U.S. patent application number 15/671001 was filed with the patent office on 2018-02-01 for puma, a pro-apoptotic gene, as a novel molecular biomarker for tnfalpha-induced human islet damage.
The applicant listed for this patent is CITY OF HOPE, HITACHI CHEMICAL CO., LTD., HITACHI CHEMICAL RESEARCH CENTER, INC.. Invention is credited to Masato MITSUHASHI, Yoko MULLEN, Keiko OMORI.
Application Number | 20180030537 15/671001 |
Document ID | / |
Family ID | 45352892 |
Filed Date | 2018-02-01 |
United States Patent
Application |
20180030537 |
Kind Code |
A1 |
MULLEN; Yoko ; et
al. |
February 1, 2018 |
PUMA, A PRO-APOPTOTIC GENE, AS A NOVEL MOLECULAR BIOMARKER FOR
TNFALPHA-INDUCED HUMAN ISLET DAMAGE
Abstract
p53-upregulated modulator of apoptosis (PUMA) is a biomarker
associated with islet cell health. If PUMA is low, islet cells are
typically healthy. If PUMA is high, islet cells are typically
unhealthy or dying. PUMA may be measured by either measuring its
nucleic or amino acid. PUMA mRNA may be induced by TNF-.alpha.
stimulation in a time- and dose-dependent manner and .beta. cell
apoptosis is induced through a mitochondrial pathway. TNF-.alpha.
significantly inhibited glucose-induced preproinsulin precursor
mRNA synthesis. Such .beta. cell stress signaling in human islets
indicates overall state of islet health and, ultimately, the risk
of onset and/or degree of severity of both type 1 and type 2
diabetes mellitus.
Inventors: |
MULLEN; Yoko; (Sherman Oaks,
CA) ; MITSUHASHI; Masato; (Irvine, CA) ;
OMORI; Keiko; (Pasadena, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CITY OF HOPE
HITACHI CHEMICAL RESEARCH CENTER, INC.
HITACHI CHEMICAL CO., LTD. |
Duarte
Irvine
Tokyo |
CA
CA |
US
US
JP |
|
|
Family ID: |
45352892 |
Appl. No.: |
15/671001 |
Filed: |
August 7, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13163326 |
Jun 17, 2011 |
9758826 |
|
|
15671001 |
|
|
|
|
61358376 |
Jun 24, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/507 20130101;
G01N 2333/4748 20130101; G01N 2333/525 20130101; C12Q 1/6883
20130101; C12Q 2600/136 20130101; C12Q 2600/158 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 33/50 20060101 G01N033/50 |
Goverment Interests
GOVERNMENT INTEREST
[0002] The present invention was made with government support under
National Institutes of Health grant number U42RR16607. The
government may have certain rights in the present invention.
Claims
1. A method for measuring the health of an islet cell, comprising
measuring the level of p53 upregulated modulator of apoptosis
(PUMA), wherein the level of PUMA is inversely proportional to the
health of the islet cell.
2. The method of claim 1, wherein the level of PUMA is measured by
quantifying the amount of nucleic acid encoding PUMA expressed by
the islet cell.
3. The method of claim 2, wherein the nucleic acid is PUMA mRNA and
wherein the level of BBC3 mRNA is also quantified.
4. The method of claim 1, wherein tumor necrosis factor-.alpha.
level is positively correlated to the level of PUMA in the islet
cell.
5. The method of claim 1, wherein the level of PUMA is measured by
stimulating islet cells with TNF-.alpha. alone or in combination
with interferon gamma.
6. The method of claim 1, wherein a high level of PUMA indicates an
increased risk or severity of diabetes in a subject that produced
the islet cell.
7. The method of claim 6, wherein the diabetes is type 1 diabetes
mellitus or type 2 diabetes mellitus.
8. The method of claim 1, wherein a low level of PUMA indicates a
healthy islet cell.
9. The method of claim 1, wherein the level of PUMA is a factor in
determining whether the islet cell is a candidate for
transplant.
10. The method of claim 1, further comprising testing the level of
one or more proinflammatory cytokines, wherein a low PUMA level
combined with a low or undetectable level of one or more of tumor
necrosis factor-.alpha., interleukin-1.beta., interferon-.gamma.,
oxygen free radicals, or nitric oxide indicates good islet cell
health.
11. A method protecting an islet cell from apoptosis comprising
administering a JAK inhibitor to the islet cell.
12. The method of claim 11, wherein the method further comprises
administering a tyrosine kinase inhibitor to the islet cell.
13. The method of claim 12, wherein the tyrosine kinase inhibitor
is Imatinib.
14. A screen for a compound that protects islet cell health,
comprising: (a) administering the compound to an islet cell; (b)
after a time sufficient for the compound to affect the level of
PUMA in the islet cell, taking a measurement of the level of PUMA
in the islet cell and comparing that measurement to either a first
measurement taken before the administration of the compound or a
known PUMA level; wherein, if the level of PUMA in the cell has
decreased after administration of the compound, then the compound
protects islet cell health.
15. The screen of claim 14, wherein the level of PUMA is measured
after both the compound and TNF-.alpha. are administered to the
islet cell, and wherein, if the level of PUMA does not increase,
the compound protect the islet cells from TNF-.alpha. mediated
islet damage.
16. The screen of claim 14, wherein the PUMA nucleic acid or amino
acid is measured.
17. The screen of claim 14, further comprising administering the
compound to the islet cell more than once and taking additional
PUMA measurements over time to develop a time and dosing course for
the compound.
18. The screen of claim 14, wherein a compound found to protect
islet health is administered in a pharmaceutically effective
carrier and dose to a patient for the treatment of diabetes.
19. The screen of claim 14, wherein the compound is a TNF-.alpha.
receptor blocker.
20. The screen of claim 19, wherein the compound is Etanercept.
Description
PRIORITY CLAIM
[0001] This application is a continuation of U.S. application Ser.
No. 13/163,326, filed Jun. 17, 2011, which claims priority to U.S.
Provisional Application No. 61/358,376, filed Jun. 24, 2010, which
are incorporated herein by reference in their entirety, including
drawings.
BACKGROUND
[0003] Beta cells (".beta. cells") are a type of islet cell found
in the pancreas that produce and secrete the hormone insulin.
Insulin controls levels of glucose in blood. Type 1 diabetes
mellitus (T1DM) is an autoimmune disease characterized by the
selective destruction of pancreatic .beta. cells, while type 2
diabetes mellitus (T2DM) is a metabolic disorder characterized by
insulin resistance and a loss of .beta. cell function and mass.
.beta. cell apoptosis is central to disease progression in both
T1DM and T2DM. Preventing .beta. cell apoptosis is a key factor in
the successful outcome of islet transplantation as a treatment for
T1DM. Proinflammatory cytokines, such as tumor necrosis
factor-.alpha. (TNF-.alpha.), interleukin-1.beta. (IL-10),
interferon-.gamma. (IFN-.gamma.), oxygen free radicals, and nitric
oxide are implicated in promoting .beta. cell death (1, 2).
Although the role of TNF-.alpha. as an effector remains ambiguous
(3-8), a combination of IFN-.gamma. and TNF-.alpha. synergistically
induces .beta. cell apoptosis, and is a key factor in the
development of autoimmune diabetes (9). In T2DM, TNF-.alpha. is a
key mediator in insulin resistance associated with obesity (10-12).
TNF-.alpha. not only induces insulin resistance in
insulin-sensitive tissues, such as adipose tissue and skeletal
muscle (13-15), but also decreases glucose stimulated insulin
secretion (GSIS) in .beta. cells (14). These findings suggest that
TNF-.alpha. mediates dysfunction and/or destruction of .beta. cells
in both T1DM and T2DM.
[0004] Inflammation contributes to .beta. cell destruction,
prolonged suppression of .beta. cell function, inhibition of .beta.
cell regeneration, and even peripheral insulin resistance (34).
Cytokine induced cell death has been shown to contribute to .beta.
cell apoptosis through an intrinsic pathway (21, 22). The
proinflammatory cytokine TNF-.alpha. has been shown to play an
important role in the pathogenesis of T1DM as well as T2DM. Human
islets express a high level of tumor necrosis factor receptor
superfamily (TNFRSF) 1A. Since mRNAs of ligands for TNFRSF1A are
constitutively expressed in peripheral blood leukocytes and are
induced at a high levels by stimulation (35, 36), receptors for
TNF-.alpha. on islet cells would play a significant role in
inflammation.
[0005] TNF-.alpha. can induce both apoptotic and anti-apoptotic
signals regulated by the activation of NF.kappa.B (16-18).
TNF-.alpha. mediated apoptosis through the TNF receptor associated
death domain (TRADD), where specific ligand-receptor binding leads
first to activation of Caspase-8 and then to activation of
Caspase-3 via an extrinsic pathway (19). Alternatively, apoptosis
through intracellular or intrinsic pathways is caused by DNA
damage, hypoxia, nutrient deprivation, or reactive oxygen species
(ROS) function via the mitochondrial pathway and tightly modulated
by the Bcl-2 proteins (also called mitochondrial pathway or Bcl-2
regulated pathway). These triggering factors lead to mitochondrial
membrane permeability and a subsequent release of cytochrome c from
the intermembranous space, followed by the activation of Caspase-9,
which in turn activates Caspase-3 (20). Bcl-2 homology 3 (BH3) only
protein, Bid (BH3 interacting domain death agonist), is shown to be
essential for death receptor-induced apoptosis of pancreatic .beta.
cells in mice (21). IL-1-.beta., IFN-.gamma. and/or TNF-.alpha.
induce cell death in rat islets through the intrinsic pathway by
dephosphorylation of the BH3 only protein, Bad (BCL2-associated
agonist of cell death) (22). However, interactions between
extrinsic and intrinsic pathways in cytokine induced cell death of
human pancreatic .beta. cells remains unclear.
[0006] PUMA (p53 upregulated modulator of apoptosis) is one of the
most potent killers among the BH3-only subgroup of Bcl-2 member
protein (23, 24). It is induced by p53 following DNA damage,
irradiation or chemotherapeutic drugs (25). PUMA/BBC3 (Bcl-2
binding component 3) can be directly activated through p53
responsive elements in its promoter region (26) or independently of
p53 by other transcription factors initiating apoptotic responses,
including growth factor/cytokine deprivation (27), endoplasmic
reticulum stress (28), and ischemia reperfusion (29, 30). PUMA is
also activated by the p65 component of NF-.kappa.B through a KB
site in the PUMA promoter in response to TNF-.alpha. (31). It would
be a significant improvement in the art to understand and measure
the role of PUMA in islet cell death, particularly in .beta. cell
specific death, which has heretofore been unknown. It would also be
a significant improvement to use such understanding to develop PUMA
as a biomarker and to make and use PUMA-based therapies for
controlling islet cell apoptosis.
SUMMARY
[0007] The present methods, assays, and screens measure PUMA
(p53-upregulated modulator of apoptosis) as a molecular biomarker
to assess tumor necrosis factor-.alpha. (TNF-.alpha.) induced
.beta. cell stress signaling in human islets, to indicate the
health of the islet cell expressing PUMA, and to search for and
administer drugs that reduce PUMA expression and/or effect, thus
increasing islet cell health. "Islet cell health" or "islet health"
or "health of an islet cell" or similar phrase, as used herein, is
intended to mean the present physiological condition of the cell,
including, but not limited to, the cell's current and continued
viability, wellness and/or continued normal functioning of an islet
cell. If the islet cell is a beta cell, "islet health" also
indicates the cell's ability to produce insulin normally. Decreased
metabolism, apoptosis, or other cellular decline or death is a
reduction or elimination of islet cell health.
[0008] Preferably, PUMA is measured by the amount of PUMA nucleic
acid, such as mRNA or cDNA, that is present in or around the islet
cell. PUMA amino acid may also be measured. In one embodiment, an
assay determines biosynthetic capacity of islets by measuring
glucose-induced preproinsulin precursor mRNA or mRNA synthesis from
a set of single human islets. This assay allows precursor mRNA or
mRNA expression of islets to be examined in multiple conditions
using a small number of islets, which is a major advantage for in
vitro islet testing. Such .beta. cell stress signaling in human
islets also indicates overall state of islet health and,
ultimately, the risk of onset and/or degree of severity of both
type 1 and type 2 diabetes mellitus and/or obesity and its related
conditions, such a high blood pressure and increased risk of
stroke.
[0009] The present experiments have revealed that PUMA mRNA is
induced by TNF-.alpha. stimulation in a time- and dose-dependent
manner and .beta. cell apoptosis is induced through a mitochondrial
pathway. Furthermore, TNF-.alpha. significantly inhibited
glucose-induced preproinsulin precursor mRNA synthesis, which
inversely correlates with PUMA mRNA expression measured in the
corresponding islets. P cell stress signaling in human islets can
be utilized to screen the quality of islets and screen drugs
candidates and compounds that protect islets from TNF-.alpha.
induced toxicity.
[0010] A screen for a compound that protects or improves islet cell
health is contemplated. Such a screen would require taking a
measurement of or previously knowing the level of PUMA expression
in the islet cell being tested, and then administering one or more
test compounds to the islet cell. Preferably, the islet cell or
group of cells is isolated in vitro for the screen. Then, after the
compound or combination of compounds has been given sufficient time
to affect the PUMA level in the cell, post-administration
measurement of the PUMA level is taken. If the PUMA level has
decreased, then the compound or combination of compounds protects
or improves islet health by antagonizing PUMA production in the
cell. Multiple measurements can be taken over time and one or
multiple compounds can be tested in combination and administered
simultaneously or at staggered time points. If the level of PUMA is
unchanged after administration of the test compound, the compound
likely has no effect on the level of PUMA in an islet cell. If the
PUMA level increases after administration of the test compound,
then it has a negative effect on islet health and should be
discarded as a candidate. If multiple compounds are administered,
then the test should be designed in a way to determine both
individual and combined effects of the compounds. The effect of
compounds may be assayed by testing levels of PUMA in the islet
cells with TNF-.alpha. stimulation. Islets are pre-incubated with a
compound and then stimulated with TNF-.alpha.. If the PUMA level
does not increase by TNF-.alpha. stimulation, it indicates that the
compound has a protective effect on islets from TNF-.alpha.
mediated damage. The level of PUMA may be measured by measuring
nucleic acid or amino acid or both. If nucleic acid is measured, it
may be PUMA mRNA or PUMA cDNA. The effect of compounds to protect
islets or improve islet health may be further confirmed by
detecting and/or measuring the glucose-induced preproinsulin
precursor mRNA along with PUMA mRNA in the islet cells. The
compound or compounds found to protect or improve islet health may
then be administered to patients for the treatment of diabetes.
[0011] The health of islet cells may be assayed by testing levels
of PUMA in the islet cells before and/or after induction by
TNF-.alpha. stimulation. Such testing may be used to determine the
viability and/or quality of isolated islet cells, pancreatic
tissues, or a whole pancreas to be transplanted.
[0012] In another embodiment, a patient at risk for type 1 and/or
type 2 diabetes has an islet health test. The test comprises
assaying islet cells for levels of PUMA mRNA in the islet cells
after induction by TNF-.alpha. stimulation. The assay can be
conducted in vitro using a pancreatic biopsy sample or conducted in
vivo by cell assay or other collection of biological samples. The
higher the level of PUMA mRNA in the islet cells, the greater the
risk of developing type 1 and/or type 2 diabetes.
[0013] In yet another embodiment, a patient who has been diagnosed
with type 1 and/or type 2 diabetes can have the progression of
diabetes tested by assaying a pancreatic biopsy sample for levels
of PUMA mRNA in the islet cells after induction by TNF-.alpha.
stimulation. The level of PUMA expression is tested once or,
preferably, more than once at various time points relevant to
determining the progression of diabetes. The higher the level of
PUMA mRNA, the more severe or progressed the type 1 and/or type 2
diabetes is in the patient. The effectiveness of diabetes
treatments may also be measured by taking a PUMA measurement before
beginning the diabetes treatment and then taking one or more PUMA
measurements during treatment. If the level of PUMA is decreasing,
it is an indication that the treatment is working. However, if the
level of PUMA remains the same or is increasing, it is an
indication that the treatment is ineffective.
[0014] Methods of silencing PUMA mRNA to prevent apoptosis of islet
cells are also described and include both transcriptional and
post-transcriptional gene silencing. In one instance,
transcriptional gene silencing results from histone modifications
such that the gene is not accessible to transcriptional machinery
such as RNA polymerase and transcription factors.
Post-transcriptional gene silencing may result when the PUMA mRNA
is blocked or destroyed to prevent translation. RNAi may also be
used to silence PUMA mRNA.
[0015] Anti-PUMA compounds may be administered alone or as part of
a composition comprising the compound. The compound may be nucleic
acid, amino acid, small molecule, or any other compound that
reduces PUMA expression or PUMA's negative effect on islet cell
health. The composition may target PUMA function directly by
down-regulating PUMA expression, by inhibiting binding of PUMA to
interacting proteins, including but not limited to Bcl-2 or Bcl-xL,
or by inhibiting the mitochondrial translocation of Bax. The
composition may further inhibit, alone or in combination with the
above, some other PUMA function. The composition may be delivered
in any effective manner and may be delivered and/or utilized alone
or in combination with another therapy.
[0016] Kits, including instructions, reagents, and tubes, and
plates, for carrying out the assays and methods of the present
invention are also contemplated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1. TNFRSF mRNA expression was examined in human islets
(in which cDNA was obtained from 10 islets) as well as in acinar
cells. Among two TNF-.alpha. receptors, TNFRSF1A was expressed at a
very high level, while the other receptor, TNFRSF1B was detectable
but very low in human islets. Differences in cycle threshold (Ct)
between the target and .beta. actin (ACTB) gene (.DELTA.Ct) were
used to quantify the relative amount of each target, calculated as
2.sup.-.DELTA.Ct and the expression level was shown as % ACTB.
[0018] FIGS. 2A-D demonstrate that IFN.gamma. alone does not induce
PUMA but enhances TNF-.alpha.-induced PUMA expression. FIG. 2A) 500
islet equivalents (IEQs) were cultured with or without TNF-.alpha.
(5 and 50 ng/ml) and/or IFN.gamma. (1000 U/ml) for 24 hours. Cell
lysate was used for western blot to examine the PUMA expression in
islets (*p<0.05, **p<0.005, n=3). FIG. 2B) Up regulation of
PUMA was associated with increased phosphorylation of the p-p65
component (Ser536) of NF.kappa.B. (p=NS, n=3). FIG. 2C) Islets
pre-incubated with NF.kappa.B inhibitor, BAY 11-7082, for 1 hour
prior to TNF-.alpha. (50 ng/ml) or in combination with IFN.gamma.
(1000 U/ml) stimulation were examined by western blot to determine
PUMA expression (n=3). FIG. 2D) Islets pre-incubated with
NF.kappa.B inhibitor, BAY 11-7082, for 1 hour prior to TNF-.alpha.
(50 ng/ml) stimulation were examined by western blot to determine
PUMA expression (n=3). All data are presented as a mean.+-.standard
error. The bar graph shows target protein expression normalized by
3 actin. PUMA protein was translationally up-regulated in human
islets by TNF-.alpha., but not by IFN.gamma. alone. The
up-regulation of PUMA by TNF-.alpha. was enhanced by the addition
of IFN.gamma.. Although PUMA expression in TNF-.alpha. stimulated
islets increased in response to NF.kappa.B activation, the
NF.kappa.B inhibitor BAY11-7082 did not inhibit PUMA expression
induced by the combination of TNF-.alpha. and IFN-.gamma.,
indicating that another pathway than NF.kappa.B is involved.
[0019] FIGS. 3A-D. TNF-.alpha., but not IFN.gamma., impairs glucose
induced preproinsulin precursor mRNA in human islets. FIG. 3A)
Insulin content of medium supernatant from a single human islet
culture in hextuplicate during 16 hours in low- or high-glucose
media with or without 50 ng/ml TNF-.alpha. was measured. FIG. 3B)
The glucose induced newly synthesized preproinsulin precursor mRNA
measured by pre-spliced preproinsulin mRNA normalized by pre- and
post-spliced preproinsulin mRNA (% exon) in the corresponding
islets with or without 50 ng/ml. TNF-.alpha. was also examined
(n=3, *p<0.05). FIG. 3C) Glucose induced preproinsululin
precursor mRNA synthesis with or without TNF-.alpha. (1, 5 and 50
ng/ml) and/or IFN.gamma. (10, 100 and 1000 U/ml) from a single
human islet in hextuplicate. FIG. 3D) Correlation between PUMA mRNA
and INS precursor mRNA levels in islets cultured in high-glucose
media treated with TNF-.alpha. (1, 5 and 50 ng/ml), IFN-.gamma.
(10, 100 and 1000 U/ml) or a combination of both for 16 hours. The
data points are from a total of 53 single islets (r=-0.45,
p<0.001). All data are presented as a mean.+-.standard error.
TNF-.alpha. did not change insulin release but preproinsulin
precursor mRNA synthesis was completely abolished over 16 hours in
human islets.
[0020] FIGS. 4A-C. PUMA, IL-8 and TNF-.alpha. are used as markers
to screen drug compounds protecting islets from TNF-.alpha.
stimulus. Single human islets in hextuplicate were pre-incubated
with various drugs (all used at 10 .mu.M except Etanercept
(0.1.mu./ml)) or solvent (DMSO) at 37.degree. C. for 1 hour,
followed by stimulation with or without 5 ng/ml of TNF-.alpha. for
an additional 4 hours. FIG. 4A: PUMA and ACTB mRNA were quantified
and the results are expressed as % ACTB (*p<0.05 vs. control
islets with TNF-.alpha.). FIG. 4B: IL-8 was quantified and the
results are expressed as % ACTB. FIG. 4C: Endogenous TNF-.alpha.
was quantified and the results are expressed as % ACTB. Together,
the results of FIGS. 4A-C show an example of a compound screening
system using PUMA, IL-8 and TNF mRNA. TNF-.alpha. receptor blocker,
Etanercept, successfully inhibited the up-regulation of PUMA, IL-8
and TNF mRNA induced by the assay control (TNF-.alpha. stimulus
alone). This screening system also showed that tyrosine inhibitor,
Imatininb, and a JAK inhibitor protects islets from TNF-.alpha.
induced apoptosis.
[0021] FIGS. 5A-J. In each of FIGS. 5A-5J, changes in blood glucose
levels in individual lot islets is shown. 1200 IEQ were
transplanted under the renal capsule of each NODscid mouse made
diabetic with STZ. Each line represents a mouse. It takes two to
four weeks for transplanted islets to fully function and islets
with marginal quality show the fractured blood glucose level during
this period.
[0022] FIGS. 6A-D. Cut off PUMA value and changes in blood glucose
levels following islet transplantation in diabetic NODscid mice are
shown. FIG. 6A) The cut off value of PUMA (% ACTB) for high and low
quality islets was set at 0.5 based on the ability of islets to
normalize blood glucose. Using this cut off value, all the mice
were separated into two groups: reversal or non-reversal of
diabetes. FIG. 6B) Changes of blood glucose levels after
transplantation of islets below or above the cut off point are
shown. The mice which received islets with higher PUMA expression
(% ACTB) .gtoreq.0.5 did not reverse diabetes, whereas the mice
which received islets with lower PUMA expression (% ACTB) <0.5,
reversed diabetes after transplantation. The graph indicates that
the PUMA mRNA expression levels prior to transplantation indicate
islet function after transplantation with the lower PUMA mRNA
levels correlating to lower blood glucose levels. FIGS. 6C and 6D)
250 hand-picked siRNA transfected rat islets were transplanted into
the liver via the portal vein of diabetic NODscid mice. Changes in
blood glucose levels in recipients that received rat islets
transfected with (6C) PUMA siRNA (3 mice with 3 islet lots) or (6D)
control siRNA (4 mice with 4 islet lots) one day prior to
transplantation.
[0023] FIG. 7. Comparison of islet PUMA levels between mice that
reversed or not reversed diabetes by day 30. The average PUMA
expression level of the mice with blood glucose less than 150 mg/dl
was significantly lower than that of the mice with blood glucose
level higher than 150 mg/dl 30 days after islet transplantation
(p<0.0001). The mice received different islet lots. Each lot is
shown using a different symbol (+, open squares, solid squares,
etc.). One to three mice were transplanted from each islet lot.
[0024] FIGS. 8A-L. TNF-.alpha. induces PUMA expression in human
islets and acinar cells. FIG. 8A) TNF-.alpha. induced Bcl-2 family
mRNA in islets. Single islets were stimulated with or without 50
ng/ml TNF-.alpha. for 16 hours. Each dot indicates the result of
one islet lot tested in hextuplicate. The tests were performed
using 4 different human islet lots. Bars indicate the mean of 4
lots. Each gene expression was normalized by ACTB (a gene encoding
.beta. actin), and the fold increase was calculated by dividing
TNF-.alpha. treated islets by control islets (*p<0.01, n=4).
PUMA mRNA was by far the most significantly TNF-.alpha. induced
member of the Blc-2 family members. FIGS. 8B-D) PUMA (FIG. 8B),
IL-8 (FIG. 8C) and TNF-.alpha. (FIG. 8D) expression from single
human islets (n=6) stimulated with 0 (open circles), 1 (solid
triangles), 5 (solid squares) and 50 ng/ml (solid circles)
TNF-.alpha. for 0, 1, 4, 16 hours in 3 independent cases. Dose
dependent expression of (FIG. 8E) PUMA, (FIG. 8F) IL-8 and (FIG.
8G) TNF-.alpha. in human islet at the 4 hour time point (n=3). The
PUMA expression in human islets was elevated by TNF-.alpha. as
early as one hour, increased during the next 4 hours, and
maintained at the similar level for 16 hours. Along with PUMA,
interleukin-8 (IL-8) and endogenous TNF mRNA expression also
increased by TNF-.alpha. in islet in a time and dose dependent
manner. (FIG. 8H) PUMA, (FIG. 8I) IL-8 and (FIG. 8J) TNF-.alpha.
mRNA expression in acinar cells, in triplicate, stimulated with 0
(open circles), 1 (solid triangles), 5 (solid squares) and 50
(solid circles) ng/ml TNF-.alpha. for 0, 1, 4, 16 hours.
Representative data from two independent cases is shown. (FIG. 8K)
PUMA and (FIG. 8L) IL-8 expression in human islets stimulated with
or without TNF-.alpha. (1, 5, 50 ng/ml) and/or IFN.gamma. (10, 100,
1000 U/ml) for 4 hours. When combined with TNF-.alpha., IFN.gamma.
strongly augmented TNF-.alpha. mediated PUMA expression. PUMA
expression is highest for TNF-.alpha. at 50 ng/ml+IFN.gamma. at
1000 U/ml. Results show representative data from 3 cases (with
statistical significance indicated as *p<0.05 [one asterisk] or
**p<0.001 [two asterisks] as compared to control; p<0.01 as
compared to TNF-.alpha. at 50 ng/ml; no asterisks indicates a lack
of statistical significance). All data are presented as a
mean.+-.standard error. The expression of PUMA, IL-8 and TNF also
increased in acinar cells. However, unlike in the islets, the
expression of PUMA and IL-8 reached to the peak level by 4 hours
and decreased to the basal level by 16 hours.
[0025] FIG. 9. Since isolated islets are not totally free of blood,
PUMA and IL-8 expressed in human islets by TNF-.alpha. stimulation
may derive from cells circulating in blood. However, PUMA is not
induced by TNF-.alpha. in human whole blood. TNF-.alpha. (2, 20,
200 ng/ml) was mixed with heparinized whole blood and incubated at
37.degree. C. for 4 hours. Various mRNA were quantified using the
method descried previously (44). >20 ng/ml TNF-.alpha. induced
both IL-8 and endogenous TNF mRNA but at lower levels. PUMA mRNA
was not induced by TNF-.alpha. even with the highest dose (200
ng/mL) used with islet experiments.
[0026] FIGS. 10A-R. TNF-.alpha.+IFN-.gamma. induced up-regulation
of PUMA and clustering of mitochondria in cytoplasm of human
.beta.-cells. Paraffin sections of human islets cultured with
TNF-.alpha. (50 ng/ml)+IFN.gamma. (10001 U/ml) or without (control)
for 24 hours were stained for PUMA, Cox IV and insulin (data not
shown); medium alone or with TNF-.alpha.+IFN-.gamma.. FIGS.
10A-10F. Arrows in FIGS. 10A, C, D and F indicate mitochondria
clustered in perinuclear region. In FIGS. 10G-10L, a representative
.beta.-cell treated with TNF-.alpha.+IFN-.gamma. and expressing
PUMA, which is in the area highlighted in FIG. 10D, is enlarged.
The individual staining is shown in FIG. 10K (PUMA), and FIG. 10L
(Cox IV). Merged double staining is shown in FIG. 10H (PUMA and
insulin), FIG. 10I (Cox IV and insulin), and FIG. 10J (PUMA and Cox
IV). FIG. 10G shows triple staining (PUMA, Cox IV and insulin). The
arrows in FIG. 10J indicate the co-localization of PUMA and
mitochondria. FIGS. 10M-10R: Paraffin sections of pancreas tissue
taken after cold preservation and before islet isolation not
treated with TNF-.alpha. or IFN-.gamma. were stained for PUMA
(FIGS. 10N and 10Q) and insulin (FIG. 10O) or glucagon (FIG. 10R).
Images are representative of three independent cases. Bar=20 .mu.m
(FIGS. 10A-10F) or 50 .mu.m (FIGS. 10M-10R).
[0027] FIGS. 11A-H. TNF-.alpha. induces apoptosis through
mitochondrial pathway in human islets. Silencing PUMA prevented
cell death induced by TNF-.alpha. and IFN.gamma. stimulation in
INS-1 cells. FIG. 11A) The activation of Caspase-8, Caspase-9 and
Caspase-3 was examined in islets cultured with or without
TNF-.alpha. (5 and 50 ng/ml) and/or IFN.gamma. (1000 U/ml) for 24
hours by western blot. Results show representative data from 3
cases. Paraffin sections from human islets cultured for 24 hours
with or without TNF-.alpha. (50 ng/ml) (FIG. 11B) or the
combination of TNF-.alpha. (50 ng/ml) and IFN.gamma. (1000 U/ml)
(FIG. 11C) were stained for TUNEL and insulin to identify apoptotic
.beta. cells, quantified using Laser Scanning Cytometry. The
percentage of apoptotic .beta. cells was calculated by dividing the
TUNEL-insulin double-positive cell number by the total number of
insulin-positive cells in each section (n=3, * p<0.05). .beta.
cell apoptosis was induced by TNF-.alpha. and IFN.gamma. through
activation of Caspase-9 and Caspase-3. .beta. cell apoptosis was
not detected by TUNEL staining when stimulated by TNF-.alpha.
alone. However TNF induced islet apoptosis was confirmed by the
increased expression of cleaved Caspase-9 and Caspase-3. PUMA siRNA
or Control siRNA was transfected into INS-1 cells 48 hours before
cytokine stimulation, and cultured an additional 48 hours before
flow cytometric analysis. FIG. 11D) Percentage of dead cells
assessed by % DAPI positive cells (*p<0.01, n=3). DAPI
(4',6-diamidino-2-phenylindole) is a fluorescent stain that binds
to DNA. FIG. 11E) Mitochondrial membrane permeability is assessed
by TMRE staining (**p<0.005, n=3). All data are presented as a
mean.+-.standard error. FIG. 11F) Dot plot shows the population of
DAPI positive, TMRE positive INS-1 cells transfected with siControl
or siPUMA after cytokine stimulated. Representative data from 3
independent experiments. Silencing PUMA protected .beta. cell from
death and loss of mitochondrial membrane potential in INS-1 cells
induced by TNF-.alpha. and IFN.gamma.. FIG. 11G) Western blot for
cleaved caspase-3 in PUMA siRNA or control siRNA transfected INS-1
cells treated with or without TNF-.alpha. (50 ng/ml) or the
combination of TNF-.alpha. (50 ng/ml) and IFN-.gamma. (1000 U/ml).
Data shows a representation of 4 independent experiments. FIG. 11H)
Densitmetric quantification of the bands for the experiments shown
in FIG. 11G (n=4, p<0.05).
[0028] FIGS. 12A-B. Increase in PUMA mRNA and decrease in INS
precursor mRNA expression in islets stimulated by TNF-.alpha.. The
expression of PUMA (% ACTB) and INS precursor mRNA (% exon) levels
were measured in a set of single human islets, in hextuplicate,
cultured for 16 hours in either (FIG. 12A) low-glucose media or
(FIG. 12B) high-glucose media with or without 50 ng/ml TNF-.alpha.
by RT-PCR (*p<0.05, n=3). All data are presented as a
mean.+-.SEM.
[0029] FIG. 13. Basal PUMA expression level and beta-cell
apoptosis. Beta-cell apoptosis (%) in human islet lots was examined
by TUNEL and insulin staining followed by Laser Scanning Cytometry
analysis. Beta-cell apoptosis was consistently low (1.8.+-.0.1%) in
the islet lots expressing low basal PUMA (<0.5 (% ACTB) as shown
by the solid squares, n=4; results are not available for one islet
lot, while some of the islet lots that expressed higher basal PUMA
(20.5, shown by the open squares) contained higher levels of
beta-cell apoptosis (4.2.+-.1.3%, n=5, P=0.15). Data are presented
by mean.+-.SEM.
[0030] FIGS. 14A-D. The efficiency of siRNA transfection of rat
islets. Using the transfection reagents, freshly isolated rat
islets were transfected overnight with rat PUMA siRNA or control
siRNA at a 50 nmol/l concentration in Ham's F-12 medium (Irvine
Scientific, Santa Ana, Calif.) containing 5% FBS, 15 mmol/l HEPES,
10 mmol/I nicotinamide prior to transplantation. FIG. 14A) A merged
image of a transfected islet: Transfection indicator (SIGLO.RTM.)
localized in the cells shows green fluorescence (light grey spots).
Images were taken at the multiple layers and merged (40.times.).
FIG. 14B) Expression of PUMA mRNA is compared between PUMA siRNA
transfected and Control siRNA transfected islets by RT-PCR. Data
are presented as a mean.+-.SEM (n=4). FIG. 14C) The transfection
efficiency was assessed by dispersing islets into single cells
using TRYPLE.TM. (Invitrogen, Carlsbad, Calif.), stained with DAPI
and 6-FAM.TM. and analyzed by FACS (n=3). FIG. 14D) Representative
histogram of transfection indicator positive cells.
[0031] FIGS. 15A-B. The efficiency of siRNA transfection of INS-1
cells. FIG. 15A) The transfection efficiency was assessed by
transfecting INS-1 cells with the SIGLO.RTM. transfection indicator
labeled with 6-FAM and analyzed by FACS (n=3). FIG. 15B) Expression
of PUMA mRNA is compared between PUMA siRNA transfected and Control
siRNA transfected INS-1 cells by RT-PCR (n=3). All data are
presented as a mean.+-.SEM.
[0032] FIGS. 16A-D. IL-1.beta. up-regulates PUMA mRNA in human
islets. Single islets in sextuplicate were stimulated with or
without recombinant IL-1.beta. (0.10 and 100 U/mL) for up to 16
hours. FIG. 16A) PUMA, FIG. 16B) IL-8, FIG. 16C) endogenous IL-1B
and FIG. 16D) endogenous TNF mRNA in islets were normalized by
.beta. actin (% ACTB) mRNA assessed by RT-PCR (n=1). IL-1.beta.
induced PUMA, IL-8, endogenous IL-1 and TNF in human islets.
DETAILED DESCRIPTION
[0033] PUMA levels are inversely proportional to the health of an
islet cell and pancreatic health in general. Suppressing or
silencing PUMA reduces or stops islet cell apoptosis. The
expression of PUMA in human islets is examined in response to
TNF-.alpha. stimulation. Accordingly, measuring PUMA as a biomarker
allows a determination of the state of islet health and controlling
PUMA expression allows for management of islet health and insulin
production.
[0034] In a present embodiment, using a newly developed method to
assess gene expressions using a set of single human islets, a
pro-apoptotic gene, PUMA/BBC3 (p53-upregulated modulator of
apoptosis/Bcl-2 binding component 3), is up-regulated in human
islets stimulated by recombinant TNF-.alpha. alone or in
combination with interferon (IFN)-.gamma. in time and dose
dependent manner. The up-regulation of PUMA is associated with an
activation of nuclear factor-.kappa.B (NF-.kappa.B) and induced
.beta. cell apoptosis through a mitochondrial pathway and is
enhanced by IFN-.gamma.. Up-regulation of PUMA by TNF-.alpha. is
associated with increased cleaved caspase-9 and cleaved caspase-3,
but undetectable with cleaved caspase-8, indicating that
TNF-.alpha. induced PUMA expression leads to islet cell apoptosis
through an intrinsic pathway.
[0035] PUMA up-regulation is also associated with the abrogation of
glucose-stimulated preproinsulin mRNA synthesis in the islet.
Silencing PUMA by transfecting small interfering PUMA RNA into a P
cell line reduced cell death induced by TNF-.alpha. and
IFN-.gamma.. Furthermore, PUMA expression levels in islets
negatively correlated with in vivo islet function following
transplantation into STZ-diabetic NODscid mice. Results show that
the increased PUMA expression levels negatively impact .beta. cell
function in vitro and in vivo, which can be used as an early
biomarker to detect TNF-.alpha. induced .beta. cell stress and may
contribute to the discovery and characterization of
islet-protecting compounds for the treatment of diabetes.
[0036] The present experiments further demonstrate that PUMA is a
marker for TNF-.alpha.-induced cellular damages in human islets. In
addition to the pathway involving Bid, a bcl-2 family gene
important in death receptor-induced mouse .beta. cell death,
multiple pathways may be involved in the PUMA expression mediated
by TNF-.alpha. and IFN.gamma.. The inhibition of NF.kappa.B by
islet pre-incubation with BAY 11-7082 did not inhibit PUMA
expression. Since IFN-.gamma. further augmented TNF-.alpha. induced
PUMA and PUMA expression, the IFN-.gamma. mediated cell death
pathway. As explained herein, the JAK/STAT pathway may also be
involved.
[0037] In addition to TNF-.alpha., the expression of PUMA was
examined following stimulation with IL-10. IL-10 alone stimulation
induced PUMA, IL-8, TNF and IL1B mRNA within 4 hours. However,
unlike TNF-.alpha.-induced PUMA, IL-1.beta.-induced PUMA expression
returned to the normal level by 16 hours. IL-1.beta.-induced PUMA
expression can also be explained through the NF.kappa.B pathway.
See FIGS. 16A-D.
[0038] TNF-.alpha. may decrease glucose-induced insulin secretion
in a P cell line before a measurable change in cell viability can
be detected because a decrease in cell function occurs before a
decrease in cell viability. TNF-.alpha. also abolishes glucose
stimulated preproinsulin mRNA synthesis. This inhibition was
inversely related to the up regulation of PUMA by TNF-.alpha.
and/or IFN.gamma. (FIG. 2A and FIG. 3C). Based on these
observations, PUMA can be used as a marker to assess TNF-.alpha.
induced .beta. cell stress expressed as the inhibition of
preproinsulin synthesis and apoptosis. As shown in FIG. 4,
pre-incubation of islets with Etanercept successfully inhibited
PUMA, IL-8 and TNF expression confirming that the effect of
recombinant TNF-.alpha. added to the culture media was absorbed by
Etanercept as expected.
[0039] A recent experiment reported a pilot randomized trial of
Etanercept treatment in children with new onset of T1DM resulted in
lowering HbA.sub.1C levels and increased levels of endogenous
insulin production, suggesting the preservation of .beta. cell
function. Imatinib, a tyrosine kinase inhibitor that suppresses
NF-.kappa.B activation, is shown to protect islets from combined
cytokines in vitro and prevents the spontaneous onset of diabetes
in NOD mice. JAK inhibitor also suppressed PUMA expression caused
by TNF-.alpha. stimulation. JAK inhibitor is effective for
prevention of islet cell death and development of diabetes in
animal models. These lines of evidence support the usefulness of
PUMA, IL-8, and TNF-.alpha. mRNA expression analysis along with
preproinsulin mRNA synthesis to confirm the effectiveness of drugs
for protecting human islets from apoptosis before conducting
clinical trials. These markers also can be used in the discovery of
compounds that protect islets from TNF-.alpha. damage. See FIGS.
4-7.
[0040] Compositions containing anti-PUMA molecules or PUMA
antagonists are contemplated for the reduction of PUMA and/or PUMA
expression, which in turn, increases islet cell health. Such
compositions comprising an anti-PUMA molecule as described herein
preferably contain a pharmaceutically acceptable excipient, diluent
or carrier.
[0041] A "pharmaceutically acceptable carrier" includes any
material which, when combined with an active ingredient of a
composition, allows the ingredient to retain biological activity
and without causing disruptive physiological reactions, such as an
unintended immune reaction. Pharmaceutically acceptable carriers
include water, phosphate buffered saline, emulsions such as
oil/water emulsion, and wetting agents. Compositions comprising
such carriers are formulated by well known conventional methods
such as those set forth in Remington's Pharmaceutical Sciences,
current Ed., Mack Publishing Co., Easton Pa. 18042, USA; A. Gennaro
(2000) "Remington: The Science and Practice of Pharmacy", 20th
edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage
Forms and Drug Delivery Systems (1999) H. C. Ansel et al., 7th ed.,
Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical
Excipients (2000) A. H. Kibbe et al., 3rd ed. Amer. Pharmaceutical
Assoc. Such carriers can be formulated by conventional methods and
can be administered to the subject at a suitable dose.
Administration of the suitable compositions may be effected by
different ways, e.g. by intravenous, intraperitoneal, subcutaneous,
intramuscular, topical or intradermal administration. The route of
administration, of course, depends, inter alia, on the kind of
compound contained in the pharmaceutical composition. The dosage
regimen will be determined by the attending physician and other
clinical factors. As is well known in the medical arts, dosages for
any one patient depends on many factors, including the patient's
size, body surface area, age, sex, the particular compound to be
administered, time and route of administration, the kind and stage
of condition or disease, general health and other drugs being
administered concurrently.
[0042] There may also be situations in which it is desirable to
harm or kill islet cells, such as when the cells are already
unhealthy or have over-proliferated. In such instances PUMA itself
or a PUMA agonist may be administered to the cells as an apoptotic
agent. Care must be taken to target only the islet cells that are
desired to be killed and so highly targeted approaches are
preferred for in vivo administration. Because of this fact, assays
and methods of administering PUMA to islet cells for its apoptotic
properties may be better suited to in vitro applications.
[0043] PUMA levels may be measured by any accurate means including
the means disclosed in the following experimental examples, in
vitro, or in vivo using either biological samples or non-invasive
techniques, such as functional MRI. Methods of multivariate
analysis of the data that may be used in for analysis in the
present assays and methods include but are not limited to:
multivariate analysis of variance, principal component analysis,
factor analysis, canonical correlation analysis, redundancy
analysis, correspondence analysis, multidimensional scaling,
discriminant function, linear discriminant analysis, clustering
systems, and artificial neural networks. Base levels of PUMA
expression are only a guide as individual cells and organs may
vary.
Methods
[0044] The following reagents and antibodies were used in the
present experiments: Reverse Transcriptase: Promega (San Luis
Obispo, Calif.), SYBER Green Mix: Bio-Rad (Hercules, Calif.),
Recombinant human TNF-.alpha., recombinant human IFN.gamma.,
recombinant rat TNF-.alpha., and recombinant rat IFN.gamma.:
R&D Systems (Minneapolis, Minn.), Antibodies for Phospho p65
(Ser536) and 3 actin: Cell Signaling Technology (Danvers, Mass.),
PUMA antibody: Abcam (Cambridge, Mass.), BAY11-7082: Calbiochem
(San Diego, Calif.), Guinea pig anti-human insulin primary
antibody: DAKO (Carpinteria, Calif.), Cy5-conjugated secondary
antibody: Jackson Immuno-Research (West Grove, Pa.),
4'-6-Diamidino-2-phenylindole (DAPI) and streptozotocin:
Sigma-Aldrich (St. Louis, Mo.), ON-TARGETplus.RTM. siRNA Reagents:
Dharmacon, Inc. (Lafayette, Colo.), TRI Reagent: Molecular Research
Center Inc. (Cincinnati, Ohio), tetramethylrhodamine, ethyl ester,
perchlorate (TMRE): Invitrogen (Carlsbad, Calif.), APC Annexin V:
BD Biosciences (San Jose, Calif.), Caspase-9, Cleaved caspase-8,
Cleaved caspase-3, .beta.-actin, anti-rabbit IgG HRP-linked
Antibody, LumiGLO.RTM. chemiluminescent substrate: Cell Signaling
Technology (Danvers, Mass.), western blot Cytochrome c oxidase
subunit IV: Cox IV, PUMA: Cell Signaling Technology.
[0045] Human Islet and Acinar Cell Culture:
[0046] Human islets and acinar cells isolated for research use were
obtained from the Southern California Islet Cell Resources (SC-ICR)
Center, Beckman Research Institute of the City of Hope (Duarte,
Calif.) 1 to 3 days after isolation. The donor age ranged from 18
to 67 (48.+-.14) years and included both sexes. Islet preparations
with >70% purity and >90% viability were used. The use of
human islets and acinar cells in this study was approved by the
Institutional Review Board of the City of Hope. For mRNA
experiments, islets between 150 .mu.m to 300 .mu.m in diameter
(medium size islet) were handpicked in hexuplicate by experienced
personnel under a dissection microscope without staining. Each
handpicked islet was cultured individually in a non-tissue culture
treated 96 well plate (Sarstedt, Newton, N.C.) with a CMRL
(Mediatech Inc., Holly Hill, Fla.) based serum-free medium, which
is used to culture human islets for clinical transplantation.
Islets were treated with or without recombinant human TNF-.alpha.
(0, 1, 5, 50 ng/mL) and/or recombinant human IFN.gamma. (0, 10,
100, 1000 U/mL) for up to 16 hours. For other islet experiments,
500 to 1000 islet equivalent (IEQ) were cultured (500 IEQ/mL of
medium) in a Petri dish for up to 24 hours in the same condition
described above unless otherwise specified. For acinar cell
experiments, acinar cells were kept in islet culture medium at
4.degree. C. immediately after the isolation and used within 24
hours. Aliquots of 5-10 acinar cell clusters in triplicates were
cultured with islet culture medium with or without TNF-.alpha. for
up to 16 hours. For drug compound screening experiments, islets
were pre-incubated with Etanercept, FK506, Cyclosporine (CsA),
Rapamycin, Imatinib mesylate, Janus Kinase (JAK) inhibitor or p38
inhibitor, SB203580, for 1 hour, and then 5 ng/mL TNF-.alpha. was
added to the islet culture for 4 hours. All the compounds except
Etanercept (0.1 .mu.g/mL) were dissolved in dimethyl sulfoxide
(DMSO) and used at a concentration of 10 .mu.M (all compounds are
gifts from Hitachi Chemical Research Center).
[0047] Quantification of mRNA from a Single Islet:
[0048] RNA purification and PCR was performed as described
previously (32). Briefly, following culture, islets were
transferred to a 96-well filter plate (Hitachi Chemical Research
Center-HCR, Irvine, Calif.)(44) and 50 .mu.L of Lysis Buffer (HCR)
containing a cocktail of specific reverse primers was applied to
each well. Poly(A)+mRNA isolation was performed using the
Hem(A)+.TM. System (Hitachi Chemical Research Center, Irvine,
Calif.). The resultant cell lysates were transferred to
oligo(dT)-immobilized microplates (GenePlate, HCR) for
poly(A).sup.+ mRNA purification (45). The cDNA was directly
synthesized with 30 .mu.L of solution in each well: specific
primer-primed cDNA in the liquid phase and oligo(dT)-primed cDNA in
the solid phase (44). The cDNA in the solution was diluted by
adding 30 .mu.L nuclease-free water, with 4 .mu.L of the diluted
cDNA used for SYBR Green PCR (BioRad, Hercules, Calif.) (46). Each
gene was amplified individually. The cycle threshold (Ct) was
determined using analytical software (SDS, Applied Biosystems,
Foster City, Calif.). Differences in Ct between the target and
control mRNA (.DELTA.Ct) are used to quantify the relative amount
of each target, calculated as 2.sup.-.DELTA.Ct. Primers used for
the gene expression assays are described previously (32, 36, 47,
48).
[0049] Measurement of Preproinsulin mRNA (or Precursor mRNA)
Synthesis and Total Insulin Release:
[0050] Hand picked human islets were cultured with 100 uL of RPMI
1640 medium containing 5% fetal bovine serum and either low-glucose
(3.3 mmol/L) or high-glucose (17 mmol/L) for 16 hours.
Preproinsulin mRNA synthesis was measured from the islets by the
methods described above. Pre-spliced preproinsulin mRNA
(preproinsulin precursor mRNA) was normalized by pre- and
post-spliced preproinsulin mRNA as described previously (32).
Specifically, primer pairs used to perform qRT-PCR of pre-spliced
preproinsulin mRNA are as follows: AGGTGGGCTCAGGATTCCA (SEQ ID NO.
1) (In1 upstream) and TCACCCCCACATGCTTCAC (SEQ ID NO. 2) (In1
downstream); ACTCGCCCCTCAAACAAATG (SEQ ID NO. 3) (In2 upstream) and
TGAATCTGCGGTCATCAAATG (SEQ ID NO. 4) (In2 downstream);
CTCTGCCTCGCCGCTGTTC (SEQ ID NO. 5) (In2Ex3 upstream) and
TCCACAATGCCACGCTTCTG (SEQ ID NO. 6) (In2Ex3 downstream);
GCAGCCTTTGTGAACCAACA (SEQ ID NO. 7) (Ex2a upstream) and
TTCCCCGCACACTAGGTAGAGA (SEQ ID NO. 8) (Ex2a downstream);
GGGAACGAGGCTTCTTCTACAC (SEQ ID NO. 9) (Ex2b upstream) and
CCACAATGCCACGCTTCTG (SEQ ID NO. 10) (Ex2b downstream); and
CATTGTGGAACAATGCTGTACCA (SEQ ID NO. 11) (Ex3 upstream) and
GCCTGCGGGCTGCGTCTA (SEQ ID NO. 12) (Ex3 downstream). The culture
supernatant was collected from each well after 16 hour-culture to
measure insulin contents using an Enzyme-Linked ImmunoSorbent Assay
(ELISA) kit for human insulin (Mercodia Inc., Winston Salem, N.C.)
following the manufacturer's protocol.
[0051] Western Blot:
[0052] Five hundred IEQ samples were harvested before and 24 hours
after culture with or without TNF-.alpha. and/or IFN.gamma., washed
twice with ice cold phosphate buffered saline (PBS), and stored at
-80.degree. C. until use. In some experiments, islets were
pre-incubated with 10 .mu.M NF.kappa.B inhibitor; BAY11-7082 for 1
hour before cytokine stimulation. Islet cell lysis and western blot
was performed as previously described (49).
[0053] .beta. Cell Apoptosis Analyzed by Laser Scanning Cytometry
(LSC):
[0054] Islet paraffin sections were stained for terminal uridine
deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) using
the Apop Tag plus Fluorescein In Situ Apoptosis Detection Kit
(Chemicon, Temecula, Calif.) followed by immunostaining for insulin
using a guinea pig anti-human insulin primary antibody and a
Cy5-conjugated secondary antibody. All sections were counterstained
for DNA with DAPI. To evaluate .beta. cell apoptosis, slides were
scanned using the iCys laser scanning cytometer and the iCys 3.2.5
software (Compucyte, Cambridge, Mass.) as previously described
(50). Cells co-staining for insulin and TUNEL were designated as
apoptotic .beta. cells and their percentage was obtained from the
histogram. The percentage of apoptotic .beta. cells was calculated
by dividing the insulin/TUNEL double-positive cell number by the
total number of insulin-positive cells.
[0055] siRNA Transfection and Flow Cytometry Analysis:
[0056] PUMA siRNA containing 4 individual siRNA targeting PUMA and
negative control siRNA were transfected into INS-1 cells at a 20 nM
concentration. Transfection was performed using ON-TARGETplus.RTM.
siRNA reagents according to the manufacturer's instructions. INS-1
cells were cultured in RPMI 1640 medium containing 5% fetal bovine
serum and 15 mM HEPES. Recombinant rat TNF-.alpha. (50 ng/ml)
and/or recombinant rat IFN.gamma. (1000 U/ml) were added in the
culture media 24 hours after the transfection and cultured for
additional up to 48 hours. Cultured cells were harvested using
TRYPLE.TM. (Invitrogen, Carlsbad, Calif.) for flow cytometric (FCM)
analysis performed on a CYAN.TM. ADP Analyzer (Beckman Coulter,
Fullerton, Calif.). The transfection rate as confirmed by a
transfection indicator labeled with 6-FAM.TM. was more than 75%. To
assess mitochondrial membrane permeability, cell were incubated
with 100 nM TMRE in culture media for 30 minutes and then washed
with PBS twice before the analysis. Cell death was analyzed by
staining with 1 .mu.g/ml of DAPI.
[0057] Assessment of In Vivo Islet Function in Diabetic NODscid
Mice:
[0058] Male NODscid mice, ages 10-12 weeks, were obtained from the
Animal Resources Center of Beckman Research Institute of the City
of Hope and used as human islet recipients. Mice were rendered
diabetic by intraperitoneal injection of 50 mg/kg streptozotocin
(STZ) on three consecutive days. Those that exhibited hyperglycemia
(>350 mg/dL) for two consecutive days were used as recipients.
1200 IEQ islets were transplanted under the left kidney capsule of
diabetic mice. Blood glucose levels were measured 2-3 times weekly.
Recipient mice that maintained a blood glucose <200 mg/dL were
considered to have reversed diabetes. At the end of each
experiment, a left nephrectomy was performed to confirm graft
dependence. In separate experiments, islets were isolated from male
Lewis rats weighing 250-350 g (Charles River Laboratories) using
our standard procedure (39) and 250 hand-picked islets transfected
with either PUMA siRNA or Control siRNA were transplanted into the
liver of diabetic NODscid mice via the portal vein. All the animal
procedures followed protocols approved by the Institutional Animal
Care and Use Committee of the City of Hope/Beckman Research
Institute.
[0059] Statistical Analysis:
[0060] Data are presented as a mean.+-.standard error. Paired
two-tailed Student's t-test was used to compare the difference
between the two groups. The Correlation and Analysis of variance
procedures were applied to assess the strength of linear dependence
between two variables (correlation coefficient: r). P value of less
than 0.05 was considered significant.
Results
[0061] Human islets express PUMA mRNA by TNF-.alpha. stimulation:
The expression of TNFRSF in human islets was previously. TNFRSF
gene expression was examined in isolated human islet and acinar
cells. Both islet and acinar cells have a similar pattern of TNFRSF
expression (FIG. 1). One of the abundant receptors in human islets
was TNFSF1A, the receptor for TNF-.alpha., while TNFSF1B, another
receptor for TNF-.alpha., was detectable but at a low level (FIG.
1).
[0062] In order to examine whether TNF-.alpha. stimulation of human
islets interacts with the intrinsic pathway and induces cell death,
islets were stimulated with recombinant human TNF-.alpha. protein
(50 ng/mL) for 16 hours and apoptosis-related Bcl-2 family genes
were examined. As shown in FIG. 8A, TNF-.alpha. induced higher
levels of PUMA as compared to non-stimulated controls (1.9-4.7
fold), whereas the increases in other Bcl-2 family mRNAs were all
less than 2 fold (n=4). Three of the 4 TNF-.alpha. stimulated islet
samples also showed elevated induction of BID, but at levels far
less than those of PUMA.
[0063] PUMA expression was elevated as early as one hour after the
exposure to TNF-.alpha., increasing during the next 4 hours, and
maintained at a similar level for 16 hours (FIG. 8B). The
expression of PUMA was TNF-.alpha. dose dependent (FIG. 8E). Along
with PUMA, interleukin-8 (IL-8) mRNA expression also increased in
TNF-.alpha. stimulated islets in a time and dose dependent manner
(FIG. 8C, 8F). Additionally, stimulation of human islets with
recombinant TNF-.alpha. was found to induce TNF mRNA expression in
the islet cells (FIGS. 8D and 8G), indicating the existence of a
possible positive feedback mechanism.
[0064] To examine whether the PUMA up regulation in response to
TNF-.alpha. was islet specific, acinar cells isolated from human
pancreata were also stimulated with TNF-.alpha.. The expression of
PUMA, IL-8 and TNF was increased in acinar cells, however, the
expression reached peak levels by 4 hours and decreased to basal
levels by 16 hours (FIGS. 8H, 8I, and 8J).
[0065] Pancreatic tissues, including islets and acinar cells, are
known to contain passenger leukocytes, which may be the source of
the PUMA, IL-8 and TNF expression detected above. To show that this
expression was not due to passenger leukocytes,
TNF-.alpha.-mediated PUMA expression was examined in blood
leukocytes. TNF-.alpha. alone, even with higher doses than that
used in islets (200 ng/mL), did not induce PUMA in leukocytes. In
contrast, leukocytes did express a high level of IL-8 following
TNF-.alpha. stimulation. These results show that passenger
leukocytes in islets did not contribute to the TNF-.alpha.-mediated
PUMA expression by islets (FIG. 9).
[0066] PUMA is known to be up regulated by p53, either dependent or
independent manner. To test the involvement of p53 in the PUMA
expression by pancreatic cells, the expression of p21/CDKN1A
(cyclin-dependent kinase inhibitor 1A), the major transcriptional
target of the p53 tumor suppressor protein, was examined in both
islets and acinar cells. Up regulation of CDKN1A was not detected
in either islets or acinar cells, which indicates that the PUMA
induction in islets and acinar cells by TNF-.alpha. stimulation was
possibly p53 independent, or at least independent of p21.
[0067] PUMA expression by human islets stimulated by recombinant
human IFN-.gamma. alone or in combination with TNF-.alpha. was
compared. As shown in FIG. 8K, IFN-.gamma. alone did not induce
PUMA, whereas the combination of TNF-.alpha. and IFN-.gamma.
strongly augmented PUMA expression in the islets. Similarly,
IFN-.gamma. alone did not induce IL-8 expression which was
increased by combining with TNF-.alpha. (FIG. 8L).
[0068] PUMA is Translationally Up Regulated in Human Islets Through
NF.kappa.B Activation:
[0069] Translation of PUMA induced by TNF-.alpha. alone or in
combination with IFN-.gamma. into PUMA protein was examined. Islets
were stimulated in culture for 16 hours with TNF-.alpha. alone or
together with IFN-.gamma., lysed and analyzed by western blot. The
expression of PUMA was significantly increased by TNF-.alpha. alone
at a concentration of 50 ng/mL (p<0.05) and the combination of
TNF-.alpha. and IFN-.gamma. (p<0.005), but not by IFN-.gamma.
(1000 U/mL) alone (FIG. 2A). This observation is consistent with
mRNA expression results.
[0070] The p65 component of NF.kappa. directly binds to the KB site
of the PUMA promoter region driving transcriptional activation in
response to TNF-.alpha. stimulation. The up regulation of PUMA in
human islets is regulated by NF.kappa.B activation. Increased
phosphorylation of p65 protein was detected in the islets
stimulated by TNF-.alpha. but not IFN-.gamma.. The expression of
p65 is further increased by stimulation with both TNF-.alpha. and
IFN-.gamma. (FIG. 2B). Although PUMA expression in TNF-.alpha.
stimulated islets increased in response to NF.kappa.B activation,
the NF.kappa.B inhibitor BAY11-7082 did not inhibit PUMA expression
induced by the combination of TNF-.alpha. and IFN.gamma. (FIG.
2C).
[0071] Treatment of human islets with TNF-.alpha. and IFN-.gamma.
together induced mitochondrial clustering and increased PUMA
protein in beta-cell cytoplasm: Confocal microscopy was used to
examine PUMA expression in human islets treated with
TNF-.alpha.+IFN-.gamma. for 24 hours. Paraffin sections of the
islets were stained for PUMA, Cox IV (marker for mitochondria) and
insulin. PUMA expression was up-regulated in
TNF-.alpha.+IFN-.gamma. treated islets (FIGS. 10B and 10E). The
treatment also increased mitochondrial condensation and perinuclear
clustering as shown by Cox IV staining (arrows in control (FIGS.
10A and 10C) as compared to TNF-.alpha.+IFN-.gamma. treated cells
(FIGS. 10D and 10F)). Higher PUMA expression in the cytoplasm was
associated with morphological changes and cellular redistribution
of mitochondria. The co-localization of PUMA and Cox IV were found
in cells marked by arrows in FIGS. 10A and 10D. The merged image of
PUMA and Cox IV showed co-localization of some PUMA with
mitochondria around the nucleus as shown in the representative cell
(arrowheads in FIG. 10J). However, the majority of cytoplasmic PUMA
was independent of Cox IV. FIGS. 10H and 101 confirmed that insulin
staining was independent from both PUMA and Cox IV staining,
respectively. To examine the PUMA protein expression in minimally
manipulated pancreatic cells, paraffin sections of pancreas tissue
taken from cold preserved pancreases before islet isolation, and
were stained for PUMA and insulin (FIG. 10M-O) or PUMA and glucagon
(FIG. 10P-R). PUMA co-localized with beta-cells but not with
alpha-cells stained for glucagon. Acinar cells surrounding islets
were also negative for PUMA.
[0072] PUMA Induces Islet Cell Death Through Mitochondrial
Pathway:
[0073] To examine whether islet apoptosis induced by such
treatments is regulated by the extrinsic or intrinsic pathway,
Caspase-8, Caspase-9 and Caspase-3 activation was determined in
treated islets by western blot analysis. Caspase-9 and Caspase-3
were induced in islets treated with TNF-.alpha. alone and further
increased by co-treatment with IFN-.gamma. (FIG. 11A). In contrast,
Caspase-8 was not activated in any islets, with or without
TNF-.alpha. treatment. These results indicate that TNF-.alpha.
induced islet cell death is primarily through the intrinsic
pathway.
[0074] .beta. cell apoptosis mediated by TNF-.alpha. or combined
with IFN-.gamma. was verified as follows: immunohistochemically
stained human islets were prepared following 24-hour culture with
TNF-.alpha. alone, or in combination with IFN-.gamma. and analyzed
by Laser Scanning Cytometry (LSC). Apoptotic .beta. cells were
detected by co-staining with terminal uridine deoxynucleotidyl
transferase dUTP nick end labeling (TUNEL) and insulin. The
percentage of apoptotic .beta. cells was calculated as described in
Methods. TNF-.alpha. treatment alone did not induce .beta. cell
apoptosis (FIG. 11B), whereas the combination of TNF-.alpha. (50
ng/mL) and IFN-.gamma. (1000 U/mL) induced significant apoptosis of
.beta. cells (FIG. 11C).
[0075] To further confirm that PUMA plays a role in TNF-.alpha.
induced .beta. cell death, PUMA siRNA was used to silence PUMA.
PUMA siRNA transfection (transfection rate >80%) suppressed PUMA
mRNA expression to 22.2.+-.8.6% of the control. PUMA siRNA was
transfected into the rat insulinoma cell line, INS-1, to avoid
potential problems associated with transfection of human islets due
to the multi-cellular structure. Silencing PUMA significantly
reduced INS-1 cell death caused by TNF-.alpha. and IFN-.gamma.
during the 48-hour culture assessed by flow cytometric (FCM)
analysis (57.7.+-.3.6% in siControl group vs. 27.1.+-.4.9% in
siPUMA group, p<0.01) (FIG. 11D). Furthermore, INS-1 cells
treated with TNF-.alpha. and INF-.gamma. contained higher levels of
TMRE positive cells when transfected with siPUMA (37.5.+-.0.8 in
siControl group vs. 65.7.+-.3.4 in siPUMA group, n=3, p<0.005)
(FIG. 11E and FIG. 11F). The presence of a higher number of
tetramethylrhodamine, ethyl ester, perchlorate (TMRE) positive
cells in the siPUMA group indicates that siPUMA protects the
mitochondrial membrane potential and that PUMA causes cell death
through mitochondrial damage. Furthermore, PUMA is required for
Caspase-3 activation in response to TNF-.alpha.+IFN-.gamma.
treatment in INS-1 cells (FIGS. 11G and 11H).
[0076] TNF-.alpha. Inhibits Preproinsulin Precursor mRNA Synthesis
in Human Islets:
[0077] The effect of TNF-.alpha. and/or IFN-.gamma. on .beta. cell
function was examined by analyzing the ability of human islets to
synthesize and release insulin. The addition of 50 ng/mL
TNF-.alpha. to either low or high glucose medium did not change
insulin release levels during the 16-hour culture period (FIG. 3A).
However, glucose-induced, newly synthesized preproinsulin precursor
mRNA measured by pre-spliced preproinsulin normalized by pre- and
post-spliced preproinsulin was totally abolished by adding
TNF-.alpha. during incubation (FIG. 3B). The dose dependent effect
of TNF-.alpha. and/or IFN-.gamma. on preproinsulin precursor mRNA
synthesis was also examined. TNF-.alpha. as low as 5 ng/mL
abrogated the preproinsulin precursor mRNA synthesis response to
high glucose culture observed in normal human islets. However,
IFN.gamma. alone did not impair glucose induced preproinsulin
precursor mRNA synthesis (FIG. 3C). FIG. 12 shows the up-regulation
of PUMA mRNA and down-regulation of INS pre-mRNA in human islets by
TNF-.alpha. (50 ng/ml). PUMA mRNA levels inversely correlated with
preproinsulin precursor mRNA levels in islets cultured in
high-glucose medium with different dose of TNF-.alpha. or
TNF-.alpha.+IFN-.gamma. treatment (FIG. 3D).
[0078] PUMA Expression Level in the Islet Reflects the In Vivo
Function to Reverse Hyperglycemia:
[0079] To examine whether the PUMA expression in isolated human
islets correlates with islet function in vivo, human islets were
transplanted into STZ induced diabetic NODscid mice using the
standard procedure for in vivo islet quality assessment. Blood
glucose levels were measured 30 days after transplantation of 1200
IEQ into the space beneath the renal capsule of diabetic NODscid
mice. The level of PUMA mRNA in human islets shortly after
isolation was variable between islet lots (FIG. 6A). These
variations may be due to exposure to cytokines, including
TNF-.alpha., released during cold ischemia and re-warming of the
pancreas, islet isolation, and culture [50, 54]. Islet lots that
had lower levels of PUMA expression reversed diabetes, while those
that had higher PUMA expression failed to reverse diabetes. PUMA
expression positively correlated significantly with blood glucose
levels 30 days after transplantation (r=0.64, p<0.001) (FIG.
6A). Islet lots that reversed diabetes had a significantly lower
PUMA expression (FIG. 13) and achieved euglycemia by day 30, while
those that exhibited higher PUMA mRNA tended to contain more
apoptotic beta cells and failed to reverse hyperglycemia. Blood
glucose levels of mice transplanted with islets expressing lower
PUMA mRNA were consistently lower than those receiving islets with
higher PUMA mRNA (FIG. 6B). We further tested the role of PUMA on
in vivo islet function by transplanting a marginal number of rat
islets in which PUMA was suppressed by PUMA siRNA transfection into
the liver of diabetic NODscid mice. Although the transfection rate
was low (25.3.+-.0.9%) (FIG. 14), PUMA siRNA transfection reduced
early islet loss as indicated by blood glucose levels of 153.+-.25
mg/dl in siPUMA group vs. 446.+-.63 mg/dl in siControl group on day
3 (p<0.05). Furthermore, diabetes was reversed in all mice
receiving PUMA siRNA-transfected islets, while mice receiving
control islets remained diabetic (FIG. 6C and FIG. 6D). These in
vivo results indicate that PUMA expression in isolated human islets
correlates with islet function following transplantation into
diabetic recipients and may be used as an indicator of islet
quality.
[0080] PUMA mRNA can be used as a molecular biomarker for screening
compounds that protect islet from TNF-.alpha. induced damage. PUMA
mRNA was induced in human islets within 4 hours following
TNF-.alpha. stimulation in a dose dependent manner. IL-8 and TNF
expression accompany the up regulation of PUMA by TNF-.alpha..
Therefore, PUMA mRNA, along with IL-8 and TNF, may be used a marker
to screen the effect of compounds on islets. To test such
possibilities, randomly selected compounds were screened using our
single islet assay system to test either increase or decrease of
PUMA expression induced by 5 ng/mL TNF-.alpha.. Pre-incubation with
Etanercept, a recombinant protein of human soluble TNFR2 coupled to
Fc portion of human IgG that binds to TNF-.alpha. and inhibits its
attachment to endogenous TNF cell surface receptors, prevented
TNF-.alpha. induced up regulation of PUMA (FIG. 4A), IL-8 (FIG. 4B)
and TNF (FIG. 4C) expression. The result indicates complete
neutralization of the added and secreted TNF-.alpha. in our in
vitro assay system. Pre-incubation of islets with a tyrosine kinase
inhibitor, Imatinib, and Janus Kinase (JAK) inhibitor prior to
TNF-.alpha. stimulation also reduced the up regulation of PUMA,
IL-8 and TNF expression as compared to the control (vehicle alone),
whereas the immunosuppressive drugs (Cyclosporine, FK506, and
Rapamicin) showed no suppression. Accordingly, an additional
embodiment provides a method protecting an islet cell from
apoptosis comprising administering a JAK inhibitor (such as
Imatinib), and optionally, a tyrosine kinase inhibitor to the islet
cell.
[0081] Measuring mRNA expression of tumor necrosis factor receptor
super family (TNFRSF) 1A and 1B on human islets and acinar cell
clusters revealed that human islet expresses abundant TNFRSF1A
(TNFR1). RT-PCR was performed in triplicate samples of either 10
islets or 10 acinar cell clusters prepared from two different
pancreases and the results are shown in FIG. 1. Transfection
efficiency of siRNA transfecting INS-1 cells is shown in FIG. 15A.
Expression of PUMA mRNA is compared between PUMA siRNA transfected
and Control siRNA transfected INS-1 cells by RT-PCR (n=3) in FIG.
15B.
[0082] In summary, the present discovery demonstrates for the first
time TNF-.alpha. induced PUMA expression in human islets via the
activation of NF.kappa.B, which leads .beta. cells to apoptosis
through an intrinsic pathway. PUMA mRNA expression mediated by
TNF-stimulation can be used as a biomarker to evaluate various
compounds/drugs to assess their effect on .beta. cell function and
survival. Tyrosine kinase inhibitor or JAK inhibitors may be used
alone or in conjunction with other anti-PUMA technology, such as
PUMA siRNA to protect islets. Furthermore the assay system using
single human islet would facilitate the development of a
high-throughput system for the discovery of new drugs that protect
islet cell death, leading to discovery of new drugs for prevention
and treatment of T1DM as well as T2DM. The significance of PUMA as
a biomarker and manipulation of PUMA levels as an indicator islet
health and a therapy is described.
[0083] Certain embodiments of the invention are described in
detail, using specific examples, sequences, and drawings. The
enumerated embodiments are not intended to limit the invention to
those embodiments, as the invention is intended to cover all
alternatives, modifications, and equivalents, which may be included
within the scope of the present invention as defined by the claims.
One skilled in the art will recognize many methods and materials
similar or equivalent to those described herein, which could be
used in the practice of the present invention. Unless defined
otherwise, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the
art to which this invention belongs. All publications and/or
patents are incorporated by reference as though fully set forth
herein.
REFERENCES
[0084] 1. Eizirik, D. L., and Mandrup-Poulsen, T. 2001. A choice of
death--the signal-transduction of immune-mediated beta-cell
apoptosis. Diabetologia 44:2115-2133. [0085] 2. Stephens, L. A.,
Thomas, H. E., Ming, L., Grell, M., Darwiche, R., Volodin, L., and
Kay, T. W. 1999. Tumor necrosis factor-alpha-activated cell death
pathways in NIT-1 insulinoma cells and primary pancreatic beta
cells. Endocrinology 140:3219-3227. [0086] 3. Jacob, C. O., Aiso,
S., Michie, S. A., McDevitt, H. O., and Acha-Orbea, H. 1990.
Prevention of diabetes in nonobese diabetic mice by tumor necrosis
factor (TNF): similarities between TNF-alpha and interleukin 1.
Proc Natl Acad Sci USA 87:968-972. [0087] 4. Satoh, J., Seino, H.,
Abo, T., Tanaka, S., Shintani, S., Ohta, S., Tamura, K., Sawai, T.,
Nobunaga, T., Oteki, T., et al. 1989. Recombinant human tumor
necrosis factor alpha suppresses autoimmune diabetes in nonobese
diabetic mice. J Clin Invest 84:1345-1348. [0088] 5. Yang, X. D.,
Tisch, R., Singer, S. M., Cao, Z. A., Liblau, R. S., Schreiber, R.
D., and McDevitt, H. O. 1994. Effect of tumor necrosis factor alpha
on insulin-dependent diabetes mellitus in NOD mice. I. The early
development of autoimmunity and the diabetogenic process. J Exp Med
180:995-1004. [0089] 6. Held, W., MacDonald, H. R., Weissman, I.
L., Hess, M. W., and Mueller, C. 1990. Genes encoding tumor
necrosis factor alpha and granzyme A are expressed during
development of autoimmune diabetes. Proc Natl Acad Sci USA
87:2239-2243. [0090] 7. Mueller, C., Held, W., Imboden, M. A., and
Carnaud, C. 1995. Accelerated beta-cell destruction in adoptively
transferred autoimmune diabetes correlates with an increased
expression of the genes coding for TNF-alpha and granzyme A in the
intra-islet infiltrates. Diabetes 44:112-117. [0091] 8. Picarella,
D. E., Kratz, A., Li, C. B., Ruddle, N. H., and Flavell, R. A.
1993. Transgenic tumor necrosis factor (TNF)-alpha production in
pancreatic islets leads to insulitis, not diabetes. Distinct
patterns of inflammation in TNF-alpha and TNF-beta transgenic mice.
J Immunol 150:4136-4150. [0092] 9. Suk, K., Kim, S., Kim, Y. H.,
Kim, K. A., Chang, I., Yagita, H., Shong, M., and Lee, M. S. 2001.
IFN-gamma/TNF-alpha synergism as the final effector in autoimmune
diabetes: a key role for STAT1/IFN regulatory factor-1 pathway in
pancreatic beta cell death. J Immunol 166:4481-4489. [0093] 10.
Hotamisligil, G. S., Murray, D. L., Choy, L. N., and Spiegelman, B.
M. 1994. Tumor necrosis factor alpha inhibits signaling from the
insulin receptor. Proc Natl Acad Sci USA 91:4854-4858. [0094] 11.
Uysal, K. T., Wiesbrock, S. M., Marino, M. W., and Hotamisligil, G.
S. 1997. Protection from obesity-induced insulin resistance in mice
lacking TNF-alpha function. Nature 389:610-614. [0095] 12.
Steinberg, G. R., Michell, B. J., van Denderen, B. J., Watt, M. J.,
Carey, A. L., Fam, B. C., Andrikopoulos, S., Proietto, J., Gorgun,
C. Z., Carling, D., et al. 2006. Tumor necrosis factor
alpha-induced skeletal muscle insulin resistance involves
suppression of AMP-kinase signaling. Cell Metab 4:465-474. [0096]
13. Tesz, G. J., Guilherme, A., Guntur, K. V., Hubbard, A. C.,
Tang, X., Chawla, A., and Czech, M. P. 2007. Tumor necrosis factor
alpha (TNFalpha) stimulates Map4k4 expression through TNFalpha
receptor 1 signaling to c-Jun and activating transcription factor
2. J Biol Chem 282:19302-19312. [0097] 14. Bouzakri, K., and
Zierath, J. R. 2007. MAP4K4 gene silencing in human skeletal muscle
prevents tumor necrosis factor-alpha-induced insulin resistance. J
Biol Chem 282:7783-7789. [0098] 15. Plomgaard, P., Bouzakri, K.,
Krogh-Madsen, R., Mittendorfer, B., Zierath, J. R., and Pedersen,
B. K. 2005. Tumor necrosis factor-alpha induces skeletal muscle
insulin resistance in healthy human subjects via inhibition of Akt
substrate 160 phosphorylation. Diabetes 54:2939-2945. [0099] 16.
Karin, M., and Lin, A. 2002. NF-kappaB at the crossroads of life
and death. Nat Immunol 3:221-227. [0100] 17. Aggarwal, B. B. 2003.
Signalling pathways of the TNF superfamily: a double-edged sword.
Nat Rev Immunol 3:745-756. [0101] 18. Wajant, H., Pfizenmaier, K.,
and Scheurich, P. 2003. Tumor necrosis factor signaling. Cell Death
Differ 10:45-65. [0102] 19. Hengartner, M. O. 2000. The
biochemistry of apoptosis. Nature 407:770-776. [0103] 20. Danial,
N. N., and Korsmeyer, S. J. 2004. Cell death: critical control
points. Cell 116:205-219. [0104] 21. McKenzie, M. D., Carrington,
E. M., Kaufmann, T., Strasser, A., Huang, D. C., Kay, T. W.,
Allison, J., and Thomas, H. E. 2008. Proapoptotic BH3-only protein
Bid is essential for death receptor-induced apoptosis of pancreatic
beta-cells. Diabetes 57:1284-1292. [0105] 22. Grunnet, L. G.,
Aikin, R., Tonnesen, M. F., Paraskevas, S., Blaabjerg, L.,
Storling, J., Rosenberg, L., Billestrup, N., Maysinger, D., and
Mandrup-Poulsen, T. 2009. Proinflammatory cytokines activate the
intrinsic apoptotic pathway in beta-cells. Diabetes 58:1807-1815.
[0106] 23. Sun, Q., Ming, L., Thomas, S. M., Wang, Y., Chen, Z. G.,
Ferris, R. L., Grandis, J. R., Zhang, L., and Yu, J. 2009. PUMA
mediates EGFR tyrosine kinase inhibitor-induced apoptosis in head
and neck cancer cells. Oncogene 28:2348-2357. [0107] 24. Vousden,
K. H. 2005. Apoptosis. p53 and PUMA: a deadly duo. Science
309:1685-1686. [0108] 25. Nakano, K., and Vousden, K. H. 2001.
PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell
7:683-694. [0109] 26. Yu, J., Wang, Z., Kinzler, K. W., Vogelstein,
B., and Zhang, L. 2003. PUMA mediates the apoptotic response to p53
in colorectal cancer cells. Proc Natl Acad Sci USA 100:1931-1936.
[0110] 27. You, H., Pellegrini, M., Tsuchihara, K., Yamamoto, K.,
Hacker, G., Erlacher, M., Villunger, A., and Mak, T. W. 2006.
FOXO3a-dependent regulation of PUMA in response to cytokine/growth
factor withdrawal. J Exp Med 203:1657-1663. [0111] 28. Reimertz,
C., Kogel, D., Rami, A., Chittenden, T., and Prehn, J. H. 2003.
Gene expression during ER stress-induced apoptosis in neurons:
induction of the BH3-only protein Bbc3/PUMA and activation of the
mitochondrial apoptosis pathway. J Cell Biol 162:587-597. [0112]
29. Wu, B., Qiu, W., Wang, P., Yu, H., Cheng, T., Zambetti, G. P.,
Zhang, L., and Yu, J. 2007. p53 independent induction of PUMA
mediates intestinal apoptosis in response to ischaemia-reperfusion.
Gut 56:645-654. [0113] 30. Toth, A., Jeffers, J. R., Nickson, P.,
Min, J. Y., Morgan, J. P., Zambetti, G. P., and Erhardt, P. 2006.
Targeted deletion of PUMA attenuates cardiomyocyte death and
improves cardiac function during ischemia-reperfusion. Am J Physiol
Heart Circ Physiol 291: H52-60. [0114] 31. Wang, P., Qiu, W.,
Dudgeon, C., Liu, H., Huang, C., Zambetti, G. P., Yu, J., and
Zhang, L. 2009. PUMA is directly activated by NF-kappaB and
contributes to TNF-alpha-induced apoptosis. Cell Death Differ
16:1192-1202. [0115] 32. Omori K, M. M., Todorov I, Rawson J,
Shiang K. D, Kandeel F, Mullen Y. 2010. Microassay for
glucose-induced preproinsulin mRNA expression to assess islet
functional potency for islet transplantation. Transplantation.
[0116] 33. Ortis, F., Pirot, P., Naamane, N., Kreins, A. Y.,
Rasschaert, J., Moore, F., Theatre, E., Verhaeghe, C., Magnusson,
N. E., Chariot, A., et al. 2008. Induction of nuclear factor-kappaB
and its downstream genes by TNF-alpha and IL-1 beta has a
pro-apoptotic role in pancreatic beta cells. Diabetologia
51:1213-1225. [0117] 34. Eizirik, D. L., Colli, M. L., and Ortis,
F. 2009. The role of inflammation in insulitis and beta-cell loss
in type 1 diabetes. Nat Rev Endocrinol 5:219-226. [0118] 35.
Mitsuhashi, M., Ogura, M., Endo, K., Obara, K., Izutsu, H., Targan,
S. R., Maemura, M., Tachikawa, D., and Shinagawa, A. 2008. Ex vivo
induction of mRNA in human whole blood as a new platform of drug
and dietary supplement development. Pharm Res 25:1116-1124. [0119]
36. Mitsuhashi, M., and Targan, S. R. 2008. Ex vivo simulation of
IgG Fc and T-cell receptor functions: an application to
inflammatory bowel disease. Inflamm Bowel Dis 14:1061-1067. [0120]
37. Thomas, H. E., Darwiche, R., Corbett, J. A., and Kay, T. W.
1999. Evidence that beta cell death in the nonobese diabetic mouse
is Fas independent. J Immunol 163:1562-1569. [0121] 38. Hughes, K.
J., Chambers, K. T., Meares, G. P., and Corbett, J. A. 2009. Nitric
oxides mediates a shift from early necrosis to late apoptosis in
cytokine-treated {beta}-cells that is associated with irreversible
DNA damage. Am J Physiol Endocrinol Metab. [0122] 39. Kwon, G., Xu,
G., Marshall, C. A., and McDaniel, M. L. 1999. Tumor necrosis
factor alpha-induced pancreatic beta-cell insulin resistance is
mediated by nitric oxide and prevented by
15-deoxy-Delta12,14-prostaglandin J2 and aminoguanidine. A role for
peroxisome proliferator-activated receptor gamma activation and
inos expression. J Biol Chem 274:18702-18708. [0123] 40. Kim, H.
E., Choi, S. E., Lee, S. J., Lee, J. H., Lee, Y. J., Kang, S. S.,
Chun, J., and Kang, Y. 2008. Tumour necrosis factor-alpha-induced
glucose-stimulated insulin secretion inhibition in INS-1 cells is
ascribed to a reduction of the glucose-stimulated Ca2+ influx. J
Endocrinol 198:549-560. [0124] 41. Mastrandrea, L., Yu, J.,
Behrens, T., Buchlis, J., Albini, C., Fourtner, S., and Quattrin,
T. 2009. Etanercept treatment in children with new-onset type 1
diabetes: pilot randomized, placebo-controlled, double-blind study.
Diabetes Care 32:1244-1249. [0125] 42. Louvet, C., Szot, G. L.,
Lang, J., Lee, M. R., Martinier, N., Bollag, G., Zhu, S., Weiss,
A., and Bluestone, J. A. 2008. Tyrosine kinase inhibitors reverse
type 1 diabetes in nonobese diabetic mice. Proc Natl Acad Sci USA
105:18895-18900. [0126] 43. Lv, N., Kim, E. K., Song, M. Y., Choi,
H. N., Moon, W. S., Park, S. J., Park, J. W., Kwon, K. B., and
Park, B. H. 2009. JANEX-1, a JAK3 inhibitor, protects pancreatic
islets from cytokine toxicity through downregulation of NF-kappaB
activation and the JAK/STAT pathway. Exp Cell Res 315:2064-2071.
[0127] 44. Mitsuhashi, M., Tomozawa, S., Endo, K., and Shinagawa,
A. 2006. Quantification of mRNA in whole blood by assessing
recovery of RNA and efficiency of cDNA synthesis. Clin Chem
52:634-642. [0128] 45. Mitsuhashi, M., Keller, C., and Akitaya, T.
1992. Gene manipulation on plastic plates. Nature 357:519-520.
[0129] 46. Morrison, T. B., Weis, J. J., and Wittwer, C. T. 1998.
Quantification of low-copy transcripts by continuous SYBR Green I
monitoring during amplification. Biotechniques 24:954-958, 960,
962. [0130] 47. Mitsuhashi, M., Endo, K., Obara, K., Izutsu, H.,
Ishida, T., Chikatsu, N., and Shinagawa, A. 2008. Ex vivo
simulation of the action of antileukemia drugs by measuring
apoptosis-related mRNA in blood. Clin Chem 54:673-681. [0131] 48.
Mitsuhashi M, E. K., Obara K, Izutsu H, Ishida T, Chikatsu N,
Shinagawa A. 2008. Quantification of Drug-Induced mRNA in Human
Whole Blood ex vivo. Clinical Medicine: Blood Disorders 1:1-11.
[0132] 49. Omori, K., Valiente, L., Orr, C., Rawson, J., Ferreri,
K., Todorov, I., A I-Abdullah, I. H., Medicherla, S., Potter, A.
A., Schreiner, G. F., et al. 2007. Improvement of human islet
cryopreservation by a p38 MAPK inhibitor. Am J Transplant
7:1224-1232. [0133] 50. Ito, T., Omori, K., Rawson, J., Todorov,
I., Asari, S., Kuroda, A., Shintaku, J., Itakura, S., Ferreri, K.,
Kandeel, F., et al. 2008. Improvement of canine islet yield by
donor pancreas infusion with a p38MAPK inhibitor. Transplantation
86:321-329. [0134] 51. Gurzov E N, Germano C M, Cunha D A, et al.
(2010) PUMA activation contributes to pancreatic beta cell
apoptosis induced by pro-inflammatory cytokines and endoplasmic
reticulum stress. J Biol Chem. [0135] 52. Todorov I, Nair I,
Avakian-Mansoorian A, et al. (2010) Quantitative assessment of
beta-cell apoptosis and cell composition of isolated, undisrupted
human islets by laser scanning cytometry. Transplantation 90:
836-842. [0136] 53. Itakura S, Asari S, Rawson J, et al. (2007)
Mesenchymal stem cells facilitate the induction of mixed
hematopoietic chimerism and islet allograft tolerance without GVHD
in the rat. Am J Transplant 7: 336-346. [0137] 54. Hanley S, Liu S,
Lipsett M, et al. (2006) Tumor necrosis factor-alpha production by
human islets leads to postisolation cell death. Transplantation 82:
813-818. [0138] 55. Hagerkvist R, Sandler S, Mokhtari D, Welsh N
(2007) Amelioration of diabetes by imatinib mesylate (Gleevec):
role of beta-cell NF-kappaB activation and anti-apoptotic
preconditioning. FASEB J 21: 618-628. [0139] 56. Matsuda T, Omori
K, Vuong T, et al. (2005) Inhibition of p38 pathway suppresses
human islet production of pro-inflammatory cytokines and improves
islet graft function. Am J Transplant 5: 484-493. [0140] 57. Omori
K, Todorov I, Shintaku J, et al. (2010) P38alpha-selective
mitogen-activated protein kinase inhibitor for improvement of
cultured human islet recovery. Pancreas 39: 436-443. [0141] 58. De
Vos K, Goossens V, Boone E, et al. (1998) The 55-kDa tumor necrosis
factor receptor induces clustering of mitochondria through its
membrane-proximal region. The Journal of biological chemistry 273:
9673-9680. [0142] 59. Desagher S, Martinou J C (2000) Mitochondria
as the central control point of apoptosis. Trends Cell Biol 10:
369-377. [0143] 60. Niizuma K, Endo H, Nito C, Myer D J, Chan P H
(2009) Potential role of PUMA in delayed death of hippocampal CA1
neurons after transient global cerebral ischemia. Stroke 40:
618-625.
Sequence CWU 1
1
6119DNAArtificial SequenceIn1 upstream probe 1aggtgggctc aggattcca
19219DNAArtificial SequenceIn1 downstrream probe 2tcacccccac
atgcttcac 19320DNAArtificial SequenceIn2 upstream probe 3actcgcccct
caaacaaatg 20421DNAArtificial SequenceIn2 downstream probe
4tgaatctgcg gtcatcaaat g 21519DNAArtificial SequenceIn2Ex3 upstream
probe 5ctctgcctcg ccgctgttc 19620DNAArtificial SequenceIn2Ex3
downstream probe 6tccacaatgc cacgcttctg 20
* * * * *