Compositions And Methods For Insecticidal Control Of Stinkbugs

Abstract

Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Pentatomidae plant pest or a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest, decrease the expression of a target sequence in the pest. In specific embodiments, the decrease in expression of the target sequence controls the pest and thereby the methods and compositions are capable of limiting damage to a plant. The present invention provides various target polynucleotides set forth in any one of SEQ ID NOS: 1-292 or 302-304 or active variants and fragments thereof, wherein a decrease in expression of one or more the sequences in the target pest controls the pest (i.e., has insecticidal activity). Further provided are silencing elements which when ingested by the pest decrease the level of the target polypeptide and thereby control the pest. In specific embodiment, the pest is Pentatomidae. Plants, plant part, bacteria and other host cells comprising the silencing elements or an active variant or fragment thereof of the invention are also provided.

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application is a divisional of U.S. Non-Provisional application Ser. No. 14/525,482 filed Oct. 28, 2014, which is a continuation of U.S. Non-Provisional application Ser. No. 13/152,795 filed Jun. 3, 2011, now granted as U.S. Pat. No. 8,872,001, which claims the benefit U.S. Provisional Application No. 61/351,405, filed Jun. 4, 2010; the contents of which are herein incorporated by reference in their entirety.

REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS-WEB

[0002] The official copy of the sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 3548USDIV_SeqList.txt, a creation date of Jun. 2, 2011 and a size of 199 KB. The sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.

FIELD OF THE INVENTION

[0003] The present invention relates generally to methods of molecular biology and gene silencing to control pests.

BACKGROUND OF THE INVENTION

[0004] Insect pests are a serious problem in agriculture. They destroy millions of acres of staple crops such as corn, soybeans, peas, and cotton. Yearly, these pests cause over $100 billion dollars in crop damage in the U.S. alone. In an ongoing seasonal battle, farmers must apply billions of gallons of synthetic pesticides to combat these pests. Other methods employed in the past delivered insecticidal activity by microorganisms or genes derived from microorganisms expressed in transgenic plants. For example, certain species of microorganisms of the genus Bacillus are known to possess pesticidal activity against a broad range of insect pests including Lepidoptera, Diptera, Coleoptera, Hemiptera, and others. In fact, microbial pesticides, particularly those obtained from Bacillus strains, have played an important role in agriculture as alternatives to chemical pest control. Agricultural scientists have developed crop plants with enhanced insect resistance by genetically engineering crop plants to produce insecticidal proteins from Bacillus. For example, corn and cotton plants genetically engineered to produce Cry toxins (see, e.g., Aronson (2002) Cell Mol. Life Sci. 59(3):417-425; Schnepf et al. (1998) Microbiol. Mol. Biol. Rev. 62(3):775-806) are now widely used in American agriculture and have provided the farmer with an alternative to traditional insect-control methods. However, these Bt insecticidal proteins only protect plants from a relatively narrow range of pests. Moreover, these modes of insecticidal activity provided varying levels of specificity and, in some cases, caused significant environmental consequences.

[0005] Previous control of stinkbugs relied on broad spectrum insecticides. With the adoption of transgenic controls for major lepidopteran pests in several crops, these insecticides are no longer used and stinkbugs have become a major secondary pest. No successful use of transgenic control of stinkbugs has been described or adopted. This may be due in part to the extra oral digestion employed by stinkbugs where digestive enzymes are injected into the host plant prior to feeding. This makes it difficult to find proteins that survive long enough to manifest activity against these insects. RNAi may overcome that feeding behavior by relying on double stranded RNAs rather than proteins. Thus, there is an immediate need for alternative methods to control pests.

BRIEF SUMMARY OF THE INVENTION

[0006] Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Pentatomidae plant pest including for example, a N. viridula (southern green stink bug), Acrosternum hilare (green stinkbug), Piezodorus guildini (redbanded stinkbug), and/or Halymorpha halys (Brown marmorated stinkbug). plant pest, is capable of decreasing the expression of a target sequence in the pest. In specific embodiments, the decrease in expression of the target sequence controls the pest and thereby the methods and compositions are capable of limiting damage to a plant. The present invention provides various target polynucleotides as set forth in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 302, 303 or 304 or active variants or fragments thereof, wherein a decrease in expression of one or more the sequences in the target pest controls the pest (i.e., has insecticidal activity). Further provided are silencing elements, which when ingested by the pest, decrease the level of expression of one or more of the target polynucleotides. Plants, plant parts, plant cells, bacteria and other host cells comprising the silencing elements or an active variant or fragment thereof are also provided.

[0007] In another embodiment, a method for controlling a pest, such as a Pentatomidae plant pest, such as, for example, a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest, is provided. The method comprises feeding to a pest a composition comprising a silencing element, wherein the silencing element, when ingested by the pest, reduces the level of a target sequence in the pest and thereby controls the pest. Further provided are methods to protect a plant from a pest. Such methods comprise introducing into the plant or plant part a silencing element of the invention. When the plant expressing the silencing element is ingested by the pest, the level of the target sequence is decreased and the pest is controlled.

BRIEF DESCRIPTION OF THE DRAWINGS

[0008] FIG. 1 shows the Southern Green Stinkbug feeding assay results with soybean embryo tissue transformed with hairpin RNA silencing contructs.

[0009] FIG. 2 shows the Southern Green Stinkbug feeding assay results with soybean embryo tissue transformed with amiRNA silencing constructs.

DETAILED DESCRIPTION OF THE INVENTION

[0010] The present inventions now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the inventions are shown. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout.

[0011] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

I. Overview

[0012] Frequently, RNAi discovery methods rely on evaluation of known classes of sensitive genes (transcription factors, housekeeping genes etc.). In contrast, the target polynucleotide set forth herein were identified based solely on high throughput screens of a library of over 1000 expressed sequence tags from N. viridula. This screen allowed for the discovery of many novel sequences, many of which have extremely low or no homology to known sequences. This method provided the advantage of having no built in bias to genes that are frequently highly conserved across taxa. As a result, many novel targets for RNAi as well as known genes not previously shown to be sensitive to RNAi have been identified.

[0013] As such, methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Pentatomidae plant pest or, for example, a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest, is capable of decreasing the expression of a target sequence in the pest. In specific embodiments, the decrease in expression of the target sequence controls the pest and thereby the methods and compositions are capable of limiting damage to a plant or plant part. The present invention provides target polynucleotides as set forth in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 302, 303, or 304. or active variants and fragments thereof. Silencing elements designed in view of these target polynucleotides are provided which, when ingested by the pest, decrease the expression of one or more of the target sequences and thereby controls the pest (i.e., has insecticidal activity).

[0014] As used herein, by "controlling a pest" or "controls a pest" is intended any affect on a pest that results in limiting the damage that the pest causes. Controlling a pest includes, but is not limited to, killing the pest, inhibiting development of the pest, altering fertility or growth of the pest in such a manner that the pest provides less damage to the plant, decreasing the number of offspring produced, producing less fit pests, producing pests more susceptible to predator attack, or deterring the pests from eating the plant.

[0015] Reducing the level of expression of the target polynucleotide or the polypeptide encoded thereby, in the pest results in the suppression, control, and/or killing the invading pathogenic organism. Reducing the level of expression of the target sequence of the pest will reduce the disease symptoms resulting from pathogen challenge by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%, or at least about 50% to about 90% or greater. Hence, the methods of the invention can be utilized to control pests, particularly, Pentatomidae plant pest or a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest.

[0016] Assays that measure the control of a pest are commonly known in the art, as are methods to quantitate disease resistance in plants following pathogen infection. See, for example, U.S. Pat. No. 5,614,395, herein incorporated by reference. Such techniques include, measuring over time, the average lesion diameter, the pathogen biomass, and the overall percentage of decayed plant tissues. See, for example, Thomma et al. (1998) Plant Biology 95:15107-15111, herein incorporated by reference. See, also Baum et al. (2007) Nature Biotech 11:1322-1326 and WO 2007/035650 which proved both whole plant feeding assays and corn root feeding assays. Both of these references are herein incorporated by reference in their entirety. See, also the examples below.

[0017] The invention is drawn to compositions and methods for protecting plants from a plant pest, such as Pentatomidae plant pests or N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pests or inducing resistance in a plant to a plant pest, such as Pentatomidae plant pests or N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pests. As used herein "Pentatomidae plant pest" is used to refer to any member of the Pentatomidae family. Accordingly, the compositions and methods are also useful in protecting plants against any Pentatomidae plant pest including representative genera and species such as, but not limited to, Acrocorisellus (A. serraticollis), Acrosternum (A. adelpha, A. hilare, A. herbidum, A. scutellatum), Agonoscelis (A. nubila), Alcaeorrhynchus (A. grandis, A. phymatophorus), Amaurochrous (A. brevitylus), Apateticus (A. anatarius, A. bracteatus, A. cynicus, A. lineolatus, A. marginiventris), Apoecilus, Arma (A. custos), Arvelius, Bagrada, Banasa (B. calva, B. dimiata, B. grisea, B. induta, B. sordida), Brochymena (B. affinis, B. cariosa, B. haedula, B. hoppingi, B. sulcata), Carbula (C. obtusangula, C. sinica), Chinavia, Chlorochroa (C. belfragii, C. kanei, C. norlandi, C. senilis, C. viridicata), Chlorocoris (C. distinctus, C. flaviviridis, C. hebetatus, C. subrugosus, C. tau), Codophila (C. remota, C. sulcata, C. varius), Coenus (C. delius, C. inermis, C. tarsalis), Cosmopepla (C. bimaculata, C. binotata, C. carnifex, C. decorata, C. intergressus), Dalpada (D. oculata), Dendrocoris (D. arizonesis, D. fruticicola, D. humeralis, D. parapini, D. reticulatus), Dolycoris (D. baccarum (sloe bug)), Dybowskyia (D. reticulata), Edessa, Erthesina (E. fullo), Eurydema (E. dominulus, E. gebleri (shield bug), E. pulchra, E. rugosa), Euschistus (E. biformis, E. integer, E. quadrator, E. serous, E. tristigma), Euthyrhynchus (E. floridanus, E. macronemis), Gonopsis (G. coccinea), Graphosoma (G. lineatum (stink bug), G. rubrolineatum), Halyomorpha (H. halys (brown marmorated stink bug)), Halys (H. sindillus, H. sulcatus), Holcostethus (H. abbreviatus, H. fulvipes, H. limbolarius, H. piceus, H. sphacelatus), Homalogonia (H. obtusa), Hymenarcys (H. aequalis, H. crassa, H. nervosa, H. perpuncata, H. reticulata), Lelia (L. decempunctata), Lineostethus, Loxa (L. flavicollis, L. viridis), Mecidea (M. indicia, M. major, M. minor), Megarrhamphus (M. hastatus), Menecles (M. insertus, M. portacrus), Mormidea (M. cubrosa, M. lugens, M. parva, M. pictiventris, M. ypsilon), Moromorpha (M. tetra), Murgantia (M. angularis, M. tessellata, M. varicolor, M. violascens), Neottiglossa (N. californica, N. cavifrons, N. coronaciliata, N. sulcifrons, N. undata), Nezara (N. smaragdulus, N. viridula (southern green stink bug)), Oebalus (O. grisescens, O. insularis, O. mexicanus, O. pugnax, O. typhoeus), Oechalia (O. schellenbergii (spined predatory shield bug)), Okeanos (O. quelpartensis), Oplomus (O. catena, O. dichrous, O. tripustulatus), Palomena (P. prasina (green shield bug)), Parabrochymena, Pentatoma (P. angulata, P. illuminata, P. japonica, P. kunmingensis, P. metallifera, P. parataibaiensis, P. rufipes, P. semiannulata, P. viridicornuta), Perillus (P. bioculatus, P. confluens, P. strigipes), Picromerus (P. griseus), Piezodorus (P. degeeri, P. guildinii, P. lituratus (gorse shield bug)), Pinthaeus (P. humeralis), Plautia (P. crossota, P. stali (brown-winged green bug)), Podisus (P. maculiventris), Priassus (P. testaceus), Prionosoma, Proxys (P. albopunctulatus, P. punctulatus, P. victor), Rhaphigaster (R. nebulosa), Scotinophara (S. horvathi), Stiretrus (S. anchorago, S. fimbriatus), Thyanta (T. accerra, T. calceata, T. casta, T. perditor, T. pseudocasta), Trichopepla (T. aurora, T. dubia, T. pilipes, T. semivittata, T. vandykei), Tylospilus, and Zicrona.

II. Target Sequences

[0018] As used herein, a "target sequence" or "target polynucleotide" comprises any sequence in the pest that one desires to reduce the level of expression. In specific embodiments, decreasing the level of the target sequence in the pest controls the pest. For instance, the target sequence can be essential for growth and development. While the target sequence can be expressed in any tissue of the pest, in specific embodiments, the sequences targeted for suppression in the pest are expressed in cells of the gut tissue of the pest, cells in the midgut of the pest, and cells lining the gut lumen or the midgut. Such target sequences can be involved in, for example, gut cell metabolism, growth or differentiation. Non-limiting examples of target sequences of the invention include a polynucleotide set forth in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 302, 303, or 304. As exemplified elsewhere herein, decreasing the level of expression of one or more of these target sequences in a Pentatomidae plant pest or a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest controls the pest.

III. Silencing Elements

[0019] By "silencing element" is intended a polynucleotide which when ingested by a pest, is capable of reducing or eliminating the level or expression of a target polynucleotide or the polypeptide encoded thereby. The silencing element employed can reduce or eliminate the expression level of the target sequence by influencing the level of the target RNA transcript or, alternatively, by influencing translation and thereby affecting the level of the encoded polypeptide. Methods to assay for functional silencing elements that are capable of reducing or eliminating the level of a sequence of interest are disclosed elsewhere herein. A single polynucleotide employed in the methods of the invention can comprise one or more silencing elements to the same or different target polynucleotides. The silencing element can be produced in vivo (i.e., in a host cell such as a plant or microorganism) or in vitro.

[0020] In specific embodiments, the target sequence is not endogenous to the plant. In other embodiments, while the silencing element controls pests, preferably the silencing element has no effect on the normal plant or plant part.

[0021] As discussed in further detail below, silencing elements can include, but are not limited to, a sense suppression element, an antisense suppression element, a double stranded RNA, a siRNA, an amiRNA, a miRNA, or a hairpin suppression element. Non-limiting examples of silencing elements that can be employed to decrease expression of these target Pentatomidae plant pest sequences or N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest sequences comprise fragments and variants of the sense or antisense sequence or consists of the sense or antisense sequence of the sequence set forth in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 302, 303, or 304 or a biologically active variant or fragment thereof. Additional sequences that can be employed as silencing elements include, for example, SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 305, 306, 307, 308, 309, 310, 311, 312, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, or 336 or active variants or fragments thereof. The silencing element can further comprise additional sequences that advantageously effect transcription and/or the stability of a resulting transcript. For example, the silencing elements can comprise at least one thymine residue at the 3' end. This can aid in stabilization. Thus, the silencing elements can have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more thymine residues at the 3' end. As discussed in further detail below, enhancer suppressor elements can also be employed in conjunction with the silencing elements disclosed herein.

[0022] By "reduces" or "reducing" the expression level of a polynucleotide or a polypeptide encoded thereby is intended to mean, the polynucleotide or polypeptide level of the target sequence is statistically lower than the polynucleotide level or polypeptide level of the same target sequence in an appropriate control pest which is not exposed to (i.e., has not ingested) the silencing element. In particular embodiments of the invention, reducing the polynucleotide level and/or the polypeptide level of the target sequence in a pest according to the invention results in less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5% of the polynucleotide level, or the level of the polypeptide encoded thereby, of the same target sequence in an appropriate control pest. Methods to assay for the level of the RNA transcript, the level of the encoded polypeptide, or the activity of the polynucleotide or polypeptide are discussed elsewhere herein.

[0023] i. Sense Suppression Elements

[0024] As used herein, a "sense suppression element" comprises a polynucleotide designed to express an RNA molecule corresponding to at least a part of a target messenger RNA in the "sense" orientation. Expression of the RNA molecule comprising the sense suppression element reduces or eliminates the level of the target polynucleotide or the polypeptide encoded thereby. The polynucleotide comprising the sense suppression element may correspond to all or part of the sequence of the target polynucleotide, all or part of the 5' and/or 3' untranslated region of the target polynucleotide, all or part of the coding sequence of the target polynucleotide, or all or part of both the coding sequence and the untranslated regions of the target polynucleotide.

[0025] Typically, a sense suppression element has substantial sequence identity to the target polynucleotide, typically greater than about 65% sequence identity, greater than about 85% sequence identity, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity. See, U.S. Pat. Nos. 5,283,184 and 5,034,323; herein incorporated by reference. The sense suppression element can be any length so long as it allows for the suppression of the targeted sequence. The sense suppression element can be, for example, 15, 16, 17, 18 19, 20, 22, 25, 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 900, 1000, 1100, 1200, 1300 nucleotides or longer of the target polynucleotides set forth in any of SEQ ID NO:1-292 or 302-304. In other embodiments, the sense suppression element can be, for example, about 15-25, 25-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-950, 950-1000, 1000-1050, 1050-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800 nucleotides or longer of the target polynucleotides set forth in any of SEQ ID NO: 1-292 or 302-304.

[0026] ii. Antisense Suppression Elements

[0027] As used herein, an "antisense suppression element" comprises a polynucleotide which is designed to express an RNA molecule complementary to all or part of a target messenger RNA. Expression of the antisense RNA suppression element reduces or eliminates the level of the target polynucleotide. The polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the target polynucleotide, all or part of the complement of the 5' and/or 3' untranslated region of the target polynucleotide, all or part of the complement of the coding sequence of the target polynucleotide, or all or part of the complement of both the coding sequence and the untranslated regions of the target polynucleotide. In addition, the antisense suppression element may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target polynucleotide. In specific embodiments, the antisense suppression element comprises at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence complementarity to the target polynucleotide. Antisense suppression may be used to inhibit the expression of multiple proteins in the same plant. See, for example, U.S. Pat. No. 5,942,657. Furthermore, the antisense suppression element can be complementary to a portion of the target polynucleotide. Generally, sequences of at least 15, 20, 22, 25, 50, 100, 200, 300, 400, 450 nucleotides or greater of the sequence set forth in any of SEQ ID NO: 1-292 or 302-304 may be used. Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, for example, in Liu et al (2002) Plant Physiol. 129:1732-1743 and U.S. Pat. Nos. 5,759,829 and 5,942,657, each of which is herein incorporated by reference.

[0028] iii. Double Stranded RNA Suppression Element

[0029] A "double stranded RNA silencing element" or "dsRNA" comprises at least one transcript that is capable of forming a dsRNA either before or after ingestion by a pest. Thus, a "dsRNA silencing element" includes a dsRNA, a transcript or polyribonucleotide capable of forming a dsRNA or more than one transcript or polyribonucleotide capable of forming a dsRNA. "Double stranded RNA" or "dsRNA" refers to a polyribonucleotide structure formed either by a single self-complementary RNA molecule or a polyribonucleotide structure formed by the expression of least two distinct RNA strands. The dsRNA molecule(s) employed in the methods and compositions of the invention mediate the reduction of expression of a target sequence, for example, by mediating RNA interference "RNAi" or gene silencing in a sequence-specific manner. In the context of the present invention, the dsRNA is capable of reducing or eliminating the level or expression of a target polynucleotide or the polypeptide encoded thereby in a pest.

[0030] The dsRNA can reduce or eliminate the expression level of the target sequence by influencing the level of the target RNA transcript, by influencing translation and thereby affecting the level of the encoded polypeptide, or by influencing expression at the pre-transcriptional level (i.e., via the modulation of chromatin structure, methylation pattern, etc., to alter gene expression). See, for example, Verdel et al. (2004) Science 303:672-676; Pal-Bhadra et al. (2004) Science 303:669-672; Allshire (2002) Science 297:1818-1819; Volpe et al. (2002) Science 297:1833-1837; Jenuwein (2002) Science 297:2215-2218; and Hall et al. (2002) Science 297:2232-2237. Methods to assay for functional dsRNA that are capable of reducing or eliminating the level of a sequence of interest are disclosed elsewhere herein. Accordingly, as used herein, the term "dsRNA" is meant to encompass other terms used to describe nucleic acid molecules that are capable of mediating RNA interference or gene silencing, including, for example, short-interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), hairpin RNA, short hairpin RNA (shRNA), post-transcriptional gene silencing RNA (ptgsRNA), and others.

[0031] In specific embodiments, at least one strand of the duplex or double-stranded region of the dsRNA shares sufficient sequence identity or sequence complementarity to the target polynucleotide to allow for the dsRNA to reduce the level of expression of the target sequence. As used herein, the strand that is complementary to the target polynucleotide is the "antisense strand" and the strand homologous to the target polynucleotide is the "sense strand."

[0032] In another embodiment, the dsRNA comprises a hairpin RNA. A hairpin RNA comprises an RNA molecule that is capable of folding back onto itself to form a double stranded structure. Multiple structures can be employed as hairpin elements. In specific embodiments, the dsRNA suppression element comprises a hairpin element which comprises in the following order, a first segment, a second segment, and a third segment, where the first and the third segment share sufficient complementarity to allow the transcribed RNA to form a double-stranded stem-loop structure.

[0033] The "second segment" of the hairpin comprises a "loop" or a "loop region." These terms are used synonymously herein and are to be construed broadly to comprise any nucleotide sequence that confers enough flexibility to allow self-pairing to occur between complementary regions of a polynucleotide (i.e., segments 1 and 3 which form the stem of the hairpin). For example, in some embodiments, the loop region may be substantially single stranded and act as a spacer between the self-complementary regions of the hairpin stem-loop. In some embodiments, the loop region can comprise a random or nonsense nucleotide sequence and thus not share sequence identity to a target polynucleotide. In other embodiments, the loop region comprises a sense or an antisense RNA sequence or fragment thereof that shares identity to a target polynucleotide. See, for example, International Patent Publication No. WO 02/00904, herein incorporated by reference. In specific embodiments, the loop region can be optimized to be as short as possible while still providing enough intramolecular flexibility to allow the formation of the base-paired stem region. Accordingly, the loop sequence is generally less than 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 25, 20, 15, 10 nucleotides or less.

[0034] The "first" and the "third" segment of the hairpin RNA molecule comprise the base-paired stem of the hairpin structure. The first and the third segments are inverted repeats of one another and share sufficient complementarity to allow the formation of the base-paired stem region. In specific embodiments, the first and the third segments are fully complementary to one another. Alternatively, the first and the third segment may be partially complementary to each other so long as they are capable of hybridizing to one another to form a base-paired stem region. The amount of complementarity between the first and the third segment can be calculated as a percentage of the entire segment. Thus, the first and the third segment of the hairpin RNA generally share at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, up to and including 100% complementarity.

[0035] The first and the third segment are at least about 1000, 500, 400, 300, 200, 100, 50, 40, 30, 25, 22, 20, 19, 18, 17, 16, 15 or 10 nucleotides in length. In specific embodiments, the length of the first and/or the third segment is about 10-100 nucleotides, about 10 to about 75 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 35 nucleotides, about 10 to about 30 nucleotides, about 10 to about 25 nucleotides, about 10 to about 19 nucleotides, about 50 nucleotides to about 100 nucleotides, about 100 nucleotides to about 150 nucleotides, about 150 nucleotides to about 200 nucleotides, about 200 nucleotides to about 250 nucleotides, about 250 nucleotides to about 300 nucleotides, about 300 nucleotides to about 350 nucleotides, about 350 nucleotides to about 400 nucleotides, about 400 nucleotide to about 500 nucleotides, about 600 nt, about 700 nt, about 800 nt, about 900 nt, about 1000 nt, about 1100 nt, about 1200 nt, 1300 nt, 1400 nt, 1500 nt, 1600 nt, 1700 nt, 1800 nt, 1900 nt, 2000 nt or longer. In other embodiments, the length of the first and/or the third segment comprises at least 10-19 nucleotides; 19-35 nucleotides; 30-45 nucleotides; 40-50 nucleotides; 50-100 nucleotides; 100-300 nucleotides; about 500 -700 nucleotides; about 700-900 nucleotides; about 900-1100 nucleotides; about 1300 -1500 nucleotides; about 1500 -1700 nucleotides; about 1700 -1900 nucleotides; about 1900 -2100 nucleotides; about 2100 -2300 nucleotides; or about 2300 -2500 nucleotides. See, for example, International Publication No. WO 0200904. In specific embodiments, the first and the third segment comprise at least 19 nucleotides having at least 85% complementary to the first segment. In still other embodiments, the first and the third segments which form the stem-loop structure of the hairpin comprises 3' or 5' overhang regions having unpaired nucleotide residues.

[0036] In specific embodiments, the sequences used in the first, the second, and/or the third segments comprise domains that are designed to have sufficient sequence identity to a target polynucleotide of interest and thereby have the ability to decrease the level of expression of the target polynucleotide. The specificity of the inhibitory RNA transcripts is therefore generally conferred by these domains of the silencing element. Thus, in some embodiments of the invention, the first, second and/or third segment of the silencing element comprise a domain having at least 10, at least 15, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1000, or more than 1000 nucleotides that share sufficient sequence identity to the target polynucleotide to allow for a decrease in expression levels of the target polynucleotide when expressed in an appropriate cell. In other embodiments, the domain is between about 15 to 50 nucleotides, about 19-35 nucleotides, about 25-50 nucleotides, about 19 to 75 nucleotides, about 40-90 nucleotides about 15-100 nucleotidesl0-100 nucleotides, about 10 to about 75 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 35 nucleotides, about 10 to about 30 nucleotides, about 10 to about 25 nucleotides, about 10 to about 19 nucleotides, about 50 nucleotides to about 100 nucleotides, about 100 nucleotides to about 150 nucleotides, about 150 nucleotides to about 200 nucleotides, about 200 nucleotides to about 250 nucleotides, about 250 nucleotides to about 300 nucleotides, about 300 nucleotides to about 350 nucleotides, about 350 nucleotides to about 400 nucleotides, about 400 nucleotide to about 500 nucleotides or longer. In other embodiments, the length of the first and/or the third segment comprises at least 10-19 nucleotides, 19-35 nucleotides, 30-45 nucleotides, 40-50 nucleotides, 50-100 nucleotides, or about 100-300 nucleotides.

[0037] In specific embodiments, the domain of the first, the second, and/or the third segment has 100% sequence identity to the target polynucleotide. In other embodiments, the domain of the first, the second and/or the third segment having homology to the target polypeptide have at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity to a region of the target polynucleotide. The sequence identity of the domains of the first, the second and/or the third segments to the target polynucleotide need only be sufficient to decrease expression of the target polynucleotide of interest. See, for example, Chuang and Meyerowitz (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol. 129:1723-1731; Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38; Pandolfini et al. BMC Biotechnology 3:7, and U.S. Patent Publication No. 20030175965; each of which is herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga et al. (2003) Mol. Biol. Rep. 30:135-140, herein incorporated by reference.

[0038] The amount of complementarity shared between the first, second, and/or third segment and the target polynucleotide or the amount of complementarity shared between the first segment and the third segment (i.e., the stem of the hairpin structure) may vary depending on the organism in which gene expression is to be controlled. Some organisms or cell types may require exact pairing or 100% identity, while other organisms or cell types may tolerate some mismatching. In some cells, for example, a single nucleotide mismatch in the targeting sequence abrogates the ability to suppress gene expression. In these cells, the suppression cassettes of the invention can be used to target the suppression of mutant genes, for example, oncogenes whose transcripts comprise point mutations and therefore they can be specifically targeted using the methods and compositions of the invention without altering the expression of the remaining wild-type allele.

[0039] Any region of the target polynucleotide can be used to design the domain of the silencing element that shares sufficient sequence identity to allow expression of the hairpin transcript to decrease the level of the target polynucleotide. For instance, the domain can be designed to share sequence identity to the 5' untranslated region of the target polynucleotide(s), the 3' untranslated region of the target polynucleotide(s), exonic regions of the target polynucleotide(s), intronic regions of the target polynucleotide(s), and any combination thereof. In specific embodiments, a domain of the silencing element shares sufficient homology to at least about 15, 16, 17, 18, 19, 20, 22, 25 or 30 consecutive nucleotides from about nucleotides 1-50, 25-75, 75-125, 50-100, 125-175, 175-225, 100-150, 150-200, 200-250, 225-275, 275-325, 250-300, 325-375, 375-425, 300-350, 350-400, 425-475, 400-450, 475-525, 450-500, 525-575, 575-625, 550-600, 625-675, 675-725, 600-650, 625-675, 675-725, 650-700, 725-825, 825-875, 750-800, 875-925, 925-975, 850-900, 925-975, 975-1025, 950-1000, 1000-1050, 1025-1075, 1075-1125, 1050-1100, 1125-1175, 1100-1200, 1175-1225, 1225-1275, 1200-1300, 1325-1375, 1375-1425, 1300-1400, 1425-1475, 1475-1525, 1400-1500, 1525-1575, 1575-1625, 1625-1675, 1675-1725, 1725-1775, 1775-1825, 1825-1875, 1875-1925, 1925-1975, 1975-2025, 2025-2075, 2075-2125, 2125-2175, 2175-2225, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000 of the target sequence. In some instances to optimize the siRNA sequences employed in the hairpin, the synthetic oligodeoxyribonucleotide/RNAse H method can be used to determine sites on the target mRNA that are in a conformation that is susceptible to RNA silencing. See, for example, Vickers et al. (2003) J. Biol. Chem 278:7108-7118 and Yang et al. (2002) Proc. Natl. Acad. Sci. USA 99:9442-9447, herein incorporated by reference. These studies indicate that there is a significant correlation between the RNase-H-sensitive sites and sites that promote efficient siRNA-directed mRNA degradation.

[0040] The hairpin silencing element may also be designed such that the sense sequence or the antisense sequence do not correspond to a target polynucleotide. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the target polynucleotide. Thus, it is the loop region that determines the specificity of the RNA interference. See, for example, WO 02/00904, herein incorporated by reference.

[0041] In addition, transcriptional gene silencing (TGS) may be accomplished through use of a hairpin suppression element where the inverted repeat of the hairpin shares sequence identity with the promoter region of a target polynucleotide to be silenced. See, for example, Aufsatz et al. (2002) PNAS 99 (Suppl. 4):16499-16506 and Mette et al. (2000) EMBO J 19(19):5194-5201.

[0042] While the various target sequences disclosed herein can be used to design any silencing element that encodes a hairpin suppression construct, non-limiting examples of such hairpin constructs are set forth in SEQ ID NO: 293 which targets SEQ ID NO: 278;

[0043] SEQ ID NOS: 294, 295 and 296 which target SEQ ID NO: 279; SEQ ID NOS: 297 and 298 which target SEQ ID NO:280; SEQ ID NO:299 which targets SEQ ID NO:281; SEQ ID NO: 300 which targets SEQ ID NO: 282; and SEQ ID NO: 301 which targets SEQ ID NO: 283; or active variants or fragments thereof. In other embodiments, the dsRNA can comprise a small RNA (sRNA). sRNAs can comprise both micro RNA (miRNA) and short-interfering RNA (siRNA) (Meister and Tuschl (2004) Nature 431:343-349 and Bonetta et al. (2004) Nature Methods 1:79-86). "MicroRNAs" or "miRNAs" are regulatory agents comprising about 19 to about 24 nucleotides (nt) in length, which are highly efficient at inhibiting the expression of target polynucleotides. See, for example Javier et al. (2003) Nature 425: 257-263, herein incorporated by reference. For miRNA interference, the silencing element can be designed to express a dsRNA molecule that forms a hairpin structure containing a 21 nucleotide sequence that is complementary to the target polynucleotide of interest. The miRNA can be an "artificial miRNA" or "amiRNA" which comprises a miRNA sequence that is synthetically designed to silence a target sequence.

[0044] When expressing an miRNA, the final (mature) miRNA is present in a duplex in a precursor backbone structure, the two strands being referred to as the miRNA (the strand that will eventually basepair with the target) and miRNA* (star sequence). This final miRNA is a substrate for a form of dicer that removes the miRNA/miRNA* duplex from the precursor, after which, similarly to siRNAs, the duplex can be taken into the RISC complex. It has been demonstrated that miRNAs can be transgenically expressed and be effective through expression of a precursor form, rather than the entire primary form (Parizotto et al. (2004) Genes & Development 18 :2237-2242 and Guo et al. (2005) Plant Cell 17:1376-1386).

[0045] The silencing element for miRNA interference comprises a miRNA precursor backbone. The miRNA precursor backbone comprises a DNA sequence having the miRNA and star sequences. When expressed as an RNA, the structure of the miRNA precursor backbone is such as to allow for the formation of a hairpin RNA structure that can be processed into a miRNA. In some embodiments, the miRNA precursor backbone comprises a genomic miRNA precursor sequence, wherein said sequence comprises a native precursor in which an heterologous (artificial) miRNA and star sequence are inserted.

[0046] As used herein, a "star sequence" is the sequence within a miRNA precursor backbone that is complementary to the miRNA and forms a duplex with the miRNA to form the stem structure of a hairpin RNA. In some embodiments, the star sequence can comprise less than 100% complementarity to the miRNA sequence. Alternatively, the star sequence can comprise at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80% or lower sequence complementarity to the miRNA sequence as long as the star sequence has sufficient complementarity to the miRNA sequence to form a double stranded structure. In still further embodiments, the star sequence comprises a sequence having 1, 2, 3, 4, 5 or more mismatches with the miRNA sequence and still has sufficient complementarity to form a double stranded structure with the miRNA sequence resulting in production of miRNA and suppression of the target sequence.

[0047] The miRNA precursor backbones can be from any plant. In some embodiments, the miRNA precursor backbone is from a monocot. In other embodiments, the miRNA precursor backbone is from a dicot. In further embodiments, the backbone is from maize or soybean. MicroRNA precursor backbones have been described previously. For example, US20090155910A1 (WO 2009/079532) discloses the following soybean miRNA precursor backbones: 156c, 159, 166b, 168c, 396b and 398b, and US20090155909A1 (WO 2009/079548) discloses the following maize miRNA precursor backbones: 159c, 164h, 168a, 169r, and 396h. Each of these references is incorporated by reference in their entirety.

[0048] Thus, the miRNA precursor backbone can be altered to allow for efficient insertion of heterologous miRNA and star sequences within the miRNA precursor backbone. In such instances, the miRNA segment and the star segment of the miRNA precursor backbone are replaced with the heterologous miRNA and the heterologous star sequences, designed to target any sequence of interest, using a PCR technique and cloned into an expression construct. It is recognized that there could be alterations to the position at which the artificial miRNA and star sequences are inserted into the backbone. Detailed methods for inserting the miRNA and star sequence into the miRNA precursor backbone are described elsewhere herein (see, Example 8) and are also described in, for example, US Patent Applications 20090155909A1 and US20090155910A1, herein incorporated by reference in their entirety.

[0049] When designing a miRNA sequence and star sequence, various design choices can be made. See, for example, Schwab R, et al. (2005) Dev Cell 8: 517-27. In non-limiting embodiments, the miRNA sequences disclosed herein can have a "U" at the 5'-end, a "C" or "G" at the 19.sup.th nucleotide position, and an "A" or "U" at the 10th nucleotide position. In other embodiments, the miRNA design is such that the miRNA have a high free delta-G as calculated using the ZipFold algorithm (Markham, N. R. & Zuker, M. (2005) Nucleic Acids Res. 33: W577-W581.) Optionally, a one base pair change can be added within the 5' portion of the miRNA so that the sequence differs from the target sequence by one nucleotide.

[0050] The methods and compositions of the invention employ silencing elements that when transcribed "form" a dsRNA molecule. Accordingly, the heterologous polynucleotide being expressed need not form the dsRNA by itself, but can interact with other sequences in the plant cell or in the pest gut after ingestion to allow the formation of the dsRNA. For example, a chimeric polynucleotide that can selectively silence the target polynucleotide can be generated by expressing a chimeric construct comprising the target sequence for a miRNA or siRNA to a sequence corresponding to all or part of the gene or genes to be silenced. In this embodiment, the dsRNA is "formed" when the target for the miRNA or siRNA interacts with the miRNA present in the cell. The resulting dsRNA can then reduce the level of expression of the gene or genes to be silenced. See, for example, US Application Publication 2007-0130653, entitled "Methods and Compositions for Gene Silencing", herein incorporated by reference. The construct can be designed to have a target for an endogenous miRNA or alternatively, a target for a heterologous and/or synthetic miRNA can be employed in the construct. If a heterologous and/or synthetic miRNA is employed, it can be introduced into the cell on the same nucleotide construct as the chimeric polynucleotide or on a separate construct. As discussed elsewhere herein, any method can be used to introduce the construct comprising the heterologous miRNA.

[0051] While the various target sequences disclosed herein can be used to design any silencing element that encodes a miRNA, non-limiting examples of such miRNA constructs include SEQ ID NOS: 311, 312, 327, 328, 335 or 336 which target SEQ ID NO: 304; SEQ ID NOS: 307, 308, 323, 324, 331 or 332 which target SEQ ID NO: 278; SEQ ID NOS: 309, 310, 325, 326, 333 or 334 which target SEQ ID NO: 303; and SEQ ID NOS: 305, 306, 321, 322, 329 or 330 which target SEQ ID NO: 302; or active variants or fragments thereof.

IV. Variants and Fragments

[0052] By "fragment" is intended a portion of the polynucleotide or a portion of the amino acid sequence and hence protein encoded thereby. Fragments of a polynucleotide may encode protein fragments that retain the biological activity of the native protein. Alternatively, fragments of a polynucleotide that are useful as a silencing element do not need to encode fragment proteins that retain biological activity. Thus, fragments of a nucleotide sequence may range from at least about 10, about 15, about 16, about 17, about 18, about 19, about 20 nucleotides, about 22 nucleotides, about 50 nucleotides, about 75 nucleotides, about 100 nucleotides, 200 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, 600 nucleotides, 700 nucleotides and up to the full-length polynucleotide employed in the invention. Alternatively, fragments of a nucleotide sequence may range from 1-50, 25-75, 75-125, 50-100, 125-175, 175-225, 100-150, 150-200, 200-250, 225-275, 275-325, 250-300, 325-375, 375-425, 300-350, 350-400, 425-475, 400-450, 475-525, 450-500, 525-575, 575-625, 550-600, 625-675, 675-725, 600-650, 625-675, 675-725, 650-700, 725-825, 825-875, 750-800, 875-925, 925-975, 850-900, 925-975, 975-1025, 950-1000, 1000-1050, 1025-1075, 1075-1125, 1050-1100, 1125-1175, 1100-1200, 1175-1225, 1225-1275, 1200-1300, 1325-1375, 1375-1425, 1300-1400, 1425-1475, 1475-1525, 1400-1500, 1525-1575, 1575-1625, 1625-1675, 1675-1725, 1725-1775, 1775-1825, 1825-1875, 1875-1925, 1925-1975, 1975-2025, 2025-2075, 2075-2125, 2125-2175, 2175-2225, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000 of any one of SEQ ID NOS: 1-304 or 321-336. Methods to assay for the activity of a desired silencing element are described elsewhere herein.

[0053] Encompassed herein are fragments of the various target sequences (i.e. SEQ ID NOS: 1-292 and 302-304) which are useful as silencing elements and fragments of the various silencing elements provided herein (i.e. SEQ ID NOS:293-301 or 321-336). Thus, fragments of a nucleotide sequence that are useful as silencing elements may range from at least about 10, about 15, about 16, about 17, about 18, about 19, about 20 nucleotides, about 22 nucleotides, about 50 nucleotides, about 75 nucleotides, about 100 nucleotides, 200 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, 600 nucleotides, 700 nucleotides and up to the full-length polynucleotide sequences of SEQ ID NOS: 1-304 or 321-336. Alternatively, fragments of a nucleotide sequence that are useful as silencing elements may range from 1-50, 25-75, 75-125, 50-100, 125-175, 175-225, 100-150, 150-200, 200-250, 225-275, 275-325, 250-300, 325-375, 375-425, 300-350, 350-400, 425-475, 400-450, 475-525, 450-500, 525-575, 575-625, 550-600, 625-675, 675-725, 600-650, 625-675, 675-725, 650-700, 725-825, 825-875, 750-800, 875-925, 925-975, 850-900, 925-975, 975-1025, 950-1000, 1000-1050, 1025-1075, 1075-1125, 1050-1100, 1125-1175, 1100-1200, 1175-1225, 1225-1275, 1200-1300, 1325-1375, 1375-1425, 1300-1400, 1425-1475, 1475-1525, 1400-1500, 1525-1575, 1575-1625, 1625-1675, 1675-1725, 1725-1775, 1775-1825, 1825-1875, 1875-1925, 1925-1975, 1975-2025, 2025-2075, 2075-2125, 2125-2175, 2175-2225, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000 of any one of SEQ ID NOS: 1-304 or 321-336. Methods to assay for the activity of a desired silencing element are described elsewhere herein. Various, non-limiting examples of fragments of SEQ ID NOS: 1-292 or 302-304 are provided herein and include, for example, SEQ ID NOS: 284-292 or 305-312.

[0054] "Variants" is intended to mean substantially similar sequences. Thus, further provided are variants of the various sequences set forth in SEQ ID NOS: 1-336. For polynucleotides, a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. A variant of a polynucleotide that is useful as a silencing element will retain the ability to reduce expression of the target polynucleotide and, in some embodiments, thereby control a pest of interest. As used herein, a "native" polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides employed in the invention. Variant polynucleotides also include synthetically derived polynucleotide, such as those generated, for example, by using site-directed mutagenesis, but continue to retain the desired activity. Generally, variants of a particular polynucleotide of the invention (i.e., a silencing element) will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein.

[0055] Variants of a particular polynucleotide of the invention (i.e., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described elsewhere herein. Where any given pair of polynucleotides employed in the invention is evaluated by comparison of the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0056] The following terms are used to describe the sequence relationships between two or more polynucleotides or polypeptides: (a) "reference sequence", (b) "comparison window", (c) "sequence identity", and, (d) "percentage of sequence identity."

[0057] (a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.

[0058] (b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two polynucleotides. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

[0059] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.

[0060] (c) As used herein, "sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).

[0061] (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

[0062] A method is further provided for identifying a silencing element from the target polynucleotides set froth in SEQ ID NO: 1-292 or 302-304. Such methods comprise obtaining a candidate fragment of any one of SEQ ID NO: 1-292 or 302-304 which is of sufficient length to act as a silencing element and thereby reduce the expression of the target polynucleotide and/or control a desired pest; expressing said candidate polynucleotide fragment in an appropriate expression cassette to produce a candidate silencing element and determining is said candidate polynucleotide fragment has the activity of a silencing element and thereby reduce the expression of the target polynucleotide and/or controls a desired pest. Methods of identifying such candidate fragments based on the desired pathway for suppression are known. For example, various bioinformatics programs can be employed to identify the region of the target polynucleotides that could be exploited to generate a silencing element. See, for example, Elbahir et al. (2001) Genes and Development 15:188-200, Schwartz et al. (2003) Cell 115:199-208, Khvorova et al. (2003) Cell 115:209-216.

[0063] See also, siRNA at Whitehead (jura.wi.mit.edu/bioc/siRNAext/) which calculates the binding energies for both sense and antisense siRNAs. See, also genscript.com/ssl-bin/app/rnai?op=known; Block-iT.TM. RNAi designer from Invitrogen and GenScript siRNA Construct Builder.

V. DNA Constructs

[0064] The use of the term "polynucleotide" is not intended to limit the present invention to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.

[0065] The polynucleotide encoding the silencing element or in specific embodiments employed in the methods and compositions of the invention can be provided in expression cassettes for expression in a plant or organism of interest. It is recognized that multiple silencing elements including multiple identical silencing elements, multiple silencing elements targeting different regions of the target sequence, or multiple silencing elements from different target sequences can be used. In this embodiment, it is recognized that each silencing element can be contained in a single or separate cassette, DNA construct, or vector. As discussed, any means of providing the silencing element is contemplated. A plant or plant cell can be transformed with a single cassette comprising DNA encoding one or more silencing elements or separate cassettes comprising each silencing element can be used to transform a plant or plant cell or host cell. Likewise, a plant transformed with one component can be subsequently transformed with the second component. One or more silencing elements can also be brought together by sexual crossing. That is, a first plant comprising one component is crossed with a second plant comprising the second component. Progeny plants from the cross will comprise both components.

[0066] The expression cassette can include 5' and 3' regulatory sequences operably linked to the polynucleotide of the invention. "Operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of the invention and a regulatory sequence (i.e., a promoter) is a functional link that allows for expression of the polynucleotide of the invention. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional polynucleotide to be cotransformed into the organism. Alternatively, the additional polypeptide(s) can be provided on multiple expression cassettes. Expression cassettes can be provided with a plurality of restriction sites and/or recombination sites for insertion of the polynucleotide to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

[0067] The expression cassette can include in the 5'-3' direction of transcription, a transcriptional and translational initiation region (i.e., a promoter), a polynucleotide comprising the silencing element employed in the methods and compositions of the invention, and a transcriptional and translational termination region (i.e., termination region) functional in plants. In other embodiment, the double stranded RNA is expressed from a suppression cassette. Such a cassette can comprise two convergent promoters that drive transcription of an operably linked silencing element. "Convergent promoters" refers to promoters that are oriented on either terminus of the operably linked silencing element such that each promoter drives transcription of the silencing element in opposite directions, yielding two transcripts. In such embodiments, the convergent promoters allow for the transcription of the sense and anti-sense strand and thus allow for the formation of a dsRNA.

[0068] The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotides employed in the invention may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide employed in the invention may be heterologous to the host cell or to each other. As used herein, "heterologous" in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

[0069] The termination region may be native with the transcriptional initiation region, may be native with the operably linked polynucleotide encoding the silencing element, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the promoter, the polynucleotide comprising silencing element, the plant host, or any combination thereof. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639.

[0070] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0071] In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0072] A number of promoters can be used in the practice of the invention. The polynucleotide encoding the silencing element can be combined with constitutive, tissue-preferred, or other promoters for expression in plants.

[0073] Such constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026); soybean elongation factor 1A (ACUP01009998), and the like. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

[0074] An inducible promoter, for instance, a pathogen-inducible promoter could also be employed. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO 99/43819, herein incorporated by reference.

[0075] Additionally, as pathogens find entry into plants through wounds or insect damage, a wound-inducible promoter may be used in the constructions of the invention. Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225:1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2):141-150); and the like, herein incorporated by reference.

[0076] Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.

[0077] Tissue-preferred promoters can be utilized to target enhanced expression within a particular plant tissue. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196; Orozco et al. (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.

[0078] In one embodiment, the various silencing elements disclosed herein are expressed using a seed-preferred promoter. "Seed-preferred" promoters include both "seed-specific" promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as "seed-germinating" promoters (those promoters active during seed germination). See Thompson et al. (1989) BioEssays 10:108, herein incorporated by reference. Such seed-preferred promoters include, but are not limited to, Cim1 (cytokinin-induced message); Kunitz trypsin inhibitor 3 (kti3) (Genbank accession AF233296); glycinin-1 genes (Genbank accession AB353075.1); cZ19B1 (maize 19 kDa zein); milps (myo-inositol-1-phosphate synthase) (see WO 00/11177 and U.S. Pat. No. 6,225,529; herein incorporated by reference). Gamma-zein is an endosperm-specific promoter. Globulin 1 (Glb-1) is a representative embryo-specific promoter. For dicots, seed-preferred promoters include, but are not limited to, bean .beta.-phaseolin, napin, .beta.-conglycinin alpha (Genbank accession GU723691), soybean lectin, cruciferin, and the like. For monocots, seed-preferred promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, gamma-zein, waxy, shrunken 1, shrunken 2, Globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from end1 and end2 genes are disclosed; herein incorporated by reference.

[0079] Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.

[0080] Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991) Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also Bogusz et al. (1990) Plant Cell 2(7):633-641, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a .beta.-glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved. Leach and Aoyagi (1991) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes (see Plant Science (Limerick) 79(1):69-76). They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters. Teeri et al. (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2' gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The TR1' gene, fused to nptll (neomycin phosphotransferase II) showed similar characteristics. Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant Mol. Biol. 29(4):759-772); and rolB promoter (Capana et al. (1994) Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and 5,023,179.

[0081] In one embodiment of this invention the plant-expressed promoter is a vascular-specific promoter such as a phloem-specific promoter. A "vascular-specific" promoter, as used herein, is a promoter which is at least expressed in vascular cells, or a promoter which is preferentially expressed in vascular cells. Expression of a vascular-specific promoter need not be exclusively in vascular cells, expression in other cell types or tissues is possible. A "phloem-specific promoter" as used herein, is a plant-expressible promoter which is at least expressed in phloem cells, or a promoter which is preferentially expressed in phloem cells.

[0082] Expression of a phloem-specific promoter need not be exclusively in phloem cells, expression in other cell types or tissues, e.g., xylem tissue, is possible. In one embodiment of this invention, a phloem-specific promoter is a plant-expressible promoter at least expressed in phloem cells, wherein the expression in non-phloem cells is more limited (or absent) compared to the expression in phloem cells. Examples of suitable vascular-specific or phloem-specific promoters in accordance with this invention include but are not limited to the promoters selected from the group consisting of: the SCSV3, SCSV4, SCSVS, and SCSV7 promoters (Schunmann et al. (2003) Plant Functional Biology 30:453-60; the rolC gene promoter of Agrobacterium rhizogenes (Kiyokawa et al. (1994) Plant Physiology 104:801-02; Pandolfini et al. (2003) BioMedCentral (BMC) Biotechnology 3:7, (www.biomedcentral.com/1472-6750/3/7); Graham et al. (1997) Plant Mol. Biol. 33:729-35; Guivarc'h et al. (1996); Almon et al. (1997) Plant Physiol. 115:1599-607; the rolA gene promoter of Agrobacterium rhizogenes (Dehio et al. (1993) Plant Mol. Biol. 23:1199-210); the promoter of the Agrobacterium tumefaciens T-DNA gene 5 (Korber et al. (1991) EMBO J. 10:3983-91); the rice sucrose synthase RSs1 gene promoter (Shi et al. (1994) J. Exp. Bot. 45:623-31); the CoYMV or Commelina yellow mottle badnavirus promoter (Medberry et al. (1992) Plant Cell 4:185-92; Zhou et al. (1998) Chin. J. Biotechnol. 14:9-16); the CFDV or coconut foliar decay virus promoter (Rohde et al. (1994) Plant Mol. Biol. 27:623-28; Hehn and Rhode (1998) J. Gen. Virol. 79:1495-99); the RTBV or rice tungro bacilliform virus promoter (Yin and Beachy (1995) Plant J. 7:969-80; Yin et al. (1997) Plant J. 12:1179-80); the pea glutamin synthase GS3A gene (Edwards et al. (1990) Proc. Natl. Acad. Sci. USA 87:3459-63; Brears et al. (1991) Plant J. 1:235-44); the inv CD111 and inv CD141 promoters of the potato invertase genes (Hedley et al. (2000) J. Exp. Botany 51:817-21); the promoter isolated from Arabidopsis shown to have phloem-specific expression in tobacco by Kertbundit et al. (1991) Proc. Natl. Acad. Sci. USA 88:5212-16); the VAHOX1 promoter region (Tornero et al. (1996) Plant J. 9:639-48); the pea cell wall invertase gene promoter (Zhang et al. (1996) Plant Physiol. 112:1111-17); the promoter of the endogenous cotton protein related to chitinase of US published patent application 20030106097, an acid invertase gene promoter from carrot (Ramloch-Lorenz et al. (1993) The Plant J. 4:545-54); the promoter of the sulfate transporter geneSultrl; 3 (Yoshimoto et al. (2003) Plant Physiol. 131:1511-17); a promoter of a sucrose synthase gene (Nolte and Koch (1993) Plant Physiol. 101:899-905); and the promoter of a tobacco sucrose transporter gene (Kuhn et al. (1997) Science 275-1298-1300).

[0083] Possible promoters also include the Black Cherry promoter for Prunasin Hydrolase (PH DL1.4 PRO) (U.S. Pat. No. 6,797, 859), Thioredoxin H promoter from cucumber and rice (Fukuda A et al. (2005). Plant Cell Physiol. 46(11):1779-86), Rice (RSs1) (Shi, T. Wang et al. (1994). J. Exp. Bot. 45(274): 623-631) and maize sucrose synthese -1 promoters (Yang., N-S. et al. (1990) PNAS 87:4144-4148), PP2 promoter from pumpkin Guo, H. et al. (2004) Transgenic Research 13:559-566), At SUC2 promoter (Truernit, E. et al. (1995) Planta 196(3):564-70., At SAM-1 (S-adenosylmethionine synthetase) (Mijnsbrugge KV. et al. (1996) Planr. Cell. Physiol. 37(8): 1108-1115), and the Rice tungro bacilliform virus (RTBV) promoter (Bhattacharyya-Pakrasi et al. (1993) Plant J. 4(1):71-79).

[0084] The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as .beta.-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and yellow florescent protein (PhiYFP.TM. from Evrogen, see, Bolte et al. (2004) J. Cell Science 117:943-54). For additional selectable markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge etal. (1988) Cell 52:713-722; Deuschle etal. (1989) Proc. Natl. Acad. Sci. USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference. The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the present invention.

VI. Compositions Comprising Silencing Elements

[0085] One or more of the polynucleotides comprising the silencing element can be provided as an external composition such as a spray or powder to the plant, plant part, seed, a pest, or an area of cultivation. In another example, a plant is transformed with a DNA construct or expression cassette for expression of at least one silencing element. In either composition, the silencing element, when ingested by an insect, can reduce the level of a target pest sequence and thereby control the pest (i.e., a Pentatomidae plant pest including a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys. It is recognized that the composition can comprise a cell (such as plant cell or a bacterial cell), in which a polynucleotide encoding the silencing element is stably incorporated into the genome and operably linked to promoters active in the cell. Compositions comprising a mixture of cells, some cells expressing at least one silencing element are also encompassed. In other embodiments, compositions comprising the silencing elements are not contained in a cell. In such embodiments, the composition can be applied to an area inhabited by a pest. In one embodiment, the composition is applied externally to a plant (i.e., by spraying a field or area of cultivation) to protect the plant from the pest.

[0086] The composition of the invention can further be formulated as bait. In this embodiment, the compositions comprise a food substance or an attractant which enhances the attractiveness of the composition to the pest.

[0087] The composition comprising the silencing element can be formulated in an agriculturally suitable and/or environmentally acceptable carrier. Such carriers can be any material that the animal, plant or environment to be treated can tolerate. Furthermore, the carrier must be such that the composition remains effective at controlling a pest. Examples of such carriers include water, saline, Ringer's solution, dextrose or other sugar solutions, Hank's solution, and other aqueous physiologically balanced salt solutions, phosphate buffer, bicarbonate buffer and Tris buffer. In addition, the composition may include compounds that increase the half-life of a composition.

[0088] It is recognized that the polynucleotides comprising sequences encoding the silencing element can be used to transform organisms to provide for host organism production of these components, and subsequent application of the host organism to the environment of the target pest(s). Such host organisms include baculoviruses, bacteria, and the like. In this manner, the combination of polynucleotides encoding the silencing element may be introduced via a suitable vector into a microbial host, and said host applied to the environment, or to plants or animals.

[0089] The term "introduced" in the context of inserting a nucleic acid into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be stably incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0090] Microbial hosts that are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or rhizoplana) of one or more crops of interest may be selected. These microorganisms are selected so as to be capable of successfully competing in the particular environment with the wild-type microorganisms, provide for stable maintenance and expression of the sequences encoding the silencing element, and desirably, provide for improved protection of the components from environmental degradation and inactivation.

[0091] Such microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms such as bacteria, e.g., Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes, fungi, particularly yeast, e.g., Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacteria, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, Clavibacter xyli and Azotobacter vinlandir, and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces rosues, S. odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms.

[0092] A number of ways are available for introducing the polynucleotide comprising the silencing element into the microbial host under conditions that allow for stable maintenance and expression of such nucleotide encoding sequences. For example, expression cassettes can be constructed which include the nucleotide constructs of interest operably linked with the transcriptional and translational regulatory signals for expression of the nucleotide constructs, and a nucleotide sequence homologous with a sequence in the host organism, whereby integration will occur, and/or a replication system that is functional in the host, whereby integration or stable maintenance will occur.

[0093] Transcriptional and translational regulatory signals include, but are not limited to, promoters, transcriptional initiation start sites, operators, activators, enhancers, other regulatory elements, ribosomal binding sites, an initiation codon, termination signals, and the like. See, for example, U.S. Pat. Nos. 5,039,523 and 4,853,331; EPO 0480762A2; Sambrook et al. (2000); Molecular Cloning: A Laboratory Manual (3rd ed.; Cold Spring Harbor Laboratory Press, Plainview, N.Y.); Davis et al. (1980) Advanced Bacterial Genetics (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); and the references cited therein.

[0094] Suitable host cells include the prokaryotes and the lower eukaryotes, such as fungi. Illustrative prokaryotes, both Gram-negative and Gram-positive, include Enterobacteriaceae, such as Escherichia, Erwinia, Shigella, Salmonella, and Proteus; Bacillaceae; Rhizobiceae, such as Rhizobium; Spirillaceae, such as photobacterium, Zymomonas , Serratia, Aeromonas, Vibrio, Desulfovibrio, Spirillum; Lactobacillaceae; Pseudomonadaceae, such as Pseudomonas and Acetobacter; Azotobacteraceae and Nitrobacteraceae. Among eukaryotes are fungi, such as Phycomycetes and Ascomycetes, which includes yeast, such as Saccharomyces and Schizosaccharomyces; and Basidiomycetes yeast, such as Rhodotorula, Aureobasidium, Sporobolomyces, and the like.

[0095] Characteristics of particular interest in selecting a host cell for purposes of the invention include ease of introducing the coding sequence into the host, availability of expression systems, efficiency of expression, stability in the host, and the presence of auxiliary genetic capabilities. Characteristics of interest for use as a pesticide microcapsule include protective qualities, such as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; leaf affinity; lack of mammalian toxicity; attractiveness to pests for ingestion; and the like. Other considerations include ease of formulation and handling, economics, storage stability, and the like.

[0096] Host organisms of particular interest include yeast, such as Rhodotorula spp., Aureobasidium spp., Saccharomyces spp., and Sporobolomyces spp., phylloplane organisms such as Pseudomonas spp., Erwinia spp., and Flavobacterium spp., and other such organisms, including Pseudomonas aeruginosa, Pseudomonas fluorescens, Saccharomyces cerevisiae, Bacillus thuringiensis, Escherichia coli, Bacillus subtilis, and the like.

[0097] The sequences encoding the silencing elements encompassed by the invention can be introduced into microorganisms that multiply on plants (epiphytes) to deliver these components to potential target pests. Epiphytes, for example, can be gram-positive or gram-negative bacteria.

[0098] The silencing element can be fermented in a bacterial host and the resulting bacteria processed and used as a microbial spray in the same manner that Bacillus thuringiensis strains have been used as insecticidal sprays. Any suitable microorganism can be used for this purpose. Pseudomonas has been used to express Bacillus thuringiensis endotoxins as encapsulated proteins and the resulting cells processed and sprayed as an insecticide Gaertner et al. (1993), in Advanced Engineered Pesticides, ed. L. Kim (Marcel Decker, Inc.).

[0099] Alternatively, the components of the invention are produced by introducing heterologous genes into a cellular host. Expression of the heterologous sequences results, directly or indirectly, in the intracellular production of the silencing element. These compositions may then be formulated in accordance with conventional techniques for application to the environment hosting a target pest, e.g., soil, water, and foliage of plants. See, for example, EPA 0192319, and the references cited therein.

[0100] In the present invention, a transformed microorganism can be formulated with an acceptable carrier into separate or combined compositions that are, for example, a suspension, a solution, an emulsion, a dusting powder, a dispersible granule, a wettable powder, and an emulsifiable concentrate, an aerosol, an impregnated granule, an adjuvant, a coatable paste, and also encapsulations in, for example, polymer substances.

[0101] Such compositions disclosed above may be obtained by the addition of a surface-active agent, an inert carrier, a preservative, a humectant, a feeding stimulant, an attractant, an encapsulating agent, a binder, an emulsifier, a dye, a UV protectant, a buffer, a flow agent or fertilizers, micronutrient donors, or other preparations that influence plant growth. One or more agrochemicals including, but not limited to, herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, acaracides, plant growth regulators, harvest aids, and fertilizers, can be combined with carriers, surfactants or adjuvants customarily employed in the art of formulation or other components to facilitate product handling and application for particular target pests. Suitable carriers and adjuvants can be solid or liquid and correspond to the substances ordinarily employed in formulation technology, e.g., natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, binders, or fertilizers. The active ingredients of the present invention (i.e., at least one silencing element) are normally applied in the form of compositions and can be applied to the crop area, plant, or seed to be treated. For example, the compositions may be applied to grain in preparation for or during storage in a grain bin or silo, etc. The compositions may be applied simultaneously or in succession with other compounds. Methods of applying an active ingredient or a composition that contains at least one silencing element include, but are not limited to, foliar application, seed coating, and soil application. The number of applications and the rate of application depend on the intensity of infestation by the corresponding pest.

[0102] Suitable surface-active agents include, but are not limited to, anionic compounds such as a carboxylate of, for example, a metal; carboxylate of a long chain fatty acid; an N-acylsarcosinate; mono- or di-esters of phosphoric acid with fatty alcohol ethoxylates or salts of such esters; fatty alcohol sulfates such as sodium dodecyl sulfate, sodium octadecyl sulfate, or sodium cetyl sulfate; ethoxylated fatty alcohol sulfates; ethoxylated alkylphenol sulfates; lignin sulfonates; petroleum sulfonates; alkyl aryl sulfonates such as alkyl-benzene sulfonates or lower alkylnaphtalene sulfonates, e.g., butyl-naphthalene sulfonate; salts of sulfonated naphthalene-formaldehyde condensates; salts of sulfonated phenol-formaldehyde condensates; more complex sulfonates such as the amide sulfonates, e.g., the sulfonated condensation product of oleic acid and N-methyl taurine; or the dialkyl sulfosuccinates, e.g., the sodium sulfonate or dioctyl succinate. Non-ionic agents include condensation products of fatty acid esters, fatty alcohols, fatty acid amides or fatty-alkyl- or alkenyl-substituted phenols with ethylene oxide, fatty esters of polyhydric alcohol ethers, e.g., sorbitan fatty acid esters, condensation products of such esters with ethylene oxide, e.g., polyoxyethylene sorbitan fatty acid esters, block copolymers of ethylene oxide and propylene oxide, acetylenic glycols such as 2,4,7,9-tetraethyl-5-decyn-4,7-diol, or ethoxylated acetylenic glycols. Examples of a cationic surface-active agent include, for instance, an aliphatic mono-, di-, or polyamine such as an acetate, naphthenate or oleate; or oxygen-containing amine such as an amine oxide of polyoxyethylene alkylamine; an amide-linked amine prepared by the condensation of a carboxylic acid with a di- or polyamine; or a quaternary ammonium salt.

[0103] Examples of inert materials include, but are not limited to, inorganic minerals such as kaolin, phyllosilicates, carbonates, sulfates, phosphates, or botanical materials such as cork, powdered corncobs, peanut hulls, rice hulls, and walnut shells.

[0104] The compositions comprising the silencing element can be in a suitable form for direct application or as a concentrate of primary composition that requires dilution with a suitable quantity of water or other dilutant before application.

[0105] The compositions (including the transformed microorganisms) can be applied to the environment of an insect pest (such as a Pentatomidae plant pest or a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest) by, for example, spraying, atomizing, dusting, scattering, coating or pouring, introducing into or on the soil, introducing into irrigation water, by seed treatment or general application or dusting at the time when the pest has begun to appear or before the appearance of pests as a protective measure. For example, the composition(s) and/or transformed microorganism(s) may be mixed with grain to protect the grain during storage. It is generally important to obtain good control of pests in the early stages of plant growth, as this is the time when the plant can be most severely damaged. The compositions can conveniently contain another insecticide if this is thought necessary. In an embodiment of the invention, the composition(s) is applied directly to the soil, at a time of planting, in granular form of a composition of a carrier and dead cells of a Bacillus strain or transformed microorganism of the invention. Another embodiment is a granular form of a composition comprising an agrochemical such as, for example, a herbicide, an insecticide, a fertilizer, in an inert carrier, and dead cells of a Bacillus strain or transformed microorganism of the invention.

VII. Plants, Plant Parts, and Methods of Introducing Sequences into Plants

[0106] The methods of the invention involve introducing a polynucleotide into a plant. In one embodiment, a plant cell is provided having stably incorporated into its genome a heterologous polynucleotide comprising any of the various silencing elements provided herein. It is recognized that the silencing element, when ingested by a Pentatomidae plant pest, can reduce the level of expression of any of the target sequences descrbed herein (i.e. SEQ ID NOS: 1-292 or 302-304). "Introducing" is intended to mean presenting to the plant the polynucleotide in such a manner that the sequence gains access to the interior of a cell of the plant. The methods of the invention do not depend on a particular method for introducing a sequence into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0107] "Stable transformation" is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. "Transient transformation" is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.

[0108] Transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated transformation (U.S. Pat. No. 5,563,055 and U.S. Pat. No. 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, U.S. Pat. Nos. 4,945,050; U.S. Pat. No. 5,879,918; U.S. Pat. No. 5,886,244; and, 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lec1 transformation (WO 00/28058). Also see Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); U.S. Pat. Nos. 5,240,855; 5,322,783; and, 5,324,646; Klein et al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.

[0109] In specific embodiments, the silencing element sequences of the invention can be provided to a plant using a variety of transient transformation methods. Such transient transformation methods include, but are not limited to, the introduction of the protein or variants and fragments thereof directly into the plant or the introduction of the transcript into the plant. Such methods include, for example, microinjection or particle bombardment. See, for example, Crossway et al. (1986) Mol Gen. Genet. 202:179-185; Nomura et al. (1986) Plant Sci. 44:53-58; Hepler et al. (1994) Proc. Natl. Acad. Sci. 91: 2176-2180 and Hush et al. (1994) The Journal of Cell Science 107:775-784, all of which are herein incorporated by reference. Alternatively, polynucleotides can be transiently transformed into the plant using techniques known in the art. Such techniques include viral vector system and the precipitation of the polynucleotide in a manner that precludes subsequent release of the DNA. Thus, the transcription from the particle-bound DNA can occur, but the frequency with which it is released to become integrated into the genome is greatly reduced. Such methods include the use of particles coated with polyethylimine (PEI; Sigma #P3143).

[0110] In other embodiments, the polynucleotide of the invention may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that promoters of the invention also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and Porta et al. (1996) Molecular Biotechnology 5:209-221; herein incorporated by reference.

[0111] Methods are known in the art for the targeted insertion of a polynucleotide at a specific location in the plant genome. In one embodiment, the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system. See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference. Briefly, the polynucleotide of the invention can be contained in transfer cassette flanked by two non-recombinogenic recombination sites. The transfer cassette is introduced into a plant having stably incorporated into its genome a target site which is flanked by two non-recombinogenic recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.

[0112] The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting progeny having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as "transgenic seed") having a polynucleotide of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.

[0113] As used herein, the term plant also includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the introduced polynucleotides.

[0114] The present invention may be used for transformation of any plant species, including, but not limited to, monocots and dicots. Examples of plant species of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.

[0115] Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.

[0116] Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). In specific embodiments, plants of the present invention are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.). In other embodiments, corn and soybean plants and sugarcane plants are optimal, and in yet other embodiments corn plants are optimal.

[0117] Other plants of interest include grain plants that provide seeds of interest, oil-seed plants, and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.

[0118] In specific embodiments, the plants/plant cells and/or seeds comprising an expression construct comprise a silencing element directed to a target sequence provided herein (i.e. SEQ ID NOS: 1-292 or 302-304) operably linked to a seed-preferred promoter.

VIII. Methods of Use

[0119] The methods of the invention comprise methods for controlling a pest (i.e., a Pentatomidae plant pest, such as, N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest). The method comprises feeding to a pest a composition comprising a silencing element of the invention, wherein said silencing element, when ingested by a pest (i.e., a Pentatomidae plant pest including N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys), reduces the level of a target polynucleotide of the pest and thereby controls the pest. The pest can be fed the silencing element in a variety of ways. For example, in one embodiment, the polynucleotide comprising the silencing element is introduced into a plant. As the Pentatomidae plant pest or N. viridula, Acrosternum hilare, Piezodorus guildini, and/or Halymorpha halys plant pest feeds on the plant or part thereof expressing these sequences, the silencing element is delivered to the pest. When the silencing element is delivered to the plant in this manner, it is recognized that the silencing element can be expressed constitutively or alternatively, it may be produced in a stage-specific manner by employing the various inducible or tissue-preferred or developmentally regulated promoters that are discussed elsewhere herein. In one embodiment, the silencing element is operably linked to a seed-preferred promoter. In specific embodiments, the silencing element expressed in the roots, stalk or stem, leaf including pedicel, xylem and phloem, fruit or reproductive tissue, silk, flowers and all parts therein or any combination thereof.

[0120] In another method, a composition comprising at least one silencing element of the invention is applied to a plant. In such embodiments, the silencing element can be formulated in an agronomically suitable and/or environmentally acceptable carrier, which is preferably, suitable for dispersal in fields. In addition, the carrier can also include compounds that increase the half life of the composition. In specific embodiments, the composition comprising the silencing element is formulated in such a manner such that it persists in the environment for a length of time sufficient to allow it to be delivered to a pest. In such embodiments, the composition can be applied to an area inhabited by a pest. In one embodiment, the composition is applied externally to a plant (i.e., by spraying a field) to protect the plant from pests.

[0121] In certain embodiments, the constructs of the present invention can be stacked with any combination of polynucleotide sequences of interest in order to create plants with a desired trait. A trait, as used herein, refers to the phenotype derived from a particular sequence or groups of sequences. For example, the polynucleotides of the present invention may be stacked with any other polynucleotides encoding polypeptides having pesticidal and/or insecticidal activity, such as other Bacillus thuringiensis toxic proteins (described in U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; and Geiser et al. (1986) Gene 48:109), lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825, pentin (described in U.S. Pat. No. 5,981,722), and the like. The combinations generated can also include multiple copies of any one of the polynucleotides of interest. The polynucleotides of the present invention can also be stacked with any other gene or combination of genes to produce plants with a variety of desired trait combinations including, but not limited to, traits desirable for animal feed such as high oil genes (e.g., U.S. Pat. No. 6,232,529); balanced amino acids (e.g., hordothionins (U.S. Pat. Nos. 5,990,389; 5,885,801; 5,885,802; and 5,703,409); barley high lysine (Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO 98/20122) and high methionine proteins (Pedersen et al. (1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; and Musumura et al. (1989) Plant Mol. Biol. 12:123)); increased digestibility (e.g., modified storage proteins (U.S. application Ser. No. 10/053,410, filed Nov. 7, 2001); and thioredoxins (U.S. application Ser. No. 10/005,429, filed Dec. 3, 2001)); the disclosures of which are herein incorporated by reference.

[0122] The polynucleotides of the present invention can also be stacked with traits desirable for disease or herbicide resistance (e.g., fumonisin detoxification genes (U.S. Pat. No. 5,792,931); avirulence and disease resistance genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al. (1994) Cell 78:1089); acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations; inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance (EPSPS gene)); and traits desirable for processing or process products such as high oil (e.g., U.S. Pat. No. 6,232,529); modified oils (e.g., fatty acid desaturase genes (U.S. Pat. No. 5,952,544; WO 94/11516)); modified starches (e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE), and starch debranching enzymes (SDBE)); and polymers or bioplastics (e.g., U.S. Pat. No. 5.602,321; beta-ketothiolase, polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-5847) facilitate expression of polyhydroxyalkanoates (PHAs)); the disclosures of which are herein incorporated by reference. One could also combine the polynucleotides of the present invention with polynucleotides providing agronomic traits such as male sterility (e.g., see U.S. Pat. No. 5.583,210), stalk strength, flowering time, or transformation technology traits such as cell cycle regulation or gene targeting (e.g., WO 99/61619, WO 00/17364, and WO 99/25821); the disclosures of which are herein incorporated by reference.

[0123] These stacked combinations can be created by any method including, but not limited to, cross-breeding plants by any conventional or TopCross methodology, or genetic transformation. If the sequences are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences will be introduced, the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of the polynucleotide of interest. This may be combined with any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant. It is further recognized that polynucleotide sequences can be stacked at a desired genomic location using a site-specific recombination system. See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference.

[0124] Methods and compositions are further provided which allow for an increase in RNAi produced from the silencing element. In such embodiments, the methods and compositions employ a first polynucleotide comprising a silencing element for a target pest sequence operably linked to a promoter active in the plant cell; and, a second polynucleotide comprising a suppressor enhancer element comprising the target pest sequence or an active variant or fragment thereof operably linked to a promoter active in the plant cell. The combined expression of the silencing element with suppressor enhancer element leads to an increased amplification of the inhibitory RNA produced from the silencing element over that achievable with only the expression of the silencing element alone. In addition to the increased amplification of the specific RNAi species itself, the methods and compositions further allow for the production of a diverse population of RNAi species that can enhance the effectiveness of disrupting target gene expression. As such, when the suppressor enhancer element is expressed in a plant cell in combination with the silencing element, the methods and composition can allow for the systemic production of RNAi throughout the plant; the production of greater amounts of RNAi than would be observed with just the silencing element construct alone; and, the improved loading of RNAi into the phloem of the plant, thus providing better control of phloem feeding insects by an RNAi approach. Thus, the various methods and compositions provide improved methods for the delivery of inhibitory RNA to the target organism. See, for example, U.S. application Ser. No. 12/351,093, entitled "Compositions and Methods for the Suppression of Target Polynucleotides", filed Jan. 9, 2009 and herein incorporated by reference in its entirety.

[0125] As used herein, a "suppressor enhancer element" comprises a polynucleotide comprising the target sequence to be suppressed or an active fragment or variant thereof. It is recognize that the suppressor enhancer element need not be identical to the target sequence, but rather, the suppressor enhancer element can comprise a variant of the target sequence, so long as the suppressor enhancer element has sufficient sequence identity to the target sequence to allow for an increased level of the RNAi produced by the silencing element over that achievable with only the expression of the silencing element. Similarly, the suppressor enhancer element can comprise a fragment of the target sequence, wherein the fragment is of sufficient length to allow for an increased level of the RNAi produced by the silencing element over that achievable with only the expression of the silencing element. Thus, in specific embodiments, the suppressor enhancer element comprises a polynucleotide set forth in SEQ ID NO: 1-292, or 302-304 or an active variant or fragment thereof.

[0126] It is recognized that multiple suppressor enhancer elements from the same target sequence or from different target sequences, or from different regions of the same target sequence can be employed. For example, the suppressor enhancer elements employed can comprise fragments of the target sequence derived from different region of the target sequence (i.e., from the 3'UTR, coding sequence, intron, and/or 5'UTR). Further, the suppressor enhancer element can be contained in an expression cassette, as described elsewhere herein, and in specific embodiments, the suppressor enhancer element is on the same or on a different DNA vector or construct as the silencing element. The suppressor enhancer element can be operably linked to a promoter as disclosed herein. It is recognized that the suppressor enhancer element can be expressed constitutively or alternatively, it may be produced in a stage-specific manner employing the various inducible or tissue-preferred or developmentally regulated promoters that are discussed elsewhere herein.

[0127] In specific embodiments, employing both a silencing element and the suppressor enhancer element the systemic production of RNAi occurs throughout the entire plant. In further embodiments, the plant or plant parts of the invention have an improved loading of RNAi into the phloem of the plant than would be observed with the expression of the silencing element construct alone and, thus provide better control of phloem feeding insects by an RNAi approach. In specific embodiments, the plants, plant parts, and plant cells of the invention can further be characterized as allowing for the production of a diversity of RNAi species that can enhance the effectiveness of disrupting target gene expression.

[0128] In specific embodiments, the combined expression of the silencing element and the suppressor enhancer element increases the concentration of the inhibitory RNA in the plant cell, plant, plant part, plant tissue or phloem over the level that is achieved when the silencing element is expressed alone.

[0129] As used herein, an "increased level of inhibitory RNA" comprises any statistically significant increase in the level of RNAi produced in a plant having the combined expression when compared to an appropriate control plant. For example, an increase in the level of RNAi in the plant, plant part or the plant cell can comprise at least about a 1%, about a 1%-5%, about a 5% -10%, about a 10%-20%, about a 20%-30%, about a 30%-40%, about a 40%-50%, about a 50%-60%, about 60-70%, about 70%-80%, about a 80%-90%, about a 90%-100% or greater increase in the level of RNAi in the plant, plant part, plant cell, or phloem when compared to an appropriate control. In other embodiments, the increase in the level of RNAi in the plant, plant part, plant cell, or phloem can comprise at least about a 1 fold, about a 1 fold-5 fold, about a 5 fold -10 fold, about a 10 fold-20 fold, about a 20 fold -30 fold, about a 30 fold -40 fold, about a 40 fold-50 fold, about a 50 fold-60 fold, about 60 fold -70 fold, about 70 fold-80 fold, about a 80 fold-90 fold, about a 90 fold-100 fold or greater increase in the level of RNAi in the plant, plant part, plant cell or phloem when compared to an appropriate control. Methods to assay for an increase in the level of RNAi are discussed elsewhere herein.

[0130] Non-limiting examples of methods and compositions disclosed herein are as follows: [0131] 1. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0132] (a) the nucleotide sequence comprising any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof;

[0133] (b) the nucleotide sequence comprising at least 90% sequence identity to any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof, wherein said polynucleotide encodes a silencing element having insecticidal activity against a Pentatomidae plant pest;

[0134] (c) the nucleotide sequence comprising at least 19 consecutive nucleotides of any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof, wherein said polynucleotide encodes a silencing element having insecticidal activity against a Pentatomidae plant pest; and,

[0135] (d) the nucleotide sequence that hybridizes under stringent conditions to the full length complement of the nucleotide sequence of a), wherein said stringent conditions comprise hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times. SSC at 60.degree. C. to 65.degree. C., wherein said polynucleotide encodes a silencing element having insecticidal activity against a Pentatomidae plant pest. [0136] 2. The isolated polynucleotide of embodiment 1, wherein said Pentatomidae plant pest is a N. viridula plant pest. [0137] 3. An expression cassette comprising a heterologous polynucleotide of embodiment 1 or 2 operably linked to a seed-preferred promoter. [0138] 4. The expression cassette of embodiment 3, wherein said polynucleotide is expressed as a double stranded RNA. [0139] 5. The expression cassette of embodiment 3, wherein said polynucleotide comprise a silencing element which is expressed as a hairpin RNA. [0140] 6. The expression cassette of embodiment 5, wherein the silencing element comprises, in the following order, a first segment, a second segment, and a third segment, wherein

[0141] a) said first segment comprises at least about 19 nucleotides having at least 90% sequence complementarity to a target sequence set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263;

[0142] b) said second segment comprises a loop of sufficient length to allow the silencing element to be transcribed as a hairpin RNA; and,

[0143] c) said third segment comprises at least about 19 nucleotides having at least 85% complementarity to the first segment. [0144] 7. The expression cassette of embodiment 6, wherein said target sequence comprises the sequences set forth any one of SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 337, 338, 339, 340, 341, 342, 343 or 344 or a sequence having at least 90% sequence identity to SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 337, 338, 339, 340, 341, 342, 343 or 344. [0145] 8. The expression cassette of embodiment 6, wherein said expression cassette comprises any one of SEQ ID NOS: 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328. [0146] 9. The expression cassette of embodiment 3, wherein said polynucleotide is flanked by a first operably linked convergent promoter at one terminus of the polynucleotide and a second operably linked convergent promoter at the opposing terminus of the polynucleotide, wherein the first and the second convergent promoters are capable of driving expression of the polynucleotide. [0147] 10. A host cell comprising a heterologous expression cassette of any one of embodiments 3-9. [0148] 11. A plant cell having stably incorporated into its genome a heterologous polynucleotide comprising a silencing element operably linked to a seed-preferred promoter, wherein said silencing element, when ingested by a Pentatomidae plant pest, reduces the level of expression of any one of the target sequences set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 in said Pentatomidae plant pest and thereby controls the Pentatomidae plant pest. [0149] 12. The plant cell of embodiment 11, wherein said silencing element comprises

[0150] a) a fragment of at least 19 consecutive nucleotides of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof; or,

[0151] b) the nucleotide sequence comprising at least 90% sequence identity to any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof,

[0152] wherein said silencing element, when ingested by a Pentatomidae plant pest, reduces the level of a target sequence in said Pentatomidae plant pest and thereby controls the Pentatomidae plant pest. [0153] 13. The plant cell of embodiment 12, wherein the Pentatomidae plant pest is a N. viridula plant pest. [0154] 14. The plant cell of any one of embodiment 11, 12 or 13, wherein said silencing element comprises the sequences set forth in any one of SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 305, 306, 307, 308, 309, 310, 311, 312, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343 or 344 or a complement thereof. [0155] 15. The plant cell of embodiment 11-14, wherein said plant cell comprises the expression cassette of embodiment 9. [0156] 16. The plant cell of any one of embodiments 11-14, wherein said silencing element expresses a double stranded RNA. [0157] 17. The plant cell of any one of embodiments 11-15, wherein said silencing element expresses a hairpin RNA. [0158] 18. The plant cell of embodiment 17, wherein said polynucleotide comprising the silencing element comprises, in the following order, a first segment, a second segment, and a third segment, wherein

[0159] a) said first segment comprises at least about 19 nucleotides having at least 90% sequence complementarity to a target sequence set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328;

[0160] b) said second segment comprises a loop of sufficient length to allow the silencing element to be transcribed as a hairpin RNA; and,

[0161] c) said third segment comprises at least about 19 nucleotides having at least 85% complementarity to the first segment. [0162] 19. The plant cell of any one of embodiments 11-18, wherein said plant cell is from a monocot. [0163] 20. The plant cell of embodiment 19, wherein said monocot is maize, barley, millet, wheat or rice. [0164] 21. The plant cell of any one of embodiments 11-18, wherein said plant cell is from a dicot. [0165] 22. The plant cell of embodiment 21, wherein said plant is soybean, canola, alfalfa, sunflower, safflower, tobacco, Arabidopsis, or cotton. [0166] 23. A plant or plant part comprising a plant cell of any one of embodiments 11-22. [0167] 24. A transgenic seed from the plant of embodiment 23, wherein said transgenic seed comprises said heterologous polynucleotide comprising said silencing element. [0168] 25. A method of controlling a Pentatomidae plant pest comprising feeding to a Pentatomidae plant pest a composition comprising a silencing element, wherein said silencing element, when ingested by said Pentatomidae plant pest, reduces the level of expression of any one of the target Pentatomidae plant pest sequences set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 and thereby controls the Pentatomidae plant pest. [0169] 26. The method of embodiment 25, wherein said silencing element comprises

[0170] a) a fragment of at least 19 consecutive nucleotides of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof; or,

[0171] b) the nucleotide sequence comprising at least 90% sequence identity to any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof, wherein said silencing element, when ingested by a Pentatomidae plant pest, reduces the level of a target sequence in said Pentatomidae plant pest and thereby controls the Pentatomidae plant pest. [0172] 27. The method of embodiment 26, wherein said Pentatomidae plant pest comprises a N. viridula plant pest. 28. The method of any one of embodiments 26 or 27, wherein said silencing element comprises the sequence set forth in any one of SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 305, 306, 307, 308, 309, 310, 311, 312, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343 or 344 or a complement thereof. [0173] 29. The method of any one of embodiments 25-28, wherein said composition comprises a plant or plant part having stably incorporated into its genome a polynucleotide comprising said silencing element, wherein said silencing element is operably linked to a seed-preferred promoter. [0174] 30. The method of any one of embodiments 25-29, wherein said silencing element comprises

[0175] a) a polynucleotide comprising the sense or antisense sequence of the sequence set forth in SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18, 263, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311 or 312 or a complement thereof; or,

[0176] b) a polynucleotide comprising the sense or antisense sequence of a sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18, 263, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311 or 312 or a complement thereof; [0177] 31. The method of any one of embodiments 25-30, wherein said silencing element expresses a double stranded RNA. [0178] 32. The method of any one of embodiments 25-30, wherein said silencing element comprises a hairpin RNA. [0179] 33. The method of embodiment 32, wherein said polynucleotide comprising the silencing element comprises, in the following order, a first segment, a second segment, and a third segment, wherein

[0180] a) said first segment comprises at least about 20 nucleotides having at least 90% sequence complementarity to the target polynucleotide;

[0181] b) said second segment comprises a loop of sufficient length to allow the silencing element to be transcribed as a hairpin RNA; and,

[0182] c) said third segment comprises at least about 20 nucleotides having at least 85% complementarity to the first segment. [0183] 34. The method of any one of embodiments 29-30, wherein said silencing element is flanked by a first operably linked convergent promoter at one terminus of the silencing element and a second operably linked convergent promoter at the opposing terminus of the polynucleotide, wherein the first and the second convergent promoters are capable of driving expression of the silencing element. [0184] 35. The method of embodiment 29, wherein said plant is a monocot. [0185] 36. The method of embodiment 35, wherein said monocot is maize, barley, millet, wheat or rice. [0186] 37. The method of embodiment 29, wherein said plant is a dicot. [0187] 38. The method of embodiment 37, wherein said plant is soybean, canola, alfalfa, sunflower, safflower, tobacco, Arabidopsis, or cotton.

[0188] The following examples are offered by way of illustration and not by way of limitation.

EXPERIMENTAL

Example 1

In Vitro Transcription dsRNA Screening Method

[0189] A high throughput survey of candidate genes from the stinkbug Nezara viridula was performed for their potential utility as a target for RNAi leading to mortality (insecticidal activity of RNAi). A library of over 1000 expressed sequence tags was subjected to in vitro transcription and individual samples tested against 2nd instar nymphs of N. viridula. The insects were fed the sample in an insect assay format. After 6 days, the number of dead nymphs was recorded. Table 1 provides the blast homology (Gene ID) of the various silencing elements (clone name) disclosed herein and also provides bioassay data demonstrating the insecticidal activity of the various sequences when fed to N. viridula.

TABLE-US-00001 TABLE 1 6 day score clone name Gene ID #dead/10 inv1c.pk008.f8.f no hits 10 inv1c.pk003.n13.f conserved hypothetical protein 10 inv1c.pk003.o24.f conserved hypothetical protein 7 inv1c.pk004.a3.f cathepsin L1 precursor 9 inv1c.pk004.a23.f no hits 9 inv1c.pk004.b4.f forked protein 8 inv1c.pk004.b6.f ribosomal protein L24e 9 inv1c.pk004.b17.f no hits 8 inv1c.pk004.b23.f nonspecific lipid transfer protein/sterol 9 carrier protein inv1c.pk004.c11.f soldier specific protein 7 inv1c.pk004.c12.f no hits 10 inv1c.pk004.d4.f no hits 8 inv1c.pk004.d16.f oligomycin sensitivity conferral 10 protein//ATP synthase inv1c.pk004.d17.f no hits 10 inv1c.pk004.d19.f no hits 7 inv1c.pk004.d20.f no hits 9 inv1c.pk004.e6.f mitochondrial protein PTCD3 10 inv1c.pk004.e11.f adapter molecule Crk 10 inv1c.pk004.e24.f cytochrome P450 10 inv1c.pk004.f2.f no hits 8 inv1c.pk004.f10.f no hits 7 inv1c.pk004.f12.f no hits 8 inv1c.pk004.f17.f similar to dipteran sequences 7 inv1c.pk004.f24.f no hits 8 inv1c.pk004.g13.f no hits 8 inv1c.pk004.g20.f vertebrate homology 9 inv1c.pk004.g22.f no hits 10 inv1c.pk004.g23.f no hits 8 inv1c.pk004.h18.f salivary protein 10 inv1c.pk004.h20.f lin-52 homolog 8 inv1c.pk004.h21.f cyclin t 10 inv1c.pk004.h23.f similar to complement component 1 q 9 subcomponent binding protein-like protein inv1c.pk004.h24.f similar to prefoldin subunit 10 inv1c.pk004.i1.f hsp70 10 inv1c.pk004.i4.f serine/threonine kinase 9 inv1c.pk004.i7.f no hits 9 inv1c.pk004.i14.f cytochrome P450 10 inv1c.pk005.f6.f U6 snRNA-associated Sm-like protein 7 inv1c.pk005.f8.f NADH dehydrogenase subunit 2 10 inv1c.pk005.f20.f apolipprotein D 7 inv1c.pk005.h1.f similar to Gag protein 10 inv1c.pk005.i21.f no hits 8 inv1c.pk005.j11.f no hits 8 inv1c.pk005.j17.f Homo sapiens 3 BAC RP11-666A9 9 inv1c.pk005.k12.f no hits 7 inv1c.pk005.l13.f no hits 10 inv1c.pk005.m5.f no hits 10 inv1c.pk005.m16.f similar to translation initiation factor 3, 8 subunit S8 inv1c.pk006.j24.f no hits 9 inv1c.pk006.k4.f no hits 7 inv1c.pk006.k18.f acyl-CoA binding protein 7 inv1c.pk006.k20.f E3 ubiquitin ligase/zinc finger protein 9 inv1c.pk006.k21.f no hits 8 inv1c.pk006.l7.f nervana 3/similar to 7 sodium/potassium-dependent atpase beta-2 subunit inv1c.pk006.m2.f no hits 10 inv1c.pk006.m13.f no hits 10 inv1c.pk006.o14.f no hits 10 inv1c.pk006.p4.f ubiquinol-cytochrome c reductase 10 complex 11 kDa protein inv1c.pk006.p8.f similar to ATPase inhibitor-like protein 10 inv1c.pk006.p11.f 40S ribosomal protein S7 9 inv1c.pk006.p14.f similar to Drosophila and pea aphid 10 sequences inv1c.pk007.a5.f homology to insect sequences 8 (Nasonia, Tribolium, Drosophila inv1c.pk007.b6.f no hits 9 inv1c.pk007.c6.f no hits 10 inv1c.pk007.c9.f conserved hypothetical protein 10 inv1c.pk007.d17.f putative ferritin 10 inv1c.pk007.e5.f fatty acyl-CoA elongase 10 inv1c.pk007.e21.f aldehyde dehydrogenase 9 inv1c.pk007.f1.f no hits 10 inv1c.pk007.f9.f beta-tubulin 10 inv1c.pk007.f12.f no hits 10 inv1c.pk007.f19.f mitochondrial import receptor subunit 10 tom40 [Aedes aegypti] inv1c.pk007.f24.f no hits 9 inv1c.pk007.g6.f no hits 10 inv1c.pk007.g17.f putative odorant-binding protein 10 precursor inv1c.pk007.h7.f no hits 7 inv1c.pk007.h11.f no hits 8 inv1c.pk007.h19.f no hits 7 inv1c.pk007.i7.f transposase 10 inv1c.pk007.i16.f venom prophenoloxidase-activating 10 protease inv1c.pk007.j14.f no hits 10 inv1c.pk007.j19.f no hits 10 inv1c.pk007.j21.f conserved hypothetical protein 9 inv1c.pk007.j23.f succinate dehydrogenase, 7 cytochrome B small subunit inv1c.pk007.j24.f no hits 8 inv1c.pk007.k17.f conserved hypothetical protein 9 inv1c.pk007.l5.f no hits 9 inv1c.pk007.l8.f transmembrane protein, putative 9 inv1c.pk007.l11.f no hits 10 inv1c.pk007.m6.f conserved hypothetical protein 10 inv1c.pk007.m21.f no hits 9 inv1c.pk007.o14.f proteasome beta subunit 7 inv1c.pk007.p17.f no hits 7 inv1c.pk008.c8.f ribosomal protein L35Ae 7 inv1c.pk008.c15.f similar to prohibitin 8 inv1c.pk008.c17.f no hits 7 inv1c.pk008.d1.f conserved hypothetical protein 9 inv1c.pk008.d3.f conserved hypothetical protein 7 inv1c.pk008.e11.f no hits 10 inv1c.pk008.e15.f no hits 10 inv1c.pk008.f3.f conserved hypothetical protein 9 inv1c.pk008.f5.f no hits 8 inv1c.pk008.f8.f no hits 10 inv1c.pk008.f23.f no hits 10 inv1c.pk008.g7.f no hits 7 inv1c.pk008.g22.f no hits 7 inv1c.pk008.h23.f putative ribosomal protein S26 10 inv1c.pk008.h24.f similar to mevalonate kinase 10 inv1c.pk008.i10.f no hits 9 inv1c.pk008.i21.f putative accessory gland protein 9 inv1c.pk008.j20.f similar to eukaryotic translation 8 initiation factor 3 subunit 2 beta inv1c.pk008.k24.f no hits 7 inv1c.pk008.l11.f similar to phosphatase and actin 9 regulator inv1c.pk008.p18.f no hits 9 inv1c.pk009.b14.f no hits 8 inv1c.pk009.b21.f ribosomal protein S20 7 inv1c.pk009.e9.f no hits 9 inv1c.pk009.e10.f similar to sarco(endo)plasmic 7 reticulum-type calcium ATPase inv1c.pk009.e17.f similar to serine/threonine protein 9 kinase death domain protein, pelle- like inv1c.pk009.f12.f no hits 10 inv1c.pk009.f17.f no hits 7 inv1c.pk009.f19.f no hits 9 inv1c.pk009.g2.f no hits 8 inv1c.pk009.g21.f no hits 8 inv1c.pk009.h21.f no hits 10 inv1c.pk009.i13.f no hits 10 inv1c.pk009.i24.f no hits 7 inv1c.pk009.k4.f no hits 8 inv1c.pk009.k8.f conserved hypothetical protein 10 inv1c.pk010.a13.f no hits 7 inv1c.pk010.a16.f arginyl-tRNA synthetase 7 inv1c.pk010.b7.f similar to tar RNA binding protein 10 inv1c.pk010.e5.f no hits 7 inv1c.pk010.n9.f no hits 7 inv1c.pk010.n24.f no hits 10 inv1c.pk010.p16.f cytochrome c oxidase subunit II 7 inv1c.pk010.p20.f no hits 8 inv1c.pk011.a20.f no hits 7 inv1c.pk011.b11.f no hits 7

[0190] Sequences displaying insecticidal activity are advanced to confirmation and further evaluation of activity against other stinkbug pests. The assay is scored for activity 6 days post infestation. The possible scores are dead, severely stunted (little or now growth but alive), stunted (growth to second instar but not equivalent to controls), or no activity. Samples demonstrating mortality or severe stunting are advanced to confirmation.

[0191] Following confirmation, a simple dose response assay is performed with N. viridula. Samples for dose response assays is produced in the same manner with the following modification; samples is further purified using column purification prior to enzymatic treatment. Samples is also normalized to 0.5ug/ul and all samples are evaluated by gel electrophoresis. Dose response assays is performed with the following rates; 50, 25, 12, 6, 3, and 1.5 ppm

Example 2

Sequences Having Insecticidal Activity

[0192] DNA sequences which encode double stranded RNAs which were shown to have insecticidal activity against N. viridula using the assay described in Example 1 are set forth in SEQ ID NOS: 1-139.

Example 3

Transformation of Maize

[0193] Immature maize embryos from greenhouse donor plants are bombarded with a plasmid containing the silencing element of the invention operably linked to either a tissue specific, tissue selective, or constitutive promoter and the selectable marker gene PAT (Wohlleben et al. (1988) Gene 70:25-37), which confers resistance to the herbicide Bialaphos. In one embodiment, the promoter employed is a seed-preferred promoter. In one embodiment, the constructs will express a long double stranded RNA or a miRNA of the target sequence set forth in SEQ ID NOS: 1-292 or 302-304 or a fragment thereof. In specific embodiments, the target sequence comprises the sequences set forth in SEQ ID NOS: 278, 279, 280, 281, 282, 283, 302, 303 or 304. Such a construct can be linked to a promoter active in maize. Alternatively, the selectable marker gene is provided on a separate plasmid. Transformation is performed as follows. Media recipes follow below.

Preparation of Target Tissue

[0194] The ears are husked and surface sterilized in 30% Clorox bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water. The immature embryos are excised and placed embryo axis side down (scutellum side up), 25 embryos per plate, on 560Y medium for 4 hours and then aligned within the 2.5cm target zone in preparation for bombardment.

[0195] A plasmid vector comprising the silencing element of interest operably linked to either the tissue specific, tissue selective, or constitutive promoter is made. This plasmid DNA plus plasmid DNA containing a PAT selectable marker is precipitated onto 1.1 p.m (average diameter) tungsten pellets using a CaCl.sub.2 precipitation procedure as follows: 100 .mu.l prepared tungsten particles in water; 10 .mu.l (1 .mu.g) DNA in Tris EDTA buffer (1 .mu.g total DNA); 100 .mu.l 2.5 M CaCl.sub.2; and,10 .mu.l 0.1 M spermidine.

[0196] Each reagent is added sequentially to the tungsten particle suspension, while maintained on the multitube vortexer. The final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes. After the precipitation period, the tubes are centrifuged briefly, liquid removed, washed with 500 ml 100% ethanol, and centrifuged for 30 seconds. Again the liquid is removed, and 105 .mu.l 100% ethanol is added to the final tungsten particle pellet. For particle gun bombardment, the tungsten/DNA particles are briefly sonicated and 10 .mu.l spotted onto the center of each macrocarrier and allowed to dry about 2 minutes before bombardment.

[0197] The sample plates are bombarded at level #4 in a particle gun. All samples receive a single shot at 650 PSI, with a total of ten aliquots taken from each tube of prepared particles/DNA.

[0198] Following bombardment, the embryos are kept on 560Y medium for 2 days, then transferred to 560R selection medium containing 3 mg/liter Bialaphos, and subcultured every 2 weeks. After approximately 10 weeks of selection, selection-resistant callus clones are transferred to 288J medium to initiate plant regeneration. Following somatic embryo maturation (2-4 weeks), well-developed somatic embryos are transferred to medium for germination and transferred to the lighted culture room. Approximately 7-10 days later, developing plantlets are transferred to 272V hormone-free medium in tubes for 7-10 days until plantlets are well established. Plants are then transferred to inserts in flats (equivalent to 2.5'' pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1-2 weeks in the greenhouse, then transferred to classic 600 pots (1.6 gallon) and grown to maturity.

[0199] Plants are monitored and scored for the appropriate marker, such as the control of a Pentatomidae plant pest, such as a N. viridula plant pest. For example, R.sub.0 maize plants are fed to N. viridula 2nd instar nymphs. Contamination and larval quality are monitored. Larval mass and survivorship are recorded for analysis. A one-way ANOVA analysis and a Dunnett's test is performed on the larval mass data to look for statistical significance compared to an untransformed negative control maize plant diet. N. viridula 2n.sup.d instar nymph stunting is measured after feeding on two events and compared to growth of larvae fed on negative control plants.

[0200] In other assays, transgenic corn plants (R.sub.0) generated are planted into 10-inch pots containing Metromix soil after reaching an appropriate size. After allowing the N. viridula 2.sup.nd instar nymphs to feed on the plant, plants are removed from the soil and washed so that the relevant plant parts can be evaluated for larval feeding. Plant damage is rated using routine methods to score the level of damage.

[0201] Bombardment medium (560Y) comprises 4.0 g/1 N6 basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000X SIGMA-1511), 0.5 mg/1 thiamine HCl, 120.0 g/l sucrose, 1.0 mg/12,4-D, and 2.88 g/l L-proline (brought to volume with D-I H.sub.2O following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added after bringing to volume with D-I H.sub.2O); and 8.5 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature). Selection medium (560R) comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000X SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose, and 2.0 mg/l 2,4-D (brought to volume with D-I H.sub.2O following adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added after bringing to volume with D-I H.sub.2O); and 0.85 mg/l silver nitrate and 3.0 mg/l bialaphos (both added after sterilizing the medium and cooling to room temperature).

[0202] Plant regeneration medium (288J) comprises 4.3 g/l MS salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/l thiamine HCl, 0.10 g/l pyridoxine HCl, and 0.40 g/l glycine brought to volume with polished D-I H.sub.2O) (Murashige and Skoog (1962) Physiol. Plant. 15:473), 100 mg/l myo-inositol, 0.5 mg/l zeatin, 60 g/l sucrose, and 1.0 ml/l of 0.1 mM abscisic acid (brought to volume with polished D-I H.sub.2O after adjusting to pH 5.6); 3.0 g/l Gelrite (added after bringing to volume with D-I H.sub.2O); and 1.0 mg/l indoleacetic acid and 3.0 mg/l bialaphos (added after sterilizing the medium and cooling to 60.degree. C.). Hormone-free medium (272V) comprises 4.3 g/l MS salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g/l nicotinic acid, 0.02 g/l thiamine HCl, 0.10 g/l pyridoxine HCl, and 0.40 g/l glycine brought to volume with polished D-I H.sub.2O), 0.1 g/l myo-inositol, and 40.0 g/l sucrose (brought to volume with polished D-I H.sub.2O after adjusting pH to 5.6); and 6 g/l bacto-agar (added after bringing to volume with polished D-I H.sub.2O), sterilized and cooled to 60.degree. C.

Example 4

Agrobacterium-Mediated Transformation of Maize

[0203] For Agrobacterium-mediated transformation of maize with a silencing element of the invention, the method of Zhao is employed (U.S. Pat. No. 5,981,840, and PCT patent publication WO98/32326; the contents of which are hereby incorporated by reference). Such a construct can, for example, express a long double stranded RNA or a miRNA of the target sequence set forth in SEQ ID NOS: 1-292 or 302-304. In one embodiment, the promoter employed is a seed-preferred promoter. In specific embodiments, the target sequence comprises the sequence set forth in SEQ ID NOS: 278, 279, 280, 281, 282, 283, 302, 303 or 304. Such a construct can be linked to the dMMB promoter. Briefly, immature embryos are isolated from maize and the embryos contacted with a suspension of Agrobacterium, where the bacteria are capable of transferring the polynucleotide comprising the silencing element to at least one cell of at least one of the immature embryos (step 1: the infection step). In this step the immature embryos are immersed in an Agrobacterium suspension for the initiation of inoculation. The embryos are co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step). The immature embryos are cultured on solid medium following the infection step. Following this co-cultivation period an optional "resting" step is contemplated. In this resting step, the embryos are incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step). The immature embryos are cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells. Next, inoculated embryos are cultured on medium containing a selective agent and growing transformed callus is recovered (step 4: the selection step). The immature embryos are cultured on solid medium with a selective agent resulting in the selective growth of transformed cells. The callus is then regenerated into plants (step 5: the regeneration step), and calli grown on selective medium are cultured on solid medium to regenerate the plants. Assays for insecticidal activity can be performed as described above in Example 3.

Example 5

Soybean Embryo Transformation

Culture Conditions

[0204] Soybean embryogenic suspension cultures (cv. Jack) are maintained in 35 ml liquid medium SB196 (see recipes below) on rotary shaker, 150 rpm, 26.degree. C. with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 60-85 .mu.E/m2/s. Cultures are subcultured every 7 days to two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid SB196 (the preferred subculture interval is every 7 days).

[0205] Soybean embryogenic suspension cultures are transformed with a plasmid containing the silencing element of the invention operably linked to either a tissue specific, tissue selective, or constitutive promoter by the method of particle gun bombardment (Klein et al. (1987) Nature, 327:70). In one embodiment, the promoter employed is a seed-preferred promoter. In one embodiment, the constructs will express a long double stranded RNA or a miRNA of the target sequence set forth in SEQ ID NOS: 1-292 or 302-304 or a fragment thereof. In specific embodiments, the target sequence comprises the sequences set forth in SEQ ID NOS: 278, 279, 280, 281, 282, 283, 302, 303 or 304.

Soybean Embryogenic Suspension Culture Initiation

[0206] Soybean cultures are initiated twice each month with 5-7 days between each initiation.

[0207] Pods with immature seeds from available soybean plants 45-55 days after planting are picked, removed from their shells and placed into a sterilized magenta box. The soybean seeds are sterilized by shaking them for 15 minutes in a 5% Clorox solution with 1 drop of ivory soap (95 ml of autoclaved distilled water plus 5 ml Clorox and 1 drop of soap). Mix well. Seeds are rinsed using 2 1-liter bottles of sterile distilled water and those less than 4 mm are placed on individual microscope slides. The small end of the seed are cut and the cotyledons pressed out of the seed coat. Cotyledons are transferred to plates containing SB1 medium (25-30 cotyledons per plate). Plates are wrapped with fiber tape and stored for 8 weeks. After this time secondary embryos are cut and placed into SB196 liquid media for 7 days.

Preparation of DNA for Bombardment

[0208] Either an intact plasmid or a DNA plasmid fragment containing the genes of interest and the selectable marker gene are used for bombardment. Plasmid DNA for bombardment are routinely prepared and purified using the method described in the Promega.TM. Protocols and Applications Guide, Second Edition (page 106). Fragments of the plasmids carrying the silencing element of interest are obtained by gel isolation of double digested plasmids. In each case, 100 ug of plasmid DNA is digested in 0.5 ml of the specific enzyme mix that is appropriate for the plasmid of interest. The resulting DNA fragments are separated by gel electrophoresis on 1% SeaPlaque GTG agarose (BioWhitaker Molecular Applications) and the DNA fragments containing silencing element of interest are cut from the agarose gel. DNA is purified from the agarose using the GELase digesting enzyme following the manufacturer's protocol.

[0209] A 50 .mu.l aliquot of sterile distilled water containing 3 mg of gold particles (3 mg gold) is added to 5 .mu.g/.mu.l DNA solution (either intact plasmid or DNA fragment prepared as described above), 50 .mu.l 2.5M CaCl.sub.2 and 20 .mu.l of 0.1 M spermidine. The mixture is shaken 3 min on level 3 of a vortex shaker and spun for 10 sec in a bench microfuge. After a wash with 400 .mu.l 100% ethanol the pellet is suspended by sonication in 40 .mu.l of 100% ethanol. Five .mu.l of DNA suspension is dispensed to each flying disk of the Biolistic PDS1000/HE instrument disk. Each 5 .mu.l aliquot contains approximately 0.375 mg gold per bombardment (i.e. per disk).

Tissue Preparation and Bombardment with DNA

[0210] Approximately 150-200 mg of 7 day old embryonic suspension cultures are placed in an empty, sterile 60.times.15 mm petri dish and the dish covered with plastic mesh. Tissue is bombarded 1 or 2 shots per plate with membrane rupture pressure set at 1100 PSI and the chamber evacuated to a vacuum of 27-28 inches of mercury. Tissue is placed approximately 3.5 inches from the retaining / stopping screen.

Selection of Transformed Embryos

[0211] Transformed embryos were selected either using hygromycin (when the hygromycin phosphotransferase, HPT, gene was used as the selectable marker) or chlorsulfuron (when the acetolactate synthase, ALS, gene was used as the selectable marker).

Hygromycin (HPT) Selection

[0212] Following bombardment, the tissue is placed into fresh SB196 media and cultured as described above. Six days post-bombardment, the SB196 is exchanged with fresh SB196 containing a selection agent of 30 mg/L hygromycin. The selection media is refreshed weekly. Four to six weeks post selection, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into multiwell plates to generate new, clonally propagated, transformed embryogenic suspension cultures.

Chlorsulfuron (ALS) Selection

[0213] Following bombardment, the tissue is divided between 2 flasks with fresh SB196 media and cultured as described above. Six to seven days post-bombardment, the SB196 is exchanged with fresh SB196 containing selection agent of 100 ng/ml Chlorsulfuron. The selection media is refreshed weekly. Four to six weeks post selection, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into multiwell plates containing SB196 to generate new, clonally propagated, transformed embryogenic suspension cultures.

Regeneration of Soybean Somatic Embryos into Plants

[0214] In order to obtain whole plants from embryogenic suspension cultures, the tissue must be regenerated.

Embryo Maturation

[0215] Embryos are cultured for 4-6 weeks at 26.degree. C. in SB196 under cool white fluorescent (Phillips cool white Econowatt F40/CW/RS/EW) and Agro (Phillips F40 Agro) bulbs (40 watt) on a 16:8 hr photoperiod with light intensity of 90-120 uE/m2s. After this time embryo clusters are removed to a solid agar media, SB166, for 1-2 weeks. Clusters are then subcultured to medium SB103 for 3 weeks. During this period, individual embryos can be removed from the clusters and screened for the appropriate marker or the ability of the plant, when injected with the silencing elements, to control the Pentatomidae plant pest or the N. viridula plant pest.

Embryo Desiccation and Germination

[0216] Matured individual embryos are desiccated by placing them into an empty, small petri dish (35.times.10 mm) for approximately 4-7 days. The plates are sealed with fiber tape (creating a small humidity chamber). Desiccated embryos are planted into SB71-4 medium where they were left to germinate under the same culture conditions described above. Germinated plantlets are removed from germination medium and rinsed thoroughly with water and then planted in Redi-Earth in 24-cell pack tray, covered with clear plastic dome. After 2 weeks the dome is removed and plants hardened off for a further week. If plantlets looked hardy they are transplanted to 10'' pot of Redi-Earth with up to 3 plantlets per pot.

Media Recipes

TABLE-US-00002 [0217] SB 196 - FN Lite liquid proliferation medium (per liter) - MS FeEDTA - 100x Stock 1 10 ml MS Sulfate - 100x Stock 2 10 ml FN Lite Halides - 100x Stock 3 10 ml FN Lite P, B, Mo - 100x Stock 4 10 ml B5 vitamins (1 ml/L) 1.0 ml 2,4-D (10 mg/L final concentration) 1.0 ml KNO3 2.83 gm (NH4)2SO4 0.463 gm Asparagine 1.0 gm Sucrose (1%) 10 gm pH 5.8

FN Lite Stock Solutions

TABLE-US-00003 [0218] Stock # 1000 ml 500 ml 1 MS Fe EDTA 100x Stock Na.sub.2 EDTA* 3.724 g 1.862 g FeSO.sub.4--7H.sub.2O 2.784 g 1.392 g 2 MS Sulfate 100x stock MgSO.sub.4--7H.sub.2O 37.0 g 18.5 g MnSO.sub.4--H.sub.2O 1.69 g 0.845 g ZnSO.sub.4--7H.sub.2O 0.86 g 0.43 g CuSO.sub.4--5H.sub.2O 0.0025 g 0.00125 g 3 FN Lite Halides 100x Stock CaCl.sub.2--2H.sub.2O 30.0 g 15.0 g KI 0.083 g 0.0715 g CoCl.sub.2--6H.sub.2O 0.0025 g 0.00125 g 4 FN Lite P, B, Mo 100x Stock KH.sub.2PO.sub.4 18.5 g 9.25 g H.sub.3BO.sub.3 0.62 g 0.31 g Na.sub.2MoO.sub.4--2H.sub.2O 0.025 g 0.0125 g *Add first, dissolve in dark bottle while stirring

[0219] SB1 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/BRL-Cat# 11117-066); 1 ml B5 vitamins 1000.times. stock; 31.5 g sucrose; 2 ml 2,4-D (20mg/L final concentration); pH 5.7; and, 8 g TC agar.

[0220] SB 166 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/BRL-Cat# 11117-066); 1 ml B5 vitamins 1000.times. stock; 60 g maltose; 750 mg MgC12 hexahydrate; 5 g activated charcoal; pH 5.7; and, 2 g gelrite.

[0221] SB 103 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/BRL-Cat# 11117-066); 1 ml B5 vitamins 1000.times. stock; 60 g maltose; 750 mg MgC12 hexahydrate; pH 5.7; and, 2 g gelrite.

[0222] SB 71-4 solid medium (per liter) comprises: 1 bottle Gamborg's B5 salts w/sucrose (Gibco/BRL-Cat# 21153-036); pH 5.7; and, 5 g TC agar. 2,4-D stock is obtained premade from Phytotech cat# D 295 -concentration is 1 mg/ml.

[0223] B5 Vitamins Stock (per 100 ml) which is stored in aliquots at -20C comprises: 10 g myo-inositol; 100 mg nicotinic acid; 100 mg pyridoxine HCl; and, 1 g thiamine. If the solution does not dissolve quickly enough, apply a low level of heat via the hot stir plate. Chlorsulfuron Stock comprises 1mg/ml in 0.01 N Ammonium Hydroxide

Example 6

Expression of Silencing Elements Comprising siRNAs

[0224] SiRNAs were generated to target the cDNA sequence set forth in SEQ ID NOS: 140, 143, 146, 149, 152, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 239, 242, 245, 248, 251, 254, 257, 260, 263, 266, 269, 273, and 276. Table 2 provides the clone name of the silencing element and the closest homology for the target sequence (gene name). Table 3 provides the clone name, the target cDNA, the sense and antisense siRNA sequence, and the respective SEQ ID NOS. Table 4 provides the bioassays for each of the siRNAs shown in Table 3.

TABLE-US-00004 TABLE 2 Query Sequence Title (ID) gene name inv1c.pk003.j16.f conserved protein of unknown function inv1c.pk003.j16.f conserved protein of unknown function inv1c.pk004.b7.f cathepsin L inv1c.pk004.b7.f cathepsin L inv1c.pk004.b7.f cathepsin L inv1c.pk004.b7.f cathepsin L inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.f4.f reverse transcriptase inv1c.pk004.f4.f reverse transcriptase inv1c.pk004.f4.f reverse transcriptase inv1c.pk004.j14.f sugar transporter inv1c.pk004.k9.f glutathione s transferase inv1c.pk004.k9.f glutathione s transferase inv1c.pk004.k9.f glutathione s transferase inv1c.pk005.a24.f cathepsin L-like protease inv1c.pk005.a24.f cathepsin L-like protease inv1c.pk005.b16.f synapsin inv1c.pk005.b16.f synapsin inv1c.pk005.b16.f synapsin inv1c.pk005.b16.f synapsin inv1c.pk005.b16.f synapsin inv1c.pk005.f20.f Apolipoprotein D precursor inv1c.pk005.f20.f Apolipoprotein D precursor inv1c.pk005.f20.f Apolipoprotein D precursor inv1c.pk005.f20.f Apolipoprotein D precursor inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h23.f chitin synthase 1 inv1c.pk005.j19.f conserved hypothetical protein inv1c.pk005.j19.f conserved hypothetical protein inv1c.pk005.k24.f cathepsin B inv1c.pk005.k24.f cathepsin B

TABLE-US-00005 TABLE 3 (Note: the sense RNA primer sequence and the antisense RNA primer sequences shown in table 3 were generated having 2 thymine residues at the 3' end.) SEQ ID NOS Approx. Target cDNA/ Query Target Target Sense Antisense sense siRNA Sequence No. Target Location cDNA Strand Strand siRNA/antisense number Title (ID) Bases Location (thirds) Sequence %CG siRNA siRNA siRNA 1 inv1c.pk003. 656 227 2 AATCAAGGTGTGGA 34.8 UCAAGGUGUG UUUUCAGUCCA 140/141/142 j16.f CTGAAAATT GACUGAAAA CACCUUGA 2 inv1c.pk003. 656 490 3 AATTGGTTGCTACAT 30.4 UUGGUUGCUA GAGAAUAUGUA 143/144/145 j16.f ATTCTCTT CAUAUUCUC GCAACCAA 3 inv1c.pk004. 603 150 1 AAGAACGTCTTAGG 34.8 GAACGUCUUA UAUGCAUCCUA 146/147/148 b7.f ATGCATATT GGAUGCAUA AGACGUUC 4 inv1c.pk004. 603 317 2 AAGCAAGCACCTAC 43.5 GCAAGCACCU UGUGAAGGUAG 149/150/151 b7.f CTTCACATT ACCUUCACA GUGCUUGC 5 inv1c.pk004. 603 412 3 AAACCAAGGTAGCT 43.5 ACCAAGGUAG GAUCCACAGCU 152/153/154 b7.f GTGGATCTT CUGUGGAUC ACCUUGGU 6 inv1c.pk004. 603 545 3 AATAATGGATGTGG 43.5 UAAUGGAUGU UCCGCCACCACA 155/156/157 b7.f TGGCGGATT GGUGGCGGA UCCAUUA 7 inv1c.pk004. 688 133 1 AAAAGGATACCACT 34.8 AAGGAUACCA AGUCCAAAGUG 158/159/160 c4.f TTGGACTTT CUUUGGACU GUAUCCUU 8 inv1c.pk004. 688 134 1 AAAGGATACCACTT 34.8 AGGAUACCAC AAGUCCAAAGU 161/162/163 c4.f TGGACTTTT UUUGGACUU GGUAUCCU 9 inv1c.pk004. 688 171 1 AAACCAAGACCCAG 47.8 ACCAAGACCC CUCCAGUCUGG 164/165/166 c4.f ACTGGAGTT AGACUGGAG GUCUUGGU 10 inv1c.pk004. 688 176 1 AAGACCCAGACTGG 43.5 GACCCAGACU UUCAACUCCAG 167/168/169 c4.f AGTTGAATT GGAGUUGAA UCUGGGUC 11 inv1c.pk004. 688 218 1 AACCAAGAAACTGG 39.1 CCAAGAAACU CACUUUCCCAG 170/171/172 c4.f GAAAGTGTT GGGAAAGUG UUUCUUGG 12 inv1c.pk004. 688 226 1 AACTGGGAAAGTGT 39.1 CUGGGAAAGU UUUCCGAACAC 173/174/175 c4.f TCGGAAATT GUUCGGAAA UUUCCCAG 13 inv1c.pk004. 688 322 2 AACTGAAATTGCCCT 3.91 CUGAAAUUGC UCAGUGAGGGC 176/177/178 c4.f CACTGATT CCUCACUGA AAUUUCAG 14 inv1c.pk004. 688 359 2 AAGCTTTCTTGTGAT 34.8 GCUUUCUUGU UGAGGUAUCAC 179/180/181 c4.f ACCTCATT GAUACCUCA AAGAAAGC 15 inv1c.pk004. 688 431 2 AATGATACGTGTGCT 34.8 UGAUACGUGU GUUCAAAGCAC 182/183/184 c4.f TTGAACTT GCUUUGAAC ACGUAUCA 16 inv1c.pk004. 688 619 3 AAGCATTAATGATG 34.8 GCAUUAAUGA ACACGUCCAUC 185/186/187 c4.f GACGTGTTT UGGACGUGU AUUAAUGC 17 inv1c.pk004. 696 368 2 AAAACTTTCTCAAA 30.4 AACUUUCUCA CUGGUUCUUUG 188/189/190 f4.f GAACCAGTT AAGAACCAG AGAAAGUU 18 inv1c.pk004. 696 379 2 AAAGAACCAGTTCC 34.8 AGAACCAGUU UGCAUUUGGAA 191/192/193 f4.f AAATGCATT CCAAAUGCA CUGGUUCU 19 inv1c.pk004. 696 394 2 AATGCATTCCCTTCA 34.8 UGCAUUCCCU UGAGAUUGAAG 194/195/196 f4.f ATCTCATT UCAAUCUCA GGAAUGCA 20 inv1c.pk004. 687 533 3 AACCTCTCCTCGTCT 52.2 CCUCUCCUCG GACUCCAGACG 197/198/199 j14.f GGAGTCTT UCUGGAGUC AGGAGAGG 21 inv1c.pk004. 663 212 1 AAAGAATTCACCTG 39.1 AGAAUUCACC GUAGGACCAGG 200/201/202 k9.f GTCCTACTT UGGUCCUAC UGAAUUCU 22 inv1c.pk004. 663 531 3 AATTCTGGAAGAAA 34.8 UUCUGGAAGA UGGUCCAUUUC 203/204/205 k9.f TGGACCATT AAUGGACCA UUCCAGAA 23 inv1c.pk004. 663 641 3 AACGTCTAGAAATG 39.1 CGUCUAGAAA CUCUCACCAUU 206/207/208 k9.f GTGAGAGTT UGGUGAGAG UCUAGACG 24 inv1c.pk005. 443 198 2 AATAAGAAACACGA 39.1 UAAGAAACAC GCCUGCUUCGU 209/210/211 a24.f AGCAGGCTT GAAGCAGGC GUUUCUUA 25 inv1c.pk005. 443 271 2 AAATGAAGAGCCAT 34.8 AUGAAGAGCC AGCCUAAAUGG 212/213/214 a24.f TTAGGCTTT AUUUAGGCU CUCUUCAU 26 inv1c.pk005. 680 17 1 AACTTCGAACCATCT 52.2 CUUCGAACCA CCGGGGAGAUG 215/216/217 b16.f CCCCGGTT UCUCCCCGG GUUCGAAG 27 inv1c.pk005. 680 119 1 AAGCTTCCTTCACTA 34.8 GCUUCCUUCA CAUUUGUAGUG 218/219/220 b16.f CAAATGTT CUACAAAUG AAGGAAGC 28 inv1c.pk005. 680 156 1 AAGGTTCAGCTCCG 52.2 GGUUCAGCUC AGAUCCCCGGA 221/222/223 b16.f GGGATCTTT CGGGGAUCU GCUGAACC 29 inv1c.pk005. 680 540 3 AATCGACGACCAAA 34.8 UCGACGACCA UCAGUAUUUUG 224/225/226 b16.f ATACTGATT AAAUACUGA GUCGUCGA 30 inv1c.pk005. 680 569 3 AATACTTCAGAGTA 39.1 UACUUCAGAG UACGCCGUACU 227/228/229 b16.f CGGCGTATT UACGGCGUA CUGAAGUA 31 inv1c.pk005. 662 46 1 AAAATGAGAGCTAC 39.1 AAUGAGAGCU GCAGUACGUAG 230/231/232 f20.f GTACTGCTT ACGUACUGC CUCUCAUU 32 inv1c.pk005. 662 316 2 AAATACCATTACAC 30.4 AUACCAUUAC AUGUCCUGUGU 233/234/235 f20.f AGGACATTT ACAGGACAU AAUGGUAU 33 inv1c.pk005. 662 387 2 AAGTGTTGCTGGAA 39.1 GUGUUGCUGG CUUGAUGUUCC 236/237/238 f20.f CATCAAGTT AACAUCAAG AGCAACAC 34 inv1c.pk005. 662 605 3 AATGCCCAGCAGAA 47.8 UGCCCAGCAG GGUUGGUUUCU 239/240/241 f20.f ACCAACCTT AAACCAACC GCUGGGCA 35 inv1c.pk005. 628 143 1 AAATACCACAGCCA 34.8 AUACCACAGC UUAUUGCUGGC 242/243/244 h1.f GCAATAATT CAGCAAUAA UGUGGUAU 36 inv1c.pk005. 628 144 1 AATACCACAGCCAG 34.8 UACCACAGCC AUUAUUGCUGG 245/246/247 h1.f CAATAATTT AGCAAUAAU CUGUGGUA 37 inv1c.pk005. 628 192 1 AAGCCTCCGGTACCT 52.2 GCCUCCGGUA ACCUUGAGGUA 248/249/250 h1.f CAAGGTTT CCUCAAGGU CCGGAGGC 38 inv1c.pk005. 628 288 2 AATCTTATCGGACA 34.8 UCUUAUCGGA ACUGGUUUGUC 251/252/253 h1.f AACCAGTTT CAAACCAGU CGAUAAGA 39 inv1c.pk005. 628 556 3 AAAAATATCCATTG 30.4 AAAUAUCCAU ACAGUGGCAAU 254/255/256 h1.f CCACTGTTT UGCCACUGU GGAUAUUU 40 inv1c.pk005. 628 557 3 AAAATATCCATTGCC 30.4 AAUAUCCAUU AACAGUGGCAA 257/258/259 h1.f ACTGTTTT GCCACUGUU UGGAUAUU 41 inv1c.pk005. 628 558 3 AAATATCCATTGCCA 30.4 AUAUCCAUUG AAACAGUGGCA 260/261/262 h1.f CTGTTTTT CCACUGUUU AUGGAUAU 42 inv1c.pk005. 647 301 2 AAGGATGGGATGTG 47.8 GGAUGGGAUG CUCGGAACACA 263/264/265 h23.f TTCCGAGTT UGUUCCGAG UCCCAUCC 43 inv1c.pk005. 597 172 1 AAGATGGGGGGATG 47.8 GAUGGGGGGA CGUACAUCAUC 266/267/268 j19.f ATGTACGTT UGAUGUACG CCCCCAUC 44 inv1c.pk005. 597 377 2 AAGAACATCCACAG 43.5 GAACAUCCAC GGUUCUCCUGU 269/270/271 j19.f GAGAACCTT AGGAGAACC GGAUGUUC 45 inv1c.pk005. 593 27 1 AAGACTCTATTAATA 30.4 GACUCUAUUA GCUGGAUAUUA 272/273/274 k24.f TCCAGCTT AUAUCCAGC AUAGAGUC 46 inv1c.pk005. 593 132 1 AAATGGAAAGCTGG 43.5 AUGGAAAGCU GUUCUGCCCAG 275/276/277 k24.f GCAGAACTT GGGCAGAAC CUUUCCAU

TABLE-US-00006 TABLE 4 Bioassay-1 Bioassay-1 Bioassay-2 Bioassay-3 100 ppm 100 ppm 100 ppm 100 ppm Bioassay-4 siRNA Query Sequence (4 day (5 day (5 day (5 day 25 ppm Bioassay-5 Bioassay-6 number Title (ID) score) score) score) Comment score) 5 day 25 ppm 50 ppm 1 inv1c.pk003.j16.f 3/9 10/10 8/10 ND 2 inv1c.pk003.j16.f 4/11 10/10 1/10 ND 3 inv1c.pk004.b7.f 11/12 10/10 ND ND 4 inv1c.pk004.b7.f 7/11 10/10 0/10 5 inv1c.pk004.b7.f 6/9 9/10 0/10 6 inv1c.pk004.b7.f 5/11 3/10 7 inv1c.pk004.c4.f 3/9 1/10 8 inv1c.pk004.c4.f 3/10 0/10 9 inv1c.pk004.c4.f 4/10 4/10 (5 stunted) 0/10 10 inv1c.pk004.c4.f 3/10 5/10 (3 stunted) 1/10 11 inv1c.pk004.c4.f 4/10 2/10 12 inv1c.pk004.c4.f 5/9 0/10 13 inv1c.pk004.c4.f 7/10 1/10 14 inv1c.pk004.c4.f 4/10 2/10 15 inv1c.pk004.c4.f 5/9 1/10 16 inv1c.pk004.c4.f 6/10 0/10 17 inv1c.pk004.f4.f 5/10 3/10 (2 stunted) 18 inv1c.pk004.f4.f 2/11 3/10 (2 stunted) 19 inv1c.pk004.f4.f 6/9 0/10 20 inv1c.pk004.j14.f 6/10 0/10 21 inv1c.pk004.k9.f 10/10 0/10 22 inv1c.pk004.k9.f 6/11 1/10 23 inv1c.pk004.k9.f 3/10 2/10 24 inv1c.pk005.a24.f 10/10 0/10 25 inv1c.pk005.a24.f 0/10 26 inv1c.pk005.b16.f 0/10 Significant growth in survivors 27 inv1c.pk005.b16.f 5/10 Significant growth in survivors 28 inv1c.pk005.b16.f 5/10 Significant growth in survivors 29 inv1c.pk005.b16.f 4/10 Significant growth in survivors 30 inv1c.pk005.b16.f 0/10 31 inv1c.pk005.f20.f 9/10 No growth 1/10 32 inv1c.pk005.f20.f 10/10 Some growth 1/10 before death 33 inv1c.pk005.f20.f 10/10 Growth 2/10 (survivors 4/10 8/10 before death stunted) 34 inv1c.pk005.f20.f 4/10 Growth before death 35 inv1c.pk005.h1.f 7/10 Growth 1/10 (some before death stunting) 36 inv1c.pk005.h1.f 10/10 some growth 1/10 before death 37 inv1c.pk005.h1.f 10/10 Growth 0/10 before death 38 inv1c.pk005.h1.f 10/10 no growth 1/10 39 inv1c.pk005.h1.f 1/10 40 inv1c.pk005.h1.f 8/10 little growth 0/10 41 inv1c.pk005.h1.f 6/10 some growth 42 inv1c.pk005.h23.f 7/10 No growth 0/10 43 inv1c.pk005.j19.f 10/10 No growth 2/10 44 inv1c.pk005.j19.f 1/10 45 inv1c.pk005.k24.f 0/10 46 inv1c.pk005.k24.f 0/10 5/10

Example 7

Constructs Expressing siRNAs

[0225] siRNAs designed to target the cDNA sequence set forth in SEQ ID NOS: 140, 143, 146, 149, 152, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 239, 242, 245, 248, 251, 254, 257, 260, 263, 266, 269, 272, and 275 can be engineered to be expressed in planta. The construct can comprise, for example, the maize ubiquitin promoter/5'UTR/1.sup.st intron operably linked to a sequence comprising SEQ ID NO: 141 which is operably linked to the ADH1 intron followed by the sequence comprising SEQ ID NO: 142. It is recognized that any of the siRNA described in Example 6 can be generated employing a simlar construct design.

Example 8

Generation of Silencing Constructs for in vivo Testing Experiments

[0226] The activity of 9 dsRNAs listed in Table 1, was confirmed on repeated testing and the target genes advanced for further evaluation in in planta assays. For this purpose, 2 different types of constructs were assembled. In one, 2 SGSB target gene fragments, separated by a spiceosomal intron, were assembled in opposite orientations with respect to each other to produce a hairpin RNA. In planta produced hairpin RNAs are expected to be processed to yield siRNAs which upon uptake into insects, mediate RNAi inhibition of SGSB target gene expression. In the second, small 21-mer SGSB gene sequences are incorporated into a micro RNA backbone to produce an artificial pre-miRNA. Processing of the pre-miRNA in vivo releases the 21-nt miRNA that targets the SGSB gene for silencing. Hairpin constructs for in vivo expression and testing of dsRNAs were assembled via Gateway technology using procedures and practices well known to those skilled in the art of molecular biology. Target gene fragments were generated by PCR using gene specific sense and antisense primers containing Gateway attB4 (CAACTTTGTATAGAAAAGTTG (SEQ ID NO: 345)) and attB3 (CAACTTTGTATAATAAAGTTG (SEQ ID NO: 346)) sequences, respectively. The amplified DNA fragments were recombined into the pDONR vector, PHP36164 containing attP4-attP3 sites in a reaction catalyzed by BP Clonase. The resultant entry clones containing target gene fragments flanked by attL 4 and attL3 sites were then used to generate an expression construct by performing 2 sequential LR recombination reactions, first with the vector pKB499 and then with the vector PHP25224. The former destination vector contains the 193 bp intron2 fragment of the potato LS1 gene flanked by attR4-R3 sites at the 5' end and attR3-R4 sites at the 3' end. LR recombination yields a hairpin segment comprised of sense and antisense target gene fragments separated by an intron loop. In planta expression is regulated by placement of the appropriate regulatory elements, promoter sequences upstream and termination sequences downstream, of the hairpin segment. In this particular example, promoter sequences are provided by a 1946 bp soybean ubiquitin promoter-5' UTR-Intronl fragment and termination sequences are provided by an 888bp 3' fragment of the Arabidopsis ubiquitin10 gene. Other promoter sequences providing constitutive or appropriate tissue specific expression may additionally be used. The final plant expression construct is produced by a second LR reaction in which the entire hairpin cassette is moved into a vector (PHP25224) which provides a plant selectable marker (herbicide resistant acetolactate synthase gene) for stable transformation experiments. In Table 5, the 9 entries correspond to hairpin constructs that were assembled and tested in soybean embryos for efficacy against Southern Green Stinkbug (SGSB).

TABLE-US-00007 TABLE 5 Hairpin constructs for SGSB target gene silencing Construct SEQ ID NO SEQ ID Fragment Fragment (without Gene ID SEQ length (bp) NO Location SEQ ID NO Construct promoter) inv1c.pk004.e6.f:fis 1054 278 2-537 284 PHP49713 293 inv1c.pk004.h20.f:fis 861 279 72-677 285 PHP48181 294 inv1c.pk004.h20.f:fis 861 279 72-834 286 pKB505 295 inv1c.pk004.h20.f:fis 861 279 72-439 287 pKB506 296 inv1c.pk004.i1.f:fis 992 280 27-511 288 PHP48183 297 inv1c.pk004.i1.f:fis 992 280 488-938 289 pKB508 298 inv1c.pk008.m9.f:fis 858 281 2-800 290 PHP49450 299 inv1c.pk011.f6.f:fis 792 282 19-594 291 PHP49451 300 inv1c.pk010.g13.f:fis 643 283 4-785 292 PHP49480 301

[0227] Silencing constructs encoding artificial microRNAs (amiRNAs) that would have the ability to silence Southern Green Stinkbug genes were designed largely according to rules described in Schwab R, et al. (2005) Dev Cell 8: 517-27. To summarize, microRNA sequences are 21 nucleotides in length, start at their 5'-end with a "U", display 5' instability relative to their star sequence which is achieved by including a C or G at position 19, and their 10th nucleotide is either an "A" or an "U". An additional requirement for artificial microRNA design was that the amiRNA have a high free delta-G as calculated using the ZipFold algorithm (Markham, N. R. & Zuker, M. (2005) Nucleic Acids Res. 33: W577-W581.) Optionally, a one base pair change was added to the 5' portion of the amiRNA so that the sequence differed from the target sequence by one nucleotide. The amiRNAs that were used to silence SGSB genes are given in Table 6.

TABLE-US-00008 TABLE 6 amiRNA Sequences Target amiRNA amiRNA SEQ SEQ ID precursor GENE ID ID NO amiRNA Sequence NO Nv-MCS Frg1 inv1c.pk005.h23.f 302 taagtaccatgtccaacgcca 305 Nv-MCS Frg2 inv1c.pk005.h23.f 302 tattacaataactgaccaccc 306 Nv-MMitpro2 inv1c.pk004.e6.f:fis 278 tcctactacatatttccaccc 307 Nv-MitprotCD3 inv1c.pk004.e6.f:fis 278 tattccttctatcttctccca 308 Nv-Madapmol2 inv1c.pk004.e11.f:fis 303 taaagtatattaataattctt 309 Nv-MadadapCRK1 inv1c.pk004.e11.f:fis 303 ttactatcttcccttacacaa 310 Nv-MNH1A inv1c.pk004.d17.f:fis 304 tacgaagagataacacaagat 311 Nv-MNH1B inv1c.pk004.d17.f:fis 304 taacaaaacaaaaaaaaactg 312

[0228] "Star sequences" are those that base pair with the amiRNA sequences in the precursor RNA, to form imperfect stem structures. To form a perfect stem structure the star sequence would be the exact reverse complement of the amiRNA. The soybean precursor sequence miR159 as described in Zhang, B. at al. (2008) Planta 229:161-182 was folded with MFold (M. Zuker (2003) Nucleic Acids Res. 31: 3406-15; and D. H. Mathews, J. et al. (1999) J. Mol. Biol. 288: 911-940). The miRNA sequence was then replaced with the amiRNA sequence and the endogenous star sequence was replaced with the exact reverse complement of the amiRNA. Changes in the artificial star sequence were introduced so that the structure of the stem would remain the same as the endogenous structure. The altered sequence was then folded with mfold and the original and altered structures were compared by eye. If necessary, further alternations to the artificial star sequence were introduced to maintain the original structure. The DNA sequences corresponding to the artificial star sequences that were used to silence the desired target genes are shown in Table 7.

TABLE-US-00009 TABLE 7 amiRNA Star Sequences amiRNA SEQ ID precursor GENE ID amiRNA Sequence NO Nv-MCS Frg1-Star inv1c.pk005.h23.f tggcgttggactaggtacttt 313 Nv-MCS Frg2-Star inv1c.pk005.h23.f gggtggtcagtatttgtaatt 314 Nv-MMitpro2-Star inv1c.pk004.e6.f:fis gggtggaaataattagtaggt 315 Nv-MitprotCD3-Star inv1c.pk004.e6.f:fis tgggagaagatcaaaggaatt 316 Nv-Madapmol2-Star inv1c.pk004.e11.f:fis aagaattattataatactttt 317 Nv-MadadapCRK1-Star inv1c.pk004.e11.f:fis ttgtgtaagggttgatagtat 318 Nv-MNH1A-Star inv1c.pk004.d17.f:fis atcttgtgttaaatcttcgtt 319 Nv-MNH1B-Star inv1c.pk004.d17.f:fis cagttttttttgcttttgttt 320

[0229] The soybean genomic miRNA precursor gene, miR159, was converted to amiRNA precursors by DNA synthesis (Genscript; Piscataway, NJ). DNA fragments were synthesized with flanking Avrll and Hpal sites and were cloned by restriction enzyme digestion followed by DNA ligation downstream of the GmUbiquitin promoter-5'UTR-Intronl fragment in the UBQ-Kozack OXOXalt7 vector. LR recombination reaction between this intermediate and the vector QC479i produced the eight final plant expression constructs given in Table 8.

TABLE-US-00010 TABLE 8 amiRNA Precursors and Expression Constructs amiRNA Target Construct amiRNA precursor Sequence SEQ ID precursor SEQ ID SEQ ID Expression NO (with GENE ID length NO Target Sequence NO Construct promoter) inv1c.pk005.h23.f 976 bp 321 tggcgttggacatggtactta 337 PHP44230 329 inv1c.pk005.h23.f 977 bp 322 gggtggtcagttattgtaata 338 PHP44231 330 inv1c.pk004.e6.f:fis 966 bp 323 gggtggaaatatgtagtagga 339 PHP44770 331 inv1c.pk004.e6.f:fis 966 bp 324 tgggagaagatagaaggaata 340 PHP44771 332 inv1c.pk004.e11.f:fis 966 bp 325 aagaattattaatatacttta 341 PHP44772 333 inv1c.pk004.e11.f:fis 966 bp 326 ttgtgtaagggaagatagtaa 342 PHP44773 334 inv1c.pk004.d17.f:fis 966 bp 327 atcttgtgttatctcttcgta 343 PHP44789 335 inv1c.pk004.d17.f:fis 966 bp 328 cagtttttttttgttttgtta 344 PHP44790 336

[0230] The SEQ ID NOS for the various target genes advanced for further evaluation in in planta assays are summarized in Table 9.

TABLE-US-00011 TABLE 9 Fragments Target of Target Sequences Encoding Silencing SEQ ID Sequences Silencing Constructs for Target Elements for Target Sequence Clone NO SEQ ID NO Sequence SEQ ID NO SEQ ID NO inv1c.pk004.d17.f:fis 304 14, 343, 344 335 (amiRNA precursor sequence with 311 (miRNA) promoter) 312 (miRNA) 336 (amiRNA precursor sequence with 327 (miRNA precursor sequence) promoter) 328 (miRNA precursor sequence) inv1c.pk004.e6.f:fis 278 17, 284, 339, 293 (hairpin RNA construct without 284 (hairpin RNA) 340 promoter) 307 (miRNA) 331(amiRNA precursor sequence with 308 (miRNA) promoter) 323 (miRNA precursor sequence) 332 (amiRNA precursor sequence with 324 (miRNA precursor sequence) promoter) inv1c.pk004.e11.f:fis 303 18, 341, 342 333 (amiRNA precursor sequence with 309 (miRNA) promoter) 310 (miRNA) 334 (amiRNA precursor sequence with 325 (miRNA precursor sequence) promoter) 326 (miRNA precursor sequence) inv1c.pk004.h20.f:fis 279 30, 285, 286, 294 (hairpin RNA construct without 285 (hairpin RNA) 287 promoter) 286 (hairpin RNA) 295 (hairpin RNA construct without 287 (hairpin RNA) promoter) 296 (hairpin RNA construct without promoter) inv1c.pk004.i1.f:fis 280 34, 288, 289 297 (hairpin RNA construct without 288 (hairpin RNA) promoter) 289 (hairpin RNA) 298 (hairpin RNA construct without promoter) inv1c.pk005.h23.f 302 263, 337, 329 (amiRNA precursor sequence with 264 (sense siRNA, RNA sequence) 338 promoter) 265 (anti-sense siRNA, RNA sequence) 330 (amiRNA precursor sequence with 305 (miRNA) promoter) 306 (miRNA) 321 (miRNA precursor sequence) 322 (miRNA precursor sequence) inv1c.pk008.m9.f:fis 281 290 299 (hairpin RNA construct without 290 (hairpin RNA) promoter) inv1c.pk010.g13.f:fis 283 292 301 (hairpin RNA construct without 292 (hairpin RNA) promoter) inv1c.pk011.f6.f:fis 282 291 300 (hairpin RNA construct without 291 (hairpin RNA) promoter)

Example 9

Transformation of Somatic Soybean Embryo Cultures Culture Conditions:

[0231] Soybean embryogenic suspension cultures (cv. Jack) were maintained in 35 mL liquid medium SB196 (infra) on a rotary shaker, 150 rpm, 26.degree. C. with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 60-85 .mu.E/m2/s. Cultures were sub-cultured every 7 days to two weeks by inoculating approximately 35 mg of tissue into 35 mL of fresh liquid SB196 (the preferred subculture interval is every 7 days).

[0232] Soybean embryogenic suspension cultures were transformed with the soybean expression plasmids described in Example 8 by the method of particle gun bombardment (Klein et al., Nature, 327:70 (1987)) using a DuPont Biolistic PDS1000/HE instrument (helium retrofit) for all transformations.

Soybean Embryogenic Suspension Culture Initiation:

[0233] Soybean cultures were initiated twice each month with 5-7 days between each initiation. Pods with immature seeds from available soybean plants 45-55 days after planting were picked, removed from their shells and placed into a sterilized magenta box. The soybean seeds were sterilized by shaking them for 15 min in a 5% Clorox solution with 1 drop of ivory soap (i.e., 95 mL of autoclaved distilled water plus 5 mL Clorox and 1 drop of soap, mixed well). Seeds were rinsed using 2 1-liter bottles of sterile distilled water and those less than 4 mm were placed on individual microscope slides. The small end of the seed was cut and the cotyledons pressed out of the seed coat. Cotyledons were transferred to plates containing SB199 medium (25-30 cotyledons per plate) for 2 weeks, then transferred to SB1 for 2-4 weeks. Plates were wrapped with fiber tape. After this time secondary embryos were cut and placed into SB196 liquid media for 7 days.

Preparation of DNA for Bombardment:

[0234] Either an intact plasmid or a DNA plasmid fragment containing the genes of interest and the selectable marker gene may be used for bombardment. In the present example, pDNAs were isolated from bacterial transformants using a Qiagen mini-prep kit. DNA concentrations were determined by UV absorbance. Each silencing construct and hygromycin selectable marker plasmid (PHP18956) were combined in a 9:1 weight ratio to give a 1 ug/ul DNA solution.

[0235] A 50 .mu.L aliquot of sterile distilled water containing 1 mg of gold particles was added to 5 .mu.L of a 1 .mu.g/.mu.L DNA solution (intact silencing and selectable marker plasmids as described above), 50 .mu.L 2.5M CaCl.sub.2 amd 20 .mu.L of 0.1 M spermidine. The mixture was pulsed 5 times on level 4 of a vortex shaker and spun for 5 sec in a bench microfuge. After a wash with 150 .mu.L of 100% ethanol, the pellet was suspended by sonication in 85 .mu.l of 100% ethanol. Five .mu.L of DNA suspension was dispensed to each flying disk of the Biolistic PDS1000/HE instrument disk. Each 5 .mu.L aliquot contained approximately 0.058 mg gold particles per bombardment (i.e., per disk).

Tissue Preparation and Bombardment with DNA:

[0236] Approximately 100-150 mg of 7 day old embryonic suspension cultures were placed in an empty, sterile 60.times.15 mm petri dish and the dish was placed inside of an empty 150.times.25mm Petri dish. Tissue was bombarded 1 shot per plate with membrane rupture pressure set at 650 PSI and the chamber was evacuated to a vacuum of 27-28 inches of mercury. Tissue was placed approximately 2.5 inches from the retaining /stopping screen.

Selection of Transformed Embryos:

[0237] Transformed embryos were selected using hygromycin as the selectable marker.

[0238] Specifically, following bombardment, the tissue was placed into fresh SB196 media and cultured as described above. Six to eight days post-bombardment, the SB196 is exchanged with fresh SB196 containing 30 mg/L hygromycin. The selection media was refreshed bi-weekly. Four to six weeks post-selection, green, transformed tissue was observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue was removed and inoculated into multi-well plates to generate new, clonally propagated, transformed embryogenic suspension cultures.

Embryo Maturation:

[0239] Transformed embryogenic clusters were cultured for 1-3 weeks at 26 .degree. C. in SB196 under cool white fluorescent (Phillips cool white Econowatt F40/CW/RS/EW) and Agro (Phillips F40 Agro) bulbs (40 watt) on a 16:8 hr photoperiod with light intensity of 90-120 .mu.E/m.sup.2s. Embryo clusters were then removed to SB228 (SHaM) liquid media, 35 ml in 250ml Erlenmeyer flask, for 2-3 weeks. Tissue cultured in SB228 was maintained on a rotary shaker, 130 rpm, 26.degree. C. with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 60-85 82 E/m2/s. After this time, embryos were harvested and used in stinkbug feeding assays.

Media Recipes:

TABLE-US-00012 [0240] SB 196 - FN Lite Liquid Proliferation Medium, pH 5.8 (per liter) MS FeEDTA - 100x Stock 1 10 mL MS Sulfate - 100x Stock 2 10 mL FN Lite Halides - 100x Stock 3 10 mL FN Lite P, B, Mo - 100x Stock 4 10 mL B5 vitamins (1 mL/L) 1.0 mL 2,4-D (10 mg/L final concentration) 1.0 mL KNO.sub.3 2.83 gm (NH.sub.4).sub.2SO.sub.4 0.463 gm asparagine 1.0 gm sucrose (1%) 10 gm

FN Lite Stock Solutions

TABLE-US-00013 [0241] Stock Number 1000 mL 500 mL 1 MS Fe EDTA 100x Stock Na.sub.2 EDTA* 3.724 g 1.862 g FeSO.sub.4--7H.sub.2O 2.784 g 1.392 g 2 MS Sulfate 100x stock MgSO.sub.4--7H.sub.2O 37.0 g 18.5 g MnSO.sub.4--H.sub.2O 1.69 g 0.845 g ZnSO.sub.4--7H.sub.2O 0.86 g 0.43 g CuSO.sub.4--5H.sub.2O 0.0025 g 0.00125 g 3 FN Lite Halides 100x Stock CaCl.sub.2--2H.sub.2O 30.0 g 15.0 g KI 0.083 g 0.0715 g CoCl.sub.2--6H.sub.2O 0.0025 g 0.00125 g 4 FN Lite P, B, Mo 100x Stock KH.sub.2PO.sub.4 18.5 g 9.25 g H.sub.3BO.sub.3 0.62 g 0.31 g Na.sub.2MoO.sub.4--2H.sub.2O 0.025 g 0.0125 g *Add first, dissolve in dark bottle while stirring

SB1 Solid Medium, pH5.7 (Per Liter)

[0242] 1 package MS salts (Gibco/BRL--Cat. No. 11117-066)

[0243] 1 mL B5 vitamins 1000.times. stock

[0244] 31.5 g glucose

[0245] 2 mL 2,4-D (20 mg/L final concentration)

[0246] 8 g TC agar

SB199 Solid Medium (per liter)

[0247] 1 package MS salts (Gibco/BRL--Cat. No. 11117-066)

[0248] 1 mL B5 vitamins 1000.times. stock

[0249] 30g Sucrose

[0250] 4 ml 2,4-D (40 mg/L final concentration)

[0251] pH 7.0

[0252] 2 gm Gelrite

SB 71-4 Solid Medium (per liter)

[0253] 1 bottle Gamborg's B5 salts w/sucrose (Gibco/BRL--Cat. No. 21153-036)

[0254] pH 5.7

[0255] 5 g TC agar

2,4-D Stock

[0256] Obtain premade from Phytotech Cat. No. D 295--concentration 1 mg/mL

B5 Vitamins Stock (per 100 mL)

[0257] Store aliquots at -20.degree. C.

[0258] 10 g myo-inositol

[0259] 100 mg nicotinic acid

[0260] 100 mg pyridoxine HCl

[0261] 1 g thiamine

If the solution does not dissolve quickly enough, apply a low level of heat via the hot stir plate.

TABLE-US-00014 SB 228 - Soybean Histodifferentiation & Maturation (SHaM) (per liter) DDI H2O 600 ml FN-Lite Macro Salts for SHaM 10X 100 ml MS Micro Salts 1000x 1 ml MS FeEDTA 100x 10 ml CaCl 100x 6.82 ml B5 Vitamins 1000x 1 ml L-Methionine 0.149 g Sucrose 30 g Sorbitol 30 g Adjust volume to 900 ml pH 5.8 Autoclave Add to cooled media (.ltoreq.30 C.): *Glutamine (Final conc. 30 mM) 4% 110 ml *Note: Final volume will be 1010 ml after glutamine addition..

FN-lite Macro for SHAM 10.times.-Stock #1 (per liter)

TABLE-US-00015 [0262] (NH.sub.4)2SO.sub.4 (Ammonium Sulfate) 4.63 g KNO.sub.3 (Potassium Nitrate) 28.3 g MgSO.sub.4*7H.sub.20 (Magnesium Sulfate Heptahydrate) 3.7 g KH.sub.2PO.sub.4 (Potassium Phosphate, Monobasic) 1.85 g Bring to volume Autoclave

MS Micro 1000.times.- Stock #2 (per 1 liter)

TABLE-US-00016 [0263] H.sub.3BO.sub.3 (Boric Acid) 6.2 g MnSO.sub.4*H.sub.2O (Manganese Sulfate Monohydrate) 16.9 g ZnSO4*7H20 (Zinc Sulfate Heptahydrate) 8.6 g Na.sub.2MoO.sub.4*2H20 (Sodium Molybdate Dihydrate) 0.25 g CuSO.sub.4*5H.sub.20 (Copper Sulfate Pentahydrate) 0.025 g CoCl.sub.2*6H.sub.20 (Cobalt Chloride Hexahydrate) 0.025 g KI (Potassium Iodide) 0.8300 g Bring to volume Autoclave

FeEDTA 100.times.- Stock #3 (per liter)

TABLE-US-00017 [0264] Na.sub.2EDTA* (Sodium EDTA) 3.73 g FeSO.sub.4*7H.sub.20 (Iron Sulfate Heptahydrate) 2.78 g *EDTA must be completely dissolved before adding iron Bring to Volume Solution is photosensitive. Bottle(s) should be wrapped in foil to omit light. Autoclave

Ca 100.times.- Stock #4 (per liter)

TABLE-US-00018 [0265] CaCl.sub.2*2H.sub.20 (Calcium Chloride Dihydrate) 44 g Bring to Volume Autoclave

B5 Vitamin 1000.times.- Stock #5 (per liter)

TABLE-US-00019 [0266] Thiamine*HCl 10 g Nicotinic Acid 1 g Pyridoxine*HCl 1 g Myo-Inositol 100 g Bring to Volume Store frozen

4% Glutamine-Stock #6 (per liter)

TABLE-US-00020 [0267] DDI water heated to 30.degree. C. 900 ml L-Glutamine 40 g Gradually add while stirring and applying low heat. Do not exceed 35.degree. C. Bring to Volume Filter Sterilize Store frozen* *Note: Warm thawed stock in 31.degree. C. bath to fully dissolve crystals

[0268] It is recognized that the experiments set forth in example 9 can be employed with silencing elements operably linked to a seed-preferred promoter, such as, for example, those provided by the b-conglycinin-alpha (Genbank accession GU723691), Kunitz trypsin inhibitor 3 (AF233296), or the glycinin-1 (AB353075.1) genes.

Example 10

Assay of Transgenic Soybean Embryos for Efficacy Against Southern Green Stinkbug

[0269] Cultures of SHaM maturated embryos, as described in Example 9, were harvested by filtration and used in feeding bioassays with 2.sup.nd instar southern green stinkbugs. A typical soy embryo transformation experiment yielded 20 to 30 independent events that were each evaluated in 4 replicate assays. Each assay was set up in a 35 mm petri dish that contained a moistened Whatman filter disc and a H2O soaked cotton pellet along with 450-500 mg of soy embryo tissue. Embryo samples were infested with 5-2.sup.nd instar SGSBs, and the petri plate was covered and incubated at 27C, 65% RH for 4 days. At this time, the sample was replenished with fresh tissue and the incubation was continued for 4 additional days at which time, the assays were scored for insect stunting and mortality.

[0270] FIGS. 1 and 2 show the results of insect feeding assays performed using embryo tissue transformed with the silencing construct DNAs listed in Tables 5 and 8. Each symbol corresponds to insect mortality scores averaged over the 4 replicate assays for each event. Controls correspond to feeding assays conducted using non-transgenic soybean embryo tissue. For all of the constructs, several transgenic events could be found which gave insect mortality scores greater than the controls. For some constructs, more than 50% of the events produced insect mortality at a rate significantly greater than controls. Variation in apparent efficacy from event to event is to be expected due to variation in construct expression with random integration of the construct DNA in the soybean genome.

Example 11

Assay of Transgenic Soybean Plants for Efficacy Against Southern Green Stinkbug

[0271] Silencing constructs can be stably expressed in insect feeding tissue for efficacy testing of transgenic plants against southern green stinkbug. The DNA constructs described in Example 8 can be used for this purpose. These consist of trait gene hairpin or miRNA gene cassettes both of which are constitutively regulated by a soybean ubiquitin promoter-5'UTR-Intron1 fragment. Similar constructs can be built using other constitutive promoters as provided for example by soybean elongation factor 1 alpha (ACUP01009998) or arabidopsis ubiquitin (L05399.1) genes. Alternatively, tissue specific expression and in some embodiments seed-preferred promoters can be produced by the use of seed storage protein promoters including those provided by the beta-conglycinin-alpha (Genbank accession GU723691), Kunitz trypsin inhibitor 3 (AF233296), or the glycinin-1 (AB353075.1) genes. To produce seed specific hairpin constructs (i.e. long dsRNA constructs and miRNA constructs), entry clones, generated as described in Example 8 above, are combined in an LR clonase reaction with a variant of the destination vector, pKB499, modified to contain a seed storage protein promoter in place of the Gm-Ubiquitin promoter. This first LR reaction generates the promoter-hairpin-terminator cassette. The final plant expression construct is produced by a second LR reaction in which the entire hairpin cassette is moved into a vector (PHP25224) which provides a plant selectable marker gene (herbicide resistant acetolactate synthase) for stable transformation experiments. For assembly of tissue specific miRNA constructs, the procedure outlined in Example 8 would be followed with final cloning of the artificial miR159 segment into a suitable plant expression vector that provides regulatory sequences of any one of the above seed storage protein promoters.

[0272] For biolistic transformation of soybean embryos as described in Example 5, a single DNA fragment containing both the trait gene and the plant selectable marker gene is prepared by restriction enzyme digestion followed by gel purification of restricted pDNA. In the case of both constitutive and tissue specific silencing constructs, 10 .mu.g of plasmid DNA is used in 0.15 mL of the specific enzyme mix described below. Plasmids are digested with AscI (100 units) in NEBuffer 4 (20 mM Tris-acetate, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM dithiothreitol, pH 7.9), 100 .mu.g/mL BSA, and 5 mM beta-mercaptoethanol at 37.degree. C. for 3 hrs. The resulting DNA fragments are separated by gel electrophoresis on 1% agarose gel and the DNA fragment containing the trait gene-selectable marker gene cassettes are cut from the agarose gel. DNA is purified from the agarose using Qiagen's Quick Spin extraction method following the manufacturer's suggested protocol. Gold particles are coated with purified DNA fragments and used for biolistic introduction of DNA into soybean embryo cultures using the procedure outlined in Example 5.

[0273] First generation transgenic plants can be assayed for insecticidal activity in individual plant cages. When the plant has started to produce green pods approximately 1-2 inches in length, plants are removed to individual bug tent cages (BioQuip, CA). The cage is infested with 50 newly emerged second instar southern green stinkbugs (Nezara viridula). The nymphs are allowed to feed for 1 week at which time a count of surviving insects is performed. Counts are facilitated by using an aspirating device with removable vials and caps to collect insects and a hand held counting device to count each insect as it is aspirated. Counts can later be verified by freezing the sample and counting again under magnification where a measure of growth can also be performed on collected insects. Fully grown insects equivalent to controls are given a score of 0. Insects demonstrating 20-60% stunting are given a score of 1. Insects demonstrating 60-100% stunting (size equivalent to original infested insects) are given a score of 2 and dead insects are scored 3. Selected plants demonstrating high insecticidal activity are recovered from the tents, treated with Marathon insecticide, and returned to growth chambers or greenhouses to complete the reproductive phase and seed production.

[0274] The article "a" and "an" are used herein to refer to one or more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one or more element.

[0275] All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0276] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Sequence CWU 1

1

3461272DNANezara viridula 1gggtattaat ttttatttgt ttatccataa attagctctt ttaaaccaat tactttgatt 60ttttcttgat agttatcatg ttagcgactt cattaacatt cactaatcag gaaagacagt 120ttacgaaatc tgtatctaga ttgaagaaat tccgtatgat ttttaataca ttgaaaaaat 180atggccatta atcgaattag aaaaacgttt ttctactaca acaataggcg cagactttcc 240atttcgcttt gggagagggg aggtgaagaa cc 2722529DNANezara viridulamisc_feature476n = A,T,C or G 2gggtatcaat tatacatata aagtagcatt accttcctat ttacaaagaa aataaataca 60agttgattca aattattgaa ctaaactatt tctttaatca ttagtaatat gctaaaaaaa 120ttaacattac ttctgtaacg cattcaaaat ttaaaaaaac aaaagacagg atataacctt 180tccagtagaa catataaaaa aaactagaga ccatatattt gctcctaatt ctctgatttt 240aacgattatt tttttgtttt tcaggaaatt ccgtaaattt tgaaaaacac aaatccgtat 300actttttgag ttattcggaa tttaattgta ccatccctcg taactttttt cctagcttct 360tttcgttgaa gtatgttata tagataaatt tagaaggagt tgagaaattg attttagcga 420agtttcattg aaatcggtac attcgtttag acgctacagt ctgtagcaac tcagantttt 480tttccccgtt attttaaaag taaaaggcga ataataatgt cgatgaagc 5293574DNANezara viridula 3ggggaaggag ctcaagattt accctgctct gcgagtttac tgagtggaag tttatcttct 60tttccaagtt attcatcgac ttctagaaga tctctatcac tcaaacaagg gcgtaagtcc 120actctatctc ccaaagacat taactcatca tcggtagatc agacggcaga agcacagtcc 180actggaaaga gaactactca atccagtgat attgttgaaa atgttaaggc taactcattt 240tcatcttctc gtaaaggaag acgatctctt agtataccaa atggtagttc ctttgaaaaa 300aatcatttga tgcagtcatc agaatcaggt tccagtgatt tattgaatat taccaatgaa 360aagcacaata gaagtgttga tacaaatcat ttctcatctc ccttaaatga cactttatct 420aggagtaagt tcgttgattg taatattagt cagaaaggct taaatggttc atcttcagat 480gtgtcagttt tttctctggg ttcttttaat tcttcttatc ataaaagtaa aagtgatggt 540gatagtttat ctttatcaca agctactgat gtaa 5744652DNANezara viridula 4ggggattgga caagaggttt ctcgtttctc aatatgaaga tcttttttct cctttttgtt 60gtggctgtca gccatgcgct tcctcacgat gaatgggaat tgtttaagat atcgcatggg 120aagaagtaca aaacattagc agaagaacaa caccgaatga atattttcta tgacaacaag 180cagttcatcg aaaatcataa taaaaatttt gaacaaggcc cggtctcttt cactctggaa 240atgaaccgtt ttggagattt gatgaaccac gaattccgaa caatgatgaa cagatacaac 300agtacaaaag cagctagaac tagacaagat tcatcaactt atatcagatc aaccgatgaa 360gaagttcccg aatcttttga ctggaggcag gaaggagcgg tcacccctgt caaagatcaa 420gcacactgtg gctcatgctg ggcttttagt actactggag ctcttgaagg acaacacttc 480aggaagaccg gggaagtggt ttctctcagc gaacagaact tggtcgactg ttccagcatg 540tacggcaaca atgggtgtca aggaggactc atggttgacg ctttcaagta cattgctgaa 600aatggcggca tcgacactga agattcttat ccttatgaag gaagggacgg ca 652575DNANezara viridula 5gggggtgtaa taagacttcc tgaaagtccg ttttatcatt gaccttaata aatttaattt 60aatcactgtt ttctg 756643DNANezara viridula 6ggggagtctg ccagcgactt cttccccgcc atataccagc ggtacctact tgtacatagc 60agtacataag tacataagta gaggcacctc ttgatgtaca gacactccat tcctagcaca 120gaaagaagac ctcatcgctg aactgaaaat gtcgaaagat atttcgggca tcaagaagct 180caaagtggag aggaccaagc aggaggagaa ggagtactgc atgtttacaa tacaatgtta 240tcataattca taatttttat ataagtttga taagtaaaga attgtaattt tttttaaaac 300aaaattgtgc ttaaaattta taaaattcag taatttaaac tgtataaagc tgatatgatt 360taaagaaatc ttgggacctg aatcgacaaa tttctagcca tttaatgcca ataacttaaa 420taatcttatc gaatgatatg ttattataga ttttttttta aatttatgat tatgaagtta 480ccctccattc aaactaacat tagattataa acaaaatatt ttacagtttt gtaataaaga 540tcttgaacaa taaaccataa atctttattt gtagaaaata aaaagagctt cactaacttt 600tattgtaagc aaaagaaaat tataacaaag aacatgttac att 6437542DNANezara viridula 7ggggacagtt cttcgtccgt ttaggttaac actcgccatg aagatcggtt tgtgtgcgta 60cagtgggtac aaaatttacc ctggacatgg gaagaccatg gtcaaagctg atgggaagac 120ctttacattt ttaaactcaa aatgtgaagc ttcccattta atgaggagaa atcctcgtaa 180agttacttgg accgttttat acagacggaa gcataagaaa ggtcaggagg aagaacagag 240taagaaaaga actagaagga cccagaagtt tcagagggct attgttggtg catccctttc 300agatatcatg gccaaaagaa acatgaaacc tgaagttagg aaagcccaga gagaacaggc 360aattagggct gccaaggagc agaagagggc gaccaaggct gccaaaaaaa cctgaaaaag 420cagctcccaa ggttaaacag ccttcaaaac agaaggccac caaggttcaa cagaaatctg 480ctccaagagt tggaggaaag cgataatttt tttttgtatt ttaaataaat acgttttatt 540at 5428676DNANezara viridula 8gggaagcagt ggtatcaacg cagagtggcc attacggccg ggaagcagtg gtatcaacgc 60agagtggcca ttacggccgg ggaatattaa ttttatgtaa actttaactc atatttattc 120tcagaaaatt ttgtattcca gtcaataaat aaacaactca tttcaacaat tgacatgaga 180atgagaacaa ctgattatcg aaacgttgct aaaatataat tctatattta tttaatgatc 240atcaatatac ttgaaacatc attaagaata tattaaacaa ttatatttat tattgttagt 300tataacaaat ctttgtatcc aaaattaaaa gaaattagtt gacccgagtg aataatacgt 360atagtgtatt gattagtgaa agaaataaga taatgctatg tattatgtga cggagaaaaa 420attttctttt tctccatcaa taacaaaatg cattcacaag tttacaaatt acaataggat 480gcatctttgc gaataattgt gtttttatat gaatagttgt tttgtttttt tttcagtgtc 540atggataaga tccgaatttt catgcaaatg catatttttt tttttcaaaa acatgagtcg 600atatctttac gaaacaagtc attctattat tattttattt tttttttttt agcatttatt 660tataacatta ctattg 6769606DNANezara viridula 9gggggtcagt ctaacgttgg acgccatgaa gagatcttcg gaagtttgct tactcagccc 60actggattcc ggtctatgta tgagactggt aagctcagct gatgattcta cggcattcaa 120gtcttccggt gtcttcaaga cattggacct tatcctcaaa gaagacacag atggaactat 180cgaaaaggct cgaggaatct acaatttcaa agtcaaaaat aaagaaggaa aggaagctat 240atggactgta aacgcttcga ctggtaaagg ttctgttaca ttcaatggaa aggaaaagcc 300agatgtaaca tttattatta acgatgaaga tgtcattgat ctgttgtctg gtaaactcaa 360tccacagaaa gcctactttc agggaaaaat aaaaatcaca gggaacatgg gtatggctat 420gaaaatcaca ggattgttga aaagagcagg tagtaaaatg gataacctca aagctaagtt 480gtaaacagaa cagttaagac tgaatatgtg tgaaacaaag taagttaata gtgaatggca 540tcatatgaat ataaatatat gtatatataa ttgtaatgtt ttgttgataa ttatatttag 600ttaacc 60610656DNANezara viridula 10gggggtcagt gcctcagctg caatcatgtc ctcagttcta tacttggtac tcctcttcgg 60ggcagccgtg tctgccaagc acgtcctccc ttcttacgtg aagacttgct caaggaatga 120ccccaacctg agtgagtgcg cactgaagag gggcaaggag atcataccca agatcattaa 180aggagaccca agtataagac ttccagtact ggacccgatg atgctggaca aagttggtat 240cagtaccact ggtcgcgcca atgggggagg actccaactc acttgctaca aatgtatcgt 300ctacgggctc tcaaacgcag tactccagga catcaaaatt gacttggaca agaagcacat 360cgccttgaag atcttcgttc cacaattatc tgtcgcaggc aaatatgatg tcaatggcaa 420gctattgctt ttcccaatca ccggcaatgg acaggctaac atcactctgc ttgatttgaa 480agctgaggcc gccctcgact ggaagcttat caagaggaaa ggaagcgaat acgctcacat 540ctcaagggac agggtagact tcacagcatc aaggcttaag ctctccctaa ctggcctctt 600cggtggagac aaagcactca gtgacaacat gaaccagatc ctcaacgata actgga 65611688DNANezara viridula 11ggggcatcag aaccagccat gttcacagct tggtctcttt gcgccatcct cttcgccgct 60gtcttcagcg caggagctgc acccttcgat gacgatgagg atatcctagt cgacaaggtg 120aaggacatca ttacccacat caacaacttc atcgaagatc ataacttaga gcacctcgcc 180cttcccaaca tcgggctgct tccgatcgac cctctcaagc tgagacaagg acggcttggc 240aagttctcca ccatcgaatt acaggatgtc accttcatca atcagactac gatgactgat 300gggtccgtcc tgttcaactt cgacctctta cttgggctga aggagttccg gttcgaatac 360gactttaccc tttatgctcc tttcttattc aaccataatg ggcatttcac cctctcgcct 420ctacgaaact ccattcaggt atccggtaaa gttgccatca aggataagac atgcgacgcc 480agcctcggca acgtcagagt tgccgagtac ggccacttca agatcgacct ccagccgaac 540aacatgcctt atgccacgca gataaccgaa gacctcatga atttcgttac ccctctggtc 600ttacctatta caaacaaagt catggaaata gcagcttatt taccacctgt aaacagggtg 660ttgtcaggac tggtttgcaa agtcatag 68812681DNANezara viridula 12gggctaatca atttataaga cttattagct attgattccc agtttcttga atttcctttt 60tctataattt ttgtccatat atcacttggc aaaaaattct cttaattttt tttctgcaga 120ttgctgttga agtgctcatc aaagaatgtt actttcaatc tttctgtagc attttccatt 180cattgtttcc agagcccttt ggcctcctgt ttttatgtaa tgaactgttc actgcattaa 240atattcatta taactcctac cctttcccat tttcatttag aagtttaata ttttcaacat 300tcaataacac atatctaaca ccattagtta agtagtccgt acagttccat tatgtcatta 360tatagcttcc tattgacacc catcactcac ttagttttat ttaattctgc tatagtagtt 420aggtaactat caaaattatc ttgtactttt ttttcttttg gtattgctga aaaatctatt 480acgacttcac atttctccaa atcttctgtc atcttatctc tgtgtgttta aatcttaaac 540attgtttaca agaaacattg tttccaagat taatatattg tttaacgaaa ggattattgg 600cccaaatgat aatgtacttc ctataggtat tgtggttgac aggttgcctt caccatgact 660tcgagctttt atacccatct c 68113674DNANezara viridula 13ggggagctga taaaaaataa tcgttcaagt caactcacca acttgcagca aaatgccctc 60aaatcaaatt ttgagtattg ttagaaatta tgcttctgct gccgctgcaa aatctattaa 120accacctgtt caagtatttg gattagaagg tcgttatgcc acagcacttt attctgctgc 180agtgaaattg aaacaactag atgttgtaga aaaggattta aaaaatatac agagtacatt 240gaaaaatgat accaaacttc gaacttttat tgaaaatcca accattaaga ggaatctgaa 300gatcgatgct ttcaaggatg tgtcaaataa aattaagttg agtgcaccat ccacaaacct 360tcttggtctt ttagctgaga atggtaggct caatagactt gaccaagttt tgaatgcttt 420ttctacaatt atggctggcc acagaggtga tcttcgatgt gaggttacga ctgcaaagcc 480attggatgag gaaacaaaaa aacaactaga gactgtattg aaagcatttg ctaaaaaggg 540tgaaaatatt atttcggagc tgaaggttga accagctatc attggtggaa tgatcgtcag 600tattggtgat aactatgttg acatgagtgt ttctagcaag attaagaagt atacagatat 660catcacagag gctg 67414687DNANezara viridula 14actcaaaatg atagcacttt gtgatttatt ctatatgtca tccaatcttt aatttactgg 60acgattgcta aaataagttt cagaaatatt tgtctgtaat aacattaatt gctcaattat 120agaaataaag ctactaatta gcctataata tctaacatat atctaaaaaa ttagatatat 180gttgaaccct aagtattgta aacatcagca tgttatacaa taaattaata acagaaaaca 240ttcttacttc taaacagaat gaaaatatag agtacttgtg atttagccgg tcgccttcgg 300acctaccttc ttatcttgtg ttatctcttc gtatcgctca tctctgctta gttacttgtg 360cgttcttctt gttattcaat tattttcagt ttttttttgt tttgttattt tttatttaaa 420atggttacaa taacacttta ggaattactg tcttcggaag aagactatat tatatattag 480acaggtcaac taaaaaaatt ggagggtcta aaaaagttgt tgaaatagac ggaagtcttt 540tttctaaacg aaaaaatcat gtagggagag tgctctcgga ataatggatg tttggcagag 600tttgtcgaga aacagatgag tgtttcattg taaaaataaa agaaacgcaa caattctatt 660tactaattga taatatctct cttctat 68715494DNANezara viridula 15ggggttaatg ttataatcta atatttgaat tttatggagt aataaatggt actgtagaaa 60atgaattcta aatttttaag ataaaataat agactgtcga atagtacttc ttaaccttaa 120catttaaaat ccaagtatat tataacagta atataggtaa tatatttgga atcaaataca 180agttttataa tattaactca ttttattata aatgaattaa tattagaaaa ataaataaat 240cctattattt ctaaaaggag tttttttttt atcggtacgt cataacttcg tcaattcctc 300atcaaatcca acgattgacc gctcattttg aagatattct gctcctacac atgtgaaaaa 360tagtccaatc tccccgaaat ttctggaaaa aaagttatgg aggaaaagaa actttatttg 420cgaataactc aaaaagtatg catttttgtt tctggattgt acccacgata attacaaaga 480ttactaaatt acct 49416100DNANezara viridula 16ggggtcagag ttgggtagag aaactctaaa acaaatagaa aatactaaaa ggcgtttaca 60attaatgaaa atagcagaaa agaaagtgta agcagaaacc 10017693DNANezara viridula 17gggtggaaat atgtagtagg aacaaaagtc agttaagtag tatgctctct gcaatcttgg 60actataccag caataaaaac tttatcatta gagataaaaa agatatatca tttttttcta 120aagctatgga agtttgtagt aaactcaaag ataaggatct tctctacagg cttcatgaat 180tattgttgac cggaaacaat tataatttga tcggagattc atttagtgaa tcggtgtatt 240accgttattt ttttttattt gcttactgat actgaagaac ttagtaaagt aatggaattc 300tatgatgacc ttgtaccaaa cgtttatgtt ccagagccat cagtgaccaa tgctatattg 360aaagctgttt gtaacaacat ggcatgggac cttcttccca agctttggcc agacatacta 420ttgtttgagc agtatgaagt ttccggtgtc ctggaaaata ttttagatat tgcatctcaa 480aatgaaggca agaatttgat ggaagggatg tctaaaattg catggtctgc atgggagaag 540atagaaggaa taaagaggga gcgatccaac tttcaatggt ctgcgagtgc attgggaaac 600attattctca ttttgttgaa atctggtgaa aaagctaagg cgaatttggt tatgaataaa 660ttaattcaac taggaagttc tgccatgaat gaa 69318654DNANezara viridula 18ggggaggtta tgtgactgtg ttacatcgag tttgatattg ttttcattgt gaagtgttga 60ttagttctgt attacttcga agtttaaaga attattaata tactttagaa atgttgaatt 120ttggttataa tgctagaaga tatatttatg ttttcatatt tactatgcct cttacttagt 180actgatgtta cataggaaaa tgagagttaa aaaatatttg cctgatgtgt acatttgtgg 240aagaaaattt aattctagaa aatggctgct ctgtttgacc caaatgacag aagcaggtaa 300gttcatgaaa ttggtatttt ggtcaaatgt caaggcaaga tgccactgat cttttaatgg 360gagaaaagga gggtggcgta tttcttgtcc gtgatagtat ctcaattcat ggtgattatg 420ttctttgtgt aagggaagat agtaaagtaa gccattatat tatcaacaaa attcagcaga 480atgatcaaat taagtacaga attggtgatc aaacatttaa tgatttgccc agttagctat 540ctttctataa attgcactat ttagatacta cacctctaat tcgaccagca ccaaagagag 600ttgaaaaagt gatagctaaa tttgacttca atggaagtga tcaagatgat ttac 65419635DNANezara viridula 19ggggtttgca cctaatccaa tgtttggatt ctttattatg agagtaccaa tgttgcaaat 60cagagatcca gaacttattc gacttatact tacaaaggaa ttttcacatt ttcgagacag 120gatgtttatt aaattaagtg aaaaagatat tctcaatcaa catctgttca atctggaagg 180cgaaaggtgg agagccttac gtgtgaaact caccccaaca tttacaagtg ggaaaatgaa 240agctatgttc ccactctttg tcaattgtgc tgaggccttt gaatctttga tcgtgtcaaa 300aattggtagt gacgtagaca tcaaagaatt agtaggtcga cttacgacag atattatctg 360cagctgtgct tttggacttg atgctaatac aatcgaagag ccagatcata agctaaggca 420aatcccagcc caacttacta aaatggggtt tattgataaa gtgataatag caatcatgca 480agctatgcca caagttgcca gcaaatttaa agccaggttc actcctaaag agcttgagga 540ctatattgta ggtcttgtag aaaacacatt ggagtataga gaaaagaata atattaaaag 600aaatgatttc ctagatttat taattgagct gaaga 63520682DNANezara viridula 20ggggttcctt agcaggtttt cttgagtttt cattaaaaaa aaaaaaaagc actagtaagg 60aaaacaataa tataaactat atatacattt ataaaactat atactgtcgc tattttgcta 120atacatctat ttttaattaa caatatatat tttttaaata tttctgcctc tctatcaaag 180atataacgaa gttttaagtg tctagatggt cagataccaa tttcgattaa ttttatcaat 240actttttctt acggatgcgc aagtgtattt tcttagatat gctaatattt cagaaactgt 300cagttcgatt tggcccaaat ttggattaaa gatgggcatt ataaaatagt gggtaaaaaa 360aaaatcatac aattttttat taattctatc ttaaaattta cttgaaatgg agtattggat 420atcagaagaa ttcataatcg agaaaatgaa aatacattcc acaagacaaa aaggacataa 480atactaattt aaggtaatag gttattaatg ttattatgtt tgaaataatg gagcacgcca 540tttttctaat tattatcata tacatgtaaa tgtaagaatc agtagaagaa aagaaaaaca 600tttagatggt caaaaaacac ttggtcatta tcgcttcgaa taacgatttt taaatattta 660taaaaaaaca ttttttttat at 68221688DNANezara viridulamisc_feature587, 600n = A,T,C or G 21ggggccgttg tttctggttc agcatactct actaaatcta agcttaacgc agccgaaagc 60aaagaaaaca aacaatcgaa agaaacctcc aacaagggat attccaagaa agccactgga 120tacccagcct atggtgttta tggtggaggc gcttatgccg aatccggcta tgacaagaaa 180tccaaatcag cttcttccaa caaggctagc cgtaccctaa acaaggaaga ttccacaaaa 240gtaaccagct caagtgttgt agctccagga gttattgccc cagcagtcgt ttctagttca 300ggatgctcca ccaaatctaa gcttaacgca gctgaaaaga aagaaaacaa acaatcaaaa 360gaaacctcca acaaaggata ctcaaagaaa gccactggat acccagtata tggtgtttct 420ggtggagccg cttatgctga atcaggctat gaccagaaat ccaaatcagc ttcttccaac 480aaggctagcc gtaccctcaa caaggaagat tccacaaaag ttaccagctc tggtgttgta 540gctccaggaa ttgttgcacc cgccgtcatt ggtagctcag gatattncaa aaaatctaan 600gttaacgccg ccgcaagcac agaaaacaaa caatctcaag aatcctctaa caagggatac 660tcgaaacagg ccactggata tccaggct 68822121DNANezara viridula 22ggggatacaa aaacaaatgt aataacaaca aaaatacttt tatttgacga caaatatatt 60aatgaaataa taaaaaaaca ctttgagaag atatgtacat ataaaacatc aaaatgaaat 120t 12123678DNANezara viridula 23ggggatttct ttgaatttat ctaattatgt ttggccctct agaattttct ccaactgtca 60aagaaatatc cgatcaatat ggaaaaattg aaagatatga agtcggttgt cttttatgct 120ccagtacctt taacttccca tctgaaaagg atgtatgttt aggtcacatt tttgaatctc 180ataaaataat aatagcagat gttcaccaga tagggaattt aaaaaagtat ttagaatttt 240ggaaacaaca attttcagaa gctcccatta cagaattctg ttcaactatt gttgcagata 300taaaaaaaga tggtttacct cttaaagaca aagagtactt tttattatca gatgtgcacg 360ataaggataa atttattcga gaaaaacttc aaacagaatt gcttgaaagt gccttagatc 420aacaaaaatt agagagagag gacacaaatt atagtcatgg ttgtctcttt tgtcgtcaga 480ttatagagcc cacaagatct gaatatttga ttcacctttc aacacagcac aatttacaat 540tagggaaacc agaaaacctc gtttatgttg atgaactaat tgaaatcttg gaacaaaaaa 600tggaaaagtt gcaatgcatt ttttgtgaac gaactttcaa agacagaaat gtcctcaaag 660agcatatgag aaaaaaga 67824103DNANezara viridula 24ggggggtcaa cggcgggggg gcggggtggc cgaataggct aaagcgtgag taacagcacc 60gctagttgcc tggcaaccgg ataacagaga tttgagacga tag 10325613DNANezara viridulamisc_feature489n = A,T,C or G 25agtccaataa gggtgctaca tttttttttt gatcggacaa gggggcttat aaacatcttt 60agatacctga aaagagtacc atgaaaaaaa aaatgaaaac cactgtctta ttaaacctag 120acagcagtaa tgtaaagatt gatattcata actggtcttt aaaaagtttg acaacaaaat 180atgtctattt gtgaaatttt ctaaaggttt ttttcacaaa atcaaagctg gtgaggttgg 240tccattgtga ttctcaaaat ttataatttt caaatataca acaatttaag aattttttaa 300aaaagttaat aaatggatgt attttttcac cctgttaaaa gtttaacgta aatctttatt 360gttataattt ttttttttga ctgatttact atcttaattt tgatgaatca aattataatt 420ttaattttat atattattgt aaagttgaaa ttgtagaagt tgcctttaaa agaataaaat 480aatattttnt tccttcttaa cccaaaaaca attgttattt agataattag attatcattc 540gatatgataa atgaaaaaga ttatttagga aaaaatatgt tacgatattg ttaaactact 600aaattttaca aat 61326682DNANezara viridula 26gggatgctaa aacatcctgc taatcgttac agaattttaa ttatacgaca tttttaaaat 60acagtattca cctatgttcg tctaattact ataacaggaa ataaataaat taaatttagt 120ttttaaaaag tgcagacaat tttagagatt aatacaaaag aaagtttaaa atgaacttag 180taacggcacg gctgtctttt cggttgatta

aaaaactttt ctaacgttct gttcccatct 240caaatttcca atgatagggt agtacaatta tggttcggaa tttaattaaa gattaattta 300tttaagaaag taccaattat tttatgtact ttatttgttg acatttttat agtacaatta 360taaaagaaat cgtctaattt tgaatctaaa ctattcaaag ttatccttat tagtgtccag 420tttaaaaccc tccctcactt agctaaatat atatttgtta taataagtat gtgtacttat 480tttatgaata atgttaatta ataataagtt attaagtttt atatttgaaa atttcatagt 540ttaaaggttt ttttctccaa aaatcgcata ttcatttagg atttcatcat tttattttaa 600aaactccgtt tttggaattt acaactgtct gactaaattc cgtaataatt tactaactcc 660gtacctgaaa ttatactgtt aa 6822751DNANezara viridula 27ggggtggagg tctgatgcac cccagtgtca tgaagctgtt aatggtaaaa c 5128636DNANezara viridula 28ggggagatca gtagcgatgc acatctattc ctttgcgatt gtagttcttt tggcaggctg 60cggcctcgcc ggtaaatgtg gtagctacgt ccagccggcc gtctaccaaa cgtatggtcc 120agttgccgct ggtagcagtg gatactcgac cagctctaaa cttaacgccg cagaaagctc 180agaagccgca caatcccaag aatcctccaa caaaggatac tccaagtatg gttccggata 240cccaacttac ggtttgtacg gaggcggtgc ttacgccgaa tctggttatg atcagagctc 300caaatcagct tcatcatcca aagctagccg ttcccttaac aaggaagatt ccgccagtgc 360ttacaactca ggatttgctg caccaggctt ctatggccca gcagttgttg gaggctcagg 420ttattctacc agttccaaac ttaatgcagc agaaagctca gaaaactctc aatcccaaga 480atcatccaac aaaggatact ccaaacaagg ttccggatac ccagtctatg gcctttacgg 540aggtggtgct tatgctgaat ctggttacga ccagagctcc aaatcagctt catcatccaa 600agctagccgt tccctgaaca aagaagattc cgccag 63629364DNANezara viridula 29ggggagttca gttttttcca ccaaaatgaa gctctacatc gccgtcctct gcatcgttct 60catccaggga gtccatgtta attgccagag cagttacttg gactcggcca tgagtactat 120caacagtgct taccagcaat accgcagcgg aacactgttg aggaacctcc tacagactgc 180cagggaatac ctcaactatg ccgttatcag actgaaccag ttgcagaact tcatcagcac 240cttgcaggtc ccggcattgc cttcgatacc gcagcccaca gtcccaggca ggatttggca 300acagtgggct ggacgctaat tgtttcatgt acggtcaaat tataataaat tgtttataat 360catc 36430683DNANezara viridula 30ggggagtttg aataatttca atctcatcta aaggattatt taatgtgaat gatttgtgtc 60agtttttact tttaactgcg gcatatagcc tgctgcagtt aatgcgggaa ggtttacctt 120attatgtctg actgggaaca aagattgctc agcctggaaa aactggacag gtcatcgcca 180gagctctggc cagagccgat acctggggtg acagaatatg ctgctcgcaa tgctctttct 240agttcctctg ttccaaagaa cattgaatca ctccagagtc agtttactga ggatgactat 300aagctgctaa attattacag tactctttct aaagaatctc tgattcaaga attaaagaag 360cttcatgacc aggcctataa attaggtctt gaagaagcca aggaaatgac tagaggaaga 420tttttgaaca tactgtctac cagaaaaaag taatggtttg taaatgctgc catgcttctg 480aatggttcca tcatattctg atccagaaga aggaagttgt agcgaatgga gtaggtataa 540aagtgagtca ataaggacaa gaagggctaa tttaatgtat ttttccaaat atttttgtaa 600ttgcagaata gaagatttat gtgaagaaat gaatttaagt ttttgttgtt gtaactgtct 660gttatagttc cttcagtccc aaa 68331672DNANezara viridula 31ggggagcaat agtagaatta tgcgcgtcat atgtgcaact gaatagtgat gctagttagt 60tttaattgta tatattatga tgtgaagtaa ttatgtagcc cgtaggaacg ataaggactt 120aattaattaa gtttgggacc tgatatcttc ctaagggatt agtgcattta agaattaaat 180ggcggctgaa gaaaaatggt attttaccaa ggaacaatta gcaaatactc caagcagaaa 240atgtggcttc gatgcggata aggaattgtc tagcagacag caagcagcaa atttcattca 300agatatgggc caacggttac tagttactca gctatgcatt aatactgcga ttgtatatat 360gcatcgtttc tatatgttcc attcgtttac acggtttcac cgaaatgcga tggctgcagc 420tgcattattc ctagcagcta aagttgagga acaacccaga aagcttgaac atgttatcaa 480agtggcccag atttgtcttc acagggagca acctccactt gacatcaagt ccgaggttta 540tatggagcaa gctcaagaac tcgttgtgaa tgaaaatata cttctccaga cccttggatt 600tgatgtcgca atagatcacc ctcatacaca tgttgtaaga tgttgtcatc tagtcagagc 660aagcaaagat ct 67232664DNANezara viridula 32ggggattgaa tgtttgatag cacgttgtga ctccttgtac cggtactttt tgataataag 60attcaaaatg agtgtaataa ttaagaatgc tttaagaatt cctgctctta aatcggctgg 120aaaacttttc ggtacaaatt ccactgttaa tgtcaccaaa atccaagcta ccaggagtat 180ctggaacttg tcgcaatctc aggaaacttt tcatcataag tgccgcaaac acaatttttg 240tcaatgttct tctttaagaa gtttacacac tcgaggagag aaagaacttg ctgattttct 300tgtggaggaa atatcagctg aaagaaagtt acaaaaaagt aagaaattac cttctgaaat 360tgatgggttt aaaattgtaa ttgaaggatc tgaaatcagc cttgtaacga aaaatggtga 420tgaaacaatt gaagtaaact tcaatgtcaa tcattctgtc gataccgacc cagttgaacc 480tgaaattgaa cctacaatgg acaaacctga acttggcgag atgaaatcta gacctacttt 540tgaagttgaa accaataggg cagggcagac actgggcttc acatgttcaa ctgtatcacc 600ttctcaccag caaggccagc aagaagaaag ttacaatgat ctatttctta ttgatgaagt 660tgtt 66433394DNANezara viridula 33gggggatgtt ggaactggct attatttgaa tatgaatatt gaaagtgcca gagactattt 60caaaaggaag gtaacttttg tcaccgaaca aatggaaaag attcagaata ttgggctaga 120aaagagtaaa ataagagaag ctattatgga tgtgatggag atgaagattc aggctcaatt 180agctacacag agagcggtcc aaaatactat agcgaaaacg tgagaaatga tgagagctgt 240catacgaaaa atttatgttt cttatattaa cgcttgtatt tataatttac taatgttttc 300acagagtttt gtatccataa atacctgtta ttaaatatgg aaattatatt ttagttctaa 360cttttttttt ataaataaat acattttgtt atgt 39434634DNANezara viridulamisc_feature462n = A,T,C or G 34gggggaagaa attgagagaa tggttaatga tgccgagaaa tacaaggctg aagatgataa 60gcagaaagct gtcattcaag ctaagaacac tctggagtcc tattgtttca atatgaaatc 120tactgtagag gatgaaaaac tgaaagacaa aatttccgat tctgataaaa ctacaatttt 180ggagaaatgt aatgaagtta ttcgctggct cgatgctaat cagttagctg aaaaagaaga 240attcgaacat aagcaaaagg aattggaagc catatgcaat cctattatta ctaaattgta 300ccaaagtggt ggtatgcccg gaggaatgcc aggtggtatg cctggtggtt tcccaggcgg 360tgcccctcct aatgctggtg gtgctgctgg acctaccatt gaagaagttg attaaacatt 420ccatgcgaat aaacacacaa ataatacatt gtataattaa tnctagttga attgcaattt 480ttttttcctt tctagtcaag agaccttcaa atggccttgt atttttgttt aaaaatttaa 540tgttaataat gtaactttta caagtatttt gtttatttat aattttttta tatgttctgt 600cattggtatc aatgaattat attagagtta ctat 63435491DNANezara viridula 35ggggaattta tcttaggtcc aagatgaggg ttatccttgc agtcatccta ttcgctggag 60tggcccttgc caggcccgac ggctacacca ccaagtacga caacatcgac ctcgacgaaa 120tcctcaacaa cgacaggctc taccagaagt acttccagtg ccacaccaac aaggggaagt 180gcactcctga cggcaagcag ttgaaggaca tcctccctga cgccctgaag agcaagtgcg 240ccaagtgtaa cgagaggcag aagaagggag cagagaaggt gttcaagcac ctcctcgaca 300agaagcccaa cgattacaag accctcgaga agatctacga ccctcagggt acctacaggg 360cccagtacaa gagcgaagcc gagaagaagg gaatcaaaat ataaaaatat ctgtgataaa 420cttgtatgaa tgatgtgtgt ttgtttttgt ttgtaaattg ttatttaatt aataaataat 480atgtttataa g 49136663DNANezara viridula 36gggcaataaa gctcgttatc acttggtatt cgacattatt atttctcttg ttgccactct 60tacacggcgt cggactaaga ttaaattttg aaaaatagcc cattgctgaa atgatgaaca 120tttcgatcgc taacaatatg caggtccgat ttttattttt tgagatatgt caatccaaat 180gcaaaaacac tttagttaat cgactccagc tgattttact cgagcgttac acatcggata 240tctgacggct caatctaatt cactctctac aaaaaaaaat attattacta atcaaattaa 300taatatgcaa taaatttgaa atcagagata catcctcaat tcttaaaata atattttaac 360atattctttc tattatgagg cttgcgtttg atattcaaaa tattacaaga aataattttg 420tggaagatgg aaattaatat gtagataatt gttgatattt cataataccg acataaccta 480accttgttat taaactttaa ctagctgata aaatgtcggg tattaattaa ataatatcga 540caacccgcaa gtaaaaaacg cgtctaaaga agttttaatt taaaaatata gtgaaaataa 600ttttattcag cctacgttcc gacctaacta tacaggtctt catcaggact atggtcagga 660aac 66337548DNANezara viridula 37ggggacagct cgcccagctg gaagagggtc aacatggatt cgcaagaact agaccacagc 60gagctgagga gtcgcctcta ctccatatcc tccctcatct tgcccatctt catcctcctc 120tacgtggggt ggaggttggc caacaagagg ttcatcgaac tcgcagaaaa gataccaggt 180cctccgggtc ttccgatcat aggaaacgtt ctcgaactgc gagggacgcc caacgaaata 240tttgaaaacc tatattcgaa gagtgaaata tatccagatg tcgccagagt gtgggcggga 300ccaagattac tggtttttct tacaaatcca gcagacattg agattgtcct cagtagccat 360gatcatttgg acaagtctgc cgaatatgat tttttgagac catggttagg aaatggactt 420ctagtaagca caggagagaa atggcgatca catagaaaga taatagctcc aacatttcat 480ctgaatgttc ttcgcagctt tatggaaaga tttaacagaa attcaaaaaa aacattagaa 540agactaac 54838598DNANezara viridula 38ggggattcgt gtatcagttt gcaatacaag ctacttttaa atttaatatc atcactggtg 60tttttaaatt tcaatcataa attactttaa tacacaagtt atttgaagtt gttttaattt 120atttcaggcc acataaatat ttaataaaat atgtctgggg accaaaaaga aagaaaaagg 180aaggaaagta tcttagattt gtcaaaatat ttagacaaag ctatcagagt caaattttct 240ggcggaagag aagctgctgg tgtattaaag ggatatgatc cacttctgaa tttggtttta 300gatgatacaa cagaatatat gagagacccc gatgaccctt ataagttaac tgatgaaaca 360aggatgcttg gtttggttgt gtgccgtgga acatcggttg ttcttatatg tccagttgat 420ggtatggaga gtataccaaa ccctttcgtt ccacaagaat cataaataat ggactaattc 480taagtttaag aagattaagt tctttcctac ttatgaaaat gaaaagaatt tactttattt 540aggtttaaaa aactgtttgt ttataaacat gtatatatat taaaaatctc cattttta 59839689DNANezara viridula 39gggattaaaa aaagaaattg attattttat tttttattaa ttataagaac attaattaca 60atttcagcta ataactgaat aagaatatga ataggtcttg aactaaacat aatatcattt 120attcctttaa ttttacaaaa aaaatagtaa atcaagatcc gaggcagcta taatttactt 180tctaattcaa agaattagaa gaattatcct atttataata attacaatta atttattaaa 240attattaaat tattcaaatt ttattaatat attaattaca attagaattc taataaaatt 300gggagctgca ccatttcata agtgaatacc tgaaattata acaaaaataa gatgaataaa 360atgtataatt ttaataacat gacaaaaaat agccccatta ataataattt gtaatttaaa 420tagaagtaga atattaatta aattatcaat tatttgatca gttggagttg gaagaatcgg 480aggaattaac caatcatcat tacgaaaatt aatagcatat tcatcaatta accatttagg 540atgaatacta gccattaata aaaaaaatta atttatgatt agtatattga ataatttata 600gaataattat ctttataatt tgtctaatat ttaataatta taaattatta ttcttaaatc 660aaattagcag atccaatata aataatcca 68940662DNANezara viridula 40ggggagttga ggtttggcaa ccgacttgtt tagagatcct gcaagaaaat gagagctacg 60tactgcttaa tcctagctgc tgcagttctt gcagtggctg cagctcacac ttaccatctc 120ggaaattgcc ccatcgtaga acctatgtct ggttttcaga tgtcaaagtt tttaggttta 180tggtatgcca tccagaagac ttcaacaggt agcagatgct tgacatacaa cttcactctt 240ggggaagagc caggcgaata caacttggag caagtttctg aacatccagt cttaggagta 300gcatcagttg acaacaaata ccattacaca ggacatttaa aggccaattc tgacgttcca 360tccaaaatga cagtgaaatt tcctttaagt gttgctggaa catcaagttt cacagtcttc 420atgacagatt acgaaactta tgctggaatt tacacgtgcc aaaaactacc tgcagctaat 480agaagatcag ctaccatcct ttctaggacg aagacattgg ataagatggt gattgataag 540attcgttccc gtctgtctaa cttcggtgtc aacccatacg acctcagcat cattgaccat 600gctaaatgcc cagcagaaac caaccttaat ttcaacatcg acaaggaaac cttctcacct 660ca 66241628DNANezara viridula 41gggctaacaa gaagaaaaat aagtcagcga agtctaaaca gacagctgaa caaaataaat 60ctaaacagcc tgccgagcaa aataaatcac cacccagaac tagaagcaaa tcaaacacca 120caaaaacagc tccaactgca ccaaatacca cagccagcaa taattttgat cttggtagta 180actcacctaa caagcctccg gtacctcaag gttttactga ccccgagccg ccccctattt 240ttgtctctaa aattgaaaat tttatatcat tcgttcaaga aattgccaat cttatcggac 300aaaccagttt ccgctgtttt tctagggtta atgacattaa gattaacacg agctctaaag 360aaaattataa aactctgata aattatttta caactaaaaa atatgaattt cactgttacc 420aactgagaca agaaaaggca tatcgggtgg tattgagagg cttgcactca accactccca 480tatccgttat caaatctgat ctagaggaaa taggacataa cgttaggcat atagcatgcg 540tcctacatcc aacgcaaaaa tatccattgc cactgttttt cgttgatttg gagcctgcaa 600gcaataacat tgacatattt caagttaa 6284270DNANezara viridula 42gggtcagtaa aaagccaagc ttatctctaa tctccaaaat taaaattttt attaaactat 60ttactgaacc 7043685DNANezara viridula 43ggggacacca caggacatcg ccatggtagc taagatatta ttggtttcac tgggccttat 60agggttgact tttggcagcc atttacaaga ttctaggcaa ttcctatacc agcagcagca 120acaacaacaa cctgccagac agtatgttgc atcacaatac caccaacttc ctgcggccac 180ccatctactt ccgaacaatg tcaatgatgg tgtaaggtat ggacagcagt cacttgtgta 240cgtaatgcct cagggttcac agtacctcta cgaggaaggc gctgaacagc cacagcaagc 300tcaacctggt ggagcttatg ttgaatcttt cttcaatttg gtcaataatc catcaggata 360tcatcaagca gcaagtgacc aaaagcctgt ccatcagcaa cctgctctgc cttctggagc 420tgaaaaacct gaaaggcttc aggcagagcg accaagtttg ccaacccagg cagctcagca 480gcagcactac ctccaacagc tggctgctca agaacagata caatatcttc aacaggaggc 540acaacgacat aagtttatgg ctttgtcttc tcagcctcaa tatttccagc aacaacaaca 600acgaccagct gctgcagcac cacacaatct cttctactac agtttccctc agcagcaact 660tcagcagtat gcccaagccg ataaa 68544669DNANezara viridula 44gggggtttct cagagtagtg gttccaggcc tctgattaag aatacataga tgaagacagc 60acgtccccgt tcttgaaaaa atcacttctt caaatgtgga ttcaactgaa gaaaatgttt 120tgattcattt gagatttgtt catcaattcc atttatatca atgccacttt ttccaaaaac 180attttcaagc agtgtacttc ataatttcta agtatcgtct tcaagaaggt ggtacaaatc 240tgctacatac ctaaaaaaat aaatagatat cagttattgt ttcattataa taaattgtta 300tattagataa gtttttaaaa attacaaatt ctttataaat aaatacattt aaatactttg 360ttgttctata caaaaggctt ttttaaaatt tatttttgta taaaacagca ttgagttagt 420aagtatgatt tttgaaattt ttatttcaat tttgcattat ccagttccaa ttactaccag 480aaagttagtt atatacagtt ttctttattt ttaagaatca attttctagt tattagaaat 540ttttaagtag aatattcaac atagtaggac aaatctactt tcttattgtt ctagatctct 600cagatcgatt gcatttgttg tatgattgag caacatttta ttataagcag aaatattata 660aatgacaaa 66945134DNANezara viridula 45ggggagtgtt gaagggaccg tccgtctggg ttgtgagtag tgttctcgtc gccgttctca 60tcaccattat aattcggaag atggcagagg tggccaagag tgtgaatgaa gtcatggaat 120cagttacaac agtt 13446225DNANezara viridula 46gggggtcgca aaaggagtaa tgaactatgc aaggtgatag cccatatatg gtaagaagaa 60tgtgtacccg aaaaatggaa gtgatcccac agagtgaaat gaaaatattt ttttattatc 120ctgggactgt tgtcccttta ggacaaatta catatacaaa ataaatgccc gtattgccat 180acataaaatt aattatttac aattattatt aaaattaaga ttttg 22547664DNANezara viridulamisc_feature557, 610n = A,T,C or G 47gggggcagtc gagtgtgaca tgcccgcctg agactttatg ctggcaggcc cgagtatgac 60tgtgcttaaa ttgccccaga tggaagagcg caagtcgccc gaagcggcca aagggatcag 120cttcagcgtg gctgcgttgc ttgcggactc gaggaggagt cctagccccg aagaagagga 180tgactcagcg gaagaggaat tggacgtgtg cagggacaag agcccggagc cggggtacag 240ccagcagcag cggctggtgc tcagccccgc cagtggcccc atcaggccca ctcccttcac 300cgccttcgct gcggccgccg cagctgccta tgccggtctg ccgccgcaca cggcctcctg 360gccggtccac cacttcccag gagggccagt cttcccgccc ttccatggcg gtctctcttc 420ttctccaggt aatagatctc tcaatgttca gttatatata ctcatgtatt gtggtggtca 480taattaaggc agaacgaatg attggaaggt tcgcggaatc atatgctaac taacgggtag 540ttcttgttta ctaacangat aactacccgt attacgaaac ttccgtgtat aggtggaaag 600aaataagtan gatcattata acatcctcca atgaattaaa atagagaata agtgataaaa 660gttg 66448452DNANezara viridula 48gggggctctt gctaggtcgc gtgttgttga agtattgtgt gggacatcaa atttatttta 60ttttgattaa aaatttagta aaatgagtag atttttcgct actgggtcgg actctgagtc 120tgaaacctct tctgaagagg agcagattgt gaaacaaact gccactttta cgttcagtga 180tgatgaagaa gatacaaaaa gggtggttcg ctcagcaaaa gaaaagcgct atgaagaact 240taccaatctt atcaagcaga ttcgaaattt caaaaagatc aaagacatga gcagtatgtt 300aaatagtttt gaagatttaa tgagagctta tcaaaaagcc caaccagtta tcaataagga 360agaaaatggt caaactccga agttttatct gcgttgtctt gttgaggtgg aagatttcat 420caatgaaatg tgggaagata gagagggaag ga 45249275DNANezara viridula 49gggcaaccat cttatgttca aacaacgcca tatgatccat ttagacaagt atttcctgca 60gtcgaccgaa caactttcaa gaaaaaataa gaagaaagca agaaaagacc aaaatgcagc 120ctatttatct caacgaaata atcccaattc agtttgatga ctggattttt gtatttatat 180actcatattg agacatacct acataacaaa atttgacaaa atctgaaatt atttgctccc 240aaaagtaaat taaacaaata ttctgaaaac aaaag 27550569DNANezara viridula 50gggcgggaag tggagcgaca atattatcct ccgaattcta ctgatgtaga aaagcttggg 60ttaagacggt aaatgtcttt gaagccaaag acaaaacata aaaaaactga gcgagtttcc 120ttgaaacaac atgagcggaa tatttatttt aaaaaatgta tcataatatc atagtcgctc 180caaccgcacc ttgataacct gtatattacc tcctacttcc ccattcctta tctttaatga 240cataaacata gaaggaatta aaaccagtct tatatattat acttatacat tatagagcct 300tcttcttggt tagagatcaa tcaacattat tgattagggg tacaatcctt gagcgtgatc 360ttggtgcaat cagctctctg tactgttggc ctgaaacttc gtaagtatct tcatctcatt 420gtgaactaca aatattttat tttcgaatta ttgaaattgg agcgtttgaa agcaagtaat 480tcctagtata agaagttgtg aatacccatt ttttcccact tgaaccgtaa gataatataa 540tcataaaatg aataaaaaga aaaaaaaaa 56951586DNANezara viridulamisc_feature534n = A,T,C or G 51gggggattca gtcgccggct tccatacaaa tattcaagaa acaaaaatgt ctttagacga 60gaacttcaac actgctgctg aagatgtcaa agcactccag ggaactccag atgaccaaga 120attattggaa atttatgcac ttttcaaaca agggactgta ggagactgta atacttccaa 180accagggatg ttcgatttta agggaaaagc taaatgggag gcttggaatg ccaagaaagg 240cacagcccaa gatgcagcaa aggagagcta catcgaaaaa gtcaaaactt taattgggaa 300atatggaaag aagtagacat tttgagtaaa gcctaacatt tattttttat taataattta 360tgatttgctg ctcaaaattt gattttattt tttacattaa tgtaagcaaa catttacaac 420attcaagaat atttgaacca aaggttgtgc aatttatgta tataatatat atacatataa 480ggtatttctt ttataatttt tcataaattt atatttgtta aaaaatttga aganagtttt 540gtaaaatgat tttttaatac atttatatgg atagttgaat attata 58652633DNANezara viridulamisc_feature555n = A,T,C or G 52gggcttcacc ccttacaacg cataagctgc acgtgtgttg ggacagtctt ctgcttacat 60tctggtttac caacatcggc gtgaacatta aacctggagc gttactagta tgagctccaa 120tacctgttat agatgtaacc ggactgggca tttcgctaga gaatgcccaa atggtggtgg 180aggaggaggt ggaggtggat ttggaggtcg tggtcgagac aaatgttata aatgtaatcg 240ttatggtcac

tttgcaaggg attgtaaaga agatcaagac agatgttaca gatgcaatgg 300agtgggacac attgctaagg actgtcaaca aagtgctgat gagccttctt gttacaactg 360caacaaaact gggcacatag ctagggaatg tcccgaacaa agagatggtt ctagaggtgg 420gttcacctca gcttgttata attgtaacaa aactgggcac atggcccgag catgtcctga 480tggatctagg tcctgttaca gttgtgggaa gacaggacac attagtcgtg actgcgataa 540gaatgactga atganttgtc aaaattaagc aagttatata tttgtttttg taaggggcaa 600ctttttcttt tcctttttta ctattacacc ttg 63353535DNANezara viridula 53ggggaaaagt gacaaacaaa cgaatgggtt ccataaggct cagagaaaca gatgaagata 60tagcagatct tttatccatg caatggatgg aatatgctca tatttatttg ataaatatta 120ctcctccata ccgcagtttg atattaacgg aactgaatga agctttaagt tttcagtcat 180attttggagg aaatcagata actgcagctg ataaagctgt tttcagagct ttaagacaca 240taatggtgat gttttattat taatttacta taaacttatc tttggagatt tttctttata 300tatgtatgtt atatgggcca tttcgaaatt ttgatcacat ttgggcatta tttttttaga 360aaaaagaaat ttgagaaata gtgttttttg gcttcttaac aatctttata gtttgagaag 420gagttgcggt caaataaata aaaaaattaa aatatataaa ttattttaat ttttgccgac 480gtttcgaccc actttgcagg tcgtcttcag ggctacaaaa gatacaaaca tgttg 53554686DNANezara viridula 54gggggcagtc gagggtgaga tggcggacaa ggccgcacct tttcatcatg ggccaaaatc 60cttctcttct atgtatgttt ttacgcttgc cttatgggct ttttctcagc cctcctcgcc 120ctgttcttcc agactctcga tttcagagca ccgaagtggc aacttaaaag ttcattgatt 180ggcgataacc caggattggg gttcaggcca atgccaccag aatctcatgt agaaagtaca 240cttgtctggt ataaaatcag cgataataat tacgcaacgt ggacgacaaa actggatgac 300ttcctaaagc catacagaga gccagattca caatgggaag cattaaagca aaattgtgac 360tataatgaca cacctgattc tccagataaa gtatgcaagg tagacatcag ttcatggtca 420ccttgtgtca aagaaaacaa ttacaactac cataatgctg ctccatgtat tttccttaaa 480ctcaacaaga tatttggttg gatgcctgag ttctacaatg atactgaaaa gttaccagaa 540aacatgccaa cagatcttaa aaatcatatc aaggcagaaa aaacaagtca tgcagcagaa 600ttgagtagat taaatacagt atgggtgtct tgtgaaggag agaatccagc agatgttgaa 660aatgttggtt cgatacaata tattcc 6865550DNANezara viridula 55ggggggaggt ctggttcacc catgtgtcag gttaattcat acgaaatccc 5056666DNANezara viridula 56ggggaggacg actatacttt ttatattttt tttttaatcg cacgattttt attttaaatt 60tgaaaacgta tttttcctat taatttcatt ttcctggaat acgaatgagt gtgatattaa 120aaaataattt ccttatttcc tttgcaataa ctgttaatgt cataaataca gagataaacg 180gactagttat ttattttgga aattaaattg tcttgaaggc agactacaaa caattgcagg 240ctcgcaaacg gtttctcata aaaaacataa tatcaatttt tttaaattta tgtttaatat 300gcatgttgta tcgatcagat atgaaaaaaa ataaaaatat tattaaaata gatataattc 360taatatttat ttttgtattt atttatttga gtgtgttttc ttcataaatt gaagtttccc 420tcagccaaat tccttcccca gtcgtttcat ccacttctcc ctgcctatcg cattctccta 480cgtcaatcct cggctctata ctctctgcca caacatctct ccatatgacg agcctttcct 540ctctttttcc tatcctcggt ctcccagtca aatgtcgttt tgggaagcag ttcgctatta 600gccctttttc tatgctcata ccactttaat ctcctttctt ccattatctc ttatatatta 660atctta 66657586DNANezara viridula 57gggctcctcc tctctcgatc atagagacct caagtcgacg aaatgagaca tgtattcaat 60gatagtaata caattaccat caggttgtgt ggatgcgtac cctatgcctt gcgttatctc 120gaaaatagta cgttttggac ttaaaaacgc aggatccgat agttccggag gaactattcg 180ggtcttgctg tacgcatcaa aatcttcaag gtccaatttg ttccgcatcg atctatagac 240ctaccaccgt cccagtattg aagcctagca aaatgtttgt atcgacttta cttattttag 300aaagaaaaac aaaagcggag aatacgattt gcttaccccc cgtgaaattc tgaatccaac 360ggtaccccat tcatggtatt tgagcatgac aggagcttat atttggtaca aaaccgattt 420cgagccttac tgtaataata tatgtacgga tttaagccca atatgaaaat attcttctct 480gtttttggta ataataactt ccgattaaca acaattgatt tatttgttgt attttcaagt 540ctataaaatg gacttaataa acaagaaaaa tgtaatttat ccacgg 58658431DNANezara viridula 58gggggaacgt gaactttttc gactaggatt tagtcgcaat gtcttttttc aattttttct 60ctcaagttgt gccttctgtc aaggcccaag atgacgaaga agagctggta gatccgcaag 120tggtcctcaa ggagcaatgt ggtgagaaat gctcgaatta taaagataaa ttagactctt 180gtaatggaag agttagctca agatcacaga ccaccgaaac ttgctttgaa gaactcattg 240acttcgttca ttgtgttgat cactgcgtag ccaaagacat attttccaag ctgaagtgaa 300tgtttctaaa aaggattgtt tttaaatttg tagctttaat tgttagtcat atgtacatat 360aattctgtgt tttaagttaa acaattgttg aaataataaa ttcattagct cagctgagtt 420attgtttatt t 43159606DNANezara viridula 59gggggtctta cgaaagttga gttgtagtta tttttatctt ctctgagaaa ataatgtctt 60gcaaaacatt attcagtaac aaactttact ccagactgat aagtcttcct ggtataaata 120tgagccaatc ttcttattcc actggtttgg gagatctggg tagtggtgca ggacaggggg 180gtggagatgg aggatcagta agacaggctg gaggtagctt tggaaaaaga gaagctggat 240tagaaggaga atattttaac agattaaaac aacaacagct tgaacaattg aagagcagca 300tgcacgatga cgtaaagttt catgaagaac aaatcaagag acatcaaggt gctattgaaa 360aaataaaaag ccgtatcaac agtgcagaat aaatttagta tttattttac accaataaag 420ttagcaatgt tagatttaaa agatattgct ggcctattga tattgaagtt ttgggattta 480tcaatatatt atatcctcat ttattatatg tggaaaattt atatattgga gaaaaaaata 540cgtagtatat aattttacag agcttttaaa tgatattatg aaacatttgt atttcattaa 600gtattg 60660615DNANezara viridula 60gggggttgtc ctttcgtgta gtggcatcgt tccagatggt ggtcaattca aaaatccaga 60aggccggagg agctgagcct gatgcttttg aggcatctat tgctcaagca ctcttagact 120tggagatgaa tagtgatttg aaggctcaat taagagaact tcatatcact aaagcaaagg 180aactagattt ggctggaaag aaatctatca ttatctatgt tccaatgcct caattgaaga 240atttccaaaa aatccagatt aggcttgtca gagaactgga gaaaaagttt tctggaaaac 300acgttgtgtt cgttggagat aggaaaatcc ttccaaaacc tactaggaaa tcgagaactc 360agagtaaaca aaaaaggcca aggagtcgaa ctcttacatc tgtttatgat gagattctgg 420aagatatggt gtttccagct gaaattgttg gtaaaagaat ccgtgtaagg actgatggca 480aacagatcat caaggttcat cttgacagat tacaacaggt caatatcgag aacaagattg 540acacattcac atcaatttat aagaaactga cagggcagag aagttacttt tgagttccca 600caaccctatc tctaa 61561517DNANezara viridula 61ggggagtcct agcatgtgct catagcaggc gggtcggagt gtgctctcga gagattacga 60tgccgtcgtc ctgttcctgg atatttcctc tgctcttctg ccttcatcta gccctagcga 120aagttcaata taaaacaaaa tgcagcgacg acacaatgga ggtagaactt cggcgcaccg 180atgacatcaa cgctatttac ctcgaaggac tcaagcatta tccagatcca gcctgtaagc 240ctgtattatt cggacatcag gcagtattca ggttgtcttt gaatgacgta ttcaaatgtg 300gcataacaag ggtcatcaac caagcaaatg gcttaagaac attttaccat agaataataa 360ttgaaacaga taataaagat gcacccaaag aagcaattca agtcaaatgt ttgcaagctg 420gaaatcacac catctttaaa agaaacgtac tgcctgctgg atttcaagag cccatagatt 480tggatattac tacatcctta acagggcgtg cccctca 51762631DNANezara viridula 62gggggtgtca tttatttcaa tgatggtgtt tgctgtcatc tcaaccatgt tgttgttagt 60cagtttgatt ctatattgca aaaattcagt gcaagaagta aaacgtttgg catttataaa 120tggttatgtt gattcaatgg tatgcacata cttttatggc tatttgaaaa aaataattcc 180tgatcaagga actggaacag gaggtttata tgacaaaata atgatctaca aagaaaaaca 240aaaccttacc aacaaagatt ttccgtttca taaaatcttc attattatat gtgcatccgg 300atttgttcca cctacccttg aaaagataga taacaaacgg atcgaagcta gaaagcactt 360agatccgttg gttttaaata atgctggaat aaatggtcga cgttatacga cagctgtata 420caaggtcaag taccgcaatt taaaggatca cattactgtt gccatggagg gtactcctcc 480attacttact ctgtcggacg cttctgcaga agatccagaa ctaaaaaata acaagaaaca 540aatcattgaa atgttttata aaagattatc aaagaaattg gctgaaaatg cagaatttgc 600aaattcttat gaggttgtat tttacaatga t 63163572DNANezara viridula 63ggggtggtgt ggaaaggtga ttagagggtg ttaatacgtt aatagaatat ctatttgatt 60aaacttgtgt attgtttata ttgttattag ttactttgtt gtatgtgaaa agtgcaacta 120gttaatgttt aaagcattaa taggatacat atatatttga ccaaacttgt atagtgttta 180tttgatcaaa cttttgcagt gaagcccttt acagtttagt gccaggtgtg aggtgcaatt 240tggcttctta ataaaaatta attttcccga ggatatcacc agtacagagt tgcctgttgt 300gtatattctt tctgaattat ggatgaactg cagggagaag tggatgaatt gaagcgacag 360cttgagtttg agaggcataa ggctgaagtg gctagattaa ggcaacaaaa tgaagatcta 420agagtttacc aagttcttga tgagtgtgaa gggtcagatg ttgatgataa cgtagaacat 480cattcagaag tagaatttga cataagcgac aatgaaattg aagctatgct ggaagaaggt 540tttgaaaaag gagtaaaaac aaaggacgaa tc 5726470DNANezara viridula 64ggggggggag gtacgatgtg tccctgtgtc atgtactgta catcgattct gtgtacaaca 60ataaagtgcg 7065621DNANezara viridulamisc_feature547, 548n = A,T,C or G 65ggggaagtaa cagctgatac tacagacacg gcagcttgaa tgatgtgtct catcagtttt 60atttatttct gttaattaag gtgaattcgc gatggcagta acattgtggg gattgttaga 120ggcttcgata ttgttcctca atgccgtttg tgttcttcat gaagaaagat ttttagcaaa 180aatgggatgg tggagagcac caagtataca aggctttggt gaaaaaccta ctctgaaaag 240ccaatgctta catttaatgc attctatcag aacagttacg aggataccgt tgattttcat 300caatatagta gtgattttag taaaacttat tttgggttga tacacttttg actccattcc 360ttgaatcctc taaaatgtct gtgaaaaagt tcatagatat tggtgccaat ttattagatt 420caatgtatca aggtatttac catggaaaga gcaaacatga acccgatttg tccgatgttc 480tgacccgtgc atggggcaat ggtctggata agattatttt aactggtgta agtttgaaag 540aaagtannaa actttagatt ttacagacac tgatagccga ttgtattgca ctgtgggctg 600ccatccaact aattgcgatg a 62166577DNANezara viridula 66ggggagaacc cgtcaccaat tggtaaggta tatcagtcct tacgctttct cgaataattg 60tcagtatcca gtgtgatcta caattattaa cacatctaca atggcatcca atcaagtacg 120ccaaaatttc catgctgact ctgaagaggc tatcaacaaa caaataaata tggaactatt 180tgccagctat gcttacatgt ctatggctta ttattttgat agagatgatg tagctttaga 240aggtttcaca aaatatttca agcatgcttc tgaggaagaa agagaacatg caatgaagtt 300gatgacttat ttaaacaaaa gaggaggaag agttatcttt tctccaattg ctgctccaag 360tacaaatgac tggggatctg ctgagaaagc tgtcgaagca tctcttcagc ttgagaaaga 420tgttaatatg agcttgttga atcttcatgg tgttgcatca tctcatggag atgctaacct 480ctgtgatttt atcgaaaatg aattcttgca agaacaagtt gactcaatta aatctcttgg 540agatctgctc actaatgttc gtcgtgtcaa ggaagga 57767544DNANezara viridula 67gggtcagtcc tctcgtggct atcgttgtgt tctgttctct ctccatctct ctctcatctt 60ctcgtctctc tacgctctct gttcaagtct caggctccgc cttttctacc gtcctctctg 120cctgcgccac gacttgcttc acaactattg atatttataa gttcgcagta tcgtaaacct 180attccattac tgttatggcg ttacttttaa aatatataga tgacatacaa gaaatatttg 240acacaaatgg agacccacgg acgagggact ggccattgat gtcttctcct ttgccgaccg 300ccatgatctg catgagctac atctacctgg tcaaggttgt tggccccaag ttgatggaga 360acaggaagcc cttccagctg agacatgtcc tcatattcta taatctgttc caagtgatct 420tctcggcgtg gctcttctac gaggtgagtc ccgtttagca accacttagc ttttagtttt 480ggttacagga tcctacaata agctacataa tgacttttca atacttgtac tgatataaat 540ctca 54468314DNANezara viridulamisc_feature297n = A,T,C or G 68aactgggcaa aaagaaggag caaacttagt aactggtggt tcaagagttt ggtaatgcag 60gatattttgt tgcgccaacc atcttttctg aagttactga tgacatgacg attgcccggg 120aggagatttt tggaccagtt caacaaattt tgaaattcaa atctctcgat gaggttatac 180acagggcaaa tgattccaat tatggtttag ctggagcagt attttcaaat aacattaata 240atataaacac cattatccaa ggtcttcggg caggaactgt ttgggttaac acctatnata 300caataactgc ccag 31469573DNANezara viridulamisc_feature78n = A,T,C or G 69gatcgtggcg gctgttcggg tcaatgtcga gcagcgggac gaagacaact gagtagccaa 60tgattaatta ttgaactngg cgaatagagc gccatcaaat gtgccaagac aaacacagtc 120tttcctatcg aatgcagttt cgaagttaat aaaataagaa tttttcttta cgagaccatg 180ttcgaaaaac attggttgat taattatttt tcttttttga tttattattt ccatggcagc 240tgtgaaaagt gttaagtgca attttgagaa tttcaccgga acgctaattt ttctctccat 300attgtgtcta aagtgctaag ttatactgca attataagta tgaacattcc tttgtgaata 360attggtggaa actccaaaat tacaccggtg aaaattccaa gctttcaatc gcatttttcc 420tttaatatga tttttgcact tacactatga acaggttcca tacatttttt aaagcgtatt 480tgtatcaaat ttttaattat ttttgcatta ttatatgaat ttgtgtgatg taattatgat 540gtaacttgtg cctttataaa cgattatacc acc 57370578DNANezara viridula 70ggggagacga ttctgagctg ggttgttgta attgttggga ttgattagta cataactgtt 60accatgaggg aaattgttca cattcaggca ggacaatgcg gcaaccagat tggtgccaag 120ttctgggaaa tcatcacaga tgagcatggc attgacccca ctggctcata ccacggtgat 180tctgatcttc agcttgaaag aatcaatgtt tactataacg aagcgtcagg tggaaagtat 240gtacctagag caattttggt tgatctggaa cccgggacca tggactcagt acgttcagga 300ccttttggac aaatctttcg acctgacaac ttcgtttttg gccaaccagg tgcaggaaac 360aactgggcta aaggccatta cacagaagga gctgaactcg ttgattcggt tcttgatgtg 420gttcgcaaag aggctgaatc atgtgattgt cttcagggtt ttcaactgac tcattccctt 480ggaggtggca ctggttctgg aatgggaacc ctgttaattt ccaaaattcg tgaagagtat 540cctgacagaa tcatgaatac ttattcagtt gtaccatc 57871527DNANezara viridula 71gggcaacaag ggacacctat agcagaatca ccattaacat ctatgaatag ataccttcat 60tggagatgat acaaatgggt cacggtgatg gatcttttta ctaaagcagc aatggtatac 120atgatccagg agcggtggtt ggaagcaatg ttaggagccc aaaggacata gttccaattt 180tatggtgtgc ctgaccgcat tgcatcggat gggggcaagg aattcaacaa tgccaccatt 240ctagtagaag cgaaaggttt ggagatcaca tagcacatta acacccaaag agtagagagt 300atattgaacg ttgcaaagca cgctaagtga cctgcaaata caccaactga taaaaggact 360agagccagat gtagtgaaga caaaagcagt cacagcatat aatcagtcta ttgtgttttt 420tgtttttgtc caccccttgc tcgccttcta ggttatacgg gtattttctc gggcatcagt 480atatgatttt attggtgtaa tattaaagtc tgatgacagt tcactcc 52772575DNANezara viridula 72gggggattgg gggaacgtgt gtgaaatgtg ttgtgtaaaa tttatgtatt gatttttata 60tttttttagt taaaataaca gacaatttgc caaaatgggg aacgttaatg catctagtca 120aaaaagtacc tcggacgcat ttgctgcatt tgaaccagaa aatgttgttc ctttagtgga 180tgaaaagttg gaaaatccag ggtctatgga agagctgcac aaaaaatgta aagatatatt 240tcctgtaaat tttgaaggag ctaaaatagc tgtccaaaaa ggtctgagca atcatttcca 300aatttctcat tccttaaata tgagttcttt ggcaccatct ggttatcgat ttggtgctac 360atatgtcgga acaaaacaat atggccctgg tgaagcatat cctgtgttag tgggtgacat 420agatccagtc ggaaatctta atgcgaacat ttatcataag tttaatgaca acataattgg 480gaaaattcaa gcccaggtac aaagtagccg ttgtacagca tcacagtacg ttttagatta 540cagaggtagt aattacacag ctacagttac gtttg 57573117DNANezara viridula 73ggggcccact cgtcggtctg ggaggcgatc ttgtgtccag cttctttgtg ttgtgtcagt 60cctaaatcgg gtctttttag ccttcacagt cagtgttcat cgccgtacgt catatat 11774301DNANezara viridula 74gggggctact gtatctatta tataacttgt gtccattata taattaaata atcgttgatt 60cctcttttga aaaaatggaa gatttaaaga aatattaata aataaatatt tttttatgat 120atctcaatga tttttgactc catataattt tgtgccatga gccttatatg tacacttttg 180ttttccttaa ttggattttg tgatatctta accttattta tgtcactcat ccatatgagt 240attttcattt acacagctat aaatatatct attatgaaaa ctattttact aataaaattt 300t 30175615DNANezara viridula 75ggggacaaga cttcttcaag atgaaagctg cactctgcct taccactctt ctcgctgttg 60tctgcctttc ttgggcggca actccggaat acaaagctaa agttgttaca gcaattagtg 120cttgctcaaa agaatacaat gctgaactaa aggatattct ggaaatcata aaacaaaata 180aacttccaga aaccaaggat caaaagtgca ttattggttg cttctttgag aaaatggact 240atgtgacgga tcacaaagtt gattgggaga aggttaaggc aatgaaccca cagaaatatg 300acacccctga tttggtagaa aaaatcaacc aagttactga cacttgtgct aaagttgtga 360ctgaaggatc aaccgacatt tgcgagttag gtgtcccagc aataaaatgc ttgaaggagg 420aagcagataa ggtcggattg ccaaaaccag aagtaaagtt tgataaacac tgatgccctg 480atgatgaaaa ttttatcgat aaaggacaat aatacactct gggatacata cttaatctac 540aaaagccaaa ttaacattta acgttaatgc catttagaaa tagttctttt attttgtgtg 600tgctatcctg tataa 61576403DNANezara viridula 76aaaagaaatg atttattcta attagaatag aaagtaatga tgtattcatt gtttctgata 60tgttgttttg tgactgttgg aagtgcaaca tcgatcagtg aacttctctt tccaactcat 120aataaatgtg gttgttttta ttatgagcaa tgccccaaac ttcatgtacc taactgtact 180attgaagatg aaaattatga ggatctttgt ctacaaaatt ctgcatcttc aaactctcct 240gagatatgca acaagtggtt tctggaaggt tttaataaac agttaatctc agaaaatggg 300actctcaaga tatcaatttc gttctcttct gccttattcc agaaaattcc tcttagtgtt 360catctctttt atcaaaatca gtgcttggat attaacaata ata 40377514DNANezara viridula 77ggggtaccga aaatttatta cttcatcgaa aggtgccccc catgaaaatt caagaccccg 60tcaaaatgtg cccccctcaa aaattttgat ggcgttcctt gccccttgaa acccccttct 120ggacacctct gcgtatcatt acacacatta tttcacggtc tgttgtttaa tgtactactc 180aaacagtaaa ccgatcgatt gagctggcag gaaattaaaa gtaactacct atgcgtgtag 240aaaaaaccat ctgtattagg aaggcattga taaagggata gaggcgaagg aggaagattg 300ttgttgatta ggaatggcaa gtgtttgaat ctaatcggaa aggaaagatt gaactcagaa 360aatatagaat taaaatcact attccattgc aaaatggttg tgattttaat ttataaaaaa 420tataaagtga ttcatgagat taaaatcttt agattagttg agcgttgctt ttagcttggg 480attgagtttg gcaacatagc gatattctag tata 51478326DNANezara viridula 78tttaatatat tcttatttgt tatttctaat ggtaagtatt aagttctgat taatgtataa 60tttttttgtt tggtgttgca taccgtaaag atgtaaagat cattggccac ataatatggt 120attatggaaa tttattgctt gccaagataa caggataacc aaccatagct tagtaaccta 180tcccttggag gccaagtcaa tgtacttccc ttcacttggg tttacgagca ttgaggaatc 240ggtctagata catggattat ggctcttttc agggtcacca ggtgcacaaa tacttgcatt 300tcttcaatga aacagattgt acatac 32679341DNANezara viridulamisc_feature304n = A,T,C or G 79ggggaacgca acacttcttg aggaaagcgc tcaactgctc ggaccaaaga ttgtttgtgg 60ttttccaact tagggtatgc tctgtggcat gccatccttt ccagttcggt ccaaagccga 120taagctaggt cagggcctcc tgagggccaa tccgagacag agatgaactc tggaatgttc 180ctttgcagcc actgctgagt tgacctggcc ttgtgagctt gagcggaatc ctgctggaaa 240acctaatgac ttccagcaaa cggagtatca tttagatgct tgacaacaag ttccaaaata 300tcancctgat agtgtttagc agctgtttta actccttttt c 34180615DNANezara viridula 80tgttcatgaa gactatagat cacaaaagaa tgacattgct ttattacgtt tagatgaaga 60tgttgttttc actgataaaa taagacctat ttgcctacca caacctgcta gcctaagatc 120ttctactttt gatagaaaat atccatttgt agttggctgg

ggtgaaacca gtctcgaggg 180tccttcttca gacattcttt tacaagtaca agttcctgta gttgacaatg atagctgtaa 240aaaagcttat gcaaaacacg gagctatcat aactgagagc caactttgtg ctggagaaaa 300gaaaggaggc aaggattctt gtaggggaga ttctggagga cctttaatgc taccacagaa 360tggatcatat taccaaattg gtattatctc ttttggttat aagtgtgctg aaccaggata 420cccaggggtg tatgctcgtg ttacgtctta ccttgattgg atcaaaaata atatggaata 480agattacatt ttgttttaat tttaccaaat agcacaaaca tatctgtgaa actgcaaaaa 540gtgtattaag tgcaattttg tgaattttta tgggtattcc tccaatgata atttatctct 600ctttctttgt ggagc 6158153DNANezara viridula 81ggggtggagg tctgatgcac cccagtgtca tgaaactgtt aatggtaaaa cag 5382604DNANezara viridulamisc_feature467n = A,T,C or G 82tgatgacatt ccattaagta ttttatttga cttatattgt ttcatgacta tttaaaaaat 60aaaaataaaa taattcatta tttttaaaaa ctgcattgta ataattcata tttatattca 120cttcttttgc atatgattca tgatagtatt tattattaaa taaaatagga atacaagtat 180tttacttaat agggttataa aattgtaatg aaatatttgg aatttgaaag aaatttttaa 240taataagttc tacaataaaa tttacttaca tgttttatgt aatagaaaat aattatgtgt 300aatggagctc aatatttatg tgtaaataaa taacttaagt ccagtcagtc cttaagaatt 360taaaattttg ttgtagtatt tagtatttgg aaatatcaca aagatgcaga attaaagaaa 420aagaagaaaa gttgggagaa ttttcataat tgagacaaaa agaaggntaa atgaagagaa 480gagataagaa aaaaaaaaga acttgaatag tgattaaaga gagataattt aaaataaaac 540atcatgtaag taaaatcaaa aagctgaaaa cattcattac atatgttttt tctacaaata 600tttt 60483623DNANezara viridula 83cggccggggg agttaaaaga cacatgttct atatatcatg cctctttgct attctttcgt 60tgaaaatgaa aattgataga atgccgtgat aagtagtcac tgttgctagc tttacttcaa 120aatttgaatt cgaatatgtc ctacagcatc attctcagtc atttgagtag gttcccacta 180ttctcttact caagaggata tagtgtcatt accagccaaa atgtgaaaaa tatccctgtg 240agtttcagat attattcatc tggtggaagg aggcctaatt ttttctccca atttatagaa 300aatgttaggc aagacttggc aaaaagtaaa gagatgaaag aaagtttgaa aaagtttagg 360gaagaagcgc agaaattaga acaatccgaa gctttacaga aagcaagatg attgttgttg 420cagagccaag tttcatactg ttgaatcaga agcatcgaaa ggtggtgaag ttttcaagga 480gaaattggac cacattaaag ataaagtcag tgatgtgctg gaggaagcag caaaatcaga 540aatcgggaaa aaagtcagct gggagcagaa attggaaaga ctgcgagggg agctgctgaa 600acattatcag aaacaggaca gca 62384637DNANezara viridulamisc_feature7, 29, 30n = A,T,C or G 84ggggagngta ataaggaagg ttttgaatnn tgtgaacttt gccttattca aaataattta 60aggaaatgtc tttatcaaat attttgggaa gaagccttaa tgtcttaaaa aataaaagtt 120tttgtagtgt aatacctggt aaaacttctt cgttattgaa gtatcctgct gtttcttctg 180tatcatgtct taacttccat aaaatatcaa atgaaaaacg aattgcccct tcagaaccca 240aggtaaaact gactgatgca gtacgacatt tttccataac ccaacctaaa ctttctggac 300atggtgacca ttccaaactg tgggtctatg aacgatatgt gtcagcagca ttactgggta 360ttgttcctct tggtttaatg atgccgaaca tactctttga tctcttgatt gcagtagcca 420gtgtcatgca tatacattgg ggtattgaag ctattgttat agactacatc cgcccaatca 480tttttggtaa tttgatatca aaattagcgg tctactttgt ctatctcctt tcaatattta 540ccttggttgg tcttttgaat cttactttca acaattgtgg ccttgctaat agcatcaagc 600ttctttggag aataagcaaa caagaataga agtaata 63785638DNANezara viridula 85gggctgttct aagattttgg gcgagcgagg agagtgagtt cgggcgcgct cgtattcctt 60tggttcttcc attacaacca ttctttgtta cgatctttta tttctccttt agttaattat 120taaattcttt catattctat atttaacaat tctttaaatc ggagatcaat gtgaaatggt 180taattatttc aaataaaaaa aattaaaggt actttagaag aagaaatagt gaaattagcc 240atatgaggcc tgtttgagaa cataaatcag aataaaacta cattttatta taaaatgctt 300aatttaacac tgataagatg aatttaatca aaactttaat gtggtttttc tagaaaatcg 360taaacatgtg tttactccaa tatataaagt ggcatttcca gttagccaat tttgacgaaa 420aatttgccgt aacatcccca gcttataaaa acctcaaata tgcaatttca cttttataag 480atttcggttt tttgagctag actgttaata cccacacaga cagaccattt tgcgggactt 540ggttatttgg actcagggga cttcaaaacg agtatttcca ttgaaaagtg agattggaaa 600attttcacga tcacaatact ttcttttact atacattt 63886444DNANezara viridula 86gggggcagtg gattttctga aaagatggct gcttcgttgg gtcgccaata tctcaggaag 60tttaattctt ccaaaactct ttttaagagc ttccttcagc ctctgctgta gctggagatc 120atggtgctgg tgttaaactt tggcgtaatg tgagttattt tgctggcttc ccttctgttt 180tgttatgcat gttaaatgca tatttggctc atattcgtca tgaacatgca agaccagaat 240ttaagaaata tgatcattta agagtgcgta ataagaaatt cccttgggga gatggaaacc 300gttccctgtt tcacaaccca cacaccaacg ccttaccaga tggttatgaa gcgtaactag 360tttaaaaata gtaaacagca tgtatgtaat taaactgaaa tcattatgtt atcatttata 420agaataaatt taagggttaa taac 4448769DNANezara viridula 87ggagggggag gtacgatgtg tccctgtgtc atgtactgta catcgattct gtgtacaaca 60ataaaatgc 6988652DNANezara viridula 88ggggaaacca aagtatggct ggagtacggc aaaatgtctc tggaacaaac agcatgtgaa 60gatttaaagg cttttgaaag aaggcttact gaagttattt catgcctaca acccgcgact 120ttaagatgga gaattctctt agcaatcata tcaacatgta cagcaattgg agcttggtat 180tggttgacag accctcatac atcagatgtt tctttcaccc aaagtctcat taatcatcca 240ttcttctcta catctagcat aattttagtt ttgctactaa tgtctggtat acacaaaaga 300gtaattgctc catcgataat aactgcaagg accaggatag tattgactga ttttaatatg 360tcttgtgatg acactggaaa gcttattttg aagcctagac cagctcaatc atgacatgaa 420tagaaatagt cagcaaatgt acataattaa gaattggtta tggtgaggct gtcattgaaa 480gtggaagaca cttagctcct ttttttgtta gaacagagtg ggaaagaatg tttaattatt 540tctttttgag ttgtatttta tatttgaagt aattttttat ggtactcgct tcctttttat 600aaagattgtt gggataactt agtgtcttct atttgtcaag ataataatga ac 65289340DNANezara viridulamisc_feature14n = A,T,C or G 89ggggacagtc agtngcaaat atgatccaac agctggtagt cctcttctcc ttggtggccg 60cctcttacgg cttcttcttc cctccgggac tcctcggcaa cggcaccaac cctctggctc 120ccttcctagg ctgaggattg gttcattctt ttacacttaa actaatttca aattgaagta 180actatgaaga taaaagtaca atgaattgta cccaaactta caacttttaa gttttcaact 240atgaaatcaa atgcaactct agctgtattt catttacttg tgtattatac caaattaatt 300ttttagatat tatataatga ataaacattt ataaaacgcc 34090492DNANezara viridula 90gggggagcca ccggtaactt ctcttcttat tgcatttgtg tgtgtatgtt ccattgttaa 60tccggcttat gtggtacttt gttgcacgaa ccagtgaaaa agatactttt aggcaagacg 120ttcattcccg aacaggtctt cgatgaatat ttaaatggtt tagccgaatc agaattcagg 180ggtgatcatt acgaccttct aaagcacaac tgcaataact tttcagacaa tctcagtcgc 240tttctcgtcg gcaacggaat accagaatac attttgaaac tacctgagga aatacttagc 300acgccatttg gacagagatt tcaaggattg attgaacaga tcagccagaa ttctccgaac 360ttgcagccta cccaacggag agccgcctca cctgaattct accaattgaa ttcagatatt 420gaagctgcta gacatcattc ttctcttctg agggaaaaac gtaatgctct gtgtgaaaaa 480ttagcaaagc at 49291503DNANezara viridula 91aattattcag tatcctggat aaacatagtc gactgtatat aaatcaaaat gtatatttta 60gattttaatt gttttattta ttttcttttt tcagatgatt cattaagttt ttttaacata 120aataattgaa tcatactaaa tttctgaaga gtgccgagtt tatgaatgta cttttaaata 180atgggctgta ttatgattga aacaagtatg agcctataac taaagaaata taccatcatt 240tttgaagtaa cttgatgcat ctcaattttc taactttcca caagaataaa aaaaactagt 300caatatttat ttataactat aaaatatatg tattttattt ggattcatta tattaattta 360aattgtgtta aattaatatt tctttaggat gttttgaata aaatgatgtg tatatcttga 420tttctacagc tatgatatat taatgatctc atttattaac aaaagtaatt cttttcaaat 480ataaatttca taaatctcca taa 50392647DNANezara viridula 92ggggaaaaac gttggtcatt cttggggtgg cttagttgtt tattgaaatt atttctttta 60aaatggcaat gccaagaagt tatggtggct tatctgatta cagaaccgtt cctgcacctt 120cttttagtcc atattctgaa aatggaggga gtgtagtagc tgtagctggc gatgacttcg 180caattatagc atctgataca cgtttaagta caggttttca aatttatacc agaaaccagt 240caaaattatt taaattgtct gacaaaacaa ttcttggtag tactggttgt tggtgtgatg 300ttctttctct tactaggctt gttcaaaccc ggataaaaat gtatcagtac gatcataata 360aagttatgtc cactccagca gttgcccaaa tgctctctgt actactttat tataaacgct 420ttttcccata ctatgtagcc aatattcttg ctggaataga tgataatggt aaaggagtgg 480tttacagtta cgatccaatc ggtcatcatg aaagctcaaa attcagagct ggaggaacag 540ctggagcttt attacaacca ctgttagaca atcagctcgg tatgttgaat caagaaaatg 600ttcaagacaa aacatacact ttggaaaaag cccatgcaat tgtaaaa 64793648DNANezara viridula 93ggggtgtagt ggtagctgat ttatatgtat gtagttggtg tctttaacca tgattagaat 60tttatttttt atctatagct gtgcttcatt attgagtgct agtagtcttc atcgaggata 120taattttgtc ggaacagcca gtgaaactga tggtatattt gttaatgtta tttctgatat 180caatcagtat ataaaagaca ataagtttga tgttcacaaa ctcatggaca ttcctataaa 240tttaccattc acctctgtga gtttatctaa tggacaaatg agagacttct cttctattga 300acttcataag tcttctattt taccacaaag tgaacgcagg ctgtattgga ctctaggagt 360aggtttggaa aatttttcat tacaatacga cttcaaatca gatttttttg atgtttttaa 420gaattcaggt agtctgaaac tgacagttcc aaaaaataat attcttttaa gtggcacgat 480agatatatca ttgccaaaat gttcgacagc aattgagatt gtgacttata tggattttcc 540tgatgttaaa gttgaagtgc aaccttggag cgtaaaaaat ttctttttta aaaatttact 600agaatttgta gtaaatcata gtaaaactct agtaagccct gcattaaa 64894550DNANezara viridula 94ggggcactaa cttagtcttc gtgagtgcca gcttcttctt aaggtaattc accatggctg 60agaaacccac aaaagaaaag gcggaaaaga agcctaagga gaaagtagaa aagaagccta 120aaaagactat tgaaaaacct actgaaccag ctaagccaaa aaaatctaag cgaatgatta 180ggaaaaaacc cgggcgtttg tatgctaaag cggttttcac agggtttcag agaggtcaaa 240gaaatcagaa tgaaaatact gccctgctgg ctgtagaagg atgtaaaaca caggaagaca 300gcaagtttta tgtcggaaag aagtgtgtgt ttgtttttaa ggctaaaaat cgaactaggg 360ttcctggccc cgtaaaaaag aagaccaagg ttcgcgccat ttggggtaaa gtaaccagga 420cccatggctg ctctggagca gtaagggcca agtccaagtc taatctcccg gccactgcca 480tgggcaggag aattagaatt atgctgtatc cttctttgat ttaattttga aaataaattt 540ttattatttc 55095568DNANezara viridula 95gggggttata gaggcggcac tggttagctg tatcacgttg ttatccactt tattttttta 60cagataggaa aaaagaattt tgatagtgtg taatatttat cgagaaaaat ggctcaaagc 120aagttgaatg atttagccgg acgttttagt caaaacccca aaggtgtcgg attaggttta 180aaactattag cttttgccgg tgctacagct tatggagtaa gtcaatctat gtatactgtt 240gaaggtggtc accgagcaat catatttagt aggcttagtg gagttcagaa agaagtctac 300tccgagggtc ttcactttag gataccttgg tttcagtatc cagttgttta cgatatcaga 360tcaagaccaa ggaaaatttc atcacctact ggatccaagg atttgcagat ggttaatatt 420tccctcaggg tactgtctag accagactcg attaagttgc cttttgtgta caggcaactt 480ggtttagatt atgatgagaa agttctacca tcaatttgta atgaagttct caaatcggtt 540gttgctaaat tcaatgcttc tcaactga 56896544DNANezara viridula 96gggggatata tttgatagtg ggaagagggt ttcgttattg aaataatgaa atgttcacta 60ttttaatcgt gtagttcatc ttattttaaa atggcatttt ctttattacc aagaagattc 120ttgaagtttc tctggaatga agaaagtgtt agaaggatat ctgttagctc tgtgaggttt 180aatgaagatg aatctaacaa aaaatcatca gctgctgata agttacattc acttttacag 240gatattatta aggatgaaac actaattaaa gaaaatatag taaaggcaac tgctgagcct 300gttattgtgc cggtaaaaaa gaaacgtcct gagaaaccaa agaatttggg tgaaaaaatt 360gttgattcgg caaaagaagt tgccaaaggt ttagaaggaa agcctgaaga aacagaagcg 420caacttcttc atcgggtact ttttaaaaac aagcctctta cagaaagtgt tacaaaagct 480gctgcaaacg atacattgaa ggagcttctt tcaggaatgg atgttgaaag aactccaaca 540gtac 54497115DNANezara viridula 97gggcgagtgt gaagaaaaag acatagactt tgttaaaact tctgatagcg gaatagataa 60agaatatgac ctaccttccc ttccaacatt ggtttattac agaaacaaat tcagg 11598344DNANezara viridula 98ggggagactc ggtgccaggc gtgttgttat aaacttttta gtccgtgtat agtgaagtgt 60gtaggcatat caatacatat tttatgttat ttatagttat tagtacttaa aattttacca 120agagagtgat agtacctata aatttcgttt caccatgtct aagcgtaaca cagaagatga 180taaaccaatt cctgatattg tttttgattc caattcgaag actacttaca aaaagggaca 240gtttttagga aagggtggtt ttgctaaatg ctatgaatta agagaagtaa ctaccaatgg 300aatatttgct gggaagattg tatccaaacg acttcttacc aatc 34499359DNANezara viridula 99gggggtagta cgagatttca cgtgaagtta ttttcaggct taaaattttt actcccggtt 60atatcttaaa cgatgtgata tagatgtaat gtcaattatt ttggtttcag atttagattt 120agtattcaaa ttataggtga ttcgaatgtt attgaaaaaa gtggtgataa aggaacatat 180agttgagggg cagtgtcggc acggtgttat tgagttttgt gttcagtcgt atttatatag 240cccgggtgta atgtatcatt catacaattt tcagttcgcg gaaatgtttt aacctgtagt 300tgtgtatact gatttctatg tgcttttaac tgttgtaaat tagaacttag gagtgtgta 359100640DNANezara viridulamisc_feature577n = A,T,C or G 100ggggagtgtc agtgtagtgt agtgtcgtga tcgggcttca tcatcatcaa caacactacc 60acgcctgcgc atcattagcc tgcgcatcac ataataaccg acgcggaggc tggtcagaag 120aagaggggag gaggtgcgac ttgaactggc ggaggcgtca ggagctcata cccagggcca 180agttgagaca gccttctccg gaatattcca agtggggcga ttcaggaaag ccagtaagac 240acacagttag tttttgtggc aaaattggac cgcagtcgtc atcaaaccag tgtcagaaac 300agccggcaca aaggcacggt gatcgacaaa aggagaaaga acgattttgc accctgagaa 360gggagccacg aagggagagg atggatcgga tgtatgacag caccgagagc ggctacgatg 420gaggctccca agagaacatt cttgatgagc cacactatga atccatcaaa aatatcaaca 480taaaaccgga aattcaaaaa gaacatattt acgaaagaat gaatggaaaa aaaaagaaaa 540agaaacaaca gaatctcaaa ataataaaac agagganagt gaaaaaaagt aggccgaaaa 600ataaatacga cgagacaaaa acggtaccaa atgggaataa 640101680DNANezara viridula 101ggggactggg atgaaacctt tcatggaggt gcaatttgta ttttgtttga ttgtgcttgt 60tgattaaacg tcatttcttt acgatatgaa taaaagaaaa agagaagata gtatgtcgga 120agactgtatg atggaagttc aggttagtaa aaatgcctgt tcaagttcag gagagtcagt 180tatgcctcag tgtttaagga tgttggatga aataatgagg agtggaccag ctgaattagt 240tgaacgtagc ttaaaccctc ttggtgcttc tccattggga aatcatgtga aacgtgttac 300aggatatgaa atagcagaat tagatgaatt tacagcaacg gttgactcaa ggcttaaaca 360aaccgttatg actaaaataa ttactatatc tgatcaaatg aaatttcttc gtcaacagct 420agtaaacgct gtccaagatg cacaagaaag ttcggcctta aaccatacac catgcaattt 480ccgcaaagtg cctggaaatg tatattatct gtatcagaga ccttctggcc agaactattt 540ttccttattg tctcctgcag attggaacga aaaaccaccc caccagttct gtggttcata 600tctttatgag catgattata catggaaaaa aatatgaatc ttgacttgtt tcttttaata 660tgaataattt taataaaaaa 680102610DNANezara viridulamisc_feature38n = A,T,C or G 102gggggtatta atgtggagat attttatttc aaaagagntc tgtttgttta tgttcagtga 60tttgagaagt aatacaggtt tgattccatt ctatttttct ttttttttct ttaatatttt 120aattgaaggt ctgaaaaaaa gtgttgtgta tctgtgtgtg ttggaataaa atgtcttcat 180aagttcctca aattttaaaa ttattttatt cttgtatgtt cctatattct tcttggaaaa 240tattatcaaa taaataagaa attgatcttt caactccatt gttatttaag actacgatac 300agccctggaa tgtaattata gattctttca attttttttt gttttttcct tggttgaatt 360aatgatgctg tgatagtttg tctaacttcc cttttcttca cctatgatta ttatatgtga 420ttaaaaaagt taccttgatt tagcctaatt ctatttgtat agatataaat atgttattaa 480tgtgaattat tgaattgatt tcttaatcat taaaatgatt atgtgcaata atattgtatc 540tgagattttc ttctaatggt aagtttattg atcacctggt ttacccgtag aacatagaat 600atagtagatt 610103272DNANezara viridula 103gggtattaat ttttatttgt ttatccataa attagctctt ttaaaccaat tactttgatt 60ttttcttgat agttatcatg ttagcgactt cattaacatt cactaatcag gaaagacagt 120ttacgaaatc tgtatctaga ttgaagaaat tccgtatgat ttttaataca ttgaaaaaat 180atggccatta atcgaattag aaaaacgttt ttctactaca acaataggcg cagactttcc 240atttcgcttt gggagagggg aggtgaagaa cc 272104618DNANezara viridula 104ggggacaggc catgttgatc atgaaggctg tcgctgtgat tcttcttgtc gtcttggccg 60cgtcttgtca tgctttctca atcagtggct tcttcggatc tgtctcaaac cacgccaagg 120aaaatatcga gcaaaagaaa acccaggtca caaacaacat cgatctcatg catggacaca 180tgaaggactt caagcaggct tcacttaatg gtgacgtcct tggggctgtt cagttgtcat 240ccaagaactc agtgaacatg gcaaaaacta tggctgagca agcaatacaa aatactgtta 300aatacgctca tgatgcagtt gaagacctaa agtatctaat tcccttcaaa ccgtcaaaga 360aaccacctag catgggcaaa gtacctaaac caacaacagg accaccaaaa tattccattg 420tttctgaaaa taataataaa ccaacaaaag gaaaaggaac tcctgcttca cacaaaactt 480tggaatggaa agccggtttt aattccaaag ttacgataag taccgaagga acgattaatg 540caactagagt acctcctgaa caaaaaatgc ctaatccttc aaaagaatca acagctaaac 600tagaaatgtc tcttacta 618105675DNANezara viridulamisc_feature483n = A,T,C or G 105ggggaagtat gttttctgta gtgaaccaat gtagttaacg ttcaagagtg ttagttttaa 60aatagcagtt aggattttct tttttctttc ttttttttgt atggaaatga gatttcatcg 120aagaagacac ttccaaatca actttattgg ttcttgacaa atccagtgta tatctttaaa 180actgattttc atgtcaagcc tcaaaacact ttcacttcat tgtaaccaaa aagtaaggcc 240cagtttgaga tggtttaaat ggcctttcaa gttcaagaaa caactagtga agaagagcgg 300ataaagattg attgggaaac aactgaaaaa gatattttgt ctcaaccgtc tgctgttgaa 360attgaagtaa atgaaaatct caacagcaac ttaaataaca gtcataaagt tgttgactac 420agtaaaccga ttgttgataa catctcaaat cacactgaga ggttctttct tgttggtgaa 480gantcaacat gtgttggaaa gaaaggcgac gaaaatgggg tatgtaatgg agtttatttt 540cagaatgtta ataccaatga agtagatgat ccaggtgaga caaatgattg tgttcagtta 600aatccaataa aggacacatt cactaatatg aaacttccat ctgtgccagt aaaagaaaat 660aaggattgta ccatt 675106653DNANezara viridula 106ggggaatgtg tgtttactac cgccagttgc ttgtgttgaa cttgaatttg tatgtcattt 60ttttagtatg aattatggag gtaacttcaa ttggaaatga agaaatacaa ttagctggta 120atctgaaata tgttcagttt aagtctgact taaagaactt aatagaaagg gaaattctag 180cagatgggtg gcaatcctcc gctgaagcat ttgataaaat cttccccaag aaaaggtact 240tgcctagttt caagaaggca tttcatggtg ctattttagc tggttttgaa gaaagtctag 300atgaaatgtt gggagatgtt ttgcctaaac agtgggatat tttatatcaa gaaaaatatg 360acaatcatca tgatgggaag gatacttctc ggctgactta tagtaaaatg gcattaaatg 420atttgaaatt aaaacaaaaa gctgctgtag aatctgttat agaattaaaa ctgaaaaaaa 480ttgaagaaat taaacaaagt atatatatta agaaattaga agtaataaag aaatcatctg 540aattgcaagc cattaaacaa aaatggaaaa aaaactgtgg aatattagaa gacttgaaaa 600aaatgagttt ctaagttaca ttaccaatac atgagaacct atttatttat ata

653107398DNANezara viridulamisc_feature176n = A,T,C or G 107ggggactcta gttagtgact aagtttaata ttttattaaa atgaccaaga aaaggaggaa 60tggaggaaga tccaaacatg gtaggggtca cgtgcaagca gtccgttgca ccaactgtgc 120ccgttgcgtg ccaaaagata aggctatcaa gaaattcgtt attcgtaata tcgtanaagc 180tgcagctgtg agggatatca cagatgctag cgtttactct tcgtaccagt tgccgaagct 240ctatgccaaa ctacattatt gtgtgtcatg tgctatccac tctaaagtag tgcgtaatcg 300ttctaaggct gagagaagaa ttaggacacc tcctcagcgt aacttcccaa gggatatgat 360gcgtcaaggt ggaccccaga taaggaagta atcttttc 398108607DNANezara viridulamisc_feature455n = A,T,C or G 108ggggaatgtt gtggtgtgct gacatagata ttagtccatt tgatttggaa atttactctg 60atttagctat aggagcaggt acgggtagta gtgcagcatt ttctgtctgt gttgctgcag 120ctgtatataa ttatattagg ttaaaagcat ttcaaaagtt tggctgtggt gaatttaata 180tttccagcag tccattcaag cctcatatga tggaattatc tcagcattat aatggatttt 240ctccaaagga taaagacata gtgaataaat gggcattttg tgtggaaaaa attaatcatt 300ccactccttc gggtattgat aacactattt gtacctttgg aaatgccgtt ttaatgaatg 360ctgctggtga aaaagatgaa aaacgttcta tagaactatt agataatctt ccagccttcc 420gggtgctgat agttaattca ggtgtaccaa gatcnactgc tgacatggta aagaaagttt 480caaccttgct tgaaatttgt cctgaaagca actcaatcca tttcttgaat caatggatgt 540aatcgctatg aaatttcttg aatatgctca agaaataaaa aaagcaactg aaaaattgga 600tgttttg 60710953DNANezara viridula 109ggggttcggt atcggtttcg ctggaaagat gaccgaactt gatcatttag agc 53110652DNANezara viridulamisc_feature399n = A,T,C or G 110ggggagttat catctctcca cagcccgcgg cactacagtt ccccgcttaa cagttctcta 60taggatcaga ggtggtgcgc tctatctgtc gacccgcgca tgctgtactc gtccctcttc 120ggggcctttc ttcttcgaac tcgccggctg gaaggtcctc gctcctcgct ccgtacagga 180tctctttagt ctctcttaaa acaatcaagt gttttttatt agtgttccat aatgagtgat 240acagcagctg aaaccaagga aactcaggct gcaagctcac ctgagaagaa ggaggtggtg 300tgcgagcgaa agccagcagc tgctgctgaa aaagaaacca aggaagaaaa gaagacagaa 360gataaaccag aaacaaatgg acacagcaaa accgaagant ctaccgaaga aaaacctgta 420gaaaatggag atgcaactga tgtgtgctca ttgccacaga agaggaaatc tgaagttggt 480agtggggaat ccactgagaa gtcagctgaa ggtgcaagtc ctgaaaagaa ggctaaacta 540gaagagaaag ttgaaaatgg tgaagctgaa gcaaaagctt aaaaccattt aattcaaatt 600aatctagact gttatacagt gttatgttta caaaatgcag catttgtaat at 652111575DNANezara viridula 111ggggacgctt tatctcattg gtacttggaa gtcacgtttc tcgtaaacct tctcttatag 60gttatattta tttcttacag ttctgttcaa actaattctt tcagatatga aacctttaat 120gttacacggc catgaaaggg ccatcaccca aatcaagtac aatagagaag gggacttatt 180attctcttca gccaaagatc actgtcctaa tgtttggtat tctcttaatg gcgaaaggct 240aggtaacttc attggacata ttggtgctgt atggtgtctt gacatcaact gggaaagcac 300taagtttatg tctggtgttg ctgataacac cctaaaatta tgggactgtt ctaatggtgt 360agagattgga aatattaaca ccaaatcaac tgtgaggaca tgtgtcttca gttattcagg 420caacttggct gcttattcca ctgatactca gaggaaacaa atttgtgaaa tcaatgtaat 480tgactgtagg attagtgact cgtttggttc cgaaccaata ctgtgtatac cagtaccaga 540gtcaaaggtg acggcattat tttggggccc tctgg 575112169DNANezara viridula 112ggggctgcct attaaagata atttatggct taatttacac cttcccttag ggaaaatact 60aggtcaagtt cttgtttaat ggtgatcatt ttacctgtgt tcagttgatc acttaaaaaa 120aagagtttat ttattaattt tttatcctga ttatagccga gtgttatac 169113636DNANezara viridula 113gggggataga aacattcttc aagttcaaag tgagaaagaa aggcaagaaa gtaaagaagc 60agtaggcgct cggctaatca ggaggttgag tatgcggccc acgcaagaag aattggaaga 120gaggaatatt ttaaaaaaac aaacagctgc tgaagaaaag aagctcaaag aagaaaagaa 180gcgtatgctg ctgcgaaaac tcagttttag gccaactgtt gaagaactga aggaaaagaa 240gatcatacgc ttcaatgact acatagaagt gacccaggct catgactacg atcggcgcgc 300agacaagcca tggactcgac tgacaccaaa agataaggct gccatccgaa aggaactcaa 360cgaatttaag tcctctgaaa tggaggtcca ccaagaaagt agacatctta ctaggtttca 420taggccatga catttggcag caaaagccgt gtctagttgt acagtgttat ctaccatgct 480attgtatata ccacagtcgc taagctacct gcaccgtatt agagcctcga caaatttttt 540tactgtttgt aactttgttt gtatatattt tatatatata tgaaaatata taaataatat 600aacatatggt accattccat aattagggat ggttaa 636114450DNANezara viridulamisc_feature414n = A,T,C or G 114gggcagactg agattttatt tatatttatc ttatgcagta tacaattcga gggtgagagc 60aattacagtt tttcataaaa ataaaaaaaa caaacaaaaa taacttgtca ttttgatgat 120ccaataaaaa taacttagta aatatcattt ttatggtatg aatttaaaaa atgtattaat 180tgtaaaatat ttaatttgtc aattcactta atagaaatac ttggatccat ttttatttgt 240cagctttcac cagtgctgta atgttataaa tgtgatctgt tcaaaggaga tttccattgg 300aaatgtatta ttattttttt atttttcttt cttttttttg tttaatttac agcatgtatg 360ttgctgtcaa tataaattgc cgttgttcga aaccttcaaa gtcttgatgt agcnacaatt 420ttttattaat aaaattggat ttgaaaatct 450115467DNANezara viridula 115gggcaccaat cttacccatt cacatctcgt tagcaagcag ccaccaccac aatgccaaca 60ctgcaataat acacttacag ccagtcacaa gttacaggaa tgttattttt acatatcaaa 120tctaaatagt gtaggactta cacctataat atcaaacatt ttaagttatg acgaagacag 180tataatgtta gtgttagatt tcttaaaatc aaacaatttg ttaaataaaa tttaaaattg 240atgcagagac cgttgatata atatgagaag gagttgatcg gggggtgcgg tcaaattaat 300actaaattaa actattatta ttaaaaaaca ctttattcag aaatattaca atttgtcaca 360gttaaggaca cttataatag agttcagaga ttgcattcat accgtatata caaaaatata 420aataaataaa gtaataacaa aagaataaga agaaagaaca aaagagc 467116363DNANezara viridula 116ggggatccat aggatccgca taacacttac ttctaaaaac atgaagtcgt tagagaaagt 60gtgtgctgat ctaataaatg gagctaagaa ggaaaatctc cgtgtcaagg gacccatcag 120gatgcccatc aaaattctga ggattacgac tcgtaaaacc ccttgcggag aaggttctaa 180gacttgggat cgattccaaa tgaggatcca caagagggtt atcgatcttc attctccttc 240tgaagttgtg aaacagataa cttcaatttc tcttgaacct ggtgttgaag tggaagtcac 300cattgccgaa taattacttt gtttttatta tgtgataatt atataaaaaa aattatataa 360tag 363117632DNANezara viridula 117gggcagaggg aaagttaaaa gtatttagaa aatgccacta tcacttagtg tacatagata 60aactagggtt acataggttc ttgatagaat tgaatttatt actatggtat aaccctcttg 120taaactttca tatcaaactg ttttaccagt gcatacacca cacctcactt cacttataaa 180taagtagcta tttaaaaaaa aaaatgtttt tattatttta taattttccc ttctgatagt 240tttactgtca tataacatgt attaaaacat aaaatctcct tattttctat tcctataaaa 300aaaagaaaaa aaaaaagaaa ttgtaaataa gaaggatgca tttgttcatt ccatttatta 360gttgttaatc aggtgctatt tcagttttta ttttagaagc attagtttac ggatgttgta 420tttctcattt tagctcttat gtgtcatact gctggttgtt ctcccataaa aatctaactg 480tgcatttaaa ttaatcataa tagctatggc taaggccttt taaatttaaa caaaagataa 540gttaagtgta ttatgtaata tgtattgtag aagaagcatg aatatcttat aagagaacaa 600taaattattt tattttaata tagtttactt tc 632118690DNANezara viridulamisc_feature627n = A,T,C or G 118gggtgttgat gagtggctga cggtgatgaa gttctcaatc cctgttgtac tgctagatga 60gacattgaag tttgttgcaa ggaagatcgc cgatgttcaa ccttcaatcc agataagata 120ctgagaggga ccaccaagac attcaaaaga gggtttatgt gcttctagta gaataaataa 180aatgcctata tttaaaatct cataggatga tcacaaattg tataaaagag gtgtatagaa 240cccatttgtc ctattacgcg gagaaatgtc atttcctatc tagtctattt tggttctcga 300tttttaacct attagaatta tattttttat aatttttttg attattttat tagatttttt 360ttatatatac acatcctttt tcaacataca acgcctctaa ccaataacat ttttattaga 420ttcttataaa ccgtcacatt tgatggaacc caacagctgg ctgaagggtg tctattcttt 480aatactaaca tgtcgcgtga ttttcattca cctctcatta tacctgtaca ttctcaatta 540atattaattt aatcttcatc taatattact ttacattctg tggtcttcct tttttataaa 600agattatatc aaaatttcac tagtagncta taaatatttt atttattttc tgttgtatat 660atgaaaatac tgtacattca cttatgtatc 690119690DNANezara viridula 119ggggaagtta taagttgtta cagtatccaa agattctctt actatgtatg tttacgattt 60gccatacaat gaaagaaagc aaatttgcag aattttggat ttgaataaag cttgggagca 120attaggtgga agttacatga aatttgatgt gacaacttta aagcattttg aggaagcacc 180ttcaagaaat cactctccaa ctgatgaatt attaacttca tggggtactc ggaatcataa 240tgttttggaa ctgttcgtat tgctttctaa aatgcagcac tatcaggcta tgaatgtact 300caaagatttt gttgatgtaa agtatcatcg gctcatatat gaaggagaag aaaatttgtc 360taagatattg gaggataaag gaaatccttt tggtcaaaat accagtgcat cagtcgggaa 420ttataaaaaa gaggaagtaa atggaaactt aaatattaat cgaaaaggac aagacattcc 480acctgataag gatatgcaga aaaataaaat gtttataaat gagaaaatag ttaacaaaaa 540agaaactgat cttggtgtcg aaggcctttt gagaatggaa aatggacagt ctaaattgga 600tgaaaatact cgtgatagtt cgagtctatt gatttcatat gctgaactag aacgagctac 660tggttcttgg gacaaaaaga atattttagg 690120250DNANezara viridula 120gggacatgtg ttattgtttc acaagattca attatccttc ttcgtaagga ataaaggtca 60ttgactggtc tcgcatagac tatgtaacta cataactata taatggtata gttattgatt 120agttatttat tatttactct tacttcagtg gggaacgttg aacattagag acagattaat 180gtttgaggca ccttagaaaa taaaaataaa gctaagacaa tttttgagta aaaacataaa 240cgttttaaag 250121138DNANezara viridula 121gggcaaaggg aacaattaca aaaacaagaa cccttaccat cagtagctac agaatgtgat 60agccaccaac catttttgat ggattcaact atgttaatcc ctagtgaagt caagtctgaa 120aagaagaaag atgatccg 138122363DNANezara viridulamisc_feature65, 243, 340n = A,T,C or G 122aaataccggt tttgagactg gtttttcaac cgtcataacc tacattattt gcctcttaca 60ttgangcaag gactaacaat ttttttttca tcgaacaatt tttgaaagat ttcttataaa 120taaaacattt ctttttatat tttcactgtt actacttctt tgactagtga gttaaatata 180acatatttaa aacatcagtg gattctccaa aaattttatt aatcagcttt tttatacaat 240gcngtatcag tatgtttaaa ataattctac atttaatact tttatggtat accataacta 300cggcttcaaa atataagttg atacggaaaa gcgattggtn attaaaaaaa aaactttata 360aac 363123547DNANezara viridula 123gggggagtgc aagatgtggg tctccactac ttttctcgtg gtagcttttt ttcacgcctc 60tgtgtctcag tactttaacg atgctgagga acaacggaat ttcgcgaaag aggaagttga 120ccgagatgac gatggtgtta tcgtagtgat aaacgacgat cctgaaccaa atgacggatg 180gaaacccgat gaggaagatc ctcttcaagc tggacctccg ccggagtata tgaacatgca 240agcaccacct tcggactact tggaagaaca aagaccacca caggactatt tcgaagtgca 300aagaccagag ccggattact tggaattgca aggaccatca ccatttgaat atgtttaagg 360taaaattgaa gaagaaaact tcaacaagaa tgtaaataag aacttaagtg ctggaagtaa 420ttgttttttc ttgatctccg ccatctactg agacttcaca cccaccgtta tgattcttca 480tgttttacaa ttttttcccc atcacctcca atttgtcttt ccttaataaa caagttatac 540attgtag 547124575DNANezara viridulamisc_feature470n = A,T,C or G 124ggggagttga gcataatgaa gtctctttca gtttgctttc tggctgtact gctaatacaa 60gcatcgtcag gcagacctaa tgatgacagt ggtgagtacg aagaacatga agagcattca 120ttcgtttaca gctcaactaa tcctggtcgg gtacagagca cgcaaacaat cataggaaga 180ccaccctttc agccaatgag ctttggcttc ggcaacccag ggcggcagaa cttcgggaat 240atgttcggca ccggaggatt cggcggtttc cccagtttta gacccttacc aggcttccca 300cctcttggac aaatgagccc aggtggtttc ggcggagtaa caggacagtc tttccagcta 360caacacccag gaggatttgg acagatcagt ggattcactg gtccatcatc cgcaggaaat 420gctgcctttg ctagttctag ttccggaagc ccaggtggtt cgaatagccn actaatcata 480aaaccaggag gaggcttagc attcgcaagt tcgagctcaa gtagcccagg aagtaaccaa 540gtttcaatca gtacgcagac ctcgagttcg acaga 575125482DNANezara viridula 125gggggcacct catcaccagc tattttagca tctgtttatg taatagaaaa attaattttt 60tgagaaaaaa tcctctgaca ttattgataa cataacatcg caaattataa taaatattaa 120agtaaatgag tgagtaaata tttacatcac tttagaattc gattgaatcg gacttacaaa 180gttttggaaa taagccattg gtatactaaa acaattgagg ggtcaagtag ataaagagaa 240gaagtaatat ttctgaattc ttaggaaaat gaattcaaat gactttcatc tattacaaga 300tcaatgttta ttggcgatgg accaaatttg aagatggaaa gaagaaatat taatgatatc 360aaacttgtaa aattttacca taaagtttgc cattatccat aattcaattt ttcctaaaaa 420tgcactcatt cccataaccc atcaattatt gttaaattga agggcaaaaa aactactttt 480tt 482126535DNANezara viridula 126gggataagag agtgcaacaa gttctggtaa ggttaaatgt agtaacttca tgtactaact 60taaaacagta caactttaga tgttaggtgt taaatgttgt agtcaattct atgattttct 120acaggaattc gtacaattta aaaattattc tatgaattaa ttctaaaata aaaagtcgat 180tttttcatag aggaactgat ttcaaaaggg ttgccataac acaagtttat ttattttacc 240cataaatagc aagggaaata gctaaacatg gattattttt aagaattgca aatattttta 300ttatgactgt agatttatta taacttttaa tttttaaaat aattatctag tctatatact 360ccattagaat aagttgtctt tgtgatgtaa aactaatttt aagaataggt ttatgtcaat 420aaggatgtac ttacgttata ttagtaggta ttgaatataa tagattctgt ataattacct 480aatagaataa gttcagtgct attgtatctg ttaacaataa atgtgaattt attat 53512794DNANezara viridula 127ggggttcatt gaactgttaa gtggtaaagt taatcatata acatatatta attcttattt 60atattgtcat ttgtcttata cctctcgaat gttt 9412870DNANezara viridula 128gggcatctat agaaatattc ttacttatca gaatcttacc tctaaatata aataaacaaa 60gaagaagtgg 70129688DNANezara viridula 129gggggactta tcaaacgttg atgaagacta attatactca cggattacat ctgtgagttg 60acaaacatat atttgtcacc ctaatgtact taccacttta ttaggttttc taaacaactt 120gaaaacaaat ttttctcttg ctttaactat gacattgttt caatttcgat ggctgcgtcg 180acttataagg agtaatacca agcccattcc aatggataaa gcagagttat ggaaagaacg 240tctttcagtt gcttatatgt ttgtttcatt aaatatcctt ggtactataa tttattttta 300ttacaaagga aaacctgatt tagctgaata ttatggtctt aaaactgagg aagagataaa 360caaaaaacca gcaatatatt atgcagagct cttaggaatt aaaaaaacac atgttataag 420gtataaaggg tttcaaaaag tagaagaatt tgattatgaa aaaccagcag acagtgaaaa 480agtgaaaact gatacagagt agaatttttg ttctttttat ttataattag tgttatattt 540aaaaaaatgg taagccagtg tcaattgtaa atctctaaat acaataatac tgttagtaaa 600ggacaattcc ataaataaat aaatgtatct atcaatacag atatttttat tatttttaca 660tatatttgtt attaattgca ttaaataa 688130214DNANezara viridula 130gggccaccat catacgatag acgtgtaatt tctggaggca gtggtccaga gtctaagcca 60actaaggtca tacctgatga tgaaggtagt gatgatgatt ccatcgactg gggcagtggt 120tcagagtcta gttcggaatc gagtgatgat gaaggacagt accaatcgat cagagaaaga 180tttttgaaaa aaacaacaga tcgagaagaa gaag 214131496DNANezara viridula 131ggggaatgaa tgagaatcgt taagagctag tcaatccttt aactgttatg tttcatctca 60agcaaatgaa ttccttgtac ttatgttcat tgttaccctc attaccacag gctacaggtg 120atacaggaag taaactgcag tatactcact gtcgattgtg cagcttagaa gaaaattgcg 180gtgttctttt gcccaaagag attaatgcaa cagttctcat ggaaccaatt gtgtttgaac 240ttatgtatga attgacaagg tttcaggatg ttatcaatag ctgccaaaat gaattagagt 300cttcttactt agtgaattat gtatttaaat tatgtaacac tgtgaatcgt tgtttaaaaa 360atttgccagt aaagggacag ccttcagata ttgctgagca acgattgtta cttttccata 420ctgctaaaac gtttctacat tcatcaatga agattcttgg tttacagcct cttaataaaa 480tgtagatttt actcag 496132632DNANezara viridulamisc_feature122n = A,T,C or G 132gggagatgtt cctttaatga aatggacagc ctttatgctc ggagagcaaa actgaatcgg 60actgcaagag cacatatggc taatgaagca ggcgttactt aggcgtagga aaaaaaaaaa 120anttattttc ttagattact ggtttaattt ctttaatagc tttttaatgt aggtactggc 180aaatcgaaaa aaattgccaa gaggttagca gcacataaaa tgtggatgag actgaaagac 240ttaccctgcg aaagcaacac cattcattac ggcttggatg atgaagatga ggtatgcgta 300attaaattgt ttatctacta ttatcttttt ttaaaaatgc ttgatttaaa tttatgattg 360attattagtt atacttgtgt agttaattac aaattaatta atatagtaat tagtttttta 420ctgatttttt ctattttaat ttattttatt ggctcgattt aagttttata gctggctata 480aaaaatacca agtttctata ctcagtaaga atatatttta tgggcattgg aaatccaggc 540tattcccaaa ctcgttatga acctataaaa ggaattaaag gtattccttt attcatcatt 600ggattgttga tagtttgctt ttgggatcaa tg 632133422DNANezara viridula 133ggggattggt tgatgaaata ttctacctgt tgacagtatg gttggggtat tgctctgttt 60tcatcagtaa ttttacgttt catctgcaaa atagttttta tttgcataag aaatgaacat 120cgaacataaa atgaaactct ttttgctgtt gttattccct tctctatgtg cctctcattt 180ttgtccatcg aggcattact ggagtaaagc tcatagtaaa tgcttggaat gtaaacagtg 240ccatgtaaca cttattcctt gtacagctaa gatgaattca atttgtgcca atatccatga 300aaaaaatcac cacttccaaa aatatcgtat tcaatttttt gatgatggga atgaagatga 360gcttgacaaa caagtagatt ctacagggca catacacaaa gatgatctgt atcttccaca 420tg 422134134DNANezara viridula 134gggcccctga tgtcgatata atccgaaaag ttacaaaaag tcaggcaact ggaacactat 60ctcaaatttg atatcatttt cataaaaagc gcccccccaa aacatcatag tcgaccctga 120tatcgattta atcc 13413568DNANezara viridula 135gggggggagg tacgatgtgt ccctgtgtca tgtactgtac atcgattctg tgtacaacaa 60taaaatac 6813682DNANezara viridula 136tatataaaac ctgcaaatga aattaaacca gaagaatttc gattactaga tgtagataat 60cgtacagtat taccaataaa ta 82137691DNANezara viridulamisc_feature532n = A,T,C or G 137ggggtaattt aggtaaaaat cagtaagaat aaatgcattg attcacttat ttgaaaatta 60aataagaatt aaataaactt ttgaaataga acaattcaat cgttgccctt taagtaagat 120aagcggttcc atattcgttt gtaagaacaa aggaattgat agattagctg tcaaagctta 180tagatcgatt gagatgtatc ttccaactct taaggtgatg acttattcaa agttttttct 240tacagaaagt aatgaagctt ttcaaattta attaaaactt ttttctcttc agatagtcaa 300tataaaaagt ccataacaat caatttataa tatagaggta tatcttcata cccaatcgta 360atttattctt cccttttttt tattattatt tacaggcttt gctgaccttt tatttctttt 420attattttat attatatttc tattatagtt taataaatta tttatttatg aatagatgta 480cgagcttgta aagttttaag taggcttttg attaaacata ccatacaatg gnacgaaatt 540tttaataagc tacaaaacaa agcaaaaaga tgaatgaaat aagttgaaaa aagtcctgga 600atgtcctaaa cgaatattag taaaaatttt acatttatca tgtatgtaag attgcatgtg 660cttgtagcat gtgttagaaa taaattattt c

691138172DNANezara viridula 138ggggcattca agtcctgtaa agttacatca acagggacaa gatctaaatg atataaaaac 60cacttaatta taaatccata cactaagttt aatcaaaatc gttggagcca ttttgaaaaa 120atcttaaaaa tgtttttaat cgattctgtt aagtgtcatt tcagattatc cc 172139645DNANezara viridula 139gggtgtattc atatataatt tttcaatttc aaaaattggg tgtttgttgg atggttcaac 60tttattaata ttgaaaaaca aaattggcgc ataaagctag ttgatcttcc aaaaatatgg 120aacctaggtt tcagtaatag gatttggtgt cattaagttg tatcaattga tgcattttac 180ccatctctaa aatattaaca taaaaattcc aatagataca tactattgct ttagaaatat 240atttaaacat attaaatgtg ataatatttt cttaatatat gttttttttt tctttcttgt 300tttattcatg cgtgtatttt aatgttttaa caaatataaa tattttagat agataaatat 360ttttgatagc gtgtgatatt gatgaactga ctagaaaata tttaattatt ttatgatctt 420atttgagtta ttagacctta atttcgaaca cattttagga aaaaaaaaca tttataaaga 480aaaaaaaaaa aggaaaagaa atgagtaaac tgaaaacagt ttaaagttta atttaacttt 540atcatgtgtc aataatacca tgatatattg ttatattcat gatatattgt tatatcaaat 600aaaaagttat atagacttat aaagcattat aatacatgta tgaaa 64514023DNANezara viridula 140aatcaaggtg tggactgaaa att 2314119RNANezara viridula 141ucaaggugug gacugaaaa 1914219RNANezara viridula 142uuuucagucc acaccuuga 1914323DNANezara viridula 143aattggttgc tacatattct ctt 2314419RNANezara viridula 144uugguugcua cauauucuc 1914519RNANezara viridula 145gagaauaugu agcaaccaa 1914623DNANezara viridula 146aagaacgtct taggatgcat att 2314719RNANezara viridula 147gaacgucuua ggaugcaua 1914819RNANezara viridula 148uaugcauccu aagacguuc 1914923DNANezara viridula 149aagcaagcac ctaccttcac att 2315019RNANezara viridula 150gcaagcaccu accuucaca 1915119RNANezara viridula 151ugugaaggua ggugcuugc 1915223DNANezara viridula 152aaaccaaggt agctgtggat ctt 2315319RNANezara viridula 153accaagguag cuguggauc 1915419RNANezara viridula 154gauccacagc uaccuuggu 1915523DNANezara viridula 155aataatggat gtggtggcgg att 2315619RNANezara viridula 156uaauggaugu gguggcgga 1915719RNANezara viridula 157uccgccacca cauccauua 1915823DNANezara viridula 158aaaaggatac cactttggac ttt 2315919RNANezara viridula 159aaggauacca cuuuggacu 1916019RNANezara viridula 160aguccaaagu gguauccuu 1916123DNANezara viridula 161aaaggatacc actttggact ttt 2316219RNANezara viridula 162aggauaccac uuuggacuu 1916319RNANezara viridula 163aaguccaaag ugguauccu 1916423DNANezara viridula 164aaaccaagac ccagactgga gtt 2316519RNANezara viridula 165accaagaccc agacuggag 1916619RNANezara viridula 166cuccagucug ggucuuggu 1916723DNANezara viridula 167aagacccaga ctggagttga att 2316819RNANezara viridula 168gacccagacu ggaguugaa 1916919RNANezara viridula 169uucaacucca gucuggguc 1917023DNANezara viridula 170aaccaagaaa ctgggaaagt gtt 2317119RNANezara viridula 171ccaagaaacu gggaaagug 1917219RNANezara viridula 172cacuuuccca guuucuugg 1917323DNANezara viridula 173aactgggaaa gtgttcggaa att 2317419RNANezara viridula 174cugggaaagu guucggaaa 1917519RNANezara viridula 175uuuccgaaca cuuucccag 1917623DNANezara viridula 176aactgaaatt gccctcactg att 2317719RNANezara viridula 177cugaaauugc ccucacuga 1917819RNANezara viridula 178ucagugaggg caauuucag 1917923DNANezara viridula 179aagctttctt gtgatacctc att 2318019RNANezara viridula 180gcuuucuugu gauaccuca 1918119RNANezara viridula 181ugagguauca caagaaagc 1918223DNANezara viridula 182aatgatacgt gtgctttgaa ctt 2318319RNANezara viridula 183ugauacgugu gcuuugaac 1918419RNANezara viridula 184guucaaagca cacguauca 1918523DNANezara viridula 185aagcattaat gatggacgtg ttt 2318619RNANezara viridula 186gcauuaauga uggacgugu 1918719RNANezara viridula 187acacguccau cauuaaugc 1918823DNANezara viridula 188aaaactttct caaagaacca gtt 2318919RNANezara viridula 189aacuuucuca aagaaccag 1919019RNANezara viridula 190cugguucuuu gagaaaguu 1919123DNANezara viridula 191aaagaaccag ttccaaatgc att 2319219RNANezara viridula 192agaaccaguu ccaaaugca 1919319RNANezara viridula 193ugcauuugga acugguucu 1919423DNANezara viridula 194aatgcattcc cttcaatctc att 2319519RNANezara viridula 195ugcauucccu ucaaucuca 1919619RNANezara viridula 196ugagauugaa gggaaugca 1919723DNANezara viridula 197aacctctcct cgtctggagt ctt 2319819RNANezara viridula 198ccucuccucg ucuggaguc 1919919RNANezara viridula 199gacuccagac gaggagagg 1920023DNANezara viridula 200aaagaattca cctggtccta ctt 2320119RNANezara viridula 201agaauucacc ugguccuac 1920219RNANezara viridula 202guaggaccag gugaauucu 1920323DNANezara viridula 203aattctggaa gaaatggacc att 2320419RNANezara viridula 204uucuggaaga aauggacca 1920519RNANezara viridula 205ugguccauuu cuuccagaa 1920623DNANezara viridula 206aacgtctaga aatggtgaga gtt 2320719RNANezara viridula 207cgucuagaaa uggugagag 1920819RNANezara viridula 208cucucaccau uucuagacg 1920923DNANezara viridula 209aataagaaac acgaagcagg ctt 2321019RNANezara viridula 210uaagaaacac gaagcaggc 1921119RNANezara viridula 211gccugcuucg uguuucuua 1921223DNANezara viridula 212aaatgaagag ccatttaggc ttt 2321319RNANezara viridula 213augaagagcc auuuaggcu 1921419RNANezara viridula 214agccuaaaug gcucuucau 1921523DNANezara viridula 215aacttcgaac catctccccg gtt 2321619RNANezara viridula 216cuucgaacca ucuccccgg 1921719RNANezara viridula 217ccggggagau gguucgaag 1921823DNANezara viridula 218aagcttcctt cactacaaat gtt 2321919RNANezara viridula 219gcuuccuuca cuacaaaug 1922019RNANezara viridula 220cauuuguagu gaaggaagc 1922123DNANezara viridula 221aaggttcagc tccggggatc ttt 2322219RNANezara viridula 222gguucagcuc cggggaucu 1922319RNANezara viridula 223agauccccgg agcugaacc 1922423DNANezara viridula 224aatcgacgac caaaatactg att 2322519RNANezara viridula 225ucgacgacca aaauacuga 1922619RNANezara viridula 226ucaguauuuu ggucgucga 1922723DNANezara viridula 227aatacttcag agtacggcgt att 2322819RNANezara viridula 228uacuucagag uacggcgua 1922919RNANezara viridula 229uacgccguac ucugaagua 1923023DNANezara viridula 230aaaatgagag ctacgtactg ctt 2323119RNANezara viridula 231aaugagagcu acguacugc 1923219RNANezara viridula 232gcaguacgua gcucucauu 1923323DNANezara viridula 233aaataccatt acacaggaca ttt 2323419RNANezara viridula 234auaccauuac acaggacau 1923519RNANezara viridula 235auguccugug uaaugguau 1923623DNANezara viridula 236aagtgttgct ggaacatcaa gtt 2323719RNANezara viridula 237guguugcugg aacaucaag 1923819RNANezara viridula 238cuugauguuc cagcaacac 1923923DNANezara viridula 239aatgcccagc agaaaccaac ctt 2324019RNANezara viridula 240ugcccagcag aaaccaacc 1924119RNANezara viridula 241gguugguuuc ugcugggca 1924223DNANezara viridula 242aaataccaca gccagcaata att 2324319RNANezara viridula 243auaccacagc cagcaauaa 1924419RNANezara viridula 244uuauugcugg cugugguau 1924523DNANezara viridula 245aataccacag ccagcaataa ttt 2324619RNANezara viridula 246uaccacagcc agcaauaau 1924719RNANezara viridula 247auuauugcug gcuguggua 1924823DNANezara viridula 248aagcctccgg tacctcaagg ttt 2324919RNANezara viridula 249gccuccggua ccucaaggu 1925019RNANezara viridula 250accuugaggu accggaggc 1925123DNANezara viridula 251aatcttatcg gacaaaccag ttt 2325219RNANezara viridula 252ucuuaucgga caaaccagu 1925319RNANezara viridula 253acugguuugu ccgauaaga 1925423DNANezara viridula 254aaaaatatcc attgccactg ttt 2325519RNANezara viridula 255aaauauccau ugccacugu 1925619RNANezara viridula 256acaguggcaa uggauauuu 1925723DNANezara viridula 257aaaatatcca ttgccactgt ttt 2325819RNANezara viridula 258aauauccauu gccacuguu 1925919RNANezara viridula 259aacaguggca auggauauu 1926023DNANezara viridula 260aaatatccat tgccactgtt ttt 2326119RNANezara viridula 261auauccauug ccacuguuu 1926219RNANezara viridula 262aaacaguggc aauggauau 1926323DNANezara viridula 263aaggatggga tgtgttccga gtt 2326419RNANezara viridula 264ggaugggaug uguuccgag 1926519RNANezara viridula 265cucggaacac aucccaucc 1926623DNANezara viridula 266aagatggggg gatgatgtac gtt 2326719RNANezara viridula 267gaugggggga ugauguacg 1926819RNANezara viridula 268cguacaucau ccccccauc 1926923DNANezara viridula 269aagaacatcc acaggagaac ctt 2327019RNANezara viridula 270gaacauccac aggagaacc 1927119RNANezara viridula 271gguucuccug uggauguuc 1927223DNANezara viridula 272aagactctat taatatccag ctt 2327319RNANezara viridula 273gacucuauua auauccagc 1927419RNANezara viridula 274gcuggauauu aauagaguc 1927523DNANezara viridula 275aaatggaaag ctgggcagaa ctt 2327619RNANezara viridula 276auggaaagcu gggcagaac 1927719RNANezara viridula 277guucugccca gcuuuccau 192781053DNANezara viridula 278ggaaatatgt agtaggaaca aaagtcagtt aagtagtatg ctctctgcaa tcttggacta 60taccagcaat aaaaacttta tcattagaga taaaaaagat atatcatttt tttctaaagc 120tatggaagtt tgtagtaaac tcaaagataa ggatcttctc tacaggcttc atgaattatt 180gttgaccgga aacaattata atttgatcgg agattcattt agtgaatcgg tgtattaccg 240ttattttttt ttatttgctt actgatactg aagaacttag taaagtaatg gaattctatg 300atgaccttgt accaaacgtt tatgttccag agccatcagt gaccaatgct atattgaaag 360ctgtttgtaa caacatggca tgggaccttc ttcccaagct ttggccagac atactattgt 420ttgagcagta tgaagtttcc ggtgtcctgg aaaatatttt agatattgca tctcaaaatg 480aaggcaagaa tttgatggaa gggatgtcta aaattgcatg gtctgcatgg gagaagatag 540aaggaataaa gagggagcga tccaactttc aatggtctgc gagtgcattg ggaaacatta 600ttctcatttt gttgaaatct ggtgaaaaag ctaaggcgaa tttggttatg aataaattaa 660ttcaactagg aagttctgcc atgaatgaac caaaaataga ggctttgagt ctctacgtgg 720acagttgcat agaaagttca tcaccagatg tagcaattaa atgcattcaa tattgcaacg 780atattggatt tacggaaacc acagagtttg ctaggcgaat caattcttct atcgagctca 840acccaaggca atatgaaaaa ttaacatcta ttgtaggcga agattgtctg aaagttgaaa 900agaaaaaaga tcaaagtagt tgaaattgtt tttagacttt taataaatgt ataattttac 960attgttagtt aatatttgca tagttttctt gtaatataat cactagttca actgttttat 1020tctaatttaa gagaataaaa gttttacatt tcc 1053279861DNANezara viridula 279agtttgaata atttcaatct catctaaagg attatttaat gtgaatgatt tgtgtcagtt 60tttactttta actgcggcat atagcctgct gcagttaatg cgggaaggtt taccttatta 120tgtctgactg ggaacaaaga ttgctcagcc tggaaaaact ggacaggtca tcgccagagc 180tctggccaga gccgatacct ggggtgacag aatatgctgc tcgcaatgct ctttctagtt 240cctctgttcc aaagaacatt gaatcactcc agagtcagtt tactgaggat gactataagc 300tgctaaatta ttacagtact ctttctaaag aatctctgat tcaagaatta aagaagcttc 360atgaccaggc ctataaatta ggtcttgaag aagccaagga aatgactaga ggaagatttt 420tgaacatact gtctaccaga aaaaagtaat ggtttgtaaa tgctgccatg cttctgaatg 480gttccatcat attctgatcc agaagaagga agttgtagcg aatggagtag gtataaaagt 540gagtcaataa ggacaagaag ggctaattta atgtattttt ccaaatattt ttgtaattgc

600agaatagaag atttatgtga agaaatgaat ttaagttttt gttgttgtaa ctgtctgtta 660tagttccttc agtcccaaat attttgttgg cttctaatca agctcttgta tttattaatt 720ttctttttca attcaattaa ttaaagtgtt gctaaaaagt tgataatatt aaagtaaatt 780tagtttattt ttatttccca gaattaatta tttattattg ttatctgtac taagaataaa 840aaatatgtta attgttctcc g 861280992DNANezara viridula 280gaagaaattg agagaatggt taatgatgcc gagaaataca aggctgaaga tgataagcag 60aaagctgtca ttcaagctaa gaacactctg gagtcctatt gtttcaatat gaaatctact 120gtagaggatg aaaaactgaa agacaaaatt tccgattctg ataaaactac aattttggag 180aaatgtaatg aagttattcg ctggctcgat gctaatcagt tagctgaaaa agaagaattc 240gaacataagc aaaaggaatt ggaagccata tgcaatccta ttattactaa attgtaccaa 300agtggtggta tgcccggagg aatgccaggt ggtatgcctg gtggtttccc aggcggtgcc 360cctcctaatg ctggtggtgc tgctggacct accattgaag aagttgatta aacattccat 420gcgaataaac acacaaataa tacattgtat aattaatgct agttgaattg caattttttt 480ttcctttcta gtcaagagac cttcaaatgg ccttgtattt ttgtttaaaa atttaatgtt 540aataatgtaa cttttacaag tattttgttt atttataatt tttttatatg ttctgtcatt 600ggtatcaatg aattatatta gagttactat taactaatgt ttttaaataa aaatatagcc 660tgtagaggaa tacttgatgt aaatgtatac agtattaaat gagccatata atttttattt 720aaattccatt tttttaattt atatattgat aaattgcatt ttgtgtgtta tacttgcctc 780attgaattta tgttaatgaa tattttttat agttaaaaaa aaaggctgat tccaatttaa 840gttttatttt gaagaagaat tttgtaccct tgtttgataa atcttgtgaa tcttgttatg 900gttaaacatc ttttggtaac caccctttgg ttgtattcaa aattgtgaat gaaacatttt 960cggcacaaaa ttaataaaat taattattcc ac 992281858DNANezara viridula 281agtgtccgcc ctcttcatct cctgtcttgt atcatcacat catccttccc cttctctcgc 60tgagtcaact tacgccaaac cgtcatccag cggtaggaag cgagaggctg ccctagattg 120tatgctaggc tctctcaccg agaacatgtc caggcaagga gtcacaacga cacagaaagg 180ctgctgttca gcttgcgaca aacccattgt cggccaggta atcacagcac taggcaagac 240atggcatcca gaacactttg tctgcacaca ctgcaaccag gagcttggaa caagaaactt 300ctttgagagg gatggtcacc cctactgtga gccagattac cacaacctct tcagtcctcg 360atgtgcctac tgcaacggcc ctatcttaga taaatgtgtc acagccttgg aaaaaacatg 420gcatacggaa catttctttt gtgctcagtg tggtaaacag tttggggaag aggggttcca 480tgagaaagat ggtcgaccct attgtcggga cgattacttt gaaatgtttg ctccaaaatg 540tggcggctgt tcccgcccaa taatggagaa ctatatttca gccctctcaa tgcagtggca 600tcaagactgt tttgtctgca gggattgccg gaagcccgtc acagggaaga ccttttatgc 660catggaagga aagcctgtct gtccgaaatg tgtcggagtg gacgaggaag aagaagactg 720aagattcggc aaaaactaat acctctatat taaatgcttt tttatagaac cacgcgaatc 780ataaccacca tcctaccaac tctgtattta tatttgtata gaaaataaaa gttttttttt 840ttttttttta ttaattag 858282643DNANezara viridula 282gggtgcctag ggtgcccctt cctggagcag gtggtggaat tggttcagca agacctgcgg 60gacgtggagt tccagctcct ggtacaccag ctgcacctgg tctccaaggt ccagttcgtg 120gtgtaggtgg cccatctgca caagttatga ctccagcggg gcgtggagga caagtttctg 180ctcctcctca gatgcgtgct ccacccccag gaatgccccc aatgatggga gctccaccaa 240tgatgaacat ggcaccagga atggcgatgg gaagaggtgg accacctcct caaatgggtg 300ctcctccagc tccaccaatg cgaggtcccc caccaggaat gatgagaggt ccccctcctt 360tttaagaaga aagaaaattt tgttaccttc cttctgtaat ttttttttaa gtttgaaatt 420tacaaagcca atggatggct aagattaatt tctgactttt ttttggatac ataccattta 480tttatgtaaa tgtgctcatg tatgtatata tttatctatg cattttggaa aaagaatatt 540tgtactaaat tatttgataa ataattgtag taattatact taaacactct ggtctttatt 600taataaacca ttgttttttt attaattgta ataaatttgt ttt 643283792DNANezara viridula 283attgaggttt cagtttctgc acagtccagt gactttggtt tcgatcggga tttatatctc 60tattatggac aatttgggtc aacaaacacc tcatcaaaat aatcattcaa atgatacaga 120aatgaacaat tttatggacg tatccagaat gagtaccatg tggccttatc cacatcctga 180caggttttca caatacaggg atttctttca tgaacctcag caaggagtag tttctgggaa 240tgaaacaaca aataatgtta gccaagtatt aacaaacaat tccacacagc aacattcttt 300agtgaatact atgcctgtta tgggaacttt acaaacagta ttaactcaag gtttgccaaa 360ccaaaatgct aatgctaatg ttgttaattt aaatcatact ccacagaatt tacccagtac 420tattcagact tccataaata gccttccaaa tgccaccaac tctaccagtc aaggacaaga 480gcaatctacc cagatattaa caagaatgag gttgcaagat ttggtgagag aagtagatcc 540taatgaacaa ttagacgaag atgttgaaga tgtattatta caaatggcag atgattttgt 600tgactcagca attacagctg gttgtcttct tgccaagcac agaaaatcaa ctactgtaga 660agttaaggat cttcagctac atttagaaag aaattggaat atgtggatac ctggttttgg 720aacagatgaa ttgcgacctt acaaacgtgc atctgttaca gaagctcata aacaaagact 780tacgcttatc ac 792284536DNANezara viridula 284gaaatatgta gtaggaacaa aagtcagtta agtagtatgc tctctgcaat cttggactat 60accagcaata aaaactttat cattagagat aaaaaagata tatcattttt ttctaaagct 120atggaagttt gtagtaaact caaagataag gatcttctct acaggcttca tgaattattg 180ttgaccggaa acaattataa tttgatcgga gattcattta gtgaatcggt gtattaccgt 240tatttttttt tatttgctta ctgatactga agaacttagt aaagtaatgg aattctatga 300tgaccttgta ccaaacgttt atgttccaga gccatcagtg accaatgcta tattgaaagc 360tgtttgtaac aacatggcat gggaccttct tcccaagctt tggccagaca tactattgtt 420tgagcagtat gaagtttccg gtgtcctgga aaatatttta gatattgcat ctcaaaatga 480aggcaagaat ttgatggaag ggatgtctaa aattgcatgg tctgcatggg agaaga 536285605DNANezara viridula 285tgcggcatat agcctgctgc agttaatgcg ggaaggttta ccttattatg tctgactggg 60aacaaagatt gctcagcctg gaaaaactgg acaggtcatc gccagagctc tggccagagc 120cgatacctgg ggtgacagaa tatgctgctc gcaatgctct ttctagttcc tctgttccaa 180agaacattga atcactccag agtcagttta ctgaggatga ctataagctg ctaaattatt 240acagtactct ttctaaagaa tctctgattc aagaattaaa gaagcttcat gaccaggcct 300ataaattagg tcttgaagaa gccaaggaaa tgactagagg aagatttttg aacatactgt 360ctaccagaaa aaagtaatgg tttgtaaatg ctgccatgct tctgaatggt tccatcatat 420tctgatccag aagaaggaag ttgtagcgaa tggagtaggt ataaaagtga gtcaataagg 480acaagaaggg ctaatttaat gtatttttcc aaatattttt gtaattgcag aatagaagat 540ttatgtgaag aaatgaattt aagtttttgt tgttgtaact gtctgttata gttccttcag 600tccca 605286762DNANezara viridula 286tgcggcatat agcctgctgc agttaatgcg ggaaggttta ccttattatg tctgactggg 60aacaaagatt gctcagcctg gaaaaactgg acaggtcatc gccagagctc tggccagagc 120cgatacctgg ggtgacagaa tatgctgctc gcaatgctct ttctagttcc tctgttccaa 180agaacattga atcactccag agtcagttta ctgaggatga ctataagctg ctaaattatt 240acagtactct ttctaaagaa tctctgattc aagaattaaa gaagcttcat gaccaggcct 300ataaattagg tcttgaagaa gccaaggaaa tgactagagg aagatttttg aacatactgt 360ctaccagaaa aaagtaatgg tttgtaaatg ctgccatgct tctgaatggt tccatcatat 420tctgatccag aagaaggaag ttgtagcgaa tggagtaggt ataaaagtga gtcaataagg 480acaagaaggg ctaatttaat gtatttttcc aaatattttt gtaattgcag aatagaagat 540ttatgtgaag aaatgaattt aagtttttgt tgttgtaact gtctgttata gttccttcag 600tcccaaatat tttgttggct tctaatcaag ctcttgtatt tattaatttt ctttttcaat 660tcaattaatt aaagtgttgc taaaaagttg ataatattaa agtaaattta gtttattttt 720atttcccaga attaattatt tattattgtt atctgtacta ag 762287367DNANezara viridula 287tgcggcatat agcctgctgc agttaatgcg ggaaggttta ccttattatg tctgactggg 60aacaaagatt gctcagcctg gaaaaactgg acaggtcatc gccagagctc tggccagagc 120cgatacctgg ggtgacagaa tatgctgctc gcaatgctct ttctagttcc tctgttccaa 180agaacattga atcactccag agtcagttta ctgaggatga ctataagctg ctaaattatt 240acagtactct ttctaaagaa tctctgattc aagaattaaa gaagcttcat gaccaggcct 300ataaattagg tcttgaagaa gccaaggaaa tgactagagg aagatttttg aacatactgt 360ctaccag 367288485DNANezara viridula 288tgccgagaaa tacaaggctg aagatgataa gcagaaagct gtcattcaag ctaagaacac 60tctggagtcc tattgtttca atatgaaatc tactgtagag gatgaaaaac tgaaagacaa 120aatttccgat tctgataaaa ctacaatttt ggagaaatgt aatgaagtta ttcgctggct 180cgatgctaat cagttagctg aaaaagaaga attcgaacat aagcaaaagg aattggaagc 240catatgcaat cctattatta ctaaattgta ccaaagtggt ggtatgcccg gaggaatgcc 300aggtggtatg cctggtggtt tcccaggcgg tgcccctcct aatgctggtg gtgctgctgg 360acctaccatt gaagaagttg attaaacatt ccatgcgaat aaacacacaa ataatacatt 420gtataattaa tgctagttga attgcaattt ttttttcctt tctagtcaag agaccttcaa 480atggc 485289451DNANezara viridula 289ctagtcaaga gaccttcaaa tggccttgta tttttgttta aaaatttaat gttaataatg 60taacttttac aagtattttg tttatttata atttttttat atgttctgtc attggtatca 120atgaattata ttagagttac tattaactaa tgtttttaaa taaaaatata gcctgtagag 180gaatacttga tgtaaatgta tacagtatta aatgagccat ataattttta tttaaattcc 240atttttttaa tttatatatt gataaattgc attttgtgtg ttatacttgc ctcattgaat 300ttatgttaat gaatattttt tatagttaaa aaaaaaggct gattccaatt taagttttat 360tttgaagaag aattttgtac ccttgtttga taaatcttgt gaatcttgtt atggttaaac 420atcttttggt aaccaccctt tggttgtatt c 451290799DNANezara viridula 290gtgtccgccc tcttcatctc ctgtcttgta tcatcacatc atccttcccc ttctctcgct 60gagtcaactt acgccaaacc gtcatccagc ggtaggaagc gagaggctgc cctagattgt 120atgctaggct ctctcaccga gaacatgtcc aggcaaggag tcacaacgac acagaaaggc 180tgctgttcag cttgcgacaa acccattgtc ggccaggtaa tcacagcact aggcaagaca 240tggcatccag aacactttgt ctgcacacac tgcaaccagg agcttggaac aagaaacttc 300tttgagaggg atggtcaccc ctactgtgag ccagattacc acaacctctt cagtcctcga 360tgtgcctact gcaacggccc tatcttagat aaatgtgtca cagccttgga aaaaacatgg 420catacggaac atttcttttg tgctcagtgt ggtaaacagt ttggggaaga ggggttccat 480gagaaagatg gtcgacccta ttgtcgggac gattactttg aaatgtttgc tccaaaatgt 540ggcggctgtt cccgcccaat aatggagaac tatatttcag ccctctcaat gcagtggcat 600caagactgtt ttgtctgcag ggattgccgg aagcccgtca cagggaagac cttttatgcc 660atggaaggaa agcctgtctg tccgaaatgt gtcggagtgg acgaggaaga agaagactga 720agattcggca aaaactaata cctctatatt aaatgctttt ttatagaacc acgcgaatca 780taaccaccat cctaccaac 799291576DNANezara viridula 291ttcctggagc aggtggtgga attggttcag caagacctgc gggacgtgga gttccagctc 60ctggtacacc agctgcacct ggtctccaag gtccagttcg tggtgtaggt ggcccatctg 120cacaagttat gactccagcg gggcgtggag gacaagtttc tgctcctcct cagatgcgtg 180ctccaccccc aggaatgccc ccaatgatgg gagctccacc aatgatgaac atggcaccag 240gaatggcgat gggaagaggt ggaccacctc ctcaaatggg tgctcctcca gctccaccaa 300tgcgaggtcc cccaccagga atgatgagag gtccccctcc tttttaagaa gaaagaaaat 360tttgttacct tccttctgta attttttttt aagtttgaaa tttacaaagc caatggatgg 420ctaagattaa tttctgactt ttttttggat acataccatt tatttatgta aatgtgctca 480tgtatgtata tatttatcta tgcattttgg aaaaagaata tttgtactaa attatttgat 540aaataattgt agtaattata cttaaacact ctggtc 576292782DNANezara viridula 292gaggtttcag tttctgcaca gtccagtgac tttggtttcg atcgggattt atatctctat 60tatggacaat ttgggtcaac aaacacctca tcaaaataat cattcaaatg atacagaaat 120gaacaatttt atggacgtat ccagaatgag taccatgtgg ccttatccac atcctgacag 180gttttcacaa tacagggatt tctttcatga acctcagcaa ggagtagttt ctgggaatga 240aacaacaaat aatgttagcc aagtattaac aaacaattcc acacagcaac attctttagt 300gaatactatg cctgttatgg gaactttaca aacagtatta actcaaggtt tgccaaacca 360aaatgctaat gctaatgttg ttaatttaaa tcatactcca cagaatttac ccagtactat 420tcagacttcc ataaatagcc ttccaaatgc caccaactct accagtcaag gacaagagca 480atctacccag atattaacaa gaatgaggtt gcaagatttg gtgagagaag tagatcctaa 540tgaacaatta gacgaagatg ttgaagatgt attattacaa atggcagatg attttgttga 600ctcagcaatt acagctggtt gtcttcttgc caagcacaga aaatcaacta ctgtagaagt 660taaggatctt cagctacatt tagaaagaaa ttggaatatg tggatacctg gttttggaac 720agatgaattg cgaccttaca aacgtgcatc tgttacagaa gctcataaac aaagacttac 780gc 7822931358DNAArtificial SequencePHP49713 Haripin RNA Construct without promoter 293ggaaatatgt agtaggaaca aaagtcagtt aagtagtatg ctctctgcaa tcttggacta 60taccagcaat aaaaacttta tcattagaga taaaaaagat atatcatttt tttctaaagc 120tatggaagtt tgtagtaaac tcaaagataa ggatcttctc tacaggcttc atgaattatt 180gttgaccgga aacaattata atttgatcgg agattcattt agtgaatcgg tgtattaccg 240ttattttttt ttatttgctt actgatactg aagaacttag taaagtaatg gaattctatg 300atgaccttgt accaaacgtt tatgttccag agccatcagt gaccaatgct atattgaaag 360ctgtttgtaa caacatggca tgggaccttc ttcccaagct ttggccagac atactattgt 420ttgagcagta tgaagtttcc ggtgtcctgg aaaatatttt agatattgca tctcaaaatg 480aaggcaagaa tttgatggaa gggatgtcta aaattgcatg gtctgcatgg gagaagcaac 540tttattatac aaagttgata gatatcggtc cgagatccat caggtaagtt tctgcttcta 600cctttgatat atatataata attatcatta attagtagta atataatatt tcaaatattt 660ttttcaaaat aaaagaatgt agtatatagc aattgctttt ctgtagttta taagtgtgta 720tattttaatt tataactttt ctaatatatg accaaaacat ggtgatgtgc aggtccatgg 780tggagctcga ccgatatcta tcaactttgt ataataaagt tgcttctccc atgcagacca 840tgcaatttta gacatccctt ccatcaaatt cttgccttca ttttgagatg caatatctaa 900aatattttcc aggacaccgg aaacttcata ctgctcaaac aatagtatgt ctggccaaag 960cttgggaaga aggtcccatg ccatgttgtt acaaacagct ttcaatatag cattggtcac 1020tgatggctct ggaacataaa cgtttggtac aaggtcatca tagaattcca ttactttact 1080aagttcttca gtatcagtaa gcaaataaaa aaaaataacg gtaatacacc gattcactaa 1140atgaatctcc gatcaaatta taattgtttc cggtcaacaa taattcatga agcctgtaga 1200gaagatcctt atctttgagt ttactacaaa cttccatagc tttagaaaaa aatgatatat 1260cttttttatc tctaatgata aagtttttat tgctggtata gtccaagatt gcagagagca 1320tactacttaa ctgacttttg ttcctactac atatttcc 13582941498DNAArtificial SequencePHP48181 Haripin RNA Construct without promoter 294ctgcggcata tagcctgctg cagttaatgc gggaaggttt accttattat gtctgactgg 60gaacaaagat tgctcagcct ggaaaaactg gacaggtcat cgccagagct ctggccagag 120ccgatacctg gggtgacaga atatgctgct cgcaatgctc tttctagttc ctctgttcca 180aagaacattg aatcactcca gagtcagttt actgaggatg actataagct gctaaattat 240tacagtactc tttctaaaga atctctgatt caagaattaa agaagcttca tgaccaggcc 300tataaattag gtcttgaaga agccaaggaa atgactagag gaagattttt gaacatactg 360tctaccagaa aaaagtaatg gtttgtaaat gctgccatgc ttctgaatgg ttccatcata 420ttctgatcca gaagaaggaa gttgtagcga atggagtagg tataaaagtg agtcaataag 480gacaagaagg gctaatttaa tgtatttttc caaatatttt tgtaattgca gaatagaaga 540tttatgtgaa gaaatgaatt taagtttttg ttgttgtaac tgtctgttat agttccttca 600gtcccacaac tttattatac aaagttgata gatatcggtc cgagatccat caggtaagtt 660tctgcttcta cctttgatat atatataata attatcatta attagtagta atataatatt 720tcaaatattt ttttcaaaat aaaagaatgt agtatatagc aattgctttt ctgtagttta 780taagtgtgta tattttaatt tataactttt ctaatatatg accaaaacat ggtgatgtgc 840aggtccatgg tggagctcga ccgatatcta tcaactttgt ataataaagt tgtgggactg 900aaggaactat aacagacagt tacaacaaca aaaacttaaa ttcatttctt cacataaatc 960ttctattctg caattacaaa aatatttgga aaaatacatt aaattagccc ttcttgtcct 1020tattgactca cttttatacc tactccattc gctacaactt ccttcttctg gatcagaata 1080tgatggaacc attcagaagc atggcagcat ttacaaacca ttactttttt ctggtagaca 1140gtatgttcaa aaatcttcct ctagtcattt ccttggcttc ttcaagacct aatttatagg 1200cctggtcatg aagcttcttt aattcttgaa tcagagattc tttagaaaga gtactgtaat 1260aatttagcag cttatagtca tcctcagtaa actgactctg gagtgattca atgttctttg 1320gaacagagga actagaaaga gcattgcgag cagcatattc tgtcacccca ggtatcggct 1380ctggccagag ctctggcgat gacctgtcca gtttttccag gctgagcaat ctttgttccc 1440agtcagacat aataaggtaa accttcccgc attaactgca gcaggctata tgccgcag 14982951813DNAArtificial SequencepKB505 Haripin RNA Construct without promoter 295ctgcggcata tagcctgctg cagttaatgc gggaaggttt accttattat gtctgactgg 60gaacaaagat tgctcagcct ggaaaaactg gacaggtcat cgccagagct ctggccagag 120ccgatacctg gggtgacaga atatgctgct cgcaatgctc tttctagttc ctctgttcca 180aagaacattg aatcactcca gagtcagttt actgaggatg actataagct gctaaattat 240tacagtactc tttctaaaga atctctgatt caagaattaa agaagcttca tgaccaggcc 300tataaattag gtcttgaaga agccaaggaa atgactagag gaagattttt gaacatactg 360tctaccagaa aaaagtaatg gtttgtaaat gctgccatgc ttctgaatgg ttccatcata 420ttctgatcca gaagaaggaa gttgtagcga atggagtagg tataaaagtg agtcaataag 480gacaagaagg gctaatttaa tgtatttttc caaatatttt tgtaattgca gaatagaaga 540tttatgtgaa gaaatgaatt taagtttttg ttgttgtaac tgtctgttat agttccttca 600gtcccaaata ttttgttggc ttctaatcaa gctcttgtat ttattaattt tctttttcaa 660ttcaattaat taaagtgttg ctaaaaagtt gataatatta aagtaaattt agtttatttt 720tatttcccag aattaattat ttattattgt tatctgtact aagcaacttt attatacaaa 780gttggataga tatcggtccg agatccatca ggtaagtttc tgcttctacc tttgatatat 840atataataat tatcattaat tagtagtaat ataatatttc aaatattttt ttcaaaataa 900aagaatgtag tatatagcaa ttgcttttct gtagtttata agtgtgtata ttttaattta 960taacttttct aatatatgac caaaacatgg tgatgtgcag gtccatggtg gagctcgacc 1020gatatctatc aactttgtat aataaagttg cttagtacag ataacaataa taaataatta 1080attctgggaa ataaaaataa actaaattta ctttaatatt atcaactttt tagcaacact 1140ttaattaatt gaattgaaaa agaaaattaa taaatacaag agcttgatta gaagccaaca 1200aaatatttgg gactgaagga actataacag acagttacaa caacaaaaac ttaaattcat 1260ttcttcacat aaatcttcta ttctgcaatt acaaaaatat ttggaaaaat acattaaatt 1320agcccttctt gtccttattg actcactttt atacctactc cattcgctac aacttccttc 1380ttctggatca gaatatgatg gaaccattca gaagcatggc agcatttaca aaccattact 1440tttttctggt agacagtatg ttcaaaaatc ttcctctagt catttccttg gcttcttcaa 1500gacctaattt ataggcctgg tcatgaagct tctttaattc ttgaatcaga gattctttag 1560aaagagtact gtaataattt agcagcttat agtcatcctc agtaaactga ctctggagtg 1620attcaatgtt ctttggaaca gaggaactag aaagagcatt gcgagcagca tattctgtca 1680ccccaggtat cggctctggc cagagctctg gcgatgacct gtccagtttt tccaggctga 1740gcaatctttg ttcccagtca gacataataa ggtaaacctt cccgcattaa ctgcagcagg 1800ctatatgccg cag 18132961694DNAArtificial SequencepKB506 Haripin RNA Construct without promoter 296gggtgattgc ggttacatca tgtacggaaa aataattcta atccttgatt taaatttgaa 60cttgactatt tatttattct ttatttcatt ttgtaaatca ttttatgtat ctcctggcaa 120gcaattttat ccaccttgca ccaacacctt cgggttccat aatcaaacca ccttaacttc 180acaccatgct gtaactcaca ccgcccagca tctccaatgt

gaaagaagct aaaatttaat 240aaacaatcat acgaagcagt gacaaaatac cagatggtat taatgcttcg ataaaattaa 300ttggaaagta taaaatggta gaaaataata aattataatt aatttaagta agataaaaaa 360taattaaaaa ctaaaatgtt aaaattttaa aaaaattatt ttaaataata tttaaaaaca 420ttaaaaatca ttttaaaaaa tttatttata gaacaattaa ataaatattt cagctaataa 480aaaacaaaag cttacctagc cttagaagac aacttgtcca acaattagat gatacccatt 540gcccttacgt tttctttaac atcaattatt gtttttgtca acaagctatc ttttagtttt 600attttattgg taaaaaatat gtcgccttca agttgcatca tttaacacat ctcgtcatta 660gaaaaataaa actcttccct aaacgattag tagaaaaaat cattcgataa taaataagaa 720agaaaaatta gaaaaaaata acttcatttt aaaaaaatca ttaaggctat attttttaaa 780tgactaattt tatatagact gtaactaaaa gtatacaatt tattatgcta tgtatcttaa 840agaattactt ataaaaatct acggaagaat atcttacaaa gtgaaaaaca aatgagaaag 900aatttagtgg gatgattatg attttatttg aaaattgaaa aaataattat taaagacttt 960agtggagtaa gaaagctttc ctattagtct tttcttatcc ataaaaaaaa aaaaaaaaat 1020ctagcgtgac agcttttcca tagattttaa taatgtaaaa tactggtagc agccgaccgt 1080tcaggtaatg gacactgtgg tcctaacttg caacgggtgc gggcccaatt taataacgcc 1140gtggtaacgg ataaagccaa gcgtgaagcg gtgaaggtac atctctgact ccgtcaagat 1200tacgaaaccg tcaactacga aggactcccc gaaatatcat ctgtgtcata aacaccaagt 1260cacaccatac atgggcacgc gtcacaatat gattggagaa cggttccacc gcatatgcta 1320taaaatgccc ccacacccct cgaccctaat cgcacttcaa ttgcaatcaa attagttcat 1380tctctttgcg cagttcccta cctctccttt caaggttcgt agatttcttc cgtttttttt 1440tcttcttctt tattgtttgt tctacatcag catgatgttg atttgattgt gttttctatc 1500gtttcatcga ttataaattt tcataatcag aagattcagc ttttattaat gcaagaacgt 1560ccttaattga tgattttata accgtaaatt aggtctaatt agagtttttt tcataaagat 1620tttcagatcc gtttacaaca agccttaatt gttgattctg tagtcgtaga ttaaggtttt 1680tttcatgaac tact 16942971256DNAArtificial SequencePHP48183 Haripin RNA Construct without promotermisc_feature432, 825n = A,T,C or G 297tgccgagaaa tacaaggctg aagatgataa gcagaaagct gtcattcaag ctaagaacac 60tctggagtcc tattgtttca atatgaaatc tactgtagag gatgaaaaac tgaaagacaa 120aatttccgat tctgataaaa ctacaatttt ggagaaatgt aatgaagtta ttcgctggct 180cgatgctaat cagttagctg aaaaagaaga attcgaacat aagcaaaagg aattggaagc 240catatgcaat cctattatta ctaaattgta ccaaagtggt ggtatgcccg gaggaatgcc 300aggtggtatg cctggtggtt tcccaggcgg tgcccctcct aatgctggtg gtgctgctgg 360acctaccatt gaagaagttg attaaacatt ccatgcgaat aaacacacaa ataatacatt 420gtataattaa tnctagttga attgcaattt ttttttcctt tctagtcaag agaccttcaa 480atggccaact ttattataca aagttgatag atatcggtcc gagatccatc aggtaagttt 540ctgcttctac ctttgatata tatataataa ttatcattaa ttagtagtaa tataatattt 600caaatatttt tttcaaaata aaagaatgta gtatatagca attgcttttc tgtagtttat 660aagtgtgtat attttaattt ataacttttc taatatatga ccaaaacatg gtgatgtgca 720ggtccatggt ggagctcgac cgatatctat caactttgta taataaagtt ggccatttga 780aggtctcttg actagaaagg aaaaaaaaat tgcaattcaa ctagnattaa ttatacaatg 840tattatttgt gtgtttattc gcatggaatg tttaatcaac ttcttcaatg gtaggtccag 900cagcaccacc agcattagga ggggcaccgc ctgggaaacc accaggcata ccacctggca 960ttcctccggg cataccacca ctttggtaca atttagtaat aataggattg catatggctt 1020ccaattcctt ttgcttatgt tcgaattctt ctttttcagc taactgatta gcatcgagcc 1080agcgaataac ttcattacat ttctccaaaa ttgtagtttt atcagaatcg gaaattttgt 1140ctttcagttt ttcatcctct acagtagatt tcatattgaa acaataggac tccagagtgt 1200tcttagcttg aatgacagct ttctgcttat catcttcagc cttgtatttc tcggca 12562981188DNAArtificial SequencepKB508 Haripin RNA Construct without promoter 298ctagtcaaga gaccttcaaa tggccttgta tttttgttta aaaatttaat gttaataatg 60taacttttac aagtattttg tttatttata atttttttat atgttctgtc attggtatca 120atgaattata ttagagttac tattaactaa tgtttttaaa taaaaatata gcctgtagag 180gaatacttga tgtaaatgta tacagtatta aatgagccat ataattttta tttaaattcc 240atttttttaa tttatatatt gataaattgc attttgtgtg ttatacttgc ctcattgaat 300ttatgttaat gaatattttt tatagttaaa aaaaaaggct gattccaatt taagttttat 360tttgaagaag aattttgtac ccttgtttga taaatcttgt gaatcttgtt atggttaaac 420atcttttggt aaccaccctt tggttgtatt ccaactttat tatacaaagt tgatagatat 480cggtccgaga tccatcaggt aagtttctgc ttctaccttt gatatatata taataattat 540cattaattag tagtaatata atatttcaaa tatttttttc aaaataaaag aatgtagtat 600atagcaattg cttttctgta gtttataagt gtgtatattt taatttataa cttttctaat 660atatgaccaa aacatggtga tgtgcaggtc catggtggag ctcgaccgat atctatcaac 720tttgtataat aaagttggaa tacaaccaaa gggtggttac caaaagatgt ttaaccataa 780caagattcac aagatttatc aaacaagggt acaaaattct tcttcaaaat aaaacttaaa 840ttggaatcag cctttttttt taactataaa aaatattcat taacataaat tcaatgaggc 900aagtataaca cacaaaatgc aatttatcaa tatataaatt aaaaaaatgg aatttaaata 960aaaattatat ggctcattta atactgtata catttacatc aagtattcct ctacaggcta 1020tatttttatt taaaaacatt agttaatagt aactctaata taattcattg ataccaatga 1080cagaacatat aaaaaaatta taaataaaca aaatacttgt aaaagttaca ttattaacat 1140taaattttta aacaaaaata caaggccatt tgaaggtctc ttgactag 11882991882DNAArtificial SequencePHP49450 Haripin RNA Construct without promoter 299gtgtccgccc tcttcatctc ctgtcttgta tcatcacatc atccttcccc ttctctcgct 60gagtcaactt acgccaaacc gtcatccagc ggtaggaagc gagaggctgc cctagattgt 120atgctaggct ctctcaccga gaacatgtcc aggcaaggag tcacaacgac acagaaaggc 180tgctgttcag cttgcgacaa acccattgtc ggccaggtaa tcacagcact aggcaagaca 240tggcatccag aacactttgt ctgcacacac tgcaaccagg agcttggaac aagaaacttc 300tttgagaggg atggtcaccc ctactgtgag ccagattacc acaacctctt cagtcctcga 360tgtgcctact gcaacggccc tatcttagat aaatgtgtca cagccttgga aaaaacatgg 420catacggaac atttcttttg tgctcagtgt ggtaaacagt ttggggaaga ggggttccat 480gagaaagatg gtcgacccta ttgtcgggac gattactttg aaatgtttgc tccaaaatgt 540ggcggctgtt cccgcccaat aatggagaac tatatttcag ccctctcaat gcagtggcat 600caagactgtt ttgtctgcag ggattgccgg aagcccgtca cagggaagac cttttatgcc 660atggaaggaa acctgtctgt ccgaaatgtg tcggagtgga cgaggaagaa gaagactgaa 720gattcggcaa aaactaatac ctctatatta aatgcttttt tatagaacca cgcgaatcat 780aaccaccatc ctaccaacca actttattat acaaagttga tagatatcgg tccgagatcc 840atcaggtaag tttctgcttc tacctttgat atatatataa taattatcat taattagtag 900taatataata tttcaaatat ttttttcaaa ataaaagaat gtagtatata gcaattgctt 960ttctgtagtt tataagtgtg tatattttaa tttataactt ttctaatata tgaccaaaac 1020atggtgatgt gcaggtccat ggtggagctc gaccgatatc tatcaacttt gtataataaa 1080gttggttggt aggatggtgg ttatgattcg cgtggttcta taaaaaagca tttaatatag 1140aggtattagt ttttgccgaa tcttcagtct tcttcttcct cgtccactcc gacacatttc 1200ggacagacag gtttccttcc atggcataaa aggtcttccc tgtgacgggc ttccggcaat 1260ccctgcagac aaaacagtct tgatgccact gcattgagag ggctgaaata tagttctcca 1320ttattgggcg ggaacagccg ccacattttg gagcaaacat ttcaaagtaa tcgtcccgac 1380aatagggtcg accatctttc tcatggaacc cctcttcccc aaactgttta ccacactgag 1440cacaaaagaa atgttccgta tgccatgttt tttccaaggc tgtgacacat ttatctaaga 1500tagggccgtt gcagtaggca catcgaggac tgaagaggtt gtggtaatct ggctcacagt 1560aggggtgacc atccctctca aagaagtttc ttgttccaag ctcctggttg cagtgtgtgc 1620agacaaagtg ttctggatgc catgtcttgc ctagtgctgt gattacctgg ccgacaatgg 1680gtttgtcgca agctgaacag cagcctttct gtgtcgttgt gactccttgc ctggacatgt 1740tctcggtgag agagcctagc atacaatcta gggcagcctc tcgcttccta ccgctggatg 1800acggtttggc gtaagttgac tcagcgagag aaggggaagg atgatgtgat gatacaagac 1860aggagatgaa gagggcggac ac 18823001438DNAArtificial SequencePHP49451 Haripin RNA Construct without promoter 300ttcctggagc aggtggtgga attggttcag caagacctgc gggacgtgga gttccagctc 60ctggtacacc agctgcacct ggtctccaag gtccagttcg tggtgtaggt ggcccatctg 120cacaagttat gactccagcg gggcgtggag gacaagtttc tgctcctcct cagatgcgtg 180ctccaccccc aggaatgccc ccaatgatgg gagctccacc aatgatgaac atggcaccag 240gaatggcgat gggaagaggt ggaccacctc ctcaaatggg tgctcctcca gctccaccaa 300tgcgaggtcc cccaccagga atgatgagag gtccccctcc tttttaagaa gaaagaaaat 360tttgttacct tccttctgta attttttttt aagtttgaaa tttacaaagc caatggatgg 420ctaagattaa tttctgactt ttttttggat acataccatt tatttatgta aatgtgctca 480tgtatgtata tatttatcta tgcattttgg aaaaagaata tttgtactaa attatttgat 540aaataattgt agtaattata cttaaacact ctggtccaac tttattatac aaagttgata 600gatatcggtc cgagatccat caggtaagtt tctgcttcta cctttgatat atatataata 660attatcatta attagtagta atataatatt tcaaatattt ttttcaaaat aaaagaatgt 720agtatatagc aattgctttt ctgtagttta taagtgtgta tattttaatt tataactttt 780ctaatatatg accaaaacat ggtgatgtgc aggtccatgg tggagctcga ccgatatcta 840tcaactttgt ataataaagt tggaccagag tgtttaagta taattactac aattatttat 900caaataattt agtacaaata ttctttttcc aaaatgcata gataaatata tacatacatg 960agcacattta cataaataaa tggtatgtat ccaaaaaaaa gtcagaaatt aatcttagcc 1020atccattggc tttgtaaatt tcaaacttaa aaaaaaatta cagaaggaag gtaacaaaat 1080tttctttctt cttaaaaagg agggggacct ctcatcattc ctggtggggg acctcgcatt 1140ggtggagctg gaggagcacc catttgagga ggtggtccac ctcttcccat cgccattcct 1200ggtgccatgt tcatcattgg tggagctccc atcattgggg gcattcctgg gggtggagca 1260cgcatctgag gaggagcaga aacttgtcct ccacgccccg ctggagtcat aacttgtgca 1320gatgggccac ctacaccacg aactggacct tggagaccag gtgcagctgg tgtaccagga 1380gctggaactc cacgtcccgc aggtcttgct gaaccaattc caccacctgc tccaggaa 14383011850DNAArtificial SequencePHP49480 Haripin RNA Construct without promoter 301gaggtttcag tttctgcaca gtccagtgac tttggtttcg atcgggattt atatctctat 60tatggacaat ttgggtcaac aaacacctca tcaaaataat cattcaaatg atacagaaat 120gaacaatttt atggacgtat ccagaatgag taccatgtgg ccttatccac atcctgacag 180gttttcacaa tacagggatt tctttcatga acctcagcaa ggagtagttt ctgggaatga 240aacaacaaat aatgttagcc aagtattaac aaacaattcc acacagcaac attctttagt 300gaatactatg cctgttatgg gaactttaca aacagtatta actcaaggtt tgccaaacca 360aaatgctaat gctaatgttg ttaatttaaa tcatactcca cagaatttac ccagtactat 420tcagacttcc ataaatagcc ttccaaatgc caccaactct accagtcaag gacaagagca 480atctacccag atattaacaa gaatgaggtt gcaagatttg gtgagagaag tagatcctaa 540tgaacaatta gacgaagatg ttgaagatgt attattacaa atggcagatg attttgttga 600ctcagcaatt acagctggtt gtcttcttgc caagcacaga aaatcaacta ctgtagaagt 660taaggatctt cagctacatt tagaaagaaa ttggaatatg tggatacctg gttttggaac 720agatgaattg cgaccttaca aacgtgcatc tgttacagaa gctcataaac aaagacttac 780gccaacttta ttatacaaag ttgatagata tcggtccgag atccatcagg taagtttctg 840cttctacctt tgatatatat ataataatta tcattaatta gtagtaatat aatatttcaa 900atattttttt caaaataaaa gaatgtagta tatagcaatt gcttttctgt agtttataag 960tgtgtatatt ttaatttata acttttctaa tatatgacca aaacatggtg atgtgcaggt 1020ccatggtgga gctcgaccga tatctatcaa ctttgtataa taaagttggc gtaagtcttt 1080gtttatgagc ttctgtaaca gatgcacgtt tgtaaggtcg caattcatct gttccaaaac 1140caggtatcca catattccaa tttctttcta aatgtagctg aagatcctta acttctacag 1200tagttgattt tctgtgcttg gcaagaagac aaccagctgt aattgctgag tcaacaaaat 1260catctgccat ttgtaataat acatcttcaa catcttcgtc taattgttca ttaggatcta 1320cttctctcac caaatcttgc aacctcattc ttgttaatat ctgggtagat tgctcttgtc 1380cttgactggt agagttggtg gcatttggaa ggctatttat ggaagtctga atagtactgg 1440gtaaattctg tggagtatga tttaaattaa caacattagc attagcattt tggtttggca 1500aaccttgagt taatactgtt tgtaaagttc ccataacagg catagtattc actaaagaat 1560gttgctgtgt ggaattgttt gttaatactt ggctaacatt atttgttgtt tcattcccag 1620aaactactcc ttgctgaggt tcatgaaaga aatccctgta ttgtgaaaac ctgtcaggat 1680gtggataagg ccacatggta ctcattctgg atacgtccat aaaattgttc atttctgtat 1740catttgaatg attattttga tgaggtgttt gttgacccaa attgtccata atagagatat 1800aaatcccgat cgaaaccaaa gtcactggac tgtgcagaaa ctgaaacctc 1850302643DNANezara viridula 302cagagtgaaa tcgctccact gagagtgtcg gtctcttgtc gctccgtttg atcgctcgta 60cgtacgcggt attatatacg ggccgagtgt ggcgttggac atggtactta catcgaacat 120ctttaaagga ctttctgttt aagagaggag gagaggagga cacatggcga ccctgcggcc 180gcacttcgtc acccacaacg gccccccaga cctgtccgac gatggcactg acgatgaggg 240gacgccgctc acccacgata tctatggcgg aagtacaagg actgttcagg agacaaaagg 300atgggatgtg ttccgagttc ttcccccaaa aacagattcg ggttcgatgg aaaaccaagc 360atgtcttgaa ttcactgtga gaattttaaa aattatagca tacctggtta cgttcactat 420tgtcctcacc agtggtgtat tggctaagct gtcagttctc ttcatcactt cccaactgcg 480acctgatagg gtggtcagtt attgtaataa ggacttggga agggataagc aattcgtagt 540gaacttacca cccgaagaac gagtggcctg gtcatggtgc ttactatttg cttttgcaat 600tcctgaagtt ggaacattca ttaggtccct gagaatatgt atc 6433031219DNANezara viridula 303aggttatgtg actgtgttac atcgagtttg atattgtttt cattgtgaag tgttgattag 60ttctgtatta cttcgaagtt taaagaatta ttaatatact ttagaaatgt tgaattttgg 120ttataatgct agaagatata tttatgtttt catatttact atgcctctta cttagtactg 180atgttacata ggaaaatgag agttaaaaaa tatttgcctg atgtgtacat ttgtggaaga 240aaatttaatt ctagaaaatg gctgctctgt ttgacccaaa tgacagaagc aggtaagttc 300atgaaattgg tattttggtc aaatgtcaag gcaagatgcc actgatcttt taatgggaga 360aaaggagggt ggcgtatttc ttgtccgtga tagtatctca attcatggtg attatgttct 420ttgtgtaagg gaagatagta aagtaagcca ttatattatc aacaaaattc agcagaatga 480tcaaattaag tacagaattg gtgatcaaac atttaatgat ttgcccagtt agctatcttt 540ctataaattg cactatttag atactacacc tctaattcga ccagcaccaa agagagttga 600aaaagtgata gctaaatttg acttcaatgg aagtgatcaa gatgatttac cgtttaagaa 660aggtgatatt ttaacaatta tttctaaaga tgaagatcag tggtggacag ccaaaaacag 720tgctggttta atgggatcaa taccagttcc ctatattcaa aagtataatg accaagatgt 780actagcagat cttggttctt catttgttga taatagtcct cctagtggaa gtcatgtaga 840acctataaga agatctaatg ttcagaggaa gcttcctgcg tttgcgaaag taaaacaggc 900cagagctcca aatgcttatg acaagacagc tttaaagcta gaaattggtg aaataataaa 960agttacaaaa atgaatttaa atggacagtg ggaaggtgaa cttaagggaa aaactggaca 1020ttttccgttt actcatgttg aattcataga taatgaaatg tgaatgctgc aattttttta 1080acaaatagta caaacataat tcatggctat tgttcattat tggtgctcta atgaaaattt 1140tattaatgca cttctgctat ttataaaaca tattattatt ttttgtaaag cattaaactt 1200atgttattca atttacagc 12193041470DNANezara viridula 304actcaaaatg atagcacttt gtgatttatt ctatatgtca tccaatcttt aatttactgg 60acgattgcta aaataagttt cagaaatatt tgtctgtaat aacattaatt gctcaattat 120agaaataaag ctactaatta gcctataata tctaacatat atctaaaaaa ttagatatat 180gttgaaccct aagtattgta aacatcagca tgttatacaa taaattaata acagaaaaca 240ttcttacttc taaacagaat gaaaatatag agtacttgtg atttagccgg tcgccttcgg 300acctaccttc ttatcttgtg ttatctcttc gtatcgctca tctctgctta gttacttgtg 360cgttcttctt gttattcaat tattttcagt ttttttttgt tttgttattt tttatttaaa 420atggttacaa taacacttta ggaattactg tcttcggaag aagactatat tatatattag 480acaggtcaac taaaaaaatt ggagggtcta aaaaagttgt tgaaatagac ggaagtcttt 540tttctaaacg aaaaaatcat gtagggagag tgctctcgga ataatggatg tttggcagag 600tttgtcgaga aacagatgag tgtttcattg taaaaataaa agaaacgcaa caattctatt 660tactaattga taatatctct cttctatatt atcttctaaa aataatatag aagaaagaaa 720cactatatat tctgactgtt ggagaggata taaaacctaa gaactaaata aagcgaacta 780aaaccatttc caggtgaatc actggtatag ctttgtcgat ccacactcaa cacatagaac 840tattatgggg ctcagctaag tggaggaata aaatatatcg aggaactgcg atgctactcc 900gggattcata tatttagcta ctgcagtaca caaaatcata tttatgtgaa tttttgtggc 960gatgggtgca cagagaagag acgtgttcct cgctatttta actagcatta agctattttg 1020tcttccaaaa tgaataaaat gttgtaaaat aaaagagttt tgttattatt acatttctgt 1080ttgtttattt caatttccat aattataaat aaggaggtag gtgttatcag tgttcagatt 1140ataaataatg atggatagca gtacgtggtg accagttaac tcacaagtgc caaatatagc 1200actggtttaa ctgtttgtga tctgaggtag aagaattaat aagaagtcta catattctcc 1260caccataagt taatataatc acctagtgtg tatcttcaat tagaacttca gaaggaagat 1320ccagcaataa tgagatgagc ataattttag ttgaaatgga agaaataggc gaagcctatc 1380aaaaatcaaa ctttattttc taatgatgta gatatgggca gataatttgt ttagggaaga 1440ggttcatgga tcaattacgt aatttgtatg 147030521DNANezara viridula 305taagtaccat gtccaacgcc a 2130621DNANezara viridula 306tattacaata actgaccacc c 2130721DNANezara viridula 307tcctactaca tatttccacc c 2130821DNANezara viridula 308tattccttct atcttctccc a 2130921DNANezara viridula 309taaagtatat taataattct t 2131021DNANezara viridula 310ttactatctt cccttacaca a 2131121DNANezara viridula 311tacgaagaga taacacaaga t 2131221DNANezara viridula 312taacaaaaca aaaaaaaact g 2131321DNANezara viridula 313tggcgttgga ctaggtactt t 2131421DNANezara viridula 314gggtggtcag tatttgtaat t 2131521DNANezara viridula 315gggtggaaat aattagtagg t 2131621DNANezara viridula 316tgggagaaga tcaaaggaat t 2131721DNANezara viridula 317aagaattatt ataatacttt t 2131821DNANezara viridula 318ttgtgtaagg gttgatagta t 2131921DNANezara viridula 319atcttgtgtt aaatcttcgt t 2132021DNANezara viridula 320cagttttttt tgcttttgtt t 21321976DNAArtificial SequenceamiRNA precursor sequence #1 for inv1c.pk005.h23.f 321ctaggtaaac catggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa 60agtttttggt taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta 120aaggggatta tgaagtggcg ttggactagg tacttttgag gatcttactg ggtgaattga 180gctgcttagc tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg 240tggcttccat atctggggag cttcatttgc ctttatagta ttaaccttct aagtaccatg 300tccaacgcca cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct 360aaactttaaa tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct 420tgctgtggag taaccttgtc

cgaggtatgt gcatgattag atccatactt aatttgtgtg 480catcacgaag gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt 540gttgcagtaa tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg 600ttagttttat tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt 660tatacagatc tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc 720tacatattta ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct 780aataaaagga gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta 840aagatgacat attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg 900taatgtcttg tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt 960tataaacaaa tctgtt 976322977DNAArtificial SequenceamiRNA precursor sequence #2 for inv1c.pk005.h23.f 322ctaggtaaac catggattct agctagctag ggtttgggta gtgagtgtaa taaagttgca 60aagtttttgg ttaggttacg ttttgacctt attattatag ttcaaaggga aacattaatt 120aaaggggatt atgaaggggt ggtcagtatt tgtaatttga ggatcttact gggtgaattg 180agctgcttag ctatggatcc cacagttcta cccatcaata agtgcttttg tggtagtctt 240gtggcttcca tatctgggga gcttcatttg cctttatagt attaaccttc tattacaata 300actgaccacc ccacccttct cttcttttct ctcataataa tttaaatttg ttatagactc 360taaactttaa atgttttttt tgaagttttt ccgtttttct cttttgccat gatcccgttc 420ttgctgtgga gtaaccttgt ccgaggtatg tgcatgatta gatccatact taatttgtgt 480gcatcacgaa ggtgaggttg aaatgaactt tgcttttttg accttttagg aaagttcttt 540tgttgcagta atcaatttta attagtttta attgacacta ttacttttat tgtcatcttt 600gttagtttta ttgttgaatt gagtgcatat ttcgtaggaa attctcttac ctaacatttt 660ttatacagat ctatgctctt ggctcttgcc cttactcttg gccttgtgtt ggttatttgt 720ctacatattt attgactggt cgatgagaca tgtcacaatt cttgggctta tttgttggtc 780taataaaagg agtgcttatt gaaagatcaa gacggagatt cggttttata taaataaact 840aaagatgaca tattagtgtg ttgatgtctc ttcaggataa tttttgtttg aaataatatg 900gtaatgtctt gtctaaattt gtgtacataa ttcttactga ttttttggat tgttggattt 960ttataaacaa atctgtt 977323966DNAArtificial SequenceamiRNA precursor sequence #1 for inv1c.pk004.e6.ffis 323ctaggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa agtttttggt 60taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta aaggggatta 120tgaaggggtg gaaataatta gtaggttgag gatcttactg ggtgaattga gctgcttagc 180tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg tggcttccat 240atctggggag cttcatttgc ctttatagta ttaaccttct cctactacat atttccaccc 300cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct aaactttaaa 360tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct tgctgtggag 420taaccttgtc cgaggtatgt gcatgattag atccatactt aatttgtgtg catcacgaag 480gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt gttgcagtaa 540tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg ttagttttat 600tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt tatacagatc 660tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc tacatattta 720ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct aataaaagga 780gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta aagatgacat 840attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg taatgtcttg 900tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt tataaacaaa 960tctgtt 966324966DNAArtificial SequenceamiRNA precursor sequence #2 for inv1c.pk004.e6.ffis 324ctaggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa agtttttggt 60taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta aaggggatta 120tgaagtggga gaagatcaaa ggaatttgag gatcttactg ggtgaattga gctgcttagc 180tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg tggcttccat 240atctggggag cttcatttgc ctttatagta ttaaccttct attccttcta tcttctccca 300cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct aaactttaaa 360tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct tgctgtggag 420taaccttgtc cgaggtatgt gcatgattag atccatactt aatttgtgtg catcacgaag 480gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt gttgcagtaa 540tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg ttagttttat 600tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt tatacagatc 660tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc tacatattta 720ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct aataaaagga 780gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta aagatgacat 840attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg taatgtcttg 900tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt tataaacaaa 960tctgtt 966325966DNAArtificial SequenceamiRNA precursor sequence #1 for inv1c.pk004.e11.ffis 325ctaggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa agtttttggt 60taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta aaggggatta 120tgaagaagaa ttattataat actttttgag gatcttactg ggtgaattga gctgcttagc 180tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg tggcttccat 240atctggggag cttcatttgc ctttatagta ttaaccttct aaagtatatt aataattctt 300cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct aaactttaaa 360tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct tgctgtggag 420taaccttgtc cgaggtatgt gcatgattag atccatactt aatttgtgtg catcacgaag 480gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt gttgcagtaa 540tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg ttagttttat 600tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt tatacagatc 660tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc tacatattta 720ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct aataaaagga 780gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta aagatgacat 840attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg taatgtcttg 900tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt tataaacaaa 960tctgtt 966326966DNAArtificial SequenceamiRNA precursor sequence #2 for inv1c.pk004.e11.ffis 326ctaggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa agtttttggt 60taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta aaggggatta 120tgaagttgtg taagggttga tagtattgag gatcttactg ggtgaattga gctgcttagc 180tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg tggcttccat 240atctggggag cttcatttgc ctttatagta ttaaccttct tactatcttc ccttacacaa 300cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct aaactttaaa 360tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct tgctgtggag 420taaccttgtc cgaggtatgt gcatgattag atccatactt aatttgtgtg catcacgaag 480gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt gttgcagtaa 540tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg ttagttttat 600tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt tatacagatc 660tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc tacatattta 720ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct aataaaagga 780gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta aagatgacat 840attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg taatgtcttg 900tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt tataaacaaa 960tctgtt 966327966DNAArtificial SequenceamiRNA precursor sequence #1 for inv1c.pk004.d17.ffis 327ctaggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa agtttttggt 60taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta aaggggatta 120tgaagatctt gtgttaaatc ttcgtttgag gatcttactg ggtgaattga gctgcttagc 180tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg tggcttccat 240atctggggag cttcatttgc ctttatagta ttaaccttct acgaagagat aacacaagat 300cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct aaactttaaa 360tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct tgctgtggag 420taaccttgtc cgaggtatgt gcatgattag atccatactt aatttgtgtg catcacgaag 480gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt gttgcagtaa 540tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg ttagttttat 600tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt tatacagatc 660tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc tacatattta 720ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct aataaaagga 780gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta aagatgacat 840attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg taatgtcttg 900tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt tataaacaaa 960tctgtt 966328966DNAArtificial SequenceamiRNA precursor sequence #2 for inv1c.pk004.d17.ffis 328ctaggttcta gctagctagg gtttgggtag tgagtgtaat aaagttgcaa agtttttggt 60taggttacgt tttgacctta ttattatagt tcaaagggaa acattaatta aaggggatta 120tgaagcagtt ttttttgctt ttgttttgag gatcttactg ggtgaattga gctgcttagc 180tatggatccc acagttctac ccatcaataa gtgcttttgt ggtagtcttg tggcttccat 240atctggggag cttcatttgc ctttatagta ttaaccttct aacaaaacaa aaaaaaactg 300cacccttctc ttcttttctc tcataataat ttaaatttgt tatagactct aaactttaaa 360tgtttttttt gaagtttttc cgtttttctc ttttgccatg atcccgttct tgctgtggag 420taaccttgtc cgaggtatgt gcatgattag atccatactt aatttgtgtg catcacgaag 480gtgaggttga aatgaacttt gcttttttga ccttttagga aagttctttt gttgcagtaa 540tcaattttaa ttagttttaa ttgacactat tacttttatt gtcatctttg ttagttttat 600tgttgaattg agtgcatatt tcgtaggaaa ttctcttacc taacattttt tatacagatc 660tatgctcttg gctcttgccc ttactcttgg ccttgtgttg gttatttgtc tacatattta 720ttgactggtc gatgagacat gtcacaattc ttgggcttat ttgttggtct aataaaagga 780gtgcttattg aaagatcaag acggagattc ggttttatat aaataaacta aagatgacat 840attagtgtgt tgatgtctct tcaggataat ttttgtttga aataatatgg taatgtcttg 900tctaaatttg tgtacataat tcttactgat tttttggatt gttggatttt tataaacaaa 960tctgtt 9663293236DNAArtificial SequencePHP44230 amiRNA precursor expression construct 329ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt aaaccatggt tctagctagc 1980tagggtttgg gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac 2040cttattatta tagttcaaag ggaaacatta attaaagggg attatgaagt ggcgttggac 2100taggtacttt tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt 2160ctacccatca ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat 2220ttgcctttat agtattaacc ttctaagtac catgtccaac gccacaccct tctcttcttt 2280tctctcataa taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt 2340tttccgtttt tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt 2400atgtgcatga ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa 2460ctttgctttt ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt 2520ttaattgaca ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca 2580tatttcgtag gaaattctct tacctaacat tttttataca gatctatgct cttggctctt 2640gcccttactc ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag 2700acatgtcaca attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat 2760caagacggag attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt 2820ctcttcagga taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca 2880taattcttac tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc 2940ttctcccggg taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg 3000gcaataaagt ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt 3060tctgttgaat tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag 3120atgggttttt atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat 3180atagcgcgca aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 32363303237DNAArtificial SequencePHP44231 amiRNA precursor expression construct 330ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt aaaccatgga ttctagctag 1980ctagggtttg ggtagtgagt gtaataaagt tgcaaagttt ttggttaggt tacgttttga 2040ccttattatt atagttcaaa gggaaacatt aattaaaggg gattatgaag gggtggtcag 2100tatttgtaat ttgaggatct tactgggtga attgagctgc ttagctatgg atcccacagt 2160tctacccatc aataagtgct tttgtggtag tcttgtggct tccatatctg gggagcttca 2220tttgccttta tagtattaac cttctattac aataactgac caccccaccc ttctcttctt 2280ttctctcata ataatttaaa tttgttatag actctaaact ttaaatgttt tttttgaagt 2340ttttccgttt ttctcttttg ccatgatccc gttcttgctg tggagtaacc ttgtccgagg 2400tatgtgcatg attagatcca tacttaattt gtgtgcatca cgaaggtgag gttgaaatga 2460actttgcttt tttgaccttt taggaaagtt cttttgttgc agtaatcaat tttaattagt 2520tttaattgac actattactt ttattgtcat ctttgttagt tttattgttg aattgagtgc 2580atatttcgta ggaaattctc ttacctaaca ttttttatac agatctatgc tcttggctct 2640tgcccttact cttggccttg tgttggttat ttgtctacat atttattgac tggtcgatga 2700gacatgtcac aattcttggg cttatttgtt ggtctaataa aaggagtgct tattgaaaga 2760tcaagacgga gattcggttt tatataaata aactaaagat gacatattag tgtgttgatg 2820tctcttcagg ataatttttg tttgaaataa tatggtaatg tcttgtctaa atttgtgtac 2880ataattctta ctgatttttt ggattgttgg atttttataa acaaatctgt taacagatct 2940cttctcccgg gtaactgtac ctaaagaagg agtgcgtcga agcagatcgt tcaaacattt 3000ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 3060ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 3120gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 3180tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatc 32373313226DNAArtificial SequencePHP44770 amiRNA precursor expression construct 331ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca

ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt tctagctagc tagggtttgg 1980gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac cttattatta 2040tagttcaaag ggaaacatta attaaagggg attatgaagg ggtggaaata attagtaggt 2100tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt ctacccatca 2160ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat ttgcctttat 2220agtattaacc ttctcctact acatatttcc accccaccct tctcttcttt tctctcataa 2280taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt tttccgtttt 2340tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt atgtgcatga 2400ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa ctttgctttt 2460ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt ttaattgaca 2520ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca tatttcgtag 2580gaaattctct tacctaacat tttttataca gatctatgct cttggctctt gcccttactc 2640ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag acatgtcaca 2700attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat caagacggag 2760attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt ctcttcagga 2820taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca taattcttac 2880tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc ttctcccggg 2940taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg gcaataaagt 3000ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 3060tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 3120atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3180aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 32263323226DNAArtificial SequencePHP44771 amiRNA precursor expression construct 332ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt tctagctagc tagggtttgg 1980gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac cttattatta 2040tagttcaaag ggaaacatta attaaagggg attatgaagt gggagaagat caaaggaatt 2100tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt ctacccatca 2160ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat ttgcctttat 2220agtattaacc ttctattcct tctatcttct cccacaccct tctcttcttt tctctcataa 2280taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt tttccgtttt 2340tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt atgtgcatga 2400ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa ctttgctttt 2460ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt ttaattgaca 2520ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca tatttcgtag 2580gaaattctct tacctaacat tttttataca gatctatgct cttggctctt gcccttactc 2640ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag acatgtcaca 2700attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat caagacggag 2760attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt ctcttcagga 2820taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca taattcttac 2880tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc ttctcccggg 2940taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg gcaataaagt 3000ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 3060tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 3120atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3180aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 32263333226DNAArtificial SequencePHP44772 amiRNA precursor expression construct 333ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt tctagctagc tagggtttgg 1980gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac cttattatta 2040tagttcaaag ggaaacatta attaaagggg attatgaaga agaattatta taatactttt 2100tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt ctacccatca 2160ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat ttgcctttat 2220agtattaacc ttctaaagta tattaataat tcttcaccct tctcttcttt tctctcataa 2280taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt tttccgtttt 2340tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt atgtgcatga 2400ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa ctttgctttt 2460ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt ttaattgaca 2520ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca tatttcgtag 2580gaaattctct tacctaacat tttttataca gatctatgct cttggctctt gcccttactc 2640ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag acatgtcaca 2700attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat caagacggag 2760attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt ctcttcagga 2820taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca taattcttac 2880tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc ttctcccggg 2940taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg gcaataaagt 3000ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 3060tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 3120atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3180aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 32263343226DNAArtificial SequencePHP44773 amiRNA precursor expression construct 334ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt tctagctagc tagggtttgg 1980gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac cttattatta 2040tagttcaaag ggaaacatta attaaagggg attatgaagt tgtgtaaggg ttgatagtat 2100tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt ctacccatca 2160ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat ttgcctttat 2220agtattaacc ttcttactat cttcccttac acaacaccct tctcttcttt tctctcataa 2280taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt tttccgtttt 2340tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt atgtgcatga 2400ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa ctttgctttt 2460ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt ttaattgaca 2520ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca tatttcgtag 2580gaaattctct tacctaacat tttttataca gatctatgct cttggctctt gcccttactc 2640ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag acatgtcaca 2700attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat caagacggag 2760attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt ctcttcagga 2820taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca taattcttac 2880tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc ttctcccggg 2940taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg gcaataaagt 3000ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 3060tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 3120atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3180aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 32263353226DNAArtificial SequencePHP44789 amiRNA precursor expression construct 335ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt

cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt tctagctagc tagggtttgg 1980gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac cttattatta 2040tagttcaaag ggaaacatta attaaagggg attatgaaga tcttgtgtta aatcttcgtt 2100tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt ctacccatca 2160ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat ttgcctttat 2220agtattaacc ttctacgaag agataacaca agatcaccct tctcttcttt tctctcataa 2280taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt tttccgtttt 2340tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt atgtgcatga 2400ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa ctttgctttt 2460ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt ttaattgaca 2520ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca tatttcgtag 2580gaaattctct tacctaacat tttttataca gatctatgct cttggctctt gcccttactc 2640ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag acatgtcaca 2700attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat caagacggag 2760attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt ctcttcagga 2820taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca taattcttac 2880tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc ttctcccggg 2940taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg gcaataaagt 3000ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 3060tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 3120atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3180aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 32263363226DNAArtificial SequencePHP44790 amiRNA precursor expression construct 336ccgggtgatt gcggttacat catgtacgga aaaataattc taatccttga tttaaatttg 60aacttgacta tttatttatt ctttatttca ttttgtaaat cattttatgt atctcctggc 120aagcaatttt atccaccttg caccaacacc ttcgggttcc ataatcaaac caccttaact 180tcacaccatg ctgtaactca caccgcccag catctccaat gtgaaagaag ctaaaattta 240ataaacaatc atacgaagca gtgacaaaat accagatggt attaatgctt cgataaaatt 300aattggaaag tataaaatgg tagaaaataa taaattataa ttaatttaag taagataaaa 360aataattaaa aactaaaatg ttaaaatttt aaaaaaatta ttttaaataa tatttaaaaa 420cattaaaaat cattttaaaa aatttattta tagaacaatt aaataaatat ttcagctaat 480aaaaaacaaa agcttaccta gccttagaag acaacttgtc caacaattag atgataccca 540ttgcccttac gttttcttta acatcaatta ttgtttttgt caacaagcta tcttttagtt 600ttattttatt ggtaaaaaat atgtcgcctt caagttgcat catttaacac atctcgtcat 660tagaaaaata aaactcttcc ctaaacgatt agtagaaaaa atcattcgat aataaataag 720aaagaaaaat tagaaaaaaa taacttcatt ttaaaaaaat cattaaggct atatttttta 780aatgactaat tttatataga ctgtaactaa aagtatacaa tttattatgc tatgtatctt 840aaagaattac ttataaaaat ctacggaaga atatcttaca aagtgaaaaa caaatgagaa 900agaatttagt gggatgatta tgattttatt tgaaaattga aaaaataatt attaaagact 960ttagtggagt aagaaagctt tcctattagt cttttcttat ccataaaaaa aaaaaaaaaa 1020atctagcgtg acagcttttc catagatttt aataatgtaa aatactggta gcagccgacc 1080gttcaggtaa tggacactgt ggtcctaact tgcaacgggt gcgggcccaa tttaataacg 1140ccgtggtaac ggataaagcc aagcgtgaag cggtgaaggt acatctctga ctccgtcaag 1200attacgaaac cgtcaactac gaaggactcc ccgaaatatc atctgtgtca taaacaccaa 1260gtcacaccat acatgggcac gcgtcacaat atgattggag aacggttcca ccgcatatgc 1320tataaaatgc ccccacaccc ctcgacccta atcgcacttc aattgcaatc aaattagttc 1380attctctttg cgcagttccc tacctctcct ttcaaggttc gtagatttct tccgtttttt 1440tttcttcttc tttattgttt gttctacatc agcatgatgt tgatttgatt gtgttttcta 1500tcgtttcatc gattataaat tttcataatc agaagattca gcttttatta atgcaagaac 1560gtccttaatt gatgatttta taaccgtaaa ttaggtctaa ttagagtttt tttcataaag 1620attttcagat ccgtttacaa caagccttaa ttgttgattc tgtagtcgta gattaaggtt 1680tttttcatga actacttcag atccgttaaa caacagcctt atttgttgat acttcagtcg 1740tttttcaaga aattgttcag atccgttgat aaaagcctta ttcgttgatt ctgtatggta 1800tttcaagaga tattgctcag gtcctttagc aactacctta tttgttgatt ctgtggccat 1860agattaggat tttttttcac gaaattgctt cttgaaatta cgtgatggat tttgattctg 1920atttatcttg tgattgttga ctctacagca gatcctaggt tctagctagc tagggtttgg 1980gtagtgagtg taataaagtt gcaaagtttt tggttaggtt acgttttgac cttattatta 2040tagttcaaag ggaaacatta attaaagggg attatgaagc agtttttttt gcttttgttt 2100tgaggatctt actgggtgaa ttgagctgct tagctatgga tcccacagtt ctacccatca 2160ataagtgctt ttgtggtagt cttgtggctt ccatatctgg ggagcttcat ttgcctttat 2220agtattaacc ttctaacaaa acaaaaaaaa actgcaccct tctcttcttt tctctcataa 2280taatttaaat ttgttataga ctctaaactt taaatgtttt ttttgaagtt tttccgtttt 2340tctcttttgc catgatcccg ttcttgctgt ggagtaacct tgtccgaggt atgtgcatga 2400ttagatccat acttaatttg tgtgcatcac gaaggtgagg ttgaaatgaa ctttgctttt 2460ttgacctttt aggaaagttc ttttgttgca gtaatcaatt ttaattagtt ttaattgaca 2520ctattacttt tattgtcatc tttgttagtt ttattgttga attgagtgca tatttcgtag 2580gaaattctct tacctaacat tttttataca gatctatgct cttggctctt gcccttactc 2640ttggccttgt gttggttatt tgtctacata tttattgact ggtcgatgag acatgtcaca 2700attcttgggc ttatttgttg gtctaataaa aggagtgctt attgaaagat caagacggag 2760attcggtttt atataaataa actaaagatg acatattagt gtgttgatgt ctcttcagga 2820taatttttgt ttgaaataat atggtaatgt cttgtctaaa tttgtgtaca taattcttac 2880tgattttttg gattgttgga tttttataaa caaatctgtt aacagatctc ttctcccggg 2940taactgtacc taaagaagga gtgcgtcgaa gcagatcgtt caaacatttg gcaataaagt 3000ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 3060tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 3120atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3180aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 322633721DNANezara viridula 337tggcgttgga catggtactt a 2133821DNANezara viridula 338gggtggtcag ttattgtaat a 2133921DNANezara viridula 339gggtggaaat atgtagtagg a 2134021DNANezara viridula 340tgggagaaga tagaaggaat a 2134121DNANezara viridula 341aagaattatt aatatacttt a 2134221DNANezara viridula 342ttgtgtaagg gaagatagta a 2134321DNANezara viridula 343atcttgtgtt atctcttcgt a 2134421DNANezara viridula 344cagttttttt ttgttttgtt a 2134521DNAArtificial SequenceattB34 primer 345caactttgta tagaaaagtt g 2134621DNAArtificial SequenceattB3 primer 346caactttgta taataaagtt g 21

Claims

1. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence comprising any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof; (b) the nucleotide sequence comprising at least 90% sequence identity to any one of SEQ ID NOS279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof, wherein said polynucleotide encodes a silencing element having insecticidal activity against a Pentatomidae plant pest; (c) the nucleotide sequence comprising at least 19 consecutive nucleotides of any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof, wherein said polynucleotide encodes a silencing element having insecticidal activity against a Pentatomidae plant pest; and, (d) the nucleotide sequence that hybridizes under stringent conditions to the full length complement of the nucleotide sequence of a), wherein said stringent conditions comprise hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times. SSC at 60.degree. C. to 65.degree. C., wherein said polynucleotide encodes a silencing element having insecticidal activity against a Pentatomidae plant pest.

2. The isolated polynucleotide of claim 1, wherein said Pentatomidae plant pest is a N. viridula plant pest.

3. An expression cassette comprising a heterologous polynucleotide of claim 1 operably linked to a seed-preferred promoter.

4. The expression cassette of claim 3, wherein said polynucleotide is expressed as a double stranded RNA.

5. The expression cassette of claim 3, wherein said polynucleotide comprise a silencing element which is expressed as a hairpin RNA.

6. The expression cassette of claim 5, wherein the silencing element comprises, in the following order, a first segment, a second segment, and a third segment, wherein a) said first segment comprises at least about 19 nucleotides having at least 90% sequence complementarity to a target sequence set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263; b) said second segment comprises a loop of sufficient length to allow the silencing element to be transcribed as a hairpin RNA; and, c) said third segment comprises at least about 19 nucleotides having at least 85% complementarity to the first segment.

7. The expression cassette of claim 6, wherein said target sequence comprises the sequences set forth any one of SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 337, 338, 339, 340, 341, 342, 343 or 344 or a sequence having at least 90% sequence identity to SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 337, 338, 339, 340, 341, 342, 343 or 344.

8. The expression cassette of claim 6, wherein said expression cassette comprises any one of SEQ ID NOS: 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328.

9. The expression cassette of claim 3, wherein said polynucleotide is flanked by a first operably linked convergent promoter at one terminus of the polynucleotide and a second operably linked convergent promoter at the opposing terminus of the polynucleotide, wherein the first and the second convergent promoters are capable of driving expression of the polynucleotide.

10. A host cell comprising the heterologous expression cassette of claim 3.

11. A plant cell having stably incorporated into its genome a heterologous polynucleotide comprising a silencing element operably linked to a seed-preferred promoter, wherein said silencing element, when ingested by a Pentatomidae plant pest, reduces the level of expression of any one of the target sequences set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 in said Pentatomidae plant pest and thereby controls the Pentatomidae plant pest.

12. The plant cell of claim 11, wherein said silencing element comprises a) a fragment of at least 19 consecutive nucleotides of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof; or, b) the nucleotide sequence comprising at least 90% sequence identity to any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof, wherein said silencing element, when ingested by a Pentatomidae plant pest, reduces the level of a target sequence in said Pentatomidae plant pest and thereby controls the Pentatomidae plant pest.

13. The plant cell of claim 12, wherein the Pentatomidae plant pest is a N. viridula plant pest.

14. The plant cell of claim 12, wherein said silencing element comprises the sequences set forth in any one of SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 305, 306, 307, 308, 309, 310, 311, 312, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343 or 344 or a complement thereof.

15. The plant cell of claim 11, wherein said plant cell comprises the expression cassette of claim 9.

16. The plant cell of claim 11, wherein said silencing element expresses a double stranded RNA.

17. The plant cell of claim 11, wherein said silencing element expresses a hairpin RNA.

18. The plant cell of claim 17, wherein said polynucleotide comprising the silencing element comprises, in the following order, a first segment, a second segment, and a third segment, wherein a) said first segment comprises at least about 19 nucleotides having at least 90% sequence complementarity to a target sequence set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328; b) said second segment comprises a loop of sufficient length to allow the silencing element to be transcribed as a hairpin RNA; and, c) said third segment comprises at least about 19 nucleotides having at least 85% complementarity to the first segment.

19. The plant cell of claim 11, wherein said plant cell is from a monocot.

20. The plant cell of claim 19, wherein said monocot is maize, barley, millet, wheat or rice.

21. The plant cell of claim 11, wherein said plant cell is from a dicot.

22. The plant cell of claim 21, wherein said plant is soybean, canola, alfalfa, sunflower, safflower, tobacco, Arabidopsis, or cotton.

23. A plant or plant part comprising a plant cell of claim 11.

24. A transgenic seed from the plant of claim 23, wherein said transgenic seed comprises said heterologous polynucleotide comprising said silencing element.

25. A method of controlling a Pentatomidae plant pest comprising feeding to a Pentatomidae plant pest a composition comprising a silencing element, wherein said silencing element, when ingested by said Pentatomidae plant pest, reduces the level of expression of any one of the target Pentatomidae plant pest sequences set forth in SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 and thereby controls the Pentatomidae plant pest.

26. The method of claim 25, wherein said silencing element comprises a) a fragment of at least 19 consecutive nucleotides of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof; or, b) the nucleotide sequence comprising at least 90% sequence identity to any one of SEQ ID NOS: 279, 302, 281, 304, 280, 283, 282, 303, 278, 284, 285, 286, 287, 288, 289, 290, 291, 292, 14, 18, 263, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 296, 297, 298, 299, 300, 301, 321, 322, 323, 324, 325, 326, 327 or 328 or a complement thereof, wherein said silencing element, when ingested by a Pentatomidae plant pest, reduces the level of a target sequence in said Pentatomidae plant pest and thereby controls the Pentatomidae plant pest.

27. The method of claim 26, wherein said Pentatomidae plant pest comprises a N. viridula plant pest.

28. The method of claim 26, wherein said silencing element comprises the sequence set forth in any one of SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 305, 306, 307, 308, 309, 310, 311, 312, 17, 30, 34, 337, 338, 339, 340, 341, 342, 343 or 344 or a complement thereof.

29. The method of claim 25, wherein said composition comprises a plant or plant part having stably incorporated into its genome a polynucleotide comprising said silencing element, wherein said silencing element is operably linked to a seed-preferred promoter.

30. The method of claim 25, wherein said silencing element comprises a) a polynucleotide comprising the sense or antisense sequence of the sequence set forth in SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18, 263, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311 or 312 or a complement thereof; or, b) a polynucleotide comprising the sense or antisense sequence of a sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NOS: 284, 285, 286, 287, 288, 289, 290, 291, 292, 17, 30, 34, 14, 18, 263, 337, 338, 339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, 310, 311 or 312 ora complement thereof.

31. The method of claim 25, wherein said silencing element expresses a double stranded RNA.

32. The method of claim 25, wherein said silencing element comprises a hairpin RNA.

33. The method of claim 32, wherein said polynucleotide comprising the silencing element comprises, in the following order, a first segment, a second segment, and a third segment, wherein a) said first segment comprises at least about 20 nucleotides having at least 90% sequence complementarity to the target polynucleotide; b) said second segment comprises a loop of sufficient length to allow the silencing element to be transcribed as a hairpin RNA; and, c) said third segment comprises at least about 20 nucleotides having at least 85% complementarity to the first segment.

34. The method of claim 29, wherein said silencing element is flanked by a first operably linked convergent promoter at one terminus of the silencing element and a second operably linked convergent promoter at the opposing terminus of the polynucleotide, wherein the first and the second convergent promoters are capable of driving expression of the silencing element.

35. The method of claim 29, wherein said plant is a monocot.

36. The method of claim 35, wherein said monocot is maize, barley, millet, wheat or rice.

37. The method of claim 29, wherein said plant is a dicot.

38. The method of claim 37, wherein said plant is soybean, canola, alfalfa, sunflower, safflower, tobacco, Arabidopsis, or cotton.