U.S. patent application number 15/786281 was filed with the patent office on 2018-02-01 for antibodies, variable domains & chains tailored for human use.
The applicant listed for this patent is Kymab Limited. Invention is credited to Allan BRADLEY, Nicholas ENGLAND, Glenn FRIEDRICH, E-Chiang LEE, Mark STRIVENS.
Application Number | 20180030121 15/786281 |
Document ID | / |
Family ID | 46889370 |
Filed Date | 2018-02-01 |
United States Patent
Application |
20180030121 |
Kind Code |
A1 |
BRADLEY; Allan ; et
al. |
February 1, 2018 |
ANTIBODIES, VARIABLE DOMAINS & CHAINS TAILORED FOR HUMAN
USE
Abstract
The invention relates to the provision of antibody therapeutics
and prophylactics that are tailored specifically for human use. The
present invention provides libraries, vertebrates and cells, such
as transgenic mice or rats or transgenic mouse or rat cells.
Furthermore, the invention relates to methods of using the
vertebrates to isolate antibodies or nucleotide sequences encoding
antibodies. Antibodies, heavy chains, polypeptides, nucleotide
sequences, pharmaceutical compositions and uses are also provided
by the invention.
Inventors: |
BRADLEY; Allan; (Cambridge,
GB) ; FRIEDRICH; Glenn; (Cambridge, GB) ; LEE;
E-Chiang; (Cambridge, GB) ; STRIVENS; Mark;
(Cambridge, GB) ; ENGLAND; Nicholas; (Cambridge,
GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kymab Limited |
Cambridge |
|
GB |
|
|
Family ID: |
46889370 |
Appl. No.: |
15/786281 |
Filed: |
October 17, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14052259 |
Oct 11, 2013 |
|
|
|
15786281 |
|
|
|
|
PCT/GB2012/052296 |
Sep 18, 2012 |
|
|
|
14052259 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 31/22 20180101;
C07K 16/085 20130101; C07K 16/1217 20130101; C07K 16/46 20130101;
C07K 2317/56 20130101; A61P 31/04 20180101; A61P 31/18 20180101;
A61P 31/16 20180101; C07K 2317/24 20130101; C12N 2800/204 20130101;
A01K 2227/105 20130101; A61P 33/06 20180101; C07K 16/462 20130101;
A01K 2267/01 20130101; A61P 31/00 20180101; C07K 16/18 20130101;
C07K 16/1045 20130101; A01K 67/0278 20130101; A01K 2217/15
20130101; A61P 31/12 20180101; A01K 2217/072 20130101; C07K 16/1018
20130101; C07K 16/1232 20130101; C12N 15/8509 20130101; C07K 16/088
20130101; C07K 16/1242 20130101 |
International
Class: |
C07K 16/12 20060101
C07K016/12; C07K 16/10 20060101 C07K016/10; C07K 16/18 20060101
C07K016/18; C12N 15/85 20060101 C12N015/85; C07K 16/46 20060101
C07K016/46; A01K 67/027 20060101 A01K067/027; C07K 16/08 20060101
C07K016/08 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 19, 2011 |
GB |
1116120.5 |
Sep 19, 2011 |
GB |
1116122.1 |
Feb 24, 2012 |
GB |
1203257.9 |
Mar 15, 2012 |
GB |
1204592.8 |
Mar 29, 2012 |
GB |
1205702.2 |
May 18, 2012 |
GB |
1208749.0 |
Jul 2, 2012 |
GB |
1211692.7 |
Claims
1. A method for producing a heavy chain, VH domain or an antibody
specific to a target antigen, wherein the heavy chain, VH domain or
antibody comprises an HCDR3 at least 20 amino acids in length, the
method comprising providing a non-human vertebrate, optionally a
mouse or a rat, that has a genome comprising an immunoglobulin
heavy chain locus comprising unrearranged human gene segment
JH6*02, one or more VH gene segments and one or more D gene
segments upstream of a constant region; wherein the gene segments
in the heavy chain locus are operably linked to the constant region
thereof so that the vertebrate is capable of producing an antibody
heavy chain produced by recombination of the human JH6*02 with a
human D segment and a human VH segment, wherein the JH6*02 gene
segment comprises the following nucleotide sequence: ATTACTA
CTACTACTAC GGTATGGACG TCTGGGGCCA AGGGACCACG GTCACCGTCT CCTCAG, and
wherein the vertebrate has been immunised with the target antigen
and produces an antibody heavy chain specific for the target
antigen wherein the variable domain of the heavy chain is the
product of recombination between a human VH, D and JH6*02 and
wherein the HCDR3 length is at least 20 amino acids, and isolating
from the non-human vertebrate the heavy chain, VH domain or an
antibody specific to the target antigen or a cell producing the
heavy chain, VH domain or antibody, wherein the heavy chain, VH
domain or antibody comprises a HCDR3 that is derived from the
recombination of human JH6*02 with a human VH gene segment and a
human D gene segment, optionally wherein the constant region of the
locus is a non-human vertebrate (e.g., mouse or rat) constant
region, and the non-human constant region of the isolated heavy
chain or antibody is replaced with a human constant region.
2. The method of claim 1 comprising isolating a heavy chain, VH
domain or an antibody, wherein the HCDR3 length is at least 20
amino acids.
3. The method of claim 1, comprising isolating a B-cell or
hybridoma expressing a heavy chain VH domain that is identical to
the VH domain of the heavy chain of claim 2.
4. The method of claim 1, wherein the constant region is mouse or
rat.
5. The method of claim 1, comprising removing B lymphocytes from
the vertebrate and selecting one or more B lymphocytes expressing
antibodies that bind to the antigen, optionally immortalising said
selected B lymphocytes or progeny thereof, optionally by producing
hybridomas therefrom, and isolating an antibody expressed by the B
lymphocytes.
6. The method of claim 5, further comprising isolating from said B
lymphocytes nucleic acid encoding said antibody.
7. The method of any claim 1, wherein the constant region of the
locus is a non-human vertebrate (e.g., mouse or rat) constant
region, and the method further comprises replacing the non-human
constant region of the isolated heavy chain or antibody with a
human constant region.
8. The method of claim 6, further comprising exchanging the heavy
chain constant region nucleotide sequence of the antibody with a
nucleotide sequence encoding a human or humanised heavy chain
constant region, and optionally affinity maturing the variable
region of said antibody.
9. The method of claim 8, further comprising inserting said nucleic
acid into an expression vector and optionally a host cell.
10. The method of claim 9, comprising expressing the heavy chain,
VH domain or antibody from the host cell and providing an isolated
heavy chain, VH domain or antibody.
11. The method of claim 1, wherein the locus comprises one, more or
all human D gene segments D3-9; D4-17; D3-10; D2-2; D5-24; D6-19;
D3-22; D6-13; D5-12; D1-26; D1-20; D5-18; D3-16; D2-21; D1-14;
D7-27; D1-1; D6-25; D2-14; and D4-23, optionally wherein the locus
comprises one, more or all human D gene segments D3-9, D3-10,
D6-19, D4-17, D6-13, D3-22, D2-2, D2-25 and D3-3.
13. The method of claim 1, wherein the locus comprises a plurality
of human D gene segments and the JH6*02 is in human germline
configuration with respect to the 3'-most human D gene segment.
14. The method of claim 1, wherein the locus comprises one, more or
all of human gene segments selected from V3-21, V3-13, V3-7, V6-1,
V1-8, V1-2, V7-4-1, V1-3, V1-18, V4-4, V3-9, V3-23, V3-11, V3-20,
D3-9*01, D3-10*01, D6-19*01, D6-13*01, D1-26*01, IGHV1-8*01,
IGHV4-61*01, IGHV6-1*01, IGHV4-4*02, IGHV1-3*01, IGHV3-66*03,
IGHV3-7*01 and IGHV3-9*01.
15. The method of claim 1, wherein the antibody heavy chain is a
product of the recombination of JH6*02 with a human VH gene segment
recited in claim 14 and/or a D gene segment recited in claim
11.
16. The method of claim 1, wherein all endogenous non-human
vertebrate heavy chain variable region gene segments have been
inactivated in the genome and/or wherein the genome is homozygous
for said heavy chain locus.
17. The method of claim 1, wherein the vertebrate is a mouse
comprising functional heavy gene segments VH2-5, VH7-4-1, VH4-4,
VHI-3, VHI-2, VH6-1, DI-1, D2-2, D3-9, D3-10, D4-11, D5-12, D6-13,
DI-14, D2-15, D3-16, D4-17, D5-18, D6-19, DI-20, D2-21, D3-22,
D4-23, D5-24, D6-25, DI-26, D7-27, JHI, JH2, JH3, JH4, JH5 and JH6,
in 5' to 3' order, wherein the JH6 is the human JH6*02 variant,
wherein the insertion of human DNA is made between positions
114666435 and 114666436 on mouse chromosome 12; wherein human
functional heavy chain gene segments VH3-13, VH3-11, VH3-9, VH1-8,
VH3-7 are inserted upstream of VH2-5; wherein the mouse VH, D and
JH gene segments are retained in the locus, immediately upstream of
(5' of) the inserted human heavy chain DNA; and wherein the mouse
VH, D and J segments are inverted to inactivate them, thereby
producing mice in which only the human heavy chain variable region
gene segments are active.
18. The method of claim 17 additionally comprising VH2-26, V H
1-24, VH 3-23, VH 3-21, VH3-20, VH1-18, and VH 3-15 inserted
upstream (5') of the 5'-most VH.
19. The method of claim 1, wherein (i) the target antigen is an
antigen of an infectious disease pathogen; (ii) the target antigen
is a receptor, and the antibody heavy chain specifically binds a
receptor cleft; or (iii) the target antigen is an enzyme, and the
antibody heavy chain specifically binds the enzyme active site.
20. A non-human vertebrate cell having a genome comprising: at
least 3 human variable region gene segments of the same type,
wherein at least two of the human gene segments are variants that
are not identical to each other; at least 2 different human
variable region gene segments of the same type in cis at the same
Ig locus; at least 2 different human variable region gene segments
of the same type in trans at the same Ig locus, or first and second
human Ig locus gene segments of the same type, wherein the first
gene segment is a gene segment selected from any one of Tables 1 to
7 and 9 to 14 and the second gene segment is the corresponding
reference sequence.
21. A method of providing an enhanced human immunoglobulin variable
region gene segment repertoire, the method comprising providing a
population of non-human vertebrates comprising a repertoire of
human variable region gene segments, providing at least 2 different
human variable region gene segments of the same type, wherein a
first of said different gene segments is provided in the genome of
a first vertebrate of the population, and a second of said
different gene segments is provided in the genome of a second
vertebrate of the population, wherein the genome of the first
vertebrate does not comprise the second gene segment.
22. A library of antibody-producing transgenic cells whose genomes
collectively encode a repertoire of antibodies, wherein (a) a first
transgenic cell expresses a first antibody having a chain encoded
by a first immunoglobulin gene, the gene comprising a first
variable domain nucleotide sequence produced following
recombination of a first human unrearranged immunoglobulin gene
segment; (b) a second transgenic cell expresses a second antibody
having a chain encoded by a second immunoglobulin gene, the second
gene comprising a second variable domain nucleotide sequence
produced following recombination of a second human unrearranged
immunoglobulin gene segment, the first and second antibodies being
non-identical; (c) the first and second gene segments are different
and derived from the genome sequences of first and second human
individuals respectively, wherein the individuals are different;
wherein the second human immunoglobulin gene segment is a
polymorphic variant of the first human immunoglobulin gene segment
and wherein the second gene segment is selected from the group
consisting of a gene segment in any of Tables 1 to 7 and 9 to 14,
and wherein (d) the cells are non-human vertebrate cells.
23. A non-human vertebrate cell comprising a genome that comprises
(i) a transgenic heavy chain immunoglobulin locus, wherein the
locus comprises a full human repertoire of functional VH, D and JH
segments derived from the genome sequence of the same human
individual, supplemented with one or more additional functional
human VH, D and/or JH gene segment that is not found in the genome
sequence of said human individual; (ii) a transgenic kappa light
chain immunoglobulin locus, wherein the locus comprises a full
human repertoire of functional Vk and Jk segments derived from the
genome sequence of the same human individual, supplemented with one
or more additional functional human Vk and/or Jk gene segment that
is not found in the genome sequence of said human individual; or
(iii) a transgenic lambda light chain immunoglobulin locus, wherein
the locus comprises a full human repertoire of functional V lambda
and J lambda segments derived from the genome sequence of the same
human individual, supplemented with one or more additional
functional human V lambda and/or J lambda gene segment that is not
found in the genome sequence of said human individual.
24. A transgenic immunoglobulin locus comprising a synthetic
immunoglobulin gene haplotype, the haplotype comprising first and
second human gene segments (each being a V, D or J), a switch
region and a constant region, wherein a) the second gene segment is
a polymorphic variant of the first gene segment; or b) the first
and second gene segments are derived respectively from genome
sequence of individuals from different, first and second, ethnic
populations according to the 1000 Genomes database and the second
gene segment is not found in the first population according to the
1000 Genomes database; and wherein the constant region, and
optionally the switch region, are non-human vertebrate constant and
switch regions.
25. A method of producing an antibody heavy chain, the method
comprising providing an antigen-specific heavy chain variable
domain; and combining the variable domain with a human heavy chain
constant region to produce an antibody heavy chain comprising (in
N- to C-terminal direction) the variable domain and the constant
region; wherein the human heavy chain constant region is an
IGHAref, IGHAIa, IGHA2a, IGHA2b, IGHGIref, IGHG2ref, IGHG2a,
IGHG3ref, IGHG3a, IGHG3b, IGHG4ref, IGHG4a, IGHDref, IGHEref,
IGHMref, IGHMa or IGHMb constant region.
26. A non-human cell (eg, a mouse cell or rat cell) comprising a
genome that comprises a transgenic heavy chain immunoglobulin
locus, wherein the locus comprises at least 42 (optionally at least
43, 44, 45, 46, 47, 48, 49, 50) functional human VH gene segments,
one or more functional human D gene segments, one or more
functional human JH gene segments operably connected upstream of a
non-human vertebrate constant region (eg, a mouse constant region,
eg, a Cmu and/or a C gamma).
27. A non-human cell (eg, a mouse cell or rat cell) comprising a
genome that comprises a transgenic kappa light chain immunoglobulin
locus, wherein the locus comprises at least 39 functional human Vk
gene segments and one or more functional human Jk gene segments
operably connected upstream of a non-human vertebrate constant
region (eg, a mouse constant region).
28. A non-human cell (eg, a mouse cell or rat cell) comprising a
genome that comprises a transgenic lambda light chain
immunoglobulin locus, wherein the locus comprises at least 32
functional human V lambda gene segments and one or more functional
human J lambda gene segments operably connected upstream of a
non-human vertebrate constant region (eg, a mouse constant region).
Description
CROSS REFERENCE
[0001] This is a Continuation of U.S. Ser. No. 14/052,259 filed
Oct. 11, 2013, which is a Continuation of PCT/GB2012/052296 filed
Sep. 18, 2012, which claims priority to GB 1116122.1 filed Sep. 19,
2011, GB 1116120.5 filed Sep. 19, 2011, GB 1203257.9 filed Feb. 24,
2012, GB 1204592.8 filed Mar. 15, 2012, GB 1205702.2 filed Mar. 29,
2012, GB 1208749.0 filed May 18, 2012 and GB 1211692.7 filed Jul.
2, 2012, all of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the provision of antibody
therapeutics and prophylactics that are tailored specifically for
human use.
[0003] The present invention provides libraries, vertebrates and
cells, such as transgenic mice or rats or transgenic mouse or rat
cells. Furthermore, the invention relates to methods of using the
vertebrates to isolate antibodies or nucleotide sequences encoding
antibodies. Antibodies, heavy chains, polypeptides, nucleotide
sequences, pharmaceutical compositions and uses are also provided
by the invention.
BACKGROUND
[0004] The state of the art provides non-human vertebrates (eg,
mice and rats) and cells comprising transgenic immunoglobulin loci,
such loci comprising human variable (V), diversity (D) and/or
joining (J) segments, and optionally human constant regions.
Alternatively, endogenous constant regions of the host vertebrate
(eg, mouse or rat constant regions) are provided in the transgenic
loci. Methods of constructing such transgenic vertebrates and use
of these to generate antibodies and nucleic acids thereof following
antigen immunisation are known in the art, eg, see U.S. Pat. No.
7,501,552 (Medarex), U.S. Pat. No. 5,939,598 (Abgenix), U.S. Pat.
No. 6,130,364 (Abgenix), WO02/066630 (Regeneron), WO2011004192
(Genome Research Limited), WO2009076464, WO2009143472 and
WO2010039900 (Ablexis), the disclosures of which are explicitly
incorporated herein. Such transgenic loci in the art include
varying amounts of the human V(D) J repertoire. Existing transgenic
immunoglobulin loci are based on a single human DNA source. The
potential diversity of human antibody variable regions in non-human
vertebrates bearing such transgenic loci is thus confined.
[0005] The inventors considered that it would be desirable to
tailor the genomes of these transgenic non-human vertebrates (and
thus antibody and antibody chain products of these) to address the
variability--and commonality--in the natural antibody gene usage of
humans. The inventors wanted to do this in order to better address
human use of antibody-based therapeutic and prophylactic drugs.
[0006] It would be desirable also to provide for novel and
potentially expanded repertoire and diversity of human variable
regions in transgenic immunoglobulin loci and non-human vertebrates
harbouring these, as well as in antibodies produced following
immunisation of such animals.
SUMMARY OF THE INVENTION
[0007] The present invention has been developed from extensive
bioinformatics analysis of natural antibody gene segment
distributions across a myriad of different human populations and
across more than two thousand samples from human individuals. The
inventors have undertaken this huge task to more thoroughly
understand and design non-human vertebrate systems and resultant
antibodies to better address human medical therapeutics as a whole,
as well as to enable rational design to address specific ethnic
populations of humans. Using such rational design, the inventors
have constructed transgenic non-human vertebrates and isolated
antibodies, antibody chains and cells expressing these in a way
that yields products that utilise gene segments that have been
purposely included on the basis of the human bioinformatics
analysis. The examples illustrate worked experiments where the
inventors isolated many cells and antibodies to this effect.
[0008] The invention also relates to synthetically-extended &
ethnically-diverse superhuman immunoglobulin gene repertoires. The
present invention thus provides for novel and potentially expanded
synthetic immunoglobulin diversities, thus providing a pool of
diversity from which human antibody therapeutic leads can be
selected. This expanded pool is useful when seeking to find
antibodies with desirable characteristics, such as relatively high
affinity to target antigen without the need for further affinity
maturation (eg, using laborious in vitro techniques such as phage
or ribosome display), or improved biophysical characteristics, or
to address targets and new epitopes that have previously been
difficult to address with antibodies are not reached by prior
antibody binding sites.
[0009] The invention also provides for diversity that is
potentially biased towards variable gene usage common to members of
a specific human population, which is useful for generating
antibodies for treating and/or preventing diseases or conditions
within such population. This ability to bias the antibody
repertoire allows one to tailor antibody therapeutics with the aim
of more effectively treating and/or preventing disease or medical
conditions in specific human populations.
[0010] The present inventors realised the possibility of providing
immunoglobulin gene segments from disparate sources in transgenic
loci, in order to provide for novel and potentially-expanded
antibody diversities from which antibody therapeutics (and antibody
tool reagents) could be generated. This- opens up the potential of
transgenic human-mouse/rat technologies to the possibility of
interrogating different and possibly larger antibody
sequence-spaces than has hitherto been possible.
[0011] In rationally designing transgenic antibody loci, as well as
antibodies and antibody chains, the inventors also realised that a
relatively long HCDR3 length (at least 20 amino acids) is often
desirable to address epitopes. For example, naturally-occurring
antibodies have been isolated from humans infected with infectious
disease pathogens, such antibodies having a long HCDR3 length.
Neutralising antibodies have been found in this respect. A long
HCDR3 length would be desirable to address other antigens (eg,
receptor clefts or enzyme active sites), not just limited to
infectious disease pathogens, and thus the inventors realised the
general desirability of the possibility of engineering transgenic
loci to be able to produce long HCDR3 antibodies and heavy chains.
The inventors, through laborious execution of bioinformatics on in
excess of 2000 human DNA samples via the 1000 Genomes project
together with rational sequence choices, identified that the
inclusion of the specific human gene segment variant JH6*02 is
desirable for producing long HCDR3 antibodies and chains.
[0012] Additional rational design and bioinformatics has led the
inventors to realise that specific human constant region variants
are conserved across many diverse human populations. The inventors
realised that this opens up the possibility of making a choice to
humanise antibodies, chains and variable domains by using such
specific constant regions in products, rather than arbitrarily
choosing the human constant region (or a synthetic version of a
human constant region). This aspect of the invention also enables
one to tailor antibody-based drugs to specific human ethnic
populations, thereby more closely matching drug to patient (and
thus disease setting) than has hitherto been performed. It can be a
problem in the state of the art that antibodies are humanised with
an arbitrary choice of human constant region (presumably derived
from one (often unknown) ethnic population or non-naturally
occurring) that does not function as well in patients of a
different human ethnic population. This is important, since the
constant region has the major role in providing antibody effector
functions, eg, for antibody recycling, cellular and complement
recruitment and for cell killing.
[0013] To this end, in a first configuration of the invention,
there is provided
[0014] First Configuration
[0015] A non-human vertebrate or vertebrate cell (optionally an ES
cell or antibody-producing cell) comprising a genome having a
superhuman immunoglobulin heavy chain human VH and/or D and/or J
gene repertoire.
[0016] A non-human vertebrate or vertebrate cell (optionally an ES
cell or antibody-producing cell) comprising a genome having a
superhuman immunoglobulin light chain human VL gene repertoire;
optionally wherein the vertebrate or cell is according to the first
configuration.
[0017] A non-human vertebrate or vertebrate cell (optionally an ES
cell or antibody-producing cell) whose genome comprises a
transgenic immunoglobulin locus (eg, a heavy chain locus or a light
chain locus), said locus comprising immunoglobulin gene segments
according to the first and second human immunoglobulin gene
segments (optionally V segments) as mentioned below operably
connected upstream of an immunoglobulin constant region; optionally
wherein the genome is homozygous for said transgenic immunoglobulin
locus;
[0018] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional V gene segments;
and/or
[0019] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional D gene segments;
and/or
[0020] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional J gene
segments.
[0021] A transgenic non-human vertebrate (eg, a mouse or rat) or
vertebrate cell (optionally an ES cell or antibody-producing cell)
whose genome comprises a transgenic immunoglobulin locus comprising
a plurality of human immunoglobulin gene segments operably
connected upstream of a non-human vertebrate constant region for
the production of a repertoire of chimaeric antibodies, or
chimaeric light or heavy chains, having a non-human vertebrate
constant region and a human variable region; wherein the transgenic
locus comprises one or more human immunoglobulin V gene segments,
one or more human J gene segments and optionally one or more human
D gene segments, a first (optionally a V segment) of said gene
segments and a second (optionally a V segment) of said gene
segments being different and derived from the genomes of first and
second human individuals respectively, wherein the individuals are
different; and optionally not related; optionally wherein the
immunoglobulin locus comprises more than the natural human
complement of functional V gene segments; and/or
[0022] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional D gene segments;
and/or
[0023] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional J gene
segments.
[0024] A transgenic non-human vertebrate (eg, a mouse or rat) or
vertebrate cell (optionally an ES cell or antibody-producing cell)
whose genome comprises first and second transgenic immunoglobulin
loci, each locus comprising a plurality of human immunoglobulin
gene segments operably connected upstream of a non-human vertebrate
constant region for the production of a repertoire of chimaeric
antibodies, or chimaeric light or heavy chains, having a non-human
vertebrate constant region and a human variable region;
[0025] wherein (i) the first transgenic locus comprises one or more
human immunoglobulin V gene segments, one or more human J gene
segments and optionally one or more human D gene segments, (ii) the
second transgenic locus comprises one or more human immunoglobulin
V gene segments, one or more human J gene segments and optionally
one or more human D gene segments; and (iii) wherein a first
(optionally a V) gene segment of said first locus and a second
(optionally a V) gene segment of said second gene locus are
different and derived from the genomes of first and second human
individuals respectively, wherein the individuals are different;
and optionally not related;
[0026] optionally wherein the first and second loci are on
different chromosomes (optionally chromosomes with the same
chromosome number) in said genome;
[0027] optionally wherein each immunoglobulin locus comprises more
than the natural human complement of functional V gene segments;
and/or
[0028] optionally wherein each immunoglobulin locus comprises more
than the natural human complement of functional D gene segments;
and/or
[0029] optionally wherein each immunoglobulin locus comprises more
than the natural human complement of functional J gene
segments.
[0030] A method of constructing a cell (eg, an ES cell) according
to the invention, the method comprising
[0031] (a) identifying functional V and J (and optionally D) gene
segments of the genome sequence of a (or said) first human
individual;
[0032] (b) identifying one or more functional V and/or D and/or J
gene segments of the genome sequence of a (or said) second human
individual, wherein these additional gene segments are not found in
the genome sequence of the first individual;
[0033] (c) and constructing a transgenic immunoglobulin locus in
the cell, wherein the gene segments of (a) and (b) are provided in
the locus operably connected upstream of a constant region.
[0034] In one embodiment, the gene segment(s) in step (b) are
identified from an immunoglobulin gene database selected from the
1000 Genomes, Ensembl, Genbank and IMGT databases.
[0035] Throughout this text, Genbank is a reference to Genbank
release number 185.0 or 191.0; the 1000 Genomes database is Phase
1, release v3, 16 Mar. 2012; the Ensembl database is assembly
GRCh37.p8 (10/04/2012); the IMGT database is available at
www.imgt.org.
[0036] In one embodiment, the first and second human individuals
are members of first and second ethnic populations respectively,
wherein the populations are different, optionally wherein the human
immunoglobulin gene segment derived from the genome sequence of the
second individual is low-frequency (optionally rare) within the
second ethnic population.
[0037] This configuration of the invention also provides a method
of making a transgenic non-human vertebrate (eg, a mouse or rat),
the method comprising
[0038] (a) constructing an ES cell (eg, a mouse C57BL/6N, C57BL/6J,
129S5 or 129Sv strain ES cell) by carrying out the method
above;
[0039] (b) injecting the ES cell into a donor non-human vertebrate
blastocyst (eg, a mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain
blastocyst);
[0040] (c) implanting the blastocyst into a foster non-human
vertebrate mother (eg, a C57BL/6N, C57BL/6J, 129S5 or 129Sv strain
mouse); and
[0041] (d) obtaining a child from said mother, wherein the child
genome comprises a transgenic immunoglobulin locus.
[0042] In one embodiment, the invention provides a method of
isolating an antibody that binds a predetermined antigen (eg, a
bacterial or viral pathogen antigen), the method comprising
immunising a non-human vertebrate according to the invention.
[0043] Second Configuration
[0044] A library of antibody-producing transgenic cells whose
genomes collectively encode a repertoire of antibodies, wherein
[0045] (a) a first transgenic cell expresses a first antibody
having a chain encoded by a first immunoglobulin gene, the gene
comprising a first variable domain nucleotide sequence produced
following recombination of a first human unrearranged
immunoglobulin gene segment;
[0046] (b) a second transgenic cell expresses a second antibody
having a chain encoded by a second immunoglobulin gene, the second
gene comprising a second variable domain nucleotide sequence
produced following recombination of a second human unrearranged
immunoglobulin gene segment, the first and second antibodies being
non-identical;
[0047] (c) the first and second gene segments are different and
derived from the genome sequences of first and second human
individuals respectively, wherein the individuals are different;
and optionally not related;
[0048] (d) wherein the cells are non-human vertebrate (eg, mouse or
rat) cells.
[0049] In one embodiment, the first and second human individuals
are members of first and second ethnic populations respectively,
wherein the populations are different; optionally wherein the
ethnic populations are selected from those identified in the 1000
Genomes database.
[0050] In another embodiment, the second human immunoglobulin gene
segment is a polymorphic variant of the first human immunoglobulin
gene segment; optionally wherein the second gene segment is
selected from the group consisting of a gene segment in any of
Tables 1 to 7 and 9 to 14 below (eg, selected from Table 13 or
Table 14), eg, the second gene segment is a polymorphic variant of
VH1-69.
[0051] Third Configuration an Isolated Antibody Having
[0052] (a) a heavy chain encoded by a nucleotide sequence produced
following recombination in a transgenic non-human vertebrate cell
of an unrearranged human immunoglobulin V gene segment with a human
D and human J segment, optionally with affinity maturation in said
cell, wherein one of the gene segments is derived from the genome
of an individual from a first human ethnic population; and the
other two gene segments are derived from the genome of an
individual from a second, different, human ethnic population, and
wherein the antibody comprises heavy chain constant regions of said
non-human vertebrate (eg, rodent, mouse or rat heavy chain constant
regions); and/or
[0053] (b) a light chain encoded by a nucleotide sequence produced
following recombination in a transgenic non-human vertebrate cell
of an unrearranged human immunoglobulin V gene segment with a human
J segment, optionally with affinity maturation in said cell,
wherein one of the gene segments is derived from the genome of an
individual from a first human ethnic population (optionally the
same as the first population in (a)); and the other gene segment is
derived from the genome of an individual from a second, different,
human ethnic population (optionally the same as the second
population in (a)), and wherein the antibody comprises light chain
constant regions of said non-human vertebrate (eg, rodent, mouse or
rat heavy light constant regions);
[0054] (c) Optionally wherein each variable domain of the antibody
is a human variable domain.
[0055] (d) Optionally wherein the heavy chain constant regions are
gamma-type constant regions.
[0056] The invention also provides an isolated nucleotide sequence
encoding the antibody, optionally wherein the sequence is provided
in an antibody expression vector, optionally in a host cell.
[0057] The invention also provides a method of producing a human
antibody, the method comprising replacing the non-human vertebrate
constant regions of the antibody of the third configuration with
human antibody constant regions.
[0058] The invention also provides a pharmaceutical composition
comprising an antibody according to the third configuration, or an
antibody produced according to the method above and a diluent,
excipient or carrier; optionally wherein the composition is
provided in a container connected to an IV needle or syringe or in
an IV bag.
[0059] The invention also provides an antibody-producing cell that
expresses the second antibody recited in any one of the
configurations.
[0060] In an alternative configuration, the invention contemplates
the combination of nucleotide sequences of first and second
immunoglobulin gene segments (eg, two or more polymorphic variants
of a particular human germline VH or VL gene segment) to provide a
synthetic gene segment. Such synthetic gene segment is used, in one
embodiment, to build a transgenic immunoglobulin locus, wherein the
synthetic gene segment is provided in combination with one or more
human variable and J regions (and optionally one or more human D
regions) operably connected upstream of a constant region. When
provided in the genome of a non-human vertebrate or cell (eg, mouse
or rat cell, eg, ES cell), the invention provides for superhuman
gene segment diversity. The sequences to be combined can be
selected from gene segments that have been observed to be commonly
used in human antibodies raised against a particular antigen (eg, a
flu antigen, such as haemaglutinin). By combining the sequences,
the synthetic gene segment may recombine in vivo to produce an
antibody that is well suited to the treatment and/or prevention of
a disease or condition (eg, influenza) mediated by said
antigen.
[0061] Fourth Configuration
[0062] A non-human vertebrate (optionally a mouse or a rat) or
vertebrate cell whose genome comprises an immunoglobulin heavy
chain locus comprising human gene segment JH6*02, one or more VH
gene segments and one or more D gene segments upstream of a
constant region; wherein the gene segments in the heavy chain locus
are operably linked to the constant region thereof so that the
mouse is capable of producing an antibody heavy chain produced by
recombination of the human JH6*02 with a D segment and a VH
segment.
[0063] A non-human vertebrate cell (optionally a mouse cell or a
rat cell) whose genome comprises an immunoglobulin heavy chain
locus comprising human gene segment JH6*02, one or more VH gene
segments and one or more D gene segments upstream of a constant
region; wherein the gene segments in the heavy chain locus are
operably linked to the constant region thereof for producing (eg,
in a subsequent progeny cell) an antibody heavy chain produced by
recombination of the human JH6*02 with a D segment and a VH
segment.
[0064] A heavy chain (eg, comprised by an antibody) isolated from a
vertebrate of the invention wherein the heavy chain comprises a
HCDR3 of at least 20 amino acids.
[0065] A method for producing a heavy chain, VH domain or an
antibody specific to a target antigen, the method comprising
immunizing a non-human vertebrate according to the invention with
the antigen and isolating the heavy chain, VH domain or an antibody
specific to a target antigen or a cell producing the heavy chain,
VH domain or an antibody, wherein the heavy chain, VH domain or an
antibody comprises a HCDR3 that is derived from the recombination
of human JH6*02 with a VH gene segment and a D gene segment.
[0066] A heavy chain, VH domain or an antibody produced by the
method.
[0067] A B-cell or hybridoma expressing a heavy chain VH domain
that is identical to the VH domain of the heavy chain.
[0068] A nucleic acid encoding the VH domain of the heavy chain, or
encoding the heavy chain.
[0069] A vector (eg, a CHO cell or HEK293 cell vector) comprising
the nucleic acid; optionally wherein the vector is in a host cell
(eg, a CHO cell or HEK293 cell).
[0070] A pharmaceutical composition comprising the antibody, heavy
chain or VH domain (eg, comprised by an antibody), together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, heavy chain or
antibody).
[0071] The antibody, heavy chain or VH domain (eg, comprised by an
antibody) as above for use in medicine.
[0072] The use of an antibody, heavy chain or VH domain (eg,
comprised by an antibody) as above in the manufacture of a
medicament for treating and/or preventing a medical condition in a
human.
[0073] Fifth Configuration
[0074] A method of producing an antibody heavy chain, the method
comprising
[0075] (a) providing an antigen-specific heavy chain variable
domain; and
[0076] (b) combining the variable domain with a human heavy chain
constant region to produce an antibody heavy chain comprising (in
N- to C-terminal direction) the variable domain and the constant
region;
[0077] wherein
[0078] the human heavy chain constant region is an IGHG1 ref,
IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a
constant region.
[0079] An antibody comprising a human heavy chain, the heavy chain
comprising a variable domain that is specific for an antigen and a
constant region that is an IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref,
IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region. Optionally, the
variable domain comprises mouse-pattern AID somatic mutations.
[0080] A polypeptide comprising (in N- to C-terminal direction) a
leader sequence, a human variable domain that is specific for an
antigen and a human constant region that is an IGHG1ref, IGHG2ref,
IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant
region wherein (i) the leader sequence is not the native human
variable domain leader sequence; and/or (ii) the variable domain
comprises mouse AID-pattern somatic mutations and/or mouse Terminal
deoxynucleotidyl transferase (TdT)-pattern junctional
mutations.
[0081] A nucleotide sequence encoding (in 5' to 3' direction) a
leader sequence and a human antibody heavy chain, the heavy chain
comprising a variable domain that is specific for an antigen and a
constant region that is an IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref,
IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region; and the leader
sequence being operable for expression of the heavy chain and
wherein the leader sequence is not the native human variable domain
leader sequence.
[0082] A nucleotide sequence encoding (in 5' to 3' direction) a
promoter and a human antibody heavy chain, the heavy chain
comprising a variable domain that is specific for an antigen and a
constant region that is an IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref,
IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region; and the
promoter being operable for expression of the heavy chain and
wherein the promoter is not the native human promoter.
[0083] A vector (eg, a CHO cell or HEK293 cell vector) comprising a
IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or
IGHG4a constant region nucleotide sequence that is 3' of a cloning
site for the insertion of a human antibody heavy chain variable
domain nucleotide sequence, such that upon insertion of such a
variable domain sequence the vector comprises (in 5' to 3'
direction) a promoter, a leader sequence, the variable domain
sequence and the constant region sequence so that the vector is
capable of expressing a human antibody heavy chain when present in
a host cell.
[0084] Sixth Configuration
[0085] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 3 human variable region gene segments of the
same type (eg, at least 3 human VH6-1 gene segments, at least 3
human JH6 gene segments, at least 3 human VK1-39 gene segments, at
least 3 human D2-2 gene segments or at least 3 human JK1 gene
segments), wherein at least two of the human gene segments are
variants that are not identical to each other.
[0086] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 different non-endogenous variable region gene
segments of the same type (eg, at least 2 human VH6-1 gene
segments, at least 3 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments) cis at the same Ig locus.
[0087] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 different human variable region gene segments
of the same type (eg, at least 2 human VH6-1 gene segments, at
least 2 human JH6 gene segments, at least 2 human VK1-39 gene
segments, at least 2 human D2-2 gene segments or at least 2 human
JK1 gene segments) trans at the same Ig locus; and optionally a
third human gene segment of the same type, wherein the third gene
segment is cis with one of said 2 different gene segments.
[0088] A population of non-human vertebrates (eg, mice or rats)
comprising a repertoire of human variable region gene segments,
wherein the plurality comprises at least 2 human variable region
gene segments of the same type (eg, at least 2 human VH6-1 gene
segments, at least 2 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments), a first of said different gene
segments is provided in the genome of a first vertebrate of the
population, and a second of said different gene segments being
provided in the genome of a second vertebrate of the population,
wherein the genome of the first vertebrate does not comprise the
second gene segment.
[0089] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 different non-endogenous variable region gene
segments of the same type (eg, at least 2 human VH6-1 gene
segments, at least 2 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments), wherein the gene segments are
derived from the genome sequence of different human individuals
that are not genetically related over at least 3 generations.
[0090] A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 3 human variable region gene segments of the same type
(eg, at least 3 human VH6-1 gene segments, at least 3 human JH6
gene segments, at least 3 human VK1-39 gene segments, at least 3
human D2-2 gene segments or at least 3 human JK1 gene segments),
wherein at least two of the human gene segments are variants that
are not identical to each other.
[0091] A method of enhancing the immunoglobulin gene diversity of a
non-human vertebrate (eg, a mouse or rat), the method comprising
providing the vertebrate with a genome comprising at least 2
different non-endogenous variable region gene segments of the same
type (eg, at least 2 human VH6-1 gene segments, at least 2 human
JH6 gene segments, at least 2 human VK1-39 gene segments, at least
2 human D2-2 gene segments or at least 2 human JK1 gene segments)
cis at the same Ig locus.
[0092] A method of enhancing the immunoglobulin gene diversity of a
non-human vertebrate (eg, a mouse or rat), the method comprising
providing the vertebrate with a genome comprising at least 2
different human variable region gene segments of the same type (eg,
at least 2 human VH6-1 gene segments, at least 2 human JH6 gene
segments, at least 2 human VK1-39 gene segments, at least 2 human
D2-2 gene segments or at least 2 human JK1 gene segments) trans at
the same Ig locus; and optionally a third human gene segment of the
same type, wherein the third gene segment is cis with one of said 2
different gene segments.
[0093] A method of providing an enhanced human immunoglobulin
variable region gene segment repertoire, the method comprising
providing a population of non-human vertebrates (eg, a mouse or
rat) comprising a repertoire of human variable region gene
segments, wherein the method comprises providing at least 2
different human variable region gene segments of the same type (eg,
at least 2 human VH6-1 gene segments, at least 2 human JH6 gene
segments, at least 2 human VK1-39 gene segments, at least 2 human
D2-2 gene segments or at least 2 human JK1 gene segments), wherein
a first of said different gene segments is provided in the genome
of a first vertebrate of the population, and a second of said
different gene segments is provided in the genome of a second
vertebrate of the population, wherein the genome of the first
vertebrate does not comprise the second gene segment.
[0094] A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 different non-endogenous variable region gene segments
of the same type (eg, at least 2 human VH6-1 gene segments, at
least 2 human JH6 gene segments, at least 2 human VK1-39 gene
segments, at least 2 human D2-2 gene segments or at least 2 human
JK1 gene segments), wherein the gene segments are derived from the
genome sequence of different human individuals that are not
genetically related over at least 3 generations.
[0095] A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 human variable region gene segments of the same type
(eg, at least 2 human VH6-1 gene segments, at least 2 human JH6
gene segments, at least 2 human VK1-39 gene segments, at least 2
human D2-2 gene segments or at least 2 human JK1 gene segments),
wherein the gene segments are derived from the genome sequence of
different human individuals that are not genetically related over
at least 3 generations; optionally wherein at least 2 or 3 of said
different gene segments are provided at the same Ig locus in said
genome.
[0096] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising first and second human Ig locus gene segments of the
same type (eg, first and second human JH6 gene segments; or first
and second IgG2 gene segments; or first and second human J.lamda.7
gene segments), wherein the first gene segment is a gene segment
selected from any one of Tables 1 and 9 to 14 (eg, selected from
Table 13 or Table 14) (eg, IGHJ6-a) and the second gene segment is
the corresponding reference sequence.
[0097] A population of non-human vertebrates (eg, mice or rats)
comprising first and second human Ig locus gene segments of the
same type (eg, first and second human JH6 gene segments; or first
and second IgG2 gene segments; or first and second human J.lamda.7
gene segments), wherein the first gene segment is a gene segment
selected from any one of Tables 1 and 9 to 14 (eg, selected from
Table 13 or Table 14) (eg, IGHJ6-a) and the second gene segment is
the corresponding reference sequence, wherein the first gene
segment is provided in the genome of a first vertebrate of the
population, and the second gene segment is provided in the genome
of a second vertebrate of the population.
[0098] A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
first and second human Ig locus gene segments of the same type (eg,
first and second human JH6 gene segments; or first and second IgG2
gene segments; or first and second human J.lamda.7 gene segments),
wherein the first gene segment is a gene segment selected from any
one of Tables 1 and 9 to 14 (eg, selected from Table 13 or Table
14) (eg, IGHJ6-a) and the second gene segment is the corresponding
reference sequence.
[0099] In one aspect of this configuration, the invention relates
to human D gene segment variants as described further below.
[0100] In one aspect of this configuration, the invention relates
to human V gene segment variants as described further below.
[0101] In one aspect of this configuration, the invention relates
to human J gene segment variants as described further below.
BRIEF DESCRIPTION OF THE FIGURES
[0102] FIGS. 1 to 3: Schematic illustrating a protocol for
producing recombineered BAC vectors to add V gene segments into a
mouse genome;
[0103] FIG. 4: Schematic illustrating a protocol for adding V gene
segments to a mouse genome using sequential recombinase mediated
cassette exchange (sRMCE); and
[0104] FIG. 5 (in 4 parts): Alignment of 13 IGHV1-69 variants
showing the variable (V) coding region only. Nucleotides that
differ from VH1-69 variant *01 are indicated at the appropriate
position whereas identical nucleotides are marked with a dash.
Where nucleotide changes result in amino acid differences, the
encoded amino acid is shown above the corresponding triplet. Boxed
regions correspond to CDR1, CDR2 and CDR3 as indicated.
[0105] FIG. 6 is a schematic illustrating gene segment diversity
and the effect of including variant variants in cis according to
the invention:--
[0106] (a) Situation in a normal person: Recombination on the same
chromosome limits combinations of variants, for instance the
antibody gene V4-4 can only be recombined within variant 1 to form
for instance for instance V4-4-D-J6 or V4-4-D-J2A. Similarly the
variant V4-4A can't be recombined with either J6 or J2A from
variant 1 and can only be joined with J-genes from variant 2 to
form V4-4A-D-J6A and V4-4A-D-J2. V4-4-J2/J6 complexity=4.
[0107] (b) Situation in a transgenic mouse: Only one variant is
provided so the genome is limited. V4-4-J6/J2 complexity=2.
[0108] (c) Supra mouse of the invention: The variants are added in
cis and thus can be recombined in every combination, expanding the
repertoire. For instance V4-4 can be combined with J6A, J6, J2A or
J2 and similarly V4-4A can be recombined with these same J-genes.
The V4-4-J6/J2 complexity=8, which in this simple example is double
that of a person and 4.times. that of a mouse with a single
variant.
[0109] FIG. 7: Alignment of human JH6*02 variants. Nucleotides that
differ from JH6 *01 are indicated at the appropriate position
whereas identical nucleotides are marked with a dash. Where
nucleotide changes result in amino acid differences, the encoded
amino acid is shown above. Accession numbers (eg, J00256) are shown
to the left of the IMGT variant name.
[0110] FIG. 8: Alignment of JH sequences from various species.
[0111] FIG. 9: Codon Table
[0112] FIG. 10: BAC database extract
BRIEF DESCRIPTION OF THE TABLES
[0113] Table 1: Human IgH V Polymorphic Variants
[0114] Table 2: Human IgH D Polymorphic Variants
[0115] Table 3: Human IgH J Polymorphic Variants
[0116] Table 4: Human Ig Vk Polymorphic Variants
[0117] Table 5: Human Ig VA Polymorphic Variants
[0118] Table 6: Human IgH Jk Polymorphic Variants
[0119] Table 7: Human IgH J.lamda. Polymorphic Variants
[0120] Table 8: 1000 Genomes Project Human Populations
[0121] Table 9: Immunoglobulin Gene Usage in Human Antibody
Responses to Infectious Disease Pathogens
[0122] Table 10A: Human IgH JH5 Variant Occurrences
[0123] Table 10B: Non-Synonymous Human IgH JH5 Variants
[0124] Table 11A: Human IgH JH6 Variant Occurrences
[0125] Table 11B: Non-Synonymous Human IgH JH6 Variants
[0126] Table 12A: Human IgH JH2 Variant Occurrences
[0127] Table 12B: Non-Synonymous Human IgH JH2 Variants
[0128] Table 13: Variant Frequency Analyses & Human Population
Distributions
[0129] Table 14: Frequent Human Variant Distributions
[0130] Table 15: Human Gene Segment Usage: Heavy Chain Repertoires
From Naive Non-Human Vertebrates
[0131] Table 16: Human Gene Segment Usage: Heavy Chain Repertoires
From Immunised Non-Human Vertebrates
[0132] Table 17: Human Gene Segment Usage: Heavy Chain Repertoires
From Antigen-Specific Hybridomas
[0133] Table 18: Sequence Correlation Table
[0134] Table 19: Summary Of Function Correlated With Human Gamma
Constant Region Sub-Type
[0135] Table 20: Gene Segments Prevalent In Few Human
Populations
[0136] Table 21: Genomic and sequence information
DETAILED DESCRIPTION OF THE INVENTION
[0137] A suitable source of JH6*02 and other human DNA sequences
for use in the invention will be readily apparent to the skilled
person. For example, it is possible to collect a DNA sample from a
consenting human donor (eg, a cheek swab sample as per the Example
herein) from which can be obtained suitable DNA sequences for use
in constructing a locus of the invention. Other sources of human
DNA are commercially available, as will be known to the skilled
person. Alternatively, the skilled person is able to construct gene
segment sequence by referring to one or more databases of human Ig
gene segment sequences disclosed herein.
[0138] An example source for human V, D and J gene segments
according to the invention are Bacterial Artificial Chromosomes
(RPCI-11 BACs) obtained from Roswell Park Cancer Institute
(RPCI)/Invitrogen. See http://bacpac.chori.org/hmalell.htm, which
describes the BACs as follows:--
[0139] "RPCI-11 Human Male BAC Library
[0140] The RPCI-11 Human Male BAC Library (Osoegawa et al., 2001)
was constructed using improved cloning techniques (Osoegawa et al.,
1998) developed by Kazutoyo Osoegawa. The library was generated by
Kazutoyo Osoegawa. Construction was funded by a grant from the
National Human Genome Research Institute (NHGRI, NIH)
(#1R01RG01165-03). This library was generated according to the new
NHGRI/DOE "Guidance on Human Subjects in Large-Scale DNA Sequencing
. . . .
[0141] "Male blood was obtained via a double-blind selection
protocol. Male blood DNA was isolated from one randomly chosen
donor (out of 10 male donors)". [0142] Osoegawa K, Mammoser A G, Wu
C, Frengen E, Zeng C, Catanese J J, de Jong P J; Genome Res. 2001
March; 11(3):483-96; "A bacterial artificial chromosome library for
sequencing the complete human genome"; [0143] Osoegawa, K., Woon,
P. Y., Zhao, B., Frengen, E., Tateno, M., Catanese, J. J, and de
Jong, P. J. (1998); "An Improved Approach for Construction of
Bacterial Artificial Chromosome Libraries"; Genomics 52, 1-8.
[0144] Superhuman Immunoglobulin Gene Repertoires
[0145] The invention relates to synthetically-extended &
ethnically-diverse superhuman immunoglobulin gene repertoires. The
human immunoglobulin repertoires are beyond those found in nature
(ie, "Superhuman"), for example, they are more diverse than a
natural human repertoire or they comprise combinations of human
immunoglobulin gene segments from disparate sources in a way that
is non-natural. Thus, the repertoires of the invention are
"superhuman" immunoglobulin repertoires, and the invention relates
to the application of these in transgenic cells and non-human
vertebrates for utility in producing chimaeric antibodies (with the
possibility of converting these into fully-human, isolated
antibodies using recombinant DNA technology). The present invention
thus provides for novel and potentially expanded synthetic
immunoglobulin diversities, which provides for a pool of diversity
from which antibody therapeutic leads (antibody therapeutics and
antibody tool reagents) can be selected. This opens up the
potential of transgenic human-mouse/rat technologies to the
possibility of interrogating different and possibly larger antibody
sequence-spaces than has hitherto been possible. To this end, in
one embodiment, the invention provides a SUPERHUMAN MOUSE.TM. (aka
SUPRA-MOUSE.TM.) and a SUPERHUMAN RAT.TM. (aka SUPRA-RAT.TM.)
[0146] In developing this thinking, the present inventors have
realised the possibility of mining the huge genetics resources now
available to the skilled person thanks to efforts such as the
HapMap Project, 1000 Genomes Project and sundry other
immunoglobulin gene databases (see below for more details). Thus,
in some embodiments, the inventors realised the application of
these genome sequencing developments in the present invention to
generate synthetically-produced and ethnically-diverse artificial
immunoglobulin gene repertoires. In one aspect, the inventors
realised that such repertoires are useful for the production of
antibodies having improved affinity and/or biophysical
characteristics, and/or wherein the range of epitope specificities
produced by means of such repertoire is novel, provides for
antibodies to epitopes that have hitherto been intractable by prior
transgenic immunoglobulin loci or difficult to address.
[0147] The present invention provides libraries, vertebrates and
cells, such as transgenic mice or rats or transgenic mouse or rat
cells. Furthermore, the invention relates to methods of using the
vertebrates to isolate antibodies or nucleotide sequences encoding
antibodies. Antibodies, nucleotide sequences, pharmaceutical
compositions and uses are also provided by the invention.
[0148] Variation Analysis
[0149] The present inventors have realized methods and antibody
loci designs that harness the power of genetic variation analysis.
The reference human genome provides a foundation for experimental
work and genetic analysis of human samples. The reference human is
a compilation of the genomes from a small number of individuals and
for any one segment of the genome a high quality single reference
genome for one of the two chromosomes is available. Because the
reference genome was assembled from a series of very large insert
clones, the identity of these clones is known. Accordingly,
experimental work with human genomic DNA is usually conducted on
the clones from which the reference sequence was derived.
[0150] Individual humans differ in their sequence and recently
several individuals have had their genomes sequenced, for instance
James Watson and Craig Venter. Comparison of the genome sequence of
these individuals has revealed differences between their sequences
and the reference genome in both coding and non-coding parts of the
genome, approximately 1 in 1000 bases are different. Some variants
will be significant and contribute to differences between
individuals. In extreme cases these will result in genetic disease.
Variation can be implicated in differing responses to drugs
administered to human patients, eg, yielding an undesirable
lowering of patient response to treatment.
[0151] The 1000-Genomes Project has the objective of identifying
the most frequent variations in the human genome. This public
domain project involved sequencing the genomes of more than 1000
individuals from diverse ethnic groups, comparing these sequences
to the reference and assembling a catalogue of variants. This has
enabled the annotation of variants in coding regions, but because
this sequence wasn't derived from large clones of DNA, the analysis
of the sequence from diploid individuals can't discriminate the
distribution of the variation between the maternal and paternally
inherited chromosomes. Where more than one variant is identified in
a protein coding gene, it is not possible to illuminate the
distribution of the pattern of variants in each version of the
protein. For example, if two variants are detected in different
positions of the same protein in an individual, this could have
resulted from one copy with two variants and none in the other or
each copy could have just one variant. To illuminate the sequence
of real proteins, the 1000-Genome Project has sequenced
mother-father-child trios. This allows one to "phase" the sequence
variants, in other words identify blocks of sequence that are
inherited from one or other parent and deconvolute the
variants.
[0152] To further understand the variation within the 1000-genome
set a tool has been developed that can identify the significant
variants (defined as non-synonymous amino acid changes) from a
region of DNA from the phased data in the 1000-genome data set.
This tool has been made available online
http://www.1000genomes.org/variation-pattern-finder. This tool
allows an investigator to download non-synonymous variation
delimited between specific coordinates. The downloaded files are
configured as individual genotypes, but the data is phased so the
haplotype information and the frequencies of specific halotypes in
different populations can be extracted.
[0153] The inventors' analysis of the 1000-genome data for the
individual human coding segments of the C, V D and J genes from the
heavy and light chains reveals that there is significant variation
in these segments. Individuals will usually have two different
heavy chain alleles and also different light chain alleles at both
kappa and lambda loci. The repertoire of antibodies that can be
generated from each allele will be different. This variation will
contribute to a better or differing immune response to certain
antigens.
[0154] Humanized mice that have hitherto been generated with
immunoglobulin heavy and light chain loci contain just one type of
immunoglobulin locus. Even if these mice contain a full human heavy
chain locus, the variation will be less than contained in a typical
human because only one set of C, V, D and J genes are available,
while a typical human would have two sets.
[0155] The inventors have devised ways to improve on this
limitation when constructing transgenic non-human vertebrates and
cells for human antibody and variable region production in
vivo.
[0156] Mice can be generated with two different loci, each
engineered to have a different repertoire of V, D and J segments.
This could be in a single mouse or two or more separate mouse
strains and would be analogous to or beyond the repertoire found in
a normal human. The engineering of such a mouse would go beyond the
repertoire described in humanized mice to date which only have one
set of alleles.
[0157] However, the inventors also realized that this also has
limitations, because the different loci would not normally interact
to shuffle V, D and J variants between loci. This same limitation
is also inherent in a human, thus this system does not utilize the
advantage of recombining variants in all combinations.
[0158] To go beyond the normal repertoire in humans and take
advantage of combinations of C, V, D and J variants the inventors
decided, in one embodiment, to provide these on the same chromosome
in cis. See FIG. 6. These loci would be characterized by having
more than the normal number of J, D or V genes. For example n=6 for
the J genes, but including one J6 variant and one J2 variant would
increase this to n=8. This could be combined with additional
variants for the D and V genes, for example. By detailed analysis
of the 1000-Genomes database, the inventors have devised a
collection of candidate polymorphic human variant gene segments,
eg, JH gene segments (eg, see the examples), that can be built into
the design of transgenic heavy and light chain loci in mice for
expressing increasingly diverse and new, synthetic repertoires of
human variable regions. Moreover, by utilizing naturally-occurring
human variant gene segments, as per embodiments of the invention,
this addresses compatibility with human patients since the
inventors analysis has drawn out candidate variants that are
naturally conserved and sometimes very prevalent amongst human
ethnic populations. Additionally this enables one to tailor the
configurations of the invention to provide for antibody-based drugs
that better address specific human ethnic populations.
[0159] In an example according to any configuration of the
invention, loci (and cells and vertebrates comprising these) are
provided in which gene segments from different human populations
are used. This is desirable to increase antibody gene diversity to
better address more diverse human patients. In an example, the gene
segments are from first and second different human populations
respectively, and thus the second gene segment is found in the
second human population, but not so (or rarely) in the first human
population. Rarely means, for example, that the gene segment is
found in 5, 4, 3, 2, or 1 or zero individuals in the first
population in the 1000 Genomes database. For example, the first
gene segment may be shown as present in a first population by
reference to Table 13 or 14 herein, the second gene segment may be
shown as present in the second population by reference to Table 13
and not in the first population. Optionally, the first gene segment
may also be shown as being present in the second population by
reference to Table 13 or 14.
[0160] In any configuration or aspect of the invention, where a V
gene segment is used, this may be used optionally with the native
leader sequence. For example, use of genomic DNA (eg, from BACs as
in the examples) will mean that the native leader will be used for
each V gene segment incorporated into the locus and genomes of the
invention. In an alternative, the skilled person may wish to inert
a non-native leader sequence together with one or more of the V
gene segments. Similarly, in any configuration or aspect of the
invention, where a V gene segment is used, this may be used
optionally with the native 5' UTR sequence. For example, use of
genomic DNA (eg, from BACs as in the examples) will mean that the
native 5' UTR sequence will be used for each V gene segment
incorporated into the locus and genomes of the invention. In an
alternative, the skilled person may wish to exclude the native 5'
UTR sequence.
[0161] The Present Invention Provides, in a First Configuration
[0162] (a) Superhuman Heavy Chain Gene Repertoires
[0163] A non-human vertebrate or vertebrate cell (optionally an ES
cell or antibody-producing cell) comprising a genome having a
superhuman immunoglobulin heavy chain human VH and/or D and/or J
gene repertoire.
[0164] In one aspect the cell of the invention is an embryonic stem
cell. For example, the ES cell is derived from the mouse C57BL/6N,
C57BL/6J, 129S5 or 129Sv strain. In one aspect the non-human
vertebrate is a rodent, suitably a mouse, and cells of the
invention, are rodent cells or ES cells, suitably mouse ES cells.
The ES cells of the present invention can be used to generate
animals using techniques well known in the art, which comprise
injection of the ES cell into a blastocyst followed by implantation
of chimaeric blastocystys into females to produce offspring which
can be bred and selected for homozygous recombinants having the
required insertion. In one aspect the invention relates to a
transgenic animal comprised of ES cell-derived tissue and host
embryo derived tissue. In one aspect the invention relates to
genetically-altered subsequent generation animals, which include
animals having a homozygous recombinants for the VDJ and/or VJ
regions.
[0165] The natural human immunoglobulin gene segment repertoire
consists of (see eg, www.imgt.org):--
[0166] VH: total--125; functional--41 DH: total--27; functional--23
JH: total--8; functional--6
[0167] Vk: total--77; functional--38 Jk: total--5;
functional--5
[0168] V lambda: total--75; functional--31
[0169] J lambda: total--7; functional--5
[0170] In one embodiment, the vertebrate or cell genome comprises a
transgenic immunoglobulin heavy chain locus comprising a plurality
of human immunoglobulin VH gene segments, one or more human D gene
segments and one or more human J gene segments, wherein the
plurality of VH gene segments consists of more than the natural
human repertoire of functional VH gene segments; optionally wherein
the genome is homozygous for said transgenic heavy chain locus.
[0171] In one embodiment of the vertebrate or cell, the VH gene
repertoire consists of a plurality of VH gene segments derived from
the genome sequence of a first human individual, supplemented with
one or more different VH gene segments derived from the genome
sequence of a second, different human individual. Optionally the D
and J segments are derived from the genome sequence of the first
human individual. Optionally the VH gene segments from the genome
sequence of the second individual are selected from the VH gene
segments listed in Table 1, 13 or 14. In this way, the locus
provides a superhuman repertoire of D gene segments.
[0172] Optionally the individuals are not related. Individuals are
"not related" in the context of any configuration or aspect of the
invention, for example, if one of the individuals does not appear
in a family tree of the other individual in the same generation or
going back one, two, three or four generations. Alternatively, are
not related, for example, if they do not share a common ancestor in
the present generation or going back one, two, three or four
generations.
[0173] In one embodiment of the vertebrate or cell, the transgenic
locus comprises more than 41 functional human VH gene segment
species, and thus more than the natural human functional
repertoire. Optionally the locus comprises at least 42, 43, 44, 45,
46, 47, 48, 49 or 50 functional human VH gene segment species (eg,
wherein the locus comprises the full functional VH repertoire of
said first individual supplemented with one or more VH gene
segments derived from the genome sequence of the second human
individual and optionally with one or more VH gene segments derived
from the genome sequence of a third human individual). In this way,
the locus provides a superhuman repertoire of VH gene segments that
is useful for generating a novel gene and antibody diversity for
use in therapeutic and tool antibody selection.
[0174] In one embodiment of the vertebrate or cell, the transgenic
locus comprises a first VH gene segment derived from the genome
sequence of the first individual and a second VH gene segment
derived from the genome sequence of the second individual, wherein
the second VH gene segment is a polymorphic variant of the first VH
gene segment. For example, the VH gene segments are polymorphic
variants of VH1-69 as illustrated in the examples below. Optionally
the locus comprises a further polymorphic variant of the first VH
gene segment (eg, a variant derived from the genome sequence of a
third human individual). In this way, the locus provides a
superhuman repertoire of VH gene segments.
[0175] In one embodiment of the vertebrate or cell, the genome
(alternatively or additionally to the superhuman VH diversity)
comprises a transgenic immunoglobulin heavy chain locus comprising
a plurality of human immunoglobulin VH gene segments, a plurality
of human D gene segments and one or more human J gene segments,
wherein the plurality of D gene segments consists of more than the
natural human repertoire of functional D gene segments. Optionally
the genome is homozygous for said transgenic heavy chain locus.
[0176] In one embodiment of the vertebrate or cell, the D gene
repertoire consists of a plurality of D gene segments derived from
the genome sequence of a (or said) first human individual,
supplemented with one or more different D gene segments derived
from the genome sequence of a (or said) second, different human
individual. Optionally the individuals are not related. Optionally
the J segments are derived from the genome sequence of the first
human individual. Optionally the D gene segments from the genome
sequence of the second individual are selected from the D gene
segments listed in Table 2, 13 or 14. In this way, the locus
provides a superhuman repertoire of D gene segments.
[0177] In one embodiment of the vertebrate or cell, the transgenic
locus comprises more than 23 functional human D gene segment
species; optionally wherein the locus comprises at least 24, 25,
26, 27, 28, 29, 30 or 31 functional human D gene segment species
(eg, wherein the locus comprises the full functional D repertoire
of said first individual supplemented with one or more D gene
segments derived from the genome sequence of the second human
individual and optionally with one or more D gene segments derived
from the genome sequence of a third human individual). In this way,
the locus provides a superhuman repertoire of D gene segments.
[0178] In one embodiment of the vertebrate or cell, the transgenic
locus comprises a first D gene segment derived from the genome
sequence of the first individual and a second D gene segment
derived from the genome sequence of the second individual, wherein
the second D gene segment is a polymorphic variant of the first D
gene segment. Optionally the locus comprises a further polymorphic
variant of the first D gene segment (eg, a variant derived from the
genome sequence of a third human individual). In this way, the
locus provides a superhuman repertoire of D gene segments.
[0179] In one embodiment of the vertebrate or cell (alternatively
or additionally to the superhuman VH and/or JH diversity), the
genome comprises a (or said) transgenic immunoglobulin heavy chain
locus comprising a plurality of human immunoglobulin VH gene
segments, one or more human D gene segments and a plurality of
human JH gene segments, wherein the plurality of J gene segments
consists of more than the natural human repertoire of functional J
gene segments; optionally wherein the genome is homozygous for said
transgenic heavy chain locus.
[0180] In one embodiment of the vertebrate or cell, the JH gene
repertoire consists of a plurality of J gene segments derived from
the genome sequence of a (or said) first human individual,
supplemented with one or more different J gene segments derived
from the genome sequence of a (or said) second, different human
individual. Optionally the individuals are not related.
[0181] Optionally D segments are derived from the genome sequence
of the first human individual. Optionally the J gene segments from
the genome sequence of the second individual are selected from the
J gene segments listed in Table 3 13 or 14. In this way, the locus
provides a superhuman repertoire of JH gene segments.
[0182] In one embodiment of the vertebrate or cell, the transgenic
locus comprises more than 6 functional human JH gene segment
segments. Optionally the locus comprises at least 7, 8, 9, 10, 11,
12, 13, 14, 15, or 16 functional human JH gene segments (eg,
wherein the locus comprises the full functional JH repertoire of
said first individual supplemented with one or more JH gene
segments derived from the genome sequence of the second human
individual and optionally with one or more JH gene segments derived
from the genome sequence of a third human individual). In this way,
the locus provides a superhuman repertoire of JH gene segments.
[0183] In one embodiment of the vertebrate or cell, the transgenic
locus comprises a first JH gene segment derived from the genome
sequence of the first individual and a second JH gene segment
derived from the genome sequence of the second individual, wherein
the second JH gene segment is a polymorphic variant of the first JH
gene segment. Optionally the locus comprises a further polymorphic
variant of the first JH gene segment (eg, a variant derived from
the genome sequence of a third human individual). In this way, the
locus provides a superhuman repertoire of JH gene segments.
[0184] (b) Superhuman Light Chain Gene Repertoires
[0185] The first configuration of the invention also
provides:--
[0186] A non-human vertebrate or vertebrate cell (optionally an ES
cell or antibody-producing cell) comprising a genome having a
superhuman immunoglobulin light chain human VL gene repertoire.
Optionally the vertebrate or cell comprises a heavy chain transgene
according to aspect (a) of the first configuration. Thus,
superhuman diversity is provided in both the heavy and light chain
immunoglobulin gene segments in the cell and vertebrate. For
example, the genome of the cell or vertebrate is homozygous for the
heavy and light chain transgenes and endogenous antibody expression
is inactivated. Such a vertebrate is useful for immunisation with a
predetermined antigen to produce one or more selected antibodies
that bind the antigen and have human variable regions resulting
from recombination within the superhuman gene segment repertoire.
This provides potentially for a novel antibody and gene sequence
space from which to select therapeutic, prophylactic and tool
antibodies.
[0187] In one embodiment of aspect (b) of the first configuration,
the vertebrate or cell genome comprises
[0188] (i) a transgenic immunoglobulin kappa light chain locus
comprising a plurality of human immunoglobulin VK gene segments and
one or more human J gene segments, wherein the plurality of VK gene
segments consists of more than the natural human repertoire of
functional VK gene segments; optionally wherein the genome is
homozygous for said transgenic kappa light chain locus; and/or
[0189] (ii) a transgenic immunoglobulin lambda light chain locus
comprising a plurality of human immunoglobulin VA gene segments and
one or more human J gene segments, wherein the plurality of VA gene
segments consists of more than the natural human repertoire of
functional VA gene segments; optionally wherein the genome is
homozygous for said transgenic lambda light chain locus.
[0190] In this way, the locus provides a superhuman repertoire of
VL gene segments. In one embodiment of the vertebrate or cell,
[0191] (i) the VK gene repertoire consists of a plurality of VK
gene segments derived from the genome sequence of a first human
individual, supplemented with one or more VK gene segments derived
from the genome sequence of a second, different human individual;
optionally wherein the individuals are not related; optionally
wherein the J segments are derived from the genome sequence of the
first human individual; and optionally wherein the VK gene segments
from the genome sequence of the second individual are selected from
the VK gene segments listed in Table 4, 13 or 14; and
[0192] (i) the VA gene repertoire consists of a plurality of VA
gene segments derived from the genome sequence of a first human
individual, supplemented with one or more VA gene segments derived
from the genome sequence of a second, different human individual;
optionally wherein the individuals are not related; optionally
wherein the J segments are derived from the genome sequence of the
first human individual; and optionally wherein the VA gene segments
from the genome sequence of the second individual are selected from
the VA gene segments listed in Table 5, 13 or 14.
[0193] In this way, the locus provides a superhuman repertoire of
VL gene segments.
[0194] In one embodiment of the vertebrate or cell, [0195] the
kappa light transgenic locus comprises more than 38 functional
human VK gene segment species; optionally wherein the locus
comprises at least 39, 40, 41, 42, 43, 44, 45, 46, 47 or 48
functional human VK gene segment species (eg, wherein the locus
comprises the full functional VK repertoire of said first
individual supplemented with one or more VK gene segments derived
from the genome sequence of the second human individual and
optionally with one or more VK gene segments derived from the
genome sequence of a third human individual); and [0196] the lambda
light transgenic locus comprises more than 31 functional human VA
gene segment species; optionally wherein the locus comprises at
least 32, 33, 34, 35, 36, 37, 38, 39, 40 or 41 functional human VA
gene segment species (eg, wherein the locus comprises the full
functional VA repertoire of said first individual supplemented with
one or more VA gene segments derived from the genome sequence of
the second human individual and optionally with one or more VA gene
segments derived from the genome sequence of a third human
individual).
[0197] In this way, the locus provides a superhuman repertoire of
VL gene segments.
[0198] In one embodiment of the vertebrate or cell, [0199] the
kappa light transgenic locus comprises a first VK gene segment
derived from the genome sequence of the first individual and a
second VK gene segment derived from the genome sequence of the
second individual, wherein the second VK gene segment is a
polymorphic variant of the first VK gene segment; optionally
wherein the locus comprises a further polymorphic variant of the
first VK gene segment (eg, a variant derived from the genome
sequence of a third human individual); and [0200] the lambda light
transgenic locus comprises a first VA gene segment derived from the
genome sequence of the first individual and a second VA gene
segment derived from the genome sequence of the second individual,
wherein the second VA gene segment is a polymorphic variant of the
first VA gene segment; optionally wherein the locus comprises a
further polymorphic variant of the first VA gene segment (eg, a
variant derived from the genome sequence of a third human
individual).
[0201] In this way, the locus provides a superhuman repertoire of
VL gene segments.
[0202] In one embodiment of the vertebrate or cell, the genome
comprises a (or said) transgenic immunoglobulin light chain locus
comprising a plurality of human immunoglobulin VL gene segments and
a plurality of human JL gene segments, wherein the plurality of J
gene segments consists of more than the natural human repertoire of
functional J gene segments; optionally wherein the genome is
homozygous for said transgenic heavy chain locus.
[0203] In one embodiment of the vertebrate or cell,
[0204] (i) the JK gene repertoire consists of a plurality of JK
gene segments derived from the genome sequence of a (or said) first
human individual, supplemented with one or more JK gene segments
derived from the genome sequence of a (or said) second, different
human individual; optionally wherein the individuals are not
related; optionally wherein the VK segments are derived from the
genome sequence of the first human individual; optionally wherein
the JK gene segments from the genome sequence of the second
individual are selected from the JK gene segments listed in Table
6, 13 or 14; and
[0205] (ii) the JK gene repertoire consists of a plurality of
J.lamda. gene segments derived from the genome sequence of a (or
said) first human individual, supplemented with one or more
J.lamda. gene segments derived from the genome sequence of a (or
said) second, different human individual; optionally wherein the
individuals are not related; optionally wherein the VA segments are
derived from the genome sequence of the first human individual;
optionally wherein the J.lamda. gene segments from the genome
sequence of the second individual are selected from the J.lamda.
gene segments listed in Table 7, 13 or 14.
[0206] In this way, the locus provides a superhuman repertoire of
JL gene segments. In one embodiment of the vertebrate or cell,
[0207] (i) the transgenic light chain locus comprises more than 5
functional human JK gene segment species; optionally wherein the
locus comprises at least 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15
functional human JK gene segment species (eg, wherein the locus
comprises the full functional JK repertoire of said first
individual supplemented with one or more JK gene segments derived
from the genome sequence of the second human individual and
optionally with one or more JK gene segments derived from the
genome sequence of a third human individual); and/or
[0208] (i) the transgenic light chain locus comprises more than 5
functional human J.lamda. gene segment species; optionally wherein
the locus comprises at least 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15
functional human J.lamda. gene segment species (eg, wherein the
locus comprises the full functional J.lamda. repertoire of said
first individual supplemented with one or more J.lamda. gene
segments derived from the genome sequence of the second human
individual and optionally with one or more J.lamda. gene segments
derived from the genome sequence of a third human individual).
[0209] In this way, the locus provides a superhuman repertoire of
JL gene segments.
[0210] In one embodiment of the vertebrate or cell,
[0211] (i) the kappa light transgenic locus comprises a first JK
gene segment derived from the genome sequence of the first
individual and a second JK gene segment derived from the genome
sequence of the second individual, wherein the second JK gene
segment is a polymorphic variant of the first JK gene segment;
optionally wherein the locus comprises a further polymorphic
variant of the first JK gene segment (eg, a variant derived from
the genome sequence of a third human individual); and
[0212] (ii) the lambda light transgenic locus comprises a first
J.lamda. gene segment derived from the genome sequence of the first
individual and a second J.lamda. gene segment derived from the
genome sequence of the second individual, wherein the second JK
gene segment is a polymorphic variant of the first J.lamda. gene
segment; optionally wherein the locus comprises a further
polymorphic variant of the first J.lamda. gene segment (eg, a
variant derived from the genome sequence of a third human
individual).
[0213] In this way, the locus provides a superhuman repertoire of
JL gene segments. Further aspects of the first configuration are
described below.
[0214] The Present Invention Provides, in a Second
Configuration
[0215] A library of antibody-producing transgenic cells whose
genomes collectively encode a repertoire of antibodies, wherein
[0216] (a) a first transgenic cell expresses a first antibody
having a chain (eg, heavy chain) encoded by a first immunoglobulin
gene, the gene comprising a first variable domain nucleotide
sequence produced following recombination of a first human
unrearranged immunoglobulin gene segment (eg, a VH);
[0217] (b) a second transgenic cell expresses a second antibody
having a chain (eg, a heavy chain) encoded by a second
immunoglobulin gene, the second gene comprising a second variable
domain nucleotide sequence produced following recombination of a
second human unrearranged immunoglobulin gene segment (eg, a VH),
the first and second antibodies being non-identical;
[0218] (c) the first and second gene segments are different and
derived from the genome sequences of first and second human
individuals respectively, wherein the individuals are different;
and optionally not related;
[0219] (d) wherein the cells are non-human vertebrate (eg, mouse or
rat) cells (eg, B-cells or hybridomas).
[0220] In one embodiment, the library is provided in vitro. In
another embodiment, the library is provided in vivo by one or a
plurality of transgenic non-human vertebrates. For example, the or
each vertebrate is according to any aspect of the first
configuration of the invention.
[0221] In one embodiment, the library encodes an antibody
repertoire of from 10 to 109 antibodies, for example, 10, 20, 30,
40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to
107; or 10, 20, 30, 40, 50, 100 or 1000 to 106; or 10, 20, 30, 40,
50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104
antibodies. In an example, library encodes an antibody repertoire
of at least 103, 104, 105, 106, 107, 108, 109, or 1010
antibodies.
[0222] The first variable domain nucleotide sequence is produced
following recombination of the first human unrearranged
immunoglobulin gene segment with one or more other immunoglobulin
gene segments (for example, human immunoglobulin gene segments).
For example, where the first gene segment is a VH, the first
variable domain nucleotide sequence (a VH domain) is produced
following recombination of the VH with a human D and JH segments in
vivo, optionally with somatic hypermutation, in the first
transgenic cell or an ancestor thereof. For example, where the
first gene segment is a VL, the first variable domain nucleotide
sequence (a VL domain) is produced following recombination of the
VL with a human JL segment in vivo, optionally with somatic
hypermutation, in the first transgenic cell or an ancestor
thereof.
[0223] The second variable domain nucleotide sequence is produced
following recombination of the second human unrearranged
immunoglobulin gene segment with one or more other immunoglobulin
gene segments (for example, human immunoglobulin gene segments).
For example, where the second gene segment is a VH, the second
variable domain nucleotide sequence (a VH domain) is produced
following recombination of the VH with a human D and JH segments in
vivo, optionally with somatic hypermutation, in the second
transgenic cell or an ancestor thereof. For example, where the
second gene segment is a VL, the second variable domain nucleotide
sequence (a VL domain) is produced following recombination of the
VL with a human JL segment in vivo, optionally with somatic
hypermutation, in the second transgenic cell or an ancestor
thereof.
[0224] The first and second gene segments are respectively derived
from genome sequences of first and second human individuals. In one
example, such a gene segment is isolated or cloned from a sample
cell taken from said individual using standard molecular biology
techniques as know to the skilled person. The sequence of the gene
segment may be mutated (eg, by the introduction of up to 5, 6, 7,
8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes) prior to use in
the present invention. In another example, a gene segment is
derived by identifying a candidate human immunoglobulin gene
segment in a database (see guidance below) and a nucleotide
sequence encoding a gene segment for use in the present invention
is made by reference (eg, to be identical or a mutant with up to 5,
6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes to the
reference sequence) to the database sequence. The skilled person
will be aware of methods of obtaining nucleotide sequences by
reference to databases or by obtaining from cellular samples.
[0225] In one embodiment of the vertebrate, cell or library of any
configuration of the invention, the first and second human
individuals are members of first and second ethnic populations
respectively, wherein the populations are different. This,
therefore, provides for superhuman gene diversity in transgenic
loci, cells and vertebrates as per the invention.
[0226] Human Populations
[0227] Optionally the ethnic populations are selected from those
identified in the 1000 Genomes Project of database. In this
respect, see Table 8 which provides details of the ethnic
populations on which the 1000 Genomes database is based.
[0228] N A Rosenberg et al (Science 20 Dec. 2002: vol. 298 no. 5602
2342-2343) studied the genetic structure of human populations of
differing geographical ancestry. In total, 52 populations were
sampled, these being populations with:
[0229] African Ancestry
[0230] (Mbuti Pygmies, Biaka Pygmies, San peoples, and speakers of
Niger-Kordofanian languages (Bantu, Yoruba or Mandenka
populations),
[0231] Eurasian Ancestry
[0232] (European ancestry (Orcadian, Adygei, Basque, French,
Russians, Italians, Sardinian, Tuscan), Middle Eastern ancestry
(Mozabite, Bedouin, Druze, Palestinians),
[0233] Central/South Asian ancestry (Balochl, Brahul, Makrani,
Sindhi, Pathan, Burusho, Hazara, Uygur, Kalash)),
[0234] East Asian Ancestry
[0235] (Han, Dal, Daur, Hezhen, Lahu, Miao, Orogen, She, Tujia, Tu,
Xibo, Yi, Mongola, Naxi, Cambodian, Japanese, Yakut), Oceanic
ancestry (Melanesian, Papuan); or
[0236] Americas Ancestry
[0237] (Karitiana, Surui, Colombian, Maya, Pima).
[0238] The International HapMap Project, Nature, 2003 December 18;
426(6968):789-96, discloses that goal of the HapMap Project: to
determine the common patterns of DNA sequence variation in the
human genome by determining the genotypes of one million or more
sequence variants, their frequencies and the degree of association
between them in DNA samples from populations with ancestry from
parts of Africa, Asia and Europe. The relevant human populations of
differing geographical ancestry include Yoruba, Japanese, Chinese,
Northern European and Western European populations. More
specifically:--
[0239] Utah population with Northern or Western European ancestry
(samples collected in 1980 by the Centre d'Etude du Polymorphisme
Humain (CEPH)); population with ancestry of Yoruba people from
Ibadan, Nigeria; population with Japanese ancestry; and population
with ancestry of Han Chinese from China.
[0240] The authors, citing earlier publications, suggest that
ancestral geography is a reasonable basis for sampling human
populations.
[0241] A suitable sample of human populations from which the
populations used in the present invention are selected is as
follows:--
[0242] (a) European Ancestry
[0243] (b) Northern European ancestry; Western European ancestry;
Toscani ancestry; British ancestry, Finnish ancestry or Iberian
ancestry.
[0244] (c) More specifically, population of Utah residents with
Northern and/or Western European ancestry; Toscani population in
Italia; British population in England and/or Scotland; Finnish
population in Finland; or Iberian population in Spain.
[0245] (a) East Asian Ancestry
[0246] (b) Japanese ancestry; Chinese ancestry or Vietnamese
ancestry.
[0247] (c) More specifically, Japanese population in Tokyo, Japan;
Han Chinese population in Beijing, China; Chinese Dai population in
Xishuangbanna; Kinh population in Ho Chi Minh City, Vietnam; or
Chinese population in Denver, Colo., USA.
[0248] (a) West African Ancestry
[0249] (b) Yoruba ancestry; Luhya ancestry; Gambian ancestry; or
Malawian ancestry.
[0250] (c) More specifically, Yoruba population in Ibadan, Nigeria;
Luhya population in Webuye, Kenya; Gambian population in Western
Division, The Gambia; or Malawian population in Blantyre,
Malawi.
[0251] (a) Population of the Americas
[0252] (b) Native American ancestry; Afro-Caribbean ancestry;
Mexican ancestry; Puerto Rican ancestry; Columbian ancestry; or
Peruvian ancestry.
[0253] (c) More specifically, population of African Ancestry in
Southwest US; population of African American in Jackson, Miss.;
population of African Caribbean in Barbados; population of Mexican
Ancestry in Los Angeles, Calif.; population of Puerto Rican in
Puerto Rico; population of Colombian in Medellin, Colombia; or
population of Peruvian in Lima, Peru.
[0254] (a) South Asian Ancestry
[0255] (b) Ahom ancestry; Kayadtha ancestry; Reddy ancestry;
Maratha; or Punjabi ancestry.
[0256] (c) More specifically, Ahom population in the State of
Assam, India; Kayadtha population in Calcutta, India; Reddy
population in Hyderabad, India; Maratha population in Bombay,
India; or Punjabi population in Lahore, Pakistan.
[0257] In any configuration of the invention, in one embodiment,
each human population is selected from a population marked "(a)"
above.
[0258] In any configuration of the invention, in another
embodiment, each human population is selected from a population
marked "(b)" above.
[0259] In any configuration of the invention, in another
embodiment, each human population is selected from a population
marked "(c)" above.
[0260] In one embodiment of the library of the vertebrate, cell or
library of the invention, the first and second ethnic populations
are selected from the group consisting of an ethnic population with
European ancestry, an ethnic population with East Asian, an ethnic
population with West African ancestry, an ethnic population with
Americas ancestry and an ethnic population with South Asian
ancestry.
[0261] In one embodiment of the library of the vertebrate, cell or
library of the invention, the first and second ethnic populations
are selected from the group consisting of an ethnic population with
Northern European ancestry; or an ethnic population with Western
European ancestry; or an ethnic population with Toscani ancestry;
or an ethnic population with British ancestry; or an ethnic
population with Icelandic ancestry; or an ethnic population with
Finnish ancestry; or an ethnic population with Iberian ancestry; or
an ethnic population with Japanese ancestry; or an ethnic
population with Chinese ancestry; or an ethnic population
Vietnamese ancestry; or an ethnic population with Yoruba ancestry;
or an ethnic population with Luhya ancestry; or an ethnic
population with Gambian ancestry; or an ethnic population with
Malawian ancestry; or an ethnic population with Native American
ancestry; or an ethnic population with Afro-Caribbean ancestry; or
an ethnic population with Mexican ancestry; or an ethnic population
with Puerto Rican ancestry; or an ethnic population with Columbian
ancestry; or an ethnic population with Peruvian ancestry; or an
ethnic population with Ahom ancestry; or an ethnic population with
Kayadtha ancestry; or an ethnic population with Reddy ancestry; or
an ethnic population with Maratha; or an ethnic population with
Punjabi ancestry.
[0262] In one embodiment of any configuration of the vertebrate,
cell or library of the invention, the human immunoglobulin gene
segment derived from the genome sequence of the second individual
is low-frequency (optionally rare) within the second ethnic
population. Optionally human immunoglobulin gene segment has a
Minor Allele Frequency (MAF) (cumulative frequency) of between
0.5%-5%, optionally less than 0.5%, in the second human population,
eg, as in the 1000 Genomes database.
[0263] In one embodiment of any configuration of the vertebrate,
cell or library of the invention, the first variable region
nucleotide sequence is produced by recombination of the first human
immunoglobulin gene segment with a first J gene segment and
optionally a first D gene segment, wherein the first human
immunoglobulin gene segment is a V gene segment and the V, D and J
segments are derived from the first human population, optionally
from the genome of one individual of the first human
population.
[0264] In one embodiment of the library of the vertebrate, cell or
library of the invention, the second variable region nucleotide
sequence is produced by recombination of the second human
immunoglobulin gene segment with a second J gene segment and
optionally a second D gene segment, wherein the second human
immunoglobulin gene segment is a V gene segment derived from the
second population and the D and/or J segments are derived from the
first human population, optionally the D and J gene segments being
from the genome of one individual of the first human
population.
[0265] In one embodiment of the library of the vertebrate, cell or
library of the invention, all of the D and J segments that have
been recombined with the first and second V gene segments are D and
J segments derived from the first human population, optionally the
D and J gene segments being from the genome of one individual of
the first human population.
[0266] In one embodiment of the library, the second human
immunoglobulin gene segment is a polymorphic variant of the first
human immunoglobulin gene segment; optionally wherein the second
gene segment is selected from the group consisting of a gene
segment in any of Tables 1 to 7 and 9 to 14 (eg, selected from
Table 13 or 14).
[0267] In one embodiment of the library, the first and second human
immunoglobulin gene segments are both (i) VH gene segments; (ii) D
segments; (iii) J segments (optionally both JH segments, both JK
segments or both J segments); (iv) constant regions (optionally
both a gamma constant region, optionally both a C gamma-1 constant
region); (v) CH1 regions; (vi) CH2 regions; or (vii) CH3
regions.
[0268] The library is, for example, a naive and optionally has a
library size of from 10 or 102 to 109 cells. For example, from 10,
20, 30, 40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or
1000 to 107; or 10, 20, 30, 40, 50, 100 or 1000 to 10 s; or 10, 20,
30, 40, 50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000
to 104 cells.
[0269] The library has, for example, been selected against a
predetermined antigen and optionally has a library size of from 10
or 102 to 109 cells. For example, from 10, 20, 30, 40, 50, 100 or
1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to 107; or 10, 20,
30, 40, 50, 100 or 1000 to 10 s; or 10, 20, 30, 40, 50, 100 or 1000
to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104 cells.
[0270] In one embodiment of the library of the invention, said
first and second cells are progeny of first and second ancestor
non-human vertebrate cells respectively, wherein the first ancestor
cell comprises a genome comprising said first human immunoglobulin
gene segment; and the second ancestor cell comprises a genome
comprising said second human immunoglobulin gene segment.
[0271] The invention further provides a library of
antibody-producing transgenic cells whose genomes collectively
encode a repertoire of antibodies, wherein the library comprises
the first and second ancestor cells described above.
[0272] The invention further provides a library of hybridoma cells
produced by fusion of the library of the invention (eg, a B-cell
library) with fusion partner cells and optionally has a library
size of from 10 or 102 to 109 cells. For example, from 10, 20, 30,
40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to
107; or 10, 20, 30, 40, 50, 100 or 1000 to 10 s; or 10, 20, 30, 40,
50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104
cells. Production of hybridomas is well known to the skilled
person. Examples of fusion partners are SP2/0-g14 (obtainable from
ECACC), P3XS3-Ag8.S53 (obtainable from LGC Standards; CRL-1580),
NS1 and NS0 cells. PEG fusion or electrofusion can be carried out,
as is conventional.
[0273] The Invention Provides, in a Third Configuration:--
[0274] An isolated antibody having
[0275] (a) a heavy chain encoded by a nucleotide sequence produced
following recombination in a transgenic non-human vertebrate cell
of an unrearranged human immunoglobulin V gene segment with a human
D and human J segment, optionally with affinity maturation in said
cell, wherein one of the gene segments (eg, VH) is derived from the
genome of an individual from a first human ethnic population; and
the other two gene segments (eg, D and JH) are derived from the
genome of an individual from a second (eg, a second and third
respectively), different, human ethnic population, and wherein the
antibody comprises heavy chain constant regions (eg, C gamma) of
said non-human vertebrate (eg, rodent, mouse or rat heavy chain
constant regions); and/or
[0276] (b) a light chain encoded by a nucleotide sequence produced
following recombination in a transgenic non-human vertebrate cell
of an unrearranged human immunoglobulin V gene segment with a human
J segment, optionally with affinity maturation in said cell,
wherein one of the gene segments (eg, VL) is derived from the
genome of an individual from a first human ethnic population
(optionally the same as the first population in (a)); and the other
gene segment (eg, JL) is derived from the genome of an individual
from a second, different, human ethnic population (optionally the
same as the second population in (a)), and wherein the antibody
comprises light chain constant regions of said non-human vertebrate
(eg, rodent, mouse or rat heavy light constant regions);
[0277] (c) Optionally wherein each variable domain of the antibody
is a human variable domain.
[0278] (d) Optionally wherein the heavy chain constant regions are
mu- or gamma-type constant regions.
[0279] The invention also provides an isolated nucleotide sequence
encoding the antibody of the third configuration, optionally
wherein the sequence is provided in an antibody expression vector,
optionally in a host cell. Suitable vectors are mammalian
expression vectors (eg, CHO cell vectors or HEK293 cell vectors),
yeast vectors (eg, a vector for expression in Pichia pastoris, or a
bacterial expression vector, eg, a vector for E. coli
expression.
[0280] The invention also provides a method of producing a human
antibody, the method comprising replacing the non-human vertebrate
constant regions of the antibody of the third configuration with
human antibody constant regions (eg, a C variant disclosed in table
13 or 18). The skilled person will be aware of standard molecular
biology techniques to do this. For example, see Harlow, E. &
Lane, D. 1998, 5th edition, Antibodies: A Laboratory Manual, Cold
Spring Harbor Lab. Press, Plainview, N.Y.; and Pasqualini and Arap,
Proceedings of the National Academy of Sciences (2004) 101:257-259
for standard immunisation. Joining of the variable regions of an
antibody to a human constant region can be effected by techniques
readily available in the art, such as using conventional
recombinant DNA and RNA technology as will be apparent to the
skilled person. See e.g. Sambrook, J and Russell, D. (2001, 3'd
edition) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Lab. Press, Plainview, N.Y.).
[0281] In one embodiment, the method comprises further making a
mutant or derivative of the antibody.
[0282] The invention also provides a pharmaceutical composition
comprising an antibody according to the third configuration, or a
human antibody of the invention and a diluent, excipient or
carrier; optionally wherein the composition is provided in a
container connected to an IV needle or syringe or in an IV bag.
[0283] The invention also provides an antibody-producing cell (eg,
a mammalian cell, eg, CHO or HEK293; a yeast cell, eg, P pastoris;
a bacterial cell, eg, E coli; a B-cell; or a hybridoma) that
expresses the second antibody of the third configuration or the
isolated antibody of the invention.
[0284] The First Configuration of the Invention Also
Provides:--
[0285] A non-human vertebrate or vertebrate cell (optionally an ES
cell or antibody-producing cell) whose genome comprises a
transgenic immunoglobulin locus (eg, a heavy chain locus or a light
chain locus), said locus comprising immunoglobulin gene segments
according to the first and second human immunoglobulin gene
segments (optionally V segments) described above in connection with
the third configuration. The gene segments are operably connected
upstream of an immunoglobulin constant region; optionally wherein
the genome is homozygous for said transgenic immunoglobulin
locus.
[0286] Optionally the immunoglobulin locus comprises more than the
natural human complement of functional V gene segments; and/or
[0287] Optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional D gene segments;
and/or
[0288] Optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional J gene
segments.
[0289] In this way, a superhuman immunoglobulin gene repertoire is
provided in a transgenic non-human vertebrate or vertebrate cell
according to the invention.
[0290] The First Configuration Also Provides:--
[0291] A transgenic non-human vertebrate (eg, a mouse or rat) or
vertebrate cell (optionally an ES cell or antibody-producing cell)
whose genome comprises a transgenic immunoglobulin locus comprising
a plurality of human immunoglobulin gene segments operably
connected upstream of a non-human vertebrate constant region for
the production of a repertoire of chimaeric antibodies, or
chimaeric light or heavy chains, having a non-human vertebrate
constant region and a human variable region; wherein the transgenic
locus comprises one or more human immunoglobulin V gene segments,
one or more human J gene segments and optionally one or more human
D gene segments, a first (optionally a V segment) of said gene
segments and a second (optionally a V segment) of said gene
segments being different and derived from the genomes of first and
second human individuals respectively, wherein the individuals are
different; and optionally not related;
[0292] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional V gene segments;
and/or
[0293] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional D gene segments;
and/or
[0294] optionally wherein the immunoglobulin locus comprises more
than the natural human complement of functional J gene
segments.
[0295] In this way, a superhuman immunoglobulin gene repertoire is
provided in a transgenic non-human vertebrate or vertebrate cell
according to the invention.
[0296] The First Configuration Also Provides:--
[0297] A transgenic non-human vertebrate (eg, a mouse or rat) or
vertebrate cell (optionally an ES cell or antibody-producing cell)
whose genome comprises first and second transgenic immunoglobulin
loci, each locus comprising a plurality of human immunoglobulin
gene segments operably connected upstream of a non-human vertebrate
constant region for the production of a repertoire of chimaeric
antibodies, or chimaeric light or heavy chains, having a non-human
vertebrate constant region and a human variable region;
[0298] wherein (i) the first transgenic locus comprises one or more
human immunoglobulin V gene segments, one or more human J gene
segments and optionally one or more human D gene segments, (ii) the
second transgenic locus comprises one or more human immunoglobulin
V gene segments, one or more human J gene segments and optionally
one or more human D gene segments; and (iii) wherein a first
(optionally a V) gene segment of said first locus and a second
(optionally a V) gene segment of said second gene locus are
different and derived from the genomes of first and second human
individuals respectively, wherein the individuals are different;
and optionally not related;
[0299] optionally wherein the first and second loci are on
different chromosomes (optionally chromosomes with the same
chromosome number) in said genome;
[0300] optionally wherein each immunoglobulin locus comprises more
than the natural human complement of functional V gene segments;
and/or
[0301] optionally wherein each immunoglobulin locus comprises more
than the natural human complement of functional D gene segments;
and/or
[0302] optionally wherein each immunoglobulin locus comprises more
than the natural human complement of functional J gene
segments.
[0303] In this way, a superhuman immunoglobulin gene repertoire is
provided in a transgenic non-human vertebrate or vertebrate cell
according to the invention.
[0304] In these embodiments of the first configuration, the
immunoglobulin gene segments are optionally as described for the
third configuration.
[0305] In these embodiments of the first configuration, the genome
optionally comprises a third immunoglobulin gene segment
(optionally a V segment), the third gene segment being derived from
a human individual that is different from the individual from which
the first (and optionally also the second) gene segment is derived;
optionally wherein the first, second and third gene segments are
polymorphic variants of a human immunoglobulin gene segment (eg,
VH1-69--see the examples for further description).
[0306] In these embodiments of the first configuration, the genome
of the vertebrate or cell is optionally homozygous for the first,
second and optional third gene segment, wherein a copy of the
first, second and optional third gene segments are provided
together on the same chromosome operably connected upstream of a
common non-human vertebrate constant region.
[0307] For example, each first, second and optional third gene
segment is a V gene segment.
[0308] In one example, the library of the invention is provided by
a collection of non-human vertebrates (optionally a collection of
rodents, mice or rats); optionally, wherein a first member of said
collection produces said first antibody but not said second
antibody, and a second member of the collection produces said
second antibody (but optionally not said first antibody). It is
therefore contemplated to make non-human vertebrates where
different human genomes have been used as a source for building the
transgenic loci in the vertebrates. For example, a first vertebrate
comprises a transgenic heavy chain locus having gene segments only
from a first (and optionally a second) human population or
individual; a second vertebrate comprises a transgenic heavy chain
locus having gene segments only from a third (and optionally a
fourth) human population or individual; and optionally third and
more vertebrates can be built similarly based on unique or
overlapping human population genomes. However, when provided as a
mixed population of transgenic vertebrates, the mixed population
provides a collective pool of human immunoglobulin genes that is
greater than found in a natural human repertoire. This is useful to
extend the antibody and gene sequence space beyond those possible
with prior transgenic mice and rats bearing human immunoglobulin
loci. As explained above, these have been based on a single human
genome.
[0309] In one embodiment, the collection of non-human vertebrates
bear human immunoglobulin genes confined to human populations that
are together grouped under the same population genus "(a)"
mentioned above. This provides for a gene repertoire that is biased
to producing human antibody variable regions prevalent in the
population genus (a) and thus useful for generating antibody
therapeutics/prophylactics for members of said population.
Alternatively, where gene segments from different human populations
are provided in a single transgene according to the invention (not
necessarily in a collection of vertebrates), the different human
populations are for example together grouped under the same
population genus "(a)" mentioned above.
[0310] The invention also provides a repertoire of antibodies
expressed from a library of cells according to the invention.
[0311] In the non-human vertebrate or cell of any configuration of
the invention, the constant region of the transgenic locus is, in
one example, an endogenous constant region of said vertebrate (eg,
endogenous mouse or rat constant region, eg, from the same strain
of mouse or rat as the non-human vertebrate itself).
[0312] The invention also provides a method of constructing a cell
(eg, an ES cell) according to the invention, the method
comprising
[0313] (a) identifying functional V and J (and optionally D) gene
segments of the genome sequence of a (or said) first human
individual;
[0314] (b) identifying one or more functional V and/or D and/or J
gene segments of the genome sequence of a (or said) second human
individual, wherein these additional gene segments are not found in
the genome sequence of the first individual;
[0315] (c) and constructing a transgenic immunoglobulin locus in
the cell, wherein the gene segments of (a) and (b) are provided in
the locus operably connected upstream of a constant region.
[0316] Optionally the cell comprises a heavy chain locus
constructed according to steps (a) to (c) and/or a light chain
locus (kappa and/or lambda loci) constructed according to steps (a)
to (c).
[0317] Optionally the cell is homozygous for the or each transgenic
locus; optionally wherein antibody expression from loci endogenous
to said cell has been inactivated. This is useful for confining the
functional antibody gene repertoire, and thus antibody production,
to antibodies bearing human variable regions.
[0318] Optionally the gene segment(s) in step (b) are identified
from an immunoglobulin gene database selected from the 1000
Genomes, Ensembl, Genbank and IMGT databases.
[0319] Optionally the first and second human individuals are
members of first and second ethnic populations respectively,
wherein the populations are different, optionally wherein the human
immunoglobulin gene segment derived from the genome sequence of the
second individual is low-frequency (optionally rare) within the
second ethnic population.
[0320] The invention also provides a method of making a transgenic
non-human vertebrate (eg, a mouse or rat), the method
comprising
[0321] (a) constructing an ES cell (eg, a mouse C57BL/6N, C57BL/6J,
129S5 or 129Sv strain ES cell) by carrying out the method
above;
[0322] (b) injecting the ES cell into a donor non-human vertebrate
blastocyst (eg, a mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain
blastocyst);
[0323] (c) implanting the blastocyst into a foster non-human
vertebrate mother (eg, a C57BL/6N, C57BL/6J, 129S5 or 129Sv strain
mouse); and
[0324] (d) obtaining a child from said mother, wherein the child
genome comprises a transgenic immunoglobulin locus.
[0325] The invention provides a transgenic non-human vertebrate
(eg, a mouse or rat) made by the method or a progeny thereof. The
invention also provides a population of such non-human
vertebrates.
[0326] Microinjection of ES cells into blastocysts and generation
of transgenic mice thereafter are conventional practices in the
state of the art, and the skilled person is aware of techniques
useful to effect this. C57BL/6N, C57BL/6J, 129S5 or 129Sv mouse
strains and ES cells are readily and publicly available.
[0327] The invention also provides a method of isolating an
antibody that binds a predetermined antigen (eg, a bacterial or
viral pathogen antigen), the method comprising
[0328] (a) providing a vertebrate (optionally a mouse or rat)
according to the invention;
[0329] (b) immunising (eg, using a standard prime-boost method)
said vertebrate with said antigen (optionally wherein the antigen
is an antigen of an infectious disease pathogen);
[0330] (c) removing B lymphocytes from the vertebrate and selecting
one or more B lymphocytes expressing antibodies that bind to the
antigen;
[0331] (d) optionally immortalising said selected B lymphocytes or
progeny thereof, optionally by producing hybridomas therefrom;
and
[0332] (e) isolating an antibody (eg, and IgG-type antibody)
expressed by the B lymphocytes; and
[0333] (f) optionally producing a derivative or variant of the
antibody.
[0334] This method optionally further comprises after step (e) the
step of isolating from said B lymphocytes nucleic acid encoding
said antibody that binds said antigen; optionally exchanging the
heavy chain constant region nucleotide sequence of the antibody
with a nucleotide sequence encoding a human or humanised heavy
chain constant region and optionally affinity maturing the variable
region of said antibody; and optionally inserting said nucleic acid
into an expression vector and optionally a host.
[0335] Bioinformatics Analysis & Selection of Immunoglobulin
Gene Segments
[0336] See also the discussion on variation analysis above.
[0337] The skilled person will know of sources of human antibody
gene sequences, such as IMGT (www.imgt.org), GenBank
(www.ncbi.nlm.nih.gov/genbank) Bioinformatics tools for database
manipulation are also readily available and known to the skilled
person, eg, as publicly available from the 1000 Genomes Project/EBI
(www.1000genomes.org)
[0338] As a source of antibody gene segment sequences, the skilled
person will also be aware of the following available databases and
resources (including updates thereof):--
[0339] 1.1. The Kabat Database (G. Johnson and T. T. Wu, 2002;
http://www.kabatdatabase.com). Created by E. A. Kabat and T. T. Wu
in 1966, the Kabat database publishes aligned sequences of
antibodies, T-cell receptors, major histocompatibility complex
(MHC) class I and II molecules, and other proteins of immunological
interest. A searchable interface is provided by the SeqhuntII tool,
and a range of utilities is available for sequence alignment,
sequence subgroup classification, and the generation of variability
plots. See also Kabat, E. A., Wu, T. T., Perry, H., Gottesman, K.,
and Foeller, C. (1991) Sequences of Proteins of Immunological
Interest, 5th ed., NIH Publication No. 91-3242, Bethesda, Md.,
which is incorporated herein by reference, in particular with
reference to human gene segments for use in the present
invention.
[0340] 1.2. KabatMan (A. C. R. Martin, 2002;
http://www.bioinf.org.uk/abs/simkab.html). This is a web interface
to make simple queries to the Kabat sequence database.
[0341] 1.3. IMGT, the International ImMunoGeneTics Information
System.RTM.; M.-P. Lefranc, 2002; http://imgt.cines.fr). IMGT is an
integrated information system that specializes in antibodies, T
cell receptors, and MHC molecules of all vertebrate species. It
provides a common portal to standardized data that include
nucleotide and protein sequences, oligonucleotide primers, gene
maps, genetic polymorphisms, specificities, and two-dimensional
(2D) and three-dimensional (3D) structures. IMGT includes three
sequence databases (IMGT/LIGM-DB, IMGT/MHC-DB, IMGT/PRIMERDB), one
genome database (IMGT/GENE-DB), one 3D structure database
(IMGT/3Dstructure-DB), and a range of web resources ("IMGT
Marie-Paule page") and interactive tools.
[0342] 1.4. V-BASE (I. M. Tomlinson, 2002;
http://www.mrc-cpe.cam.ac.uk/vbase). V-BASE is a comprehensive
directory of all human antibody germline variable region sequences
compiled from more than one thousand published sequences. It
includes a version of the alignment software DNAPLOT (developed by
Hans-Helmar Althaus and Werner Muller) that allows the assignment
of rearranged antibody V genes to their closest germline gene
segments.
[0343] 1.5. Antibodies--Structure and Sequence (A. C. R. Martin,
2002; http://www.bioinf.org.uk/abs). This page summarizes useful
information on antibody structure and sequence. It provides a query
interface to the Kabat antibody sequence data, general information
on antibodies, crystal structures, and links to other
antibody-related information. It also distributes an automated
summary of all antibody structures deposited in the Protein
Databank (PDB). Of particular interest is a thorough description
and comparison of the various numbering schemes for antibody
variable regions.
[0344] 1.6. AAAAA--AHo's Amazing Atlas of Antibody Anatomy (A.
Honegger, 2001; http://www.unizh.ch/.about.antibody). This resource
includes tools for structural analysis, modeling, and engineering.
It adopts a unifying scheme for comprehensive structural alignment
of antibody and T-cell-receptor sequences, and includes Excel
macros for antibody analysis and graphical representation.
[0345] 1.7. WAM--Web Antibody Modeling (N. Whitelegg and A. R.
Rees, 2001; http://antibody.bath.ac.uk). Hosted by the Centre for
Protein Analysis and Design at the University of Bath, United
Kingdom. Based on the AbM package (formerly marketed by Oxford
Molecular) to construct 3D models of antibody Fv sequences using a
combination of established theoretical methods, this site also
includes the latest antibody structural information.
[0346] 1.8. Mike's Immunoglobulin Structure/Function Page (M. R.
Clark, 2001; http://www.path.carmac.uk/.about.mrc7/mikeimages.html)
These pages provide educational materials on immunoglobulin
structure and function, and are illustrated by many colour images,
models, and animations. Additional information is available on
antibody humanization and Mike Clark's Therapeutic Antibody Human
Homology Project, which aims to correlate clinical efficacy and
anti-immunoglobulin responses with variable region sequences of
therapeutic antibodies.
[0347] 1.9. The Antibody Resource Page (The Antibody Resource Page,
2000; http://www.antibodyresource.com). This site describes itself
as the "complete guide to antibody research and suppliers." Links
to amino acid sequencing tools, nucleotide antibody sequencing
tools, and hybridoma/cell-culture databases are provided.
[0348] 1.9. Humanization bYDesign (J. Saldanha, 2000;
http://people.cryst.bbk.ac.uk/.about.ubcg07s). This resource
provides an overview on antibody humanization technology. The most
useful feature is a searchable database (by sequence and text) of
more than 40 published humanized antibodies including information
on design issues, framework choice, framework back-mutations, and
binding affinity of the humanized constructs.
[0349] See also Antibody Engineering Methods and Protocols, Ed.
Benny K C Lo, Methods in Molecular Biology.TM., Human Press. Also
at
http://www.blogsua.com/pdf/antibody-engineering-methods-and-protocolsanti-
body-engineering-methods-and-protocols.pdf
[0350] As a source of genomic sequence variation data, the skilled
person will also be aware of the following available databases and
resources (including updates thereof):--
[0351] 1. HapMap (The International HapMap Consortium. 2003;
http://hapmap.ncbi.nlm.nih.gov/index.html.en). The HapMap Project
is an international project that aims to compare the genetic
sequences of different individuals to identify chromosomal regions
containing shared genetic variants. The HapMap www site provides
tools to identify chromosomal regions and the variant therein, with
options to drill down to population level frequency data.
[0352] 2. 1000 Genomes (The 1000 Genomes Project Consortium 2010;
http://www.1000genomes.org/). This resource provides complete
genomic sequence for 2500 unidentified individuals from one of 25
distinct population groups, with the aim of identifying genomic
variants of >1%. The site provides the ability to interrogate
data utilizing online tools (e.g. Variation Pattern Finder) and to
download variant data for individual population groups.
[0353] 3. Japanese SNP Database (H. Haga et al. 2002;
http://snp.ims.u-tokyo.ac.jp/index.html). Based on a study
identifying 190,562 human genetic variants this site catalogues
genomic variants with useful features for searching and summarizing
data.
[0354] It is possible to identify variants in immunoglobulin genes
classed as low-frequency or rare variants that segregate with
specific human ethnic populations. For the purpose of this
analysis, a low-frequency immunoglobulin gene segment is classed as
one with `Minor Allele Frequency` (MAF) (cumulative frequency) of
between 0.5%-5%, rare variants are those classed as having a MAF of
less than 0.5% in a particular human population.
[0355] The following bioinformatics protocol is envisaged to
identify human immunoglobulin gene segments for use in the present
invention:
[0356] (a) Identify one or more genomic regions containing gene
segments of interest ("target genomic regions") and calculate the
genomic coordinates, using coordinates that match the sequence
assembly build used by either the 1000 Genomes project or
International HapMap project (or another selected human gene
database of choice).
[0357] (b) Identify genomic variants mapped to the genomic regions
previously identified in (a). Retrieve variant frequencies for
variants for each super population and preferably sub-population
where such data is available. Tools readily available on the HapMap
WWW site and the VWC tools for the 1000Genomes Project are useful
for this step.
[0358] (c) Filter list of genomic variants from target genomic
regions to contain only variants classed as either `Non-synonymous`
single nucleotide polymorphisms (SNPs) or genomic `insertions or
defections` (indels). Filter further to include those that are
present in exonic sequences only.
[0359] (d) Correlate population frequency data for each of the
identified variants for each of the super populations (for example
`European Ancestry`, `East Asian ancestry`, `West African
ancestry`, `Americas`, and `South Asian ancestry`) to identify
those variants that segregate with less than two super-populations.
Further correlate all identified variants with each of the
sub-populations (for example, `European ancestry` super-population
might be subdivided into groups such as `CEU--Utah residents with
Northern or Western European ancestry`, `TSI Toscani in Italia` and
`British from England and Scotland`) and produce a second score for
rarity of variants in within a super-population.
[0360] (e) Collect one or more gene segments that show segregation
to specific sub-populations for construction of synthetic loci
according to the invention.
[0361] In one embodiment throughout the present text, "germline"
refers to the canonical germline gene segment sequence.
[0362] By detailed analysis of the 1000 Genomes database, the
inventors have devised a collection of candidate polymorphic
antibody gene segment variants, eg, human variant JH gene segments
(eg, see Example 4), that can be built into the design of
transgenic heavy chain loci in mice for expressing increasingly
diverse and new, synthetic repertoires of human variable regions.
To this end, the invention provides the following embodiments.
[0363] The Present Invention Provides in a Fourth
Configuration--
[0364] Selection of Human JH6*02 Variant
[0365] Transgenic IgH Loci, Non-Human Vertebrates, Cells &
Antibodies Based on Human JH6*02
[0366] As explained above, in designing transgenic Ig heavy chain
loci the present inventors have considered the huge amount of data
available from the 1000 Genomes project (see www.1000genomes.org)
that analyses gene distributions amongst many human populations,
and in particular data on Ig gene segments. The inventors were also
aware of human gene segments disclosed in the IMGT database (see
www.imgt.org) and in Ensembl (see www.ensembl.org). The inventors
needed to make choices about which human gene segments to include
amongst the large number of human gene segments presented in these
databases and the other sources of human Ig gene segment
information known in the art, including those other databases
disclosed herein. When choosing human JH gene segments, the
inventors were aware that human JH6 encodes a relatively long amino
acid sequence, and thus the inventors thought it desirable to
include this for increasing the chances of producing IgH chains
with relatively long HCDR3 regions. Antibodies with long HCDR3 (at
least 20 amino acids according to IMGT nomenclature) have been
shown to neutralise a variety of pathogens effectively including
HIV, Influenza virus, malaria and Africa trypanosomes. Reference is
also made to naturally-occurring Camelid (eg, llama or camel) heavy
chain-only antibodies which bear long HCDR3s for reaching
relatively inaccessible epitopes (see, eg, EP0937140). Long HCDR3s
can form unique stable subdomains with extended loop structure that
towers above the antibody surface to confer fine specificity. In
some cases, the long HCDR3 itself is sufficient for epitope binding
and neutralization (Liu, L et al; Journal of Virology. 2011. 85:
8467-8476, incorporated herein by reference). The unique structure
of the long HCDR3 allows it to bind to cognate epitopes within
inaccessible structure or extensive glycosylation on a pathogen
surface. In human peripheral blood, there is around 3.5% of naive B
antibodies or 1.9% of memory B IgG antibodies containing the HCDR3s
with lengths of more than 24 amino acids (PLoS One. 2012;
7(5):e36750. Epub 2012 May 9; "Human peripheral blood antibodies
with long HCDR3s are established primarily at original
recombination using a limited subset of germline genes"; Briney B S
e al, incorporated herein by reference) (FIG. 1). The usage
analysis indicates that these antibodies have the preference to use
human JH6 with human D2-2, D3-3 or D2-15 (Brinley, B S et al, FIGS.
2-5). See also PLoS One. 2011 March 30; 6(3):e16857; Comparison of
antibody repertoires produced by HIV-1 infection, other chronic and
acute infections, and systemic autoimmune disease"; Breden F et al,
incorporated herein by reference. Around 20% of all HCDR3 of
antibodies use JH6. However, in those antibodies with HCDR3 of more
than 24 amino acids, 70% use JH6 (Brinley, B S et al, FIG. 2).
[0367] There is a need in the art for genetically modified
non-human vertebrates and cells that can make antibodies and heavy
chains that have long human HCDR3s, as well as antibodies, chains
and VH domains that can be selected from such vertebrates and cells
wherein these can address target epitopes better accessed by long
HCDR3s.
[0368] The inventors, therefore, chose in this configuration of the
invention to include a human JH6 gene segment as a mandatory human
gene segment in their IgH locus design. Several different
naturally-occurring human JH6 variants are known (eg, JH6*01 to *04
as well as others; IMGT nomenclature). The inventors considered
this when deciding upon which human JH6 variant should be included
in the transgenic IgH locus design. An alignment of some human JH6
variants is shown in FIG. 7 (from www.imgt.org; dashes indicate
identical nucleotides; nucleotide changes versus the *01 variant
are shown by underlined nucleotides and corresponding amino acid
changes are shown by underlined amino acids; Genbank accession
numbers (release 185.0) are shown prefixed by J, X, M or A). The
inventors used sequencing of human genomic DNA samples, inspection
of public IgH DNA databases as well as informed choices on the
basis of variant sequences as means to arrive at a rational choice
of which JH6 variant to use.
[0369] The 1000 Genomes database uses human JH6*03 as the reference
sequence, which would be a possible choice for the skilled person
wishing to construct a transgenic IgH locus. The inventors noticed
(eg, FIG. 7 herein) that position 6 in JH6*03 is a tyrosine (Y)
encoded by a TAC codon, whereas some other naturally-occurring
human variants have a glycine (G) encoded by a GGT codon (the
glycine being present as a YYG motif, forming part of a larger
YYGXDX motif). To understand the potential significance of this,
the inventors carried out analysis of JH sequences from other
vertebrate species. The inventors surprisingly noticed that YYG and
YYGXDX motifs are conserved across many vertebrate species (see
FIGS. 7 & 8). This suggested to the inventors, therefore, that
preservation of this motif might be desirable, which could guide
the choice of JH6 variant for use in the present invention.
[0370] Another pointer arose when the inventors considered the TAC
codon versus the GGT codon encoding Y or G respectively. The
inventors considered the impact of these nucleotide sequences on
the action of activation-induced cytidine deaminase (AID). The
inventors knew that activation-induced cytidine deaminase (AID) is
believed to initiate Ig somatic hypermutation (SHM) in a multi-step
mechanism and they addressed this activity when rationally
designing the locus. AID catalyses the deamination of C to U in
DNA, generating mutations at C bases. Cytidines located within
hotspot motifs are preferentially deaminated. Certain motifs are
hotspots for AID activity (DGYW, WRC, WRCY, WRCH, RGYW, AGY, TAC,
WGCW, wherein W=A or T, Y=C or T, D=A, G or T, H=A or C or T, and
R=A or G). The presence of a TAC codon encoding Y at position 6 in
JH6*03 creates AID mutation hotspots (the cytidine being the
substrate of AID), these hotspots being the underlined motifs in
the previous sentence. The inventors considered the impact of this
and in doing so they considered possible mutants created by AID
activity at the cytidine. Reference is made to FIG. 9. The
inventors noticed that a mutation at the third base of the TAC
codon would yield 3 possible outcomes: Y, stop or stop. Thus, out
of the three stop codons possible in the genetic code (the other
being encoded by TGA--see FIG. 9), two of them would be provided by
mutation of the cytidine in the TAC codon encoding position 6 in
JH6*03. The inventors, therefore, considered that this might
increase the chances of non-productive IgH variable region
production in transgenic loci based on JH6*03. Moreover, the
inventors noticed that provision of a GGT codon instead (as per the
other human JH6 variants) seemed preferable since mutation of the
third base would never yield a stop codon (see FIG. 9), and
furthermore would retain coding, and thus conservation, of glycine
at position 6, which the inventors also noticed was is in the YYG
and YYGXDX motifs conserved across species.
[0371] Having decided against using JH6*03, the inventors needed to
make a choice from other possible human variants. The MDV motif is
at the C-terminus of HCDR3 based on human JH6, the adjacent
framework 4 (FW4) starting with the WGQ motif (with reference to
the sequence shown encoded by JH6*01; FIG. 7). In making their
choices for locus design, the inventors wished to maximise
conservation of this HCDR3/FW4 junction in product IgH chains and
antibodies including these. The inventors believed this to be
desirable for heavy chain variable domain functionality and
conformation. The inventors thought that this might in some cases
be desirable to minimise immunogenicity (suitable for human
pharmaceutical use). Consistent with these considerations, the
inventors wanted to make a choice that would minimise mutation
around the HCDR3/FW4 junction as a result of SHM in vivo to
conserve junction configuration. See Rogozin & Diaz; "Cutting
Edge: DGYW/WRCH Is a Better Predictor of Mutability at G:C Bases in
Ig Hypermutation Than the Widely Accepted RGYW/WRCY Motif and
Probably Reflects a Two-Step Activation-Induced Cytidine
Deaminase-Triggered Process"; Journal of Immunology; Mar. 15, 2004
vol. 172 no. 6 3382-3384. An example of a DGYW motif is GGCA. The
inventors had this in mind when analysing the variant
sequences.
[0372] With these considerations in mind, the inventors decided
specifically to use human JH6*02 as the mandatory human JH6 for
their IgH locus design. JH6*01 was rejected as the mandatory JH6
gene segment since the nucleotide sequence GGG C A (encoding G and
Q) contains a GGCA motif which is an AID recognition hotspot. The
inventors realised that JH6*04 also contains such a motif due to
the presence of the sequence GGC AAA encoding G and K (positions 11
and 12 respectively). The inventors also realised that the *02
variant has a C instead of a G that is in the *01 variant, the C
desirably being a synonymous change (ie, not changing the encoded
amino acid sequence around the CDR3/FW4 junction) and also this
does not provide a GGCA AID hotspot motif. The inventors,
therefore, decided that the mandatory JH6 should have this C base
and this too pointed them to using the human JH6*02 variant.
[0373] In one example of any configuration of the invention herein,
the only JH6 species included in the locus or genome is human
JH6*02.
[0374] The inventors obtained 9 anonymised DNA samples from cheek
swabs of 9 consenting human adults. Sequencing was performed on IgH
locus DNA to confirm natural JH6 variant usage. It was found that
the genome of all 9 humans contained a JH6*02 variant gene segment.
In 7 out of the 9 humans, the genome was homozygous for JH6*02 (ie,
each chromosome 14 had JH6*02 as its JH6 gene segment in the IgH
locus). The inventors also inspected the publicly-available
sequence information from the genomes of well-known scientists
Craig Venter and Jim Watson. Both of these genomes contain JH6*02
too. This indicated to the inventors that this variant is common in
humans.
[0375] So, the inventors made a choice of human JH6*02 on the basis
of
[0376] (i) Containing the YYG and YYGXDX motifs that is conserved
across several vertebrate species;
[0377] (ii) Provision of one less TAC codon (an AID hotspot that
risks stop codons) and a choice instead of a codon that preserves
the YYG and YYGXDX motifs;
[0378] (iii) Avoidance of a GGCA AID hotspot in the region of the
HCDR3/FW4 junction; and
[0379] (iv) Common occurrence (and thus conservation and
acceptability) in humans of the JH6*02 variant.
[0380] This rationale was tested by the inventors in laboratory
examples, in order to see if human JH6*02 could desirably
participate in antibody gene segment recombination and heavy chain
production in a foreign (non-human vertebrate) setting, and
moreover to assess if long HCDR3s based on human JH6*02 could be
produced in vivo (in naive and immunised settings) in such
non-human systems. It was noted that in some non-human settings,
such as a mouse, the YYG and YYGXDX motifs are not conserved, and
thus the inventors decided that it was important to test whether or
not JH6*02 (having the YYG and YYGXDX motifs) could function
properly in such a foreign setting to participate in VDJ
recombination and selection against antigen.
[0381] Thus, as explained further in the examples, the inventors
constructed transgenic JH6*02-containing IgH loci in ES cells,
generated transgenic non-human vertebrates from the ES cells (both
naive and immunised with a range of different target antigen
types), isolated antibodies and heavy chain sequences based on
JH6*02 as well as B-cells expressing these and made hybridomas
expressing antigen-specific antibodies that are based on the chosen
JH6*02 variant. The inventors found that the JH6*02 variant was
extensively used and could contribute to the production of HCDR3 of
at least 20 amino acids in many different heavy chains (including
antigen-specific heavy chains). The chosen variant was preferably
used over other JH gene segments in all settings (naive, immunised
and antigen-specific) for the production of HCDR3 of at least 20
amino acids.
[0382] Thus, the present invention provides an IgH locus including
human JH6*02 (IMGT nomenclature) as a mandatory JH gene segment. In
one embodiment, the locus comprises non-human vertebrate (eg, mouse
or rat) constant region gene segments downstream (ie, 3' of) the
human JH6*02; and one or more VH gene segments (eg, a plurality of
human VH gene segments) and one or more D gene segments (eg, a
plurality of human D gene segments) upstream of (ie, 5' of) the
human JH6*02. For example, the locus is comprised by a vector (eg,
a DNA vector, eg, a yeast artificial chromosome (YAC), BAC or PAC).
Such a vector (eg, YAC) can be introduced into a non-human
vertebrate (eg, mouse or rat) cell using standard techniques (eg,
pronuclear injection) so that the locus is integrated into the cell
genome for expression of IgH chains comprising at least one chain
whose variable domain is a product of the recombination of human
JH6*02 with a VH and a D gene segment.
[0383] In another example, the locus (eg, with a completely human,
rat or mouse constant region, or a human/mouse chimaeric constant
region) can be provided in the genome of a non-human vertebrate
(eg, mouse or rat) cell. For example, the cell is an ES cell or an
antibody-producing cell (eg, an isolated B-cell, an iPS cell or a
hybridoma).
[0384] In another example, the invention provides a non-human
vertebrate (eg, a mouse or a rat) comprising an IgH locus of the
invention which comprises a human JH6*02 gene segment, wherein the
locus can express an IgH chain whose variable domain is a product
of the recombination of human JH6*02 with a VH and a D gene
segment. As shown in the examples, the inventors have successfully
produced such mice which produce such IgH chains with VH domains
based on human JH6*02. The inventors isolated and sequenced IgH
chains from the mice before (naive) and after (immunised) exposure
to a range of target antigens and confirmed by comparison to IMGT
IgH gene segment sequences that the isolated chains (and antibodies
containing these) were produced based on JH6*02. Such chains were
found in naive mice, as well as in antigen-specific antibodies from
immunised mice. B-cells were isolated from immunised mice, wherein
the B-cells express antibodies based on JH6*02 and hybridomas were
generated from the B-cells, the hybridomas expressing
antigen-specific antibodies based on JH6*02. The inventors,
therefore, provided the locus, vertebrate, cell and hybridoma of
the invention based on the use of human JH6*02 and showed that
antibodies based on JH6*02 and B-cells expressing these can be
successfully produced and isolated following immunisation of the
vertebrates, corresponding hybridomas being a good source of
antibodies whose VH domains are based on JH6*02, eg for
administration to a patient, eg, for human medicine. Furthermore,
it was found possible to produce and isolated antigen-specific
antibodies whose VH domains are based on JH6*02 and which had a
relatively long HCDR3 (eg, 20 amino acids).
[0385] Thus, the present invention provides embodiments as in the
following clauses:--
[0386] 1. A non-human vertebrate (optionally a mouse or a rat) or
vertebrate cell whose genome comprises an immunoglobulin heavy
chain locus comprising human gene segment JH6*02, one or more VH
gene segments and one or more D gene segments upstream of a
constant region; wherein the gene segments in the heavy chain locus
are operably linked to the constant region thereof so that the
mouse is capable of producing an antibody heavy chain produced by
recombination of the human JH6*02 with a D segment and a VH
segment.
[0387] In another example, the invention provides
[0388] A non-human vertebrate (optionally a mouse or a rat) or
vertebrate cell whose genome comprises an immunoglobulin heavy
chain locus comprising one, more or all of human IGHV gene segments
selected from V3-21, V3-13, V3-7, V6-1, V1-8, V1-2, V7-4-1, V1-3,
V1-18, V4-4, V3-9, V3-23, V3-11 and V3-20 (eg, one, more or all of
V3-21*03, V3-13*01, V3-7*01, V6-1*01, V1-8*01, V1-2*02, V7-4-1*01,
V1-3*01, V1-18*01, V4-4*01, V3-9*01 and V3-23*04). These segments
were found in naive repertoires to be productive to produce HCDR3s
of at least 20 amino acids in length. In an embodiment, the locus
comprises a human JH6, eg, JH6*02.
[0389] The invention also provides a HCDR3, VH domain, antibody
heavy chain or antibody having a HCDR3 size of at least 20 amino
acids. Optionally, the HCDR3 or VH domain (or VH domain of the
heavy chain or antibody) comprises mouse AID-pattern somatic
hypermutations and/or mouse dTd-pattern mutations. This can be
provided, for example, wherein VH domain is produced in a mouse
comprising mouse AID and/or mouse TdT (eg, endogenous AID or TdT).
See also Annu. Rev. Biochem. 2007. 76:1-22; Javier M. Di Noia and
Michael S. Neuberger, "Molecular Mechanisms of Antibody Somatic
Hypermutation" (in particular FIG. 1 and associated discussion on
AID hotspots in mouse); and Curr Opin Immunol. 1995 April;
7(2):248-54, "Somatic hypermutation", Neuberger M S and Milstein C
(in particular, discussion on hotspots in mouse), the disclosures
of which are incorporated herein by reference.
[0390] These segments were found in naive repertoires to be
productive in recombination with human JH6*02 to produce HCDR3s of
at least 20 amino acids in length.
[0391] In an example, the vertebrate is naive. In another
embodiment, the vertebrate instead is immunised with a target
antigen.
[0392] In an example, the vertebrate or cell mentioned below is
capable of so producing an antibody heavy chain upon immunisation
with a target antigen. In an example, the vertebrate is an
immunised vertebrate that produces antibody heavy chains specific
for a target antigen and wherein the variable domains of the heavy
chains are the product of recombination between a VH, D and JH6*02.
For example, the D is selected from human D3-3, D2-15, D3-9; D4-17;
D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; D1-26; D1-20;
D5-18; D3-16; D2-21; D1-14; D7-27; D1-1; D6-25; D2-14 and D4-23
(eg, selected from D3-9*01; D4-17*01; D3-10*01; D2-2*02; D5-24*01;
D6-19*01; D3-22*01; D6-13*01; D5-12*01; D1-26*01; D1-20*01;
D5-18*01; D3-16*02; D2-21*02; D1-14*01; D7-27*02; D1-1*01;
D6-25*01; D2-15*01; and D4-23*01). For example, the D is human D3-9
or D3-10. In an example, the HCDR3 length is at least 20 amino
acids (eg, 20, 21, 23 or 24).
[0393] In an example of the vertebrate or cell, the genome
comprises additional human JH gene segments (eg, JH2, 3, 4 and 5
gene segments).
[0394] In an example of the vertebrate or cell, the genome
comprises an immunoglobulin light chain locus comprising one or
more human V gene segments and one or more human J gene segments
upstream of a constant region (eg, a human or a mouse lambda or
kappa constant region).
[0395] For rearrangement and expression of heavy chains, the locus
comprises control elements, such as an E and S between the J gene
segment(s) and the constant region as is known by the skilled
person. In one example, a mouse E and S is included in the heavy
chain locus between the JH6*02 and the constant region (ie, in 5'
to 3' order the locus comprises the JH6*02, E and S and constant
region). In an example, the E and S are E and S of a mouse
129-derived genome (eg, a 129Sv-derived genome, eg, 129Sv/EV (such
as 129S7Sv/Ev (such as from AB2.1 or AB2.2 cells obtainable from
Baylor College of Medicine, Texas, USA) or 129S6Sv/Ev))); in
another example, the E and S are E and S of a mouse C57BL/6-derived
genome. In this respect, the locus can be constructed in the IgH
locus of the genome of a cell selected from AB2.1, AB2.2, VGF1, CJ7
and FH14. VGF1 cells were established and described in Auerbach W,
Dunmore J H, Fairchild-Huntress V, et al; Establishment and chimera
analysis of 129/SvEv- and C57BL/6-derived mouse embryonic stem cell
lines. Biotechniques 2000; 29:1024-8, 30, 32, incorporated herein
by reference.
[0396] Additionally or alternatively, the constant region (or at
least a C or C and gamma constant regions thereof) is a constant
region (or C or C and gamma constant regions thereof) is of a
genome described in the paragraph immediately above.
[0397] A suitable source of JH6*02 and other human DNA sequences
will be readily apparent to the skilled person. For example, it is
possible to collect a DNA sample from a consenting human donor (eg,
a cheek swab sample as per the Example herein) from which can be
obtained suitable DNA sequences for use in constructing a locus of
the invention. Other sources of human DNA are commercially
available, as will be known to the skilled person. Alternatively,
the skilled person is able to construct gene segment sequence by
referring to one or more databases of human Ig gene segment
sequences disclosed herein.
[0398] 2. The vertebrate of clause 1, wherein the vertebrate has
been immunised with a target antigen and wherein the variable
domain of the heavy chain is the product of recombination between a
VH, D and JH6*02 and wherein the HCDR3 length is at least 20 amino
acids (eg, 20, 21, 23 or 24).
[0399] Optionally, the immunised vertebrate produces an antibody
heavy chain specific for a target antigen and wherein the variable
domain of the heavy chain is the product of recombination between a
VH, D and JH6*02 and wherein the HCDR3 length is at least 20 amino
acids (eg, 20, 21, 23 or 24).
[0400] 3. A non-human vertebrate cell (optionally a mouse cell or a
rat cell) whose genome comprises an immunoglobulin heavy chain
locus comprising human gene segment JH6*02, one or more VH gene
segments and one or more D gene segments upstream of a constant
region; wherein the gene segments in the heavy chain locus are
operably linked to the constant region thereof for producing (eg,
in a subsequent progeny cell) an antibody heavy chain produced by
recombination of the human JH6*02 with a D segment and a VH
segment.
[0401] 4. The cell of clause 3, which is an ES cell capable of
differentiation into a progeny antibody-producing cell that
expresses said heavy chain.
[0402] 5. The vertebrate or cell of any preceding clause, wherein
the heavy chain locus comprises a human JH6*02 recombination signal
sequence (RSS) operably connected 5' to the JH6*02 gene
segment.
[0403] For example, the native RSS-JH6*02 sequence can be used to
advantageously maintain the natural pairing between RSS and this JH
gene segment. In this respect, the following sequence is
used:--
[0404]
ggtttttgtggggtgaggatggacattctgccattgtgattactactactactacggtatggacgtc-
tggggccaagggaccacggtcaccg tctcctcag (SEQ ID NO: 238)
[0405] RSSs have a common architecture: 9mer (eg, first underlined
sequence above) followed by a 22 bp spacer and then a 7mer (eg,
second underlined sequence above). Spacers are 23 bp+/-1 normally,
while the 9 and 7mer are more conserved.
[0406] 6. The vertebrate or cell of clause 5, wherein the RSS is
SEQ ID NO: 238 or a sequence having an identical 9mer and 7mer
sequence flanking a sequence that is at least 70% identical to the
22mer sequence of SEQ ID NO: 238.
[0407] 7. The vertebrate or cell of clause 6, wherein the RSS and
JH6*02 are provided as SEQ ID NO: 237.
[0408] 8. The vertebrate or cell of any preceding clause, wherein
the JH6*02 is the only JH6-type gene segment in the genome.
[0409] 9. The vertebrate or cell of any preceding clause, wherein
the JH6*02 is the closest JH gene segment to the constant region in
the locus.
[0410] 10. The vertebrate or cell of any preceding clause, wherein
the locus comprises one, more or all human D gene segments D3-9;
D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; D1-26;
D1-20; D5-18; D3-16; D2-21; D1-14; D7-27; D1-1; D6-25; D2-14; and
D4-23.
[0411] For example, the locus comprises one, more or all of human D
gene segments D3-9*01; D4-17*01; D3-10*01; D2-2*02; D5-24*01;
D6-19*01; D3-22*01; D6-13*01; D5-12*01; D1-26*01; D1-20*01;
D5-18*01; D3-16*02; D2-21*02; D1-14*01; D7-27*02; D1-1*01;
D6-25*01; D2-15*01; and D4-23*01.
[0412] 11. The vertebrate or cell of clause 10, wherein the locus
comprises one, more or all human D gene segments D3-9, D3-10,
D6-19, D4-17, D6-13, D3-22, D2-2, D2-25 and D3-3.
[0413] These D segments were found to be productive in
recombination with human JH6*02 to produce HCDR3s of at least 20
amino acids in length.
[0414] In an example, the locus comprises one, more or all human D
gene segments D3-9, D3-10, D6-19, D4-17, D6-13 and D3-22 (for
example one, more or all of D3-9*01, D3-10*01, D6-19*01, D4-17*01,
D6-13*01 and D3-22*01). These D segments were found in naive
repertoires to be productive in recombination with human JH6*02 to
produce HCDR3s of at least 20 amino acids in length.
[0415] In an example, the locus comprises one, more or all human D
gene segments D3-10, D6-19 and D1-26 (for example, one, more or all
of D3-10*01, D6-19*01 and D1-26*01). These D segments were found in
immunised repertoires to be productive in recombination with human
JH6*02 to produce HCDR3s of at least 20 amino acids in length.
[0416] In an example, the locus comprises one, more or all human D
gene segments D3-9 and D3-10 (for example, one, more or all of
D3-9*01 and D3-10*01). These D segments were found in
antigen-specific repertoires to be productive in recombination with
human JH6*02 to produce HCDR3s of at least 20 amino acids in
length.
[0417] 12. The vertebrate or cell of any preceding clause, wherein
the locus comprises a plurality of human D gene segments and the
JH6*02 is in human germline configuration with respect to the
3'-most human D gene segment (or all of the human D segments
comprised by the locus).
[0418] In an example, the 3'-most D gene segment is D7-27. In an
example, the locus comprises all of human D gene segments from D1-1
to D7-27 as present in a germline human IgH locus (eg, as shown in
the IMGT database).
[0419] Alternatively or additionally, the JH6*02 is in human
germline configuration with respect to one, more or all of the E S
and constant region (eg, Cu) 13. The vertebrate or cell of any
preceding clause, wherein the locus comprises one, more or all of
IGHV gene segments selected from V3-21, V3-13, V3-7, V6-1, V1-8,
V1-2, V7-4-1, V1-3, V1-18, V4-4, V3-9, V3-23, V3-11 and V3-20.
[0420] In an example, the locus comprises one, more or all human
IGHV gene segments V3-21, V3-13, V3-7, V6-1, V1-8, V1-2, V7-4-1,
V1-3, V1-18, V4-4, V3-9, V3-23 (for example, one, more or all of
V3-21*03, V3-13*01, V3-7*01, V6-1*01, V1-8*01, V1-2*02, V7-4-1*01,
V1-3*01, V1-18*01, V4-4*01, V3-9*01 and V3-23*04). These segments
were found in naive repertoires to be productive in recombination
with human JH6*02 to produce HCDR3s of at least 20 amino acids in
length.
[0421] In an example, the locus comprises one, more or all human
IGHV gene segments V3-7, V3-11 and V4-4 (for example, one, more or
all of V3-7*01, V3-11*01 and V4-4*02). These segments were found in
immunised repertoires to be productive in recombination with human
JH6*02 to produce HCDR3s of at least 20 amino acids in length.
[0422] In an example, the locus comprises one, more or all human
IGHV gene segments V4-4, V1-8, V3-9, V3-11 and V3-20 (for example,
one, more or all of V4-4*02, V1-8*01, V3-9*01, V3-11*01 and V3-20
(eg, *d01). These segments were found in antigen-specific
repertoires to be productive in recombination with human JH6*02 to
produce HCDR3s of at least 20 amino acids in length.
[0423] 14. The vertebrate or cell of any preceding clause, wherein
the locus comprises one, more or all of human D3-9*01, D3-10*01,
D6-19*01, D6-13*01, D1-26*01, IGHV1-8*01, IGHV4-61*01, IGHV6-1*01,
IGHV4-4*02, IGHV1-3*01, IGHV3-66*03, IGHV3-7*01 and IGHV3-9*01.
[0424] These are gene segments that very frequently combine with
JH6*02 to produce productive heavy chains and antibodies.
[0425] For example, the locus comprises one, more or all of human
IGHV1-8*01, D3-9*01 and D3-10*01. These gene segments were
productive with JH6*02 to produce HCDR3s of at least 20 amino acids
in more than 10 antibodies.
[0426] 15. An antibody-producing cell (eg, a B-cell) that is a
progeny of the cell of any one of clauses 3 to 14, wherein the
antibody-producing cell comprises a heavy chain locus comprising a
rearranged variable region produced by recombination of human
JH6*02 with a D segment and a VH segment (eg, JH6*02 with human
VH3-11 (eg, VH3-11*01) and D3-9; VH3-20 (eg, VH3-20*01) and D3-10;
VH4-4 (eg, VH4-4*02) and D3-10; VH3-9 (eg, VH3-9*01) and D3-10; or
VH1-8 (eg, VH1-8*01) and D310).
[0427] Such a variable region would be the product of in vivo
somatic hypermutation in a non-human vertebrate or cell of the
invention.
[0428] 16. The cell of clause 15, which is a B-cell or hybridoma
that expresses a target antigen-specific antibody comprising a
heavy chain that comprises a rearranged variable region produced by
recombination of human JH6*02 with a D segment and a VH segment
(eg, JH6*02 with human VH3-11 (eg, VH3-11*01) and D3-9; VH3-20 (eg,
VH3-20*01) and D3-10; VH4-4 (eg, VH4-4*02) and D3-10; VH3-9 (eg,
VH3-9*01) and D3-10; or VH1-8 (eg, VH1-8*01) and D310).
[0429] Such a variable region would be the product of in vivo
somatic hypermutation in a non-human vertebrate or cell of the
invention
[0430] 17. The vertebrate or cell of any preceding clause, wherein
the antibody heavy chain specifically binds a target antigen.
[0431] 18. The vertebrate or cell of any preceding clause, wherein
the antibody heavy chain has a HCDR3 length of at least 20 amino
acids.
[0432] Optionally, the HCDR3 length is at least 21, 22, 23, 24, 25,
26, 27, 28, 29 or 30 amino acids. Additionally, in one example the
length is no more than 35, 34, 33, 32 or 31 amino acids. For
example, the HCDR3 length is 20, 21, 22, 23 or 24 amino acids.
[0433] 19. The vertebrate or cell of any preceding clause, wherein
the antibody heavy chain is a product of the recombination of
JH6*02 with a human VH gene segment recited in clause 13 or 14
and/or a D gene segment recited in clause 10, 11 or 14.
[0434] 20. The vertebrate or cell of any preceding clause, wherein
all endogenous non-human vertebrate heavy chain variable region
gene segments have been inactivated in the genome (Eg, by gene
segment deletion or inversion).
[0435] 21. The vertebrate or cell of any preceding clause, wherein
the genome is homozygous for said heavy chain locus.
[0436] 22. A heavy chain (eg, comprised by an antibody) isolated
from a vertebrate of any one of clauses 1, 2, 5 to 14 and 17 to 21
wherein the heavy chain comprises a HCDR3 of at least 20 amino
acids.
[0437] 23. The heavy chain of clause 22, wherein the HCDR3 is the
product of recombination of human JH6*02 with a human VH gene
segment recited in clause 13 or 14 and/or a D gene segment recited
in clause 10, 11 or 14.
[0438] In an example, the heavy chain is chimaeric where the C
region is non-human. In an example, the heavy chain is human where
the C region is human.
[0439] 24. A heavy chain (eg, comprised by an antibody) whose VH
variable domain is identical to the VH variable domain of the heavy
chain of clause 22 or 23, and which comprises a human constant
region or a human-mouse chimaeric constant region (eg, CH1 is human
and the other constant domains are mouse).
[0440] 25. The heavy chain of clause 22, 23 or 24, whose VH
variable domain is specific for a target antigen.
[0441] 26. A method for producing a heavy chain, VH domain or an
antibody specific to a target antigen, the method comprising
immunizing a non-human vertebrate according to any one of clauses
1, 2, 5 to 14 and 17 to 21 with the antigen and isolating the heavy
chain, VH domain or an antibody specific to a target antigen or a
cell producing the heavy chain, VH domain or an antibody, wherein
the heavy chain, VH domain or an antibody comprises a HCDR3 that is
derived from the recombination of human JH6*02 with a VH gene
segment and a D gene segment.
[0442] 27. A method for producing a human heavy chain or antibody
comprising carrying out the method of clause 26, wherein the
constant region of the locus is a non-human vertebrate (eg, mouse
or rat) constant region, and then replacing the non-human constant
region of the isolated heavy chain or antibody with a human
constant region (eg, by engineering of the nucleic acid encoding
the antibody).
[0443] 28. A heavy chain, VH domain or an antibody produced by the
method of clause 26 or 27. Optionally the HCDR3 length is at least
20 amino acids as herein described.
[0444] 29. A B-cell or hybridoma expressing a heavy chain VH domain
that is identical to the VH domain of the heavy chain of clause 22,
23 or 28.
[0445] 30. A nucleic acid encoding the VH domain of the heavy chain
of clause 22, 23 or 28, or encoding the heavy chain of clause 22,
23, 24, 25 or 28.
[0446] 31. A vector (eg, a CHO cell or HEK293 cell vector)
comprising the nucleic acid of clause 30; optionally wherein the
vector is in a host cell (eg, a CHO cell or HEK293 cell).
[0447] 32. A pharmaceutical composition comprising the antibody,
heavy chain or VH domain (eg, comprised by an antibody) of any one
of clauses 22 to 25 and 28, together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, heavy chain or
antibody).
[0448] 33. The antibody, heavy chain or VH domain (eg, comprised by
an antibody) of any one of clauses 22 to 25 and 28 for use in
medicine (eg, human medicine).
[0449] For example, the locus comprises the following human VH gene
segments
[0450] IGHV6-1
[0451] IGHV3-7
[0452] IGHV1-8
[0453] IGHV3-9
[0454] IGHV3-11
[0455] IGHV3-13
[0456] IGHV1-18
[0457] IGHV3-30
[0458] IGHV4-31
[0459] IGHV4-39 IGHV4-59
[0460] Optionally also (i) and/or (ii)
[0461] (i)
[0462] IGHV1-2 IGHV2-5 and IGHV3-21
[0463] (ii)
[0464] IGHV1-2 IGHV2-5 IGHV3-21 IGHV1-24
[0465] For example, the locus comprises the following human VH gene
segment variants
[0466] IGHV6-1*01
[0467] IGHV3-7*01
[0468] IGHV1-8*01
[0469] IGHV3-9*01
[0470] IGHV3-11*01
[0471] IGHV3-13*01
[0472] IGHV1-18*01
[0473] IGHV3-30*18
[0474] IGHV4-31*03
[0475] IGHV4-39*01 and
[0476] IGHV4-59*01;
[0477] Optionally also (iii) or (iv)
[0478] (ii)
[0479] IGHV1-2*04 IGHV2-5*10 and IGHV3-21*03
[0480] (iv)
[0481] IGHV1-2*02 IGHV2-5*01 IGHV3-21*01 and IGHV1-24*01
[0482] For example, the locus comprises the following human JH gene
segment variants
[0483] IGHJ2*01 IGHJ3*02
[0484] IGHJ4*02 IGHJ5*02 and IGHJ6*02
[0485] For example, the locus comprises the following human D gene
segments
[0486] IGHD1-1
[0487] IGHD2-2
[0488] IGHD3-9
[0489] IGHD3-10
[0490] IGHD5-12
[0491] IGHD6-13
[0492] IGHD1-14
[0493] IGHD2-15
[0494] IGHD3-16
[0495] IGHD4-17
[0496] IGHD6-19
[0497] IGHD2-21
[0498] IGHD5-24
[0499] IGHD1-26 and
[0500] IGHD7-27
[0501] and optionally also (v) or (vi)
[0502] (v)
[0503] IGHD3-3
[0504] (vi)
[0505] IGHD3-3
[0506] IGHD4-4
[0507] IGHD5-5
[0508] IGHD6-6
[0509] IGHD1-7
[0510] IGHD2-8 and
[0511] IGHD2-8
[0512] The Present Invention Provides in a Fifth
Configuration--
[0513] Constant Regions Tailored to Human Use & Antibody
Humanisation
[0514] Additional rational design and bioinformatics has led the
inventors to realise that specific human constant region variants
are conserved across many diverse human populations. The inventors
realised that this opens up the possibility of making a choice to
humanise antibodies, chains and variable domains by using such
specific constant regions in products, rather than arbitrarily
choosing the human constant region (or a synthetic version of a
human constant region). This aspect of the invention also enables
one to tailor antibody-based drugs to specific human ethnic
populations, thereby more closely matching drug to patient (and
thus disease setting) than has hitherto been performed. It can be a
problem in the state of the art that antibodies are humanised with
an arbitrary choice of human constant region (presumably derived
from one (often unknown) ethnic population or non-naturally
occurring) that does not function as well in patients of a
different human ethnic population. This is important, since the
constant region has the major role in providing antibody effector
functions, eg, for antibody recycling, cellular and complement
recruitment and for cell killing.
[0515] As discussed further in WO2011066501, human IgG sub-types
IgG1, IgG2, gG3 and IgG4 exhibit differential capacity to recruit
immune functions, such as antibody-dependent cellular cytotoxicity
(ADCC, e.g., IgG1 and IgG3), antibody-dependent cellular
phagocytosis (ADCP, e.g., IgG1, IgG2, IgG3 and IgG4), and
complement dependent cytotoxicity (CDC, e.g., IgG1, IgG3).
Sub-type-specific engagement of such immune functions is based on
selectivity for Fc receptors on distinct immune cells and the
ability to bind C1q and activate the assembly of a membrane attack
complex (MAC).
[0516] Among the various types, relative affinity for FcY receptors
(e.g., FcYRI, FcYRIIa/b/c, FcYRIIIa/b) is high for IgG1 and IgG3,
however, there is minimal affinity for IgG2 (restricted to the
FcYRIIa 131H polymorphism), and IgG4 only has measurable affinity
for FcYRI. Using comparative sequence analysis and co-crystal
structures, the key contact residues for receptor binding have been
mapped to the amino acid residues spanning the lower hinge and CH2
region. Using standard protein engineering techniques, some success
in enhancing or reducing the affinity of an antibody preparation
for Fc receptors and the C1q component of complement has been
achieved.
[0517] Among the isotypes, IgG2 is least capable of binding the
family of Fc receptors. Using IgG2 as the starting point, efforts
have been made to find a mutant with diminished effector functions
but which retains FcRn binding, prolonged stability, and low
immunogenicity. Improved mutants of this nature may provide
improved antibody therapeutics with retained safety. Human IgG1
therapeutic antibodies that bind to cell surface targets are able
to engage effector cells that may mediate cell lysis of the target
cell by antibody-dependent cellular cytotoxicity (ADCC) or
complement dependent cytotoxicity (CDC). These mechanisms occur
through interaction of the CH2 region of the antibody Fc domain to
FcyR receptors on immune effector cells or with C1q, the first
component of the complement cascade. Table 19 shows the activities
of different human gamma sub-types. The skilled person may choose
accordingly to promote or dampen-down activity depending upon the
disease setting in humans of interest. For example, use of a human
gamma-1 constant region is desirable when one wishes to isolated
totally human heavy chains and antibodies that have relatively high
complement activation activity by the classical pathway and FcYR1
recognition in human patients. See also Mol Immunol. 2003 December;
40(9):585-93; "Differential binding to human Fcgamma RIIa and
Fcgamma RIIb receptors by human IgG wild type and mutant
antibodies"; Armour K L et al, which is incorporated herein by
reference.
[0518] IgG2 constant regions are well suited to producing
antibodies and heavy chains according to the invention for binding
to cytokines or soluble targets in humans, since IgG2 is
essentially Fc.gamma.RI,III-silent, FcYRIIa-active and has little
Complement activity.
[0519] IgG1 constant regions have wide utility for human
therapeutics, since IgG1 antibodies and heavy chains are
Fc.gamma.RI,II,III-active and have complement activity. This can be
enhanced by using a human gamma-1 constant region that has been
activated by engineering as is known in the art.
[0520] The work of the inventors has therefore identified a
collection of human constant region of different isotypes from
which an informed choice can be made when humanising chimaeric
antibody chains (or conjugating V domains, such as dAbs or Camelid
VHH, to constant regions). The collection was identified on the
basis of bioinformatics analysis of the 1000 Genomes database, the
inventors selecting constant region variants that are frequently
occurring across several human ethnic populations, as well as those
that appear with relatively high frequency within individual
populations (as assessed by the number of individuals whose genomes
comprise the variant). By sorting through the myriad possible
sequences on this basis, the inventors have provided a collection
of human constant region variants that are naturally-occurring and
which can be used when rationally designing
[0521] antibodies, heavy chains and other antibody-based formats
that bear a human constant region. In particular, this is useful
when humanising chimaeric heavy chains to produce totally human
chains in which both the variable and constant regions are human.
This is useful for compatibility with human patients receiving
antibody-based drugs.
[0522] To this End, the Invention Provides the Following
Aspects:--
[0523] 1. method of producing an antibody heavy chain, the method
comprising
[0524] (a) providing an antigen-specific heavy chain variable
domain (eg, VH (such as a human VH or dAb) or VHH or a humanised
heavy chain variable domain); and
[0525] (b) combining the variable domain with a human heavy chain
constant region to produce an antibody heavy chain comprising (in
N- to C-terminal direction) the variable domain and the constant
region;
[0526] wherein
[0527] the human heavy chain constant region is an IGHAref, IGHA1a,
IGHA2a, IGHA2b, IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a,
IGHG3b, IGHG4ref, IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb
constant region.
[0528] Step (b) can be carried out, eg, using recombinant DNA
technology using the corresponding nucleotide sequences.
[0529] For the constant region according to any aspect of this
configuration, either genomic DNA or equivalent (ie, having introns
and exons and optionally also 5' UTR sequences, eg, with native or
a non-native leader sequence) can be used for the constant region.
For example, any of the "GENOMIC" sequences disclosed as SEQ ID NO:
365 onwards herein. Alternatively, an intronless sequence can be
used, for example any of the "CDS" sequences disclosed as SEQ ID
NO: 365 onwards herein (eg, with native or a non-native leader
sequence).
[0530] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHAref
constant region.
[0531] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHA1a
constant region.
[0532] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHA2a
constant region.
[0533] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHA2b
constant region.
[0534] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is IGHG1 ref
constant region.
[0535] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG2ref
constant region.
[0536] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG2a
constant region.
[0537] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG3ref
constant region.
[0538] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG3a
constant region.
[0539] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG3b
constant region.
[0540] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG4ref
constant region.
[0541] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHG4a
constant region.
[0542] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHDref
constant region.
[0543] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHEref
constant region.
[0544] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHMref
constant region.
[0545] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHMa
constant region.
[0546] Optionally for any aspect of this configuration of the
invention, the human heavy chain constant region is an IGHMb
constant region.
[0547] Optionally, a derivative (eg, a mutant or conjugate) of the
heavy chain or an antibody containing the heavy chain is produced.
For example, a toxic payload can be conjugated (eg, for oncology
applications). For example, one or more mutations can be
introduced, as is known in the art, to inactivate or enhance Fc
effector function.
[0548] 2. The method of aspect 1, wherein the variable domain is a
human variable domain.
[0549] A human variable domain is, for example, the product of
recombination in a transgenic non-human vertebrate of human VH, D
and JH gene segments. Alternatively, the variable domain is
identified using in vitro display technology from a human VH
library, eg, using phage display, ribosome display or yeast
display, as is known in the art.
[0550] In another embodiment, the variable domain is a humanised
variable domain, eg, comprising human frameworks with non-human
(eg, mouse or rat) CDRs). Humanisation technology is conventional
in the art, and will be readily known to the skilled person.
[0551] 3. The method of any preceding aspect, wherein the variable
domain has previously been selected from a non-human vertebrate
that has been immunised with the antigen.
[0552] For example, the vertebrate (such as a mouse or rat) genome
comprises a chimaeric heavy chain locus comprising a human variable
region (human V, D and JH gene segments) operably connected
upstream of a non-human vertebrate constant region so that the
locus is able to rearrange for the expression of heavy chains
comprising human variable domains and non-human vertebrate constant
regions.
[0553] In alternative embodiments, the variable domain is selected
using an in vitro technology such as phage display, ribosome
display or yeast display. In this case the variable domain may be
displayed with or without a constant region, provided that it is
later combined with a human constant region as per the
invention.
[0554] 4. The method of any preceding aspect, comprising providing
an expression vector (Eg, a mammalian expression vector, such as a
CHO or HEK293 vector) comprising a nucleotide sequence encoding the
constant region; inserting a nucleotide sequence encoding the
variable domain into the vector 5' of the constant region sequence;
inserting the vector into a host cell and expressing the heavy
chain by the host cell; the method further comprising isolating a
heavy chain (eg, as part of an antibody) comprising the variable
domain and the human constant region.
[0555] The vector comprises regulatory elements sufficient to
effect expression of the heavy chain when the vector is harboured
by a host cell, eg, a CHO or HEK293 cell.
[0556] 5. The method of any preceding aspect, further comprising
obtaining a nucleotide sequence encoding the heavy chain.
[0557] 6. An antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region that is an IGHAref, IGHA1a, IGHA2a, IGHA2b,
IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref,
IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb constant
region.
[0558] 7. A polypeptide comprising (in N- to C-terminal direction)
a leader sequence, a human variable domain that is specific for an
antigen and a human constant region that is an IGHAref, IGHA1a,
IGHA2a, IGHA2b, IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a,
IGHG3b, IGHG4ref, IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb
constant region; wherein (i) the leader sequence is not the native
human variable domain leader sequence (eg, the leader sequence is
another human leader sequence or a non-human leader sequence);
and/or (ii) the variable domain comprises mouse AID-pattern somatic
mutations or mouse terminal deoxynucleotidyl transferase
(TdT)-pattern junctional mutations.
[0559] 8. A nucleotide sequence encoding (in 5' to 3' direction) a
leader sequence and a human antibody heavy chain, the heavy chain
comprising a variable domain that is specific for an antigen and a
constant region that is an IGHAref, IGHA1a, IGHA2a, IGHA2b,
IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref,
IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb constant region;
and the leader sequence being operable for expression (eg, in a
mammalian CHO or HEK293 cell) of the heavy chain and wherein the
leader sequence is not the native human variable domain leader
sequence (eg, the leader sequence is another human leader sequence
or a non-human leader sequence).
[0560] In an example, the leader sequence is
TABLE-US-00001 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCCACCGCCACCGGCGT
GCACAGC
[0561] Which translates to
TABLE-US-00002 MGWSCIILFLVATATGVHS
[0562] 9. A nucleotide sequence encoding (in 5' to 3' direction) a
promoter and a human antibody heavy chain, the heavy chain
comprising a variable domain that is specific for an antigen and a
constant region that is an IGHAref, IGHA1a, IGHA2a, IGHA2b,
IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref,
IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb constant region;
and the promoter being operable for expression (eg, in a mammalian
CHO or HEK293 cell) of the heavy chain and wherein the promoter is
not the native human promoter.
[0563] In one embodiment, the promoter sequence is a human IGK 3-15
promoter.
[0564] 10. The antibody, polypeptide or nucleotide sequence of any
one of aspects 6 to 9, wherein the variable domain comprises mouse
AID-pattern somatic mutations and/or mouse terminal
deoxynucleotidyl transferase (TdT)-pattern junctional
mutations.
[0565] For example, one way, in any aspect of this configuration of
the invention, to provide mouse AID-pattern somatic mutations
and/or mouse terminal deoxynucleotidyl transferase (TdT)-pattern
junctional mutations is to select a variable domain from a
non-human vertebrate or cell. For example, a vertebrate or cell as
disclosed herein.
[0566] 11. A vector (eg, a CHO cell or HEK293 cell vector)
comprising the nucleic acid of aspect 8, 9 or 10; optionally
wherein the vector is in a host cell (eg, a CHO cell or HEK293
cell).
[0567] 12. A pharmaceutical composition comprising the antibody or
polypeptide of any one of aspects 6, 7 and 10, together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, antibody chain or
antibody).
[0568] 13. The antibody or polypeptide of any one of aspects 6, 7
and 10 for use in treating and/or preventing a medical condition in
a human patient.
[0569] 14. Use of the antibody or polypeptide of any one of aspects
6, 7 and 10 for the manufacture of a medicament for treating and/or
preventing a medical condition in a human patient.
[0570] 15. The antibody, polypeptide or use of aspect 13 or 14,
wherein the human is a member of a human population selected from
population numbers 1-14, wherein the populations are numbered as
follows (population labels being according to 1000 Genomes Project
nomenclature)
[0571] 1=ASW;
[0572] 2=CEU;
[0573] 3=CHB;
[0574] 4=CHS;
[0575] 5=CLM;
[0576] 6=FIN;
[0577] 7=GBR;
[0578] 8=IBS;
[0579] 9=JPT;
[0580] 10=LWK;
[0581] 11=MXL;
[0582] 12=PUR;
[0583] 13=TSI;
[0584] 14=YRI.
[0585] 16. The antibody, polypeptide or use of aspect 15, wherein
the constant region is a
[0586] (i) IGHA1a constant region and the human population is
selected from any population number 1-14;
[0587] (ii) IGHA2a constant region and the human population is
selected from any population number 1-14;
[0588] (iii) IGHA2b constant region and the human population is
selected from any population number 1-14;
[0589] (iv) IGHG2a constant region and the human population is
selected from any population number 1-9 and 11-13;
[0590] (v) IGHG3a constant region and the human population is
selected from any population number 1-14;
[0591] (vi) IGHG3b constant region and the human population is
selected from any population number 1-8 and 11-13;
[0592] (vii) IGHG4a constant region and the human population is
selected from any population number 1-9 and 11-13;
[0593] (viii) IGHMa constant region and the human population is
selected from any population number 1-14; or
[0594] (ix) IGHMb constant region and the human population is
selected from any population number 1-14;
[0595] Wherein the populations are numbered as follows (population
labels being according to 1000 Genomes Project nomenclature)
[0596] 1=ASW;
[0597] 2=CEU;
[0598] 3=CHB;
[0599] 4=CHS;
[0600] 5=CLM;
[0601] 6=FIN;
[0602] 7=GBR;
[0603] 8=IBS;
[0604] 9=JPT;
[0605] 10=LWK;
[0606] 11=MXL;
[0607] 12=PUR;
[0608] 13=TSI;
[0609] 14=YRI.
[0610] 17. A vector (eg, a CHO cell or HEK293 cell vector)
comprising a IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b,
IGHG4ref or IGHG4a constant region nucleotide sequence that is 3'
of a cloning site for the insertion of a human antibody heavy chain
variable domain nucleotide sequence, such that upon insertion of
such a variable domain sequence the vector comprises (in 5' to 3'
direction) a promoter, a leader sequence, the variable domain
sequence and the constant region sequence so that the vector is
capable of expressing a human antibody heavy chain when present in
a host cell.
[0611] The Present Invention Provides in a Sixth
Configuration--
[0612] Multiple Variants in the Same Genome Cis or Trans
[0613] The inventors' analysis has revealed groupings of
naturally-occurring human antibody gene segment variants as set out
in Table 13 and Table 14. This revealed the possibility of
producing transgenic genomes in non-human vertebrates and cells
wherein the genomes contain more than the natural human complement
of specific human gene segments. In one example, this can be
achieved by providing more than the natural human complement of a
specific gene segment type on one or both of the respective Ig
locus (eg, one or both chromosomes harbouring IgH in a mouse genome
or mouse cell genome).
[0614] To this End, this Configuration of the Invention Provides
the Following (as Set Out in Numbered Paragraphs):--
[0615] 1. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 3 human variable region gene segments of
the same type (eg, at least 3 human VH6-1 gene segments, at least 3
human JH6 gene segments, at least 3 human VK1-39 gene segments, at
least 3 human D2-2 gene segments or at least 3 human JK1 gene
segments), wherein at least two of the human gene segments are
variants that are not identical to each other.
[0616] For example, the genome comprises a variable region that
comprises V, D and J gene segments (for the variable region of a
heavy chain locus) or V and J gene segments (for the variable
region of a light chain locus) upstream of a constant region for
expression of heavy or light chains respectively.
[0617] In an alternative, the skilled person can choose to provide
more than the wild type human complement of a specific gene segment
type by providing several copies of one variant type of the human
gene segment. Thus, there is provided A non-human vertebrate (eg, a
mouse or rat) or a non-human vertebrate cell (eg, an ES cell or a
B-cell) having a genome comprising at least 3 human variable region
gene segments of the same type (eg, at least 3 human VH6-1 gene
segments, at least 3 human JH6 gene segments, at least 3 human
VK1-39 gene segments, at least 3 human D2-2 gene segments or at
least 3 human JK1 gene segments), wherein the human gene segments
are identical variants.
[0618] For example, the genome comprises a variable region that
comprises V, D and J gene segments (for the variable region of a
heavy chain locus) or V and J gene segments (for the variable
region of a light chain locus) upstream of a constant region for
expression of heavy or light chains respectively.
[0619] 2. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different non-endogenous variable
region gene segments of the same type (eg, at least 2 human VH6-1
gene segments, at least 3 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments) cis at the same Ig locus.
[0620] In an alternative, the skilled person can choose to provide
more than the wild type human complement of a specific gene segment
type by providing several copies of one variant type of the human
gene segment. Thus, there is provided
[0621] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 non-endogenous variable region gene segments
of the same variant type (eg, at least 2 human JH6*02 gene
segments) cis at the same Ig locus.
[0622] 3. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different human variable region gene
segments of the same type (eg, at least 2 human VH6-1 gene
segments, at least 2 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments) trans at the same Ig locus; and
optionally a third human gene segment of the same type, wherein the
third gene segment is cis with one of said 2 different gene
segments.
[0623] In an alternative, the skilled person can choose to provide
more than the wild type human complement of a specific gene segment
type by providing several copies of one variant type of the human
gene segment. Thus, there is provided A non-human vertebrate (eg, a
mouse or rat) or a non-human vertebrate cell (eg, an ES cell or a
B-cell) having a genome comprising at least 2 different human
variable region gene segments of the same variant type (eg, at
least 2 human JH6*02 gene segments) trans at the same Ig locus; and
optionally a third human gene segment of the same variant type,
wherein the third gene segment is cis with one of said 2 different
gene segments.
[0624] 4. A population of non-human vertebrates (eg, mice or rats)
comprising a repertoire of human variable region gene segments,
wherein the plurality comprises at least 2 human variable region
gene segments of the same type (eg, at least 2 human VH6-1 gene
segments, at least 2 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments), a first of said different gene
segments is provided in the genome of a first vertebrate of the
population, and a second of said different gene segments being
provided in the genome of a second vertebrate of the population,
wherein the genome of the first vertebrate does not comprise the
second gene segment.
[0625] 5. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different non-endogenous variable
region gene segments of the same type (eg, at least 2 human VH6-1
gene segments, at least 2 human JH6 gene segments, at least 2 human
VK1-39 gene segments, at least 2 human D2-2 gene segments or at
least 2 human JK1 gene segments), wherein the gene segments are
derived from the genome sequence of different human individuals
that are not genetically related over at least 3 generations.
[0626] 6. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 3 human variable region gene segments of the same type
(eg, at least 3 human VH6-1 gene segments, at least 3 human JH6
gene segments, at least 3 human VK1-39 gene segments, at least 3
human D2-2 gene segments or at least 3 human JK1 gene segments),
wherein at least two of the human gene segments are variants that
are not identical to each other.
[0627] 7. A method of enhancing the immunoglobulin gene diversity
of a non-human vertebrate (eg, a mouse or rat), the method
comprising providing the vertebrate with a genome comprising at
least 2 different non-endogenous variable region gene segments of
the same type (eg, at least 2 human VH6-1 gene segments, at least 2
human JH6 gene segments, at least 2 human VK1-39 gene segments, at
least 2 human D2-2 gene segments or at least 2 human JK1 gene
segments) cis at the same Ig locus.
[0628] 8. A method of enhancing the immunoglobulin gene diversity
of a non-human vertebrate (eg, a mouse or rat), the method
comprising providing the vertebrate with a genome comprising at
least 2 different human variable region gene segments of the same
type (eg, at least 2 human VH6-1 gene segments, at least 2 human
JH6 gene segments, at least 2 human VK1-39 gene segments, at least
2 human D2-2 gene segments or at least 2 human JK1 gene segments)
trans at the same Ig locus; and optionally a third human gene
segment of the same type, wherein the third gene segment is cis
with one of said 2 different gene segments.
[0629] 9. A method of providing an enhanced human immunoglobulin
variable region gene segment repertoire, the method comprising
providing a population of non-human vertebrates (eg, a mouse or
rat) comprising a repertoire of human variable region gene
segments, wherein the method comprises providing at least 2
different human variable region gene segments of the same type (eg,
at least 2 human VH6-1 gene segments, at least 2 human JH6 gene
segments, at least 2 human VK1-39 gene segments, at least 2 human
D2-2 gene segments or at least 2 human JK1 gene segments), wherein
a first of said different gene segments is provided in the genome
of a first vertebrate of the population, and a second of said
different gene segments is provided in the genome of a second
vertebrate of the population, wherein the genome of the first
vertebrate does not comprise the second gene segment.
[0630] 10. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 different non-endogenous variable region gene segments
of the same type (eg, at least 2 human VH6-1 gene segments, at
least 2 human JH6 gene segments, at least 2 human VK1-39 gene
segments, at least 2 human D2-2 gene segments or at least 2 human
JK1 gene segments), wherein the gene segments are derived from the
genome sequence of different human individuals that are not
genetically related over at least 3 generations.
[0631] 11. The vertebrate, cell or method of any preceding
paragraph, wherein at least 2 or 3 of said different gene segments
are provided cis at the same Ig locus in said genome.
[0632] 12. The vertebrate, cell or method of any preceding
paragraph, wherein the gene segments are derived from the genome
sequence of different human individuals that are not genetically
related over at least 3 generations.
[0633] 13. The vertebrate, cell or method of any preceding
paragraph, wherein the gene segments are derived from the genome
sequence of two or more different human individuals; optionally
wherein the different human individuals are from different human
populations.
[0634] 14. The vertebrate, cell or method of paragraph 13, wherein
the individuals are not genetically related.
[0635] 15. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 human variable region gene segments of the same type
(eg, at least 2 human VH6-1 gene segments, at least 2 human JH6
gene segments, at least 2 human VK1-39 gene segments, at least 2
human D2-2 gene segments or at least 2 human JK1 gene segments),
wherein the gene segments are derived from the genome sequence of
different human individuals that are not genetically related over
at least 3 generations; optionally wherein at least 2 or 3 of said
different gene segments are provided at the same Ig locus in said
genome.
[0636] 16. The method of paragraph 15, wherein the different human
individuals are from different human populations.
[0637] 17. The method of paragraph 15, wherein the individuals are
not genetically related.
[0638] 18. The vertebrate, cell or method of preceding paragraph,
wherein at least one of the different segments is a synthetic
mutant of a human germline gene segment.
[0639] 19. The vertebrate, cell or method of any preceding
paragraph, wherein each of said gene segments occurs in 10 or more
different human populations.
[0640] 20. The vertebrate, cell or method of preceding paragraph,
wherein each of said gene segments has a human frequency of 5% or
greater (eg, 10, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, or 95% or greater).
[0641] In this respect, the skilled person can be guided by the
information provided in Table 14. Frequency can, for example, be
cumulative frequency in the 1000 Genomes database.
[0642] 21. The vertebrate, cell or method of paragraph 20, wherein
each of said gene segments occurs in 10 or more different human
populations.
[0643] 22. The vertebrate, cell or method of any preceding
paragraph, wherein each of said gene segments occurs in the 1000
Genomes database in more than 50 individuals.
[0644] 23. The vertebrate, cell or method of preceding paragraph,
wherein each of said gene segments (i) has a human frequency of 5%
or greater (eg, 10, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, or 95% or greater); and (ii) occurs in 10 or more
different human populations.
[0645] In this respect, the skilled person can be guided by the
information provided in Table 14.
[0646] Frequency can, for example, be cumulative frequency in the
1000 Genomes database.
[0647] 24. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising first and second human Ig locus gene segments of
the same type (eg, first and second human JH6 gene segments; or
first and second IgG2 gene segments; or first and second human
J.lamda.7 gene segments), wherein the first gene segment is a gene
segment selected from Table 14 (eg, IGHJ6-a) and the second gene
segment is the corresponding reference sequence (eg, IGHJ6 ref; SEQ
ID NO: 244).
[0648] Table 14 lists commonly-occurring natural human variants. It
can be seen that these occur across many human populations and thus
usefully have wide applicability for human antibody-based
drugs.
[0649] For example, the gene segments are provided as targeted
insertions into an endogenous non-human vertebrate Ig locus.
Alternatively, random integration (eg, using YACs) as is know in
the art can be performed.
[0650] For example, the genome comprises a variable region that
comprises V, D and J gene segments (for the variable region of a
heavy chain locus) or V and J gene segments (for the variable
region of a light chain locus) upstream of a constant region for
expression of heavy or light chains respectively.
[0651] In another embodiment, the invention enables the skilled
person to select two or more different naturally-occurring human
gene segment variants for combination into the genome of a
non-human vertebrate or cell. A reference sequence need not be
included. It may be desirable to use one or more rare gene segments
to increase diversity of the repertoire. Additionally or
alternatively, it may be desirable to include a mixture of frequent
and rare variants of the same type to provide repertoire diversity.
The variants may be chosen additionally or alternatively to tailor
the gene segment inclusion to one or more specific human
populations as indicated by the information provided in Table 13 or
Table 14.
[0652] Thus, the invention provides
[0653] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising first and second human Ig locus gene segments of the
same type (eg, first and second human JH6 gene segments; or first
and second IgG2 gene segments; or first and second human J.lamda.7
gene segments), wherein the gene segments are gene segments
selected from Table 13 or Table 14; and optionally wherein one or
more of the gene segments appears in Table 14 (eg, IGHJ6-a) or is a
reference sequence (eg, IGHJ6 ref; SEQ ID NO: 244).
[0654] 25. The vertebrate or cell of paragraph 24, wherein the
genome comprises a third human gene segment of said type, the third
gene segment being different from the first and second gene
segments.
[0655] 26. The vertebrate or cell of paragraph 24 or 25, wherein
the first and second gene segments are cis on the same chromosome;
and optionally the third gene segment is also cis on said
chromosome.
[0656] 27. The vertebrate or cell of paragraph 26, wherein the gene
segments are targeted insertions into an endogenous non-human Ig
locus.
[0657] For example, the gene segments are heavy chain gene segments
and the non-human locus is an IgH locus. For example, the gene
segments are light chain (kappa or lambda) gene segments and the
non-human locus is an IgL locus.
[0658] 28. The vertebrate or cell of paragraph 24 or 25, wherein
the first and second gene segments are trans on different
chromosomes.
[0659] Thus, the chromosomes are the same type (eg, both mouse
chromosome 6 or rat chromosome 4).
[0660] 29. The vertebrate or cell of any one of paragraphs 24 to
28, wherein the first gene segment is a gene segment selected from
any one of Tables 1 to 7 and 9 to 14 (eg, selected from Table 13 or
14) and the second gene segment is the corresponding reference
sequence.
[0661] 30. A population of non-human vertebrates (eg, mice or rats)
comprising first and second human Ig locus gene segments of the
same type (eg, first and second human JH6 gene segments; or first
and second IgG2 gene segments; or first and second human J.lamda.7
gene segments), wherein the first gene segment is a gene segment
selected from any one of Tables 1 to 7 and 9 to 14 (eg, Table 13 or
14) (eg, IGHJ6-a) and the second gene segment is the corresponding
reference sequence (eg, SEQ ID NO: 7), wherein the first gene
segment is provided in the genome of a first vertebrate of the
population, and the second gene segment is provided in the genome
of a second vertebrate of the population.
[0662] 31. The population of paragraph 30, wherein the genome of
the first vertebrate does not comprise the second gene segment.
[0663] 32. The population of paragraph 30 or 31, wherein the
population comprises a third human gene segment of said type, the
third gene segment being different from the first and second gene
segments and optionally wherein the first and third gene segments
are present in the genome of the first vertebrate.
[0664] 33. The population of paragraph 30, 31 or 32, wherein the
gene segments are targeted insertions into an endogenous non-human
Ig locus in the respective genome.
[0665] For example, the gene segments are heavy chain gene segments
and the non-human locus is an IgH locus. For example, the gene
segments are light chain (kappa or lambda) gene segments and the
non-human locus is an IgL locus.
[0666] 34. The population of any one of paragraphs 30 to 33,
wherein the first gene segment is a gene segment selected from any
one of Tables 1 to 7 and 9 to 14 (eg, Table 13 or 14) and the
second gene segment is the corresponding reference sequence.
[0667] 35. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
first and second human Ig locus gene segments of the same type (eg,
first and second human JH6 gene segments; or first and second IgG2
gene segments; or first and second human J.lamda.7 gene segments),
wherein the first gene segment is a gene segment selected from any
one of Tables 1 to 7 and 9 to 14 (eg, Table 13 or 14) (eg, IGHJ6-a)
and the second gene segment is the corresponding reference sequence
(eg, SEQ ID NO: 7).
[0668] 36. A method of providing an enhanced human immunogolobulin
gene segment repertoire, the method comprising providing a
population according to any one of paragraphs 30 to 33.
[0669] Variants Prevalent in Few Populations
[0670] In another aspect, it is of note that certain human gene
segment variants may appear relatively frequently in one or a small
number of populations, but is not found prevalently across many
different human populations. There is thinking that specific
germline gene segment repertoires have evolved in individual human
ethnic populations due to iterative exposure to antigens (eg,
disease pathogen antigens) to which the population is often
exposed. Repeated exposure and mutation may have lead to the
evolution of gene segment variants that can provide an effective
response to the antigen (pathogen) in the population, and this may
explain the conservation of the gene segments in those populations
(as opposed to other human ethnic populations that may not have
frequently encountered the antigen). With this in mind, the
inventors identified gene segment variants from their analysis that
are relatively prevalent in a small number of human populations,
and not across many populations. The inventors realized that
inclusion of one or more of such gene segments in the
configurations of the invention (eg, in transgenic Ig loci,
vertebrates and cells) would be useful for producing antibodies, Ig
chains and variable domains that can address antigens (eg,
disease-causing antigens or pathogens) to which the small number of
human populations may become exposed. Such products would be useful
for treating and/or preventing disease or medical conditions in
members of such a population. This aspect could also be useful for
addressing infectious disease pathogens that may have been common
in the small number of populations, but which in the future or
relatively recently in evolution has become a more prevalent
disease-causing pathogen in other human populations (ie, those not
listed in Table 13 against the gene segment variant(s) in
question). To this end, from the 1000 Genomes database the
inventors have identified the gene segment variants listed in Table
20.
[0671] Thus, according to any configuration or aspect described
herein, one, more or all of the gene segments used in the present
invention can be a gene segment listed in Table 20A, 20B, 20C or
20D.
[0672] Multiple JH Gene Segment Variants
[0673] A specific application of this configuration is the
provision of multiple human JH gene segments as follows.
[0674] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 3 human JH gene segments of the same type (JH1,
JH2, JH3, JH4, JH5 or JH6), wherein at least two of the human JH
gene segments are variants that are not identical to each
other.
[0675] In an example, any cell of the invention is an isolated
cell. An "isolated" cell is one that has been identified, separated
and/or recovered from a component of its production environment
(eg, naturally or recombinantly). Preferably, the isolated cell is
free of association with all other components from its production
environment, eg, so that the cell can produce an antibody to an
FDA-approvable or approved standard. Contaminant components of its
production environment, such as that resulting from recombinant
transfected cells, are materials that would typically interfere
with research, diagnostic or therapeutic uses for the resultant
antibody, and may include enzymes, hormones, and other
proteinaceous or non-proteinaceous solutes. In preferred
embodiments, the polypeptide will be purified: (1) to greater than
95% by weight of antibody as determined by, for example, the Lowry
method, and in some embodiments, to greater than 99% by weight; (2)
to a degree sufficient to obtain at least 15 residues of N-terminal
or internal amino acid sequence by use of a spinning cup
sequenator, or (3) to homogeneity by SDS-PAGE under non-reducing or
reducing conditions using Coomassie blue or, preferably, silver
stain. Ordinarily, however, an isolated cell will be prepared by at
least one purification step.
[0676] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 different non-endogenous JH gene segments
(eg, human gene segments) of the same type (JH1, JH2, JH3, JH4, JH5
or JH6) cis at the same Ig (eg, IgH, eg, endogenous IgH, eg, mouse
or rat IgH) locus. In an example, the genome comprises a human VH,
D and JH repertoire comprising said different JH gene segments.
Optionally the non-endogenous JH gene segments are non-mouse or
non-rat, eg, human JH gene segments. In an example one or more or
all of the non-endogenous gene segments are synthetic.
[0677] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 different human JH gene segments of the same
type (JH1, JH2, JH3, JH4, JH5 or JH6) trans at the same Ig (eg,
IgH, eg, endogenous IgH, eg, mouse or rat IgH) locus; and
optionally a third human JH gene segments of the same type, wherein
the third JH is cis with one of said 2 different JH gene
segments.
[0678] A population of non-human vertebrates (eg, mice or rats)
comprising a repertoire of human JH gene segments, wherein the
plurality comprises at least 2 different human JH gene segments of
the same type (JH1, JH2, JH3, JH4, JH5 or JH6), a first of said
different JH gene segments is provided in the genome of a first
vertebrate of the population, and a second of said different JH
gene segments being provided in the genome of a second vertebrate
of the population, wherein the genome of the first vertebrate does
not comprise the second JH gene segment.
[0679] A non-human vertebrate (eg, a mouse or rat) or a non-human
vertebrate cell (eg, an ES cell or a B-cell) having a genome
comprising at least 2 different non-endogenous (eg, human) JH gene
segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein
the JH gene segments are derived from the genome sequence of
different human individuals that are not genetically related over
at least 3 generations (eg, 3, 4, 5 or 6 generations). Optionally
the non-endogenous JH gene segments are human JH gene segments. In
an example one or more or all of the non-endogenous gene segments
are synthetic.
[0680] A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 3 human JH gene segments of the same type (JH1, JH2, JH3,
JH4, JH5 or JH6), wherein at least two of the human JH gene
segments are variants that are not identical to each other.
[0681] A method of enhancing the immunoglobulin gene diversity of a
non-human vertebrate (eg, a mouse or rat), the method comprising
providing the vertebrate with a genome comprising at least 2
different non-endogenous (eg, human) JH gene segments of the same
type (JH1, JH2, JH3, JH4, JH5 or JH6) cis at the same Ig (eg, IgH,
eg, endogenous IgH, eg, mouse or rat IgH) locus). Optionally the
non-endogenous JH gene segments are non-mouse or non-rat, eg, human
JH gene segments. In an example one or more or all of the
non-endogenous gene segments are synthetic.
[0682] A method of enhancing the immunoglobulin gene diversity of a
non-human vertebrate (eg, a mouse or rat), the method comprising
providing the vertebrate with a genome comprising at least 2
different human JH gene segments of the same type (JH1, JH2, JH3,
JH4, JH5 or JH6) trans at the same Ig (eg, IgH, eg, endogenous IgH,
eg, mouse or rat IgH) locus; and optionally a third human JH gene
segments of the same type, wherein the third JH is cis with one of
said 2 different JH gene segments.
[0683] A method of providing an enhanced human immunoglobulin JH
gene segment repertoire, the method comprising providing a
population of non-human vertebrates (eg, a mouse or rat) comprising
a repertoire of human JH gene segments, wherein the method
comprises providing at least 2 different human JH gene segments of
the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein a first of
said different JH gene segments is provided in the genome of a
first vertebrate of the population, and a second of said different
JH gene segments is provided in the genome of a second vertebrate
of the population, wherein the genome of the first vertebrate does
not comprise the second JH gene segment.
[0684] A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 different non-endogenous (eg, human) JH gene segments of
the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene
segments are derived from the genome sequence of different human
individuals that are not genetically related over at least 3
generations (eg, 3, 4, 5, or 6 generations). Optionally the
non-endogenous JH gene segments are human JH gene segments. In an
example one or more or all of the non-endogenous gene segments are
synthetic.
[0685] In an example of the vertebrate or cell or the method of the
invention at least 2 or 3 of said different gene segments are
provided cis at the same Ig locus in said genome.
[0686] In an example of the vertebrate or cell or the method of the
invention the JH gene segments are derived from the genome sequence
of different human individuals that are not genetically related
over at least 3 generations (eg, 3, 4, 5, or 6 generations).
[0687] In an example of the vertebrate or cell or the method of the
invention the JH gene segments are derived from the genome sequence
of two or more different human individuals; optionally wherein the
different human individuals are from different human
populations.
[0688] In an example of the vertebrate or cell or the method of the
invention the individuals are not genetically related (eg, going
back 3, 4, 5, or 6 generations).
[0689] In an example of the vertebrate or cell or the method of the
invention at least one of the different JH segments is a synthetic
mutant of a human germline JH gene segment.
[0690] The invention also provides a method of enhancing the human
immunoglobulin gene diversity of a non-human vertebrate (eg, a
mouse or rat), the method comprising providing the vertebrate with
a genome comprising at least 2 human JH gene segments of the same
type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene segments
are derived from the genome sequence of different human individuals
that are not genetically related over at least 3 generations (eg,
3, 4, 5, or 6 generations); optionally wherein at least 2 or 3 of
said different gene segments are provided at the same IgH locus in
said genome.
[0691] In an example of the vertebrate or cell or the method of
this embodiment of the invention the genome comprises a
substantially complete functional repertoire of human JH gene
segment types supplemented with one, two or more human JH gene
segments, wherein said substantially complete functional repertoire
and the supplementary JH gene segments are not found together in
the germline genome of a human individual.
[0692] In an example of the population of the invention, the
population comprises a substantially complete functional repertoire
of human JH gene segment types supplemented with one, two or more
human JH gene segments, wherein said substantially complete
functional repertoire and the supplementary JH gene segments are
not found together in the germline genome of a human
individual.
[0693] A non-human vertebrate (eg, a mouse or rat) or a non-human
cell (eg, an ES cell or a B-cell) having a genome comprising a
substantially complete functional repertoire of human JH gene
segment types supplemented with one, two or more human JH gene
segments, wherein said substantially complete functional repertoire
and the supplementary JH gene segments are not found together in
the germline genome of a human individual.
[0694] A population of non-human vertebrates (eg, mice or rats)
comprising a substantially complete functional repertoire of human
JH gene segment types supplemented with one, two or more human JH
gene segments, wherein said substantially complete functional
repertoire and the supplementary JH gene segments are not found
together in the germline genome of a human individual.
[0695] In an example of the vertebrate or the population, at least
one of said JH gene segments is SEQ ID NO: 1, 2, 3 or 4. For
example, at least one of said JH gene segments is SEQ ID NO: 1 and
at least one, two or more of said supplementary JH gene segments is
a variant according to any example above. For example, at least one
of said JH gene segments is SEQ ID NO: 2 and at least one, two or
more of said supplementary JH gene segments is a variant according
to any one of the examples above. For example, at least one of said
JH gene segments is SEQ ID NO: 2 and at least one, two or more of
said supplementary JH gene segments is a variant according to any
one of the examples above.
[0696] In an embodiment, the non-human vertebrate or vertebrate
cell of the invention comprises a genome that comprises VH, D and
JH gene repertoires comprising human gene segments, the JH gene
repertoire (eg, a human JH gene segment repertoire) comprising a
plurality of JH1 gene segments provided by at least 2 different JH1
gene segments in cis at the same Ig locus in said genome;
[0697] a plurality of JH2 gene segments provided by at least 2
different JH2 gene segments in cis at the same Ig locus in said
genome;
[0698] a plurality of JH3 gene segments provided by at least 2
different JH3 gene segments in cis at the same Ig locus in said
genome;
[0699] a plurality of JH4 gene segments provided by at least 2
different JH4 gene segments in cis at the same Ig locus in said
genome;
[0700] a plurality of JH5 gene segments provided by at least 2
different JH5 gene segments in cis at the same Ig locus in said
genome; and/or
[0701] a plurality of JH6 gene segments provided by at least 2
different JH6 gene segments in cis at the same Ig locus in said
genome;
[0702] optionally wherein the JH gene segments are derived from the
genome sequence of two or more different human individuals.
[0703] Optionally said at least 2 different JH gene segments are
human gene segments or synthetic gene segments derived from human
gene segments.
[0704] Optionally, the Ig locus is a IgH locus, eg, an endogenous
locus, eg, a mouse or rat IgH locus.
[0705] In an embodiment, the non-human vertebrate or vertebrate
cell of the invention comprises a genome that comprises VH, D and
JH gene repertoires comprising human gene segments, the JH gene
repertoire (eg, a human JH gene segment repertoire) comprising a
plurality of JH1 gene segments provided by at least 3 different JH1
gene segments; a plurality of JH2 gene segments provided by at
least 3 different JH2 gene segments; a plurality of JH3 gene
segments provided by at least 3 different JH3 gene segments; a
plurality of JH4 gene segments provided by at least 3 different JH4
gene segments; a plurality of JH5 gene segments provided by at
least 3 different JH5 gene segments; and/or a plurality of JH6 gene
segments provided by at least 3 different JH6 gene segments;
optionally wherein the JH gene segments are derived from the genome
sequence of two or three different human individuals;
[0706] optionally wherein at least 2 or 3 of said different gene
segments are provided in cis at the same Ig locus in said
genome.
[0707] Optionally said at least 3 different JH gene segments are
human gene segments or synthetic gene segments derived from human
gene segments.
[0708] Optionally, the Ig locus is a IgH locus, eg, an endogenous
locus, eg, a mouse or rat IgH locus.
[0709] Optionally in the vertebrate or cell the different human
individuals are from different human populations.
[0710] Optionally in the vertebrate or cell the individuals are not
genetically related (eg, Going back 3, 4, 5 or 6 generations).
[0711] Optionally in the vertebrate or cell at least one of the
different JH segments is a synthetic mutant of a human germline JH
gene segment.
[0712] In an embodiment of a non-human vertebrate or vertebrate
cell (optionally an ES cell or B-cell) according to the invention,
the vertebrate or cell genome comprises human VH, D and JH gene
repertoires, the JH gene repertoire (eg, a human JH gene
repertoire) comprising a plurality of JH1 gene segments provided by
at least 2 different human JH1 gene segments, optionally in cis at
the same Ig locus in said genome;
[0713] a plurality of JH2 gene segments provided by at least 2
different human JH2 gene segments, optionally in cis at the same Ig
locus in said genome;
[0714] a plurality of JH3 gene segments provided by at least 2
different human JH3 gene segments, optionally in cis at the same Ig
locus in said genome;
[0715] a plurality of JH4 gene segments provided by at least 2
different human JH4 gene segments, optionally in cis at the same Ig
locus in said genome;
[0716] a plurality of JH5 gene segments provided by at least 2
different human JH5 gene segments, optionally in cis at the same Ig
locus in said genome; and/or
[0717] a plurality of JH6 gene segments provided by at least 2
different human JH6 gene segments, optionally in cis at the same Ig
locus in said genome;
[0718] wherein the JH gene segments are derived from the genome
sequence of different human individuals that are not genetically
related over at least 3 generations (eg, 3, 4, 5 or 6
generations).
[0719] Optionally said at least 2 different JH gene segments are
human gene segments or synthetic gene segments derived from human
gene segments.
[0720] Optionally, the Ig locus is a IgH locus, eg, an endogenous
locus, eg, a mouse or rat IgH locus. Optionally in the vertebrate
or cell the human individuals are from different human
populations.
[0721] JH5
[0722] An embodiment provides a vertebrate, cell or population of
the invention whose genome comprises a plurality of JH5 gene
segments, wherein the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a nucleotide
mutation at one or more positions corresponding to positions
[0723] 106,330,024
[0724] 106,330,027
[0725] 106,330,032
[0726] 106,330,041
[0727] 106.330.44
[0728] 106.330.45
[0729] 106.330.62
[0730] 106.330.63
[0731] 106.330.65
[0732] 106.330.66
[0733] 106.330.67
[0734] 106.330.68 and
[0735] 106,330,071
[0736] on human chromosome 14.
[0737] In the vertebrate, cell or population optionally the
plurality comprises a human JH5 gene variant of SEQ ID NO: 1,
wherein the variant comprises a guanine at a position corresponding
to position 106,330,067 on human chromosome 14; and optionally no
further mutation from the sequence of SEQ ID NO: 1.
[0738] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106,330,071 on human
chromosome 14 (optionally the additional mutation being a guanine);
(ii) position 106,330,066 on human chromosome 14 (optionally the
additional mutation being a guanine); and/or (iii) position
106,330,068 on human chromosome 14 (optionally the additional
mutation being a thymine).
[0739] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a guanine at a
position corresponding to position 106,330,071 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0740] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106,330,063 on human
chromosome 14 (optionally the additional mutation being an
adenine); and/or (ii) position 106,330,067 on human chromosome 14
(optionally the additional mutation being a guanine).
[0741] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a cytosine at a
position corresponding to position 106,330,045 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0742] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises an adenine at a
position corresponding to position 106,330,044 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0743] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106.330.66 on human
chromosome 14 (optionally the additional mutation being a guanine);
and/or (ii) position 106,330,068 on human chromosome 14 (optionally
the additional mutation being a thymine).
[0744] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a guanine at a
position corresponding to position 106,330,066 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0745] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106.330.67 on human
chromosome 14 (optionally the additional mutation being a
guanine);
[0746] and/or (ii) position 106,330,068 on human chromosome 14
(optionally the additional mutation being a thymine).
[0747] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a thymine at a
position corresponding to position 106,330,068 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0748] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106,330,067 on human
chromosome 14 (optionally the additional mutation being a guanine);
and/or (ii) position 106,330,066 on human chromosome 14 (optionally
the additional mutation being a guanine).
[0749] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a cytosine at a
position corresponding to position 106,330,027 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0750] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises an adenine at a
position corresponding to position 106,330,024 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0751] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a thymine at a
position corresponding to position 106,330,032 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0752] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a thymine at a
position corresponding to position 106,330,041 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0753] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises an adenine or
thymine at a position corresponding to position 106,330,063 on
human chromosome 14; and optionally no further mutation from the
sequence of SEQ ID NO: 1.
[0754] Optionally the variant comprises additionally a mutation at
a position corresponding to position 106,330,071 on human
chromosome 14 (optionally the additional mutation being a
guanine).
[0755] Optionally the plurality comprises a human JH5 gene variant
of SEQ ID NO: 1, wherein the variant comprises a cytosine at a
position corresponding to position 106,330,062 on human chromosome
14; and optionally no further mutation from the sequence of SEQ ID
NO: 1.
[0756] Optionally the genome comprises SEQ ID NO:1; optionally in
cis at the same Ig locus as one, two or more of the variants.
[0757] JH6
[0758] An embodiment provides a vertebrate, cell or population of
the invention whose genome comprises a plurality of JH6 gene
segments, wherein the plurality comprises a human JH6 gene variant
of SEQ ID NO: 2, wherein the variant comprises a nucleotide
mutation at one or more positions corresponding to positions
[0759] 106,329,411
[0760] 106.329.413
[0761] 106.329.414
[0762] 106,329,417
[0763] 106,329,419
[0764] 106,329,426
[0765] 106,329,434
[0766] 106,329,435, and
[0767] 106,329,468
[0768] on human chromosome 14.
[0769] Optionally the genome of the vertebrate, cell or population
comprises a plurality of JH6 gene segments, wherein the plurality
comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the
variant comprises a guanine at a position corresponding to position
106,329,435 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 2.
[0770] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106,329,468 on human
chromosome 14 (optionally the additional mutation being a guanine);
(ii) position 106,329,419 on human chromosome 14 (optionally the
additional mutation being an adenine); (iii) position 106,329,434
on human chromosome 14 (optionally the additional mutation being a
cytosine) and/or position 106,329,414 on human chromosome 14
(optionally the additional mutation being a guanine); (iv) position
106,329,426 on human chromosome 14 (optionally the additional
mutation being an adenine); (v) position 106,329,413 on human
chromosome 14 (optionally the additional mutation being an
adenine); (vi) position 106,329,417 on human chromosome 14
(optionally the additional mutation being a thymine); (vii)
position 106,329,411 on human chromosome 14 (optionally the
additional mutation being a thymine); (viii) position 106,329,451
on human chromosome 14 (optionally the additional mutation being an
adenine); (ix) position 106,329,452 on human chromosome 14
(optionally the additional mutation being a cytosine); and/or (x)
position 106,329,453 on human chromosome 14 (optionally the
additional mutation being a cytosine).
[0771] Optionally the variant comprises additionally mutations at
positions corresponding to position 106.329.451 on human chromosome
14, the additional mutation being an adenine; position 106.329.452
on human chromosome 14, the additional mutation being a cytosine;
and position 106.329.453 on human chromosome 14, the additional
mutation being a cytosine.
[0772] The vertebrate, cell or population optionally comprises a
plurality of JH6 gene segments, wherein the plurality comprises a
human JH6 gene variant of SEQ ID NO: 2, wherein the variant
comprises a guanine at a position corresponding to position
106,329,468 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 2.
[0773] Optionally the variant comprises additionally a mutation at
a position corresponding to position 106,329,435 on human
chromosome 14 (optionally the additional mutation being a
guanine).
[0774] Optionally the vertebrate, cell or population comprises a
plurality of JH6 gene segments, wherein the plurality comprises a
human JH6 gene variant of SEQ ID NO: 2, wherein the variant
comprises a thymine at a position corresponding to position
106,329,417 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 2.
[0775] Optionally the variant comprises additionally a mutation at
a position corresponding to position 106,329,435 on human
chromosome 14 (optionally the additional mutation being a
guanine).
[0776] Optionally the vertebrate, cell or population comprises a
plurality of JH6 gene segments, wherein the plurality comprises a
human JH6 gene variant of SEQ ID NO: 2, wherein the variant
comprises a cytosine at a position corresponding to position
106,329,434 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 2.
[0777] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106,329,414 on human
chromosome 14 (optionally the additional mutation being a guanine);
and/or (ii) position 106,329,435 on human chromosome 14 (optionally
the additional mutation being a guanine).
[0778] Optionally the vertebrate, cell or population comprises a
plurality of JH6 gene segments, wherein the plurality comprises a
human JH6 gene variant of SEQ ID NO: 2, wherein the variant
comprises a thymine at a position corresponding to position
106,329,411 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 2.
[0779] Optionally the variant comprises additionally a mutation at
a position corresponding to position 106,329,435 on human
chromosome 14 (optionally the additional mutation being a
guanine).
[0780] Optionally the vertebrate, cell or population comprises a
plurality of JH6 gene segments, wherein the plurality comprises a
human JH6 gene variant that is an antisense sequence of a variant
described above.
[0781] Optionally the genome comprises SEQ ID NO:2; optionally cis
at the same Ig locus as one, two or more of the JH6 variants.
[0782] JH2
[0783] An embodiment provides a vertebrate, cell or population of
the invention whose genome comprises a plurality of JH2 gene
segments, wherein the plurality comprises a human JH2 gene variant
of SEQ ID NO: 3, wherein the variant comprises a nucleotide
mutation at one or more positions corresponding to positions
[0784] 106,331,455
[0785] 106,331,453, and
[0786] 106,331,409
[0787] on human chromosome 14.
[0788] Optionally the vertebrate, cell or population comprises said
plurality of JH2 gene segments, wherein the plurality comprises a
human JH2 gene variant of SEQ ID NO: 3, wherein the variant
comprises a guanine at a position corresponding to position
106,331,455 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 3.
[0789] Optionally the variant comprises additionally a mutation at
a position corresponding to (i) position 106,331,453 on human
chromosome 14 (optionally the additional mutation being an
adenine); and/or (ii) position 106,331,409 on human chromosome 14
(optionally the additional mutation being an adenine); (iii)
position 106,329,434 on human chromosome 14 (optionally the
additional mutation being an adenine).
[0790] Optionally the vertebrate, cell or population comprises a
plurality of JH2 gene segments, wherein the plurality comprises a
human JH2 gene variant of SEQ ID NO: 3, wherein the variant
comprises an adenine at a position corresponding to position
106,331,453 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 3.
[0791] Optionally the variant comprises additionally a mutation at
a position corresponding to position 106,331,409 on human
chromosome 14 (optionally the additional mutation being an
adenine).
[0792] Optionally the vertebrate, cell or population comprises a
plurality of JH2 gene segments, wherein the plurality comprises a
human JH2 gene variant of SEQ ID NO: 3, wherein the variant
comprises an adenine at a position corresponding to position
106,331,409 on human chromosome 14; and optionally no further
mutation from the sequence of SEQ ID NO: 3.
[0793] Optionally the vertebrate, cell or population comprises a
plurality of JH2 gene segments, wherein the plurality comprises a
human JH2 gene variant that is an antisense sequence of a variant
described above.
[0794] Optionally the genome comprises SEQ ID NO:3; optionally cis
at the same Ig locus as one, two or more of the JH2 variants.
[0795] Optionally the vertebrate, cell or population genome
comprises two or more different JH gene segments selected from SEQ
ID NOs: 1 to 3 and variants described above; optionally wherein
said JH gene segments are cis at the same immunoglobulin Ig
locus.
[0796] Multiple Human D Gene Segment Variants
[0797] A specific application of this configuration is the
provision of multiple human D gene segments as follows (as set out
in numbered clauses, starting at clause number 154).
[0798] 154. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 3 human D gene segments of the same type
(eg, D2-2 gene segments), wherein at least two of the human D gene
segments are variants that are not identical to each other (eg,
D2-2ref and D2-2a).
[0799] In an example of any aspect of the sixth configuration of
the invention (V, D, J or C), one or more or all of the variants
are naturally-occurring human gene segments.
[0800] In an example of any aspect of the sixth configuration of
the invention (V, D, J or C), one or more of the variants may be a
synthetic variant of a human gene segment.
[0801] 155. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different non-endogenous D gene
segments of the same type (eg, D2-2ref and D2-2a) cis at the same
Ig locus.
[0802] 156. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different human D gene segments of the
same type (eg, D2-2ref and D2-2a) trans at the same Ig locus; and
optionally a third human D gene segment (eg, (eg, D2-2ref, D2-2a or
D2-2b) of the same type, wherein the third D is cis with one of
said 2 different D gene segments.
[0803] 157. A population of non-human vertebrates (eg, mice or
rats) comprising a repertoire of human D gene segments, wherein the
plurality comprises at least 2 different human D gene segments of
the same type (eg, D2-2 gene segments), a first of said different D
gene segments (eg, D2-2ref) is provided in the genome of a first
vertebrate of the population, and a second of said different D gene
segment (eg, D2-2a) being provided in the genome of a second
vertebrate of the population, wherein the genome of the first
vertebrate does not comprise the second D gene segment.
[0804] 158. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different non-endogenous D gene
segments of the same type (eg, human D2-2 gene segments), wherein
the D gene segments are derived from the genome sequence of
different human individuals that are not genetically related over
at least 3 generations.
[0805] 159. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 3 human D gene segments of the same type (eg, D2-2 gene
segments), wherein at least two of the human D gene segments are
variants that are not identical to each other (eg, D2-2ref and
D2-2a).
[0806] 160. A method of enhancing the immunoglobulin gene diversity
of a non-human vertebrate (eg, a mouse or rat), the method
comprising providing the vertebrate with a genome comprising at
least 2 different non-endogenous D gene segments of the same type
(eg, human D2-2 gene segments) cis at the same Ig locus.
[0807] 161. A method of enhancing the immunoglobulin gene diversity
of a non-human vertebrate (eg, a mouse or rat), the method
comprising providing the vertebrate with a genome comprising at
least 2 different human D gene segments of the same type (eg,
D2-2ref and D2-2a) trans at the same Ig locus; and optionally a
third human D gene segment (eg, D2-2ref, D2-2a or D2-2b) of the
same type, wherein the third D is cis with one of said 2 different
D gene segments.
[0808] 162. A method of providing an enhanced human immunoglobulin
D gene segment repertoire, the method comprising providing a
population of non-human vertebrates (eg, a mouse or rat) comprising
a repertoire of human D gene segments, wherein the method comprises
providing at least 2 different human D gene segments of the same
type (eg, D2-2ref and D2-2a), wherein a first of said different D
gene segments is provided in the genome of a first vertebrate of
the population, and a second of said different D gene segments is
provided in the genome of a second vertebrate of the population,
wherein the genome of the first vertebrate does not comprise the
second D gene segment.
[0809] 163. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 different non-endogenous D gene segments of the same
type (eg, D2-2ref and D2-2a), wherein the D gene segments are
derived from the genome sequence of different human individuals
that are not genetically related over at least 3 generations.
[0810] 164. The vertebrate or cell of clause 154, 156 or 158, or
the method of clause 159, 161 or 163, wherein at least 2 or 3 of
said different gene segments are provided cis at the same Ig locus
in said genome.
[0811] 165. The vertebrate or cell of clause 154, 155 or 156, or
the method of any one of clauses 159 to 162 and 164, wherein the D
gene segments are derived from the genome sequence of different
human individuals that are not genetically related over at least 3
generations.
[0812] 166. The vertebrate or cell of any one of clauses 154 to
157, or the method of any one of clauses 159 to 162 and 165,
wherein the D gene segments are derived from the genome sequence of
two or more different human individuals; optionally wherein the
different human individuals are from different human
populations.
[0813] 167. The vertebrate, cell or method of clause 166, wherein
the individuals are not genetically related.
[0814] 168. The vertebrate, cell or method of any one of clauses
154 to 167, wherein at least one of the different D segments is a
synthetic mutant of a human germline D gene segment.
[0815] 169. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 human D gene segments of the same type (eg, D2-2ref and
D2-2a), wherein the D gene segments are derived from the genome
sequence of different human individuals that are not genetically
related over at least 3 generations; optionally wherein at least 2
or 3 of said different gene segments are provided at the same IgH
locus in said genome.
[0816] 170. The vertebrate or cell of any one of clauses 154 to 158
and 164 to 168, wherein the genome comprises a substantially
complete functional repertoire of human D gene segment types
supplemented with one, two or more variant human D gene segments,
wherein said substantially complete functional repertoire and the
supplementary D gene segments are not found together in the
germline genome of a human individual.
[0817] 171. The population of clause 157, wherein the population
comprises a substantially complete functional repertoire of human D
gene segment types supplemented with one, two or more variant human
D gene segments, wherein said substantially complete functional
repertoire and the supplementary D gene segments are not found
together in the germline genome of a human individual.
[0818] 172. A non-human vertebrate (eg, a mouse or rat) or a
non-human cell (eg, an ES cell or a B-cell) having a genome
comprising a substantially complete functional repertoire of human
D gene segment types supplemented with one, two or more variant
human D gene segments, wherein said substantially complete
functional repertoire and the supplementary D gene segments are not
found together in the germline genome of a human individual.
[0819] 173. A population of non-human vertebrates (eg, mice or
rats) comprising a substantially complete functional repertoire of
human JH gene segment types supplemented with one, two or more
variant human D gene segments, wherein said substantially complete
functional repertoire and the supplementary D gene segments are not
found together in the germline genome of a human individual.
[0820] 174. The vertebrate or cell of clause 172 or the population
of clause 173, comprising first and second D gene segments selected
from D2-2ref and D2-2a; or D2-21 ref and D2-21a; or D3-10ref and
D3-10a; or D3-16ref and D3-16a; or D2-8ref and D2-8a; or D3-3ref
and D3-3a; or D4-23ref and D4-23a; or D6-13ref and D6-13a; or
D3-9ref and D3-9a; or D4-4ref and D4-4a; or D7-27ref and
D7-27a;
[0821] Optionally wherein the first and/or second D gene segment is
present in two or more copies.
[0822] For example, there are provided two or three copies of the
first gene segment, optionally with one, two or three copies of the
second gene segment. Copies can be arranged in cis or trans.
[0823] 175. The vertebrate, cell or population of clause 174,
comprising human gene segments D2-2ref and D2-2a; and D3-3ref and
D3-3a; and optionally also D2-15.
[0824] In an example, the vertebrate, cell or population comprises
one or more D segments selected from human D3-3, D2-15, D3-9;
D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; D1-26;
D1-20; D5-18; D3-16; D2-21; D1-14; D7-27; D1-1; D6-25; D2-14 and
D4-23 (eg, selected from D3-9*01; D4-17*01; D3-10*01; D2-2*02;
D5-24*01; D6-19*01; D3-22*01; D6-13*01; D5-12*01; D1-26*01;
D1-20*01; D5-18*01; D3-16*02; D2-21*02; D1-14*01; D7-27*02;
D1-1*01; D6-25*01; D2-15*01; and D4-23*01), together with the
reference sequence(s) of said selected segment(s). These were found
in variable domains having a HCDR3 length of at least 20 amino
acids (see examples herein).
[0825] 176. A non-human vertebrate or vertebrate cell according to
clause 155, comprising a genome that comprises VH, D and JH gene
repertoires comprising human gene segments, the D gene repertoire
comprising one or more of
[0826] a plurality of D2-2 gene segments provided by at least 2
different D2-2 gene segments in cis at the same Ig locus in said
genome;
[0827] a plurality of D2-21 gene segments provided by at least 2
different D2-21 gene segments in cis at the same Ig locus in said
genome;
[0828] a plurality of D3-10 gene segments provided by at least 2
different D3-10 gene segments in cis at the same Ig locus in said
genome;
[0829] a plurality of D3-16 gene segments provided by at least 2
different D3-16 gene segments in cis at the same Ig locus in said
genome;
[0830] a plurality of D2-8 gene segments provided by at least 2
different D2-8 gene segments in cis at the same Ig locus in said
genome;
[0831] a plurality of D3-3 gene segments provided by at least 2
different D3-3 gene segments in cis at the same Ig locus in said
genome;
[0832] a plurality of D4-23 gene segments provided by at least 2
different D4-23 gene segments in cis at the same Ig locus in said
genome;
[0833] a plurality of D6-13 gene segments provided by at least 2
different D6-13 gene segments in cis at the same Ig locus in said
genome;
[0834] a plurality of D3-9 gene segments provided by at least 2
different D3-9 gene segments in cis at the same Ig locus in said
genome;
[0835] a plurality of D4-4 gene segments provided by at least 2
different D4-4 gene segments in cis at the same Ig locus in said
genome; and
[0836] a plurality of D7-27 gene segments provided by at least 2
different D7-27 gene segments in cis at the same Ig locus in said
genome;
[0837] optionally wherein the D gene segments are derived from the
genome sequence of two or more different human individuals.
[0838] 177. A non-human vertebrate or vertebrate cell according to
clause 155, comprising a genome that comprises VH, D and JH gene
repertoires comprising human gene segments, the D gene repertoire
comprising one or more of
[0839] a plurality of D2-2 gene segments provided by at least 2
different D2-2 gene segments in trans in said genome;
[0840] a plurality of D2-21 gene segments provided by at least 2
different D2-21 gene segments in trans in said genome;
[0841] a plurality of D3-10 gene segments provided by at least 2
different D3-10 gene segments in trans in said genome;
[0842] a plurality of D3-16 gene segments provided by at least 2
different D3-16 gene segments in trans in said genome;
[0843] a plurality of D2-8 gene segments provided by at least 2
different D2-8 gene segments in trans in said genome;
[0844] a plurality of D3-3 gene segments provided by at least 2
different D3-3 gene segments in trans in said genome;
[0845] a plurality of D4-23 gene segments provided by at least 2
different D4-23 gene segments in trans in said genome;
[0846] a plurality of D6-13 gene segments provided by at least 2
different D6-13 gene segments in trans in said genome;
[0847] a plurality of D3-9 gene segments provided by at least 2
different D3-9 gene segments in trans in said genome;
[0848] a plurality of D4-4 gene segments provided by at least 2
different D4-4 gene segments in trans in said genome; and
[0849] a plurality of D7-27 gene segments provided by at least 2
different D7-27 gene segments in trans in said genome;
[0850] optionally wherein the D gene segments are derived from the
genome sequence of two or more different human individuals.
[0851] 178. A non-human vertebrate or vertebrate cell (optionally
an ES cell or B-cell), according to clause 154, comprising a genome
that comprises VH, D and JH gene repertoires comprising human gene
segments, the D gene repertoire comprising one or more of a
plurality of D2-2 gene segments provided by at least 3 different
D2-2 gene segments; a plurality of D2-21 gene segments provided by
at least 3 different D2-21 gene segments; a plurality of D3-10 gene
segments provided by at least 3 different D3-10 gene segments; a
plurality of D3-16 gene segments provided by at least 3 different
D3-16 gene segments; a plurality of D2-8 gene segments provided by
at least 3 different D2-8 gene segments; a plurality of D3-3 gene
segments provided by at least 3 different D3-3 gene segments; a
plurality of D4-23 gene segments provided by at least 3 different
D4-23 gene segments; a plurality of D6-13 gene segments provided by
at least 3 different D6-13 gene segments; a plurality of D3-9 gene
segments provided by at least 3 different D3-9 gene segments; a
plurality of D4-4 gene segments provided by at least 3 different
D4-4 gene segments; and a plurality of D7-27 gene segments provided
by at least 3 different D7-27 gene segments;
[0852] optionally wherein the D gene segments are derived from the
genome sequence of two or three different human individuals;
[0853] optionally wherein at least 2 or 3 of said different gene
segments are provided in cis at the same Ig locus in said
genome.
[0854] 179. The vertebrate or cell of clause 176, 177 or 178,
wherein the different human individuals are from different human
populations.
[0855] 180. The vertebrate or cell of any one of clauses 176 to
179, wherein the individuals are not genetically related.
[0856] 181. The vertebrate or cell of any one of clauses 176 to
180, wherein at least one of the different D segments is a
synthetic mutant of a human germline D gene segment.
[0857] 182. A non-human vertebrate or vertebrate cell (optionally
an ES cell or B-cell) according to clause 158, comprising a genome
comprising human VH, D and JH gene repertoires, the D gene
repertoire comprising of one or more of a plurality of D2-2 gene
segments provided by at least 2 different D2-2 gene; optionally in
cis in said genome;
[0858] a plurality of D2-21 gene segments provided by at least 2
different D2-21 gene; optionally in cis in said genome;
[0859] a plurality of D3-10 gene segments provided by at least 2
different D3-10 gene; optionally in cis in said genome;
[0860] a plurality of D3-16 gene segments provided by at least 2
different D3-16 gene; optionally in cis in said genome;
[0861] a plurality of D2-8 gene segments provided by at least 2
different D2-8 gene; optionally in cis in said genome;
[0862] a plurality of D3-3 gene segments provided by at least 2
different D3-3 gene; optionally in cis in said genome;
[0863] a plurality of D4-23 gene segments provided by at least 2
different D4-23 gene; optionally in cis in said genome;
[0864] a plurality of D6-13 gene segments provided by at least 2
different D6-13 gene; optionally in cis in said genome;
[0865] a plurality of D3-9 gene segments provided by at least 2
different D3-9 gene; optionally in cis in said genome;
[0866] a plurality of D4-4 gene segments provided by at least 2
different D4-4 gene; optionally in cis in said genome; and
[0867] a plurality of D7-27 gene segments provided by at least 2
different D7-27 gene; optionally in cis in said genome;
[0868] wherein the D gene segments are derived from the genome
sequence of different human individuals that are not genetically
related over at least 3 generations.
[0869] 183. The vertebrate or cell of clause 182, wherein the human
individuals are from different human populations.
[0870] 184. The vertebrate, cell or population of any one of
clauses 154 to 183, wherein one or more of the D gene segments is a
variant of a human germline D gene segment, wherein the variant
gene segment encodes an amino acid sequence that differs by 1, 2 or
3 amino acids from the corresponding amino acid sequence encoded by
the human germline D gene segment, provided in that said amino acid
sequence encoded by the variant does not include a stop codon when
said corresponding amino acid sequence does not include a stop
codon.
[0871] Optionally, the variant and germline D gene segments encode
the respective amino acid sequences in reading frame 2 (IMGT
numbering). See Briney et al 2012.
[0872] 185. The vertebrate, cell or population of clause 184,
wherein said corresponding amino acid sequence encoded by the human
germline D gene segment is a hydrophilic or hydrophobic sequence
(according to J Mol Biol. 1997 Jul. 25; 270(4):587-97; Corbett S J
et al; Table 2).
[0873] 186. The vertebrate, cell or population of clause 184 or
185, comprising said variant and said germline human D gene
segments; optionally wherein the variant and germline human D gene
segments are cis on the same chromosome.
[0874] 187. The vertebrate, cell or population of any one of
clauses 184 to 186, wherein germline human D gene segment is a D2,
D3, D5 or D6 family gene segment; optionally a D2-2, D2-15, D3-3,
D3-9, D3-10, D3-22, D5-5, D5-18, D6-6, D6-13, D6-19 gene
segment.
[0875] These D segments are usable in all three reading frames.
[0876] Optionally a variant of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or all
of these human germline D gene segments is used.
[0877] 188. The vertebrate, cell or population of any one of
clauses 154 to 187, comprising a plurality of D2-2 gene segments,
wherein the plurality comprises D2-2 gene segments that vary from
each other at one or more nucleotide positions corresponding to
positions 106,382,687 and 106,382,711
[0878] on human chromosome 14.
[0879] 189. The vertebrate, cell or population of clause 188,
wherein the plurality comprises a human D2-2 gene segment
((optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,382,687 on
human chromosome 14; and optionally no further mutation from the
sequence of D2-2ref.
[0880] 190. The vertebrate, cell or population of clause 188 or
189, wherein the plurality comprises a human D2-2 gene segment
comprising a cytosine at a position corresponding to position
106,382,687 on human chromosome 14; and optionally no further
mutation from the sequence of D2-2a.
[0881] 191. The vertebrate, cell or population of any one of
clauses 188 to 190, wherein the plurality comprises a human D2-2
gene segment comprising an adenine at a position corresponding to
position 106,382,711 on human chromosome 14; and optionally no
further mutation from the sequence of D2-2b.
[0882] 192. The vertebrate, cell or population of any one of
clauses 188 to 191, wherein the plurality comprises a human D2-2
gene segment comprising an thymine at a position corresponding to
position 106,382,711 on human chromosome 14; and optionally no
further mutation from the sequence of D2-2ref.
[0883] 193. The vertebrate, cell or population of any one of
clauses 154 to 192, comprising a plurality of D7-27 gene segments,
wherein the plurality comprises D7-27 gene segments that vary from
each other at a nucleotide position corresponding to position
106,331,767 on human chromosome 14.
[0884] 194. The vertebrate, cell or population of clause 193,
wherein the plurality comprises a human D7-27 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,331,767 on
human chromosome 14; and optionally no further mutation from the
sequence of D7-27ref.
[0885] 195. The vertebrate, cell or population of clause 193 or
194, wherein the plurality comprises a human D7-27 gene segment
comprising a guanine at a position corresponding to position
106,331,767 on human chromosome 14; and optionally no further
mutation from the sequence of D7-27a.
[0886] 196. The vertebrate, cell or population of any one of
clauses 154 to 195, comprising a plurality of D4-23 gene segments,
wherein the plurality comprises D4-23 gene segments that vary from
each other at a nucleotide position corresponding to position
106,350,740 on human chromosome 14.
[0887] 197. The vertebrate, cell or population of clause 196,
wherein the plurality comprises a human D4-23 gene segment
(optionally two copies and/or in homozygous state) comprising an
adenine at a position corresponding to position 106,350,740 on
human chromosome 14; and optionally no further mutation from the
sequence of D4-23ref.
[0888] 198. The vertebrate, cell or population of clause 196 or
197, wherein the plurality comprises a human D4-23 gene segment
(optionally two copies and/or in homozygous state) comprising an
guanine at a position corresponding to position 106,350,740 on
human chromosome 14; and optionally no further mutation from the
sequence of D4-23a.
[0889] 199. The vertebrate, cell or population of any one of
clauses 154 to 197, comprising a plurality of D2-21 gene segments,
wherein the plurality comprises D2-21 gene segments that vary from
each other at a nucleotide position corresponding to position
106,354,418 on human chromosome 14.
[0890] 200. The vertebrate, cell or population of clause 199,
wherein the plurality comprises a human D2-21 gene segment
(optionally two copies and/or in homozygous state) comprising an
adenine at a position corresponding to position 106,354,418 on
human chromosome 14; and optionally no further mutation from the
sequence of D2-21 ref.
[0891] 201. The vertebrate, cell or population of clause 199 or
200, wherein the plurality comprises a human D2-21 gene segment
(optionally two copies and/or in homozygous state) comprising a
guanine at a position corresponding to position 106,354,418 on
human chromosome 14; and optionally no further mutation from the
sequence of D2-21a.
[0892] 202. The vertebrate, cell or population of any one of
clauses 154 to 201, comprising a plurality of D3-16 gene segments,
wherein the plurality comprises D3-16 gene segments that vary from
each other at a nucleotide position corresponding to position
106,354,418 on human chromosome 14.
[0893] 203. The vertebrate, cell or population of clause 202,
wherein the plurality comprises a human D3-16 gene segment
(optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,361,515 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-16ref.
[0894] 204. The vertebrate, cell or population of clause 202 or
203, wherein the plurality comprises a human D3-16 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,361,515 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-16a.
[0895] 205. The vertebrate, cell or population of any one of
clauses 154 to 204, comprising a plurality of D6-13 gene segments,
wherein the plurality comprises D6-13 gene segments that vary from
each other at a nucleotide position corresponding to position
106,367,013 on human chromosome 14.
[0896] 206. The vertebrate, cell or population of clause 205,
wherein the plurality comprises a human D6-13 gene segment
(optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,367,013 on
human chromosome 14; and optionally no further mutation from the
sequence of D6-13ref.
[0897] 207. The vertebrate, cell or population of clause 205 or
206, wherein the plurality comprises a human D6-13 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,367,013 on
human chromosome 14; and optionally no further mutation from the
sequence of D6-13a.
[0898] 208. The vertebrate, cell or population of any one of
clauses 154 to 207, comprising a plurality of D3-10 gene segments,
wherein the plurality comprises D3-10 gene segments that vary from
each other at one or more nucleotide positions corresponding to
positions
[0899] 106.370.370 and
[0900] 106.370.371
[0901] on human chromosome 14.
[0902] 209. The vertebrate, cell or population of clause 208,
wherein the plurality comprises a human D3-10 gene segment
(optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,370,370 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-10ref.
[0903] 210. The vertebrate, cell or population of clause 208 or
209, wherein the plurality comprises a human D3-10 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,370,370 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-10a.
[0904] 211. The vertebrate, cell or population of clause 208, 209
or 210 wherein the plurality comprises a human D3-10 gene segment
(optionally two copies and/or in homozygous state) comprising an
adenine at a position corresponding to position 106,370,371 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-10ref.
[0905] 212. The vertebrate, cell or population of any one of
clauses 208 to 211, wherein the plurality comprises a human D3-10
gene segment (optionally two copies and/or in homozygous state)
comprising a guanine at a position corresponding to position
106,370,371 on human chromosome 14; and optionally no further
mutation from the sequence of D3-10b.
[0906] 213. The vertebrate, cell or population of any one of
clauses 154 to 212, comprising a plurality of D3-9 gene segments,
wherein the plurality comprises D3-9 gene segments that vary from
each other at a nucleotide position corresponding to position
106,370,567 on human chromosome 14.
[0907] 214. The vertebrate, cell or population of clause 213,
wherein the plurality comprises a human D3-9 gene segment
(optionally two copies and/or in homozygous state) comprising an
adenine at a position corresponding to position 106,370,567 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-9ref.
[0908] 215. The vertebrate, cell or population of clause 213 or
214, wherein the plurality comprises a human D3-9 gene segment
(optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,370,567 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-9a.
[0909] 216. The vertebrate, cell or population of any one of
clauses 154 to 215, comprising a plurality of D2-8 gene segments,
wherein the plurality comprises D2-8 gene segments that vary from
each other at one or more nucleotide positions corresponding to
positions
[0910] 106,373,085; 106,373,086 and 106,373,089
[0911] on human chromosome 14.
[0912] 217. The vertebrate, cell or population of clause 216,
wherein the plurality comprises a human D2-8 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,373,085 on
human chromosome 14.
[0913] 218. The vertebrate, cell or population of clause 216 or
217, wherein the plurality comprises a human D2-8 gene segment
(optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,373,085 on
human chromosome 14; and optionally no further mutation from the
sequence of D2-8b.
[0914] 219. The vertebrate, cell or population of clause 216, 217
or 218 wherein the plurality comprises a human D2-8 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,373,086 on
human chromosome 14; and
[0915] optionally no further mutation from the sequence of
D2-8ref.
[0916] 220. The vertebrate, cell or population of any one of
clauses 216 to 219, wherein the plurality comprises a human D2-8
gene segment comprising a thymine at a position corresponding to
position 106,373,086 on human chromosome 14; and optionally no
further mutation from the sequence of D2-8ref.
[0917] 221. The vertebrate, cell or population of any one of
clauses 154 to 220, comprising a plurality of D4-4 gene segments,
wherein the plurality comprises D4-4 gene segments that vary from
each other at one or more nucleotide positions corresponding to
positions
[0918] 106,379,086; and 106,379,089
[0919] on human chromosome 14.
[0920] 222. The vertebrate, cell or population of clause 221,
wherein the plurality comprises a D4-4 gene segment (optionally two
copies and/or in homozygous state) comprising a cytosine at a
position corresponding to position 106,379,086 on human chromosome
14; and optionally no further mutation from the sequence of
D4-4ref.
[0921] 223. The vertebrate, cell or population of clause 221 or
222, wherein the plurality comprises a human D4-4 gene segment
(optionally two copies and/or in homozygous state) comprising a
thymine at a position corresponding to position 106,379,086 on
human chromosome 14; and optionally no further mutation from the
sequence of D4-4a.
[0922] 224. The vertebrate, cell or population of clause 221, 222
or 223 wherein the plurality comprises a human D4-4 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,379,089 on
human chromosome 14; and optionally no further mutation from the
sequence of D4-4ref or a cytosine at a position corresponding to
position 106,379,086 on human chromosome 14.
[0923] 225. The vertebrate, cell or population of any one of
clauses 221 to 224, wherein the plurality comprises a human D4-4
gene segment (optionally two copies and/or in homozygous state)
comprising a thymine at a position corresponding to position
106,373,089 on human chromosome 14; and optionally no further
mutation from the sequence of D4-4a.
[0924] 226. The vertebrate, cell or population of any one of
clauses 154 to 225, comprising a plurality of D3-3 gene segments,
wherein the plurality comprises D3-3 gene segments that vary from
each other at one or more nucleotide positions corresponding to
positions 106,380,241; and 106,380,246 on human chromosome 14.
[0925] 227. The vertebrate, cell or population of clause 226,
wherein the plurality comprises a D3-3 gene segment (optionally two
copies and/or in homozygous state) comprising a thymine at a
position corresponding to position 106,380,241 on human chromosome
14; and optionally no further mutation from the sequence of
D3-3ref.
[0926] 228. The vertebrate, cell or population of clause 226 or
227, wherein the plurality comprises a human D3-3 gene segment
(optionally two copies and/or in homozygous state) comprising a
cytosine at a position corresponding to position 106,380,241 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-3a.
[0927] 229. The vertebrate, cell or population of clause 226, 227
or 228 wherein the plurality comprises a human D3-3 gene segment
(optionally two copies and/or in homozygous state) comprising an
adenine at a position corresponding to position 106,380,246 on
human chromosome 14; and optionally no further mutation from the
sequence of D3-3ref.
[0928] 230. The vertebrate, cell or population of any one of
clauses 226 to 229, wherein the plurality comprises a human D3-3
gene segment (optionally two copies and/or in homozygous state)
comprising a thymine at a position corresponding to position
106,380,246 on human chromosome 14; and optionally no further
mutation from the sequence of D3-3a.
[0929] Multiple Human JL Gene Segment Variants
[0930] A specific application of this configuration is the
provision of multiple human JLgene segments (JK and/or JA) as
follows (as set out in numbered paragraphs, starting at paragraph
number 80).
[0931] 80. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 3 human JLgene segments of the same type
(eg, JK1), wherein at least two of the human JLgene segments are
variants that are not identical to each other.
[0932] 81. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different non-endogenous JL gene
segments of the same type (eg, JK1) cis at the same Ig locus.
[0933] 82. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different human JLgene segments of the
same type (eg, JK1) trans at the same Ig locus; and optionally a
third human JLgene segment of the same type, wherein the third JL
is cis with one of said 2 different JL gene segments.
[0934] 83. A population of non-human vertebrates (eg, mice or rats)
comprising a repertoire of human JL gene segments, wherein the
plurality comprises at least 2 different human JL gene segments of
the same type (eg, JK1), a first of said different JL gene segments
is provided in the genome of a first vertebrate of the population,
and a second of said different JLgene segments being provided in
the genome of a second vertebrate of the population, wherein the
genome of the first vertebrate does not comprise the second JL gene
segment.
[0935] 84. A non-human vertebrate (eg, a mouse or rat) or a
non-human vertebrate cell (eg, an ES cell or a B-cell) having a
genome comprising at least 2 different non-endogenous JL gene
segments of the same type (eg, JK1), wherein the JL gene segments
are derived from the genome sequence of different human individuals
that are not genetically related over at least 3 generations.
[0936] 85. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 3 human JL gene segments of the same type (eg, JK1),
wherein at least two of the human JL gene segments are variants
that are not identical to each other.
[0937] 86. A method of enhancing the immunoglobulin gene diversity
of a non-human vertebrate (eg, a mouse or rat), the method
comprising providing the vertebrate with a genome comprising at
least 2 different non-endogenous JLgene segments of the same type
(eg, JK1) cis at the same Ig locus.
[0938] 87. A method of enhancing the immunoglobulin gene diversity
of a non-human vertebrate (eg, a mouse or rat), the method
comprising providing the vertebrate with a genome comprising at
least 2 different human JLgene segments of the same type (eg, JK1)
trans at the same Ig locus; and optionally a third human JLgene
segment of the same type, wherein the third JL is cis with one of
said 2 different JL gene segments.
[0939] 88. A method of providing an enhanced human immunoglobulin
JL gene segment repertoire, the method comprising providing a
population of non-human vertebrates (eg, a mouse or rat) comprising
a repertoire of human JL gene segments, wherein the method
comprises providing at least 2 different human JLgene segments of
the same type (eg, JK1), wherein a first of said different JLgene
segments is provided in the genome of a first vertebrate of the
population, and a second of said different JL gene segments is
provided in the genome of a second vertebrate of the population,
wherein the genome of the first vertebrate does not comprise the
second JL gene segment.
[0940] 89. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 different non-endogenous JLgene segments of the same
type (eg, JK1), wherein the JL gene segments are derived from the
genome sequence of different human individuals that are not
genetically related over at least 3 generations.
[0941] 90. The vertebrate or cell of paragraph 80, 82 or 84, or the
method of paragraph 85, 82 or 89, wherein at least 2 or 3 of said
different gene segments are provided cis at the same Ig locus in
said genome.
[0942] 91. The vertebrate or cell of paragraph 80, 81 or 82, or the
method of paragraph 85, 86 or 87, wherein the JL gene segments are
derived from the genome sequence of different human individuals
that are not genetically related over at least 3 generations.
[0943] 92. The vertebrate or cell of paragraph 80, 81 or 82, or the
method of paragraph 85, 86 or 87, wherein the JL gene segments are
derived from the genome sequence of two or more different human
individuals; optionally wherein the different human individuals are
from different human populations.
[0944] 93. The vertebrate, cell or method of paragraph 92, wherein
the individuals are not genetically related.
[0945] 94. The vertebrate, cell or method of any one of paragraphs
80 to 93, wherein at least one of the different JL segments is a
synthetic mutant of a human germline JL gene segment.
[0946] 95. A method of enhancing the human immunoglobulin gene
diversity of a non-human vertebrate (eg, a mouse or rat), the
method comprising providing the vertebrate with a genome comprising
at least 2 human JL gene segments of the same type (eg, JK1),
wherein the JL gene segments are derived from the genome sequence
of different human individuals that are not genetically related
over at least 3 generations; optionally wherein at least 2 or 3 of
said different gene segments are provided at the same IgL locus in
said genome.
[0947] 96. The vertebrate or cell of any one of paragraphs
paragraph 80 to 82 and 84, wherein the genome comprises a
substantially complete functional repertoire of human JK and/or
J.lamda. gene segment types supplemented with one, two or more
human JK and/or J.lamda. A gene segments respectively, wherein said
substantially complete functional repertoire and the supplementary
gene segments are not found together in the germline genome of a
human individual.
[0948] 97. The population of paragraph 83, wherein the population
comprises a substantially complete functional repertoire of human
JL gene segment types supplemented with one, two or more human JK
and/or J.lamda. gene segments respectively, wherein said
substantially complete functional repertoire and the supplementary
gene segments are not found together in the germline genome of a
human individual.
[0949] 98. A non-human vertebrate (eg, a mouse or rat) or a
non-human cell (eg, an ES cell or a B-cell) having a genome
comprising a substantially complete functional repertoire of human
JK and/or J.lamda. gene segment types supplemented with one, two or
more human JK and/or J.lamda. gene segments respectively, wherein
said substantially complete functional repertoire and the
supplementary gene segments are not found together in the germline
genome of a human individual.
[0950] 99. A population of non-human vertebrates (eg, mice or rats)
comprising a substantially complete functional repertoire of human
JK and/or J.lamda. gene segment types supplemented with one, two or
more human JK and/or J.lamda. gene segments respectively, wherein
said substantially complete functional repertoire and the
supplementary gene segments are not found together in the germline
genome of a human individual.
[0951] 100. A non-human vertebrate or vertebrate cell according to
paragraph 81, comprising a genome that comprises VL and JL gene
repertoires comprising human gene segments, the JL gene repertoire
comprising
[0952] a plurality of human JK1 gene segments provided by at least
2 different human JK1 gene segments in cis at the same Ig locus in
said genome;
[0953] a plurality of human JK2 gene segments provided by at least
2 different human JK1 gene segments in cis at the same Ig locus in
said genome;
[0954] a plurality of human JK3 gene segments provided by at least
2 different human JK1 gene segments in cis at the same Ig locus in
said genome;
[0955] a plurality of human JK4 gene segments provided by at least
2 different human JK1 gene segments in cis at the same Ig locus in
said genome;
[0956] a plurality of human JK5 gene segments provided by at least
2 different human JK1 gene segments in cis at the same Ig locus in
said genome;
[0957] a plurality of human JA1 gene segments provided by at least
2 different human JA1 gene segments in cis at the same Ig locus in
said genome;
[0958] a plurality of human JA2 gene segments provided by at least
2 different human JA2 gene segments in cis at the same Ig locus in
said genome;
[0959] a plurality of human JA3 gene segments provided by at least
2 different human JA3 gene segments in cis at the same Ig locus in
said genome;
[0960] a plurality of human JA4 gene segments provided by at least
2 different human JA4 gene segments in cis at the same Ig locus in
said genome;
[0961] a plurality of human JA5 gene segments provided by at least
2 different human JA5 gene segments in cis at the same Ig locus in
said genome;
[0962] a plurality of human JA6 gene segments provided by at least
2 different human JA6 gene segments in cis at the same Ig locus in
said genome; or a plurality of human J.lamda.7 gene segments
provided by at least 2 different human J.lamda.7 gene segments in
cis at the same Ig locus in said genome;
[0963] optionally wherein the JLgene segments are derived from the
genome sequence of two or more different human individuals.
[0964] 101. A non-human vertebrate or vertebrate cell (optionally
an ES cell or B-cell), according to paragraph 80, comprising a
genome that comprises VL and JL gene repertoires comprising human
gene segments, the JL gene repertoire comprising
[0965] a plurality of human JK1 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JK1 gene segments;
[0966] a plurality of human JK2 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JK1 gene segments;
[0967] a plurality of human JK3 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JK1 gene segments;
[0968] a plurality of human JK4 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JK1 gene segments;
[0969] a plurality of human JK5 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JK1 gene segments;
[0970] a plurality of human JA1 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JA1 gene segments;
[0971] a plurality of human JA2 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JA2 gene segments;
[0972] a plurality of human JA3 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JA3 gene segments;
[0973] a plurality of human JA4 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JA4 gene segments;
[0974] a plurality of human JA5 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JA5 gene segments;
[0975] a plurality of human JA6 gene segments provided by at least
3 (eg, 3, 4, 5, 6, or 7) different human JA6 gene segments; or
[0976] a plurality of human J.lamda.7 gene segments provided by at
least 3 (eg, 3, 4, 5, 6, or 7) different human J.lamda.7 gene
segments;
[0977] optionally wherein the JLgene segments are derived from the
genome sequence of two or three different human individuals;
[0978] optionally wherein at least 2 or 3 of said different gene
segments are provided in cis at the same Ig locus in said
genome.
[0979] 102. The vertebrate or cell of paragraph 104 or 105, wherein
the different human individuals are from different human
populations.
[0980] 103. The vertebrate or cell of any one of paragraphs 104 to
106, wherein the individuals are not genetically related.
[0981] 104. The vertebrate or cell of any one of paragraphs 104 to
107, wherein at least one of the different JL segments is a
synthetic mutant of a human germline JL gene segment.
[0982] 105. A non-human vertebrate or vertebrate cell (optionally
an ES cell or B-cell) according to paragraph 84, comprising a
genome comprising human VL and JL gene repertoires, the JL gene
repertoire comprising
[0983] a plurality of human JK1 gene segments provided by at least
2 different human JK1 gene segments, optionally in cis at the same
Ig locus in said genome;
[0984] a plurality of human JK2 gene segments provided by at least
2 different human JK1 gene segments, optionally in cis at the same
Ig locus in said genome;
[0985] a plurality of human JK3 gene segments provided by at least
2 different human JK1 gene segments, optionally in cis at the same
Ig locus in said genome;
[0986] a plurality of human JK4 gene segments provided by at least
2 different human JK1 gene segments, optionally in cis at the same
Ig locus in said genome;
[0987] a plurality of human JK5 gene segments provided by at least
2 different human JK1 gene segments, optionally in cis at the same
Ig locus in said genome;
[0988] a plurality of human JA1 gene segments provided by at least
2 different human JA1 gene segments, optionally in cis at the same
Ig locus in said genome;
[0989] a plurality of human JA2 gene segments provided by at least
2 different human JA2 gene segments, optionally in cis at the same
Ig locus in said genome;
[0990] a plurality of human JA3 gene segments provided by at least
2 different human JA3 gene segments, optionally in cis at the same
Ig locus in said genome;
[0991] a plurality of human JA4 gene segments provided by at least
2 different human JA4 gene segments, optionally in cis at the same
Ig locus in said genome;
[0992] a plurality of human JA5 gene segments provided by at least
2 different human JA5 gene segments, optionally in cis at the same
Ig locus in said genome;
[0993] a plurality of human JA6 gene segments provided by at least
2 different human JA6 gene segments, optionally in cis at the same
Ig locus in said genome; or a plurality of human J.lamda.7 gene
segments provided by at least 2 different human J.lamda.7 gene
segments, optionally in cis at the same Ig locus in said
genome;
[0994] wherein the JL gene segments are derived from the genome
sequence of different human individuals that are not genetically
related over at least 3 generations.
[0995] 106. The vertebrate or cell of paragraph 109, wherein the
human individuals are from different human populations.
[0996] The skilled person will realise that standard molecular
biology techniques can be used to provide vectors comprising
synthetic combinations of immunoglobulin gene segments (eg, V, D
and/or J) for use in the invention, such that the vectors can be
used to build a transgenic immunoglobulin locus (eg, using
homologous recombination and/or recombinase mediated cassette
exchange as known in the art, eg, see U.S. Pat. No. 7,501,552
(Medarex), U.S. Pat. No. 5,939,598 (Abgenix), U.S. Pat. No.
6,130,364 (Abgenix), WO02/066630 (Regeneron), WO2011004192 (Genome
Research Limited), WO2009076464, WO2009143472 and WO2010039900
(Ablexis), the disclosures of which are explicitly incorporated
herein. For example, such synthetic combinations of gene segments
can be made using standard recombineering techniques in E coli to
construct BAC vectors harbouring the synthetic combination prior to
insertion in embryonic stem cells using homologous recombination or
RMCE (eg, using cre/lox site-specific recombination). Details of
recombineering can be found at www.genebridges.com and in EP1034260
and EP1204740 the disclosures of which are explicitly incorporated
herein.
[0997] In one embodiment, it is useful to bias the immune response
of the vertebrate (and thus resultant lead antibodies) to a
predetermined gene segment, eg, one known to be commonly used in
natural human immune responses to antigens, such as antigens of
infectious disease pathogens. For example, VH1-69 is commonly used
to produce antibodies in humans against Influenza virus; it is
possible, therefore, to include two or more polymorphic DNA
versions of the VH segment VH1-69 in the locus of the invention.
The examples below illustrate how such a transgenic locus can be
constructed in which diversity is extended by extending the VH1-69
gene segment repertoire based on naturally-occurring VH1-69
polymorphic variants.
[0998] In one embodiment in any configuration of the invention, the
genome has been modified to prevent or reduce the expression of
fully-endogenous antibody. Examples of suitable techniques for
doing this can be found in PCT/GB2010/051122, U.S. Pat. No.
7,501,552, U.S. Pat. No. 6,673,986, U.S. Pat. No. 6,130,364,
WO2009/076464, EP1399559 and U.S. Pat. No. 6,586,251, the
disclosures of which are incorporated herein by reference. In one
embodiment, the non-human vertebrate VDJ region of the endogenous
heavy chain immunoglobulin locus, and optionally VJ region of the
endogenous light chain immunoglobulin loci (lambda and/or kappa
loci), have been inactivated. For example, all or part of the
non-human vertebrate VDJ region is inactivated by inversion in the
endogenous heavy chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus (see, eg, WO2011004192, the
disclosure of which is incorporated herein by reference). For
example, all or part of the non-human vertebrate VJ region is
inactivated by inversion in the endogenous kappa chain
immunoglobulin locus of the mammal, optionally with the inverted
region being moved upstream or downstream of the endogenous Ig
locus. For example, all or part of the non-human vertebrate VJ
region is inactivated by inversion in the endogenous lambda chain
immunoglobulin locus of the mammal, optionally with the inverted
region being moved upstream or downstream of the endogenous Ig
locus. In one embodiment the endogenous heavy chain locus is
inactivated in this way as is one or both of the endogenous kappa
and lambda loci.
[0999] Additionally or alternatively, the vertebrate has been
generated in a genetic background which prevents the production of
mature host B and T lymphocytes, optionally a RAG-1-deficient
and/or RAG-2 deficient background. See U.S. Pat. No. 5,859,301 for
techniques of generating RAG-1 deficient animals.
[1000] Thus, in one embodiment of any configuration or aspect of
the invention herein, endogenous heavy and light chain expression
has been inactivated.
[1001] In one embodiment each said locus constant region is a heavy
chain endogenous non-human vertebrate (optionally host mouse or
rat) constant region.
[1002] In one embodiment each said locus constant region is a light
chain endogenous non-human vertebrate (optionally host mouse or
rat) constant region.
[1003] The invention provides a monoclonal or polyclonal antibody
composition prepared by immunisation of at least one vertebrate
(eg, mouse or rat) according to the invention, optionally wherein
the antigen is an antigen of an infectious disease pathogen (eg, a
bacterial or viral pathogen antigen), optionally wherein the same
antigen is used to immunise all the vertebrates; optionally wherein
the antibody or antibodies are IgG-type (eg, IgG1).
[1004] The invention also provides a monoclonal or polyclonal
antibody mixture produced by the method of the invention or a
derivative antibody or mixture thereof, eg, where one or more
constant region has been changed (eg, replaced with a different
constant region such as a human constant region; or mutated to
enhance or ablate Fc effector function). In an aspect of the
invention, the monoclonal or polyclonal antibody mixture is
provided for therapy and/or prophylaxis of a disease or condition
in a human, eg, for the treatment and/or prevention of an
infectious disease, wherein optionally wherein each antibody binds
an antigen of an infectious disease pathogen, preferably the same
antigen.
[1005] In an aspect of the invention, there is provided the use of
an isolated, monoclonal or polyclonal antibody according to the
invention, or a mutant or derivative antibody thereof in the
manufacture of a medicament for the treatment and/or prevention of
a disease or condition in a human, eg, an infectious disease,
optionally wherein the infectious disease is a disease caused by a
bacterial or viral pathogen.
[1006] An example of a mutant antibody is one that bears up to 15
or 10 amino acid mutations in its variable regions relative to an
isolated antibody (eg, IgG-type, such as IgG1-type, antibody)
obtainable or obtained by the method of the invention. An example
of a derivative is one that has been modified to replace a constant
region with a different constant region such as a human constant
region; or mutated to enhance or ablate Fc effector function.
[1007] Examples of infectious diseases are diseases caused or
mediated by a bacterial or viral pathogen. For example, the
infectious disease is selected from the group consisting of a
disease caused by a pathogen selected from the group consisting of
Haemophilus influenza, E coli, Neisseria meningitidis, a herpes
family virus, cytomegalovirus (CMV), HIV and influenza virus.
[1008] Tailoring V(D)J Incorporation into Immunoglobin Loci for the
Generation of Antibodies Against Infectious Disease
[1009] The inventors realised that it would be desirable to provide
for vertebrates, cells, methods etc for the production of
therapeutic and/or prophylactic antibodies based on natural human
immune responses to antigens, such as antigens of infectious
disease pathogens. In this respect, the literature observes
frequently used immunoglobulin gene segments to raise
anti-infective responses in humans (Table 9).
[1010] In the various configurations, aspects, embodiments and
examples above, the invention provides the skilled addressee with
the possibility of choosing immunoglobulin gene segments in a way
that tailors or biases the repertoire for application to generating
antibodies to treat and/or prevent infectious diseases. The
inventors have categorised the following groups of gene segments
for use in the invention according to the desired application of
resultant antibodies.
[1011] List A:
[1012] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by a Pathogen
[1013] (a) a VL gene segment selected from the group consisting of
a VAII gene family member, VAVII 4A, VAII 2.1, VAVII 4A, a VA1 gene
family member, a VA3 gene family member, IGLV1S2, VA3-cML70, IaIh2,
IaIvI, Ia3h3, Kv325, a VKI gene family member, KI-15A (KL012),
V.sup.0II family member, a V.sup.oIII family member, a VKI gene
family member, KI-15A (KL012), V.sup.oII A2 (optionally the A2a
variant), VK A27 (Humkv325) and a gene segment at least 80%
identical thereto.
[1014] (b) a VAgene segment selected from a VAII gene family
member, VAVII 4A, VAII 2.1, VAVII 4A, a VA1 gene family member, a
VA3 gene family member, IGLV1S2, VA3-cML70, IaIh2, IaIvI, Ia3h3 and
a gene segment at least 80% identical thereto.
[1015] (c) a VK gene segment selected from Kv325, a VKI gene family
member, KI-15A (KL012), V.sup.oII family member, a VKIII family
member, a VKI gene family member, KI-15A (KL012), V.sup.oII A2
(optionally the A2a variant), VK A27 (Humkv325) and a gene segment
at least 80% identical thereto.
[1016] (d) a VH gene segment a VHIII gene family member
(optionally, a VHIIIa or VHIIIb family member), a VHIV gene family
member, VHIII 9.1 (VH3-15), VHIII VH26 (VH3-23), VH3-21, LSG6.1,
LSG12.1, DP77 (V3-21), VH H11, VH1GRR, ha3h2, VHI-ha1c1,
VHIII-VH2-1, VH4.18, ha4h3, Hv1051, 71-2, Hv1f10, VH4.11, 71-4,
VH251, VH1-69 and a gene segment at least 80% identical
thereto.
[1017] (e) a J.lamda. gene segment selected from JA2, JA3 and a
gene segment at least 80% identical thereto.
[1018] a D gene segment selected from Dk1, Dxp>>1, Dn4r, D2r
and a gene segment at least 80% identical thereto.
[1019] List A1:
[1020] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by a Pathogen
[1021] (a) a VAgene segment selected from a VAII gene family
member, VAVII 4A, VAII 2.1, VAVII 4A and a gene segment at least
80% identical thereto.
[1022] (b) a VK gene segment selected from a VKI gene family
member, KI-15A (KL012), V.sup.oII family member, a VKIII family
member, a VKI gene family member, KI-15A (KL012), V.sup.oII A2
(optionally the A2a variant), VK A27 (Humkv325) and a gene segment
at least 80% identical thereto.
[1023] (c) a VH gene segment a VH3 gene family member (optionally,
a VHIIIa or VHIIIb family member), VHIII 9.1 (VH3-15), VHIII VH26
(VH3-23), VH3-21, LSG6.1, LSG12.1, DP77 (V3-21), VH H11 and a gene
segment at least 80% identical thereto.
[1024] (d) a J.lamda. gene segment selected from JA2, JA3 and a
gene segment at least 80% identical thereto.
[1025] (e) a JH gene segment selected from JH2, JH3, JH4 and a gene
segment at least 80% identical thereto.
[1026] List A1.1:
[1027] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by H Influenza
[1028] (a) a VAgene segment selected from a VAII gene family
member, VAVII 4A, VAII 2.1, VAVII 4A and a gene segment at least
80% identical thereto.
[1029] (b) a VK gene segment selected from a V.sup.oII family
member, a VKIII family member, a VKI gene family member, KI-15A
(KL012), V.sup.oII A2 (optionally the A2a variant), V.sup.o A27
(Humkv325) and a gene segment at least 80% identical thereto.
[1030] (c) a VH gene segment a VH3 gene family member (optionally,
a VHIIIb family member), VHIII 9.1 (VH3-15), VHIII VH26 (VH3-23),
VH3-21, LSG6.1, LSG12.1, DP77 (V3-21) and a gene segment at least
80% identical thereto.
[1031] (d) a J.lamda. gene segment selected from JA2, JA3 and a
gene segment at least 80% identical thereto.
[1032] List A1.2:
[1033] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by E Coli or Neisseria meningitidis
[1034] (a) a VH gene segment a VH3 gene family member (optionally a
VHIIIa or VHIIIb member), VHIII 9.1 (VH3-15), VH H11, VHIII VH26
(VH3-23) a gene segment at least 80% identical thereto, eg, VHIII
9.1 .COPYRGT.JH3; or VH H11 JH4; or VHIII VH26 .COPYRGT. JH2.
[1035] (b) a VK gene segment selected from a VKI gene family
member, KI-15A (KL012) and a gene segment at least 80% identical
thereto.
[1036] (c) a VAgene segment selected from a VAII gene family
member, VAII 2.1 and a gene segment at least 80% identical
thereto.
[1037] (d) a JH gene segment selected from JH2, JH3, JH4 and a gene
segment at least 80% identical thereto.
[1038] A2:
[1039] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by a Viral Pathogen
[1040] (a) a VH gene segment selected from a VHIII gene family
member, a VHIV gene family member, VHIII-VH26 (VH3-23), VH1GRR,
ha3h2, VHI-ha1c1, VHIII-VH2-1, VH4.18, ha4h3, Hv1051, 71-2, Hv1f10,
VH4.11, 71-4, VH251, VH1-69 and a gene segment at least 80%
identical thereto.
[1041] (b) a VA gene segment selected from a VA1 gene family
member, a VA3 gene family member, IGLV1S2, VA3-cML70, IaIh2, IaIvI,
Ia3h3 and a gene segment at least 80% identical thereto.
[1042] (c) a Vk gene segment selected from Kv325 and a gene segment
at least 80% identical thereto.
[1043] (d) a JH gene segment selected from JH3, JH5, JH6 and a gene
segment at least 80% identical thereto.
[1044] (e) a D gene segment selected from Dk1, Dxp>>1, Dn4r,
D2r and a gene segment at least 80% identical thereto.
[1045] a J.lamda. gene segment selected from JA2, JA3 and a gene
segment at least 80% identical thereto.
[1046] A2.1:
[1047] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by Herpes Virus Family (eq, VZV or HSV)
[1048] (a) a VH gene segment selected from a VHIII gene family
member, a VHIV gene family member, VHIII-VH26 (VH3-23), VH1GRR,
ha3h2, VHI-ha1c1, VHIII-VH2-1, VH4.18, ha4h3, and a gene segment at
least 80% identical thereto.
[1049] (b) a VA gene segment selected from a VA1 gene family
member, a VA3 gene family member, IGLV1S2, VA3-cML70, IaIh2, IaIvI,
Ia3h3 and a gene segment at least 80% identical thereto.
[1050] (c) a JH gene segment selected from JH3, JH5, JH6 and a gene
segment at least 80% identical thereto.
[1051] (d) a D gene segment selected from Dk1, Dxp>>1, Dn4r,
D2r and a gene segment at least 80% identical thereto.
[1052] (e) a J.lamda. gene segment selected from JA2, JA3 and a
gene segment at least 80% identical thereto.
[1053] A2.2:
[1054] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by CMV
[1055] (a) a VH gene segment selected from Hv1051 and a gene
segment at least 80% identical thereto.
[1056] (b) a Vk gene segment selected from Kv325 and a gene segment
at least 80% identical thereto. A2.3:
[1057] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by HIV
[1058] (a) a VH gene segment selected from 71-2, Hv1f10, VH4.11,
71-4, VH251, VH1-69 and a gene segment at least 80% identical
thereto.
[1059] A2.4:
[1060] Immunoglobulin Gene Segments for Antibodies that Bind an
Antigen Expressed by Influenza Virus
[1061] (a) a VH gene segment selected from VH1-69 and a gene
segment at least 80% identical thereto.
[1062] Thus,
[1063] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease, one or more V, D
and/or or all J gene segments used in any configuration, aspect,
method, example or embodiment of the invention can be selected from
List A1. Thus, for example in (a) of the first configuration of the
invention, the recited heavy chain V gene segment is selected from
the VH gene segments in List A, optionally with a D in that
list.
[1064] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
a bacterial pathogen, one or more or all V, D and/or J gene
segments used in any configuration, aspect, method, example or
embodiment of the invention can be selected from List A1.
[1065] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
a viral pathogen, one or more or all V, D and/or J gene segments
used in any configuration, aspect, method, example or embodiment of
the invention can be selected from List A2.
[1066] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
H influenza, one or more or all V, D and/or J gene segments used in
any configuration, aspect, method, example or embodiment of the
invention can be selected from List A1.1.
[1067] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
E Coli or Neisseria meningitidis, one or more or all V, D and/or J
gene segments used in any configuration, aspect, method, example or
embodiment of the invention can be selected from List A1.2.
[1068] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
Herpes Virus Family (eg, VZV or HSV), one or more or all V, D
and/or J gene segments used in any configuration, aspect, method,
example or embodiment of the invention can be selected from List
A2.1.
[1069] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
CMV, one or more or all V, D and/or J gene segments used in any
configuration, aspect, method, example or embodiment of the
invention can be selected from List A2.2.
[1070] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
HIV, one or more or all V, D and/or J gene segments used in any
configuration, aspect, method, example or embodiment of the
invention can be selected from List A2.3.
[1071] Where one wishes to generate an antibody or antibody mixture
to treat and/or prevent an infectious disease caused or mediated by
Influenza Virus, one or more or all V, D and/or J gene segments
used in any configuration, aspect, method, example or embodiment of
the invention can be selected from List A2.4.
[1072] Optionally each VH segment in the locus of the invention is
selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or
A2.4.
[1073] Optionally each VL segment in the locus of the invention is
selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or A2.4
[1074] Optionally each D segment in the locus of the invention is
selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or
A2.4.
[1075] Optionally each JL segment in the locus of the invention is
selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or
A2.4.
[1076] Antibodies for Therapy & Prophylaxis of Patients of
Specific Ancestry
[1077] The inventors, having undertaken the extensive
Bioinformatics analysis exercise described herein, realised that
the output of that analysis has made it possible to identify
specific gene segments that are useful to produce antibody- and VH
domain-based drugs that are tailored specifically to a patient's
ancestry (ie, genotype). That is, antibodies can be selected on the
basis that they are made in vivo in a transgenic non-human
vertebrate (eg, mouse or rat with transgenic IgH loci) and
particularly derived from gene segments that are relatively
prevalent in members of the patient's population, ie, from
individuals of the same human ancestry. Since variant distributions
differ across different populations (see Table 13), this presumably
reflects the effects of evolution, adaptation and conservation of
useful variant gene types in those populations. Thus, by tailoring
the antibody-based drugs according to the invention, it is possible
to match the drug to the population gene biases, thus with the aim
of making better drugs for that specific population of humans.
Better can, for example, mean more efficacious, better
neutralising, higher target antigen affinity, less immunogenic,
less patient reactions to the drug etc. This can be determined
empirically, as is standard in drug research and development
processes.
[1078] Thus, the Invention Provides the Following Embodiments
(Numbered from Clause 345 Onwards):--
[1079] 345. An isolated antibody for administration to a Chinese
patient, the antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region, wherein the constant region is a human
constant region selected from a constant region (eg, an IGHG
constant region) in Table 13 found in a Chinese population and with
a cumulative frequency of at least 1 or 5%; and wherein
[1080] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); and/or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1081] In another embodiment, the invention provides
[1082] An isolated antibody for administration to a Chinese
patient, the antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region, wherein the constant region is a human
constant region selected from a constant region (eg, an IGHG
constant region) present in a Chinese population with a cumulative
frequency of at least 5%; and wherein
[1083] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); and/or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1084] In an example, the constant region is found in the 1000
Genomes database. In an example, the constant region is found in
Table 13.
[1085] 346. The antibody of clause 345 wherein the constant region
is a IGHG1a, IGHG2a, IGHG3a, IGHG3b or IGHG4a constant region.
[1086] 347. The antibody of clause 345 or 346, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the VH
gene segment being selected from a VH in Table 13 found in a
Chinese population and with a cumulative frequency of at least
5%.
[1087] In another embodiment, the invention provides
[1088] The antibody of clause 345 or 346, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the VH
gene segment being selected from a VH present in a Chinese
population with a cumulative frequency of at least 5%.
[1089] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1090] 348. The antibody of clause 345, 346 or 347, wherein the
variable domain is derived from the recombination of a human VH
gene segment with a human D gene segment and a human JH gene
segment, the D gene segment being selected from a D in Table 13
found in a Chinese population and with a cumulative frequency of at
least 5%.
[1091] In another embodiment, the invention provides
[1092] The antibody of clause 345, 346 or 347, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the D gene
segment being selected from a D present in a Chinese population
with a cumulative frequency of at least 5%.
[1093] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1094] 349. The antibody of clause 345, 346, 347 or 348 wherein the
variable domain is derived from the recombination of a human VH
gene segment with a human D gene segment and a human JH gene
segment, the JH gene segment being selected from a JH in Table 13
found in a Chinese population and with a cumulative frequency of at
least 5%.
[1095] In another embodiment, the invention provides
[1096] The antibody of clause 345, 346, 347 or 348 wherein the
variable domain is derived from the recombination of a human VH
gene segment with a human D gene segment and a human JH gene
segment, the JH gene segment being selected from a JH present in a
Chinese population with a cumulative frequency of at least 5%.
[1097] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1098] 350. An isolated VH domain identical to a variable domain as
recited in any one of clauses 347 to 349, optionally fused at its
C-terminus to a polypeptide (eg, an antibody Fc).
[1099] In an embodiment, there is provided an isolated VH domain
identical to a variable domain as recited in any one of clauses 347
to 349 which is part of a conjugate, conjugated with a label (eg,
for imaging in the patient) or a toxin (eg, a radioactive toxic
payload, such as for cancer treatment in the patient) or a
half-life-extending moiety (eg, PEG of human serum albumin).
[1100] 351. A pharmaceutical composition comprising the antibody or
variable domain of any one of clauses 345 to 350 together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, antibody chain or
antibody).
[1101] 352. An isolated antibody for administration to a Chinese
patient, the antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region, wherein the variable domain is derived from
the recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH in Table 13 found in a Chinese population and
with a cumulative frequency of at least 5%; and wherein
[1102] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); and/or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1103] In another embodiment, the invention provides
[1104] An isolated antibody for administration to a Chinese
patient, the antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region, wherein the variable domain is derived from
the recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH present in a Chinese population with a
cumulative frequency of at least 5%; and wherein
[1105] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); and/or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1106] 353. The antibody of clause 352, wherein the variable domain
is derived from the recombination of a human VH gene segment with a
human D gene segment and a human JH gene segment, the D gene
segment being selected from a D in Table 13 found in a Chinese
population and with a cumulative frequency of at least 5%.
[1107] In another embodiment, the invention provides
[1108] The antibody of clause 352, wherein the variable domain is
derived from the recombination of a human VH gene segment with a
human D gene segment and a human JH gene segment, the D gene
segment being selected from a D present in a Chinese population
with a cumulative frequency of at least 5%.
[1109] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1110] 354. The antibody of clause 352 or 353, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the JH
gene segment being selected from a JH in Table 13 found in a
Chinese population and with a cumulative frequency of at least
5%.
[1111] In another embodiment, the invention provides
[1112] The antibody of clause 352 or 353, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the JH
gene segment being selected from a JH present in a Chinese
population with a cumulative frequency of at least 5%.
[1113] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1114] 355. An isolated VH domain identical to a variable domain as
recited in any one of clauses 352 to 354, optionally fused at its
C-terminus to a polypeptide (eg, an antibody Fc).
[1115] In an embodiment, there is provided a VH domain identical to
a variable domain as recited in any one of clauses 352 to 354 which
is part of a conjugate, conjugated with a label (eg, for imaging in
the patient) or a toxin (eg, a radioactive toxic payload, such as
for cancer treatment in the patient) or a half-life-extending
moiety (eg, PEG of human serum albumin).
[1116] 356. A pharmaceutical composition comprising the antibody or
variable domain of any one of clauses 352 to 355 together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, antibody chain or
antibody).
[1117] 357. An antibody heavy chain or VH domain (eg, provided as
part of an antibody) for therapy and/or prophylaxis of a disease or
medical condition in a Chinese patient, wherein the heavy chain is
a heavy chain produced by the following steps (or is a copy of such
a heavy chain):--
[1118] (a) Selection of an antigen-specific antibody heavy chain or
VH domain from a non-human vertebrate (eg, a mouse or a rat),
wherein the heavy chain or VH domain is derived from the
recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH in Table 13 found in a Chinese population and
with a cumulative frequency of at least 5%;
[1119] (b) Optional humanisation of the heavy chain by combining
the variable domain of the heavy chain with a human constant
region; or optional humanisation of the selected VH domain by
combining with a human constant region.
[1120] In another embodiment, the invention provides
[1121] An antibody heavy chain or VH domain (eg, provided as part
of an antibody) for therapy and/or prophylaxis of a disease or
medical condition in a Chinese patient, wherein the heavy chain is
a heavy chain produced by the following steps (or is a copy of such
a heavy chain):--
[1122] (a) Selection of an antigen-specific antibody heavy chain or
VH domain from a non-human vertebrate (eg, a mouse or a rat),
wherein the heavy chain or VH domain is derived from the
recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH present in a Chinese population with a
cumulative frequency of at least 5%;
[1123] (b) Optional humanisation of the heavy chain by combining
the variable domain of the heavy chain with a human constant
region; or optional humanisation of the selected VH domain by
combining with a human constant region.
[1124] In an example, the VH gene segment is found in the 1000
Genomes database. In an example, the gene segment is found in Table
13.
[1125] 358. The antibody heavy chain or VH domain of clause 357,
wherein the human constant region is as recited in clause 345 or
346.
[1126] 359. An antibody heavy chain or VH domain as recited in
clause 357 or 358 for use in a medicament for therapy and/or
prophylaxis of a disease or medical condition in a Chinese
patient.
[1127] 360. A method of treating and/or preventing a disease or
medical condition in a Chinese patient, the method comprising
administering to the patient a therapeutically or
prophylactically-effective amount of the antibody heavy chain or VH
domain as recited in clause 357 or 358.
[1128] 361. An isolated antibody for administration to a patient of
European, East Asian, West African, South Asian or Americas
ancestry, the antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region, wherein the constant region is a human
constant region selected from a constant region (eg, an IGHG
constant region) in Table 13 found in a population of European,
East Asian, West African, South Asian or Americas ancestry
respectively and with a cumulative frequency of at least 1 or 5%;
and wherein
[1129] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1130] In another embodiment, the invention provides
[1131] An isolated antibody for administration to a patient of
European, East Asian, West African, South Asian or Americas
ancestry, the antibody comprising a human heavy chain, the heavy
chain comprising a variable domain that is specific for an antigen
and a constant region, wherein the constant region is a human
constant region selected from a constant region (eg, an IGHG
constant region) present in a population of European, East Asian,
West African, South Asian or Americas ancestry respectively with a
cumulative frequency of at least 1 or 5%; and wherein
[1132] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1133] In an example, the constant region is found in the 1000
Genomes database. In an example, the constant region is found in
Table 13.
[1134] 362. The antibody of clause 361 wherein the constant region
is a IGHG1a, IGHG2a, IGHG3a, IGHG3b or IGHG4a constant region and
the patient is of European ancestry.
[1135] 363. The antibody of clause 361 or 362, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the VH
gene segment being selected from a VH in Table 13 found in said
population and with a cumulative frequency of at least 1 or 5%.
[1136] In another embodiment, the invention provides
[1137] The antibody of clause 361 or 362, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the VH
gene segment being selected from a VH present in a Chinese
population with a cumulative frequency of at least 5%.
[1138] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1139] 364. The antibody of clause 361, 362 or 363, wherein the
variable domain is derived from the recombination of a human VH
gene segment with a human D gene segment and a human JH gene
segment, the D gene segment being selected from a D in Table 13
found in said population and with a cumulative frequency of at
least 1 or 5%.
[1140] In another embodiment, the invention provides
[1141] The antibody of clause 361, 362 or 363, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the D gene
segment being selected from a D present in a Chinese population
with a cumulative frequency of at least 5%.
[1142] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1143] 365. The antibody of clause 361, 362, 363 or 364 wherein the
variable domain is derived from the recombination of a human VH
gene segment with a human D gene segment and a human JH gene
segment, the JH gene segment being selected from a JH in Table 13
found in said population and with a cumulative frequency of at
least 1 or 5%.
[1144] In another embodiment, the invention provides
[1145] The antibody of clause 361, 362, 363 or 364 wherein the
variable domain is derived from the recombination of a human VH
gene segment with a human D gene segment and a human JH gene
segment, the JH gene segment being selected from a JH present in a
Chinese population with a cumulative frequency of at least 5%.
[1146] In an example, the gene segment is found in the 1000 Genomes
database. In an example, the gene segment is found in Table 13.
[1147] 366. An isolated VH domain identical to a variable domain as
recited in any one of clauses 363 to 365, optionally fused at its
C-terminus to a polypeptide (eg, an antibody Fc).
[1148] 367. A pharmaceutical composition comprising the antibody or
variable domain of any one of clauses 361 to 366 together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, antibody chain or
antibody).
[1149] 368. An isolated antibody for administration to a patient of
European, East Asian, West African or Americas ancestry, the
antibody comprising a human heavy chain, the heavy chain comprising
a variable domain that is specific for an antigen and a constant
region, wherein the variable domain is derived from the
recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH in Table 13 found in a population of European,
East Asian, West African, South Asian or Americas ancestry
respectively and with a cumulative frequency of at least 1 or 5%;
and wherein
[1150] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1151] In another embodiment the invention provides:--
[1152] An isolated antibody for administration to a patient of
European, East Asian, West African or Americas ancestry, the
antibody comprising a human heavy chain, the heavy chain comprising
a variable domain that is specific for an antigen and a constant
region, wherein the variable domain is derived from the
recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH present in a population of European, East Asian,
West African, South Asian or Americas ancestry respectively with a
cumulative frequency of at least 1 or 5%; and wherein
[1153] (i) the variable domain is derived from the recombination of
said human gene segments in a non-human vertebrate (eg, in a mouse
or a rat); or (ii) the variable domain comprises non-human
vertebrate (eg, mouse or rat) AID-pattern mutations and non-human
vertebrate (eg, mouse or rat) terminal deoxynucleotidyl transferase
(TdT)-pattern mutations.
[1154] In an example, the VH gene segment is found in the 1000
Genomes database. In an example, the gene segment is found in Table
13.
[1155] 369. The antibody of clause 368, wherein the variable domain
is derived from the recombination of a human VH gene segment with a
human D gene segment and a human JH gene segment, the D gene
segment being selected from a D in Table 13 found in said
population and with a cumulative frequency of at least 1 or 5%.
[1156] In another example there is provided
[1157] The antibody of clause 368, wherein the variable domain is
derived from the recombination of a human VH gene segment with a
human D gene segment and a human JH gene segment, the D gene
segment being selected from a D present in said population with a
cumulative frequency of at least 1 or 5%.
[1158] In an example, the D gene segment is found in the 1000
Genomes database. In an example, the gene segment is found in Table
13.
[1159] 370. The antibody of clause 368 or 369, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the JH
gene segment being selected from a JH in Table 13 found in said
population and with a cumulative frequency of at least 1 or 5%.
[1160] In another example there is provided
[1161] The antibody of clause 368 or 369, wherein the variable
domain is derived from the recombination of a human VH gene segment
with a human D gene segment and a human JH gene segment, the JH
gene segment being selected from a JH present in said population
and with a cumulative frequency of at least 1 or 5%.
[1162] In an example, the JH gene segment is found in the 1000
Genomes database. In an example, the gene segment is found in Table
13.
[1163] 371. An isolated VH domain identical to a variable domain as
recited in any one of clauses 368 to 370, optionally fused at its
C-terminus to a polypeptide (eg, an antibody Fc).
[1164] 372. A pharmaceutical composition comprising the antibody or
variable domain of any one of clauses 368 to 371 together with a
pharmaceutically-acceptable excipient, diluent or a medicament (eg,
a further antigen-specific variable domain, antibody chain or
antibody).
[1165] 373. An antibody heavy chain or VH domain (eg, provided as
part of an antibody) for therapy and/or prophylaxis of a disease or
medical condition in a patient of European, East Asian, West
African, South Asian or Americas ancestry, wherein the heavy chain
is a heavy chain produced by the following steps (or is a copy of
such a heavy chain):--
[1166] (a) Selection of an antigen-specific antibody heavy chain or
VH domain from a non-human vertebrate (eg, a mouse or a rat),
wherein the heavy chain or VH domain is derived from the
recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH in Table 13 found in said population and with a
cumulative frequency of at least 1 or 5%;
[1167] (b) Optional humanisation of the heavy chain by combining
the variable domain of the heavy chain with a human constant
region; or optional humanisation of the selected VH domain by
combining with a human constant region.
[1168] In another embodiment, there is provided:--
[1169] An antibody heavy chain or VH domain (eg, provided as part
of an antibody) for therapy and/or prophylaxis of a disease or
medical condition in a patient of European, East Asian, West
African, South Asian or Americas ancestry, wherein the heavy chain
is a heavy chain produced by the following steps (or is a copy of
such a heavy chain):--
[1170] (a) Selection of an antigen-specific antibody heavy chain or
VH domain from a non-human vertebrate (eg, a mouse or a rat),
wherein the heavy chain or VH domain is derived from the
recombination of a human VH gene segment with a human D gene
segment and a human JH gene segment, the VH gene segment being
selected from a VH present in said population with a cumulative
frequency of at least 1 or 5%;
[1171] (b) Optional humanisation of the heavy chain by combining
the variable domain of the heavy chain with a human constant
region; or optional humanisation of the selected VH domain by
combining with a human constant region.
[1172] In an example, the VH gene segment is found in the 1000
Genomes database. In an example, the gene segment is found in Table
13.
[1173] 374. The antibody heavy chain or VH domain of clause 373,
wherein the human constant region is as recited in clause 361 or
362.
[1174] 375. An antibody heavy chain or VH domain as recited in
clause 373 or 374 for use in a medicament for therapy and/or
prophylaxis of a disease or medical condition in a patient of said
ancestry.
[1175] 376. A method of treating and/or preventing a disease or
medical condition in a patient of European, East Asian, West
African, South Asian or Americas ancestry, the method comprising
administering to the patient a therapeutically or
prophylactically-effective amount of the antibody heavy chain or VH
domain as recited in clause 373 or 374.
[1176] In embodiments herein, a Chinese patient can be a Han
Chinese patient.
[1177] In embodiments herein, a patient of European ancestry can be
a patient of Northern or Western European ancestry, Italian
ancestry, British or Scottish ancestry, Finnish ancestry or Iberian
ancestry.
[1178] In embodiments herein, a patient of East Asian ancestry can
be a patient of Han Chinese ancestry, Japanese ancestry Chinese Dai
ancestry, Vietnamese ancestry or Kinh ancestry.
[1179] In embodiments herein, a patient of West African ancestry
can be a patient of Yoruba ancestry, Luhya ancestry, Gambian
ancestry or Malawian ancestry.
[1180] In embodiments herein, a patient of Americas ancestry can be
a patient of African American ancestry, African Caribbean ancestry,
Mexican ancestry, Puerto Rican ancestry, Colombian ancestry or
Peruvian ancestry.
[1181] In embodiments herein, a patient of South Asian ancestry can
be a patient of Ahom ancestry, Kayadtha ancestry, Reddy ancestry,
Maratha ancestry, or Punjabi ancestry.
[1182] In an example of any aspect, the cumulative frequency is at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90 or 95%.
[1183] It will be understood that particular embodiments described
herein are shown by way of illustration and not as limitations of
the invention. The principal features of this invention can be
employed in various embodiments without departing from the scope of
the invention. Those skilled in the art will recognize, or be able
to ascertain using no more than routine study, numerous equivalents
to the specific procedures described herein. Such equivalents are
considered to be within the scope of this invention and are covered
by the claims. All publications and patent applications mentioned
in the specification are indicative of the level of skill of those
skilled in the art to which this invention pertains. All
publications and patent applications are herein incorporated by
reference to the same extent as if each individual publication or
patent application was specifically and individually indicated to
be incorporated by reference. The use of the word "a" or "an" when
used in conjunction with the term "comprising" in the claims and/or
the specification may mean "one," but it is also consistent with
the meaning of "one or more," "at least one," and "one or more than
one." The use of the term or in the claims is used to mean "and/or"
unless explicitly indicated to refer to alternatives only or the
alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[1184] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps
[1185] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof is intended to
include at least one of: A, B, C, AB, AC, BC, or ABC, and if order
is important in a particular context, also BA, CA, CB, CBA, BCA,
ACB, BAC, or CAB. Continuing with this example, expressly included
are combinations that contain repeats of one or more item or term,
such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
The skilled artisan will understand that typically there is no
limit on the number of items or terms in any combination, unless
otherwise apparent from the context.
[1186] Any part of this disclosure may be read in combination with
any other part of the disclosure, unless otherwise apparent from
the context.
[1187] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or
[1188] methods and in the steps or in the sequence of steps of the
method described herein without departing from the concept, spirit
and scope of the invention. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
[1189] The present invention is described in more detail in the
following non limiting prophetic Examples.
EXAMPLES
Example 1
Recombineered BAC Vectors to Add Polymorphic V-Regions to the Mouse
Genome
[1190] FIG. 1 through 3 depict recombineering methods (see
references above) that can be used to introduce polymorphic V-gene
regions into genomic DNA. In one embodiment, a genomic fragment
from the human heavy chain region is inserted into a bacterial
artificial chromosome (BAC) vector by standard techniques.
Preferably, such a BAC, which can range in size from 20-kb to
200-kb or more, can be isolated from libraries of BACs by standard
techniques including sequence searches of commercially available
libraries or by hybridization to bacterial colonies containing BACs
to identify those with a BAC of interest.
[1191] A BAC is chosen that has several VH gene segments; in FIG.
1, these are generically identified as VH[a] through VH[z] for
example. One skilled in the art will readily identify appropriate
genomic fragments, for example, an approximately 120-kb fragment
from human VH5-78 through VH1-68 which includes 5 endogenous active
VH gene segments and 7 VH psuedogenes. Using recombineering
techniques, the endogenous VH gene segments can be replaced by
polymorphic VH or VL gene segments. In this example, two steps are
required. The first step replaces the V-region coding exon of an
endogenous VH gene segment with a positive-negative selection
operon, in this example, an operon encoding an ampicillin
resistance gene (Amp) and a streptomycin-sensitizing ribosomal
protein (rpsL). Certain strains of bacteria can be selected for the
absence of the rpsL gene by resistance to streptomycin. Short
stretches of DNA homologous to sequences flanking the endogenous VH
gene exon are placed 5' and 3' of the rpsL-Amp operon. In the
presence of appropriate recombination factors per standard
recombineering techniques (see references above) recombination
between the operon fragment and the BAC will result in replacement
of the endogenous VH gene exon with the operon (FIG. 1a) which are
selected by resistance to ampicillin. The second step uses the same
homologous sequences in order to replace the inserted operon with a
desired polymorphic VH gene segment. In this example, a human
VH1-69 gene is inserted (FIGS. 1b and 1c). In particular the *02
variant of VH1-69 is used [ref IMGT and FIG. 5]. Successful
integrations of the polymorphic VH gene segment are selected in
bacteria that become resistant to streptomycin due to the loss of
the operon, specifically the rpsL portion.
[1192] In this example, the two step process as described can be
repeated for each of the endogenous VH gene segments or for as many
endogenous gene segments that one wishes to replace with
polymorphic V gene segments (FIG. 1d).
[1193] As is apparent, any polymorphic V gene segment can be
inserted in this manner and any endogenous V gene segment can act
as a target, including pseudogenes. V gene segments in each of the
heavy chain and two light chain loci can be replaced using this
technique with appropriate genomic fragments available as BAC
inserts.
[1194] FIG. 2 depicts another method for creating a genomic
fragment encoding polymorphic V gene segments. In this example,
polymorphic V gene segments are inserted into a region of genomic
DNA devoid of other genes, control elements or other functions.
Such `desert` regions can be selected based on sequence analysis
and corresponding DNA fragments cloned into BACs or identified in
existing BAC libraries. Starting with such a genomic fragment,
recombineering techniques can be used to insert polymorphic V gene
segments at intervals of, for example, 10-kb. In this example, a
150-kb genomic fragment might accommodate insertion of up to 15
polymorphic V gene segments. Insertion of the segments is a
two-step process. The first recombineering step inserts the
rpsL-Amp operon at a specific site. Sequences homologous to a
specific site are used to flank the operon. These are used by the
recombineering system to insert the element specifically into the
BAC genomic fragment and positive events are selected by resistance
to ampicillin (FIG. 2a). The second step replaces the operon in the
genomic fragment with a polymorphic V gene segment by a similar
recombineering step using the same sequence homology (FIG. 2b). In
this example, both exons and promoter element of a polymorphic VH
gene segment are inserted, resulting in replacement of the rpsL-Amp
operon and therefore resistance to streptomycin (FIG. 2c).
[1195] The two step technique for inserting polymorphic V gene
segments into a specific site on the genomic fragment can be
repeated multiple times resulting in a BAC genomic fragment with
several polymorphic gene segments, including their promoter
elements. It is apparent that the examples shown in FIGS. 1 and 2
can be combined wherein the technique for insertion can be used to
add extra polymorphic V gene segments to a BAC genomic fragment as
depicted in FIG. 1. One might choose to add these extra segments to
an IG genomic fragment since such a fragment would be more amenable
to proper IG gene expression once inserted into a non-human
mammal's genome. It is known that a genomic fragment can have
elements such as enhancers or elements that contribute to certain
chromatin conformations, both important in wild-type gene
expression.
[1196] FIG. 3 depicts an additional method to create genomic
fragments with polymorphic V gene segments. This method depends
upon the efficiency with which short (around 50 to 150 bases,
preferably 100 bases) single stranded DNA fragments recombine with
a homologous sequence using recombineering (Nat Rev Genet. 2001
October; 2(10):769-79; Recombineering: a powerful new tool for
mouse functional genomics; Copeland N G, Jenkins N A, Court D L).
The recombinases used in recombineering preferentially bind and use
such short single-stranded fragments of DNA as a substrate for
initiating homologous recombination. The efficiency can be as high
as 10-2, that is, a positive event can be found in approximately
100 randomly picked (not selected) clones resulting from
recombineering. A positive event in this example occurring when one
or more single nucleotide changes introduced into the
single-stranded fragment get transferred to the BAC insert
containing V gene segments and surrounding genomic DNA, said
nucleotide change or changes occurring at a homologous sequence on
the BAC.
[1197] Polymorphic V gene segments can differ from endogenous V
gene segments by only 1 or 2, or up to 10 or 15 nucleotide changes,
for example. An example of such nucleotide polymorphisms are
depicted in FIG. 5. Short single stranded regions that encompass
the polymorphic nucleotide changes can be chemically synthesized
using standard techniques. The resulting single stranded DNA
fragments are introduced into bacteria and via recombineering
techniques approximately 1 in 100 BAC fragments will have
incorporated the polymorphic nucleotides via homologous
incorporation of the single stranded fragment (FIG. 3a). BACs with
the desired nucleotide change can be identified by screening for
example several hundred individual clones by polymerase chain
reaction (PCR) amplification and sequencing, both by standard
techniques. In the example, two nucleotide changes will convert a
VH1-69*01 gene segment into a VH1-69*02 gene segment (FIG. 3b).
[1198] It is clear that this process can be repeated for multiple
endogenous V gene segments contained on a single BAC genomic
fragment. In addition, the techniques depicted in FIG. 2 can be
used to add additional polymorphic V gene segments by insertion
into regions between existing V gene segments. As would be evident
to one skilled in the art, a combination of these techniques can be
used to create numerous variations of both polymorphic and
endogenous human V gene segments. And it would be evident that
several different genomic fragments with engineered polymorphic V
gene segments and endogenous human V gene segments can be combined
to create even more variations.
Example 2
Adding Polymorphic V-Regions to the Genome Using SRMCE of Modified
BACs
[1199] Modified BACs with polymorphic V gene segments created using
the methods described in Example 1 can be used to alter the genome
of non-human mammals. These alterations can result in an intact IG
locus in which normal immunoglobin region recombination results in
VDJ or VJ combinations which includes the human V gene segments. An
example of how such an animal can be created is by altering the
genome of, for example, mouse embryonic stem (ES) cells using the
strategy outlined in FIG. 4.
[1200] One technique to integrate modified BACs with polymorphic V
gene segments into a genome is sequential recombinase mediated
cassette exchange (SRMCE). The technique is described in
WO2011004192 (Genome Research Limited), which is incorporated here
in its entirety by reference.
[1201] SRMCE provides for a locus modified with a `landing pad`
inserted at a specific location. This insertion can either be de
novo via homologous recombination or as a consequence of a previous
BAC insertion. In this example, the landing pad is inserted in the
mouse IGH locus between the most 3' J gene segment and the C gene
segment and a previous BAC insertion via SRMCE techniques have
resulted in the addition of 5 human V gene segments and 2 V region
pseudogenes. The landing pad has elements as shown in FIG. 4 that
will allow the selection of correct insertion of a second targeting
BAC fragment. The specificity of this insertion is provided by cre
recombinase-mediated exchange between permissive lox sites. A lox
site is permissive for recombination only with a compatible lox
site. In this example, the loxP site will only recombine with loxP
and lox2272 will only recombine with lox2272. This provides
directionality to the insertion of the BAC fragment as depicted in
FIGS. 4b and 4c.
[1202] ES cell clones with correct insertions are selected from a
pool of clones without insertions or with non-productive insertions
by resistance to puromycin. Resistance to puromycin results from
the juxtaposition of an active promoter element, PGK, with the
puroTK coding region. Correct insertions are verified by standard
techniques including PCR of junctions, PCR of internal elements,
Southern blotting, comparative genomic hybridization (CGH),
sequencing and etc. In the example, correct lox2272-lox2272 and
loxP-loxP recombination also results in two intact sets of piggyBac
elements that did not exist prior to insertion. An intact piggyBac
element is comprised of a set of inverted repeats which are
depicted in the figure by "PB5'" and "PB3'". An appropriated
oriented set of piggyBac elements are the substrate of piggyBac
transposase which can catalyse recombination between the elements,
resulting in deletion of intervening sequences as well as both
elements. The DNA remaining after a piggyBac transposition is left
intact and is lacking any remnant of the piggyBac element. In the
example, ES cell clones with successful piggyBac transposition are
selected by loss of the active puroTK element which renders the
cells resistant to the drug FIAU (FIGS. 4c and 4d).
[1203] The final product of the SRMCE method in this example is a
IGH locus with several polymorphic V gene segments inserted along
with a set of endogenous unmodified VH gene segments between
sequences of the mouse genome on the 5' side and the mouse IGH
constant region gene segments on the 3' side. The polymorphic V
gene segments are positioned such that they can participate in the
recombination events associated with B cell maturation yielding VDJ
gene segments. These gene segments can then be transcribed and
spliced to the mouse constant region. Translation of these
transcripts will result in the production of an antibody heavy
chain encoded by the polymorphic V gene segment, a human DH gene
segment, a human JH gene segment and a mouse constant heavy chain
gene segment.
[1204] As is well known to those skilled in the art, an ES cell
clone can be used to create a line of genetically modified mice via
injection of said cells into a mouse blastocyst embryo,
transferring the injected embryo to a suitable recipient and
breeding the chimeric offspring that result. The modified gene
locus can be propagated through breeding and made either
heterozygous or homozygous depending on the genetic cross.
[1205] It is evident from the structure of the IGH locus provided
in this example and by knowledge of the mechanisms involved in B
cell receptor (BCR) and antibody gene rearrangements that a large
set of different combinations of polymorphic V gene segments with
various DH and JH gene segments will result and these can
contribute to a large repertoire of functional antibody genes in a
population of B cells in genetically modified animals. In this
example, several different human VH1-69 polymorphs are incorporated
to provide superhuman VH diversity. This particular VH gene segment
is known to be prevalent in antibodies that bind infectious disease
pathogens (such as influenza virus) and therefore the antibody
repertoire of a mouse with the genetic modification of this example
would be expected to produce antibodies with a bias in favour of
those that bind infectious disease pathogens. The repertoire, in
other words, would have a larger subset of antibodies with superior
affinities for pathogen antigens. Examples of such pathogens
include influenza virus, hepatitis C virus (HCV) and human
immunodeficiency virus-1 (HIV-1) (see also table above).
Example 3
Alignment of 13 VH1-69 Alleles
[1206] Building a more diverse antibody repertoire by incorporating
additional V gene segment polymorphs requires availability of
polymorphic variants of V gene segments. One source of such
variants include sequence databases. In this example, 13 distinct
variants of the VH1-69 gene segment are provided.
[1207] These variant sequences and comparisons are drawn from the
"IMmunoGeneTics" IMGT Information System (www.imgt.com) database.
FIG. 5 is a diagram of the alignment of variants *02 through *13
with the *01 variant. The VH1-69*01 nucleotide and amino acid
sequence is provided at the top of the figure. Where the remaining
variants are identical to the *01 variant sequence a dash is
inserted below the sequence. Nucleotide differences are noted
alongside the appropriate variant and if the sequence change
results in a protein coding change, the amino acid change is
indicated above the triplet.
[1208] FIG. 5 depicts between 1 and 4 amino acid changes for each
variant in comparison to the *01 variant. All of the amino acid
changes occur in the part of the heavy chain protein encoding the
complementarity determining regions (CDRs). These regions are
responsible for antigen specificity and the affinity of the
antibody for the antigen. It is evident that providing additional
polymorphic CDRs in a repertoire of antibodies will increase the
likelihood of there being an antibody with superior binding
characteristics for various antigens. In several reports, it has
been observed that the VH1-69-encoded variable region of the heavy
chain is often found in antibodies that bind influenza virus, HCV
and HIV-1 antigens (see table above). Therefore incorporating the
polymorphic V gene segments of this example into a transgenic
animal model using the methods of Examples 1 and 2 would likely
result in an antibody repertoire in said transgenic animal with
more antibodies that bind to antigens associated with these and
other pathogens. And as is known in the art, a larger repertoire
increases the probability of finding monoclonal antibodies using,
for example, hybridoma technology, that bind with high affinity and
specificity to a desired antigen.
[1209] This disclosure therefore describes in these examples a
transgenic mouse model which can be immunized with pathogen or
other antigens. Plasma B cells from such an immunized mouse can be
used to make a hybridoma library that can be screened for
production of antibodies that bind the pathogen antigens. This
library will be superior to libraries from traditional transgenic
mice for finding such antibodies given the addition of polymorphic
VH1-69 gene segments to the IGH locus in said transgenic mouse.
[1210] These examples are not limiting to the human polymorphic V
gene segments that can be chosen or to the methods used to
introduce them into an animal model. The method can be used to
construct a transgenic locus with immunoglobulin D and/or J
segments. The V, D, J segments can be from a plurality of human
sources (optionally more than one human ethnic population).
Example 4
Human IgH JH Gene Variants Selected from the 1000 Genomes
Database
[1211] Data is presented for human JH2, 5 and 6 variants. In Tables
10A, 11A and 12A samples from humans from various populations are
listed where the sequence analysis of the inventors has revealed
the presence of polymorphisms in one or both IgH JH alleles. The
population codes are explained in Table 8 above. The polymorphisms
are nucleotide variants from JH2, 5 and 6 reference sequences (SEQ
ID NOs: 1, 2 and 3 respectively; see below). All references are
sequences taken from the Ensembl database (www.ensembl.org). The
JH5 reference is human IgH J5-001 disclosed in that database. The
JH6 reference is human IgH J6-001 disclosed in that database. The
JH2 reference is human IgH J2-001 disclosed in that database.
[1212] The reference nucleotide and encoded amino acid sequences
are shown on the next page. Alignments with encoded amino acid
sequences are also provided, including the corresponding position
numbers on human chromosome 14.
[1213] Variant Frequencies are shown in Tables 10A, 11A and 12A and
these relate to the frequency of the variants in the 1000 Genomes
Database (release current at October 2011).
[1214] Tables 10B, 11B and 12B show the non-synonymous nucleotide
polymorphisms in the human JH variants, as sorted by the present
inventors from the 1000 Genomes database. Position numbers
corresponding to nucleotide positions on human chromosome 14 are
shown for variant positions (chromosome 14 being the chromosome
bearing the IgH locus in humans). Thus, for example, the first
entry in Table 11B is "14:106330027:A/C" which refers to a position
in a variant JH5 sequence wherein the position corresponds to
position 106,330,027 on human chromosome 14, such position being A
(adenine) in the reference sequence. The "C" indicates that the
present inventors observed a mutation to cytosine at this position
in the variants found in the 1000 Genomes database. This change
leads to a change at the amino acid level of the encoded sequence
(i.e., a "non-synonymous" change), in this case a change from a
serine (found in the reference) to an alanine in the variant.
Example 5
[1215] Human Antibody Gene Segment Variant Identification &
Population Analysis
[1216] The genomic coding region coordinates for each target gene
for variant analysis were identified from the Ensembl WWW site
(www.ensembl.org) using coordinates from the GRCh.p8 Human Genome
assembly (www.ncbi.nlm.nih.gov/projects/genome/assembly/grc). Using
the collected gene location coordinates, variant data was extracted
from the public ftp site of the 1000 Genomes Project using the Perl
Variant Pattern Finder
(VPF--www.1000genomes.org/variation-pattern-finder-api-documentation).
[1217] Data extracted by VPF was post processed using software to
extract all non-synonymous (NSS) variants with their associated
genotype calls. Genotypes calls were assembled to form unique
haplotypes, representing groups of NSS variants associated with
1000 Genome population groups and frequency of occurrence within
those populations.
[1218] The output of the analysis results in tables such as in
Table 13. The main body of the table describes each haplotype in
turn giving a unique ID for that gene (in the range a-z,aa-zz), the
population frequencies and occurrence in individuals and unique
population groups; one or more subsequent columns describe the DNA
base calls at each location that form the haplotype giving both the
base from the reference sequence or the variant base call.
[1219] Table 13 was constructed in this manner. The table can be
read as follows:
[1220] The first four columns (left to right) consist of (1) the
haplotype ID letter (ref indicates reference--the DNA base call at
each genomic location from the GRCh37 Human Reference Assembly) (2)
the observed cumulative frequency of the haplotype among the
different populations (3) the number of individuals in which a
specific haplotype was observed (4) the number of unique population
groups that the identified individuals belong to (the actual
population group identifiers are displayed as a string of ID's in
the most right hand column for each haplotype. For example
haplotype `a` has a population ID string of `3, 4, 9, 13`).
[1221] The populations are numbered as follows (population labels
being according to 1000 Genomes Project nomenclature)
[1222] 1=ASW;
[1223] 2=CEU;
[1224] 3=CHB;
[1225] 4=CHS;
[1226] 5=CLM;
[1227] 6=FIN;
[1228] 7=GBR;
[1229] 8=IBS;
[1230] 9=JPT;
[1231] 10=LWK;
[1232] 11=MXL;
[1233] 12=PUR;
[1234] 13=TSI;
[1235] 14=YRI.
[1236] Subsequent columns detail a single point variant and have
the following format (top to bottom) (1) the human genomic location
of the variant (format [chromosome number]:[location] e.g.
`14:106204113`); (2) The identifier for the point variant as
defined in DbSNP (www.ncbi.nlm.nih.gov/projects/SNP/); (3) One or
additional rows show the amino acid change as result of the variant
for a specific transcript (denoted by the Ensembl transcript ID in
the most right-hand column for each row), the format is the amino
acid in the reference sequence followed by `->` and the amino
acid caused by the substitution of the variant in the reference
sequence (e.g. `Gly->Arg` means a that the translated reference
sequence would result in a glycine at that location, whereas the
substitution of the identified variant would result in translated
protein containing arginine) using the IUPAC three letter amino
acid codes
(http://paclupac.org/publications/pac/pdf/1972/pdf/3104x0639.pdf).
Subsequent rows (one per haplotype) show the DNA base at each
location, bases matching the reference sequence are shown in black
on white back ground, bases varying from the reference are shown as
white text on a black background.
[1237] The most right-hand column contains the Ensembl transcript
ID's (e.g. `ENST00000390542`) for each of the gene transcript and
relates to the amino acid changes to the left of this column.
Because the transcripts are differing lengths each variant position
may or may not have an associated amino acid change at the that
position.
Example 6
Transgenic Mice, B-Cells, Hybridomas, Antibodies & Heavy Chains
Based on Human JH6*02
[1238] A functional human gene segment repertoire (from VH2-26 to
JH6, see the IMGT database for the structure of the human IgH
locus;
[1239]
http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&rep-
ertoire=locus&species=h uman&group=IGK) was sectored by the
inventors to produce two different transgenic heavy chain alleles
(denoted S2F and S3F) and corresponding mice. The transgenic
alleles were expressed in the mice and the heavy chain repertoires
were assessed at the RNA transcript level. Deep sequence analysis
was carried out using Bioinformatics methods to assess V, D and JH
gene usage, including in variable domain sequences having a HCDR3
length of at least 20 amino acids. Endogenous, mouse variable
region gene segments were inactivated by inversion (as per the
method described in WO2011004192, this disclosure being
incorporated herein by reference).
[1240] Sequencing of Human Donor DNA Samples: Identification of
Conserved JH6*02 Variant
[1241] DNA samples from 9 anonymised consenting human donors were
obtained by taking cheek swabs.
[1242] The samples were processed and the DNA Samples were
extracted follow the protocol of QIAamp DNA Mini Kit (Cat. No.
51304, Qiagen).
[1243] PCR reactions were set up to amplify the JH6 region and PCR
products were sequenced (PCR Oligos sequence: Fwd.
5'-AGGCCAGCAGAGGGTTCCATG-3' (SEQ ID NO: 444), Rev.
5'-GGCTCCCAGATCCTCAAGGCAC-3' (SEQ ID NO: 445)).
[1244] Sequence analysis was carried out by comparing to the JH6
reference sequence from IMGT annotated database
(http://www.imgt.org/), and this identified that all 9 donor
genomes contained the human JH6*02 variant, with this variant being
in the homozygous state in 7 out of the 9 donors. The inventors
also consulted the genomic sequences publicly available for Jim
Watson and Craig Venter at Ensembl human genome database
[http://www.ensembl.org/]. These too contained the human JH6*02
variant. This confirmed to the inventors that human JH6*02 is a
common, conserved variant in humans, and thus a good candidate for
construction of a transgenic IgH locus as per the invention
[1245] Identification of Suitable Human DNA Sequence BACs
[1246] A series of human bacterial artificial chromosome (BAC)
clones were identified from Ensemble
(http://www.ensembl.org/index.html) or UCSC
(http://genome.ucsc.edu/) human database searches based on gene
name (IGH) or location (chromosome 14: 106026574-107346185). Seven
human RP11 BAC clones (see an extract of the UCSC database in FIG.
10, identified BACs being circled) were selected, RP11-1065N8 BAC
carrying human JH6*02. In total, the following BACs were identified
as sources of human IgH locus DNA: RP11-1065N8, RP11-659B19,
RP11-14117, RP-112H5, RP11-101G24, RP11-12F16 and RP11-47P23.
[1247] With a similar approach, different BAC clones (eg, different
RP11 clone IDs or different sources from RP11) or genetically
engineered BACs can be selected for insertion into the mouse IGH
locus to provide different sets of human repertoires in the
transgenic mouse.
[1248] Construction of Transgenic IgH Loci
[1249] Insertion of human heavy gene segments from a 1st IGH BAC
(RP11-1065N8) into the IGH locus of mouse AB2.1 ES cells (Baylor
College of Medicine) was performed to create a heavy chain allele
denoted the 51 allele. The inserted human sequence corresponds to
the sequence of human chromosome 14 from position 106494908 to
position 106328951 and comprises functional heavy gene segments
VH2-5, VH7-4-1, VH4-4, VH1-3, VH1-2, VH6-1, D1-1, D2-2, D3-9,
D3-10, D4-11, D5-12, D6-13, D1-14, D2-15, D3-16, D4-17, D5-18,
D6-19, D1-20, D2-21, D3-22, D4-23, D5-24, D6-25, D1-26, D7-27, JH1,
JH2, JH3, JH4, JH5 and JH6 (in 5' to 3' order), wherein the JH6 was
chosen to be the human JH6*02 variant. The insertion was made
between positions 114666435 and 114666436 on mouse chromosome 12,
which is upstream of the mouse C region. The mouse VH, D and J H
gene segments were retained in the locus, immediately upstream of
(5' of) the inserted human heavy chain DNA.
[1250] A second allele, S2 was constructed in which more human
functional VH gene segments were inserted upstream (5') of the
5'-most VH inserted in the S1 allele by the sequential insertion of
human DNA from a second BAC (BAC2). The inserted human sequence
from BAC2 corresponds to the sequence of human chromosome 14 from
position 106601551 to position 106494909 and comprises functional
heavy chain gene segments VH3-13, VH3-11, VH3-9, VH1-8, VH3-7. The
mouse VH, D and JH gene segments were retained in the locus,
immediately upstream of (5' of) the inserted human heavy chain DNA.
In a subsequent step, these were inverted to inactivate them,
thereby producing S2F mice in which only the human heavy chain
variable region gene segments are active.
[1251] A third allele, S3 was constructed in which more human
functional VH gene segments were inserted upstream (5') of the
5'-most VH inserted in the S2 allele by the sequential insertion of
human DNA from a third BAC (BAC3). The inserted sequence
corresponds to the sequence of human chromosome 14 from position
106759988 to position 106609301, and comprises functional heavy
chain gene segments, VH2-26, VH1-24, VH3-23, VH3-21, VH3-20,
VH1-18, and VH3-15. The mouse VH, D and JH gene segments were
retained in the locus, immediately upstream of (5' of) the inserted
human heavy chain DNA. In a subsequent step, these were inverted to
inactivate them, thereby producing S3F mice in which only the human
heavy chain variable region gene segments are active.
[1252] Mice bearing either the S2F or S3F insertion into an
endogenous heavy chain locus were generated from the ES cells using
standard procedures. The other endogenous heavy chain locus was
inactivated in the mice by insertion of an inactivating sequence
comprising neoR into the mouse JH-C intron (to produce the "HA"
allele).
[1253] Immunisation Procedure
[1254] Transgenic mice of the S2F or S3F genotype were primed with
20-40 ug recombinant proteins obtained commercially or produced in
house with Antigen 1 (OVA (Sigma A7641); Antigen 2 (a human
infectious disease pathogen antigen) and Antigen 3 (a human
antigen) via the ip route in complete Freunds adjuvant (Sigma F
5881) and 10 ug/animal CpG (CpG oligo; Invivogen, San Diego,
Calif., USA) and then boosted twice in about two weekly intervals
with about half the amount of antigen in incomplete Freunds
adjuvant (Sigma F 5506) and 10 ug/animal CpG. Final boosts were
administered two weeks later iv without any adjuvant and contained
5-10 ug protein in PBS.
[1255] Hybridoma Fusion Procedure
[1256] Spleens were taken 3 days after the final boost and
splenocytes were treated with CpG (25 m final concentration) for
and left until the following day. Cells were then fused with SP0/2
Ag14 myeloma cells (HPA Cultures Cat No 85072401) using a BTX
ECM2001 electrofusion instrument. Fused cells were left to recover
for 20 minutes then seeded in a T75 flask until next morning. Then
the cells were spun down and plated out by dilution series on
96-well culture plates and left for about 10 days before screening.
Media was changed 1-3 times during this period.
[1257] Screening
[1258] Culture supernatants of the hybridoma wells above were
screened using homogeneous time resolved fluorescence assay (htrf)
using Europium cryptate labelled anti-mouse IgG (Cisbio anti-mouse
Ig Europium Cryptate) and a biotin tagged target antigen with a
commercially available streptavidin conjugated donor (Cisbio;
streptavidin conjugated D2) or by IgG-specific 384 well ELISA.
Positive wells identified by htrf were scaled to 24-well plates or
immediately counterscreened using an IgG-specific detection ELISA
method. Positives identified by primary ELISA screen were
immediately expanded to 24-well plates. Once cultures were expanded
to 24-well stage and reached confluency, supernatants were
re-tested using htrf or IgG-specific ELISA to confirm binding to
target antigen. Supernatant of such confirmed cultures were then
also analysed by surface plasmon resonance using a BioRad ProteOn
XPR36 instrument. For this, antibody expressed in the hybridoma
cultures was captured on a biosensor GLM chip (BioRad 176-512)
which had an anti-mouse IgG (GE Healthcare BR-1008-38)) covalently
coupled the biosensor chip surface. The antigen was then used as
the analyte and passed over the captured hybridoma antibody
surface. For Antigen 2 and Antigen 3, concentrations of 256 nM, 64
nM, 16 nM, 4 nM and 1 nM were typically used, for Antigen 1,
concentrations of 1028 nM, 256 nM, 64 nM, 16 nM and 4 nM were
typically used, binding curves were double referenced using a 0 nM
injection (i.e. buffer alone). Kinetics and overall affinities were
determined using the 1:1 model inherent to the BioRad ProteOn XPR36
analysis software.
[1259] Any clones with confirmed binding activity were used for
preparing total RNA and followed by PCR to recover the heavy chain
variable region sequences. Standard 5'-RACE was carried out to
analyse RNA transcripts from the transgenic heavy chain loci in the
S2F and S3F mice. Additionally, deep sequence analysis of almost
2000 sequences produced by the mice was carried out.
[1260] Bionformatics Analysis
[1261] Sequences for analysis were obtained from two different
methods:
[1262] The first is from RNA extracted from the spleen: first cDNA
strand was synthesized using an oligo based on the Cmu region of
the mouse IGH locus as a PCR template. PCR was performed using this
oligo with an oligo dT-anchor primer. Then PCR product was cloned
into pDrive vector (Qiagen) and then sequenced.
[1263] The second is from hybridomas generated through
electro-fusion: total RNA was extracted from hybridoma lines of
interest using standard Trizol methods and frozen at -80.degree. C.
for long term storage. cDNA was generated from 100 ng total RNA
using standard Superscript III reverse transcriptase and a
gene-specific reverse primer binding to all mouse IgG isotypes for
heavy chain and a mouse kappa constant region primer for the light
chain amplification. 2-3 ul of cDNA were then used as template in a
PCR reaction using Pfu DNA polymerase and a panel of degenerate
forward primers annealing to the leader sequence of the human
immunoglobulin variable domain as well as one mouse pan-IgG reverse
primer. PCR products were run out of a 1% agarose gel and bands of
approximately 350-450 basepairs extracted and purified. DNA was
then sequenced.
[1264] The sequences from the first method can either be from IgM
from Naive mice or IgG from immunised mice. The samples from the
second method are all from IgG from immunised mice, and specific to
the immunising antigen. Almost 2000 sequences were analysed.
[1265] The sequences were obtained as a pair of forward and reverse
reads. These were first trimmed to remove low-quality base calls
from the ends of the reads (trimmed from both ends until a 19
nucleotide window had an average quality score of 25 or more). The
reads were combined together by taking the reverse complement of
the reverse read, and aligning it against the forward read. The
alignment scoring was 5 for a match, -4 for a mismatch, a gap open
penalty of 10 and a gap extension penalty of 1. A consensus
sequence was then produced by stepping through the alignment and
comparing bases. When there was a disagreement the base with the
highest quality value from sequencing was used.
[1266] The BLAST.COPYRGT. (Basic Local Alignment Search Tool)
(Camacho C., Coulouris G., Avagyan V., Ma N., Papadopoulos J.,
Bealer K., & Madden T. L. (2008) "BLAST.COPYRGT.: architecture
and applications." BMC Bioinformatics 10:421
http://www.ncbi.nlm.nih.gov/pubmed/20003500) program `blastn` was
then used to find the germline J and V segments used in each
sequence. A wordsize of 30 was used for V matching, and 15 for J
matching. The database searched against was constructed from the
NGS sequencing of the BACs which were used to generate the
Kymouse.
[1267] If a sequence matched both a V and a J segment, the sequence
between the two was then compared to a database of germline D
segments in the mouse using `blastn` with a wordsize of 4 and the
options `blastn-short` and `ungapped`. This was used to assign a D
segment, if possible. The CDR3 was identified by searching for the
conserved "TATTACTGT" sequence in the V segment, and the "CTGGGG"
in the J segment. If these motifs were not found, then up to 4
mismatches were allowed. The IMGT definition of CDR3 was used, so
the CDR3 length is calculated from after the "TGT" in the V to
before the "TGG" in the J. Sequences with an out of frame junction
(those which do not have a CDR3 nucleotide length divisible by 3)
or which contained a stop codon ("TAA", "TAG" or "TGA") were
excluded.
[1268] The identity of the matching V, J and D segments as well as
the CDR3 length from this assignment were then saved as a table for
downstream analysis. The ratio of IGHJ6*02 used increased from the
naive to immunised mice, as well as being enriched in the
sub-population of sequences with a long HCDR3 (defined as
consisting of 20 or more amino acids):
TABLE-US-00003 All HCDR3 >20 Total Total JH6*02% Count JH6*02%
Count % HCDR3 >20 Naive 22.31% 1340 91.11% 45 3.36% Immunised
37.50% 256 66.67% 9 3.52% Hybridoma 36.13% 119 63.64% 11 9.24%
[1269] This shows that the JH6*02 gene segment is selected for by
immunisation, as the proportion of JH6*02 usage increases after
immunisation. JH6*02 is also used in the majority of antibodies
with a long HCDR3 length, which is desirable for targets which are
specifically bound by long HCDR3 length antibodies.
TABLE-US-00004 SEQ ID NO: 1 (JH5 Reference) T T G A C C A A G C T G
G G G A C C C C G G T C C C T T G G G A C C A G T G G C A G A G G A
G T C JH5 Alignment: (top line = SEQ ID NO: 1, Middle line = SEQ ID
NO: 5, Bottom line = SEQ ID NO: 6) 106,330,068 LgH J5001
106,330,072 106,330,071 106,330,067 106,330,041 106,330,082
106,330,027 106,330,024 106,330,065 106,330,065 106,330,063
106,330,062 106,330,045 106,330,044 T T G A C C A A G C T G G G G A
C C C C G C C T T G G G A C C A G T G G C A G A G G- A A C T G G T
T C G A C C C C T G G C T G G - C A C C G T C C T C A G W P W G Q G
T L V T V S S SEQ ID NO: 2 (JH6Reference) A T G A T G A T G A T G A
T G A T G T A C C T G C A G A C C C C G T T T C C C T G G T G C C A
G T G G C A G A G G A G T JH6 Alignment: (top line = SEQ ID NO: 2,
Middle line = SEQ ID NO: 7, Bottom line = SEQ ID NO: 8) LgH J6001
106,329,468 106,329,453 106,329,452 106,329,451 106,329,435 T T G A
C C A A G C T G G G G A C C C C G C C T T G G G A C C A G T G G C A
G A G G- A A 106,329,426 106,329,419 106,329,417 106,329,414
106,329,413 106,329,411 106,329,408 C C C T G G T G C C A G T G G C
A G A G G A G T C G G G A C C A C G G T C A C C G T C T C C T C A G
G T T V T V S S SEQ ID NO: 3 JH 2 Reference) A T G A C C A T G A A
G C T A G A G A C C C C G G C A C C G T G G G A C C A G T G A C A G
A G G A G T C JH2 Alignment: (top line = SEQ ID NO: 3, Middle lien
= SEQ ID NO: 9, Bottom line = SEQ ID NO: 10) IgH J5-001 106,331,460
106,331,455 106,331,453 106,331,453 A T G A C C A T G A A G C T A G
A G A C C C C G G C A C C G T G G G A C C A G T G A C A G A G G A G
T C T A C T G G A C T T C G A C T C T G G G G C C G T G G C A C C C
T G G T C A C T G T C T C C T C A G Y W Y F D L W G R G T L V T V S
S
Tables
[1270] In the tables, the notation is illustrated by the following
example
TABLE-US-00005 IGLV1 40 G1 40*02 X53936
:g9>|c1)>g,L4>VI
[1271] Polymorphic variant IGV lambda VI-40*02 has Genbank
Accession No. X53936 and when compared to the *01 variant, the
VI-40*02 variant has mutations at positions 9, 10 and 4. For
example, at position 9, a "C" appears instead of a "G" that is
present in the *01 variant. The "I" is simply a notation separator,
and does not indicate any mutation. For example the "g282 I"
notation indicates no change (ie, position 282 is a g). "del#"
means that the residue at that position is absent.
TABLE-US-00006 Lengthy table referenced here
US20180030121A1-20180201-T00001 Please refer to the end of the
specification for access instructions.
TABLE-US-00007 Lengthy table referenced here
US20180030121A1-20180201-T00002 Please refer to the end of the
specification for access instructions.
TABLE-US-00008 Lengthy table referenced here
US20180030121A1-20180201-T00003 Please refer to the end of the
specification for access instructions.
TABLE-US-00009 Lengthy table referenced here
US20180030121A1-20180201-T00004 Please refer to the end of the
specification for access instructions.
TABLE-US-00010 Lengthy table referenced here
US20180030121A1-20180201-T00005 Please refer to the end of the
specification for access instructions.
TABLE-US-00011 Lengthy table referenced here
US20180030121A1-20180201-T00006 Please refer to the end of the
specification for access instructions.
TABLE-US-00012 Lengthy table referenced here
US20180030121A1-20180201-T00007 Please refer to the end of the
specification for access instructions.
TABLE-US-00013 Lengthy table referenced here
US20180030121A1-20180201-T00008 Please refer to the end of the
specification for access instructions.
TABLE-US-00014 Lengthy table referenced here
US20180030121A1-20180201-T00009 Please refer to the end of the
specification for access instructions.
TABLE-US-00015 Lengthy table referenced here
US20180030121A1-20180201-T00010 Please refer to the end of the
specification for access instructions.
TABLE-US-00016 Lengthy table referenced here
US20180030121A1-20180201-T00011 Please refer to the end of the
specification for access instructions.
TABLE-US-00017 Lengthy table referenced here
US20180030121A1-20180201-T00012 Please refer to the end of the
specification for access instructions.
TABLE-US-00018 Lengthy table referenced here
US20180030121A1-20180201-T00013 Please refer to the end of the
specification for access instructions.
TABLE-US-00019 Lengthy table referenced here
US20180030121A1-20180201-T00014 Please refer to the end of the
specification for access instructions.
TABLE-US-00020 Lengthy table referenced here
US20180030121A1-20180201-T00015 Please refer to the end of the
specification for access instructions.
TABLE-US-00021 Lengthy table referenced here
US20180030121A1-20180201-T00016 Please refer to the end of the
specification for access instructions.
TABLE-US-00022 Lengthy table referenced here
US20180030121A1-20180201-T00017 Please refer to the end of the
specification for access instructions.
TABLE-US-00023 Lengthy table referenced here
US20180030121A1-20180201-T00018 Please refer to the end of the
specification for access instructions.
TABLE-US-00024 Lengthy table referenced here
US20180030121A1-20180201-T00019 Please refer to the end of the
specification for access instructions.
TABLE-US-00025 Lengthy table referenced here
US20180030121A1-20180201-T00020 Please refer to the end of the
specification for access instructions.
TABLE-US-00026 Lengthy table referenced here
US20180030121A1-20180201-T00021 Please refer to the end of the
specification for access instructions.
TABLE-US-00027 Lengthy table referenced here
US20180030121A1-20180201-T00022 Please refer to the end of the
specification for access instructions.
TABLE-US-00028 Lengthy table referenced here
US20180030121A1-20180201-T00023 Please refer to the end of the
specification for access instructions.
TABLE-US-00029 Lengthy table referenced here
US20180030121A1-20180201-T00024 Please refer to the end of the
specification for access instructions.
REFERENCES
[1272] 1. Nat Biotechnol. 2005 September; 23(9):1117-25; Human
antibodies from transgenic animals; Lonberg N. [1273] 2. J Clin
Invest. 1992 March; 89(3):729-38; Immunoglobulin light chain
variable region gene sequences for human antibodies to Haemophilus
influenzae type b capsular polysaccharide are dominated by a
limited number of V kappa and V lambda segments and VJ
combinations; Adderson E E, Shackelford P G, Insel R A, Quinn A,
Wilson P M, Carroll W L. [1274] 3. J Immunol. 1993 October 15;
151(8):4352-61; Clonal characterization of the human IgG antibody
repertoire to Haemophilus influenzae type b polysaccharide. V. In
vivo expression of individual antibody clones is dependent on Ig CH
haplotypes and the categories of antigen; Chung G H, Scott M G, Kim
K H, Kearney J, Siber G R, Ambrosino D M, Nahm M H. [1275] 4. J
Immunol. 1998 December 1; 161(11):6068-73; Decreased frequency of
rearrangement due to the synergistic effect of nucleotide changes
in the heptamer and nonamer of the recombination signal sequence of
the V kappa gene A2b, which is associated with increased
susceptibility of Navajos to Haemophilus influenzae type b disease;
Nadel B, Tang A, Lugo G, Love V, Escuro G, Feeney A J. [1276] 5. J
Clin Invest. 1996 May 15; 97(10):2277-82; A defective Vkappa A2
allele in Navajos which may play a role in increased susceptibility
to haemophilus influenzae type b disease; Feeney A J, Atkinson M J,
Cowan M J, Escuro G, Lugo G. [1277] 6. Infect Immun. 1994
September; 62(9):3873-80; Variable region sequences of a protective
human monoclonal antibody specific for the Haemophilus influenzae
type b capsular polysaccharide; Lucas A H, Larrick J W, Reason D C.
[1278] 7. J Clin Invest. 1993 June; 91(6):2734-43; Restricted
immunoglobulin VH usage and VDJ combinations in the human response
to Haemophilus influenzae type b capsular polysaccharide.
Nucleotide sequences of monospecific anti-Haemophilus antibodies
and polyspecific antibodies cross-reacting with self antigens;
Adderson E E, Shackelford P G, Quinn A, Wilson P M, Cunningham M W,
Insel R A, Carroll W L. [1279] 8. J Clin Invest. 1993 March;
91(3):788-96; Variable region expression in the antibody responses
of infants vaccinated with Haemophilus influenzae type b
polysaccharide-protein conjugates. Description of a new lambda
light chain-associated idiotype and the relation between idiotype
expression, avidity, and vaccine formulation. The Collaborative
Vaccine Study Group; Granoff D M, Shackelford P G, Holmes S J,
Lucas A H. [1280] 9. Infect Immun. 1994 May; 62(5):1776-86;
Variable region sequences and idiotypic expression of a protective
human immunoglobulin M antibody to capsular polysaccharides of
Neisseria meningitidis group B and Escherichia coli K1; Azmi F H,
Lucas A H, Raff H V, Granoff D M. [1281] 10. J Clin Invest. 1992
December; 90(6):2197-208; Sequence analyses of three immunoglobulin
G anti-virus antibodies reveal their utilization of
autoantibody-related immunoglobulin Vh genes, but not V lambda
genes; Huang D F, Olee T, Masuho Y, Matsumoto Y, Carson D A, Chen P
P. [1282] 11. Science. 2011 August 12; 333(6044):834-5,
Biochemistry. Catching a moving target, Wang T T, Palese P [1283]
12. Science. 2009 Apr. 10; 324(5924):246-51. Epub 2009 February 26;
Antibody recognition of a highly conserved influenza virus epitope;
Ekiert D C, Bhabha G, Elsliger M A, Friesen R H, Jongeneelen M,
Throsby M, Goudsmit J, Wilson I A. [1284] 13. PLoS One. 2008;
3(12):e3942. Epub 2008 Dec. 16; Heterosubtypic neutralizing
monoclonal antibodies cross-protective against H5N1 and H1N1
recovered from human IgM.COPYRGT. memory B cells; Throsby M, van
den Brink E, Jongeneelen M, Poon L L, Alard P, Cornelissen L,
Bakker A, Cox F, van Deventer E, Guan Y, Cinatl J, ter Meulen J,
Lasters I, Carsetti R, Peiris M, de KruifJ, Goudsmit J. [1285] 14.
Nat Struct Mol Biol. 2009 March; 16(3):265-73. Epub 2009 Feb. 22,
Structural and functional bases for broad-spectrum neutralization
of avian and human influenza A viruses, Sui J, Hwang W C, Perez S,
Wei G, Aird D, Chen L M, Santelli E, Stec B, Cadwell G, Ali M, Wan
H, Murakami A, Yammanuru A, Han T, Cox N J, Bankston L A, Donis R
O, Liddington R C, Marasco W A. [1286] 15. Science. 2011 August 12;
333(6044):843-50. Epub 2011 Jul. 7, A highly conserved neutralizing
epitope on group 2 influenza A viruses, Ekiert D C, Friesen R H,
Bhabha G, Kwaks T, Jongeneelen M, Yu W, Ophorst C, Cox F, Korse H
J, Brandenburg B, Vogels R, Brakenhoff J P, Kompier R, Koldijk M H,
Cornelissen L A, Poon L L, Peiris M, Koudstaal W, Wilson I A,
Goudsmit J.
TABLE-US-LTS-00001 [1286] LENGTHY TABLES The patent application
contains a lengthy table section. A copy of the table is available
in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20180030121A1).
An electronic copy of the table will also be available from the
USPTO upon request and payment of the fee set forth in 37 CFR
1.19(b)(3).
Sequence CWU 1
1
445149DNAhomo sapiens; 1ttgaccaagc tggggacccc ggtcccttgg gaccagtggc
agaggagtc 49261DNAhomo sapiens; 2atgatgatga tgatgatgta cctgcagacc
ccgtttccct ggtgccagtg gcagaggagt 60c 61352DNAhomo sapiens;
3atgaccatga agctagagac cccggcaccg tgggaccagt gacagaggag tc
52461DNAhomo sapiens; 4atgatgatga tgatgccata cctgcagacc ccggttccct
ggtgccagtg gcagaggagt 60c 61549DNAhomo sapiens; 5aactggttcg
acccctgggg ccagggaacc ctggtcaccg tctcctcag 49616PRThomo sapiens;
6Asn Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 1
5 10 15 761DNAhomo sapiens; 7tactactact actactacat ggacgtctgg
ggcaaaggga ccacggtcac cgtctcctca 60g 61820PRThomo sapiens; 8Tyr Tyr
Tyr Tyr Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val 1 5 10 15
Thr Val Ser Ser 20 952DNAhomo sapiens; 9tactggtact tcgatctctg
gggccgtggc accctggtca ctgtctcctc ag 521017PRThomo sapiens; 10Tyr
Trp Tyr Phe Asp Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser 1 5 10
15 Ser 11296DNAhomo sapiens; 11caggtgcagc tggtgcagtc tggggctgag
gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg cttctggata caccttcacc
ggctactata tgcactgggt gcgacaggcc 120cctggacaag ggcttgagtg
gatgggacgg atcaacccta acagtggtgg cacaaactat 180gcacagaagt
ttcagggcag ggtcaccagt accagggaca cgtccatcag cacagcctac
240atggagctga gcaggctgag atctgacgac acggtcgtgt attactgtgc gagaga
29612296DNAhomo sapiens; 12caggtccagc ttgtgcagtc tggggctgag
gtgaagaagc ctggggcctc agtgaaggtt 60tcctgcaagg cttctggata caccttcact
agctatgcta tgcattgggt gcgccaggcc 120cccggacaaa ggcttgagtg
gatgggatgg atcaacgctg gcaatggtaa cacaaaatat 180tcacagaagt
tccagggcag agtcaccatt accagggaca catccgcgag cacagcctac
240atggagctga gcagcctgag atctgaagac acggctgtgt attactgtgc gagaga
29613296DNAhomo sapiens; 13caggtgcagc tggtgcagtc tggggctgag
gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg cttctggata caccttcacc
agttatgata tcaactgggt gcgacaggcc 120actggacaag ggcttgagtg
gatgggatgg atgaacccta acagtggtaa cacaggctat 180gcacagaagt
tccagggcag agtcaccatg accaggaaca cctccataag cacagcctac
240atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagagg
29614296DNAhomo sapiens; 14caggtccagc tggtacagtc tggggctgag
gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg tttccggata caccctcact
gaattatcca tgcactgggt gcgacaggct 120cctggaaaag ggcttgagtg
gatgggaggt tttgatcctg aagatggtga aacaatctac 180gcacagaagt
tccagggcag agtcaccatg accgaggaca catctacaga cacagcctac
240atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc aacaga
29615296DNAhomo sapiens;misc_feature(295)..(295)n is a, c, g, or t
15cagatgcagc tggtgcagtc tggggctgag gtgaagaaga ctgggtcctc agtgaaggtt
60tcctgcaagg cttccggata caccttcacc taccgctacc tgcactgggt gcgacaggcc
120cccggacaag cgcttgagtg gatgggatgg atcacacctt tcaatggtaa
caccaactac 180gcacagaaat tccaggacag agtcaccatt actagggaca
ggtctatgag cacagcctac 240atggagctga gcagcctgag atctgaggac
acagccatgt attactgtgc aagana 29616296DNAhomo sapiens; 16caggtgcagc
tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60tcctgcaagg
catctggata caccttcacc agctactata tgcactgggt gcgacaggcc
120cctggacaag ggcttgagtg gatgggaata atcaacccta gtggtggtag
cacaagctac 180gcacagaagt tccagggcag agtcaccatg accagggaca
cgtccacgag cacagtctac 240atggagctga gcagcctgag atctgaggac
acggccgtgt attactgtgc gagaga 29617296DNAhomo sapiens; 17caaatgcagc
tggtgcagtc tgggcctgag gtgaagaagc ctgggacctc agtgaaggtc 60tcctgcaagg
cttctggatt cacctttact agctctgctg tgcagtgggt gcgacaggct
120cgtggacaac gccttgagtg gataggatgg atcgtcgttg gcagtggtaa
cacaaactac 180gcacagaagt tccaggaaag agtcaccatt accagggaca
tgtccacaag cacagcctac 240atggagctga gcagcctgag atccgaggac
acggccgtgt attactgtgc ggcaga 29618296DNAhomo sapiens; 18caggtgcagc
tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60tcctgcaagg
cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc
120cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac
agcaaactac 180gcacagaagt tccagggcag agtcacgatt accgcggacg
aatccacgag cacagcctac 240atggagctga gcagcctgag atctgaggac
acggccgtgt attactgtgc gagaga 29619294DNAhomo sapiens; 19caggtccagc
tggtgcagtc ttgggctgag gtgaggaagt ctggggcctc agtgaaagtc 60tcctgtagtt
tttctgggtt taccatcacc agctacggta tacattgggt gcaacagtcc
120cctggacaag ggcttgagtg gatgggatgg atcaaccctg gcaatggtag
cccaagctat 180gccaagaagt ttcagggcag attcaccatg accagggaca
tgtccacaac cacagcctac 240acagacctga gcagcctgac atctgaggac
atggctgtgt attactatgc aaga 29420294DNAhomo sapiens; 20gaggtccagc
tggtacagtc tggggctgag gtgaagaagc ctggggctac agtgaaaatc 60tcctgcaagg
tttctggata caccttcacc gactactaca tgcactgggt gcaacaggcc
120cctggaaaag ggcttgagtg gatgggactt gttgatcctg aagatggtga
aacaatatac 180gcagagaagt tccagggcag agtcaccata accgcggaca
cgtctacaga cacagcctac 240atggagctga gcagcctgag atctgaggac
acggccgtgt attactgtgc aaca 29421302DNAhomo sapiens; 21cagatcacct
tgaaggagtc tggtcctacg ctggtgaaac ccacacagac cctcacgctg 60acctgcacct
tctctgggtt ctcactcagc actagtggag tgggtgtggg ctggatccgt
120cagcccccag gaaaggccct ggagtggctt gcactcattt attggaatga
tgataagcgc 180tacagcccat ctctgaagag caggctcacc atcaccaagg
acacctccaa aaaccaggtg 240gtccttacaa tgaccaacat ggaccctgtg
gacacagcca catattactg tgcacacaga 300cc 30222301DNAhomo sapiens;
22caggtcacct tgaaggagtc tggtcctgtg ctggtgaaac ccacagagac cctcacgctg
60acctgcaccg tctctgggtt ctcactcagc aatgctagaa tgggtgtgag ctggatccgt
120cagcccccag ggaaggccct ggagtggctt gcacacattt tttcgaatga
cgaaaaatcc 180tacagcacat ctctgaagag caggctcacc atctccaagg
acacctccaa aagccaggtg 240gtccttacca tgaccaacat ggaccctgtg
gacacagcca catattactg tgcacggata 300c 30123301DNAhomo sapiens;
23caggtcacct tgagggagtc tggtcctgcg ctggtgaaac ccacacagac cctcacactg
60acctgcacct tctctgggtt ctcactcagc actagtggaa tgtgtgtgag ctggatccgt
120cagcccccag ggaaggccct ggagtggctt gcactcattg attgggatga
tgataaatac 180tacagcacat ctctgaagac caggctcacc atctccaagg
acacctccaa aaaccaggtg 240gtccttacaa tgaccaacat ggaccctgtg
gacacagcca cgtattactg tgcacggata 300c 30124296DNAhomo sapiens;
24gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt cacctttagt agctattgga tgagctgggt ccgccaggct
120ccagggaagg ggctggagtg ggtggccaac ataaagcaag atggaagtga
gaaatactat 180gtggactctg tgaagggccg attcaccatc tccagagaca
acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagaga 29625298DNAhomo sapiens; 25gaagtgcagc
tggtggagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60tcctgtgcag
cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct
120ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag
cataggctat 180gcggactctg tgaagggccg attcaccatc tccagagaca
acgccaagaa ctccctgtat 240ctgcaaatga acagtctgag agctgaggac
acggccttgt attactgtgc aaaagata 29826296DNAhomo sapiens;
26caggtgcagc tggtggagtc tgggggaggc ttggtcaagc ctggagggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt gactactaca tgagctggat ccgccaggct
120ccagggaagg ggctggagtg ggtttcatac attagtagta gtggtagtac
catatactac 180gcagactctg tgaagggccg attcaccatc tccagggaca
acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggccgtgt attactgtgc gagaga 29627293DNAhomo sapiens; 27gaggtgcagc
tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctacgaca tgcactgggt ccgccaagct
120acaggaaaag gtctggagtg ggtctcagct attggtactg ctggtgacac
atactatcca 180ggctccgtga agggccgatt caccatctcc agagaaaatg
ccaagaactc cttgtatctt 240caaatgaaca gcctgagagc cggggacacg
gctgtgtatt actgtgcaag aga 29328302DNAhomo sapiens; 28gaggtgcagc
tggtggagtc tgggggaggc ttggtaaagc ctggggggtc ccttagactc 60tcctgtgcag
cctctggatt cactttcagt aacgcctgga tgagctgggt ccgccaggct
120ccagggaagg ggctggagtg ggttggccgt attaaaagca aaactgatgg
tgggacaaca 180gactacgctg cacccgtgaa aggcagattc accatctcaa
gagatgattc aaaaaacacg 240ctgtatctgc aaatgaacag cctgaaaacc
gaggacacag ccgtgtatta ctgtaccaca 300ga 30229296DNAhomo sapiens;
29gaggtacaac tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt aacagtgaca tgaactgggc ccgcaaggct
120ccaggaaagg ggctggagtg ggtatcgggt gttagttgga atggcagtag
gacgcactat 180gtggactccg tgaagcgccg attcatcatc tccagagaca
attccaggaa ctccctgtat 240ctgcaaaaga acagacggag agccgaggac
atggctgtgt attactgtgt gagaaa 29630296DNAhomo sapiens; 30acagtgcagc
tggtggagtc tgggggaggc ttggtagagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt aacagtgaca tgaactgggt ccgccaggct
120ccaggaaagg ggctggagtg ggtatcgggt gttagttgga atggcagtag
gacgcactat 180gcagactctg tgaagggccg attcatcatc tccagagaca
attccaggaa cttcctgtat 240cagcaaatga acagcctgag gcccgaggac
atggctgtgt attactgtgt gagaaa 29631296DNAhomo sapiens; 31gaggtgcagc
tggtggagtc tgggggaggt gtggtacggc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt cacctttgat gattatggca tgagctgggt ccgccaagct
120ccagggaagg ggctggagtg ggtctctggt attaattgga atggtggtag
cacaggttat 180gcagactctg tgaagggccg attcaccatc tccagagaca
acgccaagaa ctccctgtat 240ctgcaaatga acagtctgag agccgaggac
acggccttgt atcactgtgc gagaga 29632296DNAhomo sapiens; 32gaggtgcagc
tggtggagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtagtta
catatactac 180gcagactcag tgaagggccg attcaccatc tccagagaca
acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagaga 29633296DNAhomo sapiens; 33gaggtgcagc
tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag
cacatactac 180gcagactccg tgaagggccg gttcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggccgtat attactgtgc gaaaga 29634296DNAhomo sapiens; 34caggtgcagc
tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct
120ccaggcaagg ggctagagtg ggtggcagtt atatcatatg atggaagtaa
taaatactac 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac
acggctgtgt attactgtgc gagaga 29635294DNAhomo sapiens; 35caggtgcagc
tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagcaa
taaatactac 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac
acggctgtgt attactgtgc gaga 29436296DNAhomo sapiens; 36caggtgcagc
tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag
cgtctggatt caccttcagt agctatggca tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagtt atatggtatg atggaagtaa
taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagaga 29637296DNAhomo sapiens; 37gaggtgcagc
tggtggagtc tgggggaggc ttggtacagc ctgggggatc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt aacagtgaca tgaactgggt ccatcaggct
120ccaggaaagg ggctggagtg ggtatcgggt gttagttgga atggcagtag
gacgcactat 180gcagactctg tgaagggccg attcatcatc tccagagaca
attccaggaa caccctgtat 240ctgcaaacga atagcctgag ggccgaggac
acggctgtgt attactgtgt gagaaa 29638292DNAhomo sapiens; 38gaggtgcagc
tggtggagtc tgggggaggc ttggtacagc ctagggggtc cctgagactc 60tcctgtgcag
cctctggatt caccgtcagt agcaatgaga tgagctggat ccgccaggct
120ccagggaagg ggctggagtg ggtctcatcc attagtggtg gtagcacata
ctacgcagac 180tccaggaagg gcagattcac catctccaga gacaattcca
agaacacgct gtatcttcaa 240atgaacaacc tgagagctga gggcacggcc
gcgtattact gtgccagata ta 29239298DNAhomo sapiens; 39gaagtgcagc
tggtggagtc tgggggagtc gtggtacagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt cacctttgat gattatacca tgcactgggt ccgtcaagct
120ccggggaagg gtctggagtg ggtctctctt attagttggg atggtggtag
cacatactat 180gcagactctg tgaagggccg attcaccatc tccagagaca
acagcaaaaa ctccctgtat 240ctgcaaatga acagtctgag aactgaggac
accgccttgt attactgtgc aaaagata 29840291DNAhomo sapiens;
40gaggatcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgaccc
60tcctgtgcag cctctggatt cgccttcagt agctatgctc tgcactgggt tcgccgggct
120ccagggaagg gtctggagtg ggtatcagct attggtactg gtggtgatac
atactatgca 180gactccgtga tgggccgatt caccatctcc agagacaacg
ccaagaagtc cttgtatctt 240catatgaaca gcctgatagc tgaggacatg
gctgtgtatt attgtgcaag a 29141296DNAhomo sapiens; 41gaggtgcagc
tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct
120ccagggaagg ggctggagtg ggtttcatac attagtagta gtagtagtac
catatactac 180gcagactctg tgaagggccg attcaccatc tccagagaca
atgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagaga 29642302DNAhomo sapiens; 42gaggtgcagc
tggtggagtc tgggggaggc ttggtacagc cagggcggtc cctgagactc 60tcctgtacag
cttctggatt cacctttggt gattatgcta tgagctggtt ccgccaggct
120ccagggaagg ggctggagtg ggtaggtttc attagaagca aagcttatgg
tgggacaaca 180gaatacaccg cgtctgtgaa aggcagattc accatctcaa
gagatggttc caaaagcatc 240gcctatctgc aaatgaacag cctgaaaacc
gaggacacag ccgtgtatta ctgtactaga 300ga 30243293DNAhomo sapiens;
43gaggtgcagc tggtggagtc tggaggaggc ttgatccagc ctggggggtc cctgagactc
60tcctgtgcag cctctgggtt caccgtcagt agcaactaca tgagctgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcagtt atttatagcg gtggtagcac
atactacgca 180gactccgtga agggccgatt caccatctcc agagacaatt
ccaagaacac gctgtatctt 240caaatgaaca gcctgagagc cgaggacacg
gccgtgtatt actgtgcgag aga 29344296DNAhomo sapiens; 44gaggtgcagc
tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct
120ccagggaagg gactggaata tgtttcagct attagtagta atgggggtag
cacatattat 180gcaaactctg tgaagggcag attcaccatc tccagagaca
attccaagaa cacgctgtat 240cttcaaatgg gcagcctgag agctgaggac
atggctgtgt attactgtgc gagaga 29645293DNAhomo sapiens; 45gaggtgcagc
tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccgtcagt agcaactaca tgagctgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcagtt atttatagcg gtggtagcac
atactacgca 180gactccgtga agggcagatt caccatctcc agagacaatt
ccaagaacac gctgtatctt 240caaatgaaca gcctgagagc cgaggacacg
gctgtgtatt actgtgcgag aga 29346302DNAhomo sapiens; 46gaggtgcagc
tggtggagtc tgggggaggc ttggtccagc ctggagggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt gaccactaca tggactgggt ccgccaggct
120ccagggaagg ggctggagtg ggttggccgt actagaaaca aagctaacag
ttacaccaca 180gaatacgccg cgtctgtgaa aggcagattc accatctcaa
gagatgattc aaagaactca 240ctgtatctgc aaatgaacag cctgaaaacc
gaggacacgg ccgtgtatta ctgtgctaga 300ga 30247302DNAhomo sapiens;
47gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgaaactc
60tcctgtgcag cctctgggtt caccttcagt ggctctgcta tgcactgggt ccgccaggct
120tccgggaaag ggctggagtg ggttggccgt attagaagca aagctaacag
ttacgcgaca 180gcatatgctg cgtcggtgaa aggcaggttc accatctcca
gagatgattc aaagaacacg 240gcgtatctgc aaatgaacag cctgaaaacc
gaggacacgg ccgtgtatta ctgtactaga 300ca 30248296DNAhomo sapiens;
48gaggtgcagc tggtggagtc cgggggaggc ttagttcagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt agctactgga tgcactgggt ccgccaagct
120ccagggaagg ggctggtgtg ggtctcacgt attaatagtg atgggagtag
cacaagctac 180gcggactccg tgaagggccg attcaccatc tccagagaca
acgccaagaa cacgctgtat 240ctgcaaatga acagtctgag agccgaggac
acggctgtgt attactgtgc aagaga 29649288DNAhomo sapiens; 49gaggtgcagc
tggtggagtc tcggggagtc ttggtacagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccgtcagt agcaatgaga tgagctgggt ccgccaggct
120ccagggaagg gtctggagtg ggtctcatcc attagtggtg gtagcacata
ctacgcagac 180tccaggaagg gcagattcac catctccaga gacaattcca
agaacacgct gcatcttcaa 240atgaacagcc tgagagctga ggacacggct
gtgtattact gtaagaaa 28850293DNAhomo sapiens; 50gaggtgcagc
tggtggagtc tgggggaggc ttggtaaagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt gactactaca tgaactgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtaccat
atactacgca 180gactctgtga agggccgatt caccatctcc agagacaacg
ccaagaactc actgtatctg 240caaatgaaca gcctgagagc cgaggacacg
gctgtgtatt actgtgcgag aga 29351296DNAhomo sapiens; 51caggtgcagc
tgcaggagtc gggcccagga ctggtgaagc ctccggggac cctgtccctc 60acctgcgctg
tctctggtgg ctccatcagc agtagtaact ggtggagttg ggtccgccag
120cccccaggga aggggctgga gtggattggg gaaatctatc atagtgggag
caccaactac 180aacccgtccc tcaagagtcg agtcaccata tcagtagaca
agtccaagaa ccagttctcc 240ctgaagctga gctctgtgac cgccgcggac
acggccgtgt attgctgtgc gagaga 29652296DNAhomo sapiens; 52caggtgcagc
tgcaggagtc gggcccagga ctggtgaagc cttcggacac cctgtccctc 60acctgcgctg
tctctggtta ctccatcagc agtagtaact ggtggggctg gatccggcag
120cccccaggga agggactgga gtggattggg tacatctatt atagtgggag
cacctactac 180aacccgtccc tcaagagtcg agtcaccatg tcagtagaca
cgtccaagaa ccagttctcc 240ctgaagctga gctctgtgac cgccgtggac
acggccgtgt attactgtgc
gagaaa 29653299DNAhomo sapiens; 53cagctgcagc tgcaggagtc cggctcagga
ctggtgaagc cttcacagac cctgtccctc 60acctgcgctg tctctggtgg ctccatcagc
agtggtggtt actcctggag ctggatccgg 120cagccaccag ggaagggcct
ggagtggatt gggtacatct atcatagtgg gagcacctac 180tacaacccgt
ccctcaagag tcgagtcacc atatcagtag acaggtccaa gaaccagttc
240tccctgaagc tgagctctgt gaccgccgcg gacacggccg tgtattactg tgccagaga
29954299DNAhomo sapiens; 54caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcacagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc
agtggtgatt actactggag ttggatccgc 120cagcccccag ggaagggcct
ggagtggatt gggtacatct attacagtgg gagcacctac 180tacaacccgt
ccctcaagag tcgagttacc atatcagtag acacgtccaa gaaccagttc
240tccctgaagc tgagctctgt gactgccgca gacacggccg tgtattactg tgccagaga
29955299DNAhomo sapiens; 55caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcacagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc
agtggtggtt actactggag ctggatccgc 120cagcacccag ggaagggcct
ggagtggatt gggtacatct attacagtgg gagcacctac 180tacaacccgt
ccctcaagag tctagttacc atatcagtag acacgtctaa gaaccagttc
240tccctgaagc tgagctctgt gactgccgcg gacacggccg tgtattactg tgcgagaga
29956293DNAhomo sapiens; 56caggtgcagc tacagcagtg gggcgcagga
ctgttgaagc cttcggagac cctgtccctc 60acctgcgctg tctatggtgg gtccttcagt
ggttactact ggagctggat ccgccagccc 120ccagggaagg ggctggagtg
gattggggaa atcaatcata gtggaagcac caactacaac 180ccgtccctca
agagtcgagt caccatatca gtagacacgt ccaagaacca gttctccctg
240aagctgagct ctgtgaccgc cgcggacacg gctgtgtatt actgtgcgag agg
29357299DNAhomo sapiens; 57cagctgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc
agtagtagtt actactgggg ctggatccgc 120cagcccccag ggaaggggct
ggagtggatt gggagtatct attatagtgg gagcacctac 180tacaacccgt
ccctcaagag tcgagtcacc atatccgtag acacgtccaa gaaccagttc
240tccctgaagc tgagctctgt gaccgccgca gacacggctg tgtattactg tgcgagaca
29958296DNAhomo sapiens; 58caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcggagac cctgtccctc 60atctgcgctg tctctggtga ctccatcagc
agtggtaact ggtgaatctg ggtccgccag 120cccccaggga aggggctgga
gtggattggg gaaatccatc atagtgggag cacctactac 180aacccgtccc
tcaagagtcg aatcaccatg tccgtagaca cgtccaagaa ccagttctac
240ctgaagctga gctctgtgac cgccgcggac acggccgtgt attactgtgc gagata
29659293DNAhomo sapiens; 59caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagt
agttactact ggagctggat ccggcagccc 120ccagggaagg gactggagtg
gattgggtat atctattaca gtgggagcac caactacaac 180ccctccctca
agagtcgagt caccatatca gtagacacgt ccaagaacca gttctccctg
240aagctgagct ctgtgaccgc tgcggacacg gccgtgtatt actgtgcgag aga
29360299DNAhomo sapiens; 60caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg ctccgtcagc
agtggtagtt actactggag ctggatccgg 120cagcccccag ggaagggact
ggagtggatt gggtatatct attacagtgg gagcaccaac 180tacaacccct
ccctcaagag tcgagtcacc atatcagtag acacgtccaa gaaccagttc
240tccctgaagc tgagctctgt gaccgctgcg gacacggccg tgtattactg tgcgagaga
29961294DNAhomo sapiens; 61caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcggagac cctgtccctc 60acctgcgctg tctctggtta ctccatcagc
agtggttact actggggctg gatccggcag 120cccccaggga aggggctgga
gtggattggg agtatctatc atagtgggag cacctactac 180aacccgtccc
tcaagagtcg agtcaccata tcagtagaca cgtccaagaa ccagttctcc
240ctgaagctga gctctgtgac cgccgcagac acggccgtgt attactgtgc gaga
29462296DNAhomo sapiens; 62gaggtgcagc tggtgcagtc tggagcagag
gtgaaaaagc ccggggagtc tctgaagatc 60tcctgtaagg gttctggata cagctttacc
agctactgga tcggctgggt gcgccagatg 120cccgggaaag gcctggagtg
gatggggatc atctatcctg gtgactctga taccagatac 180agcccgtcct
tccaaggcca ggtcaccatc tcagccgaca agtccatcag caccgcctac
240ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gagaca
29663294DNAhomo sapiens; 63gaagtgcagc tggtgcagtc tggagcagag
gtgaaaaagc ccggggagtc tctgaggatc 60tcctgtaagg gttctggata cagctttacc
agctactgga tcagctgggt gcgccagatg 120cccgggaaag gcctggagtg
gatggggagg attgatccta gtgactctta taccaactac 180agcccgtcct
tccaaggcca cgtcaccatc tcagctgaca agtccatcag cactgcctac
240ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gaga
29464305DNAhomo sapiens; 64caggtacagc tgcagcagtc aggtccagga
ctggtgaagc cctcgcagac cctctcactc 60acctgtgcca tctccgggga cagtgtctct
agcaacagtg ctgcttggaa ctggatcagg 120cagtccccat cgagaggcct
tgagtggctg ggaaggacat actacaggtc caagtggtat 180aatgattatg
cagtatctgt gaaaagtcga ataaccatca acccagacac atccaagaac
240cagttctccc tgcagctgaa ctctgtgact cccgaggaca cggctgtgta
ttactgtgca 300agaga 30565294DNAhomo sapiens; 65caggtgcagc
tggtgcaatc tgggtctgag ttgaagaagc ctggggcctc agtgaaggtt 60tcctgcaagg
cttctggata caccttcact agctatgcta tgaattgggt gcgacaggcc
120cctggacaag ggcttgagtg gatgggatgg atcaacacca acactgggaa
cccaacgtat 180gcccagggct tcacaggacg gtttgtcttc tccttggaca
cctctgtcag cacggcatat 240ctgcagatct gcagcctaaa ggctgaggac
actgccgtgt attactgtgc gaga 29466296DNAhomo sapiens; 66caggtgcagc
tggtgcagtc tggccatgag gtgaagcagc ctggggcctc agtgaaggtc 60tcctgcaagg
cttctggtta cagtttcacc acctatggta tgaattgggt gccacaggcc
120cctggacaag ggcttgagtg gatgggatgg ttcaacacct acactgggaa
cccaacatat 180gcccagggct tcacaggacg gtttgtcttc tccatggaca
cctctgccag cacagcatac 240ctgcagatca gcagcctaaa ggctgaggac
atggccatgt attactgtgc gagata 2966717DNAhomo sapiens; 67ggtacaactg
gaacgac 176817DNAhomo sapiens; 68ggtataactg gaactac 176917DNAhomo
sapiens; 69ggtataaccg gaaccac 177017DNAhomo sapiens; 70ggtataactg
gaacgac 177120DNAhomo sapiens; 71ggtatagtgg gagctactac
207231DNAhomo sapiens; 72aggatattgt agtagtacca gctgctatgc c
317331DNAhomo sapiens; 73aggatattgt actaatggtg tatgctatac c
317431DNAhomo sapiens; 74aggatattgt agtggtggta gctgctactc c
317528DNAhomo sapiens; 75agcatattgt ggtggtgatt gctattcc
287631DNAhomo sapiens; 76gtattacgat ttttggagtg gttattatac c
317731DNAhomo sapiens; 77gtattacgat attttgactg gttattataa c
317831DNAhomo sapiens; 78gtattactat ggttcgggga gttattataa c
317937DNAhomo sapiens; 79gtattatgat tacgtttggg ggagttatgc ttatacc
378031DNAhomo sapiens; 80gtattactat gatagtagtg gttattacta c
318116DNAhomo sapiens; 81tgactacagt aactac 168216DNAhomo sapiens;
82tgactacagt aactac 168316DNAhomo sapiens; 83tgactacggt gactac
168419DNAhomo sapiens; 84tgactacggt ggtaactcc 198520DNAhomo
sapiens; 85gtggatacag ctatggttac 208623DNAhomo sapiens;
86gtggatatag tggctacgat tac 238720DNAhomo sapiens; 87gtggatacag
ctatggttac 208820DNAhomo sapiens; 88gtagagatgg ctacaattac
208918DNAhomo sapiens; 89gagtatagca gctcgtcc 189021DNAhomo sapiens;
90gggtatagca gcagctggta c 219121DNAhomo sapiens; 91gggtatagca
gtggctggta c 219218DNAhomo sapiens; 92gggtatagca gcggctac
189311DNAhomo sapiens; 93ctaactgggg a 119452DNAhomo sapiens;
94gctgaatact tccagcactg gggccagggc accctggtca ccgtctcctc ag
529553DNAhomo sapiens; 95ctactggtac ttcgatctct ggggccgtgg
caccctggtc actgtctcct cag 539650DNAhomo sapiens; 96tgatgctttt
gatgtctggg gccaagggac aatggtcacc gtctcttcag 509748DNAhomo sapiens;
97actactttga ctactggggc caaggaaccc tggtcaccgt ctcctcag
489851DNAhomo sapiens; 98acaactggtt cgactcctgg ggccaaggaa
ccctggtcac cgtctcctca g 519963DNAhomo sapiens; 99attactacta
ctactacggt atggacgtct gggggcaagg gaccacggtc accgtctcct 60cag
63100287DNAhomo sapiens; 100gacatccaga tgacccagtc tccttccacc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggccagtca gagtattagt
agctggttgg cctggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca ccatcagcag cctgcagcct
240gatgattttg caacttatta ctgccaacag tataatagtt attctcc
287101287DNAhomo sapiens; 101gccatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga
aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctatgct gcatccagtt tacaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacaa gattacaatt accctcc
287102287DNAhomo sapiens; 102gccatccgga tgacccagtc tccatcctca
ttctctgcat ctacaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc
agttatttag cctggtatca gcaaaaacca 120gggaaagccc ctaagctcct
gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagat ttcactctca ccatcagctg cctgcagtct
240gaagattttg caacttatta ctgtcaacag tattatagtt accctcc
287103287DNAhomo sapiens; 103gtcatctgga tgacccagtc tccatcctta
ctctctgcat ctacaggaga cagagtcacc 60atcagttgtc ggatgagtca gggcattagc
agttatttag cctggtatca gcaaaaacca 120gggaaagccc ctgagctcct
gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180aggttcagtg
gcagtggatc tgggacagat ttcactctca ccatcagttg cctgcagtct
240gaagattttg caacttatta ctgtcaacag tattatagtt tccctcc
287104287DNAhomo sapiens; 104gacatccagt tgacccagtc tccatccttc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggccagtca gggcattagc
agttatttag cctggtatca gcaaaaacca 120gggaaagccc ctaagctcct
gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtcaacag cttaatagtt accctcc
287105287DNAhomo sapiens; 105gacatccaga tgacccagtc tccatcttcc
gtgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc
agctggttag cctggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct
240gaagattttg caacttacta ttgtcaacag gctaacagtt tccctcc
287106287DNAhomo sapiens; 106gccatccagt tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattagc
agtgctttag cctgatatca gcagaaacca 120gggaaagctc ctaagctcct
gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct
240gaagattttg caacttatta ctgtcaacag tttaataatt accctca
287107287DNAhomo sapiens; 107gacatccaga tgacccagtc tccatcctca
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggcattagc
aattatttag cctggtttca gcagaaacca 120gggaaagccc ctaagtccct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct
240gaagattttg caacttatta ctgccaacag tataatagtt accctcc
287108287DNAhomo sapiens; 108gacatccaga tgacccagtc tccatcctca
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc
agctggttag cctggtatca gcagaaacca 120gagaaagccc ctaagtccct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct
240gaagattttg caacttatta ctgccaacag tataatagtt accctcc
287109287DNAhomo sapiens; 109gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga
aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagcgcct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacag cataatagtt accctcc
287110287DNAhomo sapiens; 110aacatccaga tgacccagtc tccatctgcc
atgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgaggca gggcattagc
aattatttag cctggtttca gcagaaacca 120gggaaagtcc ctaagcacct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacag cataatagtt accctcc
287111287DNAhomo sapiens; 111gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcgagtca gggcattagc
aattatttag cctggtatca gcagaaacca 120gggaaagttc ctaagctcct
gatctatgct gcatccactt tgcaatcagg ggtcccatct 180cggttcagtg
gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct
240gaagatgttg caacttatta ctgtcaaaag tataacagtg cccctcc
287112287DNAhomo sapiens; 112gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc aggcgagtca ggacattagc
aactatttaa attggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctacgat gcatccaatt tggaaacagg ggtcccatca 180aggttcagtg
gaagtggatc tgggacagat tttactttca ccatcagcag cctgcagcct
240gaagatattg caacatatta ctgtcaacag tatgataatc tccctcc
287113287DNAhomo sapiens; 113gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc aggcgagtca ggacattagc
aactatttaa attggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctacgat gcatccaatt tggaaacagg ggtcccatca 180aggttcagtg
gaagtggatc tgggacagat tttactttca ccatcagcag cctgcagcct
240gaagatattg caacatatta ctgtcaacag tatgataatc tccctcc
287114287DNAhomo sapiens; 114gacatccagt tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggtgagtca gggcattagc
agttatttaa attggtatcg gcagaaacca 120gggaaagttc ctaagctcct
gatctatagt gcatccaatt tgcaatctgg agtcccatct 180cggttcagtg
gcagtggatc tgggacagat ttcactctca ctatcagcag cctgcagcct
240gaagatgttg caacttatta cggtcaacgg acttacaatg cccctcc
287115287DNAhomo sapiens; 115gacatccagt tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggtgagtca gggcattagc
agttatttaa attggtatcg gcagaaacca 120gggaaagttc ctaagctcct
gatctatagt gcatccaatt tgcaatctgg agtcccatct 180cggttcagtg
gcagtggatc tgggacagat ttcactctca ctatcagcag cctgcagcct
240gaagatgttg caacttatta cggtcaacgg acttacaatg cccctcc
287116287DNAhomo sapiens; 116gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gagcattagc
agctatttaa attggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagtg
gcagtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct
240gaagattttg caacttacta ctgtcaacag agttacagta cccctcc
287117287DNAhomo sapiens; 117gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gagcattagc
agctatttaa attggtatca gcagaaacca 120gggaaagccc ctaagctcct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagtg
gcagtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct
240gaagattttg caacttacta ctgtcaacag agttacagta cccctcc
287118287DNAhomo sapiens; 118gacatccaga tgatccagtc tccatctttc
ctgtctgcat ctgtaggaga cagagtcagt 60atcatttgct gggcaagtga gggcattagc
agtaatttag cctggtatct gcagaaacca 120gggaaatccc ctaagctctt
cctctatgat gcaaaagatt tgcaccctgg ggtctcatcg 180aggttcagtg
gcaggggatc tgggacggat ttcactctca ccatcatcag cctgaagcct
240gaagattttg cagcttatta ctgtaaacag gacttcagtt accctcc
287119287DNAhomo sapiens; 119gccatccgga tgacccagtc tccattctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgct gggccagtca gggcattagc
agttatttag cctggtatca gcaaaaacca 120gcaaaagccc ctaagctctt
catctattat gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacggat tacactctca ccatcagcag cctgcagcct
240gaagattttg caacttatta ctgtcaacag tattatagta cccctcc
287120302DNAhomo sapiens; 120gatattgtga tgacccagac tccactctcc
tcacctgtca cccttggaca gccggcctcc 60atctcctgca ggtctagtca aagcctcgta
cacagtgatg gaaacaccta cttgagttgg 120cttcagcaga ggccaggcca
gcctccaaga ctcctaattt ataagatttc taaccggttc 180tctggggtcc
cagacagatt cagtggcagt ggggcaggga cagatttcac actgaaaatc
240agcagggtgg aagctgagga tgtcggggtt tattactgca tgcaagctac
acaatttcct 300ca 302121302DNAhomo sapiens; 121gatattgtga tgacccagac
tccactctcc tcgcctgtca cccttggaca gccggcctcc 60atctccttca ggtctagtca
aagcctcgta cacagtgatg gaaacaccta cttgagttgg 120cttcagcaga
ggccaggcca gcctccaaga ctcctaattt ataaggtttc taaccggttc
180tctggggtcc cagacagatt cagtggcagt ggggcaggga cagatttcac
actgaaaatc 240agcagggtgg aagctgagga tgtcggggtt tattactgca
cgcaagctac acaatttcct 300ca 302122302DNAhomo sapiens; 122gatattgtga
tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60atctcctgca
ggtctagtca gagcctcctg catagtaatg gatacaacta tttggattgg
120tacctgcaga agccagggca gtctccacag ctcctgatct atttgggttc
taatcgggcc 180tccggggtcc ctgacaggtt cagtggcagt ggatcaggca
cagattttac actgaaaatc 240agcagagtgg aggctgagga tgttggggtt
tattactgca tgcaagctct acaaactcct 300cc 302123302DNAhomo sapiens;
123gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga
gccggcctcc 60atctcctgca
ggtctagtca gagcctcctg catagtaatg gatacaacta tttggattgg
120tacctgcaga agccagggca gtctccacag ctcctgatct atttgggttc
taatcgggcc 180tccggggtcc ctgacaggtt cagtggcagt ggatcaggca
cagattttac actgaaaatc 240agcagagtgg aggctgagga tgttggggtt
tattactgca tgcaagctct acaaactcct 300cc 302124302DNAhomo sapiens;
124gatattgtga tgacccagac tccactctct ctgtccgtca cccctggaca
gccggcctcc 60atctcctgca agtctagtca gagcctcctg catagtgatg gaaagaccta
tttgtattgg 120tacctgcaga agccaggcca gtctccacag ctcctgatct
atgaagtttc cagccggttc 180tctggagtgc cagataggtt cagtggcagc
gggtcaggga cagatttcac actgaaaatc 240agccgggtgg aggctgagga
tgttggggtt tattactgaa tgcaaggtat acaccttcct 300cc 302125302DNAhomo
sapiens; 125gatattgtga tgacccagac tccactctct ctgtccgtca cccctggaca
gccggcctcc 60atctcctgca agtctagtca gagcctcctg catagtgatg gaaagaccta
tttgtattgg 120tacctgcaga agccaggcca gcctccacag ctcctgatct
atgaagtttc caaccggttc 180tctggagtgc cagataggtt cagtggcagc
gggtcaggga cagatttcac actgaaaatc 240agccgggtgg aggctgagga
tgttggggtt tattactgca tgcaaagtat acagcttcct 300cc 302126302DNAhomo
sapiens; 126gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccttggaca
gccggcctcc 60atctcctgca ggtctagtca aagcctcgta tacagtgatg gaaacaccta
cttgaattgg 120tttcagcaga ggccaggcca atctccaagg cgcctaattt
ataaggtttc taaccgggac 180tctggggtcc cagacagatt cagcggcagt
gggtcaggca ctgatttcac actgaaaatc 240agcagggtgg aggctgagga
tgttggggtt tattactgca tgcaaggtac acactggcct 300cc 302127302DNAhomo
sapiens; 127gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccttggaca
gccggcctcc 60atctcctgca ggtctagtca aagcctcgta tacagtgatg gaaacaccta
cttgaattgg 120tttcagcaga ggccaggcca atctccaagg cgcctaattt
ataaggtttc taactgggac 180tctggggtcc cagacagatt cagcggcagt
gggtcaggca ctgatttcac actgaaaatc 240agcagggtgg aggctgagga
tgttggggtt tattactgca tgcaaggtac acactggcct 300cc 302128305DNAhomo
sapiens; 128gatattgtga tgacccagac tccactctcc ctgcccgtca cccctggaga
gccggcctcc 60atctcctgca ggtctagtca gagcctcttg gatagtgatg atggaaacac
ctatttggac 120tggtacctgc agaagccagg gcagtctcca cagctcctga
tctatacgct ttcctatcgg 180gcctctggag tcccagacag gttcagtggc
agtgggtcag gcactgattt cacactgaaa 240atcagcaggg tggaggctga
ggatgttgga gtttattact gcatgcaacg tatagagttt 300ccttc
305129305DNAhomo sapiens; 129gatattgtga tgacccagac tccactctcc
ctgcccgtca cccctggaga gccggcctcc 60atctcctgca ggtctagtca gagcctcttg
gatagtgatg atggaaacac ctatttggac 120tggtacctgc agaagccagg
gcagtctcca cagctcctga tctatacgct ttcctatcgg 180gcctctggag
tcccagacag gttcagtggc agtgggtcag gcactgattt cacactgaaa
240atcagcaggg tggaggctga ggatgttgga gtttattact gcatgcaacg
tatagagttt 300ccttc 305130290DNAhomo sapiens; 130gaaattgtaa
tgacacagtc tccacccacc ctgtctttgt ctccagggga aagagtcacc 60ctctcctgca
gggccagtca gagtgttagc agcagctact taacctggta tcagcagaaa
120cctggccagg cgcccaggct cctcatctat ggtgcatcca ccagggccac
tagcatccca 180gccaggttca gtggcagtgg gtctgggaca gacttcactc
tcaccatcag cagcctgcag 240cctgaagatt ttgcagttta ttactgtcag
caggatcata acttacctcc 290131290DNAhomo sapiens; 131gaaattgtaa
tgacacagtc tccacccacc ctgtctttgt ctccagggga aagagtcacc 60ctctcctgca
gggccagtca gagtgttagc agcagctact taacctggta tcagcagaaa
120cctggccagg cgcccaggct cctcatctat ggtgcatcca ccagggccac
tagcatccca 180gccaggttca gtggcagtgg gtctgggaga gacttcactc
tcaccatcag cagcctgcag 240cctgaagatt ttgcagttta ttactgtcag
caggatcata acttacctcc 290132290DNAhomo sapiens; 132gaaattgtaa
tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagc agcagctact tatcctggta ccagcagaaa
120cctgggcagg ctcccaggct cctcatctat ggtgcatcca ccagggccac
tggcatccca 180gccaggttca gtggcagtgg gtctgggaca gacttcactc
tcaccatcag cagcctgcag 240cctgaagatt ttgcagttta ttactgtcag
caggattata acttacctcc 290133287DNAhomo sapiens; 133gaaattgtgt
tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct
120ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg
catcccagcc 180aggttcagtg gcagtgggtc tgggacagac ttcactctca
ccatcagcag cctagagcct 240gaagattttg cagtttatta ctgtcagcag
cgtagcaact ggcctcc 287134287DNAhomo sapiens; 134gaaattgtgt
tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gggtgttagc agctacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg
catcccagcc 180aggttcagtg gcagtgggcc tgggacagac ttcactctca
ccatcagcag cctagagcct 240gaagattttg cagtttatta ctgtcagcag
cgtagcaact ggcatcc 287135287DNAhomo sapiens; 135gaaatagtga
tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagc agcaacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
tatcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg cagtttatta ctgtcagcag
tataataact ggcctcc 287136287DNAhomo sapiens; 136gaaatagtga
tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagc agcaacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
catcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg cagtttatta ctgtcagcag
tataataact ggcctcc 287137290DNAhomo sapiens; 137gaaattgtgt
tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa
120cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac
tggcatccca 180gacaggttca gtggcagtgg gtctgggaca gacttcactc
tcaccatcag cagactggag 240cctgaagatt ttgcagtgta ttactgtcag
cagtatggta gctcacctcc 290138290DNAhomo sapiens; 138gaaattgtgt
tgacgcagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60ctctcctgcg
gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa
120cctggcctgg cgcccaggct cctcatctat gatgcatcca gcagggccac
tggcatccca 180gacaggttca gtggcagtgg gtctgggaca gacttcactc
tcaccatcag cagactggag 240cctgaagatt ttgcagtgta ttactgtcag
cagtatggta gctcacctcc 290139305DNAhomo sapiens; 139gacatcgtga
tgacccagtc tccagactcc ctggctgtgt ctctgggcga gagggccacc 60atcaactgca
agtccagcca gagtgtttta tacagctcca acaataagaa ctacttagct
120tggtaccagc agaaaccagg acagcctcct aagctgctca tttactgggc
atctacccgg 180gaatccgggg tccctgaccg attcagtggc agcgggtctg
ggacagattt cactctcacc 240atcagcagcc tgcaggctga agatgtggca
gtttattact gtcagcaata ttatagtact 300cctcc 305140287DNAhomo sapiens;
140gaaacgacac tcacgcagtc tccagcattc atgtcagcga ctccaggaga
caaagtcaac 60atctcctgca aagccagcca agacattgat gatgatatga actggtacca
acagaaacca 120ggagaagctg ctattttcat tattcaagaa gctactactc
tcgttcctgg aatcccacct 180cgattcagtg gcagcgggta tggaacagat
tttaccctca caattaataa catagaatct 240gaggatgctg catattactt
ctgtctacaa catgataatt tccctct 287141287DNAhomo sapiens;
141gaaattgtgc tgactcagtc tccagacttt cagtctgtga ctccaaagga
gaaagtcacc 60atcacctgcc gggccagtca gagcattggt agtagcttac actggtacca
gcagaaacca 120gatcagtctc caaagctcct catcaagtat gcttcccagt
ccttctcagg ggtcccctcg 180aggttcagtg gcagtggatc tgggacagat
ttcaccctca ccatcaatag cctggaagct 240gaagatgctg caacgtatta
ctgtcatcag agtagtagtt tacctca 287142287DNAhomo sapiens;
142gaaattgtgc tgactcagtc tccagacttt cagtctgtga ctccaaagga
gaaagtcacc 60atcacctgcc gggccagtca gagcattggt agtagcttac actggtacca
gcagaaacca 120gatcagtctc caaagctcct catcaagtat gcttcccagt
ccttctcagg ggtcccctcg 180aggttcagtg gcagtggatc tgggacagat
ttcaccctca ccatcaatag cctggaagct 240gaagatgctg caacgtatta
ctgtcatcag agtagtagtt tacctca 287143287DNAhomo sapiens;
143gatgttgtga tgacacagtc tccagctttc ctctctgtga ctccagggga
gaaagtcacc 60atcacctgcc aggccagtga aggcattggc aactacttat actggtacca
gcagaaacca 120gatcaagccc caaagctcct catcaagtat gcttcccagt
ccatctcagg ggtcccctcg 180aggttcagtg gcagtggatc tgggacagat
ttcaccttta ccatcagtag cctggaagct 240gaagatgctg caacatatta
ctgtcagcag ggcaataagc accctca 287144296DNAhomo sapiens;
144cagtctgtgc tgactcagcc accctcggtg tctgaagccc ccaggcagag
ggtcaccatc 60tcctgttctg gaagcagctc caacatcgga aataatgctg taaactggta
ccagcagctc 120ccaggaaagg ctcccaaact cctcatctat tatgatgatc
tgctgccctc aggggtctct 180gaccgattct ctggctccaa gtctggcacc
tcagcctccc tggccatcag tgggctccag 240tctgaggatg aggctgatta
ttactgtgca gcatgggatg acagcctgaa tggtcc 296145299DNAhomo sapiens;
145cagtctgtgc tgacgcagcc gccctcagtg tctggggccc cagggcagag
ggtcaccatc 60tcctgcactg ggagcagctc caacatcggg gcaggttatg atgtacactg
gtaccagcag 120cttccaggaa cagcccccaa actcctcatc tatggtaaca
gcaatcggcc ctcaggggtc 180cctgaccgat tctctggctc caagtctggc
acctcagcct ccctggccat cactgggctc 240caggctgagg atgaggctga
ttattactgc cagtcctatg acagcagcct gagtggttc 299146296DNAhomo
sapiens; 146cagtctgtgt tgacgcagcc gccttcagtg tctgcggccc caggacagaa
ggtcaccatc 60tcctgctctg gaagcagctc cgacatgggg aattatgcgg tatcctggta
ccagcagctc 120ccaggaacag cccccaaact cctcatctat gaaaataata
agcgaccctc agggattcct 180gaccgattct ctggctccaa gtctggcacc
tcagccaccc tgggcatcac tggcctctgg 240cctgaggacg aggccgatta
ttactgctta gcatgggata ccagcccgag agcttg 296147296DNAhomo sapiens;
147cagtctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag
ggtcaccatc 60tcttgttctg gaagcagctc caacatcgga agtaatactg taaactggta
ccagcagctc 120ccaggaacgg cccccaaact cctcatctat agtaataatc
agcggccctc aggggtccct 180gaccgattct ctggctccaa gtctggcacc
tcagcctccc tggccatcag tgggctccag 240tctgaggatg aggctgatta
ttactgtgca gcatgggatg acagcctgaa tggtcc 296148296DNAhomo sapiens;
148cagtctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag
ggtcaccatc 60tcttgttctg gaagcagctc caacatcgga agtaattatg tatactggta
ccagcagctc 120ccaggaacgg cccccaaact cctcatctat aggaataatc
agcggccctc aggggtccct 180gaccgattct ctggctccaa gtctggcacc
tcagcctccc tggccatcag tgggctccgg 240tccgaggatg aggctgatta
ttactgtgca gcatgggatg acagcctgag tggtcc 296149299DNAhomo sapiens;
149cagtctgtgc tgacgcagcc gccctcagtg tctggggccc cagggcagag
ggtcaccatc 60tcctgcactg ggagcagctc caacattggg gcgggttatg ttgtacattg
gtaccagcag 120cttccaggaa cagcccccaa actcctcatc tatggtaaca
gcaatcggcc ctcaggggtc 180cctgaccaat tctctggctc caagtctggc
acctcagcct ccctggccat cactggactc 240cagtctgagg atgaggctga
ttattactgc aaagcatggg ataacagcct gaatgctca 299150296DNAhomo
sapiens; 150cagtctgtgt tgacgcagcc gccctcagtg tctgcggccc caggacagaa
ggtcaccatc 60tcctgctctg gaagcagctc caacattggg aataattatg tatcctggta
ccagcagctc 120ccaggaacag cccccaaact cctcatttat gacaataata
agcgaccctc agggattcct 180gaccgattct ctggctccaa gtctggcacg
tcagccaccc tgggcatcac cggactccag 240actggggacg aggccgatta
ttactgcgga acatgggata gcagcctgag tgctgg 296151297DNAhomo sapiens;
151cagtctgccc tgactcagcc tccctccgcg tccgggtctc ctggacagtc
agtcaccatc 60tcctgcactg gaaccagcag tgacgttggt ggttataact atgtctcctg
gtaccaacag 120cacccaggca aagcccccaa actcatgatt tatgaggtca
gtaagcggcc ctcaggggtc 180cctgatcgct tctctggctc caagtctggc
aacacggcct ccctgaccgt ctctgggctc 240caggctgagg atgaggctga
ttattactgc agctcatatg caggcagcaa caatttc 297152297DNAhomo sapiens;
152cagtctgccc tgactcagcc tcgctcagtg tccgggtctc ctggacagtc
agtcaccatc 60tcctgcactg gaaccagcag tgatgttggt ggttataact atgtctcctg
gtaccaacag 120cacccaggca aagcccccaa actcatgatt tatgatgtca
gtaagcggcc ctcaggggtc 180cctgatcgct tctctggctc caagtctggc
aacacggcct ccctgaccat ctctgggctc 240caggctgagg atgaggctga
ttattactgc tgctcatatg caggcagcta cactttc 297153297DNAhomo sapiens;
153cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc
gatcaccatc 60tcctgcactg gaaccagcag tgacgttggt ggttataact atgtctcctg
gtaccaacag 120cacccaggca aagcccccaa actcatgatt tatgaggtca
gtaatcggcc ctcaggggtt 180tctaatcgct tctctggctc caagtctggc
aacacggcct ccctgaccat ctctgggctc 240caggctgagg acgaggctga
ttattactgc agctcatata caagcagcag cactctc 297154297DNAhomo sapiens;
154cagtctgccc tgactcagcc tccctccgtg tccgggtctc ctggacagtc
agtcaccatc 60tcctgcactg gaaccagcag tgacgttggt agttataacc gtgtctcctg
gtaccagcag 120cccccaggca cagcccccaa actcatgatt tatgaggtca
gtaatcggcc ctcaggggtc 180cctgatcgct tctctgggtc caagtctggc
aacacggcct ccctgaccat ctctgggctc 240caggctgagg acgaggctga
ttattactgc agcttatata caagcagcag cactttc 297155298DNAhomo sapiens;
155cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc
gatcaccatc 60tcctgcactg gaaccagcag tgatgttggg agttataacc ttgtctcctg
gtaccaacag 120cacccaggca aagcccccaa actcatgatt tatgagggca
gtaagcggcc ctcaggggtt 180tctaatcgct tctctggctc caagtctggc
aacacggcct ccctgacaat ctctgggctc 240caggctgagg acgaggctga
ttattactgc tgctcatatg caggtagtag cactttac 298156297DNAhomo sapiens;
156caatctgccc tgactcagcc tccttttgtg tccggggctc ctggacagtc
ggtcaccatc 60tcctgcactg gaaccagcag tgacgttggg gattatgatc atgtcttctg
gtaccaaaag 120cgtctcagca ctacctccag actcctgatt tacaatgtca
atactcggcc ttcagggatc 180tctgacctct tctcaggctc caagtctggc
aacatggctt ccctgaccat ctctgggctc 240aagtccgagg ttgaggctaa
ttatcactgc agcttatatt caagtagtta cactttc 297157285DNAhomo sapiens;
157tcctatgagc tgactcagcc accctcagtg tccgtgtccc caggacagac
agccagcatc 60acctgctctg gagataaatt gggggataaa tatgcttgct ggtatcagca
gaagccaggc 120cagtcccctg tgctggtcat ctatcaagat agcaagcggc
cctcagggat ccctgagcga 180ttctctggct ccaactctgg gaacacagcc
actctgacca tcagcgggac ccaggctatg 240gatgaggctg actattactg
tcaggcgtgg gacagcagca ctgca 285158290DNAhomo sapiens; 158tcctatgagc
tgacacagcc accctcggtg tcagtgtccc caggacaaac ggccaggatc 60acctgctctg
gagatgcatt gccaaaaaaa tatgcttatt ggtaccagca gaagtcaggc
120caggcccctg tgctggtcat ctatgaggac agcaaacgac cctccgggat
ccctgagaga 180ttctctggct ccagctcagg gacaatggcc accttgacta
tcagtggggc ccaggtggag 240gatgaagctg actactactg ttactcaaca
gacagcagtg gtaatcatag 290159290DNAhomo sapiens; 159tcctatgagc
tgactcagcc acactcagtg tcagtggcca cagcacagat ggccaggatc 60acctgtgggg
gaaacaacat tggaagtaaa gctgtgcact ggtaccagca aaagccaggc
120caggaccctg tgctggtcat ctatagcgat agcaaccggc cctcagggat
ccctgagcga 180ttctctggct ccaacccagg gaacaccacc accctaacca
tcagcaggat cgaggctggg 240gatgaggctg actattactg tcaggtgtgg
gacagtagta gtgatcatcc 290160290DNAhomo sapiens; 160tcctatgagc
tgacacagcc accctcggtg tcagtgtccc taggacagat ggccaggatc 60acctgctctg
gagaagcatt gccaaaaaaa tatgcttatt ggtaccagca gaagccaggc
120cagttccctg tgctggtgat atataaagac agcgagaggc cctcagggat
ccctgagcga 180ttctctggct ccagctcagg gacaatagtc acattgacca
tcagtggagt ccaggcagaa 240gacgaggctg actattactg tctatcagca
gacagcagtg gtacttatcc 290161290DNAhomo sapiens; 161tcttctgagc
tgactcagga ccctgctgtg tctgtggcct tgggacagac agtcaggatc 60acatgccaag
gagacagcct cagaagctat tatgcaagct ggtaccagca gaagccagga
120caggcccctg tacttgtcat ctatggtaaa aacaaccggc cctcagggat
cccagaccga 180ttctctggct ccagctcagg aaacacagct tccttgacca
tcactggggc tcaggcggaa 240gatgaggctg actattactg taactcccgg
gacagcagtg gtaaccatct 290162290DNAhomo sapiens; 162tcctatgtgc
tgactcagcc accctcagtg tcagtggccc caggaaagac ggccaggatt 60acctgtgggg
gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc
120caggcccctg tgctggtcat ctattatgat agcgaccggc cctcagggat
ccctgagcga 180ttctctggct ccaactctgg gaacacggcc accctgacca
tcagcagggt cgaagccggg 240gatgaggccg actattactg tcaggtgtgg
gacagtagta gtgatcatcc 290163284DNAhomo sapiens; 163tcctatgagc
tgacacagct accctcggtg tcagtgtccc caggacagac agccaggatc 60acctgctctg
gagatgtact gggggaaaat tatgctgact ggtaccagca gaagccaggc
120caggcccctg agttggtgat atacgaagat agtgagcggt accctggaat
ccctgaacga 180ttctctgggt ccacctcagg gaacacgacc accctgacca
tcagcagggt cctgaccgaa 240gacgaggctg actattactg tttgtctggg
gatgaggaca atcc 284164290DNAhomo sapiens; 164tcctatgagc tgatgcagcc
accctcggtg tcagtgtccc caggacagac ggccaggatc 60acctgctctg gagatgcatt
gccaaagcaa tatgcttatt ggtaccagca gaagccaggc 120caggcccctg
tgctggtgat atataaagac agtgagaggc cctcagggat ccctgagcga
180ttctctggct ccagctcagg gacaacagtc acgttgacca tcagtggagt
ccaggcagaa 240gatgaggctg actattactg tcaatcagca gacagcagtg
gtacttatcc 290165284DNAhomo sapiens; 165tcctatgagc tgacacagcc
atcctcagtg tcagtgtctc cgggacagac agccaggatc 60acctgctcag gagatgtact
ggcaaaaaaa tatgctcggt ggttccagca gaagccaggc 120caggcccctg
tgctggtgat ttataaagac agtgagcggc cctcagggat ccctgagcga
180ttctccggct ccagctcagg gaccacagtc accttgacca tcagcggggc
ccaggttgag 240gatgaggctg actattactg ttactctgcg gctgacaaca atct
284166284DNAhomo sapiens; 166tcctctgggc caactcaggt gcctgcagtg
tctgtggcct tgggacaaat ggccaggatc 60acctgccagg gagacagcat ggaaggctct
tatgaacact ggtaccagca gaagccaggc 120caggcccccg tgctggtcat
ctatgatagc agtgaccggc cctcaaggat ccctgagcga 180ttctctggct
ccaaatcagg caacacaacc accctgacca tcactggggc ccaggctgag
240gatgaggctg attattacta tcagttgata gacaaccatg ctac
284167314DNAhomo sapiens; 167ctgcctgtgc tgactcagcc cccgtctgca
tctgccttgc tgggagcctc gatcaagctc 60acctgcaccc taagcagtga gcacagcacc
tacaccatcg aatggtatca acagagacca 120gggaggtccc cccagtatat
aatgaaggtt aagagtgatg gcagccacag caagggggac 180gggatccccg
atcgcttcat gggctccagt tctggggctg accgctacct caccttctcc
240aacctccagt
ctgacgatga ggctgagtat cactgtggag agagccacac gattgatggc
300caagtcggtt gagc 314168297DNAhomo sapiens; 168cagcctgtgc
tgactcaatc atcctctgcc tctgcttccc tgggatcctc ggtcaagctc 60acctgcactc
tgagcagtgg gcacagtagc tacatcatcg catggcatca gcagcagcca
120gggaaggccc ctcggtactt gatgaagctt gaaggtagtg gaagctacaa
caaggggagc 180ggagttcctg atcgcttctc aggctccagc tctggggctg
accgctacct caccatctcc 240aacctccagt tagaggatga ggctgattat
tactgtgaga cctgggacag taacact 297169299DNAhomo sapiens;
169cagcttgtgc tgactcaatc gccctctgcc tctgcctccc tgggagcctc
ggtcaagctc 60acctgcactc tgagcagtgg gcacagcagc tacgccatcg catggcatca
gcagcagcca 120gagaagggcc ctcggtactt gatgaagctt aacagtgatg
gcagccacag caagggggac 180gggatccctg atcgcttctc aggctccagc
tctggggctg agcgctacct caccatctcc 240agcctccagt ctgaggatga
ggctgactat tactgtcaga cctggggcac tggcattca 299170312DNAhomo
sapiens; 170cagcctgtgc tgactcagcc accttcctcc tccgcatctc ctggagaatc
cgccagactc 60acctgcacct tgcccagtga catcaatgtt ggtagctaca acatatactg
gtaccagcag 120aagccaggga gccctcccag gtatctcctg tactactact
cagactcaga taagggccag 180ggctctggag tccccagccg cttctctgga
tccaaagatg cttcagccaa tacagggatt 240ttactcatct ccgggctcca
gtctgaggat gaggctgact attactgtat gatttggcca 300agcaatgctt ct
312171312DNAhomo sapiens; 171caggctgtgc tgactcagcc ggcttccctc
tctgcatctc ctggagcatc agccagtctc 60acctgcacct tgcgcagtgg catcaatgtt
ggtacctaca ggatatactg gtaccagcag 120aagccaggga gtcctcccca
gtatctcctg aggtacaaat cagactcaga taagcagcag 180ggctctggag
tccccagccg cttctctgga tccaaagatg cttcggccaa tgcagggatt
240ttactcatct ctgggctcca gtctgaggat gaggctgact attactgtat
gatttggcac 300agcagcgctt ct 312172312DNAhomo sapiens; 172cagcctgtgc
tgactcagcc aacttccctc tcagcatctc ctggagcatc agccagactc 60acctgcacct
tgcgcagtgg catcaatctt ggtagctaca ggatattctg gtaccagcag
120aagccagaga gccctccccg gtatctcctg agctactact cagactcaag
taagcatcag 180ggctctggag tccccagccg cttctctgga tccaaagatg
cttcgagcaa tgcagggatt 240ttagtcatct ctgggctcca gtctgaggat
gaggctgact attactgtat gatttggcac 300agcagtgctt ct 312173317DNAhomo
sapiens; 173cagcctgtgc tgactcagcc atcttcccat tctgcatctt ctggagcatc
agtcagactc 60acctgcatgc tgagcagtgg cttcagtgtt ggggacttct ggataaggtg
gtaccaacaa 120aagccaggga accctccccg gtatctcctg tactaccact
cagactccaa taagggccaa 180ggctctggag ttcccagccg cttctctgga
tccaacgatg catcagccaa tgcagggatt 240ctgcgtatct ctgggctcca
gcctgaggat gaggctgact attactgtgg tacatggcac 300agcaactcta agactca
317174296DNAhomo sapiens; 174aattttatgc tgactcagcc ccactctgtg
tcggagtctc cggggaagac ggtaaccatc 60tcctgcaccc gcagcagtgg cagcattgcc
agcaactatg tgcagtggta ccagcagcgc 120ccgggcagtt cccccaccac
tgtgatctat gaggataacc aaagaccctc tggggtccct 180gatcggttct
ctggctccat cgacagctcc tccaactctg cctccctcac catctctgga
240ctgaagactg aggacgaggc tgactactac tgtcagtctt atgatagcag caatca
296175294DNAhomo sapiens; 175cagactgtgg tgactcagga gccctcactg
actgtgtccc caggagggac agtcactctc 60acctgtgctt ccagcactgg agcagtcacc
agtggttact atccaaactg gttccagcag 120aaacctggac aagcacccag
ggcactgatt tatagtacaa gcaacaaaca ctcctggacc 180cctgcccggt
tctcaggctc cctccttggg ggcaaagctg ccctgacact gtcaggtgtg
240cagcctgagg acgaggctga gtattactgc ctgctctact atggtggtgc tcag
294176294DNAhomo sapiens; 176caggctgtgg tgactcagga gccctcactg
actgtgtccc caggagggac agtcactctc 60acctgtggct ccagcactgg agctgtcacc
agtggtcatt atccctactg gttccagcag 120aagcctggcc aagcccccag
gacactgatt tatgatacaa gcaacaaaca ctcctggaca 180cctgcccggt
tctcaggctc cctccttggg ggcaaagctg ccctgaccct ttcgggtgcg
240cagcctgagg atgaggctga gtattactgc ttgctctcct atagtggtgc tcgg
294177296DNAhomo sapiens; 177cagactgtgg tgacccagga gccatcgttc
tcagtgtccc ctggagggac agtcacactc 60acttgtggct tgagctctgg ctcagtctct
actagttact accccagctg gtaccagcag 120accccaggcc aggctccacg
cacgctcatc tacagcacaa acactcgctc ttctggggtc 180cctgatcgct
tctctggctc catccttggg aacaaagctg ccctcaccat cacgggggcc
240caggcagatg atgaatctga ttattactgt gtgctgtata tgggtagtgg catttc
296178317DNAhomo sapiens; 178cagcctgtgc tgactcagcc accttctgca
tcagcctccc tgggagcctc ggtcacactc 60acctgcaccc tgagcagcgg ctacagtaat
tataaagtgg actggtacca gcagagacca 120gggaagggcc cccggtttgt
gatgcgagtg ggcactggtg ggattgtggg atccaagggg 180gatggcatcc
ctgatcgctt ctcagtcttg ggctcaggcc tgaatcggta cctgaccatc
240aagaacatcc aggaagagga tgagagtgac taccactgtg gggcagacca
tggcagtggg 300agcaacttcg tgtaacc 317179296DNAhomo sapiens;
179caggcagggc tgactcagcc accctcggtg tccaagggct tgagacagac
cgccacactc 60acctgcactg ggaacagcaa caatgttggc aaccaaggag cagcttggct
gcagcagcac 120cagggccacc ctcccaaact cctatcctac aggaataaca
accggccctc agggatctca 180gagagattat ctgcatccag gtcaggaaac
acagcctccc tgaccattac tggactccag 240cctgaggacg aggctgacta
ttactgctca gcatgggaca gcagcctcag tgctca 296180312DNAhomo sapiens;
180cggcccgtgc tgactcagcc gccctctctg tctgcatccc cgggagcaac
agccagactc 60ccctgcaccc tgagcagtga cctcagtgtt ggtggtaaaa acatgttctg
gtaccagcag 120aagccaggga gctctcccag gttattcctg tatcactact
cagactcaga caagcagctg 180ggacctgggg tccccagtcg agtctctggc
tccaaggaga cctcaagtaa cacagcgttt 240ttgctcatct ctgggctcca
gcctgaggac gaggccgatt attactgcca ggtgtacgaa 300agtagtgcta at
31218138DNAhomo sapiens; 181gtggacgttc ggccaaggga ccaaggtgga
aatcaaac 3818239DNAhomo sapiens; 182tgtacacttt tggccagggg
accaagctgg agatcaaac 3918338DNAhomo sapiens; 183attcactttc
ggccctggga ccaaagtgga tatcaaac 3818438DNAhomo sapiens;
184gctcactttc ggcggaggga ccaaggtgga gatcaaac 3818538DNAhomo
sapiens; 185gatcaccttc ggccaaggga cacgactgga gattaaac
3818638DNAhomo sapiens; 186ttatgtcttc ggaactggga ccaaggtcac
cgtcctag 3818738DNAhomo sapiens; 187tgtggtattc ggcggaggga
ccaagctgac cgtcctag 3818838DNAhomo sapiens; 188tgtggtattc
ggcggaggga ccaagctgac cgtcctag 3818938DNAhomo sapiens;
189ttttgtattt ggtggaggaa cccagctgat cattttag 3819038DNAhomo
sapiens; 190ctgggtgttt ggtgagggga ccgagctgac cgtcctag
3819138DNAhomo sapiens; 191taatgtgttc ggcagtggca ccaaggtgac
cgtcctcg 3819238DNAhomo sapiens; 192tgctgtgttc ggaggaggca
cccagctgac cgtcctcg 38193302DNAhomo sapiens; 193gagattgtga
tgacccagac tccactctcc ttgtctatca cccctggaga gcaggcctcc 60atctcctgca
ggtctagtca gagcctcctg catagtgatg gatacaccta tttgtattgg
120tttctgcaga aagccaggcc agtctccaca ctcctgatct atgaagtttc
caaccggttc 180tctggagtgc cagataggtt cagtggcagc gggtcaggga
cagatttcac actgaaaatc 240agccgggtgg aggctgagga ttttggagtt
tattactgca tgcaagatgc acaagatcct 300cc 302194296DNAhomo sapiens;
194cagtctgtgc tgactcagcc accctcggtg tctgaagccc ccaggcagag
ggtcaccatc 60tcctgttctg gaagcagctc caacatcgga aataatgctg taaactggta
ccagcagctc 120ccaggaaagg ctcccaaact cctcatctat tatgatgatc
tgctgccctc aggggtctct 180gaccgattct ctggctccaa gtctggcacc
tcagcctccc tggccatcag tgggctccag 240tctgaggatg aggctgatta
ttactgtgca gcatgggatg acagcctgaa tggtcc 296195296DNAhomo sapiens;
195cagtctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag
ggtcaccatc 60tcttgttctg gaagcagctc caacatcgga agtaattatg tatactggta
ccagcagctc 120ccaggaacgg cccccaaact cctcatctat aggaataatc
agcggccctc aggggtccct 180gaccgattct ctggctccaa gtctggcacc
tcagcctccc tggccatcag tgggctccgg 240tccgaggatg aggctgatta
ttactgtgca gcatgggatg acagcctgag tggtcc 296196299DNAhomo sapiens;
196cagtctgtgc tgacgcagcc gccctcagtg tctggggccc cagggcagag
ggtcaccatc 60tcctgcactg ggagcagctc caacattggg gcgggttatg ttgtacattg
gtaccagcag 120cttccaggaa cagcccccaa actcctcatc tatggtaaca
gcaatcggcc ctcaggggtc 180cctgaccaat tctctggctc caagtctggc
acctcagcct ccctggccat cactggactc 240cagtctgagg atgaggctga
ttattactgc aaagcatggg ataacagcct gaatgctca 299197296DNAhomo
sapiens; 197cagtctgtgt tgacgcagcc gccctcagtg tctgcggccc caggacagaa
ggtcaccatc 60tcctgctctg gaagcagctc caacattggg aataattatg tatcctggta
ccagcagctc 120ccaggaacag cccccaaact cctcatttat gacaataata
agcgaccctc agggattcct 180gaccgattct ctggctccaa gtctggcacg
tcagccaccc tgggcatcac cggactccag 240actggggacg aggccgatta
ttactgcgga acatgggata gcagcctgag tgctgg 296198296DNAhomo sapiens;
198caggcagggc tgactcagcc accctcggtg tccaagggct tgagacagac
cgccacactc 60acctgcactg ggaacagcaa caatgttggc aaccaaggag cagcttggct
gcagcagcac 120cagggccacc ctcccaaact cctatcctac aggaataaca
accggccctc agggatctca 180gagagattat ctgcatccag gtcaggaaac
acagcctccc tgaccattac tggactccag 240cctgaggacg aggctgacta
ttactgctca gcatgggaca gcagcctcag tgctca 296199312DNAhomo sapiens;
199cggcccgtgc tgactcagcc gccctctctg tctgcatccc cgggagcaac
agccagactc 60ccctgcaccc tgagcagtga cctcagtgtt ggtggtaaaa acatgttctg
gtaccagcag 120aagccaggga gctctcccag gttattcctg tatcactact
cagactcaga caagcagctg 180ggacctgggg tccccagtcg agtctctggc
tccaaggaga cctcaagtaa cacagcgttt 240ttgctcatct ctgggctcca
gcctgaggac gaggccgatt attactgcca ggtgtacgaa 300agtagtgcta at
312200297DNAhomo sapiens; 200cagtctgccc tgactcagcc tgcctccgtg
tctgggtctc ctggacagtc gatcaccatc 60tcctgcactg gaaccagcag tgacgttggt
ggttataact atgtctcctg gtaccaacag 120cacccaggca aagcccccaa
actcatgatt tatgaggtca gtaatcggcc ctcaggggtt 180tctaatcgct
tctctggctc caagtctggc aacacggcct ccctgaccat ctctgggctc
240caggctgagg acgaggctga ttattactgc agctcatata caagcagcag cactctc
297201297DNAhomo sapiens; 201cagtctgccc tgactcagcc tccctccgtg
tccgggtctc ctggacagtc agtcaccatc 60tcctgcactg gaaccagcag tgacgttggt
agttataacc gtgtctcctg gtaccagcag 120cccccaggca cagcccccaa
actcatgatt tatgaggtca gtaatcggcc ctcaggggtc 180cctgatcgct
tctctgggtc caagtctggc aacacggcct ccctgaccat ctctgggctc
240caggctgagg acgaggctga ttattactgc agcttatata caagcagcag cactttc
297202298DNAhomo sapiens; 202cagtctgccc tgactcagcc tgcctccgtg
tctgggtctc ctggacagtc gatcaccatc 60tcctgcactg gaaccagcag tgatgttggg
agttataacc ttgtctcctg gtaccaacag 120cacccaggca aagcccccaa
actcatgatt tatgagggca gtaagcggcc ctcaggggtt 180tctaatcgct
tctctggctc caagtctggc aacacggcct ccctgacaat ctctgggctc
240caggctgagg acgaggctga ttattactgc tgctcatatg caggtagtag cactttac
298203297DNAhomo sapiens; 203cagtctgccc tgactcagcc tccctccgcg
tccgggtctc ctggacagtc agtcaccatc 60tcctgcactg gaaccagcag tgacgttggt
ggttataact atgtctcctg gtaccaacag 120cacccaggca aagcccccaa
actcatgatt tatgaggtca gtaagcggcc ctcaggggtc 180cctgatcgct
tctctggctc caagtctggc aacacggcct ccctgaccgt ctctgggctc
240caggctgagg atgaggctga ttattactgc agctcatatg caggcagcaa caatttc
297204285DNAhomo sapiens; 204tcctatgagc tgactcagcc accctcagtg
tccgtgtccc caggacagac agccagcatc 60acctgctctg gagataaatt gggggataaa
tatgcttgct ggtatcagca gaagccaggc 120cagtcccctg tgctggtcat
ctatcaagat agcaagcggc cctcagggat ccctgagcga 180ttctctggct
ccaactctgg gaacacagcc actctgacca tcagcgggac ccaggctatg
240gatgaggctg actattactg tcaggcgtgg gacagcagca ctgca
285205290DNAhomo sapiens; 205tcctatgagc tgactcagcc acactcagtg
tcagtggcca cagcacagat ggccaggatc 60acctgtgggg gaaacaacat tggaagtaaa
gctgtgcact ggtaccagca aaagccaggc 120caggaccctg tgctggtcat
ctatagcgat agcaaccggc cctcagggat ccctgagcga 180ttctctggct
ccaacccagg gaacaccacc accctaacca tcagcaggat cgaggctggg
240gatgaggctg actattactg tcaggtgtgg gacagtagta gtgatcatcc
290206290DNAhomo sapiens; 206tcttctgagc tgactcagga ccctgctgtg
tctgtggcct tgggacagac agtcaggatc 60acatgccaag gagacagcct cagaagctat
tatgcaagct ggtaccagca gaagccagga 120caggcccctg tacttgtcat
ctatggtaaa aacaaccggc cctcagggat cccagaccga 180ttctctggct
ccagctcagg aaacacagct tccttgacca tcactggggc tcaggcggaa
240gatgaggctg actattactg taactcccgg gacagcagtg gtaaccatct
290207290DNAhomo sapiens; 207tcctatgtgc tgactcagcc accctcagtg
tcagtggccc caggaaagac ggccaggatt 60acctgtgggg gaaacaacat tggaagtaaa
agtgtgcact ggtaccagca gaagccaggc 120caggcccctg tgctggtcat
ctattatgat agcgaccggc cctcagggat ccctgagcga 180ttctctggct
ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg
240gatgaggccg actattactg tcaggtgtgg gacagtagta gtgatcatcc
290208284DNAhomo sapiens; 208tcctatgagc tgacacagct accctcggtg
tcagtgtccc caggacagac agccaggatc 60acctgctctg gagatgtact gggggaaaat
tatgctgact ggtaccagca gaagccaggc 120caggcccctg agttggtgat
atacgaagat agtgagcggt accctggaat ccctgaacga 180ttctctgggt
ccacctcagg gaacacgacc accctgacca tcagcagggt cctgaccgaa
240gacgaggctg actattactg tttgtctggg gatgaggaca atcc
284209290DNAhomo sapiens; 209tcctatgagc tgatgcagcc accctcggtg
tcagtgtccc caggacagac ggccaggatc 60acctgctctg gagatgcatt gccaaagcaa
tatgcttatt ggtaccagca gaagccaggc 120caggcccctg tgctggtgat
atataaagac agtgagaggc cctcagggat ccctgagcga 180ttctctggct
ccagctcagg gacaacagtc acgttgacca tcagtggagt ccaggcagaa
240gatgaggctg actattactg tcaatcagca gacagcagtg gtacttatcc
290210297DNAhomo sapiens; 210cagcctgtgc tgactcaatc atcctctgcc
tctgcttccc tgggatcctc ggtcaagctc 60acctgcactc tgagcagtgg gcacagtagc
tacatcatcg catggcatca gcagcagcca 120gggaaggccc ctcggtactt
gatgaagctt gaaggtagtg gaagctacaa caaggggagc 180ggagttcctg
atcgcttctc aggctccagc tctggggctg accgctacct caccatctcc
240aacctccagt tagaggatga ggctgattat tactgtgaga cctgggacag taacact
297211312DNAhomo sapiens; 211cagcctgtgc tgactcagcc accttcctcc
tccgcatctc ctggagaatc cgccagactc 60acctgcacct tgcccagtga catcaatgtt
ggtagctaca acatatactg gtaccagcag 120aagccaggga gccctcccag
gtatctcctg tactactact cagactcaga taagggccag 180ggctctggag
tccccagccg cttctctgga tccaaagatg cttcagccaa tacagggatt
240ttactcatct ccgggctcca gtctgaggat gaggctgact attactgtat
gatttggcca 300agcaatgctt ct 312212312DNAhomo sapiens; 212caggctgtgc
tgactcagcc ggcttccctc tctgcatctc ctggagcatc agccagtctc 60acctgcacct
tgcgcagtgg catcaatgtt ggtacctaca ggatatactg gtaccagcag
120aagccaggga gtcctcccca gtatctcctg aggtacaaat cagactcaga
taagcagcag 180ggctctggag tccccagccg cttctctgga tccaaagatg
cttcggccaa tgcagggatt 240ttactcatct ctgggctcca gtctgaggat
gaggctgact attactgtat gatttggcac 300agcagcgctt ct 312213312DNAhomo
sapiens; 213cagcctgtgc tgactcagcc aacttccctc tcagcatctc ctggagcatc
agccagactc 60acctgcacct tgcgcagtgg catcaatctt ggtagctaca ggatattctg
gtaccagcag 120aagccagaga gccctccccg gtatctcctg agctactact
cagactcaag taagcatcag 180ggctctggag tccccagccg cttctctgga
tccaaagatg cttcgagcaa tgcagggatt 240ttagtcatct ctgggctcca
gtctgaggat gaggctgact attactgtat gatttggcac 300agcagtgctt ct
312214296DNAhomo sapiens; 214aattttatgc tgactcagcc ccactctgtg
tcggagtctc cggggaagac ggtaaccatc 60tcctgcaccc gcagcagtgg cagcattgcc
agcaactatg tgcagtggta ccagcagcgc 120ccgggcagtt cccccaccac
tgtgatctat gaggataacc aaagaccctc tggggtccct 180gatcggttct
ctggctccat cgacagctcc tccaactctg cctccctcac catctctgga
240ctgaagactg aggacgaggc tgactactac tgtcagtctt atgatagcag caatca
296215294DNAhomo sapiens; 215caggctgtgg tgactcagga gccctcactg
actgtgtccc caggagggac agtcactctc 60acctgtggct ccagcactgg agctgtcacc
agtggtcatt atccctactg gttccagcag 120aagcctggcc aagcccccag
gacactgatt tatgatacaa gcaacaaaca ctcctggaca 180cctgcccggt
tctcaggctc cctccttggg ggcaaagctg ccctgaccct ttcgggtgcg
240cagcctgagg atgaggctga gtattactgc ttgctctcct atagtggtgc tcgg
294216296DNAhomo sapiens; 216cagactgtgg tgacccagga gccatcgttc
tcagtgtccc ctggagggac agtcacactc 60acttgtggct tgagctctgg ctcagtctct
actagttact accccagctg gtaccagcag 120accccaggcc aggctccacg
cacgctcatc tacagcacaa acactcgctc ttctggggtc 180cctgatcgct
tctctggctc catccttggg aacaaagctg ccctcaccat cacgggggcc
240caggcagatg atgaatctga ttattactgt gtgctgtata tgggtagtgg catttc
2962171134DNAhomo sapiens;misc_feature(1)..(1)n is a, c, g, or t
217ncttccacca agggcccatc ggtcttcccc ctggcgccct gctccaggag
cacctctggg 60ggcacagcgg ccctgggctg cctggtcaag gactacttcc cagaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacccagacc 240tacacctgca acgtgaatca
caagcccagc aacaccaagg tggacaagag agttgagctc 300aaaaccccac
ttggtgacac aactcacaca tgcccacggt gcccagagcc caaatcttgt
360gacacacctc ccccgtgccc acggtgccca gagcccaaat cttgtgacac
acctccccca 420tgcccacggt gcccagagcc caaatcttgt gacacacctc
ccccgtgccc aaggtgccca 480gcacctgaac tcctgggagg accgtcagtc
ttcctcttcc ccccaaaacc caaggatacc 540cttatgattt cccggacccc
tgaggtcacg tgcgtggtgg tggacgtgag ccacgaagac 600cccgaggtcc
agttcaagtg gtacgtggac ggcgtggagg tgcataatgc caagacaaag
660ccgcgggagg agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac
cgtcctgcac 720caggactggc tgaacggcaa ggagtacaag tgcaaggtct
ccaacaaagc cctcccagcc 780cccatcgaga aaaccatctc caaaaccaaa
ggacagcccc gagaaccaca ggtgtacacc 840ctgcccccat cccgggagga
gatgaccaag aaccaggtca gcctgacctg cctggtcaaa 900ggcttctacc
ccagcgacat cgccgtggag tgggagagca gcgggcagcc ggagaacaac
960tacaacacca cgcctcccat gctggactcc gacggctcct tcttcctcta
cagcaagctc 1020accgtggaca agagcaggtg gcagcagggg aacatcttct
catgctccgt gatgcatgag 1080gctctgcaca accgcttcac gcagaagagc
ctctccctgt ctccgggtaa atga 11342181023DNAhomo sapiens;
218gcatccccga ccagccccaa ggtcttcccg
ctgagcctcg acagcacccc ccaagatggg 60aacgtggtcg tcgcatgcct ggtccagggc
ttcttccccc aggagccact cagtgtgacc 120tggagcgaaa gcggacagaa
cgtgaccgcc agaaacttcc cacctagcca ggatgcctcc 180ggggacctgt
acaccacgag cagccagctg accctgccgg ccacacagtg cccagacggc
240aagtccgtga catgccacgt gaagcactac acgaattcca gccaggatgt
gactgtgccc 300tgccgagttc ccccacctcc cccatgctgc cacccccgac
tgtcgctgca ccgaccggcc 360ctcgaggacc tgctcttagg ttcagaagcg
aacctcacgt gcacactgac cggcctgaga 420gatgcctctg gtgccacctt
cacctggacg ccctcaagtg ggaagagcgc tgttcaagga 480ccacctgagc
gtgacctctg tggctgctac agcgtgtcca gtgtcctgcc tggctgtgcc
540cagccatgga accatgggga gaccttcacc tgcactgctg cccaccccga
gttgaagacc 600ccactaaccg ccaacatcac aaaatccgga aacacattcc
ggcccgaggt ccacctgctg 660ccgccgccgt cggaggagct ggccctgaac
gagctggtga cgctgacgtg cctggcacgt 720ggcttcagcc ccaaggatgt
gctggttcgc tggctgcagg ggtcacagga gctgccccgc 780gagaagtacc
tgacttgggc atcccggcag gagcccagcc agggcaccac cacctacgct
840gtaaccagca tactgcgcgt ggcagctgag gactggaaga agggggagac
cttctcctgc 900atggtgggcc acgaggccct gccgctggcc ttcacacaga
agaccatcga ccgcatggcg 960ggtaaaccca cccacatcaa tgtgtctgtt
gtcatggcgg aggcggatgg cacctgctac 1020tga 1023219981DNAhomo sapiens;
219gcctccacca agggcccatc ggtcttcccc ctggcgccct gctccaggag
cacctccgag 60agcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgctctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcaacttcgg cacccagacc 240tacacctgca acgtagatca
caagcccagc aacaccaagg tggacaagac agttgagcgc 300aaatgttgtg
tcgagtgccc accgtgccca gcaccacctg tggcaggacc gtcagtcttc
360ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga
ggtcacgtgc 420gtggtggtgg acgtgagcca cgaagacccc gaggtccagt
tcaactggta cgtggacggc 480gtggaggtgc ataatgccaa gacaaagcca
cgggaggagc agttcaacag cacgttccgt 540gtggtcagcg tcctcaccgt
cgtgcaccag gactggctga acggcaagga gtacaagtgc 600aaggtctcca
acaaaggcct cccagccccc atcgagaaaa ccatctccaa aaccaaaggg
660cagccccgag aaccacaggt gtacaccctg cccccatccc gggaggagat
gaccaagaac 720caggtcagcc tgacctgcct ggtcaaaggc ttctacccca
gcgacatctc cgtggagtgg 780gagagcaatg ggcagccgga gaacaactac
aagaccacac ctcccatgct ggactccgac 840ggctccttct tcctctacag
caagctcacc gtggacaaga gcaggtggca gcaggggaac 900gtcttctcat
gctccgtgat gcatgaggct ctgcacaacc actacacaca gaagagcctc
960tccctgtctc cgggtaaatg a 9812201287DNAhomo sapiens; 220gcctccacac
agagcccatc cgtcttcccc ttgacccgct gctgcaaaaa cattccctcc 60aatgccacct
ccgtgactct gggctgcctg gccacgggct acttcccgga gccggtgatg
120gtgacctggg acacaggctc cctcaacggg acaactatga ccttaccagc
caccaccctc 180acgctctctg gtcactatgc caccatcagc ttgctgaccg
tctcgggtgc gtgggccaag 240cagatgttca cctgccgtgt ggcacacact
ccatcgtcca cagactgggt cgacaacaaa 300accttcagcg tctgctccag
ggacttcacc ccgcccaccg tgaagatctt acagtcgtcc 360tgcgacggcg
gcgggcactt ccccccgacc atccagctcc tgtgcctcgt ctctgggtac
420accccaggga ctatcaacat cacctggctg gaggacgggc aggtcatgga
cgtggacttg 480tccaccgcct ctaccacgca ggagggtgag ctggcctcca
cacaaagcga gctcaccctc 540agccagaagc actggctgtc agaccgcacc
tacacctgcc aggtcaccta tcaaggtcac 600acctttgagg acagcaccaa
gaagtgtgca gattccaacc cgagaggggt gagcgcctac 660ctaagccggc
ccagcccgtt cgacctgttc atccgcaagt cgcccacgat cacctgtctg
720gtggtggacc tggcacccag caaggggacc gtgaacctga cctggtcccg
ggccagtggg 780aagcctgtga accactccac cagaaaggag gagaagcagc
gcaatggcac gttaaccgtc 840acgtccaccc tgccggtggg cacccgagac
tggatcgagg gggagaccta ccagtgcagg 900gtgacccacc cccacctgcc
cagggccctc atgcggtcca cgaccaagac cagcggcccg 960cgtgctgccc
cggaagtcta tgcgtttgcg acgccggagt ggccggggag ccgggacaag
1020cgcaccctcg cctgcctgat ccagaacttc atgcctgagg acatctcggt
gcagtggctg 1080cacaacgagg tgcagctccc ggacgcccgg cacagcacga
cgcagccccg caagaccaag 1140ggctccggct tcttcgtctt cagccgcctg
gaggtgacca gggccgaatg ggagcagaaa 1200gatgagttca tctgccgtgc
agtccatgag gcagcaagcc cctcacagac cgtccagcga 1260gcggtgtctg
taaatcccgg taaatga 128722130DNAhomo sapiens; 221tccggcttct
tcgtcttcag ccgcctggag 302221062DNAhomo sapiens; 222gcatccccga
ccagccccaa ggtcttcccg ctgagcctct gcagcaccca gccagatggg 60aacgtggtca
tcgcctgcct ggtccagggc ttcttccccc aggagccact cagtgtgacc
120tggagcgaaa gcggacaggg cgtgaccgcc agaaacttcc cacccagcca
ggatgcctcc 180ggggacctgt acaccacgag cagccagctg accctgccgg
ccacacagtg cctagccggc 240aagtccgtga catgccacgt gaagcactac
acgaatccca gccaggatgt gactgtgccc 300tgcccagttc cctcaactcc
acctacccca tctccctcaa ctccacctac cccatctccc 360tcatgctgcc
acccccgact gtcactgcac cgaccggccc tcgaggacct gctcttaggt
420tcagaagcga acctcacgtg cacactgacc ggcctgagag atgcctcagg
tgtcaccttc 480acctggacgc cctcaagtgg gaagagcgct gttcaaggac
cacctgagcg tgacctctgt 540ggctgctaca gcgtgtccag tgtcctgccg
ggctgtgccg agccatggaa ccatgggaag 600accttcactt gcactgctgc
ctaccccgag tccaagaccc cgctaaccgc caccctctca 660aaatccggaa
acacattccg gcccgaggtc cacctgctgc cgccgccgtc ggaggagctg
720gccctgaacg agctggtgac gctgacgtgc ctggcacgcg gcttcagccc
caaggatgtg 780ctggttcgct ggctgcaggg gtcacaggag ctgccccgcg
agaagtacct gacttgggca 840tcccggcagg agcccagcca gggcaccacc
accttcgctg tgaccagcat actgcgcgtg 900gcagccgagg actggaagaa
gggggacacc ttctcctgca tggtgggcca cgaggccctg 960ccgctggcct
tcacacagaa gaccatcgac cgcttggcgg gtaaacccac ccatgtcaat
1020gtgtctgttg tcatggcgga ggtggacggc acctgctact ga
1062223888DNAhomo sapiens; 223gcctccacca agggcccatc ggtcttcccc
ctggcaccct cctccaagag cacctctggg 60ggcacagcag ccctgggctg cctggtcaag
gactacttcc ccgaaccggt gacggtgtcg 120tggaactcag gcgccctgac
cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180ggactctact
ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacccagacc
240tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagaa
agttgagccc 300aaatcttgtg acaaaactca cacatgccca ccgtgcccag
cacctgaact cctgggggga 360ccgtcagtct tcctcttccc cccaaaaccc
aaggacaccc tcatgatctc ccggacccct 420gaggtcacat gcgtggtggt
ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 480tacgtggacg
gcgtggagta caagtgcaag gtctccaaca aagccctccc agcccccatc
540gagaaaacca tctccaaagc caaagggcag ccccgagaac cacaggtgta
caccctgccc 600ccatcccggg atgagctgac caagaaccag gtcagcctga
cctgcctggt caaaggcttc 660tatcccagcg acatcgccgt ggagtgggag
agcaatgggc agccggagaa caactacaag 720accacgcctc ccgtgctgga
ctccgacggc tccttcttcc tctacagcaa gctcaccgtg 780gacaagagca
ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca tgaggctctg
840cacaaccact acacacagaa gagcctctcc ctgtctccgg gtaaatga
888224993DNAhomo sapiens; 224gcctccacca agggcccatc ggtcttcccc
ctggcaccct cctccaagag cacctctggg 60ggcacagcag ccctgggctg cctggtcaag
gactacttcc ccgaaccggt gacggtgtcg 120tggaactcag gcgccctgac
cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180ggactctact
ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacccagacc
240tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagaa
agttgagccc 300aaatcttgtg acaaaactca cacatgccca ccgtgcccag
cacctgaact cctgggggga 360ccgtcagtct tcctcttccc cccaaaaccc
aaggacaccc tcatgatctc ccggacccct 420gaggtcacat gcgtggtggt
ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 480tacgtggacg
gcgtggaggt gcataatgcc aagacaaagc cgcgggagga gcagtacaac
540agcacgtacc gtgtggtcag cgtcctcacc gtcctgcacc aggactggct
gaatggcaag 600gagtacaagt gcaaggtctc caacaaagcc ctcccagccc
ccatcgagaa aaccatctcc 660aaagccaaag ggcagccccg agaaccacag
gtgtacaccc tgcccccatc ccgggatgag 720ctgaccaaga accaggtcag
cctgacctgc ctggtcaaag gcttctatcc cagcgacatc 780gccgtggagt
gggagagcaa tgggcagccg gagaacaact acaagaccac gcctcccgtg
840ctggactccg acggctcctt cttcctctac agcaagctca ccgtggacaa
gagcaggtgg 900cagcagggga acgtcttctc atgctccgtg atgcatgagg
ctctgcacaa ccactacaca 960cagaagagcc tctccctgtc tccgggtaaa tga
9932251362DNAhomo sapiens; 225gggagtgcat ccgccccaac ccttttcccc
ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg tggccgttgg ctgcctcgca
caggacttcc ttcccgactc catcactttc 120tcctggaaat acaagaacaa
ctctgacatc agcagcaccc ggggcttccc atcagtcctg 180agagggggca
agtacgcagc cacctcacag gtgctgctgc cttccaagga cgtcatgcag
240ggcacagacg aacacgtggt gtgcaaagtc cagcacccca acggcaacaa
agaaaagaac 300gtgcctcttc cagtgattgc cgagctgcct cccaaagtga
gcgtcttcgt cccaccccgc 360gacggcttct tcggcaaccc ccgcaagtcc
aagctcatct gccaggccac gggtttcagt 420ccccggcaga ttcaggtgtc
ctggctgcgc gaggggaagc aggtggggtc tggcgtcacc 480acggaccagg
tgcaggctga ggccaaagag tctgggccca cgacctacaa ggtgaccagc
540acactgacca tcaaagagag cgactggctc agccagagca tgttcacctg
ccgcgtggat 600cacaggggcc tgaccttcca gcagaatgcg tcctccatgt
gtggccccga tcaagacaca 660gccatccggg tcttcgccat ccccccatcc
tttgccagca tcttcctcac caagtccacc 720aagttgacct gcctggtcac
agacctgacc acctatgaca gcgtgaccat ctcctggacc 780cgccagaatg
gcgaagctgt gaaaacccac accaacatct ccgagagcca ccccaatgcc
840actttcagcg ccgtgggtga ggccagcatc tgcgaggatg actggaattc
cggggagagg 900ttcacgtgca ccgtgaccca cacagacctg ccctcgccac
tgaagcagac catctcccgg 960cccaaggggg tggccctgca caggcccgat
gtctacttgc tgccaccagc ccgggagcag 1020ctgaacctgc gggagtcggc
caccatcacg tgcctggtga cgggcttctc tcccgcggac 1080gtcttcgtgc
agtggatgca gagggggcag cccttgtccc cggagaagta tgtgaccagc
1140gccccaatgc ctgagcccca ggccccaggc cggtacttcg cccacagcat
cctgaccgtg 1200tccgaagagg aatggaacac gggggagacc tacacctgcg
tggtggccca tgaggccctg 1260cccaacaggg tcaccgagag gaccgtggac
aagtccaccg gtaaacccac cctgtacaac 1320gtgtccctgg tcatgtccga
cacagctggc acctgctact ga 13622261200DNAhomo sapiens; 226gcctccacca
agggcccatc ggtcttcccc ctggcaccct cctccaagag cacctctggg 60ggcacagcag
ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg
120tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca 180ggactctact ccctcagcag cgtggtgacc gtgccctcca
gcagcttggg cacccagacc 240tacatctgca acgtgaatca caagcccagc
aacaccaagg tggacaagaa agttgagccc 300aaatcttgtg acaaaactca
cacatgccca ccgtgcccag cacctgaact cctgggggga 360ccgtcagtct
tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct
420gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa
gttcaactgg 480tacgtggacg gcgtggaggt gcataatgcc aagacaaagc
cgcgggagga gcagtacaac 540agcacgtacc gtgtggtcag cgtcctcacc
gtcctgcacc aggactggct gaatggcaag 600gagtacaagt gcaaggtctc
caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 660aaagccaaag
ggcagccccg agaaccacag gtgtacaccc tgcccccatc ccgggatgag
720ctgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc
cagcgacatc 780gccgtggagt gggagagcaa tgggcagccg gagaacaact
acaagaccac gcctcccgtg 840ctggactccg acggctcctt cttcctctac
agcaagctca ccgtggacaa gagcaggtgg 900cagcagggga acgtcttctc
atgctccgtg atgcatgagg ctctgcacaa ccactacaca 960cagaagagcc
tctccctgtc tccggagctg caactggagg agagctgtgc ggaggcgcag
1020gacggggagc tggacgggct gtggacgacc atcaccatct tcatcacact
cttcctgtta 1080agcgtgtgct acagtgccac cgtcaccttc ttcaaggtga
agtggatctt ctcctcggtg 1140gtggacctga agcagaccat catccccgac
tacaggaaca tgatcggaca gggggcctag 12002271293DNAhomo
sapiens;misc_feature(1)..(1)n is a, c, g, or t 227ncacccacca
aggctccgga tgtgttcccc atcatatcag ggtgcagaca cccaaaggat 60aacagccctg
tggtcctggc atgcttgata actgggtacc acccaacgtc cgtgactgtc
120acctggtaca tggggacaca gagccagccc cagagaacct tccctgagat
acaaagacgg 180gacagctact acatgacaag cagccagctc tccacccccc
tccagcagtg gcgccaaggc 240gagtacaaat gcgtggtcca gcacaccgcc
agcaagagta agaaggagat cttccgctgg 300ccagagtctc caaaggcaca
ggcctcctca gtgcccactg cacaacccca agcagagggc 360agcctcgcca
aggcaaccac agccccagcc accacccgta acacaggaag aggaggagaa
420gagaagaaga aggagaagga gaaagaggaa caagaagaga gagagacaaa
gacaccagag 480tgtccgagcc acacccagcc tcttggcgtc tacctgctaa
cccctgcagt gcaggacctg 540tggctccggg acaaagccac cttcacctgc
ttcgtggtgg gcagtgacct gaaggatgct 600cacctgacct gggaggtggc
cgggaaggtc cccacagggg gcgtggagga agggctgctg 660gagcggcaca
gcaacggctc ccagagccag cacagccgtc tgaccctgcc caggtccttg
720tggaacgcgg ggacctccgt cacctgcaca ctgaaccatc ccagcctccc
accccagagg 780ttgatggcgc tgagagaacc cgctgcgcag gcacccgtca
agctttccct gaacctgctg 840gcctcgtctg accctcccga ggcggcctcg
tggctcctgt gtgaggtgtc tggcttctcg 900ccccccaaca tcctcctgat
gtggctggag gaccagcgtg aggtgaacac ttctgggttt 960gcccccgcac
gcccccctcc acagcccggg agcaccacgt tctgggcctg gagtgtgctg
1020cgtgtcccag ccccgcccag ccctcagcca gccacctaca cgtgtgtggt
cagccacgag 1080gactcccgga ctctgctcaa cgccagccgg agcctagaag
tcagctacct ggccatgacc 1140cccctgatcc ctcagagcaa ggatgagaac
agcgatgact acacgacctt tgatgatgtg 1200ggcagcctgt ggaccgccct
gtccacgttt gtggccctct tcatcctcac cctcctctac 1260agcggcattg
tcactttcat caaggtgaag tag 1293228984DNAhomo sapiens; 228gcttccacca
agggcccatc ggtcttcccc ctggcgccct gctccaggag cacctccgag 60agcacagccg
ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg
120tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca 180ggactctact ccctcagcag cgtggtgacc gtgccctcca
gcagcttggg cacgaagacc 240tacacctgca acgtagatca caagcccagc
aacaccaagg tggacaagag agttgagtcc 300aaatatggtc ccccatgccc
atcatgccca gcacctgagt tcctgggggg accatcagtc 360ttcctgttcc
ccccaaaacc caaggacact ctcatgatct cccggacccc tgaggtcacg
420tgcgtggtgg tggacgtgag ccaggaagac cccgaggtcc agttcaactg
gtacgtggat 480ggcgtggagg tgcataatgc caagacaaag ccgcgggagg
agcagttcaa cagcacgtac 540cgtgtggtca gcgtcctcac cgtcctgcac
caggactggc tgaacggcaa ggagtacaag 600tgcaaggtct ccaacaaagg
cctcccgtcc tccatcgaga aaaccatctc caaagccaaa 660gggcagcccc
gagagccaca ggtgtacacc ctgcccccat cccaggagga gatgaccaag
720aaccaggtca gcctgacctg cctggtcaaa ggcttctacc ccagcgacat
cgccgtggag 780tgggagagca atgggcagcc ggagaacaac tacaagacca
cgcctcccgt gctggactcc 840gacggctcct tcttcctcta cagcaggctc
accgtggaca agagcaggtg gcaggagggg 900aatgtcttct catgctccgt
gatgcatgag gctctgcaca accactacac acagaagagc 960ctctccctgt
ctctgggtaa atga 984229228DNAhomo sapiens; 229tccggcttct tcgtcttcag
ccgcctggag gtgaccaggg ccgaatggga gcagaaagat 60gagttcatct gccgtgcagt
ccatgaggca gcaagcccct cacagaccgt ccagcgagcg 120gtgtctgtaa
atcccgagct ggacgtgtgc gtggaggagg ccgagggcga ggcgccgtgg
180acgtggaccg gcctctgcat cttcgccgca ctcttcctgc tcagcgtg
228230324DNAhomo sapiens;misc_feature(1)..(1)n is a, c, g, or t
230ngaactgtgg ctgcaccatc tgtcttcatc ttcccgccat ctgatgagca
gttgaaatct 60ggaactgcct ctgttgtgtg cctgctgaat aacttctatc ccagagaggc
caaagtacag 120tggaaggtgg ataacgccct ccaatcgggt aactcccagg
agagtgtcac agagcaggac 180agcaaggaca gcacctacag cctcagcagc
accctgacgc tgagcaaagc agactacgag 240aaacacaaag tctacgcctg
cgaagtcacc catcagggcc tgagctcgcc cgtcacaaag 300agcttcaaca
ggggagagtg ttag 324231321DNAhomo sapiens;misc_feature(1)..(1)n is
a, c, g, or t 231ngtcagccca aggctgcccc ctcggtcact ctgttcccgc
cctcctctga ggagcttcaa 60gccaacaagg ccacactggt gtgtctcata agtgacttct
acccgggagc cgtgacagtg 120gcctggaagg cagatagcag ccccgtcaag
gcgggagtgg agaccaccac accctccaaa 180caaagcaaca acaagtacgc
ggccagcagc tatctgagcc tgacgcctga gcagtggaag 240tcccacagaa
gctacagctg ccaggtcacg catgaaggga gcaccgtgga gaagacagtg
300gcccctacag aatgttcata g 321232321DNAhomo
sapiens;misc_feature(1)..(1)n is a, c, g, or t 232ngtcagccca
aggccaaccc cactgtcact ctgttcccgc cctcctctga ggagctccaa 60gccaacaagg
ccacactagt gtgtctgatc agtgacttct acccgggagc tgtgacagtg
120gcctggaagg cagatggcag ccccgtcaag gcgggagtgg agaccaccaa
accctccaaa 180cagagcaaca acaagtacgc ggccagcagc tacctgagcc
tgacgcccga gcagtggaag 240tcccacagaa gctacagctg ccaggtcacg
catgaaggga gcaccgtgga gaagacagtg 300gcccctacag aatgttcata g
321233321DNAhomo sapiens;misc_feature(1)..(1)n is a, c, g, or t
233ngtcagccca aggctgcccc ctcggtcact ctgttcccgc cctcctctga
ggagcttcaa 60gccaacaagg ccacactggt gtgtctcata agtgacttct acccgggagc
cgtgacagtg 120gcctggaagg cagatagcag ccccgtcaag gcgggagtgg
agaccaccac accctccaaa 180caaagcaaca acaagtacgc ggccagcagc
tacctgagcc tgacgcctga gcagtggaag 240tcccacagaa gctacagctg
ccaggtcacg catgaaggga gcaccgtgga gaagacagtg 300gcccctacag
aatgttcata g 321234321DNAhomo sapiens;misc_feature(1)..(1)n is a,
c, g, or t 234ngtcagccca aggctgcccc ctcggtcact ctgttcccac
cctcctctga ggagcttcaa 60gccaacaagg ccacactggt gtgtctcgta agtgacttct
acccgggagc cgtgacagtg 120gcctggaagg cagatggcag ccccgtcaag
gtgggagtgg agaccaccaa accctccaaa 180caaagcaaca acaagtatgc
ggccagcagc tacctgagcc tgacgcccga gcagtggaag 240tcccacagaa
gctacagctg ccgggtcacg catgaaggga gcaccgtgga gaagacagtg
300gcccctgcag aatgctctta g 32123561DNAhomo sapiens; 235tactactact
actacggtat ggacgtctgg ggccaaggga ccacggtcac cgtctcctca 60g
6123620PRThomo sapiens; 236Tyr Tyr Tyr Tyr Tyr Gly Met Asp Val Trp
Gly Gln Gly Thr Thr Val 1 5 10 15 Thr Val Ser Ser 20 237101DNAhomo
sapiens; 237ggtttttgtg gggtgaggat ggacattctg ccattgtgat tactactact
actacggtat 60ggacgtctgg ggccaaggga ccacggtcac cgtctcctca g
10123838DNAhomo sapiens; 238ggtttttgtg gggtgaggat ggacattctg
ccattgtg 3823952DNAhomo sapiens; 239gctgaatact tccagcactg
gggccagggc accctggtca ccgtctcctc ag 5224052DNAhomo sapiens;
240tactggtact tcgatctctg gggccgtggc accctggtca ctgtctcctc ag
5224149DNAhomo sapiens; 241gatgcttttg atatctgggg ccaagggaca
atggtcaccg tctcttcag 4924246DNAhomo sapiens; 242tactttgact
actggggcca gggaaccctg gtcaccgtct cctcag 4624349DNAhomo sapiens;
243aactggttcg acccctgggg ccagggaacc ctggtcaccg tctcctcag
4924461DNAhomo sapiens; 244tactactact actactacat ggacgtctgg
ggcaaaggga ccacggtcac cgtctcctca 60g
61245494DNAhomo sapiens; 245gcatcaccca aaaaccacac ccctccttgg
gagaatcccc tagatcacag ctcctcacca 60tggactggac ctggagcatc cttttcttgg
tggcagcagc aacaggtaac ggactcccca 120gtcccagggc tgagagagaa
accaggccag tcatgtgaga cttcacccac tcctgtgtcc 180tctccacagg
tgcccactcc caggttcagc tggtgcagtc tggagctgag gtgaagaagc
240ctggggcctc agtgaaggtc tcctgcaagg cttctggtta cacctttacc
agctatggta 300tcagctgggt gcgacaggcc cctggacaag ggcttgagtg
gatgggatgg atcagcgctt 360acaatggtaa cacaaactat gcacagaagc
tccagggcag agtcaccatg accacagaca 420catccacgag cacagcctac
atggagctga ggagcctgag atctgacgac acggccgtgt 480attactgtgc gaga
494246500DNAhomo sapiens; 246gagagcatca cccagcaacc acatctgtcc
tctagagaat cccctgagag ctccgttcct 60caccatggac tggacctgga ggatcctctt
cttggtggca gcagccacag gtaagaggct 120ccctagtccc agtgatgaga
aagagattga gtccagtcca gggagatctc atccacttct 180gtgttctctc
cacaggagcc cactcccagg tgcagctggt gcagtctggg gctgaggtga
240agaagcctgg ggcctcagtg aaggtctcct gcaaggcttc tggatacacc
ttcaccggct 300actatatgca ctgggtgcga caggcccctg gacaagggct
tgagtggatg ggatggatca 360accctaacag tggtggcaca aactatgcac
agaagtttca gggcagggtc accatgacca 420gggacacgtc catcagcaca
gcctacatgg agctgagcag gctgagatct gacgacacgg 480ccgtgtatta
ctgtgcgaga 500247496DNAhomo sapiens; 247accatcacac aacagccaca
tccctcccct acagaagccc ccagagcgca gcacctcacc 60atggactgca cctggaggat
cctcttcttg gtggcagcag ctacaggcaa gagaatcctg 120agttccaggg
ctgatgaggg gactgggtcc agttaagtgg tgtctcatcc actcctctgt
180cctctccaca ggcacccacg cccaggtcca gctggtacag tctggggctg
aggtgaagaa 240gcctggggcc tcagtgaagg tctcctgcaa ggtttccgga
tacaccctca ctgaattatc 300catgcactgg gtgcgacagg ctcctggaaa
agggcttgag tggatgggag gttttgatcc 360tgaagatggt gaaacaatct
acgcacagaa gttccagggc agagtcacca tgaccgagga 420cacatctaca
gacacagcct acatggagct gagcagcctg agatctgagg acacggccgt
480gtattactgt gcaaca 496248478DNAhomo sapiens; 248ccacatccct
cctcagaagc ccccagagca caactcctca ccatggactg gacctggagg 60atcctctttt
tggtggcagc agccacaggt aaggggctgc caaatcccag tgaggaggaa
120gggatcgaag ccagtcaagg gggcttccat ccactcctgt gtcttctcta
caggtgtcca 180ctcccaggtt cagctggtgc agtctggggc tgaggtgaag
aagcctgggg cctcagtgaa 240ggtttcctgc aaggcttctg gatacacctt
cactagctat gctatgcatt gggtgcgcca 300ggcccccgga caaaggcttg
agtggatggg atggagcaac gctggcaatg gtaacacaaa 360atattcacag
gagttccagg gcagagtcac cattaccagg gacacatccg cgagcacagc
420ctacatggag ctgagcagcc tgagatctga ggacatggct gtgtattact gtgcgaga
478249494DNAhomo sapiens; 249atcacccaac aaccacatcc ctcctctaga
gaatcccctg aaagcacagc tcctcaccat 60ggactggacc tggagaatcc tcttcttggt
ggcagcagcc acaggtaagg ggctcccaag 120tcccagtgat gaggagggga
ttgagtccag tcaaggtggc ttttatccac tcctgtgtcc 180cctccacaga
tgcctactcc cagatgcagc tggtgcagtc tggggctgag gtgaagaaga
240ctgggtcctc agtgaaggtt tcctgcaagg cttccggata caccttcacc
taccgctacc 300tgcactgggt gcgacaggcc cccggacaag cgcttgagtg
gatgggatgg atcacacctt 360tcaatggtaa caccaactac gcacagaaat
tccaggacag agtcaccatt accagggaca 420ggtctatgag cacagcctac
atggagctga gcagcctgag atctgaggac acagccatgt 480attactgtgc aaga
494250740DNAhomo sapiens; 250atctgtgggg acttgttctt cagtgaaagg
atcctgtccg caaacagaaa tggagcagga 60catgcatttc ttcaagcagg attagggctt
ggaccatcag catcccactc ctgtgtggca 120gatgggacat ctatcttctt
tctcaacctc gatcaggctt tgaggtatga aataatctgt 180ctcatgaata
tgcaaataac cttagatcta ctgaggtaaa tatggataca tctgggccct
240gaaagcatca tccaacaacc acatcccttc tctacagaag cctctgagag
gaaagttctt 300caccatggac tggacctgga gggtcttctg cttgctggct
gtagctccag gtaaagggcc 360aactggttcc agggctgagg aagggatttt
ttccagttta gaggactgtc attctctact 420gtgtcctctc cgcaggtgct
cactcccagg tgcagctggt gcagtctggg gctgaggtga 480agaagcctgg
ggcctcagtg aaggtttcct gcaaggcatc tggatacacc ttcaccagct
540actatatgca ctgggtgcga caggcccctg gacaagggct tgagtggatg
ggaataatca 600accctagtgg tggtagcaca agctacgcac agaagttcca
gggcagagtc accatgacca 660gggacacgtc cacgagcaca gtctacatgg
agctgagcag cctgagatct gaggacacgg 720ccgtgtatta ctgtgcgaga
740251497DNAhomo sapiens; 251agcatcatcc agaaaccaca tccctccgct
agagaagccc ctgacggcac agttcctcac 60tatggactgg atttggaggg tcctcttctt
ggtgggagca gcgacaggca aggagatgcc 120aagtcccagt gatgaggagg
ggattgagtc cagtcaaggt ggctttcatc cactcctgtg 180ttctctccac
aggtgcccac tcccaaatgc agctggtgca gtctgggcct gaggtgaaga
240agcctgggac ctcagtgaag gtctcctgca aggcttctgg attcaccttt
actagctctg 300ctatgcagtg ggtgcgacag gctcgtggac aacgccttga
gtggatagga tggatcgtcg 360ttggcagtgg taacacaaac tacgcacaga
agttccagga aagagtcacc attaccaggg 420acatgtccac aagcacagcc
tacatggagc tgagcagcct gagatccgag gacacggccg 480tgtattactg tgcggca
497252498DNAhomo sapiens; 252agcatcacat aacaaccaca ttcctcctct
gaagaagccc ctgggagcac agctcatcac 60catggactgg acctggaggt tcctctttgt
ggtggcagca gctacaggta aggggcttcc 120tagtcctaag gctgaggaag
ggatcctggt ttagttaaag aggattttat tcacccctgt 180gtcctctcca
caggtgtcca gtcccaggtg cagctggtgc agtctggggc tgaggtgaag
240aagcctgggt cctcggtgaa ggtctcctgc aaggcttctg gaggcacctt
cagcagctat 300gctatcagct gggtgcgaca ggcccctgga caagggcttg
agtggatggg agggatcatc 360cctatctttg gtacagcaaa ctacgcacag
aagttccagg gcagagtcac gattaccgcg 420gacaaatcca cgagcacagc
ctacatggag ctgagcagcc tgagatctga ggacacggcc 480gtgtattact gtgcgaga
498253499DNAhomo sapiens; 253gagcatcact caacaaccac atctgtcctc
tagagaaaac cctgtgagca cagctcctca 60ccatggactg gacctggagg atcctcttct
tggtggcagc agctacaagt aaggggcttc 120ctagtctcaa agctgaggaa
cggatcctgg ttcagtcaaa gaggatttta ttctctcctg 180tgttctctcc
acaggtgccc actcccaggt gcagctggtg cagtctgggg ctgaggtgaa
240gaagcctggg gcctcagtga aggtctcctg caaggcttct ggatacacct
tcaccagtta 300tgatatcaac tgggtgcgac aggccactgg acaagggctt
gagtggatgg gatggatgaa 360ccctaacagt ggtaacacag gctatgcaca
gaagttccag ggcagagtca ccatgaccag 420gaacacctcc ataagcacag
cctacatgga gctgagcagc ctgagatctg aggacacggc 480cgtgtattac tgtgcgaga
499254467DNAhomo sapiens; 254gctcagtgac tcctgtgccc caccatggac
acactttgct acacactcct gctgctgacc 60accccttcct gtgagtgctg tggtcaggga
cttcctcaga agtgaaacat cagttgtctc 120ctttgtgggc ttcatcttct
tatgtcttct ccacaggggt cttgtcccag gtcaccttga 180aggagtctgg
tcctgtgctg gtgaaaccca cagagaccct cacgctgacc tgcaccgtct
240ctgggttctc actcagcaat gctagaatgg gtgtgagctg gatccgtcag
cccccaggga 300aggccctgga gtggcttgca cacatttttt cgaatgacga
aaaatcctac agcacatctc 360tgaagagcag gctcaccatc tccaaggaca
cctccaaaag ccaggtggtc cttaccatga 420ccaacatgga ccctgtggac
acagccacat attactgtgc acggata 467255463DNAhomo sapiens;
255agtgactcct gtgccccacc atggacacac tttgctccac gctcctgctg
ctgaccatcc 60cttcatgtga gtgctgtggt cagggactcc ttcacgggtg aaacatcagt
tttcttgttt 120gtgggcttca tcttcttatg ctttctccac aggggtcttg
tcccagatca ccttgaagga 180gtctggtcct acgctggtga aacccacaca
gaccctcacg ctgacctgca ccttctctgg 240gttctcactc agcactagtg
gagtgggtgt gggctggatc cgtcagcccc caggaaaggc 300cctggagtgg
cttgcactca tttattggaa tgatgataag cgctacagcc catctctgaa
360gagcaggctc accatcacca aggacacctc caaaaaccag gtggtcctta
caatgaccaa 420catggaccct gtggacacag ccacatatta ctgtgcacac aga
463256519DNAhomo sapiens; 256atctccacca gctccaccct cccctgggtt
caaaagacga ggacagggcc tcgctcagtg 60aatcctgctc tccaccatgg acatactttg
ttccacgctc ctgctactga ctgtcccgtc 120ctgtgagtgc tgtggtcagg
tagtacttca gaagcaaaaa atctattctc tcctttgtgg 180gcttcatctt
cttatgtctt ctccacaggg gtcttatccc aggtcacctt gagggagtct
240ggtcctgcgc tggtgaaacc cacacagacc ctcacactga cctgcacctt
ctctgggttc 300tcactcagca ctagtggaat gtgtgtgagc tggatccgtc
agcccccagg gaaggccctg 360gagtggcttg cactcattga ttgggatgat
gataaatact acagcacatc tctgaagacc 420aggctcacca tctccaagga
cacctccaaa aaccaggtgg tccttacaat gaccaacatg 480gaccctgtgg
acacagccac gtattattgt gcacggata 519257568DNAhomo sapiens;
257ctccctctgc tgataaaaac cagccgagcc cagaccctgc agctctggga
gaagagcccc 60agccccagaa ttcccaggag tttccattcg gtgatcagca ctgaacacag
aggactcacc 120atggagtttg ggctgagctg ggttttcctt gttgctatta
taaaaggtga tttatggaga 180actagagaca ttgagtggac gtgagtgaga
taagcagtga atatatgtgg cagtttctga 240ctaggttgtc tctgtgtttg
caggtgtcca gtgtcaggtg cagctggtgg agtctggggg 300aggcttggtc
aagcctggag ggtccctgag actctcctgt gcagcctctg gattcacctt
360cagtgactac tacatgagct ggatccgcca ggctccaggg aaggggctgg
agtgggtttc 420atacattagt agtagtggta gtaccatata ctacgcagac
tctgtgaagg gccgattcac 480catctccagg gacaacgcca agaactcact
gtatctgcaa atgaacagcc tgagagccga 540ggacacggcc gtgtattact gtgcgaga
568258531DNAhomo sapiens; 258agctctggga gtggagcccc agccttggga
ttcccaagtg tttgtattca gtgatcagga 60ctgaacacac aggactcacc atggagttgg
ggctgagctg ggttttcctt gttgctatat 120tagaaggtga ttcatggaga
actagagata ttgagtgtga atgggcatga atgagagaaa 180cagtgggtat
gtgtggcaat ttctgacttt tgtgtctctg tgtttgcagg tgtccagtgt
240gaggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc
cctgagactc 300tcctgtgcag cctctggatt caccttcagt agctacgaca
tgcactgggt ccgccaagct 360acaggaaaag gtctggagtg ggtctcagct
attggtactg ctggtgacac atactatcca 420ggctccgtga agggccgatt
caccatctcc agagaaaatg ccaagaactc cttgtatctt 480caaatgaaca
gcctgagagc cggggacacg gctgtgtatt actgtgcaag a 531259540DNAhomo
sapiens; 259agctctggga gaggagcccc agccttggga ttcccaagtg ttttcattca
gtgatcagga 60ctgaacacag aggactcacc atggagtttg ggctgagctg gattttcctt
gctgctattt 120taaaaggtga tttatggaga actagagaga ttaagtgtga
gtggacgtga gtgagagaaa 180cagtggatat gtgtggcagt ttctgatctt
agtgtctctg tgtttgcagg tgtccagtgt 240gaggtgcagc tggtggagtc
tgggggaggc ttggtaaagc ctggggggtc ccttagactc 300tcctgtgcag
cctctggatt cactttcagt aacgcctgga tgagctgggt ccgccaggct
360ccagggaagg ggctggagtg ggttggccgt attaaaagca aaactgatgg
tgggacaaca 420gactacgctg cacccgtgaa aggcagattc accatctcaa
gagatgattc aaaaaacacg 480ctgtatctgc aaatgaacag cctgaaaacc
gaggacacag ccgtgtatta ctgtaccaca 540260526DNAhomo sapiens;
260agccctggga gagaagcccc agccctggga ttctcaggtg tttctattgg
gtcaacagca 60ataaacaaat taccatggaa tttgggctga gctgggtttt tcttgctggt
attttaaaag 120gtgattcatg gagaactaag gatattgagt gagtggacat
gagtgagaga aacagtggat 180atgtgtggca gtttctgacc agggtgtctc
tgtgtttgca ggtgtccagt gtgaggtgca 240gctggtggag tctgggggag
gcttggtaca gcctgggggg tccctgagac tctcctgtgc 300agcctctgga
ttcaccttca gtaacagtga catgaactgg gcccgcaagg ctccaggaaa
360ggggctggag tgggtatcgg gtgttagttg gaatggcagt aggacgcact
atgtggactc 420cgtgaagcgc cgattcatca tctccagaga caattccagg
aactccctgt atctgcaaaa 480gaacagacgg agagccgagg acatggctgt
gtattactgt gtgaga 526261515DNAhomo sapiens; 261ccagccctga
gattcccacg tgtttccatt cagtgatcag cactgaacac agaggactcg 60ccatggagtt
tgggctgagc tgggttttcc ttgttgctat tttaaaaggt gattcatgga
120tcaatagaga tgttgagtgt gagtgaacac gagtgagaga aacagtggat
ttgtgtggca 180gtttctgacc aggtgtctct gtgtttgcag gtgtccagtg
tgaggtgcag ctggtggagt 240ctgggggagg tgtggtacgg cctggggggt
ccctgagact ctcctgtgca gcctctggat 300tcacctttga tgattatggc
atgagctggg tccgccaagc tccagggaag gggctggagt 360gggtctctgg
tattaattgg aatggtggta gcacaggtta tgcagactct gtgaagggcc
420gattcaccat ctccagagac aacgccaaga actccctgta tctgcaaatg
aacagtctga 480gagccgagga cacggccttg tatcactgtg cgaga
515262531DNAhomo sapiens; 262agctctgaga gaggagcctt agccctggat
tccaaggcct atccacttgg tgatcagcac 60tgagcaccga ggattcacca tggaactggg
gctccgctgg gttttccttg ttgctatttt 120agaaggtgaa tcatggaaaa
gtagagagat ttagtgtgtg tggatatgag tgagagaaac 180ggtggatgtg
tgtgacagtt tctgaccaat gtctctctgt ttgcaggtgt ccagtgtgag
240gtgcagctgg tggagtctgg gggaggcctg gtcaagcctg gggggtccct
gagactctcc 300tgtgcagcct ctggattcac cttcagtagc tatagcatga
actgggtccg ccaggctcca 360gggaaggggc tggagtgggt ctcatccatt
agtagtagta gtagttacat atactacgca 420gactcagtga agggccgatt
caccatctcc agagacaacg ccaagaactc actgtatctg 480caaatgaaca
gcctgagagc cgaggacacg gctgtgtatt actgtgcgag a 531263533DNAhomo
sapiens; 263agctctgaga gaggagccca gccctgggat tttcaggtgt tttcatttgg
tgatcaggac 60tgaacagaga gaactcacca tggagtttgg gctgagctgg ctttttcttg
tggctatttt 120aaaaggtaat tcatggagaa atagaaaaat tgagtgtgaa
tggataagag tgagagaaac 180agtggatacg tgtggcagtt tctgaccagg
gtttcttttt gtttgcaggt gtccagtgtg 240aggtgcagct gttggagtct
gggggaggct tggtacagcc tggggggtcc ctgagactct 300cctgtgcagc
ctctggattc acctttagca gctatgccat gagctgggtc cgccaggctc
360cagggaaggg gctggagtgg gtctcagcta ttagtggtag tggtggtagc
acatactacg 420cagactccgt gaagggccgg ttcaccatct ccagagacaa
ttccaagaac acgctgtatc 480tgcaaatgaa cagcctgaga gccgaggaca
cggccgtata ttactgtgcg aaa 533264532DNAhomo sapiens; 264cagctctggg
agaggagccc agcactagaa gtcggcggtg tttccattcg gtgatcagca 60ctgaacacag
aggactcacc atggagtttg ggctgagctg ggttttcctc gttgctcttt
120taagaggtga ttcatggaga aatagagaga ctgagtgtga gtgaacatga
gtgagaaaaa 180ctggatttgt gtggcatttt ctgataacgg tgtccttctg
tttgcaggtg tccagtgtca 240ggtgcagctg gtggagtctg ggggaggcgt
ggtccagcct gggaggtccc tgagactctc 300ctgtgcagcc tctggattca
ccttcagtag ctatggcatg cactgggtcc gccaggctcc 360aggcaagggg
ctggagtggg tggcagttat atcatatgat ggaagtaata aatactatgc
420agactccgtg aagggccgat tcaccatctc cagagacaat tccaagaaca
cgctgtatct 480gcaaatgaac agcctgagag ctgaggacac ggctgtgtat
tactgtgcga ga 532265532DNAhomo sapiens; 265cagctctggg agaggagccc
agcactagaa gtcggcggtg tttccattcg gtgatcagca 60ctgaacacag aggactcacc
atggagtttg ggctgagctg ggttttcctc gttgctcttt 120taagaggtga
ttcatggaga aatagagaga ctgagtgtga gtgaacatga gtgagaaaaa
180ctggatttgt gtggcatttt ctgataacgg tgtccttctg tttgcaggtg
tccagtgtca 240ggtgcagctg gtggagtctg ggggaggcgt ggtccagcct
gggaggtccc tgagactctc 300ctgtgcagcg tctggattca ccttcagtag
ctatggcatg cactgggtcc gccaggctcc 360aggcaagggg ctggagtggg
tggcagttat atggtatgat ggaagtaata aatactatgc 420agactccgtg
aagggccgat tcaccatctc cagagacaat tccaagaaca cgctgtatct
480gcaaatgaac agcctgagag ccgaggacac ggctgtgtat tactgtgcga ga
532266467DNAhomo sapiens; 266aacaaacaaa ttaccatgga atttgggctg
agctgggttt ttcttgctgc tattttaaaa 60ggtgattcat gaagaactaa ggatattgag
tgagtggaca tgagtgagag aaacagtgga 120tttgtgtggc agtttctgac
cagggtgtct ctgtgtttgc aggtgtccag tgtgaggtgc 180agctggtgga
gtctggggga ggcttggtac agcctggggg atccctgaga ctctcctgtg
240cagcctctgg attcaccttc agtaacagtg acatgaactg ggtccatcag
gctccaggaa 300aggggctgga gtgggtatcg ggtgttagtt ggaatggcag
taggacgcac tatgcagact 360ctgtgaaggg ccgattcatc atctccagag
acaattccag gaacaccctg tatctgcaaa 420cgaatagcct gagggccgag
gacacggctg tgtattactg tgtgaga 467267529DNAhomo sapiens;
267ctctgggagt ggagccccag ccttgggatt cccaggtgtt tcccttcagt
gatcaggact 60gaacacacac aactcatcat gcagtttgtg ctgagctggg ttttccttgt
tggtatttta 120aaaggtgatt catggagaac tacagatgtt gagtgtgagt
ggacatgagt gagcaaaaca 180gtgggtttgt gtggcagttt ctgaccttgg
tgtctctgtg tttgcaggtg tccagtgtga 240ggtgcagctg gtggagtctg
ggggaggctt ggtacagcct agggggtccc tgagactctc 300ctgtgcagcc
tctggattca ccgtcagtag caatgagatg agctggatcc gccaggctcc
360agggaagggg ctggagtggg tctcatccat tagtggtggt agcacatact
acgcagactc 420caggaagggc agattcacca tctccagaga caattccaag
aacacgctgt atcttcaaat 480gaacaacctg agagctgagg gcacggccgt
gtattactgt gccagatat 529268537DNAhomo sapiens; 268agctctggga
gaggagcccc agccctgaga ttcccaggtg tttccattcg gtgatcagca 60ctgaacacag
agaacgcacc atggagtttg gactgagctg ggttttcctt gttgctattt
120taaaaggtga ttcatggata aatagagatg ttgagtgtga gtgaacatga
gtgagagaaa 180cagtggatat gtgtggcagt gtctgaccag ggtgtctctg
tgtttgcagg tgtccagtgt 240gaagtgcagc tggtggagtc tgggggagtc
gtggtacagc ctggggggtc cctgagactc 300tcctgtgcag cctctggatt
cacctttgat gattatacca tgcactgggt ccgtcaagct 360ccggggaagg
gtctggagtg ggtctctctt attagttggg atggtggtag cacatactat
420gcagactctg tgaagggccg attcaccatc tccagagaca acagcaaaaa
ctccctgtat 480ctgcaaatga acagtctgag aactgaggac accgccttgt
attactgtgc aaaagat 537269533DNAhomo sapiens; 269agctctcaga
gaggtgcctt agccctggat tccaaggcat ttccacttgg tgatcagcac 60tgaacacaga
ggactcacca tggagttggg gctgtgctgg gttttccttg ttgctatttt
120agaaggtgat tcatggaaaa ctagagagat ttagtgtgtg tggatatgag
tgagagaaac 180agtggatatg tgtggcagtt tctgaccttg gtgtctcttt
gtttgcaggt gtccagtgtg 240aggtgcagct ggtggagtct gggggaggct
tggtacagcc tggggggtcc ctgagactct 300cctgtgcagc ctctggattc
accttcagta gctatagcat gaactgggtc cgccaggctc 360cagggaaggg
gctggagtgg gtttcataca ttagtagtag tagtagtacc atatactacg
420cagactctgt gaagggccga ttcaccatct ccagagacaa tgccaagaac
tcactgtatc 480tgcaaatgaa cagcctgaga gacgaggaca cggctgtgta
ttactgtgcg aga 533270540DNAhomo sapiens; 270agctctggga gaggagcccc
agccgtgaga ttcccaggag tttccacttg gtgatcagca 60ctgaacacag accaccaacc
atggagtttg ggcttagctg ggttttcctt gttgctattt 120taaaaggtaa
ttcatggtgt actagagata ctgagtgtga ggggacatga gtggtagaaa
180cagtggatat gtgtggcagt ttctgacctt ggtgtttctg tgtttgcagg
tgtccaatgt 240gaggtgcagc tggtggagtc tgggggaggc ttggtacagc
cagggcggtc cctgagactc 300tcctgtacag cttctggatt cacctttggt
gattatgcta tgagctggtt ccgccaggct 360ccagggaagg ggctggagtg
ggtaggtttc attagaagca aagcttatgg tgggacaaca 420gaatacgccg
cgtctgtgaa aggcagattc accatctcaa gagatgattc caaaagcatc
480gcctatctgc aaatgaacag cctgaaaacc gaggacacag ccgtgtatta
ctgtactaga 540271670DNAhomo sapiens; 271aataccaatc tcccccagga
cacttcatct gcacggagcc cggcctctcc tcagatgtcc 60caccccagag cttgctatat
agtcggggac atccaaatag ggccctccct ctgctgatga 120aaaccagccc
agctgaccct gcagctctgg gagaggagcc cagcactggg attccgaggt
180gtttccattc ggtgatcagc actgaacaca gaggactcac catggagttt
tggctgagct 240gggttttcct
tgttgctatt ttaaaaggtg attcatggag aactagagat attgagtgtg
300agtgaacacg agtgagagaa acagtggata tgtgtggcag tttctaacca
atgtctctgt 360gtttgcaggt gtccagtgtg aggtgcagct ggtggagtct
ggaggaggct tgatccagcc 420tggggggtcc ctgagactct cctgtgcagc
ctctgggttc accgtcagta gcaactacat 480gagctgggtc cgccaggctc
cagggaaggg gctggagtgg gtctcagtta tttatagcgg 540tggtagcaca
tactacgcag actccgtgaa gggccgattc accatctcca gagacaattc
600caagaacacg ctgtatcttc aaatgaacag cctgagagcc gaggacacgg
ccgtgtatta 660ctgtgcgaga 670272534DNAhomo sapiens; 272agctctggga
gaggagcccc cgccctggga ttcccaggtg ttttcatttg gtgatcagca 60ctgaacacag
aagagtcatg atggagtttg ggctgagctg ggttttcctt gttgctattt
120ttaaaggtga ttcatgagga aatagagata ttgagtgtga gtggacatga
gtgagagaaa 180cagtggattt gtgtggcagt ttctgacctt ggtgtctctg
tgtttgcagg tgtccagtgt 240gaggtgcagc tggtggagtc tggggaaggc
ttggtccagc ctggggggtc cctgagactc 300tcctgtgcag cctctggatt
caccttcagt agctatgcta tgcactgggt ccgccaggct 360ccagggaagg
gactggaata tgtttcagct attagtagta atgggggtag cacatattat
420gcagactctg tgaagggcag attcaccatc tccagagaca attccaagaa
cacgctgtat 480cttcaaatgg gcagcctgag agctgaggac atggctgtgt
attactgtgc gaga 534273528DNAhomo sapiens; 273agctctggga gaggagccca
gcactgggat tccgaggtgt ttccattcag tgatctgcac 60tgaacacaga ggactcgcca
tggagtttgg gctgagctgg gttttccttg ttgctatttt 120aaaaggtgat
tcatggagaa ctagagatat tgagtgtgag tgaacacgag tgagagaaac
180agtggatatg tgtggcagtt tctaaccaat gtctctgtgt ttgcaggtgt
ccagtgtgag 240gtgcagctgg tggagtctgg aggaggcttg atccagcctg
gggggtccct gagactctcc 300tgtgcagcct ctgggttcac cgtcagtagc
aactacatga gctgggtccg ccaggctcca 360gggaaggggc tggagtgggt
ctcagttatt tatagctgtg gtagcacata ctacgcagac 420tccgtgaagg
gccgattcac catctccaga gacaattcca agaacacgct gtatcttcaa
480atgaacagcc tgagagctga ggacacggct gtgtattact gtgcgaga
528274533DNAhomo sapiens; 274aggtctcaga gaggagcctt agccctggac
tccaaggcct ttccacttgg tgatcagcac 60tgagcacaga ggactcacca tggaattggg
gctgagctgg gttttccttg ttgctatttt 120agaaggtgat tcatggaaaa
ctaggaagat tgagtgtgtg tggatatgag tgtgagaaac 180agtggatttg
tgtggcagtt tctgaccttg gtgtctcttt gtttgcaggt gtccagtgtg
240aggtgcagct ggtggagtct gggggaggct tggtccagcc tggggggtcc
ctgagactct 300cctgtgcagc ctctggattc acctttagta gctattggat
gagctgggtc cgccaggctc 360cagggaaggg gctggagtgg gtggccaaca
taaagcaaga tggaagtgag aaatactatg 420tggactctgt gaagggccga
ttcaccatct ccagagacaa cgccaagaac tcactgtatc 480tgcaaatgaa
cagcctgaga gccgaggaca cggctgtgta ttactgtgcg aga 533275540DNAhomo
sapiens; 275agctctgaga gcggagcccc agccccagaa ttcccaggtg ttttcatttg
gtgatcagca 60ctgaacacag aggactcacc atggagtttg ggctgagctg ggttttcctt
gttgttattt 120tacaaggtga tttatggaga actagagatg ttaagtgtga
gtggacgtga gtgagagaaa 180cagtggattt gtgtgacagt ttctgaccag
ggtgtctctg tgtttgcagg tgtccagtgt 240gaggtgcagc tggtggagtc
tgggggaggc ttggtccagc ctggagggtc cctgagactc 300tcctgtgcag
cctctggatt caccttcagt gaccactaca tggactgggt ccgccaggct
360ccagggaagg ggctggagtg ggttggccgt actagaaaca aagctaacag
ttacaccaca 420gaatacgccg cgtctgtgaa aggcagattc accatctcaa
gagatgattc aaagaactca 480ctgtatctgc aaatgaacag cctgaaaacc
gaggacacgg ccgtgtatta ctgtgctaga 540276540DNAhomo sapiens;
276agctctggga gaggagctcc agccttggga ttcccagctg tctccactcg
gtgatcggca 60ctgaatacag gagactcacc atggagtttg ggctgagctg ggttttcctt
gttgctattt 120taaaaggtga ttcatgggga actagagata ctgagtgtga
gtggacatga gtgagagaaa 180cagtggacgt gtgtggcact ttctgaccag
ggtgtctctg tgtttgcagg tgtccagtgt 240gaggtgcagc tggtggagtc
cgggggaggc ttggtccagc ctggggggtc cctgaaactc 300tcctgtgcag
cctctgggtt caccttcagt ggctctgcta tgcactgggt ccgccaggct
360tccgggaaag ggctggagtg ggttggccgt attagaagca aagctaacag
ttacgcgaca 420gcatatgctg cgtcggtgaa aggcaggttc accatctcca
gagatgattc aaagaacacg 480gcgtatctgc aaatgaacag cctgaaaacc
gaggacacgg ccgtgtatta ctgtactaga 540277690DNAhomo sapiens;
277aatttctcaa atcccattgt tgtcacccat cttcctcagg acactttcat
ctgccctggg 60tcctgctctt tcttcaggtg tctcacccca gagcttgata tatagtagga
gacatgcaaa 120tagggccctc actctgctga agaaaaccag ccctgcagct
ctgggagagg agccccagcc 180ctgggattcc cagctgtttc tgcttgctga
tcaggactgc acacagagaa ctcaccatgg 240agtttgggct gagctgggtt
ttccttgttg ctattttaaa aggtgattca tggagaactg 300gagatatgga
gtgtgaatgg acatgagtga gataagcagt ggatgtgtgt ggcagtttct
360gaccagggtg tctctgtgtt tgcaggtgtc cagtgtgagg tgcagctggt
ggagtccggg 420ggaggcttag ttcagcctgg ggggtccctg agactctcct
gtgcagcctc tggattcacc 480ttcagtagct actggatgca ctgggtccgc
caagctccag ggaaggggct ggtgtgggtc 540tcacgtatta atagtgatgg
gagtagcaca agctacgcgg actccgtgaa gggccgattc 600accatctcca
gagacaacgc caagaacacg ctgtatctgc aaatgaacag tctgagagcc
660gaggacacgg ctgtgtatta ctgtgcaaga 690278525DNAhomo sapiens;
278agctctggga gaggagcccc agccctgaga ttcccaggtg tttccattca
gtgatcagca 60ctgaacacag aggactcacc atggagttgg gactgagctg gattttcctt
ttggctattt 120taaaaggtga ttcatggaga aatagagaga ttgagtgtga
gtggacatga gtggatttgt 180gtggcagttt ctgaccttgg tgtctctgtg
tttgcaggtg tccagtgtga agtgcagctg 240gtggagtctg ggggaggctt
ggtacagcct ggcaggtccc tgagactctc ctgtgcagcc 300tctggattca
cctttgatga ttatgccatg cactgggtcc ggcaagctcc agggaagggc
360ctggagtggg tctcaggtat tagttggaat agtggtagca taggctatgc
ggactctgtg 420aagggccgat tcaccatctc cagagacaac gccaagaact
ccctgtatct gcaaatgaac 480agtctgagag ctgaggacac ggccttgtat
tactgtgcaa aagat 525279505DNAhomo sapiens; 279atttccttaa attcagggtc
ctgctcacat gggaaatact ttctgagagt cctggacctc 60ctgtgcaaga acatgaaaca
cctgtggttc ttcctcctgc tggtggcagc tcccagatgt 120gagtgtctca
aggctgcaga catggagata tgggaggtgc ctctgagccc agggctcact
180gtgggtctct ctgttcacag tggtcctgtc ccaggtgcag ctgcaggagt
cgggcccagg 240actggtgaag ccttcggaca ccctgtccct cacctgcgct
gtctctggtt actccatcag 300cagtagtaac tggtggggct ggatccggca
gcccccaggg aagggactgg agtggattgg 360gtacatctat tatagtggga
gcacctacta caacccgtcc ctcaagagtc gagtcaccat 420gtcagtagac
acgtccaaga accagttctc cctgaagctg agctctgtga ccgccgtgga
480cacggccgtg tattactgtg cgaga 505280508DNAhomo sapiens;
280atttccttaa attcagggtc ctgctcacat gggaaatact ttctgagagt
cctggacctc 60ctgtgcaaga acatgaaaca cctgtggttc ttcctcctgc tggtggcagc
tcccagatgt 120gagtgtctca aggctgcaga catggagata tgggaggtgc
ctctgatccc agggctcact 180gtgtgtctct ctgttcacag gggtcctgcc
ccaggtgcag ctgcaggagt cgggcccagg 240actggtgaag ccttcacaga
ccctgtccct cacctgtact gtctctggtg gctccatcag 300cagtggtggt
tactactgga gctggatccg ccagcaccca gggaagggcc tggagtggat
360tgggtacatc tattacagtg ggagcaccta ctacaacccg tccctcaaga
gtcgagttac 420catatcagta gacacgtcta agaaccagtt ctccctgaag
ctgagctctg tgactgccgc 480ggacacggcc gtgtattact gtgcgaga
508281483DNAhomo sapiens; 281cagctcacat gggaagtgct ttctgagagt
catggacctc ctgcacaaga acatgaaaca 60cctgtggttc ttcctcctcc tggtggcagc
tcccagatgt gagtgtctca ggaatgcgga 120tatgaagata tgagatgctg
cctctgatcc cagggctcac tgtgggtttc tctgttcaca 180ggggtcctgt
cccaggtgca gctacagcag tggggcgcag gactgttgaa gccttcggag
240accctgtccc tcacctgcgc tgtctatggt gggtccttca gtggttacta
ctggagctgg 300atccgccagc ccccagggaa ggggctggag tggattgggg
aaatcaatca tagtggaagc 360accaactaca acccgtccct caagagtcga
gtcaccatat cagtagacac gtccaagaac 420cagttctccc tgaagctgag
ctctgtgacc gccgcggaca cggctgtgta ttactgtgcg 480aga 483282508DNAhomo
sapiens; 282atttccttaa attcaggtcc aactcataag ggaaatgctt tctgagagtc
atggatctca 60tgtgcaagaa aatgaagcac ctgtggttct tcctcctgct ggtggcggct
cccagatgtg 120agtgtttcta ggatgcagac atggagatat gggaggctgc
ctctgatccc agggctcact 180gtgggttttt ctgttcacag gggtcctgtc
ccagctgcag ctgcaggagt cgggcccagg 240actggtgaag ccttcggaga
ccctgtccct cacctgcact gtctctggtg gctccatcag 300cagtagtagt
tactactggg gctggatccg ccagccccca gggaaggggc tggagtggat
360tgggagtatc tattatagtg ggagcaccta ctacaacccg tccctcaaga
gtcgagtcac 420catatccgta gacacgtcca agaaccagtt ctccctgaag
ctgagctctg tgaccgccgc 480agacacggct gtgtattact gtgcgaga
508283494DNAhomo sapiens; 283aaattcaggg tccagctcac atgggaaata
ctttctgaga ctcatggacc tcctgcacaa 60gaacatgaaa cacctgtggt tcttcctcct
gctggtggca gctcccagat gtgagtgtct 120caaggctgca gacatgggga
tatgggaggt gcctctgatc ccagggctca ctgtgggtct 180ctctgttcac
aggggtcctg tcccaggtgc agctgcagga gtcgggccca ggactggtga
240agccttcgga gaccctgtcc ctcacctgca ctgtctctgg tggctccatc
agtagttact 300actggagctg gatccggcag cccgccggga agggactgga
gtggattggg cgtatctata 360ccagtgggag caccaactac aacccctccc
tcaagagtcg agtcaccatg tcagtagaca 420cgtccaagaa ccagttctcc
ctgaagctga gctctgtgac cgccgcggac acggccgtgt 480attactgtgc gaga
4942842025DNAhomo sapiens; 284ttttcacctc tccatacaaa ggcaccaccc
acatgcaaat cctcacttaa gcacccacag 60gaaaccacca cacatttcct taaattcagg
ttccagctca catgggaaat actttctgag 120agtcctggac ctcctgtgca
agaacatgaa acatctgtgg ttcttccttc tcctggtggc 180agctcccaga
tgtgagtatc tcagggatcc agacatgggg atatgggagg tgcctctgat
240cccagggctc actgtgggtc tctctgttca caggggtcct gtcccaggtg
cagctgcagg 300agtcgggccc aggactggtg aagccttcgg agaccctgtc
cctcacctgc actgtctctg 360gtggctccat cagtagttac tactggagct
ggatccggca gcccccaggg aagggactgg 420agtggattgg gtatatctat
tacagtggga gcaccaacta caacccctcc ctcaagagtc 480gagtcaccat
atcagtagac acgtccaaga accagttctc cctgaagctg agctctgtga
540ccgctgcgga cacggccgtg tattactgtg cgagagacac agtgagggga
ggtgagtgtg 600agcccagaca aaaacctccg tgcagggagg cggaggggac
cggcgcaggt gctgctcagc 660gccagcaggg ggcgcgcggg gcccacagag
caggaggccc ggtcaggagc aggtgcaggg 720agggcggggc ttcctcatct
gctcagtggt ctccctcctc gccagcacct cagctgtccc 780caggggtcct
ctttctttat tatctgtggt tctgcttcct cacattcttg tgccaagaaa
840gaaatgagga agacaaattt tcgtctgtag ttgaagtttc accaattact
aggaactttc 900ctagaagttc ctgcatggcc cattatagct tacagattaa
atatatatca agcttctcat 960ctcttgattt gtgtcatcaa ctgaattgtg
ccctctttga aattcatatg cagaaacctt 1020aaattcaatt gatgtatatt
ggaattttaa tgaaataatt aaggttaaat gtggtcataa 1080gtgtaagact
ctaattcaac agacgtgtcg tctttataag aagaggaaga gacaccagag
1140acctctcact tttcacgtgc aggcagagaa gaggccatgt ggagacgtaa
tgcactagaa 1200ggtggcccag tgcaagccag gaagaagcct caccaagaac
caaccctgcc agaacattga 1260tcttcaacat tcagactgca gaattttaag
aaaatcaata tttgttgttt aagccaccca 1320ctcctgttgt cttcttatga
agatccagac agactaatac cacataactc tgttagcgct 1380gtcccctgga
tgcagaatca gcccgctggg gctgggcaca tctctcagat ttccacataa
1440agtaggcaaa aaatagtagt tctgatataa aaatttgtca tgtccctgtt
ggccaatttc 1500tgggcaaggt cttttaaaga agccctgggg gctttgtcac
aaaagttgcc ttttatcatt 1560tattaggaca taactgatga acaatgagta
ccagttggat ggagactgac cactgaccat 1620cttctgctgt ctcctaagta
tgccacagaa aaccacacca acattactct atgtcttcaa 1680ctttctaaat
ttgcactgat tggtatttaa ggcaggccca gcgttgaata actcctttag
1740tttttgcttc tctgggaaag gtcttatcta tcctggcctt ggtcttcaag
tttcagcaat 1800tctgggaagc caaggacgcc tctatctcct cctccatgct
ctgcaactca cctgagaaca 1860gctttctcat tggaatgtct tctgtttaag
gaataagagt ccctgtttca ggcttgggtg 1920cctgagtaca cctactggat
ccagcccagg attggagaaa ctttccagaa cacatcacct 1980gagaaatgac
cagtcacact gttacacttt cacaatttcc gcttc 2025285537DNAhomo sapiens;
285acttaagcac ccacaggaaa ccaccacaca tttccttaaa ttcaggttcc
agctcacatg 60ggaaatactt tctgagagtc ctggacctcc tgtgcaagaa catgaaacac
ctgtggttct 120tcctcctcct ggtggcagct cccagatgtg agtgtctcag
ggatccagac atgggggtat 180gggaggtgcc tctgatccca gggctcactg
tgggtctctc tgttcacagg ggtcctgtcc 240caggtgcagc tgcaggagtc
gggcccagga ctggtgaagc cttcggagac cctgtccctc 300acctgcactg
tctctggtgg ctccgtcagc agtggtggtt actactggag ctggatccgg
360cagcccccag ggaagggact ggagtggatt gggtatatct attacagtgg
gagcaccaac 420tacaacccct ccctcaagag tcgagtcacc atatcagtag
acacgtccaa gaaccagttc 480tccctgaagc tgagctctgt gaccgctgcg
gacacggccg tgtattactg tgcgaga 537286493DNAhomo sapiens;
286tgagtctccc tcactgccca gctgggatct cagggcttca ttttctgtcc
tccaccatca 60tggggtcaac cgccatcctc gccctcctcc tggctgttct ccaaggtcag
tcctgccgag 120ggcttgaggt cacagaggag aacgggtgga aaggagcccc
tgattcaaat tttgtgtctc 180ccccacagga gtctgtgccg aggtgcagct
ggtgcagtct ggagcagagg tgaaaaagcc 240cggggagtct ctgaagatct
cctgtaaggg ttctggatac agctttacca gctactggat 300cggctgggtg
cgccagatgc ccgggaaagg cctggagtgg atggggatca tctatcctgg
360tgactctgat accagataca gcccgtcctt ccaaggccag gtcaccatct
cagccgacaa 420gtccatcagc accgcctacc tgcagtggag cagcctgaag
gcctcggaca ccgccatgta 480ttactgtgcg aga 493287498DNAhomo sapiens;
287gcagagcctg ctgaattctg gctgaccagg gcagtcacca gagctccaga
caatgtctgt 60ctccttcctc atcttcctgc ccgtgctggg cctcccatgg ggtcagtgtc
agggagatgc 120cgtattcaca gcagcattca cagactgagg ggtgtttcac
tttgctgttt ccttttgtct 180ccaggtgtcc tgtcacaggt acagctgcag
cagtcaggtc caggactggt gaagccctcg 240cagaccctct cactcacctg
tgccatctcc ggggacagtg tctctagcaa cagtgctgct 300tggaactgga
tcaggcagtc cccatcgaga ggccttgagt ggctgggaag gacatactac
360aggtccaagt ggtataatga ttatgcagta tctgtgaaaa gtcgaataac
catcaaccca 420gacacatcca agaaccagtt ctccctgcag ctgaactctg
tgactcccga ggacacggct 480gtgtattact gtgcaaga 498288489DNAhomo
sapiens; 288acccaacaac aacatccctc cttgggagaa tcccctagag cacagctcct
caccatggac 60tggacctgga gcatcctctt cttggtggca gcagcaacag gtaaggggct
ccccagtctc 120ggggttgagg cagaaaccag gccactcaag tgaggcttta
cccacccctg tgtcctctcc 180acaggtacct actcccaggt gcagctggtg
cagtctggcc atgaggtgaa gcagcctggg 240gcctcagtga aggtctcctg
caaggcttct ggttacagtt tcaccaccta tggtatgaat 300tgggtgccac
aggcccctgg acaagggctt gagtggatgg gatggttcaa cacctacact
360gggaacccaa catatgccca gggcttcaca ggacggtttg tcttctccat
ggacacctct 420gccagcacag catacctgca gatcagcagc ctaaaggctg
aggacatggc catgtattac 480tgtgcgaga 48928938DNAhomo sapiens;
289gtacactttt ggccagggga ccaagctgga gatcaaac 3829038DNAhomo
sapiens; 290attcactttc ggccctggga ccaaagtgga tatcaaac
3829137DNAhomo sapiens; 291ctcactttcg gcggagggac caaggtggag atcaaac
3729238DNAhomo sapiens; 292gatcaccttc ggccaaggga cacgactgga
gattaaac 38293503DNAhomo sapiens; 293aggaatcaga cccagtcagg
acacagcatg gacatgagag tcctcgctca gctcctgggg 60ctcctgctgc tctgtttccc
aggtaaggat ggagaacact agcagtttac tcagcccagg 120gtgctcagta
ctgctttact attcagggaa attctcttac aacatgatta attgtgtgga
180catttgtttt tatgtttcca atctcaggtg ccagatgtga catccagatg
acccagtctc 240catcctcact gtctgcatct gtaggagaca gagtcaccat
cacttgtcgg gcgagtcagg 300gcattagcaa ttatttagcc tggtttcagc
agaaaccagg gaaagcccct aagtccctga 360tctatgctgc atccagtttg
caaagtgggg tcccatcaaa gttcagcggc agtggatctg 420ggacagattt
cactctcacc atcagcagcc tgcagcctga agattttgca acttattact
480gccaacagta taatagttac cct 503294503DNAhomo sapiens;
294aggaatcagt cccactcagg acacagcatg gacatgaggg tccccgctca
gctcctgggg 60ctcctgctgc tctggttccc aggtaaggat ggagaacact agcagtttac
tcagcccaga 120gtgctcagta ctgctttact gttcagggaa attctcttac
aacatgatta attgtgtgga 180catttgtttt tatgtttcca atctcaggtg
ccaggtgtga catccagatg acccagtctc 240catcctccct gtctgcatct
gtaggagaca gagtcaccat cacttgccgg gcaagtcagg 300gcattagaaa
tgatttaggc tggtatcagc agaaaccagg gaaagcccct aagcgcctga
360tctatgctgc atccagtttg caaagtgggg tcccatcaag gttcagcggc
agtggatctg 420ggacagaatt cactctcaca atcagcagcc tgcagcctga
agattttgca acttattact 480gtctacagca taatagttac cct 503295657DNAhomo
sapiens; 295gggacacctg gggacactga gctggtgctg agttactgag atgagccagc
tctgcagctg 60tgcccagcct gccccatccc ctgctcattt gcatgttccc agagcacaac
ctcctgccct 120gaagccttat taataggctg gtcacacttt gtgcaggagt
cagacccagt caggacacag 180catggacatg agggtccccg ctcagctcct
ggggctcctg ctgctctggc tcccaggtaa 240ggaaggagaa cactaggaat
ttactcagcc cagtgtgctc agtactgcct ggttattcag 300ggaagtcttc
ctataatatg atcaatagta tgaatatttg tgtttctatt tccaatctca
360ggtgccaaat gtgacatcca gatgacccag tctccttcca ccctgtctgc
atctgtagga 420gacagagtca ccatcacttg ccgggccagt cagagtatta
gtagctggtt ggcctggtat 480cagcagaaac cagggaaagc ccctaagctc
ctgatctata aggcgtctag tttagaaagt 540ggggtcccat caaggttcag
cggcagtgga tctgggacag aattcactct caccatcagc 600agcctgcagc
ctgatgattt tgcaacttat tactgccaac agtataatag ttattct
657296506DNAhomo sapiens; 296gcaggagtca gacccactca ggacacagca
tggacatgag ggtccccgct cagctcctgg 60ggctcctgct gctctggctc ccaggtaagg
atggagaaca ctggcagttt actcagccca 120gggtgctcag cacagcctgg
ctattcaggg aaattctctt actacatgat taattgtgtg 180gaccatttgt
ttttgtgttt ccaatctcag gtgccagatg tgccatccag atgacccagt
240ctccatcctc cctgtctgca tctgtaggag acagagtcac catcacttgc
cgggcaagtc 300agggcattag aaatgattta ggctggtatc agcagaaacc
agggaaagcc cctaagctcc 360tgatctatgc tgcatccagt ttacaaagtg
gggtcccatc aaggttcagc ggcagtggat 420ctggcacaga tttcactctc
accatcagca gcctgcagcc tgaagatttt gcaacttatt 480actgtctaca
agattacaat taccct 506297523DNAhomo sapiens; 297aggctggaca
cacttcatgc aggagtcaga ccctgtcagg acacagcata gacatgaggg 60tccccgctca
gctcctgggg ctcctgctgc tctggctccc aggtaaggaa ggagaacact
120aggaatttac tcagcccagt gtgcttggta cagcctggcc cttcagggaa
gttctcttac 180aacatgatta attgtatgga catttgtttt tatgtttcca
atctcaggtg ccagatgtgc 240catccggatg acccagtctc catcctcatt
ctctgcatct acaggagaca gagtcaccat 300cacttgtcgg gcgagtcagg
gtattagcag ttatttagcc tggtatcagc aaaaaccagg 360gaaagcccct
aagctcctga tctatgctgc atccactttg caaagtgggg tcccatcaag
420gttcagcggc agtggatctg ggacagattt cactctcacc atcagctgcc
tgcagtctga 480agattttgca acttattact gtcaacagta ttatagttac cct
523298534DNAhomo sapiens; 298agacttctta ataggctggt cacacctgtg
caggagtcag tcccagtcag gacacagcat
60ggacatgagg gtccccgctc agctcctggg gctcctgctg ctctggctcc caggtaagga
120aggagaacac taggaattta ctcagcccag tgtgttccgt acagcctggc
tcttgaggga 180agttctctta caacatgatt aattctatgg acatttgtgt
ttatatttcc aatctcaggt 240gccagatgtg acatccagtt gacccagtct
ccatccttcc tgtctgcatc tgtaggagac 300agagtcacca tcacttgccg
ggccagtcag ggcattagca gttatttagc ctggtatcag 360caaaaaccag
ggaaagcccc taagctcctg atctatgctg catccacttt gcaaagtggg
420gtcccatcaa ggttcagcgg cagtggatct gggacagaat tcactctcac
aatcagcagc 480ctgcagcctg aagattttgc aacttattac tgtcaacagc
ttaatagtta ccct 534299656DNAhomo sapiens; 299gggacacctg gggacactga
gctggtgctg agttactgag atgagccagc cctgcagctg 60cgcccagcct gccccatccc
ctgctcattt gcatgttccc agagcacagt ctcctgacct 120gaagacttat
taacaggctg atcacaccct gtgcaggagt cagacccagt caggacacag
180catggacatg agggtccccg ctcagctcct ggggctcctg ctgctctggt
tcccaggtaa 240gaaaggagaa cactaggatt atactcggtc agtgtgctga
gtactgcttt actattcagg 300gaacttctct tacagcatga ttaattgtgt
ggacatttgt ttttatgttt ccaatctcag 360gttccagatg cgacatccag
atgacccagt ctccatcttc tgtgtctgca tctgtaggag 420acagagtcac
catcacttgt cgggcgagtc agggtattag cagctggtta gcctggtatc
480agcagaaacc agggaaagcc cctaagctcc tgatctatgc tgcatccagt
ttgcaaagtg 540gggtcccatc aaggttcagc ggcagtggat ctgggacaga
tttcactctc actatcagca 600gcctgcagcc tgaagatttt gcaacttact
attgtcaaca ggctaacagt ttccct 656300503DNAhomo sapiens;
300aggaatcaga cccagtcagg acacagcatg gacatgaggg tcctcgctca
gctcctgggg 60ctcctgctgc tctgtttccc aggtaaggat ggagaacact agcagtttac
tcagcccagg 120gtgctcagta ctgctttact attcagggaa attctcttac
aacatgatta attgtgtgga 180catttgtttt tatgtttcca atctcaggtg
ccagatgtga catccagatg acccagtctc 240catcctcact gtctgcatct
gtaggagaca gagtcaccat cacttgtcgg gcgagtcagg 300gtattagcag
ctggttagcc tggtatcagc agaaaccaga gaaagcccct aagtccctga
360tctatgctgc atccagtttg caaagtgggg tcccatcaag gttcagcggc
agtggatctg 420ggacagattt cactctcacc atcagcagcc tgcagcctga
agattttgca acttattact 480gccaacagta taatagttac cct 503301657DNAhomo
sapiens; 301gggacacctg gggacactga gctgctgctg agttactgag atgagccagc
cctgcagctg 60cgcccagcct gccccatccc ctgctcattt gcatgttccc agagcatagc
ctcctgccct 120gaagccttat taataggctg gacacacttc atggaggaat
cagtcccact caggacacag 180catggacatg agggtccctg ctcagctcct
ggggctcctg ctgctctggt tcccaggtaa 240ggatggagaa cactaacagt
ttactcagcc cagagtgctc agtactgctt tactgttcag 300ggaaattctc
ttacaacatg attaattgtg tggacatttg tttttatgtt tccaatctca
360ggtgccagat gtaacatcca gatgacccag tctccatctg ccatgtctgc
atctgtagga 420gacagagtca ccatcacttg tcgggcgagg cagggcatta
gcaattattt agcctggttt 480cagcagaaac cagggaaagt ccctaagcac
ctgatctatg ctgcatccag tttgcaaagt 540ggggtcccat caaggttcag
cggcagtgga tctgggacag aattcactct cacaatcagc 600agcctgcagc
ctgaagattt tgcaacttat tactgtctac agcataatag ttaccct
657302487DNAhomo sapiens; 302agtcccagtc aggacacagc atggacatga
gggtccccgc tcagctcctg gggctcctgc 60tgctctggct cccaggtaag gaaggagaac
actaggaatt ttcttagccc actgtgctct 120ggcacttctg ggaagttctc
ttataccatg attcatggtg tggatatttg tttttatgtt 180tccaatctca
ggtgtcagat ttgacatcca gatgatccag tctccatctt tcctgtctgc
240atctgtagga gacagagtca gtatcatttg ctgggcaagt gagggcatta
gcagtaattt 300agcctggtat ctgcagaaac cagggaaatc ccctaagctc
ttcctctatg atgcaaaaga 360tttgcaccct ggggtctcat cgaggttcag
tggcagggga tctgggacgg atttcactct 420caccatcatc agcctgaagc
ctgaagattt tgcagcttat tactgtaaac aggacttcag 480ttaccct
487303657DNAhomo sapiens; 303gggacacctg gggacactga gctggtgctg
agttactgag atgaaccagc cctgcagctg 60tgcccagcct gccttgcccc ctgctaattt
gcatgttccc agagcacatc ctcctaccct 120gaagacttat taatgcgctg
gtcacacttc atgcaggagt cagacccagt caggacacag 180catggacatg
agggtgcccg ctcagcgcct ggggctcctg ctgctctggt tcccaggtaa
240ggaaggagaa ccctagcagt ttactcagcc cagtgtgttc cgtacagcct
ggctcttgag 300ggaagttctc ttacaacatg attaattgta tggacatttg
tgtttatatt tccaatctca 360ggtgccagat gtgccatccg gatgacccag
tctccattct ccctgtctgc atctgtagga 420gacagagtca ccatcacttg
ctgggccagt cagggcatta gcagttattt agcctggtat 480cagcaaaaac
cagcaaaagc ccctaagctc ttcatctatt atgcatccag tttgcaaagt
540ggggtcccat caaggttcag cggcagtgga tctgggacgg attacactct
caccatcagc 600agcctgcagc ctgaagattt tgcaacttat tactgtcaac
agtattatag tacccct 657304656DNAhomo sapiens; 304gggacacctg
gggacactga gctggtgctg agttactgag atgagccagc tctgcagctg 60tgcccagtca
gccccatccc ctgctcattt gcatgttccc agagcacaac ctcctgcact
120gaagccttat taataggctg gccacacttc atgcaggagt cagacccagt
caggacacag 180catggacatg agggtccccg ctcagctcct ggggctcctg
ctgctctggc tcccaggtaa 240ggaaggagaa cactatgaat ttactcagcc
aatgtgctca gtacagcctg gcccttcagg 300gaaattctct tactacatga
ttaattgtat ggatatttgt ttttatgttt ccaatctcag 360gtgccagatg
tgtcatctgg atgacccagt ctccatcctt actctctgca tctacaggag
420acagagtcac catcagttgt cggatgagtc agggcattag cagttattta
gcctggtatc 480agcaaaaacc agggaaagcc cctgagctcc tgatctatgc
tgcatccact ttgcaaagtg 540gggtcccatc aaggttcagt ggcagtggat
ctgggacaga tttcactctc accatcagtt 600gcctgcagtc tgaagatttt
gcaacttatt actgtcaaca gtattatagt ttccct 656305833DNAhomo sapiens;
305aattaggact cctcaggtca ccttctcaca atgaggctcc ttgctcagct
tctggggctg 60ctaatgctct gggtccctgg tgaggacaga agagagatga gggaggagaa
tggggtggga 120gggtgaactc tgggggcccc attgcctccc atgtgtgttc
tgtcctcatg ttagatgtgt 180acgtcttgta ctccaggatg gggcttgtaa
cttttatatc tgcgtgagta aggcatgtga 240ggtttagatc tgtaagaatg
aggaagattc cagaaggaac aaagaccagt gctccggtga 300agactctaac
agagaaagag ggaatggtag aggaaacttc tagcactcaa agcactctgc
360tgtgctttga aaatatgttt ttattttgaa attatatatt actagggtct
gaatcaaatt 420ataaaaattg atttagcctg aaataaataa cagaagaaaa
attattttaa aattgtgctt 480aaagtttcta cataaccttg cacttctctc
tcattatttc aggatccagt ggggatattg 540tgatgaccca gactccactc
tcctcacctg tcacccttgg acagccggcc tccatctcct 600gcaggtctag
tcaaagcctc gtacacagtg atggaaacac ctacttgagt tggcttcagc
660agaggccagg ccagcctcca agactcctaa tttataagat ttctaaccgg
ttctctgggg 720tcccagacag attcagtggc agtggggcag ggacagattt
cacactgaaa atcagcaggg 780tggaagctga ggatgtcggg gtttattact
gcatgcaagc tacacaattt cct 833306816DNAhomo sapiens; 306gatcaggact
cctcagttca ccttctcaca atgaggctcc ctgctcagct cctggggctg 60ctaatgctct
gggtcccagg taagggtaga agggagatga gggaggagaa tggcatggaa
120cggtgagttc tggggcccca ctgcctctaa caacagtgat ctctgggggt
ctcactacac 180tcctatgtgt gttcctttcc tgtattggac atgcacatgt
tgtcctccag agtggggcat 240gtgatgatca gatctgtgag agtgaggaag
attcaagcag aaacaaggat ctgtgctctg 300gggaagactg acacagaaag
gggatggtgt ggggtcttct ggagacccct ttgagccttg 360gatcccttga
gttccatttt gaaactgtgt atttttgaaa tatgaacaaa tacatatata
420gcctgaaata aacaacaaat caaaatttat gaaaattaca cataaacttt
atacataacc 480ttgctcttct ttctatttat ttcaggatcc agtggggatg
ttgtgatgac tcagtctcca 540ctctccctgc ccgtcaccct tggacagccg
gcctccatct cctgcaggtc tagtcaaagc 600ctcgtataca gtgatggaaa
cacctacttg aattggtttc agcagaggcc aggccaatct 660ccaaggcgcc
taatttataa ggtttctaac cgggactctg gggtcccaga cagattcagc
720ggcagtgggt caggcactga tttcacactg aaaatcagca gggtggaggc
tgaggatgtt 780ggggtttatt actgcatgca aggtacacac tggcct
816307833DNAhomo sapiens; 307aattaggact cctcaggtca ccttctcaca
atgaggctcc ttgctcagct tctggggctg 60ctaatgctct gggtccctgg tgaggacaga
agagagatga gggaggagaa tggggtggga 120gggtgaactc tgggggcccc
attgcctccc atgtgtgttc tgtcctcatg ttagatgtgt 180acgtcttgta
ctccaggatg gggcttgtaa cttttatatc tgcgtgagta aggcatgtga
240ggtttagatc tgtaagaatg aggaagattc cagaaggaac aaagaccagt
gctccggtga 300agactctaac agagaaagag ggaatggtag aggaaacttc
tagcactcaa agcactctgc 360tgtgctttga aaatatgttt ttattttgaa
attatatatt actagggtct gaatcaaatt 420ataaaaattg atttagcctg
aaataaataa cagaagaaaa attattttaa aattgtgctt 480aaagtttcta
cataaccttg cacttctctc tcattatttc aggatccagt ggggatattg
540tgatgaccca gactccactc tcctcgcctg tcacccttgg acagccggcc
tccatctcct 600tcaggtctag tcaaagcctc gtacacagtg atggaaacac
ctacttgagt tggcttcagc 660agaggccagg ccagcctcca agactcctaa
tttataaggt ttctaaccgg ttctctgggg 720tcccagacag attcagtggc
agtggggcag ggacagattt cacactgaaa atcagcaggg 780tggaagctga
ggatgtcggg gtttattact gcacgcaagc tacacaattt cct 833308781DNAhomo
sapiens; 308gatcaggact cctcagttca ccttctcact atgaggctcc ctgctcagct
cttggggctg 60ctaatgctct gggtccctgg taaggacaga aggagatgag ggaggagaat
ggggtgggaa 120ggtaagcctg gggaccccac tgccttccat gtgtgttctg
ccctgcccat gtgttagatg 180tacaggtctt gttctccagg atggggaatg
tgaggtttaa atctgtgaga gtgaggacga 240ttcaaaaaga agcaaggacc
tgtgtgctct ggtgaatatc gtcacacaga gaaagggagg 300tggtgtaggt
gacttctaga atcccctttg cagcttgcaa atttggaata tgtttagtgt
360ataaatacaa acaacaaaaa attatatagc ctgaaataaa aaatgaaaat
ttatgataaa 420tgacacatga tatttgtaca tatccttcca cttctttcta
tctattttag gatccagtgc 480agagattgtg atgacccaga ctccactctc
cttgtctatc acccctggag agcaggcctc 540catgtcctgc aggtctagtc
agagcctcct gcatagtgat ggatacacct atttgtattg 600gtttctgcag
aaagccaggc cagtctccac gctcctgatc tatgaagttt ccaaccggtt
660ctctggagtg ccagataggt tcagtggcag cgggtcaggg acagatttca
cactgaaaat 720cagccgggtg gaggctgagg attttggagt ttattactgc
atgcaagatg cacaagatcc 780t 781309758DNAhomo sapiens; 309gatcaggact
tctcagttca tcttctcacc atgaggctcc ctgctcagct cctggggctg 60ctaatgctct
ggatacctgg taaggatgga aggagatgag ggaggaggag ggggtgggaa
120gctgagctct ggcggcccca ctgattcccg tgtttattct aaccatgtgt
taaaggaata 180tggcctatgc tccagggaga ggaattcata ttttgccctg
atgatgattt gaaaactcct 240aaaagcagtg ctctgaataa tatcttgaga
aatgaaagaa ctcttgtgcc tatttaataa 300agggttcatt taaagagttt
gtttttatga tatgaataca aatttgtaaa aataaaagat 360tagccataaa
tcaataccat aaggcaaatc tcaaaagttg ttcattatgc tttcacataa
420ccttgcactt ctctctcata atttcaggat ccagtgcaga tattgtgatg
acccagactc 480cactctctct gtccgtcacc cctggacagc cggcctccat
ctcctgcaag tctagtcaga 540gcctcctgca tagtgatgga aagacctatt
tgtattggta cctgcagaag ccaggccagc 600ctccacagct cctgatctat
gaagtttcca accggttctc tggagtgcca gataggttca 660gtggcagcgg
gtcagggaca gatttcacac tgaaaatcag ccgggtggag gctgaggatg
720ttggggttta ttactgcatg caaagtatac agcttcct 758310821DNAhomo
sapiens; 310tgactgatca ggactcctca gttcaccttc tcacaatgag gctccctgct
cagctcctgg 60ggctgctaat gctctgggtc ccaggtaagg gtagaaggga gatgagggag
gagaatggca 120tggaacggtg agttctgggg ccccactgcc tctaacaaca
gtgatctctg ggggtctcac 180tacactccta tgtgtgttcc tttcctgtat
tggacatgca catgttgtcc tccagaatgg 240ggcatgtgat gatcagatct
gtgagagtca ggaagattca agaagaaaca aggatctgtg 300ctctggggaa
gactgacaca gaaaggggat ggtgtggggt cttctggaga cccctttgag
360ccttggatcc cttgagttcc attttgaaac tgtatatttt tgaaatatga
acaaatacat 420atatagcctg agataaacaa caaatcaaaa tttatgaaaa
ttacacataa actttataca 480taaccttgct cttctttcta tttatttcag
gatccagtgg ggatgttgtg atgactcagt 540ctccactctc cctgcccgtc
acccttggac agccggcctc catctcctgc aggtctagtc 600aaagcctcgt
atacagtgat ggaaacacct acttgaattg gtttcagcag aggccaggcc
660aatctccaag gcgcctaatt tataaggttt ctaactggga ctctggggtc
ccagacagat 720tcagcggcag tgggtcaggc actgatttca cactgaaaat
cagcagggtg gaggctgagg 780atgttggggt ttattactgc atgcaaggta
cacactggcc t 821311561DNAhomo sapiens; 311gtcagagccc tggggaggaa
ctgctcagtt aggacccaga gggaaccatg gaagccccag 60ctcagcttct cttcctcctg
ctactctggc tcccaggtga ggggaacatg aggtggtttt 120gcacattagt
gaaaactctt gccacctctg ctcagcaaga aatataatta aaattcaaag
180tatatcaaca attttggctc tactcaaaga cagttggttt gatcttgatt
acatgagtgc 240atttctgttt tatttccaat ttcagatacc accggagaaa
ttgtgttgac acagtctcca 300gccaccctgt ctttgtctcc aggggaaaga
gccaccctct cctgcagggc cagtcagagt 360gttagcagct acttagcctg
gtaccaacag aaacctggcc aggctcccag gctcctcatc 420tatgatgcat
ccaacagggc cactggcatc ccagccaggt tcagtggcag tgggtctggg
480acagacttca ctctcaccat cagcagccta gagcctgaag attttgcagt
ttattactgt 540cagcagcgta gcaactggcc t 561312587DNAhomo sapiens;
312cctgggtcag agctctggag aagagctgct cagttaggac ccagagggaa
ccatggaaac 60cccagcgcag cttctcttcc tcctgctact ctggctccca ggtgagggga
acatgggatg 120gttttgcatg tcagtgaaaa ccctctcaag tcctgttacc
tggcaactct gctcagtcaa 180tacaataatt aaagctcaat ataaagcaat
aattctggct cttctgggaa gacaatgggt 240ttgatttaga ttacatgggt
gacttttctg ttttatttcc aatctcagat accaccggag 300aaattgtgtt
gacgcagtct ccaggcaccc tgtctttgtc tccaggggaa agagccaccc
360tctcctgcag ggccagtcag agtgttagca gcagctactt agcctggtac
cagcagaaac 420ctggccaggc tcccaggctc ctcatctatg gtgcatccag
cagggccact ggcatcccag 480acaggttcag tggcagtggg tctgggacag
acttcactct caccatcagc agactggagc 540ctgaagattt tgcagtgtat
tactgtcagc agtatggtag ctcacct 587313614DNAhomo sapiens;
313gcatgtccct cccagctgcc ctaccttcca gagcccatat caatgcctgg
gtcagagccc 60tgggaaggaa ctgctcagtt aggacccaga cggaaccatg gaagccccag
ctcagcttct 120cttcctcctg ctactctggc tcccaggtga ggggaacatg
aggtggtttt gcacatcagt 180gaaaactcct gccacctctg ctcagcaaga
aatataatta aaattcaatg tagatcaaca 240attttggctc tactcaaaga
cagctggttt gatctagatt acatgagtgc atttctgttt 300tatttccaat
cttggatacc accagagaaa ttgtaatgac acagtctcca cccaccctgt
360ctttgtctcc aggggaaaga gtcaccctct cctgcagggc cagtcagagt
gttagcagca 420gctacttaac ctggtatcag cagaaacctg gccaggcgcc
caggctcctc atctatggtg 480catccaccag ggccactagc atcccagcca
ggttcagtgg cagtgggtct gggacagact 540tcactctcac catcagcagc
ctgcagcctg aagattttgc agtttattac tgtcagcagg 600attataactt acct
614314611DNAhomo sapiens; 314gcatgtccct cccagctgcc ctaccttcca
gagcccatat caatgcctgg gtcagagctc 60tggggaggaa ctgctcagtt aggacccaga
cggaaccatg gaagccccag cgcagcttct 120cttcctcctg ctactctggc
tcccaggtga ggggaatatg aggtgtcttt gcacatcagt 180gaaaactcct
gccacctctg ctcagcaaga aatataatta aaattcaaaa tagatcaaca
240attttggctc tactcaaaga cagtgggttt gattttgatt acatgagtgc
atttctgttt 300tatttccaat ttcagatacc accggagaaa ttgtgttgac
acagtctcca gccaccctgt 360ctttgtctcc aggggaaaga gccaccctct
cctgcagggc cagtcagggt gttagcagct 420acttagcctg gtaccagcag
aaacctggcc aggctcccag gctcctcatc tatgatgcat 480ccaacagggc
cactggcatc ccagccaggt tcagtggcag tgggcctggg acagacttca
540ctctcaccat cagcagccta gagcctgaag attttgcagt ttattactgt
cagcagcgta 600gcaactggca t 611315563DNAhomo sapiens; 315gggtcagagc
tctggggagg aactgctcag ttaggaccca gacggaacca tggaagcccc 60agcgcagctt
ctcttcctcc tgctactctg gctcccaggt gaggggaata tgaggtggtt
120ttgcacatca gtgaaaactc ctgccacctc tgctcagcaa gaaatataat
taaaattcaa 180tgtagatcaa caattttggc tctacttaaa gacagtgggt
ttgattttga ttacatgagt 240gcatttctgt tttatttcca atttcagata
ccactggaga aatagtgatg acgcagtctc 300cagccaccct gtctgtgtct
ccaggggaaa gagccaccct ctcctgcagg gccagtcaga 360gtgttagcag
caacttagcc tggtaccagc agaaacctgg ccaggctccc aggctcctca
420tctatggtgc atccaccagg gccactggca tcccagccag gttcagtggc
agtgggtctg 480ggacagagtt cactctcacc atcagcagcc tgcagtctga
agattttgca gtttattact 540gtcagcagta taataactgg cct 563316632DNAhomo
sapiens; 316gcatgtccct cccagccgcc ctgcagtcca gagcccatat caatgcctgg
gtcagagctc 60tggggaggaa ctgctcagtt aggacccaga gggaaccatg gaaaccccag
cgcagcttct 120cttcctcctg ctactctggc tcccaggtga ggggaacatg
ggatggtttt gcatgtcagt 180gaaaaccctc tcaagtcctg ttacctggca
actctgctga atcaatacaa taattaaagc 240tcaatataaa gcaataattc
tggctcttct gggaagacag tgggtttgat ttagattaca 300tgggtgactt
ttctatttta tttccaatct cagataccac cggagaaatt gtgttgacgc
360agtctccagc caccctgtct ttgtctccag gggaaagagc caccctctcc
tgcggggcca 420gtcagagtgt tagcagcagc tacttagcct ggtaccagca
gaaacctggc ctggcgccca 480ggctcctcat ctatgatgca tccagcaggg
ccactggcat cccagacagg ttcagtggca 540gtgggtctgg gacagacttc
actctcacca tcagcagact ggagcctgaa gattttgcag 600tgtattactg
tcagcagtat ggtagctcac ct 632317757DNAhomo sapiens; 317tttggctctt
gatttacatt gggtactttc acaacccact gctcatgaaa tttgcttttg 60tactcactgg
ttgtttttgc ataggcccct ccaggccacg accagctgtt tggattttat
120aaacgggccg tttgcattgt gaactgagct acaacaggca ggcaggggca
gcaagatggt 180gttgcagacc caggtcttca tttctctgtt gctctggatc
tctggtgagg aattaaaaag 240tgccacagtc ttttcagagt aatatctgtg
tagaaataaa aaaaattaag atatagttgg 300aaataatgac tatttccaat
atggatccaa ttatctgctg acttataata ctactagaaa 360gcaaatttaa
atgacatatt tcaattatat ctgagacagc gtgtataagt ttatgtataa
420tcattgtcca ttactgacta caggtgccta cggggacatc gtgatgaccc
agtctccaga 480ctccctggct gtgtctctgg gcgagagggc caccatcaac
tgcaagtcca gccagagtgt 540tttatacagc tccaacaata agaactactt
agcttggtac cagcagaaac caggacagcc 600tcctaagctg ctcatttact
gggcatctac ccgggaatcc ggggtccctg accgattcag 660tggcagcggg
tctgggacag atttcactct caccatcagc agcctgcagg ctgaagatgt
720ggcagtttat tactgtcagc aatattatag tactcct 757318553DNAhomo
sapiens; 318ataaaatctg tgctgtcaaa ctgattagga actgactacc acctgcaggt
cagggccaag 60gttatggggt cccaggttca cctcctcagc ttcctcctcc tttggatctc
tggtaagaga 120aacacttcct ctcctctgtg ccaccaagtc ccctgcatat
ccacaaaaat aatatatttt 180cataaggaat tgattttcct cattctctgc
aaatatgatg catttgattt atgtttttta 240ctttgctcca taatcagata
ccagggcaga aacgacactc acgcagtctc cagcattcat 300gtcagcgact
ccaggagaca aagtcaacat ctcctgcaaa gccagccaag acattgatga
360tgatatgaac tggtaccaac agaaaccagg agaagctgct attttcatta
ttcaagaagc 420tactactctc gttcctggaa tcccacctcg attcagtggc
agcgggtatg gaacagattt 480taccctcaca attaataaca tagaatctga
ggatgctgca tattacttct gtctacaaca 540tgataatttc cct 553319616DNAhomo
sapiens; 319atcttaaaag aggttctttc tctgggatgt ggcatgagca aaactgacaa
gtcaaggcag 60gaagatgttg ccatcacaac tcattgggtt tctgctgctc tgggttccag
gtgagaatat 120ttccacaaac ctaggcggag atattctttc aatctgtaat
ttctttcatt ggggactctg 180caataggtga tttttggctt gattttaaaa
tcctaatttt aaaaatgtaa tgcatattct
240ttcttcatgt ctagcaagat taaaggtgat tttcatacac agatatttat
gttgtactga 300tgtttgctgt atattttcag cctccagggg tgaaattgtg
ctgactcagt ctccagactt 360tcagtctgtg actccaaagg agaaagtcac
catcacctgc cgggccagtc agagcattgg 420tagtagctta cactggtacc
agcagaaacc agatcagtct ccaaagctcc tcatcaagta 480tgcttcccag
tccttctcag gggtcccctc gaggttcagt ggcagtggat ctgggacaga
540tttcaccctc accatcaata gcctggaagc tgaagatgct gcaacgtatt
actgtcatca 600gagtagtagt ttacct 616320619DNAhomo sapiens;
320ggtatcttaa aagaggttct ttctctggga tgtggcatga gcaaaactga
caagtcaagg 60caggaagatg tcgccatcac aactcattgg gtttctgctg ctctgggttc
caggtgagaa 120tatttccaca aacctaggcg gagatattct ttcaatctgt
aatttctttc attggggact 180ctgcaatagg tgatttttgg cttgatttta
aaatcctaat tttaaaaatg taatgcatat 240tctttcttca tgtctagcaa
gattaaaggt gattttcata cacagatatt tatgttgtac 300tgatgtttgc
tgtatatttt cagcctccag gggtgaaatt gtgctgactc agtctccaga
360ctttcagtct gtgactccaa aggagaaagt caccatcacc tgccgggcca
gtcagagcat 420tggtagtagc ttacactggt accagcagaa accagatcag
tctccaaagc tcctcatcaa 480gtatgcttcc cagtccatct caggggtccc
ctcgaggttc agtggcagtg gatctgggac 540agatttcacc ctcaccatca
atagcctgga agctgaagat gctgcagcgt attactgtca 600tcagagtagt agtttacct
619321577DNAhomo sapiens; 321agcaaaactg aagtcaaaac actgagatgg
tgtccccgtt gcaattcctg cggcttctgc 60tcctctgggt tccaggtgag aatatttaga
aaaagctaaa actaattctt tgaaccatta 120attttcttaa ttaggaacct
ggcaccatat ggaacttggc ttgtttttaa atgtgatttt 180tttttaagta
atgcgtattc tttcatcttg tgctactaga ttagtggtga tttcattaag
240cagatgctta tattgtgcta atgtttgctg tatggtttca gcctccaggg
gtgatgttgt 300gatgacacag tctccagctt tcctctctgt gactccaggg
gagaaagtca ccatcacctg 360ccaggccagt gaaggcattg gcaactactt
atactggtac cagcagaaac cagatcaagc 420cccaaagctc ctcatcaagt
atgcttccca gtccatctca ggggtcccct cgaggttcag 480tggcagtgga
tctgggacag atttcacctt taccatcagt agcctggaag ctgaagatgc
540tgcaacatat tactgtcagc agggcaataa gcaccct 577322127DNAhomo
sapiens; 322cccagcaggc tcctgctcca gcccagcccc cagagagcag accccaggtg
ctggccccgg 60gggttttggt ctgagcctca gtcactgtgt tatgtcttcg gaactgggac
caaggtcacc 120gtcctag 127323175DNAhomo sapiens; 323gtgtgggggc
catgtggact ccctcatgag cagatgccac cagggccact ggccccagct 60tcctccttca
cagctgcagt gggggctggg gctggggcat cccagggagg gtttttgtat
120gagcctgtgt cacagtgtgt ggtattcggc ggagggacca agctgaccgt cctag
175324176DNAhomo sapiens; 324gtgtgggggc catgtggact ccctcatgag
cagatgccac caggaccact ggccccagct 60tcctccttca cagctgcagt gggggctggg
gctaggggca tcccagggag ggtttttgta 120tgagcctgtg tcacagtgtt
gggtgttcgg cggagggacc aagctgaccg tcctag 17632572DNAhomo sapiens;
325cagagagggt ttttgtatga gcctgtgtca cagcactggg tgtttggtga
ggggacggag 60ctgaccgtcc ta 7232670DNAhomo sapiens; 326ggagggtttg
tgtgcagggt tatatcacag tgtaatgtgt tcggcagtgg caccaaggtg 60accgtcctcg
7032746DNAhomo sapiens; 327tcactgtgtg ctgtgttcgg aggaggcacc
cagctgaccg ccctcg 46328477DNAhomo sapiens; 328gggaatctgc accatgccct
gggctctgct cctcctgacc ctcctcactc actctgcagg 60tgagagtgga ccttacccag
ggatctgcac ccacctctgc tccagcttct ccactccctg 120gctcagtgga
ctctgatcct gctctcacat tcctttctgt cccctctaca gtgtcagtgg
180tccaggcagg gctgactcag ccaccctcgg tgtccaaggg cttgagacag
accgccacac 240tcacctgcac tgggaacagc aacattgttg gcaaccaagg
agcagcttgg ctgcagcagc 300accagggcca ccctcccaaa ctcctatcct
acaggaataa caaccggccc tcagggatct 360cagagagatt ctctgcatcc
aggtcaggaa acacagcctc cctgaccatt actggactcc 420agcctgagga
cgaggctgac tattactgct cagcattgga cagcagcctc agtgctc
477329544DNAhomo sapiens; 329gctgtgtcca ctatggccct gactcctctc
ctcctcctgc tcctctctca ctgcacaggt 60agggacaggg ctcagagccc agggtggtcc
ccagcctgat ctgtccctca tggctcagat 120ccctcagcag ctgcgccctg
accctgctcc tcactgtgct gtgtctgtgt ctgcaggttc 180cctctcccgg
cccgtgctga ctcagccgcc ctctctgtct gcatccccgg gagcaacagc
240cagactcccc tgcaccctga gcagtgacct cagtgttggt ggtaaaaaca
tgttctggta 300ccagcagaag ccagggagct ctcccaggtt attcctgtat
cactactcag actcagacaa 360gcagctggga cctggggtcc ccagtcgagt
ctctggctcc aaggagacct caagtaacac 420agcgtttttg ctcatctctg
ggctccagcc tgaggacgag gccgattatt actgccaggt 480gtacgaaagt
agtgctaatc acagtgagac agatgaggaa gtcggacaaa aaccaaggtt 540ttaa
544330507DNAhomo sapiens; 330gctgcgggta gagaagacag gactcaggac
aatctccagc atggcctggt cccctctctt 60cctcaccctc atcactcact gtgcaggtga
caggatgggg accaagagag aggccctggg 120aagcccatgc gaccctgctt
tctcctcttg tctccttttg tctcttgtca atcaccatgt 180ctgtgtctct
ctcacttcca gggtcctggg cccagtctgt gctgactcag ccaccctcgg
240tgtctgaagc ccccaggcag agggtcacca tctcctgttc tggaagcagc
tccaacatcg 300gaaataatgc tgtaaactgg taccagcagc tcccaggaaa
ggctcccaaa ctcctcatct 360attatgatga tctgctgccc tcaggggtct
ctgaccgatt ctctggctcc aagtctggca 420cctcagcctc cctggccatc
agtgggctcc agtctgagga tgaggctgat tattactgtg 480cagcatggga
tgacagcctg aatggtc 507331517DNAhomo sapiens; 331gctctgcttc
agctgtgggc acaagaggca gcactcagga caatctccag catggcctgg 60tctcctctcc
tcctcactct cctcgctcac tgcacaggtg actggataca ggtccagggg
120aggggccctg ggaagcctat ggattcttgc tttctcctgt tgtctctaga
agccgaataa 180tgatgcctgt gtctctccca cttccagggt cctgggccca
gtctgtgctg acgcagccgc 240cctcagtgtc tggggcccca gggcagaggg
tcaccatctc ctgcactggg agcagctcca 300acatcggggc aggttatgat
gtacactggt accagcagct tccaggaaca gcccccaaac 360tcctcatcta
tggtaacagc aatcggccct caggggtccc tgaccgattc tctggctcca
420agtctggcac ctcagcctcc ctggccatca ctgggctcca ggctgaggat
gaggctgatt 480attactgcca gtcctatgac agcagcctga gtggttc
517332581DNAhomo sapiens; 332ctgatttgca tggatggact ctccccctct
cagagtatga agagagggag agatctgggg 60gaagctcagc ttcagctgtg ggtagagaag
acaggactca ggacaatctc cagcatggcc 120agcttccctc tcctcctcac
cctcctcact cactgtgcag gtgacaggat ggggaccaag 180aaaggggccc
tgggaagccc atggggccct gctttctcct cttgtctcct tttgtctctt
240gtcaatcacc atgtctgtgt ctctctcact tccagggtcc tgggcccagt
ctgtgctgac 300tcagccaccc tcagcgtctg ggacccccgg gcagagggtc
accatctctt gttctggaag 360cagctccaac atcggaagta atactgtaaa
ctggtaccag cagctcccag gaacggcccc 420caaactcctc atctatagta
ataatcagcg gccctcaggg gtccctgacc gattctctgg 480ctccaagtct
ggcacctcag cctccctggc catcagtggg ctccagtctg aggatgaggc
540tgattattac tgtgcagcat gggatgacag cctgaatggt c 581333522DNAhomo
sapiens; 333ggggaagctc agcttcagct gtggtagaga agacaggatt caggacaatc
tccagcatgg 60ccggcttccc tctcctcctc accctcctca ctcactgtgc aggtgacagg
atggggacca 120agagaggggc cctgggaagc ccatggggcc ctgctttctc
ctcttgtctc ctttcgtctc 180ttgtcaatca ccatgtctgt gtctctctca
cttccagggt cctgggccca gtctgtgctg 240actcagccac cctcagcgtc
tgggaccccc gggcagaggg tcaccatctc ttgttctgga 300agcagctcca
acatcggaag taattatgta tactggtacc agcagctccc aggaacggcc
360cccaaactcc tcatctatag taataatcag cggccctcag gggtccctga
ccgattctct 420ggctccaagt ctggcacctc agcctccctg gccatcagtg
ggctccggtc cgaggatgag 480gctgattatt actgtgcagc atgggatgac
agcctgagtg gt 522334515DNAhomo sapiens; 334gctctgcttc agctgtgggc
acaggaggca gcactcagga caatctccag catggcctgg 60tcttctctcc tcctcactct
cctcgctcac tgcacaggtg actggatgca gatcgagggg 120agggtccctg
ggaagcctat ggattcttgc tttctcctct tgtctctaga agcagaatca
180tgatgcctgt gtctctccca cttccagggt cctgggccca gtctgtgctg
acgcagccgc 240cctcagtgtc tggggcccca gggcagaggg tcaccatctc
ctgcactggg agcagctcca 300acattggggc gggttatgtt gtacattggt
accagcagct tccaggaaca gcccccaaac 360tcctcatcta tggtaacagc
aatcggccct caggggtccc tgaccaattc tctggctcca 420agtctggcac
ctcagcctcc ctggccatca ctggactcca gtctgaggat gaggctgatt
480attactgcaa agcatgggat aacagcctga atgct 515335509DNAhomo sapiens;
335tgagcgcaga aggcaggact cgggacaatc ttcatcatga cctgctcccc
tctcctcctc 60acccttctca ttcactgcac aggtgcccag acacagggtc aggggagggg
tccaggaagc 120ccatgaggcc ctgctttctc cttctctctc tagaccaaga
atcaccgtgt ctgtgtctct 180cctgcttcca gggtcctggg cccagtctgt
gttgacgcag ccgccctcag tgtctgcggc 240cccaggacag aaggtcacca
tctcctgctc tggaagcagc tccaacattg ggaataatta 300tgtatcctgg
taccagcagc tcccaggaac agcccccaaa ctcctcattt atgacaataa
360taagcgaccc tcagggattc ctgaccgatt ctctggctcc aagtctggca
cgtcagccac 420cctgggcatc accggactcc agactgggga cgaggccgat
tattactgcg gaacatggga 480tagcagcctg agtgctggca cagtgctcc
509336517DNAhomo sapiens; 336tgctggggtc tcaggaggca gcactctcgg
gacgtctcca ccatggcctg ggctctgctc 60ctcctcagcc tcctcactca gggcacaggt
gacacctcca gggaaagggt cacaggggtc 120tctgggctga tccttggtct
cctgctcctc aggctcacct gggcccagca ctgactcact 180agagtgtgtt
tctccctctt tccaggatcc tgggctcagt ctgccctgac tcagcctcgc
240tcagtgtccg ggtctcctgg acagtcagtc accatctcct gcactggaac
cagcagtgat 300gttggtggtt ataactatgt ctcctggtac caacagcacc
caggcaaagc ccccaaactc 360atgatttatg atgtcagtaa gcggccctca
ggggtccctg atcgcttctc tggctccaag 420tctggcaaca cggcctccct
gaccatctct gggctccagg ctgaggatga ggctgattat 480tactgctgct
catatgcagg cagctacact ttccaca 517337519DNAhomo sapiens;
337gctggggtct caggaggcag cgctctcagg acatctccac catggcctgg
gctctgctgc 60tcctcaccct cctcactcag ggcacaggtg acgcctccag ggaaggggct
tcagggacct 120ctgggctgat ccttggtctc ctgctcctca ggctcaccgg
ggcccagcac tgactcactg 180gcatgtgttt ctccctcttt ccagggtcct
gggcccagtc tgccctgact cagcctgcct 240ccgtgtctgg gtctcctgga
cagtcgatca ccatctcctg cactggaacc agcagtgacg 300ttggtggtta
taactatgtc tcctggtacc aacagcaccc aggcaaagcc cccaaactca
360tgatttatga ggtcagtaat cggccctcag gggtttctaa tcgcttctct
ggctccaagt 420ctggcaacac ggcctccctg accatctctg ggctccaggc
tgaggacgag gctgattatt 480actgcagctc atatacaagc agcagcactc tccacagtg
519338490DNAhomo sapiens; 338gaatatctcc accatggcct gggctctgct
cctcctcacc ctcctcactc agggcacagg 60tgaggcctcc agggaagggg cttcggggac
ctctgggctg atccttaact cctgctcctc 120aggctcacct gggcccagca
ctgacttact aaaatgtgtt tcttcctttt tccaggatcc 180tgggctcagt
ctgccctgac tcagcctccc tccgtgtccg ggtctcctgg acagtcagtc
240accatctcct gcactggaac cagcagtgac gttggtagtt ataaccgtgt
ctcctggtac 300cagcagcccc caggcacagc ccccaaactc atgatttatg
aggtcagtaa tcggccctca 360ggggtccctg atcgcttctc tgggtccaag
tctggcaaca cggcctccct gaccatctct 420gggctccagg ctgaggacga
ggctgattat tactgcagct tatatacaag cagcagcact 480ttccacagag
490339619DNAhomo sapiens; 339tctctgagcc caggcccacg tgagggtggg
gtgaggagag gagcccagga tgctgatttt 60catggaggcc ccgccctcct ctgaggcaaa
ggggataaga cagggctggg gcagggccag 120tgctggggtc acaagaggca
gcgctctcgg gacgtctcca ccatggcctg ggctctgctg 180ctcctcactc
tcctcactca ggacacaggt gacgcctcca gggaaggggt cttggggacc
240tctgggctga tccttggtct cctgctcctc aggctcaccg gggcccagca
ctgactcact 300ggcatgtgtt tctccctctt tccagggtcc tgggcccagt
ctgccctgac tcagcctgcc 360tccgtgtctg ggtctcctgg acagtcgatc
accatctcct gcactggaac cagcagtgat 420gttgggagtt ataaccttgt
ctcctggtac caacagcacc caggcaaagc ccccaaactc 480atgatttatg
agggcagtaa gcggccctca ggggtttcta atcgcttctc tggctccaag
540tctggcaaca cggcctccct gacaatctct gggctccagg ctgaggacga
ggctgattat 600tactgctgct catatgcag 619340520DNAhomo sapiens;
340ggctagaggc aggcccggtg ctggggtctc aaggcagcgc tctcgggaca
tctccaccat 60ggcctgggct ctgctcctcc tcaccctcct cactcagggc acaggtgaca
cctccaggga 120aatggccttg gggacctctg agctaatgct tggtcttctg
ctcctgctcc tcagggtcac 180tggacccagt actgacccag tagagtgtgt
ttctccctct ttccagggtc ctgggcccaa 240tctgccctga ctcagcctcc
ttttgtgtcc ggggctcctg gacagtcggt caccatctcc 300tgcactggaa
ccagcagtga cgttggggat tatgatcatg tcttctggta ccaaaagcgt
360ctcagcacta cctccagact cctgatttac aatgtcaata ctcggccttc
agggatctct 420gacctcttct caggctccaa gtctggcaac atggcttccc
tgaccatctc tgggctcaag 480tccgaggttg aggctaatta tcactgcagc
ttatattcaa 520341635DNAhomo sapiens; 341tctctaagcc caggcccaag
tgagggtggg gtgagaagag gagctcagga tgcagatttg 60catggaggtc ccgcccttct
ctgaggcaga gggataagac agggctgggg gcaggcccag 120tgctggggtc
tcaggaggca gcgctctcag gacgtcacca ccatggcctg ggctctgctc
180ctcctcaccc tcctcactca gggcacaggt gatgcctcca gggaaggggc
cacagggacc 240tctgggctga tccttggtct cctgctcctc aggctcacct
gggcccagca ctgactcact 300agactgtgtt tctccctttc cagggtcctg
ggcccagtct gccctgactc agcctccctc 360cgcgtccggg tctcctggac
agtcagtcac catctcctgc actggaacca gcagtgacgt 420tggtggttat
aactatgtct cctggtacca acagcaccca ggcaaagccc ccaaactcat
480gatttatgag gtcagtaagc ggccctcagg ggtccctgat cgcttctctg
gctccaagtc 540tggcaacacg gcctccctga ccgtctctgg gctccaggct
gaggatgagg ctgattatta 600ctgcagctca tatgcaggca gcaacaattt ccaca
635342691DNAhomo sapiens; 342aagaacctgc ccagcctggg cctcaggaag
cagcatcgga ggtgcctcag ccatggcatg 60gatccctctc ttcctcggcg tccttgctta
ctgcacaggt gctgccccta gggtcctagc 120cactggtcca gtcccagggc
tctgggtcca gcctggccct gactctgagc tcagcagggc 180ccccgcctgt
ggtgggcagg atgctcatga ccctgctgca ggtggatggg ctcggcgggg
240ctgaaatccc cccacacagt gctcatgtgc tcacactgcc ttagggctct
ttcatccctg 300gatctgtgtc caggccaggc acgtgggaag atttacttgg
agttcagctc ctcagtttca 360agccttttct ctcccgtttt ctctcctgta
ggatccgtgg cctcctatga gctgactcag 420ccaccctcag tgtccgtgtc
cccaggacag acagccagca tcacctgctc tggagataaa 480ttgggggata
aatatgcttg ctggtatcag cagaagccag gccagtcccc tgtgctggtc
540atctatcaag atagcaagcg gccctcaggg atccctgagc gattctctgg
ctccaactct 600gggaacacag ccactctgac catcagcggg acccaggcta
tggatgaggc tgactattac 660tgtcaggcgt gggacagcag cactgcacac a
691343539DNAhomo sapiens; 343gtgggctcag gaggcagagc tctgggaatc
tcaccatggc ctggacccct ctcctgctcc 60ccctcctcac tttctgcaca ggtgcttctc
ccaggccctg ccccaggctc agtgcccata 120gaccccaagt tggccctgcc
ctgaaccctg tgcaaagccc agacacagtc ttagggtagg 180acccctggga
atgggctctt gatcttcaag ccccctctcc tgttttcctt gcagtctctg
240aggcctccta tgagctgaca cagccaccct cggtgtcagt gtccccagga
caaacggcca 300ggatcacctg ctctggagat gcattgccaa aaaaatatgc
ttattggtac cagcagaagt 360caggccaggc ccctgtgctg gtcatctatg
aggacagcaa acgaccctcc gggatccctg 420agagattctc tggctccagc
tcagggacaa tggccacctt gactatcagt ggggcccagg 480tggaggatga
agctgactac tactgttact caacagacag cagtggtaat catagcaca
539344763DNAhomo sapiens; 344gcctcagcca tggcctggac ccctctcctc
ctcagcctcc tcgctcactg cacaggtgct 60ctgcccaggg tatcaccaac ctgcccatcc
ccagggctct gggtccagtg tggccatgac 120tatgagctca ggagggccct
gcctgtggtg ggcaggatgc tcatgaccct gctgcagggt 180gagggactgg
cggagctgaa gtcccctcaa actctgctca gaggcttgtg agagcctgag
240gggctgcacc tgccaggaga gagtactggg ttttcagttc aaaggctcca
tgcagaggga 300aagtccatgg gccactgggg ctagggctga ttgcagggga
taccctgagg gttcacagac 360tctctgaagc ttttccagga cagcagggca
ggggatttca tacggatctt ttacctaaaa 420gccatcctct cctttttttt
tttttttaat ctttgcaggc tctgcgacct cctatgagct 480gactcagcca
cactcagtgt cagtggccac agcacagatg gccaggatca cctgtggggg
540aaacaacatt ggaagtaaag ctgtgcactg gtaccagcaa aagccaggcc
aggaccctgt 600gctggtcatc tatagcgata gcaaccggcc ctcagggatc
cctgagcgat tctctggctc 660caacccaggg aacaccgcca ccctaaccat
cagcaggatc gaggctgggg atgaggctga 720ctattactgt caggtgtggg
acagtagtag tgatcatccc acg 763345529DNAhomo sapiens; 345tctgtgggtc
caggaggcac agctctggga atctcaccat ggcctggatc cctctcctgc 60tccccctcct
cactctctgc acaggtgctg accccaggcc cttccccagg ctcagtcccc
120acagattcca agttgagcct gacctgaatc ctgagcaaag cccagacaca
gcctctgggt 180gggactcctg gaaatgggtc ctttgtcttc aagccccctc
tcttgttctt ccttgcaggc 240tctgaggcct cctatgagct gacacagcca
ccctcggtgt cagtgtccct aggacagatg 300gccaggatca cctgctctgg
agaagcattg ccaaaaaaat atgcttattg gtaccagcag 360aagccaggcc
agttccctgt gctggtgata tataaagaca gcgagaggcc ctcagggatc
420cctgagcgat tctctggctc cagctcaggg acaatagtca cattgaccat
cagtggagtc 480caggcagaag acgaggctga ctattactgt ctatcagcag acagcagtg
529346523DNAhomo sapiens; 346agctgtgggc tcagaagcag agttctgggg
tgtctccacc atggcctgga cccctctctg 60gctcactctc ctcactcttt gcataggtgc
tgcctcccag ggctcaaccc catattatca 120tgctagctgt gccaacctgg
ccctgagctt cggctcaaca cagggagtag tgtagggtgt 180gggactctag
gcgtgaaacc cttatcctca cctcttctgt cctcttttgc aggttctgtg
240gtttcttctg agctgactca ggaccctgct gtgtctgtgg ccttgggaca
gacagtcagg 300atcacatgcc aaggagacag cctcagaagc tattatgcaa
gctggtacca gcagaagcca 360ggacaggccc ctgtacttgt catctatggt
aaaaacaacc ggccctcagg gatcccagac 420cgattctctg gctccagctc
aggaaacaca gcttccttga ccatcactgg ggctcaggcg 480gaagatgagg
ctgactatta ctgtaactcc cgggacagca gtg 5233471515DNAhomo sapiens;
347gcacagagga gctgtgccct ggaatggggc ctgtacctgt ccaaggcttg
tgccgtcccc 60tgtgggagat gagaagcgtc cctgcattgg gctcttgggg acccgtcttg
gacatgagtg 120agaatgaaga gggtccctgc attgggctct ggcatgtgac
tttaaatgga tttaggcctg 180taccagacat ctcatgtctg acataaaata
tttacaatca ggacattact agagaagcag 240aaaaaagcta accacctccc
tcctgagcca ggatggaatg aaggagggga ctgtggaccc 300cagataattc
ccctgtcacc actgtgactc taacaacctc ttaaatcacg gccaacatct
360atcccatagg aaggtcttta tatcccctag aaaatacaga ggaagtcagc
tctgagcttt 420tccacgacca acccagccaa ggagcaaggc tgggcacaac
ctgggtaaag atgtgagccc 480agaccatggg accagtgggt gaaggaaaat
cgcatgggct gagggggtgg gtaagcaggg 540gccagccctc ctctctctgt
ttcctttggg gctgagtcct tctctggaaa ccacagatct 600cctccagcag
cagcctctga ctctgctgat ttgcatcatg ggccgctctc tccagcaagg
660ggataagaga ggcctgggag gaacctgctc agtctgggcc taaggaagca
gcactggtgg 720tgcctcagcc atggcctgga ccgttctcct cctcggcctc
ctctctcact gcacaggtga 780tccccccagg gtctcaccaa cctgcccagc
ccaagggttc tgggtccagc gtgtccttga 840ttctgagctc aggagggccc
ttcctgtggt gggcaggatg ctcatgaccc tgctgcaggg 900tgggaggctg
gtggggctga actcccccca aactgtgctc aaaggcttgt gagagcctga
960gggactgcac ctgccaggag agagtagtga gttttcagtt caaagtctcc
atacaacagg 1020aaagtcatgg gccactgggg ctggggctga ttgcagggga
taccctgagg gttcacagac 1080tctctggagc ttgtctggga cagcagggca
agggatttca taagaagcat ctttcacctg 1140caagccaacc tctctcttat
ttatttattt atttatttat ttatttattt atttattttt 1200atctttgcag
gctctgtgac ctcctatgtg ctgactcagc caccctcggt gtcagtggcc
1260ccaggacaga cggccaggat tacctgtggg ggaaacaaca ttggaagtaa
aagtgtgcac 1320tggtaccagc agaagccagg ccaggcccct gtgctggtcg
tctatgatga tagcgaccgg 1380ccctcaggga tccctgagcg attctctggc
tccaactctg ggaacacggc caccctgacc 1440atcagcaggg tcgaagccgg
ggatgaggcc gactattact gtcaggtgtg ggatagtagt 1500agtgatcatc ccacg
1515348558DNAhomo sapiens; 348aagagaggcc tgggaagccc agctgtgctg
tgggctcagg aggcagagct gtgggtgtct 60caccatggca tgggccacac tcctgctccc
actcctcaac ctctacacag gtgctgcccc 120cagaccctgc cccaggctca
gccctcctaa gcccctggtc ttaccctgaa ccctgagctc 180agcccaggca
tagcctcagg gcgatactac tggaatgggt ttgttatctt caagccccct
240ctcttgtcct ctcttgcagg ctctgttgcc tcctatgagc tgacacagct
accctcggtg 300tcagtgtccc caggacagac agccaggatc acctgctctg
gagatgtact gggggaaaat 360tatgctgact ggtaccagca gaagccaggc
caggcccctg agttggtgat atacgaagat 420agtgagcggt accctggaat
ccctgaacga ttctctgggt ccacctcagg gaacacgacc 480accctgacca
tcagcagggt cctgaccgaa gacgaggctg actattactg tttgtctggg
540gatgaggaca atccctca 558349546DNAhomo sapiens; 349gctgtgctgt
gggtccagga ggcagaactc tgggtgtctc accatggcct ggatccctct 60acttctcccc
ctcttcactc tctgcacagg tgctgtcccc aggccctgct ccaggccctg
120ctccagtctt attccccaca gatcccaagt tgagcctgcc ctgaatcccg
agcaaagccc 180agacgcagcc tctgggtgcg actcctggga atgggtcctt
tgtcttcaag ccccctctct 240tgttcttcct tgcaggctct gaggcctcct
atgagctgac acagccaccc tcggtgtcag 300tgtccccagg acagacggcc
aggatcacct gctctggaga tgcattgcca aagcaatatg 360cttattggta
ccagcagaag ccaggccagg cccctgtgct ggtgatatat aaagacagtg
420agaggccctc agggatccct gagcgattct ctggctccag ctcagggaca
acagtcacgt 480tgaccatcag tggagtccag gcagaagatg aggctgacta
ttactgtcaa tcagcagaca 540gcagtg 546350519DNAhomo sapiens;
350gctgtaggct caggaggcag agctctgaat gtctcaccat ggcctggatc
cctctcctgc 60tccccctcct cattctctgc acaggtgctg cccctaggct cagtctccac
agaccccaag 120ttgagcctga cctgaatcct gagcaaagcc ctgccactgc
ctctgggggg gattcctggc 180aatgcgtcct ttgtcctcaa gccccctctc
ctgtcttttc ttgcagtctc tgtggcctcc 240tatgagctga cacagccatc
ctcagtgtca gtgtctccgg gacagacagc caggatcacc 300tgctcaggag
atgtactggc aaaaaaatat gctcggtggt tccagcagaa gccaggccag
360gcccctgtgc tggtgattta taaagacagt gagcggccct cagggatccc
tgagcgattc 420tccggctcca gctcagggac cacagtcacc ttgaccatca
gcggggccca ggttgaggat 480gaggctgact attactgtta ctctgcggct gacaacaat
519351504DNAhomo sapiens; 351gctgtggact cagaggcaga gctctggggc
atttccatta tggcctggac ccctcccctg 60ctcgtcctca ctctctgcac aggtgctgcc
tcccagggct cagcccccag tgggatcaag 120atcagcctgg ccctgacctt
caactcaaca tagggagtga tgcagggtgt ggggttctgg 180gaatgaggcc
ctcatcctca gactcacctc tcctgtcctc tcttgtgggc tccgttattt
240cctctgggcc aactcaggtg cctgcagtgt ctgtggcctt gggacaaatg
gccaggatca 300cctgccaggg agacagcatg gaaggctctt atgaacactg
gtaccagcag aagccaggcc 360aggcccccgt gctggtcatc tatgatagca
gtgaccggcc ctcaaggatc cctgagcgat 420tctctggctc caaatcaggc
aacacaacca ccctgaccat cactggggcc caggctgagg 480atgaggctga
ttattactat cagt 504352747DNAhomo sapiens; 352cttgactctg ctgatttgca
tcacaggctg ctctcttcag caaggggata agagagggct 60ggaaggaacc tgcccagcct
gggcctcagg aagcagcatc gggggtgccg cagccatggc 120ctggaccgct
ctccttctga gcctccttgc tcactttaca ggtgctgccc ccagtgtccc
180agccacctac ccagctccaa ggctctgggt ccagcctggc ctgacagtga
tctcagcagg 240gccctgcctg tggtgtgcag gatgctcatg atcctgctgc
agggggaggg gctgctggag 300gtgaaatccc cccacactgt tcttctgtgc
tcatggtccc ctgaggacac ttctattcct 360gaaactcagg ccaggcaggt
gggaaggcat tgttgggttg agcctctcag tttcaagtct 420attctattct
ctcccctttt cttgcaggtt ctgtggcctc ctatgagctg actcagccac
480tctcagtgtc agtggccctg ggacagacgg ccaggattac ctgtggggga
aacaacattg 540gaagtaaaaa tgtgcactgg taccagcaga agccaggcca
ggcccctgtg ctggtcatct 600atagggatag caaccggccc tctgggatcc
ctgagcgatt ctctggctcc aactcgggga 660acacggccac cctgaccatc
agcagagccc aagccgggga tgaggctgac tattactgtc 720aggtgtggga
cagcagcact gcacaca 747353529DNAhomo sapiens; 353ctcgaataga
gctcttggaa gtccctccaa ccatggcctg ggtctccttc tacctactgc 60ccttcatttt
ctccacaggt cagaacatcc cagggaattc agggaaatgt tttcactgct
120attttcccat gagcaccagt cctcaggggc attctttcca gttcttctgt
gcattcagca 180tcattcatga cattctgttt acaggtctct gtgctctgcc
tgtgctgact cagcccccgt 240ctgcatctgc cttgctggga gcctcgatca
agctcacctg caccctaagc agtgagcaca 300gcacctacac catcgaatgg
tatcaacaga gaccagggag gtccccccag tatataatga 360aggttaagag
tgatggcagc cacagcaagg gggacgggat ccccgatcgc ttcatgggct
420ccagttctgg ggctgaccgc tacctcacct tctccaacct ccagtctgac
gatgaggctg 480agtatcactg tggagagagc cacacgattg atggccaagt cggttgagc
529354483DNAhomo sapiens; 354atggcctgga ccccactcct cctcctcttc
cctctcctcc tccactgcac aggtcaggag 60gaccctcagc atcctcatgc cccagctcac
tgacaccatc tcccaaactc ataccagaaa 120tgttgtttgc tcttgtcctt
ccttcaggcc ataatgagcg tctctgtttt cagggtctct 180ctcccagcct
gtgctgactc aatcatcctc tgcctctgct tccctgggat cctcggtcaa
240gctcacctgc actctgagca gtgggcacag tagctacatc atcgcatggc
atcagcagca 300gccagggaag gcccctcggt acttgatgaa gcttgaaggt
agtggaagct acaacaaggg 360gagcggagtt cctgatcgct tctcaggctc
cagctctggg gctgaccgct acctcaccat 420ctccaacctc cagtttgagg
atgaggctga ttattactgt gagacctggg acagtaacac 480tca 483355539DNAhomo
sapiens; 355agggtgggta agaaatacct gcaactgtca gcctcagcag agctctgggg
agtctgcacc 60atggcttgga ccccactcct cttcctcacc ctcctcctcc actgcacagg
tcaggatggc 120cctcagcacc ctgacctcca gctcactgat accacctccc
aaacttatgc caggaatgtc 180cttccctctt ttcttgactc cagccggtaa
tgggtgtctg tgttttcagg gtctctctcc 240cagcttgtgc tgactcaatc
gccctctgcc tctgcctccc tgggagcctc ggtcaagctc 300acctgcactc
tgagcagtgg gcacagcagc tacgccatcg catggcatca gcagcagcca
360gagaagggcc ctcggtactt gatgaagctt aacagtgatg gcagccacag
caagggggac 420gggatccctg atcgcttctc aggctccagc tctggggctg
agcgctacct caccatctcc 480agcctccagt ctgaggatga ggctgactat
tactgtcaga cctggggcac tggcattca 539356496DNAhomo sapiens;
356ccaccatggc ctggactcct cttcttctct tgctcctctc tcactgcaca
ggtagggaca 60ggcctcagag atcagggcca gccacccaac ctgattctgg ctcttctggt
aaagatccct 120gaaaaacctc accctgaacc ctgcccatca accatgagtg
tctgtgtttg caggttccct 180ctcccagcct gtgctgactc agccaccttc
ctcctccgca tctcctggag aatccgccag 240actcacctgc accttgccca
gtgacatcaa tgttggtagc tacaacatat actggtacca 300gcagaagcca
gggagccctc ccaggtatct cctgtactac tactcagact cagataaggg
360ccagggctct ggagtcccca gccgcttctc tggatccaaa gatgcttcag
ccaatacagg 420gattttactc atctccgggc tccagtctga ggatgaggct
gactattact gtatgatttg 480gccaagcaat gcttct 496357520DNAhomo
sapiens; 357actgcggggg taagaggttg tgtccaccat ggcctggact cctctcctcc
tcctgttcct 60ctctcactgc acaggtagga atagacttca gagaccaggg tcagccaccc
agcctgattc 120tgactcttct ggcaaagatc cctgaaaaac tttaccctgg
tttctgcctt agcacccatt 180aatgtctgtg tttccaggtt ccctctcgca
ggctgtgctg actcagccgt cttccctctc 240tgcatctcct ggagcatcag
ccagtctcac ctgcaccttg cgcagtggca tcaatgttgg 300tacctacagg
atatactggt accagcagaa gccagggagt cctccccagt atctcctgag
360gtacaaatca gactcagata agcagcaggg ctctggagtc cccagccgct
tctctggatc 420caaagatgct tcggccaatg cagggatttt actcatctct
gggctccagt ctgaggatga 480ggctgactat tactgtatga tttggcacag
cagcgcttct 520358493DNAhomo sapiens; 358atggcctgga atcctctcct
cctcctgttc ctctctcact gcacaggtag gaaaaggcct 60cagagaccag ggtcagccac
acagcctgat tctgactctt gtgtcaaaga tcactaaaaa 120aaatattacc
ttggtttctg tcttaaagcc tatatatgcc tgtgttccag gttccctctc
180gcagcctgtg ctgactcagc caacttccct ctcagcatct cctggagcat
cagccagact 240cacctgcacc ttgcgcagtg gcatcaatct tggtagctac
aggatattct ggtaccagca 300gaagccagag agccctcccc ggtatctcct
gagctactac tcagactcaa gtaagcatca 360gggctctgga gtccccagcc
gcttctctgg atccaaagat gcttcgagca atgcagggat 420tttagtcatc
tctgggctcc agtctgagga tgaggctgac tattactgta tgatttggca
480cagcagtgct tct 493359500DNAhomo sapiens; 359ccaccatggc
ctggactctt ctccttctcg tgctcctctc tcactgcaca ggtagggaaa 60gtccttataa
actgagtctc agtgtccaac ctacaccatc ccctgtggct cagacctaca
120agaagcttta ccctgggaac tgccttatca cccatgatgt ctgtgttttc
aggttccctc 180tcccagcctg tgctgactca gccatcttcc cattctgcat
cttctggagc atcagtcaga 240ctcacctgca tgctgagcag tggcttcagt
gttggggact tctggataag gtggtaccaa 300caaaagccag ggaaccctcc
ccggtatctc ctgtactacc actcagactc caataagggc 360caaggctctg
gagttcccag ccgcttctct ggatccaacg atgcatcagc caatgcaggg
420attctgcgta tctctgggct ccagcctgag gatgaggctg actattactg
tggtacatgg 480cacagcaact ctaagactca 500360574DNAhomo sapiens;
360tctgaggata cgcgtgacag ataagaaggg ctggtgggat cagtcctggt
ggtagctcag 60gaagcagagc ctggagcatc tccactatgg cctgggctcc actacttctc
accctcctcg 120ctcactgcac aggtggctgc ctgcaaggaa ttcagggagc
gttcctggat gtcacctggg 180ctgatgatct gttcctcctg cctgggaacc
agtcttcatc tctcccgact gatctctgtg 240ttgctctctt cttgcaggtt
cttgggccaa ttttatgctg actcagcccc actctgtgtc 300ggagtctccg
gggaagacgg taaccatctc ctgcacccgc agcagtggca gcattgccag
360caactatgtg cagtggtacc agcagcgccc gggcagttcc cccaccactg
tgatctatga 420ggataaccaa agaccctctg gggtccctga tcggttctct
ggctccatcg acagctcctc 480caactctgcc tccctcacca tctctggact
gaagactgag gacgaggctg actactactg 540tcagtcttat gatagcagca
atcacacagt gctc 574361472DNAhomo sapiens; 361tctggcgcca ggggtccctt
ccaatatcag caccatggcc tggactcctc tctttctgtt 60cctcctcact tgctgcccag
gttaagagag atttcaaata ccagcctttg gagggatcct 120tctgtctgcc
cttctaattt ctaacatgtg tctgtttttt gtttcagggt ccaattctca
180gactgtggtg actcaggagc cctcactgac tgtgtcccca ggagggacag
tcactctcac 240ctgtgcttcc agcactggag cagtcaccag tggttactat
ccaaactggt tccagcagaa 300acctggacaa gcacccaggg cactgattta
tagtacaagc aacaaacact cctggacccc 360tgcccggttc tcaggctccc
tccttggggg caaagctgcc ctgacactgt caggtgtgca 420gcctgaggac
gaggctgagt attactgcct gctctactat ggtggtgctc ag 472362473DNAhomo
sapiens; 362tctggcacca ggggtccctt ccaatatcag caccatggcc tggactcctc
tctttctgtt 60cctcctcact tgctgcccag gttaagagag atttcaaata ccagcctttg
gagggatccc 120tttttctccc tttctaattc ctaatatatg tctgtttttt
ttgtttcagg gtccaattcc 180caggctgtgg tgactcagga gccctcactg
actgtgtccc caggagggac agtcactctc 240acctgtggct ccagcactgg
agctgtcacc agtggtcatt atccctactg gttccagcag 300aagcctggcc
aagcccccag gacactgatt tatgatacaa gcaacaaaca ctcctggaca
360cctgcccggt tctcaggctc cctccttggg ggcaaagctg ccctgaccct
tttgggtgcg 420cagcctgagg atgaggctga gtattactgc ttgctctcct
atagtggtgc tcg 473363513DNAhomo sapiens; 363gaggaaaaca aaccccagct
gggaagcctg agaacactta gccttcatga gtgtccccac 60catggcctgg atgatgcttc
tcctcggact ccttgcttat ggatcaggtc aggggaaggg 120actctatccc
tgggggacca cagaaaacag ggtccaggtt actctcatcc tcatgatcat
180aactgtgtct ctcctgttcg ttttaggagt ggattctcag actgtggtga
cccaggagcc 240atcgttctca gtgtcccctg gagggacagt cacactcact
tgtggcttga gctctggctc 300agtctctact agttactacc ccagctggta
ccagcagacc ccaggccagg ctccacgcac 360gctcatctac agcacaaaca
ctcgctcttc tggggtccct gatcgcttct ctggctccat 420ccttgggaac
aaagctgccc tcaccatcac gggggcccag gcagatgatg aatctgatta
480ttactgtgtg ctgtatatgg gtagtggcat ttc 513364546DNAhomo sapiens;
364gagagactga agaacccagc attgcagcag ctccaccatg gcctgggctc
ctctgctcct 60caccctcctc agtctcctca caggtcaggg tgggcagtgg gctgggcccc
caaagggacc 120cccacctccc agcctccatc tccccatccc tgctcttcct
cctccaacag ctcatcagcc 180acccaccaac aggagccctc atgggtgtct
gtgtttccag ggtccctctc ccagcctgtg 240ctgactcagc caccttctgc
atcagcctcc ctgggagcct cggtcacact cacctgcacc 300ctgagcagcg
gctacagtaa ttataaagtg gactggtacc agcagagacc agggaagggc
360ccccggtttg tgatgcgagt gggcactggt gggattgtgg gatccaaggg
ggatggcatc 420cctgatcgct tctcagtctt gggctcaggc ctgaatcggt
acctgaccat caagaacatc 480caggaagaag atgagagtga ctaccactgt
ggggcagacc atggcagtgg gagcaacttc 540gtgtaa 5463656729DNAhomo
sapiens; 365gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag
cacctctggg 60ggcacagcag ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacccagacc 240tacatctgca acgtgaatca
caagcccagc aacaccaagg tggacaagaa agttggtgag 300aggccagcac
agggagggag ggtgtctgct ggaagccagg ctcagcgctc ctgcctggac
360gcatcccggc tatgcagccc cagtccaggg cagcaaggca ggccccgtct
gcctcttcac 420ccggaggcct ctgcccgccc cactcatgct cagggagagg
gtcttctggc tttttcccca 480ggctctgggc aggcacaggc taggtgcccc
taacccaggc cctgcacaca aaggggcagg 540tgctgggctc agacctgcca
agagccatat ccgggaggac cctgcccctg acctaagccc 600accccaaagg
ccaaactctc cactccctca gctcggacac cttctctcct cccagattcc
660agtaactccc aatcttctct ctgcagagcc caaatcttgt gacaaaactc
acacatgccc 720accgtgccca ggtaagccag cccaggcctc gccctccagc
tcaaggcggg acaggtgccc 780tagagtagcc tgcatccagg gacaggcccc
agccgggtgc tgacacgtcc acctccatct 840cttcctcagc acctgaactc
ctggggggac cgtcagtctt cctcttcccc ccaaaaccca 900aggacaccct
catgatctcc cggacccctg aggtcacatg cgtggtggtg gacgtgagcc
960acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg
cataatgcca 1020agacaaagcc gcgggaggag cagtacaaca gcacgtaccg
tgtggtcagc gtcctcaccg 1080tcctgcacca ggactggctg aatggcaagg
agtacaagtg caaggtctcc aacaaagccc 1140tcccagcccc catcgagaaa
accatctcca aagccaaagg tgggacccgt ggggtgcgag 1200ggccacatgg
acagaggccg gctcggccca ccctctgccc tgagagtgac cgctgtacca
1260acctctgtcc ctacagggca gccccgagaa ccacaggtgt acaccctgcc
cccatcccgg 1320gatgagctga ccaagaacca ggtcagcctg acctgcctgg
tcaaaggctt ctatcccagc 1380gacatcgccg tggagtggga gagcaatggg
cagccggaga acaactacaa gaccacgcct 1440cccgtgctgg actccgacgg
ctccttcttc ctctacagca agctcaccgt ggacaagagc 1500aggtggcagc
aggggaacgt cttctcatgc tccgtgatgc atgaggctct gcacaaccac
1560tacacacaga agagcctctc cctgtctccg ggtaaatgag tgccacggcc
ggcaagcccc 1620cgctccccag gctctcgggg tcgcgcgagg atgcttggca
cgtaccccgt gtacatactt 1680cccaggcacc cagcatggaa ataaagcacc
cagcgcttcc ctgggcccct gcgagactgt 1740gatggttctt tccacgggtc
aggccgagtc tgaggcctga gtggcatgag ggaggcagag 1800tgggtcccac
tgtccccaca ctggcccagg ctgtgcaggt gtgcctgggc cgcctagggt
1860ggggctcagc caggggctgc cctcggcagg gtgggggatt tgccagcgtg
gccctccctc 1920cagcagcagc tgccctgggc tgggccacga gaagccctag
gagcccctgg ggacagacac 1980acagcccctg cctctgtagg agactgtcct
gttctgtgag cgccctgtcc tccgacccgc 2040atgcccactc gggggcatgc
ctagtccatg tgcgtaggga caggccctcc ctcacccatc 2100tacccccacg
gcactaaccc ctggcagccc tgcccagcct cgcacccgca tggggacaca
2160accgactccg gggacatgca ctctcgggcc ctgtggagag actggtccag
atgcccacac 2220acacactcag cccagacccg ttcaacaaac cccgcactga
ggttggccgg ccacacggcc 2280accacacaca cacgtgcacg cctcacacac
ggagcctcac ccgggcgaac cgcacagcac 2340ccagaccaga gcaaggtcct
cgcacacgtg aacactcctc ggacacaggc ccccacgagc 2400cccacgcggc
acctcaaggc ccacgagccg ctcggcagct tctccacatg ctgacctgct
2460cagacaaacc cagccctcct ctcacaaggt gcccctgcag ccgccacaca
cacacagggg 2520atcacacacc acgtcacgtc cctggccctg gcccacttcc
cagtgccgcc cttccctgca 2580gctggggtca catgaggtgt gggcttcacc
atcctcctgc cctctgggcc tcagggaggg 2640acacgggaga cggggagcgg
gtcctgctga gggccaggtc gctatctagg gccgggtgtc 2700tggctgagcc
ccggggccaa agctggtgcc cagggcgggc agctgtgggg agctgacctc
2760aggacattgt tggcccatcc cggccgggcc ctacatcctg ggtcctgcca
cagagggaat 2820cacccccaga ggcccaagcc cagggggaca cagcactgac
cacccccttc ctgtccagag 2880ctgcaactgg aggagagctg tgcggaggcg
caggacgggg agctggacgg gctgtggacg 2940accatcacca tcttcatcac
actcttcctg ttaagcgtgt gctacagtgc caccgtcacc 3000ttcttcaagg
tcggccgcac gttgtcccca gctgtccttg acattgtccc ccatgctgtc
3060acaaactgtc tctgacactg tcccacaggc tgtccccacc tgtccctgac
gctgtccccc 3120atgctctcac aaactgtccc tgacattgtc cccaatgctg
cccccacctg tccaacagtg 3180tcccccaggc tctccccaca tgtccccgac
actgtccccc atgctgtccc catctgtccc 3240caacactgtc ccccaccctg
tccccctttg tccccaacac tgtcccccac agtttccacc 3300tgtccctgac
actgtccccc atgctttccc cacctgtccc tgacaccatc ccccactctg
3360tcccctatag ttcctggccc tgtcccccac gctgtcccct acagtacctg
gcactgtccc 3420ccatgctgtc ccctcctgta tgaaaccctg tcccacatgc
tgtccccacc tgtccgtgac 3480aatatccccc acactgtccc cacctgtccc
cgacactctc ctccacgttg ttcttaccta 3540aacccgacac tttcctccat
gctgtcccca cccatctccg acactgtacc ccacgttgtc 3600cccacctgtc
ctcaacactg tcccccatgc tgtccccacc tgtccccaac actctcctcc
3660atgctgtccc cacctgtccc tgatattgtc ccccatgcag tctccacctg
tccccaatgc 3720tgtcccccag gctgtaccta ccagtacaac actgtccccc
atgctgtccc cacctgtccc 3780tgacactgtc ccccacgctg tcccctcctg
tccccgacac tgtcccccac actgtcccca 3840cctgtcccca acactatcct
ccatgctgtc ccctcctgtc cccacctgtc ccctacactg 3900tcccccatgc
tgtccccacc agtccccaaa actttcctcc acactgtccc cacctgtccc
3960caacactgtc ccccacgcta tcccccctgt ccccgacaat gtccccactg
tttcctcctg 4020ttccctccta tccctgacac tgtccgccat gctgtcccca
cctgtccctg acactgtctc 4080ccactctgtc ccctataatc cctgacactg
tcccccacgc cgtcccctcc cgtatgcacc 4140actgtccccc aagctgtccc
cacctgtcct caacacagtc ccccatgctg tccccacctg 4200tccccaacac
tctcctccat gtccccacct gtccctgata ttgtccccca tgcagtcccc
4260acctgtcccc gatgctgtcc cccgggctgt acctaccagt ccaacactgt
cccccacact 4320ctccccacct gtccctgata ctgtccccca tgctgtcccc
acctgtcccg gacactgttc 4380tccacgctct cccctcctgt ccctgacact
gtcccccaca ctgtccccac ctgtccccaa 4440cactatcctc catcctgtcc
caacctgtct cctacactgt cccccatgct gtccccacca
4500gtccccaaca ctgtcctcca tgctgtcccc catgtcccca acactgtccc
ccatgctatc 4560tcccctgtcc ctgacaatgt ccccactgtt tcctgtcccc
tcctatccct gacactgtcc 4620cccatgctgt ccccacctgt cccccacatg
gtctccaccg gtccctgaca ctgtctccca 4680ctctgtcccc tataatccct
gacactgtcc cccacaccgt cccctcctgt atgcaccact 4740gtcccccatg
ctgtccccac ctgtccctga tgctgtcctc cacacagtcc ccacctctcc
4800ctgacactgt ccccatctct ccccaacact ctcctccatg ctgtccttaa
ctgtccccaa 4860cactcttcca cactctgtct ccacctgtcc ctgacactgt
cccccacact gtcctcacct 4920gtgtctgaca ctgtccccca cgctgtcccc
acctgtccct gacgctgtct tctgtgctgt 4980ccacatgctg ttggtgccct
ggctctgctc tctatcacca agcctcagag caggcagtgg 5040tgaggccatg
gcacctgggt ggcatgaggg gccggatggg cctcaggggc agggctgtgg
5100cctgcgtgga ctgacgggtg ggtgggcctt gggggcagag aggtggcctc
agtgccctga 5160ggggtgggtg gggctcgggg gcagggctgt ggcctcgctc
acccctgtgc tgtgccttgc 5220ctacaggtga agtggatctt ctcctcggtg
gtggacctga agcagaccat catccccgac 5280tacaggaaca tgatcggaca
gggggcctag ggccaccctc tgcggggtgt ccagggccgc 5340ccagacccca
cacaccagcc atgggccatg ctcagccacc acccaggcca cacctgcccc
5400cgacctcacc gccctcaacc ccatgactct ctggcctcgc agttgccctc
tgaccctgac 5460acacctgaca cgcccccctt ccagaccctg tgcatagcag
gtctacccca gacctccgct 5520gcttggtgca tgcagggcac tgggggccag
gtgtcccctc agcaggacgt ccttgccctc 5580cggaccacaa ggtgctcaca
caaaaggagg cagtgaccgg tatcccaggc ccccacccag 5640gcaggacctc
gccctggagc caaccccgtc cacgccagcc tcctgaacac aggcgtggtt
5700tccagatggt gagtgggagc gtcagccgcc aaggtaggga agccacagca
ccatcaggcc 5760ctgttgggga ggcttccgag agctgcgaag gctcactcag
acggccttcc tcccagcccg 5820cagccagcca gcctccattc cgggcactcc
cgtgaactcc tgacatgagg aatgaggttg 5880ttctgatttc aagcaaagaa
cgctgctctc tggctcctgg gaacagtctc agtgccagca 5940ccaccccttg
gctgcctgcc cacactgctg gattctcggg tggaactgga cccgcaggga
6000cagccagccc cagagtccgc actggggaga gaaggggcca ggcccaggac
actgccacct 6060cccacccact ccagtccacc gagatcactc agagaagagc
ctgggccatg tggccgctgc 6120aggagcccca cagtgcaagg gtgaggatag
cccaaggaag ggctgggcat ctgcccagac 6180aggcctccca gagaaggctg
gtgaccaggt cccaggcggg caagactcag ccttggtggg 6240gcctgaggac
agaggaggcc caggagcatc ggggagagag gtggagggac accgggagag
6300ccaggagcgt ggacacagcc agaactcatc acagaggctg gcgtccagcc
ccgggtcacg 6360tgcagcagga acaagcagcc actctggggg caccaggtgg
agaggcaaga cgacaaagag 6420ggtgcccgtg ttcttgcgaa agcagggctg
ctggccacga gtgctggaca gaggccccca 6480cgctctgctg cccccatcac
gccgttccgt gactgtcacg cagaatctgc agacaggaag 6540ggagactcga
gcgggagtgc ggccagcgcc tgcctcggcc gtcagggagg actcctgggc
6600tcactcgaag gaggtgccac catttcagct ttggtagctt ttcttcttct
tttaaatttt 6660ctaaagctca ttaattgtct ttgatgtttc ttttgtgatg
acaataaaat atccttttta 6720agtcttgta 6729366888DNAhomo sapiens;
366gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag
cacctctggg 60ggcacagcag ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacccagacc 240tacatctgca acgtgaatca
caagcccagc aacaccaagg tggacaagaa agttgagccc 300aaatcttgtg
acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga
360ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc
ccggacccct 420gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc
ctgaggtcaa gttcaactgg 480tacgtggacg gcgtggagta caagtgcaag
gtctccaaca aagccctccc agcccccatc 540gagaaaacca tctccaaagc
caaagggcag ccccgagaac cacaggtgta caccctgccc 600ccatcccggg
atgagctgac caagaaccag gtcagcctga cctgcctggt caaaggcttc
660tatcccagcg acatcgccgt ggagtgggag agcaatgggc agccggagaa
caactacaag 720accacgcctc ccgtgctgga ctccgacggc tccttcttcc
tctacagcaa gctcaccgtg 780gacaagagca ggtggcagca ggggaacgtc
ttctcatgct ccgtgatgca tgaggctctg 840cacaaccact acacacagaa
gagcctctcc ctgtctccgg gtaaatga 888367993DNAhomo sapiens;
367gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag
cacctctggg 60ggcacagcag ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacccagacc 240tacatctgca acgtgaatca
caagcccagc aacaccaagg tggacaagaa agttgagccc 300aaatcttgtg
acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga
360ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc
ccggacccct 420gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc
ctgaggtcaa gttcaactgg 480tacgtggacg gcgtggaggt gcataatgcc
aagacaaagc cgcgggagga gcagtacaac 540agcacgtacc gtgtggtcag
cgtcctcacc gtcctgcacc aggactggct gaatggcaag 600gagtacaagt
gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc
660aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcccccatc
ccgggatgag 720ctgaccaaga accaggtcag cctgacctgc ctggtcaaag
gcttctatcc cagcgacatc 780gccgtggagt gggagagcaa tgggcagccg
gagaacaact acaagaccac gcctcccgtg 840ctggactccg acggctcctt
cttcctctac agcaagctca ccgtggacaa gagcaggtgg 900cagcagggga
acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacaca
960cagaagagcc tctccctgtc tccgggtaaa tga 9933681200DNAhomo sapiens;
368gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag
cacctctggg 60ggcacagcag ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacccagacc 240tacatctgca acgtgaatca
caagcccagc aacaccaagg tggacaagaa agttgagccc 300aaatcttgtg
acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga
360ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc
ccggacccct 420gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc
ctgaggtcaa gttcaactgg 480tacgtggacg gcgtggaggt gcataatgcc
aagacaaagc cgcgggagga gcagtacaac 540agcacgtacc gtgtggtcag
cgtcctcacc gtcctgcacc aggactggct gaatggcaag 600gagtacaagt
gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc
660aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcccccatc
ccgggatgag 720ctgaccaaga accaggtcag cctgacctgc ctggtcaaag
gcttctatcc cagcgacatc 780gccgtggagt gggagagcaa tgggcagccg
gagaacaact acaagaccac gcctcccgtg 840ctggactccg acggctcctt
cttcctctac agcaagctca ccgtggacaa gagcaggtgg 900cagcagggga
acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacaca
960cagaagagcc tctccctgtc tccggagctg caactggagg agagctgtgc
ggaggcgcag 1020gacggggagc tggacgggct gtggacgacc atcaccatct
tcatcacact cttcctgtta 1080agcgtgtgct acagtgccac cgtcaccttc
ttcaaggtga agtggatctt ctcctcggtg 1140gtggacctga agcagaccat
catccccgac tacaggaaca tgatcggaca gggggcctag 12003691739DNAhomo
sapiens; 369gcctccacca agggcccatc ggtcttcccc ctggcgccct gctccaggag
cacctccgag 60agcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgctctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcaacttcgg cacccagacc 240tacacctgca acgtagatca
caagcccagc aacaccaagg tggacaagac agttggtgag 300aggccagctc
agggagggag ggtgtctgct ggaagccagg ctcagccctc ctgcctggac
360gcaccccggc tgtgcagccc cagcccaggg cagcaaggca ggccccatct
gtctcctcac 420ccggaggcct ctgcccgccc cactcatgct cagggagagg
gtcttctggc tttttccacc 480aggctccagg caggcacagg ctgggtgccc
ctaccccagg cccttcacac acaggggcag 540gtgcttggct cagacctgcc
aaaagccata tccgggagga ccctgcccct gacctaagcc 600gaccccaaag
gccaaactgt ccactccctc agctcggaca ccttctctcc tcccagatcc
660gagtaactcc caatcttctc tctgcagagc gcaaatgttg tgtcgagtgc
ccaccgtgcc 720caggtaagcc agcccaggcc tcgccctcca gctcaaggcg
ggacaggtgc cctagagtag 780cctgcatcca gggacagacc ccagctgggt
gctgacacgt ccacctccat ctcttcctca 840gcaccacctg tggcaggacc
gtcagtcttc ctcttccccc caaaacccaa ggacaccctc 900atgatctccc
ggacccctga ggtcacgtgc gtggtggtgg acgtgagcca cgaagacccc
960gaggtccagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa
gacaaagcca 1020cgggaggagc agttcaacag cacgttccgt gtggtcagcg
tcctcaccgt cgtgcaccag 1080gactggctga acggcaagga gtacaagtgc
aaggtctcca acaaaggcct cccagccccc 1140atcgagaaaa ccatctccaa
aaccaaaggt gggacccgcg gggtatgagg gccacatgga 1200cagaggccgg
ctcggcccac cctctgccct gggagtgacc gctgtgccaa cctctgtccc
1260tacagggcag ccccgagaac cacaggtgta caccctgccc ccatcccggg
aggagatgac 1320caagaaccag gtcagcctga cctgcctggt caaaggcttc
taccccagcg acatctccgt 1380ggagtgggag agcaatgggc agccggagaa
caactacaag accacacctc ccatgctgga 1440ctccgacggc tccttcttcc
tctacagcaa gctcaccgtg gacaagagca ggtggcagca 1500ggggaacgtc
ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa
1560gagcctctcc ctgtctccgg gtaaatgagt gccacggccg gcaagccccc
gctccccagg 1620ctctcggggt cgcgcgagga tgcttggcac gtaccccgtc
tacatacttc ccgggcaccc 1680agcatggaaa taaagcaccc agcgctgccc
tgggcccctg cgagactgtg atggttctt 1739370981DNAhomo sapiens;
370gcctccacca agggcccatc ggtcttcccc ctggcgccct gctccaggag
cacctccgag 60agcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgctctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcaacttcgg cacccagacc 240tacacctgca acgtagatca
caagcccagc aacaccaagg tggacaagac agttgagcgc 300aaatgttgtg
tcgagtgccc accgtgccca gcaccacctg tggcaggacc gtcagtcttc
360ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga
ggtcacgtgc 420gtggtggtgg acgtgagcca cgaagacccc gaggtccagt
tcaactggta cgtggacggc 480gtggaggtgc ataatgccaa gacaaagcca
cgggaggagc agttcaacag cacgttccgt 540gtggtcagcg tcctcaccgt
cgtgcaccag gactggctga acggcaagga gtacaagtgc 600aaggtctcca
acaaaggcct cccagccccc atcgagaaaa ccatctccaa aaccaaaggg
660cagccccgag aaccacaggt gtacaccctg cccccatccc gggaggagat
gaccaagaac 720caggtcagcc tgacctgcct ggtcaaaggc ttctacccca
gcgacatctc cgtggagtgg 780gagagcaatg ggcagccgga gaacaactac
aagaccacac ctcccatgct ggactccgac 840ggctccttct tcctctacag
caagctcacc gtggacaaga gcaggtggca gcaggggaac 900gtcttctcat
gctccgtgat gcatgaggct ctgcacaacc actacacaca gaagagcctc
960tccctgtctc cgggtaaatg a 981371981DNAhomo sapiens; 371gcctccacca
agggcccatc ggtcttcccc ctggcgccct gctccaggag cacctccgag 60agcacagcgg
ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg
120tggaactcag gcgctctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca 180ggactctact ccctcagcag cgtggtgacc gtgacctcca
gcaacttcgg cacccagacc 240tacacctgca acgtagatca caagcccagc
aacaccaagg tggacaagac agttgagcgc 300aaatgttgtg tcgagtgccc
accgtgccca gcaccacctg tggcaggacc gtcagtcttc 360ctcttccccc
caaaacccaa ggacaccctc atgatctccc ggacccctga ggtcacgtgc
420gtggtggtgg acgtgagcca cgaagacccc gaggtccagt tcaactggta
cgtggacggc 480atggaggtgc ataatgccaa gacaaagcca cgggaggagc
agttcaacag cacgttccgt 540gtggtcagcg tcctcaccgt cgtgcaccag
gactggctga acggcaagga gtacaagtgc 600aaggtctcca acaaaggcct
cccagccccc atcgagaaaa ccatctccaa aaccaaaggg 660cagccccgag
aaccacaggt gtacaccctg cccccatccc gggaggagat gaccaagaac
720caggtcagcc tgacctgcct ggtcaaaggc ttctacccca gcgacatctc
cgtggagtgg 780gagagcaatg ggcagccgga gaacaactac aagaccacac
ctcccatgct ggactccgac 840ggctccttct tcctctacag caagctcacc
gtggacaaga gcaggtggca gcaggggaac 900gtcttctcat gctccgtgat
gcatgaggct ctgcacaacc actacacaca gaagagcctc 960tccctgtctc
cgggtaaatg a 9813721739DNAhomo sapiens; 372gcctccacca agggcccatc
ggtcttcccc ctggcgccct gctccaggag cacctccgag 60agcacagcgg ccctgggctg
cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 120tggaactcag
gcgctctgac cagcggcgtg cacaccttcc cggctgtcct acagtcctca
180ggactctact ccctcagcag cgtggtgacc gtgacctcca gcaacttcgg
cacccagacc 240tacacctgca acgtagatca caagcccagc aacaccaagg
tggacaagac agttggtgag 300aggccagctc agggagggag ggtgtctgct
ggaagccagg ctcagccctc ctgcctggac 360gcaccccggc tgtgcagccc
cagcccaggg cagcaaggca ggccccatct gtctcctcac 420ccggaggcct
ctgcccgccc cactcatgct cagggagagg gtcttctggc tttttccacc
480aggctccagg caggcacagg ctgggtgccc ctaccccagg cccttcacac
acaggggcag 540gtgcttggct cagacctgcc aaaagccata tccgggagga
ccctgcccct gacctaagcc 600gaccccaaag gccaaactgt ccactccctc
agctcggaca ccttctctcc tcccagatcc 660gagtaactcc caatcttctc
tctgcagagc gcaaatgttg tgtcgagtgc ccaccgtgcc 720caggtaagcc
agcccaggcc tcgccctcca gctcaaggcg ggacaggtgc cctagagtag
780cctgcatcca gggacagacc ccagctgggt gctgacacgt ccacctccat
ctcttcctca 840gcaccacctg tggcaggacc gtcagtcttc ctcttccccc
caaaacccaa ggacaccctc 900atgatctccc ggacccctga ggtcacgtgc
gtggtggtgg acgtgagcca cgaagacccc 960gaggtccagt tcaactggta
cgtggacggc atggaggtgc ataatgccaa gacaaagcca 1020cgggaggagc
agttcaacag cacgttccgt gtggtcagcg tcctcaccgt cgtgcaccag
1080gactggctga acggcaagga gtacaagtgc aaggtctcca acaaaggcct
cccagccccc 1140atcgagaaaa ccatctccaa aaccaaaggt gggacccgcg
gggtatgagg gccacatgga 1200cagaggccgg ctcggcccac cctctgccct
gggagtgacc gctgtgccaa cctctgtccc 1260tacagggcag ccccgagaac
cacaggtgta caccctgccc ccatcccggg aggagatgac 1320caagaaccag
gtcagcctga cctgcctggt caaaggcttc taccccagcg acatctccgt
1380ggagtgggag agcaatgggc agccggagaa caactacaag accacacctc
ccatgctgga 1440ctccgacggc tccttcttcc tctacagcaa gctcaccgtg
gacaagagca ggtggcagca 1500ggggaacgtc ttctcatgct ccgtgatgca
tgaggctctg cacaaccact acacacagaa 1560gagcctctcc ctgtctccgg
gtaaatgagt gccacggccg gcaagccccc gctccccagg 1620ctctcggggt
cgcgcgagga tgcttggcac gtaccccgtc tacatacttc ccgggcaccc
1680agcatggaaa taaagcaccc agcgctgccc tgggcccctg cgagactgtg
atggttctt 17393732304DNAhomo sapiens; 373cttccaccaa gggcccatcg
gtcttccccc tggcgccctg ctccaggagc acctctgggg 60gcacagcggc cctgggctgc
ctggtcaagg actacttccc agaaccggtg acggtgtcgt 120ggaactcagg
cgccctgacc agcggcgtgc acaccttccc ggctgtccta cagtcctcag
180gactctactc cctcagcagc gtggtgaccg tgccctccag cagcttgggc
acccagacct 240acacctgcaa cgtgaatcac aagcccagca acaccaaggt
ggacaagaga gttggtgaga 300ggccagcgca gggagggagg gtgtctgctg
gaagccaggc tcagccctcc tgcctggacg 360catcccggct gtgcagtccc
agcccagggc accaaggcag gccccgtctg actcctcacc 420cggaggcctc
tgcccgcccc actcatgctc agggagaggg tcttctggct ttttccacca
480ggctccgggc aggcacaggc tggatgcccc taccccaggc ccttcacaca
caggggcagg 540tgctgcgctc agagctgcca agagccatat ccaggaggac
cctgcccctg acctaagccc 600accccaaagg ccaaactctc tactcactca
gctcagatac cttctctctt cccagatctg 660agtaactccc aatcttctct
ctgcagagct caaaacccca cttggtgaca caactcacac 720atgcccacgg
tgcccaggta agccagccca ggcctcgccc tccagctcaa ggcgggacaa
780gagccctaga gtggcctgag tccagggaca ggccccagca gggtgctgac
gcatccacct 840ccatcccaga tccccgtaac tcccaatctt ctctctgcag
agcccaaatc ttgtgacaca 900cctcccccgt gcccacggtg cccaggtaag
ccagcccagg cctcgccctc cagctcaagg 960caggacaaga gccctagagt
ggcctgagtc cagggacagg ccccagcagg gtgctgacgc 1020gtccacctcc
atcccagatc cccgtaactc ccaatcttct ctctgcagag cccaaatctt
1080gtgacacacc tcccccatgc ccacggtgcc caggtaagcc agcccaggcc
tcgccctcca 1140gctcaaggcg ggacaagagc cctagagtgg cctgagtcca
gggacaggcc ccagcagggt 1200gctgacgcat ccacctccat cccagatccc
cgtaactccc aatcttctct ctgcagagcc 1260caaatcttgt gacacacctc
ccccgtgccc aaggtgccca ggtaagccag cccaggcctc 1320gccctccagc
tcaaggcagg acaggtgccc tagagtggcc tgcatccagg gacaggtccc
1380agtcgggtgc tgacacatct gcctccatct cttcctcagc acctgaactc
ctgggaggac 1440cgtcagtctt cctcttcccc ccaaaaccca aggataccct
tatgatttcc cggacccctg 1500aggtcacgtg cgtggtggtg gacgtgagcc
acgaagaccc cgaggtccag ttcaagtggt 1560acgtggacgg cgtggaggtg
cataatgcca agacaaagcc gcgggaggag cagtacaaca 1620gcacgttccg
tgtggtcagc gtcctcaccg tcctgcacca ggactggctg aacggcaagg
1680agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa
accatctcca 1740aaaccaaagg tgggacccgc ggggtatgag ggccacatgg
acagaggcca gcttgaccca 1800ccctctgccc tgggagtgac cgctgtgcca
acctctgtcc ctacaggaca gccccgagaa 1860ccacaggtgt acaccctgcc
cccatcccgg gaggagatga ccaagaacca ggtcagcctg 1920acctgcctgg
tcaaaggctt ctaccccagc gacatcgccg tggagtggga gagcagcggg
1980cagccggaga acaactacaa caccacgcct cccatgctgg actccgacgg
ctccttcttc 2040ctctacagca agctcaccgt ggacaagagc aggtggcagc
aggggaacat cttctcatgc 2100tccgtgatgc atgaggctct gcacaaccgc
ttcacgcaga agagcctctc cctgtctccg 2160ggtaaatgag tgcgacggcc
ggcaagcccc cgctccccgg gctctcgggg tcgcgcgagg 2220atgcttggca
cgtaccccgt gtacatactt cccgggcacc cagcatggaa ataaagcacc
2280cagcgctgcc ctgggcccct gcga 23043741134DNAhomo
sapiens;misc_feature(1)..(1)n is a, c, g, or t 374ncttccacca
agggcccatc ggtcttcccc ctggcgccct gctccaggag cacctctggg 60ggcacagcgg
ccctgggctg cctggtcaag gactacttcc cagaaccggt gacggtgtcg
120tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca 180ggactctact ccctcagcag cgtggtgacc gtgccctcca
gcagcttggg cacccagacc 240tacacctgca acgtgaatca caagcccagc
aacaccaagg tggacaagag agttgagctc 300aaaaccccac ttggtgacac
aactcacaca tgcccacggt gcccagagcc caaatcttgt 360gacacacctc
ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca
420tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc
aaggtgccca 480gcacctgaac tcctgggagg accgtcagtc ttcctcttcc
ccccaaaacc caaggatacc 540cttatgattt cccggacccc tgaggtcacg
tgcgtggtgg tggacgtgag ccacgaagac 600cccgaggtcc agttcaagtg
gtacgtggac ggcgtggagg tgcataatgc caagacaaag 660ccgcgggagg
agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac
720caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc
cctcccagcc 780cccatcgaga aaaccatctc caaaaccaaa ggacagcccc
gagaaccaca ggtgtacacc 840ctgcccccat cccgggagga gatgaccaag
aaccaggtca gcctgacctg cctggtcaaa 900ggcttctacc ccagcgacat
cgccgtggag tgggagagca gcgggcagcc ggagaacaac 960tacaacacca
cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc
1020accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt
gatgcatgag 1080gctctgcaca accgcttcac gcagaagagc ctctccctgt
ctccgggtaa atga 11343751134DNAhomo sapiens;misc_feature(1)..(1)n is
a, c, g, or t 375ncttccacca agggcccatc ggtcttcccc ctggcgccct
gctccaggag cacctctggg 60ggcacagcgg ccctgggctg cctggtcaag gactacttcc
cagaaccggt gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg
cacaccttcc cggctgtcct acagtcctca 180ggactctact ccctcagcag
cgtggtgacc gtgccctcca gcagcttggg cacccagacc 240tacacctgca
acgtgaatca caagcccagc aacaccaagg tggacaagag agttgagctc
300aaaaccccac ttggtgacac
aactcacaca tgcccacggt gcccagagcc caaatcttgt 360gacacacctc
ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca
420tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc
aaggtgccca 480gcacctgaac tcctgggagg accgtcagtc ttcctcttcc
ccccaaaacc caaggatacc 540cttatgattt cccggacccc tgaggtcacg
tgcgtggtgg tggacgtgag ccacgaagac 600cccgaggtcc agttcaagtg
gtacgtggac ggcgtggagg tgcataatgc caagacaaag 660ctgcgggagg
agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac
720caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc
cctcccagcc 780cccatcgaga aaaccatctc caaaaccaaa ggacagcccc
gagaaccaca ggtgtacacc 840ctgcccccat cccgggagga gatgaccaag
aaccaggtca gcctgacctg cctggtcaaa 900ggcttctacc ccagcgacat
cgccgtggag tgggagagca gcgggcagcc ggagaacaac 960tacaacacca
cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc
1020accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt
gatgcatgag 1080gctctgcaca accgctacac gcagaagagc ctctccctgt
ctccgggtaa atga 11343762304DNAhomo sapiens; 376cttccaccaa
gggcccatcg gtcttccccc tggcgccctg ctccaggagc acctctgggg 60gcacagcggc
cctgggctgc ctggtcaagg actacttccc agaaccggtg acggtgtcgt
120ggaactcagg cgccctgacc agcggcgtgc acaccttccc ggctgtccta
cagtcctcag 180gactctactc cctcagcagc gtggtgaccg tgccctccag
cagcttgggc acccagacct 240acacctgcaa cgtgaatcac aagcccagca
acaccaaggt ggacaagaga gttggtgaga 300ggccagcgca gggagggagg
gtgtctgctg gaagccaggc tcagccctcc tgcctggacg 360catcccggct
gtgcagtccc agcccagggc accaaggcag gccccgtctg actcctcacc
420cggaggcctc tgcccgcccc actcatgctc agggagaggg tcttctggct
ttttccacca 480ggctccgggc aggcacaggc tggatgcccc taccccaggc
ccttcacaca caggggcagg 540tgctgcgctc agagctgcca agagccatat
ccaggaggac cctgcccctg acctaagccc 600accccaaagg ccaaactctc
tactcactca gctcagatac cttctctctt cccagatctg 660agtaactccc
aatcttctct ctgcagagct caaaacccca cttggtgaca caactcacac
720atgcccacgg tgcccaggta agccagccca ggcctcgccc tccagctcaa
ggcgggacaa 780gagccctaga gtggcctgag tccagggaca ggccccagca
gggtgctgac gcatccacct 840ccatcccaga tccccgtaac tcccaatctt
ctctctgcag agcccaaatc ttgtgacaca 900cctcccccgt gcccacggtg
cccaggtaag ccagcccagg cctcgccctc cagctcaagg 960caggacaaga
gccctagagt ggcctgagtc cagggacagg ccccagcagg gtgctgacgc
1020gtccacctcc atcccagatc cccgtaactc ccaatcttct ctctgcagag
cccaaatctt 1080gtgacacacc tcccccatgc ccacggtgcc caggtaagcc
agcccaggcc tcgccctcca 1140gctcaaggcg ggacaagagc cctagagtgg
cctgagtcca gggacaggcc ccagcagggt 1200gctgacgcat ccacctccat
cccagatccc cgtaactccc aatcttctct ctgcagagcc 1260caaatcttgt
gacacacctc ccccgtgccc aaggtgccca ggtaagccag cccaggcctc
1320gccctccagc tcaaggcagg acaggtgccc tagagtggcc tgcatccagg
gacaggtccc 1380agtcgggtgc tgacacatct gcctccatct cttcctcagc
acctgaactc ctgggaggac 1440cgtcagtctt cctcttcccc ccaaaaccca
aggataccct tatgatttcc cggacccctg 1500aggtcacgtg cgtggtggtg
gacgtgagcc acgaagaccc cgaggtccag ttcaagtggt 1560acgtggacgg
cgtggaggtg cataatgcca agacaaagct gcgggaggag cagtacaaca
1620gcacgttccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg
aacggcaagg 1680agtacaagtg caaggtctcc aacaaagccc tcccagcccc
catcgagaaa accatctcca 1740aaaccaaagg tgggacccgc ggggtatgag
ggccacatgg acagaggcca gcttgaccca 1800ccctctgccc tgggagtgac
cgctgtgcca acctctgtcc ctacaggaca gccccgagaa 1860ccacaggtgt
acaccctgcc cccatcccgg gaggagatga ccaagaacca ggtcagcctg
1920acctgcctgg tcaaaggctt ctaccccagc gacatcgccg tggagtggga
gagcagcggg 1980cagccggaga acaactacaa caccacgcct cccatgctgg
actccgacgg ctccttcttc 2040ctctacagca agctcaccgt ggacaagagc
aggtggcagc aggggaacat cttctcatgc 2100tccgtgatgc atgaggctct
gcacaaccgc tacacgcaga agagcctctc cctgtctccg 2160ggtaaatgag
tgcgacggcc ggcaagcccc cgctccccgg gctctcgggg tcgcgcgagg
2220atgcttggca cgtaccccgt gtacatactt cccgggcacc cagcatggaa
ataaagcacc 2280cagcgctgcc ctgggcccct gcga 23043771134DNAhomo
sapiens;misc_feature(1)..(1)n is a, c, g, or t 377ncttccacca
agggcccatc ggtcttcccc ctggcgccct gctccaggag cacctctggg 60ggcacagcgg
ccctgggctg cctggtcaag gactacttcc cagaaccggt gacggtgtcg
120tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca 180ggactctact ccctcagcag cgtggtgacc gtgccctcca
gcagcttggg cacccagacc 240tacacctgca acgtgaatca caagcccagc
aacaccaagg tggacaagag agttgagctc 300aaaaccccac ttggtgacac
aactcacaca tgcccacggt gcccagagcc caaatcttgt 360gacacacctc
ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca
420tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc
aaggtgccca 480gcacctgaac tcctgggagg accgtcagtc ttcctcttcc
ccccaaaacc caaggatacc 540cttatgattt cccggacccc tgaggtcacg
tgcgtggtgg tggacgtgag ccacgaagac 600cccgaggtcc agttcaagtg
gtacgtggac ggcgtggagg tgcataatgc caagacaaag 660ccgcgggagg
agcagttcaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac
720caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc
cctcccagcc 780cccatcgaga aaaccatctc caaaaccaaa ggacagcccc
gagaaccaca ggtgtacacc 840ctgcccccat cccgggagga gatgaccaag
aaccaggtca gcctgacctg cctggtcaaa 900ggcttctacc ccagcgacat
cgccgtggag tgggagagca gcgggcagcc ggagaacaac 960tacaacacca
cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc
1020accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt
gatgcatgag 1080gctctgcaca accgcttcac gcagaagagc ctctccctgt
ctccgggtaa atga 11343782304DNAhomo sapiens; 378cttccaccaa
gggcccatcg gtcttccccc tggcgccctg ctccaggagc acctctgggg 60gcacagcggc
cctgggctgc ctggtcaagg actacttccc agaaccggtg acggtgtcgt
120ggaactcagg cgccctgacc agcggcgtgc acaccttccc ggctgtccta
cagtcctcag 180gactctactc cctcagcagc gtggtgaccg tgccctccag
cagcttgggc acccagacct 240acacctgcaa cgtgaatcac aagcccagca
acaccaaggt ggacaagaga gttggtgaga 300ggccagcgca gggagggagg
gtgtctgctg gaagccaggc tcagccctcc tgcctggacg 360catcccggct
gtgcagtccc agcccagggc accaaggcag gccccgtctg actcctcacc
420cggaggcctc tgcccgcccc actcatgctc agggagaggg tcttctggct
ttttccacca 480ggctccgggc aggcacaggc tggatgcccc taccccaggc
ccttcacaca caggggcagg 540tgctgcgctc agagctgcca agagccatat
ccaggaggac cctgcccctg acctaagccc 600accccaaagg ccaaactctc
tactcactca gctcagatac cttctctctt cccagatctg 660agtaactccc
aatcttctct ctgcagagct caaaacccca cttggtgaca caactcacac
720atgcccacgg tgcccaggta agccagccca ggcctcgccc tccagctcaa
ggcgggacaa 780gagccctaga gtggcctgag tccagggaca ggccccagca
gggtgctgac gcatccacct 840ccatcccaga tccccgtaac tcccaatctt
ctctctgcag agcccaaatc ttgtgacaca 900cctcccccgt gcccacggtg
cccaggtaag ccagcccagg cctcgccctc cagctcaagg 960caggacaaga
gccctagagt ggcctgagtc cagggacagg ccccagcagg gtgctgacgc
1020gtccacctcc atcccagatc cccgtaactc ccaatcttct ctctgcagag
cccaaatctt 1080gtgacacacc tcccccatgc ccacggtgcc caggtaagcc
agcccaggcc tcgccctcca 1140gctcaaggcg ggacaagagc cctagagtgg
cctgagtcca gggacaggcc ccagcagggt 1200gctgacgcat ccacctccat
cccagatccc cgtaactccc aatcttctct ctgcagagcc 1260caaatcttgt
gacacacctc ccccgtgccc aaggtgccca ggtaagccag cccaggcctc
1320gccctccagc tcaaggcagg acaggtgccc tagagtggcc tgcatccagg
gacaggtccc 1380agtcgggtgc tgacacatct gcctccatct cttcctcagc
acctgaactc ctgggaggac 1440cgtcagtctt cctcttcccc ccaaaaccca
aggataccct tatgatttcc cggacccctg 1500aggtcacgtg cgtggtggtg
gacgtgagcc acgaagaccc cgaggtccag ttcaagtggt 1560acgtggacgg
cgtggaggtg cataatgcca agacaaagcc gcgggaggag cagttcaaca
1620gcacgttccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg
aacggcaagg 1680agtacaagtg caaggtctcc aacaaagccc tcccagcccc
catcgagaaa accatctcca 1740aaaccaaagg tgggacccgc ggggtatgag
ggccacatgg acagaggcca gcttgaccca 1800ccctctgccc tgggagtgac
cgctgtgcca acctctgtcc ctacaggaca gccccgagaa 1860ccacaggtgt
acaccctgcc cccatcccgg gaggagatga ccaagaacca ggtcagcctg
1920acctgcctgg tcaaaggctt ctaccccagc gacatcgccg tggagtggga
gagcagcggg 1980cagccggaga acaactacaa caccacgcct cccatgctgg
actccgacgg ctccttcttc 2040ctctacagca agctcaccgt ggacaagagc
aggtggcagc aggggaacat cttctcatgc 2100tccgtgatgc atgaggctct
gcacaaccgc ttcacgcaga agagcctctc cctgtctccg 2160ggtaaatgag
tgcgacggcc ggcaagcccc cgctccccgg gctctcgggg tcgcgcgagg
2220atgcttggca cgtaccccgt gtacatactt cccgggcacc cagcatggaa
ataaagcacc 2280cagcgctgcc ctgggcccct gcga 23043791717DNAhomo
sapiens; 379gcttccacca agggcccatc ggtcttcccc ctggcgccct gctccaggag
cacctccgag 60agcacagccg ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacgaagacc 240tacacctgca acgtagatca
caagcccagc aacaccaagg tggacaagag agttggtgag 300aggccagcac
agggagggag ggtgtctgct ggaagccagg ctcagccctc ctgcctggac
360gcaccccggc tgtgcagccc cagcccaggg cagcaaggca ggccccatct
gtctcctcac 420ccggaggcct ctgaccaccc cactcatgct cagggagagg
gtcttctgga tttttccacc 480aggctccggg cagccacagg ctggatgccc
ctaccccagg ccctgcgcat acaggggcag 540gtgctgcgct cagacctgcc
aagagccata tccgggagga ccctgcccct gacctaagcc 600caccccaaag
gccaaactct ccactccctc agctcagaca ccttctctcc tcccagatct
660gagtaactcc caatcttctc tctgcagagt ccaaatatgg tcccccatgc
ccatcatgcc 720caggtaagcc aacccaggcc tcgccctcca gctcaaggcg
ggacaggtgc cctagagtag 780cctgcatcca gggacaggcc ccagccgggt
gctgacgcat ccacctccat ctcttcctca 840gcacctgagt tcctgggggg
accatcagtc ttcctgttcc ccccaaaacc caaggacact 900ctcatgatct
cccggacccc tgaggtcacg tgcgtggtgg tggacgtgag ccaggaagac
960cccgaggtcc agttcaactg gtacgtggat ggcgtggagg tgcataatgc
caagacaaag 1020ccgcgggagg agcagttcaa cagcacgtac cgtgtggtca
gcgtcctcac cgtcctgcac 1080caggactggc tgaacggcaa ggagtacaag
tgcaaggtct ccaacaaagg cctcccgtcc 1140tccatcgaga aaaccatctc
caaagccaaa ggtgggaccc acggggtgcg agggccacat 1200ggacagaggt
cagctcggcc caccctctgc cctgggagtg accgctgtgc caacctctgt
1260ccctacaggg cagccccgag agccacaggt gtacaccctg cccccatccc
aggaggagat 1320gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc
ttctacccca gcgacatcgc 1380cgtggagtgg gagagcaatg ggcagccgga
gaacaactac aagaccacgc ctcccgtgct 1440ggactccgac ggctccttct
tcctctacag caggctcacc gtggacaaga gcaggtggca 1500ggaggggaat
gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacacaca
1560gaagagcctc tccctgtctc tgggtaaatg agtgccaggg ccggcaagcc
cccgctcccc 1620gggctctcgg ggtcgcgcga ggatgcttgg cacgtacccc
gtgtacatac ttcccgggcg 1680cccagcatgg aaataaagca cccagcgctg ccctggg
1717380984DNAhomo sapiens; 380gcttccacca agggcccatc ggtcttcccc
ctggcgccct gctccaggag cacctccgag 60agcacagccg ccctgggctg cctggtcaag
gactacttcc ccgaaccggt gacggtgtcg 120tggaactcag gcgccctgac
cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180ggactctact
ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacgaagacc
240tacacctgca acgtagatca caagcccagc aacaccaagg tggacaagag
agttgagtcc 300aaatatggtc ccccatgccc atcatgccca gcacctgagt
tcctgggggg accatcagtc 360ttcctgttcc ccccaaaacc caaggacact
ctcatgatct cccggacccc tgaggtcacg 420tgcgtggtgg tggacgtgag
ccaggaagac cccgaggtcc agttcaactg gtacgtggat 480ggcgtggagg
tgcataatgc caagacaaag ccgcgggagg agcagttcaa cagcacgtac
540cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaacggcaa
ggagtacaag 600tgcaaggtct ccaacaaagg cctcccgtcc tccatcgaga
aaaccatctc caaagccaaa 660gggcagcccc gagagccaca ggtgtacacc
ctgcccccat cccaggagga gatgaccaag 720aaccaggtca gcctgacctg
cctggtcaaa ggcttctacc ccagcgacat cgccgtggag 780tgggagagca
atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc
840gacggctcct tcttcctcta cagcaggctc accgtggaca agagcaggtg
gcaggagggg 900aatgtcttct catgctccgt gatgcatgag gctctgcaca
accactacac acagaagagc 960ctctccctgt ctctgggtaa atga
984381984DNAhomo sapiens; 381gcttccacca agggcccatc ggtcttcccc
ctggcgccct gctccaggag cacctccgag 60agcacagccg ccctgggctg cctggtcaag
gactacttcc ccgaaccggt gacggtgtcg 120tggaactcag gcgccctgac
cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180ggactctact
ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacgaagacc
240tacacctgca acgtagatca caagcccagc aacaccaagg tggacaagag
agttgagtcc 300aaatatggtc ccccatgccc atcatgccca gcacctgagt
tcctgggggg accatcagtc 360ttcctgttcc ccccaaaacc caaggacact
ctcatgatct cccggacccc tgaggtcacg 420tgcgtggtgg tggacgtgag
ccaggaagac cccgaggtcc agttcaactg gtacgtggat 480ggcgtggagg
tgcataatgc caagacaaag ccgcgggagg agcagttcaa cagcacgtac
540cgtgtggtca gcgtcctcac cgtcgtgcac caggactggc tgaacggcaa
ggagtacaag 600tgcaaggtct ccaacaaagg cctcccgtcc tccatcgaga
aaaccatctc caaagccaaa 660gggcagcccc gagagccaca ggtgtacacc
ctgcccccat cccaggagga gatgaccaag 720aaccaggtca gcctgacctg
cctggtcaaa ggcttctacc ccagcgacat cgccgtggag 780tgggagagca
atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc
840gacggctcct tcttcctcta cagcaggctc accgtggaca agagcaggtg
gcaggagggg 900aatgtcttct catgctccgt gatgcatgag gctctgcaca
accactacac acagaagagc 960ctctccctgt ctctgggtaa atga
9843821717DNAhomo sapiens; 382gcttccacca agggcccatc ggtcttcccc
ctggcgccct gctccaggag cacctccgag 60agcacagccg ccctgggctg cctggtcaag
gactacttcc ccgaaccggt gacggtgtcg 120tggaactcag gcgccctgac
cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180ggactctact
ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacgaagacc
240tacacctgca acgtagatca caagcccagc aacaccaagg tggacaagag
agttggtgag 300aggccagcac agggagggag ggtgtctgct ggaagccagg
ctcagccctc ctgcctggac 360gcaccccggc tgtgcagccc cagcccaggg
cagcaaggca ggccccatct gtctcctcac 420ccggaggcct ctgaccaccc
cactcatgct cagggagagg gtcttctgga tttttccacc 480aggctccggg
cagccacagg ctggatgccc ctaccccagg ccctgcgcat acaggggcag
540gtgctgcgct cagacctgcc aagagccata tccgggagga ccctgcccct
gacctaagcc 600caccccaaag gccaaactct ccactccctc agctcagaca
ccttctctcc tcccagatct 660gagtaactcc caatcttctc tctgcagagt
ccaaatatgg tcccccatgc ccatcatgcc 720caggtaagcc aacccaggcc
tcgccctcca gctcaaggcg ggacaggtgc cctagagtag 780cctgcatcca
gggacaggcc ccagccgggt gctgacgcat ccacctccat ctcttcctca
840gcacctgagt tcctgggggg accatcagtc ttcctgttcc ccccaaaacc
caaggacact 900ctcatgatct cccggacccc tgaggtcacg tgcgtggtgg
tggacgtgag ccaggaagac 960cccgaggtcc agttcaactg gtacgtggat
ggcgtggagg tgcataatgc caagacaaag 1020ccgcgggagg agcagttcaa
cagcacgtac cgtgtggtca gcgtcctcac cgtcgtgcac 1080caggactggc
tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagg cctcccgtcc
1140tccatcgaga aaaccatctc caaagccaaa ggtgggaccc acggggtgcg
agggccacat 1200ggacagaggt cagctcggcc caccctctgc cctgggagtg
accgctgtgc caacctctgt 1260ccctacaggg cagccccgag agccacaggt
gtacaccctg cccccatccc aggaggagat 1320gaccaagaac caggtcagcc
tgacctgcct ggtcaaaggc ttctacccca gcgacatcgc 1380cgtggagtgg
gagagcaatg ggcagccgga gaacaactac aagaccacgc ctcccgtgct
1440ggactccgac ggctccttct tcctctacag caggctcacc gtggacaaga
gcaggtggca 1500ggaggggaat gtcttctcat gctccgtgat gcatgaggct
ctgcacaacc actacacaca 1560gaagagcctc tccctgtctc tgggtaaatg
agtgccaggg ccggcaagcc cccgctcccc 1620gggctctcgg ggtcgcgcga
ggatgcttgg cacgtacccc gtgtacatac ttcccgggcg 1680cccagcatgg
aaataaagca cccagcgctg ccctggg 17173831546DNAhomo sapiens;
383gcatccccga ccagccccaa ggtcttcccg ctgagcctct gcagcaccca
gccagatggg 60aacgtggtca tcgcctgcct ggtccagggc ttcttccccc aggagccact
cagtgtgacc 120tggagcgaaa gcggacaggg cgtgaccgcc agaaacttcc
cacccagcca ggatgcctcc 180ggggacctgt acaccacgag cagccagctg
accctgccgg ccacacagtg cctagccggc 240aagtccgtga catgccacgt
gaagcactac acgaatccca gccaggatgt gactgtgccc 300tgcccaggtc
agagggcagg ctggggagtg gggcggggcc accccgtcgt gccctgacac
360tgcgcctgca cccgtgttcc ccacagggag ccgccccttc actcacacca
gagtggaccg 420cgggccgagc cccaggaggt ggtggtggac aggccaggag
gggcgaggcg ggggcatggg 480gaagtatgtg ctgaccagct caggccatct
ctccactcca gttccctcaa ctccacctac 540cccatctccc tcaactccac
ctaccccatc tccctcatgc tgccaccccc gactgtcact 600gcaccgaccg
gccctcgagg acctgctctt aggttcagaa gcgaacctca cgtgcacact
660gaccggcctg agagatgcct caggtgtcac cttcacctgg acgccctcaa
gtgggaagag 720cgctgttcaa ggaccacctg agcgtgacct ctgtggctgc
tacagcgtgt ccagtgtcct 780gccgggctgt gccgagccat ggaaccatgg
gaagaccttc acttgcactg ctgcctaccc 840cgagtccaag accccgctaa
ccgccaccct ctcaaaatcc ggtgggtcca gaccctgctc 900ggggccctgc
tcagtgctct ggtttgcaaa gcatattcct ggcctgcctc ctccctccca
960atcctgggct ccagtgctca tgccaagtac agagggaaac tgaggcaggc
tgaggggcca 1020ggacacagcc cagggtgccc accagagcag aggggctctc
tcatcccctg cccagccccc 1080tgacctggct ctctaccctc caggaaacac
attccggccc gaggtccacc tgctgccgcc 1140gccgtcggag gagctggccc
tgaacgagct ggtgacgctg acgtgcctgg cacgcggctt 1200cagccccaag
gatgtgctgg ttcgctggct gcaggggtca caggagctgc cccgcgagaa
1260gtacctgact tgggcatccc ggcaggagcc cagccagggc accaccacct
tcgctgtgac 1320cagcatactg cgcgtggcag ccgaggactg gaagaagggg
gacaccttct cctgcatggt 1380gggccacgag gccctgccgc tggccttcac
acagaagacc atcgaccgct tggcgggtaa 1440acccacccat gtcaatgtgt
ctgttgtcat ggcggaggtg gacggcacct gctactgagc 1500cgcccgcctg
tccccacccc tgaataaact ccatgctccc ccaagc 15463841062DNAhomo sapiens;
384gcatccccga ccagccccaa ggtcttcccg ctgagcctct gcagcaccca
gccagatggg 60aacgtggtca tcgcctgcct ggtccagggc ttcttccccc aggagccact
cagtgtgacc 120tggagcgaaa gcggacaggg cgtgaccgcc agaaacttcc
cacccagcca ggatgcctcc 180ggggacctgt acaccacgag cagccagctg
accctgccgg ccacacagtg cctagccggc 240aagtccgtga catgccacgt
gaagcactac acgaatccca gccaggatgt gactgtgccc 300tgcccagttc
cctcaactcc acctacccca tctccctcaa ctccacctac cccatctccc
360tcatgctgcc acccccgact gtcactgcac cgaccggccc tcgaggacct
gctcttaggt 420tcagaagcga acctcacgtg cacactgacc ggcctgagag
atgcctcagg tgtcaccttc 480acctggacgc cctcaagtgg gaagagcgct
gttcaaggac cacctgagcg tgacctctgt 540ggctgctaca gcgtgtccag
tgtcctgccg ggctgtgccg agccatggaa ccatgggaag 600accttcactt
gcactgctgc ctaccccgag tccaagaccc cgctaaccgc caccctctca
660aaatccggaa acacattccg gcccgaggtc cacctgctgc cgccgccgtc
ggaggagctg 720gccctgaacg agctggtgac gctgacgtgc ctggcacgcg
gcttcagccc caaggatgtg 780ctggttcgct ggctgcaggg gtcacaggag
ctgccccgcg agaagtacct gacttgggca 840tcccggcagg agcccagcca
gggcaccacc accttcgctg tgaccagcat actgcgcgtg 900gcagccgagg
actggaagaa gggggacacc ttctcctgca tggtgggcca cgaggccctg
960ccgctggcct tcacacagaa gaccatcgac cgcttggcgg gtaaacccac
ccatgtcaat 1020gtgtctgttg tcatggcgga ggtggacggc acctgctact ga
10623851546DNAhomo sapiens; 385gcatccccga ccagccccaa ggtcttcccg
ctgagcctct gcagcaccca gccagatggg 60aacgtggtca tcgcctgcct ggtccagggc
ttcttccccc aggagccact cagtgtgacc 120tggagcgaaa gcggacaggg
cgtgaccgcc agaaacttcc cacccagcca ggatgcctcc 180ggggacctgt
acaccacgag cagccagctg accctgccgg ccacacagtg cctagccggc
240aagtccgtga catgccacgt gaagcactac acgaatccca gccaggatgt
gactgtgccc 300tgcccaggtc agagggcagg ctggggagtg gggcggggcc
accccgtcgt gccctgacac 360tgcgcctgca cccgtgttcc ccacagggag
ccgccccttc actcacacca gagtggaccg 420cgggccgagc cccaggaggt
ggtggtggac aggccaggag gggcgaggcg ggggcatggg 480gaagtatgtg
ctgaccagct caggccatct ctccactcca gttccctcaa ctccacctac
540cccatctccc tcaactccac ctaccccatc tccctcatgc tgccaccccc
gactgtcact 600gcaccgaccg gccctcgagg acctgctctt aggttcagaa
gcgaacctca cgtgcacact 660gaccggcctg agagatgcct caggtgtcac
cttcacctgg acgccctcaa gtgggaagag 720cgctgttcaa ggaccacctg
accgtgacct ctgtggctgc tacagcgtgt ccagtgtcct 780gccgggctgt
gccgagccat ggaaccatgg gaagaccttc acttgcactg ctgcctaccc
840cgagtccaag accccgctaa ccgccaccct ctcaaaatcc ggtgggtcca
gaccctgctc 900ggggccctgc tcagtgctct ggtttgcaaa gcatattcct
ggcctgcctc ctccctccca 960atcctgggct ccagtgctca tgccaagtac
agagggaaac tgaggcaggc tgaggggcca 1020ggacacagcc cagggtgccc
accagagcag aggggctctc tcatcccctg cccagccccc 1080tgacctggct
ctctaccctc caggaaacac attccggccc gaggtccacc tgctgccgcc
1140gccgtcggag gagctggccc tgaacgagct ggtgacgctg acgtgcctgg
cacgcggctt 1200cagccccaag gatgtgctgg ttcgctggct gcaggggtca
caggagctgc cccgcgagaa 1260gtacctgact tgggcatccc ggcaggagcc
cagccagggc accaccacct tcgctgtgac 1320cagcatactg cgcgtggcag
ccgaggactg gaagaagggg gacaccttct cctgcatggt 1380gggccacgag
gccctgccgc tggccttcac acagaagacc atcgaccgct tggcgggtaa
1440acccacccat gtcaatgtgt ctgttgtcat ggcggaggtg gacggcacct
gctactgagc 1500cgcccgcctg tccccacccc tgaataaact ccatgctccc ccaagc
15463861062DNAhomo sapiens; 386gcatccccga ccagccccaa ggtcttcccg
ctgagcctct gcagcaccca gccagatggg 60aacgtggtca tcgcctgcct ggtccagggc
ttcttccccc aggagccact cagtgtgacc 120tggagcgaaa gcggacaggg
cgtgaccgcc agaaacttcc cacccagcca ggatgcctcc 180ggggacctgt
acaccacgag cagccagctg accctgccgg ccacacagtg cctagccggc
240aagtccgtga catgccacgt gaagcactac acgaatccca gccaggatgt
gactgtgccc 300tgcccagttc cctcaactcc acctacccca tctccctcaa
ctccacctac cccatctccc 360tcatgctgcc acccccgact gtcactgcac
cgaccggccc tcgaggacct gctcttaggt 420tcagaagcga acctcacgtg
cacactgacc ggcctgagag atgcctcagg tgtcaccttc 480acctggacgc
cctcaagtgg gaagagcgct gttcaaggac cacctgaccg tgacctctgt
540ggctgctaca gcgtgtccag tgtcctgccg ggctgtgccg agccatggaa
ccatgggaag 600accttcactt gcactgctgc ctaccccgag tccaagaccc
cgctaaccgc caccctctca 660aaatccggaa acacattccg gcccgaggtc
cacctgctgc cgccgccgtc ggaggagctg 720gccctgaacg agctggtgac
gctgacgtgc ctggcacgcg gcttcagccc caaggatgtg 780ctggttcgct
ggctgcaggg gtcacaggag ctgccccgcg agaagtacct gacttgggca
840tcccggcagg agcccagcca gggcaccacc accttcgctg tgaccagcat
actgcgcgtg 900gcagccgagg actggaagaa gggggacacc ttctcctgca
tggtgggcca cgaggccctg 960ccgctggcct tcacacagaa gaccatcgac
cgcttggcgg gtaaacccac ccatgtcaat 1020gtgtctgttg tcatggcgga
ggtggacggc acctgctact ga 10623871507DNAhomo sapiens; 387gcatccccga
ccagccccaa ggtcttcccg ctgagcctcg acagcacccc ccaagatggg 60aacgtggtcg
tcgcatgcct ggtccagggc ttcttccccc aggagccact cagtgtgacc
120tggagcgaaa gcggacagaa cgtgaccgcc agaaacttcc cacctagcca
ggatgcctcc 180ggggacctgt acaccacgag cagccagctg accctgccgg
ccacacagtg cccagacggc 240aagtccgtga catgccacgt gaagcactac
acgaattcca gccaggatgt gactgtgccc 300tgccgaggtc agagggcagg
ctggggagtg gggcggggcc accccgtcct gccctgacac 360tgcgcctgca
cccgtgttcc ccacagggag ccgccccttc actcacacca gagtggaccg
420cgggccgagc cccaggaggt ggtggtggac aggccaggag gggcgaggcg
ggggcacggg 480gaagggcgtt ctgaccagct caggccatct ctccactcca
gttcccccac ctcccccatg 540ctgccacccc cgactgtcgc tgcaccgacc
ggccctcgag gacctgctct taggttcaga 600agcgaacctc acgtgcacac
tgaccggcct gagagatgcc tctggtgcca ccttcacctg 660gacgccctca
agtgggaaga gcgctgttca aggaccacct gagcgtgacc tctgtggctg
720ctacagcgtg tccagtgtcc tgcctggctg tgcccagcca tggaaccatg
gggagacctt 780cacctgcact gctgcccacc ccgagttgaa gaccccacta
accgccaaca tcacaaaatc 840cggtgggtcc agaccctgct cggggccctg
ctcagtgctc tggtttgcaa agcatattcc 900cggcctgcct cctccctccc
aatcctgggc tccagtgctc atgccaagta cagagggaaa 960ctgaggcagg
ctgaggggcc aggacacagc ccagggtgcc caccagagca gaggggctct
1020ctcatcccct gcccagcccc ctgacctggc tctctaccct ccaggaaaca
cattccggcc 1080cgaggtccac ctgctgccgc cgccgtcgga ggagctggcc
ctgaacgagc tggtgacgct 1140gacgtgcctg gcacgtggct tcagccccaa
ggatgtgctg gttcgctggc tgcaggggtc 1200acaggagctg ccccgcgaga
agtacctgac ttgggcatcc cggcaggagc ccagccaggg 1260caccaccacc
tacgctgtaa ccagcatact gcgcgtggca gctgaggact ggaagaaggg
1320ggagaccttc tcctgcatgg tgggccacga ggccctgccg ctggccttca
cacagaagac 1380catcgaccgc atggcgggta aacccaccca catcaatgtg
tctgttgtca tggcggaggc 1440ggatggcacc tgctactgag ccgcccgcct
gtccccaccc ctgaataaac tccatgctcc 1500cccaagc 15073881023DNAhomo
sapiens; 388gcatccccga ccagccccaa ggtcttcccg ctgagcctcg acagcacccc
ccaagatggg 60aacgtggtcg tcgcatgcct ggtccagggc ttcttccccc aggagccact
cagtgtgacc 120tggagcgaaa gcggacagaa cgtgaccgcc agaaacttcc
cacctagcca ggatgcctcc 180ggggacctgt acaccacgag cagccagctg
accctgccgg ccacacagtg cccagacggc 240aagtccgtga catgccacgt
gaagcactac acgaattcca gccaggatgt gactgtgccc 300tgccgagttc
ccccacctcc cccatgctgc cacccccgac tgtcgctgca ccgaccggcc
360ctcgaggacc tgctcttagg ttcagaagcg aacctcacgt gcacactgac
cggcctgaga 420gatgcctctg gtgccacctt cacctggacg ccctcaagtg
ggaagagcgc tgttcaagga 480ccacctgagc gtgacctctg tggctgctac
agcgtgtcca gtgtcctgcc tggctgtgcc 540cagccatgga accatgggga
gaccttcacc tgcactgctg cccaccccga gttgaagacc 600ccactaaccg
ccaacatcac aaaatccgga aacacattcc ggcccgaggt ccacctgctg
660ccgccgccgt cggaggagct ggccctgaac gagctggtga cgctgacgtg
cctggcacgt 720ggcttcagcc ccaaggatgt gctggttcgc tggctgcagg
ggtcacagga gctgccccgc 780gagaagtacc tgacttgggc atcccggcag
gagcccagcc agggcaccac cacctacgct 840gtaaccagca tactgcgcgt
ggcagctgag gactggaaga agggggagac cttctcctgc 900atggtgggcc
acgaggccct gccgctggcc ttcacacaga agaccatcga ccgcatggcg
960ggtaaaccca cccacatcaa tgtgtctgtt gtcatggcgg aggcggatgg
cacctgctac 1020tga 10233891507DNAhomo sapiens; 389gcatccccga
ccagccccaa ggtcttcccg ctgagcctcg acagcacccc ccaagatggg 60aacgtggtcg
tcgcatgcct ggtccagggc ttcttccccc aggagccact cagtgtgacc
120tggagcgaaa gcggacagaa cgtgaccgcc agaaacttcc cacctagcca
ggatgcctcc 180ggggacctgt acaccacgag cagccagctg accctgccgg
ccacacagtg cccagacggc 240aagtccgtga catgccacgt gaagcactac
acgaatccca gccaggatgt gactgtgccc 300tgcccaggtc agagggcagg
ctggggagtg gggcggggcc accccgtcct gccctgacac 360tgcgcctgca
cccgtgttcc ccacagggag ccgccccttc actcacacca gagtggaccg
420cgggccgagc cccaggaggt ggtggtggac aggccaggag gggcgaggcg
ggggcacggg 480gaagggcgtt ctgaccagct caggccatct ctccactcca
gttcccccac ctcccccatg 540ctgccacccc cgactgtcgc tgcaccgacc
ggccctcgag gacctgctct taggttcaga 600agcgaacctc acgtgcacac
tgaccggcct gagagatgcc tctggtgcca ccttcacctg 660gacgccctca
agtgggaaga gcgctgttca aggaccacct gagcgtgacc tctgtggctg
720ctacagcgtg tccagtgtcc tgcctggctg tgcccagcca tggaaccatg
gggagacctt 780cacctgcact gctgcccacc ccgagttgaa gaccccacta
accgccaaca tcacaaaatc 840cggtgggtcc agaccctgct cggggccctg
ctcagtgctc tggtttgcaa agcatattcc 900cggcctgcct cctccctccc
aatcctgggc tccagtgctc atgccaagta cagagggaaa 960ctgaggcagg
ctgaggggcc aggacacagc ccagggtgcc caccagagca gaggggctct
1020ctcatcccct gcccagcccc ctgacctggc tctctaccct ccaggaaaca
cattccggcc 1080cgaggtccac ctgctgccgc cgccgtcgga ggagctggcc
ctgaacgagc tggtgacgct 1140gacgtgcctg gcacgtggct tcagccccaa
ggatgtgctg gttcgctggc tgcaggggtc 1200acaggagctg ccccgcgaga
agtacctgac ttgggcatcc cggcaggagc ccagccaggg 1260caccaccacc
ttcgctgtaa ccagcatact gcgcgtggca gctgaggact ggaagaaggg
1320ggacaccttc tcctgcatgg tgggccacga ggccctgccg ctggccttca
cacagaagac 1380catcgaccgc atggcgggta aacccaccca catcaatgtg
tctgttgtca tggcggaggt 1440ggatggcacc tgctactgag ccgcccgcct
gtccccaccc ctgaataaac tccatgctcc 1500cccaagc 15073901022DNAhomo
sapiens; 390gcatccccga ccagccccaa ggtcttcccg ctgagcctcg acagcacccc
ccaagatggg 60aacgtggtcg tcgcatgcct ggtccagggc ttcttccccc aggagccact
cagtgtgacc 120tggagcgaaa gcggacagaa cgtgaccgcc agaaacttcc
cacctagcca ggatgcctcc 180ggggacctgt acaccacgag cagccagctg
accctgccgg ccacacagtg cccagacggc 240aagtccgtga catgccacgt
gaagcactac acgaatccca gccaggatgt gactgtgccc 300tgccagttcc
cccacctccc ccatgctgcc acccccgact gtcgctgcac cgaccggccc
360tcgaggacct gctcttaggt tcagaagcga acctcacgtg cacactgacc
ggcctgagag 420atgcctctgg tgccaccttc acctggacgc cctcaagtgg
gaagagcgct gttcaaggac 480cacctgagcg tgacctctgt ggctgctaca
gcgtgtccag tgtcctgcct ggctgtgccc 540agccatggaa ccatggggag
accttcacct gcactgctgc ccaccccgag ttgaagaccc 600cactaaccgc
caacatcaca aaatccggaa acacattccg gcccgaggtc cacctgctgc
660cgccgccgtc ggaggagctg gccctgaacg agctggtgac gctgacgtgc
ctggcacgtg 720gcttcagccc caaggatgtg ctggttcgct ggctgcaggg
gtcacaggag ctgccccgcg 780agaagtacct gacttgggca tcccggcagg
agcccagcca gggcaccacc accttcgctg 840taaccagcat actgcgcgtg
gcagctgagg actggaagaa gggggacacc ttctcctgca 900tggtgggcca
cgaggccctg ccgctggcct tcacacagaa gaccatcgac cgcatggcgg
960gtaaacccac ccacatcaat gtgtctgttg tcatggcgga ggtggatggc
acctgctact 1020ga 10223911507DNAhomo sapiens; 391gcatccccga
ccagccccaa ggtcttcccg ctgagcctcg acagcacccc ccaagatggg 60aacgtggtcg
tcgcatgcct ggtccagggc ttcttccccc aggagccact cagtgtgacc
120tggagcgaaa gcggacagaa cgtgaccgcc agaaacttcc cacctagcca
ggatgcctcc 180ggggacctgt acaccacgag cagccagctg accctgccgg
ccacacagtg cccagacggc 240aagtccgtga catgccacgt gaagcactac
acgaatccca gccaggatgt gactgtgccc 300tgcccaggtc agagggcagg
ctggggagtg gggcggggcc accccgtcct gccctgacac 360tgcgcctgca
cccgtgttcc ccacagggag ccgccccttc actcacacca gagtggaccg
420cgggccgagc cccaggaggt ggtggtggac aggccaggag gggcgaggcg
ggggcacggg 480gaagggcgtt ctgaccagct caggccatct ctccactcca
gttcccccac ctcccccatg 540ctgccacccc cgactgtcgc tgcaccgacc
ggccctcgag gacctgctct taggttcaga 600agcgaacctc acgtgcacac
tgaccggcct gagagatgcc tctggtgcca ccttcacctg 660gacgccctca
agtgggaaga gcgctgttca aggaccacct gagcgtgacc tctgtggctg
720ctacagcgtg tccagtgtcc tgcctggctg tgcccagcca tggaaccatg
gggagacctt 780cacctgcact gctgcccacc ccgagttgaa gaccccacta
accgccaaca tcacaaaatc 840cggtgggtcc agaccctgct cggggccctg
ctcagtgctc tggtttgcaa agcatattcc 900cggcctgcct cctccctccc
aatcctgggc tccagtgctc atgccaagta cagagggaaa 960ctgaggcagg
ctgaggggcc aggacacagc ccagggtgcc caccagagca gaggggctct
1020ctcatcccct gcccagcccc ctgacctggc tctctaccct ccaggaaaca
cattccggcc 1080cgaggtccac ctgctgccgc cgccgtcgga ggagctggcc
ctgaacgagc tggtgacgct 1140gacgtgcctg gcacgtggct tcagccccaa
ggatgtgctg gttcgctggc tgcaggggtc 1200acaggagctg ccccgcgaga
agtacctgac ttgggcatcc cggcaggagc ccagccaggg 1260caccaccacc
tacgctgtaa ccagcatact gcgcgtggca gctgaggact ggaagaaggg
1320ggagaccttc tcctgcatgg tgggccacga ggccctgccg ctggccttca
cacagaagac 1380catcgaccgc atggcgggta aacccaccca catcaatgtg
tctgttgtca tggcggaggc 1440ggatggcacc tgctactgag ccgcccgcct
gtccccaccc ctgaataaac tccatgctcc 1500cccaagc 15073921022DNAhomo
sapiens; 392gcatccccga ccagccccaa ggtcttcccg ctgagcctcg acagcacccc
ccaagatggg 60aacgtggtcg tcgcatgcct ggtccagggc ttcttccccc aggagccact
cagtgtgacc 120tggagcgaaa gcggacagaa cgtgaccgcc agaaacttcc
cacctagcca ggatgcctcc 180ggggacctgt acaccacgag cagccagctg
accctgccgg ccacacagtg cccagacggc 240aagtccgtga catgccacgt
gaagcactac acgaatccca gccaggatgt gactgtgccc 300tgccagttcc
cccacctccc ccatgctgcc acccccgact gtcgctgcac cgaccggccc
360tcgaggacct gctcttaggt tcagaagcga acctcacgtg cacactgacc
ggcctgagag 420atgcctctgg tgccaccttc acctggacgc cctcaagtgg
gaagagcgct gttcaaggac 480cacctgagcg tgacctctgt ggctgctaca
gcgtgtccag tgtcctgcct ggctgtgccc 540agccatggaa ccatggggag
accttcacct gcactgctgc ccaccccgag ttgaagaccc 600cactaaccgc
caacatcaca aaatccggaa acacattccg gcccgaggtc cacctgctgc
660cgccgccgtc ggaggagctg gccctgaacg agctggtgac gctgacgtgc
ctggcacgtg 720gcttcagccc caaggatgtg ctggttcgct ggctgcaggg
gtcacaggag ctgccccgcg 780agaagtacct gacttgggca tcccggcagg
agcccagcca gggcaccacc acctacgctg 840taaccagcat actgcgcgtg
gcagctgagg actggaagaa gggggagacc ttctcctgca 900tggtgggcca
cgaggccctg ccgctggcct tcacacagaa gaccatcgac cgcatggcgg
960gtaaacccac ccacatcaat gtgtctgttg tcatggcgga ggcggatggc
acctgctact 1020ga 10223938912DNAhomo sapiens; 393cacccaccaa
ggctccggat gtgttcccca tcatatcagg gtgcagacac ccaaaggata 60acagccctgt
ggtcctggca tgcttgataa ctgggtacca cccaacgtcc gtgactgtca
120cctggtacat ggggacacag agccagcccc agagaacctt ccctgagata
caaagacggg 180acagctacta catgacaagc agccagctct ccacccccct
ccagcagtgg cgccaaggcg 240agtacaaatg cgtggtccag cacaccgcca
gcaagagtaa gaaggagatc ttccgctggc 300caggtaggtc gcaccggaga
tcacccagaa gggcccccca ggacccccag caccttccac 360tcagggcctg
accacaaaga cagaagcaag ggctgggctg tgaggcaacc cccacctccc
420cctcagagca cgttcctccc ccttcaccct gtatccaccc ctccggaccc
tccccatctc 480agtccctccg ctccctctct ctgaggccca tctcccaata
cccagatcac tttccttcca 540gacccttccc tcagtgtgca cggaggcagc
ttgcccagca aaggtgactg tctagtgggc 600ttcccacagc caagctccca
ccccatgctg cggcccttcc cttcttcctg cttggctgcc 660tgtgcccccc
acctgcctgt ccacaaccca gcctctggta catccatgcc ctctgccctc
720agcctcacct gcacttttcc ttggatttca gagtctccaa aggcacaggc
ctcctcagtg 780cccactgcac aaccccaagc agagggcagc ctcgccaagg
caaccacagc cccagccacc 840acccgtaaca caggtgagaa gccccttccc
tgcacactcc acccccaccc acctgctcat 900tcctcagccg cctcctccag
gcagcccttc ataactcctt gtctgagtct ccaagtcaca 960ctttggtaag
gagagggaca ctgaacggac ctctaacaaa cacctactgc cagccagccc
1020cagtctgggg gccagcagat gccaaacagc cagcagactc ccagagcaga
cctgggccgg 1080ctccctggcc catggaccca gctctgcctc gctgagctga
ggcatgggct ctcagcgcag 1140cctcacatag agccaccctg ccgaggcagt
ccggcttgca gactcacagg tcacttgggc 1200cgcagcagcc cctccccgtg
accctcgcct cccgcccgcc ccagcctggc tctctccaag 1260tgttggatct
tggtggccag cctgcttctc accctcaccc tgcctgccac ctcagaatgg
1320caggggaaag agggccctca ccaagaactt tatctgagga gtctgaggct
tgtgactctg 1380acctgcctga gatgtccatg tggccggggg gacgggttca
gtgttcggga gaactcgggt 1440acgtgcctga ctttctctga gtagggcagg
aagctgttag gagaagcagc agtgaggtgg 1500gctggaccaa caggcagaat
gactgtccct cagccaccct ctgggatgtg ggtcaagctc 1560tgacaaaggc
atggcacagc catggtggcc cctgcttgga tgagtggcca cggtgccctc
1620accctgggcc agaatctgcc tccactctgc aggtgcagaa acacgacatt
cccgtctcta 1680aacacaccta gctcctaggc ttggggtggg cctatcaaat
gcagggagat ggacacagca 1740caagggccag agcttcccat gagaaaggtg
agggcagctg ctccctgacc cgggcatctg 1800cacttgtccc tctccaccct
cctcatgggc agtggagact cagcaacaaa acaagttgag 1860tgcattagca
gccagctctg gagccaagtc actcacccca cggccttggc tgctggtgga
1920ggggccttcc cctgggcagc ctccaagaag acggccaagt gctcttactc
agaccacggc 1980gctgcttcct ggcacctcga tttcccacaa caacatgggg
tgcagacagg ctagggcccc 2040ctgccctggg gcctggacgg catccagtta
aagatgaccc ttcacgggcg gtgcctgagg 2100tgtgctgacc tcagcagcta
agccctcagg tctggtctgc actgccccac ctggaggacc 2160caactgaccc
agacacagcc agggttatgg catgaccccg tggacggtga cccacaggcc
2220agatgcagcc aggggctgtt ttgtgtggcc tagaaatgtc tttacagttg
tagtgggatg 2280gaggaggaag aggaagagag gaggggagag aaaagcaggg
aaggggaaaa agaggagttc 2340aatgcaaccc caaaagccag aacagttttg
agctgaaaga acaaggcagg aaacatccca 2400gtacctgact tcaaaacata
ctataaagca gttgtaatca aaacaggatc ataaaaacag 2460acacacagac
ccatggaaca gaaaagcgag cccagaaata aatctacatg cttgcagtcc
2520attgattttc aacaaaggca ccaggaaaac acaatgggga gaggacagtt
tcctcaataa 2580atagtgctgg ggaaactgga tatccatgtg cagactaatg
aaactacaca aaaatcaatt 2640gaaaacagtc taggccaggc gcggtggctc
atgccggtaa tcccagcact ttgggaggcc 2700gagacaggcg gatcacctga
ggtcaggagt tcgagaccag cttggccaac atggcgaaac 2760ccggtctcca
ctaaaaatac aaaaattagc acatggtggc ctacgtctgt tatcccagct
2820tttcaggagg ctgaggcagg agaatcgctt gaatccggga ggtgaaggtt
gcagggagcc 2880aagattgcgc cactgcattc cagcctgggc aatggagcga
gactgtctca aaaaaaaaaa 2940aaaaaagaaa agaaaacagt ctaaaggttt
aactgaacag ataaagctac tagaagaaaa 3000cataggggga aaactccatg
acattagtct gagcaacgat ttttggatat gatcccaaaa 3060gctcaggcag
cactagtcac aaaagccaag atacagaacc aacctaagca cccctcagca
3120gatgcacagg taaagaaaat gtggtacgta tggggcacaa tggaatacga
ttcagccttt 3180aaaaacagtg aaattctgtc attggcaaca atgtagatga
acctgaagga cacttatgct 3240aagtgaaata agccaggcac agaaggagca
atactgcatg attgcactta catctggcag 3300gttaaaaagg caaactctta
gaggcagaca gtagagaggt ggtgccaggg agcgggcact 3360ggtggctggg
gagatgttgg tcaaagggca caaaactgca gttgggagga attagttcag
3420gacatccctt gtacatgggg acagtggtta gtaacaacgg attgtatcct
tgaaaaccgc 3480taagaaaata gtttttaagt gttcttgaca caaaaagtga
cacgtatgtg agatactgca 3540tggtcattag ctggatttag ccattccaca
atgtacacat atttcaaaca ttgtgttgta 3600tatgataaac atgtataatt
tttgtcaatt aaaaattttt aggaagagga ggagaagaga 3660agaagaagga
gaaggagaaa gaggaacaag aagagagaga gacaaagaca ccaggttttt
3720tctgacccct gggctatcaa aacacctatt gcccaataac tagttggccg
ttggtgccct 3780aaactattga agcgattgct gttatgtgga tgggccccgg
acacttagaa actcgtgacc 3840cctgaggacc cccacgagga cagtcagggt
ccccccgaac tcagggagca ctgaggaagg 3900agctcttaga ggcgtggggc
ccctcaggcc cctcagaggg ctctgccaca tgggtcaggg 3960gcaggctgag
ggggagtccc aggctccatg cccagcctct gtgcctctga ccagggtgtc
4020ccccacaccg cctcctcccc agtgccctcc actggccaca cctggccaga
agctggggag 4080aggagagcac agtggttaag tcagtccctg cagggagacg
gcaccagaaa aacctggcct 4140gtggatgagt cccggcctgg cagccacaga
gcagagagct ctagaagcaa cgaaggcccg 4200agtctgctca gggaagagcg
ggcagcagcc
ccagggccgg acagtgacca agagtggcac 4260cgcccatggc tcaacgggtc
tttgcccaca gatcccccag cccctggaga cagggtctgt 4320gtgcctggcc
gtgcaggcag gcaccacact cagggggagg ccactgtgga gctctgtgca
4380gagccccggg cgggagccta ctgctcccga aggtccggcc acagctgctc
tcgtttgctc 4440tcccctgcag agtgtccgag ccacacccag cctcttggcg
tctacctgct aacccctgca 4500gtgcaggacc tgtggctccg ggacaaagcc
accttcacct gcttcgtggt gggcagtgac 4560ctgaaggatg ctcacctgac
ctgggaggtg gccgggaagg tccccacagg gggcgtggag 4620gaagggctgc
tggagcggca cagcaacggc tcccagagcc agcacagccg tctgaccctg
4680cccaggtcct tgtggaacgc ggggacctcc gtcacctgca cactgaacca
tcccagcctc 4740ccaccccaga ggttgatggc gctgagagaa cccggtgagc
ctggctccca ggtggggaga 4800cgagggtgcc cacagcctgc tgacccctac
gcctgcccca gggccatgac cccagctggg 4860ccccagcagc accggtcatc
ctccacagga aaggagaagg gaggcaccag caccctggcc 4920ggccccactt
ctctcccagt gcccccgtgg ccagaggctg acagcctccc ccacctcccc
4980gcagctgcgc aggcacccgt caagctttcc ctgaacctgc tggcctcgtc
tgaccctccc 5040gaggcggcct cgtggctcct gtgtgaggtg tctggcttct
cgccccccaa catcctcctg 5100atgtggctgg aggaccagcg tgaggtgaac
acttctgggt ttgcccccgc acgcccccct 5160ccacagcccg ggagcaccac
gttctgggcc tggagtgtgc tgcgtgtccc agccccgccc 5220agccctcagc
cagccaccta cacgtgtgtg gtcagccacg aggactcccg gactctgctc
5280aacgccagcc ggagcctaga agtcagctgt gagtcacccc caggcccagg
gttgggacgg 5340ggactctgag gggggccata aggagctgga atccatacta
ggcaggggtg ggcactgggc 5400aggggcgggg ctaggctgtc ctgggcacac
aggccccttc tcggtgtccg gcaggagcac 5460agacttccca gtactcctgg
gccatggatg tcccagcgtc catccttgct gtccacacca 5520cgtgctggcc
caggctggct ggcacagtgt aagaggtgga tacaacccct cgccgtgccc
5580tgaggagtgg cggtttcctc ccaagacatt ccccacggct gggtgctggg
cacaggcctt 5640ccctggtgtg accgtgaatg tggtcaccct gaacagctgc
cctctctggg gacatctgac 5700tgtccaagac cacagtcagc acctctggga
gccagagggg tctccagaga cccccagatg 5760tcaggcttgg gctcagtgcc
cagcgaaagg tcagccccac acatgcccat aatgggcgcc 5820cacccagagt
gacagccccc agcctcctgc caggcccacc cttttccgcc cccttgaggc
5880atggcacaca gaccagtgcg cccactgccc gagcatggcc ccagtgggat
gtggtggcca 5940cgaggggctg tacacacagc aggaggctgt ccgccctgct
cagggcctgc tgcctatgcc 6000ccagctgtcc aaccaaggga ggcatggaag
ggcccctggt gtaagctgga gccaggcacc 6060caggcccccg gccaccctgc
agagccaagg aaaggaagac acccaagtca acaaggggca 6120gggctgaggg
ctgtcccagg ctcttttggc ccgaggggct gccagcagcc ctgacccggc
6180atgggccttc cccaaaagcg accctgtgag gtggcctcac agagaacccc
ctctgaggac 6240agtgtctgac cctgcctgcc tcacacagat gggccccaca
gcagtgggca acctgggggg 6300cagcagccca acctgaccct gcagggactg
ccccctgcag cagcagctgc ttctcagtcc 6360cccaacctcc ctgtccccgc
cagagggtct tccccgaagc tgcagcccca acccatggct 6420gcccacctgg
aaccgggact ccctgtccac tgccccctcc ccttcggggc cccatctgtg
6480ctggggccca ggttcggcct acagattccc atcattgcca tggcctcctg
accttgccta 6540tccaccccca accaccggct ccatgctgac cctcccccag
gctcccacgc ccagctggcc 6600ggccatcccc aggcacagac agtctgggat
ctcacaggtt agcctggacc atccacctgg 6660ccagacctgg gagaggctgg
aagctgccct gccaccatgc tccagggccc caggttgcag 6720tactatgggg
tgagggtgtg tgtgcacacc tgtgtgtacc taggatatcc gagtgtaccc
6780ttgtgccccc aagcacaagt ctccctccca ggcagtgagg cccagatggt
gcagtggtta 6840gagctgaggc ttatcccaca gagaaccctg gcgccttggt
caaggaagcc cctatgcctt 6900tcttgcctcg atttcccctc ttgtctgctg
agccagcagg ggccacgtcc tgggctgctg 6960tgaggaggaa gcaagttggt
gctaggaggg gctcctgtgt gtgcatgggc gggaggggtg 7020caggtatctg
agcaccccgg tctccacttg agagagcagg gcaggagctc cctgacccac
7080ccagactaca cacgctgtgt ccacgtgtct cccattatct gtggcagagg
atccggcttc 7140tttctcaatt tccagttctt cacaaagcaa tgcctttgta
aaatgcaata agaaatacta 7200gaaaaatgat atgaacagaa agacacgccg
attttttgtt attagatgta acagaccatg 7260gccccatgaa atgatcccgg
accagatccg tccacacccg ccactcagca gctctggccg 7320agctcacagt
acaaccacaa taaactcttg ttgaatgaac tctaggaagt ctgtgacgtg
7380gctggttctt gtcaatgctt cctgcctgcc cacaggctct tcctcgtgga
tggggctgtg 7440cttgccacgg aagcgcgttt ttcccggcct aggcttgcct
tgggccccac tgccgtctcc 7500agctggagat gaccttctat acacacattt
gctcatgaca gacccttgct tagccccctt 7560ccatggctcc ctcctgctgc
tgggataaaa tcaccttgcc tggatatccc ctcctgggcc 7620cctttccacc
ctccttagtc agcaccccca gttcagggca cctgctttcc ccgctgcgga
7680gaagccactc tctccttgct gcccggctgt gtcttgcctt ccacaccttg
tcacagtggc 7740cacttcctaa ggaaggcctc cctgtgtgca ggtgtgcaga
agtgccccag cctcccgtca 7800cctttgtcac gggagcccaa tccatgagag
tctatggttc tgtctgtctg ccccactcag 7860ggcagcgaca agtccaggcg
gggaggacac agtaggcaga gatttgtcga ggggacatat 7920gagcaagagg
gtgaggctgg gagctccctg gagataacca cgcctcctgg gaagactcgc
7980cgtcatttca gctccacgct gtgcgggggt gggtggaggg gtagcctggc
cctcatgacc 8040agggagcttc tcactcagcc cctgttcctc cccagacctg
gccatgaccc ccctgatccc 8100tcagagcaag gatgagaaca gcgatgacta
cacgaccttt gatgatgtgg gcagcctgtg 8160gaccgccctg tccacgtttg
tggccctctt catcctcacc ctcctctaca gcggcattgt 8220cactttcatc
aaggtcaggg gagcggccag gctctcagtg accctcgggg tgggtgtggg
8280gcaaggtgcc cttccagggg acatgccaga gctggtccag ggatcctgga
ccaggcagag 8340gcagggctga gggagcctgg aggacatgca ggccctctgt
ggcctgtgga cactgtcgaa 8400ggccctcttg accctgtgga taaaggacaa
caccccctcc cctgctcctc tgtctcccct 8460gcccctccac ccctcaggct
tctagccccc tgtctgaccc caggggctgt ctttcaggtg 8520aagtagcccc
agaagagcag gacgccctgt acctgcagag aagggaagca gcctctgtac
8580ctcatctgtg gctaccagag agcagaaagg acccaccctg gactcttctg
tgtgcaggaa 8640gatgcgccag cccctgcccc cggctcccct ctgtccgcca
cagaatccag tcttctagac 8700cagggggacg ggcacccatc actccgcagg
cgaatcagag cccccctgcc ccggccctaa 8760cccctgtgcc tccttcccgt
gcttccccca gagccagcta cacccctgcc ccggccctaa 8820cccccatgcc
tccttcctgt gcttccccca gagccagcta gtcccacctg cagcccgctg
8880gcctccccat aaacacgctt tggttcattt ca 89123941293DNAhomo
sapiens;misc_feature(1)..(1)n is a, c, g, or t 394ncacccacca
aggctccgga tgtgttcccc atcatatcag ggtgcagaca cccaaaggat 60aacagccctg
tggtcctggc atgcttgata actgggtacc acccaacgtc cgtgactgtc
120acctggtaca tggggacaca gagccagccc cagagaacct tccctgagat
acaaagacgg 180gacagctact acatgacaag cagccagctc tccacccccc
tccagcagtg gcgccaaggc 240gagtacaaat gcgtggtcca gcacaccgcc
agcaagagta agaaggagat cttccgctgg 300ccagagtctc caaaggcaca
ggcctcctca gtgcccactg cacaacccca agcagagggc 360agcctcgcca
aggcaaccac agccccagcc accacccgta acacaggaag aggaggagaa
420gagaagaaga aggagaagga gaaagaggaa caagaagaga gagagacaaa
gacaccagag 480tgtccgagcc acacccagcc tcttggcgtc tacctgctaa
cccctgcagt gcaggacctg 540tggctccggg acaaagccac cttcacctgc
ttcgtggtgg gcagtgacct gaaggatgct 600cacctgacct gggaggtggc
cgggaaggtc cccacagggg gcgtggagga agggctgctg 660gagcggcaca
gcaacggctc ccagagccag cacagccgtc tgaccctgcc caggtccttg
720tggaacgcgg ggacctccgt cacctgcaca ctgaaccatc ccagcctccc
accccagagg 780ttgatggcgc tgagagaacc cgctgcgcag gcacccgtca
agctttccct gaacctgctg 840gcctcgtctg accctcccga ggcggcctcg
tggctcctgt gtgaggtgtc tggcttctcg 900ccccccaaca tcctcctgat
gtggctggag gaccagcgtg aggtgaacac ttctgggttt 960gcccccgcac
gcccccctcc acagcccggg agcaccacgt tctgggcctg gagtgtgctg
1020cgtgtcccag ccccgcccag ccctcagcca gccacctaca cgtgtgtggt
cagccacgag 1080gactcccgga ctctgctcaa cgccagccgg agcctagaag
tcagctacct ggccatgacc 1140cccctgatcc ctcagagcaa ggatgagaac
agcgatgact acacgacctt tgatgatgtg 1200ggcagcctgt ggaccgccct
gtccacgttt gtggccctct tcatcctcac cctcctctac 1260agcggcattg
tcactttcat caaggtgaag tag 12933953842DNAhomo sapiens; 395gcctccacac
agagcccatc cgtcttcccc ttgacccgct gctgcaaaaa cattccctcc 60aatgccacct
ccgtgactct gggctgcctg gccacgggct acttcccgga gccggtgatg
120gtgacctggg acacaggctc cctcaacggg acaactatga ccttaccagc
caccaccctc 180acgctctctg gtcactatgc caccatcagc ttgctgaccg
tctcgggtgc gtgggccaag 240cagatgttca cctgccgtgt ggcacacact
ccatcgtcca cagactgggt cgacaacaaa 300accttcagcg gtaagagagg
gccaagctca gagaccacag ttcccaggag tgccaggctg 360agggctggca
gagtgggcag gggttgaggg ggtgggtggg ctcaaacgtg ggaacaccca
420gcatgcctgg ggacccgggc caggacgcgg gggcaagagg agggcacaca
gagctcagag 480aggccaacaa ccctcatgac caccagctct cccccagtct
gctccaggga cttcaccccg 540cccaccgtga agatcttaca gtcgtcctgc
gacggcggcg ggcacttccc cccgaccatc 600cagctcctgt gcctcgtctc
tgggtacacc ccagggacta tcaacatcac ctggctggag 660gacgggcagg
tcatggacgt ggacttgtcc accgcctcta ccacgcagga gggtgagctg
720gcctccacac aaagcgagct caccctcagc cagaagcact ggctgtcaga
ccgcacctac 780acctgccagg tcacctatca aggtcacacc tttgaggaca
gcaccaagaa gtgtgcaggt 840acgttcccac ctgccctggt ggccgccacg
gaggccagag aagaggggcg ggtgggcctc 900acacagccct ccggtgtacc
acagattcca acccgagagg ggtgagcgcc tacctaagcc 960ggcccagccc
gttcgacctg ttcatccgca agtcgcccac gatcacctgt ctggtggtgg
1020acctggcacc cagcaagggg accgtgaacc tgacctggtc ccgggccagt
gggaagcctg 1080tgaaccactc caccagaaag gaggagaagc agcgcaatgg
cacgttaacc gtcacgtcca 1140ccctgccggt gggcacccga gactggatcg
agggggagac ctaccagtgc agggtgaccc 1200acccccacct gcccagggcc
ctcatgcggt ccacgaccaa gaccagcggt gagccatggg 1260caggccgggg
tcgtggggga agggagggag cgagtgagcg gggcccgggc tgaccccacg
1320tctggccaca ggcccgcgtg ctgccccgga agtctatgcg tttgcgacgc
cggagtggcc 1380ggggagccgg gacaagcgca ccctcgcctg cctgatccag
aacttcatgc ctgaggacat 1440ctcggtgcag tggctgcaca acgaggtgca
gctcccggac gcccggcaca gcacgacgca 1500gccccgcaag accaagggct
ccggcttctt cgtcttcagc cgcctggagg tgaccagggc 1560cgaatgggag
cagaaagatg agttcatctg ccgtgcagtc catgaggcag caagcccctc
1620acagaccgtc cagcgagcgg tgtctgtaaa tcccggtaaa tgacgtactc
ctgcctccct 1680ccctcccagg gctccatcca gctgtgcagt ggggaggact
ggccagacct tctgtccact 1740gttgcaatga ccccaggaag ctacccccaa
taaactgtgc ctgctcagag ccccaggtac 1800acccattctt gggagcgggc
agggctgtgg gcaggtgcat cttggcacag aggaatgggc 1860cccccaggag
gggcagtggg aggaggtggg cagggctgag tccccccagg agaggcggtg
1920ggaggaggtg ggcagggctg aggtgccact catccatctg ccttcgtgtc
agggttattt 1980gtcaaacagc atatctgcag ggactcatca cagctacccc
gggccctctc tgcccccact 2040ctgggtctac cccctccaag gagtccaaag
acccagggga ggtcctcagg gaaggggcaa 2100gggagccccc acagccctct
ctcttggggg cttggcttct acccccctgg acaggagccc 2160ctgcaccccc
aggtatagat gggcacacag gcccctccag gtggaaaaac agccctaagt
2220gaaaccccca cacagacaca cacgacccga cagccctcgc ccaagtctgt
gccactggcg 2280ttcgcctctc tgccctgtcc cgccttgccg agtcctggcc
ccagcaccgg ggccggtgga 2340gccgagccca ctcacacccc gcagcctccg
ccaccctgcc ctgtgggcac accaggccca 2400ggtcagcagc caggccccct
ctcctactgc cccccaccgc cccttggtcc atcctgaatc 2460ggcccccagg
ggatcgccag cctcacacac ccagtctcgc ccactcacgc ctcactcaag
2520gcacagctgt gcacacacta ggccccatag caactccaca gcaccctgta
ccaccaccag 2580ggcgccatag acaccccaca cgtggtcaca cgtggcccac
actccgcctc tcacgctgcc 2640tccagcgagg ctactgccaa gcccttcctc
tgagccatac ctgggccgct ggatcccaga 2700gagaaatgga gaggccctca
cgtggtgtcc tccagtccaa ccctccctgt caccctgtca 2760gcagcagcac
cccacagcca aacacaggat ggatgcgtgg gctccatccc ccactcaccc
2820acaccggaac cccagagcag gctacgtgcc cctcacagac ctcaaaccca
catgtgcatc 2880tgacacccca gatccaaacg ctccccccgg tcatgcacac
caagggcaca gcacccacca 2940aatccacacg gaaacacggg caccgggcac
cccatgagca caaagcccct ccatgtctga 3000agacagtccc tgcacaccgt
cacagccata cattcagctt cactctcacg tcccagccca 3060cctgcaccca
gctctgggcc tggagcagca gaaagaggtg tgagggcccg aggcgggacc
3120tgcacctgct gatgacccgg gaccagcagg cagctcacgg tgttggggaa
gggagtggag 3180ggcacccagg gcaggagcca gagggaccag gctggtgggc
ggggccgggc cggggtaggg 3240ccaggaggca gctctggaca cccacaggcc
tgggctcata gtccacacca ggacagcccc 3300tcagagcacc catgcagtga
gtcccaggtc ttgggagcca ggccgcagag ctcacgcatc 3360cttccgaggg
ccctgagtga ggcggccact gctgtgccga ggggttgggt ccttctctgg
3420ggagggcgtg gggtctagag aggcggagtg gaggtaacca gaggtcagga
gagaagccgt 3480aaggaacaga gggaaaatgg ggccagagtc ggggcgcagg
gacgagaggt caggagtggt 3540cggcctggct ctgggccgtt gactgactcg
ggacctgggt gcccaccctc agggctggct 3600ggcggctccg cgcagtccca
gagggccccg gatagggtgc tctgccactc cggacagcag 3660cagggactgc
cgagagcagc aggaggctct gtcccccacc cccgctgcca ctgtggagcc
3720gggagggctg actggccagg tcccccagag ctggacgtgt gcgtggagga
ggccgagggc 3780gaggcgccgt ggacgtggac cggcctctgc atcttcgccg
cactcttcct gctcagcgtg 3840ag 38423961287DNAhomo sapiens;
396gcctccacac agagcccatc cgtcttcccc ttgacccgct gctgcaaaaa
cattccctcc 60aatgccacct ccgtgactct gggctgcctg gccacgggct acttcccgga
gccggtgatg 120gtgacctggg acacaggctc cctcaacggg acaactatga
ccttaccagc caccaccctc 180acgctctctg gtcactatgc caccatcagc
ttgctgaccg tctcgggtgc gtgggccaag 240cagatgttca cctgccgtgt
ggcacacact ccatcgtcca cagactgggt cgacaacaaa 300accttcagcg
tctgctccag ggacttcacc ccgcccaccg tgaagatctt acagtcgtcc
360tgcgacggcg gcgggcactt ccccccgacc atccagctcc tgtgcctcgt
ctctgggtac 420accccaggga ctatcaacat cacctggctg gaggacgggc
aggtcatgga cgtggacttg 480tccaccgcct ctaccacgca ggagggtgag
ctggcctcca cacaaagcga gctcaccctc 540agccagaagc actggctgtc
agaccgcacc tacacctgcc aggtcaccta tcaaggtcac 600acctttgagg
acagcaccaa gaagtgtgca gattccaacc cgagaggggt gagcgcctac
660ctaagccggc ccagcccgtt cgacctgttc atccgcaagt cgcccacgat
cacctgtctg 720gtggtggacc tggcacccag caaggggacc gtgaacctga
cctggtcccg ggccagtggg 780aagcctgtga accactccac cagaaaggag
gagaagcagc gcaatggcac gttaaccgtc 840acgtccaccc tgccggtggg
cacccgagac tggatcgagg gggagaccta ccagtgcagg 900gtgacccacc
cccacctgcc cagggccctc atgcggtcca cgaccaagac cagcggcccg
960cgtgctgccc cggaagtcta tgcgtttgcg acgccggagt ggccggggag
ccgggacaag 1020cgcaccctcg cctgcctgat ccagaacttc atgcctgagg
acatctcggt gcagtggctg 1080cacaacgagg tgcagctccc ggacgcccgg
cacagcacga cgcagccccg caagaccaag 1140ggctccggct tcttcgtctt
cagccgcctg gaggtgacca gggccgaatg ggagcagaaa 1200gatgagttca
tctgccgtgc agtccatgag gcagcaagcc cctcacagac cgtccagcga
1260gcggtgtctg taaatcccgg taaatga 128739730DNAhomo sapiens;
397tccggcttct tcgtcttcag ccgcctggag 30398228DNAhomo sapiens;
398tccggcttct tcgtcttcag ccgcctggag gtgaccaggg ccgaatggga
gcagaaagat 60gagttcatct gccgtgcagt ccatgaggca gcaagcccct cacagaccgt
ccagcgagcg 120gtgtctgtaa atcccgagct ggacgtgtgc gtggaggagg
ccgagggcga ggcgccgtgg 180acgtggaccg gcctctgcat cttcgccgca
ctcttcctgc tcagcgtg 2283991975DNAhomo sapiens; 399gggagtgcat
ccgccccaac ccttttcccc ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg
tggccgttgg ctgcctcgca caggacttcc ttcccgactc catcactttc
120tcctggaaat acaagaacaa ctctgacatc agcagcaccc ggggcttccc
atcagtcctg 180agagggggca agtacgcagc cacctcacag gtgctgctgc
cttccaagga cgtcatgcag 240ggcacagacg aacacgtggt gtgcaaagtc
cagcacccca acggcaacaa agaaaagaac 300gtgcctcttc caggtgaggg
ccgggcccag ccaccgggac agagagggag ccgaaggggg 360cgggagtggc
gggcaccggg ctgacacgtg tccctcactg cagtgattgc cgagctgcct
420cccaaagtga gcgtcttcgt cccaccccgc gacggcttct tcggcaaccc
ccgcaagtcc 480aagctcatct gccaggccac gggtttcagt ccccggcaga
ttcaggtgtc ctggctgcgc 540gaggggaagc aggtggggtc tggcgtcacc
acggaccagg tgcaggctga ggccaaagag 600tctgggccca cgacctacaa
ggtgaccagc acactgacca tcaaagagag cgactggctc 660agccagagca
tgttcacctg ccgcgtggat cacaggggcc tgaccttcca gcagaatgcg
720tcctccatgt gtggccccgg tgagtgacct gtccccaggg gcagcaccca
ccgacacaca 780ggggtccact cgggtctggc attcgccacc ccggatgcag
ccatctactc cctgagcctt 840ggcttcccag agcggccaag ggcaggggct
cgggcggcag gacccctggg ctcggcagag 900gcagttgcta ctctttgggt
gggaaccatg cctccgccca catccacacc tgccccacct 960ctgactccct
tctcttgact ccagatcaag acacagccat ccgggtcttc gccatccccc
1020catcctttgc cagcatcttc ctcaccaagt ccaccaagtt gacctgcctg
gtcacagacc 1080tgaccaccta tgacagcgtg accatctcct ggacccgcca
gaatggcgaa gctgtgaaaa 1140cccacaccaa catctccgag agccacccca
atgccacttt cagcgccgtg ggtgaggcca 1200gcatctgcga ggatgactgg
aattccgggg agaggttcac gtgcaccgtg acccacacag 1260acctgccctc
gccactgaag cagaccatct cccggcccaa gggtaggccc cactcttgcc
1320cctcttcctg cactccctgg gacctccctt ggcctctggg gcatggtgga
aagcacccct 1380cactcccccg ttgtctgggc aactggggaa aaggggactc
aaccccagcc cacaggctgg 1440tccccccact gccccgccct caccaccatc
tctgttcaca ggggtggccc tgcacaggcc 1500cgatgtctac ttgctgccac
cagcccggga gcagctgaac ctgcgggagt cggccaccat 1560cacgtgcctg
gtgacgggct tctctcccgc ggacgtcttc gtgcagtgga tgcagagggg
1620gcagcccttg tccccggaga agtatgtgac cagcgcccca atgcctgagc
cccaggcccc 1680aggccggtac ttcgcccaca gcatcctgac cgtgtccgaa
gaggaatgga acacggggga 1740gacctacacc tgcgtggtgg cccatgaggc
cctgcccaac agggtcaccg agaggaccgt 1800ggacaagtcc accggtaaac
ccaccctgta caacgtgtcc ctggtcatgt ccgacacagc 1860tggcacctgc
tactgaccct gctggcctgc ccacaggctc ggggcggctg gccgctctgt
1920gtgtgcatgc aaactaaccg tgtcaacggg gtgagatgtt gcatcttata aaatt
19754001362DNAhomo sapiens; 400gggagtgcat ccgccccaac ccttttcccc
ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg tggccgttgg ctgcctcgca
caggacttcc ttcccgactc catcactttc 120tcctggaaat acaagaacaa
ctctgacatc agcagcaccc ggggcttccc atcagtcctg 180agagggggca
agtacgcagc cacctcacag gtgctgctgc cttccaagga cgtcatgcag
240ggcacagacg aacacgtggt gtgcaaagtc cagcacccca acggcaacaa
agaaaagaac 300gtgcctcttc cagtgattgc cgagctgcct cccaaagtga
gcgtcttcgt cccaccccgc 360gacggcttct tcggcaaccc ccgcaagtcc
aagctcatct gccaggccac gggtttcagt 420ccccggcaga ttcaggtgtc
ctggctgcgc gaggggaagc aggtggggtc tggcgtcacc 480acggaccagg
tgcaggctga ggccaaagag tctgggccca cgacctacaa ggtgaccagc
540acactgacca tcaaagagag cgactggctc agccagagca tgttcacctg
ccgcgtggat 600cacaggggcc tgaccttcca gcagaatgcg tcctccatgt
gtggccccga tcaagacaca 660gccatccggg tcttcgccat ccccccatcc
tttgccagca tcttcctcac caagtccacc 720aagttgacct gcctggtcac
agacctgacc acctatgaca gcgtgaccat ctcctggacc 780cgccagaatg
gcgaagctgt gaaaacccac accaacatct ccgagagcca ccccaatgcc
840actttcagcg ccgtgggtga ggccagcatc tgcgaggatg actggaattc
cggggagagg 900ttcacgtgca ccgtgaccca cacagacctg ccctcgccac
tgaagcagac catctcccgg 960cccaaggggg tggccctgca caggcccgat
gtctacttgc tgccaccagc ccgggagcag 1020ctgaacctgc gggagtcggc
caccatcacg tgcctggtga cgggcttctc tcccgcggac 1080gtcttcgtgc
agtggatgca gagggggcag cccttgtccc cggagaagta tgtgaccagc
1140gccccaatgc ctgagcccca ggccccaggc cggtacttcg cccacagcat
cctgaccgtg 1200tccgaagagg aatggaacac gggggagacc tacacctgcg
tggtggccca tgaggccctg 1260cccaacaggg tcaccgagag gaccgtggac
aagtccaccg gtaaacccac cctgtacaac 1320gtgtccctgg tcatgtccga
cacagctggc acctgctact ga 13624011975DNAhomo sapiens; 401gggagtgcat
ccgccccaac ccttttcccc ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg
tggccgttgg ctgcctcgca caggacttcc ttcccgactc catcactttc
120tcctggaaat acaagaacaa ctctgacatc agcagcaccc ggggcttccc
atcagtcctg 180agagggggca agtacgcagc cacctcacag gtgctgctgc
cttccaagga cgtcatgcag 240ggcacagacg aacacgtggt gtgcaaagtc
cagcacccca acggcaacaa agaaaagaac 300gtgcctcttc caggtgaggg
ccgggcccag ccaccgggac agagagggag ccgaaggggg 360cgggagtggc
gggcaccggg ctgacacgtg tccctcactg cagtgattgc cgagctgcct
420cccaaagtga gcgtcttcgt cccaccccgc gacggcttct tcggcaaccc
ccgcaagtcc 480aagctcatct gccaggccac gggtttcagt ccccggcaga
ttcaggtgtc ctggctgcgc 540gaggggaagc aggtggggtc tggcgtcacc
acggaccagg tgcaggctga ggccaaagag 600tctgggccca cgacctacaa
ggtgaccagc acactgacca tcaaagagag cgactggctc 660agccagagca
tgttcacctg ccgcgtggat cacaggggcc tgaccttcca gcagaatgcg
720tcctccatgt gtgtccccgg tgagtgacct gtccccaggg gcagcaccca
ccgacacaca 780ggggtccact cgggtctggc attcgccacc ccggatgcag
ccatctactc cctgagcctt 840ggcttcccag agcggccaag ggcaggggct
cgggcggcag gacccctggg ctcggcagag 900gcagttgcta ctctttgggt
gggaaccatg cctccgccca catccacacc tgccccacct 960ctgactccct
tctcttgact ccagatcaag acacagccat ccgggtcttc gccatccccc
1020catcctttgc cagcatcttc ctcaccaagt ccaccaagtt gacctgcctg
gtcacagacc 1080tgaccaccta tgacagcgtg accatctcct ggacccgcca
gaatggcgaa gctgtgaaaa 1140cccacaccaa catctccgag agccacccca
atgccacttt cagcgccgtg ggtgaggcca 1200gcatctgcga ggatgactgg
aattccgggg agaggttcac gtgcaccgtg acccacacag 1260acctgccctc
gccactgaag cagaccatct cccggcccaa gggtaggccc cactcttgcc
1320cctcttcctg cactccctgg gacctccctt ggcctctggg gcatggtgga
aagcacccct 1380cactcccccg ttgtctgggc aactggggaa aaggggactc
aaccccagcc cacaggctgg 1440tccccccact gccccgccct caccaccatc
tctgttcaca ggggtggccc tgcacaggcc 1500cgatgtctac ttgctgccac
cagcccggga gcagctgaac ctgcgggagt cggccaccat 1560cacgtgcctg
gtgacgggct tctctcccgc ggacgtcttc gtgcagtgga tgcagagggg
1620gcagcccttg tccccggaga agtatgtgac cagcgcccca atgcctgagc
cccaggcccc 1680aggccggtac ttcgcccaca gcatcctgac cgtgtccgaa
gaggaatgga acacggggga 1740gacctacacc tgcgtggtgg cccatgaggc
cctgcccaac agggtcaccg agaggaccgt 1800ggacaagtcc accggtaaac
ccaccctgta caacgtgtcc ctggtcatgt ccgacacagc 1860tggcacctgc
tactgaccct gctggcctgc ccacaggctc ggggcggctg gccgctctgt
1920gtgtgcatgc aaactaaccg tgtcaacggg gtgagatgtt gcatcttata aaatt
19754021362DNAhomo sapiens; 402gggagtgcat ccgccccaac ccttttcccc
ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg tggccgttgg ctgcctcgca
caggacttcc ttcccgactc catcactttc 120tcctggaaat acaagaacaa
ctctgacatc agcagcaccc ggggcttccc atcagtcctg 180agagggggca
agtacgcagc cacctcacag gtgctgctgc cttccaagga cgtcatgcag
240ggcacagacg aacacgtggt gtgcaaagtc cagcacccca acggcaacaa
agaaaagaac 300gtgcctcttc cagtgattgc cgagctgcct cccaaagtga
gcgtcttcgt cccaccccgc 360gacggcttct tcggcaaccc ccgcaagtcc
aagctcatct gccaggccac gggtttcagt 420ccccggcaga ttcaggtgtc
ctggctgcgc gaggggaagc aggtggggtc tggcgtcacc 480acggaccagg
tgcaggctga ggccaaagag tctgggccca cgacctacaa ggtgaccagc
540acactgacca tcaaagagag cgactggctc agccagagca tgttcacctg
ccgcgtggat 600cacaggggcc tgaccttcca gcagaatgcg tcctccatgt
gtgtccccga tcaagacaca 660gccatccggg tcttcgccat ccccccatcc
tttgccagca tcttcctcac caagtccacc 720aagttgacct gcctggtcac
agacctgacc acctatgaca gcgtgaccat ctcctggacc 780cgccagaatg
gcgaagctgt gaaaacccac accaacatct ccgagagcca ccccaatgcc
840actttcagcg ccgtgggtga ggccagcatc tgcgaggatg actggaattc
cggggagagg 900ttcacgtgca ccgtgaccca cacagacctg ccctcgccac
tgaagcagac catctcccgg 960cccaaggggg tggccctgca caggcccgat
gtctacttgc tgccaccagc ccgggagcag 1020ctgaacctgc gggagtcggc
caccatcacg tgcctggtga cgggcttctc tcccgcggac 1080gtcttcgtgc
agtggatgca gagggggcag cccttgtccc cggagaagta tgtgaccagc
1140gccccaatgc ctgagcccca ggccccaggc cggtacttcg cccacagcat
cctgaccgtg 1200tccgaagagg aatggaacac gggggagacc tacacctgcg
tggtggccca tgaggccctg 1260cccaacaggg tcaccgagag gaccgtggac
aagtccaccg gtaaacccac cctgtacaac 1320gtgtccctgg tcatgtccga
cacagctggc acctgctact ga 13624031975DNAhomo sapiens; 403gggagtgcat
ccgccccaac ccttttcccc ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg
tggccgttgg ctgcctcgca caggacttcc ttcccgactc catcactttc
120tcctggaaat acaagaacaa ctctgacatc agcagcaccc ggggcttccc
atcagtcctg 180agagggggca agtacgcagc cacctcacag gtgctgctgc
cttccaagga cgtcatgcag 240ggcacagacg aacacgtggt gtgcaaagtc
cagcacccca acggcaacaa agaaaagaac 300gtgcctcttc caggtgaggg
ccgggcccag ccaccgggac agagagggag ccgaaggggg 360cgggagtggc
gggcaccggg ctgacacgtg tccctcactg cagtgattgc cgagctgcct
420cccaaagtga gcgtcttcgt cccaccccgc gacggcttct tcggcaaccc
ccgcaagtcc 480aagctcatct gccaggccac gggtttcagt ccccggcaga
ttcaggtgtc ctggctgcgc 540gaggggaagc aggtggggtc tggcgtcacc
acggaccagg tgcaggctga ggccaaagag 600tctgggccca cgacctacaa
ggtgaccagc acactgacca tcaaagagag cgactggctc 660ggccagagca
tgttcacctg ccgcgtggat cacaggggcc tgaccttcca gcagaatgcg
720tcctccatgt gtgtccccgg tgagtgacct gtccccaggg gcagcaccca
ccgacacaca 780ggggtccact cgggtctggc attcgccacc ccggatgcag
ccatctactc cctgagcctt 840ggcttcccag agcggccaag ggcaggggct
cgggcggcag gacccctggg ctcggcagag 900gcagttgcta ctctttgggt
gggaaccatg cctccgccca catccacacc tgccccacct 960ctgactccct
tctcttgact ccagatcaag acacagccat ccgggtcttc gccatccccc
1020catcctttgc cagcatcttc ctcaccaagt ccaccaagtt gacctgcctg
gtcacagacc 1080tgaccaccta tgacagcgtg accatctcct ggacccgcca
gaatggcgaa gctgtgaaaa 1140cccacaccaa catctccgag agccacccca
atgccacttt cagcgccgtg ggtgaggcca 1200gcatctgcga ggatgactgg
aattccgggg agaggttcac gtgcaccgtg acccacacag 1260acctgccctc
gccactgaag cagaccatct cccggcccaa gggtaggccc cactcttgcc
1320cctcttcctg cactccctgg gacctccctt ggcctctggg gcatggtgga
aagcacccct 1380cactcccccg ttgtctgggc aactggggaa aaggggactc
aaccccagcc cacaggctgg 1440tccccccact gccccgccct caccaccatc
tctgttcaca ggggtggccc tgcacaggcc 1500cgatgtctac ttgctgccac
cagcccggga gcagctgaac ctgcgggagt cggccaccat 1560cacgtgcctg
gtgacgggct tctctcccgc ggacgtcttc gtgcagtgga tgcagagggg
1620gcagcccttg tccccggaga agtatgtgac cagcgcccca atgcctgagc
cccaggcccc 1680aggccggtac ttcgcccaca gcatcctgac cgtgtccgaa
gaggaatgga acacggggga 1740gacctacacc tgcgtggtgg cccatgaggc
cctgcccaac agggtcaccg agaggaccgt 1800ggacaagtcc accggtaaac
ccaccctgta caacgtgtcc ctggtcatgt ccgacacagc 1860tggcacctgc
tactgaccct gctggcctgc ccacaggctc ggggcggctg gccgctctgt
1920gtgtgcatgc aaactaaccg tgtcaacggg gtgagatgtt gcatcttata aaatt
19754041362DNAhomo sapiens; 404gggagtgcat ccgccccaac ccttttcccc
ctcgtctcct gtgagaattc cccgtcggat 60acgagcagcg tggccgttgg ctgcctcgca
caggacttcc ttcccgactc catcactttc 120tcctggaaat acaagaacaa
ctctgacatc agcagcaccc ggggcttccc atcagtcctg 180agagggggca
agtacgcagc cacctcacag gtgctgctgc cttccaagga cgtcatgcag
240ggcacagacg aacacgtggt gtgcaaagtc cagcacccca acggcaacaa
agaaaagaac 300gtgcctcttc cagtgattgc cgagctgcct cccaaagtga
gcgtcttcgt cccaccccgc 360gacggcttct tcggcaaccc ccgcaagtcc
aagctcatct gccaggccac gggtttcagt 420ccccggcaga ttcaggtgtc
ctggctgcgc gaggggaagc aggtggggtc tggcgtcacc 480acggaccagg
tgcaggctga ggccaaagag tctgggccca cgacctacaa ggtgaccagc
540acactgacca tcaaagagag cgactggctc ggccagagca tgttcacctg
ccgcgtggat 600cacaggggcc tgaccttcca gcagaatgcg tcctccatgt
gtgtccccga tcaagacaca 660gccatccggg tcttcgccat ccccccatcc
tttgccagca tcttcctcac caagtccacc 720aagttgacct gcctggtcac
agacctgacc acctatgaca gcgtgaccat ctcctggacc 780cgccagaatg
gcgaagctgt gaaaacccac accaacatct ccgagagcca ccccaatgcc
840actttcagcg ccgtgggtga ggccagcatc tgcgaggatg actggaattc
cggggagagg 900ttcacgtgca ccgtgaccca cacagacctg ccctcgccac
tgaagcagac catctcccgg 960cccaaggggg tggccctgca caggcccgat
gtctacttgc tgccaccagc ccgggagcag 1020ctgaacctgc gggagtcggc
caccatcacg tgcctggtga cgggcttctc tcccgcggac 1080gtcttcgtgc
agtggatgca gagggggcag cccttgtccc cggagaagta tgtgaccagc
1140gccccaatgc ctgagcccca ggccccaggc cggtacttcg cccacagcat
cctgaccgtg 1200tccgaagagg aatggaacac gggggagacc tacacctgcg
tggtggccca tgaggccctg 1260cccaacaggg tcaccgagag gaccgtggac
aagtccaccg gtaaacccac cctgtacaac 1320gtgtccctgg tcatgtccga
cacagctggc acctgctact ga 136240511DNAhomo sapiens; 405ctaactgggg a
1140631DNAhomo sapiens; 406aggatattgt agtggtggta gctgctactc c
3140737DNAhomo sapiens; 407gtattatgat tacgtttggg ggagttatcg ttatacc
3740818DNAhomo sapiens; 408gagtatagca gctcgtcc 1840920DNAhomo
sapiens; 409gtggatacag ctatggttac 2041031DNAhomo sapiens;
410aggatattgt agtagtacca gctgctatgc c 3141116DNAhomo sapiens;
411tgactacagt aactac 1641223DNAhomo sapiens; 412gtggatatag
tggctacgat tac 2341331DNAhomo sapiens; 413gtattacgat ttttggagtg
gttattatac c 3141431DNAhomo sapiens; 414aggatattgt actaatggtg
tatgctatac c 3141516DNAhomo sapiens; 415tgactacagt aactac
1641619DNAhomo sapiens; 416tgactacggt ggtaactcc 1941717DNAhomo
sapiens; 417ggtataaccg gaaccac 1741831DNAhomo sapiens;
418gtattactat ggttcgggga gttattataa c 3141920DNAhomo sapiens;
419ggtatagtgg gagctactac 2042031DNAhomo sapiens; 420gtattacgat
attttgactg gttattataa c 3142117DNAhomo sapiens; 421ggtacaactg
gaacgac 1742218DNAhomo sapiens; 422gggtatagca gcggctac
1842320DNAhomo sapiens; 423gtagagatgg ctacaattac 2042428DNAhomo
sapiens; 424agcatattgt ggtggtgact gctattcc 2842517DNAhomo sapiens;
425ggtataactg gaacgac 1742621DNAhomo sapiens; 426gggtatagca
gcagctggta c 2142716DNAhomo sapiens; 427tgactacggt gactac
1642831DNAhomo sapiens; 428gtattactat gatagtagtg gttattacta c
3142920DNAhomo sapiens; 429gtggatacag ctatggttac 2043021DNAhomo
sapiens; 430gggtatagca gtggctggta c 2143117DNAhomo sapiens;
431ggtataactg gaactac 174326PRTOryctolagus cuniculus; 432Tyr Tyr
Gly Met Asp Leu 1 5 43320DNAOryctolagus cuniculus; 433attactacgg
catggacctc 204346PRTOvis aries; 434Tyr Tyr Gly Val Asp Val 1 5
43520DNAOvis aries; 435attactacgg tgtagatgtc 204366PRTBos taurus;
436Tyr Tyr Gly Val Asp Val 1 5 43720DNABos taurus; 437attactacgg
tgtagatgtc 204386PRTCanis familiaris; 438Tyr Tyr Gly Met Asp Tyr 1
5 43920DNACanis familiaris; 439attactatgg tatggactac 204409PRThomo
sapiens; 440Tyr Tyr Tyr Tyr Tyr Gly Val Asp Val 1 5 44129DNAhomo
sapiens; 441attactacta ctactacggt atggacgtc 2944257DNAHomo sapiens
442atgggctggt cctgcatcat cctgtttctg gtggccaccg ccaccggcgt gcacagc
5744319PRTHomo sapiens 443Met Gly Trp Ser Cys Ile Ile Leu Phe Leu
Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser 44421DNAArtificial
SequencePrimer 444aggccagcag agggttccat g 2144522DNAArtificial
SequencePrimer 445ggctcccaga tcctcaaggc ac 22
* * * * *
References