U.S. patent application number 15/800517 was filed with the patent office on 2018-04-12 for factor xii (hageman factor) (f12), kallikrein b, plasma (fletcher factor) 1 (klkb1), and kininogen 1 (kng1) irna compositions and methods of use thereof.
The applicant listed for this patent is Alnylam Pharmaceuticals, Inc.. Invention is credited to Akin Akinc, James Butler, Gregory Hinkle, Jingxuan Liu, Martin Maier.
Application Number | 20180100150 15/800517 |
Document ID | / |
Family ID | 55971215 |
Filed Date | 2018-04-12 |
United States Patent
Application |
20180100150 |
Kind Code |
A1 |
Akinc; Akin ; et
al. |
April 12, 2018 |
Factor XII (Hageman Factor) (F12), KALLIKREIN B, PLASMA (FLETCHER
FACTOR) 1 (KLKB1), and Kininogen 1 (KNG1) iRNA COMPOSITIONS AND
METHODS OF USE THEREOF
Abstract
The present invention relates to RNAi agents, e.g., double
stranded RNAi agents, targeting the Kallikrein B, Plasma (Fletcher
Factor) 1 (KLKB1) gene, the Factor XII (Hageman Factor (F12) gene,
or the Kininogen 1 (KNG1) gene, and methods of using such RNAi
agents to inhibit expression of a KLKB1 gene, an F12 gene, and/or a
KNG1 gene, and methods of treating subjects having an hereditary
angioedema (HAE) and/or a contact activation pathway-associated
disorder.
Inventors: |
Akinc; Akin; (Needham,
MA) ; Hinkle; Gregory; (Cambridge, MA) ;
Maier; Martin; (Belmont, MA) ; Butler; James;
(Lynnfield, MA) ; Liu; Jingxuan; (West Roxbury,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Alnylam Pharmaceuticals, Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
55971215 |
Appl. No.: |
15/800517 |
Filed: |
November 1, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2016/030876 |
May 5, 2016 |
|
|
|
15800517 |
|
|
|
|
62266958 |
Dec 14, 2015 |
|
|
|
62260887 |
Nov 30, 2015 |
|
|
|
62157890 |
May 6, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/713 20130101;
C12N 2310/321 20130101; A61P 7/02 20180101; C12N 15/1137 20130101;
A61K 47/549 20170801; C12N 15/113 20130101; A61P 9/10 20180101;
A61P 9/12 20180101; C12N 2310/31 20130101; C12N 2310/322 20130101;
C12N 2310/14 20130101; C12N 2310/344 20130101; A61K 45/06 20130101;
C12Q 1/6883 20130101; A61P 7/10 20180101; A61P 43/00 20180101; C12N
2310/322 20130101; C12N 2310/3533 20130101; C12N 2310/321 20130101;
C12N 2310/3521 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12Q 1/6883 20060101 C12Q001/6883 |
Claims
1. A double stranded ribonucleic acid (dsRNA) agent selected from
the group consisting of a) a dsRNA agent for inhibiting expression
of Factor XII (Hageman Factor) (F12), wherein said dsRNA agent
comprises a sense strand and an antisense strand, wherein said
sense strand comprises at least 15 contiguous nucleotides differing
by no more than 3 nucleotides from the nucleotide sequence of SEQ
ID NO:9 and said antisense strand comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:10; b) a double stranded
ribonucleic acid (dsRNA) agent for inhibiting expression of Factor
XII (Hageman Factor) (F12), wherein said dsRNA agent comprises a
sense strand and an antisense strand, the antisense strand
comprising a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
any one of the antisense sequences listed in any one of Tables 9,
10, 19C, 19D, 20, 21, 23, 24, 26, and 27; c) a double stranded
ribonucleic acid (RNAi) agent for inhibiting expression of a Factor
XII (Hageman Factor) (F12) gene, wherein the double stranded RNAi
agent comprises a sense strand and an antisense strand, the
antisense strand comprising a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from nucleotides 2000-2060 of SEQ ID NO:9; d) a
double stranded ribonucleic acid (dsRNA) agent for inhibiting
expression of Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1),
wherein said dsRNA agent comprises a sense strand and an antisense
strand, wherein said sense strand comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:1 and said antisense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2; e)
a double stranded ribonucleic acid (dsRNA) agent for inhibiting
expression of a Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1),
wherein said dsRNA agent comprises a sense strand and an antisense
strand, the antisense strand comprising a region of complementarity
which comprises at least 15 contiguous nucleotides differing by no
more than 3 nucleotides from any one of the antisense sequences
listed in any one of Tables 3, 4, 19A, or 19B; f) a double stranded
ribonucleic acid (dsRNA) agent for inhibiting expression of
Kininogen 1 (KNG1), wherein said dsRNA agent comprises a sense
strand and an antisense strand, wherein said sense strand comprises
at least 15 contiguous nucleotides differing by no more than 3
nucleotides from the nucleotide sequence of SEQ ID NO:17 and said
antisense strand comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from the nucleotide
sequence of SEQ ID NO:18; g) a double stranded ribonucleic acid
(dsRNA) agent for inhibiting expression of a Kininogen 1 (KNG1),
wherein said dsRNA agent comprises a sense strand and an antisense
strand, the antisense strand comprising a region of complementarity
which comprises at least 15 contiguous nucleotides differing by no
more than 3 nucleotides from any one of the antisense sequences
listed in any one of Tables 15, 16, 19E or 19F; h) a double
stranded ribonucleic acid (dsRNA) agent for inhibiting expression
of Factor XII (Hageman Factor) (F12), wherein said dsRNA agent
comprises a sense strand and an antisense strand forming a double
stranded region, wherein said sense strand comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
the nucleotide sequence of SEQ ID NO:9 and said antisense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:10,
wherein substantially all of the nucleotides of said sense strand
and substantially all of the nucleotides of said antisense strand
are modified nucleotides, and wherein said sense strand is
conjugated to a ligand attached at the 3'-terminus; i) a double
stranded ribonucleic acid (dsRNA) agent for inhibiting expression
of Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1), wherein said
dsRNA agent comprises a sense strand and an antisense strand
forming a double stranded region, wherein said sense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1 and
said antisense strand comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from the nucleotide
sequence of SEQ ID NO:2, wherein substantially all of the
nucleotides of said sense strand and substantially all of the
nucleotides of said antisense strand are modified nucleotides, and
wherein said sense strand is conjugated to a ligand attached at the
3'-terminus; and j) a double stranded ribonucleic acid (dsRNA)
agent for inhibiting expression of Kininogen 1 (KNG1), wherein said
dsRNA agent comprises a sense strand and an antisense strand
forming a double stranded region, wherein said sense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:17 and
said antisense strand comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from the nucleotide
sequence of SEQ ID NO:18, wherein substantially all of the
nucleotides of said sense strand and substantially all of the
nucleotides of said antisense strand are modified nucleotides, and
wherein said sense strand is conjugated to a ligand attached at the
3'-terminus.
2. The dsRNA agent of claim 1, wherein said dsRNA agent comprises
at least one modified nucleotide.
3. The dsRNA agent of claim 1, wherein all of the nucleotides of
said sense strand and all of the nucleotides of said antisense
strand comprise a modification.
4. The dsRNA agent of claim 2, wherein the at least one modified
nucleotide is selected from the group consisting of a
deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a
2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a
2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked
nucleotide, a conformationally restricted nucleotide, a constrained
ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified
nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified
nucleotide, 2'-hydroxly-modified nucleotide, a 2'-methoxyethyl
modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino
nucleotide, a phosphoramidate, a non-natural base comprising
nucleotide, a tetrahydropyran modified nucleotide, a
1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified
nucleotide, a nucleotide comprising a phosphorothioate group, a
nucleotide comprising a methylphosphonate group, a nucleotide
comprising a 5'-phosphate, and a nucleotide comprising a
5'-phosphate mimic
5. The dsRNA agent of claim 1, further comprising at least one
phosphorothioate internucleotide linkage.
6. The dsRNA agent of claim 1, wherein the region of
complementarity is 19 to 30 nucleotides in length; 21 to 23
nucleotides in length; 21 nucleotides in length; 19 nucleotides in
length; or at least 17 nucleotides in length.
7. The dsRNA agent of claim 1, wherein each strand is no more than
30 nucleotides in length; each strand is independently 19-30
nucleotides in length; or each strand is independently 19-25
nucleotides in length.
8. The dsRNA agent of claim 1, wherein at least one strand
comprises a 3' overhang of at least 1 nucleotide; or a 3' overhang
of at least 2 nucleotides.
9. The dsRNA agent of claim 1, wherein the ligand is conjugated to
the 3' end of the sense strand of the dsRNA agent.
10. The dsRNA agent of claim 9, wherein the ligand is an
N-acetylgalactosamine (GalNAc) derivative.
11. The dsRNA agent of claim 10, wherein the ligand is
##STR00016##
12. The dsRNA agent of claim 11, wherein the dsRNA agent is
conjugated to the ligand as shown in the following schematic and,
wherein X is O or S.
13. A cell containing the dsRNA agent of claim 1.
14. A vector encoding at least one strand of of the dsRNA agent of
claim 1.
15. A pharmaceutical composition comprising the dsRNA agent of
claim 1.
16. The pharmaceutical composition of claim 15, wherein dsRNA agent
is in an unbuffered solution; or a buffer solution.
17. A pharmaceutical composition comprising the dsRNA agent of
claim 1, and a lipid formulation.
18. A method of inhibiting expression of a contact activation
pathway gene in a cell, the method comprising: (a) contacting the
cell with the dsRNA agent of claim 1, or a pharmaceutical
composition of claim 15; and (b) maintaining the cell produced in
step (a) for a time sufficient to obtain degradation of the mRNA
transcript of the contact activation pathway gene, thereby
inhibiting expression of the contact activation pathway gene in the
cell.
19. The method of claim 18, wherein said cell is within a
subject.
20. The method of claim 19, wherein the subject is a human.
21. A method of treating a subject having a disease or disorder
that would benefit from reduction in expression of a contact
activation pathway gene, the method comprising administering to the
subject a therapeutically effective amount of the dsRNA agent of
claim 1, or a pharmaceutical composition of claim 15, thereby
treating said subject.
22. A method of preventing at least one symptom in a subject having
a disease or disorder that would benefit from reduction in
expression of a contact activation pathway gene, the method
comprising administering to the subject a prophylactically
effective amount of the dsRNA agent of claim 1, or a pharmaceutical
composition of claim 15, thereby preventing at least one symptom in
the subject having a disorder that would benefit from reduction in
expression of a contact activation pathway gene.
23. The method of claim 21 or 22, wherein the administration of the
dsRNA to the subject causes a decrease in bradykinin levels or a
decrease in coagulation factor XII activity.
24. The method of claim 21 or 22, wherein the disorder is a contact
activation pathway-associated disease.
25. The method of claim 24, wherein the contact activation
pathway-associated disease is selected from the group consisting of
thrombophilia, hereditary angioedema (HAE), Fletcher Factor
Deficiency, and essential hypertension.
26. The method of claim 22, wherein the at least one symptom is an
angioedema attack or thrombus formation.
27. The method of claim 21 or 22, wherein the subject is human.
28. The method of claim 21 or 22, further comprising administering
an anti-KLKB1 antibody, or antigen-binding fragment thereof, to the
subject.
29. The method of claim 21 or 22, further comprising measuring
bradykinin and/or coagulation factor XII levels in said
subject.
30. The method of claim 21 or 22, wherein the administration is
subcutaneous administration.
Description
RELATED APPLICATIONS
[0001] This application is a 35 .sctn. U.S.C. 111(a) continuation
application which claims the benefit of priority to
PCT/US2016/030876, filed on May 5, 2016, which claims the benefit
of priority to U.S. Provisional application No. 62/157,890, filed
on May 6, 2015, to U.S. Provisional Patent Application No.
62/260,887, filed on Nov. 30, 2015, and to U.S. Provisional Patent
Application No. 62/266,958, filed on Dec. 14, 2015. The entire
contents of each of the foregoing applications are hereby
incorporated herein by reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Oct. 6, 2017, is named 121301_03104_SL.txt and is 721,872 bytes
in size.
BACKGROUND OF THE INVENTION
[0003] The blood coagulation system is essential for hemostasis,
responding to vascular injury with local production of a clot
formed of fibrin mesh and activated platelets. Blood coagulation,
thrombin generation, and fibrin formation can be initiated by two
distinct pathways, referred to as the extrinsic and intrinsic
pathways.
[0004] The extrinsic pathway involves binding of plasma factor VIIa
(FVIIa) to extravascular tissue factor (TF) at a site of vessel
injury.
[0005] The intrinsic pathway is initiated by the surface-dependent
activation of plasma factor XII (F12) to F12a in a process called
contact activation. Contact activation involves two other proteins,
prekallikrein and high molecular weight kininogen which circulate
as a bi-molecular complex. Collectively, these three proteins,
FXII, prekallikrein and HK, comprise the "contact activation
pathway," also referred to as the "Kallikrein-Kinin System." When
the contact activation pathway is initiated by binding of F12 to
negatively charged surfaces (or macromolecules), a conformational
change in F12 is induced resulting in formation of active F12
(F12a). F12a cleaves prekallikrein to generate active kallikrein
(.alpha.-kallikrein), which in turn reciprocally activates F12 to
generate additional F12a. The active kallikrein then digests
high-molecular-weight kininogen to liberate bradykinin. F12a
generated by contact activation also activates factor XI (F11) to
F11a, triggering a series of proteolytic cleavage events that
culminates in thrombin generation and fibrin clot formation.
[0006] Interestingly, it has been shown that the contact system is
not required for hemostasis. Humans and other animals deficient in
a contact activation protein are largely asymptomatic and
homozygous F12 deficiency is not associated with any disease or
disorder. However, the contact system has been shown to play an
important role in thrombotic disease, as pharmacologic inhibition
of F12a or ablation of the F12 or high molecular weight kininogen
genes can protect mice from experimentally induced thrombosis in a
variety of models.
[0007] In healthy subjects, a homeostatic balance between
procoagulant forces and anticoagulant and fibrinolytic forces
exists. However, numerous genetic, acquired, and environmental
factors can dysregulate this balance in favor of coagulation,
leading to thrombosis, the pathologic formation of thrombi,
triggering life-threatening events For example, formation of
thrombi in a vein may result in, e.g., deep venous thrombosis
(DVT), and formation of thrombi in an artery or a cardiac chamber
may result in, e.g., myocardial infarction or stroke. Thrombi may
obstruct blood flow at the site of formation or detach and embolize
to block a distant blood vessel (e.g., a pulmonary embolism or
embolic stroke).
[0008] Acquired/enviornomental factors that can lead to
pathological contact activation and contact pathway-mediated
thrombosis include various dental, surgical and medical settings,
such as atrial fibrillation, cancer treatment, immobilization,
central venous catheters, implants, and extracorporeal oxygenation.
As a result of such medical and surgical settings, tissue damage
releases tissue factor and exposes various triggers of the contact
pathway, such as DNA, RNA, phosphate, collagen, and laminin) which
activate the contact pathway leading to thrombosis.
[0009] A genetic disorder that dysregulates the homeostatic balance
between procoagulant forces and anticoagulant and fibrinolytic
forces is Hereditary Angioedema (HAE). HAE is a rare autosomal
dominant disorder that causes recurrent edema and swelling of the
extremities, face, larynx, upper respiratory tract, abdomen, trunk,
and genetials and a nonpruritic rash in one-third of patients.
Untreated HAE patients experience an average of one-to-two
angioedema attacks per month, but the frequency and severity of
episodes can vary significantly. Edema swelling is often
disfiguring and disabling, results in frequent hospitalization, and
patients sometimes require psychiatric care to treat
disease-associated anxiety. Abdominal attacks can cause severe
pain, nausea and vomiting, and sometimes lead to inappropriate
surgeries. Furthermore, over half of HAE patients also experience
life-threatening laryngeal edema during their lifetime that may
require emergency tracheostomy to prevent asphyxiation. HAE affects
an estimated 6,000 to 10,000 individuals of varying ethnic groups
in the United States and causes significant economic harm to
patients, accounting for 15,000 to 30,000 hospital visits and 20 to
100 sick days per year.
[0010] HAE results from a mutation of the C1 inhibitor (C1INH,
SERPING1) gene that results in a deficiency of C1INH protein. Over
250 different C1INH mutations have been demonstrated to cause an
HAE clinical presentation. These C1INH mutations are typically
inherited genetically, however, up to 25% of HAE cases result from
de novo mutation of C1INH. HAE type I is caused by C1INH mutations
that result in lower levels of truncated or misfolded proteins that
are inefficiently secreted, and accounts for approximately 85% of
HAE cases. HAE type II constitutes about 15% of cases and is caused
by mutations near the C1INH's active site that result in normal
levels of dysfunctional C1INH protein. In addition, HAE type III, a
rare third form the disease, occurs because of a gain-of-function
mutation in coagulation factor XII (F12) (Hageman Factor).
[0011] C1 inhibitor is a serine protease inhibitor of the serpin
family and a major inhibitor of proteases in the complement and
contact activation pathways, as well as a minor inhibitor of
fibrinolytic protease plasmin. These plasma proteolytic cascades
are activated during an HAE attack, generating substances that
increase vascular permeability, e.g., bradykinin. Studies have
shown that the bradykinin peptide, which activates proinflammatory
signaling pathways that dilate vessels and induces chemotaxis of
neutrophils, is the primary substance that enhances vascular
permeability in an HAE attack by binding to the bradykinin receptor
on vascular endothelial cells.
[0012] Typically, C1INH inhibits the autoactivation of F12 the
ability of F12a to activate prekallilrein, the activation of high
molecular weight kininogen by kallikrein, and the feedback
activation of F12 by kallikrein. Consequently, mutations causing
C1INH deficiency or F12 gain-of-function result in excess
production of bradykinin and onset of HAE angioedema.
[0013] Currently, HAE may be treated with 17.alpha.-alkylated
androgens prophylactically to reduce to probability of recurrent
episodes, or with disease-specific therapeutics to treat acute
attacks. About 70% of individuals with HAE are treated with
androgens or remain untreated, and about 30% receive therapeutics.
Androgens are unsuitable for short-term treatment of acute attacks
because they take several days to become effective, and they can
have significant side effects and may affect growth and development
adversely. As a result, androgens are used only for long-term
prophylaxis and are typically not administered to pregnant women or
children. Furthermore, current therapeutics used to treat acute
attacks must be administered intravenously numerous times per week
or may cause side-effects that require drug administration and
subsequent patient monitoring in a hospital, thereby limiting their
regular prophylactic use to manage the disease long-term.
Therefore, in the absence of regimens which be administered safely,
effectively and by more convenient routes and regimens to treat
acute angioedema attacks and prophylactically manage recurrent
attacks in a large proportion of patients, including pregnant women
and children, there is a need for alternative therapies for
subjects suffering from HAE.
[0014] Accordingly, there is a need in the art for compositions and
methods to inhibit thrombosis in a subject at risk of forming a
thrombus, such as a subject having a genetic, an acquired, or an
environmental risk of forming a thrombus.
SUMMARY OF THE INVENTION
[0015] The present invention provides iRNA compositions which
effect the RNA-induced silencing complex (RISC)-mediated cleavage
of RNA transcripts of a Kallikrein B, Plasma (Fletcher Factor) 1
(KLKB1) gene, RNA transcripts of a Factor XII (F12) gene, or RNA
transcripts of a kininogen (KNG1) gene. For simplicity, and unless
otherwise specified, the term "contact activation pathway gene" as
used herein refers to a KLKB1 gene, an F12 gene, or a KNG1 gene.
The contact activation pathway gene may be within a cell, e.g., a
cell within a subject, such as a human.
[0016] Accordingly, in one aspect, the present invention provides
double stranded ribonucleic acid (RNAi) agents for inhibiting
expression of Factor XII (Hageman Factor) (F12), wherein the double
stranded RNAi agent comprises a sense strand and an antisense
strand, wherein the sense strand comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:9 and the antisense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID
NO:10.
[0017] In another aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of a Factor XII (Hageman Factor) (F12), wherein the double stranded
RNAi agent comprises a sense strand and an antisense strand, the
antisense strand comprising a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from any one of the antisense sequences listed
in any one of Tables 9, 10, 19C, 19D, 20, 21, 23, 24, 26, and
27.
[0018] In another aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of a Factor XII (Hageman Factor) (F12), wherein the double stranded
RNAi agent comprises a sense strand and an antisense strand, the
antisense strand comprising a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from nucleotides 2000-2060 of SEQ ID NO:9. In
some embodiments, the antisense strand comprises a region of
complementarity which comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from nucleotides 2000-2030
of SEQ ID NO:9. In other embodiments, the antisense strand
comprises a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
nucleotides 2030-2060 of SEQ ID NO:9. In one embodiment, the
antisense strand comprises a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from nucleotides 2010-2040 of SEQ ID NO:9. In
one embodiment, the antisense strand comprises a region of
complementarity which comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from nucleotides 2010-2035
of SEQ ID NO:9. In another embodiment, the antisense strand
comprises a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
nucleotides 2015-2040 of SEQ ID NO:9. In another embodiment, the
antisense strand comprises a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from nucleotides 2015-2045 of SEQ ID NO:9. In
another embodiment, the antisense strand comprises a region of
complementarity which comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from nucleotides 2020-2050
of SEQ ID NO:9. In another embodiment, the antisense strand
comprises a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
nucleotides 2020-2045 of SEQ ID NO:9. In still other embodiments,
the antisense strand comprises a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from any one of the ranges of SEQ ID NO:9
provided in Table 24. In one embodiment, the antisense strand
comprises a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
nucleotides 2018-2040 of SEQ ID NO:9. In one embodiment, the
antisense strand comprises a region of complementarity which
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of the antisense
strand of AD-67244 (5'-UUCAAAGCACUUUAUUGAGUUUC-3') (SEQ ID NO: 25).
In one embodiment, the sense strand comprises the sense strand
nucleotide sequence of AD-67244. In some embodiments, the region of
complementarity comprises 15, 16, 17, 18, 19, 20, 21, 22, or 23
nucleotides differing by no more than 3 nucleotides from
nucleotides 2015-2040 of SEQ ID NO:9. In some embodiments, the
region of complementarity comprises 15, 16, 17, 18, 19, 20, 21, 22,
or 23 nucleotides differing by no more than 3 nucleotides from
nucleotides 2015-2045 of SEQ ID NO:9. In some embodiments, the
region of complementarity comprises 15, 16, 17, 18, 19, 20, 21, 22,
or 23 nucleotides differing by no more than 3 nucleotides from
nucleotides 2018-2040 of SEQ ID NO:9. In some embodiments, the
region of complementarity comprises 15, 16, 17, 18, 19, 20, 21, 22,
or 23 nucleotides differing by no more than 3 nucleotides from
nucleotides 2018-2045 of SEQ ID NO:9. In one embodiment, the agent
comprises at least one modified nucleotide. In another embodiment,
all of the nucleotides of the agent are modified nucleotides. In
one embodiment, the agent further comprises a ligand, e.g., a
ligand attached to the 3'-end of the sense strand. In one
embodiment, the sense strand and the antisense strand are each
independently 15-30 nucleotides in length. In another embodiment,
the sense strand and the antisense strand are each independently
19-25 nucleotides in length.
[0019] In one aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1), wherein the
double stranded RNAi agent comprises a sense strand and an
antisense strand, wherein the sense strand comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
the nucleotide sequence of SEQ ID NO:1 and the antisense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2.
[0020] In another aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of a Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1), wherein the
double stranded RNAi agent comprises a sense strand and an
antisense strand, the antisense strand comprising a region of
complementarity which comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from any one of the
antisense sequences listed in any one of Tables 3, 4, 19A, or
19B.
[0021] In one aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of Kininogen 1 (KNG1), wherein the double stranded RNAi agent
comprises a sense strand and an antisense strand, wherein the sense
strand comprises at least 15 contiguous nucleotides differing by no
more than 3 nucleotides from the nucleotide sequence of SEQ ID
NO:17 and the antisense strand comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:18.
[0022] In another aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of a Kininogen 1 (KNG1), wherein the double stranded RNAi agent
comprises a sense strand and an antisense strand, the antisense
strand comprising a region of complementarity which comprises at
least 15 contiguous nucleotides differing by no more than 3
nucleotides from any one of the antisense sequences listed in any
one of Tables 15, 16, 19E, or 19F.
[0023] In one embodiment, the antisense strand comprises a region
of complementarity which comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from any one of
the antisense sequences listed in any one of Tables 3, 4, 9, 10,
15, 16, 19A, 19B, 19C, 19D, 19E, 19F, 20, 21, 23, 24, 26, and
27.
[0024] In one embodiment, the double stranded RNAi agents provided
herein comprise at least one modified nucleotide.
[0025] In one aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1), wherein the
double stranded RNAi agent comprises a sense strand and an
antisense strand forming a double stranded region, wherein the
sense strand comprises at least 15 contiguous nucleotides differing
by no more than 3 nucleotides from the nucleotide sequence of SEQ
ID NO:1 and the antisense strand comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:2, wherein substantially all of
the nucleotides of the sense strand and substantially all of the
nucleotides of the antisense strand are modified nucleotides, and
wherein the sense strand is conjugated to a ligand attached at the
3'-terminus.
[0026] In another aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of Factor XII (Hageman Factor) (F12), wherein the double stranded
RNAi agent comprises a sense strand and an antisense strand forming
a double stranded region, wherein the sense strand comprises at
least 15 contiguous nucleotides differing by no more than 3
nucleotides from the nucleotide sequence of SEQ ID NO:9 and the
antisense strand comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from the nucleotide
sequence of SEQ ID NO:10, wherein substantially all of the
nucleotides of the sense strand and substantially all of the
nucleotides of the antisense strand are modified nucleotides, and
wherein the sense strand is conjugated to a ligand attached at the
3'-terminus.
[0027] In a further aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of Kininogen 1 (KNG1), wherein the double stranded RNAi agent
comprises a sense strand and an antisense strand forming a double
stranded region, wherein the sense strand comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
the nucleotide sequence of SEQ ID NO:17 and the antisense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:18,
wherein substantially all of the nucleotides of the sense strand
and substantially all of the nucleotides of the antisense strand
are modified nucleotides, and wherein the sense strand is
conjugated to a ligand attached at the 3'-terminus.
[0028] In certain embodiments, the dsRNA comprises at least one
modified nucleotide. In certain embodiments, the dsRNA comprises no
more than 4 (i.e., 4, 3, 2, 1, or 0) unmodified nucleotides in the
sense strand. In certain embodiments, the dsRNA comprises no more
than 4 (i.e., 4, 3, 2, 1, or 0) unmodified nucleotides in the
antisense strand. In certain embodiments, the dsRNA comprises no
more than 4 (i.e., 4, 3, 2, 1, or 0) unmodified nucleotides in both
the sense strand and the antisense strand. In certain embodiments,
all of the nucleotides in the sense strand of the dsRNA are
modified nucleotides. In certain embodiments,all of the nucleotides
in the antisense strand of the dsRNA are modified nucleotides. In
certain embodiments, all of the nucleotides in the sense strand of
the dsRNA and all of the nucleotides of the antisense strand are
modified nucleotides.
[0029] In certain embodiments, the at least one of the modified
nucleotides is selected from the group consisting of a
deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a
2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a
2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked
nucleotide, a conformationally restricted nucleotide, a constrained
ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified
nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified
nucleotide, 2'-hydroxly-modified nucleotide, a 2'-methoxyethyl
modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino
nucleotide, a phosphoramidate, a non-natural base comprising
nucleotide, a tetrahydropyran modified nucleotide, a
1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified
nucleotide, a nucleotide comprising a phosphorothioate group, a
nucleotide comprising a methylphosphonate group, a nucleotide
comprising a 5'-phosphate, and a nucleotide comprising a
5'-phosphate mimic, e.g., a vinyl phosphate.
[0030] In one embodiment, at least one of the modified nucleotides
is selected from the group consisting of 2'-O-methyl and 2'fluoro
modifications.
[0031] In certain embodiments, the antisesense strand of the double
stranded RNAi agents of any of the invention comprise no more than
8 2'-fluoro modifications, no more than 7 2'-fluoro modifications,
no more than 6 2'-fluoro modifications, no more than 5 2'-fluoro
modifications, no more than 4 2'-fluoro modifications, no more than
3 2'-fluoro modifications, no more than 2 2'-fluoro modifications,
no more than 1 2'-fluoro modifications, or no more than 1 2'-fluoro
modifications. In other embodiments, the sesense strand of the
double stranded RNAi agents of any of the invention comprise no
more than 6 2'-fluoro modifications, no more than 5 2'-fluoro
modifications, no more than 4 2'-fluoro modifications, no more than
3 2'-fluoro modifications, no more than 2 2'-fluoro modifications,
no more than 1 2'-fluoro modifications, or no more than 1 2'-fluoro
modifications.
[0032] In one embodiment, the double stranded RNAi agent further
comprises at least one phosphorothioate internucleotide linkage. In
one embodiment, the double stranded RNAi agent comprises 6-8
phosphorothioate internucleotide linkages.
[0033] The region of complementarity may be at least 17 nucleotides
in length, 18 nucleotides in length, 19 nucleotides in length, 20
nucleotides in length, or 21 nucleotides in length.
[0034] In certain embodiment, the region of complementarity may be
19 to 21 nucleotides in length or 21 to 23 nucleotides in
length.
[0035] In certain embodiments, each strand of the double stranded
RNAi agent is no more than 30 nucleotides in length. In certain
embodiments, the double stranded RNAi agent is at least 15
nucleotides in length.
[0036] In certain embodiments, at least one strand of the double
stranded RNAi agent comprises a 3' overhang of at least 1
nucleotide. In certain embodiments, the at least one strand
comprises a 3' overhang of at least 2 nucleotides.
[0037] In certain embodiments, the double stranded RNAi agent
further comprises a ligand. In certain embodiments, the ligand is
conjugated to the 3' end of the sense strand of the dsRNA. In
certain embodiments, the ligand is an N-acetylgalactosamine
(GalNAc) derivative. In certain embodiments, the ligand is one or
more GalNAc derivatives attached through a monovalent, a bivalent,
or a trivalent branched linker. In certain embodiments, the ligand
is
##STR00001##
[0038] In certain embodiments, the dsRNA is conjugated to the
ligand as shown in the following schematic
and, wherein X is O or S.
[0039] In one embodiment, the X is O.
[0040] In one embodiment, the sense and antisense sequences are
selected from any one of those sequences listed in any one of
Tables 3, 4, 9, 10, 15, 16, 19A, 19B, 19C, 19D, 19E, 19F, 20, 21,
23, 24, 26, and 27.
[0041] In one embodiment, the region of complementarity consists of
any one of the antisense sequences listed in any one of Tables 3,
4, 9, 10, 15, 16, 19A, 19B, 19C, 19D, 19E, 19F, 20, 21, 23, 24, 26,
and 27.
[0042] In one embodiment, the dsRNA agent that inhibits the
expression of F12 is selected from the group consisting of
AD-66170, AD-66173, AD-66176, AD-66125, AD-66172 , AD-66167 ,
AD-66165, AD-66168, AD-66163, AD-66116, AD-66126, and AD-67244. In
another embodiment, the dsRNA agent that inhibits the expression of
F12 is AD-67244.
[0043] In one embodiment, the dsRNA agent that inhibits the
expression of KLKB1 is selected from the group consisting of
AD-65077, AD-65170, AD-65103, AD-65083, AD-65087, AD-65149,
AD-64652, AD-65162, AD-65153, AD-65084, AD-65099, and AD-66948. In
another embodiment, the dsRNA agent that inhibits the expression of
KLKB1 is AD-66948.
[0044] In one embodiment, the dsRNA agent that inhibits the
expression of KNG1 is selected from the group consisting of
AD-66259, AD-66261, AD-66262, AD-66263, AD-6634, and AD-67344. In
another embodiment, the dsRNA agent that inhibits the expression of
KNG1 is AD-67344.
[0045] In one aspect, the present invention provides cells
comprising a double stranded RNAi agent of the invention targeting
KLKB1. In one aspect, the present invention provides cells
comprising a double stranded RNAi agent of the invention targeting
F12. In a further aspect, the present invention provides cells
comprising a double stranded RNAi agent of the invention targeting
KNG1.
[0046] In one aspect, the present invention provides vectors
encoding at least one strand of of a double stranded RNAi agent of
the invention targeting KLKB1. In another aspect, the present
invention provides vectors encoding at least one strand of of a
double stranded RNAi agent of the invention targeting F12. In a
further aspect, the present invention provides vectors encoding at
least one strand of of a double stranded RNAi agent of the
invention targeting KNG1.
[0047] In one aspect, the present invention provides pharmaceutical
compositions for inhibiting expression of a KLKB1 gene comprising a
double stranded RNAi agent or vector of the invention. In another
aspect, the present invention provides pharmaceutical compositions
for inhibiting expression of a F12 gene comprising a double
stranded RNAi agent or vector of the invention. In a further
aspect, the present invention provides pharmaceutical compositions
for inhibiting expression of a KNG1 gene comprising a double
stranded RNAi agent or vector of the invention.
[0048] The pharmaceutical compositions provided herein may be
administered in an unbuffered solution, e.g., saline or water, or
administered with a buffer solution, e.g., a buffer solution
comprising acetate, citrate, prolamine, carbonate, or phosphate or
any combination thereof. In one embodiment, the buffer solution is
phosphate buffered saline (PBS).
[0049] In one embodiment, the pharmaceutical compositions of the
invention comprise a double stranded RNAi agent as described
herein, and a lipid formulation.
[0050] In one aspect, the present invention provides methods of
inhibiting KLKB1 expression in a cell. The methods include
contacting the cell with a double stranded RNAi agent or a
pharmaceutical composition of the invention; and maintaining the
cell for a time sufficient to obtain degradation of the mRNA
transcript of a KLKB1 gene, thereby inhibiting expression of the
KLKB1 gene in the cell.
[0051] In another aspect, the present invention provides methods
F12 expression in a cell. The methods include contacting the cell
with a double stranded RNAi agent or a pharmaceutical composition
of the invention; and maintaining the cell for a time sufficient to
obtain degradation of the mRNA transcript of a F12 gene, thereby
inhibiting expression of the F12 gene in the cell.
[0052] In a further aspect, the present invention provides methods
KNG1 expression in a cell. The methods include contacting the cell
with a double stranded RNAi agent or a pharmaceutical composition
of the invention; and maintaining the cell for a time sufficient to
obtain degradation of the mRNA transcript of a KNG1 gene, thereby
inhibiting expression of the KNG1 gene in the cell.
[0053] In one embodiment, the cell is within a subject, such as a
human subject.
[0054] In one embodiment, the KLKB1 expression is inhibited by at
least about 30%, about 40%, about 50%, about 60%, about 70%, about
80%, about 90%, about 95%, about 98% or about 100%.
[0055] In one embodiment, the F12 expression is inhibited by at
least about 30%, about 40%, about 50%, about 60%, about 70%, about
80%, about 90%, about 95%, about 98% or about 100%.
[0056] In one embodiment, the KNG1 expression is inhibited by at
least about 30%, about 40%, about 50%, about 60%, about 70%, about
80%, about 90%, about 95%, about 98% or about 100%.
[0057] In one aspect, the present invention provides methods of
treating a subject having a disease or disorder that would benefit
from reduction in expression of a contact activation pathway gene.
The methods include administering to the subject a therapeutically
effective amount of a double stranded RNAi agent or pharmaceutical
composition of invention, thereby treating the subject.
[0058] In one embodiment, the contact activation pathway gene is
KLKB1. In another embodiment, the contact activation pathway gene
is F12. In yet another embodiment, the contact activation pathway
gene is KNG1.
[0059] In another aspect, the present invention provides methods of
preventing at least one symptom in a subject having a disease or
disorder that would benefit from reduction in expression of a
contact activation pathway gene. The methods include administering
to the subject a prophylactically effective amount of a double
stranded RNAi agent or pharmaceutical composition of invention,
thereby preventing at least one symptom in the subject having a
disorder that would benefit from reduction in expression of a
contact activation pathway gene.
[0060] In one embodiment, the contact activation pathway gene is
KLKB1. In another embodiment, the contact activation pathway gene
is F12. In yet another embodiment, the contact activation pathway
gene is KNG1. In one embodiment, the contact activation pathway
gene is F12 and the methods further comprise administering to the
subject a double stranded RNAi agent of the invention targeting
KLKB1. In another embodiment, the contact activation pathway gene
is F12 and the methods further comprise administering to the
subject a double stranded RNAi agent of the invention targeting
KNG1.
[0061] In one embodiment, the administration of the double stranded
RNAi to the subject causes a decrease in bradykinin levels or a
decrease in coagulation factor XII activity.
[0062] In one embodiment, the disorder is a contact activation
pathway-associated disease, such as a thrombophilia, hereditary
angioedema (HAE), Fletcher Factor Deficiency, or essential
hypertension.
[0063] In certain embodiment, the at least one symptom is an
angioedema attack or a thrombus formation.
[0064] In one embodiment, the subject is human.
[0065] In one embodiment, the methods further comprise
administering an anti-KLKB1 antibody, or antigen-binding fragment
thereof, to the subject.
[0066] In one embodiment, the methods further comprise measuring
bradykinin and/or coagulation factor XII levels in the subject.
[0067] In another aspect, the present invention provides methods of
inhibiting the expression of F12 in a subject. The methods include
administering to the subject a therapeutically effective amount of
a double stranded RNAi agent of the invention targeting F12,
thereby inhibiting the expression of F12 in the subject.
[0068] In one aspect, the present invention provides methods of
inhibiting the expression of KLKB1 in a subject. The methods
include administering to the subject a therapeutically effective
amount of a double stranded RNAi agent of the invention targeting
KLKB1, thereby inhibiting the expression of KLKB1 in the
subject.
[0069] In one aspect, the present invention provides methods of
inhibiting the expression of KNG1 in a subject. The methods include
administering to the subject a therapeutically effective amount of
a double stranded RNAi agent of the invention targeting KNG1,
thereby inhibiting the expression of KNG1 in the subject.
[0070] In one aspect, the present invention provides methods of
treating a subject having a thrombophilia. The methods include
administering to the subject a therapeutically effective amount of
a double stranded RNAi agent of the invention targeting F12, or a
pharmaceutical composition comprising a double stranded RNAi agent
of the invention targeting F12, thereby treating the subject.
[0071] In another aspect, the present invention provides methods of
preventing at least one symptom in a subject having a
thrombophilia. The methods include administering to the subject a
prophylactically effective amount of of a double stranded RNAi
agent of the invention targeting F12, or a pharmaceutical
composition comprising a double stranded RNAi agent of the
invention targeting F12, thereby preventing at least one symptom in
the subject.
[0072] In one embodiment, the methods further comprise
administering to the subject a double stranded RNAi agent of the
invention targeting KLKB1. In another embodiment,the methods
further comprise administering to the subject a double stranded
RNAi agent of the invention targeting KNG1.
[0073] In one aspect, the present invention provides methods of
treating a subject having hereditary angioedema (HAE). The methods
include administering to the subject a therapeutically effective
amount of of a double stranded RNAi agent of the invention
targeting F12, or a pharmaceutical composition comprising a double
stranded RNAi agent of the invention targeting F12, thereby
treating the subject.
[0074] In another aspect, the present invention provides methods of
preventing at least one symptom in a subject having hereditary
angioedema (HAE). The methods include administering to the subject
a prophylactically effective amount of a double stranded RNAi agent
of the invention targeting F12, or a pharmaceutical composition
comprising a double stranded RNAi agent of the invention targeting
F12, thereby preventing at least one symptom in the subject.
[0075] In one embodiment, the methods further comprise
administering to the subject a double stranded RNAi agent of the
invention targeting KLKB1. In another embodiment,the methods
further comprise administering to the subject a double stranded
RNAi agent of the invention targeting KNG1.
[0076] In another aspect, the present invention provides methods of
preventing the formation of a thrombus in a subject at risk of
forming a thrombus. The methods include administering to the
subject a prophylactically effective amount of of a double stranded
RNAi agent of the invention targeting F12, or a pharmaceutical
composition comprising a double stranded RNAi agent of the
invention targeting F12, thereby inhibiting formation of a thrombus
in the subject at risk of forming a thrombus.
[0077] In one embodiment, the subject at risk of forming a thrombus
has a contact activation pathway-associated disease or
disorder.
[0078] In one embodiment, the contact activation pathway-associated
disease is thrombophilia. In another embodiment, the contact
activation pathway-associated disease is hereditary angioedema
(HAE).
[0079] In other embodiments, the contact activation
pathway-associated disease is Fletcher Factor Deficiency or
essential hypertension.
[0080] In one embodiment, the subject at risk of forming a thrombus
is selected from the group consisting of a surgical patient; a
medical patient; a pregnant subject; a postpartum subject; a
subject that has previously had a thrombus; a subject undergoing
hormone replacement therapy; a subject sitting for long periods;
and an obese subject.
[0081] In one embodiment, the methods further comprise
administering to the subject a double stranded RNAi agent of the
invention targeting KLKB1. In another embodiment,the methods
further comprise administering to the subject a double stranded
RNAi agent of the invention targeting KNG1.
[0082] In another aspect, the present invention provides methods of
preventing an angioedema attack in a subject having heriditary
angioedema (HAE). The methods include administering to the subject
a prophylactically effective amount of a double stranded RNAi agent
of the invention targeting F12, or a pharmaceutical composition
comprising a double stranded RNAi agent of the invention targeting
F12, thereby preventing an angioedema attack.
[0083] In one embodiment, the methods further comprise
administering to the subject a double stranded RNAi agent of the
invention targeting KLKB1. In another embodiment,the methods
further comprise administering to the subject a double stranded
RNAi agent of the invention targeting KNG1.
BRIEF DESCRIPTION OF THE DRAWINGS
[0084] FIG. 1 is a graph depicting KLKB1 mRNA suppression following
a single subcutaneous 1 mg/kg or 3 mg/kg dose of the indicated
agents at 7-10 days post-dose in wild-type mice.
[0085] FIG. 2 is a graph depicting F12 mRNA suppression following a
single subcutaneous 1 mg/kg dose or a single 3 mg/kg dose, or a
single 1 mg/kg dose or a single 10 mg/kg dose of the of the
indicated agents at 7-10 days post-dose wild-type mice.
[0086] FIG. 3 is a graph depicting KNG1 mRNA suppression following
a single subcutaneous 1 mg/kg or 3 mg/kg dose of the indicated
agents at 7-10 days post-dose in wild-type mice.
[0087] FIG. 4A is a graph depicting the amount of Evans blue dye in
the blood of mice administered a single 0 mg/kg, 0.3 mg/kg, 1
mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-66948 and captopril at day 7
post-dose.
[0088] FIG. 4B is a graph depicting the amount of Evans blue dye in
the intestines of mice administered a single 0 mg/kg, 0.3 mg/kg, 1
mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-66948 and captopril at day 7
post-dose.
[0089] FIG. 4C is a graph depicting KLKB1 mRNA suppression in the
liver of mice administered a single 0 mg/kg, 0.3 mg/kg, 1 mg/kg, 3
mg/kg, or 10 mg/kg dose of AD-66948 and captopril at day 7
post-dose.
[0090] FIG. 4D is a graph depicting the relative permeability of
the intestine in mice administered a single 0 mg/kg, 0.3 mg/kg, 1
mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-66948 and captopril at day 7
post-dose.
[0091] FIG. 5A is a graph depicting the amount of Evans blue dye in
the blood of mice administered a single 0 mg/kg, 0.1 mg/kg, 0.3
mg/kg, 1 mg/kg, or 3 mg/kg dose of AD-67244 and captopril at day 7
post-dose.
[0092] FIG. 5B is a graph depicting the amount of Evans blue dye in
the intestines of mice administered a single 0 mg/kg, 0.1 mg/kg,
0.3 mg/kg, 1 mg/kg, or 3 mg/kg dose of AD-67244 and captopril at
day 7 post-dose.
[0093] FIG. 5C is a graph depicting F12 mRNA suppression in the
liver of mice administered a single 0 mg/kg, 0.1 mg/kg , 0.3 mg/kg,
1 mg/kg, or 3 mg/kg dose of AD-67244 and captopril at day 7
post-dose.
[0094] FIG. 5D is a graph depicting the relative permeability of
the intestine in mice administered a single 0 mg/kg, 0.1 mg/kg, 0.3
mg/kg, 1 mg/kg, or 3 mg/kg dose of AD-67244 and captopril at day 7
post-dose.
[0095] FIG. 6A is a graph depicting the amount of Evans blue dye in
the blood of mice administered a single 0 mg/kg, 0.3 mg/kg, 1
mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-67344 and captopril at day 7
post-dose.
[0096] FIG. 6B is a graph depicting the amount of Evans blue dye in
the intestines of mice administered a single 0 mg/kg, 0.3 mg/kg, 1
mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-67344 and captopril at day 7
post-dose.
[0097] FIG. 6C is a graph depicting KNG1 mRNA suppression in the
liver of mice administered a single 0 mg/kg, 0.3 mg/kg, 1 mg/kg, 3
mg/kg, or 10 mg/kg dose of AD-67344 and captopril at day 7
post-dose.
[0098] FIG. 6D is a graph depicting the relative permeability of
the intestine in mice administered a single 0 mg/kg, 0.3 mg/kg, 1
mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-67344 and captopril at day 7
post-dose.
[0099] FIG. 7 depicts the modified nucleotide sequences of the
indicated double stranded RNAi agents targeting a KLKB1 gene. F is
a 2'-fluoro nucleotide modification; OMe is a 2'-O-methyl (2'-OMe)
nucleotide modification; and s is a phosphorothioate linkage Figure
discloses SEQ ID NOS 2285-2302, respectively, in order of
appearance.
[0100] FIG. 8 depicts the modified nucleotide sequences of the
indicated double stranded
[0101] RNAi agents targeting an F12 gene. F is a 2'-fluoro
nucleotide modification; OMe is a 2'-O-methyl (2'-OMe) nucleotide
modification; and s is a phosphorothioate linkage. Figure discloses
SEQ ID NOS 2303-2320, respectively, in order of appearance.
[0102] FIG. 9 depicts the modified nucleotide sequences of the
indicated double stranded RNAi agents targeting a KNG1 gene. F is a
2'-fluoro nucleotide modification; OMe is a 2'-O-methyl (2'-OMe)
nucleotide modification; and s is a phosphorothioate linkage.
Figure discloses SEQ ID NOS 2321-2332, respectively, in order of
appearance.
[0103] FIG. 10A is a graph depicting the amount of Evans blue dye
in the ears of mice administered a single 0.1 mg/kg, 0.5 mg/kg , or
3 mg/kg dose of AD-67244 in combination with a single 10 mg/kg dose
of a dsRNA agent targeting C1-INH at day 7 post-dose. Error
bars=standard deviation.
[0104] FIG. 10B is a graph depicting dose-dependent F12 mRNA
suppression following a single subcutaneous 0.1 mg/kg, 0.5 mg/kg ,
or 3 mg/kg dose of AD-67244 in combination with a single 10 mg/kg
dose of a dsRNA agent targeting C1-INH at day 7 post-dose.
[0105] FIG. 11 is a graph depicting F12 protein suppression in the
plasma of female Cynomolgus monkeys subcutaeoulsy administered a
single 3 mg/kg, 1 mg/kg, 0.3 mg/kg, or 0.1 mg/kg dose of AD-67244.
The plasma F12 levels shown are the relative F12 protein levels
which were normalized to the average pre-dose baseline F12 protein
level. Error bars=standard deviation.
[0106] FIG. 12 is a graph depicting F12 protein suppression in the
plasma of wild-type mice administered a single 0.5 mg/kg dose of
either AD-67244 or AD-74841.
[0107] FIG. 13 is a graph depicting the effect of 5'-end
modifications on the in vivo efficacy of the indicated agents.
DETAILED DESCRIPTION OF THE INVENTION
[0108] The present invention provides iRNA compositions which
effect the RNA-induced silencing complex (RISC)-mediated cleavage
of RNA transcripts of a contact activation pathway gene (i.e.,
Kallikrein B, Plasma (Fletcher Factor) 1 (KLKB1) gene, a "Factor
XII (Hageman Factor) (F12) gene, or a Kininogen 1 (KNG1) gene). The
gene may be within a cell, e.g., a cell within a subject, such as a
human. The use of these iRNAs enables the targeted degradation of
mRNAs of the corresponding gene (the KLKB1 gene, the F12 gene, or
the KNG1 gene) in mammals.
[0109] The RNAi agents of the invention have been designed to
target protein-coding and 3' UTR regions in the human KLKB1 gene,
including portions of the gene that are conserved in the KLKB1
othologs of other mammalian species. Without intending to be
limited by theory, it is believed that a combination or
sub-combination of the foregoing properties and the specific target
sites and/or the specific modifications in these RNAi agents confer
to the RNAi agents of the invention improved efficacy, stability,
potency, durability, and safety.
[0110] The iRNAs of the invention may include an RNA strand (the
antisense strand) having a region which is about 30 nucleotides or
less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25,
15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30,
18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21,
18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23,
19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region
is substantially complementary to at least part of an mRNA
transcript of a contact activation pathway gene, i.e., the KLKB1
gene, the F12 gene, or the KNG1 gene.
[0111] In certain embodiments, the iRNAs of the invention include
an RNA strand (the antisense strand) which can include longer
lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36,
25-36, 31-60, 22-43, 27-53 nucleotides in length with a region of
at least 19 contiguous nucleotides that is substantially
complementary to at least a part of an mRNA transcript of a contact
activation pathway gene, i.e., the KLKB1 gene, the F12 gene, or the
KNG1 gene. These iRNAs with the longer length antisense strands
preferably include a second RNA strand (the sense strand) of 20-60
nucleotides in length wherein the sense and antisense strands form
a duplex of 18-30 contiguous nucleotides.
[0112] Using in vitro and in vivo assays, the present inventors
have demonstrated that iRNAs targeting a contact activation pathway
gene can potently mediate RNAi, resulting in significant inhibition
of expression the contact activation pathway gene, i.e., the KLKB1
gene, the F12 gene, or the KNG1 gene. The present inventors have
also demonstrated that the RNAi agents of the invention are
exceptionally stable in the cytoplasm and lysosme. Thus, methods
and compositions including these iRNAs are useful for treating a
subject having a contact activation pathway-associated disease or
disorder, e.g., a thrombophilia, HAE, and for preventing at least
one symptom in a subject having a contact activation
pathway-associated disease or disorder or a subject at risk of
developing a contact activation pathway-associated disease or
disorder.
[0113] Accordingly, the present invention also provides methods for
treating a subject having a disorder that would benefit from
inhibiting or reducing the expression of a contact activation
pathway gene, e.g., a contact activation pathway-associated
disease, such as a thrombophilia or hereditary angioedema (HAE),
using iRNA compositions which effect the RNA-induced silencing
complex (RISC)-mediated cleavage of RNA transcripts of a contact
activation pathway gene.
[0114] Very low dosages of the iRNAs of the invention, in
particular, can specifically and efficiently mediate RNA
interference (RNAi), resulting in significant inhibition of
expression of the corresponding gene (contact activation pathway
gene).
[0115] The following detailed description discloses how to make and
use compositions containing iRNAs to inhibit the expression of a
contact activation pathway gene (i.e., a KLKB1 gene, an F12 gene,
or a KNG1 gene) as well as compositions, uses, and methods for
treating subjects having diseases and disorders that would benefit
from inhibition and/or reduction of the expression of a contact
activation pathway gene (i.e., a KLKB1 gene, an F12 gene, or a KNG1
gene).
I. Definitions
[0116] In order that the present invention may be more readily
understood, certain terms are first defined. In addition, it should
be noted that whenever a value or range of values of a parameter
are recited, it is intended that values and ranges intermediate to
the recited values are also intended to be part of this
invention.
[0117] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element, e.g., a plurality of elements.
[0118] The term "including" is used herein to mean, and is used
interchangeably with, the phrase "including but not limited
to".
[0119] The term "or" is used herein to mean, and is used
interchangeably with, the term "and/or," unless context clearly
indicates otherwise.
[0120] The term "at least" prior to a number or series of numbers
is understood to include the number adjacent to the term "at
least", and all subsequent numbers or integers that could logically
be included, as clear from context. For example, the number of
nucleotides in a nucleic acid molecule must be an integer. For
example, "at least 18 nucleotides of a 21 nucleotide nucleic acid
molecule" means that 18, 19, 20, or 21 nucleotides have the
indicated property. When at least is present before a series of
numbers or a range, it is understood that "at least" can modify
each of the numbers in the series or range.
[0121] As used herein, ranges include both the upper and lower
limit.
[0122] As used herein, "Kallikrein B, Plasma (Fletcher Factor) 1,"
used interchangeably with the terms "Prekallikrein" and "KLKB1,"
refers to the naturally occurring gene that encodes the zymogen
form of kallikrein, prekallikrein. Plasma prekallikrein is
converted to plasma kallikrein (also referred to as active
kallikrein) by F12a and proteolytically releases bradykinin from
high-molecular weight kininogen and activates F12. Bradykinin is a
peptide that enhances vascular permeability and is present in
elevated levels in HAE patients. The amino acid and complete coding
sequences of the reference sequence of the KLKB1 gene may be found
in, for example, GenBank Accession No. GI:78191797 (RefSeq
Accession No. NM_000892.3; SEQ ID NO:1; SEQ ID NO:2). Mammalian
orthologs of the human KLKB1 gene may be found in, for example,
GenBank Accession Nos. GI:544436072 (RefSeq Accession No.
XM_005556482, cynomolgus monkey; SEQ ID NO:7 and SEQ ID NO:8);
GI:380802470 (RefSeq Accession No. JU329355, rhesus monkey);
GI:236465804 (RefSeq Accession No. NM_008455, mouse; SEQ ID NO:3
and SEQ ID NO:4); GI:162138904 (RefSeq Accession No. NM_012725,
rat; SEQ ID NO:5 and SEQ ID NO:6).
[0123] Additional examples of KLKB1 mRNA sequences are readily
available using publicly available databases, e.g., GenBank,
UniProt, and OMIM.
[0124] As used herein, "Factor XII (Hageman Factor)," used
interchangeably with the terms "coagulation factor XII," "FXII,"
"F12," active F12," and "F12a," refers to the naturally occurring
gene that encodes the zymogen form of F12a. F12 a is an enzyme (EC
3.4.21.38) of the serine protease (or serine endopeptidase) class
that cleaves prekallikrein to form kallikrein, which subsequently
releases bradykinin from high-molecular weight kininogen and
activates F12. The amino acid and complete coding sequences of the
reference sequence of the F12 gene may be found in, for example,
GenBank Accession No. GI:145275212 (RefSeq Accession No. NM_000505;
SEQ ID NO:9; SEQ ID NO:10). Mammalian orthologs of the human F12
gene may be found in, for example, GenBank Accession Nos.
GI:544441267 (RefSeq Accession No. M_005558647, cynomolgus monkey;
SEQ ID NO:11 and SEQ ID NO:12); GI:805299477 (RefSeq Accession No.
NM_021489, mouse; SEQ ID NO:13 and SEQ ID NO:14); GI:62078740
(RefSeq Accession No. NM_001014006, rat; SEQ ID NO:15 and SEQ ID
NO:16).
[0125] Additional examples of F12 mRNA sequences are readily
available using publicly available databases, e.g., GenBank,
UniProt, and OMIM.
[0126] As used herein, "Kininogen 1," used interchangeably with the
terms "Fitzgerald Factor," "Williams-Fitzgerald-Flaujeac Factor,"
"high-molecular weight kininogen" ("HMWK" or "HK"), "low-molecular
weight kininogen" ("LMWK)", and"KNG1," refers to the naturally
occurring gene that is alternatively spliced to generate HMWK and
LMWK. Cleavage of HMWK by active kallikrein releases bradykinin.
The amino acid and complete coding sequences of the reference
sequence of the KNG1 gene may be found in, for example, GenBank
Accession No. GI:262050545 (RefSeq Accession No. NM_001166451; SEQ
ID NO:17; SEQ ID NO:18). Mammalian orthologs of the human KNG1 gene
may be found in, for example, GenBank Accession Nos. GI:544410550
(RefSeq Accession No. XM_005545463, cynomolgus monkey; SEQ ID NO:19
and SEQ ID NO:20); GI:156231028 (RefSeq Accession No. NM_001102409,
mouse; SEQ ID NO:21 and SEQ ID NO:22); GI:80861400 (RefSeq
Accession No. NM_012696, rat; SEQ ID NO:23 and SEQ ID NO:23).
[0127] Additional examples of KNG1 mRNA sequences are readily
available using publicly available databases, e.g., GenBank,
UniProt, and OMIM.
[0128] For simplicity, as used herein, unless otherwise specified,
a "contact activation pathway gene" refers to a KLKB1 gene, an F12
gene, or a KNG1 gene.
[0129] As used herein, "target sequence" refers to a contiguous
portion of the nucleotide sequence of an mRNA molecule formed
during the transcription of a contact activation pathway gene,
including mRNA that is a product of RNA processing of a primary
transcription product. In one embodiment, the target portion of the
sequence will be at least long enough to serve as a substrate for
iRNA-directed cleavage at or near that portion of the nucleotide
sequence of an mRNA molecule formed during the transcription of a
contact activation pathway gene. In one embodiment, the target
sequence is within the protein coding region of the contact
activation pathway gene. In another embodiment, the target sequence
is within the 3' UTR of the contact activation pathway gene.
[0130] The target sequence may be from about 9-36 nucleotides in
length, e.g., about 15-30 nucleotides in length. For example, the
target sequence can be from about 15-30 nucleotides, 15-9, 15-28,
15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19,
15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24,
18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26,
19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28,
20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29,
21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in
length. In some embodiments, the target sequence is about 19 to
about 30 nucleotides in length. In other embodiments, the target
sequence is about 19 to about 25 nucleotides in length. In still
other embodiments, the target sequence is about 19 to about 23
nucleotides in length. In some embodiments, the target sequence is
about 21 to about 23 nucleotides in length. Ranges and lengths
intermediate to the above recited ranges and lengths are also
contemplated to be part of the invention.
[0131] As used herein, the term "strand comprising a sequence"
refers to an oligonucleotide comprising a chain of nucleotides that
is described by the sequence referred to using the standard
nucleotide nomenclature.
[0132] "G," "C," "A," "T" and "U" each generally stand for a
nucleotide that contains guanine, cytosine, adenine, thymidine and
uracil as a base, respectively. However, it will be understood that
the term "ribonucleotide" or "nucleotide" can also refer to a
modified nucleotide, as further detailed below, or a surrogate
replacement moiety (see, e.g., Table 2). The skilled person is well
aware that guanine, cytosine, adenine, and uracil can be replaced
by other moieties without substantially altering the base pairing
properties of an oligonucleotide comprising a nucleotide bearing
such replacement moiety. For example, without limitation, a
nucleotide comprising inosine as its base can base pair with
nucleotides containing adenine, cytosine, or uracil. Hence,
nucleotides containing uracil, guanine, or adenine can be replaced
in the nucleotide sequences of dsRNA featured in the invention by a
nucleotide containing, for example, inosine. In another example,
adenine and cytosine anywhere in the oligonucleotide can be
replaced with guanine and uracil, respectively to form G-U Wobble
base pairing with the target mRNA. Sequences containing such
replacement moieties are suitable for the compositions and methods
featured in the invention.
[0133] The terms "iRNA", "RNAi agent," "iRNA agent,", "RNA
interference agent" as used interchangeably herein, refer to an
agent that contains RNA as that term is defined herein, and which
mediates the targeted cleavage of an RNA transcript via an
RNA-induced silencing complex (RISC) pathway. iRNA directs the
sequence-specific degradation of mRNA through a process known as
RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the
expression of a KLKB1 gene in a cell, e.g., a cell within a
subject, such as a mammalian subject.
[0134] In one embodiment, an RNAi agent of the invention includes a
single stranded RNA that interacts with a target RNA sequence,
e.g., a contact activation pathway gene, i.e., a KLKB1 target mRNA
sequence, an F12 target mRNA sequence, or a KNG1 target mRNA
sequence, to direct the cleavage of the target RNA. Without wishing
to be bound by theory it is believed that long double stranded RNA
introduced into cells is broken down into siRNA by a Type III
endonuclease known as Dicer (Sharp et al. (2001) Genes Dev.
15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA
into 19-23 base pair short interfering RNAs with characteristic two
base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The
siRNAs are then incorporated into an RNA-induced silencing complex
(RISC) where one or more helicases unwind the siRNA duplex,
enabling the complementary antisense strand to guide target
recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to
the appropriate target mRNA, one or more endonucleases within the
RISC cleave the target to induce silencing (Elbashir, et al.,
(2001) Genes Dev. 15:188). Thus, in one aspect the invention
relates to a single stranded RNA (siRNA) generated within a cell
and which promotes the formation of a RISC complex to effect
silencing of the target gene, i.e., a contact activation pathway
gene. Accordingly, the term "siRNA" is also used herein to refer to
an RNAi as described above.
[0135] In another embodiment, the RNAi agent may be a
single-stranded siRNA that is introduced into a cell or organism to
inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC
endonuclease, Argonaute 2, which then cleaves the target mRNA. The
single-stranded siRNAs are generally 15-30 nucleotides and are
chemically modified. The design and testing of single-stranded
siRNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al.,
(2012) Cell 150:883-894, the entire contents of each of which are
hereby incorporated herein by reference. Any of the antisense
nucleotide sequences described herein may be used as a
single-stranded siRNA as described herein or as chemically modified
by the methods described in Lima et al., (2012) Cell
150:883-894.
[0136] In another embodiment, an "iRNA" for use in the
compositions, uses, and methods of the invention is a double
stranded RNA and is referred to herein as a "double stranded RNAi
agent," "double stranded RNA (dsRNA) molecule," "dsRNA agent," or
"dsRNA". The term "dsRNA", refers to a complex of ribonucleic acid
molecules, having a duplex structure comprising two anti-parallel
and substantially complementary nucleic acid strands, referred to
as having "sense" and "antisense" orientations with respect to a
target RNA, i.e., a contact activation pathway gene, i.e., a KLKB1
gene, an F12 gene, or a KNG1 gene. In some embodiments of the
invention, a double stranded RNA (dsRNA) triggers the degradation
of a target RNA, e.g., an mRNA, through a post-transcriptional
gene-silencing mechanism referred to herein as RNA interference or
RNAi.
[0137] In general, the majority of nucleotides of each strand of a
dsRNA molecule are ribonucleotides, but as described in detail
herein, each or both strands can also include one or more
non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified
nucleotide. In addition, as used in this specification, an "RNAi
agent" may include ribonucleotides with chemical modifications; an
RNAi agent may include substantial modifications at multiple
nucleotides. As used herein, the term "modified nucleotide" refers
to a nucleotide having, independently, a modified sugar moiety, a
modified internucleotide linkage, and/or modified nucleobase. Thus,
the term modified nucleotide encompasses substitutions, additions
or removal of, e.g., a functional group or atom, to internucleoside
linkages, sugar moieties, or nucleobases. The modifications
suitable for use in the agents of the invention include all types
of modifications disclosed herein or known in the art. Any such
modifications, as used in a siRNA type molecule, are encompassed by
"RNAi agent" for the purposes of this specification and claims.
[0138] The duplex region may be of any length that permits specific
degradation of a desired target RNA through a RISC pathway, and may
range from about 9 to 36 base pairs in length, e.g., about 15-30
base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29,
15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20,
15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25,
18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27,
19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29,
20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30,
21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base
pairs in length. Ranges and lengths intermediate to the above
recited ranges and lengths are also contemplated to be part of the
invention.
[0139] The two strands forming the duplex structure may be
different portions of one larger RNA molecule, or they may be
separate RNA molecules. Where the two strands are part of one
larger molecule, and therefore are connected by an uninterrupted
chain of nucleotides between the 3'-end of one strand and the
5'-end of the respective other strand forming the duplex structure,
the connecting RNA chain is referred to as a "hairpin loop." A
hairpin loop can comprise at least one unpaired nucleotide. In some
embodiments, the hairpin loop can comprise at least 2, at least 3,
at least 4, at least 5, at least 6, at least 7, at least 8, at
least 9, at least 10, at least 20, at least 23 or more unpaired
nucleotides.
[0140] Where the two substantially complementary strands of a dsRNA
are comprised by separate RNA molecules, those molecules need not,
but can be covalently connected. Where the two strands are
connected covalently by means other than an uninterrupted chain of
nucleotides between the 3'-end of one strand and the 5'-end of the
respective other strand forming the duplex structure, the
connecting structure is referred to as a "linker." The RNA strands
may have the same or a different number of nucleotides. The maximum
number of base pairs is the number of nucleotides in the shortest
strand of the dsRNA minus any overhangs that are present in the
duplex. In addition to the duplex structure, an RNAi may comprise
one or more nucleotide overhangs.
[0141] In one embodiment, an RNAi agent of the invention is a dsRNA
of 24-30 nucleotides that interacts with a target RNA sequence,
e.g., a contact activation pathway gene, i.e., a KLKB1 target mRNA
sequence, an F12 target mRNA sequence, or a KNG1 target mRNA
sequence, to direct the cleavage of the target RNA. Without wishing
to be bound by theory, long double stranded RNA introduced into
cells is broken down into siRNA by a Type III endonuclease known as
Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a
ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base
pair short interfering RNAs with characteristic two base 3'
overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs
are then incorporated into an RNA-induced silencing complex (RISC)
where one or more helicases unwind the siRNA duplex, enabling the
complementary antisense strand to guide target recognition
(Nykanen, et al., (2001) Cell 107:309). Upon binding to the
appropriate target mRNA, one or more endonucleases within the RISC
cleave the target to induce silencing (Elbashir, et al., (2001)
Genes Dev. 15:188).
[0142] As used herein, the term "nucleotide overhang" refers to at
least one unpaired nucleotide that protrudes from the duplex
structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of
one strand of a dsRNA extends beyond the 5'-end of the other
strand, or vice versa, there is a nucleotide overhang. A dsRNA can
comprise an overhang of at least one nucleotide; alternatively the
overhang can comprise at least two nucleotides, at least three
nucleotides, at least four nucleotides, at least five nucleotides
or more. A nucleotide overhang can comprise or consist of a
nucleotide/nucleoside analog, including a
deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand
of a dsRNA.
[0143] In one embodiment, the antisense strand of a dsRNA has a
1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
nucleotide, overhang at the 3'-end and/or the 5'-end. In one
embodiment, the sense strand of a dsRNA has a 1-10 nucleotide,
e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at
the 3'-end and/or the 5'-end. In another embodiment, one or more of
the nucleotides in the overhang is replaced with a nucleoside
thiophosphate.
[0144] In certain embodiments, the overhang on the sense strand or
the antisense strand, or both, can include extended lengths longer
than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides,
10-30 nucleotides, or 10-15 nucleotides in length. In certain
embodiments, an extended overhang is on the sense strand of the
duplex. In certain embodiments, an extended overhang is present on
the 3'end of the sense strand of the duplex. In certain
embodiments, an extended overhang is present on the 5'end of the
sense strand of the duplex. In certain embodiments, an extended
overhang is on the antisense strand of the duplex. In certain
embodiments, an extended overhang is present on the 3'end of the
antisense strand of the duplex. In certain embodiments, an extended
overhang is present on the 5'end of the antisense strand of the
duplex. In certain embodiments, one or more of the nucleotides in
the overhang is replaced with a nucleoside thiophosphate. In
certain embodiments, the overhang includes a self-complementary
portion such that the overhang is capable of forming a hairpin
structure that is stable under physiological conditions.
[0145] "Blunt" or "blunt end" means that there are no unpaired
nucleotides at that end of the double stranded RNAi agent, i.e., no
nucleotide overhang. A "blunt ended" RNAi agent is a dsRNA that is
double stranded over its entire length, i.e., no nucleotide
overhang at either end of the molecule. The RNAi agents of the
invention include RNAi agents with nucleotide overhangs at one end
(i.e., agents with one overhang and one blunt end) or with
nucleotide overhangs at both ends.
[0146] The term "antisense strand" or "guide strand" refers to the
strand of an iRNA, e.g., a dsRNA, which includes a region that is
substantially complementary to a target sequence, e.g., a KLKB1
mRNA. As used herein, the term "region of complementarity" refers
to the region on the antisense strand that is substantially
complementary to a sequence, for example a target sequence, e.g., a
contact activation pathway gene nucleotide sequence, as defined
herein. Where the region of complementarity is not fully
complementary to the target sequence, the mismatches can be in the
internal or terminal regions of the molecule. Generally, the most
tolerated mismatches are in the terminal regions, e.g., within 5,
4, 3, 2, or 1 nucleotides of the 5'- and/or 3'-terminus of the
iRNA. In one embodiment, a double stranded RNAi agent of the
invention includea a nucleotide mismatch in the antisense strand.
In another embodiment, a double stranded RNAi agent of the
invention includea a nucleotide mismatch in the sense strand. In
one embodiment, the nucleotide mismatch is, for example, within 5,
4, 3, 2, or 1 nucleotides from the 3'-terminus of the iRNA. In
another embodiment, the nucleotide mismatch is, for example, in the
3'-terminal nucleotide of the iRNA.
[0147] The term "sense strand," or "passenger strand" as used
herein, refers to the strand of an iRNA that includes a region that
is substantially complementary to a region of the antisense strand
as that term is defined herein.
[0148] As used herein, the term "cleavage region" refers to a
region that is located immediately adjacent to the cleavage site.
The cleavage site is the site on the target at which cleavage
occurs. In some embodiments, the cleavage region comprises three
bases on either end of, and immediately adjacent to, the cleavage
site. In some embodiments, the cleavage region comprises two bases
on either end of, and immediately adjacent to, the cleavage site.
In some embodiments, the cleavage site specifically occurs at the
site bound by nucleotides 10 and 11 of the antisense strand, and
the cleavage region comprises nucleotides 11, 12 and 13.
[0149] As used herein, and unless otherwise indicated, the term
"complementary," when used to describe a first nucleotide sequence
in relation to a second nucleotide sequence, refers to the ability
of an oligonucleotide or polynucleotide comprising the first
nucleotide sequence to hybridize and form a duplex structure under
certain conditions with an oligonucleotide or polynucleotide
comprising the second nucleotide sequence, as will be understood by
the skilled person. Such conditions can, for example, be stringent
conditions, where stringent conditions can include: 400 mM NaCl, 40
mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. for
12-16 hours followed by washing (see, e.g., "Molecular Cloning: A
Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor
Laboratory Press). Other conditions, such as physiologically
relevant conditions as can be encountered inside an organism, can
apply. The skilled person will be able to determine the set of
conditions most appropriate for a test of complementarity of two
sequences in accordance with the ultimate application of the
hybridized nucleotides.
[0150] Complementary sequences within an iRNA, e.g., within a dsRNA
as described herein, include base-pairing of the oligonucleotide or
polynucleotide comprising a first nucleotide sequence to an
oligonucleotide or polynucleotide comprising a second nucleotide
sequence over the entire length of one or both nucleotide
sequences. Such sequences can be referred to as "fully
complementary" with respect to each other herein. However, where a
first sequence is referred to as "substantially complementary" with
respect to a second sequence herein, the two sequences can be fully
complementary, or they can form one or more, but generally not more
than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a
duplex up to 30 base pairs, while retaining the ability to
hybridize under the conditions most relevant to their ultimate
application, e.g., inhibition of gene expression via a RISC
pathway. However, where two oligonucleotides are designed to form,
upon hybridization, one or more single stranded overhangs, such
overhangs shall not be regarded as mismatches with regard to the
determination of complementarity. For example, a dsRNA comprising
one oligonucleotide 21 nucleotides in length and another
oligonucleotide 23 nucleotides in length, wherein the longer
oligonucleotide comprises a sequence of 21 nucleotides that is
fully complementary to the shorter oligonucleotide, can yet be
referred to as "fully complementary" for the purposes described
herein.
[0151] "Complementary" sequences, as used herein, can also include,
or be formed entirely from, non-Watson-Crick base pairs and/or base
pairs formed from non-natural and modified nucleotides, in so far
as the above requirements with respect to their ability to
hybridize are fulfilled. Such non-Watson-Crick base pairs include,
but are not limited to, G:U Wobble or Hoogstein base pairing.
[0152] The terms "complementary," "fully complementary" and
"substantially complementary" herein can be used with respect to
the base matching between the sense strand and the antisense strand
of a dsRNA, or between the antisense strand of an iRNA agent and a
target sequence, as will be understood from the context of their
use.
[0153] As used herein, a polynucleotide that is "substantially
complementary to at least part of"a messenger RNA (mRNA) refers to
a polynucleotide that is substantially complementary to a
contiguous portion of the mRNA of interest (e.g., an mRNA encoding
a contact activation pathway gene). For example, a polynucleotide
is complementary to at least a part of a KLKB1 mRNA if the sequence
is substantially complementary to a non-interrupted portion of an
mRNA encoding a KLKB1 gene.
[0154] Accordingly, in some embodiments, the sense strand
polynucleotides and the antisense polynucleotides disclosed herein
are fully complementary to the target contact activation pathway
gene sequence.
[0155] In one embodiment, the antisense polynucleotides disclosed
herein are fully complementary to the target KLKB1 sequence. In
other embodiments, the antisense polynucleotides disclosed herein
are substantially complementary to the target KLKB1 sequence and
comprise a contiguous nucleotide sequence which is at least about
80% complementary over its entire length to the equivalent region
of the nucleotide sequence of any one of SEQ ID Nos:1 and 2, or a
fragment of any one of SEQ ID Nos:1 and 2, such as about 85%, about
86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98%, or about 99% complementary.
[0156] In other embodiments, the antisense polynucleotides
disclosed herein are substantially complementary to the target
KLKB1 sequence and comprise a contiguous nucleotide sequence which
is at least about 80% complementary over its entire length to any
one of the sense strand nucleotide sequences in any one of Tables
3, 4, 19A, or 19B, or a fragment of any one of the antisense strand
nucleotide sequences in any one of Tables 3, 4, 19A, or 19B, such
as about 85%, about 86%, about 87%, about 88%, about 89%, about
90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about
96%, about 97%, about 98%, or about 99% complementary.
[0157] In one embodiment, an RNAi agent of the invention includes a
sense strand that is substantially complementary to an antisense
polynucleotide which, in turn, is complementary to a target KLKB1
sequence and comprises a contiguous nucleotide sequence which is at
least about 80% complementary over its entire length to any one of
the antisense strand nucleotide sequences in any one of Tables 3,
4, 19A, or 19B, or a fragment of any one of the antisense strand
nucleotide sequences in any one of Tables 3, 4, 19A, or 19B, such
as about 85%, about 86%, about 87%, about 88%, about 89%, about
90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about
96%, about 97%, about 98%, or about 99% complementary.
[0158] In one embodiment, the antisense polynucleotides disclosed
herein are fully complementary to the target F12 sequence. In other
embodiments, the antisense polynucleotides disclosed herein are
substantially complementary to the target F12 sequence and comprise
a contiguous nucleotide sequence which is at least about 80%
complementary over its entire length to the equivalent region of
the nucleotide sequence of SEQ ID Nos:9 or 10, or a fragment of SEQ
ID Nos:9 or 10, such as about 85%, about 86%, about 87%, about 88%,
about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98%, or about 99%
complementary.
[0159] In other embodiment, the antisense strand polynucleotides
are substantially complementary to the target F12 sequence and
comprise a contiguous nucleotide sequence which is at least about
80% complementary over its entire length to any one of the sense
strand nucleotide sequences in any one of Tables 9, 10, 19C, 19D,
20, 21, 23, 24, 26, and 27, or a fragment of any one of the
antisense strand nucleotide sequences in any one of Tables 9, 10,
19C, 19D, 20, 21, 23, 24, 26, and 27, such as about 85%, about 86%,
about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%,
about 93%, about 94%, about 95%, about 96%, about 97%, about 98%,
or about 99% complementary.
[0160] In one embodiment, an RNAi agent of the invention includes a
sense strand that is substantially complementary to an antisense
polynucleotide which, in turn, is complementary to a target F12
sequence and comprise a contiguous nucleotide sequence which is at
least about 80% complementary over its entire length to any one of
antisense strand nucleotide sequences in any one off ables 9, 10,
19C, 19D, 20, 21, 23, 24, 26, and 27, or a fragment of any one of
the antisense strand nucleotide sequences in any one of Tables 9,
10, 19C, 19D, 20, 21, 23, 24, 26, and 27, such as about 85%, about
86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98%, or about 99% complementary.
[0161] In one embodiment, the sense strand polynucleotides and the
antisense polynucleotides disclosed herein are fully complementary
to the target KNG1 sequence. In other embodiments, the sense strand
polynucleotides and/or the antisense polynucleotides disclosed
herein are substantially complementary to the target KNG1 sequence
and comprise a contiguous nucleotide sequence which is at least
about 80% complementary over its entire length to the equivalent
region of the nucleotide sequence of SEQ ID Nos:17 or 18, or a
fragment of SEQ ID Nos:17 or 18, such as about 85%, about 86%,
about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%,
about 93%, about 94%, about 95%, about 96%, about 97%, about 98%,
or about 99% complementary.
[0162] In other embodiment, the antisense strand polynucleotides
are substantially complementary to the target KNG sequence and
comprise a contiguous nucleotide sequence which is at least about
80% complementary over its entire length to any one of the sense
strand nucleotide sequences in any one of 15 or 16, such as about
85%, about 86%, about 87%, about 88%, about 89%, about 90%, about %
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98%, or about 99% complementary.
[0163] In one embodiment, an RNAi agent of the invention includes a
sense strand that is substantially complementary to an antisense
polynucleotide which, in turn, is complementary to a target KNG1
sequence and comprises a contiguous nucleotide sequence which is at
least about 80% complementary over its entire length to any one of
the antisense strand nucleotide sequences in Table 15 or 16, or a
fragment of any one of the antisense strand nucleotide sequences in
Table 15 or 16, such as about 85%, about 86%, about 87%, about 88%,
about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98%, or about 99%
complementary.
[0164] In general, the majority of nucleotides of each strand are
ribonucleotides, but as described in detail herein, each or both
strands can also include one or more non-ribonucleotides, e.g., a
deoxyribonucleotide and/or a modified nucleotide. In addition, an
"iRNA" may include ribonucleotides with chemical modifications.
Such modifications may include all types of modifications disclosed
herein or known in the art. Any such modifications, as used in an
iRNA molecule, are encompassed by "iRNA" for the purposes of this
specification and claims.
[0165] In one aspect of the invention, an agent for use in the
methods and compositions of the invention is a single-stranded
antisense RNA molecule that inhibits a target mRNA via an antisense
inhibition mechanism. The single-stranded antisense RNA molecule is
complementary to a sequence within the target mRNA. The
single-stranded antisense oligonucleotides can inhibit translation
in a stoichiometric manner by base pairing to the mRNA and
physically obstructing the translation machinery, see Dias, N. et
al., (2002) Mol Cancer Ther 1:347-355. The single-stranded
antisense RNA molecule may be about 15 to about 30 nucleotides in
length and have a sequence that is complementary to a target
sequence. For example, the single-stranded antisense RNA molecule
may comprise a sequence that is at least about 15, 16, 17, 18, 19,
20, or more contiguous nucleotides from any one of the antisense
sequences described herein.
[0166] As used herein, a "subject" is an animal, such as a mammal,
including a primate (such as a human, a non-human primate, e.g., a
monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a
camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a
guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or
a bird (e.g., a duck or a goose). In an embodiment, the subject is
a human, such as a human being treated or assessed for a disease,
disorder or condition that would benefit from reduction in contact
activation pathway gene expression (i.e., KLKB1 gene expression,
F12 gene expression, and/or KNG1 gene expression) and/or
replication; a human at risk for a disease, disorder or condition
that would benefit from reduction in contact activation pathway
gene expression; a human having a disease, disorder or condition
that would benefit from reduction in contact activation pathway
gene expression; and/or human being treated for a disease, disorder
or condition that would benefit from reduction in contact
activation pathway gene expression, as described herein.
[0167] As used herein, the terms "treating" or "treatment" refer to
a beneficial or desired result including, but not limited to,
alleviation or amelioration of one or more symptoms associated with
contact activation pathway gene expression (i.e., KLKB1 gene
expression, F12 gene expression, and/or KNG1 gene expression)
and/or contact activation pathway protein production (i.e., KLKB1
protein production, F12 protein production, and/or KNG1 protein
production), e.g., a thrombophilia, e.g., the formation of a
thrombus, the presence of elevated bradykinin, heredity angioedema
(HAE), such as hereditary angioedema type I; hereditary angioedema
type II; hereditary angioedema type III; or any other hereditary
angioedema caused by elevated levels of bradykinin, an angioedema
attack, edema swelling of the extremities, face, larynx, upper
respiratory tract, abdomen, trunk, and genetials, prodrome;
laryngeal swelling; nonpruritic rash; nausea; vomiting; abdominal
pain. "Treatment" can also mean prolonging survival as compared to
expected survival in the absence of treatment.
[0168] The term "lower" in the context of the level of contact
activation pathway gene expression and/or contact activation
pathway protein production in a subject or a disease marker or
symptom refers to a statistically significant decrease in such
level. The decrease can be, for example, at least 10%, at least
15%, at least 20%, at least 25%, at least 30%, at least 35%, at
least 40%, at least 45%, at least 50%, at least 55%, at least 60%,
at least 65%, at least 70%, at least 75%, at least 80%, at least
85%, at least 90%, at least 95%, or more and is preferably down to
a level accepted as within the range of normal for an individual
without such disorder.
[0169] As used herein, "prevention" or "preventing," when used in
reference to a disease, disorder or condition thereof, that would
benefit from a reduction in expression of a contact activation
pathway gene and/or production of a contact activation pathway
protein, refers to a reduction in the likelihood that a subject
will develop a symptom associated with such a disease, disorder, or
condition, or a reduction in the frequency and/or duration of a
symptom associated with such a disease, disorder, or condition,
e.g., a symptom of contact activation pathway gene expression, such
as the formation of a venous thrombus, an arterial thrombus, a
cardiac chamber thrombus, a thromboembolism, the presence of
elevated bradykinin, an angioedema attack, hereditary angioedema
type I; hereditary angioedema type II; hereditary angioedema type
III; any other hereditary angioedema caused by elevated levels of
bradykinin; edema swelling of the extremities, face, larynx, upper
respiratory tract, abdomen, trunk, and genetials, prodrome;
laryngeal swelling; nonpruritic rash; nausea; vomiting; abdominal
pain. The failure to develop a disease, disorder or condition, or
the reduction in the development of a symptom associated with such
a disease, disorder or condition (e.g., by at least about 10% on a
clinically accepted scale for that disease or disorder), or the
exhibition of delayed symptoms delayed (e.g., by days, weeks,
months or years) is considered effective prevention.
[0170] As used herein, the term "contact activation
pathway-associated disease," is a disease or disorder that is
caused by, or associated with contact activation pathway gene
expression (i.e., KLKB1 gene expression, F12 gene expression,
and/or KNG1 gene expression) or contact activation pathway protein
production (i.e., KLKB1 protein production, F12 protein production,
and/or KNG1 protein production). The term "contact activation
pathway-associated disease" includes a disease, disorder or
condition that would benefit from reduction in contact activation
pathway gene expression and/or contact activation pathway protein
activity. A contact activation pathway-associated disease may be a
genetic disorder or an acquired disorder.
[0171] Non-limiting examples of contact activation
pathway-associated diseases include, for example, thrombophilia,
heredity angioedema (HAE) (such as hereditary angioedema type I;
hereditary angioedema type II; hereditary angioedema type III; or
any other hereditary angioedema caused by elevated levels of
bradykinin), prekallikrein deficiency (inherited or acquired), also
known as Fletcher Factor Deficiency, malignant essential
hypertension, hypertension, end stage renal disease.
[0172] In one embodiment, the contact activation pathway-associated
disease is a thrombophilia. As used herein, the term
"thrombophilia," also referred to as "hypercoagulability" or "a
prothrombotic state", is any disease or disorder associated with an
abnormality of blood coagulation that increases the risk of
thrombosis and the development of a thrombus. As used herein, the
term "thrombosis" refers to the process of local coagulation or
clotting of the blood (formation of a "thrombus" or "clot") in a
part of the circulatory system. A thrombophilia may be inherited,
acquired, or the result on an environmental condition. Exemplary
inherited thrombophilias include inherited antithrombin deficiency,
inherited Protein C deficiency, inherited Protein S deficiency,
inherited Factor V Leiden thrombophilia, and Prothrombin (Factor
II) G20210A. An exemplary acquired thrombophilia includes
Antiphospholipid syndrome. Acquired/environmentally acquired
thrombophilias may be the result of, for example trauma, fracture,
surgery, e.g., orthopedic surgery, oncological surgery, oral
contraceptive use, hormone replacement therapy, pregnancy,
puerperium, hypercoaguability, previous thrombus, age,
immobilization (e.g., more than three days of bed rest), prolonged
travel, metabolic syndrome, and air pollution (see, e.g.,
Previtali, et al. (2011) Blood Transfus 9:120).
[0173] Accordingly, "subjects at risk of forming a thrombus"
include surgical patients (e.g., subjects having general surgery,
dental surgery, orthopedic surgery (e.g., knee or hip replacement
surgery), trauma surgery, oncological sugery); medical patients
(e.g., subjects having an immobilizing disease, e.g., subjects
having more than three days of bed rest and/or subjects having
long-term use of an intravenous catheter; subjects having atrial
fibrillation; elderly subjects; subjects having renal impairment;
subjects having a prosthetic heart valve; subjects having heart
failure; subjects having cancer); pregnant subjects; postpartum
subjects; subjects that have previously had a thrombus; subjects
undergoing hormone replacement therapy; subjects sitting for long
periods of time, such as in a plane or car; and obese subjects.
[0174] In one embodiment, the contact activation pathway-associated
disease is hereditary angioedema (HAE). As used herein, "hereditary
angioedema," used interchangeably with the term "HAE," refers to an
autosomal dominant disorder caused by mutation of the C1 inhibitor
(C1INH), SERPING1) gene or the coagulation factor XII (F12) gene
that causes recurrent edema swelling in patients. Typical symptoms
of HAE include severe swelling of the arms, legs, hands, feet,
face, tongue and larynx, abdomen, trunk, genitals, nausea,
vomiting, abdominal pain, and nonpriuric rash. Elevanted levels of
bradykinin peptide are observed during HAE attacks or episodes.
[0175] In another embodiment, the contact activation
pathway-associated disease is prekallikrein deficiency.
[0176] In another embodiment, the contact activation
pathway-associated disease is malignant essential hypertension.
[0177] In another embodiment, the contact activation
pathway-associated disease is hypertension.
[0178] In another embodiment, the contact activation
pathway-associated disease is end stage renal disease.
[0179] "Therapeutically effective amount," as used herein, is
intended to include the amount of an RNAi agent that, when
administered to a patient for treating a subject having HAE and/or
contact activation pathway-associated disease, is sufficient to
effect treatment of the disease (e.g., by diminishing, ameliorating
or maintaining the existing disease or one or more symptoms of
disease). The "therapeutically effective amount" may vary depending
on the RNAi agent, how the agent is administered, the disease and
its severity and the history, age, weight, family history, genetic
makeup, stage of pathological processes mediated by contact
activation pathway gene expression, the types of preceding or
concomitant treatments, if any, and other individual
characteristics of the patient to be treated.
[0180] "Prophylactically effective amount," as used herein, is
intended to include the amount of an RNAi agent that, when
administered to a subject who does not yet experience or display
symptoms of a contact activation pathway-associated disease, but
who may be predisposed or at risk, is sufficient to prevent or
ameliorate the disease or one or more symptoms of the disease.
Ameliorating the disease includes slowing the course of the disease
or reducing the severity of later-developing disease. The
"prophylactically effective amount" may vary depending on the RNAi
agent, how the agent is administered, the degree of risk of
disease, and the history, age, weight, family history, genetic
makeup, the types of preceding or concomitant treatments, if any,
and other individual characteristics of the patient to be
treated.
[0181] A "therapeutically-effective amount" or "prophylacticaly
effective amount" also includes an amount of an RNAi agent that
produces some desired local or systemic effect at a reasonable
benefit/risk ratio applicable to any treatment. RNAi agents
employed in the methods of the present invention may be
administered in a sufficient amount to produce a reasonable
benefit/risk ratio applicable to such treatment.
[0182] The term "sample," as used herein, includes a collection of
similar fluids, cells, or tissues isolated from a subject, as well
as fluids, cells, or tissues present within a subject. Examples of
biological fluids include blood, serum and serosal fluids, plasma,
cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the
like. Tissue samples may include samples from tissues, organs or
localized regions. For example, samples may be derived from
particular organs, parts of organs, or fluids or cells within those
organs. In certain embodiments, samples may be derived from the
liver (e.g., whole liver or certain segments of liver or certain
types of cells in the liver, such as, e.g., hepatocytes), the
retina or parts of the retina (e.g., retinal pigment epithelium),
the central nervous system or parts of the central nervous system
(e.g., ventricles or choroid plexus), or the pancreas or certain
cells or parts of the pancreas. In some embodiments, a "sample
derived from a subject" refers to cerebrospinal fluid obtained from
the subject. In preferred embodiments, a "sample derived from a
subject" refers to blood or plasma drawn from the subject. In
further embodiments, a "sample derived from a subject" refers to
liver tissue (or subcomponents thereof) or retinal tissue (or
subcomponents thereof) derived from the subject.
II. iRNAs of the Invention
[0183] The present invention provides iRNAs which inhibit the
expression of a contact activation pathway gene (i.e., a KLKB1
gene, an F12 gene, or a KNG1 gene). In one embodiment, the iRNA
agent includes double stranded ribonucleic acid (dsRNA) molecules
for inhibiting the expression of a contact activation pathway gene
in a cell, such as a cell within a subject, e.g., a mammal, such as
a human having a contact activation pathway-associated disease,
e.g., a thrombophilia or hereditary angioedema, or at risk of
developing a contact activation pathway-associated disease, e.g., a
thrombophilia, or an angioedema attack. The dsRNA includes an
antisense strand having a region of complementarity which is
complementary to at least a part of an mRNA formed in the
expression of a contact activation pathway gene. The region of
complementarity is about 30 nucleotides or less in length (e.g.,
about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18
nucleotides or less in length). Upon contact with a cell expressing
the contact activation pathway gene, the iRNA inhibits the
expression of the contact activation pathway gene (e.g., a human, a
primate, a non-primate, or a bird contact activation pathway gene)
by at least about 10% as assayed by, for example, a PCR or branched
DNA (bDNA)-based method, or by a protein-based method, such as by
immunofluorescence analysis, using, for example, Western Blotting
or flowcytometric techniques.
[0184] A dsRNA includes two RNA strands that are complementary and
hybridize to form a duplex structure under conditions in which the
dsRNA will be used. One strand of a dsRNA (the antisense strand)
includes a region of complementarity that is substantially
complementary, and generally fully complementary, to a target
sequence. The target sequence can be derived from the sequence of
an mRNA formed during the expression of a contact activation
pathway gene (i.e., a KLKB1 gene, an F12 gene, or a KNG1 gene). The
other strand (the sense strand) includes a region that is
complementary to the antisense strand, such that the two strands
hybridize and form a duplex structure when combined under suitable
conditions. As described elsewhere herein and as known in the art,
the complementary sequences of a dsRNA can also be contained as
self-complementary regions of a single nucleic acid molecule, as
opposed to being on separate oligonucleotides.
[0185] Generally, the duplex structure is between 15 and 30 base
pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25,
15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30,
18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21,
18-20, 19-30, 19-29, 19-28, 9-27, 19-26, 19-25, 19-24, 19-23,
19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and
lengths intermediate to the above recited ranges and lengths are
also contemplated to be part of the invention.
[0186] Similarly, the region of complementarity to the target
sequence is between 15 and 30 nucleotides in length, e.g., between
15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21,
15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26,
18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28,
19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30,
20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21,
21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22
nucleotides in length. Ranges and lengths intermediate to the above
recited ranges and lengths are also contemplated to be part of the
invention.
[0187] In some embodiments, the dsRNA is about 15 to about 20
nucleotides in length, or about 25 to about 30 nucleotides in
length. In general, the dsRNA is long enough to serve as a
substrate for the Dicer enzyme. For example, it is well-known in
the art that dsRNAs longer than about 21-23 nucleotides in length
may serve as substrates for Dicer. As the ordinarily skilled person
will also recognize, the region of an RNA targeted for cleavage
will most often be part of a larger RNA molecule, often an mRNA
molecule. Where relevant, a "part" of an mRNA target is a
contiguous sequence of an mRNA target of sufficient length to allow
it to be a substrate for RNAi-directed cleavage (i.e., cleavage
through a RISC pathway).
[0188] One of skill in the art will also recognize that the duplex
region is a primary functional portion of a dsRNA, e.g., a duplex
region of about 9 to 36 base pairs, e.g., about 10-36, 11-36,
12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35,
14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33,
10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32,
12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32,
14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24,
15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29,
18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20,
19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22,
19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment,
to the extent that it becomes processed to a functional duplex, of
e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an
RNA molecule or complex of RNA molecules having a duplex region
greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled
artisan will recognize that in one embodiment, a miRNA is a dsRNA.
In another embodiment, a dsRNA is not a naturally occurring miRNA.
In another embodiment, an iRNA agent useful to target contact
activation pathway gene expression is not generated in the target
cell by cleavage of a larger dsRNA.
[0189] A dsRNA as described herein can further include one or more
single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4
nucleotides. dsRNAs having at least one nucleotide overhang can
have unexpectedly superior inhibitory properties relative to their
blunt-ended counterparts. A nucleotide overhang can comprise or
consist of a nucleotide/nucleoside analog, including a
deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand
of a dsRNA.
[0190] A dsRNA can be synthesized by standard methods known in the
art as further discussed below, e.g., by use of an automated DNA
synthesizer, such as are commercially available from, for example,
Biosearch, Applied Biosystems, Inc.
[0191] iRNA compounds of the invention may be prepared using a
two-step procedure. First, the individual strands of the double
stranded RNA molecule are prepared separately. Then, the component
strands are annealed. The individual strands of the siRNA compound
can be prepared using solution-phase or solid-phase organic
synthesis or both. Organic synthesis offers the advantage that the
oligonucleotide strands comprising unnatural or modified
nucleotides can be easily prepared. Single-stranded
oligonucleotides of the invention can be prepared using
solution-phase or solid-phase organic synthesis or both.
[0192] In one aspect, a dsRNA of the invention includes at least
two nucleotide sequences, a sense sequence and an anti-sense
sequence. The sense strand is selected from the group of sequences
provided in any one of Tables 3, 4, 9, 10, 15, 16, 19A, 19B, 19C,
19D, 19E, 19F, 20, 21, 23, 24, 26, and 27, and the corresponding
antisense strand of the sense strand is selected from the group of
sequences of any one of Tables 3, 4, 9, 10, 15, 16, 19A, 19B, 19C,
19D, 19E, 19F, 20, 21, 23, 24, 26, and 27.
[0193] In one embodiment, the sense strand is selected from the
group of sequences provided in any one of Tables 3, 4, 19A, and 19B
and the corresponding antisense strand of the sense strand is
selected from the group of sequences of any one of Tables 3, 4,
19A, and 19B. In this aspect, one of the two sequences is
complementary to the other of the two sequences, with one of the
sequences being substantially complementary to a sequence of an
mRNA generated in the expression of a KLKB1 gene. As such, in this
aspect, a dsRNA will include two oligonucleotides, where one
oligonucleotide is described as the sense strand in any one of
Tables 3, 4, 19A, and 19B and the second oligonucleotide is
described as the corresponding antisense strand of the sense strand
in any one of Tables 3, 4, 19A, and 19B. In one embodiment, the
substantially complementary sequences of the dsRNA are contained on
separate oligonucleotides. In another embodiment, the substantially
complementary sequences of the dsRNA are contained on a single
oligonucleotide.
[0194] In one embodiment, the sense strand is selected from the
group of sequences provided in any one of any one of Tables 9, 10,
19C, 19D, 20, 21, 23, 24, 26, and 27, and the corresponding
antisense strand of the sense strand is selected from the group of
sequences of any one of Tables 9, 10, 19C, 19D, 20, 21, 23, 24, 26,
and 27. In this aspect, one of the two sequences is complementary
to the other of the two sequences, with one of the sequences being
substantially complementary to a sequence of an mRNA generated in
the expression of an F12 gene. As such, in this aspect, a dsRNA
will include two oligonucleotides, where one oligonucleotide is
described as the sense strand in any one of Tables 9, 10, 19C, 19D,
20, 21, 23, 24, 26, and 27, and the second oligonucleotide is
described as the corresponding antisense strand of the sense strand
in any one of Tables 9, 10, 19C, 19D, 20, 21, 23, 24, 26, and 27.
In one embodiment, the substantially complementary sequences of the
dsRNA are contained on separate oligonucleotides. In another
embodiment, the substantially complementary sequences of the dsRNA
are contained on a single oligonucleotide.
[0195] In one embodiment, the sense strand is selected from the
group of sequences provided in any one of Tables 15, 16, 19E, and
19F, and the corresponding antisense strand of the sense strand is
selected from the group of sequences of any one of Tables 15, 16,
19E, and 19F. In this aspect, one of the two sequences is
complementary to the other of the two sequences, with one of the
sequences being substantially complementary to a sequence of an
mRNA generated in the expression of a KNG1 gene. As such, in this
aspect, a dsRNA will include two oligonucleotides, where one
oligonucleotide is described as the sense strand in any one of
Tables 15, 16, 19E, and 19F, and the second oligonucleotide is
described as the corresponding antisense strand of the sense strand
in any one of Tables 15, 16, 19E, and 19F. In one embodiment, the
substantially complementary sequences of the dsRNA are contained on
separate oligonucleotides. In another embodiment, the substantially
complementary sequences of the dsRNA are contained on a single
oligonucleotide.
[0196] It will be understood that, although some of the sequences
in Tables 3, 4, 9, 10, 15, 16, 19A, 19B, 19C, 19D, 19E, 19F, 20,
21, 23, 24, 26, and 27 are described as modified and/or conjugated
sequences, the RNA of the iRNA of the invention e.g., a dsRNA of
the invention, may comprise any one of the sequences set forth in
Tables 3, 4, 9, 10, 15, 16, 19A, 19B, 19C, 19D, 19E, 19F, 20, 21,
23, 24, 26, and 27 that is un-modified, un-conjugated, and/or
modified and/or conjugated differently than described therein.
[0197] The skilled person is well aware that dsRNAs having a duplex
structure of about 20 to about 23 base pairs, e.g., 21, base pairs
have been hailed as particularly effective in inducing RNA
interference (Elbashir et al., EMBO 2001, 20:6877-6888). However,
others have found that shorter or longer RNA duplex structures can
also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al.
(2005) Nat Biotech 23:222-226). In the embodiments described above,
by virtue of the nature of the oligonucleotide sequences provided
in any one of Tables 3, 4, 9, 10, 15, 16, 19A, 19B, 19C, 19D, 19E,
19F, 20, 21, 23, 24, 26, and 27, dsRNAs described herein can
include at least one strand of a length of minimally 21
nucleotides. It can be reasonably expected that shorter duplexes
having one of the sequences of any one of Tables 3, 4, 9, 10, 15,
16, 19A, 19B, 19C, 19D, 19E, 19F, 20, 21, 23, 24, 26, and 27 minus
only a few nucleotides on one or both ends can be similarly
effective as compared to the dsRNAs described above. Hence, dsRNAs
having a sequence of at least 15, 16, 17, 18, 19, 20, or more
contiguous nucleotides derived from one of the sequences of any one
of Tables 3, 4, 19A, and 19B and differing in their ability to
inhibit the expression of a KLKB1 gene by not more than about 5,
10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full
sequence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19,
20, or more contiguous nucleotides derived from one of the
sequences of any one of Tables 9, 10,19C, 19D, 20, and 21, and
differing in their ability to inhibit the expression of an F12 gene
by not more than about 5, 10, 15, 20, 25, or 30% inhibition from a
dsRNA comprising the full sequence, and dsRNAs having a sequence of
at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides
derived from one of the sequences of any one of Tables 15, 16, 19E,
and 19F, and differing in their ability to inhibit the expression
of a KNG1 gene by not more than about 5, 10, 15, 20, 25, or 30%
inhibition from a dsRNA comprising the full sequence, are
contemplated to be within the scope of the present invention.
[0198] In addition, the RNAs provided in any one of Tables 3, 4,
19A, and 19B identify a site(s) in a KLKB1 transcript that is
susceptible to RISC-mediated cleavage, the RNAs provided in any one
of Tables 9, 10, 19C, 19D, 20, 21, 23, 24, 26, and 27 identify a
site(s) in an F12 transcript that is susceptible to RISC-mediated
cleavage, and RNAs provided in any one of Tables 15, 16, 19E, and
19F identify a site(s) in a KNG1 transcript that is susceptible to
RISC-mediated cleavage. As such, the present invention further
features iRNAs that target within one of these sites. As used
herein, an iRNA is said to target within a particular site of an
RNA transcript if the iRNA promotes cleavage of the transcript
anywhere within that particular site. Such an iRNA will generally
include at least about 15 contiguous nucleotides from one of the
sequences provided in any one of Tables 3, 4, 9, 10, 15, 16, 19A,
19B, 19C, 19D, 19E, 19F, 20, 21, 23, 24, 26, and 27 coupled to
additional nucleotide sequences taken from the region contiguous to
the selected sequence in the contact activation pathway gene.
[0199] While a target sequence is generally about 15-30 nucleotides
in length, there is wide variation in the suitability of particular
sequences in this range for directing cleavage of any given target
RNA. Various software packages and the guidelines set out herein
provide guidance for the identification of optimal target sequences
for any given gene target, but an empirical approach can also be
taken in which a "window" or "mask" of a given size (as a
non-limiting example, 21 nucleotides) is literally or figuratively
(including, e.g., in silico) placed on the target RNA sequence to
identify sequences in the size range that can serve as target
sequences. By moving the sequence "window" progressively one
nucleotide upstream or downstream of an initial target sequence
location, the next potential target sequence can be identified,
until the complete set of possible sequences is identified for any
given target size selected. This process, coupled with systematic
synthesis and testing of the identified sequences (using assays as
described herein or as known in the art) to identify those
sequences that perform optimally can identify those RNA sequences
that, when targeted with an iRNA agent, mediate the best inhibition
of target gene expression. Thus, while the sequences identified,
for example, in any one of Tables 3, 4, 9, 10, 15, 16, 19A, 19B,
19C, 19D, 19E, 19F, 20, 21, 23, 24, 26, and 27 represent effective
target sequences, it is contemplated that further optimization of
inhibition efficiency can be achieved by progressively "walking the
window" one nucleotide upstream or downstream of the given
sequences to identify sequences with equal or better inhibition
characteristics.
[0200] Further, it is contemplated that for any sequence
identified, e.g., in any one of Tables 3, 4, 9, 10, 15, 16, 19A,
19B, 19C, 19D, 19E, 19F, 20, 21, 23, 24, 26, and 27 further
optimization could be achieved by systematically either adding or
removing nucleotides to generate longer or shorter sequences and
testing those sequences generated by walking a window of the longer
or shorter size up or down the target RNA from that point. Again,
coupling this approach to generating new candidate targets with
testing for effectiveness of iRNAs based on those target sequences
in an inhibition assay as known in the art and/or as described
herein can lead to further improvements in the efficiency of
inhibition. Further still, such optimized sequences can be adjusted
by, e.g., the introduction of modified nucleotides as described
herein or as known in the art, addition or changes in overhang, or
other modifications as known in the art and/or discussed herein to
further optimize the molecule (e.g., increasing serum stability or
circulating half-life, increasing thermal stability, enhancing
transmembrane delivery, targeting to a particular location or cell
type, increasing interaction with silencing pathway enzymes,
increasing release from endosomes) as an expression inhibitor.
[0201] An iRNA as described herein can contain one or more
mismatches to the target sequence. In one embodiment, an iRNA as
described herein contains no more than 3 mismatches. If the
antisense strand of the iRNA contains mismatches to a target
sequence, it is preferable that the area of mismatch is not located
in the center of the region of complementarity. If the antisense
strand of the iRNA contains mismatches to the target sequence, it
is preferable that the mismatch be restricted to be within the last
5 nucleotides from either the 5'- or 3'-end of the region of
complementarity. For example, for a 23 nucleotide iRNA agent the
strand which is complementary to a region of a contact activation
pathway gene, generally does not contain any mismatch within the
central 13 nucleotides. The methods described herein or methods
known in the art can be used to determine whether an iRNA
containing a mismatch to a target sequence is effective in
inhibiting the expression of a contact activation pathway gene.
Consideration of the efficacy of iRNAs with mismatches in
inhibiting expression of a contact activation pathway gene is
important, especially if the particular region of complementarity
in a contact activation pathway gene is known to have polymorphic
sequence variation within the population.
III. Modified iRNAs of the Invention
[0202] In one embodiment, the RNA of the iRNA of the invention
e.g., a dsRNA, is un-modified, and does not comprise, e.g.,
chemical modifications and/or conjugations known in the art and
described herein. In another embodiment, the RNA of an iRNA of the
invention, e.g., a dsRNA, is chemically modified to enhance
stability or other beneficial characteristics. In certain
embodiments of the invention, substantially all of the nucleotides
of an iRNA of the invention are modified. In other embodiments of
the invention, all of the nucleotides of an iRNA of the invention
are modified iRNAs of the invention in which "substantially all of
the nucleotides are modified" are largely but not wholly modified
and can include not more than 5, 4, 3, 2, or 1 unmodified
nucleotides. In some embodiments, substantially all of the
nucleotides of an iRNA of the invention are modified and the iRNA
comprises no more than 8 2'-fluoro modifications (e.g., no more
than 7 2'-fluoro modifications, no more than 6 2'-fluoro
modifications, no more than 5 2'-fluoro modification, no more than
4 2'-fluoro modifications, no more than 3 2'-fluoro modifications,
or no more than 2 2'-fluoro modifications) on the sense strand and
no more than 6 2'-fluoro modifications (e.g., no more than 5
2'-fluoro modifications, no more than 4 2'-fluoro modifications, no
more than 3 2'-fluoro modifications, or no more than 2 2'-fluoro
modifications) on the antisense strand. In other embodiments, all
of the nucleotides of an iRNA of the invention are modified and the
iRNA comprises no more than 8 2'-fluoro modifications (e.g., no
more than 7 2'-fluoro modifications, no more than 6 2'-fluoro
modifications, no more than 5 2'-fluoro modification, no more than
4 2'-fluoro modifications, no more than 3 2'-fluoro modifications,
or no more than 2 2'-fluoro modifications) on the sense strand and
no more than 6 2'-fluoro modifications (e.g., no more than 5
2'-fluoro modifications, no more than 4 2'-fluoro modifications, no
more than 3 2'-fluoro modifications, or no more than 2 2'-fluoro
modifications) on the antisense strand.
[0203] The nucleic acids featured in the invention can be
synthesized and/or modified by methods well established in the art,
such as those described in "Current protocols in nucleic acid
chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons,
Inc., New York, N.Y., USA, which is hereby incorporated herein by
reference. Modifications include, for example, end modifications,
e.g., 5'-end modifications (phosphorylation, conjugation, inverted
linkages) or 3'-end modifications (conjugation, DNA nucleotides,
inverted linkages, etc.); base modifications, e.g., replacement
with stabilizing bases, destabilizing bases, or bases that base
pair with an expanded repertoire of partners, removal of bases
(abasic nucleotides), or conjugated bases; sugar modifications
(e.g., at the 2'-position or 4'-position) or replacement of the
sugar; and/or backbone modifications, including modification or
replacement of the phosphodiester linkages. Specific examples of
iRNA compounds useful in the embodiments described herein include,
but are not limited to RNAs containing modified backbones or no
natural internucleoside linkages. RNAs having modified backbones
include, among others, those that do not have a phosphorus atom in
the backbone. For the purposes of this specification, and as
sometimes referenced in the art, modified RNAs that do not have a
phosphorus atom in their internucleoside backbone can also be
considered to be oligonucleosides. In some embodiments, a modified
iRNA will have a phosphorus atom in its internucleoside
backbone.
[0204] Modified RNA backbones include, for example,
phosphorothioates, chiral phosphorothioates, phosphorodithioates,
phosphotriesters, aminoalkylphosphotriesters, methyl and other
alkyl phosphonates including 3'-alkylene phosphonates and chiral
phosphonates, phosphinates, phosphoramidates including 3'-amino
phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates having normal
3'-5' linkages, 2'-5'-linked analogs of these, and those having
inverted polarity wherein the adjacent pairs of nucleoside units
are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed
salts and free acid forms are also included.
[0205] Representative U.S. patents that teach the preparation of
the above phosphorus-containing linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111;
5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445;
6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199;
6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167;
6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933;
7,321,029; and U.S. Pat. RE39464, the entire contents of each of
which are hereby incorporated herein by reference.
[0206] Modified RNA backbones that do not include a phosphorus atom
therein have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and
CH.sub.2 component parts.
[0207] Representative U.S. patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.
Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; and, 5,677,439, the entire contents of each of which are
hereby incorporated herein by reference.
[0208] In other embodiments, suitable RNA mimetics are contemplated
for use in iRNAs, in which both the sugar and the internucleoside
linkage, i.e., the backbone, of the nucleotide units are replaced
with novel groups. The base units are maintained for hybridization
with an appropriate nucleic acid target compound. One such
oligomeric compound, an RNA mimetic that has been shown to have
excellent hybridization properties, is referred to as a peptide
nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA
is replaced with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative U.S. patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents
of each of which are hereby incorporated herein by reference.
Additional PNA compounds suitable for use in the iRNAs of the
invention are described in, for example, in Nielsen et al.,
Science, 1991, 254, 1497-1500.
[0209] Some embodiments featured in the invention include RNAs with
phosphorothioate backbones and oligonucleosides with heteroatom
backbones, and in particular --CH.sub.2--NH--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O --CH.sub.2[known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2--and
--N(CH.sub.3)--CH.sub.2--CH.sub.2--[wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above-referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above-referenced U.S. Pat. No. 5,602,240. In some
embodiments, the RNAs featured herein have morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0210] Modified RNAs can also contain one or more substituted sugar
moieties. The iRNAs, e.g., dsRNAs, featured herein can include one
of the following at the 2'-position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl can be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Exemplary suitable modifications include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2)..sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. In other embodiments, dsRNAs include one of
the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl,
substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl,
SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an iRNA, or a group for improving the
pharmacodynamic properties of an iRNA, and other substituents
having similar properties. In some embodiments, the modification
includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O--(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chin. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another
exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples herein below, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2.
[0211] Other modifications include 2'-methoxy (2'-OCH.sub.3),
2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and
2'-fluoro (2'-F) Similar modifications can also be made at other
positions on the RNA of an iRNA, particularly the 3' position of
the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs
and the 5' position of 5' terminal nucleotide. iRNAs can also have
sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative U.S. patents that teach the
preparation of such modified sugar structures include, but are not
limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain
of which are commonly owned with the instant application. The
entire contents of each of the foregoing are hereby incorporated
herein by reference.
[0212] The RNA of an iRNA can also include nucleobase (often
referred to in the art simply as "base") modifications or
substitutions. As used herein, "unmodified" or "natural"
nucleobases include the purine bases adenine (A) and guanine (G),
and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
Modified nucleobases include other synthetic and natural
nucleobases such as deoxy-thymine (dT), 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine
and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo,
8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted
adenines and guanines, 5-halo, particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine,
7-deazaguanine and 7-daazaadenine and 3-deazaguanine and
3-deazaadenine. Further nucleobases include those disclosed in U.S.
Pat. No. 3,687,808, those disclosed in Modified Nucleosides in
Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed.
Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L,
ed. John Wiley & Sons, 1990, these disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the oligomeric compounds
featured in the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research
and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are
exemplary base substitutions, even more particularly when combined
with 2'-O-methoxyethyl sugar modifications.
[0213] Representative U.S. patents that teach the preparation of
certain of the above noted modified nucleobases as well as other
modified nucleobases include, but are not limited to, the above
noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066;
5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908;
5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091;
5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197;
6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438;
7,045,610; 7,427,672; and 7,495,088, the entire contents of each of
which are hereby incorporated herein by reference.
[0214] The RNA of an iRNA can also be modified to include one or
more bicyclic sugar moities. A "bicyclic sugar" is a furanosyl ring
modified by the bridging of two atoms. A "bicyclic nucleoside"
("BNA") is a nucleoside having a sugar moiety comprising a bridge
connecting two carbon atoms of the sugar ring, thereby forming a
bicyclic ring system. In certain embodiments, the bridge connects
the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some
embodiments an agent of the invention may include one or more
locked nucleic acids (LNA). A locked nucleic acid is a nucleotide
having a modified ribose moiety in which the ribose moiety
comprises an extra bridge connecting the 2' and 4' carbons. In
other words, an LNA is a nucleotide comprising a bicyclic sugar
moiety comprising a 4'-CH2-O-2' bridge. This structure effectively
"locks" the ribose in the 3'-endo structural conformation. The
addition of locked nucleic acids to siRNAs has been shown to
increase siRNA stability in serum, and to reduce off-target effects
(Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447;
Mook, O R. Et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller,
A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
Examples of bicyclic nucleosides for use in the polynucleotides of
the invention include without limitation nucleosides comprising a
bridge between the 4' and the 2' ribosyl ring atoms. In certain
embodiments, the antisense polynucleotide agents of the invention
include one or more bicyclic nucleosides comprising a 4' to 2'
bridge. Examples of such 4' to 2' bridged bicyclic nucleosides,
include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2';
4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as
"constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-O-2' (and analogs
thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2'
(and analogs thereof; see e.g., U.S. Pat. No. 8,278,283);
4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U.S. Pat. No.
8,278,425); 4'-CH2-O-N(CH3)-2' (see, e.g.,U.S. Patent Publication
No. 2004/0171570); 4'-CH2-N(R)-O-2', wherein R is H, C1-C12 alkyl,
or a protecting group (see, e.g., U.S. Pat. No. 7,427,672);
4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org.
Chem., 2009, 74, 118-134); and 4'-CH2-C(.dbd.CH2)-2' (and analogs
thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents
of each of the foregoing are hereby incorporated herein by
reference.
[0215] Additional representative U.S. Patents and US Patent
Publications that teach the preparation of locked nucleic acid
nucleotides include, but are not limited to, the following: U.S.
Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499;
6,998,484; 7,053,207; 7,034,133;7,084,125; 7,399,845; 7,427,672;
7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426;
8,278,283; US 2008/0039618; and US 2009/0012281, the entire
contents of each of which are hereby incorporated herein by
reference.
[0216] Any of the foregoing bicyclic nucleosides can be prepared
having one or more stereochemical sugar configurations including
for example .alpha.-L-ribofuranose and .beta.-D-ribofuranose (see
WO 99/14226).
[0217] The RNA of an iRNA can also be modified to include one or
more constrained ethyl nucleotides. As used herein, a "constrained
ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a
bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2' bridge. In one
embodiment, a constrained ethyl nucleotide is in the S conformation
referred to herein as "S-cEt."
[0218] An iRNA of the invention may also include one or more
"conformationally restricted nucleotides" ("CRN"). CRN are
nucleotide analogs with a linker connecting the C2'and C4' carbons
of ribose or the C3 and --C5' carbons of ribose. CRN lock the
ribose ring into a stable conformation and increase the
hybridization affinity to mRNA. The linker is of sufficient length
to place the oxygen in an optimal position for stability and
affinity resulting in less ribose ring puckering.
[0219] Representative publications that teach the preparation of
certain of the above noted CRN include, but are not limited to, US
Patent Publication No. 2013/0190383; and PCT publication WO
2013/036868, the entire contents of each of which are hereby
incorporated herein by reference.
[0220] One or more of the nucleotides of an iRNA of the invention
may also include a hydroxymethyl substituted nucleotide. A
"hydroxymethyl substituted nucleotide" is an acyclic
2'-3'-seco-nucleotide, also referred to as an "unlocked nucleic
acid" ("UNA") modification Representative U.S. publications that
teach the preparation of UNA include, but are not limited to, U.S.
Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289;
2013/0011922; and 2011/0313020, the entire contents of each of
which are hereby incorporated herein by reference.
[0221] Potentially stabilizing modifications to the ends of RNA
molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol
(Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6),
N-(acetyl-4-hydroxyprolinol (Hyp-NHAc),
thymidine-2'-0-deoxythymidine (ether),
N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino),
2-docosanoyl-uridine-3''-phosphate, inverted base dT(idT) and
others. Disclosure of this modification can be found in PCT
Publication No. WO 2011/005861.
[0222] Other modifications of the nucleotides of an iRNA of the
invention include a 5' phosphate or 5' phosphate mimic, e.g., a
5'-terminal phosphate or phosphate mimic on the antisense strand of
an RNAi agent. Suitable phosphate mimics are disclosed in, for
example US Patent Publication No. 2012/0157511, the entire contents
of which are incorporated herein by reference.
[0223] A. Modified iRNAs Comprising Motifs of the Invention
[0224] In certain aspects of the invention, the double stranded
RNAi agents of the invention include agents with chemical
modifications as disclosed, for example, in U.S. Provisional
Application No. 61/561,710, filed on Nov. 18, 2011, or in
PCT/US2012/065691, filed on Nov. 16, 2012, the entire contents of
each of which are incorporated herein by reference. As shown herein
and in Provisional Application No. 61/561,710 or PCT Application
No. PCT/US2012/065691, a superior result may be obtained by
introducing one or more motifs of three identical modifications on
three consecutive nucleotides into a sense strand and/or antisense
strand of an RNAi agent, particularly at or near the cleavage site.
In some embodiments, the sense strand and antisense strand of the
RNAi agent may otherwise be completely modified. The introduction
of these motifs interrupts the modification pattern, if present, of
the sense and/or antisense strand. The RNAi agent may be optionally
conjugated with a GalNAc derivative ligand, for instance on the
sense strand. The resulting RNAi agents present superior gene
silencing activity.
[0225] More specifically, it has been surprisingly discovered that
when the sense strand and antisense strand of the double stranded
RNAi agent are completely modified to have one or more motifs of
three identical modifications on three consecutive nucleotides at
or near the cleavage site of at least one strand of an RNAi agent,
the gene silencing activity of the RNAi agent was superiorly
enhanced.
[0226] Accordingly, the invention provides double stranded RNAi
agents capable of inhibiting the expression of a target gene (i.e.,
a contact activation pathway gene, i.e., a KLKB 1 gene, an F12
gene, or a KNG1 gene) in vivo. The RNAi agent comprises a sense
strand and an antisense strand. Each strand of the RNAi agent may
range from 12-30 nucleotides in length. For example, each strand
may be between 14-30 nucleotides in length, 17-30 nucleotides in
length, 25-30 nucleotides in length, 27-30 nucleotides in length,
17-23 nucleotides in length, 17-21 nucleotides in length, 17-19
nucleotides in length, 19-25 nucleotides in length, 19-23
nucleotides in length, 19-21 nucleotides in length, 21-25
nucleotides in length, or 21-23 nucleotides in length.
[0227] The sense strand and antisense strand typically form a
duplex double stranded RNA ("dsRNA"), also referred to herein as an
"RNAi agent." The duplex region of an RNAi agent may be 12-30
nucleotide pairs in length. For example, the duplex region can be
between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in
length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in
length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in
length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in
length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in
length, or 21-23 nucleotide pairs in length. In another example,
the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, and 27 nucleotides in length.
[0228] In one embodiment, the RNAi agent may contain one or more
overhang regions and/or capping groups at the 3'-end, 5'-end, or
both ends of one or both strands. The overhang can be 1-6
nucleotides in length, for instance 2-6 nucleotides in length, 1-5
nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides
in length, 2-4 nucleotides in length, 1-3 nucleotides in length,
2-3 nucleotides in length, or 1-2 nucleotides in length. The
overhangs can be the result of one strand being longer than the
other, or the result of two strands of the same length being
staggered. The overhang can form a mismatch with the target mRNA or
it can be complementary to the gene sequences being targeted or can
be another sequence. The first and second strands can also be
joined, e.g., by additional bases to form a hairpin, or by other
non-base linkers.
[0229] In one embodiment, the nucleotides in the overhang region of
the RNAi agent can each independently be a modified or unmodified
nucleotide including, but no limited to 2'-sugar modified, such as,
2-F, 2'-Omethyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine
(Teo), 2'-O-methoxyethyladenosine (Aeo),
2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations
thereof. For example, TT can be an overhang sequence for either end
on either strand. The overhang can form a mismatch with the target
mRNA or it can be complementary to the gene sequences being
targeted or can be another sequence.
[0230] The 5'- or 3'-overhangs at the sense strand, antisense
strand or both strands of the RNAi agent may be phosphorylated. In
some embodiments, the overhang region(s) contains two nucleotides
having a phosphorothioate between the two nucleotides, where the
two nucleotides can be the same or different. In one embodiment,
the overhang is present at the 3'-end of the sense strand,
antisense strand, or both strands. In one embodiment, this
3'-overhang is present in the antisense strand. In one embodiment,
this 3'-overhang is present in the sense strand.
[0231] The RNAi agent may contain only a single overhang, which can
strengthen the interference activity of the RNAi, without affecting
its overall stability. For example, the single-stranded overhang
may be located at the 3'-terminal end of the sense strand or,
alternatively, at the 3'-terminal end of the antisense strand. The
RNAi may also have a blunt end, located at the 5'-end of the
antisense strand (or the 3'-end of the sense strand) or vice versa.
Generally, the antisense strand of the RNAi has a nucleotide
overhang at the 3'-end, and the 5'-end is blunt. While not wishing
to be bound by theory, the asymmetric blunt end at the 5'-end of
the antisense strand and 3'-end overhang of the antisense strand
favor the guide strand loading into RISC process.
[0232] In one embodiment, the RNAi agent is a double ended bluntmer
of 19 nucleotides in length, wherein the sense strand contains at
least one motif of three 2'-F modifications on three consecutive
nucleotides at positions 7, 8, 9 from the 5'end. The antisense
strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at positions 11, 12,
13 from the 5'end.
[0233] In another embodiment, the RNAi agent is a double ended
bluntmer of 20 nucleotides in length, wherein the sense strand
contains at least one motif of three 2'-F modifications on three
consecutive nucleotides at positions 8, 9, 10 from the 5'end. The
antisense strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at positions 11, 12,
13 from the 5'end.
[0234] In yet another embodiment, the RNAi agent is a double ended
bluntmer of 21 nucleotides in length, wherein the sense strand
contains at least one motif of three 2'-F modifications on three
consecutive nucleotides at positions 9, 10, 11 from the 5'end. The
antisense strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at positions 11, 12,
13 from the 5'end.
[0235] In one embodiment, the RNAi agent comprises a 21 nucleotide
sense strand and a 23 nucleotide antisense strand, wherein the
sense strand contains at least one motif of three 2'-F
modifications on three consecutive nucleotides at positions 9, 10,
11 from the 5'end; the antisense strand contains at least one motif
of three 2'-O-methyl modifications on three consecutive nucleotides
at positions 11, 12, 13 from the 5'end, wherein one end of the RNAi
agent is blunt, while the other end comprises a 2 nucleotide
overhang. Preferably, the 2 nucleotide overhang is at the 3'-end of
the antisense strand.
[0236] When the 2 nucleotide overhang is at the 3'-end of the
antisense strand, there may be two phosphorothioate internucleotide
linkages between the terminal three nucleotides, wherein two of the
three nucleotides are the overhang nucleotides, and the third
nucleotide is a paired nucleotide next to the overhang nucleotide.
In one embodiment, the RNAi agent additionally has two
phosphorothioate internucleotide linkages between the terminal
three nucleotides at both the 5'-end of the sense strand and at the
5'-end of the antisense strand. In one embodiment, every nucleotide
in the sense strand and the antisense strand of the RNAi agent,
including the nucleotides that are part of the motifs are modified
nucleotides. In one embodiment each residue is independently
modified with a 2'-O-methyl or 3'-fluoro, e.g., in an alternating
motif. Optionally, the RNAi agent further comprises a ligand
(preferably GalNAc.sub.3).
[0237] In one embodiment, the RNAi agent comprises a sense and an
antisense strand, wherein the sense strand is 25-30 nucleotide
residues in length, wherein starting from the 5' terminal
nucleotide (position 1) positions 1 to 23 of the first strand
comprise at least 8 ribonucleotides; the antisense strand is 36-66
nucleotide residues in length and, starting from the 3' terminal
nucleotide, comprises at least 8 ribonucleotides in the positions
paired with positions 1-23 of sense strand to form a duplex;
wherein at least the 3' terminal nucleotide of antisense strand is
unpaired with sense strand, and up to 6 consecutive 3' terminal
nucleotides are unpaired with sense strand, thereby forming a 3'
single stranded overhang of 1-6 nucleotides; wherein the 5'
terminus of antisense strand comprises from 10-30 consecutive
nucleotides which are unpaired with sense strand, thereby forming a
10-30 nucleotide single stranded 5' overhang; wherein at least the
sense strand 5' terminal and 3' terminal nucleotides are base
paired with nucleotides of antisense strand when sense and
antisense strands are aligned for maximum complementarity, thereby
forming a substantially duplexed region between sense and antisense
strands; and antisense strand is sufficiently complementary to a
target RNA along at least 19 ribonucleotides of antisense strand
length to reduce target gene expression when the double stranded
nucleic acid is introduced into a mammalian cell; and wherein the
sense strand contains at least one motif of three 2'-F
modifications on three consecutive nucleotides, where at least one
of the motifs occurs at or near the cleavage site. The antisense
strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at or near the
cleavage site.
[0238] In one embodiment, the RNAi agent comprises sense and
antisense strands, wherein the RNAi agent comprises a first strand
having a length which is at least 25 and at most 29 nucleotides and
a second strand having a length which is at most 30 nucleotides
with at least one motif of three 2'-O-methyl modifications on three
consecutive nucleotides at position 11, 12, 13 from the 5' end;
wherein the 3' end of the first strand and the 5' end of the second
strand form a blunt end and the second strand is 1-4 nucleotides
longer at its 3' end than the first strand, wherein the duplex
region region which is at least 25 nucleotides in length, and the
second strand is sufficiently complemenatary to a target mRNA along
at least 19 nucleotide of the second strand length to reduce target
gene expression when the RNAi agent is introduced into a mammalian
cell, and wherein dicer cleavage of the RNAi agent preferentially
results in an siRNA comprising the 3' end of the second strand,
thereby reducing expression of the target gene in the mammal.
Optionally, the RNAi agent further comprises a ligand.
[0239] In one embodiment, the sense strand of the RNAi agent
contains at least one motif of three identical modifications on
three consecutive nucleotides, where one of the motifs occurs at
the cleavage site in the sense strand.
[0240] In one embodiment, the antisense strand of the RNAi agent
can also contain at least one motif of three identical
modifications on three consecutive nucleotides, where one of the
motifs occurs at or near the cleavage site in the antisense
strand
[0241] For an RNAi agent having a duplex region of 17-23 nucleotide
in length, the cleavage site of the antisense strand is typically
around the 10, 11 and 12 positions from the 5'-end. Thus the motifs
of three identical modifications may occur at the 9, 10, 11
positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14
positions; or 13, 14, 15 positions of the antisense strand, the
count starting from the 1.sup.st nucleotide from the 5'-end of the
antisense strand, or, the count starting from the 1.sup.st paired
nucleotide within the duplex region from the 5'-end of the
antisense strand. The cleavage site in the antisense strand may
also change according to the length of the duplex region of the
RNAi from the 5'-end.
[0242] The sense strand of the RNAi agent may contain at least one
motif of three identical modifications on three consecutive
nucleotides at the cleavage site of the strand; and the antisense
strand may have at least one motif of three identical modifications
on three consecutive nucleotides at or near the cleavage site of
the strand. When the sense strand and the antisense strand form a
dsRNA duplex, the sense strand and the antisense strand can be so
aligned that one motif of the three nucleotides on the sense strand
and one motif of the three nucleotides on the antisense strand have
at least one nucleotide overlap, i.e., at least one of the three
nucleotides of the motif in the sense strand forms a base pair with
at least one of the three nucleotides of the motif in the antisense
strand. Alternatively, at least two nucleotides may overlap, or all
three nucleotides may overlap.
[0243] In one embodiment, the sense strand of the RNAi agent may
contain more than one motif of three identical modifications on
three consecutive nucleotides. The first motif may occur at or near
the cleavage site of the strand and the other motifs may be a wing
modification. The term "wing modification" herein refers to a motif
occurring at another portion of the strand that is separated from
the motif at or near the cleavage site of the same strand. The wing
modification is either adajacent to the first motif or is separated
by at least one or more nucleotides. When the motifs are
immediately adjacent to each other then the chemistry of the motifs
are distinct from each other and when the motifs are separated by
one or more nucleotide than the chemistries can be the same or
different. Two or more wing modifications may be present. For
instance, when two wing modifications are present, each wing
modification may occur at one end relative to the first motif which
is at or near cleavage site or on either side of the lead
motif.
[0244] Like the sense strand, the antisense strand of the RNAi
agent may contain more than one motifs of three identical
modifications on three consecutive nucleotides, with at least one
of the motifs occurring at or near the cleavage site of the strand.
This antisense strand may also contain one or more wing
modifications in an alignment similar to the wing modifications
that may be present on the sense strand.
[0245] In one embodiment, the wing modification on the sense strand
or antisense strand of the RNAi agent typically does not include
the first one or two terminal nucleotides at the 3'-end, 5'-end or
both ends of the strand.
[0246] In another embodiment, the wing modification on the sense
strand or antisense strand of the RNAi agent typically does not
include the first one or two paired nucleotides within the duplex
region at the 3'-end, 5'-end or both ends of the strand.
[0247] When the sense strand and the antisense strand of the RNAi
agent each contain at least one wing modification, the wing
modifications may fall on the same end of the duplex region, and
have an overlap of one, two or three nucleotides.
[0248] When the sense strand and the antisense strand of the RNAi
agent each contain at least two wing modifications, the sense
strand and the antisense strand can be so aligned that two
modifications each from one strand fall on one end of the duplex
region, having an overlap of one, two or three nucleotides; two
modifications each from one strand fall on the other end of the
duplex region, having an overlap of one, two or three nucleotides;
two modifications one strand fall on each side of the lead motif,
having an overlap of one, two or three nucleotides in the duplex
region.
[0249] In one embodiment, every nucleotide in the sense strand and
antisense strand of the RNAi agent, including the nucleotides that
are part of the motifs, may be modified. Each nucleotide may be
modified with the same or different modification which can include
one or more alteration of one or both of the non-linking phosphate
oxygens and/or of one or more of the linking phosphate oxygens;
alteration of a constituent of the ribose sugar, e.g., of the 2'
hydroxyl on the ribose sugar; wholesale replacement of the
phosphate moiety with "dephospho" linkers; modification or
replacement of a naturally occurring base; and replacement or
modification of the ribose-phosphate backbone.
[0250] As nucleic acids are polymers of subunits, many of the
modifications occur at a position which is repeated within a
nucleic acid, e.g., a modification of a base, or a phosphate
moiety, or a non-linking O of a phosphate moiety. In some cases the
modification will occur at all of the subject positions in the
nucleic acid but in many cases it will not. By way of example, a
modification may only occur at a 3' or 5' terminal position, may
only occur in a terminal region, e.g., at a position on a terminal
nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a
strand.
[0251] A modification may occur in a double strand region, a single
strand region, or in both. A modification may occur only in the
double strand region of a RNA or may only occur in a single strand
region of a RNA. For example, a phosphorothioate modification at a
non-linking O position may only occur at one or both termini, may
only occur in a terminal region, e.g., at a position on a terminal
nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a
strand, or may occur in double strand and single strand regions,
particularly at termini. The 5' end or ends can be
phosphorylated.
[0252] It may be possible, e.g., to enhance stability, to include
particular bases in overhangs, or to include modified nucleotides
or nucleotide surrogates, in single strand overhangs, e.g., in a 5'
or 3' overhang, or in both. For example, it can be desirable to
include purine nucleotides in overhangs. In some embodiments all or
some of the bases in a 3' or 5' overhang may be modified, e.g.,
with a modification described herein. Modifications can include,
e.g., the use of modifications at the 2' position of the ribose
sugar with modifications that are known in the art, e.g., the use
of deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl
modified instead of the ribosugar of the nucleobase, and
modifications in the phosphate group, e.g., phosphorothioate
modifications. Overhangs need not be homologous with the target
sequence.
[0253] In one embodiment, each residue of the sense strand and
antisense strand is independently modified with LNA, CRN, cET, UNA,
HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl,
2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The strands can contain more
than one modification. In one embodiment, each residue of the sense
strand and antisense strand is independently modified with
2'-O-methyl or 2'-fluoro.
[0254] At least two different modifications are typically present
on the sense strand and antisense strand. Those two modifications
may be the 2'-O-methyl or 2'-fluoro modifications, or others.
[0255] In one embodiment, the N.sub.a and/or N.sub.b comprise
modifications of an alternating pattern. The term "alternating
motif" as used herein refers to a motif having one or more
modifications, each modification occurring on alternating
nucleotides of one strand. The alternating nucleotide may refer to
one per every other nucleotide or one per every three nucleotides,
or a similar pattern. For example, if A, B and C each represent one
type of modification to the nucleotide, the alternating motif can
be "ABABABABABAB . . . ," "AABBAABBAABB . . . ," "AABAABAABAAB . .
. ," "AAABAAABAAAB . . . ," "AAABBBAAABBB . . . ," or "ABCABCABCABC
. . . ," etc.
[0256] The type of modifications contained in the alternating motif
may be the same or different. For example, if A, B, C, D each
represent one type of modification on the nucleotide, the
alternating pattern, i.e., modifications on every other nucleotide,
may be the same, but each of the sense strand or antisense strand
can be selected from several possibilities of modifications within
the alternating motif such as "ABABAB . . . ", "ACACAC . . . "
"BDBDBD . . . " or "CDCDCD . . . ," etc.
[0257] In one embodiment, the RNAi agent of the invention comprises
the modification pattern for the alternating motif on the sense
strand relative to the modification pattern for the alternating
motif on the antisense strand is shifted. The shift may be such
that the modified group of nucleotides of the sense strand
corresponds to a differently modified group of nucleotides of the
antisense strand and vice versa. For example, the sense strand when
paired with the antisense strand in the dsRNA duplex, the
alternating motif in the sense strand may start with "ABABAB" from
5'-3' of the strand and the alternating motif in the antisense
strand may start with "BABABA" from 5'-3' of the strand within the
duplex region. As another example, the alternating motif in the
sense strand may start with "AABBAABB" from 5'-3' of the strand and
the alternating motif in the antisenese strand may start with
"BBAABBAA" from 5'-3' of the strand within the duplex region, so
that there is a complete or partial shift of the modification
patterns between the sense strand and the antisense strand.
[0258] In one embodiment, the RNAi agent comprises the pattern of
the alternating motif of 2'-O-methyl modification and 2'-F
modification on the sense strand initially has a shift relative to
the pattern of the alternating motif of 2'-O-methyl modification
and 2'-F modification on the antisense strand initially, i.e., the
2'-O-methyl modified nucleotide on the sense strand base pairs with
a 2'-F modified nucleotide on the antisense strand and vice versa.
The 1 position of the sense strand may start with the 2'-F
modification, and the 1 position of the antisense strand may start
with the 2'-O-methyl modification.
[0259] The introduction of one or more motifs of three identical
modifications on three consecutive nucleotides to the sense strand
and/or antisense strand interrupts the initial modification pattern
present in the sense strand and/or antisense strand. This
interruption of the modification pattern of the sense and/or
antisense strand by introducing one or more motifs of three
identical modifications on three consecutive nucleotides to the
sense and/or antisense strand surprisingly enhances the gene
silencing activity to the target gene.
[0260] In one embodiment, when the motif of three identical
modifications on three consecutive nucleotides is introduced to any
of the strands, the modification of the nucleotide next to the
motif is a different modification than the modification of the
motif. For example, the portion of the sequence containing the
motif is ". . . N.sub.aYYYN.sub.b . . . ," where "Y" represents the
modification of the motif of three identical modifications on three
consecutive nucleotide, and "N.sub.a" and "N.sub.b" represent a
modification to the nucleotide next to the motif "YYY" that is
different than the modification of Y, and where N.sub.a and N.sub.b
can be the same or different modifications. Altnernatively, N.sub.a
and/or N.sub.b may be present or absent when there is a wing
modification present.
[0261] The RNAi agent may further comprise at least one
phosphorothioate or methylphosphonate internucleotide linkage. The
phosphorothioate or methylphosphonate internucleotide linkage
modification may occur on any nucleotide of the sense strand or
antisense strand or both strands in any position of the strand. For
instance, the internucleotide linkage modification may occur on
every nucleotide on the sense strand and/or antisense strand; each
internucleotide linkage modification may occur in an alternating
pattern on the sense strand and/or antisense strand; or the sense
strand or antisense strand may contain both internucleotide linkage
modifications in an alternating pattern. The alternating pattern of
the internucleotide linkage modification on the sense strand may be
the same or different from the antisense strand, and the
alternating pattern of the internucleotide linkage modification on
the sense strand may have a shift relative to the alternating
pattern of the internucleotide linkage modification on the
antisense strand. In one embodiment, a double-standed RNAi agent
comprises 6-8 phosphorothioate internucleotide linkages. In one
embodiment, the antisense strand comprises two phosphorothioate
internucleotide linkages at the 5'-terminus and two
phosphorothioate internucleotide linkages at the 3'-terminus, and
the sense strand comprises at least two phosphorothioate
internucleotide linkages at either the 5'-terminus or the
3'-terminus.
[0262] In one embodiment, the RNAi comprises a phosphorothioate or
methylphosphonate internucleotide linkage modification in the
overhang region. For example, the overhang region may contain two
nucleotides having a phosphorothioate or methylphosphonate
internucleotide linkage between the two nucleotides.
Internucleotide linkage modifications also may be made to link the
overhang nucleotides with the terminal paired nucleotides within
the duplex region. For example, at least 2, 3, 4, or all the
overhang nucleotides may be linked through phosphorothioate or
methylphosphonate internucleotide linkage, and optionally, there
may be additional phosphorothioate or methylphosphonate
internucleotide linkages linking the overhang nucleotide with a
paired nucleotide that is next to the overhang nucleotide. For
instance, there may be at least two phosphorothioate
internucleotide linkages between the terminal three nucleotides, in
which two of the three nucleotides are overhang nucleotides, and
the third is a paired nucleotide next to the overhang nucleotide.
These terminal three nucleotides may be at the 3'-end of the
antisense strand, the 3'-end of the sense strand, the 5'-end of the
antisense strand, and/or the 5'end of the antisense strand.
[0263] In one embodiment, the 2 nucleotide overhang is at the
3'-end of the antisense strand, and there are two phosphorothioate
internucleotide linkages between the terminal three nucleotides,
wherein two of the three nucleotides are the overhang nucleotides,
and the third nucleotide is a paired nucleotide next to the
overhang nucleotide. Optionally, the RNAi agent may additionally
have two phosphorothioate internucleotide linkages between the
terminal three nucleotides at both the 5'-end of the sense strand
and at the 5'-end of the antisense strand.
[0264] In one embodiment, the RNAi agent comprises mismatch(es)
with the target, within the duplex, or combinations thereof. The
mistmatch may occur in the overhang region or the duplex region.
The base pair may be ranked on the basis of their propensity to
promote dissociation or melting (e.g., on the free energy of
association or dissociation of a particular pairing, the simplest
approach is to examine the pairs on an individual pair basis,
though next neighbor or similar analysis can also be used). In
terms of promoting dissociation: A:U is preferred over G:C; G:U is
preferred over G:C; and I:C is preferred over G:C (I=inosine).
Mismatches, e.g., non-canonical or other than canonical pairings
(as described elsewhere herein) are preferred over canonical (A:T,
A:U, G:C) pairings; and pairings which include a universal base are
preferred over canonical pairings.
[0265] In one embodiment, the RNAi agent comprises at least one of
the first 1, 2, 3, 4, or 5 base pairs within the duplex regions
from the 5'-end of the antisense strand independently selected from
the group of: A:U, G:U, I:C, and mismatched pairs, e.g.,
non-canonical or other than canonical pairings or pairings which
include a universal base, to promote the dissociation of the
antisense strand at the 5'-end of the duplex.
[0266] In one embodiment, the nucleotide at the 1 position within
the duplex region from the 5'-end in the antisense strand is
selected from the group consisting of A, dA, dU, U, and dT.
Alternatively, at least one of the first 1, 2 or 3 base pair within
the duplex region from the 5'-end of the antisense strand is an AU
base pair. For example, the first base pair within the duplex
region from the 5'-end of the antisense strand is an AU base
pair.
[0267] In another embodiment, the nucleotide at the 3'-end of the
sense strand is deoxy-thymine (dT). In another embodiment, the
nucleotide at the 3'-end of the antisense strand is deoxy-thymine
(dT). In one embodiment, there is a short sequence of deoxy-thymine
nucleotides, for example, two dT nucleotides on the 3'-end of the
sense and/or antisense strand. In one embodiment, the sense strand
sequence may be represented by formula (I):
5' n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y-N.sub.b-(Z Z
Z).sub.j-N.sub.a-n.sub.q 3' (I)
[0268] wherein:
[0269] i and j are each independently 0 or 1;
[0270] p and q are each independently 0-6;
[0271] each N.sub.a independently represents an oligonucleotide
sequence comprising 0-25 modified nucleotides, each sequence
comprising at least two differently modified nucleotides;
[0272] each N.sub.b independently represents an oligonucleotide
sequence comprising 0-10 modified nucleotides;
[0273] each n.sub.p and n.sub.q independently represent an overhang
nucleotide; wherein Nb and Y do not have the same modification;
and
[0274] XXX, YYY and ZZZ each independently represent one motif of
three identical modifications on three consecutive nucleotides.
Preferably YYY is all 2'-F modified nucleotides.
[0275] In one embodiment, the N.sub.a and/or N.sub.b comprise
modifications of alternating pattern.
[0276] In one embodiment, the YYY motif occurs at or near the
cleavage site of the sense strand. For example, when the RNAi agent
has a duplex region of 17-23 nucleotides in length, the YYY motif
can occur at or the vicinity of the cleavage site (e.g. can occur
at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11,12 or
11, 12, 13) of--the sense strand, the count starting from the
1.sup.st nucleotide, from the 5'-end; or optionally, the count
starting at the 1.sup.st paired nucleotide within the duplex
region, from the 5'-end.
[0277] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1,
or both i and j are 1. The sense strand can therefore be
represented by the following formulas:
5' n.sub.p-N.sub.a-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3' (Ib);
5' n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.a-n.sub.q 3' (Ic); or
5' n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3'
(Id).
[0278] When the sense strand is represented by formula (Ib),
N.sub.b represents an oligonucleotide sequence comprising 0-10,
0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a
independently can represent an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides.
[0279] When the sense strand is represented as formula (Ic),
N.sub.b represents an oligonucleotide sequence comprising 0-10,
0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each
N.sub.a can independently represent an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0280] When the sense strand is represented as formula (Id), each
N.sub.b independently represents an oligonucleotide sequence
comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6 Each N.sub.a can
independently represent an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides. Each of X, Y and Z may be
the same or different from each other.
[0281] In other embodiments, i is 0 and j is 0, and the sense
strand may be represented by the formula:
5' n.sub.p-N.sub.a-YYY-N.sub.an.sub.q 3' (Ia).
[0282] When the sense strand is represented by formula (Ia), each
N.sub.a independently can represent an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0283] In one embodiment, the antisense strand sequence of the RNAi
may be represented by formula (II):
5'
n.sub.q'-N.sub.a'-(Z'Z'Z').sub.k-N.sub.b'-Y'Y'Y'-N.sub.b'-(X'X'X').su-
b.l-N'.sub.a-n.sub.p' 3' (II)
[0284] wherein:
[0285] k and 1 are each independently 0 or 1;
[0286] p' and q' are each independently 0-6;
[0287] each N.sub.a' independently represents an oligonucleotide
sequence comprising 0-25 modified nucleotides, each sequence
comprising at least two differently modified nucleotides;
[0288] each N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10 modified nucleotides;
[0289] each n.sub.p' and n.sub.q' independently represent an
overhang nucleotide;
[0290] wherein N.sub.b' and Y' do not have the same modification;
and
[0291] X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one
motif of three identical modifications on three consecutive
nucleotides.
[0292] In one embodiment, the N.sub.a' and/or N.sub.b' comprise
modifications of alternating pattern.
[0293] The Y'Y'Y' motif occurs at or near the cleavage site of the
antisense strand. For example, when the RNAi agent has a duplex
region of 17-23 nucleotidein length, the Y'Y'Y' motif can occur at
positions 9, 10, 11;10, 11, 12; 11, 12, 13; 12, 13, 14 ; or 13, 14,
15 of the antisense strand, with the count starting from the
1.sup.st nucleotide, from the 5'-end; or optionally, the count
starting at the 1.sup.st paired nucleotide within the duplex
region, from the 5'-end. Preferably, the Y'Y'Y' motif occurs at
positions 11, 12, 13.
[0294] In one embodiment, Y'Y'Y' motif is all 2'-OMe modified
nucleotides.
[0295] In one embodiment, k is 1 and 1 is 0, or k is 0 and 1 is 1,
or both k and 1 are 1.
[0296] The antisense strand can therefore be represented by the
following formulas:
5' n.sub.q'-N.sub.a'-Z'Z'Z'-N.sub.b'-Y'Y'Y'-N.sub.a'-n.sub.p' 3'
(IIb);
5' n.sub.q'-N.sub.a'-Y'Y'Y'-N.sub.b'-X'X'X'-n.sub.p' 3' (IIc);
or
5'
n.sub.q'-N.sub.a'-Z'Z'Z'-N.sub.b'-Y'Y'Y'-N.sub.b'-X'X'X'-N.sub.a'-n.s-
ub.p' 3' (IId).
[0297] When the antisense strand is represented by formula (IIb),
N.sub.b' represents an oligonucleotide sequence comprising 0-10,
0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each
N.sub.a' independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0298] When the antisense strand is represented as formula (IIc),
N.sub.b' represents an oligonucleotide sequence comprising 0-10,
0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each
N.sub.a' independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0299] When the antisense strand is represented as formula (IId),
each N.sub.b' independently represents an oligonucleotide sequence
comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified
nucleotides. Each N.sub.a' independently represents an
oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified
nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.
[0300] In other embodiments, k is 0 and 1 is 0 and the antisense
strand may be represented by the formula:
5' n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.a'-n.sub.q' 3' (Ia).
[0301] When the antisense strand is represented as formula (IIa),
each N.sub.a' independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of X', Y'
and Z' may be the same or different from each other. Each
nucleotide of the sense strand and antisense strand may be
independently modified with LNA, CRN, UNA, cEt, HNA, CeNA,
2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl,
or 2'-fluoro. For example, each nucleotide of the sense strand and
antisense strand is independently modified with 2'-O-methyl or
2'-fluoro. Each X, Y, Z, X', Y' and Z', in particular, may
represent a 2'-O-methyl modification or a 2'-fluoro
modification.
[0302] In one embodiment, the sense strand of the RNAi agent may
contain YYY motif occurring at 9, 10 and 11 positions of the strand
when the duplex region is 21 nt, the count starting from the
1.sup.st nucleotide from the 5'-end, or optionally, the count
starting at the 1.sup.st paired nucleotide within the duplex
region, from the 5'-end; and Y represents 2'-F modification. The
sense strand may additionally contain XXX motif or ZZZ motifs as
wing modifications at the opposite end of the duplex region; and
XXX and ZZZ each independently represents a 2'-OMe modification or
2'-F modification.
[0303] In one embodiment the antisense strand may contain Y'Y'Y'
motif occurring at positions 11, 12, 13 of the strand, the count
starting from the 1.sup.st nucleotide from the 5'-end, or
optionally, the count starting at the 1.sup.st paired nucleotide
within the duplex region, from the 5'-end; and Y' represents
2'-O-methyl modification. The antisense strand may additionally
contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the
opposite end of the duplex region; and X'X'X' and Z'Z'Z' each
independently represents a 2'-OMe modification or 2'-F
modification. The sense strand represented by any one of the above
formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense
strand being represented by any one of formulas (IIa), (IIb),
(IIc), and (II), respectively.
[0304] Accordingly, the RNAi agents for use in the methods of the
invention may comprise a sense strand and an antisense strand, each
strand having 14 to 30 nucleotides, the RNAi duplex represented by
formula (III):
sense: 5' n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y-N.sub.b-(Z Z
Z).sub.j-N.sub.a-n.sub.q 3'
antisense: 3'
n.sub.p'-N.sub.a'-(X'X'X').sub.k-N.sub.b'-Y'Y'Y'-N.sub.b'-(Z'Z'Z').sub.l--
N.sub.a'-n.sub.q' 5' (III)
[0305] wherein:
[0306] i, j, k, and 1 are each independently 0 or 1;
[0307] p, p', q, and q' are each independently 0-6;
[0308] each N.sub.a and N.sub.a' independently represents an
oligonucleotide sequence comprising 0-25 modified nucleotides, each
sequence comprising at least two differently modified
nucleotides;
[0309] each N.sub.b and N.sub.b' independently represents an
oligonucleotide sequence comprising 0-10 modified nucleotides;
[0310] wherein each n.sub.p', n.sub.p, n.sub.q', and n.sub.q, each
of which may or may not be present, independently represents an
overhang nucleotide; and
[0311] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently
represent one motif of three identical modifications on three
consecutive nucleotides.
[0312] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0;
or i is 0 and j is 1; or both i and j are 0; or both i and j are 1.
In another embodiment, k is 0 and 1 is 0; or k is 1 and 1 is 0; k
is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1.
[0313] Exemplary combinations of the sense strand and antisense
strand forming a RNAi duplex include the formulas below:
5' n.sub.p-N.sub.a -Y Y Y-N.sub.a-n.sub.q 3'
3' n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.a'n.sub.q' 5' (IIIa)
5' n.sub.p-N.sub.a -Y Y Y-N.sub.b-Z Z Z-N.sub.a-n.sub.q 3'
3' n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.b'-Z'Z'Z'-N.sub.a'-n.sub.q' 5'
(IIIb)
5' n.sub.p-N.sub.a-X X X-N.sub.b -Y Y Y-N.sub.a-n.sub.q 3'
3' n.sub.p'-N.sub.a'-X'X'X'-N.sub.b'-Y'Y'Y'-N.sub.a'-n.sub.q' 5'
(IIIc)
5' n.sub.p-N.sub.a-X X X-N.sub.b-Y Y Y-N.sub.b-Z Z
Z-N.sub.a-n.sub.q 3'
3'
n.sub.p'-N.sub.a'-X'X'X'-N.sub.b'-Y'Y'Y'-N.sub.b'-Z'Z'Z'-N.sub.a-n.su-
b.q' 5' (IIId)
[0314] When the RNAi agent is represented by formula (IIIa), each
N.sub.a independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0315] When the RNAi agent is represented by formula (IIIb), each
N.sub.b independently represents an oligonucleotide sequence
comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a
independently represents an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides.
[0316] When the RNAi agent is represented as formula (IIIc), each
N.sub.b, N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0
modified nucleotides. Each N.sub.a independently represents an
oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified
nucleotides.
[0317] When the RNAi agent is represented as formula (IIId), each
N.sub.b, N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0
modified nucleotides. Each N.sub.a, N.sub.a' independently
represents an oligonucleotide sequence comprising 2-20, 2-15, or
2-10 modified nucleotides. Each of N.sub.a, N.sub.a', N.sub.b and
N.sub.b' independently comprises modifications of alternating
pattern.
[0318] Each of X, Y and Z in formulas (III), (IIIa), (IIIb),
(IIIc), and (IIId) may be the same or different from each
other.
[0319] When the RNAi agent is represented by formula (III), (IIIa),
(IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may
form a base pair with one of the Y' nucleotides. Alternatively, at
least two of the Y nucleotides form base pairs with the
corresponding Y' nucleotides; or all three of the Y nucleotides all
form base pairs with the corresponding Y' nucleotides.
[0320] When the RNAi agent is represented by formula (IIIb) or
(IIId), at least one of the Z nucleotides may form a base pair with
one of the Z' nucleotides. Alternatively, at least two of the Z
nucleotides form base pairs with the corresponding Z' nucleotides;
or all three of the Z nucleotides all form base pairs with the
corresponding Z' nucleotides.
[0321] When the RNAi agent is represented as formula (IIIc) or
(IIId), at least one of the X nucleotides may form a base pair with
one of the X' nucleotides. Alternatively, at least two of the X
nucleotides form base pairs with the corresponding X' nucleotides;
or all three of the X nucleotides all form base pairs with the
corresponding X' nucleotides.
[0322] In one embodiment, the modification on the Y nucleotide is
different than the modification on the Y' nucleotide, the
modification on the Z nucleotide is different than the modification
on the Z' nucleotide, and/or the modification on the X nucleotide
is different than the modification on the X' nucleotide.
[0323] In one embodiment, when the RNAi agent is represented by
formula (IIId), the N.sub.a modifications are 2'-O-methyl or
2'-fluoro modifications. In another embodiment, when the RNAi agent
is represented by formula (IIId), the N.sub.a modifications are
2'-O-methyl or 2'-fluoro modifications and n.sub.p'>0 and at
least one n.sub.p' is linked to a neighboring nucleotide a via
phosphorothioate linkage. In yet another embodiment, when the RNAi
agent is represented by formula (IIId), the N.sub.a modifications
are 2'-O-methyl or 2'-fluoro modifications , n.sub.p'>0 and at
least one n.sub.p' is linked to a neighboring nucleotide via
phosphorothioate linkage, and the sense strand is conjugated to one
or more GalNAc derivatives attached through a bivalent or trivalent
branched linker (described below). In another embodiment, when the
RNAi agent is represented by formula (IIId), the N.sub.a
modifications are 2'-O-methyl or 2'-fluoro modifications ,
n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring
nucleotide via phosphorothioate linkage, the sense strand comprises
at least one phosphorothioate linkage, and the sense strand is
conjugated to one or more GalNAc derivatives attached through a
bivalent or trivalent branched linker.
[0324] In one embodiment, when the RNAi agent is represented by
formula (IIIa), the N.sub.a modifications are 2'-O-methyl or
2'-fluoro modifications , n.sub.p'>0 and at least one n.sub.p'
is linked to a neighboring nucleotide via phosphorothioate linkage,
the sense strand comprises at least one phosphorothioate linkage,
and the sense strand is conjugated to one or more GalNAc
derivatives attached through a bivalent or trivalent branched
linker.
[0325] In one embodiment, the RNAi agent is a multimer containing
at least two duplexes represented by formula (III), (IIIa), (IIIb),
(IIIc), and (IIId), wherein the duplexes are connected by a linker.
The linker can be cleavable or non-cleavable. Optionally, the
multimer further comprises a ligand. Each of the duplexes can
target the same gene or two different genes; or each of the
duplexes can target same gene at two different target sites.
[0326] In one embodiment, the RNAi agent is a multimer containing
three, four, five, six or more duplexes represented by formula
(III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are
connected by a linker. The linker can be cleavable or
non-cleavable. Optionally, the multimer further comprises a ligand.
Each of the duplexes can target the same gene or two different
genes; or each of the duplexes can target same gene at two
different target sites.
[0327] In one embodiment, two RNAi agents represented by formula
(III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other
at the 5' end, and one or both of the 3' ends and are optionally
conjugated to to a ligand. Each of the agents can target the same
gene or two different genes; or each of the agents can target same
gene at two different target sites.
[0328] Various publications describe multimeric RNAi agents that
can be used in the methods of the invention. Such publications
include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511,
WO2007/117686, WO2009/014887 and WO2011/031520 the entire contents
of each of which are hereby incorporated herein by reference.
[0329] As described in more detail below, the RNAi agent that
contains conjugations of one or more carbohydrate moieties to a
RNAi agent can optimize one or more properties of the RNAi agent.
In many cases, the carbohydrate moiety will be attached to a
modified subunit of the RNAi agent. For example, the ribose sugar
of one or more ribonucleotide subunits of a dsRNA agent can be
replaced with another moiety, e.g., a non-carbohydrate (preferably
cyclic) carrier to which is attached a carbohydrate ligand. A
ribonucleotide subunit in which the ribose sugar of the subunit has
been so replaced is referred to herein as a ribose replacement
modification subunit (RRMS). A cyclic carrier may be a carbocyclic
ring system, i.e., all ring atoms are carbon atoms, or a
heterocyclic ring system, i.e., one or more ring atoms may be a
heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may
be a monocyclic ring system, or may contain two or more rings, e.g.
fused rings. The cyclic carrier may be a fully saturated ring
system, or it may contain one or more double bonds.
[0330] The ligand may be attached to the polynucleotide via a
carrier. The carriers include (i) at least one "backbone attachment
point," preferably two "backbone attachment points" and (ii) at
least one "tethering attachment point." A "backbone attachment
point" as used herein refers to a functional group, e.g. a hydroxyl
group, or generally, a bond available for, and that is suitable for
incorporation of the carrier into the backbone, e.g., the
phosphate, or modified phosphate, e.g., sulfur containing,
backbone, of a ribonucleic acid. A "tethering attachment point"
(TAP) in some embodiments refers to a constituent ring atom of the
cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from
an atom which provides a backbone attachment point), that connects
a selected moiety. The moiety can be, e.g., a carbohydrate, e.g.
monosaccharide, disaccharide, trisaccharide, tetrasaccharide,
oligosaccharide and polysaccharide. Optionally, the selected moiety
is connected by an intervening tether to the cyclic carrier. Thus,
the cyclic carrier will often include a functional group, e.g., an
amino group, or generally, provide a bond, that is suitable for
incorporation or tethering of another chemical entity, e.g., a
ligand to the constituent ring.
[0331] The RNAi agents may be conjugated to a ligand via a carrier,
wherein the carrier can be cyclic group or acyclic group;
preferably, the cyclic group is selected from pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl,
isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl,
quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin;
preferably, the acyclic group is selected from serinol backbone or
diethanolamine backbone.
[0332] In certain specific embodiments, the RNAi agent for use in
the methods of the invention is an agent selected from the group of
agents listed in any one of Tables 3, 4, 9, 10, 15, 16, 19A, 19B,
19C, 19D, 19E, 19F, 20, 21, 23, 24, 26, and 27. In one embodiment,
the agent is any one of the agents listed in any one of Tables 9,
10, 19C, 19D, 20, 21, 23, 24, 26, and 27. These agents may further
comprise a ligand.
IV. iRNAs Conjugated to Ligands
[0333] Another modification of the RNA of an iRNA of the invention
involves chemically linking to the RNA one or more ligands,
moieties or conjugates that enhance the activity, cellular
distribution or cellular uptake of the iRNA. Such moieties include
but are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:
6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let.,
1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309;
Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992,
20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl
residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118;
Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al.,
Biochimie, 1993, 75:49-54), a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995,
14:969-973), or adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra
et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an
octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke
et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0334] In one embodiment, a ligand alters the distribution,
targeting or lifetime of an iRNA agent into which it is
incorporated. In preferred embodiments a ligand provides an
enhanced affinity for a selected target, e.g., molecule, cell or
cell type, compartment, e.g., a cellular or organ compartment,
tissue, organ or region of the body, as, e.g., compared to a
species absent such a ligand. Preferred ligands will not take part
in duplex pairing in a duplexed nucleic acid.
[0335] Ligands can include a naturally occurring substance, such as
a protein (e.g., human serum albumin (HSA), low-density lipoprotein
(LDL), or globulin); carbohydrate (e.g., a dextran, pullulan,
chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or
hyaluronic acid); or a lipid. The ligand can also be a recombinant
or synthetic molecule, such as a synthetic polymer, e.g., a
synthetic polyamino acid. Examples of polyamino acids include
polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly
L-glutamic acid, styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, polylysine (PLL), spermine, spermidine,
polyamine, pseudopeptide-polyamine, peptidomimetic polyamine,
dendrimer polyamine, arginine, amidine, protamine, cationic lipid,
cationic porphyrin, quaternary salt of a polyamine, or an alpha
helical peptide.
[0336] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a lectin, glycoprotein, lipid or
protein, e.g., an antibody, that binds to a specified cell type
such as a kidney cell. A targeting group can be a thyrotropin,
melanotropin, lectin, glycoprotein, surfactant protein A, Mucin
carbohydrate, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-gulucoseamine multivalent mannose,
multivalent fucose, glycosylated polyaminoacids, multivalent
galactose, transferrin, bisphosphonate, polyglutamate,
polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate,
vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide
mimetic.
[0337] Other examples of ligands include dyes, intercalating agents
(e.g. acridines), cross-linkers (e.g. psoralen, mitomycin C),
porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic
hydrocarbons (e.g., phenazine, dihydrophenazine), artificial
endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol,
cholic acid, adamantane acetic acid, 1-pyrene butyric acid,
dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl
group, hexadecylglycerol, borneol, menthol, 1,3-propanediol,
heptadecyl group, palmitic acid, myristic acid,
O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g.,
antennapedia peptide, Tat peptide), alkylating agents, phosphate,
amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2,
polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes,
haptens (e.g. biotin), transport/absorption facilitators (e.g.,
aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g.,
imidazole, bisimidazole, histamine, imidazole clusters,
acridine-imidazole conjugates, Eu3+ complexes of
tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0338] Ligands can be proteins, e.g., glycoproteins, or peptides,
e.g., molecules having a specific affinity for a co-ligand, or
antibodies e.g., an antibody, that binds to a specified cell type
such as a hepatic cell. Ligands can also include hormones and
hormone receptors. They can also include non-peptidic species, such
as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent
lactose, multivalent galactose, N-acetyl-galactosamine,
N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.
The ligand can be, for example, a lipopolysaccharide, an activator
of p38 MAP kinase, or an activator of NF-.kappa.B.
[0339] The ligand can be a substance, e.g., a drug, which can
increase the uptake of the iRNA agent into the cell, for example,
by disrupting the cell's cytoskeleton, e.g., by disrupting the
cell's microtubules, microfilaments, and/or intermediate filaments.
The drug can be, for example, taxon, vincristine, vinblastine,
cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin,
swinholide A, indanocine, or myoservin.
[0340] In some embodiments, a ligand attached to an iRNA as
described herein acts as a pharmacokinetic modulator (PK
modulator). PK modulators include lipophiles, bile acids, steroids,
phospholipid analogues, peptides, protein binding agents, PEG,
vitamins etc. Exemplary PK modulators include, but are not limited
to, cholesterol, fatty acids, cholic acid, lithocholic acid,
dialkylglycerides, diacylglyceride, phospholipids, sphingolipids,
naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that
comprise a number of phosphorothioate linkages are also known to
bind to serum protein, thus short oligonucleotides, e.g.,
oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases,
comprising multiple of phosphorothioate linkages in the backbone
are also amenable to the present invention as ligands (e.g. as PK
modulating ligands). In addition, aptamers that bind serum
components (e.g. serum proteins) are also suitable for use as PK
modulating ligands in the embodiments described herein.
[0341] Ligand-conjugated oligonucleotides of the invention may be
synthesized by the use of an oligonucleotide that bears a pendant
reactive functionality, such as that derived from the attachment of
a linking molecule onto the oligonucleotide (described below). This
reactive oligonucleotide may be reacted directly with
commercially-available ligands, ligands that are synthesized
bearing any of a variety of protecting groups, or ligands that have
a linking moiety attached thereto.
[0342] The oligonucleotides used in the conjugates of the present
invention may be conveniently and routinely made through the
well-known technique of solid-phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is also known to use similar techniques to prepare
other oligonucleotides, such as the phosphorothioates and alkylated
derivatives.
[0343] In the ligand-conjugated oligonucleotides and
ligand-molecule bearing sequence-specific linked nucleosides of the
present invention, the oligonucleotides and oligonucleosides may be
assembled on a suitable DNA synthesizer utilizing standard
nucleotide or nucleoside precursors, or nucleotide or nucleoside
conjugate precursors that already bear the linking moiety,
ligand-nucleotide or nucleoside-conjugate precursors that already
bear the ligand molecule, or non-nucleoside ligand-bearing building
blocks.
[0344] When using nucleotide-conjugate precursors that already bear
a linking moiety, the synthesis of the sequence-specific linked
nucleosides is typically completed, and the ligand molecule is then
reacted with the linking moiety to form the ligand-conjugated
oligonucleotide. In some embodiments, the oligonucleotides or
linked nucleosides of the present invention are synthesized by an
automated synthesizer using phosphoramidites derived from
ligand-nucleoside conjugates in addition to the standard
phosphoramidites and non-standard phosphoramidites that are
commercially available and routinely used in oligonucleotide
synthesis.
[0345] A. Lipid Conjugates
[0346] In one embodiment, the ligand or conjugate is a lipid or
lipid-based molecule. Such a lipid or lipid-based molecule
preferably binds a serum protein, e.g., human serum albumin (HSA).
An HSA binding ligand allows for distribution of the conjugate to a
target tissue, e.g., a non-kidney target tissue of the body. For
example, the target tissue can be the liver, including parenchymal
cells of the liver. Other molecules that can bind HSA can also be
used as ligands. For example, naproxen or aspirin can be used. A
lipid or lipid-based ligand can (a) increase resistance to
degradation of the conjugate, (b) increase targeting or transport
into a target cell or cell membrane, and/or (c) can be used to
adjust binding to a serum protein, e.g., HSA.
[0347] A lipid based ligand can be used to inhibit, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the kidney and therefore less likely
to be cleared from the body. A lipid or lipid-based ligand that
binds to HSA less strongly can be used to target the conjugate to
the kidney.
[0348] In a preferred embodiment, the lipid based ligand binds HSA.
Preferably, it binds HSA with a sufficient affinity such that the
conjugate will be preferably distributed to a non-kidney tissue.
However, it is preferred that the affinity not be so strong that
the HSA-ligand binding cannot be reversed.
[0349] In another preferred embodiment, the lipid based ligand
binds HSA weakly or not at all, such that the conjugate will be
preferably distributed to the kidney. Other moieties that target to
kidney cells can also be used in place of or in addition to the
lipid based ligand.
[0350] In another aspect, the ligand is a moiety, e.g., a vitamin,
which is taken up by a target cell, e.g., a proliferating cell.
These are particularly useful for treating disorders characterized
by unwanted cell proliferation, e.g., of the malignant or
non-malignant type, e.g., cancer cells. Exemplary vitamins include
vitamin A, E, and K. Other exemplary vitamins include are B
vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or
other vitamins or nutrients taken up by target cells such as liver
cells. Also included are HSA and low density lipoprotein (LDL).
[0351] B. Cell Permeation Agents
[0352] In another aspect, the ligand is a cell-permeation agent,
preferably a helical cell-permeation agent. Preferably, the agent
is amphipathic. An exemplary agent is a peptide such as tat or
antennopedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0353] The ligand can be a peptide or peptidomimetic. A
peptidomimetic (also referred to herein as an oligopeptidomimetic)
is a molecule capable of folding into a defined three-dimensional
structure similar to a natural peptide. The attachment of peptide
and peptidomimetics to iRNA agents can affect pharmacokinetic
distribution of the iRNA, such as by enhancing cellular recognition
and absorption. The peptide or peptidomimetic moiety can be about
5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40,
45, or 50 amino acids long.
[0354] A peptide or peptidomimetic can be, for example, a cell
permeation peptide, cationic peptide, amphipathic peptide, or
hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or
Phe). The peptide moiety can be a dendrimer peptide, constrained
peptide or crosslinked peptide. In another alternative, the peptide
moiety can include a hydrophobic membrane translocation sequence
(MTS). An exemplary hydrophobic MTS-containing peptide is RFGF
having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 26). An
RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:
27) containing a hydrophobic MTS can also be a targeting moiety.
The peptide moiety can be a "delivery" peptide, which can carry
large polar molecules including peptides, oligonucleotides, and
protein across cell membranes. For example, sequences from the HIV
Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 28) and the Drosophila
Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 29) have been
found to be capable of functioning as delivery peptides. A peptide
or peptidomimetic can be encoded by a random sequence of DNA, such
as a peptide identified from a phage-display library, or
one-bead-one-compound (OBOC) combinatorial library (Lam et al.,
Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic
tethered to a dsRNA agent via an incorporated monomer unit for cell
targeting purposes is an arginine-glycine-aspartic acid
(RGD)-peptide, or RGD mimic. A peptide moiety can range in length
from about 5 amino acids to about 40 amino acids. The peptide
moieties can have a structural modification, such as to increase
stability or direct conformational properties. Any of the
structural modifications described below can be utilized.
[0355] An RGD peptide for use in the compositions and methods of
the invention may be linear or cyclic, and may be modified, e.g.,
glycosylated or methylated, to facilitate targeting to a specific
tissue(s). RGD-containing peptides and peptidiomimemtics may
include D-amino acids, as well as synthetic RGD mimics. In addition
to RGD, one can use other moieties that target the integrin ligand.
Preferred conjugates of this ligand target PECAM-1 or VEGF.
[0356] A "cell permeation peptide" is capable of permeating a cell,
e.g., a microbial cell, such as a bacterial or fungal cell, or a
mammalian cell, such as a human cell. A microbial cell-permeating
peptide can be, for example, an .alpha.-helical linear peptide
(e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide
(e.g., .alpha.-defensin, .beta.-defensin or bactenecin), or a
peptide containing only one or two dominating amino acids (e.g.,
PR-39 or indolicidin). A cell permeation peptide can also include a
nuclear localization signal (NLS). For example, a cell permeation
peptide can be a bipartite amphipathic peptide, such as MPG, which
is derived from the fusion peptide domain of HIV-1 gp41 and the NLS
of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.
31:2717-2724, 2003).
[0357] C. Carbohydrate Conjugates
[0358] In some embodiments of the compositions and methods of the
invention, an iRNA oligonucleotide further comprises a
carbohydrate. The carbohydrate conjugated iRNA are advantageous for
the in vivo delivery of nucleic acids, as well as compositions
suitable for in vivo therapeutic use, as described herein. As used
herein, "carbohydrate" refers to a compound which is either a
carbohydrate per se made up of one or more monosaccharide units
having at least 6 carbon atoms (which can be linear, branched or
cyclic) with an oxygen, nitrogen or sulfur atom bonded to each
carbon atom; or a compound having as a part thereof a carbohydrate
moiety made up of one or more monosaccharide units each having at
least six carbon atoms (which can be linear, branched or cyclic),
with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
Representative carbohydrates include the sugars (mono-, di-, tri-
and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9
monosaccharide units), and polysaccharides such as starches,
glycogen, cellulose and polysaccharide gums. Specific
monosaccharides include HBV and above (e.g., HBV, C6, C7, or C8)
sugars; di- and trisaccharides include sugars having two or three
monosaccharide units (e.g., HBV, C6, C7, or C8).
[0359] In one embodiment, a carbohydrate conjugate for use in the
compositions and methods of the invention is a monosaccharide. In
another embodiment, a carbohydrate conjugate for use in the
compositions and methods of the invention is selected from the
group consisting of:
##STR00002## ##STR00003## ##STR00004## ##STR00005##
##STR00006##
[0360] In one embodiment, the monosaccharide is an
N-acetylgalactosamine, such as
##STR00007##
[0361] Another representative carbohydrate conjugate for use in the
embodiments described herein includes, but is not limited to,
##STR00008##
when one of X or Y is an oligonucleotide, the other is a
hydrogen.
[0362] In certain embodiments of the invention, the GalNAc or
GalNAc derivative is attached to an iRNA agent of the invention via
a monovalent linker. In some embodiments, the GalNAc or GalNAc
derivative is attached to an iRNA agent of the invention via a
bivalent linker. In yet other embodiments of the invention, the
GalNAc or GalNAc derivative is attached to an iRNA agent of the
invention via a trivalent linker.
[0363] In one embodiment, the double stranded RNAi agents of the
invention comprise one GalNAc or GalNAc derivative attached to the
iRNA agent. In another embodiment, the double stranded RNAi agents
of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6)
GalNAc or GalNAc derivatives, each independently attached to a
plurality of nucleotides of the double stranded RNAi agent through
a plurality of monovalent linkers.
[0364] In some embodiments, for example, when the two strands of an
iRNA agent of the invention are part of one larger molecule
connected by an uninterrupted chain of nucleotides between the
3'-end of one strand and the 5'-end of the respective other strand
forming a hairpin loop comprising, a plurality of unpaired
nucleotides, each unpaired nucleotide within the hairpin loop may
independently comprise a GalNAc or GalNAc derivative attached via a
monovalent linker.
[0365] In some embodiments, the carbohydrate conjugate further
comprises one or more additional ligands as described above, such
as, but not limited to, a PK modulator and/or a cell permeation
peptide.
[0366] Additional carbohydrate conjugates suitable for use in the
present invention include those described in PCT Publication Nos.
WO 2014/179620 and WO 2014/179627, the entire contents of each of
which are incorporated herein by reference.
[0367] D. Linkers
[0368] In some embodiments, the conjugate or ligand described
herein can be attached to an iRNA oligonucleotide with various
linkers that can be cleavable or non-cleavable.
[0369] The term "linker" or "linking group" means an organic moiety
that connects two parts of a compound, e.g., covalently attaches
two parts of a compound. Linkers typically comprise a direct bond
or an atom such as oxygen or sulfur, a unit such as NR8, C(O),
C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but
not limited to, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl,
heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl,
heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl,
heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl,
alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl,
alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl,
alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl,
alkylheteroarylalkenyl, alkylheteroarylalkynyl,
alkenylheteroarylalkyl, alkenylheteroarylalkenyl,
alkenylheteroarylalkynyl, alkynylheteroarylalkyl,
alkynylheteroarylalkenyl, alkynylheteroarylalkynyl,
alkylheterocyclylalkyl, alkylheterocyclylalkenyl,
alkylhererocyclylalkynyl, alkenylheterocyclylalkyl,
alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl,
alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl,
alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl,
alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or
more methylenes can be interrupted or terminated by O, S, S(O),
SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, substituted or
unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic
or substituted aliphatic. In one embodiment, the linker is between
about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18
atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
[0370] A cleavable linking group is one which is sufficiently
stable outside the cell, but which upon entry into a target cell is
cleaved to release the two parts the linker is holding together. In
a preferred embodiment, the cleavable linking group is cleaved at
least about 10 times, 20, times, 30 times, 40 times, 50 times, 60
times, 70 times, 80 times, 90 times or more, or at least about 100
times faster in a target cell or under a first reference condition
(which can, e.g., be selected to mimic or represent intracellular
conditions) than in the blood of a subject, or under a second
reference condition (which can, e.g., be selected to mimic or
represent conditions found in the blood or serum).
[0371] Cleavable linking groups are susceptible to cleavage agents,
e.g., pH, redox potential or the presence of degradative molecules.
Generally, cleavage agents are more prevalent or found at higher
levels or activities inside cells than in serum or blood. Examples
of such degradative agents include: redox agents which are selected
for particular substrates or which have no substrate specificity,
including, e.g., oxidative or reductive enzymes or reductive agents
such as mercaptans, present in cells, that can degrade a redox
cleavable linking group by reduction; esterases; endosomes or
agents that can create an acidic environment, e.g., those that
result in a pH of five or lower; enzymes that can hydrolyze or
degrade an acid cleavable linking group by acting as a general
acid, peptidases (which can be substrate specific), and
phosphatases.
[0372] A cleavable linkage group, such as a disulfide bond can be
susceptible to pH. The pH of human serum is 7.4, while the average
intracellular pH is slightly lower, ranging from about 7.1-7.3.
Endosomes have a more acidic pH, in the range of 5.5-6.0, and
lysosomes have an even more acidic pH at around 5.0. Some linkers
will have a cleavable linking group that is cleaved at a preferred
pH, thereby releasing a cationic lipid from the ligand inside the
cell, or into the desired compartment of the cell.
[0373] A linker can include a cleavable linking group that is
cleavable by a particular enzyme. The type of cleavable linking
group incorporated into a linker can depend on the cell to be
targeted. For example, a liver-targeting ligand can be linked to a
cationic lipid through a linker that includes an ester group. Liver
cells are rich in esterases, and therefore the linker will be
cleaved more efficiently in liver cells than in cell types that are
not esterase-rich. Other cell-types rich in esterases include cells
of the lung, renal cortex, and testis.
[0374] Linkers that contain peptide bonds can be used when
targeting cell types rich in peptidases, such as liver cells and
synoviocytes.
[0375] In general, the suitability of a candidate cleavable linking
group can be evaluated by testing the ability of a degradative
agent (or condition) to cleave the candidate linking group. It will
also be desirable to also test the candidate cleavable linking
group for the ability to resist cleavage in the blood or when in
contact with other non-target tissue. Thus, one can determine the
relative susceptibility to cleavage between a first and a second
condition, where the first is selected to be indicative of cleavage
in a target cell and the second is selected to be indicative of
cleavage in other tissues or biological fluids, e.g., blood or
serum. The evaluations can be carried out in cell free systems, in
cells, in cell culture, in organ or tissue culture, or in whole
animals. It can be useful to make initial evaluations in cell-free
or culture conditions and to confirm by further evaluations in
whole animals. In preferred embodiments, useful candidate compounds
are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80,
90, or about 100 times faster in the cell (or under in vitro
conditions selected to mimic intracellular conditions) as compared
to blood or serum (or under in vitro conditions selected to mimic
extracellular conditions).
[0376] i. Redox Cleavable Linking Groups
[0377] In one embodiment, a cleavable linking group is a redox
cleavable linking group that is cleaved upon reduction or
oxidation. An example of reductively cleavable linking group is a
disulphide linking group (--S--S--). To determine if a candidate
cleavable linking group is a suitable "reductively cleavable
linking group," or for example is suitable for use with a
particular iRNA moiety and particular targeting agent one can look
to methods described herein. For example, a candidate can be
evaluated by incubation with dithiothreitol (DTT), or other
reducing agent using reagents know in the art, which mimic the rate
of cleavage which would be observed in a cell, e.g., a target cell.
The candidates can also be evaluated under conditions which are
selected to mimic blood or serum conditions. In one, candidate
compounds are cleaved by at most about 10% in the blood. In other
embodiments, useful candidate compounds are degraded at least about
2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster
in the cell (or under in vitro conditions selected to mimic
intracellular conditions) as compared to blood (or under in vitro
conditions selected to mimic extracellular conditions). The rate of
cleavage of candidate compounds can be determined using standard
enzyme kinetics assays under conditions chosen to mimic
intracellular media and compared to conditions chosen to mimic
extracellular media.
[0378] ii. Phosphate-Based Cleavable Linking Groups
[0379] In another embodiment, a cleavable linker comprises a
phosphate-based cleavable linking group. A phosphate-based
cleavable linking group is cleaved by agents that degrade or
hydrolyze the phosphate group. An example of an agent that cleaves
phosphate groups in cells are enzymes such as phosphatases in
cells. Examples of phosphate-based linking groups are
--O--P(O)(ORk)-O--, --O--P(S)(ORk)-O--, --O--P(S)(SRk)-O--,
--S--P(O)(ORk)-O--, --O--P(O)(ORk)-S--, --S--P(O)(ORk)-S--,
--O--P(S)(ORk)-S--, --S--P(S)(ORk)-O--, --O--P(O)(Rk)-O--,
--O--P(S)(Rk)-O--, --S--P(O)(Rk)-O--, --S--P(S)(Rk)-O--,
--S--P(O)(Rk)-S--, --O--P(S)(Rk)-S--. Preferred embodiments are
--O--P(O)(OH)--O--, --O--P(S)(OH)--O--, --O--P(S)(SH)--O--,
--S--P(O)(OH)--O--, --O--P(O)(OH)--S--, --S--P(O)(OH)--S--,
--O--P(S)(OH)--S--, --S--P(S)(OH)--O--, --O--P(O)(H)--O--,
--O--P(S)(H)--O--, --S--P(O)(H)--O, --S--P(S)(H)--O--,
--S--P(O)(H)--S--, --O--P(S)(H)--S--. A preferred embodiment is
--O--P(O)(OH)--O--. These candidates can be evaluated using methods
analogous to those described above.
[0380] iii. Acid Cleavable Linking Groups
[0381] In another embodiment, a cleavable linker comprises an acid
cleavable linking group. An acid cleavable linking group is a
linking group that is cleaved under acidic conditions. In preferred
embodiments acid cleavable linking groups are cleaved in an acidic
environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75,
5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can
act as a general acid. In a cell, specific low pH organelles, such
as endosomes and lysosomes can provide a cleaving environment for
acid cleavable linking groups. Examples of acid cleavable linking
groups include but are not limited to hydrazones, esters, and
esters of amino acids. Acid cleavable groups can have the general
formula --C.dbd.NN--, C(O)O, or --OC(O). A preferred embodiment is
when the carbon attached to the oxygen of the ester (the alkoxy
group) is an aryl group, substituted alkyl group, or tertiary alkyl
group such as dimethyl pentyl or t-butyl. These candidates can be
evaluated using methods analogous to those described above.
[0382] iv. Ester-Based Linking Groups
[0383] In another embodiment, a cleavable linker comprises an
ester-based cleavable linking group. An ester-based cleavable
linking group is cleaved by enzymes such as esterases and amidases
in cells. Examples of ester-based cleavable linking groups include
but are not limited to esters of alkylene, alkenylene and
alkynylene groups. Ester cleavable linking groups have the general
formula --C(O)O--, or --OC(O)--. These candidates can be evaluated
using methods analogous to those described above.
[0384] v. Peptide-Based Cleaving Groups
[0385] In yet another embodiment, a cleavable linker comprises a
peptide-based cleavable linking group. A peptide-based cleavable
linking group is cleaved by enzymes such as peptidases and
proteases in cells. Peptide-based cleavable linking groups are
peptide bonds formed between amino acids to yield oligopeptides
(e.g., dipeptides, tripeptides etc.) and polypeptides.
Peptide-based cleavable groups do not include the amide group
(--C(O)NH--). The amide group can be formed between any alkylene,
alkenylene or alkynelene. A peptide bond is a special type of amide
bond formed between amino acids to yield peptides and proteins. The
peptide based cleavage group is generally limited to the peptide
bond (i.e., the amide bond) formed between amino acids yielding
peptides and proteins and does not include the entire amide
functional group. Peptide-based cleavable linking groups have the
general formula-NHCHRAC(O)NHCHRBC(O)--, where RA and RB are the R
groups of the two adjacent amino acids. These candidates can be
evaluated using methods analogous to those described above.
[0386] In one embodiment, an iRNA of the invention is conjugated to
a carbohydrate through a linker. Non-limiting examples of iRNA
carbohydrate conjugates with linkers of the compositions and
methods of the invention include, but are not limited to,
##STR00009## ##STR00010## ##STR00011##
[0387] when one of X or Y is an oligonucleotide, the other is a
hydrogen.
[0388] In certain embodiments of the compositions and methods of
the invention, a ligand is one or more "GalNAc"
(N-acetylgalactosamine) derivatives attached through a bivalent or
trivalent branched linker.
[0389] In one embodiment, a dsRNA of the invention is conjugated to
a bivalent or trivalent branched linker selected from the group of
structures shown in any of formula (XXXII)-(XXXV):
##STR00012## [0390] wherein: [0391] q2A, q2B, q3A, q3B, q4A, q4B,
q5A, q5B and q5C represent independently for each occurrence 0-20
and wherein the repeating unit can be the same or different; [0392]
p.sup.2A, p.sup.2B, p.sup.3A , p.sup.3B, p.sup.4A, p.sup.4B,
p.sup.5A, p.sup.5B, p.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A,
T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each
independently for each occurrence absent, CO, NH, O, S, OC(O),
NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O; [0393] Q.sup.2A,
Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A,
Q.sup.5B, Q.sup.5C, are independently for each occurrence absent,
alkylene, substituted alkylene wherin one or more methylenes can be
interrupted or terminated by one or more of O, S, S(O), SO.sub.2,
N(R.sup.N), C(R').dbd.C(R''), C.ident.C or C(O); [0394] R.sup.2A,
R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A,
R.sup.5B, R.sup.5C are each independently for each occurrence
absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O),
--C(O)--CH(R.sup.a)--NH--, CO, CH.dbd.N--O,
##STR00013##
[0394] heterocyclyl;
[0395] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B,
L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each
independently for each occurrence a monosaccharide (such as
GalNAc), disaccharide, trisaccharide, tetrasaccharide,
oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid
side chain.Trivalent conjugating GalNAc derivatives are
particularly useful for use with RNAi agents for inhibiting the
expression of a target gene, such as those of formula (XXXV):
##STR00014## [0396] wherein L.sup.5A, L.sup.5B and L.sup.5C
represent a monosaccharide, such as GalNAc derivative.
[0397] Examples of suitable bivalent and trivalent branched linker
groups conjugating GalNAc derivatives include, but are not limited
to, the structures recited above as formulas II, VII, XI, X, and
XIII.
[0398] Representative U.S. patents that teach the preparation of
RNA conjugates include, but are not limited to, U.S. Pat. Nos.
4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730;
5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802;
5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046;
4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941;
4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963;
5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469;
5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241,
5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785;
5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726;
5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664;
6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022,
the entire contents of each of which are hereby incorporated herein
by reference.
[0399] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications can be incorporated in a single
compound or even at a single nucleoside within an iRNA. The present
invention also includes iRNA compounds that are chimeric
compounds.
[0400] "Chimeric" iRNA compounds or "chimeras," in the context of
this invention, are iRNA compounds, preferably dsRNAs, which
contain two or more chemically distinct regions, each made up of at
least one monomer unit, i.e., a nucleotide in the case of a dsRNA
compound. These iRNAs typically contain at least one region wherein
the RNA is modified so as to confer upon the iRNA increased
resistance to nuclease degradation, increased cellular uptake,
and/or increased binding affinity for the target nucleic acid. An
additional region of the iRNA can serve as a substrate for enzymes
capable of cleaving RNa:DNA or RNA:RNA hybrids. By way of example,
RNase H is a cellular endonuclease which cleaves the RNa strand of
an RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of iRNA inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter iRNAs when
chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs
hybridizing to the same target region. Cleavage of the RNA target
can be routinely detected by gel electrophoresis and, if necessary,
associated nucleic acid hybridization techniques known in the
art.
[0401] In certain instances, the RNA of an iRNA can be modified by
a non-ligand group. A number of non-ligand molecules have been
conjugated to iRNAs in order to enhance the activity, cellular
distribution or cellular uptake of the iRNA, and procedures for
performing such conjugations are available in the scientific
literature. Such non-ligand moieties have included lipid moieties,
such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm.,
2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem.
Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan
et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic
chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et
al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990,
259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res.,
1990, 18:3777), a polyamine or a polyethylene glycol chain
(Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or
adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995,
36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta,
1995, 1264:229), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277:923). Representative United States
patents that teach the preparation of such RNA conjugates have been
listed above. Typical conjugation protocols involve the synthesis
of an RNAs bearing an aminolinker at one or more positions of the
sequence. The amino group is then reacted with the molecule being
conjugated using appropriate coupling or activating reagents. The
conjugation reaction can be performed either with the RNA still
bound to the solid support or following cleavage of the RNA, in
solution phase. Purification of the RNA conjugate by HPLC typically
affords the pure conjugate.
V. Delivery of an iRNA of the Invention
[0402] The delivery of an iRNA of the invention to a cell e.g., a
cell within a subject, such as a human subject (e.g., a subject in
need thereof, such as a subject having a disease, disorder or
condition associated with contact activation pathway gene
expression) can be achieved in a number of different ways. For
example, delivery may be performed by contacting a cell with an
iRNA of the invention either in vitro or in vivo. In vivo delivery
may also be performed directly by administering a composition
comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in
vivo delivery may be performed indirectly by administering one or
more vectors that encode and direct the expression of the iRNA.
These alternatives are discussed further below.
[0403] In general, any method of delivering a nucleic acid molecule
(in vitro or in vivo) can be adapted for use with an iRNA of the
invention (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell.
Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by
reference in their entireties). For in vivo delivery, factors to
consider in order to deliver an iRNA molecule include, for example,
biological stability of the delivered molecule, prevention of
non-specific effects, and accumulation of the delivered molecule in
the target tissue. The non-specific effects of an iRNA can be
minimized by local administration, for example, by direct injection
or implantation into a tissue or topically administering the
preparation. Local administration to a treatment site maximizes
local concentration of the agent, limits the exposure of the agent
to systemic tissues that can otherwise be harmed by the agent or
that can degrade the agent, and permits a lower total dose of the
iRNA molecule to be administered. Several studies have shown
successful knockdown of gene products when an iRNA is administered
locally. For example, intraocular delivery of a VEGF dsRNA by
intravitreal injection in cynomolgus monkeys (Tolentino, M J., et
al (2004) Retina 24:132-138) and subretinal injections in mice
(Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to
prevent neovascularization in an experimental model of age-related
macular degeneration. In addition, direct intratumoral injection of
a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol.
Ther.11:267-274) and can prolong survival of tumor-bearing mice
(Kim, W J., et al (2006) Mol. Ther. 14:343-350; Li, S., et al
(2007) Mol. Ther. 15:515-523). RNA interference has also shown
success with local delivery to the CNS by direct injection (Dorn,
G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005)
Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18;
Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E
R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275;
Akaneya,Y., et al (2005) J. Neurophysiol. 93:594-602) and to the
lungs by intranasal administration (Howard, K A., et al (2006) Mol.
Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem.
279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For
administering an iRNA systemically for the treatment of a disease,
the RNA can be modified or alternatively delivered using a drug
delivery system; both methods act to prevent the rapid degradation
of the dsRNA by endo- and exo-nucleases in vivo. Modification of
the RNA or the pharmaceutical carrier can also permit targeting of
the iRNA composition to the target tissue and avoid undesirable
off-target effects. iRNA molecules can be modified by chemical
conjugation to lipophilic groups such as cholesterol to enhance
cellular uptake and prevent degradation. For example, an iRNA
directed against ApoB conjugated to a lipophilic cholesterol moiety
was injected systemically into mice and resulted in knockdown of
apoB mRNA in both the liver and jejunum (Soutschek, J., et al
(2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer
has been shown to inhibit tumor growth and mediate tumor regression
in a mouse model of prostate cancer (McNamara, J O., et al (2006)
Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the
iRNA can be delivered using drug delivery systems such as a
nanoparticle, a dendrimer, a polymer, liposomes, or a cationic
delivery system. Positively charged cationic delivery systems
facilitate binding of an iRNA molecule (negatively charged) and
also enhance interactions at the negatively charged cell membrane
to permit efficient uptake of an iRNA by the cell. Cationic lipids,
dendrimers, or polymers can either be bound to an iRNA, or induced
to form a vesicle or micelle (see e.g., Kim SH., et al (2008)
Journal of Controlled Release 129(2):107-116) that encases an iRNA.
The formation of vesicles or micelles further prevents degradation
of the iRNA when administered systemically. Methods for making and
administering cationic-iRNA complexes are well within the abilities
of one skilled in the art (see e.g., Sorensen, D R., et al (2003)
J. Mol. Biol 327:761-766; Verma, U N., et al (2003) Clin. Cancer
Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens.
25:197-205, which are incorporated herein by reference in their
entirety). Some non-limiting examples of drug delivery systems
useful for systemic delivery of iRNAs include DOTAP (Sorensen, D
R., et al (2003), supra; Verma, U N., et al (2003), supra),
Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T
S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et
al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int
J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al
(2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006)
J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S.
(2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A.,
et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999)
Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a
complex with cyclodextrin for systemic administration. Methods for
administration and pharmaceutical compositions of iRNAs and
cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is
herein incorporated by reference in its entirety.
[0404] A. Vector Encoded iRNAs of the Invention
[0405] iRNA targeting a contact activation pathway gene can be
expressed from transcription units inserted into DNA or RNA vectors
(see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A.,
et al., International PCT Publication No. WO 00/22113, Conrad,
International PCT Publication No. WO 00/22114, and Conrad, U.S.
Pat. No. 6,054,299). Expression can be transient (on the order of
hours to weeks) or sustained (weeks to months or longer), depending
upon the specific construct used and the target tissue or cell
type. These transgenes can be introduced as a linear construct, a
circular plasmid, or a viral vector, which can be an integrating or
non-integrating vector. The transgene can also be constructed to
permit it to be inherited as an extrachromosomal plasmid (Gassmann,
et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0406] The individual strand or strands of an iRNA can be
transcribed from a promoter on an expression vector. Where two
separate strands are to be expressed to generate, for example, a
dsRNA, two separate expression vectors can be co-introduced (e.g.,
by transfection or infection) into a target cell. Alternatively
each individual strand of a dsRNA can be transcribed by promoters
both of which are located on the same expression plasmid. In one
embodiment, a dsRNA is expressed as inverted repeat polynucleotides
joined by a linker polynucleotide sequence such that the dsRNA has
a stem and loop structure.
[0407] iRNA expression vectors are generally DNA plasmids or viral
vectors. Expression vectors compatible with eukaryotic cells,
preferably those compatible with vertebrate cells, can be used to
produce recombinant constructs for the expression of an iRNA as
described herein. Eukaryotic cell expression vectors are well known
in the art and are available from a number of commercial sources.
Typically, such vectors are provided containing convenient
restriction sites for insertion of the desired nucleic acid
segment. Delivery of iRNA expressing vectors can be systemic, such
as by intravenous or intramuscular administration, by
administration to target cells ex-planted from the patient followed
by reintroduction into the patient, or by any other means that
allows for introduction into a desired target cell.
[0408] iRNA expression plasmids can be transfected into target
cells as a complex with cationic lipid carriers (e.g.,
Oligofectamine) or non-cationic lipid-based carriers (e.g.,
Transit-TKO.TM.). Multiple lipid transfections for iRNA-mediated
knockdowns targeting different regions of a target RNA over a
period of a week or more are also contemplated by the invention.
Successful introduction of vectors into host cells can be monitored
using various known methods. For example, transient transfection
can be signaled with a reporter, such as a fluorescent marker, such
as Green Fluorescent Protein (GFP). Stable transfection of cells ex
vivo can be ensured using markers that provide the transfected cell
with resistance to specific environmental factors (e.g.,
antibiotics and drugs), such as hygromycin B resistance.
[0409] Viral vector systems which can be utilized with the methods
and compositions described herein include, but are not limited to,
(a) adenovirus vectors; (b) retrovirus vectors, including but not
limited to lentiviral vectors, moloney murine leukemia virus, etc.;
(c) adeno-associated virus vectors; (d) herpes simplex virus
vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g)
papilloma virus vectors; (h) picornavirus vectors; (i) pox virus
vectors such as an orthopox, e.g., vaccinia virus vectors or
avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or
gutless adenovirus. Replication-defective viruses can also be
advantageous. Different vectors will or will not become
incorporated into the cells' genome. The constructs can include
viral sequences for transfection, if desired. Alternatively, the
construct can be incorporated into vectors capable of episomal
replication, e.g. EPV and EBV vectors. Constructs for the
recombinant expression of an iRNA will generally require regulatory
elements, e.g., promoters, enhancers, etc., to ensure the
expression of the iRNA in target cells. Other aspects to consider
for vectors and constructs are further described below.
[0410] Vectors useful for the delivery of an iRNA will include
regulatory elements (promoter, enhancer, etc.) sufficient for
expression of the iRNA in the desired target cell or tissue. The
regulatory elements can be chosen to provide either constitutive or
regulated/inducible expression.
[0411] Expression of the iRNA can be precisely regulated, for
example, by using an inducible regulatory sequence that is
sensitive to certain physiological regulators, e.g., circulating
glucose levels, or hormones (Docherty et al., 1994, FASEB J.
8:20-24). Such inducible expression systems, suitable for the
control of dsRNA expression in cells or in mammals include, for
example, regulation by ecdysone, by estrogen, progesterone,
tetracycline, chemical inducers of dimerization, and
isopropyl-beta-D1-thiogalactopyranoside (IPTG). A person skilled in
the art would be able to choose the appropriate regulatory/promoter
sequence based on the intended use of the iRNA transgene. Viral
vectors that contain nucleic acid sequences encoding an iRNA can be
used. For example, a retroviral vector can be used (see Miller et
al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors
contain the components necessary for the correct packaging of the
viral genome and integration into the host cell DNA. The nucleic
acid sequences encoding an iRNA are cloned into one or more
vectors, which facilitate delivery of the nucleic acid into a
patient. More detail about retroviral vectors can be found, for
example, in Boesen et al., Biotherapy 6:291-302 (1994), which
describes the use of a retroviral vector to deliver the mdr1 gene
to hematopoietic stem cells in order to make the stem cells more
resistant to chemotherapy. Other references illustrating the use of
retroviral vectors in gene therapy are: Clowes et al., J. Clin.
Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114
(1993). Lentiviral vectors contemplated for use include, for
example, the HIV based vectors described in U.S. Pat. Nos.
6,143,520; 5,665,557; and 5,981,276, which are herein incorporated
by reference.
[0412] Adenoviruses are also contemplated for use in delivery of
iRNAs of the invention. Adenoviruses are especially attractive
vehicles, e.g., for delivering genes to respiratory epithelia.
Adenoviruses naturally infect respiratory epithelia where they
cause a mild disease. Other targets for adenovirus-based delivery
systems are liver, the central nervous system, endothelial cells,
and muscle. Adenoviruses have the advantage of being capable of
infecting non-dividing cells. Kozarsky and Wilson, Current Opinion
in Genetics and Development 3:499-503 (1993) present a review of
adenovirus-based gene therapy. Bout et al., Human Gene Therapy
5:3-10 (1994) demonstrated the use of adenovirus vectors to
transfer genes to the respiratory epithelia of rhesus monkeys.
Other instances of the use of adenoviruses in gene therapy can be
found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et
al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest.
91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al.,
Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing
an iRNA featured in the invention, a method for constructing the
recombinant AV vector, and a method for delivering the vector into
target cells, are described in Xia H et al. (2002), Nat. Biotech.
20: 1006-1010.
[0413] Adeno-associated virus (AAV) vectors may also be used to
delivery an iRNA of the invention (Walsh et al., Proc. Soc. Exp.
Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one
embodiment, the iRNA can be expressed as two separate,
complementary single-stranded RNA molecules from a recombinant AAV
vector having, for example, either the U6 or H1 RNA promoters, or
the cytomegalovirus (CMV) promoter. Suitable AAV vectors for
expressing the dsRNA featured in the invention, methods for
constructing the recombinant AV vector, and methods for delivering
the vectors into target cells are described in Samulski R et al.
(1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J.
Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63:
3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941;
International Patent Application No. WO 94/13788; and International
Patent Application No. WO 93/24641, the entire disclosures of which
are herein incorporated by reference.
[0414] Another viral vector suitable for delivery of an iRNA of the
inevtion is a pox virus such as a vaccinia virus, for example an
attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC,
an avipox such as fowl pox or canary pox.
[0415] The tropism of viral vectors can be modified by pseudotyping
the vectors with envelope proteins or other surface antigens from
other viruses, or by substituting different viral capsid proteins,
as appropriate. For example, lentiviral vectors can be pseudotyped
with surface proteins from vesicular stomatitis virus (VSV),
rabies, Ebola, Mokola, and the like. AAV vectors can be made to
target different cells by engineering the vectors to express
different capsid protein serotypes; see, e.g., Rabinowitz J E et
al. (2002), J Virol 76:791-801, the entire disclosure of which is
herein incorporated by reference.
[0416] The pharmaceutical preparation of a vector can include the
vector in an acceptable diluent, or can include a slow release
matrix in which the gene delivery vehicle is imbedded.
Alternatively, where the complete gene delivery vector can be
produced intact from recombinant cells, e.g., retroviral vectors,
the pharmaceutical preparation can include one or more cells which
produce the gene delivery system.
VI. Pharmaceutical Compositions of the Invention
[0417] The present invention also includes pharmaceutical
compositions and formulations which include the iRNAs of the
invention. In one embodiment, provided herein are pharmaceutical
compositions containing an iRNA, as described herein, and a
pharmaceutically acceptable carrier. The pharmaceutical
compositions containing the iRNA are useful for treating a disease
or disorder associated with the expression or activity of a contact
activation pathway gene (i.e., a KLKB1 gene, an F12 gene, and/or a
KNG1 gene). Such pharmaceutical compositions are formulated based
on the mode of delivery. One example is compositions that are
formulated for systemic administration via parenteral delivery,
e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV)
delivery. Another example is compositions that are formulated for
direct delivery into the brain parenchyma, e.g., by infusion into
the brain, such as by continuous pump infusion. The pharmaceutical
compositions of the invention may be administered in dosages
sufficient to inhibit expression of a contact activation pathway
gene.
[0418] Such pharmaceutical compositions are formulated based on the
mode of delivery. One example is compositions that are formulated
for systemic administration via parenteral delivery, e.g., by
intravenous (IV) or for subcutaneous delivery. Another example is
compositions that are formulated for direct delivery into the
liver, e.g., by infusion into the liver, such as by continuous pump
infusion.
[0419] The pharmaceutical compositions of the invention may be
administered in dosages sufficient to inhibit expression of a
contact activation pathway gene. In general, a suitable dose of an
iRNA of the invention will be in the range of about 0.001 to about
200.0 milligrams per kilogram body weight of the recipient per day,
generally in the range of about 1 to 50 mg per kilogram body weight
per day. Typically, a suitable dose of an iRNA of the invention
will be in the range of about 0.1 mg/kg to about 5.0 mg/kg,
preferably about 0.3 mg/kg and about 3.0 mg/kg. A repeat-dose
regimine may include administration of a therapeutic amount of iRNA
on a regular basis, such as every other day or once a year. In
certain embodiments, the iRNA is administered about once per month
to about once per quarter (i.e., about once every three
months).
[0420] After an initial treatment regimen, the treatments can be
administered on a less frequent basis.
[0421] The skilled artisan will appreciate that certain factors can
influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the disease
or disorder, previous treatments, the general health and/or age of
the subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of a composition
can include a single treatment or a series of treatments. Estimates
of effective dosages and in vivo half-lives for the individual
iRNAs encompassed by the invention can be made using conventional
methodologies or on the basis of in vivo testing using an
appropriate animal model, as described elsewhere herein.
[0422] Advances in mouse genetics have generated a number of mouse
models for the study of various human diseases, such as disorders
that would benefit from reduction in the expression of a contact
activation pathway gene.
[0423] The pharmaceutical compositions of the present invention can
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration can be topical (e.g., by a transdermal patch),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal, oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; subdermal,
e.g., via an implanted device; or intracranial, e.g., by
intraparenchymal, intrathecal or intraventricular,
administration.
[0424] The iRNA can be delivered in a manner to target a particular
tissue, such as the liver (e.g., the hepatocytes of the liver).
[0425] Pharmaceutical compositions and formulations for topical
administration can include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids, and powders.
Conventional pharmaceutical carriers, aqueous, powder, or oily
bases, thickeners and the like can be necessary or desirable.
Coated condoms, gloves and the like can also be useful. Suitable
topical formulations include those in which the iRNAs featured in
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents, and surfactants. Suitable lipids and liposomes
include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline), negative (e.g., dimyristoylphosphatidyl glycerol DMPG),
and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the
invention can be encapsulated within liposomes or can form
complexes thereto, in particular to cationic liposomes.
Alternatively, iRNAs can be complexed to lipids, in particular to
cationic lipids. Suitable fatty acids and esters include but are
not limited to arachidonic acid, oleic acid, eicosanoic acid,
lauric acid, caprylic acid, capric acid, myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM),
monoglyceride or diglyceride;
[0426] or pharmaceutically acceptable salt thereof. Topical
formulations are described in detail in U.S. Pat. No. 6,747,014,
which is incorporated herein by reference.
[0427] A. iRNA Formulations Comprising Membranous Molecular
Assemblies
[0428] An iRNA for use in the compositions and methods of the
invention can be formulated for delivery in a membranous molecular
assembly, e.g., a liposome or a micelle. As used herein, the term
"liposome" refers to a vesicle composed of amphiphilic lipids
arranged in at least one bilayer, e.g., one bilayer or a plurality
of bilayers. Liposomes include unilamellar and multilamellar
vesicles that have a membrane formed from a lipophilic material and
an aqueous interior. The aqueous portion contains the iRNA
composition. The lipophilic material isolates the aqueous interior
from an aqueous exterior, which typically does not include the iRNA
composition, although in some examples, it may. Liposomes are
useful for the transfer and delivery of active ingredients to the
site of action. Because the liposomal membrane is structurally
similar to biological membranes, when liposomes are applied to a
tissue, the liposomal bilayer fuses with bilayer of the cellular
membranes. As the merging of the liposome and cell progresses, the
internal aqueous contents that include the iRNA are delivered into
the cell where the iRNA can specifically bind to a target RNA and
can mediate iRNA. In some cases the liposomes are also specifically
targeted, e.g., to direct the iRNA to particular cell types.
[0429] A liposome containing an iRNA agent can be prepared by a
variety of methods. In one example, the lipid component of a
liposome is dissolved in a detergent so that micelles are formed
with the lipid component. For example, the lipid component can be
an amphipathic cationic lipid or lipid conjugate. The detergent can
have a high critical micelle concentration and may be nonionic.
Exemplary detergents include cholate, CHAPS, octylglucoside,
deoxycholate, and lauroyl sarcosine. The iRNA agent preparation is
then added to the micelles that include the lipid component. The
cationic groups on the lipid interact with the iRNA agent and
condense around the iRNA agent to form a liposome. After
condensation, the detergent is removed, e.g., by dialysis, to yield
a liposomal preparation of iRNA agent.
[0430] If necessary a carrier compound that assists in condensation
can be added during the condensation reaction, e.g., by controlled
addition. For example, the carrier compound can be a polymer other
than a nucleic acid (e.g., spermine or spermidine). pH can also
adjusted to favor condensation.
[0431] Methods for producing stable polynucleotide delivery
vehicles, which incorporate a polynucleotide/cationic lipid complex
as structural components of the delivery vehicle, are further
described in, e.g., WO 96/37194, the entire contents of which are
incorporated herein by reference. Liposome formation can also
include one or more aspects of exemplary methods described in
Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417,
1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham, et
al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys.
Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194,
1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et
al. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al.
Endocrinol. 115:757, 1984. Commonly used techniques for preparing
lipid aggregates of appropriate size for use as delivery vehicles
include sonication and freeze-thaw plus extrusion (see, e.g.,
Mayer, et al. Biochim. Biophys. Acta 858:161, 1986).
Microfluidization can be used when consistently small (50 to 200
nm) and relatively uniform aggregates are desired (Mayhew, et al.
Biochim. Biophys. Acta 775:169, 1984). These methods are readily
adapted to packaging iRNA agent preparations into liposomes.
[0432] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged nucleic acid molecules to form a stable complex. The
positively charged nucleic acid/liposome complex binds to the
negatively charged cell surface and is internalized in an endosome.
Due to the acidic pH within the endosome, the liposomes are
ruptured, releasing their contents into the cell cytoplasm (Wang et
al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
[0433] Liposomes which are pH-sensitive or negatively-charged,
entrap nucleic acids rather than complex with it. Since both the
nucleic acid and the lipid are similarly charged, repulsion rather
than complex formation occurs. Nevertheless, some nucleic acid is
entrapped within the aqueous interior of these liposomes.
pH-sensitive liposomes have been used to deliver nucleic acids
encoding the thymidine kinase gene to cell monolayers in culture.
Expression of the exogenous gene was detected in the target cells
(Zhou et al., Journal of Controlled Release, 1992, 19,
269-274).
[0434] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0435] Examples of other methods to introduce liposomes into cells
in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No.
5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, J. Biol.
Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993;
Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143,
1993; and Strauss EMBO J. 11:417, 1992.
[0436] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporine A into different layers
of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4(6) 466).
[0437] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0438] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499
(Lim et al).
[0439] In one embodiment, cationic liposomes are used. Cationic
liposomes possess the advantage of being able to fuse to the cell
membrane. Non-cationic liposomes, although not able to fuse as
efficiently with the plasma membrane, are taken up by macrophages
in vivo and can be used to deliver iRNA agents to macrophages.
[0440] Further advantages of liposomes include: liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated iRNA agents in their
internal compartments from metabolism and degradation (Rosoff, in
"Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.),
1988, volume 1, p. 245). Important considerations in the
preparation of liposome formulations are the lipid surface charge,
vesicle size and the aqueous volume of the liposomes.
[0441] A positively charged synthetic cationic lipid,
N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride
(DOTMA) can be used to form small liposomes that interact
spontaneously with nucleic acid to form lipid-nucleic acid
complexes which are capable of fusing with the negatively charged
lipids of the cell membranes of tissue culture cells, resulting in
delivery of iRNA agent (see, e.g., Felgner, P. L. et al., Proc.
Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355
for a description of DOTMA and its use with DNA).
[0442] A DOTMA analogue,
1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used
in combination with a phospholipid to form DNA-complexing vesicles.
Lipofectin.TM. Bethesda Research Laboratories, Gaithersburg, Md.)
is an effective agent for the delivery of highly anionic nucleic
acids into living tissue culture cells that comprise positively
charged DOTMA liposomes which interact spontaneously with
negatively charged polynucleotides to form complexes. When enough
positively charged liposomes are used, the net charge on the
resulting complexes is also positive. Positively charged complexes
prepared in this way spontaneously attach to negatively charged
cell surfaces, fuse with the plasma membrane, and efficiently
deliver functional nucleic acids into, for example, tissue culture
cells. Another commercially available cationic lipid,
1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP")
(Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in
that the oleoyl moieties are linked by ester, rather than ether
linkages.
[0443] Other reported cationic lipid compounds include those that
have been conjugated to a variety of moieties including, for
example, carboxyspermine which has been conjugated to one of two
types of lipids and includes compounds such as
5-carboxyspermylglycine dioctaoleoylamide ("DOGS")
(Transfectam.TM., Promega, Madison, Wis.) and
dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide
("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).
[0444] Another cationic lipid conjugate includes derivatization of
the lipid with cholesterol ("DC-Chol") which has been formulated
into liposomes in combination with DOPE (See, Gao, X. and Huang,
L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine,
made by conjugating polylysine to DOPE, has been reported to be
effective for transfection in the presence of serum (Zhou, X. et
al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines,
these liposomes containing conjugated cationic lipids, are said to
exhibit lower toxicity and provide more efficient transfection than
the DOTMA-containing compositions. Other commercially available
cationic lipid products include DMRIE and DMRIE-HP (Vical, La
Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc.,
Gaithersburg, Md.). Other cationic lipids suitable for the delivery
of oligonucleotides are described in WO 98/39359 and WO
96/37194.
[0445] Liposomal formulations are particularly suited for topical
administration, liposomes present several advantages over other
formulations. Such advantages include reduced side effects related
to high systemic absorption of the administered drug, increased
accumulation of the administered drug at the desired target, and
the ability to administer iRNA agent into the skin. In some
implementations, liposomes are used for delivering iRNA agent to
epidermal cells and also to enhance the penetration of iRNA agent
into dermal tissues, e.g., into skin. For example, the liposomes
can be applied topically. Topical delivery of drugs formulated as
liposomes to the skin has been documented (see, e.g., Weiner et
al., Journal of Drug Targeting, 1992, vol. 2,405-410 and du Plessis
et al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and
Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al.
Gene 56:267-276. 1987; Nicolau, C. et al. Meth. Enz. 149:157-176,
1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz.
101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad.
Sci. USA 84:7851-7855, 1987).
[0446] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome I (glyceryl
dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and
Novasome II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver a drug into the dermis of mouse skin. Such formulations
with iRNA agent are useful for treating a dermatological
disorder.
[0447] Liposomes that include iRNA can be made highly deformable.
Such deformability can enable the liposomes to penetrate through
pore that are smaller than the average radius of the liposome. For
example, transfersomes are a type of deformable liposomes.
Transferosomes can be made by adding surface edge activators,
usually surfactants, to a standard liposomal composition.
Transfersomes that include iRNA agent can be delivered, for
example, subcutaneously by infection in order to deliver iRNA agent
to keratinocytes in the skin. In order to cross intact mammalian
skin, lipid vesicles must pass through a series of fine pores, each
with a diameter less than 50 nm, under the influence of a suitable
transdermal gradient. In addition, due to the lipid properties,
these transferosomes can be self-optimizing (adaptive to the shape
of pores, e.g., in the skin), self-repairing, and can frequently
reach their targets without fragmenting, and often
self-loading.
[0448] Other formulations amenable to the present invention are
described in U.S. provisional application Ser. Nos. 61/018,616,
filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748,
filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and
61/051,528, filed May 8, 2008. PCT application no
PCT/US2007/080331, filed Oct. 3, 2007 also describes formulations
that are amenable to the present invention.
[0449] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes can be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g., they are self-optimizing (adaptive to the shape of
pores in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0450] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in "Pharmaceutical Dosage Forms", Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0451] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0452] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0453] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0454] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0455] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in "Pharmaceutical Dosage
Forms", Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0456] The iRNA for use in the methods of the invention can also be
provided as micellar formulations. "Micelles" are defined herein as
a particular type of molecular assembly in which amphipathic
molecules are arranged in a spherical structure such that all the
hydrophobic portions of the molecules are directed inward, leaving
the hydrophilic portions in contact with the surrounding aqueous
phase. The converse arrangement exists if the environment is
hydrophobic.
[0457] A mixed micellar formulation suitable for delivery through
transdermal membranes may be prepared by mixing an aqueous solution
of the siRNA composition, an alkali metal C.sub.8 to C.sub.22 alkyl
sulphate, and a micelle forming compounds. Exemplary micelle
forming compounds include lecithin, hyaluronic acid,
pharmaceutically acceptable salts of hyaluronic acid, glycolic
acid, lactic acid, chamomile extract, cucumber extract, oleic acid,
linoleic acid, linolenic acid, monoolein, monooleates,
monolaurates, borage oil, evening of primrose oil, menthol,
trihydroxy oxo cholanyl glycine and pharmaceutically acceptable
salts thereof, glycerin, polyglycerin, lysine, polylysine,
triolein, polyoxyethylene ethers and analogues thereof, polidocanol
alkyl ethers and analogues thereof, chenodeoxycholate,
deoxycholate, and mixtures thereof. The micelle forming compounds
may be added at the same time or after addition of the alkali metal
alkyl sulphate. Mixed micelles will form with substantially any
kind of mixing of the ingredients but vigorous mixing in order to
provide smaller size micelles.
[0458] In one method a first micellar composition is prepared which
contains the siRNA composition and at least the alkali metal alkyl
sulphate. The first micellar composition is then mixed with at
least three micelle forming compounds to form a mixed micellar
composition. In another method, the micellar composition is
prepared by mixing the siRNA composition, the alkali metal alkyl
sulphate and at least one of the micelle forming compounds,
followed by addition of the remaining micelle forming compounds,
with vigorous mixing.
[0459] Phenol and/or m-cresol may be added to the mixed micellar
composition to stabilize the formulation and protect against
bacterial growth. Alternatively, phenol and/or m-cresol may be
added with the micelle forming ingredients. An isotonic agent such
as glycerin may also be added after formation of the mixed micellar
composition.
[0460] For delivery of the micellar formulation as a spray, the
formulation can be put into an aerosol dispenser and the dispenser
is charged with a propellant. The propellant, which is under
pressure, is in liquid form in the dispenser. The ratios of the
ingredients are adjusted so that the aqueous and propellant phases
become one, i.e., there is one phase. If there are two phases, it
is necessary to shake the dispenser prior to dispensing a portion
of the contents, e.g., through a metered valve. The dispensed dose
of pharmaceutical agent is propelled from the metered valve in a
fine spray.
[0461] Propellants may include hydrogen-containing
chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl
ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2
tetrafluoroethane) may be used.
[0462] The specific concentrations of the essential ingredients can
be determined by relatively straightforward experimentation. For
absorption through the oral cavities, it is often desirable to
increase, e.g., at least double or triple, the dosage for through
injection or administration through the gastrointestinal tract.
[0463] B. Lipid Particles
[0464] iRNAs, e.g., dsRNAs of in the invention may be fully
encapsulated in a lipid formulation, e.g., a LNP, or other nucleic
acid-lipid particle.
[0465] As used herein, the term "LNP" refers to a stable nucleic
acid-lipid particle. LNPs typically contain a cationic lipid, a
non-cationic lipid, and a lipid that prevents aggregation of the
particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful
for systemic applications, as they exhibit extended circulation
lifetimes following intravenous (i.v.) injection and accumulate at
distal sites (e.g., sites physically separated from the
administration site). LNPs include "pSPLP," which include an
encapsulated condensing agent-nucleic acid complex as set forth in
PCT Publication No. WO 00/03683. The particles of the present
invention typically have a mean diameter of about 50 nm to about
150 nm, more typically about 60 nm to about 130 nm, more typically
about 70 nm to about 110 nm, most typically about 70 nm to about 90
nm, and are substantially nontoxic. In addition, the nucleic acids
when present in the nucleic acid-lipid particles of the present
invention are resistant in aqueous solution to degradation with a
nuclease. Nucleic acid-lipid particles and their method of
preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567;
5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No.
2010/0324120 and PCT Publication No. WO 96/40964.
[0466] In one embodiment, the lipid to drug ratio (mass/mass ratio)
(e.g., lipid to dsRNA ratio) will be in the range of from about 1:1
to about 50:1, from about 1:1 to about 25:1, from about 3:1 to
about 15:1, from about 4:1 to about 10:1, from about 5:1 to about
9:1, or about 6:1 to about 9:1. Ranges intermediate to the above
recited ranges are also contemplated to be part of the
invention.
[0467] The cationic lipid can be, for example,
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),
1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP),
1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (Dlin-DAC),
1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA),
1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDaP),
1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA),
1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP),
1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt
(DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride
salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane
(DLin-MPz), or 3-(N,N-Dilinoleylamino)-1,2-propanediol(DLinAP),
3-(N,N-Dioleylamino)-1,2-propanedio (DOAP),
1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane
(DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane
(DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane
(DLin-K-DMA) or analogs thereof,
(3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-
-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu-
tanoate (MC3),
1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami-
no)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or
a mixture thereof. The cationic lipid can comprise from about 20
mol % to about 50 mol % or about 40 mol % of the total lipid
present in the particle.
[0468] In another embodiment, the compound
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to
prepare lipid-siRNA nanoparticles. Synthesis of
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in
U.S. provisional patent application No. 61/107,998 filed on Oct.
23, 2008, which is herein incorporated by reference.
[0469] In one embodiment, the lipid-siRNA particle includes 40% 2,
2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40%
Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of
63.0.+-.20 nm and a 0.027 siRNA/Lipid Ratio.
[0470] The ionizable/non-cationic lipid can be an anionic lipid or
a neutral lipid including, but not limited to,
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol(DOPG), dipalmitoylphosphatidylglycerol
(DPPG), dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoylphosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or
a mixture thereof. The non-cationic lipid can be from about 5 mol %
to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol
is included, of the total lipid present in the particle.
[0471] The conjugated lipid that inhibits aggregation of particles
can be, for example, a polyethyleneglycol (PEG)-lipid including,
without limitation, a PEG-diacylglycerol (DAG), a
PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide
(Cer), or a mixture thereof. The PEG-DAA conjugate can be, for
example, a PEG-dilauryloxypropyl (Ci.sub.2), a
PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl
(Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated
lipid that prevents aggregation of particles can be from 0 mol % to
about 20 mol % or about 2 mol % of the total lipid present in the
particle.
[0472] In some embodiments, the nucleic acid-lipid particle further
includes cholesterol at, e.g., about 10 mol % to about 60 mol % or
about 48 mol % of the total lipid present in the particle.
[0473] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (see
U.S. Patent Application Ser. No. 12/056,230, filed Mar. 26, 2008,
which is incorporated herein by reference), Cholesterol
(Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be
used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles).
Stock solutions of each in ethanol can be prepared as follows:
ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100
mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions
can then be combined in a, e.g., 42:48:10 molar ratio. The combined
lipid solution can be mixed with aqueous dsRNA (e.g., in sodium
acetate pH 5) such that the final ethanol concentration is about
35-45% and the final sodium acetate concentration is about 100-300
mM. Lipid-dsRNA nanoparticles typically form spontaneously upon
mixing. Depending on the desired particle size distribution, the
resultant nanoparticle mixture can be extruded through a
polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a
thermobarrel extruder, such as Lipex Extruder (Northern Lipids,
Inc). In some cases, the extrusion step can be omitted. Ethanol
removal and simultaneous buffer exchange can be accomplished by,
for example, dialysis or tangential flow filtration. Buffer can be
exchanged with, for example, phosphate buffered saline (PBS) at
about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about
pH 7.2, about pH 7.3, or about pH 7.4.
##STR00015##
[0474] LNP01 formulations are described, e.g., in International
Application Publication No. WO 2008/042973, which is hereby
incorporated by reference.
[0475] Additional exemplary lipid-dsRNA formulations are described
in Table 1.
TABLE-US-00001 TABLE 1 cationic lipid/non-cationic
lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid
Lipid:siRNA ratio SNALP-1 1,2-Dilinolenyloxy-N,N-
DLinDMA/DPPC/Cholesterol/PEG- dimethylaminopropane (DLinDMA) cDMA
(57.1/7.1/34.4/1.4) lipid:siRNA ~7:1 2-XTC
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DPPC/Cholesterol/PEG-cDMA
[1,3]-dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid:siRNA ~7:1 LNP05
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~6:1 LNP06
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~11:1 LNP07
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~6:1 LNP08
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~11:1 LNP09
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 50/10/38.5/1.5 Lipid: siRNA 10:1 LNP10
(3aR,5s,6aS)-N,N-dimethyl-2,2- ALN100/DSPC/Cholesterol/PEG-DMG
di((9Z,12Z)-octadeca-9,12- 50/10/38.5/1.5 dienyl)tetrahydro-3aH-
Lipid:siRNA 10:1 cyclopenta[d][1,3]dioxol-5-amine (ALN100) LNP11
(6Z,9Z,28Z,31Z)-heptatriaconta- MC-3/DSPC/Cholesterol/PEG-DMG
6,9,28,31-tetraen-19-yl 4- 50/10/38.5/1.5 (dimethylamino)butanoate
(MC3) Lipid:siRNA 10:1 LNP12 1,1'-(2-(4-(2-((2-(bis(2- Tech
G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl)(2-
50/10/38.5/1.5 hydroxydodecyl)amino)ethyl)piperazin- Lipid:siRNA
10:1 1-yl)ethylazanediyl)didodecan-2-ol (Tech G1) LNP13 XTC
XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 LNP14 MC3
MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA: 11:1 LNP15 MC3
MC3/DSPC/Chol/PEG-DSG/GalNAc- PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA:
11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA:
7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:
10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA:
12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA: 8:1
LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1
LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:
7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:
10:1 DSPC: distearoylphosphatidylcholine DPPC:
dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol
(C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) PEG-DSG:
PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of
2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG
with avg mol wt of 2000) SNALP
(1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising
formulations are described in International Publication No.
WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by
reference.
[0476] XTC comprising formulations are described, e.g., in U.S.
Provisional Ser. No. 61/148,366, filed Jan. 29, 2009; U.S.
Provisional Ser. No. 61/156,851, filed Mar. 2, 2009; U.S.
Provisional Serial No. filed Jun. 10, 2009; U.S. Provisional Ser.
No. 61/228,373, filed Jul. 24, 2009; U.S. Provisional Ser. No.
61/239,686, filed Sep. 3, 2009, and International Application No.
PCT/US2010/022614, filed Jan. 29, 2010, which are hereby
incorporated by reference.
[0477] MC3 comprising formulations are described, e.g., in U.S.
Publication No. 2010/0324120, filed Jun. 10, 2010, the entire
contents of which are hereby incorporated by reference.
[0478] ALNY-100 comprising formulations are described, e.g.,
International patent application number PCT/US09/63933, filed on
Nov. 10, 2009, which is hereby incorporated by reference.
[0479] C12-200 comprising formulations are described in U.S.
Provisional Ser. No. 61/175,770, filed May 5, 2009 and
International Application No. PCT/US10/33777, filed May 5, 2010,
which are hereby incorporated by reference.
[0480] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
can be desirable. In some embodiments, oral formulations are those
in which dsRNAs featured in the invention are administered in
conjunction with one or more penetration enhancer surfactants and
chelators. Suitable surfactants include fatty acids and/or esters
or salts thereof, bile acids and/or salts thereof. Suitable bile
acids/salts include chenodeoxycholic acid (CDCA) and
ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic
acid, deoxycholic acid, glucholic acid, glycholic acid,
glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid,
sodium tauro-24,25-dihydro-fusidate and sodium
glycodihydrofusidate. Suitable fatty acids include arachidonic
acid, undecanoic acid, oleic acid, lauric acid, caprylic acid,
capric acid, myristic acid, palmitic acid, stearic acid, linoleic
acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin,
glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an
acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or
a pharmaceutically acceptable salt thereof (e.g., sodium). In some
embodiments, combinations of penetration enhancers are used, for
example, fatty acids/salts in combination with bile acids/salts.
One exemplary combination is the sodium salt of lauric acid, capric
acid and UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
DsRNAs featured in the invention can be delivered orally, in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. DsRNA complexing agents include
poly-amino acids; polyimines; polyacrylates; polyalkylacrylates,
polyoxethanes, polyalkylcyanoacrylates; cationized gelatins,
albumins, starches, acrylates, polyethyleneglycols (PEG) and
starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines,
pollulans, celluloses and starches. Suitable complexing agents
include chitosan, N-trimethylchitosan, poly-L-lysine,
polyhistidine, polyornithine, polyspermines, protamine,
polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE),
polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate),
poly(ethylcyanoacrylate), poly(butylcyanoacrylate),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate),
DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide,
DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for dsRNAs and their
preparation are described in detail in U.S. Pat. No. 6,887,906, US
Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which
is incorporated herein by reference.
[0481] Compositions and formulations for parenteral,
intraparenchymal (into the brain), intrathecal, intraventricular or
intrahepatic administration can include sterile aqueous solutions
which can also contain buffers, diluents and other suitable
additives such as, but not limited to, penetration enhancers,
carrier compounds and other pharmaceutically acceptable carriers or
excipients.
[0482] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions can be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids. Particularly preferred are
formulations that target the liver when treating hepatic disorders
such as hepatic carcinoma.
[0483] The pharmaceutical formulations of the present invention,
which can conveniently be presented in unit dosage form, can be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0484] The compositions of the present invention can be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention can also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions can further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension can also contain stabilizers.
[0485] C. Additional Formulations
[0486] i. Emulsions
[0487] The compositions of the present invention can be prepared
and formulated as emulsions. Emulsions are typically heterogeneous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335;
Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising two immiscible liquid phases intimately
mixed and dispersed with each other. In general, emulsions can be
of either the water-in-oil (w/o) or the oil-in-water (o/w) variety.
When an aqueous phase is finely divided into and dispersed as
minute droplets into a bulk oily phase, the resulting composition
is called a water-in-oil (w/o) emulsion. Alternatively, when an
oily phase is finely divided into and dispersed as minute droplets
into a bulk aqueous phase, the resulting composition is called an
oil-in-water (o/w) emulsion. Emulsions can contain additional
components in addition to the dispersed phases, and the active drug
which can be present as a solution in either the aqueous phase,
oily phase or itself as a separate phase. Pharmaceutical excipients
such as emulsifiers, stabilizers, dyes, and anti-oxidants can also
be present in emulsions as needed. Pharmaceutical emulsions can
also be multiple emulsions that are comprised of more than two
phases such as, for example, in the case of oil-in-water-in-oil
(o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex
formulations often provide certain advantages that simple binary
emulsions do not. Multiple emulsions in which individual oil
droplets of an o/w emulsion enclose small water droplets constitute
a w/o/w emulsion. Likewise a system of oil droplets enclosed in
globules of water stabilized in an oily continuous phase provides
an o/w/o emulsion.
[0488] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
can be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that can be incorporated into either
phase of the emulsion. Emulsifiers can broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0489] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker,
Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are
typically amphiphilic and comprise a hydrophilic and a hydrophobic
portion. The ratio of the hydrophilic to the hydrophobic nature of
the surfactant has been termed the hydrophile/lipophile balance
(HLB) and is a valuable tool in categorizing and selecting
surfactants in the preparation of formulations. Surfactants can be
classified into different classes based on the nature of the
hydrophilic group: nonionic, anionic, cationic and amphoteric (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
285).
[0490] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0491] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0492] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0493] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that can
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used can be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0494] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (see e.g., Ansel's Pharmaceutical
Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G.,
and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.),
New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 199). Emulsion formulations for oral delivery
have been very widely used because of ease of formulation, as well
as efficacy from an absorption and bioavailability standpoint (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.;
Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins
and high fat nutritive preparations are among the materials that
have commonly been administered orally as o/w emulsions.
[0495] ii. Microemulsions
[0496] In one embodiment of the present invention, the compositions
of iRNAs and nucleic acids are formulated as microemulsions. A
microemulsion can be defined as a system of water, oil and
amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions
are systems that are prepared by first dispersing an oil in an
aqueous surfactant solution and then adding a sufficient amount of
a fourth component, generally an intermediate chain-length alcohol
to form a transparent system. Therefore, microemulsions have also
been described as thermodynamically stable, isotropically clear
dispersions of two immiscible liquids that are stabilized by
interfacial films of surface-active molecules (Leung and Shah, in:
Controlled Release of Drugs: Polymers and Aggregate Systems,
Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215).
Microemulsions commonly are prepared via a combination of three to
five components that include oil, water, surfactant, cosurfactant
and electrolyte. Whether the microemulsion is of the water-in-oil
(w/o) or an oil-in-water (o/w) type is dependent on the properties
of the oil and surfactant used and on the structure and geometric
packing of the polar heads and hydrocarbon tails of the surfactant
molecules (Schott, in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 271).
[0497] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.;
Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0498] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions can, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase can typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase can include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0499] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802;
7,157,099; Constantinides et al., Pharmaceutical Research, 1994,
11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993,
13, 205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (see e.g., U.S.
Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099;
Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho
et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions
can form spontaneously when their components are brought together
at ambient temperature. This can be particularly advantageous when
formulating thermolabile drugs, peptides or iRNAs. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of iRNAs and nucleic acids from the gastrointestinal
tract, as well as improve the local cellular uptake of iRNAs and
nucleic acids.
[0500] Microemulsions of the present invention can also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
iRNAs and nucleic acids of the present invention. Penetration
enhancers used in the microemulsions of the present invention can
be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0501] iii. Microparticles
[0502] An iRNA agent of the invention may be incorporated into a
particle, e.g., a microparticle. Microparticles can be produced by
spray-drying, but may also be produced by other methods including
lyophilization, evaporation, fluid bed drying, vacuum drying, or a
combination of these techniques.
[0503] iv. Penetration Enhancers
[0504] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly iRNAs, to the skin of animals. Most drugs are
present in solution in both ionized and nonionized forms. However,
usually only lipid soluble or lipophilic drugs readily cross cell
membranes. It has been discovered that even non-lipophilic drugs
can cross cell membranes if the membrane to be crossed is treated
with a penetration enhancer. In addition to aiding the diffusion of
non-lipophilic drugs across cell membranes, penetration enhancers
also enhance the permeability of lipophilic drugs.
[0505] Penetration enhancers can be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (see
e.g., Malmsten, M. Surfactants and polymers in drug delivery,
Informa Health Care, New York, N.Y., 2002; Lee et al., Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of
the above mentioned classes of penetration enhancers are described
below in greater detail.
[0506] Surfactants (or "surface-active agents") are chemical
entities which, when dissolved in an aqueous solution, reduce the
surface tension of the solution or the interfacial tension between
the aqueous solution and another liquid, with the result that
absorption of iRNAs through the mucosa is enhanced. In addition to
bile salts and fatty acids, these penetration enhancers include,
for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether
and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M.
Surfactants and polymers in drug delivery, Informa Health Care, New
York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug
Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such
as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40,
252).
[0507] Various fatty acids and their derivatives which act as
penetration enhancers include, for example, oleic acid, lauric
acid, capric acid (n-decanoic acid), myristic acid, palmitic acid,
stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid,
arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-20
alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and
mono- and di-glycerides thereof (i.e., oleate, laurate, caprate,
myristate, palmitate, stearate, linoleate, etc.) (see e.g.,
Touitou, E., et al. Enhancement in Drug Delivery, CRC Press,
Danvers, M A, 2006; Lee et al., Critical Reviews in Therapeutic
Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in
Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al.,
J. Pharm. Pharmacol., 1992, 44, 651-654).
[0508] The physiological role of bile includes the facilitation of
dispersion and absorption of lipids and fat-soluble vitamins (see
e.g., Malmsten, M. Surfactants and polymers in drug delivery,
Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in:
Goodman & Gilman's The Pharmacological Basis of Therapeutics,
9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp.
934-935). Various natural bile salts, and their synthetic
derivatives, act as penetration enhancers. Thus the term "bile
salts" includes any of the naturally occurring components of bile
as well as any of their synthetic derivatives. Suitable bile salts
include, for example, cholic acid (or its pharmaceutically
acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium
dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic
acid (sodium glucholate), glycholic acid (sodium glycocholate),
glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid
(sodium taurocholate), taurodeoxycholic acid (sodium
taurodeoxycholate), chenodeoxycholic acid (sodium
chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium
tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate
and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M.
Surfactants and polymers in drug delivery, Informa Health Care, New
York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug
Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In:
Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack
Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7,
1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25;
Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
[0509] Chelating agents, as used in connection with the present
invention, can be defined as compounds that remove metallic ions
from solution by forming complexes therewith, with the result that
absorption of iRNAs through the mucosa is enhanced. With regards to
their use as penetration enhancers in the present invention,
chelating agents have the added advantage of also serving as DNase
inhibitors, as most characterized DNA nucleases require a divalent
metal ion for catalysis and are thus inhibited by chelating agents
(Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating
agents include but are not limited to disodium
ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g.,
sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl
derivatives of collagen, laureth-9 and N-amino acyl derivatives of
beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient
development for pharmaceutical, biotechnology, and drug delivery,
CRC Press, Danvers, M A, 2006; Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7,
1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).
[0510] As used herein, non-chelating non-surfactant penetration
enhancing compounds can be defined as compounds that demonstrate
insignificant activity as chelating agents or as surfactants but
that nonetheless enhance absorption of iRNAs through the alimentary
mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1-33). This class of penetration
enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl-
and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and
non-steroidal anti-inflammatory agents such as diclofenac sodium,
indomethacin and phenylbutazone (Yamashita et al., J. Pharm.
Pharmacol., 1987, 39, 621-626).
[0511] Agents that enhance uptake of iRNAs at the cellular level
can also be added to the pharmaceutical and other compositions of
the present invention. For example, cationic lipids, such as
lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic
glycerol derivatives, and polycationic molecules, such as
polylysine (Lollo et al., PCT Application WO 97/30731), are also
known to enhance the cellular uptake of dsRNAs. Examples of
commercially available transfection reagents include, for example
Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), Lipofectamine
2000.TM. (Invitrogen; Carlsbad, Calif.), 293fectin.TM. (Invitrogen;
Carlsbad, Calif.), Cellfectin.TM. (Invitrogen; Carlsbad, Calif.),
DMRIE-C.TM. (Invitrogen; Carlsbad, Calif.), FreeStyle.TM. MAX
(Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. 2000 CD
(Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. (Invitrogen;
Carlsbad, Calif.), iRNAMAX (Invitrogen; Carlsbad, Calif.),
Oligofectamine.TM. (Invitrogen; Carlsbad, Calif.), Optifect.TM.
(Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent
(Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal
Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER
Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or
Fugene (Grenzacherstrasse, Switzerland), Transfectam.RTM. Reagent
(Promega; Madison, Wis.), TransFast.TM. Transfection Reagent
(Promega; Madison, Wis.), Tfx.TM.-20 Reagent (Promega; Madison,
Wis.), Tfx.TM.-50 Reagent (Promega; Madison, Wis.), DreamFect.TM.
(OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences;
Marseille, France), TransPass.sup.a D1 Transfection Reagent (New
England Biolabs; Ipswich, Mass., USA), LyoVec.TM./LipoGen.TM.
(Invitrogen; San Diego, Calif., USA), PerFectin Transfection
Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER
Transfection Reagent (Genlantis; San Diego, Calif., USA),
GenePORTER Transfection reagent (Genlantis; San Diego, Calif.,
USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego,
Calif., USA), Cytofectin Transfection Reagent (Genlantis; San
Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis;
San Diego, Calif., USA), TroganPORTER.TM. transfection Reagent
(Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton,
Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR
(B-Bridge International; Mountain View, Calif., USA), SureFECTOR
(B-Bridge International; Mountain View, Calif., USA), or HiFect.TM.
(B-Bridge International, Mountain View, Calif., USA), among
others.
[0512] Other agents can be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
[0513] v. Carriers
[0514] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate dsRNA in hepatic tissue can be reduced
when it is coadministered with polyinosinic acid, dextran sulfate,
polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA
& Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0515] vi. Excipients
[0516] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
can be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc).
[0517] Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0518] Formulations for topical administration of nucleic acids can
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions can also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0519] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0520] vii. Other Components
[0521] The compositions of the present invention can additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions can contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or can contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0522] Aqueous suspensions can contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension can
also contain stabilizers.
[0523] In some embodiments, pharmaceutical compositions featured in
the invention include (a) one or more iRNA compounds and (b) one or
more agents which function by a non-iRNA mechanism and which are
useful in treating a hemolytic disorder. Examples of such agents
include, but are not limited to an anti-inflammatory agent,
anti-steatosis agent, anti-viral, and/or anti-fibrosis agent.
[0524] In addition, other substances commonly used to protect the
liver, such as silymarin, can also be used in conjunction with the
iRNAs described herein. Other agents useful for treating liver
diseases include telbivudine, entecavir, and protease inhibitors
such as telaprevir and other disclosed, for example, in Tung et
al., U.S. Application Publication Nos. 2005/0148548, 2004/0167116,
and 2003/0144217; and in Hale et al., U.S. Application Publication
No. 2004/0127488.
[0525] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Compounds that exhibit
high therapeutic indices are preferred.
[0526] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of compositions featured herein in the invention
lies generally within a range of circulating concentrations that
include the ED50 with little or no toxicity. The dosage can vary
within this range depending upon the dosage form employed and the
route of administration utilized. For any compound used in the
methods featured in the invention, the therapeutically effective
dose can be estimated initially from cell culture assays. A dose
can be formulated in animal models to achieve a circulating plasma
concentration range of the compound or, when appropriate, of the
polypeptide product of a target sequence (e.g., achieving a
decreased concentration of the polypeptide) that includes the IC50
(i.e., the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma can be measured, for example, by
high performance liquid chromatography.
[0527] In addition to their administration, as discussed above, the
iRNAs featured in the invention can be administered in combination
with other known agents effective in treatment of pathological
processes mediated by contact activation pathway gene expression
(i.e., KLKB1 gene expression, F12 gene expression, and/or KNG1 gene
expression). In any event, the administering physician can adjust
the amount and timing of iRNA administration on the basis of
results observed using standard measures of efficacy known in the
art or described herein.
VII. Methods For Inhibiting Contact Activation Pathway Gene
Expression
[0528] The present invention also provides methods of inhibiting
expression of a contact activation pathway gene (i.e., a KLKB1 gene
, an F12 gene , and/or a KNG1 gene) in a cell.
[0529] In one embodiment, the invention provides methods for
inhibiting expression of a KLKB1 gene in a cell. The methods
include contacting a cell with an RNAi agent, e.g., double stranded
RNAi agent, in an amount effective to inhibit expression of KLKB1
in the cell, thereby inhibiting expression of KLKB1 in the
cell.
[0530] In one embodiment, the invention provides methods for
inhibiting expression of an F12 gene in a cell. The methods include
contacting a cell with an RNAi agent, e.g., double stranded RNAi
agent, in an amount effective to inhibit expression of F12 in the
cell, thereby inhibiting expression of F12 in the cell.
[0531] In one embodiment, the invention provides methods for
inhibiting expression of a KNG1 gene in a cell. The methods include
contacting a cell with an RNAi agent, e.g., double stranded RNAi
agent, in an amount effective to inhibit expression of KNG1 in the
cell, thereby inhibiting expression of KNG1 in the cell.
[0532] Contacting of a cell with an RNAi agent, e.g., a double
stranded RNAi agent, may be done in vitro or in vivo. Contacting a
cell in vivo with the RNAi agent includes contacting a cell or
group of cells within a subject, e.g., a human subject, with the
RNAi agent. Combinations of in vitro and in vivo methods of
contacting a cell are also possible. Contacting a cell may be
direct or indirect, as discussed above. Furthermore, contacting a
cell may be accomplished via a targeting ligand, including any
ligand described herein or known in the art. In preferred
embodiments, the targeting ligand is a carbohydrate moiety, e.g., a
GalNAc.sub.3 ligand, or any other ligand that directs the RNAi
agent to a site of interest.
[0533] The term "inhibiting," as used herein, is used
interchangeably with "reducing," "silencing," "downregulating",
"suppressing", and other similar terms, and includes any level of
inhibition.
[0534] The phrase "inhibiting expression of a contact activation
pathway gene" is intended to refer to inhibition of expression of
any contact activation pathway gene (such as, e.g., a mouse contact
activation pathway gene, a rat contact activation pathway gene, a
monkey contact activation pathway gene, or a human contact
activation pathway gene) as well as variants or mutants of a
contact activation pathway gene.
[0535] The phrase "inhibiting expression of a KLKB1" is intended to
refer to inhibition of expression of any KLKB1gene (such as, e.g.,
a mouse KLKB1 gene, a rat KLKB1 gene, a monkey KLKB1 gene, or a
human KLKB1 gene) as well as variants or mutants of a KLKB1 gene.
Thus, the KLKB1 gene may be a wild-type KLKB1 gene, a mutant KLKB1
gene (such as a mutant KLKB1 gene giving rise to amyloid
deposition), or a transgenic KLKB1 gene in the context of a
genetically manipulated cell, group of cells, or organism.
[0536] "Inhibiting expression of a KLKB1 gene" includes any level
of inhibition of a KLKB1 gene, e.g., at least partial suppression
of the expression of a KLKB1 gene. The expression of the KLKB1 gene
may be assessed based on the level, or the change in the level, of
any variable associated with KLKB1 gene expression, e.g., KLKB1
mRNA level, KLKB1 protein level, or the number or extent of amyloid
deposits. This level may be assessed in an individual cell or in a
group of cells, including, for example, a sample derived from a
subject.
[0537] The phrase "inhibiting expression of F12" is intended to
refer to inhibition of expression of any F12 gene (such as, e.g., a
mouse F12 gene, a rat F12 gene, a monkey F12 gene, or a human F12
gene) as well as variants or mutants of an F12 gene. Thus, the F12
gene may be a wild-type F12 gene, a mutant F12 gene (such as a
mutant F12 gene), or a transgenic F12 gene in the context of a
genetically manipulated cell, group of cells, or organism.
[0538] "Inhibiting expression of an F12 gene" includes any level of
inhibition of an F12 gene, e.g., at least partial suppression of
the expression of an F12 gene. The expression of the F12 gene may
be assessed based on the level, or the change in the level, of any
variable associated with F12 gene expression, e.g., F12 mRNA level,
F12 protein level, or the number or extent of amyloid deposits.
This level may be assessed in an individual cell or in a group of
cells, including, for example, a sample derived from a subject.
[0539] The phrase "inhibiting expression of KNG1" is intended to
refer to inhibition of expression of any KNG1 gene (such as, e.g.,
a mouse KNG1 gene, a rat KNG1 gene, a monkey KNG1 gene, or a human
KNG1 gene) as well as variants or mutants of an KNG1 gene. Thus,
the KNG1 gene may be a wild-type KNG1 gene, a mutant KNG1 gene
(such as a mutant KNG1 gene), or a transgenic KNG1 gene in the
context of a genetically manipulated cell, group of cells, or
organism.
[0540] "Inhibiting expression of an KNG1 gene" includes any level
of inhibition of an KNG1 gene, e.g., at least partial suppression
of the expression of an KNG1 gene. The expression of the KNG1 gene
may be assessed based on the level, or the change in the level, of
any variable associated with KNG1 gene expression, e.g., KNG1 mRNA
level, KNG1 protein level, or the number or extent of amyloid
deposits. This level may be assessed in an individual cell or in a
group of cells, including, for example, a sample derived from a
subject.
[0541] Inhibition may be assessed by a decrease in an absolute or
relative level of one or more variables that are associated with
contact activation pathway gene expression compared with a control
level. The control level may be any type of control level that is
utilized in the art, e.g., a pre-dose baseline level, or a level
determined from a similar subject, cell, or sample that is
untreated or treated with a control (such as, e.g., buffer only
control or inactive agent control).
[0542] In some embodiments of the methods of the invention,
expression of a contact activation pathway gene (i.e., a KLKB1
gene, an F12 gene, and/or a KNG1 gene) is inhibited by at least
about 5%, at least about 10%, at least about 15%, at least about
20%, at least about 25%, at least about 30%, at least about 35%,at
least about 40%, at least about 45%, at least about 50%, at least
about 55%, at least about 60%, at least about 65%, at least about
70%, at least about 75%, at least about 80%, at least about 85%, at
least about 90%, at least about 91%, at least about 92%, at least
about 93%, at least about 94%. at least about 95%, at least about
96%, at least about 97%, at least about 98%, or at least about
99%.
[0543] Inhibition of the expression of a contact activation pathway
gene may be manifested by a reduction of the amount of mRNA
expressed by a first cell or group of cells (such cells may be
present, for example, in a sample derived from a subject) in which
a contact activation pathway gene is transcribed and which has or
have been treated (e.g., by contacting the cell or cells with an
RNAi agent of the invention, or by administering an RNAi agent of
the invention to a subject in which the cells are or were present)
such that the expression of a contact activation pathway gene is
inhibited, as compared to a second cell or group of cells
substantially identical to the first cell or group of cells but
which has not or have not been so treated (control cell(s)). In
preferred embodiments, the inhibition is assessed by expressing the
level of mRNA in treated cells as a percentage of the level of mRNA
in control cells, using the following formula:
( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in
control cells ) 100 % ##EQU00001##
[0544] Alternatively, inhibition of the expression of a contact
activation pathway gene may be assessed in terms of a reduction of
a parameter that is functionally linked to contact activation
pathway gene expression, e.g., KLKB1 protein expression, F12
protein expression, KNG1 protein expression, fibrin deposition,
thrombus generation, or bradykinin level. Contact activation
pathway gene silencing may be determined in any cell expressing a
contact activation pathway gene, either constitutively or by
genomic engineering, and by any assay known in the art.
[0545] Inhibition of the expression of a contact activation pathway
protein may be manifested by a reduction in the level of a contact
activation pathway protein that is expressed by a cell or group of
cells (e.g., the level of protein expressed in a sample derived
from a subject). As explained above, for the assessment of mRNA
suppression, the inhibiton of protein expression levels in a
treated cell or group of cells may similarly be expressed as a
percentage of the level of protein in a control cell or group of
cells.
[0546] A control cell or group of cells that may be used to assess
the inhibition of the expression of a contact activation pathway
gene includes a cell or group of cells that has not yet been
contacted with an RNAi agent of the invention. For example, the
control cell or group of cells may be derived from an individual
subject (e.g., a human or animal subject) prior to treatment of the
subject with an RNAi agent.
[0547] The level of contact activation pathway mRNA that is
expressed by a cell or group of cells, or the level of circulating
contact activation pathway mRNA, may be determined using any method
known in the art for assessing mRNA expression. In one embodiment,
the level of expression of a contact activation pathway gene in a
sample is determined by detecting a transcribed polynucleotide, or
portion thereof, e.g., mRNA of the KLKB1 gene, mRNA of the F12
gene, and/or mRNA of the KNG1 gene. RNA may be extracted from cells
using RNA extraction techniques including, for example, using acid
phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis),
RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix,
Switzerland). Typical assay formats utilizing ribonucleic acid
hybridization include nuclear run-on assays, RT-PCR, RNase
protection assays (Melton et al., Nuc. Acids Res. 12:7035),
Northern blotting, in situ hybridization, and microarray analysis.
Circulating KLKB1 mRNA may be detected using methods the described
in PCT/US2012/043584, the entire contents of which are hereby
incorporated herein by reference.
[0548] In one embodiment, the level of expression of a contact
activation pathway gene is determined using a nucleic acid probe.
The term "probe", as used herein, refers to any molecule that is
capable of selectively binding to a specific contact activation
pathway gene. Probes can be synthesized by one of skill in the art,
or derived from appropriate biological preparations. Probes may be
specifically designed to be labeled. Examples of molecules that can
be utilized as probes include, but are not limited to, RNA, DNA,
proteins, antibodies, and organic molecules.
[0549] Isolated mRNA can be used in hybridization or amplification
assays that include, but are not limited to, Southern or Northern
analyses, polymerase chain reaction (PCR) analyses and probe
arrays. One method for the determination of mRNA levels involves
contacting the isolated mRNA with a nucleic acid molecule (probe)
that can hybridize to KLKB1 mRNA. In one embodiment, the mRNA is
immobilized on a solid surface and contacted with a probe, for
example by running the isolated mRNA on an agarose gel and
transferring the mRNA from the gel to a membrane, such as
nitrocellulose. In an alternative embodiment, the probe(s) are
immobilized on a solid surface and the mRNA is contacted with the
probe(s), for example, in an Affymetrix gene chip array. A skilled
artisan can readily adapt known mRNA detection methods for use in
determining the level of contact activation pathway gene mRNA.
[0550] An alternative method for determining the level of
expression of a contact activation pathway gene in a sample
involves the process of nucleic acid amplification and/or reverse
transcriptase (to prepare cDNA) of for example mRNA in the sample,
e.g., by RT-PCR (the experimental embodiment set forth in Mullis,
1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany
(1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained
sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87:1874-1878), transcriptional amplification system (Kwoh et
al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta
Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling
circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any
other nucleic acid amplification method, followed by the detection
of the amplified molecules using techniques well known to those of
skill in the art. These detection schemes are especially useful for
the detection of nucleic acid molecules if such molecules are
present in very low numbers. In particular aspects of the
invention, the level of expression of a contact activation pathway
gene is determined by quantitative fluorogenic RT-PCR (i.e., the
TaqMan.TM. System).
[0551] The expression levels of a contact activation pathway mRNA
may be monitored using a membrane blot (such as used in
hybridization analysis such as Northern, Southern, dot, and the
like), or microwells, sample tubes, gels, beads or fibers (or any
solid support comprising bound nucleic acids). See U.S. Pat. Nos.
5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are
incorporated herein by reference. The determination of KLKB1
expression level may also comprise using nucleic acid probes in
solution.
[0552] In preferred embodiments, the level of mRNA expression is
assessed using branched DNA (bDNA) assays or real time PCR (qPCR).
The use of these methods is described and exemplified in the
Examples presented herein.
[0553] The level of contact activation pathway protein expression
may be determined using any method known in the art for the
measurement of protein levels. Such methods include, for example,
electrophoresis, capillary electrophoresis, high performance liquid
chromatography (HPLC), thin layer chromatography (TLC),
hyperdiffusion chromatography, fluid or gel precipitin reactions,
absorption spectroscopy, a colorimetric assays, spectrophotometric
assays, flow cytometry, immunodiffusion (single or double),
immunoelectrophoresis, Western blotting, radioimmunoassay (RIA),
enzyme-linked immunosorbent assays (ELISAs), immunofluorescent
assays, electrochemiluminescence assays, and the like.
[0554] In some embodiments, the efficacy of the methods of the
invention can be monitored by detecting or monitoring a reduction
in a symptom of a contact activation pathway-associated disease,
such as reduction in edema swelling of the extremities, face,
larynx, upper respiratory tract, abdomen, trunk, and genitals,
prodrome; laryngeal swelling; nonpruritic rash; nausea; vomiting;
or abdominal pain. These symptoms may be assessed in vitro or in
vivo using any method known in the art.
[0555] The term "sample" as used herein refers to a collection of
similar fluids, cells, or tissues isolated from a subject, as well
as fluids, cells, or tissues present within a subject. Examples of
biological fluids include blood, serum and serosal fluids, plasma,
lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the
like. Tissue samples may include samples from tissues, organs or
localized regions. For example, samples may be derived from
particular organs, parts of organs, or fluids or cells within those
organis. In certain embodiments, samples may be derived from the
liver (e.g., whole liver or certain segments of liver or certain
types of cells in the liver, such as, e.g., hepatocytes), the
retina or parts of the retina (e.g., retinal pigment epithelium),
the central nervous system or parts of the central nervous system
(e.g., ventricles or choroid plexus), or the pancreas or certain
cells or parts of the pancreas. In preferred embodiments, a "sample
derived from a subject" refers to blood or plasma drawn from the
subject. In further embodiments, a "sample derived from a subject"
refers to liver tissue or retinal tissue derived from the
subject.
[0556] In some embodiments of the methods of the invention, the
RNAi agent is administered to a subject such that the RNAi agent is
delivered to a specific site within the subject. The inhibition of
expression of a contact activation pathway gene may be assessed
using measurements of the level or change in the level of contact
activation pathway gene mRNA or contact activation pathway protein
in a sample derived from fluid or tissue from the specific site
within the subject. In preferred embodiments, the site is selected
from the group consisting of liver, choroid plexus, retina, and
pancreas. The site may also be a subsection or subgroup of cells
from any one of the aforementioned sites. The site may also include
cells that express a particular type of receptor.
VIII. Methods of Treating or Preventing Contact Activation
Pathway-Associated Diseases
[0557] The present invention provides therapeutic and prophylactic
methods which include administering to a subject having a contact
activation pathway gene-associated disease, disorder, and/or
condition, or prone to developing, a contact activation pathway
gene-associated disease, disorder, and/or condition, compositions
comprising an iRNA agent (i.e., an iRNA agent targeting a KLKB1
gene, an iRNA agent targeting an F12 gene, an iRNA agent targeting
a KNG1 gene, or a combination of any of the foregoing, i.e., a
combination of an iRNA agent targeting a KLKB1 gene and an iRNA
agent targeting an F12 gene, or a combination of an iRNA agent
targeting a KLKB1 gene and an iRNA agent targeting a KNG1 gene, or
a combination of an iRNA agent targeting an F12 gene and an iRNA
agent targeting a KNG1 gene, or a combination of an iRNA agent
targeting a KLKB1 gene, an iRNA agent targeting an F12 gene, and an
iRNA agent targeting a KNG1 gene), or pharmaceutical compositions
comprising an iRNA agent (i.e., an iRNA agent targeting a KLKB1
gene, an iRNA agent targeting an F12 gene, an iRNA agent targeting
a KNG1 gene, or a combination of any of the foregoing), or vectors
comprising an iRNA (i.e., an iRNA agent targeting a KLKB1 gene, an
iRNA agent targeting an F12 gene, an iRNA agent targeting a KNG1
gene, or a combination of any of the foregoing) of the invention.
Non-limiting examples of contact activation pathway gene-associated
diseases include, for example, a thrombophilia, heredity angioedema
(HAE) (such as hereditary angioedema type I; hereditary angioedema
type II; hereditary angioedema type III; or any other hereditary
angioedema caused by elevated levels of bradykinin), prekallikrein
deficiency, malignant essential hypertension, hypertension, end
stage renal disease, Fletcher Factor Deficiency, edema swelling of
the extremities, face, larynx, upper respiratory tract, abdomen,
trunk, and genitals, prodrome; laryngeal swelling; nonpruritic
rash; nausea; vomiting; abdominal pain.
[0558] In one embodiment, the contact activation pathway
gene-associated disease is a thrombophilia. In another embodiment,
the contact activation pathway gene-associated disease is HAE. In
another embodiment, the contact activation pathway gene-associated
disease is prekallikrein deficiency. In another embodiment, the
contact activation pathway gene-associated disease is malignant
essential hypertension. In another embodiment, the contact
activation pathway gene-associated disease is hypertension. In
another embodiment, the contact activation pathway gene-associated
disease is end stage renal disease. In another embodiment, the
contact activation pathway gene-associated disease is Fletcher
Factor Deficiency.
[0559] The methods of the invention are useful for treating a
subject having a contact activation pathway gene-associated
disease, e.g., a subject that would benefit from reduction in
contact activation pathway gene expression and/or contact
activation pathway protein production. In one aspect, the present
invention provides methods of reducing the level of Kallikrein B,
Plasma (Fletcher Factor) 1 (KLKB1) gene expression in a subject
having hereditary angioedema (HAE). In another aspect, the present
invention provides methods of reducing the level of KLKB1 protein
in a subject with HAE. In one aspect, the present invention
provides methods of reducing the level of Factor XII (Hageman
Factor) (F12) gene expression in a subject having hereditary
angioedema (HAE). In another aspect, the present invention provides
methods of reducing the level of F12 protein in a subject with HAE.
In one aspect, the present invention provides methods of reducing
the level of Kininogen 1 (KNG1) gene expression in a subject having
hereditary angioedema (HAE). In another aspect, the present
invention provides methods of reducing the level of KNG1 protein in
a subject with HAE.
[0560] The present invention also provides methods of reducing the
level of bradykinin in a subject with contact activation
pathway-associated disease, e.g., a thrombophilia or hereditary
angioedema. For example, in one embodiment, the invention provides
methods of reducing the level of bradykinin in a subject with
hereditary angioedema which include administering to the subject a
therapeutically effective amount or a prophylactically effective
amount of a dsRNA agent of the invention, (i.e., an iRNA agent
targeting a KLKB1 gene, an iRNA agent targeting an F12 gene, an
iRNA agent targeting a KNG1 gene, or a combination of any of the
foregoing, i.e., a combination of an iRNA agent targeting a KLKB1
gene and an iRNA agent targeting an F12 gene, or a combination of
an iRNA agent targeting a KLKB1 gene and an iRNA agent targeting a
KNG1 gene, or a combination of an iRNA agent targeting an F12 gene
and an iRNA agent targeting a KNG1 gene, or a combination of an
iRNA agent targeting a KLKB1 gene, an iRNA agent targeting an F12
gene, and an iRNA agent targeting a KNG1 gene), or a pharmaceutical
composition or vector comprising such agents, or combinations of
such agents.
[0561] In one aspect, the present invention provides methods of
treating a subject having an contact activation pathway-associated
disease, e.g., a thrombophilia, hereditary angioedema type I;
hereditary angioedema type II; hereditary angioedema type III; any
other hereditary angioedema caused by elevated levels of
bradykinin. In one embodiment, the treatment methods (and uses) of
the invention include administering to the subject, e.g., a human,
a therapeutically effective amount of an iRNA agent of the
invention targeting a KLKB1 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting a KLKB1 gene or
a vector of the invention comprising an iRNA agent targeting an
KLKB1 gene. In another embodiment, the treatment methods (and uses)
of the invention include administering to the subject, e.g., a
human, a therapeutically effective amount of an iRNA agent of the
invention targeting an F12 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting an F12 gene or
a vector of the invention comprising an iRNA agent targeting an F12
gene. In yet another embodiment, the treatment methods (and uses)
of the invention include administering to the subject, e.g., a
human, a therapeutically effective amount of an iRNA agent of the
invention targeting an KNG1 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting an KNG1 gene or
a vector of the invention comprising an iRNA agent targeting an
KNG1 gene. In other embodiments, the treatment methods (and uses)
of the invention include administering to the subject, e.g., a
human, a therapeutically effective amount of a combination of dsRNA
agents of the invention, (i.e., a combination of an iRNA agent
targeting a KLKB 1 gene and an iRNA agent targeting an F12 gene, or
a combination of an iRNA agent targeting a KLKB1 gene and an iRNA
agent targeting a KNG1 gene, or a combination of an iRNA agent
targeting an F12 gene and an iRNA agent targeting a KNG1 gene, or a
combination of an iRNA agent targeting a KLKB1 gene, an iRNA agent
targeting an F12 gene, and an iRNA agent targeting a KNG1 gene), or
a pharmaceutical composition or vector comprising such agents, or
combinations of such agents.
[0562] In another aspect, the present invention provides methods of
treating a subject having HAE. In one embodiment, the methods (and
uses) of the invention for treating a subject having HAE include
administering to the subject, e.g., a human, a therapeutically
effective amount of an iRNA agent of the invention targeting a F12
gene or a pharmaceutical composition comprising an iRNA agent of
the invention targeting a F12 gene or a vector of the invention
comprising an iRNA agent targeting an F12 gene. In another
embodiment, the methods (and uses) of the invention for treating a
subject having HAE include administering to the subject, e.g., a
human, a therapeutically effective amount of an iRNA agent of the
invention targeting an KLKB1 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting an KLKB1 gene
or a vector of the invention comprising an iRNA agent targeting an
KLKB1 gene. In yet another embodiment, the methods (and uses) of
the invention for treating a subject having HAE include
administering to the subject, e.g., a human, a therapeutically
effective amount of an iRNA agent of the invention targeting an
KNG1 gene or a pharmaceutical composition comprising an iRNA agent
of the invention targeting an KNG1 gene or a vector of the
invention comprising an iRNA agent targeting an KNG1 gene. In other
embodiments, the methods (and uses) of the invention for treating a
subject having HAE include administering to the subject, e.g., a
human, a therapeutically effective amount of a combination of dsRNA
agents of the invention, (i.e., a combination of an iRNA agent
targeting a KLKB1 gene and an iRNA agent targeting an F12 gene, or
a combination of an iRNA agent targeting a KLKB1 gene and an iRNA
agent targeting a KNG1 gene, or a combination of an iRNA agent
targeting an F12 gene and an iRNA agent targeting a KNG1 gene, or a
combination of an iRNA agent targeting a KLKB1 gene, an iRNA agent
targeting an F12 gene, and an iRNA agent targeting a KNG1 gene), or
a pharmaceutical composition or vector comprising such agents, or
combinations of such agents.
[0563] In another aspect, the present invention provides methods of
treating a subject having a thrombophilia. In one embodiment, the
methods (and uses) of the invention for treating a subject having
thrombophilia include administering to the subject, e.g., a human,
a therapeutically effective amount of an iRNA agent of the
invention targeting a F12 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting a F12 gene or a
vector of the invention comprising an iRNA agent targeting an F12
gene. In another embodiment, the methods (and uses) of the
invention for treating a subject having thrombophilia include
administering to the subject, e.g., a human, a therapeutically
effective amount of an iRNA agent of the invention targeting an
KLKB1 gene or a pharmaceutical composition comprising an iRNA agent
of the invention targeting an KLKB1 gene or a vector of the
invention comprising an iRNA agent targeting an KLKB1 gene. In yet
another embodiment, the methods (and uses) of the invention for
treating a subject having thrombophilia include administering to
the subject, e.g., a human, a therapeutically effective amount of
an iRNA agent of the invention targeting an KNG1 gene or a
pharmaceutical composition comprising an iRNA agent of the
invention targeting an KNG1 gene or a vector of the invention
comprising an iRNA agent targeting an KNG1 gene. In other
embodiments, the methods (and uses) of the invention for treating a
subject having thrombophilia include administering to the subject,
e.g., a human, a therapeutically effective amount of a combination
of dsRNA agents of the invention, (i.e., a combination of an iRNA
agent targeting a KLKB1 gene and an iRNA agent targeting an F12
gene, or a combination of an iRNA agent targeting a KLKB1 gene and
an iRNA agent targeting a KNG1 gene, or a combination of an iRNA
agent targeting an F12 gene and an iRNA agent targeting a KNG1
gene, or a combination of an iRNA agent targeting a KLKB1 gene, an
iRNA agent targeting an F12 gene, and an iRNA agent targeting a
KNG1 gene), or a pharmaceutical composition or vector comprising
such agents, or combinations of such agents.
[0564] In one aspect, the invention provides methods of preventing
at least one symptom in a subject having a contact activation
pathway-associated disease, e.g., a thrombophilia, hereditary
angioedema (HAE), e.g., the presence of elevated bradykinin, edema
swelling of the extremities, face, larynx, upper respiratory tract,
abdomen, trunk, and genitals, prodrome; laryngeal swelling;
nonpruritic rash; nausea; vomiting; abdominal pain. The methods
include administering to the subject a prohylactically effective
amount of the iRNA agent, e.g. dsRNA, pharmaceutical compositions,
or vectors of the invention, thereby preventing at least one
symptom in a subject having a contact activation pathway-associated
disease. In one embodiment, the prophylactic methods (and uses) of
the invention include administering to the subject, e.g., a human,
a prophylactically effective amount of an iRNA agent of the
invention targeting a KLKB1 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting a KLKB1 gene or
a vector of the invention comprising an iRNA agent targeting an
KLKB1 gene. In another embodiment, the prophylactic methods (and
uses) of the invention include administering to the subject, e.g.,
a human, a prophylactically effective amount of an iRNA agent of
the invention targeting an F12 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting an F12 gene or
a vector of the invention comprising an iRNA agent targeting an F12
gene. In yet another embodiment, the prophylactic methods (and
uses) of the invention include administering to the subject, e.g.,
a human, a prophylactically effective amount of an iRNA agent of
the invention targeting an KNG1 gene or a pharmaceutical
composition comprising an iRNA agent of the invention targeting an
KNG1 gene or a vector of the invention comprising an iRNA agent
targeting an KNG1 gene. In other embodiments,the prophylactic
methods (and uses) of the invention include administering to the
subject, e.g., a human, a prophylactically effective amount of a
combination of dsRNA agents of the invention, (i.e., a combination
of an iRNA agent targeting a KLKB1 gene and an iRNA agent targeting
an F12 gene, or a combination of an iRNA agent targeting a KLKB1
gene and an iRNA agent targeting a KNG1 gene, or a combination of
an iRNA agent targeting an F12 gene and an iRNA agent targeting a
KNG1 gene, or a combination of an iRNA agent targeting a KLKB1
gene, an iRNA agent targeting an F12 gene, and an iRNA agent
targeting a KNG1 gene), or a pharmaceutical composition or vector
comprising such agents, or combinations of such agents.
[0565] In one aspect, the present invention provides methods of
preventing the formation of a thrombus in a subject at risk of
forming a thrombus. The methods include administering to the
subject a prohylactically effective amount of the iRNA agent, e.g.
dsRNA, pharmaceutical compositions, or vectors of the invention,
thereby preventing the formation of a thrombus in the subject at
risk of forming a thrombus. In one embodiment, the prophylactic
methods (and uses) of the invention include administering to the
subject, e.g., a human, a prophylactically effective amount of an
iRNA agent of the invention targeting a KLKB1 gene or a
pharmaceutical composition comprising an iRNA agent of the
invention targeting a KLKB1 gene or a vector of the invention
comprising an iRNA agent targeting an KLKB1 gene. In another
embodiment, the prophylactic methods (and uses) of the invention
include administering to the subject, e.g., a human, a
prophylactically effective amount of an iRNA agent of the invention
targeting an F12 gene or a pharmaceutical composition comprising an
iRNA agent of the invention targeting an F12 gene or a vector of
the invention comprising an iRNA agent targeting an F12 gene. In
yet another embodiment, the prophylactic methods (and uses) of the
invention include administering to the subject, e.g., a human, a
prophylactically effective amount of an iRNA agent of the invention
targeting an KNG1 gene or a pharmaceutical composition comprising
an iRNA agent of the invention targeting an KNG1 gene or a vector
of the invention comprising an iRNA agent targeting an KNG1 gene.
In other embodiments,the prophylactic methods (and uses) of the
invention include administering to the subject, e.g., a human, a
prophylactically effective amount of a combination of dsRNA agents
of the invention, (i.e., a combination of an iRNA agent targeting a
KLKB1 gene and an iRNA agent targeting an F12 gene, or a
combination of an iRNA agent targeting a KLKB1 gene and an iRNA
agent targeting a KNG1 gene, or a combination of an iRNA agent
targeting an F12 gene and an iRNA agent targeting a KNG1 gene, or a
combination of an iRNA agent targeting a KLKB1 gene, an iRNA agent
targeting an F12 gene, and an iRNA agent targeting a KNG1 gene), or
a pharmaceutical composition or vector comprising such agents, or
combinations of such agents.
[0566] "Subjects at risk of forming a thrombus" include surgical
patients (e.g., subjects having general surgery, dental surgery,
orthopedic surgery (e.g., knee or hip replacement surgery), trauma
surgery, oncological surgery); medical patients (e.g., subjects
having an immobilizing disease, e.g., subjects having more than
three days of bed rest and/or subjects having long-term use of an
intravenous catheter; subjects having atrial fibrillation; elderly
subjects; subjects having renal impairment; subjects having a
prosthetic heart valve; subjects having heart failure; subjects
having cancer); pregnant subjects; postpartum subjects; subjects
that have previously had a thrombus; subjects undergoing hormone
replacement therapy; subjects sitting for long periods of time,
such as in a plane or car; and obese subjects.
[0567] In one aspect, the present invention provides methods of
preventing an angioedema attack in a subject having HAE. The
methods include administering to the subject a prohylactically
effective amount of the iRNA agent, e.g. dsRNA, pharmaceutical
compositions, or vectors of the invention, thereby preventing the
formation of a thrombus in the subject at risk of forming a
thrombus. In one embodiment, the prophylactic methods (and uses) of
the invention include administering to the subject, e.g., a human,
a prophylactically effective amount of an iRNA agent of the
invention targeting a KLKB1 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting a KLKB1 gene or
a vector of the invention comprising an iRNA agent targeting an
KLKB1 gene. In another embodiment, the prophylactic methods (and
uses) of the invention include administering to the subject, e.g.,
a human, a prophylactically effective amount of an iRNA agent of
the invention targeting an F12 gene or a pharmaceutical composition
comprising an iRNA agent of the invention targeting an F12 gene or
a vector of the invention comprising an iRNA agent targeting an F12
gene. In yet another embodiment, the prophylactic methods (and
uses) of the invention include administering to the subject, e.g.,
a human, a prophylactically effective amount of an iRNA agent of
the invention targeting an KNG1 gene or a pharmaceutical
composition comprising an iRNA agent of the invention targeting an
KNG1 gene or a vector of the invention comprising an iRNA agent
targeting an KNG1 gene. In other embodiments,the prophylactic
methods (and uses) of the invention include administering to the
subject, e.g., a human, a prophylactically effective amount of a
combination of dsRNA agents of the invention, (i.e., a combination
of an iRNA agent targeting a KLKB1 gene and an iRNA agent targeting
an F12 gene, or a combination of an iRNA agent targeting a KLKB1
gene and an iRNA agent targeting a KNG1 gene, or a combination of
an iRNA agent targeting an F12 gene and an iRNA agent targeting a
KNG1 gene, or a combination of an iRNA agent targeting a KLKB1
gene, an iRNA agent targeting an F12 gene, and an iRNA agent
targeting a KNG1 gene), or a pharmaceutical composition or vector
comprising such agents, or combinations of such agents.
[0568] In one aspect, the present invention provides uses of a
therapeutically effective amount of an iRNA agent of the invention
for treating a subject, e.g., a subject that would benefit from a
reduction and/or inhibition of KLKB1 gene expression.
[0569] In another aspect, the present invention provides uses of a
therapeutically effective amount of an iRNA agent of the invention
for treating a subject, e.g., a subject that would benefit from a
reduction and/or inhibition of F12 gene expression.
[0570] In yet another aspect, the present invention provides uses
of a therapeutically effective amount of an iRNA agent of the
invention for treating a subject, e.g., a subject that would
benefit from a reduction and/or inhibition of KNG1 gene
expression.
[0571] In another aspect, the present invention provides uses of an
iRNA agent, e.g., a dsRNA, of the invention targeting an KLKB1 gene
or pharmaceutical composition comprising an iRNA agent targeting a
KLKB1 gene in the manufacture of a medicament for treating a
subject, e.g., a subject that would benefit from a reduction and/or
inhibition of KLKB1 gene expression and/or KLKB1 protein
production, such as a subject having a disorder that would benefit
from reduction in KLKB1 gene expression, e.g., a contact activation
pathway-associated disease.
[0572] In one aspect, the present invention provides uses of an
iRNA agent, e.g., a dsRNA, of the invention targeting an F12 gene
or pharmaceutical composition comprising an iRNA agent targeting an
F12 gene in the manufacture of a medicament for treating a subject,
e.g., a subject that would benefit from a reduction and/or
inhibition of F12 gene expression and/or F12 protein production,
such as a subject having a disorder that would benefit from
reduction in F12 gene expression, e.g., a contact activation
pathway-associated disease.
[0573] In another aspect, the present invention provides uses of an
iRNA agent, e.g., a dsRNA, of the invention targeting an KNG1 gene
or pharmaceutical composition comprising an iRNA agent targeting a
KNG1 gene in the manufacture of a medicament for treating a
subject, e.g., a subject that would benefit from a reduction and/or
inhibition of KNG1 gene expression and/or KNG1 protein production,
such as a subject having a disorder that would benefit from
reduction in KNG1 gene expression, e.g., a contact activation
pathway-associated disease.
[0574] In another aspect, the invention provides uses of an iRNA,
e.g., a dsRNA, of the invention for preventing at least one symptom
in a subject suffering from a disorder that would benefit from a
reduction and/or inhibition of KLKB1 gene expression and/or KLKB1
protein production.
[0575] In another aspect, the invention provides uses of an iRNA,
e.g., a dsRNA, of the invention for preventing at least one symptom
in a subject suffering from a disorder that would benefit from a
reduction and/or inhibition of F12 gene expression and/or F12
protein production.
[0576] In another aspect, the invention provides uses of an iRNA,
e.g., a dsRNA, of the invention for preventing at least one symptom
in a subject suffering from a disorder that would benefit from a
reduction and/or inhibition of KNG1 gene expression and/or KNG1
protein production.
[0577] In a further aspect, the present invention provides uses of
an iRNA agent of the invention in the manufacture of a medicament
for preventing at least one symptom in a subject suffering from a
disorder that would benefit from a reduction and/or inhibition of
KLKB1 gene expression and/or KLKB1 protein production, such as a
contact activation pathway-associated disease.
[0578] In one embodiment, an iRNA agent targeting KLKB1 is
administered to a subject having hereditary angioedema (HAE) and/or
an KLKB1-associated disease such that the expression of a KLKB1
gene, e.g., in a cell, tissue, blood or other tissue or fluid of
the subject are reduced by at least about 10%, 11%, 12%, 13%, 14%,
15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%,
28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%,
41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%,
54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%,
67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more when
the dsRNA agent is administered to the subject.
[0579] The methods and uses of the invention include administering
a composition described herein such that expression of the target
KLKB1 gene is decreased, such as for about 1, 2, 3, 4 5, 6, 7, 8,
12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76,
or about 80 hours. In one embodiment, expression of the target
KLKB1 gene is decreased for an extended duration, e.g., at least
about two, three, four, five, six, seven days or more, e.g., about
one week, two weeks, three weeks, or about four weeks or
longer.
[0580] In a further aspect, the present invention provides uses of
an iRNA agent of the invention in the manufacture of a medicament
for preventing at least one symptom in a subject suffering from a
disorder that would benefit from a reduction and/or inhibition of
F12 gene expression and/or F12 protein production, such as a
contact activation pathway-associated disease.
[0581] In one embodiment, an iRNA agent targeting F12 is
administered to a subject having hereditary angioedema (HAE) and/or
a contact activation pathway-associated disease such that the
expression of a F12 gene, e.g., in a cell, tissue, blood or other
tissue or fluid of the subject are reduced by at least about 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,
37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%,
50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%,
62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about
99% or more when the dsRNA agent is administered to the
subject.
[0582] The methods and uses of the invention include administering
a composition described herein such that expression of the target
F12 gene is decreased, such as for about 1, 2, 3, 4 5, 6, 7, 8, 12,
16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or
about 80 hours. In one embodiment, expression of the target F12
gene is decreased for an extended duration, e.g., at least about
two, three, four, five, six, seven days or more, e.g., about one
week, two weeks, three weeks, or about four weeks or longer.
[0583] In a further aspect, the present invention provides uses of
an iRNA agent of the invention in the manufacture of a medicament
for preventing at least one symptom in a subject suffering from a
disorder that would benefit from a reduction and/or inhibition of
KNG1 gene expression and/or KNG1 protein production, such as a
contact activation pathway-associated disease.
[0584] In one embodiment, an iRNA agent targeting KNG1 is
administered to a subject having hereditary angioedema (HAE) and/or
a contact activation pathway-associated disease such that the
expression of a KNG1 gene, e.g., in a cell, tissue, blood or other
tissue or fluid of the subject are reduced by at least about 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,
37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%,
50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%,
62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about
99% or more when the dsRNA agent is administered to the
subject.
[0585] The methods and uses of the invention include administering
a composition described herein such that expression of the target
KNG1 gene is decreased, such as for about 1, 2, 3, 4 5, 6, 7, 8,
12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76,
or about 80 hours. In one embodiment, expression of the target KNG1
gene is decreased for an extended duration, e.g., at least about
two, three, four, five, six, seven days or more, e.g., about one
week, two weeks, three weeks, or about four weeks or longer.
[0586] Administration of the dsRNA according to the methods and
uses of the invention may result in a reduction of the severity,
signs, symptoms, and/or markers of such diseases or disorders in a
patient with hereditary angioedema (HAE) and/or contact activation
pathway-associated disease. By "reduction" in this context is meant
a statistically significant decrease in such level. The reduction
can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or
about 100%.
[0587] Efficacy of treatment or prevention of disease can be
assessed, for example by measuring disease progression, disease
remission, symptom severity, reduction in pain, quality of life,
dose of a medication required to sustain a treatment effect, level
of a disease marker or any other measurable parameter appropriate
for a given disease being treated or targeted for prevention. It is
well within the ability of one skilled in the art to monitor
efficacy of treatment or prevention by measuring any one of such
parameters, or any combination of parameters. For example, efficacy
of treatment of HAE may be assessed, for example, by periodic
monitoring of HAE symptoms or bradykinin levels. Comparison of the
later readings with the initial readings provide a physician an
indication of whether the treatment is effective. It is well within
the ability of one skilled in the art to monitor efficacy of
treatment or prevention by measuring any one of such parameters, or
any combination of parameters. In connection with the
administration of an iRNA targeting a contact activation pathway
gene or pharmaceutical composition thereof, "effective against" a
contact activation pathway-associated disease indicates that
administration in a clinically appropriate manner results in a
beneficial effect for at least a statistically significant fraction
of patients, such as improvement of symptoms, a cure, a reduction
in disease, extension of life, improvement in quality of life, or
other effect generally recognized as positive by medical doctors
familiar with treating HAE and/or a contact activation
pathway-associated disease and the related causes.
[0588] A treatment or preventive effect is evident when there is a
statistically significant improvement in one or more parameters of
disease status, or by a failure to worsen or to develop symptoms
where they would otherwise be anticipated. As an example, a
favorable change of at least 10% in a measurable parameter of
disease, and preferably at least 20%, 30%, 40%, 50% or more can be
indicative of effective treatment. Efficacy for a given iRNA drug
or formulation of that drug can also be judged using an
experimental animal model for the given disease as known in the
art. When using an experimental animal model, efficacy of treatment
is evidenced when a statistically significant reduction in a marker
or symptom is observed.
[0589] Subjects can be administered a therapeutic amount of iRNA,
such as about 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05
mg/kg, 0.1 mg/kg, 0.15 mg/kg, 0.2 mg/kg, 0.25 mg/kg, 0.3 mg/kg,
0.35 mg/kg, 0.4 mg/kg, 0.45 mg/kg, 0.5 mg/kg, 0.55 mg/kg, 0.6
mg/kg, 0.65 mg/kg, 0.7 mg/kg, 0.75 mg/kg, 0.8 mg/kg, 0.85 mg/kg,
0.9 mg/kg, 0.95 mg/kg, 1.0 mg/kg, 1.1 mg/kg, 1.2 mg/kg, 1.3 mg/kg,
1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.7 mg/kg, 1.8 mg/kg, 1.9 mg/kg,
2.0 mg/kg, 2.1 mg/kg, 2.2 mg/kg, 2.3 mg/kg, 2.4 mg/kg, 2.5 mg/kg
dsRNA, 2.6 mg/kg dsRNA, 2.7 mg/kg dsRNA, 2.8 mg/kg dsRNA, 2.9 mg/kg
dsRNA, 3.0 mg/kg dsRNA, 3.1 mg/kg dsRNA, 3.2 mg/kg dsRNA, 3.3 mg/kg
dsRNA, 3.4 mg/kg dsRNA, 3.5 mg/kg dsRNA, 3.6 mg/kg dsRNA, 3.7 mg/kg
dsRNA, 3.8 mg/kg dsRNA, 3.9 mg/kg dsRNA, 4.0 mg/kg dsRNA, 4.1 mg/kg
dsRNA, 4.2 mg/kg dsRNA, 4.3 mg/kg dsRNA, 4.4 mg/kg dsRNA, 4.5 mg/kg
dsRNA, 4.6 mg/kg dsRNA, 4.7 mg/kg dsRNA, 4.8 mg/kg dsRNA, 4.9 mg/kg
dsRNA, 5.0 mg/kg dsRNA, 5.1 mg/kg dsRNA, 5.2 mg/kg dsRNA, 5.3 mg/kg
dsRNA, 5.4 mg/kg dsRNA, 5.5 mg/kg dsRNA, 5.6 mg/kg dsRNA, 5.7 mg/kg
dsRNA, 5.8 mg/kg dsRNA, 5.9 mg/kg dsRNA, 6.0 mg/kg dsRNA, 6.1 mg/kg
dsRNA, 6.2 mg/kg dsRNA, 6.3 mg/kg dsRNA, 6.4 mg/kg dsRNA, 6.5 mg/kg
dsRNA, 6.6 mg/kg dsRNA, 6.7 mg/kg dsRNA, 6.8 mg/kg dsRNA, 6.9 mg/kg
dsRNA, 7.0 mg/kg dsRNA, 7.1 mg/kg dsRNA, 7.2 mg/kg dsRNA, 7.3 mg/kg
dsRNA, 7.4 mg/kg dsRNA, 7.5 mg/kg dsRNA, 7.6 mg/kg dsRNA, 7.7 mg/kg
dsRNA, 7.8 mg/kg dsRNA, 7.9 mg/kg dsRNA, 8.0 mg/kg dsRNA, 8.1 mg/kg
dsRNA, 8.2 mg/kg dsRNA, 8.3 mg/kg dsRNA, 8.4 mg/kg dsRNA, 8.5 mg/kg
dsRNA, 8.6 mg/kg dsRNA, 8.7 mg/kg dsRNA, 8.8 mg/kg dsRNA, 8.9 mg/kg
dsRNA, 9.0 mg/kg dsRNA, 9.1 mg/kg dsRNA, 9.2 mg/kg dsRNA, 9.3 mg/kg
dsRNA, 9.4 mg/kg dsRNA, 9.5 mg/kg dsRNA, 9.6 mg/kg dsRNA, 9.7 mg/kg
dsRNA, 9.8 mg/kg dsRNA, 9.9 mg/kg dsRNA, 9.0 mg/kg dsRNA, 10 mg/kg
dsRNA, 15 mg/kg dsRNA, 20 mg/kg dsRNA, 25 mg/kg dsRNA, 30 mg/kg
dsRNA, 35 mg/kg dsRNA, 40 mg/kg dsRNA, 45 mg/kg dsRNA, or about 50
mg/kg dsRNA. In one embodiment, subjects can be administered 0.5
mg/kg of the dsRNA. Values and ranges intermediate to the recited
values are also intended to be part of this invention.
[0590] In certain embodiments, for example, when a composition of
the invention comprises a dsRNA as described herein and a lipid,
subjects can be administered a therapeutic amount of iRNA, such as
about 0.01 mg/kg to about 5 mg/kg, about 0.01 mg/kg to about 10
mg/kg, about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about
10 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to
about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg
to about 10 mg/kg, about 0.3 mg/kg to about 5 mg/kg, about 0.3
mg/kg to about 10 mg/kg, about 0.4 mg/kg to about 5 mg/kg, about
0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg,
about 0.5 mg/kg to about 10 mg/kg, about 1 mg/kg to about 5 mg/kg,
about 1 mg/kg to about 10 mg/kg, about 1.5 mg/kg to about 5 mg/kg,
about 1.5 mg/kg to about 10 mg/kg, about 2 mg/kg to about 2.5
mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 5
mg/kg, about 3 mg/kg to about 10 mg/kg, about 3.5 mg/kg to about 5
mg/kg, about 4 mg/kg to about 5 mg/kg, about 4.5 mg/kg to about 5
mg/kg, about 4 mg/kg to about 10 mg/kg, about 4.5 mg/kg to about 10
mg/kg, about 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10
mg/kg, about 6 mg/kg to about 10 mg/kg, about 6.5 mg/kg to about 10
mg/kg, about 7 mg/kg to about 10 mg/kg, about 7.5 mg/kg to about 10
mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10
mg/kg, about 9 mg/kg to about 10 mg/kg, or about 9.5 mg/kg to about
10 mg/kg. Values and ranges intermediate to the recited values are
also intended to be part of this invention.
[0591] For example, the dsRNA may be administered at a dose of
about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2,
1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6,
2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4,
4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4,
5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8,
6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2,
8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6,
9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to
the recited values are also intended to be part of this
invention.
[0592] In other embodiments, for example, when a composition of the
invention comprises a dsRNA as described herein and an
N-acetylgalactosamine, subjects can be administered a therapeutic
amount of iRNA, such as a dose of about 0.1 to about 50 mg/kg,
about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about
0.75 to about 50 mg/kg, about 1 to about 50 mg/kg, about 1.5 to
about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50
mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg,
about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to
about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50
mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg,
about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to
about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50
mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg,
about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about
0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to
about 45 mg/kg, about 1.5 to about 45 mg/kg, about 2 to about 45
mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg,
about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5
to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45
mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg,
about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to
about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45
mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg,
about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about
0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to
about 40 mg/kg, about 1.5 to about 40 mg/kg, about 2 to about 40
mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg,
about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5
to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40
mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg,
about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to
about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40
mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg,
about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about
0.75 to about 30 mg/kg, about 1 to about 30 mg/kg, about 1.5 to
about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30
mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg,
about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to
about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30
mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg,
about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1
to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about
20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/kg,
about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5
to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20
mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg,
about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to
about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment,
when a composition of the invention comprises a dsRNA as described
herein and an N-acetylgalactosamine, subjects can be administered a
therapeutic amount of about 10 to about 30 mg/kg of dsRNA. Values
and ranges intermediate to the recited values are also intended to
be part of this invention. For example, subjects can be
administered a therapeutic amount of iRNA, such as about 0.1, 0.2,
0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6,
1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3,
3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4,
4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8,
5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2,
7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6,
8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10,
10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5,
17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23,
23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5,
30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate
to the recited values are also intended to be part of this
invention.
[0593] In certain embodiments of the invention, for example, when a
double stranded RNAi agent includes a modification (e.g., one or
more motifs of three identical modifications on three consecutive
nucleotides), including one such motif at or near the cleavage site
of the agent, six phosphorothioate linkages, and a ligand, such an
agent is administered at a dose of about 0.01 to about 0.5 mg/kg,
about 0.01 to about 0.4 mg/kg, about 0.01 to about 0.3 mg/kg, about
0.01 to about 0.2 mg/kg, about 0.01 to about 0.1 mg/kg, about 0.01
mg/kg to about 0.09 mg/kg, about 0.01 mg/kg to about 0.08 mg/kg,
about 0.01 mg/kg to about 0.07 mg/kg, about 0.01 mg/kg to about
0.06 mg/kg, about 0.01 mg/kg to about 0.05 mg/kg, about 0.02 to
about 0.5 mg/kg, about 0.02 to about 0.4 mg/kg, about 0.02 to about
0.3 mg/kg, about 0.02 to about 0.2 mg/kg, about 0.02 to about 0.1
mg/kg, about 0.02 mg/kg to about 0.09 mg/kg, about 0.02 mg/kg to
about 0.08 mg/kg, about 0.02 mg/kg to about 0.07 mg/kg, about 0.02
mg/kg to about 0.06 mg/kg, about 0.02 mg/kg to about 0.05 mg/kg,
about 0.03 to about 0.5 mg/kg, about 0.03 to about 0.4 mg/kg, about
0.03 to about 0.3 mg/kg, about 0.03 to about 0.2 mg/kg, about 0.03
to about 0.1 mg/kg, about 0.03 mg/kg to about 0.09 mg/kg, about
0.03 mg/kg to about 0.08 mg/kg, about 0.03 mg/kg to about 0.07
mg/kg, about 0.03 mg/kg to about 0.06 mg/kg, about 0.03 mg/kg to
about 0.05 mg/kg, about 0.04 to about 0.5 mg/kg, about 0.04 to
about 0.4 mg/kg, about 0.04 to about 0.3 mg/kg, about 0.04 to about
0.2 mg/kg, about 0.04 to about 0.1 mg/kg, about 0.04 mg/kg to about
0.09 mg/kg, about 0.04 mg/kg to about 0.08 mg/kg, about 0.04 mg/kg
to about 0.07 mg/kg, about 0.04 mg/kg to about 0.06 mg/kg, about
0.05 to about 0.5 mg/kg, about 0.05 to about 0.4 mg/kg, about 0.05
to about 0.3 mg/kg, about 0.05 to about 0.2 mg/kg, about 0.05 to
about 0.1 mg/kg, about 0.05 mg/kg to about 0.09 mg/kg, about 0.05
mg/kg to about 0.08 mg/kg, or about 0.05 mg/kg to about 0.07 mg/kg.
Values and ranges intermediate to the foregoing recited values are
also intended to be part of this invention, e.g., the RNAi agent
may be administered to the subject at a dose of about 0.015 mg/kg
to about 0.45 mg/kg.
[0594] For example, the RNAi agent, e.g., RNAi agent in a
pharmaceutical composition, may be administered at a dose of about
0.01 mg/kg, 0.0125 mg/kg, 0.015 mg/kg, 0.0175 mg/kg, 0.02 mg/kg,
0.0225 mg/kg, 0.025 mg/kg, 0.0275 mg/kg, 0.03 mg/kg, 0.0325 mg/kg,
0.035 mg/kg, 0.0375 mg/kg, 0.04 mg/kg, 0.0425 mg/kg, 0.045 mg/kg,
0.0475 mg/kg, 0.05 mg/kg, 0.0525 mg/kg, 0.055 mg/kg, 0.0575 mg/kg,
0.06 mg/kg, 0.0625 mg/kg, 0.065 mg/kg, 0.0675 mg/kg, 0.07 mg/kg,
0.0725 mg/kg, 0.075 mg/kg, 0.0775 mg/kg, 0.08 mg/kg, 0.0825 mg/kg,
0.085 mg/kg, 0.0875 mg/kg, 0.09 mg/kg, 0.0925 mg/kg, 0.095 mg/kg,
0.0975 mg/kg, 0.1 mg/kg, 0.125 mg/kg, 0.15 mg/kg, 0.175 mg/kg, 0.2
mg/kg, 0.225 mg/kg, 0.25 mg/kg, 0.275 mg/kg, 0.3 mg/kg, 0.325
mg/kg, 0.35 mg/kg, 0.375 mg/kg, 0.4 mg/kg, 0.425 mg/kg, 0.45 mg/kg,
0.475 mg/kg, or about 0.5 mg/kg. Values intermediate to the
foregoing recited values are also intended to be part of this
invention.
[0595] In some embodiments, the RNAi agent is administered as a
fixed dose of between about 100 mg to about 900 mg, e.g., between
about 100 mg to about 850 mg, between about 100 mg to about 800 mg,
between about 100 mg to about 750 mg, between about 100 mg to about
700 mg, between about 100 mg to about 650 mg, between about 100 mg
to about 600 mg, between about 100 mg to about 550 mg, between
about 100 mg to about 500 mg, between about 200 mg to about 850 mg,
between about 200 mg to about 800 mg, between about 200 mg to about
750 mg, between about 200 mg to about 700 mg, between about 200 mg
to about 650 mg, between about 200 mg to about 600 mg, between
about 200 mg to about 550 mg, between about 200 mg to about 500 mg,
between about 300 mg to about 850 mg, between about 300 mg to about
800 mg, between about 300 mg to about 750 mg, between about 300 mg
to about 700 mg, between about 300 mg to about 650 mg, between
about 300 mg to about 600 mg, between about 300 mg to about 550 mg,
between about 300 mg to about 500 mg, between about 400 mg to about
850 mg, between about 400 mg to about 800 mg, between about 400 mg
to about 750 mg, between about 400 mg to about 700 mg, between
about 400 mg to about 650 mg, between about 400 mg to about 600 mg,
between about 400 mg to about 550 mg, or between about 400 mg to
about 500 mg.
[0596] In some embodiments, the RNAi agent is administered as a
fixed dose of about 100 mg, about 125 mg, about 150 mg, about 175
mg, 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg,
about 325 mg, about 350 mg, about 375 mg, about 400 mg, about 425
mg, about 450 mg, about 475 mg, about 500 mg, about 525 mg, about
550 mg, about 575 mg, about 600 mg, about 625 mg, about 650 mg,
about 675 mg, about 700 mg, about 725 mg, about 750 mg, about 775
mg, about 800 mg, about 825 mg, about 850 mg, about 875 mg, or
about 900 mg.
[0597] The iRNA can be administered by intravenous infusion over a
period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or about a 25 minute
period. The administration may be repeated, for example, on a
regular basis, such as weekly, biweekly (i.e., every two weeks) for
one month, two months, three months, four months or longer. After
an initial treatment regimen, the treatments can be administered on
a less frequent basis. For example, after administration weekly or
biweekly for three months, administration can be repeated once per
month, for six months or a year or longer.
[0598] Administration of the iRNA can reduce the presence of
contact activation pathway protein (i.e., KLKB1 protein, F12
protein, and/or KNG1 protein) and/or bradykinin levels, e.g., in a
cell, tissue, blood, urine or other compartment of the patient by
at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or at least about 99% or more.
[0599] Before administration of a full dose of the iRNA, patients
can be administered a smaller dose, such as a 5% infusion, and
monitored for adverse effects, such as an allergic reaction. In
another example, the patient can be monitored for unwanted
immunostimulatory effects, such as increased cytokine (e.g.,
TNF-alpha or INF-alpha) levels.
[0600] Owing to the inhibitory effects on contact activation
pathway gene expression, a composition according to the invention
or a pharmaceutical composition prepared therefrom can enhance the
quality of life.
[0601] An iRNA of the invention may be administered in "naked"
form, where the modified or unmodified iRNA agent is directly
suspended in aqueous or suitable buffer solvent, as a "free iRNA."
A free iRNA is administered in the absence of a pharmaceutical
composition. The free iRNA may be in a suitable buffer solution.
The buffer solution may comprise acetate, citrate, prolamine,
carbonate, or phosphate, or any combination thereof. In one
embodiment, the buffer solution is phosphate buffered saline (PBS).
The pH and osmolarity of the buffer solution containing the iRNA
can be adjusted such that it is suitable for administering to a
subject.
[0602] Alternatively, an iRNA of the invention may be administered
as a pharmaceutical composition, such as a dsRNA liposomal
formulation.
[0603] Subjects that would benefit from a reduction and/or
inhibition of contact activation pathway gene expression are those
having hereditary angioedema (HAE) and/or a contact activation
pathway-associated disease or disorder as described herein.
[0604] Treatment of a subject that would benefit from a reduction
and/or inhibition of contact activation pathway gene expression
includes therapeutic and prophylactic treatment.
[0605] The invention further provides methods and uses of an iRNA
agent or a pharmaceutical composition thereof for treating a
subject that would benefit from reduction and/or inhibition of
contact activation pathway gene expression, e.g., a subject having
a contact activation pathway-associated disease, in combination
with other pharmaceuticals and/or other therapeutic methods, e.g.,
with known pharmaceuticals and/or known therapeutic methods, such
as, for example, those which are currently employed for treating
these disorders.
[0606] For example, in certain embodiments, an iRNA targeting a
contact activation pathway gene is administered in combination
with, e.g., an agent useful in treating an contact activation
pathway-associated disease as described elsewhere herein. For
example, additional therapeutics and therapeutic methods suitable
for treating a subject that would benefit from reduction in contact
activation pathway gene expression, e.g., a subject having a
contact activation pathway-associated disease, include an iRNA
agent targeting a different portion of the contact activation
pathway gene, an androgen, or a therapeutic agent, e.g., a C1INH
replacement protein, a kallikrein inhibitor peptide, a bradkinin B2
receptor antagonist peptide, or other therapeutic agents and/or
procedures for treating a contact activation pathway-associated
disease or a combination of any of the foregoing. In one
embodiment, the additional therapeutic is selected from the group
consisting of an androgen, such as danazol or oxandrolone,
Berinert.RTM., Cinryze.TM., Rhuconest.RTM., Ecallantide,
Firazyr.RTM., Kalbitor.RTM., and a combination of any of the
foregoing.
[0607] In certain embodiments, a first iRNA agent targeting a
contact activation pathway gene is administered in combination with
a second iRNA agent targeting a different portion of the contact
activation pathway gene. For example, the first RNAi agent
comprises a first sense strand and a first antisense strand forming
a double stranded region, wherein substantially all of the
nucleotides of said first sense strand and substantially all of the
nucleotides of the first antisense strand are modified nucleotides,
wherein said first sense strand is conjugated to a ligand attached
at the 3'-terminus, and wherein the ligand is one or more GalNAc
derivatives attached through a bivalent or trivalent branched
linker; and the second RNAi agent comprises a second sense strand
and a second antisense strand forming a double stranded region,
wherein substantially all of the nucleotides of the second sense
strand and substantially all of the nucleotides of the second
antisense strand are modified nucleotides, wherein the second sense
strand is conjugated to a ligand attached at the 3'-terminus, and
wherein the ligand is one or more GalNAc derivatives attached
through a bivalent or trivalent branched linker.
[0608] In one embodiment, all of the nucleotides of the first and
second sense strand and/or all of the nucleotides of the first and
second antisense strand comprise a modification.
[0609] In one embodiment, the at least one of the modified
nucleotides is selected from the group consisting of a 3'-terminal
deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a
2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a
locked nucleotide, an unlocked nucleotide, a conformationally
restricted nucleotide, a constrained ethyl nucleotide, an abasic
nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified
nucleotide, 2'-C-alkyl-modified nucleotide, 2'-hydroxly-modified
nucleotide, a 2'-methoxyethyl modified nucleotide, a
2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a
phosphoramidate, a non-natural base comprising nucleotide, a
tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified
nucleotide, a cyclohexenyl modified nucleotide, a nucleotide
comprising a phosphorothioate group, a nucleotide comprising a
methylphosphonate group, a nucleotide comprising a 5'-phosphate,
and a nucleotide comprising a 5'-phosphate mimic.
[0610] In certain embodiments, a first iRNA agent targeting a
contact activation pathway gene is administered in combination with
a second iRNA agent targeting a gene that is different from the
contact activation pathway gene. For example, the iRNA agent
targeting the KLKB 1 gene may be administered in combination with
an iRNA agent targeting the coagulation factor XII (F12) gene. The
first iRNA agent targeting a KLKB 1 gene and the second iRNA agent
targeting a gene different from the KLKB1 gene, e.g., the
coagulation factor XII (F12) gene, may be administred as parts of
the same pharmaceutical composition. Alternatively, the first iRNA
agent targeting a KLKB 1 gene and the second iRNA agent targeting a
gene different from the KLKB1 gene, e.g., the coagulation factor
XII (F12) gene, may be administered as parts of different
pharmaceutical compositions.
[0611] The iRNA agent and an additional therapeutic agent and/or
treatment may be administered at the same time and/or in the same
combination, e.g., parenterally, or the additional therapeutic
agent can be administered as part of a separate composition or at
separate times and/or by another method known in the art or
described herein.
[0612] The present invention also provides methods of using an iRNA
agent of the invention and/or a composition containing an iRNA
agent of the invention to reduce and/or inhibit contact activation
pathway gene expression (i.e., KLKB1 expression, F12 expression, or
KNG1 expression) in a cell. In other aspects, the present invention
provides an iRNA of the invention and/or a composition comprising
an iRNA of the invention for use in reducing and/or inhibiting
contact activation pathway gene expression (i.e., KLKB1 expression,
F12 expression, or KNG1 expression) in a cell. In yet other
aspects, use of an iRNA of the invention and/or a composition
comprising an iRNA of the invention for the manufacture of a
medicament for reducing and/or inhibiting contact activation
pathway gene expression (i.e., KLKB1 expression, F12 expression, or
KNG1 expression) in a cell are provided. In still other aspects,
the the present invention provides an iRNA of the invention and/or
a composition comprising an iRNA of the invention for use in
reducing and/or inhibiting contact activation pathway protein
production (i.e., KLKB1 protein production, F12 protein production,
or KNG1 protein production) in a cell. In yet other aspects, use of
an iRNA of the invention and/or a composition comprising an iRNA of
the invention for the manufacture of a medicament for reducing
and/or inhibiting contact activation pathway protein production
(i.e., KLKB1 protein production, F12 protein production, or KNG1
protein production) in a cell are provided. The methods and uses
include contacting the cell with an iRNA, e.g., a dsRNA, of the
invention and maintaining the cell for a time sufficient to obtain
degradation of the mRNA transcript of the contact activation
pathway gene, thereby inhibiting expression of the contact
activation pathway gene or inhibiting contact activation pathway
protein production in the cell.
[0613] Reduction in gene expression can be assessed by any methods
known in the art. For example, a reduction in the expression of
KLKB1 may be determined by determining the mRNA expression level of
KLKB1 using methods routine to one of ordinary skill in the art,
e.g., Northern blotting, qRT-PCR, by determining the protein level
of KLKB1 using methods routine to one of ordinary skill in the art,
such as Western blotting, immunological techniques, flow cytometry
methods, ELISA, and/or by determining a biological activity of
KLKB1.
[0614] In the methods and uses of the invention the cell may be
contacted in vitro or in vivo, i.e., the cell may be within a
subject.
[0615] A cell suitable for treatment using the methods of the
invention may be any cell that expresses a contact activation
pathway gene, e.g., a cell from a subject having hereditary
angioedema (HAE) or a cell comprising an expression vector
comprising a contact activation pathway gene or portion of a
contact activation pathway gene. A cell suitable for use in the
methods and uses of the invention may be a mammalian cell, e.g., a
primate cell (such as a human cell or a non-human primate cell,
e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such
as a cow cell, a pig cell, a camel cell, a llama cell, a horse
cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea
pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion
cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell
(e.g., a duck cell or a goose cell), or a whale cell. In one
embodiment, the cell is a human cell.
[0616] Contact activation pathway gene expression may be inhibited
in the cell by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%,
13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100%.
[0617] Contact activation pathway protein production may be
inhibited in the cell by at least about 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,
37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%,
50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%,
63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about
100%.
[0618] The in vivo methods and uses of the invention may include
administering to a subject a composition containing an iRNA, where
the iRNA includes a nucleotide sequence that is complementary to at
least a part of an RNA transcript of the contact activation pathway
gene of the mammal to be treated. When the organism to be treated
is a human, the composition can be administered by any means known
in the art including, but not limited to subcutaneous, intravenous,
oral, intraperitoneal, or parenteral routes, including intracranial
(e.g., intraventricular, intraparenchymal and intrathecal),
intramuscular, transdermal, airway (aerosol), nasal, rectal, and
topical (including buccal and sublingual) administration. In
certain embodiments, the compositions are administered by
subcutaneous or intravenous infusion or injection. In one
embodiment, the compositions are administered by subcutaneous
injection.
[0619] In some embodiments, the administration is via a depot
injection. A depot injection may release the iRNA in a consistent
way over a prolonged time period. Thus, a depot injection may
reduce the frequency of dosing needed to obtain a desired effect,
e.g., a desired inhibition of KLKB1, or a therapeutic or
prophylactic effect. A depot injection may also provide more
consistent serum concentrations. Depot injections may include
subcutaneous injections or intramuscular injections. In preferred
embodiments, the depot injection is a subcutaneous injection.
[0620] In some embodiments, the administration is via a pump. The
pump may be an external pump or a surgically implanted pump. In
certain embodiments, the pump is a subcutaneously implanted osmotic
pump. In other embodiments, the pump is an infusion pump. An
infusion pump may be used for intravenous, subcutaneous, arterial,
or epidural infusions. In preferred embodiments, the infusion pump
is a subcutaneous infusion pump. In other embodiments, the pump is
a surgically implanted pump that delivers the iRNA to the
subject.
[0621] The mode of administration may be chosen based upon whether
local or systemic treatment is desired and based upon the area to
be treated. The route and site of administration may be chosen to
enhance targeting.
[0622] In one aspect, the present invention also provides methods
for inhibiting the expression of an KLKB1 gene in a mammal, e.g., a
human. The present invention also provides a composition comprising
an iRNA, e.g., a dsRNA, that targets an KLKB1 gene in a cell of a
mammal for use in inhibiting expression of the KLKB1 gene in the
mammal. In another aspect, the present invention provides use of an
iRNA, e.g., a dsRNA, that targets an KLKB1 gene in a cell of a
mammal in the manufacture of a medicament for inhibiting expression
of the KLKB1 gene in the mammal.
[0623] The methods and uses include administering to the mammal,
e.g., a human, a composition comprising an iRNA, e.g., a dsRNA,
that targets an KLKB1 gene in a cell of the mammal and maintaining
the mammal for a time sufficient to obtain degradation of the mRNA
transcript of the KLKB1 gene, thereby inhibiting expression of the
KLKB1 gene in the mammal.
[0624] In another aspect, the present invention also provides
methods for inhibiting the expression of an F12 gene in a mammal,
e.g., a human. The present invention also provides a composition
comprising an iRNA, e.g., a dsRNA, that targets an F12 gene in a
cell of a mammal for use in inhibiting expression of the F12 gene
in the mammal. In another aspect, the present invention provides
use of an iRNA, e.g., a dsRNA, that targets an F12 gene in a cell
of a mammal in the manufacture of a medicament for inhibiting
expression of the F12 gene in the mammal.
[0625] The methods and uses include administering to the mammal,
e.g., a human, a composition comprising an iRNA, e.g., a dsRNA,
that targets an F12 gene in a cell of the mammal and maintaining
the mammal for a time sufficient to obtain degradation of the mRNA
transcript of the F12 gene, thereby inhibiting expression of the
F12 gene in the mammal.
[0626] In yet another aspect, the present invention also provides
methods for inhibiting the expression of an KNG1 gene in a mammal,
e.g., a human. The present invention also provides a composition
comprising an iRNA, e.g., a dsRNA, that targets an KNG1 gene in a
cell of a mammal for use in inhibiting expression of the KNG1 gene
in the mammal. In another aspect, the present invention provides
use of an iRNA, e.g., a dsRNA, that targets an KNG1 gene in a cell
of a mammal in the manufacture of a medicament for inhibiting
expression of the KNG1 gene in the mammal.
[0627] The methods and uses include administering to the mammal,
e.g., a human, a composition comprising an iRNA, e.g., a dsRNA,
that targets an KNG1 gene in a cell of the mammal and maintaining
the mammal for a time sufficient to obtain degradation of the mRNA
transcript of the KNG1 gene, thereby inhibiting expression of the
KNG1 gene in the mammal.
[0628] Reduction in gene expression can be assessed in peripheral
blood sample of the iRNA-administered subject by any methods known
it the art, e.g. qRT-PCR, described herein. Reduction in protein
production can be assessed by any methods known it the art and by
methods, e.g., ELISA or Western blotting, described herein. In one
embodiment, a tissue sample serves as the tissue material for
monitoring the reduction in contact activation pathway gene and/or
protein expression. In another embodiment, a blood sample serves as
the tissue material for monitoring the reduction in contact
activation pathway gene and/or protein expression.
[0629] In one embodiment, verification of RISC medicated cleavage
of target in vivo following administration of iRNA agent is done by
performing 5'-RACE or modifications of the protocol as known in the
art (Lasham A et al., (2010) Nucleic Acid Res., 38 (3) p-e19)
(Zimmermann et al. (2006) Nature 441: 111-4).
[0630] This invention is further illustrated by the following
examples which should not be construed as limiting. The entire
contents of all references, patents and published patent
applications cited throughout this application, as well as the
Figures and the Sequence Listing, are hereby incorporated herein by
reference.
EXAMPLES
Example 1
KLKB1 iRNA Synthesis
Source of Reagents
[0631] Where the source of a reagent is not specifically given
herein, such reagent can be obtained from any supplier of reagents
for molecular biology at a quality/purity standard for application
in molecular biology.
Transcripts
[0632] siRNA Design
[0633] A set of siRNAs targeting human KLKB1, "kallikrein B, plasma
(Fletcher factor) 1" (REFSeq Accession No. NM_000892.3,
GI:78191797, GeneID: 3818, SEQ ID NO:1 and SEQ ID NO.2) and KLKB1
orthologs from toxicology species (cynomolgus monkey: RefSeq
Accession No. XM_005556482, GI:544436072; rhesus monkey: RefSeq
JU329355, GI:380802470; mouse: RefSeq NM_008455, GI:236465804; rat:
RefSeq NM_012725, GI:162138904) was designed using custom R and
Python scripts. The human KLKB1 RefSeq mRNA has a length of 2252
bases. The rationale and method for the set of siRNA designs is as
follows: the predicted efficacy for every potential 19mer siRNA
from position 72 through position 2252 of human KLKB1 mRNA
(containing the the coding region and 3' UTR) was determined using
a linear model that predicted the direct measure of mRNA knockdown
based on the data of more than 20,000 distinct siRNA designs
targeting a large number of vertebrate genes. Subsets of the KLKB1
siRNAs were designed with perfect or near-perfect matches between
human, cynomolgus monkey and rhesus monkey. A further subset was
designed with perfect or near-perfect matches to mouse and rat
KLKB1 orthologs. For each strand of the siRNA, a custom Python
script was used in a brute force search to measure the number and
positions of mismatches between the siRNA and all potential
alignments in the target species transcriptome. Extra weight was
given to mismatches in the seed region, defined here as positions
2-9 of the antisense oligonucleotide, as well the cleavage site of
the siRNA, defined here as positions 10-11 of the antisense
oligonucleotide. The relative weights for the mismatches were 2.8
for seed mismatches, 1.2 for cleavage site mismatches, and 1
mismatches in other positions up through antisense position 19.
Mismatches in the first position were ignored. A specificity score
was calculated for each strand by summing the value of each
weighted mismatch. Preference was given to siRNAs whose antisense
score in human and cynomolgus monkey was greater than or equal to
3.0 and predicted efficacy was greater than or equal to 70%
knockdown of the KLKB1 transcript. One set of siRNAs containing
structure-activity modifications, including various 2'-O-methyl and
2'-fluoro substitution patterns, were also designed, synthesized
and screened.
[0634] A detailed list of the unmodified KLKB1 sense and antisense
strand sequences is shown in Table 3. A detailed list of the
modified KLKB1 sense and antisense strand sequences is shown in
Table 4.
siRNA Synthesis
[0635] KLKB1 siRNA sequences were synthesized at 1 .mu.mol scale on
a Mermade 192 synthesizer (BioAutomation) using the solid support
mediated phosphoramidite chemistry. The solid support was
controlled pore glass (500 A) loaded with custom GalNAc ligand or
universal solid support (AM biochemical). Ancillary synthesis
reagents, 2'-F and 2'-O-Methyl RNA and deoxy phosphoramidites were
obtained from Thermo-Fisher (Milwaukee, Wis.) and Hongene (China).
2'F 2'-O-Methyl, GNA (glycol nucleic acids), 5'phosphate and other
modifications were introduced using the corresponding
phosphoramidites. Synthesis of 3' GalNAc conjugated single strands
was performed on a GalNAc modified CPG support. Custom CPG
universal solid support was used for the synthesis of antisense
single strands. Coupling time for all phosphoramidites (100 mM in
acetonitrile) was 5 min employing 5-Ethylthio-1H-tetrazole (ETT) as
activator (0.6 M in acetonitrile). Phosphorothioate linkages were
generated using a 50 mM solution of 3-((Dimethylamino-methylidene)
amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes
(Wilmington, Mass., USA)) in anhydrous acetonitrile/pyridine (1:1
v/v). Oxidation time was 3 minutes. All sequences were synthesized
with final removal of the DMT group ("DMT off").
[0636] Upon completion of the solid phase synthesis,
oligoribonucleotides were cleaved from the solid support and
deprotected in sealed 96 deep well plates using 200 .mu.L Aqueous
Methylamine reagents at 60.degree. C. for 20 minutes. For sequences
containing 2' ribo residues (2'-OH) that are protected with a
tert-butyl dimethyl silyl (TBDMS) group, a second step deprotection
was performed using TEA.3HF (triethylamine trihydro fluoride)
reagent. To the methylamine deprotection solution, 200 uL of
dimethyl sulfoxide (DMSO) and 300 ul TEA.3HF reagent was added and
the solution was incubated for additional 20 min at 60.degree. C.
At the end of cleavage and deprotection step, the synthesis plate
was allowed to come to room temperature and was precipitated by
addition of 1 mL of acetontile: ethanol mixture (9:1). The plates
were cooled at -80 C for 2 hrs, superanatant decanted carefully
with the aid of a multi channel pipette. The oligonucleotide pellet
was re-suspended in 20 mM NaOAc buffer and were desalted using a 5
mL HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier
System equipped with an A905 autosampler and a Frac 950 fraction
collector. Desalted samples were collected in 96-well plates.
Samples from each sequence were analyzed by LC-MS to confirm the
identity, UV (260 nm) for quantification and a selected set of
samples by IEX chromatography to determine purity.
[0637] Annealing of KLKB1 single strands was performed on a Tecan
liquid handling robot. Equimolar mixture of sense and antisense
single strands were combined and annealed in 96 well plates. After
combining the complementary single strands, the 96-well plate was
sealed tightly and heated in an oven at 100.degree. C. for 10
minutes and allowed to come slowly to room temperature over a
period 2-3 hours. The concentration of each duplex was normalized
to 10 .mu.M in 1.times. PBS and then submitted for in vitro
screening assays.
Example 2
In Vitro Screening of KLKB1 siRNA Duplexes
Cell Culture and Transfections
[0638] Cos7 cells (ATCC, Manassas, Va.) were grown to near
confluence at 37.degree. C. in an atmosphere of 5% CO2 in DMEM
(ATCC) supplemented with 10% FBS, before being released from the
plate by trypsinization. Dual-Glo.RTM. Luciferase constructs were
generated in the psiCHECK2 plasmid containing either approximately
2.2 kb of human KLKB1 genomic sequence or 2.5 kb of orthologous
mouse KLKB1 genomic sequence. Each dual-luciferase plasmid was
co-transfected with siRNA into approximately 15.times.10.sup.4
cells using Lipofectamine 2000 (Invitrogen, Carlsbad Calif. cat
#11668-019). For each well of a 96 well plate, 0.2 .mu.l of
Lipofectamine was added to 10 ng of plasmid vector and a single
siRNA (Tables 3 and 4) in 14.8 .mu.l of Opti-MEM and allowed to
complex at room temperature for 15 minutes. The mixture was then
added to the cells which were resuspended in 80 .mu.l of fresh
complete media. Cells were incubated for 24 hours before luciferase
was measured.
[0639] Single dose experiments were performed at 10 nM and 0.01 nM
final duplex concentration and dose response experiments were done
over a range of doses from 10 nM to 36 fM final duplex
concentration over 8, 6-fold dilutions.
Dual-Glo.RTM. Luciferase Assay
[0640] Forty-eight hours after the siRNAs were transfected, Firefly
(transfection control) and Rinella (fused to KLKB1 target sequence)
luciferase were measured. First, media was removed from cells. Then
Firefly luciferase activity was measured by adding 75 .mu.l of
Dual-Glo.RTM. Luciferase Reagent equal to the culture medium volume
to each well and mix. The mixture was incubated at room temperature
for 30 minutes before lunimescense (500 nm) was measured on a
Spectramax (Molecular Devices) to detect the Firefly luciferase
signal. Renilla luciferase activity was measured by adding 75 .mu.l
of room temperature Dual-Glo.RTM. Stop & Glo.RTM. Reagent to
each well and the plates were incubated for 10-15 minutes before
luminescence was again measured to determine the Renilla luciferase
signal. The Dual-Glo.RTM. Stop & Glo.RTM. Reagent, quenches the
firefly luciferase signal and sustaines luminescence for the
Renilla luciferase reaction. siRNA activity was determined by
normalizing the Renilla (KLKB1) signal to the Firefly (control)
signal within each well. The magnitude of siRNA activity was then
assessed relative to cells that were transfected with the same
vector but were not treated with siRNA or were treated with a
non-targeting siRNA. All transfections were done in triplicate.
[0641] Table 5 shows the results of a single dose screen in Cos7
cells transfected with the indicated human KLKB1 iRNAs. Table 6
shows the results of a single dose screen in Cos7 cells transfected
with the indicated mouse KLKB1 iRNAs. Data are expressed as percent
of mRNA remaining relative to negative control.
TABLE-US-00002 TABLE 2 Abbreviations of nucleotide monomers used in
nucleic acid sequence representation. It will be understood that
these monomers, when present in an oligonucleotide, are mutually
linked by 5'-3'-phosphodiester bonds. Abbreviation Nucleotide(s) A
Adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs
2'-fluoroadenosine-3'-phosphorothioate As
adenosine-3'-phosphorothioate C cytidine-3'-phosphate Cf
2'-fluorocytidine-3'-phosphate Cfs
2'-fluorocytidine-3'-phosphorothioate Cs
cytidine-3'-phosphorothioate G guanosine-3'-phosphate Gf
2'-fluoroguanosine-3'-phosphate Gfs
2'-fluoroguanosine-3'-phosphorothioate Gs
guanosine-3'-phosphorothioate T 5'-methyluridine-3'-phosphate Tf
2'-fluoro-5-methyluridine-3'-phosphate Tfs
2'-fluoro-5-methyluridine-3'-phosphorothioate Ts
5-methyluridine-3'-phosphorothioate U Uridine-3'-phosphate Uf
2'-fluorouridine-3'-phosphate Ufs
2'-fluorouridine-3'-phosphorothioate Us uridine-3'-phosphorothioate
N any nucleotide (G, A, C, T or U) a
2'-O-methyladenosine-3'-phosphate as
2'-O-methyladenosine-3'-phosphorothioate c
2'-O-methylcytidine-3'-phosphate cs
2'-O-methylcytidine-3'-phosphorothioate g
2'-O-methylguanosine-3'-phosphate gs
2'-O-methylguanosine-3'-phosphorothioate t
2'-O-methyl-5-methyluridine-3'-phosphate ts
2'-O-methyl-5-methyluridine-3'-phosphorothioate u
2'-O-methyluridine-3'-phosphate us
2'-O-methyluridine-3'-phosphorothioate s phosphorothioate linkage
L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol
Hyp-(GalNAc-alkyl)3 (dt) deoxy-thymine Y34
2-hydroxymethyl-tetrahydrofurane-4-methoxy-3-phosphate (abasic
2'-OMe furanose) Y44 2-hydroxymethyl-tetrahydrofurane-5-phosphate
(Agn) Adenosine-glycol nucleic acid (GNA) (Tgn) Thymidine-glycol
nucleic acid (GNA) S-Isomer (Cgn) Cytidine-glycol nucleic acid
(GNA) P Phosphate VP Vinyl-phosphate
TABLE-US-00003 TABLE 3 Unmodified Sense and Antisense Strand
Sequences of KLKB1 dsRNAs Sense Oligo SEQ ID Antisense SEQ ID
Position in Duple Name Name Sense Sequence 5' to 3' NO: Oligo Name
Antisense Sequence 5' to 3' NO: NM_000892.3 AD-65077 A-129940
AAUCCAAAAUAUUCUACAAAA 30 A-129941 UUUUGUAGAAUAUUUUGGAUUUC 117
1661-1682 AD-65170 A-130248 CUGGUCAUCAAAUAAGUGCUU 31 A-130249
AAGCACUUAUUUGAUGACCAGAU 118 382-403 AD-65103 A-130010
GUGGUCAUCAAAUAAGUGCUU 32 A-130011 AAGCACUUAUUUGAUGACCACAU 119
382-403 AD-65083 A-129942 CAUGGACUGGAUUUUAGAGAA 33 A-129943
UUCUCUAAAAUCCAGUCCAUGUA 120 1922-1943 AD-65087 A-130004
ACCAAAGUCGCUGAGUACAUA 34 A-130005 UAUGUACUCAGCGACUUUGGUGU 121
1905-1926 AD-65149 A-130178 GAUGGACUGGAUUUUAGAGAA 35 A-130179
UUCUCUAAAAUCCAGUCCAUCUA 122 1922-1943 AD-64652 A-129275
UAUGAGAGGAGUCAAUUUUAA 36 A-129276 UUAAAAUUGACUCCUCUCAUAUC 123
431-452 AD-65162 A-130198 AAUGAGAGGAGUCAAUUUUAA 37 A-130199
UUAAAAUUGACUCCUCUCAUUUC 124 431-452 AD-65153 A-130242
UCCAAAGUCGCUGAGUACAUA 38 A-130243 UAUGUACUCAGCGACUUUGGAGU 125
1905-1926 AD-65084 A-129958 AUUCUACAAAAGGUAAAUAUU 39 A-129959
AAUAUUUACCUUUUGUAGAAUAU 126 1671-1692 AD-65099 A-129948
UUUCUCACAAAUAAAAGAGAU 40 A-129949 AUCUCUUUUAUUUGUGAGAAAGG 127
1457-1478 AD-65100 A-129962 UAUCAAGAUUAUAAAAUAACA 41 A-129963
UGUUAUUUUAUAAUCUUGAUAUC 128 1725-1746 AD-65090 A-129960
CUUCUUGAAAGAUAGUGUUAA 42 A-129961 UUAACACUAUCUUUCAAGAAGCA 129
302-323 AD-65085 A-129972 GAAUGUUUGCCAAGAGACUUA 43 A-129973
UAAGUCUCUUGGCAAACAUUCAC 130 1016-1037 AD-65062 A-129980
AUAUUCCUUUGGUAACAAAUA 44 A-129981 UAUUUGUUACCAAAGGAAUAUUU 131
1687-1708 AD-65164 A-130230 CGUCAUCAAAUAAGUGCUUGA 45 A-130231
UCAAGCACUUAUUUGAUGACGAC 132 384-405 AD-65139 A-130206
UCCUGCAAAAGAACUUUACCU 46 A-130207 AGGUAAAGUUCUUUUGCAGGAUA 133
918-939 AD-65151 A-130210 CAAUGUUUGCCAAGAGACUUA 47 A-130211
UAAGUCUCUUGGCAAACAUUGAC 134 1016-1037 AD-65158 A-130228
AGACACAAGCACAAUUUAUAA 48 A-130229 UUAUAAAUUGUGCUUGUGUCUCC 135
1595-1616 AD-65078 A-129956 CGAGUCACAAAGAAAUGUUUA 49 A-129957
UAAACAUUUCUUUGUGACUCGAU 136 818-839 AD-65161 A-130182
AUCUUGAAAGAUAGUGUUACA 50 A-130183 UGUAACACUAUCUUUCAAGAUGC 137
303-324 AD-65076 A-130016 AAUGUGGUCAUCAAAUAAGUA 51 A-130017
UACUUAUUUGAUGACCACAUUGC 138 379-400 AD-65093 A-130006
GUUACUCUUUGAGAUUGUGUA 52 A-130007 UACACAAUCUCAAAGAGUAACCA 139
1177-1198 AD-65156 A-130196 GUUCUUGAAAGAUAGUGUUAA 53 A-130197
UUAACACUAUCUUUCAAGAACCA 140 302-323 AD-65059 A-129934
GACUUUGGAGGAGAAGAAUUA 54 A-129935 UAAUUCUUCUCCUCCAAAGUCAA 141
972-993 AD-65073 A-129968 ACCUGCAAAAGAACUUUACCU 55 A-129969
AGGUAAAGUUCUUUUGCAGGUUA 142 918-939 AD-65074 A-129984
AUCGAGUCACAAAGAAAUGUU 56 A-129985 AACAUUUCUUUGUGACUCGAUUU 143
816-837 AD-65092 A-129990 UGACACAAGCACAAUUUAUAA 57 A-129991
UUAUAAAUUGUGCUUGUGUCACC 144 1595-1616 AD-65097 A-129992
GGUCAUCAAAUAAGUGCUUGA 58 A-129993 UCAAGCACUUAUUUGAUGACCAC 145
384-405 AD-65101 A-129978 UGGUCAUCAAAUAAGUGCUUA 59 A-129979
UAAGCACUUAUUUGAUGACCACA 146 383-404 AD-65131 A-130172
AGCCAGAAAAGAUAUCAAGAU 60 A-130173 AUCUUGAUAUCUUUUCUGGCUUU 147
1713-1734 AD-65159 A-130244 CUUACUCUUUGAGAUUGUGUA 61 A-130245
UACACAAUCUCAAAGAGUAAGCA 148 1177-1198 AD-65150 A-130194
UUUCUACAAAAGGUAAAUAUU 62 A-130195 AAUAUUUACCUUUUGUAGAAAAU 149
1671-1692 AD-65060 A-129950 CACAAUGGAAUGUGGCGUUUA 63 A-129951
UAAACGCCACAUUCCAUUGUGUU 150 1827-1848 AD-65098 A-130008
UUACUCUUUGAGAUUGUGUAA 64 A-130009 UUACACAAUCUCAAAGAGUAACC 151
1178-1199 AD-65067 A-129966 UACUCUUUGAGAUUGUGUAAA 65 A-129967
UUUACACAAUCUCAAAGAGUAAC 152 1179-1200 AD-65065 A-129936
UGCCAGAAAAGAUAUCAAGAU 66 A-129937 AUCUUGAUAUCUUUUCUGGCAUU 153
1713-1734 AD-65095 A-129946 UUCUUGAAAGAUAGUGUUACA 67 A-129947
UGUAACACUAUCUUUCAAGAAGC 154 303-324 AD-65126 A-130186
GACAAUGGAAUGUGGCGUUUA 68 A-130187 UAAACGCCACAUUCCAUUGUCUU 155
1827-1848 AD-65157 A-130212 AAUAAAAUAACCCAACGGAUA 69 A-130213
UAUCCGUUGGGUUAUUUUAUUAU 156 1734-1755 AD-65086 A-129988
CUUAAAACAUCUGAAAGUGGA 70 A-129989 UCCACUUUCAGAUGUUUUAAGAA 157
843-864 AD-65167 A-130200 AAUCAAGAUUAUAAAAUAACA 71 A-130201
UGUUAUUUUAUAAUCUUGAUUUC 158 1725-1746 AD-65071 A-129938
AGUAACGUGGAAUCUGGAUUA 72 A-129939 UAAUCCAGAUUCCACGUUACUCA 159
618-639 AD-65066 A-129952 UAUAAAGGAGUUGAUAUGAGA 73 A-129953
UCUCAUAUCAACUCCUUUAUAAA 160 417-438 AD-65165 A-130246
AUACUCUUUGAGAUUGUGUAA 74 A-130247 UUACACAAUCUCAAAGAGUAUCC 161
1178-1199 AD-65132 A-130188 AAUAAAGGAGUUGAUAUGAGA 75 A-130189
UCUCAUAUCAACUCCUUUAUUAA 162 417-438 AD-65125 A-130170
CACUUUGGAGGAGAAGAAUUA 76 A-130171 UAAUUCUUCUCCUCCAAAGUGAA 163
972-993 AD-65091 A-129974 UAUAAAAUAACCCAACGGAUA 77 A-129975
UAUCCGUUGGGUUAUUUUAUAAU 164 1734-1755 AD-65136 A-130252
GAAUGUGGUCAUCAAAUAAGU 78 A-130253 ACUUAUUUGAUGACCACAUUCCU 165
378-399 AD-65137 A-130174 UGUAACGUGGAAUCUGGAUUA 79 A-130175
UAAUCCAGAUUCCACGUUACACA 166 618-639 AD-65140 A-130222
UUCGAGUCACAAAGAAAUGUU 80 A-130223 AACAUUUCUUUGUGACUCGAAUU 167
816-837 AD-65128 A-130218 UUAUUCCUUUGGUAACAAAUA 81 A-130219
UAUUUGUUACCAAAGGAAUAAUU 168 1687-1708 AD-65088 A-130020
ACACAAGCACAAUUUAUACCA 82 A-130021 UGGUAUAAAUUGUGCUUGUGUCA 169
1597-1618 AD-65160 A-130260 CUGGAAUCUGGAUUCUCACUA 83 A-130261
UAGUGAGAAUCCAGAUUCCAGGU 170 624-645 AD-65152 A-130226
GUUAAAACAUCUGAAAGUGGA 84 A-130227 UCCACUUUCAGAUGUUUUAACAA 171
843-864 AD-65133 A-130204 AACUCUUUGAGAUUGUGUAAA 85 A-130205
UUUACACAAUCUCAAAGAGUUAC 172 1179-1200 AD-65082 A-130018
GCAAUGUGGUCAUCAAAUAAA 86 A-130019 UUUAUUUGAUGACCACAUUGCUU 173
377-398 AD-65094 A-130022 GUGGAAUCUGGAUUCUCACUA 87 A-130023
UAGUGAGAAUCCAGAUUCCACGU 174 624-645 AD-65155 A-130180
GGCAUUGUUGGAGGAACAAAA 88 A-130181 UUUUGUUCCUCCAACAAUGCCUG 175
1239-1260 AD-65163 A-130214 UUUGUUGGAGGAACAAACUCU 89 A-130215
AGAGUUUGUUCCUCCAACAAAGC 176 1242-1263 AD-65144 A-130192
GGAGUCACAAAGAAAUGUUUA 90 A-130193 UAAACAUUUCUUUGUGACUCCAU 177
818-839 AD-65096 A-129976 AUUGUUGGAGGAACAAACUCU 91 A-129977
AGAGUUUGUUCCUCCAACAAUGC 178 1242-1263 AD-65142 A-130254
UAUGUGGUCAUCAAAUAAGUA 92 A-130255 UACUUAUUUGAUGACCACAUAGC 179
379-400 AD-65141 A-130238 CAAAAGAUGCUUGUAAGGGAA 93 A-130239
UUCCCUUACAAGCAUCUUUUGCC 180 1780-1801 AD-65079 A-129970
GUCUGUGCUGGCUAUAAAGAA 94 A-129971 UUCUUUAUAGCCAGCACAGACCA 181
1755-1776 AD-65102 A-129994 AGCAGUGUUGAAGAAUGCCAA 95 A-129995
UUGGCAUUCUUCAACACUGCUAA 182 465-486 AD-65138 A-130190
GUGUGUGGAGGGUCACUCAUA 96 A-130191 UAUGAGUGACCCUCCACACACGU 183
1323-1344 AD-65075 A-130000 GAAAAGAUGCUUGUAAGGGAA 97 A-130001
UUCCCUUACAAGCAUCUUUUCCC 184 1780-1801 AD-65080 A-129986
ACAUCUGAAAGUGGCACACCA 98 A-129987 UGGUGUGCCACUUUCAGAUGUUU 185
849-870 AD-65145 A-130208 CUCUGUGCUGGCUAUAAAGAA 99 A-130209
UUCUUUAUAGCCAGCACAGAGCA 186 1755-1776 AD-65169 A-130232
UGCAGUGUUGAAGAAUGCCAA 100 A-130233 UUGGCAUUCUUCAACACUGCAAA 187
465-486 AD-65061 A-129964 UUCUUAAAACAUCUGAAAGUA 101 A-129965
UACUUUCAGAUGUUUUAAGAAGA 188 841-862 AD-65135 A-130236
UAGCACAAUUUAUACCAACUA 102 A-130237 UAGUUGGUAUAAAUUGUGCUAGU 189
1601-1622 AD-65068 A-129982 UGGAAUGUGGCGUUUGGUGGA 103 A-129983
UCCACCAAACGCCACAUUCCAUU 190 1832-1853 AD-65148 A-130256
CCAAUGUGGUCAUCAAAUAAA 104 A-130257 UUUAUUUGAUGACCACAUUGGUU 191
377-398 AD-65072 A-129954 CUGUGUGGAGGGUCACUCAUA 105 A-129955
UAUGAGUGACCCUCCACACAGGU 192 1323-1344 AD-65146 A-130224
UCAUCUGAAAGUGGCACACCA 106 A-130225 UGGUGUGCCACUUUCAGAUGAUU 193
849-870 AD-65129 A-130234 CCACAAUUUAUACCAACUGUU 107 A-130235
AACAGUUGGUAUAAAUUGUGGUU 194 1603-1624 AD-65064 A-130012
CACAAGCACAAUUUAUACCAA 108 A-130013 UUGGUAUAAAUUGUGCUUGUGUC 195
1598-1619 AD-65134 A-130220 AGGAAUGUGGCGUUUGGUGGA 109 A-130221
UCCACCAAACGCCACAUUCCUUU 196 1832-1853 AD-65063 A-129996
GCACAAUUUAUACCAACUGUU 110 A-129997 AACAGUUGGUAUAAAUUGUGCUU 197
1603-1624
AD-65089 A-129944 CGCAUUGUUGGAGGAACAAAA 111 A-129945
UUUUGUUCCUCCAACAAUGCGUG 198 1239-1260 AD-65069 A-129998
AAGCACAAUUUAUACCAACUA 112 A-129999 UAGUUGGUAUAAAUUGUGCUUGU 199
1601-1622 AD-65130 A-130250 GACAAGCACAAUUUAUACCAA 113 A-130251
UUGGUAUAAAUUGUGCUUGUCUC 200 1598-1619 AD-65147 A-130240
UUUUACCCGGGAGUUGACUUU 114 A-130241 AAAGUCAACUCCCGGGUAAAAUU 201
957-978 AD-65081 A-130002 AUUUACCCGGGAGUUGACUUU 115 A-130003
AAAGUCAACUCCCGGGUAAAUUU 202 957-978 AD-65154 A-130258
UCACAAGCACAAUUUAUACCA 116 A-130259 UGGUAUAAAUUGUGCUUGUGACA 203
1597-1618
TABLE-US-00004 TABLE 4 Modified Sense and Antisense Strand
Sequences of KLKB1 dsRNAs Duplex Sense Oligo SEQ ID Antisence SEQ
ID Name Name Sense Sequence 5' to 3' NO: Oligo Name Antisense
Sequence 5' to 3' NO: AD-65077 A-129940
AfsasUfcCfaAfaAfUfAfuUfcUfaCfaAfaAfL96 204 A-129941
usUfsuUfgUfaGfaAfuauUfuUfgGfaUfususc 291 AD-65170 A-130248
CfsusGfgUfcAfuCfAfAfaUfaAfgUfgCfuUfL96 205 A-130249
asAfsgCfaCfuUfaUfuugAfuGfaCfcAfgsasu 292 AD-65103 A-130010
GfsusGfgUfcAfuCfAfAfaUfaAfgUfgCfuUfL96 206 A-130011
asAfsgCfaCfuUfaUfuugAfuGfaCfcAfcsasu 293 AD-65083 A-129942
CfsasUfgGfaCfuGfGfAfuUfuUfaGfaGfaAfL96 207 A-129943
usUfscUfcUfaAfaAfuccAfgUfcCfaUfgsusa 294 AD-65087 A-130004
AfscsCfaAfaGfuCfGfCfuGfaGfuAfcAfuAfL96 208 A-130005
usAfsuGfuAfcUfcAfgcgAfcUfuUfgGfusgsu 295 AD-65149 A-130178
GfsasUfgGfaCfuGfGfAfuUfuUfaGfaGfaAfL96 209 A-130179
usUfscUfcUfaAfaAfuccAfgUfcCfaUfcsusa 296 AD-64652 A-129275
UfsasUfgAfgAfgGfAfGfuCfaAfuUfuUfaAfL96 210 A-129276
usUfsaAfaAfuUfgAfcucCfuCfuCfaUfasusc 297 AD-65162 A-130198
AfsasUfgAfgAfgGfAfGfuCfaAfuUfuUfaAfL96 211 A-130199
usUfsaAfaAfuUfgAfcucCfuCfuCfaUfususc 298 AD-65153 A-130242
UfscsCfaAfaGfuCfGfCfuGfaGfuAfcAfuAfL96 212 A-130243
usAfsuGfuAfcUfcAfgcgAfcUfuUfgGfasgsu 299 AD-65084 A-129958
AfsusUfcUfaCfaAfAfAfgGfuAfaAfuAfuUfL96 213 A-129959
asAfsuAfuUfuAfcCfuuuUfgUfaGfaAfusasu 300 AD-65099 A-129948
UfsusUfcUfcAfcAfAfAfuAfaAfaGfaGfaUfL96 214 A-129949
asUfscUfcUfuUfuAfuuuGfuGfaGfaAfasgsg 301 AD-65100 A-129962
UfsasUfcAfaGfaUfUfAfuAfaAfaUfaAfcAfL96 215 A-129963
usGfsuUfaUfuUfuAfuaaUfcUfuGfaUfasusc 302 AD-65090 A-129960
CfsusUfcUfuGfaAfAfGfaUfaGfuGfuUfaAfL96 216 A-129961
usUfsaAfcAfcUfaUfcuuUfcAfaGfaAfgscsa 303 AD-65085 A-129972
GfsasAfuGfuUfuGfCfCfaAfgAfgAfcUfuAfL96 217 A-129973
usAfsaGfuCfuCfuUfggcAfaAfcAfuUfcsasc 304 AD-65062 A-129980
AfsusAfuUfcCfuUfUfGfgUfaAfcAfaAfuAfL96 218 A-129981
usAfsuUfuGfuUfaCfcaaAfgGfaAfuAfususu 305 AD-65164 A-130230
CfsgsUfcAfuCfaAfAfUfaAfgUfgCfuUfgAfL96 219 A-130231
usCfsaAfgCfaCfuUfauuUfgAfuGfaCfgsasc 306 AD-65139 A-130206
UfscsCfuGfcAfaAfAfGfaAfcUfuUfaCfcUfL96 220 A-130207
asGfsgUfaAfaGfuUfcuuUfuGfcAfgGfasusa 307 AD-65151 A-130210
CfsasAfuGfuUfuGfCfCfaAfgAfgAfcUfuAfL96 221 A-130211
usAfsaGfuCfuCfuUfggcAfaAfcAfuUfgsasc 308 AD-65158 A-130228
AfsgsAfcAfcAfaGfCfAfcAfaUfuUfaUfaAfL96 222 A-130229
usUfsaUfaAfaUfuGfugcUfuGfuGfuCfuscsc 309 AD-65078 A-129956
CfsgsAfgUfcAfcAfAfAfgAfaAfuGfuUfuAfL96 223 A-129957
usAfsaAfcAfuUfuCfuuuGfuGfaCfuCfgsasu 310 AD-65161 A-130182
AfsusCfuUfgAfaAfGfAfuAfgUfgUfuAfcAfL96 224 A-130183
usGfsuAfaCfaCfuAfucuUfuCfaAfgAfusgsc 311 AD-65076 A-130016
AfsasUfgUfgGfuCfAfUfcAfaAfuAfaGfuAfL96 225 A-130017
usAfscUfuAfuUfuGfaugAfcCfaCfaUfusgsc 312 AD-65093 A-130006
GfsusUfaCfuCfuUfUfGfaGfaUfuGfuGfuAfL96 226 A-130007
usAfscAfcAfaUfcUfcaaAfgAfgUfaAfcscsa 313 AD-65156 A-130196
GfsusUfcUfuGfaAfAfGfaUfaGfuGfuUfaAfL96 227 A-130197
usUfsaAfcAfcUfaUfcuuUfcAfaGfaAfcscsa 314 AD-65059 A-129934
GfsasCfuUfuGfgAfGfGfaGfaAfgAfaUfuAfL96 228 A-129935
usAfsaUfuCfuUfcUfccuCfcAfaAfgUfcsasa 315 AD-65073 A-129968
AfscsCfuGfcAfaAfAfGfaAfcUfuUfaCfcUfL96 229 A-129969
asGfsgUfaAfaGfuUfcuuUfuGfcAfgGfususa 316 AD-65074 A-129984
AfsusCfgAfgUfcAfCfAfaAfgAfaAfuGfuUfL96 230 A-129985
asAfscAfuUfuCfuUfuguGfaCfuCfgAfususu 317 AD-65092 A-129990
UfsgsAfcAfcAfaGfCfAfcAfaUfuUfaUfaAfL96 231 A-129991
usUfsaUfaAfaUfuGfugcUfuGfuGfuCfascsc 318 AD-65097 A-129992
GfsgsUfcAfuCfaAfAfUfaAfgUfgCfuUfgAfL96 232 A-129993
usCfsaAfgCfaCfuUfauuUfgAfuGfaCfcsasc 319 AD-65101 A-129978
UfsgsGfuCfaUfcAfAfAfuAfaGfuGfcUfuAfL96 233 A-129979
usAfsaGfcAfcUfuAfuuuGfaUfgAfcCfascsa 320 AD-65131 A-130172
AfsgsCfcAfgAfaAfAfGfaUfaUfcAfaGfaUfL96 234 A-130173
asUfscUfuGfaUfaUfcuuUfuCfuGfgCfususu 321 AD-65159 A-130244
CfsusUfaCfuCfuUfUfGfaGfaUfuGfuGfuAfL96 235 A-130245
usAfscAfcAfaUfcUfcaaAfgAfgUfaAfgscsa 322 AD-65150 A-130194
UfsusUfcUfaCfaAfAfAfgGfuAfaAfuAfuUfL96 236 A-130195
asAfsuAfuUfuAfcCfuuuUfgUfaGfaAfasasu 323 AD-65060 A-129950
CfsasCfaAfuGfgAfAfUfgUfgGfcGfuUluAfL96 237 A-129951
usAfsaAfcGfcCfaCfauuCfcAfuUfgUfgsusu 324 AD-65098 A-130008
UfsusAfcUfcUfuUfGfAfgAfuUfgUfgUfaAfL96 238 A-130009
usUfsaCfaCfaAfuCfucaAfaGfaGfuAfascsc 325 AD-65067 A-129966
UfsasCfuCfuUfuGfAfGfaUfuGfuGfuAfaAfL96 239 A-129967
usUfsuAfcAfcAfaUfcucAfaAfgAfgUfasasc 326 AD-65065 A-129936
UfsgsCfcAfgAfaAfAfGfaUfaUfcAfaGfaUfL96 240 A-129937
asUfscUfuGfaUfaUfcuuUfuCfuGfgCfasusu 327 AD-65095 A-129946
UfsusCfuUfgAfaAfGfAfuAfgUfgUfuAfcAfL96 241 A-129947
usGfsuAfaCfaCfuAfucuUfuCfaAfgAfasgsc 328 AD-65126 A-130186
GfsasCfaAfuGfgAfAfUfgUfgGfcGfutifuAfL96 242 A-130187
usAfsaAfcGfcCfaCfauuCfcAfuUfgUfcsusu 329 AD-65157 A-130212
AfsasUfaAfaAfuAfAfCfcCfaAfcGfgAfuAfL96 243 A-130213
usAfsuCfcGfuUfgGfguuAfuUfuUfaUfusasu 330 AD-65086 A-129988
CfsusUfaAfaAfcAfUfCfuGfaAfaGfuGfgAfL96 244 A-129989
usCfscAfcUfuUfcAfgauGfuUfuUfaAfgsasa 331 AD-65167 A-130200
AfsasUfcAfaGfaUfUfAfuAfaAfaUfaAfcAfL96 245 A-130201
usGfsuUfaUfuUfuAfuaaUfcUfuGfaUfususc 332 AD-65071 A-129938
AfsgsUfaAfcGfuGfGfAfaUfcUfgGfaUfuAfL96 246 A-129939
usAfsaUfcCfaGfaUfuccAfcGfuUfaCfuscsa 333 AD-65066 A-129952
UfsasUfaAfaGfgAfGfUfuGfaUfaUfgAfgAfL96 247 A-129953
usCfsuCfaUfaUfcAfacuCfcUfuUfaUfasasa 334 AD-65165 A-130246
AfsusAfcUfcUfuUfGfAfgAfuUfgUfgUfaAfL96 248 A-130247
usUfsaCfaCfaAfuCfucaAfaGfaGfuAfuscsc 335 AD-65132 A-130188
AfsasUfaAfaGfgAfGfUfuGfaUfaUfgAfgAfL96 249 A-130189
usCfsuCfaUfaUfcAfacuCfcUfuUfaUfusasa 336 AD-65125 A-130170
CfsasCfuUfuGfgAfGfGfaGfaAfgAfaUfuAfL96 250 A-130171
usAfsaUfuCfuUfcUfccuCfcAfaAfgUfgsasa 337 AD-65091 A-129974
UfsasUfaAfaAfuAfAfCfcCfaAfcGfgAfuAfL96 251 A-129975
usAfsuCfcGfuUfgGfguuAfuUfuUfaUfasasu 338 AD-65136 A-130252
GfsasAfuGfuGfgUfCfAfuCfaAfaUfaAfgUfL96 252 A-130253
asCfsuUfaUfuUfgAfugaCfcAfcAfuUfcscsu 339 AD-65137 A-130174
UfsgsUfaAfcGfuGfGfAfaUfcUfgGfaUfuAfL96 253 A-130175
usAfsaUfcCfaGfaUfuccAfcGfuUfaCfascsa 340 AD-65140 A-130222
UfsusCfgAfgUfcAfCfAfaAfgAfaAfuGfuUfL96 254 A-130223
asAfscAfuUfuCfuUfuguGfaCfuCfgAfasusu 341 AD-65128 A-130218
UfsusAfuUfcCfuUfUfGfgUfaAfcAfaAfuAfL96 255 A-130219
usAfsuUfuGfuUfaCfcaaAfgGfaAfuAfasusu 342 AD-65088 A-130020
AfscsAfcAfaGfcAfCfAfaUfuUfaUfaCfcAfL96 256 A-130021
usGfsgUfaUfaAfaUfuguGfcUfuGfuGfuscsa 343 AD-65160 A-130260
CfsusGfgAfaUfcUfGfGfaUfuCfuCfaCfuAfL96 257 A-130261
usAfsgUfgAfgAfaUfccaGfaUfuCfcAfgsgsu 344 AD-65152 A-130226
GfsusUfaAfaAfcAfUfCfuGfaAfaGfuGfgAfL96 258 A-130227
usCfscAfcUfuUfcAfgauGfuUfuUfaAfcsasa 345 AD-65133 A-130204
AfsasCfuCfuUfuGfAfGfaUfuGfuGfuAfaAfL96 259 A-130205
usUfsuAfcAfcAfaUfcucAfaAfgAfgUfusasc 346 AD-65082 A-130018
GfscsAfaUfgUfgGfUfCfaUfcAfaAfuAfaAfL96 260 A-130019
usUfsuAfuUfuGfaUfgacCfaCfaUfuGfcsusu 347 AD-65094 A-130022
GfsusGfgAfaUfcUfGfGfaUfuCfuCfaCfuAfL96 261 A-130023
usAfsgUfgAfgAfaUfccaGfaUfuCfcAfcsgsu 348 AD-65155 A-130180
GfsgsCfaUfuGfuUfGfGfaGfgAfaCfaAfaAfL96 262 A-130181
usUfsuUfgUfuCfcUfccaAfcAfaUfgCfcsusg 349 AD-65163 A-130214
UfsusUfgUfuGfgAfGfGfaAfcAfaAfcUfcUfL96 263 A-130215
asGfsaGfuUfuGfuUfccuCfcAfaCfaAfasgsc 350 AD-65144 A-130192
GfsgsAfgUfcAfcAfAfAfgAfaAfuGfuUfuAfL96 264 A-130193
usAfsaAfcAfuUfuCfuuuGfuGfaCfuCfcsasu 351 AD-65096 A-129976
AfsusUfgUfuGfgAfGfGfaAfcAfaAfcUfcUfL96 265 A-129977
asGfsaGfuUfuGfuUfccuCfcAfaCfaAfusgsc 352 AD-65142 A-130254
UfsasUfgUfgGfuCfAfUfcAfaAfuAfaGfuAfL96 266 A-130255
usAfscUfuAfuUfuGfaugAfcCfaCfaUfasgsc 353 AD-65141 A-130238
CfsasAfaAfgAfuGfCfUfuGfuAfaGfgGfaAfL96 267 A-130239
usUfscCfcUfuAfcAfagcAfuCfuUfuUfgscsc 354 AD-65079 A-129970
GfsusCfuGfuGfcUfGfGfcUfaUfaAfaGfaAfL96 268 A-129971
usUfscUfuUfaUfaGfccaGfcAfcAfgAfcscsa 355 AD-65102 A-129994
AfsgsCfaGfuGfuUfGfAfaGfaAfuGfcCfaAfL96 269 A-129995
usUfsgGfcAfuUfcUfucaAfcAfcUfgCfusasa 356 AD-65138 A-130190
GfsusGfuGfuGfgAfGfGfgUfcAfcUfcAfuAfL96 270 A-130191
usAfsuGfaGfuGfaCfccuCfcAfcAfcAfcsgsu 357 AD-65075 A-130000
GfsasAfaAfgAfuGfCfUfuGfuAfaGfgGfaAfL96 271 A-130001
usUfscCfcUfuAfcAfagcAfuCfuUfuUfcscsc 358 AD-65080 A-129986
AfscsAfuCfuGfaAfAfGfuGfgCfaCfaCfcAfL96 272 A-129987
usGfsgUfgUfgCfcAfcuuUfcAfgAfuGfususu 359 AD-65145 A-130208
CfsusCfuGfuGfcUfGfGfcUfaUfaAfaGfaAfL96 273 A-130209
usUfscUfuUfaUfaGfccaGfcAfcAfgAfgscsa 360 AD-65169 A-130232
UfsgsCfaGfuGfuUfGfAfaGfaAfuGfcCfaAfL96 274 A-130233
usUfsgGfcAfuUfcUfucaAfcAfcUfgCfasasa 361 AD-65061 A-129964
UfsusCfuUfaAfaAfCfAfuCfuGfaAfaGfuAfL96 275 A-129965
usAfscUfuUfcAfgAfuguUfuUfaAfgAfasgsa 362 AD-65135 A-130236
UfsasGfcAfcAfaUfUfUfaUfaCfcAfaCfuAfL96 276 A-130237
usAfsgUfuGfgUfaUfaaaUfuGfuGfcUfasgsu 363 AD-65068 A-129982
UfsgsGfaAfuGfuGfGfCfgUfuUfgGfuGfgAfL96 277 A-129983
usCfscAfcCfaAfaCfgccAfcAfuUfcCfasusu 364 AD-65148 A-130256
CfscsAfaUfgUfgGfUfCfaUfcAfaAfuAfaAfL96 278 A-130257
usUfsuAfuUfuGfaUfgacCfaCfaUfuGfgsusu 365 AD-65072 A-129954
CfsusGfuGfuGfgAfGfGfgUfcAfcUfcAfuAfL96 279 A-129955
usAfsuGfaGfuGfaCfccuCfcAfcAfcAfgsgsu 366 AD-65146 A-130224
UfscsAfuCfuGfaAfAfGfuGfgCfaCfaCfcAfL96 280 A-130225
usGfsgUfgUfgCfcAfcuuUfcAfgAfuGfasusu 367 AD-65129 A-130234
CfscsAfcAfaUfuUfAfUfaCfcAfaCfuGfuUfL96 281 A-130235
asAfscAfgUfuGfgUfauaAfaUfuGfuGfgsusu 368 AD-65064 A-130012
CfsasCfaAfgCfaCfAfAfuUfuAfuAfcCfaAfL96 282 A-130013
usUfsgGfuAfuAfaAfuugUfgCfuUfgUfgsusc 369 AD-65134 A-130220
AfsgsGfaAfuGfuGfGfCfgUfuUfgGfuGfgAfL96 283 A-130221
usCfscAfcCfaAfaCfgccAfcAfuUfcCfususu 370 AD-65063 A-129996
GfscsAfcAfaUfuUfAfUfaCfcAfaCfuGfuUfL96 284 A-129997
asAfscAfgUfuGfgUfauaAfaUfuGfuGfcsusu 371
AD-65089 A-129944 CfsgsCfaUfuGfuUfGfGfaGfgAfaCfaAfaAfL96 285
A-129945 usUfsuUfgUfuCfcUfccaAfcAfaUfgCfgsusg 372 AD-65069 A-129998
AfsasGfcAfcAfaUfUfUfaUfaCfcAfaCfuAfL96 286 A-129999
usAfsgUfuGfgUfaUfaaaUfuGfuGfcUfusgsu 373 AD-65130 A-130250
GfsasCfaAfgCfaCfAfAfuUfuAfuAfcCfaAfL96 287 A-130251
usUfsgGfuAfuAfaAfuugUfgCfuUfgUfcsusc 374 AD-65147 A-130240
UfsusUfuAfcCfcGfGfGfaGfuUfgAfcUluUfL96 288 A-130241
asAfsaGfuCfaAfcUfcccGfgGfuAfaAfasusu 375 AD-65081 A-130002
AfsusUfuAfcCfcGfGfGfaGfuUfgAfcUluUfL96 289 A-130003
asAfsaGfuCfaAfcUfcccGfgGfuAfaAfususu 376 AD-65154 A-130258
UfscsAfcAfaGfcAfCfAfaUfuUfaUfaCfcAfL96 290 A-130259
usGfsgUfaUfaAfaUfuguGfcUfuGfuGfascsa 377
TABLE-US-00005 TABLE 5 Human KLKB1 single dose screen using Dual-
Glo Luciferase .RTM. Assay 10 0.1 10 0.1 Duplex ID nM Avg nM Avg nM
SD nM_SD AD-65077 15.04 36.85 1.97 0.94 AD-65170 11.72 37.36 1.61
3.43 AD-65103 11.77 40.29 1.72 2.58 AD-65083 14.90 46.32 1.64 3.59
AD-65087 14.83 47.05 0.93 3.15 AD-65149 15.68 47.95 1.10 5.95
AD-64652 17.40 48.15 0.98 2.10 AD-65162 20.26 48.59 0.11 6.03
AD-65153 13.45 49.10 0.80 3.51 AD-65084 16.25 49.14 1.79 4.63
AD-65099 14.44 49.82 2.09 1.40 AD-65100 19.10 50.71 0.37 1.49
AD-65090 18.90 50.81 1.95 7.82 AD-65085 15.98 52.77 0.74 3.97
AD-65062 16.20 54.87 0.06 3.28 AD-65164 14.22 55.83 0.13 5.41
AD-65139 14.30 56.04 0.82 4.47 AD-65151 15.78 56.12 2.34 8.24
AD-65158 22.09 56.30 2.11 4.24 AD-65078 16.43 56.83 2.21 4.52
AD-65161 20.86 56.93 1.98 2.35 AD-65076 15.06 57.79 1.13 3.90
AD-65093 18.51 58.48 1.65 2.72 AD-65156 21.88 58.48 1.23 5.06
AD-65059 23.66 59.20 2.39 9.41 AD-65073 14.96 59.62 0.84 4.37
AD-65074 20.38 59.64 1.70 4.26 AD-65092 25.49 59.65 1.13 5.25
AD-65097 16.10 59.84 1.05 6.04 AD-65101 17.79 60.00 1.09 7.50
AD-65131 26.32 60.83 3.13 4.22 AD-65159 20.30 60.84 1.29 5.93
AD-65150 26.14 60.87 2.74 5.87 AD-65060 21.85 61.24 2.64 8.69
AD-65098 21.82 61.42 1.59 2.06 AD-65067 14.78 61.63 1.49 1.15
AD-65065 30.49 61.91 1.08 3.88 AD-65095 20.31 62.19 0.93 3.55
AD-65126 22.68 62.58 2.00 3.65 AD-65157 37.47 63.14 1.23 3.92
AD-65086 32.28 63.19 2.00 6.01 AD-65167 26.43 63.54 1.61 3.80
AD-65071 26.58 64.16 2.30 2.64 AD-65066 22.13 64.20 1.26 3.77
AD-65165 21.89 64.31 2.14 3.57 AD-65132 21.03 64.52 2.67 2.21
AD-65125 25.73 64.78 3.64 10.30 AD-65091 35.66 65.28 3.85 0.92
AD-65136 19.19 65.74 1.46 2.65 AD-65137 28.04 65.76 1.12 4.54
AD-65140 27.71 65.90 2.52 2.03 AD-65128 24.33 66.14 3.88 6.36
AD-65088 38.37 66.28 0.75 4.58 AD-65160 25.02 66.42 1.10 2.11
AD-65152 48.65 66.46 2.84 2.02 AD-65133 14.03 66.60 1.79 1.76
AD-65082 28.29 66.66 3.48 4.83 AD-65094 26.65 66.78 0.56 1.41
AD-65155 40.50 66.99 2.70 1.23 AD-65163 35.04 67.16 3.15 4.42
AD-65144 22.23 67.27 1.79 0.87 AD-65096 36.47 67.31 2.64 1.97
AD-65142 19.07 67.32 3.01 1.34 AD-65141 15.21 67.58 1.60 3.45
AD-65079 29.27 67.76 2.80 3.80 AD-65102 30.46 68.54 2.45 1.65
AD-65138 41.51 68.68 2.13 5.34 AD-65075 16.72 69.00 1.04 1.14
AD-65080 36.41 69.03 4.21 3.96 AD-65145 34.78 69.34 2.61 2.95
AD-65169 30.06 69.63 2.17 4.29 AD-65061 41.00 70.18 4.34 3.71
AD-65135 67.86 70.58 2.28 5.97 AD-65068 30.14 71.51 3.78 4.08
AD-65148 37.81 71.67 7.51 2.54 AD-65072 43.46 71.73 1.45 6.71
AD-65146 55.99 71.80 5.50 3.07 AD-65129 34.09 71.81 1 22 2.86
AD-65064 37.23 71.84 4.61 2.50 AD-65134 34.90 71.86 3.14 2.91
AD-65063 32.52 72.21 2.92 4.47 AD-65089 34.88 73.21 0.07 0.46
AD-65069 59.34 73.27 4.47 4.89 AD-65130 38.52 73.89 1.69 2.78
AD-65147 69.27 76.69 7.33 4.28 AD-65081 55.75 77.78 4.77 5.96
AD-65154 45.69 79.81 2.01 7.82
TABLE-US-00006 TABLE 6 Mouse KLKB1 single dose screen using Dual-
Glo Luciferase .RTM. Assay 10 0.1 10 0.1 Duplex ID nM Avg nM Avg nM
SD nM_SD AD-65077 8.67 44.09 0.45 0.12 AD-65103 13.99 52.56 1.01
0.70 AD-65087 11.03 55.15 0.53 0.44 AD-65101 18.50 57.32 1.40 5.05
AD-65151 13.94 58.04 0.90 1.91 AD-65097 17.04 58.72 1.99 3.06
AD-65170 25.69 59.35 1.72 3.72 AD-65062 32.25 60.50 3.49 0.75
AD-65064 34.48 61.67 1.44 0.10 AD-65085 13.68 61.86 1.70 3.87
AD-65063 17.43 61.92 1.12 2.56 AD-65153 23.75 62.67 2.17 2.36
AD-65089 30.93 62.79 0.75 2.15 AD-65074 43.09 63.07 1.73 4.37
AD-65067 18.02 63.49 2.41 2.86 AD-65099 48.62 63.58 2.12 4.44
AD-65091 67.51 64.14 8.48 2.38 AD-65086 41.17 64.14 4.31 2.61
AD-65059 75.31 64.20 2.59 3.27 AD-65158 59.18 64.32 3.51 2.00
AD-65095 65.59 64.35 6.12 5.81 AD-65083 32.77 64.54 1.99 3.38
AD-65169 66.29 64.54 3.45 4.37 AD-65125 71.21 64.58 3.75 2.19
AD-65141 34.27 64.65 2.11 5.10 AD-65073 47.93 64.68 2.48 1.94
AD-65142 49.73 64.74 4.36 5.42 AD-65128 37.04 64.86 3.14 0.92
AD-65075 34.53 65.38 3.98 1.48 AD-65068 75.01 65.42 1.57 3.56
AD-65148 54.43 65.52 3.04 1.57 AD-65065 110.49 65.55 4.29 2.79
AD-65071 54.17 65.62 3.09 2.92 AD-65061 112.26 65.87 2.27 2.26
AD-65060 63.69 65.90 5.04 0.97 AD-65076 27.86 65.98 2.99 3.32
AD-65098 51.86 66.08 3.95 6.10 AD-64652 70.91 66.42 5.35 3.70
AD-65154 65.58 66.44 3.77 1.79 AD-65131 104.49 66.84 3.11 3.42
AD-65152 46.64 66.91 2.11 2.46 AD-65160 18.79 67.16 0.67 4.48
AD-65133 23.73 67.16 1.62 3.56 AD-65096 55.79 67.18 3.11 4.26
AD-65163 62.97 67.20 4.28 0.88 AD-65157 66.01 67.22 4.10 3.60
AD-65092 51.19 67.53 3.56 1.95 AD-65093 52.08 67.55 2.16 1.72
AD-65130 57.52 67.76 6.66 1.12 AD-65100 74.97 67.91 6.18 2.73
AD-65102 63.88 67.94 2.90 2.22 AD-65159 59.98 67.94 6.46 4.35
AD-65165 62.31 67.95 1.86 3.06 AD-65150 81.30 68.12 8.66 0.38
AD-65164 34.95 68.44 0.63 3.58 AD-65136 50.50 68.53 3.84 0.44
AD-65161 71.46 68.64 3.85 1.88 AD-65088 48.15 68.68 3.38 1.80
AD-65134 68.99 68.91 2.75 1.56 AD-65078 63.09 69.05 4.57 3.85
AD-65129 18.28 69.24 1.92 0.72 AD-65155 45.01 69.32 3.93 1.78
AD-65079 47.09 69.38 0.79 3.42 AD-65126 67.47 69.39 3.54 7.01
AD-65144 65.85 69.71 2.58 4.73 AD-65084 81.65 69.74 4.96 3.77
AD-65162 74.13 69.80 5.71 3.24 AD-65140 54.32 69.81 1.87 3.84
AD-65139 46.64 69.97 6.00 2.50 AD-65147 66.48 69.99 4.21 3.72
AD-65069 67.61 70.00 2.85 2.74 AD-65149 45.54 70.01 2.63 2.08
AD-65072 73.76 70.21 3.59 1.93 AD-65146 79.06 70.25 5.25 2.65
AD-65145 41.44 70.43 1.00 3.89 AD-65132 72.39 70.57 2.20 1.67
AD-65090 112.31 70.73 6.67 2.16 AD-65094 35.82 70.81 2.77 0.09
AD-65066 75.47 70.83 3.28 4.93 AD-65137 57.80 71.08 2.54 3.10
AD-65081 62.66 71.12 4.17 6.09 AD-65082 42.77 71.30 1.68 1.58
AD-65138 72.87 71.49 1.82 2.34 AD-65080 68.06 72.17 3.20 0.58
AD-65167 73.30 72.47 5.89 3.39 AD-65135 76.47 72.83 0.50 2.14
AD-65156 104.49 73.62 4.93 2.80 AD-65077 15.04 36.85 1.97 0.94
AD-65170 11.72 37.36 1.61 3.43 AD-65103 11.77 40.29 1.72 2.58
[0642] A subset of duplexes were also assayed for dose response for
silencing human KLKB1 and mouse KLKB1 mRNA using the Dual-Glo.RTM.
Luciferase assay, as described above. The results of the human
KLKB1 screen in Cos7 cells transfected with the indicated KLKB1
iRNAs are shown in Table 7. The results of the mouse KLKB1 screen
in Cos7 cells transfected with the indicated KLKB1 iRNAs are shown
in Table 8. Data are expressed as percent of mRNA remaining
relative to negative control at 48 hours.
TABLE-US-00007 TABLE 7 Human KLKB1 dose response screen in Cos7
cells using Dual-Glo Luciferase .RTM. Assay Duplex ID IC50 (nM)
AD-65077 0.0004 AD-65170 0.0084 AD-65103 0.0344 AD-65083 0.0704
AD-65087 0.0593 AD-65149 0.0854 AD-64652 0.123 AD-65162 0.1323
AD-65153 0.0683 AD-65084 0.0987 AD-65099 0.0211
TABLE-US-00008 TABLE 8 Mouse KLKB1 dose response screen in Cos7
cells using Dual-Glo Luciferase .RTM. Assay Duplex ID IC50 (nM)
AD-65077 0.0083 AD-65170 0.206 AD-65103 0.1216 AD-65083 1.2257
AD-65087 0.1381 AD-65149 36.5482 AD-64652 N/A AD-65162 N/A AD-65153
0.4234 AD-65084 N/A AD-65099 246.7682
Example 3
F12 iRNA Synthesis
Source of Reagents
[0643] Where the source of a reagent is not specifically given
herein, such reagent can be obtained from any supplier of reagents
for molecular biology at a quality/purity standard for application
in molecular biology.
Transcripts
[0644] siRNA Design
[0645] A set of siRNAs targeting the human F12, "coagulation factor
XII" (human: NCBI refseqID NM_000505; NCBI GeneID: 2161), as well
as toxicology-species F12 orthologs (cynomolgus monkey:
XM_005558647; mouse: NM_021489; rat, NM_001014006) were designed
using custom R and Python scripts. The human F12 REFSEQ mRNA has a
length of 2060 bases. The rationale and method for the set of siRNA
designs is as follows: the predicted efficacy for every potential
19mer siRNA from position 50 through position 2060 (the coding
region and 3' UTR) of human F12 mRNA (containing the the coding
region and 3' UTR) was determined using a linear model that
predicted the direct measure of mRNA knockdown based on the data of
more than 20,000 distinct siRNA designs targeting a large number of
vertebrate genes. Subsets of the F12 siRNAs were designed with
perfect or near-perfect matches between human, cynomolgus and
rhesus monkey. A further subset was designed with perfect or
near-perfect matches to mouse and rat F12 orthologs. For each
strand of the siRNA, a custom Python script was used in a brute
force search to measure the number and positions of mismatches
between the siRNA and all potential alignments in the target
species transcriptome. Extra weight was given to mismatches in the
seed region, defined here as positions 2-9 of the antisense
oligonucleotide, as well the cleavage site of the siRNA, defined
here as positions 10-11 of the antisense oligonucleotide. The
relative weights for the mismatches were 2.8 for seed mismatches,
1.2 for cleavage site mismatches, and 1 mismatches in other
positions up through antisense position 19. Mismatches in the first
position were ignored. A specificity score was calculated for each
strand by summing the value of each weighted mismatch. Preference
was given to siRNAs whose antisense score in human and cynomolgus
monkey was >=3.0 and predicted efficacy was >=70% knockdown
of the F12 transcript.
[0646] A detailed list of the unmodified F12 sense and antisense
strand sequences is shown in Table 9. A detailed list of the
modified F12 sense and antisense strand sequences is shown in Table
10.
siRNA Synthesis
[0647] F12 siRNA sequences were synthesized at 1 .mu.mol scale on a
Mermade 192 synthesizer (BioAutomation) using the solid support
mediated phosphoramidite chemistry. The solid support was
controlled pore glass (500 A) loaded with custom GalNAc ligand or
universal solid support (AM biochemical). Ancillary synthesis
reagents, 2'-F and 2'-O-Methyl RNA and deoxy phosphoramidites were
obtained from Thermo-Fisher (Milwaukee, Wis.) and Hongene (China).
2'F 2'-O-Methyl, GNA (glycol nucleic acids), 5'phosphate and other
modifications were introduced using the corresponding
phosphoramidites. Synthesis of 3' GalNAc conjugated single strands
was performed on a GalNAc modified CPG support. Custom CPG
universal solid support was used for the synthesis of antisense
single strands. Coupling time for all phosphoramidites (100 mM in
acetonitrile) was 5 min employing 5-Ethylthio-1H-tetrazole (ETT) as
activator (0.6 M in acetonitrile). Phosphorothioate linkages were
generated using a 50 mM solution of 3-((Dimethylamino-methylidene)
amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes
(Wilmington, Mass., USA)) in anhydrous acetonitrile/pyridine (1:1
v/v). Oxidation time was 3 minutes. All sequences were synthesized
with final removal of the DMT group ("DMT off").
[0648] Upon completion of the solid phase synthesis,
oligoribonucleotides were cleaved from the solid support and
deprotected in sealed 96 deep well plates using 200 .mu.L Aqueous
Methylamine reagents at 60.degree. C. for 20 minutes. For sequences
containing 2' ribo residues (2'-OH) that are protected with a
tert-butyl dimethyl silyl (TBDMS) group, a second step deprotection
was performed using TEA.3HF (triethylamine trihydro fluoride)
reagent. To the methylamine deprotection solution, 200 uL of
dimethyl sulfoxide (DMSO) and 300u1 TEA. 3HF reagent was added and
the solution was incubated for additional 20 min at 60.degree. C.
At the end of cleavage and deprotection step, the synthesis plate
was allowed to come to room temperature and was precipitated by
addition of 1 mL of acetontile: ethanol mixture (9:1). The plates
were cooled at -80 C for 2 hrs, superanatant decanted carefully
with the aid of a multi channel pipette. The oligonucleotide pellet
was re-suspended in 20 mM NaOAc buffer and were desalted using a 5
mL HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier
System equipped with an A905 autosampler and a Frac 950 fraction
collector. Desalted samples were collected in 96-well plates.
Samples from each sequence were analyzed by LC-MS to confirm the
identity, UV (260 nm) for quantification and a selected set of
samples by IEX chromatography to determine purity.
[0649] Annealing of F12 single strands was performed on a Tecan
liquid handling robot. Equimolar mixture of sense and antisense
single strands were combined and annealed in 96 well plates. After
combining the complementary single strands, the 96-well plate was
sealed tightly and heated in an oven at 100.degree. C. for 10
minutes and allowed to come slowly to room temperature over a
period 2-3 hours. The concentration of each duplex was normalized
to 10 .mu.M in 1.times. PBS and then submitted for in vitro
screening assays.
TABLE-US-00009 TABLE 9 Unmodified F12 Sequences sense antis Duplex
oligo SEQ ID oligo Position in SEQ ID name name Sense Sequence 5'
to 3' NO: name Antisense Sequence 5' to 3' NM_000505 NO: AD-66186
A-132464 GGUGAGCUUGGAGUCAACACU 378 A-132465 AGUGUUGACUCCAAGCUCACCAG
79_102 428 AD-66157 A-132406 GAGCUUGGAGUCAACACUUUA 379 A-132407
UAAAGUGUUGACUCCAAGCUCAC 82_105 429 AD-66118 A-132326
CUUGGAGUCAACACUUUCGAU 380 A-132327 AUCGAAAGUGUUGACUCCAAGCU 85_108
430 AD-66115 A-132320 UUGGAGUCAACACUUUCGAUU 381 A-132321
AAUCGAAAGUGUUGACUCCAAGC 86_109 431 AD-66170 A-132432
AACACUUUCGAUUCCACCUUA 382 A-132433 UAAGGUGGAAUCGAAAGUGUUGA 94_117
432 AD-66166 A-132424 AGGAGCAUAAGUACAAAGCUA 383 A-132425
UAGCUUUGUACUUAUGCUCCUUG 126_149 433 AD-66173 A-132438
GAGCAUAAGUACAAAGCUGAA 384 A-132439 UUCAGCUUUGUACUUAUGCUCCU 128_151
434 AD-66177 A-132446 UAAGUACAAAGCUGAAGAGCA 385 A-132447
UGCUCUUCAGCUUUGUACUUAUG 133_156 435 AD-66161 A-132414
AAGUACAAAGCUGAAGAGCAA 386 A-132415 UUGCUCUUCAGCUUUGUACUUAU 134_157
436 AD-66114 A-132318 UACCACAAAUGUACCCACAAA 387 A-132319
UUUGUGGGUACAUUUGUGGUACA 218_241 437 AD-66179 A-132450
CCACAAAUGUACCCACAAGGA 388 A-132451 UCCUUGUGGGUACAUUUGUGGUA 220_243
438 AD-66160 A-132412 UACUGUUUGGAGCCCAAGAAA 389 A-132413
UUUCUUGGGCUCCAAACAGUAUC 305_328 439 AD-66171 A-132434
ACUGUUUGGAGCCCAAGAAAA 390 A-132435 UUUUCUUGGGCUCCAAACAGUAU 306_329
440 AD-66189 A-132470 CUGUUUGGAGCCCAAGAAAGU 391 A-132471
ACUUUCUUGGGCUCCAAACAGUA 307_330 441 AD-66122 A-132334
GGAGCCCAAGAAAGUGAAAGA 392 A-132335 UCUUUCACUUUCUUGGGCUCCAA 313_336
442 AD-66176 A-132444 GAGCCCAAGAAAGUGAAAGAA 393 A-132445
UUCUUUCACUUUCUUGGGCUCCA 314_337 443 AD-66125 A-132340
AGCCCAAGAAAGUGAAAGACA 394 A-132341 UGUCUUUCACUUUCUUGGGCUCC 315_338
444 AD-66112 A-132314 GCCCAAGAAAGUGAAAGACCA 395 A-132315
UGGUCUUUCACUUUCUUGGGCUC 316_339 445 AD-66172 A-132436
CCCAAGAAAGUGAAAGACCAA 396 A-132437 UUGGUCUUUCACUUUCUUGGGCU 317_340
446 AD-66127 A-132344 CAAGAAAGUGAAAGACCAUUA 397 A-132345
UAAUGGUCUUUCACUUUCUUGGG 319_342 447 AD-66162 A-132416
GAAAGUGAAAGACCACUGCAA 398 A-132417 UUGCAGUGGUCUUUCACUUUCUU 322_345
448 AD-66181 A-132454 AAAGUGAAAGACCACUGCAGA 399 A-132455
UCUGCAGUGGUCUUUCACUUUCU 323_346 449 AD-66184 A-132460
UCACUGGAAACCACUGCCAGA 400 A-132461 UCUGGCAGUGGUUUCCAGUGAGG 420_443
450 AD-66182 A-132456 ACUGCCAGAAAGAGAAGUGCU 401 A-132457
AGCACUUCUCUUUCUGGCAGUGG 432_455 451 AD-66167 A-132426
CUGCCAGAAAGAGAAGUGCUU 402 A-132427 AAGCACUUCUCUUUCUGGCAGUG 433_456
452 AD-66165 A-132422 CAGAAAGAGAAGUGCUUUGAA 403 A-132423
UUCAAAGCACUUCUCUUUCUGGC 437_460 453 AD-66155 A-132402
AGAAAGAGAAGUGCUUUGAGA 404 A-132403 UCUCAAAGCACUUCUCUUUCUGG 438_461
454 AD-66159 A-132410 AGUGCUUUGAGCCUCAGCUUA 405 A-132411
UAAGCUGAGGCUCAAAGCACUUC 447_470 455 AD-66168 A-132428
UUCCACAAGAAUGAGAUAUGA 406 A-132429 UCAUAUCUCAUUCUUGUGGAAAA 476_499
456 AD-66185 A-132462 UCCACAAGAAUGAGAUAUGGU 407 A-132463
ACCAUAUCUCAUUCUUGUGGAAA 477_500 457 AD-66156 A-132404
CCACAAGAAUGAGAUAUGGUA 408 A-132405 UACCAUAUCUCAUUCUUGUGGAA 478_501
458 AD-66113 A-132316 AAGAAUGAGAUAUGGUAUAGA 409 A-132317
UCUAUACCAUAUCUCAUUCUUGU 482_505 459 AD-66188 A-132468
UGGUAUAGAACUGAGCAAGCA 410 A-132469 UGCUUGCUCAGUUCUAUACCAUA 494_517
460 AD-66190 A-132472 GUAUAGAACUGAGCAAGCAGA 411 A-132473
UCUGCUUGCUCAGUUCUAUACCA 496_519 461 AD-66180 A-132452
AUAGAACUGAGCAAGCAGCUA 412 A-132453 UAGCUGCUUGCUCAGUUCUAUAC 498_521
462 AD-66117 A-132324 CCAGAUGCCAGUGCAAGGGUA 413 A-132325
UACCCUUGCACUGGCAUCUGGCC 522_545 463 AD-66169 A-132430
GCCAGUGCAAGGGUCCUGAUA 414 A-132431 UAUCAGGACCCUUGCACUGGCAU 528_551
464 AD-66174 A-132440 CAGUGCAAGGGUCCUGAUGCA 415 A-132441
UGCAUCAGGACCCUUGCACUGGC 530_553 465 AD-66175 A-132442
ACCAAGGCAAGCUGCUAUGAU 416 A-132443 AUCAUAGCAGCUUGCCUUGGUGU 683_706
466 AD-66158 A-132408 CCAAGGCAAGCUGCUAUGAUA 417 A-132409
UAUCAUAGCAGCUUGCCUUGGUG 684_707 467 AD-66119 A-132328
AGGCUUCAUGUCCCACUCAUA 418 A-132329 UAUGAGUGGGACAUGAAGCCUAG 974_997
468 AD-66187 A-132466 GGCUCCGCAAGAGUCUGUCUU 419 A-132467
AAGACAGACUCUUGCGGAGCCGC 1131_1154 469 AD-66163 A-132418
GCUCCGCAAGAGUCUGUCUUA 420 A-132419 UAAGACAGACUCUUGCGGAGCCG
1132_1155 470 AD-66116 A-132322 CCGCAAGAGUCUGUCUUCGAU 421 A-132323
AUCGAAGACAGACUCUUGCGGAG 1135_1158 471 AD-66137 A-132364
GUUCGAGGGGGCUGAAGAAUA 422 A-132365 UAUUCUUCAGCCCCCUCGAACUG
1570_1593 472 AD-66183 A-132458 GGAAGGCAAGAUUGUGUCCCA 423 A-132459
UGGGACACAAUCUUGCCUUCCAU 1956_1979 473 AD-66164 A-132420
AGGCAAGAUUGUGUCCCAUUA 424 A-132421 UAAUGGGACACAAUCUUGCCUUC
1959_1982 474 AD-66121 A-132332 AACUCAAUAAAGUGCUUUGAA 425 A-132333
UUCAAAGCACUUUAUUGAGUUUC 2017_2040 475 AD-66126 A-132342
AAUAAAGUGCUUUGAAAACGU 426 A-132343 ACGUUUUCAAAGCACUUUAUUGA
2022_2045 476 AD-66178 A-132448 AGUGCUUUGAAAAUGCUGAGA 427 A-132449
UCUCAGCAUUUUCAAAGCACUUU 2027_2050 477
TABLE-US-00010 TABLE 10 Modified F12 Sequences sense antis Duplex
oligo SEQ ID oligo SEQ ID name name Sense Sequence 5' to 3' NO:
name Antisense Sequence 5' to 3' NO: AD-66186 A-132464
GfsgsUfgAfgCfuUfGfGfaGfuCfaAfcAfcUfL96 478 A-132465
asGfsuGfuUfgAfcUfccaAfgCfuCfaCfcsasg 528 AD-66157 A-132406
GfsasGfcUfuGfgAfGfUfcAfaCfaCfutUuAfL96 479 A-132407
usAfsaAfgUfgUfuGfacuCfcAfaGfcUfcsasc 529 AD-66118 A-132326
CfsusUfgGfaGfuCfAfAfcAfcUfuUfcGfaUfL96 480 A-132327
asUfscGfaAfaGfuGfuugAfcUfcCfaAfgscsu 530 AD-66115 A-132320
UfsusGfgAfgUfcAfAfCfaCfuUfuCfgAfuUfL96 481 A-132321
asAfsuCfgAfaAfgUfguuGfaCfuCfcAfasgsc 531 AD-66170 A-132432
AfsasCfaCfuUfuCfGfAfuUfcCfaCfcUfuAfL96 482 A-132433
usAfsaGfgUfgGfaAfucgAfaAfgUfgUfusgsa 532 AD-66166 A-132424
AfsgsGfaGfcAfuAfAfGfuAfcAfaAfgCfuAfL96 483 A-132425
usAfsgCfuUfuGfuAfcuuAfuGfcUfcCfususg 533 AD-66173 A-132438
GfsasGfcAfuAfaGfUfAfcAfaAfgCfuGfaAfL96 484 A-132439
usUfscAfgCfuUfuGfuacUfuAfuGfcUfcscsu 534 AD-66177 A-132446
UfsasAfgUfaCfaAfAfGfcUfgAfaGfaGfcAfL96 485 A-132447
usGfscUfcUfuCfaGfcuuUfgUfaCfuUfasusg 535 AD-66161 A-132414
AfsasGfuAfcAfaAfGfCfuGfaAfgAfgCfaAfL96 486 A-132415
usUfsgCfuCfuUfcAfgcuUfuGfuAfcUfusasu 536 AD-66114 A-132318
UfsasCfcAfcAfaAfUfGfuAfcCfcAfcAfaAfL96 487 A-132319
usUfsuGfuGfgGfuAfcauUfuGfuGfgUfascsa 537 AD-66179 A-132450
CfscsAfcAfaAfuGfUfAfcCfcAfcAfaGfgAfL96 488 A-132451
usCfscUfuGfuGfgGfuacAfuUfuGfuGfgsusa 538 AD-66160 A-132412
UfsasCfuGfuUfuGfGfAfgCfcCfaAfgAfaAfL96 489 A-132413
usUfsuCfuUfgGfgCfuccAfaAfcAfgUfasusc 539 AD-66171 A-132434
AfscsUfgUfuUfgGfAfGfcCfcAfaGfaAfaAfL96 490 A-132435
usUfsuUfcUfuGfgGfcucCfaAfaCfaGfusasu 540 AD-66189 A-132470
CfsusGfuUfuGfgAfGfCfcCfaAfgAfaAfgUfL96 491 A-132471
asCfsuUfuCfuUfgGfgcuCfcAfaAfcAfgsusa 541 AD-66122 A-132334
GfsgsAfgCfcCfaAfGfAfaAfgUfgAfaAfgAfL96 492 A-132335
usCfsuUfuCfaCfuUfucuUfgGfgCfuCfcsasa 542 AD-66176 A-132444
GfsasGfcCfcAfaGfAfAfaGfuGfaAfaGfaAfL96 493 A-132445
usUfscUfuUfcAfcUfuucUfuGfgGfcUfcscsa 543 AD-66125 A-132340
AfsgsCfcCfaAfgAfAfAfgUfgAfaAfgAfcAfL96 494 A-132341
usGfsuCfuUfuCfaCfuuuCfuUfgGfgCfuscsc 544 AD-66112 A-132314
GfscsCfcAfaGfaAfAfGfuGfaAfaGfaCfcAfL96 495 A-132315
usGfsgUfcUfuUfcAfcuuUfcUfuGfgGfcsusc 545 AD-66172 A-132436
CfscsCfaAfgAfaAfGfUfgAfaAfgAfcCfaAfL96 496 A-132437
usUfsgGfuCfuUfuCfacuUfuCfuUfgGfgscsu 546 AD-66127 A-132344
CfsasAfgAfaAfgUfGfAfaAfgAfcCfaUfuAfL96 497 A-132345
usAfsaUfgGfuCfuUfucaCfuUfuCfuUfgsgsg 547 AD-66162 A-132416
GfsasAfaGfuGfaAfAfGfaCfcAfuUfgCfaAfL96 498 A-132417
usUfsgCfaAfuGfgUfcuuUfcAfcUfuUfcsusu 548 AD-66181 A-132454
AfsasAfgUfgAfaAfGfAfcCfaUfuGfcAfgAfL96 499 A-132455
usCfsuGfcAfaUfgGfucuUfuCfaCfuUfuscsu 549 AD-66184 A-132460
UfscsAfcUfgGfaAfAfCfcAfcUfgCfcAfgAfL96 500 A-132461
usCfsuGfgCfaGfuGfguuUfcCfaGfuGfasgsg 550 AD-66182 A-132456
AfscsUfgCfcAfgAfAfAfgAfgAfaGfuGfcUfL96 501 A-132457
asGfscAfcUfuCfuCfuuuCfuGfgCfaGfusgsg 551 AD-66167 A-132426
CfsusGfcCfaGfaAfAfGfaGfaAfgUfgCfuUfL96 502 A-132427
asAfsgCfaCfuUfcUfcuuUfcUfgGfcAfgsusg 552 AD-66165 A-132422
CfsasGfaAfaGfaGfAfAfgUfgCfuUfuGfaAfL96 503 A-132423
usUfscAfaAfgCfaCfuucUfcUfuUfcUfgsgsc 553 AD-66155 A-132402
AfsgsAfaAfgAfgAfAfGfuGfcUluUfgAfgAfL96 504 A-132403
usCfsuCfaAfaGfcAfcuuCfuCfuUfuCfusgsg 554 AD-66159 A-132410
AfsgsUfgCfuUfuGfAfGfcCfuCfaGfcUluAfL96 505 A-132411
usAfsaGfcUfgAfgGfcucAfaAfgCfaCfususc 555 AD-66168 A-132428
UfsusCfcAfcAfaGfAfAfuGfaGfaUfaUfgAfL96 506 A-132429
usCfsaUfaUfcUfcAfuucUfuGfuGfgAfasasa 556 AD-66185 A-132462
UfscsCfaCfaAfgAfAfUfgAfgAfuAfuGfgUfL96 507 A-132463
asCfscAfuAfuCfuCfauuCfuUfgUfgGfasasa 557 AD-66156 A-132404
CfscsAfcAfaGfaAfUfGfaGfaUfaUfgGfuAfL96 508 A-132405
usAfscCfaUfaUfcUfcauUfcUfuGfuGfgsasa 558 AD-66113 A-132316
AfsasGfaAfuGfaGfAfUfaUfgGfuAfuAfgAfL96 509 A-132317
usCfsuAfuAfcCfaUfaucUfcAfuUfcUfusgsu 559 AD-66188 A-132468
UfsgsGfuAfuAfgAfAfCfuGfaGfcAfaGfcAfL96 510 A-132469
usGfscUfuGfcUfcAfguuCfuAfuAfcCfasusa 560 AD-66190 A-132472
GfsusAfuAfgAfaCfUfGfaGfcAfaGfcAfgAfL96 511 A-132473
usCfsuGfcUfuGfcUfcagUfuCfuAfuAfcscsa 561 AD-66180 A-132452
AfsusAfgAfaCfuGfAfGfcAfaGfcAfgCfuAfL96 512 A-132453
usAfsgCfuGfcUfuGfcucAfgUfuCfuAfusasc 562 AD-66117 A-132324
CfscsAfgAfuGfcCfAfGfuGfcAfaGfgGfuAfL96 513 A-132325
usAfscCfcUfuGfcAfcugGfcAfuCfuGfgscsc 563 AD-66169 A-132430
GfscsCfaGfuGfcAfAfGfgGfuCfcUfgAfuAfL96 514 A-132431
usAfsuCfaGfgAfcCfcuuGfcAfcUfgGfcsasu 564 AD-66174 A-132440
CfsasGfuGfcAfaGfGfGfuCfcUfgAfuGfcAfL96 515 A-132441
usGfscAfuCfaGfgAfcccUfuGfcAfcUfgsgsc 565 AD-66175 A-132442
AfscsCfaAfgGfcAfAfGfcUfgCfuAfuGfaUfL96 516 A-132443
asUfscAfuAfgCfaGfcuuGfcCfuUfgGfusgsu 566 AD-66158 A-132408
CfscsAfaGfgCfaAfGfCfuGfcUfaUfgAfuAfL96 517 A-132409
usAfsuCfaUfaGfcAfgcuUfgCfcUfuGfgsusg 567 AD-66119 A-132328
AfsgsGfcUluCfaUfGfUfcCfcAfcUfcAfuAfL96 518 A-132329
usAfsuGfaGfuGfgGfacaUfgAfaGfcCfusasg 568 AD-66187 A-132466
GfsgsCfuCfcGfcAfAfGfaGfuCfuGfuCfuUfL96 519 A-132467
asAfsgAfcAfgAfcUfcuuGfcGfgAfgCfcsgsc 569 AD-66163 A-132418
GfscsUfcCfgCfaAfGfAfgUfcUfgUfcUluAfL96 520 A-132419
usAfsaGfaCfaGfaCfucuUfgCfgGfaGfcscsg 570 AD-66116 A-132322
CfscsGfcAfaGfaGfUfCfuGfuCfuUfcGfaUfL96 521 A-132323
asUfscGfaAfgAfcAfgacUfcUfuGfcGfgsasg 571 AD-66137 A-132364
GfsusUfcGfaGfgGfGfGfcUfgAfaGfaAfuAfL96 522 A-132365
usAfsuUfcUfuCfaGfcccCfcUfcGfaAfcsusg 572 AD-66183 A-132458
GfsgsAfaGfgCfaAfGfAfuUfgUfgUfcCfcAfL96 523 A-132459
usGfsgGfaCfaCfaAfucuUfgCfcUfuCfcsasu 573 AD-66164 A-132420
AfsgsGfcAfaGfaUfUfGfuGfuCfcCfaUfuAfL96 524 A-132421
usAfsaUfgGfgAfcAfcaaUfcUfuGfcCfususc 574 AD-66121 A-132332
AfsasCfuCfaAfuAfAfAfgUfgCfuUfuGfaAfL96 525 A-132333
usUfscAfaAfgCfaCfuuuAfuUfgAfgUfususc 575 AD-66126 A-132342
AfsasUfaAfaGfuGfCfUfuUfgAfaAfaCfgUfL96 526 A-132343
asCfsgUfuUluCfaAfagcAfcUfuUfaUfusgsa 576 AD-66178 A-132448
AfsgsUfgCfuUfuGfAfAfaAfuGfcUfgAfgAfL96 527 A-132449
usCfsuCfaGfcAfuUfuucAfaAfgCfaCfususu 577
Example 4
In Vitro Screening of F12 siRNA Duplexes
Cell Culture and Transfections
[0650] Hep3b or Primary Mouse Hepatocyte cells (PMH) (MSCP10,
Lot#MC613) were transfected by adding 4.9 .mu.l of Opti-MEM plus
0.1 .mu.l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad
Calif. cat #13778-150) to 5 .mu.l of siRNA duplexes per well into a
384-well plate and incubated at room temperature for 15 minutes.
Forty .mu.l of DMEM (Hep3b) of William's E Medium (PMH) containing
about 5.times.10.sup.3 cells was then added to the siRNA mixture.
Cells were incubated for 24 hours prior to RNA purification.
[0651] Single dose experiments were performed at 10 nM and 0.01 nM
final duplex concentration and dose response experiments were done
over a range of doses from 10 nM to 36 fM final duplex
concentration over 8, 6-fold dilutions.
Total RNA Isolation Using DYNABEADS mRNA Isolation Kit:
[0652] RNA was isolated using an automated protocol on a
BioTek-EL406 platform using DYNABEADs (Invitrogen, cat#61012).
Briefly, 50 .mu.l of Lysis/Binding Buffer and 25 .mu.l of lysis
buffer containing 3 .mu.l of magnetic beads were added to the plate
with cells. Plates were incubated on an electromagnetic shaker for
10 minutes at room temperature and then magnetic beads were
captured and the supernatant was removed. Bead-bound RNA was then
washed 2 times with 150 .mu.l Wash Buffer A and once with Wash
Buffer B. Beads were then washed with 150 .mu.l Elution Buffer,
re-captured and the supernatant was removed.
cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription
Kit (Applied Biosystems, Foster City, Calif., Cat #4368813):
[0653] Ten .mu.l of a master mix containing 1 .mu.l 10.times.
Buffer, 0.4 .mu.l 25.times. dNTPs, 1 .mu.l 10.times. Random
primers, 0.5 .mu.l Reverse Transcriptase, 0.5 .mu.l RNase inhibitor
and 6.6 .mu.l of H2O per reaction was added to RNA isolated as
described above. Plates were sealed, mixed, and incubated on an
electromagnetic shaker for 10 minutes at room temperature, followed
by 2 hours 37.degree. C. Plates were then incubated at 81.degree.
C. for 8 minutes.
Real Time PCR:
[0654] Two .mu.l of cDNA were added to a master mix containing 0.5
.mu.l of GAPDH TaqMan Probe (Hs99999905_ml or 4352339E), 0.5 .mu.l
F12 probe (Hs00166821 or Mm00491349) and 5 .mu.l Lightcycler 480
probe master mix (Roche Cat #04887301001) per well in a 384 well
plates (Roche cat #04887301001). Real time PCR was performed using
a LightCycler480 Real Time PCR system (Roche) using the
.DELTA..DELTA.Ct(RQ) assay. Each duplex was tested in four
independent transfections.
[0655] To calculate relative fold change, real time data were
analyzed using the .DELTA..DELTA.Ct method and normalized to assays
performed with cells transfected with 10 nM AD-1955, or mock
transfected cells. IC.sub.50s were calculated using a 4 parameter
fit model using XLFit and normalized to cells transfected with
AD-1955, a non-targeting control, or naive cells.
[0656] The sense and antisense sequences of AD-1955 are:
TABLE-US-00011 SENSE: (SEQ ID NO: 2343) cuuAcGcuGAGuAcuucGAdTsdT;
ANTISENSE: (SEQ ID NO: 2344) UCGAAGuACUcAGCGuAAGdTsdT.
[0657] Table 11 shows the results of a single dose screen in Hep3b
cells transfected with the indicated human F12 iRNAs. Table 12
shows the results of a single dose response screen in Hep3b cells
transfected with the indicated human F12 iRNAs. Table 13 shows the
results of a single dose screen in primary mouse hepatocytes
transfected with the indicated mouse F12 iRNAs. Table 14 shows the
results of a dose response screen in primary mouse hepatocytes
transfected with the indicated human F12 iRNAs. Data are expressed
as percent of mRNA remaining relative to AD-1955.
TABLE-US-00012 TABLE 11 F12 Single Dose Screen in Hep3bCells 10 0.1
10 0.1 DuplexId nM AVG nM AVG nM STDEV nM STDEV AD-66186 33.1 88.4
5.3 12.6 AD-66157 62.2 85.3 9.6 13.2 AD-66118 47.4 59.4 2.9 10.6
AD-66115 54.8 73.9 4.8 3 AD-66170 31.6 57.3 3.9 12.5 AD-66166 74.7
88.8 14.3 15.8 AD-66173 22.3 58.5 7.6 11.8 AD-66177 52.9 86.7 6.9
6.3 AD-66161 50.3 59.9 7.9 10 AD-66114 42.1 82.3 5.3 8.5 AD-66179
78.4 101.4 14.3 16.1 AD-66160 45.4 82.3 13.4 18.5 AD-66171 74.8
126.2 12.1 28.2 AD-66189 49.3 78.1 16.6 9.1 AD-66122 47.2 94.9 7.4
7.5 AD-66176 42.7 69.4 5.2 7 AD-66125 46 91.8 7.5 17.4 AD-66112
60.4 136.8 11.4 14.4 AD-66172 34.9 70.2 13.1 11.1 AD-66127 39.5
73.3 8.5 12.4 AD-66162 79.1 93.6 13 24.7 AD-66181 59.8 101.7 1.2
5.4 AD-66184 34 72.9 7.8 14.9 AD-66182 47 101 8.8 7.9 AD-66167 30.3
60.2 2.6 5.9 AD-66165 44.3 63.2 11.4 22.3 AD-66155 45.3 72.8 13.5
16.1 AD-66159 49.6 98 8.4 31.2 AD-66168 25.5 52.9 5.8 16.6 AD-66185
40.8 81.7 3.8 11.5 AD-66156 30.8 75.6 4.4 5.4 AD-66113 42.1 76 8.1
5.9 AD-66188 43.9 82.1 9.1 15.4 AD-66190 40.2 74.9 9 8.3 AD-66180
34.6 83.1 6.6 23.3 AD-66117 48.9 108.1 4.1 9.5 AD-66169 64.9 89.4
9.8 1.9 AD-66174 55.4 107.6 7.9 23 AD-66175 37.9 104.7 4 19.7
AD-66158 55 107.3 14.7 31.7 AD-66119 27.6 69.8 3.4 4.3 AD-66187
53.3 105 19.6 9.6 AD-66163 33.6 53.9 5.1 4.9 AD-66116 33.9 57.4
10.4 12.6 AD-66137 103.4 136.7 6.6 15.9 AD-66183 36.5 91.9 8 12.7
AD-66164 31.3 78.2 5.1 6.4 AD-66121 26.5 72.1 2.7 18.3 AD-66126
33.2 56.7 2.6 12.6 AD-66178 51.1 72.1 6.3 16.5
TABLE-US-00013 TABLE 12 F12 Dose Response Screen in Hep3b Cells
DuplexId IC.sub.50 (nM) AD-66170 0.085 AD-66173 0.244 AD-66176 N/A
AD-66125 N/A AD-66172 0.398 AD-66167 0.457 AD-66165 0.058 AD-66168
0.657 AD-66163 0.481 AD-66116 0.089 AD-66126 0.086
TABLE-US-00014 TABLE 13 F12 Single Dose Screen in Primary Mouse
Hepatocytes 10 0.1 10 0.1 DuplexId nM AVG nM AVG nM STDEV nM STDEV
AD-66186 93.1 102.6 2 6.6 AD-66157 97.4 114.5 16.5 17 AD-66118 65.9
93 11.6 11.9 AD-66115 61.8 89 5.5 8.9 AD-66170 88 98.5 11.7 8.4
AD-66166 106.8 98.5 8.8 5.2 AD-66173 106.8 106 11.2 14.8 AD-66177
87.5 103 3.6 3.2 AD-66161 94.4 103.1 7 15.9 AD-66114 38.6 79.1 4.1
5 AD-66179 71.1 105.7 6.8 18.2 AD-66160 14.6 106.8 1.2 8.7 AD-66171
17.7 102.5 2.3 6.1 AD-66189 9.1 90.2 1.3 6.1 AD-66122 14.4 95.7 0.7
13.9 AD-66176 10.9 85.8 2.1 4.6 AD-66125 12.6 80.5 2.1 6.2 AD-66112
19.1 82 7.2 3.5 AD-66172 4.2 75.3 0.4 6.7 AD-66127 7.4 48.4 3.7 7.3
AD-66162 3.9 30.6 1.9 4.9 AD-66181 7.2 69.2 0.9 4.1 AD-66184 93.6
110.9 4.1 6.8 AD-66182 13.4 89.9 1.3 2 AD-66167 4.8 55.5 0.5 2.6
AD-66165 2.1 18.7 0.3 3.6 AD-66155 5.7 48 0.7 5.1 AD-66159 7.2 88.7
0.5 3.7 AD-66168 65.6 105.6 1.6 11.3 AD-66185 96 108.9 3.1 16
AD-66156 56.8 107.2 3.5 8.8 AD-66113 72.8 88.7 4.8 5.5 AD-66188
117.5 95.5 17.3 4.9 AD-66190 118.3 96.5 5.8 8.4 AD-66180 121.4
109.3 15.2 6.6 AD-66117 72.3 89.1 7.4 8.5 AD-66169 89.4 103.7 8.8
4.2 AD-66174 92 103.4 18.1 8.4 AD-66175 89.5 112.9 13.7 8.9
AD-66158 103.9 105.3 11.5 15.2 AD-66119 66.5 92 8.9 9 AD-66187
109.1 107 16.4 10.3 AD-66163 89.9 106 6.8 6.1 AD-66116 69.8 97 8.2
10.6 AD-66137 17.6 94.1 2.1 8.7 AD-66183 100.1 109.6 7.6 8.4
AD-66164 84 98.8 10.2 9.8 AD-66121 2.5 30.5 0.4 3.2 AD-66126 4.1
22.3 0.3 2.3 AD-66178 79.6 112.8 6.8 16.5
TABLE-US-00015 TABLE 14 F12 Dose Response Screen in Primary Mouse
Hepatocytes DuplexId IC.sub.50 (nM) AD-66170 N/A AD-66173 N/A
AD-66176 3.571 AD-66125 14.962 AD-66172 1.104 AD-66167 1.013
AD-66165 0.231 AD-66168 N/A AD-66163 N/A AD-66116 N/A AD-66121
0.119 AD-66126 0.045
Example 5
KNG1 iRNA Synthesis
Source of Reagents
[0658] Where the source of a reagent is not specifically given
herein, such reagent can be obtained from any supplier of reagents
for molecular biology at a quality/purity standard for application
in molecular biology.
Transcripts
[0659] siRNA Design
[0660] A set of siRNAs targeting the human KNG1, "kininogen 1"
(human: NCBI refseqID NM_001166451; NCBI GeneID: 3827), as well as
toxicology-species KNG1 orthologs (cynomolgus monkey: XM_005545463;
mouse: NM_001102409; rat, NM_012696) were designed using custom R
and Python scripts. The human NM_001166451 REFSEQ mRNA has a length
of 2035 bases. The rationale and method for the set of siRNA
designs is as follows: the predicted efficacy for every potential
19mer siRNA from position position 235 through position 2035 (the
coding region and 3' UTR was determined using a linear model that
predicted the direct measure of mRNA knockdown based on the data of
more than 20,000 distinct siRNA designs targeting a large number of
vertebrate genes. Subsets of the KNG1 siRNAs were designed with
perfect or near-perfect matches between human and cynomolgus
monkey. A further subset was designed with perfect or near-perfect
matches to mouse and rat KNG1 orthologs. For each strand of the
siRNA, a custom Python script was used in a brute force search to
measure the number and positions of mismatches between the siRNA
and all potential alignments in the target species transcriptome.
Extra weight was given to mismatches in the seed region, defined
here as positions 2-9 of the antisense oligonucleotide, as well the
cleavage site of the siRNA, defined here as positions 10-11 of the
antisense oligonucleotide. The relative weights for the mismatches
were 2.8 for seed mismatches, 1.2 for cleavage site mismatches, and
1 mismatches in other positions up through antisense position 19.
Mismatches in the first position were ignored. A specificity score
was calculated for each strand by summing the value of each
weighted mismatch. Preference was given to siRNAs whose antisense
score in human and cynomolgus monkey was >=3.0 and predicted
efficacy was >=70% knockdown of the NM_001166451 transcript.
[0661] A detailed list of the unmodified KNG1 sense and antisense
strand sequences is shown in Table 15. A detailed list of the
modified KNG1 sense and antisense strand sequences is shown in
Table 16.
siRNA Synthesis
[0662] KNG1 siRNA sequences were synthesized at 1 .mu.mol scale on
a Mermade 192 synthesizer (BioAutomation) using the solid support
mediated phosphoramidite chemistry. The solid support was
controlled pore glass (500.degree. A) loaded with custom GalNAc
ligand or universal solid support (AM biochemical). Ancillary
synthesis reagents, 2'-F and 2'-O-Methyl RNA and deoxy
phosphoramidites were obtained from Thermo-Fisher (Milwaukee, Wis.)
and Hongene (China). 2'F 2'-O-Methyl, GNA (glycol nucleic acids),
5'phosphate and other modifications were introduced using the
corresponding phosphoramidites. Synthesis of 3' GalNAc conjugated
single strands was performed on a GalNAc modified CPG support.
Custom CPG universal solid support was used for the synthesis of
antisense single strands. Coupling time for all phosphoramidites
(100 mM in acetonitrile) was 5 min employing
5-Ethylthio-1H-tetrazole (ETT) as activator (0.6 M in
acetonitrile). Phosphorothioate linkages were generated using a 50
mM solution of 3-((Dimethylamino-methylidene)
amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes
(Wilmington, Mass., USA)) in anhydrous acetonitrile/pyridine (1:1
v/v). Oxidation time was 3 minutes. All sequences were synthesized
with final removal of the DMT group ("DMT off").
[0663] Upon completion of the solid phase synthesis,
oligoribonucleotides were cleaved from the solid support and
deprotected in sealed 96 deep well plates using 200 .mu.L Aqueous
Methylamine reagents at 60.degree. C. for 20 minutes. For sequences
containing 2' ribo residues (2'-OH) that are protected with a
tert-butyl dimethyl silyl (TBDMS) group, a second step deprotection
was performed using TEA.3HF (triethylamine trihydro fluoride)
reagent. To the methylamine deprotection solution, 200 uL of
dimethyl sulfoxide (DMSO) and 300 ul TEA.3HF reagent was added and
the solution was incubated for additional 20 min at 60.degree. C.
At the end of cleavage and deprotection step, the synthesis plate
was allowed to come to room temperature and was precipitated by
addition of 1 mL of acetontile: ethanol mixture (9:1). The plates
were cooled at -80 C for 2 hrs, superanatant decanted carefully
with the aid of a multi channel pipette. The oligonucleotide pellet
was re-suspended in 20 mM NaOAc buffer and were desalted using a 5
mL HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier
System equipped with an A905 autosampler and a Frac 950 fraction
collector. Desalted samples were collected in 96-well plates.
Samples from each sequence were analyzed by LC-MS to confirm the
identity, UV (260 nm) for quantification and a selected set of
samples by IEX chromatography to determine purity.
[0664] Annealing of KNG1 single strands was performed on a Tecan
liquid handling robot. Equimolar mixture of sense and antisense
single strands were combined and annealed in 96 well plates. After
combining the complementary single strands, the 96-well plate was
sealed tightly and heated in an oven at 100.degree. C. for 10
minutes and allowed to come slowly to room temperature over a
period 2-3 hours. The concentration of each duplex was normalized
to 10 .mu.M in 1.times. PBS and then submitted for in vitro
screening assays.
TABLE-US-00016 TABLE 15 KNG1 Unmodified Sequences sense SEQ antis
SEQ Duplex oligo Sense ID oligo Antisense ID Position in name name
Sequence 5' to 3' NO: name Sequence 5' to 3' NO: NM_001166451
AD-66259 A-132506 GAGGAAAUUGACUGCAAUGAA 578 A-132507
UUCAUUGCAGUCAAUUUCCUCGG 647 301_324 AD-66261 A-132510
CACGUUUUAUUCCUUCAAGUA 579 A-132511 UACUUGAAGGAAUAAAACGUGUC 648
438_461 AD-66262 A-132512 UACCUACUCAAUUGUGCAAAA 580 A-132513
UUUUGCACAAUUGAGUAGGUAAU 649 822_845 AD-66263 A-132514
CUUUCUAUUUCAAGAUUGACA 581 A-132515 UGUCAAUCUUGAAAUAGAAAGUU 650
1118_1141 AD-66260 A-132508 AACCACAUGUUCCAAGGAAAA 582 A-132509
UUUUCCUUGGAACAUGUGGUUUC 651 1206_1229 AD-66341 A-132670
AAUAAAAGAAGAAACAACUGU 583 A-132671 ACAGUUGUUUCUUCUUUUAUUUC 652
1416_1439 AD-66345 A-132678 AGAAGAAACAACUGUAAGUCA 584 A-132679
UGACUUACAGUUGUUUCUUCUUU 653 1422_1445 AD-66328 A-132644
CGGGAUUCAGGAAAAGAACAA 585 A-132645 UUGUUCUUUUCCUGAAUCCCGCU 654
1480_1503 AD-66317 A-132622 GGGAUUCAGGAAAAGAACAAA 586 A-132623
UUUGUUCUUUUCCUGAAUCCCGC 655 1481_1504 AD-66333 A-132654
GGAUUCAGGAAAAGAACAAGA 587 A-132655 UCUUGUUCUUUUCCUGAAUCCCG 656
1482_1505 AD-66338 A-132664 GAUUCAGGAAAAGAACAAGGA 588 A-132665
UCCUUGUUCUUUUCCUGAAUCCC 657 1483_1506 AD-66343 A-132674
AUUCAGGAAAAGAACAAGGGA 589 A-132675 UCCCUUGUUCUUUUCCUGAAUCC 658
1484_1507 AD-66319 A-132626 AAACAUGAACGUGACCAAGGA 590 A-132627
UCCUUGGUCACGUUCAUGUUUAU 659 1567_1590 AD-66346 A-132680
CACGAACAACAGCAUGGUCUU 591 A-132681 AAGACCAUGCUGUUGUUCGUGUC 660
1624_1647 AD-66329 A-132646 GGUCUUGGUCAUGGACAUAAA 592 A-132647
UUUAUGUCCAUGACCAAGACCAU 661 1639_1662 AD-66270 A-132528
CUUGGUCAUGGACAUAAGUUA 593 A-132529 UAACUUAUGUCCAUGACCAAGAC 662
1642_1665 AD-66279 A-132546 UUGGUCAUGGACAUAAGUUCA 594 A-132547
UGAACUUAUGUCCAUGACCAAGA 663 1643_1666 AD-66273 A-132534
GGUCAUGGACAUAAGUUCAAA 595 A-132535 UUUGAACUUAUGUCCAUGACCAA 664
1645_1668 AD-66264 A-132516 AUGGACAUAAGUUCAAACUUA 596 A-132517
UAAGUUUGAACUUAUGUCCAUGA 665 1649_1672 AD-66342 A-132672
GGACAUAAGUUCAAACUUGAU 597 A-132673 AUCAAGUUUGAACUUAUGUCCAU 666
1651_1674 AD-66278 A-132544 CAUAAGUUCAAACUUGAUGAU 598 A-132545
AUCAUCAAGUUUGAACUUAUGUC 667 1654_1677 AD-66277 A-132542
AUAAGUUCAAACUUGAUGAUA 599 A-132543 UAUCAUCAAGUUUGAACUUAUGU 668
1655_1678 AD-66267 A-132522 UUCAAACUUGAUGAUGAUCUU 600 A-132523
AAGAUCAUCAUCAAGUUUGAACU 669 1660_1683 AD-66325 A-132638
UCAAACUUGAUGAUGAUCUUA 601 A-132639 UAAGAUCAUCAUCAAGUUUGAAC 670
1661_1684 AD-66320 A-132628 AACUUGAUGAUGAUCUUGAAA 602 A-132629
UUUCAAGAUCAUCAUCAAGUUUG 671 1664_1687 AD-66336 A-132660
GUCCUUGACCAUGGACAUAAA 603 A-132661 UUUAUGUCCAUGGUCAAGGACAU 672
1699_1722 AD-66280 A-132548 GACCAUGGACAUAAGCAUAAA 604 A-132549
UUUAUGCUUAUGUCCAUGGUCAA 673 1705_1728 AD-66272 A-132532
AUGGACAUAAGCAUAAGCAUA 605 A-132533 UAUGCUUAUGCUUAUGUCCAUGG 674
1709_1732 AD-66275 A-132538 GAAUGGAAAGCACAAUGGUUA 606 A-132539
UAACCAUUGUGCUUUCCAUUCUU 675 1767_1790 AD-66348 A-132684
GAAAGCACAAUGGUUGGAAAA 607 A-132685 UUUUCCAACCAUUGUGCUUUCCA 676
1772_1795 AD-66340 A-132668 AAGCACAAUGGUUGGAAAACA 608 A-132669
UGUUUUCCAACCAUUGUGCUUUC 677 1774_1797 AD-66330 A-132648
AUGGUUGGAAAACAGAGCAUU 609 A-132649 AAUGCUCUGUUUUCCAACCAUUG 678
1781_1804 AD-66306 A-132600 GGUUGGAAAACAGAGCAUUUA 610 A-132601
UAAAUGCUCUGUUUUCCAACCAU 679 1783_1806 AD-66322 A-132632
AUUUGGCAAGCUCUUCUGAAA 611 A-132633 UUUCAGAAGAGCUUGCCAAAUGC 680
1799_1822 AD-66274 A-132536 UCUUCUGAAGACAGUACUACA 612 A-132537
UGUAGUACUGUCUUCAGAAGAGC 681 1810_1833 AD-66271 A-132530
CAGAGUGAUGACGAUUGGAUA 613 A-132531 UAUCCAAUCGUCAUCACUCUGUA 682
1975_1998 AD-66339 A-132666 CUUUCAUUUAACCCAAUAUCA 614 A-132667
UGAUAUUGGGUUAAAUGAAAGGC 683 2023_2046 AD-66276 A-132540
UUUCAUUUAACCCAAUAUCAA 615 A-132541 UUGAUAUUGGGUUAAAUGAAAGG 684
2024_2047 AD-66281 A-132550 UUUAACCCAAUAUCAGAUUUU 616 A-132551
AAAAUCUGAUAUUGGGUUAAAUG 685 2029_2052 AD-66313 A-132614
UUAACCCAAUAUCAGAUUUUA 617 A-132615 UAAAAUCUGAUAUUGGGUUAAAU 686
2030_2053 AD-66307 A-132602 GUGGCUAUGGGUAUUUCUUUA 618 A-132603
UAAAGAAAUACCCAUAGCCACUU 687 2172_2195 AD-66309 A-132606
UUUCUUUCAUACUUUAUUAAA 619 A-132607 UUUAAUAAAGUAUGAAAGAAAUA 688
2185_2208 AD-66316 A-132620 UUCUUUCAUACUUUAUUAAAA 620 A-132621
UUUUAAUAAAGUAUGAAAGAAAU 689 2186_2209 AD-66321 A-132630
UCUUUCAUACUUUAUUAAAGU 621 A-132631 ACUUUAAUAAAGUAUGAAAGAAA 690
2187_2210 AD-66323 A-132634 UUCAUACUUUAUUAAAGUAUA 622 A-132635
UAUACUUUAAUAAAGUAUGAAAG 691 2190_2213 AD-66315 A-132618
CUUUAUUAAAGUAUCAAUAUA 623 A-132619 UAUAUUGAUACUUUAAUAAAGUA 692
2196_2219 AD-66268 A-132524 UUUAUUAAAGUAUCAAUAUCA 624 A-132525
UGAUAUUGAUACUUUAAUAAAGU 693 2197_2220 AD-66332 A-132652
AAGUAUCAAUAUCCCUCUCUA 625 A-132653 UAGAGAGGGAUAUUGAUACUUUA 694
2204_2227 AD-66303 A-132594 CAUUGUCCAGAUGAAAAUAUA 626 A-132595
UAUAUUUUCAUCUGGACAAUGGA 695 2225_2248 AD-66334 A-132656
AUGAAAAUAUCCUGAUAUAAU 627 A-132657 AUUAUAUCAGGAUAUUUUCAUCU 696
2235_2258 AD-66331 A-132650 UCUCCACGGACUGCAUAAAAU 628 A-132651
AUUUUAUGCAGUCCGUGGAGACU 697 2327_2350 AD-66326 A-132640
CACGGACUGCAUAAAAUUGUA 629 A-132641 UACAAUUUUAUGCAGUCCGUGGA 698
2331_2354 AD-66312 A-132612 CUGCAAUUGGCUUCUCUGAUA 630 A-132613
UAUCAGAGAAGCCAAUUGCAGCA 699 2441_2464 AD-66304 A-132596
UGAUAACAAAUAUGUACCUUA 631 A-132597 UAAGGUACAUAUUUGUUAUCAGA 700
2457_2480 AD-66324 A-132636 UACCUUACAACAUAUGUCAUA 632 A-132637
UAUGACAUAUGUUGUAAGGUACA 701 2471_2494 AD-66266 A-132520
UACAACAUAUGUCAUGAAUUU 633 A-132521 AAAUUCAUGACAUAUGUUGUAAG 702
2476_2499 AD-66311 A-132610 AUUCUUGUCAUUCUUAAUAAA 634 A-132611
UUUAUUAAGAAUGACAAGAAUCU 703 2507_2530 AD-66335 A-132658
UUCUUGUCAUUCUUAAUAAAA 635 A-132659 UUUUAUUAAGAAUGACAAGAAUC 704
2508_2531 AD-66344 A-132676 UCUUGUCAUUCUUAAUAAACU 636 A-132677
AGUUUAUUAAGAAUGACAAGAAU 705 2509_2532 AD-66305 A-132598
AUUUGAAUGUGUGUGAAAAUA 637 A-132599 UAUUUUCACACACAUUCAAAUAC 706
2542_2565 AD-66318 A-132624 GAAUGUGUGUGAAAAUAAGGA 638 A-132625
UCCUUAUUUUCACACACAUUCAA 707 2546_2569 AD-66308 A-132604
AUGUGUGUGAAAAUAAGGGAA 639 A-132605 UUCCCUUAUUUUCACACACAUUC 708
2548_2571 AD-66327 A-132642 GUGUGUGAAAAUAAGGGAAGU 640 A-132643
ACUUCCCUUAUUUUCACACACAU 709 2550_2573 AD-66337 A-132662
GUGUGAAAAUAAGGGAAGUCA 641 A-132663 UGACUUCCCUUAUUUUCACACAC 710
2552_2575 AD-66347 A-132682 UGUGAAAAUAAGGGAAGUCAA 642 A-132683
UUGACUUCCCUUAUUUUCACACA 711 2553_2576 AD-66269 A-132526
GUGAAAAUAAGGGAAGUCAAA 643 A-132527 UUUGACUUCCCUUAUUUUCACAC 712
2554_2577 AD-66314 A-132616 AAUAAGGGAAGUCAAGAGAUU 644 A-132617
AAUCUCUUGACUUCCCUUAUUUU 713 2559_2582 AD-66265 A-132518
GGGAAGUCAAGAGAUUAAAUA 645 A-132519 UAUUUAAUCUCUUGACUUCCCUU 714
2564_2587 AD-66310 A-132608 UAAAUGCUGAACUUAUUAAUA 646 A-132609
UAUUAAUAAGUUCAGCAUUUAAU 715 2579_2602
TABLE-US-00017 TABLE 16 KNG1 Modified Sequences sense Duplex oligo
Sense SEQ ID antis Antisense SEQ ID name name Sequence 5' to 3' NO:
oligoname Sequence 5' to 3' NO: AD-66259 A-132506
GfsasGfgAfaAfuUfGfAfcUfgCfaAfuGfaAfL96 716 A-132507
usUfscAfuUfgCfaGfucaAfuUfuCfcUfcsgsg 785 AD-66261 A-132510
CfsasCfgUfuUfuAfUtUfcCfuUfcAfaGfuAfL96 717 A-132511
usAfscUfuGfaAfgGfaauAfaAfaCfgUfgsusc 786 AD-66262 A-132512
UfsasCfcUfaCfuCfAfAfuUfgUfgCfaAfaAfL96 718 A-132513
usUfsuUfgCfaCfaAfuugAfgUfaGfgUfasasu 787 AD-66263 A-132514
CfsusUfuCfuAfuUtUfCfaAfgAfuUfgAfcAfL96 719 A-132515
usGfsuCfaAfuCfuUfgaaAfuAfgAfaAfgsusu 788 AD-66260 A-132508
AfsasCfcAfcAfuGfUtUfcCfaAfgGfaAfaAfL96 720 A-132509
usUfsuUfcCfuUfgGfaacAfuGfuGfgUfususc 789 AD-66341 A-132670
AfsasUfaAfaAfgAfAfGfaAfaCfaAfcUfgUfL96 721 A-132671
asCfsaGfuUfgUfuUfcuuCfuUfuUfaUfususc 790 AD-66345 A-132678
AfsgsAfaGfaAfaCfAfAfcUfgUfaAfgUfcAfL96 722 A-132679
usGfsaCfuUfaCfaGfuugUfuUfcUfuCfususu 791 AD-66328 A-132644
CfsgsGfgAfuUfcAfGfGfaAfaAfgAfaCfaAfL96 723 A-132645
usUfsgUfuCfuUfuUfccuGfaAfuCfcCfgscsu 792 AD-66317 A-132622
GfsgsGfaUfuCfaGfGfAfaAfaGfaAfcAfaAfL96 724 A-132623
usUfsuGfuUfcUfuUfuccUfgAfaUfcCfcsgsc 793 AD-66333 A-132654
GfsgsAfuUfcAfgGfAfAfaAfgAfaCfaAfgAfL96 725 A-132655
usCfsuUfgUfuCfuUfuucCfuGfaAfuCfcscsg 794 AD-66338 A-132664
GfsasUfuCfaGfgAfAfAfaGfaAfcAfaGfgAfL96 726 A-132665
usCfscUfuGfuUfcUfuuuCfcUfgAfaUfcscsc 795 AD-66343 A-132674
AfsusUfcAfgGfaAfAfAfgAfaCfaAfgGfgAfL96 727 A-132675
usCfscCfuUfgUfuCfuuuUfcCfuGfaAfuscsc 796 AD-66319 A-132626
AfsasAfcAfuGfaAfCfGfuGfaCfcAfaGfgAfL96 728 A-132627
usCfscUfuGfgUfcAfcguUfcAfuGfuUfusasu 797 AD-66346 A-132680
CfsasCfgAfaCfaAfCfAfgCfaUfgGfuCfuUfL96 729 A-132681
asAfsgAfcCfaUfgCfuguUfgUfuCfgUfgsusc 798 AD-66329 A-132646
GfsgsUfcUfuGfgUfCfAfuGfgAfcAfuAfaAfL96 730 A-132647
usUfsuAfuGfuCfcAfugaCfcAfaGfaCfcsasu 799 AD-66270 A-132528
CfsusUfgGfuCfaUfGfGfaCfaUfaAfgUfuAfL96 731 A-132529
usAfsaCfuUfaUfgUfccaUfgAfcCfaAfgsasc 800 AD-66279 A-132546
UfsusGfgUfcAfuGfGfAfcAfuAfaGfuUfcAfL96 732 A-132547
usGfsaAfcUfuAfuGfuccAfuGfaCfcAfasgsa 801 AD-66273 A-132534
GfsgsUfcAfuGfgAfCfAfuAfaGfuUfcAfaAfL96 733 A-132535
usUfsuGfaAfcUfuAfuguCfcAfuGfaCfcsasa 802 AD-66264 A-132516
AfsusGfgAfcAfuAfAfGfuUfcAfaAfcUfuAfL96 734 A-132517
usAfsaGfuUfuGfaAfcuuAfuGfuCfcAfusgsa 803 AD-66342 A-132672
GfsgsAfcAfuAfaGfUtUfcAfaAfcUfuGfaUfL96 735 A-132673
asUfscAfaGfuUfuGfaacUfuAfuGfuCfcsasu 804 AD-66278 A-132544
CfsasUfaAfgUfuCfAfAfaCfuUfgAfuGfaUfL96 736 A-132545
asUfscAfuCfaAfgUfuugAfaCfuUfaUfgsusc 805 AD-66277 A-132542
AfsusAfaGfuUfcAfAfAfcUfuGfaUfgAfuAfL96 737 A-132543
usAfsuCfaUfcAfaGfuuuGfaAfcUfuAfusgsu 806 AD-66267 A-132522
UfsusCfaAfaCfuUfGfAfuGfaUfgAfuCfuUfL96 738 A-132523
asAfsgAfuCfaUfcAfucaAfgUfuUfgAfascsu 807 AD-66325 A-132638
UfscsAfaAfcUfuGfAfUfgAfuGfaUfcUfuAfL96 739 A-132639
usAfsaGfaUfcAfuCfaucAfaGfuUfuGfasasc 808 AD-66320 A-132628
AfsasCfuUfgAfuGfAfUfgAfuCfuUfgAfaAfL96 740 A-132629
usUfsuCfaAfgAfuCfaucAfuCfaAfgUfususg 809 AD-66336 A-132660
GfsusCfcUfuGfaCfCfAfuGfgAfcAfuAfaAfL96 741 A-132661
usUfsuAfuGfuCfcAfuggUfcAfaGfgAfcsasu 810 AD-66280 A-132548
GfsasCfcAfuGfgAfCfAfuAfaGfcAfuAfaAfL96 742 A-132549
usUfsuAfuGfcUfuAfuguCfcAfuGfgUfcsasa 811 AD-66272 A-132532
AfsusGfgAfcAfuAfAfGfcAfuAfaGfcAfuAfL96 743 A-132533
usAfsuGfcUfuAfuGfcuuAfuGfuCfcAfusgsg 812 AD-66275 A-132538
GfsasAfuGfgAfaAfGfCfaCfaAfuGfgUfuAfL96 744 A-132539
usAfsaCfcAfuUfgUfgcuUfuCfcAfuUfcsusu 813 AD-66348 A-132684
GfsasAfaGfcAfcAfAfUfgGfuUfgGfaAfaAfL96 745 A-132685
usUfsuUfcCfaAfcCfauuGfuGfcUfuUfcscsa 814 AD-66340 A-132668
AfsasGfcAfcAfaUfGfGfuUfgGfaAfaAfcAfL96 746 A-132669
usGfsuUfuUfcCfaAfccaUfuGfuGfcUfususc 815 AD-66330 A-132648
AfsusGfgUfuGfgAfAfAfaCfaGfaGfcAfuUfL96 747 A-132649
asAfsuGfcUfcUfgUfuuuCfcAfaCfcAfususg 816 AD-66306 A-132600
GfsgsUfuGfgAfaAfAfCfaGfaGfcAfuUfuAfL96 748 A-132601
usAfsaAfuGfcUfcUfguuUfuCfcAfaCfcsasu 817 AD-66322 A-132632
AfsusUfuGfgCfaAfGfCfuCfuUfcUfgAfaAfL96 749 A-132633
usUfsuCfaGfaAfgAfgcuUfgCfcAfaAfusgsc 818 AD-66274 A-132536
UfscsUfuCfuGfaAfGfAfcAfgUfaCfuAfcAfL96 750 A-132537
usGfsuAfgUfaCfuGfucuUfcAfgAfaGfasgsc 819 AD-66271 A-132530
CfsasGfaGfuGfaUfGfAfcGfaUfuGfgAfuAfL96 751 A-132531
usAfsuCfcAfaUfcGfucaUfcAfcUfcUfgsusa 820 AD-66339 A-132666
CfsusUfuCfaUfuUfAfAfcCfcAfaUfaUfcAfL96 752 A-132667
usGfsaUfaUfuGfgGfuuaAfaUfgAfaAfgsgsc 821 AD-66276 A-132540
UfsusUfcAfuUfuAfAfCfcCfaAfuAfuCfaAfL96 753 A-132541
usUfsgAfuAfuUfgGfguuAfaAfuGfaAfasgsg 822 AD-66281 A-132550
UfsusUfaAfcCfcAfAfUfaUfcAfgAfuUfuUfL96 754 A-132551
asAfsaAfuCfuGfaUfauuGfgGfuUfaAfasusg 823 AD-66313 A-132614
UfsusAfaCfcCfaAfUfAfuCfaGfaUfuUluAfL96 755 A-132615
usAfsaAfaUfcUfgAfuauUfgGfgUfuAfasasu 824 AD-66307 A-132602
GfsusGfgCfuAfuGfGfGfuAfuUfuCfuUfuAfL96 756 A-132603
usAfsaAfgAfaAfuAfcccAfuAfgCfcAfcsusu 825 AD-66309 A-132606
UfsusUfcUluUlcAfUfAfcUluUfaUfuAfaAfL96 757 A-132607
usUfsuAfaUfaAfaGfuauGfaAfaGfaAfasusa 826 AD-66316 A-132620
UfsusCfuUfuCfaUfAfCfuUfuAfuUfaAfaAfL96 758 A-132621
usUfsuUfaAfuAfaAfguaUfgAfaAfgAfasasu 827 AD-66321 A-132630
UfscsUfuUlcAfuAfCfUfuUfaUfuAfaAfgUfL96 759 A-132631
asCfsuUfuAfaUfaAfaguAfuGfaAfaGfasasa 828 AD-66323 A-132634
UfsusCfaUfaCfuUfUfAfuUfaAfaGfuAfuAfL96 760 A-132635
usAfsuAfcUfuUfaAfuaaAfgUfaUfgAfasasg 829 AD-66315 A-132618
CfsusUfuAfuUfaAfAfGfuAfuCfaAfuAfuAfL96 761 A-132619
usAfsuAfuUfgAfuAfcuuUfaAfuAfaAfgsusa 830 AD-66268 A-132524
UfsusUfaUfuAfaAfGfUfaUfcAfaUfaUfcAfL96 762 A-132525
usGfsaUfaUfuGfaUfacuUfuAfaUfaAfasgsu 831 AD-66332 A-132652
AfsasGfuAfuCfaAfUfAfuCfcCfuCfuCfuAfL96 763 A-132653
usAfsgAfgAfgGfgAfuauUfgAfuAfcUfususa 832 AD-66303 A-132594
CfsasUfuGfuCfcAfGfAfuGfaAfaAfuAfuAfL96 764 A-132595
usAfsuAfuUluUfcAfucuGfgAfcAfaUfgsgsa 833 AD-66334 A-132656
AfsusGfaAfaAfuAfUfCfcUfgAfuAfuAfaUfL96 765 A-132657
asUfsuAfuAfuCfaGfgauAfuUfuUfcAfuscsu 834 AD-66331 A-132650
UfscsUfcCfaCfgGfAfCfuGfcAfuAfaAfaUfL96 766 A-132651
asUfsuUfuAfuGfcAfgucCfgUfgGfaGfascsu 835 AD-66326 A-132640
CfsasCfgGfaCfuGfCfAfuAfaAfaUfuGfuAfL96 767 A-132641
usAfscAfaUfuUfuAfugcAfgUfcCfgUfgsgsa 836 AD-66312 A-132612
CfsusGfcAfaUfuGfGfCfuUlcUfcUfgAfuAfL96 768 A-132613
usAfsuCfaGfaGfaAfgccAfaUfuGfcAfgscsa 837 AD-66304 A-132596
UfsgsAfuAfaCfaAfAfUfaUfgUfaCfcUluAfL96 769 A-132597
usAfsaGfgUfaCfaUfauuUfgUfuAfuCfasgsa 838 AD-66324 A-132636
UfsasCfcUluAfcAfAfCfaUfaUfgUfcAfuAfL96 770 A-132637
usAfsuGfaCfaUfaUfguuGfuAfaGfgUfascsa 839 AD-66266 A-132520
UfsasCfaAfcAfuAfUfGfuCfaUfgAfaUfuUfL96 771 A-132521
asAfsaUfuCfaUfgAfcauAfuGfuUfgUfasasg 840 AD-66311 A-132610
AfsusUfcUluGfuCfAfUfuCfuUfaAfuAfaAfL96 772 A-132611
usUfsuAfuUfaAfgAfaugAfcAfaGfaAfuscsu 841 AD-66335 A-132658
UfsusCfuUfgUfcAfUfUfcUluAfaUfaAfaAfL96 773 A-132659
usUfsuUfaUfuAfaGfaauGfaCfaAfgAfasusc 842 AD-66344 A-132676
UfscsUfuGfuCfaUfUlCfuUfaAfuAfaAfcUfL96 774 A-132677
asGfsuUfuAfuUfaAfgaaUfgAfcAfaGfasasu 843 AD-66305 A-132598
AfsusUfuGfaAfuGfUfGfuGfuGfaAfaAfuAfL96 775 A-132599
usAfsuUfuUfcAfcAfcacAfuUfcAfaAfusasc 844 AD-66318 A-132624
GfsasAfuGfuGfuGfUfGfaAfaAfuAfaGfgAfL96 776 A-132625
usCfscUfuAfuUfuUfcacAfcAfcAfuUfcsasa 845 AD-66308 A-132604
AfsusGfuGfuGfuGfAfAfaAfuAfaGfgGfaAfL96 777 A-132605
usUfscCfcUfuAfuUfuucAfcAfcAfcAfususc 846 AD-66327 A-132642
GfsusGfuGfuGfaAfAfAfuAfaGfgGfaAfgUfL96 778 A-132643
asCfsuUfcCfcUfuAfuuuUfcAfcAfcAfcsasu 847 AD-66337 A-132662
GfsusGfuGfaAfaAfUfAfaGfgGfaAfgUfcAfL96 779 A-132663
usGfsaCfuUfcCfcUfuauUfuUfcAfcAfcsasc 848 AD-66347 A-132682
UfsgsUfgAfaAfaUfAfAfgGfgAfaGfuCfaAfL96 780 A-132683
usUfsgAfcUfuCfcCfuuaUfuUfuCfaCfascsa 849 AD-66269 A-132526
GfsusGfaAfaAfuAfAfGfgGfaAfgUfcAfaAfL96 781 A-132527
usUfsuGfaCfuUfcCfcuuAfuUfuUfcAfcsasc 850 AD-66314 A-132616
AfsasUfaAfgGfgAfAfGfuCfaAfgAfgAfuUfL96 782 A-132617
asAfsuCfuCfuUfgAfcuuCfcCfuUfaUfususu 851 AD-66265 A-132518
GfsgsGfaAfgUfcAfAfGfaGfaUfuAfaAfuAfL96 783 A-132519
usAfsuUfuAfaUfcUfcuuGfaCfuUfcCfcsusu 852 AD-66310 A-132608
UfsasAfaUfgCfuGfAfAfcUfuAfuUfaAfuAfL96 784 A-132609
usAfsuUfaAfuAfaGfuucAfgCfaUfuUfasasu 853
Example 6
In Vitro Screening of KNG1 siRNA Duplexes
Cell Culture and Transfections
[0665] Hep3b were transfected by adding 4.9 .mu.l of Opti-MEM plus
0.1 .mu.l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad
Calif. cat #13778-150) to 5 .mu.l of siRNA duplexes per well into a
384-well plate and incubated at room temperature for 15 minutes.
Forty .mu.l of DMEM (Hep3b) of William's E Medium (PMH) containing
about 5.times.10.sup.3 cells was then added to the siRNA mixture.
Cells were incubated for 24 hours prior to RNA purification.
[0666] Single dose experiments were performed at 10 nM and 0.01 nM
final duplex concentration and dose response experiments were done
over a range of doses from 10 nM to 36 fM final duplex
concentration over 8, 6-fold dilutions.
Total RNA Isolation Using DYNABEADS mRNA Isolation Kit:
[0667] RNA was isolated using an automated protocol on a
BioTek-EL406 platform using DYNABEADs (Invitrogen, cat#61012).
Briefly, 50 .mu.l of Lysis/Binding Buffer and 25 .mu.l of lysis
buffer containing 3 .mu.l of magnetic beads were added to the plate
with cells. Plates were incubated on an electromagnetic shaker for
10 minutes at room temperature and then magnetic beads were
captured and the supernatant was removed. Bead-bound RNA was then
washed 2 times with 150 .mu.l Wash Buffer A and once with Wash
Buffer B. Beads were then washed with 150 .mu.l Elution Buffer,
re-captured and the supernatant was removed.
cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription
Kit (Applied Biosystems, Foster City, Calif., Cat #4368813):
[0668] Ten .mu.l of a master mix containing 1 .mu.l 10.times.
Buffer, 0.4 .mu.l 25.times. dNTPs, 1 .mu.l 10.times. Random
primers, 0.5 .mu.l Reverse Transcriptase, 0.5 .mu.l RNase inhibitor
and 6.6 .mu.l of H2O per reaction was added to RNA isolated as
described above. Plates were sealed, mixed, and incubated on an
electromagnetic shaker for 10 minutes at room temperature, followed
by 2 hours 37.degree. C. Plates were then incubated at 81.degree.
C. for 8 minutes.
Real Time PCR:
[0669] Two .mu.l of cDNA were added to a master mix containing 0.5
.mu.l of GAPDH TaqMan Probe (Hs99999905_ml or 4352339E), 0.5.mu.l
F12 probe (Hs00166821 or Mm00491349) and 5 .mu.l Lightcycler 480
probe master mix (Roche Cat #04887301001) per well in a 384 well
plates (Roche cat #04887301001). Real time PCR was performed using
a LightCycler480 Real Time PCR system (Roche) using the
.DELTA..DELTA.Ct(RQ) assay. Each duplex was tested in four
independent transfections.
[0670] To calculate relative fold change, real time data were
analyzed using the .DELTA..DELTA.Ct method and normalized to assays
performed with cells transfected with 10 nM AD-1955, or mock
transfected cells. IC.sub.50s were calculated using a 4 parameter
fit model using XLFit and normalized to cells transfected with
AD-1955, a non-targeting control, or naive cells.
[0671] The sense and antisense sequences of AD-1955 are:
TABLE-US-00018 SENSE: (SEQ ID NO: 2343) cuuAcGcuGAGuAcuucGAdTsdT;
ANTISENSE: (SEQ ID NO: 2344) UCGAAGuACUcAGCGuAAGdTsdT.
[0672] Table 17 shows the results of a single dose screen in Hep3b
cells transfected with the indicated human KNG1 iRNAs. Table 18
shows the results of a dose response screen in Hep3b cells
transfected with the indicated human KNG1 iRNAs. Data are expressed
as percent of mRNA remaining relative to AD-1955.
TABLE-US-00019 TABLE 17 KNG1 Single Dose Screen in Hep3b 10 0.1 10
0.1 DuplexId nM AVG nM AVG nM STDEV nM STDEV AD-66259 5 30.8 1.4
12.6 AD-66261 14.5 74.9 4.5 37.1 AD-66262 14.4 40.4 12.7 19.8
AD-66263 23.8 87.4 33.9 20.6 AD-66260 42.4 78.7 12.8 20.7 AD-66341
30 88.9 11.8 20.6 AD-66345 79.5 180 9.2 57.7 AD-66328 75.1 74.5
16.8 13.5 AD-66317 30.4 71.5 6.4 19.6 AD-66333 66 90.7 23.5 31.4
AD-66338 74.2 123.7 30.4 35.3 AD-66343 69 86.9 27.3 24 AD-66319
70.9 93.6 10.7 26.8 AD-66346 68.2 184.8 5.5 55.7 AD-66329 73.5
104.6 15.6 15.5 AD-66270 96.1 80.5 51.4 22.4 AD-66279 54.7 75.7
28.6 21.5 AD-66273 141.2 71.9 26.9 12.9 AD-66264 82.6 92.3 43.5
25.1 AD-66342 55.9 91.6 12.4 8.5 AD-66278 77.4 62.2 23.9 17.4
AD-66277 56.5 86 41.7 31.8 AD-66267 56.1 68.7 22.4 15.6 AD-66325
40.3 60.8 13.5 19.2 AD-66320 70.4 99.5 16.5 6.2 AD-66336 102.7 94.4
26.6 21.3 AD-66280 71.9 94.8 32.4 19.9 AD-66272 150.9 241.6 43.7
195.8 AD-66275 49.3 100.4 12 40.6 AD-66348 64.8 117.2 17.2 21.5
AD-66340 56.7 85.1 15.7 26.4 AD-66330 61.5 97.1 12.4 24.9 AD-66306
36.1 68.4 8.2 14 AD-66322 59.9 84.4 14.4 28.8 AD-66274 109.6 88.2
48 17.3 AD-66271 130.9 70.1 25.3 20.9 AD-66339 68.4 107.4 29.3 27.7
AD-66276 40.6 85 8.8 31 AD-66281 111.1 89.8 54.8 27.2 AD-66313 57.1
112.6 8.5 35.9 AD-66307 37.2 70.4 10 5.4 AD-66309 42.7 58.8 9.4
11.5 AD-66316 42.2 75.3 10.3 9.9 AD-66321 63.8 106.1 28 32.4
AD-66323 68.7 89 16.3 21.4 AD-66315 41.4 87.5 7.2 10.8 AD-66268
81.1 55 34.2 5.6 AD-66332 59.6 74.6 22.8 22.8 AD-66303 63.3 52.3
9.6 7.1 AD-66334 47.7 72.7 11.9 36.2 AD-66331 51.1 98.1 13.6 33.5
AD-66326 53 58.9 5.7 11.7 AD-66312 76 90.8 16.2 19.8 AD-66304 85.5
54.3 12.4 4.3 AD-66324 49.5 63.4 8.2 4.7 AD-66266 118.3 185.1 21.2
42.8 AD-66311 59 68.6 4.3 15.5 AD-66335 65.8 74.3 9.6 28.2 AD-66344
113.2 110.1 41.2 37.7 AD-66305 62.5 100.6 18.1 32.7 AD-66318 56.5
60.4 12.5 5.2 AD-66308 43.7 65.6 12 12.9 AD-66327 58.5 65.8 11.9
9.2 AD-66337 102.8 156.4 41.6 32.7 AD-66347 78.4 105.7 25.9 24.3
AD-66269 66.2 85.1 20.4 15 AD-66314 49.6 98.3 8.9 25.3 AD-66265
109.9 177.7 40.1 57.8 AD-66310 42.1 73.4 7 27.5
TABLE-US-00020 TABLE 18 KNG1 Dose Response Screen in Hep3b DuplexId
IC.sub.50 (nM) AD-66259 0.035 AD-66261 1.02 AD-66262 0.04 AD-66263
0.299 AD-66341 9.181
Example 7
In Vivo KLKB1, F12, and KNG1 Silencing in Wild-Type Mice
[0673] Three of the most active agents targeting KLKB1, described
above, three of the most active agents targeting F12, described
above, and two of the most active agents targeting KNG1, described
above, were selected for further evaluation. In particular,
additional agents targeting nucleotides 1661-1682, or nucleotides
1905-1926, or nucleotides 382-403 of NM_000892 (a KLKB1 gene) (FIG.
7), additional agents targeting nucleotides 2017-2040, or
nucleotides 315-338, or nucleotides 438-459 of NM_000505 (an F12
gene) (FIG. 8), and additional agents targeting nucleotides 301-324
or nucleotides 822-845 of NM_001166451 (a KNG1 gene) (FIG. 9) were
synthesized as described above. The in vivo efficacy of these
additional agents was assessed by administration of a single
subcutaneous dose of the agent to wild-type C57BL/6 mice and
determining the level of mRNA at 7-10 days post-dose. The
unmodified nucleotide sequences of the sense and antisense strands
of the agents depicted in FIG. 7 targeting KLKB1 are provided in
Table 19A, and the modified nucleotide sequences of the sense and
antisense strands of the agents depicted in FIG. 7 are provided in
Table 19B. The unmodified nucleotide sequences of the sense and
antisense strands of the agents depicted in FIG. 8 targeting F12
are provided in Table 19C, and the modified nucleotide sequences of
the sense and antisense strands of the agents depicted in FIG. 8
are provided in Table 19D. The unmodified nucleotide sequences of
the sense and antisense strands of the agents depicted in FIG. 9
targeting KNG1 are provided in Table 19E, and the modified
nucleotide sequences of the sense and antisense strands of the
agents depicted in FIG. 9 are provided in Table 19F.
[0674] In particular, with respect to the additional agents
targeting a KLKB1 gene, wild-type C57BL/6 mice were administered a
single 1 mg/kg or 3 mg/kg dose of the agent and the level of KLKB1
mRNA was determined at 7-10 days post-dose. The results of these
assays are provided in FIG. 1 which demonstrates that AD-66948 was
the most efficiacious agent targeting a KLKB1 gene that was
tested.
[0675] With respect to the additional agents targeting F12,
wild-type C57BL/6 mice were administered either a single 1 mg/kg
dose or a single 3 mg/kg dose, or a single 1 mg/kg dose or a single
10 mg/kg dose of the agent and the level of F12 mRNA was determined
at 7-10 days post-dose. The results of these assays are provided in
FIG. 2 which demonstrates that AD-67244 was the most efficiacious
agent targeting a F12 gene that was tested.
[0676] With respect to the additional agents targeting a KNG1 gene,
wild-type C57BL/6 mice were administered a single 1 mg/kg or 3
mg/kg dose of the agent and the level of KNG1 mRNA was determined
at 7-10 days post-dose. The results of these assays are provided in
FIG. 3 which demonstrates that AD-67344 was the most efficiacious
agent targeting a KNG1 gene that was tested.
TABLE-US-00021 TABLE 19A Unmodified sense and antisense strand
sequences of agents targeting KLKB1 Anti- sense Sense Antisense
Start Position Position Position in GenBank in GenBank Duplex on
Reference Reference SEQ ID SEQ ID Name Target mRNA Sequence
Sequence Sense Sequence NO Antiense Sequence NO AD- KLEB1 1659
NM_000892.3_ NM_000892.3_ AAUCCAAAAUAUUCUACAAAA 854
UUUUGUAGAAUAUUUUGGAUUUC 863 65077 1661-1681_s 1659-1681_as AD-
KLEB1 1659 NM_000892.3_ NM_000892.3_ AAUCCAAAAUAUUCUACAAAA 855
UUUUGUAGAAUAUUUUGGAUUUC 864 66944 1661-1681_s 1659-1681_as AD-
KLEB1 1659 NM_000892.3_ NM_000892.3_ AAUCCAAAAUAUUCUACAAAA 856
UUUUGUAGAAUAUUUUGGAUUUC 865 66945 1661-1681_s 1659-1681_as AD-
KLEB1 1903 NM_000892.3_ NM_000892.3_ ACCAAAGUCGCUGAGUACAUA 857
UAUGUACUCAGCGACUUUGGUGU 866 65087 1905-1925_s 1903-1925_as AD-
KLEB1 1903 NM_000892.3_ NM_000892.3_ ACCAAAGUCGCUGAGUACAUA 858
UAUGUACUCAGCGACUUUGGUGU 867 66946 1905-1925_s 1903-1925_as AD-
KLEB1 1903 NM_000892.3_ NM_000892.3_ ACCAAAGUCGCUGAGUACAUA 859
UAUGUACUCAGCGACUUUGGUGU 868 66947 1905-1925_s 1903-1925_as AD-
KLEB1 380 NM_000892.3_ NM_000892.3_ GUGGUCAUCAAAUAAGUGCUU 860
AAGCACUUAUUUGAUGACCACAU 869 65103 382-402_s 380-402_as AD- KLEB1
380 NM_000892.3_ NM_000892.3_ GUGGUCAUCAAAUAAGUGCUU 861
AAGCACUUAUUUGAUGACCACAU 870 66948 382-402_s 380-402_as AD- KLEB1
380 NM_000892.3_ NM_000892.3_ GUGGUCAUCAAAUAAGUGCUU 862
AAGCACUUAUUUGAUGACCACAU 871 66949 382-402_s 380-402_as
TABLE-US-00022 TABLE 19B Modified sense and antisense strand
sequences of agents targeting KLKB1 Anti- sense Sense Antisense
Start Position Position Position in GenBank in GenBank SEQ SEQ
Duplex on Reference Reference ID ID Name Target mRNA Sequence
Sequence Sense Sequence NO Antiense Sequence NO AD- KLKB1 1659
NM_000892.3_ NM_000892.3_ AfsasUfcCfaAfaAfUfAfuUfcUfaCfaAfa 872
usUfsuUfgUfaGfaAfuauUfuUfgGfaUfususc 881 65077 1661-1681_s
1659-1681_as AfL96 AD- KLKB1 1659 NM_000892.3_ NM_000892.3_
asasuccaAfaAfUfAfuucuacaaaaL96 873
usUfsuugUfaGfAfauauUfuUfggauususc 882 66944 1661-1681_s
1659-1681_as AD- KLKB1 1659 NM_000892.3_ NM_000892.3_
asasuccaAfaAfUfAfuucuacaaaaL96 874
UfsUfsuugUfaGfAfauauUfuUfggauususc 883 66945 1661-1681_s
1659-1681_as AD- KLKB1 1903 NM_000892.3_ NM_000892.3_
AfscsCfaAfaGfuCfGfCfuGfaGfuAfcAfu 875
usAfsuGfuAfcUfcAfgcgAfcUfuUfgGfusgs 884 65087 1905-1925_s
1903-1925_as AfL96 u AD- KLKB1 1903 NM_000892.3_ NM_000892.3_
ascscaaaGfuCfGfCfugaguacauaL96 876
usAfsuguAfcUfCfagcgAfcUfuuggusgsu 885 66946 1905-1925_s
1903-1925_as AD- KLKB1 1903 NM_000892.3_ NM_000892.3_
ascscaaaGfuCfGfCfugaguacauaL96 877
UfsAfsuguAfcUfCfagcgAfcUfuuggusgsu 886 66947 1905-1925_s
1903-1925_as AD- KLKB1 380 NM_000892.3_ NM_000892.3_
GfsusGfgUfcAfuCfAfAfaUfaAfgUfgCfu 878
asAfsgCfaCfuUfaUfuugAfuGfaCfcAfcsasu 887 65103 382-402_s 380-402_as
UfL96 AD- KLKB1 380 NM_000892.3_ NM_000892.3_
gsusggucAfuCfAfAfauaagugcuuL96 879
asAfsgcaCfuUfAfuuugAfuGfaccacsasu 888 66948 382-402_s 380-402_as
AD- KLKB1 380 NM_000892.3_ NM_000892.3_
gsusggucAfuCfAfAfauaagugcuuL96 880
AfsAfsgcaCfuUfAfuuugAfuGfaccacsasu 889 66949 382-402_s
380-402_as
TABLE-US-00023 TABLE 19C Unmodified sense and antisense strand
sequences of agents targeting F12 Anti- sense Sense Antisense Start
Position Position Position in GenBank in GenBank Duplex on
Reference Reference SEQ ID SEQ ID Name Target mRNA Sequence
Sequence Sense Sequence NO Antiense Sequence NO AD- F12 2018
NM_000505.3_ NM_000505.3_ AACUCAAUAAAGUGCUUUGAA 890
UUCAAAGCACUUUAUUGAGUUUC 898 66121 2020-2040_s 2018-2040_as AD- F12
2018 NM_000505.3_ NM_000505.3_ AACUCAAUAAAGUGCUUUGAA 891
UUCAAAGCACUUUAUUGAGUUUC 899 67244 2020-2040_s 2018-2040_as AD- F12
2018 NM_000505.3_ NM_000505.3_ AACUCAAUAAAGUGCUUUGAA 892
UUCAAAGCACUUUAUUGAGUUUC 900 67245 2020-2040_s 2018-2040_as AD- F12
316 NM_000505.3_ NM_000505.3_ AGCCCAAGAAAGUGAAAGACA 893
UGUCUUUCACUUUCUUGGGCUCC 901 66125 318-338_s 316-338_as AD- F12 2023
NM_000505.3_ NM_000505.3_ AAUAAAGUGCUUUGAAAACGU 894
ACGUUUUCAAAGCACUUUAUUGA 902 67246 2025-2045_s 2023-2045_as AD- F12
2023 NM_000505.3_ NM_000505.3_ AAUAAAGUGCUUUGAAAACGU 895
ACGUUUUCAAAGCACUUUAUUGA 903 67247 2025-2045_s 2023-2045_as AD- F12
438 NM_000029.3_ NM_000029.3_ CAGAAAGAGAAGUGCUUUGAA 896
UUCAAAGCACUUCUCUUUCUGGC 904 67248 440-460_s 438-460_as AD- F12 438
NM_000029.3_ NM_000029.3_ CAGAAAGAGAAGUGCUUUGAA 897
UUCAAAGCACUUCUCUUUCUGGC 905 67249 440-460_s 438-460_as
TABLE-US-00024 TABLE 19D Modified sense and antisense strand
sequences of agents targeting F12 Anti- sense Sense Antisense Start
Position Position Position in GenBank in GenBank SEQ SEQ Duplex on
Reference Reference ID ID Name Target mRNA Sequence Sequence Sense
Sequence NO Antiense Sequence NO AD- F12 2018 NM_000505.3_
NM_000505.3_ AfsasCfuCfaAfuAfAfAfgUfgCfuUfuGfa 906
usUfscAfaAfgCfaCfuuuAfuUfgAfgUfususc 914 66121 2020-2040_s
2018-2040_as AfL96 AD- F12 2018 NM_000505.3_ NM_000505.3_
asascucaAfuAfAfAfgugcuuugaaL96 907
usUfscaaAfgCfAfcuuuAfuUfgaguususc 915 67244 2020-2040_s
2018-2040_as AD- F12 2018 NM_000505.3_ NM_000505.3_
asascucaAfuAfAfAfgugcuuugaaL96 908
UfsUfscaaAfgCfAfcuuuAfuUfgaguususc 916 67245 2020-2040_s
2018-2040_as AD- F12 316 NM_000505.3_ NM_000505.3_
AfsgsCfcCfaAfgAfAfAfgUfgAfaAfgAfc 909
usGfsuCfuUfuCfaCfuuuCfuUfgGfgCfuscsc 917 66125 318-338_s 316-338_as
AfL96 AD- F12 2023 NM_000505.3_ NM_000505.3_
asasuaaaGfuGfCfUfuugaaaacguL96 910
asCfsguuUfuCfAfaagcAfcUfuuauusgsa 918 67246 2025-2045_s
2023-2045_as AD- F12 2023 NM_000505.3_ NM_000505.3_
asasuaaaGfuGfCfUfuugaaaacguL96 911
AfsCfsguuUfuCfAfaagcAfcUfuuauusgsa 919 67247 2025-2045_s
2023-2045_as AD- F12 438 NM_000029.3_ NM_000029.3_
csasgaaaGfaGfAfAfgugcuuugaaL96 912
usUfscaaAfgCfAfcuucUfcUfuucugsgsc 920 67248 440-460_s 438-460_as
AD- F12 438 NM_000029.3_ NM_000029.3_
csasgaaaGfaGfAfAfgugcuuugaaL96 913
UfsUfscaaAfgCfAfcuucUfcUfuucugsgsc 921 67249 440-460_s
438-460_as
TABLE-US-00025 TABLE 19E Unmodified sense and antisense strand
sequences of agents targeting KNG1 Anti- sense Sense Antisense
Start Position Position Position in GenBank in GenBank Duplex on
Reference Reference SEQ ID SEQ ID Name Target mRNA Sequence
Sequence Sense Sequence NO Antiense Sequence NO AD- KNG1 302
NM_000893.3_ NM_000893.3_ GAGGAAAUUGACUGCAAUGAA 922
UUCAUUGCAGUCAAUUUCCUCGG 928 66259 304-324_s 302-324_as AD- KNG1 302
NM_000893.3_ NM_000893.3_ GAGGAAAUUGACUGCAAUGAA 923
UUCAUUGCAGUCAAUUUCCUCGG 929 67344 304-324_s 302-324_as AD- KNG1 302
NM_000893.3_ NM_000893.3_ GAGGAAAUUGACUGCAAUGAA 924
UUCAUUGCAGUCAAUUUCCUCGG 930 67345 304-324_s 302-324_as AD- KNG1 823
NM_000893.3_ NM_000893.3_ UACCUACUCAAUUGUGCAAAA 925
UUUUGCACAAUUGAGUAGGUAAU 931 66262 825-845_s 823-845_as AD- KNG1 823
NM_000893.3_ NM_000893.3_ UACCUACUCAAUUGUGCAAAA 926
UUUUGCACAAUUGAGUAGGUAAU 932 67346 825-845_s 823-845_as AD- KNG1 823
NM_000893.3_ NM_000893.3_ UACCUACUCAAUUGUGCAAAA 927
UUUUGCACAAUUGAGUAGGUAAU 933 67347 825-845_s 823-845_as
TABLE-US-00026 TABLE 19F Modified sense and antisense strand
sequences of agents targeting KNG1 Antisense Antisense Start Sense
Position Position Position in Genbank in GenBank SEQ SEQ Duplex on
Reference Reference ID ID Name Target mRNA Sequence Sequence Sense
Sequence NO Antisense Sequence NO AD- KNG1 302 NM_000893.3_
NM_000893.3_ GfsasGfgAfaAfuUfGfAf 934 usUfscAfuUfgCfaGfuc 940 66259
304-324_s 302-324_as cUfgCfaAfuGfaAfL96 aAfuUfuCfcUfcsgsg AD- KNG1
302 NM_000893.3_ NM_000893.3_ gsasggaaAfuUfGfAfcug 935
usUfscauUfgCfAfguca 941 67344 304-324_s 302-324_as caaugaaL96
AfuUfuccucsgsg AD- KNG1 302 NM_000893.3_ NM_000893.3_
gsasggaaAfuUfGfAfcug 936 UfsUfscauUgfCfAfguc 942 67345 304-324_s
302-324_as caaugaaL96 aAfuUfuccucsgsg AD- KNG1 823 NM_000893.3_
NM_000893.3_ UfsasCfcUfaCfuCfAfAf 937 usUfsuUfgCfaCfaAfuu 943 66262
825-845_s 823-845_as uUfgUfgCfaAfaAfL96 gAfgUfaGfgUfasasu AD- KNG1
823 NM_000893.3_ NM_000893.3_ usasccuaCfuCfAfAfuug 938
usUfsuugCfaCfAfauug 944 67346 825-845_s 823-845_as ugcaaaaL96
AfgUfagguasasu AD- KNG1 823 NM_000893.3_ NM_000893.3_
usasccuaCfuCfAfAfuug 939 UfsUfsuugCfaCfAfauu 945 67347 825-845_s
823-845_as ugcaaaaL96 gAfgUfagguasasu
Example 8
In Vivo KLKB1, F12, and KNG1 Silencing in ACE-Inhibitor Induced
Vascular Permeability Mouse Model
[0677] To determine the in vivo efficacy of a single dose of a
subset of the agents described above to reduce human KLKB1, F12, or
KNG1 mRNA levels, wild-type C57BL/6 female mice were subcutaneously
administered a single 0 mg/kg, 0.3 mg/kg 1 mg/kg, 3 mg/kg or 10
mg/kg dose of AD-66948 (targeting KLKB1), or a single 0 mg/kg, 0.1
mg/kg 0.3 mg/kg, 1 mg/kg or 3 mg/kg dose of AD-67244 (targeting
F12), or a single 0 mg/kg, 0.3 mg/kg 1 mg/kg, 3 mg/kg or 10 mg/kg
dose of AD-67344 (targeting KNG1). At day 7 post-dose, animals were
intravenously administered 2.5 mg/kg of the angiotensin-converting
enzyme (ACE) inhibitor, captopril, in order to induce vascular
permeability. Fifteen minutes after administration of captopril,
animals were intravenously administered 30 mg/kg Evans blue dye.
Fifteen minutes after Evans Blue dye administration, animals were
sacrificed and blood, intestine, and liver samples were collected.
Evans Blue dye was extracted and quantified from the blood and
intestine samples, and target mRNA levels were determined in the
liver samples.
[0678] The results of these assays using an agent targeting KLKB1
(AD-66948) are shown in FIG. 4. The results of these assays using
an agent targeting F12 (AD-AD-67244) are shown in FIG. 5. The
results of these assays using an agent targeting KNG1 (AD-AD-67344)
are shown in FIG. 6.
Example 9
Synthesis and In Vitro Screening of F12 siRNA Duplexes
[0679] Additional iRNA agents targeting F12 were designed,
synsthesized and screened for in vitro efficacy, as described
above. A detailed list of the additional unmodified F12 sense and
antisense strand sequences is shown in Table 20. A detailed list of
the additional modified F12 sense and antisense strand sequences is
shown in Table 21. Table 22 shows the results of a single dose
screen in Hep3b cells transfected with the indicated additional F12
iRNAs. Data are expressed as percent of mRNA remaining relative to
AD-1955.
TABLE-US-00027 TABLE 20 F12 Unmodified Sequences Duplex Sense SEQ
Position in Antisense SEQ Position in Name Sequence 5' to 3' ID NO
NM_000505.3 Sequence 5' to 3' ID NO NM_000505.3 AD-70653
GACUCCUGGAUAGGCAGCU 946 12-30 AGCUGCCUAUCCAGGAGUC 1130 12-30
AD-70654 UAGGCAGCUGGACCAACGA 947 22-40 UCGUUGGUCCAGCUGCCUA 1131
22-40 AD-70655 ACCAACGGACGGAUGCCAU 948 33-51 AUGGCAUCCGUCCGUUGGU
1132 33-51 AD-70656 AUGCCAUGAGGGCUCUGCU 949 45-63
AGCAGAGCCCUCAUGGCAU 1133 45-63 AD-70657 GCUCUGCUGCUCCUGGGGU 950
56-74 ACCCCAGGAGCAGCAGAGC 1134 56-74 AD-70658 UCCUGGGGUUCCUGCUGGU
951 66-84 ACCAGCAGGAACCCCAGGA 1135 66-84 AD-70659
CUGCUGGUGAGCUUGGAGU 952 77-95 ACUCCAAGCUCACCAGCAG 1136 77-95
AD-70660 CUUGGAGUCAACACUUUCA 953 88-106 UGAAAGUGUUGACUCCAAG 1137
88-106 AD-70661 ACUUUCGAUUCCACCUUGA 954 100-118 UCAAGGUGGAAUCGAAAGU
1138 100-118 AD-70662 CCACCUUGGGAAGCCCCCA 955 110-128
UGGGGGCUUCCCAAGGUGG 1139 110-128 AD-70663 GCCCCCAAGGAGCAUAAGU 956
122-140 ACUUAUGCUCCUUGGGGGC 1140 122-140 AD-70664
CAUAAGUACAAAGCUGAAA 957 134-152 UUUCAGCUUUGUACUUAUG 1141 134-152
AD-70665 AAGCUGAAGAGCACACAGU 958 144-162 ACUGUGUGCUCUUCAGCUU 1142
144-162 AD-70666 ACACAGUCGUUCUCACUGU 959 156-174
ACAGUGAGAACGACUGUGU 1143 156-174 AD-70667 UUCUCACUGUCACCGGGGA 960
165-183 UCCCCGGUGACAGUGAGAA 1144 165-183 AD-70668
ACCGGGGAGCCCUGCCACU 961 176-194 AGUGGCAGGGCUCCCCGGU 1145 176-194
AD-70669 UGCCACUUCCCCUUCCAGU 962 188-206 ACUGGAAGGGGAAGUGGCA 1146
188-206 AD-70670 UUCCAGUACCACCGGCAGA 963 200-218
UCUGCCGGUGGUACUGGAA 1147 200-218 AD-70671 ACCGGCAGCUGUACCACAA 964
210-228 UUGUGGUACAGCUGCCGGU 1148 210-228 AD-70672
UACCACAAAUGUACCCACA 965 221-239 UGUGGGUACAUUUGUGGUA 1149 221-239
AD-70673 UACCCACAAGGGCCGGCCA 966 232-250 UGGCCGGCCCUUGUGGGUA 1150
232-250 AD-70674 GCCGGCCAGGCCCUCAGCA 967 243-261
UGCUGAGGGCCUGGCCGGC 1151 243-261 AD-70675 CUCAGCCCUGGUGUGCUAA 968
255-273 UUAGCACACCAGGGCUGAG 1152 255-273 AD-70676
UGUGCUACCACCCCCAACU 969 266-284 AGUUGGGGGUGGUAGCACA 1153 266-284
AD-70677 ACCCCCAACUUUGAUCAGA 970 275-293 UCUGAUCAAAGUUGGGGGU 1154
275-293 AD-70678 AUCAGGACCAGCGAUGGGA 971 288-306
UCCCAUCGCUGGUCCUGAU 1155 288-306 AD-70679 AGCGAUGGGGAUACUGUUU 972
297-315 AAACAGUAUCCCCAUCGCU 1156 297-315 AD-70680
UACUGUUUGGAGCCCAAGA 973 308-326 UCUUGGGCUCCAAACAGUA 1157 308-326
AD-70681 CCAAGAAAGUGAAAGACCA 974 321-339 UGGUCUUUCACUUUCUUGG 1158
321-339 AD-70682 AAAGACCACUGCAGCAAAC 975 332-350
GUUUGCUGCAGUGGUCUUU 1159 332-350 AD-70683 UGCAGCAAACACAGCCCCU 976
341-359 AGGGGCUGUGUUUGCUGCA 1160 341-359 AD-70684
AGCCCCUGCCAGAAAGGAA 977 353-371 UUCCUUUCUGGCAGGGGCU 1161 353-371
AD-70685 AGAAAGGAGGGACCUGUGU 978 363-381 ACACAGGUCCCUCCUUUCU 1162
363-381 AD-70686 ACCUGUGUGAACAUGCCAA 979 374-392
UUGGCAUGUUCACACAGGU 1163 374-392 AD-70687 AUGCCAAGCGGCCCCCACU 980
386-404 AGUGGGGGCCGCUUGGCAU 1164 386-404 AD-70688
GCCCCCACUGUCUCUGUCA 981 396-414 UGACAGAGACAGUGGGGGC 1165 396-414
AD-70689 CACCUCACUGGAAACCACU 982 419-437 AGUGGUUUCCAGUGAGGUG 1166
419-437 AD-70690 AACCACUGCCAGAAAGAGA 983 431-449
UCUCUUUCUGGCAGUGGUU 1167 431-449 AD-70691 CAGAAAGAGAAGUGCUUUA 984
440-458 UAAAGCACUUCUCUUUCUG 1168 440-458 AD-70692
UGCUUUGAGCCUCAGCUUA 985 452-470 UAAGCUGAGGCUCAAAGCA 1169 452-470
AD-70693 CAGCUUCUCCGGUUUUUCA 986 464-482 UGAAAAACCGGAGAAGCUG 1170
464-482 AD-70694 CGGUUUUUCCACAAGAAUA 987 473-491
UAUUCUUGUGGAAAAACCG 1171 473-491 AD-70695 CAAGAAUGAGAUAUGGUAU 988
484-502 AUACCAUAUCUCAUUCUUG 1172 484-502 AD-70696
UAUGGUAUAGAACUGAGCA 989 495-513 UGCUCAGUUCUAUACCAUA 1173 495-513
AD-70697 UGAGCAAGCAGCUGUGGCA 990 508-526 UGCCACAGCUGCUUGCUCA 1174
508-526 AD-70698 GCUGUGGCCAGAUGCCAGU 991 518-536
ACUGGCAUCUGGCCACAGC 1175 518-536 AD-70699 AUGCCAGUGCAAGGGUCCU 992
529-547 AGGACCCUUGCACUGGCAU 1176 529-547 AD-70700
AAGGGUCCUGAUGCCCACU 993 539-557 AGUGGGCAUCAGGACCCUU 1177 539-557
AD-70701 UGCCCACUGCCAGCGGCUA 994 550-568 UAGCCGCUGGCAGUGGGCA 1178
550-568 AD-70702 CGGCUGGCCAGCCAGGCCU 995 563-581
AGGCCUGGCUGGCCAGCCG 1179 563-581 AD-70703 AGCCAGGCCUGCCGCACCA 996
572-590 UGGUGCGGCAGGCCUGGCU 1180 572-590 AD-70704
CGCACCAACCCGUGCCUCA 997 584-602 UGAGGCACGGGUUGGUGCG 1181 584-602
AD-70705 UGCCUCCAUGGGGGUCGCU 998 596-614 AGCGACCCCCAUGGAGGCA 1182
596-614 AD-70706 GGGGUCGCUGCCUAGAGGU 999 606-624
ACCUCUAGGCAGCGACCCC 1183 606-624 AD-70707 CUAGAGGUGGAGGGCCACA 1000
617-635 UGUGGCCCUCCACCUCUAG 1184 617-635 AD-70708
AGGGCCACCGCCUGUGCCA 1001 627-645 UGGCACAGGCGGUGGCCCU 1185 627-645
AD-70709 UGUGCCACUGCCCGGUGGA 1002 639-657 UCCACCGGGCAGUGGCACA 1186
639-657 AD-70710 CGGUGGGCUACACCGGAGA 1003 651-669
UCUCCGGUGUAGCCCACCG 1187 651-669 AD-70711 ACCGGAGCCUUCUGCGACA 1004
662-680 UGUCGCAGAAGGCUCCGGU 1188 662-680 AD-70712
UUCUGCGACGUGGACACCA 1005 671-689 UGGUGUCCACGUCGCAGAA 1189 671-689
AD-70713 GACACCAAGGCAAGCUGCU 1006 683-701 AGCAGCUUGCCUUGGUGUC 1190
683-701 AD-70714 CAAGCUGCUAUGAUGGCCA 1007 693-711
UGGCCAUCAUAGCAGCUUG 1191 693-711 AD-70715 GAUGGCCGCGGGCUCAGCU 1008
704-722 AGCUGAGCCCGCGGCCAUC 1192 704-722 AD-70716
UCAGCUACCGCGGCCUGGA 1009 717-735 UCCAGGCCGCGGUAGCUGA 1193 717-735
AD-70717 CGGCCUGGCCAGGACCACA 1010 727-745 UGUGGUCCUGGCCAGGCCG 1194
727-745 AD-70718 AGGACCACGCUCUCGGGUA 1011 737-755
UACCCGAGAGCGUGGUCCU 1195 737-755 AD-70719 UCGGGUGCGCCCUGUCAGA 1012
749-767 UCUGACAGGGCGCACCCGA 1196 749-767 AD-70720
CUGUCAGCCGUGGGCCUCA 1013 760-778 UGAGGCCCACGGCUGACAG 1197 760-778
AD-70721 UGGGCCUCGGAGGCCACCU 1014 770-788 AGGUGGCCUCCGAGGCCCA 1198
770-788 AD-70722 CCACCUACCGGAACGUGAA 1015 783-801
UUCACGUUCCGGUAGGUGG 1199 783-801 AD-70723 AACGUGACUGCCGAGCAAA 1016
794-812 UUUGCUCGGCAGUCACGUU 1200 794-812 AD-70724
CGAGCAAGCGCGGAACUGA 1017 805-823 UCAGUUCCGCGCUUGCUCG 1201 805-823
AD-70725 CGGAACUGGGGACUGGGCA 1018 815-833 UGCCCAGUCCCCAGUUCCG 1202
815-833 AD-70726 GACUGGGCGGCCACGCCUU 1019 825-843
AAGGCGUGGCCGCCCAGUC 1203 825-843 AD-70727 ACGCCUUCUGCCGGAACCA 1020
837-855 UGGUUCCGGCAGAAGGCGU 1204 837-855 AD-70728
CGGAACCCGGACAACGACA 1021 848-866 UGUCGUUGUCCGGGUUCCG 1205 848-866
AD-70729 AACGACAUCCGCCCGUGGU 1022 860-878 ACCACGGGCGGAUGUCGUU 1206
860-878 AD-70730 GCCCGUGGUGCUUCGUGCU 1023 870-888
AGCACGAAGCACCACGGGC 1207 870-888 AD-70731 UUCGUGCUGAACCGCGACA 1024
881-899 UGUCGCGGUUCAGCACGAA 1208 881-899 AD-70732
ACCGCGACCGGCUGAGCUA 1025 891-909 UAGCUCAGCCGGUCGCGGU 1209 891-909
AD-70733 CUGAGCUGGGAGUACUGCA 1026 902-920 UGCAGUACUCCCAGCUCAG 1210
902-920 AD-70734 UACUGCGACCUGGCACAGU 1027 914-932
ACUGUGCCAGGUCGCAGUA 1211 914-932 AD-70735 UGGCACAGUGCCAGACCCA 1028
924-942 UGGGUCUGGCACUGUGCCA 1212 924-942 AD-70736
AGACCCCAACCCAGGCGGA 1029 936-954 UCCGCCUGGGUUGGGGUCU 1213
936-954
AD-70737 AGGCGGCGCCUCCGACCCA 1030 948-966 UGGGUCGGAGGCGCCGCCU 1214
948-966 AD-70738 UCCGACCCCGGUGUCCCCU 1031 958-976
AGGGGACACCGGGGUCGGA 1215 958-976 AD-70739 UGUCCCCUAGGCUUCAUGU 1032
969-987 ACAUGAAGCCUAGGGGACA 1216 969-987 AD-70740
UUCAUGUCCCACUCAUGCA 1033 981-999 UGCAUGAGUGGGACAUGAA 1217 981-999
AD-70741 ACUCAUGCCCGCGCAGCCA 1034 991-1009 UGGCUGCGCGGGCAUGAGU 1218
991-1009 AD-70742 CGCAGCCGGCACCGCCGAA 1035 1002-1020
UUCGGCGGUGCCGGCUGCG 1219 1002-1020 AD-70743 ACCGCCGAAGCCUCAGCCA
1036 1012-1030 UGGCUGAGGCUUCGGCGGU 1220 1012-1030 AD-70744
UCAGCCCACGACCCGGACA 1037 1024-1042 UGUCCGGGUCGUGGGCUGA 1221
1024-1042 AD-70745 ACCCGGACCCCGCCUCAGU 1038 1034-1052
ACUGAGGCGGGGUCCGGGU 1222 1034-1052 AD-70562 CCUCAGUCCCAGACCCCGA
1039 1046-1064 UCGGGGUCUGGGACUGAGG 1223 1046-1064 AD-70563
AGACCCCGGGAGCCUUGCA 1040 1056-1074 UGCAAGGCUCCCGGGGUCU 1224
1056-1074 AD-70564 CCUUGCCGGCGAAGCGGGA 1041 1068-1086
UCCCGCUUCGCCGGCAAGG 1225 1068-1086 AD-70565 AAGCGGGAGCAGCCGCCUU
1042 1079-1097 AAGGCGGCUGCUCCCGCUU 1226 1079-1097 AD-70566
AGCCGCCUUCCCUGACCAA 1043 1089-1107 UUGGUCAGGGAAGGCGGCU 1227
1089-1107 AD-70567 UGACCAGGAACGGCCCACU 1044 1101-1119
AGUGGGCCGUUCCUGGUCA 1228 1101-1119 AD-70568 CGGCCCACUGAGCUGCGGA
1045 1111-1129 UCCGCAGCUCAGUGGGCCG 1229 1111-1129 AD-70569
UGCGGGCAGCGGCUCCGCA 1046 1124-1142 UGCGGAGCCGCUGCCCGCA 1230
1124-1142 AD-70570 CGGCUCCGCAAGAGUCUGU 1047 1133-1151
ACAGACUCUUGCGGAGCCG 1231 1133-1151 AD-70571 AGUCUGUCUUCGAUGACCA
1048 1145-1163 UGGUCAUCGAAGACAGACU 1232 1145-1163 AD-70572
CGAUGACCCGCGUCGUUGA 1049 1155-1173 UCAACGACGCGGGUCAUCG 1233
1155-1173 AD-70573 UCGUUGGCGGGCUGGUGGA 1050 1167-1185
UCCACCAGCCCGCCAACGA 1234 1167-1185 AD-70574 UGGUGGCGCUACGCGGGGA
1051 1179-1197 UCCCCGCGUAGCGCCACCA 1235 1179-1197 AD-70575
UACGCGGGGCGCACCCCUA 1052 1188-1206 UAGGGGUGCGCCCCGCGUA 1236
1188-1206 AD-70576 ACCCCUACAUCGCCGCGCU 1053 1200-1218
AGCGCGGCGAUGUAGGGGU 1237 1200-1218 AD-70577 GCCGCGCUGUACUGGGGCA
1054 1211-1229 UGCCCCAGUACAGCGCGGC 1238 1211-1229 AD-70578
CUGGGGCCACAGUUUCUGA 1055 1222-1240 UCAGAAACUGUGGCCCCAG 1239
1222-1240 AD-70579 UUUCUGCGCCGGCAGCCUA 1056 1234-1252
UAGGCUGCCGGCGCAGAAA 1240 1234-1252 AD-70580 CGGCAGCCUCAUCGCCCCA
1057 1243-1261 UGGGGCGAUGAGGCUGCCG 1241 1243-1261 AD-70581
UCGCCCCCUGCUGGGUGCU 1058 1254-1272 AGCACCCAGCAGGGGGCGA 1242
1254-1272 AD-70582 UGGGUGCUGACGGCCGCUA 1059 1265-1283
UAGCGGCCGUCAGCACCCA 1243 1265-1283 AD-70583 GCCGCUCACUGCCUGCAGA
1060 1277-1295 UCUGCAGGCAGUGAGCGGC 1244 1277-1295 AD-70584
CUGCAGGACCGGCCCGCAA 1061 1289-1307 UUGCGGGCCGGUCCUGCAG 1245
1289-1307 AD-70585 GGCCCGCACCCGAGGAUCU 1062 1299-1317
AGAUCCUCGGGUGCGGGCC 1246 1299-1317 AD-70586 CGAGGAUCUGACGGUGGUA
1063 1309-1327 UACCACCGUCAGAUCCUCG 1247 1309-1327 AD-70587
GUGGUGCUCGGCCAGGAAA 1064 1322-1340 UUUCCUGGCCGAGCACCAC 1248
1322-1340 AD-70588 GCCAGGAACGCCGUAACCA 1065 1332-1350
UGGUUACGGCGUUCCUGGC 1249 1332-1350 AD-70589 CGUAACCACAGCUGUGAGA
1066 1343-1361 UCUCACAGCUGUGGUUACG 1250 1343-1361 AD-70590
UGUGAGCCGUGCCAGACGU 1067 1355-1373 ACGUCUGGCACGGCUCACA 1251
1355-1373 AD-70591 UGCCAGACGUUGGCCGUGA 1068 1364-1382
UCACGGCCAACGUCUGGCA 1252 1364-1382 AD-70592 GCCGUGCGCUCCUACCGCU
1069 1376-1394 AGCGGUAGGAGCGCACGGC 1253 1376-1394 AD-70593
UACCGCUUGCACGAGGCCU 1070 1388-1406 AGGCCUCGUGCAAGCGGUA 1254
1388-1406 AD-70594 ACGAGGCCUUCUCGCCCGU 1071 1398-1416
ACGGGCGAGAAGGCCUCGU 1255 1398-1416 AD-70595 UCGCCCGUCAGCUACCAGA
1072 1409-1427 UCUGGUAGCUGACGGGCGA 1256 1409-1427 AD-70596
CUACCAGCACGACCUGGCU 1073 1420-1438 AGCCAGGUCGUGCUGGUAG 1257
1420-1438 AD-70597 ACCUGGCUCUGUUGCGCCU 1074 1431-1449
AGGCGCAACAGAGCCAGGU 1258 1431-1449 AD-70598 UUGCGCCUUCAGGAGGAUA
1075 1442-1460 UAUCCUCCUGAAGGCGCAA 1259 1442-1460 AD-70599
GAGGAUGCGGACGGCAGCU 1076 1454-1472 AGCUGCCGUCCGCAUCCUC 1260
1454-1472 AD-70600 ACGGCAGCUGCGCGCUCCU 1077 1464-1482
AGGAGCGCGCAGCUGCCGU 1261 1464-1482 AD-70601 CGCUCCUGUCGCCUUACGU
1078 1476-1494 ACGUAAGGCGACAGGAGCG 1262 1476-1494 AD-70602
CCUUACGUUCAGCCGGUGU 1079 1487-1505 ACACCGGCUGAACGUAAGG 1263
1487-1505 AD-70603 AGCCGGUGUGCCUGCCAAA 1080 1497-1515
UUUGGCAGGCACACCGGCU 1264 1497-1515 AD-70604 UGCCAAGCGGCGCCGCGCA
1081 1509-1527 UGCGCGGCGCCGCUUGGCA 1265 1509-1527 AD-70605
GCGCCGCGCGACCCUCCGA 1082 1518-1536 UCGGAGGGUCGCGCGGCGC 1266
1518-1536 AD-70606 CCCUCCGAGACCACGCUCU 1083 1529-1547
AGAGCGUGGUCUCGGAGGG 1267 1529-1547 AD-70607 CGCUCUGCCAGGUGGCCGA
1084 1542-1560 UCGGCCACCUGGCAGAGCG 1268 1542-1560 AD-70608
AGGUGGCCGGCUGGGGCCA 1085 1551-1569 UGGCCCCAGCCGGCCACCU 1269
1551-1569 AD-70609 UGGGGCCACCAGUUCGAGA 1086 1562-1580
UCUCGAACUGGUGGCCCCA 1270 1562-1580 AD-70610 UUCGAGGGGGCGGAGGAAU
1087 1574-1592 AUUCCUCCGCCCCCUCGAA 1271 1574-1592 AD-70611
CGGAGGAAUAUGCCAGCUU 1088 1584-1602 AAGCUGGCAUAUUCCUCCG 1272
1584-1602 AD-70612 CAGCUUCCUGCAGGAGGCA 1089 1597-1615
UGCCUCCUGCAGGAAGCUG 1273 1597-1615 AD-70613 AGGAGGCGCAGGUACCGUU
1090 1608-1626 AACGGUACCUGCGCCUCCU 1274 1608-1626 AD-70614
AGGUACCGUUCCUCUCCCU 1091 1617-1635 AGGGAGAGGAACGGUACCU 1275
1617-1635 AD-70615 CUCUCCCUGGAGCGCUGCU 1092 1628-1646
AGCAGCGCUCCAGGGAGAG 1276 1628-1646 AD-70616 CGCUGCUCAGCCCCGGACA
1093 1640-1658 UGUCCGGGGCUGAGCAGCG 1277 1640-1658 AD-70617
CCGGACGUGCACGGAUCCU 1094 1652-1670 AGGAUCCGUGCACGUCCGG 1278
1652-1670 AD-70618 CGGAUCCUCCAUCCUCCCA 1095 1663-1681
UGGGAGGAUGGAGGAUCCG 1279 1663-1681 AD-70619 CAUCCUCCCCGGCAUGCUA
1096 1672-1690 UAGCAUGCCGGGGAGGAUG 1280 1672-1690 AD-70620
CAUGCUCUGCGCAGGGUUA 1097 1684-1702 UAACCCUGCGCAGAGCAUG 1281
1684-1702 AD-70621 AGGGUUCCUCGAGGGCGGA 1098 1696-1714
UCCGCCCUCGAGGAACCCU 1282 1696-1714 AD-70622 GAGGGCGGCACCGAUGCGU
1099 1706-1724 ACGCAUCGGUGCCGCCCUC 1283 1706-1724 AD-70623
GAUGCGUGCCAGGGUGAUU 1100 1718-1736 AAUCACCCUGGCACGCAUC 1284
1718-1736 AD-70624 AGGGUGAUUCCGGAGGCCA 1101 1728-1746
UGGCCUCCGGAAUCACCCU 1285 1728-1746 AD-70625 CGGAGGCCCGCUGGUGUGU
1102 1738-1756 ACACACCAGCGGGCCUCCG 1286 1738-1756 AD-70626
GGUGUGUGAGGACCAAGCU 1103 1750-1768 AGCUUGGUCCUCACACACC 1287
1750-1768 AD-70627 CCAAGCUGCAGAGCGCCGA 1104 1762-1780
UCGGCGCUCUGCAGCUUGG 1288 1762-1780 AD-70628 AGAGCGCCGGCUCACCCUA
1105 1771-1789 UAGGGUGAGCCGGCGCUCU 1289 1771-1789 AD-70629
UCACCCUGCAAGGCAUCAU 1106 1782-1800 AUGAUGCCUUGCAGGGUGA 1290
1782-1800 AD-70630 GGCAUCAUCAGCUGGGGAU 1107 1793-1811
AUCCCCAGCUGAUGAUGCC 1291 1793-1811 AD-70631 CUGGGGAUCGGGCUGUGGU
1108 1804-1822 ACCACAGCCCGAUCCCCAG 1292 1804-1822 AD-70632
UGUGGUGACCGCAACAAGA 1109 1817-1835 UCUUGUUGCGGUCACCACA 1293
1817-1835 AD-70633 CAACAAGCCAGGCGUCUAA 1110 1828-1846
UUAGACGCCUGGCUUGUUG 1294 1828-1846 AD-70634 AGGCGUCUACACCGAUGUA
1111 1837-1855 UACAUCGGUGUAGACGCCU 1295 1837-1855 AD-70635
GAUGUGGCCUACUACCUGA 1112 1850-1868 UCAGGUAGUAGGCCACAUC 1296
1850-1868
AD-70636 UACUACCUGGCCUGGAUCA 1113 1859-1877 UGAUCCAGGCCAGGUAGUA
1297 1859-1877 AD-70637 CUGGAUCCGGGAGCACACA 1114 1870-1888
UGUGUGCUCCCGGAUCCAG 1298 1870-1888 AD-70638 AGCACACCGUUUCCUGAUU
1115 1881-1899 AAUCAGGAAACGGUGUGCU 1299 1881-1899 AD-70639
UCCUGAUUGCUCAGGGACU 1116 1892-1910 AGUCCCUGAGCAAUCAGGA 1300
1892-1910 AD-70640 CAGGGACUCAUCUUUCCCU 1117 1903-1921
AGGGAAAGAUGAGUCCCUG 1301 1903-1921 AD-70641 UUUCCCUCCUUGGUGAUUA
1118 1915-1933 UAAUCACCAAGGAGGGAAA 1302 1915-1933 AD-70642
UGGUGAUUCCGCAGUGAGA 1119 1925-1943 UCUCACUGCGGAAUCACCA 1303
1925-1943 AD-70643 AGUGAGAGAGUGGCUGGGA 1120 1937-1955
UCCCAGCCACUCUCUCACU 1304 1937-1955 AD-70644 GCUGGGGCAUGGAAGGCAA
1121 1949-1967 UUGCCUUCCAUGCCCCAGC 1305 1949-1967 AD-70645
UGGAAGGCAAGAUUGUGUA 1122 1958-1976 UACACAAUCUUGCCUUCCA 1306
1958-1976 AD-70646 UUGUGUCCCAUUCCCCCAA 1123 1970-1988
UUGGGGGAAUGGGACACAA 1307 1970-1988 AD-70647 UCCCCCAGUGCGGCCAGCU
1124 1981-1999 AGCUGGCCGCACUGGGGGA 1308 1981-1999 AD-70648
GCCAGCUCCGCGCCAGGAU 1125 1993-2011 AUCCUGGCGCGGAGCUGGC 1309
1993-2011 AD-70649 GCCAGGAUGGCGCAGGAAA 1126 2004-2022
UUUCCUGCGCCAUCCUGGC 1310 2004-2022 AD-70650 GCAGGAACUCAAUAAAGUA
1127 2015-2033 UACUUUAUUGAGUUCCUGC 1311 2015-2033 AD-70651
AAUAAAGUGCUUUGAAAAU 1128 2025-2043 AUUUUCAAAGCACUUUAUU 1312
2025-2043 AD-70652 UUGAAAAUGCUGAGAAAAA 1129 2036-2054
UUUUUCUCAGCAUUUUCAA 1313 2036-2054
TABLE-US-00028 TABLE 21 F12 Modified Sequences Duplex Sense SEQ
Antisense SEQ SEQ Name Sequence 5' to 3' ID NO Sequence 5' to 3' ID
NO mRNA target sequence ID NO AD-70653 GACUCCUGGAUAGGCAGCUdTdT 1314
AGCUGCCUAUCCAGGAGUCdTdT 1498 GACUCCUGGAUAGGCAGCU 1682 AD-70654
UAGGCAGCUGGACCAACGAdTdT 1315 UCGUUGGUCCAGCUGCCUAdTdT 1499
UAGGCAGCUGGACCAACGG 1683 AD-70655 ACCAACGGACGGAUGCCAUdTdT 1316
AUGGCAUCCGUCCGUUGGUdTdT 1500 ACCAACGGACGGAUGCCAU 1684 AD-70656
AUGCCAUGAGGGCUCUGCUdTdT 1317 AGCAGAGCCCUCAUGGCAUdTdT 1501
AUGCCAUGAGGGCUCUGCU 1685 AD-70657 GCUCUGCUGCUCCUGGGGUdTdT 1318
ACCCCAGGAGCAGCAGAGCdTdT 1502 GCUCUGCUGCUCCUGGGGU 1686 AD-70658
UCCUGGGGUUCCUGCUGGUdTdT 1319 ACCAGCAGGAACCCCAGGAdTdT 1503
UCCUGGGGUUCCUGCUGGU 1687 AD-70659 CUGCUGGUGAGCUUGGAGUdTdT 1320
ACUCCAAGCUCACCAGCAGdTdT 1504 CUGCUGGUGAGCUUGGAGU 1688 AD-70660
CUUGGAGUCAACACUUUCAdTdT 1321 UGAAAGUGUUGACUCCAAGdTdT 1505
CUUGGAGUCAACACUUUCG 1689 AD-70661 ACUUUCGAUUCCACCUUGAdTdT 1322
UCAAGGUGGAAUCGAAAGUdTdT 1506 ACUUUCGAUUCCACCUUGG 1690 AD-70662
CCACCUUGGGAAGCCCCCAdTdT 1323 UGGGGGCUUCCCAAGGUGGdTdT 1507
CCACCUUGGGAAGCCCCCA 1691 AD-70663 GCCCCCAAGGAGCAUAAGUdTdT 1324
ACUUAUGCUCCUUGGGGGCdTdT 1508 GCCCCCAAGGAGCAUAAGU 1692 AD-70664
CAUAAGUACAAAGCUGAAAdTdT 1325 UUUCAGCUUUGUACUUAUGdTdT 1509
CAUAAGUACAAAGCUGAAG 1693 AD-70665 AAGCUGAAGAGCACACAGUdTdT 1326
ACUGUGUGCUCUUCAGCUUdTdT 1510 AAGCUGAAGAGCACACAGU 1694 AD-70666
ACACAGUCGUUCUCACUGUdTdT 1327 ACAGUGAGAACGACUGUGUdTdT 1511
ACACAGUCGUUCUCACUGU 1695 AD-70667 UUCUCACUGUCACCGGGGAdTdT 1328
UCCCCGGUGACAGUGAGAAdTdT 1512 UUCUCACUGUCACCGGGGA 1696 AD-70668
ACCGGGGAGCCCUGCCACUdTdT 1329 AGUGGCAGGGCUCCCCGGUdTdT 1513
ACCGGGGAGCCCUGCCACU 1697 AD-70669 UGCCACUUCCCCUUCCAGUdTdT 1330
ACUGGAAGGGGAAGUGGCAdTdT 1514 UGCCACUUCCCCUUCCAGU 1698 AD-70670
UUCCAGUACCACCGGCAGAdTdT 1331 UCUGCCGGUGGUACUGGAAdTdT 1515
UUCCAGUACCACCGGCAGC 1699 AD-70671 ACCGGCAGCUGUACCACAAdTdT 1332
UUGUGGUACAGCUGCCGGUdTdT 1516 ACCGGCAGCUGUACCACAA 1700 AD-70672
UACCACAAAUGUACCCACAdTdT 1333 UGUGGGUACAUUUGUGGUAdTdT 1517
UACCACAAAUGUACCCACA 1701 AD-70673 UACCCACAAGGGCCGGCCAdTdT 1334
UGGCCGGCCCUUGUGGGUAdTdT 1518 UACCCACAAGGGCCGGCCA 1702 AD-70674
GCCGGCCAGGCCCUCAGCAdTdT 1335 UGCUGAGGGCCUGGCCGGCdTdT 1519
GCCGGCCAGGCCCUCAGCC 1703 AD-70675 CUCAGCCCUGGUGUGCUAAdTdT 1336
UUAGCACACCAGGGCUGAGdTdT 1520 CUCAGCCCUGGUGUGCUAC 1704 AD-70676
UGUGCUACCACCCCCAACUdTdT 1337 AGUUGGGGGUGGUAGCACAdTdT 1521
UGUGCUACCACCCCCAACU 1705 AD-70677 ACCCCCAACUUUGAUCAGAdTdT 1338
UCUGAUCAAAGUUGGGGGUdTdT 1522 ACCCCCAACUUUGAUCAGG 1706 AD-70678
AUCAGGACCAGCGAUGGGAdTdT 1339 UCCCAUCGCUGGUCCUGAUdTdT 1523
AUCAGGACCAGCGAUGGGG 1707 AD-70679 AGCGAUGGGGAUACUGUUUdTdT 1340
AAACAGUAUCCCCAUCGCUdTdT 1524 AGCGAUGGGGAUACUGUUU 1708 AD-70680
UACUGUUUGGAGCCCAAGAdTdT 1341 UCUUGGGCUCCAAACAGUAdTdT 1525
UACUGUUUGGAGCCCAAGA 1709 AD-70681 CCAAGAAAGUGAAAGACCAdTdT 1342
UGGUCUUUCACUUUCUUGGdTdT 1526 CCAAGAAAGUGAAAGACCA 1710 AD-70682
AAAGACCACUGCAGCAAACdTdT 1343 GUUUGCUGCAGUGGUCUUUdTdT 1527
AAAGACCACUGCAGCAAAC 1711 AD-70683 UGCAGCAAACACAGCCCCUdTdT 1344
AGGGGCUGUGUUUGCUGCAdTdT 1528 UGCAGCAAACACAGCCCCU 1712 AD-70684
AGCCCCUGCCAGAAAGGAAdTdT 1345 UUCCUUUCUGGCAGGGGCUdTdT 1529
AGCCCCUGCCAGAAAGGAG 1713 AD-70685 AGAAAGGAGGGACCUGUGUdTdT 1346
ACACAGGUCCCUCCUUUCUdTdT 1530 AGAAAGGAGGGACCUGUGU 1714 AD-70686
ACCUGUGUGAACAUGCCAAdTdT 1347 UUGGCAUGUUCACACAGGUdTdT 1531
ACCUGUGUGAACAUGCCAA 1715 AD-70687 AUGCCAAGCGGCCCCCACUdTdT 1348
AGUGGGGGCCGCUUGGCAUdTdT 1532 AUGCCAAGCGGCCCCCACU 1716 AD-70688
GCCCCCACUGUCUCUGUCAdTdT 1349 UGACAGAGACAGUGGGGGCdTdT 1533
GCCCCCACUGUCUCUGUCC 1717 AD-70689 CACCUCACUGGAAACCACUdTdT 1350
AGUGGUUUCCAGUGAGGUGdTdT 1534 CACCUCACUGGAAACCACU 1718 AD-70690
AACCACUGCCAGAAAGAGAdTdT 1351 UCUCUUUCUGGCAGUGGUUdTdT 1535
AACCACUGCCAGAAAGAGA 1719 AD-70691 CAGAAAGAGAAGUGCUUUAdTdT 1352
UAAAGCACUUCUCUUUCUGdTdT 1536 CAGAAAGAGAAGUGCUUUG 1720 AD-70692
UGCUUUGAGCCUCAGCUUAdTdT 1353 UAAGCUGAGGCUCAAAGCAdTdT 1537
UGCUUUGAGCCUCAGCUUC 1721 AD-70693 CAGCUUCUCCGGUUUUUCAdTdT 1354
UGAAAAACCGGAGAAGCUGdTdT 1538 CAGCUUCUCCGGUUUUUCC 1722 AD-70694
CGGUUUUUCCACAAGAAUAdTdT 1355 UAUUCUUGUGGAAAAACCGdTdT 1539
CGGUUUUUCCACAAGAAUG 1723 AD-70695 CAAGAAUGAGAUAUGGUAUdTdT 1356
AUACCAUAUCUCAUUCUUGdTdT 1540 CAAGAAUGAGAUAUGGUAU 1724 AD-70696
UAUGGUAUAGAACUGAGCAdTdT 1357 UGCUCAGUUCUAUACCAUAdTdT 1541
UAUGGUAUAGAACUGAGCA 1725 AD-70697 UGAGCAAGCAGCUGUGGCAdTdT 1358
UGCCACAGCUGCUUGCUCAdTdT 1542 UGAGCAAGCAGCUGUGGCC 1726 AD-70698
GCUGUGGCCAGAUGCCAGUdTdT 1359 ACUGGCAUCUGGCCACAGCdTdT 1543
GCUGUGGCCAGAUGCCAGU 1727 AD-70699 AUGCCAGUGCAAGGGUCCUdTdT 1360
AGGACCCUUGCACUGGCAUdTdT 1544 AUGCCAGUGCAAGGGUCCU 1728 AD-70700
AAGGGUCCUGAUGCCCACUdTdT 1361 AGUGGGCAUCAGGACCCUUdTdT 1545
AAGGGUCCUGAUGCCCACU 1729 AD-70701 UGCCCACUGCCAGCGGCUAdTdT 1362
UAGCCGCUGGCAGUGGGCAdTdT 1546 UGCCCACUGCCAGCGGCUG 1730 AD-70702
CGGCUGGCCAGCCAGGCCUdTdT 1363 AGGCCUGGCUGGCCAGCCGdTdT 1547
CGGCUGGCCAGCCAGGCCU 1731 AD-70703 AGCCAGGCCUGCCGCACCAdTdT 1364
UGGUGCGGCAGGCCUGGCUdTdT 1548 AGCCAGGCCUGCCGCACCA 1732 AD-70704
CGCACCAACCCGUGCCUCAdTdT 1365 UGAGGCACGGGUUGGUGCGdTdT 1549
CGCACCAACCCGUGCCUCC 1733 AD-70705 UGCCUCCAUGGGGGUCGCUdTdT 1366
AGCGACCCCCAUGGAGGCAdTdT 1550 UGCCUCCAUGGGGGUCGCU 1734 AD-70706
GGGGUCGCUGCCUAGAGGUdTdT 1367 ACCUCUAGGCAGCGACCCCdTdT 1551
GGGGUCGCUGCCUAGAGGU 1735 AD-70707 CUAGAGGUGGAGGGCCACAdTdT 1368
UGUGGCCCUCCACCUCUAGdTdT 1552 CUAGAGGUGGAGGGCCACC 1736 AD-70708
AGGGCCACCGCCUGUGCCAdTdT 1369 UGGCACAGGCGGUGGCCCUdTdT 1553
AGGGCCACCGCCUGUGCCA 1737 AD-70709 UGUGCCACUGCCCGGUGGAdTdT 1370
UCCACCGGGCAGUGGCACAdTdT 1554 UGUGCCACUGCCCGGUGGG 1738 AD-70710
CGGUGGGCUACACCGGAGAdTdT 1371 UCUCCGGUGUAGCCCACCGdTdT 1555
CGGUGGGCUACACCGGAGC 1739 AD-70711 ACCGGAGCCUUCUGCGACAdTdT 1372
UGUCGCAGAAGGCUCCGGUdTdT 1556 ACCGGAGCCUUCUGCGACG 1740 AD-70712
UUCUGCGACGUGGACACCAdTdT 1373 UGGUGUCCACGUCGCAGAAdTdT 1557
UUCUGCGACGUGGACACCA 1741 AD-70713 GACACCAAGGCAAGCUGCUdTdT 1374
AGCAGCUUGCCUUGGUGUCdTdT 1558 GACACCAAGGCAAGCUGCU 1742 AD-70714
CAAGCUGCUAUGAUGGCCAdTdT 1375 UGGCCAUCAUAGCAGCUUGdTdT 1559
CAAGCUGCUAUGAUGGCCG 1743 AD-70715 GAUGGCCGCGGGCUCAGCUdTdT 1376
AGCUGAGCCCGCGGCCAUCdTdT 1560 GAUGGCCGCGGGCUCAGCU 1744 AD-70716
UCAGCUACCGCGGCCUGGAdTdT 1377 UCCAGGCCGCGGUAGCUGAdTdT 1561
UCAGCUACCGCGGCCUGGC 1745 AD-70717 CGGCCUGGCCAGGACCACAdTdT 1378
UGUGGUCCUGGCCAGGCCGdTdT 1562 CGGCCUGGCCAGGACCACG 1746 AD-70718
AGGACCACGCUCUCGGGUAdTdT 1379 UACCCGAGAGCGUGGUCCUdTdT 1563
AGGACCACGCUCUCGGGUG 1747 AD-70719 UCGGGUGCGCCCUGUCAGAdTdT 1380
UCUGACAGGGCGCACCCGAdTdT 1564 UCGGGUGCGCCCUGUCAGC 1748 AD-70720
CUGUCAGCCGUGGGCCUCAdTdT 1381 UGAGGCCCACGGCUGACAGdTdT 1565
CUGUCAGCCGUGGGCCUCG 1749 AD-70721 UGGGCCUCGGAGGCCACCUdTdT 1382
AGGUGGCCUCCGAGGCCCAdTdT 1566 UGGGCCUCGGAGGCCACCU 1750 AD-70722
CCACCUACCGGAACGUGAAdTdT 1383 UUCACGUUCCGGUAGGUGGdTdT 1567
CCACCUACCGGAACGUGAC 1751 AD-70723 AACGUGACUGCCGAGCAAAdTdT 1384
UUUGCUCGGCAGUCACGUUdTdT 1568 AACGUGACUGCCGAGCAAG 1752 AD-70724
CGAGCAAGCGCGGAACUGAdTdT 1385 UCAGUUCCGCGCUUGCUCGdTdT 1569
CGAGCAAGCGCGGAACUGG 1753 AD-70725 CGGAACUGGGGACUGGGCAdTdT 1386
UGCCCAGUCCCCAGUUCCGdTdT 1570 CGGAACUGGGGACUGGGCG 1754 AD-70726
GACUGGGCGGCCACGCCUUdTdT 1387 AAGGCGUGGCCGCCCAGUCdTdT 1571
GACUGGGCGGCCACGCCUU 1755 AD-70727 ACGCCUUCUGCCGGAACCAdTdT 1388
UGGUUCCGGCAGAAGGCGUdTdT 1572 ACGCCUUCUGCCGGAACCC 1756 AD-70728
CGGAACCCGGACAACGACAdTdT 1389 UGUCGUUGUCCGGGUUCCGdTdT 1573
CGGAACCCGGACAACGACA 1757 AD-70729 AACGACAUCCGCCCGUGGUdTdT 1390
ACCACGGGCGGAUGUCGUUdTdT 1574 AACGACAUCCGCCCGUGGU 1758 AD-70730
GCCCGUGGUGCUUCGUGCUdTdT 1391 AGCACGAAGCACCACGGGCdTdT 1575
GCCCGUGGUGCUUCGUGCU 1759 AD-70731 UUCGUGCUGAACCGCGACAdTdT 1392
UGUCGCGGUUCAGCACGAAdTdT 1576 UUCGUGCUGAACCGCGACC 1760 AD-70732
ACCGCGACCGGCUGAGCUAdTdT 1393 UAGCUCAGCCGGUCGCGGUdTdT 1577
ACCGCGACCGGCUGAGCUG 1761 AD-70733 CUGAGCUGGGAGUACUGCAdTdT 1394
UGCAGUACUCCCAGCUCAGdTdT 1578 CUGAGCUGGGAGUACUGCG 1762
AD-70734 UACUGCGACCUGGCACAGUdTdT 1395 ACUGUGCCAGGUCGCAGUAdTdT 1579
UACUGCGACCUGGCACAGU 1763 AD-70735 UGGCACAGUGCCAGACCCAdTdT 1396
UGGGUCUGGCACUGUGCCAdTdT 1580 UGGCACAGUGCCAGACCCC 1764 AD-70736
AGACCCCAACCCAGGCGGAdTdT 1397 UCCGCCUGGGUUGGGGUCUdTdT 1581
AGACCCCAACCCAGGCGGC 1765 AD-70737 AGGCGGCGCCUCCGACCCAdTdT 1398
UGGGUCGGAGGCGCCGCCUdTdT 1582 AGGCGGCGCCUCCGACCCC 1766 AD-70738
UCCGACCCCGGUGUCCCCUdTdT 1399 AGGGGACACCGGGGUCGGAdTdT 1583
UCCGACCCCGGUGUCCCCU 1767 AD-70739 UGUCCCCUAGGCUUCAUGUdTdT 1400
ACAUGAAGCCUAGGGGACAdTdT 1584 UGUCCCCUAGGCUUCAUGU 1768 AD-70740
UUCAUGUCCCACUCAUGCAdTdT 1401 UGCAUGAGUGGGACAUGAAdTdT 1585
UUCAUGUCCCACUCAUGCC 1769 AD-70741 ACUCAUGCCCGCGCAGCCAdTdT 1402
UGGCUGCGCGGGCAUGAGUdTdT 1586 ACUCAUGCCCGCGCAGCCG 1770 AD-70742
CGCAGCCGGCACCGCCGAAdTdT 1403 UUCGGCGGUGCCGGCUGCGdTdT 1587
CGCAGCCGGCACCGCCGAA 1771 AD-70743 ACCGCCGAAGCCUCAGCCAdTdT 1404
UGGCUGAGGCUUCGGCGGUdTdT 1588 ACCGCCGAAGCCUCAGCCC 1772 AD-70744
UCAGCCCACGACCCGGACAdTdT 1405 UGUCCGGGUCGUGGGCUGAdTdT 1589
UCAGCCCACGACCCGGACC 1773 AD-70745 ACCCGGACCCCGCCUCAGUdTdT 1406
ACUGAGGCGGGGUCCGGGUdTdT 1590 ACCCGGACCCCGCCUCAGU 1774 AD-70562
CCUCAGUCCCAGACCCCGAdTdT 1407 UCGGGGUCUGGGACUGAGGdTdT 1591
CCUCAGUCCCAGACCCCGG 1775 AD-70563 AGACCCCGGGAGCCUUGCAdTdT 1408
UGCAAGGCUCCCGGGGUCUdTdT 1592 AGACCCCGGGAGCCUUGCC 1776 AD-70564
CCUUGCCGGCGAAGCGGGAdTdT 1409 UCCCGCUUCGCCGGCAAGGdTdT 1593
CCUUGCCGGCGAAGCGGGA 1777 AD-70565 AAGCGGGAGCAGCCGCCUUdTdT 1410
AAGGCGGCUGCUCCCGCUUdTdT 1594 AAGCGGGAGCAGCCGCCUU 1778 AD-70566
AGCCGCCUUCCCUGACCAAdTdT 1411 UUGGUCAGGGAAGGCGGCUdTdT 1595
AGCCGCCUUCCCUGACCAG 1779 AD-70567 UGACCAGGAACGGCCCACUdTdT 1412
AGUGGGCCGUUCCUGGUCAdTdT 1596 UGACCAGGAACGGCCCACU 1780 AD-70568
CGGCCCACUGAGCUGCGGAdTdT 1413 UCCGCAGCUCAGUGGGCCGdTdT 1597
CGGCCCACUGAGCUGCGGG 1781 AD-70569 UGCGGGCAGCGGCUCCGCAdTdT 1414
UGCGGAGCCGCUGCCCGCAdTdT 1598 UGCGGGCAGCGGCUCCGCA 1782 AD-70570
CGGCUCCGCAAGAGUCUGUdTdT 1415 ACAGACUCUUGCGGAGCCGdTdT 1599
CGGCUCCGCAAGAGUCUGU 1783 AD-70571 AGUCUGUCUUCGAUGACCAdTdT 1416
UGGUCAUCGAAGACAGACUdTdT 1600 AGUCUGUCUUCGAUGACCC 1784 AD-70572
CGAUGACCCGCGUCGUUGAdTdT 1417 UCAACGACGCGGGUCAUCGdTdT 1601
CGAUGACCCGCGUCGUUGG 1785 AD-70573 UCGUUGGCGGGCUGGUGGAdTdT 1418
UCCACCAGCCCGCCAACGAdTdT 1602 UCGUUGGCGGGCUGGUGGC 1786 AD-70574
UGGUGGCGCUACGCGGGGAdTdT 1419 UCCCCGCGUAGCGCCACCAdTdT 1603
UGGUGGCGCUACGCGGGGC 1787 AD-70575 UACGCGGGGCGCACCCCUAdTdT 1420
UAGGGGUGCGCCCCGCGUAdTdT 1604 UACGCGGGGCGCACCCCUA 1788 AD-70576
ACCCCUACAUCGCCGCGCUdTdT 1421 AGCGCGGCGAUGUAGGGGUdTdT 1605
ACCCCUACAUCGCCGCGCU 1789 AD-70577 GCCGCGCUGUACUGGGGCAdTdT 1422
UGCCCCAGUACAGCGCGGCdTdT 1606 GCCGCGCUGUACUGGGGCC 1790 AD-70578
CUGGGGCCACAGUUUCUGAdTdT 1423 UCAGAAACUGUGGCCCCAGdTdT 1607
CUGGGGCCACAGUUUCUGC 1791 AD-70579 UUUCUGCGCCGGCAGCCUAdTdT 1424
UAGGCUGCCGGCGCAGAAAdTdT 1608 UUUCUGCGCCGGCAGCCUC 1792 AD-70580
CGGCAGCCUCAUCGCCCCAdTdT 1425 UGGGGCGAUGAGGCUGCCGdTdT 1609
CGGCAGCCUCAUCGCCCCC 1793 AD-70581 UCGCCCCCUGCUGGGUGCUdTdT 1426
AGCACCCAGCAGGGGGCGAdTdT 1610 UCGCCCCCUGCUGGGUGCU 1794 AD-70582
UGGGUGCUGACGGCCGCUAdTdT 1427 UAGCGGCCGUCAGCACCCAdTdT 1611
UGGGUGCUGACGGCCGCUC 1795 AD-70583 GCCGCUCACUGCCUGCAGAdTdT 1428
UCUGCAGGCAGUGAGCGGCdTdT 1612 GCCGCUCACUGCCUGCAGG 1796 AD-70584
CUGCAGGACCGGCCCGCAAdTdT 1429 UUGCGGGCCGGUCCUGCAGdTdT 1613
CUGCAGGACCGGCCCGCAC 1797 AD-70585 GGCCCGCACCCGAGGAUCUdTdT 1430
AGAUCCUCGGGUGCGGGCCdTdT 1614 GGCCCGCACCCGAGGAUCU 1798 AD-70586
CGAGGAUCUGACGGUGGUAdTdT 1431 UACCACCGUCAGAUCCUCGdTdT 1615
CGAGGAUCUGACGGUGGUG 1799 AD-70587 GUGGUGCUCGGCCAGGAAAdTdT 1432
UUUCCUGGCCGAGCACCACdTdT 1616 GUGGUGCUCGGCCAGGAAC 1800 AD-70588
GCCAGGAACGCCGUAACCAdTdT 1433 UGGUUACGGCGUUCCUGGCdTdT 1617
GCCAGGAACGCCGUAACCA 1801 AD-70589 CGUAACCACAGCUGUGAGAdTdT 1434
UCUCACAGCUGUGGUUACGdTdT 1618 CGUAACCACAGCUGUGAGC 1802 AD-70590
UGUGAGCCGUGCCAGACGUdTdT 1435 ACGUCUGGCACGGCUCACAdTdT 1619
UGUGAGCCGUGCCAGACGU 1803 AD-70591 UGCCAGACGUUGGCCGUGAdTdT 1436
UCACGGCCAACGUCUGGCAdTdT 1620 UGCCAGACGUUGGCCGUGC 1804 AD-70592
GCCGUGCGCUCCUACCGCUdTdT 1437 AGCGGUAGGAGCGCACGGCdTdT 1621
GCCGUGCGCUCCUACCGCU 1805 AD-70593 UACCGCUUGCACGAGGCCUdTdT 1438
AGGCCUCGUGCAAGCGGUAdTdT 1622 UACCGCUUGCACGAGGCCU 1806 AD-70594
ACGAGGCCUUCUCGCCCGUdTdT 1439 ACGGGCGAGAAGGCCUCGUdTdT 1623
ACGAGGCCUUCUCGCCCGU 1807 AD-70595 UCGCCCGUCAGCUACCAGAdTdT 1440
UCUGGUAGCUGACGGGCGAdTdT 1624 UCGCCCGUCAGCUACCAGC 1808 AD-70596
CUACCAGCACGACCUGGCUdTdT 1441 AGCCAGGUCGUGCUGGUAGdTdT 1625
CUACCAGCACGACCUGGCU 1809 AD-70597 ACCUGGCUCUGUUGCGCCUdTdT 1442
AGGCGCAACAGAGCCAGGUdTdT 1626 ACCUGGCUCUGUUGCGCCU 1810 AD-70598
UUGCGCCUUCAGGAGGAUAdTdT 1443 UAUCCUCCUGAAGGCGCAAdTdT 1627
UUGCGCCUUCAGGAGGAUG 1811 AD-70599 GAGGAUGCGGACGGCAGCUdTdT 1444
AGCUGCCGUCCGCAUCCUCdTdT 1628 GAGGAUGCGGACGGCAGCU 1812 AD-70600
ACGGCAGCUGCGCGCUCCUdTdT 1445 AGGAGCGCGCAGCUGCCGUdTdT 1629
ACGGCAGCUGCGCGCUCCU 1813 AD-70601 CGCUCCUGUCGCCUUACGUdTdT 1446
ACGUAAGGCGACAGGAGCGdTdT 1630 CGCUCCUGUCGCCUUACGU 1814 AD-70602
CCUUACGUUCAGCCGGUGUdTdT 1447 ACACCGGCUGAACGUAAGGdTdT 1631
CCUUACGUUCAGCCGGUGU 1815 AD-70603 AGCCGGUGUGCCUGCCAAAdTdT 1448
UUUGGCAGGCACACCGGCUdTdT 1632 AGCCGGUGUGCCUGCCAAG 1816 AD-70604
UGCCAAGCGGCGCCGCGCAdTdT 1449 UGCGCGGCGCCGCUUGGCAdTdT 1633
UGCCAAGCGGCGCCGCGCG 1817 AD-70605 GCGCCGCGCGACCCUCCGAdTdT 1450
UCGGAGGGUCGCGCGGCGCdTdT 1634 GCGCCGCGCGACCCUCCGA 1818 AD-70606
CCCUCCGAGACCACGCUCUdTdT 1451 AGAGCGUGGUCUCGGAGGGdTdT 1635
CCCUCCGAGACCACGCUCU 1819 AD-70607 CGCUCUGCCAGGUGGCCGAdTdT 1452
UCGGCCACCUGGCAGAGCGdTdT 1636 CGCUCUGCCAGGUGGCCGG 1820 AD-70608
AGGUGGCCGGCUGGGGCCAdTdT 1453 UGGCCCCAGCCGGCCACCUdTdT 1637
AGGUGGCCGGCUGGGGCCA 1821 AD-70609 UGGGGCCACCAGUUCGAGAdTdT 1454
UCUCGAACUGGUGGCCCCAdTdT 1638 UGGGGCCACCAGUUCGAGG 1822 AD-70610
UUCGAGGGGGCGGAGGAAUdTdT 1455 AUUCCUCCGCCCCCUCGAAdTdT 1639
UUCGAGGGGGCGGAGGAAU 1823 AD-70611 CGGAGGAAUAUGCCAGCUUdTdT 1456
AAGCUGGCAUAUUCCUCCGdTdT 1640 CGGAGGAAUAUGCCAGCUU 1824 AD-70612
CAGCUUCCUGCAGGAGGCAdTdT 1457 UGCCUCCUGCAGGAAGCUGdTdT 1641
CAGCUUCCUGCAGGAGGCG 1825 AD-70613 AGGAGGCGCAGGUACCGUUdTdT 1458
AACGGUACCUGCGCCUCCUdTdT 1642 AGGAGGCGCAGGUACCGUU 1826 AD-70614
AGGUACCGUUCCUCUCCCUdTdT 1459 AGGGAGAGGAACGGUACCUdTdT 1643
AGGUACCGUUCCUCUCCCU 1827 AD-70615 CUCUCCCUGGAGCGCUGCUdTdT 1460
AGCAGCGCUCCAGGGAGAGdTdT 1644 CUCUCCCUGGAGCGCUGCU 1828 AD-70616
CGCUGCUCAGCCCCGGACAdTdT 1461 UGUCCGGGGCUGAGCAGCGdTdT 1645
CGCUGCUCAGCCCCGGACG 1829 AD-70617 CCGGACGUGCACGGAUCCUdTdT 1462
AGGAUCCGUGCACGUCCGGdTdT 1646 CCGGACGUGCACGGAUCCU 1830 AD-70618
CGGAUCCUCCAUCCUCCCAdTdT 1463 UGGGAGGAUGGAGGAUCCGdTdT 1647
CGGAUCCUCCAUCCUCCCC 1831 AD-70619 CAUCCUCCCCGGCAUGCUAdTdT 1464
UAGCAUGCCGGGGAGGAUGdTdT 1648 CAUCCUCCCCGGCAUGCUC 1832 AD-70620
CAUGCUCUGCGCAGGGUUAdTdT 1465 UAACCCUGCGCAGAGCAUGdTdT 1649
CAUGCUCUGCGCAGGGUUC 1833 AD-70621 AGGGUUCCUCGAGGGCGGAdTdT 1466
UCCGCCCUCGAGGAACCCUdTdT 1650 AGGGUUCCUCGAGGGCGGC 1834 AD-70622
GAGGGCGGCACCGAUGCGUdTdT 1467 ACGCAUCGGUGCCGCCCUCdTdT 1651
GAGGGCGGCACCGAUGCGU 1835 AD-70623 GAUGCGUGCCAGGGUGAUUdTdT 1468
AAUCACCCUGGCACGCAUCdTdT 1652 GAUGCGUGCCAGGGUGAUU 1836 AD-70624
AGGGUGAUUCCGGAGGCCAdTdT 1469 UGGCCUCCGGAAUCACCCUdTdT 1653
AGGGUGAUUCCGGAGGCCC 1837 AD-70625 CGGAGGCCCGCUGGUGUGUdTdT 1470
ACACACCAGCGGGCCUCCGdTdT 1654 CGGAGGCCCGCUGGUGUGU 1838 AD-70626
GGUGUGUGAGGACCAAGCUdTdT 1471 AGCUUGGUCCUCACACACCdTdT 1655
GGUGUGUGAGGACCAAGCU 1839 AD-70627 CCAAGCUGCAGAGCGCCGAdTdT 1472
UCGGCGCUCUGCAGCUUGGdTdT 1656 CCAAGCUGCAGAGCGCCGG 1840 AD-70628
AGAGCGCCGGCUCACCCUAdTdT 1473 UAGGGUGAGCCGGCGCUCUdTdT 1657
AGAGCGCCGGCUCACCCUG 1841 AD-70629 UCACCCUGCAAGGCAUCAUdTdT 1474
AUGAUGCCUUGCAGGGUGAdTdT 1658 UCACCCUGCAAGGCAUCAU 1842 AD-70630
GGCAUCAUCAGCUGGGGAUdTdT 1475 AUCCCCAGCUGAUGAUGCCdTdT 1659
GGCAUCAUCAGCUGGGGAU 1843 AD-70631 CUGGGGAUCGGGCUGUGGUdTdT 1476
ACCACAGCCCGAUCCCCAGdTdT 1660 CUGGGGAUCGGGCUGUGGU 1844 AD-70632
UGUGGUGACCGCAACAAGAdTdT 1477 UCUUGUUGCGGUCACCACAdTdT 1661
UGUGGUGACCGCAACAAGC 1845 AD-70633 CAACAAGCCAGGCGUCUAAdTdT 1478
UUAGACGCCUGGCUUGUUGdTdT 1662 CAACAAGCCAGGCGUCUAC 1846
AD-70634 AGGCGUCUACACCGAUGUAdTdT 1479 UACAUCGGUGUAGACGCCUdTdT 1663
AGGCGUCUACACCGAUGUG 1847 AD-70635 GAUGUGGCCUACUACCUGAdTdT 1480
UCAGGUAGUAGGCCACAUCdTdT 1664 GAUGUGGCCUACUACCUGG 1848 AD-70636
UACUACCUGGCCUGGAUCAdTdT 1481 UGAUCCAGGCCAGGUAGUAdTdT 1665
UACUACCUGGCCUGGAUCC 1849 AD-70637 CUGGAUCCGGGAGCACACAdTdT 1482
UGUGUGCUCCCGGAUCCAGdTdT 1666 CUGGAUCCGGGAGCACACC 1850 AD-70638
AGCACACCGUUUCCUGAUUdTdT 1483 AAUCAGGAAACGGUGUGCUdTdT 1667
AGCACACCGUUUCCUGAUU 1851 AD-70639 UCCUGAUUGCUCAGGGACUdTdT 1484
AGUCCCUGAGCAAUCAGGAdTdT 1668 UCCUGAUUGCUCAGGGACU 1852 AD-70640
CAGGGACUCAUCUUUCCCUdTdT 1485 AGGGAAAGAUGAGUCCCUGdTdT 1669
CAGGGACUCAUCUUUCCCU 1853 AD-70641 UUUCCCUCCUUGGUGAUUAdTdT 1486
UAAUCACCAAGGAGGGAAAdTdT 1670 UUUCCCUCCUUGGUGAUUC 1854 AD-70642
UGGUGAUUCCGCAGUGAGAdTdT 1487 UCUCACUGCGGAAUCACCAdTdT 1671
UGGUGAUUCCGCAGUGAGA 1855 AD-70643 AGUGAGAGAGUGGCUGGGAdTdT 1488
UCCCAGCCACUCUCUCACUdTdT 1672 AGUGAGAGAGUGGCUGGGG 1856 AD-70644
GCUGGGGCAUGGAAGGCAAdTdT 1489 UUGCCUUCCAUGCCCCAGCdTdT 1673
GCUGGGGCAUGGAAGGCAA 1857 AD-70645 UGGAAGGCAAGAUUGUGUAdTdT 1490
UACACAAUCUUGCCUUCCAdTdT 1674 UGGAAGGCAAGAUUGUGUC 1858 AD-70646
UUGUGUCCCAUUCCCCCAAdTdT 1491 UUGGGGGAAUGGGACACAAdTdT 1675
UUGUGUCCCAUUCCCCCAG 1859 AD-70647 UCCCCCAGUGCGGCCAGCUdTdT 1492
AGCUGGCCGCACUGGGGGAdTdT 1676 UCCCCCAGUGCGGCCAGCU 1860 AD-70648
GCCAGCUCCGCGCCAGGAUdTdT 1493 AUCCUGGCGCGGAGCUGGCdTdT 1677
GCCAGCUCCGCGCCAGGAU 1861 AD-70649 GCCAGGAUGGCGCAGGAAAdTdT 1494
UUUCCUGCGCCAUCCUGGCdTdT 1678 GCCAGGAUGGCGCAGGAAC 1862 AD-70650
GCAGGAACUCAAUAAAGUAdTdT 1495 UACUUUAUUGAGUUCCUGCdTdT 1679
GCAGGAACUCAAUAAAGUG 1863 AD-70651 AAUAAAGUGCUUUGAAAAUdTdT 1496
AUUUUCAAAGCACUUUAUUdTdT 1680 AAUAAAGUGCUUUGAAAAU 1864 AD-70652
UUGAAAAUGCUGAGAAAAAdTdT 1497 UUUUUCUCAGCAUUUUCAAdTdT 1681
UUGAAAAUGCUGAGAAAAA 1865
TABLE-US-00029 TABLE 22 F12 Single Dose Screen in Hep3b Cells
Duplex Name AVG STDEV AD-70653 75.05 21.99 AD-70654 59.86 17.07
AD-70655 49.58 5.13 AD-70656 42.85 9.76 AD-70657 40.2 6.21 AD-70658
52.43 13.02 AD-70659 34.67 3.33 AD-70660 33.59 8.28 AD-70661 53.13
11.32 AD-70662 61.89 7.76 AD-70663 48.43 6.92 AD-70664 34.42 4.01
AD-70665 33.22 4.21 AD-70666 33.44 5.89 AD-70667 47.6 10.96
AD-70668 125.01 38.32 AD-70669 64.78 12.71 AD-70670 57.49 5.4
AD-70671 30.06 7.8 AD-70672 54.95 2.39 AD-70673 79.79 10.29
AD-70674 88.3 12.07 AD-70675 55.83 14.88 AD-70676 61.99 12.96
AD-70677 50.27 9.84 AD-70678 65.84 10.37 AD-70679 51.1 8.97
AD-70680 64.71 10.54 AD-70681 41.02 6.75 AD-70682 60.65 9.01
AD-70683 96.74 6.29 AD-70684 71.16 13.22 AD-70685 99.97 12.48
AD-70686 45.51 6.21 AD-70687 68.37 5.36 AD-70688 65.68 6.4 AD-70689
63.41 5.72 AD-70690 54.1 7.23 AD-70691 43.79 11.91 AD-70692 51.36
8.64 AD-70693 43.25 7.81 AD-70694 51.13 4.52 AD-70695 47.38 4.76
AD-70696 63.08 3.96 AD-70697 49.53 6.44 AD-70698 56.12 8.22
AD-70699 53.68 4.62 AD-70700 68.45 12.64 AD-70701 94.45 11.32
AD-70702 70.82 8.36 AD-70703 93.79 7.87 AD-70704 35.84 4.09
AD-70705 87.79 5.74 AD-70706 59.21 9.08 AD-70707 64.22 10.1
AD-70708 49.55 3 AD-70709 87.37 7.17 AD-70710 76.54 11.55 AD-70711
62.4 4.69 AD-70712 80.45 8.12 AD-70713 76.68 16.28 AD-70714 61.92
15.07 AD-70715 85.76 8.24 AD-70716 97.67 8.1 AD-70717 70.83 2.72
AD-70718 50.19 9.69 AD-70719 77.23 4.82 AD-70720 69.02 6.52
AD-70721 84.91 12.03 AD-70722 42.64 6.44 AD-70723 56.77 6.73
AD-70724 50.28 7.37 AD-70725 73.06 14.77 AD-70726 69.29 8.43
AD-70727 68.98 5.88 AD-70728 59.51 5.26 AD-70729 77.31 11.18
AD-70730 48.22 9.04 AD-70731 63.52 3.78 AD-70732 60.89 6.26
AD-70733 55.56 13.83 AD-70734 110.37 7.09 AD-70735 70.96 1.41
AD-70736 72.71 4.28 AD-70737 66.94 4.75 AD-70738 104.61 9.8
AD-70739 87.48 8.44 AD-70740 69.08 9.31 AD-70741 67.82 3.49
AD-70742 92.93 14.66 AD-70743 59.32 9.95 AD-70744 81.97 6.05
AD-70745 54.96 7.81 AD-70562 46.21 8.44 AD-70563 44.88 5.69
AD-70564 67.82 20.32 AD-70565 52.32 12.39 AD-70566 53.22 10.43
AD-70567 46.28 10.21 AD-70568 41.84 3.91 AD-70569 46.27 10.51
AD-70570 37.31 7.6 AD-70571 55.84 13.93 AD-70572 64.38 6.03
AD-70573 75.03 17.72 AD-70574 61.2 7.6 AD-70575 55.54 18.99
AD-70576 48.67 7.52 AD-70577 34.12 10.23 AD-70578 56.62 6.22
AD-70579 58.22 17.32 AD-70580 64.99 8.66 AD-70581 86.55 15.76
AD-70582 72.76 11.98 AD-70583 47.99 20.51 AD-70584 54 14.12
AD-70585 43.72 6.69 AD-70586 55.96 12.05 AD-70587 64.82 18.43
AD-70588 66.06 13.08 AD-70589 56.65 10.27 AD-70590 77.82 4.75
AD-70591 68.65 9.93 AD-70592 37.1 9.84 AD-70593 50.14 17.24
AD-70594 50.16 13.61 AD-70595 60.63 13.54 AD-70596 80.78 12.29
AD-70597 60.74 21.94 AD-70598 70.51 8.48 AD-70599 67.75 7.59
AD-70600 68.09 31.51 AD-70601 53.28 21.16 AD-70602 44.03 10.56
AD-70603 87.08 40.51 AD-70604 69.39 9.62 AD-70605 86.92 27.74
AD-70606 62.19 7.28 AD-70607 67.55 19.57 AD-70608 98.46 10.23
AD-70609 77.67 10.72 AD-70610 108.45 21.97 AD-70611 73.02 19.12
AD-70612 97.49 26.26 AD-70613 65.22 19.24 AD-70614 96.69 21.51
AD-70615 76.53 7.96 AD-70616 69.73 12.06 AD-70617 58.38 10.85
AD-70618 73.89 22.5 AD-70619 85.32 25.92 AD-70620 72.03 33.04
AD-70621 83.22 24.59 AD-70622 108.98 14.93 AD-70623 71.28 32.49
AD-70624 67.8 25.27 AD-70625 52.08 10.91 AD-70626 40.94 13.75
AD-70627 33.55 3.35 AD-70628 52.37 10.46 AD-70629 53.46 4.07
AD-70630 47 8.42 AD-70631 64.51 42.23 AD-70632 30.66 4.32 AD-70633
33.64 12.21 AD-70634 65.42 6.92 AD-70635 45.84 6.76 AD-70636 47.83
6.63 AD-70637 64.39 8.42 AD-70638 38.91 8.35 AD-70639 40.87 7.79
AD-70640 50.87 13.34 AD-70641 49.64 5.85 AD-70642 44.04 8.02
AD-70643 61.04 11.12 AD-70644 50.03 9.07 AD-70645 67.35 28.98
AD-70646 50.93 6 AD-70647 83.29 5.96 AD-70648 53.57 15.44 AD-70649
46.35 8.99 AD-70650 52.06 7.83 AD-70651 64.65 9.04 AD-70652 100.8
9.21
Example 11
In Vivo F12 Silencing in Mustard Oil-Induced Vascular Permeability
Mouse Model
[0680] As discussed above and demonstrated in FIGS. 2 and 5,
AD-67244 was the most efficacious agent targeting an F12 gene that
was tested, resulting in robust, dose-dependent reduction of F12
mRNA and plasma F12 protein in wild-type mice, and normalization of
vascular permeability in a bradykinin-induced vascular leakage
mouse model of HAE (the ACE-inhibitor-induced mouse model).
[0681] The in vivo efficacy of AD-67244 was also assessed in a
second mouse model of HAE. In particular, the ability of AD-67244
to rescue mustard oil-induced vascular permeability in C1-INH
deficient mice was determined by subcutaneously administering CD-1
female mice (n=10/group) a single 3 mg/kg, 0.5 mg/kg, or 0.1 mg/kg
dose of AD-67244 in combination with a single10 mg/kg dose of a
double stranded RNA agent targeting C1-INH at day -7 . On Day 0,
Evans Blue dye (30 mg/kg) was injected into the tail vein of the
animals and a 5% solution of mustard oil was topically applied to
the right ear of each animal (the left ear was left untreated and
served as a control). Thirty minutes later, the animals were
sacrificed, each ear was collected for dye extravasation to
determine vascular permeability, and livers were collected for F12
and C1-INH mRNA measurements.
[0682] As shown in FIG. 10A, administration of a single 3 mg/kg,
0.5 mg/kg, or 0.1 mg/kg dose of AD-67244 normalized vascular
permeability in these mice and, as shown in FIG. 10B, this
administration resulted in robust, dose-dependent reduction of F12
mRNA in the livers of these animals. The level of C1-INH in the
livers of these animals was less than 0.01% of the level of C1-INH
in the livers of the control group administered. These data
demonstrate that AD-67244 can mitigate excess bradykinin
stimulation.
Example 12
In Vivo F12 Silencing in Non-Human Primates
[0683] To determine the efficacy of AD-67244 in non-human primates,
female Cynomolgus monkeys (n=3 per group) were subcutaneously
administered a single 3 mg/kg, 1 mg/kg, 0.3 mg/kg, or 0.1 mg/kg
dose of AD-67244. The level of Cynomolgus F12 plasma protein levels
was measured by ELISA at days -5, -3, -1, 3, 7, 10, 14, 21, 28, 35,
42, 49, 56, 63, 70, 77, 84, 91, 98, 112, 126, and 140 post-dose.
FIG. 11 demonstrates that administration of a single 0.3 mg/kg dose
of AD-67244 resulted in greater than 85% reduction in F12 protein.
FIG. 11 also demonstrates that this reduction in F12 protein was
durable with greater than 70% and 50% reduction at 2 and 3 months
post-dose, respectively.
Example 13
Effect of 5' Modification of AD-67244 on Potency in Mice
[0684] The effect of modifying the 5' antisense phosphate of
AD-67244 with a vinylphosphate (VP) on the potency of the agent was
determined in mice. Wild-type mice (n=3/group) were administered a
single 0.5 mg/kg dose of either AD-67244 (sense:
5'-asascucaAfuAfAfAfgugcuuugaa-3' (SEQ ID NO: 1866); antisense:
5'-usUfscaaAfgCfAfcuuuAfuUfgaguususc-3' (SEQ ID NO: 1867); ALN-F12)
or AD-74841 (sense: 5'-asascucaAfuAfAfAfgugcuuugaa-3' (SEQ ID NO:
1868); antisense: 5'-VP-usUfscaaAfgCfAfcuuuAfuUfgaguususc-3' (SEQ
ID NO: 1869); ALN-F12-VP). The plasma level of F12 protein was
determined by ELISA at days 0, 3, 7, 15, and 21 post-dose. FIG. 12
demonstrates that 5' modification of the antisense phosphate group
with a vinylphosphate moderately increased the potency of
AD-67244.
Example 14
Synthesis and In vitro Screening of F12 siRNA Duplexes
[0685] Additional iRNA agents targeting F12, e.g., targeting about
nucleotides 2000-2060 of SEQ ID NO:9, were designed, synsthesized,
and screened for in vitro efficacy, as described above. A detailed
list of the additional unmodified F12 sense and antisense strand
sequences is shown in Table 23. A detailed list of the additional
modified F12 sense and antisense strand sequences is shown in Table
24. Table 25 provides the results of a single dose screen in Hep3b
cells transfected with the indicated additional F12 iRNAs. Data are
expressed as percent of mRNA remaining relative to AD-1955.
TABLE-US-00030 TABLE 23 F12 Unmodified Sequences Sense SEQ Range in
Antisense SEQ Range in Duplex Name Sequence 5' to 3' ID NO SEQ ID
NO: 9 Sequence 5' to 3' ID NO SEQ ID NO: 9 AD-70649.2
GCCAGGAUGGCGCAGGAAA 1870 2004-2022 UUUCCUGCGCCAUCCUGGC 1908
2004-2022 AD-75921.1 CCAGGAUGGCGCAGGAACU 1871 2005-2023
AGUUCCUGCGCCAUCCUGG 1909 2005-2023 AD-75920.1 CAGGAUGGCGCAGGAACUA
1872 2006-2024 UAGUUCCUGCGCCAUCCUG 1910 2006-2024 AD-75919.1
AGGAUGGCGCAGGAACUCA 1873 2007-2025 UGAGUUCCUGCGCCAUCCU 1911
2007-2025 AD-75918.1 GGAUGGCGCAGGAACUCAA 1874 2008-2026
UUGAGUUCCUGCGCCAUCC 1912 2008-2026 AD-75917.1 GAUGGCGCAGGAACUCAAU
1875 2009-2027 AUUGAGUUCCUGCGCCAUC 1913 2009-2027 AD-75916.1
AUGGCGCAGGAACUCAAUA 1876 2010-2028 UAUUGAGUUCCUGCGCCAU 1914
2010-2028 AD-75915.1 UGGCGCAGGAACUCAAUAA 1877 2011-2029
UUAUUGAGUUCCUGCGCCA 1915 2011-2029 AD-75914.1 GGCGCAGGAACUCAAUAAA
1878 2012-2030 UUUAUUGAGUUCCUGCGCC 1916 2012-2030 AD-75913.1
GCGCAGGAACUCAAUAAAA 1879 2013-2031 UUUUAUUGAGUUCCUGCGC 1917
2013-2031 AD-75912.1 CGCAGGAACUCAAUAAAGU 1880 2014-2032
ACUUUAUUGAGUUCCUGCG 1918 2014-2032 AD-70650.2 GCAGGAACUCAAUAAAGUA
1881 2015-2033 UACUUUAUUGAGUUCCUGC 1919 2015-2033 AD-75911.1
CAGGAACUCAAUAAAGUGA 1882 2016-2034 UCACUUUAUUGAGUUCCUG 1920
2016-2034 AD-75910.1 AGGAACUCAAUAAAGUGCU 1883 2017-2035
AGCACUUUAUUGAGUUCCU 1921 2017-2035 AD-75909.1 GGAACUCAAUAAAGUGCUU
1884 2018-2036 AAGCACUUUAUUGAGUUCC 1922 2018-2036 AD-75908.1
GAACUCAAUAAAGUGCUUU 1885 2019-2037 AAAGCACUUUAUUGAGUUC 1923
2019-2037 AD-75907.1 AACUCAAUAAAGUGCUUUA 1886 2020-2038
UAAAGCACUUUAUUGAGUU 1924 2020-2038 AD-75906.1 ACUCAAUAAAGUGCUUUGA
1887 2021-2039 UCAAAGCACUUUAUUGAGU 1925 2021-2039 AD-75922.1
UCAAUAAAGUGCUUUGAAA 1888 2023-2041 UUUCAAAGCACUUUAUUGA 1926
2023-2041 AD-75923.1 CAAUAAAGUGCUUUGAAAA 1889 2024-2042
UUUUCAAAGCACUUUAUUG 1927 2024-2042 AD-70651.2 AAUAAAGUGCUUUGAAAAU
1890 2025-2043 AUUUUCAAAGCACUUUAUU 1928 2025-2043 AD-75924.1
AUAAAGUGCUUUGAAAAUA 1891 2026-2044 UAUUUUCAAAGCACUUUAU 1929
2026-2044 AD-75925.1 UAAAGUGCUUUGAAAAUGA 1892 2027-2045
UCAUUUUCAAAGCACUUUA 1930 2027-2045 AD-75926.1 AAAGUGCUUUGAAAAUGCU
1893 2028-2046 AGCAUUUUCAAAGCACUUU 1931 2028-2046 AD-75927.1
AAGUGCUUUGAAAAUGCUA 1894 2029-2047 UAGCAUUUUCAAAGCACUU 1932
2029-2047 AD-75928.1 AGUGCUUUGAAAAUGCUGA 1895 2030-2048
UCAGCAUUUUCAAAGCACU 1933 2030-2048 AD-75929.1 GUGCUUUGAAAAUGCUGAA
1896 2031-2049 UUCAGCAUUUUCAAAGCAC 1934 2031-2049 AD-75930.1
UGCUUUGAAAAUGCUGAGA 1897 2032-2050 UCUCAGCAUUUUCAAAGCA 1935
2032-2050 AD-75931.1 GCUUUGAAAAUGCUGAGAA 1898 2033-2051
UUCUCAGCAUUUUCAAAGC 1936 2033-2051 AD-75932.1 CUUUGAAAAUGCUGAGAAA
1899 2034-2052 UUUCUCAGCAUUUUCAAAG 1937 2034-2052 AD-75933.1
UUUGAAAAUGCUGAGAAAA 1900 2035-2053 UUUUCUCAGCAUUUUCAAA 1938
2035-2053 AD-70652.2 UUGAAAAUGCUGAGAAAAA 1901 2036-2054
UUUUUCUCAGCAUUUUCAA 1939 2036-2054 AD-75934.1 UGAAAAUGCUGAGAAAAAA
1902 2037-2055 UUUUUUCUCAGCAUUUUCA 1940 2037-2055 AD-75935.1
GAAAAUGCUGAGAAAAAAA 1903 2038-2056 UUUUUUUCUCAGCAUUUUC 1941
2038-2056 AD-75936.1 AAAAUGCUGAGAAAAAAAA 1904 2039-2057
UUUUUUUUCUCAGCAUUUU 1942 2039-2057 AD-75937.1 AAAUGCUGAGAAAAAAAAA
1905 2040-2058 UUUUUUUUUCUCAGCAUUU 1943 2040-2058 AD-75938.1
AAUGCUGAGAAAAAAAAAA 1906 2041-2059 UUUUUUUUUUCUCAGCAUU 1944
2041-2059 AD-75939.1 AUGCUGAGAAAAAAAAAAA 1907 2042-2060
UUUUUUUUUUUCUCAGCAU 1945 2042-2060
TABLE-US-00031 TABLE 24 F12 Modified Sequences mRNA target Duplex
Sense SEQ Antisense SEQ mRNA target SEQ site in Name Sequence 5' to
3' ID NO Sequence 5' to 3' ID NO sequence 5' to 3' ID NO SEQ ID NO:
9 AD- GCCAGGAUGGCGCAGGAAA 1946 UUUCCUGCGCCAUCCUGGC 1984
GCCAGGAUGGCGCAGGA 2022 2004-2022 70649 dTdT dTdT AC AD-
CCAGGAUGGCGCAGGAACU 1947 AGUUCCUGCGCCAUCCUGG 1985 CCAGGAUGGCGCAGGAA
2023 2005-2023 75921 dTdT dTdT CU AD- CAGGAUGGCGCAGGAACUA 1948
UAGUUCCUGCGCCAUCCUG 1986 CAGGAUGGCGCAGGAAC 2024 2006-2024 75920
dTdT dTdT UC AD- AGGAUGGCGCAGGAACUCA 1949 UGAGUUCCUGCGCCAUCCU 1987
AGGAUGGCGCAGGAACU 2025 2007-2025 75919 dTdT dTdT CA AD-
GGAUGGCGCAGGAACUCAA 1950 UUGAGUUCCUGCGCCAUCC 1988 GGAUGGCGCAGGAACUC
2026 2008-2026 75918 dTdT dTdT AA AD- GAUGGCGCAGGAACUCAAU 1951
AUUGAGUUCCUGCGCCAUC 1989 GAUGGCGCAGGAACUCA 2027 2009-2027 75917
dTdT dTdT AU AD- AUGGCGCAGGAACUCAAUA 1952 UAUUGAGUUCCUGCGCCAU 1990
AUGGCGCAGGAACUCAA 2028 2010-2028 75916 dTdT dTdT UA AD-
UGGCGCAGGAACUCAAUAA 1953 UUAUUGAGUUCCUGCGCCA 1991 UGGCGCAGGAACUCAAU
2029 2011-2029 75915 dTdT dTdT AA AD- GGCGCAGGAACUCAAUAAA 1954
UUUAUUGAGUUCCUGCGCC 1992 GGCGCAGGAACUCAAUA 2030 2012-2030 75914
dTdT dTdT AA AD- GCGCAGGAACUCAAUAAAA 1955 UUUUAUUGAGUUCCUGCGC 1993
GCGCAGGAACUCAAUAA 2031 2013-2031 75913 dTdT dTdT AG AD-
CGCAGGAACUCAAUAAAGU 1956 ACUUUAUUGAGUUCCUGCG 1994 CGCAGGAACUCAAUAAA
2032 2014-2032 75912 dTdT dTdT GU AD- GCAGGAACUCAAUAAAGUA 1957
UACUUUAUUGAGUUCCUGC 1995 GCAGGAACUCAAUAAAG 2033 2015-2033 70650
dTdT dTdT UG AD- CAGGAACUCAAUAAAGUGA 1958 UCACUUUAUUGAGUUCCUG 1996
CAGGAACUCAAUAAAGU 2034 2016-2034 75911 dTdT dTdT GC AD-
AGGAACUCAAUAAAGUGCU 1959 AGCACUUUAUUGAGUUCCU 1997 AGGAACUCAAUAAAGUG
2035 2017-2035 75910 dTdT dTdT CU AD- GGAACUCAAUAAAGUGCUU 1960
AAGCACUUUAUUGAGUUCC 1998 GGAACUCAAUAAAGUGC 2036 2018-2036 75909
dTdT dTdT UU AD- GAACUCAAUAAAGUGCUUU 1961 AAAGCACUUUAUUGAGUUC 1999
GAACUCAAUAAAGUGCU 2037 2019-2037 75908 dTdT dTdT UU AD-
AACUCAAUAAAGUGCUUUA 1962 UAAAGCACUUUAUUGAGUU 2000 AACUCAAUAAAGUGCUU
2038 2020-2038 75907 dTdT dTdT UG AD- ACUCAAUAAAGUGCUUUGA 1963
UCAAAGCACUUUAUUGAGU 2001 ACUCAAUAAAGUGCUUU 2039 2021-2039 75906
dTdT dTdT GA AD- UCAAUAAAGUGCUUUGAAA 1964 UUUCAAAGCACUUUAUUGA 2002
UCAAUAAAGUGCUUUGA 2040 2023-2041 75922 dTdT dTdT AA AD-
CAAUAAAGUGCUUUGAAAA 1965 UUUUCAAAGCACUUUAUUG 2003 CAAUAAAGUGCUUUGAA
2041 2024-2042 75923 dTdT dTdT AA AD- AAUAAAGUGCUUUGAAAAU 1966
AUUUUCAAAGCACUUUAUU 2004 AAUAAAGUGCUUUGAAA 2042 2025-2043 70651
dTdT dTdT AU AD- AUAAAGUGCUUUGAAAAUA 1967 UAUUUUCAAAGCACUUUAU 2005
AUAAAGUGCUUUGAAAA 2043 2026-2044 75924 dTdT dTdT UG AD-
UAAAGUGCUUUGAAAAUGA 1968 UCAUUUUCAAAGCACUUUA 2006 UAAAGUGCUUUGAAAAU
2044 2027-2045 75925 dTdT dTdT GC AD- AAAGUGCUUUGAAAAUGCU 1969
AGCAUUUUCAAAGCACUUU 2007 AAAGUGCUUUGAAAAUG 2045 2028-2046 75926
dTdT dTdT CU AD- AAGUGCUUUGAAAAUGCUA 1970 UAGCAUUUUCAAAGCACUU 2008
AAGUGCUUUGAAAAUGC 2046 2029-2047 75927 dTdT dTdT UG AD-
AGUGCUUUGAAAAUGCUGA 1971 UCAGCAUUUUCAAAGCACU 2009 AGUGCUUUGAAAAUGCU
2047 2030-2048 75928 dTdT dTdT GA AD- GUGCUUUGAAAAUGCUGAA 1972
UUCAGCAUUUUCAAAGCAC 2010 GUGCUUUGAAAAUGCUG 2048 2031-2049 75929
dTdT dTdT AG AD- UGCUUUGAAAAUGCUGAGA 1973 UCUCAGCAUUUUCAAAGCA 2011
UGCUUUGAAAAUGCUGA 2049 2032-2050 75930 dTdT dTdT GA AD-
GCUUUGAAAAUGCUGAGAA 1974 UUCUCAGCAUUUUCAAAGC 2012 GCUUUGAAAAUGCUGAG
2050 2033-2051 75931 dTdT dTdT AA AD- CUUUGAAAAUGCUGAGAAA 1975
UUUCUCAGCAUUUUCAAAG 2013 CUUUGAAAAUGCUGAGA 2051 2034-2052 75932
dTdT dTdT AA AD- UUUGAAAAUGCUGAGAAAA 1976 UUUUCUCAGCAUUUUCAAA 2014
UUUGAAAAUGCUGAGAA 2052 2035-2053 75933 dTdT dTdT AA AD-
UUGAAAAUGCUGAGAAAAA 1977 UUUUUCUCAGCAUUUUCAA 2015 UUGAAAAUGCUGAGAAA
2053 2036-2054 70652 dTdT dTdT AA AD- UGAAAAUGCUGAGAAAAAA 1978
UUUUUUCUCAGCAUUUUCA 2016 UGAAAAUGCUGAGAAAA 2054 2037-2055 75934
dTdT dTdT AA AD- GAAAAUGCUGAGAAAAAAA 1979 UUUUUUUCUCAGCAUUUUC 2017
GAAAAUGCUGAGAAAAA 2055 2038-2056 75935 dTdT dTdT AA AD-
AAAAUGCUGAGAAAAAAAA 1980 UUUUUUUUCUCAGCAUUUU 2018 AAAAUGCUGAGAAAAAA
2056 2039-2057 75936 dTdT dTdT AA AD- AAAUGCUGAGAAAAAAAAA 1981
UUUUUUUUUCUCAGCAUUU 2019 AAAUGCUGAGAAAAAAA 2057 2040-2058 75937
dTdT dTdT AA AD- AAUGCUGAGAAAAAAAAAA 1982 UUUUUUUUUUCUCAGCAUU 2020
AAUGCUGAGAAAAAAAA 2058 2041-2059 75938 dTdT dTdT AA AD-
AUGCUGAGAAAAAAAAAAA 1983 UUUUUUUUUUUCUCAGCAU 2021 AUGCUGAGAAAAAAAAA
2059 2042-2060 75939 dTdT dTdT AA
TABLE-US-00032 TABLE 25 F12 Single Dose Screen in Hep3b Cells 10 10
0.1 0.1 Duplex ID nM_AVG nM_SD nM_AVG nM_SD AD-70649.2 28.65 6.26
41.38 9.60 AD-75921.1 29.32 7.31 41.14 10.86 AD-75920.1 30.91 5.90
45.92 15.18 AD-75919.1 32.12 14.45 66.98 17.31 AD-75918.1 28.51
14.34 57.71 21.51 AD-75917.1 22.80 1.02 33.45 5.13 AD-75916.1 27.48
7.88 34.62 6.73 AD-75915.1 50.58 28.39 56.95 39.88 AD-75914.1 28.22
5.74 54.70 9.80 AD-75913.1 38.35 11.58 32.08 9.74 AD-75912.1 27.06
9.92 39.41 14.48 AD-70650.2 31.86 12.64 40.42 11.08 AD-75911.1
28.50 5.83 53.54 9.61 AD-75910.1 34.12 6.44 47.93 22.85 AD-75909.1
35.13 13.76 51.88 42.23 AD-75908.1 38.17 7.67 66.18 59.34
AD-75907.1 40.80 20.27 62.36 20.96 AD-75906.1 49.29 8.64 58.20
26.56 AD-75922.1 25.51 3.58 45.53 20.00 AD-75923.1 49.08 13.60
49.27 11.54 AD-70651.2 55.60 32.34 94.24 39.01 AD-75924.1 46.27
14.11 53.33 11.68 AD-75925.1 37.21 8.81 46.28 17.48 AD-75926.1
27.13 6.82 39.29 8.19 AD-75927.1 47.80 14.67 62.71 21.77 AD-75928.1
34.40 6.27 70.89 29.90 AD-75929.1 43.65 16.80 54.91 4.67 AD-75930.1
72.67 33.09 81.86 17.63 AD-75931.1 85.60 17.39 88.98 12.61
AD-75932.1 46.69 3.04 68.57 12.35 AD-75933.1 75.04 4.59 97.52 8.55
AD-70652.2 104.50 12.08 84.12 4.74 AD-75934.1 83.25 19.97 82.77
10.51 AD-75935.1 65.87 3.46 84.47 11.66 AD-75936.1 97.74 3.66 93.48
10.33 AD-75937.1 112.45 30.62 98.91 29.75 AD-75938.1 125.12 33.83
110.47 33.87 AD-75939.1 112.95 24.79 93.19 18.21
Example 15
Evaluation of 5'-End Modifications of F12 siRNA Duplexes
[0686] Additional iRNA agents targeting F12 comprising a nucleotide
comprising a 5'-phosphate mimic, i.e., a vinyl phosphate, were
designed, synsthesized, and screened for in vitro efficacy, as
described above. Agents comprising the same unmodified and modified
nucleotide sequences of these agents but without the 5'-antisense
strand vinyl phosphate modification were also designed, synthesized
and screened, as described above. A detailed list of all of these
additional unmodified F12 sense and antisense strand sequences is
shown in Table 26. A detailed list of all of these additional
modified F12 sense and antisense strand sequences is shown in Table
27. Table 28 provides the results of a single dose screen in
primary mouse hepatocytes cells transfected with the indicated F12
dsRNA agents.
[0687] The in vivo efficacy of a subset of these compounds was also
assessed by subcutaneously administering wild-type mice a single
0.5 mg/kg dose of an agent and determining the level of F12 protein
in the plasma of the animals at days 3, 7, and 15 post-dose. FIG.
13 depicts the results of these assays and demonstrates that the
addition of a 5'vinyl phosphate to the antisense strands has a
moderate effect on the in vivo efficacy of the indicated
agents.
TABLE-US-00033 TABLE 26 F12 Unmodified F12 Sequences Duplex SEQ SEQ
Range in Name Sense Sequence 5' to 3' ID NO Antisense Sequence 5'
to 3' ID NO SEQ ID NO: 9 AD-73610 GGAGCCCAAGAAAGUGAAAGA 2060
UCUUUCACUUUCUUGGGCUCCAA 2105 299-321 AD-73633 GGAGCCCAAGAAAGUGAAAGA
2061 UCUUUCACUUUCUUGGGCUCCAA 2106 299-321 AD-73604
GAGCCCAAGAAAGUGAAAGAA 2062 UUCUUUCACUUUCUUGGGCUCCA 2107 300-322
AD-73627 GAGCCCAAGAAAGUGAAAGAA 2063 UUCUUUCACUUUCUUGGGCUCCA 2108
300-322 AD-73595 GCCCAAGAAAGUGAAAGACCA 2064 UGGUCUUUCACUUUCUUGGGCUC
2109 302-324 AD-73617 GCCCAAGAAAGUGAAAGACCA 2065
UGGUCUUUCACUUUCUUGGGCUC 2110 302-324 AD-73606 CCCAAGAAAGUGAAAGACCAA
2066 UUGGUCUUUCACUUUCUUGGGCU 2111 303-325 AD-73629
CCCAAGAAAGUGAAAGACCAA 2067 UUGGUCUUUCACUUUCUUGGGCU 2112 303-325
AD-73609 AAAGAGAAAUGCUUUGAGCCA 2068 UGGCUCAAAGCAUUUCUCUUUCU 2113
426-448 AD-73632 AAAGAGAAAUGCUUUGAGCCA 2069 UGGCUCAAAGCAUUUCUCUUUCU
2114 426-448 AD-73599 AAGAGAAAUGCUUUGAGCCUA 2070
UAGGCUCAAAGCAUUUCUCUUUC 2115 427-449 AD-73621 AAGAGAAAUGCUUUGAGCCUA
2071 UAGGCUCAAAGCAUUUCUCUUUC 2116 427-449 AD-73597
AGAGAAAUGCUUUGAGCCUCA 2072 UGAGGCUCAAAGCAUUUCUCUUU 2117 428-450
AD-73619 AGAGAAAUGCUUUGAGCCUCA 2073 UGAGGCUCAAAGCAUUUCUCUUU 2118
428-450 AD-73596 GAGAAAUGCUUUGAGCCUCAA 2074 UUGAGGCUCAAAGCAUUUCUCUU
2119 429-451 AD-73618 GAGAAAUGCUUUGAGCCUCAA 2075
UUGAGGCUCAAAGCAUUUCUCUU 2120 429-451 AD-73614 AGAAAUGCUUUGAGCCUCAGA
2076 UCUGAGGCUCAAAGCAUUUCUCU 2121 430-452 AD-73637
AGAAAUGCUUUGAGCCUCAGA 2077 UCUGAGGCUCAAAGCAUUUCUCU 2122 430-452
AD-73611 AAAUGCUUUGAGCCUCAGCUA 2078 UAGCUGAGGCUCAAAGCAUUUCU 2123
432-454 AD-73634 AAAUGCUUUGAGCCUCAGCUA 2079 UAGCUGAGGCUCAAAGCAUUUCU
2124 432-454 AD-73605 AUGCUUUGAGCCUCAGCUUCA 2080
UGAAGCUGAGGCUCAAAGCAUUU 2125 434-456 AD-73628 AUGCUUUGAGCCUCAGCUUCA
2081 UGAAGCUGAGGCUCAAAGCAUUU 2126 434-456 AD-73601
UGCUUUGAGCCUCAGCUUCUA 2082 UAGAAGCUGAGGCUCAAAGCAUU 2127 435-457
AD-73624 UGCUUUGAGCCUCAGCUUCUA 2083 UAGAAGCUGAGGCUCAAAGCAUU 2128
435-457 AD-73613 GCUUUGAGCCUCAGCUUCUCA 2084 UGAGAAGCUGAGGCUCAAAGCAU
2129 436-458 AD-73636 GCUUUGAGCCUCAGCUUCUCA 2085
UGAGAAGCUGAGGCUCAAAGCAU 2130 436-458 AD-73616 ACUCCACCUUCCUGCAGGAGA
2086 UCUCCUGCAGGAAGGUGGAGUAU 2131 1522-1544 AD-73639
ACUCCACCUUCCUGCAGGAGA 2087 UCUCCUGCAGGAAGGUGGAGUAU 2132 1522-1544
AD-73603 CACAGAAACUCAAUAAAGUGA 2088 UCACUUUAUUGAGUUUCUGUGCC 2133
1927-1949 AD-73626 CACAGAAACUCAAUAAAGUGA 2089
UCACUUUAUUGAGUUUCUGUGCC 2134 1927-1949 AD-73607
ACAGAAACUCAAUAAAGUGCA 2090 UGCACUUUAUUGAGUUUCUGUGC 2135 1928-1950
AD-73630 ACAGAAACUCAAUAAAGUGCA 2091 UGCACUUUAUUGAGUUUCUGUGC 2136
1928-1950 AD-73600 CAGAAACUCAAUAAAGUGCUA 2092
UAGCACUUUAUUGAGUUUCUGUG 2137 1929-1951 AD-73622
CAGAAACUCAAUAAAGUGCUA 2093 UAGCACUUUAUUGAGUUUCUGUG 2138 1929-1951
AD-73615 AGAAACUCAAUAAAGUGCUUA 2094 UAAGCACUUUAUUGAGUUUCUGU 2139
1930-1952 AD-73638 AGAAACUCAAUAAAGUGCUUA 2095
UAAGCACUUUAUUGAGUUUCUGU 2140 1930-1952 AD-73598
GAAACUCAAUAAAGUGCUUUA 2096 UAAAGCACUUUAUUGAGUUUCUG 2141 1931-1953
AD-73620 GAAACUCAAUAAAGUGCUUUA 2097 UAAAGCACUUUAUUGAGUUUCUG 2142
1931-1953 AD-73602 AAACUCAAUAAAGUGCUUUGA 2098
UCAAAGCACUUUAUUGAGUUUCU 2143 1932-1954 AD-73625
AAACUCAAUAAAGUGCUUUGA 2099 UCAAAGCACUUUAUUGAGUUUCU 2144 1932-1954
AD-73608 ACUCAAUAAAGUGCUUUGAAA 2100 UUUCAAAGCACUUUAUUGAGUUU 2145
1934-1956 AD-73631 ACUCAAUAAAGUGCUUUGAAA 2101
UUUCAAAGCACUUUAUUGAGUUU 2146 1934-1956 AD-73612
UCAAUAAAGUGCUUUGAAAAA 2102 UUUUUCAAAGCACUUUAUUGAGU 2147 1936-1958
AD-73635 UCAAUAAAGUGCUUUGAAAAA 2103 UUUUUCAAAGCACUUUAUUGAGU 2148
1936-1958 AD-73623 AACUCAAUAAAGUGCUUUGAA 2104
UUCAAAGCACUUUAUUGAGUUUC 2149 1933-1955 AD-74838
AAUAAAGUGCUUUGAAAACGA 2333 UCGUUUUCAAAGCACUUUAUUGA 2335 1938-1960
AD-74842 AAUAAAGUGCUUUGAAAACGA 2334 UCGUUUUCAAAGCACUUUAUUGA 2336
1938-1960
TABLE-US-00034 TABLE 27 Modified F12 Sequences Duplex Sense SEQ
Antisense SEQ SEQ Name Sequence 5' to 3' ID NO Sequence 5' to 3' ID
NO mRNA target sequence ID NO AD- gsgsagccCfaAfGfAf 2150
usCfsuuuCfaCfUfuu 2195 UUGGAGCCCAAGAAAGUGAA 2240 73610
aagugaaagaL96 cuUfgGfgcuccsasa AGA AD- gsgsagccCfaAfGfAf 2151
PusCfsuuuCfaCfUfu 2196 UUGGAGCCCAAGAAAGUGAA 2241 73633
aagugaaagaL96 ucuUfgGfgcuccsasa AGA AD- gsasgcccAfaGfAfAf 2152
usUfscuuUfcAfCfuu 2197 UGGAGCCCAAGAAAGUGAAA 2242 73604
agugaaagaaL96 ucUfuGfggcucscsa GAC AD- gsasgcccAfaGfAfAf 2153
PusUfscuuUfcAfCfu 2198 UGGAGCCCAAGAAAGUGAAA 2243 73627
agugaaagaaL96 uucUfUgFggcucscsa GAC AD- gscsccaaGfaAfAfGf 2154
usGfsgucUfuUfCfac 2199 GAGCCCAAGAAAGUGAAAGA 2244 73595
ugaaagaccaL96 uuUfcUfugggcsusc CCA AD- gscsccaaGfaAfAfGf 2155
PusGfsgucUfuUfCfa 2200 GAGCCCAAGAAAGUGAAAGA 2245 73617
ugaaagaccaL96 cuuUfcUfugggcsusc CCA AD- cscscaagAfaAfGfUf 2156
usUfsgguCfuUfUfca 2201 AGCCCAAGAAAGUGAAAGAC 2246 73606
gaaagaccaaL96 cuUfuCfuugggscsu CAU AD- cscscaagAfaAfGfUf 2157
PusUfsgguCfuUfUfc 2202 AGCCCAAGAAAGUGAAAGAC 2247 73629
gaaagaccaaL96 acuUfuCfuugggscsu CAU AD- asasagagAfaAfUfGf 2158
usGfsgcuCfaAfAfgc 2203 AGAAAGAGAAAUGCUUUGAG 2248 73609
cuuugagccaL96 auUfuCfucuuuscsu CCU AD- asasagagAfaAfUfGf 2159
PusGfsgcuCfaAfAfg 2204 AGAAAGAGAAAUGCUUUGAG 2249 73632
cuuugagccaL96 cauUfuCfucuuuscsu CCU AD- asasgagaAfaUfGfCf 2160
usAfsggcUfcAfAfag 2205 GAAAGAGAAAUGCUUUGAGC 2250 73599
uuugagccuaL96 caUfuUfcucuususc CUC AD- asasgagaAfaUfGfCf 2161
PusAfsggcUfcAfAfa 2206 GAAAGAGAAAUGCUUUGAGC 2251 73621
uuugagccuaL96 gcaUfuUfcucuususc CUC AD- asgsagaaAfuGfCfUf 2162
usGfsaggCfuCdfAfa 2207 AAAGAGAAAUGCUUUGAGCC 2252 73597
uugagccucaL96 agcAfuUfucucususu UCA AD- asgsagaaAfuGfCfUf 2163
PusGfsaggCfuCfAfa 2208 AAAGAGAAAUGCUUUGAGCC 2253 73619
uugagccucaL96 agcAfuUfucucususu UCA AD- gsasgaaaUfgCfUfUf 2164
usUfsgagGfcUfCfaa 2209 AAGAGAAAUGCUUUGAGCCU 2254 73596
ugagccucaaL96 aCfaUfuucucsusu CAG AD- gsasgaaaUfgCfUfUf 2165
PusUfsgagGfcUfCfa 2210 AAGAGAAAUGCUUUGAGCCU 2255 73618
ugagccucaaL96 aagCfaUfuucucsusu CAG AD- asgsaaauGfcUfUfUf 2166
usCfsugaGfgCfUfca 2211 AGAGAAAUGCUUUGAGCCUC 2256 73614
gagccucagaL96 aGfcAfuuucuscsu AGC AD- asgsaaauGfcUfUfUf 2167
PusCfsugaGfgCfUfc 2212 AGAGAAAUGCUUUGAGCCUC 2257 73637
gagccucagaL96 aaaGfcAfuuucuscsu AGC AD- asasaugcUfuUfGfAf 2168
usAfsgcuGfaGfGfcu 2213 AGAAAUGCUUUGAGCCUCAG 2258 73611
gccucagcuaL96 caAfaGfcauuuscsu CUU AD- asasaugcUfuUfGfAf 2169
PusAfsgcuGfaGfGfc 2214 AGAAAUGCUUUGAGCCUCAG 2259 73634
gccucagcuaL96 ucaAfaGfcauuuscsu CUU AD- asusgcuuUfgAfGfCf 2170
usGfsaagCfuGfAfgg 2215 AAAUGCUUUGAGCCUCAGCU 2260 73605
cucagcuucaL96 cuCfaAfagcaususu UCU AD- asusgcuuUfgAfGfCf 2171
PusGfsaagCfuGfAfg 2216 AAAUGCUUUGAGCCUCAGCU 2261 73628
cucagcuucaL96 gcuCfaAfagcaususu UCU AD- usgscuuuGfaGfCfCf 2172
usAfsgaaGfcUfGfag 2217 AAUGCUUUGAGCCUCAGCUU 2262 73601
ucagcuucuaL96 gcUfcAfaagcasusu CUC AD- usgscuuuGfaGfCfCf 2173
PusAfsgaaGfcUfGfa 2218 AAUGCUUUGAGCCUCAGCUU 2263 73624
ucagcuucuaL96 ggcUfcAfaagcasusu CUC AD- gscsuuugAfgCfCfUf 2174
usGfsagaAfgCfUfga 2219 AUGCUUUGAGCCUCAGCUUC 2264 73613
cagcuucucaL96 ggCfuCfaaagcsasu UCA AD- gscsuuugAfgCfCfUf 2175
PusGfsagaAfgCfUfg 2220 AUGCUUUGAGCCUCAGCUUC 2265 73636
cagcuucucaL96 aggCfuCfaaagcsasu UCA AD- ascsuccaCfcUfUfCf 2176
usCfsuccUfgCfAfgg 2221 AUACUCCACCUUCCUGCAGG 2266 73616
cugcaggagaL96 aaGfgUfggagusasu AGG AD- ascsuccaCfcUfUfCf 2177
PusCfsuccUfgCfAfg 2222 AUACUCCACCUUCCUGCAGG 2267 73639
cugcaggagaL96 gaaGfgUfggagusasu AGG AD- csascagaAfaCfUfCf 2178
usCfsacuUfuAfUfug 2223 GGCACAGAAACUCAAUAAAG 2268 73603
aauaaagugaL96 agUfuUfcugugscsc UGC AD- csascagaAfaCfUfCf 2179
PusCfsacuUfuAfUfu 2224 GGCACAGAAACUCAAUAAAG 2269 73626
aauaaagugaL96 gagUfuUfcugugscsc UGC AD- ascsagaaAfcUfCfAf 2180
usGfscacUfuUfAfuu 2225 GCACAGAAACUCAAUAAAGU 2270 73607
auaaagugcaL96 gaGfuUfucugusgsc GCU AD- ascsagaaAfcUfCfAf 2181
PusGfscacUfuUfAfu 2226 GCACAGAAACUCAAUAAAGU 2271 73630
auaaagugcaL96 ugaGfuUfucugusgsc GCU AD- csasgaaaCfuCfAfAf 2182
usAfsgcaCfuUfUfau 2227 CACAGAAACUCAAUAAAGUG 2272 73600
uaaagugcuaL96 ugAfgUfuucugsusg CUU AD- csasgaaaCfuCfAfAf 2183
PusAfsgcaCfuUfUfa 2228 CACAGAAACUCAAUAAAGUG 2273 73622
uaaagugcuaL96 uugAfgUfuucugsusg CUU AD- asgsaaacUfcAfAfUf 2184
usAfsagcAfcUfUfua 2229 ACAGAAACUCAAUAAAGUGC 2274 73615
aaagugcuuaL96 uuGfaGfuuucusgsu UUU AD- asgsaaacUfcAfAfUf 2185
PusAfsagcAfcUfUfu 2230 ACAGAAACUCAAUAAAGUGC 2275 73638
aaagugcuuaL96 auuGfaGfuuucusgsu UUU AD- gsasaacuCfaAfUfAf 2186
usAfsaagCfaCfUfuu 2231 CAGAAACUCAAUAAAGUGCU 2276 73598
aagugcuuuaL96 auUfgAfguuucsusg UUG AD- gsasaacuCfaAfUfAf 2187
PusAfsaagCfaCfUfu 2232 CAGAAACUCAAUAAAGUGCU 2277 73620
aagugcuuuaL96 uauUfgAfguuucsusg UUG AD- asasacucAfaUfAfAf 2188
usCfsaaaGfcAfCfuu 2233 AGAAACUCAAUAAAGUGCUU 2278 73602
agugcuuugaL96 uaUfuGfaguuuscsu UGA AD- asasacucAfaUfAfAf 2189
PusCfsaaaGfcAfCfu 2234 AGAAACUCAAUAAAGUGCUU 2279 73625
agugcuuugaL96 uuaUfuGfaguuuscsu UGA AD- ascsucaaUfaAfAfGf 2190
usUfsucaAfaGfCfac 2235 AAACUCAAUAAAGUGCUUUG 2280 73608
ugcuuugaaaL96 uuUfaUfugagususu AAA AD- ascsucaaUfaAfAfGf 2191
PusUfsucaAfaGfCfa 2236 AAACUCAAUAAAGUGCUUUG 2281 73631
ugcuuugaaaL96 cuuUfaUfugagususu AAA AD- uscsaauaAfaGfUfGf 2192
usUfsuuuCfaAfAfgc 2237 ACUCAAUAAAGUGCUUUGAA 2282 73612
cuuugaaaaaL96 acUfuUfauugasgsu AAC AD- uscsaauaAfaGfUfGf 2913
PusUfsuuuCfaAfAfg 2238 ACUCAAUAAAGUGCUUUGAA 2283 73635
cuuugaaaaaL96 cacUfuUfauugasgsu AAC AD- asascucaAfuAfAfAf 2914
PusUfscaaAfgCfAfc 2239 GAAACUCAAUAAAGUGCUUU 2284 73623
gugcuuugaaL96 uuuAfuUfgaguususc GAA AD- asasuaaaGfuGfCfUf 2337
usCfsguuUfuCfAfaa 2239 UCAAUAAAGUGCUUUGAAAA 2341 74838
uugaaaacgaL96 gcAfcUfuuauusgsa CGA AD- asasuaaaGfuGfCfUf 2338
PusCfsguuUfuCfAfa 2340 UCAAUAAAGUGCUUUGAAAA 2342 74842
uugaaaacgaL96 agcAfcUfuuauusgsa CGA
TABLE-US-00035 TABLE 28 F12 Single Dose Screen in Primary Mouse
Hepatocytes Activity 10 nM 0.1 nM* Duplex ID Avg SD Avg SD AD-67244
7.5 2.3 69.5 4.6 AD-73610 46.8 14.1 104.7 10.1 AD-73633 18.0 6.8
69.2 13.3 AD-73604 21.0 6.3 100.3 10.0 AD-73627 10.5 3.2 55.5 5.7
AD-73595 29.0 7.6 96.1 4.8 AD-73617 12.4 4.9 66.1 10.5 AD-73606
11.8 3.6 93.2 4.1 AD-73629 14.9 4.6 57.8 6.4 AD-73609 35.2 4.7 89.6
5.0 AD-73632 3.3 0.6 46.5 8.0 AD-73599 11.7 2.2 84.4 10.9 AD-73621
5.9 1.7 34.8 4.4 AD-73597 9.4 1.8 60.6 3.0 AD-73619 5.0 1.7 21.0
7.4 AD-73596 7.3 3.1 53.2 10.9 AD-73618 4.6 2.4 29.4 8.2 AD-73614
24.0 8.8 96.0 4.8 AD-73637 7.1 2.2 47.3 6.9 AD-73611 17.3 3.8 92.5
4.0 AD-73634 7.1 3.5 54.5 12.5 AD-73605 10.2 2.1 88.7 6.0 AD-73628
5.7 0.4 23.5 8.1 AD-73601 6.4 2.4 67.4 9.9 AD-73624 3.0 0.5 28.0
5.9 AD-73613 16.4 5.3 92.6 8.8 AD-73636 4.8 1.5 22.5 7.2 AD-73616
99.7 8.0 97.3 3.2 AD-73639 35.5 4.8 100.3 6.7 AD-73603 12.8 5.0
87.7 7.2 AD-73626 2.2 0.8 19.8 4.3 AD-73607 17.4 5.6 90.0 6.4
AD-73630 3.9 1.2 25.0 7.3 AD-73600 2.7 1.5 24.9 4.9 AD-73622 1.5
0.2 16.2 2.3 AD-73615 7.6 3.6 51.9 4.8 AD-73638 3.7 1.5 17.6 5.6
AD-73598 2.0 0.5 18.7 7.5 AD-73620 2.0 0.3 9.5 3.4 AD-73602 4.4 1.9
48.7 8.4 AD-73625 3.3 1.4 9.8 2.0 AD-73608 5.5 1.3 65.4 10.7
AD-73631 2.1 0.4 11.1 1.9 AD-73612 5.4 1.4 49.1 7.3 AD-73635 3.5
0.7 13.0 2.5 AD-73623 2.5 0.4 7.2 1.2
EQUIVALENTS
[0688] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments and methods described
herein. Such equivalents are intended to be encompassed by the
scope of the following claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20180100150A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20180100150A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References