U.S. patent application number 15/814761 was filed with the patent office on 2018-03-22 for nucleic acid detection method, detection probe, detection probe set, and nucleic acid quantification method.
This patent application is currently assigned to The University of Tokyo. The applicant listed for this patent is Nikon Corporaton, The University of Tokyo. Invention is credited to Takashi Funatsu, Takanori Ichiki, Hirofumi Shiono, Taro Ueno.
Application Number | 20180080076 15/814761 |
Document ID | / |
Family ID | 49327485 |
Filed Date | 2018-03-22 |
United States Patent
Application |
20180080076 |
Kind Code |
A1 |
Ueno; Taro ; et al. |
March 22, 2018 |
NUCLEIC ACID DETECTION METHOD, DETECTION PROBE, DETECTION PROBE
SET, AND NUCLEIC ACID QUANTIFICATION METHOD
Abstract
A method for detecting a target nucleic acid, comprising: (a)
contacting a nucleic acid sample comprising a target nucleic acid,
comprising a first portion and a second portion, with: (i) a
detection probe, wherein the detection probe is labeled with a
labeling substance and comprises a nucleic acid sequence that forms
a stem-loop structure and having a 5' protruding end or a 3'
protruding end that is capable of hybridizing to the second
portion, and (ii) a capture probe comprising a nucleic acid
sequence capable of hybridizing to the first portion, wherein the
capture probe is immobilized to a substrate, under conditions to
form a target nucleic acid-detection probe-capture probe complex by
hybridizing the second portion to the detection probe and
hybridizing the first portion to the capture probe; (b) ligating a
first end of the detection probe with an end of the target nucleic
acid and ligating a second end of the detection probe with an end
of the capture probe; and (c) detecting the labeling substance of
the nucleic acid-detection probe-capture probe complex formed on
the substrate.
Inventors: |
Ueno; Taro; (Tokyo, JP)
; Funatsu; Takashi; (Tokyo, JP) ; Ichiki;
Takanori; (Tokyo, JP) ; Shiono; Hirofumi;
(Fujisawa-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of Tokyo
Nikon Corporaton |
Tokyo
Tokyo |
|
JP
JP |
|
|
Assignee: |
The University of Tokyo
Tokyo
JP
Nikon Corporation
Tokyo
JP
|
Family ID: |
49327485 |
Appl. No.: |
15/814761 |
Filed: |
November 16, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14510282 |
Oct 9, 2014 |
9850535 |
|
|
15814761 |
|
|
|
|
PCT/JP2013/057410 |
Mar 15, 2013 |
|
|
|
14510282 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6834 20130101;
C12Q 1/6876 20130101; C12Q 1/6837 20130101; C12Q 2600/178 20130101;
C12Q 1/6834 20130101; C12Q 2521/501 20130101; C12Q 2525/301
20130101; C12Q 2565/519 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 12, 2012 |
JP |
2012-091088 |
Claims
1. A probe set for detecting a target nucleic acid comprising a
first portion and a second portion, comprising: a detection probe
comprising a first stem forming portion, a second stem forming
portion, a loop portion, and a 5' protruding end or 3' protruding
end that comprises a sequence capable of hybridizing to the second
portion of the target nucleic acid, wherein the first and second
stem forming portions are complementary to each other, the loop
portion is located between the first and second stem forming
portions, the loop portion is labeled with a labeling substance;
and a capture probe comprising a sequence that hybridizes to the
first portion of the target nucleic acid, wherein the capture probe
is immobilized to a substrate.
2. The probe set according to claim 1, wherein the target nucleic
acid is miRNA.
3. The probe set according to claim 1, wherein the capture probe
comprises a spacer at one end that binds to the substrate.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This is a Divisional of U.S. application Ser. No.
14/510,282, filed Oct. 9, 2014, which is a Continuation Application
of International Application No. PCT/JP2013/057410, filed Mar. 15,
2013, which claims priority to Japanese Patent Application No.
2012-091088 filed on Apr. 12, 2012. The contents of the
aforementioned applications are incorporated herein by
reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 13, 2017, is named 107929-0141_SL.txt and is 9 KB in
size.
TECHNICAL FIELD
[0003] The present invention relates to a nucleic acid detection
method, detection probe, detection probe set, and nucleic acid
quantification method.
BACKGROUND ART
[0004] Conventionally, DNA microarray targeting mRNA is widely used
as a means of measuring the gene expression levels in cells. In the
21st century, it is reported that miRNA, which is a short-chain and
a non-coding RNA, controls gene expression in vivo, and
relationships between abnormal expression of miRNA and a variety of
diseases such as the cancer have been elucidated. Based on these
findings, development race of the DNA microarray targeting miRNA
takes place.
[0005] Furthermore, the possibility of diagnosis of cancer in which
blood test is simply conducted was shown since Mitchell et al,
Proc. Nat. Acad. Sci. vol. 105, pp 10513-10518, 2008, showed that
miRNA is circulating in the blood in 2008. Accordingly, it is
expected that the market of DNA microarray targeting miRNA will
rapidly expand in the near future.
[0006] On the other hand, quantitative PCR (qRT-PCR) method is
widely put to practical use as a technique which quantifies miRNA
by using a reverse transcription reaction to cDNA. The quantitative
PCR method is a method which converts miRNA to cDNA by using a
reverse transcriptase, and amplifies the cDNA, to estimate the
amount of miRNA used as a template. The quantitative PCR method has
a problem such that parallel processing for multiple samples and
various miRNAs is difficult, since it is a method for measuring the
amount of cDNA amplified to a certain amount by using PCR reaction,
while quantitative capability is higher than that of DNA
microarray.
[0007] The existing DNA microarrays targeting miRNA (hereinafter
referred as miRNA targeting DNA microarrays) are obtained by
arranging nucleic acid probes having gene sequences complementarily
hybridizing to the objective miRNA on a transparent substrate.
[0008] As the quantification method of miRNA using miRNA targeting
DNA microarrays, for example, the following methods are
exemplified. First, after extracting miRNA from a biological
sample, fluorescently labelling miRNA, then the labeled miRNA is
added to the miRNA targeting DNA microarray to hybridize to the
nucleic acid probe on the substrate. Then, after washing miRNA that
is nonspecifically adsorbed to the substrate, the amount of miRNA
is estimated based on the fluorescence intensity.
[0009] When preparing miRNA from a biological sample, total RNA is
extracted from the biological sample and purified, then the total
RNA including miRNA is fluorescently labeled, then the
fluorescently labeled total RNA including fluorescently labeled
miRNA is contacted with miRNA targeting DNA microarrays.
[0010] However, miRNA is susceptible to the effect of adsorption or
decomposition during pipetting in the case such pre-treatment step
is complex, because the amount of miRNA in vivo, especially in
blood, is 0.01% by mass among total RNA and very small.
Furthermore, there is also a problem such that variations in
fluorescent labeling index of each measurement arise to lower the
reproducibility of the measurement results.
[0011] In addition, it is desired that all of the pretreatment
steps will be fully automated to be able to be performed on the
chip by using .mu.-TAS (Micro-Total Analysis Systems) in the
future, since such hand working pretreatment is affected by the
technology differences of scientists or clinical laboratory
technicians. Here, the .mu.-TAS means the microfluidic device
analyzing biological molecules on a single chip provided with a
small flow path, reaction chamber and mixing chamber on the chip by
using the MEMS (Micro Electro Mechanical Systems) technology.
However, the fluorescently labeling method becomes a bottleneck as
shown below, integration into full automation has not
progressed.
[0012] The main methods of fluorescently labeling miRNA include a
method of fluorescently labeling the base portion of miRNA
directly, and a method of adding a fluorescently labeled nucleotide
to the 3' end of miRNA using an enzyme such as T4 DNA ligase.
[0013] However, since all of nucleic acids are fluorescently
labeled non-specifically by these methods, it is necessary to
remove the unreacted fluorescent reagent and the like from the
fluorescently pre-labeled target miRNA prior to hybridization to
the nucleic acid probe on the substrate. Gel filtration
chromatography is generally used to separate these, and it is
necessary to accurately separate short miRNA whose length is about
22 bases from the unreacted fluorescent reagent. For example, in
the case of separating by using the .mu.-TAS, a step of migrating a
biological sample in an area filled with resin for a long distance
is required, and it is extremely difficult to carry out the step in
a chip with a limited space. Even if it is possible, in order to
repeat the experiment continuously, it is required to flush the
unreacted fluorescence reagent by washing for a long time, and it
is not practical.
[0014] For the above problem, a sandwich-type microarray method
which can detect miRNA without the separation process of the
unreacted fluorescent dye has been devised in WO2008/052774.
[0015] As a first method of the sandwich-type microarray method,
concretely, the following steps are exemplified. First, by dual
partitioning nucleic acid probes having a sequence complementary to
each miRNA 103 which comprises first portion 100 and second portion
101, capture probe 104 (Capture probe) and detection probe 105
(Detect probe) are generated. Then, a microarray is fabricated by
arranging the capture probe 104 group having a sequence
complementary to the first portion 100 of each miRNA 103 on the
substrate 106 (see FIG. 5).
[0016] Then, after contacting each miRNA 103 with the fabricated
microarray substrates (substrate 106), the tripartite of miRNA 103,
capture probe 104 and detection probe 105 are hybridized by
contacting a solution containing the detection probe 105 group
having a sequence complementary to the second portion 101 of each
miRNA 103 with the microarray substrate (substrate 106). It is not
necessary to separate the unreacted detection probe 104 by such as
chromatography since the detection probe 105 recognizes and binds
to the second portion 101 of miRNA 103, and non-specific binding to
the capture probe 104 does not occur.
[0017] However, in the first method described in WO2008/052774,
each sequence complementary to miRNA 103 in one probe becomes about
10 bases since the nucleic acid probe having a sequence
complementary to miRNA 103 is divided into two portions. As a
result, the affinity of miRNA 103 and the nucleic acid probe is
reduced, and it is difficult to accurately quantify miRNA 103 which
exists in blood in only trace amounts. In addition, pre-miRNA
(precursor of miRNA) of about 70 bases is contained in the
biological sample. There is a fundamental problem in the first
method of WO2008/052774, it is impossible to accurately quantify
only miRNA having a gene expression control function, because
pre-miRNA contains a sequence of a miRNA of about 22 bases, and the
first method of WO2008/052774 cannot distinguish pre-miRNA and
miRNA.
[0018] As a solution to this problem, in the second method
described in WO2008/052774, further, a method for covalently
bonding miRNA 103 and the nucleic acid probe using ligase has been
proposed (see FIG. 6). However, in the first method shown in FIG.
5, when ligase is used, there is a risk such that the same molecule
miRNA 103 is detected more than once, since the capture probe 104
is covalently bonded to the detection probe 105 which hybridized
with miRNA 103, then miRNA 103 is dissociated and binds to the
other capture probe 104.
[0019] On the other hand, in the second method shown in FIG. 6,
dissociation of miRNA 103 from the substrate 106 is prevented by
further using two kinds of the bridging probes 107, 108 (c-bridge
107, d-bridge 108), thereby covalently bonding the capture probe
104, miRNA 103 and the detection probe 109 by ligation.
DISCLOSURE OF THE INVENTION
Problems to be Solved by the Invention
[0020] However, for example, in the second method described in
Patent Document 1, the signal is detected only when all of miRNA
103 and four kinds of probes collide with each other and five kinds
of the molecules form a complex, and the operation is complicated
and time consuming.
[0021] The present invention provides a method for detecting
nucleic acid which is capable of detecting the nucleic acid, as
well as a detection probe and a detection probe set used in the
method for detecting nucleic acid.
Means of Solving the Problems
[0022] As a result of conducting extensive studies to achieve the
aforementioned problems, the inventors of the present invention
found that the problems can be solved by using a detection probe
that forms a stem-loop structure. Embodiments of the present
invention provide the following (1) to (19).
(1) A method for detecting a target nucleic acid, comprising: (a)
contacting a nucleic acid sample comprising a target nucleic acid,
comprising a first portion and a second portion, with: (i) a
detection probe, wherein the detection probe is labeled with a
labeling substance and comprises a nucleic acid sequence that forms
a stem-loop structure and having a 5' protruding end or a 3'
protruding end that is capable of hybridizing to the second
portion, and (ii) a capture probe comprising a nucleic acid
sequence capable of hybridizing to the first portion, wherein the
capture probe is immobilized to a substrate, under conditions to
form a target nucleic acid-detection probe-capture probe complex by
hybridizing the second portion to the detection probe and
hybridizing the first portion to the capture probe; (b) ligating a
first end of the detection probe with an end of the target nucleic
acid and ligating a second end of the detection probe with an end
of the capture probe; and (c) detecting the labeling substance of
the nucleic acid-detection probe-capture probe complex formed on
the substrate. (2) The method for detecting a target nucleic acid
according to (1), wherein the nucleic acid sample comprising the
target nucleic acid is contacted with the detection probe in a
solution. (3) The method for detecting a target nucleic acid
according to (1) or (2), wherein the target nucleic acid is
contacted with the detection probe after the target nucleic acid is
contacted with the capture probe. (4) The method for detecting a
target nucleic acid according to any one of (1) to (3), wherein the
target nucleic acid is contacted with the capture probe after the
target nucleic acid is contacted with the detection probe. (5) The
method for detecting a target nucleic acid according to any one of
(1) to (4), wherein the method further comprises a step of
quantifying the target nucleic acid by quantitatively detecting the
labeling substance of the nucleic acid-detection probe-capture
probe complex formed on the substrate. (6) The method for detecting
a target nucleic acid according to any one of (1) to (5), wherein a
plurality of detection probes is employed to detect a plurality of
different target nucleic acids in the nucleic acid sample, wherein
the detection probes are labeled with--a labeling substances that
is different for each different target nucleic acid detected. (7)
The method for detecting a target nucleic acid according to any one
of (1) to (6), wherein the 5' end or the 3' end of the capture
probe is immobilized to the substrate. (8) The method for detecting
a target nucleic acid according to any one of (1) to (7), wherein
the target nucleic acid is contacted with a plurality of detection
probes having varying base lengths and a plurality of capture
probes having varying base lengths. (9) The method for detecting a
target nucleic acid according to any one of (1) to (8), wherein
step (a) and step (b) are performed simultaneously. (10) The method
for detecting a target nucleic acid according to any one of (1) to
(9), wherein the capture probe and/or the detection probe contain a
LNA (Locked Nucleic Acid) or a BNA (Bridged Nucleic Acid). (11) A
detection probe that hybridizes to a target nucleic acid comprising
a first portion and a second portion, wherein the detection probe
comprises: a first stem forming portion and a second stem forming
portion, wherein the first and second stem forming portions are
complementary to each other; a loop portion located between the
first and second stem forming portions, wherein the loop portion is
labeled with a labeling substance; and a 5' protruding end or a 3'
protruding end, comprising a sequence capable of hybridizing to the
second portion of the target nucleic acid. (12) The detection probe
according to (11), wherein a label of the loop portion is related
to the nucleotide sequence of the second portion. (13) The
detection probe according to (11) or (12), wherein the target
nucleic acid is miRNA. (14) A detection probe set comprising a
plurality of detection probes that can hybridize to a plurality of
different target nucleic acids each comprising a first portion and
a second portion, wherein the detection probes comprise: a first
stem forming portion and a second stem forming portion, wherein the
first and second stem forming portions are complementary to each
other; a loop portion located between the first and second stem
forming portions, wherein the loop portion is labeled with a
labeling substances that is different for each different target
nucleic acid to be detected; and a 5' protruding end or a 3'
protruding end, comprising a sequence capable of hybridizing to the
second portion of a target nucleic acid. (15) The detection probe
set according to (14), wherein the target nucleic acid is miRNA.
(16) The method for detecting a target nucleic acid according to
any one of (1) to (10), wherein the target nucleic acid is a short
chain RNA. (17) The method for detecting a target nucleic acid
according to any one of (1) to (10) and (16), wherein the target
nucleic acid is miRNA. (18) The method for detecting a target
nucleic acid according to any one of (1) to (10), (16) and (17),
wherein the first portion of the target nucleic acid is about 5 to
17 bases. (19) The method for detecting a target nucleic acid
according to any one of (1) to (10) and (16) to (18), wherein the
second portion of the target nucleic acid is about 5 to 17
bases.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 is a schematic view of one embodiment of a method for
quantifying nucleic acids in this embodiment.
[0024] FIG. 2 is a schematic view of one embodiment of the
detection probe in the embodiment.
[0025] FIG. 3 is a quantitative result of miRNA in Example 1.
[0026] FIG. 4 is a quantitative result of miRNA in Example 2.
[0027] FIG. 5 is a schematic view of one embodiment of a
conventional method for quantifying nucleic acids.
[0028] FIG. 6 is a schematic view of one embodiment of a
conventional method for quantifying nucleic acids.
[0029] FIG. 7 is a schematic view of one embodiment of a method for
quantifying nucleic acids in this embodiment. FIG. 7 discloses SEQ
ID NOS 26-27, 11, 11, 26, 28, 21 and 21, respectively, in order of
appearance.
[0030] FIG. 8 is a result of electrophoresis in Example 4.
[0031] FIG. 9 is a schematic view of a microchip in Example 5.
[0032] FIG. 10 is a fluorescence image of the detection probe fixed
on a glass substrate in Example 5.
[0033] FIG. 11 is a fluorescence image of the capture probe or the
detection probe fixed on a glass substrate in Example 5.
BEST MODE FOR CARRYING OUT THE INVENTION
<<Method for Detecting Nucleic Acids>>
[0034] The nucleic acid to be detected (target nucleic acid) is not
particularly limited, short chain RNA such as miRNA or short chain
mRNA generated by stopping transcription on the way is preferable,
and miRNA which exists in various types in vivo, and is involved in
the regulation of gene expression is more preferable.
[0035] As an example, a method for quantifying nucleic acids of the
present embodiment comprises,
(a) a step of contacting a solution comprising: a nucleic acid
sample containing miRNA comprising a first portion and a second
portion, and a detection probe labeled with a labeling substance
containing a sequence which forms a stem-loop structure and is
capable of hybridizing to the second portion, and having 5'
protruding end or 3' protruding end, with a substrate fixed with a
capture probe containing a sequence capable of hybridizing to the
first portion, (b) a step of forming the miRNA--the detection
probe--the capture probe complex on the substrate by hybridizing
the second portion to the detection probe and hybridizing the first
portion to the capture probe, (c) a step of ligating an end of the
detection probe and ends of the miRNA and the capture probe, (d) a
step of quantitatively detecting the labeling substance of the
miRNA--the detection probe--the capture probe complex formed on the
substrate, and quantifying miRNA of the nucleic acid sample from a
detection result.
[0036] Hereinafter, with reference to FIG. 1, each step in this
embodiment will be described.
[0037] The step (a) is a step of contacting a solution comprising:
a nucleic acid sample containing miRNA 3 comprising a first portion
1 and a second portion 2, and a detection probe 5 labeled with a
labeling substance 5a containing a sequence 5b which forms a
stem-loop structure and is capable of hybridizing to the second
portion 2, and having 5' protruding end or 3' protruding end, with
a substrate 6 fixed with a capture probe 4 containing a sequence
capable of hybridizing to the first portion.
[0038] As shown in FIG. 1, miRNA 3 to be detected is divided into
two portions, the first portion 1 and the second portion 2. That is
to say, miRNA 3 comprises the first portion and the second
portion.
[0039] The capture probe 4 and the detection probe 5 are capable of
hybridizing to the first portion 1 and the second portion 2 of
miRNA 3, respectively. Accordingly, the lengths of the first
portion 1 and the second portion 2 are preferably 5 to 17 bases,
and based on the viewpoint of the base number generated by dividing
miRNA of about 22 bases into two portions, 7 to 15 bases are more
preferable.
[0040] The lengths of these first portion 1 and second portion 2
are not particularly limited to the above base numbers, as long as
the following two points are guaranteed. (1) The Tm values of the
first portion 1 and the second portion 2 are near the optimum
temperature of T4 DNA ligase (37.degree. C.). (2) Sequence
specificity is maintained. The above two points are affected by the
GC content of the first portion 1 and the second portion 2 and
existence of similar nucleic acids to the target miRNA. In the
present embodiment, 5' portion of miRNA refers to the first portion
1 and 3' portion of miRNA refers to the second portion 2.
[0041] In the present invention and the specification of the
present application, "capable of hybridizing" means that part of
the capture probe and the detection probe used in the present
invention hybridizes to the target nucleic acid (target miRNA)
under the stringent conditions, and means that it does not
hybridize to the nucleic acid molecule other than target nucleic
acid (target miRNA). The "stringent conditions", for example, the
conditions include those described in Molecular Cloning-A
LABORATORY MANUAL THIRD EDITION (Sambrook et al, Cold Spring Harbor
Laboratory Press).
[0042] The nucleic acid sample is not particularly limited, as long
as the sample contains a nucleic acid, for example, when the method
for quantifying nucleic acids of the present embodiment is used for
diagnosis of cancer, the nucleic acid samples are preferably those
obtained by extracting nucleic acids from a sample such as blood,
lymph, cerebrospinal fluid, semen, saliva, urine, of a subject such
as a person being identified onset of cancer, a person being
suspected onset of cancer, or a patient being treated for cancer,
etc. Nucleic acids extraction from these samples may be carried out
by a conventional method such as using Trizol, but utilizing the
method of extracting short chain RNA is preferred.
[0043] As described above, since the amount of miRNA in blood, is
0.01% by mass among total RNA and very small, miRNA enriched by
fractionation from total RNA extracted from the sample may be used
as a nucleic acid sample, in the present embodiment, a sample which
is not fractionated may be used as a nucleic acid sample, since it
is not necessary to label miRNA itself to be detected with a
labeling substance.
[0044] The capture probe 4 contains a sequence capable of
hybridizing to the first portion 1 of miRNA 3 in the 5' end
region.
[0045] From the viewpoint of quantifying miRNA 3 with high
accuracy, it is preferable that the capture probe 4 does not
contain a sequence complementary to the second portion 2 of miRNA 3
so that the capture probe 4 does not hybridize to the second
portion 2 of miRNA 3.
[0046] The capture probe 4 preferably has a spacer 4a at the 3' end
which binds to the substrate 6, since molecular flexibility is
required for hybridization of the capture probe 4 fixed to
(immobilized to) the substrate 6 with miRNA 3. As the length of the
spacer 4a is not particularly limited, 3 to 50 bases are
preferable, 5 to 25 bases are more preferable. However, the bases
used in the spacer, can be replaced with a linker such as PEG
having the nearly equal length and softness. In such a case, the
number of bases used for the spacer 4a may be 0 bases. The length
of the capture probe 4 is not particularly limited, as long as the
length is one required to function as a probe, but taking into
account the number of bases of the first portion 1 and the spacer
4a, 3 to 50 bases are preferable, 5 to 40 bases are more
preferable.
[0047] The capture probe 4 may be DNA or RNA, and it is not limited
to natural or non-natural, as long as it has the similar function
to RNA or DNA, and it may contain artificial nucleic acid such as
PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), BNA (Bridged
Nucleic Acid), etc. The capture probe 4 preferably contain LNA or
BNA since LNA and BNA has high affinity with the target miRNA 3 in
comparison with DNA or RNA, and LNA and BNA is resistant to
deoxyribonuclease or ribonuclease, and LNA and BNA can be a
substrate for DNA ligase such as T4 DNA ligase.
[0048] Upon ligation in step (c), in this embodiment, the 5' end of
the capture probe 4 is preferably phosphorylated by using the
enzyme such as T4 polynucleotide kinase.
[0049] Moreover, in step (d), upon quantifying the miRNA 3--the
detection probe 5--the capture probe 4 complex formed on the
substrate 6, the capture probe 4 is preferably labeled with
different types of the labeling substance from the labeling
substance which is used for labeling the detection probe 5. The
labeling substances used for labeling the capture probe 4 include
similar substances used for labeling the detection probe 5 as
described later.
[0050] The substrate 6 used for fixing the capture probe 4 includes
a glass substrate, a silicon substrate, a plastic substrate, a
metal substrate, and the like. The method for fixing the capture
probe 4 on the substrate 6 includes a method for fixing the probe
at a high density on the substrate by using a photolithographic
technique, a method of fixing the probe by spotting on a glass
substrate, and the like.
[0051] In the case of using a photolithographic technique, it is
possible to synthesize the capture probe 4 on the substrate 6. In
the case of fixing the capture probe 4 by spotting, a solid phase
binding site is preferably provided to the capture probe 4, and a
recognition site for the solid phase binding site is preferably
provided on the substrate 6.
[0052] The combinations of such solid phase binding site/the
recognition site for the solid phase binding site include
combinations of the solid phase binding site provided by modifying
the capture probe 4 with a functional group such as an amino group,
a formyl group, SH group, a succimidyl ester group, and the
recognition site for the solid phase binding site provided by
modifying the substrate 6 by surface treatment with a silane
coupling agent having an amino group, a formyl group, an epoxy
group, a maleimide group, and a combination using gold-thiol
bond.
[0053] In addition, as another method for fixing the capture probe
by spotting, a method of discharging capture probes having a
silanol group on a glass substrate, arranging the capture probes,
then covalently bonding the capture probes with a silane coupling
reaction, is exemplified.
[0054] In this embodiment, the detection probe 5 contains a
sequence 5b capable of hybridizing with the second portion 2 of
miRNA 3 at the 3' terminal region.
[0055] From the viewpoint of accurate quantification of miRNA 3, it
is preferable that the detection probe 5 does not contain a
sequence complementary to the first portion 1 of miRNA 3, so that
it does not hybridize to the first portion 1 of miRNA 3.
[0056] The detection probe 5 forms a stem-loop structure. When
there are complementary sequences in two separate regions within a
molecule in a single-stranded nucleic acid, the stem-loop structure
is formed by forming a complementary strand (stem structure) by the
interaction between base pairs of nucleic acids, and by forming a
loop structure of a sequence between the two regions. It is also
referred to as a hairpin loop.
[0057] In this embodiment, the detection probe 5 comprises, from
the 5' end, two stem portions 5c and 5d which form a complementary
strand, a loop portion 5e which is a region between the two stem
portions 5c and 5d, and a sequence 5b capable of hybridizing to the
second portion 2. That is to say, the detection probe 5 has a 3'
protruding end. The detection probe has a protruding end, and
whether the protruding end of the detection probe is a 5'
protruding end or 3' protruding end is determined by whether the
capture probe is bound to the substrate via the 5' end or the 3'
end of the capture probe.
[0058] The detection probe-miRNA-capture probe complex is not
formed even if the capture probe forms a complex with pre-miRNA
(precursor miRNA) containing a same base sequence region as miRNA,
since the detection probe has a protruding end, and steric
hindrance occurs. Therefore, according to this embodiment, it is
possible to quantify the target miRNA with high accuracy, because
pre-miRNA is not recognized, and only the target miRNA is
recognized.
[0059] The length of the stem portion of the detection probe 5 is
determined by the balance with the length of the loop portion, and
it is not particularly limited as long as the detection probe 5 can
stably form a stem-loop structure, but 3 to 50 bases are
preferable, and 5 to 20 bases are more preferable.
[0060] The length of the loop portion of the detection probe 5 is
determined by the balance with the length of the stem portion, and
it is not particularly limited as long as the detection probe 5 can
stably form a stem-loop structure, but 3 to 200 bases are
preferable, and 5 to 100 bases are more preferable.
[0061] The length of the detection probe 5 is not particularly
limited as long as the detection probe 5 can stably form a
stem-loop structure, and the length is one required to function as
a probe. However, taking the base number of the second portion 2
and the base number necessary for the stem-loop structure formation
into consideration, 14 to 200 bases are preferable, and 24 to 150
bases are more preferable.
[0062] The detection probe 5 may be DNA or RNA, and it is not
limited to natural or non-natural, as long as it has the similar
function to DNA or RNA, and it may contain artificial nucleic acid
such as PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), BNA
(Bridged Nucleic Acid), etc. The detection probe 5 preferably
contain LNA or BNA since LNA and BNA has high affinity with the
target miRNA in comparison with DNA or RNA, LNA and BNA is
resistant to deoxyribonuclease or ribonuclease, and LNA and BNA can
be a substrate for DNA ligase such as T4 DNA ligase.
[0063] It is preferable that at least one of the capture probe 4
and the detection probe 5 contains LNA or BNA, and it is more
preferable that both of the capture probe 4 and the detection probe
5 contains LNA or BNA.
[0064] Upon ligation in step (c), the 5' end of the detection probe
5 is preferably phosphorylated by using the enzyme such as T4
polynucleotide kinase.
[0065] The detection probe 5 is labeled with a labeling substance
5a. From the viewpoint of steric hindrance during the formation of
the miRNA 3-detection probe 5-capture probe 4 complex described
later, the labeling substance 5a is preferably bound to the loop
portion 5e.
[0066] The labeling substances include, for example, fluorescent
dye, fluorescent beads, quantum dots, biotin, antibody, antigen,
energy absorbing materials, radioisotopes, chemiluminescent,
enzyme, and the like.
[0067] The fluorescent dyes include, FAM (carboxyfluorescein), JOE
(6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), FITC
(fluorescein isothiocyanate), TET (tetrachlorofluorescein), HEX
(5'-hexachloro-fluorescein-CE phosphoramidite), Cy3, Cy5, Alexa568,
Alexa647, and the like.
[0068] Since miRNA exists in only trace amounts among total RNA,
labeling miRNA with high efficiency without fractionation is
difficult. On the other hand, in the present embodiment, it is
possible to quantitate miRNA with high sensitivity, since the
detection probe which is labeled in advance is used.
[0069] If the capture probe 4 is labeled with a labeling substance,
combination of a labeling substance for labeling the capture probe
4 and a labeling substance for labeling the detection probe 5, may
be a combination by which FRET (Fluorescence Resonance Energy
Transfer) cannot occur, and may be a combination by which FRET can
occur.
[0070] The combination by which FRET cannot occur is preferred from
the viewpoint that FRET efficiency is different by the sequence and
length of the target miRNA. Even in the case of using a combination
of the labeling substances by which FRET can occur, for example, it
can also be designed so that FRET between the labeling substances
does not occur by labeling the near end of the capture probe to the
substrate with FAM and labeling the farthest loop portion from the
substrate of the detection probe with Alexa647.
[0071] In addition, the combination by which FRET can occur is
preferable in view of being able to distinguish whether the
detection probe is coupled to the capture probe or the detection
probe is adsorbed to the substrate.
[0072] As a combination of the labeling substances by which FRET
can occur, a combination of fluorescent dye excitation wavelength
thereof is near 490 nm (for example, FITC, rhodamine green, Alexa
(registered trademark) fluor 488, Body P FL, etc.) and fluorescent
dye excitation wavelength thereof is near 540 nm (for example,
TAMRA, tetramethyl rhodamine, Cy3), or a combination of fluorescent
dye excitation wavelength thereof is near 540 nm and fluorescent
dye excitation wavelength thereof is near 630 nm (for example, Cy5,
or the like) is preferable.
[0073] In addition, in the present embodiment, the two probes, the
capture probe and the detection probe recognize the first portion
and the second portion of the target miRNA, respectively. For
example, when miRNA is let-7a (5'-UGAGGUAGUAGGUUGUAUAGUU-3') (SEQ
ID NO: 11), by setting the first portion of let-7a to
5'-UGAGGUAGUAG-3' (SEQ ID NO: 16) and setting the second portion of
let-7a to 5'-GUUGUAUAGUU-3' (SEQ ID NO: 17) to produce the capture
probe and the detection probe containing sequences capable of
hybridizing to the first portion and the second portion,
respectively. Here, in the detection probe, when setting a sequence
that is capable of hybridizing to the second portion to
5'-AACTATACAAC-3' (SEQ ID NO: 18), let-7f
(5'-UGAGGUAGUAGAUUGUAUAGUU-3') (SEQ ID NO: 19) in which the first
base guanine is substituted with adenine in the second portion of
let-7a, cannot form a covalent bond by ligation with detection
probe.
[0074] Thus, according to this embodiment, it is possible to
identify difference of one base in miRNA strictly, and to quantify
the target miRNA with high accuracy.
[0075] Since the sequences of the first portions of the let-7a and
let-7f are completely the same, when quantifying in parallel, both
sequences hybridize to the same capture probe 4 on the microarray,
each sequence forms the miRNA 3-detection probe 5-capture probe 4
complex. Therefore, a combined signal of both miRNAs is detected in
the area, which may lead to erroneous results. For example, in
Patent Document 1, this is a fatal problem.
[0076] The present inventors have found that it is possible to
solve this problem by the following three points.
[0077] First, in the step (a), the solution preferably contains
plural kinds of detection probes which are labeled with different
kinds of labeling substances.
[0078] This is a method in which the detection probe (let-7a) and
the detection probe (let-7f) which hybridize the second portions of
let-7a and let-7f, respectively, are labeled with different kinds
of labeling substances, thereby quantifying the each signal
separately. A method of labeling the both probes in which
fluorescent substances having different wavelengths, Alexa532 and
Alexa647 are used as labeling substances is exemplified.
[0079] Secondly, in the step (a), the nucleic acid sample
preferably contains plural kinds of miRNA having different sequence
to be detected, and it is preferably selected that either 5' end or
3' end of the capture probe is fixed to (immobilized to) the
substrate so as not to be the same sequence in the first portions
of the plural kinds of miRNA.
[0080] This is a method in which the probes hybridizing to portions
having different sequence among the similar miRNAs are used as the
capture probes. When let-7a and let-7f are exemplified, 3' distal
5'-GUUGUAUAGUU-3' (SEQ ID NO: 17) and 5'-AUUGUAUAGUU-3' (SEQ ID NO:
20) having different sequences are set to the first portions, and
5' distal 5'-UGAGGUAGUAG-3' (SEQ ID NO: 16) having common sequence
is set to the second portion. By inverting the position of the 5'
end and 3' end shown in FIG. 1, it is possible to form the capture
probe 4-detection probe 5-miRNA 3 complex in which the 5' end of
the capture probe 4 is fixed on the substrate. In this case,
sequence of the detection probe 5 for let-7a and let-7f is the
same, the labeling substance to be labeled is also the same.
[0081] In addition, thirdly, in the step (a), the solution
preferably contains a plurality of detection probes having
different base lengths (varying base lengths), and a plurality of
capture probes having different base lengths. For example, when two
kinds of the target object miRNA are let-7a
(5'-UGAGGUAGUAGGUUGUAUAGUU-3') (SEQ ID NO: 11) and let-7b
(5'-UGAGGUAGUAGGUUGUGUGGUU-3') (SEQ ID NO: 21), the capture probe
(5'-AACCTACTACCTCA-3' (SEQ ID NO: 22); C-probe-let7a-D8) having 14
bases of complementary chain, and the detection probe
(5'-AACTATAC-3' (SEQ ID NO: 23); D-probe-let7a-D8) having 8 bases
of complementary chain are prepared as the probes for let-7a, and
the capture probe (5'-ACCTACTACCTCA-3' (SEQ ID NO: 24);
C-probe-let7b-D9) having 13 bases of complementary chain, and the
detection probe (5'-AACCACACA-3' (SEQ ID NO: 25); D-probe-let7b-D9)
having 9 bases of complementary chain are prepared as the probes
for let-7b.
[0082] let-7a reacts only with the detection probe of 8 bases
(D-probe-let7a-D8), thereby forming a binary complex, and further
hybridizes to the capture probe of 14 bases (C-probe-let7a-D8),
thereby forming a ternary complex, then covalent bonds are formed
by T4 DNA ligase.
[0083] On the other hand, the binary complex of let-7a and
D-probe-let7a-D8 is possible to hybridize to the 13 bases of
C-probe-let7b-D9 (However, the affinity is low since there is no
stacking effect which occurs when the bases are laid side-by-side
each other), it is not ligated since the one base nick exists as
shown in the upper right of FIG. 7. The signal of the let-7a does
not appear on the spot fixed with the C-probe-let7b-D9, because the
signal will be 1/50,000 if ligation does not occur as described in
Example 2 described below.
[0084] Vice versa, let-7b reacts only with the detection probe of 9
bases (D-probe-let7b-D9), thereby forming a binary complex, and
further hybridizes to 13 bases of C-probe-let7b-D9), thereby
forming a ternary complex, then covalent bonds are formed by T4 DNA
ligase.
[0085] On the other hand, the binary complex of let-7b and
D-probe-let7b-D9 is possible to hybridize to the 14 bases of
C-probe-let7b-D9, it is not ligated since one base is surplus as
shown in the bottom right of FIG. 7.
[0086] In Example 4 described below, it is confirmed that the
signal is obtained when the capture probe and the detection probe
is adjacent as shown in the upper left of FIG. 7, but the signal is
not obtained at all when one base is deficient as shown in the
upper right of FIG. 7. Concretely, as the capture probe fixed to
the substrate, C-probe-let7a-D8 or C-probe-let7b-D9 was mixed with
let-7a and D-probe-let7a-D8, and reacted in solution, then
formation of a ternary complex was confirmed by acrylamide gel
electrophoresis. As a result, it has been confirmed that a ternary
complex was formed only when C-probe-let7a-D8 is mixed with let-7a
and D-probe-let7a-D8.
[0087] Thus, according to this embodiment, it is possible to
strictly distinguish similar miRNA, and to quantify the target
miRNA with high accuracy. In particular, when the abundances of two
kinds of the target object miRNA are largely different, according
to this embodiment, it is possible to accurately quantify the
low-abundance target miRNA.
[0088] The liquid used for a solution comprising a nucleic acid
sample containing miRNA 3, and the detection probe 5, includes
buffers used for ordinary hybridization and the like.
[0089] The step (b) is a step in which the second portion 2 is
hybridized to the detection probe 5, the first portion 1 is
hybridized to the capture probe 4, thereby forming the miRNA
3-detection probe 5-capture probe 4 complex on the substrate 6.
[0090] In the step (b), since miRNA easily forms a steric
structure, it is preferable that miRNA is heat-denatured by
incubating at 95.degree. C. for about 5 minutes, thereby enabling
easily hybridizing to the probe.
[0091] The condition of hybridization is not particularly limited,
it is preferable that hybridization is carried out under the
stringent conditions from the viewpoint of the highly accurate
quantification of miRNA although hybridization can be carried out
under conventional conditions temperature, pH, salt concentration,
buffer, etc., in consideration of the Tm value, etc., of each
probe.
[0092] The stringent conditions include, for example, temperature
conditions of about 30.degree. C. (temperature conditions in which
about 5.degree. C. to 10.degree. C. higher than the Tm of the probe
sequence), salt concentration conditions of less than 1 M, and the
like.
[0093] The step (c) is a step of ligating the end of the detection
probe 5, miRNA 3 and the end of the capture probe 4.
[0094] In order to prevent the miRNA 3 which hybridized to the
capture probe 4 and the detection probe 5, from dissociating from
these probes, 5' end of the detection probe 5 and 3' end of miRNA 3
are ligated, and 3' end of the detection probe 5 and 5' end of the
capture probe 4 are ligated.
[0095] By ligation, it is possible to prevent from detecting a
plurality of miRNA 3 in the step (e).
[0096] The enzyme used for ligation is preferably DNA ligase, for
example, T4 DNA ligase is exemplified.
[0097] The step (b) and the step (c) may be carried out
simultaneously. That is to say, hybridization and ligation may be
carried out simultaneously.
[0098] Moreover, it is possible to ligate 3' end of the detection
probe and 5' end of miRNA, and to ligate 5' end of the detection
probe and the 3' end of the capture probe, in the case as other
embodiments in which the capture probe and the substrate are bound
via 5' end of the capture probe by using the detection probe having
5' protruding end because the 5' end of miRNA is phosphorylated
during the biosynthesis.
[0099] By dividing the probe into two capture probe 4 and detection
probe 5, the affinity of each probe and the target miRNA 3 is
reduced slightly. However, it is possible to increase the affinity
of each probe and the target miRNA 3 by that (1) the substrate 6 is
bound to the capture probe 4 via the spacer 4a to impart a degree
of molecular freedom to the capture probe 4, (2) the capture probe
4 and/or the detection probe 5 include a LNA or BNA.
[0100] In order to remove those hybridized nonspecifically after
the hybridization reaction is completed, it is preferable to wash
the substrate 6. The method for washing can be carried out under
the usual conditions. From the viewpoint of quantifying miRNA with
high accuracy, it is preferably carried out under the stringent
conditions, for example, a method of washing several times by
shaking the substrate 6 in a solution of low salt concentration is
exemplified.
[0101] The step (d) is a step of quantitatively detecting the
labeling substance 5a in the miRNA 3-detection probe 5-capture
probe 4 complex formed on the substrate 6, and quantifying miRNA 3
in a nucleic acid sample from the detection result.
[0102] As described above, since the detection probe 5 is labeled
with a labeling substance 5a, the labeling substance 5a in the
miRNA 3-detection probe 5-capture probe 4 complex is quantitatively
detected. In this case, it is preferable to prepare a standard
curve by using known amounts of miRNA which is serially diluted,
and to utilize the standard curve. It is possible to quantify miRNA
3 in a nucleic acid sample by using such detection results.
[0103] The detection method of the labeling substance in step (d)
is not particularly limited, it can be carried out by using usual
methods for detecting nucleic acids, for example, measuring the
fluorescence intensity of the complex by using a nucleic acid
microarray automatically detecting apparatus, and the like.
[0104] According to the method for quantifying miRNA in the present
embodiment, since bridging probe conventionally required is
unnecessary, the operation is simplified, in addition, since there
is no need to label miRNA itself with a labeling substance, it is
possible to quantify the target miRNA with high sensitivity.
[0105] Furthermore, according to the method for quantifying miRNA
in the present embodiment, since the detection probe that forms a
stem-loop structure is used, it is possible to detect the target
miRNA without recognizing pre-miRNA.
<<Detection Probe and Detection Probe Set>>
[0106] As shown in FIG. 2, the detection probe of the present
embodiment is a detection probe 5 used to detect a nucleic acid
comprising a first portion and a second portion in a nucleic acid
sample. The detection probe 5 comprises, from the 5' end, two stem
portions 5c and 5d which form a complementary strand, a loop
portion 5e which is a region between the two stem portions 5c and
5d and labeled with a labeling substance, and a sequence 5b capable
of hybridizing to the second portion. That is to say, the detection
probe 5 has 3' protruding end. In addition, the detection probe of
the present embodiment may have 5' protruding end. In this case,
the detection probe of the present embodiment has a sequence
capable of hybridizing to the second portion at the 3' terminal
region.
[0107] In addition, from the viewpoint of the ability of strictly
distinguishing and recognizing similar miRNA, a label of the loop
portion is preferably related to the base sequence of the second
portion.
[0108] Furthermore, the target nucleic acid of the detection probe
5 is preferably miRNA.
[0109] The detection probe 5 may be labeled with a single labeling
substance, and as shown in FIG. 3, the detection probe 5 may be
labeled with a plurality of labeling substances 5a1 and 5a2. The
labeling substances 5a1 and 5a2 may be the same substance, and may
be the different substances.
[0110] When the same substance is used as the labeling substance
5a1 and 5a2, it is possible to raise the intensity of the label,
and to detect the target miRNA with higher sensitively.
[0111] In addition, when the different substances are used as the
labeling substances 5a1 and 5a2, it is possible to confirm
existence or non-existence of the formation of the stem-loop
structure of the detection probe based on FRET, for example, by
using a combination of labeling substances by which FRET can
occur.
[0112] The detection probe set of the present embodiment is a
detection probe set comprising plural kinds of detection probes
used to detect a nucleic acid comprising plurali kinds of first
portions and second portions in a nucleic acid sample. In the
detection probe of the present embodiment described above, each
loop portion is labeled with different kinds of labeling
substances, and the label of the loop portion and the base sequence
of the second portion are related in these plural kinds of
detection probes.
[0113] In addition, the target nucleic acid of the detection probe
set of the present embodiment is preferably miRNA.
[0114] As described above, among the plural miRNAs to be detected,
there are plural miRNAs in which the base sequence of the first
portion constituting miRNA is the same.
[0115] According to the detection probe set of the present
embodiment, since the sequence information (the base sequence of
the second portion) of the target miRNA recognized by the detection
probes constituting the detection probe set is related to different
kinds of labels, it is possible to exactly identify each miRNA.
<<Method for Detecting Nucleic Acid>>
First Embodiment
[0116] A method for detecting nucleic acid of the present
embodiment comprises:
(a) a step of contacting a solution comprising: a nucleic acid
sample containing a nucleic acid comprising a first portion and a
second portion, and a detection probe labeled with a labeling
substance containing a sequence which forms a stem-loop structure
and is capable of hybridizing to the second portion, and having 5'
protruding end or 3' protruding end, with a substrate fixed with a
capture probe containing a sequence capable of hybridizing to the
first portion, (b) a step of forming the nucleic acid--the
detection probe--the capture probe complex on the substrate by
hybridizing the second portion to the detection probe and
hybridizing the first portion to the capture probe, (c) a step of
hybridizing the first portion to the capture probe and ligating an
end of the detection probe and ends of the nucleic acid and the
capture probe, (d) a step of detecting the labeling substance of
the nucleic acid--the detection probe--the capture probe complex
formed on the substrate.
[0117] Each step in the method for detecting nucleic acid of the
present embodiment is the same as each step of the <<Method
for detecting nucleic acids>> described above, explanation
thereof will be omitted.
Second Embodiment
[0118] A method for detecting nucleic acid of the present
embodiment comprises:
(a') a step of contacting a nucleic acid sample containing a
nucleic acid comprising a first portion and a second portion with a
substrate fixed with a capture probe containing a sequence capable
of hybridizing to the first portion, (b') a step of hybridizing the
second portion to a detection probe by contacting the detection
probe labeled with a labeling substance containing a sequence which
forms a stem-loop structure and is capable of hybridizing to the
second portion and having 5' protruding end or 3' protruding end,
with the substrate, and forming the nucleic acid--the detection
probe--the capture probe complex on the substrate by hybridizing
the first portion to the capture probe, (c) a step of hybridizing
the first portion to the capture probe and ligating an end of the
detection probe and ends of the nucleic acid and the capture probe,
(d) a step of detecting the labeling substance of the nucleic
acid--the detection probe--the capture probe complex formed on the
substrate.
[0119] In the method for detecting nucleic acid of the present
embodiment, first, after contacting a nucleic acid sample with the
substrate to which the capture probe is fixed, contacting the
detection probe with the substrate. With regard to other steps,
they are the same as the method for detecting nucleic acid
according to the first embodiment.
[0120] According to the method for detecting miRNA in the present
embodiment, since bridging probe required conventionally is
unnecessary, the operation is simplified. Furthermore, since there
is no need to label miRNA itself with a labeling substance, it is
possible to detect the target miRNA with high sensitivity.
[0121] Hereinafter, explanation of the present invention is
provided by the following examples. However, the present invention
is not limited to the following examples.
EXAMPLES
Example 1
[0122] (Synthesis of Target miRNA, Capture Probe, and Detection
Probe)
[0123] RNA having the sequence of miR-141 was synthesized as the
target miRNA. In addition, two kinds of the nucleic acid probes,
the capture probe and the detection probe having complementary
sequence to the above RNA were designed and synthesized.
[0124] The sequences used for the target miRNA, the capture probe,
and the detection probe are shown below.
(1) Target miRNA: miR-141
TABLE-US-00001 (SEQ ID NO 1: 22 mer) [SEQ:
5'-UAACACUGUCUGGUAAAGAUGG-3']
(2) Capture probe 1 (Capture probe 1) [SEQ: 5'-p-X1-fS-3'] (SEQ ID
NO: 29) X1 represents the following sequence, p represents a
phosphate, S represents a thiol group, f represents a 6-FAM
(6-fluorescein).
TABLE-US-00002 (SEQ ID NO 2: 35 mer) X1:
ACCAGACAGTGTTAACAACAACAACAACAACAACA
(3) Detection probe 1 (Detect probe 1) [SEQ: 5'-p-X2-Al-X3-3'] (SEQ
ID NO: 30) X2, X3 represent the following sequences, p represents a
phosphate, Al represents an Alexa647-AminoC6-dA.
TABLE-US-00003 (SEQ ID NO 3: 17 mer) X2: CTCAACTGGTGTCGTGG (SEQ ID
NO 4: 26 mer) X3: GTCGGCAATTCAGTTGAGCCATCTTT
(3) Detection probe 1 (Detect probe 1) [SEQ: 5'-p-X2-Al-X3-3'] X2,
X3 represent the following sequences, p represents a phosphate, Al
represents an Alexa647-AminoC6-dA.
TABLE-US-00004 (SEQ ID NO 3: 17 mer) X2: CTCAACTGGTGTCGTGG (SEQ ID
NO 4: 26 mer) X3: GTCGGCAATTCAGTTGAGCCATCTTT
[0125] By using an ink jet device (MicroJet Co. LaboJet-500Bio), a
microarray was prepared by discharging a solution containing a
capture probe shown in Table 1 onto a glass substrate.
[0126] In Table 1, the composition of 20.times.SSC buffer is 3 M
NaCl, 0.3 M sodium citrate.
TABLE-US-00005 TABLE 1 10 .mu.M Capture probe 1 45 .mu.l 5M betaine
22.5 .mu.l 20 .times. SSC buffer 22.5 .mu.l Milli-Q Water 60 .mu.l
Total 150 .mu.l
[0127] Furthermore, the hybridization reaction solution containing
arbitrary concentration of miR-141 and the detection probe was
prepared as shown in Table 2.
TABLE-US-00006 TABLE 2 X pM miR-141 100 .mu.l 20 .mu.M Detect probe
1 0.75 .mu.l 1M Tris-HCl (pH 7.5) 20 .mu.l 1M MgCl.sub.2 3 .mu.l
100 mM ATP 0.3 .mu.l 10 mg/ml BSA 3 .mu.l 1M DTT 3 .mu.l 2.5M NaCl
18 .mu.l 50% PEG6000 (Hampton Research) 60 .mu.l RNase-free water
92 .mu.l Total 300 .mu.l
[0128] The hybridization reaction solution was incubated at
95.degree. C. for 5 minutes and returned to room temperature. Then
T4 DNA ligase was added to a final concentration of 5 units/.mu.l.
Then the hybridization reaction solution was sealed in a state of
contacting with the microarray substrate, hybridization was carried
out at 30.degree. C. for 2 hours while being shaken at a speed of
1000 rpm on a shaker.
[0129] After the hybridization reaction was completed, the
microarray substrate was washed in 0.2.times.SSC buffer (30 mM
NaCl, 3 mM sodium citrate) by shaking for 10 minutes, and this
washing operation was repeated twice. The substrate was
subsequently dried, observed with a fluorescence microscope, and
the fluorescence intensity was measured.
[0130] The results are shown in FIG. 3. In each spot with a fixed
probe, the fluorescence image of the detection probe labeled with
Alexa647 were observed, and linearity was observed in a range of
number of molecules 0.5 fmol to 50 fmol of miR-141 used for the
hybridization reaction. Thus, it was confirmed that the signal of
fluorescence intensity over the spots is increased depending on the
concentration of miRNA.
Example 2
[0131] (Synthesis of Target miRNA, Capture Probe, and Detection
Probe)
[0132] RNA having the sequence of miR-143 was synthesized as
another target miRNA. In addition, two kinds of the nucleic acid
probes, the capture probe and the detection probe having
complementary sequence to the above RNA were designed and
synthesized.
[0133] The sequences used for the target miRNA, the capture probe,
and the detection probe are shown below.
(1) Target miRNA: miR-143
TABLE-US-00007 (SEQ ID NO 5: 21 mer) [SEQ:
5'-UGAGAUGAAGCACUGUAGCUC-3']
(2) Capture probe 2 (Capture probe 2) [SEQ: 5'-p-X4-fS-3'] (SEQ ID
NO: 31) X4 represents the following sequence, p represents a
phosphate, S represents a thiol group, f represents a 6-FAM
(6-fluorescein).
TABLE-US-00008 (SEQ ID NO 6: 34 mer) X4:
GTGCTTCATCTCAACAACAACAACAACAACAACA
(3) Detection probe 2 (Detect probe 2) [SEQ: 5'-p-X5-Al-X6-3'] (SEQ
ID NO: 32) X5, X6 represent the following sequences, p represents a
phosphate, Al represents an Alexa647-AminoC6-dA.
TABLE-US-00009 (SEQ ID NO 7: 17 mer) X5: CTCAACTGGTGTCGTGG (SEQ ID
NO 8: 26 mer) X6: GTCGGCAATTCAGTTGAGGAGCTACA
[0134] The microarray was prepared, hybridization was carried out
and the fluorescence intensity over the spots on the substrate was
measured in the same manner as described in Example 1.
Comparative Example 1
[0135] Except that T4 DNA ligase was not added in Example 2, the
microarray was prepared, hybridization was carried out and the
fluorescence intensity over the spots on the substrate was measured
in the same manner as described in Example 2.
[0136] The results of Example 2 and Comparative Example 1 are shown
in FIG. 4. In Example 2, and linearity was observed in a range of
number of molecules 0.03 fmol to 10 fmol of miR-143 used for the
hybridization reaction. On the other hand, in Comparative Example 1
in which T4 DNA ligase was not used, the detection sensitivity was
reduced to about 1/10.sup.5. Accordingly, it is confirmed that the
detection sensitivity significantly increases by ligating the
target miRNA, the capture probe, and the detection probe.
Example 3
[0137] (Synthesis of Target miRNA, Capture Probe, and Detection
Probe)
[0138] RNA having the sequence of miR-141 and miR-200a was
synthesized as the similar target miRNAs. In addition, a total
three kinds of the nucleic acid probes, one kind of the capture
probe and two kinds of the detection probes having complementary
sequence to the above RNA were designed and synthesized.
[0139] The sequences used for the target miRNA, the capture probe,
and the detection probe are shown below.
(1) Target miRNA: miR-141
TABLE-US-00010 (SEQ ID NO 1: 22 mer) [SEQ:
5'-UAACACUGUCUGGUAAAGAUGG-3']
(2) Target miRNA: miR-200a
TABLE-US-00011 (SEQ ID NO 9: 22 mer) [SEQ:
5'-UAACACUGUCUGGUAACGAUGU-3']
(3) Capture probe 1 (Capture probe 1) [SEQ: 5'-p-X1-fS-3'] (SEQ ID
NO: 29) X1 represents the following sequence, p represents a
phosphate, S represents a thiol group, f represents a 6-FAM
(6-fluorescein).
TABLE-US-00012 (SEQ ID NO 2: 35 mer) X1:
ACCAGACAGTGTTAACAACAACAACAACAACAACA
(4) Detection probe 1 (Detect probe 1) [SEQ: 5'-p-X2-Al-X3-3'] (SEQ
ID NO: 30) X2, X3 represent the following sequences, p represents a
phosphate, Al represents an Alexa647-AminoC6-dA.
TABLE-US-00013 (SEQ ID NO 3: 17 mer) X2: CTCAACTGGTGTCGTGG (SEQ ID
NO 4: 26 mer) X3: GTCGGCAATTCAGTTGAGCCATCTTT
(5) Detection probe 3 (Detect probe 3) [SEQ: 5'-p-X2-Al-X7-3'] (SEQ
ID NO: 33) X2, X7 represent the following sequences, p represents a
phosphate, Al represents an Alexa647-AminoC6-dA,
TABLE-US-00014 (SEQ ID NO 3: 17 mer) X2: CTCAACTGGTGTCGTGG (SEQ ID
NO 10: 26 mer) X7: GTCGGCAATTCAGTTGAGACATCGTT
[0140] The microarray was prepared in the same manner as described
in Example 1.
[0141] Furthermore, the hybridization reaction solution containing
miR-141 or miR-200a, the detection probe 1 and the detection probe
3 was prepared as shown in Table 3.
TABLE-US-00015 TABLE 3 300 pM miR-141 or miR-200a 100 .mu.l 20
.mu.M Detect probe 1 0.75 .mu.l 20 .mu.M Detect probe 3 0.75 .mu.l
1M Tris-HCl (pH 7.5) 20 .mu.l 1M MgCl.sub.2 3 .mu.l 100 mM ATP 0.3
.mu.l 10 mg/ml BSA 3 .mu.l 1M DTT 3 .mu.l 2.5M NaCl 18 .mu.l 50%
PEG6000 (Hampton Research) 60 .mu.l RNase-free water 92 .mu.l Total
300 .mu.l
[0142] Hybridization was carried out and the fluorescence intensity
over the spots on the substrate was measured in the same manner as
described in Example 1.
[0143] The results are shown in Table 4. In each spot with a fixed
probe, each fluorescence image of the detection probe which is
labeled with Alexa647 or Alexa532 was observed, and miR-141 and
miR-200a were quantified from the fluorescence intensity. Assuming
that the fluorescence intensity of the detection probe having a
sequence that is fully complementary to the target miRNA is 100%,
the fluorescence intensity becomes 1% or less in the presence of
miRNA having a sequence with different 2 bases. Accordingly, it was
confirmed that the detection probe has high specificity.
TABLE-US-00016 TABLE 4 synthetic miRNAs miR-141 miR-200a Detect
miR-141 100 0.58 Probes miR-200a 0.69 100
Example 4
[0144] (Synthesis of Target miRNA, Capture Probe, and Detection
Probe)
[0145] RNA having the sequence of let-7a was synthesized as the
target miRNA. In addition, a total three kinds of the nucleic acid
probes, two kinds of capture the probes and the detection probe
having complementary sequence to the above RNA, but their lengths
are different, were designed and synthesized.
[0146] The sequences used for the target miRNA, the capture probe,
and the detection probe are shown below.
(1) Target miRNA: let-7a
TABLE-US-00017 (SEQ ID NO 11: 22 mer) [SEQ:
5'-UGAGGUAGUAGGUUGUAUAGUU-3']
(2) Capture probe 3 (Capture Probe 3) [SEQ: 5'-p-X9-fS-3'] (SEQ ID
NO: 34) X9 represents the following sequence, p represents a
phosphate, S represents a thiol group, f represents a 6-FAM
(6-fluorescein).
TABLE-US-00018 (SEQ ID NO 12: 35 mer) X9:
AACCTACTACCTCAACAACAACAACAACAACAACA
(3) Capture probe 4 (Capture Probe 4) [SEQ: 5'-p-X10-fS-3'] (SEQ ID
NO: 35) X10 represents the following sequence, p represents a
phosphate, S represents a thiol group, f represents a 6-FAM
(6-fluorescein
TABLE-US-00019 (SEQ ID NO 13: 34 mer) X10:
ACCTACTACCTCAACAACAACAACAACAACAACA
(4) Detection probe 4 (Detect Probe 4) [SEQ: 5'-p-X11-Al-X12-3']
(SEQ ID NO: 36) X11, X12 represent the following sequences, p
represents a phosphate, Al represents an Alexa647-AminoC6-dA.
TABLE-US-00020 (SEQ ID NO 14: 17 mer) X11: CTCAACTGGTGTCGTGG (SEQ
ID NO 15: 26 mer) X12: GTCGGCAATTCAGTTGAGAACTATAC
TABLE-US-00021 TABLE 5 300 nM let-7a 100 .mu.l 20 .mu.M Capture
probe 3 or 20 .mu.M Capture probe 4 0.75 .mu.l 20 .mu.M Detect
probe 4 0.75 .mu.l 1M Tris-HCl (pH 7.5) 20 .mu.l 1M MgCl.sub.2 3
.mu.l 100 mM ATP 0.3 .mu.l 10 mg/ml BSA 3 .mu.l 1M DTT 3 .mu.l 2.5M
NaCl 18 .mu.l 50% PEG6000 (Hampton Research) 60 .mu.l RNase-free
water 92 .mu.l Total 300 .mu.l
[0147] The hybridization reaction solution was incubated at
95.degree. C. for 5 minutes and returned to room temperature. Then
T4 DNA ligase was added to a final concentration of 5 units/.mu.l.
Then the hybridization reaction was carried out at 30.degree. C.
for 2 hours.
[0148] After the hybridization reaction was completed, denaturing
urea acrylamide gel electrophoresis was carried out, and it was
confirmed that the ternary complex of the capture probe-detection
probe 4-let-7a was formed.
[0149] The results are shown in FIG. 8. A photograph of the gel
after the electrophoresis was taken by setting the fluorescence of
Alexa647 bound to the detection probe 4 as an indicator. As a
result, a band of the ternary complex was observed at a position of
approximately 130 bases in length when the capture probe 3 is
contained. On the other hand, since a signal did not appear at all
when the capture probe 4 is contained, it was shown that it is
possible to control the formation of the ternary complex by
changing the base length of the capture probe. That is to say, when
the capture probes 3 and 4 are fixed to different regions on the
substrate, the signals of let-7a and let-7b are detected in the
different regions from each other. As described above, according to
the present embodiment, a group of similar miRNAs can be quantified
specifically.
Example 5
[0150] The microchip shown in FIG. 9 was prepared with PDMS
(Polydimethylsiloxane), by using the reagent of Example 1,
quantification of miRNA on the microchip was attempted. In each
flow path, width is 200 .mu.m and height is 20 .mu.m, and two
solution inlets are arranged, and each flow path is separated by a
valve which is opened and closed by the gas pressure. Such flow
path sets are arranged in six parallel rows on the glass substrate
of 30 mm square.
[0151] First, flow path for fixing the capture probe (flow path
made of PDMS surrounded by a dashed box) was fixed on a glass
substrate, and FAM-labeled capture probe solution was introduced
from one inlet, and fixed on a glass substrate. Then the flow path
was washed, and the flow path was removed. As a result, it was
possible to fix the detection probes lineally, as shown in FIG.
10.
[0152] Subsequently, flow path for hybridization was affixed to the
glass substrate obtained by removing the flow path for fixing the
capture probe, sample solution (containing 25 nM miR-141, 100 nM
detection probe labeled with Alexa647, and T4 DNA ligase, etc.) was
introduced with a syringe pump from "sample solution inlet" while
closing the valve of the flow path for washing solution by
"nitrogen gas B" (flow rate: 0.8 .mu.l/min, 10 minutes). Then the
washing solution was flushed by switching the valve, and the amount
of the detection probe labeled with Alexa647 bound on the region
fixed with the capture probe was measured. Results are shown in
FIG. 11. At the intersection with the capture probe fixed on the
dashed line portion shown in the left figure of FIG. 11, miRNA and
the detection probe are bound predominantly which have flowed
through the dashed line portion shown in the right figure of FIG.
11, and it is confirmed that the method of quantifying miRNA of
this embodiment is also applicable when using the microchannel.
[0153] From the above results, according to this embodiment, it is
clear that it is possible to easily quantify nucleic acids with
high accuracy and high sensitivity.
INDUSTRIAL APPLICABILITY
[0154] It is possible to provide a method for detecting nucleic
acid which is capable of detecting the nucleic acid with
simplicity, high accuracy and high sensitivity, and a detection
probe and detection probe set used in the method for detecting
nucleic acids.
Sequence CWU 1
1
36122RNAHomo sapiens 1uaacacuguc ugguaaagau gg 22235DNAArtificial
SequenceDescription of Artificial Sequence Synthetic capture probe1
2accagacagt gttaacaaca acaacaacaa caaca 35317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic detect
probe1-1 3ctcaactggt gtcgtgg 17426DNAArtificial SequenceDescription
of Artificial Sequence Synthetic detect probe1-2 4gtcggcaatt
cagttgagcc atcttt 26521RNAHomo sapiens 5ugagaugaag cacuguagcu c
21634DNAArtificial SequenceDescription of Artificial Sequence
Synthetic capture probe2 6gtgcttcatc tcaacaacaa caacaacaac aaca
34717DNAArtificial SequenceDescription of Artificial Sequence
Synthetic detect probe2-1 7ctcaactggt gtcgtgg 17826DNAArtificial
SequenceDescription of Artificial Sequence Synthetic detect
probe2-2 8gtcggcaatt cagttgagga gctaca 26922RNAHomo sapiens
9uaacacuguc ugguaacgau gu 221026DNAArtificial SequenceDescription
of Artificial Sequence Synthetic detect probe3-1 10gtcggcaatt
cagttgagac atcgtt 261122RNAHomo sapiens 11ugagguagua gguuguauag uu
221235DNAArtificial SequenceDescription of Artificial Sequence
Synthetic X9 oligonucleotide 12aacctactac ctcaacaaca acaacaacaa
caaca 351334DNAArtificial SequenceDescription of Artificial
Sequence Synthetic X10 oligonucleotide 13acctactacc tcaacaacaa
caacaacaac aaca 341417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic X11 oligonucleotide 14ctcaactggt
gtcgtgg 171526DNAArtificial SequenceDescription of Artificial
Sequence Synthetic X12 oligonucleotide 15gtcggcaatt cagttgagaa
ctatac 261611RNAHomo sapiens 16ugagguagua g 111711RNAHomo sapiens
17guuguauagu u 111811DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 18aactatacaa c
111922RNAHomo sapiens 19ugagguagua gauuguauag uu 222011RNAHomo
sapiens 20auuguauagu u 112122RNAHomo sapiens 21ugagguagua
gguugugugg uu 222214DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 22aacctactac ctca 14238DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
23aactatac 82413DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 24acctactacc tca 13259DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
25aaccacaca 92622DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 26aactatacaa cctactacct ca
222723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 27aaccacacaa acctactacc tca 232821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
28aaccacacac ctactacctc a 212935DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide5' phosphate3'
thiol 6-FAM 29accagacagt gttaacaaca acaacaacaa caaca
353044DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide5'
phosphatemodified_base(18)..(18)Alexa647-AminoC6-dA 30ctcaactggt
gtcgtggagt cggcaattca gttgagccat cttt 443134DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide5' phosphate3' thiol 6-FAM 31gtgcttcatc tcaacaacaa
caacaacaac aaca 343244DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide5'
phosphatemodified_base(18)..(18)Alexa647-AminoC6-dA 32ctcaactggt
gtcgtggagt cggcaattca gttgaggagc taca 443344DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide5'
phosphatemodified_base(18)..(18)Alexa647-AminoC6-dA 33ctcaactggt
gtcgtggagt cggcaattca gttgagacat cgtt 443435DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide5' phosphate3' thiol 6-FAM 34aacctactac ctcaacaaca
acaacaacaa caaca 353534DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide5' phosphate3' thiol
6-FAM 35acctactacc tcaacaacaa caacaacaac aaca 343644DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide5'
phosphatemodified_base(18)..(18)Alexa647-AminoC6-dA 36ctcaactggt
gtcgtggagt cggcaattca gttgagaact atac 44
* * * * *