Polynucleotides And Methods For Making Plants Resistant To Fungal Pathogens

Abstract

This invention relates to polynucleotide sequences encoding a gene that can confer resistance to the plant pathogen Colletotrichum, which causes anthracnose stalk rot, leaf blight and top dieback in corn and other cereals. It further relates to plants and seeds of plants carrying chimeric genes comprising said polynucleotide sequences, which enhance or confer resistance to the plant pathogen Colletotrichum, and processes of making said plants and seeds. The invention further presents sequences that can be used as molecular markers that in turn can be used to identify the region of interest in corn lines resulting from new crosses and to quickly and efficiently introgress the gene from corn lines carrying said gene into other corn lines that do not carry said gene, in order to make them resistant to Colletotrichum and resistant to stalk rot.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. application Ser. No. 14/538,238 filed Nov. 11, 2014, which is a continuation of U.S. application Ser. No. 13/270,722 filed Oct. 11, 2011, now granted as U.S. Pat. No. 8,884,126, which is a continuation of U.S. application Ser. No. 11/774,121 filed Jul. 6, 2007, now granted as U.S. Pat. No. 8,084,671, which is a continuation of U.S. application Ser. No. 11/397,247 filed Apr. 4, 2006 and also claims priority to and the benefit of U.S. Provisional Application Nos. 60/668,241 and 60/675,664, filed on Apr. 4, 2005 and Apr. 28, 2005 respectively, which are herein incorporated by reference in their entirety.

THE NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT

[0002] A joint Research Project Agreement was executed on Feb. 18, 2002 for map-based cloning and gene expression studies of a maize gene(s) that confer(s) resistance to ASR. The names of the parties executing the joint Research Project Agreement are the University of Delaware and E.I. du Pont de Nemours and Company.

FIELD OF THE INVENTION

[0003] This invention relates to compositions and methods useful in creating or enhancing pathogen-resistance in plants. Additionally, the invention relates to plants that have been genetically transformed with the compositions of the invention.

BACKGROUND OF THE INVENTION

[0004] Colletotrichum graminicola (Ces.) (Cg), more commonly known as anthracnose, is the causative agent of anthracnose leaf blight, anthracnose stalk rot (ASR) and top dieback that affects Zea mays (L.), also known as maize or corn. It is the only known common stalk rot that also causes a leaf blight (Bergstrom, et al, (1999), Plant Disease, 83:596-608, White, D. G. (1998), Compendium of Corn Diseases, pp. 1-78). It has been known to occur in the United States since 1855 and has been reported in the Americas, Europe, Africa, Asia, and Australia (McGee, D. C. (1988), Maize Diseases: A Reference Source for Seed Technologists, APS Press, St. Paul, Minn.; White, (1998) supra; White, et al., (1979) Proc. Annu. Corn Sorghum Res Conf (34th) 1-15). In the United States alone, over 37.5 million acres are infested annually with average yield losses of 6.6% nationwide (See FIG. 1). The yield losses are due both to low kernel weight in infected plants and "lodging," that is, the falling over of the plants due to weakness in the stalks caused by the infection (Dodd, J., (1980), Plant Disease, 64:533-537). Lodged plants are more difficult to harvest and are susceptible to other diseases. After infection, typically the upper portion of the stalk dies first while the lower stalk is still green. Externally, infection can be recognized by blotchy black patches on the outer rind of the stalk, while internally the pith tissue is discolored or black in appearance. Inoculation occurs in a number of ways. Roots may grow through stalk debris and become infected. This will become an increasing problem as "no till" methods of agriculture are more widely adopted due to their environmental benefits. The fungus may also infect the stalks through insect damage and other wounds (White (1998) supra). Stalk infection may be preceded by leaf infection causing leaf blight and providing inoculum for stalk infection. There is controversy in the technical literature as to the number of different varieties or races of Cg present in nature. The pathogen is transmitted by wind or contaminated seed lots. Spores remain viable for up to 2 years (McGee (1988) supra; Nicholson, et al., (1980), Phytopathology, 70:255-261; Warren, H. L. (1977), Phytopathology, 67:160-162; Warren, et al., (1975), Phytopathology, 65:620-623).

[0005] Farmers may combat infection by corn fungal diseases such as anthracnose through the use of fungicides, but these have environmental side effects, and require monitoring of fields and diagnostic techniques to determine which fungus is causing the infection so that the correct fungicide can be used. Particularly with large field crops such as corn, this is difficult. The use of corn lines that carry genetic or transgenic sources of resistance is more practical if the genes responsible for resistance can be incorporated into elite, high yielding germplasm without reducing yield. Genetic sources of resistance to Cg have been described. There have been several maize lines identified that carry some level of resistance to Cg (White, et al. (1979) supra). These included A556, MP305, H21, SP288, CI88A, and FR16. A reciprocal translocation testcross analysis using A556 indicated that genes controlling resistance to ASR lie on the long arms of chromosomes 1, 4, and 8 as well as both arms of chromosome 6 (Carson, M. L. (1981), Sources of inheritance of resistance to anthracnose stalk rot of corn. Ph.D. Thesis, University of Illinois, Urbana-Champaign). Introgression of resistance derived from such lines is complex. Another inbred, LB31, was reported to carry a single dominant gene controlling resistance to ASR but appears to be unstable, especially in the presence of European corn borer infestation (Badu-Apraku et al., (1987) Phytopathology 77: 957-959). The line MP305 was found to carry two dominant genes for resistance, one with a major effect and one with a minor effect (Carson (1981) supra). MP305 has been made available by the University of Mississippi through the National Plant Germplasm System (GRIN ID: NSL 250298) operated by the United States Department of Agriculture. See Compilation of North American Maize Breeding Germplasm, J. T. Gerdes et al., Crop Science Society of America, 1993. Seed of MP305 can be obtained through W. Paul Williams, Supervisory Research Geneticist USDA-ARS, Corn Host Plant Resistance Research Unit, Box 9555, 340 Dorman Hall, Mississippi State, Miss. 39762.

[0006] It has been reported that there are two genes linked on the long arm of chromosome 4 that confer resistance to Cg (Toman, et al., (1993), Phytopathology, 83:981-986; Cowen, N et al. (1991) Maize Genetics Conference Abstracts 33). A significant resistance quantitative trait locus (QTL) on chromosome 4 has also been reported (Jung, et al., (1994), Theoretical and Applied Genetics, 89:413-418). Jung et al. (supra) reported that UMC15 could be used to select for the QTL on chromosome 4 in MP305, and suggested that the QTL is on a 12cM region of chromosome 4 between UMC15 and UMC66. In fact, as discussed in more detail below, the region between UMC15 and UMC66 as reported on the IBM2 neighbors 4 genetic map is approximately 129 cM, and selection for the QTL in the manner suggested by Jung et al. (1994, supra) would at best select a large chromosomal interval with considerable linkage drag and negative phenotypic effect, and at worst, a double recombination could occur between the two markers resulting in a false positive selection for the Rcg1 locus.

[0007] Much work has been done on the mechanisms of disease resistance in plants in general. Some mechanisms of resistance are non-pathogen specific in nature, or so-called "non-host resistance." These may be based on cell wall structure or similar protective mechanisms. However, while plants lack an immune system with circulating antibodies and the other attributes of a mammalian immune system, they do have other mechanisms to specifically protect against pathogens. The most important and best studied of these are the plant disease resistance genes, or "R" genes. One of very many reviews of this resistance mechanism and the R genes can be found in Bekhadir et al., (2004), Current Opinion in Plant Biology 7:391-399. There are 5 recognized classes of R genes: intracellular proteins with a nucleotide-binding site (NBS) and a leucine-rich repeat (LRR); transmembrane proteins with an extracellular LRR domain (TM-LRR); transmembrane and extracellular LRR with a cytoplasmic kinase domain (TM-CK-LRR); membrane signal anchored protein with a coiled-coil cytoplasmic domain (MSAP-CC); and membrane associated kinases with an N-terminal myristylation site (MAK-N) (See, for example: Cohn, et al., (2001), Immunology, 13:55-62; Dangl, et al. (2001), Nature, 411:826-833).

[0008] The resistance gene of the embodiments of the present invention encodes a novel R gene related to the NBS-LRR type. While multiple NBS-LRR genes have been described, they differ widely in their response to different pathogens and exact action. To Applicants' knowledge, the novel R gene described in this disclosure is the only one demonstrated to provide resistance to Cg.

SUMMARY OF THE INVENTION

[0009] Embodiments of this invention are based on the fine mapping, cloning and characterization of the gene responsible for the major portion of the resistance phenotype from the line MP305, the introgression of a truncated chromosomal interval with the MP305 resistance locus into other lines with little or no linkage drag, the demonstration of the use of that gene as a transgene and the use of molecular markers to move the gene or transgene into elite lines using breeding techniques.

[0010] Embodiments include an isolated polynucleotide comprising a nucleotide sequence encoding a polypeptide capable of conferring resistance to Colletotrichum, wherein the polypeptide has an amino acid sequence of at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, and at least 95% identity, when compared to SEQ ID NO:3 or the sequences deposited with the Agricultural Research Service (ARS) Culture Collection on Feb. 22, 2006 as Patent Deposit No. NRRL B-30895, based on the Needleman-Wunsch alignment algorithm, or a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

[0011] Additional embodiments of the present invention include a vector comprising the polynucleotide of an embodiment of the present invention, such as SEQ ID NO: 3, or the sequences of the plasmid deposited as Patent Deposit No. NRRL-30895, and a recombinant DNA construct comprising the polynucleotide of an embodiment of the present invention operably linked to at least one regulatory sequence. A plant cell, as well as a plant, each comprising the recombinant DNA construct of an embodiment of the present invention, and a seed comprising the recombinant DNA construct are also embodied by the present invention.

[0012] The methods embodied by the present invention include 1) a method for transforming a host cell, including a plant cell, comprising transforming the host cell with the polynucleotide of an embodiment of the present invention, 2) a method for producing a plant comprising transforming a plant cell with the recombinant DNA construct of an embodiment of the present invention and regenerating a plant from the transformed plant cell, and 3) methods of conferring or enhancing resistance to Colletotrichum and/or stalk rot, comprising transforming a plant with the recombinant DNA construct of an embodiment of the present invention, thereby conferring and/or enhancing resistance to Colletotrichum or stalk rot.

[0013] Additional embodiments include methods of determining the presence or absence of the polynucleotides of an embodiment of the present invention, or the Rcg1 locus, in a corn plant, comprising at least one of (a) isolating nucleic acid molecules from the corn plant and determining if an Rcg1 gene is present or absent by amplifying sequences homologous to the polynucleotide, (b) isolating nucleic acid molecules from the corn plant and performing a Southern hybridization, (c) isolating proteins from the corn plant and performing a western blot using antibodies to the Rcg1 protein, (d) isolating proteins from the corn plant and performing an ELISA assay using antibodies to the Rcg1 protein, or (e) demonstrating the presence of mRNA sequences derived from the Rcg1 mRNA transcript and unique to Rcg1, thereby determining the presence of the polynucleotide or the Rcg1 locus in the corn plant.

[0014] Methods of altering the level of expression of a protein capable of conferring resistance to Colletotrichum or stalk rot in a plant or plant cell comprising (a) transforming a plant cell with the recombinant DNA construct of an embodiment of the present invention and (b) growing the transformed plant cell under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of a protein capable of conferring resistance to Colletotrichum or stalk rot in the transformed host are also embodied by the present invention.

[0015] An additional method embodied by the present invention is a method of conferring or enhancing resistance to Colletotrichum and/or stalk rot in a corn plant, comprising (a) crossing a first corn plant lacking the Rcg1 locus with a second corn plant containing the Rcg1 locus to produce a segregating population, (b) screening the segregating population for a member containing the Rcg1 locus with a first nucleic acid, not including UMC15a or UMC66, capable of hybridizing with a second nucleic acid linked to or located within the Rcg1 locus, and (c) selecting the member for further crossing and selection.

[0016] Methods of enhancing resistance to Colletotrichum and/or stalk rot, or introgressing Colletotrichum and/or stalk rot resistance into a corn plant, comprising performing marker assisted selection of the corn plant with a nucleic acid marker, wherein the nucleic acid marker specifically hybridizes with a nucleic acid molecule having a first nucleic acid sequence that is linked to a second nucleic acid sequence that is located on the Rcg1 locus of MP305 and selecting the corn plant based on the marker assisted selection are also embodiments of the present invention. Specific FLP, MZA and Rcg1 specific SNP markers disclosed herein are further aspects of the invention.

[0017] Additional embodiments are an improved donor source of germplasm for introgressing resistance or enhancing resistance to Colletotrichum or stalk rot into a corn plant, said germplasm comprising DE811ASR (BC5) and progeny derived therefrom. Said progeny can be further characterized as containing the DE811ASR (BC5) Rcg1 sequences disclosed herein, molecular markers in or genetically linked to Rcg1, resistance or enhanced resistance to Colletotrichum, or any combinations thereof.

[0018] Further embodiments include processes for identifying corn plants that display newly conferred or enhanced resistance to Colletotrichum by detecting alleles of at least 2 markers in the corn plant, wherein at least one of the markers is on or within the chromosomal interval below UMC2041 and above the Rcg1 gene, and at least one of the markers is on or within the interval below the Rcg1 gene and above UMC2200. Similar embodiments encompassed by this process include at least one of the markers being on or within the chromosomal interval below UMC1086 and above the Rcg1 gene, on or within the chromosomal interval below UMC2285 and above the Rcg1 gene, and at least one of the markers is on or within the interval below the Rcg1 gene and above UMC2200, on or within the interval below the Rcg1 gene and above UMC2187, or on or within the interval below the Rcg1 gene and above UMC15a. Further embodiments related to the same process include those in which at least one of the markers is capable of detecting a polymorphism located at a position corresponding to nucleotides 7230 and 7535 of SEQ ID NO: 137, nucleotides 11293 and 12553 of SEQ ID NO: 173, nucleotides 25412 and 29086 of SEQ ID NO: 137, or nucleotides 43017 and 50330 of SEQ ID NO: 137.

[0019] Further embodiments include processes for identifying corn plants that display newly conferred or enhanced resistance to Colletotrichum by detecting alleles of at least 2 markers in the corn plant, wherein at least one of the markers on or within the chromosomal interval below UMC2041 and above the Rcg1 gene is selected from the markers listed in Table 16, and at least one of the markers on or within the interval below the Rcg1 gene and above UMC2200 is also selected from the markers listed in Table 16. Embodiments include processes for identifying corn plants that display newly conferred or enhanced resistance to Colletotrichum by selecting for at least four markers or at least six, wherein at least two or three of the markers are on or within the chromosomal interval below UMC2041 and above the Rcg1 gene, and at least two or three of the markers are on or within the interval below the Rcg1 gene and above UMC2200. Additional embodiments include this same process when the two or three markers on or within the chromosomal interval below UMC2041 and above the Rcg1 gene, as well as the two or three markers on or within the interval below the Rcg1 gene and above UMC2200, are selected from those listed in Table 16. Another embodiment of this process includes detecting allele 7 at MZA1112, detecting allele 2 at MZA2591, or detecting allele 8 at MZA3434. Corn plants and seeds produced by the embodied processes are also embodiments of the invention, including those corn plants which do not comprise the same alleles as MP305 at or above UMC2041, or at or below UMC2200 at the loci shown in Table 16.

[0020] Other embodiments include processes for identifying corn plants that display newly conferred or enhanced resistance to Colletotrichum by detecting alleles of at least 2 markers in the corn plant, wherein at least one of the markers is on or within the chromosomal interval below UMC2041 and above the Rcg1 gene, and at least one of the markers is on or within the interval below the Rcg1 gene and above UMC2200, and where the process detects the presence or absence of at least one marker located within the Rcg1 gene. A further such embodiment includes a modification of this process in which four markers are selected for, in which two of the markers are within the chromosomal interval below UMC2285 and above the Rcg1 gene, and at least two of the markers are within the interval below the Rcg1 gene and above UMC15a. A further embodiment of this process includes the Rcg1 gene having been introgressed from a donor corn plant, including MP305 or DE811ASR(BC5), into a recipient corn plant to produce an introgressed corn plant. This process also includes the instance when the introgressed corn plant is selected for a recombination event below the Rcg1 gene and above UMC15a, so that the introgressed corn plant retains a first MP305 derived chromosomal interval below the Rcg1 gene and above UMC15a, and does not retain a second MP305 derived chromosomal interval at and below UMC15a. Corn plants and seeds produced by these processes are also embodiments of the invention. Introgressed corn plants embodied by the invention include those that are Rcg1 locus conversions of PH705, PH5W4, PH51 K or PH87P, or progeny thereof.

[0021] A further embodiment of the invention is a process of identifying a corn plant that displays enhanced resistance to Colletotrichum infection, by detecting in the corn plant the presence or absence of at least one marker at the Rcg1 locus, and selecting the corn plant in which the at least one marker is present. Embodiments include when at least one marker is on or within SEQ ID NO: 137, and also when the at least one marker is capable of detecting a polymorphism located at a position in SEQ ID NO: 137 corresponding to the position between nucleotides 1 and 536, between nucleotides 7230 and 7535, between nucleotides 11293 and 12553, between nucleotides 25412 and 29086; and between nucleotides 43017 and 50330, and also when at least one marker is on or within the Rcg1 coding sequence, or located on or within the polynucleotide set forth in SEQ ID NO: 1. Another embodiment includes when the process detects a single nucleotide polymorphism at a position in SEQ ID NO: 1 corresponding to one or more of position 413, 958, 971, 1099, 1154, 1235, 1250, 1308, 1607, 2001, 2598, and 3342. Markers included by the processes in these embodiments include SNP markers C00060-01 and C00060-02, markers that detect an mRNA sequence derived from the Rcg1 mRNA transcript and unique to Rcg1, and FLP markers on an amplicon generated by a primer pair set forth in this disclosure, such as those of SEQ ID NO:s 35-42, and their complements. Another embodiment includes when the process detects the presence or absence of at least two markers within the Rcg1 locus, including C00060-01 and C00060-02. Corn plants and seeds produced by these processes are also embodiments of the invention. Introgressed corn plants embodied by the invention include those that are Rcg1 locus conversions of PH705, PH5W4, PH51 K or PH87P, or progeny thereof. Such embodiments include corn seed comprising a first MP305 derived chromosomal interval defined by BNLG2162 and UMC1051, and not comprising a second MP305 derived chromosomal interval above UMC2041 or below UMC1051, and when the corn seed comprises the Rcg1 gene and, when grown, produces a corn plant that exhibits resistance to Colletotrichum infection. Seed of the embodiments also includes corn seed comprising a first MP305 derived chromosomal interval between, but not including, UMC2285 and UMC15a, and not comprising a second MP305 derived chromosomal interval at or above UMC2285 or at or below UMC15a, and furthermore such corn seed which comprises the Rcg1 gene and, when grown, produces a corn plant that exhibits resistance to Colletotrichum infection. Corn plants and plant cells produced from this seed are also included in the embodiments of the invention.

[0022] Additional embodiments include seed of a corn variety designated DE811ASR(BC5), or the corn seed deposited as ATCC accession number PTA-7434, or a progeny seed derived from that variety, that comprises the Rcg1 gene, that when grown, produces a plant that exhibits enhanced or newly conferred resistance to Colletotrichum infection. Plants and plant cells grown from this seed are also embodiments, as well as progeny seed that retain a first MP305 or DE811ASR(BC5) derived chromosomal interval within, but not including, UMC2285 and UMC15a, and progeny seed that do not comprise a second MP305 derived chromosomal interval at or above UMC2285 or at or below UMC15a. Plants and plant cells of the above seed are included as embodiments. Progeny seed that is an Rcg1 locus conversion of PH705, PH5W4, PH51 K or PH87P, or a progeny thereof is also embodied in the invention, as are progeny seed that comprise at least two or more of allele 7 at MZA11123, allele 2 at MZA2591, or allele 8 at MZA3434. Further embodiments include progeny seed which comprise a cytosine nucleotide at MZA2591.32, a thymine nucleotide at MZA2591.35, and a cytosine nucleotide at MZA3434.17.

[0023] Additional embodiments include a computer system for identifying a corn plant that displays newly conferred or enhanced resistance to Colletotrichum infection comprising a database comprising an allele score information for one or more corn plants for four or more marker loci closely linked to or within the Rcg1 locus, and instructions that examine said database to determine inheritance of the chromosomal interval or portions thereof defined by the four or more marker loci and compute whether or not the one or more corn plants comprise the Rcg1 gene. Further embodiments include a computer system for identifying a corn plant that displays newly conferred or enhanced resistance to Colletotrichum infection comprising a database comprising allele score information for one or more corn plants for one or more marker loci within the Rcg1 locus, and instructions that examine said database to determine inheritance of the Rcg1 locus. The allele score information for one or more corn plants for such computer systems may further comprise two, three, or more marker loci within the Rcg1 locus.

[0024] Embodiments also include genetic markers on or within SEQ ID NOs: 140 through 146 for MZA3434, MZA2591, MZA11123, MZA15842, MZA1851, MZA8761 and MZA11455, respectively. Other embodiments include genetic markers located on or in the Rcg1 locus or the Rcg1 gene, including those located on SEQ ID NO: 137, for example those located on regions corresponding to nucleotides between 1 and 536, between 7230 and 7535, between 11293 and 12553, between 25412 and 29086, and the region between nucleotides 43017 and 50330. Embodied markers also include those located on SEQ ID NO: 1, such as those located on or within nucleotide positions 550-658 of SEQ ID NO: 1, or those located on or within nucleotide positions 1562-1767 of SEQ ID NO: 1. Markers of the embodiments include those on markers located on amplicons generated by a primer pair wherein the first primer is an odd-numbered sequence from SEQ ID NO: 23 to 41, and wherein the second primer is an even-numbered sequence from SEQ ID NO: 24 to 42.

[0025] Further embodiments include corn plants obtainable by a method comprising: crossing MP305 or DE811ASR(BC5) [Deposit No. PTO-7434] as a first parent plant, with a different plant that lacks an Rcg1 locus as a second parent plant, thereby to obtain progeny comprising the Rcg1 locus of the first parent; and optionally further comprising one or more further breeding steps to obtain progeny of one or more further generations comprising the Rcg1 locus of the first parent. Such embodied corn plants include both inbred and hybrid plants. Seeds of such plants, including those seeds which are homozygous and heterozygous for the Rcg1 locus, and methods of obtaining corn products resulting from the processing of those seeds are embodied in the invention. Using such seed in food or feed or the production of a corn product, such as corn flour, corn meal and corn oil is also an embodiment of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG. 1 is a map of the United States showing the severity of anthracnose stalk rot infestation by county for 2002.

[0027] FIG. 2 (a,b,c) is an alignment of a polypeptide sequence of the embodiments (SEQ ID NO: 3) comparing it to other known NBS-LRR polypeptides.

[0028] FIG. 3 is a graph produced by Windows QTL Cartographer software showing a statistical analysis of the chance (Y axis) that the locus responsible for the Cg resistance phenotype is located at a particular position along the chromosome (X axis) as defined by FLP markers.

[0029] FIG. 4 is an electrophoresis gel blot of aliquots of RT-PCR reactions which reveals the presence of a 260 bp band present in the samples derived from both infected and uninfected resistant plants but absent from susceptible samples. RT-PCR fragments were obtained from 12.5 ng total RNA from DE811 and DE811ASR stalk tissue. cDNA obtained by reverse transcription was amplified using Rcg1 specific primers and 18S rRNA primers as an internal standard.

[0030] FIG. 5 is a schematic diagram of the Mu-tagging strategy used to validate the Rcg1 gene.

[0031] FIG. 6 is the gene structure of Rcg1 showing the location of four different mutator insertion sites.

[0032] FIG. 7(a-b) is a series of genetic map images with increasing resolution of the map of the region near the Rcg1 gene. Map distances for 7(a) for the map labelled "A" are in cM and in relation to the IBM2 Neighbors 4 genetic map. Map distances for 7(b) for the map labelled "B" were developed using 184 individuals from the BC7 population, and map distances for 7(b) for the map labelled "C" were developed using 1060 individuals from the BC7 population. Genetic mapping in the BC7 population increased the map resolution greater than 10-fold, when compared with the published map. The location of the markers shown to the right of each map is based on extrapolation of their location on the physical map.

[0033] FIG. 8(a-b) is a genetic map image showing the chromosomal interval with the Rcg1 gene in DE811ASR (BC3), the reduced size of the chromosomal interval with the Rcg1 gene obtained in DE811ASR (BC5) and the further reduced size of the chromosomal interval in inbreds obtained by initially using DE811ASR (BC5) as a donor source. For all markers, the map distances shown were reported on the IBM2 neighbors map publicly available on the Maize GDB, apart from for MZA15842, FLP27 and FLP56 for which map positions were extrapolated using regression analysis relative to the high resolution maps in FIG. 7(b), maps B and C, using the positions of UMC2285, PHI093 and CSU166a which were common to both maps.

[0034] FIGS. 9(a-b). FIG. 9(a) shows the alignment of the non-colinear region from DE811ASR (BC5) relative to B73 and Mo17. The BAC sizes in FIG. 9(a) are estimates. FIG. 9(b) shows a portion of the non-colinear region as set forth in SEQ ID NO: 137 on which Rcg1 resides, including the repetitive regions therein, as well as the Rcg1 exons 1 and 2.

[0035] FIG. 10 (a-b) show distributions of average leaf lesion size in different individual plants at 15 days after inoculation with Cg in the DE811ASR(BC5) and DE811 lines, respectively.

[0036] FIG. 11 shows a comparison of average leaf lesion size on plants of DE811 and DE811ASR(BC5) infected with Cg at 7 and 15 days after inoculation.

[0037] FIG. 12 shows the average severity of disease four to five weeks after inoculation with Cg in stalks of hybrids derived from crossing DE811ASR(BC5) and DE811 to the line indicated.

[0038] FIG. 13 shows the improvement in yield at maturity after inoculation with Cg in hybrids derived from crossing DE811ASR(BC5) to the line indicated when compared to the yield of hybrids derived from crossing DE811 to the line indicated.

[0039] FIG. 14 shows the severity of disease at 5 different locations caused by Cg in stalks of inbred lines derived from DE811ASR(BC5) or MP305 four to five weeks after inoculation. Differences between the lines which were positive and negative for the Rcg1 gene are statistically significant at a P value of less than 0.05.

[0040] FIG. 15 shows disease progression in representative stalks from inbred PH705 lines which are positive and negative for Rcg1.

[0041] FIG. 16 shows disease progression in representative stalks from inbred PH87P lines which are positive and negative for Rcg1.

[0042] FIG. 17 shows the severity of disease four to five weeks after inoculation at 5 different locations caused by Cg in stalks of hybrids derived from crossing DE811ASR(BC5) to the line indicated. Differences between the lines which were positive and negative for the Rcg1 gene are statistically significant at a P value of less than 0.05, except for location 5.

[0043] FIG. 18 shows disease progression in representative stalks from hybrids created from PH4CV and PH705 lines which are positive and negative for Rcg1.

[0044] FIG. 19 shows disease progression in representative stalks from hybrids created from PH705 and PH87P lines which are positive and negative for Rcg1.

[0045] FIG. 20 shows the method of scoring for disease severity in corn stalks. The stalks are given a score, designated antgr75, which represents the number of internodes (up to 5, including the inoculated internode) that are more than 75% discolored. This results in a score ranging from 0 to 5, with 0 indicating less than 75% discoloration in the inoculated internode, and 5 indicating 75% or more discoloration of the first five internodes, including the inoculated internode.

[0046] FIG. 21 shows a contig on the B73 physical map that is homologous to the region into which the Rcg1 non-colinear region containing DE811ASR (BC5) is inserted, which demonstrates that many B73 derived bacterial artificial chromosomes (BACs) are available in the region of interest from which sequence information can be obtained.

[0047] FIG. 22 shows the alignment of the genetic map containing MZA and public markers with the physical maps of Mo17 and B73. The genetic map distances were developed by using 1060 individuals from the BC7 mapping population. An analysis of a Mo17 BAC library also showed the Rcg1 locus to be non-colinear with the corresponding region of Mo17. The location of the markers shown by dotted lines to the B73 map are extrapolations from the Mo17 physical map location. The location of the markers shown by dotted lines to the Mo17 map are extrapolations from the B73 physical map location.

[0048] FIG. 23 shows the oligos for the Rcg1 hybridization markers designed for use with Invader.TM. reactions.

[0049] FIG. 24 shows the oligos for the Rcg1 hybridization markers designed for use with TaqMan.RTM. reactions.

[0050] FIG. 25 shows the results of a northern blot obtained from approximately 1.5 mg of polyA-enriched RNA isolated from resistant and susceptible plants 0, 3, 6, 9, and 13 days post inoculation (dpi). The membrane was probed with a random primer labeled 420 bp Rcg1 fragment. Resistant tissue is from DE811ASR(BC5) and susceptible tissue is from DE811.

[0051] FIG. 26 shows that PCR amplification using Rcg1 specific primer pairs only amplifies in the resistant line DE811ASR(BC5) and donor parent MP305, but not in susceptible line DE811, with the exception of FLP110E-R, which amplifies the coiled coil-nucleotide binding site region, which is highly conserved, and thus amplifies a region elsewhere in the genome that is not Rcg1 in the DE811 line. A 100 bp ladder was used for fragment sizing.

DETAILED DESCRIPTION OF THE INVENTION

[0052] Embodiments of the present invention provide compositions and methods (or processes) directed to inducing pathogen resistance, particularly fungal resistance, in plants. The compositions are novel nucleotide and amino acid sequences that confer or enhance resistance to plant fungal pathogens. Specifically, certain embodiments provide polypeptides having the amino acid sequence set forth in SEQ ID NO: 3, and variants and fragments thereof. Isolated nucleic acid molecules, and variants and fragments thereof, comprising nucleotide sequences that encode the amino acid sequence shown in SEQ ID NO: 3 are further provided.

[0053] Nucleotide sequences that encode the polypeptide of SEQ ID NO: 3 are set forth in SEQ ID NOs: 1 and 4. Plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes a polypeptide of the embodiments are also disclosed herein.

[0054] A deposit of the Rcg1 nucleic acid molecule was made on Feb. 22, 2006 with the Agricultural Research Service (ARS) Culture Collection, housed in the Microbial Genomics and Bioprocessing Research Unit of the National Center for Agricultural Utilization Research (NCAUR), under the Budapest Treaty provisions. The deposit was given the following accession number: NRRL B-30895. The address of NCAUR is 1815 N. University Street, Peoria, Ill., 61604. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. .sctn. 112. The deposit will irrevocably and without restriction or condition be available to the public upon issuance of a patent. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by government action.

[0055] A sample of 2500 seeds of DE811ASR (BC5) were deposited in the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Va. 20110-2209, USA on Mar. 13, 2006 and assigned Deposit No. PTO-7434. Access to this deposit will be available during the pendency of the application to the Commissioner of Patents and Trademarks, persons determined by the Commissioner to be entitled thereto upon request, and corresponding officials in foreign patent offices in which this patent application is filed. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The deposit will irrevocably and without restriction or condition be available to the public upon issuance of a patent. However, it should be understood that the availability of the deposit does not constitute a license to practice the subject invention or methods in derogation of patent rights.

[0056] The full length polypeptide of the embodiments (SEQ ID NO: 3) shares varying degrees of homology with known polypeptides of the NBS-LRR family. In particular, the novel polypeptide of the embodiments shares homology with NBS-LRR proteins isolated from Oryza sativa (Accession Nos. NP_910480 (SEQ ID NO: 14), NP_910482 (SEQ ID NO: 16), NP_921091 (SEQ ID NO: 17) and NP_910483 (SEQ ID NO: 15)) and Hordeum vulgare (Accession No. AAG37354 (SEQ ID NO: 18); Zhou et al., (2001) Plant Cell 13:337-350). FIG. 1 provides an alignment of the amino acid sequence set forth in SEQ ID NO: 3 with the O. sativa and H. vulgare antifungal proteins (SEQ ID NOs: 14-18).

[0057] Amino acid alignments using the GAP program indicate that SEQ ID NO:3 shares approximately 42.3% sequence similarity with the O. sativa antifungal protein NP_910480 (SEQ ID NO: 14), 41.7% sequence similarity with the O. sativa protein NP_910482 (SEQ ID NO: 16), 56.9% similarity with the O. sativa protein NP_921091 (SEQ ID NO: 17) and 42.1% sequence similarity with the O. sativa protein NP_910483 (SEQ ID NO: 15). Furthermore, SEQ ID NO: 3 shares approximately 42.8% sequence similarity with the H. vulgare protein AAG37354 (SEQ ID NO: 18).

[0058] The NBS-LRR group of R-genes is the largest class of R-genes discovered to date. In Arabidopsis thaliana, over 150 are predicted to be present in the genome (Meyers, et al., (2003), Plant Cell, 15:809-834; Monosi, et al., (2004), Theoretical and Applied Genetics, 109:1434-1447), while in rice, approximately 500 NBS-LRR genes have been predicted (Monosi, (2004) supra). The NBS-LRR class of R genes is comprised of two subclasses. Class 1 NBS-LRR genes contain a TIR-Toll/Interleukin-1 like domain at their N' terminus; which to date have only been found in dicots (Meyers, (2003) supra; Monosi, (2004) supra). The second class of NBS-LRR contain either a coiled-coil domain or an (nt) domain at their N terminus (Bai, et al., (2002) Genome Research, 12:1871-1884; Monosi, (2004) supra; Pan, et al., (2000), Journal of Molecular Evolution, 50:203-213). Class 2 NBS-LRR have been found in both dicot and monocot species. (Bai, (2002) supra; Meyers, (2003) supra; Monosi, (2004) supra; Pan, (2000) supra).

[0059] The NBS domain of the gene appears to have a role in signaling in plant defense mechanisms (van der Biezen, et al., (1998), Current Biology: CB, 8:R226-R227). The LRR region appears to be the region that interacts with the pathogen AVR products (Michelmore, et al., (1998), Genome Res., 8:1113-1130; Meyers, (2003) supra). This LRR region in comparison with the NBS domain is under a much greater selection pressure to diversify (Michelmore, (1998) supra; Meyers, (2003) supra; Palomino, et al., (2002), Genome Research, 12:1305-1315). LRR domains are found in other contexts as well; these 20-29-residue motifs are present in tandem arrays in a number of proteins with diverse functions, such as hormone--receptor interactions, enzyme inhibition, cell adhesion and cellular trafficking. A number of recent studies revealed the involvement of LRR proteins in early mammalian development, neural development, cell polarization, regulation of gene expression and apoptosis signaling.

[0060] The gene of the embodiments is clearly related to the NBS-LRR of the class 2 family, but does not completely fit the classical mold. The amino end has homology to so-called nucleotide binding sites (NBS). There is a leucine rich region as well, located, as expected, downstream of the NBS. However, unlike previously studied NBS-LRR proteins, the leucine rich region lacks the systematic repetitive nature found in more classical LRR domains, much less consistently following the typical Lxx repeat pattern and in particular having no instances of the consensus sequences described by Wang et al. ((1999) Plant J. 19:55-64; see especially, FIG. 5) or Bryan et al. ((2000), Plant Cell 12:2033-2045; see especially, FIG. 3).

[0061] As the LRR region is the receptor portion of an NBS-LRR, when a new LRR such as that of this disclosure is found, the range of its activity, that is, the range of pathogens to which it will respond, is not immediately obvious from the sequence. The gene of the embodiments was isolated on the basis of the Cg resistance phenotype, and therefore the novel LRR responds to Cg. However, it is not excluded that it responds to other pathogens not tested in the work done heretofore.

[0062] The nucleic acids and polypeptides of the embodiments find use in methods for conferring or enhancing fungal resistance to a plant. Accordingly, the compositions and methods disclosed herein are useful in protecting plants from fungal pathogens. "Pathogen resistance," "fungal resistance," and "disease resistance" are intended to mean that the plant avoids the disease symptoms that are the outcome of plant-pathogen interactions. That is, pathogens are prevented from causing plant diseases and the associated disease symptoms, or alternatively, the disease symptoms caused by the pathogen are minimized or lessened, such as, for example, the reduction of stress and associated yield loss. One of skill in the art will appreciate that the compositions and methods disclosed herein can be used with other compositions and methods available in the art for protecting plants from pathogen attack.

[0063] Hence, the methods of the embodiments can be utilized to protect plants from disease, particularly those diseases that are caused by plant fungal pathogens. As used herein, "fungal resistance" refers to enhanced resistance or tolerance to a fungal pathogen when compared to that of a wild type plant. Effects may vary from a slight increase in tolerance to the effects of the fungal pathogen (e.g., partial inhibition) to total resistance such that the plant is unaffected by the presence of the fungal pathogen. An increased level of resistance against a particular fungal pathogen or against a wider spectrum of fungal pathogens constitutes "enhanced" or improved fungal resistance. The embodiments of the invention also will enhance or improve fungal plant pathogen resistance, such that the resistance of the plant to a fungal pathogen or pathogens will increase. The term "enhance" refers to improve, increase, amplify, multiply, elevate, raise, and the like. Herein, plants of the invention are described as being resistant to infection by Cg or having `enhanced resistance` to infection by Cg as a result of the Rcg1 locus of the invention. Accordingly, they typically exhibit increased resistance to the disease when compared to equivalent plants that are susceptible to infection by Cg because they lack the Rcg1 locus. For example, using the scoring system described in Example 11 (also see FIG. 20), they typically exhibit a one point, two point or three point or more decrease in the infection score, or even a reduction of the score to 1 or 0, when compared to equivalent plants that are susceptible to infection by Cg because they lack the Rcg1 locus

[0064] In particular aspects, methods for conferring or enhancing fungal resistance in a plant comprise introducing into a plant at least one expression cassette, wherein the expression cassette comprises a nucleotide sequence encoding an antifungal polypeptide of the embodiments operably linked to a promoter that drives expression in the plant. The plant expresses the polypeptide, thereby conferring fungal resistance upon the plant, or improving the plant's inherent level of resistance. In particular embodiments, the gene confers resistance to the fungal pathogen, Cg.

[0065] Expression of an antifungal polypeptide of the embodiments may be targeted to specific plant tissues where pathogen resistance is particularly important, such as, for example, the leaves, roots, stalks, or vascular tissues. Such tissue-preferred expression may be accomplished by root-preferred, leaf-preferred, vascular tissue-preferred, stalk-preferred, or seed-preferred promoters.

[0066] As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues (e.g., peptide nucleic acids) having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides.

[0067] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Polypeptides of the embodiments can be produced either from a nucleic acid disclosed herein, or by the use of standard molecular biology techniques. For example, a truncated protein of the embodiments can be produced by expression of a recombinant nucleic acid of the embodiments in an appropriate host cell, or alternatively by a combination of ex vivo procedures, such as protease digestion and purification.

[0068] As used herein, the terms "encoding" or "encoded" when used in the context of a specified nucleic acid mean that the nucleic acid comprises the requisite information to direct translation of the nucleotide sequence into a specified protein. The information by which a protein is encoded is specified by the use of codons. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid or may lack such intervening non-translated sequences (e.g., as in cDNA).

[0069] The embodiments of the invention encompass isolated or substantially purified polynucleotide or protein compositions. An "isolated" or "purified" polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide or protein is substantially free of other cellular material, or culture medium when produced by recombinant techniques (e.g. PCR amplification), or substantially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an "isolated" polynucleotide is free of sequences (for example, protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide can contain less than about 5 kb, about 4 kb, about 3 kb, about 2 kb, about 1 kb, about 0.5 kb, or about 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, about 20%, about 10%, about 5%, or about 1% (by dry weight) of contaminating protein. When the protein of the embodiments, or a biologically active portion thereof, is recombinantly produced, optimally culture medium represents less than about 30%, about 20%, about 10%, about 5%, or about 1% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.

[0070] Fragments and variants of the disclosed nucleotide sequences and proteins encoded thereby are also encompassed by the embodiments. "Fragment" is intended to mean a portion of the nucleotide sequence or a portion of the amino acid sequence and hence protein encoded thereby. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native protein and hence have the ability to confer fungal resistance upon a plant. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes do not necessarily encode fragment proteins retaining biological activity. Thus, fragments of a nucleotide sequence may range from at least about 15 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length nucleotide sequence encoding the polypeptides of the embodiments.

[0071] A fragment of a nucleotide sequence that encodes a biologically active portion of a polypeptide of the embodiments will encode at least about 15, about 25, about 30, about 40, or about 50 contiguous amino acids, or up to the total number of amino acids present in a full-length polypeptide of the embodiments (for example, 980 amino acids for the peptide encoded by SEQ ID NO:1). Fragments of a nucleotide sequence that are useful as hybridization probes or PCR primers generally need not encode a biologically active portion of a protein.

[0072] As used herein, "full-length sequence," in reference to a specified polynucleotide, means having the entire nucleic acid sequence of a native sequence. "Native sequence" is intended to mean an endogenous sequence, i.e., a non-engineered sequence found in an organism's genome.

[0073] Thus, a fragment of a nucleotide sequence of the embodiments may encode a biologically active portion of a polypeptide, or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. A biologically active portion of an antipathogenic polypeptide can be prepared by isolating a portion of one of the nucleotide sequences of the embodiments, expressing the encoded portion of the protein and assessing the ability of the encoded portion of the protein to confer or enhance fungal resistance in a plant. Nucleic acid molecules that are fragments of a nucleotide sequence of the embodiments comprise at least about 15, about 20, about 50, about 75, about 100, or about 150 nucleotides, or up to the number of nucleotides present in a full-length nucleotide sequence disclosed herein (for example, 4212 nucleotides for SEQ ID NO: 1).

[0074] "Variants" is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a "native" polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. One of skill in the art will recognize that variants of the nucleic acids of the embodiments will be constructed such that the open reading frame is maintained. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides of the embodiments. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis but which still encode a protein of the embodiments. Generally, variants of a particular polynucleotide of the embodiments will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein.

[0075] Variants of a particular polynucleotide of the embodiments (i.e., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, for example, isolated polynucleotides that encode a polypeptide with a given percent sequence identity to the polypeptide of SEQ ID NO: 3 are disclosed. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described elsewhere herein. Where any given pair of polynucleotides of the embodiments is evaluated by comparison of the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity.

[0076] "Variant" protein is intended to mean a protein derived from the native protein by deletion or addition of one or more amino acids at one or more internal sites in the native protein and/or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the embodiments are biologically active, that is they continue to possess the desired biological activity of the native protein, that is, the ability to confer or enhance plant fungal pathogen resistance as described herein. Such variants may result, for example, from genetic polymorphism or from human manipulation. Biologically active variants of a native protein of the embodiments will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a protein of the embodiments may differ from that protein by as few as about 1-15 amino acid residues, as few as about 1-10, such as about 6-10, as few as about 5, as few as 4, 3, 2, or even 1 amino acid residue.

[0077] The proteins of the embodiments may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants and fragments of the antipathogenic proteins can be prepared by mutations in the DNA. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be optimal.

[0078] Thus, the genes and polynucleotides of the embodiments include both naturally occurring sequences as well as mutant forms. Likewise, the proteins of the embodiments encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired ability to confer or enhance plant fungal pathogen resistance. Obviously, the mutations that will be made in the DNA encoding the variant must not place the sequence out of reading frame and optimally will not create complementary regions that could produce secondary mRNA structure. See, EP Patent No. 0075444.

[0079] The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by screening transgenic plants which have been transformed with the variant protein to ascertain the effect on the ability of the plant to resist fungal pathogenic attack.

[0080] Variant polynucleotides and proteins also encompass sequences and proteins derived from mutagenic or recombinogenic procedures, including and not limited to procedures such as DNA shuffling. One of skill in the art could envision modifications that would alter the range of pathogens to which the protein responds. With such a procedure, one or more different protein coding sequences can be manipulated to create a new protein possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shuffled between the protein gene of the embodiments and other known protein genes to obtain a new gene coding for a protein with an improved property of interest, such as increased ability to confer or enhance plant fungal pathogen resistance. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391:288-291; and U.S. Pat. Nos. 5,605,793 and 5,837,458.

[0081] The polynucleotides of the embodiments can be used to isolate corresponding sequences from other organisms, particularly other plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire sequences set forth herein or to variants and fragments thereof are encompassed by the embodiments. Such sequences include sequences that are orthologs of the disclosed sequences. "Orthologs" is intended to mean genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share at least about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity. Functions of orthologs are often highly conserved among species. Thus, isolated polynucleotides that encode for a protein that confers or enhances fungal plant pathogen resistance and that hybridize under stringent conditions to the sequences disclosed herein, or to variants or fragments thereof, are encompassed by the embodiments.

[0082] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, and are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.

[0083] In hybridization techniques, all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding polynucleotides present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as .sup.32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the polynucleotides of the embodiments. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989) supra.

[0084] For example, an entire polynucleotide disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding polynucleotides and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique and are optimally at least about 10 nucleotides in length, at least about 15 nucleotides in length, or at least about 20 nucleotides in length. Such probes may be used to amplify corresponding polynucleotides from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) supra.

[0085] Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent hybridization conditions" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optimally less than 500 nucleotides in length.

[0086] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30.degree. C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60.degree. C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree. C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a final wash in 0.1.times.SSC at 60 to 65.degree. C. for at least 30 minutes. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.

[0087] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the thermal melting point (T.sub.m) can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: T.sub.m=81.5.degree. C.+16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T.sub.m is reduced by about 1.degree. C. for each 1% of mismatching; thus, T.sub.m, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with .gtoreq.90% identity are sought, the T.sub.m can be decreased 10.degree. C. Generally, stringent conditions are selected to be about 5.degree. C. lower than the T.sub.m for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4.degree. C. lower than the T.sub.m; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10.degree. C. lower than the T.sub.m; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C. lower than the T.sub.m. Using the equation, hybridization and wash compositions, and desired T.sub.m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T.sub.m of less than 45.degree. C. (aqueous solution) or 32.degree. C. (formamide solution), it is optimal to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) supra.

[0088] Various procedures can be used to check for the presence or absence of a particular sequence of DNA, RNA, or a protein. These include, for example, Southern blots, northern blots, western blots, and ELISA analysis. Techniques such as these are well known to those of skill in the art and many references exist which provide detailed protocols. Such references include Sambrook et al. (1989) supra, and Crowther, J. R. (2001), The ELISA Guidebook, Humana Press, Totowa, N.J., USA.

[0089] The following terms are used to describe the sequence relationships between two or more polynucleotides or polypeptides: (a) "reference sequence," (b) "comparison window," (c) "sequence identity," and, (d) "percentage of sequence identity."

[0090] (a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.

[0091] (b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two polynucleotides. Generally, the comparison window is at least about 20 contiguous nucleotides in length, and optionally can be about 30, about 40, about 50, about 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

[0092] Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent sequence identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988) CABIOS 4:11-17; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the global alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453; the search-for-local alignment method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.

[0093] Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, and are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, Calif., USA). Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins et al. (1988) Gene 73:237-244 (1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) CABIOS 8:155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24:307-331. The ALIGN program is based on the algorithm of Myers and Miller (1988) supra. A PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. The BLAST programs of Altschul et al (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and Altschul (1990) supra. BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12, to obtain nucleotide sequences homologous to a nucleotide sequence encoding a protein of the embodiments. BLAST protein searches can be performed with the BLASTX program, score=50, wordlength=3, to obtain amino acid sequences homologous to a protein or polypeptide of the embodiments. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may also be performed manually by inspection.

[0094] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using Gap Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using Gap Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.

[0095] GAP uses the algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.

[0096] GAP presents one member of the family of best alignments. There may be many members of this family, and no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity. The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the GCG Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0097] (c) As used herein, "sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).

[0098] (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

[0099] The use of the term "polynucleotide" is not intended to limit the embodiments to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides of the embodiments also encompass all forms of sequences including, and not limited to, single-stranded forms, double-stranded forms, and the like.

[0100] Isolated polynucleotides of the embodiments can be incorporated into recombinant DNA constructs capable of introduction into and replication in a host cell. A "vector" may be such a construct that includes a replication system and sequences that are capable of transcription and translation of a polypeptide-encoding sequence in a given host cell. A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Flevin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.

[0101] The terms "recombinant construct," "expression cassette," "expression construct," "chimeric construct," "construct," "recombinant DNA construct" and "recombinant DNA fragment" are used interchangeably herein and are nucleic acid fragments. A recombinant construct comprises an artificial combination of nucleic acid fragments, including, and not limited to, regulatory and coding sequences that are not found together in nature. For example, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source and arranged in a manner different than that found in nature. Such construct may be used by itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the embodiments. Screening to obtain lines displaying the desired expression level and pattern of the polynucleotides or of the Rcg1 locus may be accomplished by amplification, Southern analysis of DNA, northern analysis of mRNA expression, immunoblotting analysis of protein expression, phenotypic analysis, and the like.

[0102] The term "recombinant DNA construct" refers to a DNA construct assembled from nucleic acid fragments obtained from different sources. The types and origins of the nucleic acid fragments may be very diverse.

[0103] In some embodiments, expression cassettes comprising a promoter operably linked to a heterologous nucleotide sequence of the embodiments are further provided. The expression cassettes of the embodiments find use in generating transformed plants, plant cells, and microorganisms and in practicing the methods for inducing plant fungal pathogen resistance disclosed herein. The expression cassette will include 5' and 3' regulatory sequences operably linked to a polynucleotide of the embodiments. "Operably linked" is intended to mean a functional linkage between two or more elements. "Regulatory sequences" refer to nucleotides located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which may influence the transcription, RNA processing, stability, or translation of the associated coding sequence. Regulatory sequences may include, and are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (a promoter, for example) is functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the polynucleotide that encodes an antipathogenic polypeptide to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

[0104] The expression cassette will include in the 5'-3' direction of transcription, a transcriptional initiation region (i.e., a promoter), translational initiation region, a polynucleotide of the embodiments, a translational termination region and, optionally, a transcriptional termination region functional in the host organism. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotide of the embodiments may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide of the embodiments may be heterologous to the host cell or to each other. As used herein, "heterologous" in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.

[0105] The optionally included termination region may be native with the transcriptional initiation region, may be native with the operably linked polynucleotide of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the promoter, the polynucleotide of interest, the host, or any combination thereof. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639. In particular embodiments, the potato protease inhibitor II gene (Pin II) terminator is used. See, for example, Keil et al. (1986) Nucl. Acids Res. 14:5641-5650; and An et al. (1989) Plant Cell 1:115-122, herein incorporated by reference in their entirety.

[0106] A number of promoters can be used in the practice of the embodiments, including the native promoter of the polynucleotide sequence of interest. The promoters can be selected based on the desired outcome. A wide range of plant promoters are discussed in the recent review of Potenza et al. (2004) In Vitro Cell Dev Biol--Plant 40:1-22, herein incorporated by reference. For example, the nucleic acids can be combined with constitutive, tissue-preferred, pathogen-inducible, or other promoters for expression in plants. Such constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

[0107] It may sometimes be beneficial to express the gene from an inducible promoter, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO 99/43819, herein incorporated by reference.

[0108] Of interest are promoters that result in expression of a protein locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA 91:2507-2511; Warner et al. (1993) Plant J. 3:191-201; Siebertz et al. (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol. Plant Path. 41:189-200).

[0109] Additionally, as pathogens find entry into plants through wounds or insect damage, a wound-inducible promoter may be used in the constructions of the embodiments. Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225:1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2):141-150); and the like, herein incorporated by reference.

[0110] Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, and are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.

[0111] Tissue-preferred promoters can be utilized to target enhanced expression of the polypeptides of the embodiments within a particular plant tissue. For example, a tissue-preferred promoter may be used to express a polypeptide in a plant tissue where disease resistance is particularly important, such as, for example, the roots, the stalk or the leaves. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196; Orozco et al. (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.

[0112] Vascular tissue-preferred promoters are known in the art and include those promoters that selectively drive protein expression in, for example, xylem and phloem tissue. Vascular tissue-preferred promoters include, and are not limited to, the Prunus serotina prunasin hydrolase gene promoter (see, e.g., International Publication No. WO 03/006651), and also those found in U.S. patent application Ser. No. 10/109,488.

[0113] Stalk-preferred promoters may be used to drive expression of a polypeptide of the embodiments. Exemplary stalk-preferred promoters include the maize MS8-15 gene promoter (see, for example, U.S. Pat. No. 5,986,174 and International Publication No. WO 98/00533), and those found in Graham et al. (1997) Plant Mol Biol 33(4): 729-735..

[0114] Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.

[0115] Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991) Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also Bogusz et al. (1990) Plant Cell 2(7):633-641, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a .beta.-glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus comiculatus, and in both instances root-specific promoter activity was preserved. Leach and Aoyagi (1991) describe their analysis of the promoters of the highly expressed roIC and rolD root-inducing genes of Agrobacterium rhizogenes (see Plant Science (Limerick) 79(1):69-76). They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters. Teeri et al. (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2' gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The TR1' gene, fused to nptII (neomycin phosphotransferase II) showed similar characteristics. Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant Mol. Biol. 29(4):759-772); and rolB promoter (Capana et al. (1994) Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and 5,023,179.

[0116] "Seed-preferred" promoters include both "seed-specific" promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as "seed-germinating" promoters (those promoters active during seed germination). See Thompson et al. (1989) BioEssays 10:108, herein incorporated by reference. Such seed-preferred promoters include, and are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); milps (myo-inositol-1-phosphate synthase) (see WO 00/11177 and U.S. Pat. No. 6,225,529; herein incorporated by reference). Gamma-zein is a preferred endosperm-specific promoter. Glob-1 is a preferred embryo-specific promoter. For dicots, seed-specific promoters include, and are not limited to, bean .beta.-phaseolin, napin, .beta.-conglycinin, soybean lectin, cruciferin, and the like. For monocots, seed-specific promoters include, and are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from end1 and end2 genes are disclosed; herein incorporated by reference.

[0117] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0118] Expression cassettes may additionally contain 5' leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al. (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology 81:382-385). See also, Della-Cioppa et al. (1987) Plant Physiol. 84:965-968. Other methods known to enhance translation can also be utilized, for example, introns, and the like.

[0119] In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0120] The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (H PT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as .beta.-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell/6.215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and yellow florescent protein (PhiYFP.TM. from Evrogen, see, Bolte et al. (2004) J. Cell Science 117:943-54). For additional selectable markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference.

[0121] The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the embodiments.

[0122] The gene of the embodiments can be expressed as a transgene in order to make plants resistant to Cg. Using the different promoters described elsewhere in this disclosure, this will allow its expression in a modulated form in different circumstances. For example, one might desire higher levels of expression in stalks to enhance resistance to Cg-caused stalk rot. In environments where Cg-caused leaf blight is more of a problem, lines with higher expression levels in leaves could be used. However, one can also insert the entire gene, both native promoter and coding sequence, as a transgene. Finally, using the gene of the embodiments as a transgene will allow quick combination with other traits, such as insect or herbicide resistance.

[0123] In certain embodiments the nucleic acid sequences of the embodiments can be stacked with any combination of polynucleotide sequences of interest in order to create plants with a desired phenotype. This stacking may be accomplished by a combination of genes within the DNA construct, or by crossing Rcg1 with another line that comprises the combination. For example, the polynucleotides of the embodiments may be stacked with any other polynucleotides of the embodiments, or with other genes. The combinations generated can also include multiple copies of any one of the polynucleotides of interest. The polynucleotides of the embodiments can also be stacked with any other gene or combination of genes to produce plants with a variety of desired trait combinations including and not limited to traits desirable for animal feed such as high oil genes (e.g., U.S. Pat. No. 6,232,529); balanced amino acids (e.g. hordothionins (U.S. Pat. Nos. 5,990,389; 5,885,801; 5,885,802; and 5,703,409); barley high lysine (Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO 98/20122); and high methionine proteins (Pedersen et al. (1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; and Musumura et al. (1989) Plant Mol. Biol. 12: 123)); increased digestibility (e.g., modified storage proteins (U.S. application Ser. No. 10/053,410, filed Nov. 7, 2001); and thioredoxins (U.S. application Ser. No. 10/005,429, filed Dec. 3, 2001)), the disclosures of which are herein incorporated by reference. The polynucleotides of the embodiments can also be stacked with traits desirable for insect, disease or herbicide resistance (e.g., Bacillus thuringiensis toxic proteins (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; Geiser et al (1986) Gene 48:109); lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825); fumonisin detoxification genes (U.S. Pat. No. 5,792,931); avirulence and disease resistance genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al. (1994) Cell 78:1089); acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations; inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance (EPSPS genes, GAT genes such as those disclosed in U.S. Patent Application Publication US2004/0082770, also WO02/36782 and WO03/092360)); and traits desirable for processing or process products such as high oil (e.g., U.S. Pat. No. 6,232,529); modified oils (e.g., fatty acid desaturase genes (U.S. Pat. No. 5,952,544; WO 94/11516)); modified starches (e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE) and starch debranching enzymes (SDBE)); and polymers or bioplastics (e.g., U.S. Pat. No. 5,602,321; beta-ketothiolase, polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-5847) facilitate expression of polyhydroxyalkanoates (PHAs)), the disclosures of which are herein incorporated by reference. One could also combine the polynucleotides of the embodiments with polynucleotides providing agronomic traits such as male sterility (e.g., see U.S. Pat. No. 5,583,210), stalk strength, flowering time, or transformation technology traits such as cell cycle regulation or gene targeting (e.g. WO 99/61619; WO 00/17364; WO 99/25821), the disclosures of which are herein incorporated by reference.

[0124] These stacked combinations can be created by any method including and not limited to cross breeding plants by any conventional or TopCross.RTM. methodology, or genetic transformation. If the traits are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences will be introduced, the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of the polynucleotide of interest. This may be combined with any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant.

[0125] The methods of the embodiments may involve, and are not limited to, introducing a polypeptide or polynucleotide into a plant. "Introducing" is intended to mean presenting to the plant the polynucleotide. In some embodiments, the polynucleotide will be presented in such a manner that the sequence gains access to the interior of a cell of the plant, including its potential insertion into the genome of a plant. The methods of the embodiments do not depend on a particular method for introducing a sequence into a plant, only that the polynucleotide gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotides into plants are known in the art including, and not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0126] "Transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" organisms. "Host cell" refers the cell into which transformation of the recombinant DNA construct takes place and may include a yeast cell, a bacterial cell, and a plant cell. Examples of methods of plant transformation include Agrobacterium-mediated transformation (De Blaere et al., 1987, Meth. Enzymol. 143:277) and particle-accelerated or "gene gun" transformation technology (Klein et al., 1987, Nature (London) 327:70-73; U.S. Pat. No. 4,945,050), among others.

[0127] "Stable transformation" is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. "Transient transformation" or "transient expression" is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.

[0128] Transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated transformation (U.S. Pat. No. 5,563,055- and 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, Sanford et al., U.S. Pat. Nos. 4,945,050; 5,879,918; 5,886,244; and U.S. Pat. No. 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lec1 transformation (WO 00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); U.S. Pat. Nos. 5,240,855; 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, N.Y.), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.

[0129] Methods are known in the art for the targeted insertion of a polynucleotide at a specific location in the plant genome. In one embodiment, the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system. See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference. Briefly, the polynucleotide of the embodiments can be contained in transfer cassette flanked by two non-identical recombination sites. The transfer cassette is introduced into a plant have stably incorporated into its genome a target site which is flanked by two non-identical recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.

[0130] The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting progeny having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the embodiments provides transformed seed (also referred to as "transgenic seed") having a nucleotide construct of the embodiments, for example, an expression cassette of the embodiments, stably incorporated into their genome.

[0131] As used herein, the term "plant" can be a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term "plant" can refer to any of: whole plants, plant components or organs (including but not limited to embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like), plant tissues, plant cells, plant protoplasts, plant cell tissue cultures from which maize plant can be regenerated, plant calli, plant clumps, and plant seeds. A plant cell is a cell of a plant, either taken directly from a seed or plant, or derived through culture from a cell taken from a plant. Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the embodiments, provided that these parts comprise the introduced polynucleotides.

[0132] The embodiments of the invention may be used to confer or enhance fungal plant pathogen resistance or protect from fungal pathogen attack in plants, especially corn (Zea mays). It will protect different parts of the plant from attack by pathogens, including and not limited to stalks, ears, leaves, roots and tassels. Other plant species may also be of interest in practicing the embodiments of the invention, including, and not limited to, other monocot crop plants.

[0133] Where appropriate, the polynucleotides may be optimized for increased expression in the transformed organism. For example, the polynucleotides can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831, and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.

[0134] The embodiments of the present invention may be effective against a variety of plant pathogens, particularly fungal pathogens, such as, for example, Colletotrichum, including Cg. The embodiments of the present invention may also be effective against maize stalk rot, including anthracnose stalk rot, wherein the causative agent is Colletotrichum. Other plant pathogenic fungi and oomycetes (many of the latter of which have been historically been considered fungi although modern taxonomists have now classified them separately) include, and are not limited to, the following: Soybeans: Phytophthora megasperma f sp. glycinea, Macrophomina phaseolina, Rhizoctonia solani, Sclerotinia sclerotiorum, Fusarium oxysporum, Diaporthe phaseolorum var. sojae (Phomopsis sojae), Diaporthe phaseolorum var. caulivora, Sclerotium rolfsii, Cercospora kikuchii, Cercospora sojina, Peronospora manshurica, Colletotrichum dematium (Colletotichum truncaturn), Corynespora cassiicola, Septoria glycines, Phyllosticta sojicola, Alternaria alternata, Microsphaera diffusa, Fusarium semitectum, Phialophora gregata, Glomerella glycines, Phakopsora pachyrhizi, Pythium aphanidermaturn, Pythium ultimum, Pythium debaryanum, Fusarium solani; Canola: Albugo candida, Alternaria brassicae, Leptosphaeria maculans, Rhizoctonia solani, Sclerotinia sclerotiorum, Mycosphaerella brassiccola, Pythium ultimum, Peronospora parasitica, Fusarium roseum, Alternaria alternata; Alfalfa: Pythium ultimum, Pythium irregulare, Pythium splendens, Pythium debaryanum, Pythium aphanidermaturn, Phytophthora megasperma, Peronospora trifoliorum, Phoma medicaginis var. medicaginis, Cercospora medicaginis, Pseudopeziza medicaginis, Leptotrochila medicaginis, Fusarium oxysporum, Verticillium albo-atrum, Aphanomyces euteiches, Stemphylium herbarum, Stemphylium alfalfae, Colletotrichum trifolii, Leptosphaerulina briosiana, Uromyces striatus, Sclerotinia trifoliorum, Stagnospora meliloti, Stemphylium botryosum, Leptotrochila medicaginis; Wheat: Urocystis agropyri, Alternaria alternata, Cladosporium herbarum, Fusarium graminearum, Fusarium avenaceum, Fusarium culmorum, Ustilago tritici, Ascochyta tritici, Cephalosporium gramineum, Collotetrichum graminicola, Erysiphe graminis f. sp. tritici, Puccinia graminis f. sp. tritici, Puccinia recondita f. sp. tritici, Puccinia striiformis, Pyrenophora tritici-repentis, Septoria nodorum, Septoria tritici, Septoria avenae, Pseudocercosporella herpotrichoides, Rhizoctonia solani, Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici, Pythium aphanidermatum, Pythium arrhenomanes, Pythium ultimum, Bipolaris sorokiniana, Claviceps purpurea, Tilletia tritici, Tilletia laevis, Ustilago tritici, Tilletia indica, Rhizoctonia solani, Pythium arrhenomannes, Pythium gramicola, Pythium aphanidermatum; Sunflower: Plasmophora halstedii, Sclerotinia sclerotiorum, Septoria helianthi, Phomopsis helianthi, Alternaria helianthi, Alternaria zinniae, Botrytis cinerea, Phoma macdonaldii, Macrophomina phaseolina, Erysiphe cichoracearum, Rhizopus oryzae, Rhizopus arrhizus, Rhizopus stolonifer, Puccinia helianthi, Verticillium dahliae, Erwinia carotovorum pv. carotovora, Cephalosporium acremonium, Phytophthora cryptogea, Albugo tragopogonis; Corn: Fusarium moniliforme var. subglutinans, Erwinia stewartii, Fusarium moniliforme, Gibberella zeae (Fusarium graminearum), Stenocarpella maydi (Diplodia maydis), Pythium irregulare, Pythium debaryanum, Pythium graminicola, Pythium splendens, Pythium ultimum, Pythium aphanidermatum, Aspergillus flavus, Bipolaris maydis O, T (Cochliobolus heterostrophus), Helminthosporium carbonum I, II & Ill (Cochliobolus carbonum), Exserohilum turcicum I, II & Ill, Helminthosporium pedicellatum, Physoderma maydis, Phyllosticta maydis, Kabatiella maydis, Cercospora sorghi, Ustilago maydis, Puccinia sorghi, Puccinia polysora, Macrophomina phaseolina, Penicillium oxalicum, Nigrospora oryzae, Cladosporium herbarum, Curvularia lunata, Curvularia inaequalis, Curvularia pallescens, Trichoderma viride, Claviceps sorghi, Erwinia chrysanthemi pv. zea, Erwinia carotovora, Diplodia macrospora, Sclerophthora macrospora, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora maydis, Peronosclerospora sacchari, Sphacelotheca reiliana, Physopella zeae, Cephalosporium maydis, Cephalosporium acremonium; Sorghum: Exserohilum turcicum, Colletotrichum graminicola (Glomerella graminicola), Cercospora sorghi, Gloeocercospora sorghi, Ascochyta sorghina, Puccinia purpurea, Macrophomina phaseolina, Perconia circinata, Fusarium moniliforme, Alternaria altemata, Bipolaris sorghicola, Helminthosporium sorghicola, Curvularia lunata, Phoma insidiosa, Ramulispora sorghi, Ramulispora sorghicola, Phyllachara sacchari, Sporisorium reilianum (Sphacelotheca reiliana), Sphacelotheca cruenta, Sporisorium sorghi, Claviceps sorghi, Rhizoctonia solani, Acremonium strictum, Sclerophthona macrospora, Peronosclerospora sorghi, Peronosclerospora philippinensis, Sclerospora graminicola, Fusarium graminearum, Fusarium oxysporum, Pythium arrhenomanes, Pythium graminicola, etc.

[0135] "Germplasm" refers to genetic material of or from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety or family), or a clone derived from a line, variety, species, or culture. The germplasm can be part of an organism or cell, or can be separate from the organism or cell. In general, germplasm provides genetic material with a specific molecular makeup that provides a physical foundation for some or all of the hereditary qualities of an organism or cell culture. As used herein, germplasm includes cells, seed or tissues from which new plants may be grown, or plant parts, such as leaves, stems, pollen, or cells, that can be cultured into a whole plant.

[0136] The term "allele" refers to one of two or more different nucleotide sequences that occur at a specific locus. A first allele is found on one chromosome, while a second allele occurs at the same position on the homologue of that chromosome, e.g., as occurs for different chromosomes of a heterozygous individual, or between different homozygous or heterozygous individuals in a population. A "favorable allele" is the allele at a particular locus that confers, or contributes to, an agronomically desirable phenotype, e.g., resistance to Cg infection. A favorable allele of a marker is a marker allele that segregates with the favorable phenotype. A favorable allelic form of a chromosome segment is a chromosome segment that includes a nucleotide sequence that contributes to superior agronomic performance at one or more genetic loci physically located on the chromosome segment. "Allele frequency" refers to the frequency (proportion or percentage) of an allele within a population, or a population of lines. One can estimate the allele frequency within a population by averaging the allele frequencies of a sample of individuals from that population.

[0137] An allele "positively" correlates with a trait when it is linked to it and when presence of the allele is an indicator that the desired trait or trait form will occur in a plant comprising the allele. An allele negatively correlates with a trait when it is linked to it and when presence of the allele is an indicator that a desired trait or trait form will not occur in a plant comprising the allele.

[0138] An individual is "homozygous" if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes). An individual is "heterozygous" if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). A special case of a heterozygous situation is where one chromosome has an allele of a gene and the other chromosome lacks that gene, locus or region completely--in other words, has a deletion relative to the first chromosome. This situation is referred to as "hemizygous." The term "homogeneity" indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that individuals within the group differ in genotype at one or more specific loci.

[0139] The embodiments provide not only a gene and its functional variants for use in transgenic applications, but sequences and processes that allow the Rcg1 resistance gene to be moved between corn lines using marker assisted breeding. The embodiments also relate to plants produced by these processes that retain a truncated chromosomal interval comprising the Rcg1 resistance gene.

[0140] A genetic map is a graphical representation of a genome (or a portion of a genome such as a single chromosome) where the distances between landmarks on a chromosome are measured by the recombination frequencies between the landmarks. Recombinations between genetic landmarks can be detected using a variety of molecular genetic markers (also called molecular markers) that are described in more detail herein.

[0141] For markers to be useful at detecting recombinations, they need to detect differences, or polymorphisms, within the population being monitored. For molecular markers, this means differences at the DNA level due to polynucleotide sequence differences (eg SSRs, RFLPs, FLPs, SNPs). The genomic variability can be of any origin, for example, insertions, deletions, duplications, repetitive elements, point mutations, recombination events, or the presence and sequence of transposable elements. Molecular markers can be derived from genomic or expressed nucleic acids (e.g., ESTs). ESTs are generally well conserved within a species, while other regions of DNA (typically non-coding) tend to accumulate polymorphism, and therefore, can be more variable between individuals of the same species. A large number of corn molecular markers are known in the art, and are published or available from various sources, such as the Maize GDB internet resource and the Arizona Genomics Institute internet resource run by the University of Arizona.

[0142] Molecular markers can be used in a variety of plant breeding applications (eg see Staub et al. (1996) Hortscience 31: 729-741; Tanksley (1983) Plant Molecular Biology Reporter. 1: 3-8). One of the main areas of interest is to increase the efficiency of backcrossing and introgressing genes using marker-assisted selection (MAS). A molecular marker that demonstrates linkage with a locus affecting a desired phenotypic trait provides a useful tool for the selection of the trait in a plant population. This is particularly true where the phenotype is hard to assay, e.g. many disease resistance traits, or, occurs at a late stage in the plants development, e.g. kernel characteristics. Since DNA marker assays are less laborious, and take up less physical space, than field phenotyping, much larger populations can be assayed, increasing the chances of finding a recombinant with the target segment from the donor line moved to the recipient line. The closer the linkage, the more useful the marker, as recombination is less likely to occur between the marker and the gene causing the trait, which can result in false positives. Having flanking markers decreases the chances that false positive selection will occur as a double recombination event would be needed. The ideal situation is to have a marker in the gene itself, so that recombination can not occur between the marker and the gene. Such a marker is called a `perfect marker`.

[0143] When a gene is introgressed by MAS, it is not only the gene that is introduced but also the flanking regions (Gepts. (2002). Crop Sci; 42: 1780-1790). This is referred to as "linkage drag." In the case where the donor plant is highly unrelated to the recipient plant, as in the case of the Rcg1 locus being introgressed from MP305, an exotic source, into elite inbreds, these flanking regions carry additional genes that may code for agronomically undesirable traits. This "linkage drag" may also result in reduced yield or other negative agronomic characteristics even after multiple cycles of backcrossing into the elite corn line. This is also sometimes referred to as "yield drag." The size of the flanking region can be decreased by additional backcrossing, although this is not always successful, as breeders do not have control over the size of the region or the recombination breakpoints (Young et al. (1998) Genetics 120:579-585). In classical breeding it is usually only by chance that recombinations are selected that contribute to a reduction in the size of the donor segment (Tanksley et al. (1989). Biotechnology 7: 257-264). Even after 20 backcrosses in backcrosses of this type, one may expect to find a sizeable piece of the donor chromosome still linked to the gene being selected. With markers however, it is possible to select those rare individuals that have experienced recombination near the gene of interest. In 150 backcross plants, there is a 95% chance that at least one plant will have experienced a crossover within 1 cM of the gene, based on a single meiosis map distance. Markers will allow unequivocal identification of those individuals. With one additional backcross of 300 plants, there would be a 95% chance of a crossover within 1 cM single meiosis map distance of the other side of the gene, generating a segment around the target gene of less than 2 cM based on a single meiosis map distance. This can be accomplished in two generations with markers, while it would have required on average 100 generations without markers (See Tanksley et al., supra). When the exact location of a gene is known, a series of flanking markers surrounding the gene can be utilized to select for recombinations in different population sizes. For example, in smaller population sizes recombinations may be expected further away from the gene, so more distal flanking markers would be required to detect the recombination.

[0144] The availability of integrated linkage maps of the maize genome containing increasing densities of public maize markers has facilitated maize genetic mapping and MAS. See, e.g. the IBM2 Neighbors 4 map [online], [retrieved on 2006-03-21]. Retrieved from the Internet<URL: http://www.maizegdb.org/cgi-bin/displaymaprecord.cgi?id=871214>

[0145] The key components to the implementation of MAS are: (i) Defining the population within which the marker-trait association will be determined, which can be a segregating population, or a random or structured population; (ii) monitoring the segregation or association of polymorphic markers relative to the trait, and determining linkage or association using statistical methods; (iii) defining a set of desirable markers based on the results of the statistical analysis, and (iv) the use and/or extrapolation of this information to the current set of breeding germplasm to enable marker-based selection decisions to be made. The three types of markers described in this disclosure can be used in marker assisted selection protocols; simple sequence repeat (SSR, also known as microsatellite) markers, single nucleotide polymorphism (SNP) markers and fragment length polymorphic (FLP) markers. SSRs can be defined as relatively short runs of tandemly repeated DNA with lengths of 6 bp or less (Tautz (1989) Nucleic Acid Research 17: 6463-6471; Wang et al. (1994) Theoretical and Applied Genetics, 88:1-6) Polymorphisms arise due to variation in the number of repeat units, probably caused by slippage during DNA replication (Levinson and Gutman (1987) Mol Biol Evol 4: 203-221). The variation in repeat length may be detected by designing PCR primers to the conserved non-repetitive flanking regions (Weber and May (1989) Am J Hum Genet 44:388-396). SSRs are highly suited to mapping and MAS as they are multi-allelic, codominant, reproducible and amenable to high throughput automation (Rafalski et al. (1996) Generating and using DNA markers in plants. In: Non-mammalian genomic analysis: a practical guide. Academic press. pp 75-135).

[0146] For example, an SSR marker profile of MP305 is provided in Example 5 herein. This marker profile was generated by gel electrophoresis of the amplification products generated by the primer pairs for these markers. Scoring of marker genotype is based on the size of the amplified fragment, which in this case was measured by the base pair weight of the fragment. While variation in the primer used or in laboratory procedures can affect the reported base pair weight, relative values will remain constant regardless of the specific primer or laboratory used. Thus, when comparing lines, the SSR profiles being compared should be obtained from the same lab, so that the same primers and equipment is used. For this reason, when comparing plants or lines vis a vis specific markers, it is preferable to state that such plants or lines have the same (or different) alleles at specified loci (e.g. one can say that if a plant does not comprise the MP305 derived chromosomal interval at or below UMC15a, it will not comprise the same alleles as MP305 at all of the loci at or below UMC15a listed on Table 6 in Example 5). An SSR service for corn is available to the public on a contractual basis by DNA Landmarks in Saint-Jean-sur-Richelieu, Quebec, Canada.

[0147] Various types of FLP markers can be generated. Most commonly, amplification primers are used to generate fragment length polymorphisms. Such FLP markers are in many ways similar to SSR markers, except that the region amplified by the primers is not typically a highly repetitive region. Still, the amplified region, or amplicon, will have sufficient variability among germplasm, often due to insertions or deletions, such that the fragments generated by the amplification primers can be distinguished among polymorphic individuals, and such indels are known to occur frequently in maize (Bhattramakki et al. (2002). Plant Mol Biol 48,539-547; Rafalski (2002b), supra). The term "indel" refers to an insertion or deletion, wherein one line may be referred to as having an insertion relative to a second line, or the second line may be referred to as having a deletion relative to the first line. The MZA markers disclosed herein are examples of amplified FLP markers that have been selected because they are in close proximity to the Rcg1 gene.

[0148] SNP markers detect single base pair nucleotide substitutions. Of all the molecular marker types, SNPs are the most abundant, thus having the potential to provide the highest genetic map resolution (Bhattramakki et al. 2002 Plant Molecular Biology 48:539-547). SNPs can be assayed at an even higher level of throughput than SSRs, in a so-called `ultra-high-throughput` fashion, as they do not require large amounts of DNA and automation of the assay may be straight-forward. SNPs also have the promise of being relatively low-cost systems. These three factors together make SNPs highly attractive for use in MAS. Several methods are available for SNP genotyping, including but not limited to, hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, minisequencing and coded spheres. Such methods have been reviewed in: Gut (2001) Hum Mutat 17 pp. 475-492; Shi (2001) Clin Chem 47, pp. 164-172; Kwok (2000) Pharmacogenomics 1, pp. 95-100; Bhattramakki and Rafalski (2001) Discovery and application of single nucleotide polymorphism markers in plants. In: R. J. Henry, Ed, Plant Genotyping: The DNA Fingerprinting of Plants, CABI Publishing, Wallingford. A wide range of commercially available technologies utilize these and other methods to interrogate SNPs including Masscode.TM. (Qiagen), Invader.RTM. (Third Wave Technologies), SnapShot.RTM. (Applied Biosystems), Taqman.RTM. (Applied Biosystems) and Beadarrays.TM. (Illumina).

[0149] A number of SNPs together within a sequence, or across linked sequences, can be used to describe a haplotype for any particular genotype (Ching et al. (2002), BMC Genet. 3:19 pp Gupta et al. 2001, Rafalski (2002b), supra). Haplotypes can be more informative than single SNPs and can be more descriptive of any particular genotype. For example, a single SNP may be allele `T` for MP305, but the allele `T` might also occur in the maize breeding population being utilized for recurrent parents. In this case, a haplotype, e.g. a series of alleles at linked SNP markers, may be more informative. Once a unique haplotype has been assigned to a donor chromosomal region, that haplotype can be used in that population or any subset thereof to determine whether an individual has a particular gene. See, for example, WO2003054229. Using automated high throughput marker detection platforms known to those of ordinary skill in the art makes this process highly efficient and effective.

[0150] As described herein, many of the primers listed in Tables 1 and 2 can readily be used as FLP markers to select for the Rcg1 locus. These primers can also be used to convert these markers to SNP or other structurally similar or functionally equivalent markers (SSRs, CAPs, indels, etc), in the same regions. One very productive approach for SNP conversion is described by Rafalski (2002a) Current opinion in plant biology 5 (2): 94-100 and also Rafalski (2002b) Plant Science 162: 329-333. Using PCR, the primers are used to amplify DNA segments from individuals (preferably inbred) that represent the diversity in the population of interest. The PCR products are sequenced directly in one or both directions. The resulting sequences are aligned and polymorphisms are identified. The polymorphisms are not limited to single nucleotide polymorphisms (SNPs), but also include indels, CAPS, SSRs, and VNTRs (variable number of tandem repeats). Specifically with respect to the fine map information described herein, one can readily use the information provided herein to obtain additional polymorphic SNPs (and other markers) within the region amplified by the primers listed in this disclosure. Markers within the described map region can be hybridized to BACs or other genomic libraries, or electronically aligned with genome sequences, to find new sequences in the same approximate location as the described markers.

[0151] In addition to SSR's, FLPs and SNPs as described above, other types of molecular markers are also widely used, including but not limited to expressed sequence tags (ESTs) and SSR markers derived from EST sequences, and randomly amplified polymorphic DNA (RAPD). As used herein, the term "Genetic Marker" shall refer to any type of nucleic acid based marker, including but not limited to, Restriction Fragment Length Polymorphism (RFLP), Simple Sequence Repeat (SSR), Random Amplified Polymorphic DNA (RAPD), Cleaved Amplified Polymorphic Sequences (CAPS) (Rafalski and Tingey, 1993, Trends in Genetics 9:275-280), Amplified Fragment Length Polymorphism (AFLP) (Vos et al., 1995, Nucleic Acids Res. 23:4407-4414), Single Nucleotide Polymorphism (SNP) (Brookes, 1999, Gene 234:177-186), Sequence Characterized Amplified Region (SCAR) (Paran and Michelmore, 1993, Theor. Appl. Genet. 85:985-993), Sequence Tagged Site (STS) (Onozaki et al., 2004, Euphytica 138:255-262), Single Stranded Conformation Polymorphism (SSCP) (Orita et al., 1989, Proc Natl Acad Sci USA 86:2766-2770), Inter-Simple Sequence Repeat (ISSR) (Blair et al., 1999, Theor. Appl. Genet. 98:780-792), Inter-Retrotransposon Amplified Polymorphism (IRAP), Retrotransposon-Microsatellite Amplified Polymorphism (REMAP) (Kalendar et al., 1999, Theor. Appl. Genet. 98:704-711), an RNA cleavage product (such as a Lynx tag) and the like.

[0152] More generically, the term "molecular marker" may be used to refer to a genetic marker, as defined above, or an encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus. A marker can be derived from genomic nucleotide sequences or from expressed nucleotide sequences (e.g., from a spliced RNA, a cDNA, etc.), or from an encoded polypeptide. The term also refers to nucleic acid sequences complementary to or flanking the marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence. A "molecular marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence. Alternatively, in some aspects, a marker probe refers to a probe of any type that is able to distinguish (i.e., genotype) the particular allele that is present at a marker locus. Nucleic acids are "complementary" when they specifically hybridize in solution, e.g., according to Watson-Crick base pairing rules. Some of the markers described herein are also referred to as hybridization markers when located on an indel region, such as the non-collinear region described herein. This is because the insertion region is, by definition, a polymorphism vis a vis a plant without the insertion. Thus, the marker need only indicate whether the indel region is present or absent. Any suitable marker detection technology may be used to identify such a hybridization marker, e.g. SNP technology is used in the examples provided herein.

[0153] A "genomic nucleic acid" is a nucleic acid that corresponds in sequence to a heritable nucleic acid in a cell. Common examples include nuclear genomic DNA and amplicons thereof. A genomic nucleic acid is, in some cases, different from a spliced RNA, or a corresponding cDNA, in that the spliced RNA or cDNA is processed, e.g., by the splicing machinery, to remove introns. Genomic nucleic acids optionally comprise non-transcribed (e.g., chromosome structural sequences, promoter regions, enhancer regions, etc.) and/or non-translated sequences (e.g., introns), whereas spliced RNA/cDNA typically do not have non-transcribed sequences or introns. A "template nucleic acid" is a nucleic acid that serves as a template in an amplification reaction (e.g., a polymerase based amplification reaction such as PCR, a ligase mediated amplification reaction such as LCR, a transcription reaction, or the like). A template nucleic acid can be genomic in origin, or alternatively, can be derived from expressed sequences, e.g., a cDNA or an EST.

[0154] The term "amplifying" in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. Typical amplification methods include various polymerase based replication methods, including the polymerase chain reaction (PCR), ligase mediated methods such as the ligase chain reaction (LCR) and RNA polymerase based amplification (e.g., by transcription) methods. An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, or the like).

[0155] Isozyme profiles and linked morphological characteristics can, in some cases, also be indirectly used as markers. Even though they do not directly detect DNA differences, they are often influenced by specific genetic differences. However, markers that detect DNA variation are far more numerous and polymorphic than isozyme or morphological markers (Tanksley (1983) Plant Molecular Biology Reporter 1:3-8).

[0156] Sequence alignments or contigs may also be used to find sequences upstream or downstream of the specific markers listed herein. These new sequences, close to the markers described herein, are then used to discover and develop functionally equivalent markers.

[0157] For example, different physical and/or genetic maps are aligned to locate equivalent markers not described within this disclosure but that are within similar regions. These maps may be within the maize species, or even across other species that have been genetically or physically aligned with maize, such as rice, wheat, barley or sorghum.

[0158] As noted in Example 2, by using common sequences from the region flanking the Rcg1 locus that hybridized to BACs in the Mo17 and the B73 BAC libraries, the BACs from both libraries were lined up with BACs from the DE811ASR(BC5) homologous region flanking the Rcg1 locus in a tiling path as shown in FIG. 9(a). The public B73 BACs, c0113f01 and c0117e18 were identified as directly north and south, respectively, of the Rcg1 locus.

[0159] With this information, an extended non-contiguous tiling path of B73 BACs between genetic markers UMC2285 and UMC15a, UMC2285 and UMC2187, UMC1086 and UMC2200, or UMC2041 and UMC2200, can be created by aligning genetic markers within this region with the physical map of the B73 BAC. Alignment information of the genetic and physical maps of B73 is obtained from the maize genome database of the Arizona Genomics Institute on the world wide web, accessed by entering the following web address prefixed by "www.": genome.arizona.edu/fpc/maize/#webagcol. In the WebChrom view, one can select the genetic markers in the vicinity of the Rcg1 gene and get a link to the physical contig where these genetic markers are located. By aligning the physical map in such way with the genetic map one can find a plethora of B73 BACs in the region between the chromosomal intervals defined by genetic markers UMC2285 and UMC15a, UMC2285 and UMC2187, UMC1086 and UMC2200, or UMC2041 and UMC2200. The BACs can be used by one of ordinary skill in the art to develop new markers for introgression of the Rcg1 locus into maize germplasm. In particular, such genetic markers would be useful for tracking the Rcg1 locus in any lines into which the Rcg1 locus or Rcg1 gene has been introgressed, and for selecting for recurrent parent genome in a backcrossing program.

[0160] For example, in order to design polymorphic markers that will be useful for introgression and selection of the Rcg1 gene or locus in other maize germplasm, sequence information of the region surrounding the Rcg1 locus can be used. There are many B73 derived bacterial artificial chromosomes (BACs) available in the region of interest from which sequence information can be obtained. An example of BACs in the region of interest is shown in FIG. 21, which shows a contig on the B73 physical map that is homologous to the Rcg1 region in DE811ASR (BC5) [FIG. 21 retrieved 2006-03-10]. Retrieved from the Internet <URL: http://www.genome.arizona.edu/cgi-bin//WebAGCoL/WebFPC/WebFPC_Direct_v2.1- .cgi?name=maize&contig=187&mark er=ssu1>. Sequence information is obtained either through information that is already publicly available (e.g. BAC end-sequence, sequence of Expressed Sequence Tags (ESTs) that hybridize to BACs in this region, overgo probes that often relate to these ESTs, etc.) or by obtaining new sequence by directly sequencing BAC clones in this region. From this sequence one can determine which regions are most unique using several different methods known to one of ordinary skill in the art. For example, by using gene prediction software or by blasting the sequence against all available maize sequence, one can select for non-repetitive sequence. Low copy sequence can be used to develop a wide array of nucleic acid based markers. These markers are used to screen the plant material in which the Rcg1 locus is present and the plant material in which the Rcg1 locus is absent. If a marker outside of the Rcg1 locus is desired, then the markers are used to screen the plant material in which the Rcg1 locus is present and the plant material in which the Rcg1 locus is absent to determine if the marker is polymorphic in such germplasm. Polymorphic markers are then used for marker assisted introgression and selection of the Rcg1 region and optimally also recurrent parent genome selection, in other maize germplasm. Thus, with the location of the Rcg1 locus identified and its association with resistance to Colletotrichum established, one of ordinary skill in the art can utilize any number of existing markers, or readily develop new markers, that can be used introgress or identify the presence or absence of the Rcg1 locus in germplasm, and to select for recurrent parent genome in a backcrossing program.

[0161] On a genetic map, linkage of one molecular marker to a gene or another molecular marker is measured as a recombination frequency. In general, the closer two loci (e.g., two SSR markers) are on the genetic map, the closer they lie to each other on the physical map. A relative genetic distance (determined by crossing over frequencies, measured in centimorgans; cM) can be proportional to the physical distance (measured in base pairs, e.g., kilobase pairs [kb] or mega-basepairs [Mbp]) that two linked loci are separated from each other on a chromosome. A lack of precise proportionality between cM and physical distance can result from variation in recombination frequencies for different chromosomal regions, e.g., some chromosomal regions are recombination "hot spots," while others regions do not show any recombination, or only demonstrate rare recombination events. Some of the introgression data and mapping information suggest that the region around the Rcg1 locus is one that does have a high amount of recombination.

[0162] In general, the closer one marker is to another marker, whether measured in terms of recombination or physical distance, the more strongly they are linked. The closer a molecular marker is to a gene that encodes a polypeptide that imparts a particular phenotype (disease resistance), whether measured in terms of recombination or physical distance, the better that marker serves to tag the desired phenotypic trait. If possible, the best marker is one within the gene itself, since it will always remain linked with the gene causing the desired phenotype.

[0163] Genetic mapping variability can also be observed between different populations of the same crop species, including maize. In spite of this variability in the genetic map that may occur between populations, genetic map and marker information derived from one population generally remains useful across multiple populations in identification of plants with desired traits, counter-selection of plants with undesirable traits and in guiding MAS.

[0164] To locate equivalent markers across genetic maps, a mapping population may be used to confirm whether any such equivalent marker is within the region described herein and therefore useful for selection of Rcg1. Using this method, the equivalent marker, along with the markers listed herein, are mapped on such mapping population. Any equivalent marker that falls within the same region can be used to select for Rcg1. Mapping populations known in the art and that may be used for this purpose include, but are not limited to, the IBM populations and T218.times.GT119 IF2 population described in Sharopova, N. et al. (2002) Plant Mol Biol 48(5):463-481 and Lee, M. et al. (1999): Tools for high resolution genetic mapping in maize--status report. Proc. Plant Animal Genome VII, January 17-21, 1999, San Diego, USA, P. 146; the UMC 98 population, described in Davis, G. L. et al. (1999) Genetics 152(3):1137-72 and in Davis, M. D. et al., (1998) The 1998 UMC Maize Genetic Map: ESTs, Sequenced Core Markers, and Nonmaize Probes as a Foundation for Gene Discovery, Maize Genetics Conference Abstracts 40.

[0165] As used herein, "introgression" or "introgressing" shall refer to moving a gene or locus from one line to another by: (1) crossing individuals of each line to create a population; and (2) selecting individuals carrying the desired gene or locus. After each cross, the selection process is repeated. For example, the gene of the embodiments, or the locus containing it, may be introgressed into a recurrent parent that is not resistant or only partially resistant, meaning that it is sensitive or susceptible or partially so, to Cg. The recurrent parent line with the introgressed gene or locus then has enhanced or newly conferred resistance to Cg. This line into which the Rcg1 locus has been introgressed is referred to herein as an Rcg1 locus conversion.

[0166] The process of introgressing is often referred to as "backcrossing" when the process is repeated two or more times. In introgressing or backcrossing, the "donor" parent refers to the parental plant with the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or "recurrent" parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed. For example, see Ragot, M. et al. (1995) Marker-assisted backcrossing: a practical example, in Techniques et Utilisations des Marqueurs Moleculaires (Les Colloques, Vol. 72, pp. 45-56 and Openshaw et al., (1994) Marker-assisted Selection in Backcross Breeding, Analysis of Molecular Marker Data, pp. 41-43. The initial cross gives rise to the F1 generation; the term "BC1" then refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on.

[0167] In the case of Rcg1, where the sequence of the gene and very nearby regions are available, DNA markers based on the gene itself or closely linked sequences can be developed for direct selection of the donor gene in the recurrent parent background. While any polymorphic DNA sequence from the chromosomal region carrying the gene could be used, the sequences provided in the embodiments allow the use of DNA markers within or close to the gene, minimizing false positive selection for the gene. Flanking markers limit the size of the donor genome fragments introduced into the recipient background, thus minimizing so called "linkage drag," meaning the introduction of undesirable sequences from the donor line that could impact plant performance in otherwise elite germplasm. The embodiments provide multiple examples of DNA markers that could be so used, and the person skilled in the art will be able to use the genomic sequences provided to create even more markers. An example is to use markers that hybridize (in the case of RFLP assays) or anneal (in the case of PCR assays) specifically (exclusively) to sequences closely linked, including within, the locus. In principle, sequences that also hybridize or anneal elsewhere in the genome could be used if several such markers are used in combination. When PCR reactions are used, in practice the length of the primers used in the amplification reaction should be at least about 15 nucleotides, but depending on the sequences and hybridization conditions, any length that provides specific annealing can be used, such as about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28 or longer. For PCR reactions the term "anneal" is commonly used, and as used herein it shall be understood to have the same meaning as "hybridize."

[0168] Thus, by using the markers and processes described herein, one may produce a plant comprising a truncated chromosomal interval comprising the Rcg1 locus and/or the Rcg1 gene. The term "chromosomal interval" or "chromosomal segment" refers to a contiguous linear span of genomic DNA that resides in planta on a single chromosome, usually defined with reference to two markers defining the end points of the chromosomal interval. The specified interval may include the markers at the end points (e.g. one or more markers on or within the chromosomal interval defined by marker A and marker B) or may exclude the markers at the end points of the interval (e.g. one or more markers within the chromosomal interval defined by marker A and marker B). A truncated chromosomal interval refers to a chromosomal interval that has been reduced in size by selecting for one or more recombination events that have reduced the size of the chromosomal interval. A "recombination event" refers to the occurrence of recombination between homologous chromosomes, and refers to a specific chromosomal location where such a recombination has occurred (e.g. a recombination of a chromosomal interval internal to the end points of the chromosome will have a recombination event at each end of the chromosomal interval). The truncated chromosomal interval may be defined with reference to one or both new markers at the end points of the segment. The length of two chromosomal segments may be measured by either centimorgans or base pairs. The genetic elements or genes located on a single chromosomal interval are physically linked. The size of a chromosomal interval is not particularly limited, but in the context of the embodiments of the present invention, generally the genetic elements located within a single chromosomal interval are also genetically linked.

[0169] By using the processes of the embodiments, it is possible to select for a plant that comprises a truncated chromosomal interval comprising the Rcg1 gene. Specifically, with respect to the invention described in more detail in the examples below, the chromosomal interval may be reduced to a length of 12cM or less, 10 cM or less, 8 cM or less, 6 cM or less, 4 cM or less, 3cM or less, 2.5 cM or less, 2 cM or less, 1.5 cM or less, 1 cM or less, 0.75 cM or less, 0.50 cM or less, or 0.25 cM or less, in each case as measured with respect to the map distances as shown on the IBM2 Neighbors 4 genetic map as in effect on Mar. 21, 2006. As measured in base pairs, the chromosomal interval may be reduced to a length of 15 mbp or less, 10 mbp or less, 5 mbp or less, 3 mbp or less, 1 mpb or less, 500 kbp or less, or 250 kbp or less. One of ordinary skill in the art would understand that it is undesirable to cause a break in the chromosomal region so proximal to the Rcg1 coding sequence (e.g. within 5 kpb or less, within 4 kbp or less, 3 kbp or less, 2 kbp or less, 1 kbp or less, or 0.5 kbp or less), such that the promoter and other upstream regulatory elements would be unlinked from the coding sequence.

[0170] The term "locus" generally refers to a genetically defined region of a chromosome carrying a gene or, possibly, two or more genes so closely linked that genetically they behave as a single locus responsible for a phenotype. When used herein with respect to Rcg1, the "Rcg1 locus" shall refer to the defined region of the chromosome carrying the Rcg1 gene including its associated regulatory sequences, plus the region surrounding the Rcg1 gene that is non-colinear with B73, or any smaller portion thereof that retains the Rcg1 gene and associated regulatory sequences. This locus has also been referred to elsewhere as the ASR locus, and will be referred to as the Rcg1 locus here.

[0171] A "gene" shall refer to a specific genetic coding region within a locus, including its associated regulatory sequences. The region encoding the Rcg1 primary transcript, referred to herein as the "Rcg1 coding sequence", will be used to define the position of the Rcg1 gene, and one of ordinary skill in the art would understand that the associated regulatory sequences will be within a distance of about 4 kb from the Rcg1 coding sequence, with the promoter located upstream. One embodiment of the present invention is the isolation of the Rcg1 gene and the demonstration that it is the gene responsible for the phenotype conferred by the presence of the locus.

[0172] As used herein, "linked" or "linkage" (as distinguished from the term "operably linked") shall refer to the genetic or physical linkage of loci or genes. Loci or genes are considered genetically linked if the recombination frequency between them is less than about 50% as determined on a single meiosis map. They are progressively more linked if the recombination frequency is about 40%, about 30%, about 20%, about 10% or less, as determined on a single meiosis map. Two or more genes are physically linked (or syntenic) if they have been demonstrated to be on a single piece of DNA, such as a chromosome. Genetically linked genes will in practice be physically linked (or syntenic), but the exact physical distance (number of nucleotides) may not have been demonstrated yet. As used herein, the term "closely linked" refers to genetically linked markers within 15 cM or less, including without limitation 12 cM or less, 10 cM or less, 8 cM or less, 7 cM or less, 6 cM or less, 5 cM or less, 4 cM or less, 3 cM or less, 2 cM or less, 1 cM or less and 0.5 cM or less, as determined on the IBM2 neighbors 4 genetic map publicly available on the Maize GDB website previously referenced in this disclosure. A DNA sequence, such as a short oligonucleotide representing a sequence within a locus or one complementary to it, is also linked to that locus.

[0173] A "line" or "strain" is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci.

[0174] An "ancestral line" or "progenitor" is a parent line used as a source of genes, e.g., for the development of elite lines. "Progeny" are the descendents of the ancestral line, and may be separated from their ancestors by many generations of breeding. For example, many elite lines are the progeny of B73 or Mo17. A "pedigree structure" defines the relationship between a descendant and each ancestor that gave rise to that descendant. A pedigree structure can span one or more generations, describing relationships between the descendant and it's parents, grand parents, great-grand parents, etc.

[0175] An "elite line" or "elite variety" is an agronomically superior line or variety that has resulted from many cycles of breeding and selection for superior agronomic performance. An "elite inbred line" is an elite line that is an inbred, and that has been shown to be useful for producing sufficiently high yielding and agronomically fit hybrid varieties (an "elite hybrid variety"). Numerous elite lines and varieties are available and known to those of skill in the art of corn breeding. Similarly, "elite germplasm" is an agronomically superior germplasm, typically derived from and/or capable of giving rise to a plant with superior agronomic performance, such as an existing or newly developed elite line of corn.

[0176] In contrast, an "exotic corn line" or "exotic corn germplasm" is germplasm derived from corn not belonging to an available elite line, elite variety or elite germplasm. In the context of a cross between two corn plants, an exotic line or exotic germplasm is not closely related by descent to the elite line, elite variety or elite germplasm with which it is crossed. Most commonly, the exotic line or exotic germplasm is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.

[0177] Units, prefixes, and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively. Numeric ranges are inclusive of the numbers defining the range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. The above-defined terms are more fully defined by reference to the specification as a whole.

[0178] With respect to map directions noted herein, instead of the terms 5' and 3', the terms "north" and "above" are used (e.g., a marker north of the Rcg1 gene refers to a marker above the Rcg1 gene, as determined with reference to the maps provided in a vertical orientation, such as FIGS. 7 and 8, and to the left of the Rcg1 gene, as determined with reference to maps provided in a horizontal orientation, such as FIG. 22). Likewise, the terms "south" and "below" are used (e.g. a marker south of the Rcg1 gene refers to a marker below the Rcg1 gene, as determined with reference to the vertically oriented maps provided herein, and to the right of the Rcg1 gene, as determined with reference to the horizontally oriented maps provided herein). More specifically, above the Rcg1 coding sequence refers to the chromosome above, or north of the primary transcript in SEQ ID NO: 1 (at about FLP110F), and below the Rcg1 coding sequence refers to the chromosome below or south of the primary transcript in SEQ ID NO: 1 (at about FLPA1R). See FIG. 26. The term "proximal" and "distal" are relative terms meaning, respectively, nearer and farther from a specified location (e.g., the Rcg1 gene) when used to compare two points on a map relative to the specified location.

[0179] The term "computer systems" refers generally to various automated systems used to perform some or all of the method steps described herein. The term "instructions" refers to computer code that instructs the computer system to perform some or all of the method steps. In addition to practicing some or all of the method steps, digital or analog systems, e.g., comprising a digital or analog computer, can also control a variety of other functions such as a user viewable display (e.g., to permit viewing of method results by a user) and/or control of output features (e.g., to assist in marker assisted selection or control of automated field equipment).

[0180] Certain of the methods described herein are optionally (and typically) implemented via a computer program or programs (e.g., that store and can be used to analyze molecular marker data). Thus, the embodiments provide digital systems, e.g., computers, computer readable media, and/or integrated systems comprising instructions (e.g., embodied in appropriate software) for performing the methods herein. The digital system will include information (data) corresponding to plant genotypes for a set of genetic markers, and optionally, phenotypic values and/or family relationships. The system can also aid a user in performing marker assisted selection for Rcg1 according to the methods herein, or can control field equipment which automates selection, harvesting, and/or breeding schemes.

[0181] Standard desktop applications such as word processing software (e.g., Microsoft Word.TM. or Corel WordPerfect.TM.) and/or database software (e.g., spreadsheet software such as Microsoft Excel.TM., Corel Quattro Pro.TM., or database programs such as Microsoft Access.TM. or Paradox.TM.) can be adapted to the embodiments by inputting data which is loaded into the memory of a digital system, and performing an operation as noted herein on the data. For example, systems can include the foregoing software having the appropriate genotypic data, and optionally pedigree data, used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a Windows, Macintosh or LINUX system) to perform any analysis noted herein, or simply to acquire data (e.g., in a spreadsheet) to be used in the methods herein. The computer can be, e.g., a PC (Intel x86 or Pentium chip-compatible DOS,.TM. OS2,.TM. WINDOWS,.TM. WINDOWS NT,.TM. WINDOWS95,.TM. WINDOWS98,.TM. LINUX, Apple-compatible, MACINTOSH.TM. compatible, Power PC compatible, or a UNIX compatible (e.g., SUN.TM. work station) machine) or other commercially common computer which is known to one of skill. Software for performing association analysis and/or phenotypic value prediction can be constructed by one of skill using a standard programming language such as Visualbasic, Fortran, Basic, Java, or the like, according to the methods herein.

[0182] Any system controller or computer optionally includes a monitor which can include, e.g., a cathode ray tube ("CRT") display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display), or others. Computer circuitry is often placed in a box which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others. The box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements. Inputting devices such as a keyboard or mouse optionally provide for input from a user and for user selection of genetic marker genotype, phenotypic value, or the like in the relevant computer system.

[0183] The computer typically includes appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations. The software then converts these instructions to an appropriate language for instructing the system to carry out any desired operation. For example, a digital system can instruct selection of plants comprising certain markers, or control field machinery for harvesting, selecting, crossing or preserving crops according to the relevant method herein.

[0184] The invention can also be embodied within the circuitry of an application specific integrated circuit (ASIC) or programmable logic device (PLD). In such a case, the invention is embodied in a computer readable descriptor language that can be used to create an ASIC or PLD. The invention can also be embodied within the circuitry or logic processors of a variety of other digital apparatus, such as PDAs, laptop computer systems, displays, image editing equipment, etc.

Examples

[0185] The embodiments of the invention are further defined in the following examples, in which all parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these examples, one skilled in the art can ascertain the essential characteristics of the embodiments of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications to adapt it to various usages and conditions. Thus, various modifications of the embodiments of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. The disclosure of each reference set forth herein is incorporated by reference in its entirety. Examples 1-4 and 7-12 are actual. Examples 5, 6 and 13 are actual in part and prophetic in part.

Example 1

Fine Mapping of the Rcg1 Locus to a Specific Region of 4L

[0186] In order to map and clone the gene responsible for the resistance of corn line MP305 to Cg, lines had previously been created which differed as little as possible from each other genetically with the exception of the presence of the locus responsible for the resistant phenotype. Such lines are called near isogenic lines. To this end, DE811 had been crossed to MP305 and the progeny had been backcrossed to the sensitive line DE811 three times, at each backcross selecting for resistance to Cg and otherwise for characteristics of DE811 (Weldekidan and Hawk, (1993), Maydica, 38:189-192). The resulting line was designated DE811ASR (BC3) (Weldekidan and Hawk, (1993) supra). This line was used as the starting point for the fine mapping of the Rcg1 locus. It was first necessary to know roughly where in the maize genome it was located. Using standard genetic methods, Jung et al. ((1994) supra) had previously localized the locus on the long arm of chromosome 4.

[0187] Since the Rcg1 locus had previously been mapped to the long arm of maize chromosome 4, using the information on markers near the locus obtained by Jung et al. (1994) supra, all available public and private simple sequence repeat (SSR) markers located in the region of the chromosome designated 4.06-4.08 were analyzed to determine if these markers were polymorphic between the two near isogenic lines DE811 and DE811ASR (BC5). The DE811ASR (BC5) line was derived from the DE811ASR (BC3) line described by Weldekidan and Hawk (1993), supra through two backcrosses to DE811 under selection for resistance to Cg, followed by 5 generations of selfing and selection to obtain the BC5 line. The BC5 line was backcrossed twice more to DE811 to create the BC7 segregating population used for fine mapping. In order to be able to conduct phenotypic evaluation on a family basis, BC7 individuals were selfed to create BC7S1 families.

[0188] From this analysis two SSR markers, PHI093 and UMC2041, were discovered to be polymorphic. Using the publicly available inter-mated (Coe et al. (2002) Plant Physiol. 128:9-12; Gardiner, et al., (2004), Plant Physiol., 134:1317-1326; Yim et al., (2002) Plant Physiol. 130:1686-1696) B73.times.Mo17 (IBM) neighbors map (Lee et al. (2002) Plant Mol Biol 48:453-61; Sharopova et al., (2002) Plant Mol Biol 48:463-81), the sequences of three nearby Restriction Fragment Length Polymorphism (RFLP) markers, CD0365, CSU166 and CD0127, were used to create fragment length polymorphic markers (hereafter designated FLPs). FLPs are markers that can be assayed using gel electrophoresis or any similar high-resolution fragment separation method following a PCR reaction using primers of a defined sequence. All three markers were found to be polymorphic. The FLPs used in mapping the Rcg1 locus are summarized in Table 1. Any primers for the MZA FLPs shown on Table 1, which also have the same MZA markers names shown on Table 2, will amplify a region of the FLP internal to the internal sequence shown on Table 2. The annealing temperature for all the primers listed in Table 1 is 60.degree. C.

[0189] In order to determine whether the presence of these three polymorphic FLPs and two polymorphic SSRs was associated with the resistant phenotype, indicating that the region carrying the Rcg1 locus was located on a chromosomal segment containing these three markers, a table was created in which the phenotypic status of 4784 individuals determined by field observation and the genotypic status relative to each of the five markers, determined by fragment size analysis, were entered. This data was submitted sequentially to the software programs Joinmap (Van Ooijen, et al., (2001), Plant Research International, Wageningen, the Netherlands) and Windows QTL Cartographer (Wang, et al., (2004), (online, version 2.0 retrieved on 2004-06-14 and version 2.5 retrieved on 2005-02-22); retrieved from the North Carolina State University Statistical Genetics and Bioinformatics website on the Internet <URL: http://statgen.ncsu.edu/qticart/WQTLCart.htm>. The former program determines the order of the markers along the chromosomal region. The latter determines if a particular allele of a marker (a particular form of the two polymorphic forms of the marker) is significantly associated with the presence of the phenotype. Markers for which the presence of one or the other allele is more significantly associated with the resistant phenotype are more likely to be closer to the gene responsible for the resistant phenotype. FIG. 3 depicts a graph produced by Windows QTL Cartographer showing a statistical analysis of the chance (Y axis) that the locus responsible for the Cg resistance phenotype is located at a particular position along the chromosome (X axis) as defined by FLP markers.

[0190] From the integrated physical and genetic map as described by Fengler, et al., ((2004) Plant and Animal Genome XII Abstract Book, Page 192 (Poster number P487), January 10-14, San Diego, Calif.) and Gardiner, (2004) supra, it was possible to identify two bacterial artificial chromosome (BAC) contigs, derived from a Mo17 BAC library, harboring the above mentioned genetic markers.

[0191] However, the two BAC contigs containing the markers flanking the region of interest contained a gap of unknown size. In order to identify further BACs to bridge this gap, a dense genetic map containing markers (Fengler, (2004) supra) with known positions on the physical map was used to find additional markers genetically linked to markers previously identified on the two BAC contigs. These additional markers in Table 2, were used to identify BAC contigs from a B73 BAC library which closed the physical gap between the previously found Mo17-derived BAC contigs (Coe et al. (2002) supra; Gardiner (2004) supra; Yim et al. (2002) supra. Four markers, MZA11455, MZA6064, MZA2591 and MZA15842, were used for mapping purposes. In Table 2, "E" stands for "external" and "I" stands for "internal," which respectively refer to the outer and inner primers used during nested PCR. The external set is used in the first round of PCR, after which the internal sequences are used for a second round of PCR on the products of the first round. This increases the specificity of the reaction. Upper case letters indicate portions of the primer based on vector sequences, which are later used to sequence the PCR product. They are not maize sequences. For the forward internal nested MZA primers, the upper case portion of the sequence is SEQ ID NO: 126, and for the reverse internal nested MZA primers, the upper case portion is SEQ ID NO: 127. The sequences shown in Table 2 for the internal forward MZA nested primers are therefore a combination of SEQ ID NO: 126 plus the SEQ ID NO: for each respective primer. Similarly, the sequences shown in Table 2 for the internal reverse MZA nested primers are a combination of SEQ ID NO: 127 plus the SEQ ID NO: for each respective primer. These combinations are indicated in the SEQ ID NO: column of Table 2. The annealing temperature for all the primers listed in Table 2 is 55.degree. C. All markers set forth in Table 2 have shown polymorphism within a diverse panel of corn germplasm, including MP305 and the corn lines shown on Table 18.

[0192] The sequences of the ends of several of these BACs, as well as ESTs known to be located on these BACs, were used in order to identify new markers with which to further narrow the range in which the locus was located. The further markers used for this purpose are designated FLP8, FLP27, FLP33, FLP41, FLP56 and FLP95 in Table 1. In a manner similar to that described above, phenotype and genotypic correlations were made. It was determined that the locus was most likely located between FLP 8 and FLP 27 (See FIG. 3).

TABLE-US-00001 TABLE 1 Markers and primer pairs used in Examples 1, 4 and 5 Used in SEQ SEQ Example Name Forward ID NO: Reverse ID NO: 1, 4 FLP8 CATGGAAGCCCCACAATAAC 24 ACATGGGTCCAAAGATCGAC 23 1, 4 FLP27 AGCCCTATTTCCTGCTCCTG 26 GCATGCCCCATCTGGTATAG 25 1, 4 FLP33 CTGTCGTTCGGTTTTGCTTC 28 GCATTCACATGTTCCTCACC 27 1, 4 FLP41 TGTGTTCGCATCAAAGGTGT 30 CTGTAAGGCACCCGATGTTT 29 1, 4 FLP56 GGTCTGGGAATGCTAAAGAGG 32 TGTCCAGGGTTACAGAAAACG 31 1, 4 FLP95 ATTTCGACGGAGGGTTCTTC 33 GCAGCAGGAGGAGCTCATAG 34 4 FLP110 ATGGAGGCTGCCCTGCTGAG 35 CGTATACCTCTCTGGCAAGGACGG 36 4 FLP111 TTCCTGTTCGTCTGTATCTGATCCG 37 TTTGATTCCGGTCGAGTATAACCTG 38 4 FLP112 GAAACTGCCTTCCCAGAAAACAATG 39 CAAGATCGGTGAAGTTGGTGCTTC 40 4 FLP113F ATCACAGATGGGTCTCAAGGATTGC 41 4 FLPA1R TTCCAAGCAATTCACAGCTC 42 1, 5 UMC1612 AGGTCCAGGTTACAGAGCAAGAGA 43 GCTAGTAGGTGCATGGTGGTTTCT 44 1, 4, 5 UMC2041 CTACACAAGCATAGAGGCCTGGAG 45 CAGTACGAGACGATGGAGGACAT 46 1, 4 CDO127 TGCTGTTGTTACTCGGGTTG 47 CTCTGCCTCAGCACAAATTC 48 1, 4, 5 PHI093 AGTGCGTCAGCTTCATCGCCTACAAG 49 AGGCCATGCATGCTTGCAACAATGGATACA 50 1, 4 CDO365 CTTCCAGAGGCAAAGCGTAG 51 TGTCACCCATGATCCAGTTG 52 1, 4, 5 CSU166 TATTGTGCACGTCACCTTGG 53 GGGCAGACTTACTGCTGGAG 54 1, 4 UMC2285 ATCTGCCTCCTTTTCCTTGG 55 AAGTAGCTGGGCTTGGAGGG 56 1, 4 MZA11455 ACGAAGCAATTTCACCTTCC 57 TGTGGAACTAACCCTCAGCATAG 58 1 MZA6064 CGAGAACCGGAGAAGAAGG 59 TTGGGCTGCTGTATTTTGTG 60 1, 4 MZA15842 GACGCAGCTGTGAAGTTGG 61 CACCGGAATACCTTGACCAC 62 1, 5 UMC1086 CATGAAAGTTTTCCTGTGCAGATT 63 GGGCAACTTTAGAGGTCGATTTATT 64 5 UMC1466 GATCCACTAGGGTTTCGGGGT 65 CGAATAGTGGTCTCGCGTCTATCT 66 5 UMC1418 GAGCCAAGAGCCAGAGCAAAG 67 TCACACACACACTACACTCGCAAT 68 5 BNLG2162 CACCGGCATTCGATATCTTT 69 GTCTGCTGCTAGTGGTGGTG 70 5 CSU166 AAATATCGGCTTTGGTCACG 71 TCGTCCTTCCTCAATTCGAC 72 5 UMC1051 AATGATCGAAATGCCATTATTTGT 73 CTGATCTGACTAAGGCCATCAAAC 74 5 UMC2187 ACCCAACAAGTCTTAATCGGGTTT 75 GTCCACCCTACCTCTCAACAAACA 76 5 UMC1371 CATGTGAATGGAAGTGTCCCTTT 77 GCATCCTTTTCGTTTCAAATATGC 78 5 UMC1856 AGATCTGTTTTGCTTTGCTCTGCT 79 CATGCCTTTATTCTCACACAAACG 80

TABLE-US-00002 TABLE 2 Nested MZA Primer Pairs Used in Example 1 SEQ SEQ ID Name Forward ID NOs: Reverse NOs: MZA1215 E Agcccaattctgtagatccaa 81 Tgcatgcaccggatccttc 82 MZA1215 I TGTAAAACGACGGCCAGTagcagcagac 126 + 83 GGAAACAGCTATGACCATGaggctggcggt 127 + 84 gatgcaaaga ggacttga MZA1216 E Ccggcctacggcaacaagaa 85 agggtacggtgacccgaag 86 MZA1216 I TGTAAAACGACGGCCAGTttcgagacgc 126 + 87 GGAAACAGCTATGACCATGacgacgcatgg 127 + 88 tgtcgtacct cactagcta MZA3434 E Tgtaccgcgagaactcca 89 ttgcattcacatgttcctcac 90 MZA3434 I TGTAAAACGACGGCCAGTctactacgac 126 + 91 GGAAACAGCTATGACCATGttgcagtagtt 127 + 92 ggccgcta ttgtagcagg MZA2591 E Agtaaataacagcattgacctc 93 tccaacggcggtcactcc 94 MZA2591 I TGTAAAACGACGGCCAGTctatataaca 126 + 95 GGAAACAGCTATGACCATGcacaaagccca 127 + 96 gggccctggaa caagctaag MZA11123 E Accacaatctgaagcaagtag 97 cacagaaacatctggtgctg 98 MZA11123 I TGTAAAACGACGGCCAGTaaagaccaag 126 + 99 GGAAACAGCTATGACCATGagacatcacgt 127 + 100 aaatgcagtcc aacagtttcc MZA15842 E Ctcgattggcatacgcgata 101 ttccttctccacgcagttca 102 MZA15842 I TGTAAAACGACGGCCAGTagaaggtatt 126 + 103 GGAAACAGCTATGACCATGgtttcacttgc 127 + 104 tgccatggctta tgaaggcagtc MZA11455 E Gaccgatgaaggcaattgtga 105 accaaatagtcctagataatgg 106 MZA114551 I TGTAAAACGACGGCCAGTttcaaccttc 126 + 107 GGAAACAGCTATGACCATGtaaacatagtc 127 + 108 tgactgacacat ataaaaattac MZA6064 E Tcgaatgtattttttaatgcgg 109 atccacaatggcacttgggt 110 MZA6064 I TGTAAAACGACGGCCAGTcagctatttt 126 + 111 GGAAACAGCTATGACCATGggtcagattcc 127 + 112 tgtcttcttcct aattcggac MZA11394 E Tcgtcctaacagcctgtgtt 113 gtccggatcaaatggatcgt 114 MZA11394 I TGTAAAACGACGGCCAGTaacagcctgt 126 + 115 GGAAACAGCTATGACCATGcgtgttccgtc 127 + 116 gttgaataaggt gagggagt MZA8761 E Ttctttgattctactcttgagc 117 cttcatggacgcctgagatt 118 MZA8761 I TGTAAAACGACGGCCAGTtagagctttc 126 + 119 GGAAACAGCTATGACCATGttggcatttag 127 + 120 tgaactgatagc cttctctcca MZA1851 E Atatattgcaccacttaaagcc 121 gggtgttatcacttgttctata 122 MZA1851 I TGTAAAACGACGGCCAGTtggagtcctt 126 + 123 GGAAACAGCTATGACCATGtatatgcactt 127 + 124 gaccatttgc ctagcgagtat MZA16510 E Aacaacaaggcgacggtgat 127 Tcatcttcgtcgtcctcatc 130 MZA16510 I TGTAAAACGACGGCCAGTgatcatcctg 126 + 131 GGAAACAGCTATGACCATGaaccgaaaaca 127 + 132 ccggagtt caccctc MZA1719 E ccagcggtagattatatacag 133 cggtttggtctgatgaggc 134 MZA1719 I TGTAAAACGACGGCCAGTctcgggaacc 126 + 135 GGAAACAGCTATGACCATGtgaaatccaga 127 + 136 ttgttggga acctcctttg

Example 2

Isolation of BAC Clones from the Resistant Lines and Identification of Candidate Genes in the Region of the Rcg1 Locus

[0193] In order to isolate the gene responsible for the phenotype conferred by the Rcg1 locus, BACs containing the region between the FLP 8 and FLP 27 markers were isolated from a BAC library prepared from the resistant line DE811ASR (BC5). This library was prepared using standard techniques for the preparation of genomic DNA (Zhang et al. (1995) Plant Journal 7:175-184) followed by partial digestion with HindIII and ligation of size selected fragments into a modified form of the commercially available vector pCC1 BAC.TM. (Epicentre, Madison, USA). After transformation into EPI300.TM. E. coli cells following the vendors instructions (Epicentre, Madison, USA), 125,184 recombinant clones were arrayed into 326 384-well microtiter dishes. These clones were then gridded onto nylon filters (Hybond N+, Amersham Biosciences, Piscataway, USA).

[0194] The library was probed with overlapping oligonucleotide probes (overgo probes; Ross et al. (1999) Screening large-insert libraries by hybridization, p. 5.6.1-5.6.52, In A. Boyl, ed. Current Protocols in Human Genetics. Wiley, New York) designed on the basis of sequences found in the BAC sequences shown in the previous example to be present between FLP8 and FLP27. BLAST search analyses were done to screen out repeated sequences and identify unique sequences for probe design. The position and interspacing of the probes along the contig was verified by PCR. For each probe two 24-mer oligos self-complementary over 8 bp were designed. Their annealing resulted in a 40 bp overgo, whose two 16 bp overhangs were filled in. The probes used in this way are presented in Table 4. Note that some of these probes were based on markers also used in Example 1 and Table 1, but the exact sequences are different as they were to be used as overgo probes rather than just PCR primers. Probes for hybridization were prepared as described (Ross et al. (1999) supra), and the filters prepared by the gridding of the BAC library were hybridized and washed as described by (Ross et al. (1999) supra). Phosphorimager analysis was used for detection of hybridization signals. Thereafter, the membranes were stripped of probes by placing them in a just-boiled solution of 0.1.times.SSC and 0.1% SDS and allowing them to cool to room temperature in the solution overnight.

[0195] BACs that gave a positive signal were isolated from the plates. Restriction mapping, PCR experiments with primers corresponding to the markers previously used and sequences obtained from the ends of each BAC were used to determine the order of the BACs covering the region of interest. Four BACs that spanned the entire region were selected for sequencing. These BACs were sequenced using standard shotgun sequencing techniques and the sequences assembled using the Phred/Phrap/Consed software package (Ewing et al. (1998) Genome Research, 8:175-185).

[0196] After assembly, the sequences thought to be in the region closest to the locus on the basis of the mapping data were annotated, meaning that possible gene-encoding regions and regions representing repetitive elements were deduced. Gene encoding (genic) regions were sought using the fGenesH software package (Softberry, Mount Kisco, N.Y., USA). fGenesH predicted a portion of a protein, that when BLASTed (BLASTx/nr), displayed partial homology at the amino acid level to a portion of a rice protein that was annotated as encoding for a protein that confers disease resistance in rice. The portion of the maize sequence that displayed homology to this protein fell at the end of a contiguous stretch of BAC consensus sequence and appeared to be truncated. In order to obtain the full representation of the gene in the maize BAC, the rice amino acid sequence was used in a tBLASTn analysis against all other consensus sequences from the same maize BAC clone. This resulted in the identification of a consensus sequence representing the 3' end of the maize gene. However, the center portion of the gene was not represented in the sequences so obtained. PCR primers were designed based on the 5' and 3' regions of the putative gene and used in a PCR experiment with DNA from the original maize BAC as a template. The sequence of the resulting PCR product contained sequence bridging the 5' and 3' fragments previously isolated.

[0197] DE811ASR (BC5) has been deposited with the ATCC, and the methods described herein may be used to obtain a BAC clone comprising the Rcg1 locus. As shown in FIG. 9(a), the DE811ASR (BC5) chromosomal interval with the Rcg1 locus is non-colinear with the corresponding region of B73 and Mo17 (See FIGS. 9 and 22), as determined by the analysis of BAC libraries.

[0198] Using common sequence that hybridize to BACs in the Mo17 and the B73 BAC libraries, the corresponding BACs from both libraries were lined up in a tiling path as shown in FIG. 22. The B73 BACs in FIG. 22 were given shorter names for the purposes of the figure. Table 3, below, shows the BAC ID for each BAC designation indicated on FIG. 22. The public B73 BACs, c0113f01 and c0117e18 are directly north and south, respectively, of the Rcg1 locus indel region, with the deletion occurring in B73. Information about these two BACs can be viewed on several websites including the maize GDB website (maizegdb.org), the Gramene website (gramene.org) and the maize genome database of the Arizona Genomics Institute (genome.arizona.edu). The Arizona Genomics Institute website also provides the Maize Agarose FPC Map, version Jul. 19, 2005, which identifies BACs contiguous with c0113f01 and c0117e18. By searching on those databases, a multitude of BACs were identified that form a contig of the regions flanking the Rcg1 locus. Thus, the precise location of the Rcg1 locus and Rcg1 gene have now been identified on both the maize genetic and physical map. See FIGS. 7(a,b) and 22.

TABLE-US-00003 TABLE 3 BAC designations in FIG. 22, which were part of either the 187 contig (B73a through B73p) or 188 contig (B73q through B73af) of B73as shown on the Arizona Genomics Institute website mentioned above. B73 BAC designation in FIG. 22 B73 BAC ID B73a c0100m06 B73b b0050k15 B73c c0127n01 B73d c0449o09 B73e c0046c06 B73f c0212g06 B73g c0153l14 B73h c0105c14 B73i b0502a04 B73j b0239l06 B73k b0171g07 B73l c0273k24 B73m c0113f01 B73n c0117e18 B73o c0119n15 B73p b0369n20 B73q b0031c17 B73r c0081g12 B73s c0303g03 B73t c0222i18 B73u c0428j12 B73v c0314e18 B73w c0150j16 B73x b0085n01 B73y c0040c01 B73z c0018f13 B73aa c0091e23 B73ab b0100g11 B73ac c0177e03 B73ad b0264h08 B73ae c0410a17 B73af c0012f18

[0199] The complete sequence of the putative gene is set forth in SEQ ID NO: 1. The gene contains one intron, from nucleotide 950 to nucleotide 1452 of SEQ ID NO: 1. Reverse transcriptase-PCR using RNA prepared from DE811ASR (BC5) plants was used to determine the borders of the intron. The protein coding sequence of the gene is set forth in SEQ ID NO: 2, and the amino acid translation is set forth in SEQ ID NO 3. The predicted protein has a molecular weight of 110.76 kD.

[0200] The amino end from approximately amino acids 157 to 404 has homology to so-called nucleotide binding sites (NBS). There is a region with loose homology to LRR domains located approximately from amino acids 528 to 846. However, unlike previously studied NBS-LRR proteins, the leucine rich region lacks the systematic repetitive nature (Lxx) found in more classical LRR domains and in particular having no instances of the consensus sequences described by Wang et al. ((1999), Plant J. 19:55-64) or Bryan et al. ((2000), Plant Cell 12:2033-2045). The gene has loose homology with a family of rice genes and a barley gene as shown in FIG. 2 (a, b and c). Most of the homology is at the amino terminal end of the protein; the carboxyl end is quite distinct. This is demonstrated by the use of bold type, in FIG. 2 (a, b and c), which are amino acids identical to the gene of the embodiments, while those which are non-identical are not shown in bold type.

TABLE-US-00004 TABLE 4 Oligonucleotides annealed to synthesize overgo probes Associated Forward SEQ SEQ Genetic oligonucleotide ID Reverse oligonucleotide ID marker sequence NO: sequence NO: FLP8 cagggcctacttggtttagtaata 4 gggtactacactagcctattacta 5 None cggttacaaggtctacccaatctg 6 gtcaaacagatagccgcagattgg 7 FLP33/PHI93 tacaaaactactgcaacgcctata 8 cctcaccccaagtatatataggcg 9 FLP27 cattggacctcttccccactaaga 10 tccttgagtccagtgctcttagtg 11 None gaaactaggcgcgtcaggttttat 12 aaggcagccactgaaaataaaacc 13

Example 3

Comparison of Genetic Structure in the Region of the Rcg1 Locus Between Resistant and Susceptible Lines and Expression Profiles of Candidate Genes Found in that Region Between Resistant and Susceptible Lines

[0201] Having found a candidate gene in the region genetically defined to carry the locus responsible for the resistance to anthracnose phenotype, efforts were undertaken first to determine if there might be other genes present in the region and second to determine if the expression patterns of the candidate gene were consistent with its putative role. Fu and Dooner ((2002), Proc Natl Acad Sci 99:9573-9578) and Brunner et al. ((2005), Plant Cell 17:343-360) have demonstrated that different corn inbred lines may have significant rearrangements and lack of colinearity with respect to each other. Comparison of such genomes over larger regions can thus be complex. Such a comparison of the genomes of Mo17 (Missouri 17) and DE811ASR (BC5) revealed that in the region where the candidate gene is found in DE811ASR (BC5), a large insertion relative to Mo17 is present. Regions within and surrounding the insertion were sequenced and scanned for possible genes. A gene encoding a subunit of Ribulose bisphosphate carboxylase (Rubisco, a protein involved in carbon fixation after photosynthesis whose gene is present in multiple copies in the corn genome) was found in both the DE811ASR (BC5) and Mo17 genomes, just downstream of the position of the Rcg1 gene. A pseudogene (a gene rendered nonfunctional due to mutations disrupting the coding sequence) related to a vegetative storage protein was found, present only in the DE811ASR (BC5) genome some distance upstream of the Rcg1 gene. The only structurally intact gene likely to encode a protein with a function likely to be related to disease resistance was the Rcg1 gene isolated in the previous example. Other genes equally unlikely to be involved in disease resistance were located at a greater distance from the most likely position of the locus, as well as a large number of repetitive sequences.

[0202] In order to determine if and where the Rcg1 gene was transcribed, two techniques were used. First, the RNA profiles of resistant and susceptible plant materials were surveyed using Massively Parallel Signature Sequencing (MPSS; Lynx Therapeutics, Berkeley, USA). Briefly, cDNA libraries were constructed and immobilized on microbeads as described (Brenner, S. et al. (2000) Nat. Biotechnol. 18(6): 630-634). The construction of the library on a solid support allows the library to be arrayed in a monolayer and thousands of clones to be subjected to nucleotide sequence analysis in parallel. The analysis results in a "signature" 17-mer sequence whose frequency of occurrence is proportional to the abundance of that transcript in the plant tissue. cDNA derived from RNA prepared from DE811ASR(BC5) and from DE811 (control line, susceptible to Cg) was subjected to MPSS analysis. Bioinformatic inspection of the resulting signatures showed that a signature sequence, referred to herein as Lynx19, (SEQ ID NO: 19) was present at 43 parts per million (ppm) in RNA samples from DE811ASR (BC5) uninfected stalks and at 65 ppm in infected, resistant stalks 9 days post inoculation (DPI) with Cg. This signature sequence was not detected in cDNA libraries of uninfected or Cg-infected stalks of the susceptible corn line DE811. An analysis of the sequence of Rcg1 indicates that the 17-mer tag is present at nucleotides 3945 to 3961 of SEQ ID NO: 1 in the putative 3' untranslated region of the gene.

[0203] Further proof that Rcg1 is exclusively expressed in corn lines that are derived from MP305 and resistant to anthracnose stalk rot was obtained by RT-PCR experiments. Total RNA was isolated from uninfected and Cg-infected stalks of resistant (DE811ASR1 (BC5)) and susceptible (DE811) corn lines using RNA STAT-60.TM. (Iso-Tex Diagnostics, Friendswood, Tex., USA). Total RNA (250 ng) from 0, 3, 6, 9, and 13 DPI resistant and susceptible samples was copied into cDNA and amplified using a GeneAmp.RTM. RNA-PCR kit (Applied Biosystems, Foster City, Calif., USA). The cDNA synthesis reaction was assembled according to the kit protocol using random hexamers as primers and incubated at 42.degree. C. for 45 minutes. For PCR, KEB131 (SEQ ID NO: 20) and KEB138 (SEQ ID NO: 21), both designed from the putative 3' untranslated sequence of Rcg1, were used as the upstream and downstream primers, respectively. The cDNA was amplified for 30 cycles consisting of 1 minute at 94.degree. C., 2 minutes at 50.degree. C. and 3 minutes at 72.degree. C. followed by a 7 minute extension at 72.degree. C. As shown in FIG. 4, agarose gel electrophoresis of an aliquot of the RT-PCRs revealed the presence of a 260 bp band present in the samples derived from both infected and uninfected resistant plants but absent from susceptible samples. DNA sequence analysis confirmed that this fragment corresponded to nt 3625 to 3884 of the Rcg1 sequence consistent with the amplification product predicted from primers KEB131 and KEB138.

Example 4

Isolation of Lines Containing Mu Insertions in the Candidate Gene

[0204] One method to determine if a gene is responsible for a phenotype is to disrupt the gene genetically through the insertion of a transposition element (so-called transposon tagging) and then determine if the relevant phenotype of the plant is altered, in this case from resistant to Cg to susceptible to Cg. In corn this can be done using the mutator (Mu) element (Walbot, V. (1992) Annu. Rev. Plant Physiol. Plant Mol. Biol. 43:49-82). The basic strategy, outlined in FIG. 5, was to introduce active mutator elements into lines carrying the resistance gene, isolating plants homozygous for the resistance gene by assaying associated DNA markers as well as resistance to Cg by inoculation with Cg, then crossing those homozygous plants with a susceptible "tester" line. If the resistance gene is dominant, in principle all the resulting progeny would be resistant but heterozygous for the gene. However, if a Mu element inserted into the resistance gene in a way that disrupted its function, that individual would be susceptible to Cg. The disrupted gene can then be isolated and characterized.

[0205] MP305 was crossed with fifteen diverse mutator stocks (lines carrying active mutator elements). The resulting F1s were inter-mated (crossed with each other) in all possible combinations. To track the chromosomal region 4L on which the resistance locus was known to reside (see Example 1) a variety of DNA markers known to be in the vicinity of the locus from the work described in Example 1 were selected and used on the Mu-tagged materials. About 1500 progeny plants from the inter-mating process were examined for resistance to Cg and for the presence of these markers. Analysis of the markers was done using either Southern blots (Botstein et al., (1980) Am. J. Hum. Gen. 32:314-331) for RFLP markers or by PCR for FLP markers as described in Example 1. Plants that were homozygous for all the markers tested and resistant to Cg were selected and test crossed with susceptible tester lines (.DELTA.63, EH6WA and EF09B). About 16,000 test cross seeds generated from these homozygous and resistant plants were then planted and were used as female parents (meaning the pollen producing tassels were removed) and crossed with the susceptible tester lines used as males. All the female plants were screened for susceptibility to Cg. More than ten susceptible plants (putative knockout mutants) were identified. The open pollinated seed from each of these susceptible plants was harvested, along with eight resistant siblings as controls.

[0206] DNA from a pool of 24 seedlings (grown in paper towels) from each of the putative knockouts and the control resistant siblings was extracted. This DNA was used as template for amplifying the flanking sequence from the site of Mu-insertion using gene-specific primers in combination with a consensus primer designed from the terminal inverted repeats (TIR) from the Mutator element sequence (SEQ ID NO: 125). In other words, PCR products would only be observed if a Mu element had inserted into the candidate gene isolated in Example 2. The primers FLP110F, FLP110R, FLP111F, FLP111R, FLP112F, FLP112R, FLP113F, and FLPA1R were used as the gene-specific primers (See Table 1). PCR amplified products were blotted onto nylon membranes and hybridized with a DNA probe from the candidate gene isolated in Example 2. PCR products that showed strong hybridization were excised from the gel, purified, cloned and sequenced. The resulting sequences were analyzed by aligning with sequences from the candidate gene and Mu-TIR. Mutator elements cause a direct 9 bp duplication at the site of insertion. Based on the flanking sequence information and a direct 9 bp duplication, four independent insertions were identified in exon 1 of the candidate gene (FIG. 5). One insertion (m177) was detected approximately 97 bp upstream of the initiation codon, in the 5' untranslated region of the gene. One common insertion event, 270 bp downstream of the initiation codon, was detected in three susceptible plants: m164, m159, and m179. The m171 susceptible plant was found to contain two Mu-insertions, 556 bp and 286 bp downstream of the initiation codon. When Southern blots were carried out using the exon1 region of the gene as a DNA probe, the modified hybridization pattern observed further confirmed these results.

[0207] This and the preceding examples may be summarized as follows. The earlier work cited in Example 1 showed that a previously observed locus conferring resistance to Cg was localized on the long arm of maize chromosome 4. The nature of this locus, its exact location or the gene(s) encoded by it were completely unknown. The work done in Example 1 demonstrates that the locus can be mapped to a very small region of the long arm of chromosome 4. Example 2 demonstrates that there is only one gene to be found in this chromosomal region likely to be such a resistance gene. It encodes a novel form of an NBS-LRR protein, a family of proteins known to be involved in resistance to pathogens but which vary widely in their sequence and specificity of resistance. Example 3 shows that this gene is present only in the resistant line, not the isogenic susceptible line, and that transcripts corresponding to this gene are found in the resistant line, indicating that the gene is expressed, and these transcripts are found only in the resistant line. Example 4 demonstrates that in four independently isolated Mu insertion events, when the gene is disrupted by insertion of a Mu element, the phenotype of these plants is changed from resistant to susceptible to Cg. Taken together, these data provide overwhelming evidence that the subject of the embodiments of this invention is a gene that can enhance or confer Cg resistance to corn plants.

Example 5

Backcrossing of the Rcg1 Locus into Susceptible Lines

[0208] An Rcg1 locus introgression of an inbred was made to confirm that the Rcg1 locus could be successfully backcrossed into inbreds, and that hybrids produced with the inbred line with the Rcg1 locus would have enhanced or conferred Cg resistance. DE811ASR (BC5) was also developed and used as an improved donor source for introgression of the Rcg1 locus. Next, several additional inbreds were utilized as recurrent parents in order to use the marker assisted breeding methods described herein to efficiently introgress the Rcg1 locus into a variety of inbred and hybrid genetic backgrounds, thereby enhancing or conferring resistance to Cg. Each of these examples are discussed in more detail below.

Proof of Concept (PH09B)

[0209] MP305 is a white kernel color inbred line with strong resistance to Cg, but its late flowering, poor yield and weak agronomic characteristics make it a poor donor parent in the absence of the use of the marker assisted breeding methods described herein. A molecular marker profile of MP305 is provided in Table 6. Primers used for the SSRs reported in the table can be constructed from publicly available sequences found in the Maize GDB on the World Wide Web at maizegdb.org (sponsored by the USDA Agricultural Research Service), in Sharopova et al. (Plant Mol. Biol. 48(5-6):463-481), and/or in Lee et al. (Plant Mol. Biol. 48(5-6); 453-461). UMC15a is an RFLP marker, and the score reported is based on EcoR1 restriction.

[0210] To demonstrate the phenotypic value of the Rcg1 locus, the locus was first introgressed into line PH09B (U.S. Pat. No. 5,859,354) through to the BC3 stage as follows. The F1 population derived from the cross between MP305 and line PH09B was backcrossed once more to line PH09B, resulting in a BC1 population. Seedlings were planted out and backcrossed again to line PH09B to develop a BC2 population. DNA was prepared from leaf punches of BC2 families. To determine which BC2 families to plant for further backcrosses, genotyping was carried out on DNA from BC2 families using primers for markers flanking the region of interest, UMC2041, PHI093 and CSU166 (See Table 1). Seeds from BC2 families were planted and individual plants were genotyped again for the presence of the MP305 version of that region of the chromosome using the same three markers noted above. Positive plants were backcrossed to line PH09B once more to develop BC3 populations. Seed from these BC3 populations was planted and plants were selfed to obtain BC3S1 families segregating for the region of interest as well as BC3S1 families missing the region of interest. These families were used for phenotypic comparison (BC3S1 segregating versus BC3S1 without the region of interest).

[0211] In order to observe the performance of the Rcg1 gene in a heterozygous situation such as would be found in a commercial hybrid, appropriate testcrosses were made. Specifically, BC3S1 families segregating for the region of interest were planted and individual BC3S1 plants were genotyped. Plants homozygous for the Rcg1 gene as well as plants homozygous for the null allele (lacking the gene on both chromosomes) within each family were used to make testcrosses with inbreds PH2EJ (U.S. Pat. No. 6,333,453), PH2NO (U.S. Pat. No. 6,124,533), PH4CV (U.S. Pat. No. 6,897,363) and PH8CW (U.S. Pat. No. 6,784,349).

[0212] In the case of both the BC3S1 lines and the hybrids, the observed phenotypic differences indicated significant improvement for ASR resistance in lines and hybrids containing the region carrying Rcg1. The effect of the introgressed Rcg1 locus in the BC3S1 families and the derived testcross hybrids resulted in an improvement in terms of both the number of internodes infected and the number of internodes infected at more than 75%. The scores, using a visual scoring system commonly used by plant breeders, are shown in Table 5 below. The data clearly demonstrate that using crossing techniques to move the gene of the embodiments into other lines genetically competent to use the gene result in enhanced resistance to Cg.

TABLE-US-00005 TABLE 5 Effect of the introgressed Rcg1 region on degree of resistance to anthracnose stalk rot in BC3S1 families and derived test crosses. Number of Number of internodes internodes >75% Rcg 1 infected infected BC3S1 Absent 3.1 2.4 Present 2.3 1.5 Difference 0.8 0.9 PH2EJ Absent 2.6 1.5 Present 2.1 0.9 Difference 0.5 0.6 PH2NO Absent 3.0 2.1 Present 2.4 1.3 Difference 0.6 0.8 PH4CV Absent 2.8 1.8 Present 2.2 1.0 Difference 0.6 0.8 PH8CW Absent 2.9 1.7 Present 2.3 0.8 Difference 0.6 0.9

TABLE-US-00006 TABLE 6 Molecular marker profile of MP305 Marker Base Pair Base Pair Name Weight Bin Marker Name Weight Bin phi295450 191.1 4.01 umc1667 154.65 4.08 phi213984 302.23 4.01 phi438301 212.76 4.05 phi096 235.07 4.04 umc1808 106.67 4.08 mmc0471 241.6 4.04 umc1043 199.6 4.07 umc1969 65.01 4.05 umc1871 148.48 4.08 umc1662 116.14 4.05 dupssr28 100.64 4.08 umc2061 125.34 4.05 umc1466 110.91 4.08 phi079 185.76 4.05 umc1418 153.12 4.08 bnlg1937 235.87 4.05 umc1899 111.81 4.08 umc1382 153.7 4.05 bnlg2162 144.98 4.08 bnlg1217 194.36 4.05 umc2041 165.17 4.08 umc1390 133.46 4.05 umc2285 156 4.08 bnlg1265 221.83 4.05 umc1086 95.57 4.08 umc1303 127.2 4.05 umc1612 108.54 4.08 bnlg252 167.85 4.06 umc15a approx 10 kb 4.08 umc1895 142 4.05 with EcoRI umc1175 279.6 4.05 restriction umc1317 110.12 4.05 cdo365 411.5 4.08 umc1548 159.52 4.05 umc1051 125.9 4.08 umc1451 110.69 4.05 umc2187 84.94 4.08 umc1896 87.89 4.05 umc1371 120.6 4.08 umc1511 166.43 4.05 umc1132 132.14 4.08 umc1851 114.13 4.05 umc1856 156.88 4.08 umc1791 153.23 4.05 umc2153 131.97 4.08 bnlg1755 216.93 4.05 umc2200 151 4.08 umc1702 94.8 4.05 phi066 160 4.08 umc1346 96.39 4.05 umc1039 222.7 4.08 umc1142 146.98 4.05 umc2139 134.2 4.09 mmc0371 230.82 4.06 umc1559 141.09 4.09 umc1945 113.52 4.06 umc1999 131.55 4.09 umc1093 222.7 4.06 umc1820 138.94 4.09 umc2027 111 4.06 umc1173 168.02 4.09 bnlg1621 184.11 4.06 umc1650 139.84 4.09 umc1299 144.46 4.06 umc1328 161.33 4.09 umc1869 154.39 4.06 umc1740 98.2 4.09 bnlg2291 201.5 4.06 umc1643 145.23 4.09 bnlg1784 237.23 4.07 umc1989 100.5 4.09 dupssr34 326.01 4.07 umc1284 144.39 4.09 umc1651 99.59 4.07 umc1574 155.11 4.09 umc2038 122.19 4.07 umc2137 158.1 4.08 umc1847 160.17 4.07 umc1101 160.12 4.09 umc1620 148.2 4.07 umc2046 115.82 4.09 umc1194 162.29 4.07 phi314704 143.54 4.09 bnlg1890 251.68 4.11 phi076 158.05 4.11

DE811ASR(BC5) as Most Improved Donor for Use in Backcrossing

[0213] Although MP305 was utilized in the above experiment, as is illustrated in FIG. 8(a), DE811ASR(BC5) retains a smaller MP305 chromosomal interval with the Rcg1 locus than DE811ASR(BC3) (and of course MP305 as well), and therefore is particularly useful as a donor source for the Rcg1 gene. The shortened chromosomal interval from the DE811ASR(BC5) source has been shown to be associated with an improved agronomic phenotype. Twenty two plants from the DE811ASR(BC3) derived line, 20 plants from the DE811ASR(BC5) derived line, five DE811 plants and five MP305 plants were grown in a greenhouse from November 2005 through March 2006 and data were taken for plant height and ear height; dates when 50% of the plants shed pollen (midshed), when 50% of the plants had visual ear shoots (midves) and when 50% of the plants had silks protruding from the earshoots (midslk); and kernel color was observed. On average, the DE811ASR(BC5) line was shorter than DE811ASR(BC3) (293 cm vs 345 cm) and the location of the ear was lower in the DE811ASR(BC5) than in the DE811ASR(BC3) (146 cm vs 183 cm), both of which are positive traits in terms of elite variety development. DE811ASR(BC5) was earlier for midshed, midves and midslk compared to DE811ASR(BC3). Midshed was approximately 1 day earlier, midves was approximately 6 days earlier and midslk was approximately 3 days earlier for DE811ASR(BC5) compared to DE811ASR(BC3). Kernels of DE811ASR(BC5) had a yellowish-brown (bronze) color whereas kernels of DE811ASR(BC3) had a pale yellow cap. Dates for midshed, midves and midslk were similar for DE811ASR(BC5) and DE811, whereas MP305 was approximately 11 days later for midshed and did not produce 50% visual ear shoots, nor 50% silks during the growing period. While these data are based on only a few plants for DE811 and MP305, and ears were not produced on those few lines, these greenhouse results resemble observations of these lines in the field. These data indicate that DE811ASR(BC5) resembles the DE811 recurrent parent much more closely than DE811ASR(BC3). Thus, DE811ASR(BC5) is an excellent initial donor source for the Rcg1 locus and the Rcg1 gene, both genotypically and phenotypically. In addition, DE811ASR(BC5) is particularly useful when introgressing the Rcg1 locus into germplasm with similar adaptation to DE811.

[0214] DE811 was developed by J. Hawk (Hawk, J. A. (1985). Crop Science Vol 25: p716) and has been described as a yellow dent inbred line that originated from selfing and selection for six generations in a pedigree program out of a cross of B68 to an inbred derived from [B37 Ht.times. (C103.times.Mp3204 double cross) sel.]. DE811 silked 1 to 2 days later than B73 in tests in Delaware, but 4 days later than B73 at Missouri. Limited yield trials indicate that DE811 has satisfactory combining ability. It is a good silker (forms good silks, a component of the maize female flower important for fertility) and pollen shedder and can be crossed to earlier maturity germplasm for Northern US adaptation and to later maturity germplasm for Southern US adaptation. Thus, DE811ASR (BC5), in combination with the markers and breeding methods disclosed herein, is useful as an initial donor source for introgressing the Rcg1 gene into a wide variety of germplasm, including germplasm adapted to all of the regions in the US where Cg is present.

Creation of Inbred Rcg1 Locus Conversions

[0215] Following the tests for successful Rcg1 locus introgression in PH09B described above, additional Rcg1 locus conversions were carried out on other inbred lines. The first series had 5 backcrosses, with MP305 and DE811ASR(BC5) as donors. For the second series of backcrosses, molecular markers were used to reduce the chromosome interval in the BC5 conversions from the first series. These BC5 conversions were selected for crossovers below the Rcg1 gene. Those selected plants were then backcrossed to create the BC6 generation. Plants with crossovers above the gene were selected in the BC6 generation.

First Series of Backcrosses

[0216] In the first series, DE811ASR(BC5) was used as the primary donor source, but parallel introgressions were also made to the same inbreds using MP305 as a donor source. These data, described in more detail below, show that while DE811ASR(BC5) is the preferred donor in many situations, MP305 can also be effectively used with the marker assisted breeding methods of the embodiments taught herein.

[0217] Elite inbred lines primarily adapted to North American growing conditions were selected for use as recurrent parents. The inbreds lines initially selected for use as recurrent parents were lines PHOR8 (U.S. Pat. No. 6,717,036), PH7CH (U.S. Pat. No. 6,730,835), PH705 (U.S. Pat. No. 6,903,25), PH5W4 (U.S. Pat. No. 6,717,040), PH51 K (U.S. Pat. No. 6,881,881) and PH87P (U.S. Pat. No. 6,888,051). Each of these lines was crossed with DE811ASR (BC5) as well as with MP305. The F1 generation derived from each of these crosses was backcrossed once more to the respective inbred line, resulting in a first backcross (the recurrent parent BC1) generation. Seedlings were planted out and DNA was prepared from leaf punches. PCR reactions were carried out using primers for markers flanking the region of interest; UMC1466, UMC1418, BNLG2162, UMC1086, UMC2041, UMC1612, CSU166, UMC1051, UMC2187, UMC1371, and UMC1856 were used in the early BC rounds (See Table 1) while in later BC rounds, UMC1418, BNLG2162, UMC1051, UMC2041, UMC2187, UMC1371 and UMC1856 were used. Seedlings whose PCR reactions gave a positive result (meaning that the MP305 derived Rcg1 locus was present) were then further backcrossed to the respective inbred lines to make a BC2. This procedure, called "genotyping", identifies the genetic composition of a plant at the site of a particular marker. These steps were repeated for the recurrent parent BC3, BC4 and BC5 development. Analysis shows that, after five backcrosses, these lines retained a significantly truncated chromosomal interval comprising the Rcg1 locus, and, based on visual observations, no indication of negative effects resulting from the presence of the Rcg1 locus was observed.

[0218] Recurrent parent selection was also carried out by selecting the plants most phenotypically like the recurrent parent. Using these genotypic and phenotypic methods, high quality conversions were selected with a high percentage of recurrent parent across the whole genome.

[0219] This example also illustrates that flanking markers are not used exclusively to select either for or away from the Rcg1 gene. Seedlings whose PCR reactions gave a positive result (meaning that the MP305 derived Rcg1 locus was present) were then further backcrossed to the respective inbred lines to make the final backcross (the recurrent parent BC5 generation) in this first series. Where the closest flanking polymorphic markers determined that the gene was present, the next set of double flanking polymorphic markers more distal to the gene were used for recurrent parent selection. Thus, the use of markers flanking the Rcg1 gene or Rcg1 locus serves to illuminate the recombination occurring in the region.

Second Series of Backcrossing

[0220] The inbred Rcg1 locus conversions made using the SSRs flanking the Rcg1 locus in the first series of backcrossing were then used as donors in a successive round of backcrossing. For this series of backcrossing, SNP markers were developed for the Rcg1 gene that enabled marker assisted selection in a high throughput manner, as described in Example 13, to select for the Rcg1 gene. SNP markers were also designed in the region around the Rcg1 locus, allowing flanking markers to be used to select away from the MP305 chromosomal interval surrounding the Rcg1 locus, and to select for the recurrent parent genotype, thereby greatly reducing linkage drag. It is only through physically mapping and cloning the gene that such precise marker-assisted recurrent parent selection is possible.

[0221] First, the recurrent parent BC5 plants resulting from the first series of backcrossing were re-screened with the more precise marker set, and recombination was selected for south of the Rcg1 gene. Flanking markers tightly linked to the Rcg1 gene (MZA8761, MZA1851, UMC1051, and UMC2187) were used to select for recurrent parent to the south of the gene in small population sizes of approximately 40 progeny. (See FIG. 8(a-b)). These progeny were then analyzed using the FLP markers disclosed herein, to more precisely determine the point of recombination. This data showed that some progeny were selected with recurrent parent genome less than 1 cM (based on IBM2 Neighbors genetic map distances) south of the Rcg1 gene, as shown in FIG. 8(b). Other progeny had recurrent parent genome less than 4 cM south of the Rcg1 gene. These marker-selected BC5 conversions were then used as donors, and crossed to near-isogenic counterparts of PH705, PH5W4, PH51 K and PH87P as the recurrent parents to give a BC6 population. Markers in the Rcg1 gene were again used to select for Rcg1, with flanking markers to the north of Rcg1 this time being used to select for recurrent parent. In this round of selections, recombinations were detected in each population between Rcg1 and the marker MZA15842. The position of MZA15842 on the IBM2 Neighbors genetic map can be extrapolated from its position on the high resolution map shown in FIG. 7(b), map B, using regression relative to the flanking markers UMC2285 and PHI093. This placed MZA15842 at 520.5 cM on the IBM2 Neighbors genetic map. Therefore, as shown in FIG. 8(b), in two rounds of backcrossing, the donor genome was reduced to a segment of less than 6 cM in each population, or less than 0.8% of chromosome 4, based on the IBM2 Neighbors genetic map distances, and in some progeny the segment was less than 2.1 cM, or less than 0.25% of chromosome 4. For comparison, the MP305 chromosomal interval with the Rcg1 locus in DE811ASR (BC3) was 131 cM, or approximately 16% of chromosome 4, based on the IBM2 Neighbors genetic map distances. It is only through physically mapping and cloning the gene that such precise and efficient marker-assisted recurrent parent selection is possible.

Further Analysis

[0222] Therefore, as a result of fine mapping the location of the Rcg1 gene, one may utilize any two flanking markers that are genetically linked with the Rcg1 gene to select for a small chromosomal region with crossovers both north and south of the Rcg1 gene. This has the benefit of reducing linkage drag, which can be a confounding factor when trying to introgress a specific gene from non-adapted germplasm, such as MP305, into elite germplasm, such as the inbred lines noted above. FIGS. 7 and 22, and Table 16 show many combinations of markers flanking the Rcg1 gene and locus that may be used for this purpose. Some specific flanking markers that may be used for selecting truncated chromosomal intervals that include the Rcg1 gene or locus are UMC2285 and UMC15a, UMC2285 and UMC2187, UMC1086 and UMC2200, UMC2041 and UMC2200, UMC2041 and PHI093, MZA11455 and UMC15a, MZA11455 and MZA3434, MZA15842 and MZA3434, and FLP8 and FLP33. Optionally, on or within each of these chromosomal intervals, one could utilize at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more markers in order to locate the recombination event and select for the Rcg1 gene or Rcg1 locus with the maximum amount of recurrent parent genotype. Further, one may have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more markers between the north end of such chromosomal interval and the top of the Rcg1 gene and/or between the south end of such chromosomal interval and the bottom of the Rcg1 gene.

[0223] It is advantageous to have closely linked flanking markers for selection of a gene, and highly advantageous to have markers within the gene itself. This is an improvement over the use of a single marker or distant flanking markers, since with a single marker or with distant flanking markers the linkage associated with Rcg1 may be broken, and by selecting for such markers one is more likely to inadvertently select for plants without the Rcg1 gene. Since marker assisted selection is often used instead of phenotypic selection once the marker-trait association has been confirmed, the unfortunate result of such a mistake would be to select plants that are not resistant to Cg and to discard plants that are resistant to Cg. In this regard, markers within the Rcg1 gene are particularly useful, since they will, by definition, remain linked with resistance to Cg as enhanced or conferred by the gene. Further, markers within the Rcg1 locus are just as useful for a similar reason. Due to their very close proximity to the Rcg1 gene they are highly likely to remain linked with the Rcg1 gene. Once introgressed with the Rcg1 gene, such elite inbreds may be used both for hybrid seed production and as a donor source for further introgression of the Rcg1 gene into other inbred lines.

[0224] Thus, the data clearly shows that inbred progeny converted by using DE811ASR(BC5) as a donor source retain the truncated MP305 chromosomal interval. The inbreds comprising the truncated MP305 chromosomal interval are very useful as donor sources themselves, and there is no need to revert to DE811ASR(BC5) as a donor source. By using marker assisted breeding as described herein, the truncated MP305 chromosomal interval can be further reduced in size as necessary without concern for losing the linkage between the markers and the Rcg1 gene. Phenotypically, a reduced chromosomal interval is associated with improved agronomic performance, as was demonstrated for DE811ASR(BC5) versus DE811ASR(BC3) described above.

Example 6

Use of Rcg1 as a Transgene to Create Resistant Corn Plants

[0225] The Rcg1 gene can be expressed as a transgene as well, allowing modulation of its expression in different circumstances. The following examples show how the Rcg1 gene could be expressed in different ways to combat different diseases or protect different portions of the plant, or simply to move the Rcg1 gene into different corn lines as a transgene, as an alternative to the method described in Example 5.

Example 6a

[0226] In this example, the Rcg1 gene is expressed using its own promoter. The upstream region of the Rcg1 gene was sequenced using the same BACs which in Example 2 provided the sequences of the protein-coding section of the gene. The sequence of 1684 bp 5' to the ATG is set forth in SEQ ID NO: 24.

[0227] In order to transform the complete Rcg1 gene, including the promoter and protein encoding region, a 5910 bp fragment extending from position 41268 through position 47176 in SEQ ID NO: 137 was amplified by PCR using BAC clone #24 (pk257m7) as template DNA. To enable cloning using the Gateway.RTM. Technology (Invitrogen, Carlsbad, USA), attB sites were incorporated into the PCR primers, and the amplified product was cloned into pDONR221 vector by Gateway.RTM. BP recombination reaction. The resulting fragment, flanked by attL sites, was moved by the Gateway.RTM. LR recombination reaction into a binary vector. The construct DNA was then used for corn transformation as described in Example 7.

Example 6b

[0228] In order to express the Rcg1 gene throughout the plant at a low level, the coding region of the gene and its terminator are placed behind the promoters of either a rice actin gene (U.S. Pat. Nos. 5,641,876 and 5,684,239) or the F3.7 gene (U.S. Pat. No. 5,850,018). To enable cloning using the Gateway.RTM. Technology (Invitrogen, Carlsbad, USA), attB sites are incorporated into PCR primers that are used to amplify the Rcg1 gene starting 35 bp upstream from its initiation codon. A NotI site is added to the attB1 primer. The amplified Rcg1 product is cloned into pDONR221 vector by Gateway.RTM. BP recombination reaction (Invitrogen, Carlsbad, USA). After cloning, the resulting Rcg1 gene is flanked by attL sites and has a unique NotI site at 35 bp upstream the initiation codon. Thereafter, promoter fragments are PCR amplified using primers that contain NotI sites. Each promoter is fused to the NotI site of Rcg1. In the final step, the chimeric gene construct is moved by Gateway.RTM. LR recombination reaction (Invitrogen, Carlsbad, USA) into the binary vector PHP20622. This is used for corn transformation as described in Example 7.

Example 6c

[0229] In order to express the Rcg1 gene throughout the plant at a high level, the coding region of the gene and its terminator were placed behind the promoter, 5' untranslated region and an intron of a maize ubiquitin gene (Christensen et al. (1989) Plant Mol. Biol. 12:619-632; Christensen et al. (1992) Plant Mol. Biol. 18:675-689). To enable cloning using the Gateway.RTM. Technology (Invitrogen, Carlsbad, USA), attB sites were incorporated into PCR primers that were used to amplify the Rcg1 gene starting at 142 bp upstream of the initiation codon. The amplified product was cloned into pDONR221 (Invitrogen, Carlsbad, USA) using a Gateway.RTM. BP recombination reaction (Invitrogen, Carlsbad, USA). After cloning, the resulting Rcg1 gene was flanked by attL sites. In the final step, the Rcg1 clone was moved by Gateway.RTM. LR recombination reaction (Invitrogen, Carlsbad, USA) into a vector which contained the maize ubiquitin promoter, 5' untranslated region and first intron of the ubiquitin gene as described by Christensen et al. (supra) followed by Gateway.RTM. ATTR1 and R2 sites for insertion of the Rcg1 gene, behind the ubiquitin expression cassette. The vector also contained a marker gene suitable for corn transformation, so the resulting plasmid, carrying the chimeric gene (maize ubiquitin promoter--ubiquitin 5' untranslated region--ubiquitin intron 1--Rcg1), was suitable for corn transformation as described in Example 7.

Example 6d

[0230] In order to express the Rcg1 gene at a stalk-preferred, low level of expression, the coding region of the gene and its terminator are placed behind the promoter of the Br2 gene (U.S. application Ser. No. 10/931,077). The fragment described in Example 6b containing the Rcg1 coding region flanked by attL sites and containing a unique NotI site 35 bp upstream of the Rcg1 initiation codon is used to enable cloning using the Gateway.RTM. Technology (Invitrogen, Carlsbad, USA). Promoter fragments of either Br2 or ZM-419 are PCR amplified using primers that contain NotI sites. Each promoter is fused to the NotI site of Rcg1. In the final step, the chimeric gene construct is moved by Gateway.RTM. LR recombination reaction (Invitrogen, Carlsbad, USA) into the binary vector PHP20622. This is used for corn transformation as described in Example 7.

Example 7

Agrobacterium-Mediated Transformation of Maize and Regeneration of Transgenic Plants

[0231] The recombinant DNA constructs prepared in Example 6a and 6c were used to prepare transgenic maize plants as follows.

[0232] Maize was transformed with selected polynucleotide constructs described in Example 6a and 6c using the method of Zhao (U.S. Pat. No. 5,981,840, and PCT patent publication WO98/32326). Briefly, immature embryos were isolated from maize and the embryos contacted with a suspension of Agrobacterium, where the bacteria were capable of transferring the polynucleotide construct to at least one cell of at least one of the immature embryos (step 1: the infection step). In this step the immature embryos were immersed in an Agrobacterium suspension for the initiation of inoculation. The embryos were co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step). The immature embryos were cultured on solid medium following the infection step. Following this co-cultivation period an optional "resting" step was performed. In this resting step, the embryos were incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step). The immature embryos were cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells. Next, inoculated embryos were cultured on medium containing a selective agent, and growing transformed callus was recovered (step 4: the selection step). The callus was then regenerated into plants (step 5: the regeneration step), and calli grown on selective medium were cultured on solid medium to regenerate the plants.

Example 8: Transgenic Plant Evaluation

[0233] Transgenic plants were made as described in Example 7 using the constructs described in Examples 6a and 6c, respectively. For both the native Rcg1 gene and the ubiquitin Rcg1 gene constructs, 30 independent events and 10 vector only control events were generated.

[0234] Leaf discs of each native gene transgenic event were harvested for total RNA isolation. RT-PCR was performed using the gene specific primers FLP111F and FLP111R set forth in SEQ ID NOS: 37 and 38. In 30 out of 30 transgenic events, the expected 637 bp RT-PCR band was present indicating expression of the native gene construct. Disease assays were performed in the greenhouse on the same 30 native Rcg1 transgenic events to determine if the plants were resistant to Cg. To accomplish this, leaf blight assays were first carried out on 5 sibling plants of each event using the procedures described in Example 10. A single event was found to show a significant reduction in disease relative to control plants lacking the native Rcg1 gene construct. Plants that had been subjected to the leaf blight assay were allowed to develop two weeks post anthesis and were then further tested by Cg inoculation into the first elongated stalk internode. These stalk infection assays showed a single transgenic event expressing the native Rcg1 transgene to be more resistant to infection by Cg when compared to control plants. However, this event differed from the positive event identified via the leaf infection assays.

[0235] Plants transformed with the ubiquitin Rcg1 construct described in Example 6c were analyzed in a similar fashion. RT-PCR analysis showed that 28 out of 30 transgenic events contained the expected transcript band, indicating expression of the ubiquitin Rcg1 construct. When leaf infection assays were performed on 5 plants from each of the 30 events, a single event was identified that showed a statistically significant reduction in disease compared to control plants. The transgenic plants were further analyzed by stalk infection assays. Three events were found to exhibit increased resistance to stalk rot when compared to control plants lacking the ubiquitin Rcg1 gene. These transgenic events did not include the former positive event identified in the leaf blight assays.

[0236] The results of these experiments were considered encouraging for the events that showed some resistance but overall inconclusive for several reasons. Positive events showing increased disease resistance by the leaf blight assay failed to correlate with those identified by the stalk infection assay. This is in contrast to the DE811ASR(BC5) positive control which shows a clear increase in resistance relative to DE811 in both leaf blight and stalk infection assays. In addition, assays of the primary transgenics showed a higher degree of variability than assays of DE811 or DE811ASR(BC5) controls. This was often seen within replicates as well as across negative control events. This latter observation may render discrimination of positive from negative events difficult. The possible causes for the inconclusive nature of the disease assay results include but are not limited to the following. It is well known to those skilled in the art that transgenic plants being tissue culture derived, exhibit greater plant to plant variability than control plants that are seed derived. Moreover, gene expression in primary transformants, that is, plants which have been through the transformation and regeneration process described in Example 7, is often unpredictable due to the stress of tissue culture procedures. If, in fact, the events are negative, which cannot be determined at this point, there are several technical reasons why this could be the case. The assays carried out also did not determine if the protein encoded by the Rcg1 gene is actually present in the transgenic lines--only the presence of a segment of the predicted mRNA was assayed using RT-PCR. It could be that artifacts were introduced into the gene cassette during transformation extensive Southern blots or sequencing were not carried out to determine the integrity of the entire construct in the transgenic lines. In order to more carefully study these transgenic lines, plants of later generations will be grown in larger numbers under field conditions and assayed for disease resistance. It is anticipated that these future transgenic plants will more clearly exhibit increased resistance to Cg.

Example 9

Analysis of Rcg1 Gene Distribution Across Germplasm and Identification of Rcg1 Sequence Variants

[0237] Following the identification, sequencing and fine mapping of Rcg1, other lines were screened for the Rcg1 gene. To determine the presence of the Rcg1 gene in other maize germplasm, gene specific primers combinations FLP111F and FLP111R as well as FLP113F and FLPA1R were used to amplify genomic DNA from a diverse panel of maize inbred lines, including those lines listed on Table 18 and F2834T, by polymerase chain reaction. In only 14 (including MP305) out of the panel of maize inbred lines an amplification product was detected, indicating that the Rcg1 gene is only present in a very small percentage of the inbred lines that were screened. Thus, in addition to using MP305 or DE811ASR (BC5) as the donor source, other sources containing the Rcg1 gene can also be used as a donor source. For example the public inbred lines TX601 (available under ID `Ames 22763` from National Plant Germplasm System (NPGS)) and F2834T (available under ID `Ames 27112` from NPGS) which contain the Rcg1 gene can be used as donor sources in crosses with other maize inbred lines not containing the Rcg1 gene, and selecting for the Rcg1 gene by using markers as described herein.

[0238] Variants of the Rcg1 gene were also identified and analyzed for single nucleotide polymorphisms (SNPs). SNPs were identified at positions on Sequence ID number 1 corresponding to one or more of position 413, 958, 971, 1099, 1154, 1235, 1250, 1308, 1607, 2001, 2598 and 3342. (See Table 7). Not all of the allelic variants of the Rcg1 gene indicated a resistant phenotype. Therefore, these SNPs can be used as markers to precisely identify and track the Rcg1 sequence in a plant breeding program, and to distinguish between resistant and susceptible allelic variants. Further, these SNPs indicate that there are variant sequences that show a resistant phenotype and can be used in the methods and products disclosed herein. Four other lines have also been found to contain an Rcg1 allele: BYD10, 7F11, CML261 and CML277. Testing of 10 plants did not provide sufficient data to conclusively determine whether line 7F11 is resistant. No data are available on the resistance of the BYD10, CML261 and CML277 lines, and sequencing of these alleles has not been completed.

TABLE-US-00007 TABLE 7 SNPs identified in allelic variants of the Rcg1 gene # Plants Consensus position Phenotype Tested 413 958 971 1099 1154 1235 1250 1308 1607 2001 2598 3342 SEQ ID NO: 1 Resistant Over 500 A A G C C A A C A A G C from plants over DE811ASR (BC5) 4-5 years PHBTB Resistant 150-210, over A A G C C A A : A G C A 3 years PH26T Resistant 50, over 1 A A G C C A A : A A G C year TX601 Insufficient 10, over 1 A A G C C ? A : A A G C data year F28341 No data -- A A G C C A A : A A G C B54 No data -- C C C T A A T : G G A A PH0RC Insufficient 19, over 1 C C C T A A T : G G A A data year PH277 Insufficient 17, over 1 C C C T A A T : G G A A data year PHDGP Susceptible 150-210, over C C C T A A T : G G A A 3 years PHDH7 No data -- C C C T A A T : G G A A MP305 (public) Resistant 50 A A G C C A A C A A G C Length of Consensus = 4212 nucleotides. SEQ ID NO: 1 is the Rcg1 sequence. For the remaining lines, the sequence available spanned from the "atg" start codon in the first exon to the "tga" stop codon in the second exon. The consensus position is based on SEQ ID NO: 1.

Example 10

Lines Containing the Rcg1 Gene are Resistant to Anthracnose-Induced Leaf Blight

[0239] The near isogenic lines DE811 and DE811ASR described in Example 1 were tested for differences in resistance to leaf blight caused by Cg using the following procedure. Four common household sewing needles were glued to a metal support such that the holes for the thread extended out from the piece of metal, with all four needles extending an equal distance. This apparatus was dipped in a suspension of Cg spores at 5.times.10.sup.6 spores/mL and then pushed through the surface of a young corn leaf such that the leaf was wounded and the wounds simultaneously inoculated with the spores. A wet cotton swab was placed on the midrib near the inoculation site and the entire area covered with plastic film and, over that, reflective cloth, both attached with tape, to keep it moist and shaded. The plants were left in this state for 50-54 hours in a standard greenhouse, after which the tape, cloth and plastic film were removed. At 7 and 15 days after inoculation the size of the lesion was measured and recorded in units of square centimeters.

[0240] FIG. 10(a-b) shows the distribution of lesion sizes 15 days after inoculation across all the individual leaves. Lesion sizes vary in each data set, but virtually all of the DE811 leaves (FIG. 10b) had lesion sizes significantly larger than the largest lesions to be found on the DE811ASR(BC5) leaves (FIG. 10a). The data are summarized for both the 7 day and 15 day post-inoculation data sets in FIG. 11. At both 7 and 15 days, the average lesion size was smaller on the leaves carrying the Rcg1 gene. The difference becomes larger over time as the fungus has time to grow and cause further damage, so that while the difference is approximately two fold at 7 days, by 15 days it is more than four fold and in fact the fungus has made only minor progress on the DE811ASR(BC5) leaves. These results clearly demonstrate that the presence of the locus containing the Rcg1 gene confers resistance to anthracnose leaf blight.

Example 11

Hybrid Lines Derived from DE811ASR(BC5) have Higher Yield than Hybrids Derived from DE811 when Infected with Colletotrichum graminicola

[0241] In order to demonstrate that corn hybrids containing the Rcg1 gene have higher yield potential when infected with Cg than hybrid lines without Rcg1, DE811ASR (BC5) and DE811, the isogenic lines described in Example 1, were each crossed to inbred lines B73Ht and Mol 7Ht, which are both susceptible to Cg.

[0242] The hybrid lines were grown and evaluated for response to Cg in 2005 at six locations in five different states of the USA. For each hybrid line, three replications of four rows were planted at approximately 74,000 plants per hectare. Plants were inoculated with Cg at the base of the stalk approximately 10 days after flowering. The first row of each four-row plot was evaluated to determine if the inoculations had been successful by determining the response to Cg four to five weeks after inoculation. The stalks were split and the progression of the disease was scored by observation of the characteristic black color of the fungus as it grows up the stalk. Disease ratings were conducted as described by Jung et al. (1994) Theoretical and Applied Genetics, 89:413-418). The total number of internodes discolored greater than 75% (antgr75) was recorded on the first five internodes (See FIG. 20). This provided a disease score ranging from 0 to 5, with zero indicating no internodes more than 75% discolored and 5 indicating complete discoloration of the first five internodes. The center two plots were harvested via combine at physiological maturity and grain yield in kg/ha was determined.

[0243] The results summarized over all locations are shown in FIG. 12 for disease severity and in FIG. 13 for yield. The data show that hybrids containing Rcg1 (DE811ASR(BC5)/B73Ht and DE811ASR(BC5)/Mo17Ht) have much less disease progression than hybrids without Rcg1 (DE811/B73Ht and DE811/Mo17Ht). The high scores for disease progression in the susceptible hybrids (lacking Rcg1) show the successful infection of the experiment with Cg. Furthermore, the data show that when infected with Cg, hybrids containing Rcg1 have a higher yield than hybrids lacking Rcg1. Differences of the individual pairwise comparisons are significant at P<0.05.

[0244] These results clearly demonstrate that by using the methods of the embodiments one can create hybrids which yield more kg of grain per hectare when infected with Cg.

Example 12

Inbred and Hybrid Rcg1 Locus Conversions Derived from DE811ASR (BC5) or MP305 are Resistant to Colletotrichum graminicola Induced Stalk Rot

[0245] In order to demonstrate that commercial corn lines can be made resistant to Cg-induced stalk rot, MP305 and DE811ASR (BC5) were crossed with PH87P, PH5W4, and PH705. The resulting progeny were crossed again to the same three lines (i.e., the lines were used as recurrent parents in a backcrossing program) three more times, each time selecting for the presence of the Rcg1 gene using molecular markers as described in Example 5 above. As controls, selected backcross lines which lacked the Rcg1 gene were also collected from the same backcrossing program. After three backcrosses were completed, several versions were selected and selfed to obtain BC3S1 families. Individual BC3S1 plants were genotyped and plants homozygous positive and homozygous negative for Rcg1 were selfed to obtain BC3S2 families, which were then phenotyped. BC3S2 versions containing Rcg1 and, as controls, selected versions without the gene, were planted in single row plots containing approximately 25 plants per row. The experiment was planted in five different locations in five different states of the United States, designated Locations 1, 2, 3, 4, and 5. At approximately two weeks after flowering, plants were inoculated with Cg at the base of the stalk. Four to five weeks later the stalks were split and progression of the disease evaluated by visually estimating the amount of disease in the stalk. A visual score was assigned to each stalk based on the degree of infection of each internode for the inoculated internode and the four internodes above the inoculation internode. A low score thus indicates resistance to the disease. The compiled results for all rows and locations are summarized in FIG. 14. Representative pictures of two lines are shown in FIGS. 15 and 16. The data show that at all locations, each of the elite inbred lines was made more resistant to the disease by the presence of the Rcg1 gene.

[0246] Corn seed sold to farmers is "hybrid," meaning that it is most commonly the result of a cross of two inbred parents, referred to as a single cross hybrid. Many years of breeding and production experience have shown that the use of single cross hybrids result in higher yields. It is thus important for commercial applications that the Rcg1 gene function in the hybrid plants (those in the farmer's production field) even when it is present in only one of the two parents used to make single cross hybrid seed. One of the inbred lines into which the Rcg1 line had been crossed, PH705, was thus used to create hybrid seed by crossing with PH4CV, an elite inbred that does not carry the Rcg1 gene. The resulting hybrid seeds were used in experiments identical to those described for the inbred lines as discussed above and scored in the same way at all five locations. The data are summarized for all locations in FIG. 17, which also shows the performance of the inbred PH705, and representative pictures shown in FIGS. 18 and 19. As can be seen, a clear difference in disease progression was observed in all locations for hybrid PH705.times.PH5W4 and in four of the five locations for PH705.times.PH87P. In the fifth location, environmental conditions were very stressful for plant growth, resulting in plants that were in poor condition. Under these conditions, measurements of plant disease resistance are often not reliable.

[0247] The results with both inbred lines and hybrid combinations containing Rcg1 clearly demonstrate that using the methods of the embodiments one can create commercially useful lines which are resistant to Cg-induced stalk rot.

Example 13

Markers within the Rcg1 Coding Sequence, Marker Locations and Designs within the Rcg1 Locus, and Haplotypes for the Flanking Chromosomal Region

[0248] Three levels of marker locations may be utilized as a result of the fine mapping and cloning of the Rcg1 gene, markers designed within the Rcg1 coding sequence, markers designed within the non-colinear region that identify the Rcg1 locus (but outside of the Rcg1 coding sequence), and markers designed within the flanking colinear region.

Markers within the Rcg1 Coding Sequence

[0249] Following the identification and fine mapping of the Rcg1 gene, hybridization markers were designed that will function on SNP platforms. Since the Rcg1 gene occurs in a non-colinear region of the maize genome, the hybridization marker will be present in lines comprising the Rcg1 gene and absent on lines that do not comprise the Rcg1 gene. These markers identify polynucleotide sequences specific to the Rcg1 coding sequence listed on SEQ ID NO: 1. As noted in Table 7, there are other corn lines with variants of the Rcg1 coding sequence set forth in SEQ ID NO: 1, and these markers were also designed to also identify these Rcg1 coding sequence variants.

[0250] To accomplish this, a consensus map of variant Rcg1 coding sequence from different sources was created, as shown on Table 7. This consensus map aligned 4209 bases of the Rcg1 coding sequence isolated from MP305 with 3451 bases from PHBTB and 3457 bases from PH26T. The Rcg1 gene in both PHBTB and PH26T show resistance to anthracnose. Next, segments of the Rcg1 coding sequence were BLASTed against several databases including NT (Public DNA from NCBI) and the highest homology hits were aligned with the Rcg1 consensus sequence to determine the segments that shared high homology and had common segments with other resistance genes in the NBS-LRR family. Regions unique to the Rcg1 coding sequence and common across the different sources of Rcg1 were selected for marker design. Specifically, since FLP111F and FLP111R primers produced a single amplicon that reliably diagnosed the presence of Rcg1 from different sources, the regions where FLP111F and FLP111R hybridized were therefore targeted for development of a SNP marker design.

[0251] An Invader.TM. (Third Wave Technologies, Madison, Wis.) marker was designed using a 1413 bp segment from the consensus sequence that contained both primer sites, with the primer regions themselves being targeted for probe and Invader.TM. oligo hybridization. Primers were designed around each probe site to give an amplicon size below 150 bp. This marker indicated the presence of the Rcg1 coding sequence with fluorescence due to hybridization, with the absence of the Rcg1 coding sequence resulting in no fluorescence. A control fluorescence signal can also be generated by designing a marker that hybridizes to a second highly conserved maize gene, so that the presence of the Rcg1 coding sequence results in fluorescence of two dyes (Rcg1 and the conserved gene) and the absence of Rcg1 results in fluorescence due to the conserved gene only. This `control` florescence may be used to reduce lab error by distinguishing between the situations where the Rcg1 is in fact absent and the situation where a false negative has occurred because of a failed reaction. Such markers are not limited to a specific marker detection platform. Taqman.RTM. markers (Applied Biosystems) were also designed to the same location (primer pairs FLP111F and FLP111R), that were used as for the Invader.TM. markers. The markers are shown on Table 15 and FIGS. 23 and 24.

[0252] The marker designs C00060-01-A and C00060-02-A were tested across a wide variety of sources and were highly successful at identifying plants that contained the Rcg1 locus and the Rcg1 gene, regardless of the source of the Rcg1 locus or Rcg1 gene. These markers were also used against a control set of nearly 100 diverse inbred lines known not to carry the gene, and no fluorescence was detected in the control set. Plants in which one or both of marker designs C00060-01-A and C00060-02-A confirmed as having Rcg1 include those shown in Table 7.

[0253] Therefore, this example shows that, based on the teaching provided herein, markers can be constructed that identify the Rcg1 coding sequence in a variety of sources.

Markers within the Rcg1 Locus

[0254] Markers may be designed to the Rcg1 locus in addition to or instead of using markers within the Rcg1 coding sequence itself. The close physical distance between the Rcg1 coding sequence and the non-colinear region makes it unlikely that the linkage between markers within the non-colinear region but outside of the Rcg1 coding sequence would be lost through recombination. As with markers for the Rcg1 coding sequence, a marker showing as present or absent would be sufficient to identify the Rcg1 locus.

[0255] To design markers for this region, a 64,460 bp segment of non-colinear region including the Rcg1 gene and the region directly north of the Rcg1 gene was sequenced. BACs in this sequence were broken up into sub-clones of approximately 800 nucleotides in length and sequenced. These sequences were then assembled to construct the BAC sequence, and genic and repetitive regions were identified. Repetitive regions were identified in order to avoid placing markers in repetitive regions. Similarly, sequences with high homology with known maize sequences were easily avoided by a simple BLAST search. Potential sequences were avoided that contained SSRs, runs of As, Ts or Gs, or that would result in the generation of probes low in GC content which can cause problems within the Invader.TM. platform. See FIG. 9(b) and Table 17.

[0256] Selected segments were then put into Invader Creator.TM. software (Third Wave, Madison, Wis.), which generates oligos for an Invader.TM. reaction. This produced a sense and an anti-sense design for all SNPs. The sense designs with the best scores and no penalties were selected. Although these markers have been designed, they have not yet been tested.

[0257] Primers were designed using Primer3 (Steve Rozen and Helen J. Skaletsky (2000) Primer3 available on the world wide web for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, N.J., pp 365-386). Primers were selected outside of the Invader.TM. components, and preferred primers close to or below 150 bp long were selected. Primer temperature and length was adjusted to be most useful for the Invader.TM. platform, although if using other detection platforms primers would be optimized for use with such platforms.

Markers in the Colinear Region and Associated Haplotypes

[0258] Closely linked markers flanking the Rcg1 locus may be effectively used to select for a progeny plant that has inherited the Rcg1 locus from a parent that comprises the Rcg1 locus. The markers described herein, such as those listed on Table 16, as well as other markers genetically or physically mapped to the same chromosomal segment, may be used to select for a truncated chromosomal segment comprising the Rcg1 locus. Typically, a set of these markers will be used, (e.g., 2 or more, 3 or more, 4 or more, 5 or more) in the flanking region above the gene and a similar set in the flanking region below the gene. Optionally, as described above, a marker within the Rcg1 gene and/or Rcg1 locus may also be used. The parents and their progeny are screened for these sets of markers, and the markers that are polymorphic between the two parents are used for selection. The most proximal polymorphic markers to the Rcg1 gene or Rcg1 locus are used to select for the gene or locus, and the more distal polymorphic markers are used to select against the gene or locus. In an introgression program, this allows for selection of the Rcg1 gene or Rcg1 locus genotype at the more proximal polymorphic markers, and selection for the recurrent parent genotype at the more distal polymorphic markers. As described in more detail in Example 5 above, this process allowed for the efficient selection of a truncated chromosomal segment comprising the Rcg1 locus.

[0259] The process described above requires knowledge of the parental genotypes used in the cross. Optionally, haplotypes may be used so that the Rcg1 gene or Rcg1 locus can be selected for without first genotyping the specific parents used in the cross. This is a highly efficient way to select for the Rcg1 locus, especially in the absence of using markers within the Rcg1 gene or the Rcg1 locus.

[0260] All plants to be used in the breeding program, such as a gene introgression program, are screened with markers. The markers disclosed herein or equivalent markers on the same chromosomal segment may be used. The plant haplotypes (a series of SNP or other markers in linkage disequilibrium) are noted. The haplotype of the resistant plant around the Rcg1 locus is compared with the haplotype of the other plants to be used that do not comprise the Rcg1 locus. A haplotype unique to the resistant plant around the Rcg1 locus is then used for selection, and this haplotype will specifically identify the chromosomal segment from the resistant plant with the Rcg1 locus.

[0261] Based on an analysis of MP305 and a diverse set of several hundred corn lines, including 50 public corn lines shown in Table 18, a unique SNP haplotype for the MP305 chromosomal segment with the Rcg1 locus was identified. This SNP haplotype uniquely identifies the MP305 chromosomal segment that extends across MZA3434, MZA2591 and MZA11123. See FIG. 22, SEQ ID NO: 140, 141 and 142, and Tables 8, 9 and 10.

[0262] First, the primer pairs described in Table 2 for these three MZA's were used to identify haplotypes. The primer pairs MZA3434 E forward and reverse were used to amplify the genomic DNA of the set of corn lines. The PCR fragments were further purified by amplification with MZA3434 I forward and reverse primer pairs. This process was repeated for MZA2591 and MZA11123. The resulting PCR fragments were sequenced in the forward and reverse direction and the sequences were aligned to give a consensus sequence (see the sequences set forth in SEQ ID NOs: 140, 141 and 142). SNPs and indels within these consensus sequences are shown in Tables 8, 9 and 10. These series of SNPs and indels were compared across the set of genotypes.

[0263] For MZA3434, haplotype 8 was a rare haplotype allele, and was unique to MP305 and only one other corn line. This process was repeated for MZA2591, and MP305 was found to have haplotype 2 at MZA2591, which was shared by only two other corn lines. MP305 was the only corn line to have both haplotype 8 at MZA3434 and haplotype 2 at MZA2591, and therefore, the combination of these two haplotypes, 8 at MZA3434 and 2 at MZA2591, uniquely identifies the MP305 chromosomal region comprising the Rcg1 locus. MP305 also had an informative haplotype at MZA11123. MP305 was found to have haplotype 7, which was shared by 66 other corn lines, but none of these corn lines had haplotype 8 at MZA3434, or haplotype 2 at MZA2591. Therefore, any combination of 2 haplotypes at MZA3434, MZA2591 or MZA11123 could be used to uniquely identify MP305 among these genotypes. The haplotypes can then be interrogated by sequencing the fragment or by designing markers to each SNP or indel within a fragment.

[0264] Polymorphisms within haplotypes can be used to tag the haplotype. So called `Tag-SNPs`, or `haplotype-tags` can be very useful in plant breeding, as more information than the polymorphism itself can be determined via extrapolation to the haplotype. A haplotype can also be defined as a series of polymorphisms across sequences, and these may be termed `long-range haplotypes`.

[0265] Rare polymorphisms were observed within haplotypes that could be used as taplotype tags'. For example, either the SNPs MZA2591.32 (allele c) or MZA2591.35 (allele t) could be used to tag the haplotype 2 at MZA2591, and like haplotype 2, both were unique to MP305 and two other corn lines. The combination of SNPs MZA2591.32 (allele c) and MZA2591.35 (allele t) combined with MZA3434.17 (allele c) gave a `long-range` haplotype that could be used to distinguish MP305 from all of the other genotypes in the study.

[0266] In addition, other markers, MZA15842, MZA11455, MZA8761 and MZA1851 also showed polymorphism with MP305. For MZA15842, only 18 of the other corn lines shared the same haplotype as MP305; for MZA11455, only 43 of the other corn lines shared the same haplotype as MP305; for MZA8761, only about half of the other corn lines shared the same haplotype as MP305; and for MZA1851, only about half of the other corn lines shared the same haplotype as MP305. Consensus sequences were developed for these markers, and are set forth in SEQ ID NOs: 143-146. SNPs and indels within these consensus sequences are shown in Tables 11-14. Four examples of unique haplotypes using the MZA markers are:

MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA8761 (haplotype 1) and MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA1851 (haplotype 1)

And

[0267] MZA11455 (haplotype 6) MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA16510 (haplotype 4) and MZA11455 (haplotype 6) MZA11123 (haplotype 7) MZA15842 (haplotype 3) MZA11394 (haplotype 6).

[0268] Multiple combination within all of the markers disclosed herein, or other markers within the region, also will contain unique haplotypes that identify the Rcg1 locus.

TABLE-US-00008 TABLE 8 MZA3434 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA3434.3 MZA3434.4 MZA3434.6 MZA3434.17 MZA3434.2 MZA3434.5 Nucleotide position 282 283 327 343 377 387 on SEQ ID NO: 140 Type DEL DEL DEL SNP DEL DEL Size of indel 6 1 4 2 2 MP305 W M W C W M Counter allele M W M T M W

TABLE-US-00009 TABLE 9 MZA2591 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA2591.43 MZA2591.20 MZA2591.21 MZA2591.8 MZA2591.12 MZA2591.4 Nucleotide position 101 114 124 131 160 176 on SEQ ID NO: 141 Type INS SNP SNP DEL DEL INS Size of indel 3 2 3 MP305 W T C W W W Counter allele M A T M M M MZA2591.31 MZA2591.32 MZA2591.1 MZA2591.33 MZA2591.35 MZA2591.36 Nucleotide position 213 223 238 250 257 264 on SEQ ID NO: 141 Type SNP SNP DEL SNP SNP SNP Size of indel 2 MP305 T C M C T C Counter allele C T W G A G

TABLE-US-00010 TABLE 9 MZA2591 M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA2591.37 MZA2591.38 MZA2591.10 MZA2591.39 MZA2591.3 Nucleotide position 271 282 290 310 313 on SEQ ID NO: 141 Type SNP SNP DEL SNP DEL Size of indel 4 2 MP305 G C M T M Counter Allele A T W C W MZA2591.40 MZA2591.41 MZA2591.6 MZA2591.7 MZA2591.9 Nucleotide position 325 332 332 371 404 on SEQ ID NO: 141 Type SNP SNP DEL DEL DEL Size of indel 1 MP305 T C W W W Counter Allele C T M M M

TABLE-US-00011 TABLE 10 MZA11123 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA11123.5 MZA11123.18 MZA11123.2 MZA11123.13 MZA11123.34 MZA11123.37 MZA11123.40 MZA11123.41 Nucleotide 631 641 650 671 703 727 744 786 position on SEQ ID NO: 142 Type DEL INS INS INS SNP SNP SNP SNP Size of indel 1 1 1 10 MP305 W W W W G T C A Counter allele M M M M A C A G MZA11123.45 MZA11123.48 MZA11123.9 MZA11123.19 MZA11123.59 MZA11123.17 MZA11123.16 Nucleotide 807 864 915 934 956 991 1010 position on SEQ ID NO: 142 Type SNP SNP INS DEL SNP DEL DEL Size of indel 18 1 3 3 MP305 C T W W C M W Counter allele A A M M T W M

TABLE-US-00012 TABLE 11 MZA15842 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA15842.3 MZA15842.4 MZA15842.5 MZA15842.7 MZA15842.8 Nucleotide position 287 295 313 337 353 on SEQ ID NO: 143 Type SNP SNP SNP SNP SNP MP305 T A T C T Counter Allele C G A T C MZA15842.9 MZA15842.10 MZA15842.11 MZA15842.12 MZA15842.3 Nucleotide position 366 436 439 463 287 on SEQ ID NO: 143 Type SNP SNP SNP SNP SNP MP305 T G A A T Counter Allele C A G G C

TABLE-US-00013 TABLE 12 MZA8761 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA8761.3 MZA8761.6 MZA8761.7 MZA8761.8 MZA8761.9 MZA8761.10 MZA8761.11 Nucleotide position 595 633 671 681 687 696 702 on SEQ ID NO: 145 Type DEL SNP SNP SNP SNP SNP SNP Size of indel 7 MP305 W G T G T G C Counter allele M A C C C T A MZA8761.4 MZA8761.2 MZA8761.1 MZA8761.5 MZA8761.12 MZA8761.13 MZA8761.14 Nucleotide position 710 710 710 722 779 882 901 on SEQ ID NO: 145 Type DEL DEL INS DEL SNP SNP SNP Size of indel 1 1 1 1 MP305 W W W W T C T Counter allele M M M M G T C

TABLE-US-00014 TABLE 13 MZA1851 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA1851.24 MZA1851.41 MZA1851.32 MZA1851.49 MZA1851.51 MZA1851.52 Nucleotide position 1213 1236 1271 1465 1615 1617 on SEQ ID NO: 144 Type INS SNP INS SNP SNP SNP Size of indel 19 34 MP305 W G W A C A Counter Allele M A M G A C MZA1851.53 MZA1851.54 MZA1851.55 MZA1851.56 MZA1851.35 Nucleotide position 1686 1697 1698 1701 1717 on SEQ ID NO: 144 Type SNP SNP SNP SNP DEL Size of indel 6 MP305 T A G T W Counter Allele C C C C M

TABLE-US-00015 TABLE 14 MZA11455 Polymorphisms M = "Mutant`: differs to consensus W = `wild type`: same as consensus, MZA11455.3 MZA11455.5 MZA11455.2 MZA11455.7 MZA11455.8 MZA11455.10 MZA11455.11 MZA11455.12 Nucleotide 373 392 402 425 426 432 435 491 position on SEQ ID NO: 146 Type DEL SNP DEL SNP SNP SNP SNP SNP Size of indel 1 10 MP305 M G M G C C A T Counter allele W C W A G G G A MZA11455.4 MZA11455.13 MZA11455.14 MZA11455.15 MZA11455.1 MZA11455.17 MZA11455.18 MZA11455.19 Nucleotide 526 552 581 599 610 611 628 634 position on SEQ ID NO: 146 Type DEL SNP SNP SNP DEL SNP SNP SNP Size of indel 1 3 MP305 M A G G W G C A Counter allele W G A C M A G C

TABLE-US-00016 TABLE 15 Markers within the Rcg1 Coding Sequence SNP Platform Invader Invader Taqman Taqman PCR Marker Name C00060-01-A C00060-02-A C00060-01 C00060-02 FLP111 Forward Primer C00060-01-F1 C00060-02-F1 C00060-01-F-Taq C00060-02-F-Taq FLP111F Name Position on 550-567 1562-1586 552-568 1634-1659 595-619 SEQ ID NO: 1 Forward Primer SEQ ID NO: 145 SEQ ID NO: 146 SEQ ID NO: 147 SEQ ID NO: 148 SEQ ID NO: 37 Sequence Reverse Primer C00060-01-R1 C00060-02-R1 C00060-01-R-Taq C00060-02-R-Taq FLP111RB Name Position on 641-658 1739-1767 599-620 1707-1730 1676-1700 SEQ ID NO: 1 Reverse Primer SEQ ID NO: 149 SEQ ID NO: 150 SEQ ID NO: 151 SEQ ID NO: 152 SEQ ID NO: 153 Sequence Probe Name C00060-01-PCA C00060-02-PCA C00060-01-P-Taq C00060-02-P-Taq Position on 586-603 1685-1701 570-595 1662-1693 SEQ ID NO: 1 Probe Sequence SEQ ID NO: 154 SEQ ID NO: 155 SEQ ID NO: 156 SEQ ID NO: 157

TABLE-US-00017 TABLE 16 Markers contained within defined chromosomal intervals that can be used to select for Rcg1. The public markers are taken from the IBM2 neighbors 4 map, while the relative locations of the Pioneer markers (prefix `MZA`) were determined by mapping to the same genetic map, and by location on the physical map. Interval (and position on IBM2 Position neighbors 4 relative to map in cM) Rcg1 Markers that could be used for selection of Rcg1 UMC2041 Above the UMC2041, AY112127, UMC1086, AY110631, UMC2285, (483.93)- Rcg1 gene MZA8136, MZA6064, NPI270, NPI300C, PHP20071, UMC2200 UMC2041- CDO127a, RGPI102, UAZI22, BNL17.05, MZA11455, (543.44) Rcg1 MZA15842, MZA11123, MZA2591 Below the PHI093, MZAI215, MZAI216, MZA3434, CL12681_1, Rcg1 gene NPI444, UMC15a, MZA8761, CSU166a, CDO365, Rcg1- CSU1038b, CSU1073b, CSU597a, RGPG111, UMN433, UMC2200 PHP20562, C2, NPI910, CSU178a, CSU202, TDA44, MZA1851, UMC1051, MZA11394, PCO136722, UMC2187, NPI410, PSR109B, UMC1371, UMC1842, UMC1856, AY109980, UMC1132, NFD106, AY105971, AY110989, ENSI002A, RZ596B, BNL23A, BNL29, UMC2200 UMCI 086 Above the UMC1086, AY110631, UMC2285, MZA8136, MZA6064, (500.59)- Rcg1 gene NPI270, NPI300C, PHP20071, CDO127a, RGPI102, UMC2200 UMCI 086- UAZ122, BNL17.05, MZA11455, MZA15842, MZA11123, (543.44) Rcg1 MZA2591 Below the PHI093, MZA1215, MZA1216, MZA3434, CL12681_1, Rcg1 gene NPI444, UMC15a, MZA8761, CSU166a, CDO365, Rcg1- CSU1038b, CSU1073b, CSU597a, RGPG111, UMN433, UMC2200 PHP20562, C2, NPI910, CSU178a, CSU202, TDA44, MZA1851, UMC1051, MZA11394, PCO136722, UMC2187, NPI410, PSR109B, UMC1371, UMC1842, UMC1856, AY109980, UMC1132, NFD106, AY105971, AY110989, ENSI002A, RZ596B, BNL23A, BNL29, UMC2200 UMC2285 Above the UMC2285, MZA8I36, MZA6064, NPI270, NPI300C, (514.9)- Rcg1 gene PHP20071, CDO127a, RGPI102, UAZ122, BNL17.05, UMC2187 UMC2285- MZA11455, MZA15842, MZA11123, MZA2591 (531.7) Rcg1 Below the PHI093, MZA1215, MZA1216, MZA3434, CL12681_1, Rcg1 gene NPI444, UMC15a, MZA8761, CSU166a, CDO365, Rcg1- CSU1038b, CSU1073b, CSU597a, RGPG111, UMN433, UMC2187 PHP20562, C2, NPI910, CSU178a, CSU202, TDA44, MZA1851, UMC1051, MZA11394, PCO136722, UMC2187 Within Above the MZA8136, MZA6064, NPI270, NPI300C, PHP20071, UMC2285 Rcg1 gene, CDO127a, RGPI102, UAZ122, BNL17.05, MZA11455, (514.9)- within MZA15842, MZA11123, MZA2591 UMC15a UMC2285- (525.8) Rcg1 Below the PHI093, MZA1215, MZA1216, MZA3434, CL12681_1, Rcg1 gene, NPI444 within Rcg1- UMC15a

TABLE-US-00018 TABLE 17 Markers Within the Rcg1 Locus SNP sequence Marker position on Name SEQ ID NO: 137 SNP Sequence Invader Oligo Invader Probe Forward Primer Reverse Primer PHD0001-01 12-270 SEQ ID NO: 158 SEQ ID NO: 159 SEQ ID NO: 160 SEQ ID NO: 161 SEQ ID NO: 162 PHD0002-01 272-530 SEQ ID NO: 163 SEQ ID NO: 164 SEQ ID NO: 165 SEQ ID NO: 166 SEQ ID NO: 167 PHD0003-01 7232-7500 SEQ ID NO: 168 SEQ ID NO: 169 SEQ ID NO: 170 SEQ ID NO: 171 SEQ ID NO: 172 PHD0004-01 11302-11580 SEQ ID NO: 173 SEQ ID NO: 174 SEQ ID NO: 175 SEQ ID NO: 176 SEQ ID NO: 177 PHD0005-01 11581-11880 SEQ ID NO: 178 SEQ ID NO: 179 SEQ ID NO: 180 SEQ ID NO: 181 SEQ ID NO: 182 PHD0006-01 11881-12170 SEQ ID NO: 183 SEQ ID NO: 184 SEQ ID NO: 185 SEQ ID NO: 186 SEQ ID NO: 187 PHD0007-01 12171-12470 SEQ ID NO: 188 SEQ ID NO: 189 SEQ ID NO: 190 SEQ ID NO: 191 SEQ ID NO: 192 PHD0008-01 25417-25690 SEQ ID NO: 193 SEQ ID NO: 194 SEQ ID NO: 195 SEQ ID NO: 196 SEQ ID NO: 197 PHD0009-01 25692-25950 SEQ ID NO: 198 SEQ ID NO: 199 SEQ ID NO: 200 SEQ ID NO: 201 SEQ ID NO: 202 PHD0010-01 25951-26200 SEQ ID NO: 203 SEQ ID NO: 204 SEQ ID NO: 205 SEQ ID NO: 206 SEQ ID NO: 207 PHD0011-01 26602-26860 SEQ ID NO: 208 SEQ ID NO: 209 SEQ ID NO: 210 SEQ ID NO: 211 SEQ ID NO: 212 PHD0012-01 26932-27200 SEQ ID NO: 213 SEQ ID NO: 214 SEQ ID NO: 215 SEQ ID NO: 216 SEQ ID NO: 217 PHD0013-01 27322-27580 SEQ ID NO: 218 SEQ ID NO: 219 SEQ ID NO: 220 SEQ ID NO: 221 SEQ ID NO: 222 PHD0014-01 28472-28740 SEQ ID NO: 223 SEQ ID NO: 224 SEQ ID NO: 225 SEQ ID NO: 226 SEQ ID NO: 227 PHD0015-01 28791-2900? SEQ ID NO: 228 SEQ ID NO: 229 SEQ ID NO: 230 SEQ ID NO: 231 SEQ ID NO: 232

TABLE-US-00019 TABLE 18 List of Public Lines use in Haplotype Analysis 38-11 CO109 MP305 A165 D02 N28 A188 D146 OH07 A509 F2 OH4OB A556 F252 OH43 A619 F257 OH45 A632 F283 OS420 B F7 OS426 B14 GT119 PA91 B37 H84 R159 B42 H99 SC213R B64 HATO4 SD105 B73 HY SRS303 B84 Indiana H60 T232 B89 K187-11217 TR9-1-1-6 B94 K55 TX601 C103 L1546 V3 C106 L317 W153R CI66 Minn49 WF9 CM49 MO13 CM7 Mo17

Sequence CWU 1

1

23214212DNAZea maysgene(0)...(0)Nucleotide sequence for Rcg1 bac811h.pk257.m04 1aaaaccctca ccacattttc ctcaaccaca tgatggagat tggggctact agatactatg 60cctggtggta gactggtagc tgatgtcttt ggaccagtag ttggtgctag atttgtgaac 120tctaccaagg tgagaaacgg ag atg gag gct gcc ctg ctg agc ggg ttc atc 172 Met Glu Ala Ala Leu Leu Ser Gly Phe Ile 1 5 10aaa acc atc ctg cca agg ctc ttc tca ctg gta caa ggg aga tac aag 220Lys Thr Ile Leu Pro Arg Leu Phe Ser Leu Val Gln Gly Arg Tyr Lys 15 20 25ctg cac aag ggc ctc aag agc gac atc aaa tcg ctg gag aaa gag ctc 268Leu His Lys Gly Leu Lys Ser Asp Ile Lys Ser Leu Glu Lys Glu Leu 30 35 40cat atg atc gct gtt aca atc gat gaa caa atc tcg ctg ggg agg aag 316His Met Ile Ala Val Thr Ile Asp Glu Gln Ile Ser Leu Gly Arg Lys 45 50 55gat cag gga gct gtg ctg agc ctc tca att gat gag ctg cat gaa ctg 364Asp Gln Gly Ala Val Leu Ser Leu Ser Ile Asp Glu Leu His Glu Leu 60 65 70gct cac caa atc gag gac tcc ata gat cgc ttc ttg tac cat gtg acc 412Ala His Gln Ile Glu Asp Ser Ile Asp Arg Phe Leu Tyr His Val Thr75 80 85 90agg gag cag caa gca tcc ttt ttt cgt cgg act gta cgg tcg ccg aag 460Arg Glu Gln Gln Ala Ser Phe Phe Arg Arg Thr Val Arg Ser Pro Lys 95 100 105act ctg ttg tca cgt cag cgg ctg gct gcc gag gtt cag ttc ctg aag 508Thr Leu Leu Ser Arg Gln Arg Leu Ala Ala Glu Val Gln Phe Leu Lys 110 115 120aag ata ccg gag gag gcg cac cag cga gag aag agg tac agg gtc ttc 556Lys Ile Pro Glu Glu Ala His Gln Arg Glu Lys Arg Tyr Arg Val Phe 125 130 135gcc ggc ctt tct tcc tct acc cgg cac act gaa tcg tct tcc tgt tcg 604Ala Gly Leu Ser Ser Ser Thr Arg His Thr Glu Ser Ser Ser Cys Ser 140 145 150tct gta tct gat ccg cac aca ctt aag gcc gac gtc gtc ggc atc gac 652Ser Val Ser Asp Pro His Thr Leu Lys Ala Asp Val Val Gly Ile Asp155 160 165 170ggt ccc agg gac gag ctt gtg cag cag tta acc gaa gag gca gag ggc 700Gly Pro Arg Asp Glu Leu Val Gln Gln Leu Thr Glu Glu Ala Glu Gly 175 180 185cta aca aag cag ctc aag gtg atc tcc atc gtc ggg atc cat ggc tcc 748Leu Thr Lys Gln Leu Lys Val Ile Ser Ile Val Gly Ile His Gly Ser 190 195 200ggc aag acc gtc ctt gcc aga gag gta tac gag agc gac gtc ggc cgg 796Gly Lys Thr Val Leu Ala Arg Glu Val Tyr Glu Ser Asp Val Gly Arg 205 210 215cag ttc agt ctc cgg gca tgg gtt tct gct act gac aga ggt ccg aga 844Gln Phe Ser Leu Arg Ala Trp Val Ser Ala Thr Asp Arg Gly Pro Arg 220 225 230gag gtg ctc atg gag atc ctc cga aat ttt ggt agg cca gtg gtg gat 892Glu Val Leu Met Glu Ile Leu Arg Asn Phe Gly Arg Pro Val Val Asp235 240 245 250agc tct agt att gac cag ctt acg gta gat ctc agg aaa cac ttg ggt 940Ser Ser Ser Ile Asp Gln Leu Thr Val Asp Leu Arg Lys His Leu Gly 255 260 265gag aaa ag gtgaaaaaaa cctcttcttt atgttattta ttatttatga agtttcttca 998Glu Lys Seractacgggtt ttcatgttca aattgcctct ctgaacttcg aaaacgttta ataccaattg 1058aattgaggat cttagctttg gaaaagcggt agtgttttga cgttttgcat acatttctca 1118ccgttatttt attcatttat aatttagagt ttaagcagta tattcatttt gaaatttatg 1178agatttctgt ctgcacgctt acttccatgc ccaaaacatg tccgattgag aacagaaggt 1238aattttgttt gatctttgag atcagacaca ctgattgagt agtaacagga aacaagtgct 1298caccaatcac ccaagtcact tacaaagaat ttcatgctta caaaacacac tgattgttaa 1358ggatagagac tatgtttgat ctgcatagtt tgaattttga ttatgtcatc gtcgattgtt 1418atcattaact tttgttggaa atttctcttg tag c tat ttc att gta atc gat 1470 Tyr Phe Ile Val Ile Asp 270 275ggc atg caa aca gat cag tgg agc acc att gaa act gcc ttc cca gaa 1518Gly Met Gln Thr Asp Gln Trp Ser Thr Ile Glu Thr Ala Phe Pro Glu 280 285 290aac aat gtt gtt agc agc aga gta att gtt aca aca aca atc cgg tca 1566Asn Asn Val Val Ser Ser Arg Val Ile Val Thr Thr Thr Ile Arg Ser 295 300 305gta gct aat tct tgc agc tct tct aac ggt tat gtg cac aaa atg aaa 1614Val Ala Asn Ser Cys Ser Ser Ser Asn Gly Tyr Val His Lys Met Lys 310 315 320aga ctt agt gac gaa cac tca gag caa ttg ttt atc aag aaa gct tgc 1662Arg Leu Ser Asp Glu His Ser Glu Gln Leu Phe Ile Lys Lys Ala Cys 325 330 335cca aca aaa tat tca ggt tat act cga ccg gaa tca aaa gaa gtt ctg 1710Pro Thr Lys Tyr Ser Gly Tyr Thr Arg Pro Glu Ser Lys Glu Val Leu340 345 350 355aag aaa tgt gat ggt caa cca ctt gct ctt gtt act atg ggc caa ttc 1758Lys Lys Cys Asp Gly Gln Pro Leu Ala Leu Val Thr Met Gly Gln Phe 360 365 370ttg agg aaa aat ggt tgg ccc aca gga ccc aac tgc gaa aat gtg tgt 1806Leu Arg Lys Asn Gly Trp Pro Thr Gly Pro Asn Cys Glu Asn Val Cys 375 380 385aga gat ctt aga cga cat ctg gag cag gat gat aca ttg gag aga atg 1854Arg Asp Leu Arg Arg His Leu Glu Gln Asp Asp Thr Leu Glu Arg Met 390 395 400cga agg gtg ctt atc cac agc tta tct agt ctt cct agc cat gtt ccc 1902Arg Arg Val Leu Ile His Ser Leu Ser Ser Leu Pro Ser His Val Pro 405 410 415aaa gcc tgc ctt ttg tat ttt ggt atg ttt cca tgt gat cat ccc ata 1950Lys Ala Cys Leu Leu Tyr Phe Gly Met Phe Pro Cys Asp His Pro Ile420 425 430 435aag agg aag agc ctg atg agg cga tgg tta gca gag gga ttt gta caa 1998Lys Arg Lys Ser Leu Met Arg Arg Trp Leu Ala Glu Gly Phe Val Gln 440 445 450aca cag cct tca tct agt gaa aac ttc aac acc ctc ata gac cgg aat 2046Thr Gln Pro Ser Ser Ser Glu Asn Phe Asn Thr Leu Ile Asp Arg Asn 455 460 465att att gag ccc atc ggc ata tgt aac gat gat cag gta aag aca tgc 2094Ile Ile Glu Pro Ile Gly Ile Cys Asn Asp Asp Gln Val Lys Thr Cys 470 475 480aaa aca tat ggc atg atg cac gag ttc att ttg tta atg tcc acc tcc 2142Lys Thr Tyr Gly Met Met His Glu Phe Ile Leu Leu Met Ser Thr Ser 485 490 495cat gac ttc att acc ctg ctt tgt aat aat aaa gtt gaa cac aaa tat 2190His Asp Phe Ile Thr Leu Leu Cys Asn Asn Lys Val Glu His Lys Tyr500 505 510 515gtg cgt cgg ctt tct ctc cat cat cat agt gct aca agt ggc agt ttt 2238Val Arg Arg Leu Ser Leu His His His Ser Ala Thr Ser Gly Ser Phe 520 525 530tcg gtc atc gac tta tct ctt gtt aga tct ctg atg gtt ttt ggg gag 2286Ser Val Ile Asp Leu Ser Leu Val Arg Ser Leu Met Val Phe Gly Glu 535 540 545gct ggc aaa act att ttg agt ttc cga aag tac gag cta ttg aga gtc 2334Ala Gly Lys Thr Ile Leu Ser Phe Arg Lys Tyr Glu Leu Leu Arg Val 550 555 560ttg gat ctt gaa caa tgt acc gac ttg gaa gat gat cac ctc aaa gac 2382Leu Asp Leu Glu Gln Cys Thr Asp Leu Glu Asp Asp His Leu Lys Asp 565 570 575ata tgc aac ctt ttt ctt atg aaa tat cta agc ctc gga gaa act att 2430Ile Cys Asn Leu Phe Leu Met Lys Tyr Leu Ser Leu Gly Glu Thr Ile580 585 590 595aga agt ctt cca aag gag ata gaa aaa ctg aag ctc ttg gag aca ctt 2478Arg Ser Leu Pro Lys Glu Ile Glu Lys Leu Lys Leu Leu Glu Thr Leu 600 605 610gac ttg agg aga aca aag gtg aaa aca cta cct ata gag gtc ctc ctg 2526Asp Leu Arg Arg Thr Lys Val Lys Thr Leu Pro Ile Glu Val Leu Leu 615 620 625ctc ccc tgt tta ctc cat ctg ttt ggg aag ttc caa ttt tct gat aaa 2574Leu Pro Cys Leu Leu His Leu Phe Gly Lys Phe Gln Phe Ser Asp Lys 630 635 640atc aag ata aca agt gac atg cag aag ttt ttc tta act gga cag agt 2622Ile Lys Ile Thr Ser Asp Met Gln Lys Phe Phe Leu Thr Gly Gln Ser 645 650 655aac tta gag aca ctt tca gga ttt atc aca gat ggg tct caa gga ttg 2670Asn Leu Glu Thr Leu Ser Gly Phe Ile Thr Asp Gly Ser Gln Gly Leu660 665 670 675cca cag atg atg aat tac atg aat tta aga aag ctt aag ata tgg ttt 2718Pro Gln Met Met Asn Tyr Met Asn Leu Arg Lys Leu Lys Ile Trp Phe 680 685 690gag agg agt aag aga agc acc aac ttc acc gat ctt gtg aat gct gtc 2766Glu Arg Ser Lys Arg Ser Thr Asn Phe Thr Asp Leu Val Asn Ala Val 695 700 705caa aag ttc atc cat gat gac aaa gag agc aat gat cca cgt tct cta 2814Gln Lys Phe Ile His Asp Asp Lys Glu Ser Asn Asp Pro Arg Ser Leu 710 715 720tca ctt cat ttc gat gac ggc act gaa aac atc ctg aac tct ttg aag 2862Ser Leu His Phe Asp Asp Gly Thr Glu Asn Ile Leu Asn Ser Leu Lys 725 730 735gct cct tgt tac ctt agg tca ttg aag tta aaa ggg aat ttg ctg gaa 2910Ala Pro Cys Tyr Leu Arg Ser Leu Lys Leu Lys Gly Asn Leu Leu Glu740 745 750 755ctt ccc cag ttt gtc ata tca atg cgg ggt ctc cgg gag ata tgc ctt 2958Leu Pro Gln Phe Val Ile Ser Met Arg Gly Leu Arg Glu Ile Cys Leu 760 765 770tca tca aca aaa ttg aca tcg ggc ctc ctt gca aca ctc gct aac ttg 3006Ser Ser Thr Lys Leu Thr Ser Gly Leu Leu Ala Thr Leu Ala Asn Leu 775 780 785aaa ggc ttg cag cat ctc aag ctg att gca gat gtc ctt gaa gat ttt 3054Lys Gly Leu Gln His Leu Lys Leu Ile Ala Asp Val Leu Glu Asp Phe 790 795 800atc att gaa ggt cag gca ttc ctg ggg ctg cta cac cta tgt ttt gtc 3102Ile Ile Glu Gly Gln Ala Phe Leu Gly Leu Leu His Leu Cys Phe Val 805 810 815cta gaa cgt gcc acc tta cca ata att gaa gga gga gct ttg ccg tac 3150Leu Glu Arg Ala Thr Leu Pro Ile Ile Glu Gly Gly Ala Leu Pro Tyr820 825 830 835ctc atc tca ctt aag cta atc tgc aaa gat cta gtt ggc ctc ggt gac 3198Leu Ile Ser Leu Lys Leu Ile Cys Lys Asp Leu Val Gly Leu Gly Asp 840 845 850atc aaa atc aac cgc ctc aaa tgt ctt aag gaa gtc agt cta gat cat 3246Ile Lys Ile Asn Arg Leu Lys Cys Leu Lys Glu Val Ser Leu Asp His 855 860 865aga gtc gct tcg gaa aca aga gaa atc tgg gaa aaa gct gcc gag aag 3294Arg Val Ala Ser Glu Thr Arg Glu Ile Trp Glu Lys Ala Ala Glu Lys 870 875 880cat cca aac cgg ccg aaa gta ttg ttg gtc aac tca tct gat gaa agc 3342His Pro Asn Arg Pro Lys Val Leu Leu Val Asn Ser Ser Asp Glu Ser 885 890 895gaa att aag gct gta gac tgt tct gtt gct tca aga cca gct gtg agt 3390Glu Ile Lys Ala Val Asp Cys Ser Val Ala Ser Arg Pro Ala Val Ser900 905 910 915gag gct aat gga act tct ccc atg tca gag gtt gat gta cga gag gat 3438Glu Ala Asn Gly Thr Ser Pro Met Ser Glu Val Asp Val Arg Glu Asp 920 925 930gac att cag atg ata ctt aac cag ggg ctc tct gcc gct gct gag aaa 3486Asp Ile Gln Met Ile Leu Asn Gln Gly Leu Ser Ala Ala Ala Glu Lys 935 940 945cag atg aat tgt gca gtt cag cca agt tca aaa gct gaa ctg aac tct 3534Gln Met Asn Cys Ala Val Gln Pro Ser Ser Lys Ala Glu Leu Asn Ser 950 955 960gat ttc aat aat att agt ttc cca gag gtt gcg ctt ggt tta acc gag 3582Asp Phe Asn Asn Ile Ser Phe Pro Glu Val Ala Leu Gly Leu Thr Glu 965 970 975ctg tga attgcttgga attgaaatgt gtcttcatac acctattgat ccttgattgt 3638Leu *980ccatggtcag tttcgttgca cttgcagcat attactatga ggctagtatc atgtaaatta 3698caaatctttt gttgttaagg ccataaattg catattatag cacaacaagc tggtatgtct 3758caacaatggc attaattttt tttctgcttg aatctacaaa tttcatcatt attttgcaat 3818ttcgctttta tacagatatg gtgatgccat gtcattttga ctttgcagca tatatgcaag 3878caacggtttg agttgctgga gttgctagaa tattgataca acttcagttt actcgaaggc 3938tacagggatc tcataactag gatggttgaa gataatttgc gattgtttcc ttcagtgtca 3998ctgaaaagac ttttgtaaca ataaagcata cctttgcttc ctactttttt gaagttactt 4058cagatgctaa gttcgcagtt gggcctggac tttatcatgt ttatccagct gtttatttgt 4118ttcatgtaca ataataccgg tgattgctgt tgttatataa tctatattta tactatagtt 4178aaagtatcag tttcaacggt tgtcccgcgc catc 421222943DNAZea maysgene(1)...(2943)Coding region only of Cgr1 gene 2atg gag gct gcc ctg ctg agc ggg ttc atc aaa acc atc ctg cca agg 48Met Glu Ala Ala Leu Leu Ser Gly Phe Ile Lys Thr Ile Leu Pro Arg1 5 10 15ctc ttc tca ctg gta caa ggg aga tac aag ctg cac aag ggc ctc aag 96Leu Phe Ser Leu Val Gln Gly Arg Tyr Lys Leu His Lys Gly Leu Lys 20 25 30agc gac atc aaa tcg ctg gag aaa gag ctc cat atg atc gct gtt aca 144Ser Asp Ile Lys Ser Leu Glu Lys Glu Leu His Met Ile Ala Val Thr 35 40 45atc gat gaa caa atc tcg ctg ggg agg aag gat cag gga gct gtg ctg 192Ile Asp Glu Gln Ile Ser Leu Gly Arg Lys Asp Gln Gly Ala Val Leu 50 55 60agc ctc tca att gat gag ctg cat gaa ctg gct cac caa atc gag gac 240Ser Leu Ser Ile Asp Glu Leu His Glu Leu Ala His Gln Ile Glu Asp65 70 75 80tcc ata gat cgc ttc ttg tac cat gtg acc agg gag cag caa gca tcc 288Ser Ile Asp Arg Phe Leu Tyr His Val Thr Arg Glu Gln Gln Ala Ser 85 90 95ttt ttt cgt cgg act gta cgg tcg ccg aag act ctg ttg tca cgt cag 336Phe Phe Arg Arg Thr Val Arg Ser Pro Lys Thr Leu Leu Ser Arg Gln 100 105 110cgg ctg gct gcc gag gtt cag ttc ctg aag aag ata ccg gag gag gcg 384Arg Leu Ala Ala Glu Val Gln Phe Leu Lys Lys Ile Pro Glu Glu Ala 115 120 125cac cag cga gag aag agg tac agg gtc ttc gcc ggc ctt tct tcc tct 432His Gln Arg Glu Lys Arg Tyr Arg Val Phe Ala Gly Leu Ser Ser Ser 130 135 140acc cgg cac act gaa tcg tct tcc tgt tcg tct gta tct gat ccg cac 480Thr Arg His Thr Glu Ser Ser Ser Cys Ser Ser Val Ser Asp Pro His145 150 155 160aca ctt aag gcc gac gtc gtc ggc atc gac ggt ccc agg gac gag ctt 528Thr Leu Lys Ala Asp Val Val Gly Ile Asp Gly Pro Arg Asp Glu Leu 165 170 175gtg cag cag tta acc gaa gag gca gag ggc cta aca aag cag ctc aag 576Val Gln Gln Leu Thr Glu Glu Ala Glu Gly Leu Thr Lys Gln Leu Lys 180 185 190gtg atc tcc atc gtc ggg atc cat ggc tcc ggc aag acc gtc ctt gcc 624Val Ile Ser Ile Val Gly Ile His Gly Ser Gly Lys Thr Val Leu Ala 195 200 205aga gag gta tac gag agc gac gtc ggc cgg cag ttc agt ctc cgg gca 672Arg Glu Val Tyr Glu Ser Asp Val Gly Arg Gln Phe Ser Leu Arg Ala 210 215 220tgg gtt tct gct act gac aga ggt ccg aga gag gtg ctc atg gag atc 720Trp Val Ser Ala Thr Asp Arg Gly Pro Arg Glu Val Leu Met Glu Ile225 230 235 240ctc cga aat ttt ggt agg cca gtg gtg gat agc tct agt att gac cag 768Leu Arg Asn Phe Gly Arg Pro Val Val Asp Ser Ser Ser Ile Asp Gln 245 250 255ctt acg gta gat ctc agg aaa cac ttg ggt gag aaa agg tat ttc att 816Leu Thr Val Asp Leu Arg Lys His Leu Gly Glu Lys Arg Tyr Phe Ile 260 265 270gta atc gat ggc atg caa aca gat cag tgg agc acc att gaa act gcc 864Val Ile Asp Gly Met Gln Thr Asp Gln Trp Ser Thr Ile Glu Thr Ala 275 280 285ttc cca gaa aac aat gtt gtt agc agc aga gta att gtt aca aca aca 912Phe Pro Glu Asn Asn Val Val Ser Ser Arg Val Ile Val Thr Thr Thr 290 295 300atc cgg tca gta gct aat tct tgc agc tct tct aac ggt tat gtg cac 960Ile Arg Ser Val Ala Asn Ser Cys Ser Ser Ser Asn Gly Tyr Val His305 310 315 320aaa atg aaa aga ctt agt gac gaa cac tca gag caa ttg ttt atc aag 1008Lys Met Lys Arg Leu Ser Asp Glu His Ser Glu Gln Leu Phe Ile Lys 325 330 335aaa gct tgc cca aca aaa tat tca ggt tat act cga ccg gaa tca aaa 1056Lys Ala Cys Pro Thr Lys Tyr Ser Gly Tyr Thr Arg Pro Glu Ser Lys 340 345 350gaa gtt ctg aag aaa tgt gat ggt caa cca ctt gct ctt gtt act atg 1104Glu Val Leu Lys Lys Cys Asp Gly Gln Pro Leu Ala Leu Val Thr Met 355 360 365ggc caa ttc ttg agg aaa aat ggt tgg ccc aca gga ccc aac tgc gaa 1152Gly Gln Phe Leu Arg Lys Asn Gly Trp Pro Thr Gly Pro Asn Cys Glu 370 375 380aat gtg tgt aga gat ctt aga cga cat ctg gag cag gat gat aca ttg 1200Asn Val Cys Arg Asp Leu Arg Arg His Leu Glu Gln Asp Asp Thr Leu385 390 395 400gag aga atg cga agg gtg ctt atc cac agc tta tct agt ctt cct agc

1248Glu Arg Met Arg Arg Val Leu Ile His Ser Leu Ser Ser Leu Pro Ser 405 410 415cat gtt ccc aaa gcc tgc ctt ttg tat ttt ggt atg ttt cca tgt gat 1296His Val Pro Lys Ala Cys Leu Leu Tyr Phe Gly Met Phe Pro Cys Asp 420 425 430cat ccc ata aag agg aag agc ctg atg agg cga tgg tta gca gag gga 1344His Pro Ile Lys Arg Lys Ser Leu Met Arg Arg Trp Leu Ala Glu Gly 435 440 445ttt gta caa aca cag cct tca tct agt gaa aac ttc aac acc ctc ata 1392Phe Val Gln Thr Gln Pro Ser Ser Ser Glu Asn Phe Asn Thr Leu Ile 450 455 460gac cgg aat att att gag ccc atc ggc ata tgt aac gat gat cag gta 1440Asp Arg Asn Ile Ile Glu Pro Ile Gly Ile Cys Asn Asp Asp Gln Val465 470 475 480aag aca tgc aaa aca tat ggc atg atg cac gag ttc att ttg tta atg 1488Lys Thr Cys Lys Thr Tyr Gly Met Met His Glu Phe Ile Leu Leu Met 485 490 495tcc acc tcc cat gac ttc att acc ctg ctt tgt aat aat aaa gtt gaa 1536Ser Thr Ser His Asp Phe Ile Thr Leu Leu Cys Asn Asn Lys Val Glu 500 505 510cac aaa tat gtg cgt cgg ctt tct ctc cat cat cat agt gct aca agt 1584His Lys Tyr Val Arg Arg Leu Ser Leu His His His Ser Ala Thr Ser 515 520 525ggc agt ttt tcg gtc atc gac tta tct ctt gtt aga tct ctg atg gtt 1632Gly Ser Phe Ser Val Ile Asp Leu Ser Leu Val Arg Ser Leu Met Val 530 535 540ttt ggg gag gct ggc aaa act att ttg agt ttc cga aag tac gag cta 1680Phe Gly Glu Ala Gly Lys Thr Ile Leu Ser Phe Arg Lys Tyr Glu Leu545 550 555 560ttg aga gtc ttg gat ctt gaa caa tgt acc gac ttg gaa gat gat cac 1728Leu Arg Val Leu Asp Leu Glu Gln Cys Thr Asp Leu Glu Asp Asp His 565 570 575ctc aaa gac ata tgc aac ctt ttt ctt atg aaa tat cta agc ctc gga 1776Leu Lys Asp Ile Cys Asn Leu Phe Leu Met Lys Tyr Leu Ser Leu Gly 580 585 590gaa act att aga agt ctt cca aag gag ata gaa aaa ctg aag ctc ttg 1824Glu Thr Ile Arg Ser Leu Pro Lys Glu Ile Glu Lys Leu Lys Leu Leu 595 600 605gag aca ctt gac ttg agg aga aca aag gtg aaa aca cta cct ata gag 1872Glu Thr Leu Asp Leu Arg Arg Thr Lys Val Lys Thr Leu Pro Ile Glu 610 615 620gtc ctc ctg ctc ccc tgt tta ctc cat ctg ttt ggg aag ttc caa ttt 1920Val Leu Leu Leu Pro Cys Leu Leu His Leu Phe Gly Lys Phe Gln Phe625 630 635 640tct gat aaa atc aag ata aca agt gac atg cag aag ttt ttc tta act 1968Ser Asp Lys Ile Lys Ile Thr Ser Asp Met Gln Lys Phe Phe Leu Thr 645 650 655gga cag agt aac tta gag aca ctt tca gga ttt atc aca gat ggg tct 2016Gly Gln Ser Asn Leu Glu Thr Leu Ser Gly Phe Ile Thr Asp Gly Ser 660 665 670caa gga ttg cca cag atg atg aat tac atg aat tta aga aag ctt aag 2064Gln Gly Leu Pro Gln Met Met Asn Tyr Met Asn Leu Arg Lys Leu Lys 675 680 685ata tgg ttt gag agg agt aag aga agc acc aac ttc acc gat ctt gtg 2112Ile Trp Phe Glu Arg Ser Lys Arg Ser Thr Asn Phe Thr Asp Leu Val 690 695 700aat gct gtc caa aag ttc atc cat gat gac aaa gag agc aat gat cca 2160Asn Ala Val Gln Lys Phe Ile His Asp Asp Lys Glu Ser Asn Asp Pro705 710 715 720cgt tct cta tca ctt cat ttc gat gac ggc act gaa aac atc ctg aac 2208Arg Ser Leu Ser Leu His Phe Asp Asp Gly Thr Glu Asn Ile Leu Asn 725 730 735tct ttg aag gct cct tgt tac ctt agg tca ttg aag tta aaa ggg aat 2256Ser Leu Lys Ala Pro Cys Tyr Leu Arg Ser Leu Lys Leu Lys Gly Asn 740 745 750ttg ctg gaa ctt ccc cag ttt gtc ata tca atg cgg ggt ctc cgg gag 2304Leu Leu Glu Leu Pro Gln Phe Val Ile Ser Met Arg Gly Leu Arg Glu 755 760 765ata tgc ctt tca tca aca aaa ttg aca tcg ggc ctc ctt gca aca ctc 2352Ile Cys Leu Ser Ser Thr Lys Leu Thr Ser Gly Leu Leu Ala Thr Leu 770 775 780gct aac ttg aaa ggc ttg cag cat ctc aag ctg att gca gat gtc ctt 2400Ala Asn Leu Lys Gly Leu Gln His Leu Lys Leu Ile Ala Asp Val Leu785 790 795 800gaa gat ttt atc att gaa ggt cag gca ttc ctg ggg ctg cta cac cta 2448Glu Asp Phe Ile Ile Glu Gly Gln Ala Phe Leu Gly Leu Leu His Leu 805 810 815tgt ttt gtc cta gaa cgt gcc acc tta cca ata att gaa gga gga gct 2496Cys Phe Val Leu Glu Arg Ala Thr Leu Pro Ile Ile Glu Gly Gly Ala 820 825 830ttg ccg tac ctc atc tca ctt aag cta atc tgc aaa gat cta gtt ggc 2544Leu Pro Tyr Leu Ile Ser Leu Lys Leu Ile Cys Lys Asp Leu Val Gly 835 840 845ctc ggt gac atc aaa atc aac cgc ctc aaa tgt ctt aag gaa gtc agt 2592Leu Gly Asp Ile Lys Ile Asn Arg Leu Lys Cys Leu Lys Glu Val Ser 850 855 860cta gat cat aga gtc gct tcg gaa aca aga gaa atc tgg gaa aaa gct 2640Leu Asp His Arg Val Ala Ser Glu Thr Arg Glu Ile Trp Glu Lys Ala865 870 875 880gcc gag aag cat cca aac cgg ccg aaa gta ttg ttg gtc aac tca tct 2688Ala Glu Lys His Pro Asn Arg Pro Lys Val Leu Leu Val Asn Ser Ser 885 890 895gat gaa agc gaa att aag gct gta gac tgt tct gtt gct tca aga cca 2736Asp Glu Ser Glu Ile Lys Ala Val Asp Cys Ser Val Ala Ser Arg Pro 900 905 910gct gtg agt gag gct aat gga act tct ccc atg tca gag gtt gat gta 2784Ala Val Ser Glu Ala Asn Gly Thr Ser Pro Met Ser Glu Val Asp Val 915 920 925cga gag gat gac att cag atg ata ctt aac cag ggg ctc tct gcc gct 2832Arg Glu Asp Asp Ile Gln Met Ile Leu Asn Gln Gly Leu Ser Ala Ala 930 935 940gct gag aaa cag atg aat tgt gca gtt cag cca agt tca aaa gct gaa 2880Ala Glu Lys Gln Met Asn Cys Ala Val Gln Pro Ser Ser Lys Ala Glu945 950 955 960ctg aac tct gat ttc aat aat att agt ttc cca gag gtt gcg ctt ggt 2928Leu Asn Ser Asp Phe Asn Asn Ile Ser Phe Pro Glu Val Ala Leu Gly 965 970 975tta acc gag ctg tga 2943Leu Thr Glu Leu * 9803980PRTZea maysDOMAIN(157)...(404)Region showing homology to nucleotide binding site (NBS) domain. 3Met Glu Ala Ala Leu Leu Ser Gly Phe Ile Lys Thr Ile Leu Pro Arg1 5 10 15 Leu Phe Ser Leu Val Gln Gly Arg Tyr Lys Leu His Lys Gly Leu Lys 20 25 30 Ser Asp Ile Lys Ser Leu Glu Lys Glu Leu His Met Ile Ala Val Thr 35 40 45 Ile Asp Glu Gln Ile Ser Leu Gly Arg Lys Asp Gln Gly Ala Val Leu 50 55 60 Ser Leu Ser Ile Asp Glu Leu His Glu Leu Ala His Gln Ile Glu Asp65 70 75 80 Ser Ile Asp Arg Phe Leu Tyr His Val Thr Arg Glu Gln Gln Ala Ser 85 90 95 Phe Phe Arg Arg Thr Val Arg Ser Pro Lys Thr Leu Leu Ser Arg Gln 100 105 110 Arg Leu Ala Ala Glu Val Gln Phe Leu Lys Lys Ile Pro Glu Glu Ala 115 120 125 His Gln Arg Glu Lys Arg Tyr Arg Val Phe Ala Gly Leu Ser Ser Ser 130 135 140 Thr Arg His Thr Glu Ser Ser Ser Cys Ser Ser Val Ser Asp Pro His145 150 155 160 Thr Leu Lys Ala Asp Val Val Gly Ile Asp Gly Pro Arg Asp Glu Leu 165 170 175 Val Gln Gln Leu Thr Glu Glu Ala Glu Gly Leu Thr Lys Gln Leu Lys 180 185 190 Val Ile Ser Ile Val Gly Ile His Gly Ser Gly Lys Thr Val Leu Ala 195 200 205 Arg Glu Val Tyr Glu Ser Asp Val Gly Arg Gln Phe Ser Leu Arg Ala 210 215 220 Trp Val Ser Ala Thr Asp Arg Gly Pro Arg Glu Val Leu Met Glu Ile225 230 235 240 Leu Arg Asn Phe Gly Arg Pro Val Val Asp Ser Ser Ser Ile Asp Gln 245 250 255 Leu Thr Val Asp Leu Arg Lys His Leu Gly Glu Lys Arg Tyr Phe Ile 260 265 270 Val Ile Asp Gly Met Gln Thr Asp Gln Trp Ser Thr Ile Glu Thr Ala 275 280 285 Phe Pro Glu Asn Asn Val Val Ser Ser Arg Val Ile Val Thr Thr Thr 290 295 300 Ile Arg Ser Val Ala Asn Ser Cys Ser Ser Ser Asn Gly Tyr Val His305 310 315 320 Lys Met Lys Arg Leu Ser Asp Glu His Ser Glu Gln Leu Phe Ile Lys 325 330 335 Lys Ala Cys Pro Thr Lys Tyr Ser Gly Tyr Thr Arg Pro Glu Ser Lys 340 345 350 Glu Val Leu Lys Lys Cys Asp Gly Gln Pro Leu Ala Leu Val Thr Met 355 360 365 Gly Gln Phe Leu Arg Lys Asn Gly Trp Pro Thr Gly Pro Asn Cys Glu 370 375 380 Asn Val Cys Arg Asp Leu Arg Arg His Leu Glu Gln Asp Asp Thr Leu385 390 395 400 Glu Arg Met Arg Arg Val Leu Ile His Ser Leu Ser Ser Leu Pro Ser 405 410 415 His Val Pro Lys Ala Cys Leu Leu Tyr Phe Gly Met Phe Pro Cys Asp 420 425 430 His Pro Ile Lys Arg Lys Ser Leu Met Arg Arg Trp Leu Ala Glu Gly 435 440 445 Phe Val Gln Thr Gln Pro Ser Ser Ser Glu Asn Phe Asn Thr Leu Ile 450 455 460 Asp Arg Asn Ile Ile Glu Pro Ile Gly Ile Cys Asn Asp Asp Gln Val465 470 475 480 Lys Thr Cys Lys Thr Tyr Gly Met Met His Glu Phe Ile Leu Leu Met 485 490 495 Ser Thr Ser His Asp Phe Ile Thr Leu Leu Cys Asn Asn Lys Val Glu 500 505 510 His Lys Tyr Val Arg Arg Leu Ser Leu His His His Ser Ala Thr Ser 515 520 525 Gly Ser Phe Ser Val Ile Asp Leu Ser Leu Val Arg Ser Leu Met Val 530 535 540 Phe Gly Glu Ala Gly Lys Thr Ile Leu Ser Phe Arg Lys Tyr Glu Leu545 550 555 560 Leu Arg Val Leu Asp Leu Glu Gln Cys Thr Asp Leu Glu Asp Asp His 565 570 575 Leu Lys Asp Ile Cys Asn Leu Phe Leu Met Lys Tyr Leu Ser Leu Gly 580 585 590 Glu Thr Ile Arg Ser Leu Pro Lys Glu Ile Glu Lys Leu Lys Leu Leu 595 600 605 Glu Thr Leu Asp Leu Arg Arg Thr Lys Val Lys Thr Leu Pro Ile Glu 610 615 620 Val Leu Leu Leu Pro Cys Leu Leu His Leu Phe Gly Lys Phe Gln Phe625 630 635 640 Ser Asp Lys Ile Lys Ile Thr Ser Asp Met Gln Lys Phe Phe Leu Thr 645 650 655 Gly Gln Ser Asn Leu Glu Thr Leu Ser Gly Phe Ile Thr Asp Gly Ser 660 665 670 Gln Gly Leu Pro Gln Met Met Asn Tyr Met Asn Leu Arg Lys Leu Lys 675 680 685 Ile Trp Phe Glu Arg Ser Lys Arg Ser Thr Asn Phe Thr Asp Leu Val 690 695 700 Asn Ala Val Gln Lys Phe Ile His Asp Asp Lys Glu Ser Asn Asp Pro705 710 715 720 Arg Ser Leu Ser Leu His Phe Asp Asp Gly Thr Glu Asn Ile Leu Asn 725 730 735 Ser Leu Lys Ala Pro Cys Tyr Leu Arg Ser Leu Lys Leu Lys Gly Asn 740 745 750 Leu Leu Glu Leu Pro Gln Phe Val Ile Ser Met Arg Gly Leu Arg Glu 755 760 765 Ile Cys Leu Ser Ser Thr Lys Leu Thr Ser Gly Leu Leu Ala Thr Leu 770 775 780 Ala Asn Leu Lys Gly Leu Gln His Leu Lys Leu Ile Ala Asp Val Leu785 790 795 800 Glu Asp Phe Ile Ile Glu Gly Gln Ala Phe Leu Gly Leu Leu His Leu 805 810 815 Cys Phe Val Leu Glu Arg Ala Thr Leu Pro Ile Ile Glu Gly Gly Ala 820 825 830 Leu Pro Tyr Leu Ile Ser Leu Lys Leu Ile Cys Lys Asp Leu Val Gly 835 840 845 Leu Gly Asp Ile Lys Ile Asn Arg Leu Lys Cys Leu Lys Glu Val Ser 850 855 860 Leu Asp His Arg Val Ala Ser Glu Thr Arg Glu Ile Trp Glu Lys Ala865 870 875 880 Ala Glu Lys His Pro Asn Arg Pro Lys Val Leu Leu Val Asn Ser Ser 885 890 895 Asp Glu Ser Glu Ile Lys Ala Val Asp Cys Ser Val Ala Ser Arg Pro 900 905 910 Ala Val Ser Glu Ala Asn Gly Thr Ser Pro Met Ser Glu Val Asp Val 915 920 925 Arg Glu Asp Asp Ile Gln Met Ile Leu Asn Gln Gly Leu Ser Ala Ala 930 935 940 Ala Glu Lys Gln Met Asn Cys Ala Val Gln Pro Ser Ser Lys Ala Glu945 950 955 960 Leu Asn Ser Asp Phe Asn Asn Ile Ser Phe Pro Glu Val Ala Leu Gly 965 970 975 Leu Thr Glu Leu 980 424DNAArtificial SequenceOligonucleotide Primer a20Cforw4881 4cagggcctac ttggtttagt aata 24524DNAArtificial SequenceOligonucleotide Primer a20Crev4920 5gggtactaca ctagcctatt acta 24624DNAArtificial SequenceOligonucleotide Primer a20fis19forw1110 6cggttacaag gtctacccaa tctg 24724DNAArtificial SequenceOligonucleotide Primer a20fis19rev1149 7gtcaaacaga tagccgcaga ttgg 24824DNAArtificial SequenceOligonucleotide Primer n07fis13forw51524 8tacaaaacta ctgcaacgcc tata 24924DNAArtificial SequenceOligonucleotide Primer n07fis13rev51563 9cctcacccca agtatatata ggcg 241024DNAArtificial SequenceOligonucleotide Primer n07Bforw10439/53434 10cattggacct cttccccact aaga 241124DNAArtificial SequenceOligonucleotide Primer n07Brev10478/53473 11tccttgagtc cagtgctctt agtg 241224DNAArtificial SequenceOligonucleotide Primer n07Aforw4333 12gaaactaggc gcgtcaggtt ttat 241324DNAArtificial SequenceOligonucleotide Primer n07Arev4372 13aaggcagcca ctgaaaataa aacc 2414954PRTOryza sativaPEPTIDE(0)...(0)Accession No NP_910480, Rice NBS-LRR 14Met Glu Gly Ala Val Phe Ser Leu Thr Glu Gly Ala Val Arg Ser Leu1 5 10 15 Leu Cys Lys Leu Gly Cys Leu Leu Thr Glu Asp Thr Trp Leu Val Gln 20 25 30 Gly Val His Gly Glu Ile Gln Tyr Ile Lys Asp Glu Leu Glu Cys Met 35 40 45 Asn Ala Phe Leu Arg Asn Leu Thr Ile Ser Gln Ile His Asp Asp Gln 50 55 60 Val Arg Ile Trp Met Lys Gln Val Arg Glu Ile Ala Tyr Asp Ser Glu65 70 75 80 Asp Cys Ile Asp Glu Phe Ile His Asn Leu Gly Glu Ser Ser Glu Met 85 90 95 Gly Phe Phe Gly Gly Leu Ile Ser Met Leu Arg Lys Leu Ala Cys Arg 100 105 110 His Arg Ile Ala Leu Gln Leu Gln Glu Leu Lys Ala Arg Ala Gln Asp 115 120 125 Val Gly Asp Arg Arg Ser Arg Tyr Gly Val Glu Leu Ala Lys Ala Thr 130 135 140 His Glu Glu Ala His Pro Arg Leu Thr Arg His Ala Ser Leu His Ile145 150 155 160 Asp Pro Gln Leu His Ala Leu Phe Ala Glu Glu Ala Gln Leu Val Gly 165 170 175 Ile Asp Glu Pro Arg Asn Glu Leu Val Ser Trp Leu Met Glu Glu Asp 180 185 190 Leu Arg Leu Arg Val Leu Ala Ile Val Gly Phe Gly Gly Leu Gly Lys 195 200 205 Thr Thr Leu Ala Arg Met Val Cys Gly Ser Pro Val Val Lys Ser Ala 210 215 220 Asp Phe Gln Cys Cys Pro Leu Phe Ile Ile Ser Gln Thr Phe Asn Ile225 230 235 240 Arg Ala Leu Phe Gln His Met Val Arg Glu Leu Ile Gln Glu Pro His 245 250

255 Lys Ala Met Ala Ile Ala Gly Cys Lys His Gly Leu Ile Thr Asp Asp 260 265 270 Tyr Leu Glu Gly Met Glu Arg Trp Glu Val Ala Ala Leu Thr Lys Asn 275 280 285 Leu Arg Arg Tyr Phe Gln Asp Lys Arg Tyr Ile Val Ile Leu Asp Asp 290 295 300 Ile Trp Thr Val Ser Ala Trp Glu Ser Ile Arg Cys Ala Leu Pro Asp305 310 315 320 Asn Leu Lys Gly Ser Arg Ile Ile Val Thr Thr Arg Asn Ala Asp Val 325 330 335 Ala Asn Thr Cys Cys Ser Arg Pro Gln Asp Arg Ile Tyr Asn Ile Gln 340 345 350 Arg Leu Ser Glu Thr Thr Ser Arg Glu Leu Phe Phe Lys Lys Ile Phe 355 360 365 Gly Phe Ala Asp Asp Lys Ser Pro Thr Asp Glu Phe Glu Glu Val Ser 370 375 380 Asn Ser Val Leu Lys Lys Cys Gly Gly Leu Pro Leu Ala Ile Val Asn385 390 395 400 Ile Gly Ser Leu Leu Ala Ser Lys Thr Asn Arg Thr Lys Glu Glu Trp 405 410 415 Gln Lys Val Cys Asn Asn Leu Gly Ser Glu Leu Glu Asn Asn Pro Thr 420 425 430 Leu Glu Gly Val Lys Gln Val Leu Thr Leu Ser Tyr Asn Asp Leu Pro 435 440 445 Tyr His Leu Lys Ala Cys Phe Leu Tyr Leu Ser Ile Phe Pro Glu Asn 450 455 460 Tyr Val Ile Lys Arg Gly Pro Leu Val Arg Arg Trp Ile Ala Glu Gly465 470 475 480 Phe Val Ser Gln Arg His Gly Gln Ser Met Glu Gln Leu Ala Glu Ser 485 490 495 Tyr Phe Asp Glu Phe Val Ala Arg Ser Ile Val Gln Pro Val Arg Thr 500 505 510 Asp Trp Thr Gly Lys Val Arg Ser Cys Arg Val His Asp Leu Met Leu 515 520 525 Asp Val Ile Val Ser Arg Ser Ile Glu Glu Asn Phe Ala Ser Phe Leu 530 535 540 Cys Asp Asn Gly Ser Thr Leu Ala Ser His Asp Lys Ile Arg Arg Leu545 550 555 560 Ser Ile His Ser Ser Tyr Asn Ser Ser Gln Lys Thr Ser Ala Asn Val 565 570 575 Ser His Ala Arg Ser Phe Thr Met Ser Ala Ser Val Glu Glu Val Pro 580 585 590 Phe Phe Phe Pro Gln Leu Arg Leu Leu Arg Val Leu Asp Leu Gln Gly 595 600 605 Cys Ser Cys Leu Ser Asn Glu Thr Leu His Cys Met Cys Arg Phe Phe 610 615 620 Gln Leu Lys Tyr Leu Ser Leu Arg Asn Thr Asn Val Ser Lys Leu Pro625 630 635 640 His Leu Leu Gly Asn Leu Lys His Leu Glu Thr Leu Asp Ile Arg Ala 645 650 655 Thr Leu Ile Lys Lys Leu Pro Ala Ser Ala Gly Asn Leu Ser Cys Leu 660 665 670 Lys His Leu Phe Ala Gly His Lys Val Gln Leu Thr Arg Thr Ala Ser 675 680 685 Val Lys Phe Leu Arg Gln Ser Ser Gly Leu Glu Val Ala Thr Gly Val 690 695 700 Val Lys Asn Met Val Ala Leu Gln Ser Leu Val His Ile Val Val Lys705 710 715 720 Asp Lys Ser Pro Val Leu Arg Glu Ile Gly Leu Leu Gln Asn Leu Thr 725 730 735 Lys Leu Asn Val Leu Leu Arg Gly Val Glu Glu Asn Trp Asn Ala Phe 740 745 750 Leu Glu Ser Leu Ser Lys Leu Pro Gly Pro Leu Arg Ser Leu Ser Ile 755 760 765 His Thr Leu Asp Glu Lys Glu His Ser Leu Ser Leu Asp Asn Leu Ala 770 775 780 Phe Val Glu Ser Pro Pro Leu Phe Ile Thr Lys Phe Ser Leu Ala Gly785 790 795 800 Glu Leu Glu Arg Leu Pro Pro Trp Ile Pro Ser Leu Arg Asn Val Ser 805 810 815 Arg Phe Ala Leu Arg Arg Thr Glu Leu His Ala Asp Ala Ile Gly Val 820 825 830 Leu Gly Asp Leu Pro Asn Leu Leu Cys Leu Lys Leu Tyr His Lys Ser 835 840 845 Tyr Ala Asp Asn Cys Ile Val Phe Cys His Gly Lys Phe Val Lys Leu 850 855 860 Lys Leu Leu Ile Ile Asp Asn Leu Glu Arg Ile Glu Lys Met Gln Phe865 870 875 880 Asp Ala Gly Ser Val Thr Asn Leu Glu Arg Leu Thr Leu Ser Phe Leu 885 890 895 Arg Glu Pro Lys Tyr Gly Ile Ser Gly Leu Glu Asn Leu Pro Lys Leu 900 905 910 Lys Glu Ile Glu Phe Phe Gly Asp Ile Ile Leu Ser Val Val Thr Lys 915 920 925 Val Ala Ser Cys Val Lys Ala His Pro Asn His Pro Arg Val Ile Gly 930 935 940 Asp Lys Trp Asn Ile Val Thr Glu Tyr Ala945 950 15953PRTOryza sativaPEPTIDE(0)...(0)Accession No. NP_910483 Rice NBS-LRR 15Met Glu Gly Ala Ile Phe Ser Val Ala Glu Gly Thr Val Arg Ser Leu1 5 10 15 Leu Ser Lys Leu Ser Ser Leu Leu Ser Gln Glu Ser Trp Phe Val Arg 20 25 30 Gly Val His Gly Asp Ile Gln Tyr Ile Lys Asp Glu Leu Glu Ser Met 35 40 45 Asn Ala Phe Leu Arg Tyr Leu Thr Val Leu Glu Asp His Asp Thr Gln 50 55 60 Val Arg Ile Trp Met Lys Gln Val Arg Glu Ile Ala Tyr Asp Ala Glu65 70 75 80 Asp Cys Ile Asp Gln Phe Thr His His Leu Gly Glu Ser Ser Gly Ile 85 90 95 Gly Phe Leu Tyr Arg Leu Ile Tyr Ile Leu Gly Lys Leu Cys Cys Arg 100 105 110 His Arg Ile Ala Met Gln Leu Gln Glu Leu Lys Ala Arg Ala Gln Asp 115 120 125 Val Ser Glu Arg Arg Ser Arg Tyr Glu Val Met Leu Pro Lys Thr Thr 130 135 140 Leu Gln Gly Ala Gly Pro Arg Leu Thr Arg His Ala Ser Arg His Leu145 150 155 160 Asp Pro Gln Leu His Ala Leu Phe Thr Glu Glu Ala Gln Leu Val Gly 165 170 175 Leu Asp Glu Pro Arg Asp Lys Leu Val Arg Trp Val Met Glu Ala Asp 180 185 190 Pro Cys Arg Arg Val Leu Ala Ile Val Gly Phe Gly Gly Leu Gly Lys 195 200 205 Thr Thr Leu Ala Arg Met Val Cys Glu Asn Pro Met Val Lys Gly Ala 210 215 220 Asp Phe His Cys Cys Pro Leu Phe Ile Val Ser Gln Thr Phe Asn Ile225 230 235 240 Arg Thr Leu Phe Gln Tyr Met Ile Arg Glu Leu Ile Gln Arg Pro Asn 245 250 255 Lys Ala Met Ala Val Ala Gly Gly Lys His Gly His Thr Met Asp Gly 260 265 270 Asn Met Asp Gly Met Glu Arg Trp Glu Val Ala Val Leu Ala Glu Lys 275 280 285 Val Arg Gln Tyr Leu Leu Asp Lys Tyr Ile Val Ile Phe Asp Asp Ile 290 295 300 Trp Thr Ile Ser Ala Trp Glu Ser Ile Arg Cys Ala Leu Pro Asp Asn305 310 315 320 Lys Lys Gly Ser Arg Val Ile Ile Thr Thr Arg Asn Glu Asp Val Ala 325 330 335 Asn Thr Cys Cys Ser Gly Pro Gln Asp Gln Val Tyr Lys Met Gln Arg 340 345 350 Leu Ser Asp Ala Ala Ser Arg Glu Leu Phe Phe Lys Arg Ile Phe Gly 355 360 365 Ser Ala Asp Ile Ser Ser Asn Glu Glu Leu Asp Glu Val Ser Asn Ser 370 375 380 Ile Leu Lys Lys Cys Gly Gly Leu Pro Leu Ala Ile Val Ser Ile Gly385 390 395 400 Ser Leu Val Ala Ser Lys Thr Asn Arg Thr Lys Glu Glu Trp Gln Lys 405 410 415 Ile Cys Asp Asn Leu Gly Ser Glu Leu Glu Thr Asn Pro Thr Leu Glu 420 425 430 Val Ala Lys Gln Val Leu Thr Leu Ser Tyr Asn Asp Leu Pro Tyr His 435 440 445 Leu Lys Ala Cys Phe Leu Tyr Leu Ser Ile Phe Pro Glu Asn Tyr Val 450 455 460 Ile Arg Arg Gly Pro Leu Val Arg Arg Trp Ile Ala Glu Gly Phe Val465 470 475 480 Asn Gln Arg His Gly Leu Ser Met Glu Glu Val Ala Glu Ser Tyr Phe 485 490 495 Asp Glu Phe Val Ala Arg Ser Ile Val Gln Pro Val Lys Ile Asp Trp 500 505 510 Ser Gly Lys Val Arg Thr Cys Arg Val His Asp Met Met Leu Glu Val 515 520 525 Ile Ile Ser Lys Ser Leu Glu Glu Asn Phe Ala Ser Phe Leu Cys Asp 530 535 540 Asn Gly His Pro Leu Val Cys His Asp Lys Ile Arg Arg Leu Ser Ile545 550 555 560 His Asn Ser His Asn Ser Val Gln Arg Thr Arg Val Ser Val Ser His 565 570 575 Val Arg Ser Phe Thr Met Ser Ala Ser Val Glu Glu Val Pro Met Phe 580 585 590 Phe Pro Gln Met Arg Leu Leu Arg Val Leu Asp Leu Gln Gly Ser Ser 595 600 605 Cys Leu Asn Asn Ser Thr Leu Asn Tyr Ile Cys Lys Phe Tyr Gln Leu 610 615 620 Lys Tyr Leu Thr Leu Arg Lys Thr Asn Ile Gly Lys Leu Pro Arg Leu625 630 635 640 Ile Gly Asn Leu Lys Tyr Leu Glu Thr Leu Asp Ile Arg Ala Thr Arg 645 650 655 Ile Lys Arg Leu Pro Ala Ser Ala Ser Asn Leu Ser Cys Leu Lys His 660 665 670 Leu Leu Val Gly His Lys Val Gln Leu Thr Arg Thr Thr Ser Val Lys 675 680 685 Cys Phe Arg Pro Asp Ser Gly Leu Glu Met Thr Ala Gly Val Val Lys 690 695 700 Asn Met Met Ala Leu Gln Ser Leu Ala His Ile Val Val Lys Glu Arg705 710 715 720 Pro Ala Val Leu Ser Glu Ile Gly Gln Leu Gln Lys Leu Gln Lys Leu 725 730 735 Asn Val Leu Phe Arg Gly Val Glu Glu Asn Trp Asn Ala Phe Leu Gln 740 745 750 Ser Leu Val Lys Leu Thr Gly Ser Leu Arg Ser Leu Ser Ile His Ile 755 760 765 Leu Asp Glu Lys Glu His Ser Ser Ser Leu Glu Tyr Leu Ala Leu Ile 770 775 780 Ala Glu Ser Pro Pro Leu Phe Ile Arg Asn Phe Ser Leu Lys Gly Lys785 790 795 800 Leu Gln Arg Leu Pro Pro Trp Ile Pro Ser Leu Arg Asn Val Ser Arg 805 810 815 Ile Thr Phe Arg Asp Thr Gly Leu His Ala Glu Ala Ile Gly Val Leu 820 825 830 Gly Asp Leu Pro Asn Leu Leu Cys Leu Lys Leu Tyr Gln Arg Ser Tyr 835 840 845 Ala Asp Asp His Ile Phe Phe Ala His Gly Asn Phe Leu Lys Leu Arg 850 855 860 Met Leu Val Ile Asp Asn Met Glu Asn Ile Arg Asn Val His Phe Glu865 870 875 880 Lys Gly Ser Val Pro Asn Leu Glu Trp Leu Thr Ile Ala Phe Leu Gln 885 890 895 Glu Pro Lys Asp Gly Ile Thr Gly Leu Glu Asn Leu Leu Lys Leu Lys 900 905 910 Glu Ile Glu Phe Phe Gly Asp Ile Ile Leu Ser Met Val Thr Lys Val 915 920 925 Ala Ser Cys Met Lys Ala His Pro Asn Arg Pro Arg Val Ile Gly Asp 930 935 940 Lys Trp Asn Asn Val Thr Glu Tyr Ala945 950 16989PRTOryza sativaPEPTIDE(0)...(0)Accession No NP_910482 Rice NBS-LRR 16Met Glu Gly Ala Ile Val Ser Leu Thr Glu Gly Ala Val Arg Gly Leu1 5 10 15 Leu Arg Lys Leu Ala Gly Val Leu Ala Gln Glu Ser Ser Pro Ala Gln 20 25 30 Arg Val His Gly Glu Val Gln Tyr Ile Lys Asp Glu Leu Glu Ser Met 35 40 45 Asn Ala Phe Leu Arg Ser Val Ser Thr Ser Pro Glu Asp Ala Ala Gly 50 55 60 His Asp Asp Gln Val Arg Val Trp Met Lys Gln Val Arg Glu Ile Ala65 70 75 80 Tyr Asp Ala Glu Asp Cys Ile Asp Val Phe Val Arg Gly Arg Ser His 85 90 95 Pro Ala Ala Ala Ala Gly Asp Glu Gly Arg Leu Val Ala Ser Leu Arg 100 105 110 Arg Phe Val Arg Leu Leu Ala Gly Ala Leu Gly Val Gly Gly Gly Asp 115 120 125 Arg Ser Val Ala Ala Gln Leu Arg Glu Leu Lys Ala Arg Ala Arg Asp 130 135 140 Ala Gly Glu Arg Arg Thr Arg Tyr Gly Val Ser Leu Ala Ala Ala Ala145 150 155 160 Val Arg Gly Gly Gly Gly Ser Ser Ser Ser Gly Arg Leu Asp Pro Arg 165 170 175 Leu His Ala Leu Phe Thr Glu Glu Ala Gln Leu Val Gly Ile Asp Gly 180 185 190 Pro Arg Glu Glu Leu Val Gly Trp Val Met Glu Glu Glu Pro Arg Leu 195 200 205 Arg Val Leu Ala Val Val Gly Phe Gly Gly Leu Gly Lys Thr Thr Leu 210 215 220 Ala Arg Met Val Cys Gly Ser Pro Arg Val Lys Gly Ala Ala Asp Phe225 230 235 240 Gln Cys Ser Pro Pro Leu Val Val Val Ser Gln Thr Phe Ser Ile Thr 245 250 255 Ala Leu Phe Gln His Leu Leu Arg Glu Leu Ile Gln Arg Pro Arg Lys 260 265 270 Ala Met Ala Ala Val Ala Ala Ala Gly Gly Gly Gly Gly Asp Leu Val 275 280 285 Ala Tyr Asp Ala Leu Gln Gly Met Glu Arg Trp Glu Thr Ala Ala Leu 290 295 300 Ala Ser Lys Ala Glu Gly Ile Pro Ala Arg Gln Lys Phe Val His Ile305 310 315 320 Cys Gly Thr Ile Thr Leu Tyr Arg Tyr Ile Val Ile Leu Asp Asp Ile 325 330 335 Trp Ser Ser Ser Ala Trp Glu Ser Ile Lys Cys Ala Phe Pro Asp Asn 340 345 350 Lys Lys Gly Ser Arg Ile Ile Val Thr Thr Arg Asn Glu Asp Val Ala 355 360 365 Asn Thr Cys Cys Cys Arg Pro Gln Asp Arg Ile Tyr Lys Ile Gln Arg 370 375 380 Leu Ser Asp Ala Ala Ser Arg Glu Leu Phe Phe Lys Arg Ile Phe Gly385 390 395 400 Met Ala Asp Ala Gly Ala Pro Asp Asp Asp Glu Leu Lys Gln Val Ser 405 410 415 Asp Ser Ile Leu Lys Lys Cys Gly Gly Leu Pro Leu Ala Ile Val Ser 420 425 430 Ile Gly Ser Leu Leu Ala Ser Lys Pro Asn Arg Ser Lys Glu Glu Trp 435 440 445 Gln Lys Val Cys Asp Asn Leu Gly Ser Glu Leu Glu Ser Asn Pro Thr 450 455 460 Leu Glu Gly Thr Lys Gln Val Leu Thr Leu Ser Tyr Asn Asp Leu Pro465 470 475 480 Tyr His Leu Lys Ala Cys Phe Leu Tyr Leu Ser Ile Phe Pro Glu Asn 485 490 495 His Val Ile Lys Arg Gly Pro Leu Val Arg Met Trp Ile Ala Glu Gly 500 505 510 Phe Val Thr Gln Arg His Gly Leu Ser Met Glu Gln Val Gly Glu Arg 515 520 525 Tyr Phe Asp Glu Phe Val Ser Arg Ser Met Val His Leu Val Arg Ile 530 535 540 Asp Trp Ser Gly Lys Val Arg Ser Cys Lys Val His Asp Ile Met Leu545 550 555 560 Glu Val Ile Val Ser Lys Ser Leu Glu Glu Asn Phe Ala Ser Phe Phe 565 570 575 Cys Asp Asn Gly Thr Glu Leu Val Ser His Asp Lys Ile Arg Arg Leu 580 585 590 Ser Ile Arg Ser Ser Ser Tyr Ser Ser Ala Gln Arg Thr Ser Asn Ser 595 600 605 Val Ala His Val Arg Thr Phe Arg Met Ser Pro Ser Ile Asp Asn Ile 610 615 620 Pro Phe Phe Phe Pro Gln Leu Arg Leu Leu Arg Val Leu Asp Met Gln625 630 635 640 Gly Ser Arg Cys Met Ser Asn Lys Asn Leu Asp

Cys Ile Cys Arg Phe 645 650 655 Phe Gln Leu Lys Tyr Leu Ser Leu Arg Asn Thr Ser Val Ser Ile Leu 660 665 670 Pro Arg Leu Ile Gly Asn Leu Asn His Leu Glu Thr Leu Asp Ile Arg 675 680 685 Glu Thr Leu Ile Lys Lys Leu Pro Ser Ser Ala Ala Asn Leu Thr Cys 690 695 700 Leu Lys His Leu Leu Ala Gly His Lys Glu Gln Leu Thr Arg Thr Ser705 710 715 720 Ser Val Lys Phe Leu Arg Pro Ser Ser Gly Leu Lys Met Ser His Gly 725 730 735 Val Ile Arg Asn Met Ala Lys Leu Gln Ser Leu Val His Val Glu Ile 740 745 750 Lys Glu His Pro Ser Val Phe Gln Glu Ile Ala Leu Leu Gln Asn Leu 755 760 765 Arg Lys Leu Ser Val Leu Phe Tyr Gly Ile Glu Val Asn Trp Lys Pro 770 775 780 Phe Leu Glu Leu Leu Asn Met Leu Ser Gly Ser Val Arg Ser Leu Ser785 790 795 800 Ile Asp Ile Phe Asp Ala Gln Gly Asn Ile Ser Ile Ser Ser Leu Glu 805 810 815 Met Leu Ser Ser Leu Val Ser Pro Pro Ile Phe Ile Thr Ser Phe Ser 820 825 830 Leu Thr Gly Lys Leu Gly Ser Leu Pro Pro Trp Val Ala Ser Leu Arg 835 840 845 Ser Val Ser Arg Leu Thr Leu Arg Arg Ser Gln Leu Arg Ala Asp Ala 850 855 860 Ile His Val Leu Gly Gly Leu Gln Asn Leu Leu Cys Leu Lys Leu Tyr865 870 875 880 His Lys Ser Tyr Ala Asp Asp Arg Leu Val Phe Pro Gln Gly Gly Phe 885 890 895 Ala Arg Val Lys Leu Leu Ile Asp Asp Asn Leu Val Asn Leu Glu Lys 900 905 910 Leu His Phe Asn Glu Gly Ser Met Pro Asn Leu Glu Arg Leu Thr Leu 915 920 925 Ser Phe Leu Arg Glu Pro Lys Asp Gly Ile Ser Gly Leu Asn Asn Leu 930 935 940 Leu Lys Leu Lys Glu Val Glu Phe Phe Gly Asn Ile Val Ser Ser Val945 950 955 960 Val Ser Lys Val Val Ser Cys Val Lys Asp His Pro Asn His Pro Arg 965 970 975 Val Val Gly Asp Lys Trp Asn Ile Val Thr Val Tyr Asn 980 985 17998PRTOryza sativaPEPTIDE(0)...(0)Accession No. NP_921091.1 Rice disease resistance protein 17Met Glu Thr Ala Val Leu Ser Ala Val Leu Arg Thr Leu Gly Pro Lys1 5 10 15 Leu Tyr Ala Phe Leu Arg Asp Gly His Asp Leu Leu Arg Arg Asp Leu 20 25 30 Glu Arg Asp Val His Tyr Ile Arg Asn Glu Leu Ala Met Ile Ala Ala 35 40 45 Ala Ile Glu Glu His Asp Arg Arg Pro Pro Pro Ala Ala Gly Asp Val 50 55 60 Arg Ser Ala Trp Ile Arg Gly Val Arg Asp Leu Ala Cys Asp Met Glu65 70 75 80 Asp Cys Val Asp Arg Phe Val His Arg Ala Thr Gly His Gly Leu Ala 85 90 95 Ser Met Gly Ala Arg Ala Lys Phe Ala Ala Val Ile Gln Glu Leu Arg 100 105 110 Arg Lys Ser Glu Glu Leu Ser Arg Leu Arg Ala Ser Tyr Ala Ala Ala 115 120 125 Ala Gly Glu Pro Ser Cys Trp Val Ala Thr Gly Ser Ser Ala Leu Thr 130 135 140 Leu Pro Ala Ser Ser Ser Glu Ala His Thr Leu Ala Ser Asp Ile Val145 150 155 160 Gly Met Asp Gly Pro Arg Asp Glu Ile Leu Glu Leu Ile Gly Glu Thr 165 170 175 Gln Gly Gln Leu Lys Val Ile Ser Ile Val Gly Phe Gly Gly Leu Gly 180 185 190 Lys Thr Leu Leu Ala Arg Gln Ile Tyr Glu Ser Asp Ala Val Ala Ala 195 200 205 Gln Phe His Pro Arg Ile Trp Val Arg Ala Ala Gly Lys Asn Ala Glu 210 215 220 Asp Val Leu Met Asp Ile Leu Gln Gln Leu Gly Met Pro Val His His225 230 235 240 Cys His Ala Ser Asn Leu Val Val Asn Leu Arg Asn Cys Leu Glu Ser 245 250 255 Lys Arg Phe Phe Val Val Ile Asp Asp Met Gln Arg Glu Tyr Trp Asn 260 265 270 Ser Ser Phe Arg Asn Ala Phe Pro Ser Asp Thr Gly Leu Ser Ser Ile 275 280 285 Val Ile Val Thr Thr Ala Ile Gln Ser Ile Ala Asn Ala Cys Ser Ser 290 295 300 Arg Asn Ser His Val Tyr Val Met Arg Thr Leu Asn Glu Glu His Ser305 310 315 320 Arg Gln Leu Phe Leu Lys Glu Ala Ser Trp Lys Asp Tyr Pro Pro Gly 325 330 335 Ser Glu Ala Ile Leu Lys Lys Cys Asp Gly Leu Pro Leu Ala Leu Val 340 345 350 Thr Thr Ala Gln Phe Leu Gln Ser Arg Cys Gln Gln Gln Pro Leu Gly 355 360 365 Cys Ala Lys Leu Cys Asp Asn Leu Gly Lys His Leu Val Thr Glu Asp 370 375 380 Thr Leu Ala Arg Met Lys Arg Val Leu Val His His Tyr Ser Ser Leu385 390 395 400 Pro Gly His Val Ile Lys Ala Cys Leu Leu Tyr Leu Gly Ile Phe Pro 405 410 415 Ser Gly His Pro Val Arg Arg Lys Thr Leu Ile Arg Arg Trp Ser Ala 420 425 430 Glu Gly Phe Val Gly Ala Asp His His Arg Ser Ser Leu Asp Val Ala 435 440 445 Ile Asp Ser Phe Glu Glu Leu Val Asn Arg Ser Ile Ile Gln Pro Val 450 455 460 Asp Val Ser Ser Asn Thr Glu Val Lys Thr Cys Gln Thr His Gly Met465 470 475 480 Met Leu Glu Phe Ile Leu His Lys Ser Ile Cys Asp Asn Phe Ile Thr 485 490 495 Phe Leu Tyr Gly Gln Ala Arg Leu Pro Asp Lys Ile Arg Cys Val Ser 500 505 510 Ile Gln Gln Asn Ser Gly Ser Lys Thr Arg Val Asp Ser Asp Ile Asp 515 520 525 Leu Ser Leu Val Arg Ser Leu Thr Ile Phe Gly Lys Ala His Lys Ser 530 535 540 Phe Leu Asn Phe Ser Arg Tyr Lys Leu Leu Arg Val Leu Asp Leu Glu545 550 555 560 Glu Cys Asp Glu Leu Glu Asp Glu His Leu Lys Lys Ile Cys Lys Arg 565 570 575 Leu Leu Leu Lys Tyr Leu Ser Leu Gly Arg Gly Ile Thr Val Leu Pro 580 585 590 Lys Glu Ile Ala Lys Leu Lys Phe Leu Glu Thr Leu Asp Leu Arg Arg 595 600 605 Thr Val Ile Lys Phe Leu Pro Ile Gln Val Leu Glu Leu Pro Cys Leu 610 615 620 Ile His Leu Phe Gly Val Phe Lys Ile Gln Asp Ala Asp Gln Gln Met625 630 635 640 Arg Lys Leu Lys Ser Phe Leu Thr Glu Lys Ser Lys Leu Glu Thr Leu 645 650 655 Ala Gly Phe Val Thr Asp Arg Cys Gln Thr Phe Pro Gln Leu Met Lys 660 665 670 His Met Thr Asn Leu Ala Lys Val Lys Ile Trp Cys Glu Asn Thr Ala 675 680 685 Asp Ala Ser Ser Ser Ser Asn Ser Asp Val His Leu Ser Glu Ala Ile 690 695 700 Gln Glu Phe Ile Gln Arg Gly Thr Asp Val Asn Asp Val Arg Ser Leu705 710 715 720 Ser Leu Asp Val Gly Glu Cys Ser Gln Glu Phe Leu Asn Phe Ser Leu 725 730 735 Gly Asp Ser Cys Tyr Leu Ser Ser Leu Lys Leu Lys Gly Asn Lys Ile 740 745 750 Cys Arg Leu Pro Pro Phe Val Thr Ser Leu Ala Val Leu Thr Asp Leu 755 760 765 Cys Leu Ser Ser Ser Asp Arg Leu Ser Ser Asp Val Leu Ala Ala Leu 770 775 780 Ser Asn Val Arg Ala Leu Arg Tyr Leu Lys Leu Ile Ala Arg His Leu785 790 795 800 Asp Arg Phe Val Ile Glu Arg Gly Asp Leu Gln Ser Leu Arg Arg Leu 805 810 815 His Ile Val Val Val Ser Met Thr Thr Met Ser Lys Gln Gln Pro Glu 820 825 830 Ile Gln Glu Gly Ala Leu Pro Asn Leu Glu Ser Phe His Leu Leu Cys 835 840 845 Lys Asp Leu Asp Gly Pro Cys Gly His Gly Gly Ile Arg Ile Asp Ser 850 855 860 Leu Gly Leu Gly Cys Leu Arg Glu Ile Val Leu Asp Asp Gly Val Arg865 870 875 880 Glu Thr Ala Lys Glu Gln Trp Lys Asp Ala Ala Arg Arg His Pro Lys 885 890 895 Arg Pro Lys Val Val Phe Val Gly Ala Gly Asp Val Val Asp Arg Arg 900 905 910 Arg Val Gly Ala Ala Ala Ala Ala Ala Pro Ala Ala Gly Glu Ser Asn 915 920 925 Ser Ala Met Ala Pro Ala Ala Val Ala Ser Val Val Ala Ala Gly Asp 930 935 940 Val Lys Arg Pro Ala Arg Glu Glu Ser Asp Ile Ser Ala Ala Leu Ala945 950 955 960 Ser Leu Pro Ala Lys Met Ala Arg Leu Leu Gly Ala Ala Ser Ile His 965 970 975 Gln Ser Ser Gly Thr Gln Gly Glu Leu Ser Cys Gly Gly Asn Gly Ala 980 985 990 Ser Gln Arg His Phe Ser 995 18958PRTHordeum vulgarePEPTIDE(0)...(0)Accession No. AAG37354, Barley powdery mildew resistance protein 18Met Asp Ile Val Thr Gly Ala Ile Ser Asn Leu Ile Pro Lys Leu Gly1 5 10 15 Glu Leu Leu Thr Glu Glu Phe Lys Leu His Lys Gly Val Lys Lys Asn 20 25 30 Ile Glu Asp Leu Gly Lys Glu Leu Glu Ser Met Asn Ala Ala Leu Ile 35 40 45 Lys Ile Gly Glu Val Pro Arg Glu Gln Leu Asp Ser Gln Asp Lys Leu 50 55 60 Trp Ala Asp Glu Val Arg Glu Leu Ser Tyr Val Ile Glu Asp Val Val65 70 75 80 Asp Lys Phe Leu Val Gln Val Asp Gly Ile Gln Phe Asp Asp Asn Asn 85 90 95 Asn Lys Phe Lys Gly Phe Met Lys Arg Thr Thr Glu Leu Leu Lys Lys 100 105 110 Val Lys His Lys His Gly Ile Ala His Ala Ile Lys Asp Ile Gln Glu 115 120 125 Gln Leu Gln Lys Val Ala Asp Arg Arg Asp Arg Asn Lys Val Phe Val 130 135 140 Pro His Pro Thr Arg Thr Ile Ala Ile Asp Pro Cys Leu Arg Ala Leu145 150 155 160 Tyr Ala Glu Ala Thr Glu Leu Val Gly Ile Tyr Gly Lys Arg Asp Gln 165 170 175 Asp Leu Met Arg Leu Leu Ser Met Glu Gly Asp Asp Ala Ser Asn Lys 180 185 190 Arg Leu Lys Lys Val Ser Ile Val Gly Phe Gly Gly Leu Gly Lys Thr 195 200 205 Thr Leu Ala Arg Ala Val Tyr Glu Lys Ile Lys Gly Asp Phe Asp Cys 210 215 220 Arg Ala Phe Val Pro Val Gly Gln Asn Pro His Met Lys Lys Val Leu225 230 235 240 Arg Asp Ile Leu Ile Asp Leu Gly Asn Pro His Ser Asp Leu Ala Met 245 250 255 Leu Asp Ala Asn Gln Leu Ile Lys Lys Leu Arg Glu Phe Leu Glu Asn 260 265 270 Lys Arg Tyr Leu Val Ile Ile Asp Asp Ile Trp Asp Glu Lys Leu Trp 275 280 285 Glu Gly Ile Asn Phe Ala Phe Ser Asn Arg Asn Asn Leu Gly Ser Arg 290 295 300 Leu Ile Thr Thr Thr Arg Ile Val Ser Val Ser Asn Ser Cys Cys Ser305 310 315 320 Ser His Gly Asp Ser Val Tyr Gln Met Glu Pro Leu Ser Val Asp Asp 325 330 335 Ser Arg Ile Leu Phe Trp Lys Arg Ile Phe Pro Asp Glu Asn Gly Cys 340 345 350 Leu Asn Glu Phe Glu Gln Val Ser Arg Asp Ile Leu Lys Lys Cys Gly 355 360 365 Gly Val Pro Leu Ala Ile Ile Thr Ile Ala Ser Ala Leu Ala Gly Asp 370 375 380 Gln Lys Met Lys Pro Lys Cys Glu Trp Asp Ile Leu Leu Gln Ser Leu385 390 395 400 Gly Ser Gly Leu Thr Glu Asp Asn Ser Leu Glu Glu Met Arg Arg Ile 405 410 415 Leu Ser Phe Ser Tyr Ser Asn Leu Pro Ser His Leu Lys Thr Cys Leu 420 425 430 Leu Tyr Leu Cys Ile Tyr Pro Glu Asp Ser Lys Ile His Arg Asp Glu 435 440 445 Leu Ile Trp Lys Trp Val Ala Glu Gly Phe Val His His Glu Asn Gln 450 455 460 Gly Asn Ser Leu Tyr Leu Leu Gly Leu Asn Tyr Phe Asn Gln Leu Ile465 470 475 480 Asn Arg Ser Met Ile Gln Pro Ile Tyr Gly Phe Asn Asp Glu Val Tyr 485 490 495 Val Cys Arg Val His Asp Met Val Leu Asp Leu Ile Cys Asn Leu Ser 500 505 510 Arg Glu Ala Lys Phe Val Asn Leu Leu Asp Gly Ser Gly Asn Ser Met 515 520 525 Ser Ser Gln Gly Asn Cys Arg Arg Leu Ser Leu Gln Lys Arg Asn Glu 530 535 540 Asp His Gln Ala Lys Pro Ile Thr Asp Ile Lys Ser Met Ser Arg Val545 550 555 560 Arg Ser Ile Thr Ile Phe Pro Pro Ala Ile Glu Val Met Pro Ser Leu 565 570 575 Ser Arg Phe Asp Val Leu Arg Val Leu Asp Leu Ser Arg Cys Asn Leu 580 585 590 Gly Glu Asn Ser Ser Leu Gln Leu Asn Leu Lys Asp Val Gly His Leu 595 600 605 Thr His Leu Arg Tyr Leu Gly Leu Glu Gly Thr Asn Ile Ser Lys Leu 610 615 620 Pro Ala Glu Ile Gly Lys Leu Gln Phe Leu Glu Val Leu Asp Leu Gly625 630 635 640 Asn Asn His Asn Leu Lys Glu Leu Pro Ser Thr Val Cys Asn Phe Arg 645 650 655 Arg Leu Ile Tyr Leu Asn Leu Phe Gly Cys Pro Val Val Pro Pro Val 660 665 670 Gly Val Leu Gln Asn Leu Thr Ser Ile Glu Val Leu Arg Gly Ile Leu 675 680 685 Val Ser Val Asn Ile Ile Ala Gln Glu Leu Gly Asn Leu Glu Arg Leu 690 695 700 Arg Val Leu Asp Ile Cys Phe Arg Asp Gly Ser Leu Asp Leu Tyr Lys705 710 715 720 Asp Phe Val Lys Ser Leu Cys Asn Leu His His Ile Glu Ser Leu Arg 725 730 735 Ile Glu Cys Asn Ser Arg Glu Thr Ser Ser Phe Glu Leu Val Asp Leu 740 745 750 Leu Gly Glu Arg Trp Val Pro Pro Val His Phe Arg Glu Phe Val Ser 755 760 765 Ser Met Pro Ser Gln Leu Ser Ala Leu Arg Gly Trp Ile Lys Arg Asp 770 775 780 Pro Ser His Leu Ser Asn Leu Ser Glu Leu Ile Leu Ser Ser Val Lys785 790 795 800 Asp Val Gln Gln Asp Asp Val Glu Ile Ile Gly Gly Leu Leu Cys Leu 805 810 815 Arg Arg Leu Phe Ile Ile Thr Ser Thr Asp Gln Thr Gln Arg Leu Leu 820 825 830 Val Ile Arg Ala Asp Gly Phe Arg Cys Thr Val Asp Phe Arg Leu Asp 835 840 845 Cys Gly Ser Ala Thr Gln Ile Leu Phe Glu Pro Gly Ala Leu Pro Arg 850 855 860 Ala Val Arg Val Trp Phe Ser Leu Gly Val Arg Val Thr Lys Glu Asp865 870 875 880 Gly Asn Arg Gly Phe Asp Leu Gly Leu Gln Gly Asn Leu Phe Ser Leu 885 890 895 Arg Glu Phe Val Ser Val Tyr Met Tyr Cys Gly Gly Ala Arg Val Gly 900 905 910 Glu Ala Lys Glu Ala Glu Ala Ala Val Arg Arg Ala Leu Glu Ala His 915 920 925 Pro Ser His Pro Arg Ile Tyr Ile Gln Met Arg Pro His Ile Ala Lys 930 935 940

Gly Ala His Asp Asp Asp Leu Cys Glu Asp Glu Glu Glu Asn945 950 955 1917DNAArtificial SequenceMPSS Signature Sequence Tag 19gatctcataa ctaggat 172020DNAArtificial SequenceOligonucleotide Primer KEB131 20tgatccttga ttgtccatgg 202120DNAArtificial SequenceOligonucleotide Primer KEB138 21ccgttgcttg catatatgct 20221684DNAZea mayspromoter(0)...(0)Rcg1 Promoter Region 22actgtcgggg accataatta ggggtaccct caagacgcct aattctcagc tggtaacccc 60catcagcata aagctgcaaa ggcctgatgg gcacgattaa gtcagggatc agtccacacg 120agtgactcga tcgcgcttca cccgagccta gcctcggccg aaggcagccg acctcgagag 180acttccgtct cgcccgaggc cccccttttt atggcggaca catcaccggc ttgcccaagg 240ccttggcttc gctcagaagc aaccttgact aaatcaccac accgactgac caaattgcag 300gggcatttaa cgcaaaggtg gcctgacacc tctatcctga cacgcgcccc cggcagagcc 360gaggtgaccg ccgtcactcc accgctccac tggccagtct gacagaagga cagcgccgcc 420tgcgccactc cgactgcagt gccactcgac agagtgagtc tgacaggcaa ctaggccttg 480ccgaaggcgc cacggcgaac tccgctccgc ccgaccccag ggctcggact cgggctaaga 540cccggaagac ggcgaactcc gctccgcccg accccagggc tcggactcgg gctaagaccc 600ggaagacggc gaactccgct ccgcccgacc ccagggctcg gactcgggct aagacccgga 660agacggcgaa ctccgctccg cccgacccca gggctcggac tcgggctaag acccggaaga 720cggcgaactc cgctccgccc gaccccaggg ctcggactcg ggctaagacc cggaagacgg 780cgaactccgc tccgcccgac cccagggctc agactcaggc taagacccgg aagacgacga 840aactccgcct cgcccgaccc cagggctcgg actccgccct ggcctcggcc ggacgacttc 900cgcctcgccc gaccccctgg ctcgggctcg gccacagcaa ctgaaggcaa gactcaacct 960cggcttcgga ggaaacccca cgtcgccctg cctagagcac agaccgccac gtcaacagga 1020aacgtcatca tcaccctacc ccgaatcgac tcgggtcacg gagaacaaga ccggcgtctc 1080gtccggccag ctccgccaga ggggcaatga tggcgctcca cgagctctat gacgacggcg 1140gcccccagct ctcttacggc agcaggacaa cgtcagcagg gactcgaccg ctccaacagc 1200tgtccctcca tcaggctccg ccgcaccacc gatagccacg acatcacgcc agcaggatgc 1260ccagatctct ccggctgcca catcggcatg tacctagggc actagctctc cctccgctag 1320acacgtagca ctctgctaca tccccattgt acacctgggt cctctcctta cgactataaa 1380aggaaggacc agggtcttct cagagaaggt tggccgcgcg ggaccgagga cgggacaggc 1440gctctcttgg ggccgctcgc ttccctcacc cgcgtggacg cttgtaaccc ccctactgca 1500agcgcacctg acctgggcgc gggacgaaca cgaaggccgc gggacttcca cctctctcac 1560gctcggctcc ggccgcctcg cctctccccc ctccgcgctc gcccacgcgc tcgacccatc 1620tgggctgggg cacgcagcac actcactcgt cggcttaggg accccctgtc tcgaaacgcc 1680gaca 16842320DNAArtificial SequenceOligonucleotide Primer Frey8 Forward 23acatgggtcc aaagatcgac 202420DNAArtificial SequenceOligonucleotide Primer Frey8 Reverse 24catggaagcc ccacaataac 202520DNAArtificial SequenceOligonucleotide Primer Frey27 Forward 25gcatgcccca tctggtatag 202620DNAArtificial SequenceOligonucleotide Primer Frey27 Reverse 26agccctattt cctgctcctg 202720DNAArtificial SequenceOligonucleotide Primer Frey33 Forward 27gcattcacat gttcctcacc 202820DNAArtificial SequenceOligonucleotide Primer Frey33 Reverse 28ctgtcgttcg gttttgcttc 202920DNAArtificial SequenceOligonucleotide Primer Frey41 Forward 29ctgtaaggca cccgatgttt 203020DNAArtificial SequenceOligonucleotide Primer Frey41 Reverse 30tgtgttcgca tcaaaggtgt 203121DNAArtificial SequenceOligonucleotide Primer Frey56 Forward 31tgtccagggt tacagaaaac g 213221DNAArtificial SequenceOligonucleotide Primer Frey56 Reverse 32ggtctgggaa tgctaaagag g 213320DNAArtificial SequenceOligonucleotide Primer Frey95 Forward 33atttcgacgg agggttcttc 203420DNAArtificial SequenceOligonucleotide Primer Frey95 Reverse 34gcagcaggag gagctcatag 203520DNAArtificial SequenceOligonucleotide Primer Frey110 Forward 35atggaggctg ccctgctgag 203624DNAArtificial SequenceOligonucleotide Primer Frey110 Reverse 36cgtatacctc tctggcaagg acgg 243725DNAArtificial SequenceOligonucleotide Primer Frey111 Forward 37ttcctgttcg tctgtatctg atccg 253825DNAArtificial SequenceOligonucleotide Primer Frey111 Reverse 38tttgattccg gtcgagtata acctg 253925DNAArtificial SequenceOligonucleotide Primer Frey112 Forward 39gaaactgcct tcccagaaaa caatg 254024DNAArtificial SequenceOligonucleotide Primer Frey112 Reverse 40caagatcggt gaagttggtg cttc 244125DNAArtificial SequenceOligonucleotide Primer Frey113F Forward 41atcacagatg ggtctcaagg attgc 254220DNAArtificial SequenceOligonucleotide Primer Alex1R Reverse 42ttccaagcaa ttcacagctc 204324DNAArtificial SequenceOligonucleotide Primer umc1612 Forward 43aggtccaggt tacagagcaa gaga 244424DNAArtificial SequenceOligonucleotide Primer umc1612 Reverse 44gctagtaggt gcatggtggt ttct 244524DNAArtificial SequenceOligonucleotide Primer umc2041 Forward 45ctacacaagc atagaggcct ggag 244623DNAArtificial SequenceOligonucleotide Primer umc2041 Reverse 46cagtacgaga cgatggagga cat 234720DNAArtificial SequenceOligonucleotide Primer cdo127 Forward 47tgctgttgtt actcgggttg 204820DNAArtificial SequenceOligonucleotide Primer cdo127 Reverse 48ctctgcctca gcacaaattc 204926DNAArtificial SequenceOligonucleotide Primer phi093 Forward 49agtgcgtcag cttcatcgcc tacaag 265030DNAArtificial SequenceOligonucleotide Primer phi093 Reverse 50aggccatgca tgcttgcaac aatggataca 305120DNAArtificial SequenceOligonucleotide Primer cdo365 Forward 51cttccagagg caaagcgtag 205220DNAArtificial SequenceOligonucleotide Primer cdo365 Reverse 52tgtcacccat gatccagttg 205320DNAArtificial SequenceOligonucleotide Primer csu166 Forward 53tattgtgcac gtcaccttgg 205420DNAArtificial SequenceOligonucleotide Primer csu166 Reverse 54gggcagactt actgctggag 205520DNAArtificial SequenceOligonucleotide Primer umc2285 Forward 55atctgcctcc ttttccttgg 205620DNAArtificial SequenceOligonucleotide Primer umc2285 Reverse 56aagtagctgg gcttggaggg 205720DNAArtificial SequenceOligonucleotide Primer MZA11455 Forward 57acgaagcaat ttcaccttcc 205823DNAArtificial SequenceOligonucleotide Primer MZA11455 Reverse 58tgtggaacta accctcagca tag 235919DNAArtificial SequenceOligonucleotide Primer MZA6064 Forward 59cgagaaccgg agaagaagg 196020DNAArtificial SequenceOligonucleotide Primer MZA6064 Reverse 60ttgggctgct gtattttgtg 206119DNAArtificial SequenceOligonucleotide Primer MZA15842 Forward 61gacgcagctg tgaagttgg 196220DNAArtificial SequenceOligonucleotide Primer MZA15842 Reverse 62caccggaata ccttgaccac 206324DNAArtificial SequenceOligonucleotide Primer umc1086 Forward 63catgaaagtt ttcctgtgca gatt 246425DNAArtificial SequenceOligonucleotide Primer umc1086 Reverse 64gggcaacttt agaggtcgat ttatt 256521DNAArtificial SequenceOligonucleotide Primer umc1466-FA Forward 65gatccactag ggtttcgggg t 216624DNAArtificial SequenceOligonucleotide Primer umc1466-FA Reverse 66cgaatagtgg tctcgcgtct atct 246721DNAArtificial SequenceOligonucleotide Primer umc1418-PA Forward 67gagccaagag ccagagcaaa g 216824DNAArtificial SequenceOligonucleotide Primer umc1418-PA Reverse 68tcacacacac actacactcg caat 246920DNAArtificial SequenceOligonucleotide Primer BNLG2162-DA Forward 69caccggcatt cgatatcttt 207020DNAArtificial SequenceOligonucleotide Primer BNLG2162-DA Reverse 70gtctgctgct agtggtggtg 207120DNAArtificial SequenceOligonucleotide Primer csu166-IA Forward 71aaatatcggc tttggtcacg 207220DNAArtificial SequenceOligonucleotide Primer csu166-IA 72tcgtccttcc tcaattcgac 207324DNAArtificial SequenceOligonucleotide Primer umc1051 Forward 73aatgatcgaa atgccattat ttgt 247424DNAArtificial SequenceOligonucleotide Primer umc1051 Reverse 74ctgatctgac taaggccatc aaac 247524DNAArtificial SequenceOligonucleotide Primer umc2187 Forward 75acccaacaag tcttaatcgg gttt 247624DNAArtificial SequenceOligonucleotide Primer umc2187 Reverse 76gtccacccta cctctcaaca aaca 247723DNAArtificial SequenceOligonucleotide Primer umc1371 Forward 77catgtgaatg gaagtgtccc ttt 237824DNAArtificial SequenceOligonucleotide Primer umc1371 Reverse 78gcatcctttt cgtttcaaat atgc 247924DNAArtificial SequenceOligonucleotide Primer umc1856 Forward 79agatctgttt tgctttgctc tgct 248024DNAArtificial SequenceOligonucleotide Primer umc1856 Reverse 80catgccttta ttctcacaca aacg 248121DNAArtificial SequenceOligonucleotide Primer MZA1215 External Nested Forward Primer 81agcccaattc tgtagatcca a 218219DNAArtificial SequenceOligonucleotide Primer MZA1215 External Nested Reverse Primer 82tgcatgcacc ggatccttc 198320DNAArtificial SequenceOligonucleotide Primer MZA1215 Internal Nested Forward Primer 83agcagcagac gatgcaaaga 208419DNAArtificial SequenceOligonucleotide Primer MZA1215 Internal Nested Reverse Primer 84aggctggcgg tggacttga 198520DNAArtificial SequenceOligonucleotide Primer MZA1216 External Nested Forward Primer 85ccggcctacg gcaacaagaa 208619DNAArtificial SequenceOligonucleotide Primer MZA1216 External Nested Reverse Primer 86agggtacggt gacccgaag 198720DNAArtificial SequenceOligonucleotide Primer MZA1216 Internal Nested Forward Primer 87ttcgagacgc tgtcgtacct 208820DNAArtificial SequenceOligonucleotide Primer MZA1216 Internal Nested Reverse Primer 88acgacgcatg gcactagcta 208918DNAArtificial SequenceOligonucleotide Primer MZA3434 External Nested Forward Primer 89tgtaccgcga gaactcca 189021DNAArtificial SequenceOligonucleotide Primer MZA3434 External Nested Reverse Primer 90ttgcattcac atgttcctca c 219118DNAArtificial SequenceOligonucleotide Primer MZA3434 Internal Nested Forward Primer 91ctactacgac ggccgcta 189221DNAArtificial SequenceOligonucleotide Primer MZA3434 Internal Nested Reverse Primer 92ttgcagtagt tttgtagcag g 219322DNAArtificial SequenceOligonucleotide Primer MZA2591 External Nested Forward Primer 93agtaaataac agcattgacc tc 229418DNAArtificial SequenceOligonucleotide Primer MZA2591 External Nested Reverse Primer 94tccaacggcg gtcactcc 189521DNAArtificial SequenceOligonucleotide Primer MZA2591 Internal Nested Forward Primer 95ctatataaca gggccctgga a 219620DNAArtificial SequenceOligonucleotide Primer MZA2591 Internal Nested Reverse Primer 96cacaaagccc acaagctaag 209721DNAArtificial SequenceOligonucleotide Primer MZA11123 External Nested Forward Primer 97accacaatct gaagcaagta g 219820DNAArtificial SequenceOligonucleotide Primer MZA11123 External Nested Reverse Primer 98cacagaaaca tctggtgctg 209921DNAArtificial SequenceOligonucleotide Primer MZA11123 Internal Nested Forward Primer 99aaagaccaag aaatgcagtc c 2110021DNAArtificial SequenceOligonucleotide Primer MZA11123 Internal Nested Reverse Primer 100agacatcacg taacagtttc c 2110120DNAArtificial SequenceOligonucleotide Primer MZA15842 External Nested Forward Primer 101ctcgattggc atacgcgata 2010220DNAArtificial SequenceOligonucleotide Primer MZA15842 External Nested Reverse Primer 102ttccttctcc acgcagttca 2010322DNAArtificial SequenceOligonucleotide Primer MZA15842 Internal Nested Forward Primer 103agaaggtatt tgccatggct ta 2210422DNAArtificial SequenceOligonucleotide Primer MZA15842 Internal Nested Reverse Primer 104gtttcacttg ctgaaggcag tc 2210521DNAArtificial SequenceOligonucleotide Primer MZA11455 External Nested Forward Primer 105gaccgatgaa ggcaattgtg a 2110622DNAArtificial SequenceOligonucleotide Primer MZA11455 External Nested Reverse Primer 106accaaatagt cctagataat gg 2210722DNAArtificial SequenceOligonucleotide Primer MZA11455 Internal Nested Forward Primer 107ttcaaccttc tgactgacac at 2210822DNAArtificial SequenceOligonucleotide Primer MZA11455 Internal Nested Reverse Primer 108taaacatagt cataaaaatt ac 2210922DNAArtificial SequenceOligonucleotide Primer MZA6064 External Nested Forward Primer 109tcgaatgtat tttttaatgc gg 2211020DNAArtificial SequenceOligonucleotide Primer MZA6064 External Nested Reverse Primer 110atccacaatg gcacttgggt 2011122DNAArtificial SequenceOligonucleotide Primer MZA6064 Internal Nested Forward Primer 111cagctatttt tgtcttcttc ct 2211220DNAArtificial SequenceOligonucleotide Primer MZA6064 Internal Nested Reverse Primer 112ggtcagattc caattcggac 2011320DNAArtificial SequenceOligonucleotide Primer MZA11394 External Nested Forward Primer 113tcgtcctaac agcctgtgtt 2011420DNAArtificial SequenceOligonucleotide Primer MZA11394 External Nested Reverse Primer 114gtccggatca aatggatcgt 2011522DNAArtificial SequenceOligonucleotide Primer MZA11394 Internal Nested Forward Primer 115aacagcctgt gttgaataag gt 2211619DNAArtificial SequenceOligonucleotide Primer MZA11394 Internal Nested Reverse Primer 116cgtgttccgt cgagggagt 1911722DNAArtificial SequenceOligonucleotide Primer MZA8761 External Nested Forward Primer 117ttctttgatt ctactcttga gc 2211820DNAArtificial SequenceOligonucleotide Primer MZA8761 External Nested Reverse Primer 118cttcatggac gcctgagatt 2011922DNAArtificial SequenceOligonucleotide Primer MZA8761 Internal Nested Forward Primer 119tagagctttc tgaactgata gc 2212021DNAArtificial SequenceOligonucleotide Primer MZA8761 Internal Nested Reverse Primer 120ttggcattta gcttctctcc a

2112122DNAArtificial SequenceOligonucleotide Primer MZA1851 External Nested Forward Primer 121atatattgca ccacttaaag cc 2212222DNAArtificial SequenceOligonucleotide Primer MZA1851 External Nested Reverse Primer 122gggtgttatc acttgttcta ta 2212320DNAArtificial SequenceOligonucleotide Primer MZA1851 Internal Nested Forward Primer 123tggagtcctt gaccatttgc 2012422DNAArtificial SequenceOligonucleotide Primer MZA1851 Internal Nested Reverse Primer 124tatatgcact tctagcgagt at 2212532DNAArtificial SequenceDegenerate oligonucleotide consensus primer designed from the terminal inverted repeats (TIR) from the Mutator element sequence 125agagaagcca acgccawcgc ctcyatttcg tc 3212618DNAArtificial SequenceOligonucleotide primer used linked in combination with MZA internal primers in order to sequence PCR products 126tgtaaaacga cggccagt 1812719DNAArtificial SequenceOligonucleotide primer used linked in combination with MZA internal primers in order to sequence PCR products 127ggaaacagct atgaccatg 191281698DNAArtificial SequenceRcg1 promoter with 14 bp of cloning oligonucleotide sequence added at 5' end 128gaggctcggg ggctactgtc ggggaccata attaggggta ccctcaagac gcctaattct 60cagctggtaa cccccatcag cataaagctg caaaggcctg atgggcacga ttaagtcagg 120gatcagtcca cacgagtgac tcgatcgcgc ttcacccgag cctagcctcg gccgaaggca 180gccgacctcg agagacttcc gtctcgcccg aggcccccct ttttatggcg gacacatcac 240cggcttgccc aaggccttgg cttcgctcag aagcaacctt gactaaatca ccacaccgac 300tgaccaaatt gcaggggcat ttaacgcaaa ggtggcctga cacctctatc ctgacacgcg 360cccccggcag agccgaggtg accgccgtca ctccaccgct ccactggcca gtctgacaga 420aggacagcgc cgcctgcgcc actccgactg cagtgccact cgacagagtg agtctgacag 480gcaactaggc cttgccgaag gcgccacggc gaactccgct ccgcccgacc ccagggctcg 540gactcgggct aagacccgga agacggcgaa ctccgctccg cccgacccca gggctcggac 600tcgggctaag acccggaaga cggcgaactc cgctccgccc gaccccaggg ctcggactcg 660ggctaagacc cggaagacgg cgaactccgc tccgcccgac cccagggctc ggactcgggc 720taagacccgg aagacggcga actccgctcc gcccgacccc agggctcgga ctcgggctaa 780gacccggaag acggcgaact ccgctccgcc cgaccccagg gctcagactc aggctaagac 840ccggaagacg acgaaactcc gcctcgcccg accccagggc tcggactccg ccctggcctc 900ggccggacga cttccgcctc gcccgacccc ctggctcggg ctcggccaca gcaactgaag 960gcaagactca acctcggctt cggaggaaac cccacgtcgc cctgcctaga gcacagaccg 1020ccacgtcaac aggaaacgtc atcatcaccc taccccgaat cgactcgggt cacggagaac 1080aagaccggcg tctcgtccgg ccagctccgc cagaggggca atgatggcgc tccacgagct 1140ctatgacgac ggcggccccc agctctctta cggcagcagg acaacgtcag cagggactcg 1200accgctccaa cagctgtccc tccatcaggc tccgccgcac caccgatagc cacgacatca 1260cgccagcagg atgcccagat ctctccggct gccacatcgg catgtaccta gggcactagc 1320tctccctccg ctagacacgt agcactctgc tacatcccca ttgtacacct gggtcctctc 1380cttacgacta taaaaggaag gaccagggtc ttctcagaga aggttggccg cgcgggaccg 1440aggacgggac aggcgctctc ttggggccgc tcgcttccct cacccgcgtg gacgcttgta 1500acccccctac tgcaagcgca cctgacctgg gcgcgggacg aacacgaagg ccgcgggact 1560tccacctctc tcacgctcgg ctccggccgc ctcgcctctc ccccctccgc gctcgcccac 1620gcgctcgacc catctgggct ggggcacgca gcacactcac tcgtcggctt agggaccccc 1680tgtctcgaaa cgccgaca 169812920DNAArtificial SequenceOligonucleotide Primer MZA16510 External Nested Forward Primer 129aacaacaagg cgacggtgat 2013020DNAArtificial SequenceOligonucleotide Primer MZA16510 External Nested Reverse Primer 130tcatcttcgt cgtcctcatc 2013118DNAArtificial SequenceOligonucleotide Primer MZA16510 Internal Nested Forward Primer 131gatcatcctg ccggagtt 1813218DNAArtificial SequenceOligonucleotide Primer MZA16510 Internal Nested Reverse Primer 132aaccgaaaac acaccctc 1813321DNAArtificial SequenceOligonucleotide Primer MZA1719 External Nested Forward Primer 133ccagcggtag attatataca g 2113419DNAArtificial SequenceOligonucleotide Primer MZA1719 External Nested Reverse Primer 134cggtttggtc tgatgaggc 1913519DNAArtificial SequenceOligonucleotide Primer MZA1719 Internal Nested Forward Primer 135ctcgggaacc ttgttggga 1913621DNAArtificial SequenceOligonucleotide Primer MZA1719 Internal Nested Reverse Primer 136tgaaatccag aacctccttt g 2113750330DNAzea maysmisc_feature(0)...(0)Non-colinear sequence 137taaaaacttg atttagaaac tcagctagtg cttttggcaa ccaaacccca cagccaaaca 60gctgcatgtc tagaggtaga ggagtagact cctcacaccg ggtaagtcta gctgagtatt 120agtatactca gccttgcttg tggcataatt tttacaggtt ctctggagga aatggttgct 180ggagtgactt ggccgtccat cttgccaccg ggttggactg tcgagtggga ccctgccttg 240gctgaggagg agcatgagga gtgatgggac aggcttcccc atctctctat ttatttaccg 300ttagtttatt tccgctgcac ttcgaacaat gatggttact tttgcaaaaa ctccgaggat 360gatgatgatg gtgatgtaat aatttaatac tctgacatgt atggttttat gctttattgt 420atttgctctg tgactcacct tcgagtgaga ttgtggtact tgatcctgtc agtggccgtg 480tcggactaga tccgagggat tgacgggtta ttcccaatta agtgtggtct agcctctaag 540gcggggctta ggcacttaag ttggaataat tcgggcagtt ccgccacaaa tagagtgctc 600ggatgaaata gcaatttttc ctaacccttt caccttgcct tggttcccat cactgaatat 660gattgaatct tggggatcct tgttcttgac gtaggaagag aacatcctct tttcccccgt 720catgtggttt gtgcatccgc tgtcgataat ccagcttgag cccccggatg cataaacctg 780caaggcaaat ttaggcttgg gtcttaggta cccaactcat gttgggtcct acaaggttag 840ttacaatagt cttagagacc caaatgcaag tcttgtctcc cttacatttg gcccctaatt 900tcctagcaat taccttctta tcctttctac aaatagcaaa ggaagcattg caagcataat 960aaattgtaca aggttcattc attactttcc tagggacatg aacaatattt attctaggca 1020tatgatgaac aacatttttc ctagcaaatt tttatcatgc ataatagaag aactagaagc 1080aatcatggca tgagaatcaa aagcatcata acttctatac acattcctag aatgtctcct 1140atcatgatac atgaaagcac ggttcttttg agcactacta gccatagggg ccttcccttt 1200ctccttggcg gagatggaag ccttatggct tgttaagttc ttgacttccc tcttgaagcc 1260aagaccatcc ttaattgagg ggtgtctacc aatcgtgtag gcatcccttg caaattttag 1320tttgtcaaat tcactcttgc tagtcttaag ttgagcatta agactagcca cttcatcatt 1380caatttagaa attgaaacta ggcgttcact acaagcatca acattaaaat ctttacacct 1440attgcaaact acaacatgtt ctacacaaga tgttgattta ttagctattt ctaacttagc 1500actcaaatca tcatttatgc tctttaagct agaaatagag tcatgacatg tagacaattc 1560acaagaaagc atttcattcc ttttaatttc taaagcaagg gatttttgtg cctctacaaa 1620cttatcatgt tcttcataca aaagatcctc ttgcttttct aataacctgt ttctatcatt 1680caaggcatca attaattcat taatcttatc aactttagtt ctatctaggc ccttgaataa 1740acatgaatag tctatttcat catcgctaga ttcttcatca cttgaggaag cgtaagtact 1800agtatcacga gtgcttacct tcttttccct tgccatgagg caggtgtgat gctcattggg 1860gaagagggac gatttgttga aggcggtggc ggcgagtcct ttgttgtcgg agtcggacga 1920cgaacaatcc gagtcccact ccttgccaag gtgtgcctcg cccttagcct tcttgtaagt 1980cttcttcttt tccctcttgt tcccttgttc ctggtcacta tcattatcgg gacaattagc 2040gataaaatga ccaatcttac cacatttgaa gcatgagcgt ttcccctttg tcttgttctt 2100gttgggatgc tccttacgac cctttagcgc cgtcttgaaa cgcttgatga tgagggccat 2160ttcttcatca ttaagcccgg ccgcctcaac ttgtgccacc ttgctaggta gcgcctcctt 2220gctcctcgtt gctttgagag caatggtttg aggctcttgg attaggccat tcaatgcatc 2280atcaacgtat ctagcctcct tgatcatcat ccgcccgctt acgaactttc caagtatctc 2340ctcgggcgtc atcttggtgt acctaggatt ctcacgaata ttgttcacaa gatgtggatc 2400aaggacagta aaagacttta gcattaggcg gacgacgtcg tggtccgtcc atcgcgtgct 2460tccatagctc cttattttgt tgacgagggt cttgagccgg ttgtatgttt gggttggttc 2520ttcgcccctg atcattgcga atctcccaag ttctccctcc accaactcca tcttggtgag 2580catggtgacg tcgtttccct catgagagat cttgagggtg tcccaaatct gcttggcatt 2640atccaagccg ctcaccttat ggtattcatc cctgcacaat gaagctagaa gaaaagtagt 2700agcttgtgca tttttgtgaa tttgctcatt aatgaacatg ggactatccg tactatcaaa 2760gtgcattcca ttttctacta tctcccatat acttggatgg agagagaata agtggttgtg 2820cattttgtga ctccaaaatc cgtagtcctc tccatcaaag tgggggggtt taccgagggg 2880aatggaaagc aaatgagcat tgaaactttg cggaatatga gaataatcaa aggaaaagat 2940tgaattaacc gtcttctttt tctcgtagtc gttgtcatcg tccttttggg aagaggaaga 3000ttcgtcgctg tcgtagtaga ctatctcctt gatgcgcctt gttttcttct tcctcccgtc 3060gtttcttttg tggcccgacc ccgagtcagt aggcttgtca tcctttagat cattgacgaa 3120ggactccttc tccttatcat tgaccaccat ccccttgccc ttaggatcca tctcttcggg 3180tgattagtcc ctttcttgaa gagaacggct ctgataccaa ttgagagcac ctagaggggg 3240gggtgaatag gtgatcctgt aaaacttgaa acttaatgcc acaaaacttg attagtagtt 3300agcacgatta aagccaagtg gctagagagg agttcttgca agacccgata accacaagag 3360gattaatcac atatagacac agtggtttat cccgtggttc ggccaagttc aacacttgcc 3420tactccacgt tgtggcgtcc caacggacga gggttgcaat caacccctct caagtggtcc 3480aaagacccac ttgaatacca cggtgttttg ctttgcttta ctatatcccg cttgcgagga 3540atctccacaa cttggagcct ctcgccctta cactttgatg ttcacaaaga agcacggagt 3600aagggaggga tgagcaacgc acacaagaca caaaattaga gtgacaatac gcacacaagt 3660cacaacacga gctctcaaca caactcaaag agttctctac tcaaatggag ctctagttgc 3720tatcacaaag aatcaaatgc gcggaatcga agtcttggtg cttagtaatg cttagagaat 3780gcttggtgta ctcctccatg cgcctagggg tcccttttat agccccaagg cagctatgaa 3840ccgttgagat cattccaaga aggcaattct tgccttctgt cgcctggcgc accagacagt 3900ccggtgcacc accggacact gtccggtgcg gatttctttc cttctttggc gaagccgacc 3960gttggagatt cagagtcgtt ggcgcaccgg acactgtccg gtgcacaccg gacagtccgg 4020tgcccccttc tgaccgttgg ctctgccacg cgtcgcgcgc gaattacgcg gccgaccgtt 4080ggcccggctg actgttggct caccggacag tccggtgcac caccggacag tctggtgaat 4140tatagccgta caccaccgtc aaagtcccga gagcagccat ttgacagacg ccagcctggc 4200gcaccggaca ctgtccggtg caccaccgga cagtccggtg caccccgacg agcagccttt 4260tggctgtaca cagccaactt ctccaaaatt gtttctccta tttctagcac ttagacacaa 4320tacattagtc ttcaaaacaa tgtactaagt ctagaaacat acctttaatc ttgatttgca 4380cttcttgagt ccatggcaca atttaacact tatgcacttg tgttggacac ttaatcacca 4440aaatatttag aaatggccca agggcacatt tccctttcac ctgcaatatc tccaccaagg 4500agagctcccc ctcgacaaag ccgaagctcg gtgactggcg cggcgcgcca agtcgttcgt 4560cttactgggc gatgaaaagg agctctacca ccgcatcccc tcaggcatcc tccaacgatg 4620catatccatc gctgaaggac aggagctatt gcaagagata cactcgaggg cttgcggtca 4680ccatgtagca cctcgagccc tcgttgggaa cgccttccga caaggcttct actggccgac 4740cgcggtggcc gacgccacta ggattgtacg ctcctgccaa gggtgtcaat tctacgcaag 4800acagacgcac ctgcccgctc agaccctgca gacaataccc atcacttggt catttgttgt 4860gtggggtctg gacctcgtcg gtccattgca aaaggcacct ggggcttctc gcacctgctg 4920gtcgccatcg acaaattctc caagtggatc gaggtccgac ccctaaccag catcaggtcc 4980gagcaggcgg tggcgttctt caccaacatc gtccatcgct tcagggtccc gaactccatc 5040atcaccgaca atggcaccca gttcactggc aagaggttcc tggacttctg cgaggaccac 5100cacatccggg tggactgggc cgccgtggct caccccatga caaatgggca agtggagcgt 5160gccaacggta tgctcctgca aggactaaaa ccgaggatct acaacgacct caacaagttt 5220ggcaagcaat ggatgaagga actaccctcg gtggtctgga gtctgaggac gacgccaagc 5280tgagccacgg gcttctcacc gttctttcta gtctatgggg ccgaggctat cttgcccata 5340gacttagagt acggttcccc gaggatgagg gcgtacgacg accaaagcaa ctagaccagc 5400cgagaagact cactggacca gctggaggag gctcaggacg tggccttgct acacttggca 5460cgatatcagc agtctcgacg ctaccacgcc cgaggtgttc ggccccgaga cctccaagtg 5520ggagacttgg tgcttcggct gcggcaagac gctcgagggc gccacaagct tactcctccc 5580tgggaggggc cattcatcat ctccaagatt ttgaagcccg gaacttacaa gctggccaac 5640aatcaaggcg aggtctacaa caacgcttgg aacatccgac aactacattg cttttaccct 5700taagatgttt tcaagtcgtt catatacctc attttctatt caaataaagt ctaaccgtta 5760aggaagggtc agccttgcct cggcaaagcc cgaccctccc tcgggggcta gaagggggga 5820accccctctg cgtaaaaaat ttcctcggaa aaagtctttc tgccagaaca tctttcgcgc 5880tttttgactg cttcgatagc gggatcctga aaacgacgga gtacacgtaa gcggcaaggc 5940cgaccgagcc gagggactcc tacgcctccg ggatacggat acctcactca tcaccttctg 6000tgataagtaa ctcacgctcg gataagcgat tttgctgacc gaacaagtgt taacgctcga 6060aaacttttct gccagaacga ttttcgtgcc ttctcgacta tatcgataac agaatcctac 6120ggacgagtaa gagtgcacgt aagcggcgag gccgaccgag ccgaggaact cctatgcctc 6180cgggatacgg atacctcact catcaccttc tgtgaaaagt aactctcgct cggataaacg 6240attctgttac cgacgaacaa gtccagatac tcgaaataag aggaaaggaa acgcagcttt 6300acaacacaac aatgatatgt ttgggcctca gcggccgcga aaaacatacg cacactacag 6360acaaactctc cctgcaggtt cagacatcag cagagggagc agcagcaccc tcgacgtcgt 6420ctccaccttc ggcggaatct ggcccggcct tggacggcga cgtgggcgga aggatctcca 6480cctcgaagat ggaagccaac accaagctcg ggccatcata gccaaggtct ccgtaagggt 6540cccggcccgg gcaaacgcct cgaccggccg ctccgtagcc tcagccagct gtcccccgag 6600gacatcagcc cgactcatgg cctcgacagc ctgactccgg ggttggtccc gccagcggac 6660gacctggcca ggttccagcc gccgctgttg cacctcctcg accagggagg ccaagtgctc 6720ctaggccaac gaagcttctt ctcgagccga ctcagcctct gtccacactg acaccgctgc 6780ctccggctcc ggctcatcgc agagcggccg agggttcttt aactgagcaa gagaagcctt 6840gggtggcaag gccgaccgag ccgagggact cctacgcctc cgggatatgg atacctcact 6900cgtcaccttc cgcagtgggc aactcacact tggttaagcg gttcagctag ccgacaggcg 6960agtcctggtg ctcgaaatga ggaagaaaca tggtattgca ctcaaatacc tagatgttca 7020ggcctcgaca gccataatga acaaacaccg gcactcaagg tgccattaca aacggaactc 7080cggttccact cccgcgggta tgaacaacct ccacatcgga gggcctgcgg gacgacaaac 7140tctagttggc tcgccgccga ccgctccatc agcagcgaca acgacctccg ctccgggcgg 7200ctgaacagca gcagcgatga cctcagggca gacgctgctg cgacaaggcc ctcgcccgca 7260tccccactcg aggggcgagg acaagctatc aaagccgaag agccggaggt ccgaccgcag 7320gtggcgccga gaaaccttct ctggctgcca ccacctcagc accgacgacg gcagccacct 7380gcccaccaac acccgccggg ccgtgaccaa tgtgctcggt tggcactgtt gggtcatgcg 7440cagggttgcc tcgagtcgcg gcaccggttc cgcagtcgag aaggcgcggg aggaggcgcg 7500acggtcgata tagccaaaag cgggccagca gtaatggcga cagcaggcga gcggaagcag 7560cagtcaagtt gtctgcaggc tcacgtcccc tacctggcgc gccaactgtc ggcgtttcga 7620ccccaggggg tccctggacc aacgagtaaa ttgtcgctgc gtgccccagc ccagatgggt 7680tggcgcgaga cggaacacag agggggggaa aaccgcggct tcgtgttgtc ctgcgccaga 7740gtggatgcgc ttgcagtagg gggttacaag cgtccacgag ggagagaaag agagagtgcc 7800tgttcgtcgg cccgtcctcc cgcgcgacca ccctcccgta tgagggccct ggaccttcct 7860tttatagatg taagaagagg gtccaggtgt acaatggggg tgtagcaata tgctaacgtg 7920tctggcagag aggagccaga gccctatgta catgccaacg tggctgtcgg agaggtgcta 7980gagccctgtg catgcgatgt cgtggccgtc ggaggagcac ttgagccctg tagaagcaca 8040actgttgggg ctgtcgggac cttgctgacg tctccttact tccgtaaggg gctgagagcc 8100gccgtcgtca tggccgcacg cggggagcca tcattacttg ttaccggggc gagcctggat 8160gggacaccga tcttgttccc tgtagcctga gctagctagg ggtagggtaa tgatgatccc 8220ccctgtggcg tggtcggtcc gagcccaagg tcgggcgagg cggaaactcc tcctgaggcc 8280gaggtcgggg ttgggtgagg acgcgattcc ttctgaggtc ggggccgagg tcgagccctg 8340gggtcgggcg aggcggagac catcctccga ggtcgaggtc gaggctgagc cctggggtca 8400ggcgaggcgg agtccatctt ccgaggccga ggcgagggcc gagccctagg gtcgggcaag 8460gcggagactt ctcctgaggc cgaggcctaa ggtcgggcga ggcggagctt cctgtggcgc 8520ctgaggctgg actcagctgc tgtcagcctc atcttggcag gtggcacagc agtcggagcg 8580gggcaggcgg cgctgttttc ttgtcaggtc agtcagtgga ggggcgacgt gactgcggtc 8640actttggccc taccgactga ggaacgtgcg tcaggataag gtgtcaggcg atccttgcat 8700tgaatgctcc tgcgatacag tcggttggtg aggcgatctg gccaaggttg cttcactgcg 8760aagcctgccc gagctgggcc tcgggcgagt cgggggtgcg ctcgtttctt tgaggaggcc 8820ctcgggcgag gcgtgaatcc gcctgggtct actgttcctg cccgaggctg ggctcgagcg 8880aggcgagatc gcgtcccttg tcacacccgg atttcagggc accaagaccc gggcgcgaac 8940ataatcacca ggtgtgctgg gaccaagtct cacacatatg atgattcatg gcacaggatc 9000gaatgtcaca tctttactac ataacaggag ttctatacaa aataaataag taattacatt 9060ataaggagac aacggtccag caacccaaag ttgactggga gacgacgacc tagatctctc 9120tcacgaactc atcgcagcat cctccatgcg cctcatcctg cggtacttgt tcttgacctg 9180tggggggggt gagacagcaa gagtgagctc acatacgttc atcgctcaac aagttgtggg 9240gaataatgtg catgatctcg ccaaaggtgg gagctcacgt gaagtgtaag gcttaccaaa 9300gaggatggtt agagctgagc attgctttta aagttggtca aaattttatt agcaattact 9360aagtataagt aaataccaac ccaattaagt agtagaacaa aagtaacaac atcacctgcg 9420atgcaatgca tatgacaaat tgagtttaag ttccataatt taatcatcag agagtcctga 9480gctgctcatg accgtgagct cggctagtat accagtttta cactctgcag aggttgtacc 9540ctttacccac aagtcatgtt acccatttgc gaagggatcg cgacttccca tacacctcta 9600ccaaggaggc gaggcagggt aacactacga ggcctttaca aagttccact agcttcagaa 9660aacccgctac agtttatagg aagctccaat gcagggttct tgcctgaccg ccatcgcagc 9720aaaatcaacc aaggacctcc ctacactgac cactccccta ctgcccttgc ccctttcggg 9780taaggtagtc ctccactggc tttcctaatt aatcagccaa gagcgtccat aaacccttgt 9840ggtggcacgt gtttctcaag ttaagctcta tgttccaatt aacattaatg atcttgacat 9900gaacataaat agaataacaa aataactgga acatagatat gataattaat tatcccaaat 9960ccatgtaaag caatagcaaa ctacccaagt gattcagggg taaacaaggt aatgagataa 10020acaatctagg gtaacctatt gggtcccatc aaaattaacc tatgcatgaa tagtgataat 10080aacgaatatt attgggtaac agaagtgatc aagggcacaa cttgccttta atgagcacct 10140gctcagctac ttcaacctgc tgctcaccag gatcctcatt cacgggctct tctactcgcc 10200acaatacaaa caagcacaat atatagagaa atcaacatca caccaaacat gtaaacaaac 10260tacacagtaa taatctatgc attaaaataa aatcctagga acagaaatca taattttcgg 10320agttatagat tttaagttat ggattttcaa aggttttatg tgtttaaaat agattaagtg 10380aggaattaaa tttcttactg ttttcatgac aaaacagagg ctctaagtga tagagaatta 10440aattacaaaa atttagaaag tggaatggag taatttgggg ttcatataca ttttctatga 10500attattgaag ttctagcaat tattttccta ttaaaaatcc cttttccaat ttatttactc 10560aatttcaaac agctctggat cgagcctcaa ttaccgaaaa gtgcaggggc ttctgcgcat 10620aattttctaa gactcagaat actatgcagt ggacggcggg tttattcctc ggttttccag 10680ggtttctctt acaaaactga cccgcgaagg ggtatcagcc gatctcggcc gcaggatgtg

10740aagtggacgg cccagattaa ttcatacaac ttaacaaatc ggtatgcacc caaggcccac 10800ggatacgaaa tccatgaccg agagagttcc acgtcattga cctaacctaa ccatcggatc 10860tataaccagt ggctcagatt tcatctgcga aggaggtatg ctgtatataa tctcgctcgt 10920ccattcagat cgaacgatcc acatctagtt tgaacccgat ctaatctaga tcgttcgtac 10980acagatcaaa ggcccacggc aagcgcttct cttccccctc cggccacccg tgcggccagg 11040gacagggcac cgcggcggcg ccatcgccgg caacacggtc ggtcggcccc tacagcctta 11100acccgagcga taaatggtgc aaacgggaga ggaagagatg caaaaccaaa tgggagcgat 11160tttaccgtga atcgagtagc aggactcgcc gcccacggag acacgcaggt tcacagcaag 11220agttgatgcc cgacgaggaa tttcccggcc atggctcgcc cagtcgactg gagagcgcct 11280agcccgcgtt cgggtatccc tcacgaacac cccaaaccac atgccgaggc tgtagagtcg 11340ccccagggtt gaatcgaccg aggcggtcat ttctcccctg accacggcga agagcggcac 11400ggtgcgcaac tggttttcct gatagtgggc accggcgtga aattaggccg ccaactcgcg 11460ccccgatgca ccgacccaca atcgccaagg cttctgctgc gcaaacgagt tccccgctgt 11520gatggccgaa gcacagcaca gcaggtggac ggcagcggac cagtcgcggc ggcgcacaga 11580ttggggcgag cagggaggag aagaggaaca gcggcttcgg gtgttatagg cgcagggtaa 11640aggaggggac gaacaggtca cgctggcgcg atgccgcacc tatatgacga gtccgggctg 11700aggacgttaa ccgggcggcg ctagaatcct ggggcttcgg cagaggccgt tgcgggagta 11760gcggcgggca ggtgtgccgc cagcgctgta cgcggggtcg gggcacggag gttgttgcgc 11820taggggtccg cgatttccgt gaatcgggca cgagctcacc agcgccaccg gttttgcgca 11880cgaagcggag gaaatgtagg gagggagaag aagaccactg ccggctgggt ggataagtta 11940gctgggtgac cctggaatgt ggggcccgcc tggcggcgac gcgaaggcca cacgagcgag 12000tgaggggcgt tgggtcgtgc ggtatcggaa aaaaaagaat gggccgaaag tgaggattcg 12060gcccaagtag tgttttattg tttttctttt tcttattttt tttcaaattc aactttaaat 12120tcccatttaa attcaaattt agtggtggat ctatcttcac attaatttcc caacttaaac 12180atggcatggg tgaacttatt tattttcaat atttatttta ttaaaactag tgctatgttt 12240ctccaaatta gagtttaaat gctatgtgtc ccttaatata ttaatatatg ggtactaaca 12300catttatttt actatccaca aatgcacaat caagtaaaaa ctcagcatga tgcataattt 12360atttgagtgt cttctattaa ttatttattg tatagatgag gtgtccacat gaaatggtaa 12420atagggataa cccacacaca tgtaaaggaa tataatctct ccttttagat ttttcttaca 12480aagtgggtgt tacatccctt gagtggacgg agccttgacc tgaattgcgc ccaacagcct 12540ctgcagtttg cgctgatggt gattaccagc cgagtttagg agtcttgggg gtacccctaa 12600ttatggtacc cgacaactgg tatggacgag tctggtgtgg tatgacaatt agagattttc 12660tataacctcc gtgaacaggg aaatgtgtgt gtaagtgcat actgaaaaag aaaacaaggc 12720cacgggagcg ggaagctcag tggtggttga gtattttgtt acttttaagt ctttgggaaa 12780accttacagc aattgccttt ctctaagaaa atgaagagtg acttcaactc caccaaataa 12840agcatgtatg atataggtct ctttctcttt acgggagcgc ggtgggcttg cggaatacct 12900agtgtattca cccatattta tttatgtttt tcagcagccg aagacttctt ttctgctatg 12960cttgattgag agggctgtgt ctgcacccag ttctgcctgt ggcttgggct agtatatttt 13020tctactgcgc ttcatcttct ggctctctcg agcttgtacc cccgtattgt aataactctt 13080atttaaactc tgtactattt gaagaaagga atgtgtttac tagcctcatg ggactactaa 13140ttgtatcaca tttgagtccc aaaggatcgg gacgcttcag aaaatgtcgg ggaccataat 13200taggggtacc ctcaagacgc ctaattctca gctggtaacc cccatcagca taaagctgca 13260aaggcctgat gggtacgatt aagtcaggga tcagtccaca cgagtgactc gatcacgctt 13320cgcccgagcc tagcctcggc caagggcagc cgacctcgag agacttccgt ctcgcccgag 13380gccccccttt gtaatggcgg acacacctcc ggctcgcccg aggccctggc ttcgcttaga 13440agcaaccctg actaaatcgc cgtgccgact gaccaggttg caggagcatt taacgcaaag 13500gtggcctgac acctttatcc tgacacgcgc cccccggcag agccgaagtg accgccgtca 13560ctccaccgct ctactgacca gtctgacaga aggacagcgc cgcctgcgcc actccgactg 13620cagtgccact cgacagagtg agtctgacag gcaatcaggc cttgccaaag gcgccatagg 13680gaactccgct ccgcccgacc ccagggctcg gactcgggct aagacccgga agacggcgaa 13740ctccgctccg cccgacccag ggctcggact cgggctaaga cccggaagac ggcgaactcc 13800gctccgcccg accccagggc tcggactcgg gctaagaccc ggaagacggc gaactccgct 13860ccgcccgacc ccagggctcg gactcgggct aagacccgga agacggcgaa ctccgctccg 13920cccgacccag ggctcggact cgggctcagc cccagaagac gacgaaactc cgcctcgccc 13980gacccagggc tcggactccg ccctggcctc ggccgaacga cctccgcctc gcccgaccca 14040atggctcgga ctcggcctcg gcaacagaag acagactcaa cctcggcttc ggaggagccc 14100ccacgtcgcc cgacctaggg cgcaggcccg ccacgtcaac aaggagcgcc atcatcatcc 14160taccccgagc cgactcgggt cacggagaac aagactggcg tcccatctgg ccagctccgc 14220cagatggaca atgatggcgc cccacaagct ctgtgacgac ggcggctctc agctctctta 14280cggaagcagg gcaacgtcag caaggactcg accgctccaa cagctgtccc tccgccaggc 14340tccgtcgctc ctccgacagc cacgacatca cgccagcaag gtgccaagac ctctccggct 14400gccacattgg catgtaccta gggcgctagc tctctctccg ctagacacgt agcactctgc 14460tacacccccc attgtacacc tggatcctct ccttacgact ataaaaggaa ggaccagggc 14520cttcttagag gaggttggcc gcgcggggac gaggacgaga catgcgctct cttggggccg 14580ctcgcttccc tcacccgcgt ggacgcttgt aaccccccta ctgcaagcgc acccgacctg 14640ggcgcgggac gaacacgaag gccgcgggat ctccacctct ctcacgcccg tctcaggcca 14700cctcgcctct ccccccttcg cgctcgaccc atctgggctg gggcacgcag cacactcact 14760cgtcggctcg gggacccccc ggtctcgaaa cgccgacagt tggcgcgcca ggtaggggcc 14820tgctgcgtgc tgacgaacag cttcccgtca agctccagat gggcagtctc cagaaacctc 14880tccggcccgg gacggtgctc cgtttcggga gtctcgagtt catgtccttc aacggcagct 14940acgacatgat actccttcct ccgccgcgcg acaacgacaa tggcggccga caacccgccc 15000gccggcggcg gaatcggcga catcttcccc gcgtggcgga agaacaacat tcgagctcgc 15060tccgtcctct cccccgccga cggaggagga ggcgaggcaa ccaaggccaa gcgggaggcc 15120gcgcttcgtc ggctgtcgag cgaatcgacg tccccagcgc cccgacggaa ggcacgccgg 15180gcgtcgacct cgcgttcgag atggaggcag gcgccgtccc cccgcgacac gctgatcccg 15240agcaagaaga cgacgccagc gcgctcgcgg gaagcctgca ggacgtcgcc ctcgtacctg 15300ggatgacggt gcaaccagtc cccgatgtga ctacgtcgct cctcgtcgac caaaaggtac 15360cgactaactc ccatcttacg tcatttcgac tcggcctcaa cccgccaagc gacctcgctt 15420tggcgggcgc tctcgttgag gcaagtgcaa ccccactggg gtttcgtatg cggtcgcctt 15480gggaccggtt gacggacgtc tcaacctacg ggccctccga gtccgaggaa gatgacgatc 15540ccagcatcta ttgggatttc tctggacttg gcaaccccag tgccatgcgg gacttcatga 15600ccgcatgcga ctactgcctc tccgactgtt ccgacggaag tcgcagcctt gacgatgagg 15660gctgcggccc aagccgcgaa tgtttccacg ttgagctggg ggatccctcc gaaggcaacc 15720atcttggcat gccggaggac ggtgattttc ctaggcccgt gcctcgcgcc gacatcccgc 15780gggagctagc tgtggtcctc gttccggcgg ggggtcacga cccacagctc gagcgagtcc 15840gcggggcgca ggctaggctc gacgagggaa caggagcgct tgagacgatc cgccgagacg 15900tagggcaggt atgggcgggc caacccccgg gccggagaaa tacgtcacct gccccagggt 15960ctccagcacc gcgtcgccaa cgatgtcagg gtcaggccgc cgcccgcatc cagcggggtt 16020ggtcagaacc tggcagccgc agcgatgctc ctccgcgcga tgccggagcc atcaaccacc 16080gagggtcggc gaatccaggg agagctcaag aatcttctgg aaggcgctgc ggcctgacgg 16140gccgagagca ctgcctcccg aaggtaggga tatccctcgg aacctcatgc cgcgacttcc 16200cgattcatgc gggaagcctc ggtctacacc gggcgcacgc gtaacaccgc gcctgcggcc 16260ccgggccacc tcggcaacga gcaccatcga cgcgaccgtc gggcccacct cgacgaaagg 16320gtgcgccgag gctaccaccc caggcgtggg ggacgctacg acagcgggga ggatcggagt 16380ccctcgcccg aaccacccgg cccgcaggcc ttcagtcggg ccatccgacg ggcgccgttc 16440ccgacccggt tccgaccccc gactactatc gcgaagtact cgggggaaac gagaccggaa 16500ctgtggctcg cggactaccg cctggcctgc caactgggtg gaacggacga cgacaacctc 16560atcatccgta acctccccct gttcctctcc gacactgctc gcgcctggtt ggagcacctg 16620cctccggggc agatctccaa ctgggacgac ttggtccaag ccttcgctgg caatttccag 16680ggcacatacg tgcgccccgg gaattcttgg gaccttcgaa gctgccggca acagccggga 16740gagtctctcc gggactacat ccggcgattc tcgaagcagc gcaccgagct gcccaacatc 16800accgactcgg atgtcatcgg cgcgttcctc gccggcacca cttgccgcga cctggtgagc 16860aagctgggtc gcaagacccc caccagggcg agcgagctga tggacatcgc caccaagttc 16920gcctctggcc aggaggcggt tgaggctatc ttccgaaagg acaagcagcc ccagggccgc 16980ccgtcggaag aggctcccga ggcgtctact ccgcgcggcg ccaagaagaa aggcaagaag 17040aagtcgcaat cgaaacgcgg caccgctgat gcggaccttg tcgccgccgc cgagtacaag 17100aaccctcgga agccccccgg aggtgctaac ctcttcgaca agatgctcaa ggagccgtgc 17160ccctaccatc agggacccat caagcacacc ctcgaggagt gcgtcatgct tcggcgtcac 17220ttccacaggg ccgggccacc cgccgagggt ggcagggctc gcaacgacga caaaaacgaa 17280gatcaccaag caggagagtt ccccgaggtc cgcgactgct tcatgatcta cggtgggcat 17340gcggcgaacg cctcggcttg gcaccacaag caagagcgcc gggaggtctg ctcggtgaag 17400gtggcggcgc cagtctacct agactggtcc gacaagccca tcaccttcga ccaggccgac 17460caccccgacc acgtgccgag cccggggaaa tacccgctcg tcgtcgaccc cgtcatcggc 17520gacgtcaggc tcaccaaggt cctgatggat gggggcagct gcctcaacat catctatgcc 17580gagaccctca agctcctgcg cgtcgatcag tcctccgtcc gggcaggcgc tgcgccattc 17640cacgggatcg tccctgggaa gcgcgtccag cccttcggac gactcgacct ccccgtctgc 17700ttcggaacgc cctccaactt ccgaagggag accctgacgt tcgaggtggt cgggttccga 17760ggaacctacc acgcggtact ggggaggcca tgctacgcga agttcatggc cgtccccaac 17820tacacctact tgaagctcaa gatgccgggc cccaacgggg tcatcaccgt cggccccacg 17880tacaaacacg cgttcgaatg cgacgtggag tgcgtggagt acgccgaggc cctcgccgag 17940tccgaggccc tcatcgccga cctggagaac ctctccaagg aggtgccagc cgtgaagcgt 18000cacgccggca acttcgagcc agcggagacg gttaaggccg tccctctcga ccccagtggc 18060gacacctccg agcagatccg gattgggtcc gggctcgacc ccaaatagga agcagtgctc 18120gtcgactttc tccgcgcaaa cgccgatgtc tttgcatgga gtccctcgga catgcctggc 18180ataccgaggg atgtcgtcga acactcgctg gatactcgga cctgagtctg atccgtcagg 18240cagcctctgc gcctcggtca tcaaggaagg gtcggccttg cctcggcaga gcccgaccct 18300ccctcggggg ctaaaagggg ggaacccctc tgcgtcgaga ttgggcatac ttctccgcat 18360cgaaaatttt caatcaaaaa aggggcctct tgcgttctcc tggctatgtc agaagcaggg 18420tttcaaggag cgaacatggg tacatgtaaa tggcaaggcc gactgagccg agggactcct 18480gtgcctccgg gttagggata cctcactcat cacctgccac gaagaatgac ccaactcgag 18540aagccaccct attattgaca agctaggacg aacacgcaga tggaaagaaa ggagggtacg 18600acttcatgca agaaagacaa agtgttcagg cctcagcggc cacggtgaga cgcgcatcca 18660acaagaaatt gttcaaacaa gaattaggcg ccgccttggg aaggagccgc gccctcagct 18720tcgtccccgc cgtcggtgag gtccatctcg gcctccggtg atggcgcagg gggaaggatc 18780tccgcctcaa aggtggtcgc cagcaccgtg ctcggacccg cggcgaccgc gtcaagccgc 18840tggacctctg ccagggcagc atcgtcttcg tcaggaagac agtacccctc actaacccgc 18900tccaggtcca cgacgtagtg ggaagcgagc acggcgaagg cccgcctgac gccgtggtgt 18960agcgcctcgc ggactctgcc gcgcgtgtga tcacccaagg ctcgaaggcg gctttgaggg 19020gagcttcctg aagggacgtc gccagagccg aggatacgat aaaagtccga gacggcctcg 19080gacatggccg cgaggtcagc ttccctctgc tcggcagctc cggcaagcgc ctcggcgagc 19140gccttggcgg actcatcaag ggcggactca agctctgcga gcaaccagga gaaatacctc 19200aagcacaagc aaaggaaacg gacaagaaca agaaccaggg aggaccaaga catacctccg 19260gctcggacac gatgctccga ggccgcgacc tgggccgcgg ctaggtcggc cgcgagggtc 19320tcagctcggc tttcggcctc ggcagcccgg ccccgagatt ggtcccgctc ctcgacgacc 19380tgggcgagct ccgatcgctg ccgttgcgcc tccgcacgcg ctgctgccgc ctcggccctc 19440aggtcggcgc agagcagctg gaggtccgct accttggcat cctgctgaga aaggcgcgcg 19500gtagccccgg cgagcgagga cctcagggat cgcagcgagc cctagacgtc gacctcgcgg 19560cggatgaacg acgacttggc ggcgctccgg tctgacagat cctggggaaa ggaaacaggg 19620cgtcacgacg agtgcctcgc tcacagaagg aaaaaggtat gcctgaaacc gctacctgga 19680ggattttggg gacgtctctg cagaaaacct ccagcgatga ccggagcgac cccaccgttg 19740cctcagcaca ctcgcggagc tcatcccagg actggtcctc ctgctcatcg tcgagaacga 19800agacagggtc cgaggcctcg ccggtccgga atcggagcaa cgggcgccgg gcctcggggc 19860ttcgccacac agcgatgagg ctgtcacccg gctggacgga tcgcgcgtcc acgcccacct 19920cttctgaggc cttgggcgcc gacgcatcag ccatcccgac actggcggca actggtcgct 19980ctccgacagg gacggcgaca acctcggcgg tggcgggcgc cggcatggcc ggcacgacag 20040gcgggctcag ggccacgttg gcgtcagccg cctcctcaac cacgatggcc gcctcggcag 20100aagagccggc ctcgggagcc cgcttctcag agaccggcga cgcccgagcc ccctgcggtg 20160aagtaccccg cgaaagggtt ggctgaatga caaggcccgg ggcggcgctg gccacacagt 20220ccggcgccgt cttgagggcc ttccggggtg ccaggtcggt ctggccatga ctttgcttgc 20280tggatataaa aaaagaggag gaaagaaaga tcacggccga gacatatgaa tgggaagcca 20340agacgaagac gtcccgggat actcacccac ttcgggccat tatccaccgc gcctgggggg 20400aggtctcttg gatcccggct cccaaggcgg ccgccgaggt ccgcttcgcc ggcattttcg 20460gcgccaccct cgccgtggac gcccgggaag aagattgccc gggcgcggtt gcgacgacct 20520gagggtcacc cccatgcgcc accggtgcga gcggcggccc ctcgggagcg gacgccctga 20580cctggccctc cggagccacc tcagctcctc cggccgaggg aacaggtgac acctcgggtc 20640gcccccgtgc ctcggactgg gaccccgacg ccccaactcc ggggactgat ggtgtcggcc 20700cgcgcggggg ctggctcgac gactcctggc cgcaccccga gccggggccg aggccgagac 20760gggcggccat gtcgtcctcc tcctcatcat cgtcgtcatc gtcgtcgtcg ggcgtctccg 20820gcgacggctc cctcgggagt ccttccctct cctgctggcg acggcgcttc tccaaggcgt 20880cccgagcccg cctccgctcg cgggcccggg ccttctccgc gtccttcttt ttcttcttct 20940cctccgcggc gactcgccgc gctgcacggt ccaccgcatc ctccgggacc cgtggcaggg 21000agggcttgtg ccaccccaca tcctaaaagg aggggagaaa ggaacccgat cataaggacc 21060cggaacgacc caatgtacga agaaggaagg agcgaacact caccaaagtt acgcacccct 21120ggtcggggcg catccgaagc tgggagtatg cgtgggggtc cggcttcccc atcgcagccg 21180acacccgcca ttggagggcg ttgaagggaa gaggatcagg ggacattcgc gagccctccc 21240agtcagcctc tggggtcatc tcctagagcg acagccgccg ctccgccaat ggaagcaccc 21300tccgacggtg gatggcagcg atcactcccg cagcggtgag tcccccctcc cgcaactcct 21360tcagggcctg gagaaggggc tcgaggttct tctgtctctc gtgcggggtc ctgtggcgcc 21420aggcgtcggt ggcagcagta actactctct gggagaacgg tgggagcaac tcaccgtcat 21480tccggaggta gaaccaccgg cgctgccacc ccttgttcga ggacgcaaga atggcaggaa 21540tgtactgtga cgcccgcgac tgcctcagca aaagagtgca gccgccggcc cgcaccgctg 21600cacggaccct cctctcctcc gtcgacaagg cgaaaagctc ggcgaggaag agatgagtcc 21660gcaaatccca atggggggcg atccccaagt acccttcgca taccgctacg aagatagcgg 21720cctgcgagat ggagttgggg gagaggttat gcaattccac cccgtagtgg aacaggatag 21780ctcgcataaa gcggcccgtc ggcacaccga atccccgctc gtggaaggag acgaagctca 21840cgacgtaccc cagcggtggg gacggagcgg ctccacccac gggaggaatc cactctggcc 21900gctgcttatc ggtgaggggg cggagcaaac cctcgccgac cagctcctcc agatcgctcg 21960ctgtcaccgt ggaaaaaggc cacggatcac gcggggggat tatggtcact cgatccgcca 22020tcaccaaaat ggaagagatg gcggcgcggg gggcagggag ggcggttttt tctcttctcc 22080gactaaagtt tcccgggttg cgaaaaccta aagggaaagg aaggaagaag agcaaagaac 22140cgtcaccgga ccccctctcg agtatatgaa ggccagggcg aaaccgtttc cagcgctcca 22200cccggaccgg acgcgggatt cgaaaaacgc gaggcgaaac agccgttcct cgaacggctc 22260gcgcacgcgc aacggccgcc ccgccaacca ctcgccccgt cgcattaact ccgcggcggg 22320acaggcggcg cctctggcag gagaagcgga cgacgcttcg ccttcgccgt aataaccgcg 22380tcaaaaaagg tacgccacgt cgttcgattt cgtatccttt tttcctcttt ctctatctct 22440tgcaacaggg accgggaaag ggggataccc cgaaaaggat ccttctctgt gaaggaaccg 22500ggctccgagc ccccctactg atcagaggtt cgaaggctgg ccctccgagg ggttcaacag 22560tcgcctcaga tcgcgtgggc ccgacaccca ctactggtca ggggttcgaa ggccggcccc 22620ccgaagggct ccatggccgc ctcaggctac tcgggctccg cacccattac tgatcagggg 22680ttcgaaggct ggcccccgaa gggttcacag tcgcctcaga cgccgagcga gggatgacca 22740ggggtacgtt cgatacataa ccgaggctcg ggctgcgctc ccgaggtacc ctaggacatt 22800tccgagacca gcgggaacga tcttgtaacg gaatcccatc ggagggaggc atcgagccct 22860cggaccccgt cgccagggga ccgggtccgg caaatcaccc gcaggtactt ttgggcgtgc 22920ctctgggccc ctagccgacc cccaacgaac ggggcacgga cgtccactcg gattacccgc 22980ttgcagctca ccggagacac catgttcggt gcccatcgag ggtaacatgg cgctctcccc 23040cctcctcctt gcggaaaggc gacgtagggg cgtatgtaaa aaagccgagt ctgtccctga 23100tcgtcctctc gccctgtgca gaggctcggg ggctgctctc gcaaacccgg ctccggccaa 23160accgttgaca gcgtcaacat accagcccga gagcttgggc cctgaccgtg cacccgggct 23220acggccagtt cgcatgaggg aacaaccaga ccagccgaag cattacgcaa ggcattaaga 23280cctcgaagga gtgtaaccac tcctccgagg cctcgggggc tacacccggc gggtgcgctc 23340gcgcgcaccc accggaacaa aatgcaaccg agaaaggctg gtccccttgc aaaaaagtgc 23400gacgaaagcc tccaagcgag tgctaacact cccttcgagg ctcgggggct actgtcgggg 23460accataatta ggggtaccct caagacgcct aattctcagc tggtaacccc catcagcata 23520aagctgcaaa ggcctgatgg gtacgattaa gtcagggatc agtccacacg agtgactcga 23580tcacgcttcg cccgagccta gcctcagcca agggcagccg acctcgagag acttccgtct 23640cggccgaggc ccccctttgt aacggcggac acacctccgg ctcgcccgag gccctggctt 23700tgcttagaag caaccctgac taaatcgccg tgccgactga ccaggttgca ggagcattta 23760acgcaaaggt ggtctgacac ctttatcctg acacgcgccc cccggcagag ccgaagtgac 23820cgccgtcact ccaccgctct actgaccagt ctgacagaag gacagcgccg tctgcgccac 23880tccgactgca gtgccactcg acagagtgag tctgacaggc agtcaggcct taccaaaggc 23940gccataggga actccgctcc gcccgacccc agggctcgga ctcgggctat gacccggaag 24000acggcgaact ccgctccgcc cgacccaggg ctcggactcg ggctaagacc cggaagacgg 24060cgaactccgc tccgcccgac cccagggctc ggactcgggc taagacccgg aagacggcga 24120actccgctcc gcccgacccc agggctcgga ctcgggctaa gacccggaag acggcgaact 24180ccgctccgcc cgaccccagg gctcggactc gggctaagac ccggaagacg gcgaactccg 24240ctccgcccga cccagggctc ggactcgggc tcagccccag aagacgacga aactccgcct 24300cgcccgaccc agggctcgga ctccgccctg gcctcggccg aatgacctcc gcctcgcccg 24360acccagggct cggactcggg ctaagacccg gaagacggcg aactccgctc cgcccgaccc 24420cagggctcgg actcgggcta agacccggaa gacggcgaac tccgctccgc ccgacccatg 24480gctcggactc gggcttagcc ccagaagacg acgaaactcc gcctcgcccg acccagggct 24540cggactccgc cctggcctcg gccgaacgac ctccgcctcg cccgacccaa tggctcggcc 24600tcggcctcgg caacagaaga cagactcaac ctcggcttcg gaggagcccc cacgtcgccc 24660gacctagggc gcaggcccgc cacgtcaaca aggagcgcca tcatcatcct accccgagcc 24720gactcgggtc acggagaaca agaccggcgt cccatctggc cagctccgcc agatggacaa 24780tgatggcgcc ccacaagctc tgtgacgacg gcggctctca gctctcttac ggaagcaggg 24840cgacgtcagc aaggactcga ccgctccaac agctgtccct ccgccaggct ccgtcgctcc 24900tccgacagcc acgacatcac gccagcaagg tgccaagacc tctccggctg ccacattggc 24960atgtacctag ggcgctagct ctctctccgc tagacacgta gcactctgct acacccccca 25020ttgtacacct ggatcctctc cttacgacta taaaaggaag gaccagggcc ttcttagagg 25080aggttggccg cgcggggacg aggacgagac atgcgctctc ttggggccgc tcgcttccct 25140cacccgcgtg gacgcttgta acccccctac tgcaagcgca cccgacctgg gcgcgggacg 25200aacacgaagg ctgcgggatc tccacctctc tcacgcccgt ctccggccac ctcgcctctc 25260cccccttcgc gctcgcccac acgctcgacc catctgggct ggggcacgca gcacactcac 25320tcgtcggctc ggggaccccc cggtctcgaa acgccgacag aaaataaggc catattttcg 25380gcggctaggg tctagccgcc gaaagtagct tattttcggc ggccacaagt cagtcgccga 25440aaattacctg ttcttttcgg tgggcctctg acggccgccg aaaataacaa gtgccgaaaa 25500tagtatttaa aaatacaaaa aataacagaa aattcataca ataacagaaa attcatactt 25560gagtccacaa cataaaactt aagtccatac aaacataaag tccacaaata gtccatacaa 25620acataaagtc cacaaatagt ccattacaaa gcacaatgcc gcacaaagct aactccatca 25680catatcgggg tcgttggagt tgtgtccact accttcagaa gcgaaaaact cgttgacgaa 25740gtcgtgtaac gggtttagat tctaaagaaa aaagaagaca ttaataacga tattagttac

25800atgtatgacc actattcaaa caaattgttt ctcaaactaa cctctcatgg agtagctccc 25860tcccctgcat atgctcctcc tggtgctggt atgagcggtg gtggcgtgtt gtggcccatg 25920accccggatc cctacaaaat caagtttagt aaagatttga aattagattg atacaaacga 25980caagtcttaa ctaaattgaa gcacctgagg tggaggtggc ggagcatgta atccccactg 26040aggcatcgac ggctgaaact gagggaaaac aaatggttgt tgttgtgcct gctgtggaaa 26100ccaagaccgt tgcaaatata atatgttagt tatagaacca atatcgagcg tgttgagaag 26160aaataagaca ctcacgttca ttgcttgttg ggcctgtgcg ttgtaagcag ccatgtactc 26220tgattgctct ttgaggaatg ccatttgttg ttgccgcagc tcttcacgaa actttttttg 26280ctactccctc atagcctcct ccatgctaga tacagagcgg caactacgcc tgctactaca 26340acaacccgcc tgcgcgcggg cggtcggcgg cgcgcaggcg tgggcggcgg acagcgcgcg 26400ggcgtgggtg gctgatttgg gagaggagag agagagagga aaaacaaaga agaagaaggg 26460cgtcggtttt aaaaagacta ttttcggcgg ccccctggca cagccgccga aaatagcgtt 26520actttcggtg gccctctgac acagccgccg aaagtagcct tatttccggc ggctgtgtga 26580gaggccaccg aaaatagcct tatttccggc ggttgtggca ggccgccaaa aatagcagat 26640aattttcggc ggctataggt gggccatcga aaattacatt ggccgccgaa aatgttcaac 26700agtgttgttg tgatagcaac caacaggtat gagccacaat actacacatt gcaacttggg 26760aaagtaattt actggtcacc atatttccga atagctggtt atgatatgat atttacaaat 26820cttccaattc attccttcag cttaaatgaa tctcattaat tcatctagga aacatctggg 26880ctgaaacgtc agaacaacag tgttttctac tgttaacatg atccgtttat cttgtaaaaa 26940acaaggtttt gtaaatggat ttatttttat gctcaaactt aaattgaaca attcaatcac 27000gcacaattgc tatgctgaca gaagtttatg acaagtttga gcataatgtt gtaataataa 27060tgagaccctt catgatcttg ttgttattcc acatttccat ctctcctcga agcatagcag 27120tgcccaccat tttctaccga gtcagcaaca ataatctagg ctgaaagaac aatggacaac 27180agcttcgtgt gttgtccatc tagtagtcct ttgaataaca gtataatatg cttatgagaa 27240tcaatattat tttcatggca cacttgtttt tttcatgaat agtttcattt ttgtagataa 27300ttttcagttc tctgtcacag gtacaatatt tgcctatggt gttacaagga gtggaaagat 27360acatacgatg catgtgggaa aacttattac aatatttttc ctttaataag ttttaccttt 27420gtagagtgta tgtttctagt cataggcttt gaagtatgcc tcatgctacc aattaacatg 27480caaaaacttg gactaatctt actgatacta agatctaaca tagttgtcaa cctccttggt 27540tggacatttt agttgctttt gttgtattaa gcttttaatt ctctacaggc tgaggatgat 27600gatggcactg atcttttcgg gacgaaaccg aagaggacaa gaaggctgct gatgagcatg 27660tccctaccaa ggtctcttat agaaagtctc tttatcgaag aggacaagaa gtgctaacct 27720acattatttc agttaggggc atgcctttga gaagtctctt tacaatgcaa cgggcaaaat 27780gcccccgaag caaccctagg gatgatgccg gatccaagtg agacagggca tatagtggga 27840ggggaagcaa tgggggcata cctgacgacg ttagagagaa agagggcgag gactttggcg 27900acgaagccgg gtagcaggtt gacaatatta atgtacttga cgcagagact cgagacgggt 27960gcgacgtcgt agctgtgcag tgcctcaacg atctccaccg gcttcatcag cgggaaggag 28020agctcgccct cccctccgtc gcaggcacca caggtaaact gctgcattga cgacttcctg 28080gcgatggctt cctctgtcac tcaaagccgc ggccgccgcg cgctcggcgc atatccttgg 28140ccgggctggt gtgaggaggt ctaggatggt ggccgggttc cgtcgtacga tctcattccc 28200aacgcctagg tcctcgacgc cgccaacggg aggcgcgggg cccagcgctg ccaacaagta 28260tggggcctac cgcgcgtggt tgatgagcct gccatgccgg ttccacctgc gggagctggt 28320aggccgcctt gcgtcgaaag cctccgtgga ggccatgacc gagggtgcgg catggcgggg 28380ccgcgtggtc ttgtcactct ccgagctgct gcaccagccg ctgcgccggc tcggcccgtc 28440cctgtagggt cgcgtcgtcg ggcggggggg gattggattt gtggtggggt gcgtgggcgg 28500gcatcacgcg tggcgatggc actggaagca cggggaacag ggcaggtgta gggtgggggc 28560aggcgatgga atggcgcggc atgcttgcgg ccgattgtcc ttgcgtggat ggaggggatt 28620gcgggctcga ggatgaggat ggcgggatgc gcgcgccttt cgtcgatcga acgtgggcac 28680gggacgagga ttgcattgcg cggccacgcg ggggcgagat tggcgtcgtc ggtgggatgt 28740aggcttcgat gactgtcagc ggggtgggac gtgaatcacg ggggcgaaac aattgctatt 28800ttagcccttc taacgtgggc tctctgctat tatgtgaccc tctgtctatg acttgtgtga 28860ccatttgtgt ctatgatttg tgggactggt ggtaaaatag agaagttcac aactgagagt 28920gacaaaatag caaattctcc cacgggggcg ggggcacgac gcaccagtgt ggacgtccac 28980actatagcct tatagagtag tggagattat tttttttaat taaactatac ttaatatttc 29040tacttaacat aatatttgat gtaacatgga cgactaaact tttccctcaa gccggtatta 29100caaggacacc gggacacgtg ctgtgcggtg acaaaactgt cggggaccat aattaggggt 29160accctcaaga cgcctaattc tcagctggta acccccatca gcataaagct gcaaaggcct 29220gatgggcacg attaagtcag ggatcagtcc acacgagtga ctcgatcgcg cttcacccga 29280gcctagcctc ggccgaaggc agccgacctc gagagacttc cgtctcgccc gaggcccccc 29340tttttatggc ggacacatca ccggcttgcc caaggccttg gcttcgctca gaagcaacct 29400tgactaaatc accacaccga ctgaccaaat tgcaggggca tttaacgcaa aggtggcctg 29460acacctctat cctgacacgc gcccccggca gagccgaggt gaccgccgtc actccaccgc 29520tccactggcc agtctgacag aaggacagcg ccgcctgcgc cactccgact gcagtgccac 29580tcgacagagt gagtctgaca ggcaactagg ccttgccgaa ggcgccacgg cgaactccgc 29640tccgcccgac cccagggctc ggactcgggc taagacccgg aagacggcga actccgctcc 29700gcccgacccc agggctcgga ctcgggctaa gacccggaag acggcgaact ccgctccgcc 29760cgaccccagg gctcggactc gggctaagac ccggaagacg gcgaactccg ctccgcccga 29820ccccagggct cggactcggg ctaagacccg gaagacggcg aactccgctc cgcccgaccc 29880cagggctcgg actcgggcta agacccggaa gacggcgaac tccgctccgc ccgaccccag 29940ggctcagact caggctaaga cccggaagac gacgaaactc cgcctcgccc gaccccaggg 30000ctcggactcc gccctggcct cggccggacg acttctgcct cgcccgaccc cctggctcgg 30060gctcggccac ggcaactgaa ggcaagactc aacctcggct tcggaggaaa ccccacgtcg 30120ccctgcctag agcacagacc gccacgtcaa taggaaacgt catcatcacc ctaccccgaa 30180tcgactcggg tcacggagaa caagaccggc gtctcgtccg gccagctccg ctagaggggc 30240aatgatggcg ctccacgagc tctatgacga cggcggcccc cagctctctt acggcagcag 30300gacaacgtca gcagggactc gaccgctcca acagctgtcc ctccatcagg ctccgccgca 30360ccaccgatag ccacgacatc acgccagcag gatgcccaga tctctccggc tgccacatcg 30420tcatgtacct agggcactag ctctccctcc gctagacacg tagcactctg ctacatcccc 30480attgtacacc tgggtcctct ccttacgact ataaaaggaa ggaccagggc cttctcagag 30540aaggttggcc gcgcgggacc gaggacggga caggcgctct cttggggccg ctcgcttccc 30600tcacccgcgt ggacgcttgt aaccccccta ctgcaagcgc acctgacctg ggcgcgggac 30660gaacacgaag gccgcgggac ttccacctct ctcacgctcg gctccggccg cctcgcctct 30720cccccctccg cgctcgccca cgcgctcgac ccatctgggc tggggcacgc agcacactca 30780ctcgtcggct tagggacccc cctgtctcga aacgccgaca gttggcgcgc caggtagggg 30840cacgctgcgt gctgacgaat agctccccgt caagctccag atgggcagtc tccagcaacc 30900tctccggccc gggacggtgc ttcgtttcgg ggctctcgag ttcatgtcct tcgacggcag 30960ctacgacatg atacttcttc caccgccgtg cgaccacgac aatggcggcc gacaacccgc 31020ccgccggcgg cggaatcgac gacgtctacc ccgcgtggtg gaaaagcaac attcgggctc 31080gctccgttct ctcccccgcc aacggaggag gaggcggggc cgtcaaggcc agacgggaga 31140ccgcgcttcg ccggccgtcg agcgaatcga cgcccccgac gccccgacgg aaggcacgcc 31200ggacaccgac ctcgcgttca agacggaggc aagcgccgtc cccccgcggc acgacgaccc 31260cgagcaagaa gacgacgccg gcgcgctcgc ggaaagcctg caggacgtcg ccctcgaacc 31320agagatgacg gcgcaaccag tccccgatgt gactacgtcg ctcctcgtcg accaaaaggt 31380aacgactaac tcccatcttg cgtcatttcg actcggcctc aacccgccaa acgacctcgt 31440tttggcgggc gccctcattg aggcgagtgc aaccccactg aggttctgta tgcgatcgcc 31500ttgggaccga ctgacggacg tctcgaccta cgggccctct gggtccgagg aagatgacga 31560ccccagcatc ggttgggatt tctccggact tggcaacccc agtgtcgtgc cggacttcat 31620ggccgcatgt gactactgtc tgtccgactg ttccgatgca agccgcagcc ttggcgacga 31680gagctgcggc ccaagccgcg aatgtttcca catcgagcta gggaatccca ccgaaggcaa 31740ccatcttggc atgccggagg atggtgatct ccctaggccg gtgcctcgcg ccgacatccc 31800acgggagcta gctgtggtcc ccgctccggc ggggggttac gacccacaac tcgagcaagt 31860ccgcgaggcg caggccaggc tcaacgaggg aacgggagcg cttgagccga tccgtcggga 31920cgtcggacag gcatgggtgg gccaacccct ggccggagaa atacgtcatc tgccccaagg 31980tctccagcac cgcgtcgcca acgacatcag gatcaggccg ccgcccgcat ccagcggggt 32040cggtcagaac ctggcaaccg cagcaatgct catccgcgcg atgccggagc cgtcaaccac 32100cgagggtcgg cggatccagg gagaactcaa gaatctcctg gaaggcgccg cggcccggcg 32160ggccgagagc actgcatccc gaaggcaagg atatccctcg gaacctcatg ccgcgacttc 32220ccgattcatg cgggaagcct cggtctacac cgggcgcacg cgcaacaccg cgcctgcggc 32280cccgggccac ctcggcaacg agcaccatcg acacgaccgt cgggctcacc tcgacgaaag 32340ggtgcgccga ggctatcacc ccaggcgtgg gggacgttac gacagcgggg aggatcggag 32400tccttcgccc gaaccacccg gtccgcaggc tttcagtcgg gccatccgac gggcgccatt 32460cccgacccgg ttccgacccc cgactactat cgtaaagtac tcgggggaaa cgagaccgga 32520gctgtggctc gcggactacc gccttgcctg ccaactgggt ggaacggacg acgacaacct 32580catcatccgc aacctccccc tgttcctctc cgacactgct cgtgcctggt tggagcacct 32640gcctccgggg cagatttcca actgggacga cttggtccaa gccttcgctg gcaatttcca 32700gggcacatac gtgcgccccg ggaattcctg ggaccttcga agctgccggc aacagccggg 32760ggagtcgctc cgggactaca tccagcgatt ctcgaagcag cacaccgagc tgcccaacat 32820caccgactcg gatgtcatcg gcgcgttcct cgccggcacc acttgccgcg acctggtgag 32880caagctgggt cgcaaaaccc ccaccagggc cagcgagctg atggacatcg ccaccaagtt 32940cgcctccggc caggaggcgg tcgaggctat cttccgaaag gacaagcagc cccagggccg 33000cccgtcggaa gaagctcccg agacgtctgc tccgcgcggc gccaagaaga aaggcaagaa 33060gaagtcgcaa tcgaaacgcg acgccgccga cgcggacctt gtcgccgccg ccgagtataa 33120gaaccctcgg aagcccccca gaggtgcaaa cctcttcgac aagatgctca aggagccgtg 33180cccctaccat cagaggcccg tcaagcacac cctcgaggag tgcgttatgc ttcggcgtca 33240tttccacagg gccgggccac ccgccgaggg tggcagggcc cacgacgaca acaagaacga 33300agaataccca gcaggggggt tccccgaggt ccgcgactgc ttcatgatct acggagggca 33360tgcggcgaat gcctcggctc ggcaccgcaa gcaagagcgc cgggaggtct gctcgttgaa 33420ggtggcggcg ccagtctacc tagactggtc cgacaagccc atcactttcg accgagccga 33480ccaccccgac catgtgccga gcccggggaa atacccgctc gtcgtcgacc ccgttgtcgg 33540cgatgtcagg ctcaccaagg tcctgatgga cgggggcagc tgcctcaaca tcatctacgc 33600cgagaccctc aagctcctgc gcgtcgatcc gtccaccgtc cgagcaggcg ctgcgccctt 33660ccacgggatc atccctggga agcgcgtcca gcccctcggg cgactcgacc tcccagtctg 33720cttcgggaca ccctccaact tccgaaggaa gaccctgacg ttcgaagtgg tcgggttccg 33780aggaacctac cacgccgtgt tagggaggcc atgctacgcg aagttcatgg ccgtccccaa 33840ctacacctac ctgaagctca agatgccggg ccccaacggg gtcatcaccg tcggccccac 33900gtacaaacac gcgttcgaat gcgacgtgga gtgcgtggag tacgccgagg ccctcgccga 33960gtccgaggcc ctcatcgccg acctggagaa cctctccaag gaggtcccag acgtgaagcg 34020ccatgccggc aacttcgagc cagcggagac ggtcaaggcc gtccccctcg accccagcgg 34080cgacaccacc aagcagatcc ggatcggttc cgggctcgac cccaaatagg aagcagtgct 34140cgtcgacttt ctccgcgcaa acgccgacgt ctttgcgtgg agtccctcgg acatgcccgg 34200cataccgagg gatgtcgccg agcactcgct ggatattcgg gccggagccc gacccgtcag 34260acagcctctg cgccgattcg acgaggagaa gcgcagagcg attggcgaag agatccacaa 34320gctaatggcg gcagggttca tcaaagaggt attccatccc aaatggcttg ccaaccctgt 34380gcttgtgagg aagaaagggg ggaaatggcg gatgtgtgta gactacactg gtctcaacaa 34440agcatgtccg aaggttccct accctctgcc tcgcatcgac caaatcgtgg attccactgc 34500tgggtgcgaa accctgtcct tcctcgatgc ctactcgggg tatcaccaga tccggatgaa 34560agagtccgac cagctcgcga cctctttcat cacgccgttc ggcatgtact gctacgtcac 34620catgccgttc ggcctgagga atgcaggcgc gacgtaccag cggtgcatga accatgtgtt 34680cggcgaacac atcggtcgca cagtcgaggc ctacgtcgat gacatcgtag tcaagacacg 34740gaaggctccc aacctcctct ccgaccttga agtgacattc cggtgtctca aggcgaaagg 34800agtcaagctt aatcctgaga agtgtgtctt cggggtgccc cgaggcatgc tcctagggtt 34860catcgtctct gagcgaggca tcgaggccaa cccggagaag atcgcggcca tcaccagcat 34920ggggcccatc aaggacttaa aaggggtaca gagggtcatg ggatgcctcg cggccctgag 34980ccgcttcatc tcacgcctcg gcgaaagagg tctgcccctg taccgccttt taaggaaagc 35040cgagtgtttc gtttggaccc ctgaggccga ggaagccctc ggcaacctaa aggcgctcct 35100tacaaaggcg ccagtcttgg tgccgccggc ggacggagaa accctcttgg tctacgtcgc 35160cgcgaccact caggtggtta gcgccgcgat tgtggtcgaa aggcaggagg aagggcatac 35220attgcccgtt cagaggccgg tttacttcat cagcgaagtg ctgtccgaga ctaagatccg 35280ctacccacaa gttcaaaagc tgctgtatgc tgtgatcctg acgaggcgga agctacgaca 35340ctacttcgag tcccatccgg tgactgtggt gtcatccttc cccctggggg agatcatcca 35400gtgccgagag gcctcgggca ggatcgcaaa gtgggcagtg gagatcatgg gcgaaacgat 35460ctcgttcgcc cctcggaagg ccatcaagtc ccaagtgttg gcggatttcg tggctgaatg 35520ggtcgacacc caactaccaa cgactccgat ccaaccggag ctctggacca tgtttttcga 35580cgggtcgctg atgaagacgg gggccggtgc gggcctgctc ttcatctcgc ccctcggaaa 35640gcacttgcgc tacgtgctgc gcctccactt cccggcgtcc aacaatgtgg ccgagtacga 35700agctctggtc aacggattgc ggatcgccat cgagctaggg gtcagacgcc tcgacgcccg 35760tggtgattcg cagctcgtca tcgaccaagt catgaagaac tcccactgcc gcgacccgaa 35820gatggaggcc tactgcgacg aggttcggcg cctggaagac aagttcttcg ggctcgagct 35880caaccatatc gctcggcgct acaacgaaac cgcagacgag ctggcgaaga tagcctcggg 35940gcgaacgaca gtccccccgg acgtcttctc ccgggatctg catcaaccct ccgtcaagct 36000cgacgacgcg cccgagcccg aggtatcctc ggctcagccc gaggtaccct cggctcagcc 36060cgaggtaccc tcggttcagc ccgaggcacc ctcggcccag cccgaggtac tctcggcccc 36120cgagggcagg gcattgaacg tcgaggaagg gcagagcggg gccacgccag accaggattg 36180gcaggccccg tacctgcaat atctccgtcg aggagagcta cccctcgacc aagtcgaggc 36240tcggcgggta gcgcgacgcg ccaagtcatt cgtcttgctg ggcgacgaag aggagctcta 36300ccatcgcagc ccctcgggca tcctccagcg atgcatctcc atcgccgaag gtcgggaact 36360gctgcaagaa gtacactcgg gggcttgcgg ccaccacgca gcaccccgag cccttgttgg 36420aaatgctttc cggcaaggct tctactggcc aacggcggtg gctgacgcca ctagaattgt 36480ccgcacctgc gaagggtgcc aattctatgc gaagcggaca cacctgcccg ctcaggctct 36540gcagacaata cccatcacct ggcccttcgc tgtatggggt ctggacctcg tcggtccctt 36600gcaaaaggcg cccgggggct acacgcacct gctggtcgcc atcgacaaat tctccaagtg 36660gatcgaggtc cgacctctga acagcatcag gtccgagcag gcggtggcat tcttcaccaa 36720catcatccat cgcttcgggg tcccgaactc catcatcacc gacaacggca cccagttcac 36780cggcaaaaaa ttcttggatt tttgcgagga tcatcatatc cgggtggact gggccgccgt 36840ggctcatccc atgtcgaatg ggcaagtaga gcgtgccaac ggcatgattc tacaagggct 36900caagcctcgg atctacaacg acctcaacaa gttcggcagg cgatggatga aggaactccc 36960ctcggtggtc tggagcctaa ggacgacgcc gagtcgtgcc acgggcttca cgccgttttt 37020cctggtctat ggggctgaag ctatcctgcc cactgacctg gaatacggct ccccaagggc 37080gagggcctac accgagcaaa gcaaccaagc cagccgagag gaatcgctgg accagttgga 37140ggaagctcgg gacagggcct tactacactc ggcgcggtac caacagtccc tgcgacgtta 37200ccacgcccga ggggtccggt cccgagaact ccaggtgggc gacctggtgc ttcggctgcg 37260acaagacgcc cgagggaggc acaagctcac gcccccctgg aaagggccgt tcgtcatcgc 37320caaagttctg aagcccggaa catacaagct ggccaacaat caaggcgaga tctacggcaa 37380cgcttggaac atcaaacagc tacgtcgctt ctacccttaa gatgttttca agttgttcac 37440atacctcgca cctacgcaaa gtttagttgt caaggaaggg tcggcctagc ctcggcaaag 37500cccgaccctc cctcgggggc taaaaggggg gagaccccct ctgcgtcgaa ttttttcctc 37560gaaaaaggac ctctttttag caggatttct tccgtgcttc ttgactactt tggaaagcgg 37620atcctggaaa cgacgaggta cacgtaagca gccaaggctg accaagccga gggactccta 37680cgcctccggg atacggatac ctcactcgtc cccttctgcg ataagtaact tgcgctcgga 37740taaagcgact ccgtggaccg aacgagtcat cacgttcgga agctctcctg ccgaagcagt 37800ccttcaagct ttctcgacta aatcggggac agggcctcat ggacgggtga aagtacgcgt 37860aagcggcaag gccgaccgag ccgagggatt cccacgcctc tgggatacgg atacctcact 37920cgtcccttcc gcgaaaagca actctcgctc acacaaacat ccctattacc gacagagtcc 37980agatgctcga aacaagagga aaaaaggacg cagcttcgca agcgcggcga gggcgtgttc 38040ttctggcctc ggcggccgca gaaagcgcac gctacaagat gatctgatcc tgcaggctcg 38100ggtcttcacg ccgaagggag ccgtagcacc ctcggcatcg acgacgtcta cagcaaagcc 38160cgacccagcc tcgggcggcg ccgaggtcca ggggctcctc caggaatccg gcccgagcag 38220gcggctcaac cggttacccc tggggcctcg ggcaaccggc ttccaagggc gctagcccga 38280tccaaggcct cgactgaccg acttgggcgt cggcaccgct gacgggcgac acggctaggc 38340tccggccaac caggttcccc attctcgagc caactccgcc tctgttcaca ctgatatcgc 38400tacccccggc ctcgatccac caaagggcgg ccgaggggtc ccttcaacta agctagaaga 38460gcctcacgta acaaggccga acgggccgag ggattcctac gcctccggga tacggatacc 38520tcacccgtca ccttgacacg gggcaactca tgcttggtaa agcggtttag ataataaaac 38580aggcgagact tagtgctcgg aaatgaggaa aaaacacggc tccgtgccaa aattacatac 38640atgttcaggc ctcgacagcc acaatgaacg aactcactgg cattcgaagt gccattacaa 38700acggaactcc ggttccccct ccgcaggtac gaacaacccc actccgaggg ggaaggcctg 38760cggagcaacg gaagaccgac gaacggcgcg ccgtcacctg ctccagcagt ggcgacgacg 38820gcgacttctg ctccgggggg ccgaacagcg gcaacgctga cctcagggtg gatgccgctg 38880tcaggaggcc cccgcccgtg ccaaaactcg tgaggcaagg acgggcagaa ggccgtagaa 38940gatggaggtc agcccgtggc cggtcccggc cgccgcgccg gcggaagaac ctcttccggc 39000tgccgtggca gacgccgacg ccgcaagggg ccccgaagcc actcgcggct gaagaacagg 39060cacgctgcag ctgccggacg ccacgggcaa tgcccgcttc tccccccatc actgagtgaa 39120ggagcgggcc accgcccacg caggggctga ccccaactcg gcactctccc ctccccagcc 39180ttggtgatga aaatccttga ggctgaggaa ggggcagagg ccacagcccg gctcgctttc 39240ccccaccatc aagctggagg tcgccatctc gggtgaccgc cggtgaaggg gtgcgaccgg 39300gctgcgtggt gaaaatcctt gaagccgaac gatggctgag aggtaccaac tcccatggag 39360ttgcgttcct ccaacgagga ggcggaaagg cggcggatat cccccatccg ggggcttgga 39420agacgggaag acccggcgct taagggagga agaagacatg gtcgccttac gaaaggagcc 39480tccctccttt taaaggcaac tcccctacgt gcgcccccag gcgccgcggg ccgagtcttc 39540tccaacacgc tccaaggccc tcccctgcga ctcgggggct gggtcccgca tgtcatgcaa 39600gccggctcag ggcagaagaa gccaaaccgc cgcgcatggt gcgcacgacc gtccagcggt 39660tacaggcgac cccccatttc cgcccagacc aacaggcaga aggggcgagc agccatgcag 39720gcggcatgca accgcgccag atggacgcgc ttctccaact tctgacacgc cagcctgggg 39780cccaggccca cgcgtcgagc aactggcacg ccagttgctg catgcaagca accgcaccgc 39840cacttgtgcc accgtcgcgc ctcttcggtt gcgaagccta tgccacgact cgaggcgacc 39900caacagcgcc agactggcgc gtcggtcaaa gcgaccgaaa gtgggccggc agtaatagcg 39960gtggcaggcg ggcgggcgca gcggtcacgt cgtcagccag gctcacgtcc catcctgaga 40020cagcaagaga gcctcctctc acggcgtgaa gacggtgcac ccgtgacccg ttcctcgaac 40080ggatcacccg cgcgcaacgg ccgccccgcc aaccactcgc cccgtcgcat taactccgcg 40140gcgggacacg cggcgcttct ggcaggagga gcgcgcgacg cttcacctcc gccttaataa 40200ccgcgtcaga aaaggtacgc cacgtcgtct gatttcgtat ccttttccgt tttcctcttt 40260ctctatctct tgcatcaggg accggggaag ggggataccc cgagagggat ccttctccgc 40320gaaggaaccg ggctccgcgc cccccattac tgatcagggg ttcgaaggct ggccccccga 40380gggttcaaca gccgcctcag atcgcgtggg cccgacaccc actactggtc aggggttcga 40440aggccggccc tccgaagggc tccacggccg cctcaggcta ctcgggctcc gcgcccatta 40500ctgatcaggg gttcgaaggc tggcccccga agggttcaca gtcgcctcag acaccgagcg 40560agggatgacc aggggtacgt tcgatacata accgaggctc gggctgcgct cccgaggtac 40620cctaggacat atccgagacc agcgggaacg atcttgtaac ggaatcccat cggagggagg 40680catcgagccc tcggaccccg tcgccagggg accgggtccg gcaagtcacc cgcatgtact 40740tttgggcgtg cctctgggcc cctagccgac ccccaacgaa cggggcacgg acgtccactc 40800ggattacccg cttgcagctc accggagaca ccatgttcgg tgcccatcga gggtaacatg

40860gcgcactccc ccctcctcct tgcggaaagg cgacgtaggg gcgtatgtaa aaagccgagt 40920ctgtccctga tcgtcctctc gccctgtgca gaggctcggg ggctgctctc gcaaaaaccg 40980gctccggcca aatcgttgac agcgtcaaca taccagcccg agagcttggg ccccgaccgt 41040gcacccgggc tacggccagt tcgcatgagg gaacgaccag accagccgaa gcgctaagcg 41100aagtattaag acctcgaagg agtgtaacca ctcctccgag gcctcggggg ctacacccgg 41160cgggtgcgct cgcgcgcacc caccggaacg aaatgcaacc gagaaaggct ggtccccttg 41220caaaaaagtg cgacaaaagc ctccaagcga gtgctaacac tcccttcgag gctcgggggc 41280tactgtcggg gaccataatt aggggtaccc tcaagacgcc taattctcag ctggtaaccc 41340ccatcagcat aaagctgcaa aggcctgatg ggcacgatta agtcagggat cagtccacac 41400gagtgactcg atcgcgcttc acccgagcct agcctcggcc gaaggcagcc gacctcgaga 41460gacttccgtc tcgcctgagg cccccctttt tatggcggac acatcaccgg cttgcccaag 41520gccttggctt cgctcagaag caaccttgac taaatcacca caccgactga ccaaattgca 41580ggggcattta acgcaaaggt ggcctgacac ctctatcctg acacgcgccc ccggcagagc 41640cgaggtgacc gccgtcactc caccgctcca ctggccagtc tgacagaagg acagcgccgc 41700ctgcgccact ccgactgcag tgccactcga cagagtgagt ctgacaggca actaggcctt 41760gccgaaggcg ccacggcgaa ctccgctccg cccgacccca gggctcggac tcgggctaag 41820acccggaaga cggcgaactc cgctccgccc gaccccaggg ctcggactcg ggctaagacc 41880cggaagacgg cgaactccgc tccgcccgac cccagggctc ggactcgggc taagacccgg 41940aagacggcga actccgctcc gcccgacccc agggctcgga ctcgggctaa gacccggaag 42000acggcgaact ccgctccgcc cgaccccagg gctcggactc gggctaagac ccggaagacg 42060gcgaactccg ctccgcccga ccccagggct cagactcagg ctaagacccg gaagacgacg 42120aaactccgcc tcgcccgacc ccagggctcg gactccgccc tggcctcggc cggacgactt 42180ccgcctcgcc cgaccccctg gctcgggctc ggccacagca actgaaggca agactcaacc 42240tcggcttcgg aggaaacccc acgtcgccct gcctagagca cagaccgcca cgtcaacagg 42300aaacgtcatc atcaccctac cccgaatcga ctcgggtcac ggagaacaag accggcgtct 42360cgtccggcca gctccgccag aggggcaatg atggcgctcc acgagctcta tgacgacggc 42420ggcccccagc tctcttacgg cagcaggaca acgtcagcag ggactcgacc gctccaacag 42480ctgtccctcc atcaggctcc gccgcaccac cgatagccac gacatcacgc cagcaggatg 42540cccagatctc tccggctgcc acatcggcat gtacctaggg cactagctct ccctccgcta 42600gacacgtagc actctgctac atccccattg tacacctggg tcctctcctt acgactataa 42660aaggaaggac cagggtcttc tcagagaagg ttggccgcgc gggaccgagg acgggacagg 42720cgctctcttg gggccgctcg cttccctcac ccgcgtggac gcttgtaacc cccctactgc 42780aagcgcacct gacctgggcg cgggacgaac acgaaggccg cgggacttcc acctctctca 42840cgctcggctc cggccgcctc gcctctcccc cctccgcgct cgcccacgcg ctcgacccat 42900ctgggctggg gcacgcagca cactcactcg tcggcttagg gaccccctgt ctcgaaacgc 42960cgacaaaaac cctcaccaca ttttcctcaa ccacatgatg gagattgggg ctactagata 43020ctatgcctgg tggtagactg gtagctgatg tctttggacc agtagttggt gctagatttg 43080tgaactctac caaggtgaga aacggagatg gaggctgccc tgctgagcgg gttcatcaaa 43140accatcctgc caaggctctt ctcactggta caagggagat acaagctgca caagggcctc 43200aagagcgaca tcaaatcgct ggagaaagag ctccatatga tcgctgttac aatcgatgaa 43260caaatctcgc tggggaggaa ggatcaggga gctgtgctga gcctctcaat tgatgagctg 43320catgaactgg ctcaccaaat cgaggactcc atagatcgct tcttgtacca tgtgaccagg 43380gagcagcaag catccttttt tcgtcggact gtacggtcgc cgaagactct gttgtcacgt 43440cagcggctgg ctgccgaggt tcagttcctg aagaagatac cggaggaggc gcaccagcga 43500gagaagaggt acagggtctt cgccggcctt tcttcctcta cccggcacac tgaatcgtct 43560tcctgttcgt ctgtatctga tccgcacaca cttaaggccg acgtcgtcgg catcgacggt 43620cccagggacg agcttgtgca gcagttaacc gaagaggcag agggcctaac aaagcagctc 43680aaggtgatct ccatcgtcgg gatccatggc tccggcaaga ccgtccttgc cagagaggta 43740tacgagagcg acgtcggccg gcagttcagt ctccgggcat gggtttctgc tactgacaga 43800ggtccgagag aggtgctcat ggagatcctc cgaaattttg gtaggccagt ggtggatagc 43860tctagtattg accagcttac ggtagatctc aggaaacact tgggtgagaa aaggtgaaaa 43920aaacctcttc tttatgttat ttattattta tgaagtttct tcaactacgg gttttcatgt 43980tcaaattgcc tctctgaact tcgaaaacgt ttaataccaa ttgaattgag gatcttagct 44040ttggaaaagc ggtagtgttt tgacgttttg catacatttc tcaccgttat tttattcatt 44100tataatttag agtttaagca gtatattcat tttgaaattt atgagatttc tgtctgcacg 44160cttacttcca tgcccaaaac atgtccgatt gagaacagaa ggtaattttg tttgatcttt 44220gagatcagac acactgattg agtagtaaca ggaaacaagt gctcaccaat caccaagtca 44280cttacaaaga atttcatgct tacaaaacac actgattgtt aaggatagag actatgtttg 44340atctgcatag tttgaatttt gattatgtca tcgtcgattg ttatcattaa cttttgttgg 44400aaatttctct tgtagctatt tcattgtaat cgatggcatg caaacagatc agtggagcac 44460cattgaaact gccttcccag aaaacaatgt tgttagcagc agagtaattg ttacaacaac 44520aatccggtca gtagctaatt cttgcagctc ttctaacggt tatgtgcaca aaatgaaaag 44580acttagtgac gaacactcag agcaattgtt tatcaagaaa gcttgcccaa caaaatattc 44640aggttatact cgaccggaat caaaagaagt tctgaagaaa tgtgatggtc aaccacttgc 44700tcttgttact atgggccaat tcttgaggaa aaatggttgg cccacaggac ccaactgcga 44760aaatgtgtgt agagatctta gacgacatct ggagcaggat gatacattgg agagaatgcg 44820aagggtgctt atccacagct tatctagtct tcctagccat gttcccaaag cctgcctttt 44880gtattttggt atgtttccat gtgatcatcc cataaagagg aagagcctga tgaggcgatg 44940gttagcagag ggatttgtac aaacacagcc ttcatctagt gaaaacttca acaccctcat 45000agaccggaat attattgagc ccatcggcat atgtaacgat gatcaggtaa agacatgcaa 45060aacatatggc atgatgcacg agttcatttt gttaatgtcc acctcccatg acttcattac 45120cctgctttgt aataataaag ttgaacacaa atatgtgcgt cggctttctc tccatcatca 45180tagtgctaca agtggcagtt tttcggtcat cgacttatct cttgttagat ctctgatggt 45240ttttggggag gctggcaaaa ctattttgag tttccgaaag tacgagctat tgagagtctt 45300ggatcttgaa caatgtaccg acttggaaga tgatcacctc aaagacatat gcaacctttt 45360tcttatgaaa tatctaagcc tcggagaaac tattagaagt cttccaaagg agatagaaaa 45420actgaagctc ttggagacac ttgacttgag gagaacaaag gtgaaaacac tacctataga 45480ggtcctcctg ctcccctgtt tactccatct gtttgggaag ttccaatttt ctgataaaat 45540caagataaca agtgacatgc agaagttttt cttaactgga cagagtaact tagagacact 45600ttcaggattt atcacagatg ggtctcaagg attgccacag atgatgaatt acatgaattt 45660aagaaagctt aagatatggt ttgagaggag taagagaagc accaacttca ccgatcttgt 45720gaatgctgtc caaaagttca tccatgatga caaagagagc aatgatccac gttctctatc 45780acttcatttc gatgacggca ctgaaaacat cctgaactct ttgaaggctc cttgttacct 45840taggtcattg aagttaaaag ggaatttgct ggaacttccc cagtttgtca tatcaatgcg 45900gggtctccgg gagatatgcc tttcatcaac aaaattgaca tcgggcctcc ttgcaacact 45960cgctaacttg aaaggcttgc agcatctcaa gctgattgca gatgtccttg aagattttat 46020cattgaaggt caggcattcc tggggctgct acacctatgt tttgtcctag aacgtgccac 46080cttaccaata attgaaggag gagctttgcc gtacctcatc tcacttaagc taatctgcaa 46140agatctagtt ggcctcggtg acatcaaaat caaccgcctc aaatgtctta aggaagtcag 46200tctagatcat agagtcgctt cggaaacaag agaaatctgg gaaaaagctg ccgagaagca 46260tccaaaccgg ccgaaagtat tgttggtcaa ctcatctgat gaaagcgaaa ttaaggctgt 46320agactgttct gttgcttcaa gaccagctgt gagtgaggct aatggaactt ctcccatgtc 46380agaggttgat gtacgagagg atgacattca gatgatactt aaccaggggc tctctgccgc 46440tgctgagaaa cagatgaatt gtgcagttca gccaagttca aaagctgaac tgaactctga 46500tttcaataat attagtttcc cagaggttgc gcttggttta accgagctgt gaattgcttg 46560gaattgaaat gtgtcttcat acacctattg atccttgatt gtccatggtc agtttcgttg 46620cacttgcagc atattactat gaggctagta tcatgtaaat tacaaatctt ttgttgttaa 46680ggccataaat tgcatattat agcacaacaa gctggtatgt ctcaacaatg gcattaattt 46740tttttctgct tgaatctaca aatttcatca ttattttgca atttcgcttt tatacagata 46800tggtgatgcc atgtcatttt gactttgcag catatatgca agcaacggtt tgagttgctg 46860gagttgctag aatattgata caacttcagt ttactcgaag gctacaggga tctcataact 46920aggatggttg aagataattt gcgattgttt ccttcagtgt cactgaaaag acttttgtaa 46980caataaagca tacctttgct tcctactttt ttgaagttac ttcagatgct aagttcgcag 47040ttgggcctgg actttatcat gtttatccag ctgtttattt gtttcatgta caataatacc 47100ggtgattgct gttgttatat aatctatatt tatactatag ttaaagtatc agtttcaacg 47160gttgtcccgc gccatctttt tacaaataat ccatcacaaa tatttcaaat taacccgatg 47220cacgcctata gatggccaaa cggcggtccg gcacgggcca gatgccttcg ggccacaact 47280ctggcccagg cacgtcatgc cgggtcagct cattagcccg ttcgattaaa tcagcgtaaa 47340atgttaaaaa acagtgtaag agttggagtt tgaacccatg ccctgattaa agaagggcaa 47400aagacacttg gtgaagctat ctaaccaata gaacatcatg ctcaaatatt ttaatattga 47460atataaattg tatatatgta tatacatttt tttataaaat ttaaaaaatt ataatcgtgt 47520cgggctgtgc cagcactacg gactgaggct acagcccaag cacggcacga cgttcttggc 47580tcttgcaagc attagattgt ttctgagact acattggcgc aatggactcg atggtgtttg 47640aggttgctga attggatgaa gcaacaatga tttgtcacac taacagtaaa atgaaaggtt 47700atttgttatt tttaaacgtt agttattgct acgaagtagc ataatttata tgaagtacat 47760ccagttttta ttgatgcctg actttaacaa tcacttcata ttttgatata tcttttttat 47820aagtttgagt tcagtgactt attttagaaa tttgagctca caaactttct cttatttggt 47880ctctgtatgg tggaattatg tcattttata atttttgttc gttcagccag tcgttgtgaa 47940ctttcttcta actgctcact tcattggccg tattgtacca agacatattg gatgtagtaa 48000accataacat cagatagtta aatcaaaaaa atattatacg gagagcggag acaataaata 48060aaaaatcttg aaattttttg gtggatagtt tatataggta ttgttgtaag ccgtcgcaac 48120gcacgtgtaa ccgactagta ctaagtgaat tccccacttg tgggaattgt gagattgttt 48180ttatatgaac gaatattgta ggtaaatgag taacataata ttccttttgt taacaccttg 48240atctggtacg tcaaaaccac gtatgtacca tatgttttaa cttttgtatc tggtagaatg 48300gactgaagta aagaatctca tccatcgact gctgctaata tatgcagctt cccagatcag 48360aggtcccaaa catgtcacca cttaccaatt aaatctctta tttacttggc cttcccatga 48420aactagcaaa agttgctgtc tccacaaact gcaggtcaat tcgtttcttt agcgccttat 48480ttcagaaacc gtggtagcat tgacatttta ctcatctgga tagtttcggc ttgaatacgt 48540agcgtcttgt acatttattc tctcacagta acagctaact cctgtgcaaa gatgcggctt 48600attccattgg agaatagcgg actttttgtt ttatttagtt tcagctctct ggttgcaact 48660tgcaattagc cactctgccc ttttgcgtta cctacattct atctagcaag gcagccaatg 48720tttctcattg ccaggtcact tgtttttgaa ggctgtgcgg aagaaacatt tctacaaaca 48780aacaattaga actgacatta ccgaagaaac agttaagtca aaagcttgtt ggttggatnn 48840nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnngt tcnttcttgc gttccgttgn 48900ttnnnnnnnn gnnngnnggn aatnnnannn taaannagnn actnaatnnn aagnttatac 48960cnntagttta atttgtttac cctcccagga atattgcacg cctcgatgta ggcctccact 49020cagactttat ttgggtactt tagtattggg gtttttatag tggtgccctc ggttttgctg 49080gtgtgctcat ttttatcctt ggttccgctt tattttgctc agttttgccc ttccagtgct 49140atagaacaga agggcaaaag tgagcaaaaa aaaacacaac taaggataaa aatgagcaca 49200ccagcaaaac cgagggcacc actataaaaa ccccaatact aaagtaccca aataaagtct 49260gagtggaggc ctaaatagag gcttgctaat tattagacct ttataactac attaaataag 49320ataaaatatc cactgaaatt agaaaattga gtgaggtctg tgcccccgct aagccgtcca 49380atgagggttc gtccgtcttc caacctgatt aaataagata aaatatccac taaaattaga 49440aaaattgagt gcggtctgtg cccccgctaa gccgcccaac ccaaccttga tgaatttcct 49500ggttcacaca tatgtggtgt gattgaaggg ttacacgaaa aacctcacaa ccccgatggc 49560ctgtcttcgc tgaagtgtca ttcagtggtg atcaggaaca aatcccatcc caaactcaag 49620cagagaacat tacaagttaa cataactgaa gttgaaccag atggtggtca gaatgagaag 49680gcctgcaaca gtcaatttgt tctgattcct tttgtgcagg ctgctacagg ttgttctcct 49740gacgagaaaa gcagttctaa gccggttgaa ttcgtgcagg atgcatacaa cagaaccatg 49800cagactgaac ctcattgtgg atggcaatat ttttttcaat ctctgatact agtaccaagt 49860cagcatgttt tgtccatccc catggcaatg gcatagagat agaactttct ataaatagtc 49920ttgaggatca ggggacaagt caatcttgtg aaatcctaag taatacggag tacaagtttg 49980tctgaaatat cacatcgagc gattgtgtgt gcgcgcctac tagctcatga aagtcctggt 50040actgaagttt tcatttttct caagtcataa attatgcagg atgttataac tccacagagg 50100gttatggagg ggacaaatag agcaaaatgt ggatggaaac atagaacaca gcaggctgcg 50160gaaaaggaaa cataatctgt tcatccgctg acacaaaagc aagaacctct atttgagtgg 50220aacctacaac ccattgtcac cgttgctcta ttgggtcttc agaagaaatt ttgactagaa 50280tgttctaggc ggatggcgac ggcgattagg catcgtttct ccttcatgaa 50330138507DNAArtificial SequenceMZA3434 Processed consensus sequence 138gtcatgtccc ccctcattag aggcgctact ggacatgtgg aagctgccat gttcggctgc 60aacgacgcca cccaggtgta caaggagctg caggaggcca tcaaatccta cccggacgcc 120ttccaccgcg tcatcggctt cgacaacatc aagcagacgc agtgcgtcag cttcatcgcc 180tacaagcccc cgggcagcga ctagaccgcg cccgccggcc gccccccgcc ggctagctag 240ctagctagct cctgcgtgag ctagtagcta gctagtgcca tgcgtcgtct ctgtcgttcg 300gttttgcttc ggggtcaccg tgtacccttt gcttgcttgg tttcttcttt ccttttttcc 360tttttttttt cttcttttcc ccggccatgg ttcctttgct ttccagcagt tctctgctgg 420atgtaatgta tccattgttg caagcatggc cttgcattgg ctacctctat acctgctaaa 480aaactactgc aaatggtcat agctgtc 507139650DNAArtificial SequenceMZA2591 Processed consensus sequence 139asggtaccaa ctaaaagggc ctggaatcat ggaagcccac aataaccagg agcgagctac 60ctgcgaagcc acatctctcc ttcctcttca tcgatagtac tcatctccat attcaggtaa 120ataacatcgt ctgcatgccg cgcgccccta atagcatctc gatcacattt ttgtgttctt 180gacttctcct cggaagcctt cttgtttaac aaacttatat tagtcgttgg tcgatctttg 240gacccacatg taaatcttgg ttcgcgtccg ccgtgcagtg cagaggcaca agctaagcca 300tgagcaacgg tggtaaccgc agcaggggcg gcgcgaggtt cgagctgcag ctgcacctgt 360cgccgccgcc gcccgtggct aggagggtgt aggtttactg cgtatgctac tgcagcgact 420cgtcttcttc cccgagctcg tgcgtgtcgt ctgactgcat tccagggagc aattcgccga 480ttgtaatcgg cgcctgcacg cggtgcatga tgtactgcat ggtgtccaag aatgacttcc 540ccacctgcat caactgcaag cagccctgcc tcgtgtacct cctccactgc tcttggcccc 600tgctgcagcg gcaccggcaa ggccaattaa aakgacttca acctttcgta 650140731DNAArtificial SequenceMZA11123 Processed consensus sequence 140tcaaatcctg gggggaaacc ttccgggtgg gtcattgcaa aatgggcagt ttatgggctc 60cttaatgatg gggggtcacg gttcgggggt tttttcggcc gggaccatgt ttcggtctct 120tcttaatata ataccgggag gcagtttttc ctcctccccg gccgcgtttt ttagtgtaaa 180tatgcaaatg taccatcttg attggcttct atgatctaca ttttagtgta ggctgcaagt 240ccacgagctt tgaaaagtta cacaatctgg attatttgca agtcgtaaac acttatagga 300ctcagtgact agattggacc agcctgttgc attcatgcaa ttgttaggct aattgtcatt 360tcaccttcag tctacaatga aatggttaac atagtgcatg gatttcttcc attggtacat 420caataataat atccaacagc gctaatgaga tgtacgtctt gtttccagat gttacagatc 480caactgcaaa tggtgcagcg tggcgctgct gggccgccca gtaacgagaa tactgagcac 540acagaagaat gactgaatct gtgaacagac acttctgcat cgtggtgtaa taataaggag 600aatactgatg agcacacacg ctgaagaatc tgtaaatagg cggcgatgag gatgggacaa 660aagaaagcca aggattggcg atacctgggc tggggaaact gtacgggtaa aaacttaata 720agggggttta a 731141704DNAArtificial SequenceMZA15842 Processed consensus sequence 141taaccacccg cctggctaat tgttccgacc atttttatag cctgcatggc ttacattgtc 60ttcacgaggg tcaacaggat attcagattg cgcatttgga cttaaaacca gcaaatatat 120tacttgacag tgacatggtt cctaaacttg ctgattttgg tatgtcaagg ctcttcagtc 180tcgaacaagt ttatatcctt gcttccaagc ctatgggaac aatgtaagct cattaagttt 240actgaatgtg ctttcttgat cttatatggc ttgcaacacc tttgaaactt atttggttta 300aaagacacat ttaattttcc ttcattagta catgtgtcct gaagtataag gaaaccttag 360ttcgttaact caaaagattt ctatttggct aagtttatag agaagagtat tagcatatac 420catattaaaa agctagctat gaaaatatat ttcatagtgg gtttaatgat gatcatttga 480tactccctct gccccaattt ataatccgtt taactttttt actctaagtt tgatcgactc 540gtcttattca aaacttatgc gagaaaatgg aaaattcaaa gccatactta aagcatatta 600tatgctaaat gacatcacag taaaaattaa taacaattat gattttttta ataggacgaa 660ttggtcaaag ttagggtaaa aaagtcaaac aaattataaa ttgg 704142665DNAArtificial SequenceMZA1851 Processed consensus sequence 142aaaaaggaaa tttttttttt taaaaaaaac ggaggctcta acagggctct gggtagtggc 60ccaaactgtg ccaatatgga taatggaaga ttcttggggc agagtattaa gggaagttgt 120ttttttcttc ttcttttggt tggtcttttt aagctgaatg gatgacatga ttgcctatgt 180tatgtattgg gtaattttag ttgtcaaaat atatctttac agctatacgc tatcgctgtg 240ctctgagcac ctcaaaacat ccaggtgatg acatctacac atggggttgg ggaggcgcca 300atgggacttt tttcgaagag ggccattctt ccggtggaca gctggtgagt tgctttcaga 360ccacaactgt ttccgcttga tggcaacaat gtgcggcatg cataatcccc acaggacacc 420attcatatgg atatggtcga actgacttgc tacttgcagg gacatggaaa cgacgtagac 480tattttgagc ctatgatggt tccctttggc acgaatgcca gagccgtcca tgtatcgtgt 540ggcttcaatc atactggtgc aatttacgag tgctccgagg actttgactg acgtgagact 600tgcagacagc agatccgcat gtcttggaga cttaggttag ttatcaaata tactcgctga 660ggaaa 665143698DNAArtificial SequenceMZA8761 Processed consensus sequence 143tgccaaaggg ggaacagtta aggctttata gaagggraag atttggttca ggtaactggg 60ctcacatttg ttactatttg gaatcatagg ggttcaagca tttaaaaaga actgggatcc 120ctaccaccag tttggagtgt tccacaaata cacttttatg tccttgggca tcgccaaggg 180ctgctttttt ttctttgggt attcctgtta actcagatgc tcaaaaattg ggacaatatt 240gacatgccct cttgattaga agtgtttgta gtttgtaatt tgcatcttat actttcatga 300gtactcgagc cattgttgtg ttctcagttg atgtaatttc attatttaaa cttcttgttg 360ggttgtctaa tggaatgcaa aaaaaatact tgaaaaatga cagatagcag atccagcagc 420aattgaggca atggtagata aagtaattgc tgataatcca aagcaacttg agcagtaccg 480tgctggaaaa actaagctac aaggattttt tgctggccag gtttgtcaat tgatgactag 540cactgtttgt cccttcagct aggatgtatt atcagtgatc atatttgttt caattgatta 600taggtgatga aagcatcgaa gggaaggcca acccagtttt gttgaataaa attcttgaaa 660aattcttgga gagaagtttt tgctaaattt tatataaa 698144521DNAArtificial SequenceMZA11455 Processed consensus sequence 144ttgaggcaat ttaaataagc attgcaggga aggcccagta caaacgttca accttctgac 60tgacacatgt tgtggaacta accctcagca taggagcaag agaaaaatga ctgggaagag 120aatgactggg aagagagatt gtttgcatgc acgtagcaga tatctgagag ctacagagga 180aagctgggaa atagaagaag ctctaaaaca aggagtgttt ctggaaattc tttagttttc 240aaaaaacact ttctgaaaat gtgtgtacaa gaaaattcca ggaaggtgaa attgcttcgt 300tgactgcagt gggaagggga aagagagaag ctagaatctc atgtcgagta atccagtaca 360atgtgttctt ttgtctggtc taaattcttg taacagctct tcctatgatg gaagaatcca 420ttcaacaatt ccacctatga ttactggatt gagtatgttg aataggttgg ttgaggctat 480ctagtaattt tatgactatt taatttattt ataactattt a 52114518DNAArtificial SequenceOligonucleotide primer C00060-01-F1 145ggtcttcgcc ggcctttc 1814625DNAArtificial SequenceOligonucleotide primer C00060-02-F1 146ggtcagtagc taattcttgc agctc 2514717DNAArtificial SequenceOligonucleotide primer C00060-01-F-Taq 147tcttcgccgg cctttct 1714826DNAArtificial SequenceOligonucleotide primer C00060-02-F-Taq 148cagagcaatt gtttatcaag aaagct

2614918DNAArtificial SequenceOligonucleotide primer C00060-01-R1 149gggaccgtcg atgccgac 1815029DNAArtificial SequenceOligonucleotide primer C00060-02-R1 150tttcctcaag aattggccca tagtaacaa 2915122DNAArtificial SequenceOligonucleotide primer C00060-01-R-Taq 151gcggatcaga tacagacgaa ca 2215224DNAArtificial SequenceOligonucleotide primer C00060-02-R-Taq 152ggttgaccat cacatttctt caga 2415325DNAArtificial SequenceOligonucleotide primer FLP111RB 153caggttatac tcgaccggaa tcaaa 2515430DNAArtificial SequenceOligonucleotide probe C00060-01-PCA 154acggacgcgg aggaacagga agacgattca 3015529DNAArtificial SequenceOligonucleotide probe C00060-02-PCA 155acggacgcgg agctcgaccg gaatcaaaa 2915626DNAArtificial SequenceOligonucleotide probe C00060-01-P-Taq 156cctctacccg gcacactgaa tcgtct 2615732DNAArtificial SequenceOligonucleotide probe C00060-02-P-Taq 157cccaacaaaa tattcaggtt atactcgacc gg 32158259DNAArtificial SequenceSNP Sequence for Marker PHD0001-01 158tttagaaact cagctagtgc ttttggcaac caaaccccac agccaaacag ctgcatgtct 60agaggtagag gagtagactc ctcacaccgg gtaagtctag ctgagtatta gtatactcag 120ccttgcttgt ggcataattt ttacaggttc tctggaggaa atggttgctg gagtgacttg 180gccgtccatc ttgccaccgg gttggactgt cgagtgggac cctgccttgg ctgaggagga 240gcatgaggag tgatgggac 25915934DNAArtificial SequenceInvader Oligo for Marker PHD0001-01 159tgccacaagc aaggctgagt atactaatac tcat 3416026DNAArtificial SequenceInvader Probe for Marker PHD0001-01 160cgcgccgagg gctagactta cccggt 2616122DNAArtificial SequenceForward Oligonucleotide Primer for Marker PHD0001-01 161tagtgctttt ggcaaccaaa cc 2216222DNAArtificial SequenceReverse Oligonucleotide Primer for Marker PHD0001-01 162ccatttcctc cagagaacct gt 22163259DNAArtificial SequenceSNP Sequence for Marker PHD0002-01 163ggcttcccca tctctctatt tatttaccgt tagtttattt ccgctgcact tcgaacaatg 60atggttactt ttgcaaaaac tccgaggatg atgatgatgg tgatgtaata atttaatact 120ctgacatgta tggttttatg ctttattgta tttgctctgt gactcacctt cgagtgagat 180tgtggtactt gatcctgtca gtggccgtgt cggactagat ccgagggatt gacgggttat 240tcccaattaa gtgtggtct 25916436DNAArtificial SequenceInvader Oligo for Marker PHD0002-01 164ggccactgac aggatcaagt accacaatct cactct 3616527DNAArtificial SequenceInvader Probe for Marker PHD0002-01 165cgcgccgagg gaaggtgagt cacagag 2716623DNAArtificial SequenceForward Oligonucleotide Primer for Marker PHD0002-01 166ggatgatgat gatggtgatg taa 2316722DNAArtificial SequenceReverse Oligonucleotide Primer for Marker PHD0002-01 167ccgtcaatcc ctcggatcta gt 22168269DNAArtificial SequenceSNP Sequence for Marker PHD0003-01 168acgctgctgc gacaaggccc tcgcccgcat ccccactcga ggggcgagga caagctatca 60aagccgaaga gccggaggtc cgaccgcagg tggcgccgag aaaccttctc tggctgccac 120cacctcagca ccgacgacgg cagccacctg cccaccaaca cccgccgggc cgtgaccaat 180gtgctcggtt ggcactgttg ggtcatgcgc agggttgcct cgagtcgcgg caccggttcc 240gcagtcgaga aggcgcggga ggaggcgcg 26916921DNAArtificial SequenceInvader Oligo for Marker PHD0003-01 169tggctgccgt cgtcggtgct t 2117024DNAArtificial SequenceInvader Probe for Marker PHD0003-01 170cgcgccgagg gaggtggtgg cagc 2417122DNAArtificial SequenceForward Oligonucleotide Primer for Marker PHD0003-01 171ggacaagcta tcaaagccga ag 2217220DNAArtificial SequenceReverse Oligonucleotide Primer for Marker PHD0003-01 172caaccgagca cattggtcac 20173279DNAArtificial SequenceSNP Sequence for marker PHD0004-01 173cacgaacacc ccaaaccaca tgccgaggct gtagagtcgc cccagggttg aatcgaccga 60ggcggtcatt tctcccctga ccacggcgaa gagcggcacg gtgcgcaact ggttttcctg 120atagtgggca ccggcgtgaa attaggccgc caactcgcgc cccgatgcac cgacccacaa 180tcgccaaggc ttctgctgcg caaacgagtt ccccgctgtg atggccgaag cacagcacag 240caggtggacg gcagcggacc agtcgcggcg gcgcacaga 27917424DNAArtificial SequenceInvader Oligo for marker PHD0004-01 174tggcggccta atttcacgcc ggtt 2417528DNAArtificial SequenceInvader Probe for marker PHD0004-01 175cgcgccgagg gcccactatc aggaaaac 2817621DNAArtificial SequenceForward oligonucleotide primer for marker PHD0004-01 176ggtcatttct cccctgacca c 2117719DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0004-01 177agcagaagcc ttggcgatt 19178300DNAArtificial SequenceSNP Sequence for marker PHD0005-01 178ttggggcgag cagggaggag aagaggaaca gcggcttcgg gtgttatagg cgcagggtaa 60aggaggggac gaacaggtca cgctggcgcg atgccgcacc tatatgacga gtccgggctg 120aggacgttaa ccgggcggcg ctagaatcct ggggcttcgg cagaggccgt tgcgggagta 180gcggcgggca ggtgtgccgc cagcgctgta cgcggggtcg gggcacggag gttgttgcgc 240taggggtccg cgatttccgt gaatcgggca cgagctcacc agcgccaccg gttttgcgca 30017923DNAArtificial SequenceInvader Oligo for marker PHD0005-01 179cgctactccc gcaacggcct ctt 2318022DNAArtificial SequenceInvader Probe for marker PHD0005-01 180cgcgccgagg gccgaagccc ca 2218122DNAArtificial SequenceForward oligonucleotide primer for marker PHD0005-01 181ctatatgacg agtccgggct ga 2218219DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0005-01 182acccctagcg caacaacct 19183290DNAArtificial SequenceSNP sequence for marker PHD0006-01 183cgaagcggag gaaatgtagg gagggagaag aagaccactg ccggctgggt ggataagtta 60gctgggtgac cctggaatgt ggggcccgcc tggcggcgac gcgaaggcca cacgagcgag 120tgaggggcgt tgggtcgtgc ggtatcggaa aaaaaagaat gggccgaaag tgaggattcg 180gcccaagtag tgttttattg tttttctttt tcttattttt tttcaaattc aactttaaat 240tcccatttaa attcaaattt agtggtggat ctatcttcac attaatttcc 29018423DNAArtificial SequenceInvader oligo for marker PHD0006-01 184tcgctcgtgt ggccttcgcg tct 2318521DNAArtificial SequenceInvader probe for marker PHD0006-01 185cgcgccgagg gccgccaggc g 2118622DNAArtificial SequenceForward oligonucleotide primer for marker PHD0006-01 186ggctgggtgg ataagttagc tg 2218721DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0006-01 187cactttcggc ccattctttt t 21188300DNAArtificial SequenceSNP Sequence for marker PHD0007-01 188caacttaaac atggcatggg tgaacttatt tattttcaat atttatttta ttaaaactag 60tgctatgttt ctccaaatta gagtttaaat gctatgtgtc ccttaatata ttaatatatg 120ggtactaaca catttatttt actatccaca aatgcacaat caagtaaaaa ctcagcatga 180tgcataattt atttgagtgt cttctattaa ttatttattg tatagatgag gtgtccacat 240gaaatggtaa atagggataa cccacacaca tgtaaaggaa tataatctct ccttttagat 30018958DNAArtificial SequenceInvader oligo for marker PHD0007-01 189tttctccaaa ttagagttta aatgctatgt gtcccttaat atattaatat atgggtat 5819036DNAArtificial SequenceInvader probe for marker PHD0007-01 190cgcgccgagg ctaacacatt tattttacta tccaca 3619122DNAArtificial SequenceForward oligonucleotide primer for marker PHD0007-01 191ttaaacatgg catgggtgaa ct 2219224DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0007-01 192tgcatcatgc tgagttttta cttg 24193274DNAArtificial SequenceSNP Sequence for marker PHD0008-01 193cggcggccac aagtcagtcg ccgaaaatta cctgttcttt tcggtgggcc tctgacggcc 60gccgaaaata acaagtgccg aaaatagtat ttaaaaatac aaaaaataac agaaaattca 120tacaataaca gaaaattcat acttgagtcc acaacataaa acttaagtcc atacaaacat 180aaagtccaca aatagtccat acaaacataa agtccacaaa tagtccatta caaagcacaa 240tgccgcacaa agctaactcc atcacatatc gggg 27419451DNAArtificial SequenceInvader oligo for marker PHD0008-01 194tttgtatgga ctatttgtgg actttatgtt tgtatggact taagttttat t 5119529DNAArtificial SequenceInvader probe for marker PHD0008-01 195cgcgccgagg gttgtggact caagtatga 2919622DNAArtificial SequenceForward oligonucleotide primer for marker PHD0008-01 196cgaaaataac aagtgccgaa aa 2219723DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0008-01 197ggcattgtgc tttgtaatgg act 23198259DNAArtificial SequenceSNP sequence for marker PHD0009-01 198cgttggagtt gtgtccacta ccttcagaag cgaaaaactc gttgacgaag tcgtgtaacg 60ggtttagatt ctaaagaaaa aagaagacat taataacgat attagttaca tgtatgacca 120ctattcaaac aaattgtttc tcaaactaac ctctcatgga gtagctccct cccctgcata 180tgctcctcct ggtgctggta tgagcggtgg tggcgtgttg tggcccatga ccccggatcc 240ctacaaaatc aagtttagt 25919949DNAArtificial SequenceInvader oligo for marker PHD0009-01 199gggagctact ccatgagagg ttagtttgag aaacaatttg tttgaatat 4920034DNAArtificial SequenceInvader probe for marker PHD0009-01 200cgcgccgagg gtggtcatac atgtaactaa tatc 3420124DNAArtificial SequenceForward oligonucleotide primer for marker PHD0009-01 201aagtcgtgta acgggtttag attc 2420219DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0009-01 202cagcaccagg aggagcata 19203250DNAArtificial SequenceSNP sequence for marker PHD0010-01 203aaagatttga aattagattg atacaaacga caagtcttaa ctaaattgaa gcacctgagg 60tggaggtggc ggagcatgta atccccactg aggcatcgac ggctgaaact gagggaaaac 120aaatggttgt tgttgtgcct gctgtggaaa ccaagaccgt tgcaaatata atatgttagt 180tatagaacca atatcgagcg tgttgagaag aaataagaca ctcacgttca ttgcttgttg 240ggcctgtgcg 25020434DNAArtificial SequenceInvader oligo for marker PHD0010-01 204gcaggcacaa caacaaccat ttgttttccc tcat 3420526DNAArtificial SequenceInvader probe for marker PHD0010-01 205cgcgccgagg gtttcagccg tcgatg 2620622DNAArtificial SequenceForward oligonucleotide primer for marker PHD0010-01 206ggagcatgta atccccactg ag 2220722DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0010-01 207tctcaacacg ctcgatattg gt 22208259DNAArtificial SequenceSNP sequence for marker PHD0011-01 208atttccggcg gttgtggcag gccgccaaaa atagcagata attttcggcg gctataggtg 60ggccatcgaa aattacattg gccgccgaaa atgttcaaca gtgttgttgt gatagcaacc 120aacaggtatg agccacaata ctacacattg caacttggga aagtaattta ctggtcacca 180tatttccgaa tagctggtta tgatatgata tttacaaatc ttccaattca ttccttcagc 240ttaaatgaat ctcattaat 25920940DNAArtificial SequenceInvader oligo for marker PHD0011-01 209agttgcaatg tgtagtattg tggctcatac ctgttggttt 4021029DNAArtificial SequenceInvader probe for marker PHD0011-01 210cgcgccgagg gctatcacaa caacactgt 2921122DNAArtificial SequenceForward oligonucleotide primer for marker PHD0011-01 211taggtgggcc atcgaaaatt ac 2221224DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0011-01 212ttcggaaata tggtgaccag taaa 24213269DNAArtificial SequenceSNP sequence for marker PHD0012-01 213ttgtaaaaaa caaggttttg taaatggatt tatttttatg ctcaaactta aattgaacaa 60ttcaatcacg cacaattgct atgctgacag aagtttatga caagtttgag cataatgttg 120taataataat gagacccttc atgatcttgt tgttattcca catttccatc tctcctcgaa 180gcatagcagt gcccaccatt ttctaccgag tcagcaacaa taatctaggc tgaaagaaca 240atggacaaca gcttcgtgtg ttgtccatc 26921451DNAArtificial SequenceInvader oligo for marker PHD0012-01 214gtggaataac aacaagatca tgaagggtct cattattatt acaacattat t 5121531DNAArtificial SequenceInvader probe for marker PHD0012-01 215cgcgccgagg gctcaaactt gtcataaact t 3121622DNAArtificial SequenceForward oligonucleotide primer for marker PHD0012-01 216tcaatcacgc acaattgcta tg 2221722DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0012-01 217agaaaatggt gggcactgct at 22218259DNAArtificial SequenceSNP sequence for marker PHD0013-01 218tacaatattt gcctatggtg ttacaaggag tggaaagata catacgatgc atgtgggaaa 60acttattaca atatttttcc tttaataagt tttacctttg tagagtgtat gtttctagtc 120ataggctttg aagtatgcct catgctacca attaacatgc aaaaacttgg actaatctta 180ctgatactaa gatctaacat agttgtcaac ctccttggtt ggacatttta gttgcttttg 240ttgtattaag cttttaatt 25921945DNAArtificial SequenceInvader oligo for marker PHD0013-01 219ccaagttttt gcatgttaat tggtagcatg aggcatactt caaat 4522031DNAArtificial SequenceInvader probe for marker PHD0013-01 220cgcgccgagg gcctatgact agaaacatac a 3122122DNAArtificial SequenceForward oligonucleotide primer for marker PHD0013-01 221acatacgatg catgtgggaa aa 2222222DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0013-01 222aatgtccaac caaggaggtt ga 22223269DNAArtificial SequenceSNP sequence for marker PHD0014-01 223attggatttg tggtggggtg cgtgggcggg catcacgcgt ggcgatggca ctggaagcac 60ggggaacagg gcaggtgtag ggtgggggca ggcgatggaa tggcgcggca tgcttgcggc 120cgattgtcct tgcgtggatg gaggggattg cgggctcgag gatgaggatg gcgggatgcg 180cgcgcctttc gtcgatcgaa cgtgggcacg ggacgaggat tgcattgcgc ggccacgcgg 240gggcgagatt ggcgtcgtcg gtgggatgt 26922424DNAArtificial SequenceInvader oligo for marker PHD0014-01 224ccgccatcct catcctcgag ccct 2422525DNAArtificial SequenceInvader probe for marker PHD0014-01 225cgcgccgagg gcaatcccct ccatc 2522618DNAArtificial SequenceForward oligonucleotide primer for marker PHD0014-01 226cttgcggccg attgtcct 1822718DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0014-01 227accgacgacg ccaatctc 18228210DNAArtificial SequenceSNP sequence for marker PHD0015-01 228aattgctatt ttagcccttc taacgtgggc tctctgctat tatgtgaccc tctgtctatg 60acttgtgtga ccatttgtgt ctatgatttg tgggactggt ggtaaaatag agaagttcac 120aactgagagt gacaaaatag caaattctcc cacgggggcg ggggcacgac gcaccagtgt 180ggacgtccac actatagcct tatagagtag 21022939DNAArtificial SequenceInvader oligo for marker PHD0015-01 229cccgtgggag aatttgctat tttgtcactc tcagttgtt 3923032DNAArtificial SequenceInvader probe for marker PHD0015-01 230cgcgccgagg gaacttctct attttaccac ca 3223124DNAArtificial SequenceForward oligonucleotide primer for marker PHD0015-01 231tgacttgtgt gaccatttgt gtct 2423219DNAArtificial SequenceReverse oligonucleotide primer for marker PHD0015-01 232gtccacactg gtgcgtcgt 19

Claims

1. Corn seed comprising a first MP305 derived chromosomal interval defined by BNLG2162 and UMC1051, and not comprising a second MP305 derived chromosomal interval above BNLG2162 or below UMC1051.

2. The corn seed of claim 1, wherein said corn seed comprises the Rcg1 gene and, when grown, produces a corn plant that exhibits resistance to Colletotrichum infection.

3. A plant produced from the corn seed of claim 2.

4. A plant cell of the plant of claim 3.

5. Corn seed comprising a first MP305 derived chromosomal interval between, but not including, MZA15842 and UMC15a, and not comprising a second MP305 derived chromosomal interval at or above MZA15842 or at or below UMC15a.

6. The corn seed of claim 5, wherein said corn seed comprises the Rcg1 gene and, when grown, produces a corn plant that exhibits resistance to Colletotrichum infection.

7. A plant produced from the corn seed of claim 6.

8. A plant cell of the plant of claim 7.

9. Seed of a corn variety designated DE811ASR(BC5), or a progeny seed derived therefrom that comprises the Rcg1 gene, that when grown, produces a plant that exhibits enhanced or newly conferred resistance to Colletotrichum infection.

10. The seed of claim 9, wherein a representative sample of said corn variety DE811ASR(BC5) has been deposited as ATCC accession number PTA-7434.

11. A plant produced from the seed of claim 10.

12. A plant cell of the plant of claim 11.

13. The progeny seed of claim 9, wherein said progeny seed retains a first MP305 or DE811ASR(BC5) derived chromosomal interval within, but not including, UMC2285 and UMC15a.

14. The progeny seed of claim 9, wherein said progeny seed retains a first MP305 or DE811ASR(BC5) derived chromosomal interval within, but not including, MZA15842 and UMC15a.

15. A plant produced from the seed of claim 14.

16. A plant cell of the plant of claim 15.

17. The progeny seed of claim 14, wherein the progeny seed is an Rcg1 locus conversion of PH705, PH5W4, PH51 K or PH87P, or a progeny thereof.

18. The progeny seed of claim 9, wherein the progeny seed comprises at least two or more of (a) allele 7 at MZA11123, (b) allele 2 at MZA2591, or (c) allele 8 at MZA3434.

19. A corn plant produced by the progeny seed of claim 18.

20. The progeny seed of claim 9, wherein the progeny seed comprises a cytosine nucleotide at MZA2591.32, a thymine nucleotide at MZA2591.35, and a cytosine nucleotide at MZA3434.17.

21. A corn plant produced by the progeny seed of claim 20.