprise a buffer, a buffering agent, a
salt, a sterile aqueous solution, and/or preservatives.
Illustrative kits comprise one or more components of a NASC
polynucleotide composition and optionally one or more cognate
nucleic acid binding proteins, such as a Cpf1 and/or a Cas9
protein; and one or more nucleic acid sequences encoding one or
more components of a NASC polynucleotide composition, and
optionally one or more nucleic acid sequences encoding a Cpf1
and/or a Cas9 protein.
[0301] Furthermore, kits can further comprise instructions for
using components of the nucleoprotein complexes comprising NASC
polynucleotide compositions of the present invention or nucleic
acid sequences encoding such components. Instructions included in
kits of the invention can be affixed to packaging material or can
be included as a package insert. Although the instructions are
typically written or printed materials, they are not limited to
such. Any medium capable of storing such instructions and
communicating them to an end user is contemplated by this
invention. Such media include, but are not limited to, electronic
storage media (e.g., magnetic discs, tapes, cartridges, chips),
optical media (e.g., CD ROM), RF tags, and the like. Instructions
can also include the address of an internet site that provides the
instructions.
[0302] Another aspect of the invention relates to methods of making
or manufacturing a NASC polynucleotide composition or a nucleic
acid/protein composition comprising a NASC polynucleotide
composition of the present invention. In one embodiment, the
methods of making or manufacturing comprise chemically synthesizing
polynucleotide components of a NASC polynucleotide composition. In
some embodiments, a NASC polynucleotide composition comprises RNA
bases and can be generated from DNA templates using in vitro
transcription.
[0303] In some embodiments, NASC polynucleotide composition
components can be modified by a moiety (e.g., a ligand moiety, a
ligand binding moiety, an affinity tag, an exonuclease resistance
moiety). Polynucleotide components can be connected to, for
example, the 5' terminal sequence and/or 3' terminal sequence of a
polynucleotide component.
[0304] A nucleic acid/protein composition comprising NASC
polynucleotide composition can further comprise a detectable label,
including a moiety that can provide a detectable signal. Examples
of detectable labels include, but are not limited to, an enzyme, a
radioisotope, a member of a specific binding pair, a fluorophore
(FAM), a fluorescent protein (green fluorescent protein, red
fluorescent protein, mCherry, tdTomato), an DNA or RNA aptamer
together with a suitable fluorophore (enhanced GFP (EGFP),
"Spinach"), a quantum dot, an antibody, and the like. A large
number and variety of suitable detectable labels are well-known to
one of ordinary skill in the art.
[0305] A nucleic acid/protein composition comprising a NASC
polynucleotide composition or cells modified by use of a nucleic
acid/protein composition comprising NASC polynucleotide
composition, as described herein, can be used as a pharmaceutical
composition formulated, for example, with a pharmaceutically
acceptable excipient. Illustrative excipients include carriers,
stabilizers, diluents, dispersing agents, suspending agents,
thickening agents, and the like. The pharmaceutical composition can
facilitate administration of a nucleic acid/protein composition
comprising an engineered NASC polynucleotide composition to an
organism. Pharmaceutical compositions can be administered in
therapeutically effective amounts by various forms and routes
including, for example, intravenous, subcutaneous, intramuscular,
oral, aerosol, parenteral, ophthalmic, and pulmonary
administration.
[0306] Numerous advantages may be obtained using the NASC
polynucleotide compositions and nucleoprotein complexes of the
present invention including, but not limited to, the following:
[0307] reduction in off-targeting binding using a nucleic
acid/protein composition comprising nucleic acid binding proteins
(e.g., Class 2 CRISPR-Cas proteins) and a NASC polynucleotide
composition that targets binding to multiple target nucleic acid
sequences using a single nucleoprotein complex relative to use of
similarly targeted individual NATNA/nucleic acid binding protein
complexes (e.g., a sgRNA/Cas9 protein complex); [0308] tethering of
a donor polynucleotide through use of a nucleic acid/protein
composition comprising nucleic acid binding proteins (e.g., Class 2
CRISPR-Cas proteins) and a NASC polynucleotide composition to bring
the donor polynucleotide into proximity of a cut in a
double-stranded nucleic acid; [0309] bringing two separate
polynucleotides (e.g., two different chromosomes) or two regions of
a single polynucleotide (e.g., two regions of a single chromosome)
into proximity of each other using a nucleic acid/protein
composition comprising nucleic acid binding proteins (e.g., Class 2
CRISPR-Cas proteins) and a NASC polynucleotide composition; [0310]
transcriptional modulation of a target gene by binding of a nucleic
acid/protein composition comprising nucleic acid binding proteins
(e.g., Class 2 CRISPR-Cas proteins) and a NASC polynucleotide
composition to multiple regulatory sequences operably linked to the
target gene; [0311] transcriptional modulation of a target gene by
binding of a nucleic acid/protein composition comprising nucleic
acid binding proteins (e.g., Class 2 CRISPR-Cas proteins) and a
NASC polynucleotide composition to bring two separate
polynucleotides (e.g., trans-acting regulatory element) or two
regions of a single polynucleotide (e.g., cis-acting regulatory
element) into proximity of each other; [0312] simultaneous
targeting of multiple target nucleic acid sequences using a nucleic
acid/protein composition comprising nucleic acid binding proteins
(e.g., Class 2 CRISPR-Cas proteins) and a NASC polynucleotide
composition, including embodiments wherein a donor polynucleotide
is also tethered to the nucleic acid/protein composition; [0313]
forming biological nanostructures comprising a nucleic acid/protein
composition comprising nucleic acid binding proteins (e.g., Class 2
CRISPR-Cas proteins) and a NASC polynucleotide composition, for
example, for pharmaceutical formulation of small molecules; [0314]
building nanoscale architectures with nucleic acid/protein
compositions comprising nucleic acid binding proteins (e.g., Class
2 CRISPR-Cas proteins) and NASC polynucleotide compositions that
have predefined sizes and shapes; and [0315] designing nucleic
acid/protein components, comprising nucleic acid/protein
compositions comprising nucleic acid binding proteins (e.g., Class
2 CRISPR-Cas proteins) and NASC polynucleotide compositions, that
self-assemble into predetermined complex architectures.
[0316] Various embodiments contemplated herein include, but are not
limited to, one or more of the following. The embodiments are
numbered for ease of reference.
[0317] Embodiments of the present invention include, but are not
limited to, the following.
[0318] 1. A complex of two or more engineered nucleic acid
sequences forming a scaffold, comprising: a first engineered
nucleic acid comprising--a first element 1 comprising a first
double-stranded nucleic acid binding protein binding sequence
having a first end and a second end--a second element 1 comprising
a repeat nucleic acid sequence 1, wherein the repeat nucleic acid
sequence 1 is proximal to the first end of the first
double-stranded nucleic acid binding protein binding sequence--a
third element 1 comprising a nucleic acid sequence 1;--and a second
engineered nucleic acid comprising, a first element 2 comprising a
second double-stranded nucleic acid binding protein binding
sequence, having a first end and a second end--a second element 2
comprising a repeat nucleic acid sequence 1C, wherein the repeat
nucleic acid sequence 1C is proximal to the first end of the first
double-stranded nucleic acid binding protein binding sequence--and
a third element 2 comprising a nucleic acid sequence 2; wherein the
repeat nucleic acid sequence 1 is associated with the repeat
nucleic acid sequence 1C through hydrogen bonding between the
repeat nucleic acid sequence 1 and the repeat nucleic acid sequence
1C.
[0319] 2. The complex of embodiment 1, wherein the first engineered
nucleic acid comprises--the first element 1 further comprising--the
first double-stranded nucleic acid binding protein binding
sequence, wherein the first end is a 5' end and the second end is a
3' end--the second element 1 further comprising the repeat nucleic
acid sequence 1 having a 5' end and a 3' end, wherein the 3' end of
the repeat nucleic acid sequence 1 is located 5' of the 5' end of
the first double-stranded nucleic acid binding protein binding
sequence--and the third element 1 further comprising the nucleic
acid sequence 1, having a 5' end and a 3' end, wherein the 5' end
of the nucleic acid sequence 1 is located 3' of the 3' end of the
first double-stranded nucleic acid binding protein binding
sequence; and--the second engineered nucleic acid comprises, the
first element 2 further comprising the second double-stranded
nucleic acid binding protein binding sequence, wherein the first
end is a 5' end and the second end is a 3' end--the second element
2 further comprising the repeat nucleic acid sequence 1C having a
5' end and a 3' end, wherein the 3' end of the repeat nucleic acid
sequence 1C is located 5' of the 5' end of the 5' end of the second
double-stranded nucleic acid binding protein binding sequence--and
the third element 2 further comprising the nucleic acid sequence 2
has a 5' end and a 3' end, wherein the 5' end of the nucleic acid
sequence 2 is located 3' of the 3' end of the second
double-stranded nucleic acid binding protein binding sequence.
[0320] 3. The complex of embodiment 1, wherein the first engineered
nucleic acid comprises,--the first element 1 further comprising the
first double-stranded nucleic acid binding protein binding
sequence, wherein the first end is a 5' end and the second end is a
3' end--the second element 1 further comprising the repeat nucleic
acid sequence 1, having a 5' end and a 3' end, wherein the 3' end
of the repeat nucleic acid sequence 1 is located 5' of the 5' end
of the first double-stranded nucleic acid binding protein binding
sequence--and the third element 1 further comprising the nucleic
acid sequence 1, having a 5' end and a 3' end, wherein the 3' end
of the nucleic acid sequence 1 is located 5' of the 5' end of the
repeat nucleic acid sequence 1; and the second engineered nucleic
acid comprises--the first element 2 further comprising the second
double-stranded nucleic acid binding protein binding sequence,
wherein the first end is a 5' end and the second end is a 3'
end--the second element 2 further comprising the repeat nucleic
acid sequence 1C having a 5' end and a 3' end, wherein the 3' end
of the repeat nucleic acid sequence 1C is located 5' of the 5' end
of the 5' end of the second double-stranded nucleic acid binding
protein binding sequence--and the third element 2 further
comprising the nucleic acid sequence 2 has a 5' end and a 3' end,
wherein the 3' end of the nucleic acid sequence 2 is located 5' of
the 5' end of the repeat nucleic acid sequence 1C.
[0321] 4. A complex of two or more engineered nucleic acid
sequences forming a scaffold, comprising: a first engineered
nucleic acid sequence comprising, a first element 1 comprising a
first nucleic acid binding Class 2 CRISPR protein binding sequence,
having a first end and a second end--a second element 1 comprising
a repeat nucleic acid sequence 1, wherein the repeat nucleic acid
sequence 1 is proximal to the first end of the first nucleic acid
binding Class 2 CRISPR protein binding sequence--and a third
element 1 comprising a nucleic acid sequence 1;--and a second
engineered nucleic acid sequence comprising, a first element 2
comprising a second nucleic acid binding Class 2 CRISPR protein
binding sequence, having a first end and a second end--a second
element 2 comprising a repeat nucleic acid sequence 1C, wherein the
repeat nucleic acid sequence 2 is proximal to the first end of the
second nucleic acid binding Class 2 CRISPR protein binding
sequence--and a third element 2 comprising a nucleic acid sequence
2; wherein the repeat nucleic acid sequence 1 is associated with
the repeat nucleic acid sequence 1C through hydrogen bonding
between the repeat nucleic acid sequence 1 and the repeat nucleic
acid sequence 1C.
[0322] 5. The complex of embodiment 4, wherein the first nucleic
acid binding Class 2 CRISPR protein binding sequence is a Class 2
Type V CRISPR protein binding sequence, wherein the first end is a
5' end and the second end is a 3' end--the repeat nucleic acid
sequence 1 has a 5' end and a 3' end, wherein the 3' end of the
repeat nucleic acid sequence 1 is located 5' of the 5' end of the
first nucleic acid binding Class 2 Type V CRISPR protein binding
sequence--and the nucleic acid sequence 1 has a 5' end and a 3'
end, wherein the 5' end of the nucleic acid sequence 1 is located
3' of the 3' end of the first nucleic acid binding Class 2 Type V
CRISPR protein binding sequence;--and the second nucleic acid
binding Class 2 CRISPR protein binding sequence is a Class 2 Type V
CRISPR protein binding sequence, wherein the first end is a 5' end
and the second end is a 3' end--the repeat nucleic acid sequence 2
has a 5' end and a 3' end, wherein the 3' end of the repeat nucleic
acid sequence 2 is located 5' of the 5' end of the second nucleic
acid binding Class 2 Type V CRISPR protein binding sequence--and
the nucleic acid sequence 2 has a 5' end and a 3' end, wherein the
5' end of the nucleic acid sequence 2 is located 3' of the 3' end
of the second nucleic acid binding Class 2 Type V CRISPR protein
binding sequence.
[0323] 6. The complex of embodiment 5, wherein the repeat nucleic
acid sequence 1 further comprises a linker element nucleic acid
sequence 1-1, having a 5' end and a 3' end--a repeat nucleic acid
sequence 1a, having a 5' end and a 3' end--a linker element nucleic
acid sequence 1-2, having a 5' end and a 3' end--a repeat nucleic
acid sequence 1b, having a 5' end and a 3' end--and a linker
element nucleic acid sequence 1-3, having a 5' end and a 3' end,
arranged in the following 3' to 5' order: the linker element
nucleic acid sequence 1-1, the repeat nucleic acid sequence 1a, the
linker element nucleic acid sequence 1-2, the repeat nucleic acid
sequence 1b, and the linker element nucleic acid sequence 1-3;--and
the repeat nucleic acid sequence 2 further comprises a linker
element nucleic acid sequence 2-1, having a 5' end and a 3' end--a
repeat nucleic acid sequence 1bC, having a 5' end and a 3' end--a
linker element nucleic acid sequence 2-2, having a 5' end and a 3'
end--a repeat nucleic acid sequence 2a, having a 5' end and a 3'
end--and a linker element nucleic acid sequence 2-3, having a 5'
end and a 3' end, arranged in the following 3' to 5' order: the
linker element nucleic acid sequence 2-1, the repeat nucleic acid
sequence 1bC, the linker element nucleic acid sequence 2-2, the
repeat nucleic acid sequence 2a, and the linker element nucleic
acid sequence 2-3; wherein the repeat nucleic acid sequence 1 is
associated with the repeat nucleic acid sequence 2 through hydrogen
bonding between the repeat nucleic acid sequence 1b and the repeat
nucleic acid sequence 1bC.
[0324] 7. The complex of embodiment 6, further comprising a third
engineered nucleic acid comprising, a first element 3 comprising a
third nucleic acid binding Class 2 Type V CRISPR protein binding
sequence, wherein the first end is a 5' end and the second end is a
3' end--and a second element 3 comprising a repeat nucleic acid
sequence 3 having a 5' end and a 3' end, wherein the 3' end of the
repeat nucleic acid sequence 3 is located 5' of the 5' end of the
third nucleic acid binding Class 2 Type V CRISPR protein binding
sequence, wherein the repeat nucleic acid binding sequence 3
further comprises a linker element nucleic acid sequence 3-1,
having a 5' end and a 3' end--a repeat nucleic acid sequence 2aC,
having a 5' end and a 3' end--a linker element nucleic acid
sequence 3-2, having a 5' end and a 3' end--a repeat nucleic acid
sequence 3a, having a 5' end and a 3' end--and a linker element
nucleic acid sequence 3-3, having a 5' end and a 3' end, arranged
in the following 3' to 5' order: the linker element nucleic acid
sequence 3-1, the repeat nucleic acid sequence 2aC, the linker
element nucleic acid sequence 3-2, the repeat nucleic acid sequence
3a, and the linker element nucleic acid sequence 3-3;--and a third
element 3 comprising a nucleic acid sequence 3, having a 5' end and
a 3' end, wherein the 5' end of the nucleic acid sequence 3 is
located 3' of the 3' end of the first nucleic acid binding Class 2
Type V CRISPR protein binding sequence;--and a fourth engineered
nucleic acid comprising, a first element 4 comprising a fourth
nucleic acid binding Class 2 Type V CRISPR protein binding
sequence, wherein the first end is a 5' end and the second end is a
3' end--a second element 4 comprising a repeat nucleic acid
sequence 4 having a 5' end and a 3' end, wherein the 3' end of the
repeat nucleic acid sequence 3 is located 5' of the 5' end of the
fourth nucleic acid binding Class 2 Type V CRISPR protein binding
sequence, wherein the repeat nucleic acid binding sequence 4
further comprises a linker element nucleic acid sequence 4-1,
having a 5' end and a 3' end--a repeat nucleic acid sequence 3aC,
having a 5' end and a 3' end--a linker element nucleic acid
sequence 4-2, having a 5' end and a 3' end--a repeat nucleic acid
sequence 1aC, having a 5' end and a 3' end--and a linker element
nucleic acid sequence 4-3, having a 5' end and a 3' end, arranged
in the following 3' to 5' order: the linker element nucleic acid
sequence 4-1, the repeat nucleic acid sequence 3aC, the linker
element nucleic acid sequence 4-2, the repeat nucleic acid sequence
1aC, and the linker element nucleic acid sequence 4-3;--and the
third element 4 further comprising the nucleic acid sequence 4,
having a 5' end and a 3' end, wherein the 5' end of the nucleic
acid sequence 4 is located 3' of the 3' end of the first nucleic
acid binding Class 2 Type V CRISPR protein binding sequence;
wherein the repeat nucleic acid sequence 1 is associated with the
repeat nucleic acid sequence 2 through hydrogen bonding between the
repeat nucleic acid sequence 1b and the repeat nucleic acid
sequence 1bC, the repeat nucleic acid sequence 1 is associated with
the repeat nucleic acid sequence 4 through hydrogen bonding between
the repeat nucleic acid sequence 1a and the repeat nucleic acid
sequence 1aC, the repeat nucleic acid sequence 2 is associated with
the repeat nucleic acid sequence 3 through hydrogen bonding between
the repeat nucleic acid sequence 2a and the repeat nucleic acid
sequence 2aC, and the repeat nucleic acid sequence 3 is associated
with the repeat nucleic acid sequence 4 through hydrogen bonding
between the repeat nucleic acid sequence 3a and the repeat nucleic
acid sequence 3aC.
[0325] 8. The complex of any one of embodiments 4 to 7, wherein the
repeat nucleic acid sequence 1 and the repeat nucleic acid sequence
2 further comprise a double-stranded nucleic acid binding protein
binding site 1 and the double-stranded nucleic acid binding protein
binding site 1 is formed by hydrogen base-pair bonding between the
repeat nucleic acid sequence 1 and the repeat nucleic acid sequence
2.
[0326] 9. The complex of embodiment 8, wherein the double-stranded
nucleic acid binding protein binding site 1 is a Csy4 protein
binding site.
[0327] 10. The complex of any one of embodiments 4 to 9, wherein
the first engineered nucleic acid and the second engineered nucleic
acid each comprises RNA, DNA, or a combination thereof.
[0328] 11. The complex of embodiment 7, wherein the first
engineered nucleic acid, the second engineered nucleic acid, the
third engineered nucleic acid, and the fourth engineered nucleic
acid each comprises RNA, DNA, or a combination thereof.
[0329] 12. The complex of any one of embodiments 5 to 11, wherein
the first nucleic acid binding Class 2 Type V CRISPR protein
binding sequence and the second nucleic acid binding Class 2 Type V
CRISPR protein binding sequence are each a Cpf1 protein binding
sequence.
[0330] 13. The complex of embodiment 7 or 11, wherein the first
nucleic acid binding Class 2 Type V CRISPR protein binding
sequence, the second nucleic acid binding Class 2 Type V CRISPR
protein binding sequence, the third nucleic acid binding Class 2
Type 5 CRISPR protein binding sequence, and the fourth nucleic acid
binding Class 2 Type V CRISPR protein binding sequence are each a
Cpf1 protein binding sequence.
[0331] 14. The complex of any one of embodiments 5, 6, 7, 8, 9, or
10, wherein (i) the nucleic acid sequence 1 further comprises a
spacer nucleic acid sequence 1 and the nucleic acid sequence 2
further comprises a spacer nucleic acid sequence 2, and (ii) the
spacer nucleic acid sequence 1 is complementary to a target nucleic
acid sequence 1 and the spacer nucleic acid sequence 2 is
complementary to a target nucleic acid sequence 2.
[0332] 15. The complex of embodiment 14, wherein target nucleic
acid sequence 1 and target nucleic acid sequence 2 are each a
nucleic acid sequence selected from the group consisting of a
single-stranded RNA, a single-stranded DNA, a double-stranded RNA,
a double-stranded DNA, a single-stranded RNA/DNA hybrid, and a
double-stranded RNA/DNA hybrid.
[0333] 16. The complex of any one of embodiments 7, 11, or 13,
wherein (i) the nucleic acid sequence 1 further comprises a spacer
nucleic acid sequence 1, the nucleic acid sequence 2 further
comprises a spacer nucleic acid sequence 2, the nucleic acid
sequence 3 further comprises a spacer nucleic acid sequence 3, and
the nucleic acid sequence 4 further comprises a spacer nucleic acid
sequence 4, and (ii) the spacer nucleic acid sequence 1 is
complementary to a target nucleic acid sequence 1, the spacer
nucleic acid sequence 2 is complementary to a target nucleic acid
sequence 2, the spacer nucleic acid sequence 3 is complementary to
a target nucleic acid sequence 3, and the spacer nucleic acid
sequence 4 is complementary to a target nucleic acid sequence
4.
[0334] 17. The complex of embodiment 16, wherein the target nucleic
acid sequence 1, the target nucleic acid sequence 2, the target
nucleic acid 3, and the target nucleic acid 4 are each a nucleic
acid sequence selected from the group consisting of a
single-stranded RNA, a single-stranded DNA, a double-stranded RNA,
a double-stranded DNA, a single-stranded RNA/DNA hybrid, and a
double-stranded RNA/DNA hybrid.
[0335] 18. A complex of the two or more engineered nucleic acid
sequences forming the scaffold of any one of embodiments 1 to 17,
the complex further comprising a first Class 2 Type V CRISPR
protein bound to the first nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, and a second Class 2 Type V CRISPR
protein bound to the second nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, wherein the first Class 2 Type V
CRISPR protein and the second Class 2 Type V CRISPR protein are
each selected from the group consisting of a Cpf1 protein and a
catalytically inactive Cpf1 protein.
[0336] 19. A complex of the two or more engineered nucleic acid
sequences forming the scaffold of any one of embodiments 7, 11, 13,
or 16, the complex further comprising a first Class 2 Type V CRISPR
protein bound to the first nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, a second Class 2 Type V CRISPR
protein bound to the second nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, a third Class 2 Type V CRISPR
protein bound to the third nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, and a fourth Class 2 Type V CRISPR
protein bound to the fourth nucleic acid binding Class 2 Type V
CRISPR protein binding sequence, wherein the first Class 2 Type V
CRISPR protein, the second Class 2 Type V CRISPR protein, the third
Class 2 Type V CRISPR protein, and the fourth Class 2 Type V CRISPR
protein are each selected from the group consisting of a Cpf1
protein and a catalytically inactive Cpf1 protein.
[0337] 20. The complex of embodiment 4, wherein the first nucleic
acid binding Class 2 CRISPR protein binding sequence is a Class 2
Type II CRISPR protein binding sequence, wherein the first end is a
5' end and the second end is a 3' end--the repeat nucleic acid
sequence 1 has a 5' end and a 3' end, wherein the 3' end of the
repeat nucleic acid sequence 1 is located 5' of the 5' end of the
first nucleic acid binding Class 2 Type II CRISPR protein binding
sequence--and the nucleic acid sequence 1 has a 5' end and a 3'
end, wherein the 3' end of the nucleic acid sequence 1 is located
5' of the 5' end of the repeat nucleic acid sequence 1;--and the
second nucleic acid binding Class 2 CRISPR protein binding sequence
is a Class 2 Type II CRISPR protein binding sequence, wherein the
first end is a 5' end and the second end is a 3' end--the repeat
nucleic acid sequence 1C has a 5' end and a 3' end, wherein the 3'
end of the repeat nucleic acid sequence 1C is located 5' of the 5'
end of the second nucleic acid binding Class 2 Type II CRISPR
protein binding sequence--and the nucleic acid sequence 2, having a
5' end and a 3' end, wherein the 3' end of the nucleic acid
sequence 2 is located 5' of the 5' end of the repeat nucleic acid
sequence 1C.
[0338] 21. The complex of embodiment 20, wherein the repeat nucleic
acid sequence 1 further comprises a linker element nucleic acid
sequence 1-1, having a 5' end and a 3' end--a repeat nucleic acid
sequence 1a, having a 5' end and a 3' end--a linker element nucleic
acid sequence 1-2, having a 5' end and a 3' end--a repeat nucleic
acid sequence 1b, having a 5' end and a 3' end--and a linker
element nucleic acid sequence 1-3, having a 5' end and a 3' end,
arranged in the following 3' to 5' order: the linker element
nucleic acid sequence 1-1, the repeat nucleic acid sequence 1a, the
linker element nucleic acid sequence 1-2, the repeat nucleic acid
sequence 1b, and the linker element nucleic acid sequence 1-3;--and
the repeat nucleic acid sequence 2 further comprises a linker
element nucleic acid sequence 2-1, having a 5' end and a 3' end--a
repeat nucleic acid sequence 1aC, having a 5' end and a 3' end--a
linker element nucleic acid sequence 2-2, having a 5' end and a 3'
end--a repeat nucleic acid sequence 1bC, having a 5' end and a 3'
end--and a linker element nucleic acid sequence 2-3, having a 5'
end and a 3' end, arranged in the following 3' to 5' order: the
linker element nucleic acid sequence 2-3, the repeat nucleic acid
sequence 1bC, the linker element nucleic acid sequence 2-2, the
repeat nucleic acid sequence 1aC, and the linker element nucleic
acid sequence 2-1; wherein the repeat nucleic acid sequence 1 is
associated with the repeat nucleic acid sequence 2 through hydrogen
bonding between the repeat nucleic acid sequence 1a and the repeat
nucleic acid sequence 1aC and through hydrogen bonding between the
repeat nucleic acid sequence 1b and the repeat nucleic acid
sequence 1bC.
[0339] 22. The complex of embodiment 21, wherein the repeat nucleic
acid sequence 1a further comprises a repeat nucleic acid sequence
1a1, having a 5' end and a 3' end--a bulge nucleic acid sequence
1a1, having a 5' end and a 3' end--and a repeat nucleic acid
sequence 1a2, having a 5' end and a 3' end, arranged in the
following 3' to 5' order: the repeat nucleic acid sequence 1a1, the
bulge nucleic acid sequence 1a1, and the repeat nucleic acid
sequence 1a2;--and the repeat nucleic acid sequence 1b further
comprises a repeat nucleic acid sequence 1b1, having a 5' end and a
3' end--a bulge nucleic acid sequence 1b1, having a 5' end and a 3'
end--and a repeat nucleic acid sequence 1b2, having a 5' end and a
3' end, arranged in the following 3' to 5' order: the repeat
nucleic acid sequence 1b1, the bulge nucleic acid sequence 1b 1,
and the repeat nucleic acid sequence 1b2; and the repeat nucleic
acid sequence 1bC further comprises a repeat nucleic acid sequence
1b2C, having a 5' end and a 3' end--a bulge nucleic acid sequence
2b2, having a 5' end and a 3' end--and a repeat nucleic acid
sequence 1b1C, having a 5' end and a 3' end, arranged in the
following 3' to 5' order: the repeat nucleic acid sequence 1b2C,
the bulge nucleic acid sequence 2b2, and the repeat nucleic acid
sequence 1b1C--and the repeat nucleic acid sequence 1aC further
comprises a repeat nucleic acid sequence 1a2C, having a 5' end and
a 3' end--a bulge nucleic acid sequence 2a2, having a 5' end and a
3' end--and a repeat nucleic acid sequence 1a1C, having a 5' end
and a 3' end, arranged in the following 3' to 5' order: the repeat
nucleic acid sequence 1a2C, the bulge nucleic acid sequence 2a2,
and the repeat nucleic acid sequence 1a1C; wherein the repeat
nucleic acid sequence 1 is associated with the repeat nucleic acid
sequence 2 through hydrogen bonding between the repeat nucleic acid
sequence 1a1 and the repeat nucleic acid sequence 1a1C, the repeat
nucleic acid sequence 1a2 and the repeat nucleic acid sequence
1a2C, the repeat nucleic acid sequence 1b1 and the repeat nucleic
acid sequence 1b1C, the repeat nucleic acid sequence 1b2 and the
repeat nucleic acid sequence 1b2C.
[0340] 23. The complex of any one of embodiments 20, 21, or 22,
wherein the repeat nucleic acid sequence 1 and the repeat nucleic
acid sequence 2 comprise a double-stranded nucleic acid binding
protein binding site 1 and the double-stranded nucleic acid binding
protein binding site 1 is formed by hydrogen base-pair bonding
between the repeat nucleic acid sequence 1 and the repeat nucleic
acid sequence 2.
[0341] 24. The complex of embodiment 23, wherein the
double-stranded nucleic acid binding protein binding site 1 is a
Csy4 protein binding site.
[0342] 25. The complex of any one of embodiments 20 to 24, wherein
the first engineered nucleic acid and the second engineered nucleic
acid each comprises RNA, DNA, or a combination thereof.
[0343] 26. The complex of any one of embodiments 20 to 25, wherein
the first nucleic acid binding Class 2 Type II CRISPR protein
binding sequence and the second nucleic acid binding Class 2 Type
II CRISPR protein binding sequence are each a Cas9 protein binding
sequence.
[0344] 27. The complex of any one of embodiments 20 to 26, wherein
(i) the nucleic acid sequence 1 further comprises a spacer nucleic
acid sequence 1 and the nucleic acid sequence 2 further comprises a
spacer nucleic acid sequence 2, and (ii) the spacer nucleic acid
sequence 1 is complementary to a target nucleic acid sequence 1 and
the spacer nucleic acid sequence 2 is complementary to a target
nucleic acid sequence 2.
[0345] 28. The complex of embodiment 27, wherein the target nucleic
acid sequence 1 and the target nucleic acid sequence 2 are each a
nucleic acid sequence selected from the group consisting of a
single-stranded RNA, a single-stranded DNA, a double-stranded RNA,
a double-stranded DNA, a single-stranded RNA/DNA hybrid, and a
double-stranded RNA/DNA hybrid.
[0346] 29. A complex of the two or more engineered nucleic acid
sequences forming the scaffold of any one of embodiments 20 to 28,
the complex further comprising a first Class 2 Type II CRISPR
protein bound to the first nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, and a second Class 2 Type II
CRISPR protein bound to the second nucleic acid binding Class 2
Type II CRISPR protein binding sequence, wherein the first Class 2
Type II CRISPR protein and the second Class 2 Type II CRISPR
protein are each selected from the group consisting of a Cas9
protein and a catalytically inactive Cas9 protein.
[0347] 30. A complex of three or more engineered nucleic acid
sequences forming a scaffold, comprising: a first engineered
nucleic acid comprising, a first CRISPR element 1 comprising--a
first nucleic acid binding Class 2 Type II CRISPR protein binding
sequence, having a 5' end and a 3' end--and a repeat nucleic acid
sequence 1, having a 5' end and a 3' end, wherein the 3' end of the
repeat nucleic acid sequence 1 is located 5' of the 5' end of the
first nucleic acid binding Class 2 Type II CRISPR protein binding
sequence, the repeat nucleic acid sequence 1 further comprising, a
linker element nucleic acid sequence 1-1, having a 5' end and a 3'
end--a repeat nucleic acid sequence 1a, having a 5' end and a 3'
end--a linker element nucleic acid sequence 1-2, having a 5' end
and a 3' end--a repeat nucleic acid sequence 1b, having a 5' end
and a 3' end--and a linker element nucleic acid sequence 1-3,
having a 5' end and a 3' end, arranged in the following 3' to 5'
order: the linker element nucleic acid sequence 1-1, the repeat
nucleic acid sequence 1a, the linker element nucleic acid sequence
1-2, the repeat nucleic acid sequence 1b, and the linker element
nucleic acid sequence 1-3;--and a second CRISPR element 1 further
comprising a nucleic acid sequence 1, having a 5' end and a 3' end,
wherein (i) the 3' end of the nucleic acid sequence 1 is located 5'
of the 5' end of the repeat nucleic acid sequence 1, and (ii) the
nucleic acid sequence 1 comprises a spacer nucleic acid sequence
1;--a second engineered nucleic acid comprising,--a first CRISPR
element 2 comprising--a second nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, having a 5' end and a 3' end--and
a repeat nucleic acid sequence 2, having a 5' end and a 3' end,
wherein the 3' end of the repeat nucleic acid sequence 2 is located
5' of the 5' end of the second nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, the repeat nucleic acid sequence 2
further comprising--a linker element nucleic acid sequence 2-3,
having a 5' end and a 3' end--a repeat nucleic acid sequence 1bC,
having a 5' end and a 3' end--a linker element nucleic acid
sequence 2-4, having a 5' end and a 3' end--a repeat nucleic acid
sequence 2a, having a 5' end and a 3' end--and a linker element
nucleic acid sequence 2-5, having a 5' end and a 3' end, arranged
in the following 3' to 5' order: the linker element nucleic acid
sequence 2-3, the repeat nucleic acid sequence 1bC, the linker
element nucleic acid sequence 2-4, the repeat nucleic acid sequence
2a, and the linker element nucleic acid sequence 2-5;--a second
CRISPR element 2 comprising a nucleic acid sequence 2, having a 5'
end and a 3' end, wherein (i) the 3' end of the nucleic acid
sequence 1 is located 5' of the 5' end of the repeat nucleic acid
sequence 2, and (ii) the nucleic acid sequence 2 comprises a spacer
nucleic acid sequence 2;--and a third engineered nucleic acid
comprising, a first CRISPR element 3 comprising a third nucleic
acid binding Class 2 Type II CRISPR protein binding sequence,
having a 5' end and a 3' end--and a repeat nucleic acid sequence 3,
having a 5' end and a 3' end, wherein the 3' end of the repeat
nucleic acid sequence 3 is located 5' of the 5' end of the third
nucleic acid binding Class 2 Type II CRISPR protein binding
sequence, the repeat nucleic acid sequence 3 further comprising a
linker element nucleic acid sequence 3-1, having a 5' end and a 3'
end--a repeat nucleic acid sequence 2aC, having a 5' end and a 3'
end--a linker element nucleic acid sequence 3-2, having a 5' end
and a 3' end--a repeat nucleic acid sequence 1aC-1, having a 5' end
and a 3' end--and a linker element nucleic acid sequence 3-3,
having a 5' end and a 3' end, arranged in the following 3' to 5'
order: the linker element nucleic acid sequence 3-1, the repeat
nucleic acid sequence 2aC, the linker element nucleic acid sequence
3-2, the repeat nucleic acid sequence 1aC-1, and the linker element
nucleic acid sequence 3-3; a second CRISPR element 3 comprising a
nucleic acid sequence 3, having a 5' end and a 3' end, wherein (i)
the 3' end of the nucleic acid sequence 3 is located 5' of the 5'
end of the repeat nucleic acid sequence 3, and (ii) the nucleic
acid sequence 3 comprises a spacer nucleic acid sequence 3; wherein
repeat nucleic acid sequence 1a is associated with the repeat
nucleic acid sequence 1aC-1 through hydrogen bonding between the
repeat nucleic acid sequence 1a and the repeat nucleic acid
sequence 1aC-1, the repeat nucleic acid sequence 1b is associated
with the repeat nucleic acid sequence 1bC through hydrogen bonding
between the repeat nucleic acid sequence 1b and the repeat nucleic
acid sequence 1bC, and the repeat nucleic acid sequence 2a is
associated with the repeat nucleic acid sequence 2aC through
hydrogen bonding between the repeat nucleic acid sequence 2a and
the repeat nucleic acid sequence 2aC.
[0348] 31. The complex of embodiment 30, wherein the repeat nucleic
acid sequence 1 and the repeat nucleic acid sequence 2 comprise a
double-stranded nucleic acid binding protein binding site 1 and the
double-stranded nucleic acid binding protein binding site 1 is
formed by hydrogen base-pair bonding between the repeat nucleic
acid sequence 1 and the repeat nucleic acid sequence 2.
[0349] 32. The complex of embodiment 31, wherein the
double-stranded nucleic acid binding protein binding site 1 is a
Csy4 protein binding site.
[0350] 33. The complex of any one of embodiments 30, 31, or 32,
wherein the first engineered nucleic acid, the second engineered
nucleic acid, and the third engineered nucleic acid each comprises
RNA, DNA, or a combination thereof.
[0351] 34. The complex of any one of embodiments 30 to 33, wherein
the first nucleic acid binding Class 2 Type II CRISPR protein
binding sequence, the second nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, and the third nucleic acid binding
Class 2 Type II CRISPR protein binding sequence are each a Cas9
protein binding sequence.
[0352] 35. The complex of any one of embodiments 30 to 34, wherein
(i) the nucleic acid sequence 1 further comprises a spacer nucleic
acid sequence 1, the nucleic acid sequence 2 further comprises a
spacer nucleic acid sequence 2, and the nucleic acid sequence 3
further comprises a spacer nucleic acid sequence 3, and (ii) the
spacer nucleic acid sequence 1 is complementary to a target nucleic
acid sequence 1, the spacer nucleic acid sequence 2 is
complementary to a target nucleic acid sequence 2, and the spacer
nucleic acid sequence 3 is complementary to a target nucleic acid
sequence 3.
[0353] 36. The complex of embodiment 35, wherein the target nucleic
acid sequence 1, the target nucleic acid sequence 2, and the target
nucleic acid sequence 3 are each a nucleic acid sequence selected
from the group consisting of a single-stranded RNA, a
single-stranded DNA, a double-stranded RNA, a double-stranded DNA,
a single-stranded RNA/DNA hybrid, and a double-stranded RNA/DNA
hybrid.
[0354] 37. A complex of the three or more engineered nucleic acid
sequences forming the scaffold of any one of embodiments 30 to 36,
the complex further comprising a first Class 2 Type II CRISPR
protein bound to the first nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, a second Class 2 Type II CRISPR
protein bound to the second nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, and a third Class 2 Type II CRISPR
protein bound to the third nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, wherein the first Class 2 Type II
CRISPR protein, the second Class 2 Type II CRISPR protein, and the
third Class 2 Type II CRISPR protein are each selected from the
group consisting of a Cas9 protein and a catalytically inactive
Cas9 protein.
[0355] 38. A complex of two or more engineered nucleic acid
sequences forming a scaffold, comprising: an engineered
concatenated nucleic acid 1 having a 5' end and a 3' end comprising
a first concatenate element 1 comprising a first nucleic acid
binding Class 2 Type II CRISPR protein binding sequence, having a
5' end and a 3' end--a second concatenate element 1 comprising a
repeat nucleic acid sequence A1 having a 5' end and a 3' end
wherein the first nucleic acid binding Class 2 Type II CRISPR
protein binding sequence is located 3' of the 3' end of the repeat
nucleic acid sequence A1--a first concatenate element 2 comprising
a second nucleic acid binding Class 2 Type II CRISPR protein
binding sequence, having a 5' end and a 3' end--a second
concatenate element 2 comprising a repeat nucleic acid sequence A2,
having a 5' end and a 3' end, wherein the second nucleic acid
binding Class 2 Type II CRISPR protein binding sequence is located
3' of the 3' end of the repeat nucleic acid sequence A2, wherein
the 5' end of the first concatenate element 1 is covalently bound
to the 3' end of the first concatenate element 2 to form the
engineered concatenated nucleic acid 1;--a third concatenate
element 1 having a 5' end and a 3' end comprising a repeat nucleic
acid sequence A1C having a 5' end and a 3' end and a nucleic acid
sequence 1 having a 5' end and a 3' end, wherein the nucleic acid
sequence 1 is located 5' of the 5' end of the repeat nucleic acid
sequence A1C, wherein (i) the repeat nucleic acid sequence A1C is
complementary to the repeat nucleic acid sequence A1, (ii) the
repeat nucleic acid sequence A1C is associated with the repeat
nucleic acid sequence A1 through hydrogen bonding between the
repeat nucleic acid sequence A1C and the repeat nucleic acid
sequence A1;--and a third concatenate element 2 having a 5' end and
a 3' end comprising a repeat nucleic acid sequence A2C having a 5'
end and a 3' end and a nucleic acid sequence 2 having a 5' end and
a 3' end, wherein the nucleic acid sequence 2 is located 5' of the
5' end of the repeat nucleic acid sequence A2C, wherein (i) the
repeat nucleic acid sequence A2C is complementary to the repeat
nucleic acid sequence A2, (ii) the repeat nucleic acid sequence A2C
is associated to the repeat nucleic acid sequence A2, and (iii) the
repeat nucleic acid sequence A2C is associated with the repeat
nucleic acid sequence A2 through hydrogen bonding between the
repeat nucleic acid sequence A2C and the repeat nucleic acid
sequence A2.
[0356] 39. The complex of embodiment 38, wherein the repeat nucleic
acid sequence A1 further comprises a linker element nucleic acid
sequence A1-1 having a 5' end and a 3' end, the 3' end of the
linker element nucleic acid sequence A1-1 located 5' of the 5' end
of the first nucleic acid binding Class 2 Type II CRISPR protein
binding sequence, the linker element nucleic acid sequence A1-1
comprising, a repeat nucleic acid sequence A1-1 having a 5' end and
a 3' end, and a bulge nucleic acid sequence A1-1, having a 5' end
and a 3' end, the 3' end of the bulge nucleic acid sequence A1-1
adjacent the 5' end of the repeat nucleic acid sequence A1-1--and a
linker element nucleic acid sequence A1-2, having a 5' end and a 3'
end, comprising, a repeat nucleic acid sequence A1-2, having a 5'
end and a 3' end, the 3' end of the linker element nucleic acid
sequence A1-2 located 5' of the 5' end of the linker element
nucleic acid A1-1;--the repeat nucleic acid sequence A2 further
comprises a linker element nucleic acid sequence A2-1 having a 5'
end and a 3' end, the 3' end of the linker element nucleic acid
sequence A2-1 located 5' of the 5' end of the second nucleic acid
binding Class 2 Type II CRISPR protein binding sequence, the linker
element nucleic acid sequence A2-1 comprising, a repeat nucleic
acid sequence A2-1 having a 5' end and a 3' end, and a bulge
nucleic acid sequence A2-1, having a 5' end and a 3' end, the 3'
end of the bulge nucleic acid sequence A2-1 adjacent the 5' end of
the repeat nucleic acid sequence A2-1--and a linker element nucleic
acid sequence A2-2, having a 5' end and a 3' end, comprising, a
repeat nucleic acid sequence A2-2, having a 5' end and a 3' end,
the 3' end of the linker element nucleic acid sequence A2-2 located
5' of the 5' end of the linker element nucleic acid A2-1;--the
third concatenate element 1 wherein the repeat nucleic acid
sequence A1C further comprises a linker element nucleic acid
sequence A1-1C comprising a repeat nucleic acid sequence A1-1C
having a 5' end and a 3' end, the 5' end of the repeat nucleic acid
sequence A1-1C located 3' of the 3' end of the nucleic acid
sequence 1, and a bulge nucleic acid sequence A1-1C, having a 5'
end and a 3' end, the 5' end of the bulge nucleic acid sequence
A1-1C located 3' of the 3' end of the repeat nucleic acid sequence
A1-1C, wherein (i) the repeat nucleic acid sequence A1-1C is
complementary to the repeat nucleic acid sequence A1-1, and (ii)
the repeat nucleic acid sequence A1-1C is associated with the
repeat nucleic acid sequence A1-1 through hydrogen bonding between
the repeat nucleic acid sequence A1-1C and the repeat nucleic acid
sequence A1-1--and a linker element nucleic acid sequence A1-2C
having a 5' end and a 3' end, comprising a repeat nucleic acid
sequence A1-2C, having a 5' end and a 3' end, the 5' end of the
linker element nucleic acid sequence A1-2C located 3' of the 3' end
of the linker element nucleic acid sequence A1-1C, wherein (i) the
repeat nucleic acid sequence A1-2C is complementary to the repeat
nucleic acid sequence A1-2, and (ii) the repeat nucleic acid
sequence A1-2C is associated with the repeat nucleic acid sequence
A1-2 through hydrogen bonding between the repeat nucleic acid
sequence A1-2C and the repeat nucleic acid sequence A1-2;--and the
repeat nucleic acid sequence A2C further comprises a linker element
nucleic acid sequence A2-1C comprising a repeat nucleic acid
sequence A2-1C having a 5' end and a 3' end, the 5' end of the
repeat nucleic acid sequence A2-1C located 3' of the 3' end of the
nucleic acid sequence 2, and a bulge nucleic acid sequence A2-1C,
having a 5' end and a 3' end, the 5' end of the bulge nucleic acid
sequence A2-1C located 3' of the 3' end of the repeat nucleic acid
sequence A2-1C, wherein (i) the repeat nucleic acid sequence A2-1C
is complementary to the repeat nucleic acid sequence A2-1, and (ii)
the repeat nucleic acid sequence A2-1C is associated with the
repeat nucleic acid sequence A2-1 through hydrogen bonding between
the repeat nucleic acid sequence A2-1C and the repeat nucleic acid
sequence A2-1--and a linker element nucleic acid sequence A2-2C
having a 5' end and a 3' end, comprising a repeat nucleic acid
sequence A2-2C, having a 5' end and a 3' end, the 5' end of the
linker element nucleic acid sequence A2-2C located 3' of the 3' end
of the linker element nucleic acid sequence A2-1C, wherein (i) the
repeat nucleic acid sequence A2-2C is complementary to the repeat
nucleic acid sequence A2-2, and (ii) the repeat nucleic acid
sequence A2-2C is associated with the repeat nucleic acid sequence
A2-2 through hydrogen bonding between the repeat nucleic acid
sequence A2-2C and the repeat nucleic acid sequence A2-2.
[0357] 40. The complex of embodiment 38 or 39, wherein the repeat
nucleic acid sequence A1 and the repeat nucleic acid sequence A1C
further comprise a double-stranded nucleic acid binding protein
binding site 1 and the double-stranded nucleic acid binding protein
binding site 1 is formed by hydrogen base-pair bonding between the
repeat nucleic acid sequence A1 and the repeat nucleic acid
sequence A1C.
[0358] 41. The complex of any one of embodiments 38 to 40, wherein
the repeat nucleic acid sequence A2 and the repeat nucleic acid
sequence A2C further comprise a double-stranded nucleic acid
binding protein binding site 2 and the double-stranded nucleic acid
binding protein binding site 2 is formed by hydrogen base-pair
bonding between the repeat nucleic acid sequence A2 and the repeat
nucleic acid sequence A2C.
[0359] 42. The complex of embodiment 40 or 41, wherein the
double-stranded nucleic acid binding protein binding site 1 is a
Csy4 protein binding site.
[0360] 43. The complex of any one of 38 to 42, wherein the
engineered concatenated nucleic acid 1, the third concatenate
element 1, and the third concatenate element 2 each comprises RNA,
DNA, or a combination thereof.
[0361] 44. The complex of any one of 38 to 43, wherein the first
nucleic acid binding Class 2 Type II CRISPR protein binding
sequence and the second nucleic acid binding Class 2 Type II CRISPR
protein binding sequence are each a Cas9 protein binding
sequence.
[0362] 45. The complex of any one of 38 to 44, wherein (i) the
nucleic acid sequence 1 further comprises a spacer nucleic acid
sequence 1 and the nucleic acid sequence 2 further comprises a
spacer nucleic acid sequence 2, and (ii) the spacer nucleic acid
sequence 1 is complementary to a target nucleic acid sequence 1 and
the spacer nucleic acid sequence 2 is complementary to a target
nucleic acid sequence 2.
[0363] 46. The complex of embodiment 45, wherein the target nucleic
acid sequence 1 and the target nucleic acid sequence 2 are each a
nucleic acid sequence selected from the group consisting of a
single-stranded RNA, a single-stranded DNA, a double-stranded RNA,
a double-stranded DNA, a single-stranded RNA/DNA hybrid, and a
double-stranded RNA/DNA hybrid.
[0364] 47. A complex of the two or more engineered nucleic acid
sequences forming the scaffold of any one of embodiments 38 to 46
the complex further comprising a first Class 2 Type II CRISPR
protein bound to the first nucleic acid binding Class 2 Type II
CRISPR protein binding sequence and a second Class 2 Type II CRISPR
protein bound to the second nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, wherein the first Class 2 Type II
CRISPR protein and the second Class 2 Type II CRISPR protein are
each selected from the group consisting of a Cas9 protein and a
catalytically inactive Cas9 protein.
[0365] 48. A complex of two or more engineered nucleic acid
sequences forming a scaffold, comprising: an engineered
concatenated split-nexus nucleic acid 1, having a 5' end and a 3'
end, comprising a first split-nexus element 1, having a 5' end and
a 3' end, comprising a first nucleic acid binding Class 2 Type II
CRISPR protein binding sequence and a split-nexus stem element
nucleic acid sequence 1-1 having a 5' end and a 3' end wherein the
first nucleic acid binding Class 2 Type II CRISPR protein binding
sequence is located 3' to the 3' end of the split-nexus stem
element nucleic acid sequence 1-1--and a first split-nexus element
2 having a 5' end and a 3' end, comprising a second nucleic acid
binding Class 2 Type II CRISPR protein binding sequence and a
split-nexus stem element nucleic acid sequence 2-1 having a 5' end
and a 3' end wherein the second nucleic acid binding Class 2 Type
II CRISPR protein binding sequence is located 3' to the 3' end of
the split-nexus stem element nucleic acid sequence 2-1,--and an
auxiliary polynucleotide 1-1 having a 5' end and a 3' end, wherein
the 5' end of the first split-nexus element 1 is covalently bound
to the 3' end of the auxiliary polynucleotide 1-1, and the 5' end
of the auxiliary polynucleotide 1-1 is covalently bound to the 3'
end of the first split-nexus element 2 to form the concatenated
split-nexus element;--a second split-nexus element 1, having a 5'
end and a 3' end, comprising a nucleic acid sequence 1 having a 5'
end and a 3' end and a first stem element nucleic acid sequence 1-1
having a 5' end and a 3' end, wherein the 3' end of the nucleic
acid sequence 1 is covalently bound to the 5' end of the first stem
element nucleic acid sequence 1-1--a loop element nucleic acid
sequence 1 having a 5' end and a 3' end, wherein the 3' end of the
first stem element nucleic acid sequence 1-1 is covalently bound to
the 5' end of the loop element nucleic acid sequence 1--a first
stem element nucleic acid sequence 1-2 having a 5' end and a 3'
end, wherein the 3' end of the loop element nucleic acid sequence 1
is covalently bound to the 5' end of the first stem element nucleic
acid sequence 1-2--a connective nucleic acid sequence 1 having a 5'
end and a 3' end, wherein the 3' end of the first stem element
nucleic acid sequence 1-2 is covalently bound to the 5' end of the
connective nucleic acid sequence 1--and a split-nexus stem element
nucleic acid sequence 1-2, wherein the 3' end of the connective
nucleic acid sequence 1 is covalently bound to the 5' end of the
split-nexus stem element nucleic acid sequence 1-2, wherein (i) the
first stem element nucleic acid sequence 1-1 and the first stem
element nucleic acid sequence 1-2 form a first stem element 1 by
hydrogen base-pair bonding between the first stem element nucleic
acid sequence 1-1 and the first stem element nucleic acid sequence
1-2, and (ii) the split-nexus stem element nucleic acid sequence
1-1 and the split-nexus stem element nucleic acid sequence 1-2 form
a split-nexus stem element 1 by hydrogen base-pair bonding between
the split-nexus stem element nucleic acid sequence 1-1 and the
split-nexus stem element nucleic acid sequence 1-2;--and a second
split-nexus element 2, having a 5' end and a 3' end, comprising a
nucleic acid sequence 2 having a 5' end and a 3' end and a first
stem element nucleic acid sequence 2-1 having a 5' end and a 3'
end, wherein the 3' end of the nucleic acid sequence 2 is
covalently bound to the 5' end of the first stem element nucleic
acid sequence 2-1--a loop element nucleic acid sequence 2 having a
5' end and a 3' end, wherein the 3' end of the first stem element
nucleic acid sequence 2-1 is covalently bound to the 5' end of the
loop element nucleic acid sequence 2--a first stem element nucleic
acid sequence 2-2 having a 5' end and a 3' end, wherein the 3' end
of the loop element nucleic acid sequence 2 is covalently bound to
the 5' end of the first stem element nucleic acid sequence 2-2--a
connective nucleic acid sequence 2 having a 5' end and a 3' end,
wherein the 3' end of the first stem element nucleic acid sequence
2-2 is covalently bound to the 5' end of the connective nucleic
acid sequence 2--and a split-nexus stem element nucleic acid
sequence 2-2, wherein the 3' end of the connective nucleic acid
sequence 1 is covalently bound to the 5' end of the split-nexus
stem element nucleic acid sequence 2-2, wherein (i) the first stem
element nucleic acid sequence 2-1 and the first stem element
nucleic acid sequence 2-2 form a first stem element 2 by hydrogen
base-pair bonding between the first stem element nucleic acid
sequence 2-1 and the first stem element nucleic acid sequence 2-2,
and (ii) the split-nexus stem element nucleic acid sequence 2-1 and
the split-nexus stem element nucleic acid sequence 2-2 form a
split-nexus stem element 2 by hydrogen base-pair bonding between
the split-nexus stem element nucleic acid sequence 2-1 and the
split-nexus stem element nucleic acid sequence 2-2.
[0366] 49. The complex of embodiment 48, wherein the first stem
element 1 further comprises in a 5' to 3' direction a lower stem
element nucleic acid sequence 1-1, a bulge element nucleic acid
sequence 1-1, an upper stem element nucleic acid sequence 1-1, the
loop element nucleic acid sequence 1, an upper stem element nucleic
acid sequence 1-2, a bulge element nucleic acid sequence 1-2, and a
lower stem element nucleic acid sequence 1-2, wherein the upper
stem element nucleic acid sequence 1-1 and the upper stem element
nucleic acid sequence 1-2 form an upper stem element 1 by hydrogen
base-pair bonding between the upper stem element nucleotide
sequence 1-1 and the upper stem element nucleotide sequence 1-2,
and the lower stem element nucleic acid sequence 1-1 and the lower
stem element nucleic acid sequence 1-2 form a lower stem element 1
by hydrogen base-pair bonding between the lower stem element
nucleic acid sequence 1-1 and the lower stem element nucleotide
sequence 1-2.
[0367] 50. The complex of embodiment 48 or 49, wherein the first
stem element 2 further comprises in a 5' to 3' direction a lower
stem element nucleic acid sequence 2-1, a bulge element nucleic
acid sequence 2-1, an upper stem element nucleic acid sequence 2-1,
the loop element nucleic acid sequence 2, an upper stem element
nucleic acid sequence 2-2, a bulge element nucleic acid sequence
2-2, and a lower stem element nucleic acid sequence 2-2, wherein
the upper stem element nucleic acid sequence 2-1 and the upper stem
element nucleic acid sequence 2-2 form an upper stem element 2 by
hydrogen base-pair bonding between the upper stem element
nucleotide sequence 2-1 and the upper stem element nucleotide
sequence 2-2, and the lower stem element nucleic acid sequence 2-1
and the lower stem element nucleic acid sequence 2-2 form a lower
stem element 2 by hydrogen base-pair bonding between the lower stem
element nucleic acid sequence 2-1 and the lower stem element
nucleotide sequence 2-2.
[0368] 51. The complex of any one of embodiments 48 to 50, wherein
the second split-nexus element 1 further comprises an auxiliary
polynucleotide 1-2, having a 5' and a 3' end, wherein 5' end of the
auxiliary polynucleotide 1-2 is 3' of the 3' end of the split-nexus
stem element nucleic acid sequence 1-2, wherein the auxiliary
polynucleotide 1-2 is associated with the auxiliary polynucleotide
1-1 through hydrogen base-pair bonding.
[0369] 52. The complex of embodiment 51, wherein the auxiliary
polynucleotide 1-1 and the auxiliary polynucleotide 1-2 further
comprise a double-stranded nucleic acid binding protein binding
site 1 and the double-stranded nucleic acid binding protein binding
site 1 is formed by hydrogen base-pair bonding between the
auxiliary polynucleotide 1-1 and the auxiliary polynucleotide
1-2.
[0370] 53. The complex of embodiment 52, wherein the
double-stranded nucleic acid binding protein binding site 1 is a
Csy4 protein binding site 1.
[0371] 54. The complex of any one of embodiments 48 to 53, wherein
the second split-nexus element 2 further comprises an auxiliary
polynucleotide 2-2, having a 5' and a 3' end, wherein 5' end of the
auxiliary polynucleotide 2-2 is 3' of the 3' end of the split-nexus
stem element nucleic acid sequence 2-2--and the first split-nexus
element 2 further comprises an auxiliary polynucleotide 2-1 having
a 5' end and a 3' end, wherein (i) the 5' end of the first
split-nexus element 2 is covalently bound to the 3' end of the
auxiliary polynucleotide 2-1, and (ii) the auxiliary polynucleotide
2-2 is associated with the auxiliary polynucleotide 2-1 through
hydrogen base-pair bonding.
[0372] 55. The complex of embodiment 54, wherein the auxiliary
polynucleotide 2-1 and the auxiliary polynucleotide 2-2 further
comprise a double-stranded nucleic acid binding protein binding
site 2 and the double-stranded nucleic acid binding protein binding
site 2 is formed by hydrogen base-pair bonding between the
auxiliary polynucleotide 2-1 and the auxiliary polynucleotide
2-2.
[0373] 56. The complex of embodiment 55, wherein the
double-stranded nucleic acid binding protein binding site 2 is a
Csy4 protein binding site 2.
[0374] 57. The complex of any one of 48 to 56, wherein the
engineered concatenated split-nexus nucleic acid 1, the third
concatenate element 1, and the third concatenate element 2 each
comprises RNA, DNA, or a combination thereof.
[0375] 58. The complex of any one of 48 to 57, wherein the first
nucleic acid binding Class 2 Type II CRISPR protein binding
sequence and the second nucleic acid binding Class 2 Type II CRISPR
protein binding sequence are each a Cas9 protein binding
sequence.
[0376] 59. The complex of any one of 48 to 58, wherein (i) the
nucleic acid sequence 1 further comprises a spacer nucleic acid
sequence 1 and the nucleic acid sequence 2 further comprises a
spacer nucleic acid sequence 2, and (ii) the spacer nucleic acid
sequence 1 is complementary to a target nucleic acid sequence 1 and
the spacer nucleic acid sequence 2 is complementary to a target
nucleic acid sequence 2.
[0377] 60. The complex of embodiment 59, wherein the target nucleic
acid sequence 1 and the target nucleic acid sequence 2 are each a
nucleic acid sequence selected from the group consisting of a
single-stranded RNA, a single-stranded DNA, a double-stranded RNA,
a double-stranded DNA, a single-stranded RNA/DNA hybrid, and a
double-stranded RNA/DNA hybrid.
[0378] 61. A complex of the two or more engineered nucleic acid
sequences forming the scaffold of any one of embodiments 48 to 60,
the complex further comprising a first Class 2 Type II CRISPR
protein bound to the first nucleic acid binding Class 2 Type II
CRISPR protein binding sequence and a second Class 2 Type II CRISPR
protein bound to the second nucleic acid binding Class 2 Type II
CRISPR protein binding sequence, wherein the first Class 2 Type II
CRISPR protein and the second Class 2 Type II CRISPR protein are
each selected from the group consisting of a Cas9 protein and a
catalytically inactive Cas9 protein.
[0379] 62. An engineered nucleic acid scaffold, comprising; a first
engineered nucleic acid comprising--a first element 1 comprising a
first nucleic acid binding Class 2 Type II CRISPR protein binding
sequence, having a 5' end and a 3' end--and a second element 1
comprising a repeat nucleic acid sequence 1 having a 5' end and a
3' end, wherein the 3' end of the repeat nucleic acid sequence 1 is
located 5' of the 5' end of the first nucleic acid binding Class 2
Type II CRISPR protein binding sequence, the repeat nucleic acid
sequence 1 further comprising a linker element nucleic acid
sequence 1-1, having a 5' end and a 3' end--a repeat nucleic acid
sequence 1a, having a 5' end and a 3' end--a linker element nucleic
acid sequence 1-2, having a 5' end and a 3' end--a repeat nucleic
acid sequence 1b, having a 5' end and a 3' end--and a linker
element nucleic acid sequence 1-3, having a 5' end and a 3' end,
arranged in the following 3' to 5' order: the linker element
nucleic acid sequence 1-1, the repeat nucleic acid sequence 1a, the
linker element nucleic acid sequence 1-2, the repeat nucleic acid
sequence 1b, and the linker element nucleic acid sequence 1-3;
wherein no nucleic acid sequence within the repeat nucleic acid
sequence 1 associates with any nucleic acid sequence within the
repeat nucleic acid sequence 1 to form a stem element through
hydrogen bonding capable of binding to a Class 2 Type II CRISPR-Cas
protein.
[0380] 63. The engineered nucleic acid scaffold of embodiment 62,
further comprising a third element 1 comprising a nucleic acid
sequence 1, having a 5' end and a 3' end, wherein (i) the 3' end of
the nucleic acid sequence 1 is covalently attached to the 5' end of
the repeat nucleic acid sequence 1, and (ii) the nucleic acid
sequence 1 comprises a spacer nucleic acid sequence 1.
[0381] 64. The engineered nucleic acid scaffold of embodiment 62 or
63, further comprising: a second engineered nucleic acid
comprising--a first element 2 comprising a second nucleic acid
binding Class 2 Type II CRISPR protein binding sequence, having a
5' end and a 3' end--and a second element 2 comprising the repeat
nucleic acid sequence 1C has a 5' end and a 3' end, wherein the 3'
end of the repeat nucleic acid sequence 1C is located 5' of the 5'
end of the second nucleic acid binding Class 2 Type II CRISPR
protein binding sequence, the repeat nucleic acid sequence 2
further comprising, a linker element nucleic acid sequence 2-1,
having a 5' end and a 3' end--a repeat nucleic acid sequence 1bC,
having a 5' end and a 3' end--a linker element nucleic acid
sequence 2-2, having a 5' end and a 3' end--a repeat nucleic acid
sequence 1aC, having a 5' end and a 3' end--and a linker element
nucleic acid sequence 2-3, having a 5' end and a 3' end, arranged
in the following 3' to 5' order: the linker element nucleic acid
sequence 2-3, the repeat nucleic acid sequence 1bC, the linker
element nucleic acid sequence 2-2, the repeat nucleic acid sequence
1aC, and the linker element nucleic acid sequence 2-1; wherein the
repeat nucleic acid sequence 1 is associated with the repeat
nucleic acid sequence 2 through hydrogen bonding between the repeat
nucleic acid sequence 1a and the repeat nucleic acid sequence 1aC
and through hydrogen bonding between the repeat nucleic acid
sequence 1b and the repeat nucleic acid sequence 1bC.
[0382] 65. The engineered nucleic acid scaffold of embodiment 64,
further comprising, a third element 2 comprises a nucleic acid
sequence 2, having a 5' end and a 3' end, wherein (i) the 3' end of
the nucleic acid sequence 2 is covalently attached to the 5' end of
the repeat nucleic acid sequence 1C, and (ii) the nucleic acid
sequence 2 comprises a spacer nucleic acid sequence 2.
[0383] Although preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. From the above description and the following
Examples, one skilled in the art can ascertain essential
characteristics of this invention and, without departing from the
spirit and scope thereof, can make changes, substitutions,
variations, and modifications of the invention to adapt it to
various usages and conditions. Such changes, substitutions,
variations, and modifications are also intended to fall within the
scope of the present disclosure.
[0384] Experimental
[0385] Aspects of the present invention are illustrated in the
following Examples. Efforts have been made to ensure accuracy with
respect to numbers used (e.g., amounts, concentrations, percent
changes, and the like) but some experimental errors and deviations
should be accounted for. Unless indicated otherwise, temperature is
in degrees Centigrade and pressure is at or near atmospheric. It
should be understood that these Examples are given by way of
illustration only and are not intended to limit the scope of what
the inventors regard as various aspects of the present
invention.
EXAMPLE 1
In Silico Design of NASC Polynucleotide Components
[0386] This Example provides a description of the design of NASC
polynucleotide components for a number of embodiments of the NASCs
described herein.
[0387] Table 9 sets forth a correlation between NASC polynucleotide
components and structures illustrated in the figures. The column
"Assoc. Cas protein" lists the Cas proteins with which the NASC
polynucleotide component can be used. Unless otherwise indicated,
the Cas9 protein is a S. pyogenes Cas9 protein (S. pyogenes Cas9
protein, SEQ ID NO. 100 or S. pyogenes dCas9 protein (SEQ ID NO.
101)). The Cpf1 protein is an Acidaminococcus sp. Cpf1 protein
(dCpf SEQ ID NO. 105) unless otherwise indicated.
[0388] Sequences that hybridize between polynucleotide components
are underlined. Nucleic acid target binding sequences are indicated
by a series of twenty Ns, wherein N is any nucleotide. A nucleic
acid target binding sequence can be engineered by one of ordinary
skill in the art.
TABLE-US-00009 TABLE 9 Examples of NASC Polynucleotide Component
Sequences NASC component Assoc. FIG. generic Cas FIG. indicator
designation protein Sequence SEQ ID NO. 4A 1-1, 1-2, NASC-PC1 Cpf1
CUCCGGCGAUGUCACAC SEQ ID NO. 1-3 CGAACUGAUAAUUUCUA 64
CUCUUGUAGAUNNNNNN NNNNNNNNNNNNNN 4A 2-3, 2-2, NASC-PC2 Cpf1
UCGGUGUGACAUCGCCG SEQ ID NO. 2-1 GAGUUGAUAAAUUUCUA 65
CUCUUGUAGAUNNNNNN NNNNNNNNNNNNNN 4B 1-1 NASC-PC1- Cpf1
CUCCGGCGAUGUCACAC SEQ ID NO. 1 CGAACUGAUAAUUUCUA 66 C 4B 1-3
NASC-PC1- Cpf1 GUAGAUNNNNNNNNNN SEQ ID NO. 2 NNNNNNNNNN 67 4B 2-1
NASC-PC2- Cpf1 UCGGUGUGACAUCGCCG SEQ ID NO. 1 GAGUUGAUAAAUUUGU 68
AG 4B 2-3 NASC-PC2- Cpf1 CUACAUNNNNNNNNNNN SEQ ID NO. 2 NNNNNNNNN
69 4C 1-1, 1-3, NASC-PC1 Cpf1 AAUUUCUACUCUUGUAG SEQ ID NO. 1-2
AUNNNNNNNNNNNNNN 70 NNNNNNACUGAUCUCCG GCGAUGUCACACCGA 4C 2-2, 2-3,
NASC-PC2 Cpf1 AAUUUCUACUCUUGUAG SEQ ID NO. 2-2 AUNNNNNNNNNNNNNN 71
NNNNNNUUGAUAUCGGU GUGACAUCGCCGGAG 4M 1-1, 1-2, NASC-PC1 Cpf1
CUCCGGCGAUGUCACAC SEQ ID NO. 1-3, 1-4 CGAACUGAUAAUUUCUA 72
CUCUUGUAGAUNNNNNN NNNNNNNNNNNNNNUU GAUAGUCUAAGGCAGCU AGGGUCU 4M
2-1,2-2, NASC-PC2 Cpf1 UCGGUGUGACAUCGCCG SEQ ID NO. 2-3
GAGUUGAUAAAUUUCUA 73 CUCUUGUAGAUNNNNNN NNNNNNNNNNNNNN 4M 3-2, 3-3,
NASC-PC3 Cpf1 AAUUUCUACUCUUGUAG SEQ ID NO. 3-1 AUNNNNNNNNNNNNNN 74
NNNNNNUACCAAAGACC CUAGCUGCCUUAGAC 5D 507-500 NASC-PC1 Cpf1
CUCCGGCGAUGUCACAC SEQ ID NO. I CGAACUGAUGUCUAAGG 75
CAGCUAGGGUCUUUGAU AAAUUUCUACUCUUGUA GAUNNNNNNNNNNNNN NNNNNNN 5D
508-515 NASC-PC2 Cpf1 UGCGAACCACUGUGAGC SEQ ID NO. II
CAGUACCAAUCGGUGUG 76 ACAUCGCCGGAGUUGAU AAAUUUCUACUCUUGUA
GAUNNNNNNNNNNNNN NNNNNNN 5F VIII NASC-PC1- Cpf1 CUCCGGCGAUGUCACAC
SEQ ID NO. 507-503 1 CGAACUGAUGUCUAAGG 77 CAGCUAGGGUCUUUGAU
AAAUUUCUAC 5F VIII NASC-PC1- Cpf1 GUAGAUNNNNNNNNNN SEQ ID NO.
502-500 2 NNNNNNNNNN 78 5F V NASC-PC2- Cpf1 UGCGAACCACUGUGAGC SEQ
ID NO. 508-512 1 CAGUACCAAUCGGUGUG 79 ACAUCGCCGGAGUUGAU AAAUUUGUAG
5F V NASC-PC2- Cpf1 CUACAUNNNNNNNNNNN SEQ ID NO. 513-515 2
NNNNNNNNN 80 6D 611-601 NASC-PC1 Cas9 NNNNNNNNNNNNNNNN SEQ ID NO.
NNNNGUUUUAGUCCCUA 81 AUUAAAUUUCUUGAAA UUGGUAUAUAAGGAGG
GACUACAACAAAGAGUU UGCGGGACUCUGCGGGG UUACAAUCCCCUAAAAC
CGCUUUUAAAAUUCAAA UAAAUUUUGCUUU 6D 612-622 NASC-PC2 Cas9
NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUUGUAGUCCCUC 82 CUUAUAUACCAAGAAAA
AGAAAUUUAAUUAGGG ACUAAAACAAAGAGUUU GCGGGACUCUGCGGGGU
UACAAUCCCCUAAAACC GCUUUUAAAAUUCAAAU AAAUUUUGCUUU 6G 611-601
NASC-PC1 Cas9 NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUCUCAGAGCUAU 83
GCAGUCCUGGACAACUG CCGAACCUCAUGAGAAU CCAAGUAUGUGUAAGGC
UAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAG UCGGUGCUU 6G 622-612 NASC-PC2
Cas9 NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGCACAUGAGGAUU 84
CUCAUGAGGGACGGCAG AAGAACAGGACUGCAUA GCAAGUUGAGAUAAGGC
UAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAG UCGGUGCUU 6I IV NASC-PC1 Cas9
NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUUUUAGAGCUAU 85 GCUGUUUUGGAAAGGUC
AUGUCCUUCAAAGUUGU AAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUG
GCACCGAGUCGGUGCUU 6I V NA SC-PC2 Cas9 NNNNNNNNNNNNNNNN SEQ ID NO.
NNNNGUAAUAGAAUCGU 86 GCUGAAAAGGAAACAAA ACAGCAUAGCAAGUUAA
AAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUG GCACCGAGUCGGUGCUU 6I VI
NASC-PC3 Cas9 NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUUACAGAUGAAG 87
GACAUGACCGAAACUUU UCAGCACGAUAAGUUAU UAUAAGGCUAGUCCGUU
AUCAACUUGAAAAAGUG GCACCGAGUCGGUGCUU 7B 725-722 NASC-PC1 Cas9
NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUUUUAGUCCCUA 88 AUUAAAUUUCUU 7B
721-718 NASC-PC2 Cas9 NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUUGUAGUCCCUC
89 CUUAUAUACCAA 7B 717-700 NASC-PC- Cas9 AAGAAAUUUAAUUAGG SEQ ID
NO. NTS GACUAAAACAAAGAGUU 90 UGCGGGACUCUGCGGGG UUACAAUCCCCUAAAAC
CGCUUUUAAAAUUCAAA UAAAUUUUGCUUUAGUU GAUAAAUUUGGUAUAU
AAGGAGGGACUACAACA AAGAGUUUGCGGGACUC UGCGGGGUUACAAUCCC
CUAAAACCGCUUUUAAA AUUCAAAUAAAUUUUGC UUU 8L I NASC-PC1 Cas9
NNNNNNNNNNNNNNNN SEQ ID NO. 809-817 NNNNGUUUUAGAGCTAT 91
GCTGTGAAAACAGCATA GCAAGUUAAAAUAAGGC UACUGCCG 8L II NASC-PC2 Cas9
NNNNNNNNNNNNNNNN SEQ ID NO. 828-836 NNNNGUUUUAGAGCTAT 92
GCTGTGAAAACAGCATA GCAAGUUAAAAUAAGGC UAGUCACG 8L 835-800 NASC-PC-
Cas9 CGGCAGUCCGUUAUCAA SEQ ID NO. NTS CUUGAAAAAGUGGCACC 93
GAGUCGGUGCUUAGUUG AUAAAUCGUGACGUCCG UUAUCAACUUGAAAAAG
UGGCACCGAGUCGGUGC UUU 9A II + I NASC-PC1- Cas9 NNNNNNNNNNNNNNNN SEQ
ID NO. 2TS Cpf1 NNNNGUUUUAGAGCUAU 94 GCUGUGAAAACAGCAUA
GCAAGUUAAAAUAAGGC UAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAG
UCGGUGCUUACUGAUAA UUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNN NNNN 6J VII
NASC-PC1- Cas9 NNNNNNNNNNNNNNNN SEQ ID NO. 2TS Cpf1
NNNNGUUUUAGAGCUAU 97 GCUGUUACCAAUUGAUA GUAGAUNNNNNNNNNN NNNNNNNNNN
6J VIII NASC-PC- Cpf1 AAUUUCUACUUGAUAAC SEQ ID NO. NTS Cas9
AGCAUAGCAAGUUAAAA 98 UAAGGCUAUCCGUUAUC AACUUGAAAAAGUGGCA
CCGAGUCGGUGCUUU 6K X NASC-PC1 Cas9 NNNNNNNNNNNNNNNN SEQ ID NO.
NNNNGUUUUUGUACUCU 95 CAAGAUUCAAAUAACAG CAUAGCAAGUUAAAAUA
AGGCUAUCCGUUAUCAA CUUGAAAAAGUGGCACC GAGUCGGUGCUUU 6K IX NASC-PC2
Cas9* NNNNNNNNNNNNNNNN SEQ ID NO. NNNNGUUUUAGAGCUAU 96
GCUGUUACGUAAAUCUU GCAGAAGCUACAAAGAU AAGGCUUCAUGCCGAAA
UCAACACCCUGUCAUUU UAUGGCAGGGUGUUU *S. thermophilus CRISPR-I Cas9
protein, SEQ ID NO. 108 or S. thermophilus CRISPR-I dCas9 protein,
SEQ ID NO. 109
[0389] Following the guidance of the present specification, one or
ordinary skill in the art can design NASC polynucleotide components
(e.g., based on other NASC polynucleotide components described
herein) for different cognate Cas proteins (e.g., C. jejuni Cas9
protein (SEQ ID NO. 103), C. jejuni dCas9 protein (SEQ ID NO. 56),
S. aureus Cas9 (SEQ ID NO. 99), S. aureus dCas9 (SEQ ID NO. 102),
Lachnospiraceae bacterium Cpf1 protein (SEQ ID NO. 106),
Lachnospiraceae bacterium dCpf1 protein (SEQ ID NO. 107) or
Acidaminococcus sp. Cpf1 (SEQ ID NO. 104).
EXAMPLE 2
Production of sgRNAs and NASC Polynucleotide Components
[0390] This Example describes production of sgRNAs and NASC
polynucleotide components NASC-PC1 (Table 9, generic target
sequence SEQ ID NO. 83) and NASC-PC2 (Table 9, generic target
sequence SEQ ID NO. 84), as illustrated in FIG. 6G. The sgRNAs and
NASC polynucleotide components described in this Example were used
in Cas cleavage assays (Example 5).
[0391] NASC-PC1 and NASC-PC2 comprised different first stem element
nucleic acid sequences (illustrated in FIG. 6E, 608-609 and
619-620) to limit formation of secondary structures within each
NASC-PC that may interfere with the formation of stable secondary
structure between the NASC-PC1 first stem element nucleic acid
sequences and NASC-PC2 first stem element nucleic acid sequences
complementary to the first stem element nucleic acid sequence.
[0392] Two sgRNA backbones were used (sgRNA-1 and sgRNA-2), each
comprising different upper stem and lower stem nucleic acid
sequences (illustrated in FIG. 2C, 221-222/227-228 and
223-224/225-226, respectively); the bulge sequences were the
same.
[0393] Four nucleic acid target-binding sequences, each 20
nucleotides in length, were selected. One of the four nucleic acid
target binding sequences was incorporated at the 5' end of a
sgRNA-1 and a sgRNA-2 backbone, and the 5' end of a NASC-PC1 and a
NASC-PC2. The four double-stranded DNA target sequences were as
follows: Target 1 (AAVST1) corresponded to a human AAVS-1 target
sequence. Target 2 (VT2), Target 3 (VT3) and Target 4 (VT4) were
DNA target sequences present in the vector sequence (SEQ ID NO.
20).
[0394] RNA components were produced by in vitro transcription using
a T7 Quick High Yield RNA Synthesis Kit (New England Biolabs,
Ipswich, Mass.) from a double-stranded DNA template incorporating a
T7 promoter at the 5' end of the DNA sequences.
[0395] A double-stranded DNA template for each sgRNA, NASC-PC1, and
NASC-PC2 was assembled by PCR using 3' overlapping oligonucleotide
primers containing DNA sequences corresponding to each sgRNA,
NASC-PC1, and NASC-PC2. The oligonucleotide primers are presented
in Table 10.
TABLE-US-00010 TABLE 10 Overlapping Primers for Generation of
sgRNA, NASC-PC1, and NASC-PC2 Encoding Templates Construct
designation Target Oligonucleotide sgRNA-1-AAVST1 target-1 SEQ ID
NO. 1, 3, 11, 12, 2 sgRNA-1-VT2 target-2 SEQ ID NO. 1, 4, 11, 12, 2
sgRNA-1-VT3 target-3 SEQ ID NO. 1, 5, 11, 12, 2 sgRNA-1-VT4
target-4 SEQ ID NO. 1, 6, 11, 12, 2 sgRNA-2-AAVST1 target-1 SEQ ID
NO. 1, 7, 13, 14, 2 sgRNA-2-VT2 target-2 SEQ ID NO. 1, 8, 13, 14, 2
sgRNA-2-VT3 target-3 SEQ ID NO. 1, 9, 13, 14, 2 sgRNA-2-VT4
target-4 SEQ ID NO. 1, 10, 13, 14, 2 NASC-PC1-AAVST1 target-1 SEQ
ID NO. 1, 3, 15, 16, 2 NASC-PC1-VT2 target-2 SEQ ID NO. 1, 4, 15,
16, 2 NASC-PC1-VT3 target-3 SEQ ID NO. 1, 5, 15, 16, 2 NASC-PC1-VT4
target-4 SEQ ID NO. 1, 6, 15, 16, 2 NASC-PC2- AAVST1 target-1 SEQ
ID NO. 1, 7, 17, 18, 2 NASC-PC2-VT2 target-2 SEQ ID NO. 1, 8, 17,
18, 2 NASC-PC2-VT3 target-3 SEQ ID NO. 1, 9, 17, 18, 2 NASC-PC2-VT4
target-4 SEQ ID NO. 1, 10, 17, 18, 2
[0396] The DNA primers were present at a concentration of 2 nM
each. One DNA primer corresponded to the T7 promoter (SEQ ID NO. 1)
and the other to the 3' end of the RNA sequence (SEQ ID NO. 2) and
were used at a concentration of 640 nM to drive the amplification
reaction. PCR reactions were performed using Q5 Hot Start
High-Fidelity 2.times. Master Mix (New England Biolabs, Ipswich,
Mass.) following the manufacturer's instructions. PCR assembly
reactions were carried out using the following thermal cycling
conditions: 98.degree. C. for 2 minutes; 2 cycles of 20 seconds at
98.degree. C., 20 seconds at 52.5.degree. C., 20 seconds at
72.degree. C.; followed by 32 cycles of 20 seconds at 98.degree.
C., 20 seconds at 57.degree. C., 20 seconds at 72.degree. C.; and a
final extension at 72.degree. C. for 2 minutes. DNA product quality
was evaluated after the PCR reaction by agarose gel electrophoresis
(1.5%, SYBR.RTM. Safe, Life Technologies, Grand Island, N.Y.).
[0397] Between 0.25-0.5 .mu.g of the DNA template for each sgRNA,
NASC-PC1, and NASC-PC2 was used as a template for transcription
using T7 High Yield RNA Synthesis Kit (New England Biolabs,
Ipswich, Mass.) for approximately 16 hours at 37.degree. C.
Transcription reactions were treated with DNase I (New England
Biolabs, Ipswich, Mass.) and purified using GeneJet RNA Cleanup and
Concentration Kit (Life Technologies, Grand Island, N.Y.). RNA
yield was quantified using the Nanodrop.TM. 2000 System (Thermo
Scientific, Wilmington, Del.). The quality of the transcribed RNA
was checked by agarose gel electrophoresis (2%, SYBR.RTM. Safe;
Life Technologies, Grand Island, N.Y.). The sgRNA and NASC
polynucleotide component sequences are shown in Table 11.
TABLE-US-00011 TABLE 11 sgRNA, NASC-PC1, and NASC-PC2 Sequences
Name Sequence* SEQ ID NO. sgRNA- GGGGCCACUAGGGACAGGAUGUCUCAGAGCUA
SEQ ID NO. 1- UGCAGUCCUGGACAACUGCCGAACAGGACUGC 25 AAVST1
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GUAGGCUAUAGUGUAGAUCUGUCUCAGAGCUA SEQ ID NO. 1-
UGCAGUCCUGGACAACUGCCGAACAGGACUGC 26 VT2
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GGAAAAAGUGGAAGCGGCGAGUCUCAGAGCUA SEQ ID NO. 1-
UGCAGUCCUGGACAACUGCCGAACAGGACUGC 27 VT3
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GGCGAUAAGUCGUGUCUUACGUCUCAGAGCUA SEQ ID NO. 1-
UGCAGUCCUGGACAACUGCCGAACAGGACUGC 28 VT4
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GGGGCCACUAGGGACAGGAUGCACAUGAGGAU SEQ ID NO. 2-
UCUCAUGAGGGACGGCAGAAGAACCUCAUGAG 29 AAVST1
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GUAGGCUAUAGUGUAGAUCUGCACAUGAGGAU SEQ ID NO. 2-
UCUCAUGAGGGACGGCAGAAGAACCUCAUGAG 30 VT2
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GGAAAAAGUGGAAGCGGCGAGCACAUGAGGAU SEQ ID NO. 2-
UCUCAUGAGGGACGGCAGAAGAACCUCAUGAG 31 VT3
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
sgRNA- GGCGAUAAGUCGUGUCUUACGCACAUGAGGAU SEQ ID NO. 2-
UCUCAUGAGGGACGGCAGAAGAACCUCAUGAG 32 VT4
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GGGGCCACUAGGGACAGGAUGUCUCAGAGCUA SEQ ID NO. PC1-
UGCAGUCCUGGACAACUGCCGAACCUCAUGAG 33 AAVST1
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GUAGGCUAUAGUGUAGAUCUGUCUCAGAGCUA SEQ ID NO. PC1-
UGCAGUCCUGGACAACUGCCGAACCUCAUGAG 34 VT2
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GGAAAAAGUGGAAGCGGCGAGUCUCAGAGCUA SEQ ID NO. PC1-
UGCAGUCCUGGACAACUGCCGAACCUCAUGAG 35 VT3
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GGCGAUAAGUCGUGUCUUACGUCUCAGAGCUA SEQ ID NO. PC1-
UGCAGUCCUGGACAACUGCCGAACCUCAUGAG 36 VT4
AAUCCAAGUAUGUGUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GGGGCCACUAGGGACAGGAUGCACAUGAGGAU SEQ ID NO. PC2-
UCUCAUGAGGGACGGCAGAAGAACAGGACUGC 37 AAVST1
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GUAGGCUAUAGUGUAGAUCUGCACAUGAGGAU SEQ ID NO. PC2-
UCUCAUGAGGGACGGCAGAAGAACAGGACUGC 38 VT2
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GGAAAAAGUGGAAGCGGCGAGCACAUGAGGAU SEQ ID NO. PC2-
UCUCAUGAGGGACGGCAGAAGAACAGGACUGC 39 VT3
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
NASC- GGCGAUAAGUCGUGUCUUACGCACAUGAGGAU SEQ ID NO. PC2-
UCUCAUGAGGGACGGCAGAAGAACAGGACUGC 40 VT4
AUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUU
*NASC-PC hybridizing regions are underlined
[0398] This method for production of sgRNA and NASC polynucleotide
components can be applied to the production of other the sgRNA and
NASC polynucleotide components by one of ordinary skill in the art
in view of the teachings of the specification.
EXAMPLE 3
Production of Double-Stranded DNA Target Sequences for Use in
Cleavage Assays by Cloning of Double-Stranded DNA Target Sequences
into Plasmids
[0399] Double-stranded DNA target sequences for use in the in vitro
Cas protein cleavage assays were produced though the ligation of a
double-stranded nucleic acid target sequence (e.g., the AAVS-1
target sequence) into a cloning vector backbone. Each vector was
transformation into a suitable strain of E. coli for production of
double-stranded DNA target sequences.
[0400] A 25 nucleotide single-stranded DNA target sequence
corresponding to the human Adeno-Associated Virus Integration Site
1 (AAVS-1) was appended in silico with a randomized nucleic acid
sequence of 47 nucleotides at the 5' end and a randomized nucleic
acid sequence of 53 nucleotides at the 3' end. Forward and reverse
oligonucleotide primers compatible with the Electra.TM. Vector
System (DNA2.0, Newark, Calif.) were incorporated at the 5' end and
the 3' end of the DNA target sequence, producing a 237 bp
single-stranded DNA sequence. A nucleic acid sequence of 237 bp
single-stranded DNA ("DNA cloning fragment"), as well as nucleic
acid sequences of forward and reverse amplification oligonucleotide
primers, were provided to a commercial manufacturer for synthesis.
These single-stranded DNA sequences are shown in Table 12.
TABLE-US-00012 TABLE 12 Single-stranded DNA Sequences SEQ ID
Description Sequence* NO. DNA TACACGTACTTAGTCGCTGAAGCTCTTCTATG SEQ
ID cloning CAAGCAGAAGACGGCATACGAGATCGAGTAA NO. 19 Fragment
TGTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCTGCTACTGGGGCCACTAGGGACAGGATNG
GTGCTAGCTCAGATCGGAAGAGCGTCGTGTA GGGAAAGAGTGTAGGCTATAGTGTAGATCTC
GGTGGTCGCCGTATCATTGGTAGAAGAGCCGT CAATCGAGTTCGTACCT Forward
TACACGTACTTAGTCGCTGAAGCTCTTCTATG SEQ ID primer
CAAGCAGAAGACGGCATACGAGAT NO. 21 Reverse
AGGTACGAACTCGATTGACGGCTCTTCTACCA SEQ ID primer
ATGATACGGCGACCACCGAGATCT NO. 22 *AAVS-1 DNA target sequence
comprising a PAM is underlined
[0401] The single-stranded DNA cloning fragment was amplified via
PCR to generate double-stranded DNA for use with the Electra.TM.
Vector System (DNA2.0, Newark, Calif.). The PCR reaction mixture
was as follows: 0.5 unit KAPA HiFi Hot Start DNA Polymerase (Kapa
Biosystems, Wilmington, Mass.), 1.times. reaction buffer, 0.3 mM
dNTPs, 200 nM forward primer (SEQ ID NO. 21), 200 nM reverse primer
(SEQ ID NO. 22), and 80 nM of the DNA cloning fragment (SEQ ID NO.
19) in a total volume of 25 .mu.L. The DNA cloning fragment was
amplified using the following conditions: 95.degree. C. for 4
minutes, 30 cycles of 20 seconds at 98.degree. C., 20 seconds at
60.degree. C., and 30 seconds at 72.degree. C., followed by a final
extension at 72.degree. C. for 5 minutes. PCR products were
purified using Spin Smart.TM. PCR purification tubes (Denville
Scientific, South Plainfield, N.J.) and quantified using a
Nanodrop.TM. 2000 UV-Vis spectrophotometer (Thermo Scientific,
Wilmington, Del.).
[0402] The double-stranded DNA cloning fragment was cloned into the
commercially available "pD441-SR: T5-sRBS-ORF, Ecoli-Elec D" vector
(an Electra.TM. bacterial DNA vector (DNA2.0, Newark, Calif.))
using the manufacturer's cloning protocol. The following cloning
reaction mixture was prepared: 20 ng of the PCR-amplified cloning
fragment, 20 ng of the bacterial DNA vector, 2 .mu.l of Electra.TM.
buffer mix (DNA2.0, Newark, Calif.), and 1 .mu.l of Electra.TM.
enzyme mix (DNA2.0, Newark, Calif.) in a final volume of 20 .mu.L.
The cloning reaction mixture was then briefly vortexed, subjected
to centrifugation using benchtop centrifuge, and incubated at room
temperature for 20 minutes.
[0403] After incubation, 1 .mu.L of One Shot.RTM. Mach1.TM. T1R
(Thermo Scientific, Wilmington, Del.) chemically competent E. coli
cells were mixed with 2 .mu.L of the cloning reaction mixture to
form a transformation mixture that was incubated in ice for 30
minutes. The transformation mixture was heat-shocked for 30 seconds
at 42.degree. C., and incubated in ice for 2 minutes. 250 .mu.L of
room temperature S.O.C. medium (Thermo Scientific, Wilmington,
Del.) was added to the transformation mixture, and the mixture was
incubated at 37.degree. C. for 1 hour with shaking. After this
incubation, 50 .mu.L of the cell mixture was spread onto an LB agar
plate with 50 .mu.g/mL kanamycin, and the plate was incubated
overnight at 37.degree. C. for bacterial colony formation.
[0404] Five bacterial colonies were picked and transferred to
separate 15 mL culture tubes containing 5 mL of LB supplemented
with 50 .mu.g/mL kanamycin culture medium and the tubes were
incubated for 8 hours with shaking. Cells were pelleted by
centrifugation at 4000 RPM for 15 minutes, culture medium was
aspirated, and the cells were re-suspended in 200 .mu.L of LB
culture medium without antibiotics. DNA vectors were extracted from
the bacteria of each of the five bacterial colonies using QlAprep
Spin Miniprep Kit (Qiagen, Venlo, Netherlands) following the
manufacturer's instructions. DNA vector yields were quantified
using a Nanodrop.TM. 2000 UV-Vis spectrophotometer (Thermo
Scientific, Wilmington, Del.). 250 ng of each DNA vector was Sanger
sequenced to verify incorporation of the DNA cloning fragment
corresponding to SEQ ID NO. 19. The full DNA vector sequence,
including AAVS-1 target sequence, is provided as SEQ ID NO. 20.
[0405] A bacterial clone identified as containing a DNA vector
comprising the DNA cloning fragment was cultured in 100 mL of LB
supplemented with 50 .mu.g/mL kanamycin culture medium and grown
overnight at 37.degree. C. with shaking. Cells were pelleted by
centrifugation at 4000 RPM for 15 minutes, culture medium was
aspirated, and the DNA vector was purified using a QIAprep Spin
Maxiprep Kit (Qiagen, Venlo, Netherlands) following the
manufacturer's instructions. DNA vector yields were quantified
using a Nanodrop.TM. 2000 UV-Vis spectrophotometer (Thermo
Scientific, Wilmington, Del.).
[0406] The DNA vector was prepared to be used in Cas cleavage assay
by linearization of the circular vector with an Ascl Type II
restriction endonuclease. To linearize the circular DNA vector, the
following reaction mixture was assembled: 1 unit of Ascl
restriction endonuclease (New England Biolabs, Ipswich, Mass.) per
1 .mu.g of circular DNA vector, and 1.times. CutSmart.RTM. buffer
(New England Biolabs, Ipswich, Mass.) in a final volume of 50 uL.
The reaction mixture was incubated for 1 hour at 37.degree. C., and
the reaction stopped by incubation at 80.degree. C. for 20 minutes.
Linear DNA vector was purified using the QIAquick PCR Purification
Kit (Qiagen, Venlo, Netherland) following the manufacturer's
instructions. Linear DNA vector yields were quantified using a
Nanodrop.TM. 2000 UV-Vis spectrophotometer (Thermo Scientific,
Wilmington, Del.).
[0407] Other suitable cloning methods and DNA vectors can be used
for the incorporation of double-stranded DNA target sequences
following essentially the method described in this Example. If
linearization of the DNA vector is undesirable or unnecessary, a
circular DNA vector can be used in Cas cleavage assays.
EXAMPLE 4
Production of Double-Stranded DNA Target Sequences for Use in
Cleavage Assays Using PCR
[0408] Double-stranded DNA target sequences for use in in vitro Cas
protein cleavage assays can be produced using PCR amplification of
selected nucleic acid target sequences from genomic human DNA.
[0409] Genomic human DNA comprising the Adeno-Associated Virus
Integration Site 1 (AAVS-1) can be prepared by phenol-chloroform
extraction from human cell line K562 (American Type Culture
Collection (ATCC), Manassas, Va.). PCR reactions can be carried out
with Q5 Hot Start High-Fidelity 2.times. Master Mix (New England
Biolabs, Ipswich, Mass.) following the manufacturer's instructions.
20 ng/.mu.L gDNA in a final volume of 25 .mu.l can be used to
amplify the selected nucleic acid target sequence under the
following conditions: 98.degree. C. for 2 minutes, 35 cycles of 20
seconds at 98.degree. C., 20 seconds at 60.degree. C., 20 seconds
at 72.degree. C., and a final extension at 72.degree. C. for 2
minutes. PCR products can be purified using Spin Smart.TM. PCR
purification tubes (Denville Scientific, South Plainfield, N.J.)
and can be quantified using a Nanodrop.TM. 2000 UV-Vis
spectrophotometer (Thermo Scientific, Wilmington, Del.).
[0410] Examples of forward and reverse primers that can be used for
amplification of the AAVS-1 DNA target sequences from gDNA are
presented in Table 13.
TABLE-US-00013 TABLE 13 AAVS-1 DNA Target Sequence Oligonucleotide
Primers SEQ ID NO. Sequence SEQ ID NO. 23 CCCCGTTCTCCTGTGGATTC SEQ
ID NO. 24 ATCCTCTCTGGCTCCATCGT
[0411] The AAVS-1 DNA target sequence can be amplified using SEQ ID
NO. 23 and SEQ ID NO. 24 to produce a 495 bp double-stranded AAVS-1
DNA target sequence.
[0412] Other suitable double-stranded DNA target sequences can be
obtained using essentially the same method by choosing suitable
oligonucleotide primers. gDNA from the any organism (e.g., plant,
bacteria, yeast, algae, and the like) can be used instead of DNA
derived from human cells. Furthermore, DNA target sequences can be
amplified via PCR from polynucleotides other than gDNA (e.g.,
vectors and gel isolated DNA fragments).
EXAMPLE 5
Cas Cleavage Assays
[0413] This Example illustrates the use of a NASC polynucleotide
compositions and a Cas9 protein in an in vitro assay to evaluate
cleavage percentages of nucleic acid target sequences by the NASC
polynucleotide compositions.
[0414] NASC-PC1 and NASC-PC2 comprised different first stem element
nucleic acid sequences to limit formation of secondary structures
within each NASC-PC that may interfere with the formation of stable
secondary structure through hydrogen bond formation between the
NASC-PC1 first stem element nucleic acid sequences and NASC-PC2
first stem element nucleic acid sequences complementary to the
NASC-PC1 first stem element nucleic acid sequence.
[0415] The generic components of the NASC polynucleotide
composition used in this Example were NASC-PC1 (Table 9, generic
target sequence SEQ ID NO. 83) and NASC-PC2 (Table 9, generic
target sequence SEQ ID NO. 84). The general structure of this
NASC-P1/NASC-P2 pair is illustrated in FIG. 6G.
[0416] Ribonucleoprotein complexes of sgRNA/Cas9 protein and
NASC-PC1/NASC-PC2/Cas9 protein were used in in vitro Cas9 cleavage
assays to evaluate percent cleavage of each complex relative to the
corresponding double-stranded DNA target sequences on a DNA
vector.
[0417] The ribonucleoprotein complexes of sgRNA/Cas9 protein and
NASC-PC1/NASC-PC2/Cas9 used the sgRNA and NASC-PC1/NASC-P2
constructs set forth in Example 2 Table 11. Target 1 (AAVST1)
corresponded to a human AAVS-1 target sequence. Target 2 (VT2),
Target 3 (VT3) and Target 4 (VT4) were DNA target sequences present
in the vector sequence (SEQ ID NO. 20). In a cleavage reaction with
only a single sgRNA or single NASC polynucleotide component, the
linearized vector was used. In a cleavage reaction with two sgRNAs
or NASC-PC1/NASC-PC2 components, the circular vector was used.
Cleavage of the linear plasmid with a sgRNA yielded two DNA
fragments, cleavage of the circular plasmid with two sgRNA or
NASC-PC1/NASC-PC2 components yielded two DNA target fragments. The
size of the double-stranded DNA target sequences and the sizes of
the predicted cleavage fragments are presented in Table 14.
TABLE-US-00014 TABLE 14 Target and Cleavage Fragment Sizes DNA
target Fragment 1 Fragment 2 Target vector (bp) (bp) AAVST1 Linear
1706 2469 VT2 Linear 1769 2406 VT3 Linear 3214 961 VT4 Linear 350
3825 AAVST1/VT3 Circular 1509 2666 AAVST1/VT4 Circular 1357 2818
VT2/VT3 Circular 1446 2729 VT2/VT4 Circular 1420 2755
[0418] The sgRNA and NASC-PC1/NASC-PC2 components were diluted to a
suitable working concentration. sgRNA and NASC-PC components were
aliquoted into separate tubes to a final concentration of 50 nM.
Pairs of sgRNAs and NASC-PC1/NASC-PC2 components were aliquoted
into separate tubes to a final concentration of 50 nM for each
component. All RNAs were incubated for 2 minutes at 95.degree. C.,
removed from thermocycler, and allowed to equilibrate to room
temperature. The combinations of the sgRNA and NASC-PC1/NASC-PC2
components that were used in cleavage reactions are presented in
Table 15.
TABLE-US-00015 TABLE 15 sgRNA and NASC-PC1/NASC-PC2 Reaction
Mixture Components SEQ ID SEQ ID Reaction RNA-1 type NO. RNA-2 type
NO. 1 sgRNA-1-AAVST1 SEQ ID -- -- NO. 25 2 sgRNA-1-VT2 SEQ ID -- --
NO. 26 3 sgRNA-1-VT3 SEQ ID -- -- NO. 27 4 sgRNA-1-VT4 SEQ ID -- --
NO. 28 5 sgRNA-2-AAVST1 SEQ ID -- -- NO. 29 6 sgRNA-2-VT2 SEQ ID --
-- NO. 30 7 sgRNA-2-VT3 SEQ ID -- -- NO. 31 8 sgRNA-2-VT4 SEQ ID --
-- NO. 32 9 NASC-PC1-AAVST1 SEQ ID -- -- NO. 33 10 NASC-PC1-VT2 SEQ
ID -- -- NO. 34 11 NASC-PC1-VT3 SEQ ID -- -- NO. 35 12 NASC-PC1-VT4
SEQ ID -- -- NO. 36 13 NASC-PC2- AAVST1 SEQ ID -- -- NO. 37 14
NASC-PC2-VT2 SEQ ID -- -- NO. 38 15 NASC-PC2-VT3 SEQ ID -- -- NO.
39 16 NASC-PC2-VST4 SEQ ID -- -- NO. 40 17 sgRNA-1-AAVST1 SEQ ID
sgRNA-2-VT3 SEQ ID NO. 25 NO. 31 18 NASC-PC1-AAVST1 SEQ ID
NASC-PC2-VT3 SEQ ID NO. 33 NO. 39 19 sgRNA-1-AAVST1 SEQ ID
sgRNA-2-VT4 SEQ ID NO. 25 NO. 32 20 NASC-PC1-AAVST1 SEQ ID
NASC-PC2-VT4 SEQ ID NO. 33 NO. 40 21 sgRNA-1-VT2 SEQ ID sgRNA-2-VT3
SEQ ID NO. 26 NO. 31 22 NASC-PC1-VT2 SEQ ID NASC-PC2-VT3 SEQ ID NO.
34 NO. 39 23 sgRNA-1-VT2 SEQ ID sgRNA-2-VT4 SEQ ID NO. 26 NO. 32 24
NASC-PC1-VT2 SEQ ID NASC-PC2-VT4 SEQ ID NO. 34 NO. 40
[0419] Each sgRNA reaction mixture component(s) and
NASC-PC1/NASC-PC2 reaction mixture component(s) was added to a Cas9
reaction mix. S. pyogenes Cas9 protein was recombinantly expressed
in E. coli and purified for use in the in vitro biochemical
cleavage assay. The Cas9 reaction mixture comprised Cas9 protein
diluted to a final concentration of 200 nM in reaction buffer (20
mM HEPES, 100 mM KCl, 5 mM MgCl.sub.2, and 5% glycerol at pH 7.4).
Each Cas9 reaction mixture was incubated at 37.degree. C. for 10
minutes. Cleavage in each Cas9 reaction mixture was initiated by
addition of the DNA target vector to a final concentration of 5 nM.
Each Cas9 reaction mixture was mixed, centrifuged briefly, and
incubated for 15 minutes at 37.degree. C. The cleavage reaction was
terminated by the addition of Proteinase K (Denville Scientific,
South Plainfield, N.J.) at a final concentration of 0.2 .mu.g/.mu.L
and 0.44 mg/.mu.L RNase A Solution (Sigma Aldrich, St. Louis, Mo.)
to each Cas9 reaction mixture.
[0420] Each Cas9 reaction mixture was then incubated for 25 minutes
at 37.degree. C. and 25 minutes at 55.degree. C. Each Cas9 reaction
mixture was evaluated for cleavage activity using the Fragment
Analyzer.TM. (Advanced Analytical Technologies, Ames, Iowa) System
and the DNF-474-05000 High Sensitivity NGS Reagent Kit (Advanced
Analytical Technologies, Ames, Iowa). The data from the Fragment
Analyzer.TM. System provided the concentration of each cleavage
fragment and of the DNA target vector that remained after cleavage
for each Cas9 reaction mixture. For each Cas9 reaction mixture,
percent cleavage was calculated by dividing the sum of the cleavage
fragments by the sum of both the cleavage fragments and the DNA
target vector that remained after cleavage.
[0421] Table 16 presents the cleavage data for each of the
ribonucleoprotein complexes of sgRNA/Cas9 protein and
NASC-PC1/NASC-PC2/Cas9.
TABLE-US-00016 TABLE 16 Biochemical Cleavage of DNA Target
Sequences with sgRNA/Cas9 Protein Complexes and NASC-
PC1/NASC-PC2/Cas9 Protein Complexes Per- cent Reac- SEQ ID SEQ ID
cleav- tion NO. RNA-1 type NO. RNA-2 type age 1 SEQ ID sgRNA-1- --
-- 100% NO. 25 AAVST1 2 SEQ ID sgRNA-1-VT2 -- -- 95% NO. 29 3 SEQ
ID sgRNA-1-VT3 -- -- 92% NO. 26 4 SEQ ID sgRNA-1-VT4 -- -- 94% NO.
30 5 SEQ ID sgRNA-2- -- -- 100% NO. 27 AAVST1 6 SEQ ID sgRNA-2-VT2
-- -- 100% NO. 31 7 SEQ ID sgRNA-2-VT3 -- -- 96% NO. 28 8 SEQ ID
sgRNA-2-VT4 -- -- 95% NO. 32 9 SEQ ID NASC-PC1- -- -- LOD* NO. 33
AAVST1 10 SEQ ID NASC-PC1-VT2 -- -- LOD NO. 37 11 SEQ ID
NASC-PC1-VT3 -- -- LOD NO. 34 12 SEQ ID NASC-PC1-VT4 -- -- LOD NO.
38 13 SEQ ID NASC-PC2- -- -- LOD NO. 35 AAVST1 14 SEQ ID
NASC-PC2-VT2 -- -- LOD NO. 39 15 SEQ ID NASC-PC2-VT3 -- -- LOD NO.
36 16 SEQ ID NASC-PC2-VT4 -- -- LOD NO. 40 17 SEQ ID sgRNA-1- SEQ
ID sgRNA-2-VT3 88% NO. 25 AAVST1 NO. 31 18 SEQ ID NASC-PC1- SEQ ID
NASC-PC2-VT3 89% NO. 33 AAVST1 NO. 39 19 SEQ ID sgRNA-1- SEQ ID
sgRNA-2-VT4 91% NO. 25 AAVST1 NO. 32 20 SEQ ID NASC-PC1- SEQ ID
NASC-PC2-VT4 92% NO. 33 AAVST1 NO. 40 21 SEQ ID sgRNA-1-VT2 SEQ ID
sgRNA-2-VT3 81% NO. 26 NO. 31 22 SEQ ID NASC-PC1-VT2 SEQ ID
NASC-PC2-VT3 86% NO. 34 NO. 39 23 SEQ ID sgRNA-1-VT2 SEQ ID
sgRNA-2-VT4 94% NO. 26 NO. 32 24 SEQ ID NASC-PC1-VT2 SEQ ID
NASC-PC2-VT4 96% NO. 34 NO. 40 *LOD indicates cleavage values below
the limit of detection
[0422] The data presented in Table 16 demonstrates that each
NASC-PC1/NASC-PC2/Cas9 protein complex of Reactions 18, 20, 22, and
24 (Table 16) facilitated Cas protein mediated site-specific
cleavage of the two DNA target sequences corresponding to the two
nucleic acid target binding sequences of the NASC-PC1/NASC-PC2/Cas9
protein complex. Furthermore, the percent of site-specific cleavage
by each NASC-PC1/NASC-PC2/Cas9 protein complex was essentially
equivalent to site-specific cleavage of the same two DNA target
sequences by two sgRNA/Cas9 protein complexes, wherein one
sgRNA/Cas9 protein complex targeted cleavage at a first DNA target
sequence and a second sgRNA/Cas9 protein complex targeted cleavage
at a second DNA target sequence (compare percent cleavage of
reactions 17 with 18; 19 with 20; 21 with 22; and 23 with 24). The
data presented in Table 16 also demonstrates each NASC-PC1 was
required to be paired with a complementary NASC-PC2 in order to
target site-specific cleavage by the associated Cas9 proteins (see
Table 16, Reactions 9-16); that is, an individual polynucleotide
component of a NASC polynucleotide composition was incapable of
supporting Cas protein mediated site-specific cleavage.
[0423] Following the guidance of the present specification and
Examples, the biochemical cleavage assay described in this Example
can be practiced by one of ordinary skill in the art with other
NASC polynucleotide compositions and cognate Cas proteins (e.g.,
Cas9 proteins and Cpf1 proteins).
EXAMPLE 6
Deep Sequencing Analysis for Detection of Target Sequence
Modifications in Eukaryotic Cells
[0424] This Example illustrates the use of deep sequencing analysis
to evaluate and compare the percent cleavage in cells using NASC
polynucleotide composition/Cas protein complexes relative to
selected double-stranded DNA target sequences.
[0425] A. Genome Target Sequence Selection
[0426] Two target nucleic acid sequences can be selected from
exonic regions in the human genome (e.g., X-Ray Repair Cross
Complementing 5 (XRCC5) gene sequence). Nucleic acid sequences
twenty nucleotides in length that are 5' adjacent to PAM sequences
(e.g., a S. pyogenes Cas9 PAM 5'--NGG) can be selected, for
example, the XRCC5 target DNA sequences presented in Table 17.
TABLE-US-00017 TABLE 17 XRCC5 Target DNA Sequences hg38 Target
chromosomal SEQ ID name Target sequence coordinate NO. XRCC5T1
GGTGGACAAGCGGCAGATAG chr2: SEQ ID 216109346- NO. 41 216109365
XRCC5T3 GCACCATGTTGCCGGTCCTC chr2: SEQ ID 216109421- NO. 42
216109440
[0427] B. Construction of NASC Polynucleotide Compositions
[0428] A NASC polynucleotide composition comprising NASC-PC1 and
NASC-PC2 can be used. Nucleic acid target binding sequences
corresponding to XRCC5T1 can be incorporated at the 5' end of
NASC-PC1, and nucleic acid target binding sequences corresponding
to XRCC5T3 can be incorporated at the 5' end of NASC-PC2. As
positive controls, a nucleic acid target binding sequence
corresponding to XRCC5T1 can be incorporated at the 5' end of a
sgRNA, and a nucleic acid target binding sequences corresponding to
XRCC5T3 can be incorporated at the 5' end of a sgRNA. NASC-PC1,
NASC-PC2, and sgRNAs can be produced as described in Example 2.
Examples of sequences for NASC-PC1, NASC-PC2, and sgRNAs are given
in Table 18.
TABLE-US-00018 TABLE 18 sgRNA and NASC Polynucleotide Component
Sequences Component RNA SEQ ID designation Type RNA sequence* NO.
sgRNA- sgRNA GGUGGACAAGCGGCAGAUAGGUUU SEQ ID XRCC5-T1
UAGAGCUAUGCUGUUUUGGAAACA NO. 43 AAACAGCAUAGCAAGUUAAAAUAA
GGCUAGUCCGUUAUCAACUUGAAAA AGUGGCACCGAGUCGGUGCUU sgRNA- sgRNA
GCACCAUGUUGCCGGUCCUCGUUUU SEQ ID XRCC5-T3 AGAGCUAUGCUGUUUUGGAAACAA
NO. 44 AACAGCAUAGCAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAA
GUGGCACCGAGUCGGUGCUU NASC-PC1- NASC.sub.1 GGUGGACAAGCGGCAGAUAGGUUU
SEQ ID XRCC5-T1 UAGAGCUAUGCUGUUUUGGAAACU NO. 45
UUUCAGCACGAUAAGUUAUUAUAA GGCUAGUCCGUUAUCAACUUGAAAA
AGUGGCACCGAGUCGGUGCUU NASC-PC2- NASC.sub.1C
GCACCAUGUUGCCGGUCCUCGUAAU SEQ ID XRCC5-T3 AGAAUCGUGCUGAAAAGGAAACAA
NO. 46 AACAGCAUAGCAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAA
GUGGCACCGAGUCGGUGCUU *NASC-PC hybridizing regions are
underlined
[0429] C. Formation of NASC/Cas9 Protein Nucleoprotein
Complexes
[0430] S. pyogenes Cas9 can be C-terminally tagged with two nuclear
localization sequences (NLS) and can be recombinantly expressed in
E. coli, and purified using chromatographic methods.
Ribonucleoprotein complexes can be formed at a concentration of 80
pmol Cas9 protein:120 pmol NASC-PC1:120 pmols NASC-PC2. Control
sgRNA components can be individually assembled into
ribonucleoprotein complexes with Cas9 protein in a similar manner.
Prior to assembly with the Cas9 protein, NASC-PC1, NASC-PC2, and
the sgRNAs can be diluted to the desired concentration (120 pmol)
in a final volume of 2 .mu.L, incubated for 2 minutes at 95.degree.
C., removed from the thermocycler, and allowed to equilibrate to
room temperature. The Cas9 protein can be diluted to an appropriate
concentration in binding buffer (20 mM HEPES, 100 mM KCl, 5 mM
MgCl.sub.2, and 5% glycerol at pH 7.4) to a final volume of 3 .mu.L
and can be mixed with the 2 .mu.L of each NASC-PC1, NASC-PC2, and
the sgRNAs followed by incubation at 37.degree. C. for 30
minutes.
[0431] D. Cell Transfections Using the NASC/Cas9 Ribonucleoprotein
Complexes
[0432] Ribonucleoprotein complexes can be transfected into HEK293
cells (ATCC, Manassas Va.), using the Nucleofector.RTM. 96-well
Shuttle System (Lonza, Allendale, N.J.) following the
manufacturer's protocol. Ribonucleoprotein complexes can be
dispensed in a 5 .mu.L final volume into individual wells of a
96-well plate, wherein the wells contain the HEK293 cells in
culture medium. The cell culture medium can be removed from the
wells of the plate and the cells can be detached with TrypLE.TM.
enzyme (Thermo Scientific, Wilmington, Del.). Suspended HEK293
cells can be pelleted by centrifugation for 3 minutes at
200.times.g, TrypLE reagents can be aspirated, and cells can be
washed with calcium and magnesium-free phosphate buffered saline
(PBS). Cells can be pelleted by centrifugation for 3 minutes at
200.times.g the PBS aspirated and the cell pellet can be
re-suspended in 10 mL of calcium and magnesium-free PBS.
[0433] The cells can be counted using the Countess.RTM. II
Automated Cell Counter (Life Technologies, Grand Island, N.Y.).
2.2.times.10.sup.7 cells can be transferred to a 1.5 ml microfuge
tube and pelleted. The PBS can be aspirated and the cells can be
re-suspended in Nucleofector.TM. SF solution (Lonza, Allendale,
N.J.) to a density of 1.times.10.sup.7 cells/mL. 20 .mu.L of the
cell suspension can be added to each individual well containing 5
.mu.L of ribonucleoprotein complexes, and the entire volume from
each well can be transferred to a well of a 96-well
Nucleocuvette.TM. Plate (Lonza, Allendale, N.J.). The plate can be
loaded onto the Nucleofector.TM. 96-well Shuttle.TM. (Lonza,
Allendale, N.J.) and cells can be nucleofected using the 96-CM-130
Nucleofector.TM. program (Lonza, Allendale, N.J.).
Post-nucleofection, 70 .mu.L Dulbecco's Modified Eagle Medium
(DMEM; Thermo Scientific, Wilmington, Del.) supplemented with 10%
Fetal Bovine Serum (FBS; Thermo Scientific, Wilmington, Del.),
penicillin, and streptomycin (Life Technologies, Grand Island,
N.Y.) can be added to each well and then 50 .mu.L of the cell
suspension can be transferred to a 96-well cell culture plate
containing 150 .mu.L pre-warmed DMEM complete culture medium. The
plate can be then transferred to a tissue culture incubator and
maintained at 37.degree. C. in 5% CO.sub.2 for 48 hours.
[0434] E. Double-Stranded DNA Target Sequence Generation for Deep
Sequencing
[0435] gDNA can be isolated from the HEK293 cells 48 hours after
transfection of the ribonucleoprotein complexes using 50 .mu.L
QuickExtract DNA Extraction solution (Epicentre, Madison, Wis.) per
well, followed by incubation at 37.degree. C. for 10 minutes,
65.degree. C. for 6 minutes and 95.degree. C. for 3 minutes to stop
the reaction. The isolated gDNA can be diluted with 50 .mu.L
sterile water and samples can be stored at -80.degree. C.
[0436] Using the isolated gDNA, a first PCR can be performed using
Q5 Hot Start High-Fidelity 2.times. Master Mix (New England
Biolabs, Ipswich, Mass.) at 1.times. concentration, primers at 0.5
.mu.M each, 3.75 .mu.L of gDNA in a final volume of 10 .mu.L and
amplified 98.degree. C. for 1 minute, 35 cycles of 10 seconds at
98.degree. C., 20 seconds at 60.degree. C., 30 seconds at
72.degree. C., and a final extension at 72.degree. C. for 2
minutes. Primers can be designed to amplify either the XRCC5_T1
region (e.g., SEQ ID NO. 47 and SEQ ID NO. 48) or XRCC5_T3 (SEQ ID
NO. 49 and SEQ ID NO. 50). gDNA prepped from the
NASC-PC1/NASC-PC2/Cas9 nucleofected samples and the sgRNA/Ca9
nucleofected samples can be amplified with both primer pairs,
separately, to assess editing of each target site by the
ribonucleoproteins. Each PCR reaction can be diluted 1:100 in
water.
[0437] A "barcoding" PCR can be set up using unique index primers
for each sample to facilitate multiplex sequencing. Examples of
such primer pairs are shown in Table 19.
TABLE-US-00019 TABLE 19 Barcoding Primers ID Sample Primer
BARCODING PRIMER XRCC5_T1-sgRNA SEQ ID NO. 51, 52 set-1 BARCODING
PRIMER XRCC5_T3-sgRNA SEQ ID NO. 51, 53 set-2 BARCODING PRIMER
XRCC5-T1 NASC-PC1 SEQ ID NO. 51, 54 set-3 BARCODING PRIMER
XRCC5-T13 NASC-PC1 SEQ ID NO. 51, 55 set-4
[0438] The barcoding PCR can be performed using Q5 Hot Start
High-Fidelity 2.times. Master Mix (New England Biolabs, Ipswich,
Mass.) at 1.times. concentration, primers at 0.5 .mu.M each (Table
19), 1 .mu.L of 1:100 diluted first PCR, in a final volume of 10
.mu.L, and can be amplified 98.degree. C. for 1 minutes, 12 cycles
of 10 seconds at 98.degree. C., 20 seconds at 60.degree. C., 30
seconds at 72.degree. C., and a final extension at 72.degree. C.
for 2 minutes.
[0439] F. SPRIselect Clean-Up
[0440] All the barcoding PCR reactions can be pooled and
transferred into a single microfuge ("amplicon library") tube for
SPRIselect bead-based cleanup (Beckman Coulter, Pasadena, Calif.)
of amplicons for sequencing.
[0441] To each tube, 0.9.times. volumes of SPRIselect beads can be
added, mixed, and incubated at room temperature for 10 minutes. The
microfuge tube can be placed on magnetic tube stand (Beckman
Coulter, Pasadena, Calif.) until the solution clears. Supernatant
can be removed and discarded, and the residual beads can be washed
with 1 volume of 85% ethanol, and incubated at room temperature for
30 seconds. After incubation, ethanol can be aspirated and beads
can be air dried at room temperature for 10 minutes. Each microfuge
tube can be removed from the magnetic stand and 0.25.times. volumes
of Qiagen EB buffer (Qiagen, Venlo, Netherlands) can be added to
the beads, mixed vigorously, and incubated for 2 minutes at room
temperature. Each microfuge tube can be returned to the magnet,
incubated until the solution had cleared, and then the supernatant
containing the purified amplicons can be dispensed into a clean
microfuge tube. The purified amplicon library can be quantified
using the Nanodrop.TM. 2000 System (Thermo Scientific, Wilmington,
Del.) and library quality can be analyzed using the Fragment
Analyzer.TM. System (Advanced Analytical Technologies, Ames, Iowa)
and the DNF-910 Double-stranded DNA Reagent Kit (Advanced
Analytical Technologies, Ames, Iowa).
[0442] G. Deep Sequencing Set-Up
[0443] The pooled amplicon library can be normalized to a 4 nM
concentration as calculated from quantified values and the average
size of the amplicons. The amplicon library can be analyzed on
MiSeq Sequencer (Illumina, San Diego, Calif.) with MiSeq Reagent
Kit v2 (Illumina, San Diego, Calif.) for 300 cycles with two
151-cycle paired-end runs plus two eight-cycle index reads.
[0444] H. Deep Sequencing Data Analysis
[0445] The identities of products in the sequencing data can be
determined based on the index barcode sequences adapted onto the
amplicons in the barcoding PCR. A computational script can be used
to process the MiSeq data that executes, for example, the following
tasks: [0446] Reads can be aligned to the human genome (build
GRCh38/38) using Bowtie (bowtie-bio.sourceforge.net/index.shtml)
software. [0447] Aligned reads can be compared to the expected
wild-type locus region (e.g., XRCC5_T1 or XRCC5_T3) [0448] Locus
sequence and reads not aligning to any part of the target locus can
be discarded. [0449] Reads matching wild-type target locus
sequences can be tallied. [0450] Reads with indels (insertion or
deletion of bases) can be categorized by indel type and tallied.
[0451] Total indel reads can be divided by the sum of wild-type
reads and indel reads to give percent-mutated reads.
[0452] Through the identification of indel sequences at the regions
targeted by the NASC-PC1NASC-PC2/Cas9 protein ribonucleoprotein
complexes and the sgRNA/Cas9 protein ribonucleoprotein complexes,
sequence-specific targeting of in a human cell line can be
determined. Editing in NASC-PC1/NASC-PC2 samples can be compared to
the editing efficiencies of sgRNA controls.
[0453] Following the guidance of the present specification and
Examples, the in cell editing of a genomic sequence can be
practiced by one of ordinary skill in the art with other Cas
proteins and their cognate the NASC polynucleotide
compositions.
EXAMPLE 7
Identification and Screening of crRNAs
[0454] In this Example, a method is described through which crRNAs
of species having a Class 2 CRISPR system can be identified. The
method presented here is adapted from Chylinski, K., et al., RNA
Biology 10(5):726-737 (2013). Not all of the following steps are
required for screening nor must the order of the steps be as
presented.
[0455] A. Identify a Species Containing a Class 2 CRISPR Locus
[0456] Using the Basic Local Alignment Search Tool (BLAST,
blast.ncbi.nlm.nih.gov/Blast.cgi), a search of the genomes of
various species can be conducted to identify Class 2 CRISPR Cas
nucleases, (e.g., Cas9 protein, Cpf1 protein, Cas9-like proteins,
Cpf1-like proteins, etc.). Class 2 CRISPR systems exhibit a high
diversity in sequence across species, however Class 2 CRISPR
nuclease orthologs have conserved domains, for example, an HNH
endonuclease domain and/or a RuvC/RNase H domain. Primary BLAST
results can be filtered for identified domains, incomplete or
truncated sequences can be discarded, and species having Class 2
CRISPR nuclease orthologs can be identified.
[0457] If a Class 2 CRISPR nuclease ortholog can be identified in a
species, sequences adjacent to the Cas protein ortholog coding
sequence (e.g., a Cas9 protein or a Cpf1 protein) can be probed for
other Cas proteins and an associated repeat-spacer array to
identify all sequences belonging to the CRISPR-Cas locus. This may
be done by alignment to other known Class 2 CRISPR loci.
[0458] Once the sequence of the Class 2 CRISPR locus for the
nuclease ortholog can be identified for the species, in silico
predictive screening can be used to extract the crRNA sequence. The
crRNA sequence is contained within CRISPR repeat array and can be
identified by its hallmark repeating sequences interspaced by
foreign spacer sequences.
[0459] B. Preparation of RNA-Seq Library
[0460] The putative CRISPR array containing the individual crRNA
identified in silico can be further validated using RNA sequencing
(RNA-seq).
[0461] Cells from species identified as comprising putative crRNA
can be procured from a commercial repository (e.g., ATCC, Manassas,
Va.; German Collection of Microorganisms and Cell Cultures GmbH
(DSMZ), Braunschweig, Germany).
[0462] Cells can be grown to mid-log phase and total RNA prepped
using Trizol reagent (Sigma Aldrich, St. Louis, Mo.) and treated
with DNasel (Fermentas, Vilnius, Lithuania).
[0463] 10 .mu.g of the total RNA can be treated with Ribo-Zero rRNA
Removal Kit (Illumina, San Diego, Calif.) and the remaining RNA
purified using RNA Clean and Concentrators (Zymo Research, Irvine,
Calif.).
[0464] A library can be then prepared using a TruSeq Small RNA
Library Preparation Kit (Illumina, San Diego, Calif.) following the
manufacturer's instructions. This results in cDNAs having adapter
sequences.
[0465] The resulting cDNA library can be sequenced using MiSeq
Sequencer (Illumina, San Diego, Calif.).
[0466] C. Processing of Sequencing Data
[0467] Sequencing reads of the cDNA library can be processed, for
example, using the following method.
[0468] Adapter sequences can be removed using cutadapt 1.1
(pypi.python.org/pypi/cutadapt/1.1) and about 15 nt can be trimmed
from the 3' end of the read to improve read quality.
[0469] Reads can be aligned to the genome of the respective species
(i.e., from which the putative crRNA was identified) using Bowtie 2
(http://bowtie-bio.sourceforge.net/bowtie2/index.shtml).
[0470] The Sequence Alignment/Map (SAM) file, generated by Bowtie
2, can be converted into a Binary Alignment/Map (BAM) file using
SAMTools (samtools.sourceforge.net/) for subsequent sequencing
analysis steps.
[0471] Read coverage mapping to the CRISPR locus or loci, can be
calculated from the BAM file using BedTools
(bedtools.readthedocs.org/en/latest/).
[0472] The BED file, generated in the previous step, can be loaded
into Integrative Genomics Viewer (IGV; www.broadinstitute.org/igv/)
to visualize the sequencing read pileup. Read pile-ups can be used
to identify the 5' and 3' ends of the transcribed putative crRNA
sequence.
[0473] The RNA-seq data can be used to validate that a putative
crRNA element sequence is actively transcribed in vivo. Confirmed
hits from comparison of the in silico and RNA-seq screens can be
validated for functional ability to support Class 2 CRISPR nuclease
cleavage of a double-stranded DNA target nucleic acid sequences
using the methods outline herein (e.g., Examples 2, 3, and 5). It
is known in the art that Class 2 Type V CRISPR systems only
requires a crRNA to facilitate Cpf1 nuclease cleavage of a
double-stranded DNA target sequence, whereas Class 2 Type II CRISPR
systems require a crRNA and a cognate tracrRNA to facilitate Cas9
nuclease cleavage of a double-stranded DNA target sequence.
[0474] Following the guidance of the present specification and
Examples, the identification of crRNA sequences associated with
Cas9 proteins can be practiced by one of ordinary skill in the
art.
EXAMPLE 8
Identification and Screening of tracrRNAs
[0475] This Example illustrates a method by which tracrRNAs of
species having, for example, a Class 2 Type II CRISPR-Cas9 system
can be identified. This is adapted from Chylinski, K., et al., RNA
Biology 10(5):726-737 (2013). Not all of the following steps are
required for screening nor must the order of the steps be as
presented.
[0476] A. Identify a Species Containing a CRISPR-Cas9 Type-II
System
[0477] Using the Basic Local Alignment Search Tool (BLAST,
blast.ncbi.nlm.nih.gov/Blast.cgi), a search of the genomes of
various species can be conducted to identify a Cas9 protein. Class
2 Type II CRISPR-Cas9 systems exhibit a high diversity in sequence
across species, however Cas9 orthologs exhibit conserved domain
architectures of a central HNH endonuclease domain and a split
RuvC/RNase domain. Primary BLAST results can be filtered for
identified domains; incomplete or truncated sequences can be
discarded and Cas9 orthologs can be identified.
[0478] If a Cas9 ortholog can be identified in a species, sequences
adjacent to the Cas9 ortholog-coding sequence can be probed for
other Cas proteins and a Cas-associated repeat-spacer array to
identify all sequences belonging to the CRISPR-Cas9 locus. This may
be done by alignment to other known Class 2 Type II CRISPR-Cas9
loci, with the knowledge that closely related species exhibit
similar CRISPR-Cas9 locus architecture (e.g., Cas protein
composition, size, orientation, location of array, location of
tracrRNA, etc.). The tracrRNA element is typically contained within
the Class 2 Type II CRISPR-Cas9 locus and can be readily identified
by its sequence complementarity to the repeat elements in the
repeat-spacer array. The tracr sequences complementary to the
repeat elements are called the tracr anti-repeat sequences.
[0479] Once the sequence of the CRISPR-Cas9 locus corresponding to
the Cas9 ortholog is identified for a species, in silico predictive
screening can be used to extract the tracr anti-repeat sequence to
identify the Cas-associated tracrRNA. Putative anti-repeats can be
screened, for example, as follows.
[0480] If the repeat sequence is from a known species, the repeat
sequence can be identified in and retrieved from the CRISPRdb
database (crispr.u-psud.fr/crispr/). If the repeat sequence is not
from a known species, the repeat sequence can be predicted
employing CRISPRfinder software (crispr.u-psud.fr/Server/) using
the Class 2 Type II CRISPR-Cas9 locus for the species as described
above.
[0481] The identified repeat sequence for the species can be used
to probe the CRISPR-Cas9 locus for the anti-repeat sequence (e.g.,
using the BLASTp algorithm or the like). The search is typically
restricted to intergenic regions of the CRISPR-Cas9 locus.
[0482] An identified tracr anti-repeat region can be validated for
complementarity to the identified repeat sequence.
[0483] A putative anti-repeat region can be probed in the regions
5' and 3' of the putative anti-repeat region for the presence of a
Rho-independent transcriptional terminator (TransTerm HP,
transterm.cbcb.umd.edu/).
[0484] By combining the identified sequence comprising the
anti-repeat element and the Rho-independent transcriptional
terminator the sequence can be determined to be the putative
tracrRNA of the given species.
[0485] B. Preparation of RNA-Seq Library
[0486] The in silico identified, putative tracrRNA can be further
validated using RNA sequencing (RNA-seq).
[0487] Cells from species comprising the putative tracrRNA can be
procured from a commercial repository (e.g., ATCC, Manassas Va.;
DSMZ, Braunschweig, Germany).
[0488] Cells can be grown to mid-log phase and total RNA prepared
using Trizol reagent (Sigma Aldrich, St. Louis, Mo.) and treated
with DNaseI (Fermentas, Vilnius, Lithuania).
[0489] 10 ug of the total RNA can be treated using a Ribo-Zero rRNA
Removal Kit (Illumina, San Diego, Calif.) and the remaining RNA
purified using RNA Clean and Concentrators (Zymo Research, Irvine,
Calif.).
[0490] A library can be prepared using a TruSeq Small RNA Library
Preparation Kit (Illumina, San Diego, Calif.) following the
manufacturer's instructions. This results in cDNAs having adapter
sequences.
[0491] The resulting cDNA library can be sequenced using a MiSeq
Sequencer (Illumina, San Diego, Calif.).
[0492] C. Processing of Sequencing Data
[0493] Sequencing reads of the cDNA library can be processed, for
example, using the following method.
[0494] Adapter sequences can be removed using cutadapt 1.1
(pypi.python.org/pypi/cutadapt/1.1) and about 15 nt can be trimmed
from the 3' end of the read to improve read quality.
[0495] Reads can be aligned to the genome of the respective species
(i.e., from which the putative crRNA was identified) using Bowtie 2
(http://bowtie-bio.sourceforge.net/bowtie2/index.shtml).
[0496] The Sequence Alignment/Map (SAM) file generated by Bowtie 2
can be converted into a Binary Alignment/Map (BAM) file using
SAMTools (http://samtools.sourceforge.net/) for subsequent
sequencing analysis steps.
[0497] Read coverage mapping to the CRISPR locus or loci can be
calculated from the BAM file using BedTools
(bedtools.readthedocs.org/en/latest/).
[0498] The BED file, generated in the previous step, can be loaded
into Integrative Genomics Viewer (IGV; www.broadinstitute.org/igv/)
to visualize the sequencing read pileup. Read pile-ups can be used
to identify the 5' and 3' ends of the transcribed putative tracrRNA
sequence.
[0499] The RNA-seq data can be used to validate that a putative
tracrRNA element sequence is actively transcribed in vivo.
Confirmed hits from the comparison of the in silico and RNA-seq
screens can be validated for functional ability of the identified
tracrRNA sequence and its cognate crRNA to support Cas9-mediated
cleavage of a double-stranded DNA target sequence using methods
outline herein (e.g., Examples 2, 3, and 5).
[0500] Following the guidance of the present specification and
Examples, the identification of tracrRNA sequences related to Cas9
proteins can be accomplished by one of ordinary skill in the
art.
EXAMPLE 9
T7E1 Assay for Detection of Target Sequence Modifications in
Eukaryotic Cells
[0501] This Example illustrates the use of T7E1 assays to evaluate
and compare the percent cleavage in vivo of NASC/Cas9 protein
complexes (e.g., NASC-PC1/NASC-PC2/Cas9 protein complexes) relative
to selected double-stranded DNA target sequences.
[0502] A. Cell Transfections Using Cas Polynucleotide
Components
[0503] NASC-PC1 and NASC-PC2 can be transfected into HEK293 cells
constitutively expressing S. pyogenes Cas9 (HEK293-Cas9), using the
Nucleofector.RTM. 96-well Shuttle System (Lonza, Allendale, N.J.)
and the following protocol. NASC-PC1 and NASC-PC2 can be
individually diluted to appropriate concentration (e.g., 120 pmol),
mixed together, incubated for 2 minutes at 95.degree. C., removed
from the thermocycler, allowed to equilibrate to room temperature,
and dispensed in a 5 .mu.L final volume in a 96-well plate. Culture
medium can be aspirated from HEK293-Cas9 cells, the cells can be
washed once with calcium and magnesium-free PBS, and can be
trypsinized by the addition of TrypLE (Life Technologies, Grand
Island, N.Y.) followed by incubation at 37.degree. C. for 3-5
minutes. Trypsinized cells can be gently pipetted up and down to
form a single-cell suspension and added to DMEM complete culture
medium composed of DMEM culture medium (Life Technologies, Grand
Island, N.Y.) containing 10% Fetal Bovine Serum (FBS; Thermo
Scientific, Wilmington, Del.) and supplemented with penicillin and
streptomycin (Life Technologies, Grand Island, N.Y.).
[0504] The cells can be pelleted by centrifugation for 3 minutes at
200.times.g, the culture medium can be aspirated, and cells can be
re-suspended in PBS. The cells can be counted using the
Countess.RTM. II Automated Cell Counter (Life Technologies, Grand
Island, N.Y.). 2.2.times.10.sup.7 cells can be transferred to a 1.5
ml microfuge tube and pelleted. The PBS can be aspirated and the
cells can be re-suspended in Nucleofector.TM. SF (Lonza, Allendale,
N.J.) solution to a density of 1.times.10.sup.7 cells/mL. 20 .mu.L
of the cell suspension can be added to individual wells containing
5 uL of NASC-PC1/NASC-PC2 and the entire volume can be transferred
to the wells of a 96-well Nucleocuvette.TM. Plate (Lonza,
Allendale, N.J.). The plate can be loaded onto the Nucleofector.TM.
96-well Shuttle.TM. (Lonza, Allendale, N.J.) and cells can be
nucleofected using the 96-CM-130 Nucleofector.TM. program (Lonza,
Allendale, N.J.). Post-nucleofection, 70 .mu.L DMEM complete
culture medium can be added to each well, and 50 .mu.L of the cell
suspension can be transferred to a collagen coated 96-well cell
culture plate containing 150 .mu.L pre-warmed DMEM complete culture
medium. The plate can be transferred to a tissue culture incubator
and maintained at 37.degree. C. in 5% CO.sub.2 for 48 hours.
[0505] B. Double-Stranded DNA Target Sequence Generation for T7E1
Assay
[0506] gDNA can be isolated from HEK293-Cas9 cells 48 hours after
transfection with NASC-PC1/NASC-PC2 using 50 .mu.L QuickExtract DNA
Extraction solution (Epicentre, Madison, Wis.) per well followed by
incubation at 37.degree. C. for 10 minutes, 65.degree. C. for 6
minutes and 95.degree. C. for 3 minutes to stop the reaction. gDNA
can be diluted with 150 .mu.L water and samples can be stored at
-80.degree. C.
[0507] DNA for T7E1 can be generated by PCR amplification of
double-stranded DNA target sequences (e.g., XRCC5_T1 and XRCC5_T3)
from isolated gDNA. PCR reactions can be set up using 8 .mu.L gDNA
as template with KAPA HiFi Hot Start polymerase and contain 0.5 U
of polymerase, 1.times. reaction buffer, 0.4 mM dNTPs and 300 nM
forward and reverse primers directed to one of the double-stranded
DNA target sequences (e.g., SEQ ID NO. 47/SEQ ID NO. 48 and SEQ ID
NO. 49/SEQ ID NO. 50) in a total volume of 25 .mu.L. The DNA target
sequences can be amplified using the following conditions:
95.degree. C. for 5 minutes, 4 cycles of 20 seconds at 98.degree.
C., 20 seconds at 70.degree. C., minus 2.degree. C./cycle, 30
seconds at 72.degree. C., followed by 30 cycles of 15 seconds at
98.degree. C., 20 seconds at 62.degree. C., 20 seconds at
72.degree. C., and a final extension at 72.degree. C. for 1
minute.
[0508] C. T7E1 Assay
[0509] PCR-amplified double-stranded DNA target sequences for T7E1
assays can be denatured at 95.degree. C. for 10 minutes and then
allowed to re-anneal by cooling to 25.degree. C. at -0.5.degree.
C./second in a thermal cycler. The re-annealed DNA can be incubated
with 0.5 .mu.L T7 Endonuclease I in 1.times. NEBuffer 2 buffer (New
England Biolabs, Ipswich, Mass.) in a total volume of 15 .mu.L for
25 minutes at 37.degree. C. T7E1 reactions can be analyzed using
the Fragment Analyzer.TM. System (Advanced Analytical Technologies,
Ames, Iowa) and the DNF-910 Double-stranded DNA Reagent Kit
(Advanced Analytical Technologies, Ames, Iowa). The Fragment
Analyzer.TM. System provides the concentration of each cleavage
fragment and of the double-stranded DNA target sequence that
remains after cleavage.
[0510] Cleavage percentages of the double-stranded DNA target
sequences can be calculated from the concentration of each cleavage
fragment and the double-stranded DNA target sequence that remains
after cleavage has taken place, using the following formula:
% cleavage = ( 1 - ( 1 - ( frag 1 + frag 2 ) ( frag 1 + frag 2 +
parent ) ) ) EQUATION 1 ##EQU00001##
[0511] In Equation 1, frag1 and frag2 concentrations correspond to
the concentration of Cas9 cleavage fragments of the double-stranded
DNA target sequence and parent corresponds to the double-stranded
DNA target sequence that remains after cleavage has taken
place.
[0512] The T7E1 assay for detection of target sequence
modifications in eukaryotic cells provides data to demonstrate that
the NASC polynucleotide compositions described herein facilitate
Cas9-mediated site-specific in vivo cleavage of multiple
double-stranded DNA target sequences. sgRNA, crRNA, and/or
crRNA/tracrRNA polynucleotides having the same DNA target binding
sequence as the NASC polynucleotide composition can also be
included in the assay to compare the Cas-mediated site-specific
cleavage percentages between the constructs.
[0513] Following the guidance of the present specification and
Examples, the T7E1 assay described in this Example can be practiced
by one of ordinary skill in the art with other Cas proteins and
their cognate NASC polynucleotide compositions.
EXAMPLE 10
Probing for Sites Tolerant of Modification in Class 2 Type V Cpf1
Guide RNA Backbones
[0514] This Example describes the generation and testing of various
modifications of Class 2 Type V guide crRNAs and their suitability
for use in constructing NASC polynucleotide components. The method
described below is adapted from Briner, A., et al., Molecular Cell
56(2):333-339 (2014). Not all of the following steps are required
for screening nor must the order of the steps be as presented.
[0515] In this Example, modifications can be introduced into the
crRNA backbone, and the modified crRNA tested with a cognate Cpf1
nuclease to facilitate identification of regions or positions in
the Cpf1-crRNA backbone wherein linkages for NASC polynucleotide
components can be engineered.
[0516] A crRNA from a Class 2 Type V CRISPR system (e.g.,
Acidaminococcus sp. Cpf1) can be selected for engineering. The
crRNA sequence can be modified in silico to introduce one or more
base substitutions, deletions, or insertions into nucleic acid
sequences in regions selected from one or more of the following
regions: nucleic acid sequences 5' of the pseudo-knot, Cpf1-stem
RNA sequence 1, the pseudo-knot loop (loop element nucleic acid
sequence), Cpf1-stem RNA sequence 1C, or the spacer element.
[0517] The crRNA sequence can be modified in silico to introduce
one or more break in the phosphodiester backbone in one or more
regions selected from the following: nucleic acid sequences 5' of
the pseudo-knot, Cpf1-stem RNA sequence 1, the pseudo-knot loop
(loop element nucleic acid sequence), Cpf1-stem RNA sequence 1C, or
the spacer element.
[0518] Base modification can also be used to introduce mismatches
in the hydrogen base-pair interactions of any of the crRNA regions,
or base-pair mutation introducing an alternative hydrogen base-pair
interaction through substitution of two bases, wherein the
alternative hydrogen base-pair interaction differs from the
original hydrogen base-pair interaction (e.g., the original
hydrogen base-pair interaction is Watson-Crick base pairing and the
substitution of the two bases form a reverse Hoogsteen base
pairing). Substitution of bases can also be used to introduce
hydrogen base-pair interaction within the crRNA backbone (e.g.,
within the pseudo-knot loop sequence).
[0519] Regions of the crRNA can be independently engineered to
introduce secondary structure elements into the crRNA backbone.
Such secondary structure elements include, but are not limited to,
the following: stem-loop elements, stem elements, pseudo-knots, and
ribozymes. Furthermore, the crRNA guide RNA backbone can be
modified to delete portions of the crRNA backbone either through
deletion at the 5' end, 3' end or internal to the crRNA.
Alternative backbone structures can also be introduced.
[0520] In silico designed crRNA sequences can be provided to a
commercial manufacturer for synthesis.
[0521] Modified crRNAs can be evaluated for their ability to
support cleavage of a double-stranded DNA target sequence mediated
by the cognate Cpf1 protein to the crRNA that gave rise to the
modified crRNA. Amplification of double-stranded DNA target
sequences and the biochemical cleavage assay can be carried out in
a manner similar to those described in Example 4 and Example 5,
respectively. Modified crRNA that are capable of mediating cleavage
of a DNA target sequence with their cognate Cpf1 proteins can be
validated for activity in cells using the method described in
Example 6.
[0522] Following the guidance of the present specification and
Examples, the modification of a Cpf1 crRNA (e.g., introduction or
deletion of various sequences, and/or introduction or deletion of
secondary structural modifications) can be used to probe for
locations for insertion or linkages to facilitate making NASC
polynucleotide compositions. This Example can be practiced by one
of ordinary skill in the art with other Type V CRISPR Cpf1 proteins
and other Type V CRISPR crRNA in view of the teachings of the
present specification.
EXAMPLE 11
Probing for Sites Tolerant of Modification in Class 2 Type II Cas9
Guide RNA Backbones
[0523] This Example describes the generation and testing of various
modifications of Class 2 Type II guide RNA(s) and their suitability
for use in constructing NASC polynucleotide compositions.
[0524] In this Example, modifications can be introduced into the
RNA backbone of Class 2 Type II CRISPR guide RNA(s) (e.g.,
dual-guide RNAs or single-guide RNAs) to identify locations for
engineering or attachment of various nucleic acid sequences. The
method described below is adapted from Briner, A., et al.,
Molecular Cell 56(2):333-339 (2014). Not all of the following steps
are required for screening nor must the order of the steps be as
presented.
[0525] A Class 2 Type II CRISPR sgRNA, crRNA, tracrRNA, or crRNA
and tracrRNA (collectively referred to a "Cas9 guide RNA") can be
selected for engineering.
[0526] The Cas9 guide RNA sequence can be modified in silico to
introduce one or more base substitutions, deletions, or insertions
into regions selected from one or more of the following: a nucleic
acid target binding sequence, a lower stem nucleic acid sequence, a
bulge nucleic acid sequence, an upper stem nucleic acid sequence, a
first stem-loop element nucleic acid sequence, a nexus nucleic acid
sequence, a linking nucleic acid sequence, and/or 3' hairpins. The
Cas9 guide RNA sequence can be modified in silico to introduce one
or more breaks in the phosphodiester backbone in one or more
regions selected from the following: a nucleic acid target binding
sequence, a lower stem nucleic acid sequence, a bulge nucleic acid
sequence, an upper stem nucleic acid sequence, a first stem-loop
element nucleic acid sequence, a nexus nucleic acid sequence, a
linking nucleic acid sequence, and 3' hairpins.
[0527] Base modification can be used to introduce mismatches in the
hydrogen base-pair interactions of any of the Cas9 guide RNA
regions. Base-pair mutation can be used to introduce an alternative
hydrogen base-pair interaction through substitution of two bases,
wherein the alternative hydrogen base-pair interaction differs from
the original hydrogen base-pair interaction (e.g., the original
hydrogen base-pair interaction is Watson-Crick base pairing and the
substitution of the two bases form a reverse Hoogsteen base
pairing). Substitution of bases can also be used to introduce
hydrogen base-pair interaction within the Cas9 guide RNA backbone
(e.g., within the bulge sequence).
[0528] Regions of the Cas9 guide RNA can be independently
engineered to introduce secondary structure elements into the Cas9
guide RNA backbone. Such secondary structure elements include, but
are not limited to, the following: stem-loop elements, stem
elements, pseudo-knots, and ribozymes. Furthermore, the Cas9 guide
RNA backbone can be modified to delete portions of the Cas9 guide
RNA backbone through deletion at the 5' end, 3' end, and/or or
internal to the Cas9 guide RNA. Alternative backbone structures can
also be introduced.
[0529] In silico designed Class 2 Type II CRISPR Cas9 guide RNA
sequences can be provided to a commercial manufacturer for
synthesis.
[0530] Modified Class 2 Type II CRISPR Cas9 guide RNAs can be
evaluated for ability to support cleavage of a double-stranded DNA
target sequence mediated by the cognate Cas9 protein to the Cas9
guide RNA that gave rise to the modified Cas9 guide RNA.
Amplification of a double-stranded DNA target sequences and the
biochemical cleavage assay can be carried out in a manner similar
to those described in Example 4 and Example 5, respectively.
Modified Cas9 guide RNAs capable of mediating cleavage of a DNA
target sequence with their cognate Cas9 proteins can be validated
for activity in cells using the method described in Example 6.
[0531] Following the guidance of the present specification and
Examples, the modification of a Cas9 guide RNA(s) (e.g.,
introduction or deletion of various sequences, and/or introduction
or deletion of secondary structural modifications) can be used to
probe for locations for insertion or linkages to facilitate making
NASC polynucleotide compositions. This Example can be practiced by
one of ordinary skill in the art with other Type II CRISPR Cas9
proteins and other Type II CRISPR Cas9 guide RNA in view of the
teachings of the present specification.
EXAMPLE 12
Screening of NASC Polynucleotide Compositions Comprising DNA Target
Binding Sequences
[0532] This Example illustrates the use of NASC polynucleotide
compositions of the present invention to modify DNA target
sequences present in human gDNA and measure the level of cleavage
activity at those sites.
[0533] Target sites (DNA target sequences) can be first selected
from gDNA. Individual components of NASC polynucleotide
compositions can be designed to target the selected sequences.
Assays (e.g., as described in Example 5) can be performed to
determine the level of DNA target sequence cleavage.
[0534] Not all of the following steps are required for every
screening nor must the order of the steps be as presented, and the
screening can be coupled to other experiments, or form part of a
larger experiment.
[0535] A. Selecting DNA Target Regions (DNA Target Sequences) from
gDNA
[0536] PAM sequences (i.e., NGG, TTN, etc.) for a Cas protein
(e.g., S. pyogenes Cas9 or Acidaminococcus sp. Cpf1) can be
identified within the selected genomic region.
[0537] One or more Cas9 DNA target sequences (20 nucleotides in
length) that are 5' adjacent to a PAM sequence can be identified
and selected or one or more Cpf1 DNA target sequences (20-24
nucleotide in length) that are 3' adjacent to a PAM sequence can be
identified and selected.
[0538] Criteria for selection of nucleic acid target sequences can
include, but are not limited to, the following: homology to other
regions in the genome, percent G-C content, melting temperature,
presences of homopolymer within the spacer, distance between the
two sequences, and other criteria known to one skilled in the
art.
[0539] If a Type II CRISPR NASC polynucleotide composition is
desired to be used, the DNA target binding sequence can be
incorporated at the 5' end. If a Type V CRISPR NASC polynucleotide
composition is desired to be used, the DNA target binding sequence
can be incorporated at the 3' end. A commercial manufacturer
typically synthesizes NASC polynucleotide compositions based on
provided sequences. Alternatively, the NASC polynucleotide
compositions can be produced as described in Example 2 by in vitro
transcription.
[0540] NASC polynucleotide compositions as described herein can be
used with cognate Class 2 Type II CRISPR nuclease (e.g., a Cas9
nuclease), a Class 2 Type V CRISPR nuclease (e.g., a Cpf1
nuclease), or both a cognate Class 2 Type II CRISPR nuclease and a
Class 2 Type V CRISPR nuclease to form NASC/Cas protein
complexes.
[0541] B. Determination of Cleavage Percentages and Specificity
[0542] In vitro cleavage percentages and specificity (e.g., the
amount of off-target binding) related to NASC polynucleotide
compositions can be determined, for example, using the cleavage
assays described in Example 5 and can be compared as follows:
[0543] (1) If only a single pair of DNA target sequences can be
identified or selected for a NASC, the cleavage percentage and
specificity for each of the DNA target sequences can be determined.
If so desired, cleavage percentage and/or specificity can be
altered in further experiments using methods including, but not
limited to, modifying the NASC; or introducing effector
proteins/effector protein-binding sequences to modify the NASC, a
NASC polynucleotide component, or the Cas protein; or introducing
ligand/ligand binding moieties to modify the NASC polynucleotide or
the Cas protein.
[0544] (2) If multiple pairs of DNA target sequences can be
identified or selected for a NASC, the percentage cleavage data and
site-specificity data obtained from the cleavage assays can be
compared between different DNAs comprising the target binding
sequence to identify the DNA target sequences having the desired
cleavage percentage and specificity. Cleavage percentage data and
specificity data provide criteria on which to base choices for a
variety of applications. For example, in some situations the
activity of the NASC polynucleotide composition may be the most
important factor. In other situations, the specificity of the
cleavage site may be relatively more important than the cleavage
percentage. If so desired, cleavage percentage and/or specificity
can be altered in further experiments using methods including, but
not limited to, modifying the NASC; or introducing effector
proteins/effector protein-binding sequences to modify the NASC, a
NASC polynucleotide component, or the Cas protein; or introducing
ligand/ligand binding moieties to modify the NASC polynucleotide
component or the Cas protein.
[0545] Alternatively, or in addition to the in vitro analysis, in
cell cleavage percentages and specificities associated with NASC
polynucleotide compositions can be obtained using, for example, the
method described in Example 6, can be compared as follows:
[0546] (1) If only a single pair of DNA target sequences can be
identified or selected for a NASC, the cleavage percentage and
specificity for each of the DNA target sequences can be determined.
If so desired, cleavage percentage and/or specificity can be
altered in further experiments using methods including, but not
limited to, modifying the NASC; or introducing effector
proteins/effector protein-binding sequences to modify the NASC, a
NASC polynucleotide component, or the Cas protein; or introducing
ligand/ligand binding moieties to modify the NASC polynucleotide
component or the Cas protein.
[0547] (2) If multiple pairs of DNA target sequences can be
identified or selected for a NASC, the percentage cleavage data and
site-specificity data obtained from the cleavage assays can be
compared between different DNAs comprising the target binding
sequence to identify the DNA target sequences having the desired
cleavage percentage and specificity. Cleavage percentage data and
specificity data provide criteria on which to base choices for a
variety of applications. For example, in some situations the
activity of the NASC polynucleotide composition may be the most
important factor. In other situations, the specificity of the
cleavage site may be relatively more important than the cleavage
percentage. If so desired, cleavage percentage and/or specificity
can be altered in further experiments using methods including, but
not limited to, modifying the NASC; or introducing effector
proteins/effector protein-binding sequences to modify the NASC, a
NASC polynucleotide component, or the Cas protein; or introducing
ligand/ligand binding moieties to modify the NASC polynucleotide
component or the Cas protein.
[0548] Following the guidance of the present specification and
Examples, the screening described in this Example can be practiced
by one of ordinary skill in the art with other NASC polynucleotide
compositions for use with cognate Class 2 Type II CRISPR Cas9
proteins, cognate Class 2 Type V CRISPR Cpf1 proteins, or both
cognate Class 2 Type II CRISPR Cas9 proteins and cognate Class 2
Type V CRISPR Cpf1 proteins.
EXAMPLE 13
Engineering of Ribonucleoprotein Closed-Cage Complexes Comprising
NASC Polynucleotide Compositions
[0549] This Example illustrates the use of NASC polynucleotide
compositions of the present invention for formation of NASC-CC
closed-cage complexes for packaging of small molecules.
[0550] A NASC-CC can be engineered, for example, using a first NASC
polynucleotide composition and a second NASC polynucleotide
composition, each having the general structure shown in FIG. 6H
(FIG. 6H, I, NASC-PC1; FIG. 6H, II, NASC-PC2; and FIG. 6H, III,
NASC-PC-3). The first NASC polynucleotide composition and the
second NASC polynucleotide composition can be used in combination
with three double-stranded DNA sequences. Each double-stranded DNA
sequence ("a double-stranded DNA brace sequence") can comprise two
unique DNA target sequences, wherein the first DNA target sequence
is complementary to a first nucleic acid binding sequence of the
first NASC polynucleotide composition, and the second DNA target
sequence is complementary to a second nucleic acid binding sequence
of the second NASC polynucleotide composition.
[0551] NASC-CC and associated Cas proteins can be used to create
closed-cage complexes suitable for the packaging of molecules. The
size of the cage can be varied by changing the design of the
NASC-CC components or by binding different length DNA target
sequences.
[0552] A. Design of NASC-CC Components
[0553] A first NASC polynucleotide composition (referred to in this
Example as a "NASC-triplex1") can be engineered comprising a
NASC-PC1, a NASC-PC2, and a NASC-PC3, which are similar in
structure to those depicted in FIG. 6A (referred to in this Example
as a "NASC-PC1-triplex1," a "NASC-PC2-triplex1," and a
"NASC-PC3-triplex1"). A first 20-nucleotide DNA target sequence can
be added to the 5' end (see, e.g., FIG. 6A, 610-611) of each of
NASC-PC1-triplex1, NASC-PC2-triplex1, and NASC-PC3-triplex1. The
DNA target sequence typically will be selected to have no or
limited homology to native DNA sequences in an organism into which
the NASC-CC are to be introduced (e.g., human gDNA or plant
gDNA).
[0554] A second NASC polynucleotide composition (referred to in
this Example as "NASC-triplex2") can be engineered comprising a
NASC-PC1-triplex2, a NASC-PC2-triplex2, and a NASC-PC3-triplex2,
which are similar in structure to those depicted in FIG. 6A. A
second 20-nucleotide DNA target sequence can be added to the 5' end
(see, e.g., FIG. 6A, 610-611) of each of NASC-PC1-triplex2,
NASC-PC2-triplex2, and NASC-PC3-triplex2. The DNA target sequence
typically will be selected to have no or limited homology to native
DNA sequences in an organism into which the NASC-CC are to be
introduced (e.g., human gDNA or plant gDNA). Furthermore, the
20-nucleotide DNA target sequences should be distinct from (i.e.,
not complementary to) the DNA target sequences engineered in the
NASC-triplex1.
[0555] Illustrative components of NASC-triplex1 and NASC-triplex2
are presented in Table 20. In the table, the "Target sequence"
column indicates the 20 bp DNA target sequence that is
complementary to the nucleic acid target binding sequence in the
corresponding NASC polynucleotide component.
TABLE-US-00020 TABLE 20 NASC-triplex 1 and NASC-triplex2 Components
NASC- NASC Target SEQ triplex component sequence Sequence* ID NO.
NASC- NASC- 1 AUCUUGUUGACACGAGGAAUGU SEQ triplex1 PC1-
UUUAGUCCCUAAUUAAAUUUCU ID NO. triplex1 UGAAAUUGGUAUAUAAGGAGGG 57
ACUACAACAAAGAGUUUGCGGG ACUCUGCGGGGUUACAAUCCCC
UAAAACCGCUUUUAAAAUUCAA AUAAAUUUUGCUUU NASC- NASC- 1
AUCUUGUUGACACGAGGAAUGU SEQ triplex1 PC2- UGUAGUCCCUCCUUAUAUACCA ID
NO. triplex1 AGAAAAAGAAAUUUAAAACUGA 58 ACUCCAACAAAGAGUUUGCGGG
ACUCUGCGGGGUUACAAUCCCC UAAAACCGCUUUUAAAAUUCAA AUAAAUUUUGCUUU NASC-
NASC- 1 AUCUUGUUGACACGAGGAAUGU SEQ triplex1 PC3-
UGGAGUUCAGUUUUAAAUUUCU ID NO. triplex1 UGAAAAAGAAAUUUAAUUAGGG 59
ACUAAAACAAAGAGUUUGCGGG ACUCUGCGGGGUUACAAUCCCC
UAAAACCGCUUUUAAAAUUCAA AUAAAUUUUGCUUU NASC- NASC- 2
CGAUAUAAUACAGCAAGGUGGU SEQ triplex2 PC1- UUUAGACCCCUCUUCCAUUUCGC ID
NO. triplex2 GAAAGCGUUUUGAGAGAGUGAA 60 CUACAACAAAGAGUUUGCGGGA
CUCUGCGGGGUUACAAUCCCCU AAAACCGCUUUUAAAAUUCAAA UAAAUUUUGCUUU NASC-
NASC- 2 CGAUAUAAUACAGCAAGGUGGU SEQ triplex2 PC2-
UGUAGUUCACUCUCUCAAAACG ID NO. triplex2 CGAAAAAGAAAUUUAAUAAGGA 61
ACUACAACAAAGAGUUUGCGGG ACUCUGCGGGGUUACAAUCCCC
UAAAACCGCUUUUAAAAUUCAA AUAAAUUUUGCUUU NASC- NASC- 2
CGAUAUAAUACAGCAAGGUGGU SEQ triplex2 PC3- UGUAGUUCCUUAUUAAAUUUCU ID
NO. triplex2 UGAAAGCGAAAUGGAAGAGGGG 62 UCUAAAACAAAGAGUUUGCGGG
ACUCUGCGGGGUUACAAUCCCC UAAAACCGCUUUUAAAAUUCAA AUAAAUUUUGCUUU
*NASC-triplex hybridizing regions are underlined
[0556] A double-stranded DNA brace sequence can be engineered to
incorporate, in the 5' to 3' direction, a 20 nucleotide random
sequence at the 5' end, target sequence 1, the C. jejuni PAM
sequence 5'-NNNACA-3' (where "N" is any nucleotide), 50 nucleotides
of random sequence, the reverse compliment of the C. jejuni PAM
sequence, the reverse compliment of target sequence 2, and a
randomize 20-nucleotide sequence at the 3' end. The double-stranded
DNA brace sequence will be targetable by C. jejuni dCas9 proteins
when bound to both the NASC-PC1-triplex1 and the NASC-PC1-TRP2 and
will bring the two NASCs within proximity of one another. The
sequence of the double-stranded DNA brace sequence can be provided
to a commercial manufacturer for synthesis of the double-stranded
DNA. Alternatively, the sequence of the double-stranded DNA brace
sequence can be constructed using single-stranded DNA
oligonucleotides, similar to the construction of double-stranded
DNA template presented in Example 2.
[0557] An illustrative sequence for a double-stranded DNA brace
sequence is shown in Table 21.
TABLE-US-00021 TABLE 21 Double-stranded DNA Brace Sequence SEQ ID
Sequence* NO. CGTCGCTATGATTTGCCTATATCTTGTTGACACGAGGAAT SEQ ID
GTAAACAACGAGTTCCGCTATTGGGATGGAGTTTAACTGT NO.
CGCAACTCTCATCGCAATGTCAGTCACCTTGCTGTATTAT 63
ATCGCGCATGATAAAGTACGCCAT *Target and PAM sequences are bolded
[0558] B. Engineering and Production of C. jejuni dCas9 Protein
[0559] A C. jejuni (e.g., C. jejuni NCTC 1168; SEQ ID NO. 103) Cas9
amino acid sequence can be mutated from an aspartic acid at amino
acid position 8 to an alanine (D8A) and a histidine at position 559
to alanine (D8A/H559A) to generate a nuclease-inactive form of the
C. jejuni Cas9 protein (C. jejuni dCas9 protein; SEQ ID NO. 56). C.
jejuni dCas9 protein will remain capable of binding to a
NASC-triplex1. Three C. jejuni dCas9 proteins are capable of
binding to the NASC-triplex1 and directing the NASC-triplex1 to
bind the target sequences complementary to the nucleic acid target
binding sequences therein. The C. jejuni dCas9 protein can be
C-terminally tagged with two nuclear localization sequences (NLS)
and can be recombinantly expressed in E. coli, and purified using
chromatographic methods.
[0560] C. Formation of NASC-CCs
[0561] NASC-triplex1 can be formed by mixing NASC-PC1-triplex1,
NASC-PC2-triplex1, and NASC-PC3-triplex1 (Table 20) in equal molar
concentration, incubating for 2 minutes at 95.degree. C., annealing
by cooling to 25.degree. C. at -0.5.degree. C./second in a thermal
cycler, and then allowing the mixture to equilibrate to room
temperature. NASC-triplex2 can be formed by mixing
NASC-PC1-triplex2, NASC-PC2-triplex2, and NASC-PC3-triplex2 (Table
20) in equal molar concentration, incubating for 2 minutes at
95.degree. C., annealing by cooling to 25.degree. C. at
-0.5.degree. C./second in a thermal cycler, and then allowing the
mixture to equilibrate to room temperature.
[0562] Ribonucleoprotein closed-cage complexes can be formed by
mixing NASC-triplex1 in the presence of an excess concentration of
the C. jejuni dCas9 protein in a binding buffer (20 mM HEPES, 100
mM KCl, 5 mM MgCl.sub.2, and 5% glycerol at pH 7.4) and incubating
at 37.degree. C. for 20 minutes. The double-stranded DNA brace
sequence can be added at a limiting concentration to the mixture
comprising the NASC-triplex1/dCas9 protein complex, and incubated
for 37.degree. C. for 20 minutes. NASC-triplex2 can be added to the
mixture of NASC-triplex1/dCas9 protein/double-stranded DNA brace
sequences at an equivalent concentration of NASC-triplex1. The
mixture can be incubated for 1 hour at 37.degree. C.
NASC-triplex1/dCas9 protein/double-stranded DNA brace
sequences/NASC-triplex2/dCas9 protein closed-cage complexes can be
frozen at -80.degree. C. for long-term storage.
[0563] FIG. 6L illustrates an example of an underlying nucleic acid
scaffold structure (NASC-CC), with Cas proteins omitted for
clarity. NASC-triplex1 and NASC-triplex2 are the structures in this
figure that correspond to the structure shown in FIG. 6G. The
dashed lines in this figure give an indication of the kinds of
connections created by the double-stranded DNA brace sequences
between NASC-triplex1 and NASC-triplex2. FIG. 6M illustrates the
NASC-CC in complex with the dCas9 protein proteins. The dCas9
protein proteins are represented in this figure by the grey
circles.
[0564] Following the guidance of the present specification and
Example, the formulation of other NASC-CC ribonucleoprotein
closed-cage complexes (e.g., comprising various combinations of the
NASC compositions described herein) can be practiced by one of
ordinary skill in the art with other NASC compositions and cognate
Cas proteins.
EXAMPLE 14
Structural Analysis of NASC Ribonucleoprotein Closed-Cage
Complexes
[0565] The following Example describes characterization of
NASC-CC/dCas protein closed-cage complexes to verify proper
assembly and assess the size and volume of assembled NASC-CC/dCas
protein complexes. The method described below is adapted from
Andersen, F., et al., Nucleic Acids Research 36(4):1113-1119 (2008)
and Lapinaite, A., et al., Nature 502(7472):519-523 (2013). Not all
of the following steps are required for screening nor must the
order of the steps be as presented.
[0566] A. Electrophoretic Mobility Shift Assay of NASC-CC/dCas
Protein Complexes
[0567] NASC-CC/dCas protein complexes can be formulated as
described in Example 13, modified so that a radiolabeled
double-stranded DNA brace sequence can be used. The double-stranded
DNA brace sequence can be radiolabeled by preparing the following
reaction mixture: double-stranded DNA brace sequences in the
presence of T4 polynucleotide kinase (New England Biolabs, Ipswich,
Mass.), .gamma.-(.sup.32P) ATP (Promega, Madison, Wis.), and
1.times. T4 polynucleotide kinase reaction buffer. The reaction
mixture can be incubated and then heat inactivated at 65.degree. C.
for 20 minutes. Radiolabeled DNA can be purified using an Illustra
MicroSpin G-25 column (GE Healthcare, Pittsburgh, Pa.).
[0568] Alternatively, one or more of the NASC-CC components can be
radiolabeled in a similar manner.
[0569] Radiolabeled NASC-CC/dCas9 protein complexes can be
aliquoted into a 10 .mu.L volume, and resolved at 4.degree. C. by
electrophoresis in a 8% native polyacrylamide gel containing
1.times. Tris/Borate/EDTA buffer (90 mM Tris, 90 mM boric acid, 2
mM EDTA at pH 8.3) and 5 mM MgCl.sub.2. The gel can be subsequently
dried and imaged using the PMI.TM. system (Bio-Rad Laboratories,
Hercules, Calif.). Individual polynucleotide components of the
NASC-CC (e.g., NASC-PC1-triplex1, NASC-PC2-triplex1,
NASC-PC3-triplex1, NASC-PC1-triplex2, NASC-PC2-triplex2,
NASC-PC3-triplex2, double-stranded DNA brace sequences, and/or
individual components complexed with dCas9 protein) can be used as
controls for comparison to identify the electrophoretic mobility
shift of the completely formed NASC-CC/dCas9 protein complexes.
[0570] B. Small Angle X-ray Scattering of NASC-CC/dCas9 Protein
Complexes
[0571] NASC-CC/dCas9 protein complexes, described in Example 13,
can be dialyzed at 4.degree. C. in a buffer of 20 mM HEPES, 100 mM
KCl, 5 mM MgCl.sub.2, and 5% glycerol at pH 7.4. The dialyzed
preparation of NASC-CC/dCas9 protein complexes can be dispensed
into the wells of a 96-well plate using a concentration series from
1 mg/mL to 5 mg/mL in a final volume of 40 .mu.L.
[0572] Small angle X-ray scattering (SAXS) measurements can be
collected at a service provider, such as The Advanced Light Source
(Berkeley, Calif.), using a Structurally Integrated BiologY for
Life Sciences (SIBYLS) beamline with a Mar165CCD detector. Data can
be collected in multiple frames with exposure time ranges of 0.5
second to 10 seconds and detector distances of 1.5 meters to 5
meters. Optimal collection conditions can be evaluated for minimal
radiation damage to sample as well as optimal signal to noise
ratios. Similarly, beamline kiloelectron-volts (keV) energy can be
tuned from a range of 7 keV to 15 keV. Buffer-only control can be
used as background and subtracted from measurements.
[0573] Data processing and analysis can be performed using standard
beamline software and PRIMUS (Konarev, P., et al., Journal of
Applied Crystallography 36:1277-1282 (2003)). Data modeling can be
performed using SAXS analysis programs, such as an open source
software suite (e.g., ATSAS 2.7.2, Petoukhov, M., et al., Journal
of Applied Crystallography 45:342-350 (2012)). Atomic coordinates
of Cas9 protein and single-guide RNA in different nucleotide bound
states (e.g., sgRNA only, sgRNA plus target strand, sgRNA plus
target and non-target strand), as well as structures (e.g.,
nucleases, proteins, double-stranded DNA and RNA) are available
from the Protein Database (PDB, www.rcsb.org/pdb/home/home.do) or
Electron Microscopy Data Bank (EMDB, www.ebi.ac.uk/pdbe/emdb/).
These atomic coordinates can be used to calculate the internal
volume, pore size, and closed-cage sizes of the NASC-CC/dCas9
protein complexes by modeling, combined with SAXS data.
[0574] NASC-CC/dCas9 protein complexes can be modified to increase
or decrease the internal volume, pore size, or closed-cage sizes as
needed for the packaging and delivery of biomolecules, proteins, or
other payloads. Such modifications can include, but are not limited
to, lengthening or shortening of the first stem element nucleic
acid sequence (FIG. 6A, 608-609; FIG. 6H, 623-624/658-657,
626-625/627-628, 652-651/655-646), and/or the double-stranded DNA
brace sequence (Table 21).
[0575] Following the guidance of the present specification and
Examples, analysis of the structural features of NASC-CC/Cas
protein complexes, including internal volumes, pore sizes, and
closed-cage sizes, can be practiced by one of ordinary skill in the
art.
[0576] As is apparent to one of skill in the art, various
modification and variations of the above embodiments can be made
without departing from the spirit and scope of this invention. Such
modifications and variations are within the scope of this
invention.
Sequence CWU 1
1
109123DNAArtificial SequenceOligonucleotide Primer 1agtaataata
cgactcacta tag 23226DNAArtificial SequenceOligonucleotide Primer
2aagcaccgac tcggtgccac tttttc 26355DNAArtificial
SequenceOligonucleotide Primer 3taatacgact cactataggg gccactaggg
acaggatgtc tcagagctat gcagt 55455DNAArtificial
SequenceOligonucleotide Primer 4taatacgact cactatagta ggctatagtg
tagatctgtc tcagagctat gcagt 55555DNAArtificial
SequenceOligonucleotide Primer 5taatacgact cactatagga aaaagtggaa
gcggcgagtc tcagagctat gcagt 55655DNAArtificial
SequenceOligonucleotide Primer 6taatacgact cactataggc gataagtcgt
gtcttacgtc tcagagctat gcagt 55755DNAArtificial
SequenceOligonucleotide Primer 7taatacgact cactataggg gccactaggg
acaggatgca catgaggatt ctcat 55855DNAArtificial
SequenceOligonucleotide Primer 8taatacgact cactatagta ggctatagtg
tagatctgca catgaggatt ctcat 55955DNAArtificial
SequenceOligonucleotide Primer 9taatacgact cactatagga aaaagtggaa
gcggcgagca catgaggatt ctcat 551055DNAArtificial
SequenceOligonucleotide Primer 10taatacgact cactataggc gataagtcgt
gtcttacgca catgaggatt ctcat 551160DNAArtificial
SequenceOligonucleotide Primer 11gtctcagagc tatgcagtcc tggacaactg
ccgaacagga ctgcatagca agttgagata 601260DNAArtificial
SequenceOligonucleotide Primer 12gactcggtgc cactttttca agttgataac
ggactagcct tatctcaact tgctatgcag 601360DNAArtificial
SequenceOligonucleotide Primer 13gcacatgagg attctcatga gggacggcag
aagaacctca tgagaatcca agtatgtgta 601460DNAArtificial
SequenceOligonucleotide Primer 14gactcggtgc cactttttca agttgataac
ggactagcct tacacatact tggattctca 601560DNAArtificial
SequenceOligonucleotide Primer 15gtctcagagc tatgcagtcc tggacaactg
ccgaacctca tgagaatcca agtatgtgta 601660DNAArtificial
SequenceOligonucleotide Primer 16gactcggtgc cactttttca agttgataac
ggactagcct tacacatact tggattctca 601760DNAArtificial
SequenceOligonucleotide Primer 17gcacatgagg attctcatga gggacggcag
aagaacagga ctgcatagca agttgagata 601860DNAArtificial
SequenceOligonucleotide Primer 18gactcggtgc cactttttca agttgataac
ggactagcct tatctcaact tgctatgcag 6019237DNAArtificial
Sequencecloning oligonucleotidesmisc_feature(125)..(125)n is a, c,
g, or t 19tacacgtact tagtcgctga agctcttcta tgcaagcaga agacggcata
cgagatcgag 60taatgtgact ggagttcaga cgtgtgctct tccgatctgc tactggggcc
actagggaca 120ggatnggtgc tagctcagat cggaagagcg tcgtgtaggg
aaagagtgta ggctatagtg 180tagatctcgg tggtcgccgt atcattggta
gaagagccgt caatcgagtt cgtacct 237204175DNAArtificial SequenceAAVS-1
target sequence 20ctcatgacca aaatccctta acgtgagtta cgcgcgcgtc
gttccactga gcgtcagacc 60ccgtagaaaa gatcaaagga tcttcttgag atcctttttt
tctgcgcgta atctgctgct 120tgcaaacaaa aaaaccaccg ctaccagcgg
tggtttgttt gccggatcaa gagctaccaa 180ctctttttcc gaaggtaact
ggcttcagca gagcgcagat accaaatact gttcttctag 240tgtagccgta
gttagcccac cacttcaaga actctgtagc accgcctaca tacctcgctc
300tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt
accgggttgg 360actcaagacg atagttaccg gataaggcgc agcggtcggg
ctgaacgggg ggttcgtgca 420cacagcccag cttggagcga acgacctaca
ccgaactgag atacctacag cgtgagctat 480gagaaagcgc cacgcttccc
gaagggagaa aggcggacag gtatccggta agcggcaggg 540tcggaacagg
agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc
600ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg
tcaggggggc 660ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg
gttcctggcc ttttgctggc 720cttttgctca catgttcttt cctgcgttat
cccctgattc tgtggataac cgtattaccg 780cctttgagtg agctgatacc
gctcgccgca gccgaacgac cgagcgcagc gagtcagtga 840gcgaggaagc
ggaaggcgag agtagggaac tgccaggcat caaactaagc agaaggcccc
900tgacggatgg cctttttgcg tttctacaaa ctctttctgt gttgtaaaac
gacggccagt 960cttaagctcg ggccccctgg gcggttctga taacgagtaa
tcgttaatcc gcaaataacg 1020taaaaacccg cttcggcggg tttttttatg
gggggagttt agggaaagag catttgtcag 1080aatatttaag ggcgcctgtc
actttgcttg atatatgaga attatttaac cttataaatg 1140agaaaaaagc
aacgcacttt aaataagata cgttgctttt tcgattgatg aacacctata
1200attaaactat tcatctatta tttatgattt tttgtatata caatatttct
agtttgttaa 1260agagaattaa gaaaataaat ctcgaaaata ataaagggaa
aatcagtttt tgatatcaaa 1320attatacatg tcaacgataa tacaaaatat
aatacaaact ataagatgtt atcagtattt 1380attatgcatt tagaataaat
tttgtgtcgc ccttaattgt gagcggataa caattacgag 1440cttcatgcac
agtgaaatca tgaaaaattt atttgctttg tgagcggata acaattataa
1500tatgtggaat tgtgagcgct cacaattcca caacggtttc cctctagaaa
taattttgtt 1560taacttttaa ggaggtaaaa aatgtacacg tacttagtcg
ctgaagctct tctatgcaag 1620cagaagacgg catacgagat cgagtaatgt
gactggagtt cagacgtgtg ctcttccgat 1680ctgctactgg ggccactagg
gacaggattg gtgctagctc agatcggaag agcgtcgtgt 1740agggaaagag
tgtaggctat agtgtagatc tcggtggtcg ccgtatcatt ggtagaagag
1800ccgtcaatcg agttcgtacc tggttgaccc caagggcgac accccctaat
tagcccgggc 1860gaaaggccca gtctttcgac tgagcctttc gttttatttg
atgcctggca gttccctact 1920ctcgcatggg gagtccccac actaccatcg
gcgctacggc gtttcacttc tgagttcggc 1980atggggtcag gtgggaccac
cgcgctactg ccgccaggca aacaaggggt gttatgagcc 2040atattcaggt
ataaatgggc tcgcgataat gttcagaatt ggttaattgg ttgtaacact
2100gacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
tgagacaata 2160accctgataa atgcttcaat aatattgaaa aaggaagaat
atgagccata ttcaacggga 2220aacgtcgagg ccgcgattaa attccaacat
ggatgctgat ttatatgggt ataaatgggc 2280tcgcgataat gtcgggcaat
caggtgcgac aatctatcgc ttgtatggga agcccgatgc 2340gccagagttg
tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat
2400ggtcagacta aactggctga cggaatttat gccacttccg accatcaagc
attttatccg 2460tactcctgat gatgcatggt tactcaccac tgcgatcccc
ggaaaaacag cgttccaggt 2520attagaagaa tatcctgatt caggtgaaaa
tattgttgat gcgctggcag tgttcctgcg 2580ccggttgcac tcgattcctg
tttgtaattg tccttttaac agcgatcgcg tatttcgcct 2640cgctcaggcg
caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga
2700gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataaacttt
tgccattctc 2760accggattca gtcgtcactc atggtgattt ctcacttgat
aaccttattt ttgacgaggg 2820gaaattaata ggttgtattg atgttggacg
agtcggaatc gcagaccgat accaggatct 2880tgccatccta tggaactgcc
tcggtgagtt ttctccttca ttacagaaac ggctttttca 2940aaaatatggt
attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga
3000gtttttctaa gcggcgcgcc atcgaatggc gcaaaacctt tcgcggtatg
gcatgatagc 3060gcccggaaga gagtcaattc agggtggtga atatgaaacc
agtaacgtta tacgatgtcg 3120cagagtatgc cggtgtctct tatcagaccg
tttcccgcgt ggtgaaccag gccagccacg 3180tttctgcgaa aacgcgggaa
aaagtggaag cggcgatggc ggagctgaat tacattccca 3240accgcgtggc
acaacaactg gcgggcaaac agtcgttgct gattggcgtt gccacctcca
3300gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat taaatctcgc
gccgatcaac 3360tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg
cgtcgaagcc tgtaaagcgg 3420cggtgcacaa tcttctcgcg caacgcgtca
gtgggctgat cattaactat ccgctggatg 3480accaggatgc cattgctgtg
gaagctgcct gcactaatgt tccggcgtta tttcttgatg 3540tctctgacca
gacacccatc aacagtatta ttttctccca tgaggacggt acgcgactgg
3600gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc gctgttagcg
ggcccattaa 3660gttctgtctc ggcgcgtctg cgtctggctg gctggcataa
atatctcact cgcaatcaaa 3720ttcagccgat agcggaacgg gaaggcgact
ggagtgccat gtccggtttt caacaaacca 3780tgcaaatgct gaatgagggc
atcgttccca ctgcgatgct ggttgccaac gatcagatgg 3840cgctgggcgc
aatgcgcgcc attaccgagt ccgggctgcg cgttggtgcg gatatctcgg
3900tagtgggata cgacgatacc gaagatagct catgttatat cccgccgtta
accaccatca 3960aacaggattt tcgcctgctg gggcaaacca gcgtggaccg
cttgctgcaa ctctctcagg 4020gccaggcggt gaagggcaat cagctgttgc
cagtctcact ggtgaaaaga aaaaccaccc 4080tggcgcccaa tacgcaaacc
gcctctcccc gcgcgttggc cgattcatta atgcagctgg 4140cacgacaggt
ttcccgactg gaaagcgggc agtga 41752156DNAArtificial Sequencecloning
oligonucleotides 21tacacgtact tagtcgctga agctcttcta tgcaagcaga
agacggcata cgagat 562256DNAArtificial Sequencecloning
oligonucleotides 22aggtacgaac tcgattgacg gctcttctac caatgatacg
gcgaccaccg agatct 562320DNAArtificial Sequenceprimer 23ccccgttctc
ctgtggattc 202420DNAArtificial Sequenceprimer 24atcctctctg
gctccatcgt 2025127RNAArtificial SequencesgRNA-1-AAVST1 25ggggccacua
gggacaggau gucucagagc uaugcagucc uggacaacug ccgaacagga 60cugcauagca
aguugagaua aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12726127RNAArtificial SequencesgRNA-1-VT2 26guaggcuaua guguagaucu
gucucagagc uaugcagucc uggacaacug ccgaacagga 60cugcauagca aguugagaua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12727127RNAArtificial SequencesgRNA-1-VT3 27ggaaaaagug gaagcggcga
gucucagagc uaugcagucc uggacaacug ccgaacagga 60cugcauagca aguugagaua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12728127RNAArtificial SequencesgRNA-1-VT4 28ggcgauaagu cgugucuuac
gucucagagc uaugcagucc uggacaacug ccgaacagga 60cugcauagca aguugagaua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12729127RNAArtificial SequencesgRNA-2-AAVST1 29ggggccacua
gggacaggau gcacaugagg auucucauga gggacggcag aagaaccuca 60ugagaaucca
aguaugugua aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12730127RNAArtificial SequencesgRNA-2-VT2 30guaggcuaua guguagaucu
gcacaugagg auucucauga gggacggcag aagaaccuca 60ugagaaucca aguaugugua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12731127RNAArtificial SequencesgRNA-2-VT3 31ggaaaaagug gaagcggcga
gcacaugagg auucucauga gggacggcag aagaaccuca 60ugagaaucca aguaugugua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12732127RNAArtificial SequencesgRNA-2-VT4 32ggcgauaagu cgugucuuac
gcacaugagg auucucauga gggacggcag aagaaccuca 60ugagaaucca aguaugugua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12733127RNAArtificial SequenceNASC-PC1-AAVST1 33ggggccacua
gggacaggau gucucagagc uaugcagucc uggacaacug ccgaaccuca 60ugagaaucca
aguaugugua aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12734127RNAArtificial SequenceNASC-PC1-VT2 34guaggcuaua guguagaucu
gucucagagc uaugcagucc uggacaacug ccgaaccuca 60ugagaaucca aguaugugua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12735127RNAArtificial SequenceNASC-PC1-VT3 35ggaaaaagug gaagcggcga
gucucagagc uaugcagucc uggacaacug ccgaaccuca 60ugagaaucca aguaugugua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12736127RNAArtificial SequenceNASC-PC1-VT4 36ggcgauaagu cgugucuuac
gucucagagc uaugcagucc uggacaacug ccgaaccuca 60ugagaaucca aguaugugua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12737127RNAArtificial SequenceNASC-PC2- AAVST1 37ggggccacua
gggacaggau gcacaugagg auucucauga gggacggcag aagaacagga 60cugcauagca
aguugagaua aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12738127RNAArtificial SequenceNASC-PC2-VT2 38guaggcuaua guguagaucu
gcacaugagg auucucauga gggacggcag aagaacagga 60cugcauagca aguugagaua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12739127RNAArtificial SequenceNASC-PC2-VT3 39ggaaaaagug gaagcggcga
gcacaugagg auucucauga gggacggcag aagaacagga 60cugcauagca aguugagaua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
12740127RNAArtificial SequenceNASC-PC2-VT4 40ggcgauaagu cgugucuuac
gcacaugagg auucucauga gggacggcag aagaacagga 60cugcauagca aguugagaua
aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc 120ggugcuu
1274120DNAHomo sapiens 41ggtggacaag cggcagatag 204220DNAHomo
sapiens 42gcaccatgtt gccggtcctc 2043118RNAArtificial SequencesgRNA-
XRCC5-T1 43gguggacaag cggcagauag guuuuagagc uaugcuguuu uggaaacaaa
acagcauagc 60aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu
cggugcuu 11844118RNAArtificial SequencesgRNA- XRCC5-T3 44gcaccauguu
gccgguccuc guuuuagagc uaugcuguuu uggaaacaaa acagcauagc 60aaguuaaaau
aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuu
11845118RNAArtificial SequenceNASCA-PC1- XRCC5-T1 45gguggacaag
cggcagauag guuuuagagc uaugcuguuu uggaaacuuu ucagcacgau 60aaguuauuau
aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuu
11846118RNAArtificial SequenceNASCA-PC2- XRCC5-T3 46gcaccauguu
gccgguccuc guaauagaau cgugcugaaa aggaaacaaa acagcauagc 60aaguuaaaau
aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuu
1184750DNAArtificial SequenceXRCC5 target region 1 47cactctttcc
ctacacgacg ctcttccgat cttgcgcatg ctcagagttc 504848DNAArtificial
SequenceXRCC5 target region 1 48ggagttcaga cgtgtgctct tccgatctcc
aagtccatgg ctttcttt 484952DNAArtificial SequenceXRCC5 target region
1 49cactctttcc ctacacgacg ctcttccgat cttttcaggc ctagcaggaa ac
525048DNAArtificial SequenceXRCC5 target region 1 50ggagttcaga
cgtgtgctct tccgatctcc cattctttgt cttgaccg 485157DNAArtificial
SequencePrimer 51caagcagaag acggcatacg agattacgtg atgtgactgg
agttcagacg tgtgctc 575258DNAArtificial SequencePrimer 52aatgatacgg
cgaccaccga gatctacacc gtctaataca ctctttccct acacgacg
585358DNAArtificial SequencePrimer 53aatgatacgg cgaccaccga
gatctacact ctctccgaca ctctttccct acacgacg 585458DNAArtificial
SequencePrimer 54aatgatacgg cgaccaccga gatctacact cgactagaca
ctctttccct acacgacg 585558DNAArtificial SequencePrimer 55aatgatacgg
cgaccaccga gatctacact tctagctaca ctctttccct acacgacg
5856984PRTCampylobacter jejuni 56Met Ala Arg Ile Leu Ala Phe Ala
Ile Gly Ile Ser Ser Ile Gly Trp 1 5 10 15 Ala Phe Ser Glu Asn Asp
Glu Leu Lys Asp Cys Gly Val Arg Ile Phe 20 25 30 Thr Lys Val Glu
Asn Pro Lys Thr Gly Glu Ser Leu Ala Leu Pro Arg 35 40 45 Arg Leu
Ala Arg Ser Ala Arg Lys Arg Leu Ala Arg Arg Lys Ala Arg 50 55 60
Leu Asn His Leu Lys His Leu Ile Ala Asn Glu Phe Lys Leu Asn Tyr 65
70 75 80 Glu Asp Tyr Gln Ser Phe Asp Glu Ser Leu Ala Lys Ala Tyr
Lys Gly 85 90 95 Ser Leu Ile Ser Pro Tyr Glu Leu Arg Phe Arg Ala
Leu Asn Glu Leu 100 105 110 Leu Ser Lys Gln Asp Phe Ala Arg Val Ile
Leu His Ile Ala Lys Arg 115 120 125 Arg Gly Tyr Asp Asp Ile Lys Asn
Ser Asp Asp Lys Glu Lys Gly Ala 130 135 140 Ile Leu Lys Ala Ile Lys
Gln Asn Glu Glu Lys Leu Ala Asn Tyr Gln 145 150 155 160 Ser Val Gly
Glu Tyr Leu Tyr Lys Glu Tyr Phe Gln Lys Phe Lys Glu 165 170 175 Asn
Ser Lys Glu Phe Thr Asn Val Arg Asn Lys Lys Glu Ser Tyr Glu 180 185
190 Arg Cys Ile Ala Gln Ser Phe Leu Lys Asp Glu Leu Lys Leu Ile Phe
195 200 205 Lys Lys Gln Arg Glu Phe Gly Phe Ser Phe Ser Lys Lys Phe
Glu Glu 210 215 220 Glu Val Leu Ser Val Ala Phe Tyr Lys Arg Ala Leu
Lys Asp Phe Ser 225 230 235 240 His Leu Val Gly Asn Cys Ser Phe Phe
Thr Asp Glu Lys Arg Ala Pro 245 250 255 Lys Asn Ser Pro Leu Ala Phe
Met Phe Val Ala Leu Thr Arg Ile Ile 260 265 270 Asn Leu Leu Asn Asn
Leu Lys Asn Thr Glu Gly Ile Leu Tyr Thr Lys 275 280 285 Asp Asp Leu
Asn Ala Leu Leu Asn Glu Val Leu Lys Asn Gly Thr Leu 290 295 300 Thr
Tyr Lys Gln Thr Lys Lys Leu Leu Gly Leu Ser Asp Asp Tyr Glu 305 310
315 320 Phe Lys Gly Glu Lys Gly Thr Tyr Phe Ile Glu Phe Lys Lys Tyr
Lys 325 330 335 Glu Phe Ile Lys Ala Leu Gly Glu His Asn Leu Ser Gln
Asp Asp Leu 340 345 350 Asn Glu Ile Ala Lys Asp Ile Thr Leu Ile Lys
Asp Glu Ile Lys Leu 355 360 365 Lys Lys Ala Leu Ala Lys Tyr Asp Leu
Asn Gln Asn Gln Ile Asp Ser 370 375 380 Leu Ser Lys Leu Glu Phe Lys
Asp His Leu Asn Ile Ser Phe Lys Ala 385 390 395 400 Leu Lys Leu Val
Thr Pro Leu Met Leu Glu Gly Lys Lys Tyr Asp Glu 405 410 415 Ala Cys
Asn Glu Leu Asn Leu Lys Val Ala
Ile Asn Glu Asp Lys Lys 420 425 430 Asp Phe Leu Pro Ala Phe Asn Glu
Thr Tyr Tyr Lys Asp Glu Val Thr 435 440 445 Asn Pro Val Val Leu Arg
Ala Ile Lys Glu Tyr Arg Lys Val Leu Asn 450 455 460 Ala Leu Leu Lys
Lys Tyr Gly Lys Val His Lys Ile Asn Ile Glu Leu 465 470 475 480 Ala
Arg Glu Val Gly Lys Asn His Ser Gln Arg Ala Lys Ile Glu Lys 485 490
495 Glu Gln Asn Glu Asn Tyr Lys Ala Lys Lys Asp Ala Glu Leu Glu Cys
500 505 510 Glu Lys Leu Gly Leu Lys Ile Asn Ser Lys Asn Ile Leu Lys
Leu Arg 515 520 525 Leu Phe Lys Glu Gln Lys Glu Phe Cys Ala Tyr Ser
Gly Glu Lys Ile 530 535 540 Lys Ile Ser Asp Leu Gln Asp Glu Lys Met
Leu Glu Ile Asp Ala Ile 545 550 555 560 Tyr Pro Tyr Ser Arg Ser Phe
Asp Asp Ser Tyr Met Asn Lys Val Leu 565 570 575 Val Phe Thr Lys Gln
Asn Gln Glu Lys Leu Asn Gln Thr Pro Phe Glu 580 585 590 Ala Phe Gly
Asn Asp Ser Ala Lys Trp Gln Lys Ile Glu Val Leu Ala 595 600 605 Lys
Asn Leu Pro Thr Lys Lys Gln Lys Arg Ile Leu Asp Lys Asn Tyr 610 615
620 Lys Asp Lys Glu Gln Lys Asn Phe Lys Asp Arg Asn Leu Asn Asp Thr
625 630 635 640 Arg Tyr Ile Ala Arg Leu Val Leu Asn Tyr Thr Lys Asp
Tyr Leu Asp 645 650 655 Phe Leu Pro Leu Ser Asp Asp Glu Asn Thr Lys
Leu Asn Asp Thr Gln 660 665 670 Lys Gly Ser Lys Val His Val Glu Ala
Lys Ser Gly Met Leu Thr Ser 675 680 685 Ala Leu Arg His Thr Trp Gly
Phe Ser Ala Lys Asp Arg Asn Asn His 690 695 700 Leu His His Ala Ile
Asp Ala Val Ile Ile Ala Tyr Ala Asn Asn Ser 705 710 715 720 Ile Val
Lys Ala Phe Ser Asp Phe Lys Lys Glu Gln Glu Ser Asn Ser 725 730 735
Ala Glu Leu Tyr Ala Lys Lys Ile Ser Glu Leu Asp Tyr Lys Asn Lys 740
745 750 Arg Lys Phe Phe Glu Pro Phe Ser Gly Phe Arg Gln Lys Val Leu
Asp 755 760 765 Lys Ile Asp Glu Ile Phe Val Ser Lys Pro Glu Arg Lys
Lys Pro Ser 770 775 780 Gly Ala Leu His Glu Glu Thr Phe Arg Lys Glu
Glu Glu Phe Tyr Gln 785 790 795 800 Ser Tyr Gly Gly Lys Glu Gly Val
Leu Lys Ala Leu Glu Leu Gly Lys 805 810 815 Ile Arg Lys Val Asn Gly
Lys Ile Val Lys Asn Gly Asp Met Phe Arg 820 825 830 Val Asp Ile Phe
Lys His Lys Lys Thr Asn Lys Phe Tyr Ala Val Pro 835 840 845 Ile Tyr
Thr Met Asp Phe Ala Leu Lys Val Leu Pro Asn Lys Ala Val 850 855 860
Ala Arg Ser Lys Lys Gly Glu Ile Lys Asp Trp Ile Leu Met Asp Glu 865
870 875 880 Asn Tyr Glu Phe Cys Phe Ser Leu Tyr Lys Asp Ser Leu Ile
Leu Ile 885 890 895 Gln Thr Lys Asp Met Gln Glu Pro Glu Phe Val Tyr
Tyr Asn Ala Phe 900 905 910 Thr Ser Ser Thr Val Ser Leu Ile Val Ser
Lys His Asp Asn Lys Phe 915 920 925 Glu Thr Leu Ser Lys Asn Gln Lys
Ile Leu Phe Lys Asn Ala Asn Glu 930 935 940 Lys Glu Val Ile Ala Lys
Ser Ile Gly Ile Gln Asn Leu Lys Val Phe 945 950 955 960 Glu Lys Tyr
Ile Val Ser Ala Leu Gly Glu Val Thr Lys Ala Glu Phe 965 970 975 Arg
Gln Arg Glu Asp Phe Lys Lys 980 57146RNAArtificial
SequenceNASC-PC1-triplex1 57aucuuguuga cacgaggaau guuuuagucc
cuaauuaaau uucuugaaau ugguauauaa 60ggagggacua caacaaagag uuugcgggac
ucugcggggu uacaaucccc uaaaaccgcu 120uuuaaaauuc aaauaaauuu ugcuuu
14658146RNAArtificial SequenceNASC-PC2-triplex1 58aucuuguuga
cacgaggaau guuguagucc cuccuuauau accaagaaaa agaaauuuaa 60aacugaacuc
caacaaagag uuugcgggac ucugcggggu uacaaucccc uaaaaccgcu
120uuuaaaauuc aaauaaauuu ugcuuu 14659146RNAArtificial
SequenceNASC-PC3-triplex1 59aucuuguuga cacgaggaau guuggaguuc
aguuuuaaau uucuugaaaa agaaauuuaa 60uuagggacua aaacaaagag uuugcgggac
ucugcggggu uacaaucccc uaaaaccgcu 120uuuaaaauuc aaauaaauuu ugcuuu
14660146RNAArtificial SequenceNASC-PC1-triplex2 60cgauauaaua
cagcaaggug guuuuagacc ccucuuccau uucgcgaaag cguuuugaga 60gagugaacua
caacaaagag uuugcgggac ucugcggggu uacaaucccc uaaaaccgcu
120uuuaaaauuc aaauaaauuu ugcuuu 14661146RNAArtificial
SequenceNASC-PC2-triplex2 61cgauauaaua cagcaaggug guuguaguuc
acucucucaa aacgcgaaaa agaaauuuaa 60uaaggaacua caacaaagag uuugcgggac
ucugcggggu uacaaucccc uaaaaccgcu 120uuuaaaauuc aaauaaauuu ugcuuu
14662146RNAArtificial SequenceNASC-PC3-triplex2 62cgauauaaua
cagcaaggug guuguaguuc cuuauuaaau uucuugaaag cgaaauggaa 60gaggggucua
aaacaaagag uuugcgggac ucugcggggu uacaaucccc uaaaaccgcu
120uuuaaaauuc aaauaaauuu ugcuuu 14663144DNAArtificial
Sequenceoligonucleotide sequence 63cgtcgctatg atttgcctat atcttgttga
cacgaggaat gtaaacaacg agttccgcta 60ttgggatgga gtttaactgt cgcaactctc
atcgcaatgt cagtcacctt gctgtattat 120atcgcgcatg ataaagtacg ccat
1446465RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(46)..(65)n is a, c, g, or u 64cuccggcgau
gucacaccga acugauaauu ucuacucuug uagaunnnnn nnnnnnnnnn 60nnnnn
656565RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(46)..(65)n is a, c, g, or u 65ucggugugac
aucgccggag uugauaaauu ucuacucuug uagaunnnnn nnnnnnnnnn 60nnnnn
656635RNAArtificial SequenceNASCA polynucleotide component
66cuccggcgau gucacaccga acugauaauu ucuac 356726RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(7)..(26)n is a,
c, g, or u 67guagaunnnn nnnnnnnnnn nnnnnn 266835RNAArtificial
SequenceNASCA polynucleotide component 68ucggugugac aucgccggag
uugauaaauu uguag 356926RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(7)..(26)n is a, c, g, or u 69cuacaunnnn
nnnnnnnnnn nnnnnn 267065RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(20)..(39)n is a, c, g, or u 70aauuucuacu
cuuguagaun nnnnnnnnnn nnnnnnnnna cugaucuccg gcgaugucac 60accga
657165RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(20)..(39)n is a, c, g, or u 71aauuucuacu
cuuguagaun nnnnnnnnnn nnnnnnnnnu ugauaucggu gugacaucgc 60cggag
657291RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(46)..(65)n is a, c, g, or u 72cuccggcgau
gucacaccga acugauaauu ucuacucuug uagaunnnnn nnnnnnnnnn 60nnnnnuugau
agucuaaggc agcuaggguc u 917365RNAArtificial SequenceNASCA
polynucleotide componentmisc_feature(46)..(65)n is a, c, g, or u
73ucggugugac aucgccggag uugauaaauu ucuacucuug uagaunnnnn nnnnnnnnnn
60nnnnn 657465RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(20)..(39)n is a, c, g, or u 74aauuucuacu
cuuguagaun nnnnnnnnnn nnnnnnnnnu accaaagacc cuagcugccu 60uagac
657591RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(72)..(91)n is a, c, g, or u 75cuccggcgau
gucacaccga acugaugucu aaggcagcua gggucuuuga uaaauuucua 60cucuuguaga
unnnnnnnnn nnnnnnnnnn n 917691RNAArtificial SequenceNASCA
polynucleotide componentmisc_feature(72)..(91)n is a, c, g, or u
76ugcgaaccac ugugagccag uaccaaucgg ugugacaucg ccggaguuga uaaauuucua
60cucuuguaga unnnnnnnnn nnnnnnnnnn n 917761RNAArtificial
SequenceNASCA polynucleotide component 77cuccggcgau gucacaccga
acugaugucu aaggcagcua gggucuuuga uaaauuucua 60c 617826RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(7)..(26)n is a,
c, g, or u 78guagaunnnn nnnnnnnnnn nnnnnn 267961RNAArtificial
SequenceNASCA polynucleotide component 79ugcgaaccac ugugagccag
uaccaaucgg ugugacaucg ccggaguuga uaaauuugua 60g 618026RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(7)..(26)n is a,
c, g, or u 80cuacaunnnn nnnnnnnnnn nnnnnn 2681146RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(1)..(20)n is a,
c, g, or u 81nnnnnnnnnn nnnnnnnnnn guuuuagucc cuaauuaaau uucuugaaau
ugguauauaa 60ggagggacua caacaaagag uuugcgggac ucugcggggu uacaaucccc
uaaaaccgcu 120uuuaaaauuc aaauaaauuu ugcuuu 14682146RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(1)..(20)n is a,
c, g, or u 82nnnnnnnnnn nnnnnnnnnn guuguagucc cuccuuauau accaagaaaa
agaaauuuaa 60uuagggacua aaacaaagag uuugcgggac ucugcggggu uacaaucccc
uaaaaccgcu 120uuuaaaauuc aaauaaauuu ugcuuu 14683127RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(1)..(20)n is a,
c, g, or u 83nnnnnnnnnn nnnnnnnnnn gucucagagc uaugcagucc uggacaacug
ccgaaccuca 60ugagaaucca aguaugugua aggcuagucc guuaucaacu ugaaaaagug
gcaccgaguc 120ggugcuu 12784127RNAArtificial SequenceNASCA
polynucleotide componentmisc_feature(1)..(20)n is a, c, g, or u
84nnnnnnnnnn nnnnnnnnnn gcacaugagg auucucauga gggacggcag aagaacagga
60cugcauagca aguugagaua aggcuagucc guuaucaacu ugaaaaagug gcaccgaguc
120ggugcuu 12785118RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(1)..(20)n is a, c, g, or u 85nnnnnnnnnn
nnnnnnnnnn guuuuagagc uaugcuguuu uggaaagguc auguccuuca 60aaguuguaau
aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuu
11886118RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(1)..(20)n is a, c, g, or u 86nnnnnnnnnn
nnnnnnnnnn guaauagaau cgugcugaaa aggaaacaaa acagcauagc 60aaguuaaaau
aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuu
11887118RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(1)..(20)n is a, c, g, or u 87nnnnnnnnnn
nnnnnnnnnn guuacagaug aaggacauga ccgaaacuuu ucagcacgau 60aaguuauuau
aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuu
1188845RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(1)..(20)n is a, c, g, or u 88nnnnnnnnnn
nnnnnnnnnn guuuuagucc cuaauuaaau uucuu 458945RNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(1)..(20)n is a,
c, g, or u 89nnnnnnnnnn nnnnnnnnnn guuguagucc cuccuuauau accaa
4590205RNAArtificial SequenceNASCA polynucleotide component
90aagaaauuua auuagggacu aaaacaaaga guuugcggga cucugcgggg uuacaauccc
60cuaaaaccgc uuuuaaaauu caaauaaauu uugcuuuagu ugauaaauuu gguauauaag
120gagggacuac aacaaagagu uugcgggacu cugcgggguu acaauccccu
aaaaccgcuu 180uuaaaauuca aauaaauuuu gcuuu 2059175DNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(1)..(20)n is a,
c, g, t or u 91nnnnnnnnnn nnnnnnnnnn guuuuagagc tatgctgtga
aaacagcata gcaaguuaaa 60auaaggcuac ugccg 759275DNAArtificial
SequenceNASCA polynucleotide componentmisc_feature(1)..(20)n is a,
c, g, t or u 92nnnnnnnnnn nnnnnnnnnn guuuuagagc tatgctgtga
aaacagcata gcaaguuaaa 60auaaggcuag ucacg 7593105RNAArtificial
SequenceNASCA polynucleotide component 93cggcaguccg uuaucaacuu
gaaaaagugg caccgagucg gugcuuaguu gauaaaucgu 60gacguccguu aucaacuuga
aaaaguggca ccgagucggu gcuuu 10594155RNAArtificial SequenceNASCA
polynucleotide componentmisc_feature(1)..(20)n is a, c, g, or
umisc_feature(136)..(155)n is a, c, g, or u 94nnnnnnnnnn nnnnnnnnnn
guuuuagagc uaugcuguga aaacagcaua gcaaguuaaa 60auaaggcuag uccguuauca
acuugaaaaa guggcaccga gucggugcuu acugauaauu 120ucuacucuug
uagaunnnnn nnnnnnnnnn nnnnn 15595114RNAArtificial SequenceNASCA
polynucleotide componentmisc_feature(1)..(20)n is a, c, g, or u
95nnnnnnnnnn nnnnnnnnnn guuuuuguac ucucaagauu caaauaacag cauagcaagu
60uaaaauaagg cuauccguua ucaacuugaa aaaguggcac cgagucggug cuuu
11496116RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(1)..(20)n is a, c, g, or u 96nnnnnnnnnn
nnnnnnnnnn guuuuagagc uaugcuguua cguaaaucuu gcagaagcua 60caaagauaag
gcuucaugcc gaaaucaaca cccugucauu uuauggcagg guguuu
1169776RNAArtificial SequenceNASCA polynucleotide
componentmisc_feature(1)..(20)n is a, c, g, or
umisc_feature(57)..(76)n is a, c, g, or u 97nnnnnnnnnn nnnnnnnnnn
guuuuagagc uaugcuguua ccaauugaua guagaunnnn 60nnnnnnnnnn nnnnnn
769883RNAArtificial SequenceNASCA polynucleotide component
98aauuucuacu ugauaacagc auagcaaguu aaaauaaggc uauccguuau caacuugaaa
60aaguggcacc gagucggugc uuu 83991053PRTStaphylococcus aureus 99Met
Lys Arg Asn Tyr Ile Leu Gly Leu Asp Ile Gly Ile Thr Ser Val 1 5 10
15 Gly Tyr Gly Ile Ile Asp Tyr Glu Thr Arg Asp Val Ile Asp Ala Gly
20 25 30 Val Arg Leu Phe Lys Glu Ala Asn Val Glu Asn Asn Glu Gly
Arg Arg 35 40 45 Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg Arg
Arg His Arg Ile 50 55 60 Gln Arg Val Lys Lys Leu Leu Phe Asp Tyr
Asn Leu Leu Thr Asp His 65 70 75 80 Ser Glu Leu Ser Gly Ile Asn Pro
Tyr Glu Ala Arg Val Lys Gly Leu 85 90 95 Ser Gln Lys Leu Ser Glu
Glu Glu Phe Ser Ala Ala Leu Leu His Leu 100 105 110 Ala Lys Arg Arg
Gly Val His Asn Val Asn Glu Val Glu Glu Asp Thr 115 120 125 Gly Asn
Glu Leu Ser Thr Lys Glu Gln Ile Ser Arg Asn Ser Lys Ala 130 135 140
Leu Glu Glu Lys Tyr Val Ala Glu Leu Gln Leu Glu Arg Leu Lys Lys 145
150 155 160 Asp Gly Glu Val Arg Gly Ser Ile Asn Arg Phe Lys Thr Ser
Asp Tyr 165 170 175 Val Lys Glu Ala Lys Gln Leu Leu Lys Val Gln Lys
Ala Tyr His Gln 180 185 190 Leu Asp Gln Ser Phe Ile Asp Thr Tyr Ile
Asp Leu Leu Glu Thr Arg 195 200 205 Arg Thr Tyr Tyr Glu Gly Pro Gly
Glu Gly Ser Pro Phe Gly Trp Lys 210 215 220 Asp Ile Lys Glu Trp Tyr
Glu Met Leu Met Gly His Cys Thr Tyr Phe 225 230 235 240 Pro Glu Glu
Leu Arg Ser Val Lys Tyr Ala Tyr Asn Ala Asp Leu Tyr 245 250 255 Asn
Ala Leu Asn Asp Leu Asn Asn Leu Val Ile Thr Arg Asp Glu Asn 260 265
270 Glu Lys Leu Glu Tyr Tyr Glu Lys Phe Gln Ile Ile Glu Asn Val Phe
275 280 285 Lys Gln Lys Lys Lys Pro Thr Leu Lys Gln Ile Ala Lys Glu
Ile Leu 290 295 300 Val Asn Glu Glu Asp Ile Lys Gly Tyr Arg Val Thr
Ser Thr Gly Lys 305 310 315 320 Pro Glu Phe Thr Asn Leu Lys Val Tyr
His Asp Ile Lys Asp Ile Thr 325 330 335 Ala Arg Lys Glu Ile Ile Glu
Asn Ala Glu Leu Leu Asp Gln Ile Ala 340 345 350 Lys Ile Leu Thr Ile
Tyr Gln Ser Ser Glu Asp Ile Gln Glu Glu Leu 355 360 365 Thr Asn Leu
Asn Ser Glu Leu Thr Gln Glu Glu Ile Glu Gln Ile Ser 370 375 380 Asn
Leu Lys Gly Tyr Thr Gly Thr His Asn Leu Ser Leu Lys Ala Ile 385 390
395
400 Asn Leu Ile Leu Asp Glu Leu Trp His Thr Asn Asp Asn Gln Ile Ala
405 410 415 Ile Phe Asn Arg Leu Lys Leu Val Pro Lys Lys Val Asp Leu
Ser Gln 420 425 430 Gln Lys Glu Ile Pro Thr Thr Leu Val Asp Asp Phe
Ile Leu Ser Pro 435 440 445 Val Val Lys Arg Ser Phe Ile Gln Ser Ile
Lys Val Ile Asn Ala Ile 450 455 460 Ile Lys Lys Tyr Gly Leu Pro Asn
Asp Ile Ile Ile Glu Leu Ala Arg 465 470 475 480 Glu Lys Asn Ser Lys
Asp Ala Gln Lys Met Ile Asn Glu Met Gln Lys 485 490 495 Arg Asn Arg
Gln Thr Asn Glu Arg Ile Glu Glu Ile Ile Arg Thr Thr 500 505 510 Gly
Lys Glu Asn Ala Lys Tyr Leu Ile Glu Lys Ile Lys Leu His Asp 515 520
525 Met Gln Glu Gly Lys Cys Leu Tyr Ser Leu Glu Ala Ile Pro Leu Glu
530 535 540 Asp Leu Leu Asn Asn Pro Phe Asn Tyr Glu Val Asp His Ile
Ile Pro 545 550 555 560 Arg Ser Val Ser Phe Asp Asn Ser Phe Asn Asn
Lys Val Leu Val Lys 565 570 575 Gln Glu Glu Asn Ser Lys Lys Gly Asn
Arg Thr Pro Phe Gln Tyr Leu 580 585 590 Ser Ser Ser Asp Ser Lys Ile
Ser Tyr Glu Thr Phe Lys Lys His Ile 595 600 605 Leu Asn Leu Ala Lys
Gly Lys Gly Arg Ile Ser Lys Thr Lys Lys Glu 610 615 620 Tyr Leu Leu
Glu Glu Arg Asp Ile Asn Arg Phe Ser Val Gln Lys Asp 625 630 635 640
Phe Ile Asn Arg Asn Leu Val Asp Thr Arg Tyr Ala Thr Arg Gly Leu 645
650 655 Met Asn Leu Leu Arg Ser Tyr Phe Arg Val Asn Asn Leu Asp Val
Lys 660 665 670 Val Lys Ser Ile Asn Gly Gly Phe Thr Ser Phe Leu Arg
Arg Lys Trp 675 680 685 Lys Phe Lys Lys Glu Arg Asn Lys Gly Tyr Lys
His His Ala Glu Asp 690 695 700 Ala Leu Ile Ile Ala Asn Ala Asp Phe
Ile Phe Lys Glu Trp Lys Lys 705 710 715 720 Leu Asp Lys Ala Lys Lys
Val Met Glu Asn Gln Met Phe Glu Glu Lys 725 730 735 Gln Ala Glu Ser
Met Pro Glu Ile Glu Thr Glu Gln Glu Tyr Lys Glu 740 745 750 Ile Phe
Ile Thr Pro His Gln Ile Lys His Ile Lys Asp Phe Lys Asp 755 760 765
Tyr Lys Tyr Ser His Arg Val Asp Lys Lys Pro Asn Arg Glu Leu Ile 770
775 780 Asn Asp Thr Leu Tyr Ser Thr Arg Lys Asp Asp Lys Gly Asn Thr
Leu 785 790 795 800 Ile Val Asn Asn Leu Asn Gly Leu Tyr Asp Lys Asp
Asn Asp Lys Leu 805 810 815 Lys Lys Leu Ile Asn Lys Ser Pro Glu Lys
Leu Leu Met Tyr His His 820 825 830 Asp Pro Gln Thr Tyr Gln Lys Leu
Lys Leu Ile Met Glu Gln Tyr Gly 835 840 845 Asp Glu Lys Asn Pro Leu
Tyr Lys Tyr Tyr Glu Glu Thr Gly Asn Tyr 850 855 860 Leu Thr Lys Tyr
Ser Lys Lys Asp Asn Gly Pro Val Ile Lys Lys Ile 865 870 875 880 Lys
Tyr Tyr Gly Asn Lys Leu Asn Ala His Leu Asp Ile Thr Asp Asp 885 890
895 Tyr Pro Asn Ser Arg Asn Lys Val Val Lys Leu Ser Leu Lys Pro Tyr
900 905 910 Arg Phe Asp Val Tyr Leu Asp Asn Gly Val Tyr Lys Phe Val
Thr Val 915 920 925 Lys Asn Leu Asp Val Ile Lys Lys Glu Asn Tyr Tyr
Glu Val Asn Ser 930 935 940 Lys Ala Tyr Glu Glu Ala Lys Lys Leu Lys
Lys Ile Ser Asn Gln Ala 945 950 955 960 Glu Phe Ile Ala Ser Phe Tyr
Asn Asn Asp Leu Ile Lys Ile Asn Gly 965 970 975 Glu Leu Tyr Arg Val
Ile Gly Val Asn Asn Asp Leu Leu Asn Arg Ile 980 985 990 Glu Val Asn
Met Ile Asp Ile Thr Tyr Arg Glu Tyr Leu Glu Asn Met 995 1000 1005
Asn Asp Lys Arg Pro Pro Arg Ile Ile Lys Thr Ile Ala Ser Lys 1010
1015 1020 Thr Gln Ser Ile Lys Lys Tyr Ser Thr Asp Ile Leu Gly Asn
Leu 1025 1030 1035 Tyr Glu Val Lys Ser Lys Lys His Pro Gln Ile Ile
Lys Lys Gly 1040 1045 1050 1001368PRTStreptococcus pyogenes 100Met
Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val 1 5 10
15 Gly Trp Ala Val Ile Thr Asp Asp Tyr Lys Val Pro Ser Lys Lys Phe
20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn
Leu Ile 35 40 45 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu
Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg
Arg Lys Asn Arg Ile Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn
Glu Met Ala Lys Val Asp Asp Ser 85 90 95 Phe Phe His Arg Leu Glu
Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His
Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu
Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp 130 135 140
Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145
150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu
Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu
Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn
Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu
Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro
Gly Glu Lys Lys Asn Ser Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala
Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp
Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265
270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp
275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu
Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro
Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His
Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu
Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn
Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu
Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly
Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390
395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His
Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe
Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile
Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg
Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu
Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys
Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe
Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510
Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515
520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu
Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg
Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys
Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu
Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu
Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn
Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe
Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635
640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr
645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile
Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys
Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His
Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln
Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala
Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln
Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg
His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760
765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile
770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu
His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu
Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp
Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp
His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp
Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser
Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880
Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885
890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu
Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg
Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met
Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val
Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe
Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu Ile Asn Asn
Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985 990 Val Gly
Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000
1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala
1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr
Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu
Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg Pro Leu
Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp
Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser
Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln
Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg
Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120
1125 Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val
1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys
Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met
Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu
Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile
Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn
Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gln
Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn
Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240
1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys
1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe
Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys
Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile
Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu
Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp
Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu
Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly
Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360
1365 1011368PRTStreptococcus pyogenes 101Met Asp Lys Lys Tyr Ser
Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val
Ile Thr Asp Asp Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val
Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 35 40 45
Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50
55 60 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile
Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val
Asp Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val
Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn
Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile
Tyr His Leu Arg Lys Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala
Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile
Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175
Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180
185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp
Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg
Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn
Ser Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu
Thr Pro Asn Phe Lys Ser Asn Phe 245
250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr
Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln
Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala
Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr
Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp
Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg
Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln
Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365
Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370
375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu
Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His
Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln
Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile
Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro
Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys
Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val
Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490
495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser
500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys
Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu
Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys
Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp
Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser
Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His
Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn
Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615
620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala
625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg
Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile
Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp
Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln
Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln
Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu
His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735
Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740
745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn
Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met
Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile
Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn
Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met
Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr
Asp Val Asp Ala Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp
Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860
Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865
870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln
Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu
Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val
Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp
Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile
Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val
Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu
Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985
990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe
995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met
Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala
Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys
Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg
Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val
Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val
Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu
Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105
1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro
1115 1120 1125 Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr
Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser
Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr
Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp
Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp
Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu
Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu
Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225
1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser
1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln
His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser
Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu
Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys
Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe
Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr
Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr
Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345
1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp
1355 1360 1365 1021053PRTStaphylococcus aureus 102Met Lys Arg Asn
Tyr Ile Leu Gly Leu Ala Ile Gly Ile Thr Ser Val 1 5 10 15 Gly Tyr
Gly Ile Ile Asp Tyr Glu Thr Arg Asp Val Ile Asp Ala Gly 20 25 30
Val Arg Leu Phe Lys Glu Ala Asn Val Glu Asn Asn Glu Gly Arg Arg 35
40 45 Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg Arg Arg His Arg
Ile 50 55 60 Gln Arg Val Lys Lys Leu Leu Phe Asp Tyr Asn Leu Leu
Thr Asp His 65 70 75 80 Ser Glu Leu Ser Gly Ile Asn Pro Tyr Glu Ala
Arg Val Lys Gly Leu 85 90 95 Ser Gln Lys Leu Ser Glu Glu Glu Phe
Ser Ala Ala Leu Leu His Leu 100 105 110 Ala Lys Arg Arg Gly Val His
Asn Val Asn Glu Val Glu Glu Asp Thr 115 120 125 Gly Asn Glu Leu Ser
Thr Lys Glu Gln Ile Ser Arg Asn Ser Lys Ala 130 135 140 Leu Glu Glu
Lys Tyr Val Ala Glu Leu Gln Leu Glu Arg Leu Lys Lys 145 150 155 160
Asp Gly Glu Val Arg Gly Ser Ile Asn Arg Phe Lys Thr Ser Asp Tyr 165
170 175 Val Lys Glu Ala Lys Gln Leu Leu Lys Val Gln Lys Ala Tyr His
Gln 180 185 190 Leu Asp Gln Ser Phe Ile Asp Thr Tyr Ile Asp Leu Leu
Glu Thr Arg 195 200 205 Arg Thr Tyr Tyr Glu Gly Pro Gly Glu Gly Ser
Pro Phe Gly Trp Lys 210 215 220 Asp Ile Lys Glu Trp Tyr Glu Met Leu
Met Gly His Cys Thr Tyr Phe 225 230 235 240 Pro Glu Glu Leu Arg Ser
Val Lys Tyr Ala Tyr Asn Ala Asp Leu Tyr 245 250 255 Asn Ala Leu Asn
Asp Leu Asn Asn Leu Val Ile Thr Arg Asp Glu Asn 260 265 270 Glu Lys
Leu Glu Tyr Tyr Glu Lys Phe Gln Ile Ile Glu Asn Val Phe 275 280 285
Lys Gln Lys Lys Lys Pro Thr Leu Lys Gln Ile Ala Lys Glu Ile Leu 290
295 300 Val Asn Glu Glu Asp Ile Lys Gly Tyr Arg Val Thr Ser Thr Gly
Lys 305 310 315 320 Pro Glu Phe Thr Asn Leu Lys Val Tyr His Asp Ile
Lys Asp Ile Thr 325 330 335 Ala Arg Lys Glu Ile Ile Glu Asn Ala Glu
Leu Leu Asp Gln Ile Ala 340 345 350 Lys Ile Leu Thr Ile Tyr Gln Ser
Ser Glu Asp Ile Gln Glu Glu Leu 355 360 365 Thr Asn Leu Asn Ser Glu
Leu Thr Gln Glu Glu Ile Glu Gln Ile Ser 370 375 380 Asn Leu Lys Gly
Tyr Thr Gly Thr His Asn Leu Ser Leu Lys Ala Ile 385 390 395 400 Asn
Leu Ile Leu Asp Glu Leu Trp His Thr Asn Asp Asn Gln Ile Ala 405 410
415 Ile Phe Asn Arg Leu Lys Leu Val Pro Lys Lys Val Asp Leu Ser Gln
420 425 430 Gln Lys Glu Ile Pro Thr Thr Leu Val Asp Asp Phe Ile Leu
Ser Pro 435 440 445 Val Val Lys Arg Ser Phe Ile Gln Ser Ile Lys Val
Ile Asn Ala Ile 450 455 460 Ile Lys Lys Tyr Gly Leu Pro Asn Asp Ile
Ile Ile Glu Leu Ala Arg 465 470 475 480 Glu Lys Asn Ser Lys Asp Ala
Gln Lys Met Ile Asn Glu Met Gln Lys 485 490 495 Arg Asn Arg Gln Thr
Asn Glu Arg Ile Glu Glu Ile Ile Arg Thr Thr 500 505 510 Gly Lys Glu
Asn Ala Lys Tyr Leu Ile Glu Lys Ile Lys Leu His Asp 515 520 525 Met
Gln Glu Gly Lys Cys Leu Tyr Ser Leu Glu Ala Ile Pro Leu Glu 530 535
540 Asp Leu Leu Asn Asn Pro Phe Asn Tyr Glu Val Asp His Ile Ile Pro
545 550 555 560 Arg Ser Val Ser Phe Asp Asn Ser Phe Asn Asn Lys Val
Leu Val Lys 565 570 575 Gln Glu Glu Ala Ser Lys Lys Gly Asn Arg Thr
Pro Phe Gln Tyr Leu 580 585 590 Ser Ser Ser Asp Ser Lys Ile Ser Tyr
Glu Thr Phe Lys Lys His Ile 595 600 605 Leu Asn Leu Ala Lys Gly Lys
Gly Arg Ile Ser Lys Thr Lys Lys Glu 610 615 620 Tyr Leu Leu Glu Glu
Arg Asp Ile Asn Arg Phe Ser Val Gln Lys Asp 625 630 635 640 Phe Ile
Asn Arg Asn Leu Val Asp Thr Arg Tyr Ala Thr Arg Gly Leu 645 650 655
Met Asn Leu Leu Arg Ser Tyr Phe Arg Val Asn Asn Leu Asp Val Lys 660
665 670 Val Lys Ser Ile Asn Gly Gly Phe Thr Ser Phe Leu Arg Arg Lys
Trp 675 680 685 Lys Phe Lys Lys Glu Arg Asn Lys Gly Tyr Lys His His
Ala Glu Asp 690 695 700 Ala Leu Ile Ile Ala Asn Ala Asp Phe Ile Phe
Lys Glu Trp Lys Lys 705 710 715 720 Leu Asp Lys Ala Lys Lys Val Met
Glu Asn Gln Met Phe Glu Glu Lys 725 730 735 Gln Ala Glu Ser Met Pro
Glu Ile Glu Thr Glu Gln Glu Tyr Lys Glu 740 745 750 Ile Phe Ile Thr
Pro His Gln Ile Lys His Ile Lys Asp Phe Lys Asp 755 760 765 Tyr Lys
Tyr Ser His Arg Val Asp Lys Lys Pro Asn Arg Glu Leu Ile 770 775 780
Asn Asp Thr Leu Tyr Ser Thr Arg Lys Asp Asp Lys Gly Asn Thr Leu 785
790 795 800 Ile Val Asn Asn Leu Asn Gly Leu Tyr Asp Lys Asp Asn Asp
Lys Leu 805 810 815 Lys Lys Leu Ile Asn Lys Ser Pro Glu Lys Leu Leu
Met Tyr His His 820 825 830 Asp Pro Gln Thr Tyr Gln Lys Leu Lys Leu
Ile Met Glu Gln Tyr Gly 835 840 845 Asp Glu Lys Asn Pro Leu Tyr Lys
Tyr Tyr Glu Glu Thr Gly Asn Tyr 850 855 860 Leu Thr Lys Tyr Ser Lys
Lys Asp Asn Gly Pro Val Ile Lys Lys Ile 865 870 875 880 Lys Tyr Tyr
Gly Asn Lys Leu Asn Ala His Leu Asp Ile Thr Asp Asp 885 890 895 Tyr
Pro Asn Ser Arg Asn Lys Val Val Lys Leu Ser Leu Lys Pro Tyr 900 905
910 Arg Phe Asp Val Tyr Leu Asp Asn Gly Val Tyr Lys Phe Val Thr Val
915 920 925 Lys Asn Leu Asp Val Ile Lys Lys Glu Asn Tyr Tyr Glu Val
Asn Ser 930 935 940 Lys Ala Tyr Glu Glu Ala Lys Lys Leu Lys Lys Ile
Ser Asn Gln Ala 945 950 955 960 Glu Phe Ile Ala Ser Phe Tyr Asn Asn
Asp Leu Ile Lys Ile Asn Gly 965 970 975 Glu Leu Tyr Arg Val Ile Gly
Val Asn Asn Asp Leu Leu Asn Arg Ile 980 985 990 Glu Val Asn Met Ile
Asp Ile Thr Tyr Arg Glu Tyr Leu Glu Asn Met 995 1000 1005 Asn Asp
Lys Arg Pro Pro Arg Ile Ile Lys Thr Ile Ala Ser Lys 1010 1015 1020
Thr Gln Ser Ile Lys Lys Tyr Ser Thr Asp Ile Leu Gly Asn Leu 1025
1030 1035 Tyr Glu Val Lys Ser Lys Lys His Pro Gln Ile Ile Lys Lys
Gly 1040 1045 1050 103984PRTCampylobacter jejuni 103Met Ala Arg Ile
Leu Ala Phe Asp Ile Gly Ile Ser Ser Ile Gly Trp 1 5 10 15 Ala Phe
Ser Glu Asn Asp Glu Leu Lys Asp Cys Gly Val Arg Ile Phe 20 25 30
Thr Lys Val Glu Asn Pro Lys Thr Gly Glu Ser Leu Ala Leu Pro Arg 35
40 45 Arg Leu Ala Arg Ser Ala Arg Lys Arg Leu Ala Arg Arg Lys Ala
Arg 50 55 60 Leu Asn His Leu Lys His Leu Ile Ala Asn Glu Phe Lys
Leu Asn Tyr 65 70 75 80 Glu Asp Tyr Gln Ser Phe Asp Glu Ser Leu Ala
Lys Ala Tyr Lys Gly 85 90 95 Ser Leu Ile Ser Pro Tyr Glu Leu Arg
Phe Arg Ala Leu Asn Glu Leu 100
105 110 Leu Ser Lys Gln Asp Phe Ala Arg Val Ile Leu His Ile Ala Lys
Arg 115 120 125 Arg Gly Tyr Asp Asp Ile Lys Asn Ser Asp Asp Lys Glu
Lys Gly Ala 130 135 140 Ile Leu Lys Ala Ile Lys Gln Asn Glu Glu Lys
Leu Ala Asn Tyr Gln 145 150 155 160 Ser Val Gly Glu Tyr Leu Tyr Lys
Glu Tyr Phe Gln Lys Phe Lys Glu 165 170 175 Asn Ser Lys Glu Phe Thr
Asn Val Arg Asn Lys Lys Glu Ser Tyr Glu 180 185 190 Arg Cys Ile Ala
Gln Ser Phe Leu Lys Asp Glu Leu Lys Leu Ile Phe 195 200 205 Lys Lys
Gln Arg Glu Phe Gly Phe Ser Phe Ser Lys Lys Phe Glu Glu 210 215 220
Glu Val Leu Ser Val Ala Phe Tyr Lys Arg Ala Leu Lys Asp Phe Ser 225
230 235 240 His Leu Val Gly Asn Cys Ser Phe Phe Thr Asp Glu Lys Arg
Ala Pro 245 250 255 Lys Asn Ser Pro Leu Ala Phe Met Phe Val Ala Leu
Thr Arg Ile Ile 260 265 270 Asn Leu Leu Asn Asn Leu Lys Asn Thr Glu
Gly Ile Leu Tyr Thr Lys 275 280 285 Asp Asp Leu Asn Ala Leu Leu Asn
Glu Val Leu Lys Asn Gly Thr Leu 290 295 300 Thr Tyr Lys Gln Thr Lys
Lys Leu Leu Gly Leu Ser Asp Asp Tyr Glu 305 310 315 320 Phe Lys Gly
Glu Lys Gly Thr Tyr Phe Ile Glu Phe Lys Lys Tyr Lys 325 330 335 Glu
Phe Ile Lys Ala Leu Gly Glu His Asn Leu Ser Gln Asp Asp Leu 340 345
350 Asn Glu Ile Ala Lys Asp Ile Thr Leu Ile Lys Asp Glu Ile Lys Leu
355 360 365 Lys Lys Ala Leu Ala Lys Tyr Asp Leu Asn Gln Asn Gln Ile
Asp Ser 370 375 380 Leu Ser Lys Leu Glu Phe Lys Asp His Leu Asn Ile
Ser Phe Lys Ala 385 390 395 400 Leu Lys Leu Val Thr Pro Leu Met Leu
Glu Gly Lys Lys Tyr Asp Glu 405 410 415 Ala Cys Asn Glu Leu Asn Leu
Lys Val Ala Ile Asn Glu Asp Lys Lys 420 425 430 Asp Phe Leu Pro Ala
Phe Asn Glu Thr Tyr Tyr Lys Asp Glu Val Thr 435 440 445 Asn Pro Val
Val Leu Arg Ala Ile Lys Glu Tyr Arg Lys Val Leu Asn 450 455 460 Ala
Leu Leu Lys Lys Tyr Gly Lys Val His Lys Ile Asn Ile Glu Leu 465 470
475 480 Ala Arg Glu Val Gly Lys Asn His Ser Gln Arg Ala Lys Ile Glu
Lys 485 490 495 Glu Gln Asn Glu Asn Tyr Lys Ala Lys Lys Asp Ala Glu
Leu Glu Cys 500 505 510 Glu Lys Leu Gly Leu Lys Ile Asn Ser Lys Asn
Ile Leu Lys Leu Arg 515 520 525 Leu Phe Lys Glu Gln Lys Glu Phe Cys
Ala Tyr Ser Gly Glu Lys Ile 530 535 540 Lys Ile Ser Asp Leu Gln Asp
Glu Lys Met Leu Glu Ile Asp His Ile 545 550 555 560 Tyr Pro Tyr Ser
Arg Ser Phe Asp Asp Ser Tyr Met Asn Lys Val Leu 565 570 575 Val Phe
Thr Lys Gln Asn Gln Glu Lys Leu Asn Gln Thr Pro Phe Glu 580 585 590
Ala Phe Gly Asn Asp Ser Ala Lys Trp Gln Lys Ile Glu Val Leu Ala 595
600 605 Lys Asn Leu Pro Thr Lys Lys Gln Lys Arg Ile Leu Asp Lys Asn
Tyr 610 615 620 Lys Asp Lys Glu Gln Lys Asn Phe Lys Asp Arg Asn Leu
Asn Asp Thr 625 630 635 640 Arg Tyr Ile Ala Arg Leu Val Leu Asn Tyr
Thr Lys Asp Tyr Leu Asp 645 650 655 Phe Leu Pro Leu Ser Asp Asp Glu
Asn Thr Lys Leu Asn Asp Thr Gln 660 665 670 Lys Gly Ser Lys Val His
Val Glu Ala Lys Ser Gly Met Leu Thr Ser 675 680 685 Ala Leu Arg His
Thr Trp Gly Phe Ser Ala Lys Asp Arg Asn Asn His 690 695 700 Leu His
His Ala Ile Asp Ala Val Ile Ile Ala Tyr Ala Asn Asn Ser 705 710 715
720 Ile Val Lys Ala Phe Ser Asp Phe Lys Lys Glu Gln Glu Ser Asn Ser
725 730 735 Ala Glu Leu Tyr Ala Lys Lys Ile Ser Glu Leu Asp Tyr Lys
Asn Lys 740 745 750 Arg Lys Phe Phe Glu Pro Phe Ser Gly Phe Arg Gln
Lys Val Leu Asp 755 760 765 Lys Ile Asp Glu Ile Phe Val Ser Lys Pro
Glu Arg Lys Lys Pro Ser 770 775 780 Gly Ala Leu His Glu Glu Thr Phe
Arg Lys Glu Glu Glu Phe Tyr Gln 785 790 795 800 Ser Tyr Gly Gly Lys
Glu Gly Val Leu Lys Ala Leu Glu Leu Gly Lys 805 810 815 Ile Arg Lys
Val Asn Gly Lys Ile Val Lys Asn Gly Asp Met Phe Arg 820 825 830 Val
Asp Ile Phe Lys His Lys Lys Thr Asn Lys Phe Tyr Ala Val Pro 835 840
845 Ile Tyr Thr Met Asp Phe Ala Leu Lys Val Leu Pro Asn Lys Ala Val
850 855 860 Ala Arg Ser Lys Lys Gly Glu Ile Lys Asp Trp Ile Leu Met
Asp Glu 865 870 875 880 Asn Tyr Glu Phe Cys Phe Ser Leu Tyr Lys Asp
Ser Leu Ile Leu Ile 885 890 895 Gln Thr Lys Asp Met Gln Glu Pro Glu
Phe Val Tyr Tyr Asn Ala Phe 900 905 910 Thr Ser Ser Thr Val Ser Leu
Ile Val Ser Lys His Asp Asn Lys Phe 915 920 925 Glu Thr Leu Ser Lys
Asn Gln Lys Ile Leu Phe Lys Asn Ala Asn Glu 930 935 940 Lys Glu Val
Ile Ala Lys Ser Ile Gly Ile Gln Asn Leu Lys Val Phe 945 950 955 960
Glu Lys Tyr Ile Val Ser Ala Leu Gly Glu Val Thr Lys Ala Glu Phe 965
970 975 Arg Gln Arg Glu Asp Phe Lys Lys 980
1041307PRTAcidaminococcus sp. 104Met Thr Gln Phe Glu Gly Phe Thr
Asn Leu Tyr Gln Val Ser Lys Thr 1 5 10 15 Leu Arg Phe Glu Leu Ile
Pro Gln Gly Lys Thr Leu Lys His Ile Gln 20 25 30 Glu Gln Gly Phe
Ile Glu Glu Asp Lys Ala Arg Asn Asp His Tyr Lys 35 40 45 Glu Leu
Lys Pro Ile Ile Asp Arg Ile Tyr Lys Thr Tyr Ala Asp Gln 50 55 60
Cys Leu Gln Leu Val Gln Leu Asp Trp Glu Asn Leu Ser Ala Ala Ile 65
70 75 80 Asp Ser Tyr Arg Lys Glu Lys Thr Glu Glu Thr Arg Asn Ala
Leu Ile 85 90 95 Glu Glu Gln Ala Thr Tyr Arg Asn Ala Ile His Asp
Tyr Phe Ile Gly 100 105 110 Arg Thr Asp Asn Leu Thr Asp Ala Ile Asn
Lys Arg His Ala Glu Ile 115 120 125 Tyr Lys Gly Leu Phe Lys Ala Glu
Leu Phe Asn Gly Lys Val Leu Lys 130 135 140 Gln Leu Gly Thr Val Thr
Thr Thr Glu His Glu Asn Ala Leu Leu Arg 145 150 155 160 Ser Phe Asp
Lys Phe Thr Thr Tyr Phe Ser Gly Phe Tyr Glu Asn Arg 165 170 175 Lys
Asn Val Phe Ser Ala Glu Asp Ile Ser Thr Ala Ile Pro His Arg 180 185
190 Ile Val Gln Asp Asn Phe Pro Lys Phe Lys Glu Asn Cys His Ile Phe
195 200 205 Thr Arg Leu Ile Thr Ala Val Pro Ser Leu Arg Glu His Phe
Glu Asn 210 215 220 Val Lys Lys Ala Ile Gly Ile Phe Val Ser Thr Ser
Ile Glu Glu Val 225 230 235 240 Phe Ser Phe Pro Phe Tyr Asn Gln Leu
Leu Thr Gln Thr Gln Ile Asp 245 250 255 Leu Tyr Asn Gln Leu Leu Gly
Gly Ile Ser Arg Glu Ala Gly Thr Glu 260 265 270 Lys Ile Lys Gly Leu
Asn Glu Val Leu Asn Leu Ala Ile Gln Lys Asn 275 280 285 Asp Glu Thr
Ala His Ile Ile Ala Ser Leu Pro His Arg Phe Ile Pro 290 295 300 Leu
Phe Lys Gln Ile Leu Ser Asp Arg Asn Thr Leu Ser Phe Ile Leu 305 310
315 320 Glu Glu Phe Lys Ser Asp Glu Glu Val Ile Gln Ser Phe Cys Lys
Tyr 325 330 335 Lys Thr Leu Leu Arg Asn Glu Asn Val Leu Glu Thr Ala
Glu Ala Leu 340 345 350 Phe Asn Glu Leu Asn Ser Ile Asp Leu Thr His
Ile Phe Ile Ser His 355 360 365 Lys Lys Leu Glu Thr Ile Ser Ser Ala
Leu Cys Asp His Trp Asp Thr 370 375 380 Leu Arg Asn Ala Leu Tyr Glu
Arg Arg Ile Ser Glu Leu Thr Gly Lys 385 390 395 400 Ile Thr Lys Ser
Ala Lys Glu Lys Val Gln Arg Ser Leu Lys His Glu 405 410 415 Asp Ile
Asn Leu Gln Glu Ile Ile Ser Ala Ala Gly Lys Glu Leu Ser 420 425 430
Glu Ala Phe Lys Gln Lys Thr Ser Glu Ile Leu Ser His Ala His Ala 435
440 445 Ala Leu Asp Gln Pro Leu Pro Thr Thr Leu Lys Lys Gln Glu Glu
Lys 450 455 460 Glu Ile Leu Lys Ser Gln Leu Asp Ser Leu Leu Gly Leu
Tyr His Leu 465 470 475 480 Leu Asp Trp Phe Ala Val Asp Glu Ser Asn
Glu Val Asp Pro Glu Phe 485 490 495 Ser Ala Arg Leu Thr Gly Ile Lys
Leu Glu Met Glu Pro Ser Leu Ser 500 505 510 Phe Tyr Asn Lys Ala Arg
Asn Tyr Ala Thr Lys Lys Pro Tyr Ser Val 515 520 525 Glu Lys Phe Lys
Leu Asn Phe Gln Met Pro Thr Leu Ala Ser Gly Trp 530 535 540 Asp Val
Asn Lys Glu Lys Asn Asn Gly Ala Ile Leu Phe Val Lys Asn 545 550 555
560 Gly Leu Tyr Tyr Leu Gly Ile Met Pro Lys Gln Lys Gly Arg Tyr Lys
565 570 575 Ala Leu Ser Phe Glu Pro Thr Glu Lys Thr Ser Glu Gly Phe
Asp Lys 580 585 590 Met Tyr Tyr Asp Tyr Phe Pro Asp Ala Ala Lys Met
Ile Pro Lys Cys 595 600 605 Ser Thr Gln Leu Lys Ala Val Thr Ala His
Phe Gln Thr His Thr Thr 610 615 620 Pro Ile Leu Leu Ser Asn Asn Phe
Ile Glu Pro Leu Glu Ile Thr Lys 625 630 635 640 Glu Ile Tyr Asp Leu
Asn Asn Pro Glu Lys Glu Pro Lys Lys Phe Gln 645 650 655 Thr Ala Tyr
Ala Lys Lys Thr Gly Asp Gln Lys Gly Tyr Arg Glu Ala 660 665 670 Leu
Cys Lys Trp Ile Asp Phe Thr Arg Asp Phe Leu Ser Lys Tyr Thr 675 680
685 Lys Thr Thr Ser Ile Asp Leu Ser Ser Leu Arg Pro Ser Ser Gln Tyr
690 695 700 Lys Asp Leu Gly Glu Tyr Tyr Ala Glu Leu Asn Pro Leu Leu
Tyr His 705 710 715 720 Ile Ser Phe Gln Arg Ile Ala Glu Lys Glu Ile
Met Asp Ala Val Glu 725 730 735 Thr Gly Lys Leu Tyr Leu Phe Gln Ile
Tyr Asn Lys Asp Phe Ala Lys 740 745 750 Gly His His Gly Lys Pro Asn
Leu His Thr Leu Tyr Trp Thr Gly Leu 755 760 765 Phe Ser Pro Glu Asn
Leu Ala Lys Thr Ser Ile Lys Leu Asn Gly Gln 770 775 780 Ala Glu Leu
Phe Tyr Arg Pro Lys Ser Arg Met Lys Arg Met Ala His 785 790 795 800
Arg Leu Gly Glu Lys Met Leu Asn Lys Lys Leu Lys Asp Gln Lys Thr 805
810 815 Pro Ile Pro Asp Thr Leu Tyr Gln Glu Leu Tyr Asp Tyr Val Asn
His 820 825 830 Arg Leu Ser His Asp Leu Ser Asp Glu Ala Arg Ala Leu
Leu Pro Asn 835 840 845 Val Ile Thr Lys Glu Val Ser His Glu Ile Ile
Lys Asp Arg Arg Phe 850 855 860 Thr Ser Asp Lys Phe Phe Phe His Val
Pro Ile Thr Leu Asn Tyr Gln 865 870 875 880 Ala Ala Asn Ser Pro Ser
Lys Phe Asn Gln Arg Val Asn Ala Tyr Leu 885 890 895 Lys Glu His Pro
Glu Thr Pro Ile Ile Gly Ile Asp Arg Gly Glu Arg 900 905 910 Asn Leu
Ile Tyr Ile Thr Val Ile Asp Ser Thr Gly Lys Ile Leu Glu 915 920 925
Gln Arg Ser Leu Asn Thr Ile Gln Gln Phe Asp Tyr Gln Lys Lys Leu 930
935 940 Asp Asn Arg Glu Lys Glu Arg Val Ala Ala Arg Gln Ala Trp Ser
Val 945 950 955 960 Val Gly Thr Ile Lys Asp Leu Lys Gln Gly Tyr Leu
Ser Gln Val Ile 965 970 975 His Glu Ile Val Asp Leu Met Ile His Tyr
Gln Ala Val Val Val Leu 980 985 990 Glu Asn Leu Asn Phe Gly Phe Lys
Ser Lys Arg Thr Gly Ile Ala Glu 995 1000 1005 Lys Ala Val Tyr Gln
Gln Phe Glu Lys Met Leu Ile Asp Lys Leu 1010 1015 1020 Asn Cys Leu
Val Leu Lys Asp Tyr Pro Ala Glu Lys Val Gly Gly 1025 1030 1035 Val
Leu Asn Pro Tyr Gln Leu Thr Asp Gln Phe Thr Ser Phe Ala 1040 1045
1050 Lys Met Gly Thr Gln Ser Gly Phe Leu Phe Tyr Val Pro Ala Pro
1055 1060 1065 Tyr Thr Ser Lys Ile Asp Pro Leu Thr Gly Phe Val Asp
Pro Phe 1070 1075 1080 Val Trp Lys Thr Ile Lys Asn His Glu Ser Arg
Lys His Phe Leu 1085 1090 1095 Glu Gly Phe Asp Phe Leu His Tyr Asp
Val Lys Thr Gly Asp Phe 1100 1105 1110 Ile Leu His Phe Lys Met Asn
Arg Asn Leu Ser Phe Gln Arg Gly 1115 1120 1125 Leu Pro Gly Phe Met
Pro Ala Trp Asp Ile Val Phe Glu Lys Asn 1130 1135 1140 Glu Thr Gln
Phe Asp Ala Lys Gly Thr Pro Phe Ile Ala Gly Lys 1145 1150 1155 Arg
Ile Val Pro Val Ile Glu Asn His Arg Phe Thr Gly Arg Tyr 1160 1165
1170 Arg Asp Leu Tyr Pro Ala Asn Glu Leu Ile Ala Leu Leu Glu Glu
1175 1180 1185 Lys Gly Ile Val Phe Arg Asp Gly Ser Asn Ile Leu Pro
Lys Leu 1190 1195 1200 Leu Glu Asn Asp Asp Ser His Ala Ile Asp Thr
Met Val Ala Leu 1205 1210 1215 Ile Arg Ser Val Leu Gln Met Arg Asn
Ser Asn Ala Ala Thr Gly 1220 1225 1230 Glu Asp Tyr Ile Asn Ser Pro
Val Arg Asp Leu Asn Gly Val Cys 1235 1240 1245 Phe Asp Ser Arg Phe
Gln Asn Pro Glu Trp Pro Met Asp Ala Asp 1250 1255 1260 Ala Asn Gly
Ala Tyr His Ile Ala Leu Lys Gly Gln Leu Leu Leu 1265 1270 1275 Asn
His Leu Lys Glu Ser Lys Asp Leu Lys Leu Gln Asn Gly Ile 1280 1285
1290 Ser Asn Gln Asp Trp Leu Ala Tyr Ile Gln Glu Leu Arg Asn 1295
1300 1305 1051307PRTAcidaminococcus sp. 105Met Thr Gln Phe Glu Gly
Phe Thr Asn Leu Tyr Gln Val Ser Lys Thr 1 5 10 15 Leu Arg Phe Glu
Leu Ile Pro Gln Gly Lys Thr Leu Lys His Ile Gln 20 25 30 Glu Gln
Gly Phe Ile Glu Glu Asp Lys Ala Arg Asn Asp His Tyr Lys 35 40 45
Glu Leu Lys Pro Ile Ile Asp Arg Ile Tyr Lys Thr Tyr Ala Asp Gln 50
55 60 Cys Leu Gln Leu Val Gln Leu Asp Trp Glu Asn Leu Ser Ala Ala
Ile 65 70 75 80 Asp Ser Tyr Arg Lys Glu Lys Thr Glu Glu Thr Arg Asn
Ala Leu Ile 85 90 95 Glu Glu
Gln Ala Thr Tyr Arg Asn Ala Ile His Asp Tyr Phe Ile Gly 100 105 110
Arg Thr Asp Asn Leu Thr Asp Ala Ile Asn Lys Arg His Ala Glu Ile 115
120 125 Tyr Lys Gly Leu Phe Lys Ala Glu Leu Phe Asn Gly Lys Val Leu
Lys 130 135 140 Gln Leu Gly Thr Val Thr Thr Thr Glu His Glu Asn Ala
Leu Leu Arg 145 150 155 160 Ser Phe Asp Lys Phe Thr Thr Tyr Phe Ser
Gly Phe Tyr Glu Asn Arg 165 170 175 Lys Asn Val Phe Ser Ala Glu Asp
Ile Ser Thr Ala Ile Pro His Arg 180 185 190 Ile Val Gln Asp Asn Phe
Pro Lys Phe Lys Glu Asn Cys His Ile Phe 195 200 205 Thr Arg Leu Ile
Thr Ala Val Pro Ser Leu Arg Glu His Phe Glu Asn 210 215 220 Val Lys
Lys Ala Ile Gly Ile Phe Val Ser Thr Ser Ile Glu Glu Val 225 230 235
240 Phe Ser Phe Pro Phe Tyr Asn Gln Leu Leu Thr Gln Thr Gln Ile Asp
245 250 255 Leu Tyr Asn Gln Leu Leu Gly Gly Ile Ser Arg Glu Ala Gly
Thr Glu 260 265 270 Lys Ile Lys Gly Leu Asn Glu Val Leu Asn Leu Ala
Ile Gln Lys Asn 275 280 285 Asp Glu Thr Ala His Ile Ile Ala Ser Leu
Pro His Arg Phe Ile Pro 290 295 300 Leu Phe Lys Gln Ile Leu Ser Asp
Arg Asn Thr Leu Ser Phe Ile Leu 305 310 315 320 Glu Glu Phe Lys Ser
Asp Glu Glu Val Ile Gln Ser Phe Cys Lys Tyr 325 330 335 Lys Thr Leu
Leu Arg Asn Glu Asn Val Leu Glu Thr Ala Glu Ala Leu 340 345 350 Phe
Asn Glu Leu Asn Ser Ile Asp Leu Thr His Ile Phe Ile Ser His 355 360
365 Lys Lys Leu Glu Thr Ile Ser Ser Ala Leu Cys Asp His Trp Asp Thr
370 375 380 Leu Arg Asn Ala Leu Tyr Glu Arg Arg Ile Ser Glu Leu Thr
Gly Lys 385 390 395 400 Ile Thr Lys Ser Ala Lys Glu Lys Val Gln Arg
Ser Leu Lys His Glu 405 410 415 Asp Ile Asn Leu Gln Glu Ile Ile Ser
Ala Ala Gly Lys Glu Leu Ser 420 425 430 Glu Ala Phe Lys Gln Lys Thr
Ser Glu Ile Leu Ser His Ala His Ala 435 440 445 Ala Leu Asp Gln Pro
Leu Pro Thr Thr Leu Lys Lys Gln Glu Glu Lys 450 455 460 Glu Ile Leu
Lys Ser Gln Leu Asp Ser Leu Leu Gly Leu Tyr His Leu 465 470 475 480
Leu Asp Trp Phe Ala Val Asp Glu Ser Asn Glu Val Asp Pro Glu Phe 485
490 495 Ser Ala Arg Leu Thr Gly Ile Lys Leu Glu Met Glu Pro Ser Leu
Ser 500 505 510 Phe Tyr Asn Lys Ala Arg Asn Tyr Ala Thr Lys Lys Pro
Tyr Ser Val 515 520 525 Glu Lys Phe Lys Leu Asn Phe Gln Met Pro Thr
Leu Ala Ser Gly Trp 530 535 540 Asp Val Asn Lys Glu Lys Asn Asn Gly
Ala Ile Leu Phe Val Lys Asn 545 550 555 560 Gly Leu Tyr Tyr Leu Gly
Ile Met Pro Lys Gln Lys Gly Arg Tyr Lys 565 570 575 Ala Leu Ser Phe
Glu Pro Thr Glu Lys Thr Ser Glu Gly Phe Asp Lys 580 585 590 Met Tyr
Tyr Asp Tyr Phe Pro Asp Ala Ala Lys Met Ile Pro Lys Cys 595 600 605
Ser Thr Gln Leu Lys Ala Val Thr Ala His Phe Gln Thr His Thr Thr 610
615 620 Pro Ile Leu Leu Ser Asn Asn Phe Ile Glu Pro Leu Glu Ile Thr
Lys 625 630 635 640 Glu Ile Tyr Asp Leu Asn Asn Pro Glu Lys Glu Pro
Lys Lys Phe Gln 645 650 655 Thr Ala Tyr Ala Lys Lys Thr Gly Asp Gln
Lys Gly Tyr Arg Glu Ala 660 665 670 Leu Cys Lys Trp Ile Asp Phe Thr
Arg Asp Phe Leu Ser Lys Tyr Thr 675 680 685 Lys Thr Thr Ser Ile Asp
Leu Ser Ser Leu Arg Pro Ser Ser Gln Tyr 690 695 700 Lys Asp Leu Gly
Glu Tyr Tyr Ala Glu Leu Asn Pro Leu Leu Tyr His 705 710 715 720 Ile
Ser Phe Gln Arg Ile Ala Glu Lys Glu Ile Met Asp Ala Val Glu 725 730
735 Thr Gly Lys Leu Tyr Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ala Lys
740 745 750 Gly His His Gly Lys Pro Asn Leu His Thr Leu Tyr Trp Thr
Gly Leu 755 760 765 Phe Ser Pro Glu Asn Leu Ala Lys Thr Ser Ile Lys
Leu Asn Gly Gln 770 775 780 Ala Glu Leu Phe Tyr Arg Pro Lys Ser Arg
Met Lys Arg Met Ala His 785 790 795 800 Arg Leu Gly Glu Lys Met Leu
Asn Lys Lys Leu Lys Asp Gln Lys Thr 805 810 815 Pro Ile Pro Asp Thr
Leu Tyr Gln Glu Leu Tyr Asp Tyr Val Asn His 820 825 830 Arg Leu Ser
His Asp Leu Ser Asp Glu Ala Arg Ala Leu Leu Pro Asn 835 840 845 Val
Ile Thr Lys Glu Val Ser His Glu Ile Ile Lys Asp Arg Arg Phe 850 855
860 Thr Ser Asp Lys Phe Phe Phe His Val Pro Ile Thr Leu Asn Tyr Gln
865 870 875 880 Ala Ala Asn Ser Pro Ser Lys Phe Asn Gln Arg Val Asn
Ala Tyr Leu 885 890 895 Lys Glu His Pro Glu Thr Pro Ile Ile Gly Ile
Ala Arg Gly Glu Arg 900 905 910 Asn Leu Ile Tyr Ile Thr Val Ile Asp
Ser Thr Gly Lys Ile Leu Glu 915 920 925 Gln Arg Ser Leu Asn Thr Ile
Gln Gln Phe Asp Tyr Gln Lys Lys Leu 930 935 940 Asp Asn Arg Glu Lys
Glu Arg Val Ala Ala Arg Gln Ala Trp Ser Val 945 950 955 960 Val Gly
Thr Ile Lys Asp Leu Lys Gln Gly Tyr Leu Ser Gln Val Ile 965 970 975
His Glu Ile Val Asp Leu Met Ile His Tyr Gln Ala Val Val Val Leu 980
985 990 Ala Asn Leu Asn Phe Gly Phe Lys Ser Lys Arg Thr Gly Ile Ala
Glu 995 1000 1005 Lys Ala Val Tyr Gln Gln Phe Glu Lys Met Leu Ile
Asp Lys Leu 1010 1015 1020 Asn Cys Leu Val Leu Lys Asp Tyr Pro Ala
Glu Lys Val Gly Gly 1025 1030 1035 Val Leu Asn Pro Tyr Gln Leu Thr
Asp Gln Phe Thr Ser Phe Ala 1040 1045 1050 Lys Met Gly Thr Gln Ser
Gly Phe Leu Phe Tyr Val Pro Ala Pro 1055 1060 1065 Tyr Thr Ser Lys
Ile Asp Pro Leu Thr Gly Phe Val Asp Pro Phe 1070 1075 1080 Val Trp
Lys Thr Ile Lys Asn His Glu Ser Arg Lys His Phe Leu 1085 1090 1095
Glu Gly Phe Asp Phe Leu His Tyr Asp Val Lys Thr Gly Asp Phe 1100
1105 1110 Ile Leu His Phe Lys Met Asn Arg Asn Leu Ser Phe Gln Arg
Gly 1115 1120 1125 Leu Pro Gly Phe Met Pro Ala Trp Asp Ile Val Phe
Glu Lys Asn 1130 1135 1140 Glu Thr Gln Phe Asp Ala Lys Gly Thr Pro
Phe Ile Ala Gly Lys 1145 1150 1155 Arg Ile Val Pro Val Ile Glu Asn
His Arg Phe Thr Gly Arg Tyr 1160 1165 1170 Arg Asp Leu Tyr Pro Ala
Asn Glu Leu Ile Ala Leu Leu Glu Glu 1175 1180 1185 Lys Gly Ile Val
Phe Arg Asp Gly Ser Asn Ile Leu Pro Lys Leu 1190 1195 1200 Leu Glu
Asn Asp Asp Ser His Ala Ile Asp Thr Met Val Ala Leu 1205 1210 1215
Ile Arg Ser Val Leu Gln Met Ala Asn Ser Asn Ala Ala Thr Gly 1220
1225 1230 Glu Asp Tyr Ile Asn Ser Pro Val Arg Asp Leu Asn Gly Val
Cys 1235 1240 1245 Phe Asp Ser Arg Phe Gln Asn Pro Glu Trp Pro Met
Asp Ala Asp 1250 1255 1260 Ala Asn Gly Ala Tyr His Ile Ala Leu Lys
Gly Gln Leu Leu Leu 1265 1270 1275 Asn His Leu Lys Glu Ser Lys Asp
Leu Lys Leu Gln Asn Gly Ile 1280 1285 1290 Ser Asn Gln Asp Trp Leu
Ala Tyr Ile Gln Glu Leu Arg Asn 1295 1300 1305
1061245PRTLachnospiraceae bacterium 106Met Leu Lys Asn Val Gly Ile
Asp Arg Leu Asp Val Glu Lys Gly Arg 1 5 10 15 Lys Asn Met Ser Lys
Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser 20 25 30 Lys Thr Leu
Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn 35 40 45 Ile
Asp Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp 50 55
60 Tyr Lys Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile
65 70 75 80 Asn Asp Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn
Tyr Ile 85 90 95 Ser Leu Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu
Asn Lys Glu Leu 100 105 110 Glu Asn Leu Glu Ile Asn Leu Arg Lys Glu
Ile Ala Lys Ala Phe Lys 115 120 125 Gly Asn Glu Gly Tyr Lys Ser Leu
Phe Lys Lys Asp Ile Ile Glu Thr 130 135 140 Ile Leu Pro Glu Phe Leu
Asp Asp Lys Asp Glu Ile Ala Leu Val Asn 145 150 155 160 Ser Phe Asn
Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg 165 170 175 Glu
Asn Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg 180 185
190 Cys Ile Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe
195 200 205 Glu Lys Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu
Ile Lys 210 215 220 Glu Lys Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp
Phe Phe Glu Gly 225 230 235 240 Glu Phe Phe Asn Phe Val Leu Thr Gln
Glu Gly Ile Asp Val Tyr Asn 245 250 255 Ala Ile Ile Gly Gly Phe Val
Thr Glu Ser Gly Glu Lys Ile Lys Gly 260 265 270 Leu Asn Glu Tyr Ile
Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu 275 280 285 Pro Lys Phe
Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser 290 295 300 Leu
Ser Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu 305 310
315 320 Val Phe Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser
Ile 325 330 335 Lys Lys Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr
Ser Ser Ala 340 345 350 Gly Ile Phe Val Lys Asn Gly Pro Ala Ile Ser
Thr Ile Ser Lys Asp 355 360 365 Ile Phe Gly Glu Trp Asn Val Ile Arg
Asp Lys Trp Asn Ala Glu Tyr 370 375 380 Asp Asp Ile His Leu Lys Lys
Lys Ala Val Val Thr Glu Lys Tyr Glu 385 390 395 400 Asp Asp Arg Arg
Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu 405 410 415 Gln Leu
Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu 420 425 430
Lys Glu Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly 435
440 445 Ser Ser Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser
Leu 450 455 460 Lys Lys Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu
Leu Asp Ser 465 470 475 480 Val Lys Ser Phe Glu Asn Tyr Ile Lys Ala
Phe Phe Gly Glu Gly Lys 485 490 495 Glu Thr Asn Arg Asp Glu Ser Phe
Tyr Gly Asp Phe Val Leu Ala Tyr 500 505 510 Asp Ile Leu Leu Lys Val
Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr 515 520 525 Val Thr Gln Lys
Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln 530 535 540 Asn Pro
Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr 545 550 555
560 Arg Ala Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met
565 570 575 Asp Lys Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp
Asp Val 580 585 590 Asn Gly Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu
Pro Gly Pro Asn 595 600 605 Lys Met Leu Pro Lys Val Phe Phe Ser Lys
Lys Trp Met Ala Tyr Tyr 610 615 620 Asn Pro Ser Glu Asp Ile Gln Lys
Ile Tyr Lys Asn Gly Thr Phe Lys 625 630 635 640 Lys Gly Asp Met Phe
Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe 645 650 655 Phe Lys Asp
Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp 660 665 670 Phe
Asn Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr 675 680
685 Arg Glu Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser
690 695 700 Lys Lys Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr
Met Phe 705 710 715 720 Gln Ile Tyr Asn Lys Asp Phe Ser Asp Lys Ser
His Gly Thr Pro Asn 725 730 735 Leu His Thr Met Tyr Phe Lys Leu Leu
Phe Asp Glu Asn Asn His Gly 740 745 750 Gln Ile Arg Leu Ser Gly Gly
Ala Glu Leu Phe Met Arg Arg Ala Ser 755 760 765 Leu Lys Lys Glu Glu
Leu Val Val His Pro Ala Asn Ser Pro Ile Ala 770 775 780 Asn Lys Asn
Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp 785 790 795 800
Val Tyr Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile 805
810 815 Pro Ile Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn
Thr 820 825 830 Glu Val Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr
Val Ile Gly 835 840 845 Ile Asp Arg Gly Glu Arg Asn Leu Leu Tyr Ile
Val Val Val Asp Gly 850 855 860 Lys Gly Asn Ile Val Glu Gln Tyr Ser
Leu Asn Glu Ile Ile Asn Asn 865 870 875 880 Phe Asn Gly Ile Arg Ile
Lys Thr Asp Tyr His Ser Leu Leu Asp Lys 885 890 895 Lys Glu Lys Glu
Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu 900 905 910 Asn Ile
Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys 915 920 925
Ile Cys Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp 930
935 940 Leu Asn Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln
Val 945 950 955 960 Tyr Gln Lys Phe Glu Lys Met Leu Ile Asp Lys Leu
Asn Tyr Met Val 965 970 975 Asp Lys Lys Ser Asn Pro Cys Ala Thr Gly
Gly Ala Leu Lys Gly Tyr 980 985 990 Gln Ile Thr Asn Lys Phe Glu Ser
Phe Lys Ser Met Ser Thr Gln Asn 995 1000 1005 Gly Phe Ile Phe Tyr
Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp 1010 1015 1020 Pro Ser Thr
Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser 1025 1030 1035 Ile
Ala Asp Ser Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met 1040 1045
1050 Tyr Val Pro Glu Glu Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys
1055 1060 1065 Asn Phe Ser Arg Thr Asp Ala Asp
Tyr Ile Lys Lys Trp Lys Leu 1070 1075 1080 Tyr Ser Tyr Gly Asn Arg
Ile Arg Ile Phe Arg Asn Pro Lys Lys 1085 1090 1095 Asn Asn Val Phe
Asp Trp Glu Glu Val Cys Leu Thr Ser Ala Tyr 1100 1105 1110 Lys Glu
Leu Phe Asn Lys Tyr Gly Ile Asn Tyr Gln Gln Gly Asp 1115 1120 1125
Ile Arg Ala Leu Leu Cys Glu Gln Ser Asp Lys Ala Phe Tyr Ser 1130
1135 1140 Ser Phe Met Ala Leu Met Ser Leu Met Leu Gln Met Arg Asn
Ser 1145 1150 1155 Ile Thr Gly Arg Thr Asp Val Asp Phe Leu Ile Ser
Pro Val Lys 1160 1165 1170 Asn Ser Asp Gly Ile Phe Tyr Asp Ser Arg
Asn Tyr Glu Ala Gln 1175 1180 1185 Glu Asn Ala Ile Leu Pro Lys Asn
Ala Asp Ala Asn Gly Ala Tyr 1190 1195 1200 Asn Ile Ala Arg Lys Val
Leu Trp Ala Ile Gly Gln Phe Lys Lys 1205 1210 1215 Ala Glu Asp Glu
Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn 1220 1225 1230 Lys Glu
Trp Leu Glu Tyr Ala Gln Thr Ser Val Lys 1235 1240 1245
1071246PRTLachnospiraceae bacterium 107Met Leu Lys Asn Val Gly Ile
Asp Arg Leu Asp Val Glu Lys Gly Arg 1 5 10 15 Lys Asn Met Ser Lys
Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser 20 25 30 Lys Thr Leu
Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn 35 40 45 Ile
Asp Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp 50 55
60 Tyr Lys Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile
65 70 75 80 Asn Asp Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn
Tyr Ile 85 90 95 Ser Leu Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu
Asn Lys Glu Leu 100 105 110 Glu Asn Leu Glu Ile Asn Leu Arg Lys Glu
Ile Ala Lys Ala Phe Lys 115 120 125 Gly Asn Glu Gly Tyr Lys Ser Leu
Phe Lys Lys Asp Ile Ile Glu Thr 130 135 140 Ile Leu Pro Glu Phe Leu
Asp Asp Lys Asp Glu Ile Ala Leu Val Asn 145 150 155 160 Ser Phe Asn
Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg 165 170 175 Glu
Asn Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg 180 185
190 Cys Ile Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe
195 200 205 Glu Lys Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu
Ile Lys 210 215 220 Glu Lys Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp
Phe Phe Glu Gly 225 230 235 240 Glu Phe Phe Asn Phe Val Leu Thr Gln
Glu Gly Ile Asp Val Tyr Asn 245 250 255 Ala Ile Ile Gly Gly Phe Val
Thr Glu Ser Gly Glu Lys Ile Lys Gly 260 265 270 Leu Asn Glu Tyr Ile
Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu 275 280 285 Pro Lys Phe
Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser 290 295 300 Leu
Ser Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu 305 310
315 320 Val Phe Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser
Ile 325 330 335 Lys Lys Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr
Ser Ser Ala 340 345 350 Gly Ile Phe Val Lys Asn Gly Pro Ala Ile Ser
Thr Ile Ser Lys Asp 355 360 365 Ile Phe Gly Glu Trp Asn Val Ile Arg
Asp Lys Trp Asn Ala Glu Tyr 370 375 380 Asp Asp Ile His Leu Lys Lys
Lys Ala Val Val Thr Glu Lys Tyr Glu 385 390 395 400 Asp Asp Arg Arg
Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu 405 410 415 Gln Leu
Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu 420 425 430
Lys Glu Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly 435
440 445 Ser Ser Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser
Leu 450 455 460 Lys Lys Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu
Leu Asp Ser 465 470 475 480 Val Lys Ser Phe Glu Asn Tyr Ile Lys Ala
Phe Phe Gly Glu Gly Lys 485 490 495 Glu Thr Asn Arg Asp Glu Ser Phe
Tyr Gly Asp Phe Val Leu Ala Tyr 500 505 510 Asp Ile Leu Leu Lys Val
Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr 515 520 525 Val Thr Gln Lys
Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln 530 535 540 Asn Pro
Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr 545 550 555
560 Arg Ala Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met
565 570 575 Asp Lys Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp
Asp Val 580 585 590 Asn Gly Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu
Pro Gly Pro Asn 595 600 605 Lys Met Leu Pro Lys Val Phe Phe Ser Lys
Lys Trp Met Ala Tyr Tyr 610 615 620 Asn Pro Ser Glu Asp Ile Gln Lys
Ile Tyr Lys Asn Gly Thr Phe Lys 625 630 635 640 Lys Gly Asp Met Phe
Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe 645 650 655 Phe Lys Asp
Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp 660 665 670 Phe
Asn Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr 675 680
685 Arg Glu Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser
690 695 700 Lys Lys Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr
Met Phe 705 710 715 720 Gln Ile Tyr Asn Lys Asp Phe Ser Asp Lys Ser
His Gly Thr Pro Asn 725 730 735 Leu His Thr Met Tyr Phe Lys Leu Leu
Phe Asp Glu Asn Asn His Gly 740 745 750 Gln Ile Arg Leu Ser Gly Gly
Ala Glu Leu Phe Met Arg Arg Ala Ser 755 760 765 Leu Lys Lys Glu Glu
Leu Val Val His Pro Ala Asn Ser Pro Ile Ala 770 775 780 Asn Lys Asn
Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp 785 790 795 800
Val Tyr Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile 805
810 815 Pro Ile Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn
Thr 820 825 830 Glu Val Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr
Val Ile Gly 835 840 845 Ile Ala Arg Gly Glu Arg Asn Leu Leu Tyr Ile
Val Val Val Asp Gly 850 855 860 Lys Gly Asn Ile Val Glu Gln Tyr Ser
Leu Asn Glu Ile Ile Asn Asn 865 870 875 880 Phe Asn Gly Ile Arg Ile
Lys Thr Asp Tyr His Ser Leu Leu Asp Lys 885 890 895 Lys Glu Lys Glu
Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu 900 905 910 Asn Ile
Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys 915 920 925
Ile Cys Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Ala Asp 930
935 940 Leu Asn Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln
Val 945 950 955 960 Tyr Gln Lys Phe Glu Lys Met Leu Ile Asp Lys Leu
Asn Tyr Met Val 965 970 975 Asp Lys Lys Ser Asn Pro Cys Ala Thr Gly
Gly Ala Leu Lys Gly Tyr 980 985 990 Gln Ile Thr Asn Lys Phe Glu Ser
Phe Lys Ser Met Ser Thr Gln Asn 995 1000 1005 Gly Phe Ile Phe Tyr
Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp 1010 1015 1020 Pro Ser Thr
Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser 1025 1030 1035 Ile
Ala Asp Ser Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met 1040 1045
1050 Tyr Val Pro Glu Glu Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys
1055 1060 1065 Asn Phe Ser Arg Thr Asp Ala Asp Tyr Ile Lys Lys Trp
Lys Leu 1070 1075 1080 Tyr Ser Tyr Gly Asn Arg Ile Arg Ile Phe Arg
Asn Pro Lys Lys 1085 1090 1095 Asn Asn Val Phe Asp Trp Glu Glu Val
Cys Leu Thr Ser Ala Tyr 1100 1105 1110 Lys Glu Leu Phe Asn Lys Tyr
Gly Ile Asn Tyr Gln Gln Gly Asp 1115 1120 1125 Ile Arg Ala Leu Leu
Cys Glu Gln Ser Asp Lys Ala Phe Tyr Ser 1130 1135 1140 Ser Phe Met
Ala Leu Met Ser Leu Met Leu Gln Met Ala Asn Ser 1145 1150 1155 Ile
Thr Gly Arg Thr Asp Val Asp Phe Leu Ile Ser Pro Val Lys 1160 1165
1170 Asn Ser Asp Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu Ala Gln
1175 1180 1185 Glu Asn Ala Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly
Ala Tyr 1190 1195 1200 Asn Ile Ala Arg Lys Val Leu Trp Ala Ile Gly
Gln Phe Lys Lys 1205 1210 1215 Ala Glu Asp Glu Lys Leu Asp Lys Val
Lys Ile Ala Ile Ser Asn 1220 1225 1230 Lys Glu Trp Leu Glu Tyr Ala
Gln Thr Ser Val Lys His 1235 1240 1245 1081121PRTStreptococcus
thermophilus 108Met Ser Asp Leu Val Leu Gly Leu Asp Ile Gly Ile Gly
Ser Val Gly 1 5 10 15 Val Gly Ile Leu Asn Lys Val Thr Gly Glu Ile
Ile His Lys Asn Ser 20 25 30 Arg Ile Phe Pro Ala Ala Gln Ala Glu
Asn Asn Leu Val Arg Arg Thr 35 40 45 Asn Arg Gln Gly Arg Arg Leu
Thr Arg Arg Lys Lys His Arg Arg Val 50 55 60 Arg Leu Asn Arg Leu
Phe Glu Glu Ser Gly Leu Ile Thr Asp Phe Thr 65 70 75 80 Lys Ile Ser
Ile Asn Leu Asn Pro Tyr Gln Leu Arg Val Lys Gly Leu 85 90 95 Thr
Asp Glu Leu Ser Asn Glu Glu Leu Phe Ile Ala Leu Lys Asn Met 100 105
110 Val Lys His Arg Gly Ile Ser Tyr Leu Asp Asp Ala Ser Asp Asp Gly
115 120 125 Asn Ser Ser Ile Gly Asp Tyr Ala Gln Ile Val Lys Glu Asn
Ser Lys 130 135 140 Gln Leu Glu Thr Lys Thr Pro Gly Gln Ile Gln Leu
Glu Arg Tyr Gln 145 150 155 160 Thr Tyr Gly Gln Leu Arg Gly Asp Phe
Thr Val Glu Lys Asp Gly Lys 165 170 175 Lys His Arg Leu Ile Asn Val
Phe Pro Thr Ser Ala Tyr Arg Ser Glu 180 185 190 Ala Leu Arg Ile Leu
Gln Thr Gln Gln Glu Phe Asn Pro Gln Ile Thr 195 200 205 Asp Glu Phe
Ile Asn Arg Tyr Leu Glu Ile Leu Thr Gly Lys Arg Lys 210 215 220 Tyr
Tyr His Gly Pro Gly Asn Glu Lys Ser Arg Thr Asp Tyr Gly Arg 225 230
235 240 Tyr Arg Thr Ser Gly Glu Thr Leu Asp Asn Ile Phe Gly Ile Leu
Ile 245 250 255 Gly Lys Cys Thr Phe Tyr Pro Asp Glu Phe Arg Ala Ala
Lys Ala Ser 260 265 270 Tyr Thr Ala Gln Glu Phe Asn Leu Leu Asn Asp
Leu Asn Asn Leu Thr 275 280 285 Val Pro Thr Glu Thr Lys Lys Leu Ser
Lys Glu Gln Lys Asn Gln Ile 290 295 300 Ile Asn Tyr Val Lys Asn Glu
Lys Ala Met Gly Pro Ala Lys Leu Phe 305 310 315 320 Lys Tyr Ile Ala
Lys Leu Leu Ser Cys Asp Val Ala Asp Ile Lys Gly 325 330 335 Tyr Arg
Ile Asp Lys Ser Gly Lys Ala Glu Ile His Thr Phe Glu Ala 340 345 350
Tyr Arg Lys Met Lys Thr Leu Glu Thr Leu Asp Ile Glu Gln Met Asp 355
360 365 Arg Glu Thr Leu Asp Lys Leu Ala Tyr Val Leu Thr Leu Asn Thr
Glu 370 375 380 Arg Glu Gly Ile Gln Glu Ala Leu Glu His Glu Phe Ala
Asp Gly Ser 385 390 395 400 Phe Ser Gln Lys Gln Val Asp Glu Leu Val
Gln Phe Arg Lys Ala Asn 405 410 415 Ser Ser Ile Phe Gly Lys Gly Trp
His Asn Phe Ser Val Lys Leu Met 420 425 430 Met Glu Leu Ile Pro Glu
Leu Tyr Glu Thr Ser Glu Glu Gln Met Thr 435 440 445 Ile Leu Thr Arg
Leu Gly Lys Gln Lys Thr Thr Ser Ser Ser Asn Lys 450 455 460 Thr Lys
Tyr Ile Asp Glu Lys Leu Leu Thr Glu Glu Ile Tyr Asn Pro 465 470 475
480 Val Val Ala Lys Ser Val Arg Gln Ala Ile Lys Ile Val Asn Ala Ala
485 490 495 Ile Lys Glu Tyr Gly Asp Phe Asp Asn Ile Val Ile Glu Met
Ala Arg 500 505 510 Glu Thr Asn Glu Asp Asp Glu Lys Lys Ala Ile Gln
Lys Ile Gln Lys 515 520 525 Ala Asn Lys Asp Glu Lys Asp Ala Ala Met
Leu Lys Ala Ala Asn Gln 530 535 540 Tyr Asn Gly Lys Ala Glu Leu Pro
His Ser Val Phe His Gly His Lys 545 550 555 560 Gln Leu Ala Thr Lys
Ile Arg Leu Trp His Gln Gln Gly Glu Arg Cys 565 570 575 Leu Tyr Thr
Gly Lys Thr Ile Ser Ile His Asp Leu Ile Asn Asn Ser 580 585 590 Asn
Gln Phe Glu Val Asp His Ile Leu Pro Leu Ser Ile Thr Phe Asp 595 600
605 Asp Ser Leu Ala Asn Lys Val Leu Val Tyr Ala Thr Ala Asn Gln Glu
610 615 620 Lys Gly Gln Arg Thr Pro Tyr Gln Ala Leu Asp Ser Met Asp
Asp Ala 625 630 635 640 Trp Ser Phe Arg Glu Leu Lys Ala Phe Val Arg
Glu Ser Lys Thr Leu 645 650 655 Ser Asn Lys Lys Lys Glu Tyr Leu Leu
Thr Glu Glu Asp Ile Ser Lys 660 665 670 Phe Asp Val Arg Lys Lys Phe
Ile Glu Arg Asn Leu Val Asp Thr Arg 675 680 685 Tyr Ala Ser Arg Val
Val Leu Asn Ala Leu Gln Glu His Phe Arg Ala 690 695 700 His Lys Ile
Asp Thr Lys Val Ser Val Val Arg Gly Gln Phe Thr Ser 705 710 715 720
Gln Leu Arg Arg His Trp Gly Ile Glu Lys Thr Arg Asp Thr Tyr His 725
730 735 His His Ala Val Asp Ala Leu Ile Ile Ala Ala Ser Ser Gln Leu
Asn 740 745 750 Leu Trp Lys Lys Gln Lys Asn Thr Leu Val Ser Tyr Ser
Glu Asp Gln 755 760 765 Leu Leu Asp Ile Glu Thr Gly Glu Leu Ile Ser
Asp Asp Glu Tyr Lys 770 775 780 Glu Ser Val Phe Lys Ala Pro Tyr Gln
His Phe Val Asp Thr Leu Lys 785 790 795 800 Ser Lys Glu Phe Glu Asp
Ser Ile Leu Phe Ser Tyr Gln Val Asp Ser 805 810 815 Lys Phe Asn Arg
Lys Ile Ser Asp Ala Thr Ile Tyr Ala Thr Arg Gln 820 825 830 Ala Lys
Val Gly Lys Asp Lys Ala Asp Glu Thr Tyr Val Leu Gly Lys 835 840 845
Ile Lys Asp Ile Tyr Thr Gln Asp
Gly Tyr Asp Ala Phe Met Lys Ile 850 855 860 Tyr Lys Lys Asp Lys Ser
Lys Phe Leu Met Tyr Arg His Asp Pro Gln 865 870 875 880 Thr Phe Glu
Lys Val Ile Glu Pro Ile Leu Glu Asn Tyr Pro Asn Lys 885 890 895 Gln
Ile Asn Glu Lys Gly Lys Glu Val Pro Cys Asn Pro Phe Leu Lys 900 905
910 Tyr Lys Glu Glu His Gly Tyr Ile Arg Lys Tyr Ser Lys Lys Gly Asn
915 920 925 Gly Pro Glu Ile Lys Ser Leu Lys Tyr Tyr Asp Ser Lys Leu
Gly Asn 930 935 940 His Ile Asp Ile Thr Pro Lys Asp Ser Asn Asn Lys
Val Val Leu Gln 945 950 955 960 Ser Val Ser Pro Trp Arg Ala Asp Val
Tyr Phe Asn Lys Thr Thr Gly 965 970 975 Lys Tyr Glu Ile Leu Gly Leu
Lys Tyr Ala Asp Leu Gln Phe Glu Lys 980 985 990 Gly Thr Gly Thr Tyr
Lys Ile Ser Gln Glu Lys Tyr Asn Asp Ile Lys 995 1000 1005 Lys Lys
Glu Gly Val Asp Ser Asp Ser Glu Phe Lys Phe Thr Leu 1010 1015 1020
Tyr Lys Asn Asp Leu Leu Leu Val Lys Asp Thr Glu Thr Lys Glu 1025
1030 1035 Gln Gln Leu Phe Arg Phe Leu Ser Arg Thr Met Pro Lys Gln
Lys 1040 1045 1050 His Tyr Val Glu Leu Lys Pro Tyr Asp Lys Gln Lys
Phe Glu Gly 1055 1060 1065 Gly Glu Ala Leu Ile Lys Val Leu Gly Asn
Val Ala Asn Ser Gly 1070 1075 1080 Gln Cys Lys Lys Gly Leu Gly Lys
Ser Asn Ile Ser Ile Tyr Lys 1085 1090 1095 Val Arg Thr Asp Val Leu
Gly Asn Gln His Ile Ile Lys Asn Glu 1100 1105 1110 Gly Asp Lys Pro
Lys Leu Asp Phe 1115 1120 1091121PRTStreptococcus thermophilus
109Met Ser Asp Leu Val Leu Gly Leu Ala Ile Gly Ile Gly Ser Val Gly
1 5 10 15 Val Gly Ile Leu Asn Lys Val Thr Gly Glu Ile Ile His Lys
Asn Ser 20 25 30 Arg Ile Phe Pro Ala Ala Gln Ala Glu Asn Asn Leu
Val Arg Arg Thr 35 40 45 Asn Arg Gln Gly Arg Arg Leu Thr Arg Arg
Lys Lys His Arg Arg Val 50 55 60 Arg Leu Asn Arg Leu Phe Glu Glu
Ser Gly Leu Ile Thr Asp Phe Thr 65 70 75 80 Lys Ile Ser Ile Asn Leu
Asn Pro Tyr Gln Leu Arg Val Lys Gly Leu 85 90 95 Thr Asp Glu Leu
Ser Asn Glu Glu Leu Phe Ile Ala Leu Lys Asn Met 100 105 110 Val Lys
His Arg Gly Ile Ser Tyr Leu Asp Asp Ala Ser Asp Asp Gly 115 120 125
Asn Ser Ser Ile Gly Asp Tyr Ala Gln Ile Val Lys Glu Asn Ser Lys 130
135 140 Gln Leu Glu Thr Lys Thr Pro Gly Gln Ile Gln Leu Glu Arg Tyr
Gln 145 150 155 160 Thr Tyr Gly Gln Leu Arg Gly Asp Phe Thr Val Glu
Lys Asp Gly Lys 165 170 175 Lys His Arg Leu Ile Asn Val Phe Pro Thr
Ser Ala Tyr Arg Ser Glu 180 185 190 Ala Leu Arg Ile Leu Gln Thr Gln
Gln Glu Phe Asn Pro Gln Ile Thr 195 200 205 Asp Glu Phe Ile Asn Arg
Tyr Leu Glu Ile Leu Thr Gly Lys Arg Lys 210 215 220 Tyr Tyr His Gly
Pro Gly Asn Glu Lys Ser Arg Thr Asp Tyr Gly Arg 225 230 235 240 Tyr
Arg Thr Ser Gly Glu Thr Leu Asp Asn Ile Phe Gly Ile Leu Ile 245 250
255 Gly Lys Cys Thr Phe Tyr Pro Asp Glu Phe Arg Ala Ala Lys Ala Ser
260 265 270 Tyr Thr Ala Gln Glu Phe Asn Leu Leu Asn Asp Leu Asn Asn
Leu Thr 275 280 285 Val Pro Thr Glu Thr Lys Lys Leu Ser Lys Glu Gln
Lys Asn Gln Ile 290 295 300 Ile Asn Tyr Val Lys Asn Glu Lys Ala Met
Gly Pro Ala Lys Leu Phe 305 310 315 320 Lys Tyr Ile Ala Lys Leu Leu
Ser Cys Asp Val Ala Asp Ile Lys Gly 325 330 335 Tyr Arg Ile Asp Lys
Ser Gly Lys Ala Glu Ile His Thr Phe Glu Ala 340 345 350 Tyr Arg Lys
Met Lys Thr Leu Glu Thr Leu Asp Ile Glu Gln Met Asp 355 360 365 Arg
Glu Thr Leu Asp Lys Leu Ala Tyr Val Leu Thr Leu Asn Thr Glu 370 375
380 Arg Glu Gly Ile Gln Glu Ala Leu Glu His Glu Phe Ala Asp Gly Ser
385 390 395 400 Phe Ser Gln Lys Gln Val Asp Glu Leu Val Gln Phe Arg
Lys Ala Asn 405 410 415 Ser Ser Ile Phe Gly Lys Gly Trp His Asn Phe
Ser Val Lys Leu Met 420 425 430 Met Glu Leu Ile Pro Glu Leu Tyr Glu
Thr Ser Glu Glu Gln Met Thr 435 440 445 Ile Leu Thr Arg Leu Gly Lys
Gln Lys Thr Thr Ser Ser Ser Asn Lys 450 455 460 Thr Lys Tyr Ile Asp
Glu Lys Leu Leu Thr Glu Glu Ile Tyr Asn Pro 465 470 475 480 Val Val
Ala Lys Ser Val Arg Gln Ala Ile Lys Ile Val Asn Ala Ala 485 490 495
Ile Lys Glu Tyr Gly Asp Phe Asp Asn Ile Val Ile Glu Met Ala Arg 500
505 510 Glu Thr Asn Glu Asp Asp Glu Lys Lys Ala Ile Gln Lys Ile Gln
Lys 515 520 525 Ala Asn Lys Asp Glu Lys Asp Ala Ala Met Leu Lys Ala
Ala Asn Gln 530 535 540 Tyr Asn Gly Lys Ala Glu Leu Pro His Ser Val
Phe His Gly His Lys 545 550 555 560 Gln Leu Ala Thr Lys Ile Arg Leu
Trp His Gln Gln Gly Glu Arg Cys 565 570 575 Leu Tyr Thr Gly Lys Thr
Ile Ser Ile His Asp Leu Ile Asn Asn Ser 580 585 590 Asn Gln Phe Glu
Val Asp Ala Ile Leu Pro Leu Ser Ile Thr Phe Asp 595 600 605 Asp Ser
Leu Ala Asn Lys Val Leu Val Tyr Ala Thr Ala Asn Gln Glu 610 615 620
Lys Gly Gln Arg Thr Pro Tyr Gln Ala Leu Asp Ser Met Asp Asp Ala 625
630 635 640 Trp Ser Phe Arg Glu Leu Lys Ala Phe Val Arg Glu Ser Lys
Thr Leu 645 650 655 Ser Asn Lys Lys Lys Glu Tyr Leu Leu Thr Glu Glu
Asp Ile Ser Lys 660 665 670 Phe Asp Val Arg Lys Lys Phe Ile Glu Arg
Asn Leu Val Asp Thr Arg 675 680 685 Tyr Ala Ser Arg Val Val Leu Asn
Ala Leu Gln Glu His Phe Arg Ala 690 695 700 His Lys Ile Asp Thr Lys
Val Ser Val Val Arg Gly Gln Phe Thr Ser 705 710 715 720 Gln Leu Arg
Arg His Trp Gly Ile Glu Lys Thr Arg Asp Thr Tyr His 725 730 735 His
His Ala Val Asp Ala Leu Ile Ile Ala Ala Ser Ser Gln Leu Asn 740 745
750 Leu Trp Lys Lys Gln Lys Asn Thr Leu Val Ser Tyr Ser Glu Asp Gln
755 760 765 Leu Leu Asp Ile Glu Thr Gly Glu Leu Ile Ser Asp Asp Glu
Tyr Lys 770 775 780 Glu Ser Val Phe Lys Ala Pro Tyr Gln His Phe Val
Asp Thr Leu Lys 785 790 795 800 Ser Lys Glu Phe Glu Asp Ser Ile Leu
Phe Ser Tyr Gln Val Asp Ser 805 810 815 Lys Phe Asn Arg Lys Ile Ser
Asp Ala Thr Ile Tyr Ala Thr Arg Gln 820 825 830 Ala Lys Val Gly Lys
Asp Lys Ala Asp Glu Thr Tyr Val Leu Gly Lys 835 840 845 Ile Lys Asp
Ile Tyr Thr Gln Asp Gly Tyr Asp Ala Phe Met Lys Ile 850 855 860 Tyr
Lys Lys Asp Lys Ser Lys Phe Leu Met Tyr Arg His Asp Pro Gln 865 870
875 880 Thr Phe Glu Lys Val Ile Glu Pro Ile Leu Glu Asn Tyr Pro Asn
Lys 885 890 895 Gln Ile Asn Glu Lys Gly Lys Glu Val Pro Cys Asn Pro
Phe Leu Lys 900 905 910 Tyr Lys Glu Glu His Gly Tyr Ile Arg Lys Tyr
Ser Lys Lys Gly Asn 915 920 925 Gly Pro Glu Ile Lys Ser Leu Lys Tyr
Tyr Asp Ser Lys Leu Gly Asn 930 935 940 His Ile Asp Ile Thr Pro Lys
Asp Ser Asn Asn Lys Val Val Leu Gln 945 950 955 960 Ser Val Ser Pro
Trp Arg Ala Asp Val Tyr Phe Asn Lys Thr Thr Gly 965 970 975 Lys Tyr
Glu Ile Leu Gly Leu Lys Tyr Ala Asp Leu Gln Phe Glu Lys 980 985 990
Gly Thr Gly Thr Tyr Lys Ile Ser Gln Glu Lys Tyr Asn Asp Ile Lys 995
1000 1005 Lys Lys Glu Gly Val Asp Ser Asp Ser Glu Phe Lys Phe Thr
Leu 1010 1015 1020 Tyr Lys Asn Asp Leu Leu Leu Val Lys Asp Thr Glu
Thr Lys Glu 1025 1030 1035 Gln Gln Leu Phe Arg Phe Leu Ser Arg Thr
Met Pro Lys Gln Lys 1040 1045 1050 His Tyr Val Glu Leu Lys Pro Tyr
Asp Lys Gln Lys Phe Glu Gly 1055 1060 1065 Gly Glu Ala Leu Ile Lys
Val Leu Gly Asn Val Ala Asn Ser Gly 1070 1075 1080 Gln Cys Lys Lys
Gly Leu Gly Lys Ser Asn Ile Ser Ile Tyr Lys 1085 1090 1095 Val Arg
Thr Asp Val Leu Gly Asn Gln His Ile Ile Lys Asn Glu 1100 1105 1110
Gly Asp Lys Pro Lys Leu Asp Phe 1115 1120
* * * * *
References