U.S. patent application number 15/825740 was filed with the patent office on 2018-04-19 for methods and systems for barcoding nucleic acid molecules from individual cells or cell populations.
The applicant listed for this patent is 10X Genomics, Inc.. Invention is credited to Phillip Belgrader, Tarjei Sigurd Mikkelsen, Xinying Zheng.
Application Number | 20180105808 15/825740 |
Document ID | / |
Family ID | 61902195 |
Filed Date | 2018-04-19 |
United States Patent
Application |
20180105808 |
Kind Code |
A1 |
Mikkelsen; Tarjei Sigurd ;
et al. |
April 19, 2018 |
METHODS AND SYSTEMS FOR BARCODING NUCLEIC ACID MOLECULES FROM
INDIVIDUAL CELLS OR CELL POPULATIONS
Abstract
The present disclosure provides methods, compositions and
systems for analyzing individual cells or cell populations through
a partitioned analysis of contents of individual cells or cell
populations, such as cancer cells and cells of the immune system.
Individual cells or cell populations may be co-partitioned with
processing reagents for accessing cellular contents, and for
uniquely identifying the content of a given cell or cell
population, and subsequently analyzing the content of the cell and
characterizing it as having derived from an individual cell or cell
population, including analysis and characterization of nucleic
acid(s) from the cell through sequencing.
Inventors: |
Mikkelsen; Tarjei Sigurd;
(Dublin, CA) ; Belgrader; Phillip; (Livermore,
CA) ; Zheng; Xinying; (San Jose, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
10X Genomics, Inc. |
Pleasanton |
CA |
US |
|
|
Family ID: |
61902195 |
Appl. No.: |
15/825740 |
Filed: |
November 29, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2017/057269 |
Oct 18, 2017 |
|
|
|
15825740 |
|
|
|
|
62410326 |
Oct 19, 2016 |
|
|
|
62490546 |
Apr 26, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/1096 20130101;
C12Q 1/6834 20130101; C12Q 1/6816 20130101; C12N 15/1003 20130101;
C12N 15/1065 20130101; C12N 5/0602 20130101; C12Q 1/6853 20130101;
C12Q 1/686 20130101; C12N 15/1062 20130101; C12Q 1/6869 20130101;
C12Q 1/6869 20130101; C12Q 2563/159 20130101; C12Q 2565/514
20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C12Q 1/68 20060101 C12Q001/68; C12N 5/071 20060101
C12N005/071 |
Claims
1. A method for nucleic acid sequencing, comprising: (a) providing
a plurality of droplets, wherein a droplet of said plurality of
droplets comprises (i) a ribonucleic acid (RNA) molecule comprising
a nucleic acid sequence, and (ii) a bead comprising a nucleic acid
barcode molecule coupled thereto, wherein said nucleic acid barcode
molecule comprises a barcode sequence; (b) using said RNA molecule
and said nucleic acid barcode molecule to generate a barcoded
nucleic acid molecule comprising, from a 5' end to a 3' end, a
sequence corresponding to said nucleic acid sequence of said RNA
molecule and a complement of said barcode sequence; and (c)
sequencing said barcoded nucleic acid molecule or a derivative
thereof.
2. The method of claim 1, wherein said RNA molecule is from a
cell.
3. The method of claim 2, wherein said droplet comprises said
cell.
4. The method of claim 3, further comprising releasing said RNA
molecule from said cell prior to (b).
5. The method of claim 1, wherein said bead comprises a plurality
of nucleic acid molecules coupled thereto, wherein said plurality
of nucleic acid molecules comprises said nucleic acid barcode
molecule.
6. The method of claim 5, wherein each of said plurality of nucleic
acid molecules comprises said barcode sequence.
7. The method of claim 6, wherein each of said plurality of nucleic
acid molecules comprises an additional barcode sequence that varies
across said plurality of nucleic acid molecules.
8. The method of claim 1, wherein said nucleic acid barcode
molecule comprises a template switching sequence.
9. The method of claim 1, further comprising, prior to (c),
subjecting said barcoded nucleic acid molecule or derivative
thereof to nucleic acid amplification.
10. The method of claim 9, wherein said nucleic acid amplification
is performed subsequent to releasing said barcoded nucleic acid
molecule or derivative thereof from said droplet.
11. The method of claim 9, wherein said nucleic acid amplification
is polymerase chain reaction.
12. The method of claim 1, wherein said RNA molecule is a messenger
ribonucleic acid (mRNA) molecule.
13. The method of claim 1, wherein in (a) said droplet comprises
(i) an additional nucleic acid molecule comprising an additional
nucleic acid sequence, and (ii) an additional nucleic acid barcode
molecule comprising an additional barcode sequence, and wherein in
(b) said additional nucleic acid molecule and said additional
nucleic acid barcode molecule are used to generate an additional
barcoded nucleic acid molecule comprising, from a 5' end to a 3'
end, said additional barcode sequence and an additional sequence
corresponding to said additional nucleic acid sequence.
14. The method of claim 13, wherein said additional nucleic acid
barcode molecule is coupled to said bead.
15. The method of claim 1, wherein (b) comprises extending a primer
hybridized to a region at a 3' end of the RNA molecule in a primer
extension reaction, said nucleic acid barcode molecule acting as a
template switching oligonucleotide in said primer extension
reaction, thereby generating said barcoded nucleic acid molecule
comprising, from the 5' end to the 3' end, the sequence
corresponding to the nucleic acid sequence of the RNA molecule and
the complement of the barcode sequence.
16. The method of claim 1, wherein (b) is performed in said
droplet.
17. The method of claim 15, further comprising releasing said
barcoded nucleic acid molecule or a derivative thereof from said
droplet.
18. The method of claim 1, wherein said barcoded nucleic acid
molecule further comprises, towards a 5' end, a functional sequence
for permitting said barcoded nucleic acid molecule or a derivative
thereof to couple to a flow cell of a sequencer.
19. The method of claim 1, wherein said sequence is a reverse
complement of said nucleic acid sequence.
20. The method of claim 1, further comprising, prior to (c), using
said barcoded nucleic acid molecule or a derivative thereof and a
pair of primers to generate nucleic acid molecules having a target
nucleic acid sequence.
21. The method of claim 20, wherein said target nucleic acid
sequence comprises a T cell receptor variable region sequence, a B
cell receptor variable region sequence, or an immunoglobulin
variable region sequence.
22. The method of claim 20, wherein at least one of said pair of
primers hybridizes to a constant region of a T cell receptor
nucleic acid sequence, a constant region of a B cell receptor
nucleic acid sequence, or a constant region of an immunoglobulin
nucleic acid sequence.
23. The method of claim 20, wherein said nucleic acid molecules
having said target nucleic acid sequence or derivatives thereof are
sequenced in (c).
24. The method of claim 1, further comprising releasing said
nucleic acid barcode molecule from said bead.
25. The method of claim 24, wherein said nucleic acid barcode
molecule is released from said bead before said barcoded nucleic
acid molecule is generated.
26. The method of claim 24, wherein said nucleic acid barcode
molecule is released from said bead while said barcoded nucleic
acid molecule is generated.
27. The method of claim 24, wherein said nucleic acid barcode
molecule is released from said bead after said barcoded nucleic
acid molecule is generated.
28. The method of claim 1, wherein said bead is a gel bead.
29. The method of claim 1, wherein said barcode sequence is a
combinatorial assembly of a plurality of barcode segments.
30. The method of claim 29, wherein plurality of barcode segments
comprises at least three segments.
Description
CROSS-REFERENCE
[0001] This application is a Continuation Application of
International Patent Application PCT/US2017/057269, filed Oct. 18,
2017, which claims the benefit of U.S. Provisional Patent
Application No. 62/410,326, filed Oct. 19, 2016, and U.S.
Provisional Patent Application No. 62/490,546, filed Apr. 26, 2017,
each of which is incorporated herein by reference in its entirety
for all purposes.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 9, 2017, is named 43487_745_301 SL.txt and is 44,113 bytes
in size.
BACKGROUND
[0003] Significant advances in analyzing and characterizing
biological and biochemical materials and systems have led to
unprecedented advances in understanding the mechanisms of life,
health, disease and treatment. Among these advances, technologies
that target and characterize the genomic make up of biological
systems have yielded some of the most groundbreaking results,
including advances in the use and exploitation of genetic
amplification technologies, and nucleic acid sequencing
technologies.
[0004] Nucleic acid sequencing can be used to obtain information in
a wide variety of biomedical contexts, including diagnostics,
prognostics, biotechnology, and forensic biology. Sequencing may
involve methods including Maxam-Gilbert sequencing and
chain-termination methods, or de novo sequencing methods including
shotgun sequencing and bridge PCR, or next-generation methods
including polony sequencing, 454 pyrosequencing, Illumina
sequencing, SOLiD sequencing, Ion Torrent semiconductor sequencing,
HeliScope single molecule sequencing, SMRT.RTM. sequencing, and
others. Nucleic acid sequencing technologies, including
next-generation DNA sequencing, have been useful for genomic and
proteomic analysis of cell populations.
SUMMARY
[0005] Recognized herein is the need for methods, compositions and
systems for analyzing genomic and proteomic information from
individual cells or a small population of cells. Such cells
include, but are not limited to, cancer cells, fetal cells, and
immune cells involved in immune responses. Provided herein are
methods, compositions and systems for analyzing individual cells or
a small population of cells, including the analysis and attribution
of nucleic acids from and to these individual cells or cell
populations.
[0006] In an aspect, the present disclosure provides a method for
nucleic acid sequencing, comprising (a) providing a plurality of
droplets, wherein a droplet of the plurality of droplets comprises
(i) a ribonucleic acid (RNA) molecule comprising a nucleic acid
sequence, and (ii) a bead comprising a nucleic acid barcode
molecule coupled thereto, wherein the nucleic acid barcode molecule
comprises a barcode sequence; (b) using the RNA molecule and the
nucleic acid barcode molecule to generate a barcoded nucleic acid
molecule comprising, from a 5' end to a 3' end, a sequence
corresponding to the nucleic acid sequence of the RNA molecule and
a complement of the barcode sequence; and (c) sequencing the
barcoded nucleic acid molecule or a derivative thereof.
[0007] In some embodiments, the RNA molecule is from a cell. In
some embodiments, the droplet comprises the cell. In some
embodiments, the method further comprises releasing the RNA
molecule from the cell prior to (b).
[0008] In some embodiments, the bead comprises a plurality of
nucleic acid molecules coupled thereto, wherein the plurality of
nucleic acid molecules comprises the nucleic acid barcode
molecule.
[0009] In some embodiments, each of the plurality of nucleic acid
molecules comprises the barcode sequence. In some embodiments, each
of the plurality of nucleic acid molecules comprises an additional
barcode sequence that varies across the plurality of nucleic acid
molecules.
[0010] In some embodiments, the nucleic acid barcode molecule
comprises a template switching sequence.
[0011] In some embodiments, the method further comprises, prior to
(c), subjecting the barcoded nucleic acid molecule or derivative
thereof to nucleic acid amplification. In some embodiments, the
nucleic acid amplification is performed subsequent to releasing the
barcoded nucleic acid molecule or derivative thereof from the
droplet. In some embodiments, the nucleic acid amplification is
polymerase chain reaction. In some embodiments, the RNA molecule is
a messenger ribonucleic acid (mRNA) molecule.
[0012] In some embodiments, in (a) the droplet comprises (i) an
additional nucleic acid molecule comprising an additional nucleic
acid sequence, and (ii) an additional nucleic acid barcode molecule
comprising an additional barcode sequence, and wherein in (b) the
additional nucleic acid molecule and the additional nucleic acid
barcode molecule are used to generate an additional barcoded
nucleic acid molecule comprising, from a 5' end to a 3' end, the
additional barcode sequence and an additional sequence
corresponding to the additional nucleic acid sequence. In some
embodiments, the additional nucleic acid barcode molecule is
coupled to the bead. In some embodiments, the additional nucleic
acid barcode molecule is coupled to an additional bead.
[0013] In some embodiments, (b) is performed in the droplet.
[0014] In some embodiments, the method further comprises releasing
the barcoded nucleic acid molecule or a derivative thereof from the
droplet.
[0015] In some embodiments, the barcoded nucleic acid molecule
further comprises, towards a 3' end, a functional sequence for
permitting the barcoded nucleic acid molecule or a derivative
thereof to couple to a flow cell of a sequencer.
[0016] In some embodiments, the sequence is a reverse complement of
the nucleic acid sequence.
[0017] In some embodiments, the method further comprises, prior to
(c), using the barcoded nucleic acid molecule or a derivative
thereof and a pair of primers to generate a subset of nucleic acids
having a target nucleic acid sequence. In some embodiments, the
target nucleic acid sequence comprises a T cell receptor variable
region sequence, a B cell receptor variable region sequence, or an
immunoglobulin variable region sequence. In some embodiments, the
at least one of the pair of primers hybridizes to a constant region
of a T cell receptor nucleic acid sequence, a constant region of a
B cell receptor nucleic acid sequence, or a constant region of an
immunoglobulin nucleic acid sequence. In some embodiments, the
subset of nucleic acids or derivatives thereof are sequenced in
(c).
[0018] In some embodiments, the method further comprises releasing
the nucleic acid barcode molecule from the bead. In some
embodiments, the nucleic acid barcode molecule is released from the
bead before the barcoded nucleic acid molecule is generated. In
some embodiments, the nucleic acid barcode molecule is released
from the bead while the barcoded nucleic acid molecule is
generated. In some embodiments, the nucleic acid barcode molecule
is released from the bead after the barcoded nucleic acid molecule
is generated. In some embodiments, the bead is a gel bead.
[0019] In some embodiments, the barcode sequence is a combinatorial
assembly of a plurality of barcode segments. In some embodiments,
the plurality of barcode segments comprises at least three
segments.
[0020] In an aspect, the present disclosure provides a method for
generating a labeled polynucleotide. The method comprises (a)
subjecting a reaction mixture to a first amplification reaction
under conditions sufficient to generate a first amplification
product, wherein the reaction mixture comprises a template
polynucleotide and (i) a primer having a sequence towards a 3' end
that hybridizes to the template polynucleotide, and (ii) a template
switching oligonucleotide that comprises a first predefined
sequence towards a 5' end; and (b) subjecting the first
amplification product to a second amplification reaction in the
presence of a barcoded oligonucleotide under conditions sufficient
to generate a second amplification product, wherein the barcoded
oligonucleotide comprises a sequence of at least a segment of the
template switching oligonucleotide and at least a second predefined
sequence, wherein (i) the second amplification reaction uses the
first amplification product as a template and the barcoded
oligonucleotide as a primer, or (ii) the second amplification
reaction uses the barcoded oligonucleotide as a template and at
least a portion of the first amplification product as a primer, to
generate the second amplification product, wherein the first
amplification reaction and the second amplification reaction are
performed within a same reaction volume. In some embodiments, the
second amplification reaction uses the first amplification product
as a template and the barcoded oligonucleotide as a primer. In some
embodiments, the second amplification reaction uses the barcoded
oligonucleotide as a template and at least a portion of the first
amplification product as a primer.
[0021] In an aspect, the present disclosure provides a method for
generating a labeled polynucleotide comprising (a) providing a
reaction mixture in a reaction volume, wherein the reaction mixture
comprises (i) a template polynucleotide, (ii) a primer comprising a
sequence towards a 3' end of the primer that hybridizes to the
template polynucleotide, and (iii) a template switching
oligonucleotide; (b) in the reaction volume, subjecting the
reaction mixture to a first reaction under conditions sufficient to
generate a first nucleic acid product comprising the primer, a
reverse complement of a sequence of the template polynucleotide,
and a sequence complementary to at least a portion of the template
switch oligonucleotide; and (c) subjecting the first nucleic acid
product to a second reaction in the reaction volume, which second
reaction comprises using (i) the first nucleic acid product as a
template and a barcoded oligonucleotide as a primer, which barcoded
oligonucleotide comprises a sequence of at least a segment of the
template switching oligonucleotide, or (ii) the barcoded
oligonucleotide as a template and at least a portion of the first
nucleic acid as a primer, to generate a second nucleic acid
product.
[0022] In some embodiments, the template polynucleotide is obtained
from a single cell. In some embodiments, the single cell is an
immune cell. In some embodiments, the immune cell is a T-cell. In
some embodiments, the immune cell is a B-cell. In some embodiments,
the method further comprises lysing the single cell in the same
reaction volume to obtain the template polynucleotide prior to
generating the first amplification product in the first
amplification reaction.
[0023] In some embodiments, the template polynucleotide comprises a
T-cell receptor gene or gene product. In some embodiments, the
template polynucleotide comprises a B-cell receptor gene or gene
product. In some embodiments, the template polynucleotide is among
a plurality of template polynucleotides.
[0024] In some embodiments, a concentration of the template
switching oligonucleotide in the same reaction volume is at least
two times that of a concentration of the barcoded oligonucleotide
in the same reaction volume. In some embodiments, a concentration
of the template switching oligonucleotide in the same reaction
volume is at least five times that of a concentration of the
barcoded oligonucleotide in the same reaction volume. In some
embodiments, a concentration of the template switching
oligonucleotide in the same reaction volume is at least ten times
that of a concentration of the barcoded oligonucleotide in the same
reaction volume. In some embodiments, a concentration of the
template switching oligonucleotide in the same reaction volume is
at least twenty times that of a concentration of the barcoded
oligonucleotide in the same reaction volume. In some embodiments, a
concentration of the template switching oligonucleotide in the same
reaction volume is at least fifty times that of a concentration of
the barcoded oligonucleotide in the same reaction volume. In some
embodiments, a concentration of the template switching
oligonucleotide in the same reaction volume is at least one hundred
times that of a concentration of the barcoded oligonucleotide in
the same reaction volume. In some embodiments, a concentration of
the template switching oligonucleotide in the same reaction volume
is at least two hundred times that of a concentration of the
barcoded oligonucleotide in the same reaction volume.
[0025] In some embodiments, the primer comprises a sequence towards
a 5' end that does not specifically hybridize to the template
polynucleotide.
[0026] In some embodiments, the first amplification reaction is
facilitated using an enzyme comprising polymerase activity. In some
embodiments, the enzyme is a DNA-dependent polymerase. In some
embodiments, the enzyme is a reverse transcriptase.
[0027] In some embodiments, the second amplification reaction is
facilitated using an enzyme comprising polymerase activity. In some
embodiments, the enzyme is a DNA-dependent polymerase.
[0028] In some embodiments, the first amplification reaction
comprises polymerase chain reaction. In some embodiments, the first
amplification reaction comprises reverse transcription. In some
embodiments, the second amplification reaction comprises polymerase
chain reaction.
[0029] In some embodiments, the first amplification reaction and
the second amplification reaction are performed sequentially in the
absence of an intervening purification step.
[0030] In some embodiments, the template switching oligonucleotide
is not available for primer extension during the second
amplification reaction.
[0031] In some embodiments, the method further comprises degrading
the template switching oligonucleotide prior to the second
amplification reaction. In some embodiments, the template switching
oligonucleotide comprises ribonucleic acids (RNA). In some
embodiments, the template switching oligonucleotide comprises at
least 10% ribonucleic acids (RNA).
[0032] In some embodiments, the method further comprises degrading
the template switching oligonucleotide during the second
amplification reaction. In some embodiments, the template switching
oligonucleotide comprises ribonucleic acids (RNA). In some
embodiments, the template switching oligonucleotide comprises at
least 10% ribonucleic acids (RNA).
[0033] In some embodiments, a first reaction rate of the second
amplification reaction using the barcoded oligonucleotide is
greater than a second reaction rate of the second amplification
using the template switching oligonucleotide.
[0034] In some embodiments, the first amplification product and the
barcoded oligonucleotide has a higher melting temperature as
compared to a melting temperature of the first amplification
product and the template switching oligonucleotide. In some
embodiments, a primer annealing temperature of the second
amplification reaction is at least 0.5.degree. C. greater than a
primer annealing temperature of the first amplification
reaction.
[0035] In some embodiments, the template switching oligonucleotide
comprises modified nucleotides. In some embodiments, the template
switching oligonucleotide comprises at least 10% modified
nucleotides. In some embodiments, the template switching
oligonucleotide comprises modified nucleotides selected from
unlocked nucleic acids (UNAs), locked nucleic acids (LNAs), and
5-hydroxybutynl-2'-deoxyuridine.
[0036] In some embodiments, the barcoded oligonucleotide comprises
modified nucleotides. In some embodiments, the barcoded
oligonucleotide comprises at least 10% modified nucleotides. In
some embodiments, the barcoded oligonucleotide comprises modified
nucleotides selected from locked nucleic acids (LNAs), unlocked
nucleic acids (UNAs), and 5-hydroxybutynl-2'-deoxyuridine.
[0037] In some embodiments, the same reaction volume comprises an
emulsion, a droplet, or a microwell.
[0038] In some embodiments, the first defined sequence comprises at
least one of an adaptor sequence, a barcode sequence, a unique
molecular identifier sequence, a primer binding site, and a
sequencing primer binding site. In some embodiments, the second
defined sequence comprises at least one of an adaptor sequence, a
barcode sequence, a unique molecular identifier sequence, a primer
binding site, and a sequencing primer binding site.
[0039] In some embodiments, the primer is among a plurality of
primers. In some embodiments, the sequence towards the 3' end of
the primer comprises a random sequence. In some embodiments, the
sequence towards the 3' end of the primer comprises a gene specific
sequence. In some embodiments, the sequence towards the 3' end of
the primer comprises a polyA sequence.
[0040] In some embodiments, the template switching oligonucleotide
is among a plurality of template switching oligonucleotides. In
some embodiments, the barcoded oligonucleotide is among a plurality
of barcoded oligonucleotides.
[0041] In some embodiments, the method further comprises subjecting
the second amplification product to sequencing.
[0042] In some embodiments, the barcoded oligonucleotide is
releasably coupled to a microcapsule. In some embodiments, the
method further comprises releasing the barcoded oligonucleotide
from the microcapsule. In some embodiments, the barcoded
oligonucleotide is released from the microcapsule upon application
of a stimulus. In some embodiments, the stimulus is at least one of
a biological stimulus, a chemical stimulus, a thermal stimulus, an
electrical stimulus, a magnetic stimulus, a photo stimulus, or any
combination thereof. In some embodiments, the microcapsule is a
degradable microcapsule and releasing the barcoded oligonucleotide
comprises degrading the microcapsule. In some embodiments, the
microcapsule comprises a polymer gel. In some embodiments, the
polymer gel is a polyacrylamide. In some embodiments, the
microcapsule comprises a bead. In some embodiments, the bead is a
gel bead. In some embodiments, the microcapsule comprises a
chemical cross-linker. In some embodiments, the chemical
cross-linker is a disulfide bond.
[0043] In an aspect, the present disclosure provides a method
comprising (a) providing a reaction volume comprising (i) a cell or
cell derivative, and (ii) a bead comprising a barcoded
oligonucleotide releasably coupled thereto, wherein the barcoded
oligonucleotide is a template switching oligonucleotide; and (b)
releasing the barcoded oligonucleotide from the bead to provide the
barcoded oligonucleotide in the reaction volume at a concentration
of at least about 0.20 .mu.M; and (c) subjecting the reaction
volume to an amplification reaction to generate an amplification
product, wherein during the amplification reaction, the reaction
volume comprises a template polynucleotide from the cell or cell
derivative, the barcoded oligonucleotide and a primer having a
sequence towards a 3' end that hybridizes to the template
polynucleotide, and wherein the amplification product has sequence
complementarity with the template polynucleotide and the barcoded
oligonucleotide.
[0044] In an aspect, the present disclosure provides a method
comprising (a) providing a reaction volume comprising a cell and a
microcapsule comprising a barcoded oligonucleotide releasably
coupled thereto, wherein the barcoded oligonucleotide is a template
switching oligonucleotide; and (b) subjecting the reaction volume
to dissociation conditions sufficient to release the barcoded
oligonucleotide from the microcapsule, thereby providing the
barcoded oligonucleotide in the reaction volume at a concentration
of at least about 0.20 uM; and (c) subjecting the reaction volume
to an amplification reaction to generate an amplification product,
wherein during the amplification reaction, the reaction volume
comprises a template polynucleotide from the cell, the barcoded
oligonucleotide and a primer having a sequence towards a 3' end
that hybridizes to the template polynucleotide, and wherein the
amplification product has sequence complementarity with the
template polynucleotide and the barcoded oligonucleotide.
[0045] In some embodiments, the method further comprises subjecting
the amplification product to sequencing. In some embodiments, the
barcoded oligonucleotide does not hybridize to the template
polynucleotide. In some embodiments, the template polynucleotide is
an mRNA molecule. In some embodiments, the method further comprises
subjecting the reaction volume to a second amplification reaction
to generate an additional amplification product using the
amplification product as a template.
[0046] In some embodiments, the method further comprises subjecting
the additional amplification product to sequencing.
[0047] In some embodiments, the cell is a mammalian cell. In some
embodiments, the cell is an immune cell. In some embodiments, the
immune cell is a B-cell. In some embodiments, the immune cell is a
T-cell. In some embodiments, the cell is cancer cell. In some
embodiments, the cancer cell is obtained from a tissue sample. In
some embodiments, the cancer cell is obtained from a biological
fluid. In some embodiments, the biological fluid comprises blood.
In some embodiments, the biological fluid comprises lymph
fluid.
[0048] In some embodiments, the template polynucleotide comprises a
T cell receptor gene sequence, a B cell receptor gene sequence, or
an immunoglobulin gene sequence. In some embodiments, the template
polynucleotide is a T cell receptor mRNA molecule, a B cell
receptor mRNA molecule, or an immunoglobulin mRNA molecule.
[0049] In some embodiments, the reaction volume further comprises
an enzyme. In some embodiments, the enzyme is a DNA polymerase. In
some embodiments, the enzyme is a reverse transcriptase.
[0050] In some embodiments, the reaction volume further comprises
at least one reagent for nucleic acid amplification. In some
embodiments, the at least one reagent comprises dNTPs. In some
embodiments, the at least one reagent comprises oligonucleotide
primers.
[0051] In some embodiments, the microcapsule comprises a polymer
gel. In some embodiments, the polymer gel is a polyacrylamide. In
some embodiments, the microcapsule comprises a bead. In some
embodiments, the bead is a gel bead. In some embodiments, the
microcapsule comprises a chemical cross-linker. In some
embodiments, the chemical cross-linker is a disulfide bond. In some
embodiments, the dissociation condition is at least one of a
biological stimulus, a chemical stimulus, a thermal stimulus, an
electrical stimulus, a magnetic stimulus, a photo stimulus, or any
combination thereof.
[0052] In some embodiments, the barcoded oligonucleotide comprises
at least one of an adaptor sequence, a barcode sequence, unique
molecular identifier sequence, a primer binding site, and a
sequencing primer binding site.
[0053] In some embodiments, the same reaction volume comprises an
emulsion, a droplet, or a microwell.
[0054] In some embodiments, the method further comprises performing
a third reaction, wherein the third reaction specifically amplifies
variable region cDNAs, wherein the variable region cDNA are derived
from a T cell receptor cDNA, a B cell receptor cDNA, or an
immunoglobulin cDNA. In some embodiments, the third reaction
comprises use of a primer that specifically binds in the constant
region of the T cell receptor cDNA, B cell receptor cDNA, or
immunoglobulin cDNA, and extends through the variable region of the
T cell receptor cDNA, B cell receptor cDNA, or immunoglobulin cDNA.
In some embodiments, the third reaction results in an enrichment
product that comprises at (a) least one of a T cell receptor
variable region sequence, a B cell receptor variable region
sequence, and an immunoglobulin variable region sequence, and (b)
at least one of an adaptor sequence, a barcode sequence, a unique
molecular identifier sequence, a primer binding site, and a
sequencing primer binding site. In some embodiments, greater than
about 25% of reads in a subsequent short-read sequencing reaction
map to a T cell receptor, a B cell receptor, or an immunoglobulin
gene.
[0055] In an aspect, the present disclosure provides a
non-transitory computer-readable medium comprising
machine-executable code that, upon execution by one of more
computer processors, implements a method for nucleic acid
sequencing, comprising (a) providing a plurality of droplets,
wherein a droplet of the plurality of droplets comprises (i) a
ribonucleic acid (RNA) molecule comprising a nucleic acid sequence,
and (ii) a bead comprising a nucleic acid barcode molecule coupled
thereto, wherein the nucleic acid barcode molecule comprises a
barcode sequence; (b) using the RNA molecule and the nucleic acid
barcode molecule to generate a barcoded nucleic acid molecule
comprising, from a 5' end to a 3' end, a sequence corresponding to
the nucleic acid sequence of the RNA molecule and a complement of
the barcode sequence; and (c) sequencing the barcoded nucleic acid
molecule or a derivative thereof.
[0056] In an aspect, the present disclosure provides a
non-transitory computer-readable medium comprising
machine-executable code that, upon execution by one of more
computer processors, implements a method for generating a labeled
polynucleotide, the method comprising (a) subjecting a reaction
mixture to a first reaction under conditions sufficient to generate
a first nucleic acid product, wherein the reaction mixture
comprises (i) a template polynucleotide, (ii) a primer having a
sequence towards a 3' end that hybridizes to the template
polynucleotide, and (iii) a template switching oligonucleotide,
wherein the first nucleic acid product comprises the primer, a
reverse complement of a sequence of the template polynucleotide,
and a sequence complementary to at least a portion of the template
switch oligonucleotide; and (b) subjecting the first nucleic acid
product to a second reaction in the presence of a barcoded
oligonucleotide under conditions sufficient to generate a second
nucleic acid product, wherein the barcoded oligonucleotide
comprises a sequence of at least a segment of the template
switching oligonucleotide, wherein (i) the second reaction uses the
first nucleic acid as a template and the barcoded oligonucleotide
as a primer, or (ii) the second reaction uses the barcoded
oligonucleotide as a template and at least a portion of the first
nucleic acid as a primer, to generate the second nucleic acid
product, wherein the first reaction and the second reaction are
performed within a same reaction volume.
[0057] In an aspect, the present disclosure provides a
non-transitory computer-readable medium comprising
machine-executable code that, upon execution by one of more
computer processors, implements a method for generating a labeled
polynucleotide. The method comprises (a) subjecting a reaction
mixture to a first amplification reaction under conditions
sufficient to generate a first amplification product, wherein the
reaction mixture comprises a template polynucleotide and (i) a
primer having a sequence towards a 3' end that hybridizes to the
template polynucleotide, and (ii) a template switching
oligonucleotide that comprises a first predefined sequence towards
a 5' end; and (b) subjecting the first amplification product to a
second amplification reaction in the presence of a barcoded
oligonucleotide under conditions sufficient to generate a second
amplification product, wherein the barcoded oligonucleotide
comprises a sequence of at least a segment of the template
switching oligonucleotide and at least a second predefined
sequence, wherein (i) the second amplification reaction uses the
first amplification product as a template and the barcoded
oligonucleotide as a primer, or (ii) the second amplification
reaction uses the barcoded oligonucleotide as a template and at
least a portion of the first amplification product as a primer, to
generate the second amplification product, wherein the first
amplification reaction and the second amplification reaction are
performed within a same reaction volume.
[0058] Additional aspects and advantages of the present disclosure
will become readily apparent to those skilled in this art from the
following detailed description, wherein only illustrative
embodiments of the present disclosure are shown and described. As
will be realized, the present disclosure is capable of other and
different embodiments, and its several details are capable of
modifications in various obvious respects, all without departing
from the disclosure. Accordingly, the drawings and description are
to be regarded as illustrative in nature, and not as
restrictive.
INCORPORATION BY REFERENCE
[0059] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0060] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings (also "Figure" and
"FIG." herein), of which:
[0061] FIG. 1 schematically illustrates a microfluidic channel
structure for partitioning individual or small groups of cells.
[0062] FIG. 2 schematically illustrates a microfluidic channel
structure for co-partitioning cells and microcapsules (e.g., beads)
comprising additional reagents.
[0063] FIG. 3 schematically illustrates an example process for
amplification and barcoding of cell's nucleic acids.
[0064] FIG. 4 provides a schematic illustration of use of barcoding
of cell's nucleic acids in attributing sequence data to individual
cells or groups of cells for use in their characterization.
[0065] FIG. 5 provides a schematic illustration of cells associated
with labeled cell-binding ligands.
[0066] FIG. 6 provides a schematic illustration of an example
workflow for performing RNA analysis using the methods described
herein.
[0067] FIG. 7 provides a schematic illustration of an example
barcoded oligonucleotide structure for use in analysis of
ribonucleic (RNA) using the methods described herein.
[0068] FIG. 8 provides an image of individual cells co-partitioned
along with individual barcode bearing beads.
[0069] FIGS. 9A-9E provide schematic illustration of example
barcoded oligonucleotide structures for use in analysis of RNA and
example operations for performing RNA analysis. FIG. 9A discloses
SEQ ID NOS 167 and 167, respectively, in order of appearance. FIG.
9B discloses SEQ ID NOS 167, 167 and 167, respectively, in order of
appearance. FIG. 9C discloses SEQ ID NOS 167 and 167, respectively,
in order of appearance. FIG. 9D discloses SEQ ID NOS 167 and 167,
respectively, in order of appearance. FIG. 9E discloses SEQ ID NOS
167 and 167, respectively, in order of appearance.
[0070] FIG. 10 provides schematic illustration of example barcoded
oligonucleotide structure for use in example analysis of RNA and
use of a sequence for in vitro transcription. FIG. 10 discloses SEQ
ID NOS 167 and 167, respectively, in order of appearance.
[0071] FIG. 11 provides schematic illustration of an example
barcoded oligonucleotide structure for use in analysis of RNA and
example operations for performing RNA analysis. FIG. 11 discloses
SEQ ID NOS 168-169 and 168-169, respectively, in order of
appearance.
[0072] FIGS. 12A-12B provide schematic illustrations of example
barcoded oligonucleotide structure for use in analysis of RNA.
[0073] FIGS. 13A-13C provide illustrations of example yields from
template switch reverse transcription and PCR in partitions.
[0074] FIGS. 14A-14B provide illustrations of example yields from
reverse transcription and complementary deoxyribonucleic acid
(cDNA) amplification in partitions with various cell numbers.
[0075] FIG. 15 provides an illustration of example yields from cDNA
synthesis and real-time quantitative PCR at various input cell
concentrations and also the effect of varying primer concentration
on yield at a fixed cell input concentration.
[0076] FIG. 16 provides an illustration of example yields from in
vitro transcription.
[0077] FIG. 17 shows an example computer control system that is
programmed or otherwise configured to implement methods provided
herein.
[0078] FIG. 18 provides a schematic illustration of an example
barcoded oligonucleotide structure.
[0079] FIGS. 19A and 19B show example operations for performing RNA
analysis. FIG. 19A discloses SEQ ID NOS 167, 167 and 167,
respectively, in order of appearance. FIG. 19B discloses SEQ ID NOS
168-169, 168-169, 169, 169 and 169, respectively, in order of
appearance.
[0080] FIG. 20 shows a schematic for enriching VDJ sequences from
immune molecules such as TCRs, BCRs, and immunoglobulins. FIG. 20
discloses SEQ ID NOS 167 and 167, respectively, in order of
appearance.
[0081] FIGS. 21A-21C show enrichment of target sequences (A) after
cDNA amplification, [0082] (B) after enrichment, and (C) after
sequencing library preparation.
[0083] FIG. 22 shows cDNA yields from 12,000; 6,000; or 3,000 cells
using gel-beads in an emulsion-reverse transcription reaction
(GEM-RT).
[0084] FIG. 23 shows sequencing results from cDNA that has been
enriched using constant region primers compared to unenriched
cDNA.
[0085] FIG. 24 shows cDNA yields using differing concentrations of
a template switch oligo (TSO) were tested.
[0086] FIGS. 25A and 25B show cDNA yields from TSO immobilized to
gel beads (GB-TSO) using either 6,000 primary T cells (A) or 2,200
Jurkat cells (B).
[0087] FIGS. 26A and 26B show cDNA yields from an enrichment using
an in solution RT reaction (A) or a GEM RT reaction (B) using
nested enrichment primers.
[0088] FIGS. 27A-27C show enrichment of TCR cDNA using p7 primers
only (A), variable region primers with TCR beta chain constant
region primers (B), and variable region primers with TCR alpha
chain constant region primers (C).
[0089] FIGS. 28A-28D show a comparison of enriched product
generated with either 8 .mu.M or 200 .mu.M TSO gel beads using P7
primers with TCR alpha chain constant region primers (A), variable
region primers with TCR beta chain constant region primers (B),
variable region primers with TCR alpha chain constant region
primers (C), and variable region primers with TCR beta chain
constant region primers (D).
[0090] FIGS. 29A and 29B show variations of a schematic for
generating labeled polynucleotides. FIG. 29A discloses SEQ ID NOS
170, 170, 170, 170 and 170, respectively, in order of
appearance.
DETAILED DESCRIPTION
[0091] While various embodiments of the invention have been shown
and described herein, it will be obvious to those skilled in the
art that such embodiments are provided by way of example only.
Numerous variations, changes, and substitutions may occur to those
skilled in the art without departing from the invention. It should
be understood that various alternatives to the embodiments of the
invention described herein may be employed.
[0092] Where values are described as ranges, it will be understood
that such disclosure includes the disclosure of all possible
sub-ranges within such ranges, as well as specific numerical values
that fall within such ranges irrespective of whether a specific
numerical value or specific sub-range is expressly stated.
[0093] The term "barcode," as used herein, generally refers to a
label, or identifier, that can be part of an analyte to convey
information about the analyte. A barcode can be a tag attached to
an analyte (e.g., nucleic acid molecule) or a combination of the
tag in addition to an endogenous characteristic of the analyte
(e.g., size of the analyte or end sequence(s)). The barcode may be
unique. Barcodes can have a variety of different formats, for
example, barcodes can include: polynucleotide barcodes; random
nucleic acid and/or amino acid sequences; and synthetic nucleic
acid and/or amino acid sequences. A barcode can be attached to an
analyte in a reversible or irreversible manner. The barcode can be
added to, for example, a fragment of a deoxyribonucleic acid (DNA)
or ribonucleic acid (RNA) sample before, during, and/or after
sequencing of the sample. Barcodes can allow for identification
and/or quantification of individual sequencing-reads in real time.
In some examples, the barcode is generated in a combinatorial
manner. Barcodes that may be used with methods, devices and systems
of the present disclosure, including methods for forming such
barcodes, are described in, for example, U.S. Patent Pub. No.
2014/0378350, which is entirely incorporated herein by
reference.
[0094] The term "subject," as used herein, generally refers to an
animal, such as a mammalian species (e.g., human) or avian (e.g.,
bird) species, or other organism, such as a plant. The subject can
be a vertebrate, a mammal, a mouse, a primate, a simian or a human.
Animals may include, but are not limited to, farm animals, sport
animals, and pets. A subject can be a healthy individual, an
individual that has or is suspected of having a disease or a
pre-disposition to the disease, or an individual that is in need of
therapy or suspected of needing therapy. A subject can be a
patient.
[0095] The term "genome," as used herein, generally refers to an
entirety of a subject's hereditary information. A genome can be
encoded either in DNA or in RNA. A genome can comprise coding
regions that code for proteins as well as non-coding regions. A
genome can include the sequence of all chromosomes together in an
organism. For example, the human genome has a total of 46
chromosomes. The sequence of all of these together may constitute a
human genome.
[0096] The terms "adaptor(s)", "adapter(s)" and "tag(s)" may be
used synonymously. An adaptor or tag can be coupled to a
polynucleotide sequence to be "tagged" by any approach including
ligation, hybridization, or other approaches.
[0097] The term "sequencing," as used herein, generally refers to
methods and technologies for determining the sequence of nucleotide
bases in one or more polynucleotides. The polynucleotides can be,
for example, deoxyribonucleic acid (DNA) or ribonucleic acid (RNA),
including variants or derivatives thereof (e.g., single stranded
DNA). Sequencing can be performed by various systems currently
available, such as, with limitation, a sequencing system by
Illumina, Pacific Biosciences, Oxford Nanopore, or Life
Technologies (Ion Torrent). Such devices may provide a plurality of
raw genetic data corresponding to the genetic information of a
subject (e.g., human), as generated by the device from a sample
provided by the subject. In some situations, systems and methods
provided herein may be used with proteomic information.
[0098] The term "variant," as used herein, generally refers to a
genetic variant, such as a nucleic acid molecule comprising a
polymorphism. A variant can be a structural variant or copy number
variant, which can be genomic variants that are larger than single
nucleotide variants or short indels. A variant can be an alteration
or polymorphism in a nucleic acid sample or genome of a subject.
Single nucleotide polymorphisms (SNPs) are a form of polymorphisms.
Polymorphisms can include single nucleotide variations (SNVs),
insertions, deletions, repeats, small insertions, small deletions,
small repeats, structural variant junctions, variable length tandem
repeats, and/or flanking sequences. Copy number variants (CNVs),
transversions and other rearrangements are also forms of genetic
variation. A genomic alternation may be a base change, insertion,
deletion, repeat, copy number variation, or transversion.
[0099] The term "bead," as used herein, generally refers to a
particle. The bead may be a solid or semi-solid particle. The bead
may be a gel. The bead may be formed of a polymeric material. The
bead may be magnetic or non-magnetic.
[0100] The term "sample," as used herein, generally refers to a
biological sample of a subject. The sample may be a tissue sample,
such as a biopsy, core biopsy, needle aspirate, or fine needle
aspirate. The sample may be a fluid sample, such as a blood sample,
urine sample, or saliva sample. The sample may be a skin sample.
The sample may be a cheek swap. The sample may be a plasma or serum
sample. The sample may be a cell-free or cell free sample. A
cell-free sample may include extracellular polynucleotides.
Extracellular polynucleotides may be isolated from a bodily sample
that may be selected from a group consisting of blood, plasma,
serum, urine, saliva, mucosal excretions, sputum, stool and
tears.
[0101] The term "primer," as used herein generally refers to a
strand of RNA or DNA that serves as a starting point for nucleic
acid (e.g., DNA) synthesis. A primer may be used in a primer
extension reaction, which may be a nucleic acid amplification
reaction, such as, for example, polymerase chain reaction (PCR) or
reverse transcription PCR (RT-PCR). The primer may have a sequence
that is capable of coupling to a nucleic acid molecule. Such
sequence may be complementary to the nucleic acid molecule, such as
a poly-T sequence or a predetermined sequence, or a sequence that
is otherwise capable of coupling (e.g., hybridizing) to the nucleic
acid molecule, such as a universal primer.
[0102] Nucleic acid sequencing technologies have yielded
substantial results in sequencing biological materials, including
providing substantial sequence information on individual organisms,
and relatively pure biological samples. However, these systems have
traditionally not been effective at being able to identify and
characterize cells at the single cell level.
[0103] Many nucleic acid sequencing technologies derive the nucleic
acids that they sequence from collections of cells obtained from
tissue or other samples, such as biological fluids (e.g., blood,
plasma, etc). The cells can be processed (e.g., all together) to
extract the genetic material that represents an average of the
population of cells, which can then be processed into sequencing
ready DNA libraries that are configured for a given sequencing
technology. Although often discussed in terms of DNA or nucleic
acids, the nucleic acids derived from the cells may include DNA, or
RNA, including, e.g., mRNA, total RNA, or the like, that may be
processed to produce complementary DNA (cDNA) for sequencing.
Following processing, absent a cell specific marker, attribution of
genetic material as being contributed by a subset of cells or an
individual cell may not be possible in such an ensemble
approach.
[0104] In addition to the inability to attribute characteristics to
particular subsets of cells or individual cells, such ensemble
sample preparation methods can be, from the outset, predisposed to
primarily identifying and characterizing the majority constituents
in the sample of cells, and may not be designed to pick out the
minority constituents, e.g., genetic material contributed by one
cell, a few cells, or a small percentage of total cells in the
sample. Likewise, where analyzing expression levels, e.g., of mRNA,
an ensemble approach can be predisposed to presenting potentially
inaccurate data from cell populations that are non-homogeneous in
terms of expression levels. In some cases, where expression is high
in a small minority of the cells in an analyzed population, and
absent in the majority of the cells of the population, an ensemble
method may indicate low level expression for the entire
population.
[0105] These inaccuracies can be further magnified through
processing operations used in generating the sequencing libraries
from these samples. In particular, many next generation sequencing
technologies (e.g., massively parallel sequencing) may rely upon
the geometric amplification of nucleic acid fragments, such as via
polymerase chain reaction, in order to produce sufficient DNA for
the sequencing library. However, such amplification can be biased
toward amplification of majority constituents in a sample, and may
not preserve the starting ratios of such minority and majority
components. While some of these difficulties may be addressed by
utilizing different sequencing systems, such as single molecule
systems that do not require amplification, the single molecule
systems, as well as the ensemble sequencing methods of other next
generation sequencing systems, can also have large input DNA
requirements. Some single molecule sequencing systems, for example,
can have sample input DNA requirements of from 500 nanograms (ng)
to upwards of 10 micrograms (.mu.g), which may not be obtainable
from individual cells or even small subpopulations of cells.
Likewise, other NGS systems can be optimized for starting amounts
of sample DNA in the sample of from approximately 50 ng to about 1
.mu.g.
[0106] Disclosed herein are methods and systems for characterizing
nucleic acids from small populations of cells, and in some cases,
for characterizing nucleic acids from individual cells. The methods
described herein may compartmentalize the analysis of individual
cells or small populations of cells, including e.g., nucleic acids
from individual cells or small groups of cells, and then allow that
analysis to be attributed back to the individual cell or small
group of cells from which the nucleic acids were derived. This can
be accomplished regardless of whether the cell population
represents a 50/50 mix of cell types, a 90/10 mix of cell types, or
virtually any ratio of cell types, as well as a complete
heterogeneous mix of different cell types, or any mixture between
these. Differing cell types may include cells from different tissue
types of an individual or the same tissue type from different
individuals, or biological organisms such as microorganisms from
differing genera, species, strains, variants, or any combination of
any or all of the foregoing. For example, differing cell types may
include normal and tumor tissue from an individual, various cell
types obtained from a human subject such as a variety of immune
cells (e.g., B cells, T cells, and the like), multiple different
bacterial species, strains and/or variants from environmental,
forensic, microbiome or other samples, or any of a variety of other
mixtures of cell types.
[0107] Methods and systems described herein may provide for the
compartmentalization, depositing or partitioning of the nucleic
acid contents of individual cells from a sample material containing
cells, into discrete compartments or partitions (referred to
interchangeably herein as partitions), where each partition
maintains separation of its own contents from the contents of other
partitions. In some examples, a partition is a droplet or well.
Unique identifiers, e.g., barcodes, may be previously, subsequently
or concurrently delivered to the partitions that hold the
compartmentalized or partitioned cells or cellular derivatives, in
order to allow for the later attribution of the characteristics of
the individual cells to the particular compartment. Barcodes may be
delivered, for example in an oligonucleotide to a partition via any
suitable mechanism, such as using beads (e.g., gel beads). In some
examples, cellular derivatives, such as cells or constituents of
such cells in matrix (e.g., gel or polymeric matrix), are
compartmentalized or partitioned in partitions (e.g., droplets or
wells).
[0108] In some embodiments, barcoded oligonucleotides are delivered
to a partition via a microcapsule. In some cases, barcoded
oligonucleotides are initially associated with the microcapsule and
then released from the microcapsule upon application of a stimulus
which allows the oligonucleotides to dissociate or to be released
from the microcapsule.
[0109] A microcapsule, in some embodiments, comprises a bead. In
some embodiments, a bead may be porous, non-porous, solid,
semi-solid, semi-fluidic, or fluidic. In some embodiments, a bead
may be dissolvable, disruptable, or degradable. In some cases, a
bead may not be degradable. In some embodiments, the bead may be a
gel bead. A gel bead may be a hydrogel bead. A gel bead may be
formed from molecular precursors, such as a polymeric or monomeric
species. A semi-solid bead may be a liposomal bead. Solid beads may
comprise metals including iron oxide, gold, and silver. In some
cases, the beads are silica beads. In some cases, the beads are
rigid. In some cases, the beads may be flexible and/or
compressible.
[0110] In some embodiments, the bead may contain molecular
precursors (e.g., monomers or polymers), which may form a polymer
network via polymerization of the precursors. In some cases, a
precursor may be an already polymerized species capable of
undergoing further polymerization via, for example, a chemical
cross-linkage. In some cases, a precursor comprises one or more of
an acrylamide or a methacrylamide monomer, oligomer, or polymer. In
some cases, the bead may comprise prepolymers, which are oligomers
capable of further polymerization. For example, polyurethane beads
may be prepared using prepolymers. In some cases, the bead may
contain individual polymers that may be further polymerized
together. In some cases, beads may be generated via polymerization
of different precursors, such that they comprise mixed polymers,
co-polymers, and/or block co-polymers.
[0111] A bead may comprise natural and/or synthetic materials. For
example, a polymer can be a natural polymer or a synthetic polymer.
In some cases, a bead comprises both natural and synthetic
polymers. Examples of natural polymers include proteins and sugars
such as deoxyribonucleic acid, rubber, cellulose, starch (e.g.,
amylose, amylopectin), proteins, enzymes, polysaccharides, silks,
polyhydroxyalkanoates, chitosan, dextran, collagen, carrageenan,
ispaghula, acacia, agar, gelatin, shellac, sterculia gum, xanthan
gum, Corn sugar gum, guar gum, gum karaya, agarose, alginic acid,
alginate, or natural polymers thereof. Examples of synthetic
polymers include acrylics, nylons, silicones, spandex, viscose
rayon, polycarboxylic acids, polyvinyl acetate, polyacrylamide,
polyacrylate, polyethylene glycol, polyurethanes, polylactic acid,
silica, polystyrene, polyacrylonitrile, polybutadiene,
polycarbonate, polyethylene, polyethylene terephthalate,
poly(chlorotrifluoroethylene), poly(ethylene oxide), poly(ethylene
terephthalate), polyethylene, polyisobutylene, poly(methyl
methacrylate), poly(oxymethylene), polyformaldehyde, polypropylene,
polystyrene, poly(tetrafluoroethylene), poly(vinyl acetate),
poly(vinyl alcohol), poly(vinyl chloride), poly(vinylidene
dichloride), poly(vinylidene difluoride), poly(vinyl fluoride) and
combinations (e.g., co-polymers) thereof. Beads may also be formed
from materials other than polymers, including lipids, micelles,
ceramics, glass-ceramics, material composites, metals, other
inorganic materials, and others.
[0112] In some cases, a chemical cross-linker may be a precursor
used to cross-link monomers during polymerization of the monomers
and/or may be used to attach oligonucleotides (e.g., barcoded
oligonucleotides) to the bead. In some cases, polymers may be
further polymerized with a cross-linker species or other type of
monomer to generate a further polymeric network. Non-limiting
examples of chemical cross-linkers (also referred to as a
"crosslinker" or a "crosslinker agent" herein) include cystamine,
gluteraldehyde, dimethyl suberimidate, N-Hydroxysuccinimide
crosslinker BS3, formaldehyde, carbodiimide (EDC), SMCC,
Sulfo-SMCC, vinylsilane, N,N'diallyltartardiamide (DATD),
N,N'-Bis(acryloyl)cystamine (BAC), or homologs thereof. In some
cases, the crosslinker used in the present disclosure contains
cystamine.
[0113] Crosslinking may be permanent or reversible, depending upon
the particular crosslinker used. Reversible crosslinking may allow
for the polymer to linearize or dissociate under appropriate
conditions. In some cases, reversible cross-linking may also allow
for reversible attachment of a material bound to the surface of a
bead. In some cases, a cross-linker may form disulfide linkages. In
some cases, the chemical cross-linker forming disulfide linkages
may be cystamine or a modified cystamine.
[0114] In some embodiments, disulfide linkages can be formed
between molecular precursor units (e.g., monomers, oligomers, or
linear polymers) or precursors incorporated into a bead and
oligonucleotides. Cystamine (including modified cystamines), for
example, is an organic agent comprising a disulfide bond that may
be used as a crosslinker agent between individual monomeric or
polymeric precursors of a bead. Polyacrylamide may be polymerized
in the presence of cystamine or a species comprising cystamine
(e.g., a modified cystamine) to generate polyacrylamide gel beads
comprising disulfide linkages (e.g., chemically degradable beads
comprising chemically-reducible cross-linkers). The disulfide
linkages may permit the bead to be degraded (or dissolved) upon
exposure of the bead to a reducing agent.
[0115] In some embodiments, chitosan, a linear polysaccharide
polymer, may be crosslinked with glutaraldehyde via hydrophilic
chains to form a bead. Crosslinking of chitosan polymers may be
achieved by chemical reactions that are initiated by heat,
pressure, change in pH, and/or radiation.
[0116] In some embodiments, the bead may comprise covalent or ionic
bonds between polymeric precursors (e.g., monomers, oligomers,
linear polymers), oligonucleotides, primers, and other entities. In
some cases, the covalent bonds comprise carbon-carbon bonds or
thioether bonds.
[0117] In some cases, a bead may comprise an acrydite moiety, which
in certain aspects may be used to attach one or more
oligonucleotides (e.g., barcode sequence, barcoded oligonucleotide,
primer, or other oligonucleotide) to the bead. In some cases, an
acrydite moiety can refer to an acrydite analogue generated from
the reaction of acrydite with one or more species, such as, the
reaction of acrydite with other monomers and cross-linkers during a
polymerization reaction. Acrydite moieties may be modified to form
chemical bonds with a species to be attached, such as an
oligonucleotide (e.g., barcode sequence, barcoded oligonucleotide,
primer, or other oligonucleotide). Acrydite moieties may be
modified with thiol groups capable of forming a disulfide bond or
may be modified with groups already comprising a disulfide bond.
The thiol or disulfide (via disulfide exchange) may be used as an
anchor point for a species to be attached or another part of the
acrydite moiety may be used for attachment. In some cases,
attachment is reversible, such that when the disulfide bond is
broken (e.g., in the presence of a reducing agent), the attached
species is released from the bead. In other cases, an acrydite
moiety comprises a reactive hydroxyl group that may be used for
attachment.
[0118] Functionalization of beads for attachment of
oligonucleotides may be achieved through a wide range of different
approaches, including activation of chemical groups within a
polymer, incorporation of active or activatable functional groups
in the polymer structure, or attachment at the pre-polymer or
monomer stage in bead production.
[0119] For example, precursors (e.g., monomers, cross-linkers) that
are polymerized to form a bead may comprise acrydite moieties, such
that when a bead is generated, the bead also comprises acrydite
moieties. The acrydite moieties can be attached to an
oligonucleotide, such as a primer (e.g., a primer for amplifying
target nucleic acids, barcoded oligonucleotide, etc) that is
desired to be incorporated into the bead. In some cases, the primer
comprises a P5 sequence for attachment to a sequencing flow cell
for Illumina sequencing. In some cases, the primer comprises a P7
sequence for attachment to a sequencing flow cell for Illumina
sequencing. In some cases, the primer comprises a barcode sequence.
In some cases, the primer further comprises a unique molecular
identifier (UMI). In some cases, the primer comprises an R1 primer
sequence for Illumina sequencing. In some cases, the primer
comprises an R2 primer sequence for Illumina sequencing.
[0120] In some cases, precursors comprising a functional group that
is reactive or capable of being activated such that it becomes
reactive can be polymerized with other precursors to generate gel
beads comprising the activated or activatable functional group. The
functional group may then be used to attach additional species
(e.g., disulfide linkers, primers, other oligonucleotides, etc.) to
the gel beads. For example, some precursors comprising a carboxylic
acid (COOH) group can co-polymerize with other precursors to form a
gel bead that also comprises a COOH functional group. In some
cases, acrylic acid (a species comprising free COOH groups),
acrylamide, and bis(acryloyl)cystamine can be co-polymerized
together to generate a gel bead comprising free COOH groups. The
COOH groups of the gel bead can be activated (e.g., via
1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and
N-Hydroxysuccinimide (NHS) or
4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride
(DMTMM)) such that they are reactive (e.g., reactive to amine
functional groups where EDC/NHS or DMTMM are used for activation).
The activated COOH groups can then react with an appropriate
species (e.g., a species comprising an amine functional group where
the carboxylic acid groups are activated to be reactive with an
amine functional group) comprising a moiety to be linked to the
bead.
[0121] Beads comprising disulfide linkages in their polymeric
network may be functionalized with additional species via reduction
of some of the disulfide linkages to free thiols. The disulfide
linkages may be reduced via, for example, the action of a reducing
agent (e.g., DTT, TCEP, etc.) to generate free thiol groups,
without dissolution of the bead. Free thiols of the beads can then
react with free thiols of a species or a species comprising another
disulfide bond (e.g., via thiol-disulfide exchange) such that the
species can be linked to the beads (e.g., via a generated disulfide
bond). In some cases, free thiols of the beads may react with any
other suitable group. For example, free thiols of the beads may
react with species comprising an acrydite moiety. The free thiol
groups of the beads can react with the acrydite via Michael
addition chemistry, such that the species comprising the acrydite
is linked to the bead. In some cases, uncontrolled reactions can be
prevented by inclusion of a thiol capping agent such as
N-ethylmalieamide or iodoacetate.
[0122] Activation of disulfide linkages within a bead can be
controlled such that only a small number of disulfide linkages are
activated. Control may be exerted, for example, by controlling the
concentration of a reducing agent used to generate free thiol
groups and/or concentration of reagents used to form disulfide
bonds in bead polymerization. In some cases, a low concentration
(e.g., molecules of reducing agent:gel bead ratios of less than
about 10,000; 100,000; 1,000,000; 10,000,000; 100,000,000;
1,000,000,000; 10,000,000,000; or 100,000,000,000) of reducing
agent may be used for reduction. Controlling the number of
disulfide linkages that are reduced to free thiols may be useful in
ensuring bead structural integrity during functionalization. In
some cases, optically-active agents, such as fluorescent dyes may
be may be coupled to beads via free thiol groups of the beads and
used to quantify the number of free thiols present in a bead and/or
track a bead.
[0123] In some cases, addition of moieties to a gel bead after gel
bead formation may be advantageous. For example, addition of an
oligonucleotide (e.g., barcoded oligonucleotide) after gel bead
formation may avoid loss of the species during chain transfer
termination that can occur during polymerization. Moreover, smaller
precursors (e.g., monomers or cross linkers that do not comprise
side chain groups and linked moieties) may be used for
polymerization and can be minimally hindered from growing chain
ends due to viscous effects. In some cases, functionalization after
gel bead synthesis can minimize exposure of species (e.g.,
oligonucleotides) to be loaded with potentially damaging agents
(e.g., free radicals) and/or chemical environments. In some cases,
the generated gel may possess an upper critical solution
temperature (UCST) that can permit temperature driven swelling and
collapse of a bead. Such functionality may aid in oligonucleotide
(e.g., a primer) infiltration into the bead during subsequent
functionalization of the bead with the oligonucleotide.
Post-production functionalization may also be useful in controlling
loading ratios of species in beads, such that, for example, the
variability in loading ratio is minimized. Species loading may also
be performed in a batch process such that a plurality of beads can
be functionalized with the species in a single batch.
[0124] In some cases, an acrydite moiety linked to precursor,
another species linked to a precursor, or a precursor itself
comprises a labile bond, such as chemically, thermally, or
photo-sensitive bonds e.g., disulfide bonds, UV sensitive bonds, or
the like. Once acrydite moieties or other moieties comprising a
labile bond are incorporated into a bead, the bead may also
comprise the labile bond. The labile bond may be, for example,
useful in reversibly linking (e.g., covalently linking) species
(e.g., barcodes, primers, etc.) to a bead. In some cases, a
thermally labile bond may include a nucleic acid hybridization
based attachment, e.g., where an oligonucleotide is hybridized to a
complementary sequence that is attached to the bead, such that
thermal melting of the hybrid releases the oligonucleotide, e.g., a
barcode containing sequence, from the bead or microcapsule.
[0125] The addition of multiple types of labile bonds to a gel bead
may result in the generation of a bead capable of responding to
varied stimuli. Each type of labile bond may be sensitive to an
associated stimulus (e.g., chemical stimulus, light, temperature,
etc.) such that release of species attached to a bead via each
labile bond may be controlled by the application of the appropriate
stimulus. Such functionality may be useful in controlled release of
species from a gel bead. In some cases, another species comprising
a labile bond may be linked to a gel bead after gel bead formation
via, for example, an activated functional group of the gel bead as
described above. As will be appreciated, barcodes that are
releasably, cleavably or reversibly attached to the beads described
herein include barcodes that are released or releasable through
cleavage of a linkage between the barcode molecule and the bead, or
that are released through degradation of the underlying bead
itself, allowing the barcodes to be accessed or accessible by other
reagents, or both.
[0126] The barcodes that are releasable as described herein may
sometimes be referred to as being activatable, in that they are
available for reaction once released. Thus, for example, an
activatable barcode may be activated by releasing the barcode from
a bead (or other suitable type of partition described herein).
Other activatable configurations are also envisioned in the context
of the described methods and systems.
[0127] In addition to thermally cleavable bonds, disulfide bonds
and UV sensitive bonds, other non-limiting examples of labile bonds
that may be coupled to a precursor or bead include an ester linkage
(e.g., cleavable with an acid, a base, or hydroxylamine), a vicinal
diol linkage (e.g., cleavable via sodium periodate), a Diels-Alder
linkage (e.g., cleavable via heat), a sulfone linkage (e.g.,
cleavable via a base), a silyl ether linkage (e.g., cleavable via
an acid), a glycosidic linkage (e.g., cleavable via an amylase), a
peptide linkage (e.g., cleavable via a protease), or a
phosphodiester linkage (e.g., cleavable via a nuclease (e.g.,
DNAase)).
[0128] Species that do not participate in polymerization may also
be encapsulated in beads during bead generation (e.g., during
polymerization of precursors). Such species may be entered into
polymerization reaction mixtures such that generated beads comprise
the species upon bead formation. In some cases, such species may be
added to the gel beads after formation. Such species may include,
for example, oligonucleotides, reagents for a nucleic acid
amplification reaction (e.g., primers, polymerases, dNTPs,
co-factors (e.g., ionic co-factors)) including those described
herein, reagents for enzymatic reactions (e.g., enzymes,
co-factors, substrates), or reagents for a nucleic acid
modification reactions such as polymerization, ligation, or
digestion. Trapping of such species may be controlled by the
polymer network density generated during polymerization of
precursors, control of ionic charge within the gel bead (e.g., via
ionic species linked to polymerized species), or by the release of
other species. Encapsulated species may be released from a bead
upon bead degradation and/or by application of a stimulus capable
of releasing the species from the bead.
[0129] Beads may be of uniform size or heterogeneous size. In some
cases, the diameter of a bead may be about 1 .mu.m, 5 .mu.m, 10
.mu.m, 20 .mu.m, 30 .mu.m, 40 .mu.m, 50 .mu.m, 60 .mu.m, 70 .mu.m,
80 .mu.m, 90 .mu.m, 100 .mu.m, 250 .mu.m, 500 .mu.m, or 1 mm. In
some cases, a bead may have a diameter of at least about 1 .mu.m, 5
.mu.m, 10 .mu.m, 20 .mu.m, 30 .mu.m, 40 .mu.m, 50 .mu.m, 60 .mu.m,
70 .mu.m, 80 .mu.m, 90 .mu.m, 100 .mu.m, 250 .mu.m, 500 .mu.m, 1
mm, or more. In some cases, a bead may have a diameter of less than
about 1 .mu.m, 5 .mu.m, 10 .mu.m, 20 .mu.m, 30 .mu.m, 40 .mu.m, 50
.mu.m, 60 .mu.m, 70 .mu.m, 80 .mu.m, 90 .mu.m, 100 .mu.m, 250
.mu.m, 500 .mu.m, or 1 mm. In some cases, a bead may have a
diameter in the range of about 40-75 .mu.m, 30-75 .mu.m, 20-75
.mu.m, 40-85 .mu.m, 40-95 .mu.m, 20-100 .mu.m, 10-100 .mu.m, 1-100
.mu.m, 20-250 .mu.m, or 20-500 .mu.m.
[0130] In certain aspects, beads are provided as a population or
plurality of beads having a relatively monodisperse size
distribution. Where it may be desirable to provide relatively
consistent amounts of reagents within partitions, maintaining
relatively consistent bead characteristics, such as size, can
contribute to the overall consistency. In particular, the beads
described herein may have size distributions that have a
coefficient of variation in their cross-sectional dimensions of
less than 50%, less than 40%, less than 30%, less than 20%, and in
some cases less than 15%, less than 10%, or even less than 5%.
[0131] Beads may be of any suitable shape. Examples of bead shapes
include, but are not limited to, spherical, non-spherical, oval,
oblong, amorphous, circular, cylindrical, and variations
thereof.
[0132] In addition to, or as an alternative to the cleavable
linkages between the beads and the associated molecules, e.g.,
barcode containing oligonucleotides, described above, the beads may
be degradable, disruptable, or dissolvable spontaneously or upon
exposure to one or more stimuli (e.g., temperature changes, pH
changes, exposure to particular chemical species or phase, exposure
to light, reducing agent, etc.). In some cases, a bead may be
dissolvable, such that material components of the beads are
solubilized when exposed to a particular chemical species or an
environmental change, such as a change temperature or a change in
pH. In some cases, a gel bead is degraded or dissolved at elevated
temperature and/or in basic conditions. In some cases, a bead may
be thermally degradable such that when the bead is exposed to an
appropriate change in temperature (e.g., heat), the bead degrades.
Degradation or dissolution of a bead bound to a species (e.g., an
oligonucleotide, e.g., barcoded oligonucleotide) may result in
release of the species from the bead.
[0133] A degradable bead may comprise one or more species with a
labile bond such that, when the bead/species is exposed to the
appropriate stimuli, the bond is broken and the bead degrades. The
labile bond may be a chemical bond (e.g., covalent bond, ionic
bond) or may be another type of physical interaction (e.g., van der
Waals interactions, dipole-dipole interactions, etc.). In some
cases, a crosslinker used to generate a bead may comprise a labile
bond. Upon exposure to the appropriate conditions, the labile bond
can be broken and the bead degraded. For example, upon exposure of
a polyacrylamide gel bead comprising cystamine crosslinkers to a
reducing agent, the disulfide bonds of the cystamine can be broken
and the bead degraded.
[0134] A degradable bead may be useful in more quickly releasing an
attached species (e.g., an oligonucleotide, a barcode sequence, a
primer, etc) from the bead when the appropriate stimulus is applied
to the bead as compared to a bead that does not degrade. For
example, for a species bound to an inner surface of a porous bead
or in the case of an encapsulated species, the species may have
greater mobility and accessibility to other species in solution
upon degradation of the bead. In some cases, a species may also be
attached to a degradable bead via a degradable linker (e.g.,
disulfide linker). The degradable linker may respond to the same
stimuli as the degradable bead or the two degradable species may
respond to different stimuli. For example, a barcode sequence may
be attached, via a disulfide bond, to a polyacrylamide bead
comprising cystamine. Upon exposure of the barcoded-bead to a
reducing agent, the bead degrades and the barcode sequence is
released upon breakage of both the disulfide linkage between the
barcode sequence and the bead and the disulfide linkages of the
cystamine in the bead.
[0135] A degradable bead may be introduced into a partition, such
as a droplet of an emulsion or a well, such that the bead degrades
within the partition and any associated species (e.g.,
oligonucleotides) are released within the droplet when the
appropriate stimulus is applied. The free species (e.g.,
oligonucleotides) may interact with other reagents contained in the
partition. For example, a polyacrylamide bead comprising cystamine
and linked, via a disulfide bond, to a barcode sequence, may be
combined with a reducing agent within a droplet of a water-in-oil
emulsion. Within the droplet, the reducing agent breaks the various
disulfide bonds resulting in bead degradation and release of the
barcode sequence into the aqueous, inner environment of the
droplet. In another example, heating of a droplet comprising a
bead-bound barcode sequence in basic solution may also result in
bead degradation and release of the attached barcode sequence into
the aqueous, inner environment of the droplet.
[0136] As will be appreciated from the above disclosure, while
referred to as degradation of a bead, in many instances as noted
above, that degradation may refer to the disassociation of a bound
or entrained species from a bead, both with and without
structurally degrading the physical bead itself. For example,
entrained species may be released from beads through osmotic
pressure differences due to, for example, changing chemical
environments. By way of example, alteration of bead pore sizes due
to osmotic pressure differences can generally occur without
structural degradation of the bead itself. In some cases, an
increase in pore size due to osmotic swelling of a bead can permit
the release of entrained species within the bead. In other cases,
osmotic shrinking of a bead may cause a bead to better retain an
entrained species due to pore size contraction.
[0137] Where degradable beads are provided, it may be desirable to
avoid exposing such beads to the stimulus or stimuli that cause
such degradation prior to the desired time, in order to avoid
premature bead degradation and issues that arise from such
degradation, including for example poor flow characteristics and
aggregation. By way of example, where beads comprise reducible
cross-linking groups, such as disulfide groups, it will be
desirable to avoid contacting such beads with reducing agents,
e.g., DTT or other disulfide cleaving reagents. In such cases,
treatment to the beads described herein will, in some cases be
provided free of reducing agents, such as DTT. Because reducing
agents are often provided in commercial enzyme preparations, it may
be desirable to provide reducing agent free (or DTT free) enzyme
preparations in treating the beads described herein. Examples of
such enzymes include, e.g., polymerase enzyme preparations, reverse
transcriptase enzyme preparations, ligase enzyme preparations, as
well as many other enzyme preparations that may be used to treat
the beads described herein. The terms "reducing agent free" or "DTT
free" preparations can refer to a preparation having less than
1/10th, less than 1/50th, and even less than 1/100th of the lower
ranges for such materials used in degrading the beads. For example,
for DTT, the reducing agent free preparation will typically have
less than 0.01 mM, 0.005 mM, 0.001 mM DTT, 0.0005 mM DTT, or even
less than 0.0001 mM DTT. In many cases, the amount of DTT will be
undetectable.
[0138] In some cases, a stimulus may be used to trigger degradation
of the bead, which may result in the release of contents from the
bead. Generally, a stimulus may cause degradation of the bead
structure, such as degradation of the covalent bonds or other types
of physical interaction. These stimuli may be useful in inducing a
bead to degrade and/or to release its contents. Examples of stimuli
that may be used include chemical stimuli, thermal stimuli, optical
stimuli (e.g., light) and any combination thereof, as described
more fully below.
[0139] Numerous chemical triggers may be used to trigger the
degradation of beads. Examples of these chemical changes may
include, but are not limited to pH-mediated changes to the
integrity of a component within the bead, degradation of a
component of a bead via cleavage of cross-linked bonds, and
depolymerization of a component of a bead.
[0140] In some embodiments, a bead may be formed from materials
that comprise degradable chemical crosslinkers, such as BAC or
cystamine. Degradation of such degradable crosslinkers may be
accomplished through a number of mechanisms. In some examples, a
bead may be contacted with a chemical degrading agent that may
induce oxidation, reduction or other chemical changes. For example,
a chemical degrading agent may be a reducing agent, such as
dithiothreitol (DTT). Additional examples of reducing agents may
include .beta.-mercaptoethanol, (2S)-2-amino-1,4-dimercaptobutane
(dithiobutylamine or DTBA), tris(2-carboxyethyl) phosphine (TCEP),
or combinations thereof. A reducing agent may degrade the disulfide
bonds formed between gel precursors forming the bead, and thus,
degrade the bead. In other cases, a change in pH of a solution,
such as an increase in pH, may trigger degradation of a bead. In
other cases, exposure to an aqueous solution, such as water, may
trigger hydrolytic degradation, and thus degradation of the
bead.
[0141] Beads may also be induced to release their contents upon the
application of a thermal stimulus. A change in temperature can
cause a variety of changes to a bead. For example, heat can cause a
solid bead to liquefy. A change in heat may cause melting of a bead
such that a portion of the bead degrades. In other cases, heat may
increase the internal pressure of the bead components such that the
bead ruptures or explodes. Heat may also act upon heat-sensitive
polymers used as materials to construct beads.
[0142] The methods, compositions, devices, and kits of this
disclosure may be used with any suitable agent to degrade beads. In
some embodiments, changes in temperature or pH may be used to
degrade thermo-sensitive or pH-sensitive bonds within beads. In
some embodiments, chemical degrading agents may be used to degrade
chemical bonds within beads by oxidation, reduction or other
chemical changes. For example, a chemical degrading agent may be a
reducing agent, such as DTT, wherein DTT may degrade the disulfide
bonds formed between a crosslinker and gel precursors, thus
degrading the bead. In some embodiments, a reducing agent may be
added to degrade the bead, which may or may not cause the bead to
release its contents. Examples of reducing agents may include
dithiothreitol (DTT), .beta.-mercaptoethanol,
(2S)-2-amino-1,4-dimercaptobutane (dithiobutylamine or DTBA),
tris(2-carboxyethyl) phosphine (TCEP), or combinations thereof. The
reducing agent may be present at a concentration of about 0.1 mM,
0.5 mM, 1 mM, 5 mM, or 10 mM. The reducing agent may be present at
a concentration of at least about 0.1 mM, 0.5 mM, 1 mM, 5 mM, 10
mM, or greater. The reducing agent may be present at concentration
of at most about 0.1 mM, 0.5 mM, 1 mM, 5 mM, or 10 mM.
[0143] Any suitable number of nucleic acid molecules (e.g., primer,
e.g., barcoded oligonucleotide) can be associated with a bead such
that, upon release from the bead, the nucleic acid molecules (e.g.,
primer, e.g., barcoded oligonucleotide) are present in the
partition at a pre-defined concentration. Such pre-defined
concentration may be selected to facilitate certain reactions for
generating a sequencing library, e.g., amplification, within the
partition. In some cases, the pre-defined concentration of the
primer is limited by the process of producing oligonucleotide
bearing beads.
[0144] In some aspects, the partitions refer to containers or
vessels (such as wells, microwells, tubes, vials, through ports in
nanoarray substrates, e.g., BioTrove nanoarrays, or other
containers). In some aspects, the compartments or partitions
comprise partitions that are flowable within fluid streams. These
partitions may comprise, e.g., micro-vesicles that have an outer
barrier surrounding an inner fluid center or core, or, in some
cases, they may comprise a porous matrix that is capable of
entraining and/or retaining materials within its matrix. In some
aspects, partitions comprise droplets of aqueous fluid within a
non-aqueous continuous phase, e.g., an oil phase. A variety of
different vessels are described in, for example, U.S. Patent
Application Publication No. 20140155295, the full disclosure of
which is incorporated herein by reference in its entirety for all
purposes. Emulsion systems for creating stable droplets in
non-aqueous or oil continuous phases are described in detail in,
e.g., U.S. Patent Application Publication No. 20100105112, the full
disclosure of which is incorporated herein by reference in its
entirety for all purposes.
[0145] In the case of droplets in an emulsion, allocating
individual cells to discrete partitions may generally be
accomplished by introducing a flowing stream of cells in an aqueous
fluid into a flowing stream of a non-aqueous fluid, such that
droplets are generated at the junction of the two streams. By
providing the aqueous cell-containing stream at a certain
concentration of cells, the occupancy of the resulting partitions
(e.g., number of cells per partition) can be controlled. Where
single cell partitions are desired, the relative flow rates of the
fluids can be selected such that, on average, the partitions
contain less than one cell per partition, in order to ensure that
those partitions that are occupied, are primarily singly occupied.
In some embodiments, the relative flow rates of the fluids can be
selected such that a majority of partitions are occupied, e.g.,
allowing for only a small percentage of unoccupied partitions. In
some aspects, the flows and channel architectures are controlled as
to ensure a desired number of singly occupied partitions, less than
a certain level of unoccupied partitions and less than a certain
level of multiply occupied partitions.
[0146] The systems and methods described herein can be operated
such that a majority of occupied partitions include no more than
one cell per occupied partition. In some cases, the partitioning
process is conducted such that fewer than 25% of the occupied
partitions contain more than one cell, and in many cases, fewer
than 20% of the occupied partitions have more than one cell. In
some cases, fewer than 10% or even fewer than 5% of the occupied
partitions include more than one cell per partition.
[0147] In some cases, it is desirable to avoid the creation of
excessive numbers of empty partitions. For example, from a cost
perspective and/or efficiency perspective, it may desirable to
minimize the number of empty partitions. While this may be
accomplished by providing sufficient numbers of cells into the
partitioning zone, the Poissonian distribution may expectedly
increase the number of partitions that may include multiple cells.
As such, in accordance with aspects described herein, the flow of
one or more of the cells, or other fluids directed into the
partitioning zone are conducted such that, in many cases, no more
than 50% of the generated partitions, no more than 25% of the
generated partitions, or no more than 10% of the generated
partitions are unoccupied. Further, in some aspects, these flows
are controlled so as to present non-Poissonian distribution of
single occupied partitions while providing lower levels of
unoccupied partitions. Restated, in some aspects, the above noted
ranges of unoccupied partitions can be achieved while still
providing any of the single occupancy rates described above. For
example, in many cases, the use of the systems and methods
described herein creates resulting partitions that have multiple
occupancy rates of less than 25%, less than 20%, less than 15%,
less than 10%, and in many cases, less than 5%, while having
unoccupied partitions of less than 50%, less than 40%, less than
30%, less than 20%, less than 10%, and in some cases, less than
5%.
[0148] As will be appreciated, the above-described occupancy rates
are also applicable to partitions that include both cells and
additional reagents, including, but not limited to, microcapsules
carrying barcoded oligonucleotides. In some aspects, a substantial
percentage of the overall occupied partitions can include both a
microcapsule (e.g., bead) comprising barcoded oligonucleotides and
a cell.
[0149] Although described in terms of providing substantially
singly occupied partitions, above, in certain cases, it is
desirable to provide multiply occupied partitions, e.g., containing
two, three, four or more cells and/or microcapsules (e.g., beads)
comprising barcoded oligonucleotides within a single partition.
Accordingly, as noted above, the flow characteristics of the cell
and/or bead containing fluids and partitioning fluids may be
controlled to provide for such multiply occupied partitions. In
particular, the flow parameters may be controlled to provide a
desired occupancy rate at greater than 50% of the partitions,
greater than 75%, and in some cases greater than 80%, 90%, 95%, or
higher.
[0150] In some cases, additional microcapsules are used to deliver
additional reagents to a partition. In such cases, it may be
advantageous to introduce different beads into a common channel or
droplet generation junction, from different bead sources, i.e.,
containing different associated reagents, through different channel
inlets into such common channel or droplet generation junction. In
such cases, the flow and frequency of the different beads into the
channel or junction may be controlled to provide for the desired
ratio of microcapsules from each source, while ensuring the desired
pairing or combination of such beads into a partition with the
desired number of cells.
[0151] The partitions described herein may comprise small volumes,
e.g., less than 10 .mu.L, less than 54, less than 14, less than 900
picoliters (pL), less than 800 pL, less than 700 pL, less than 600
pL, less than 500 pL, less than 400 pL, less than 300 pL, less than
200 pL, less than 100 pL, less than 50 pL, less than 20 pL, less
than 10 pL, less than 1 pL, less than 500 nanoliters (nL), or even
less than 100 nL, 50 nL, or even less.
[0152] For example, in the case of droplet based partitions, the
droplets may have overall volumes that are less than 1000 pL, less
than 900 pL, less than 800 pL, less than 700 pL, less than 600 pL,
less than 500 pL, less than 400 pL, less than 300 pL, less than 200
pL, less than 100 pL, less than 50 pL, less than 20 pL, less than
10 pL, or even less than 1 pL. Where co-partitioned with
microcapsules, it will be appreciated that the sample fluid volume,
e.g., including co-partitioned cells, within the partitions may be
less than 90% of the above described volumes, less than 80%, less
than 70%, less than 60%, less than 50%, less than 40%, less than
30%, less than 20%, or even less than 10% the above described
volumes.
[0153] As is described elsewhere herein, partitioning species may
generate a population or plurality of partitions. In such cases,
any suitable number of partitions can be generated to generate the
plurality of partitions. For example, in a method described herein,
a plurality of partitions may be generated that comprises at least
about 1,000 partitions, at least about 5,000 partitions, at least
about 10,000 partitions, at least about 50,000 partitions, at least
about 100,000 partitions, at least about 500,000 partitions, at
least about 1,000,000 partitions, at least about 5,000,000
partitions at least about 10,000,000 partitions, at least about
50,000,000 partitions, at least about 100,000,000 partitions, at
least about 500,000,000 partitions or at least about 1,000,000,000
partitions. Moreover, the plurality of partitions may comprise both
unoccupied partitions (e.g., empty partitions) and occupied
partitions
[0154] Microfluidic channel networks can be utilized to generate
partitions as described herein. Alternative mechanisms may also be
employed in the partitioning of individual cells, including porous
membranes through which aqueous mixtures of cells are extruded into
non-aqueous fluids.
[0155] An example of a simplified microfluidic channel structure
for partitioning individual cells is illustrated in FIG. 1. As
described elsewhere herein, in some cases, the majority of occupied
partitions include no more than one cell per occupied partition
and, in some cases, some of the generated partitions are
unoccupied. In some cases, though, some of the occupied partitions
may include more than one cell. In some cases, the partitioning
process may be controlled such that fewer than 25% of the occupied
partitions contain more than one cell, and in many cases, fewer
than 20% of the occupied partitions have more than one cell, while
in some cases, fewer than 10% or even fewer than 5% of the occupied
partitions include more than one cell per partition. As shown, the
channel structure can include channel segments 102, 104, 106 and
108 communicating at a channel junction 110. In operation, a first
aqueous fluid 112 that includes suspended cells 114, may be
transported along channel segment 102 into junction 110, while a
second fluid 116 that is immiscible with the aqueous fluid 112 is
delivered to the junction 110 from channel segments 104 and 106 to
create discrete droplets 118 of the aqueous fluid including
individual cells 114, flowing into channel segment 108.
[0156] In some aspects, this second fluid 116 comprises an oil,
such as a fluorinated oil, that includes a fluorosurfactant for
stabilizing the resulting droplets, e.g., inhibiting subsequent
coalescence of the resulting droplets. Examples of particularly
useful partitioning fluids and fluorosurfactants are described for
example, in U.S. Patent Application Publication No. 20100105112,
the full disclosure of which is hereby incorporated herein by
reference in its entirety for all purposes.
[0157] In other aspects, in addition to or as an alternative to
droplet based partitioning, cells may be encapsulated within a
microcapsule that comprises an outer shell or layer or porous
matrix in which is entrained one or more individual cells or small
groups of cells, and may include other reagents. Encapsulation of
cells may be carried out by a variety of processes. Such processes
combine an aqueous fluid containing the cells to be analyzed with a
polymeric precursor material that may be capable of being formed
into a gel or other solid or semi-solid matrix upon application of
a particular stimulus to the polymer precursor. Such stimuli
include, e.g., thermal stimuli (either heating or cooling),
photo-stimuli (e.g., through photo-curing), chemical stimuli (e.g.,
through crosslinking, polymerization initiation of the precursor
(e.g., through added initiators), or the like.
[0158] Preparation of microcapsules comprising cells may be carried
out by a variety of methods. For example, air knife droplet or
aerosol generators may be used to dispense droplets of precursor
fluids into gelling solutions in order to form microcapsules that
include individual cells or small groups of cells. Likewise,
membrane based encapsulation systems may be used to generate
microcapsules comprising encapsulated cells as described herein. In
some aspects, microfluidic systems like that shown in FIG. 1 may be
readily used in encapsulating cells as described herein. In
particular, and with reference to FIG. 1, the aqueous fluid
comprising the cells and the polymer precursor material is flowed
into channel junction 110, where it is partitioned into droplets
118 comprising the individual cells 114, through the flow of
non-aqueous fluid 116. In the case of encapsulation methods,
non-aqueous fluid 116 may also include an initiator to cause
polymerization and/or crosslinking of the polymer precursor to form
the microcapsule that includes the entrained cells. Examples of
polymer precursor/initiator pairs include those described in U.S.
Patent Application Publication No. 20140378345, the full disclosure
of which are hereby incorporated herein by reference in their
entireties for all purposes.
[0159] For example, in the case where the polymer precursor
material comprises a linear polymer material, e.g., a linear
polyacrylamide, PEG, or other linear polymeric material, the
activation agent may comprise a cross-linking agent, or a chemical
that activates a cross-linking agent within the formed droplets.
Likewise, for polymer precursors that comprise polymerizable
monomers, the activation agent may comprise a polymerization
initiator. For example, in certain cases, where the polymer
precursor comprises a mixture of acrylamide monomer with a
N,N'-bis-(acryloyl)cystamine (BAC) comonomer, an agent such as
tetraethylmethylenediamine (TEMED) may be provided within the
second fluid streams in channel segments 104 and 106, which
initiates the copolymerization of the acrylamide and BAC into a
cross-linked polymer network or, hydrogel.
[0160] Upon contact of the second fluid stream 116 with the first
fluid stream 112 at junction 110 in the formation of droplets, the
TEMED may diffuse from the second fluid 116 into the aqueous first
fluid 112 comprising the linear polyacrylamide, which will activate
the crosslinking of the polyacrylamide within the droplets,
resulting in the formation of the gel, e.g., hydrogel,
microcapsules 118, as solid or semi-solid beads or particles
entraining the cells 114. Although described in terms of
polyacrylamide encapsulation, other `activatable` encapsulation
compositions may also be employed in the context of the methods and
compositions described herein. For example, formation of alginate
droplets followed by exposure to divalent metal ions, e.g., Ca2+,
can be used as an encapsulation process using the described
processes. Likewise, agarose droplets may also be transformed into
capsules through temperature based gelling, e.g., upon cooling, or
the like. In some cases, encapsulated cells can be selectively
releasable from the microcapsule, e.g., through passage of time, or
upon application of a particular stimulus, that degrades the
microcapsule sufficiently to allow the cell, or its contents to be
released from the microcapsule, e.g., into a partition, such as a
droplet. For example, in the case of the polyacrylamide polymer
described above, degradation of the microcapsule may be
accomplished through the introduction of an appropriate reducing
agent, such as DTT or the like, to cleave disulfide bonds that
cross link the polymer matrix (See, e.g., U.S. Patent Application
Publication No. 20140378345, the full disclosures of which are
hereby incorporated herein by reference in their entirety for all
purposes.
[0161] Encapsulated cells or cell populations provide certain
potential advantages of being storable, and more portable than
droplet based partitioned cells. Furthermore, in some cases, it may
be desirable to allow cells to be analyzed to incubate for a select
period of time, in order to characterize changes in such cells over
time, either in the presence or absence of different stimuli. In
such cases, encapsulation of individual cells may allow for longer
incubation than partitioning in emulsion droplets, although in some
cases, droplet partitioned cells may also be incubated for
different periods of time, e.g., at least 10 seconds, at least 30
seconds, at least 1 minute, at least 5 minutes, at least 10
minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at
least 5 hours, or at least 10 hours or more. The encapsulation of
cells may constitute the partitioning of the cells into which other
reagents are co-partitioned. Alternatively, encapsulated cells may
be readily deposited into other partitions, e.g., droplets, as
described above.
[0162] In accordance with certain aspects, the cells may be
partitioned along with lysis reagents in order to release the
contents of the cells within the partition. In such cases, the
lysis agents can be contacted with the cell suspension concurrently
with, or immediately prior to the introduction of the cells into
the partitioning junction/droplet generation zone, e.g., through an
additional channel or channels upstream of channel junction 110.
Examples of lysis agents include bioactive reagents, such as lysis
enzymes that are used for lysis of different cell types, e.g., gram
positive or negative bacteria, plants, yeast, mammalian, etc., such
as lysozymes, achromopeptidase, lysostaphin, labiase, kitalase,
lyticase, and a variety of other lysis enzymes available from,
e.g., Sigma-Aldrich, Inc. (St Louis, Mo.), as well as other
commercially available lysis enzymes. Other lysis agents may
additionally or alternatively be co-partitioned with the cells to
cause the release of the cell's contents into the partitions. For
example, in some cases, surfactant based lysis solutions may be
used to lyse cells, although these may be less desirable for
emulsion based systems where the surfactants can interfere with
stable emulsions. In some cases, lysis solutions may include
non-ionic surfactants such as, for example, TritonX-100 and Tween
20. In some cases, lysis solutions may include ionic surfactants
such as, for example, sarcosyl and sodium dodecyl sulfate (SDS).
Electroporation, thermal, acoustic or mechanical cellular
disruption may also be used in certain cases, e.g., non-emulsion
based partitioning such as encapsulation of cells that may be in
addition to or in place of droplet partitioning, where any pore
size of the encapsulate is sufficiently small to retain nucleic
acid fragments of a desired size, following cellular
disruption.
[0163] In addition to the lysis agents co-partitioned with the
cells described above, other reagents can also be co-partitioned
with the cells, including, for example, DNase and RNase
inactivating agents or inhibitors, such as proteinase K, chelating
agents, such as EDTA, and other reagents employed in removing or
otherwise reducing negative activity or impact of different cell
lysate components on subsequent processing of nucleic acids. In
addition, in the case of encapsulated cells, the cells may be
exposed to an appropriate stimulus to release the cells or their
contents from a co-partitioned microcapsule. For example, in some
cases, a chemical stimulus may be co-partitioned along with an
encapsulated cell to allow for the degradation of the microcapsule
and release of the cell or its contents into the larger partition.
In some cases, this stimulus may be the same as the stimulus
described elsewhere herein for release of oligonucleotides from
their respective microcapsule (e.g., bead). In alternative aspects,
this may be a different and non-overlapping stimulus, in order to
allow an encapsulated cell to be released into a partition at a
different time from the release of oligonucleotides into the same
partition.
[0164] Additional reagents may also be co-partitioned with the
cells, such as endonucleases to fragment the cell's DNA, DNA
polymerase enzymes and dNTPs used to amplify the cell's nucleic
acid fragments and to attach the barcode oligonucleotides to the
amplified fragments. Additional reagents may also include reverse
transcriptase enzymes, including enzymes with terminal transferase
activity, primers and oligonucleotides, and switch oligonucleotides
(also referred to herein as "switch oligos" or "template switching
oligonucleotides") which can be used for template switching. In
some cases, template switching can be used to increase the length
of a cDNA. In some cases, template switching can be used to append
a predefined nucleic acid sequence to the cDNA. In one example of
template switching, cDNA can be generated from reverse
transcription of a template, e.g., cellular mRNA, where a reverse
transcriptase with terminal transferase activity can add additional
nucleotides, e.g., polyC, to the cDNA in a template independent
manner. Switch oligos can include sequences complementary to the
additional nucleotides, e.g., polyG. The additional nucleotides
(e.g., polyC) on the cDNA can hybridize to the additional
nucleotides (e.g., polyG) on the switch oligo, whereby the switch
oligo can be used by the reverse transcriptase as template to
further extend the cDNA. Template switching oligonucleotides may
comprise a hybridization region and a template region. The
hybridization region can comprise any sequence capable of
hybridizing to the target. In some cases, as previously described,
the hybridization region comprises a series of G bases to
complement the overhanging C bases at the 3' end of a cDNA
molecule. The series of G bases may comprise 1 G base, 2 G bases, 3
G bases, 4 G bases, 5 G bases or more than 5 G bases. The template
sequence can comprise any sequence to be incorporated into the
cDNA. In some cases, the template region comprises at least 1
(e.g., at least 2, 3, 4, 5 or more) tag sequences and/or functional
sequences. Switch oligos may comprise deoxyribonucleic acids;
ribonucleic acids; modified nucleic acids including 2-Aminopurine,
2,6-Diaminopurine (2-Amino-dA), inverted dT, 5-Methyl dC,
2'-deoxylnosine, Super T (5-hydroxybutynl-2'-deoxyuridine), Super G
(8-aza-7-deazaguanosine), locked nucleic acids (LNAs), unlocked
nucleic acids (UNAs, e.g., UNA-A, UNA-U, UNA-C, UNA-G), Iso-dG,
Iso-dC, 2' Fluoro bases (e.g., Fluoro C, Fluoro U, Fluoro A, and
Fluoro G), or any combination.
[0165] In some cases, the length of a switch oligo may be 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,
74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105,
106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118,
119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,
132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144,
145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157,
158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170,
171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,
184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196,
197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209,
210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222,
223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235,
236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248,
249, 250 nucleotides or longer.
[0166] In some cases, the length of a switch oligo may be at least
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,
104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155,
156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181,
182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194,
195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220,
221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233,
234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246,
247, 248, 249 or 250 nucleotides or longer.
[0167] In some cases, the length of a switch oligo may be at most
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,
104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155,
156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181,
182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194,
195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220,
221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233,
234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246,
247, 248, 249 or 250 nucleotides.
[0168] Once the contents of the cells are released into their
respective partitions, the nucleic acids contained therein may be
further processed within the partitions. In accordance with the
methods and systems described herein, the nucleic acid contents of
individual cells can be provided with unique identifiers such that,
upon characterization of those nucleic acids they may be attributed
as having been derived from the same cell or cells. The ability to
attribute characteristics to individual cells or groups of cells is
provided by the assignment of unique identifiers specifically to an
individual cell or groups of cells. Unique identifiers, e.g., in
the form of nucleic acid barcodes can be assigned or associated
with individual cells or populations of cells, in order to tag or
label the cell's components (and as a result, its characteristics)
with the unique identifiers. These unique identifiers can then be
used to attribute the cell's components and characteristics to an
individual cell or group of cells. In some aspects, this is carried
out by co-partitioning the individual cells or groups of cells with
the unique identifiers. In some aspects, the unique identifiers are
provided in the form of oligonucleotides that comprise nucleic acid
barcode sequences that may be attached to or otherwise associated
with the nucleic acid contents of individual cells, or to other
components of the cells, and particularly to fragments of those
nucleic acids. The oligonucleotides are partitioned such that as
between oligonucleotides in a given partition, the nucleic acid
barcode sequences contained therein are the same, but as between
different partitions, the oligonucleotides can, and do have
differing barcode sequences, or at least represent a large number
of different barcode sequences across all of the partitions in a
given analysis. In some aspects, only one nucleic acid barcode
sequence can be associated with a given partition, although in some
cases, two or more different barcode sequences may be present.
[0169] The nucleic acid barcode sequences can include from 6 to
about 20 or more nucleotides within the sequence of the
oligonucleotides. In some cases, the length of a barcode sequence
may be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20
nucleotides or longer. In some cases, the length of a barcode
sequence may be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20 nucleotides or longer. In some cases, the length of
a barcode sequence may be at most 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20 nucleotides or shorter. These nucleotides
may be completely contiguous, i.e., in a single stretch of adjacent
nucleotides, or they may be separated into two or more separate
subsequences that are separated by 1 or more nucleotides. In some
cases, separated barcode subsequences can be from about 4 to about
16 nucleotides in length. In some cases, the barcode subsequence
may be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 nucleotides or
longer. In some cases, the barcode subsequence may be at least 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 nucleotides or longer. In
some cases, the barcode subsequence may be at most 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16 nucleotides or shorter.
[0170] The co-partitioned oligonucleotides can also comprise other
functional sequences useful in the processing of the nucleic acids
from the co-partitioned cells. These sequences include, e.g.,
targeted or random/universal amplification primer sequences for
amplifying the genomic DNA from the individual cells within the
partitions while attaching the associated barcode sequences,
sequencing primers or primer recognition sites, hybridization or
probing sequences, e.g., for identification of presence of the
sequences or for pulling down barcoded nucleic acids, or any of a
number of other potential functional sequences. Other mechanisms of
co-partitioning oligonucleotides may also be employed, including,
e.g., coalescence of two or more droplets, where one droplet
contains oligonucleotides, or microdispensing of oligonucleotides
into partitions, e.g., droplets within microfluidic systems.
[0171] Briefly, in one example, microcapsules, such as beads, are
provided that each include large numbers of the above described
barcoded oligonucleotides releasably attached to the beads, where
all of the oligonucleotides attached to a particular bead will
include the same nucleic acid barcode sequence, but where a large
number of diverse barcode sequences are represented across the
population of beads used. In some embodiments, hydrogel beads,
e.g., comprising polyacrylamide polymer matrices, are used as a
solid support and delivery vehicle for the oligonucleotides into
the partitions, as they are capable of carrying large numbers of
oligonucleotide molecules, and may be configured to release those
oligonucleotides upon exposure to a particular stimulus, as
described elsewhere herein. In some cases, the population of beads
will provide a diverse barcode sequence library that includes at
least 1,000 different barcode sequences, at least 5,000 different
barcode sequences, at least 10,000 different barcode sequences, at
least at least 50,000 different barcode sequences, at least 100,000
different barcode sequences, at least 1,000,000 different barcode
sequences, at least 5,000,000 different barcode sequences, or at
least 10,000,000 different barcode sequences. Additionally, each
bead can be provided with large numbers of oligonucleotide
molecules attached. In particular, the number of molecules of
oligonucleotides including the barcode sequence on an individual
bead can be at least 1,000 oligonucleotide molecules, at least
5,000 oligonucleotide molecules, at least 10,000 oligonucleotide
molecules, at least 50,000 oligonucleotide molecules, at least
100,000 oligonucleotide molecules, at least 500,000
oligonucleotides, at least 1,000,000 oligonucleotide molecules, at
least 5,000,000 oligonucleotide molecules, at least 10,000,000
oligonucleotide molecules, at least 50,000,000 oligonucleotide
molecules, at least 100,000,000 oligonucleotide molecules, and in
some cases at least 1 billion oligonucleotide molecules.
[0172] Moreover, when the population of beads is partitioned, the
resulting population of partitions can also include a diverse
barcode library that includes at least 1,000 different barcode
sequences, at least 5,000 different barcode sequences, at least
10,000 different barcode sequences, at least at least 50,000
different barcode sequences, at least 100,000 different barcode
sequences, at least 1,000,000 different barcode sequences, at least
5,000,000 different barcode sequences, or at least 10,000,000
different barcode sequences. Additionally, each partition of the
population can include at least 1,000 oligonucleotide molecules, at
least 5,000 oligonucleotide molecules, at least 10,000
oligonucleotide molecules, at least 50,000 oligonucleotide
molecules, at least 100,000 oligonucleotide molecules, at least
500,000 oligonucleotides, at least 1,000,000 oligonucleotide
molecules, at least 5,000,000 oligonucleotide molecules, at least
10,000,000 oligonucleotide molecules, at least 50,000,000
oligonucleotide molecules, at least 100,000,000 oligonucleotide
molecules, and in some cases at least 1 billion oligonucleotide
molecules.
[0173] In some cases, it may be desirable to incorporate multiple
different barcodes within a given partition, either attached to a
single or multiple beads within the partition. For example, in some
cases, a mixed, but known barcode sequences set may provide greater
assurance of identification in the subsequent processing, e.g., by
providing a stronger address or attribution of the barcodes to a
given partition, as a duplicate or independent confirmation of the
output from a given partition.
[0174] The oligonucleotides are releasable from the beads upon the
application of a particular stimulus to the beads. In some cases,
the stimulus may be a photo-stimulus, e.g., through cleavage of a
photo-labile linkage that releases the oligonucleotides. In other
cases, a thermal stimulus may be used, where elevation of the
temperature of the beads environment will result in cleavage of a
linkage or other release of the oligonucleotides form the beads. In
still other cases, a chemical stimulus is used that cleaves a
linkage of the oligonucleotides to the beads, or otherwise results
in release of the oligonucleotides from the beads. In one case,
such compositions include the polyacrylamide matrices described
above for encapsulation of cells, and may be degraded for release
of the attached oligonucleotides through exposure to a reducing
agent, such as DTT.
[0175] In accordance with the methods and systems described herein,
the beads including the attached oligonucleotides are
co-partitioned with the individual cells, such that a single bead
and a single cell are contained within an individual partition. As
noted above, while single cell/single bead occupancy is the most
desired state, it will be appreciated that multiply occupied
partitions (either in terms of cells, beads or both), or unoccupied
partitions (either in terms of cells, beads or both) will often be
present. An example of a microfluidic channel structure for
co-partitioning cells and beads comprising barcode oligonucleotides
is schematically illustrated in FIG. 2. As described elsewhere
herein, in some aspects, a substantial percentage of the overall
occupied partitions will include both a bead and a cell and, in
some cases, some of the partitions that are generated will be
unoccupied. In some cases, some of the partitions may have beads
and cells that are not partitioned 1:1. In some cases, it may be
desirable to provide multiply occupied partitions, e.g., containing
two, three, four or more cells and/or beads within a single
partition. As shown, channel segments 202, 204, 206, 208 and 210
are provided in fluid communication at channel junction 212. An
aqueous stream comprising the individual cells 214, is flowed
through channel segment 202 toward channel junction 212. As
described above, these cells may be suspended within an aqueous
fluid, or may have been pre-encapsulated, prior to the partitioning
process.
[0176] Concurrently, an aqueous stream comprising the barcode
carrying beads 216, is flowed through channel segment 204 toward
channel junction 212. A non-aqueous partitioning fluid 216 is
introduced into channel junction 212 from each of side channels 206
and 208, and the combined streams are flowed into outlet channel
210. Within channel junction 212, the two combined aqueous streams
from channel segments 202 and 204 are combined, and partitioned
into droplets 218, that include co-partitioned cells 214 and beads
216. As noted previously, by controlling the flow characteristics
of each of the fluids combining at channel junction 212, as well as
controlling the geometry of the channel junction, partitioning can
be optimized to achieve a desired occupancy level of beads, cells
or both, within the partitions 218 that are generated.
[0177] In some cases, lysis agents, e.g., cell lysis enzymes, may
be introduced into the partition with the bead stream, e.g.,
flowing through channel segment 204, such that lysis of the cell
only commences at or after the time of partitioning. Additional
reagents may also be added to the partition in this configuration,
such as endonucleases to fragment the cell's DNA, DNA polymerase
enzyme and dNTPs used to amplify the cell's nucleic acid fragments
and to attach the barcode oligonucleotides to the amplified
fragments. As noted above, in many cases, a chemical stimulus, such
as DTT, may be used to release the barcodes from their respective
beads into the partition. In such cases, it may be particularly
desirable to provide the chemical stimulus along with the
cell-containing stream in channel segment 202, such that release of
the barcodes only occurs after the two streams have been combined,
e.g., within the partitions 218. Where the cells are encapsulated,
however, introduction of a common chemical stimulus, e.g., that
both releases the oligonucleotides form their beads, and releases
cells from their microcapsules may generally be provided from a
separate additional side channel (not shown) upstream of or
connected to channel junction 212.
[0178] A number of other reagents may be co-partitioned along with
the cells, beads, lysis agents and chemical stimuli, including, for
example, protective reagents, like proteinase K, chelators, nucleic
acid extension, replication, transcription or amplification
reagents such as polymerases, reverse transcriptases, transposases
which can be used for transposon based methods (e.g., Nextera),
nucleoside triphosphates or NTP analogues, primer sequences and
additional cofactors such as divalent metal ions used in such
reactions, ligation reaction reagents, such as ligase enzymes and
ligation sequences, dyes, labels, or other tagging reagents.
[0179] The channel networks, e.g., as described herein, can be
fluidly coupled to appropriate fluidic components. For example, the
inlet channel segments, e.g., channel segments 202, 204, 206 and
208 are fluidly coupled to appropriate sources of the materials
they are to deliver to channel junction 212. For example, channel
segment 202 will be fluidly coupled to a source of an aqueous
suspension of cells 214 to be analyzed, while channel segment 204
may be fluidly coupled to a source of an aqueous suspension of
beads 216. Channel segments 206 and 208 may then be fluidly
connected to one or more sources of the non-aqueous fluid. These
sources may include any of a variety of different fluidic
components, from simple reservoirs defined in or connected to a
body structure of a microfluidic device, to fluid conduits that
deliver fluids from off-device sources, manifolds, or the like.
Likewise, the outlet channel segment 210 may be fluidly coupled to
a receiving vessel or conduit for the partitioned cells. Again,
this may be a reservoir defined in the body of a microfluidic
device, or it may be a fluidic conduit for delivering the
partitioned cells to a subsequent process operation, instrument or
component.
[0180] FIG. 8 shows images of individual Jurkat cells
co-partitioned along with barcode oligonucleotide containing beads
in aqueous droplets in an aqueous in oil emulsion. As illustrated,
individual cells may be readily co-partitioned with individual
beads. As will be appreciated, optimization of individual cell
loading may be carried out by a number of methods, including by
providing dilutions of cell populations into the microfluidic
system in order to achieve the desired cell loading per partition
as described elsewhere herein.
[0181] In operation, once lysed, the nucleic acid contents of the
individual cells are then available for further processing within
the partitions, including, e.g., fragmentation, amplification and
barcoding, as well as attachment of other functional sequences. As
noted above, fragmentation may be accomplished through the
co-partitioning of shearing enzymes, such as endonucleases, in
order to fragment the nucleic acids into smaller fragments. These
endonucleases may include restriction endonucleases, including type
II and type IIs restriction endonucleases as well as other nucleic
acid cleaving enzymes, such as nicking endonucleases, and the like.
In some cases, fragmentation may not be desired, and full length
nucleic acids may be retained within the partitions, or in the case
of encapsulated cells or cell contents, fragmentation may be
carried out prior to partitioning, e.g., through enzymatic methods,
e.g., those described herein, or through mechanical methods, e.g.,
mechanical, acoustic or other shearing.
[0182] Once co-partitioned, and the cells are lysed to release
their nucleic acids, the oligonucleotides disposed upon the bead
may be used to barcode and amplify fragments of those nucleic
acids. Briefly, in one aspect, the oligonucleotides present on the
beads that are co-partitioned with the cells, are released from
their beads into the partition with the cell's nucleic acids. The
oligonucleotides can include, along with the barcode sequence, a
primer sequence at its 5' end. This primer sequence may be a random
oligonucleotide sequence intended to randomly prime numerous
different regions on the cell's nucleic acids, or it may be a
specific primer sequence targeted to prime upstream of a specific
targeted region of the cell's genome.
[0183] Once released, the primer portion of the oligonucleotide can
anneal to a complementary region of the cell's nucleic acid.
Extension reaction reagents, e.g., DNA polymerase, nucleoside
triphosphates, co-factors (e.g., Mg2+ or Mn2+), that are also
co-partitioned with the cells and beads, then extend the primer
sequence using the cell's nucleic acid as a template, to produce a
complementary fragment to the strand of the cell's nucleic acid to
which the primer annealed, which complementary fragment includes
the oligonucleotide and its associated barcode sequence. Annealing
and extension of multiple primers to different portions of the
cell's nucleic acids will result in a large pool of overlapping
complementary fragments of the nucleic acid, each possessing its
own barcode sequence indicative of the partition in which it was
created. In some cases, these complementary fragments may
themselves be used as a template primed by the oligonucleotides
present in the partition to produce a complement of the complement
that again, includes the barcode sequence. In some cases, this
replication process is configured such that when the first
complement is duplicated, it produces two complementary sequences
at or near its termini, to allow formation of a hairpin structure
or partial hairpin structure, the reduces the ability of the
molecule to be the basis for producing further iterative copies. As
described herein, the cell's nucleic acids may include any desired
nucleic acids within the cell including, for example, the cell's
DNA, e.g., genomic DNA, RNA, e.g., messenger RNA, and the like. For
example, in some cases, the methods and systems described herein
are used in characterizing expressed mRNA, including, e.g., the
presence and quantification of such mRNA, and may include RNA
sequencing processes as the characterization process. Alternatively
or additionally, the reagents partitioned along with the cells may
include reagents for the conversion of mRNA into cDNA, e.g.,
reverse transcriptase enzymes and reagents, to facilitate
sequencing processes where DNA sequencing is employed. In some
cases, where the nucleic acids to be characterized comprise RNA,
e.g., mRNA, schematic illustration of one example of this is shown
in FIG. 3.
[0184] As shown, oligonucleotides that include a barcode sequence
are co-partitioned in, e.g., a droplet 302 in an emulsion, along
with a sample nucleic acid 304. As noted elsewhere herein, the
oligonucleotides 308 may be provided on a bead 306 that is
co-partitioned with the sample nucleic acid 304, which
oligonucleotides are releasable from the bead 306, as shown in
panel A. The oligonucleotides 308 include a barcode sequence 312,
in addition to one or more functional sequences, e.g., sequences
310, 314 and 316. For example, oligonucleotide 308 is shown as
comprising barcode sequence 312, as well as sequence 310 that may
function as an attachment or immobilization sequence for a given
sequencing system, e.g., a P5 sequence used for attachment in flow
cells of an Illumina Hiseq.RTM. or Miseq.RTM. system. As shown, the
oligonucleotides also include a primer sequence 316, which may
include a random or targeted N-mer for priming replication of
portions of the sample nucleic acid 304. Also included within
oligonucleotide 308 is a sequence 314 which may provide a
sequencing priming region, such as a "read1" or R1 priming region,
that is used to prime polymerase mediated, template directed
sequencing by synthesis reactions in sequencing systems. As will be
appreciated, the functional sequences may be selected to be
compatible with a variety of different sequencing systems, e.g.,
454 Sequencing, Ion Torrent Proton or PGM, Illumina X10, etc., and
the requirements thereof. In many cases, the barcode sequence 312,
immobilization sequence 310 and R1 sequence 314 may be common to
all of the oligonucleotides attached to a given bead. The primer
sequence 316 may vary for random N-mer primers, or may be common to
the oligonucleotides on a given bead for certain targeted
applications.
[0185] As will be appreciated, in some cases, the functional
sequences may include primer sequences useful for RNA-seq
applications. For example, in some cases, the oligonucleotides may
include poly-T primers for priming reverse transcription of RNA for
RNA-seq. In still other cases, oligonucleotides in a given
partition, e.g., included on an individual bead, may include
multiple types of primer sequences in addition to the common
barcode sequences, such as both DNA-sequencing and RNA sequencing
primers, e.g., poly-T primer sequences included within the
oligonucleotides coupled to the bead. In such cases, a single
partitioned cell may be both subjected to DNA and RNA sequencing
processes.
[0186] Based upon the presence of primer sequence 316, the
oligonucleotides can prime the sample nucleic acid as shown in
panel B, which allows for extension of the oligonucleotides 308 and
308a using polymerase enzymes and other extension reagents also
co-partitioned with the bead 306 and sample nucleic acid 304. As
shown in panel C, following extension of the oligonucleotides that,
for random N-mer primers, may anneal to multiple different regions
of the sample nucleic acid 304; multiple overlapping complements or
fragments of the nucleic acid are created, e.g., fragments 318 and
320. Although including sequence portions that are complementary to
portions of sample nucleic acid, e.g., sequences 322 and 324, these
constructs are generally referred to herein as comprising fragments
of the sample nucleic acid 304, having the attached barcode
sequences.
[0187] The barcoded nucleic acid fragments may then be subjected to
characterization, e.g., through sequence analysis, or they may be
further amplified in the process, as shown in panel D. For example,
additional oligonucleotides, e.g., oligonucleotide 308b, also
released from bead 306, may prime the fragments 318 and 320. This
shown for fragment 318. In particular, again, based upon the
presence of the random N-mer primer 316b in oligonucleotide 308b
(which in many cases can be different from other random N-mers in a
given partition, e.g., primer sequence 316), the oligonucleotide
anneals with the fragment 318, and is extended to create a
complement 326 to at least a portion of fragment 318 which includes
sequence 328, that comprises a duplicate of a portion of the sample
nucleic acid sequence. Extension of the oligonucleotide 308b
continues until it has replicated through the oligonucleotide
portion 308 of fragment 318. As noted elsewhere herein, and as
illustrated in panel D, the oligonucleotides may be configured to
prompt a stop in the replication by the polymerase at a desired
point, e.g., after replicating through sequences 316 and 314 of
oligonucleotide 308 that is included within fragment 318. As
described herein, this may be accomplished by different methods,
including, for example, the incorporation of different nucleotides
and/or nucleotide analogues that are not capable of being processed
by the polymerase enzyme used. For example, this may include the
inclusion of uracil containing nucleotides within the sequence
region 312 to prevent a non-uracil tolerant polymerase to cease
replication of that region. As a result a fragment 326 is created
that includes the full-length oligonucleotide 308b at one end,
including the barcode sequence 312, the attachment sequence 310,
the R1 primer region 314, and the random N-mer sequence 316b. At
the other end of the sequence may be included the complement 316'
to the random N-mer of the first oligonucleotide 308, as well as a
complement to all or a portion of the R1 sequence, shown as
sequence 314'. The R1 sequence 314 and its complement 314' are then
able to hybridize together to form a partial hairpin structure 328.
As will be appreciated because the random N-mers differ among
different oligonucleotides, these sequences and their complements
may not be expected to participate in hairpin formation, e.g.,
sequence 316', which is the complement to random N-mer 316, may not
be expected to be complementary to random N-mer sequence 316b. This
may not be the case for other applications, e.g., targeted primers,
where the N-mers may be common among oligonucleotides within a
given partition.
[0188] By forming these partial hairpin structures, it allows for
the removal of first level duplicates of the sample sequence from
further replication, e.g., preventing iterative copying of copies.
The partial hairpin structure also provides a useful structure for
subsequent processing of the created fragments, e.g., fragment
326.
[0189] In general, the amplification of the cell's nucleic acids is
carried out until the barcoded overlapping fragments within the
partition constitute at least 1.times. coverage of the particular
portion or all of the cell's genome, at least 2.times., at least
3.times., at least 4.times., at least 5.times., at least 10.times.,
at least 20.times., at least 40.times. or more coverage of the
genome or its relevant portion of interest. Once the barcoded
fragments are produced, they may be directly sequenced on an
appropriate sequencing system, e.g., an Illumina Hiseq.RTM.,
Miseq.RTM. or X10 system, or they may be subjected to additional
processing, such as further amplification, attachment of other
functional sequences, e.g., second sequencing primers, for reverse
reads, sample index sequences, and the like.
[0190] All of the fragments from multiple different partitions may
then be pooled for sequencing on high throughput sequencers as
described herein, where the pooled fragments comprise a large
number of fragments derived from the nucleic acids of different
cells or small cell populations, but where the fragments from the
nucleic acids of a given cell will share the same barcode sequence.
In particular, because each fragment is coded as to its partition
of origin, and consequently its single cell or small population of
cells, the sequence of that fragment may be attributed back to that
cell or those cells based upon the presence of the barcode, which
will also aid in applying the various sequence fragments from
multiple partitions to assembly of individual genomes for different
cells. This is schematically illustrated in FIG. 4. As shown in one
example, a first nucleic acid 404 from a first cell 400, and a
second nucleic acid 406 from a second cell 402 are each partitioned
along with their own sets of barcode oligonucleotides as described
above. The nucleic acids may comprise a chromosome, entire genome
or other large nucleic acid from the cells.
[0191] Within each partition, each cell's nucleic acids 404 and 406
is then processed to separately provide overlapping set of second
fragments of the first fragment(s), e.g., second fragment sets 408
and 410. This processing also provides the second fragments with a
barcode sequence that is the same for each of the second fragments
derived from a particular first fragment. As shown, the barcode
sequence for second fragment set 408 is denoted by "1" while the
barcode sequence for fragment set 410 is denoted by "2". A diverse
library of barcodes may be used to differentially barcode large
numbers of different fragment sets. However, it is not necessary
for every second fragment set from a different first fragment to be
barcoded with different barcode sequences. In fact, in many cases,
multiple different first fragments may be processed concurrently to
include the same barcode sequence. Diverse barcode libraries are
described in detail elsewhere herein.
[0192] The barcoded fragments, e.g., from fragment sets 408 and
410, may then be pooled for sequencing using, for example, sequence
by synthesis technologies available from Illumina or Ion Torrent
division of Thermo-Fisher, Inc. Once sequenced, the sequence reads
412 can be attributed to their respective fragment set, e.g., as
shown in aggregated reads 414 and 416, at least in part based upon
the included barcodes, and in some cases, in part based upon the
sequence of the fragment itself. The attributed sequence reads for
each fragment set are then assembled to provide the assembled
sequence for each cell's nucleic acids, e.g., sequences 418 and
420, which in turn, may be attributed to individual cells, e.g.,
cells 400 and 402.
[0193] While described in terms of analyzing the genetic material
present within cells, the methods and systems described herein may
have much broader applicability, including the ability to
characterize other aspects of individual cells or cell populations,
by allowing for the allocation of reagents to individual cells, and
providing for the attributable analysis or characterization of
those cells in response to those reagents. These methods and
systems are particularly valuable in being able to characterize
cells for, e.g., research, diagnostic, pathogen identification, and
many other purposes. By way of example, a wide range of different
cell surface features, e.g., cell surface proteins like cluster of
differentiation or CD proteins, have significant diagnostic
relevance in characterization of diseases like cancer.
[0194] In one particularly useful application, the methods and
systems described herein may be used to characterize cell features,
such as cell surface features, e.g., proteins, receptors, etc. In
particular, the methods described herein may be used to attach
reporter molecules to these cell features, that when partitioned as
described above, may be barcoded and analyzed, e.g., using DNA
sequencing technologies, to ascertain the presence, and in some
cases, relative abundance or quantity of such cell features within
an individual cell or population of cells.
[0195] In a particular example, a library of potential cell binding
ligands, e.g., antibodies, antibody fragments, cell surface
receptor binding molecules, or the like, maybe provided associated
with a first set of nucleic acid reporter molecules, e.g., where a
different reporter oligonucleotide sequence is associated with a
specific ligand, and therefore capable of binding to a specific
cell surface feature. In some aspects, different members of the
library may be characterized by the presence of a different
oligonucleotide sequence label, e.g., an antibody to a first type
of cell surface protein or receptor may have associated with it a
first known reporter oligonucleotide sequence, while an antibody to
a second receptor protein may have a different known reporter
oligonucleotide sequence associated with it. Prior to
co-partitioning, the cells may be incubated with the library of
ligands, that may represent antibodies to a broad panel of
different cell surface features, e.g., receptors, proteins, etc.,
and which include their associated reporter oligonucleotides.
Unbound ligands are washed from the cells, and the cells are then
co-partitioned along with the barcode oligonucleotides described
above. As a result, the partitions will include the cell or cells,
as well as the bound ligands and their known, associated reporter
oligonucleotides.
[0196] Without the need for lysing the cells within the partitions,
one may then subject the reporter oligonucleotides to the barcoding
operations described above for cellular nucleic acids, to produce
barcoded, reporter oligonucleotides, where the presence of the
reporter oligonucleotides can be indicative of the presence of the
particular cell surface feature, and the barcode sequence will
allow the attribution of the range of different cell surface
features to a given individual cell or population of cells based
upon the barcode sequence that was co-partitioned with that cell or
population of cells. As a result, one may generate a cell-by-cell
profile of the cell surface features within a broader population of
cells. This aspect of the methods and systems described herein, is
described in greater detail below.
[0197] This example is schematically illustrated in FIG. 5. As
shown, a population of cells, represented by cells 502 and 504 are
incubated with a library of cell surface associated reagents, e.g.,
antibodies, cell surface binding proteins, ligands or the like,
where each different type of binding group includes an associated
nucleic acid reporter molecule associated with it, shown as ligands
and associated reporter molecules 506, 508, 510 and 512 (with the
reporter molecules being indicated by the differently shaded
circles). Where the cell expresses the surface features that are
bound by the library, the ligands and their associated reporter
molecules can become associated or coupled with the cell surface.
Individual cells are then partitioned into separate partitions,
e.g., droplets 514 and 516, along with their associated
ligand/reporter molecules, as well as an individual barcode
oligonucleotide bead as described elsewhere herein, e.g., beads 522
and 524, respectively. As with other examples described herein, the
barcoded oligonucleotides are released from the beads and used to
attach the barcode sequence the reporter molecules present within
each partition with a barcode that is common to a given partition,
but which varies widely among different partitions. For example, as
shown in FIG. 5, the reporter molecules that associate with cell
502 in partition 514 are barcoded with barcode sequence 518, while
the reporter molecules associated with cell 504 in partition 516
are barcoded with barcode 520. As a result, one is provided with a
library of oligonucleotides that reflects the surface ligands of
the cell, as reflected by the reporter molecule, but which is
substantially attributable to an individual cell by virtue of a
common barcode sequence, allowing a single cell level profiling of
the surface characteristics of the cell. As will be appreciated,
this process is not limited to cell surface receptors but may be
used to identify the presence of a wide variety of specific cell
structures, chemistries or other characteristics.
[0198] Single cell processing and analysis methods and systems
described herein can be utilized for a wide variety of
applications, including analysis of specific individual cells,
analysis of different cell types within populations of differing
cell types, analysis and characterization of large populations of
cells for environmental, human health, epidemiological forensic, or
any of a wide variety of different applications.
[0199] A particularly valuable application of the single cell
analysis processes described herein is in the sequencing and
characterization of a diseased cell. A diseased cell can have
altered metabolic properties, gene expression, and/or morphologic
features. Examples of diseases include inflammatory disorders,
metabolic disorders, nervous system disorders, and cancer.
[0200] Of particular interest are cancer cells. In particular,
conventional analytical techniques, including the ensemble
sequencing processes alluded to above, are not highly adept at
picking small variations in genomic make-up of cancer cells,
particularly where those exist in a sea of normal tissue cells.
Further, even as between tumor cells, wide variations can exist and
can be masked by the ensemble approaches to sequencing (See, e.g.,
Patel, et al., Single-cell RNA-seq highlights intratumoral
heterogeneity in primary glioblastoma, Science DOI:
10.1126/science.1254257 (Published online Jun. 12, 2014). Cancer
cells may be derived from solid tumors, hematological malignancies,
cell lines, or obtained as circulating tumor cells, and subjected
to the partitioning processes described above. Upon analysis, one
can identify individual cell sequences as deriving from a single
cell or small group of cells, and distinguish those over normal
tissue cell sequences.
[0201] Non-limiting examples of cancer cells include cells of
cancers such as Acanthoma, Acinic cell carcinoma, Acoustic neuroma,
Acral lentiginous melanoma, Acrospiroma, Acute eosinophilic
leukemia, Acute lymphoblastic leukemia, Acute megakaryoblastic
leukemia, Acute monocytic leukemia, Acute myeloblastic leukemia
with maturation, Acute myeloid dendritic cell leukemia, Acute
myeloid leukemia, Acute promyelocytic leukemia, Adamantinoma,
Adenocarcinoma, Adenoid cystic carcinoma, Adenoma, Adenomatoid
odontogenic tumor, Adrenocortical carcinoma, Adult T-cell leukemia,
Aggressive NK-cell leukemia, AIDS-Related Cancers, AIDS-related
lymphoma, Alveolar soft part sarcoma, Ameloblastic fibroma, Anal
cancer, Anaplastic large cell lymphoma, Anaplastic thyroid cancer,
Angioimmunoblastic T-cell lymphoma, Angiomyolipoma, Angiosarcoma,
Appendix cancer, Astrocytoma, Atypical teratoid rhabdoid tumor,
Basal cell carcinoma, Basal-like carcinoma, B-cell leukemia, B-cell
lymphoma, Bellini duct carcinoma, Biliary tract cancer, Bladder
cancer, Blastoma, Bone Cancer, Bone tumor, Brain Stem Glioma, Brain
Tumor, Breast Cancer, Brenner tumor, Bronchial Tumor,
Bronchioloalveolar carcinoma, Brown tumor, Burkitt's lymphoma,
Cancer of Unknown Primary Site, Carcinoid Tumor, Carcinoma,
Carcinoma in situ, Carcinoma of the penis, Carcinoma of Unknown
Primary Site, Carcinosarcoma, Castleman's Disease, Central Nervous
System Embryonal Tumor, Cerebellar Astrocytoma, Cerebral
Astrocytoma, Cervical Cancer, Cholangiocarcinoma, Chondroma,
Chondrosarcoma, Chordoma, Choriocarcinoma, Choroid plexus
papilloma, Chronic Lymphocytic Leukemia, Chronic monocytic
leukemia, Chronic myelogenous leukemia, Chronic Myeloproliferative
Disorder, Chronic neutrophilic leukemia, Clear-cell tumor, Colon
Cancer, Colorectal cancer, Craniopharyngioma, Cutaneous T-cell
lymphoma, Degos disease, Dermatofibrosarcoma protuberans, Dermoid
cyst, Desmoplastic small round cell tumor, Diffuse large B cell
lymphoma, Dysembryoplastic neuroepithelial tumor, Embryonal
carcinoma, Endodermal sinus tumor, Endometrial cancer, Endometrial
Uterine Cancer, Endometrioid tumor, Enteropathy-associated T-cell
lymphoma, Ependymoblastoma, Ependymoma, Epithelioid sarcoma,
Erythroleukemia, Esophageal cancer, Esthesioneuroblastoma, Ewing
Family of Tumor, Ewing Family Sarcoma, Ewing's sarcoma,
Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor,
Extrahepatic Bile Duct Cancer, Extramammary Paget's disease,
Fallopian tube cancer, Fetus in fetu, Fibroma, Fibrosarcoma,
Follicular lymphoma, Follicular thyroid cancer, Gallbladder Cancer,
Gallbladder cancer, Ganglioglioma, Ganglioneuroma, Gastric Cancer,
Gastric lymphoma, Gastrointestinal cancer, Gastrointestinal
Carcinoid Tumor, Gastrointestinal Stromal Tumor, Gastrointestinal
stromal tumor, Germ cell tumor, Germinoma, Gestational
choriocarcinoma, Gestational Trophoblastic Tumor, Giant cell tumor
of bone, Glioblastoma multiforme, Glioma, Gliomatosis cerebri,
Glomus tumor, Glucagonoma, Gonadoblastoma, Granulosa cell tumor,
Hairy Cell Leukemia, Hairy cell leukemia, Head and Neck Cancer,
Head and neck cancer, Heart cancer, Hemangioblastoma,
Hemangiopericytoma, Hemangiosarcoma, Hematological malignancy,
Hepatocellular carcinoma, Hepatosplenic T-cell lymphoma, Hereditary
breast-ovarian cancer syndrome, Hodgkin Lymphoma, Hodgkin's
lymphoma, Hypopharyngeal Cancer, Hypothalamic Glioma, Inflammatory
breast cancer, Intraocular Melanoma, Islet cell carcinoma, Islet
Cell Tumor, Juvenile myelomonocytic leukemia, Kaposi Sarcoma,
Kaposi's sarcoma, Kidney Cancer, Klatskin tumor, Krukenberg tumor,
Laryngeal Cancer, Laryngeal cancer, Lentigo maligna melanoma,
Leukemia, Leukemia, Lip and Oral Cavity Cancer, Liposarcoma, Lung
cancer, Luteoma, Lymphangioma, Lymphangiosarcoma,
Lymphoepithelioma, Lymphoid leukemia, Lymphoma, Macroglobulinemia,
Malignant Fibrous Histiocytoma, Malignant fibrous histiocytoma,
Malignant Fibrous Histiocytoma of Bone, Malignant Glioma, Malignant
Mesothelioma, Malignant peripheral nerve sheath tumor, Malignant
rhabdoid tumor, Malignant triton tumor, MALT lymphoma, Mantle cell
lymphoma, Mast cell leukemia, Mediastinal germ cell tumor,
Mediastinal tumor, Medullary thyroid cancer, Medulloblastoma,
Medulloblastoma, Medulloepithelioma, Melanoma, Melanoma,
Meningioma, Merkel Cell Carcinoma, Mesothelioma, Mesothelioma,
Metastatic Squamous Neck Cancer with Occult Primary, Metastatic
urothelial carcinoma, Mixed Mullerian tumor, Monocytic leukemia,
Mouth Cancer, Mucinous tumor, Multiple Endocrine Neoplasia
Syndrome, Multiple Myeloma, Multiple myeloma, Mycosis Fungoides,
Mycosis fungoides, Myelodysplastic Disease, Myelodysplastic
Syndromes, Myeloid leukemia, Myeloid sarcoma, Myeloproliferative
Disease, Myxoma, Nasal Cavity Cancer, Nasopharyngeal Cancer,
Nasopharyngeal carcinoma, Neoplasm, Neurinoma, Neuroblastoma,
Neuroblastoma, Neurofibroma, Neuroma, Nodular melanoma, Non-Hodgkin
Lymphoma, Non-Hodgkin lymphoma, Nonmelanoma Skin Cancer, Non-Small
Cell Lung Cancer, Ocular oncology, Oligoastrocytoma,
Oligodendroglioma, Oncocytoma, Optic nerve sheath meningioma, Oral
Cancer, Oral cancer, Oropharyngeal Cancer, Osteosarcoma,
Osteosarcoma, Ovarian Cancer, Ovarian cancer, Ovarian Epithelial
Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential
Tumor, Paget's disease of the breast, Pancoast tumor, Pancreatic
Cancer, Pancreatic cancer, Papillary thyroid cancer,
Papillomatosis, Paraganglioma, Paranasal Sinus Cancer, Parathyroid
Cancer, Penile Cancer, Perivascular epithelioid cell tumor,
Pharyngeal Cancer, Pheochromocytoma, Pineal Parenchymal Tumor of
Intermediate Differentiation, Pineoblastoma, Pituicytoma, Pituitary
adenoma, Pituitary tumor, Plasma Cell Neoplasm, Pleuropulmonary
blastoma, Polyembryoma, Precursor T-lymphoblastic lymphoma, Primary
central nervous system lymphoma, Primary effusion lymphoma, Primary
Hepatocellular Cancer, Primary Liver Cancer, Primary peritoneal
cancer, Primitive neuroectodermal tumor, Prostate cancer,
Pseudomyxoma peritonei, Rectal Cancer, Renal cell carcinoma,
Respiratory Tract Carcinoma Involving the NUT Gene on Chromosome
15, Retinoblastoma, Rhabdomyoma, Rhabdomyosarcoma, Richter's
transformation, Sacrococcygeal teratoma, Salivary Gland Cancer,
Sarcoma, Schwannomatosis, Sebaceous gland carcinoma, Secondary
neoplasm, Seminoma, Serous tumor, Sertoli-Leydig cell tumor, Sex
cord-stromal tumor, Sezary Syndrome, Signet ring cell carcinoma,
Skin Cancer, Small blue round cell tumor, Small cell carcinoma,
Small Cell Lung Cancer, Small cell lymphoma, Small intestine
cancer, Soft tissue sarcoma, Somatostatinoma, Soot wart, Spinal
Cord Tumor, Spinal tumor, Splenic marginal zone lymphoma, Squamous
cell carcinoma, Stomach cancer, Superficial spreading melanoma,
Supratentorial Primitive Neuroectodermal Tumor, Surface
epithelial-stromal tumor, Synovial sarcoma, T-cell acute
lymphoblastic leukemia, T-cell large granular lymphocyte leukemia,
T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia,
Teratoma, Terminal lymphatic cancer, Testicular cancer, Thecoma,
Throat Cancer, Thymic Carcinoma, Thymoma, Thyroid cancer,
Transitional Cell Cancer of Renal Pelvis and Ureter, Transitional
cell carcinoma, Urachal cancer, Urethral cancer, Urogenital
neoplasm, Uterine sarcoma, Uveal melanoma, Vaginal Cancer, Verner
Morrison syndrome, Verrucous carcinoma, Visual Pathway Glioma,
Vulvar Cancer, Waldenstrom's macroglobulinemia, Warthin's tumor,
Wilms' tumor, and combinations thereof.
[0202] Where cancer cells are to be analyzed, primer sequences
useful in any of the various operations for attaching barcode
sequences and/or amplification reactions may comprise gene specific
sequences which target genes or regions of genes associated with or
suspected of being associated with cancer. For example, this can
include genes or regions of genes where the presence of mutations
(e.g., insertions, deletions, polymorphisms, copy number
variations, and gene fusions) associated with a cancerous condition
are suspected to be present in a cell population.
[0203] As with cancer cell analysis, the analysis and diagnosis of
fetal health or abnormality through the analysis of fetal cells is
a difficult task using conventional techniques. In particular, in
the absence of relatively invasive procedures, such as
amniocentesis obtaining fetal cell samples can employ harvesting
those cells from the maternal circulation. As will be appreciated,
such circulating fetal cells make up an extremely small fraction of
the overall cellular population of that circulation. As a result
complex analyses are performed in order to characterize what of the
obtained data is likely derived from fetal cells as opposed to
maternal cells. By employing the single cell characterization
methods and systems described herein, however, one can attribute
genetic make up to individual cells, and categorize those cells as
maternal or fetal based upon their respective genetic make-up.
Further, the genetic sequence of fetal cells may be used to
identify any of a number of genetic disorders, including, e.g.,
aneuploidy such as Down syndrome, Edwards syndrome, and Patau
syndrome.
[0204] Also of interest are immune cells. Methods and compositions
disclosed herein can be utilized for sequence analysis of the
immune repertoire. Analysis of sequence information underlying the
immune repertoire can provide a significant improvement in
understanding the status and function of the immune system.
[0205] Non-limiting examples of immune cells which can be analyzed
utilizing the methods described herein include B cells, T cells
(e.g., cytotoxic T cells, natural killer T cells, regulatory T
cells, and T helper cells), natural killer cells, cytokine induced
killer (CIK) cells; myeloid cells, such as granulocytes (basophil
granulocytes, eosinophil granulocytes, neutrophil
granulocytes/hypersegmented neutrophils), monocytes/macrophages,
mast cell, thrombocytes/megakaryocytes, and dendritic cells. In
some embodiments, individual T cells are analyzed using the methods
disclosed herein. In some embodiments, individual B cells are
analyzed using the methods disclosed herein.
[0206] Immune cells express various adaptive immunological
receptors relating to immune function, such as T cell receptors and
B cell receptors. T cell receptors and B cells receptors play a
part in the immune response by specifically recognizing and binding
to antigens and aiding in their destruction.
[0207] The T cell receptor, or TCR, is a molecule found on the
surface of T cells that is generally responsible for recognizing
fragments of antigen as peptides bound to major histocompatibility
complex (MHC) molecules. The TCR is generally a heterodimer of two
chains, each of which is a member of the immunoglobulin
superfamily, possessing an N-terminal variable (V) domain, and a C
terminal constant domain. In humans, in 95% of T cells the TCR
consists of an alpha (.alpha.) and beta (.beta.) chain, whereas in
5% of T cells the TCR consists of gamma and delta (.gamma./.delta.)
chains. This ratio can change during ontogeny and in diseased
states as well as in different species. When the TCR engages with
antigenic peptide and MHC (peptide/MHC), the T lymphocyte is
activated through signal transduction.
[0208] Each of the two chains of a TCR contains multiple copies of
gene segments--a variable `V` gene segment, a diversity `D` gene
segment, and a joining T gene segment. The TCR alpha chain is
generated by recombination of V and J segments, while the beta
chain is generated by recombination of V, D, and J segments.
Similarly, generation of the TCR gamma chain involves recombination
of V and J gene segments, while generation of the TCR delta chain
occurs by recombination of V, D, and J gene segments. The
intersection of these specific regions (V and J for the alpha or
gamma chain, or V, D and J for the beta or delta chain) corresponds
to the CDR3 region that is important for antigen-MHC recognition.
Complementarity determining regions (e.g., CDR1, CDR2, and CDR3),
or hypervariable regions, are sequences in the variable domains of
antigen receptors (e.g., T cell receptor and immunoglobulin) that
can complement an antigen. Most of the diversity of CDRs is found
in CDR3, with the diversity being generated by somatic
recombination events during the development of T lymphocytes. A
unique nucleotide sequence that arises during the gene arrangement
process can be referred to as a clonotype.
[0209] The B cell receptor, or BCR, is a molecule found on the
surface of B cells. The antigen binding portion of a BCR is
composed of a membrane-bound antibody that, like most antibodies
(e.g., immunoglobulins), has a unique and randomly determined
antigen-binding site. The antigen binding portion of a BCR includes
membrane-bound immunoglobulin molecule of one isotype (e.g., IgD,
IgM, IgA, IgG, or IgE). When a B cell is activated by its first
encounter with a cognate antigen, the cell proliferates and
differentiates to generate a population of antibody-secreting
plasma B cells and memory B cells. The various immunoglobulin
isotypes differ in their biological features, structure, target
specificity and distribution. A variety of molecular mechanisms
exist to generate initial diversity, including genetic
recombination at multiple sites.
[0210] The BCR is composed of two genes IgH and IgK (or IgL) coding
for antibody heavy and light chains. Immunoglobulins are formed by
recombination among gene segments, sequence diversification at the
junctions of these segments, and point mutations throughout the
gene. Each heavy chain gene contains multiple copies of three
different gene segments--a variable `V` gene segment, a diversity
`D` gene segment, and a joining T gene segment. Each light chain
gene contains multiple copies of two different gene segments for
the variable region of the protein--a variable `V` gene segment and
a joining T gene segment. The recombination can generate a molecule
with one of each of the V, D, and J segments. Furthermore, several
bases may be deleted and others added (called N and P nucleotides)
at each of the two junctions, thereby generating further diversity.
After B cell activation, a process of affinity maturation through
somatic hypermutation occurs. In this process progeny cells of the
activated B cells accumulate distinct somatic mutations throughout
the gene with higher mutation concentration in the CDR regions
leading to the generation of antibodies with higher affinity to the
antigens. In addition to somatic hypermutation activated B cells
undergo the process of isotype switching. Antibodies with the same
variable segments can have different forms (isotypes) depending on
the constant segment. Whereas all naive B cells express IgM (or
IgD), activated B cells mostly express IgG but also IgM, IgA and
IgE. This expression switching from IgM (and/or IgD) to IgG, IgA,
or IgE occurs through a recombination event causing one cell to
specialize in producing a specific isotype. A unique nucleotide
sequence that arises during the gene arrangement process can
similarly be referred to as a clonotype.
[0211] In some embodiments, the methods, compositions and systems
disclosed herein are utilized to analyze the various sequences of
TCRs and BCRs from immune cells, for example various clonotypes. In
some embodiments, methods, compositions and systems disclosed
herein are used to analyze the sequence of a TCR alpha chain, a TCR
beta chain, a TCR delta chain, a TCR gamma chain, or any fragment
thereof (e.g., variable regions including VDJ or VJ regions,
constant regions, transmembrane regions, fragments thereof,
combinations thereof, and combinations of fragments thereof). In
some embodiments, methods, compositions and systems disclosed
herein are used to analyze the sequence of a B cell receptor heavy
chain, B cell receptor light chain, or any fragment thereof (e.g.,
variable regions including VDJ or VJ regions, constant regions,
transmembrane regions, fragments thereof, combinations thereof, and
combinations of fragments thereof).
[0212] Where immune cells are to be analyzed, primer sequences
useful in any of the various operations for attaching barcode
sequences and/or amplification reactions may comprise gene specific
sequences which target genes or regions of genes of immune cell
proteins, for example immune receptors. Such gene sequences
include, but are not limited to, sequences of various T cell
receptor alpha variable genes (TRAV genes), T cell receptor alpha
joining genes (TRAJ genes), T cell receptor alpha constant genes
(TRAC genes), T cell receptor beta variable genes (TRBV genes), T
cell receptor beta diversity genes (TRBD genes), T cell receptor
beta joining genes (TRBJ genes), T cell receptor beta constant
genes (TRBC genes), T cell receptor gamma variable genes (TRGV
genes), T cell receptor gamma joining genes (TRGJ genes), T cell
receptor gamma constant genes (TRGC genes), T cell receptor delta
variable genes (TRDV genes), T cell receptor delta diversity genes
(TRDD genes), T cell receptor delta joining genes (TRDJ genes), and
T cell receptor delta constant genes (TRDC genes).
[0213] The ability to characterize individual cells from larger
diverse populations of cells is also of significant value in both
environmental testing as well as in forensic analysis, where
samples may, by their nature, be made up of diverse populations of
cells and other material that "contaminate" the sample, relative to
the cells for which the sample is being tested, e.g., environmental
indicator organisms, toxic organisms, and the like for, e.g.,
environmental and food safety testing, victim and/or perpetrator
cells in forensic analysis for sexual assault, and other violent
crimes, and the like.
[0214] Additionally the methods and compositions disclosed herein,
allow the determination of not only the immune repertoire and
different clonotypes, but the functional characteristics (e.g., the
transcriptome) of the cells associated with a clonotype or
plurality of clonotypes that bind to the same or similar antigen.
These functional characteristics can comprise transcription of
cytokine, chemokine, or cell-surface associated molecules, such as,
costimulatory molecules, checkpoint inhibitors, cell surface
maturation markers, or cell-adhesion molecules. Such analysis
allows a cell or cell population expressing a particular T cell
receptor, B cell receptor, or immunoglobulin to be associated with
certain functional characteristics. For example, for any given
antigen there will be multiple clonotypes of T cell receptor, B
cell receptor, or immunoglobulin that specifically bind to that
antigen. Multiple clonotypes that bind to the same antigen are
known as the idiotype.
[0215] Additional useful applications of the above described single
cell sequencing and characterization processes are in the field of
neuroscience research and diagnosis. In particular, neural cells
can include long interspersed nuclear elements (LINEs), or
`jumping` genes that can move around the genome, which cause each
neuron to differ from its neighbor cells. Research has shown that
the number of LINES in human brain exceeds that of other tissues,
e.g., heart and liver tissue, with between 80 and 300 unique
insertions (See, e.g., Coufal, N. G. et al. Nature 460, 1127-1131
(2009)). These differences have been postulated as being related to
a person's susceptibility to neuro-logical disorders (see, e.g.,
Muotri, A. R. et al. Nature 468, 443-446 (2010)), or provide the
brain with a diversity with which to respond to challenges. As
such, the methods described herein may be used in the sequencing
and characterization of individual neural cells.
[0216] The single cell analysis methods described herein are also
useful in the analysis of gene expression, as noted above, both in
terms of identification of RNA transcripts and their quantitation.
In particular, using the single cell level analysis methods
described herein, one can isolate and analyze the RNA transcripts
present in individual cells, populations of cells, or subsets of
populations of cells. In particular, in some cases, the barcode
oligonucleotides may be configured to prime, replicate and
consequently yield barcoded fragments of RNA from individual cells.
For example, in some cases, the barcode oligonucleotides may
include mRNA specific priming sequences, e.g., poly-T primer
segments that allow priming and replication of mRNA in a reverse
transcription reaction or other targeted priming sequences.
Alternatively or additionally, random RNA priming may be carried
out using random N-mer primer segments of the barcode
oligonucleotides.
[0217] FIG. 6 provides a schematic of one example method for RNA
expression analysis in individual cells using the methods described
herein. As shown, at operation 602 a cell containing sample is
sorted for viable cells, which are quantified and diluted for
subsequent partitioning. At operation 604, the individual cells
separately co-partitioned with gel beads bearing the barcoding
oligonucleotides as described herein. The cells are lysed and the
barcoded oligonucleotides released into the partitions at operation
606, where they interact with and hybridize to the mRNA at
operation 608, e.g., by virtue of a poly-T primer sequence, which
is complementary to the poly-A tail of the mRNA. Using the poly-T
barcode oligonucleotide as a priming sequence, a reverse
transcription reaction is carried out at operation 610 to
synthesize a cDNA transcript of the mRNA that includes the barcode
sequence. The barcoded cDNA transcripts are then subjected to
additional amplification at operation 612, e.g., using a polymerase
chain reaction (PCR) process, purification at operation 614, before
they are placed on a nucleic acid sequencing system for
determination of the cDNA sequence and its associated barcode
sequence(s). In some cases, as shown, operations 602 through 608
can occur while the reagents remain in their original droplet or
partition, while operations 612 through 616 can occur in bulk
(e.g., outside of the partition). In the case where a partition is
a droplet in an emulsion, the emulsion can be broken and the
contents of the droplet pooled in order to complete operations 612
through 616. In some cases, barcode oligonucleotides may be
digested with exonucleases after the emulsion is broken.
Exonuclease activity can be inhibited by ethylenediaminetetraacetic
acid (EDTA) following primer digestion. In some cases, operation
610 may be performed either within the partitions based upon
co-partitioning of the reverse transcription mixture, e.g., reverse
transcriptase and associated reagents, or it may be performed in
bulk.
[0218] As noted elsewhere herein, the structure of the barcode
oligonucleotides may include a number of sequence elements in
addition to the oligonucleotide barcode sequence. One example of a
barcode oligonucleotide for use in RNA analysis as described above
is shown in FIG. 7. As shown, the overall oligonucleotide 702 is
coupled to a bead 704 by a releasable linkage 706, such as a
disulfide linker. The oligonucleotide may include functional
sequences that are used in subsequent processing, such as
functional sequence 708, which may include one or more of a
sequencer specific flow cell attachment sequence, e.g., a P5
sequence for Illumina sequencing systems, as well as sequencing
primer sequences, e.g., a R1 primer for Illumina sequencing
systems. A barcode sequence 710 is included within the structure
for use in barcoding the sample RNA. An mRNA specific priming
sequence, such as poly-T sequence 712 is also included in the
oligonucleotide structure. An anchoring sequence segment 714 may be
included to ensure that the poly-T sequence hybridizes at the
sequence end of the mRNA. This anchoring sequence can include a
random short sequence of nucleotides, e.g., 1-mer, 2-mer, 3-mer or
longer sequence, which will ensure that the poly-T segment is more
likely to hybridize at the sequence end of the poly-A tail of the
mRNA. An additional sequence segment 716 may be provided within the
oligonucleotide sequence. In some cases, this additional sequence
provides a unique molecular identifier (UMI) sequence segment,
e.g., as a random sequence (e.g., such as a random N-mer sequence)
that varies across individual oligonucleotides coupled to a single
bead, whereas barcode sequence 710 can be constant among
oligonucleotides tethered to an individual bead. This unique
sequence serves to provide a unique identifier of the starting mRNA
molecule that was captured, in order to allow quantitation of the
number of original expressed RNA. As will be appreciated, although
shown as a single oligonucleotide tethered to the surface of a
bead, individual bead can include tens to hundreds of thousands or
even millions of individual oligonucleotide molecules, where, as
noted, the barcode segment can be constant or relatively constant
for a given bead, but where the variable or unique sequence segment
will vary across an individual bead. This unique molecular
identifier (UMI) sequence segment may include from 5 to about 8 or
more nucleotides within the sequence of the oligonucleotides. In
some cases, the unique molecular identifier (UMI) sequence segment
can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19 or 20 nucleotides in length or longer. In some cases, the unique
molecular identifier (UMI) sequence segment can be at least 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20
nucleotides in length or longer. In some cases, the unique
molecular identifier (UMI) sequence segment can be at most 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20
nucleotides in length or shorter.
[0219] In operation, and with reference to FIGS. 6 and 7, a cell is
co-partitioned along with a barcode bearing bead and lysed while
the barcoded oligonucleotides are released from the bead. The
poly-T portion of the released barcode oligonucleotide then
hybridizes to the poly-A tail of the mRNA. The poly-T segment then
primes the reverse transcription of the mRNA to produce a cDNA
transcript of the mRNA, but which includes each of the sequence
segments 708-716 of the barcode oligonucleotide. Again, because the
oligonucleotide 702 includes an anchoring sequence 714, it will
more likely hybridize to and prime reverse transcription at the
sequence end of the poly-A tail of the mRNA. Within any given
partition, all of the cDNA transcripts of the individual mRNA
molecules will include a common barcode sequence segment 710.
However, by including the unique random N-mer sequence, the
transcripts made from different mRNA molecules within a given
partition will vary at this unique sequence. This provides a
quantitation feature that can be identifiable even following any
subsequent amplification of the contents of a given partition,
e.g., the number of unique segments associated with a common
barcode can be indicative of the quantity of mRNA originating from
a single partition, and thus, a single cell. As noted above, the
transcripts are then amplified, cleaned up and sequenced to
identify the sequence of the cDNA transcript of the mRNA, as well
as to sequence the barcode segment and the unique sequence
segment.
[0220] As noted elsewhere herein, while a poly-T primer sequence is
described, other targeted or random priming sequences may also be
used in priming the reverse transcription reaction. In some cases,
the primer sequence can be a gene specific primer sequence which
targets specific genes for reverse transcription. In some examples,
such target genes comprise T cell receptor genes, B cell receptor
genes or immunoglobulin receptor genes. Likewise, although
described as releasing the barcoded oligonucleotides into the
partition along with the contents of the lysed cells, it will be
appreciated that in some cases, the gel bead bound oligonucleotides
may be used to hybridize and capture the mRNA on the solid phase of
the gel beads, in order to facilitate the separation of the RNA
from other cell contents.
[0221] An additional example of a barcode oligonucleotide for use
in RNA analysis, including messenger RNA (mRNA, including mRNA
obtained from a cell) analysis, is shown in FIG. 9A. As shown, the
overall oligonucleotide 902 can be coupled to a bead 904 by a
releasable linkage 906, such as a disulfide linker. The
oligonucleotide may include functional sequences that are used in
subsequent processing, such as functional sequence 908, which may
include a sequencer specific flow cell attachment sequence, e.g., a
P5 sequence for Illumina sequencing systems, as well as functional
sequence 910, which may include sequencing primer sequences, e.g.,
a R1 primer binding site for Illumina sequencing systems. A barcode
sequence 912 is included within the structure for use in barcoding
the sample RNA. An RNA specific (e.g., mRNA specific) priming
sequence, such as poly-T sequence 914 is also included in the
oligonucleotide structure. An anchoring sequence segment (not
shown) may be included to ensure that the poly-T sequence
hybridizes at the sequence end of the mRNA. An additional sequence
segment 916 may be provided within the oligonucleotide sequence.
This additional sequence can provide a unique molecular identifier
(UMI) sequence segment, e.g., as a random N-mer sequence that
varies across individual oligonucleotides coupled to a single bead,
whereas barcode sequence 912 can be constant among oligonucleotides
tethered to an individual bead. As described elsewhere herein, this
unique sequence can serve to provide a unique identifier of the
starting mRNA molecule that was captured, in order to allow
quantitation of the number of original expressed RNA, e.g., mRNA
counting. As will be appreciated, although shown as a single
oligonucleotide tethered to the surface of a bead, individual beads
can include tens to hundreds of thousands or even millions of
individual oligonucleotide molecules, where, as noted, the barcode
segment can be constant or relatively constant for a given bead,
but where the variable or unique sequence segment will vary across
an individual bead.
[0222] In an example method of cellular RNA (e.g., mRNA) analysis
and in reference to FIG. 9A, a cell is co-partitioned along with a
barcode bearing bead, switch oligo 924, and other reagents such as
reverse transcriptase, a reducing agent and dNTPs into a partition
(e.g., a droplet in an emulsion). In operation 950, the cell is
lysed while the barcoded oligonucleotides 902 are released from the
bead (e.g., via the action of the reducing agent) and the poly-T
segment 914 of the released barcode oligonucleotide then hybridizes
to the poly-A tail of mRNA 920 that is released from the cell.
Next, in operation 952 the poly-T segment 914 is extended in a
reverse transcription reaction using the mRNA as a template to
produce a cDNA transcript 922 complementary to the mRNA and also
includes each of the sequence segments 908, 912, 910, 916 and 914
of the barcode oligonucleotide. Terminal transferase activity of
the reverse transcriptase can add additional bases to the cDNA
transcript (e.g., polyC). The switch oligo 924 may then hybridize
with the additional bases added to the cDNA transcript and
facilitate template switching. A sequence complementary to the
switch oligo sequence can then be incorporated into the cDNA
transcript 922 via extension of the cDNA transcript 922 using the
switch oligo 924 as a template. Within any given partition, all of
the cDNA transcripts of the individual mRNA molecules will include
a common barcode sequence segment 912. However, by including the
unique random N-mer sequence 916, the transcripts made from
different mRNA molecules within a given partition will vary at this
unique sequence. As described elsewhere herein, this provides a
quantitation feature that can be identifiable even following any
subsequent amplification of the contents of a given partition,
e.g., the number of unique segments associated with a common
barcode can be indicative of the quantity of mRNA originating from
a single partition, and thus, a single cell. Following operation
952, the cDNA transcript 922 is then amplified with primers 926
(e.g., PCR primers) in operation 954. Next, the amplified product
is then purified (e.g., via solid phase reversible immobilization
(SPRI)) in operation 956. At operation 958, the amplified product
is then sheared, ligated to additional functional sequences, and
further amplified (e.g., via PCR). The functional sequences may
include a sequencer specific flow cell attachment sequence 930,
e.g., a P7 sequence for Illumina sequencing systems, as well as
functional sequence 928, which may include a sequencing primer
binding site, e.g., for a R2 primer for Illumina sequencing
systems, as well as functional sequence 932, which may include a
sample index, e.g., an i7 sample index sequence for Illumina
sequencing systems. In some cases, operations 950 and 952 can occur
in the partition, while operations 954, 956 and 958 can occur in
bulk solution (e.g., in a pooled mixture outside of the partition).
In the case where a partition is a droplet in an emulsion, the
emulsion can be broken and the contents of the droplet pooled in
order to complete operations 954, 956 and 958. In some cases,
operation 954 may be completed in the partition. In some cases,
barcode oligonucleotides may be digested with exonucleases after
the emulsion is broken. Exonuclease activity can be inhibited by
ethylenediaminetetraacetic acid (EDTA) following primer digestion.
Although described in terms of specific sequence references used
for certain sequencing systems, e.g., Illumina systems, it will be
understood that the reference to these sequences is for
illustration purposes only, and the methods described herein may be
configured for use with other sequencing systems incorporating
specific priming, attachment, index, and other operational
sequences used in those systems, e.g., systems available from Ion
Torrent, Oxford Nanopore, Genia, Pacific Biosciences, Complete
Genomics, and the like.
[0223] In an alternative example of a barcode oligonucleotide for
use in RNA (e.g., cellular RNA) analysis as shown in FIG. 9A,
functional sequence 908 may be a P7 sequence and functional
sequence 910 may be a R2 primer binding site. Moreover, the
functional sequence 930 may be a P5 sequence, functional sequence
928 may be a R1 primer binding site, and functional sequence 932
may be an i5 sample index sequence for Illumina sequencing systems.
The configuration of the constructs generated by such a barcode
oligonucleotide can help minimize (or avoid) sequencing of the
poly-T sequence during sequencing.
[0224] Shown in FIG. 9B is another example method for RNA analysis,
including cellular mRNA analysis. In this method, the switch oligo
924 is co-partitioned with the individual cell and barcoded bead
along with reagents such as reverse transcriptase, a reducing agent
and dNTPs into a partition (e.g., a droplet in an emulsion). The
switch oligo 924 may be labeled with an additional tag 934, e.g.,
biotin. In operation 951, the cell is lysed while the barcoded
oligonucleotides 902 (e.g., as shown in FIG. 9A) are released from
the bead (e.g., via the action of the reducing agent). In some
cases, sequence 908 is a P7 sequence and sequence 910 is a R2
primer binding site. In other cases, sequence 908 is a P5 sequence
and sequence 910 is a R1 primer binding site. Next, the poly-T
segment 914 of the released barcode oligonucleotide hybridizes to
the poly-A tail of mRNA 920 that is released from the cell. In
operation 953, the poly-T segment 914 is then extended in a reverse
transcription reaction using the mRNA as a template to produce a
cDNA transcript 922 complementary to the mRNA and also includes
each of the sequence segments 908, 912, 910, 916 and 914 of the
barcode oligonucleotide. Terminal transferase activity of the
reverse transcriptase can add additional bases to the cDNA
transcript (e.g., polyC). The switch oligo 924 may then hybridize
with the cDNA transcript and facilitate template switching. A
sequence complementary to the switch oligo sequence can then be
incorporated into the cDNA transcript 922 via extension of the cDNA
transcript 922 using the switch oligo 924 as a template. Next, an
isolation operation 960 can be used to isolate the cDNA transcript
922 from the reagents and oligonucleotides in the partition. The
additional tag 934, e.g., biotin, can be contacted with an
interacting tag 936, e.g., streptavidin, which may be attached to a
magnetic bead 938. At operation 960 the cDNA can be isolated with a
pull-down operation (e.g., via magnetic separation, centrifugation)
before amplification (e.g., via PCR) in operation 955, followed by
purification (e.g., via solid phase reversible immobilization
(SPRI)) in operation 957 and further processing (shearing, ligation
of sequences 928, 932 and 930 and subsequent amplification (e.g.,
via PCR)) in operation 959. In some cases where sequence 908 is a
P7 sequence and sequence 910 is a R2 primer binding site, sequence
930 is a P5 sequence and sequence 928 is a R1 primer binding site
and sequence 932 is an i5 sample index sequence. In some cases
where sequence 908 is a P5 sequence and sequence 910 is a R1 primer
binding site, sequence 930 is a P7 sequence and sequence 928 is a
R2 primer binding site and sequence 932 is an i7 sample index
sequence. In some cases, as shown, operations 951 and 953 can occur
in the partition, while operations 960, 955, 957 and 959 can occur
in bulk solution (e.g., in a pooled mixture outside of the
partition). In the case where a partition is a droplet in an
emulsion, the emulsion can be broken and the contents of the
droplet pooled in order to complete operation 960. The operations
955, 957, and 959 can then be carried out following operation 960
after the transcripts are pooled for processing.
[0225] Shown in FIG. 9C is another example method for RNA analysis,
including cellular mRNA analysis. In this method, the switch oligo
924 is co-partitioned with the individual cell and barcoded bead
along with reagents such as reverse transcriptase, a reducing agent
and dNTPs in a partition (e.g., a droplet in an emulsion). In
operation 961, the cell is lysed while the barcoded
oligonucleotides 902 (e.g., as shown in FIG. 9A) are released from
the bead (e.g., via the action of the reducing agent). In some
cases, sequence 908 is a P7 sequence and sequence 910 is a R2
primer binding site. In other cases, sequence 908 is a P5 sequence
and sequence 910 is a R1 primer binding site. Next, the poly-T
segment 914 of the released barcode oligonucleotide then hybridizes
to the poly-A tail of mRNA 920 that is released from the cell.
Next, in operation 963 the poly-T segment 914 is then extended in a
reverse transcription reaction using the mRNA as a template to
produce a cDNA transcript 922 complementary to the mRNA and also
includes each of the sequence segments 908, 912, 910, 916 and 914
of the barcode oligonucleotide. Terminal transferase activity of
the reverse transcriptase can add additional bases to the cDNA
transcript (e.g., polyC). The switch oligo 924 may then hybridize
with the cDNA transcript and facilitate template switching. A
sequence complementary to the switch oligo sequence can then be
incorporated into the cDNA transcript 922 via extension of the cDNA
transcript 922 using the switch oligo 924 as a template. Following
operation 961 and operation 963, mRNA 920 and cDNA transcript 922
are denatured in operation 962. At operation 964, a second strand
is extended from a primer 940 having an additional tag 942, e.g.,
biotin, and hybridized to the cDNA transcript 922. Also in
operation 964, the biotin labeled second strand can be contacted
with an interacting tag 936, e.g., streptavidin, which may be
attached to a magnetic bead 938. The cDNA can be isolated with a
pull-down operation (e.g., via magnetic separation, centrifugation)
before amplification (e.g., via polymerase chain reaction (PCR)) in
operation 965, followed by purification (e.g., via solid phase
reversible immobilization (SPRI)) in operation 967 and further
processing (shearing, ligation of sequences 928, 932 and 930 and
subsequent amplification (e.g., via PCR)) in operation 969. In some
cases where sequence 908 is a P7 sequence and sequence 910 is a R2
primer binding site, sequence 930 is a P5 sequence and sequence 928
is a R1 primer binding site and sequence 932 is an i5 sample index
sequence. In some cases where sequence 908 is a P5 sequence and
sequence 910 is a R1 primer binding site, sequence 930 is a P7
sequence and sequence 928 is a R2 primer binding site and sequence
932 is an i7 sample index sequence. In some cases, operations 961
and 963 can occur in the partition, while operations 962, 964, 965,
967, and 969 can occur in bulk (e.g., outside the partition). In
the case where a partition is a droplet in an emulsion, the
emulsion can be broken and the contents of the droplet pooled in
order to complete operations 962, 964, 965, 967 and 969.
[0226] Shown in FIG. 9D is another example method for RNA analysis,
including cellular mRNA analysis. In this method, the switch oligo
924 is co-partitioned with the individual cell and barcoded bead
along with reagents such as reverse transcriptase, a reducing agent
and dNTPs. In operation 971, the cell is lysed while the barcoded
oligonucleotides 902 (e.g., as shown in FIG. 9A) are released from
the bead (e.g., via the action of the reducing agent). In some
cases, sequence 908 is a P7 sequence and sequence 910 is a R2
primer binding site. In other cases, sequence 908 is a P5 sequence
and sequence 910 is a R1 primer binding site. Next the poly-T
segment 914 of the released barcode oligonucleotide then hybridizes
to the poly-A tail of mRNA 920 that is released from the cell. Next
in operation 973, the poly-T segment 914 is then extended in a
reverse transcription reaction using the mRNA as a template to
produce a cDNA transcript 922 complementary to the mRNA and also
includes each of the sequence segments 908, 912, 910, 916 and 914
of the barcode oligonucleotide. Terminal transferase activity of
the reverse transcriptase can add additional bases to the cDNA
transcript (e.g., polyC). The switch oligo 924 may then hybridize
with the cDNA transcript and facilitate template switching. A
sequence complementary to the switch oligo sequence can then be
incorporated into the cDNA transcript 922 via extension of the cDNA
transcript 922 using the switch oligo 924 as a template. In
operation 966, the mRNA 920, cDNA transcript 922 and switch oligo
924 can be denatured, and the cDNA transcript 922 can be hybridized
with a capture oligonucleotide 944 labeled with an additional tag
946, e.g., biotin. In this operation, the biotin-labeled capture
oligonucleotide 944, which is hybridized to the cDNA transcript,
can be contacted with an interacting tag 936, e.g., streptavidin,
which may be attached to a magnetic bead 938. Following separation
from other species (e.g., excess barcoded oligonucleotides) using a
pull-down operation (e.g., via magnetic separation,
centrifugation), the cDNA transcript can be amplified (e.g., via
PCR) with primers 926 at operation 975, followed by purification
(e.g., via solid phase reversible immobilization (SPRI)) in
operation 977 and further processing (shearing, ligation of
sequences 928, 932 and 930 and subsequent amplification (e.g., via
PCR)) in operation 979. In some cases where sequence 908 is a P7
sequence and sequence 910 is a R2 primer binding site, sequence 930
is a P5 sequence and sequence 928 is a R1 primer binding site and
sequence 932 is an i5 sample index sequence. In other cases where
sequence 908 is a P5 sequence and sequence 910 is a R1 primer
binding site, sequence 930 is a P7 sequence and sequence 928 is a
R2 primer binding site and sequence 932 is an i7 sample index
sequence. In some cases, operations 971 and 973 can occur in the
partition, while operations 966, 975, 977 (purification), and 979
can occur in bulk (e.g., outside the partition). In the case where
a partition is a droplet in an emulsion, the emulsion can be broken
and the contents of the droplet pooled in order to complete
operations 966, 975, 977 and 979.
[0227] Shown in FIG. 9E is another example method for RNA analysis,
including cellular RNA analysis. In this method, an individual cell
is co-partitioned along with a barcode bearing bead, a switch oligo
990, and other reagents such as reverse transcriptase, a reducing
agent and dNTPs into a partition (e.g., a droplet in an emulsion).
In operation 981, the cell is lysed while the barcoded
oligonucleotides (e.g., 902 as shown in FIG. 9A) are released from
the bead (e.g., via the action of the reducing agent). In some
cases, sequence 908 is a P7 sequence and sequence 910 is a R2
primer binding site. In other cases, sequence 908 is a P5 sequence
and sequence 910 is a R1 primer binding site. Next, the poly-T
segment of the released barcode oligonucleotide then hybridizes to
the poly-A tail of mRNA 920 released from the cell. Next at
operation 983, the poly-T segment is then extended in a reverse
transcription reaction to produce a cDNA transcript 922
complementary to the mRNA and also includes each of the sequence
segments 908, 912, 910, 916 and 914 of the barcode oligonucleotide.
Terminal transferase activity of the reverse transcriptase can add
additional bases to the cDNA transcript (e.g., polyC). The switch
oligo 990 may then hybridize with the cDNA transcript and
facilitate template switching. A sequence complementary to the
switch oligo sequence and including a T7 promoter sequence, can be
incorporated into the cDNA transcript 922. At operation 968, a
second strand is synthesized and at operation 970 the T7 promoter
sequence can be used by T7 polymerase to produce RNA transcripts in
in vitro transcription. At operation 985 the RNA transcripts can be
purified (e.g., via solid phase reversible immobilization (SPRI)),
reverse transcribed to form DNA transcripts, and a second strand
can be synthesized for each of the DNA transcripts. In some cases,
prior to purification, the RNA transcripts can be contacted with a
DNase (e.g., DNAase I) to break down residual DNA. At operation 987
the DNA transcripts are then fragmented and ligated to additional
functional sequences, such as sequences 928, 932 and 930 and, in
some cases, further amplified (e.g., via PCR). In some cases where
sequence 908 is a P7 sequence and sequence 910 is a R2 primer
binding site, sequence 930 is a P5 sequence and sequence 928 is a
R1 primer binding site and sequence 932 is an i5 sample index
sequence. In some cases where sequence 908 is a P5 sequence and
sequence 910 is a R1 primer binding site, sequence 930 is a P7
sequence and sequence 928 is a R2 primer binding site and sequence
932 is an i7 sample index sequence. In some cases, prior to
removing a portion of the DNA transcripts, the DNA transcripts can
be contacted with an RNase to break down residual RNA. In some
cases, operations 981 and 983 can occur in the partition, while
operations 968, 970, 985 and 987 can occur in bulk (e.g., outside
the partition). In the case where a partition is a droplet in an
emulsion, the emulsion can be broken and the contents of the
droplet pooled in order to complete operations 968, 970, 985 and
987.
[0228] The approaches of FIGS. 9A-9E may be employed for use with
various target regions. In some examples, such target regions are
TCR, BCR, and/or immunoglobulin regions. In such examples,
oligonucleotides coupled to beads may include primers with
sequences that are targeted for such target regions (e.g., constant
regions). For example, polyT primer regions can instead be gene
specific primer sequences.
[0229] Another example of a barcode oligonucleotide for use in RNA
analysis, including messenger RNA (mRNA, including mRNA obtained
from a cell) analysis is shown in FIG. 10. As shown, the overall
oligonucleotide 1002 is coupled to a bead 1004 by a releasable
linkage 1006, such as a disulfide linker. The oligonucleotide may
include functional sequences that are used in subsequent
processing, such as functional sequence 1008, which may include a
sequencer specific flow cell attachment sequence, e.g., a P7
sequence, as well as functional sequence 1010, which may include
sequencing primer sequences, e.g., a R2 primer binding site. A
barcode sequence 1012 is included within the structure for use in
barcoding the sample RNA. An RNA specific (e.g., mRNA specific)
priming sequence, such as poly-T sequence 1014 may be included in
the oligonucleotide structure. An anchoring sequence segment (not
shown) may be included to ensure that the poly-T sequence
hybridizes at the sequence end of the mRNA. An additional sequence
segment 1016 may be provided within the oligonucleotide sequence.
This additional sequence can provide a unique molecular identifier
(UMI) sequence segment, as described elsewhere herein. An
additional functional sequence 1020 may be included for in vitro
transcription, e.g., a T7 RNA polymerase promoter sequence. As will
be appreciated, although shown as a single oligonucleotide tethered
to the surface of a bead, individual beads can include tens to
hundreds of thousands or even millions of individual
oligonucleotide molecules, where, as noted, the barcode segment can
be constant or relatively constant for a given bead, but where the
variable or unique sequence segment will vary across an individual
bead.
[0230] In an example method of cellular RNA analysis and in
reference to FIG. 10, a cell is co-partitioned along with a barcode
bearing bead, and other reagents such as reverse transcriptase,
reducing agent and dNTPs into a partition (e.g., a droplet in an
emulsion). In operation 1050, the cell is lysed while the barcoded
oligonucleotides 1002 are released (e.g., via the action of the
reducing agent) from the bead, and the poly-T segment 1014 of the
released barcode oligonucleotide then hybridizes to the poly-A tail
of mRNA 1020. Next at operation 1052, the poly-T segment is then
extended in a reverse transcription reaction using the mRNA as
template to produce a cDNA transcript 1022 of the mRNA and also
includes each of the sequence segments 1020, 1008, 1012, 1010,
1016, and 1014 of the barcode oligonucleotide. Within any given
partition, all of the cDNA transcripts of the individual mRNA
molecules will include a common barcode sequence segment 1012.
However, by including the unique random N-mer sequence, the
transcripts made from different mRNA molecules within a given
partition will vary at this unique sequence. As described elsewhere
herein, this provides a quantitation feature that can be
identifiable even following any subsequent amplification of the
contents of a given partition, e.g., the number of unique segments
associated with a common barcode can be indicative of the quantity
of mRNA originating from a single partition, and thus, a single
cell. At operation 1054 a second strand is synthesized and at
operation 1056 the T7 promoter sequence can be used by T7
polymerase to produce RNA transcripts in in vitro transcription. At
operation 1058 the transcripts are fragmented (e.g., sheared),
ligated to additional functional sequences, and reverse
transcribed. The functional sequences may include a sequencer
specific flow cell attachment sequence 1030, e.g., a P5 sequence,
as well as functional sequence 1028, which may include sequencing
primers, e.g., a R1 primer binding sequence, as well as functional
sequence 1032, which may include a sample index, e.g., an i5 sample
index sequence. At operation 1060 the RNA transcripts can be
reverse transcribed to DNA, the DNA amplified (e.g., via PCR), and
sequenced to identify the sequence of the cDNA transcript of the
mRNA, as well as to sequence the barcode segment and the unique
sequence segment. In some cases, operations 1050 and 1052 can occur
in the partition, while operations 1054, 1056, 1058 and 1060 can
occur in bulk (e.g., outside the partition). In the case where a
partition is a droplet in an emulsion, the emulsion can be broken
and the contents of the droplet pooled in order to complete
operations 1054, 1056, 1058 and 1060.
[0231] In an alternative example of a barcode oligonucleotide for
use in RNA (e.g., cellular RNA) analysis as shown in FIG. 10,
functional sequence 1008 may be a P5 sequence and functional
sequence 1010 may be a R1 primer binding site. Moreover, the
functional sequence 1030 may be a P7 sequence, functional sequence
1028 may be a R2 primer binding site, and functional sequence 1032
may be an i7 sample index sequence.
[0232] An additional example of a barcode oligonucleotide for use
in RNA analysis, including messenger RNA (mRNA, including mRNA
obtained from a cell) analysis is shown in FIG. 11. As shown, the
overall oligonucleotide 1102 is coupled to a bead 1104 by a
releasable linkage 1106, such as a disulfide linker. The
oligonucleotide may include functional sequences that are used in
subsequent processing, such as functional sequence 1108, which may
include a sequencer specific flow cell attachment sequence, e.g., a
P5 sequence, as well as functional sequence 1110, which may include
sequencing primer sequences, e.g., a R1 primer binding site. In
some cases, sequence 1108 is a P7 sequence and sequence 1110 is a
R2 primer binding site. A barcode sequence 1112 is included within
the structure for use in barcoding the sample RNA. An additional
sequence segment 1116 may be provided within the oligonucleotide
sequence. In some cases, this additional sequence can provide a
unique molecular identifier (UMI) sequence segment, as described
elsewhere herein. An additional sequence 1114 may be included to
facilitate template switching, e.g., polyG. As will be appreciated,
although shown as a single oligonucleotide tethered to the surface
of a bead, individual beads can include tens to hundreds of
thousands or even millions of individual oligonucleotide molecules,
where, as noted, the barcode segment can be constant or relatively
constant for a given bead, but where the variable or unique
sequence segment will vary across an individual bead.
[0233] In an example method of cellular mRNA analysis and in
reference to FIG. 11, a cell is co-partitioned along with a
microcapsule (e.g., bead bearing a barcoded oligonucleotide), polyT
sequence, and other reagents such as a DNA polymerase, a reverse
transcriptase, oligonucleotide primers, dNTPs, and reducing agent
into a partition (e.g., a droplet in an emulsion). The partition
can serve as a reaction volume. As described elsewhere herein, the
partition serving as the reaction volume can comprise a container
or vessel such as a well, a microwell, vial, a tube, through ports
in nanoarray substrates, or micro-vesicles having an outer barrier
surrounding an inner fluid center or core, emulsion, or a droplet.
In some embodiments, the partition comprises a droplet of aqueous
fluid within a non-aqueous continuous phase, e.g., an oil phase.
Within the partition, the cell can be lysed and the barcoded
oligonucleotides can be released from the bead (e.g., via the
action of the reducing agent or other stimulus). Cell lysis and
release of the barcoded oligonucleotides from the microcapsule may
occur simultaneously in the partition (e.g., a droplet in an
emulsion) or the reaction volume. In some embodiments, cell lysis
precedes release of the barcoded oligonucleotides from the
microcapsule. In some embodiments, release of the barcoded
oligonucleotides from the microcapsule precedes cell lysis.
[0234] Subsequent to cell lysis and the release of barcoded
oligonucleotides from the microcapsule, the reaction volume can be
subjected to an amplification reaction to generate an amplification
product. In an example amplification reaction, the polyT sequence
hybridizes to the polyA tail of mRNA 1120 released from the cell as
illustrated in operation 1150. Next, in operation 1152, the polyT
sequence is then extended in a reverse transcription reaction using
the mRNA as a template to produce a cDNA transcript 1122
complementary to the mRNA. Terminal transferase activity of the
reverse transcriptase can add additional bases to the cDNA
transcript (e.g., polyC) in a template independent manner. The
additional bases added to the cDNA transcript, e.g., polyC, can
then hybridize with 1114 of the barcoded oligonucleotide. This can
facilitate template switching and a sequence complementary to the
barcoded oligonucleotide can be incorporated into the cDNA
transcript. In various embodiments, the barcoded oligonucleotide
does not hybridize to the template polynucleotide.
[0235] The barcoded oligonucleotide, upon release from the
microcapsule, can be present in the reaction volume at any suitable
concentration. In some embodiments, the barcoded oligonucleotide is
present in the reaction volume at a concentration of about 0.2
.mu.M, 0.3 .mu.M, 0.4 .mu.M, 0.5 .mu.M, 1 .mu.M, 5 .mu.M, 10 .mu.M,
15 .mu.M, 20 .mu.M, 25 .mu.M, 30 .mu.M, 35 .mu.M, 40 .mu.M, 50
.mu.M, 100 .mu.M, 150 .mu.M, 200 .mu.M, 250 .mu.M, 300 .mu.M, 400
.mu.M, or 500 .mu.M. In some embodiments, the barcoded
oligonucleotide is present in the reaction volume at a
concentration of at least about 0.2 .mu.M, 0.3 .mu.M, 0.4 .mu.M,
0.5 .mu.M, 1 .mu.M, 5 .mu.M, 10 .mu.M, 15 .mu.M, 20 .mu.M, 25
.mu.M, 30 .mu.M, 35 .mu.M, 40 .mu.M, 50 .mu.M, 100 .mu.M, 150
.mu.M, 200 .mu.M, 250 .mu.M, 300 .mu.M, 400 .mu.M, 500 .mu.M or
greater. In some embodiments, the barcoded oligonucleotide is
present in the reaction volume at a concentration of at most about
0.2 .mu.M, 0.3 .mu.M, 0.4 .mu.M, 0.5 .mu.M, 1 .mu.M, 5 .mu.M, 10
.mu.M, 15 .mu.M, 20 .mu.M, 25 .mu.M, 30 .mu.M, 35 .mu.M, 40 .mu.M,
50 .mu.M, 100 .mu.M, 150 .mu.M, 200 .mu.M, 250 .mu.M, 300 .mu.M,
400 .mu.M, or 500 .mu.M.
[0236] The transcripts can be further processed (e.g., amplified,
portions removed, additional sequences added, etc.) and
characterized as described elsewhere herein. In some embodiments,
the transcripts are sequenced directly. In some embodiments, the
transcripts are further processed (e.g., portions removed,
additional sequences added, etc) and then sequenced. In some
embodiments, the reaction volume is subjected to a second
amplification reaction to generate an additional amplification
product. The transcripts or first amplification products can be
used as the template for the second amplification reaction. In some
embodiments, primers for the second amplification reaction comprise
the barcoded oligonucleotide and polyT sequence. In some
embodiments, primers for the second amplification reaction comprise
additional primers co-partitioned with the cell. In some
embodiments, these additional amplification products are sequenced
directly. In some embodiments, these additional amplification
products are further processed (e.g., portions removed, additional
sequences added, etc) and then sequenced. The configuration of the
amplification products (e.g., first amplification products and
second amplification products) generated by such a method can help
minimize (or avoid) sequencing of the poly-T sequence during
sequencing.
[0237] An additional example of a barcode oligonucleotide for use
in RNA analysis, including cellular RNA analysis is shown in FIG.
12A. As shown, the overall oligonucleotide 1202 is coupled to a
bead 1204 by a releasable linkage 1206, such as a disulfide linker.
The oligonucleotide may include functional sequences that are used
in subsequent processing, such as functional sequence 1208, which
may include a sequencer specific flow cell attachment sequence,
e.g., a P5 sequence, as well as functional sequence 1210, which may
include sequencing primer sequences, e.g., a R1 primer binding
site. In some cases, sequence 1208 is a P7 sequence and sequence
1210 is a R2 primer binding site. A barcode sequence 1212 is
included within the structure for use in barcoding the sample RNA.
An additional sequence segment 1216 may be provided within the
oligonucleotide sequence. In some cases, this additional sequence
can provide a unique molecular identifier (UMI) sequence segment,
as described elsewhere herein. As will be appreciated, although
shown as a single oligonucleotide tethered to the surface of a
bead, individual beads can include tens to hundreds of thousands or
even millions of individual oligonucleotide molecules, where, as
noted, the barcode segment can be constant or relatively constant
for a given bead, but where the variable or unique sequence segment
will vary across an individual bead. In an example method of
cellular RNA analysis using this barcode, a cell is co-partitioned
along with a barcode bearing bead and other reagents such as RNA
ligase and a reducing agent into a partition (e.g., a droplet in an
emulsion). The cell is lysed while the barcoded oligonucleotides
are released (e.g., via the action of the reducing agent) from the
bead. The barcoded oligonucleotides can then be ligated to the 5'
end of mRNA transcripts while in the partitions by RNA ligase.
Subsequent operations may include purification (e.g., via solid
phase reversible immobilization (SPRI)) and further processing
(shearing, ligation of functional sequences, and subsequent
amplification (e.g., via PCR)), and these operations may occur in
bulk (e.g., outside the partition). In the case where a partition
is a droplet in an emulsion, the emulsion can be broken and the
contents of the droplet pooled for the additional operations.
[0238] An additional example of a barcode oligonucleotide for use
in RNA analysis, including cellular RNA analysis is shown in FIG.
12B. As shown, the overall oligonucleotide 1222 is coupled to a
bead 1224 by a releasable linkage 1226, such as a disulfide linker.
The oligonucleotide may include functional sequences that are used
in subsequent processing, such as functional sequence 1228, which
may include a sequencer specific flow cell attachment sequence,
e.g., a P5 sequence, as well as functional sequence 1230, which may
include sequencing primer sequences, e.g., a R1 primer binding
site. In some cases, sequence 1228 is a P7 sequence and sequence
1230 is a R2 primer binding site. A barcode sequence 1232 is
included within the structure for use in barcoding the sample RNA.
A priming sequence 1234 (e.g., a random priming sequence) can also
be included in the oligonucleotide structure, e.g., a random
hexamer. An additional sequence segment 1236 may be provided within
the oligonucleotide sequence. In some cases, this additional
sequence provides a unique molecular identifier (UMI) sequence
segment, as described elsewhere herein. As will be appreciated,
although shown as a single oligonucleotide tethered to the surface
of a bead, individual beads can include tens to hundreds of
thousands or even millions of individual oligonucleotide molecules,
where, as noted, the barcode segment can be constant or relatively
constant for a given bead, but where the variable or unique
sequence segment will vary across an individual bead. In an example
method of cellular mRNA analysis using the barcode oligonucleotide
of FIG. 12B, a cell is co-partitioned along with a barcode bearing
bead and additional reagents such as reverse transcriptase, a
reducing agent and dNTPs into a partition (e.g., a droplet in an
emulsion). The cell is lysed while the barcoded oligonucleotides
are released from the bead (e.g., via the action of the reducing
agent). In some cases, sequence 1228 is a P7 sequence and sequence
1230 is a R2 primer binding site. In other cases, sequence 1228 is
a P5 sequence and sequence 1230 is a R1 primer binding site. The
priming sequence 1234 of random hexamers can randomly hybridize
cellular mRNA. The random hexamer sequence can then be extended in
a reverse transcription reaction using mRNA from the cell as a
template to produce a cDNA transcript complementary to the mRNA and
also includes each of the sequence segments 1228, 1232, 1230, 1236,
and 1234 of the barcode oligonucleotide. Subsequent operations may
include purification (e.g., via solid phase reversible
immobilization (SPRI)), further processing (shearing, ligation of
functional sequences, and subsequent amplification (e.g., via
PCR)), and these operations may occur in bulk (e.g., outside the
partition). In the case where a partition is a droplet in an
emulsion, the emulsion can be broken and the contents of the
droplet pooled for additional operations. Additional reagents that
may be co-partitioned along with the barcode bearing bead may
include oligonucleotides to block ribosomal RNA (rRNA) and
nucleases to digest genomic DNA and cDNA from cells. Alternatively,
rRNA removal agents may be applied during additional processing
operations. The configuration of the constructs generated by such a
method can help minimize (or avoid) sequencing of the poly-T
sequence during sequencing.
[0239] The single cell analysis methods described herein may also
be useful in the analysis of the whole transcriptome. Referring
back to the barcode of FIG. 12B, the priming sequence 1234 may be a
random N-mer. In some cases, sequence 1228 is a P7 sequence and
sequence 1230 is a R2 primer binding site. In other cases, sequence
1228 is a P5 sequence and sequence 1230 is a R1 primer binding
site. In an example method of whole transcriptome analysis using
this barcode, the individual cell is co-partitioned along with a
barcode bearing bead, poly-T sequence, and other reagents such as
reverse transcriptase, polymerase, a reducing agent and dNTPs into
a partition (e.g., droplet in an emulsion). In an operation of this
method, the cell is lysed while the barcoded oligonucleotides are
released from the bead (e.g., via the action of the reducing agent)
and the poly-T sequence hybridizes to the poly-A tail of cellular
mRNA. In a reverse transcription reaction using the mRNA as
template, cDNA transcripts of cellular mRNA can be produced. The
RNA can then be degraded with an RNase. The priming sequence 1234
in the barcoded oligonucleotide can then randomly hybridize to the
cDNA transcripts. The oligonucleotides can be extended using
polymerase enzymes and other extension reagents co-partitioned with
the bead and cell similar to as shown in FIG. 3 to generate
amplification products (e.g., barcoded fragments), similar to the
example amplification product shown in FIG. 3 (panel F). The
barcoded nucleic acid fragments may, in some cases subjected to
further processing (e.g., amplification, addition of additional
sequences, clean up processes, etc. as described elsewhere herein)
characterized, e.g., through sequence analysis. In this operation,
sequencing signals can come from full length RNA.
[0240] In some embodiments, the barcode sequence can be appended to
the 3' end of the template polynucleotide sequence (e.g., mRNA).
Such configuration may be desired, for example, if the sequence at
the 3' end of the template polynucleotide is desired to be
analyzed.
[0241] In some embodiments, the barcode sequence can be appended to
the 5' end of a template polynucleotide sequence (e.g., mRNA). Such
configuration may be desired, for example, if the sequence at the
5' end of the template polynucleotide is desired to be
analyzed.
[0242] In some embodiments, a barcode sequence can be appended to
the 3' end of a first subset of the template polynucleotides, and a
barcode sequence can be appended to the 5' end of a second subset
of the template polynucleotides. In some embodiments, the first
subset of template polynucleotides and the second subset of
template polynucleotides are appended to barcode sequences in the
same partition. In some cases, the barcodes appended to the 3' ends
of template polynucleotides are different from the barcodes
appended to the 5' ends of template polynucleotides. For example,
the barcodes appended to the 3' ends may have a different barcode
sequence compared to the barcodes appended to the 5' end. In some
cases, the barcodes appended to the 3' ends of template
polynucleotides have the same barcode sequence as the barcodes
appended to the 5' ends of template polynucleotides. In some cases,
beads are used to deliver the barcode oligonucleotides to
partitions. The different barcodes can be attached to the same or
different bead.
[0243] A barcode sequence can be appended to the 5' end of a
template polynucleotide sequence by any suitable method. In some
cases, the template polynucleotide is a messenger RNA, mRNA,
molecule. The barcode sequence can be appended to the 5' end of a
template polynucleotide sequence by use of a primer comprising the
barcode sequence in a primer extension reaction. For example, the
barcode may be present in a primer used for a primer extension
reaction in which the template polynucleotide or a derivative
thereof, for example an amplification product, is used as the
template for primer extension. In some cases, the barcode may be
present on a template switching oligonucleotide participating in a
primer extension reaction. As an alternative, the barcode sequence
can be appended to the 5' end of a template polynucleotide by
ligating an oligonucleotide comprising the barcode sequence
directly to the template polynucleotide.
[0244] In another aspect, the present disclosure provides a method
of appending a barcode sequence to the 5' end of a template
polynucleotide sequence by a primer extension reaction using a
primer comprising a barcode sequence and the template
polynucleotide or a derivative thereof as the template for primer
extension. The primer extension reaction may occur in a partition.
In some embodiments, a cell, or a nucleic acid derivative thereof,
is co-partitioned with a primer capable of primer extension and a
template switching oligo comprising a barcode sequence. The primer
capable of primer extension may hybridize to a nucleic acid of the
cell or to a nucleic acid derivative. In some cases, the template
switching oligo comprising the barcode sequence is releasably
attached to a bead, e.g., a gel bead. In some embodiments, a cell,
or a nucleic acid derivative thereof, is co-partitioned with a
primer having a sequence towards a 3' end that hybridizes to the
template polynucleotide, a template switching oligonucleotide
having a first predefined sequence towards a 5' end, and a
microcapsule, such as a bead, having barcoded oligonucleotides
releasably coupled thereto. In some embodiments, the
oligonucleotides coupled to the bead include barcode sequences that
are identical (e.g., all oligonucleotides sharing the same barcode
sequence). In some aspects, the oligonucleotides coupled to the
beads additionally include unique molecular identifier (UMI)
sequence segments (e.g., all oligonucleotides having different
unique molecular identifier sequences).
[0245] In an example, FIG. 18 shows a barcoded oligonucleotide
coupled to a bead. As shown, the overall oligonucleotide 1802 is
coupled to a bead 1804 by a releasable linkage 1806, such as a
disulfide linker. The oligonucleotide may include functional
sequences that are useful for subsequent processing, such as
functional sequence 1808, which may include a sequencer specific
flow cell attachment sequence, e.g., a P5 sequence, as well as
functional sequence 1810, which may include sequencing primer
sequences, e.g., a R1 primer binding site. In some cases, sequence
1808 is a P7 sequence and sequence 1810 is a R2 primer binding
site. A barcode sequence 1812 can be included within the structure
for use in barcoding the template polynucleotide. The functional
sequences may be selected for compatibility with a variety of
different sequencing systems, e.g., 454 Sequencing, Ion Torrent
Proton or PGM, Illumina X10, etc., and the requirements thereof. In
many cases, the barcode sequence 1812, functional sequences 1808
(e.g., flow cell attachment sequence) and 1810 (e.g., sequencing
primer sequences) may be common to all of the oligonucleotides
attached to a given bead. The barcoded oligonucleotide can also
comprise a sequence 1816 to facilitate template switching (e.g., a
polyG sequence). In some cases, the additional sequence provides a
unique molecular identifier (UMI) sequence segment, as described
elsewhere herein. The one or more functional sequences that may be
present in an oligonucleotide can be arranged in any suitable
order.
[0246] Although shown as a single oligonucleotide tethered to the
surface of a bead, individual beads can include tens to hundreds of
thousands or even millions of individual oligonucleotide molecules,
where, as previously noted herein, the barcode sequence can be
constant or relatively constant for a given bead.
[0247] In an example method of generating labeled polynucleotides
using a barcode oligonucleotide, a cell or a nucleic acid derived
therefrom is co-partitioned with a bead bearing a barcoded
oligonucleotide and reagents such as reverse transcriptase, poly-T
primers, dNTPs, and a chemical stimulus (e.g., reducing agent) into
a partition. The barcoded oligonucleotide attached to the bead can
comprise a sequence to facilitate template switching (e.g., polyG
or riboG). The partition can be a droplet in an emulsion. In cases
where a cell is provided in the partition, the partition can
further comprise a lysis reagent to lyse the cell.
[0248] Where the bead is a degradable or disruptable bead, the
barcoded oligonucleotide can be released from the bead when
contacted with the chemical stimulus (e.g., reducing agent).
Following release from the bead, the barcoded oligonucleotide can
be present in the partition at any suitable concentration. In some
embodiments, the barcoded oligonucleotide is present in the
partition at a concentration that is suitable for generating a
sufficient yield of amplification products for downstream
processing and analysis, including, but not limited to, sequencing
adaptor attachment and sequencing analysis.
[0249] With reference to FIG. 19A, in 1901A, an oligonucleotide
with a poly-T sequence 1914A, and in some cases an additional
sequence 1916A that binds to, for example, a sequencing or PCR
primer, anneals to a target mRNA 1920A. In 1902A, the
oligonucleotide is extended yielding an anti-sense strand 1922A
which is appended by multiple cytidines on the 3' end. In 1903A,
the template switching sequence 1990A (e.g., polyG or riboG) of the
barcoded oligonucleotide pairs with the cytidines of the anti-sense
strand 1922A and the anti-sense strand is extended using the
barcoded oligonucleotide as template. In addition to the riboG
sequence, the barcoded oligonucleotide can comprise additional
functional sequences 1908A, 1912A, and 1910A. In some cases, the
barcoded oligonucleotide comprises a unique molecular identifier
(UMI, for example 1908A), a barcode sequence (for example 1912A),
and a Read 1 sequence (R1, for example 1910A). Operations 1901A,
1902A, and 1903A may be performed in the partition (e.g., droplet
or well). The extension in 1902A and 1903A can be facilitated by an
enzyme comprising polymerase activity. For example, the extension
can be facilitated by a DNA-dependent polymerase or a
reverse-transcriptase (e.g., RNA dependent). In some embodiments,
the extension comprises polymerase chain reaction. In some
embodiments, the extension comprises reverse transcription. The
enzyme can add nucleotides in a template independent manner. In
some cases, at least three cytidines are appended to the 3' end of
the cDNA transcript in a template independent manner.
[0250] Subsequent to 1903A, the nucleic acid product (e.g., cDNA
product) may be released from the partition and subject to further
processing reactions such as additional amplification. In some
cases, the nucleic acid product is pooled with products from other
partitions for subsequent processing in bulk. In some cases, a
portion of the amplified product can be subjected to enrichment to
obtain a subset of nucleic acids corresponding to genes of
interest.
[0251] In some cases, enrichment to obtain a subset of nucleic
acids corresponding to genes of interest comprises one or more
amplification reactions. One or more gene specific primers can be
used for primer extension using the cDNA molecule as a template.
Any of a variety of polymerases can be used in embodiments herein
for primer extension, non-limiting examples of which include
exonuclease minus DNA Polymerase I large (Klenow) Fragment, Phi29
DNA polymerase, Taq DNA Polymerase, T4 DNA polymerase, T7 DNA
polymerase, and the like. Further examples of polymerase enzymes
that can be used in embodiments herein include thermostable
polymerases, including but not limited to, Thermus thermophilus
HB8; Thermus oshimai; Thermus scotoductus; Thermus thermophilus
1B21; Thermus thermophilus GK24; Thermus aquaticus polymerase
AmpliTaq.RTM. FS or Taq (G46D; F667Y), Taq (G46D; F667Y; E6811),
and Taq (G46D; F667Y; T664N; R660G); Pyrococcus furiosus
polymerase; Thermococcus gorgonarius polymerase; Pyrococcus species
GB-D polymerase; Thermococcus sp. (strain 9 deg. N-7) polymerase;
Bacillus stearo thermophilus polymerase; Tsp polymerase; Thermus
flavus polymerase; Thermus litoralis polymerase; Thermus Z05
polymerase; delta Z05 polymerase (e.g. delta Z05 Gold DNA
polymerase); and mutants, variants, or derivatives thereof. In some
embodiments, a hot start polymerase is used. A hot start polymerase
is a modified form of a DNA polymerase that can be activated by
incubation at elevated temperatures.
[0252] Additional functional sequences can be added to the nucleic
acid product or an amplification product thereof. The additional
functional sequences may allow for amplification or sample
identification. This may occur in the partition or, alternatively,
in bulk. In some cases, the amplification products can be sheared,
ligated to adapters and amplified to add additional functional
sequences. In some cases, both the enriched and unenriched
amplification products are subject to analysis.
[0253] In an example method of cellular polynucleotide analysis
using the barcode oligonucleotide of FIG. 18, a cell is
co-partitioned along with a bead bearing a barcoded oligonucleotide
and additional reagents such as reverse transcriptase, primers,
oligonucleotides (e.g., template switching oligonucleotides),
dNTPs, and reducing agent into a partition (e.g., a droplet in an
emulsion). Within the partition, the cell can be lysed to yield a
plurality of template polynucleotides (e.g., DNA such as genomic
DNA, RNA such as mRNA, etc). In some cases, the cell is lysed using
a lysis reagent that is co-partitioned with the cell.
[0254] Where the bead is a degradable or disruptable bead, the
barcoded oligonucleotide can be released from the bead following
the application of stimulus as previously described herein.
Following release from the bead, the barcoded oligonucleotide can
be present in the partition at any suitable concentration. In some
embodiments, the barcoded oligonucleotide is present in the
partition at a concentration that is suitable for generating a
sufficient yield of amplification products for downstream
processing and analysis, including, but not limited to, sequencing
adaptor attachment and sequencing analysis. In some embodiments,
the concentration of the barcoded oligonucleotide is limited by the
loading capacity of the barcode bearing bead, or the amount of
oligonucleotides deliverable by the bead.
[0255] The template switching oligonucleotide, which can be
co-partitioned with the cell, bead bearing barcoded
oligonucleotides, etc, can be present in the partition at any
suitable concentration. In some embodiments, the template switching
oligonucleotide is present in the partition at a concentration that
is suitable for efficient template switching during an
amplification reaction. The concentration of the template switching
oligonucleotide can be dependent on the reagents used for droplet
generation. In some embodiments, the template switching
oligonucleotide is among a plurality of template switching
oligonucleotides.
[0256] In some embodiments, the barcoded oligonucleotide and
template switching oligonucleotide are present in the partition at
similar concentrations. In some embodiments, the barcoded
oligonucleotide and template switching oligonucleotides may be
present in proportions reflective of the desired amount of
amplification products to be generated using each oligonucleotide.
In some embodiments, the template switching oligonucleotide is
present in the partition at a greater concentration than the
barcoded oligonucleotide. This difference in concentration can be
due to limitations on the capacity of the barcode bearing bead. In
some embodiments, the concentration of the template switching
oligonucleotide in the reaction volume is at least 2, 5, 10, 20,
50, 100, 200 or more times that of the concentration of the
barcoded oligonucleotide in the same reaction volume when the
barcoded oligonucleotide is free in the partition (e.g., not
attached to the bead).
[0257] As illustrated in FIG. 19B, a reaction mixture comprising a
template polynucleotide from a cell 1920B and (i) the primer 1924B
having a sequence towards a 3' end that hybridizes to the template
polynucleotide (e.g., polyT) and an additional sequence element
1900B and (ii) a template switching oligonucleotide 1926B that
comprises a first predefined sequence 1810 towards a 5' end can be
subjected to an amplification reaction to yield a first
amplification product. In some cases, the template polynucleotide
is an mRNA with a polyA tail and the primer that hybridizes to the
template polynucleotide comprises a polyT sequence towards a 3'
end, which is complementary to the polyA segment. The first
predefined sequence can comprise at least one of an adaptor
sequence, a barcode sequence, a unique molecular identifier (UMI)
sequence, a primer binding site, and a sequencing primer binding
site or any combination thereof. In some cases, the first
predefined sequence 1810 is a sequence that can be common to all
partitions of a plurality of partitions. For example, the first
predefined sequence may comprise a flow cell attachment sequence,
an amplification primer binding site, or a sequencing primer
binding site and the first amplification reaction facilitates the
attachment the predefined sequence to the template polynucleotide
from the cell. In some embodiments, the first predefined sequence
comprises a primer binding site. In some embodiments, the first
predefined sequence comprises a sequencing primer binding site. In
some embodiments, the first predefined sequence comprises a barcode
sequence. As illustrated in operation 1950B, the sequence towards a
3' end (e.g., polyT) of the primer 1924B hybridizes to the template
polynucleotide 1920B. In a first amplification reaction, extension
reaction reagents, e.g., reverse transcriptase, nucleoside
triphosphates, co-factors (e.g., Mg2+ or Mn2+), that are also
co-partitioned, can extend the primer 1924B sequence using the
cell's nucleic acid as a template, to produce a transcript, e.g.,
cDNA transcript, 1922B having a fragment complementary to the
nucleic acid to which the primer annealed. In some cases, the
reverse transcriptase has terminal transferase activity and the
reverse transcriptase adds additional nucleotides, e.g., polyC, to
the cDNA transcript in a template independent manner. As
illustrated in operation 1952B, the template switching
oligonucleotide 1926B, for example a template switching
oligonucleotide which includes a polyG sequence, can hybridize to
the cDNA transcript 1922B and facilitate template switching in the
first amplification reaction. The transcript, therefore, may
comprise the sequence of the primer 1924B, a sequence complementary
to the template polynucleotide from the cell, and a sequence
complementary to the template switching oligonucleotide.
[0258] Among a plurality of partitions, the primer and template
switching oligonucleotide may be universal to all partitions. The
partitions may individually contain more than one cell, one cell,
no cells, or nucleic acids derived from a cell. Where analysis of
mRNA is desired, for example, the primer may comprise at least a
polyT segment capable of hybridizing and priming an extension
reaction from the polyA segment of an mRNA. Where analysis of a
variety of polynucleotides is desired, the primer may comprise a
random sequence capable of hybridizing to and priming extension
reactions randomly on various polynucleotide templates. As template
switching can occur with the use of an enzyme having terminal
transferase activity, a template switching oligonucleotide having a
sequence capable of hybridizing to the appended bases can be used
for template switching in manner that is independent of the
sequence of the polynucleotide templates to be analyzed. In some
embodiments, the template switching oligonucleotide can comprise a
first predefined sequence towards a 5' end that does not
specifically hybridize to the template. In some embodiments,
analysis of particular genes is desired. In such cases, the primer
may comprise a gene specific sequence capable of hybridizing to and
priming extension reactions from templates comprising specific
genes. In some embodiments, multiple genes are to be analyzed and a
primer is among a plurality of primers. Individual primers of the
plurality may target different genes. Each of the plurality of
primers may have a sequence for a particular gene.
[0259] Subsequent to the first amplification reaction, the first
amplification product or transcript can be subjected to a second
amplification reaction to generate a second amplification product.
In some cases, additional sequences (e.g., functional sequences
such as flow cell attachment sequence, sequencing primer binding
sequences, barcode sequences, etc) are to be attached. The first
and second amplification reactions can be performed in the same
volume, such as for example in a droplet or well. In some cases,
the first amplification product is subjected to a second
amplification reaction in the presence of a barcoded
oligonucleotide to generate a second amplification product having a
barcode sequence. The barcode sequence can be unique to a
partition, that is, each partition has a unique barcode sequence.
The barcoded oligonucleotide may comprise a sequence of at least a
segment of the template switching oligonucleotide and at least a
second predefined sequence. The segment of the template switching
oligonucleotide on the barcoded oligonucleotide can facilitate
hybridization of the barcoded oligonucleotide to the transcript,
e.g., cDNA transcript, to facilitate the generation of a second
amplification product. In addition to a barcode sequence, the
barcoded oligonucleotide may comprise a second defined sequence
such as at least one of an adaptor sequence, a unique molecular
identifier (UMI) sequence, a primer binding site, and a sequencing
primer binding site or any combination thereof.
[0260] In some embodiments, the second amplification reaction uses
the first amplification product as a template and the barcoded
oligonucleotide as a primer. As illustrated in operation 1954B, the
segment of the template switching oligonucleotide on the barcoded
oligonucleotide 1928B can hybridize to the portion of the cDNA
transcript or complementary fragment 1922B having a sequence
complementary to the template switching oligonucleotide or that
which was copied from the template switching oligonucleotide. In
the second amplification reaction, extension reaction reagents,
e.g., polymerase, nucleoside triphosphates, co-factors (e.g., Mg2+
or Mn2+), that are also co-partitioned, can extend the primer
sequence using the first amplification product as template as
illustrated in operation 1956B. The second amplification product
can comprise a second predefined sequence (e.g., 1808, 1812, and
1810), a sequence of a segment of the template polynucleotide
(e.g., mRNA), and a sequence complementary to the primer (e.g.,
1924B). In cases where the template polynucleotide is an mRNA
molecule, amplification products derived therefrom can comprise the
corresponding DNA sequence, for example thymine instead of uracil
bases.
[0261] In some embodiments, the second amplification product uses
the barcoded oligonucleotide as a template and at least a portion
of the first amplification product as a primer. As illustrated in
operation 1954B, the segment of the first amplification product
(e.g., cDNA transcript) having a sequence complementary to the
template switching oligonucleotide can hybridize to the segment of
the barcoded oligonucleotide comprising a sequence of at least a
segment of the template switching oligonucleotide. In the second
amplification reaction, extension reaction reagents, e.g.,
polymerase, nucleoside triphosphates, co-factors (e.g., Mg2+ or
Mn2+), that are also co-partitioned, can extend the primer sequence
(e.g., first amplification product) using the barcoded
oligonucleotide as template as illustrated in operation 1958B. The
second amplification product may comprise the sequence of the
primer (e.g., 1924B), a sequence which is complementary to the
sequence of the template polynucleotide (e.g., mRNA), and a
sequence complementary to the second predefined sequence (e.g.,
1808, 1812, and 1810).
[0262] In some embodiments, the second amplification reaction is
performed subsequent to the first amplification reaction in the
presence of an intervening purification step. An intervening
purification step can be used, for example, to purify the template
(e.g., first amplification product) from excess reagents, including
excess primers such as template switching oligonucleotides. In some
embodiments, the amplification reaction is performed in the absence
of an intervening purification step. In certain embodiments, an
intervening purification step is not performed so that all sample
preparation is performed in a same reaction volume. In the absence
of an intervening purification step, the template switching
oligonucleotide may compete with barcoded oligonucleotide in the
second amplification reaction as the barcoded oligonucleotide
comprises at least a segment of the template switching
oligonucleotide. Competition between the template switching
oligonucleotide and barcoded oligonucleotide in the second
amplification reaction to generate additional amplification product
may result in a second amplification product lacking a barcode
sequence. Such amplification products lacking a barcode sequence
may be undesirable as they lack a barcode sequence which can
provide unique identifying information of the template. In some
embodiments, the template switching oligonucleotide may out-compete
the barcoded oligonucleotide in the second amplification reaction
if the template switching oligonucleotide is present at a higher
concentration in the reaction volume than the barcoded
oligonucleotide. Various approaches can be utilized to favor the
use of the barcoded oligonucleotide in the second amplification
reaction to generate amplification products having a barcode
sequence in situations where the barcoded oligonucleotide is
present at a lower concentration than the template switching
oligonucleotide in the reaction volume.
[0263] In some embodiments, the template switching oligonucleotide
is not available for primer extension during the second
amplification reaction. In some embodiments, the template switching
oligonucleotide is degraded prior to the second amplification
reaction. In some embodiments, the template switching
oligonucleotide is degraded during the second amplification
reaction. The template switching oligonucleotide may comprise
ribonucleic acids (RNA). A template switching oligonucleotide
comprising RNA can be degraded, for example, by elevated
temperatures or alkaline conditions. In some embodiments, the
template switching oligonucleotide comprises at least 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, or 95% RNA. In some embodiments, the template switching
oligonucleotide comprises 100% RNA. In some embodiments, a first
reaction rate of the second amplification reaction using the
barcoded oligonucleotide is greater than a second reaction rate of
the second amplification using the template switching
oligonucleotide.
[0264] In some embodiments, the barcoded oligonucleotide can
hybridize to the first amplification product at a higher annealing
temperature as compared to the template switching oligonucleotide.
For example, the first amplification product and the barcoded
oligonucleotide can have a higher melting temperature as compared
to a melting temperature of the first amplification product and the
template switching oligonucleotide. In such cases, the second
amplification reaction may be performed with an annealing
temperature at which the barcoded oligonucleotide is able to
hybridize to the first amplification product and initiation primer
extension and at which the template switching oligonucleotide is
unable to hybridize to the first amplification product and initiate
primer extension. In some embodiments, the primer annealing
temperature of the second amplification reaction is at least about
0.5.degree. C., 1.degree. C., 2.degree. C., 3.degree. C., 4.degree.
C., 5.degree. C., 6.degree. C., 7.degree. C., 8.degree. C.,
9.degree. C., 10.degree. C. or greater than a primer annealing
temperature of the first amplification reaction. The difference in
melting temperatures can result from the presence of modified
nucleotides in the template switching oligonucleotide. In some
embodiment, the template switching oligonucleotide comprises at
least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, or 95% modified nucleotides. In some
embodiments, the template switching oligonucleotide comprises 100%
modified oligonucleotides. In some embodiments, the difference in
melting temperature can be the result of the presence of modified
nucleotides in the barcoded oligonucleotide. In some embodiment,
the barcoded oligonucleotide comprises at least 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or
95% modified nucleotides. In some embodiments, the barcoded
oligonucleotide comprises 100% modified oligonucleotides. Modified
nucleotides include, but are not limited to, 2-Aminopurine,
2,6-Diaminopurine (2-Amino-dA), inverted dT, 5-Methyl dC,
2'-deoxylnosine, Super T (5-hydroxybutynl-2'-deoxyuridine), Super G
(8-aza-7-deazaguanosine), locked nucleic acids (LNAs), unlocked
nucleic acids (UNAs, e.g., UNA-A, UNA-U, UNA-C, UNA-G), Iso-dG,
Iso-dC, and 2' Fluoro bases (e.g., Fluoro C, Fluoro U, Fluoro A,
and Fluoro G).
[0265] In various embodiments, the first amplification reaction is
facilitated using an enzyme comprising polymerase activity. For
example, the first amplification reaction can be facilitated by a
DNA-dependent polymerase or a reverse-transcriptase (e.g., RNA
dependent). In some embodiments, the first amplification reaction
comprises polymerase chain reaction. In some embodiments, the first
amplification reaction comprises reverse transcription. In various
embodiments, the second amplification reaction is facilitated using
an enzyme comprising polymerase activity. For example, the second
amplification reaction can be facilitated by a DNA-dependent
polymerase. In some embodiments, the second amplification reaction
comprises polymerase chain reaction.
[0266] In another aspect, a template polynucleotide comprising mRNA
may first be reverse transcribed to cDNA (e.g., an amplification
product of the template polynucleotide). The mRNA molecule can be
reverse transcribed to cDNA using a reverse transcriptase enzyme
and a primer, such as a poly-T primer. Non-limiting examples of
enzymes that can be used for reverse transcription in embodiments
herein include HIV-1 reverse transcriptase, M-MLV reverse
transcriptase, AMV reverse transcriptase, telomerase reverse
transcriptase, and variants, modified products and derivatives
thereof.
[0267] A gene specific primer having a barcode sequence can then be
used for primer extension using the cDNA molecule (e.g.,
amplification product of the template polynucleotide) as a
template. A primer comprising a barcode can hybridize to the cDNA
molecule via sequence complementarity. Extension of the primer
using the cDNA molecule as template may result in a polynucleotide
product comprising the template polynucleotide sequence and the
barcode sequence located at the 5' end of the template
polynucleotide sequence. Any of a variety of polymerases can be
used in embodiments herein for primer extension, non-limiting
examples of which include exonuclease minus DNA Polymerase I large
(Klenow) Fragment, Phi29 DNA polymerase, Taq DNA Polymerase, T4 DNA
polymerase, T7 DNA polymerase, and the like. Further examples of
polymerase enzymes that can be used in embodiments herein include
thermostable polymerases, including but not limited to, Thermus
thermophilus HB8; Thermus oshimai; Thermus scotoductus; Thermus
thermophilus 1B21; Thermus thermophilus GK24; Thermus aquaticus
polymerase AmpliTaq.RTM. FS or Taq (G46D; F667Y), Taq (G46D; F667Y;
E6811), and Taq (G46D; F667Y; T664N; R660G); Pyrococcus furiosus
polymerase; Thermococcus gorgonarius polymerase; Pyrococcus species
GB-D polymerase; Thermococcus sp. (strain 9 deg. N-7) polymerase;
Bacillus stearo thermophilus polymerase; Tsp polymerase; Thermus
flavus polymerase; Thermus litoralis polymerase; Thermus Z05
polymerase; delta Z05 polymerase (e.g. delta Z05 Gold DNA
polymerase); and mutants, variants, or derivatives thereof. In some
embodiments, a hot start polymerase is used. A hot start polymerase
is a modified form of a DNA polymerase that can be activated by
incubation at elevated temperatures. Such a polymerase can be used,
for example, to further increase sensitivity, specificity, and
yield; and/or to further improve low copy target amplification.
[0268] In another aspect, a barcode sequence is appended to the 5'
end of a template polynucleotide sequence by ligating an
oligonucleotide comprising a barcode sequence directly to the 5'
end of the template polynucleotide. Ligating an oligonucleotide
comprising a barcode sequence to a template polynucleotide can be
implemented by various methods. In some embodiments herein,
ligating an oligonucleotide comprising a barcode sequence to a
template polynucleotide involves an enzyme, such as a ligase (e.g.,
an RNA ligase or a DNA ligase). Non-limiting examples of enzymes
that can be used for ligation in embodiments herein include
ATP-dependent double-stranded polynucleotide ligases, NAD+
dependent DNA or RNA ligases, and single-strand polynucleotide
ligases. Non-limiting examples of ligases which can be used in
embodiments herein include CircLigase I and CircLigase II
(Epicentre; Madison, Wis.), Escherichia coli DNA ligase, Thermus
filiformis DNA ligase, Tth DNA ligase, Thermus scotoductus DNA
ligase (I and II), T3 DNA ligase, T4 DNA ligase, T4 RNA ligase, T7
DNA ligase, Taq ligase, Ampligase (Epicentre.RTM. Technologies
Corp.), VanC-type ligase, 9.degree. N DNA Ligase, Tsp DNA ligase,
DNA ligase I, DNA ligase III, DNA ligase IV, Sso7-T3 DNA ligase,
Sso7-T4 DNA ligase, Sso7-T7 DNA ligase, Sso7-Taq DNA ligase,
Sso7-E. coli DNA ligase, Sso7-Ampligase DNA ligase, and
thermostable ligases. Ligase enzymes may be wild-type, mutant
isoforms, and genetically engineered variants.
[0269] In some embodiments where a barcode oligonucleotide is
ligated to a template polynucleotide comprising mRNA, the mRNA
molecule can be treated to yield a 5' monophosphate group prior to
ligating. Any suitable reaction may be employed to yield a 5'
monophosphate group. For example, the mRNA molecule can be treated
with an enzyme such as a pyrophosphohydrolase. An example of a
pyrophosphohydrolase that can be used in embodiments herein is RNA
5' phyrophosphohydrolase (RppH). In some cases, all of the
phosphate groups at the 5' end of the molecule are removed and a
single phosphate groups is added back to the 5' end. In some cases,
two phosphate groups are removed from a triphosphate group to yield
a monophosphate. In some cases, a single enzyme both removes the
phosphate groups present on the mRNA molecule and adds the
monophosphate group. In some cases, a first enzyme removes the
phosphate groups present on the mRNA molecule and a second enzyme
adds the monophosphate group. In some cases, the phosphate groups
are removed from the 5' end of the mRNA molecule and the 5' end is
adenylated. An enzyme which can be used for 5' adenylation in
embodiments herein includes Mth RNA ligase.
[0270] In some cases, the oligonucleotide comprising the barcode
sequence is ligated to the template polynucleotide within a
partition (e.g., droplet or well). A partition, in some cases,
comprises a polynucleotide sample comprising the template
polynucleotide, an oligonucleotide having the barcode sequence, a
ligase enzyme, and any other suitable reagents for ligation. The
ligase can implement the attachment of the oligonucleotide
comprising the barcode sequence to the template polynucleotide
within the partition. In some cases, the template polynucleotide is
an mRNA molecule and the oligonucleotide ligated to it is a DNA
molecule. In some cases, the oligonucleotide comprising the barcode
sequence is ligated to the template polynucleotide outside of a
partition.
[0271] Following the attachment of an oligonucleotide comprising a
barcode sequence to the 5' end of a template polynucleotide, for
example an mRNA polynucleotide, the barcoded template can be
subjected to further amplification. In some cases, one or more
further amplification reactions are performed within the partition.
In some cases, one or more further amplification reactions are
performed outside of a partition. In some cases, a plurality of
barcoded mRNA polynucleotides, for example from a plurality of
partitions, is pooled and subjected to further processing in bulk.
In some embodiments, the barcoded template polynucleotide is
subjected to polymerase chain reaction. In some embodiments, the
template polynucleotide comprises mRNA and the barcoded template
polynucleotide is subjected to reverse transcription, yielding a
cDNA transcript. In embodiments where reverse transcription is
performed in a partition, the partitions can comprise primers
having a poly-T region capable of hybridizing to the poly-A region
of the barcoded mRNA. Within the partition, the primer having a
poly-T region can hybridize to the barcoded template and initiate
primer extension in reverse transcription. Non-limiting examples of
enzymes that can be used for reverse transcription in embodiments
herein include HIV-1 reverse transcriptase, M-MLV reverse
transcriptase, AMV reverse transcriptase, telomerase reverse
transcriptase, and variants, modified products and derivatives
thereof. A partition can contain a reverse transcriptase enzyme
capable of reverse transcribing a template polynucleotide that is
attached at its 5' end to a barcoded oligonucleotide. In
embodiments where reverse transcription is performed in bulk, a
plurality of barcoded mRNA polynucleotides from a plurality of
partitions can be pooled for bulk processing. The reaction volume
for performing reverse transcription can comprise primers having a
poly-T region capable of hybridizing to the poly-A region of a
barcoded mRNA. In some cases, the primers for reverse transcription
further comprise additional elements, such as tags, which can be
used, for example, for isolating cDNA transcripts. For example,
cDNA transcripts comprising biotin tags can be isolated from
components of the reaction volume (e.g., excess primers, reverse
transcriptase enzyme, barcoded mRNA molecules) by performing a
purification reaction with streptavidin or other molecule capable
of binding biotin.
[0272] Following the generation of barcoded template
polynucleotides or derivatives (e.g., amplification products)
thereof, subsequent operations may be performed, including
purification (e.g., via solid phase reversible immobilization
(SPRI)) or further processing (e.g., shearing, addition of
functional sequences, and subsequent amplification (e.g., via
PCR)). Functional sequences, such as flow cell sequences, may be
added by ligation. These operations may occur in bulk (e.g.,
outside the partition). In the case where a partition is a droplet
in an emulsion, the emulsion can be broken and the contents of the
droplet pooled for additional operations. Additional reagents that
may be co-partitioned along with the barcode bearing bead may
include oligonucleotides to block ribosomal RNA (rRNA) and
nucleases to digest genomic DNA from cells. Alternatively, rRNA
removal agents may be applied during additional processing
operations. The configuration of the constructs generated by such a
method can help minimize (or avoid) sequencing of the poly-T
sequence during sequencing and/or sequence the 5' end of a
polynucleotide sequence. The amplification products, for example
first amplification products and/or second amplification products,
may be subject to sequencing for sequence analysis.
[0273] Although operations with various barcode designs have been
discussed individually, individual beads can include barcode
oligonucleotides of various designs for simultaneous use.
[0274] In addition to characterizing individual cells or cell
sub-populations from larger populations, the processes and systems
described herein may also be used to characterize individual cells
as a way to provide an overall profile of a cellular, or other
organismal population. A variety of applications require the
evaluation of the presence and quantification of different cell or
organism types within a population of cells, including, for
example, microbiome analysis and characterization, environmental
testing, food safety testing, epidemiological analysis, e.g., in
tracing contamination or the like. In particular, the analysis
processes described above may be used to individually characterize,
sequence and/or identify large numbers of individual cells within a
population. This characterization may then be used to assemble an
overall profile of the originating population, which can provide
important prognostic and diagnostic information.
[0275] For example, shifts in human microbiomes, including, e.g.,
gut, buccal, epidermal microbiomes, etc., have been identified as
being both diagnostic and prognostic of different conditions or
general states of health. Using the single cell analysis methods
and systems described herein, one can again, characterize, sequence
and identify individual cells in an overall population, and
identify shifts within that population that may be indicative of
diagnostic ally relevant factors. By way of example, sequencing of
bacterial 16S ribosomal RNA genes has been used as a highly
accurate method for taxonomic classification of bacteria. Using the
targeted amplification and sequencing processes described above can
provide identification of individual cells within a population of
cells. One may further quantify the numbers of different cells
within a population to identify current states or shifts in states
over time. See, e.g., Morgan et al, PLoS Comput. Biol., Ch. 12,
December 2012, 8(12):e1002808, and Ram et al., Syst. Biol. Reprod.
Med., June 2011, 57(3):162-170, each of which is incorporated
herein by reference in its entirety for all purposes. Likewise,
identification and diagnosis of infection or potential infection
may also benefit from the single cell analyses described herein,
e.g., to identify microbial species present in large mixes of other
cells or other biological material, cells and/or nucleic acids,
including the environments described above, as well as any other
diagnostically relevant environments, e.g., cerebrospinal fluid,
blood, fecal or intestinal samples, or the like.
[0276] The foregoing analyses may also be particularly useful in
the characterization of potential drug resistance of different
cells or pathogens, e.g., cancer cells, bacterial pathogens, etc.,
through the analysis of distribution and profiling of different
resistance markers/mutations across cell populations in a given
sample. Additionally, characterization of shifts in these
markers/mutations across populations of cells over time can provide
valuable insight into the progression, alteration, prevention, and
treatment of a variety of diseases characterized by such drug
resistance issues.
[0277] Although described in terms of cells, it will be appreciated
that any of a variety of individual biological organisms, or
components of organisms are encompassed within this description,
including, for example, cells, viruses, organelles, cellular
inclusions, vesicles, or the like. Additionally, where referring to
cells, it will be appreciated that such reference includes any type
of cell, including without limitation prokaryotic cells, eukaryotic
cells, bacterial, fungal, plant, mammalian, or other animal cell
types, mycoplasmas, normal tissue cells, tumor cells, or any other
cell type, whether derived from single cell or multicellular
organisms.
[0278] Similarly, analysis of different environmental samples to
profile the microbial organisms, viruses, or other biological
contaminants that are present within such samples, can provide
important information about disease epidemiology, and potentially
aid in forecasting disease outbreaks, epidemics an pandemics.
[0279] As described above, the methods, systems and compositions
described herein may also be used for analysis and characterization
of other aspects of individual cells or populations of cells. In
one example process, a sample is provided that contains cells that
are to be analyzed and characterized as to their cell surface
proteins. Also provided is a library of antibodies, antibody
fragments, or other molecules having a binding affinity to the cell
surface proteins or antigens (or other cell features) for which the
cell is to be characterized (also referred to herein as cell
surface feature binding groups). For ease of discussion, these
affinity groups are referred to herein as binding groups. The
binding groups can include a reporter molecule that is indicative
of the cell surface feature to which the binding group binds. In
particular, a binding group type that is specific to one type of
cell surface feature will comprise a first reporter molecule, while
a binding group type that is specific to a different cell surface
feature will have a different reporter molecule associated with it.
In some aspects, these reporter molecules will comprise
oligonucleotide sequences. Oligonucleotide based reporter molecules
provide advantages of being able to generate significant diversity
in terms of sequence, while also being readily attachable to most
biomolecules, e.g., antibodies, etc., as well as being readily
detected, e.g., using sequencing or array technologies. In the
example process, the binding groups include oligonucleotides
attached to them. Thus, a first binding group type, e.g.,
antibodies to a first type of cell surface feature, will have
associated with it a reporter oligonucleotide that has a first
nucleotide sequence. Different binding group types, e.g.,
antibodies having binding affinity for other, different cell
surface features, will have associated therewith reporter
oligonucleotides that comprise different nucleotide sequences,
e.g., having a partially or completely different nucleotide
sequence. In some cases, for each type of cell surface feature
binding group, e.g., antibody or antibody fragment, the reporter
oligonucleotide sequence may be known and readily identifiable as
being associated with the known cell surface feature binding group.
These oligonucleotides may be directly coupled to the binding
group, or they may be attached to a bead, molecular lattice, e.g.,
a linear, globular, cross-linked, or other polymer, or other
framework that is attached or otherwise associated with the binding
group, which allows attachment of multiple reporter
oligonucleotides to a single binding group.
[0280] In the case of multiple reporter molecules coupled to a
single binding group, such reporter molecules can comprise the same
sequence, or a particular binding group will include a known set of
reporter oligonucleotide sequences. As between different binding
groups, e.g., specific for different cell surface features, the
reporter molecules can be different and attributable to the
particular binding group.
[0281] Attachment of the reporter groups to the binding groups may
be achieved through any of a variety of direct or indirect,
covalent or non-covalent associations or attachments. For example,
in the case of oligonucleotide reporter groups associated with
antibody based binding groups, such oligonucleotides may be
covalently attached to a portion of an antibody or antibody
fragment using chemical conjugation techniques (e.g.,
Lightning-Link.RTM. antibody labeling kits available from Innova
Biosciences), as well as other non-covalent attachment mechanisms,
e.g., using biotinylated antibodies and oligonucleotides (or beads
that include one or more biotinylated linker, coupled to
oligonucleotides) with an avidin or streptavidin linker. Antibody
and oligonucleotide biotinylation techniques are available (See,
e.g., Fang, et al., Fluoride-Cleavable Biotinylation
Phosphoramidite for 5'-end-Labeling and Affinity Purification of
Synthetic Oligonucleotides, Nucleic Acids Res. Jan. 15, 2003;
31(2):708-715, DNA 3' End Biotinylation Kit, available from Thermo
Scientific, the full disclosures of which are incorporated herein
by reference in their entirety for all purposes). Likewise, protein
and peptide biotinylation techniques have been developed and are
readily available (See, e.g., U.S. Pat. No. 6,265,552, the full
disclosures of which are incorporated herein by reference in their
entirety for all purposes).
[0282] The reporter oligonucleotides may be provided having any of
a range of different lengths, depending upon the diversity of
reporter molecules desired or a given analysis, the sequence
detection scheme employed, and the like. In some cases, these
reporter sequences can be greater than about 5 nucleotides in
length, greater than about 10 nucleotides in length, greater than
about 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150 or even 200
nucleotides in length. In some cases, these reporter nucleotides
may be less than about 250 nucleotides in length, less than about
200, 180, 150, 120 100, 90, 80, 70, 60, 50, 40, or even 30
nucleotides in length. In many cases, the reporter oligonucleotides
may be selected to provide barcoded products that are already
sized, and otherwise configured to be analyzed on a sequencing
system. For example, these sequences may be provided at a length
that ideally creates sequenceable products of a desired length for
particular sequencing systems. Likewise, these reporter
oligonucleotides may include additional sequence elements, in
addition to the reporter sequence, such as sequencer attachment
sequences, sequencing primer sequences, amplification primer
sequences, or the complements to any of these.
[0283] In operation, a cell-containing sample is incubated with the
binding molecules and their associated reporter oligonucleotides,
for any of the cell surface features desired to be analyzed.
Following incubation, the cells are washed to remove unbound
binding groups. Following washing, the cells are partitioned into
separate partitions, e.g., droplets, along with the barcode
carrying beads described above, where each partition includes a
limited number of cells, e.g., in some cases, a single cell. Upon
releasing the barcodes from the beads, they will prime the
amplification and barcoding of the reporter oligonucleotides. As
noted above, the barcoded replicates of the reporter molecules may
additionally include functional sequences, such as primer
sequences, attachment sequences or the like.
[0284] The barcoded reporter oligonucleotides are then subjected to
sequence analysis to identify which reporter oligonucleotides bound
to the cells within the partitions. Further, by also sequencing the
associated barcode sequence, one can identify that a given cell
surface feature likely came from the same cell as other, different
cell surface features, whose reporter sequences include the same
barcode sequence, i.e., they were derived from the same
partition.
[0285] Based upon the reporter molecules that emanate from an
individual partition based upon the presence of the barcode
sequence, one may then create a cell surface profile of individual
cells from a population of cells. Profiles of individual cells or
populations of cells may be compared to profiles from other cells,
e.g., `normal` cells, to identify variations in cell surface
features, which may provide diagnostically relevant information. In
particular, these profiles may be particularly useful in the
diagnosis of a variety of disorders that are characterized by
variations in cell surface receptors, such as cancer and other
disorders.
[0286] The present disclosure also provides methods for reducing
nonspecific priming in a single-cell 5' gene expression assay. In
generating an assay that allows measurement of 1) a cell barcode
sequence (barcode), 2) a unique molecular identifier sequence (UMI)
and 3) the 5' sequence of an mRNA transcript simultaneously, one
strategy is to place these sequences on a sequence that attaches to
the 5' end of an mRNA transcript--in the present disclosure, this
may be accomplished by placing the barcode and UMI on a template
switching oligonucleotide (TSO). This oligonucleotide may be
attached to the first strand cDNA via a template switching reaction
where the reverse transcription (RT) enzyme 1) reverse transcribes
a messenger RNA (mRNA) sequence into first-strand complementary DNA
(cDNA) from a primer targeting the 3' end of the mRNA, 2) adds
nontemplated cytidines to the 5' end of the first-strand cDNA, 3)
switches template to the TSO, which may contain 3' guanidines or
guanidine-derivatives that hybridize to the added cytidines. The
result is a first-strand cDNA molecule that is complementary to the
TSO sequence: cell-barcode, UMI, guanidines, and the 5' end of the
mRNA.
[0287] In some cases, the TSO may co-exist in solution with the RT
enzyme and the total RNA contents of a cell. If the TSO is a single
stranded DNA (ssDNA) molecule, it can participate as an RT primer
rather than as a template-switching substrate. Given, for example,
that the over 90% of the total RNA contents of a cell include
noncoding ribosomal RNA (rRNA), this may produce barcoded off
products that do not contribute to the 5' gene expression or V(D)J
sequencing assay but do consume sequencing reads, increasing the
cost required to achieve the same sequencing depth. In addition, if
the UMI is implemented as a randomer, the presence of this randomer
at the 3' end of the TSO greatly increases its ability to serve as
a primer on rRNA template.
[0288] In some cases, a TSO that is less likely to serve as an RT
primer via the introduction of a particular spacer sequence between
the UMI and terminal riboGs may be used. Another approach is to
design and include a set of auxiliary blocking oligonucleotides
that may hybridize to rRNA and prevent binding of the TSO.
[0289] The spacer sequence can be optimized by selecting a sequence
that minimizes the predicted melting temperature of the
(spacer-GGG):rRNA duplex against all human ribosomal RNA
molecules.
[0290] The blocker sequences can be optimized by selecting
sequences that maximize the predicted melting temperature of the
(blocker):rRNA duplex against all human ribosomal RNA
molecules.
[0291] Provided herein are TSO that are less likely to serve as an
RT primer via the introduction of a particular spacer sequence
between the UMI and terminal riboGs. Additionally, described herein
are auxiliary blocking oligonucleotides that hybridize to rRNA and
prevent binding of the TSO.
[0292] Table 1 provides examples of spacer sequences that are
optimized by selecting a sequence that minimizes the predicted
melting temperature of the (spacer-GGG):rRNA duplex against all
human ribosomal RNA molecules.
TABLE-US-00001 TABLE 1 Spacer sequences SEQ ID NO GG_S1_6 TTATATGGG
GG_S1_10 TTTCTTATATGGG 1 GG_S1_20 AAATCAAATCTTTCTTATATGGG 2
GG_S1_30 ACAAACAAATAAATCAAATCTTTCTTATATGGG 3 GG_S2_6 TTTAAAGGG
GG_S2_10 GAAATTTAAAGGG 4 GG_S2_20 CACTCTACATGAAATTTAAAGGG 5
GG_S2_30 CCAAAGTTGTCACTCTACATGAAATTTAAAGGG 6 GL6_S3_6 ATATAAGGG
GL6_S3_10 ATATATATAAGGG 7 GL6_S3_20 ATATATATATATATATATAAGGG 8
GL6_S3_30 ATATATATATATATATATATATATATATAAGGG 9
[0293] Table 2 provides examples of blocker sequences that are
optimized by selecting sequences that maximize the predicted
melting temperature of the (blocker):rRNA duplex against all human
ribosomal RNA molecules.
TABLE-US-00002 TABLE 2 Blocker sequences SEQ ID NO 28S_30_3130
GCCGGCCGCCCCGGCGGCCGCCGCGCGGCC 10 18S_30_254
GCCGCCGGCGCCCGCCCCCCGGCCGGGGCC 11 28S_30_2088
GCGCGCGCGCGCGCCGCCCCCGCCGCTCCC 12 28S_30_3284
GGGGCGCGCCGCGCCGCCGCCGGGCTCCCC 13 28S_30_834
GCCGCCGCCACCGCCGCCGCCGCCGCCGCC 14 28S_30_3373
GCCCCGCCCCGCCGCCCGCCGACCGCCGCC 15 28S_30_3473
GCGGCCCCTCCGCCGCCTGCCGCCGCCGCC 16 28S_30_4105
GGAGCGGGTCGCGCCCGGCCGGGCGGGCGC 17 28S_30_1129
GCCCCGCCCCCCGACCCGCGCGCGGCACCC 18 28S_30_3989
GGCGGCCCGCAGGGCCGCGGACCCCGCCCC 19 28S_30_4781
GGCGGGGCACGCGCCCTCCCGCGGCGGGGC 20 18S_30_1750
GCCAGGGCCGTGGGCCGACCCCGGCGGGGC 21 28S_30_611
GTCCCCCGCCGACCCCACCCCCGGCCCCGC 22 18S_30_693
GGCTCGCCTCGCGGCGGACCGCCCGCCCGC 23 28S_30_232
GACCCGGGCGCGCGCCGGCCGCTACCGGCC 24 28S_30_2919
GCGCGCCTCGTCCAGCCGCGGCGCGCGCCC 25 28S_30_1050
GCGCCGTGGGAGGGGTGGCCCGGCCCCCCC 26 28S_30_725
GGGCCCCCCGAGCCACCTTCCCCGCCGGGC 27 28S_30_2295
GGCGGCTCCACCCGGGCCCGCGCCCTAGGC 28 28S_30_3004
GGCGCGGGGTGGGGAGGGAGCGAGCGGCGC 29 28S_30_3547
GCTAGGCGCCGGCCGAGGCGAGGCGCGCGC 30 28S_30_115
GTCCCGCGCCCCGCGGGGCGGGGATTCGGC 31 28S_30_4858
GGGGCGGCCGCCTTTCCGGCCGCGCCCCGT 32 28S_30_1451
ACCTCCCCGGCGCGGCGGGCGAGACGGGCC 33 28S_30_472
GATCCGCCGGGCCGCCGACACGGCCGGACC 34 28S_30_1246
GCCGACCCCGTGCGCTCGCTCCGCCGTCCC 35 28S_30_936
GCGCGGCGACGGGTCTCGCTCCCTCGGCCC 36 28S_30_3207
GCCCGGCTCGCGTCCAGAGTCCGCGCCGCC 37 28S_30_2578
TCCCCGGGGCTCCCGCCGGCTTCTCCGGGA 38 28S_30_1380
ACCTCGGCCGGCGAGCGCGCCGGCCTTCAC 39 28S_30_1791
ACGCCCGGCTCCACGCCAGCGAGCCGGGCT 40 28S_30_2684
GCTCACCGGACGCCGCCGGAACCGCGACGC 41 28S_30_2441
TCGCCCGTCCCTTCGGAACGGCGCTCGCCC 42 28S_30_1671
GGGGTGCGTCGGGTCTGCGAGAGCGCCAGC 43 28S_30_4696
GGCCAACCGAGGCTCCGCGGCGCTGCCGTA 44 18S_30_1551
GTTACCCGCGCCTGCCGGCGTAGGGTAGGC 45 28S_30_3634
GCGTCAACACCCGCCGCGGGCCTTCGCGAT 46 18S_30_827
AGCTGCGGTATCCAGGCGGCTCGGGCCTGC 47 28S_30_1883
GCGTCGGCATCGGGCGCCTTAACCCGGCGT 48 18S_30_1088
GGGAATAACGCCGCCGCATCGCCGGTCGGC 49 18S_30_923
GCGGCGCAATACGAATGCCCCCGGCCGTCC 50 28S_30_2755
TGCTGCGGATATGGGTACGGCCCGGCGCGA 51 18S_30_328
GGGCAGACGTTCGAATGGGTCGTCGCCGCC 52 18S_30_1207
GCCGCAGGCTCCACTCCTGGTGGTGCCCTT 53 18S_30_597
ACCGCGGCTGCTGGCACCAGACTTGCCCTC 54 18S_30_473
GGGTCGGGAGTGGGTAATTTGCGCGCCTGC 55 28S_30_1
AGCGGGTCGCCACGTCTGATCTGAGGTCGC 56 28S_30_3851
TTCCCCGCTGATTCCGCCAAGCCCGTTCCC 57 28S_30_1556
TGCACGTCAGGACCGCTACGGACCTCCACC 58 28S_30_1954
AGCGGATTCCGACTTCCATGGCCACCGTCC 59 28S_30_4608
AGCTTCGCCCCATTGGCTCCTCAGCCAAGC 60 28S_30_4971
GATCGCAGCGAGGGAGCTGCTCTGCTACGT 61 18S_30_1311
GAACGGCCATGCACCACCACCCACGGAATC 62 18S_30_1446
TCTCGGGTGGCTGAACGCCACTTGTCCCTC 63 18S_30_164
GGGTCAGCGCCCGTCGGCATGTATTAGCTC 64 28S_30_4191
TCCTCCCTGAGCTCGCCTTAGGACACCTGC 65 18S_30_400
GGAATCGAACCCTGATTCCCCGTCACCCGT 66 18S_30_1679
ACGGGCGGTGTGTACAAAGGGCAGGGACTT 67 28S_30_2827
TACGGATCCGGCTTGCCGACTTCCCTTACC 68 18S_30_46
ACCGGCCGTGCGTACTTAGACATGCATGGC 69 28S_30_3716
GTCATAGTTACTCCCGCCGTTTACCCGCGC 70 18S_30_1837
GATCCTTCCGCAGGTTCACCTACGGAAACC 71 28S_30_4484
TCACGACGGTCTAAACCCAGCTCACGTTCC 72 28S_30_4273
GGCCCCGCTTTCACGGTCTGTATTCGTACT 73 28S_30_328
GTACTTGTTGACTATCGGTCTCGTGCCGGT 74 28S_30_2368
GGAACCCTTCTCCACTTCGGCCTTCAAAGT 75 28S_30_401
ACCCGTTTACCTCTTAACGGTTTCACGCCC 76 18S_30_1017
GAACCTCCGACTTTCGTTCTTGATTAATGA 77 28S_50_3116
GCCCCCGCCGGCCGCCCCGGCGGCCGCCGCGCG 78 GCCCCTGCCGCCCCGAC 28S_50_823
GCCCCCGCCGCCGCCGCCACCGCCGCCGCCGCC 79 GCCGCCCCGACCCGCGC 28S_50_3463
GGACCGGCCCGCGGCCCCTCCGCCGCCTGCCGC 80 CGCCGCCGCCGCGCGCC 28S_50_3353
GCCCCGCCCCGCCGCCCGCCGACCGCCGCCGCC 81 CGACCGCTCCCGCCCCC 28S_50_1113
GTCCGCCCCGCCCCCCGACCCGCGCGCGGCACC 82 CCCCCCGTCGCCGGGGC 28S_50_4779
ACCCCGGTCCCGGCGCGCGGCGGGGCACGCGCC 83 CTCCCGCGGCGGGGCGC 28S_50_569
GGCCCCGCCCGCCCACCCCCGCACCCGCCGGAG 84 CCCGCCCCCTCCGGGGA 28S_50_3969
GGCGGCCCGCAGGGCCGCGGACCCCGCCCCGGG 85 CCCCTCGCGGGGACACC 28S_50_2094
GCCGCCCTCCGACGCACACCACACGCGCGCGCG 86 CGCGCGCCGCCCCCGCC 28S_50_2904
GGGGCGCGCGCCTCGTCCAGCCGCGGCGCGCGC 87 CCAGCCCCGCTTCGCGC 18S_50_235
AGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGG 88 AGAGGGGCTGACCGGGT 18S_50_690
GGGCGGGGACGGGCGGTGGCTCGCCTCGCGGCG 89 GACCGCCCGCCCGCTCC 28S_50_3189
GGGCCCGGCTCGCGTCCAGAGTCCGCGCCGCCG 90 CCGGCCCCCCGGGTCCC 28S_50_4097
GGCACTGTCCCCGGAGCGGGTCGCGCCCGGCCG 91 GGCGGGCGCTTGGCGCC 28S_50_1030
GCGCCGTGGGAGGGGTGGCCCGGCCCCCCCACG 92 AGGAGACGCCGGCGCGC 28S_50_1434
TCCACCTCCCCGGCGCGGCGGGCGAGACGGGCC 93 GGTGGTGCGCCCTCGGC 28S_50_687
TCCCCGCCGGGCCTTCCCAGCCGTCCCGGAGCC 94 GGTCGCGGCGCACCGCC 28S_50_3534
GTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGC 95 GCGCGGAACCGCGGCCC 28S_50_207
GGGCGCGCGCCGGCCGCTACCGGCCTCACACCG 96 TCCACGGGCTGGGCCTC 28S_50_1187
GGGACGCGCGCGTGGCCCCGAGAGAACCTCCCC 97 CGGGCCCGACGGCGCGA 28S_50_461
GGCGGGAAAGATCCGCCGGGCCGCCGACACGG 98 CCGGACCCGCCGCCGGGT 18S_50_1750
GACCGTCTTCTCAGCGCTCCGCCAGGGCCGTGG 99 GCCGACCCCGGCGGGGC 28S_50_131
AGCGGCGCCGGGGAGCGGGTCTTCCGTACGCCA 100 CATGTCCCGCGCCCCGC 28S_50_2240
GGCTCACCGCAGCGGCCCTCCTACTCGTCGCGG 101 CGTAGCGTCCGCGGGGC 28S_50_916
GCGCGGCGACGGGTCTCGCTCCCTCGGCCCCGG 102 GATTCGGCGAGTGCTGC 28S_50_1360
ACCTCGGCCGGCGAGCGCGCCGGCCTTCACCTT 103 CATTGCGCCACGGCGGC 28S_50_2442
GGCCGAGGGCAACGGAGGCCATCGCCCGTCCCT 104 TCGGAACGGCGCTCGCC 28S_50_4678
GAGGCCAACCGAGGCTCCGCGGCGCTGCCGTAT 105 CGTTCGCCTGGGCGGGA 28S_50_2665
AGCTCACCGGACGCCGCCGGAACCGCGACGCTT 106 TCCAAGGCACGGGCCCC 28S_50_1259
TCAAGACGGGTCGGGTGGGTAGCCGACGTCGCC 107 GCCGACCCCGTGCGCTC 28S_50_2560
TCTCCCCGGGGCTCCCGCCGGCTTCTCCGGGAT 108 GGTCGCGTTACCGCAC 18S_50_1085
GCTGCCCGGCGGGTCATGGGAATAACGCCGCCG 109 CATCGCCGGTCGGCATC 28S_50_1796
GTGGCCCACTAGGCACTCGCATTCCACGCCCGG 110 CTCCACGCCAGCGAGCC 28S_50_2020
GCGACGGCCGGGTATGGGCCCGACGCTCCAGCG 111 CCATCCATTTTCAGGGC 18S_50_1509
GGGTAGGCACACGCTGAGCCAGTCAGTGTAGCG 112 CGCGTGCAGCCCCGGAC 28S_50_1875
GGGGTCTGATGAGCGTCGGCATCGGGCGCCTTA 113 ACCCGGCGTTCGGTTCA
28S_50_3635 GCACTGGGCAGAAATCACATCGCGTCAACACCC 114 GCCGCGGGCCTTCGCGA
28S_50_2757 GAGGCTGTTCACCTTGGAGACCTGCTGCGGATA 115 TGGGTACGGCCCGGCGC
18S_50_469 TCGTCACTACCTCCCCGGGTCGGGAGTGGGTAA 116 TTTGCGCGCCTGCTGCC
28S_50_4889 GAATGGTTTAGCGCCAGGTTCCCCACGAACGTG 117 CGGTGCGTGACGGGCGA
28S_50_1646 GCGTCGGGTCTGCGAGAGCGCCAGCTATCCTGA 118 GGGAAACTTCGGAGGGA
28S50 1557 ACCCAGGTCGGACGACCGATTTGCACGTCAGGA 119 CCGCTACGGACCTCCAC
18S_50_376 TCGAACCCTGATTCCCCGTCACCCGTGGTCACCA 120 TGGTAGGCACGGCGAC
28S_50_3831 TTCCCCGCTGATTCCGCCAAGCCCGTTCCCTTGG 121 CTGTGGTTTCGCTGGA
18S_50_903 GCGGCGCAATACGAATGCCCCCGGCCGTCCCTC 122 TTAATCATGGCCTCAGT
18S_50_1223 GGGCCGGGTGAGGTTTCCCGTGTTGAGTCAAAT 123 TAAGCCGCAGGCTCCAC
18S_50_827 GGTCCTATTCCATTATTCCTAGCTGCGGTATCCA 124 GGCGGCTCGGGCCTGC
18S_50_595 GCTATTGGAGCTGGAATTACCGCGGCTGCTGGC 125 ACCAGACTTGCCCTCCA
28S_50_4172 GTCCTCCCTGAGCTCGCCTTAGGACACCTGCGTT 126 ACCGTTTGACAGGTGT
18S_50_1307 TCGCTCCACCAACTAAGAACGGCCATGCACCAC 127 CACCCACGGAATCGAGA
28S_50_4967 GGGCTGACTTTCAATAGATCGCAGCGAGGGAGC 128 TGCTCTGCTACGTACGA
28S_50_1948 GTTACACACTCCTTAGCGGATTCCGACTTCCATG 129 GCCACCGTCCTGCTGT
28S_50_4602 ATCCCACAGATGGTAGCTTCGCCCCATTGGCTCC 130 TCAGCCAAGCACATAC
18S_50_46 GCCATTCGCAGTTTCACTGTACCGGCCGTGCGTA 131 CTTAGACATGCATGGC
18S_50_1669 GGTAGTAGCGACGGGCGGTGTGTACAAAGGGCA 132 GGGACTTAATCAACGCA
28S_50_390 GCGGACCCCACCCGTTTACCTCTTAACGGTTTCA 133 CGCCCTCTTGAACTCT
28S_50_2312 TTGAATATTTGCTACTACCACCAAGATCTGCACC 134 TGCGGCGGCTCCACCC
28S_50_2832 TTAGAGCCAATCCTTATCCCGAAGTTACGGATCC 135 GGCTTGCCGACTTCCC
28S_50_288 TCGTGCCGGTATTTAGCCTTAGATGGAGTTTACC 136 ACCCGCTTTGGGCTGC
28S_50_3718 GGCATTTGGCTACCTTAAGAGAGTCATAGTTACT 137 CCCGCCGTTTACCCGC
28S_50_4472 AACCTGTCTCACGACGGTCTAAACCCAGCTCAC 138 GTTCCCTATTAGTGGGT
18S_50_144 GGGTCAGCGCCCGTCGGCATGTATTAGCTCTAG 139 AATTACCACAGTTATCC
28S_50_4252 GCCCCGCTTTCACGGTCTGTATTCGTACTGAAAA 140 TCAAGATCAAGCGAGC
28S_50_9 TCCTCCGCTGACTAATATGCTTAAATTCAGCGGG 141 TCGCCACGTCTGATCT
18S_50_1438 GTTATTGCTCAATCTCGGGTGGCTGAACGCCACT 142 TGTCCCTCTAAGAAGT
28S_50_1723 TGAGAATAGGTTGAGATCGTTTCGGCCCCAAGA 143 CCTCTAATCATTCGCTT
18S_50_1003 GTCTTCGAACCTCCGACTTTCGTTCTTGATTAAT 144
GAAAACATTCTTGGCA
[0294] Table 3 provides examples of full construct barcodes.
TABLE-US-00003 TABLE 3 Full construct barcodes SEQ ID NO P7 no UMI
CAAGCAGAAGACGGCATACGAGATXXXXXXGTXXXX 145
XXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTrG rGrG P7 early UMI
CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNXX 146
XXXXGTXXXXXXGTGACTGGAGTTCAGACGTGTGCTC TTCCGATCTrGrGrG P5 no UMI
AATGATACGGCGACCACCGAGATCTACACXXXXXXG 147
TXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGAT CTrGrGrG P5 early UMI
AATGATACGGCGACCACCGAGATCTACACNTNNNNNNN 148
NNNXXXXXXGTXXXXXXACACTCTTTCCCTACACGAC GCTCTTCCGATCTrGrGrG R1 inline
no UMI CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXr 149 GrGrG R1 inline
late UMI CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 150 NNNNNNNNNrGrGrG
R1 late UMI AT rich CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXX 151 (N1:
25252525)N1N1N1N1(N2: 40101040)N2N2WWrGrGrG R1 inline early UMI
CTACACGACGCTCTTCCGATCTNNNNNNNNNNXXXXX 152 XGTXXXXXXrGrGrG R1 inline
late UMI CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 153 Spacer 2
NNNNNNNNNATrGrGrG R1 inline late UMI
CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 154 Spacer 4
NNNNNNNNNACATrGrGrG R1 inline late UMI
CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 155 Spacer 6
NNNNNNNNNTAACATrGrGrG R1 inline late UMI
CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 156 Spacer 8
NNNNNNNNNCGTAACATrGrGrG R1 inline late UMI
CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 157 Spacer 10
NNNNNNNNNACCGTAACATrGrGrG R1 inline late UMI Full
CTACACGACGCTCTTCCGATCTXXXXXXGTXXXXXXN 158 Spacer
NNNNNNNNNACACAAGAGGCACGCGTAACATrGrGrG X represents nucleotides that
make up the barcode sequence. All oligos on one bead can have the
same barcode sequence, oligos on different beads may have different
barcode sequences. N and W represent any of {A,C,G,T} and any of
{A,T} respectively that make up the UMI sequence. UMIs may be
different across different oligos on the same bead. N1 is any one
of {A,C,G,T}; N1 positions with ratios of 25%, 25%, 25% and 25% for
the four nucleotides. N2 is any one of {A,C,G,T}; N2 positions with
ratios of 40%, 10%, 10% and 40% for the four nucleotides.
[0295] In some examples, a cell barcode may be a 16 base sequence
that is a random choice from about 737,000 sequences. The length of
the barcode (16) can be altered. The diversity of potential barcode
sequences (737 k) can be alterable. The defined nature of the
barcode can be altered, for example, it may also be completely
random (16 Ns) or semi-random (16 bases that come from a biased
distribution of nucleotides).
[0296] The canonical UMI sequence may be a 10 nucleotide randomer.
The length of the UMI can be altered. The random nature of the UMI
can be altered, for example, it may be semi-random (bases that come
from a biased distribution of nucleotides.) In a certain case, the
distribution of UMI nucleotide(s) may be biased; for example, UMI
sequences that do not contain Gs or Cs may be less likely to serve
as primers.
[0297] The spacer may alterable within given or predetermined
parameters. For example one method may give an optimal sequence of
TTTCTTATAT (SEQ ID NO: 159), but using a slightly different
optimization strategy results in a sequence that is likely just as
or nearly as good.
[0298] The selected template switching region can comprise 3
consecutive riboGs or more. The selected template switching region
can comprise 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20 consecutive riboGs or more. Alternative nucleotide may be
used such as deoxyribo Gs, LNA G's, and potentially any combination
thereof.
[0299] The present disclosure also provides methods of enriching
cDNA sequences. Enrichment may be useful for TCR, BCR, and
immunoglobulin gene analysis since these genes may possess similar
yet polymorphic variable region sequences. These sequences can be
responsible for antigen binding and peptide-MHC interactions. For
example, due to gene recombination events in individual developing
T cells, a single human or mouse will naturally express many
thousands of different TCR genes. This T cell repertoire can exceed
100,000 or more different TCR rearrangements occurring during T
cell development, yielding a total T cell population that is highly
polymorphic with respect to its TCR gene sequences especially for
the variable region. For immunoglobulin genes, the same may apply,
except even greater diversity may be present. As previously noted,
each distinct sequence may correspond to a clonotype. In certain
embodiments, enrichment increases accuracy and sensitivity of
methods for sequencing TCR, BCR and immunoglobulin genes at a
single cell level. In certain embodiments, enrichment increases the
number of sequencing reads that map to a TCR, BCR, or
immunoglobulin gene. In some embodiments, enrichment leads to
greater than or equal to 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95% or more of total sequencing reads
mapping to a TCR, BCR or immunoglobulin gene. In some embodiments,
enrichment leads to greater than or equal to 25%, 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of
total sequencing reads mapping to a variable region of a TCR, BCR
or immunoglobulin gene.
[0300] In order to aide in sequencing, detection, and analysis of
sequences of interest, an enrichment step can be employed.
Enrichment may be useful for the sequencing and analysis of genes
that may be related yet highly polymorphic. In some embodiments, an
enriched gene comprises a TCR sequence, a BCR sequence, or an
immunoglobulin sequence. In some embodiments, an enriched gene
comprises a mitochondrial gene or a cytochrome family gene. In some
embodiments, enrichment is employed after an initial round of
reverse transcription (e.g., cDNA production). In some embodiments,
enrichment is employed after an initial round of reverse
transcription and cDNA amplification for at least 5, 10, 15, 20,
25, 30, 40 or more cycles. In some embodiments, enrichment is
employed after a cDNA amplification. In some embodiments, the
amplified cDNA can be subjected to a clean up step before the
enrichment step using a column, gel extraction, or beads in order
to remove unincorporated primers, unincorporated nucleotides, very
short or very long nucleic acid fragments and enzymes. In some
embodiments, enrichment is followed by a clean-up step before
sequencing library preparation.
[0301] Enrichment of gene or cDNA sequences can be facilitated by a
primer that anneals within a known sequence of the target gene. In
some embodiments, for enrichment of a TCR, BCR, or immunoglobulin
gene, a primer that anneals to a constant region of the gene or
cDNA can be paired with a sequencing primer that anneals to a TSO
functional sequence. In some embodiments, the enriched cDNA falls
into a length range that approximately corresponds to that genes
variable region. In some embodiments, greater than about 50%, 60%,
70%, 80%, 85%, 90%, 95% or more cDNA or cDNA fragments fall within
a range of about 300 base pairs to about 900 base pairs, of about
400 base pairs to about 800 base pairs, of about 500 base pairs to
about 700 base pairs, or of about 500 base pairs to about 600 base
pairs.
[0302] FIG. 20 shows an example enrichment scheme. In operation
2001, an oligonucleotide with a poly-T sequence 2014, and in some
cases an additional sequence 2016 that binds to, for example, a
sequencing or PCR primer, anneals to a target RNA 2020. In
operation 2002 the oligonucleotide is extended yielding an
anti-sense strand 2022 which is appended by multiple cytidines on
the 3' end. A template switching oligonucleotide attached to a gel
bead 2038 is provided and a riboG of the TSO pairs with the
cytidines of the sense strand and is extended to create a sense and
an antisense strand. In some cases, the template switching
oligonucleotide is released from the gel bead during extension. In
some cases, the template switching oligonucleotide is released from
the gel bead prior to extension. In some cases, the template
switching oligonucleotide is released from the gel bead after
extension. In addition to the riboG sequence, the TSO comprises a
barcode 2012 and one or two additional functional sequences 2008
and 2012. The additional functional sequences can comprise a P7 or
R2 sequence for attachment to an Illumina sequencing flow cell, for
example. Operations 2001 and 2002 may be performed in a partition
(e.g., droplet or well). Subsequent to operation 2002, the nucleic
acid product from operations 2001 and 2002 may be removed from the
partition and in some cases pooled with other products from other
partitions for subsequent processing.
[0303] Next, additional functional sequences can be added that
allow for amplification or sample identification. This may occur in
a partition or in bulk. This reaction yields amplified cDNA
molecules as in 2003 which are mixed templates comprising a barcode
and sequencing primers. In some cases, not all of these cDNA
molecules will comprise a target variable region sequence. In one
enrichment scheme, shown in operation 2004, a primer 2018 that
anneals to a sequence 3' of a TCR, BCR or immunoglobulin variable
region 2020 specifically amplifies the variable region comprising
cDNAs yielding products as shown in operation 2005. Such enrichment
may be performed for various approaches described herein, such as,
e.g., the approaches described above in the context of FIGS. 19A
and 19B.
[0304] In certain aspects, primer 2018 anneals in a constant region
of a TCR (e.g., TCR-alpha or TCR-beta), BCR or immunoglobulin gene.
After amplification the products are sheared, adaptors ligated and
amplified a second time to add additional functional sequences 2007
and 2011 and a sample index 2009 as shown in operation 2006. The
additional functional sequences can functionally complement the
first pair 2008 and 2010 and comprise for example a P5 or R1
sequence. FIG. 21 shows example size distributions after cDNA
amplification but before enrichment (A), after enrichment but
before sequencing library prep (B), and after sequencing library
preparation (C). In some embodiments, the initial poly-T primer,
comprising sequences 2016 and 2014 can be attached to a gel bead as
opposed to the TSO. In some embodiments, the poly-T comprising
primer comprises functional sequences and barcode sequences 2008,
2010, 2012, and the TSO comprises sequence 2016. Operations
2003-2006 may be performed in bulk.
[0305] In some embodiments, clonotype information derived from
next-generation sequencing data of cDNA prepped from cellular RNA
is combined with other targeted on non targeted cDNA enrichment to
illuminate functional and ontological aspects of B-cell and T cells
that express a given TCR, BCR, or immunoglobulin. In some
embodiments, clonotype information is combined with analysis of
expression of an immunologically relevant cDNA. In some
embodiments, the cDNA encodes a cell lineage marker, a cell surface
functional marker, immunoglobulin isotype, a cytokine and/or
chemokine, an intracellular signaling polypeptide, a cell
metabolism polypeptide, a cell-cycle polypeptide, an apoptosis
polypeptide, a transcriptional activator/inhibitor, an miRNA or
lncRNA.
[0306] Also disclosed herein are methods and systems for
reference-free clonotype identification. Such methods may be
implemented by way of software executing algorithms. Tools for
assembling T-cell Receptor (TCR) sequences may use known sequences
of V and C regions to "anchor" assemblies. This may make such tools
only applicable to organisms with well characterized references
(human and mouse). However, most mammalian T cell receptors have
similar amino acid motifs and similar structure. In the absence of
a reference, a method can scan assembled transcripts for regions
that are diverse or semi-diverse, find the junction region which
should be highly diverse, then scan for known amino acid motifs. In
some cases, it may not be critical that the complementary CDRs,
such as the CDR1, CDR2, or CDR3, region be accurately delimited,
only that a diverse sequence is found that can uniquely identify
the clonotype. One advantage of this method is that the software
may not require a set of reference sequences and can operate fully
de novo, thus this method can enable immune research in eukaryotes
with poorly characterized genomes/transcriptomes.
[0307] The methods described herein allow simultaneously obtaining
single-cell gene expression information with single-cell immune
receptor sequences (TCRs/BCRs). This can be achieved using the
methods described herein, such as by amplifying genes relevant to
lymphocyte function and state (either in a targeted or unbiased
way) while simultaneously amplifying the TCR/BCR sequences for
clonotyping. This can allow such applications as 1) interrogating
changes in lymphocyte activation/response to an antigen, at the
single clonotype or single cell level; or 2) classifying
lymphocytes into subtypes based on gene expression while
simultaneously sequencing their TCR/BCRs. UMIs are typically
ignored during TCR (or generally transcriptome) assembly.
[0308] Key analytical operations involved in clonotype sequencing
according to the methods described herein include: 1) Assemble each
UMI separately, then merge highly similar assembled sequences. High
depth per molecule in TCR sequencing makes this feasible. This may
result in a reduced chance of "chimeric" assemblies; 2) Assemble
all UMIs from each cell together but use UMI information to choose
paths in the assembly graph. This is analogous to using barcode and
read-pair information to resolve "bubbles" in WGS assemblies; 3)
Base quality estimation. UMI information and alignment of short
reads may be used to assemble contigs to compute per-base quality
scores. Base quality scoring may be important as a few base
differences in a CDR sequence may differentiate one clonotype from
another. This may be in contrast to other methods that rely on
using long-read sequencing.
[0309] Thus, base quality estimates for assembled contigs can
inform clonotype inference. Errors can make cells with the same
(real) clonotype have mismatching assembled sequences. Further,
combining base-quality estimates and clonotype abundances to
correct clonotype assignments. For example, if 10 cells have
clonotype X and one cell has a clonotype that differs by X in only
a few bases and these bases have low quality, then this cell may be
assigned to clonotype X. In some embodiments, clonotypes that
differ by a single amino acid or nucleic acid may be discriminated.
In some embodiments, clonotypes that differ by less than 50, 40,
30, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acids or nucleic
acids may be discriminated. An example, non limiting, base error
calculation scheme is shown below in Example VII.
[0310] Also provided herein are the microfluidic devices used for
partitioning the cells as described above. Such microfluidic
devices can comprise channel networks for carrying out the
partitioning process like those set forth in FIGS. 1 and 2.
Briefly, these microfluidic devices can comprise channel networks,
such as those described herein, for partitioning cells into
separate partitions, and co-partitioning such cells with
oligonucleotide barcode library members, e.g., disposed on beads.
These channel networks can be disposed within a solid body, e.g., a
glass, semiconductor or polymer body structure in which the
channels are defined, where those channels communicate at their
termini with reservoirs for receiving the various input fluids, and
for the ultimate deposition of the partitioned cells, etc., from
the output of the channel networks. By way of example, and with
reference to FIG. 2, a reservoir fluidly coupled to channel 202 may
be provided with an aqueous suspension of cells 214, while a
reservoir coupled to channel 204 may be provided with an aqueous
suspension of beads 216 carrying the oligonucleotides. Channel
segments 206 and 208 may be provided with a non-aqueous solution,
e.g., an oil, into which the aqueous fluids are partitioned as
droplets at the channel junction 212. Finally, an outlet reservoir
may be fluidly coupled to channel 210 into which the partitioned
cells and beads can be delivered and from which they may be
harvested. As will be appreciated, while described as reservoirs,
it will be appreciated that the channel segments may be coupled to
any of a variety of different fluid sources or receiving
components, including tubing, manifolds, or fluidic components of
other systems.
[0311] Also provided are systems that control flow of these fluids
through the channel networks e.g., through applied pressure
differentials, centrifugal force, electrokinetic pumping, capillary
or gravity flow, or the like.
[0312] Also provided herein are kits for analyzing individual cells
or small populations of cells. The kits may include one, two,
three, four, five or more, up to all of partitioning fluids,
including both aqueous buffers and non-aqueous partitioning fluids
or oils, nucleic acid barcode libraries that are releasably
associated with beads, as described herein, microfluidic devices,
reagents for disrupting cells amplifying nucleic acids, and
providing additional functional sequences on fragments of cellular
nucleic acids or replicates thereof, as well as instructions for
using any of the foregoing in the methods described herein.
[0313] The present disclosure provides computer control systems
that are programmed to implement methods of the disclosure. FIG. 17
shows a computer system 1701 that is programmed or otherwise
configured to implement methods of the disclosure including nucleic
acid sequencing methods, interpretation of nucleic acid sequencing
data and analysis of cellular nucleic acids, such as RNA (e.g.,
mRNA), and characterization of cells from sequencing data. The
computer system 1701 can be an electronic device of a user or a
computer system that is remotely located with respect to the
electronic device. The electronic device can be a mobile electronic
device.
[0314] The computer system 1701 includes a central processing unit
(CPU, also "processor" and "computer processor" herein) 1705, which
can be a single core or multi core processor, or a plurality of
processors for parallel processing. The computer system 1701 also
includes memory or memory location 1710 (e.g., random-access
memory, read-only memory, flash memory), electronic storage unit
1715 (e.g., hard disk), communication interface 1720 (e.g., network
adapter) for communicating with one or more other systems, and
peripheral devices 1725, such as cache, other memory, data storage
and/or electronic display adapters. The memory 1710, storage unit
1715, interface 1720 and peripheral devices 1725 are in
communication with the CPU 1705 through a communication bus (solid
lines), such as a motherboard. The storage unit 1715 can be a data
storage unit (or data repository) for storing data. The computer
system 1701 can be operatively coupled to a computer network
("network") 1730 with the aid of the communication interface 1720.
The network 1730 can be the Internet, an internet and/or extranet,
or an intranet and/or extranet that is in communication with the
Internet. The network 1730 in some cases is a telecommunication
and/or data network. The network 1730 can include one or more
computer servers, which can enable distributed computing, such as
cloud computing. The network 1730, in some cases with the aid of
the computer system 1701, can implement a peer-to-peer network,
which may enable devices coupled to the computer system 1701 to
behave as a client or a server.
[0315] The CPU 1705 can execute a sequence of machine-readable
instructions, which can be embodied in a program or software. The
instructions may be stored in a memory location, such as the memory
1710. The instructions can be directed to the CPU 1705, which can
subsequently program or otherwise configure the CPU 1705 to
implement methods of the present disclosure. Examples of operations
performed by the CPU 1705 can include fetch, decode, execute, and
writeback.
[0316] The CPU 1705 can be part of a circuit, such as an integrated
circuit. One or more other components of the system 1701 can be
included in the circuit. In some cases, the circuit is an
application specific integrated circuit (ASIC).
[0317] The storage unit 1715 can store files, such as drivers,
libraries and saved programs. The storage unit 1715 can store user
data, e.g., user preferences and user programs. The computer system
1701 in some cases can include one or more additional data storage
units that are external to the computer system 1701, such as
located on a remote server that is in communication with the
computer system 1701 through an intranet or the Internet.
[0318] The computer system 1701 can communicate with one or more
remote computer systems through the network 1730. For instance, the
computer system 1701 can communicate with a remote computer system
of a user. Examples of remote computer systems include personal
computers (e.g., portable PC), slate or tablet PC's (e.g.,
Apple.RTM. iPad, Samsung.RTM. Galaxy Tab), telephones, Smart phones
(e.g., Apple.RTM. iPhone, Android-enabled device, Blackberry.RTM.),
or personal digital assistants. The user can access the computer
system 1701 via the network 1730.
[0319] Methods as described herein can be implemented by way of
machine (e.g., computer processor) executable code stored on an
electronic storage location of the computer system 1701, such as,
for example, on the memory 1710 or electronic storage unit 1715.
The machine executable or machine readable code can be provided in
the form of software. During use, the code can be executed by the
processor 1705. In some cases, the code can be retrieved from the
storage unit 1715 and stored on the memory 1710 for ready access by
the processor 1705. In some situations, the electronic storage unit
1715 can be precluded, and machine-executable instructions are
stored on memory 1710.
[0320] The code can be pre-compiled and configured for use with a
machine having a processor adapted to execute the code, or can be
compiled during runtime. The code can be supplied in a programming
language that can be selected to enable the code to execute in a
pre-compiled or as-compiled fashion.
[0321] Aspects of the systems and methods provided herein, such as
the computer system 1701, can be embodied in programming. Various
aspects of the technology may be thought of as "products" or
"articles of manufacture" typically in the form of machine (or
processor) executable code and/or associated data that is carried
on or embodied in a type of machine readable medium.
Machine-executable code can be stored on an electronic storage
unit, such as memory (e.g., read-only memory, random-access memory,
flash memory) or a hard disk. "Storage" type media can include any
or all of the tangible memory of the computers, processors or the
like, or associated modules thereof, such as various semiconductor
memories, tape drives, disk drives and the like, which may provide
non-transitory storage at any time for the software programming.
All or portions of the software may at times be communicated
through the Internet or various other telecommunication networks.
Such communications, for example, may enable loading of the
software from one computer or processor into another, for example,
from a management server or host computer into the computer
platform of an application server. Thus, another type of media that
may bear the software elements includes optical, electrical and
electromagnetic waves, such as used across physical interfaces
between local devices, through wired and optical landline networks
and over various air-links. The physical elements that carry such
waves, such as wired or wireless links, optical links or the like,
also may be considered as media bearing the software. As used
herein, unless restricted to non-transitory, tangible "storage"
media, terms such as computer or machine "readable medium" refer to
any medium that participates in providing instructions to a
processor for execution.
[0322] Hence, a machine readable medium, such as
computer-executable code, may take many forms, including but not
limited to, a tangible storage medium, a carrier wave medium or
physical transmission medium. Non-volatile storage media include,
for example, optical or magnetic disks, such as any of the storage
devices in any computer(s) or the like, such as may be used to
implement the databases, etc. shown in the drawings. Volatile
storage media include dynamic memory, such as main memory of such a
computer platform. Tangible transmission media include coaxial
cables; copper wire and fiber optics, including the wires that
comprise a bus within a computer system. Carrier-wave transmission
media may take the form of electric or electromagnetic signals, or
acoustic or light waves such as those generated during radio
frequency (RF) and infrared (IR) data communications. Common forms
of computer-readable media therefore include for example: a floppy
disk, a flexible disk, hard disk, magnetic tape, any other magnetic
medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch
cards paper tape, any other physical storage medium with patterns
of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other
memory chip or cartridge, a carrier wave transporting data or
instructions, cables or links transporting such a carrier wave, or
any other medium from which a computer may read programming code
and/or data. Many of these forms of computer readable media may be
involved in carrying one or more sequences of one or more
instructions to a processor for execution.
[0323] The computer system 1701 can include or be in communication
with an electronic display 1735 that comprises a user interface
(UI) 1740 for providing, for example, results of nucleic acid
sequencing, analysis of nucleic acid sequencing data,
characterization of nucleic acid sequencing samples, cell
characterizations, etc. Examples of UI's include, without
limitation, a graphical user interface (GUI) and web-based user
interface.
[0324] Methods and systems of the present disclosure can be
implemented by way of one or more algorithms. An algorithm can be
implemented by way of software upon execution by the central
processing unit 1705. The algorithm can, for example, initiate
nucleic acid sequencing, process nucleic acid sequencing data,
interpret nucleic acid sequencing results, characterize nucleic
acid samples, characterize cells, etc.
EXAMPLES
[0325] The following non-limiting examples are given for the
purpose of illustrating various embodiments of present
disclosure.
Example I: Cellular RNA Analysis Using Emulsions
[0326] In an example, reverse transcription with template switching
and cDNA amplification (via PCR) is performed in emulsion droplets
with operations as shown in FIG. 9A. The reaction mixture that is
partitioned for reverse transcription and cDNA amplification (via
PCR) includes 1,000 cells or 10,000 cells or 10 ng of RNA, beads
bearing barcoded oligonucleotides/0.2% Tx-100/5.times. Kapa buffer,
2.times. Kapa HS HiFi Ready Mix, 4 .mu.M switch oligo, and
Smartscribe. Where cells are present, the mixture is partitioned
such that a majority or all of the droplets comprise a single cell
and single bead. The cells are lysed while the barcoded
oligonucleotides are released from the bead, and the poly-T segment
of the barcoded oligonucleotide hybridizes to the poly-A tail of
mRNA that is released from the cell as in operation 950. The poly-T
segment is extended in a reverse transcription reaction as in
operation 952 and the cDNA transcript is amplified as in operation
954. The thermal cycling conditions are 42.degree. C. for 130
minutes; 98.degree. C. for 2 min; and 35 cycles of the following
98.degree. C. for 15 sec, 60.degree. C. for 20 sec, and 72.degree.
C. for 6 min. Following thermal cycling, the emulsion is broken and
the transcripts are purified with Dynabeads and 0.6.times.SPRI as
in operation 956.
[0327] The yield from template switch reverse transcription and PCR
in emulsions is shown for 1,000 cells in FIG. 13A and 10,000 cells
in FIG. 13C and 10 ng of RNA in FIG. 13B (Smartscribe line). The
cDNA transcripts from RT and PCR performed in emulsions for 10 ng
RNA is sheared and ligated to functional sequences, cleaned up with
0.8.times.SPRI, and is further amplified by PCR as in operation
958. The amplification product is cleaned up with 0.8.times.SPRI.
The yield from this processing is shown in FIG. 13B (SSII
line).
Example II: Cellular RNA Analysis Using Emulsions
[0328] In another example, reverse transcription with template
switching and cDNA amplification (via PCR) is performed in emulsion
droplets with operations as shown in FIG. 9A. The reaction mixture
that is partitioned for reverse transcription and cDNA
amplification (via PCR) includes Jurkat cells, beads bearing
barcoded oligonucleotides/0.2% TritonX-100/5.times. Kapa buffer,
2.times. Kapa HS HiFi Ready Mix, 4 .mu.M switch oligo, and
Smartscribe. The mixture is partitioned such that a majority or all
of the droplets comprise a single cell and single bead. The cells
are lysed while the barcoded oligonucleotides are released from the
bead, and the poly-T segment of the barcoded oligonucleotide
hybridizes to the poly-A tail of mRNA that is released from the
cell as in operation 950. The poly-T segment is extended in a
reverse transcription reaction as in operation 952 and the cDNA
transcript is amplified as in operation 954. The thermal cycling
conditions are 42.degree. C. for 130 minutes; 98.degree. C. for 2
min; and 35 cycles of the following 98.degree. C. for 15 sec,
60.degree. C. for 20 sec, and 72.degree. C. for 6 min. Following
thermal cycling, the emulsion is broken and the transcripts are
cleaned-up with Dynabeads and 0.6.times.SPRI as in operation 956.
The yield from reactions with various cell numbers (625 cells,
1,250 cells, 2,500 cells, 5,000 cells, and 10,000 cells) is shown
in FIG. 14A. These yields are confirmed with GADPH qPCR assay
results shown in FIG. 14B.
Example III: RNA Analysis Using Emulsions
[0329] In another example, reverse transcription is performed in
emulsion droplets and cDNA amplification is performed in bulk in a
manner similar to that as shown in FIG. 9C. The reaction mixture
that is partitioned for reverse transcription includes beads
bearing barcoded oligonucleotides, 10 ng Jurkat RNA (e.g., Jurkat
mRNA), 5.times. First-Strand buffer, and Smartscribe. The barcoded
oligonucleotides are released from the bead, and the poly-T segment
of the barcoded oligonucleotide hybridizes to the poly-A tail of
the RNA as in operation 961. The poly-T segment is extended in a
reverse transcription reaction as in operation 963. The thermal
cycling conditions for reverse transcription are one cycle at
42.degree. C. for 2 hours and one cycle at 70.degree. C. for 10
min. Following thermal cycling, the emulsion is broken and RNA and
cDNA transcripts are denatured as in operation 962. A second strand
is then synthesized by primer extension with a primer having a
biotin tag as in operation 964. The reaction conditions for this
primer extension include cDNA transcript as the first strand and
biotinylated extension primer ranging in concentration from 0.5-3.0
.mu.M. The thermal cycling conditions are one cycle at 98.degree.
C. for 3 min and one cycle of 98.degree. C. for 15 sec, 60.degree.
C. for 20 sec, and 72.degree. C. for 30 min. Following primer
extension, the second strand is pulled down with Dynabeads MyOne
Streptavidin C1 and T1, and cleaned-up with Agilent SureSelect XT
buffers. The second strand is pre-amplified via PCR as in operation
965 with the following cycling conditions--one cycle at 98.degree.
C. for 3 min and one cycle of 98.degree. C. for 15 sec, 60.degree.
C. for 20 sec, and 72.degree. C. for 30 min. The yield for various
concentrations of biotinylated primer (0.5 .mu.M, 1.0 .mu.M, 2.0
.mu.M, and 3.0 .mu.M) is shown in FIG. 15.
Example IV: RNA Analysis Using Emulsions
[0330] In another example, in vitro transcription by T7 polymerase
is used to produce RNA transcripts as shown in FIG. 10. The mixture
that is partitioned for reverse transcription includes beads
bearing barcoded oligonucleotides which also include a T7 RNA
polymerase promoter sequence, 10 ng human RNA (e.g., human mRNA),
5.times. First-Strand buffer, and Smartscribe. The mixture is
partitioned such that a majority or all of the droplets comprise a
single bead. The barcoded oligonucleotides are released from the
bead, and the poly-T segment of the barcoded oligonucleotide
hybridizes to the poly-A tail of the RNA as in operation 1050. The
poly-T segment is extended in a reverse transcription reaction as
in operation 1052. The thermal cycling conditions are one cycle at
42.degree. C. for 2 hours and one cycle at 70.degree. C. for 10
min. Following thermal cycling, the emulsion is broken and the
remaining operations are performed in bulk. A second strand is then
synthesized by primer extension as in operation 1054. The reaction
conditions for this primer extension include cDNA transcript as
template and extension primer. The thermal cycling conditions are
one cycle at 98.degree. C. for 3 min and one cycle of 98.degree. C.
for 15 sec, 60.degree. C. for 20 sec, and 72.degree. C. for 30 min.
Following this primer extension, the second strand is purified with
0.6.times.SPRI. As in operation 1056, in vitro transcription is
then performed to produce RNA transcripts. In vitro transcription
is performed overnight, and the transcripts are purified with
0.6.times.SPRI. The RNA yields from in vitro transcription are
shown in FIG. 16.
Example V: Analysis of T-Cell Receptors (TCRs)
[0331] In this example, methods disclosed herein are used to assay
T-cell receptors. To generate labeled polynucleotides comprising
T-cell receptor gene sequences, T-cells are co-partitioned with gel
beads comprising barcoded template switching oligonucleotides.
Prior to partitioning, T-cells are optionally enriched from a cell
sample, for example by fluorescence activated cell sorting (FACS)
or other sorting technique. Additional reagents for generating
labeled polynucleotides including, but not limited to, reverse
transcriptase enzyme, poly(dT) primer, and dNTPs, are delivered to
partitions as part of a master mix. Within partitions, cells are
lysed, thereby yielding template polynucleotides comprising nucleic
acids from T-cells. As illustrated schematically in FIG. 19, a
T-cell derived template polynucleotide comprising mRNA (e.g.,
1920), poly(dT) primer (e.g., 1924), and a template switching
oligonucleotide (e.g., 1926) are subjected to an amplification
reaction to yield a first amplification product. The poly(dT)
primer hybridizes to the polyA tail of the mRNA template
polynucleotide and acts as a primer for reverse transcription by
the reverse transcriptase enzyme that is co-partitioned with the
T-cell (e.g., 1950). The reverse transcriptase enzyme has terminal
transferase activity and adds additional nucleotides, e.g., polyC,
to the cDNA transcript in a template independent manner. The
template switching oligonucleotide (e.g., 1926) hybridizes to the
cDNA transcript and facilitates template switching in the first
amplification reaction (e.g., 1952).
[0332] Using methods disclosed herein, reverse transcription
performed within partitions generates unbiased cDNA comprising a
sequencing adapter, a cell barcode and a unique molecular
identifier (UMI) on the 5' end of the transcript. To enrich for
transcripts comprising TCR gene sequences, the first amplification
reaction product or cDNA transcript is subjected to a second
amplification reaction to generate a second amplification product.
Polymerase chain reaction (PCR) is performed with one primer for
the 5' end of the transcript and one or more primers for the
desired TCR/Ig constant region(s) (e.g., primers targeting TCR
alpha (.alpha.) and/or beta (.beta.) chain, and in some cases gamma
and/or delta (.gamma./.delta.) chains). The contents of multiple
partitions can be combined such that the second amplification
reaction is performed in bulk.
[0333] Next, amplification products are subjected to enzymatic
fragmentation and further processed to attach sequencing adaptors
to generate a sequencing library. Additional sequences include
functional sequences such as flow cell attachment sequences and
sequencing primer binding sequences. The labeled polynucleotides
are sequenced to yield sequencing reads, and sequencing reads are
used to assemble full or partial TCR receptor gene sequences.
Additional analysis includes transcript counting for which an
analysis pipeline may include, for example, (i) barcode processing,
(ii) read filtering, (iii) cell-by-cell consensus assembly, (iv)
V(D)J annotation, and (v) clonotype inference and clustering.
[0334] Other receptors (e.g., B-cell receptors (BCRs) and Ig
receptors) can be similarly analyzed using the methods described
herein by partitioning the appropriate immune cell type for
generating labeled polynucleotides and using receptor specific
primers to generate amplification products.
Example VI: Enrichment of T-Cell Receptor (TCR) Transcripts
[0335] In this example, cellular suspensions of 3,000; 6,000; or
12,000 primary human T cells were loaded on a GemCode Single Cell
Instrument (10.times. Genomics, Pleasanton, Calif.) to generate
single cell-gel bead emulsions (SC-GEMs). The gel beads were
modified to carry a template switching oligonucleotide (TSO) as
shown in FIG. 18 or FIG. 20 at 8 .mu.M, yielding a final
concentration of 0.32 .mu.M in GEM. After creation of SC-GEMs,
reverse transcription was performed on the cells in emulsion using
a poly-T primer and reverse transcriptase for 5 minutes at
55.degree. C., followed by 1 hour and 55 minutes at 52.degree. C.
After RT, GEMs were broken and the single-stranded cDNA was cleaned
up with DynaBeads.RTM. MyOne.TM. Silane Beads and SPRIselect
Reagent Kit (0.6.times.SPRI). cDNA was amplified for 15 cycles with
1 minute extensions and amplified cDNA product was cleaned up with
the SPRIselect Reagent Kit (0.6.times.SPRI). FIG. 22 shows the cDNA
yields from all three cellular suspensions. cDNA yields from 12,000
cells was greater than either 6,000 or 3,000 cells, which yielded
similar amounts.
[0336] Indexed sequencing libraries were constructed using the
GemCode Single Cell 3' Library Kit, following these steps: 1) end
repair and A-tailing; 2) adapter ligation; 3) post-ligation cleanup
with SPRIselect; 4) sample index PCR and cleanup. These sequencing
libraries were sequenced using an Illumina MiSeq sequencer.
Sequencing performance of poly-T primed libraries was compared to
libraries constructed from enriched cDNA libraries created by using
an enriched priming method which substituted the poly-T primer with
primers that bound the constant region of TCR.alpha., TCR.beta., or
both. FIG. 23 shows that enrichment led to reduced mapping of
sequencing reads to the transcriptome (8.9% unmappable reads with
poly-T priming versus 49.3% for TCR.alpha. priming, 45.7% for
TCR.beta. priming, or 39% for both). However, more reads mapped to
the VDJ regions of TCR transcripts, indicating that enrichment is
important for targeted VDJ sequencing (0.3% VDJ mappable fragments
with poly T priming versus 15.5% for TCR.alpha. priming, 19.7% for
TCR.beta. priming, or 29.50% for both). See FIG. 23, Fraction
fragments mapped to VDJ column.
[0337] In order to increase cDNA yields prior to sequencing library
preparation, differing concentrations of TSO were tested. TSO were
tested at concentrations of 32, 16, 8, 4, 2, 1, and 0.5 .mu.M
(which may correspond to 800, 400, 200, 100, 50, 25, and 12.5 .mu.M
immobilized to gel beads). Jurkat T cells were used for this
experiment, and results are shown in FIG. 24 with cDNA yields
directly correlating with TSO concentration and plateauing at about
a concentration of 16 .mu.M. These experiments were repeated with
TSO immobilized to gel beads (GB-TSTO) using either 6,000 primary T
cells as shown in FIG. 25A, or 2,200 Jurkat cells as shown in FIG.
25B. GB-TSO concentrations of 8, 20, 100, and 200 .mu.M were tested
and concentrations of 100 and 200 .mu.M showed a significant
increase over the lower concentrations of 8 and 20 .mu.M.
[0338] Differing enrichment schemes were tested to determine
optimal enrichment methods. Using a non-GEM protocol, cDNA from
3,000 primary T cells was prepared using poly-T priming followed by
enrichment using primers that anneal to TCR constant regions,
yielding 38.5% VDJ mappable reads, quantitation of this enrichment
is shown in FIG. 26A. Using a gel-beads in emulsion-reverse
transcription reaction (GEM-RT) protocol, cDNA from 6,000 primary T
cells was prepared using Poly-T priming and gel beads with a TSO at
8, 100 or 200 .mu.M concentration followed by enrichment using a
two stage nested approach. This nested enrichment comprised PCR
using outer primers annealing to the TCR alpha and beta paired with
a P7 primer for 10 cycles using 60.degree. C. extensions, followed
by PCR using inner primers annealing to the TCR alpha and beta
paired with a P7 primer for 10 cycles using 60.degree. C.
extensions. Results of this are shown in FIG. 26B with the largest
amount of enrichment exhibited using a lower concentration of gel
beads (8 .mu.M).
[0339] To further optimize enrichment, a comparison was conducted
between using P7 primers and variable region specific primers in
combination with the constant region primers for cDNA
amplification. Primer sequences used are shown in Table 4.
TABLE-US-00004 TABLE 4 Enrichment primer sequences and predicted
products Primer Sequence V region TRA-V1 ACTTGTCCAGCCTAACCTGC
primers (SEQ ID NO: 160) TRA-V2 TTACCCTGGGAGGAACCAGA (SEQ ID NO:
161) TRB-Vl TTTCAGGCCACAACTCCCTT (SEQ ID NO: 162) TRB-V2
CAGACAGACCATGATGCGGG (SEQ ID NO: 163) TRB-V3 GCCACAACTCCCTTTTCTGG
(SEQ ID NO: 164) Constant TRAC-inner AGTCTCTCAGCTGGTACACG region
(SEQ ID NO: 165) primers TRBC-inner TCTGATGGCTCAAACACAGC (SEQ ID
NO: 166) Predicted TRA-V1/TRAC-inner 554 amplicon TRA-V2/TRAC-inner
413 size TRB-V1/TRBC-inner 324 TRB-V2/TRBC-inner 296
TRB-V3/TRBC-inner 318
[0340] GEM-RT was carried out using poly-T priming followed by a
template switch using 8 .mu.M TSO-GB, followed by clean up, 15
cycles of cDNA amplification and enrichment for 20 cycles. Results
shown in FIGS. 27A-27C show that using V region primers in
conjunction with constant region primers specifically enrich TCR
alpha (FIG. 27B) and TCR beta sequences (FIG. 27C) compared to P7
primers paired with constant region primers. FIG. 28 further shows
that by using specific enrichment (28C and D; V region+C region
primers) compared to general enrichment (28A and B; P7 primer+C
region primer) yields of specifically enriched product were
increased by increasing the amount of TSO-GB (from 8 .mu.M to 200
.mu.m). This is in contrast to what was observed using P7-constant
region primer enrichment which required using less TSO-GB (8 .mu.M)
in the GEM-RT reaction to produce more enriched product. Overall
using the P7-constant region enrichment allows preservation of
barcode information in the subsequent sequencing reaction. This
configuration yields at least 30% reads mappable to VDJ genes.
Example VII: Generating Labeled Polynucleotides
[0341] In this example, and with reference to FIGS. 29A and 29B,
individual cells are lysed in partitions comprising gel bead
emulsions (GEMs). GEMs, for example, can be aqueous droplets
comprising gel beads. Within GEMs, a template polynucleotide
comprising an mRNA molecule can be reverse transcribed by a reverse
transcriptase and a primer comprising a poly(dT) region. A template
switching oligo (TSO) present in the GEM, for example a TSO
delivered by the gel bead, can facilitate template switching so
that a resulting polynucleotide product or cDNA transcript from
reverse transcription comprises the primer sequence, a reverse
complement of the mRNA molecule sequence, and a sequence
complementary to the template switching oligo. The template
switching oligo can comprise additional sequence elements, such as
a unique molecular identifier (UMI), a barcode sequence (BC), and a
Read1 sequence. See FIG. 29A. In some cases, a plurality of mRNA
molecules from the cell is reverse transcribed within the GEM,
yielding a plurality of polynucleotide products having various
nucleic acid sequences. Following reverse transcription, the
polynucleotide product can be subjected to target enrichment in
bulk. Prior to target enrichment, the polynucleotide product can be
optionally subjected to additional reaction(s) to yield
double-stranded polynucleotides. The target may comprise VDJ
sequences of a T cell and/or B cell receptor gene sequence. As
shown at the top of the right panel of FIG. 29A, the polynucleotide
product (shown as a double-stranded molecule, but can optionally be
a single-stranded transcript) can be subjected to a first target
enrichment polymerase chain reaction (PCR) using a primer that
hybridizes to the Read 1 region and a second primer that hybridizes
to a first region of the constant region (C) of the receptor
sequence (e.g., TCR or BCR). The product of the first target
enrichment PCR can be subjected to a second, optional target
enrichment PCR. In the second target enrichment PCR, a second
primer that hybridizes to a second region of the constant region
(C) of the receptor can be used. This second primer can, in some
cases, hybridize to a region of the constant region that is closer
to the VDJ region that the primer used in the first target
enrichment PCR. Following the first and second (optional) target
enrichment PCR, the resulting polynucleotide product can be further
processed to add additional sequences useful for downstream
analysis, for example sequencing. The polynucleotide products can
be subjected to fragmentation, end repair, A-tailing, adapter
ligation, and one or more clean-up/purification operations.
[0342] In some cases, a first subset of the polynucleotide products
from cDNA amplification can be subjected to target enrichment (FIG.
29B, right panel) and a second subset of the polynucleotide
products from cDNA amplification is not subjected to target
enrichment (FIG. 29B, bottom left panel). The second subset can be
subjected to further processing without enrichment to yield an
unenriched, sequencing ready population of polynucleotides. For
example, the second subset can be subjected to fragmentation, end
repair, A-tailing, adapter ligation, and one or more
clean-up/purification operations.
[0343] The labeled polynucleotides can then be subjected to
sequencing analysis. Sequencing reads of the enriched
polynucleotides can yield sequence information about a particular
population of the mRNA molecules in the cell whereas the enriched
polynucleotides can yield sequence information about various mRNA
molecules in the cell.
Example VIII: Base Error Calculations
[0344] All calculations of this example are for a single base. The
terms transcript and UMI will be used inter-changeably, assuming
that there is a 1-1 relationship between transcripts and UMIs. Let
D be all observed data (reads, qualities, UMIs) at a given base and
D.sub.u, u=1, . . . , m be the data from UMI u. Let R be the real
template base at the given position and T.sub.u be the (unobserved)
base at the given position on transcipt/UMI u. Let .sub.Rui and
.sub.Rui be the real (pre-sequencing errors) and observed
(post-sequencing errors) bases on the i.sup.th read of UMI u and
.sub.Qui be the corresponding base quality. Let .sub.prt be
probability of an RT error, and p.sub.pcr be the probability of a
PCR error. Let also p.sub.s(Q)=10-Q/10 be the probability of a
sequencing error given a base quality of Q. Finally, let L={A, C,
G, T}. Transcripts are conditionally independent given the real
template base and reads from a transcript are conditionally
independent given the base of the transcript (i.e. errors occur
completely independently of one another). Below, Equation I can be
derived by summing over the unobserved value c of transcript u at
the given position and the (also unobserved) real value d of each
read at this position.
P ( D | R ) = u P ( D u | R ) = u c .di-elect cons. L P ( D u | T u
+ e ) P ( T u = c | R ) = u c .di-elect cons. L i P ( R u i | T u =
c ) P ( T u = c | R ) = u c .di-elect cons. L i d .di-elect cons. L
P ( R u i | R u i = d ) P ( R u i = d | T u = c ) P ( T u = c | R )
= u c .di-elect cons. L [ i d .di-elect cons. L [ ( p s ( Q u i ) 3
) R u i .noteq. d ( 1 - p s ( Q u i ) ) R u i = d ( P pcr 3 ) d
.noteq. c ( 1 - p pcr ) d = c ] ( p rt 3 ) R .noteq. c ( 1 - p rt )
R = c ] Equation I ##EQU00001##
If it is assumed that p.sub.pcr is negligible (compared to
sequencing and RT errors), that is the sequenced base R.sub.ui
always equals the transcript base T.sub.u, the simplified form of
Equation II can be derived below.
u c .di-elect cons. L [ ( p ri 3 ) R .noteq. c ( 1 - p rt ) R = c i
( p s ( Q u i ) 3 ) R u i .noteq. c ( 1 - p s ( Q u i ) ) R u i = c
] Equation II ##EQU00002##
[0345] Let X be the called base at that position (i.e. the base in
the assembled sequence). The probability of an error is:
P ( R .noteq. X | D ) = 1 - P ( R = X | D ) = 1 - P ( D | R = X ) P
( R = X ) P ( D ) = 1 - 0.25 * P ( D | c ) c .di-elect cons. L 0.25
* P ( D | c ) ##EQU00003##
[0346] Devices, systems, compositions and methods of the present
disclosure may be used for various applications, such as, for
example, processing a single analyte (e.g., RNA, DNA, or protein)
or multiple analytes (e.g., DNA and RNA, DNA and protein, RNA and
protein, or RNA, DNA and protein) form a single cell. For example,
a biological particle (e.g., a cell or cell bead) is partitioned in
a partition (e.g., droplet), and multiple analytes from the
biological particle are processed for subsequent processing. The
multiple analytes may be from the single cell. This may enable, for
example, simultaneous proteomic, transcriptomic and genomic
analysis of the cell.
[0347] While some embodiments of the present invention have been
shown and described herein, it will be obvious to those skilled in
the art that such embodiments are provided by way of example only.
It is not intended that the invention be limited by the specific
examples provided within the specification. While the invention has
been described with reference to the aforementioned specification,
the descriptions and illustrations of the embodiments herein are
not meant to be construed in a limiting sense. Numerous variations,
changes, and substitutions will now occur to those skilled in the
art without departing from the invention. Furthermore, it shall be
understood that all aspects of the invention are not limited to the
specific depictions, configurations or relative proportions set
forth herein which depend upon a variety of conditions and
variables. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is therefore contemplated that the
invention shall also cover any such alternatives, modifications,
variations or equivalents. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
Sequence CWU 1
1
170113DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1tttcttatat ggg 13223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2aaatcaaatc tttcttatat ggg 23333DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3acaaacaaat aaatcaaatc tttcttatat ggg
33413DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4gaaatttaaa ggg 13523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5cactctacat gaaatttaaa ggg 23633DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6ccaaagttgt cactctacat gaaatttaaa ggg
33713DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7atatatataa ggg 13823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8atatatatat atatatataa ggg 23933DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9atatatatat atatatatat atatatataa ggg
331030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 10gccggccgcc ccggcggccg ccgcgcggcc
301130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 11gccgccggcg cccgcccccc ggccggggcc
301230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 12gcgcgcgcgc gcgccgcccc cgccgctccc
301330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 13ggggcgcgcc gcgccgccgc cgggctcccc
301430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14gccgccgcca ccgccgccgc cgccgccgcc
301530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 15gccccgcccc gccgcccgcc gaccgccgcc
301630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16gcggcccctc cgccgcctgc cgccgccgcc
301730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 17ggagcgggtc gcgcccggcc gggcgggcgc
301830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 18gccccgcccc ccgacccgcg cgcggcaccc
301930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19ggcggcccgc agggccgcgg accccgcccc
302030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20ggcggggcac gcgccctccc gcggcggggc
302130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 21gccagggccg tgggccgacc ccggcggggc
302230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22gtcccccgcc gaccccaccc ccggccccgc
302330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 23ggctcgcctc gcggcggacc gcccgcccgc
302430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 24gacccgggcg cgcgccggcc gctaccggcc
302530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25gcgcgcctcg tccagccgcg gcgcgcgccc
302630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 26gcgccgtggg aggggtggcc cggccccccc
302730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 27gggccccccg agccaccttc cccgccgggc
302830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 28ggcggctcca cccgggcccg cgccctaggc
302930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 29ggcgcggggt ggggagggag cgagcggcgc
303030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 30gctaggcgcc ggccgaggcg aggcgcgcgc
303130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 31gtcccgcgcc ccgcggggcg gggattcggc
303230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 32ggggcggccg cctttccggc cgcgccccgt
303330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 33acctccccgg cgcggcgggc gagacgggcc
303430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 34gatccgccgg gccgccgaca cggccggacc
303530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 35gccgaccccg tgcgctcgct ccgccgtccc
303630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 36gcgcggcgac gggtctcgct ccctcggccc
303730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 37gcccggctcg cgtccagagt ccgcgccgcc
303830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 38tccccggggc tcccgccggc ttctccggga
303930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 39acctcggccg gcgagcgcgc cggccttcac
304030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 40acgcccggct ccacgccagc gagccgggct
304130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 41gctcaccgga cgccgccgga accgcgacgc
304230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 42tcgcccgtcc cttcggaacg gcgctcgccc
304330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 43ggggtgcgtc gggtctgcga gagcgccagc
304430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 44ggccaaccga ggctccgcgg cgctgccgta
304530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45gttacccgcg cctgccggcg tagggtaggc
304630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46gcgtcaacac ccgccgcggg ccttcgcgat
304730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 47agctgcggta tccaggcggc tcgggcctgc
304830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 48gcgtcggcat cgggcgcctt aacccggcgt
304930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 49gggaataacg ccgccgcatc gccggtcggc
305030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50gcggcgcaat acgaatgccc ccggccgtcc
305130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 51tgctgcggat atgggtacgg cccggcgcga
305230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 52gggcagacgt tcgaatgggt cgtcgccgcc
305330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 53gccgcaggct ccactcctgg tggtgccctt
305430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 54accgcggctg ctggcaccag acttgccctc
305530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55gggtcgggag tgggtaattt gcgcgcctgc
305630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 56agcgggtcgc cacgtctgat ctgaggtcgc
305730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 57ttccccgctg attccgccaa gcccgttccc
305830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 58tgcacgtcag gaccgctacg gacctccacc
305930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 59agcggattcc gacttccatg gccaccgtcc
306030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 60agcttcgccc cattggctcc tcagccaagc
306130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 61gatcgcagcg agggagctgc tctgctacgt
306230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 62gaacggccat gcaccaccac ccacggaatc
306330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 63tctcgggtgg ctgaacgcca cttgtccctc
306430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 64gggtcagcgc ccgtcggcat gtattagctc
306530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 65tcctccctga gctcgcctta ggacacctgc
306630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 66ggaatcgaac cctgattccc cgtcacccgt
306730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 67acgggcggtg tgtacaaagg gcagggactt
306830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 68tacggatccg gcttgccgac ttcccttacc
306930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 69accggccgtg cgtacttaga catgcatggc
307030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 70gtcatagtta ctcccgccgt ttacccgcgc
307130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 71gatccttccg caggttcacc tacggaaacc
307230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 72tcacgacggt ctaaacccag ctcacgttcc
307330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 73ggccccgctt tcacggtctg tattcgtact
307430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 74gtacttgttg actatcggtc tcgtgccggt
307530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 75ggaacccttc tccacttcgg ccttcaaagt
307630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 76acccgtttac ctcttaacgg tttcacgccc
307730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 77gaacctccga ctttcgttct tgattaatga
307850DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 78gcccccgccg gccgccccgg cggccgccgc
gcggcccctg ccgccccgac 507950DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 79gcccccgccg
ccgccgccac cgccgccgcc gccgccgccc cgacccgcgc 508050DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80ggaccggccc gcggcccctc cgccgcctgc cgccgccgcc
gccgcgcgcc 508150DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 81gccccgcccc gccgcccgcc
gaccgccgcc gcccgaccgc tcccgccccc 508250DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82gtccgccccg ccccccgacc cgcgcgcggc accccccccg
tcgccggggc 508350DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 83accccggtcc cggcgcgcgg
cggggcacgc gccctcccgc ggcggggcgc 508450DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84ggccccgccc gcccaccccc gcacccgccg gagcccgccc
cctccgggga 508550DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 85ggcggcccgc agggccgcgg
accccgcccc gggcccctcg cggggacacc 508650DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86gccgccctcc gacgcacacc acacgcgcgc gcgcgcgcgc
cgcccccgcc 508750DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 87ggggcgcgcg cctcgtccag
ccgcggcgcg cgcccagccc cgcttcgcgc 508850DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88agccgccggc gcccgccccc cggccggggc cggagagggg
ctgaccgggt 508950DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 89gggcggggac gggcggtggc
tcgcctcgcg gcggaccgcc cgcccgctcc 509050DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90gggcccggct cgcgtccaga gtccgcgccg ccgccggccc
cccgggtccc 509150DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 91ggcactgtcc ccggagcggg
tcgcgcccgg ccgggcgggc gcttggcgcc 509250DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92gcgccgtggg aggggtggcc cggccccccc acgaggagac
gccggcgcgc 509350DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 93tccacctccc cggcgcggcg
ggcgagacgg gccggtggtg cgccctcggc 509450DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 94tccccgccgg gccttcccag ccgtcccgga gccggtcgcg
gcgcaccgcc 509550DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 95gtcggctgct aggcgccggc
cgaggcgagg cgcgcgcgga accgcggccc 509650DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 96gggcgcgcgc cggccgctac cggcctcaca ccgtccacgg
gctgggcctc 509750DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 97gggacgcgcg cgtggccccg
agagaacctc ccccgggccc gacggcgcga 509850DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98ggcgggaaag atccgccggg ccgccgacac ggccggaccc
gccgccgggt 509950DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 99gaccgtcttc tcagcgctcc
gccagggccg tgggccgacc ccggcggggc 5010050DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 100agcggcgccg gggagcgggt cttccgtacg ccacatgtcc
cgcgccccgc 5010150DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 101ggctcaccgc agcggccctc
ctactcgtcg cggcgtagcg tccgcggggc 5010250DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 102gcgcggcgac gggtctcgct ccctcggccc cgggattcgg
cgagtgctgc 5010350DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 103acctcggccg gcgagcgcgc
cggccttcac cttcattgcg ccacggcggc 5010450DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 104ggccgagggc aacggaggcc atcgcccgtc ccttcggaac
ggcgctcgcc 5010550DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 105gaggccaacc gaggctccgc
ggcgctgccg tatcgttcgc ctgggcggga 5010650DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 106agctcaccgg
acgccgccgg aaccgcgacg ctttccaagg cacgggcccc 5010750DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 107tcaagacggg tcgggtgggt agccgacgtc gccgccgacc
ccgtgcgctc 5010850DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 108tctccccggg gctcccgccg
gcttctccgg gatcggtcgc gttaccgcac 5010950DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 109gctgcccggc gggtcatggg aataacgccg ccgcatcgcc
ggtcggcatc 5011050DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 110gtggcccact aggcactcgc
attccacgcc cggctccacg ccagcgagcc 5011150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 111gcgacggccg ggtatgggcc cgacgctcca gcgccatcca
ttttcagggc 5011250DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 112gggtaggcac acgctgagcc
agtcagtgta gcgcgcgtgc agccccggac 5011350DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 113ggggtctgat gagcgtcggc atcgggcgcc ttaacccggc
gttcggttca 5011450DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 114gcactgggca gaaatcacat
cgcgtcaaca cccgccgcgg gccttcgcga 5011550DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 115gaggctgttc accttggaga cctgctgcgg atatgggtac
ggcccggcgc 5011650DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 116tcgtcactac ctccccgggt
cgggagtggg taatttgcgc gcctgctgcc 5011750DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 117gaatggttta gcgccaggtt ccccacgaac gtgcggtgcg
tgacgggcga 5011850DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 118gcgtcgggtc tgcgagagcg
ccagctatcc tgagggaaac ttcggaggga 5011950DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 119acccaggtcg gacgaccgat ttgcacgtca ggaccgctac
ggacctccac 5012050DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 120tcgaaccctg attccccgtc
acccgtggtc accatggtag gcacggcgac 5012150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 121ttccccgctg attccgccaa gcccgttccc ttggctgtgg
tttcgctgga 5012250DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 122gcggcgcaat acgaatgccc
ccggccgtcc ctcttaatca tggcctcagt 5012350DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 123gggccgggtg aggtttcccg tgttgagtca aattaagccg
caggctccac 5012450DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 124ggtcctattc cattattcct
agctgcggta tccaggcggc tcgggcctgc 5012550DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 125gctattggag ctggaattac cgcggctgct ggcaccagac
ttgccctcca 5012650DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 126gtcctccctg agctcgcctt
aggacacctg cgttaccgtt tgacaggtgt 5012750DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 127tcgctccacc aactaagaac ggccatgcac caccacccac
ggaatcgaga 5012850DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 128gggctgactt tcaatagatc
gcagcgaggg agctgctctg ctacgtacga 5012950DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 129gttacacact ccttagcgga ttccgacttc catggccacc
gtcctgctgt 5013050DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 130atcccacaga tggtagcttc
gccccattgg ctcctcagcc aagcacatac 5013150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 131gccattcgca gtttcactgt accggccgtg cgtacttaga
catgcatggc 5013250DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 132ggtagtagcg acgggcggtg
tgtacaaagg gcagggactt aatcaacgca 5013350DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 133gcggacccca cccgtttacc tcttaacggt ttcacgccct
cttgaactct 5013450DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 134ttgaatattt gctactacca
ccaagatctg cacctgcggc ggctccaccc 5013550DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 135ttagagccaa tccttatccc gaagttacgg atccggcttg
ccgacttccc 5013650DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 136tcgtgccggt atttagcctt
agatggagtt taccacccgc tttgggctgc 5013750DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 137ggcatttggc taccttaaga gagtcatagt tactcccgcc
gtttacccgc 5013850DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 138aacctgtctc acgacggtct
aaacccagct cacgttccct attagtgggt 5013950DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 139gggtcagcgc ccgtcggcat gtattagctc tagaattacc
acagttatcc 5014050DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 140gccccgcttt cacggtctgt
attcgtactg aaaatcaaga tcaagcgagc 5014150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 141tcctccgctg actaatatgc ttaaattcag cgggtcgcca
cgtctgatct 5014250DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 142gttattgctc aatctcgggt
ggctgaacgc cacttgtccc tctaagaagt 5014350DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 143tgagaatagg ttgagatcgt ttcggcccca agacctctaa
tcattcgctt 5014450DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 144gtcttcgaac ctccgacttt
cgttcttgat taatgaaaac attcttggca 5014575DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(25)..(30)a, c, t or
gmodified_base(33)..(38)a, c, t or g 145caagcagaag acggcatacg
agatnnnnnn gtnnnnnngt gactggagtt cagacgtgtg 60ctcttccgat ctggg
7514685DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotidemodified_base(25)..(40)a, c, t or
gmodified_base(43)..(48)a, c, t or g 146caagcagaag acggcatacg
agatnnnnnn nnnnnnnnnn gtnnnnnngt gactggagtt 60cagacgtgtg ctcttccgat
ctggg 8514779DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotideDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotidemodified_base(30)..(35)a, c, t or
gmodified_base(38)..(43)a, c, t or g 147aatgatacgg cgaccaccga
gatctacacn nnnnngtnnn nnnacactct ttccctacac 60gacgctcttc cgatctggg
7914889DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotidemodified_base(30)..(45)a, c, t or
gmodified_base(48)..(53)a, c, t or g 148aatgatacgg cgaccaccga
gatctacacn nnnnnnnnnn nnnnngtnnn nnnacactct 60ttccctacac gacgctcttc
cgatctggg 8914939DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotideDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(36)a, c, t or g 149ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnggg 3915049DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotideDescription of
Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 150ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnnggg 4915149DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(44)a, c, t or gSee specification as filed for
detailed description of substitutions and preferred embodiments
151ctacacgacg ctcttccgat ctnnnnnngt nnnnnnnnnn nnnnwwggg
4915249DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotidemodified_base(23)..(38)a, c, t or
gmodified_base(41)..(46)a, c, t or g 152ctacacgacg ctcttccgat
ctnnnnnnnn nnnnnnnngt nnnnnnggg 4915351DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 153ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnnatgg g 5115453DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 154ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnnacat ggg 5315555DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 155ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnntaac atggg 5515657DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 156ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnncgta acatggg 5715759DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 157ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnnaccg taacatggg 5915871DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(23)..(28)a, c, t or
gmodified_base(31)..(46)a, c, t or g 158ctacacgacg ctcttccgat
ctnnnnnngt nnnnnnnnnn nnnnnnacac aagaggcacg 60cgtaacatgg g
7115910DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 159tttcttatat 1016020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
160acttgtccag cctaacctgc 2016120DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 161ttaccctggg aggaaccaga
2016220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 162tttcaggcca caactccctt 2016320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
163cagacagacc atgatgcggg 2016420DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 164gccacaactc ccttttctgg
2016520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 165agtctctcag ctggtacacg 2016620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
166tctgatggct caaacacagc 2016716DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 167aaaaaaaaaa
aaaaaa 1616811DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 168aaaaaaaaaa a
1116911DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 169tttttttttt t 1117021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 170aaaaaaaaaa aaaaaaaaaa a 21
* * * * *