U.S. patent application number 15/855435 was filed with the patent office on 2018-04-26 for polynucleotides and methods for making plants resistant to fungal pathogens.
This patent application is currently assigned to PIONEER HI-BRED INTERNATIONAL, INC.. The applicant listed for this patent is E. I. DU PONT DE NEMOURS AND COMPANY, PIONEER HI-BRED INTERNATIONAL, INC., UNIVERSITY OF DELAWARE. Invention is credited to KAREN E. BROGLIE, KARLENE H. BUTLER, MARYMAR GONCALVES BUTRUILLE, ALEXANDRE DA SILVA CONCEICAO, TRAVIS JAMES FREY, JAMES A. HAWK, JENNIFER S. JAQUETH, ELIZABETH S. JONES, DILBAG S. MULTANI, PETRA J. WOLTERS.
Application Number | 20180112280 15/855435 |
Document ID | / |
Family ID | 36940190 |
Filed Date | 2018-04-26 |
United States Patent
Application |
20180112280 |
Kind Code |
A1 |
BROGLIE; KAREN E. ; et
al. |
April 26, 2018 |
POLYNUCLEOTIDES AND METHODS FOR MAKING PLANTS RESISTANT TO FUNGAL
PATHOGENS
Abstract
This invention relates to polynucleotide sequences encoding a
gene that can confer resistance to the plant pathogen
Colletotrichum, which causes anthracnose stalk rot, leaf blight and
top dieback in corn and other cereals. It further relates to plants
and seeds of plants carrying chimeric genes comprising said
polynucleotide sequences, which enhance or confer resistance to the
plant pathogen Colletotrichum, and processes of making said plants
and seeds. The invention further presents sequences that can be
used as molecular markers that in turn can be used to identify the
region of interest in corn lines resulting from new crosses and to
quickly and efficiently introgress the gene from corn lines
carrying said gene into other corn lines that do not carry said
gene, in order to make them resistant to Colletotrichum and
resistant to stalk rot.
Inventors: |
BROGLIE; KAREN E.;
(LANDENBERG, PA) ; BUTLER; KARLENE H.; (NEWARK,
DE) ; BUTRUILLE; MARYMAR GONCALVES; (DES MOINES,
IA) ; DA SILVA CONCEICAO; ALEXANDRE; (WILMINGTON,
DE) ; FREY; TRAVIS JAMES; (HUXLEY, IA) ; HAWK;
JAMES A.; (NEWARK, DE) ; JAQUETH; JENNIFER S.;
(DES MOINES, IA) ; JONES; ELIZABETH S.; (RALEIGH,
NC) ; MULTANI; DILBAG S.; (URBANDALE, IA) ;
WOLTERS; PETRA J.; (KENNETT SQUARE, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PIONEER HI-BRED INTERNATIONAL, INC.
E. I. DU PONT DE NEMOURS AND COMPANY
UNIVERSITY OF DELAWARE |
Johnston
Wilmington
Newark |
IA
DE
DE |
US
US
US |
|
|
Assignee: |
PIONEER HI-BRED INTERNATIONAL,
INC.
JOHNSTON
IA
E. I. DU PONT DE NEMOURS AND COMPANY
WILMINGTON
DE
UNIVERSITY OF DELAWARE
NEWARK
DE
|
Family ID: |
36940190 |
Appl. No.: |
15/855435 |
Filed: |
December 27, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14538238 |
Nov 11, 2014 |
9884896 |
|
|
15855435 |
|
|
|
|
13270722 |
Oct 11, 2011 |
8884126 |
|
|
14538238 |
|
|
|
|
11774121 |
Jul 6, 2007 |
8084671 |
|
|
13270722 |
|
|
|
|
11397247 |
Apr 4, 2006 |
|
|
|
11774121 |
|
|
|
|
60675664 |
Apr 28, 2005 |
|
|
|
60668241 |
Apr 4, 2005 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12N 15/8282 20130101; C12Q 2600/13 20130101; C12Q 1/6895 20130101;
C07K 14/415 20130101; C12Q 2600/172 20130101; A01H 5/10 20130101;
A01H 1/04 20130101 |
International
Class: |
C12Q 1/6895 20060101
C12Q001/6895; A01H 1/04 20060101 A01H001/04; C12N 15/82 20060101
C12N015/82; A01H 5/10 20060101 A01H005/10; C07K 14/415 20060101
C07K014/415 |
Claims
1. Corn seed comprising a first MP305 derived chromosomal interval
defined by BNLG2162 and UMC1051, and not comprising a second MP305
derived chromosomal interval above BNLG2162 or below UMC1051.
2. The corn seed of claim 1, wherein said corn seed comprises the
Rcg1 gene and, when grown, produces a corn plant that exhibits
resistance to Colletotrichum infection.
3. A plant produced from the corn seed of claim 2.
4. A plant cell of the plant of claim 3.
5. Corn seed comprising a first MP305 derived chromosomal interval
between, but not including, MZA15842 and UMC15a, and not comprising
a second MP305 derived chromosomal interval at or above MZA15842 or
at or below UMC15a.
6. The corn seed of claim 5, wherein said corn seed comprises the
Rcg1 gene and, when grown, produces a corn plant that exhibits
resistance to Colletotrichum infection.
7. A plant produced from the corn seed of claim 6.
8. A plant cell of the plant of claim 7.
9. Seed of a corn variety designated DE811ASR(BC5), or a progeny
seed derived therefrom that comprises the Rcg1 gene, that when
grown, produces a plant that exhibits enhanced or newly conferred
resistance to Colletotrichum infection.
10. The seed of claim 9, wherein a representative sample of said
corn variety DE811ASR(BC5) has been deposited as ATCC accession
number PTA-7434.
11. A plant produced from the seed of claim 10.
12. A plant cell of the plant of claim 11.
13. The progeny seed of claim 9, wherein said progeny seed retains
a first MP305 or DE811ASR(BC5) derived chromosomal interval within,
but not including, UMC2285 and UMC15a.
14. The progeny seed of claim 9, wherein said progeny seed retains
a first MP305 or DE811ASR(BC5) derived chromosomal interval within,
but not including, MZA15842 and UMC15a.
15. A plant produced from the seed of claim 14.
16. A plant cell of the plant of claim 15.
17. The progeny seed of claim 14, wherein the progeny seed is an
Rcg1 locus conversion of PH705, PH5W4, PH51 K or PH87P, or a
progeny thereof.
18. The progeny seed of claim 9, wherein the progeny seed comprises
at least two or more of (a) allele 7 at MZA11123, (b) allele 2 at
MZA2591, or (c) allele 8 at MZA3434.
19. A corn plant produced by the progeny seed of claim 18.
20. The progeny seed of claim 9, wherein the progeny seed comprises
a cytosine nucleotide at MZA2591.32, a thymine nucleotide at
MZA2591.35, and a cytosine nucleotide at MZA3434.17.
21. A corn plant produced by the progeny seed of claim 20.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/538,238 filed Nov. 11, 2014, which is a continuation of U.S.
application Ser. No. 13/270,722 filed Oct. 11, 2011, now granted as
U.S. Pat. No. 8,884,126, which is a continuation of U.S.
application Ser. No. 11/774,121 filed Jul. 6, 2007, now granted as
U.S. Pat. No. 8,084,671, which is a continuation of U.S.
application Ser. No. 11/397,247 filed Apr. 4, 2006 and also claims
priority to and the benefit of U.S. Provisional Application Nos.
60/668,241 and 60/675,664, filed on Apr. 4, 2005 and Apr. 28, 2005
respectively, which are herein incorporated by reference in their
entirety.
THE NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT
[0002] A joint Research Project Agreement was executed on Feb. 18,
2002 for map-based cloning and gene expression studies of a maize
gene(s) that confer(s) resistance to ASR. The names of the parties
executing the joint Research Project Agreement are the University
of Delaware and E.I. du Pont de Nemours and Company.
FIELD OF THE INVENTION
[0003] This invention relates to compositions and methods useful in
creating or enhancing pathogen-resistance in plants. Additionally,
the invention relates to plants that have been genetically
transformed with the compositions of the invention.
BACKGROUND OF THE INVENTION
[0004] Colletotrichum graminicola (Ces.) (Cg), more commonly known
as anthracnose, is the causative agent of anthracnose leaf blight,
anthracnose stalk rot (ASR) and top dieback that affects Zea mays
(L.), also known as maize or corn. It is the only known common
stalk rot that also causes a leaf blight (Bergstrom, et al, (1999),
Plant Disease, 83:596-608, White, D. G. (1998), Compendium of Corn
Diseases, pp. 1-78). It has been known to occur in the United
States since 1855 and has been reported in the Americas, Europe,
Africa, Asia, and Australia (McGee, D. C. (1988), Maize Diseases: A
Reference Source for Seed Technologists, APS Press, St. Paul,
Minn.; White, (1998) supra; White, et al., (1979) Proc. Annu. Corn
Sorghum Res Conf (34th) 1-15). In the United States alone, over
37.5 million acres are infested annually with average yield losses
of 6.6% nationwide (See FIG. 1). The yield losses are due both to
low kernel weight in infected plants and "lodging," that is, the
falling over of the plants due to weakness in the stalks caused by
the infection (Dodd, J., (1980), Plant Disease, 64:533-537). Lodged
plants are more difficult to harvest and are susceptible to other
diseases. After infection, typically the upper portion of the stalk
dies first while the lower stalk is still green. Externally,
infection can be recognized by blotchy black patches on the outer
rind of the stalk, while internally the pith tissue is discolored
or black in appearance. Inoculation occurs in a number of ways.
Roots may grow through stalk debris and become infected. This will
become an increasing problem as "no till" methods of agriculture
are more widely adopted due to their environmental benefits. The
fungus may also infect the stalks through insect damage and other
wounds (White (1998) supra). Stalk infection may be preceded by
leaf infection causing leaf blight and providing inoculum for stalk
infection. There is controversy in the technical literature as to
the number of different varieties or races of Cg present in nature.
The pathogen is transmitted by wind or contaminated seed lots.
Spores remain viable for up to 2 years (McGee (1988) supra;
Nicholson, et al., (1980), Phytopathology, 70:255-261; Warren, H.
L. (1977), Phytopathology, 67:160-162; Warren, et al., (1975),
Phytopathology, 65:620-623).
[0005] Farmers may combat infection by corn fungal diseases such as
anthracnose through the use of fungicides, but these have
environmental side effects, and require monitoring of fields and
diagnostic techniques to determine which fungus is causing the
infection so that the correct fungicide can be used. Particularly
with large field crops such as corn, this is difficult. The use of
corn lines that carry genetic or transgenic sources of resistance
is more practical if the genes responsible for resistance can be
incorporated into elite, high yielding germplasm without reducing
yield. Genetic sources of resistance to Cg have been described.
There have been several maize lines identified that carry some
level of resistance to Cg (White, et al. (1979) supra). These
included A556, MP305, H21, SP288, CI88A, and FR16. A reciprocal
translocation testcross analysis using A556 indicated that genes
controlling resistance to ASR lie on the long arms of chromosomes
1, 4, and 8 as well as both arms of chromosome 6 (Carson, M. L.
(1981), Sources of inheritance of resistance to anthracnose stalk
rot of corn. Ph.D. Thesis, University of Illinois,
Urbana-Champaign). Introgression of resistance derived from such
lines is complex. Another inbred, LB31, was reported to carry a
single dominant gene controlling resistance to ASR but appears to
be unstable, especially in the presence of European corn borer
infestation (Badu-Apraku et al., (1987) Phytopathology 77:
957-959). The line MP305 was found to carry two dominant genes for
resistance, one with a major effect and one with a minor effect
(Carson (1981) supra). MP305 has been made available by the
University of Mississippi through the National Plant Germplasm
System (GRIN ID: NSL 250298) operated by the United States
Department of Agriculture. See Compilation of North American Maize
Breeding Germplasm, J. T. Gerdes et al., Crop Science Society of
America, 1993. Seed of MP305 can be obtained through W. Paul
Williams, Supervisory Research Geneticist USDA-ARS, Corn Host Plant
Resistance Research Unit, Box 9555, 340 Dorman Hall, Mississippi
State, Miss. 39762.
[0006] It has been reported that there are two genes linked on the
long arm of chromosome 4 that confer resistance to Cg (Toman, et
al., (1993), Phytopathology, 83:981-986; Cowen, N et al. (1991)
Maize Genetics Conference Abstracts 33). A significant resistance
quantitative trait locus (QTL) on chromosome 4 has also been
reported (Jung, et al., (1994), Theoretical and Applied Genetics,
89:413-418). Jung et al. (supra) reported that UMC15 could be used
to select for the QTL on chromosome 4 in MP305, and suggested that
the QTL is on a 12cM region of chromosome 4 between UMC15 and
UMC66. In fact, as discussed in more detail below, the region
between UMC15 and UMC66 as reported on the IBM2 neighbors 4 genetic
map is approximately 129 cM, and selection for the QTL in the
manner suggested by Jung et al. (1994, supra) would at best select
a large chromosomal interval with considerable linkage drag and
negative phenotypic effect, and at worst, a double recombination
could occur between the two markers resulting in a false positive
selection for the Rcg1 locus.
[0007] Much work has been done on the mechanisms of disease
resistance in plants in general. Some mechanisms of resistance are
non-pathogen specific in nature, or so-called "non-host
resistance." These may be based on cell wall structure or similar
protective mechanisms. However, while plants lack an immune system
with circulating antibodies and the other attributes of a mammalian
immune system, they do have other mechanisms to specifically
protect against pathogens. The most important and best studied of
these are the plant disease resistance genes, or "R" genes. One of
very many reviews of this resistance mechanism and the R genes can
be found in Bekhadir et al., (2004), Current Opinion in Plant
Biology 7:391-399. There are 5 recognized classes of R genes:
intracellular proteins with a nucleotide-binding site (NBS) and a
leucine-rich repeat (LRR); transmembrane proteins with an
extracellular LRR domain (TM-LRR); transmembrane and extracellular
LRR with a cytoplasmic kinase domain (TM-CK-LRR); membrane signal
anchored protein with a coiled-coil cytoplasmic domain (MSAP-CC);
and membrane associated kinases with an N-terminal myristylation
site (MAK-N) (See, for example: Cohn, et al., (2001), Immunology,
13:55-62; Dangl, et al. (2001), Nature, 411:826-833).
[0008] The resistance gene of the embodiments of the present
invention encodes a novel R gene related to the NBS-LRR type. While
multiple NBS-LRR genes have been described, they differ widely in
their response to different pathogens and exact action. To
Applicants' knowledge, the novel R gene described in this
disclosure is the only one demonstrated to provide resistance to
Cg.
SUMMARY OF THE INVENTION
[0009] Embodiments of this invention are based on the fine mapping,
cloning and characterization of the gene responsible for the major
portion of the resistance phenotype from the line MP305, the
introgression of a truncated chromosomal interval with the MP305
resistance locus into other lines with little or no linkage drag,
the demonstration of the use of that gene as a transgene and the
use of molecular markers to move the gene or transgene into elite
lines using breeding techniques.
[0010] Embodiments include an isolated polynucleotide comprising a
nucleotide sequence encoding a polypeptide capable of conferring
resistance to Colletotrichum, wherein the polypeptide has an amino
acid sequence of at least 50%, at least 75%, at least 80%, at least
85%, at least 90%, and at least 95% identity, when compared to SEQ
ID NO:3 or the sequences deposited with the Agricultural Research
Service (ARS) Culture Collection on Feb. 22, 2006 as Patent Deposit
No. NRRL B-30895, based on the Needleman-Wunsch alignment
algorithm, or a complement of the nucleotide sequence, wherein the
complement and the nucleotide sequence consist of the same number
of nucleotides and are 100% complementary.
[0011] Additional embodiments of the present invention include a
vector comprising the polynucleotide of an embodiment of the
present invention, such as SEQ ID NO: 3, or the sequences of the
plasmid deposited as Patent Deposit No. NRRL-30895, and a
recombinant DNA construct comprising the polynucleotide of an
embodiment of the present invention operably linked to at least one
regulatory sequence. A plant cell, as well as a plant, each
comprising the recombinant DNA construct of an embodiment of the
present invention, and a seed comprising the recombinant DNA
construct are also embodied by the present invention.
[0012] The methods embodied by the present invention include 1) a
method for transforming a host cell, including a plant cell,
comprising transforming the host cell with the polynucleotide of an
embodiment of the present invention, 2) a method for producing a
plant comprising transforming a plant cell with the recombinant DNA
construct of an embodiment of the present invention and
regenerating a plant from the transformed plant cell, and 3)
methods of conferring or enhancing resistance to Colletotrichum
and/or stalk rot, comprising transforming a plant with the
recombinant DNA construct of an embodiment of the present
invention, thereby conferring and/or enhancing resistance to
Colletotrichum or stalk rot.
[0013] Additional embodiments include methods of determining the
presence or absence of the polynucleotides of an embodiment of the
present invention, or the Rcg1 locus, in a corn plant, comprising
at least one of (a) isolating nucleic acid molecules from the corn
plant and determining if an Rcg1 gene is present or absent by
amplifying sequences homologous to the polynucleotide, (b)
isolating nucleic acid molecules from the corn plant and performing
a Southern hybridization, (c) isolating proteins from the corn
plant and performing a western blot using antibodies to the Rcg1
protein, (d) isolating proteins from the corn plant and performing
an ELISA assay using antibodies to the Rcg1 protein, or (e)
demonstrating the presence of mRNA sequences derived from the Rcg1
mRNA transcript and unique to Rcg1, thereby determining the
presence of the polynucleotide or the Rcg1 locus in the corn
plant.
[0014] Methods of altering the level of expression of a protein
capable of conferring resistance to Colletotrichum or stalk rot in
a plant or plant cell comprising (a) transforming a plant cell with
the recombinant DNA construct of an embodiment of the present
invention and (b) growing the transformed plant cell under
conditions that are suitable for expression of the recombinant DNA
construct wherein expression of the recombinant DNA construct
results in production of altered levels of a protein capable of
conferring resistance to Colletotrichum or stalk rot in the
transformed host are also embodied by the present invention.
[0015] An additional method embodied by the present invention is a
method of conferring or enhancing resistance to Colletotrichum
and/or stalk rot in a corn plant, comprising (a) crossing a first
corn plant lacking the Rcg1 locus with a second corn plant
containing the Rcg1 locus to produce a segregating population, (b)
screening the segregating population for a member containing the
Rcg1 locus with a first nucleic acid, not including UMC15a or
UMC66, capable of hybridizing with a second nucleic acid linked to
or located within the Rcg1 locus, and (c) selecting the member for
further crossing and selection.
[0016] Methods of enhancing resistance to Colletotrichum and/or
stalk rot, or introgressing Colletotrichum and/or stalk rot
resistance into a corn plant, comprising performing marker assisted
selection of the corn plant with a nucleic acid marker, wherein the
nucleic acid marker specifically hybridizes with a nucleic acid
molecule having a first nucleic acid sequence that is linked to a
second nucleic acid sequence that is located on the Rcg1 locus of
MP305 and selecting the corn plant based on the marker assisted
selection are also embodiments of the present invention. Specific
FLP, MZA and Rcg1 specific SNP markers disclosed herein are further
aspects of the invention.
[0017] Additional embodiments are an improved donor source of
germplasm for introgressing resistance or enhancing resistance to
Colletotrichum or stalk rot into a corn plant, said germplasm
comprising DE811ASR (BC5) and progeny derived therefrom. Said
progeny can be further characterized as containing the DE811ASR
(BC5) Rcg1 sequences disclosed herein, molecular markers in or
genetically linked to Rcg1, resistance or enhanced resistance to
Colletotrichum, or any combinations thereof.
[0018] Further embodiments include processes for identifying corn
plants that display newly conferred or enhanced resistance to
Colletotrichum by detecting alleles of at least 2 markers in the
corn plant, wherein at least one of the markers is on or within the
chromosomal interval below UMC2041 and above the Rcg1 gene, and at
least one of the markers is on or within the interval below the
Rcg1 gene and above UMC2200. Similar embodiments encompassed by
this process include at least one of the markers being on or within
the chromosomal interval below UMC1086 and above the Rcg1 gene, on
or within the chromosomal interval below UMC2285 and above the Rcg1
gene, and at least one of the markers is on or within the interval
below the Rcg1 gene and above UMC2200, on or within the interval
below the Rcg1 gene and above UMC2187, or on or within the interval
below the Rcg1 gene and above UMC15a. Further embodiments related
to the same process include those in which at least one of the
markers is capable of detecting a polymorphism located at a
position corresponding to nucleotides 7230 and 7535 of SEQ ID NO:
137, nucleotides 11293 and 12553 of SEQ ID NO: 173, nucleotides
25412 and 29086 of SEQ ID NO: 137, or nucleotides 43017 and 50330
of SEQ ID NO: 137.
[0019] Further embodiments include processes for identifying corn
plants that display newly conferred or enhanced resistance to
Colletotrichum by detecting alleles of at least 2 markers in the
corn plant, wherein at least one of the markers on or within the
chromosomal interval below UMC2041 and above the Rcg1 gene is
selected from the markers listed in Table 16, and at least one of
the markers on or within the interval below the Rcg1 gene and above
UMC2200 is also selected from the markers listed in Table 16.
Embodiments include processes for identifying corn plants that
display newly conferred or enhanced resistance to Colletotrichum by
selecting for at least four markers or at least six, wherein at
least two or three of the markers are on or within the chromosomal
interval below UMC2041 and above the Rcg1 gene, and at least two or
three of the markers are on or within the interval below the Rcg1
gene and above UMC2200. Additional embodiments include this same
process when the two or three markers on or within the chromosomal
interval below UMC2041 and above the Rcg1 gene, as well as the two
or three markers on or within the interval below the Rcg1 gene and
above UMC2200, are selected from those listed in Table 16. Another
embodiment of this process includes detecting allele 7 at MZA1112,
detecting allele 2 at MZA2591, or detecting allele 8 at MZA3434.
Corn plants and seeds produced by the embodied processes are also
embodiments of the invention, including those corn plants which do
not comprise the same alleles as MP305 at or above UMC2041, or at
or below UMC2200 at the loci shown in Table 16.
[0020] Other embodiments include processes for identifying corn
plants that display newly conferred or enhanced resistance to
Colletotrichum by detecting alleles of at least 2 markers in the
corn plant, wherein at least one of the markers is on or within the
chromosomal interval below UMC2041 and above the Rcg1 gene, and at
least one of the markers is on or within the interval below the
Rcg1 gene and above UMC2200, and where the process detects the
presence or absence of at least one marker located within the Rcg1
gene. A further such embodiment includes a modification of this
process in which four markers are selected for, in which two of the
markers are within the chromosomal interval below UMC2285 and above
the Rcg1 gene, and at least two of the markers are within the
interval below the Rcg1 gene and above UMC15a. A further embodiment
of this process includes the Rcg1 gene having been introgressed
from a donor corn plant, including MP305 or DE811ASR(BC5), into a
recipient corn plant to produce an introgressed corn plant. This
process also includes the instance when the introgressed corn plant
is selected for a recombination event below the Rcg1 gene and above
UMC15a, so that the introgressed corn plant retains a first MP305
derived chromosomal interval below the Rcg1 gene and above UMC15a,
and does not retain a second MP305 derived chromosomal interval at
and below UMC15a. Corn plants and seeds produced by these processes
are also embodiments of the invention. Introgressed corn plants
embodied by the invention include those that are Rcg1 locus
conversions of PH705, PH5W4, PH51 K or PH87P, or progeny
thereof.
[0021] A further embodiment of the invention is a process of
identifying a corn plant that displays enhanced resistance to
Colletotrichum infection, by detecting in the corn plant the
presence or absence of at least one marker at the Rcg1 locus, and
selecting the corn plant in which the at least one marker is
present. Embodiments include when at least one marker is on or
within SEQ ID NO: 137, and also when the at least one marker is
capable of detecting a polymorphism located at a position in SEQ ID
NO: 137 corresponding to the position between nucleotides 1 and
536, between nucleotides 7230 and 7535, between nucleotides 11293
and 12553, between nucleotides 25412 and 29086; and between
nucleotides 43017 and 50330, and also when at least one marker is
on or within the Rcg1 coding sequence, or located on or within the
polynucleotide set forth in SEQ ID NO: 1. Another embodiment
includes when the process detects a single nucleotide polymorphism
at a position in SEQ ID NO: 1 corresponding to one or more of
position 413, 958, 971, 1099, 1154, 1235, 1250, 1308, 1607, 2001,
2598, and 3342. Markers included by the processes in these
embodiments include SNP markers C00060-01 and C00060-02, markers
that detect an mRNA sequence derived from the Rcg1 mRNA transcript
and unique to Rcg1, and FLP markers on an amplicon generated by a
primer pair set forth in this disclosure, such as those of SEQ ID
NO:s 35-42, and their complements. Another embodiment includes when
the process detects the presence or absence of at least two markers
within the Rcg1 locus, including C00060-01 and C00060-02. Corn
plants and seeds produced by these processes are also embodiments
of the invention. Introgressed corn plants embodied by the
invention include those that are Rcg1 locus conversions of PH705,
PH5W4, PH51 K or PH87P, or progeny thereof. Such embodiments
include corn seed comprising a first MP305 derived chromosomal
interval defined by BNLG2162 and UMC1051, and not comprising a
second MP305 derived chromosomal interval above UMC2041 or below
UMC1051, and when the corn seed comprises the Rcg1 gene and, when
grown, produces a corn plant that exhibits resistance to
Colletotrichum infection. Seed of the embodiments also includes
corn seed comprising a first MP305 derived chromosomal interval
between, but not including, UMC2285 and UMC15a, and not comprising
a second MP305 derived chromosomal interval at or above UMC2285 or
at or below UMC15a, and furthermore such corn seed which comprises
the Rcg1 gene and, when grown, produces a corn plant that exhibits
resistance to Colletotrichum infection. Corn plants and plant cells
produced from this seed are also included in the embodiments of the
invention.
[0022] Additional embodiments include seed of a corn variety
designated DE811ASR(BC5), or the corn seed deposited as ATCC
accession number PTA-7434, or a progeny seed derived from that
variety, that comprises the Rcg1 gene, that when grown, produces a
plant that exhibits enhanced or newly conferred resistance to
Colletotrichum infection. Plants and plant cells grown from this
seed are also embodiments, as well as progeny seed that retain a
first MP305 or DE811ASR(BC5) derived chromosomal interval within,
but not including, UMC2285 and UMC15a, and progeny seed that do not
comprise a second MP305 derived chromosomal interval at or above
UMC2285 or at or below UMC15a. Plants and plant cells of the above
seed are included as embodiments. Progeny seed that is an Rcg1
locus conversion of PH705, PH5W4, PH51 K or PH87P, or a progeny
thereof is also embodied in the invention, as are progeny seed that
comprise at least two or more of allele 7 at MZA11123, allele 2 at
MZA2591, or allele 8 at MZA3434. Further embodiments include
progeny seed which comprise a cytosine nucleotide at MZA2591.32, a
thymine nucleotide at MZA2591.35, and a cytosine nucleotide at
MZA3434.17.
[0023] Additional embodiments include a computer system for
identifying a corn plant that displays newly conferred or enhanced
resistance to Colletotrichum infection comprising a database
comprising an allele score information for one or more corn plants
for four or more marker loci closely linked to or within the Rcg1
locus, and instructions that examine said database to determine
inheritance of the chromosomal interval or portions thereof defined
by the four or more marker loci and compute whether or not the one
or more corn plants comprise the Rcg1 gene. Further embodiments
include a computer system for identifying a corn plant that
displays newly conferred or enhanced resistance to Colletotrichum
infection comprising a database comprising allele score information
for one or more corn plants for one or more marker loci within the
Rcg1 locus, and instructions that examine said database to
determine inheritance of the Rcg1 locus. The allele score
information for one or more corn plants for such computer systems
may further comprise two, three, or more marker loci within the
Rcg1 locus.
[0024] Embodiments also include genetic markers on or within SEQ ID
NOs: 140 through 146 for MZA3434, MZA2591, MZA11123, MZA15842,
MZA1851, MZA8761 and MZA11455, respectively. Other embodiments
include genetic markers located on or in the Rcg1 locus or the Rcg1
gene, including those located on SEQ ID NO: 137, for example those
located on regions corresponding to nucleotides between 1 and 536,
between 7230 and 7535, between 11293 and 12553, between 25412 and
29086, and the region between nucleotides 43017 and 50330. Embodied
markers also include those located on SEQ ID NO: 1, such as those
located on or within nucleotide positions 550-658 of SEQ ID NO: 1,
or those located on or within nucleotide positions 1562-1767 of SEQ
ID NO: 1. Markers of the embodiments include those on markers
located on amplicons generated by a primer pair wherein the first
primer is an odd-numbered sequence from SEQ ID NO: 23 to 41, and
wherein the second primer is an even-numbered sequence from SEQ ID
NO: 24 to 42.
[0025] Further embodiments include corn plants obtainable by a
method comprising: crossing MP305 or DE811ASR(BC5) [Deposit No.
PTO-7434] as a first parent plant, with a different plant that
lacks an Rcg1 locus as a second parent plant, thereby to obtain
progeny comprising the Rcg1 locus of the first parent; and
optionally further comprising one or more further breeding steps to
obtain progeny of one or more further generations comprising the
Rcg1 locus of the first parent. Such embodied corn plants include
both inbred and hybrid plants. Seeds of such plants, including
those seeds which are homozygous and heterozygous for the Rcg1
locus, and methods of obtaining corn products resulting from the
processing of those seeds are embodied in the invention. Using such
seed in food or feed or the production of a corn product, such as
corn flour, corn meal and corn oil is also an embodiment of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 is a map of the United States showing the severity of
anthracnose stalk rot infestation by county for 2002.
[0027] FIG. 2 (a,b,c) is an alignment of a polypeptide sequence of
the embodiments (SEQ ID NO: 3) comparing it to other known NBS-LRR
polypeptides.
[0028] FIG. 3 is a graph produced by Windows QTL Cartographer
software showing a statistical analysis of the chance (Y axis) that
the locus responsible for the Cg resistance phenotype is located at
a particular position along the chromosome (X axis) as defined by
FLP markers.
[0029] FIG. 4 is an electrophoresis gel blot of aliquots of RT-PCR
reactions which reveals the presence of a 260 bp band present in
the samples derived from both infected and uninfected resistant
plants but absent from susceptible samples. RT-PCR fragments were
obtained from 12.5 ng total RNA from DE811 and DE811ASR stalk
tissue. cDNA obtained by reverse transcription was amplified using
Rcg1 specific primers and 18S rRNA primers as an internal
standard.
[0030] FIG. 5 is a schematic diagram of the Mu-tagging strategy
used to validate the Rcg1 gene.
[0031] FIG. 6 is the gene structure of Rcg1 showing the location of
four different mutator insertion sites.
[0032] FIG. 7(a-b) is a series of genetic map images with
increasing resolution of the map of the region near the Rcg1 gene.
Map distances for 7(a) for the map labelled "A" are in cM and in
relation to the IBM2 Neighbors 4 genetic map. Map distances for
7(b) for the map labelled "B" were developed using 184 individuals
from the BC7 population, and map distances for 7(b) for the map
labelled "C" were developed using 1060 individuals from the BC7
population. Genetic mapping in the BC7 population increased the map
resolution greater than 10-fold, when compared with the published
map. The location of the markers shown to the right of each map is
based on extrapolation of their location on the physical map.
[0033] FIG. 8(a-b) is a genetic map image showing the chromosomal
interval with the Rcg1 gene in DE811ASR (BC3), the reduced size of
the chromosomal interval with the Rcg1 gene obtained in DE811ASR
(BC5) and the further reduced size of the chromosomal interval in
inbreds obtained by initially using DE811ASR (BC5) as a donor
source. For all markers, the map distances shown were reported on
the IBM2 neighbors map publicly available on the Maize GDB, apart
from for MZA15842, FLP27 and FLP56 for which map positions were
extrapolated using regression analysis relative to the high
resolution maps in FIG. 7(b), maps B and C, using the positions of
UMC2285, PHI093 and CSU166a which were common to both maps.
[0034] FIGS. 9(a-b). FIG. 9(a) shows the alignment of the
non-colinear region from DE811ASR (BC5) relative to B73 and Mo17.
The BAC sizes in FIG. 9(a) are estimates. FIG. 9(b) shows a portion
of the non-colinear region as set forth in SEQ ID NO: 137 on which
Rcg1 resides, including the repetitive regions therein, as well as
the Rcg1 exons 1 and 2.
[0035] FIG. 10 (a-b) show distributions of average leaf lesion size
in different individual plants at 15 days after inoculation with Cg
in the DE811ASR(BC5) and DE811 lines, respectively.
[0036] FIG. 11 shows a comparison of average leaf lesion size on
plants of DE811 and DE811ASR(BC5) infected with Cg at 7 and 15 days
after inoculation.
[0037] FIG. 12 shows the average severity of disease four to five
weeks after inoculation with Cg in stalks of hybrids derived from
crossing DE811ASR(BC5) and DE811 to the line indicated.
[0038] FIG. 13 shows the improvement in yield at maturity after
inoculation with Cg in hybrids derived from crossing DE811ASR(BC5)
to the line indicated when compared to the yield of hybrids derived
from crossing DE811 to the line indicated.
[0039] FIG. 14 shows the severity of disease at 5 different
locations caused by Cg in stalks of inbred lines derived from
DE811ASR(BC5) or MP305 four to five weeks after inoculation.
Differences between the lines which were positive and negative for
the Rcg1 gene are statistically significant at a P value of less
than 0.05.
[0040] FIG. 15 shows disease progression in representative stalks
from inbred PH705 lines which are positive and negative for
Rcg1.
[0041] FIG. 16 shows disease progression in representative stalks
from inbred PH87P lines which are positive and negative for
Rcg1.
[0042] FIG. 17 shows the severity of disease four to five weeks
after inoculation at 5 different locations caused by Cg in stalks
of hybrids derived from crossing DE811ASR(BC5) to the line
indicated. Differences between the lines which were positive and
negative for the Rcg1 gene are statistically significant at a P
value of less than 0.05, except for location 5.
[0043] FIG. 18 shows disease progression in representative stalks
from hybrids created from PH4CV and PH705 lines which are positive
and negative for Rcg1.
[0044] FIG. 19 shows disease progression in representative stalks
from hybrids created from PH705 and PH87P lines which are positive
and negative for Rcg1.
[0045] FIG. 20 shows the method of scoring for disease severity in
corn stalks. The stalks are given a score, designated antgr75,
which represents the number of internodes (up to 5, including the
inoculated internode) that are more than 75% discolored. This
results in a score ranging from 0 to 5, with 0 indicating less than
75% discoloration in the inoculated internode, and 5 indicating 75%
or more discoloration of the first five internodes, including the
inoculated internode.
[0046] FIG. 21 shows a contig on the B73 physical map that is
homologous to the region into which the Rcg1 non-colinear region
containing DE811ASR (BC5) is inserted, which demonstrates that many
B73 derived bacterial artificial chromosomes (BACs) are available
in the region of interest from which sequence information can be
obtained.
[0047] FIG. 22 shows the alignment of the genetic map containing
MZA and public markers with the physical maps of Mo17 and B73. The
genetic map distances were developed by using 1060 individuals from
the BC7 mapping population. An analysis of a Mo17 BAC library also
showed the Rcg1 locus to be non-colinear with the corresponding
region of Mo17. The location of the markers shown by dotted lines
to the B73 map are extrapolations from the Mo17 physical map
location. The location of the markers shown by dotted lines to the
Mo17 map are extrapolations from the B73 physical map location.
[0048] FIG. 23 shows the oligos for the Rcg1 hybridization markers
designed for use with Invader.TM. reactions.
[0049] FIG. 24 shows the oligos for the Rcg1 hybridization markers
designed for use with TaqMan.RTM. reactions.
[0050] FIG. 25 shows the results of a northern blot obtained from
approximately 1.5 mg of polyA-enriched RNA isolated from resistant
and susceptible plants 0, 3, 6, 9, and 13 days post inoculation
(dpi). The membrane was probed with a random primer labeled 420 bp
Rcg1 fragment. Resistant tissue is from DE811ASR(BC5) and
susceptible tissue is from DE811.
[0051] FIG. 26 shows that PCR amplification using Rcg1 specific
primer pairs only amplifies in the resistant line DE811ASR(BC5) and
donor parent MP305, but not in susceptible line DE811, with the
exception of FLP110E-R, which amplifies the coiled coil-nucleotide
binding site region, which is highly conserved, and thus amplifies
a region elsewhere in the genome that is not Rcg1 in the DE811
line. A 100 bp ladder was used for fragment sizing.
DETAILED DESCRIPTION OF THE INVENTION
[0052] Embodiments of the present invention provide compositions
and methods (or processes) directed to inducing pathogen
resistance, particularly fungal resistance, in plants. The
compositions are novel nucleotide and amino acid sequences that
confer or enhance resistance to plant fungal pathogens.
Specifically, certain embodiments provide polypeptides having the
amino acid sequence set forth in SEQ ID NO: 3, and variants and
fragments thereof. Isolated nucleic acid molecules, and variants
and fragments thereof, comprising nucleotide sequences that encode
the amino acid sequence shown in SEQ ID NO: 3 are further
provided.
[0053] Nucleotide sequences that encode the polypeptide of SEQ ID
NO: 3 are set forth in SEQ ID NOs: 1 and 4. Plants, plant cells,
seeds, and microorganisms comprising a nucleotide sequence that
encodes a polypeptide of the embodiments are also disclosed
herein.
[0054] A deposit of the Rcg1 nucleic acid molecule was made on Feb.
22, 2006 with the Agricultural Research Service (ARS) Culture
Collection, housed in the Microbial Genomics and Bioprocessing
Research Unit of the National Center for Agricultural Utilization
Research (NCAUR), under the Budapest Treaty provisions. The deposit
was given the following accession number: NRRL B-30895. The address
of NCAUR is 1815 N. University Street, Peoria, Ill., 61604. This
deposit will be maintained under the terms of the Budapest Treaty
on the International Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure. This deposit was made merely
as a convenience for those of skill in the art and is not an
admission that a deposit is required under 35 U.S.C. .sctn. 112.
The deposit will irrevocably and without restriction or condition
be available to the public upon issuance of a patent. However, it
should be understood that the availability of a deposit does not
constitute a license to practice the subject invention in
derogation of patent rights granted by government action.
[0055] A sample of 2500 seeds of DE811ASR (BC5) were deposited in
the American Type Culture Collection (ATCC), 10801 University
Blvd., Manassas, Va. 20110-2209, USA on Mar. 13, 2006 and assigned
Deposit No. PTO-7434. Access to this deposit will be available
during the pendency of the application to the Commissioner of
Patents and Trademarks, persons determined by the Commissioner to
be entitled thereto upon request, and corresponding officials in
foreign patent offices in which this patent application is filed.
This deposit will be maintained under the terms of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purposes of Patent Procedure. The deposit
will irrevocably and without restriction or condition be available
to the public upon issuance of a patent. However, it should be
understood that the availability of the deposit does not constitute
a license to practice the subject invention or methods in
derogation of patent rights.
[0056] The full length polypeptide of the embodiments (SEQ ID NO:
3) shares varying degrees of homology with known polypeptides of
the NBS-LRR family. In particular, the novel polypeptide of the
embodiments shares homology with NBS-LRR proteins isolated from
Oryza sativa (Accession Nos. NP_910480 (SEQ ID NO: 14), NP_910482
(SEQ ID NO: 16), NP_921091 (SEQ ID NO: 17) and NP_910483 (SEQ ID
NO: 15)) and Hordeum vulgare (Accession No. AAG37354 (SEQ ID NO:
18); Zhou et al., (2001) Plant Cell 13:337-350). FIG. 1 provides an
alignment of the amino acid sequence set forth in SEQ ID NO: 3 with
the O. sativa and H. vulgare antifungal proteins (SEQ ID NOs:
14-18).
[0057] Amino acid alignments using the GAP program indicate that
SEQ ID NO:3 shares approximately 42.3% sequence similarity with the
O. sativa antifungal protein NP_910480 (SEQ ID NO: 14), 41.7%
sequence similarity with the O. sativa protein NP_910482 (SEQ ID
NO: 16), 56.9% similarity with the O. sativa protein NP_921091 (SEQ
ID NO: 17) and 42.1% sequence similarity with the O. sativa protein
NP_910483 (SEQ ID NO: 15). Furthermore, SEQ ID NO: 3 shares
approximately 42.8% sequence similarity with the H. vulgare protein
AAG37354 (SEQ ID NO: 18).
[0058] The NBS-LRR group of R-genes is the largest class of R-genes
discovered to date. In Arabidopsis thaliana, over 150 are predicted
to be present in the genome (Meyers, et al., (2003), Plant Cell,
15:809-834; Monosi, et al., (2004), Theoretical and Applied
Genetics, 109:1434-1447), while in rice, approximately 500 NBS-LRR
genes have been predicted (Monosi, (2004) supra). The NBS-LRR class
of R genes is comprised of two subclasses. Class 1 NBS-LRR genes
contain a TIR-Toll/Interleukin-1 like domain at their N' terminus;
which to date have only been found in dicots (Meyers, (2003) supra;
Monosi, (2004) supra). The second class of NBS-LRR contain either a
coiled-coil domain or an (nt) domain at their N terminus (Bai, et
al., (2002) Genome Research, 12:1871-1884; Monosi, (2004) supra;
Pan, et al., (2000), Journal of Molecular Evolution, 50:203-213).
Class 2 NBS-LRR have been found in both dicot and monocot species.
(Bai, (2002) supra; Meyers, (2003) supra; Monosi, (2004) supra;
Pan, (2000) supra).
[0059] The NBS domain of the gene appears to have a role in
signaling in plant defense mechanisms (van der Biezen, et al.,
(1998), Current Biology: CB, 8:R226-R227). The LRR region appears
to be the region that interacts with the pathogen AVR products
(Michelmore, et al., (1998), Genome Res., 8:1113-1130; Meyers,
(2003) supra). This LRR region in comparison with the NBS domain is
under a much greater selection pressure to diversify (Michelmore,
(1998) supra; Meyers, (2003) supra; Palomino, et al., (2002),
Genome Research, 12:1305-1315). LRR domains are found in other
contexts as well; these 20-29-residue motifs are present in tandem
arrays in a number of proteins with diverse functions, such as
hormone--receptor interactions, enzyme inhibition, cell adhesion
and cellular trafficking. A number of recent studies revealed the
involvement of LRR proteins in early mammalian development, neural
development, cell polarization, regulation of gene expression and
apoptosis signaling.
[0060] The gene of the embodiments is clearly related to the
NBS-LRR of the class 2 family, but does not completely fit the
classical mold. The amino end has homology to so-called nucleotide
binding sites (NBS). There is a leucine rich region as well,
located, as expected, downstream of the NBS. However, unlike
previously studied NBS-LRR proteins, the leucine rich region lacks
the systematic repetitive nature found in more classical LRR
domains, much less consistently following the typical Lxx repeat
pattern and in particular having no instances of the consensus
sequences described by Wang et al. ((1999) Plant J. 19:55-64; see
especially, FIG. 5) or Bryan et al. ((2000), Plant Cell
12:2033-2045; see especially, FIG. 3).
[0061] As the LRR region is the receptor portion of an NBS-LRR,
when a new LRR such as that of this disclosure is found, the range
of its activity, that is, the range of pathogens to which it will
respond, is not immediately obvious from the sequence. The gene of
the embodiments was isolated on the basis of the Cg resistance
phenotype, and therefore the novel LRR responds to Cg. However, it
is not excluded that it responds to other pathogens not tested in
the work done heretofore.
[0062] The nucleic acids and polypeptides of the embodiments find
use in methods for conferring or enhancing fungal resistance to a
plant. Accordingly, the compositions and methods disclosed herein
are useful in protecting plants from fungal pathogens. "Pathogen
resistance," "fungal resistance," and "disease resistance" are
intended to mean that the plant avoids the disease symptoms that
are the outcome of plant-pathogen interactions. That is, pathogens
are prevented from causing plant diseases and the associated
disease symptoms, or alternatively, the disease symptoms caused by
the pathogen are minimized or lessened, such as, for example, the
reduction of stress and associated yield loss. One of skill in the
art will appreciate that the compositions and methods disclosed
herein can be used with other compositions and methods available in
the art for protecting plants from pathogen attack.
[0063] Hence, the methods of the embodiments can be utilized to
protect plants from disease, particularly those diseases that are
caused by plant fungal pathogens. As used herein, "fungal
resistance" refers to enhanced resistance or tolerance to a fungal
pathogen when compared to that of a wild type plant. Effects may
vary from a slight increase in tolerance to the effects of the
fungal pathogen (e.g., partial inhibition) to total resistance such
that the plant is unaffected by the presence of the fungal
pathogen. An increased level of resistance against a particular
fungal pathogen or against a wider spectrum of fungal pathogens
constitutes "enhanced" or improved fungal resistance. The
embodiments of the invention also will enhance or improve fungal
plant pathogen resistance, such that the resistance of the plant to
a fungal pathogen or pathogens will increase. The term "enhance"
refers to improve, increase, amplify, multiply, elevate, raise, and
the like. Herein, plants of the invention are described as being
resistant to infection by Cg or having `enhanced resistance` to
infection by Cg as a result of the Rcg1 locus of the invention.
Accordingly, they typically exhibit increased resistance to the
disease when compared to equivalent plants that are susceptible to
infection by Cg because they lack the Rcg1 locus. For example,
using the scoring system described in Example 11 (also see FIG.
20), they typically exhibit a one point, two point or three point
or more decrease in the infection score, or even a reduction of the
score to 1 or 0, when compared to equivalent plants that are
susceptible to infection by Cg because they lack the Rcg1 locus
[0064] In particular aspects, methods for conferring or enhancing
fungal resistance in a plant comprise introducing into a plant at
least one expression cassette, wherein the expression cassette
comprises a nucleotide sequence encoding an antifungal polypeptide
of the embodiments operably linked to a promoter that drives
expression in the plant. The plant expresses the polypeptide,
thereby conferring fungal resistance upon the plant, or improving
the plant's inherent level of resistance. In particular
embodiments, the gene confers resistance to the fungal pathogen,
Cg.
[0065] Expression of an antifungal polypeptide of the embodiments
may be targeted to specific plant tissues where pathogen resistance
is particularly important, such as, for example, the leaves, roots,
stalks, or vascular tissues. Such tissue-preferred expression may
be accomplished by root-preferred, leaf-preferred, vascular
tissue-preferred, stalk-preferred, or seed-preferred promoters.
[0066] As used herein, "nucleic acid" includes reference to a
deoxyribonucleotide or ribonucleotide polymer in either single- or
double-stranded form, and unless otherwise limited, encompasses
known analogues (e.g., peptide nucleic acids) having the essential
nature of natural nucleotides in that they hybridize to
single-stranded nucleic acids in a manner similar to naturally
occurring nucleotides.
[0067] The terms "polypeptide," "peptide," and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residues is an artificial chemical analogue of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers. Polypeptides of the
embodiments can be produced either from a nucleic acid disclosed
herein, or by the use of standard molecular biology techniques. For
example, a truncated protein of the embodiments can be produced by
expression of a recombinant nucleic acid of the embodiments in an
appropriate host cell, or alternatively by a combination of ex vivo
procedures, such as protease digestion and purification.
[0068] As used herein, the terms "encoding" or "encoded" when used
in the context of a specified nucleic acid mean that the nucleic
acid comprises the requisite information to direct translation of
the nucleotide sequence into a specified protein. The information
by which a protein is encoded is specified by the use of codons. A
nucleic acid encoding a protein may comprise non-translated
sequences (e.g., introns) within translated regions of the nucleic
acid or may lack such intervening non-translated sequences (e.g.,
as in cDNA).
[0069] The embodiments of the invention encompass isolated or
substantially purified polynucleotide or protein compositions. An
"isolated" or "purified" polynucleotide or protein, or biologically
active portion thereof, is substantially or essentially free from
components that normally accompany or interact with the
polynucleotide or protein as found in its naturally occurring
environment. Thus, an isolated or purified polynucleotide or
protein is substantially free of other cellular material, or
culture medium when produced by recombinant techniques (e.g. PCR
amplification), or substantially free of chemical precursors or
other chemicals when chemically synthesized. Optimally, an
"isolated" polynucleotide is free of sequences (for example,
protein encoding sequences) that naturally flank the polynucleotide
(i.e., sequences located at the 5' and 3' ends of the
polynucleotide) in the genomic DNA of the organism from which the
polynucleotide is derived. For example, in various embodiments, the
isolated polynucleotide can contain less than about 5 kb, about 4
kb, about 3 kb, about 2 kb, about 1 kb, about 0.5 kb, or about 0.1
kb of nucleotide sequence that naturally flank the polynucleotide
in genomic DNA of the cell from which the polynucleotide is
derived. A protein that is substantially free of cellular material
includes preparations of protein having less than about 30%, about
20%, about 10%, about 5%, or about 1% (by dry weight) of
contaminating protein. When the protein of the embodiments, or a
biologically active portion thereof, is recombinantly produced,
optimally culture medium represents less than about 30%, about 20%,
about 10%, about 5%, or about 1% (by dry weight) of chemical
precursors or non-protein-of-interest chemicals.
[0070] Fragments and variants of the disclosed nucleotide sequences
and proteins encoded thereby are also encompassed by the
embodiments. "Fragment" is intended to mean a portion of the
nucleotide sequence or a portion of the amino acid sequence and
hence protein encoded thereby. Fragments of a nucleotide sequence
may encode protein fragments that retain the biological activity of
the native protein and hence have the ability to confer fungal
resistance upon a plant. Alternatively, fragments of a nucleotide
sequence that are useful as hybridization probes do not necessarily
encode fragment proteins retaining biological activity. Thus,
fragments of a nucleotide sequence may range from at least about 15
nucleotides, about 50 nucleotides, about 100 nucleotides, and up to
the full-length nucleotide sequence encoding the polypeptides of
the embodiments.
[0071] A fragment of a nucleotide sequence that encodes a
biologically active portion of a polypeptide of the embodiments
will encode at least about 15, about 25, about 30, about 40, or
about 50 contiguous amino acids, or up to the total number of amino
acids present in a full-length polypeptide of the embodiments (for
example, 980 amino acids for the peptide encoded by SEQ ID NO:1).
Fragments of a nucleotide sequence that are useful as hybridization
probes or PCR primers generally need not encode a biologically
active portion of a protein.
[0072] As used herein, "full-length sequence," in reference to a
specified polynucleotide, means having the entire nucleic acid
sequence of a native sequence. "Native sequence" is intended to
mean an endogenous sequence, i.e., a non-engineered sequence found
in an organism's genome.
[0073] Thus, a fragment of a nucleotide sequence of the embodiments
may encode a biologically active portion of a polypeptide, or it
may be a fragment that can be used as a hybridization probe or PCR
primer using methods disclosed below. A biologically active portion
of an antipathogenic polypeptide can be prepared by isolating a
portion of one of the nucleotide sequences of the embodiments,
expressing the encoded portion of the protein and assessing the
ability of the encoded portion of the protein to confer or enhance
fungal resistance in a plant. Nucleic acid molecules that are
fragments of a nucleotide sequence of the embodiments comprise at
least about 15, about 20, about 50, about 75, about 100, or about
150 nucleotides, or up to the number of nucleotides present in a
full-length nucleotide sequence disclosed herein (for example, 4212
nucleotides for SEQ ID NO: 1).
[0074] "Variants" is intended to mean substantially similar
sequences. For polynucleotides, a variant comprises a deletion
and/or addition of one or more nucleotides at one or more internal
sites within the native polynucleotide and/or a substitution of one
or more nucleotides at one or more sites in the native
polynucleotide. As used herein, a "native" polynucleotide or
polypeptide comprises a naturally occurring nucleotide sequence or
amino acid sequence, respectively. One of skill in the art will
recognize that variants of the nucleic acids of the embodiments
will be constructed such that the open reading frame is maintained.
For polynucleotides, conservative variants include those sequences
that, because of the degeneracy of the genetic code, encode the
amino acid sequence of one of the polypeptides of the embodiments.
Naturally occurring allelic variants such as these can be
identified with the use of well-known molecular biology techniques,
as, for example, with polymerase chain reaction (PCR) and
hybridization techniques as outlined below. Variant polynucleotides
also include synthetically derived polynucleotides, such as those
generated, for example, by using site-directed mutagenesis but
which still encode a protein of the embodiments. Generally,
variants of a particular polynucleotide of the embodiments will
have at least about 40%, about 45%, about 50%, about 55%, about
60%, about 65%, about 70%, about 75%, about 80%, about 85%, about
90%, about 91%, about 92%, about 93%, about 94%, about 95%, about
96%, about 97%, about 98%, about 99% or more sequence identity to
that particular polynucleotide as determined by sequence alignment
programs and parameters described elsewhere herein.
[0075] Variants of a particular polynucleotide of the embodiments
(i.e., the reference polynucleotide) can also be evaluated by
comparison of the percent sequence identity between the polypeptide
encoded by a variant polynucleotide and the polypeptide encoded by
the reference polynucleotide. Thus, for example, isolated
polynucleotides that encode a polypeptide with a given percent
sequence identity to the polypeptide of SEQ ID NO: 3 are disclosed.
Percent sequence identity between any two polypeptides can be
calculated using sequence alignment programs and parameters
described elsewhere herein. Where any given pair of polynucleotides
of the embodiments is evaluated by comparison of the percent
sequence identity shared by the two polypeptides they encode, the
percent sequence identity between the two encoded polypeptides is
at least about 40%, about 45%, about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98%, about 99% or more sequence identity.
[0076] "Variant" protein is intended to mean a protein derived from
the native protein by deletion or addition of one or more amino
acids at one or more internal sites in the native protein and/or
substitution of one or more amino acids at one or more sites in the
native protein. Variant proteins encompassed by the embodiments are
biologically active, that is they continue to possess the desired
biological activity of the native protein, that is, the ability to
confer or enhance plant fungal pathogen resistance as described
herein. Such variants may result, for example, from genetic
polymorphism or from human manipulation. Biologically active
variants of a native protein of the embodiments will have at least
about 40%, about 45%, about 50%, about 55%, about 60%, about 65%,
about 70%, about 75%, about 80%, about 85%, about 90%, about 91%,
about 92%, about 93%, about 94%, about 95%, about 96%, about 97%,
about 98%, about 99% or more sequence identity to the amino acid
sequence for the native protein as determined by sequence alignment
programs and parameters described elsewhere herein. A biologically
active variant of a protein of the embodiments may differ from that
protein by as few as about 1-15 amino acid residues, as few as
about 1-10, such as about 6-10, as few as about 5, as few as 4, 3,
2, or even 1 amino acid residue.
[0077] The proteins of the embodiments may be altered in various
ways including amino acid substitutions, deletions, truncations,
and insertions. Methods for such manipulations are generally known
in the art. For example, amino acid sequence variants and fragments
of the antipathogenic proteins can be prepared by mutations in the
DNA. Methods for mutagenesis and polynucleotide alterations are
well known in the art. See, for example, Kunkel (1985) Proc. Natl.
Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol.
154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds.
(1983) Techniques in Molecular Biology (MacMillan Publishing
Company, New York) and the references cited therein. Guidance as to
appropriate amino acid substitutions that do not affect biological
activity of the protein of interest may be found in the model of
Dayhoff et al. (1978) Atlas of Protein Sequence and Structure
(Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated
by reference. Conservative substitutions, such as exchanging one
amino acid with another having similar properties, may be
optimal.
[0078] Thus, the genes and polynucleotides of the embodiments
include both naturally occurring sequences as well as mutant forms.
Likewise, the proteins of the embodiments encompass both naturally
occurring proteins as well as variations and modified forms
thereof. Such variants will continue to possess the desired ability
to confer or enhance plant fungal pathogen resistance. Obviously,
the mutations that will be made in the DNA encoding the variant
must not place the sequence out of reading frame and optimally will
not create complementary regions that could produce secondary mRNA
structure. See, EP Patent No. 0075444.
[0079] The deletions, insertions, and substitutions of the protein
sequences encompassed herein are not expected to produce radical
changes in the characteristics of the protein. However, when it is
difficult to predict the exact effect of the substitution,
deletion, or insertion in advance of doing so, one skilled in the
art will appreciate that the effect will be evaluated by screening
transgenic plants which have been transformed with the variant
protein to ascertain the effect on the ability of the plant to
resist fungal pathogenic attack.
[0080] Variant polynucleotides and proteins also encompass
sequences and proteins derived from mutagenic or recombinogenic
procedures, including and not limited to procedures such as DNA
shuffling. One of skill in the art could envision modifications
that would alter the range of pathogens to which the protein
responds. With such a procedure, one or more different protein
coding sequences can be manipulated to create a new protein
possessing the desired properties. In this manner, libraries of
recombinant polynucleotides are generated from a population of
related sequence polynucleotides comprising sequence regions that
have substantial sequence identity and can be homologously
recombined in vitro or in vivo. For example, using this approach,
sequence motifs encoding a domain of interest may be shuffled
between the protein gene of the embodiments and other known protein
genes to obtain a new gene coding for a protein with an improved
property of interest, such as increased ability to confer or
enhance plant fungal pathogen resistance. Strategies for such DNA
shuffling are known in the art. See, for example, Stemmer (1994)
Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer (1994) Nature
370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438;
Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997)
Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998)
Nature 391:288-291; and U.S. Pat. Nos. 5,605,793 and 5,837,458.
[0081] The polynucleotides of the embodiments can be used to
isolate corresponding sequences from other organisms, particularly
other plants. In this manner, methods such as PCR, hybridization,
and the like can be used to identify such sequences based on their
sequence homology to the sequences set forth herein. Sequences
isolated based on their sequence identity to the entire sequences
set forth herein or to variants and fragments thereof are
encompassed by the embodiments. Such sequences include sequences
that are orthologs of the disclosed sequences. "Orthologs" is
intended to mean genes derived from a common ancestral gene and
which are found in different species as a result of speciation.
Genes found in different species are considered orthologs when
their nucleotide sequences and/or their encoded protein sequences
share at least about 60%, about 70%, about 75%, about 80%, about
85%, about 90%, about 91%, about 92%, about 93%, about 94%, about
95%, about 96%, about 97%, about 98%, about 99%, or greater
sequence identity. Functions of orthologs are often highly
conserved among species. Thus, isolated polynucleotides that encode
for a protein that confers or enhances fungal plant pathogen
resistance and that hybridize under stringent conditions to the
sequences disclosed herein, or to variants or fragments thereof,
are encompassed by the embodiments.
[0082] In a PCR approach, oligonucleotide primers can be designed
for use in PCR reactions to amplify corresponding DNA sequences
from cDNA or genomic DNA extracted from any organism of interest.
Methods for designing PCR primers and PCR cloning are generally
known in the art and are disclosed in Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.). See also Innis et al., eds.
(1990) PCR Protocols: A Guide to Methods and Applications (Academic
Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies
(Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR
Methods Manual (Academic Press, New York). Known methods of PCR
include, and are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers,
partially-mismatched primers, and the like.
[0083] In hybridization techniques, all or part of a known
polynucleotide is used as a probe that selectively hybridizes to
other corresponding polynucleotides present in a population of
cloned genomic DNA fragments or cDNA fragments (i.e., genomic or
cDNA libraries) from a chosen organism. The hybridization probes
may be genomic DNA fragments, cDNA fragments, RNA fragments, or
other oligonucleotides, and may be labeled with a detectable group
such as .sup.32P, or any other detectable marker. Thus, for
example, probes for hybridization can be made by labeling synthetic
oligonucleotides based on the polynucleotides of the embodiments.
Methods for preparation of probes for hybridization and for
construction of cDNA and genomic libraries are generally known in
the art and are disclosed in Sambrook et al. (1989) supra.
[0084] For example, an entire polynucleotide disclosed herein, or
one or more portions thereof, may be used as a probe capable of
specifically hybridizing to corresponding polynucleotides and
messenger RNAs. To achieve specific hybridization under a variety
of conditions, such probes include sequences that are unique and
are optimally at least about 10 nucleotides in length, at least
about 15 nucleotides in length, or at least about 20 nucleotides in
length. Such probes may be used to amplify corresponding
polynucleotides from a chosen organism by PCR. This technique may
be used to isolate additional coding sequences from a desired
organism or as a diagnostic assay to determine the presence of
coding sequences in an organism. Hybridization techniques include
hybridization screening of plated DNA libraries (either plaques or
colonies; see, for example, Sambrook et al. (1989) supra.
[0085] Hybridization of such sequences may be carried out under
stringent conditions. By "stringent conditions" or "stringent
hybridization conditions" is intended conditions under which a
probe will hybridize to its target sequence to a detectably greater
degree than to other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances. By controlling the
stringency of the hybridization and/or washing conditions, target
sequences that are 100% complementary to the probe can be
identified (homologous probing). Alternatively, stringency
conditions can be adjusted to allow some mismatching in sequences
so that lower degrees of similarity are detected (heterologous
probing). Generally, a probe is less than about 1000 nucleotides in
length, optimally less than 500 nucleotides in length.
[0086] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a final wash in 0.1.times.SSC at
60 to 65.degree. C. for at least 30 minutes. Optionally, wash
buffers may comprise about 0.1% to about 1% SDS. Duration of
hybridization is generally less than about 24 hours, usually about
4 to about 12 hours. The duration of the wash time will be at least
a length of time sufficient to reach equilibrium.
[0087] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
thermal melting point (T.sub.m) can be approximated from the
equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284:
T.sub.m=81.5.degree. C.+16.6 (log M)+0.41 (% GC)-0.61 (%
form)-500/L; where M is the molarity of monovalent cations, % GC is
the percentage of guanosine and cytosine nucleotides in the DNA, %
form is the percentage of formamide in the hybridization solution,
and L is the length of the hybrid in base pairs. The T.sub.m is the
temperature (under defined ionic strength and pH) at which 50% of a
complementary target sequence hybridizes to a perfectly matched
probe. T.sub.m is reduced by about 1.degree. C. for each 1% of
mismatching; thus, T.sub.m, hybridization, and/or wash conditions
can be adjusted to hybridize to sequences of the desired identity.
For example, if sequences with .gtoreq.90% identity are sought, the
T.sub.m can be decreased 10.degree. C. Generally, stringent
conditions are selected to be about 5.degree. C. lower than the
T.sub.m for the specific sequence and its complement at a defined
ionic strength and pH. However, severely stringent conditions can
utilize a hybridization and/or wash at 1, 2, 3, or 4.degree. C.
lower than the T.sub.m; moderately stringent conditions can utilize
a hybridization and/or wash at 6, 7, 8, 9, or 10.degree. C. lower
than the T.sub.m; low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the T.sub.m. Using the equation, hybridization and wash
compositions, and desired T.sub.m, those of ordinary skill will
understand that variations in the stringency of hybridization
and/or wash solutions are inherently described. If the desired
degree of mismatching results in a T.sub.m of less than 45.degree.
C. (aqueous solution) or 32.degree. C. (formamide solution), it is
optimal to increase the SSC concentration so that a higher
temperature can be used. An extensive guide to the hybridization of
nucleic acids is found in Tijssen (1993) Laboratory Techniques in
Biochemistry and Molecular Biology--Hybridization with Nucleic Acid
Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al.,
eds. (1995) Current Protocols in Molecular Biology, Chapter 2
(Greene Publishing and Wiley-Interscience, New York). See Sambrook
et al. (1989) supra.
[0088] Various procedures can be used to check for the presence or
absence of a particular sequence of DNA, RNA, or a protein. These
include, for example, Southern blots, northern blots, western
blots, and ELISA analysis. Techniques such as these are well known
to those of skill in the art and many references exist which
provide detailed protocols. Such references include Sambrook et al.
(1989) supra, and Crowther, J. R. (2001), The ELISA Guidebook,
Humana Press, Totowa, N.J., USA.
[0089] The following terms are used to describe the sequence
relationships between two or more polynucleotides or polypeptides:
(a) "reference sequence," (b) "comparison window," (c) "sequence
identity," and, (d) "percentage of sequence identity."
[0090] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0091] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two polynucleotides. Generally, the
comparison window is at least about 20 contiguous nucleotides in
length, and optionally can be about 30, about 40, about 50, about
100, or longer. Those of skill in the art understand that to avoid
a high similarity to a reference sequence due to inclusion of gaps
in the polynucleotide sequence a gap penalty is typically
introduced and is subtracted from the number of matches.
[0092] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent sequence
identity between any two sequences can be accomplished using a
mathematical algorithm. Non-limiting examples of such mathematical
algorithms are the algorithm of Myers and Miller (1988) CABIOS
4:11-17; the local alignment algorithm of Smith et al. (1981) Adv.
Appl. Math. 2:482; the global alignment algorithm of Needleman and
Wunsch (1970) J. Mol. Biol. 48:443-453; the search-for-local
alignment method of Pearson and Lipman (1988) Proc. Natl. Acad.
Sci. 85:2444-2448; the algorithm of Karlin and Altschul (1990)
Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and
Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
[0093] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, and are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics
Software Package, Version 10 (available from Accelrys Inc., 9685
Scranton Road, San Diego, Calif., USA). Alignments using these
programs can be performed using the default parameters. The CLUSTAL
program is well described by Higgins et al. (1988) Gene 73:237-244
(1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet et al.
(1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) CABIOS
8:155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24:307-331.
The ALIGN program is based on the algorithm of Myers and Miller
(1988) supra. A PAM120 weight residue table, a gap length penalty
of 12, and a gap penalty of 4 can be used with the ALIGN program
when comparing amino acid sequences. The BLAST programs of Altschul
et al (1990) J. Mol. Biol. 215:403 are based on the algorithm of
Karlin and Altschul (1990) supra. BLAST nucleotide searches can be
performed with the BLASTN program, score=100, wordlength=12, to
obtain nucleotide sequences homologous to a nucleotide sequence
encoding a protein of the embodiments. BLAST protein searches can
be performed with the BLASTX program, score=50, wordlength=3, to
obtain amino acid sequences homologous to a protein or polypeptide
of the embodiments. To obtain gapped alignments for comparison
purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described
in Altschul et al. (1997) Nucleic Acids Res. 25:3389.
Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an
iterated search that detects distant relationships between
molecules. See Altschul et al. (1997) supra. When utilizing BLAST,
Gapped BLAST, PSI-BLAST, the default parameters of the respective
programs (e.g., BLASTN for nucleotide sequences, BLASTX for
proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may also
be performed manually by inspection.
[0094] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using GAP Version 10
using the following parameters: % identity and % similarity for a
nucleotide sequence using Gap Weight of 50 and Length Weight of 3,
and the nwsgapdna.cmp scoring matrix; % identity and % similarity
for an amino acid sequence using Gap Weight of 8 and Length Weight
of 2, and the BLOSUM62 scoring matrix; or any equivalent program
thereof. By "equivalent program" is intended any sequence
comparison program that, for any two sequences in question,
generates an alignment having identical nucleotide or amino acid
residue matches and an identical percent sequence identity when
compared to the corresponding alignment generated by GAP Version
10.
[0095] GAP uses the algorithm of Needleman and Wunsch (1970) J.
Mol. Biol. 48:443-453, to find the alignment of two complete
sequences that maximizes the number of matches and minimizes the
number of gaps. GAP considers all possible alignments and gap
positions and creates the alignment with the largest number of
matched bases and the fewest gaps. It allows for the provision of a
gap creation penalty and a gap extension penalty in units of
matched bases. GAP must make a profit of gap creation penalty
number of matches for each gap it inserts. If a gap extension
penalty greater than zero is chosen, GAP must, in addition, make a
profit for each gap inserted of the length of the gap times the gap
extension penalty. Default gap creation penalty values and gap
extension penalty values in Version 10 of the GCG Wisconsin
Genetics Software Package for protein sequences are 8 and 2,
respectively. For nucleotide sequences the default gap creation
penalty is 50 while the default gap extension penalty is 3. The gap
creation and gap extension penalties can be expressed as an integer
selected from the group of integers consisting of from 0 to 200.
Thus, for example, the gap creation and gap extension penalties can
be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65 or greater.
[0096] GAP presents one member of the family of best alignments.
There may be many members of this family, and no other member has a
better quality. GAP displays four figures of merit for alignments:
Quality, Ratio, Identity, and Similarity. The Quality is the metric
maximized in order to align the sequences. Ratio is the quality
divided by the number of bases in the shorter segment. Percent
Identity is the percent of the symbols that actually match. Percent
Similarity is the percent of the symbols that are similar. Symbols
that are across from gaps are ignored. A similarity is scored when
the scoring matrix value for a pair of symbols is greater than or
equal to 0.50, the similarity threshold. The scoring matrix used in
Version 10 of the GCG Wisconsin Genetics Software Package is
BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci.
USA 89:10915).
[0097] (c) As used herein, "sequence identity" or "identity" in the
context of two polynucleotides or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity." Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0098] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0099] The use of the term "polynucleotide" is not intended to
limit the embodiments to polynucleotides comprising DNA. Those of
ordinary skill in the art will recognize that polynucleotides can
comprise ribonucleotides and combinations of ribonucleotides and
deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides
include both naturally occurring molecules and synthetic analogues.
The polynucleotides of the embodiments also encompass all forms of
sequences including, and not limited to, single-stranded forms,
double-stranded forms, and the like.
[0100] Isolated polynucleotides of the embodiments can be
incorporated into recombinant DNA constructs capable of
introduction into and replication in a host cell. A "vector" may be
such a construct that includes a replication system and sequences
that are capable of transcription and translation of a
polypeptide-encoding sequence in a given host cell. A number of
vectors suitable for stable transfection of plant cells or for the
establishment of transgenic plants have been described in, e.g.,
Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp.
1987; Weissbach and Weissbach, Methods for Plant Molecular Biology,
Academic Press, 1989; and Flevin et al., Plant Molecular Biology
Manual, Kluwer Academic Publishers, 1990. Typically, plant
expression vectors include, for example, one or more cloned plant
genes under the transcriptional control of 5' and 3' regulatory
sequences and a dominant selectable marker. Such plant expression
vectors also can contain a promoter regulatory region (e.g., a
regulatory region controlling inducible or constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific expression), a transcription initiation start site,
a ribosome binding site, an RNA processing signal, a transcription
termination site, and/or a polyadenylation signal.
[0101] The terms "recombinant construct," "expression cassette,"
"expression construct," "chimeric construct," "construct,"
"recombinant DNA construct" and "recombinant DNA fragment" are used
interchangeably herein and are nucleic acid fragments. A
recombinant construct comprises an artificial combination of
nucleic acid fragments, including, and not limited to, regulatory
and coding sequences that are not found together in nature. For
example, a recombinant DNA construct may comprise regulatory
sequences and coding sequences that are derived from different
sources, or regulatory sequences and coding sequences derived from
the same source and arranged in a manner different than that found
in nature. Such construct may be used by itself or may be used in
conjunction with a vector. If a vector is used then the choice of
vector is dependent upon the method that will be used to transform
host cells as is well known to those skilled in the art. For
example, a plasmid vector can be used. The skilled artisan is well
aware of the genetic elements that must be present on the vector in
order to successfully transform, select and propagate host cells
comprising any of the isolated nucleic acid fragments of the
embodiments. Screening to obtain lines displaying the desired
expression level and pattern of the polynucleotides or of the Rcg1
locus may be accomplished by amplification, Southern analysis of
DNA, northern analysis of mRNA expression, immunoblotting analysis
of protein expression, phenotypic analysis, and the like.
[0102] The term "recombinant DNA construct" refers to a DNA
construct assembled from nucleic acid fragments obtained from
different sources. The types and origins of the nucleic acid
fragments may be very diverse.
[0103] In some embodiments, expression cassettes comprising a
promoter operably linked to a heterologous nucleotide sequence of
the embodiments are further provided. The expression cassettes of
the embodiments find use in generating transformed plants, plant
cells, and microorganisms and in practicing the methods for
inducing plant fungal pathogen resistance disclosed herein. The
expression cassette will include 5' and 3' regulatory sequences
operably linked to a polynucleotide of the embodiments. "Operably
linked" is intended to mean a functional linkage between two or
more elements. "Regulatory sequences" refer to nucleotides located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which may influence
the transcription, RNA processing, stability, or translation of the
associated coding sequence. Regulatory sequences may include, and
are not limited to, promoters, translation leader sequences,
introns, and polyadenylation recognition sequences. For example, an
operable linkage between a polynucleotide of interest and a
regulatory sequence (a promoter, for example) is functional link
that allows for expression of the polynucleotide of interest.
Operably linked elements may be contiguous or non-contiguous. When
used to refer to the joining of two protein coding regions, by
operably linked is intended that the coding regions are in the same
reading frame. The cassette may additionally contain at least one
additional gene to be cotransformed into the organism.
Alternatively, the additional gene(s) can be provided on multiple
expression cassettes. Such an expression cassette is provided with
a plurality of restriction sites and/or recombination sites for
insertion of the polynucleotide that encodes an antipathogenic
polypeptide to be under the transcriptional regulation of the
regulatory regions. The expression cassette may additionally
contain selectable marker genes.
[0104] The expression cassette will include in the 5'-3' direction
of transcription, a transcriptional initiation region (i.e., a
promoter), translational initiation region, a polynucleotide of the
embodiments, a translational termination region and, optionally, a
transcriptional termination region functional in the host organism.
The regulatory regions (i.e., promoters, transcriptional regulatory
regions, and translational termination regions) and/or the
polynucleotide of the embodiments may be native/analogous to the
host cell or to each other. Alternatively, the regulatory regions
and/or the polynucleotide of the embodiments may be heterologous to
the host cell or to each other. As used herein, "heterologous" in
reference to a sequence is a sequence that originates from a
foreign species, or, if from the same species, is substantially
modified from its native form in composition and/or genomic locus
by deliberate human intervention. For example, a promoter operably
linked to a heterologous polynucleotide is from a species different
from the species from which the polynucleotide was derived, or, if
from the same/analogous species, one or both are substantially
modified from their original form and/or genomic locus, or the
promoter is not the native promoter for the operably linked
polynucleotide.
[0105] The optionally included termination region may be native
with the transcriptional initiation region, may be native with the
operably linked polynucleotide of interest, may be native with the
plant host, or may be derived from another source (i.e., foreign or
heterologous) to the promoter, the polynucleotide of interest, the
host, or any combination thereof. Convenient termination regions
are available from the Ti-plasmid of A. tumefaciens, such as the
octopine synthase and nopaline synthase termination regions. See
also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144;
Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev.
5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et
al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res.
17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res.
15:9627-9639. In particular embodiments, the potato protease
inhibitor II gene (Pin II) terminator is used. See, for example,
Keil et al. (1986) Nucl. Acids Res. 14:5641-5650; and An et al.
(1989) Plant Cell 1:115-122, herein incorporated by reference in
their entirety.
[0106] A number of promoters can be used in the practice of the
embodiments, including the native promoter of the polynucleotide
sequence of interest. The promoters can be selected based on the
desired outcome. A wide range of plant promoters are discussed in
the recent review of Potenza et al. (2004) In Vitro Cell Dev
Biol--Plant 40:1-22, herein incorporated by reference. For example,
the nucleic acids can be combined with constitutive,
tissue-preferred, pathogen-inducible, or other promoters for
expression in plants. Such constitutive promoters include, for
example, the core promoter of the Rsyn7 promoter and other
constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No.
6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature
313:810-812); rice actin (McElroy et al. (1990) Plant Cell
2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol.
12:619-632 and Christensen et al. (1992) Plant Mol. Biol.
18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet.
81:581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS
promoter (U.S. Pat. No. 5,659,026), and the like. Other
constitutive promoters include, for example, U.S. Pat. Nos.
5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680;
5,268,463; 5,608,142; and 6,177,611.
[0107] It may sometimes be beneficial to express the gene from an
inducible promoter, particularly from a pathogen-inducible
promoter. Such promoters include those from pathogenesis-related
proteins (PR proteins), which are induced following infection by a
pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase,
chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J.
Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656;
and Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO
99/43819, herein incorporated by reference.
[0108] Of interest are promoters that result in expression of a
protein locally at or near the site of pathogen infection. See, for
example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton
et al. (1989) Molecular Plant-Microbe Interactions 2:325-331;
Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430;
Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996)
Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al.
(1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad.
Sci. USA 91:2507-2511; Warner et al. (1993) Plant J. 3:191-201;
Siebertz et al. (1989) Plant Cell 1:961-968; U.S. Pat. No.
5,750,386 (nematode-inducible); and the references cited therein.
Of particular interest is the inducible promoter for the maize PRms
gene, whose expression is induced by the pathogen Fusarium
moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol.
Plant Path. 41:189-200).
[0109] Additionally, as pathogens find entry into plants through
wounds or insect damage, a wound-inducible promoter may be used in
the constructions of the embodiments. Such wound-inducible
promoters include potato proteinase inhibitor (pin II) gene (Ryan
(1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature
Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148;
win1 and win2 (Stanford et al. (1989) Mol. Gen. Genet.
215:200-208); systemin (McGurl et al. (1992) Science
225:1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol.
22:783-792; Eckelkamp et al. (1993) FEBS Letters 323:73-76); MPI
gene (Corderok et al. (1994) Plant J. 6(2):141-150); and the like,
herein incorporated by reference.
[0110] Chemical-regulated promoters can be used to modulate the
expression of a gene in a plant through the application of an
exogenous chemical regulator. Depending upon the objective, the
promoter may be a chemical-inducible promoter, where application of
the chemical induces gene expression, or a chemical-repressible
promoter, where application of the chemical represses gene
expression. Chemical-inducible promoters are known in the art and
include, and are not limited to, the maize In2-2 promoter, which is
activated by benzenesulfonamide herbicide safeners, the maize GST
promoter, which is activated by hydrophobic electrophilic compounds
that are used as pre-emergent herbicides, and the tobacco PR-1a
promoter, which is activated by salicylic acid. Other
chemical-regulated promoters of interest include steroid-responsive
promoters (see, for example, the glucocorticoid-inducible promoter
in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425
and McNellis et al. (1998) Plant J. 14(2):247-257) and
tetracycline-inducible and tetracycline-repressible promoters (see,
for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and
U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by
reference.
[0111] Tissue-preferred promoters can be utilized to target
enhanced expression of the polypeptides of the embodiments within a
particular plant tissue. For example, a tissue-preferred promoter
may be used to express a polypeptide in a plant tissue where
disease resistance is particularly important, such as, for example,
the roots, the stalk or the leaves. Tissue-preferred promoters
include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et
al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997)
Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic
Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol.
112(3):1331-1341; Van Camp et al. (1996) Plant Physiol.
112(2):525-535; Canevascini et al. (1996) Plant Physiol.
112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol.
35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196;
Orozco et al. (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka et
al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and
Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters
can be modified, if necessary, for weak expression.
[0112] Vascular tissue-preferred promoters are known in the art and
include those promoters that selectively drive protein expression
in, for example, xylem and phloem tissue. Vascular tissue-preferred
promoters include, and are not limited to, the Prunus serotina
prunasin hydrolase gene promoter (see, e.g., International
Publication No. WO 03/006651), and also those found in U.S. patent
application Ser. No. 10/109,488.
[0113] Stalk-preferred promoters may be used to drive expression of
a polypeptide of the embodiments. Exemplary stalk-preferred
promoters include the maize MS8-15 gene promoter (see, for example,
U.S. Pat. No. 5,986,174 and International Publication No. WO
98/00533), and those found in Graham et al. (1997) Plant Mol Biol
33(4): 729-735..
[0114] Leaf-preferred promoters are known in the art. See, for
example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al.
(1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell
Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18;
Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka
et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.
[0115] Root-preferred promoters are known and can be selected from
the many available from the literature or isolated de novo from
various compatible species. See, for example, Hire et al. (1992)
Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine
synthetase gene); Keller and Baumgartner (1991) Plant Cell
3(10):1051-1061 (root-specific control element in the GRP 1.8 gene
of French bean); Sanger et al. (1990) Plant Mol. Biol.
14(3):433-443 (root-specific promoter of the mannopine synthase
(MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991)
Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic
glutamine synthetase (GS), which is expressed in roots and root
nodules of soybean). See also Bogusz et al. (1990) Plant Cell
2(7):633-641, where two root-specific promoters isolated from
hemoglobin genes from the nitrogen-fixing nonlegume Parasponia
andersonii and the related non-nitrogen-fixing nonlegume Trema
tomentosa are described. The promoters of these genes were linked
to a .beta.-glucuronidase reporter gene and introduced into both
the nonlegume Nicotiana tabacum and the legume Lotus comiculatus,
and in both instances root-specific promoter activity was
preserved. Leach and Aoyagi (1991) describe their analysis of the
promoters of the highly expressed roIC and rolD root-inducing genes
of Agrobacterium rhizogenes (see Plant Science (Limerick)
79(1):69-76). They concluded that enhancer and tissue-preferred DNA
determinants are dissociated in those promoters. Teeri et al.
(1989) used gene fusion to lacZ to show that the Agrobacterium
T-DNA gene encoding octopine synthase is especially active in the
epidermis of the root tip and that the TR2' gene is root specific
in the intact plant and stimulated by wounding in leaf tissue, an
especially desirable combination of characteristics for use with an
insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The
TR1' gene, fused to nptII (neomycin phosphotransferase II) showed
similar characteristics. Additional root-preferred promoters
include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant
Mol. Biol. 29(4):759-772); and rolB promoter (Capana et al. (1994)
Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876;
5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and
5,023,179.
[0116] "Seed-preferred" promoters include both "seed-specific"
promoters (those promoters active during seed development such as
promoters of seed storage proteins) as well as "seed-germinating"
promoters (those promoters active during seed germination). See
Thompson et al. (1989) BioEssays 10:108, herein incorporated by
reference. Such seed-preferred promoters include, and are not
limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa
zein); milps (myo-inositol-1-phosphate synthase) (see WO 00/11177
and U.S. Pat. No. 6,225,529; herein incorporated by reference).
Gamma-zein is a preferred endosperm-specific promoter. Glob-1 is a
preferred embryo-specific promoter. For dicots, seed-specific
promoters include, and are not limited to, bean .beta.-phaseolin,
napin, .beta.-conglycinin, soybean lectin, cruciferin, and the
like. For monocots, seed-specific promoters include, and are not
limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein,
waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO
00/12733, where seed-preferred promoters from end1 and end2 genes
are disclosed; herein incorporated by reference.
[0117] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences that may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. When possible,
the sequence is modified to avoid predicted hairpin secondary mRNA
structures.
[0118] Expression cassettes may additionally contain 5' leader
sequences. Such leader sequences can act to enhance translation.
Translation leaders are known in the art and include: picornavirus
leaders, for example, EMCV leader (Encephalomyocarditis 5'
noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci.
USA 86:6126-6130); potyvirus leaders, for example, TEV leader
(Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238),
MDMV leader (Maize Dwarf Mosaic Virus), and human immunoglobulin
heavy-chain binding protein (BiP) (Macejak et al. (1991) Nature
353:90-94); untranslated leader from the coat protein mRNA of
alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature
325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al.
(1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp.
237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et
al. (1991) Virology 81:382-385). See also, Della-Cioppa et al.
(1987) Plant Physiol. 84:965-968. Other methods known to enhance
translation can also be utilized, for example, introns, and the
like.
[0119] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g., transitions and transversions,
may be involved.
[0120] The expression cassette can also comprise a selectable
marker gene for the selection of transformed cells. Selectable
marker genes are utilized for the selection of transformed cells or
tissues. Marker genes include genes encoding antibiotic resistance,
such as those encoding neomycin phosphotransferase II (NEO) and
hygromycin phosphotransferase (H PT), as well as genes conferring
resistance to herbicidal compounds, such as glufosinate ammonium,
bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).
Additional selectable markers include phenotypic markers such as
.beta.-galactosidase and fluorescent proteins such as green
fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng
85:610-9 and Fetter et al. (2004) Plant Cell/6.215-28), cyan
florescent protein (CYP) (Bolte et al. (2004) J. Cell Science
117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and
yellow florescent protein (PhiYFP.TM. from Evrogen, see, Bolte et
al. (2004) J. Cell Science 117:943-54). For additional selectable
markers, see generally, Yarranton (1992) Curr. Opin. Biotech.
3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA
89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992)
Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon,
pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987)
Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et
al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404; Fuerst et al.
(1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al.
(1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University
of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA
90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356;
Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956;
Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076;
Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653;
Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162;
Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595;
Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993)
Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc.
Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob.
Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of
Experimental Pharmacology, Vol. 78 Springer-Verlag, Berlin); Gill
et al. (1988) Nature 334:721-724. Such disclosures are herein
incorporated by reference.
[0121] The above list of selectable marker genes is not meant to be
limiting. Any selectable marker gene can be used in the
embodiments.
[0122] The gene of the embodiments can be expressed as a transgene
in order to make plants resistant to Cg. Using the different
promoters described elsewhere in this disclosure, this will allow
its expression in a modulated form in different circumstances. For
example, one might desire higher levels of expression in stalks to
enhance resistance to Cg-caused stalk rot. In environments where
Cg-caused leaf blight is more of a problem, lines with higher
expression levels in leaves could be used. However, one can also
insert the entire gene, both native promoter and coding sequence,
as a transgene. Finally, using the gene of the embodiments as a
transgene will allow quick combination with other traits, such as
insect or herbicide resistance.
[0123] In certain embodiments the nucleic acid sequences of the
embodiments can be stacked with any combination of polynucleotide
sequences of interest in order to create plants with a desired
phenotype. This stacking may be accomplished by a combination of
genes within the DNA construct, or by crossing Rcg1 with another
line that comprises the combination. For example, the
polynucleotides of the embodiments may be stacked with any other
polynucleotides of the embodiments, or with other genes. The
combinations generated can also include multiple copies of any one
of the polynucleotides of interest. The polynucleotides of the
embodiments can also be stacked with any other gene or combination
of genes to produce plants with a variety of desired trait
combinations including and not limited to traits desirable for
animal feed such as high oil genes (e.g., U.S. Pat. No. 6,232,529);
balanced amino acids (e.g. hordothionins (U.S. Pat. Nos. 5,990,389;
5,885,801; 5,885,802; and 5,703,409); barley high lysine
(Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO
98/20122); and high methionine proteins (Pedersen et al. (1986) J.
Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; and
Musumura et al. (1989) Plant Mol. Biol. 12: 123)); increased
digestibility (e.g., modified storage proteins (U.S. application
Ser. No. 10/053,410, filed Nov. 7, 2001); and thioredoxins (U.S.
application Ser. No. 10/005,429, filed Dec. 3, 2001)), the
disclosures of which are herein incorporated by reference. The
polynucleotides of the embodiments can also be stacked with traits
desirable for insect, disease or herbicide resistance (e.g.,
Bacillus thuringiensis toxic proteins (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,737,514; 5,723,756; 5,593,881; Geiser et al (1986)
Gene 48:109); lectins (Van Damme et al. (1994) Plant Mol. Biol.
24:825); fumonisin detoxification genes (U.S. Pat. No. 5,792,931);
avirulence and disease resistance genes (Jones et al. (1994)
Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos
et al. (1994) Cell 78:1089); acetolactate synthase (ALS) mutants
that lead to herbicide resistance such as the S4 and/or Hra
mutations; inhibitors of glutamine synthase such as
phosphinothricin or basta (e.g., bar gene); and glyphosate
resistance (EPSPS genes, GAT genes such as those disclosed in U.S.
Patent Application Publication US2004/0082770, also WO02/36782 and
WO03/092360)); and traits desirable for processing or process
products such as high oil (e.g., U.S. Pat. No. 6,232,529); modified
oils (e.g., fatty acid desaturase genes (U.S. Pat. No. 5,952,544;
WO 94/11516)); modified starches (e.g., ADPG pyrophosphorylases
(AGPase), starch synthases (SS), starch branching enzymes (SBE) and
starch debranching enzymes (SDBE)); and polymers or bioplastics
(e.g., U.S. Pat. No. 5,602,321; beta-ketothiolase,
polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase
(Schubert et al. (1988) J. Bacteriol. 170:5837-5847) facilitate
expression of polyhydroxyalkanoates (PHAs)), the disclosures of
which are herein incorporated by reference. One could also combine
the polynucleotides of the embodiments with polynucleotides
providing agronomic traits such as male sterility (e.g., see U.S.
Pat. No. 5,583,210), stalk strength, flowering time, or
transformation technology traits such as cell cycle regulation or
gene targeting (e.g. WO 99/61619; WO 00/17364; WO 99/25821), the
disclosures of which are herein incorporated by reference.
[0124] These stacked combinations can be created by any method
including and not limited to cross breeding plants by any
conventional or TopCross.RTM. methodology, or genetic
transformation. If the traits are stacked by genetically
transforming the plants, the polynucleotide sequences of interest
can be combined at any time and in any order. For example, a
transgenic plant comprising one or more desired traits can be used
as the target to introduce further traits by subsequent
transformation. The traits can be introduced simultaneously in a
co-transformation protocol with the polynucleotides of interest
provided by any combination of transformation cassettes. For
example, if two sequences will be introduced, the two sequences can
be contained in separate transformation cassettes (trans) or
contained on the same transformation cassette (cis). Expression of
the sequences can be driven by the same promoter or by different
promoters. In certain cases, it may be desirable to introduce a
transformation cassette that will suppress the expression of the
polynucleotide of interest. This may be combined with any
combination of other suppression cassettes or overexpression
cassettes to generate the desired combination of traits in the
plant.
[0125] The methods of the embodiments may involve, and are not
limited to, introducing a polypeptide or polynucleotide into a
plant. "Introducing" is intended to mean presenting to the plant
the polynucleotide. In some embodiments, the polynucleotide will be
presented in such a manner that the sequence gains access to the
interior of a cell of the plant, including its potential insertion
into the genome of a plant. The methods of the embodiments do not
depend on a particular method for introducing a sequence into a
plant, only that the polynucleotide gains access to the interior of
at least one cell of the plant. Methods for introducing
polynucleotides into plants are known in the art including, and not
limited to, stable transformation methods, transient transformation
methods, and virus-mediated methods.
[0126] "Transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host organism, resulting in
genetically stable inheritance. Host organisms containing the
transformed nucleic acid fragments are referred to as "transgenic"
organisms. "Host cell" refers the cell into which transformation of
the recombinant DNA construct takes place and may include a yeast
cell, a bacterial cell, and a plant cell. Examples of methods of
plant transformation include Agrobacterium-mediated transformation
(De Blaere et al., 1987, Meth. Enzymol. 143:277) and
particle-accelerated or "gene gun" transformation technology (Klein
et al., 1987, Nature (London) 327:70-73; U.S. Pat. No. 4,945,050),
among others.
[0127] "Stable transformation" is intended to mean that the
nucleotide construct introduced into a plant integrates into the
genome of the plant and is capable of being inherited by the
progeny thereof. "Transient transformation" or "transient
expression" is intended to mean that a polynucleotide is introduced
into the plant and does not integrate into the genome of the plant
or a polypeptide is introduced into a plant.
[0128] Transformation protocols as well as protocols for
introducing polypeptides or polynucleotide sequences into plants
may vary depending on the type of plant or plant cell, i.e.,
monocot or dicot, targeted for transformation. Suitable methods of
introducing polypeptides and polynucleotides into plant cells
include microinjection (Crossway et al. (1986) Biotechniques
4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad.
Sci. USA 83:5602-5606, Agrobacterium-mediated transformation (U.S.
Pat. No. 5,563,055- and 5,981,840), direct gene transfer
(Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic
particle acceleration (see, for example, Sanford et al., U.S. Pat.
Nos. 4,945,050; 5,879,918; 5,886,244; and U.S. Pat. No. 5,932,782;
Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture:
Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag,
Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lec1
transformation (WO 00/28058). Also see, Weissinger et al. (1988)
Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate
Science and Technology 5:27-37 (onion); Christou et al. (1988)
Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988)
Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In
Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al. (1998)
Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990)
Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl.
Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988)
Biotechnology 6:559-563 (maize); U.S. Pat. Nos. 5,240,855;
5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol.
91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839
(maize); Hooykaas-Van Slogteren et al. (1984) Nature (London)
311:763-764; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al.
(1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet
et al. (1985) in The Experimental Manipulation of Ovule Tissues,
ed. Chapman et al. (Longman, N.Y.), pp. 197-209 (pollen); Kaeppler
et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al.
(1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated
transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505
(electroporation); Li et al. (1993) Plant Cell Reports 12:250-255
and Christou and Ford (1995) Annals of Botany 75:407-413 (rice);
Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via
Agrobacterium tumefaciens); all of which are herein incorporated by
reference.
[0129] Methods are known in the art for the targeted insertion of a
polynucleotide at a specific location in the plant genome. In one
embodiment, the insertion of the polynucleotide at a desired
genomic location is achieved using a site-specific recombination
system. See, for example, WO99/25821, WO99/25854, WO99/25840,
WO99/25855, and WO99/25853, all of which are herein incorporated by
reference. Briefly, the polynucleotide of the embodiments can be
contained in transfer cassette flanked by two non-identical
recombination sites. The transfer cassette is introduced into a
plant have stably incorporated into its genome a target site which
is flanked by two non-identical recombination sites that correspond
to the sites of the transfer cassette. An appropriate recombinase
is provided and the transfer cassette is integrated at the target
site. The polynucleotide of interest is thereby integrated at a
specific chromosomal position in the plant genome.
[0130] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting progeny having
constitutive expression of the desired phenotypic characteristic
identified. Two or more generations may be grown to ensure that
expression of the desired phenotypic characteristic is stably
maintained and inherited and then seeds harvested to ensure
expression of the desired phenotypic characteristic has been
achieved. In this manner, the embodiments provides transformed seed
(also referred to as "transgenic seed") having a nucleotide
construct of the embodiments, for example, an expression cassette
of the embodiments, stably incorporated into their genome.
[0131] As used herein, the term "plant" can be a whole plant, any
part thereof, or a cell or tissue culture derived from a plant.
Thus, the term "plant" can refer to any of: whole plants, plant
components or organs (including but not limited to embryos, pollen,
ovules, seeds, leaves, flowers, branches, fruit, kernels, ears,
cobs, husks, stalks, roots, root tips, anthers, and the like),
plant tissues, plant cells, plant protoplasts, plant cell tissue
cultures from which maize plant can be regenerated, plant calli,
plant clumps, and plant seeds. A plant cell is a cell of a plant,
either taken directly from a seed or plant, or derived through
culture from a cell taken from a plant. Grain is intended to mean
the mature seed produced by commercial growers for purposes other
than growing or reproducing the species. Progeny, variants, and
mutants of the regenerated plants are also included within the
scope of the embodiments, provided that these parts comprise the
introduced polynucleotides.
[0132] The embodiments of the invention may be used to confer or
enhance fungal plant pathogen resistance or protect from fungal
pathogen attack in plants, especially corn (Zea mays). It will
protect different parts of the plant from attack by pathogens,
including and not limited to stalks, ears, leaves, roots and
tassels. Other plant species may also be of interest in practicing
the embodiments of the invention, including, and not limited to,
other monocot crop plants.
[0133] Where appropriate, the polynucleotides may be optimized for
increased expression in the transformed organism. For example, the
polynucleotides can be synthesized using plant-preferred codons for
improved expression. See, for example, Campbell and Gowri (1990)
Plant Physiol. 92:1-11 for a discussion of host-preferred codon
usage. Methods are available in the art for synthesizing
plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831,
and 5,436,391, and Murray et al. (1989) Nucleic Acids Res.
17:477-498, herein incorporated by reference.
[0134] The embodiments of the present invention may be effective
against a variety of plant pathogens, particularly fungal
pathogens, such as, for example, Colletotrichum, including Cg. The
embodiments of the present invention may also be effective against
maize stalk rot, including anthracnose stalk rot, wherein the
causative agent is Colletotrichum. Other plant pathogenic fungi and
oomycetes (many of the latter of which have been historically been
considered fungi although modern taxonomists have now classified
them separately) include, and are not limited to, the following:
Soybeans: Phytophthora megasperma f sp. glycinea, Macrophomina
phaseolina, Rhizoctonia solani, Sclerotinia sclerotiorum, Fusarium
oxysporum, Diaporthe phaseolorum var. sojae (Phomopsis sojae),
Diaporthe phaseolorum var. caulivora, Sclerotium rolfsii,
Cercospora kikuchii, Cercospora sojina, Peronospora manshurica,
Colletotrichum dematium (Colletotichum truncaturn), Corynespora
cassiicola, Septoria glycines, Phyllosticta sojicola, Alternaria
alternata, Microsphaera diffusa, Fusarium semitectum, Phialophora
gregata, Glomerella glycines, Phakopsora pachyrhizi, Pythium
aphanidermaturn, Pythium ultimum, Pythium debaryanum, Fusarium
solani; Canola: Albugo candida, Alternaria brassicae, Leptosphaeria
maculans, Rhizoctonia solani, Sclerotinia sclerotiorum,
Mycosphaerella brassiccola, Pythium ultimum, Peronospora
parasitica, Fusarium roseum, Alternaria alternata; Alfalfa: Pythium
ultimum, Pythium irregulare, Pythium splendens, Pythium debaryanum,
Pythium aphanidermaturn, Phytophthora megasperma, Peronospora
trifoliorum, Phoma medicaginis var. medicaginis, Cercospora
medicaginis, Pseudopeziza medicaginis, Leptotrochila medicaginis,
Fusarium oxysporum, Verticillium albo-atrum, Aphanomyces euteiches,
Stemphylium herbarum, Stemphylium alfalfae, Colletotrichum
trifolii, Leptosphaerulina briosiana, Uromyces striatus,
Sclerotinia trifoliorum, Stagnospora meliloti, Stemphylium
botryosum, Leptotrochila medicaginis; Wheat: Urocystis agropyri,
Alternaria alternata, Cladosporium herbarum, Fusarium graminearum,
Fusarium avenaceum, Fusarium culmorum, Ustilago tritici, Ascochyta
tritici, Cephalosporium gramineum, Collotetrichum graminicola,
Erysiphe graminis f. sp. tritici, Puccinia graminis f. sp. tritici,
Puccinia recondita f. sp. tritici, Puccinia striiformis,
Pyrenophora tritici-repentis, Septoria nodorum, Septoria tritici,
Septoria avenae, Pseudocercosporella herpotrichoides, Rhizoctonia
solani, Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici,
Pythium aphanidermatum, Pythium arrhenomanes, Pythium ultimum,
Bipolaris sorokiniana, Claviceps purpurea, Tilletia tritici,
Tilletia laevis, Ustilago tritici, Tilletia indica, Rhizoctonia
solani, Pythium arrhenomannes, Pythium gramicola, Pythium
aphanidermatum; Sunflower: Plasmophora halstedii, Sclerotinia
sclerotiorum, Septoria helianthi, Phomopsis helianthi, Alternaria
helianthi, Alternaria zinniae, Botrytis cinerea, Phoma macdonaldii,
Macrophomina phaseolina, Erysiphe cichoracearum, Rhizopus oryzae,
Rhizopus arrhizus, Rhizopus stolonifer, Puccinia helianthi,
Verticillium dahliae, Erwinia carotovorum pv. carotovora,
Cephalosporium acremonium, Phytophthora cryptogea, Albugo
tragopogonis; Corn: Fusarium moniliforme var. subglutinans, Erwinia
stewartii, Fusarium moniliforme, Gibberella zeae (Fusarium
graminearum), Stenocarpella maydi (Diplodia maydis), Pythium
irregulare, Pythium debaryanum, Pythium graminicola, Pythium
splendens, Pythium ultimum, Pythium aphanidermatum, Aspergillus
flavus, Bipolaris maydis O, T (Cochliobolus heterostrophus),
Helminthosporium carbonum I, II & Ill (Cochliobolus carbonum),
Exserohilum turcicum I, II & Ill, Helminthosporium
pedicellatum, Physoderma maydis, Phyllosticta maydis, Kabatiella
maydis, Cercospora sorghi, Ustilago maydis, Puccinia sorghi,
Puccinia polysora, Macrophomina phaseolina, Penicillium oxalicum,
Nigrospora oryzae, Cladosporium herbarum, Curvularia lunata,
Curvularia inaequalis, Curvularia pallescens, Trichoderma viride,
Claviceps sorghi, Erwinia chrysanthemi pv. zea, Erwinia carotovora,
Diplodia macrospora, Sclerophthora macrospora, Peronosclerospora
sorghi, Peronosclerospora philippinensis, Peronosclerospora maydis,
Peronosclerospora sacchari, Sphacelotheca reiliana, Physopella
zeae, Cephalosporium maydis, Cephalosporium acremonium; Sorghum:
Exserohilum turcicum, Colletotrichum graminicola (Glomerella
graminicola), Cercospora sorghi, Gloeocercospora sorghi, Ascochyta
sorghina, Puccinia purpurea, Macrophomina phaseolina, Perconia
circinata, Fusarium moniliforme, Alternaria altemata, Bipolaris
sorghicola, Helminthosporium sorghicola, Curvularia lunata, Phoma
insidiosa, Ramulispora sorghi, Ramulispora sorghicola, Phyllachara
sacchari, Sporisorium reilianum (Sphacelotheca reiliana),
Sphacelotheca cruenta, Sporisorium sorghi, Claviceps sorghi,
Rhizoctonia solani, Acremonium strictum, Sclerophthona macrospora,
Peronosclerospora sorghi, Peronosclerospora philippinensis,
Sclerospora graminicola, Fusarium graminearum, Fusarium oxysporum,
Pythium arrhenomanes, Pythium graminicola, etc.
[0135] "Germplasm" refers to genetic material of or from an
individual (e.g., a plant), a group of individuals (e.g., a plant
line, variety or family), or a clone derived from a line, variety,
species, or culture. The germplasm can be part of an organism or
cell, or can be separate from the organism or cell. In general,
germplasm provides genetic material with a specific molecular
makeup that provides a physical foundation for some or all of the
hereditary qualities of an organism or cell culture. As used
herein, germplasm includes cells, seed or tissues from which new
plants may be grown, or plant parts, such as leaves, stems, pollen,
or cells, that can be cultured into a whole plant.
[0136] The term "allele" refers to one of two or more different
nucleotide sequences that occur at a specific locus. A first allele
is found on one chromosome, while a second allele occurs at the
same position on the homologue of that chromosome, e.g., as occurs
for different chromosomes of a heterozygous individual, or between
different homozygous or heterozygous individuals in a population. A
"favorable allele" is the allele at a particular locus that
confers, or contributes to, an agronomically desirable phenotype,
e.g., resistance to Cg infection. A favorable allele of a marker is
a marker allele that segregates with the favorable phenotype. A
favorable allelic form of a chromosome segment is a chromosome
segment that includes a nucleotide sequence that contributes to
superior agronomic performance at one or more genetic loci
physically located on the chromosome segment. "Allele frequency"
refers to the frequency (proportion or percentage) of an allele
within a population, or a population of lines. One can estimate the
allele frequency within a population by averaging the allele
frequencies of a sample of individuals from that population.
[0137] An allele "positively" correlates with a trait when it is
linked to it and when presence of the allele is an indicator that
the desired trait or trait form will occur in a plant comprising
the allele. An allele negatively correlates with a trait when it is
linked to it and when presence of the allele is an indicator that a
desired trait or trait form will not occur in a plant comprising
the allele.
[0138] An individual is "homozygous" if the individual has only one
type of allele at a given locus (e.g., a diploid individual has a
copy of the same allele at a locus for each of two homologous
chromosomes). An individual is "heterozygous" if more than one
allele type is present at a given locus (e.g., a diploid individual
with one copy each of two different alleles). A special case of a
heterozygous situation is where one chromosome has an allele of a
gene and the other chromosome lacks that gene, locus or region
completely--in other words, has a deletion relative to the first
chromosome. This situation is referred to as "hemizygous." The term
"homogeneity" indicates that members of a group have the same
genotype at one or more specific loci. In contrast, the term
"heterogeneity" is used to indicate that individuals within the
group differ in genotype at one or more specific loci.
[0139] The embodiments provide not only a gene and its functional
variants for use in transgenic applications, but sequences and
processes that allow the Rcg1 resistance gene to be moved between
corn lines using marker assisted breeding. The embodiments also
relate to plants produced by these processes that retain a
truncated chromosomal interval comprising the Rcg1 resistance
gene.
[0140] A genetic map is a graphical representation of a genome (or
a portion of a genome such as a single chromosome) where the
distances between landmarks on a chromosome are measured by the
recombination frequencies between the landmarks. Recombinations
between genetic landmarks can be detected using a variety of
molecular genetic markers (also called molecular markers) that are
described in more detail herein.
[0141] For markers to be useful at detecting recombinations, they
need to detect differences, or polymorphisms, within the population
being monitored. For molecular markers, this means differences at
the DNA level due to polynucleotide sequence differences (eg SSRs,
RFLPs, FLPs, SNPs). The genomic variability can be of any origin,
for example, insertions, deletions, duplications, repetitive
elements, point mutations, recombination events, or the presence
and sequence of transposable elements. Molecular markers can be
derived from genomic or expressed nucleic acids (e.g., ESTs). ESTs
are generally well conserved within a species, while other regions
of DNA (typically non-coding) tend to accumulate polymorphism, and
therefore, can be more variable between individuals of the same
species. A large number of corn molecular markers are known in the
art, and are published or available from various sources, such as
the Maize GDB internet resource and the Arizona Genomics Institute
internet resource run by the University of Arizona.
[0142] Molecular markers can be used in a variety of plant breeding
applications (eg see Staub et al. (1996) Hortscience 31: 729-741;
Tanksley (1983) Plant Molecular Biology Reporter. 1: 3-8). One of
the main areas of interest is to increase the efficiency of
backcrossing and introgressing genes using marker-assisted
selection (MAS). A molecular marker that demonstrates linkage with
a locus affecting a desired phenotypic trait provides a useful tool
for the selection of the trait in a plant population. This is
particularly true where the phenotype is hard to assay, e.g. many
disease resistance traits, or, occurs at a late stage in the plants
development, e.g. kernel characteristics. Since DNA marker assays
are less laborious, and take up less physical space, than field
phenotyping, much larger populations can be assayed, increasing the
chances of finding a recombinant with the target segment from the
donor line moved to the recipient line. The closer the linkage, the
more useful the marker, as recombination is less likely to occur
between the marker and the gene causing the trait, which can result
in false positives. Having flanking markers decreases the chances
that false positive selection will occur as a double recombination
event would be needed. The ideal situation is to have a marker in
the gene itself, so that recombination can not occur between the
marker and the gene. Such a marker is called a `perfect
marker`.
[0143] When a gene is introgressed by MAS, it is not only the gene
that is introduced but also the flanking regions (Gepts. (2002).
Crop Sci; 42: 1780-1790). This is referred to as "linkage drag." In
the case where the donor plant is highly unrelated to the recipient
plant, as in the case of the Rcg1 locus being introgressed from
MP305, an exotic source, into elite inbreds, these flanking regions
carry additional genes that may code for agronomically undesirable
traits. This "linkage drag" may also result in reduced yield or
other negative agronomic characteristics even after multiple cycles
of backcrossing into the elite corn line. This is also sometimes
referred to as "yield drag." The size of the flanking region can be
decreased by additional backcrossing, although this is not always
successful, as breeders do not have control over the size of the
region or the recombination breakpoints (Young et al. (1998)
Genetics 120:579-585). In classical breeding it is usually only by
chance that recombinations are selected that contribute to a
reduction in the size of the donor segment (Tanksley et al. (1989).
Biotechnology 7: 257-264). Even after 20 backcrosses in backcrosses
of this type, one may expect to find a sizeable piece of the donor
chromosome still linked to the gene being selected. With markers
however, it is possible to select those rare individuals that have
experienced recombination near the gene of interest. In 150
backcross plants, there is a 95% chance that at least one plant
will have experienced a crossover within 1 cM of the gene, based on
a single meiosis map distance. Markers will allow unequivocal
identification of those individuals. With one additional backcross
of 300 plants, there would be a 95% chance of a crossover within 1
cM single meiosis map distance of the other side of the gene,
generating a segment around the target gene of less than 2 cM based
on a single meiosis map distance. This can be accomplished in two
generations with markers, while it would have required on average
100 generations without markers (See Tanksley et al., supra). When
the exact location of a gene is known, a series of flanking markers
surrounding the gene can be utilized to select for recombinations
in different population sizes. For example, in smaller population
sizes recombinations may be expected further away from the gene, so
more distal flanking markers would be required to detect the
recombination.
[0144] The availability of integrated linkage maps of the maize
genome containing increasing densities of public maize markers has
facilitated maize genetic mapping and MAS. See, e.g. the IBM2
Neighbors 4 map [online], [retrieved on 2006-03-21]. Retrieved from
the Internet<URL:
http://www.maizegdb.org/cgi-bin/displaymaprecord.cgi?id=871214>
[0145] The key components to the implementation of MAS are: (i)
Defining the population within which the marker-trait association
will be determined, which can be a segregating population, or a
random or structured population; (ii) monitoring the segregation or
association of polymorphic markers relative to the trait, and
determining linkage or association using statistical methods; (iii)
defining a set of desirable markers based on the results of the
statistical analysis, and (iv) the use and/or extrapolation of this
information to the current set of breeding germplasm to enable
marker-based selection decisions to be made. The three types of
markers described in this disclosure can be used in marker assisted
selection protocols; simple sequence repeat (SSR, also known as
microsatellite) markers, single nucleotide polymorphism (SNP)
markers and fragment length polymorphic (FLP) markers. SSRs can be
defined as relatively short runs of tandemly repeated DNA with
lengths of 6 bp or less (Tautz (1989) Nucleic Acid Research 17:
6463-6471; Wang et al. (1994) Theoretical and Applied Genetics,
88:1-6) Polymorphisms arise due to variation in the number of
repeat units, probably caused by slippage during DNA replication
(Levinson and Gutman (1987) Mol Biol Evol 4: 203-221). The
variation in repeat length may be detected by designing PCR primers
to the conserved non-repetitive flanking regions (Weber and May
(1989) Am J Hum Genet 44:388-396). SSRs are highly suited to
mapping and MAS as they are multi-allelic, codominant, reproducible
and amenable to high throughput automation (Rafalski et al. (1996)
Generating and using DNA markers in plants. In: Non-mammalian
genomic analysis: a practical guide. Academic press. pp
75-135).
[0146] For example, an SSR marker profile of MP305 is provided in
Example 5 herein. This marker profile was generated by gel
electrophoresis of the amplification products generated by the
primer pairs for these markers. Scoring of marker genotype is based
on the size of the amplified fragment, which in this case was
measured by the base pair weight of the fragment. While variation
in the primer used or in laboratory procedures can affect the
reported base pair weight, relative values will remain constant
regardless of the specific primer or laboratory used. Thus, when
comparing lines, the SSR profiles being compared should be obtained
from the same lab, so that the same primers and equipment is used.
For this reason, when comparing plants or lines vis a vis specific
markers, it is preferable to state that such plants or lines have
the same (or different) alleles at specified loci (e.g. one can say
that if a plant does not comprise the MP305 derived chromosomal
interval at or below UMC15a, it will not comprise the same alleles
as MP305 at all of the loci at or below UMC15a listed on Table 6 in
Example 5). An SSR service for corn is available to the public on a
contractual basis by DNA Landmarks in Saint-Jean-sur-Richelieu,
Quebec, Canada.
[0147] Various types of FLP markers can be generated. Most
commonly, amplification primers are used to generate fragment
length polymorphisms. Such FLP markers are in many ways similar to
SSR markers, except that the region amplified by the primers is not
typically a highly repetitive region. Still, the amplified region,
or amplicon, will have sufficient variability among germplasm,
often due to insertions or deletions, such that the fragments
generated by the amplification primers can be distinguished among
polymorphic individuals, and such indels are known to occur
frequently in maize (Bhattramakki et al. (2002). Plant Mol Biol
48,539-547; Rafalski (2002b), supra). The term "indel" refers to an
insertion or deletion, wherein one line may be referred to as
having an insertion relative to a second line, or the second line
may be referred to as having a deletion relative to the first line.
The MZA markers disclosed herein are examples of amplified FLP
markers that have been selected because they are in close proximity
to the Rcg1 gene.
[0148] SNP markers detect single base pair nucleotide
substitutions. Of all the molecular marker types, SNPs are the most
abundant, thus having the potential to provide the highest genetic
map resolution (Bhattramakki et al. 2002 Plant Molecular Biology
48:539-547). SNPs can be assayed at an even higher level of
throughput than SSRs, in a so-called `ultra-high-throughput`
fashion, as they do not require large amounts of DNA and automation
of the assay may be straight-forward. SNPs also have the promise of
being relatively low-cost systems. These three factors together
make SNPs highly attractive for use in MAS. Several methods are
available for SNP genotyping, including but not limited to,
hybridization, primer extension, oligonucleotide ligation, nuclease
cleavage, minisequencing and coded spheres. Such methods have been
reviewed in: Gut (2001) Hum Mutat 17 pp. 475-492; Shi (2001) Clin
Chem 47, pp. 164-172; Kwok (2000) Pharmacogenomics 1, pp. 95-100;
Bhattramakki and Rafalski (2001) Discovery and application of
single nucleotide polymorphism markers in plants. In: R. J. Henry,
Ed, Plant Genotyping: The DNA Fingerprinting of Plants, CABI
Publishing, Wallingford. A wide range of commercially available
technologies utilize these and other methods to interrogate SNPs
including Masscode.TM. (Qiagen), Invader.RTM. (Third Wave
Technologies), SnapShot.RTM. (Applied Biosystems), Taqman.RTM.
(Applied Biosystems) and Beadarrays.TM. (Illumina).
[0149] A number of SNPs together within a sequence, or across
linked sequences, can be used to describe a haplotype for any
particular genotype (Ching et al. (2002), BMC Genet. 3:19 pp Gupta
et al. 2001, Rafalski (2002b), supra). Haplotypes can be more
informative than single SNPs and can be more descriptive of any
particular genotype. For example, a single SNP may be allele `T`
for MP305, but the allele `T` might also occur in the maize
breeding population being utilized for recurrent parents. In this
case, a haplotype, e.g. a series of alleles at linked SNP markers,
may be more informative. Once a unique haplotype has been assigned
to a donor chromosomal region, that haplotype can be used in that
population or any subset thereof to determine whether an individual
has a particular gene. See, for example, WO2003054229. Using
automated high throughput marker detection platforms known to those
of ordinary skill in the art makes this process highly efficient
and effective.
[0150] As described herein, many of the primers listed in Tables 1
and 2 can readily be used as FLP markers to select for the Rcg1
locus. These primers can also be used to convert these markers to
SNP or other structurally similar or functionally equivalent
markers (SSRs, CAPs, indels, etc), in the same regions. One very
productive approach for SNP conversion is described by Rafalski
(2002a) Current opinion in plant biology 5 (2): 94-100 and also
Rafalski (2002b) Plant Science 162: 329-333. Using PCR, the primers
are used to amplify DNA segments from individuals (preferably
inbred) that represent the diversity in the population of interest.
The PCR products are sequenced directly in one or both directions.
The resulting sequences are aligned and polymorphisms are
identified. The polymorphisms are not limited to single nucleotide
polymorphisms (SNPs), but also include indels, CAPS, SSRs, and
VNTRs (variable number of tandem repeats). Specifically with
respect to the fine map information described herein, one can
readily use the information provided herein to obtain additional
polymorphic SNPs (and other markers) within the region amplified by
the primers listed in this disclosure. Markers within the described
map region can be hybridized to BACs or other genomic libraries, or
electronically aligned with genome sequences, to find new sequences
in the same approximate location as the described markers.
[0151] In addition to SSR's, FLPs and SNPs as described above,
other types of molecular markers are also widely used, including
but not limited to expressed sequence tags (ESTs) and SSR markers
derived from EST sequences, and randomly amplified polymorphic DNA
(RAPD). As used herein, the term "Genetic Marker" shall refer to
any type of nucleic acid based marker, including but not limited
to, Restriction Fragment Length Polymorphism (RFLP), Simple
Sequence Repeat (SSR), Random Amplified Polymorphic DNA (RAPD),
Cleaved Amplified Polymorphic Sequences (CAPS) (Rafalski and
Tingey, 1993, Trends in Genetics 9:275-280), Amplified Fragment
Length Polymorphism (AFLP) (Vos et al., 1995, Nucleic Acids Res.
23:4407-4414), Single Nucleotide Polymorphism (SNP) (Brookes, 1999,
Gene 234:177-186), Sequence Characterized Amplified Region (SCAR)
(Paran and Michelmore, 1993, Theor. Appl. Genet. 85:985-993),
Sequence Tagged Site (STS) (Onozaki et al., 2004, Euphytica
138:255-262), Single Stranded Conformation Polymorphism (SSCP)
(Orita et al., 1989, Proc Natl Acad Sci USA 86:2766-2770),
Inter-Simple Sequence Repeat (ISSR) (Blair et al., 1999, Theor.
Appl. Genet. 98:780-792), Inter-Retrotransposon Amplified
Polymorphism (IRAP), Retrotransposon-Microsatellite Amplified
Polymorphism (REMAP) (Kalendar et al., 1999, Theor. Appl. Genet.
98:704-711), an RNA cleavage product (such as a Lynx tag) and the
like.
[0152] More generically, the term "molecular marker" may be used to
refer to a genetic marker, as defined above, or an encoded product
thereof (e.g., a protein) used as a point of reference when
identifying a linked locus. A marker can be derived from genomic
nucleotide sequences or from expressed nucleotide sequences (e.g.,
from a spliced RNA, a cDNA, etc.), or from an encoded polypeptide.
The term also refers to nucleic acid sequences complementary to or
flanking the marker sequences, such as nucleic acids used as probes
or primer pairs capable of amplifying the marker sequence. A
"molecular marker probe" is a nucleic acid sequence or molecule
that can be used to identify the presence of a marker locus, e.g.,
a nucleic acid probe that is complementary to a marker locus
sequence. Alternatively, in some aspects, a marker probe refers to
a probe of any type that is able to distinguish (i.e., genotype)
the particular allele that is present at a marker locus. Nucleic
acids are "complementary" when they specifically hybridize in
solution, e.g., according to Watson-Crick base pairing rules. Some
of the markers described herein are also referred to as
hybridization markers when located on an indel region, such as the
non-collinear region described herein. This is because the
insertion region is, by definition, a polymorphism vis a vis a
plant without the insertion. Thus, the marker need only indicate
whether the indel region is present or absent. Any suitable marker
detection technology may be used to identify such a hybridization
marker, e.g. SNP technology is used in the examples provided
herein.
[0153] A "genomic nucleic acid" is a nucleic acid that corresponds
in sequence to a heritable nucleic acid in a cell. Common examples
include nuclear genomic DNA and amplicons thereof. A genomic
nucleic acid is, in some cases, different from a spliced RNA, or a
corresponding cDNA, in that the spliced RNA or cDNA is processed,
e.g., by the splicing machinery, to remove introns. Genomic nucleic
acids optionally comprise non-transcribed (e.g., chromosome
structural sequences, promoter regions, enhancer regions, etc.)
and/or non-translated sequences (e.g., introns), whereas spliced
RNA/cDNA typically do not have non-transcribed sequences or
introns. A "template nucleic acid" is a nucleic acid that serves as
a template in an amplification reaction (e.g., a polymerase based
amplification reaction such as PCR, a ligase mediated amplification
reaction such as LCR, a transcription reaction, or the like). A
template nucleic acid can be genomic in origin, or alternatively,
can be derived from expressed sequences, e.g., a cDNA or an
EST.
[0154] The term "amplifying" in the context of nucleic acid
amplification is any process whereby additional copies of a
selected nucleic acid (or a transcribed form thereof) are produced.
Typical amplification methods include various polymerase based
replication methods, including the polymerase chain reaction (PCR),
ligase mediated methods such as the ligase chain reaction (LCR) and
RNA polymerase based amplification (e.g., by transcription)
methods. An "amplicon" is an amplified nucleic acid, e.g., a
nucleic acid that is produced by amplifying a template nucleic acid
by any available amplification method (e.g., PCR, LCR,
transcription, or the like).
[0155] Isozyme profiles and linked morphological characteristics
can, in some cases, also be indirectly used as markers. Even though
they do not directly detect DNA differences, they are often
influenced by specific genetic differences. However, markers that
detect DNA variation are far more numerous and polymorphic than
isozyme or morphological markers (Tanksley (1983) Plant Molecular
Biology Reporter 1:3-8).
[0156] Sequence alignments or contigs may also be used to find
sequences upstream or downstream of the specific markers listed
herein. These new sequences, close to the markers described herein,
are then used to discover and develop functionally equivalent
markers.
[0157] For example, different physical and/or genetic maps are
aligned to locate equivalent markers not described within this
disclosure but that are within similar regions. These maps may be
within the maize species, or even across other species that have
been genetically or physically aligned with maize, such as rice,
wheat, barley or sorghum.
[0158] As noted in Example 2, by using common sequences from the
region flanking the Rcg1 locus that hybridized to BACs in the Mo17
and the B73 BAC libraries, the BACs from both libraries were lined
up with BACs from the DE811ASR(BC5) homologous region flanking the
Rcg1 locus in a tiling path as shown in FIG. 9(a). The public B73
BACs, c0113f01 and c0117e18 were identified as directly north and
south, respectively, of the Rcg1 locus.
[0159] With this information, an extended non-contiguous tiling
path of B73 BACs between genetic markers UMC2285 and UMC15a,
UMC2285 and UMC2187, UMC1086 and UMC2200, or UMC2041 and UMC2200,
can be created by aligning genetic markers within this region with
the physical map of the B73 BAC. Alignment information of the
genetic and physical maps of B73 is obtained from the maize genome
database of the Arizona Genomics Institute on the world wide web,
accessed by entering the following web address prefixed by "www.":
genome.arizona.edu/fpc/maize/#webagcol. In the WebChrom view, one
can select the genetic markers in the vicinity of the Rcg1 gene and
get a link to the physical contig where these genetic markers are
located. By aligning the physical map in such way with the genetic
map one can find a plethora of B73 BACs in the region between the
chromosomal intervals defined by genetic markers UMC2285 and
UMC15a, UMC2285 and UMC2187, UMC1086 and UMC2200, or UMC2041 and
UMC2200. The BACs can be used by one of ordinary skill in the art
to develop new markers for introgression of the Rcg1 locus into
maize germplasm. In particular, such genetic markers would be
useful for tracking the Rcg1 locus in any lines into which the Rcg1
locus or Rcg1 gene has been introgressed, and for selecting for
recurrent parent genome in a backcrossing program.
[0160] For example, in order to design polymorphic markers that
will be useful for introgression and selection of the Rcg1 gene or
locus in other maize germplasm, sequence information of the region
surrounding the Rcg1 locus can be used. There are many B73 derived
bacterial artificial chromosomes (BACs) available in the region of
interest from which sequence information can be obtained. An
example of BACs in the region of interest is shown in FIG. 21,
which shows a contig on the B73 physical map that is homologous to
the Rcg1 region in DE811ASR (BC5) [FIG. 21 retrieved 2006-03-10].
Retrieved from the Internet <URL:
http://www.genome.arizona.edu/cgi-bin//WebAGCoL/WebFPC/WebFPC_Direct_v2.1-
.cgi?name=maize&contig=187&mark er=ssu1>. Sequence
information is obtained either through information that is already
publicly available (e.g. BAC end-sequence, sequence of Expressed
Sequence Tags (ESTs) that hybridize to BACs in this region, overgo
probes that often relate to these ESTs, etc.) or by obtaining new
sequence by directly sequencing BAC clones in this region. From
this sequence one can determine which regions are most unique using
several different methods known to one of ordinary skill in the
art. For example, by using gene prediction software or by blasting
the sequence against all available maize sequence, one can select
for non-repetitive sequence. Low copy sequence can be used to
develop a wide array of nucleic acid based markers. These markers
are used to screen the plant material in which the Rcg1 locus is
present and the plant material in which the Rcg1 locus is absent.
If a marker outside of the Rcg1 locus is desired, then the markers
are used to screen the plant material in which the Rcg1 locus is
present and the plant material in which the Rcg1 locus is absent to
determine if the marker is polymorphic in such germplasm.
Polymorphic markers are then used for marker assisted introgression
and selection of the Rcg1 region and optimally also recurrent
parent genome selection, in other maize germplasm. Thus, with the
location of the Rcg1 locus identified and its association with
resistance to Colletotrichum established, one of ordinary skill in
the art can utilize any number of existing markers, or readily
develop new markers, that can be used introgress or identify the
presence or absence of the Rcg1 locus in germplasm, and to select
for recurrent parent genome in a backcrossing program.
[0161] On a genetic map, linkage of one molecular marker to a gene
or another molecular marker is measured as a recombination
frequency. In general, the closer two loci (e.g., two SSR markers)
are on the genetic map, the closer they lie to each other on the
physical map. A relative genetic distance (determined by crossing
over frequencies, measured in centimorgans; cM) can be proportional
to the physical distance (measured in base pairs, e.g., kilobase
pairs [kb] or mega-basepairs [Mbp]) that two linked loci are
separated from each other on a chromosome. A lack of precise
proportionality between cM and physical distance can result from
variation in recombination frequencies for different chromosomal
regions, e.g., some chromosomal regions are recombination "hot
spots," while others regions do not show any recombination, or only
demonstrate rare recombination events. Some of the introgression
data and mapping information suggest that the region around the
Rcg1 locus is one that does have a high amount of
recombination.
[0162] In general, the closer one marker is to another marker,
whether measured in terms of recombination or physical distance,
the more strongly they are linked. The closer a molecular marker is
to a gene that encodes a polypeptide that imparts a particular
phenotype (disease resistance), whether measured in terms of
recombination or physical distance, the better that marker serves
to tag the desired phenotypic trait. If possible, the best marker
is one within the gene itself, since it will always remain linked
with the gene causing the desired phenotype.
[0163] Genetic mapping variability can also be observed between
different populations of the same crop species, including maize. In
spite of this variability in the genetic map that may occur between
populations, genetic map and marker information derived from one
population generally remains useful across multiple populations in
identification of plants with desired traits, counter-selection of
plants with undesirable traits and in guiding MAS.
[0164] To locate equivalent markers across genetic maps, a mapping
population may be used to confirm whether any such equivalent
marker is within the region described herein and therefore useful
for selection of Rcg1. Using this method, the equivalent marker,
along with the markers listed herein, are mapped on such mapping
population. Any equivalent marker that falls within the same region
can be used to select for Rcg1. Mapping populations known in the
art and that may be used for this purpose include, but are not
limited to, the IBM populations and T218.times.GT119 IF2 population
described in Sharopova, N. et al. (2002) Plant Mol Biol
48(5):463-481 and Lee, M. et al. (1999): Tools for high resolution
genetic mapping in maize--status report. Proc. Plant Animal Genome
VII, January 17-21, 1999, San Diego, USA, P. 146; the UMC 98
population, described in Davis, G. L. et al. (1999) Genetics
152(3):1137-72 and in Davis, M. D. et al., (1998) The 1998 UMC
Maize Genetic Map: ESTs, Sequenced Core Markers, and Nonmaize
Probes as a Foundation for Gene Discovery, Maize Genetics
Conference Abstracts 40.
[0165] As used herein, "introgression" or "introgressing" shall
refer to moving a gene or locus from one line to another by: (1)
crossing individuals of each line to create a population; and (2)
selecting individuals carrying the desired gene or locus. After
each cross, the selection process is repeated. For example, the
gene of the embodiments, or the locus containing it, may be
introgressed into a recurrent parent that is not resistant or only
partially resistant, meaning that it is sensitive or susceptible or
partially so, to Cg. The recurrent parent line with the
introgressed gene or locus then has enhanced or newly conferred
resistance to Cg. This line into which the Rcg1 locus has been
introgressed is referred to herein as an Rcg1 locus conversion.
[0166] The process of introgressing is often referred to as
"backcrossing" when the process is repeated two or more times. In
introgressing or backcrossing, the "donor" parent refers to the
parental plant with the desired gene or locus to be introgressed.
The "recipient" parent (used one or more times) or "recurrent"
parent (used two or more times) refers to the parental plant into
which the gene or locus is being introgressed. For example, see
Ragot, M. et al. (1995) Marker-assisted backcrossing: a practical
example, in Techniques et Utilisations des Marqueurs Moleculaires
(Les Colloques, Vol. 72, pp. 45-56 and Openshaw et al., (1994)
Marker-assisted Selection in Backcross Breeding, Analysis of
Molecular Marker Data, pp. 41-43. The initial cross gives rise to
the F1 generation; the term "BC1" then refers to the second use of
the recurrent parent, "BC2" refers to the third use of the
recurrent parent, and so on.
[0167] In the case of Rcg1, where the sequence of the gene and very
nearby regions are available, DNA markers based on the gene itself
or closely linked sequences can be developed for direct selection
of the donor gene in the recurrent parent background. While any
polymorphic DNA sequence from the chromosomal region carrying the
gene could be used, the sequences provided in the embodiments allow
the use of DNA markers within or close to the gene, minimizing
false positive selection for the gene. Flanking markers limit the
size of the donor genome fragments introduced into the recipient
background, thus minimizing so called "linkage drag," meaning the
introduction of undesirable sequences from the donor line that
could impact plant performance in otherwise elite germplasm. The
embodiments provide multiple examples of DNA markers that could be
so used, and the person skilled in the art will be able to use the
genomic sequences provided to create even more markers. An example
is to use markers that hybridize (in the case of RFLP assays) or
anneal (in the case of PCR assays) specifically (exclusively) to
sequences closely linked, including within, the locus. In
principle, sequences that also hybridize or anneal elsewhere in the
genome could be used if several such markers are used in
combination. When PCR reactions are used, in practice the length of
the primers used in the amplification reaction should be at least
about 15 nucleotides, but depending on the sequences and
hybridization conditions, any length that provides specific
annealing can be used, such as about 16, about 17, about 18, about
19, about 20, about 21, about 22, about 23, about 24, about 25,
about 26, about 27, about 28 or longer. For PCR reactions the term
"anneal" is commonly used, and as used herein it shall be
understood to have the same meaning as "hybridize."
[0168] Thus, by using the markers and processes described herein,
one may produce a plant comprising a truncated chromosomal interval
comprising the Rcg1 locus and/or the Rcg1 gene. The term
"chromosomal interval" or "chromosomal segment" refers to a
contiguous linear span of genomic DNA that resides in planta on a
single chromosome, usually defined with reference to two markers
defining the end points of the chromosomal interval. The specified
interval may include the markers at the end points (e.g. one or
more markers on or within the chromosomal interval defined by
marker A and marker B) or may exclude the markers at the end points
of the interval (e.g. one or more markers within the chromosomal
interval defined by marker A and marker B). A truncated chromosomal
interval refers to a chromosomal interval that has been reduced in
size by selecting for one or more recombination events that have
reduced the size of the chromosomal interval. A "recombination
event" refers to the occurrence of recombination between homologous
chromosomes, and refers to a specific chromosomal location where
such a recombination has occurred (e.g. a recombination of a
chromosomal interval internal to the end points of the chromosome
will have a recombination event at each end of the chromosomal
interval). The truncated chromosomal interval may be defined with
reference to one or both new markers at the end points of the
segment. The length of two chromosomal segments may be measured by
either centimorgans or base pairs. The genetic elements or genes
located on a single chromosomal interval are physically linked. The
size of a chromosomal interval is not particularly limited, but in
the context of the embodiments of the present invention, generally
the genetic elements located within a single chromosomal interval
are also genetically linked.
[0169] By using the processes of the embodiments, it is possible to
select for a plant that comprises a truncated chromosomal interval
comprising the Rcg1 gene. Specifically, with respect to the
invention described in more detail in the examples below, the
chromosomal interval may be reduced to a length of 12cM or less, 10
cM or less, 8 cM or less, 6 cM or less, 4 cM or less, 3cM or less,
2.5 cM or less, 2 cM or less, 1.5 cM or less, 1 cM or less, 0.75 cM
or less, 0.50 cM or less, or 0.25 cM or less, in each case as
measured with respect to the map distances as shown on the IBM2
Neighbors 4 genetic map as in effect on Mar. 21, 2006. As measured
in base pairs, the chromosomal interval may be reduced to a length
of 15 mbp or less, 10 mbp or less, 5 mbp or less, 3 mbp or less, 1
mpb or less, 500 kbp or less, or 250 kbp or less. One of ordinary
skill in the art would understand that it is undesirable to cause a
break in the chromosomal region so proximal to the Rcg1 coding
sequence (e.g. within 5 kpb or less, within 4 kbp or less, 3 kbp or
less, 2 kbp or less, 1 kbp or less, or 0.5 kbp or less), such that
the promoter and other upstream regulatory elements would be
unlinked from the coding sequence.
[0170] The term "locus" generally refers to a genetically defined
region of a chromosome carrying a gene or, possibly, two or more
genes so closely linked that genetically they behave as a single
locus responsible for a phenotype. When used herein with respect to
Rcg1, the "Rcg1 locus" shall refer to the defined region of the
chromosome carrying the Rcg1 gene including its associated
regulatory sequences, plus the region surrounding the Rcg1 gene
that is non-colinear with B73, or any smaller portion thereof that
retains the Rcg1 gene and associated regulatory sequences. This
locus has also been referred to elsewhere as the ASR locus, and
will be referred to as the Rcg1 locus here.
[0171] A "gene" shall refer to a specific genetic coding region
within a locus, including its associated regulatory sequences. The
region encoding the Rcg1 primary transcript, referred to herein as
the "Rcg1 coding sequence", will be used to define the position of
the Rcg1 gene, and one of ordinary skill in the art would
understand that the associated regulatory sequences will be within
a distance of about 4 kb from the Rcg1 coding sequence, with the
promoter located upstream. One embodiment of the present invention
is the isolation of the Rcg1 gene and the demonstration that it is
the gene responsible for the phenotype conferred by the presence of
the locus.
[0172] As used herein, "linked" or "linkage" (as distinguished from
the term "operably linked") shall refer to the genetic or physical
linkage of loci or genes. Loci or genes are considered genetically
linked if the recombination frequency between them is less than
about 50% as determined on a single meiosis map. They are
progressively more linked if the recombination frequency is about
40%, about 30%, about 20%, about 10% or less, as determined on a
single meiosis map. Two or more genes are physically linked (or
syntenic) if they have been demonstrated to be on a single piece of
DNA, such as a chromosome. Genetically linked genes will in
practice be physically linked (or syntenic), but the exact physical
distance (number of nucleotides) may not have been demonstrated
yet. As used herein, the term "closely linked" refers to
genetically linked markers within 15 cM or less, including without
limitation 12 cM or less, 10 cM or less, 8 cM or less, 7 cM or
less, 6 cM or less, 5 cM or less, 4 cM or less, 3 cM or less, 2 cM
or less, 1 cM or less and 0.5 cM or less, as determined on the IBM2
neighbors 4 genetic map publicly available on the Maize GDB website
previously referenced in this disclosure. A DNA sequence, such as a
short oligonucleotide representing a sequence within a locus or one
complementary to it, is also linked to that locus.
[0173] A "line" or "strain" is a group of individuals of identical
parentage that are generally inbred to some degree and that are
generally homozygous and homogeneous at most loci.
[0174] An "ancestral line" or "progenitor" is a parent line used as
a source of genes, e.g., for the development of elite lines.
"Progeny" are the descendents of the ancestral line, and may be
separated from their ancestors by many generations of breeding. For
example, many elite lines are the progeny of B73 or Mo17. A
"pedigree structure" defines the relationship between a descendant
and each ancestor that gave rise to that descendant. A pedigree
structure can span one or more generations, describing
relationships between the descendant and it's parents, grand
parents, great-grand parents, etc.
[0175] An "elite line" or "elite variety" is an agronomically
superior line or variety that has resulted from many cycles of
breeding and selection for superior agronomic performance. An
"elite inbred line" is an elite line that is an inbred, and that
has been shown to be useful for producing sufficiently high
yielding and agronomically fit hybrid varieties (an "elite hybrid
variety"). Numerous elite lines and varieties are available and
known to those of skill in the art of corn breeding. Similarly,
"elite germplasm" is an agronomically superior germplasm, typically
derived from and/or capable of giving rise to a plant with superior
agronomic performance, such as an existing or newly developed elite
line of corn.
[0176] In contrast, an "exotic corn line" or "exotic corn
germplasm" is germplasm derived from corn not belonging to an
available elite line, elite variety or elite germplasm. In the
context of a cross between two corn plants, an exotic line or
exotic germplasm is not closely related by descent to the elite
line, elite variety or elite germplasm with which it is crossed.
Most commonly, the exotic line or exotic germplasm is selected to
introduce novel genetic elements (typically novel alleles) into a
breeding program.
[0177] Units, prefixes, and symbols may be denoted in their SI
accepted form. Unless otherwise indicated, nucleic acids are
written left to right in 5' to 3' orientation; amino acid sequences
are written left to right in amino to carboxyl orientation,
respectively. Numeric ranges are inclusive of the numbers defining
the range. Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes. The above-defined terms are more
fully defined by reference to the specification as a whole.
[0178] With respect to map directions noted herein, instead of the
terms 5' and 3', the terms "north" and "above" are used (e.g., a
marker north of the Rcg1 gene refers to a marker above the Rcg1
gene, as determined with reference to the maps provided in a
vertical orientation, such as FIGS. 7 and 8, and to the left of the
Rcg1 gene, as determined with reference to maps provided in a
horizontal orientation, such as FIG. 22). Likewise, the terms
"south" and "below" are used (e.g. a marker south of the Rcg1 gene
refers to a marker below the Rcg1 gene, as determined with
reference to the vertically oriented maps provided herein, and to
the right of the Rcg1 gene, as determined with reference to the
horizontally oriented maps provided herein). More specifically,
above the Rcg1 coding sequence refers to the chromosome above, or
north of the primary transcript in SEQ ID NO: 1 (at about FLP110F),
and below the Rcg1 coding sequence refers to the chromosome below
or south of the primary transcript in SEQ ID NO: 1 (at about
FLPA1R). See FIG. 26. The term "proximal" and "distal" are relative
terms meaning, respectively, nearer and farther from a specified
location (e.g., the Rcg1 gene) when used to compare two points on a
map relative to the specified location.
[0179] The term "computer systems" refers generally to various
automated systems used to perform some or all of the method steps
described herein. The term "instructions" refers to computer code
that instructs the computer system to perform some or all of the
method steps. In addition to practicing some or all of the method
steps, digital or analog systems, e.g., comprising a digital or
analog computer, can also control a variety of other functions such
as a user viewable display (e.g., to permit viewing of method
results by a user) and/or control of output features (e.g., to
assist in marker assisted selection or control of automated field
equipment).
[0180] Certain of the methods described herein are optionally (and
typically) implemented via a computer program or programs (e.g.,
that store and can be used to analyze molecular marker data). Thus,
the embodiments provide digital systems, e.g., computers, computer
readable media, and/or integrated systems comprising instructions
(e.g., embodied in appropriate software) for performing the methods
herein. The digital system will include information (data)
corresponding to plant genotypes for a set of genetic markers, and
optionally, phenotypic values and/or family relationships. The
system can also aid a user in performing marker assisted selection
for Rcg1 according to the methods herein, or can control field
equipment which automates selection, harvesting, and/or breeding
schemes.
[0181] Standard desktop applications such as word processing
software (e.g., Microsoft Word.TM. or Corel WordPerfect.TM.) and/or
database software (e.g., spreadsheet software such as Microsoft
Excel.TM., Corel Quattro Pro.TM., or database programs such as
Microsoft Access.TM. or Paradox.TM.) can be adapted to the
embodiments by inputting data which is loaded into the memory of a
digital system, and performing an operation as noted herein on the
data. For example, systems can include the foregoing software
having the appropriate genotypic data, and optionally pedigree
data, used in conjunction with a user interface (e.g., a GUI in a
standard operating system such as a Windows, Macintosh or LINUX
system) to perform any analysis noted herein, or simply to acquire
data (e.g., in a spreadsheet) to be used in the methods herein. The
computer can be, e.g., a PC (Intel x86 or Pentium chip-compatible
DOS,.TM. OS2,.TM. WINDOWS,.TM. WINDOWS NT,.TM. WINDOWS95,.TM.
WINDOWS98,.TM. LINUX, Apple-compatible, MACINTOSH.TM. compatible,
Power PC compatible, or a UNIX compatible (e.g., SUN.TM. work
station) machine) or other commercially common computer which is
known to one of skill. Software for performing association analysis
and/or phenotypic value prediction can be constructed by one of
skill using a standard programming language such as Visualbasic,
Fortran, Basic, Java, or the like, according to the methods
herein.
[0182] Any system controller or computer optionally includes a
monitor which can include, e.g., a cathode ray tube ("CRT")
display, a flat panel display (e.g., active matrix liquid crystal
display, liquid crystal display), or others. Computer circuitry is
often placed in a box which includes numerous integrated circuit
chips, such as a microprocessor, memory, interface circuits, and
others. The box also optionally includes a hard disk drive, a
floppy disk drive, a high capacity removable drive such as a
writeable CD-ROM, and other common peripheral elements. Inputting
devices such as a keyboard or mouse optionally provide for input
from a user and for user selection of genetic marker genotype,
phenotypic value, or the like in the relevant computer system.
[0183] The computer typically includes appropriate software for
receiving user instructions, either in the form of user input into
a set of parameter fields, e.g., in a GUI, or in the form of
preprogrammed instructions, e.g., preprogrammed for a variety of
different specific operations. The software then converts these
instructions to an appropriate language for instructing the system
to carry out any desired operation. For example, a digital system
can instruct selection of plants comprising certain markers, or
control field machinery for harvesting, selecting, crossing or
preserving crops according to the relevant method herein.
[0184] The invention can also be embodied within the circuitry of
an application specific integrated circuit (ASIC) or programmable
logic device (PLD). In such a case, the invention is embodied in a
computer readable descriptor language that can be used to create an
ASIC or PLD. The invention can also be embodied within the
circuitry or logic processors of a variety of other digital
apparatus, such as PDAs, laptop computer systems, displays, image
editing equipment, etc.
Examples
[0185] The embodiments of the invention are further defined in the
following examples, in which all parts and percentages are by
weight and degrees are Celsius, unless otherwise stated. It should
be understood that these examples, while indicating embodiments of
the invention, are given by way of illustration only. From the
above discussion and these examples, one skilled in the art can
ascertain the essential characteristics of the embodiments of this
invention, and without departing from the spirit and scope thereof,
can make various changes and modifications to adapt it to various
usages and conditions. Thus, various modifications of the
embodiments of the invention in addition to those shown and
described herein will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims. The disclosure of
each reference set forth herein is incorporated by reference in its
entirety. Examples 1-4 and 7-12 are actual. Examples 5, 6 and 13
are actual in part and prophetic in part.
Example 1
Fine Mapping of the Rcg1 Locus to a Specific Region of 4L
[0186] In order to map and clone the gene responsible for the
resistance of corn line MP305 to Cg, lines had previously been
created which differed as little as possible from each other
genetically with the exception of the presence of the locus
responsible for the resistant phenotype. Such lines are called near
isogenic lines. To this end, DE811 had been crossed to MP305 and
the progeny had been backcrossed to the sensitive line DE811 three
times, at each backcross selecting for resistance to Cg and
otherwise for characteristics of DE811 (Weldekidan and Hawk,
(1993), Maydica, 38:189-192). The resulting line was designated
DE811ASR (BC3) (Weldekidan and Hawk, (1993) supra). This line was
used as the starting point for the fine mapping of the Rcg1 locus.
It was first necessary to know roughly where in the maize genome it
was located. Using standard genetic methods, Jung et al. ((1994)
supra) had previously localized the locus on the long arm of
chromosome 4.
[0187] Since the Rcg1 locus had previously been mapped to the long
arm of maize chromosome 4, using the information on markers near
the locus obtained by Jung et al. (1994) supra, all available
public and private simple sequence repeat (SSR) markers located in
the region of the chromosome designated 4.06-4.08 were analyzed to
determine if these markers were polymorphic between the two near
isogenic lines DE811 and DE811ASR (BC5). The DE811ASR (BC5) line
was derived from the DE811ASR (BC3) line described by Weldekidan
and Hawk (1993), supra through two backcrosses to DE811 under
selection for resistance to Cg, followed by 5 generations of
selfing and selection to obtain the BC5 line. The BC5 line was
backcrossed twice more to DE811 to create the BC7 segregating
population used for fine mapping. In order to be able to conduct
phenotypic evaluation on a family basis, BC7 individuals were
selfed to create BC7S1 families.
[0188] From this analysis two SSR markers, PHI093 and UMC2041, were
discovered to be polymorphic. Using the publicly available
inter-mated (Coe et al. (2002) Plant Physiol. 128:9-12; Gardiner,
et al., (2004), Plant Physiol., 134:1317-1326; Yim et al., (2002)
Plant Physiol. 130:1686-1696) B73.times.Mo17 (IBM) neighbors map
(Lee et al. (2002) Plant Mol Biol 48:453-61; Sharopova et al.,
(2002) Plant Mol Biol 48:463-81), the sequences of three nearby
Restriction Fragment Length Polymorphism (RFLP) markers, CD0365,
CSU166 and CD0127, were used to create fragment length polymorphic
markers (hereafter designated FLPs). FLPs are markers that can be
assayed using gel electrophoresis or any similar high-resolution
fragment separation method following a PCR reaction using primers
of a defined sequence. All three markers were found to be
polymorphic. The FLPs used in mapping the Rcg1 locus are summarized
in Table 1. Any primers for the MZA FLPs shown on Table 1, which
also have the same MZA markers names shown on Table 2, will amplify
a region of the FLP internal to the internal sequence shown on
Table 2. The annealing temperature for all the primers listed in
Table 1 is 60.degree. C.
[0189] In order to determine whether the presence of these three
polymorphic FLPs and two polymorphic SSRs was associated with the
resistant phenotype, indicating that the region carrying the Rcg1
locus was located on a chromosomal segment containing these three
markers, a table was created in which the phenotypic status of 4784
individuals determined by field observation and the genotypic
status relative to each of the five markers, determined by fragment
size analysis, were entered. This data was submitted sequentially
to the software programs Joinmap (Van Ooijen, et al., (2001), Plant
Research International, Wageningen, the Netherlands) and Windows
QTL Cartographer (Wang, et al., (2004), (online, version 2.0
retrieved on 2004-06-14 and version 2.5 retrieved on 2005-02-22);
retrieved from the North Carolina State University Statistical
Genetics and Bioinformatics website on the Internet <URL:
http://statgen.ncsu.edu/qticart/WQTLCart.htm>. The former
program determines the order of the markers along the chromosomal
region. The latter determines if a particular allele of a marker (a
particular form of the two polymorphic forms of the marker) is
significantly associated with the presence of the phenotype.
Markers for which the presence of one or the other allele is more
significantly associated with the resistant phenotype are more
likely to be closer to the gene responsible for the resistant
phenotype. FIG. 3 depicts a graph produced by Windows QTL
Cartographer showing a statistical analysis of the chance (Y axis)
that the locus responsible for the Cg resistance phenotype is
located at a particular position along the chromosome (X axis) as
defined by FLP markers.
[0190] From the integrated physical and genetic map as described by
Fengler, et al., ((2004) Plant and Animal Genome XII Abstract Book,
Page 192 (Poster number P487), January 10-14, San Diego, Calif.)
and Gardiner, (2004) supra, it was possible to identify two
bacterial artificial chromosome (BAC) contigs, derived from a Mo17
BAC library, harboring the above mentioned genetic markers.
[0191] However, the two BAC contigs containing the markers flanking
the region of interest contained a gap of unknown size. In order to
identify further BACs to bridge this gap, a dense genetic map
containing markers (Fengler, (2004) supra) with known positions on
the physical map was used to find additional markers genetically
linked to markers previously identified on the two BAC contigs.
These additional markers in Table 2, were used to identify BAC
contigs from a B73 BAC library which closed the physical gap
between the previously found Mo17-derived BAC contigs (Coe et al.
(2002) supra; Gardiner (2004) supra; Yim et al. (2002) supra. Four
markers, MZA11455, MZA6064, MZA2591 and MZA15842, were used for
mapping purposes. In Table 2, "E" stands for "external" and "I"
stands for "internal," which respectively refer to the outer and
inner primers used during nested PCR. The external set is used in
the first round of PCR, after which the internal sequences are used
for a second round of PCR on the products of the first round. This
increases the specificity of the reaction. Upper case letters
indicate portions of the primer based on vector sequences, which
are later used to sequence the PCR product. They are not maize
sequences. For the forward internal nested MZA primers, the upper
case portion of the sequence is SEQ ID NO: 126, and for the reverse
internal nested MZA primers, the upper case portion is SEQ ID NO:
127. The sequences shown in Table 2 for the internal forward MZA
nested primers are therefore a combination of SEQ ID NO: 126 plus
the SEQ ID NO: for each respective primer. Similarly, the sequences
shown in Table 2 for the internal reverse MZA nested primers are a
combination of SEQ ID NO: 127 plus the SEQ ID NO: for each
respective primer. These combinations are indicated in the SEQ ID
NO: column of Table 2. The annealing temperature for all the
primers listed in Table 2 is 55.degree. C. All markers set forth in
Table 2 have shown polymorphism within a diverse panel of corn
germplasm, including MP305 and the corn lines shown on Table
18.
[0192] The sequences of the ends of several of these BACs, as well
as ESTs known to be located on these BACs, were used in order to
identify new markers with which to further narrow the range in
which the locus was located. The further markers used for this
purpose are designated FLP8, FLP27, FLP33, FLP41, FLP56 and FLP95
in Table 1. In a manner similar to that described above, phenotype
and genotypic correlations were made. It was determined that the
locus was most likely located between FLP 8 and FLP 27 (See FIG.
3).
TABLE-US-00001 TABLE 1 Markers and primer pairs used in Examples 1,
4 and 5 Used in SEQ SEQ Example Name Forward ID NO: Reverse ID NO:
1, 4 FLP8 CATGGAAGCCCCACAATAAC 24 ACATGGGTCCAAAGATCGAC 23 1, 4
FLP27 AGCCCTATTTCCTGCTCCTG 26 GCATGCCCCATCTGGTATAG 25 1, 4 FLP33
CTGTCGTTCGGTTTTGCTTC 28 GCATTCACATGTTCCTCACC 27 1, 4 FLP41
TGTGTTCGCATCAAAGGTGT 30 CTGTAAGGCACCCGATGTTT 29 1, 4 FLP56
GGTCTGGGAATGCTAAAGAGG 32 TGTCCAGGGTTACAGAAAACG 31 1, 4 FLP95
ATTTCGACGGAGGGTTCTTC 33 GCAGCAGGAGGAGCTCATAG 34 4 FLP110
ATGGAGGCTGCCCTGCTGAG 35 CGTATACCTCTCTGGCAAGGACGG 36 4 FLP111
TTCCTGTTCGTCTGTATCTGATCCG 37 TTTGATTCCGGTCGAGTATAACCTG 38 4 FLP112
GAAACTGCCTTCCCAGAAAACAATG 39 CAAGATCGGTGAAGTTGGTGCTTC 40 4 FLP113F
ATCACAGATGGGTCTCAAGGATTGC 41 4 FLPA1R TTCCAAGCAATTCACAGCTC 42 1, 5
UMC1612 AGGTCCAGGTTACAGAGCAAGAGA 43 GCTAGTAGGTGCATGGTGGTTTCT 44 1,
4, 5 UMC2041 CTACACAAGCATAGAGGCCTGGAG 45 CAGTACGAGACGATGGAGGACAT 46
1, 4 CDO127 TGCTGTTGTTACTCGGGTTG 47 CTCTGCCTCAGCACAAATTC 48 1, 4, 5
PHI093 AGTGCGTCAGCTTCATCGCCTACAAG 49 AGGCCATGCATGCTTGCAACAATGGATACA
50 1, 4 CDO365 CTTCCAGAGGCAAAGCGTAG 51 TGTCACCCATGATCCAGTTG 52 1,
4, 5 CSU166 TATTGTGCACGTCACCTTGG 53 GGGCAGACTTACTGCTGGAG 54 1, 4
UMC2285 ATCTGCCTCCTTTTCCTTGG 55 AAGTAGCTGGGCTTGGAGGG 56 1, 4
MZA11455 ACGAAGCAATTTCACCTTCC 57 TGTGGAACTAACCCTCAGCATAG 58 1
MZA6064 CGAGAACCGGAGAAGAAGG 59 TTGGGCTGCTGTATTTTGTG 60 1, 4
MZA15842 GACGCAGCTGTGAAGTTGG 61 CACCGGAATACCTTGACCAC 62 1, 5
UMC1086 CATGAAAGTTTTCCTGTGCAGATT 63 GGGCAACTTTAGAGGTCGATTTATT 64 5
UMC1466 GATCCACTAGGGTTTCGGGGT 65 CGAATAGTGGTCTCGCGTCTATCT 66 5
UMC1418 GAGCCAAGAGCCAGAGCAAAG 67 TCACACACACACTACACTCGCAAT 68 5
BNLG2162 CACCGGCATTCGATATCTTT 69 GTCTGCTGCTAGTGGTGGTG 70 5 CSU166
AAATATCGGCTTTGGTCACG 71 TCGTCCTTCCTCAATTCGAC 72 5 UMC1051
AATGATCGAAATGCCATTATTTGT 73 CTGATCTGACTAAGGCCATCAAAC 74 5 UMC2187
ACCCAACAAGTCTTAATCGGGTTT 75 GTCCACCCTACCTCTCAACAAACA 76 5 UMC1371
CATGTGAATGGAAGTGTCCCTTT 77 GCATCCTTTTCGTTTCAAATATGC 78 5 UMC1856
AGATCTGTTTTGCTTTGCTCTGCT 79 CATGCCTTTATTCTCACACAAACG 80
TABLE-US-00002 TABLE 2 Nested MZA Primer Pairs Used in Example 1
SEQ SEQ ID Name Forward ID NOs: Reverse NOs: MZA1215 E
Agcccaattctgtagatccaa 81 Tgcatgcaccggatccttc 82 MZA1215 I
TGTAAAACGACGGCCAGTagcagcagac 126 + 83
GGAAACAGCTATGACCATGaggctggcggt 127 + 84 gatgcaaaga ggacttga MZA1216
E Ccggcctacggcaacaagaa 85 agggtacggtgacccgaag 86 MZA1216 I
TGTAAAACGACGGCCAGTttcgagacgc 126 + 87
GGAAACAGCTATGACCATGacgacgcatgg 127 + 88 tgtcgtacct cactagcta
MZA3434 E Tgtaccgcgagaactcca 89 ttgcattcacatgttcctcac 90 MZA3434 I
TGTAAAACGACGGCCAGTctactacgac 126 + 91
GGAAACAGCTATGACCATGttgcagtagtt 127 + 92 ggccgcta ttgtagcagg MZA2591
E Agtaaataacagcattgacctc 93 tccaacggcggtcactcc 94 MZA2591 I
TGTAAAACGACGGCCAGTctatataaca 126 + 95
GGAAACAGCTATGACCATGcacaaagccca 127 + 96 gggccctggaa caagctaag
MZA11123 E Accacaatctgaagcaagtag 97 cacagaaacatctggtgctg 98
MZA11123 I TGTAAAACGACGGCCAGTaaagaccaag 126 + 99
GGAAACAGCTATGACCATGagacatcacgt 127 + 100 aaatgcagtcc aacagtttcc
MZA15842 E Ctcgattggcatacgcgata 101 ttccttctccacgcagttca 102
MZA15842 I TGTAAAACGACGGCCAGTagaaggtatt 126 + 103
GGAAACAGCTATGACCATGgtttcacttgc 127 + 104 tgccatggctta tgaaggcagtc
MZA11455 E Gaccgatgaaggcaattgtga 105 accaaatagtcctagataatgg 106
MZA114551 I TGTAAAACGACGGCCAGTttcaaccttc 126 + 107
GGAAACAGCTATGACCATGtaaacatagtc 127 + 108 tgactgacacat ataaaaattac
MZA6064 E Tcgaatgtattttttaatgcgg 109 atccacaatggcacttgggt 110
MZA6064 I TGTAAAACGACGGCCAGTcagctatttt 126 + 111
GGAAACAGCTATGACCATGggtcagattcc 127 + 112 tgtcttcttcct aattcggac
MZA11394 E Tcgtcctaacagcctgtgtt 113 gtccggatcaaatggatcgt 114
MZA11394 I TGTAAAACGACGGCCAGTaacagcctgt 126 + 115
GGAAACAGCTATGACCATGcgtgttccgtc 127 + 116 gttgaataaggt gagggagt
MZA8761 E Ttctttgattctactcttgagc 117 cttcatggacgcctgagatt 118
MZA8761 I TGTAAAACGACGGCCAGTtagagctttc 126 + 119
GGAAACAGCTATGACCATGttggcatttag 127 + 120 tgaactgatagc cttctctcca
MZA1851 E Atatattgcaccacttaaagcc 121 gggtgttatcacttgttctata 122
MZA1851 I TGTAAAACGACGGCCAGTtggagtcctt 126 + 123
GGAAACAGCTATGACCATGtatatgcactt 127 + 124 gaccatttgc ctagcgagtat
MZA16510 E Aacaacaaggcgacggtgat 127 Tcatcttcgtcgtcctcatc 130
MZA16510 I TGTAAAACGACGGCCAGTgatcatcctg 126 + 131
GGAAACAGCTATGACCATGaaccgaaaaca 127 + 132 ccggagtt caccctc MZA1719 E
ccagcggtagattatatacag 133 cggtttggtctgatgaggc 134 MZA1719 I
TGTAAAACGACGGCCAGTctcgggaacc 126 + 135
GGAAACAGCTATGACCATGtgaaatccaga 127 + 136 ttgttggga acctcctttg
Example 2
Isolation of BAC Clones from the Resistant Lines and Identification
of Candidate Genes in the Region of the Rcg1 Locus
[0193] In order to isolate the gene responsible for the phenotype
conferred by the Rcg1 locus, BACs containing the region between the
FLP 8 and FLP 27 markers were isolated from a BAC library prepared
from the resistant line DE811ASR (BC5). This library was prepared
using standard techniques for the preparation of genomic DNA (Zhang
et al. (1995) Plant Journal 7:175-184) followed by partial
digestion with HindIII and ligation of size selected fragments into
a modified form of the commercially available vector pCC1 BAC.TM.
(Epicentre, Madison, USA). After transformation into EPI300.TM. E.
coli cells following the vendors instructions (Epicentre, Madison,
USA), 125,184 recombinant clones were arrayed into 326 384-well
microtiter dishes. These clones were then gridded onto nylon
filters (Hybond N+, Amersham Biosciences, Piscataway, USA).
[0194] The library was probed with overlapping oligonucleotide
probes (overgo probes; Ross et al. (1999) Screening large-insert
libraries by hybridization, p. 5.6.1-5.6.52, In A. Boyl, ed.
Current Protocols in Human Genetics. Wiley, New York) designed on
the basis of sequences found in the BAC sequences shown in the
previous example to be present between FLP8 and FLP27. BLAST search
analyses were done to screen out repeated sequences and identify
unique sequences for probe design. The position and interspacing of
the probes along the contig was verified by PCR. For each probe two
24-mer oligos self-complementary over 8 bp were designed. Their
annealing resulted in a 40 bp overgo, whose two 16 bp overhangs
were filled in. The probes used in this way are presented in Table
4. Note that some of these probes were based on markers also used
in Example 1 and Table 1, but the exact sequences are different as
they were to be used as overgo probes rather than just PCR primers.
Probes for hybridization were prepared as described (Ross et al.
(1999) supra), and the filters prepared by the gridding of the BAC
library were hybridized and washed as described by (Ross et al.
(1999) supra). Phosphorimager analysis was used for detection of
hybridization signals. Thereafter, the membranes were stripped of
probes by placing them in a just-boiled solution of 0.1.times.SSC
and 0.1% SDS and allowing them to cool to room temperature in the
solution overnight.
[0195] BACs that gave a positive signal were isolated from the
plates. Restriction mapping, PCR experiments with primers
corresponding to the markers previously used and sequences obtained
from the ends of each BAC were used to determine the order of the
BACs covering the region of interest. Four BACs that spanned the
entire region were selected for sequencing. These BACs were
sequenced using standard shotgun sequencing techniques and the
sequences assembled using the Phred/Phrap/Consed software package
(Ewing et al. (1998) Genome Research, 8:175-185).
[0196] After assembly, the sequences thought to be in the region
closest to the locus on the basis of the mapping data were
annotated, meaning that possible gene-encoding regions and regions
representing repetitive elements were deduced. Gene encoding
(genic) regions were sought using the fGenesH software package
(Softberry, Mount Kisco, N.Y., USA). fGenesH predicted a portion of
a protein, that when BLASTed (BLASTx/nr), displayed partial
homology at the amino acid level to a portion of a rice protein
that was annotated as encoding for a protein that confers disease
resistance in rice. The portion of the maize sequence that
displayed homology to this protein fell at the end of a contiguous
stretch of BAC consensus sequence and appeared to be truncated. In
order to obtain the full representation of the gene in the maize
BAC, the rice amino acid sequence was used in a tBLASTn analysis
against all other consensus sequences from the same maize BAC
clone. This resulted in the identification of a consensus sequence
representing the 3' end of the maize gene. However, the center
portion of the gene was not represented in the sequences so
obtained. PCR primers were designed based on the 5' and 3' regions
of the putative gene and used in a PCR experiment with DNA from the
original maize BAC as a template. The sequence of the resulting PCR
product contained sequence bridging the 5' and 3' fragments
previously isolated.
[0197] DE811ASR (BC5) has been deposited with the ATCC, and the
methods described herein may be used to obtain a BAC clone
comprising the Rcg1 locus. As shown in FIG. 9(a), the DE811ASR
(BC5) chromosomal interval with the Rcg1 locus is non-colinear with
the corresponding region of B73 and Mo17 (See FIGS. 9 and 22), as
determined by the analysis of BAC libraries.
[0198] Using common sequence that hybridize to BACs in the Mo17 and
the B73 BAC libraries, the corresponding BACs from both libraries
were lined up in a tiling path as shown in FIG. 22. The B73 BACs in
FIG. 22 were given shorter names for the purposes of the figure.
Table 3, below, shows the BAC ID for each BAC designation indicated
on FIG. 22. The public B73 BACs, c0113f01 and c0117e18 are directly
north and south, respectively, of the Rcg1 locus indel region, with
the deletion occurring in B73. Information about these two BACs can
be viewed on several websites including the maize GDB website
(maizegdb.org), the Gramene website (gramene.org) and the maize
genome database of the Arizona Genomics Institute
(genome.arizona.edu). The Arizona Genomics Institute website also
provides the Maize Agarose FPC Map, version Jul. 19, 2005, which
identifies BACs contiguous with c0113f01 and c0117e18. By searching
on those databases, a multitude of BACs were identified that form a
contig of the regions flanking the Rcg1 locus. Thus, the precise
location of the Rcg1 locus and Rcg1 gene have now been identified
on both the maize genetic and physical map. See FIGS. 7(a,b) and
22.
TABLE-US-00003 TABLE 3 BAC designations in FIG. 22, which were part
of either the 187 contig (B73a through B73p) or 188 contig (B73q
through B73af) of B73as shown on the Arizona Genomics Institute
website mentioned above. B73 BAC designation in FIG. 22 B73 BAC ID
B73a c0100m06 B73b b0050k15 B73c c0127n01 B73d c0449o09 B73e
c0046c06 B73f c0212g06 B73g c0153l14 B73h c0105c14 B73i b0502a04
B73j b0239l06 B73k b0171g07 B73l c0273k24 B73m c0113f01 B73n
c0117e18 B73o c0119n15 B73p b0369n20 B73q b0031c17 B73r c0081g12
B73s c0303g03 B73t c0222i18 B73u c0428j12 B73v c0314e18 B73w
c0150j16 B73x b0085n01 B73y c0040c01 B73z c0018f13 B73aa c0091e23
B73ab b0100g11 B73ac c0177e03 B73ad b0264h08 B73ae c0410a17 B73af
c0012f18
[0199] The complete sequence of the putative gene is set forth in
SEQ ID NO: 1. The gene contains one intron, from nucleotide 950 to
nucleotide 1452 of SEQ ID NO: 1. Reverse transcriptase-PCR using
RNA prepared from DE811ASR (BC5) plants was used to determine the
borders of the intron. The protein coding sequence of the gene is
set forth in SEQ ID NO: 2, and the amino acid translation is set
forth in SEQ ID NO 3. The predicted protein has a molecular weight
of 110.76 kD.
[0200] The amino end from approximately amino acids 157 to 404 has
homology to so-called nucleotide binding sites (NBS). There is a
region with loose homology to LRR domains located approximately
from amino acids 528 to 846. However, unlike previously studied
NBS-LRR proteins, the leucine rich region lacks the systematic
repetitive nature (Lxx) found in more classical LRR domains and in
particular having no instances of the consensus sequences described
by Wang et al. ((1999), Plant J. 19:55-64) or Bryan et al. ((2000),
Plant Cell 12:2033-2045). The gene has loose homology with a family
of rice genes and a barley gene as shown in FIG. 2 (a, b and c).
Most of the homology is at the amino terminal end of the protein;
the carboxyl end is quite distinct. This is demonstrated by the use
of bold type, in FIG. 2 (a, b and c), which are amino acids
identical to the gene of the embodiments, while those which are
non-identical are not shown in bold type.
TABLE-US-00004 TABLE 4 Oligonucleotides annealed to synthesize
overgo probes Associated Forward SEQ SEQ Genetic oligonucleotide ID
Reverse oligonucleotide ID marker sequence NO: sequence NO: FLP8
cagggcctacttggtttagtaata 4 gggtactacactagcctattacta 5 None
cggttacaaggtctacccaatctg 6 gtcaaacagatagccgcagattgg 7 FLP33/PHI93
tacaaaactactgcaacgcctata 8 cctcaccccaagtatatataggcg 9 FLP27
cattggacctcttccccactaaga 10 tccttgagtccagtgctcttagtg 11 None
gaaactaggcgcgtcaggttttat 12 aaggcagccactgaaaataaaacc 13
Example 3
Comparison of Genetic Structure in the Region of the Rcg1 Locus
Between Resistant and Susceptible Lines and Expression Profiles of
Candidate Genes Found in that Region Between Resistant and
Susceptible Lines
[0201] Having found a candidate gene in the region genetically
defined to carry the locus responsible for the resistance to
anthracnose phenotype, efforts were undertaken first to determine
if there might be other genes present in the region and second to
determine if the expression patterns of the candidate gene were
consistent with its putative role. Fu and Dooner ((2002), Proc Natl
Acad Sci 99:9573-9578) and Brunner et al. ((2005), Plant Cell
17:343-360) have demonstrated that different corn inbred lines may
have significant rearrangements and lack of colinearity with
respect to each other. Comparison of such genomes over larger
regions can thus be complex. Such a comparison of the genomes of
Mo17 (Missouri 17) and DE811ASR (BC5) revealed that in the region
where the candidate gene is found in DE811ASR (BC5), a large
insertion relative to Mo17 is present. Regions within and
surrounding the insertion were sequenced and scanned for possible
genes. A gene encoding a subunit of Ribulose bisphosphate
carboxylase (Rubisco, a protein involved in carbon fixation after
photosynthesis whose gene is present in multiple copies in the corn
genome) was found in both the DE811ASR (BC5) and Mo17 genomes, just
downstream of the position of the Rcg1 gene. A pseudogene (a gene
rendered nonfunctional due to mutations disrupting the coding
sequence) related to a vegetative storage protein was found,
present only in the DE811ASR (BC5) genome some distance upstream of
the Rcg1 gene. The only structurally intact gene likely to encode a
protein with a function likely to be related to disease resistance
was the Rcg1 gene isolated in the previous example. Other genes
equally unlikely to be involved in disease resistance were located
at a greater distance from the most likely position of the locus,
as well as a large number of repetitive sequences.
[0202] In order to determine if and where the Rcg1 gene was
transcribed, two techniques were used. First, the RNA profiles of
resistant and susceptible plant materials were surveyed using
Massively Parallel Signature Sequencing (MPSS; Lynx Therapeutics,
Berkeley, USA). Briefly, cDNA libraries were constructed and
immobilized on microbeads as described (Brenner, S. et al. (2000)
Nat. Biotechnol. 18(6): 630-634). The construction of the library
on a solid support allows the library to be arrayed in a monolayer
and thousands of clones to be subjected to nucleotide sequence
analysis in parallel. The analysis results in a "signature" 17-mer
sequence whose frequency of occurrence is proportional to the
abundance of that transcript in the plant tissue. cDNA derived from
RNA prepared from DE811ASR(BC5) and from DE811 (control line,
susceptible to Cg) was subjected to MPSS analysis. Bioinformatic
inspection of the resulting signatures showed that a signature
sequence, referred to herein as Lynx19, (SEQ ID NO: 19) was present
at 43 parts per million (ppm) in RNA samples from DE811ASR (BC5)
uninfected stalks and at 65 ppm in infected, resistant stalks 9
days post inoculation (DPI) with Cg. This signature sequence was
not detected in cDNA libraries of uninfected or Cg-infected stalks
of the susceptible corn line DE811. An analysis of the sequence of
Rcg1 indicates that the 17-mer tag is present at nucleotides 3945
to 3961 of SEQ ID NO: 1 in the putative 3' untranslated region of
the gene.
[0203] Further proof that Rcg1 is exclusively expressed in corn
lines that are derived from MP305 and resistant to anthracnose
stalk rot was obtained by RT-PCR experiments. Total RNA was
isolated from uninfected and Cg-infected stalks of resistant
(DE811ASR1 (BC5)) and susceptible (DE811) corn lines using RNA
STAT-60.TM. (Iso-Tex Diagnostics, Friendswood, Tex., USA). Total
RNA (250 ng) from 0, 3, 6, 9, and 13 DPI resistant and susceptible
samples was copied into cDNA and amplified using a GeneAmp.RTM.
RNA-PCR kit (Applied Biosystems, Foster City, Calif., USA). The
cDNA synthesis reaction was assembled according to the kit protocol
using random hexamers as primers and incubated at 42.degree. C. for
45 minutes. For PCR, KEB131 (SEQ ID NO: 20) and KEB138 (SEQ ID NO:
21), both designed from the putative 3' untranslated sequence of
Rcg1, were used as the upstream and downstream primers,
respectively. The cDNA was amplified for 30 cycles consisting of 1
minute at 94.degree. C., 2 minutes at 50.degree. C. and 3 minutes
at 72.degree. C. followed by a 7 minute extension at 72.degree. C.
As shown in FIG. 4, agarose gel electrophoresis of an aliquot of
the RT-PCRs revealed the presence of a 260 bp band present in the
samples derived from both infected and uninfected resistant plants
but absent from susceptible samples. DNA sequence analysis
confirmed that this fragment corresponded to nt 3625 to 3884 of the
Rcg1 sequence consistent with the amplification product predicted
from primers KEB131 and KEB138.
Example 4
Isolation of Lines Containing Mu Insertions in the Candidate
Gene
[0204] One method to determine if a gene is responsible for a
phenotype is to disrupt the gene genetically through the insertion
of a transposition element (so-called transposon tagging) and then
determine if the relevant phenotype of the plant is altered, in
this case from resistant to Cg to susceptible to Cg. In corn this
can be done using the mutator (Mu) element (Walbot, V. (1992) Annu.
Rev. Plant Physiol. Plant Mol. Biol. 43:49-82). The basic strategy,
outlined in FIG. 5, was to introduce active mutator elements into
lines carrying the resistance gene, isolating plants homozygous for
the resistance gene by assaying associated DNA markers as well as
resistance to Cg by inoculation with Cg, then crossing those
homozygous plants with a susceptible "tester" line. If the
resistance gene is dominant, in principle all the resulting progeny
would be resistant but heterozygous for the gene. However, if a Mu
element inserted into the resistance gene in a way that disrupted
its function, that individual would be susceptible to Cg. The
disrupted gene can then be isolated and characterized.
[0205] MP305 was crossed with fifteen diverse mutator stocks (lines
carrying active mutator elements). The resulting F1s were
inter-mated (crossed with each other) in all possible combinations.
To track the chromosomal region 4L on which the resistance locus
was known to reside (see Example 1) a variety of DNA markers known
to be in the vicinity of the locus from the work described in
Example 1 were selected and used on the Mu-tagged materials. About
1500 progeny plants from the inter-mating process were examined for
resistance to Cg and for the presence of these markers. Analysis of
the markers was done using either Southern blots (Botstein et al.,
(1980) Am. J. Hum. Gen. 32:314-331) for RFLP markers or by PCR for
FLP markers as described in Example 1. Plants that were homozygous
for all the markers tested and resistant to Cg were selected and
test crossed with susceptible tester lines (.DELTA.63, EH6WA and
EF09B). About 16,000 test cross seeds generated from these
homozygous and resistant plants were then planted and were used as
female parents (meaning the pollen producing tassels were removed)
and crossed with the susceptible tester lines used as males. All
the female plants were screened for susceptibility to Cg. More than
ten susceptible plants (putative knockout mutants) were identified.
The open pollinated seed from each of these susceptible plants was
harvested, along with eight resistant siblings as controls.
[0206] DNA from a pool of 24 seedlings (grown in paper towels) from
each of the putative knockouts and the control resistant siblings
was extracted. This DNA was used as template for amplifying the
flanking sequence from the site of Mu-insertion using gene-specific
primers in combination with a consensus primer designed from the
terminal inverted repeats (TIR) from the Mutator element sequence
(SEQ ID NO: 125). In other words, PCR products would only be
observed if a Mu element had inserted into the candidate gene
isolated in Example 2. The primers FLP110F, FLP110R, FLP111F,
FLP111R, FLP112F, FLP112R, FLP113F, and FLPA1R were used as the
gene-specific primers (See Table 1). PCR amplified products were
blotted onto nylon membranes and hybridized with a DNA probe from
the candidate gene isolated in Example 2. PCR products that showed
strong hybridization were excised from the gel, purified, cloned
and sequenced. The resulting sequences were analyzed by aligning
with sequences from the candidate gene and Mu-TIR. Mutator elements
cause a direct 9 bp duplication at the site of insertion. Based on
the flanking sequence information and a direct 9 bp duplication,
four independent insertions were identified in exon 1 of the
candidate gene (FIG. 5). One insertion (m177) was detected
approximately 97 bp upstream of the initiation codon, in the 5'
untranslated region of the gene. One common insertion event, 270 bp
downstream of the initiation codon, was detected in three
susceptible plants: m164, m159, and m179. The m171 susceptible
plant was found to contain two Mu-insertions, 556 bp and 286 bp
downstream of the initiation codon. When Southern blots were
carried out using the exon1 region of the gene as a DNA probe, the
modified hybridization pattern observed further confirmed these
results.
[0207] This and the preceding examples may be summarized as
follows. The earlier work cited in Example 1 showed that a
previously observed locus conferring resistance to Cg was localized
on the long arm of maize chromosome 4. The nature of this locus,
its exact location or the gene(s) encoded by it were completely
unknown. The work done in Example 1 demonstrates that the locus can
be mapped to a very small region of the long arm of chromosome 4.
Example 2 demonstrates that there is only one gene to be found in
this chromosomal region likely to be such a resistance gene. It
encodes a novel form of an NBS-LRR protein, a family of proteins
known to be involved in resistance to pathogens but which vary
widely in their sequence and specificity of resistance. Example 3
shows that this gene is present only in the resistant line, not the
isogenic susceptible line, and that transcripts corresponding to
this gene are found in the resistant line, indicating that the gene
is expressed, and these transcripts are found only in the resistant
line. Example 4 demonstrates that in four independently isolated Mu
insertion events, when the gene is disrupted by insertion of a Mu
element, the phenotype of these plants is changed from resistant to
susceptible to Cg. Taken together, these data provide overwhelming
evidence that the subject of the embodiments of this invention is a
gene that can enhance or confer Cg resistance to corn plants.
Example 5
Backcrossing of the Rcg1 Locus into Susceptible Lines
[0208] An Rcg1 locus introgression of an inbred was made to confirm
that the Rcg1 locus could be successfully backcrossed into inbreds,
and that hybrids produced with the inbred line with the Rcg1 locus
would have enhanced or conferred Cg resistance. DE811ASR (BC5) was
also developed and used as an improved donor source for
introgression of the Rcg1 locus. Next, several additional inbreds
were utilized as recurrent parents in order to use the marker
assisted breeding methods described herein to efficiently
introgress the Rcg1 locus into a variety of inbred and hybrid
genetic backgrounds, thereby enhancing or conferring resistance to
Cg. Each of these examples are discussed in more detail below.
Proof of Concept (PH09B)
[0209] MP305 is a white kernel color inbred line with strong
resistance to Cg, but its late flowering, poor yield and weak
agronomic characteristics make it a poor donor parent in the
absence of the use of the marker assisted breeding methods
described herein. A molecular marker profile of MP305 is provided
in Table 6. Primers used for the SSRs reported in the table can be
constructed from publicly available sequences found in the Maize
GDB on the World Wide Web at maizegdb.org (sponsored by the USDA
Agricultural Research Service), in Sharopova et al. (Plant Mol.
Biol. 48(5-6):463-481), and/or in Lee et al. (Plant Mol. Biol.
48(5-6); 453-461). UMC15a is an RFLP marker, and the score reported
is based on EcoR1 restriction.
[0210] To demonstrate the phenotypic value of the Rcg1 locus, the
locus was first introgressed into line PH09B (U.S. Pat. No.
5,859,354) through to the BC3 stage as follows. The F1 population
derived from the cross between MP305 and line PH09B was backcrossed
once more to line PH09B, resulting in a BC1 population. Seedlings
were planted out and backcrossed again to line PH09B to develop a
BC2 population. DNA was prepared from leaf punches of BC2 families.
To determine which BC2 families to plant for further backcrosses,
genotyping was carried out on DNA from BC2 families using primers
for markers flanking the region of interest, UMC2041, PHI093 and
CSU166 (See Table 1). Seeds from BC2 families were planted and
individual plants were genotyped again for the presence of the
MP305 version of that region of the chromosome using the same three
markers noted above. Positive plants were backcrossed to line PH09B
once more to develop BC3 populations. Seed from these BC3
populations was planted and plants were selfed to obtain BC3S1
families segregating for the region of interest as well as BC3S1
families missing the region of interest. These families were used
for phenotypic comparison (BC3S1 segregating versus BC3S1 without
the region of interest).
[0211] In order to observe the performance of the Rcg1 gene in a
heterozygous situation such as would be found in a commercial
hybrid, appropriate testcrosses were made. Specifically, BC3S1
families segregating for the region of interest were planted and
individual BC3S1 plants were genotyped. Plants homozygous for the
Rcg1 gene as well as plants homozygous for the null allele (lacking
the gene on both chromosomes) within each family were used to make
testcrosses with inbreds PH2EJ (U.S. Pat. No. 6,333,453), PH2NO
(U.S. Pat. No. 6,124,533), PH4CV (U.S. Pat. No. 6,897,363) and
PH8CW (U.S. Pat. No. 6,784,349).
[0212] In the case of both the BC3S1 lines and the hybrids, the
observed phenotypic differences indicated significant improvement
for ASR resistance in lines and hybrids containing the region
carrying Rcg1. The effect of the introgressed Rcg1 locus in the
BC3S1 families and the derived testcross hybrids resulted in an
improvement in terms of both the number of internodes infected and
the number of internodes infected at more than 75%. The scores,
using a visual scoring system commonly used by plant breeders, are
shown in Table 5 below. The data clearly demonstrate that using
crossing techniques to move the gene of the embodiments into other
lines genetically competent to use the gene result in enhanced
resistance to Cg.
TABLE-US-00005 TABLE 5 Effect of the introgressed Rcg1 region on
degree of resistance to anthracnose stalk rot in BC3S1 families and
derived test crosses. Number of Number of internodes internodes
>75% Rcg 1 infected infected BC3S1 Absent 3.1 2.4 Present 2.3
1.5 Difference 0.8 0.9 PH2EJ Absent 2.6 1.5 Present 2.1 0.9
Difference 0.5 0.6 PH2NO Absent 3.0 2.1 Present 2.4 1.3 Difference
0.6 0.8 PH4CV Absent 2.8 1.8 Present 2.2 1.0 Difference 0.6 0.8
PH8CW Absent 2.9 1.7 Present 2.3 0.8 Difference 0.6 0.9
TABLE-US-00006 TABLE 6 Molecular marker profile of MP305 Marker
Base Pair Base Pair Name Weight Bin Marker Name Weight Bin
phi295450 191.1 4.01 umc1667 154.65 4.08 phi213984 302.23 4.01
phi438301 212.76 4.05 phi096 235.07 4.04 umc1808 106.67 4.08
mmc0471 241.6 4.04 umc1043 199.6 4.07 umc1969 65.01 4.05 umc1871
148.48 4.08 umc1662 116.14 4.05 dupssr28 100.64 4.08 umc2061 125.34
4.05 umc1466 110.91 4.08 phi079 185.76 4.05 umc1418 153.12 4.08
bnlg1937 235.87 4.05 umc1899 111.81 4.08 umc1382 153.7 4.05
bnlg2162 144.98 4.08 bnlg1217 194.36 4.05 umc2041 165.17 4.08
umc1390 133.46 4.05 umc2285 156 4.08 bnlg1265 221.83 4.05 umc1086
95.57 4.08 umc1303 127.2 4.05 umc1612 108.54 4.08 bnlg252 167.85
4.06 umc15a approx 10 kb 4.08 umc1895 142 4.05 with EcoRI umc1175
279.6 4.05 restriction umc1317 110.12 4.05 cdo365 411.5 4.08
umc1548 159.52 4.05 umc1051 125.9 4.08 umc1451 110.69 4.05 umc2187
84.94 4.08 umc1896 87.89 4.05 umc1371 120.6 4.08 umc1511 166.43
4.05 umc1132 132.14 4.08 umc1851 114.13 4.05 umc1856 156.88 4.08
umc1791 153.23 4.05 umc2153 131.97 4.08 bnlg1755 216.93 4.05
umc2200 151 4.08 umc1702 94.8 4.05 phi066 160 4.08 umc1346 96.39
4.05 umc1039 222.7 4.08 umc1142 146.98 4.05 umc2139 134.2 4.09
mmc0371 230.82 4.06 umc1559 141.09 4.09 umc1945 113.52 4.06 umc1999
131.55 4.09 umc1093 222.7 4.06 umc1820 138.94 4.09 umc2027 111 4.06
umc1173 168.02 4.09 bnlg1621 184.11 4.06 umc1650 139.84 4.09
umc1299 144.46 4.06 umc1328 161.33 4.09 umc1869 154.39 4.06 umc1740
98.2 4.09 bnlg2291 201.5 4.06 umc1643 145.23 4.09 bnlg1784 237.23
4.07 umc1989 100.5 4.09 dupssr34 326.01 4.07 umc1284 144.39 4.09
umc1651 99.59 4.07 umc1574 155.11 4.09 umc2038 122.19 4.07 umc2137
158.1 4.08 umc1847 160.17 4.07 umc1101 160.12 4.09 umc1620 148.2
4.07 umc2046 115.82 4.09 umc1194 162.29 4.07 phi314704 143.54 4.09
bnlg1890 251.68 4.11 phi076 158.05 4.11
DE811ASR(BC5) as Most Improved Donor for Use in Backcrossing
[0213] Although MP305 was utilized in the above experiment, as is
illustrated in FIG. 8(a), DE811ASR(BC5) retains a smaller MP305
chromosomal interval with the Rcg1 locus than DE811ASR(BC3) (and of
course MP305 as well), and therefore is particularly useful as a
donor source for the Rcg1 gene. The shortened chromosomal interval
from the DE811ASR(BC5) source has been shown to be associated with
an improved agronomic phenotype. Twenty two plants from the
DE811ASR(BC3) derived line, 20 plants from the DE811ASR(BC5)
derived line, five DE811 plants and five MP305 plants were grown in
a greenhouse from November 2005 through March 2006 and data were
taken for plant height and ear height; dates when 50% of the plants
shed pollen (midshed), when 50% of the plants had visual ear shoots
(midves) and when 50% of the plants had silks protruding from the
earshoots (midslk); and kernel color was observed. On average, the
DE811ASR(BC5) line was shorter than DE811ASR(BC3) (293 cm vs 345
cm) and the location of the ear was lower in the DE811ASR(BC5) than
in the DE811ASR(BC3) (146 cm vs 183 cm), both of which are positive
traits in terms of elite variety development. DE811ASR(BC5) was
earlier for midshed, midves and midslk compared to DE811ASR(BC3).
Midshed was approximately 1 day earlier, midves was approximately 6
days earlier and midslk was approximately 3 days earlier for
DE811ASR(BC5) compared to DE811ASR(BC3). Kernels of DE811ASR(BC5)
had a yellowish-brown (bronze) color whereas kernels of
DE811ASR(BC3) had a pale yellow cap. Dates for midshed, midves and
midslk were similar for DE811ASR(BC5) and DE811, whereas MP305 was
approximately 11 days later for midshed and did not produce 50%
visual ear shoots, nor 50% silks during the growing period. While
these data are based on only a few plants for DE811 and MP305, and
ears were not produced on those few lines, these greenhouse results
resemble observations of these lines in the field. These data
indicate that DE811ASR(BC5) resembles the DE811 recurrent parent
much more closely than DE811ASR(BC3). Thus, DE811ASR(BC5) is an
excellent initial donor source for the Rcg1 locus and the Rcg1
gene, both genotypically and phenotypically. In addition,
DE811ASR(BC5) is particularly useful when introgressing the Rcg1
locus into germplasm with similar adaptation to DE811.
[0214] DE811 was developed by J. Hawk (Hawk, J. A. (1985). Crop
Science Vol 25: p716) and has been described as a yellow dent
inbred line that originated from selfing and selection for six
generations in a pedigree program out of a cross of B68 to an
inbred derived from [B37 Ht.times. (C103.times.Mp3204 double cross)
sel.]. DE811 silked 1 to 2 days later than B73 in tests in
Delaware, but 4 days later than B73 at Missouri. Limited yield
trials indicate that DE811 has satisfactory combining ability. It
is a good silker (forms good silks, a component of the maize female
flower important for fertility) and pollen shedder and can be
crossed to earlier maturity germplasm for Northern US adaptation
and to later maturity germplasm for Southern US adaptation. Thus,
DE811ASR (BC5), in combination with the markers and breeding
methods disclosed herein, is useful as an initial donor source for
introgressing the Rcg1 gene into a wide variety of germplasm,
including germplasm adapted to all of the regions in the US where
Cg is present.
Creation of Inbred Rcg1 Locus Conversions
[0215] Following the tests for successful Rcg1 locus introgression
in PH09B described above, additional Rcg1 locus conversions were
carried out on other inbred lines. The first series had 5
backcrosses, with MP305 and DE811ASR(BC5) as donors. For the second
series of backcrosses, molecular markers were used to reduce the
chromosome interval in the BC5 conversions from the first series.
These BC5 conversions were selected for crossovers below the Rcg1
gene. Those selected plants were then backcrossed to create the BC6
generation. Plants with crossovers above the gene were selected in
the BC6 generation.
First Series of Backcrosses
[0216] In the first series, DE811ASR(BC5) was used as the primary
donor source, but parallel introgressions were also made to the
same inbreds using MP305 as a donor source. These data, described
in more detail below, show that while DE811ASR(BC5) is the
preferred donor in many situations, MP305 can also be effectively
used with the marker assisted breeding methods of the embodiments
taught herein.
[0217] Elite inbred lines primarily adapted to North American
growing conditions were selected for use as recurrent parents. The
inbreds lines initially selected for use as recurrent parents were
lines PHOR8 (U.S. Pat. No. 6,717,036), PH7CH (U.S. Pat. No.
6,730,835), PH705 (U.S. Pat. No. 6,903,25), PH5W4 (U.S. Pat. No.
6,717,040), PH51 K (U.S. Pat. No. 6,881,881) and PH87P (U.S. Pat.
No. 6,888,051). Each of these lines was crossed with DE811ASR (BC5)
as well as with MP305. The F1 generation derived from each of these
crosses was backcrossed once more to the respective inbred line,
resulting in a first backcross (the recurrent parent BC1)
generation. Seedlings were planted out and DNA was prepared from
leaf punches. PCR reactions were carried out using primers for
markers flanking the region of interest; UMC1466, UMC1418,
BNLG2162, UMC1086, UMC2041, UMC1612, CSU166, UMC1051, UMC2187,
UMC1371, and UMC1856 were used in the early BC rounds (See Table 1)
while in later BC rounds, UMC1418, BNLG2162, UMC1051, UMC2041,
UMC2187, UMC1371 and UMC1856 were used. Seedlings whose PCR
reactions gave a positive result (meaning that the MP305 derived
Rcg1 locus was present) were then further backcrossed to the
respective inbred lines to make a BC2. This procedure, called
"genotyping", identifies the genetic composition of a plant at the
site of a particular marker. These steps were repeated for the
recurrent parent BC3, BC4 and BC5 development. Analysis shows that,
after five backcrosses, these lines retained a significantly
truncated chromosomal interval comprising the Rcg1 locus, and,
based on visual observations, no indication of negative effects
resulting from the presence of the Rcg1 locus was observed.
[0218] Recurrent parent selection was also carried out by selecting
the plants most phenotypically like the recurrent parent. Using
these genotypic and phenotypic methods, high quality conversions
were selected with a high percentage of recurrent parent across the
whole genome.
[0219] This example also illustrates that flanking markers are not
used exclusively to select either for or away from the Rcg1 gene.
Seedlings whose PCR reactions gave a positive result (meaning that
the MP305 derived Rcg1 locus was present) were then further
backcrossed to the respective inbred lines to make the final
backcross (the recurrent parent BC5 generation) in this first
series. Where the closest flanking polymorphic markers determined
that the gene was present, the next set of double flanking
polymorphic markers more distal to the gene were used for recurrent
parent selection. Thus, the use of markers flanking the Rcg1 gene
or Rcg1 locus serves to illuminate the recombination occurring in
the region.
Second Series of Backcrossing
[0220] The inbred Rcg1 locus conversions made using the SSRs
flanking the Rcg1 locus in the first series of backcrossing were
then used as donors in a successive round of backcrossing. For this
series of backcrossing, SNP markers were developed for the Rcg1
gene that enabled marker assisted selection in a high throughput
manner, as described in Example 13, to select for the Rcg1 gene.
SNP markers were also designed in the region around the Rcg1 locus,
allowing flanking markers to be used to select away from the MP305
chromosomal interval surrounding the Rcg1 locus, and to select for
the recurrent parent genotype, thereby greatly reducing linkage
drag. It is only through physically mapping and cloning the gene
that such precise marker-assisted recurrent parent selection is
possible.
[0221] First, the recurrent parent BC5 plants resulting from the
first series of backcrossing were re-screened with the more precise
marker set, and recombination was selected for south of the Rcg1
gene. Flanking markers tightly linked to the Rcg1 gene (MZA8761,
MZA1851, UMC1051, and UMC2187) were used to select for recurrent
parent to the south of the gene in small population sizes of
approximately 40 progeny. (See FIG. 8(a-b)). These progeny were
then analyzed using the FLP markers disclosed herein, to more
precisely determine the point of recombination. This data showed
that some progeny were selected with recurrent parent genome less
than 1 cM (based on IBM2 Neighbors genetic map distances) south of
the Rcg1 gene, as shown in FIG. 8(b). Other progeny had recurrent
parent genome less than 4 cM south of the Rcg1 gene. These
marker-selected BC5 conversions were then used as donors, and
crossed to near-isogenic counterparts of PH705, PH5W4, PH51 K and
PH87P as the recurrent parents to give a BC6 population. Markers in
the Rcg1 gene were again used to select for Rcg1, with flanking
markers to the north of Rcg1 this time being used to select for
recurrent parent. In this round of selections, recombinations were
detected in each population between Rcg1 and the marker MZA15842.
The position of MZA15842 on the IBM2 Neighbors genetic map can be
extrapolated from its position on the high resolution map shown in
FIG. 7(b), map B, using regression relative to the flanking markers
UMC2285 and PHI093. This placed MZA15842 at 520.5 cM on the IBM2
Neighbors genetic map. Therefore, as shown in FIG. 8(b), in two
rounds of backcrossing, the donor genome was reduced to a segment
of less than 6 cM in each population, or less than 0.8% of
chromosome 4, based on the IBM2 Neighbors genetic map distances,
and in some progeny the segment was less than 2.1 cM, or less than
0.25% of chromosome 4. For comparison, the MP305 chromosomal
interval with the Rcg1 locus in DE811ASR (BC3) was 131 cM, or
approximately 16% of chromosome 4, based on the IBM2 Neighbors
genetic map distances. It is only through physically mapping and
cloning the gene that such precise and efficient marker-assisted
recurrent parent selection is possible.
Further Analysis
[0222] Therefore, as a result of fine mapping the location of the
Rcg1 gene, one may utilize any two flanking markers that are
genetically linked with the Rcg1 gene to select for a small
chromosomal region with crossovers both north and south of the Rcg1
gene. This has the benefit of reducing linkage drag, which can be a
confounding factor when trying to introgress a specific gene from
non-adapted germplasm, such as MP305, into elite germplasm, such as
the inbred lines noted above. FIGS. 7 and 22, and Table 16 show
many combinations of markers flanking the Rcg1 gene and locus that
may be used for this purpose. Some specific flanking markers that
may be used for selecting truncated chromosomal intervals that
include the Rcg1 gene or locus are UMC2285 and UMC15a, UMC2285 and
UMC2187, UMC1086 and UMC2200, UMC2041 and UMC2200, UMC2041 and
PHI093, MZA11455 and UMC15a, MZA11455 and MZA3434, MZA15842 and
MZA3434, and FLP8 and FLP33. Optionally, on or within each of these
chromosomal intervals, one could utilize at least 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more markers in order to
locate the recombination event and select for the Rcg1 gene or Rcg1
locus with the maximum amount of recurrent parent genotype.
Further, one may have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, or more markers between the north end of such
chromosomal interval and the top of the Rcg1 gene and/or between
the south end of such chromosomal interval and the bottom of the
Rcg1 gene.
[0223] It is advantageous to have closely linked flanking markers
for selection of a gene, and highly advantageous to have markers
within the gene itself. This is an improvement over the use of a
single marker or distant flanking markers, since with a single
marker or with distant flanking markers the linkage associated with
Rcg1 may be broken, and by selecting for such markers one is more
likely to inadvertently select for plants without the Rcg1 gene.
Since marker assisted selection is often used instead of phenotypic
selection once the marker-trait association has been confirmed, the
unfortunate result of such a mistake would be to select plants that
are not resistant to Cg and to discard plants that are resistant to
Cg. In this regard, markers within the Rcg1 gene are particularly
useful, since they will, by definition, remain linked with
resistance to Cg as enhanced or conferred by the gene. Further,
markers within the Rcg1 locus are just as useful for a similar
reason. Due to their very close proximity to the Rcg1 gene they are
highly likely to remain linked with the Rcg1 gene. Once
introgressed with the Rcg1 gene, such elite inbreds may be used
both for hybrid seed production and as a donor source for further
introgression of the Rcg1 gene into other inbred lines.
[0224] Thus, the data clearly shows that inbred progeny converted
by using DE811ASR(BC5) as a donor source retain the truncated MP305
chromosomal interval. The inbreds comprising the truncated MP305
chromosomal interval are very useful as donor sources themselves,
and there is no need to revert to DE811ASR(BC5) as a donor source.
By using marker assisted breeding as described herein, the
truncated MP305 chromosomal interval can be further reduced in size
as necessary without concern for losing the linkage between the
markers and the Rcg1 gene. Phenotypically, a reduced chromosomal
interval is associated with improved agronomic performance, as was
demonstrated for DE811ASR(BC5) versus DE811ASR(BC3) described
above.
Example 6
Use of Rcg1 as a Transgene to Create Resistant Corn Plants
[0225] The Rcg1 gene can be expressed as a transgene as well,
allowing modulation of its expression in different circumstances.
The following examples show how the Rcg1 gene could be expressed in
different ways to combat different diseases or protect different
portions of the plant, or simply to move the Rcg1 gene into
different corn lines as a transgene, as an alternative to the
method described in Example 5.
Example 6a
[0226] In this example, the Rcg1 gene is expressed using its own
promoter. The upstream region of the Rcg1 gene was sequenced using
the same BACs which in Example 2 provided the sequences of the
protein-coding section of the gene. The sequence of 1684 bp 5' to
the ATG is set forth in SEQ ID NO: 24.
[0227] In order to transform the complete Rcg1 gene, including the
promoter and protein encoding region, a 5910 bp fragment extending
from position 41268 through position 47176 in SEQ ID NO: 137 was
amplified by PCR using BAC clone #24 (pk257m7) as template DNA. To
enable cloning using the Gateway.RTM. Technology (Invitrogen,
Carlsbad, USA), attB sites were incorporated into the PCR primers,
and the amplified product was cloned into pDONR221 vector by
Gateway.RTM. BP recombination reaction. The resulting fragment,
flanked by attL sites, was moved by the Gateway.RTM. LR
recombination reaction into a binary vector. The construct DNA was
then used for corn transformation as described in Example 7.
Example 6b
[0228] In order to express the Rcg1 gene throughout the plant at a
low level, the coding region of the gene and its terminator are
placed behind the promoters of either a rice actin gene (U.S. Pat.
Nos. 5,641,876 and 5,684,239) or the F3.7 gene (U.S. Pat. No.
5,850,018). To enable cloning using the Gateway.RTM. Technology
(Invitrogen, Carlsbad, USA), attB sites are incorporated into PCR
primers that are used to amplify the Rcg1 gene starting 35 bp
upstream from its initiation codon. A NotI site is added to the
attB1 primer. The amplified Rcg1 product is cloned into pDONR221
vector by Gateway.RTM. BP recombination reaction (Invitrogen,
Carlsbad, USA). After cloning, the resulting Rcg1 gene is flanked
by attL sites and has a unique NotI site at 35 bp upstream the
initiation codon. Thereafter, promoter fragments are PCR amplified
using primers that contain NotI sites. Each promoter is fused to
the NotI site of Rcg1. In the final step, the chimeric gene
construct is moved by Gateway.RTM. LR recombination reaction
(Invitrogen, Carlsbad, USA) into the binary vector PHP20622. This
is used for corn transformation as described in Example 7.
Example 6c
[0229] In order to express the Rcg1 gene throughout the plant at a
high level, the coding region of the gene and its terminator were
placed behind the promoter, 5' untranslated region and an intron of
a maize ubiquitin gene (Christensen et al. (1989) Plant Mol. Biol.
12:619-632; Christensen et al. (1992) Plant Mol. Biol. 18:675-689).
To enable cloning using the Gateway.RTM. Technology (Invitrogen,
Carlsbad, USA), attB sites were incorporated into PCR primers that
were used to amplify the Rcg1 gene starting at 142 bp upstream of
the initiation codon. The amplified product was cloned into
pDONR221 (Invitrogen, Carlsbad, USA) using a Gateway.RTM. BP
recombination reaction (Invitrogen, Carlsbad, USA). After cloning,
the resulting Rcg1 gene was flanked by attL sites. In the final
step, the Rcg1 clone was moved by Gateway.RTM. LR recombination
reaction (Invitrogen, Carlsbad, USA) into a vector which contained
the maize ubiquitin promoter, 5' untranslated region and first
intron of the ubiquitin gene as described by Christensen et al.
(supra) followed by Gateway.RTM. ATTR1 and R2 sites for insertion
of the Rcg1 gene, behind the ubiquitin expression cassette. The
vector also contained a marker gene suitable for corn
transformation, so the resulting plasmid, carrying the chimeric
gene (maize ubiquitin promoter--ubiquitin 5' untranslated
region--ubiquitin intron 1--Rcg1), was suitable for corn
transformation as described in Example 7.
Example 6d
[0230] In order to express the Rcg1 gene at a stalk-preferred, low
level of expression, the coding region of the gene and its
terminator are placed behind the promoter of the Br2 gene (U.S.
application Ser. No. 10/931,077). The fragment described in Example
6b containing the Rcg1 coding region flanked by attL sites and
containing a unique NotI site 35 bp upstream of the Rcg1 initiation
codon is used to enable cloning using the Gateway.RTM. Technology
(Invitrogen, Carlsbad, USA). Promoter fragments of either Br2 or
ZM-419 are PCR amplified using primers that contain NotI sites.
Each promoter is fused to the NotI site of Rcg1. In the final step,
the chimeric gene construct is moved by Gateway.RTM. LR
recombination reaction (Invitrogen, Carlsbad, USA) into the binary
vector PHP20622. This is used for corn transformation as described
in Example 7.
Example 7
Agrobacterium-Mediated Transformation of Maize and Regeneration of
Transgenic Plants
[0231] The recombinant DNA constructs prepared in Example 6a and 6c
were used to prepare transgenic maize plants as follows.
[0232] Maize was transformed with selected polynucleotide
constructs described in Example 6a and 6c using the method of Zhao
(U.S. Pat. No. 5,981,840, and PCT patent publication WO98/32326).
Briefly, immature embryos were isolated from maize and the embryos
contacted with a suspension of Agrobacterium, where the bacteria
were capable of transferring the polynucleotide construct to at
least one cell of at least one of the immature embryos (step 1: the
infection step). In this step the immature embryos were immersed in
an Agrobacterium suspension for the initiation of inoculation. The
embryos were co-cultured for a time with the Agrobacterium (step 2:
the co-cultivation step). The immature embryos were cultured on
solid medium following the infection step. Following this
co-cultivation period an optional "resting" step was performed. In
this resting step, the embryos were incubated in the presence of at
least one antibiotic known to inhibit the growth of Agrobacterium
without the addition of a selective agent for plant transformants
(step 3: resting step). The immature embryos were cultured on solid
medium with antibiotic, but without a selecting agent, for
elimination of Agrobacterium and for a resting phase for the
infected cells. Next, inoculated embryos were cultured on medium
containing a selective agent, and growing transformed callus was
recovered (step 4: the selection step). The callus was then
regenerated into plants (step 5: the regeneration step), and calli
grown on selective medium were cultured on solid medium to
regenerate the plants.
Example 8: Transgenic Plant Evaluation
[0233] Transgenic plants were made as described in Example 7 using
the constructs described in Examples 6a and 6c, respectively. For
both the native Rcg1 gene and the ubiquitin Rcg1 gene constructs,
30 independent events and 10 vector only control events were
generated.
[0234] Leaf discs of each native gene transgenic event were
harvested for total RNA isolation. RT-PCR was performed using the
gene specific primers FLP111F and FLP111R set forth in SEQ ID NOS:
37 and 38. In 30 out of 30 transgenic events, the expected 637 bp
RT-PCR band was present indicating expression of the native gene
construct. Disease assays were performed in the greenhouse on the
same 30 native Rcg1 transgenic events to determine if the plants
were resistant to Cg. To accomplish this, leaf blight assays were
first carried out on 5 sibling plants of each event using the
procedures described in Example 10. A single event was found to
show a significant reduction in disease relative to control plants
lacking the native Rcg1 gene construct. Plants that had been
subjected to the leaf blight assay were allowed to develop two
weeks post anthesis and were then further tested by Cg inoculation
into the first elongated stalk internode. These stalk infection
assays showed a single transgenic event expressing the native Rcg1
transgene to be more resistant to infection by Cg when compared to
control plants. However, this event differed from the positive
event identified via the leaf infection assays.
[0235] Plants transformed with the ubiquitin Rcg1 construct
described in Example 6c were analyzed in a similar fashion. RT-PCR
analysis showed that 28 out of 30 transgenic events contained the
expected transcript band, indicating expression of the ubiquitin
Rcg1 construct. When leaf infection assays were performed on 5
plants from each of the 30 events, a single event was identified
that showed a statistically significant reduction in disease
compared to control plants. The transgenic plants were further
analyzed by stalk infection assays. Three events were found to
exhibit increased resistance to stalk rot when compared to control
plants lacking the ubiquitin Rcg1 gene. These transgenic events did
not include the former positive event identified in the leaf blight
assays.
[0236] The results of these experiments were considered encouraging
for the events that showed some resistance but overall inconclusive
for several reasons. Positive events showing increased disease
resistance by the leaf blight assay failed to correlate with those
identified by the stalk infection assay. This is in contrast to the
DE811ASR(BC5) positive control which shows a clear increase in
resistance relative to DE811 in both leaf blight and stalk
infection assays. In addition, assays of the primary transgenics
showed a higher degree of variability than assays of DE811 or
DE811ASR(BC5) controls. This was often seen within replicates as
well as across negative control events. This latter observation may
render discrimination of positive from negative events difficult.
The possible causes for the inconclusive nature of the disease
assay results include but are not limited to the following. It is
well known to those skilled in the art that transgenic plants being
tissue culture derived, exhibit greater plant to plant variability
than control plants that are seed derived. Moreover, gene
expression in primary transformants, that is, plants which have
been through the transformation and regeneration process described
in Example 7, is often unpredictable due to the stress of tissue
culture procedures. If, in fact, the events are negative, which
cannot be determined at this point, there are several technical
reasons why this could be the case. The assays carried out also did
not determine if the protein encoded by the Rcg1 gene is actually
present in the transgenic lines--only the presence of a segment of
the predicted mRNA was assayed using RT-PCR. It could be that
artifacts were introduced into the gene cassette during
transformation extensive Southern blots or sequencing were not
carried out to determine the integrity of the entire construct in
the transgenic lines. In order to more carefully study these
transgenic lines, plants of later generations will be grown in
larger numbers under field conditions and assayed for disease
resistance. It is anticipated that these future transgenic plants
will more clearly exhibit increased resistance to Cg.
Example 9
Analysis of Rcg1 Gene Distribution Across Germplasm and
Identification of Rcg1 Sequence Variants
[0237] Following the identification, sequencing and fine mapping of
Rcg1, other lines were screened for the Rcg1 gene. To determine the
presence of the Rcg1 gene in other maize germplasm, gene specific
primers combinations FLP111F and FLP111R as well as FLP113F and
FLPA1R were used to amplify genomic DNA from a diverse panel of
maize inbred lines, including those lines listed on Table 18 and
F2834T, by polymerase chain reaction. In only 14 (including MP305)
out of the panel of maize inbred lines an amplification product was
detected, indicating that the Rcg1 gene is only present in a very
small percentage of the inbred lines that were screened. Thus, in
addition to using MP305 or DE811ASR (BC5) as the donor source,
other sources containing the Rcg1 gene can also be used as a donor
source. For example the public inbred lines TX601 (available under
ID `Ames 22763` from National Plant Germplasm System (NPGS)) and
F2834T (available under ID `Ames 27112` from NPGS) which contain
the Rcg1 gene can be used as donor sources in crosses with other
maize inbred lines not containing the Rcg1 gene, and selecting for
the Rcg1 gene by using markers as described herein.
[0238] Variants of the Rcg1 gene were also identified and analyzed
for single nucleotide polymorphisms (SNPs). SNPs were identified at
positions on Sequence ID number 1 corresponding to one or more of
position 413, 958, 971, 1099, 1154, 1235, 1250, 1308, 1607, 2001,
2598 and 3342. (See Table 7). Not all of the allelic variants of
the Rcg1 gene indicated a resistant phenotype. Therefore, these
SNPs can be used as markers to precisely identify and track the
Rcg1 sequence in a plant breeding program, and to distinguish
between resistant and susceptible allelic variants. Further, these
SNPs indicate that there are variant sequences that show a
resistant phenotype and can be used in the methods and products
disclosed herein. Four other lines have also been found to contain
an Rcg1 allele: BYD10, 7F11, CML261 and CML277. Testing of 10
plants did not provide sufficient data to conclusively determine
whether line 7F11 is resistant. No data are available on the
resistance of the BYD10, CML261 and CML277 lines, and sequencing of
these alleles has not been completed.
TABLE-US-00007 TABLE 7 SNPs identified in allelic variants of the
Rcg1 gene # Plants Consensus position Phenotype Tested 413 958 971
1099 1154 1235 1250 1308 1607 2001 2598 3342 SEQ ID NO: 1 Resistant
Over 500 A A G C C A A C A A G C from plants over DE811ASR (BC5)
4-5 years PHBTB Resistant 150-210, over A A G C C A A : A G C A 3
years PH26T Resistant 50, over 1 A A G C C A A : A A G C year TX601
Insufficient 10, over 1 A A G C C ? A : A A G C data year F28341 No
data -- A A G C C A A : A A G C B54 No data -- C C C T A A T : G G
A A PH0RC Insufficient 19, over 1 C C C T A A T : G G A A data year
PH277 Insufficient 17, over 1 C C C T A A T : G G A A data year
PHDGP Susceptible 150-210, over C C C T A A T : G G A A 3 years
PHDH7 No data -- C C C T A A T : G G A A MP305 (public) Resistant
50 A A G C C A A C A A G C Length of Consensus = 4212 nucleotides.
SEQ ID NO: 1 is the Rcg1 sequence. For the remaining lines, the
sequence available spanned from the "atg" start codon in the first
exon to the "tga" stop codon in the second exon. The consensus
position is based on SEQ ID NO: 1.
Example 10
Lines Containing the Rcg1 Gene are Resistant to Anthracnose-Induced
Leaf Blight
[0239] The near isogenic lines DE811 and DE811ASR described in
Example 1 were tested for differences in resistance to leaf blight
caused by Cg using the following procedure. Four common household
sewing needles were glued to a metal support such that the holes
for the thread extended out from the piece of metal, with all four
needles extending an equal distance. This apparatus was dipped in a
suspension of Cg spores at 5.times.10.sup.6 spores/mL and then
pushed through the surface of a young corn leaf such that the leaf
was wounded and the wounds simultaneously inoculated with the
spores. A wet cotton swab was placed on the midrib near the
inoculation site and the entire area covered with plastic film and,
over that, reflective cloth, both attached with tape, to keep it
moist and shaded. The plants were left in this state for 50-54
hours in a standard greenhouse, after which the tape, cloth and
plastic film were removed. At 7 and 15 days after inoculation the
size of the lesion was measured and recorded in units of square
centimeters.
[0240] FIG. 10(a-b) shows the distribution of lesion sizes 15 days
after inoculation across all the individual leaves. Lesion sizes
vary in each data set, but virtually all of the DE811 leaves (FIG.
10b) had lesion sizes significantly larger than the largest lesions
to be found on the DE811ASR(BC5) leaves (FIG. 10a). The data are
summarized for both the 7 day and 15 day post-inoculation data sets
in FIG. 11. At both 7 and 15 days, the average lesion size was
smaller on the leaves carrying the Rcg1 gene. The difference
becomes larger over time as the fungus has time to grow and cause
further damage, so that while the difference is approximately two
fold at 7 days, by 15 days it is more than four fold and in fact
the fungus has made only minor progress on the DE811ASR(BC5)
leaves. These results clearly demonstrate that the presence of the
locus containing the Rcg1 gene confers resistance to anthracnose
leaf blight.
Example 11
Hybrid Lines Derived from DE811ASR(BC5) have Higher Yield than
Hybrids Derived from DE811 when Infected with Colletotrichum
graminicola
[0241] In order to demonstrate that corn hybrids containing the
Rcg1 gene have higher yield potential when infected with Cg than
hybrid lines without Rcg1, DE811ASR (BC5) and DE811, the isogenic
lines described in Example 1, were each crossed to inbred lines
B73Ht and Mol 7Ht, which are both susceptible to Cg.
[0242] The hybrid lines were grown and evaluated for response to Cg
in 2005 at six locations in five different states of the USA. For
each hybrid line, three replications of four rows were planted at
approximately 74,000 plants per hectare. Plants were inoculated
with Cg at the base of the stalk approximately 10 days after
flowering. The first row of each four-row plot was evaluated to
determine if the inoculations had been successful by determining
the response to Cg four to five weeks after inoculation. The stalks
were split and the progression of the disease was scored by
observation of the characteristic black color of the fungus as it
grows up the stalk. Disease ratings were conducted as described by
Jung et al. (1994) Theoretical and Applied Genetics, 89:413-418).
The total number of internodes discolored greater than 75%
(antgr75) was recorded on the first five internodes (See FIG. 20).
This provided a disease score ranging from 0 to 5, with zero
indicating no internodes more than 75% discolored and 5 indicating
complete discoloration of the first five internodes. The center two
plots were harvested via combine at physiological maturity and
grain yield in kg/ha was determined.
[0243] The results summarized over all locations are shown in FIG.
12 for disease severity and in FIG. 13 for yield. The data show
that hybrids containing Rcg1 (DE811ASR(BC5)/B73Ht and
DE811ASR(BC5)/Mo17Ht) have much less disease progression than
hybrids without Rcg1 (DE811/B73Ht and DE811/Mo17Ht). The high
scores for disease progression in the susceptible hybrids (lacking
Rcg1) show the successful infection of the experiment with Cg.
Furthermore, the data show that when infected with Cg, hybrids
containing Rcg1 have a higher yield than hybrids lacking Rcg1.
Differences of the individual pairwise comparisons are significant
at P<0.05.
[0244] These results clearly demonstrate that by using the methods
of the embodiments one can create hybrids which yield more kg of
grain per hectare when infected with Cg.
Example 12
Inbred and Hybrid Rcg1 Locus Conversions Derived from DE811ASR
(BC5) or MP305 are Resistant to Colletotrichum graminicola Induced
Stalk Rot
[0245] In order to demonstrate that commercial corn lines can be
made resistant to Cg-induced stalk rot, MP305 and DE811ASR (BC5)
were crossed with PH87P, PH5W4, and PH705. The resulting progeny
were crossed again to the same three lines (i.e., the lines were
used as recurrent parents in a backcrossing program) three more
times, each time selecting for the presence of the Rcg1 gene using
molecular markers as described in Example 5 above. As controls,
selected backcross lines which lacked the Rcg1 gene were also
collected from the same backcrossing program. After three
backcrosses were completed, several versions were selected and
selfed to obtain BC3S1 families. Individual BC3S1 plants were
genotyped and plants homozygous positive and homozygous negative
for Rcg1 were selfed to obtain BC3S2 families, which were then
phenotyped. BC3S2 versions containing Rcg1 and, as controls,
selected versions without the gene, were planted in single row
plots containing approximately 25 plants per row. The experiment
was planted in five different locations in five different states of
the United States, designated Locations 1, 2, 3, 4, and 5. At
approximately two weeks after flowering, plants were inoculated
with Cg at the base of the stalk. Four to five weeks later the
stalks were split and progression of the disease evaluated by
visually estimating the amount of disease in the stalk. A visual
score was assigned to each stalk based on the degree of infection
of each internode for the inoculated internode and the four
internodes above the inoculation internode. A low score thus
indicates resistance to the disease. The compiled results for all
rows and locations are summarized in FIG. 14. Representative
pictures of two lines are shown in FIGS. 15 and 16. The data show
that at all locations, each of the elite inbred lines was made more
resistant to the disease by the presence of the Rcg1 gene.
[0246] Corn seed sold to farmers is "hybrid," meaning that it is
most commonly the result of a cross of two inbred parents, referred
to as a single cross hybrid. Many years of breeding and production
experience have shown that the use of single cross hybrids result
in higher yields. It is thus important for commercial applications
that the Rcg1 gene function in the hybrid plants (those in the
farmer's production field) even when it is present in only one of
the two parents used to make single cross hybrid seed. One of the
inbred lines into which the Rcg1 line had been crossed, PH705, was
thus used to create hybrid seed by crossing with PH4CV, an elite
inbred that does not carry the Rcg1 gene. The resulting hybrid
seeds were used in experiments identical to those described for the
inbred lines as discussed above and scored in the same way at all
five locations. The data are summarized for all locations in FIG.
17, which also shows the performance of the inbred PH705, and
representative pictures shown in FIGS. 18 and 19. As can be seen, a
clear difference in disease progression was observed in all
locations for hybrid PH705.times.PH5W4 and in four of the five
locations for PH705.times.PH87P. In the fifth location,
environmental conditions were very stressful for plant growth,
resulting in plants that were in poor condition. Under these
conditions, measurements of plant disease resistance are often not
reliable.
[0247] The results with both inbred lines and hybrid combinations
containing Rcg1 clearly demonstrate that using the methods of the
embodiments one can create commercially useful lines which are
resistant to Cg-induced stalk rot.
Example 13
Markers within the Rcg1 Coding Sequence, Marker Locations and
Designs within the Rcg1 Locus, and Haplotypes for the Flanking
Chromosomal Region
[0248] Three levels of marker locations may be utilized as a result
of the fine mapping and cloning of the Rcg1 gene, markers designed
within the Rcg1 coding sequence, markers designed within the
non-colinear region that identify the Rcg1 locus (but outside of
the Rcg1 coding sequence), and markers designed within the flanking
colinear region.
Markers within the Rcg1 Coding Sequence
[0249] Following the identification and fine mapping of the Rcg1
gene, hybridization markers were designed that will function on SNP
platforms. Since the Rcg1 gene occurs in a non-colinear region of
the maize genome, the hybridization marker will be present in lines
comprising the Rcg1 gene and absent on lines that do not comprise
the Rcg1 gene. These markers identify polynucleotide sequences
specific to the Rcg1 coding sequence listed on SEQ ID NO: 1. As
noted in Table 7, there are other corn lines with variants of the
Rcg1 coding sequence set forth in SEQ ID NO: 1, and these markers
were also designed to also identify these Rcg1 coding sequence
variants.
[0250] To accomplish this, a consensus map of variant Rcg1 coding
sequence from different sources was created, as shown on Table 7.
This consensus map aligned 4209 bases of the Rcg1 coding sequence
isolated from MP305 with 3451 bases from PHBTB and 3457 bases from
PH26T. The Rcg1 gene in both PHBTB and PH26T show resistance to
anthracnose. Next, segments of the Rcg1 coding sequence were
BLASTed against several databases including NT (Public DNA from
NCBI) and the highest homology hits were aligned with the Rcg1
consensus sequence to determine the segments that shared high
homology and had common segments with other resistance genes in the
NBS-LRR family. Regions unique to the Rcg1 coding sequence and
common across the different sources of Rcg1 were selected for
marker design. Specifically, since FLP111F and FLP111R primers
produced a single amplicon that reliably diagnosed the presence of
Rcg1 from different sources, the regions where FLP111F and FLP111R
hybridized were therefore targeted for development of a SNP marker
design.
[0251] An Invader.TM. (Third Wave Technologies, Madison, Wis.)
marker was designed using a 1413 bp segment from the consensus
sequence that contained both primer sites, with the primer regions
themselves being targeted for probe and Invader.TM. oligo
hybridization. Primers were designed around each probe site to give
an amplicon size below 150 bp. This marker indicated the presence
of the Rcg1 coding sequence with fluorescence due to hybridization,
with the absence of the Rcg1 coding sequence resulting in no
fluorescence. A control fluorescence signal can also be generated
by designing a marker that hybridizes to a second highly conserved
maize gene, so that the presence of the Rcg1 coding sequence
results in fluorescence of two dyes (Rcg1 and the conserved gene)
and the absence of Rcg1 results in fluorescence due to the
conserved gene only. This `control` florescence may be used to
reduce lab error by distinguishing between the situations where the
Rcg1 is in fact absent and the situation where a false negative has
occurred because of a failed reaction. Such markers are not limited
to a specific marker detection platform. Taqman.RTM. markers
(Applied Biosystems) were also designed to the same location
(primer pairs FLP111F and FLP111R), that were used as for the
Invader.TM. markers. The markers are shown on Table 15 and FIGS. 23
and 24.
[0252] The marker designs C00060-01-A and C00060-02-A were tested
across a wide variety of sources and were highly successful at
identifying plants that contained the Rcg1 locus and the Rcg1 gene,
regardless of the source of the Rcg1 locus or Rcg1 gene. These
markers were also used against a control set of nearly 100 diverse
inbred lines known not to carry the gene, and no fluorescence was
detected in the control set. Plants in which one or both of marker
designs C00060-01-A and C00060-02-A confirmed as having Rcg1
include those shown in Table 7.
[0253] Therefore, this example shows that, based on the teaching
provided herein, markers can be constructed that identify the Rcg1
coding sequence in a variety of sources.
Markers within the Rcg1 Locus
[0254] Markers may be designed to the Rcg1 locus in addition to or
instead of using markers within the Rcg1 coding sequence itself.
The close physical distance between the Rcg1 coding sequence and
the non-colinear region makes it unlikely that the linkage between
markers within the non-colinear region but outside of the Rcg1
coding sequence would be lost through recombination. As with
markers for the Rcg1 coding sequence, a marker showing as present
or absent would be sufficient to identify the Rcg1 locus.
[0255] To design markers for this region, a 64,460 bp segment of
non-colinear region including the Rcg1 gene and the region directly
north of the Rcg1 gene was sequenced. BACs in this sequence were
broken up into sub-clones of approximately 800 nucleotides in
length and sequenced. These sequences were then assembled to
construct the BAC sequence, and genic and repetitive regions were
identified. Repetitive regions were identified in order to avoid
placing markers in repetitive regions. Similarly, sequences with
high homology with known maize sequences were easily avoided by a
simple BLAST search. Potential sequences were avoided that
contained SSRs, runs of As, Ts or Gs, or that would result in the
generation of probes low in GC content which can cause problems
within the Invader.TM. platform. See FIG. 9(b) and Table 17.
[0256] Selected segments were then put into Invader Creator.TM.
software (Third Wave, Madison, Wis.), which generates oligos for an
Invader.TM. reaction. This produced a sense and an anti-sense
design for all SNPs. The sense designs with the best scores and no
penalties were selected. Although these markers have been designed,
they have not yet been tested.
[0257] Primers were designed using Primer3 (Steve Rozen and Helen
J. Skaletsky (2000) Primer3 available on the world wide web for
general users and for biologist programmers. In: Krawetz S, Misener
S (eds) Bioinformatics Methods and Protocols: Methods in Molecular
Biology. Humana Press, Totowa, N.J., pp 365-386). Primers were
selected outside of the Invader.TM. components, and preferred
primers close to or below 150 bp long were selected. Primer
temperature and length was adjusted to be most useful for the
Invader.TM. platform, although if using other detection platforms
primers would be optimized for use with such platforms.
Markers in the Colinear Region and Associated Haplotypes
[0258] Closely linked markers flanking the Rcg1 locus may be
effectively used to select for a progeny plant that has inherited
the Rcg1 locus from a parent that comprises the Rcg1 locus. The
markers described herein, such as those listed on Table 16, as well
as other markers genetically or physically mapped to the same
chromosomal segment, may be used to select for a truncated
chromosomal segment comprising the Rcg1 locus. Typically, a set of
these markers will be used, (e.g., 2 or more, 3 or more, 4 or more,
5 or more) in the flanking region above the gene and a similar set
in the flanking region below the gene. Optionally, as described
above, a marker within the Rcg1 gene and/or Rcg1 locus may also be
used. The parents and their progeny are screened for these sets of
markers, and the markers that are polymorphic between the two
parents are used for selection. The most proximal polymorphic
markers to the Rcg1 gene or Rcg1 locus are used to select for the
gene or locus, and the more distal polymorphic markers are used to
select against the gene or locus. In an introgression program, this
allows for selection of the Rcg1 gene or Rcg1 locus genotype at the
more proximal polymorphic markers, and selection for the recurrent
parent genotype at the more distal polymorphic markers. As
described in more detail in Example 5 above, this process allowed
for the efficient selection of a truncated chromosomal segment
comprising the Rcg1 locus.
[0259] The process described above requires knowledge of the
parental genotypes used in the cross. Optionally, haplotypes may be
used so that the Rcg1 gene or Rcg1 locus can be selected for
without first genotyping the specific parents used in the cross.
This is a highly efficient way to select for the Rcg1 locus,
especially in the absence of using markers within the Rcg1 gene or
the Rcg1 locus.
[0260] All plants to be used in the breeding program, such as a
gene introgression program, are screened with markers. The markers
disclosed herein or equivalent markers on the same chromosomal
segment may be used. The plant haplotypes (a series of SNP or other
markers in linkage disequilibrium) are noted. The haplotype of the
resistant plant around the Rcg1 locus is compared with the
haplotype of the other plants to be used that do not comprise the
Rcg1 locus. A haplotype unique to the resistant plant around the
Rcg1 locus is then used for selection, and this haplotype will
specifically identify the chromosomal segment from the resistant
plant with the Rcg1 locus.
[0261] Based on an analysis of MP305 and a diverse set of several
hundred corn lines, including 50 public corn lines shown in Table
18, a unique SNP haplotype for the MP305 chromosomal segment with
the Rcg1 locus was identified. This SNP haplotype uniquely
identifies the MP305 chromosomal segment that extends across
MZA3434, MZA2591 and MZA11123. See FIG. 22, SEQ ID NO: 140, 141 and
142, and Tables 8, 9 and 10.
[0262] First, the primer pairs described in Table 2 for these three
MZA's were used to identify haplotypes. The primer pairs MZA3434 E
forward and reverse were used to amplify the genomic DNA of the set
of corn lines. The PCR fragments were further purified by
amplification with MZA3434 I forward and reverse primer pairs. This
process was repeated for MZA2591 and MZA11123. The resulting PCR
fragments were sequenced in the forward and reverse direction and
the sequences were aligned to give a consensus sequence (see the
sequences set forth in SEQ ID NOs: 140, 141 and 142). SNPs and
indels within these consensus sequences are shown in Tables 8, 9
and 10. These series of SNPs and indels were compared across the
set of genotypes.
[0263] For MZA3434, haplotype 8 was a rare haplotype allele, and
was unique to MP305 and only one other corn line. This process was
repeated for MZA2591, and MP305 was found to have haplotype 2 at
MZA2591, which was shared by only two other corn lines. MP305 was
the only corn line to have both haplotype 8 at MZA3434 and
haplotype 2 at MZA2591, and therefore, the combination of these two
haplotypes, 8 at MZA3434 and 2 at MZA2591, uniquely identifies the
MP305 chromosomal region comprising the Rcg1 locus. MP305 also had
an informative haplotype at MZA11123. MP305 was found to have
haplotype 7, which was shared by 66 other corn lines, but none of
these corn lines had haplotype 8 at MZA3434, or haplotype 2 at
MZA2591. Therefore, any combination of 2 haplotypes at MZA3434,
MZA2591 or MZA11123 could be used to uniquely identify MP305 among
these genotypes. The haplotypes can then be interrogated by
sequencing the fragment or by designing markers to each SNP or
indel within a fragment.
[0264] Polymorphisms within haplotypes can be used to tag the
haplotype. So called `Tag-SNPs`, or `haplotype-tags` can be very
useful in plant breeding, as more information than the polymorphism
itself can be determined via extrapolation to the haplotype. A
haplotype can also be defined as a series of polymorphisms across
sequences, and these may be termed `long-range haplotypes`.
[0265] Rare polymorphisms were observed within haplotypes that
could be used as taplotype tags'. For example, either the SNPs
MZA2591.32 (allele c) or MZA2591.35 (allele t) could be used to tag
the haplotype 2 at MZA2591, and like haplotype 2, both were unique
to MP305 and two other corn lines. The combination of SNPs
MZA2591.32 (allele c) and MZA2591.35 (allele t) combined with
MZA3434.17 (allele c) gave a `long-range` haplotype that could be
used to distinguish MP305 from all of the other genotypes in the
study.
[0266] In addition, other markers, MZA15842, MZA11455, MZA8761 and
MZA1851 also showed polymorphism with MP305. For MZA15842, only 18
of the other corn lines shared the same haplotype as MP305; for
MZA11455, only 43 of the other corn lines shared the same haplotype
as MP305; for MZA8761, only about half of the other corn lines
shared the same haplotype as MP305; and for MZA1851, only about
half of the other corn lines shared the same haplotype as MP305.
Consensus sequences were developed for these markers, and are set
forth in SEQ ID NOs: 143-146. SNPs and indels within these
consensus sequences are shown in Tables 11-14. Four examples of
unique haplotypes using the MZA markers are:
MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA8761 (haplotype 1)
and MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA1851
(haplotype 1)
And
[0267] MZA11455 (haplotype 6) MZA11123 (haplotype 7) MZA15842
(haplotype 3) MZA16510 (haplotype 4) and MZA11455 (haplotype 6)
MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA11394 (haplotype
6).
[0268] Multiple combination within all of the markers disclosed
herein, or other markers within the region, also will contain
unique haplotypes that identify the Rcg1 locus.
TABLE-US-00008 TABLE 8 MZA3434 Polymorphisms M = "Mutant`: differs
to consensus W = `wild type`: same as consensus, MZA3434.3
MZA3434.4 MZA3434.6 MZA3434.17 MZA3434.2 MZA3434.5 Nucleotide
position 282 283 327 343 377 387 on SEQ ID NO: 140 Type DEL DEL DEL
SNP DEL DEL Size of indel 6 1 4 2 2 MP305 W M W C W M Counter
allele M W M T M W
TABLE-US-00009 TABLE 9 MZA2591 Polymorphisms M = "Mutant`: differs
to consensus W = `wild type`: same as consensus, MZA2591.43
MZA2591.20 MZA2591.21 MZA2591.8 MZA2591.12 MZA2591.4 Nucleotide
position 101 114 124 131 160 176 on SEQ ID NO: 141 Type INS SNP SNP
DEL DEL INS Size of indel 3 2 3 MP305 W T C W W W Counter allele M
A T M M M MZA2591.31 MZA2591.32 MZA2591.1 MZA2591.33 MZA2591.35
MZA2591.36 Nucleotide position 213 223 238 250 257 264 on SEQ ID
NO: 141 Type SNP SNP DEL SNP SNP SNP Size of indel 2 MP305 T C M C
T C Counter allele C T W G A G
TABLE-US-00010 TABLE 9 MZA2591 M = "Mutant`: differs to consensus W
= `wild type`: same as consensus, MZA2591.37 MZA2591.38 MZA2591.10
MZA2591.39 MZA2591.3 Nucleotide position 271 282 290 310 313 on SEQ
ID NO: 141 Type SNP SNP DEL SNP DEL Size of indel 4 2 MP305 G C M T
M Counter Allele A T W C W MZA2591.40 MZA2591.41 MZA2591.6
MZA2591.7 MZA2591.9 Nucleotide position 325 332 332 371 404 on SEQ
ID NO: 141 Type SNP SNP DEL DEL DEL Size of indel 1 MP305 T C W W W
Counter Allele C T M M M
TABLE-US-00011 TABLE 10 MZA11123 Polymorphisms M = "Mutant`:
differs to consensus W = `wild type`: same as consensus, MZA11123.5
MZA11123.18 MZA11123.2 MZA11123.13 MZA11123.34 MZA11123.37
MZA11123.40 MZA11123.41 Nucleotide 631 641 650 671 703 727 744 786
position on SEQ ID NO: 142 Type DEL INS INS INS SNP SNP SNP SNP
Size of indel 1 1 1 10 MP305 W W W W G T C A Counter allele M M M M
A C A G MZA11123.45 MZA11123.48 MZA11123.9 MZA11123.19 MZA11123.59
MZA11123.17 MZA11123.16 Nucleotide 807 864 915 934 956 991 1010
position on SEQ ID NO: 142 Type SNP SNP INS DEL SNP DEL DEL Size of
indel 18 1 3 3 MP305 C T W W C M W Counter allele A A M M T W M
TABLE-US-00012 TABLE 11 MZA15842 Polymorphisms M = "Mutant`:
differs to consensus W = `wild type`: same as consensus, MZA15842.3
MZA15842.4 MZA15842.5 MZA15842.7 MZA15842.8 Nucleotide position 287
295 313 337 353 on SEQ ID NO: 143 Type SNP SNP SNP SNP SNP MP305 T
A T C T Counter Allele C G A T C MZA15842.9 MZA15842.10 MZA15842.11
MZA15842.12 MZA15842.3 Nucleotide position 366 436 439 463 287 on
SEQ ID NO: 143 Type SNP SNP SNP SNP SNP MP305 T G A A T Counter
Allele C A G G C
TABLE-US-00013 TABLE 12 MZA8761 Polymorphisms M = "Mutant`: differs
to consensus W = `wild type`: same as consensus, MZA8761.3
MZA8761.6 MZA8761.7 MZA8761.8 MZA8761.9 MZA8761.10 MZA8761.11
Nucleotide position 595 633 671 681 687 696 702 on SEQ ID NO: 145
Type DEL SNP SNP SNP SNP SNP SNP Size of indel 7 MP305 W G T G T G
C Counter allele M A C C C T A MZA8761.4 MZA8761.2 MZA8761.1
MZA8761.5 MZA8761.12 MZA8761.13 MZA8761.14 Nucleotide position 710
710 710 722 779 882 901 on SEQ ID NO: 145 Type DEL DEL INS DEL SNP
SNP SNP Size of indel 1 1 1 1 MP305 W W W W T C T Counter allele M
M M M G T C
TABLE-US-00014 TABLE 13 MZA1851 Polymorphisms M = "Mutant`: differs
to consensus W = `wild type`: same as consensus, MZA1851.24
MZA1851.41 MZA1851.32 MZA1851.49 MZA1851.51 MZA1851.52 Nucleotide
position 1213 1236 1271 1465 1615 1617 on SEQ ID NO: 144 Type INS
SNP INS SNP SNP SNP Size of indel 19 34 MP305 W G W A C A Counter
Allele M A M G A C MZA1851.53 MZA1851.54 MZA1851.55 MZA1851.56
MZA1851.35 Nucleotide position 1686 1697 1698 1701 1717 on SEQ ID
NO: 144 Type SNP SNP SNP SNP DEL Size of indel 6 MP305 T A G T W
Counter Allele C C C C M
TABLE-US-00015 TABLE 14 MZA11455 Polymorphisms M = "Mutant`:
differs to consensus W = `wild type`: same as consensus, MZA11455.3
MZA11455.5 MZA11455.2 MZA11455.7 MZA11455.8 MZA11455.10 MZA11455.11
MZA11455.12 Nucleotide 373 392 402 425 426 432 435 491 position on
SEQ ID NO: 146 Type DEL SNP DEL SNP SNP SNP SNP SNP Size of indel 1
10 MP305 M G M G C C A T Counter allele W C W A G G G A MZA11455.4
MZA11455.13 MZA11455.14 MZA11455.15 MZA11455.1 MZA11455.17
MZA11455.18 MZA11455.19 Nucleotide 526 552 581 599 610 611 628 634
position on SEQ ID NO: 146 Type DEL SNP SNP SNP DEL SNP SNP SNP
Size of indel 1 3 MP305 M A G G W G C A Counter allele W G A C M A
G C
TABLE-US-00016 TABLE 15 Markers within the Rcg1 Coding Sequence SNP
Platform Invader Invader Taqman Taqman PCR Marker Name C00060-01-A
C00060-02-A C00060-01 C00060-02 FLP111 Forward Primer C00060-01-F1
C00060-02-F1 C00060-01-F-Taq C00060-02-F-Taq FLP111F Name Position
on 550-567 1562-1586 552-568 1634-1659 595-619 SEQ ID NO: 1 Forward
Primer SEQ ID NO: 145 SEQ ID NO: 146 SEQ ID NO: 147 SEQ ID NO: 148
SEQ ID NO: 37 Sequence Reverse Primer C00060-01-R1 C00060-02-R1
C00060-01-R-Taq C00060-02-R-Taq FLP111RB Name Position on 641-658
1739-1767 599-620 1707-1730 1676-1700 SEQ ID NO: 1 Reverse Primer
SEQ ID NO: 149 SEQ ID NO: 150 SEQ ID NO: 151 SEQ ID NO: 152 SEQ ID
NO: 153 Sequence Probe Name C00060-01-PCA C00060-02-PCA
C00060-01-P-Taq C00060-02-P-Taq Position on 586-603 1685-1701
570-595 1662-1693 SEQ ID NO: 1 Probe Sequence SEQ ID NO: 154 SEQ ID
NO: 155 SEQ ID NO: 156 SEQ ID NO: 157
TABLE-US-00017 TABLE 16 Markers contained within defined
chromosomal intervals that can be used to select for Rcg1. The
public markers are taken from the IBM2 neighbors 4 map, while the
relative locations of the Pioneer markers (prefix `MZA`) were
determined by mapping to the same genetic map, and by location on
the physical map. Interval (and position on IBM2 Position neighbors
4 relative to map in cM) Rcg1 Markers that could be used for
selection of Rcg1 UMC2041 Above the UMC2041, AY112127, UMC1086,
AY110631, UMC2285, (483.93)- Rcg1 gene MZA8136, MZA6064, NPI270,
NPI300C, PHP20071, UMC2200 UMC2041- CDO127a, RGPI102, UAZI22,
BNL17.05, MZA11455, (543.44) Rcg1 MZA15842, MZA11123, MZA2591 Below
the PHI093, MZAI215, MZAI216, MZA3434, CL12681_1, Rcg1 gene NPI444,
UMC15a, MZA8761, CSU166a, CDO365, Rcg1- CSU1038b, CSU1073b,
CSU597a, RGPG111, UMN433, UMC2200 PHP20562, C2, NPI910, CSU178a,
CSU202, TDA44, MZA1851, UMC1051, MZA11394, PCO136722, UMC2187,
NPI410, PSR109B, UMC1371, UMC1842, UMC1856, AY109980, UMC1132,
NFD106, AY105971, AY110989, ENSI002A, RZ596B, BNL23A, BNL29,
UMC2200 UMCI 086 Above the UMC1086, AY110631, UMC2285, MZA8136,
MZA6064, (500.59)- Rcg1 gene NPI270, NPI300C, PHP20071, CDO127a,
RGPI102, UMC2200 UMCI 086- UAZ122, BNL17.05, MZA11455, MZA15842,
MZA11123, (543.44) Rcg1 MZA2591 Below the PHI093, MZA1215, MZA1216,
MZA3434, CL12681_1, Rcg1 gene NPI444, UMC15a, MZA8761, CSU166a,
CDO365, Rcg1- CSU1038b, CSU1073b, CSU597a, RGPG111, UMN433, UMC2200
PHP20562, C2, NPI910, CSU178a, CSU202, TDA44, MZA1851, UMC1051,
MZA11394, PCO136722, UMC2187, NPI410, PSR109B, UMC1371, UMC1842,
UMC1856, AY109980, UMC1132, NFD106, AY105971, AY110989, ENSI002A,
RZ596B, BNL23A, BNL29, UMC2200 UMC2285 Above the UMC2285, MZA8I36,
MZA6064, NPI270, NPI300C, (514.9)- Rcg1 gene PHP20071, CDO127a,
RGPI102, UAZ122, BNL17.05, UMC2187 UMC2285- MZA11455, MZA15842,
MZA11123, MZA2591 (531.7) Rcg1 Below the PHI093, MZA1215, MZA1216,
MZA3434, CL12681_1, Rcg1 gene NPI444, UMC15a, MZA8761, CSU166a,
CDO365, Rcg1- CSU1038b, CSU1073b, CSU597a, RGPG111, UMN433, UMC2187
PHP20562, C2, NPI910, CSU178a, CSU202, TDA44, MZA1851, UMC1051,
MZA11394, PCO136722, UMC2187 Within Above the MZA8136, MZA6064,
NPI270, NPI300C, PHP20071, UMC2285 Rcg1 gene, CDO127a, RGPI102,
UAZ122, BNL17.05, MZA11455, (514.9)- within MZA15842, MZA11123,
MZA2591 UMC15a UMC2285- (525.8) Rcg1 Below the PHI093, MZA1215,
MZA1216, MZA3434, CL12681_1, Rcg1 gene, NPI444 within Rcg1-
UMC15a
TABLE-US-00018 TABLE 17 Markers Within the Rcg1 Locus SNP sequence
Marker position on Name SEQ ID NO: 137 SNP Sequence Invader Oligo
Invader Probe Forward Primer Reverse Primer PHD0001-01 12-270 SEQ
ID NO: 158 SEQ ID NO: 159 SEQ ID NO: 160 SEQ ID NO: 161 SEQ ID NO:
162 PHD0002-01 272-530 SEQ ID NO: 163 SEQ ID NO: 164 SEQ ID NO: 165
SEQ ID NO: 166 SEQ ID NO: 167 PHD0003-01 7232-7500 SEQ ID NO: 168
SEQ ID NO: 169 SEQ ID NO: 170 SEQ ID NO: 171 SEQ ID NO: 172
PHD0004-01 11302-11580 SEQ ID NO: 173 SEQ ID NO: 174 SEQ ID NO: 175
SEQ ID NO: 176 SEQ ID NO: 177 PHD0005-01 11581-11880 SEQ ID NO: 178
SEQ ID NO: 179 SEQ ID NO: 180 SEQ ID NO: 181 SEQ ID NO: 182
PHD0006-01 11881-12170 SEQ ID NO: 183 SEQ ID NO: 184 SEQ ID NO: 185
SEQ ID NO: 186 SEQ ID NO: 187 PHD0007-01 12171-12470 SEQ ID NO: 188
SEQ ID NO: 189 SEQ ID NO: 190 SEQ ID NO: 191 SEQ ID NO: 192
PHD0008-01 25417-25690 SEQ ID NO: 193 SEQ ID NO: 194 SEQ ID NO: 195
SEQ ID NO: 196 SEQ ID NO: 197 PHD0009-01 25692-25950 SEQ ID NO: 198
SEQ ID NO: 199 SEQ ID NO: 200 SEQ ID NO: 201 SEQ ID NO: 202
PHD0010-01 25951-26200 SEQ ID NO: 203 SEQ ID NO: 204 SEQ ID NO: 205
SEQ ID NO: 206 SEQ ID NO: 207 PHD0011-01 26602-26860 SEQ ID NO: 208
SEQ ID NO: 209 SEQ ID NO: 210 SEQ ID NO: 211 SEQ ID NO: 212
PHD0012-01 26932-27200 SEQ ID NO: 213 SEQ ID NO: 214 SEQ ID NO: 215
SEQ ID NO: 216 SEQ ID NO: 217 PHD0013-01 27322-27580 SEQ ID NO: 218
SEQ ID NO: 219 SEQ ID NO: 220 SEQ ID NO: 221 SEQ ID NO: 222
PHD0014-01 28472-28740 SEQ ID NO: 223 SEQ ID NO: 224 SEQ ID NO: 225
SEQ ID NO: 226 SEQ ID NO: 227 PHD0015-01 28791-2900? SEQ ID NO: 228
SEQ ID NO: 229 SEQ ID NO: 230 SEQ ID NO: 231 SEQ ID NO: 232
TABLE-US-00019 TABLE 18 List of Public Lines use in Haplotype
Analysis 38-11 CO109 MP305 A165 D02 N28 A188 D146 OH07 A509 F2
OH4OB A556 F252 OH43 A619 F257 OH45 A632 F283 OS420 B F7 OS426 B14
GT119 PA91 B37 H84 R159 B42 H99 SC213R B64 HATO4 SD105 B73 HY
SRS303 B84 Indiana H60 T232 B89 K187-11217 TR9-1-1-6 B94 K55 TX601
C103 L1546 V3 C106 L317 W153R CI66 Minn49 WF9 CM49 MO13 CM7 Mo17
Sequence CWU 1
1
23214212DNAZea maysgene(0)...(0)Nucleotide sequence for Rcg1
bac811h.pk257.m04 1aaaaccctca ccacattttc ctcaaccaca tgatggagat
tggggctact agatactatg 60cctggtggta gactggtagc tgatgtcttt ggaccagtag
ttggtgctag atttgtgaac 120tctaccaagg tgagaaacgg ag atg gag gct gcc
ctg ctg agc ggg ttc atc 172 Met Glu Ala Ala Leu Leu Ser Gly Phe Ile
1 5 10aaa acc atc ctg cca agg ctc ttc tca ctg gta caa ggg aga tac
aag 220Lys Thr Ile Leu Pro Arg Leu Phe Ser Leu Val Gln Gly Arg Tyr
Lys 15 20 25ctg cac aag ggc ctc aag agc gac atc aaa tcg ctg gag aaa
gag ctc 268Leu His Lys Gly Leu Lys Ser Asp Ile Lys Ser Leu Glu Lys
Glu Leu 30 35 40cat atg atc gct gtt aca atc gat gaa caa atc tcg ctg
ggg agg aag 316His Met Ile Ala Val Thr Ile Asp Glu Gln Ile Ser Leu
Gly Arg Lys 45 50 55gat cag gga gct gtg ctg agc ctc tca att gat gag
ctg cat gaa ctg 364Asp Gln Gly Ala Val Leu Ser Leu Ser Ile Asp Glu
Leu His Glu Leu 60 65 70gct cac caa atc gag gac tcc ata gat cgc ttc
ttg tac cat gtg acc 412Ala His Gln Ile Glu Asp Ser Ile Asp Arg Phe
Leu Tyr His Val Thr75 80 85 90agg gag cag caa gca tcc ttt ttt cgt
cgg act gta cgg tcg ccg aag 460Arg Glu Gln Gln Ala Ser Phe Phe Arg
Arg Thr Val Arg Ser Pro Lys 95 100 105act ctg ttg tca cgt cag cgg
ctg gct gcc gag gtt cag ttc ctg aag 508Thr Leu Leu Ser Arg Gln Arg
Leu Ala Ala Glu Val Gln Phe Leu Lys 110 115 120aag ata ccg gag gag
gcg cac cag cga gag aag agg tac agg gtc ttc 556Lys Ile Pro Glu Glu
Ala His Gln Arg Glu Lys Arg Tyr Arg Val Phe 125 130 135gcc ggc ctt
tct tcc tct acc cgg cac act gaa tcg tct tcc tgt tcg 604Ala Gly Leu
Ser Ser Ser Thr Arg His Thr Glu Ser Ser Ser Cys Ser 140 145 150tct
gta tct gat ccg cac aca ctt aag gcc gac gtc gtc ggc atc gac 652Ser
Val Ser Asp Pro His Thr Leu Lys Ala Asp Val Val Gly Ile Asp155 160
165 170ggt ccc agg gac gag ctt gtg cag cag tta acc gaa gag gca gag
ggc 700Gly Pro Arg Asp Glu Leu Val Gln Gln Leu Thr Glu Glu Ala Glu
Gly 175 180 185cta aca aag cag ctc aag gtg atc tcc atc gtc ggg atc
cat ggc tcc 748Leu Thr Lys Gln Leu Lys Val Ile Ser Ile Val Gly Ile
His Gly Ser 190 195 200ggc aag acc gtc ctt gcc aga gag gta tac gag
agc gac gtc ggc cgg 796Gly Lys Thr Val Leu Ala Arg Glu Val Tyr Glu
Ser Asp Val Gly Arg 205 210 215cag ttc agt ctc cgg gca tgg gtt tct
gct act gac aga ggt ccg aga 844Gln Phe Ser Leu Arg Ala Trp Val Ser
Ala Thr Asp Arg Gly Pro Arg 220 225 230gag gtg ctc atg gag atc ctc
cga aat ttt ggt agg cca gtg gtg gat 892Glu Val Leu Met Glu Ile Leu
Arg Asn Phe Gly Arg Pro Val Val Asp235 240 245 250agc tct agt att
gac cag ctt acg gta gat ctc agg aaa cac ttg ggt 940Ser Ser Ser Ile
Asp Gln Leu Thr Val Asp Leu Arg Lys His Leu Gly 255 260 265gag aaa
ag gtgaaaaaaa cctcttcttt atgttattta ttatttatga agtttcttca 998Glu
Lys Seractacgggtt ttcatgttca aattgcctct ctgaacttcg aaaacgttta
ataccaattg 1058aattgaggat cttagctttg gaaaagcggt agtgttttga
cgttttgcat acatttctca 1118ccgttatttt attcatttat aatttagagt
ttaagcagta tattcatttt gaaatttatg 1178agatttctgt ctgcacgctt
acttccatgc ccaaaacatg tccgattgag aacagaaggt 1238aattttgttt
gatctttgag atcagacaca ctgattgagt agtaacagga aacaagtgct
1298caccaatcac ccaagtcact tacaaagaat ttcatgctta caaaacacac
tgattgttaa 1358ggatagagac tatgtttgat ctgcatagtt tgaattttga
ttatgtcatc gtcgattgtt 1418atcattaact tttgttggaa atttctcttg tag c
tat ttc att gta atc gat 1470 Tyr Phe Ile Val Ile Asp 270 275ggc atg
caa aca gat cag tgg agc acc att gaa act gcc ttc cca gaa 1518Gly Met
Gln Thr Asp Gln Trp Ser Thr Ile Glu Thr Ala Phe Pro Glu 280 285
290aac aat gtt gtt agc agc aga gta att gtt aca aca aca atc cgg tca
1566Asn Asn Val Val Ser Ser Arg Val Ile Val Thr Thr Thr Ile Arg Ser
295 300 305gta gct aat tct tgc agc tct tct aac ggt tat gtg cac aaa
atg aaa 1614Val Ala Asn Ser Cys Ser Ser Ser Asn Gly Tyr Val His Lys
Met Lys 310 315 320aga ctt agt gac gaa cac tca gag caa ttg ttt atc
aag aaa gct tgc 1662Arg Leu Ser Asp Glu His Ser Glu Gln Leu Phe Ile
Lys Lys Ala Cys 325 330 335cca aca aaa tat tca ggt tat act cga ccg
gaa tca aaa gaa gtt ctg 1710Pro Thr Lys Tyr Ser Gly Tyr Thr Arg Pro
Glu Ser Lys Glu Val Leu340 345 350 355aag aaa tgt gat ggt caa cca
ctt gct ctt gtt act atg ggc caa ttc 1758Lys Lys Cys Asp Gly Gln Pro
Leu Ala Leu Val Thr Met Gly Gln Phe 360 365 370ttg agg aaa aat ggt
tgg ccc aca gga ccc aac tgc gaa aat gtg tgt 1806Leu Arg Lys Asn Gly
Trp Pro Thr Gly Pro Asn Cys Glu Asn Val Cys 375 380 385aga gat ctt
aga cga cat ctg gag cag gat gat aca ttg gag aga atg 1854Arg Asp Leu
Arg Arg His Leu Glu Gln Asp Asp Thr Leu Glu Arg Met 390 395 400cga
agg gtg ctt atc cac agc tta tct agt ctt cct agc cat gtt ccc 1902Arg
Arg Val Leu Ile His Ser Leu Ser Ser Leu Pro Ser His Val Pro 405 410
415aaa gcc tgc ctt ttg tat ttt ggt atg ttt cca tgt gat cat ccc ata
1950Lys Ala Cys Leu Leu Tyr Phe Gly Met Phe Pro Cys Asp His Pro
Ile420 425 430 435aag agg aag agc ctg atg agg cga tgg tta gca gag
gga ttt gta caa 1998Lys Arg Lys Ser Leu Met Arg Arg Trp Leu Ala Glu
Gly Phe Val Gln 440 445 450aca cag cct tca tct agt gaa aac ttc aac
acc ctc ata gac cgg aat 2046Thr Gln Pro Ser Ser Ser Glu Asn Phe Asn
Thr Leu Ile Asp Arg Asn 455 460 465att att gag ccc atc ggc ata tgt
aac gat gat cag gta aag aca tgc 2094Ile Ile Glu Pro Ile Gly Ile Cys
Asn Asp Asp Gln Val Lys Thr Cys 470 475 480aaa aca tat ggc atg atg
cac gag ttc att ttg tta atg tcc acc tcc 2142Lys Thr Tyr Gly Met Met
His Glu Phe Ile Leu Leu Met Ser Thr Ser 485 490 495cat gac ttc att
acc ctg ctt tgt aat aat aaa gtt gaa cac aaa tat 2190His Asp Phe Ile
Thr Leu Leu Cys Asn Asn Lys Val Glu His Lys Tyr500 505 510 515gtg
cgt cgg ctt tct ctc cat cat cat agt gct aca agt ggc agt ttt 2238Val
Arg Arg Leu Ser Leu His His His Ser Ala Thr Ser Gly Ser Phe 520 525
530tcg gtc atc gac tta tct ctt gtt aga tct ctg atg gtt ttt ggg gag
2286Ser Val Ile Asp Leu Ser Leu Val Arg Ser Leu Met Val Phe Gly Glu
535 540 545gct ggc aaa act att ttg agt ttc cga aag tac gag cta ttg
aga gtc 2334Ala Gly Lys Thr Ile Leu Ser Phe Arg Lys Tyr Glu Leu Leu
Arg Val 550 555 560ttg gat ctt gaa caa tgt acc gac ttg gaa gat gat
cac ctc aaa gac 2382Leu Asp Leu Glu Gln Cys Thr Asp Leu Glu Asp Asp
His Leu Lys Asp 565 570 575ata tgc aac ctt ttt ctt atg aaa tat cta
agc ctc gga gaa act att 2430Ile Cys Asn Leu Phe Leu Met Lys Tyr Leu
Ser Leu Gly Glu Thr Ile580 585 590 595aga agt ctt cca aag gag ata
gaa aaa ctg aag ctc ttg gag aca ctt 2478Arg Ser Leu Pro Lys Glu Ile
Glu Lys Leu Lys Leu Leu Glu Thr Leu 600 605 610gac ttg agg aga aca
aag gtg aaa aca cta cct ata gag gtc ctc ctg 2526Asp Leu Arg Arg Thr
Lys Val Lys Thr Leu Pro Ile Glu Val Leu Leu 615 620 625ctc ccc tgt
tta ctc cat ctg ttt ggg aag ttc caa ttt tct gat aaa 2574Leu Pro Cys
Leu Leu His Leu Phe Gly Lys Phe Gln Phe Ser Asp Lys 630 635 640atc
aag ata aca agt gac atg cag aag ttt ttc tta act gga cag agt 2622Ile
Lys Ile Thr Ser Asp Met Gln Lys Phe Phe Leu Thr Gly Gln Ser 645 650
655aac tta gag aca ctt tca gga ttt atc aca gat ggg tct caa gga ttg
2670Asn Leu Glu Thr Leu Ser Gly Phe Ile Thr Asp Gly Ser Gln Gly
Leu660 665 670 675cca cag atg atg aat tac atg aat tta aga aag ctt
aag ata tgg ttt 2718Pro Gln Met Met Asn Tyr Met Asn Leu Arg Lys Leu
Lys Ile Trp Phe 680 685 690gag agg agt aag aga agc acc aac ttc acc
gat ctt gtg aat gct gtc 2766Glu Arg Ser Lys Arg Ser Thr Asn Phe Thr
Asp Leu Val Asn Ala Val 695 700 705caa aag ttc atc cat gat gac aaa
gag agc aat gat cca cgt tct cta 2814Gln Lys Phe Ile His Asp Asp Lys
Glu Ser Asn Asp Pro Arg Ser Leu 710 715 720tca ctt cat ttc gat gac
ggc act gaa aac atc ctg aac tct ttg aag 2862Ser Leu His Phe Asp Asp
Gly Thr Glu Asn Ile Leu Asn Ser Leu Lys 725 730 735gct cct tgt tac
ctt agg tca ttg aag tta aaa ggg aat ttg ctg gaa 2910Ala Pro Cys Tyr
Leu Arg Ser Leu Lys Leu Lys Gly Asn Leu Leu Glu740 745 750 755ctt
ccc cag ttt gtc ata tca atg cgg ggt ctc cgg gag ata tgc ctt 2958Leu
Pro Gln Phe Val Ile Ser Met Arg Gly Leu Arg Glu Ile Cys Leu 760 765
770tca tca aca aaa ttg aca tcg ggc ctc ctt gca aca ctc gct aac ttg
3006Ser Ser Thr Lys Leu Thr Ser Gly Leu Leu Ala Thr Leu Ala Asn Leu
775 780 785aaa ggc ttg cag cat ctc aag ctg att gca gat gtc ctt gaa
gat ttt 3054Lys Gly Leu Gln His Leu Lys Leu Ile Ala Asp Val Leu Glu
Asp Phe 790 795 800atc att gaa ggt cag gca ttc ctg ggg ctg cta cac
cta tgt ttt gtc 3102Ile Ile Glu Gly Gln Ala Phe Leu Gly Leu Leu His
Leu Cys Phe Val 805 810 815cta gaa cgt gcc acc tta cca ata att gaa
gga gga gct ttg ccg tac 3150Leu Glu Arg Ala Thr Leu Pro Ile Ile Glu
Gly Gly Ala Leu Pro Tyr820 825 830 835ctc atc tca ctt aag cta atc
tgc aaa gat cta gtt ggc ctc ggt gac 3198Leu Ile Ser Leu Lys Leu Ile
Cys Lys Asp Leu Val Gly Leu Gly Asp 840 845 850atc aaa atc aac cgc
ctc aaa tgt ctt aag gaa gtc agt cta gat cat 3246Ile Lys Ile Asn Arg
Leu Lys Cys Leu Lys Glu Val Ser Leu Asp His 855 860 865aga gtc gct
tcg gaa aca aga gaa atc tgg gaa aaa gct gcc gag aag 3294Arg Val Ala
Ser Glu Thr Arg Glu Ile Trp Glu Lys Ala Ala Glu Lys 870 875 880cat
cca aac cgg ccg aaa gta ttg ttg gtc aac tca tct gat gaa agc 3342His
Pro Asn Arg Pro Lys Val Leu Leu Val Asn Ser Ser Asp Glu Ser 885 890
895gaa att aag gct gta gac tgt tct gtt gct tca aga cca gct gtg agt
3390Glu Ile Lys Ala Val Asp Cys Ser Val Ala Ser Arg Pro Ala Val
Ser900 905 910 915gag gct aat gga act tct ccc atg tca gag gtt gat
gta cga gag gat 3438Glu Ala Asn Gly Thr Ser Pro Met Ser Glu Val Asp
Val Arg Glu Asp 920 925 930gac att cag atg ata ctt aac cag ggg ctc
tct gcc gct gct gag aaa 3486Asp Ile Gln Met Ile Leu Asn Gln Gly Leu
Ser Ala Ala Ala Glu Lys 935 940 945cag atg aat tgt gca gtt cag cca
agt tca aaa gct gaa ctg aac tct 3534Gln Met Asn Cys Ala Val Gln Pro
Ser Ser Lys Ala Glu Leu Asn Ser 950 955 960gat ttc aat aat att agt
ttc cca gag gtt gcg ctt ggt tta acc gag 3582Asp Phe Asn Asn Ile Ser
Phe Pro Glu Val Ala Leu Gly Leu Thr Glu 965 970 975ctg tga
attgcttgga attgaaatgt gtcttcatac acctattgat ccttgattgt 3638Leu
*980ccatggtcag tttcgttgca cttgcagcat attactatga ggctagtatc
atgtaaatta 3698caaatctttt gttgttaagg ccataaattg catattatag
cacaacaagc tggtatgtct 3758caacaatggc attaattttt tttctgcttg
aatctacaaa tttcatcatt attttgcaat 3818ttcgctttta tacagatatg
gtgatgccat gtcattttga ctttgcagca tatatgcaag 3878caacggtttg
agttgctgga gttgctagaa tattgataca acttcagttt actcgaaggc
3938tacagggatc tcataactag gatggttgaa gataatttgc gattgtttcc
ttcagtgtca 3998ctgaaaagac ttttgtaaca ataaagcata cctttgcttc
ctactttttt gaagttactt 4058cagatgctaa gttcgcagtt gggcctggac
tttatcatgt ttatccagct gtttatttgt 4118ttcatgtaca ataataccgg
tgattgctgt tgttatataa tctatattta tactatagtt 4178aaagtatcag
tttcaacggt tgtcccgcgc catc 421222943DNAZea
maysgene(1)...(2943)Coding region only of Cgr1 gene 2atg gag gct
gcc ctg ctg agc ggg ttc atc aaa acc atc ctg cca agg 48Met Glu Ala
Ala Leu Leu Ser Gly Phe Ile Lys Thr Ile Leu Pro Arg1 5 10 15ctc ttc
tca ctg gta caa ggg aga tac aag ctg cac aag ggc ctc aag 96Leu Phe
Ser Leu Val Gln Gly Arg Tyr Lys Leu His Lys Gly Leu Lys 20 25 30agc
gac atc aaa tcg ctg gag aaa gag ctc cat atg atc gct gtt aca 144Ser
Asp Ile Lys Ser Leu Glu Lys Glu Leu His Met Ile Ala Val Thr 35 40
45atc gat gaa caa atc tcg ctg ggg agg aag gat cag gga gct gtg ctg
192Ile Asp Glu Gln Ile Ser Leu Gly Arg Lys Asp Gln Gly Ala Val Leu
50 55 60agc ctc tca att gat gag ctg cat gaa ctg gct cac caa atc gag
gac 240Ser Leu Ser Ile Asp Glu Leu His Glu Leu Ala His Gln Ile Glu
Asp65 70 75 80tcc ata gat cgc ttc ttg tac cat gtg acc agg gag cag
caa gca tcc 288Ser Ile Asp Arg Phe Leu Tyr His Val Thr Arg Glu Gln
Gln Ala Ser 85 90 95ttt ttt cgt cgg act gta cgg tcg ccg aag act ctg
ttg tca cgt cag 336Phe Phe Arg Arg Thr Val Arg Ser Pro Lys Thr Leu
Leu Ser Arg Gln 100 105 110cgg ctg gct gcc gag gtt cag ttc ctg aag
aag ata ccg gag gag gcg 384Arg Leu Ala Ala Glu Val Gln Phe Leu Lys
Lys Ile Pro Glu Glu Ala 115 120 125cac cag cga gag aag agg tac agg
gtc ttc gcc ggc ctt tct tcc tct 432His Gln Arg Glu Lys Arg Tyr Arg
Val Phe Ala Gly Leu Ser Ser Ser 130 135 140acc cgg cac act gaa tcg
tct tcc tgt tcg tct gta tct gat ccg cac 480Thr Arg His Thr Glu Ser
Ser Ser Cys Ser Ser Val Ser Asp Pro His145 150 155 160aca ctt aag
gcc gac gtc gtc ggc atc gac ggt ccc agg gac gag ctt 528Thr Leu Lys
Ala Asp Val Val Gly Ile Asp Gly Pro Arg Asp Glu Leu 165 170 175gtg
cag cag tta acc gaa gag gca gag ggc cta aca aag cag ctc aag 576Val
Gln Gln Leu Thr Glu Glu Ala Glu Gly Leu Thr Lys Gln Leu Lys 180 185
190gtg atc tcc atc gtc ggg atc cat ggc tcc ggc aag acc gtc ctt gcc
624Val Ile Ser Ile Val Gly Ile His Gly Ser Gly Lys Thr Val Leu Ala
195 200 205aga gag gta tac gag agc gac gtc ggc cgg cag ttc agt ctc
cgg gca 672Arg Glu Val Tyr Glu Ser Asp Val Gly Arg Gln Phe Ser Leu
Arg Ala 210 215 220tgg gtt tct gct act gac aga ggt ccg aga gag gtg
ctc atg gag atc 720Trp Val Ser Ala Thr Asp Arg Gly Pro Arg Glu Val
Leu Met Glu Ile225 230 235 240ctc cga aat ttt ggt agg cca gtg gtg
gat agc tct agt att gac cag 768Leu Arg Asn Phe Gly Arg Pro Val Val
Asp Ser Ser Ser Ile Asp Gln 245 250 255ctt acg gta gat ctc agg aaa
cac ttg ggt gag aaa agg tat ttc att 816Leu Thr Val Asp Leu Arg Lys
His Leu Gly Glu Lys Arg Tyr Phe Ile 260 265 270gta atc gat ggc atg
caa aca gat cag tgg agc acc att gaa act gcc 864Val Ile Asp Gly Met
Gln Thr Asp Gln Trp Ser Thr Ile Glu Thr Ala 275 280 285ttc cca gaa
aac aat gtt gtt agc agc aga gta att gtt aca aca aca 912Phe Pro Glu
Asn Asn Val Val Ser Ser Arg Val Ile Val Thr Thr Thr 290 295 300atc
cgg tca gta gct aat tct tgc agc tct tct aac ggt tat gtg cac 960Ile
Arg Ser Val Ala Asn Ser Cys Ser Ser Ser Asn Gly Tyr Val His305 310
315 320aaa atg aaa aga ctt agt gac gaa cac tca gag caa ttg ttt atc
aag 1008Lys Met Lys Arg Leu Ser Asp Glu His Ser Glu Gln Leu Phe Ile
Lys 325 330 335aaa gct tgc cca aca aaa tat tca ggt tat act cga ccg
gaa tca aaa 1056Lys Ala Cys Pro Thr Lys Tyr Ser Gly Tyr Thr Arg Pro
Glu Ser Lys 340 345 350gaa gtt ctg aag aaa tgt gat ggt caa cca ctt
gct ctt gtt act atg 1104Glu Val Leu Lys Lys Cys Asp Gly Gln Pro Leu
Ala Leu Val Thr Met 355 360 365ggc caa ttc ttg agg aaa aat ggt tgg
ccc aca gga ccc aac tgc gaa 1152Gly Gln Phe Leu Arg Lys Asn Gly Trp
Pro Thr Gly Pro Asn Cys Glu 370 375 380aat gtg tgt aga gat ctt aga
cga cat ctg gag cag gat gat aca ttg 1200Asn Val Cys Arg Asp Leu Arg
Arg His Leu Glu Gln Asp Asp Thr Leu385 390 395 400gag aga atg cga
agg gtg ctt atc cac agc tta tct agt ctt cct agc
1248Glu Arg Met Arg Arg Val Leu Ile His Ser Leu Ser Ser Leu Pro Ser
405 410 415cat gtt ccc aaa gcc tgc ctt ttg tat ttt ggt atg ttt cca
tgt gat 1296His Val Pro Lys Ala Cys Leu Leu Tyr Phe Gly Met Phe Pro
Cys Asp 420 425 430cat ccc ata aag agg aag agc ctg atg agg cga tgg
tta gca gag gga 1344His Pro Ile Lys Arg Lys Ser Leu Met Arg Arg Trp
Leu Ala Glu Gly 435 440 445ttt gta caa aca cag cct tca tct agt gaa
aac ttc aac acc ctc ata 1392Phe Val Gln Thr Gln Pro Ser Ser Ser Glu
Asn Phe Asn Thr Leu Ile 450 455 460gac cgg aat att att gag ccc atc
ggc ata tgt aac gat gat cag gta 1440Asp Arg Asn Ile Ile Glu Pro Ile
Gly Ile Cys Asn Asp Asp Gln Val465 470 475 480aag aca tgc aaa aca
tat ggc atg atg cac gag ttc att ttg tta atg 1488Lys Thr Cys Lys Thr
Tyr Gly Met Met His Glu Phe Ile Leu Leu Met 485 490 495tcc acc tcc
cat gac ttc att acc ctg ctt tgt aat aat aaa gtt gaa 1536Ser Thr Ser
His Asp Phe Ile Thr Leu Leu Cys Asn Asn Lys Val Glu 500 505 510cac
aaa tat gtg cgt cgg ctt tct ctc cat cat cat agt gct aca agt 1584His
Lys Tyr Val Arg Arg Leu Ser Leu His His His Ser Ala Thr Ser 515 520
525ggc agt ttt tcg gtc atc gac tta tct ctt gtt aga tct ctg atg gtt
1632Gly Ser Phe Ser Val Ile Asp Leu Ser Leu Val Arg Ser Leu Met Val
530 535 540ttt ggg gag gct ggc aaa act att ttg agt ttc cga aag tac
gag cta 1680Phe Gly Glu Ala Gly Lys Thr Ile Leu Ser Phe Arg Lys Tyr
Glu Leu545 550 555 560ttg aga gtc ttg gat ctt gaa caa tgt acc gac
ttg gaa gat gat cac 1728Leu Arg Val Leu Asp Leu Glu Gln Cys Thr Asp
Leu Glu Asp Asp His 565 570 575ctc aaa gac ata tgc aac ctt ttt ctt
atg aaa tat cta agc ctc gga 1776Leu Lys Asp Ile Cys Asn Leu Phe Leu
Met Lys Tyr Leu Ser Leu Gly 580 585 590gaa act att aga agt ctt cca
aag gag ata gaa aaa ctg aag ctc ttg 1824Glu Thr Ile Arg Ser Leu Pro
Lys Glu Ile Glu Lys Leu Lys Leu Leu 595 600 605gag aca ctt gac ttg
agg aga aca aag gtg aaa aca cta cct ata gag 1872Glu Thr Leu Asp Leu
Arg Arg Thr Lys Val Lys Thr Leu Pro Ile Glu 610 615 620gtc ctc ctg
ctc ccc tgt tta ctc cat ctg ttt ggg aag ttc caa ttt 1920Val Leu Leu
Leu Pro Cys Leu Leu His Leu Phe Gly Lys Phe Gln Phe625 630 635
640tct gat aaa atc aag ata aca agt gac atg cag aag ttt ttc tta act
1968Ser Asp Lys Ile Lys Ile Thr Ser Asp Met Gln Lys Phe Phe Leu Thr
645 650 655gga cag agt aac tta gag aca ctt tca gga ttt atc aca gat
ggg tct 2016Gly Gln Ser Asn Leu Glu Thr Leu Ser Gly Phe Ile Thr Asp
Gly Ser 660 665 670caa gga ttg cca cag atg atg aat tac atg aat tta
aga aag ctt aag 2064Gln Gly Leu Pro Gln Met Met Asn Tyr Met Asn Leu
Arg Lys Leu Lys 675 680 685ata tgg ttt gag agg agt aag aga agc acc
aac ttc acc gat ctt gtg 2112Ile Trp Phe Glu Arg Ser Lys Arg Ser Thr
Asn Phe Thr Asp Leu Val 690 695 700aat gct gtc caa aag ttc atc cat
gat gac aaa gag agc aat gat cca 2160Asn Ala Val Gln Lys Phe Ile His
Asp Asp Lys Glu Ser Asn Asp Pro705 710 715 720cgt tct cta tca ctt
cat ttc gat gac ggc act gaa aac atc ctg aac 2208Arg Ser Leu Ser Leu
His Phe Asp Asp Gly Thr Glu Asn Ile Leu Asn 725 730 735tct ttg aag
gct cct tgt tac ctt agg tca ttg aag tta aaa ggg aat 2256Ser Leu Lys
Ala Pro Cys Tyr Leu Arg Ser Leu Lys Leu Lys Gly Asn 740 745 750ttg
ctg gaa ctt ccc cag ttt gtc ata tca atg cgg ggt ctc cgg gag 2304Leu
Leu Glu Leu Pro Gln Phe Val Ile Ser Met Arg Gly Leu Arg Glu 755 760
765ata tgc ctt tca tca aca aaa ttg aca tcg ggc ctc ctt gca aca ctc
2352Ile Cys Leu Ser Ser Thr Lys Leu Thr Ser Gly Leu Leu Ala Thr Leu
770 775 780gct aac ttg aaa ggc ttg cag cat ctc aag ctg att gca gat
gtc ctt 2400Ala Asn Leu Lys Gly Leu Gln His Leu Lys Leu Ile Ala Asp
Val Leu785 790 795 800gaa gat ttt atc att gaa ggt cag gca ttc ctg
ggg ctg cta cac cta 2448Glu Asp Phe Ile Ile Glu Gly Gln Ala Phe Leu
Gly Leu Leu His Leu 805 810 815tgt ttt gtc cta gaa cgt gcc acc tta
cca ata att gaa gga gga gct 2496Cys Phe Val Leu Glu Arg Ala Thr Leu
Pro Ile Ile Glu Gly Gly Ala 820 825 830ttg ccg tac ctc atc tca ctt
aag cta atc tgc aaa gat cta gtt ggc 2544Leu Pro Tyr Leu Ile Ser Leu
Lys Leu Ile Cys Lys Asp Leu Val Gly 835 840 845ctc ggt gac atc aaa
atc aac cgc ctc aaa tgt ctt aag gaa gtc agt 2592Leu Gly Asp Ile Lys
Ile Asn Arg Leu Lys Cys Leu Lys Glu Val Ser 850 855 860cta gat cat
aga gtc gct tcg gaa aca aga gaa atc tgg gaa aaa gct 2640Leu Asp His
Arg Val Ala Ser Glu Thr Arg Glu Ile Trp Glu Lys Ala865 870 875
880gcc gag aag cat cca aac cgg ccg aaa gta ttg ttg gtc aac tca tct
2688Ala Glu Lys His Pro Asn Arg Pro Lys Val Leu Leu Val Asn Ser Ser
885 890 895gat gaa agc gaa att aag gct gta gac tgt tct gtt gct tca
aga cca 2736Asp Glu Ser Glu Ile Lys Ala Val Asp Cys Ser Val Ala Ser
Arg Pro 900 905 910gct gtg agt gag gct aat gga act tct ccc atg tca
gag gtt gat gta 2784Ala Val Ser Glu Ala Asn Gly Thr Ser Pro Met Ser
Glu Val Asp Val 915 920 925cga gag gat gac att cag atg ata ctt aac
cag ggg ctc tct gcc gct 2832Arg Glu Asp Asp Ile Gln Met Ile Leu Asn
Gln Gly Leu Ser Ala Ala 930 935 940gct gag aaa cag atg aat tgt gca
gtt cag cca agt tca aaa gct gaa 2880Ala Glu Lys Gln Met Asn Cys Ala
Val Gln Pro Ser Ser Lys Ala Glu945 950 955 960ctg aac tct gat ttc
aat aat att agt ttc cca gag gtt gcg ctt ggt 2928Leu Asn Ser Asp Phe
Asn Asn Ile Ser Phe Pro Glu Val Ala Leu Gly 965 970 975tta acc gag
ctg tga 2943Leu Thr Glu Leu * 9803980PRTZea
maysDOMAIN(157)...(404)Region showing homology to nucleotide
binding site (NBS) domain. 3Met Glu Ala Ala Leu Leu Ser Gly Phe Ile
Lys Thr Ile Leu Pro Arg1 5 10 15 Leu Phe Ser Leu Val Gln Gly Arg
Tyr Lys Leu His Lys Gly Leu Lys 20 25 30 Ser Asp Ile Lys Ser Leu
Glu Lys Glu Leu His Met Ile Ala Val Thr 35 40 45 Ile Asp Glu Gln
Ile Ser Leu Gly Arg Lys Asp Gln Gly Ala Val Leu 50 55 60 Ser Leu
Ser Ile Asp Glu Leu His Glu Leu Ala His Gln Ile Glu Asp65 70 75 80
Ser Ile Asp Arg Phe Leu Tyr His Val Thr Arg Glu Gln Gln Ala Ser 85
90 95 Phe Phe Arg Arg Thr Val Arg Ser Pro Lys Thr Leu Leu Ser Arg
Gln 100 105 110 Arg Leu Ala Ala Glu Val Gln Phe Leu Lys Lys Ile Pro
Glu Glu Ala 115 120 125 His Gln Arg Glu Lys Arg Tyr Arg Val Phe Ala
Gly Leu Ser Ser Ser 130 135 140 Thr Arg His Thr Glu Ser Ser Ser Cys
Ser Ser Val Ser Asp Pro His145 150 155 160 Thr Leu Lys Ala Asp Val
Val Gly Ile Asp Gly Pro Arg Asp Glu Leu 165 170 175 Val Gln Gln Leu
Thr Glu Glu Ala Glu Gly Leu Thr Lys Gln Leu Lys 180 185 190 Val Ile
Ser Ile Val Gly Ile His Gly Ser Gly Lys Thr Val Leu Ala 195 200 205
Arg Glu Val Tyr Glu Ser Asp Val Gly Arg Gln Phe Ser Leu Arg Ala 210
215 220 Trp Val Ser Ala Thr Asp Arg Gly Pro Arg Glu Val Leu Met Glu
Ile225 230 235 240 Leu Arg Asn Phe Gly Arg Pro Val Val Asp Ser Ser
Ser Ile Asp Gln 245 250 255 Leu Thr Val Asp Leu Arg Lys His Leu Gly
Glu Lys Arg Tyr Phe Ile 260 265 270 Val Ile Asp Gly Met Gln Thr Asp
Gln Trp Ser Thr Ile Glu Thr Ala 275 280 285 Phe Pro Glu Asn Asn Val
Val Ser Ser Arg Val Ile Val Thr Thr Thr 290 295 300 Ile Arg Ser Val
Ala Asn Ser Cys Ser Ser Ser Asn Gly Tyr Val His305 310 315 320 Lys
Met Lys Arg Leu Ser Asp Glu His Ser Glu Gln Leu Phe Ile Lys 325 330
335 Lys Ala Cys Pro Thr Lys Tyr Ser Gly Tyr Thr Arg Pro Glu Ser Lys
340 345 350 Glu Val Leu Lys Lys Cys Asp Gly Gln Pro Leu Ala Leu Val
Thr Met 355 360 365 Gly Gln Phe Leu Arg Lys Asn Gly Trp Pro Thr Gly
Pro Asn Cys Glu 370 375 380 Asn Val Cys Arg Asp Leu Arg Arg His Leu
Glu Gln Asp Asp Thr Leu385 390 395 400 Glu Arg Met Arg Arg Val Leu
Ile His Ser Leu Ser Ser Leu Pro Ser 405 410 415 His Val Pro Lys Ala
Cys Leu Leu Tyr Phe Gly Met Phe Pro Cys Asp 420 425 430 His Pro Ile
Lys Arg Lys Ser Leu Met Arg Arg Trp Leu Ala Glu Gly 435 440 445 Phe
Val Gln Thr Gln Pro Ser Ser Ser Glu Asn Phe Asn Thr Leu Ile 450 455
460 Asp Arg Asn Ile Ile Glu Pro Ile Gly Ile Cys Asn Asp Asp Gln
Val465 470 475 480 Lys Thr Cys Lys Thr Tyr Gly Met Met His Glu Phe
Ile Leu Leu Met 485 490 495 Ser Thr Ser His Asp Phe Ile Thr Leu Leu
Cys Asn Asn Lys Val Glu 500 505 510 His Lys Tyr Val Arg Arg Leu Ser
Leu His His His Ser Ala Thr Ser 515 520 525 Gly Ser Phe Ser Val Ile
Asp Leu Ser Leu Val Arg Ser Leu Met Val 530 535 540 Phe Gly Glu Ala
Gly Lys Thr Ile Leu Ser Phe Arg Lys Tyr Glu Leu545 550 555 560 Leu
Arg Val Leu Asp Leu Glu Gln Cys Thr Asp Leu Glu Asp Asp His 565 570
575 Leu Lys Asp Ile Cys Asn Leu Phe Leu Met Lys Tyr Leu Ser Leu Gly
580 585 590 Glu Thr Ile Arg Ser Leu Pro Lys Glu Ile Glu Lys Leu Lys
Leu Leu 595 600 605 Glu Thr Leu Asp Leu Arg Arg Thr Lys Val Lys Thr
Leu Pro Ile Glu 610 615 620 Val Leu Leu Leu Pro Cys Leu Leu His Leu
Phe Gly Lys Phe Gln Phe625 630 635 640 Ser Asp Lys Ile Lys Ile Thr
Ser Asp Met Gln Lys Phe Phe Leu Thr 645 650 655 Gly Gln Ser Asn Leu
Glu Thr Leu Ser Gly Phe Ile Thr Asp Gly Ser 660 665 670 Gln Gly Leu
Pro Gln Met Met Asn Tyr Met Asn Leu Arg Lys Leu Lys 675 680 685 Ile
Trp Phe Glu Arg Ser Lys Arg Ser Thr Asn Phe Thr Asp Leu Val 690 695
700 Asn Ala Val Gln Lys Phe Ile His Asp Asp Lys Glu Ser Asn Asp
Pro705 710 715 720 Arg Ser Leu Ser Leu His Phe Asp Asp Gly Thr Glu
Asn Ile Leu Asn 725 730 735 Ser Leu Lys Ala Pro Cys Tyr Leu Arg Ser
Leu Lys Leu Lys Gly Asn 740 745 750 Leu Leu Glu Leu Pro Gln Phe Val
Ile Ser Met Arg Gly Leu Arg Glu 755 760 765 Ile Cys Leu Ser Ser Thr
Lys Leu Thr Ser Gly Leu Leu Ala Thr Leu 770 775 780 Ala Asn Leu Lys
Gly Leu Gln His Leu Lys Leu Ile Ala Asp Val Leu785 790 795 800 Glu
Asp Phe Ile Ile Glu Gly Gln Ala Phe Leu Gly Leu Leu His Leu 805 810
815 Cys Phe Val Leu Glu Arg Ala Thr Leu Pro Ile Ile Glu Gly Gly Ala
820 825 830 Leu Pro Tyr Leu Ile Ser Leu Lys Leu Ile Cys Lys Asp Leu
Val Gly 835 840 845 Leu Gly Asp Ile Lys Ile Asn Arg Leu Lys Cys Leu
Lys Glu Val Ser 850 855 860 Leu Asp His Arg Val Ala Ser Glu Thr Arg
Glu Ile Trp Glu Lys Ala865 870 875 880 Ala Glu Lys His Pro Asn Arg
Pro Lys Val Leu Leu Val Asn Ser Ser 885 890 895 Asp Glu Ser Glu Ile
Lys Ala Val Asp Cys Ser Val Ala Ser Arg Pro 900 905 910 Ala Val Ser
Glu Ala Asn Gly Thr Ser Pro Met Ser Glu Val Asp Val 915 920 925 Arg
Glu Asp Asp Ile Gln Met Ile Leu Asn Gln Gly Leu Ser Ala Ala 930 935
940 Ala Glu Lys Gln Met Asn Cys Ala Val Gln Pro Ser Ser Lys Ala
Glu945 950 955 960 Leu Asn Ser Asp Phe Asn Asn Ile Ser Phe Pro Glu
Val Ala Leu Gly 965 970 975 Leu Thr Glu Leu 980 424DNAArtificial
SequenceOligonucleotide Primer a20Cforw4881 4cagggcctac ttggtttagt
aata 24524DNAArtificial SequenceOligonucleotide Primer a20Crev4920
5gggtactaca ctagcctatt acta 24624DNAArtificial
SequenceOligonucleotide Primer a20fis19forw1110 6cggttacaag
gtctacccaa tctg 24724DNAArtificial SequenceOligonucleotide Primer
a20fis19rev1149 7gtcaaacaga tagccgcaga ttgg 24824DNAArtificial
SequenceOligonucleotide Primer n07fis13forw51524 8tacaaaacta
ctgcaacgcc tata 24924DNAArtificial SequenceOligonucleotide Primer
n07fis13rev51563 9cctcacccca agtatatata ggcg 241024DNAArtificial
SequenceOligonucleotide Primer n07Bforw10439/53434 10cattggacct
cttccccact aaga 241124DNAArtificial SequenceOligonucleotide Primer
n07Brev10478/53473 11tccttgagtc cagtgctctt agtg 241224DNAArtificial
SequenceOligonucleotide Primer n07Aforw4333 12gaaactaggc gcgtcaggtt
ttat 241324DNAArtificial SequenceOligonucleotide Primer n07Arev4372
13aaggcagcca ctgaaaataa aacc 2414954PRTOryza
sativaPEPTIDE(0)...(0)Accession No NP_910480, Rice NBS-LRR 14Met
Glu Gly Ala Val Phe Ser Leu Thr Glu Gly Ala Val Arg Ser Leu1 5 10
15 Leu Cys Lys Leu Gly Cys Leu Leu Thr Glu Asp Thr Trp Leu Val Gln
20 25 30 Gly Val His Gly Glu Ile Gln Tyr Ile Lys Asp Glu Leu Glu
Cys Met 35 40 45 Asn Ala Phe Leu Arg Asn Leu Thr Ile Ser Gln Ile
His Asp Asp Gln 50 55 60 Val Arg Ile Trp Met Lys Gln Val Arg Glu
Ile Ala Tyr Asp Ser Glu65 70 75 80 Asp Cys Ile Asp Glu Phe Ile His
Asn Leu Gly Glu Ser Ser Glu Met 85 90 95 Gly Phe Phe Gly Gly Leu
Ile Ser Met Leu Arg Lys Leu Ala Cys Arg 100 105 110 His Arg Ile Ala
Leu Gln Leu Gln Glu Leu Lys Ala Arg Ala Gln Asp 115 120 125 Val Gly
Asp Arg Arg Ser Arg Tyr Gly Val Glu Leu Ala Lys Ala Thr 130 135 140
His Glu Glu Ala His Pro Arg Leu Thr Arg His Ala Ser Leu His Ile145
150 155 160 Asp Pro Gln Leu His Ala Leu Phe Ala Glu Glu Ala Gln Leu
Val Gly 165 170 175 Ile Asp Glu Pro Arg Asn Glu Leu Val Ser Trp Leu
Met Glu Glu Asp 180 185 190 Leu Arg Leu Arg Val Leu Ala Ile Val Gly
Phe Gly Gly Leu Gly Lys 195 200 205 Thr Thr Leu Ala Arg Met Val Cys
Gly Ser Pro Val Val Lys Ser Ala 210 215 220 Asp Phe Gln Cys Cys Pro
Leu Phe Ile Ile Ser Gln Thr Phe Asn Ile225 230 235 240 Arg Ala Leu
Phe Gln His Met Val Arg Glu Leu Ile Gln Glu Pro His 245 250
255 Lys Ala Met Ala Ile Ala Gly Cys Lys His Gly Leu Ile Thr Asp Asp
260 265 270 Tyr Leu Glu Gly Met Glu Arg Trp Glu Val Ala Ala Leu Thr
Lys Asn 275 280 285 Leu Arg Arg Tyr Phe Gln Asp Lys Arg Tyr Ile Val
Ile Leu Asp Asp 290 295 300 Ile Trp Thr Val Ser Ala Trp Glu Ser Ile
Arg Cys Ala Leu Pro Asp305 310 315 320 Asn Leu Lys Gly Ser Arg Ile
Ile Val Thr Thr Arg Asn Ala Asp Val 325 330 335 Ala Asn Thr Cys Cys
Ser Arg Pro Gln Asp Arg Ile Tyr Asn Ile Gln 340 345 350 Arg Leu Ser
Glu Thr Thr Ser Arg Glu Leu Phe Phe Lys Lys Ile Phe 355 360 365 Gly
Phe Ala Asp Asp Lys Ser Pro Thr Asp Glu Phe Glu Glu Val Ser 370 375
380 Asn Ser Val Leu Lys Lys Cys Gly Gly Leu Pro Leu Ala Ile Val
Asn385 390 395 400 Ile Gly Ser Leu Leu Ala Ser Lys Thr Asn Arg Thr
Lys Glu Glu Trp 405 410 415 Gln Lys Val Cys Asn Asn Leu Gly Ser Glu
Leu Glu Asn Asn Pro Thr 420 425 430 Leu Glu Gly Val Lys Gln Val Leu
Thr Leu Ser Tyr Asn Asp Leu Pro 435 440 445 Tyr His Leu Lys Ala Cys
Phe Leu Tyr Leu Ser Ile Phe Pro Glu Asn 450 455 460 Tyr Val Ile Lys
Arg Gly Pro Leu Val Arg Arg Trp Ile Ala Glu Gly465 470 475 480 Phe
Val Ser Gln Arg His Gly Gln Ser Met Glu Gln Leu Ala Glu Ser 485 490
495 Tyr Phe Asp Glu Phe Val Ala Arg Ser Ile Val Gln Pro Val Arg Thr
500 505 510 Asp Trp Thr Gly Lys Val Arg Ser Cys Arg Val His Asp Leu
Met Leu 515 520 525 Asp Val Ile Val Ser Arg Ser Ile Glu Glu Asn Phe
Ala Ser Phe Leu 530 535 540 Cys Asp Asn Gly Ser Thr Leu Ala Ser His
Asp Lys Ile Arg Arg Leu545 550 555 560 Ser Ile His Ser Ser Tyr Asn
Ser Ser Gln Lys Thr Ser Ala Asn Val 565 570 575 Ser His Ala Arg Ser
Phe Thr Met Ser Ala Ser Val Glu Glu Val Pro 580 585 590 Phe Phe Phe
Pro Gln Leu Arg Leu Leu Arg Val Leu Asp Leu Gln Gly 595 600 605 Cys
Ser Cys Leu Ser Asn Glu Thr Leu His Cys Met Cys Arg Phe Phe 610 615
620 Gln Leu Lys Tyr Leu Ser Leu Arg Asn Thr Asn Val Ser Lys Leu
Pro625 630 635 640 His Leu Leu Gly Asn Leu Lys His Leu Glu Thr Leu
Asp Ile Arg Ala 645 650 655 Thr Leu Ile Lys Lys Leu Pro Ala Ser Ala
Gly Asn Leu Ser Cys Leu 660 665 670 Lys His Leu Phe Ala Gly His Lys
Val Gln Leu Thr Arg Thr Ala Ser 675 680 685 Val Lys Phe Leu Arg Gln
Ser Ser Gly Leu Glu Val Ala Thr Gly Val 690 695 700 Val Lys Asn Met
Val Ala Leu Gln Ser Leu Val His Ile Val Val Lys705 710 715 720 Asp
Lys Ser Pro Val Leu Arg Glu Ile Gly Leu Leu Gln Asn Leu Thr 725 730
735 Lys Leu Asn Val Leu Leu Arg Gly Val Glu Glu Asn Trp Asn Ala Phe
740 745 750 Leu Glu Ser Leu Ser Lys Leu Pro Gly Pro Leu Arg Ser Leu
Ser Ile 755 760 765 His Thr Leu Asp Glu Lys Glu His Ser Leu Ser Leu
Asp Asn Leu Ala 770 775 780 Phe Val Glu Ser Pro Pro Leu Phe Ile Thr
Lys Phe Ser Leu Ala Gly785 790 795 800 Glu Leu Glu Arg Leu Pro Pro
Trp Ile Pro Ser Leu Arg Asn Val Ser 805 810 815 Arg Phe Ala Leu Arg
Arg Thr Glu Leu His Ala Asp Ala Ile Gly Val 820 825 830 Leu Gly Asp
Leu Pro Asn Leu Leu Cys Leu Lys Leu Tyr His Lys Ser 835 840 845 Tyr
Ala Asp Asn Cys Ile Val Phe Cys His Gly Lys Phe Val Lys Leu 850 855
860 Lys Leu Leu Ile Ile Asp Asn Leu Glu Arg Ile Glu Lys Met Gln
Phe865 870 875 880 Asp Ala Gly Ser Val Thr Asn Leu Glu Arg Leu Thr
Leu Ser Phe Leu 885 890 895 Arg Glu Pro Lys Tyr Gly Ile Ser Gly Leu
Glu Asn Leu Pro Lys Leu 900 905 910 Lys Glu Ile Glu Phe Phe Gly Asp
Ile Ile Leu Ser Val Val Thr Lys 915 920 925 Val Ala Ser Cys Val Lys
Ala His Pro Asn His Pro Arg Val Ile Gly 930 935 940 Asp Lys Trp Asn
Ile Val Thr Glu Tyr Ala945 950 15953PRTOryza
sativaPEPTIDE(0)...(0)Accession No. NP_910483 Rice NBS-LRR 15Met
Glu Gly Ala Ile Phe Ser Val Ala Glu Gly Thr Val Arg Ser Leu1 5 10
15 Leu Ser Lys Leu Ser Ser Leu Leu Ser Gln Glu Ser Trp Phe Val Arg
20 25 30 Gly Val His Gly Asp Ile Gln Tyr Ile Lys Asp Glu Leu Glu
Ser Met 35 40 45 Asn Ala Phe Leu Arg Tyr Leu Thr Val Leu Glu Asp
His Asp Thr Gln 50 55 60 Val Arg Ile Trp Met Lys Gln Val Arg Glu
Ile Ala Tyr Asp Ala Glu65 70 75 80 Asp Cys Ile Asp Gln Phe Thr His
His Leu Gly Glu Ser Ser Gly Ile 85 90 95 Gly Phe Leu Tyr Arg Leu
Ile Tyr Ile Leu Gly Lys Leu Cys Cys Arg 100 105 110 His Arg Ile Ala
Met Gln Leu Gln Glu Leu Lys Ala Arg Ala Gln Asp 115 120 125 Val Ser
Glu Arg Arg Ser Arg Tyr Glu Val Met Leu Pro Lys Thr Thr 130 135 140
Leu Gln Gly Ala Gly Pro Arg Leu Thr Arg His Ala Ser Arg His Leu145
150 155 160 Asp Pro Gln Leu His Ala Leu Phe Thr Glu Glu Ala Gln Leu
Val Gly 165 170 175 Leu Asp Glu Pro Arg Asp Lys Leu Val Arg Trp Val
Met Glu Ala Asp 180 185 190 Pro Cys Arg Arg Val Leu Ala Ile Val Gly
Phe Gly Gly Leu Gly Lys 195 200 205 Thr Thr Leu Ala Arg Met Val Cys
Glu Asn Pro Met Val Lys Gly Ala 210 215 220 Asp Phe His Cys Cys Pro
Leu Phe Ile Val Ser Gln Thr Phe Asn Ile225 230 235 240 Arg Thr Leu
Phe Gln Tyr Met Ile Arg Glu Leu Ile Gln Arg Pro Asn 245 250 255 Lys
Ala Met Ala Val Ala Gly Gly Lys His Gly His Thr Met Asp Gly 260 265
270 Asn Met Asp Gly Met Glu Arg Trp Glu Val Ala Val Leu Ala Glu Lys
275 280 285 Val Arg Gln Tyr Leu Leu Asp Lys Tyr Ile Val Ile Phe Asp
Asp Ile 290 295 300 Trp Thr Ile Ser Ala Trp Glu Ser Ile Arg Cys Ala
Leu Pro Asp Asn305 310 315 320 Lys Lys Gly Ser Arg Val Ile Ile Thr
Thr Arg Asn Glu Asp Val Ala 325 330 335 Asn Thr Cys Cys Ser Gly Pro
Gln Asp Gln Val Tyr Lys Met Gln Arg 340 345 350 Leu Ser Asp Ala Ala
Ser Arg Glu Leu Phe Phe Lys Arg Ile Phe Gly 355 360 365 Ser Ala Asp
Ile Ser Ser Asn Glu Glu Leu Asp Glu Val Ser Asn Ser 370 375 380 Ile
Leu Lys Lys Cys Gly Gly Leu Pro Leu Ala Ile Val Ser Ile Gly385 390
395 400 Ser Leu Val Ala Ser Lys Thr Asn Arg Thr Lys Glu Glu Trp Gln
Lys 405 410 415 Ile Cys Asp Asn Leu Gly Ser Glu Leu Glu Thr Asn Pro
Thr Leu Glu 420 425 430 Val Ala Lys Gln Val Leu Thr Leu Ser Tyr Asn
Asp Leu Pro Tyr His 435 440 445 Leu Lys Ala Cys Phe Leu Tyr Leu Ser
Ile Phe Pro Glu Asn Tyr Val 450 455 460 Ile Arg Arg Gly Pro Leu Val
Arg Arg Trp Ile Ala Glu Gly Phe Val465 470 475 480 Asn Gln Arg His
Gly Leu Ser Met Glu Glu Val Ala Glu Ser Tyr Phe 485 490 495 Asp Glu
Phe Val Ala Arg Ser Ile Val Gln Pro Val Lys Ile Asp Trp 500 505 510
Ser Gly Lys Val Arg Thr Cys Arg Val His Asp Met Met Leu Glu Val 515
520 525 Ile Ile Ser Lys Ser Leu Glu Glu Asn Phe Ala Ser Phe Leu Cys
Asp 530 535 540 Asn Gly His Pro Leu Val Cys His Asp Lys Ile Arg Arg
Leu Ser Ile545 550 555 560 His Asn Ser His Asn Ser Val Gln Arg Thr
Arg Val Ser Val Ser His 565 570 575 Val Arg Ser Phe Thr Met Ser Ala
Ser Val Glu Glu Val Pro Met Phe 580 585 590 Phe Pro Gln Met Arg Leu
Leu Arg Val Leu Asp Leu Gln Gly Ser Ser 595 600 605 Cys Leu Asn Asn
Ser Thr Leu Asn Tyr Ile Cys Lys Phe Tyr Gln Leu 610 615 620 Lys Tyr
Leu Thr Leu Arg Lys Thr Asn Ile Gly Lys Leu Pro Arg Leu625 630 635
640 Ile Gly Asn Leu Lys Tyr Leu Glu Thr Leu Asp Ile Arg Ala Thr Arg
645 650 655 Ile Lys Arg Leu Pro Ala Ser Ala Ser Asn Leu Ser Cys Leu
Lys His 660 665 670 Leu Leu Val Gly His Lys Val Gln Leu Thr Arg Thr
Thr Ser Val Lys 675 680 685 Cys Phe Arg Pro Asp Ser Gly Leu Glu Met
Thr Ala Gly Val Val Lys 690 695 700 Asn Met Met Ala Leu Gln Ser Leu
Ala His Ile Val Val Lys Glu Arg705 710 715 720 Pro Ala Val Leu Ser
Glu Ile Gly Gln Leu Gln Lys Leu Gln Lys Leu 725 730 735 Asn Val Leu
Phe Arg Gly Val Glu Glu Asn Trp Asn Ala Phe Leu Gln 740 745 750 Ser
Leu Val Lys Leu Thr Gly Ser Leu Arg Ser Leu Ser Ile His Ile 755 760
765 Leu Asp Glu Lys Glu His Ser Ser Ser Leu Glu Tyr Leu Ala Leu Ile
770 775 780 Ala Glu Ser Pro Pro Leu Phe Ile Arg Asn Phe Ser Leu Lys
Gly Lys785 790 795 800 Leu Gln Arg Leu Pro Pro Trp Ile Pro Ser Leu
Arg Asn Val Ser Arg 805 810 815 Ile Thr Phe Arg Asp Thr Gly Leu His
Ala Glu Ala Ile Gly Val Leu 820 825 830 Gly Asp Leu Pro Asn Leu Leu
Cys Leu Lys Leu Tyr Gln Arg Ser Tyr 835 840 845 Ala Asp Asp His Ile
Phe Phe Ala His Gly Asn Phe Leu Lys Leu Arg 850 855 860 Met Leu Val
Ile Asp Asn Met Glu Asn Ile Arg Asn Val His Phe Glu865 870 875 880
Lys Gly Ser Val Pro Asn Leu Glu Trp Leu Thr Ile Ala Phe Leu Gln 885
890 895 Glu Pro Lys Asp Gly Ile Thr Gly Leu Glu Asn Leu Leu Lys Leu
Lys 900 905 910 Glu Ile Glu Phe Phe Gly Asp Ile Ile Leu Ser Met Val
Thr Lys Val 915 920 925 Ala Ser Cys Met Lys Ala His Pro Asn Arg Pro
Arg Val Ile Gly Asp 930 935 940 Lys Trp Asn Asn Val Thr Glu Tyr
Ala945 950 16989PRTOryza sativaPEPTIDE(0)...(0)Accession No
NP_910482 Rice NBS-LRR 16Met Glu Gly Ala Ile Val Ser Leu Thr Glu
Gly Ala Val Arg Gly Leu1 5 10 15 Leu Arg Lys Leu Ala Gly Val Leu
Ala Gln Glu Ser Ser Pro Ala Gln 20 25 30 Arg Val His Gly Glu Val
Gln Tyr Ile Lys Asp Glu Leu Glu Ser Met 35 40 45 Asn Ala Phe Leu
Arg Ser Val Ser Thr Ser Pro Glu Asp Ala Ala Gly 50 55 60 His Asp
Asp Gln Val Arg Val Trp Met Lys Gln Val Arg Glu Ile Ala65 70 75 80
Tyr Asp Ala Glu Asp Cys Ile Asp Val Phe Val Arg Gly Arg Ser His 85
90 95 Pro Ala Ala Ala Ala Gly Asp Glu Gly Arg Leu Val Ala Ser Leu
Arg 100 105 110 Arg Phe Val Arg Leu Leu Ala Gly Ala Leu Gly Val Gly
Gly Gly Asp 115 120 125 Arg Ser Val Ala Ala Gln Leu Arg Glu Leu Lys
Ala Arg Ala Arg Asp 130 135 140 Ala Gly Glu Arg Arg Thr Arg Tyr Gly
Val Ser Leu Ala Ala Ala Ala145 150 155 160 Val Arg Gly Gly Gly Gly
Ser Ser Ser Ser Gly Arg Leu Asp Pro Arg 165 170 175 Leu His Ala Leu
Phe Thr Glu Glu Ala Gln Leu Val Gly Ile Asp Gly 180 185 190 Pro Arg
Glu Glu Leu Val Gly Trp Val Met Glu Glu Glu Pro Arg Leu 195 200 205
Arg Val Leu Ala Val Val Gly Phe Gly Gly Leu Gly Lys Thr Thr Leu 210
215 220 Ala Arg Met Val Cys Gly Ser Pro Arg Val Lys Gly Ala Ala Asp
Phe225 230 235 240 Gln Cys Ser Pro Pro Leu Val Val Val Ser Gln Thr
Phe Ser Ile Thr 245 250 255 Ala Leu Phe Gln His Leu Leu Arg Glu Leu
Ile Gln Arg Pro Arg Lys 260 265 270 Ala Met Ala Ala Val Ala Ala Ala
Gly Gly Gly Gly Gly Asp Leu Val 275 280 285 Ala Tyr Asp Ala Leu Gln
Gly Met Glu Arg Trp Glu Thr Ala Ala Leu 290 295 300 Ala Ser Lys Ala
Glu Gly Ile Pro Ala Arg Gln Lys Phe Val His Ile305 310 315 320 Cys
Gly Thr Ile Thr Leu Tyr Arg Tyr Ile Val Ile Leu Asp Asp Ile 325 330
335 Trp Ser Ser Ser Ala Trp Glu Ser Ile Lys Cys Ala Phe Pro Asp Asn
340 345 350 Lys Lys Gly Ser Arg Ile Ile Val Thr Thr Arg Asn Glu Asp
Val Ala 355 360 365 Asn Thr Cys Cys Cys Arg Pro Gln Asp Arg Ile Tyr
Lys Ile Gln Arg 370 375 380 Leu Ser Asp Ala Ala Ser Arg Glu Leu Phe
Phe Lys Arg Ile Phe Gly385 390 395 400 Met Ala Asp Ala Gly Ala Pro
Asp Asp Asp Glu Leu Lys Gln Val Ser 405 410 415 Asp Ser Ile Leu Lys
Lys Cys Gly Gly Leu Pro Leu Ala Ile Val Ser 420 425 430 Ile Gly Ser
Leu Leu Ala Ser Lys Pro Asn Arg Ser Lys Glu Glu Trp 435 440 445 Gln
Lys Val Cys Asp Asn Leu Gly Ser Glu Leu Glu Ser Asn Pro Thr 450 455
460 Leu Glu Gly Thr Lys Gln Val Leu Thr Leu Ser Tyr Asn Asp Leu
Pro465 470 475 480 Tyr His Leu Lys Ala Cys Phe Leu Tyr Leu Ser Ile
Phe Pro Glu Asn 485 490 495 His Val Ile Lys Arg Gly Pro Leu Val Arg
Met Trp Ile Ala Glu Gly 500 505 510 Phe Val Thr Gln Arg His Gly Leu
Ser Met Glu Gln Val Gly Glu Arg 515 520 525 Tyr Phe Asp Glu Phe Val
Ser Arg Ser Met Val His Leu Val Arg Ile 530 535 540 Asp Trp Ser Gly
Lys Val Arg Ser Cys Lys Val His Asp Ile Met Leu545 550 555 560 Glu
Val Ile Val Ser Lys Ser Leu Glu Glu Asn Phe Ala Ser Phe Phe 565 570
575 Cys Asp Asn Gly Thr Glu Leu Val Ser His Asp Lys Ile Arg Arg Leu
580 585 590 Ser Ile Arg Ser Ser Ser Tyr Ser Ser Ala Gln Arg Thr Ser
Asn Ser 595 600 605 Val Ala His Val Arg Thr Phe Arg Met Ser Pro Ser
Ile Asp Asn Ile 610 615 620 Pro Phe Phe Phe Pro Gln Leu Arg Leu Leu
Arg Val Leu Asp Met Gln625 630 635 640 Gly Ser Arg Cys Met Ser Asn
Lys Asn Leu Asp
Cys Ile Cys Arg Phe 645 650 655 Phe Gln Leu Lys Tyr Leu Ser Leu Arg
Asn Thr Ser Val Ser Ile Leu 660 665 670 Pro Arg Leu Ile Gly Asn Leu
Asn His Leu Glu Thr Leu Asp Ile Arg 675 680 685 Glu Thr Leu Ile Lys
Lys Leu Pro Ser Ser Ala Ala Asn Leu Thr Cys 690 695 700 Leu Lys His
Leu Leu Ala Gly His Lys Glu Gln Leu Thr Arg Thr Ser705 710 715 720
Ser Val Lys Phe Leu Arg Pro Ser Ser Gly Leu Lys Met Ser His Gly 725
730 735 Val Ile Arg Asn Met Ala Lys Leu Gln Ser Leu Val His Val Glu
Ile 740 745 750 Lys Glu His Pro Ser Val Phe Gln Glu Ile Ala Leu Leu
Gln Asn Leu 755 760 765 Arg Lys Leu Ser Val Leu Phe Tyr Gly Ile Glu
Val Asn Trp Lys Pro 770 775 780 Phe Leu Glu Leu Leu Asn Met Leu Ser
Gly Ser Val Arg Ser Leu Ser785 790 795 800 Ile Asp Ile Phe Asp Ala
Gln Gly Asn Ile Ser Ile Ser Ser Leu Glu 805 810 815 Met Leu Ser Ser
Leu Val Ser Pro Pro Ile Phe Ile Thr Ser Phe Ser 820 825 830 Leu Thr
Gly Lys Leu Gly Ser Leu Pro Pro Trp Val Ala Ser Leu Arg 835 840 845
Ser Val Ser Arg Leu Thr Leu Arg Arg Ser Gln Leu Arg Ala Asp Ala 850
855 860 Ile His Val Leu Gly Gly Leu Gln Asn Leu Leu Cys Leu Lys Leu
Tyr865 870 875 880 His Lys Ser Tyr Ala Asp Asp Arg Leu Val Phe Pro
Gln Gly Gly Phe 885 890 895 Ala Arg Val Lys Leu Leu Ile Asp Asp Asn
Leu Val Asn Leu Glu Lys 900 905 910 Leu His Phe Asn Glu Gly Ser Met
Pro Asn Leu Glu Arg Leu Thr Leu 915 920 925 Ser Phe Leu Arg Glu Pro
Lys Asp Gly Ile Ser Gly Leu Asn Asn Leu 930 935 940 Leu Lys Leu Lys
Glu Val Glu Phe Phe Gly Asn Ile Val Ser Ser Val945 950 955 960 Val
Ser Lys Val Val Ser Cys Val Lys Asp His Pro Asn His Pro Arg 965 970
975 Val Val Gly Asp Lys Trp Asn Ile Val Thr Val Tyr Asn 980 985
17998PRTOryza sativaPEPTIDE(0)...(0)Accession No. NP_921091.1 Rice
disease resistance protein 17Met Glu Thr Ala Val Leu Ser Ala Val
Leu Arg Thr Leu Gly Pro Lys1 5 10 15 Leu Tyr Ala Phe Leu Arg Asp
Gly His Asp Leu Leu Arg Arg Asp Leu 20 25 30 Glu Arg Asp Val His
Tyr Ile Arg Asn Glu Leu Ala Met Ile Ala Ala 35 40 45 Ala Ile Glu
Glu His Asp Arg Arg Pro Pro Pro Ala Ala Gly Asp Val 50 55 60 Arg
Ser Ala Trp Ile Arg Gly Val Arg Asp Leu Ala Cys Asp Met Glu65 70 75
80 Asp Cys Val Asp Arg Phe Val His Arg Ala Thr Gly His Gly Leu Ala
85 90 95 Ser Met Gly Ala Arg Ala Lys Phe Ala Ala Val Ile Gln Glu
Leu Arg 100 105 110 Arg Lys Ser Glu Glu Leu Ser Arg Leu Arg Ala Ser
Tyr Ala Ala Ala 115 120 125 Ala Gly Glu Pro Ser Cys Trp Val Ala Thr
Gly Ser Ser Ala Leu Thr 130 135 140 Leu Pro Ala Ser Ser Ser Glu Ala
His Thr Leu Ala Ser Asp Ile Val145 150 155 160 Gly Met Asp Gly Pro
Arg Asp Glu Ile Leu Glu Leu Ile Gly Glu Thr 165 170 175 Gln Gly Gln
Leu Lys Val Ile Ser Ile Val Gly Phe Gly Gly Leu Gly 180 185 190 Lys
Thr Leu Leu Ala Arg Gln Ile Tyr Glu Ser Asp Ala Val Ala Ala 195 200
205 Gln Phe His Pro Arg Ile Trp Val Arg Ala Ala Gly Lys Asn Ala Glu
210 215 220 Asp Val Leu Met Asp Ile Leu Gln Gln Leu Gly Met Pro Val
His His225 230 235 240 Cys His Ala Ser Asn Leu Val Val Asn Leu Arg
Asn Cys Leu Glu Ser 245 250 255 Lys Arg Phe Phe Val Val Ile Asp Asp
Met Gln Arg Glu Tyr Trp Asn 260 265 270 Ser Ser Phe Arg Asn Ala Phe
Pro Ser Asp Thr Gly Leu Ser Ser Ile 275 280 285 Val Ile Val Thr Thr
Ala Ile Gln Ser Ile Ala Asn Ala Cys Ser Ser 290 295 300 Arg Asn Ser
His Val Tyr Val Met Arg Thr Leu Asn Glu Glu His Ser305 310 315 320
Arg Gln Leu Phe Leu Lys Glu Ala Ser Trp Lys Asp Tyr Pro Pro Gly 325
330 335 Ser Glu Ala Ile Leu Lys Lys Cys Asp Gly Leu Pro Leu Ala Leu
Val 340 345 350 Thr Thr Ala Gln Phe Leu Gln Ser Arg Cys Gln Gln Gln
Pro Leu Gly 355 360 365 Cys Ala Lys Leu Cys Asp Asn Leu Gly Lys His
Leu Val Thr Glu Asp 370 375 380 Thr Leu Ala Arg Met Lys Arg Val Leu
Val His His Tyr Ser Ser Leu385 390 395 400 Pro Gly His Val Ile Lys
Ala Cys Leu Leu Tyr Leu Gly Ile Phe Pro 405 410 415 Ser Gly His Pro
Val Arg Arg Lys Thr Leu Ile Arg Arg Trp Ser Ala 420 425 430 Glu Gly
Phe Val Gly Ala Asp His His Arg Ser Ser Leu Asp Val Ala 435 440 445
Ile Asp Ser Phe Glu Glu Leu Val Asn Arg Ser Ile Ile Gln Pro Val 450
455 460 Asp Val Ser Ser Asn Thr Glu Val Lys Thr Cys Gln Thr His Gly
Met465 470 475 480 Met Leu Glu Phe Ile Leu His Lys Ser Ile Cys Asp
Asn Phe Ile Thr 485 490 495 Phe Leu Tyr Gly Gln Ala Arg Leu Pro Asp
Lys Ile Arg Cys Val Ser 500 505 510 Ile Gln Gln Asn Ser Gly Ser Lys
Thr Arg Val Asp Ser Asp Ile Asp 515 520 525 Leu Ser Leu Val Arg Ser
Leu Thr Ile Phe Gly Lys Ala His Lys Ser 530 535 540 Phe Leu Asn Phe
Ser Arg Tyr Lys Leu Leu Arg Val Leu Asp Leu Glu545 550 555 560 Glu
Cys Asp Glu Leu Glu Asp Glu His Leu Lys Lys Ile Cys Lys Arg 565 570
575 Leu Leu Leu Lys Tyr Leu Ser Leu Gly Arg Gly Ile Thr Val Leu Pro
580 585 590 Lys Glu Ile Ala Lys Leu Lys Phe Leu Glu Thr Leu Asp Leu
Arg Arg 595 600 605 Thr Val Ile Lys Phe Leu Pro Ile Gln Val Leu Glu
Leu Pro Cys Leu 610 615 620 Ile His Leu Phe Gly Val Phe Lys Ile Gln
Asp Ala Asp Gln Gln Met625 630 635 640 Arg Lys Leu Lys Ser Phe Leu
Thr Glu Lys Ser Lys Leu Glu Thr Leu 645 650 655 Ala Gly Phe Val Thr
Asp Arg Cys Gln Thr Phe Pro Gln Leu Met Lys 660 665 670 His Met Thr
Asn Leu Ala Lys Val Lys Ile Trp Cys Glu Asn Thr Ala 675 680 685 Asp
Ala Ser Ser Ser Ser Asn Ser Asp Val His Leu Ser Glu Ala Ile 690 695
700 Gln Glu Phe Ile Gln Arg Gly Thr Asp Val Asn Asp Val Arg Ser
Leu705 710 715 720 Ser Leu Asp Val Gly Glu Cys Ser Gln Glu Phe Leu
Asn Phe Ser Leu 725 730 735 Gly Asp Ser Cys Tyr Leu Ser Ser Leu Lys
Leu Lys Gly Asn Lys Ile 740 745 750 Cys Arg Leu Pro Pro Phe Val Thr
Ser Leu Ala Val Leu Thr Asp Leu 755 760 765 Cys Leu Ser Ser Ser Asp
Arg Leu Ser Ser Asp Val Leu Ala Ala Leu 770 775 780 Ser Asn Val Arg
Ala Leu Arg Tyr Leu Lys Leu Ile Ala Arg His Leu785 790 795 800 Asp
Arg Phe Val Ile Glu Arg Gly Asp Leu Gln Ser Leu Arg Arg Leu 805 810
815 His Ile Val Val Val Ser Met Thr Thr Met Ser Lys Gln Gln Pro Glu
820 825 830 Ile Gln Glu Gly Ala Leu Pro Asn Leu Glu Ser Phe His Leu
Leu Cys 835 840 845 Lys Asp Leu Asp Gly Pro Cys Gly His Gly Gly Ile
Arg Ile Asp Ser 850 855 860 Leu Gly Leu Gly Cys Leu Arg Glu Ile Val
Leu Asp Asp Gly Val Arg865 870 875 880 Glu Thr Ala Lys Glu Gln Trp
Lys Asp Ala Ala Arg Arg His Pro Lys 885 890 895 Arg Pro Lys Val Val
Phe Val Gly Ala Gly Asp Val Val Asp Arg Arg 900 905 910 Arg Val Gly
Ala Ala Ala Ala Ala Ala Pro Ala Ala Gly Glu Ser Asn 915 920 925 Ser
Ala Met Ala Pro Ala Ala Val Ala Ser Val Val Ala Ala Gly Asp 930 935
940 Val Lys Arg Pro Ala Arg Glu Glu Ser Asp Ile Ser Ala Ala Leu
Ala945 950 955 960 Ser Leu Pro Ala Lys Met Ala Arg Leu Leu Gly Ala
Ala Ser Ile His 965 970 975 Gln Ser Ser Gly Thr Gln Gly Glu Leu Ser
Cys Gly Gly Asn Gly Ala 980 985 990 Ser Gln Arg His Phe Ser 995
18958PRTHordeum vulgarePEPTIDE(0)...(0)Accession No. AAG37354,
Barley powdery mildew resistance protein 18Met Asp Ile Val Thr Gly
Ala Ile Ser Asn Leu Ile Pro Lys Leu Gly1 5 10 15 Glu Leu Leu Thr
Glu Glu Phe Lys Leu His Lys Gly Val Lys Lys Asn 20 25 30 Ile Glu
Asp Leu Gly Lys Glu Leu Glu Ser Met Asn Ala Ala Leu Ile 35 40 45
Lys Ile Gly Glu Val Pro Arg Glu Gln Leu Asp Ser Gln Asp Lys Leu 50
55 60 Trp Ala Asp Glu Val Arg Glu Leu Ser Tyr Val Ile Glu Asp Val
Val65 70 75 80 Asp Lys Phe Leu Val Gln Val Asp Gly Ile Gln Phe Asp
Asp Asn Asn 85 90 95 Asn Lys Phe Lys Gly Phe Met Lys Arg Thr Thr
Glu Leu Leu Lys Lys 100 105 110 Val Lys His Lys His Gly Ile Ala His
Ala Ile Lys Asp Ile Gln Glu 115 120 125 Gln Leu Gln Lys Val Ala Asp
Arg Arg Asp Arg Asn Lys Val Phe Val 130 135 140 Pro His Pro Thr Arg
Thr Ile Ala Ile Asp Pro Cys Leu Arg Ala Leu145 150 155 160 Tyr Ala
Glu Ala Thr Glu Leu Val Gly Ile Tyr Gly Lys Arg Asp Gln 165 170 175
Asp Leu Met Arg Leu Leu Ser Met Glu Gly Asp Asp Ala Ser Asn Lys 180
185 190 Arg Leu Lys Lys Val Ser Ile Val Gly Phe Gly Gly Leu Gly Lys
Thr 195 200 205 Thr Leu Ala Arg Ala Val Tyr Glu Lys Ile Lys Gly Asp
Phe Asp Cys 210 215 220 Arg Ala Phe Val Pro Val Gly Gln Asn Pro His
Met Lys Lys Val Leu225 230 235 240 Arg Asp Ile Leu Ile Asp Leu Gly
Asn Pro His Ser Asp Leu Ala Met 245 250 255 Leu Asp Ala Asn Gln Leu
Ile Lys Lys Leu Arg Glu Phe Leu Glu Asn 260 265 270 Lys Arg Tyr Leu
Val Ile Ile Asp Asp Ile Trp Asp Glu Lys Leu Trp 275 280 285 Glu Gly
Ile Asn Phe Ala Phe Ser Asn Arg Asn Asn Leu Gly Ser Arg 290 295 300
Leu Ile Thr Thr Thr Arg Ile Val Ser Val Ser Asn Ser Cys Cys Ser305
310 315 320 Ser His Gly Asp Ser Val Tyr Gln Met Glu Pro Leu Ser Val
Asp Asp 325 330 335 Ser Arg Ile Leu Phe Trp Lys Arg Ile Phe Pro Asp
Glu Asn Gly Cys 340 345 350 Leu Asn Glu Phe Glu Gln Val Ser Arg Asp
Ile Leu Lys Lys Cys Gly 355 360 365 Gly Val Pro Leu Ala Ile Ile Thr
Ile Ala Ser Ala Leu Ala Gly Asp 370 375 380 Gln Lys Met Lys Pro Lys
Cys Glu Trp Asp Ile Leu Leu Gln Ser Leu385 390 395 400 Gly Ser Gly
Leu Thr Glu Asp Asn Ser Leu Glu Glu Met Arg Arg Ile 405 410 415 Leu
Ser Phe Ser Tyr Ser Asn Leu Pro Ser His Leu Lys Thr Cys Leu 420 425
430 Leu Tyr Leu Cys Ile Tyr Pro Glu Asp Ser Lys Ile His Arg Asp Glu
435 440 445 Leu Ile Trp Lys Trp Val Ala Glu Gly Phe Val His His Glu
Asn Gln 450 455 460 Gly Asn Ser Leu Tyr Leu Leu Gly Leu Asn Tyr Phe
Asn Gln Leu Ile465 470 475 480 Asn Arg Ser Met Ile Gln Pro Ile Tyr
Gly Phe Asn Asp Glu Val Tyr 485 490 495 Val Cys Arg Val His Asp Met
Val Leu Asp Leu Ile Cys Asn Leu Ser 500 505 510 Arg Glu Ala Lys Phe
Val Asn Leu Leu Asp Gly Ser Gly Asn Ser Met 515 520 525 Ser Ser Gln
Gly Asn Cys Arg Arg Leu Ser Leu Gln Lys Arg Asn Glu 530 535 540 Asp
His Gln Ala Lys Pro Ile Thr Asp Ile Lys Ser Met Ser Arg Val545 550
555 560 Arg Ser Ile Thr Ile Phe Pro Pro Ala Ile Glu Val Met Pro Ser
Leu 565 570 575 Ser Arg Phe Asp Val Leu Arg Val Leu Asp Leu Ser Arg
Cys Asn Leu 580 585 590 Gly Glu Asn Ser Ser Leu Gln Leu Asn Leu Lys
Asp Val Gly His Leu 595 600 605 Thr His Leu Arg Tyr Leu Gly Leu Glu
Gly Thr Asn Ile Ser Lys Leu 610 615 620 Pro Ala Glu Ile Gly Lys Leu
Gln Phe Leu Glu Val Leu Asp Leu Gly625 630 635 640 Asn Asn His Asn
Leu Lys Glu Leu Pro Ser Thr Val Cys Asn Phe Arg 645 650 655 Arg Leu
Ile Tyr Leu Asn Leu Phe Gly Cys Pro Val Val Pro Pro Val 660 665 670
Gly Val Leu Gln Asn Leu Thr Ser Ile Glu Val Leu Arg Gly Ile Leu 675
680 685 Val Ser Val Asn Ile Ile Ala Gln Glu Leu Gly Asn Leu Glu Arg
Leu 690 695 700 Arg Val Leu Asp Ile Cys Phe Arg Asp Gly Ser Leu Asp
Leu Tyr Lys705 710 715 720 Asp Phe Val Lys Ser Leu Cys Asn Leu His
His Ile Glu Ser Leu Arg 725 730 735 Ile Glu Cys Asn Ser Arg Glu Thr
Ser Ser Phe Glu Leu Val Asp Leu 740 745 750 Leu Gly Glu Arg Trp Val
Pro Pro Val His Phe Arg Glu Phe Val Ser 755 760 765 Ser Met Pro Ser
Gln Leu Ser Ala Leu Arg Gly Trp Ile Lys Arg Asp 770 775 780 Pro Ser
His Leu Ser Asn Leu Ser Glu Leu Ile Leu Ser Ser Val Lys785 790 795
800 Asp Val Gln Gln Asp Asp Val Glu Ile Ile Gly Gly Leu Leu Cys Leu
805 810 815 Arg Arg Leu Phe Ile Ile Thr Ser Thr Asp Gln Thr Gln Arg
Leu Leu 820 825 830 Val Ile Arg Ala Asp Gly Phe Arg Cys Thr Val Asp
Phe Arg Leu Asp 835 840 845 Cys Gly Ser Ala Thr Gln Ile Leu Phe Glu
Pro Gly Ala Leu Pro Arg 850 855 860 Ala Val Arg Val Trp Phe Ser Leu
Gly Val Arg Val Thr Lys Glu Asp865 870 875 880 Gly Asn Arg Gly Phe
Asp Leu Gly Leu Gln Gly Asn Leu Phe Ser Leu 885 890 895 Arg Glu Phe
Val Ser Val Tyr Met Tyr Cys Gly Gly Ala Arg Val Gly 900 905 910 Glu
Ala Lys Glu Ala Glu Ala Ala Val Arg Arg Ala Leu Glu Ala His 915 920
925 Pro Ser His Pro Arg Ile Tyr Ile Gln Met Arg Pro His Ile Ala Lys
930 935 940
Gly Ala His Asp Asp Asp Leu Cys Glu Asp Glu Glu Glu Asn945 950 955
1917DNAArtificial SequenceMPSS Signature Sequence Tag 19gatctcataa
ctaggat 172020DNAArtificial SequenceOligonucleotide Primer KEB131
20tgatccttga ttgtccatgg 202120DNAArtificial SequenceOligonucleotide
Primer KEB138 21ccgttgcttg catatatgct 20221684DNAZea
mayspromoter(0)...(0)Rcg1 Promoter Region 22actgtcgggg accataatta
ggggtaccct caagacgcct aattctcagc tggtaacccc 60catcagcata aagctgcaaa
ggcctgatgg gcacgattaa gtcagggatc agtccacacg 120agtgactcga
tcgcgcttca cccgagccta gcctcggccg aaggcagccg acctcgagag
180acttccgtct cgcccgaggc cccccttttt atggcggaca catcaccggc
ttgcccaagg 240ccttggcttc gctcagaagc aaccttgact aaatcaccac
accgactgac caaattgcag 300gggcatttaa cgcaaaggtg gcctgacacc
tctatcctga cacgcgcccc cggcagagcc 360gaggtgaccg ccgtcactcc
accgctccac tggccagtct gacagaagga cagcgccgcc 420tgcgccactc
cgactgcagt gccactcgac agagtgagtc tgacaggcaa ctaggccttg
480ccgaaggcgc cacggcgaac tccgctccgc ccgaccccag ggctcggact
cgggctaaga 540cccggaagac ggcgaactcc gctccgcccg accccagggc
tcggactcgg gctaagaccc 600ggaagacggc gaactccgct ccgcccgacc
ccagggctcg gactcgggct aagacccgga 660agacggcgaa ctccgctccg
cccgacccca gggctcggac tcgggctaag acccggaaga 720cggcgaactc
cgctccgccc gaccccaggg ctcggactcg ggctaagacc cggaagacgg
780cgaactccgc tccgcccgac cccagggctc agactcaggc taagacccgg
aagacgacga 840aactccgcct cgcccgaccc cagggctcgg actccgccct
ggcctcggcc ggacgacttc 900cgcctcgccc gaccccctgg ctcgggctcg
gccacagcaa ctgaaggcaa gactcaacct 960cggcttcgga ggaaacccca
cgtcgccctg cctagagcac agaccgccac gtcaacagga 1020aacgtcatca
tcaccctacc ccgaatcgac tcgggtcacg gagaacaaga ccggcgtctc
1080gtccggccag ctccgccaga ggggcaatga tggcgctcca cgagctctat
gacgacggcg 1140gcccccagct ctcttacggc agcaggacaa cgtcagcagg
gactcgaccg ctccaacagc 1200tgtccctcca tcaggctccg ccgcaccacc
gatagccacg acatcacgcc agcaggatgc 1260ccagatctct ccggctgcca
catcggcatg tacctagggc actagctctc cctccgctag 1320acacgtagca
ctctgctaca tccccattgt acacctgggt cctctcctta cgactataaa
1380aggaaggacc agggtcttct cagagaaggt tggccgcgcg ggaccgagga
cgggacaggc 1440gctctcttgg ggccgctcgc ttccctcacc cgcgtggacg
cttgtaaccc ccctactgca 1500agcgcacctg acctgggcgc gggacgaaca
cgaaggccgc gggacttcca cctctctcac 1560gctcggctcc ggccgcctcg
cctctccccc ctccgcgctc gcccacgcgc tcgacccatc 1620tgggctgggg
cacgcagcac actcactcgt cggcttaggg accccctgtc tcgaaacgcc 1680gaca
16842320DNAArtificial SequenceOligonucleotide Primer Frey8 Forward
23acatgggtcc aaagatcgac 202420DNAArtificial SequenceOligonucleotide
Primer Frey8 Reverse 24catggaagcc ccacaataac 202520DNAArtificial
SequenceOligonucleotide Primer Frey27 Forward 25gcatgcccca
tctggtatag 202620DNAArtificial SequenceOligonucleotide Primer
Frey27 Reverse 26agccctattt cctgctcctg 202720DNAArtificial
SequenceOligonucleotide Primer Frey33 Forward 27gcattcacat
gttcctcacc 202820DNAArtificial SequenceOligonucleotide Primer
Frey33 Reverse 28ctgtcgttcg gttttgcttc 202920DNAArtificial
SequenceOligonucleotide Primer Frey41 Forward 29ctgtaaggca
cccgatgttt 203020DNAArtificial SequenceOligonucleotide Primer
Frey41 Reverse 30tgtgttcgca tcaaaggtgt 203121DNAArtificial
SequenceOligonucleotide Primer Frey56 Forward 31tgtccagggt
tacagaaaac g 213221DNAArtificial SequenceOligonucleotide Primer
Frey56 Reverse 32ggtctgggaa tgctaaagag g 213320DNAArtificial
SequenceOligonucleotide Primer Frey95 Forward 33atttcgacgg
agggttcttc 203420DNAArtificial SequenceOligonucleotide Primer
Frey95 Reverse 34gcagcaggag gagctcatag 203520DNAArtificial
SequenceOligonucleotide Primer Frey110 Forward 35atggaggctg
ccctgctgag 203624DNAArtificial SequenceOligonucleotide Primer
Frey110 Reverse 36cgtatacctc tctggcaagg acgg 243725DNAArtificial
SequenceOligonucleotide Primer Frey111 Forward 37ttcctgttcg
tctgtatctg atccg 253825DNAArtificial SequenceOligonucleotide Primer
Frey111 Reverse 38tttgattccg gtcgagtata acctg 253925DNAArtificial
SequenceOligonucleotide Primer Frey112 Forward 39gaaactgcct
tcccagaaaa caatg 254024DNAArtificial SequenceOligonucleotide Primer
Frey112 Reverse 40caagatcggt gaagttggtg cttc 244125DNAArtificial
SequenceOligonucleotide Primer Frey113F Forward 41atcacagatg
ggtctcaagg attgc 254220DNAArtificial SequenceOligonucleotide Primer
Alex1R Reverse 42ttccaagcaa ttcacagctc 204324DNAArtificial
SequenceOligonucleotide Primer umc1612 Forward 43aggtccaggt
tacagagcaa gaga 244424DNAArtificial SequenceOligonucleotide Primer
umc1612 Reverse 44gctagtaggt gcatggtggt ttct 244524DNAArtificial
SequenceOligonucleotide Primer umc2041 Forward 45ctacacaagc
atagaggcct ggag 244623DNAArtificial SequenceOligonucleotide Primer
umc2041 Reverse 46cagtacgaga cgatggagga cat 234720DNAArtificial
SequenceOligonucleotide Primer cdo127 Forward 47tgctgttgtt
actcgggttg 204820DNAArtificial SequenceOligonucleotide Primer
cdo127 Reverse 48ctctgcctca gcacaaattc 204926DNAArtificial
SequenceOligonucleotide Primer phi093 Forward 49agtgcgtcag
cttcatcgcc tacaag 265030DNAArtificial SequenceOligonucleotide
Primer phi093 Reverse 50aggccatgca tgcttgcaac aatggataca
305120DNAArtificial SequenceOligonucleotide Primer cdo365 Forward
51cttccagagg caaagcgtag 205220DNAArtificial SequenceOligonucleotide
Primer cdo365 Reverse 52tgtcacccat gatccagttg 205320DNAArtificial
SequenceOligonucleotide Primer csu166 Forward 53tattgtgcac
gtcaccttgg 205420DNAArtificial SequenceOligonucleotide Primer
csu166 Reverse 54gggcagactt actgctggag 205520DNAArtificial
SequenceOligonucleotide Primer umc2285 Forward 55atctgcctcc
ttttccttgg 205620DNAArtificial SequenceOligonucleotide Primer
umc2285 Reverse 56aagtagctgg gcttggaggg 205720DNAArtificial
SequenceOligonucleotide Primer MZA11455 Forward 57acgaagcaat
ttcaccttcc 205823DNAArtificial SequenceOligonucleotide Primer
MZA11455 Reverse 58tgtggaacta accctcagca tag 235919DNAArtificial
SequenceOligonucleotide Primer MZA6064 Forward 59cgagaaccgg
agaagaagg 196020DNAArtificial SequenceOligonucleotide Primer
MZA6064 Reverse 60ttgggctgct gtattttgtg 206119DNAArtificial
SequenceOligonucleotide Primer MZA15842 Forward 61gacgcagctg
tgaagttgg 196220DNAArtificial SequenceOligonucleotide Primer
MZA15842 Reverse 62caccggaata ccttgaccac 206324DNAArtificial
SequenceOligonucleotide Primer umc1086 Forward 63catgaaagtt
ttcctgtgca gatt 246425DNAArtificial SequenceOligonucleotide Primer
umc1086 Reverse 64gggcaacttt agaggtcgat ttatt 256521DNAArtificial
SequenceOligonucleotide Primer umc1466-FA Forward 65gatccactag
ggtttcgggg t 216624DNAArtificial SequenceOligonucleotide Primer
umc1466-FA Reverse 66cgaatagtgg tctcgcgtct atct 246721DNAArtificial
SequenceOligonucleotide Primer umc1418-PA Forward 67gagccaagag
ccagagcaaa g 216824DNAArtificial SequenceOligonucleotide Primer
umc1418-PA Reverse 68tcacacacac actacactcg caat 246920DNAArtificial
SequenceOligonucleotide Primer BNLG2162-DA Forward 69caccggcatt
cgatatcttt 207020DNAArtificial SequenceOligonucleotide Primer
BNLG2162-DA Reverse 70gtctgctgct agtggtggtg 207120DNAArtificial
SequenceOligonucleotide Primer csu166-IA Forward 71aaatatcggc
tttggtcacg 207220DNAArtificial SequenceOligonucleotide Primer
csu166-IA 72tcgtccttcc tcaattcgac 207324DNAArtificial
SequenceOligonucleotide Primer umc1051 Forward 73aatgatcgaa
atgccattat ttgt 247424DNAArtificial SequenceOligonucleotide Primer
umc1051 Reverse 74ctgatctgac taaggccatc aaac 247524DNAArtificial
SequenceOligonucleotide Primer umc2187 Forward 75acccaacaag
tcttaatcgg gttt 247624DNAArtificial SequenceOligonucleotide Primer
umc2187 Reverse 76gtccacccta cctctcaaca aaca 247723DNAArtificial
SequenceOligonucleotide Primer umc1371 Forward 77catgtgaatg
gaagtgtccc ttt 237824DNAArtificial SequenceOligonucleotide Primer
umc1371 Reverse 78gcatcctttt cgtttcaaat atgc 247924DNAArtificial
SequenceOligonucleotide Primer umc1856 Forward 79agatctgttt
tgctttgctc tgct 248024DNAArtificial SequenceOligonucleotide Primer
umc1856 Reverse 80catgccttta ttctcacaca aacg 248121DNAArtificial
SequenceOligonucleotide Primer MZA1215 External Nested Forward
Primer 81agcccaattc tgtagatcca a 218219DNAArtificial
SequenceOligonucleotide Primer MZA1215 External Nested Reverse
Primer 82tgcatgcacc ggatccttc 198320DNAArtificial
SequenceOligonucleotide Primer MZA1215 Internal Nested Forward
Primer 83agcagcagac gatgcaaaga 208419DNAArtificial
SequenceOligonucleotide Primer MZA1215 Internal Nested Reverse
Primer 84aggctggcgg tggacttga 198520DNAArtificial
SequenceOligonucleotide Primer MZA1216 External Nested Forward
Primer 85ccggcctacg gcaacaagaa 208619DNAArtificial
SequenceOligonucleotide Primer MZA1216 External Nested Reverse
Primer 86agggtacggt gacccgaag 198720DNAArtificial
SequenceOligonucleotide Primer MZA1216 Internal Nested Forward
Primer 87ttcgagacgc tgtcgtacct 208820DNAArtificial
SequenceOligonucleotide Primer MZA1216 Internal Nested Reverse
Primer 88acgacgcatg gcactagcta 208918DNAArtificial
SequenceOligonucleotide Primer MZA3434 External Nested Forward
Primer 89tgtaccgcga gaactcca 189021DNAArtificial
SequenceOligonucleotide Primer MZA3434 External Nested Reverse
Primer 90ttgcattcac atgttcctca c 219118DNAArtificial
SequenceOligonucleotide Primer MZA3434 Internal Nested Forward
Primer 91ctactacgac ggccgcta 189221DNAArtificial
SequenceOligonucleotide Primer MZA3434 Internal Nested Reverse
Primer 92ttgcagtagt tttgtagcag g 219322DNAArtificial
SequenceOligonucleotide Primer MZA2591 External Nested Forward
Primer 93agtaaataac agcattgacc tc 229418DNAArtificial
SequenceOligonucleotide Primer MZA2591 External Nested Reverse
Primer 94tccaacggcg gtcactcc 189521DNAArtificial
SequenceOligonucleotide Primer MZA2591 Internal Nested Forward
Primer 95ctatataaca gggccctgga a 219620DNAArtificial
SequenceOligonucleotide Primer MZA2591 Internal Nested Reverse
Primer 96cacaaagccc acaagctaag 209721DNAArtificial
SequenceOligonucleotide Primer MZA11123 External Nested Forward
Primer 97accacaatct gaagcaagta g 219820DNAArtificial
SequenceOligonucleotide Primer MZA11123 External Nested Reverse
Primer 98cacagaaaca tctggtgctg 209921DNAArtificial
SequenceOligonucleotide Primer MZA11123 Internal Nested Forward
Primer 99aaagaccaag aaatgcagtc c 2110021DNAArtificial
SequenceOligonucleotide Primer MZA11123 Internal Nested Reverse
Primer 100agacatcacg taacagtttc c 2110120DNAArtificial
SequenceOligonucleotide Primer MZA15842 External Nested Forward
Primer 101ctcgattggc atacgcgata 2010220DNAArtificial
SequenceOligonucleotide Primer MZA15842 External Nested Reverse
Primer 102ttccttctcc acgcagttca 2010322DNAArtificial
SequenceOligonucleotide Primer MZA15842 Internal Nested Forward
Primer 103agaaggtatt tgccatggct ta 2210422DNAArtificial
SequenceOligonucleotide Primer MZA15842 Internal Nested Reverse
Primer 104gtttcacttg ctgaaggcag tc 2210521DNAArtificial
SequenceOligonucleotide Primer MZA11455 External Nested Forward
Primer 105gaccgatgaa ggcaattgtg a 2110622DNAArtificial
SequenceOligonucleotide Primer MZA11455 External Nested Reverse
Primer 106accaaatagt cctagataat gg 2210722DNAArtificial
SequenceOligonucleotide Primer MZA11455 Internal Nested Forward
Primer 107ttcaaccttc tgactgacac at 2210822DNAArtificial
SequenceOligonucleotide Primer MZA11455 Internal Nested Reverse
Primer 108taaacatagt cataaaaatt ac 2210922DNAArtificial
SequenceOligonucleotide Primer MZA6064 External Nested Forward
Primer 109tcgaatgtat tttttaatgc gg 2211020DNAArtificial
SequenceOligonucleotide Primer MZA6064 External Nested Reverse
Primer 110atccacaatg gcacttgggt 2011122DNAArtificial
SequenceOligonucleotide Primer MZA6064 Internal Nested Forward
Primer 111cagctatttt tgtcttcttc ct 2211220DNAArtificial
SequenceOligonucleotide Primer MZA6064 Internal Nested Reverse
Primer 112ggtcagattc caattcggac 2011320DNAArtificial
SequenceOligonucleotide Primer MZA11394 External Nested Forward
Primer 113tcgtcctaac agcctgtgtt 2011420DNAArtificial
SequenceOligonucleotide Primer MZA11394 External Nested Reverse
Primer 114gtccggatca aatggatcgt 2011522DNAArtificial
SequenceOligonucleotide Primer MZA11394 Internal Nested Forward
Primer 115aacagcctgt gttgaataag gt 2211619DNAArtificial
SequenceOligonucleotide Primer MZA11394 Internal Nested Reverse
Primer 116cgtgttccgt cgagggagt 1911722DNAArtificial
SequenceOligonucleotide Primer MZA8761 External Nested Forward
Primer 117ttctttgatt ctactcttga gc 2211820DNAArtificial
SequenceOligonucleotide Primer MZA8761 External Nested Reverse
Primer 118cttcatggac gcctgagatt 2011922DNAArtificial
SequenceOligonucleotide Primer MZA8761 Internal Nested Forward
Primer 119tagagctttc tgaactgata gc 2212021DNAArtificial
SequenceOligonucleotide Primer MZA8761 Internal Nested Reverse
Primer 120ttggcattta gcttctctcc a
2112122DNAArtificial SequenceOligonucleotide Primer MZA1851
External Nested Forward Primer 121atatattgca ccacttaaag cc
2212222DNAArtificial SequenceOligonucleotide Primer MZA1851
External Nested Reverse Primer 122gggtgttatc acttgttcta ta
2212320DNAArtificial SequenceOligonucleotide Primer MZA1851
Internal Nested Forward Primer 123tggagtcctt gaccatttgc
2012422DNAArtificial SequenceOligonucleotide Primer MZA1851
Internal Nested Reverse Primer 124tatatgcact tctagcgagt at
2212532DNAArtificial SequenceDegenerate oligonucleotide consensus
primer designed from the terminal inverted repeats (TIR) from the
Mutator element sequence 125agagaagcca acgccawcgc ctcyatttcg tc
3212618DNAArtificial SequenceOligonucleotide primer used linked in
combination with MZA internal primers in order to sequence PCR
products 126tgtaaaacga cggccagt 1812719DNAArtificial
SequenceOligonucleotide primer used linked in combination with MZA
internal primers in order to sequence PCR products 127ggaaacagct
atgaccatg 191281698DNAArtificial SequenceRcg1 promoter with 14 bp
of cloning oligonucleotide sequence added at 5' end 128gaggctcggg
ggctactgtc ggggaccata attaggggta ccctcaagac gcctaattct 60cagctggtaa
cccccatcag cataaagctg caaaggcctg atgggcacga ttaagtcagg
120gatcagtcca cacgagtgac tcgatcgcgc ttcacccgag cctagcctcg
gccgaaggca 180gccgacctcg agagacttcc gtctcgcccg aggcccccct
ttttatggcg gacacatcac 240cggcttgccc aaggccttgg cttcgctcag
aagcaacctt gactaaatca ccacaccgac 300tgaccaaatt gcaggggcat
ttaacgcaaa ggtggcctga cacctctatc ctgacacgcg 360cccccggcag
agccgaggtg accgccgtca ctccaccgct ccactggcca gtctgacaga
420aggacagcgc cgcctgcgcc actccgactg cagtgccact cgacagagtg
agtctgacag 480gcaactaggc cttgccgaag gcgccacggc gaactccgct
ccgcccgacc ccagggctcg 540gactcgggct aagacccgga agacggcgaa
ctccgctccg cccgacccca gggctcggac 600tcgggctaag acccggaaga
cggcgaactc cgctccgccc gaccccaggg ctcggactcg 660ggctaagacc
cggaagacgg cgaactccgc tccgcccgac cccagggctc ggactcgggc
720taagacccgg aagacggcga actccgctcc gcccgacccc agggctcgga
ctcgggctaa 780gacccggaag acggcgaact ccgctccgcc cgaccccagg
gctcagactc aggctaagac 840ccggaagacg acgaaactcc gcctcgcccg
accccagggc tcggactccg ccctggcctc 900ggccggacga cttccgcctc
gcccgacccc ctggctcggg ctcggccaca gcaactgaag 960gcaagactca
acctcggctt cggaggaaac cccacgtcgc cctgcctaga gcacagaccg
1020ccacgtcaac aggaaacgtc atcatcaccc taccccgaat cgactcgggt
cacggagaac 1080aagaccggcg tctcgtccgg ccagctccgc cagaggggca
atgatggcgc tccacgagct 1140ctatgacgac ggcggccccc agctctctta
cggcagcagg acaacgtcag cagggactcg 1200accgctccaa cagctgtccc
tccatcaggc tccgccgcac caccgatagc cacgacatca 1260cgccagcagg
atgcccagat ctctccggct gccacatcgg catgtaccta gggcactagc
1320tctccctccg ctagacacgt agcactctgc tacatcccca ttgtacacct
gggtcctctc 1380cttacgacta taaaaggaag gaccagggtc ttctcagaga
aggttggccg cgcgggaccg 1440aggacgggac aggcgctctc ttggggccgc
tcgcttccct cacccgcgtg gacgcttgta 1500acccccctac tgcaagcgca
cctgacctgg gcgcgggacg aacacgaagg ccgcgggact 1560tccacctctc
tcacgctcgg ctccggccgc ctcgcctctc ccccctccgc gctcgcccac
1620gcgctcgacc catctgggct ggggcacgca gcacactcac tcgtcggctt
agggaccccc 1680tgtctcgaaa cgccgaca 169812920DNAArtificial
SequenceOligonucleotide Primer MZA16510 External Nested Forward
Primer 129aacaacaagg cgacggtgat 2013020DNAArtificial
SequenceOligonucleotide Primer MZA16510 External Nested Reverse
Primer 130tcatcttcgt cgtcctcatc 2013118DNAArtificial
SequenceOligonucleotide Primer MZA16510 Internal Nested Forward
Primer 131gatcatcctg ccggagtt 1813218DNAArtificial
SequenceOligonucleotide Primer MZA16510 Internal Nested Reverse
Primer 132aaccgaaaac acaccctc 1813321DNAArtificial
SequenceOligonucleotide Primer MZA1719 External Nested Forward
Primer 133ccagcggtag attatataca g 2113419DNAArtificial
SequenceOligonucleotide Primer MZA1719 External Nested Reverse
Primer 134cggtttggtc tgatgaggc 1913519DNAArtificial
SequenceOligonucleotide Primer MZA1719 Internal Nested Forward
Primer 135ctcgggaacc ttgttggga 1913621DNAArtificial
SequenceOligonucleotide Primer MZA1719 Internal Nested Reverse
Primer 136tgaaatccag aacctccttt g 2113750330DNAzea
maysmisc_feature(0)...(0)Non-colinear sequence 137taaaaacttg
atttagaaac tcagctagtg cttttggcaa ccaaacccca cagccaaaca 60gctgcatgtc
tagaggtaga ggagtagact cctcacaccg ggtaagtcta gctgagtatt
120agtatactca gccttgcttg tggcataatt tttacaggtt ctctggagga
aatggttgct 180ggagtgactt ggccgtccat cttgccaccg ggttggactg
tcgagtggga ccctgccttg 240gctgaggagg agcatgagga gtgatgggac
aggcttcccc atctctctat ttatttaccg 300ttagtttatt tccgctgcac
ttcgaacaat gatggttact tttgcaaaaa ctccgaggat 360gatgatgatg
gtgatgtaat aatttaatac tctgacatgt atggttttat gctttattgt
420atttgctctg tgactcacct tcgagtgaga ttgtggtact tgatcctgtc
agtggccgtg 480tcggactaga tccgagggat tgacgggtta ttcccaatta
agtgtggtct agcctctaag 540gcggggctta ggcacttaag ttggaataat
tcgggcagtt ccgccacaaa tagagtgctc 600ggatgaaata gcaatttttc
ctaacccttt caccttgcct tggttcccat cactgaatat 660gattgaatct
tggggatcct tgttcttgac gtaggaagag aacatcctct tttcccccgt
720catgtggttt gtgcatccgc tgtcgataat ccagcttgag cccccggatg
cataaacctg 780caaggcaaat ttaggcttgg gtcttaggta cccaactcat
gttgggtcct acaaggttag 840ttacaatagt cttagagacc caaatgcaag
tcttgtctcc cttacatttg gcccctaatt 900tcctagcaat taccttctta
tcctttctac aaatagcaaa ggaagcattg caagcataat 960aaattgtaca
aggttcattc attactttcc tagggacatg aacaatattt attctaggca
1020tatgatgaac aacatttttc ctagcaaatt tttatcatgc ataatagaag
aactagaagc 1080aatcatggca tgagaatcaa aagcatcata acttctatac
acattcctag aatgtctcct 1140atcatgatac atgaaagcac ggttcttttg
agcactacta gccatagggg ccttcccttt 1200ctccttggcg gagatggaag
ccttatggct tgttaagttc ttgacttccc tcttgaagcc 1260aagaccatcc
ttaattgagg ggtgtctacc aatcgtgtag gcatcccttg caaattttag
1320tttgtcaaat tcactcttgc tagtcttaag ttgagcatta agactagcca
cttcatcatt 1380caatttagaa attgaaacta ggcgttcact acaagcatca
acattaaaat ctttacacct 1440attgcaaact acaacatgtt ctacacaaga
tgttgattta ttagctattt ctaacttagc 1500actcaaatca tcatttatgc
tctttaagct agaaatagag tcatgacatg tagacaattc 1560acaagaaagc
atttcattcc ttttaatttc taaagcaagg gatttttgtg cctctacaaa
1620cttatcatgt tcttcataca aaagatcctc ttgcttttct aataacctgt
ttctatcatt 1680caaggcatca attaattcat taatcttatc aactttagtt
ctatctaggc ccttgaataa 1740acatgaatag tctatttcat catcgctaga
ttcttcatca cttgaggaag cgtaagtact 1800agtatcacga gtgcttacct
tcttttccct tgccatgagg caggtgtgat gctcattggg 1860gaagagggac
gatttgttga aggcggtggc ggcgagtcct ttgttgtcgg agtcggacga
1920cgaacaatcc gagtcccact ccttgccaag gtgtgcctcg cccttagcct
tcttgtaagt 1980cttcttcttt tccctcttgt tcccttgttc ctggtcacta
tcattatcgg gacaattagc 2040gataaaatga ccaatcttac cacatttgaa
gcatgagcgt ttcccctttg tcttgttctt 2100gttgggatgc tccttacgac
cctttagcgc cgtcttgaaa cgcttgatga tgagggccat 2160ttcttcatca
ttaagcccgg ccgcctcaac ttgtgccacc ttgctaggta gcgcctcctt
2220gctcctcgtt gctttgagag caatggtttg aggctcttgg attaggccat
tcaatgcatc 2280atcaacgtat ctagcctcct tgatcatcat ccgcccgctt
acgaactttc caagtatctc 2340ctcgggcgtc atcttggtgt acctaggatt
ctcacgaata ttgttcacaa gatgtggatc 2400aaggacagta aaagacttta
gcattaggcg gacgacgtcg tggtccgtcc atcgcgtgct 2460tccatagctc
cttattttgt tgacgagggt cttgagccgg ttgtatgttt gggttggttc
2520ttcgcccctg atcattgcga atctcccaag ttctccctcc accaactcca
tcttggtgag 2580catggtgacg tcgtttccct catgagagat cttgagggtg
tcccaaatct gcttggcatt 2640atccaagccg ctcaccttat ggtattcatc
cctgcacaat gaagctagaa gaaaagtagt 2700agcttgtgca tttttgtgaa
tttgctcatt aatgaacatg ggactatccg tactatcaaa 2760gtgcattcca
ttttctacta tctcccatat acttggatgg agagagaata agtggttgtg
2820cattttgtga ctccaaaatc cgtagtcctc tccatcaaag tgggggggtt
taccgagggg 2880aatggaaagc aaatgagcat tgaaactttg cggaatatga
gaataatcaa aggaaaagat 2940tgaattaacc gtcttctttt tctcgtagtc
gttgtcatcg tccttttggg aagaggaaga 3000ttcgtcgctg tcgtagtaga
ctatctcctt gatgcgcctt gttttcttct tcctcccgtc 3060gtttcttttg
tggcccgacc ccgagtcagt aggcttgtca tcctttagat cattgacgaa
3120ggactccttc tccttatcat tgaccaccat ccccttgccc ttaggatcca
tctcttcggg 3180tgattagtcc ctttcttgaa gagaacggct ctgataccaa
ttgagagcac ctagaggggg 3240gggtgaatag gtgatcctgt aaaacttgaa
acttaatgcc acaaaacttg attagtagtt 3300agcacgatta aagccaagtg
gctagagagg agttcttgca agacccgata accacaagag 3360gattaatcac
atatagacac agtggtttat cccgtggttc ggccaagttc aacacttgcc
3420tactccacgt tgtggcgtcc caacggacga gggttgcaat caacccctct
caagtggtcc 3480aaagacccac ttgaatacca cggtgttttg ctttgcttta
ctatatcccg cttgcgagga 3540atctccacaa cttggagcct ctcgccctta
cactttgatg ttcacaaaga agcacggagt 3600aagggaggga tgagcaacgc
acacaagaca caaaattaga gtgacaatac gcacacaagt 3660cacaacacga
gctctcaaca caactcaaag agttctctac tcaaatggag ctctagttgc
3720tatcacaaag aatcaaatgc gcggaatcga agtcttggtg cttagtaatg
cttagagaat 3780gcttggtgta ctcctccatg cgcctagggg tcccttttat
agccccaagg cagctatgaa 3840ccgttgagat cattccaaga aggcaattct
tgccttctgt cgcctggcgc accagacagt 3900ccggtgcacc accggacact
gtccggtgcg gatttctttc cttctttggc gaagccgacc 3960gttggagatt
cagagtcgtt ggcgcaccgg acactgtccg gtgcacaccg gacagtccgg
4020tgcccccttc tgaccgttgg ctctgccacg cgtcgcgcgc gaattacgcg
gccgaccgtt 4080ggcccggctg actgttggct caccggacag tccggtgcac
caccggacag tctggtgaat 4140tatagccgta caccaccgtc aaagtcccga
gagcagccat ttgacagacg ccagcctggc 4200gcaccggaca ctgtccggtg
caccaccgga cagtccggtg caccccgacg agcagccttt 4260tggctgtaca
cagccaactt ctccaaaatt gtttctccta tttctagcac ttagacacaa
4320tacattagtc ttcaaaacaa tgtactaagt ctagaaacat acctttaatc
ttgatttgca 4380cttcttgagt ccatggcaca atttaacact tatgcacttg
tgttggacac ttaatcacca 4440aaatatttag aaatggccca agggcacatt
tccctttcac ctgcaatatc tccaccaagg 4500agagctcccc ctcgacaaag
ccgaagctcg gtgactggcg cggcgcgcca agtcgttcgt 4560cttactgggc
gatgaaaagg agctctacca ccgcatcccc tcaggcatcc tccaacgatg
4620catatccatc gctgaaggac aggagctatt gcaagagata cactcgaggg
cttgcggtca 4680ccatgtagca cctcgagccc tcgttgggaa cgccttccga
caaggcttct actggccgac 4740cgcggtggcc gacgccacta ggattgtacg
ctcctgccaa gggtgtcaat tctacgcaag 4800acagacgcac ctgcccgctc
agaccctgca gacaataccc atcacttggt catttgttgt 4860gtggggtctg
gacctcgtcg gtccattgca aaaggcacct ggggcttctc gcacctgctg
4920gtcgccatcg acaaattctc caagtggatc gaggtccgac ccctaaccag
catcaggtcc 4980gagcaggcgg tggcgttctt caccaacatc gtccatcgct
tcagggtccc gaactccatc 5040atcaccgaca atggcaccca gttcactggc
aagaggttcc tggacttctg cgaggaccac 5100cacatccggg tggactgggc
cgccgtggct caccccatga caaatgggca agtggagcgt 5160gccaacggta
tgctcctgca aggactaaaa ccgaggatct acaacgacct caacaagttt
5220ggcaagcaat ggatgaagga actaccctcg gtggtctgga gtctgaggac
gacgccaagc 5280tgagccacgg gcttctcacc gttctttcta gtctatgggg
ccgaggctat cttgcccata 5340gacttagagt acggttcccc gaggatgagg
gcgtacgacg accaaagcaa ctagaccagc 5400cgagaagact cactggacca
gctggaggag gctcaggacg tggccttgct acacttggca 5460cgatatcagc
agtctcgacg ctaccacgcc cgaggtgttc ggccccgaga cctccaagtg
5520ggagacttgg tgcttcggct gcggcaagac gctcgagggc gccacaagct
tactcctccc 5580tgggaggggc cattcatcat ctccaagatt ttgaagcccg
gaacttacaa gctggccaac 5640aatcaaggcg aggtctacaa caacgcttgg
aacatccgac aactacattg cttttaccct 5700taagatgttt tcaagtcgtt
catatacctc attttctatt caaataaagt ctaaccgtta 5760aggaagggtc
agccttgcct cggcaaagcc cgaccctccc tcgggggcta gaagggggga
5820accccctctg cgtaaaaaat ttcctcggaa aaagtctttc tgccagaaca
tctttcgcgc 5880tttttgactg cttcgatagc gggatcctga aaacgacgga
gtacacgtaa gcggcaaggc 5940cgaccgagcc gagggactcc tacgcctccg
ggatacggat acctcactca tcaccttctg 6000tgataagtaa ctcacgctcg
gataagcgat tttgctgacc gaacaagtgt taacgctcga 6060aaacttttct
gccagaacga ttttcgtgcc ttctcgacta tatcgataac agaatcctac
6120ggacgagtaa gagtgcacgt aagcggcgag gccgaccgag ccgaggaact
cctatgcctc 6180cgggatacgg atacctcact catcaccttc tgtgaaaagt
aactctcgct cggataaacg 6240attctgttac cgacgaacaa gtccagatac
tcgaaataag aggaaaggaa acgcagcttt 6300acaacacaac aatgatatgt
ttgggcctca gcggccgcga aaaacatacg cacactacag 6360acaaactctc
cctgcaggtt cagacatcag cagagggagc agcagcaccc tcgacgtcgt
6420ctccaccttc ggcggaatct ggcccggcct tggacggcga cgtgggcgga
aggatctcca 6480cctcgaagat ggaagccaac accaagctcg ggccatcata
gccaaggtct ccgtaagggt 6540cccggcccgg gcaaacgcct cgaccggccg
ctccgtagcc tcagccagct gtcccccgag 6600gacatcagcc cgactcatgg
cctcgacagc ctgactccgg ggttggtccc gccagcggac 6660gacctggcca
ggttccagcc gccgctgttg cacctcctcg accagggagg ccaagtgctc
6720ctaggccaac gaagcttctt ctcgagccga ctcagcctct gtccacactg
acaccgctgc 6780ctccggctcc ggctcatcgc agagcggccg agggttcttt
aactgagcaa gagaagcctt 6840gggtggcaag gccgaccgag ccgagggact
cctacgcctc cgggatatgg atacctcact 6900cgtcaccttc cgcagtgggc
aactcacact tggttaagcg gttcagctag ccgacaggcg 6960agtcctggtg
ctcgaaatga ggaagaaaca tggtattgca ctcaaatacc tagatgttca
7020ggcctcgaca gccataatga acaaacaccg gcactcaagg tgccattaca
aacggaactc 7080cggttccact cccgcgggta tgaacaacct ccacatcgga
gggcctgcgg gacgacaaac 7140tctagttggc tcgccgccga ccgctccatc
agcagcgaca acgacctccg ctccgggcgg 7200ctgaacagca gcagcgatga
cctcagggca gacgctgctg cgacaaggcc ctcgcccgca 7260tccccactcg
aggggcgagg acaagctatc aaagccgaag agccggaggt ccgaccgcag
7320gtggcgccga gaaaccttct ctggctgcca ccacctcagc accgacgacg
gcagccacct 7380gcccaccaac acccgccggg ccgtgaccaa tgtgctcggt
tggcactgtt gggtcatgcg 7440cagggttgcc tcgagtcgcg gcaccggttc
cgcagtcgag aaggcgcggg aggaggcgcg 7500acggtcgata tagccaaaag
cgggccagca gtaatggcga cagcaggcga gcggaagcag 7560cagtcaagtt
gtctgcaggc tcacgtcccc tacctggcgc gccaactgtc ggcgtttcga
7620ccccaggggg tccctggacc aacgagtaaa ttgtcgctgc gtgccccagc
ccagatgggt 7680tggcgcgaga cggaacacag agggggggaa aaccgcggct
tcgtgttgtc ctgcgccaga 7740gtggatgcgc ttgcagtagg gggttacaag
cgtccacgag ggagagaaag agagagtgcc 7800tgttcgtcgg cccgtcctcc
cgcgcgacca ccctcccgta tgagggccct ggaccttcct 7860tttatagatg
taagaagagg gtccaggtgt acaatggggg tgtagcaata tgctaacgtg
7920tctggcagag aggagccaga gccctatgta catgccaacg tggctgtcgg
agaggtgcta 7980gagccctgtg catgcgatgt cgtggccgtc ggaggagcac
ttgagccctg tagaagcaca 8040actgttgggg ctgtcgggac cttgctgacg
tctccttact tccgtaaggg gctgagagcc 8100gccgtcgtca tggccgcacg
cggggagcca tcattacttg ttaccggggc gagcctggat 8160gggacaccga
tcttgttccc tgtagcctga gctagctagg ggtagggtaa tgatgatccc
8220ccctgtggcg tggtcggtcc gagcccaagg tcgggcgagg cggaaactcc
tcctgaggcc 8280gaggtcgggg ttgggtgagg acgcgattcc ttctgaggtc
ggggccgagg tcgagccctg 8340gggtcgggcg aggcggagac catcctccga
ggtcgaggtc gaggctgagc cctggggtca 8400ggcgaggcgg agtccatctt
ccgaggccga ggcgagggcc gagccctagg gtcgggcaag 8460gcggagactt
ctcctgaggc cgaggcctaa ggtcgggcga ggcggagctt cctgtggcgc
8520ctgaggctgg actcagctgc tgtcagcctc atcttggcag gtggcacagc
agtcggagcg 8580gggcaggcgg cgctgttttc ttgtcaggtc agtcagtgga
ggggcgacgt gactgcggtc 8640actttggccc taccgactga ggaacgtgcg
tcaggataag gtgtcaggcg atccttgcat 8700tgaatgctcc tgcgatacag
tcggttggtg aggcgatctg gccaaggttg cttcactgcg 8760aagcctgccc
gagctgggcc tcgggcgagt cgggggtgcg ctcgtttctt tgaggaggcc
8820ctcgggcgag gcgtgaatcc gcctgggtct actgttcctg cccgaggctg
ggctcgagcg 8880aggcgagatc gcgtcccttg tcacacccgg atttcagggc
accaagaccc gggcgcgaac 8940ataatcacca ggtgtgctgg gaccaagtct
cacacatatg atgattcatg gcacaggatc 9000gaatgtcaca tctttactac
ataacaggag ttctatacaa aataaataag taattacatt 9060ataaggagac
aacggtccag caacccaaag ttgactggga gacgacgacc tagatctctc
9120tcacgaactc atcgcagcat cctccatgcg cctcatcctg cggtacttgt
tcttgacctg 9180tggggggggt gagacagcaa gagtgagctc acatacgttc
atcgctcaac aagttgtggg 9240gaataatgtg catgatctcg ccaaaggtgg
gagctcacgt gaagtgtaag gcttaccaaa 9300gaggatggtt agagctgagc
attgctttta aagttggtca aaattttatt agcaattact 9360aagtataagt
aaataccaac ccaattaagt agtagaacaa aagtaacaac atcacctgcg
9420atgcaatgca tatgacaaat tgagtttaag ttccataatt taatcatcag
agagtcctga 9480gctgctcatg accgtgagct cggctagtat accagtttta
cactctgcag aggttgtacc 9540ctttacccac aagtcatgtt acccatttgc
gaagggatcg cgacttccca tacacctcta 9600ccaaggaggc gaggcagggt
aacactacga ggcctttaca aagttccact agcttcagaa 9660aacccgctac
agtttatagg aagctccaat gcagggttct tgcctgaccg ccatcgcagc
9720aaaatcaacc aaggacctcc ctacactgac cactccccta ctgcccttgc
ccctttcggg 9780taaggtagtc ctccactggc tttcctaatt aatcagccaa
gagcgtccat aaacccttgt 9840ggtggcacgt gtttctcaag ttaagctcta
tgttccaatt aacattaatg atcttgacat 9900gaacataaat agaataacaa
aataactgga acatagatat gataattaat tatcccaaat 9960ccatgtaaag
caatagcaaa ctacccaagt gattcagggg taaacaaggt aatgagataa
10020acaatctagg gtaacctatt gggtcccatc aaaattaacc tatgcatgaa
tagtgataat 10080aacgaatatt attgggtaac agaagtgatc aagggcacaa
cttgccttta atgagcacct 10140gctcagctac ttcaacctgc tgctcaccag
gatcctcatt cacgggctct tctactcgcc 10200acaatacaaa caagcacaat
atatagagaa atcaacatca caccaaacat gtaaacaaac 10260tacacagtaa
taatctatgc attaaaataa aatcctagga acagaaatca taattttcgg
10320agttatagat tttaagttat ggattttcaa aggttttatg tgtttaaaat
agattaagtg 10380aggaattaaa tttcttactg ttttcatgac aaaacagagg
ctctaagtga tagagaatta 10440aattacaaaa atttagaaag tggaatggag
taatttgggg ttcatataca ttttctatga 10500attattgaag ttctagcaat
tattttccta ttaaaaatcc cttttccaat ttatttactc 10560aatttcaaac
agctctggat cgagcctcaa ttaccgaaaa gtgcaggggc ttctgcgcat
10620aattttctaa gactcagaat actatgcagt ggacggcggg tttattcctc
ggttttccag 10680ggtttctctt acaaaactga cccgcgaagg ggtatcagcc
gatctcggcc gcaggatgtg
10740aagtggacgg cccagattaa ttcatacaac ttaacaaatc ggtatgcacc
caaggcccac 10800ggatacgaaa tccatgaccg agagagttcc acgtcattga
cctaacctaa ccatcggatc 10860tataaccagt ggctcagatt tcatctgcga
aggaggtatg ctgtatataa tctcgctcgt 10920ccattcagat cgaacgatcc
acatctagtt tgaacccgat ctaatctaga tcgttcgtac 10980acagatcaaa
ggcccacggc aagcgcttct cttccccctc cggccacccg tgcggccagg
11040gacagggcac cgcggcggcg ccatcgccgg caacacggtc ggtcggcccc
tacagcctta 11100acccgagcga taaatggtgc aaacgggaga ggaagagatg
caaaaccaaa tgggagcgat 11160tttaccgtga atcgagtagc aggactcgcc
gcccacggag acacgcaggt tcacagcaag 11220agttgatgcc cgacgaggaa
tttcccggcc atggctcgcc cagtcgactg gagagcgcct 11280agcccgcgtt
cgggtatccc tcacgaacac cccaaaccac atgccgaggc tgtagagtcg
11340ccccagggtt gaatcgaccg aggcggtcat ttctcccctg accacggcga
agagcggcac 11400ggtgcgcaac tggttttcct gatagtgggc accggcgtga
aattaggccg ccaactcgcg 11460ccccgatgca ccgacccaca atcgccaagg
cttctgctgc gcaaacgagt tccccgctgt 11520gatggccgaa gcacagcaca
gcaggtggac ggcagcggac cagtcgcggc ggcgcacaga 11580ttggggcgag
cagggaggag aagaggaaca gcggcttcgg gtgttatagg cgcagggtaa
11640aggaggggac gaacaggtca cgctggcgcg atgccgcacc tatatgacga
gtccgggctg 11700aggacgttaa ccgggcggcg ctagaatcct ggggcttcgg
cagaggccgt tgcgggagta 11760gcggcgggca ggtgtgccgc cagcgctgta
cgcggggtcg gggcacggag gttgttgcgc 11820taggggtccg cgatttccgt
gaatcgggca cgagctcacc agcgccaccg gttttgcgca 11880cgaagcggag
gaaatgtagg gagggagaag aagaccactg ccggctgggt ggataagtta
11940gctgggtgac cctggaatgt ggggcccgcc tggcggcgac gcgaaggcca
cacgagcgag 12000tgaggggcgt tgggtcgtgc ggtatcggaa aaaaaagaat
gggccgaaag tgaggattcg 12060gcccaagtag tgttttattg tttttctttt
tcttattttt tttcaaattc aactttaaat 12120tcccatttaa attcaaattt
agtggtggat ctatcttcac attaatttcc caacttaaac 12180atggcatggg
tgaacttatt tattttcaat atttatttta ttaaaactag tgctatgttt
12240ctccaaatta gagtttaaat gctatgtgtc ccttaatata ttaatatatg
ggtactaaca 12300catttatttt actatccaca aatgcacaat caagtaaaaa
ctcagcatga tgcataattt 12360atttgagtgt cttctattaa ttatttattg
tatagatgag gtgtccacat gaaatggtaa 12420atagggataa cccacacaca
tgtaaaggaa tataatctct ccttttagat ttttcttaca 12480aagtgggtgt
tacatccctt gagtggacgg agccttgacc tgaattgcgc ccaacagcct
12540ctgcagtttg cgctgatggt gattaccagc cgagtttagg agtcttgggg
gtacccctaa 12600ttatggtacc cgacaactgg tatggacgag tctggtgtgg
tatgacaatt agagattttc 12660tataacctcc gtgaacaggg aaatgtgtgt
gtaagtgcat actgaaaaag aaaacaaggc 12720cacgggagcg ggaagctcag
tggtggttga gtattttgtt acttttaagt ctttgggaaa 12780accttacagc
aattgccttt ctctaagaaa atgaagagtg acttcaactc caccaaataa
12840agcatgtatg atataggtct ctttctcttt acgggagcgc ggtgggcttg
cggaatacct 12900agtgtattca cccatattta tttatgtttt tcagcagccg
aagacttctt ttctgctatg 12960cttgattgag agggctgtgt ctgcacccag
ttctgcctgt ggcttgggct agtatatttt 13020tctactgcgc ttcatcttct
ggctctctcg agcttgtacc cccgtattgt aataactctt 13080atttaaactc
tgtactattt gaagaaagga atgtgtttac tagcctcatg ggactactaa
13140ttgtatcaca tttgagtccc aaaggatcgg gacgcttcag aaaatgtcgg
ggaccataat 13200taggggtacc ctcaagacgc ctaattctca gctggtaacc
cccatcagca taaagctgca 13260aaggcctgat gggtacgatt aagtcaggga
tcagtccaca cgagtgactc gatcacgctt 13320cgcccgagcc tagcctcggc
caagggcagc cgacctcgag agacttccgt ctcgcccgag 13380gccccccttt
gtaatggcgg acacacctcc ggctcgcccg aggccctggc ttcgcttaga
13440agcaaccctg actaaatcgc cgtgccgact gaccaggttg caggagcatt
taacgcaaag 13500gtggcctgac acctttatcc tgacacgcgc cccccggcag
agccgaagtg accgccgtca 13560ctccaccgct ctactgacca gtctgacaga
aggacagcgc cgcctgcgcc actccgactg 13620cagtgccact cgacagagtg
agtctgacag gcaatcaggc cttgccaaag gcgccatagg 13680gaactccgct
ccgcccgacc ccagggctcg gactcgggct aagacccgga agacggcgaa
13740ctccgctccg cccgacccag ggctcggact cgggctaaga cccggaagac
ggcgaactcc 13800gctccgcccg accccagggc tcggactcgg gctaagaccc
ggaagacggc gaactccgct 13860ccgcccgacc ccagggctcg gactcgggct
aagacccgga agacggcgaa ctccgctccg 13920cccgacccag ggctcggact
cgggctcagc cccagaagac gacgaaactc cgcctcgccc 13980gacccagggc
tcggactccg ccctggcctc ggccgaacga cctccgcctc gcccgaccca
14040atggctcgga ctcggcctcg gcaacagaag acagactcaa cctcggcttc
ggaggagccc 14100ccacgtcgcc cgacctaggg cgcaggcccg ccacgtcaac
aaggagcgcc atcatcatcc 14160taccccgagc cgactcgggt cacggagaac
aagactggcg tcccatctgg ccagctccgc 14220cagatggaca atgatggcgc
cccacaagct ctgtgacgac ggcggctctc agctctctta 14280cggaagcagg
gcaacgtcag caaggactcg accgctccaa cagctgtccc tccgccaggc
14340tccgtcgctc ctccgacagc cacgacatca cgccagcaag gtgccaagac
ctctccggct 14400gccacattgg catgtaccta gggcgctagc tctctctccg
ctagacacgt agcactctgc 14460tacacccccc attgtacacc tggatcctct
ccttacgact ataaaaggaa ggaccagggc 14520cttcttagag gaggttggcc
gcgcggggac gaggacgaga catgcgctct cttggggccg 14580ctcgcttccc
tcacccgcgt ggacgcttgt aaccccccta ctgcaagcgc acccgacctg
14640ggcgcgggac gaacacgaag gccgcgggat ctccacctct ctcacgcccg
tctcaggcca 14700cctcgcctct ccccccttcg cgctcgaccc atctgggctg
gggcacgcag cacactcact 14760cgtcggctcg gggacccccc ggtctcgaaa
cgccgacagt tggcgcgcca ggtaggggcc 14820tgctgcgtgc tgacgaacag
cttcccgtca agctccagat gggcagtctc cagaaacctc 14880tccggcccgg
gacggtgctc cgtttcggga gtctcgagtt catgtccttc aacggcagct
14940acgacatgat actccttcct ccgccgcgcg acaacgacaa tggcggccga
caacccgccc 15000gccggcggcg gaatcggcga catcttcccc gcgtggcgga
agaacaacat tcgagctcgc 15060tccgtcctct cccccgccga cggaggagga
ggcgaggcaa ccaaggccaa gcgggaggcc 15120gcgcttcgtc ggctgtcgag
cgaatcgacg tccccagcgc cccgacggaa ggcacgccgg 15180gcgtcgacct
cgcgttcgag atggaggcag gcgccgtccc cccgcgacac gctgatcccg
15240agcaagaaga cgacgccagc gcgctcgcgg gaagcctgca ggacgtcgcc
ctcgtacctg 15300ggatgacggt gcaaccagtc cccgatgtga ctacgtcgct
cctcgtcgac caaaaggtac 15360cgactaactc ccatcttacg tcatttcgac
tcggcctcaa cccgccaagc gacctcgctt 15420tggcgggcgc tctcgttgag
gcaagtgcaa ccccactggg gtttcgtatg cggtcgcctt 15480gggaccggtt
gacggacgtc tcaacctacg ggccctccga gtccgaggaa gatgacgatc
15540ccagcatcta ttgggatttc tctggacttg gcaaccccag tgccatgcgg
gacttcatga 15600ccgcatgcga ctactgcctc tccgactgtt ccgacggaag
tcgcagcctt gacgatgagg 15660gctgcggccc aagccgcgaa tgtttccacg
ttgagctggg ggatccctcc gaaggcaacc 15720atcttggcat gccggaggac
ggtgattttc ctaggcccgt gcctcgcgcc gacatcccgc 15780gggagctagc
tgtggtcctc gttccggcgg ggggtcacga cccacagctc gagcgagtcc
15840gcggggcgca ggctaggctc gacgagggaa caggagcgct tgagacgatc
cgccgagacg 15900tagggcaggt atgggcgggc caacccccgg gccggagaaa
tacgtcacct gccccagggt 15960ctccagcacc gcgtcgccaa cgatgtcagg
gtcaggccgc cgcccgcatc cagcggggtt 16020ggtcagaacc tggcagccgc
agcgatgctc ctccgcgcga tgccggagcc atcaaccacc 16080gagggtcggc
gaatccaggg agagctcaag aatcttctgg aaggcgctgc ggcctgacgg
16140gccgagagca ctgcctcccg aaggtaggga tatccctcgg aacctcatgc
cgcgacttcc 16200cgattcatgc gggaagcctc ggtctacacc gggcgcacgc
gtaacaccgc gcctgcggcc 16260ccgggccacc tcggcaacga gcaccatcga
cgcgaccgtc gggcccacct cgacgaaagg 16320gtgcgccgag gctaccaccc
caggcgtggg ggacgctacg acagcgggga ggatcggagt 16380ccctcgcccg
aaccacccgg cccgcaggcc ttcagtcggg ccatccgacg ggcgccgttc
16440ccgacccggt tccgaccccc gactactatc gcgaagtact cgggggaaac
gagaccggaa 16500ctgtggctcg cggactaccg cctggcctgc caactgggtg
gaacggacga cgacaacctc 16560atcatccgta acctccccct gttcctctcc
gacactgctc gcgcctggtt ggagcacctg 16620cctccggggc agatctccaa
ctgggacgac ttggtccaag ccttcgctgg caatttccag 16680ggcacatacg
tgcgccccgg gaattcttgg gaccttcgaa gctgccggca acagccggga
16740gagtctctcc gggactacat ccggcgattc tcgaagcagc gcaccgagct
gcccaacatc 16800accgactcgg atgtcatcgg cgcgttcctc gccggcacca
cttgccgcga cctggtgagc 16860aagctgggtc gcaagacccc caccagggcg
agcgagctga tggacatcgc caccaagttc 16920gcctctggcc aggaggcggt
tgaggctatc ttccgaaagg acaagcagcc ccagggccgc 16980ccgtcggaag
aggctcccga ggcgtctact ccgcgcggcg ccaagaagaa aggcaagaag
17040aagtcgcaat cgaaacgcgg caccgctgat gcggaccttg tcgccgccgc
cgagtacaag 17100aaccctcgga agccccccgg aggtgctaac ctcttcgaca
agatgctcaa ggagccgtgc 17160ccctaccatc agggacccat caagcacacc
ctcgaggagt gcgtcatgct tcggcgtcac 17220ttccacaggg ccgggccacc
cgccgagggt ggcagggctc gcaacgacga caaaaacgaa 17280gatcaccaag
caggagagtt ccccgaggtc cgcgactgct tcatgatcta cggtgggcat
17340gcggcgaacg cctcggcttg gcaccacaag caagagcgcc gggaggtctg
ctcggtgaag 17400gtggcggcgc cagtctacct agactggtcc gacaagccca
tcaccttcga ccaggccgac 17460caccccgacc acgtgccgag cccggggaaa
tacccgctcg tcgtcgaccc cgtcatcggc 17520gacgtcaggc tcaccaaggt
cctgatggat gggggcagct gcctcaacat catctatgcc 17580gagaccctca
agctcctgcg cgtcgatcag tcctccgtcc gggcaggcgc tgcgccattc
17640cacgggatcg tccctgggaa gcgcgtccag cccttcggac gactcgacct
ccccgtctgc 17700ttcggaacgc cctccaactt ccgaagggag accctgacgt
tcgaggtggt cgggttccga 17760ggaacctacc acgcggtact ggggaggcca
tgctacgcga agttcatggc cgtccccaac 17820tacacctact tgaagctcaa
gatgccgggc cccaacgggg tcatcaccgt cggccccacg 17880tacaaacacg
cgttcgaatg cgacgtggag tgcgtggagt acgccgaggc cctcgccgag
17940tccgaggccc tcatcgccga cctggagaac ctctccaagg aggtgccagc
cgtgaagcgt 18000cacgccggca acttcgagcc agcggagacg gttaaggccg
tccctctcga ccccagtggc 18060gacacctccg agcagatccg gattgggtcc
gggctcgacc ccaaatagga agcagtgctc 18120gtcgactttc tccgcgcaaa
cgccgatgtc tttgcatgga gtccctcgga catgcctggc 18180ataccgaggg
atgtcgtcga acactcgctg gatactcgga cctgagtctg atccgtcagg
18240cagcctctgc gcctcggtca tcaaggaagg gtcggccttg cctcggcaga
gcccgaccct 18300ccctcggggg ctaaaagggg ggaacccctc tgcgtcgaga
ttgggcatac ttctccgcat 18360cgaaaatttt caatcaaaaa aggggcctct
tgcgttctcc tggctatgtc agaagcaggg 18420tttcaaggag cgaacatggg
tacatgtaaa tggcaaggcc gactgagccg agggactcct 18480gtgcctccgg
gttagggata cctcactcat cacctgccac gaagaatgac ccaactcgag
18540aagccaccct attattgaca agctaggacg aacacgcaga tggaaagaaa
ggagggtacg 18600acttcatgca agaaagacaa agtgttcagg cctcagcggc
cacggtgaga cgcgcatcca 18660acaagaaatt gttcaaacaa gaattaggcg
ccgccttggg aaggagccgc gccctcagct 18720tcgtccccgc cgtcggtgag
gtccatctcg gcctccggtg atggcgcagg gggaaggatc 18780tccgcctcaa
aggtggtcgc cagcaccgtg ctcggacccg cggcgaccgc gtcaagccgc
18840tggacctctg ccagggcagc atcgtcttcg tcaggaagac agtacccctc
actaacccgc 18900tccaggtcca cgacgtagtg ggaagcgagc acggcgaagg
cccgcctgac gccgtggtgt 18960agcgcctcgc ggactctgcc gcgcgtgtga
tcacccaagg ctcgaaggcg gctttgaggg 19020gagcttcctg aagggacgtc
gccagagccg aggatacgat aaaagtccga gacggcctcg 19080gacatggccg
cgaggtcagc ttccctctgc tcggcagctc cggcaagcgc ctcggcgagc
19140gccttggcgg actcatcaag ggcggactca agctctgcga gcaaccagga
gaaatacctc 19200aagcacaagc aaaggaaacg gacaagaaca agaaccaggg
aggaccaaga catacctccg 19260gctcggacac gatgctccga ggccgcgacc
tgggccgcgg ctaggtcggc cgcgagggtc 19320tcagctcggc tttcggcctc
ggcagcccgg ccccgagatt ggtcccgctc ctcgacgacc 19380tgggcgagct
ccgatcgctg ccgttgcgcc tccgcacgcg ctgctgccgc ctcggccctc
19440aggtcggcgc agagcagctg gaggtccgct accttggcat cctgctgaga
aaggcgcgcg 19500gtagccccgg cgagcgagga cctcagggat cgcagcgagc
cctagacgtc gacctcgcgg 19560cggatgaacg acgacttggc ggcgctccgg
tctgacagat cctggggaaa ggaaacaggg 19620cgtcacgacg agtgcctcgc
tcacagaagg aaaaaggtat gcctgaaacc gctacctgga 19680ggattttggg
gacgtctctg cagaaaacct ccagcgatga ccggagcgac cccaccgttg
19740cctcagcaca ctcgcggagc tcatcccagg actggtcctc ctgctcatcg
tcgagaacga 19800agacagggtc cgaggcctcg ccggtccgga atcggagcaa
cgggcgccgg gcctcggggc 19860ttcgccacac agcgatgagg ctgtcacccg
gctggacgga tcgcgcgtcc acgcccacct 19920cttctgaggc cttgggcgcc
gacgcatcag ccatcccgac actggcggca actggtcgct 19980ctccgacagg
gacggcgaca acctcggcgg tggcgggcgc cggcatggcc ggcacgacag
20040gcgggctcag ggccacgttg gcgtcagccg cctcctcaac cacgatggcc
gcctcggcag 20100aagagccggc ctcgggagcc cgcttctcag agaccggcga
cgcccgagcc ccctgcggtg 20160aagtaccccg cgaaagggtt ggctgaatga
caaggcccgg ggcggcgctg gccacacagt 20220ccggcgccgt cttgagggcc
ttccggggtg ccaggtcggt ctggccatga ctttgcttgc 20280tggatataaa
aaaagaggag gaaagaaaga tcacggccga gacatatgaa tgggaagcca
20340agacgaagac gtcccgggat actcacccac ttcgggccat tatccaccgc
gcctgggggg 20400aggtctcttg gatcccggct cccaaggcgg ccgccgaggt
ccgcttcgcc ggcattttcg 20460gcgccaccct cgccgtggac gcccgggaag
aagattgccc gggcgcggtt gcgacgacct 20520gagggtcacc cccatgcgcc
accggtgcga gcggcggccc ctcgggagcg gacgccctga 20580cctggccctc
cggagccacc tcagctcctc cggccgaggg aacaggtgac acctcgggtc
20640gcccccgtgc ctcggactgg gaccccgacg ccccaactcc ggggactgat
ggtgtcggcc 20700cgcgcggggg ctggctcgac gactcctggc cgcaccccga
gccggggccg aggccgagac 20760gggcggccat gtcgtcctcc tcctcatcat
cgtcgtcatc gtcgtcgtcg ggcgtctccg 20820gcgacggctc cctcgggagt
ccttccctct cctgctggcg acggcgcttc tccaaggcgt 20880cccgagcccg
cctccgctcg cgggcccggg ccttctccgc gtccttcttt ttcttcttct
20940cctccgcggc gactcgccgc gctgcacggt ccaccgcatc ctccgggacc
cgtggcaggg 21000agggcttgtg ccaccccaca tcctaaaagg aggggagaaa
ggaacccgat cataaggacc 21060cggaacgacc caatgtacga agaaggaagg
agcgaacact caccaaagtt acgcacccct 21120ggtcggggcg catccgaagc
tgggagtatg cgtgggggtc cggcttcccc atcgcagccg 21180acacccgcca
ttggagggcg ttgaagggaa gaggatcagg ggacattcgc gagccctccc
21240agtcagcctc tggggtcatc tcctagagcg acagccgccg ctccgccaat
ggaagcaccc 21300tccgacggtg gatggcagcg atcactcccg cagcggtgag
tcccccctcc cgcaactcct 21360tcagggcctg gagaaggggc tcgaggttct
tctgtctctc gtgcggggtc ctgtggcgcc 21420aggcgtcggt ggcagcagta
actactctct gggagaacgg tgggagcaac tcaccgtcat 21480tccggaggta
gaaccaccgg cgctgccacc ccttgttcga ggacgcaaga atggcaggaa
21540tgtactgtga cgcccgcgac tgcctcagca aaagagtgca gccgccggcc
cgcaccgctg 21600cacggaccct cctctcctcc gtcgacaagg cgaaaagctc
ggcgaggaag agatgagtcc 21660gcaaatccca atggggggcg atccccaagt
acccttcgca taccgctacg aagatagcgg 21720cctgcgagat ggagttgggg
gagaggttat gcaattccac cccgtagtgg aacaggatag 21780ctcgcataaa
gcggcccgtc ggcacaccga atccccgctc gtggaaggag acgaagctca
21840cgacgtaccc cagcggtggg gacggagcgg ctccacccac gggaggaatc
cactctggcc 21900gctgcttatc ggtgaggggg cggagcaaac cctcgccgac
cagctcctcc agatcgctcg 21960ctgtcaccgt ggaaaaaggc cacggatcac
gcggggggat tatggtcact cgatccgcca 22020tcaccaaaat ggaagagatg
gcggcgcggg gggcagggag ggcggttttt tctcttctcc 22080gactaaagtt
tcccgggttg cgaaaaccta aagggaaagg aaggaagaag agcaaagaac
22140cgtcaccgga ccccctctcg agtatatgaa ggccagggcg aaaccgtttc
cagcgctcca 22200cccggaccgg acgcgggatt cgaaaaacgc gaggcgaaac
agccgttcct cgaacggctc 22260gcgcacgcgc aacggccgcc ccgccaacca
ctcgccccgt cgcattaact ccgcggcggg 22320acaggcggcg cctctggcag
gagaagcgga cgacgcttcg ccttcgccgt aataaccgcg 22380tcaaaaaagg
tacgccacgt cgttcgattt cgtatccttt tttcctcttt ctctatctct
22440tgcaacaggg accgggaaag ggggataccc cgaaaaggat ccttctctgt
gaaggaaccg 22500ggctccgagc ccccctactg atcagaggtt cgaaggctgg
ccctccgagg ggttcaacag 22560tcgcctcaga tcgcgtgggc ccgacaccca
ctactggtca ggggttcgaa ggccggcccc 22620ccgaagggct ccatggccgc
ctcaggctac tcgggctccg cacccattac tgatcagggg 22680ttcgaaggct
ggcccccgaa gggttcacag tcgcctcaga cgccgagcga gggatgacca
22740ggggtacgtt cgatacataa ccgaggctcg ggctgcgctc ccgaggtacc
ctaggacatt 22800tccgagacca gcgggaacga tcttgtaacg gaatcccatc
ggagggaggc atcgagccct 22860cggaccccgt cgccagggga ccgggtccgg
caaatcaccc gcaggtactt ttgggcgtgc 22920ctctgggccc ctagccgacc
cccaacgaac ggggcacgga cgtccactcg gattacccgc 22980ttgcagctca
ccggagacac catgttcggt gcccatcgag ggtaacatgg cgctctcccc
23040cctcctcctt gcggaaaggc gacgtagggg cgtatgtaaa aaagccgagt
ctgtccctga 23100tcgtcctctc gccctgtgca gaggctcggg ggctgctctc
gcaaacccgg ctccggccaa 23160accgttgaca gcgtcaacat accagcccga
gagcttgggc cctgaccgtg cacccgggct 23220acggccagtt cgcatgaggg
aacaaccaga ccagccgaag cattacgcaa ggcattaaga 23280cctcgaagga
gtgtaaccac tcctccgagg cctcgggggc tacacccggc gggtgcgctc
23340gcgcgcaccc accggaacaa aatgcaaccg agaaaggctg gtccccttgc
aaaaaagtgc 23400gacgaaagcc tccaagcgag tgctaacact cccttcgagg
ctcgggggct actgtcgggg 23460accataatta ggggtaccct caagacgcct
aattctcagc tggtaacccc catcagcata 23520aagctgcaaa ggcctgatgg
gtacgattaa gtcagggatc agtccacacg agtgactcga 23580tcacgcttcg
cccgagccta gcctcagcca agggcagccg acctcgagag acttccgtct
23640cggccgaggc ccccctttgt aacggcggac acacctccgg ctcgcccgag
gccctggctt 23700tgcttagaag caaccctgac taaatcgccg tgccgactga
ccaggttgca ggagcattta 23760acgcaaaggt ggtctgacac ctttatcctg
acacgcgccc cccggcagag ccgaagtgac 23820cgccgtcact ccaccgctct
actgaccagt ctgacagaag gacagcgccg tctgcgccac 23880tccgactgca
gtgccactcg acagagtgag tctgacaggc agtcaggcct taccaaaggc
23940gccataggga actccgctcc gcccgacccc agggctcgga ctcgggctat
gacccggaag 24000acggcgaact ccgctccgcc cgacccaggg ctcggactcg
ggctaagacc cggaagacgg 24060cgaactccgc tccgcccgac cccagggctc
ggactcgggc taagacccgg aagacggcga 24120actccgctcc gcccgacccc
agggctcgga ctcgggctaa gacccggaag acggcgaact 24180ccgctccgcc
cgaccccagg gctcggactc gggctaagac ccggaagacg gcgaactccg
24240ctccgcccga cccagggctc ggactcgggc tcagccccag aagacgacga
aactccgcct 24300cgcccgaccc agggctcgga ctccgccctg gcctcggccg
aatgacctcc gcctcgcccg 24360acccagggct cggactcggg ctaagacccg
gaagacggcg aactccgctc cgcccgaccc 24420cagggctcgg actcgggcta
agacccggaa gacggcgaac tccgctccgc ccgacccatg 24480gctcggactc
gggcttagcc ccagaagacg acgaaactcc gcctcgcccg acccagggct
24540cggactccgc cctggcctcg gccgaacgac ctccgcctcg cccgacccaa
tggctcggcc 24600tcggcctcgg caacagaaga cagactcaac ctcggcttcg
gaggagcccc cacgtcgccc 24660gacctagggc gcaggcccgc cacgtcaaca
aggagcgcca tcatcatcct accccgagcc 24720gactcgggtc acggagaaca
agaccggcgt cccatctggc cagctccgcc agatggacaa 24780tgatggcgcc
ccacaagctc tgtgacgacg gcggctctca gctctcttac ggaagcaggg
24840cgacgtcagc aaggactcga ccgctccaac agctgtccct ccgccaggct
ccgtcgctcc 24900tccgacagcc acgacatcac gccagcaagg tgccaagacc
tctccggctg ccacattggc 24960atgtacctag ggcgctagct ctctctccgc
tagacacgta gcactctgct acacccccca 25020ttgtacacct ggatcctctc
cttacgacta taaaaggaag gaccagggcc ttcttagagg 25080aggttggccg
cgcggggacg aggacgagac atgcgctctc ttggggccgc tcgcttccct
25140cacccgcgtg gacgcttgta acccccctac tgcaagcgca cccgacctgg
gcgcgggacg 25200aacacgaagg ctgcgggatc tccacctctc tcacgcccgt
ctccggccac ctcgcctctc 25260cccccttcgc gctcgcccac acgctcgacc
catctgggct ggggcacgca gcacactcac 25320tcgtcggctc ggggaccccc
cggtctcgaa acgccgacag aaaataaggc catattttcg 25380gcggctaggg
tctagccgcc gaaagtagct tattttcggc ggccacaagt cagtcgccga
25440aaattacctg ttcttttcgg tgggcctctg acggccgccg aaaataacaa
gtgccgaaaa 25500tagtatttaa aaatacaaaa aataacagaa aattcataca
ataacagaaa attcatactt 25560gagtccacaa cataaaactt aagtccatac
aaacataaag tccacaaata gtccatacaa 25620acataaagtc cacaaatagt
ccattacaaa gcacaatgcc gcacaaagct aactccatca 25680catatcgggg
tcgttggagt tgtgtccact accttcagaa gcgaaaaact cgttgacgaa
25740gtcgtgtaac gggtttagat tctaaagaaa aaagaagaca ttaataacga
tattagttac
25800atgtatgacc actattcaaa caaattgttt ctcaaactaa cctctcatgg
agtagctccc 25860tcccctgcat atgctcctcc tggtgctggt atgagcggtg
gtggcgtgtt gtggcccatg 25920accccggatc cctacaaaat caagtttagt
aaagatttga aattagattg atacaaacga 25980caagtcttaa ctaaattgaa
gcacctgagg tggaggtggc ggagcatgta atccccactg 26040aggcatcgac
ggctgaaact gagggaaaac aaatggttgt tgttgtgcct gctgtggaaa
26100ccaagaccgt tgcaaatata atatgttagt tatagaacca atatcgagcg
tgttgagaag 26160aaataagaca ctcacgttca ttgcttgttg ggcctgtgcg
ttgtaagcag ccatgtactc 26220tgattgctct ttgaggaatg ccatttgttg
ttgccgcagc tcttcacgaa actttttttg 26280ctactccctc atagcctcct
ccatgctaga tacagagcgg caactacgcc tgctactaca 26340acaacccgcc
tgcgcgcggg cggtcggcgg cgcgcaggcg tgggcggcgg acagcgcgcg
26400ggcgtgggtg gctgatttgg gagaggagag agagagagga aaaacaaaga
agaagaaggg 26460cgtcggtttt aaaaagacta ttttcggcgg ccccctggca
cagccgccga aaatagcgtt 26520actttcggtg gccctctgac acagccgccg
aaagtagcct tatttccggc ggctgtgtga 26580gaggccaccg aaaatagcct
tatttccggc ggttgtggca ggccgccaaa aatagcagat 26640aattttcggc
ggctataggt gggccatcga aaattacatt ggccgccgaa aatgttcaac
26700agtgttgttg tgatagcaac caacaggtat gagccacaat actacacatt
gcaacttggg 26760aaagtaattt actggtcacc atatttccga atagctggtt
atgatatgat atttacaaat 26820cttccaattc attccttcag cttaaatgaa
tctcattaat tcatctagga aacatctggg 26880ctgaaacgtc agaacaacag
tgttttctac tgttaacatg atccgtttat cttgtaaaaa 26940acaaggtttt
gtaaatggat ttatttttat gctcaaactt aaattgaaca attcaatcac
27000gcacaattgc tatgctgaca gaagtttatg acaagtttga gcataatgtt
gtaataataa 27060tgagaccctt catgatcttg ttgttattcc acatttccat
ctctcctcga agcatagcag 27120tgcccaccat tttctaccga gtcagcaaca
ataatctagg ctgaaagaac aatggacaac 27180agcttcgtgt gttgtccatc
tagtagtcct ttgaataaca gtataatatg cttatgagaa 27240tcaatattat
tttcatggca cacttgtttt tttcatgaat agtttcattt ttgtagataa
27300ttttcagttc tctgtcacag gtacaatatt tgcctatggt gttacaagga
gtggaaagat 27360acatacgatg catgtgggaa aacttattac aatatttttc
ctttaataag ttttaccttt 27420gtagagtgta tgtttctagt cataggcttt
gaagtatgcc tcatgctacc aattaacatg 27480caaaaacttg gactaatctt
actgatacta agatctaaca tagttgtcaa cctccttggt 27540tggacatttt
agttgctttt gttgtattaa gcttttaatt ctctacaggc tgaggatgat
27600gatggcactg atcttttcgg gacgaaaccg aagaggacaa gaaggctgct
gatgagcatg 27660tccctaccaa ggtctcttat agaaagtctc tttatcgaag
aggacaagaa gtgctaacct 27720acattatttc agttaggggc atgcctttga
gaagtctctt tacaatgcaa cgggcaaaat 27780gcccccgaag caaccctagg
gatgatgccg gatccaagtg agacagggca tatagtggga 27840ggggaagcaa
tgggggcata cctgacgacg ttagagagaa agagggcgag gactttggcg
27900acgaagccgg gtagcaggtt gacaatatta atgtacttga cgcagagact
cgagacgggt 27960gcgacgtcgt agctgtgcag tgcctcaacg atctccaccg
gcttcatcag cgggaaggag 28020agctcgccct cccctccgtc gcaggcacca
caggtaaact gctgcattga cgacttcctg 28080gcgatggctt cctctgtcac
tcaaagccgc ggccgccgcg cgctcggcgc atatccttgg 28140ccgggctggt
gtgaggaggt ctaggatggt ggccgggttc cgtcgtacga tctcattccc
28200aacgcctagg tcctcgacgc cgccaacggg aggcgcgggg cccagcgctg
ccaacaagta 28260tggggcctac cgcgcgtggt tgatgagcct gccatgccgg
ttccacctgc gggagctggt 28320aggccgcctt gcgtcgaaag cctccgtgga
ggccatgacc gagggtgcgg catggcgggg 28380ccgcgtggtc ttgtcactct
ccgagctgct gcaccagccg ctgcgccggc tcggcccgtc 28440cctgtagggt
cgcgtcgtcg ggcggggggg gattggattt gtggtggggt gcgtgggcgg
28500gcatcacgcg tggcgatggc actggaagca cggggaacag ggcaggtgta
gggtgggggc 28560aggcgatgga atggcgcggc atgcttgcgg ccgattgtcc
ttgcgtggat ggaggggatt 28620gcgggctcga ggatgaggat ggcgggatgc
gcgcgccttt cgtcgatcga acgtgggcac 28680gggacgagga ttgcattgcg
cggccacgcg ggggcgagat tggcgtcgtc ggtgggatgt 28740aggcttcgat
gactgtcagc ggggtgggac gtgaatcacg ggggcgaaac aattgctatt
28800ttagcccttc taacgtgggc tctctgctat tatgtgaccc tctgtctatg
acttgtgtga 28860ccatttgtgt ctatgatttg tgggactggt ggtaaaatag
agaagttcac aactgagagt 28920gacaaaatag caaattctcc cacgggggcg
ggggcacgac gcaccagtgt ggacgtccac 28980actatagcct tatagagtag
tggagattat tttttttaat taaactatac ttaatatttc 29040tacttaacat
aatatttgat gtaacatgga cgactaaact tttccctcaa gccggtatta
29100caaggacacc gggacacgtg ctgtgcggtg acaaaactgt cggggaccat
aattaggggt 29160accctcaaga cgcctaattc tcagctggta acccccatca
gcataaagct gcaaaggcct 29220gatgggcacg attaagtcag ggatcagtcc
acacgagtga ctcgatcgcg cttcacccga 29280gcctagcctc ggccgaaggc
agccgacctc gagagacttc cgtctcgccc gaggcccccc 29340tttttatggc
ggacacatca ccggcttgcc caaggccttg gcttcgctca gaagcaacct
29400tgactaaatc accacaccga ctgaccaaat tgcaggggca tttaacgcaa
aggtggcctg 29460acacctctat cctgacacgc gcccccggca gagccgaggt
gaccgccgtc actccaccgc 29520tccactggcc agtctgacag aaggacagcg
ccgcctgcgc cactccgact gcagtgccac 29580tcgacagagt gagtctgaca
ggcaactagg ccttgccgaa ggcgccacgg cgaactccgc 29640tccgcccgac
cccagggctc ggactcgggc taagacccgg aagacggcga actccgctcc
29700gcccgacccc agggctcgga ctcgggctaa gacccggaag acggcgaact
ccgctccgcc 29760cgaccccagg gctcggactc gggctaagac ccggaagacg
gcgaactccg ctccgcccga 29820ccccagggct cggactcggg ctaagacccg
gaagacggcg aactccgctc cgcccgaccc 29880cagggctcgg actcgggcta
agacccggaa gacggcgaac tccgctccgc ccgaccccag 29940ggctcagact
caggctaaga cccggaagac gacgaaactc cgcctcgccc gaccccaggg
30000ctcggactcc gccctggcct cggccggacg acttctgcct cgcccgaccc
cctggctcgg 30060gctcggccac ggcaactgaa ggcaagactc aacctcggct
tcggaggaaa ccccacgtcg 30120ccctgcctag agcacagacc gccacgtcaa
taggaaacgt catcatcacc ctaccccgaa 30180tcgactcggg tcacggagaa
caagaccggc gtctcgtccg gccagctccg ctagaggggc 30240aatgatggcg
ctccacgagc tctatgacga cggcggcccc cagctctctt acggcagcag
30300gacaacgtca gcagggactc gaccgctcca acagctgtcc ctccatcagg
ctccgccgca 30360ccaccgatag ccacgacatc acgccagcag gatgcccaga
tctctccggc tgccacatcg 30420tcatgtacct agggcactag ctctccctcc
gctagacacg tagcactctg ctacatcccc 30480attgtacacc tgggtcctct
ccttacgact ataaaaggaa ggaccagggc cttctcagag 30540aaggttggcc
gcgcgggacc gaggacggga caggcgctct cttggggccg ctcgcttccc
30600tcacccgcgt ggacgcttgt aaccccccta ctgcaagcgc acctgacctg
ggcgcgggac 30660gaacacgaag gccgcgggac ttccacctct ctcacgctcg
gctccggccg cctcgcctct 30720cccccctccg cgctcgccca cgcgctcgac
ccatctgggc tggggcacgc agcacactca 30780ctcgtcggct tagggacccc
cctgtctcga aacgccgaca gttggcgcgc caggtagggg 30840cacgctgcgt
gctgacgaat agctccccgt caagctccag atgggcagtc tccagcaacc
30900tctccggccc gggacggtgc ttcgtttcgg ggctctcgag ttcatgtcct
tcgacggcag 30960ctacgacatg atacttcttc caccgccgtg cgaccacgac
aatggcggcc gacaacccgc 31020ccgccggcgg cggaatcgac gacgtctacc
ccgcgtggtg gaaaagcaac attcgggctc 31080gctccgttct ctcccccgcc
aacggaggag gaggcggggc cgtcaaggcc agacgggaga 31140ccgcgcttcg
ccggccgtcg agcgaatcga cgcccccgac gccccgacgg aaggcacgcc
31200ggacaccgac ctcgcgttca agacggaggc aagcgccgtc cccccgcggc
acgacgaccc 31260cgagcaagaa gacgacgccg gcgcgctcgc ggaaagcctg
caggacgtcg ccctcgaacc 31320agagatgacg gcgcaaccag tccccgatgt
gactacgtcg ctcctcgtcg accaaaaggt 31380aacgactaac tcccatcttg
cgtcatttcg actcggcctc aacccgccaa acgacctcgt 31440tttggcgggc
gccctcattg aggcgagtgc aaccccactg aggttctgta tgcgatcgcc
31500ttgggaccga ctgacggacg tctcgaccta cgggccctct gggtccgagg
aagatgacga 31560ccccagcatc ggttgggatt tctccggact tggcaacccc
agtgtcgtgc cggacttcat 31620ggccgcatgt gactactgtc tgtccgactg
ttccgatgca agccgcagcc ttggcgacga 31680gagctgcggc ccaagccgcg
aatgtttcca catcgagcta gggaatccca ccgaaggcaa 31740ccatcttggc
atgccggagg atggtgatct ccctaggccg gtgcctcgcg ccgacatccc
31800acgggagcta gctgtggtcc ccgctccggc ggggggttac gacccacaac
tcgagcaagt 31860ccgcgaggcg caggccaggc tcaacgaggg aacgggagcg
cttgagccga tccgtcggga 31920cgtcggacag gcatgggtgg gccaacccct
ggccggagaa atacgtcatc tgccccaagg 31980tctccagcac cgcgtcgcca
acgacatcag gatcaggccg ccgcccgcat ccagcggggt 32040cggtcagaac
ctggcaaccg cagcaatgct catccgcgcg atgccggagc cgtcaaccac
32100cgagggtcgg cggatccagg gagaactcaa gaatctcctg gaaggcgccg
cggcccggcg 32160ggccgagagc actgcatccc gaaggcaagg atatccctcg
gaacctcatg ccgcgacttc 32220ccgattcatg cgggaagcct cggtctacac
cgggcgcacg cgcaacaccg cgcctgcggc 32280cccgggccac ctcggcaacg
agcaccatcg acacgaccgt cgggctcacc tcgacgaaag 32340ggtgcgccga
ggctatcacc ccaggcgtgg gggacgttac gacagcgggg aggatcggag
32400tccttcgccc gaaccacccg gtccgcaggc tttcagtcgg gccatccgac
gggcgccatt 32460cccgacccgg ttccgacccc cgactactat cgtaaagtac
tcgggggaaa cgagaccgga 32520gctgtggctc gcggactacc gccttgcctg
ccaactgggt ggaacggacg acgacaacct 32580catcatccgc aacctccccc
tgttcctctc cgacactgct cgtgcctggt tggagcacct 32640gcctccgggg
cagatttcca actgggacga cttggtccaa gccttcgctg gcaatttcca
32700gggcacatac gtgcgccccg ggaattcctg ggaccttcga agctgccggc
aacagccggg 32760ggagtcgctc cgggactaca tccagcgatt ctcgaagcag
cacaccgagc tgcccaacat 32820caccgactcg gatgtcatcg gcgcgttcct
cgccggcacc acttgccgcg acctggtgag 32880caagctgggt cgcaaaaccc
ccaccagggc cagcgagctg atggacatcg ccaccaagtt 32940cgcctccggc
caggaggcgg tcgaggctat cttccgaaag gacaagcagc cccagggccg
33000cccgtcggaa gaagctcccg agacgtctgc tccgcgcggc gccaagaaga
aaggcaagaa 33060gaagtcgcaa tcgaaacgcg acgccgccga cgcggacctt
gtcgccgccg ccgagtataa 33120gaaccctcgg aagcccccca gaggtgcaaa
cctcttcgac aagatgctca aggagccgtg 33180cccctaccat cagaggcccg
tcaagcacac cctcgaggag tgcgttatgc ttcggcgtca 33240tttccacagg
gccgggccac ccgccgaggg tggcagggcc cacgacgaca acaagaacga
33300agaataccca gcaggggggt tccccgaggt ccgcgactgc ttcatgatct
acggagggca 33360tgcggcgaat gcctcggctc ggcaccgcaa gcaagagcgc
cgggaggtct gctcgttgaa 33420ggtggcggcg ccagtctacc tagactggtc
cgacaagccc atcactttcg accgagccga 33480ccaccccgac catgtgccga
gcccggggaa atacccgctc gtcgtcgacc ccgttgtcgg 33540cgatgtcagg
ctcaccaagg tcctgatgga cgggggcagc tgcctcaaca tcatctacgc
33600cgagaccctc aagctcctgc gcgtcgatcc gtccaccgtc cgagcaggcg
ctgcgccctt 33660ccacgggatc atccctggga agcgcgtcca gcccctcggg
cgactcgacc tcccagtctg 33720cttcgggaca ccctccaact tccgaaggaa
gaccctgacg ttcgaagtgg tcgggttccg 33780aggaacctac cacgccgtgt
tagggaggcc atgctacgcg aagttcatgg ccgtccccaa 33840ctacacctac
ctgaagctca agatgccggg ccccaacggg gtcatcaccg tcggccccac
33900gtacaaacac gcgttcgaat gcgacgtgga gtgcgtggag tacgccgagg
ccctcgccga 33960gtccgaggcc ctcatcgccg acctggagaa cctctccaag
gaggtcccag acgtgaagcg 34020ccatgccggc aacttcgagc cagcggagac
ggtcaaggcc gtccccctcg accccagcgg 34080cgacaccacc aagcagatcc
ggatcggttc cgggctcgac cccaaatagg aagcagtgct 34140cgtcgacttt
ctccgcgcaa acgccgacgt ctttgcgtgg agtccctcgg acatgcccgg
34200cataccgagg gatgtcgccg agcactcgct ggatattcgg gccggagccc
gacccgtcag 34260acagcctctg cgccgattcg acgaggagaa gcgcagagcg
attggcgaag agatccacaa 34320gctaatggcg gcagggttca tcaaagaggt
attccatccc aaatggcttg ccaaccctgt 34380gcttgtgagg aagaaagggg
ggaaatggcg gatgtgtgta gactacactg gtctcaacaa 34440agcatgtccg
aaggttccct accctctgcc tcgcatcgac caaatcgtgg attccactgc
34500tgggtgcgaa accctgtcct tcctcgatgc ctactcgggg tatcaccaga
tccggatgaa 34560agagtccgac cagctcgcga cctctttcat cacgccgttc
ggcatgtact gctacgtcac 34620catgccgttc ggcctgagga atgcaggcgc
gacgtaccag cggtgcatga accatgtgtt 34680cggcgaacac atcggtcgca
cagtcgaggc ctacgtcgat gacatcgtag tcaagacacg 34740gaaggctccc
aacctcctct ccgaccttga agtgacattc cggtgtctca aggcgaaagg
34800agtcaagctt aatcctgaga agtgtgtctt cggggtgccc cgaggcatgc
tcctagggtt 34860catcgtctct gagcgaggca tcgaggccaa cccggagaag
atcgcggcca tcaccagcat 34920ggggcccatc aaggacttaa aaggggtaca
gagggtcatg ggatgcctcg cggccctgag 34980ccgcttcatc tcacgcctcg
gcgaaagagg tctgcccctg taccgccttt taaggaaagc 35040cgagtgtttc
gtttggaccc ctgaggccga ggaagccctc ggcaacctaa aggcgctcct
35100tacaaaggcg ccagtcttgg tgccgccggc ggacggagaa accctcttgg
tctacgtcgc 35160cgcgaccact caggtggtta gcgccgcgat tgtggtcgaa
aggcaggagg aagggcatac 35220attgcccgtt cagaggccgg tttacttcat
cagcgaagtg ctgtccgaga ctaagatccg 35280ctacccacaa gttcaaaagc
tgctgtatgc tgtgatcctg acgaggcgga agctacgaca 35340ctacttcgag
tcccatccgg tgactgtggt gtcatccttc cccctggggg agatcatcca
35400gtgccgagag gcctcgggca ggatcgcaaa gtgggcagtg gagatcatgg
gcgaaacgat 35460ctcgttcgcc cctcggaagg ccatcaagtc ccaagtgttg
gcggatttcg tggctgaatg 35520ggtcgacacc caactaccaa cgactccgat
ccaaccggag ctctggacca tgtttttcga 35580cgggtcgctg atgaagacgg
gggccggtgc gggcctgctc ttcatctcgc ccctcggaaa 35640gcacttgcgc
tacgtgctgc gcctccactt cccggcgtcc aacaatgtgg ccgagtacga
35700agctctggtc aacggattgc ggatcgccat cgagctaggg gtcagacgcc
tcgacgcccg 35760tggtgattcg cagctcgtca tcgaccaagt catgaagaac
tcccactgcc gcgacccgaa 35820gatggaggcc tactgcgacg aggttcggcg
cctggaagac aagttcttcg ggctcgagct 35880caaccatatc gctcggcgct
acaacgaaac cgcagacgag ctggcgaaga tagcctcggg 35940gcgaacgaca
gtccccccgg acgtcttctc ccgggatctg catcaaccct ccgtcaagct
36000cgacgacgcg cccgagcccg aggtatcctc ggctcagccc gaggtaccct
cggctcagcc 36060cgaggtaccc tcggttcagc ccgaggcacc ctcggcccag
cccgaggtac tctcggcccc 36120cgagggcagg gcattgaacg tcgaggaagg
gcagagcggg gccacgccag accaggattg 36180gcaggccccg tacctgcaat
atctccgtcg aggagagcta cccctcgacc aagtcgaggc 36240tcggcgggta
gcgcgacgcg ccaagtcatt cgtcttgctg ggcgacgaag aggagctcta
36300ccatcgcagc ccctcgggca tcctccagcg atgcatctcc atcgccgaag
gtcgggaact 36360gctgcaagaa gtacactcgg gggcttgcgg ccaccacgca
gcaccccgag cccttgttgg 36420aaatgctttc cggcaaggct tctactggcc
aacggcggtg gctgacgcca ctagaattgt 36480ccgcacctgc gaagggtgcc
aattctatgc gaagcggaca cacctgcccg ctcaggctct 36540gcagacaata
cccatcacct ggcccttcgc tgtatggggt ctggacctcg tcggtccctt
36600gcaaaaggcg cccgggggct acacgcacct gctggtcgcc atcgacaaat
tctccaagtg 36660gatcgaggtc cgacctctga acagcatcag gtccgagcag
gcggtggcat tcttcaccaa 36720catcatccat cgcttcgggg tcccgaactc
catcatcacc gacaacggca cccagttcac 36780cggcaaaaaa ttcttggatt
tttgcgagga tcatcatatc cgggtggact gggccgccgt 36840ggctcatccc
atgtcgaatg ggcaagtaga gcgtgccaac ggcatgattc tacaagggct
36900caagcctcgg atctacaacg acctcaacaa gttcggcagg cgatggatga
aggaactccc 36960ctcggtggtc tggagcctaa ggacgacgcc gagtcgtgcc
acgggcttca cgccgttttt 37020cctggtctat ggggctgaag ctatcctgcc
cactgacctg gaatacggct ccccaagggc 37080gagggcctac accgagcaaa
gcaaccaagc cagccgagag gaatcgctgg accagttgga 37140ggaagctcgg
gacagggcct tactacactc ggcgcggtac caacagtccc tgcgacgtta
37200ccacgcccga ggggtccggt cccgagaact ccaggtgggc gacctggtgc
ttcggctgcg 37260acaagacgcc cgagggaggc acaagctcac gcccccctgg
aaagggccgt tcgtcatcgc 37320caaagttctg aagcccggaa catacaagct
ggccaacaat caaggcgaga tctacggcaa 37380cgcttggaac atcaaacagc
tacgtcgctt ctacccttaa gatgttttca agttgttcac 37440atacctcgca
cctacgcaaa gtttagttgt caaggaaggg tcggcctagc ctcggcaaag
37500cccgaccctc cctcgggggc taaaaggggg gagaccccct ctgcgtcgaa
ttttttcctc 37560gaaaaaggac ctctttttag caggatttct tccgtgcttc
ttgactactt tggaaagcgg 37620atcctggaaa cgacgaggta cacgtaagca
gccaaggctg accaagccga gggactccta 37680cgcctccggg atacggatac
ctcactcgtc cccttctgcg ataagtaact tgcgctcgga 37740taaagcgact
ccgtggaccg aacgagtcat cacgttcgga agctctcctg ccgaagcagt
37800ccttcaagct ttctcgacta aatcggggac agggcctcat ggacgggtga
aagtacgcgt 37860aagcggcaag gccgaccgag ccgagggatt cccacgcctc
tgggatacgg atacctcact 37920cgtcccttcc gcgaaaagca actctcgctc
acacaaacat ccctattacc gacagagtcc 37980agatgctcga aacaagagga
aaaaaggacg cagcttcgca agcgcggcga gggcgtgttc 38040ttctggcctc
ggcggccgca gaaagcgcac gctacaagat gatctgatcc tgcaggctcg
38100ggtcttcacg ccgaagggag ccgtagcacc ctcggcatcg acgacgtcta
cagcaaagcc 38160cgacccagcc tcgggcggcg ccgaggtcca ggggctcctc
caggaatccg gcccgagcag 38220gcggctcaac cggttacccc tggggcctcg
ggcaaccggc ttccaagggc gctagcccga 38280tccaaggcct cgactgaccg
acttgggcgt cggcaccgct gacgggcgac acggctaggc 38340tccggccaac
caggttcccc attctcgagc caactccgcc tctgttcaca ctgatatcgc
38400tacccccggc ctcgatccac caaagggcgg ccgaggggtc ccttcaacta
agctagaaga 38460gcctcacgta acaaggccga acgggccgag ggattcctac
gcctccggga tacggatacc 38520tcacccgtca ccttgacacg gggcaactca
tgcttggtaa agcggtttag ataataaaac 38580aggcgagact tagtgctcgg
aaatgaggaa aaaacacggc tccgtgccaa aattacatac 38640atgttcaggc
ctcgacagcc acaatgaacg aactcactgg cattcgaagt gccattacaa
38700acggaactcc ggttccccct ccgcaggtac gaacaacccc actccgaggg
ggaaggcctg 38760cggagcaacg gaagaccgac gaacggcgcg ccgtcacctg
ctccagcagt ggcgacgacg 38820gcgacttctg ctccgggggg ccgaacagcg
gcaacgctga cctcagggtg gatgccgctg 38880tcaggaggcc cccgcccgtg
ccaaaactcg tgaggcaagg acgggcagaa ggccgtagaa 38940gatggaggtc
agcccgtggc cggtcccggc cgccgcgccg gcggaagaac ctcttccggc
39000tgccgtggca gacgccgacg ccgcaagggg ccccgaagcc actcgcggct
gaagaacagg 39060cacgctgcag ctgccggacg ccacgggcaa tgcccgcttc
tccccccatc actgagtgaa 39120ggagcgggcc accgcccacg caggggctga
ccccaactcg gcactctccc ctccccagcc 39180ttggtgatga aaatccttga
ggctgaggaa ggggcagagg ccacagcccg gctcgctttc 39240ccccaccatc
aagctggagg tcgccatctc gggtgaccgc cggtgaaggg gtgcgaccgg
39300gctgcgtggt gaaaatcctt gaagccgaac gatggctgag aggtaccaac
tcccatggag 39360ttgcgttcct ccaacgagga ggcggaaagg cggcggatat
cccccatccg ggggcttgga 39420agacgggaag acccggcgct taagggagga
agaagacatg gtcgccttac gaaaggagcc 39480tccctccttt taaaggcaac
tcccctacgt gcgcccccag gcgccgcggg ccgagtcttc 39540tccaacacgc
tccaaggccc tcccctgcga ctcgggggct gggtcccgca tgtcatgcaa
39600gccggctcag ggcagaagaa gccaaaccgc cgcgcatggt gcgcacgacc
gtccagcggt 39660tacaggcgac cccccatttc cgcccagacc aacaggcaga
aggggcgagc agccatgcag 39720gcggcatgca accgcgccag atggacgcgc
ttctccaact tctgacacgc cagcctgggg 39780cccaggccca cgcgtcgagc
aactggcacg ccagttgctg catgcaagca accgcaccgc 39840cacttgtgcc
accgtcgcgc ctcttcggtt gcgaagccta tgccacgact cgaggcgacc
39900caacagcgcc agactggcgc gtcggtcaaa gcgaccgaaa gtgggccggc
agtaatagcg 39960gtggcaggcg ggcgggcgca gcggtcacgt cgtcagccag
gctcacgtcc catcctgaga 40020cagcaagaga gcctcctctc acggcgtgaa
gacggtgcac ccgtgacccg ttcctcgaac 40080ggatcacccg cgcgcaacgg
ccgccccgcc aaccactcgc cccgtcgcat taactccgcg 40140gcgggacacg
cggcgcttct ggcaggagga gcgcgcgacg cttcacctcc gccttaataa
40200ccgcgtcaga aaaggtacgc cacgtcgtct gatttcgtat ccttttccgt
tttcctcttt 40260ctctatctct tgcatcaggg accggggaag ggggataccc
cgagagggat ccttctccgc 40320gaaggaaccg ggctccgcgc cccccattac
tgatcagggg ttcgaaggct ggccccccga 40380gggttcaaca gccgcctcag
atcgcgtggg cccgacaccc actactggtc aggggttcga 40440aggccggccc
tccgaagggc tccacggccg cctcaggcta ctcgggctcc gcgcccatta
40500ctgatcaggg gttcgaaggc tggcccccga agggttcaca gtcgcctcag
acaccgagcg 40560agggatgacc aggggtacgt tcgatacata accgaggctc
gggctgcgct cccgaggtac 40620cctaggacat atccgagacc agcgggaacg
atcttgtaac ggaatcccat cggagggagg 40680catcgagccc tcggaccccg
tcgccagggg accgggtccg gcaagtcacc cgcatgtact 40740tttgggcgtg
cctctgggcc cctagccgac ccccaacgaa cggggcacgg acgtccactc
40800ggattacccg cttgcagctc accggagaca ccatgttcgg tgcccatcga
gggtaacatg
40860gcgcactccc ccctcctcct tgcggaaagg cgacgtaggg gcgtatgtaa
aaagccgagt 40920ctgtccctga tcgtcctctc gccctgtgca gaggctcggg
ggctgctctc gcaaaaaccg 40980gctccggcca aatcgttgac agcgtcaaca
taccagcccg agagcttggg ccccgaccgt 41040gcacccgggc tacggccagt
tcgcatgagg gaacgaccag accagccgaa gcgctaagcg 41100aagtattaag
acctcgaagg agtgtaacca ctcctccgag gcctcggggg ctacacccgg
41160cgggtgcgct cgcgcgcacc caccggaacg aaatgcaacc gagaaaggct
ggtccccttg 41220caaaaaagtg cgacaaaagc ctccaagcga gtgctaacac
tcccttcgag gctcgggggc 41280tactgtcggg gaccataatt aggggtaccc
tcaagacgcc taattctcag ctggtaaccc 41340ccatcagcat aaagctgcaa
aggcctgatg ggcacgatta agtcagggat cagtccacac 41400gagtgactcg
atcgcgcttc acccgagcct agcctcggcc gaaggcagcc gacctcgaga
41460gacttccgtc tcgcctgagg cccccctttt tatggcggac acatcaccgg
cttgcccaag 41520gccttggctt cgctcagaag caaccttgac taaatcacca
caccgactga ccaaattgca 41580ggggcattta acgcaaaggt ggcctgacac
ctctatcctg acacgcgccc ccggcagagc 41640cgaggtgacc gccgtcactc
caccgctcca ctggccagtc tgacagaagg acagcgccgc 41700ctgcgccact
ccgactgcag tgccactcga cagagtgagt ctgacaggca actaggcctt
41760gccgaaggcg ccacggcgaa ctccgctccg cccgacccca gggctcggac
tcgggctaag 41820acccggaaga cggcgaactc cgctccgccc gaccccaggg
ctcggactcg ggctaagacc 41880cggaagacgg cgaactccgc tccgcccgac
cccagggctc ggactcgggc taagacccgg 41940aagacggcga actccgctcc
gcccgacccc agggctcgga ctcgggctaa gacccggaag 42000acggcgaact
ccgctccgcc cgaccccagg gctcggactc gggctaagac ccggaagacg
42060gcgaactccg ctccgcccga ccccagggct cagactcagg ctaagacccg
gaagacgacg 42120aaactccgcc tcgcccgacc ccagggctcg gactccgccc
tggcctcggc cggacgactt 42180ccgcctcgcc cgaccccctg gctcgggctc
ggccacagca actgaaggca agactcaacc 42240tcggcttcgg aggaaacccc
acgtcgccct gcctagagca cagaccgcca cgtcaacagg 42300aaacgtcatc
atcaccctac cccgaatcga ctcgggtcac ggagaacaag accggcgtct
42360cgtccggcca gctccgccag aggggcaatg atggcgctcc acgagctcta
tgacgacggc 42420ggcccccagc tctcttacgg cagcaggaca acgtcagcag
ggactcgacc gctccaacag 42480ctgtccctcc atcaggctcc gccgcaccac
cgatagccac gacatcacgc cagcaggatg 42540cccagatctc tccggctgcc
acatcggcat gtacctaggg cactagctct ccctccgcta 42600gacacgtagc
actctgctac atccccattg tacacctggg tcctctcctt acgactataa
42660aaggaaggac cagggtcttc tcagagaagg ttggccgcgc gggaccgagg
acgggacagg 42720cgctctcttg gggccgctcg cttccctcac ccgcgtggac
gcttgtaacc cccctactgc 42780aagcgcacct gacctgggcg cgggacgaac
acgaaggccg cgggacttcc acctctctca 42840cgctcggctc cggccgcctc
gcctctcccc cctccgcgct cgcccacgcg ctcgacccat 42900ctgggctggg
gcacgcagca cactcactcg tcggcttagg gaccccctgt ctcgaaacgc
42960cgacaaaaac cctcaccaca ttttcctcaa ccacatgatg gagattgggg
ctactagata 43020ctatgcctgg tggtagactg gtagctgatg tctttggacc
agtagttggt gctagatttg 43080tgaactctac caaggtgaga aacggagatg
gaggctgccc tgctgagcgg gttcatcaaa 43140accatcctgc caaggctctt
ctcactggta caagggagat acaagctgca caagggcctc 43200aagagcgaca
tcaaatcgct ggagaaagag ctccatatga tcgctgttac aatcgatgaa
43260caaatctcgc tggggaggaa ggatcaggga gctgtgctga gcctctcaat
tgatgagctg 43320catgaactgg ctcaccaaat cgaggactcc atagatcgct
tcttgtacca tgtgaccagg 43380gagcagcaag catccttttt tcgtcggact
gtacggtcgc cgaagactct gttgtcacgt 43440cagcggctgg ctgccgaggt
tcagttcctg aagaagatac cggaggaggc gcaccagcga 43500gagaagaggt
acagggtctt cgccggcctt tcttcctcta cccggcacac tgaatcgtct
43560tcctgttcgt ctgtatctga tccgcacaca cttaaggccg acgtcgtcgg
catcgacggt 43620cccagggacg agcttgtgca gcagttaacc gaagaggcag
agggcctaac aaagcagctc 43680aaggtgatct ccatcgtcgg gatccatggc
tccggcaaga ccgtccttgc cagagaggta 43740tacgagagcg acgtcggccg
gcagttcagt ctccgggcat gggtttctgc tactgacaga 43800ggtccgagag
aggtgctcat ggagatcctc cgaaattttg gtaggccagt ggtggatagc
43860tctagtattg accagcttac ggtagatctc aggaaacact tgggtgagaa
aaggtgaaaa 43920aaacctcttc tttatgttat ttattattta tgaagtttct
tcaactacgg gttttcatgt 43980tcaaattgcc tctctgaact tcgaaaacgt
ttaataccaa ttgaattgag gatcttagct 44040ttggaaaagc ggtagtgttt
tgacgttttg catacatttc tcaccgttat tttattcatt 44100tataatttag
agtttaagca gtatattcat tttgaaattt atgagatttc tgtctgcacg
44160cttacttcca tgcccaaaac atgtccgatt gagaacagaa ggtaattttg
tttgatcttt 44220gagatcagac acactgattg agtagtaaca ggaaacaagt
gctcaccaat caccaagtca 44280cttacaaaga atttcatgct tacaaaacac
actgattgtt aaggatagag actatgtttg 44340atctgcatag tttgaatttt
gattatgtca tcgtcgattg ttatcattaa cttttgttgg 44400aaatttctct
tgtagctatt tcattgtaat cgatggcatg caaacagatc agtggagcac
44460cattgaaact gccttcccag aaaacaatgt tgttagcagc agagtaattg
ttacaacaac 44520aatccggtca gtagctaatt cttgcagctc ttctaacggt
tatgtgcaca aaatgaaaag 44580acttagtgac gaacactcag agcaattgtt
tatcaagaaa gcttgcccaa caaaatattc 44640aggttatact cgaccggaat
caaaagaagt tctgaagaaa tgtgatggtc aaccacttgc 44700tcttgttact
atgggccaat tcttgaggaa aaatggttgg cccacaggac ccaactgcga
44760aaatgtgtgt agagatctta gacgacatct ggagcaggat gatacattgg
agagaatgcg 44820aagggtgctt atccacagct tatctagtct tcctagccat
gttcccaaag cctgcctttt 44880gtattttggt atgtttccat gtgatcatcc
cataaagagg aagagcctga tgaggcgatg 44940gttagcagag ggatttgtac
aaacacagcc ttcatctagt gaaaacttca acaccctcat 45000agaccggaat
attattgagc ccatcggcat atgtaacgat gatcaggtaa agacatgcaa
45060aacatatggc atgatgcacg agttcatttt gttaatgtcc acctcccatg
acttcattac 45120cctgctttgt aataataaag ttgaacacaa atatgtgcgt
cggctttctc tccatcatca 45180tagtgctaca agtggcagtt tttcggtcat
cgacttatct cttgttagat ctctgatggt 45240ttttggggag gctggcaaaa
ctattttgag tttccgaaag tacgagctat tgagagtctt 45300ggatcttgaa
caatgtaccg acttggaaga tgatcacctc aaagacatat gcaacctttt
45360tcttatgaaa tatctaagcc tcggagaaac tattagaagt cttccaaagg
agatagaaaa 45420actgaagctc ttggagacac ttgacttgag gagaacaaag
gtgaaaacac tacctataga 45480ggtcctcctg ctcccctgtt tactccatct
gtttgggaag ttccaatttt ctgataaaat 45540caagataaca agtgacatgc
agaagttttt cttaactgga cagagtaact tagagacact 45600ttcaggattt
atcacagatg ggtctcaagg attgccacag atgatgaatt acatgaattt
45660aagaaagctt aagatatggt ttgagaggag taagagaagc accaacttca
ccgatcttgt 45720gaatgctgtc caaaagttca tccatgatga caaagagagc
aatgatccac gttctctatc 45780acttcatttc gatgacggca ctgaaaacat
cctgaactct ttgaaggctc cttgttacct 45840taggtcattg aagttaaaag
ggaatttgct ggaacttccc cagtttgtca tatcaatgcg 45900gggtctccgg
gagatatgcc tttcatcaac aaaattgaca tcgggcctcc ttgcaacact
45960cgctaacttg aaaggcttgc agcatctcaa gctgattgca gatgtccttg
aagattttat 46020cattgaaggt caggcattcc tggggctgct acacctatgt
tttgtcctag aacgtgccac 46080cttaccaata attgaaggag gagctttgcc
gtacctcatc tcacttaagc taatctgcaa 46140agatctagtt ggcctcggtg
acatcaaaat caaccgcctc aaatgtctta aggaagtcag 46200tctagatcat
agagtcgctt cggaaacaag agaaatctgg gaaaaagctg ccgagaagca
46260tccaaaccgg ccgaaagtat tgttggtcaa ctcatctgat gaaagcgaaa
ttaaggctgt 46320agactgttct gttgcttcaa gaccagctgt gagtgaggct
aatggaactt ctcccatgtc 46380agaggttgat gtacgagagg atgacattca
gatgatactt aaccaggggc tctctgccgc 46440tgctgagaaa cagatgaatt
gtgcagttca gccaagttca aaagctgaac tgaactctga 46500tttcaataat
attagtttcc cagaggttgc gcttggttta accgagctgt gaattgcttg
46560gaattgaaat gtgtcttcat acacctattg atccttgatt gtccatggtc
agtttcgttg 46620cacttgcagc atattactat gaggctagta tcatgtaaat
tacaaatctt ttgttgttaa 46680ggccataaat tgcatattat agcacaacaa
gctggtatgt ctcaacaatg gcattaattt 46740tttttctgct tgaatctaca
aatttcatca ttattttgca atttcgcttt tatacagata 46800tggtgatgcc
atgtcatttt gactttgcag catatatgca agcaacggtt tgagttgctg
46860gagttgctag aatattgata caacttcagt ttactcgaag gctacaggga
tctcataact 46920aggatggttg aagataattt gcgattgttt ccttcagtgt
cactgaaaag acttttgtaa 46980caataaagca tacctttgct tcctactttt
ttgaagttac ttcagatgct aagttcgcag 47040ttgggcctgg actttatcat
gtttatccag ctgtttattt gtttcatgta caataatacc 47100ggtgattgct
gttgttatat aatctatatt tatactatag ttaaagtatc agtttcaacg
47160gttgtcccgc gccatctttt tacaaataat ccatcacaaa tatttcaaat
taacccgatg 47220cacgcctata gatggccaaa cggcggtccg gcacgggcca
gatgccttcg ggccacaact 47280ctggcccagg cacgtcatgc cgggtcagct
cattagcccg ttcgattaaa tcagcgtaaa 47340atgttaaaaa acagtgtaag
agttggagtt tgaacccatg ccctgattaa agaagggcaa 47400aagacacttg
gtgaagctat ctaaccaata gaacatcatg ctcaaatatt ttaatattga
47460atataaattg tatatatgta tatacatttt tttataaaat ttaaaaaatt
ataatcgtgt 47520cgggctgtgc cagcactacg gactgaggct acagcccaag
cacggcacga cgttcttggc 47580tcttgcaagc attagattgt ttctgagact
acattggcgc aatggactcg atggtgtttg 47640aggttgctga attggatgaa
gcaacaatga tttgtcacac taacagtaaa atgaaaggtt 47700atttgttatt
tttaaacgtt agttattgct acgaagtagc ataatttata tgaagtacat
47760ccagttttta ttgatgcctg actttaacaa tcacttcata ttttgatata
tcttttttat 47820aagtttgagt tcagtgactt attttagaaa tttgagctca
caaactttct cttatttggt 47880ctctgtatgg tggaattatg tcattttata
atttttgttc gttcagccag tcgttgtgaa 47940ctttcttcta actgctcact
tcattggccg tattgtacca agacatattg gatgtagtaa 48000accataacat
cagatagtta aatcaaaaaa atattatacg gagagcggag acaataaata
48060aaaaatcttg aaattttttg gtggatagtt tatataggta ttgttgtaag
ccgtcgcaac 48120gcacgtgtaa ccgactagta ctaagtgaat tccccacttg
tgggaattgt gagattgttt 48180ttatatgaac gaatattgta ggtaaatgag
taacataata ttccttttgt taacaccttg 48240atctggtacg tcaaaaccac
gtatgtacca tatgttttaa cttttgtatc tggtagaatg 48300gactgaagta
aagaatctca tccatcgact gctgctaata tatgcagctt cccagatcag
48360aggtcccaaa catgtcacca cttaccaatt aaatctctta tttacttggc
cttcccatga 48420aactagcaaa agttgctgtc tccacaaact gcaggtcaat
tcgtttcttt agcgccttat 48480ttcagaaacc gtggtagcat tgacatttta
ctcatctgga tagtttcggc ttgaatacgt 48540agcgtcttgt acatttattc
tctcacagta acagctaact cctgtgcaaa gatgcggctt 48600attccattgg
agaatagcgg actttttgtt ttatttagtt tcagctctct ggttgcaact
48660tgcaattagc cactctgccc ttttgcgtta cctacattct atctagcaag
gcagccaatg 48720tttctcattg ccaggtcact tgtttttgaa ggctgtgcgg
aagaaacatt tctacaaaca 48780aacaattaga actgacatta ccgaagaaac
agttaagtca aaagcttgtt ggttggatnn 48840nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnngt tcnttcttgc gttccgttgn 48900ttnnnnnnnn
gnnngnnggn aatnnnannn taaannagnn actnaatnnn aagnttatac
48960cnntagttta atttgtttac cctcccagga atattgcacg cctcgatgta
ggcctccact 49020cagactttat ttgggtactt tagtattggg gtttttatag
tggtgccctc ggttttgctg 49080gtgtgctcat ttttatcctt ggttccgctt
tattttgctc agttttgccc ttccagtgct 49140atagaacaga agggcaaaag
tgagcaaaaa aaaacacaac taaggataaa aatgagcaca 49200ccagcaaaac
cgagggcacc actataaaaa ccccaatact aaagtaccca aataaagtct
49260gagtggaggc ctaaatagag gcttgctaat tattagacct ttataactac
attaaataag 49320ataaaatatc cactgaaatt agaaaattga gtgaggtctg
tgcccccgct aagccgtcca 49380atgagggttc gtccgtcttc caacctgatt
aaataagata aaatatccac taaaattaga 49440aaaattgagt gcggtctgtg
cccccgctaa gccgcccaac ccaaccttga tgaatttcct 49500ggttcacaca
tatgtggtgt gattgaaggg ttacacgaaa aacctcacaa ccccgatggc
49560ctgtcttcgc tgaagtgtca ttcagtggtg atcaggaaca aatcccatcc
caaactcaag 49620cagagaacat tacaagttaa cataactgaa gttgaaccag
atggtggtca gaatgagaag 49680gcctgcaaca gtcaatttgt tctgattcct
tttgtgcagg ctgctacagg ttgttctcct 49740gacgagaaaa gcagttctaa
gccggttgaa ttcgtgcagg atgcatacaa cagaaccatg 49800cagactgaac
ctcattgtgg atggcaatat ttttttcaat ctctgatact agtaccaagt
49860cagcatgttt tgtccatccc catggcaatg gcatagagat agaactttct
ataaatagtc 49920ttgaggatca ggggacaagt caatcttgtg aaatcctaag
taatacggag tacaagtttg 49980tctgaaatat cacatcgagc gattgtgtgt
gcgcgcctac tagctcatga aagtcctggt 50040actgaagttt tcatttttct
caagtcataa attatgcagg atgttataac tccacagagg 50100gttatggagg
ggacaaatag agcaaaatgt ggatggaaac atagaacaca gcaggctgcg
50160gaaaaggaaa cataatctgt tcatccgctg acacaaaagc aagaacctct
atttgagtgg 50220aacctacaac ccattgtcac cgttgctcta ttgggtcttc
agaagaaatt ttgactagaa 50280tgttctaggc ggatggcgac ggcgattagg
catcgtttct ccttcatgaa 50330138507DNAArtificial SequenceMZA3434
Processed consensus sequence 138gtcatgtccc ccctcattag aggcgctact
ggacatgtgg aagctgccat gttcggctgc 60aacgacgcca cccaggtgta caaggagctg
caggaggcca tcaaatccta cccggacgcc 120ttccaccgcg tcatcggctt
cgacaacatc aagcagacgc agtgcgtcag cttcatcgcc 180tacaagcccc
cgggcagcga ctagaccgcg cccgccggcc gccccccgcc ggctagctag
240ctagctagct cctgcgtgag ctagtagcta gctagtgcca tgcgtcgtct
ctgtcgttcg 300gttttgcttc ggggtcaccg tgtacccttt gcttgcttgg
tttcttcttt ccttttttcc 360tttttttttt cttcttttcc ccggccatgg
ttcctttgct ttccagcagt tctctgctgg 420atgtaatgta tccattgttg
caagcatggc cttgcattgg ctacctctat acctgctaaa 480aaactactgc
aaatggtcat agctgtc 507139650DNAArtificial SequenceMZA2591 Processed
consensus sequence 139asggtaccaa ctaaaagggc ctggaatcat ggaagcccac
aataaccagg agcgagctac 60ctgcgaagcc acatctctcc ttcctcttca tcgatagtac
tcatctccat attcaggtaa 120ataacatcgt ctgcatgccg cgcgccccta
atagcatctc gatcacattt ttgtgttctt 180gacttctcct cggaagcctt
cttgtttaac aaacttatat tagtcgttgg tcgatctttg 240gacccacatg
taaatcttgg ttcgcgtccg ccgtgcagtg cagaggcaca agctaagcca
300tgagcaacgg tggtaaccgc agcaggggcg gcgcgaggtt cgagctgcag
ctgcacctgt 360cgccgccgcc gcccgtggct aggagggtgt aggtttactg
cgtatgctac tgcagcgact 420cgtcttcttc cccgagctcg tgcgtgtcgt
ctgactgcat tccagggagc aattcgccga 480ttgtaatcgg cgcctgcacg
cggtgcatga tgtactgcat ggtgtccaag aatgacttcc 540ccacctgcat
caactgcaag cagccctgcc tcgtgtacct cctccactgc tcttggcccc
600tgctgcagcg gcaccggcaa ggccaattaa aakgacttca acctttcgta
650140731DNAArtificial SequenceMZA11123 Processed consensus
sequence 140tcaaatcctg gggggaaacc ttccgggtgg gtcattgcaa aatgggcagt
ttatgggctc 60cttaatgatg gggggtcacg gttcgggggt tttttcggcc gggaccatgt
ttcggtctct 120tcttaatata ataccgggag gcagtttttc ctcctccccg
gccgcgtttt ttagtgtaaa 180tatgcaaatg taccatcttg attggcttct
atgatctaca ttttagtgta ggctgcaagt 240ccacgagctt tgaaaagtta
cacaatctgg attatttgca agtcgtaaac acttatagga 300ctcagtgact
agattggacc agcctgttgc attcatgcaa ttgttaggct aattgtcatt
360tcaccttcag tctacaatga aatggttaac atagtgcatg gatttcttcc
attggtacat 420caataataat atccaacagc gctaatgaga tgtacgtctt
gtttccagat gttacagatc 480caactgcaaa tggtgcagcg tggcgctgct
gggccgccca gtaacgagaa tactgagcac 540acagaagaat gactgaatct
gtgaacagac acttctgcat cgtggtgtaa taataaggag 600aatactgatg
agcacacacg ctgaagaatc tgtaaatagg cggcgatgag gatgggacaa
660aagaaagcca aggattggcg atacctgggc tggggaaact gtacgggtaa
aaacttaata 720agggggttta a 731141704DNAArtificial SequenceMZA15842
Processed consensus sequence 141taaccacccg cctggctaat tgttccgacc
atttttatag cctgcatggc ttacattgtc 60ttcacgaggg tcaacaggat attcagattg
cgcatttgga cttaaaacca gcaaatatat 120tacttgacag tgacatggtt
cctaaacttg ctgattttgg tatgtcaagg ctcttcagtc 180tcgaacaagt
ttatatcctt gcttccaagc ctatgggaac aatgtaagct cattaagttt
240actgaatgtg ctttcttgat cttatatggc ttgcaacacc tttgaaactt
atttggttta 300aaagacacat ttaattttcc ttcattagta catgtgtcct
gaagtataag gaaaccttag 360ttcgttaact caaaagattt ctatttggct
aagtttatag agaagagtat tagcatatac 420catattaaaa agctagctat
gaaaatatat ttcatagtgg gtttaatgat gatcatttga 480tactccctct
gccccaattt ataatccgtt taactttttt actctaagtt tgatcgactc
540gtcttattca aaacttatgc gagaaaatgg aaaattcaaa gccatactta
aagcatatta 600tatgctaaat gacatcacag taaaaattaa taacaattat
gattttttta ataggacgaa 660ttggtcaaag ttagggtaaa aaagtcaaac
aaattataaa ttgg 704142665DNAArtificial SequenceMZA1851 Processed
consensus sequence 142aaaaaggaaa tttttttttt taaaaaaaac ggaggctcta
acagggctct gggtagtggc 60ccaaactgtg ccaatatgga taatggaaga ttcttggggc
agagtattaa gggaagttgt 120ttttttcttc ttcttttggt tggtcttttt
aagctgaatg gatgacatga ttgcctatgt 180tatgtattgg gtaattttag
ttgtcaaaat atatctttac agctatacgc tatcgctgtg 240ctctgagcac
ctcaaaacat ccaggtgatg acatctacac atggggttgg ggaggcgcca
300atgggacttt tttcgaagag ggccattctt ccggtggaca gctggtgagt
tgctttcaga 360ccacaactgt ttccgcttga tggcaacaat gtgcggcatg
cataatcccc acaggacacc 420attcatatgg atatggtcga actgacttgc
tacttgcagg gacatggaaa cgacgtagac 480tattttgagc ctatgatggt
tccctttggc acgaatgcca gagccgtcca tgtatcgtgt 540ggcttcaatc
atactggtgc aatttacgag tgctccgagg actttgactg acgtgagact
600tgcagacagc agatccgcat gtcttggaga cttaggttag ttatcaaata
tactcgctga 660ggaaa 665143698DNAArtificial SequenceMZA8761
Processed consensus sequence 143tgccaaaggg ggaacagtta aggctttata
gaagggraag atttggttca ggtaactggg 60ctcacatttg ttactatttg gaatcatagg
ggttcaagca tttaaaaaga actgggatcc 120ctaccaccag tttggagtgt
tccacaaata cacttttatg tccttgggca tcgccaaggg 180ctgctttttt
ttctttgggt attcctgtta actcagatgc tcaaaaattg ggacaatatt
240gacatgccct cttgattaga agtgtttgta gtttgtaatt tgcatcttat
actttcatga 300gtactcgagc cattgttgtg ttctcagttg atgtaatttc
attatttaaa cttcttgttg 360ggttgtctaa tggaatgcaa aaaaaatact
tgaaaaatga cagatagcag atccagcagc 420aattgaggca atggtagata
aagtaattgc tgataatcca aagcaacttg agcagtaccg 480tgctggaaaa
actaagctac aaggattttt tgctggccag gtttgtcaat tgatgactag
540cactgtttgt cccttcagct aggatgtatt atcagtgatc atatttgttt
caattgatta 600taggtgatga aagcatcgaa gggaaggcca acccagtttt
gttgaataaa attcttgaaa 660aattcttgga gagaagtttt tgctaaattt tatataaa
698144521DNAArtificial SequenceMZA11455 Processed consensus
sequence 144ttgaggcaat ttaaataagc attgcaggga aggcccagta caaacgttca
accttctgac 60tgacacatgt tgtggaacta accctcagca taggagcaag agaaaaatga
ctgggaagag 120aatgactggg aagagagatt gtttgcatgc acgtagcaga
tatctgagag ctacagagga 180aagctgggaa atagaagaag ctctaaaaca
aggagtgttt ctggaaattc tttagttttc 240aaaaaacact ttctgaaaat
gtgtgtacaa gaaaattcca ggaaggtgaa attgcttcgt 300tgactgcagt
gggaagggga aagagagaag ctagaatctc atgtcgagta atccagtaca
360atgtgttctt ttgtctggtc taaattcttg taacagctct tcctatgatg
gaagaatcca 420ttcaacaatt ccacctatga ttactggatt gagtatgttg
aataggttgg ttgaggctat 480ctagtaattt tatgactatt taatttattt
ataactattt a 52114518DNAArtificial SequenceOligonucleotide primer
C00060-01-F1 145ggtcttcgcc ggcctttc 1814625DNAArtificial
SequenceOligonucleotide primer C00060-02-F1 146ggtcagtagc
taattcttgc agctc 2514717DNAArtificial SequenceOligonucleotide
primer C00060-01-F-Taq 147tcttcgccgg cctttct 1714826DNAArtificial
SequenceOligonucleotide primer C00060-02-F-Taq 148cagagcaatt
gtttatcaag aaagct
2614918DNAArtificial SequenceOligonucleotide primer C00060-01-R1
149gggaccgtcg atgccgac 1815029DNAArtificial SequenceOligonucleotide
primer C00060-02-R1 150tttcctcaag aattggccca tagtaacaa
2915122DNAArtificial SequenceOligonucleotide primer C00060-01-R-Taq
151gcggatcaga tacagacgaa ca 2215224DNAArtificial
SequenceOligonucleotide primer C00060-02-R-Taq 152ggttgaccat
cacatttctt caga 2415325DNAArtificial SequenceOligonucleotide primer
FLP111RB 153caggttatac tcgaccggaa tcaaa 2515430DNAArtificial
SequenceOligonucleotide probe C00060-01-PCA 154acggacgcgg
aggaacagga agacgattca 3015529DNAArtificial SequenceOligonucleotide
probe C00060-02-PCA 155acggacgcgg agctcgaccg gaatcaaaa
2915626DNAArtificial SequenceOligonucleotide probe C00060-01-P-Taq
156cctctacccg gcacactgaa tcgtct 2615732DNAArtificial
SequenceOligonucleotide probe C00060-02-P-Taq 157cccaacaaaa
tattcaggtt atactcgacc gg 32158259DNAArtificial SequenceSNP Sequence
for Marker PHD0001-01 158tttagaaact cagctagtgc ttttggcaac
caaaccccac agccaaacag ctgcatgtct 60agaggtagag gagtagactc ctcacaccgg
gtaagtctag ctgagtatta gtatactcag 120ccttgcttgt ggcataattt
ttacaggttc tctggaggaa atggttgctg gagtgacttg 180gccgtccatc
ttgccaccgg gttggactgt cgagtgggac cctgccttgg ctgaggagga
240gcatgaggag tgatgggac 25915934DNAArtificial SequenceInvader Oligo
for Marker PHD0001-01 159tgccacaagc aaggctgagt atactaatac tcat
3416026DNAArtificial SequenceInvader Probe for Marker PHD0001-01
160cgcgccgagg gctagactta cccggt 2616122DNAArtificial
SequenceForward Oligonucleotide Primer for Marker PHD0001-01
161tagtgctttt ggcaaccaaa cc 2216222DNAArtificial SequenceReverse
Oligonucleotide Primer for Marker PHD0001-01 162ccatttcctc
cagagaacct gt 22163259DNAArtificial SequenceSNP Sequence for Marker
PHD0002-01 163ggcttcccca tctctctatt tatttaccgt tagtttattt
ccgctgcact tcgaacaatg 60atggttactt ttgcaaaaac tccgaggatg atgatgatgg
tgatgtaata atttaatact 120ctgacatgta tggttttatg ctttattgta
tttgctctgt gactcacctt cgagtgagat 180tgtggtactt gatcctgtca
gtggccgtgt cggactagat ccgagggatt gacgggttat 240tcccaattaa gtgtggtct
25916436DNAArtificial SequenceInvader Oligo for Marker PHD0002-01
164ggccactgac aggatcaagt accacaatct cactct 3616527DNAArtificial
SequenceInvader Probe for Marker PHD0002-01 165cgcgccgagg
gaaggtgagt cacagag 2716623DNAArtificial SequenceForward
Oligonucleotide Primer for Marker PHD0002-01 166ggatgatgat
gatggtgatg taa 2316722DNAArtificial SequenceReverse Oligonucleotide
Primer for Marker PHD0002-01 167ccgtcaatcc ctcggatcta gt
22168269DNAArtificial SequenceSNP Sequence for Marker PHD0003-01
168acgctgctgc gacaaggccc tcgcccgcat ccccactcga ggggcgagga
caagctatca 60aagccgaaga gccggaggtc cgaccgcagg tggcgccgag aaaccttctc
tggctgccac 120cacctcagca ccgacgacgg cagccacctg cccaccaaca
cccgccgggc cgtgaccaat 180gtgctcggtt ggcactgttg ggtcatgcgc
agggttgcct cgagtcgcgg caccggttcc 240gcagtcgaga aggcgcggga ggaggcgcg
26916921DNAArtificial SequenceInvader Oligo for Marker PHD0003-01
169tggctgccgt cgtcggtgct t 2117024DNAArtificial SequenceInvader
Probe for Marker PHD0003-01 170cgcgccgagg gaggtggtgg cagc
2417122DNAArtificial SequenceForward Oligonucleotide Primer for
Marker PHD0003-01 171ggacaagcta tcaaagccga ag 2217220DNAArtificial
SequenceReverse Oligonucleotide Primer for Marker PHD0003-01
172caaccgagca cattggtcac 20173279DNAArtificial SequenceSNP Sequence
for marker PHD0004-01 173cacgaacacc ccaaaccaca tgccgaggct
gtagagtcgc cccagggttg aatcgaccga 60ggcggtcatt tctcccctga ccacggcgaa
gagcggcacg gtgcgcaact ggttttcctg 120atagtgggca ccggcgtgaa
attaggccgc caactcgcgc cccgatgcac cgacccacaa 180tcgccaaggc
ttctgctgcg caaacgagtt ccccgctgtg atggccgaag cacagcacag
240caggtggacg gcagcggacc agtcgcggcg gcgcacaga 27917424DNAArtificial
SequenceInvader Oligo for marker PHD0004-01 174tggcggccta
atttcacgcc ggtt 2417528DNAArtificial SequenceInvader Probe for
marker PHD0004-01 175cgcgccgagg gcccactatc aggaaaac
2817621DNAArtificial SequenceForward oligonucleotide primer for
marker PHD0004-01 176ggtcatttct cccctgacca c 2117719DNAArtificial
SequenceReverse oligonucleotide primer for marker PHD0004-01
177agcagaagcc ttggcgatt 19178300DNAArtificial SequenceSNP Sequence
for marker PHD0005-01 178ttggggcgag cagggaggag aagaggaaca
gcggcttcgg gtgttatagg cgcagggtaa 60aggaggggac gaacaggtca cgctggcgcg
atgccgcacc tatatgacga gtccgggctg 120aggacgttaa ccgggcggcg
ctagaatcct ggggcttcgg cagaggccgt tgcgggagta 180gcggcgggca
ggtgtgccgc cagcgctgta cgcggggtcg gggcacggag gttgttgcgc
240taggggtccg cgatttccgt gaatcgggca cgagctcacc agcgccaccg
gttttgcgca 30017923DNAArtificial SequenceInvader Oligo for marker
PHD0005-01 179cgctactccc gcaacggcct ctt 2318022DNAArtificial
SequenceInvader Probe for marker PHD0005-01 180cgcgccgagg
gccgaagccc ca 2218122DNAArtificial SequenceForward oligonucleotide
primer for marker PHD0005-01 181ctatatgacg agtccgggct ga
2218219DNAArtificial SequenceReverse oligonucleotide primer for
marker PHD0005-01 182acccctagcg caacaacct 19183290DNAArtificial
SequenceSNP sequence for marker PHD0006-01 183cgaagcggag gaaatgtagg
gagggagaag aagaccactg ccggctgggt ggataagtta 60gctgggtgac cctggaatgt
ggggcccgcc tggcggcgac gcgaaggcca cacgagcgag 120tgaggggcgt
tgggtcgtgc ggtatcggaa aaaaaagaat gggccgaaag tgaggattcg
180gcccaagtag tgttttattg tttttctttt tcttattttt tttcaaattc
aactttaaat 240tcccatttaa attcaaattt agtggtggat ctatcttcac
attaatttcc 29018423DNAArtificial SequenceInvader oligo for marker
PHD0006-01 184tcgctcgtgt ggccttcgcg tct 2318521DNAArtificial
SequenceInvader probe for marker PHD0006-01 185cgcgccgagg
gccgccaggc g 2118622DNAArtificial SequenceForward oligonucleotide
primer for marker PHD0006-01 186ggctgggtgg ataagttagc tg
2218721DNAArtificial SequenceReverse oligonucleotide primer for
marker PHD0006-01 187cactttcggc ccattctttt t 21188300DNAArtificial
SequenceSNP Sequence for marker PHD0007-01 188caacttaaac atggcatggg
tgaacttatt tattttcaat atttatttta ttaaaactag 60tgctatgttt ctccaaatta
gagtttaaat gctatgtgtc ccttaatata ttaatatatg 120ggtactaaca
catttatttt actatccaca aatgcacaat caagtaaaaa ctcagcatga
180tgcataattt atttgagtgt cttctattaa ttatttattg tatagatgag
gtgtccacat 240gaaatggtaa atagggataa cccacacaca tgtaaaggaa
tataatctct ccttttagat 30018958DNAArtificial SequenceInvader oligo
for marker PHD0007-01 189tttctccaaa ttagagttta aatgctatgt
gtcccttaat atattaatat atgggtat 5819036DNAArtificial SequenceInvader
probe for marker PHD0007-01 190cgcgccgagg ctaacacatt tattttacta
tccaca 3619122DNAArtificial SequenceForward oligonucleotide primer
for marker PHD0007-01 191ttaaacatgg catgggtgaa ct
2219224DNAArtificial SequenceReverse oligonucleotide primer for
marker PHD0007-01 192tgcatcatgc tgagttttta cttg
24193274DNAArtificial SequenceSNP Sequence for marker PHD0008-01
193cggcggccac aagtcagtcg ccgaaaatta cctgttcttt tcggtgggcc
tctgacggcc 60gccgaaaata acaagtgccg aaaatagtat ttaaaaatac aaaaaataac
agaaaattca 120tacaataaca gaaaattcat acttgagtcc acaacataaa
acttaagtcc atacaaacat 180aaagtccaca aatagtccat acaaacataa
agtccacaaa tagtccatta caaagcacaa 240tgccgcacaa agctaactcc
atcacatatc gggg 27419451DNAArtificial SequenceInvader oligo for
marker PHD0008-01 194tttgtatgga ctatttgtgg actttatgtt tgtatggact
taagttttat t 5119529DNAArtificial SequenceInvader probe for marker
PHD0008-01 195cgcgccgagg gttgtggact caagtatga 2919622DNAArtificial
SequenceForward oligonucleotide primer for marker PHD0008-01
196cgaaaataac aagtgccgaa aa 2219723DNAArtificial SequenceReverse
oligonucleotide primer for marker PHD0008-01 197ggcattgtgc
tttgtaatgg act 23198259DNAArtificial SequenceSNP sequence for
marker PHD0009-01 198cgttggagtt gtgtccacta ccttcagaag cgaaaaactc
gttgacgaag tcgtgtaacg 60ggtttagatt ctaaagaaaa aagaagacat taataacgat
attagttaca tgtatgacca 120ctattcaaac aaattgtttc tcaaactaac
ctctcatgga gtagctccct cccctgcata 180tgctcctcct ggtgctggta
tgagcggtgg tggcgtgttg tggcccatga ccccggatcc 240ctacaaaatc aagtttagt
25919949DNAArtificial SequenceInvader oligo for marker PHD0009-01
199gggagctact ccatgagagg ttagtttgag aaacaatttg tttgaatat
4920034DNAArtificial SequenceInvader probe for marker PHD0009-01
200cgcgccgagg gtggtcatac atgtaactaa tatc 3420124DNAArtificial
SequenceForward oligonucleotide primer for marker PHD0009-01
201aagtcgtgta acgggtttag attc 2420219DNAArtificial SequenceReverse
oligonucleotide primer for marker PHD0009-01 202cagcaccagg
aggagcata 19203250DNAArtificial SequenceSNP sequence for marker
PHD0010-01 203aaagatttga aattagattg atacaaacga caagtcttaa
ctaaattgaa gcacctgagg 60tggaggtggc ggagcatgta atccccactg aggcatcgac
ggctgaaact gagggaaaac 120aaatggttgt tgttgtgcct gctgtggaaa
ccaagaccgt tgcaaatata atatgttagt 180tatagaacca atatcgagcg
tgttgagaag aaataagaca ctcacgttca ttgcttgttg 240ggcctgtgcg
25020434DNAArtificial SequenceInvader oligo for marker PHD0010-01
204gcaggcacaa caacaaccat ttgttttccc tcat 3420526DNAArtificial
SequenceInvader probe for marker PHD0010-01 205cgcgccgagg
gtttcagccg tcgatg 2620622DNAArtificial SequenceForward
oligonucleotide primer for marker PHD0010-01 206ggagcatgta
atccccactg ag 2220722DNAArtificial SequenceReverse oligonucleotide
primer for marker PHD0010-01 207tctcaacacg ctcgatattg gt
22208259DNAArtificial SequenceSNP sequence for marker PHD0011-01
208atttccggcg gttgtggcag gccgccaaaa atagcagata attttcggcg
gctataggtg 60ggccatcgaa aattacattg gccgccgaaa atgttcaaca gtgttgttgt
gatagcaacc 120aacaggtatg agccacaata ctacacattg caacttggga
aagtaattta ctggtcacca 180tatttccgaa tagctggtta tgatatgata
tttacaaatc ttccaattca ttccttcagc 240ttaaatgaat ctcattaat
25920940DNAArtificial SequenceInvader oligo for marker PHD0011-01
209agttgcaatg tgtagtattg tggctcatac ctgttggttt 4021029DNAArtificial
SequenceInvader probe for marker PHD0011-01 210cgcgccgagg
gctatcacaa caacactgt 2921122DNAArtificial SequenceForward
oligonucleotide primer for marker PHD0011-01 211taggtgggcc
atcgaaaatt ac 2221224DNAArtificial SequenceReverse oligonucleotide
primer for marker PHD0011-01 212ttcggaaata tggtgaccag taaa
24213269DNAArtificial SequenceSNP sequence for marker PHD0012-01
213ttgtaaaaaa caaggttttg taaatggatt tatttttatg ctcaaactta
aattgaacaa 60ttcaatcacg cacaattgct atgctgacag aagtttatga caagtttgag
cataatgttg 120taataataat gagacccttc atgatcttgt tgttattcca
catttccatc tctcctcgaa 180gcatagcagt gcccaccatt ttctaccgag
tcagcaacaa taatctaggc tgaaagaaca 240atggacaaca gcttcgtgtg ttgtccatc
26921451DNAArtificial SequenceInvader oligo for marker PHD0012-01
214gtggaataac aacaagatca tgaagggtct cattattatt acaacattat t
5121531DNAArtificial SequenceInvader probe for marker PHD0012-01
215cgcgccgagg gctcaaactt gtcataaact t 3121622DNAArtificial
SequenceForward oligonucleotide primer for marker PHD0012-01
216tcaatcacgc acaattgcta tg 2221722DNAArtificial SequenceReverse
oligonucleotide primer for marker PHD0012-01 217agaaaatggt
gggcactgct at 22218259DNAArtificial SequenceSNP sequence for marker
PHD0013-01 218tacaatattt gcctatggtg ttacaaggag tggaaagata
catacgatgc atgtgggaaa 60acttattaca atatttttcc tttaataagt tttacctttg
tagagtgtat gtttctagtc 120ataggctttg aagtatgcct catgctacca
attaacatgc aaaaacttgg actaatctta 180ctgatactaa gatctaacat
agttgtcaac ctccttggtt ggacatttta gttgcttttg 240ttgtattaag cttttaatt
25921945DNAArtificial SequenceInvader oligo for marker PHD0013-01
219ccaagttttt gcatgttaat tggtagcatg aggcatactt caaat
4522031DNAArtificial SequenceInvader probe for marker PHD0013-01
220cgcgccgagg gcctatgact agaaacatac a 3122122DNAArtificial
SequenceForward oligonucleotide primer for marker PHD0013-01
221acatacgatg catgtgggaa aa 2222222DNAArtificial SequenceReverse
oligonucleotide primer for marker PHD0013-01 222aatgtccaac
caaggaggtt ga 22223269DNAArtificial SequenceSNP sequence for marker
PHD0014-01 223attggatttg tggtggggtg cgtgggcggg catcacgcgt
ggcgatggca ctggaagcac 60ggggaacagg gcaggtgtag ggtgggggca ggcgatggaa
tggcgcggca tgcttgcggc 120cgattgtcct tgcgtggatg gaggggattg
cgggctcgag gatgaggatg gcgggatgcg 180cgcgcctttc gtcgatcgaa
cgtgggcacg ggacgaggat tgcattgcgc ggccacgcgg 240gggcgagatt
ggcgtcgtcg gtgggatgt 26922424DNAArtificial SequenceInvader oligo
for marker PHD0014-01 224ccgccatcct catcctcgag ccct
2422525DNAArtificial SequenceInvader probe for marker PHD0014-01
225cgcgccgagg gcaatcccct ccatc 2522618DNAArtificial SequenceForward
oligonucleotide primer for marker PHD0014-01 226cttgcggccg attgtcct
1822718DNAArtificial SequenceReverse oligonucleotide primer for
marker PHD0014-01 227accgacgacg ccaatctc 18228210DNAArtificial
SequenceSNP sequence for marker PHD0015-01 228aattgctatt ttagcccttc
taacgtgggc tctctgctat tatgtgaccc tctgtctatg 60acttgtgtga ccatttgtgt
ctatgatttg tgggactggt ggtaaaatag agaagttcac 120aactgagagt
gacaaaatag caaattctcc cacgggggcg ggggcacgac gcaccagtgt
180ggacgtccac actatagcct tatagagtag 21022939DNAArtificial
SequenceInvader oligo for marker PHD0015-01 229cccgtgggag
aatttgctat tttgtcactc tcagttgtt 3923032DNAArtificial
SequenceInvader probe for marker PHD0015-01 230cgcgccgagg
gaacttctct attttaccac ca 3223124DNAArtificial SequenceForward
oligonucleotide primer for marker PHD0015-01 231tgacttgtgt
gaccatttgt gtct 2423219DNAArtificial SequenceReverse
oligonucleotide primer for marker PHD0015-01 232gtccacactg
gtgcgtcgt 19
* * * * *
References