U.S. patent application number 15/634977 was filed with the patent office on 2018-03-29 for competitive modulation of micrornas.
This patent application is currently assigned to Ionis Pharmaceuticals, Inc.. The applicant listed for this patent is Ionis Pharmaceuticals, Inc.. Invention is credited to Stanley T. Crooke, Xue-hai Liang.
Application Number | 20180087107 15/634977 |
Document ID | / |
Family ID | 50934929 |
Filed Date | 2018-03-29 |
United States Patent
Application |
20180087107 |
Kind Code |
A1 |
Liang; Xue-hai ; et
al. |
March 29, 2018 |
COMPETITIVE MODULATION OF MICRORNAS
Abstract
The present invention provides compounds and methods for
competitive modulation of microRNAs. Such copounds and methods have
profound effects on cells.
Inventors: |
Liang; Xue-hai; (Del Mar,
CA) ; Crooke; Stanley T.; (Carlsbad, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ionis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
Ionis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
50934929 |
Appl. No.: |
15/634977 |
Filed: |
June 27, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14651344 |
Jun 11, 2015 |
9695475 |
|
|
PCT/US2013/074473 |
Dec 11, 2013 |
|
|
|
15634977 |
|
|
|
|
61735688 |
Dec 11, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/178 20130101;
A61K 31/713 20130101; C12N 15/113 20130101; C12N 2310/14 20130101;
A61K 31/7125 20130101; C12N 2310/141 20130101; A61K 31/7115
20130101; A61K 31/712 20130101; C12Q 1/6876 20130101; C12N 2320/11
20130101; A61K 31/7088 20130101; C12Q 2600/136 20130101; C12N
15/111 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; A61K 31/7115 20060101 A61K031/7115; A61K 31/712
20060101 A61K031/712; A61K 31/7125 20060101 A61K031/7125; A61K
31/713 20060101 A61K031/713; A61K 31/7088 20060101 A61K031/7088;
C12N 15/113 20060101 C12N015/113; C12N 15/11 20060101
C12N015/11 |
Claims
1-135. (canceled)
136. A method of modulating miR-tone in a cell comprising
contacting the cell with a broad competitive microRNA modulating
compound, wherein the cell is in a human.
137. The method of claim 136, wherein the modulating comprises a
decrease in the activity and/or amount of a plurality of natural
microRNAs.
138. The method of claim 136, wherein the modulating comprises an
increase in the activity and/or amount of a plurality of natural
microRNAs.
139. (canceled)
140. The method of claim 136, wherein the human has a condition
selected from among: cancer, inflammatory disease, metabolic
disease, infectious disease, autoimmune disease, neurodegenerative
disease and cardiovascular disease.
141. (canceled)
142. The method of claim 137 wherein the natural microRNAs are
selected from among mir-16, mir-17, mir-21, mir-24, mir-27a,
mir-92, mir-202, mir-378, and mir-422a.
143. (canceled)
144. The method of claim 136, wherein the human has a condition
selected from among: leukemia, lymphomas, multiple myeloma, ovarian
neoplasms, colorectal cancer, pituitary neoplasms, adrenocortical
carcinoma, prostatic neoplasms, Patau syndrome, non-small cell lung
carcinoma, glioblastoma, breast neoplasms, myocardial infarction,
Alzheimer, Parkinson, Hodgkin, medulloblastoma, multiple sclerosis,
mesothelioma, obesity, periodontitis, pancreatic neoplasms,
psoriasis, diabetes, eclampsia, Sezary syndrome, hypertension,
fibrosis, Schizophrenia, myeolodysplastic syndrome, heptatocellular
carcinoma, endometriosis, laryngeal neoplasms, systemic lupus
erythematosus (SLE), rheumatoid arthritis, asthma, osteoarthritis,
ulcerative colitis and atopic eczema.
145. The method of claim 1, wherein the method comprises performing
an assay for determining whether a test compound is capable of
competing with one or more natural microRNA for a
microRNA-associated protein comprises: a. creating a first test
sample comprising a test compound, a microRNA, and a
microRNA-associated protein, wherein the test compound is at a
first concentration; b. creating a second test sample comprising
the test compound, the microRNA, and the microRNA-associated
protein, wherein the test compound is present at a second
concentration; c. determining the amount of test compound and/or
the amount of microRNA bound to the microRNA-associated protein in
each of the first and second test sample; and d. calculating the
relative binding affinity of the test compound and the microRNA for
their binding for the microRNA-associated protein.
146. The method of claim 145, wherein the assay for determining
whether a test compound is capable of competing with one or more
natural microRNA for a microRNA-associated protein comprises: a.
creating a first test sample comprising a test compound, a
microRNA, and a microRNA-associated protein, wherein the test
compound is at a first concentration; b. creating a second test
sample comprising the test compound, the microRNA, and the
microRNA-associated protein, wherein the test compound is present
at a second concentration; c. determining the activity of at least
one microRNA in each of the first and second test sample; and; d.
calculating the degree to which the test sample alters activity of
the at least one microRNA.
147. The method of claim 145, wherein the microRNA-associated
protein is provided at excess.
148. The method of claim 137, wherein the natural microRNAs are
selected from among mir-133, mir-331, mir-339, mir-532, and
mir-615.
149. The method of claim 136, wherein the broad competitive
microRNA modulating compound is an oligonucleotide.
150. The method of claim 149, wherein the broad competitive
microRNA modulating compound is a single-stranded
oligonucleotide
151. The method of claim 149, wherein the broad competitive
microRNA modulating compound is a double-stranded
oligonucleotide.
152. The method of claim 136, wherein the broad competitive
microRNA modulating compound modulates the amount or activity of at
least one object nucleic acid in the cells.
153. The method of claim 136, wherein the broad competitive
microRNA modulating compound modulates the amount or activity of at
least one object protein in the cell.
154. The method of claim 153, wherein the at least one object
protein is a protease.
155. The method of claim 154, wherein the protease is granzyme
B.
156. The method of claim 154, wherein the protease is granzyme
M.
157. The method of claim 136, wherein the broad competitive
microRNA modulating compound ultimately modulates the amount or
activity of .alpha.-tubulin.
158. The method of claim 149, wherein the oligonucleotide comprises
at least one modified nucleoside comprising a 2'-substituted sugar
moiety.
Description
FIELD OF THE INVENTION
[0001] The present invention pertains generally to
chemically-modified oligonucleotides for use in research,
diagnostics, and/or therapeutics.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0102USC1SEQ_ST25.txt, created Jun. 27, 2017,
which is 16 Kb in size. The information in the electronic format of
the sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0003] MicroRNAs (microRNAs), are small (approximately 18-24
nucleotides in length), non-coding RNA molecules encoded in the
genomes of plants and animals. In certain instances, microRNAs
regulate the expression of genes by binding to the 3'-untranslated
regions (3'-UTR) of specific mRNAs. More than 1000 different
microRNAs have been identified in plants and animals. Certain
mature microRNAs appear to originate from long endogenous primary
microRNA transcripts (also known as pri-microRNAs, pri-mirs,
pri-miRs or pri-pre-microRNAs) that are often hundreds of
nucleotides in length (Lee, et al., EMBO J., 2002, 21(17),
4663-4670).
[0004] Functional analyses of microRNAs have revealed that these
small non-coding RNAs contribute to different physiological
processes in animals, including developmental timing,
organogenesis, differentiation, patterning, embryogenesis, growth
control and programmed cell death. Examples of particular processes
in which microRNAs participate include stem cell differentiation,
neurogenesis, angiogenesis, hematopoiesis, and exocytosis (reviewed
by Alvarez-Garcia and Miska, Development, 2005, 132,
4653-4662).
SUMMARY OF THE INVENTION
[0005] In certain embodiments, the present invention provides
methods for identifying competitive microRNA modulating compounds.
Such methods comprising performing an assay to determine whether a
test compound is capable of competing with at least one microRNA
for a microRNA-associated protein. In certain embodiments, the
microRNA-associated protein is required for microRNA activity. In
certain embodiments, the microRNA-associated protein is Ago2. In
certain embodiments, the microRNA-associated protein is involved in
the inactivation, degradation, and/or export of the microRNA. In
certain embodiments, the microRNA-associated protein is nucleolin.
In certain embodiments, the microRNA-associated protein is
nucleophosmin. In certain embodiments, the modulation is a decrease
in the activity of at least one microRNA in the cell. In certain
embodiments, the modulation is an increase in the amount and/or
activity of at least one microRNA in the cell.
[0006] Certain such competitive microRNA modulators compete
selectively for a microRNA-associated protein with one or more
microRNA, but do not compete or compete to a lesser degree with at
least one other microRNA. Certain such selective competitive
microRNA modulators may be identified and used to modulate specific
microRNAs. In certain embodiments, competitive microRNA modulators
compete for a microRNA-associated protein with more than one
microRNA, with more than 10 microRNAs, with at least half of the
microRNAs in the cell; with essentially all of the microRNAs in the
cell; or with all of the microRNAs in the cell. Such broad
competitive microRNA modulators may be identified and used to
affect the overall microRNA activity or amount (or miR-tone) in the
cell.
[0007] In certain embodiments, competitive microRNA modulators are
small molecules. In certain embodiments, competitive microRNA
modulators are oligomers, such as oligonucleotides. In certain such
embodiments, microRNA modulators are double-stranded
oligonucleotides. Certain such oligonucleotides comprise at least
one RNA or RNA-like nucleoside.
[0008] Since competitive microRNA modulators derive their activity
from the ability to competitively bind microRNA-associated proteins
(and thus displace microRNAs), and not from hybridization, in
certain embodiments, competitive microRNA modulators have a
nucleobase sequence that is not complementary to any target nucleic
acid in the cell. Alternatively, certain competitive microRNA
modulators are complementary to a target nucleic acid. Certain such
competitive microRNA modulators may exert activity by competing for
a microRNA-associated protein and also have hybridization-based
antisense activity. Certain such competitive microRNA modulators
are siRNA compounds.
[0009] In certain embodiments, competitive microRNA modulators
modulate the activity and/or amount of one or more microRNA in a
cell and consequently alter the expression of one or more object
mRNA of the modulated microRNA. In certain instances, the object
mRNA or its associated protein is associated with a disease or
disorder. In certain embodiments, competitive microRNA modulators
ultimately modulate the expression of function of such mRNA to
alleviate one or more symptom of the disease or disorder.
[0010] In certain embodiments, methods and compounds described
herein are useful in vitro. In certain embodiments such methods and
compounds are used in diagnostics and/or for target validation
experiments.
BRIEF DESCRIPTION OF THE FIGURES
[0011] FIG. 1 shows a western blot illustrating relative protein
expression of various proteins following treatment of HeLa cells
with various siRNAs.
[0012] FIG. 2 shows quantification of .alpha.-tubulin protein
levels normalized to hnRNP A2 protein levels in the western blot
depicted in FIG. 1.
[0013] FIG. 3 shows a western blot illustrating RHA and tubulin
protein levels following various doses of RHA siRNA treatment in
HeLa cells.
[0014] FIG. 4 shows a western blot illustrating tubulin, nucleolin,
and actin protein levels following various doses of Fen1 siRNA
treatment in HeLa cells. FIG. 5 shows quantification of
.alpha.-tubulin, .beta.-tubulin, and nucleolin protein levels
normalized to .gamma.-tubulin protein levels in the western blot
depicted in FIG. 4.
[0015] FIG. 6 shows a western blot illustrating .alpha.-tubulin and
GAPDH protein levels following individual and combination treatment
of HeLa cells with Fen1 siRNA and/or PTEN siRNA.
[0016] FIG. 7 shows quantification of .alpha.-tubulin protein
levels normalized to GAPDH protein levels in the western blot
depicted in FIG. 6.
[0017] FIG. 8 shows a western blot illustrating .alpha.-tubulin
protein levels following treatment of MHT cells with various
siRNAs. A Coomassie blue stained gel is also shown as a loading
control.
[0018] FIG. 9 shows quantification of .alpha.-tubulin protein
levels relative to the untreated control in the western blot
depicted in FIG. 8.
[0019] FIG. 10 shows a western blot illustrating .alpha.-tubulin
and .gamma.-tubulin protein levels following siRNA treatment of MEF
and Ago2 knock-out cells.
[0020] FIG. 11 shows RT-PCR results for siRNA Isis 341401 following
treatment of HeLa cells with siRNA Isis 341401 in the HeLa cell
lysate input and following immunoprecipitation of HeLa cell lysates
with various antibodies.
[0021] FIG. 12 shows a western blot illustrating the protein levels
of .alpha.-tubulin and .beta.-tubulin in the HeLa cell lysate input
and the immunoprecipitation elutes referred to in FIG. 11.
[0022] FIG. 13 shows a northern blot illustrating miRNA and U16
snoRNA levels following treatment of MEF cells with various
siRNAs.
[0023] FIG. 14 shows quantification of miRNA levels normalized to
U16 snoRNA in the northern blot depicted in FIG. 13.
[0024] FIG. 15 shows a northern blot illustrating miR-21 and U2
snRNA levels following treatment of HEK293 cells with siRNA.
[0025] FIG. 16 shows quantification of miR-21 levels normalized to
U2 snRNA levels in the northern blot depicted in FIG. 15.
[0026] FIG. 17 shows a northern blot illustrating miRNA and U16
snoRNA levels following various doses of PTEN siRNA treatment in
HeLa cells.
[0027] FIG. 18 shows quantification of miR-21 and miR-16 levels
normalized to U16 snoRNA levels in the northern blot depicted in
FIG. 17.
[0028] FIG. 19 shows a northern blot illustrating U16 snoRNA,
pre-miR-16, miR-16, and miR-92 levels following various doses of
TSN siRNA treatment in HeLa cells.
[0029] FIG. 20 shows quantification of miR-16 and miR-92 levels
normalized to U17 snoRNA levels in the northern blot depicted in
FIG. 19.
[0030] FIG. 21 shows miR-17 and miR-378 levels at various time
points following treatment of HeLa cells with PTEN siRNA relative
to miR-17 and miR-378 levels in untreated control HeLa cells.
[0031] FIG. 22 shows levels of miRNA co-immunoprecipitated with an
Ago2 antibody at various time points following treatment of HeLa
cells with PTEN siRNA relative to levels of miRNA
co-immunoprecipitated with an Ago2 antibody in untreated control
HeLa cells.
[0032] FIG. 23 shows levels of PTEN siRNA co-immunoprecipitated
with an Ago2 antibody at various time points following treatment of
HeLa cells with the PTEN siRNA.
[0033] FIG. 24 shows a western blot illustrating Ago2 and
.gamma.-tubulin protein levels at various time points following
treatment of HeLa cells with PTEN siRNA.
[0034] FIG. 25 shows a schematic depiction of the relative
positions that miRNAs may potentially target the GZMB 3' UTR.
[0035] FIG. 26 shows miR-378 and miR-422a levels following
treatment of HeLa cells with siRNA relative to miR-378 and miR-422a
levels in untreated control HeLa cells.
[0036] FIG. 27 shows RT-PCR results for GZMB mRNA following
treatment of HeLa cells with Fen1 siRNA.
[0037] FIG. 28 shows a schematic depiction of the relative
positions that miRNAs may potentially target the GZMM 3' UTR.
[0038] FIG. 29 shows miRNA levels following treatment of HeLa cells
with Fen1 siRNA relative to miRNA levels in untreated control HeLa
cells.
[0039] FIG. 30 shows RT-PCR results for GZMM mRNA following
treatment of HeLa cells with siRNA.
[0040] FIG. 31 shows a western blot illustrating protein levels
following treatment of HeLa cells with siRNA.
[0041] FIG. 32 shows a western blot illustrating tubulin protein
levels following individual and combination treatment of HeLa cells
with GZMB, GZMM, and Fen1 siRNA.
[0042] FIG. 33 shows quantification of .alpha.-tubulin protein
levels normalized to .gamma.-tubulin protein levels in the western
blot depicted in FIG. 32.
DETAILED DESCRIPTION OF THE INVENTION
[0043] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0044] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose.
A. Definitions
[0045] Unless specific definitions are provided, the nomenclature
used in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa.,
21.sup.st edition, 2005; and "Antisense Drug Technology,
Principles, Strategies, and Applications" Edited by Stanley T.
Crooke, CRC Press, Boca Raton, Florida; and Sambrook et al.,
"Molecular Cloning, A laboratory Manual," 2.sup.nd Edition, Cold
Spring Harbor Laboratory Press, 1989, which are hereby incorporated
by reference for any purpose. Where permitted, all patents,
applications, published applications and other publications and
other data referred to throughout in the disclosure are
incorporated by reference herein in their entirety.
[0046] Unless otherwise indicated, the following terms have the
following meanings:
[0047] As used herein, "nucleoside" means a compound comprising a
nucleobase moiety and a sugar moiety. Nucleosides include, but are
not limited to, naturally occurring nucleosides (as found in DNA
and RNA) and modified nucleosides. Nucleosides may be linked to a
phosphate moiety.
[0048] As used herein, "chemical modification" means a chemical
difference in a compound when compared to a naturally occurring
counterpart. Chemical modifications of oligonucleotides include
nucleoside modifications (including sugar moiety modifications and
nucleobase modifications) and internucleoside linkage
modifications. In reference to an oligonucleotide, chemical
modification does not include differences only in nucleobase
sequence.
[0049] As used herein, "furanosyl" means a structure comprising a
5-membered ring comprising four carbon atoms and one oxygen
atom.
[0050] As used herein, "naturally occurring sugar moiety" means a
ribofuranosyl as found in naturally occurring RNA or a
deoxyribofuranosyl as found in naturally occurring DNA.
[0051] As used herein, "sugar moiety" means a naturally occurring
sugar moiety or a modified sugar moiety of a nucleoside.
[0052] As used herein, "modified sugar moiety" means a substituted
sugar moiety or a sugar surrogate.
[0053] As used herein, "substituted sugar moiety" means a furanosyl
that is not a naturally occurring sugar moiety. Substituted sugar
moieties include, but are not limited to furanosyls comprising
substituents at the 2'-position, the 3'-position, the 5'-position
and/or the 4'-position. Certain substituted sugar moieties are
bicyclic sugar moieties.
[0054] As used herein, "2'-substituted sugar moiety" means a
furanosyl comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is
not a bicyclic sugar moiety (i.e., the 2'-substituent of a
2'-substituted sugar moiety does not form a bridge to another atom
of the furanosyl ring.
[0055] As used herein, "MOE" means
--OCH.sub.2CH.sub.2OCH.sub.3.
[0056] As used herein, "2'-F nucleoside" refers to a nucleoside
comprising a sugar comprising fluoroine at the 2' position. Unless
otherwise indicated, the fluorine in a 2'-F nucleoside is in the
ribo position (replacing the OH of a natural ribose).
[0057] As used herein the term "sugar surrogate" means a structure
that does not comprise a furanosyl and that is capable of replacing
the naturally occurring sugar moiety of a nucleoside, such that the
resulting nucleoside sub-units are capable of linking together
and/or linking to other nucleosides to form an oligomeric compound
which is capable of hybridizing to a complementary oligomeric
compound. Such structures include rings comprising a different
number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings);
replacement of the oxygen of a furanosyl with a non-oxygen atom
(e.g., carbon, sulfur, or nitrogen); or both a change in the number
of atoms and a replacement of the oxygen. Such structures may also
comprise substitutions corresponding to those described for
substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic
sugar surrogates optionally comprising additional substituents).
Sugar surrogates also include more complex sugar replacements
(e.g., the non-ring systems of peptide nucleic acid). Sugar
surrogates include without limitation morpholinos, cyclohexenyls
and cyclohexitols.
[0058] As used herein, "bicyclic sugar moiety" means a modified
sugar moiety comprising a 4 to 7 membered ring (including but not
limited to a furanosyl) comprising a bridge connecting two atoms of
the 4 to 7 membered ring to form a second ring, resulting in a
bicyclic structure. In certain embodiments, the 4 to 7 membered
ring is a sugar ring. In certain embodiments the 4 to 7 membered
ring is a furanosyl. In certain such embodiments, the bridge
connects the 2'-carbon and the 4'-carbon of the furanosyl.
[0059] As used herein, "nucleotide" means a nucleoside further
comprising a phosphate linking group. As used herein, "linked
nucleosides" may or may not be linked by phosphate linkages and
thus includes, but is not limited to "linked nucleotides." As used
herein, "linked nucleosides" are nucleosides that are connected in
a continuous sequence (i.e. no additional nucleosides are present
between those that are linked).
[0060] As used herein, "nucleobase" means a group of atoms that can
be linked to a sugar moiety to create a nucleoside that is capable
of incorporation into an oligonucleotide, and wherein the group of
atoms is capable of bonding with a complementary naturally
occurring nucleobase of another oligonucleotide or nucleic acid.
Nucleobases may be naturally occurring or may be modified.
[0061] As used herein the terms, "unmodified nucleobase" or
"naturally occurring nucleobase" means the naturally occurring
heterocyclic nucleobases of RNA or DNA: the purine bases adenine
(A) and guanine (G), and the pyrimidine bases thymine (T), cytosine
(C) (including 5-methyl C), and uracil (U).
[0062] As used herein, "modified nucleobase" means any nucleobase
that is not a naturally occurring nucleobase.
[0063] As used herein, "modified nucleoside" means a nucleoside
comprising at least one chemical modification compared to naturally
occurring RNA or DNA nucleosides. Modified nucleosides comprise a
modified sugar moiety and/or a modified nucleobase.
[0064] As used herein, "bicyclic nucleoside" or "BNA" means a
nucleoside comprising a bicyclic sugar moiety.
[0065] As used herein, "constrained ethyl nucleoside" or "cEt"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH(CH.sub.3)--)-2'bridge.
[0066] As used herein, "locked nucleic acid nucleoside" or "LNA"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH.sub.2--O-2'bridge.
[0067] As used herein, "2'-substituted nucleoside" means a
nucleoside comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted nucleoside is
not a bicyclic nucleoside.
[0068] As used herein, "2'-deoxynucleoside" means a nucleoside
comprising 2'-H furanosyl sugar moiety, as found in naturally
occurring deoxyribonucleosides (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (e.g., uracil).
[0069] As used herein, "RNA-like nucleoside" means a modified
nucleoside that adopts a northern configuration and functions like
RNA when incorporated into an oligonucleotide. RNA-like nucleosides
include, but are not limited to 3'-endo furanosyl nucleosides and
RNA surrogates.
[0070] As used herein, "3'-endo-furanosyl nucleoside" means an
RNA-like nucleoside that comprises a substituted sugar moiety that
has a 3'-endo conformation. 3'-endo-furanosyl nucleosides include,
but are not limitied to: 2'-MOE, 2'-F, 2'-OMe, LNA, ENA, and cEt
nucleosides.
[0071] As used herein, "RNA-surrogate nucleoside" means an RNA-like
nucleoside that does not comprise a furanosyl. RNA-surrogate
nucleosides include, but are not limited to hexitols and
cyclopentanes.
[0072] As used herein, "oligonucleotide" means a compound
comprising a plurality of linked nucleosides. In certain
embodiments, an oligonucleotide comprises one or more unmodified
ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA)
and/or one or more modified nucleosides.
[0073] As used herein "oligonucleoside" means an oligonucleotide in
which none of the internucleoside linkages contains a phosphorus
atom. As used herein, oligonucleotides include
oligonucleosides.
[0074] As used herein, "modified oligonucleotide" means an
oligonucleotide comprising at least one modified nucleoside and/or
at least one modified internucleoside linkage.
[0075] As used herein "internucleoside linkage" means a covalent
linkage between adjacent nucleosides in an oligonucleotide.
[0076] As used herein "naturally occurring internucleoside linkage"
means a 3' to 5' phosphodiester linkage. As used herein, "modified
internucleoside linkage" means any internucleoside linkage other
than a naturally occurring internucleoside linkage.
[0077] As used herein, "oligomeric compound" means a polymeric
structure comprising two or more sub-structures. In certain
embodiments, an oligomeric compound comprises an oligonucleotide.
In certain embodiments, an oligomeric compound comprises one or
more conjugate groups and/or terminal groups. In certain
embodiments, an oligomeric compound consists of an
oligonucleotide.
[0078] As used herein, "terminal group" means one or more atom
attached to either, or both, the 3' end or the 5' end of an
oligonucleotide. In certain embodiments a terminal group is a
conjugate group. In certain embodiments, a terminal group comprises
one or more terminal group nucleosides.
[0079] As used herein, "conjugate" means an atom or group of atoms
bound to an oligonucleotide or oligomeric compound. In general,
conjugate groups modify one or more properties of the compound to
which they are attached, including, but not limited to
pharmacodynamic, pharmacokinetic, binding, absorption, cellular
distribution, cellular uptake, charge and/or clearance
properties.
[0080] As used herein, "conjugate linking group" means any atom or
group of atoms used to attach a conjugate to an oligonucleotide or
oligomeric compound.
[0081] As used herein, "antisense compound" means a compound
comprising or consisting of an oligonucleotide at least a portion
of which is complementary to a target nucleic acid to which it is
capable of hybridizing, resulting in at least one antisense
activity.
[0082] As used herein, "antisense activity" means any detectable
and/or measurable change attributable to the hybridization of an
antisense compound to its target nucleic acid.
[0083] As used herein, "detecting" or "measuring" means that a test
or assay for detecting or measuring is performed. Such detection
and/or measuring may result in a value of zero. Thus, if a test for
detection or measuring results in a finding of no activity
(activity of zero), the step of detecting or measuring the activity
has nevertheless been performed.
[0084] As used herein, "detectable and/or measureable activity"
means a statistically significant activity that is not zero.
[0085] As used herein, "essentially unchanged" means little or no
change in a particular parameter, particularly relative to another
parameter which changes much more. In certain embodiments, a
parameter is essentially unchanged when it changes less than 5%. In
certain embodiments, a parameter is essentially unchanged if it
changes less than two-fold while another parameter changes at least
ten-fold. For example, in certain embodiments, an antisense
activity is a change in the amount of a target nucleic acid. In
certain such embodiments, the amount of a non-target nucleic acid
is essentially unchanged if it changes much less than the target
nucleic acid does, but the change need not be zero.
[0086] As used herein, "expression" means the process by which a
gene ultimately results in a protein. Expression includes, but is
not limited to, transcription, post-transcriptional modification
(e.g., splicing, polyadenlyation, addition of 5'-cap), and
translation.
[0087] As used herein, "target nucleic acid" means a nucleic acid
molecule to which an antisense compound hybridizes.
[0088] As used herein, "mRNA" means an RNA molecule that encodes a
protein.
[0089] As used herein, "pre-mRNA" means an RNA transcript that has
not been fully processed into mRNA. Pre-RNA includes one or more
intron.
[0090] As used herein, "object RNA" means an RNA molecule other
than a target RNA, the amount, activity, splicing, and/or function
of which is modulated, either directly or indirectly, by a target
nucleic acid. In certain embodiments, a target nucleic acid
modulates splicing of an object RNA. In certain such embodiments,
an antisense compound modulates the amount or activity of the
target nucleic acid, resulting in a change in the splicing of an
object RNA and ultimately resulting in a change in the activity or
function of the object RNA.
[0091] As used herein, "microRNA" means a naturally occurring,
small, non-coding RNA that represses gene expression of at least
one mRNA. In certain embodiments, a microRNA represses gene
expression by binding to a target site within a 3' untranslated
region of an mRNA. In certain embodiments, a microRNA has a
nucleobase sequence as set forth in miRBase, a database of
published microRNA sequences found at
http://microrna.sanger.ac.uk/sequences/. In certain embodiments, a
microRNA has a nucleobase sequence as set forth in miRBase version
18.0 released November 2011, which is herein incorporated by
reference in its entirety.
[0092] As used herein, "microRNA mimic" means an oligomeric
compound having a sequence that is at least partially identical to
that of a microRNA. In certain embodiments, a microRNA mimic
comprises the microRNA seed region of a microRNA. In certain
embodiments, a microRNA mimic modulates translation of more than
one target nucleic acids. In certain embodiments, a microRNA mimic
is double-stranded.
[0093] As used herein, "microRNA-associated protein" means a
protein that interacts directly with a microRNA. In certain
embodiments, a miroRNA-associated protein is Ago2. In certain
embodiments, a microRNA-associated protein is nucleolin. In certain
embodiments, a microRNA-associated protein is nucleophosmin.
[0094] As used herein, "competitive microRNA modulating compound"
means a compound capable of competively modulating the activity
and/or amount of at least one target microRNA in a cell, without
interacting directly with the target microRNA and instead by
interacting with a microRNA-associated protein. In certain
embodiments, a competitive microRNA modulating compound is an
oligomer. In certain embodiments, a competitive microRNA modulating
compound is an oligonucleotide. In certain embodiments, a
competitive microRNA modulating compound is single-stranded. In
certain embodiments, a competitive microRNA modulating compound is
double-stranded.
[0095] As used herein, "selective competitive microRNA modulating
compound" means a compound capable of competing for a
microRNA-associated protein by modulating the activity and/or
amount of at least one target microRNA in a cell and not capable of
modulating, or modulating to a substantially lower degree, the
amount and/or activity of at least one other (non-target) microRNA
in the cell and without interacting directly with the target
microRNA. In certain embodiments, a selective competitive microRNA
modulating compound is an oligomer. In certain embodiments, a
selective competitive microRNA modulating compound is an
oligonucleotide. In certain embodiments, a selective competitive
microRNA modulating compound is single-stranded. In certain
embodiments, a selective competitive microRNA modulating compound
is double-stranded.
[0096] As used herein, "broad competitive microRNA modulating
compound" means a compound capable of modulating the activity
and/or amount of more than one microRNA in a cell without
interacting directly with the target microRNAs. In certain
embodiments, a broad competitive microRNA modulating compound is
capable of modulating the activity and/or amount of more than two,
three, four or five microRNAs in a cell. In certain embodiments, a
broad competitive microRNA modulating compound is capable of
modulating the activity and/or amount of more than 50%, 60%, 70%,
or 80% of the total microRNAs in a cell. In certain embodiments, a
broad competitive microRNA modulating compound is an oligomer. In
certain embodiments, a broad competitive microRNA modulating
compound is an oligonucleotide. In certain embodiments, a broad
competitive microRNA modulating compound is single-stranded. In
certain embodiments, a broad competitive microRNA modulating
compound is double-stranded.
[0097] As used herein, "nucleobase complementarity" or
"complementarity" when in reference to nucleobases means a
nucleobase that is capable of base pairing with another nucleobase.
For example, in DNA, adenine (A) is complementary to thymine (T).
For example, in RNA, adenine (A) is complementary to uracil (U). In
certain embodiments, complementary nucleobase means a nucleobase of
an antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair. Nucleobases comprising
certain modifications may maintain the ability to pair with a
counterpart nucleobase and thus, are still capable of nucleobase
complementarity.
[0098] As used herein, "non-complementary" in reference to
nucleobases means a pair of nucleobases that do not form hydrogen
bonds with one another.
[0099] As used herein, "complementary" in reference to oligomeric
compounds (e.g., linked nucleosides, oligonucleotides, or nucleic
acids) means the capacity of such oligomeric compounds or regions
thereof to hybridize to another oligomeric compound or region
thereof through nucleobase complementarity under stringent
conditions. Complementary oligomeric compounds need not have
nucleobase complementarity at each nucleoside. Rather, some
mismatches are tolerated. In certain embodiments, complementary
oligomeric compounds or regions are complementary at 70% of the
nucleobases (70% complementary). In certain embodiments,
complementary oligomeric compounds or regions are 80%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 90% complementary. In certain embodiments,
complementary oligomeric compounds or regions are 95%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 100% complementary.
[0100] As used herein, "mismatch" means a nucleobase of a first
oligomeric compound that is not capable of pairing with a
nucleobase at a corresponding position of a second oligomeric
compound, when the first and second oligomeric compound are
aligned. Either or both of the first and second oligomeric
compounds may be oligonucleotides.
[0101] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid). While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleobases.
[0102] As used herein, "specifically hybridizes" means the ability
of an oligomeric compound to hybridize to one nucleic acid site
with greater affinity than it hybridizes to another nucleic acid
site. In certain embodiments, an antisense oligonucleotide
specifically hybridizes to more than one target site.
[0103] As used herein, "fully complementary" in reference to an
oligonucleotide or portion thereof means that each nucleobase of
the oligonucleotide or portion thereof is capable of pairing with a
nucleobase of a complementary nucleic acid or contiguous portion
thereof Thus, a fully complementary region comprises no mismatches
or unhybridized nucleobases in either strand.
[0104] As used herein, "percent complementarity" means the
percentage of nucleobases of an oligomeric compound that are
complementary to an equal-length portion of a target nucleic acid.
Percent complementarity is calculated by dividing the number of
nucleobases of the oligomeric compound that are complementary to
nucleobases at corresponding positions in the target nucleic acid
by the total length of the oligomeric compound.
[0105] As used herein, "percent identity" means the number of
nucleobases in a first nucleic acid that are the same type
(independent of chemical modification) as nucleobases at
corresponding positions in a second nucleic acid, divided by the
total number of nucleobases in the first nucleic acid.
[0106] As used herein, "modulation" means a change of amount or
quality of a molecule, function, or activity when compared to the
amount or quality of a molecule, function, or activity prior to
modulation. For example, modulation includes the change, either an
increase (stimulation or induction) or a decrease (inhibition or
reduction) in gene expression. As a further example, modulation of
expression can include a change in splice site selection of
pre-mRNA processing, resulting in a change in the absolute or
relative amount of a particular splice-variant compared to the
amount in the absence of modulation.
[0107] As used herein, "modification motif" means a pattern of
chemical modifications in an oligomeric compound or a region
thereof. Motifs may be defined by modifications at certain
nucleosides and/or at certain linking groups of an oligomeric
compound.
[0108] As used herein, "nucleoside motif" means a pattern of
nucleoside modifications in an oligomeric compound or a region
thereof. The linkages of such an oligomeric compound may be
modified or unmodified. Unless otherwise indicated, motifs herein
describing only nucleosides are intended to be nucleoside motifs.
Thus, in such instances, the linkages are not limited.
[0109] As used herein, "sugar motif" means a pattern of sugar
modifications in an oligomeric compound or a region thereof.
[0110] As used herein, "linkage motif" means a pattern of linkage
modifications in an oligomeric compound or region thereof. The
nucleosides of such an oligomeric compound may be modified or
unmodified. Unless otherwise indicated, motifs herein describing
only linkages are intended to be linkage motifs. Thus, in such
instances, the nucleosides are not limited.
[0111] As used herein, "nucleobase modification motif" means a
pattern of modifications to nucleobases along an oligonucleotide.
Unless otherwise indicated, a nucleobase modification motif is
independent of the nucleobase sequence.
[0112] As used herein, "sequence motif" means a pattern of
nucleobases arranged along an oligonucleotide or portion thereof.
Unless otherwise indicated, a sequence motif is independent of
chemical modifications and thus may have any combination of
chemical modifications, including no chemical modifications.
[0113] As used herein, "type of modification" in reference to a
nucleoside or a nucleoside of a "type" means the chemical
modification of a nucleoside and includes modified and unmodified
nucleosides. Accordingly, unless otherwise indicated, a "nucleoside
having a modification of a first type" may be an unmodified
nucleoside.
[0114] As used herein, "differently modified" mean chemical
modifications or chemical substituents that are different from one
another, including absence of modifications. Thus, for example, a
MOE nucleoside and an unmodified DNA nucleoside are "differently
modified," even though the DNA nucleoside is unmodified. Likewise,
DNA and RNA are "differently modified," even though both are
naturally-occurring unmodified nucleosides. Nucleosides that are
the same but for comprising different nucleobases are not
differently modified. For example, a nucleoside comprising a 2'-OMe
modified sugar and an unmodified adenine nucleobase and a
nucleoside comprising a 2'-OMe modified sugar and an unmodified
thymine nucleobase are not differently modified.
[0115] As used herein, "the same type of modifications" refers to
modifications that are the same as one another, including absence
of modifications. Thus, for example, two unmodified DNA nucleoside
have "the same type of modification," even though the DNA
nucleoside is unmodified. Such nucleosides having the same type
modification may comprise different nucleobases.
[0116] As used herein, "pharmaceutically acceptable carrier or
diluent" means any substance suitable for use in administering to
an animal. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile saline. In certain embodiments, such
sterile saline is pharmaceutical grade saline.
[0117] As used herein, "substituent" and "substituent group," means
an atom or group that replaces the atom or group of a named parent
compound. For example a substituent of a modified nucleoside is any
atom or group that differs from the atom or group found in a
naturally occurring nucleoside (e.g., a modified 2'-substuent is
any atom or group at the 2'-position of a nucleoside other than H
or OH). Substituent groups can be protected or unprotected. In
certain embodiments, compounds of the present invention have
substituents at one or at more than one position of the parent
compound. Substituents may also be further substituted with other
substituent groups and may be attached directly or via a linking
group such as an alkyl or hydrocarbyl group to a parent
compound.
[0118] Likewise, as used herein, "substituent" in reference to a
chemical functional group means an atom or group of atoms differs
from the atom or a group of atoms normally present in the named
functional group. In certain embodiments, a substituent replaces a
hydrogen atom of the functional group (e.g., in certain
embodiments, the substituent of a substituted methyl group is an
atom or group other than hydrogen which replaces one of the
hydrogen atoms of an unsubstituted methyl group). Unless otherwise
indicated, groups amenable for use as substituents include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl,
aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino
(--N(R.sub.bb)(R.sub.cc)), imino(.dbd.NR.sub.bb), amido
(--C(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)OR.sub.aa),
ureido (--N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido
(--N(R.sub.bb)C(S)N(R.sub.bb)--(R.sub.cc)), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl
(--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb),
sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and
sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)S--(O).sub.2Rbb). Wherein each R.sub.aa, R.sub.bb and
R.sub.cc is, independently, H, an optionally linked chemical
functional group or a further substituent group with a preferred
list including without limitation, alkyl, alkenyl, alkynyl,
aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic,
heterocyclic and heteroarylalkyl. Selected substituents within the
compounds described herein are present to a recursive degree.
[0119] As used herein, "alkyl," as used herein, means a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include without
limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred.
[0120] As used herein, "alkenyl," means a straight or branched
hydrocarbon chain radical containing up to twenty four carbon atoms
and having at least one carbon-carbon double bond. Examples of
alkenyl groups include without limitation, ethenyl, propenyl,
butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and
the like. Alkenyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkenyl groups
as used herein may optionally include one or more further
substituent groups.
[0121] As used herein, "alkynyl," means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms and
having at least one carbon-carbon triple bond. Examples of alkynyl
groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl,
and the like. Alkynyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkynyl groups
as used herein may optionally include one or more further
substituent groups.
[0122] As used herein, "acyl," means a radical formed by removal of
a hydroxyl group from an organic acid and has the general Formula
--C(O)--X where X is typically aliphatic, alicyclic or aromatic.
Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic
sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic
phosphates, aliphatic phosphates and the like. Acyl groups as used
herein may optionally include further substituent groups.
[0123] As used herein, "alicyclic" means a cyclic ring system
wherein the ring is aliphatic. The ring system can comprise one or
more rings wherein at least one ring is aliphatic. Preferred
alicyclics include rings having from about 5 to about 9 carbon
atoms in the ring. Alicyclic as used herein may optionally include
further substituent groups.
[0124] As used herein, "aliphatic" means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms
wherein the saturation between any two carbon atoms is a single,
double or triple bond. An aliphatic group preferably contains from
1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms with from 1 to about 6 carbon atoms being more
preferred. The straight or branched chain of an aliphatic group may
be interrupted with one or more heteroatoms that include nitrogen,
oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by
heteroatoms include without limitation, polyalkoxys, such as
polyalkylene glycols, polyamines, and polyimines. Aliphatic groups
as used herein may optionally include further substituent
groups.
[0125] As used herein, "alkoxy" means a radical formed between an
alkyl group and an oxygen atom wherein the oxygen atom is used to
attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include without limitation, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substituent groups.
[0126] As used herein, "aminoalkyl" means an amino substituted
C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical
forms a covalent bond with a parent molecule. The amino group can
be located at any position and the aminoalkyl group can be
substituted with a further substituent group at the alkyl and/or
amino portions.
[0127] As used herein, "aralkyl" and "arylalkyl" mean an aromatic
group that is covalently linked to a C.sub.1-C.sub.12 alkyl
radical. The alkyl radical portion of the resulting aralkyl (or
arylalkyl) group forms a covalent bond with a parent molecule.
Examples include without limitation, benzyl, phenethyl and the
like. Aralkyl groups as used herein may optionally include further
substituent groups attached to the alkyl, the aryl or both groups
that form the radical group.
[0128] As used herein, "aryl" and "aromatic" mean a mono- or
polycyclic carbocyclic ring system radicals having one or more
aromatic rings. Examples of aryl groups include without limitation,
phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
Preferred aryl ring systems have from about 5 to about 20 carbon
atoms in one or more rings. Aryl groups as used herein may
optionally include further substituent groups.
[0129] As used herein, "halo" and "halogen," mean an atom selected
from fluorine, chlorine, bromine and iodine.
[0130] As used herein, "heteroaryl," and "heteroaromatic," mean a
radical comprising a mono- or poly-cyclic aromatic ring, ring
system or fused ring system wherein at least one of the rings is
aromatic and includes one or more heteroatoms. Heteroaryl is also
meant to include fused ring systems including systems where one or
more of the fused rings contain no heteroatoms. Heteroaryl groups
typically include one ring atom selected from sulfur, nitrogen or
oxygen. Examples of heteroaryl groups include without limitation,
pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl,
thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl,
thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl,
benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can
be attached to a parent molecule directly or through a linking
moiety such as an aliphatic group or hetero atom. Heteroaryl groups
as used herein may optionally include further substituent
groups.
B. RNA Interference
[0131] RNA interference (RNAi) is a process by which
double-stranded (dsRNA) triggers specific degradation of homologous
mRNAs. RNAi is mediated by small interfering RNAs (siRNAs), 21-24
nts double stranded RNAs (dsRNAs) that are either transfected as in
vitro synthesized form, or expressed in cells as long dsRNAs or
small hairpin RNAs (shRNAs) that are processed into siRNAs using
endogenous proteins including Dicer. The double stranded siRNAs are
incorporated into the RNA induced silencing complex (RISC), which
includes Ago2. The passenger strand siRNA is then released, and the
guide strand siRNA remains associated with Ago2 and directs the
RISC to substrate mRNA, which is cleaved by Ago2, resulting in
sequence-specific mRNA cleavage through perfect base-pairing of
siRNAs with target mRNAs.
[0132] MicroRNAs are endogenously expressed small RNAs that mainly
function in regulating gene expression through imperfect
base-pairing with target mRNAs, either by inhibiting target mRNA
translation or by modulating mRNA stability. Since microRNA:mRNA
base-pairing involves only short seed sequence, a single microRNA
can target multiple microRNAs and a single mRNA can be targeted by
multiple microRNAs, making a huge, complex microRNA regulation
network. Indeed, it was proposed that more than half of the human
genes can be targeted by microRNAs. siRNA and microRNAs utilize
overlapping cellular machinery for biogenesis and function. For
example, both siRNA and microRNA associate with Ago2 protein in
mammals, the core component of the RISC complex. It has been
demonstrated that siRNA and microRNAs can be functionally
inter-changeable by altering the base-pairing patterns with mRNA
targets. Thus, siRNA can lead to mis-regulation of other non-target
genes by functioning as microRNAs through imperfect base-pairing,
or by inducing non-specific mRNA cleavage via near-perfect
base-pairing, leading to RISC dependent off-target effects. Thus,
RNAi is commonly used as a convenient tool for gene
functionalization in different model systems.
C. Competitive MicroRNA Modulation and Assays
[0133] In certain embodiments, the present invention provides
compounds and methods for competitive microRNA modulation. In
certain embodiments, the invention provides methods for identifying
compounds that modulate the amount and/or activity of one or more
microRNA in a cell. In certain instances, microRNAs interact with
proteins (microRNA-associated proteins). Such protein interactions
result in microRNA activity or in microRNA inactivation,
degradation, or export. Compounds that compete with microRNAs for
such proteins can modulate the activity and/or amount of one or
more microRNA in a cell.
[0134] MicroRNAs interact with various microRNA-associated
proteins. For example, microRNAs interact with members of the RISC
(RNA-induced silencing complex) pathway to suppress translation of
one or more messenger RNAs ("object mRNAs"). Ago2 (also known in
the art as Argonaute 2 and EIF2C2) is an essential protein of the
RISC pathway. In certain instances, Ago2 binds to a microRNA, which
in turn hybridizes with a region of an object mRNA that is at least
partially complementary to a portion of the microRNA. Formation of
an Ago2/microRNA/mRNA complex typically results in reduced or
suppressed translation of the object mRNA and thus reduction of the
protein encoded by the mRNA ("object protein"). Certain other
proteins have been shown or suggested to be involved in
inactivation, degradation, and/or export of microRNAs. Such
proteins include, but are not limited to nucleophosmin and
nucleolin. It has been shown that XRN2, the orthologue of the yeast
5'.fwdarw.3' exoribonuclease Rat1p, is involved in RNA processing
and degradation. XRN2 mediates miRNA turn over in nematodes, and
that degradation of miRNAs can affect functional miRNA homeostasis.
For example, in XRN-2-dependent miRNA turnover in larval lysates.
Although Argonaute:miRNA complexes are highly resistant to salt,
larval lysate promotes efficient release of the miRNA, exposing it
to degradation by XRN-2 (Chatterjee et al., Nature, 2009, 461,
546-549). Disruption of these interactions between microRNAs and
microRNA-associated proteins alters the activity and/or amount of
microRNAs.
[0135] In certain embodiments, competitive microRNA modulators
compete with one or more microRNA for binding with at least one
microRNA-associated protein. In certain embodiments, competitive
microRNA modulators compete with one or more microRNA for Ago2
binding. Such competition results in a reduction in the activity of
the microRNA, which leads to de-repression of object mRNA and thus,
an increase in expression of object protein. In certain
embodiments, the invention provides methods of identifying such
competitive microRNA modulators by performing a competition assay
using a test compound, a microRNA and Ago2. In certain embodiments,
competitive microRNA modulators compete with one or more microRNA
for binding with at least one microRNA-associated protein
responsible for degradation or export of a microRNA. Such
competition results in a decrease in microRNA inactivation,
degradation and/or export from the cell. Consequently, microRNA
activity will increase and expression of object protein will
decrease.
[0136] Certain compounds that bind to directly to microRNAs to
modulate their activity have been reported. For example, antisense
oligonucleotides complementary to a particular target microRNA have
been demonstrated to reduce the amount or activity of that target
microRNA, resulting in de-repression (increase) in expression of
object mRNA otherwise suppressed by that target microRNA. In
certain instances, such target microRNA have multiple object mRNA
and object proteins. Modulation of a single microRNA, for example
by antisense oligonucleotides, has been shown to modulate
expression of multiple object proteins.
[0137] Certain of the present methods and compounds differ from
previously reported anti-microRNA antisense oligonucleotides that
specifically hybridize with a particular target microRNA. Certain
embodiments of the present invention focus instead on compounds
that compete with microRNAs for their associated proteins. In
certain embodiments, the invention provides methods for identifying
compounds that bind to Ago2 to block or displace binding by one or
more microRNA. Since the Ago2/microRNA association is necessary for
microRNA mediated activity, compounds that compete with a microRNA
for Ago2 reduce such activity of the microRNA. Such compounds
capable of competing with microRNAs for Ago2 (competitive microRNA
modulators) may have any of a variety of structures. For example,
in certain embodiments, competitive microRNA modulators are
selected from small molecules and oligomeric compounds, including,
but not limited to single- or double-stranded oligonucleotides.
Competitive microRNA modulators that are oligomers may also have
antisense activity. For example, a double-stranded oligonucleotide
may have the duel functions of competing with microRNAs for Ago2
and, by virtue of its nucleobase sequence, may also have antisense
activity (e.g., may be an siRNA), and thus directly silences
expression of a target nucleic acid as well. In certain
embodiments, competitive microRNA modulators are not complementary
to a target mRNA and thus, do not have siRNA activity.
[0138] In certain embodiments, competition assays are employed for
identifying completive microRNA modulators. Such assays are
designed to determine whether a test compound is capable of
competing with at least one microRNA for a microRNA-associated
protein.
[0139] In certain embodiments, assays are performed to determine
the ability of a test compound to compete with a microRNA for
binding to a microRNA-associated protein (e.g., Ago2). In certain
such embodiments, the ability to compete is assessed in a cell. For
example, in certain such embodiments, a test compound is contacted
with a cell to allow it to interact with a microRNA-associated
protein inside the cell; the microRNA-associated protein is then
precipitated from the cell and binding of the test compound with
the microRNA-associated protein is assessed. In certain
embodiments, the ability of a test compound to compete with a
microRNA for a microRNA-associated protein is assessed in a
cell-free assay. In certain such embodiments, a microRNA-associated
protein is contacted with a test compound in the presence of at
least one microRNA. In certain embodiments, the concentrations of
the test compound, the microRNA, and/or the microRNA-associated
protein are varied.
[0140] In certain such embodiments, (1) cells or
microRNA-associated protein is placed in a multiwell plate; (2) one
or more microRNAs is added to each well at the same concentration
per well; (3) a test compound is added to each of several wells,
typically at several different concentrations; and (4)
microRNA-associated protein activity or binding of either the
microRNA or the test compound or both is detected and/or measured.
Such assays are useful for assessing the relative binding of the
test compound compared to the one or more microRNA. In certain
embodiments, the concentration of the one or more microRNA is
varied and the concentration of the test compound is the same for
each well. One of ordinary skill in the art will readily appreciate
that these components can be manipulated in a variety of ways.
Certain competition assays have been described previously. See
e.g., Koller et al., Nucleic Acid Research, 34:16, 4467-4476
(2006), which is hereby incorporated by reference in its
entirety.
[0141] In certain embodiments, the test compound is a small
molecule. In certain embodiments, the test compound is an
oligomeric compound. In certain embodiments, the test compound
comprises an oligonucleotide. In certain embodiments, the test
compound comprises a single-stranded oligonucleotide. In certain
embodiments, the test compound comprises a double-stranded
oligonucleotide. In certain embodiments, the test compound
comprises a single- or double-stranded oligonucleotide and at least
one conjugate. In certain embodiments, the test compound comprises
an antisense oligonucleotide.
[0142] In certain embodiments, the microRNA-associated protein is a
RISC protein. In certain embodiments, the microRNA-associated
protein is an Ago protein. In certain embodiments, the microRNA
associate protein is Ago2. In certain embodiments, the certain
embodiments, the microRNA-associated protein is a protein that
reduced the activity or amount of a microRNA in a cell. In certain
embodiments, the microRNA-associated protein degrades microRNAs. In
certain embodiments, the microRNA-associated protein exports
microRNAs from the cell. In certain embodiments, the
microRNA-associated protein is nucleolin. In certain embodiments,
the microRNA-associated protein is nucleophosmin.
[0143] In certain embodiments, the microRNA is any natural
microRNA. In certain embodiments, more than one microRNA is tested.
In certain embodiments, a library of microRNAs is tested. In
certain embodiments, synthetic microRNA is tested.
[0144] In certain embodiments, competition assays are conducted to
determine whether a test compound is capable of competing with a
single microRNA for a protein associated protein. In certain
embodiments, a test compound is tested for its ability to compete
with more than one different microRNA. Thus, assays may be
performed to identify a selective competitive microRNA modulator,
which competes with one or more microRNA to a greater extent than
it competes with one or more other microRNA. In certain instances,
a selective competitive microRNA modulator competes or displaces
one microRNA, but fails to compete with another microRNA. This may
be due to differing affinities or binding characteristics among
different microRNAs for the microRNA-associated protein. Since such
selective competitive microRNA modulators modulate one or more
microRNA more than at least one other microRNA, they have specific
uses. In certain instances, a selective competitive microRNA
modulator is capable of modulating a single microRNA to a greater
degree than it modulates any other microRNA.
[0145] In certain embodiments, assays are used to identify broad
competitive microRNA modulators. In certain embodiments, broad
competitive microRNA modulators are capable of competing with more
than one microRNA. In certain embodiments, broad competitive
microRNA modulators are capable of competing with at least half of
the natural microRNAs. In certain embodiments, broad competitive
microRNA modulators are capable of competing with essential all
microRNAs. In certain embodiments, broad competitive microRNA
modulators are capable of competing with all microRNAs. Such broad
competitive microRNA modulators alter the "miR tone," or overall
microRNA activity in a cell. Because microRNAs are involved in
regulation of expression of many object proteins, broad competitive
microRNA modulators are expected to have profound consequences in
cells.
[0146] Certain microRNAs are known to regulate several object mRNAs
and in some cases hundreds of object mRNAs. Inhibiting the activity
of a single microRNA can lead to detectable changes in expression
of many of such object mRNAs. Provided herein are methods for
modulating multiple microRNA targets, wherein broad gene expression
changes occur. In certain embodiments, one may detect competitive
microRNA modulation indirectly by assessing changes in one or more
object mRNA or protein or even further indirectly by measuring a
consequence of the change in the amount of one or more object
mRNAs. For example, in certain instances, a compound capable of
competing with miR133, 331, 339, 532, and/or 615 for Ago2 results
in a decrease in the activity of those microRNAs. That decrease in
microRNA activity de-represses (and thus, increases) expression of
several transcripts, including the protease granzyme B, which in
turn is responsible for, among other things, degrading
.alpha.-tubulin. Thus, in certain embodiments, competition of a
test compound may assessed by contacting a cell with the test
compound and assessing any of: binding of the test compound to
Ago2; decrease in binding of miR133, 331, 339, 532, and/or 615 to
Ago2, increase in granzyme B expression, or decrease in
.alpha.-tubulin level in the cell. Compounds identified by such
methods are useful for increasing granzyme B and/or reducing
.alpha.-tubulin in a cell. Since .alpha.-tubulin is important for
many cellular functions, such compounds may be used in certain
embodiments to reduce cell viability, for example in cancer
treatment.
[0147] MicroRNAs are found to be associated with a variety of
diseases. In certain embodiments, the microRNA is associated with a
disease, and provided herein are methods for modulating the disease
comprising administering a competitive microRNA modulator described
herein to an individual having the disease. In certain embodiments,
the methods comprise treating the disease. In certain embodiments,
the methods comprise preventing the disease. In certain
embodiments, the methods comprise delaying the onset of the
disease.
D. Certain Competitive MicroRNA Modulators
[0148] In certain embodiments, the present invention provides
methods of predicting or assessing the ability of a test compound
to modulate microRNA activity by competing with the microRNA for a
microRNA-associated protein. Such methods may be performed using
any molecule suspected of having the ability to compete (a test
compound or test competitive microRNA modulator). In certain
embodiments, the test compound may be a synthetic small molecule or
a peptide. In certain embodiments, test compounds are oligomeric
compounds, such as oligonucleotides. Such oligonucleotides may be
single stranded or they may be double stranded. In certain
embodiments, such oligonucleotides comprise one or more
modifications. In certain embodiments, competitive microRNA
modulators are double-stranded oligonucleotides comprising at least
one modified nucleoside, wherein essentially each nucleoside is RNA
or RNA-like.
[0149] Since the activity of competitive microRNA modulators
derives from their ability to competitively bind to a
microRNA-associated protein, and does not necessarily derive from
hybridization to a target nucleic acid, competitive microRNA
modulators that are oligonucleotides may have any nucleobase
sequence. It is expected that different nucleobase sequences result
in differing competitive activity. Accordingly, in certain
embodiments, the nucleobase sequence of a competitive microRNA
modulator is selected for its ability to compete for a
microRNA-associated protein. In certain embodiments, a competitive
microRNA modulator is also an antisense compound--that is, it has a
nucleobase sequence that is complementary to a target nucleic acid.
Such compounds may have duel activity of modulating a target
nucleic acid through antisense and modulating one or more microRNA
activity through competitive binding of a microRNA-associated
protein. In certain embodiments, a competitive microRNA modulator
that is also an antisense compound is single stranded. In certain
embodiments, a competitive microRNA modulator that is also an
antisense compound is double stranded. In certain embodiments, a
competitive microRNA modulator that is also an antisense compound
is an RNAi agent (uses the RISC mechanism). In certain embodiments,
a competitive microRNA modulator that is also an antisense compound
is an siRNA.
[0150] a. Oligomeric Compounds
[0151] In certain embodiments, competitive microRNA modulators are
oligomeric compounds. In certain embodiments, such oligomeric
compounds comprise oligonucleotides optionally comprising one or
more conjugate and/or terminal groups. In certain embodiments, an
oligomeric compound consists of an oligonucleotide. In certain
embodiments, oligonucleotides comprise one or more chemical
modifications. Such chemical modifications include modifications of
one or more nucleoside (including modifications to the sugar moiety
and/or the nucleobase) and/or modifications to one or more
internucleoside linkage.
[0152] i. Certain Modified Nucleosides
[0153] In certain embodiments, provided herein are oligomeric
compounds comprising or consisting of oligonuleotides comprising at
least one modified nucleoside. Such modified nucleosides comprise a
modified sugar moeity, a modified nucleobase, or both a modifed
sugar moiety and a modified nucleobase.
[0154] 1. Certain Modified Sugar Moieties
[0155] In certain embodiments, competitive microRNA modulators
comprise oligomeric compounds comprising one or more modifed
nucleosides comprising a modifed sugar moiety. Such compounds
comprising one or more sugar-modified nucleosides may have
desirable properties, such as enhanced nuclease stability or
increased binding affinity with a target nucleic acid relative to
an oligonucleotide comprising only nucleosides comprising naturally
occurring sugar moieties. In certain embodiments, modified sugar
moieties are substitued sugar moieties. In certain embodiments,
modified sugar moieties are sugar surrogates. Such sugar surogates
may comprise one or more substitutions corresponding to those of
substituted sugar moieties.
[0156] In certain embodiments, modified sugar moieties are
substituted sugar moieties comprising one or more non-bridging
sugar substituent, including but not limited to substituents at the
2' and/or 5' positions. Examples of sugar substituents suitable for
the 2'-position, include, but are not limited to: 2'-F,
2'-OCH.sub.3 ("OMe" or "O-methyl"), and
2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments,
sugar substituents at the 2' position is selected from allyl,
amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl,
O--C.sub.1-C.sub.10 substituted alkyl; OCF3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2--O N(Rm)(Rn), and
O--CH.sub.2--C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is,
independently, H or substituted or unsubstituted C.sub.1-C.sub.10
alkyl. Examples of sugar substituents at the 5'-position, include,
but are not limited to:, 5'-methyl (R or S); 5'-vinyl, and
5'-methoxy. In certain embodiments, substituted sugars comprise
more than one non-bridging sugar substituent, for example,
2'-F-5'-methyl sugar moieties (see,e.g., PCT International
Application WO 2008/101157, for additional 5', 2'-bis substituted
sugar moieties and nucleosides).
[0157] Nucleosides comprising 2'-substituted sugar moieties are
referred to as 2'-substituted nucleosides. In certain embodiments,
a 2'-substituted nucleoside comprises a 2'-substituent group
selected from halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3,
OCF.sub.3, O, S, or N(R.sub.m)-alkyl; O, S, or N(R.sub.m)-alkenyl;
O, S or N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl,
aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0158] In certain embodiments, a 2'- substituted nucleoside
comprises a 2'-substituent group selected from F, NH.sub.2,
N.sub.3, OCF.sub.3, O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2,
CH.sub.2--CH.dbd.CH.sub.2, O--CH.sub.2--CH.dbd.CH.sub.2,
OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0159] Certain modifed sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
Examples of such 4' to 2' sugar substituents, include, but are not
limited to: --[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--; 4'- CH.sub.2-2',
4'--(CH.sub.2).sub.2-2',
4'--(CH.sub.2).sub.3-2',4'-(CH.sub.2)--O-2' (LNA);
4'--(CH.sub.2)--S-2; 4'-(CH.sub.2).sub.2--O-2' (ENA);
4'-CH(CH.sub.3)--O-2' (cEt) and 4'-CH(CH.sub.2OCH.sub.3)--O-2', and
analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul.
15, 2008); 4'-C(CH.sub.3)(CH.sub.3)--O-2'and analogs thereof, (see,
e.g., WO2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
WO2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2--N(R)--O-2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008).
[0160] In certain embodiments, such 4' to 2' bridges independently
comprise from 1 to 4 linked groups independently selected from
--[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--;
[0161] wherein:
[0162] x is 0, 1, or 2;
[0163] n is 1, 2, 3, or 4;
[0164] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0165] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.5-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0166] Nucleosides comprising bicyclic sugar moieties are referred
to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include,
but are not limited to, (A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA (also referred to as locked nucleic acid or
LNA), (C) Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt), (G) methylene-thio (4'-CH.sub.2--S-2') BNA, (H)
methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl carbocyclic
(4'-CH.sub.2--CH(CH.sub.3)-2') BNA, (J) propylene carbocyclic
(4'-(CH.sub.2).sub.3-2') BNA, and (K) Ethylene(methoxy)
(4'-(CH(CH.sub.2OMe)--O-2') BNA (also referred to as constrained
MOE or cMOE) as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0167] Additional bicyclic sugar moieties are known in the art, for
example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et
al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.
Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem.,
1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,
129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion
Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001,
8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243;
U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499,
7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO
1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent
Publication Nos. US2004/0171570, US2007/0287831, and
US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574,
61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and
61/099,844; and PCT International Applications Nos.
PCT/US2008/064591, PCT/U52008/066154, and PCT/US2008/068922.
[0168] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the (3-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') bicyclic nucleosides
have been incorporated into antisense oligonucleotides that showed
antisense activity (Frieden et al., Nucleic Acids Research, 2003,
21, 6365-6372).
[0169] In certain embodiments, substituted sugar moieties comprise
one or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars).
(see, PCT International Application WO 2007/134181, published on
11/22/07, wherein LNA is substituted with, for example, a 5'-methyl
or a 5'-vinyl group).
[0170] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
naturally occuring sugar is substituted, e.g., with a sulfer,
carbon or nitrogen atom. In certain such embodiments, such modified
sugar moiety also comprises bridging and/or non-bridging
substituents as described above. For example, certain sugar
surogates comprise a 4'-sulfer atom and a substitution at the
2'-position (see,e.g., published U.S. Patent Application
US2005/0130923, published on Jun. 16, 2005) and/or the 5' position.
By way of additional example, carbocyclic bicyclic nucleosides
having a 4'-2' bridge have been described (see, e.g., Freier et
al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et
al., J. Org. Chem., 2006, 71, 7731-7740).
[0171] In certain embodiments, sugar surrogates comprise rings
having other than 5-atoms. For example, in certain embodiments, a
sugar surrogate comprises a six-membered tetrahydropyran. Such
tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include, but
are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid
(ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. &
Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA).
[0172] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see, e.g., review
article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002,
10, 841-854).
[0173] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 Published on Aug. 21, 2008
for other disclosed 5',2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0174] In certain embodiments, the present invention provides
oligonucleotides comprising modified nucleosides. Those modified
nucleotides may include modified sugars, modified nucleobases,
and/or modified linkages. The specific modifications are selected
such that the resulting oligonucleotides possess desireable
characteristics. In certain embodmiments, oligonucleotides comprise
one or more RNA-like nucleosides. In certain embodiments,
oligonucleotides comprise one or more DNA-like nucleotides.
[0175] 2. Certain Modified Nucleobases
[0176] In certain embodiments, nucleosides of the present invention
comprise one or more unmodified nucleobases. In certain
embodiments, nucleosides of the present invention comprise one or
more modifed nucleobases.
[0177] In certain embodiments, modified nucleobases are selected
from: universal bases, hydrophobic bases, promiscuous bases,
size-expanded bases, and fluorinated bases as defined herein.
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl CH.sub.3)
uracil and cytosine and other alkynyl derivatives of pyrimidine
bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and
other 8-substituted adenines and guanines, 5-halo particularly
5-bromo, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine,
2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases,
hydrophobic bases, promiscuous bases, size-expanded bases, and
fluorinated bases as defined herein. Further modified nucleobases
include tricyclic pyrimidines such as phenoxazine
cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, Kroschwitz, J. I., Ed., John Wiley &
Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613; and those disclosed
by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0178] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include without limitation, U.S.
Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908;
5,502,177;
[0179] 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091;
5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653
and 6,005,096, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0180] ii. Certain Internucleoside Linkages
[0181] In certain embodiments, nucleosides may be linked together
using any internucleoside linkage to form oligonucleotides. The two
main classes of internucleoside linking groups are defined by the
presence or absence of a phosphorus atom. Representative phosphorus
containing internucleoside linkages include, but are not limited
to, phosphodiesters (P.dbd.O), phosphotriesters,
methylphosphonates, phosphoramidate, and phosphorothioates
(P.dbd.S). Representative non-phosphorus containing internucleoside
linking groups include, but are not limited to,
methylenemethylimino (--CH.sub.2--N(CH.sub.3)--)--CH.sub.2--),
thiodiester (--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--);
siloxane (--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified linkages,
compared to natural phosphodiester linkages, can be used to alter,
typically increase, nuclease resistance of the oligonucleotide. In
certain embodiments, intemucleoside linkages having a chiral atom
can be prepared as a racemic mixture, or as separate enantiomers.
Representative chiral linkages include, but are not limited to,
alkylphosphonates and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing
internucleoside linkages are well known to those skilled in the
art.
[0182] The oligonucleotides described herein contain one or more
asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S),
.alpha. or .beta. such as for sugar anomers, or as (D) or (L) such
as for amino acids etc. Included in the antisense compounds
provided herein are all such possible isomers, as well as their
racemic and optically pure forms.
[0183] Neutral internucleoside linkages include without limitation,
phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), and thioformacetal (3'-S--CH.sub.2--O-5').
Further neutral internucleoside linkages include nonionic linkages
comprising siloxane (dialkylsiloxane), carboxylate ester,
carboxamide, sulfide, sulfonate ester and amides (See for example:
Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and
P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4,
40-65). Further neutral internucleoside linkages include nonionic
linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0184] b. Certain Overall Lengths
[0185] In certain embodiments, the present invention provides
oligomeric compounds including oligonucleotides of any of a variety
of ranges of lengths. In certain embodiments, the invention
provides oligomeric compounds or oligonucleotides consisting of X
to Y linked nucleosides, where X represents the fewest number of
nucleosides in the range and Y represents the largest number of
nucleosides in the range. In certain such embodiments, X and Y are
each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and
50; provided that X.ltoreq.Y. For example, in certain embodiments,
the invention provides oligomeric compounds which comprise
oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8
to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to
20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27,
8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to
14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21,
9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to
29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10
to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22,
10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to
29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16,
11to 17, 11to18, 11to19, 11to 20, 11to21, 11to 22, 11to 23, 11to
24, 11to 25, 11 to 26, 11to 27, 11 to 28, 11 to 29, 11 to 30, 12 to
13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12
to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26,
12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to
16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13
to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29,
13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to
20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14
to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18,
15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to
25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16
to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24,
16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to
18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17
to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19,
18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to
26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19
to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28,
19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to
25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21
to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29,
21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to
28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23
to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28,
24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to
30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27
to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In
embodiments where the number of nucleosides of an oligomeric
compound or oligonucleotide is limited, whether to a range or to a
specific number, the oligomeric compound or oligonucleotide may,
nonetheless further comprise additional other substituents. For
example, an oligonucleotide comprising 8-30 nucleosides excludes
oligonucleotides having 31 nucleosides, but, unless otherwise
indicated, such an oligonucleotide may further comprise, for
example one or more conjugates, terminal groups, or other
substituents. In certain embodiments, a gapmer oligonucleotide has
any of the above lengths.
[0186] Further, where an oligonucleotide is described by an overall
length range and by regions having specified lengths, and where the
sum of specified lengths of the regions is less than the upper
limit of the overall length range, the oligonucleotide may have
additional nucleosides, beyond those of the specified regions,
provided that the total number of nucleosides does not exceed the
upper limit of the overall length range.
[0187] c. Certain Conjugate Groups
[0188] In certain embodiments, competitive microRNA modulators are
oligomeric compounds that are modified by attachment of one or more
conjugate groups. In general, conjugate groups modify one or more
properties of the attached oligomeric compound including but not
limited to pharmacodynamics, pharmacokinetics, stability, binding,
absorption, cellular distribution, cellular uptake, charge and
clearance. Conjugate groups are routinely used in the chemical arts
and are linked directly or via an optional conjugate linking moiety
or conjugate linking group to a parent compound such as an
oligomeric compound, such as an oligonucleotide. Conjugate groups
includes without limitation, intercalators, reporter molecules,
polyamines, polyamides, polyethylene glycols, thioethers,
polyethers, cholesterols, thiocholesterols, cholic acid moieties,
folate, lipids, phospholipids, biotin, phenazine, phenanthridine,
anthraquinone, adamantane, acridine, fluoresceins, rhodamines,
coumarins and dyes. Certain conjugate groups have been described
previously, for example: cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
[0189] (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4,
1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et
al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al.,
Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an
aliphatic chain, e.g., do-decan-diol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et
al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et
al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a
polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969-973), or adamantane acetic acid
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a
palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264,
229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0190] In certain embodiments, a conjugate group comprises an
active drug substance, for example, aspirin, warfarin, phenylbu
a7one, ibuprofen, suprofen, fen-bufen, ketoprofen,
(S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic.
[0191] In certain embodiments, conjugate groups are directly
attached to oligonucleotides in oligomeric compounds. In certain
embodiments, conjugate groups are attached to oligonucleotides by a
conjugate linking group. In certain such embodiments, conjugate
linking groups, including, but not limited to, bifunctional linking
moieties such as those known in the art are amenable to the
compounds provided herein. Conjugate linking groups are useful for
attachment of conjugate groups, such as chemical stabilizing
groups, functional groups, reporter groups and other groups to
selective sites in a parent compound such as for example an
oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the conjugate linker comprises a chain
structure or an oligomer of repeating units such as ethylene glycol
or amino acid units. Examples of functional groups that are
routinely used in a bifunctional linking moiety include, but are
not limited to, electrophiles for reacting with nucleophilic groups
and nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like.
[0192] Some nonlimiting examples of conjugate linking moieties
include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a
nonlimiting list of preferred substituent groups includes hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
halogen, alkyl, aryl, alkenyl and alkynyl.
[0193] Conjugate groups may be attached to either or both ends of
an oligonucleotide (terminal conjugate groups) and/or at any
internal position.
[0194] In certain embodiments, conjugate groups are at the 3'-end
of an oligonucleotide of an oligomeric compound. In certain
embodiments, conjugate groups are near the 3'-end. In certain
embodiments, conjugates are attached at the 3'end of an oligomeric
compound, but before one or more terminal group nucleosides. In
certain embodiments, conjugate groups are placed within a terminal
group. In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, oligomeric compounds
comprise an oligonucleotide. In certain embodiments, an oligomeric
compound comprises an oligonucleotide and one or more conjugate
and/or terminal groups. Such conjugate and/or terminal groups may
be added to oligonucleotides having any of the motifs discussed
above. Thus, for example, an oligomeric compound comprising an
oligonucleotide having region of alternating nucleosides may
comprise a terminal group.
[0195] h. Compositions and Methods for Formulating Pharmaceutical
Compositions
[0196] Oligomeric compounds may be mixed with pharmaceutically
acceptable active and/or inert substances for the preparation of
pharmaceutical compositions or formulations. Compositions and
methods for the formulation of pharmaceutical compositions are
dependent upon a number of criteria, including, but not limited to,
route of administration, extent of disease, or dose to be
administered.
[0197] Oligomeric compounds, including siRNAs, can be utilized in
pharmaceutical compositions by combining such oligomeric compounds
with a suitable pharmaceutically acceptable diluent or carrier. A
pharmaceutically acceptable diluent includes phosphate-buffered
saline (PBS). PBS is a diluent suitable for use in compositions to
be delivered parenterally. Accordingly, in certain embodiments,
employed in the methods described herein is a pharmaceutical
composition comprising an siRNA compound and a pharmaceutically
acceptable diluent. In certain embodiments, the pharmaceutically
acceptable diluent is PBS.
[0198] Pharmaceutical compositions comprising oligomeric compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising oligomeric compounds comprise one or more
oligonucleotide which, upon administration to an animal, including
a human, is capable of providing (directly or indirectly) the
biologically active metabolite or residue thereof. Accordingly, for
example, the disclosure is also drawn to pharmaceutically
acceptable salts of antisense compounds, prodrugs, pharmaceutically
acceptable salts of such prodrugs, and other bioequivalents.
Suitable pharmaceutically acceptable salts include, but are not
limited to, sodium and potassium salts.
[0199] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligomeric compound which are
cleaved by endogenous nucleases within the body, to form the active
oligomeric compound.
[0200] Lipid-based vectors have been used in nucleic acid therapies
in a variety of methods. In one method, the nucleic acid is
introduced into preformed liposomes or lipoplexes made of mixtures
of cationic lipids and neutral lipids. In another method, DNA
complexes with mono- or poly-cationic lipids are formed without the
presence of a neutral lipid.
[0201] In certain methods, preparations are made that include a
polyamine compound or a lipid moiety complexed with a nucleic acid.
In certain embodiments, such preparations comprise one or more
compounds each individually having a structure defined by formula
(I) or a pharmaceutically acceptable salt thereof,
##STR00003##
wherein each X.sup.a and X.sup.b, for each occurrence, is
independently C.sub.1-6 alkylene; n is 0, 1, 2, 3, 4, or 5; each R
is independently H, wherein at least n+2 of the R moieties in at
least about 80% of the molecules of the compound of formula (I) in
the preparation are not H; m is 1, 2, 3 or 4; Y is O, NR.sup.2, or
S; R.sup.1 is alkyl, alkenyl, or alkynyl; each of which is
optionally substituted with one or more substituents; and R.sup.2
is H, alkyl, alkenyl, or alkynyl; each of which is optionally
substituted each of which is optionally substituted with one or
more substituents; provided that, if n=0, then at least n+3 of the
R moieties are not H. Such preparations are described in PCT
publication WO120081042973, which is herein incorporated by
reference in its entirety.
[0202] Certain preparations, some of which are shown below, are
described in Akinc et al., Nature Biotechnology 26, 561-569 (1 May
2008), which is herein incorporated by reference in its
entirety.
##STR00004## ##STR00005## ##STR00006##
Nonlimiting Disclosure and Incorporation by Reference
[0203] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety.
[0204] Although the sequence listing accompanying this filing
identifies each sequence as either "RNA" or "DNA" as required, in
reality, those sequences may be modified with any combination of
chemical modifications. One of skill in the art will readily
appreciate that such designation as "RNA" or "DNA" to describe
modified oligonucleotides is, in certain instances, arbitrary. For
example, an oligonucleotide comprising a nucleoside comprising a
2'-OH sugar moiety and a thymine base could be described as a DNA
having a modified sugar (2'-OH for the natural 2'-H of DNA) or as
an RNA having a modified base (thymine (methylated uracil) for
natural uracil of RNA).
[0205] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, an oligomeric compound having the
nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as
[0206] "AUCGATCG" and oligomeric compounds having other modified or
naturally occurring bases, such as "AT.sup.meCGAUCG," wherein
.sup.me C indicates a cytosine base comprising a methyl group at
the 5-position.
EXAMPLES
[0207] The following examples illustrate certain embodiments of the
present invention and are not limiting. Moreover, where specific
embodiments are provided, the inventors have contemplated generic
application of those specific embodiments. For example, disclosure
of an oligonucleotide having a particular motif provides reasonable
support for additional oligonucleotides having the same or similar
motif. And, for example, where a particular high-affinity
modification appears at a particular position, other high-affinity
modifications at the same position are considered suitable, unless
otherwise indicated.
Example 1
Materials and Methods
Materials
[0208] Antibodies, siRNAs, RNaseH-dependent oligonucleotides,
qRT-PCR primers and probes, and oligonucleotide probes for northern
hybridization are as follows.
Antibodies
[0209] Antibodies against RNase H1 and H2 that were raised in
rabbit are gifts from Hong Jiang Wu. Antibodies for .alpha.-tubulin
(T5168, 1:8000), .beta.-tubulin (T5293, 1:6000), .gamma.-tubulin
(T6557, 1:6000) and .beta.-actin (A5316, 1:6000) were purchased
from Sigma. Antibodies against hnRNPA2/B1 (ab6102, 1:1000),
nucleolin (ab13541, 1:1000), Ubiquitin (ab7780, 1:500), RHA
(ab26271, 1:1000), GAPDH (ab8245, 1:1000), Ago2 (ab57113, 1:1000),
Fen1 (ab17993, 1:1000), GZMM (ab55226, 1:1000) were from Abcam.
RPL4 antibody (11302-1-AP, 1:1000) was from Proteintech. Rio2
(NBP1-30098, 1:1000) and MRTO4 (H00051154-D01, 1:1000) antibodies
were from Novus. Secondary antibodies (1:2000) conjugated with HRP
for mouse (172-1019) and rabbit (172-1011) were purchased from
Bio-Rad. Anti-mouse secondary antibody conjugated with FITC
(ab6785) and anti-rabbit secondary antibody conjugated with Texas
Red (ab6719) were from Abcam.
Antisense Oligonucleotides(ASOs) Used for Northern
Hybridization
[0210] The sequences of antisense oligonucleotides used for
northern hybridization are presented in Table 1a. Each nucleoside
throughout the oligonucleotide is ribonucleoside and all the
internucleoside linkages are phosphodiester (P.dbd.O) linkages.
TABLE-US-00001 TABLE 1a Antisense oligonucleotides (ASOs) used for
northern hybridization SEQ ID ASO Composition (5' to 3') RNA NO
XL137 AACTATACAACCTACTACCTCA Let-7a 1 XL138 CGCCAATATTTACGTGCTGCTA
miR-16 2 XL139 CTACCTGCACTGTAAGCACTTTG miR-17 3 XL140
TCAGTTTTGCATGGATTTGCACA miR-19b 4 XL141 TCAACATCAGTCTGATAAGCTA
miR-21 5 XL142 CTGTTCCTGCTGAACTGAGCCA miR-24 6 XL143
GCGGAACTTAGCCACTGTGAA miR-27a 7 XL144 ACAGGCCGGGACAAGTGCAATA miR-92
8 XL011 TTGCTCAGTAAGAATTTTCG U16 9 snoRNA XL018
AATACCAGGTCGATGCGTGG U2 snRNA 10
qRT-PCR Primer Probe Sets
[0211] The sequences for .alpha.-tubulin primer/probe set used in
qRT-PCR are as follows. 5'-GTGAAACTGGTGCTGGAAAAC (forward primer)
(SEQ ID NO: 11); 5'-CAGCATCCTCTTTCCCAGTG-3' (reverse) (SEQ ID NO:
12); and 5'-AAATGGCCCATACCGACAGCTCTT-3' (probe) (SEQ ID NO:
13).
[0212] The sequences for GZMB primer/probe set used in qRT-PCR are
as follows. 5'-GGGATGGGTCTTTTCACAGG-3' (forward primer) (SEQ ID NO:
14) 5'-CGGTGGCTTCCTGATACAAG-3' (reverse) (SEQ ID NO: 15); and
5'-CTGGGTCGGCTCCTGTTCTTTGA-3' (probe) (SEQ ID NO: 16).
[0213] The sequences for GZMM primer/probe set used in qRT-PCR are
as follows. 5'-GCATGTGTAACAACAGCCGCTTCT-3' (forward primer) (SEQ ID
NO: 17); 5'-TTGAAGATGTCAGTGCAGACCCTG-3' (reverse) (SEQ ID NO: 18);
and 5'-TGTTGGCCGGAGTCCTGTCCTTCA-3' (probe) (SEQ ID NO: 19).
[0214] The sequences for MOV10 primer/probe set used in qRT-PCR are
as follows. 5'-ATGGTGTGGATGTGGAAGTC-3' (forward primer) (SEQ ID NO:
20); 5'-AGAGTGGGAAGAGGTGAGTG-3' (reverse) (SEQ ID NO: 21); and
5'-TTGAACCGCAAAGAGGTGCTGAC-3' (probe) (SEQ ID NO: 22).
[0215] The sequences for Fen1 primer/probe set used in qRT-PCR are
as follows. 5'-GGGCCGCCTGGATGAT-3' (forward primer) (SEQ ID NO:
23); 5'-TGGCTCCTTGCGCTTAGC-3' (reverse) (SEQ ID NO: 24); and
5'-TCTTCAAGGTGACCGGCTCACTCTCTTC-3' (probe) (SEQ ID NO: 25).
[0216] The sequences for RHA primer/probe set used in qRT-PCR are
as follows. 5'-CCACTTACTGATACTCCTGACAC-3' (forward primer) (SEQ ID
NO: 26); 5'-CAGGAACACCATAGCCAGAG-3' (reverse) (SEQ ID NO: 27); and
5'-TGCTTTGAGAGCCAGATGTGGAGG-3' (probe) (SEQ ID NO: 28).
[0217] The sequences for DHX30 primer/probe set used in qRT-PCR are
as follows. 5'-AAAAGAGTTCCCACAGCCC-3' (forward primer) (SEQ ID NO:
29); 5'-GGCCATTTTATGTGCAGTGTG-3' (reverse) (SEQ ID NO: 30); and
5'-AGTGTGATTGGAAGAGCCCTCGG-3' (probe) (SEQ ID NO: 31).
[0218] The sequences for DHX36 primer/probe set used in qRT-PCR are
as follows. 5'-GAAAGAGGAAAAGGATCTGCTTG-3' (forward primer) (SEQ ID
NO: 32); 5'-ACCGATCTGGAGACGAATTTG-3' (reverse) (SEQ ID NO: 33); and
5'-TTACCACTGCCACAAGATTCTGCCC-3' (probe) (SEQ ID NO: 34).
[0219] The sequences for Rnase H1 primer/probe set used in qRT-PCR
are as follows. 5'-CCTGTACTTACTGGTGTGGAAAATAGC-3' (forward primer)
(SEQ ID NO: 35); 5'-CCGTGTGAAAGACGCATCTG-3' (reverse) (SEQ ID NO:
36); and 5'-TGCAGGTAGGACCATTGCAGTGATGG-3' (probe) (SEQ ID NO:
37).
[0220] The sequences for Rnase H2 primer/probe set used in qRT-PCR
are as follows. 5'-TCCTCAATGAAGGGTCCCAA-3' (forward primer) (SEQ ID
NO: 38); 5'-GCCGCGTTCCAGGAAATAT-3' (reverse) (SEQ ID NO: 39); and
5'-CCCGTCCCCGTTCTTCCCACC-3' (probe) (SEQ ID NO: 40).
[0221] The sequences for PTEN primer/probe set used in qRT-PCR are
as follows. 5'-AATGGCTAAGTGAAGATGACAATCAT-3' (forward primer) (SEQ
ID NO: 41); 5'-TGCACATATCATTACACCAGTTCGT-3' (reverse) (SEQ ID NO:
42); and 5'-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-3' (probe) (SEQ ID NO:
43). Primer probe sets for PTEN siRNA (sense and antisense) were
customized and purchased from Applied Biosystems, based on the
siRNA sequence (sense, 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 44);
antisense, 5'-UUGUCUCUGGUCCUUACUU-3' (SEQ ID NO: 45)).
[0222] The sequences for OAS1 primer/probe set used in qRT-PCR are
as follows. 5'-CCGCATGCAAATCAACCAT-3' (forward primer) (SEQ ID NO:
46); 5'-GCTACCTCGGAAGCACCTTTC-3' (reverse) (SEQ ID NO: 47); and
5'-CCATTGACATCATCTGTGGGTTCCTGAA-3' (probe) (SEQ ID NO: 48).
[0223] The sequences for U16 primer/probe set used in qRT-PCR are
as follows. 5'-CTTGCAATGATGTCGTAATTTGC-3' (forward primer) (SEQ ID
NO: 49); 5'-TCGTCAACCTTCTGTACCAGCTT-3' (reverse) (SEQ ID NO: 50);
and 5'-TTACTCTGTTCTCAGCGACAGTTGCCTGC-3' (probe) (SEQ ID NO:
51).
[0224] The sequences for Nucleolin primer/probe set used in qRT-PCR
are as follows. 5'-GCTTGGCTTCTTCTGGACTCA-3' (forward primer) (SEQ
ID NO: 52); 5'-TCGCGAGCTTCACCATGA-3' (reverse) (SEQ ID NO: 53); and
5'-CGCCACTTGTCCGCTTCACACTCC-3' (probe) (SEQ ID NO: 54).
TaqMan miRNA Assays Used to Detect miRNAs
[0225] qRT-PCR primer probe sets for detecting miRNAs were
purchased from Applied Biosystems and assay IDs are as follows.
miR-16 (000391); miR-17 (002308); miR-21 (000397); miR-24 (000402);
miR-27a (000408); miR-378 (002243); miR-422a (002297); miR-133a
(002246); miR-331-3p (000545); miR-339-5p (002257); miR-532-3p
(002355) and miR-615-5p (002353).
Cell Culture and Transfection
[0226] HeLa, HEK293, mouse embryonic fibroblast (MEF) cells, Ago2
knock cells, and MHT cells (a gift from Eric Koller) were cultured
in DMEM supplemented with 10% FBS, 0.1 .mu.g/ml streptomycin, and
100 units/ml penicillin. Transfection of siRNAs was performed in
DMEM medium supplemented with 10% FBS, using 5 .mu.g/ml
lipofectamin RNAiMAX or 4 .mu.g/ml Lipofectamin 2000 or
Oligofectamin according to the manufacture's procedure. Unless
otherwise stated, starting cell confluency was at approximately
50-70%.
Western Analysis
[0227] Equal amount of proteins (8-20 .mu.g) were separated in
4-12% SDS PAGE, transferred to membrane. Blocking and detection of
proteins was performed as described in Liang et al., Nucleic Acids
Research, 2010, 1-17.
Northern Hybridization and qRT-PCR
[0228] Northern hybridization and qRT-PCR using TaqMan primer probe
sets were performed as described in Liang et al., Nucleic Acids
Research, 2010, 1-17. For miRNA detection, total RNA was isolated
from cells using miRNeasy kit (Qiagen) and miRNA was either
detected by northern hybridization, or by qRT-PCR using TaqMan
miRNA assay (Applied Biosystems) according to manufacturer's
protocol.
Immunoprecipitation
[0229] Whole cell extracts prepared in Buffer A [25 mM Tris.Cl pH
8.0]; 5 mM MgCl.sub.2; 150 mM KCl; 10% glycerol; 0.5 mM PMSF; 5 mM
.beta.-mercaptoethanol; and one tablet of Protease Inhibitor
Cocktail/50 ml (Roche) were incubated at 4.degree. C. for 4 hours
with Protein A beads (Roche) pre-coated with antibody against Ago2
(ab57113), .alpha.-tubulin (T5168), or RIO2 (NBP1-30098). After six
washes with wash buffer (50 mM Tris.Cl, pH7.5; 150 mM NaCl; 5 mM
EDTA; 0.1% NP-40; 0.05% SDS), the co-selected proteins were
directly separated by loading the boiled beads into SDS-PAGE. The
co-immunoprecipitated RNAs were prepared directly from the beads
using Tri-Reagent and subjected to reverse transcription-qRT-PCR
analysis.
Translation Shut-Off
[0230] HeLa cells were transfected with or without 8 nM Fen1 siRNA
for 48 hrs. Medium was then replaced with pre-warmed DMEM medium
supplemented with 10% FBS and 15 .mu.g/ml cycloheximide. Cells were
collected at different times using trypsine and the protein levels
were detected by western analysis.
Example 2
Effect of siRNAs on Target Protein Degredation
[0231] To examine the effect of siRNAs on protein degradation (e.g.
.alpha.-tubulin, hnRNP A2, .gamma.-tubulin, nucleolin, RPL4, MTRO4,
Ubiquitin), eight siRNAs were selected and evaluated.
siRNAs
[0232] The synthesis and purification of ISIS 341401 was performed
using similar methods as described in Baker et al., J. Biol. Chem,
272, 11994-12000. Unless otherwise stated, the pre-designed siRNAs
were purchased from commercial sources and the composition of the
sense strand is presented in Table 1. The internucleoside linkages
throughout each siRNA are phosphodiester (P.dbd.O) linkages.
Nucleosides with capitalized letters indicate ribonucleosides
(RNAs). Nucleosides with small letters "tt" indicate
2'-.beta.-deoxyribonucleosides overhang.
[0233] Compositions for the following siRNAs, sc88358, s14450,
s48358 and s20656 can be obtained from the manufacturers.
Cell Culture, Transfection, and Analysis
[0234] HeLa cells were maintained in DMEM supplemented with 10%
FBS, 0.1 .mu.g/ml streptomycin, and 100 units/ml penicillin.
Transfection of siRNAs from Table 1 at 5 nM concentration was
performed in DMEM medium supplemented with 10% FBS, using 5
.mu.g/ml lipofectamin RNAiMAX according to the manufacture's
procedure. "UTC" indicates untreated control. "Mov10" indicates
cells transfected with sc-88358 siRNA targeting Mov10. "RHA"
indicates cells transfected with s4019 siRNA targeting RHA/DHX9.
"DHX30" indicates cells transfected with s22643 siRNA targeting
DHX30. "DHX36" indicates cells transfected with s46822 siRNA
targeting DHX36. "TSNAX" indicates cells transfected with s14450
siRNA targeting TSNAX. "H1" indicates cells transfected with s48358
siRNA targeting Rnase H1. "H2" indicates cells transfected with
s20656 siRNA targeting Rnase H2A. "PTEN" indicates cells
transfected with ISIS 341401 siRNA targeting PTEN. Starting cell
confluency was approximately at 50%. After 48 hrs, western analysis
for various proteins (i.e. .alpha.-tubulin, hnRNP A2,
.gamma.-tubulin, nucleolin, RPL4, MTRO4 and Ubiquitin) was
performed using the procedures described in Example 1. Equal amount
of proteins (.about.10 .mu.g) were separated by 4-12% gradient
SDS-PAGE, transferred to membranes and different proteins were
sequentially detected. Quantification of .alpha.-tubulin protein
levels was measured using ImageJ and normalized to hnRNP A2. The
results are presented in FIGS. 1 and 2.
[0235] As illustrated, .alpha.-tubulin protein levels were
significantly reduced in cells transfected with siRNAs targeting
various targets comparing to untreated control (UTC). Further,
similar reduction was also observed for nucleolin protein in
siRNA-treated cells as illustrated in FIG. 1. No significant
reduction was detected for other target proteins examined,
including hnRNP A2, RPL4, .gamma.-tubulin, and MTRO4.
TABLE-US-00002 TABLE 1 siRNAs targeting various targets siRNA
Composition SEQ ID catalog no. Target Company (only sense strand is
shown) NO. sc-88358 MOV10 Santa Cruz -- Biotechnology s4019 RHA
(DHX9) Applied Biosystems 5'-GAGUGUAACAUCGUAGUAAtt-3' 55 s22643
DHX30 Applied Biosystems 5'-GGACCAUAGAUGUUACCGAtt-3' 56 s46822
DHX36 Applied Biosystems 5'-CAGUGUUAGUCAUAUCGUAtt-3' 57 s14450
TSNAX Ambion -- s48358 Rnase H1 Ambion -- s20656 Rnase H2A Ambion
-- ISIS 341401 PTEN ISIS Pharm. 5'-AAGUAAGGACCAGAGACAA-3' 58
Example 3
Dose-Dependent Effect of RHA siRNAs on .alpha.-Tubulin
Reduction
[0236] To further examine if the reduction of .alpha.-tubulin is
directly related to siRNA, a dose-dependent study was performed.
One siRNA from Table 1 (s4019) was selected and evaluated.
Cell Culture, Transfection, and analysis
[0237] HeLa cells were cultured in DMEM supplemented with 10% FBS,
0.1 .mu.g/ml streptomycin, and 100 units/ml penicillin. Cells were
transfected with siRNA (s4019) targeting RHA at 0, 0.5, 1, 2, 4 and
8 nM concentrations for 36 hours using similar transfection methods
as described in Example 1. .gamma.-tubulin was used as a loading
control with cell confluency at approximately 50%. Western analysis
was used as described in Example 1 to evaluate the dose-dependent
effect of siRNA on .alpha.-tubulin protein levels. The results are
presented in FIG. 3.
[0238] As illustrated in FIG. 3, reduction of .alpha.-tubulin was
affected in a dose-dependent manner. For example, 45-60%
.alpha.-tubulin reduction was observed at high siRNA concentrations
(4-8 nM) while the targeted protein RHA was significantly reduced
at a lower concentration (0.5 nM). That the .gamma.-tubulin level
was not significantly affected shows that in certain embodiments,
not all microtubule related proteins are equally affected by siRNA
transfection.
Example 4
Dose-Dependent Effect of siRNAs on Tubulin Reduction
[0239] To confirm the dose-dependent effect of siRNAs on tubulin
reduction, a different siRNA (HSS176903) was selected and
evaluated.
siRNA
[0240] Unless otherwise stated, the pre-designed siRNA (HSS176903)
was purchased from Invitrogen and the sequence for the sense strand
is 5'-CAGGAACAGUUUGUGGAUCUGUGCA-3' (SEQ ID NO: 59). Each nucleoside
throughout the oligonucleotide is ribonucleosides and all the
internucleoside linkages are phosphodiester (P.dbd.O) linkages.
Cell Culture, Transfection, and Analysis
[0241] HeLa cells were cultured in DMEM supplemented with 10% FBS.
Cells with approximately 50% confluency were transfected with
HSS176903 siRNA targeting Fen1 at 0, 1, 2, 4 and 8 nM
concentrations for 36 hours using similar transfection methods as
described in Example 1. .gamma.-tubulin was used as a loading
control. Western analysis was used as described in Example 1 to
evaluate the dose-dependent effect of siRNA on target protein
levels (i.e. .alpha.-tubulin, nucleolin or .beta.-actin).
Quantification of protein levels was measured using ImageJ and
normalized to .gamma.-tubulin. The results are presented in FIGS. 4
and 5.
[0242] As illustrated in FIGS. 4 and 5, reduction of
.alpha.-tubulin was affected in a dose-dependent manner. Further,
reduction of nucleolin and .beta.-actin protein levels at 85% and
40% respectively, could be detected at high concentration of siRNA
(8 nM). Taken together, these results show that in certain
embodiments, other proteins can also be affected by siRNA
transfection.
Example 5
Additive Effect of siRNAs on .alpha.-Tubulin Protein Reduction
[0243] To examine the effect of siRNAs on .alpha.-tubulin reduction
when used a single siRNA alone or in combination with other siRNAs,
two siRNAs from Examples 2 and 4 (HSS176903 and ISIS 341401) were
selected and evaluated.
Cell Culture, Transfection, and Analysis .mu.
[0244] HeLa cells were cultured in DMEM supplemented with 10% FBS,
0.1 .mu.g/ml streptomycin, and 100 units/ml penicillin. Cells were
transfected for 48 hours with siRNAs (HSS176903 or ISIS 341401
alone or in combination) at various concentrations as presented in
Table 2 using similar transfection methods as described in Example
1. Western analysis was used to evaluate the dose-dependent effect
of siRNA on .alpha.-tubulin protein level. GAPDH was used as a
loading control. Quantification of .alpha.-tubulin protein level
was measured using ImageJ and normalized to GAPDH. The results are
presented in FIGS. 6 and 7.
[0245] As illustrated in FIGS. 6 and 7, significant reduction of
.alpha.-tubulin was observed in a dose-dependent manner when used
alone or in combination with other siRNAs.
TABLE-US-00003 TABLE 2 siRNAs used in the evaluation of siRNAs on
.alpha.-tubulin level siRNA catalog no. HSS176903 ISIS 341401 SEQ
ID NO. 59 58 Concentration Combination 1 0 0 (nM) Combination 2 8 0
Combination 3 8 4 Combination 4 8 8
Example 6
Effect of siRNAs on .alpha.-Tubulin Protein Level in Mouse MHT
Cells
[0246] To examine the effect of siRNAs on .alpha.-tubulin reduction
in mouse MHT cells targeting various targets (Fen1-03, Fen1-27,
MOv10, hVPS28 and mVPS28), several siRNAs were selected and
evaluated.
siRNAs
[0247] Unless otherwise stated, the pre-designed siRNAs were
purchased from commercial sources and the composition of the sense
strand is presented in Table 1. The internucleoside linkages
throughout each siRNA are phosphodiester (P.dbd.O) linkages.
Nucleosides with capitalized letters indicate ribonucleosides
(RNAs). Nucleosides with small letters "tt" indicate
2'-.beta.-deoxyribonucleosides overhang.
[0248] Composition for sc-88358 siRNA can be obtained from the
manufacturer.
Cell Culture, Transfection, and Analysis
[0249] Mouse MHT cells were cultured in DMEM supplemented with 10%
FBS, 0.1 .mu.g/ml streptomycin, and 100 units/ml penicillin. Cells
were transfected for 24 hours with 8 nM concentration of siRNAs in
Table 3 targeting different human and mouse genes using similar
transfection methods as described in Example 1. "UTC" indicates
untreated control. "Fen1-03" indicates cells transfected with
HSS176903 siRNA targeting Fen1-03. "Fen1-27" indicates cells
transfected with HSS103627 siRNA targeting Fen1-27. "Mov10"
indicates cells transfected with sc-88358 siRNA targeting Mov10.
"hVPS28" indicates cells transfected with hVPS28 siRNA targeting
human VPS28. "mVPS28" indicates cells transfected with mVPS28 siRNa
targeting mouse VPS28. Coomassie blue staining of a duplicate gel
was used as loading control. Western analysis was used as described
in Example 1 to evaluate the effect of siRNA on .alpha.-tubulin.
Quantification of .alpha.-tubulin protein level was measured using
ImageJ. The results are presented in FIGS. 8 and 9.
[0250] As illustrated in FIGS. 8 and 9, transfection of siRNAs can
cause .alpha.-tubulin reduction as compared to untreated control
(UTC) in all targets tested.
TABLE-US-00004 TABLE 3 siRNAs targeting various targets siRNA
Composition SEQ catalog no. Target Company (only sense strand is
shown) ID NO. HSS176903 Fen1-03 Invitrogen
5'-CAGGAACAGUUUGUGGAUCUGUGCA-3' 59 HSS103627 Fen1-27 Invitrogen
5'-CAUCAAGCCCGUGUAUGUCUUUGAU-3' 60 sc-88358 MOv10 Santa Cruz --
Biotechnology hVPS28 Human Applied 5'-GAAGUGAAGUUGUACAAGAtt-3' 61
VPS28 Biosystems mVPS28 Mouse Applied mVPS28 Biosystems
5'-GAAGTAAAGCTCTACAAGAtt-3' 62
Example 7
Ago2 Effect on siRNA-Induced .alpha.-Tubulin Reduction
[0251] Since siRNAs associate with Ago2 to form RISC complexes,
siRNA-induced .alpha.-tubulin reduction may thus depend on Ago2. To
examine this hypothesis, two siRNAs from Table 2 (ISIS 341401 and
HSS176903) were selected and evaluated.
Cell Culture, Transfection, and Analysis
[0252] Ago2 knockout (-/-Ago2) and mouse embryonic fibroblast (MEF)
cells were transfected at 60% start confluency with siRNAs at 15 nM
concentration for 36 hours using the transfection method as
described in Example 1. "Fen1-si" indicates cells tranfected with
HSS176903 siRNA targeting Fen1. "PTEN-si" indicates cells
transfected with ISIS 341401 siRNA targeting PTEN. "UTC" indicates
untreated control. Western analysis was used as described in
Example 1 to evaluate the effect of siRNA on .alpha.-tubulin
levels. Quantification of .alpha.-tubulin protein was measured
using ImageJ and normalized to .gamma.-tubulin. The results are
presented in FIG. 10.
[0253] As illustrated in FIG. 10, transfection of two different
siRNAs into Ago2 knockout mouse cells had no obvious effect on
.alpha.-tubulin level as compared to untreated control (UTC). In
contrast, 80% reduction was detected in MEF cells treated with the
same siRNAs. These results indicate that siRNA-induced
.alpha.-tubulin reduction is Ago2-dependent.
Example 8
Effect of siRNAs or Ago2 on .alpha.-Tubulin Protein
[0254] To further investigate if siRNAs or Ago2 directly interact
with tubulin protein since it has been shown that some
microtubule-targeting reagents can lead to rapid degradation of
tubulin protein by directly interacting with tubulin protein or
microtubule (Harris et al., Biochem. Biophys. Res. Comm., 2009,
388, 354-349; or Huff et al., Cancer Res, 2010, 70, 5870-5879). One
siRNA from Table 1 (ISIS 341401) was selected and evaluated.
Cell Culture, Transfection, and Analysis
[0255] Cell lysate prepared from HeLa cells was transfected with
ISIS 341401 siRNA at 5 nM concentration for 4 hours, and
immunoprecipitation was performed using antibodies against Ago2,
.alpha.-tubulin, or Rio2, as described in Example 1.
Co-precipitated siRNA was analyzed by qRT-PCR. As a positive
control, qRT-PCR was performed on RNA from 10% input material used
for immunoprecipitation. The results are presented in FIG. 11, in
which the error bars represent standard deviation of three parallel
experiments and "(-)AB" means the immunoprecipitation procedure was
performed without antibody. Co-precipitated proteins were analyzed
by western analysis for the presence of .alpha.- or .beta.-tubulin
proteins and the results are presented in FIG. 12.
[0256] As illustrated in FIG. 11, neither sense nor antisense siRNA
was significantly co-precipitated with .alpha.-tubulin protein.
Ago2 antibodies were used as a positive control, and siRNA was
significantly co-precipitated with Ago2 (FIG. 11). In addition,
neither .alpha.- nor .beta.-tubulin protein was
co-immunoprecipitated with Ago2 (FIG. 12), demonstrating that in
certain embodiments, tubulin reduction is not induced by direct
interaction of siRNAs and/or Ago2 protein with .alpha.-tubulin
protein.
Example 9
Effect of siRNA Transfection on Endogenous miRNAs
[0257] Since Ago2 protein is shared by both siRNAs and endogenous
miRNAs, transfection of siRNA may thus compete with miRNAs for Ago2
protein, leading to disturbed miRNA expression or function, which
in turn can cause tubulin reduction through mis-regulation of other
genes. It has been shown that transfection of siRNA can affect
global gene expression (Tagami et al., Pharm. Res., 2008, 25,
2497-2504), most likely by perturbing gene regulation by miRNAs
(Khan et al., Nature Biotech., 2009, 27, 549-555).
[0258] Thus, to examine if transfection of siRNAs can cause
reduction of miRNA levels due to competition for Ago2, the levels
of three selected miRNAs (miR-21, miR-17, and miR-24) were
evaluated.
siRNAs
[0259] The synthesis and purification of ISIS 341401 was performed
using similar methods as described in Baker et al., J. Biol. Chem,
272, 11994-12000. Unless otherwise stated, the pre-designed siRNAs
were purchased from commercial sources and the composition of the
sense strand is presented in Table 4. Each nucleoside throughout
the oligonucleotide is ribonucleosides. The internucleoside
linkages throughout are phosphodiester (P.dbd.O) linkages.
[0260] Compositions for siRNAs, sc-88358 and s14431 can be obtained
from the manufacturers.
Cell Culture, Transfection and Method
[0261] Mouse MEF cells were transfected at 70% confluency with
siRNAs in Table 4 at 10 nM concentration using the transfection
method as described in Example 1. "No-si or UTC" indicates
non-transfected or untreated control. "MOv10-s or Mov10" indicates
cells transfected with sc-88358 siRNA targeting Mov10. "PTEN-si or
PTEN" indicates cells transfected with ISIS 341401 siRNA targeting
PTEN. "TSN-si or TSN" indicates cells transfected with s14431 siRNA
targeting TSN. Northern analysis of miRNAs in mouse MEF cells was
performed after 24 hours post transfection. Total RNA (.about.8
.mu.g/lane) was separated in a 10% polyacrylamide, 7 M urea gel,
and transferred to membrane. Different miRNAs were detected by
northern hybridization using 5' end-labeled probes, as described in
Example 1. U16 snoRNA was used as a loading control. Quantification
of endogenous miRNA levels was determined using ImageJ and
normalized to U16. The blot is shown in FIG. 13, and the
quantification is shown in FIG. 14.
[0262] As illustrated in FIGS. 13 and 14, the levels of three
tested miRNAs (miR-21, miR-17, and miR-24) were reduced by
approximately 20-50% in MEF cells transfected with different siRNAs
as compared to non-transfected control.
TABLE-US-00005 TABLE 4 siRNAs targeting various targets siRNA cat.
Composition SEQ ID no. Target Company (only sense strand is shown)
NO. sc-88358 MOv10 Santa Cruz -- Biotechnology ISIS PTEN ISIS
Pharm. 5'-AAGUAAGGACCAGAGACAA-3' 58 341401 s14431 TSN Ambion --
Example 10
Effect of siRNA Transfection on Endogenous miRNAs in HEK293
cells
[0263] To further investigate the effect of siRNAs on endogenous
miRNA-21, two siRNAs from Table 4 (ISIS 341401 and s14431) were
selected and evaluated.
Cell Culture, Transfection and Analysis
[0264] HEK293 cells were transfected with PTEN or TSN siRNAs at 10
nM concentration for 48 hrs using transfection method as described
in Example 1. "UTC" indicates untreated control. "PTEN" indicates
cells transfected with ISIS 341401 siRNA targeting PTEN. "TSN"
indicates cells transfected with s14431 siRNA targeting TSN.
miRNA-21 was detected by northern hybridization. U2 snRNA was used
as a loading control. Quantification of miR-21 level was measured
using ImageJ and normalized to U2 using the analysis method as
described in Example 1. The blot is shown in FIG. 15, and the
quantification is shown in FIG. 16.
[0265] As illustrated in FIGS. 15 and 16, reduction of miR-21 was
observed in siRNA-transfected HEK293 cells.
Example 11
Dose-Dependent Effect of PTEN siRNAs on Endogeneous miRNA
Levels
[0266] To examine the dose-dependent effect of siRNAs on
endogeneous miRNA levels, ISIS 341401 siRNA from Table 4 was
selected and evaluated.
Cell Culture, Transfection, and Analysis
[0267] HeLa cells were cultured in DMEM supplemented with 10% FBS,
0.1 .mu.g/ml streptomycin, and 100 units/ml penicillin. Cells were
transfected with ISIS 341401 targeting PTEN at 0, 1, 5, 10, 20 and
30 concentrations for 36 hours using similar transfection methods
as described in Example 1. miRNA levels were detected by Northern
analysis as described in Example 1. U16 snoRNA was used as loading
control. Quantification of miRNA levels was measured using ImageJ
and normalized to U16. The blot is shown in FIG. 17, and the
quantification is shown in FIG. 18.
[0268] As illustrated in FIGS. 17 and 18, a dose-dependent
reduction of miRNAs was observed with increasing siRNA
concentrations, showing that in certain embodiments, siRNAs compete
with miRNAs in a dose dependent manner.
Example 12
Dose-Dependent Effect of TSN siRNAs on Endogeneous miRNA Levels
[0269] To examine the dose-dependent effect of siRNAs on
endogeneous miRNA levels, siRNA (s14431) targeting TSN from Table 4
was selected and evaluated.
Cell Culture, Transfection, and Analysis
[0270] HeLa cells were cultured in DMEM supplemented with 10% FBS,
0.1 .mu.g/ml streptomycin, and 100 units/ml penicillin. Cells were
transfected with siRNA (s14431) targeting TSN at 0, 1.5, 4.5, and
13.5 concentrations for 48 hours using similar transfection methods
as described in Example 1. miRNA levels were detected by northern
analysis as described in Example 1. U16 snoRNA was used as loading
control. Quantification of miRNA levels was measured using ImageJ
and normalized to U16. The blot is shown in FIG. 19, and the
quantification is shown in FIG. 20.
[0271] As illustrated in FIGS. 19 and 20, transfection of siRNA
targeting TSN reduced the level of mature miR-16, yet the pre-miRNA
level increased. This result demonstratess that in certain
embodiments, transfection of siRNA can also disturb the miRNA
biogenesis pathway.
[0272] Taken together, results from Examples 9-12 show that in
certain embodiments, transfection of siRNAs can reduce the levels
of many, if not all, miRNAs. Global reduction of miRNAs may thus
cause mis-regulation of many genes, which in turn, can lead to
tubulin reduction.
Example 13
Timecourse of miRNA Reduction Following siRNA Transfection
[0273] If disrupted miRNA regulation is the cause of tubulin
reduction, miRNA levels should be affected shortly after siRNA
transfection since tubulin protein is quickly degraded following
siRNA transfection (data not shown). Thus, the kinetics of the
siRNA effect on miRNA levels (miR-17 and miR378) was determined.
siRNA (ISIS 341401) from Table 1 was selected and evaluated.
Cell Culture, Transfection and Analysis
[0274] HeLa cells were transfected with 8 nM PTEN siRNA (ISIS
341401) at various time points and the total RNA was prepared using
miRNeasy kit. Endogenous miRNA levels were determined by qRT-PCR
using TaqMan miRNA assay. The methods used to conduct the studies
are described in Example 1, and the results are presented in FIG.
21.
[0275] Consistent with rapid degradation of tubulin protein, the
levels of some miRNAs, such as miR-17 and miR-378, were gradually
reduced after siRNA transfection, even at early time points (2-4
hrs). This is consistent with the data shown that targeted mRNAs
could be significantly reduced 2 hrs after siRNA transfection
(Vickers et al., Nucleic Acids Research, 2007, 35, 6598-6610).
These results suggest that siRNAs compete with miRNAs, most likely
for binding of Ago2 protein, leading to reduction of miRNAs that
otherwise are protected by Ago2.
Example 14
Effect of siRNAs on Ago2-Bound miRNA Levels
[0276] To determine the effect of siRNA on Ago-2 bound miRNA levels
(miR-17 and miR378), ISIS 341401 siRNA from Table 1 was selected
and evaluated.
Cell Culture, Transfection and Analysis
[0277] HeLa cells were transfected with 8 nM concentration of PTEN
siRNA (ISIS 341401) at various time points. miRNAs associated with
Ago2 were isolated by immunoprecipitation from siRNA-treated cells,
and co-immunoprecipitated miRNAs were analyzed by qRT-PCR using the
methods described in Example 1. Fen1 antibody was used as a
negative control in the immunoprecipitation. The results are
presented in FIG. 22.
[0278] Further, the same immunoprecipitated samples were analyzed
for the level of co-precipitated PTEN siRNA (ISIS 341401) using
qRT-PCR. The results are presented in FIG. 23, in which the error
bars represent standard deviation from three parallel
experiments.
[0279] In addition, aliquots of whole cell extract used as the
input for the immunoprecipitation were analyzed by western blot to
determine the levels of Ago2. .gamma.-tubulin was used as a loading
control. A non-specific product detected by Ago2 antibody is marked
with an asterisk (*). The results are presented in FIG. 24.
[0280] As illustrated in FIG. 22, the levels of Ago2-bound miRNAs
significantly reduced after siRNA transfection, as determined using
RNA-immunoprecipitation with an Ago2 antibody. Significantly
reduced level of Ago2-bound miR-378 was also observed, although the
cellular level of this miRNA did not transiently increase upon
siRNA transfection, suggesting that a portion of miR-378 lost
association with Ago2.
[0281] Further, reduction of Ago2-bound miRNAs is accompanied by an
increase in the levels of Ago2-bound siRNAs over time (FIG. 23),
providing evidence that siRNAs compete with miRNAs for Ago2,
leading to eventual reduction of miRNAs.
[0282] Consistently, reduction of Ago2-bound miRNAs is not due to
unexpected reduction of Ago2 protein upon siRNA transfection, since
the Ago2 level was actually up-regulated shortly after siRNA
transfection (FIG. 24).
[0283] Taken together, these results suggest that transfection of
siRNA can quickly compete and interfere with miRNA pathway, leading
to rapid reduction of Ago2-bound miRNAs.
Example 15
Depiction of miRNAs Potentially Targeting GZMB 3' UTR Region
[0284] Schematic depiction of miRNAs potentially targeting GZMB 3'
UTR region is illustrated in FIG. 25. The relative positions of
miRNAs are indicated with colored bars, and names are shown with
the corresponding colors. The gray box indicates the coding region
of the mRNA.
[0285] Since rapid degradation of tubulin via siRNA transfection
may also be mediated by proteases, like the case of small-molecule
triggered tubulin degradation (Harris et al., Biochem. Biophys.
Res. Commun., 2009, 388, 345-349. Two proteases, Granzyme B (GZMB)
and Granzyme M (GZMM), have been shown to be required for tubulin
degradation (Bovenschen et al., J. Immunol., 2008, 180, 8184-8191,
and Goping et al., J. Cell Sci., 2006, 119, 858-865). Thus, it is
possible that siRNA induced .alpha.-tubulin reduction can be
mediated by mis-regulation of these two proteases due to reduced
level of miRNAs. As depicted, the 3' UTR of GZMB can be potentially
targeted by nine miRNAs, as predicted using a web-based server
TargetScan (http://www.targetscan.org/). Two miRNAs (mir-378 and
mir-422a) were selected, tested and evaluated as illustrated in the
following example (Example 16).
Example 16
miRNA Levels in siRNA-Treated HeLa Cells
[0286] HeLa cells were transfected for 24 hours with H1 or Fen1
siRNAs selected from Examples 2 and 4 (s48358 or HSS176903) using
the transfection methods as described in Example 1. "H1 siRNA"
indicates cells transfected with s48358 targeting Rnase H1. "Fen1
siRNA" indicates cells transfected with HSS176903 targeting Fenl.
Levels of miR-378 and miR-422a were detected using qRT-PCR as
described in Example 1. The results are presented in FIG. 26.
[0287] As illustrated in FIG. 26, two tested miRNAs (miR-378 and
miR-422a) were significantly reduced by transfection of siRNAs.
Example 17
Effect of siRNA on GZMB mRNA Level
[0288] To examine the effect of siRNA on GZMB expression, HeLa
cells were transfected at 8 nM concentration for 36 hours with Fen1
siRNA (HSS176903) from Example 4 using the transfection methods as
described in Example 1. Level of GZMB mRNA was determined by
qRT-PCR as described in Example 1. The results are presented in
FIG. 27.
[0289] As illustrated in FIG. 27, the level of GZMB mRNA was
moderately increased at approximately 30% in siRNA-transfected
cells as compared to untreated control (UTC). This result is
consistent with the data shown that most miRNAs suppress gene
expression (Chekulaeva et al., Curr. Opin. Cell Biol., 2009, 21,
452-460).
Example 18
Depiction of miRNAs Potentially Targeting GZMM 3' UTR Region
[0290] Schematic depiction of miRNAs potentially targeting GZMM 3'
UTR region is illustrated in FIG. 28. The relative positions of
miRNAs are indicated with colored bars, and names are shown with
the corresponding colors. The gray box indicates the coding region
of the mRNA.
[0291] As depicted, the 3' UTR of GZMM can be potentially targeted
by eleven miRNAs, as predicted using a web-based server TargetScan
(http://www.targetscan.org/). Six miRNAs (miR-133, miR-331,
miR-339, miR-532, mir-and 615) were selected, tested and evaluated
as illustrated in the following example (Example 19).
Example 19
Effect of siRNA Transfection on miRNA Levels in HeLa Cells
[0292] HeLa cells were transfected for 48 hours at 8 nM
concentration with Fen1 siRNA (HSS176903) from Example 4 using the
transfection methods as described in Example 1. Levels of six
tested miRNAs (miR-133, miR-331, miR-339, miR-532, mir-and 615)
were detected using qRT-PCR as described in Example 1. The results
are presented in FIG. 29.
[0293] As illustrated in FIG. 29, the levels of the six tested
miRNAs were significantly reduced upon siRNA transfection as
compared to untreated control (UTC). This result suggests that the
effect of siRNAs on miRNAs is broad.
Example 20
Role of GZMM Protease in siRNA-Induced Tubulin Reduction
[0294] To examine the effect of siRNAs on GZMM and .alpha.-tubulin
levels, HeLa cells were transfected at 8 nM concentration for 24
hours with PTEN or Fen1 siRNA (ISIS 341401 or HSS176903). Levels of
GZMM mRNA were determined by qRT-PCR. GZMM and .alpha.-tubulin
protein levels were analyzed by western blot. hnRNP A2 was used as
a loading control. The methods used to perform this assay are
described in Example 1. The results are presented in FIGS. 30 and
31. "UTC" indicates untreated control. "Fen-1 siRNA" indicates
cells transfected with siRNA HSS176903 targeting Fen1. "PTEN-siRNA"
indicates cells transfected with ISIS 341401 targeting PTEN.
[0295] As illustrated in FIGS. 30 and 31, increased levels of GZMM
mRNA and protein and decreased levels of .alpha.-tubulin were
observed in siRNA-transfected cells as compared to untreated
control (UTC).
[0296] Taken together, results from Examples 15-20 suggest that
siRNA-induced degradation of .alpha.-tubulin may result from
up-regulation of GZMB and/or GZMM.
Example 21
Role of GZMB and GZMM on siRNA-Induced Tubulin Reduction
[0297] To examine the role of GZMB and GZMM on siRNA-induced
tubulin reduction, several siRNAs were selected and evaluated.
siRNAs
[0298] The synthesis and purification of U16 siRNA was performed
using similar methods as described in Baker et al., J. Biol. Chem,
272, 11994-12000. Unless otherwise stated, the pre-designed siRNAs
were purchased from commercial sources and the composition of the
sense trand is presented in Table 5. Each nucleoside throughout the
oligonucleotide is ribonucleosides and all the internucleoside
linkages are phosphodiester (P=0) linkages.
Cell Culture, Transfection and Analysis
[0299] HeLa cells were transfected with 0.75 nM concentration of
siRNAs from Table 5 targeting U16, GZMB, or GZMM alone; or 0.5 nM
concentration each of GZMB and GZMM siRNAs (HSS104647 or HSS179158)
for co-depletion. After 36 hours, 8 nM concentration of Fen1 siRNA
(HSS176903) was transfected. Cells were harvested 16 hours post
transfection and protein levels were detected by western analysis
as described in Example 1. The effect of reducing these proteases
on Fen1 siRNA induced .alpha.-tubulin reduction was analyzed, and
tubulin level was detected by western analysis, shown in FIG. 32.
The signal strength was measured using ImageJ and plotted either as
raw data (blue bars) or normalized to .gamma.-tubulin (red bars) in
FIG. 33. The error bars represent standard deviation of three
parallel experiments.
[0300] As illustrated in FIGS. 32 and 33, simultaneous reduction of
GZMB and GZMM partially suppressed siRNA-induced tubulin reduction.
Although granzyme mRNAs were significantly reduced by more than 80%
in cells treated with the corresponding siRNAs (data not shown),
reduction of either GZMB or GZMM had no significant effect on
tubulin reduction, similar to the control siRNA (U16) treated
cells. However, co-depletion of the two proteases partially
restored .alpha.-tubulin level to approximately 60% of normal,
suggesting that GZMB and GZMM may have redundant roles in
.alpha.-tubulin degradation, and that siRNA-induced tubulin
reduction is at least partially due to up-regulation of the two
proteases.
TABLE-US-00006 TABLE 5 siRNAs used to evaluate the role of GZMB and
GZMM on siRNA-induced tubulin reduction siRNA Composition SEQ ID
cat. no. Target Company (only sense strand is shown) NO. HSS176903
Fen1-03 Invitrogen 5'-CAGGAACAGUUUGUGGAUCUGUGCA 59 U16 U16 ISIS
Pharm. 5'-GGCAACUGUCGCUGAGAACA-3' 63 HSS104647 GZMB Invitrogen
5'-CCUACAUGGCUUAUCUUAUGAUCUG-3' 64 HSS179158 GZMM Invitrogen
5'-CAGCCAUCCAGCACCCUCGCUACAA-3' 65
Sequence CWU 1
1
65122DNAArtificial sequenceSynthetic oligonucleotide 1aactatacaa
cctactacct ca 22222DNAArtificial sequenceSynthetic oligonucleotide
2cgccaatatt tacgtgctgc ta 22323DNAArtificial sequenceSynthetic
oligonucleotide 3ctacctgcac tgtaagcact ttg 23423DNAArtificial
sequenceSynthetic oligonucleotide 4tcagttttgc atggatttgc aca
23522DNAArtificial sequenceSynthetic oligonucleotide 5tcaacatcag
tctgataagc ta 22622DNAArtificial sequenceSynthetic oligonucleotide
6ctgttcctgc tgaactgagc ca 22721DNAArtificial sequenceSynthetic
oligonucleotide 7gcggaactta gccactgtga a 21822DNAArtificial
sequenceSynthetic oligonucleotide 8acaggccggg acaagtgcaa ta
22920DNAArtificial sequenceSynthetic oligonucleotide 9ttgctcagta
agaattttcg 201020DNAArtificial sequenceSynthetic oligonucleotide
10aataccaggt cgatgcgtgg 201121DNAArtificial sequencePrimer
11gtgaaactgg tgctggaaaa c 211220DNAArtificial sequencePrimer
12cagcatcctc tttcccagtg 201324DNAArtificial sequenceProbe
13aaatggccca taccgacagc tctt 241420DNAArtificial sequencePrimer
14gggatgggtc ttttcacagg 201520DNAArtificial sequencePrimer
15cggtggcttc ctgatacaag 201623DNAArtificial sequenceProbe
16ctgggtcggc tcctgttctt tga 231724DNAArtificial sequencePrimer
17gcatgtgtaa caacagccgc ttct 241824DNAArtificial sequencePrimer
18ttgaagatgt cagtgcagac cctg 241924DNAArtificial sequenceProbe
19tgttggccgg agtcctgtcc ttca 242020DNAArtificial sequencePrimer
20atggtgtgga tgtggaagtc 202120DNAArtificial sequencePrimer
21agagtgggaa gaggtgagtg 202223DNAArtificial sequenceProbe
22ttgaaccgca aagaggtgct gac 232316DNAArtificial sequencePrimer
23gggccgcctg gatgat 162418DNAArtificial sequencePrimer 24tggctccttg
cgcttagc 182528DNAArtificial sequenceProbe 25tcttcaaggt gaccggctca
ctctcttc 282623DNAArtificial sequencePrimer 26ccacttactg atactcctga
cac 232720DNAArtificial sequencePrimer 27caggaacacc atagccagag
202824DNAArtificial sequenceProbe 28tgctttgaga gccagatgtg gagg
242919DNAArtificial sequencePrimer 29aaaagagttc ccacagccc
193021DNAArtificial sequencePrimer 30ggccatttta tgtgcagtgt g
213123DNAArtificial sequenceProbe 31agtgtgattg gaagagccct cgg
233223DNAArtificial sequencePrimer 32gaaagaggaa aaggatctgc ttg
233321DNAArtificial sequencePrimer 33accgatctgg agacgaattt g
213425DNAArtificial sequenceProbe 34ttaccactgc cacaagattc tgccc
253527DNAArtificial sequencePrimer 35cctgtactta ctggtgtgga aaatagc
273620DNAArtificial sequencePrimer 36ccgtgtgaaa gacgcatctg
203726DNAArtificial sequenceProbe 37tgcaggtagg accattgcag tgatgg
263820DNAArtificial sequencePrimer 38tcctcaatga agggtcccaa
203919DNAArtificial sequencePrimer 39gccgcgttcc aggaaatat
194021DNAArtificial sequenceProbe 40cccgtccccg ttcttcccac c
214126DNAArtificial sequencePrimer 41aatggctaag tgaagatgac aatcat
264225DNAArtificial sequencePrimer 42tgcacatatc attacaccag ttcgt
254330DNAArtificial sequenceProbe 43ttgcagcaat tcactgtaaa
gctggaaagg 304419RNAArtificial sequenceSynthetic oligonucleotide
44aaguaaggac cagagacaa 194519RNAArtificial sequenceSynthetic
oligonucleotide 45uugucucugg uccuuacuu 194619DNAArtificial
sequencePrimer 46ccgcatgcaa atcaaccat 194721DNAArtificial
sequencePrimer 47gctacctcgg aagcaccttt c 214828DNAArtificial
sequenceProbe 48ccattgacat catctgtggg ttcctgaa 284923DNAArtificial
sequencePrimer 49cttgcaatga tgtcgtaatt tgc 235023DNAArtificial
sequencePrimer 50tcgtcaacct tctgtaccag ctt 235129DNAArtificial
sequenceProbe 51ttactctgtt ctcagcgaca gttgcctgc 295221DNAArtificial
sequencePrimer 52gcttggcttc ttctggactc a 215318DNAArtificial
sequencePrimer 53tcgcgagctt caccatga 185424DNAArtificial
sequenceProbe 54cgccacttgt ccgcttcaca ctcc 245521DNAArtificial
sequenceSynthetic oligonucleotidemisc_feature(1)..(19)bases at
these positions are RNA 55gaguguaaca ucguaguaat t
215621DNAArtificial sequenceSynthetic
oligonucleotidemisc_feature(1)..(19)bases at these positions are
RNA 56ggaccauaga uguuaccgat t 215721DNAArtificial sequenceSynthetic
oligonucleotidemisc_feature(1)..(19)bases at these positions are
RNA 57caguguuagu cauaucguat t 215819RNAArtificial sequenceSynthetic
oligonucleotide 58aaguaaggac cagagacaa 195925RNAArtificial
sequenceSynthetic oligonucleotide 59caggaacagu uuguggaucu gugca
256025RNAArtificial sequenceSynthetic oligonucleotide 60caucaagccc
guguaugucu uugau 256121DNAArtificial sequenceSynthetic
oligonucleotidemisc_feature(1)..(19)bases at these positions are
RNA 61gaagugaagu uguacaagat t 216221DNAArtificial sequenceSynthetic
oligonucleotidemisc_feature(1)..(19)bases at these positions are
RNA 62gaagtaaagc tctacaagat t 216320RNAArtificial sequenceSynthetic
oligonucleotide 63ggcaacuguc gcugagaaca 206425RNAArtificial
sequenceSynthetic oligonucleotide 64ccuacauggc uuaucuuaug aucug
256525RNAArtificial sequenceSynthetic oligonucleotide 65cagccaucca
gcacccucgc uacaa 25
* * * * *
References