U.S. patent application number 15/694323 was filed with the patent office on 2018-03-08 for compositions and methods for pest control management.
The applicant listed for this patent is Lepidext, University of Kentucky Research Foundation. Invention is credited to Angelika Fath-Goodin, Kendra Hitz Steele, Bruce Webb.
Application Number | 20180064113 15/694323 |
Document ID | / |
Family ID | 56404270 |
Filed Date | 2018-03-08 |
United States Patent
Application |
20180064113 |
Kind Code |
A1 |
Webb; Bruce ; et
al. |
March 8, 2018 |
COMPOSITIONS AND METHODS FOR PEST CONTROL MANAGEMENT
Abstract
Disclosed are genetically modified nudiviruses capable of being
sexually transmitted by an insect useful for controlling pest
populations. The genetically modified nudiviruses are capable of
causing sterility in a target population of insects. Also disclosed
are insects infected with the disclosed genetically modified
nudiviruses, methods of making the genetically modified
nudiviruses, and methods of using the genetically modified
nudiviruses to control an insect pest population.
Inventors: |
Webb; Bruce; (Lexington,
KY) ; Steele; Kendra Hitz; (Lexington, KY) ;
Fath-Goodin; Angelika; (Lexington, KY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Kentucky Research Foundation
Lepidext |
Lexington
Lexington |
KY
KY |
US
US |
|
|
Family ID: |
56404270 |
Appl. No.: |
15/694323 |
Filed: |
September 1, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15154069 |
May 13, 2016 |
9770033 |
|
|
15694323 |
|
|
|
|
62161674 |
May 14, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2710/00071
20130101; A01N 63/00 20130101; C12N 7/00 20130101; C12N 2710/00021
20130101; C12N 2710/00031 20130101; A01N 63/10 20200101 |
International
Class: |
A01N 63/00 20060101
A01N063/00; A01N 63/02 20060101 A01N063/02; C12N 7/00 20060101
C12N007/00 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under
1338775 by the National Science Foundation. The government has
certain rights in the invention.
Claims
1. A genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus having at least about 80% sequence identity to a wild type
Helicoverpa zea nudivirus 2 (HzNV-2) virus, wherein said
genetically modified Helicoverpa zea nudivirus 2 (HzNV-2) has a
mutation in a region selected from Open Reading Frame 90 (ORF90),
Open Reading Frame 92 (ORF92), Persistance-associated Gene (pag1),
or a combination thereof, wherein said mutation disrupts expression
of the gene product encoded by said mutant region and wherein said
mutation increases the rate of an agonadal phenotype in a progeny
of a moth infected with said genetically modified HzNV-2 as
compared to a progeny of a moth infected with a wild-type HzNV-2
virus.
2. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said genetically modified HZNV 2 has at
least about 85% sequence identity to wild type Helicoverpa zea
nudivirus 2 (HzNV-2) virus.
3-5. (canceled)
6. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said moth is a moth from the Noctuidae
family.
7-9. (canceled)
10. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said genetically modified HzNV-2 virus is
achieved via chemical mutagenesis.
11. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said genetically modified HzNV-2 virus is
achieved via recombinant DNA technology.
12. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said genetically modified HzNV-2 virus is
achieved via gene editing technology.
13. A method of reducing a population of lepidopteran moths,
comprising the step of introducing a moth infected with the virus
of claim 1 into said population, wherein said moth is a moth from
the Noctuidae family.
14-15. (canceled)
16. A moth infected with the genetically modified Helicoverpa zea
nudivirus 2 (HzNV-2) virus of claim 1, wherein said moth is a moth
from the Noctuidae family.
17-22. (canceled)
23. A method of protecting a crop susceptible to a moth pest from
said moth pest damage, comprising the step of introducing a moth
infected with the genetically modified nudivirus of claim 1 into
said crop.
24-31. (canceled)
32. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said genetically modified HZNV-2 has at
least about 90% sequence identity to wild type Helicoverpa zea
nudivirus 2 (HzNV-2) virus.
33. The genetically modified Helicoverpa zea nudivirus 2 (HzNV-2)
virus of claim 1, wherein said genetically modified HZNV-2 has at
least about 95% sequence identity to wild type Helicoverpa zea
nudivirus 2 (HzNV-2) virus.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S.
Provisional Application Ser. No. 62/161,674, filed on May 14, 2015,
entitled "Mutant Nudivirus and Method for Using Same for Insect
Control," the contents of which are incorporated herein in their
entirety for all purposes.
BACKGROUND
[0003] Insect pests cause crop damage worldwide resulting in
significant losses to food and fiber crops and increased production
costs that target control of such pests. For example, the
Heliothine complex of lepidopteran moths cause in excess of 2 B
dollars in damage and cost of control in the United States
annually. While all crops are susceptible to similar pest pressure,
transgenic expression of Bacillus thuringiensis (Bt) toxins was
developed to control the lepidopteran pests and has become a major
tool for control of these and other insect pests. Since the
commercial introduction of Bt crops in 1996, they have been adopted
around the world and have been grown on more than one billion acres
worldwide. In the US, 81% of corn and 84% of cotton express one or
more Bt toxins.
(http://www.ers.usda.gov/data-products/adoption-of-genetically-engineered-
-crops-in-the-us/recent-trends-in-ge-adoption.aspx, 2015 report.)
Unfortunately, due to the remarkable ability of insects to adapt to
insecticides, resistance to Bt toxins was predicted and reports of
field-evolved resistance and reduced efficacy are increasing. Such
resistance is a threat to the sustainability of important Bt crops,
in the US and elsewhere. Thus, there is a continuing need to
develop new methods to control insect pests. For example,
Helicoverpa zea (H. zea, commonly known as the corn earworm), is a
major polyphagous moth pest in the Heliothine complex in the United
States and causes millions of dollars of damage to corn and cotton
plants each year.
[0004] A number of pests in the Heliothine complex of moths,
notably H. zea H. armigera and Heliothis virescens are highly
polyphagous and cause economically significant damage to many
crops. Crops commonly damaged by H. zea include cotton, corn,
soybean, sunflowers, tomato, sorghum, strawberry, peppers, beans,
aubergine, okra, peas, millet, cucumber, melon, lettuce,
cauliflower, and cabbage. Because H. zea attacks a wide variety of
plants and, in many instances, is developing resistance to Bt
crops, farmers rely heavily on pesticides to control this pest
insect.
[0005] The need for pest management, such as in field, fruit and
vegetable crops, is a need in the art, which will only become more
critical as resistance to Bt expands. Further, there is a need for
pest management that does not involve the use of conventional
pesticides or transgenic technologies such as in organic cropping
systems. The instant invention addresses one or more aforementioned
needs in the art.
BRIEF SUMMARY
[0006] Disclosed are genetically modified nudiviruses capable of
being sexually transmitted by an insect useful for controlling pest
populations. The genetically modified nudiviruses are capable of
causing sterility in a target population of insects. Also disclosed
are insects infected with the disclosed genetically modified
nudiviruses, methods of making the genetically modified
nudiviruses, and methods of using the genetically modified
nudiviruses to control an insect pest population.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1. Schematic of nudivirus genome showing genes known to
be involved or implicated in sterilizing mutations.
[0008] FIG. 2. Percentage of agonadal female F1 progeny. Wild-type
(WT) and mutant HzNV-2 generated by chemical mutagenesis (KS-3,
KS-38, KS-39, KS-45, KS-51, and KS-52) were injected into adult
female moths on the day of emergence, and eggs were collected on
oviposition days 2 (OviD2) and 3 (OviD3). Female F1 progeny were
reared to adult moths and evaluated for the presence of a viral
plug indicating an agonadal pathology (OviD2-WT n=17, KS-3 n=24,
KS-38 n=23, KS-39 n=26, KS-45 n=19, KS-51 n=14, KS-52 n=18;
OviD3-WT n=15, KS-3 n=16, KS-38 n=22, KS-39 n=16, KS-45 n=19, KS-51
n=18, KS-52 n=23).
[0009] FIG. 3. Occurrence of complete sterility in agonadal female
F1 progeny. Wild-type (WT) and mutant HzNV-2 (KS-3, KS-38, KS-39,
KS-45, KS-51, and KS-52) were injected into adult female moths on
the day of emergence, and offspring eggs were collected on
oviposition days 2 (OviD2) and 3 (OviD3). Female F1 progeny were
reared to adult moths and evaluated for ability to lay viable eggs.
Failure to lay eggs or lay viable eggs indicates complete sterility
(OviD2-WT n=17, KS-3 n=24, KS-38 n=23, KS-39 n=26, KS-45 n=19,
KS-51 n=14, KS-52 n=18; OviD3-WT n=15, KS-3 n=16, KS-38 n=22, KS-39
n=16, KS-45 n=19, KS-51 n=18, KS-52 n=23). This illustrates that
these mutant HzNV-2 causes decreased egg production and
sterility.
[0010] FIG. 4. Effect of viral titer on H. zea egg production.
Female adult moths (7) were injected with 100 .mu.l wt HzNV-2 (high
dose: 4.times.10.sup.4 pfu/ml; low dose: 40 pfu/ml) or yfp
recombinant HzNV-2 (high dose: 1.times.10.sup.7 pfu/ml; low dose:
1.times.10.sup.4 pfu/ml) isolated from cell culture and mated with
uninfected male moths (9). Eggs were collected on oviposition days
2-5 and counted. Uninfected females were mated with uninfected
males as a control.
[0011] FIG. 5. Direct inoculation of insect larvae causes high
numbers of agonadal moths. Wild-type (WT) HzNV-2 and mutant KS3
were amplified in Sf9 insect cell culture and injected into third
instar larvae via an insulin syringe. WT HzNV-2 and mutant yfp
HzNV-2 virus isolated from viral plugs of agonadal female moths
were used to infect third instar larvae via a pre-sterilized pin.
After both types of infections, larvae were reared to adult moths,
and females were examined for the presence of a viral plug, an
indicator of virus infection and agonadal pathology (Syringe, WT
n=20, KS3 n=25; Pin, WT n=20, yfp HzNV-2 n=21).
[0012] FIG. 6. 1.5% agarose gel showing PCR results that yfp HzNV-2
is a pag1 mutant. Wild-type (WT) HzNV-2 (control) and yfp HzNV-2
viral DNA and yfp-pUC57 (control), the plasmid used for homologous
recombination to make the yfp HzNV-2 virus, were used as DNA
templates in the PCR reactions. If present, yfp primers were used
to amplify the yellow fluorescent protein gene (547 bp); pag1
primers were used to amplify pag1 DNA; ORF78 primers were used to
amplify hypothetical gene ORF78 (403 bp) that the DNA is from
HzNV-2.
DETAILED DESCRIPTION
[0013] As used herein and in the appended claims, the singular
forms "a," "and," and "the" include plural referents unless the
context clearly dictates otherwise. Thus, for example, reference to
"a method" includes a plurality of such methods and reference to "a
dose" includes reference to one or more doses and equivalents
thereof known to those skilled in the art, and so forth.
[0014] The term "about" or "approximately" means within an
acceptable error range for the particular value as determined by
one of ordinary skill in the art, which will depend in part on how
the value is measured or determined, e.g., the limitations of the
measurement system. For example, "about" can mean within 1 or more
than 1 standard deviations, per the practice in the art.
Alternatively, "about" can mean a range of up to 20%, or up to 10%,
or up to 5%, or up to 1% of a given value. Alternatively,
particularly with respect to biological systems or processes, the
term can mean within an order of magnitude, preferably within
5-fold, and more preferably within 2-fold, of a value. Where
particular values are described in the application and claims,
unless otherwise stated the term "about" meaning within an
acceptable error range for the particular value should be
assumed.
[0015] The term "closely related" as used herein, with respect to
the term insect and/or moth, means a species so closely related so
as to support replication of the HzNV-2 virus.
[0016] The terms "express" and "expression" mean allowing or
causing the information in a gene or DNA sequence to become
manifest, for example producing a protein by activating the
cellular functions involved in transcription and translation of a
corresponding gene or DNA sequence. A DNA sequence is expressed in
or by a cell to form an "expression product" such as a protein. The
expression product itself, e.g. the resulting protein, may also be
said to be "expressed". An expression product can be characterized
as intracellular, extracellular or secreted. The term
"intracellular" means something that is inside a cell. The term
"extracellular" means something that is outside a cell. A substance
is "secreted" by a cell if it appears in significant measure
outside the cell, from somewhere on or inside the cell.
[0017] The term "gene", also called a "structural gene" means a DNA
sequence that codes for or corresponds to a particular sequence of
amino acids which comprise all or part of one or more proteins or
enzymes, and may or may not include introns and regulatory DNA
sequences, such as promoter sequences, 5'-untranslated region, or
3'-untranslated region which affect for example the conditions
under which the gene is expressed. Some genes, which are not
structural genes, may be transcribed from DNA to RNA, but are not
translated into an amino acid sequence. Other genes may function as
regulators of structural genes or as regulators of DNA
transcription.
[0018] By "genetically modified" is meant a gene that is altered
from its native state. The term "genetically modified," as used
herein, includes a sequence (a virus, for example) that contains
genetic material from more than one organism. The term further
includes a sequence that is modified from its native state, for
example, via a deletion or insertion, and which does not include
genetic material from more than one organism. The latter may be
referred to as a "mutant" as used herein.
[0019] The instant disclosure addresses one or more needs in the
art as described above. In one aspect, the present disclosure
addresses the globally important need for new methods to control
insect pests in crops threatened by such pests. In a further
aspect, the disclosure addresses an increasingly important issue,
Bt resistance, that threatens the sustainability of
insect-resistant transgenic crops.
[0020] A sexually transmitted insect virus, Helicoverpa zea
nudivirus 2 (HzNV-2, accession number NC_004156), is known to cause
approximately 33% of infected H. zea to be sterile. (Raina 1995).
Wildtype (WT) HzNV-2, however, is not a potential biological
control agent due to the high proportion of asymptomatic carrier
moths. Applicant has found that HzNV-2 can be modified so that
extremely high percentages, for example, up to 100%, or greater
than about 90%, of the infected H. zea become sterile. As such, the
mutant HzNV-2 may be an important tool in controlling various
insect pests by causing collapse in the target insect population.
In turn, this modified virus can be used to infect a target insect,
and control an insect population without the use of traditional
pesticides, or, alternatively, can be used in combination with
traditional pesticides such that the amount of the pesticide used
is minimized. Such a technology may have particular utility in
control of populations of Bt resistant insects and invasive insect
populations for which traditional pesticides are ineffective.
Applicant's approach allows for pest control via release of insects
infected with a sexually transmitted virus that can be transmitted
by mating in the targeted farming area. The approach developed by
Applicant is effective for both transgenic and/or non-transgenic
crops and is capable of targeting pest species in which the virus
replicates and is sexually transmitted.
[0021] Attempts to control insect populations via genetic
manipulation of crops is currently limited due to the ability of
insects to rapidly develop resistance to the genetically added
toxins, and is further limited by the costs to producers to use
such modified crops. For example, crops expressing the Bacillus
thuringiensis (Bt) toxins were introduced twenty years ago to
control caterpillar pests. Since then, they have been adopted
worldwide, planted on more than one billion acres and have become
one of the most successful and rapidly adopted agricultural
technologies since the `green revolution` of the mid-20th century
(James, 2012). As of 2015 in the US, 81% of corn and 84% of cotton
express one or more Bt toxins. However, the widespread adoption of
Bt technology carries the significant risk that overuse will
inevitably lead to development of insect resistance to Bt toxins
and crop failures, which threatens the technology's continued
viability (Carriere et al., 2010, Tabashnik et al., 2013; Tabashnik
et al., 2009). This risk, which always has been recognized by
regulators, industry, and researchers, has been managed by
resistance monitoring and the use of refuge strategies to delay
resistance. These refuge strategies, which have been mandated by
the EPA in the USA with similar mandates in other countries, entail
the planting of nearby non-transgenic plants to maintain
susceptible insect populations (EPA, 1998; Huang et al., 2011).
Unfortunately, this practice is not always followed due to cost to
producers, and is not always effective because of the remarkable
ability of insects to evolve resistance to insecticides. Increasing
insect resistance to Bt plants is reported, and some insects
exhibit resistance traits that are genetically dominant (Campagne
et al., 2013). To summarize, Bt-resistant insects represent an
ongoing and increasingly important threat to the continued efficacy
of Bt crops, and to food and fiber production in the US and
worldwide.
[0022] One insect pest threatening Bt crops is the corn earworm,
Helicoverpa zea, a lepidopteran moth. H. zea is found throughout
North America, for example, where it is the second most costly crop
pest (Fitt, 1989), and is also found in Central America, the
Caribbean, and South America. H. zea, which feeds on many different
plants and has several common names (e.g., corn earworm, cotton
budworm, tomato fruitworm) has some strains that are 1000-times
more resistant to Bt toxin than susceptible insects (Ali and
Luttrell, 2007; Ali et al., 2006).
[0023] Applicant has developed a new approach to suppress insect
pest populations. In a further aspect, Applicant has developed a
new approach to managing Bt resistance, which relies upon
engineering or mutating a sexually-transmitted insect virus that
sterilizes infected insects (including complete or partial
sterility). Insects containing the mutant virus may be released in
areas where Bt resistance is present in H. zea populations, thereby
suppressing these targeted populations and preserving the utility
of the Bt transgenic plants and/or non-transgenic plants.
Similarly, the susceptible pest insects are commonly invasive
across the world and the disclosed methods may be used to reduce
and eliminate the invasive insect pest populations. The viruses
developed by Applicant are mutant and recombinant forms of a
naturally-occurring (i.e., wild-type) virus, Helicoverpa zea
nudivirus 2 (HzNV-2), which infects H. zea. HzNV-2 is the only
lepidopteran insect virus which has been shown to be sexually
transmitted and causes sterility in both males and females. In one
aspect, the infected insect may have partial sterility, defined as
when a female H. zea moth lays less than 30 viable eggs each day
due to damage to her reproductive organs. In one aspect, the
infected insect may have complete sterility, defined as the
inability of a female moth to lay viable eggs due to damage to her
reproductive organs.
[0024] In one aspect, disclosed is a genetically modified nudivirus
of a wild type nudivirus. The genetically modified nudivirus
contemplated herein is generally capable of being sexually
transmitted by an insect and capable of causing sterility in an
insect at a rate of greater than about 50%, or from about 50% to
about 100%, or from about 80% to about 95% or from about 90% to
about 100% following infection of said insect with said nudivirus
comprising a genetic mutation.
[0025] In one aspect, the wild type nudivirus has at least about
80% sequence identity to Helicoverpa zea nudivirus 2 (HzNV-2)
virus. The wild type nudivirus may be characterized in that it has
a latent phase, has about 80% or greater sequence identity to
Helicoverpa zea nudivirus 2 (HzNV-2, also known as Heliothis zea
nudivirus or gonad specific virus) virus, and is capable of
replicating in one or more moths.
[0026] In one aspect, the genetically modified nudivirus may
contain a disruption in a latent phase of said wild type
nudivirus.
[0027] In one aspect, the insect may be a lepidopteran moth in the
family noctuidae which supports replication of the HzNV-2 virus in
reproductive tissues sufficient to cause sterility at a rate of 50%
or greater. The insect may be selected from Helicoverpa zea (H.
zea) H. armigera, H. assulta, Heliothis virescens, Agrotis ipsilon,
Spodoptera frugiperda, Spodoptera exiguae, closely related moths,
noctuid moths, or combinations thereof.
[0028] In one aspect, genetic modification may be a mutation in one
or more genes selected from the persistence-associated gene (pag1)
(which encodes PAT1, or the persistence associated transcript (SEQ
ID NO: 7), ORF 90 (SEQ ID NO: 4), ORF92 (SEQ ID NO: 5), ORF 2 (SEQ
ID NO: 3), or combinations thereof, such that the modification is
sufficient to disrupt expression of one or more of such genes, for
example, wherein said disruption reduces expression or is a
functional knockout. In one aspect, the genetic modification may be
a mutation in the persistence associated gene (pag1) sufficient to
disrupt expression of the pag1 gene. In one aspect, the genetic
modification may be a mutation in the PAT1 gene (SEQ ID NO: 7),
which is the persistently-associated transcript and has been shown
to be involved in the establishment of latent infections of HzNV-1.
In one aspect, the genetic modification may be a mutation in one or
more sequences selected from dr1 (atgaagctgaggatgaatctgaac, SEQ ID
NO: 14), dr2 (gaaactcctaaatcaaaggatgaacctaaagcaaag, SEQ ID NO: 15),
dr3 (atgaaaaagcaaaggctgaggcgaaggctaaagccgatgctgctgcaaaagccaaagctg,
SEQ ID NO: 16), dr4 (ttataccagagagcaagccagaaa, SEQ ID NO: 17), dr5
(acctaaagttgaatctaaagtagt ggaaccacctaaagcggaatctaa
aacagtggaagctcctactaaaacagttgaagt, SEQ ID NO: 18), dr6
(agctgccgctaaacgcaaagccgaggctga, SEQ ID NO: 19), or a combination
thereof. In one aspect, the genetic modification may be a mutation
in dr3 (SEQ ID NO: 16), for example, KS-3 in which there is a bp
insertion at 175,550 and KS-45, 80 bp insertion at 175,650. In one
aspect, the genetic modification may be a mutation in dr6 (SEQ ID
NO: 19), for example, KS-51, having a 29 bp deletion at
180,270-180,299.
[0029] In a further aspect, the genetic modification is one in
which an increase in activity of a viral regulatory gene results
from the modification, wherein said viral regulatory gene is hhi-1
(SEQ ID NO: 8). In certain aspects, the identification of a genetic
modification of interest can be determined via detection of
increased hhi-1 activity.
[0030] In one aspect, the genetically modified nudivirus, may be
obtained via chemical mutagenesis. In another aspect, the
genetically modified nudivirus may be obtained via recombinant DNA
technology.
[0031] Exemplary, non-limiting methods are disclosed herein. In a
further aspect, the genetically modified nudivirus may be obtained
using gene editing technology as is known in the art.
[0032] In one aspect, a method of reducing a population of
lepidopteran moths is disclosed. The method may comprise the step
of introducing an insect infected with a genetically modified
nudivirus as disclosed herein into the population of interest. In
one aspect, infected insects of a single sex may be introduced into
a target population, for example an all-male or all-female
population of insects. In another aspect, a mixed population of
infected insects may be introduced.
[0033] In one aspect, an insect infected with a virus as described
above is disclosed. The insect may be a lepidopteran moth. In
further aspects, the insect may be Helicoverpa zea (H. zea) H.
armigera, H. assulta, Heliothis virescens, Agrotis ipsilon,
Spodoptera frugiperda, Spodoptera exiguae or a closely-related
moth, for example, a closely related moth, or noctuid moths. The
insect may be a female or a male.
[0034] In one aspect, a method of making an insect capable of
transmitting a genetically modified nudivirus as disclosed herein
to a population of insects is disclosed. The method may comprise
the step of infecting an insect with a genetically modified
nudivirus as described herein. In one aspect, the insect is a
lepidopteran moth. The insect may be Helicoverpa zea (H. zea) H.
armigera, H. assulta, Heliothis virescens, Agrotis ipsilon,
Spodoptera frugiperda, Spodoptera exiguae or a closely related moth
or noctuid moth. The method may utilize male insects, female
insects, or both. In one aspect, the genetically modified nudivirus
may be derived from a viral plug. The genetically modified
nudivirus may be administered orally to the insect. In other
aspects, the genetically modified nudivirus may be administered to
an insect via direct inoculation of insect larvae or adult moths by
puncturing the cuticle of the insect with a pin containing viral
inoculum derived from a viral plug. In a further aspect, the
genetically modified nudivirus may be administered to the insect
via direct hypodermic injection into third instar larvae or
moths.
[0035] In one aspect, a method of protecting a crop susceptible to
a moth pest from moth pest damage is disclosed. In this aspect, the
method may comprise the step of introducing insects infected with a
genetically modified nudivirus as described herein, into a crop of
interest. The crop may be any crop threatened by the pest, and may
include, for example, the following non-limiting list of crops:
corn, cotton, soybeans, tomatoes, sorghum, artichoke, asparagus,
cabbage, cantaloupe, collard, cowpea, cucumber, eggplant, lettuce,
lima bean, melon, okra, pea, pepper, potato, pumpkin, snap bean,
spinach, squash, sweet potato, and watermelon, alfalfa, clover,
cotton, flax, oat, millet, rice, sorghum, soybean, sugarcane,
sunflower, tobacco, vetch, and wheat, avocado, grape, peaches,
pear, plum, raspberry, strawberry, carnation, geranium, gladiolus,
nasturtium, rose, snapdragon, zinnia, and combinations thereof (see
http://edis.ifas.ufl.edu/in302). In certain aspects, the crop may
be a Bacillus thuringiensis (Bt) toxin producing crop. The insect
used may be any insect as described above.
[0036] In a further aspect, a method of sterilizing an insect
population is disclosed. The method may include the step of
introducing a genetically modified nudivirus as described herein
into a target insect population. This may include an invasive
insect population, and may further include an insect population
that is Bt resistant. One such example insect is the lepidopteran
moth, which may further include Helicoverpa zea (H. zea), H.
armigera, H. assulta, Heliothis virescens, Agrotis ipsilon,
Spodoptera frugiperda, Spodoptera exiguae and closely related moths
or noctuid moths.
[0037] In one aspect, a method of making a genetically modified
nudivirus via chemical modification is disclosed. The method may
comprise the steps of
[0038] a) incubating a population of insect cells infected with a
virus with about 0.05 mM to about 0.1 mM 1,3-butadiene diepoxide
(or 1,2,3,4-Diepoxybutane or "DEB") for at least 1 hour and up to
to five hours at a temperature range of about 26 to about
28.degree. C., wherein the population of infected insect cells may
comprise an Sf9 insect cell, for example, further wherein the
insect cell may be infected with a virus having at least 80%
identity, or at least 85% identity, or at least 90% identity, or at
least 95% identity, or at least 99% identity to a wild-type HzNV-2
virus (SEQ ID NO: 1), and wherein the incubation is sufficient to
induce one or more mutations in the HzNv-2 virus;
[0039] b) purifying the virus, wherein the purifying step includes
the steps of
[0040] i. culturing the population of insect cells infected with a
virus in a DEB-free media, wherein the population of infected
insect cells are isolated and washed prior to the culturing
step;
[0041] ii. collecting a supernatant from DEB-free media to obtain a
DEB-exposed virus population;
[0042] c) amplifying and collecting the mutated virus from the
DEB-exposed virus population, wherein the collection step may
comprise selecting virus from a plaque having a large plaque
phenotype.
[0043] Exemplary methods making a genetically modified nudivirus
via chemical modification are provided below.
Examples
[0044] The present invention may be understood more readily by
reference to the following detailed description of preferred
embodiments of the invention and the Examples included therein and
to the Figures and their previous and following description.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, the preferred methods, devices, and materials
are now described. All references, publications, patents, patent
applications, and commercial materials mentioned herein are
incorporated herein by reference for the purpose of describing and
disclosing the materials and/or methodologies which are reported in
the publications which might be used in connection with the
invention. Nothing herein is to be construed as an admission that
the invention is not entitled to antedate such disclosure by virtue
of prior invention.
Method--Generating a Recombinant HzNV-2 Virus
[0045] To generate a yfp insert mutant virus using recombinant DNA
technology, Applicant replaced the pag1 gene with a gene encoding
yellow fluorescent protein (yfp) by homologous recombination. pag1
expresses a microRNA that suppresses the expression of the viral
transcription factor, hhi-1, an RNA intermediate necessary to
maintain latency in HzNV-1 (Chao, 1998; Wu and Wu, 2011). To
inactivate the pag1 gene, a pUC57-based transfer vector, yfp-pUC57,
was designed and synthesized with the yfp gene controlled by the
Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus
immediate early 2 (OplE2) promoter, and flanked by 1.2 kb of viral
HzNV-2 sequences upstream and downstream of pag1.
[0046] The yfp HzNV-2 recombinant virus was generated by homologous
recombination of yfp/pag1-pUC57 plasmid with WT HzNV-2 genomic DNA
after transfection into Sf9 insect cells. The mutant virus was
plaque purified, screened for YFP fluorescence using a Zeiss
observer Al fluorescent microscope and the AxioVision Rel. 4.6
program, and amplified in Sf9 cells in nudivirus media (1.times.
Supplemented Grace's Media, 7% FBS, 1% Penicillin/streptomycin) in
25 cm.sup.2 tissue culture flasks. Viral DNA was isolated from the
cell culture supernatant using DNAzol (ThermoFisher Scientific
#10503027) and PCR was performed using the AmpliTaq Gold master mix
(ThermoFisher Scientific #4398881). PCR results confirmed deletion
of pag1 and presence of the yfp gene using internal pag1 (F
5'-GTGGTGCCAGACTTTCAGACATCAT-3'(SEQ ID NO: 10), R
5'-GGGTCTGTTGCGACCTAAAGGTCTA(SEQ ID NO: 11)) and yfp (F
5'-CGAAGAGCTCTTCACTGGCGTGGT-3'(SEQ ID NO: 12), R
5'-GGTGTTTTGCTGGTAATGATCCGC-3' (SEQ ID NO: 13)) primers,
respectively (FIG. 6). Subsequent PCR reactions detected pag1 DNA
indicating that the yfp HzNV-2 virus is a yfp insertional mutant
rather than a complete replacement of this gene. Nevertheless,
inactivation of pag1 was sufficient to produce a virus that caused
sterility in up to 100% of infected insects. Primers to the HzNV-2
open-reading frame ORF78 (F 5'-GCACACCTATCGATCACCAT-3', R
5'-GCACGATTCGTAATGTTCAAGG-3') were used as a control for detecting
the HzNv-2 genome.
Method of Targeting Mutations in a Nudivirus Genome
[0047] Applicant has developed a novel method using diepoxybutane
(DEB) to produce deletions in nudivirus genomes by chemical
mutagenesis. DEB is known to crosslink DNA and lead to deletions of
multiple bases (from .about.50 bases to several kilobases), often
within a single gene (Reardon et al., 1987; Wijen et al., 2001).
DEB tends to cause mutations within regions of DNA that are
actively transcribed. However, published protocols for DEB
mutagenesis do not teach mutating a nudivirus as it infects an
insect cell so that genes involved in establishing viral lysogeny
are preferentially mutated. In the literature, DEB mutagenesis
usually involves feeding DEB to insects (Reardon et al., 1987,
Genetics 115:323-331; Kimble et al., 1990 Genetics. 1990 December;
126(4):991-1005; Olsen and Green 1982 Mutat Res. 1982 Feb. 22;
92(1-2):107-15), or exposing DNA directly to the mutagen (Yazaki et
al., J Virol Methods. 1986 November; 14(3-4):275-83). See also
Gherezghiher et al. (J Proteome Res 2013, 12(5):2151-2164), Kempf
et al. (Biosci Rep 1990 10(4):363-374), "Methods of identifying
anti-viral agents" U.S. Pat. No. 7,476,499), which relate to
chemical mutagenesis, but which do not describe methods for
targeting viral mutations to selective classes of viral genes as
disclosed herein. The art does not teach the use of DEB to mutate
nudivirus genomes during an infection or methods to target viral
genes by synchronizing chemical exposure with stages of the virus
infection process in cells. Disclosed herein is a novel method that
addresses one or more of the following objectives: 1) efficient
mutation in early expressed genes in the HzNV-2 genome, 2)
introducing a mutation while avoiding viral DNA damage to a level
that compromises virus replication, 3) introducing a mutation while
avoiding killing the virus-infected host Sf9 insect cell, and 4)
allowing recovery of virus mutants before host cells lyse and the
virus becomes unstable (typically in less than 48 h).
[0048] Applicant established an efficient protocol, wherein Sf9
cells were infected with WT HzNV-2 at a multiplicity of infection
(MOI) of 1 for 1.5 hrs. The 1.5 hr incubation time was chosen
because previous literature illustrated that 2 h was enough time
for the related HzNV-1 virus (SEQ ID NO: 2) to enter Sf21 insect
cells and to transcribe the pag1 gene (Chao et al., 1992. J Virol
66(3):1442-1448). Applicant found that one barrier to an effective
method was allowing sufficient time for the virus to enter into the
target cell (the insect cell) and start viral transcription.
Without intending to be limited by theory, Applicant found that
about 1.5 hours was sufficient to achieve this objective. In other
aspects, the infection time may be about 45 minutes or more, or
about one hour to about two hours. Following this step, 0.1 mM DEB
is added to the culture. Applicant found that, at higher
concentrations of DEB (equal to and greater than about 0.5 mM), the
host cell (for example, Sf9 cells) could not survive. A range of
from about 0.05 mM to about 0.1 mM DEB is considered sufficient to
carry out the protocol. The cells were harvested by centrifugation
after a three hr incubation and re-suspended in fresh medium.
Applicant found that three hours was sufficient to cause
mutagenesis but not kill host insect cells. In other aspects, the
infection time may be about four to five hours.
[0049] Plaque assays are performed to isolate mutated viruses,
which are then amplified in Sf9 cells and evaluated for cell lysis.
A mutation in a locus required for the virus latent phase, such as
the pag1 region, should result in increased cell lysis because
infected cells do not enter a latent phase. Increased lysis of
virus-infected cells could be evident from observations of viral
plaque morphology in which lytic virus mutants were larger than
wild type virus plaques. Following the protocol, Applicant found
that almost half of DEB-treated viral plaques (26 of 66) had a
large plaque phenotype. The plaques may be preserved as DEB-mutant
HzNV-2 viral stocks. 31 DEB-treated viruses were further screened
to determine if they caused agonadal female moths. Briefly,
3.sup.rd instar larvae were inoculated with a pre-sterilized pin
dipped in mutant viral supernatants collected from cell culture.
Larvae were reared to adults, and female moths were evaluated for
the ability to lay eggs and for the presence of a viral plug.
Applicant found that 11 of the 31 mutants (KS-3, KS-38, KS-39,
KS-40, KS-45, KS-49, KS-50, KS-51, KS-54, KS-57, KS-65) caused a
higher percentage of agonadal females than WT virus and one virus
(KS-52) led to lower egg production. The outcome of the DEB
mutagenesis was surprisingly efficient; 36% of the 30 viruses
caused more agonadal females than the WT virus in the in vivo
screen. Random mutation of the HzNV-2 genome would be expected to
rarely affect latency because only two of more than 113 viral genes
are known to have a role in establishing the latency. In the
described method, however, approximately 1/3 of mutants appeared to
alter or eliminate the latent phase.
[0050] A detailed exemplary method is as follows:
[0051] Culture conditions. Seed Sf9 insect cells at
2.5.times.10.sup.6 cells/ml in 2 mL with nudivirus media (1.times.
Supplemented Grace's Media, 7% FBS, 1% Penicillin/streptomycin) in
a 25 cm.sup.2 tissue culture flask. Then 3 mL wild-type HzNV-2
virus previously amplified in tissue culture at an estimated MOI of
1 is added.
[0052] WT HzNV-2 virus was amplified by first seeding Sf9 insect
cells in all wells of a 6-well culture dish at 8.times.10.sup.5
cells/ml in 2 ml nudivirus media. After a 1 hr incubation at
27.degree. C., 50 .mu.l of filtered WT HzNV-2 obtained from a viral
plug of agonadal female moth (acquired the same day) was added to
each well using a large bore tip. Plates were incubated for 2 days
at 27.degree. C. Viral supernatants were then collected, cells and
debris were removed by centrifugation (900.times.g, 10 min,
4.degree. C.), and supernatants from all wells were filter
sterilized using a 0.22 .mu.m filter and combined. The approximate
viral titer from the procedure is 1.5.times.10.sup.6 pfu/ml.
[0053] To isolate the WT HzNV-2 from infected female moths, the
viral plug from an infected female moth is first extracted from the
body and moved to a 1.5 ml-microcentrifuge tube. 100 .mu.l
1.times.PBS is added and the plug is homogenized manually with a
pipette tip to release the virus. The large fragments of insect
cuticle and tissue are then removed. This viral solution is termed
unfiltered viral plug extract (UVPE). The filtered viral plug
extract (FVPE) is a filtered solution (with a 0.22 .mu.m filter) of
1.times. supplemented Grace's media, 2% unfiltered viral plug
extract, and 5% penicillin/streptomycin antibiotics.
[0054] Controls for this mutagenesis are performed in parallel.
Controls included uninfected Sf9 culture, uninfected Sf9 culture
treated with DEB, and virus-infected Sf9 culture. These cultures
are prepared the same way and at the same time as the mutagenized
culture described herein.
[0055] The infected Sf9 insect culture is incubated at 27.degree.
C. for 1.5 hours.
Chemical Mutagenesis
[0056] In a fume hood, DEB (other names 1,3-butadiene diepoxide or
1,2,3,4-Diepoxybutane) is added at a 0.1 mM final concentration to
the culture. The culture is then incubated at 27.degree. C. for 3
hours.
[0057] After the 3 h incubation, the culture is moved to the fume
hood. A cell scraper is used to detach cells from the 25 cm.sup.2
flask. The cells and supernatant are moved to a 50 ml-conical tube
and centrifuged at 900.times.g for 10 min at 4.degree. C. The
supernatant is removed to a specified waste container. Cells are
washed with 10 ml PBS, incubated in fume hood for 5 min, then spun
down at 900.times.g for 10 min at 4.degree. C.
[0058] The wash supernatant is removed to a specified waste
container. The cell pellet is then resuspended in 5 ml nudivirus
media and moved to a new 25 cm.sup.2 tissue culture flask, which is
now considered DEB-free. Culture is incubated at 27.degree. C. for
2 d.
[0059] After 2 days, the cell culture medium containing DEB-exposed
HzNV-2 is collected after culture centrifugation at 900.times.g for
10 min and filter sterilization using a 0.22 .mu.m filter. 2 ml of
the virus stock is added to a new 25 cm.sup.2 tissue culture flask
containing Sf9 insect cells that were seeded at 1.times.10.sup.6
cells/ml in a 5 ml total volume with nudivirus media. The
virus-infected culture is incubated at 27.degree. C. for 7 d.
[0060] To purify and amplify the virus to a suitable volume for
insect infection, the virus-containing medium was collected after
centrifugation (3000 rpm, 10 min, 4.degree. C.), filter sterilized
using a 0.22 .mu.m filter, and stored in 1 mL aliquots at
-80.degree. C. The titer of the virus is approximately
1.times.10.sup.4 pfu/mL While HzNV-2 has been shown to infect
several lepidopteran cell lines including Sf-9 and TN-368 cells,
Applicant found that it is difficult to pass the virus in insect
cells due to the virus causing quick cellular lysis. The disclosed
methods allow for amplification of the virus to a volume that
allows for both amounts sufficient virus for storage and also virus
suitable for insect infection.
[0061] Viruses were isolated using a traditional plaque assay,
described in, for example, Anderson, D., Harris, R., Polayes, D.,
Ciccarone, V., Donahue, R., Gerard, G., and Jessee, J. (1996) Rapid
Generation of Recombinant Baculoviruses and Expression of Foreign
Genes Using the Bac-To-Bac.RTM. Baculovirus Expression System.
Focus 17, 53-58. Large plaques, referred to as the p0 viruses, were
further amplified.
[0062] For p0 to p1 amplification, Sf9 insect cells were seeded at
5.times.10.sup.5 cells/ml in a final 2 ml volume with nudivirus
media in 12-well culture plates and incubated at 27.degree. C. for
1 h. Afterwards, viral plaques were picked using a large bore
pipette tip and transferred to one well. Plates were incubated at
27.degree. C. for 5 d. Medium containing DEB-treated HzNV-2 virus
is collected after culture centrifugation (900.times.g for 10 m at
4.degree. C.) and filter sterilized using a 0.22 .mu.m filter.
[0063] For p1 to p2 amplification, Sf9 insect cells were seeded at
8.times.10.sup.5 cells/ml in a final 2 ml volume with nudivirus
media in 6-well culture plates and incubated at 27.degree. C. for 1
h. Afterwards, 600 .mu.l p1 virus was added to one well using a
serological pipet. Plates were incubated at 27.degree. C. for 4 d.
Medium containing DEB-mutated HzNV-2 was then collected after
culture centrifugation (900.times.g for 10 m at 4.degree. C.).
[0064] For p2 to p3 amplification, Sf9 insect cells were seeded at
1.times.10.sup.6 cells/ml in 5 ml with nudivirus media in 25
cm.sup.2 tissue culture flask with no incubation. .about.1.5 ml (or
all) p2 virus was added to one flask using a serological pipet.
Flasks were incubated at 27.degree. C. for 4 d. Medium containing
DEB-mutated HzNV-2 is then collected after culture centrifugation
(900.times.g for 10 min at 4.degree. C.) and filter sterilization
using a 0.22 .mu.m filter. p3 virus is stored in 1 ml aliquots at
-80.degree. C.
[0065] p3 virus was used to infect 3.sup.rd instar larvae via the
direct inoculation method. Each mutant virus caused an infection in
the insect leading to formation of a viral plug found in agonadal
female moths. Virus from these viral plugs may be used in
subsequent experiments.
Confirming Sterilizing Activity of Recombinant and Chemically
Mutated HzNV-2 Virus
[0066] Taken together, the data demonstrate that recombinant and
mutant HzNV-2 viruses can be effectively achieved using one or more
of the above-described methods. Recombinant and mutant HzNV-2
viruses having a disrupted latency phase may be produced in which
genes that affect the latency phase are disrupted or structural
genetic elements required to establish or break latency are
altered. The resulting genetically modified mutant HzNV-2 viruses
cause elevated levels of sterility in infected H. zea moths. In one
aspect, the genes that are disrupted include one or more of pag1,
ORF 90, and ORF92. It is noted that 100% sterile phenotypes may be
produced by mutating different viral genes and regions of the viral
genome.
TABLE-US-00001 TABLE 1 Locations of mutations in the chemical
mutants relative to HzNV-2. Wild-type (WT) HzNV-2 virus was mutated
with DEB to form HzNV-2 chemical mutants. Mutants KS-3, KS-45, and
KS-51 were sequenced and gene deletions were identified. It is
notable that the three mutants have mutations in a region that is
not present in the HzNV-1 genome. HzNV-2 strain WT base pairs
affected WT genes affected yfp HzNV-2 210,631-214,753 bp pag1 KS-3
48 bp insertion at bp ORF90, hypothetical protein 175,550 KS-45 80
bp insertion at bp ORF90, hypothetical protein 175,650 KS-51
180,270-180,299 deletion ORF92, hypothetical protein 77 bp
insertion at bp Intergenic DNA between 109,598 hypothetical
proteins ORF55 and ORF56
[0067] The sterilizing activity of the resulting mutants were
assessed through many experiments in which virus was injected into
H. zea adults or 3rd instar larvae. In a typical experiment,
WT-HzNV-2, the recombinant yfp HzNV-2, and mutant KS3 viruses were
collected and purified from viral plugs found in virus-infected
female moths and then injected into new healthy female moths 2 days
after emergence. The eggs laid on oviposition day 3 were collected
and the F1 progeny female adults were analyzed for sterility as
indicated by the presence of a viral plug and number of eggs laid
(Table 2). Both female groups infected with mutants yfp HzNV-2 and
KS-3 laid few or no eggs and had a much higher percentage of
agonadal females than the WT-infected group. Thus, the viruses
obtained using the described methods are suited for use in
sterilizing populations of pests susceptible to infection by the
described viruses, and may be utilized to control pest
populations.
TABLE-US-00002 TABLE 2 Injection of female moths with mutant HzNV-2
KS3, recombinant mutant yfp HzNV-2, or wild-type (WT) HzNV-2 and
analyses of their female offspring for sterility as determined by
the presence of a viral plug and production of eggs. Virus Plugs
Eggs laid WT HzNV-2 34% many KS3 95% a few yfp HzNV-2 100% none
[0068] In a similar experiment, WT and 9 chemical mutant viruses
were evaluated for the ability to cause agonadal moths. Briefly,
adult female moths were injected with 100 .mu.l of .about.10.sup.8
pfu/ml of virus isolated from viral plugs on the day of emergence.
Eggs laid on oviposition days 2 and 3 were collected and reared to
adult moths. The F1 progeny female moths were evaluated for the
ability to lay eggs and the presence of a viral plug. Four mutants
(KS-3, KS-45, KS-52, KS-51) caused viral plug formation in 100% of
the F1 female progeny (FIG. 2). No eggs were laid by F1 female
progeny of female moths infected with the three mutants (indicative
of an agonadal phenotype (KS3, KS45, KS51) (FIG. 3). F1 female
progeny of female moths infected with another mutant KS52, laid
fewer eggs than F1 female progeny of female moths infected with WT
virus on oviposition day 2 and no eggs on oviposition day 3.
[0069] The functional mutations defined by the applicant, KS-3,
KS-45 and KS-51, identify and localize to ORFs that have several
unrelated direct repeated sequences ranging from 24 to 81 bp in
size and having these sequence repeated from 4 to 12 times. These
repeated sequences were identified by Burand et al., (2012). Such
repeated sequences may have structural as well as coding roles and
with some functions of repeated sequences involving recognition
sites for DNA proteins and directing conformational changes of DNA
that can promote DNA replication, DNA recombination and/or RNA
transcription as examples. A similar repeated sequence exists in
ORF 2 (direct repeat 1; Table 2; Burand et al., 2012) and is
claimed herein as an identified sequence, region and ORF that is
susceptible to mutation and such mutations are likely to impact DNA
replication and recombination and the function of the virus
relative to its effects on viral lysogeny and increased sterility
among H. zea infected with mutations that alter ORF2 (SEQ ID NO:
3). It is notable that the 3 mutations defined by the applicant
localize to ORFs 90 and 92 which contain 4 of the 6 repeated
sequences in the HzNV2 genome. ORF 2 and ORF 91 contain the only
other large repeated sequences in the viral genome and are thus
obvious candidates for mutagenesis with an expectation that it
would impact HzNV2 replication and lysogeny.
[0070] Table 2 shows additional data that compares genetically
engineered and chemical mutant viruses. Progeny female moths
developing from female moths infected with the genetically
engineered recombinant virus, yfp HzNV-2 did not lay eggs and all
F1 female progeny had viral plugs indicating their sterility.
Similarly, essentially all F1 progeny of female moths infected with
the chemical mutant viruses KS3, KS45, KS51, and KS52 had viral
plugs and exhibited sterility (Table 2, FIGS. 2 and 3). By
contrast, much smaller percentages (.about.33%) of insects infected
with WT virus were agonadal (had plugs) with most moths infected
with the WT HzNV-2 being fertile and laying many eggs (Table 2,
FIG. 3). Similar results are seen on other oviposition days,
although the number of female sterile moths in the F1 progeny of
female moths injected with WT HzNV-2 increases at later oviposition
days as reported in the literature (Hamm et al., 1996; Burand
2013). These results support the hypothesis that inactivation of
several nudivirus genes, for example, pag1 (SEQ ID NO: 6), ORF90
(SEQ ID NO: 4), and ORF92 (SEQ ID NO: 5) can cause sterility in
essentially 100% of infected insects.
[0071] While it is to be recognized that viruses capable of being
sexually transmitted among an insect pest species, can be mutated
and selected using the described protocols without knowledge of
specific genes involved in the phenotype of the resulting virus
(for example, using the DEB protocol described above), some genes
associated with increased sterility following viral infection have
been identified by the Applicant. For example, the pag1, ORF 90,
and ORF92 genes have been found by Applicant to be associated with
increased sterility in virus-infected insects.
Infection of an Insect Using Modified HzNV-2
[0072] Published nudivirus literature describes various techniques
for infecting and sterilizing H. zea moths with WT HzNV-2 but are
lacking in various aspects such that a meaningful protocol can be
carried out. Applicant has developed protocols that efficiently 1)
infect the adult moth, 2) infect the moth offspring, and 3) mimic
natural infections of moth populations in the field.
Method of Sterilizing the Offspring of Adult Moths. A Protocol for
Producing Agonadal Infections with WT HzNV-2.
[0073] To infect adult moths, the virus is injected into the
abdomen of adult moths using an insulin syringe. In such
experiments, WT virus collected from a viral plug effectively
infected female adult moths and F1 progeny mimicking natural
infected moth populations (i.e. 20-50% agonadal) (Table 3). Virus
is collected by removing the plug from the abdominal area and
suspending the plug in 100 .mu.l PBS; this is called the unfiltered
viral plug extract (UVPE). The virus is then diluted to 2% in
1.times. Grace's media and filtered through a 0.22 micron filter to
sterilize; this is called the filtered viral plug extract (FVPE).
Applicant determined there was no difference in the percentage of
agonadal F1 progeny when using either UVPE or FVPE for injections.
(Table 3.) Applicant used FVPE for most experimentation.
TABLE-US-00003 TABLE 3 Comparison of unfiltered viral plug extract
(UVPE) and filtered viral plug extract (FVPE) in their ability to
cause agonadal F1 progeny with plug. Oviposition day is the day the
infected female moth laid eggs. Eggs laid on oviposition days 3 and
4 were reared to adults. Oviposition # Females F1 progeny females
day Virus type evaluated for plug with plug 3 UVPE 40 33% 3 FVPE 25
36% 4 UVPE and 35 74% FVPE
Developing the Protocol to Generate a High Number of Agonadal
Moths
[0074] Subsequent experimentation determined that injecting virus
extracted from viral plugs results in a higher percentage of
agonadal F1 progeny than injecting virus produced from infections
of Sf9 cells in culture. Briefly, adult female moths were injected
with 50-60 .mu.l of either FVPE or virus amplified in cell culture.
Eggs were collected on oviposition day 3 and reared to adults. F1
female progeny were evaluated for the presence of a plug. Almost
all of the F1 female progeny developed a plug if F0 female moths
were injected with viral plug extract, whereas only 10% of F1
progeny developed a plug if injected with virus collected from
infected Sf9 cells. (Table 4).
TABLE-US-00004 TABLE 4 Comparison of virus isolated from infected
Sf9 insect cells (cell culture) and isolated from viral plugs (plug
virus) in their ability to cause agonadal F1 progeny as indicated
by the presence of viral plugs. # Females F1 female progeny Virus
type Virus strain evaluated for a plug with plug Cell culture yfp
HzNV-2 11 9% Cell culture KS-3 20 10% Plug virus yfp HzNV-2 26 100%
Plug virus KS-3 20 95%
[0075] Thus, the titer of virus amplified in cell culture used for
infection of adult moths was not optimal. Titer is an important
factor in developing a method for creating high volumes of sterile
insects. The optimal viral titer will be as low as possible but
sufficient to cause agonadal adults. To assess the effects of virus
titer, adult female moths were injected with either 10.sup.7,
10.sup.4 or 10' pfu/ml virus (WT or yfp HzNV-2) and mated with
uninfected males. Eggs were collected on oviposition days 3-5, and
reared to the adult stage. Moths were evaluated for the presence of
a viral plug and egg production. Virus titer of 10.sup.4 pfu/ml led
to a high number of agonadal F1 progeny on oviposition day 5 (Table
5) indicating that the virus replication in the host moth was
important for effective transmission of the virus to the offspring
eggs.
TABLE-US-00005 TABLE 5 Moths were either uninfected or infected
with a low (10.sup.1 pfu/ml), mid (10.sup.4 pfu/ml), or high
(10.sup.7 pfu/ml) dose with either wild- type (WT) or recombinant
yfp HzNV-2 virus. Eggs were collected on oviposition days 3-5,
reared to adults, and the agonadal state of each female was
evaluated by the presence of a plug. F1 progeny collected on F1
Virus oviposition # females # Eggs females group Virus dose day
evaluated laid with plugs Uninfected -- Day 3 7 ~300 0% Day 4 6 14
0% Day 5 4 0 0% WT- 10.sup.1 pfu/ml Day 3 9 5 0% infected Day 4 5
~300 0% Day 5 9 64 22% 10.sup.4 pfu/ml Day 3 6 1 0% Day 4 10 ~150
20% Day 5 10 0 100% yfp HzNV- 10.sup.4 pfu/ml Day 3 4 0 0%
2-infected Day 4 4 0 0% Day 5 10 0 70% 10.sup.7 pfu/ml Day 3 9 ~150
0 Day 4 3 0 0 Day 5 1 0 0
[0076] Injection of the recombinant virus into naive male moths,
followed by mating with healthy females, does not significantly
reduce the number of eggs laid by female moths although the
infection can be transmitted in this manner. However, when newly
emerged female moths were injected with recombinant yfp HzNV-2 and
mated with healthy males, the egg number was dramatically reduced
(FIG. 4). This effect was dose-dependent as a viral dose of
1.times.10.sup.6 pfu exhibited fewer eggs compared to a viral dose
of 1.times.10.sup.3 pfu. The total number of eggs laid by female
moths injected with WT HzNV-2 was not reduced relative to media
injected controls; this effect is only observed with the mutant and
recombinant viruses.
Methods of Sterilizing Adult Moths by Injecting the Insects with
Virus at the Larvae Stage
[0077] An alternative protocol for inducing sterility is to inject
virus into 3rd instar larvae such that the injected insects exhibit
the sterile pathology as adults. While this is not the normal mode
of transmission, larval injections are much faster, amenable to
automation and likely mimic the activation of viral replication
(Rallis et al., 2002-a). Applicant has created two protocols for
inducing sterility in 3.sup.rd instar larvae: syringe injection and
direct inoculation.
Infection Using Syringe Injection
[0078] Injecting supernatants from cultures of virus-infected cells
into adult moths does not produce high numbers of agonadal
offspring (Table 4). To determine if virus produced from infected,
cultured insect cells effectively initiated productive virus
infections when injected into larvae, Applicant injected
virus-containing tissue culture medium into 3.sup.rd instar larvae.
3.sup.rd instar larvae (83 larvae per group) were injected using an
insulin syringe with either WT HzNV-2, yfp HzNV-2, or KS-3 virus
(25-50 .mu.l) or not injected. Larvae were reared to adults.
Surprisingly, none of the yfp HzNV-2-injected larvae pupated and
eventually died (Table 6). However, .about.95% of female larvae
infected with either WT HzNV-2 or KS-3 virus produced a viral plug
as adults (FIG. 5). Applicant concluded that while injecting virus
amplified in tissue culture into adult moths does not produce many
agonadal offspring, injecting virus amplified in tissue culture
into 3.sup.rd instar larvae was an effective method as almost all
moths became agonadal.
TABLE-US-00006 TABLE 6 Larval and pupal stage mortality after
injection of 3.sup.rd instar larvae with WT HzNV-2, recombinant and
mutant HzNV-2 derived from virus-infected insect cell cultures.
Insects survived injection and Group pupated Uninfected 100%
WT-infected 60% KS3-infected 73% yfp HzNV-2-infected 0%
[0079] Injection of viral plug extract into 3.sup.rd instar larvae
with an insulin syringe was also evaluated. Briefly, WT HzNV-2 and
yfp HzNV-2 FVPE was diluted to 7.times.10.sup.3 pfu/ml and
2.5.times.10.sup.2 pfu/ml and 25 .mu.l was injected into 3.sup.rd
instar larvae. Larvae were reared to adults and female moths were
evaluated for the presence of a plug. Female moths that were
injected as larvae with a titer of 10.sup.3 pfu/ml developed a
viral plug, whereas only .about.80% of those injected with 10.sup.2
pfu/ml developed a viral plug (Table 7). Applicant concluded that
injecting 3.sup.rd instar larvae with viral plug extract was also
highly effective at developing agonadal adults, but titer should be
around 10.sup.3 pfu/ml.
TABLE-US-00007 TABLE 7 Incidence of viral plugs after 3.sup.rd
instar larvae were infected with wild-type (WT) HzNV-2 or
recombinant yfp HzNV-2\ at viral doses between 10.sup.2 to 8
.times. 10.sup.3 pfu/ml. Infection-group Virus titer (pfu/ml)
Females with plug Uninfected 0 0% WT-infected 1 .times. 10.sup.2
80% WT-infected 1 .times. 10.sup.3 100% yfp-HzNV2- 4 .times.
10.sup.2 79% infected yfp-HzNV2- 8 .times. 10.sup.3 100%
infected
Infection Using Direct Inoculation Using a Pin
[0080] Direct injection of third instar larvae or moths are
efficient methods for infecting HzNV-2 in the laboratory, but
feeding is a preferred method.
[0081] Infecting H. zea with WT HzNV-2 via an oral route of
infection is possible. Raina et al. (2006) fed WT HzNV-2 to
1.sup.st instar larvae for 1-3 days and found that 9-17% (varies
based on gender and duration of feeding) of adults became agonadal.
Hamm et al. (1996) fed WT HzNV-2 to adult moths in an aqueous
solution and from 60-100% of the offspring adults were agaondal.
The HzNV-2 genome also encodes genes related to four baculovirus
genes (p74, pif-1, pif-2, and pif-3) whose protein products are
involved in viral entry per os (Burand, Kim, Afonso et al. 2012).
Although the natural route of infection for HzNV-2 is through
mating and/or transovarial transmission, other methods for
infecting insects include direct inoculation and feeding of both
larvae and adults.
[0082] A direct inoculation method for transmitting the virus to
3rd instar larvae (Table 8) was developed and may be amenable to
automation. This method is similar to that used by Hamm et al.,
(1996) to infect 1.sup.st instar larvae with viral plug extract
with 9 of 10 larvae becoming agonadal as adults. Direct inoculation
is a rapid means to introduce virus into H. zea larvae in which a
sterile pin is dipped into the viral solution and then used to
prick larvae between the head capsule and abdomen with sufficient
force to penetrate the cuticle and enter the insect's body cavity.
WT HzNV-2 (A, B) virus obtained from two different cell culture
infections A and B) were used for direct inoculation. The pricked
larvae were reared to adult moths, and female moths were evaluated
for the presence of a plug. 57% (WT A) and 16% (WT B) of moths were
agonadal.
[0083] To test virus isolated from plugs, .about.10.sup.8 pfu/ml of
WT HzNV-2 or recombinant yfp HzNV-2 viruses were isolated, filter
sterilized and used in direct inoculation experiments. The
inoculated larvae were reared to adult moths and mated. All female
moths developing from larvae inoculated with recombinant yfp HzNV-2
were sterile (no eggs laid; plugs in 100% of females). Upon
dissection, all male moths examined were found to be agonadal.
[0084] For larvae inoculated with WT HzNV-2, 90% of female moths
had a viral plug with the number of eggs laid commensurately
reduced relative to controls (Table 8). In summary, the direct
inoculation method not only was as efficient as injecting the virus
into larvae, it also was much faster.
TABLE-US-00008 TABLE 8 Effects of direct inoculation of 3.sup.rd
instar larvae with wild-type (WT) and yfp recombinant HzNV-2
purified from viral plugs on moth sterility. State of # % Female
reproductive of eggs moths with organs in male Group laid* plugs
moths** Unpricked High 0 0% agonadal Medium control High 0 0%
agonadal WT HzNV-2 Low 90 50% agonadal yfp HzNV-2 None 100 100%
agonadal *high: >700 eggs; low <200 eggs; **determined by
dissecting reproductive organs of H. zea males.
[0085] To investigate effects of titer on the direct inoculation
method WT HzNV-2 isolated from a viral plug was diluted to 10.sup.6
pfu/ml and used to inoculate 3.sup.rd instar larvae. Only 18% of
WT-HzNV-2 pricked females were agonadal with the 10.sup.6 pfu/ml
inoculum. Many females, termed carriers, are infected with virus
but have inactive or latent infections. Moths having latent
infections have intact, functional reproductive tracts but can
transmit the virus horizontally and vertically to their offspring.
PCR using a primer set to the HzNV-2 ORF78 was performed, and all
20 of the females without viral plugs tested were carriers.
Applicant concluded that use of direct inoculation with a lower
titer of 10.sup.6 pfu/ml to infect 3.sup.rd instar larvae created a
carrier population.
Method of Infecting an Insect with the Disclosed Viruses
[0086] Alternative methods for introducing insect nudiviruses and
baculoviruses are reported in the scientific and patent literature.
The literature suggests that efficient infection is possible by
feeding newly emerged (neonate) first instar larvae, by feeding
adults virus in a sucrose solution, by adding fluorescent
brighteners to larval diet, or by aerosol infections with virus in
powdered or droplet form (Kirkpatrick et al., 1994; U.S. Pat. No.
7,261,886). A recent patent filing reports efficient baculovirus
infection achieved by immersing larvae in a viral solution (US
Patent Publication US2011/0314562).
[0087] In accordance with the instant disclosure, three different
methods for infecting large numbers of larvae may be used as
follows:
[0088] 1. Virus Feeding. The protocol used by Raina and Lupiani
(2006) may be used. Briefly, newly hatched H. zea larvae may be
placed in a 100.times.15 mm Petri dish containing a diet with 1000
pfu of mutant HzNV-2. To increase the efficient uptake of the
virus, the fluorescent brightener Blankophor may be added to the
diet (Martinez et al., 2009). The larvae may be allowed to feed for
48 hrs then placed in diet-containing cups. H. zea is very
cannibalistic and so must be housed individually at a young instar.
The pupae will be sexed and emerged females will be analyzed for
viral plugs, the ability to lay fertile eggs after mating, and the
presence of intact reproductive organs.
[0089] The males may then be dissected and their reproductive
organs examined to determine if they are agonadal. The presence of
mutant HzNV-2 may be confirmed by PCR, as described above.
[0090] 2. Virus Aerosols. The virus may be delivered as a
lyophilized powder (Kirkpatrick et al., 1994) or as an aqueous mist
(U.S. Pat. No. 7,261,886). 3rd instar H. zea larvae may be
anesthetized with CO.sub.2 and placed in a test chamber. The
lyophilized mutant virus may be placed in the chamber at different
doses and dispersed continuously throughout the chamber by a gentle
stream of air, for a total exposure time of 30 min. Each insect may
be sexed after they pupate, and after emergence, each moth may be
analyzed for sterility as described above. For the aqueous mist
deliver, a Potter precision laboratory spray tower (Burkard
Scientific) may be used, and 3rd instar larvae may receive doses of
mutant HzNV-2 from 10.sup.2 to 10.sup.4 pfu/ml. Agonadal pathology
may be assessed in adult moths.
[0091] 3. Immersion. H. zea larvae may be submerged in a HzNV-2
solution as described by Lu et al. (2011). This treatment method
involves first stressing the insects at 4.degree. C. for 15 hours
before soaking the 3rd instar larvae in different concentrations of
mutant HzNV-2 (10.sup.3-10.sup.6 pfu/ml) for 1 hr. Sterility in
adult moths may be determined as described above.
Method of Protecting a Crop from Pest Insects
[0092] The instant disclosure addresses a method for control of
lepidopteran pest moths by rendering them sterile from infection
with mutant or transgenic HzNV-2. The delivery of HzNV-2 or a
mutant form thereof in accordance with the disclosed methods and
compositions to the targeted population may be through established
methods for release of moths for sterile insect control. In one
aspect, the moths or other pest infected with a mutant virus as
disclosed herein, are released at point locations and permitted to
disperse over a range. The range may be, for example, about 800
meters from the release site or released aerially from planes,
helicopters or drones. Moths infected with mutant or recombinant
HzNV-2 may be released after infection using one or more of the
disclosed methods at ratios from 0.1 infected moths/WT moth in the
field population moth up to 10 infected moths/WT moth in the field
population. Targeted release at lower ratios may rely on
generational transmission of the infection for control and may
require supplemental release on virus-infected adult moths.
REFERENCES
[0093] Adamo, S. A., Kovalko, I., Easy, R. H., and Stoltz, D.
(2014). A viral aphrodisiac in the cricket Gryllus texensis. J Exp
Biol. 217(Pt 11): 1970-1976, PMID: 24625650. [0094] Ali, M. I., and
Luttrell, R. G. (2007). Susceptibility of bollworm and tobacco
budworm (Lepidoptera: Noctuidae) to Cry2Ab2 insecticidal protein. J
Econ Entomol 100: 921-931, PMID:17598557. [0095] Ali, M. I.,
Luttrell, R. G., and Young, S. Y. 3.sup.rd (2006). Susceptibilities
of Helicoverpa zea and Heliothis virescens (Lepidoptera: Noctuidae)
populations to Cry1Ac insecticidal protein. J Econ Entomol 99:
164-175, PMID:16573337. [0096] Arneodo, J. D., Balbi, E. I.,
Flores, F. M., and Sciocco-Cap, A. (2015). Molecular identification
of Helicoverpa armigera (Lepidoptera: Noctuidae: Heliothinae) in
Argentina and development of a novel PCR-RFLP method for its rapid
differentiation from H. zea and H. gelotopoeon. J Econ Entomol
108(6): 2505-2510, PMID: 26318007. [0097] Bedford, G. O. (2013).
Biology and management of palm dynastid beetles: recent advances.
Annu Rev Entomol. 58: 353-372, PubMed PMID: 23317044. [0098] Berge,
J. B., and Ricroch, A. E. (2010). Emergence of minor pests becoming
major pests in GE cotton in China: what are the reasons? What are
the alternatives practices to this change of status? GM Crops.
1(4): 214-219, PMID: 21844676. [0099] Bezier, A., Theze, J.,
Gavory, F., Gaillard, J., Poulain, J., Drezen, J. M, and Herniou,
E. A. (2015). The genome of the nucleopolyhedrosis-causing virus
from Tipula oleracea sheds new light on the Nudiviridae family. J
Virol. 89(6): 3008-3025, PMID: 25540386. [0100] Burand, J. P.
(2013). Pathology and replication of the sexually transmitted
insect virus HzNV-2. Advances in Virus Research. ISBN:
978-1477555-04-0. iConcept Press. [0101] Burand, J. P., Kim, W.,
Afonso, C. L., Tulman, E. R., Kutish, G. F., Lu, Z., and Rock, D.
L. (2012). Analysis of the genome of the sexually transmitted
insect virus Helicoverpa zea nudivirus 2. Viruses 4: 28-61,
PMID:22355451. [0102] Burand J. P., Tan, W., Kim, W., Nojima, S.,
and Roelofs, W. (2005). Infection with the insect virus Hz-2v
alters mating behavior and pheromone production in female
Helicoverpa zea moths. J Insect Sci. 5: 6. PMID: 16299596. [0103]
Burand, J. P., and Rallis, C. P. (2004). In vivo dose-response of
insects to Hz-2V infection. Virology journal 1: 15, PMID:15613241.
[0104] Burand, J. P., Rallis, C. P., and Tan, W. (2004). Horizontal
transmission of Hz-2V by virus infected Helicoverpa zea moths. J
Invertebr Pathol 85: 128-131, PMID:15050843. [0105] Burand, J. P.,
and Lu, H. (1997). Replication of a Gonad-Specific Insect Virus in
TN-368 Cells in Culture. J Invertebr Pathol. 70(2): 88-95. PMID:
9281395. [0106] Burand, J. P., and Wood, H. A. (1986).
Intracellular protein synthesis during standard and defective Hz-1
virus replication. J. Gen. Virol. 67: 167-173. [0107] Burand, J.
P., Stiles, B., and Wood, H. A. (1983). Structural and
Intracellular Proteins of the Nonoccluded Baculovirus HZ-1. J
Virol. 46(1): 137-142. PMID: 16789238. [0108] Burand, J. P., Wood,
H. A., and Summer, M. D., (1983). Defective particles from a
persistent baculovirus infection in Trichoplusia ni tissue culture
cells. J. Gen. Virol. 64: 391-398. [0109] CABI 2015
http://www.cabi.org/isc/datasheet/26776 [0110] Campagne, P.,
Kruger, M., Pasquet, R., Le Ru, B., and Van den Berg, J. (2013).
Dominant inheritance of field-evolved resistance to Bt corn in
Busseolafusca. PLoS One 8: e69675, PMID:23844262. [0111] Capinera
2000, revised 2007 UF/IFAS Extension
http://entomology.ifas.ufl.edu/creatures. [0112] Carriere, Y.,
Crowder, D. W., and Tabashnik, B. E. (2010). Evolutionary ecology
of insect adaptation to Bt crops. Evol Appl 3: 561-573, EPA (1998).
The Environmental Protection Agency's White Paper on Bt
Plant-pesticide Resistance Managment (EPA). [0113] Chao, Y. C.,
Lee, S. T., Chang, M. C., Chen, H. H., Chen, S. S., Wu, T. Y., Liu,
F. H., Hsu, E. L., and Hou, R. F. (1998). A 2.9-kilobase noncoding
nuclear RNA functions in the establishment of persistent Hz-1 viral
infection. J Virol. 72(3): 2233-2245. PMID: 9499081. [0114] Chao,
Y. C., Wood, H. A., Chang, C. Y., Lee, H. J., Shen, W. C., and Lee,
H. T. (1992). Differential expression of Hz-1 baculovirus genes
during productive and persistent viral infections. J Virol. 66(3):
1442-7448. PMID: 1738201. [0115] Chen, H. H., Tsai, F. Y., Chen, C.
T. (2001). Negative regulatory regions of the PAT1 promoter of Hz-1
virus contain GATA elements which associate with cellular factors
and regulate promoter activity. J Gen Virol. 82(Pt 2): 313-320.
PMID: 11161268. [0116] Cheng, C. H., Liu, S. M., Chow, T. Y.,
Hsiao, Y. Y., Wang, D. P., Huang, J. J., Chen, H. H. (2002).
Analysis of the complete genome sequence of the Hz-1 virus suggests
that it is related to members of the Baculoviridae. J Virol.
76(18): 9024-9034. PMID: 12186886. [0117] Cheng, R. L., Xi, Y.,
Lou, Y. H., Wang, Z., Xu, J. Y., Xu, H. J., and Zhang, C. X.
(2014). Brown planthopper nudivirus DNA integrated in its host
genome. J Virol. 88(10): 5310-5318. PMID: 24574410. [0118]
Cunningham, J. P., and Zalucki, M. P. (2014). Understanding
heliothine (Lepidoptera: Heliothinae) pests: what is a host plant?
J Econ Entomol. 107(3): 881-896, PMID: 25026644. [0119] de Miranda,
J. R., and Fries, I. (2008). Venereal and vertical transmission of
deformed wing virus in honeybees (Apis mellifera L.). J Invertebr
Pathol. 98(2): 184-189, PubMed PMID: 18358488. [0120] Ferrelli, M.
L., Taibo, C., Fichetti, P., Sciocco-Cap, A., Arneodo, J. D.
(2015). Characterization of a new Helicoverpa armigera
nucleopolyhedrovirus variant causing epizootic on a previously
unreported host, Helicoverpa gelotopoeon (Lepidoptera: Noctuidae).
J Invertebr Pathol. pii: S0022-2011(15)30008-2, PMID: 26296927.
[0121] Fitt, G. P. (1989). The ecology of Heliothis species in
relation to agrosystems. Ann Rev Entomol 34, 17-52 [0122] Franz,
G., and Robinson, A. S. (2011). Molecular technologies to improve
the effectiveness of the sterile insect technique. Genetica 139(1):
1-5, PMID: 21258957. [0123] Gherezghiher, T. B., Ming, X.,
Villalta, P. W., Campbell, C., and Tretyakova, N. Y. (2013).
1,2,3,4-Diepoxybutane-induced DNA-protein cross-linking in human
fibrosarcoma (HT1080) cells. J Proteome Res. 12(5): 2151-2164,
PMID: 23506368. [0124] Granados, R. R., Nguyen, T., and Cato, B.
(1978). An insect cell line persistently infected with a
baculovirus-like particle. Intervirol, 10(5), 309-17. [0125] Hamm,
J. J. (1997). Gonad-specific virus of Helicoverpa zea does not
affect infectivity of nuclear polyhedrosis virus. J. Entomol. Sci.
32(1): 106-109 [0126] Hamm, J. J., Carpenter, J. E., and Styer, E.
L. (1996). Oviposition day effect on incidence of agonadal progeny
of Helicoverpa zea (Lepidoptera: Nocutidae) infected with a virus.
Ann. Entomol. Soc. Am. 89(2): 266-275 [0127] Helicoverpa armigera
TWG Report, Rev. 1, USDA APHIS PPQ Technical Working Group [0128]
http://www.statista.com/topics/2062/genetically-modified-crops/
[0129] Huang, F., Andow, D. A., and Buschman, L. (2011). Success of
the high dose/refuge resistance management strategy after 15 years
of Bt crop use in North America. Entomol Exp Appl 140, 1-16. [0130]
James, C. (2012). Global status of commercialized biotech/GM crops:
2012. In ISAA Briefs (Ithaca, N.Y.: ISAAA). [0131] Kempf, C.,
Michel, M. R., Omar, A., Jentsch, P., and Morell, A. (1990).
Semliki Forest virus induced cell-cell fusion at neutral
extracellular pH. Biosci Rep. 10(4): 363-374, PMID: 2249002. [0132]
Knell, R. J., and Webberley, K. M. (2004). Sexually transmitted
diseases of insects: distribution, evolution, ecology and host
behaviour. Biol Rev Camb Philos Soc. 79(3): 557-581, PMID:
15366763. [0133] Lee, S., Park, K. H., Nam, S. H., Kwak, K. W., and
Choi, J. Y. (2015). First report of Oryctes rhinoceros nudivirus
(Coleoptera: Scarabaeidae) causing severe disease in Allomyrina
dichotoma in Korea. J Insect Sci. 12: 15, PubMed PMID: 25765317.
[0134] Lee, J. C., Chen, H. H., Wei, H. L., and Chao, Y. C. (1993).
Superinfection-induced apoptosis and its correlation with the
reduction of viral progeny in cells persistently infected with Hz-1
baculovirus. J Virol. 67(12): 6989-94, PMID: 8230422. [0135] Lin,
C. L., Lee, J. C., Chen, S. S., Wood, H. A., Li, M. L., Li, C. F.,
and Chao, Y. C. (1999). Persistent Hz-1 virus infection in insect
cells: evidence for insertion of viral DNA into host chromosomes
and viral infection in a latent status. J Virol. 73(1): 128-39,
PMID: 9847315. [0136] Lupiani, B., Raina, A. K., and Huber, C.
(1999). Development and use of a PCR assay for detection of the
reproductive virus in wild populations of Helicoverpa zea
(Lepidoptera: noctuidae). J Invertebr Pathol 73, 107-112. [0137]
Luttrell, R. G., and Jackson, R. E. (2012). Helicoverpa zea and Bt
cotton in the United States. GM Crops & Food: Biotechnol in
Agriculture Food Chain, 3(3): 213-227. [0138] Morrison, N. I.,
Simmons, G. S., Fu, G., O'Connell, S., Walker, A. S., Dafa'alla,
T., Walters, M., Claus, J., Tang, G., Jin, L., Marubbi, T., Epton,
M. J., Harris, C. L., Staten, R. T., Miller, E., Miller, T. A., and
Alphey, L. (2012). Engineered repressible lethality for controlling
the pinkbollworm, a lepidopteran pest of cotton. PLoS One 7(12):
e50922, PMID: 23226548. [0139] Nguyen, Q., Chan, L. C., Nielsen, L.
K., and Reid, S. (2013). Genome scale analysis of differential mRNA
expression of Helicoverpa zea insect cells infected with a H.
armigera baculovirus. Virology 444(1-2): 158-170, PMID: 23827436.
[0140] Nguyen, Q., Palfreyman, R. W., Chan, L. C., Reid, S., and
Nielsen, L. K. (2012). Transcriptome sequencing of and microarray
development for a Helicoverpa zea cell line to investigate in vitro
insect cell-baculovirus interactions. PLoS One. 7(5): e36324, PMID:
22629315. [0141] U.S. Pat. No. 7,476,499: "Methods of identifying
anti-viral agents" (use of DEB as mutagen) [0142] U.S. Pat. No.
7,261,886 B2 "Insect larva aerosol infection method for producing
recombinant proteins and baculovirus bio-insecticides" [0143]
patent # US 2011/0314562 A1 "Insect infection method for production
of proteins" [0144] Pichon, A., Bezier, A., Urbach, S., Aury, J.
M., Jouan, V., Ravallec, M., Guy, J., Cousserans, F., Theze, J.,
Gauthier, J., Demettre, E., Schmieder, S., Wurmser, F., Sibut, V.,
Poirie, M., Colinet, D., da Silva, C., Couloux, A., Barbe, V.,
Drezen, J. M., and Volkoff, A. N. (2015). Recurrent DNA virus
domestication leading to different parasite virulence strategies.
Sci Adv. 1(10): e1501150, PMID: 26702449. [0145] Pushparajan, C.,
Claus, J. D., Marshall, S. D., and Visnovsky, G. (2013).
Characterization of growth and Oryctes rhinoceros nudivirus
production in attached cultures of the DSIR-HA-1179 coleopteran
insect cell line. Cytotechnology. 65(6): 1003-1016, PMID: 23979321.
[0146] Raina, A. K., Adams, J. R., Lupiani, B., Lynn, D. E., Kim,
W., Burand, J. P., and Dougherty, E. M. (2000). Further
characterization of the gonad-specific virus of corn earworm,
Helicoverpa zea. J Invertebr Pathol 76: 6-12, PMID:10963397. [0147]
Raina, A. K., and Lupiani, B. (2006). Acquisition, persistence, and
species susceptibility of the Hz-2V virus. J Invertebr Pathol 93:
71-74. [0148] Rallis, C. P., and Burand, J. P. (2002a). Pathology
and ultrastructure of Hz-2V infection in the agonadal female corn
earworm, Helicoverpa zea. J Invertebr Pathol 81: 33-44,
PMID:12417211. [0149] Rallis, C. P., and Burand, J. P. (2002b).
Pathology and ultrastructure of the insect virus, Hz-2V, infecting
agonadal male corn earworms, Helicoverpa zea. J Invertebr Pathol
80: 81-89, PMID:12383433. [0150] Reardon, J. T.,
Liljestrand-Golden, C. A., Dusenbery, R. L., and Smith, P. D.
(1987). Molecular Analysis of Diepoxybutane-Induced Mutations at
the rosy Locus of Drosophila melanogaster. Genetics 115: 323-331,
PMID: 17246369. [0151] Simmons, G. S., McKemey, A. R., Morrison, N.
I., O'Connell, S., Tabashnik, B. E., Claus, J., Fu, G., Tang, G.,
Sledge, M., Walker, A. S., Phillips, C. E., Miller, E. D., Rose, R.
I., Staten, R. T., Donnelly, C. A., and Alphey, L. (2011). Field
performance of a genetically engineered strain of pink bollworm.
PLoS One. 6(9): e24110, PMID: 21931649. [0152] Skalsky, R. L., and
Cullen, B. R. (2010). Viruses, microRNAs, and host interactions.
Annu Rev Microbiol. 64:123-41, PMID: 20477536. [0153] Smith-Pardo,
A. (2014). The old world bollworm Helicoverpa armigera (Hubner)
(Lepidoptera: Noctuidae: Heliothinae) its biology, economic
importance and its recent introduction into the western hemisphere.
Boletin del museo entomologico 6(1): 18-28. [0154] Tabashnik, B.
E., Mota-Sanchez, D., Whalon, M. E., Hollingworth, R. M., and
Carriere, Y. (2014). Defining terms for proactive management of
resistance to Bt crops and pesticides. J Econ Entomol 107(2):
496-507, PMID: 24772527. [0155] Tabashnik, B. E., Brevault, T., and
Carriere, Y. (2013). Insect resistance to Bt crops: lessons from
the first billion acres. Nat Biotechnol 31: 510-521, PMID:23752438.
[0156] Tabashnik, B. E., Van Rensburg, J. B. J., and Carriere, Y.
(2009). Field-evolved insect resistance to Bt crops: evidence
versus theory. J Econ Entomol 102: 2011-2025. [0157] Tretyakova, N.
Y., Michaelson-Richie, E. D., Gherezghiher, T. B., Kurtz, J., Ming,
X., Wickramaratne, S., Campion, M., Kanugula, S., Pegg, A. E., and
Campbell, C. (2013). DNA-reactive protein monoepoxides induce cell
death and mutagenesis in mammalian cells. Biochemistry 52(18):
3171-3181, PMID: 23566219. [0158] Tyagi, A., Singh, N. K., Gurtler,
V., and Karunasagar, I. (2016). Bioinformatics analysis of codon
usage patterns and influencing factors in Penaeus monodon
nudivirus. Arch Virol. 161(2): 459-464, PMID: 26586333. [0159]
Unckless, R. L. (2011). A DNA virus of Drosophila. PLoS One. 6(10):
e26564, PMID: 22053195. [0160] Walters, M., Morrison, N. I., Claus,
J., Tang, G., Phillips, C. E., Young, R., Zink, R. T., and Alphey,
L. (2012). Field longevity of a fluorescent protein marker in an
engineered strain of the pink bollworm, Pectinophora gossypiella
(Saunders). PLoS One 7(6): e38547, PMID: 22693645. [0161] Wang, Y.,
Bininda-Emonds, O. R., van Oers, M. M., Vlak, J. M., and Jehle, J.
A. (2011). The genome of Oryctes rhinoceros nudivirus provides
novel insight into the evolution of nucleararthropod-specific large
circular double-stranded DNA viruses. Virus Genes 42(3): 444-456,
PMID: 21380757. [0162] Wang, Y., and Jehle, J. A. (2009).
Nudiviruses and other large, double-stranded circular DNA viruses
of invertebrates: new insights on an old topic. J Invertebr Pathol.
101(3): 187-193, PMID: 19460388. [0163] Wang, Y., Kleespies, R. G.,
Ramle, M. B., and Jehle, J. A. (2008). Sequencing of the large
dsDNA genome of Oryctes rhinoceros nudivirus using multiple
displacement amplification of nanogram amounts of virus DNA. J
Virol Methods. 152(1-2): 106-108, PMID: 18598718. [0164] Wang, Y.,
Kleespies, R. G., Huger, A. M., and Jehle, J. A. (2007). The genome
of
Gryllus bimaculatus nudivirus indicates an ancient diversification
of baculovirus-related nonoccluded nudiviruses of insects. J Virol.
81(10): 5395-5406, PMID: 17360757. [0165] Wang, Y., van Oers, M.
M., Crawford, A. M., Vlak, J. M., and Jehle, J. A. (2007). Genomic
analysis of Oryctes rhinoceros virus reveals genetic relatedness to
Heliothis zea virus 1. Arch Virol. 152(3): 519-531, PMID: 17106621.
[0166] Wijen, J. P., Nivard, M. J., and Vogel, E. W. (2001).
Genetic damage by bifunctional agents in repair-active pre-meiotic
stages of Drosophila males. Mutat Res 478: 107-117, PMID: 11406175.
[0167] Wood, H. A., and Burand, J. P. (1986). Persistent and
productive infections with the Hz-1 baculovirus. Current topics in
microbiology and immunology 131: 119-133, PMID: 3816297. [0168] Wu,
Y. L., Wu, C. P., Lee, S. T., Tang, H., Chang, C. H., Chen, H. H.,
and Chao, Y. C. (2010). The early gene hhil reactivates Heliothis
zea nudivirus 1 in latently infected cells. Journal of virology 84:
1057-1065, PMID: 19889784. [0169] Wu, Y. L., Wu, C. P., Liu, C. Y.,
Hsu, P. W., Wu, E. C., and Chao, Y. C. (2011a). A non-coding RNA of
insect HzNV-1 virus establishes latent viral infection through
microRNA. Scientific reports 1: 60, PMID: 22355579. [0170] Wu, Y.
L., Wu, C. P., Liu, C. Y., Lee, S. T., Lee, H. P., and Chao, Y. C.
(2011b). Heliothis zea nudivirus 1 gene hhil induces apoptosis
which is blocked by the Hz-iap2 gene and a noncoding gene, pag1.
Journal of virology 85: 6856-6866, PMID: 21543471. [0171] Wu, Y.
L., Liu, C. Y., Wu, C. P., Wang, C. H., Lee, S. T., and Chao, Y. C.
(2008). Cooperation of iel and p35 genes in the activation of
baculovirus AcMNPV and HzNV-1 promoters. Virus Res. 135(2):
247-254, PMID: 18486255. [0172]
www.usda.gov/nass/PUBS/TODAYRPT/acrg0615.pdf (USDA "Acreage" 2015
ISSN: 1949-1522) [0173] Yang, Y. T., Lee, D. Y., Wang, Y., Hu, J.
M., Li, W. H., Leu, J. H., Chang, G. D., Ke, H. M., Kang, S. T.,
Lin, S. S., Kou, G. H., and Lo, C. F. (2014). The genome and
occlusion bodies of marine Penaeus monodon nudivirus (PmNV, also
known as MBV and PemoNPV) suggest that it should be assigned to a
new nudivirus genus that is distinct from the terrestrial
nudiviruses. BMC Genomics 15: 628, PMID: 25063321. [0174] Yazaki,
K., Mizuno, A., Sano, T., Fujii, H., and Miura, K. (1986). A new
method for extractingcircular and supercoiled genome segments from
cytoplasmic polyhedrosis virus. J Virol Methods 14(3-4): 275-283,
PMID: 3539959. [0175] Zhao, X.-C., Dong, J.-F., Tang, Q.-B., Yan,
Y.-H., Gelbic, I., Van Loon, J. J. A., and Wang, C.-Z. (2005).
Hybridization between Helicoverpa armigera and Helicoverpa assulta
(Lepidoptera: Noctuidae): development and morphological
characterization of F.sub.1 hybrids. Bulletin of Entomol Research
95: 409-416.
[0176] All percentages and ratios are calculated by weight unless
otherwise indicated.
[0177] All percentages and ratios are calculated based on the total
composition unless otherwise indicated.
[0178] It should be understood that every maximum numerical
limitation given throughout this specification includes every lower
numerical limitation, as if such lower numerical limitations were
expressly written herein. Every minimum numerical limitation given
throughout this specification will include every higher numerical
limitation, as if such higher numerical limitations were expressly
written herein. Every numerical range given throughout this
specification will include every narrower numerical range that
falls within such broader numerical range, as if such narrower
numerical ranges were all expressly written herein.
[0179] The dimensions and values disclosed herein are not to be
understood as being strictly limited to the exact numerical values
recited. Instead, unless otherwise specified, each such dimension
is intended to mean both the recited value and a functionally
equivalent range surrounding that value. For example, a dimension
disclosed as "20 mm" is intended to mean "about 20 mm."
[0180] Every document cited herein, including any cross referenced
or related patent or application, is hereby incorporated herein by
reference in its entirety unless expressly excluded or otherwise
limited. The citation of any document is not an admission that it
is prior art with respect to any invention disclosed or claimed
herein or that it alone, or in any combination with any other
reference or references, teaches, suggests or discloses any such
invention. Further, to the extent that any meaning or definition of
a term in this document conflicts with any meaning or definition of
the same term in a document incorporated by reference, the meaning
or definition assigned to that term in this document shall
govern.
[0181] While particular embodiments of the present invention have
been illustrated and described, it would be obvious to those
skilled in the art that various other changes and modifications can
be made without departing from the spirit and scope of the
invention. It is therefore intended to cover in the appended claims
all such changes and modifications that are within the scope of
this invention.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20180064113A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20180064113A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References