U.S. patent application number 15/548728 was filed with the patent office on 2018-02-01 for recombinant aav1, aav5, and aav6 capsid mutants and uses thereof.
This patent application is currently assigned to University of Florida Research Foundation, Inc.. The applicant listed for this patent is University of Florida Research Foundation, Inc.. Invention is credited to Mavis Agbandje-McKenna, George Vladimirovich Aslanidi, Arun Srivastava, Kim M. Van Vliet.
Application Number | 20180030096 15/548728 |
Document ID | / |
Family ID | 56564659 |
Filed Date | 2018-02-01 |
United States Patent
Application |
20180030096 |
Kind Code |
A1 |
Aslanidi; George Vladimirovich ;
et al. |
February 1, 2018 |
RECOMBINANT AAV1, AAV5, AND AAV6 CAPSID MUTANTS AND USES
THEREOF
Abstract
Provided herein are modified recombinant adeno-associated virus
(rAAV) capsid proteins, such as modified rAAV1, rAAV5, and rAAV6
capsid proteins, rAAV particles comprising such capsid proteins,
nucleic acid molecules encoding such capsid proteins, as well as
compositions, kits and methods of use thereof.
Inventors: |
Aslanidi; George Vladimirovich;
(Gainesville, FL) ; Van Vliet; Kim M.;
(Gainesville, FL) ; Agbandje-McKenna; Mavis;
(Gainesville, FL) ; Srivastava; Arun;
(Gainesville, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Florida Research Foundation, Inc. |
Gainesville |
FL |
US |
|
|
Assignee: |
University of Florida Research
Foundation, Inc.
Gainesville
FL
|
Family ID: |
56564659 |
Appl. No.: |
15/548728 |
Filed: |
February 3, 2016 |
PCT Filed: |
February 3, 2016 |
PCT NO: |
PCT/US16/16422 |
371 Date: |
August 3, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62111319 |
Feb 3, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/86 20130101;
A61K 48/00 20130101; C07K 14/005 20130101; C12N 15/861 20130101;
C12N 2750/14122 20130101; C12N 2750/14143 20130101 |
International
Class: |
C07K 14/005 20060101
C07K014/005; C12N 15/861 20060101 C12N015/861 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support under R01
HL097088 and R21 EB-015684 awarded by the National Institutes of
Health. The government has certain rights in the invention.
Claims
1. A modified adeno-associated virus (AAV) capsid protein, wherein
a VP3 region of the modified AAV capsid protein comprises a
replacement of tyrosine residues with non-tyrosine residues and/or
a replacement of a threonine residue with a non-threonine residue
at positions corresponding to: Y705, Y731, and T492 of a wild-type
AAV1 capsid protein having the sequence of SEQ ID NO: 1, Y436,
Y693, and Y719 of a wild-type AAV5 capsid protein having the
sequence of SEQ ID NO: 2, or Y705, Y731, and T492 of a wild-type
AAV6 capsid protein having the sequence of SEQ ID NO: 3.
2. The modified AAV capsid protein of claim 1, wherein the modified
AAV capsid protein is a modified AAV1 capsid protein and the
modified AAV1 capsid protein comprises replacement of tyrosine
residues with non-tyrosine residues and a replacement of a
threonine residue with a non-threonine residue at each of the
positions corresponding to Y705, Y731, and T492 of the wild-type
AAV1 capsid protein having the sequence of SEQ ID NO: 1.
3. The modified AAV capsid protein of claim 1, wherein the modified
AAV capsid protein is a modified AAV5 capsid protein and the
modified AAV5 capsid protein comprises replacement of tyrosine
residues with non-tyrosine residues at each of the positions
corresponding to Y436, Y693, and Y719 of a wild-type AAV5 capsid
protein having the sequence of SEQ ID NO: 2.
4. The modified AAV capsid protein of claim 1, wherein the modified
AAV capsid protein is a modified AAV6 capsid protein and the
modified AAV6 capsid protein comprises replacement of tyrosine
residues with non-tyrosine residues and a replacement of a
threonine residue with a non-threonine residue at each of the
positions corresponding to Y705, Y731, and T492 of a wild-type AAV6
capsid protein having the sequence of SEQ ID NO: 3.
5. The modified capsid protein of any one of claims 1 to 4, wherein
the non-tyrosine residues are phenylalanine and the non-threonine
residue is valine.
6. A nucleic acid molecule encoding a modified capsid proteins of
any one of claims 1 to 5.
7. The nucleic acid molecule of claim 6, wherein the nucleic acid
molecule is a plasmid.
8. A recombinant AAV (rAAV) particle comprising a modified capsid
protein of any one of claims 1 to 5.
9. A composition comprising a rAAV particle of claim 8 and a
pharmaceutically-acceptable carrier.
10. A method, comprising: contacting a host cell with an rAAV
particle comprising the modified AAV1 capsid protein of claim 2 or
claim 5 or a composition comprising the rAAV particle and a
pharmaceutically-acceptable carrier.
11. The method of claim 10, wherein the host cell is a muscle
cell.
12. A method, comprising: contacting a host cell with an rAAV
particle comprising the modified AAV5 capsid protein of claim 3 or
claim 5 or a composition comprising the rAAV particle and a
pharmaceutically-acceptable carrier.
13. The method of claim 12, wherein the host cell is a retinal or
airway epithelial cell.
14. A method, comprising: contacting a host cell with an rAAV
particle comprising the modified AAV6 capsid protein of claim 4 or
claim 5 or a composition comprising the rAAV particle and a
pharmaceutically-acceptable carrier.
15. The method of claim 14, wherein the host cell is a
hematopoietic stem cell, a dendritic cell, a monocyte, an airway
epithelial cell, a muscle cell or a microglial cell.
16. A kit comprising any of the modified capsid proteins of claims
1 to 5, or the rAAV particle of claim 8, or the composition of
claim 9.
Description
RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C.
.sctn.119(e) to U.S. provisional application No. 62/111,319, filed
Feb. 3, 2015, the content of which is incorporated herein by
reference in its entirety.
BACKGROUND OF INVENTION
[0003] Gene therapy using recombinant adeno-associated virus (rAAV)
vectors has advanced significantly in the last decade. However, the
transduction efficiency of rAAV vectors varies widely between
different cells and tissues in vitro and in vivo.
SUMMARY OF THE INVENTION
[0004] As described herein, rAAV1, rAAV5, and rAAV6 capsid
mutant-containing viral particles were shown to transduce different
tissues and cells (e.g., muscle, retina, airway epithelia,
hematopoietic stem cells, dendritic cells, monocytes, airway
epithelial cells, and microglial cells) with high efficiency, when
compared to rAAV particles comprising wild-type capsid
proteins.
[0005] Accordingly, the present disclosure provides AAV capsid
proteins comprising modifications of a combination of one or more
of the surface-exposed residues. Also provided are rAAV viral
particles that comprise the modified AAV capsid proteins, as well
as nucleic acid molecules and rAAV vectors encoding the modified
AAV capsid proteins. Also disclosed herein are methods utilizing
such proteins, viral particles, nucleic acid molecules and rAAV
vectors.
[0006] In some embodiments, the present disclosure provides a
nucleic acid molecule comprising a nucleotide sequence encoding an
AAV capsid protein (e.g., an AAV1, AAV5, or AAV6 capsid protein),
wherein the VP3 region of the capsid protein comprises
modifications (e.g., replacement of a tyrosine residue with a
non-tyrosine residue and/or a threonine residue with a
non-threonine residue) at positions corresponding to:
[0007] one or more of or each of Y705, Y731, and T492 of a
wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1),
[0008] one or more of or each of Y436, Y693, and Y719 of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2), or
[0009] one or more of or each of Y705, Y731, and T492 of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3).
[0010] In some embodiments, the nucleotide sequence encodes an AAV
capsid protein (e.g., an AAV1, AAV5, or AAV6 capsid protein)
comprising Y to F (tyrosine to phenylalanine) modifications or T to
V (threonine to valine) modifications in the VP3 region of the
capsid at positions corresponding to:
[0011] one or more of or each of Y705F, Y731F, and T492V of a
wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1),
[0012] one or more of or each of Y436F, Y693F, and Y719F of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2), or
[0013] one or more of or each of Y705F, Y731F, and T492V of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3).
[0014] In some embodiments, the present disclosure provides an AAV
capsid protein (e.g., an AAV1, AAV5, or AAV6 capsid protein),
wherein a VP3 region of the capsid protein comprises modifications
(e.g., replacement of a tyrosine residue with a non-tyrosine
residue and/or a threonine residue with a non-threonine residue) at
positions corresponding to:
[0015] one or more of or each of Y705, Y731, and T492 of a
wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1),
[0016] one or more of or each of Y436, Y693, and Y719 of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2), or
[0017] one or more of or each of Y705, Y731, and T492 of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3).
[0018] In some embodiments, the AAV capsid protein (e.g., an AAV1,
AAV5, or AAV6 capsid protein) comprises Y to F (tyrosine to
phenylalanine) modifications or T to V (threonine to valine)
modifications in the VP3 region of the capsid protein at positions
corresponding to:
[0019] one or more of or each of Y705F, Y731F, and T492V of a
wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1),
[0020] one or more of or each of Y436F, Y693F, and Y719F of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2), or
[0021] one or more of or each of Y705F, Y731F, and T492V of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3).
[0022] In some embodiments, the present disclosure provides an rAAV
particle comprising an AAV capsid protein (e.g., an AAV1, AAV5, or
AAV6 capsid protein), wherein the VP3 region of the capsid protein
comprises modifications (e.g., replacement of a tyrosine residue
with a non-tyrosine residue and/or a threonine residue with a
non-threonine residue) at positions corresponding to:
[0023] one or more of or each of Y705, Y731, and T492 of a
wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1),
[0024] one or more of or each of Y436, Y693, and Y719 of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2), or
[0025] one or more of or each of Y705, Y731, and T492 of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3).
[0026] In some embodiments, the rAAV particle comprises an AAV
capsid protein (e.g., an AAV1, AAV5, or AAV6 capsid protein)
comprising Y to F modifications or T to V modifications in the VP3
region at positions corresponding to:
[0027] one or more of or each of Y705F, Y731F, and T492V of a
wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1),
[0028] one or more of or each of Y436F, Y693F, and Y719F of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2), or
[0029] one or more of or each of Y705F, Y731F, and T492V of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3).
[0030] In related embodiments, the disclosure provides methods for
using the viral particles, nucleic acids, vectors, proteins and
compositions disclosed herein, and further provides processes for
the transduction of one or more cells, one or more tissues, and/or
one or more organs of interest, and particularly those of a
mammalian animal using the disclosed viral particles. In an overall
and general sense, such methods generally include at least the step
of contacting a suitable host cell of interest with at least a
first composition that comprises, consists essentially of, or
alternatively consists of, an effective amount of a rAAV viral
particle described herein, in an amount and for a time sufficient
to transform at least a first cell or a first population of cells
with a nucleic acid segment contained within the particle. In some
embodiments, the viral particles of the present disclosure are
preferably useful as vectors for introducing one or more nucleic
acid segments to a selected host cell of interest. Preferably the
host cell is a mammalian host cell, with human host cells being
particularly preferred as targets for the rAAV particles described
herein. In certain embodiments, such rAAV particles will comprise
one or more isolated nucleic acid segments (e.g., DNA segments)
encoding a selected therapeutic and/or diagnostic agent, including,
for example one or more polynucleotides comprising one or more
genes of interest or other therapeutic agent(s) that are capable of
being expressed in a mammalian host cell that has been transformed
by one or more of the rAAV viral particles described herein.
Exemplary therapeutic agents include a polypeptide, a peptide, an
antibody, an antigen binding fragment, a ribozyme, a peptide
nucleic acid, a siRNA, an RNAi, an antisense oligonucleotide and an
antisense polynucleotide.
[0031] In some embodiments, a method is provided, comprising:
[0032] contacting a host cell (e.g., a muscle cell) with an rAAV
particle comprising an AAV1 capsid protein, wherein the AAV1 capsid
protein comprises modifications (e.g., replacement of a tyrosine
residue with a non-tyrosine residue and/or a threonine residue with
a non-threonine residue) in a VP3 region of the capsid protein at
positions corresponding to Y705, Y731, and T492 of a wild-type AAV1
(e.g., SEQ ID NO: 1). In some embodiments, the AAV1 capsid protein
comprises Y to F (tyrosine to phenylalanine) modifications or T to
V (threonine to valine) modifications in the VP3 region of the
capsid protein at positions corresponding to Y705F, Y731F, and
T492V of a wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1). The
contacting may be in vitro (e.g., by administering to a cell in a
dish or well) or in vivo (e.g., by administering the rAAV particle,
e.g., as a composition comprising the rAAV particle, to a
subject).
[0033] In some embodiments, a method is provided, comprising:
[0034] contacting a host cell (e.g., a retinal or airway epithelial
cell) with an rAAV particle comprising an AAV5 capsid protein,
wherein the AAV5 capsid protein comprises modifications (e.g.,
replacement of a tyrosine residue with a non-tyrosine residue
and/or a threonine residue with a non-threonine residue) in a VP3
region of the capsid protein at positions corresponding to Y436,
Y693, and Y719 of a wild-type AAV5 capsid protein (e.g., SEQ ID NO:
2). In some embodiments, the AAV5 capsid protein comprises Y to F
(tyrosine to phenylalanine) modifications in the VP3 region of the
capsid protein at positions corresponding to Y436F, Y693F, and
Y719F of a wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2). The
contacting may be in vitro (e.g., by administering to a cell in a
dish or well) or in vivo (e.g., by administering the rAAV particle,
e.g., as a composition comprising the rAAV particle, to a
subject).
[0035] In some embodiments, a method is provided, comprising:
[0036] contacting a host cell (e.g., a hematopoietic stem cell, a
dendritic cell, a monocyte, airway an epithelial cell, a muscle
cell, a liver cell, a pancreas cell or a microglial cell) with an
rAAV particle comprising an AAV6 capsid protein, wherein the AAV6
capsid protein comprises modifications (e.g., replacement of a
tyrosine residue with a non-tyrosine residue and/or a threonine
residue with a non-threonine residue) in a VP3 region of the capsid
protein at positions corresponding to Y705, Y731, and T492 of a
wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3). In some
embodiments, the VP3 region of the AAV6 capsid protein comprises Y
to F (tyrosine to phenylalanine) modifications or T to V (threonine
to valine) modifications at positions corresponding to Y705F,
Y731F, and T492V of a wild-type AAV6 capsid protein (e.g., SEQ ID
NO: 3). The contacting may be in vitro (e.g., by administering the
rAAV particle to a cell in a dish or well) or in vivo (e.g., by
administering the rAAV particle, e.g., as a composition comprising
the rAAV particle, to a subject).
[0037] In another aspect, the disclosure further provides
compositions comprising rAAV particles, and pharmaceutical
formulations thereof, useful in methods for delivering genetic
material encoding one or more beneficial or therapeutic product(s)
to mammalian cells and tissues. In particular, the compositions and
methods of the disclosure provide a significant advancement in the
art through their use in the treatment, prevention, and/or
amelioration of symptoms of one or more mammalian diseases. It is
contemplated that human gene therapy will particularly benefit from
the present teachings by providing new and improved rAAV particles
for use in the treatment of a number of diverse diseases,
disorders, and dysfunctions.
[0038] In another aspect, the disclosure concerns a rAAV particle
as described herein comprising a rAAV nucleic acid vector that
encodes one or more mammalian therapeutic agents for the
prevention, treatment, and/or amelioration of one or more disorders
in the mammal into which the vector construct is delivered. In
particular, the disclosure provides rAAV particles comprising
rAAV-based nucleic acid expression constructs that encode one or
more mammalian therapeutic agent(s) (including, but not limited to,
for example, protein(s), polypeptide(s), peptide(s), enzyme(s), a
ribozyme, a peptide nucleic acid, a siRNA, an RNAi, an antisense
oligonucleotide, an antisense polynucleotide, antibodies, antigen
binding fragments, as well as variants, and/or active fragments
thereof, for use in the treatment, prophylaxis, and/or amelioration
of one or more symptoms of a mammalian disease, dysfunction,
injury, and/or disorder). polypeptide, a peptide, an antibody, an
antigen binding fragment.
[0039] In some embodiments, the disclosure provides rAAV particles
as described herein comprising rAAV nucleic acid vectors that
comprise at least a first nucleic acid segment that encodes one or
more therapeutic agents that alter, inhibit, reduce, prevent,
eliminate, or impair the activity of one or more endogenous
biological processes in the cell. In particular embodiments, such
therapeutic agents may be those that selectively inhibit or reduce
the effects of one or more metabolic processes, dysfunctions,
disorders, or diseases. In certain embodiments, the defect may be
caused by injury or trauma to the mammal for which treatment is
desired. In other embodiments, the defect may be caused by the
over-expression of an endogenous biological compound, while in
other embodiments still, the defect may be caused by the
under-expression or even lack of one or more endogenous biological
compounds.
[0040] When the use of such nucleic acid vectors is contemplated
for introduction of one or more exogenous proteins, polypeptides,
peptides, ribozymes, siRNAs, and/or antisense oligonucleotides, to
a particular cell transfected with the nucleic acid vector, one may
employ the AAV nucleic acid vectors disclosed herein by
incorporating into the vector at least a first exogenous
polynucleotide operably positioned downstream and under the control
of at least a first heterologous promoter that expresses the
polynucleotide in a cell comprising the vector to produce the
encoded therapeutic agent, including for example, peptides,
proteins, polypeptides, antibodies, ribozymes, siRNAs, and
antisense oligo- or polynucleotides. Such constructs may employ one
or more heterologous promoters to express the therapeutic agent of
interest. Such promoters may be constitutive, inducible, or even
cell- or tissue-specific. Exemplary promoters include, but are not
limited to, a CMV promoter, a .beta.-actin promoter, a hybrid CMV
promoter, a hybrid .beta.-actin promoter, an EF1 promoter, a U1a
promoter, a U1b promoter, a Tet-inducible promoter, a VP16-LexA
promoter, human parvovirus B19 promoter, a joint-specific promoter
and a human-specific promoter.
[0041] The rAAV nucleic acid vectors of the disclosure may also
further comprise a second nucleic acid segment that comprises,
consists essentially of, or consists of, one or more enhancers,
regulatory elements, transcriptional elements, to alter or effect
transcription of the heterologous gene cloned in the rAAV nucleic
acid vectors. For example, the rAAV nucleic acid vectors of the
disclosure may further comprise a second nucleic acid segment that
comprises, consists essentially of, or consists of, at least a
first CMV enhancer, a synthetic enhancer, or a cell- or
tissue-specific enhancer. The second nucleic acid segment may also
further comprise, consist essentially of, or consist of one or more
intron sequences, post-transcriptional regulatory elements, or such
like. The nucleic acid vectors of the disclosure may also
optionally further comprise a third nucleic acid segment that
comprises, consists essentially of, or consists of, one or more
polylinker or multiple restriction sites/cloning region(s) to
facilitate insertion of one or more selected genetic elements,
polynucleotides, and the like into the rAAV nucleic acid vectors at
a convenient restriction site.
[0042] In aspects of the disclosure, the exogenous polynucleotides
that are comprised within one or more of the rAAV nucleic acid
vectors disclosed herein are preferably of mammalian origin, with
polynucleotides encoding nucleic acids, polypeptides and peptides
of human, primate, murine, porcine, bovine, ovine, feline, canine,
equine, epine, caprine, or lupine origin being particularly
preferred.
[0043] As described herein, the exogenous polynucleotide will
preferably encode one or more proteins, polypeptides, peptides,
enzymes, antibodies, siRNAs, ribozymes, antisense polynucleotides
or oligonucleotides, PNA molecules, or a combination of two or more
of these therapeutic agents. In fact, the exogenous polynucleotide
may encode two or more such molecules, or a plurality of such
molecules as may be desired. When combinational gene therapies are
desired, two or more different molecules may be produced from a
single rAAV expression system, or alternatively, a selected host
cell may be transfected with two or more unique rAAV expression
systems, each of which may comprise one or more distinct
polynucleotides that encode a therapeutic agent.
[0044] In other embodiments, the disclosure also provides rAAV
nucleic acid vectors that are comprised within an infectious rAAV
viral particle (e.g., an rAAV viral particle comprising a modified
capsid protein as described herein), or pluralities of such
particles, which themselves may also be comprised within one or
more diluents, buffers, physiological solutions or pharmaceutical
vehicles, formulated for administration to a mammal such as a human
for therapeutic, and/or prophylactic gene therapy regimens. Such
nucleic acid vectors or rAAV particles, and pluralities thereof may
also be provided in excipient formulations that are acceptable for
veterinary administration to selected livestock, exotic or
domesticated animals, companion animals (including pets and such
like), as well as non-human primates, zoological or otherwise
captive specimens, and such like, wherein the use of such nucleic
acid vectors and rAAV particles and related gene therapy is
indicated to produce a beneficial effect upon administration to
such an animal.
[0045] The disclosure also concerns host cells that comprise at
least one of the disclosed rAAV particles or rAAV vectors. Such
host cells include mammalian host cells, with human host cells
being preferred, and may be either isolated, in cell or tissue
culture. In the case of genetically modified animal models (e.g., a
mouse or dog), the transformed host cells may be comprised within
the body of a non-human animal itself.
[0046] Also provided herein is a method for the production of the
rAAV particles described herein. In some embodiments, it is
contemplated that one very significant advantage of the disclosed
viral particles will be the ability to utilize lower titers of
viral particles in mammalian transduction protocols, yet still
retain transfection rates at a suitable level.
[0047] Compositions comprising one or more of the disclosed rAAV
particles, rAAV nucleic acid vectors or host cells are also
provided, and particularly those compositions that further comprise
at least a first pharmaceutically-acceptable excipient for use in
therapy, and for use in the manufacture of medicaments for the
treatment of one or more mammalian diseases, disorders,
dysfunctions, or trauma. Such pharmaceutical compositions may
optionally further comprise one or more diluents, buffers,
liposomes, a lipid, a lipid complex, or the rAAV particles may be
comprised within a microsphere or a nanoparticle. Pharmaceutical
formulations suitable for intramuscular, intravenous, or direct
injection into an organ or tissue or a plurality of cells or
tissues of a human or other mammal are particularly preferred,
however, the compositions disclosed herein may also find utility in
administration to discreet areas of the mammalian body, including
for example, formulations that are suitable for direct injection
into one or more organs, tissues, or cell types in the body. Such
injection sites include, but are not limited to, a tissue such as a
muscle or epithelium, or an organ such as the eye, or other site
within a subject's body.
[0048] Also provided by the disclosure are kits comprising one or
more of the disclosed rAAV particles, vectors, proteins,
transformed host cells or pharmaceutical compositions comprising
such; and instructions for using the kit in a therapeutic,
diagnostic, or clinical embodiment. Such kits may further comprise
one or more reagents, restriction enzymes, peptides, therapeutics,
pharmaceutical compounds, or means for delivery of the
composition(s) to host cells, or to an animal (e.g., syringes,
injectables, and the like). Such kits may be therapeutic kits for
treating, preventing, or ameliorating the symptoms of a disease,
deficiency, dysfunction, and/or injury, and may comprise one or
more of the nucleic acid vectors, proteins, rAAV particles, or a
plurality of such particles, and instructions for using the kit in
a therapeutic and/or diagnostic medical regimen. Such kits may also
be used in large-scale production methodologies to produce large
quantities of the viral particles themselves for commercial sale,
or for use by others, including e.g., virologists, medical
professionals, and the like.
[0049] Another important aspect of the present disclosure concerns
methods of use of the disclosed rAAV particles, nucleic acid
vectors, protein compositions, and host cells described herein in
the preparation of medicaments for preventing, treating or
ameliorating the symptoms of various diseases, dysfunctions, or
deficiencies in an animal, such as a vertebrate mammal. Such
methods generally involve administration to a mammal, such as a
human in need thereof, one or more of the disclosed viral
particles, nucleic acid vectors, host cells, compositions, or
pluralities thereof, in an amount and for a time sufficient to
prevent, treat, or lessen the symptoms of such a disease,
dysfunction, or deficiency in the affected animal. The methods may
also encompass prophylactic treatment of animals suspected of
having such conditions, or administration of such compositions to
those animals at risk for developing such conditions either
following diagnosis, or prior to the onset of symptoms.
[0050] In other embodiments, the disclosure also provides the
disclosed rAAV nucleic acid vectors comprised within a rAAV
particle, comprised within one or more pharmaceutical carriers, and
may be formulated for administration to a mammal such as a human
for therapeutic, and/or prophylactic gene therapy regimens. Such
vectors may also be provided in pharmaceutical formulations that
are acceptable for veterinary administration to selected livestock,
domesticated animals, pets, and the like.
[0051] Another aspect of the present disclosure concerns methods of
use of the disclosed vectors, viral particles, compositions, and
host cells described herein in the preparation of medicaments for
treating or ameliorating the symptoms of various polypeptide
deficiencies in a mammal. Such methods generally involve
administration to a mammal, or human in need thereof, one or more
of the disclosed nucleic acid vectors, viral particles, host cells,
or compositions, in an amount and for a time sufficient to treat or
ameliorate the symptoms of such a deficiency in the affected
mammal. The methods may also encompass prophylactic treatment of
animals suspected of having such conditions, or administration of
such compositions to those animals at risk for developing such
conditions either following diagnosis, or prior to the onset of
symptoms.
[0052] The details of one or more embodiments of the disclosure are
set forth in the description below. Other features or advantages of
the present disclosure will be apparent from the following drawings
and detailed description of several embodiments, and also from the
appending claims.
BRIEF DESCRIPTION OF THE SEQUENCES
[0053] SEQ ID NO:1 is an exemplary amino acid sequence of the
capsid protein of the wild-type adeno-associated virus serotype 1
(AAV1);
[0054] SEQ ID NO:2 is an exemplary amino acid sequence of the
capsid protein of the wild-type adeno-associated virus serotype 5
(AAV5);
[0055] SEQ ID NO:3 is an exemplary amino acid sequence of the
capsid protein of the wild-type adeno-associated virus serotype 6
(AAV6).
TABLE-US-00001 (exemplary positions Y705, Y731, and T492 are each
bolded, underlined, and italicized) SEQ ID NO: 1 1 MAADGYLPDW
LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD
KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF
GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP GKKRPVEQSP 151 QEPDSSSGIG
KTGQQPAKKR LNFGQTGDSE SVPDPQPLGE PPATPAAVGP 201 TTMASGGGAP
MADNNEGADG VGNASGNWHC DSTWLGDRVI TTSTRTWALP 251 TYNNHLYKQI
SSASTGASND NHYFGYSTPW GYFDFNRFHC HFSPRDWQRL 301 INNNWGFRPK
RLNFKLFNIQ VKEVTTNDGV TTIANNLTST VQVFSDSEYQ 351 LPYVLGSAHQ
GCLPPFPADV FMIPQYGYLT LNNGSQAVGR SSFYCLEYFP 401 SQMLRTGNNF
TFSYTFEEVP FHSSYAHSQS LDRLMNPLID QYLYYLNRTQ 451 NQSGSAQNKD
LLFSRGSPAG MSVQPKNWLP GPCYRQQRVS K KTDNNNSN 501 FTWTGASKYN
LNGRESIINP GTAMASHKDD EDKFFPMSGV MIFGKESAGA 551 SNTALDNVMI
TDEEEIKATN PVATERFGTV AVNFQSSSTD PATGDVHAMG 601 ALPGMVWQDR
DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KNPPPQILIK 651 NTPVPANPPA
EFSATKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEVQ 701 YTSN AKSAN
VDFTVDNNGL YTEPRPIGTR LTRPL (exemplary positions Y436, Y693, and
Y719 are each bolded, underlined, and italicized) SEQ ID NO: 2 1
MSFVDHPPDW LEEVGEGLRE FLGLEAGPPK PKPNQQHQDQ ARGLVLPGYN 51
YLGPGNGLDR GEPVNRADEV AREHDISYNE QLEAGDNPYL KYNHADAEFQ 101
EKLADDTSFG GNLGKAVFQA KKRVLEPFGL VEEGAKTAPT GKRIDDHFPK 151
RKKARTEEDS KPSTSSDAEA GPSGSQQLQI PAQPASSLGA DTMSAGGGGP 201
LGDNNQGADG VGNASGDWHC DSTWMGDRVV TKSTRTWVLP SYNNHQYREI 251
KSGSVDGSNA NAYFGYSTPW GYFDFNRFHS HWSPRDWQRL INNYWGFRPR 301
SLRVKIFNIQ VKEVTVQDST TTIANNLTST VQVFTDDDYQ LPYVVGNGTE 351
GCLPAFPPQV FTLPQYGYAT LNRDNTENPT ERSSFFCLEY FPSKMLRTGN 401
NFEFTYNFEE VPFHSSFAPS QNLFKLANPL VDQYL RFVS TNNTGGVQFN 451
KNLAGRYANT YKNWFPGPMG RTQGWNLGSG VNRASVSAFA TTNRMELEGA 501
SYQVPPQPNG MTNNLQGSNT YALENTMIFN SQPANPGTTA TYLEGNMLIT 551
SESETQPVNR VAYNVGGQMA TNNQSSTTAP ATGTYNLQEI VPGSVWMERD 601
VYLQGPIWAK IPETGAHFHP SPAMGGFGLK HPPPMMLIKN TPVPGNITSF 651
SDVPVSSFIT QYSTGQVTVE MEWELKKENS KRWNPEIQYT NN NDPQFVD 701
FAPDSTGEYR TTRPIGTR L TRPL (exemplary positions Y705, Y731, and
T492 are each bolded, underlined, and italicized) SEQ ID NO: 3 1
MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51
KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101
QERLQEDTSF GGNLGRAVFQ AKKRVLEPFG LVEEGAKTAP GKKRPVEQSP 151
QEPDSSSGIG KTGQQPAKKR LNFGQTGDSE SVPDPQPLGE PPATPAAVGP 201
TTMASGGGAP MADNNEGADG VGNASGNWHC DSTWLGDRVI TTSTRTWALP 251
TYNNHLYKQI SSASTGASND NHYFGYSTPW GYFDFNRFHC HFSPRDWQRL 301
INNNWGFRPK RLNFKLFNIQ VKEVTTNDGV TTIANNLTST VQVFSDSEYQ 351
LPYVLGSAHQ GCLPPFPADV FMIPQYGYLT LNNGSQAVGR SSFYCLEYFP 401
SQMLRTGNNF TFSYTFEDVP FHSSYAHSQS LDRLMNPLID QYLYFLNRTQ 451
NQSGSAQNKD LLFSRGSPAG MSVQPKNWLP GPCYRQQRVS K KTDNNNSN 501
FTWTGASKYN LNGRESIINP GTAMASHKDD KDKFFPMSGV MIFGKESAGA 551
SNTALDNVMI TDEEEIKATN PVATERFGTV AVNLQSSSTD PATGDVHVMG 601
ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KHPPPQILIK 651
NTPVPANPPA EFSATKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEVQ 701 YTSN
AKSAN VDFTVDNNGL YTEPRPIGTR LTRPL
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present disclosure, which can be better understood
by reference to one or more of these drawings in combination with
the detailed description of specific embodiments presented
herein.
[0057] FIG. 1A is a series of photographs and a graph showing EGFP
expression in a murine muscle cell line treated with wild-type (WT)
or mutant AAV1 vectors.
[0058] FIG. 1B is a graph showing the total Alpha-1 antitrypsin
(AAT) concentration in muscle from mice injected with wild-type
AAV1 vectors or mutant AAV1 Y705F+Y731F+T492V vector (AAV1m).
[0059] FIG. 2 is a photograph showing mCherry expression in major
organs of mice following injection of wild-type (WT) or mutant AAV6
vectors.
[0060] FIG. 3 is a series of photographs showing EGFP expression in
mouse pancreas at the interior or edge following injection with
wild-type (WT) or mutant AAV6 vectors.
[0061] FIG. 4 is a series of photographs showing EGFP expression in
primary murine glial cells cultured from mice injected with
wild-type (WT) or mutant AAV6 vectors.
[0062] FIG. 5 is a series of photographs showing EGFP expression in
murine glial cells in mice injected with wild-type (WT) or mutant
AAV6 vectors.
[0063] FIG. 6 is a series of photographs showing EGFP expression in
neurons and astrocytes in brains from mice injected with mutant
AAV6 Y705+731F+T492V vectors.
[0064] FIG. 7 is a series of photographs and a graph showing EGFP
expression in human airway epithelial cells transduced with
wild-type (WT) or mutant AAV1, AAV2, AAV5, or AAV6 vectors.
[0065] FIG. 8A is a series of photographs and a graph showing EGFP
expression in primary human monocyte-derived dendritic cells
transduced with wild-type (WT) or mutant AAV2 vectors.
[0066] FIG. 8B is a series of photographs and a graph showing EGFP
expression in primary human monocyte-derived dendritic cells
transduced with wild-type (WT) AAV6 or mutant AAV2 or AAV6
vectors.
DETAILED DESCRIPTION OF THE INVENTION
[0067] The present disclosure provides AAV capsid proteins
comprising modifications of one or more of a combination of the
surface-exposed threonine and/or tyrosine residues in the VP3
region. Also provided are rAAV particles that include one or more
of the AAV capsid protein mutations disclosed herein, as well as
nucleic acid molecules encoding the AAV capsid proteins disclosed
herein. Advantageously, the rAAV particles of the present
disclosure have improved transduction efficiency in a variety of
cells, tissues and organs of interest, when compared to rAAV viral
particles comprising wild-type capsid proteins. In particular, as
described herein, it was found that rAAV particles comprising a
modified AAV1 capsid protein having three mutations at
Y705F+Y731F+T492V efficiently transduced muscle. It was also found
that rAAV particles comprising a modified AAV5 capsid protein
having three mutations at Y436F+Y693F+Y719F efficiently transduced
retinal cells and airway epithelial cells. Lastly, it was found
that rAAV particles comprising a modified AAV6 capsid protein
having three mutations at Y705F+Y731F+T492V efficiently transduced
multiple cells and tissues including hematopoietic stem cells,
dendritic cells, monocytes, airway epithelial cells, muscle, liver,
pancreas and microglial cells. Accordingly, aspects of the
disclosure relate to rAAV particles, capsid proteins, nucleic acid
vectors, host cells, compositions, kits, and uses thereof.
Recombinant AAV Vectors and Viral Particles
[0068] One aspect of the disclosure provides AAV capsid proteins,
such as AAV VP3 capsid proteins, or VP1 or VP2 capsid proteins
comprising a VP3 region, comprising modifications of a combination
of the surface-exposed threonine and/or tyrosine residues. Also
provided are rAAV particles comprising the AAV capsid proteins, as
well as nucleic acid molecules encoding the AAV capsid proteins of
the present disclosure. Advantageously, the rAAV particles
described herein have improved efficiency in transduction of a
variety of cells, tissues and organs of interest, when compared to
rAAV particles comprising wild-type AAV capsid proteins.
[0069] In some embodiments, the present disclosure provides a
nucleic acid molecule comprising a nucleotide sequence encoding an
AAV capsid protein (e.g., an AAV1, AAV5, or AAV6 capsid protein),
wherein the AAV capsid protein comprises modifications of a
combination of the surface-exposed threonine and/or tyrosine
residues at positions within the VP3 region.
[0070] In one embodiment, the nucleic acid molecule comprises a
nucleotide sequence encoding an AAV capsid protein, the AAV capsid
protein comprising one of the following modifications in the VP3
region:
[0071] (i) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y705 and Y731 of a wild-type AAV1
capsid protein (e.g., SEQ ID NO: 1) and a non-threonine residue at
a position that corresponds to T492 in the wild-type AAV1
protein;
[0072] (ii) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y705 and Y731 of
a wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1) and a
chemically-modified threonine residue at a position that
corresponds to T492 of the wild-type AAV1 capsid protein;
[0073] (iii) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y436F, Y693F, and Y719F of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2);
[0074] (iv) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y436F, Y693F, and
Y719F of a wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2);
[0075] (v) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y705 and Y731 of a wild-type AAV6
capsid protein (e.g., SEQ ID NO: 3) and a non-threonine residue at
a position that corresponds to T492 of the wild-type AAV6 capsid
protein; or
[0076] (vi) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y705 and Y731 of
a wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3) and a
chemically-modified threonine residue at a position that
corresponds to T492 of the wild-type AAV6 capsid protein.
[0077] In some embodiments, the present disclosure provides an AAV
capsid protein (e.g., an AAV1, AAV5, or AAV6 capsid protein),
wherein the AAV capsid protein comprises modifications of a
combination of the surface-exposed threonine and/or tyrosine
residues at positions within the VP3 region.
[0078] In one embodiment, the AAV capsid protein comprises one of
the following modifications in the VP3 region:
[0079] (i) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y705 and Y731 of a wild-type AAV1
capsid protein (e.g., SEQ ID NO: 1) and a non-threonine residue at
a position that corresponds to T492 in the wild-type AAV1
protein;
[0080] (ii) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y705 and Y731 of
a wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1) and a
chemically-modified threonine residue at a position that
corresponds to T492 of the wild-type AAV1 capsid protein;
[0081] (iii) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y436F, Y693F, and Y719F of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2);
[0082] (iv) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y436F, Y693F, and
Y719F of a wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2);
[0083] (v) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y705 and Y731 of a wild-type AAV6
capsid protein (e.g., SEQ ID NO: 3) and a non-threonine residue at
a position that corresponds to T492 of the wild-type AAV6 capsid
protein; or
[0084] (vi) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y705 and Y731 of
a wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3) and a
chemically-modified threonine residue at a position that
corresponds to T492 of the wild-type AAV6 capsid protein.
[0085] In some embodiments, the present disclosure provides an rAAV
particle comprising an AAV capsid protein (e.g., an AAV1, AAV5, or
AAV6 capsid protein), wherein the AAV capsid protein comprises
modifications of a combination of the surface-exposed threonine
and/or tyrosine residues at positions within the VP3 region.
[0086] In one embodiment, the rAAV particle comprises an AAV capsid
protein, the AAV capsid protein comprising one of the following
modifications in the VP3 region:
[0087] (i) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y705 and Y731 of a wild-type AAV1
capsid protein (e.g., SEQ ID NO: 1) and a non-threonine residue at
a position that corresponds to T492 in the wild-type AAV1
protein;
[0088] (ii) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y705 and Y731 of
a wild-type AAV1 capsid protein (e.g., SEQ ID NO: 1) and a
chemically-modified threonine residue at a position that
corresponds to T492 of the wild-type AAV1 capsid protein;
[0089] (iii) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y436F, Y693F, and Y719F of a
wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2);
[0090] (iv) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y436F, Y693F, and
Y719F of a wild-type AAV5 capsid protein (e.g., SEQ ID NO: 2);
[0091] (v) a non-tyrosine residue at one or more of or at each of
the positions that correspond to Y705 and Y731 of a wild-type AAV6
capsid protein (e.g., SEQ ID NO: 3) and a non-threonine residue at
a position that corresponds to T492 of the wild-type AAV6 capsid
protein; or
[0092] (vi) a chemically-modified tyrosine residue at one or more
of or at each of the positions that correspond to Y705 and Y731 of
a wild-type AAV6 capsid protein (e.g., SEQ ID NO: 3) and a
chemically-modified threonine residue at a position that
corresponds to T492 of the wild-type AAV6 capsid protein.
[0093] In some embodiments, modified AAV capsid protein does not
result in phosphorylation and/or ubiquitination of an rAAV particle
comprising the capsid protein and/or increases the efficiency of
transduction of such a viral particle into a cell or tissue
compared to a rAAV particle comprising a corresponding wild-type
capsid protein (e.g., a AAV1, AAV5, or AAV6 wild-type capsid
protein, such as SEQ ID NOs:1-3).
[0094] In one embodiment, the nucleic acid molecule comprises a
nucleotide sequence encoding an AAV capsid protein (e.g., a VP3
capsid protein), wherein the AAV serotype is selected from AAV1,
AAV5, and AAV6. In certain embodiments, the wild-type AAV capsid
protein has an amino acid sequence selected from SEQ ID NOs:
1-3.
[0095] In some embodiments, the nucleic acid molecule comprises a
nucleotide sequence encoding an AAV1 capsid protein. The
adeno-associated virus 1 (AAV1) is a non-pathogenic human
parvovirus. Recombinant AAV1 vectors are currently in use in Phase
I/II clinical trials for gene therapy of a number of diseases such
as alpha-1 antitrypsin deficiency, LPL deficiency, Pompe's disease
and muscular dystrophy. In some embodiments, the nucleic acid
molecule comprises a nucleotide sequence encoding an AAV5 capsid
protein. Recombinant AAV5 vectors are currently in use in Phase
I/II clinical trials for gene therapy of diseases such as Acute
Intermittent Porphyria. In some embodiments, the nucleic acid
molecule comprises a nucleotide sequence encoding an AAV6 capsid
protein. Recombinant AAV6 vectors are currently in use in Phase
I/II clinical trials for gene therapy of diseases such as severe
heart failure.
[0096] In one embodiment, a surface-exposed threonine residue
corresponding to a threonine residue of a wild-type AAV capsid
sequence described herein (e.g., SEQ ID NOs:1-3) is modified into a
non-threonine residue and/or is chemically modified so that said
non-threonine residue or said modified threonine residue does not
result in phosphorylation and/or ubiquitination of an AAV viral
particle. In some embodiments, the surface-exposed threonine
residue of the AAV capsid is modified into valine (V).
[0097] In some embodiments, a surface-exposed tyrosine residue
corresponding to a tyrosine residue of a wild-type AAV capsid
sequence described herein (e.g., SEQ ID NOs:1-3) is modified into a
non-tyrosine residue and/or is chemically modified so that said
non-tyrosine residue or said modified tyrosine residue does not
result in phosphorylation and/or ubiquitination of an AAV viral
particle. In some embodiments, the surface-exposed tyrosine residue
of the AAV capsid is modified into phenylalanine (F).
[0098] In some embodiments, the disclosure provides a rAAV particle
comprising an AAV capsid protein described herein (e.g., a
Y705F+Y731F+T492V AAV1 modified capsid protein, a Y436F+Y693F+Y719F
AAV5 modified capsid protein, or a Y705F+Y731F+T492V AAV6 modified
capsid protein). In some embodiments, a rAAV particle comprises a
AAV nucleic acid vector described herein and a capsid comprising
the modified capsid protein (e.g., a Y705F+Y731F+T492V AAV1
modified capsid protein, a Y436F+Y693F+Y719F AAV5 modified capsid
protein, or a Y705F+Y731F+T492V AAV6 modified capsid protein),
wherein the capsid encapsidates the AAV nucleic acid vector. In one
embodiment, the rAAV particle has enhanced transduction efficiency,
when compared to the wild-type rAAV particle. In another
embodiment, the rAAV particle is capable of efficient transduction
of cells, tissues, and/or organs of interest.
[0099] In some embodiments, the rAAV nucleic acid vector comprises
inverted terminal repeat sequences (ITRs), such as those derived
from a wild-type AAV genome, such as the AAV2 genome. In some
embodiments, the rAAV nucleic acid vector further comprises a
transgene (also referred to as a heterologous nucleic acid
molecule) operably linked to a promoter and optionally, other
regulatory elements, wherein the ITRs flank the transgene. In some
embodiments, the rAAV nucleic acid vector comprises a transgene,
wherein the transgene is a gene of interest operatively linked to a
promoter (e.g., a heterologous promoter, for example, a promoter
sequence non-native to the gene of interest) and flanked by ITRs.
In one embodiment, the transgene encodes a therapeutic agent of
interest.
[0100] Exemplary promoters include one or more heterologous,
tissue-specific, constitutive or inducible promoters, including,
but not limited to, a promoter selected from the group consisting
of cytomegalovirus (CMV) promoters, desmin (DES), beta-actin
promoters, insulin promoters, enolase promoters, BDNF promoters,
NGF promoters, EGF promoters, growth factor promoters,
axon-specific promoters, dendrite-specific promoters,
brain-specific promoters, hippocampal-specific promoters,
kidney-specific promoters, elafin promoters, cytokine promoters,
interferon promoters, growth factor promoters, alpha-1 antitrypsin
promoters, brain-specific promoters, neural cell-specific
promoters, central nervous system cell-specific promoters,
peripheral nervous system cell-specific promoters, interleukin
promoters, serpin promoters, hybrid CMV promoters, hybrid
beta-actin promoters, EF1 promoters, U1a promoters, U1b promoters,
Tet-inducible promoters and VP16-LexA promoters. In exemplary
embodiments, the promoter is a mammalian or avian beta-actin
promoter.
[0101] Exemplary enhancer sequences include, but are not limited
to, one or more selected from the group consisting of CMV
enhancers, synthetic enhancers, liver-specific enhancers,
vascular-specific enhancers, brain-specific enhancers, neural
cell-specific enhancers, lung-specific enhancers, muscle-specific
enhancers, kidney-specific enhancers, pancreas-specific enhancers,
and islet cell-specific enhancers.
[0102] Exemplary therapeutic agents include, but are not limited
to, an agent selected from the group consisting of polypeptides,
peptides, antibodies, antigen binding fragments, ribozymes, peptide
nucleic acids, siRNA, RNAi, antisense oligonucleotides and
antisense polynucleotides.
[0103] In exemplary embodiments, the rAAV nucleic acid vectors of
the disclosure encode a therapeutic protein or polypeptide (e.g.,
as a transgene operatively linked to a heterologous promoter, for
example, a promoter sequence non-native to the transgene) selected
from the group consisting of adrenergic agonists, anti-apoptosis
factors, apoptosis inhibitors, cytokine receptors, cytokines,
cytotoxins, erythropoietic agents, glutamic acid decarboxylases,
glycoproteins, growth factors, growth factor receptors, hormones,
hormone receptors, interferons, interleukins, interleukin
receptors, kinases, kinase inhibitors, nerve growth factors,
netrins, neuroactive peptides, neuroactive peptide receptors,
neurogenic factors, neurogenic factor receptors, neuropilins,
neurotrophic factors, neurotrophins, neurotrophin receptors,
N-methyl-D-aspartate antagonists, plexins, proteases, protease
inhibitors, protein decarboxylases, protein kinases, protein
kinsase inhibitors, proteolytic proteins, proteolytic protein
inhibitors, semaphorin a semaphorin receptors, serotonin transport
proteins, serotonin uptake inhibitors, serotonin receptors,
serpins, serpin receptors, and tumor suppressors.
[0104] In exemplary embodiments, the rAAV nucleic acid vectors may
comprise a nucleic acid segment that encodes a polypeptide selected
from the group consisting of BDNF, CNTF, CSF, EGF, FGF, G-SCF,
GM-CSF, gonadotropin, IFN, IFG-1, M-CSF, NGF, PDGF, PEDF, TGF,
TGF-B2, TNF, VEGF, prolactin, somatotropin, XIAP1, IL-1, IL-2,
IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10(187A), viral
IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, and IL-18.
Such therapeutic agents may be of human, murine, avian, porcine,
bovine, ovine, feline, canine, equine, epine, caprine, lupine or
primate origin.
[0105] Exemplary rAAV nucleic acid vectors useful according to the
disclosure include single-stranded (ss) or self-complementary (sc)
AAV nucleic acid vectors.
[0106] The rAAV nucleic acid vectors or rAAV particles of the
present disclosure may also be within an isolated mammalian host
cell, including for example, human, primate, murine, feline,
canine, porcine, ovine, bovine, equine, epine, caprine and lupine
host cells. The rAAV nucleic acid vectors or rAAV particles may be
within an isolated mammalian host cell such as a human endothelial,
epithelial, vascular, liver, lung, heart, pancreas, intestinal,
kidney, cardiac, cancer or tumor, muscle, bone, neural, blood, or
brain cell.
[0107] The rAAV particle may be of any AAV serotype, including any
derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, or 13, or pseudotypes/derivatives thereof). For example, any
ITR sequence derived or modified from an AAV serotype (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13) can be used with viral
particles comprising capsid proteins of a different serotype (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, or derivatives
thereof).
[0108] Methods of producing rAAV particles and nucleic acid vectors
are also known in the art and commercially available (see, e.g.,
Zolotukhin et al. Production and purification of serotype 1, 2, and
5 recombinant adeno-associated viral vectors. Methods 28 (2002)
158-167; and U.S. Patent Publication Numbers US20070015238 and
US20120322861, which are incorporated herein by reference; and
plasmids and kits available from ATCC and Cell Biolabs, Inc.). For
example, a plasmid containing the nucleic acid vector may be
combined with one or more helper plasmids, e.g., that contain a rep
gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene
(encoding VP1, VP2, and VP3, including a modified VP3 region as
described herein), and transfected into a producer cell line such
that the rAAV particle can be packaged and subsequently
purified.
[0109] In some embodiments, the one or more helper plasmids is a
first helper plasmid comprising a rep gene and a cap gene and a
second helper plasmid comprising a E1a gene, a E1b gene, a E4 gene,
a E2a gene, and a VA gene. In some embodiments, the rep gene is a
rep gene derived from AAV2 and the cap gene is derived from AAV1,
AAV5, and AAV6 and includes modifications to the gene in order to
produce the modified capsid protein described herein. Helper
plasmids, and methods of making such plasmids, are known in the art
and commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs,
pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E/R585E), and pDP8.ape
plasmids from PlasmidFactory, Bielefeld, Germany; other products
and services available from Vector Biolabs, Philadelphia, Pa.;
Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara,
Ca; and Addgene, Cambridge, Mass.; pxx6; Grimm et al. (1998), Novel
Tools for Production and Purification of Recombinant
Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9,
2745-2760; Kern, A. et al. (2003), Identification of a
Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids,
Journal of Virology, Vol. 77, 11072-11081; Grimm et al. (2003),
Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based
Production of Adeno-associated Virus Vectors of Serotypes 1 to 6,
Molecular Therapy, Vol. 7, 839-850; Kronenberg et al. (2005), A
Conformational Change in the Adeno-Associated Virus Type 2 Capsid
Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology,
Vol. 79, 5296-5303; and Moullier, P. and Snyder, R. O. (2008),
International efforts for recombinant adeno-associated viral vector
reference standards, Molecular Therapy, Vol. 16, 1185-1188).
[0110] An exemplary, non-limiting, rAAV particle production method
is described next. One or more helper plasmids are produced or
obtained, which comprise rep and cap ORFs for the desired AAV
serotype and the adenoviral VA, E2A (DBP), and E4 genes under the
transcriptional control of their native promoters. The cap ORF may
also comprise one or more modifications to produce a modified
capsid protein as described herein. HEK293 cells (available from
ATCC.RTM.) are transfected via CaPO4-mediated transfection, lipids
or polymeric molecules such as Polyethylenimine (PEI) with the
helper plasmid(s) and a plasmid containing a nucleic acid vector
described herein. The HEK293 cells are then incubated for at least
60 hours to allow for rAAV particle production. Alternatively, in
another example Sf9-based producer stable cell lines are infected
with a single recombinant baculovirus containing the nucleic acid
vector. As a further alternative, in another example HEK293 or BHK
cell lines are infected with a HSV containing the nucleic acid
vector and optionally one or more helper HSVs containing rep and
cap ORFs as described herein and the adenoviral VA, E2A (DBP), and
E4 genes under the transcriptional control of their native
promoters. The HEK293, BHK, or Sf9 cells are then incubated for at
least 60 hours to allow for rAAV particle production. The rAAV
particles can then be purified using any method known the art or
described herein, e.g., by iodixanol step gradient, CsCl gradient,
chromatography, or polyethylene glycol (PEG) precipitation.
[0111] Exemplary nucleic acid sequences for producing mutated AAV1,
AAV5 and AAV6 capsid proteins as described herein are provided
below.
TABLE-US-00002 AAV1 (SEQ ID NO: 4):
ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTCTCTGA
GGGCATTCGCGAGTGGTGGGACTTGAAACCTGGAGCCCCGAAGCCCAAAG
CCAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGGTGCTTCCTGGCTAC
AAGTACCTCGGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGC
GGCGGACGCAGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCA
AAGCGGGTGACAATCCGTACCTGCGGTATAACCACGCCGACGCCGAGTTT
CAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGC
AGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGG
AAGGCGCTAAGACGGCTCCTGGAAAGAAACGTCCGGTAGAGCAGTCGCCA
CAAGAGCCAGACTCCTCCTCGGGCATCGGCAAGACAGGCCAGCAGCCCGC
TAAAAAGAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTCCCCG
ATCCACAACCTCTCGGAGAACCTCCAGCAACCCCCGCTGCTGTGGGACCT
ACTACAATGGCTTCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGG
CGCCGACGGAGTGGGTAATGCCTCAGGAAATTGGCATTGCGATTCCACAT
GGCTGGGCGACAGAGTCATCACCACCAGCACCCGCACCTGGGCCTTGCCC
ACCTACAATAACCACCTCTACAAGCAAATCTCCAGTGCTTCAACGGGGGC
CAGCAACGACAACCACTACTTCGGCTACAGCACCCCCTGGGGGTATTTTG
ATTTCAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTC
ATCAACAACAATTGGGGATTCCGGCCCAAGAGACTCAACTTCAAACTCTT
CAACATCCAAGTCAAGGAGGTCACGACGAATGATGGCGTCACAACCATCG
CTAATAACCTTACCAGCACGGTTCAAGTCTTCTCGGACTCGGAGTACCAG
CTTCCGTACGTCCTCGGCTCTGCGCACCAGGGCTGCCTCCCTCCGTTCCC
GGCGGACGTGTTCATGATTCCGCAATACGGCTACCTGACGCTCAACAATG
GCAGCCAAGCCGTGGGACGTTCATCCTTTTACTGCCTGGAATATTTCCCT
TCTCAGATGCTGAGAACGGGCAACAACTTTACCTTCAGCTACACCTTTGA
GGAAGTGCCTTTCCACAGCAGCTACGCGCACAGCCAGAGCCTGGACCGGC
TGATGAATCCTCTCATCGACCAATACCTGTATTACCTGAACAGAACTCAA
AATCAGTCCGGAAGTGCCCAAAACAAGGACTTGCTGTTTAGCCGTGGGTC
TCCAGCTGGCATGTCTGTTCAGCCCAAAAACTGGCTACCTGGACCCTGTT
ATCGGCAGCAGCGCGTTTCTAAAGTAAAAACAGACAACAACAACAGCAAT
TTTACCTGGACTGGTGCTTCAAAATATAACCTCAATGGGCGTGAATCCAT
CATCAACCCTGGCACTGCTATGGCCTCACACAAAGACGACGAAGACAAGT
TCTTTCCCATGAGCGGTGTCATGATTTTTGGAAAAGAGAGCGCCGGAGCT
TCAAACACTGCATTGGACAATGTCATGATTACAGACGAAGAGGAAATTAA
AGCCACTAACCCTGTGGCCACCGAAAGATTTGGGACCGTGGCAGTCAATT
TCCAGAGCAGCAGCACAGACCCTGCGACCGGAGATGTGCATGCTATGGGA
GCATTACCTGGCATGGTGTGGCAAGATAGAGACGTGTACCTGCAGGGTCC
CATTTGGGCCAAAATTCCTCACACAGATGGACACTTTCACCCGTCTCCTC
TTATGGGCGGCTTTGGACTCAAGAACCCGCCTCCTCAGATCCTCATCAAA
AACACGCCTGTTCCTGCGAATCCTCCGGCGGAGTTTTCAGCTACAAAGTT
TGCTTCATTCATCACCCAATACTCCACAGGACAAGTGAGTGTGGAAATTG
AATGGGAGCTGCAGAAAGAAAACAGCAAGCGCTGGAATCCCGAAGTGCAG
TACACATCCAATTTTGCAAAATCTGCCAATGTTGATTTTACTGTGGACAA
CAATGGACTTTATACTGAGCCTCGCCCCATTGGCACGCGTTTCCTTACCC GTCCCCTGTAA AAV5
(SEQ ID NO: 5): ATGTCTTTTGTTGATCACCCTCCAGATTGGTTGGAAGAAGTTGGTGAAGG
TCTTCGCGAGTTTTTGGGCCTTGAAGCGGGCCCACCGAAACCAAAACCCA
ATCAGCAGCATCAAGATCAAGCCCGTGGTCTTGTGCTGCCTGGTTATAAC
TATCTCGGACCCGGAAACGGTCTCGATCGAGGAGAGCCTGTCAACAGGGC
AGACGAGGTCGCGCGAGAGCACGACATCTCGTACAACGAGCAGCTTGAGG
CGGGAGACAACCCCTACCTCAAGTACAACCACGCGGACGCCGAGTTTCAG
GAGAAGCTCGCCGACGACACATCCTTCGGGGGAAACCTCGGAAAGGCAGT
CTTTCAGGCCAAGAAAAGGGTTCTCGAACCTTTTGGCCTGGTTGAAGAGG
GTGCTAAGACGGCCCCTACCGGAAAGCGGATAGACGACCACTTTCCAAAA
AGAAAGAAGGCTCGGACCGAAGAGGACTCCAAGCCTTCCACCTCGTCAGA
CGCCGAAGCTGGACCCAGCGGATCCCAGCAGCTGCAAATCCCAGCCCAAC
CAGCCTCAAGTTTGGGAGCTGATACAATGTCTGCGGGAGGTGGCGGCCCA
TTGGGCGACAATAACCAAGGTGCCGATGGAGTGGGCAATGCCTCGGGAGA
TTGGCATTGCGATTCCACGTGGATGGGGGACAGAGTCGTCACCAAGTCCA
CCCGAACCTGGGTGCTGCCCAGCTACAACAACCACCAGTACCGAGAGATC
AAAAGCGGCTCCGTCGACGGAAGCAACGCCAACGCGTTCTTTGGATACAG
CACCCCCTGGGGGTACTTTGACTTTAACCGCTTCCACAGCCACTGGAGCC
CCCGAGACTGGCAAAGACTCATCAACAACTACTGGGGCTTCAGACCCCGG
TCCCTCAGAGTCAAAATCTTCAACATTCAAGTCAAAGAGGTCACGGTGCA
GGACTCCACCACCACCATCGCCAACAACCTCACCTCCACCGTCCAAGTGT
TTACGGACGACGACTACCAGCTGCCCTACGTCGTCGGCAACGGGACCGAG
GGATGCCTGCCGGCCTTCCCTCCGCAGGTCTTTACGCTGCCGCAGTACGG
TTACGCGACGCTGAACCGCGACAACACAGAAAATCCCACCGAGAGGAGCA
GCTTCTTCTGCCTAGAGTACTTTCCCAGCAAGATGCTGAGAACGGGCAAC
AACTTTGAGTTTACCTACAACTTTGAGGAGGTGCCCTTCCACTCCAGCTT
CGCTCCCAGTCAGAACCTCTTCAAGCTGGCCAACCCGCTGGTGGACCAGT
ACTTGTACCGCTTCGTGAGCACAAATAACACTGGCGGAGTCCAGTTCAAC
AAGAACCTGGCCGGGAGATACGCCAACACCTACAAAAACTGGTTCCCGGG
GCCCATGGGCCGAACCCAGGGCTGGAACCTGGGCTCCGGGGTCAACCGCG
CCAGTGTCAGCGCCTTCGCCACGACCAATAGGATGGAGCTCGAGGGCGCG
AGTTACCAGGTGCCCCCGCAGCCGAACGGCATGACCAACAACCTCCAGGG
CAGCAACACCTATGCCCTGGAGAACACTATGATCTTCAACAGCCAGCCGG
CGAACCCGGGCACCACCGCCACGTACCTCGAGGGCAACATGCTCATCACC
AGCGAGAGCGAGACGCAGCCGGTGAACCGCGTGGCGTACAACGTCGGCGG
GCAGATGGCCACCAACAACCAGAGCTCCACCACTGCCCCCGCGACCGGCA
CGTACAACCTCCAGGAAATCGTGCCCGGCAGCGTGTGGATGGAGAGGGAC
GTGTACCTCCAAGGACCCATCTGGGCCAAGATCCCAGAGACGGGGGCGCA
CTTTCACCCCTCTCCGGCCATGGGCGGATTCGGACTCAAACACCCACCGC
CCATGATGCTCATCAAGAACACGCCTGTGCCCGGAAATATCACCAGCTTC
TCGGACGTGCCCGTCAGCAGCTTCATCACCCAGTACAGCACCGGGCAGGT
CACCGTGGAGATGGAGTGGGAGCTCAAGAAGGAAAACTCCAAGAGGTGGA
ACCCAGAGATCCAGTACACAAACAACTACAACGACCCCCAGTTTGTGGAC
TTTGCCCCGGACAGCACCGGGGAATACAGAACCACCAGACCTATCGGAAC
GCGTTTCCTTACCCGACCCCTTTAA AAV6 (SEQ ID NO: 6):
ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTCTCTGA
GGGCATTCGCGAGTGGTGGGACTTGAAACCTGGAGCCCCGAAACCCAAAG
CCAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGGTGCTTCCTGGCTAC
AAGTACCTCGGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGC
GGCGGATGCAGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCA
AAGCGGGTGACAATCCGTACCTGCGGTATAACCACGCCGACGCCGAGTTT
CAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGC
AGTCTTCCAGGCCAAGAAGAGGGTTCTCGAACCTTTTGGTCTGGTTGAGG
AAGGTGCTAAGACGGCTCCTGGAAAGAAACGTCCGGTAGAGCAGTCGCCA
CAAGAGCCAGACTCCTCCTCGGGCATTGGCAAGACAGGCCAGCAGCCCGC
TAAAAAGAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTCCCCG
ACCCACAACCTCTCGGAGAACCTCCAGCAACCCCCGCTGCTGTGGGACCT
ACTACAATGGCTTCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGG
CGCCGACGGAGTGGGTAATGCCTCAGGAAATTGGCATTGCGATTCCACAT
GGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACATGGGCCTTGCCC
ACCTATAACAACCACCTCTACAAGCAAATCTCCAGTGCTTCAACGGGGGC
CAGCAACGACAACCACTACTTCGGCTACAGCACCCCCTGGGGGTATTTTG
ATTTCAACAGATTCCACTGCCATTTCTCACCACGTGACTGGCAGCGACTC
ATCAACAACAATTGGGGATTCCGGCCCAAGAGACTCAACTTCAAGCTCTT
CAACATCCAAGTCAAGGAGGTCACGACGAATGATGGCGTCACGACCATCG
CTAATAACCTTACCAGCACGGTTCAAGTCTTCTCGGACTCGGAGTACCAG
TTGCCGTACGTCCTCGGCTCTGCGCACCAGGGCTGCCTCCCTCCGTTCCC
GGCGGACGTGTTCATGATTCCGCAGTACGGCTACCTAACGCTCAACAATG
GCAGCCAGGCAGTGGGACGGTCATCCTTTTACTGCCTGGAATATTTCCCA
TCGCAGATGCTGAGAACGGGCAATAACTTTACCTTCAGCTACACCTTCGA
GGACGTGCCTTTCCACAGCAGCTACGCGCACAGCCAGAGCCTGGACCGGC
TGATGAATCCTCTCATCGACCAGTACCTGTATTACCTGAACAGAACTCAG
AATCAGTCCGGAAGTGCCCAAAACAAGGACTTGCTGTTTAGCCGGGGGTC
TCCAGCTGGCATGTCTGTTCAGCCCAAAAACTGGCTACCTGGACCCTGTT
ACCGGCAGCAGCGCGTTTCTAAAGTAAAAACAGACAACAACAACAGCAAC
TTTACCTGGACTGGTGCTTCAAAATATAACCTTAATGGGCGTGAATCTAT
AATCAACCCTGGCACTGCTATGGCCTCACACAAAGACGACAAAGACAAGT
TCTTTCCCATGAGCGGTGTCATGATTTTTGGAAAGGAGAGCGCCGGAGCT
TCAAACACTGCATTGGACAATGTCATGATCACAGACGAAGAGGAAATCAA
AGCCACTAACCCCGTGGCCACCGAAAGATTTGGGACTGTGGCAGTCAATC
TCCAGAGCAGCAGCACAGACCCTGCGACCGGAGATGTGCATGTTATGGGA
GCCTTACCTGGAATGGTGTGGCAAGACAGAGACGTATACCTGCAGGGTCC
TATTTGGGCCAAAATTCCTCACACGGATGGACACTTTCACCCGTCTCCTC
TCATGGGCGGCTTTGGACTTAAGCACCCGCCTCCTCAGATCCTCATCAAA
AACACGCCTGTTCCTGCGAATCCTCCGGCAGAGTTTTCGGCTACAAAGTT
TGCTTCATTCATCACCCAGTATTCCACAGGACAAGTGAGCGTGGAGATTG
AATGGGAGCTGCAGAAAGAAAACAGCAAACGCTGGAATCCCGAAGTGCAG
TATACATCTAACTTTGCCAAATCTGCCAACGTTGATTTCACTGTGGACAA
CAATGGACTTTATACTGAGCCTCGCCCCATTGGCACACGTTTCCTCACCC GTCCCCTGTAA
Therapeutic Uses
[0112] Another aspect of the disclosure pertains to uses of the
rAAV nucleic acid vectors and rAAV particles described herein for
efficient transduction of cells, tissues, and/or organs of
interest, and/or for use in gene therapy.
[0113] In some embodiments, the disclosure provides a method for
transduction of cells, tissues, and/or organs of interest,
comprising introducing into a cell, a composition comprising an
effective amount of a rAAV particle described herein, such as an
rAAV particle comprising a rAAV nucleic acid vector described
herein.
[0114] In certain embodiments, the rAAV nucleic acid vectors and
rAAV particles described herein are used for transduction of
mammalian host cells, including for example, human, primate,
murine, feline, canine, porcine, ovine, bovine, equine, epine,
caprine and lupine host cells. In certain embodiments, the rAAV
nucleic acid vectors and rAAV particles described herein are used
for transduction of endothelial, epithelial, vascular, liver, lung,
heart, pancreas, intestinal, kidney, muscle, bone, dendritic,
cardiac, neural, blood, brain, fibroblast or cancer cells. In some
embodiments, the rAAV particles comprising a modified AAV1 capsid
described herein (e.g., Y705F+Y731F+T492V) are used for transducing
muscle (e.g., mouse muscle). In some embodiments, the rAAV
particles comprising a modified AAV5 capsid described herein (e.g.,
Y436F+Y693F+Y719F) are used for transducing retinal cells (e.g.,
mouse cells) or airway epithelial cells (e.g., human cells). In
some embodiments, the rAAV particles comprising a modified AAV6
capsid described herein (e.g., Y705F+Y731F+T492V) are used for
transducing hematopoietic stem cells (e.g., human cells), dendritic
cells (e.g., human cells), monocytes (e.g., human cells), airway
epithelial cells (e.g., human cells), muscle (e.g., mouse or dog
muscle), liver (e.g., mouse liver), pancreas (e.g., mouse
pancreas), or microglial cells (e.g., mouse cells).
[0115] In one embodiment, cells, tissues, and/or organs of a
subject are transduced using the rAAV particles described
herein.
[0116] The term "subject," as used herein, describes an organism,
including mammals such as primates, to which treatment with the
compositions according to the present disclosure can be provided.
Mammalian species that can benefit from the disclosed methods of
treatment include, but are not limited to, humans; apes;
chimpanzees; orangutans; monkeys; domesticated animals such as dogs
and cats; livestock such as horses, cattle, pigs, sheep, goats, and
chickens; and other animals such as mice, rats, guinea pigs, and
hamsters.
[0117] In some embodiments, the disclosure provides a method for
treatment of a disease, wherein the method comprises administering,
to a subject in need of such treatment, an effective amount of a
composition comprising the rAAV particle described herein.
[0118] The term "treatment" or any grammatical variation thereof
(e.g., treat, treating, and treatment, etc.), as used herein,
includes but is not limited to, alleviating a symptom of a disease
or condition; and/or reducing, suppressing, inhibiting, lessening,
ameliorating or affecting the progression, and/or severity of a
disease or condition.
[0119] The term "effective amount," as used herein, refers to an
amount that is capable of treating a disease or condition or
otherwise capable of producing an intended therapeutic effect
(e.g., transduction of a cell or tissue or organ).
[0120] The disclosure also provides for the use of a composition
disclosed herein in the manufacture of a medicament for treating,
preventing or ameliorating the symptoms of a disease, disorder,
dysfunction, injury or trauma, including, but not limited to, the
treatment, prevention, and/or prophylaxis of a disease, disorder or
dysfunction, and/or the amelioration of one or more symptoms of
such a disease, disorder or dysfunction. Exemplary conditions for
which rAAV viral based gene therapy may find particular utility
include, but are not limited to, cancer, diabetes, autoimmune
disease, kidney disease, cardiovascular disease, pancreatic
disease, intestinal disease, liver disease, neurological disease,
neuromuscular disorder, neuromotor deficit, neuroskeletal
impairment, neurological disability, neurosensory dysfunction,
stroke, alpha-1-antitrypsin (AAT) deficiency, Batten's disease,
ischemia, an eating disorder, Alzheimer's disease, Huntington's
disease, Parkinson's disease, skeletal disease and pulmonary
disease.
[0121] In some embodiments, a composition comprising an rAAV
particle comprising a modified AAV1 capsid protein as described
herein (e.g., a modified AAV1 capsid protein comprising replacement
of tyrosine residues with non-tyrosine residues and a replacement
of a threonine residue with a non-threonine residue at each of the
positions corresponding to Y705, Y731, and T492 of the wild-type
AAV1 capsid protein having the sequence of SEQ ID NO: 1) is used in
a method of manufacturing a medicament for treating, preventing or
ameliorating one or more symptoms of muscular dystrophy or
alpha-1-antitripsin deficiency.
[0122] In some embodiments, a composition comprising an rAAV
particle comprising a modified AAV5 capsid protein as described
herein (e.g., a modified AAV5 capsid protein comprising replacement
of tyrosine residues with non-tyrosine residues at each of the
positions corresponding to Y436, Y693, and Y719 of a wild-type AAV5
capsid protein having the sequence of SEQ ID NO: 2) is used in a
method of manufacturing a medicament for treating, preventing or
ameliorating one or more symptoms of retinitis pigmentosa,
age-related macular degeneration, or cystic fibrosis.
[0123] In some embodiments, a composition comprising an rAAV
particle comprising a modified AAV6 capsid protein as described
herein (e.g., a modified AAV6 capsid protein comprising replacement
of tyrosine residues with non-tyrosine residues and a replacement
of a threonine residue with a non-threonine residue at each of the
positions corresponding to Y705, Y731, and T492 of a wild-type AAV6
capsid protein having the sequence of SEQ ID NO: 3) is used in a
method of manufacturing a medicament for treating, preventing or
ameliorating one or more symptoms of an immune disease that
involves treatment with genetically-modified dendritic cells and/or
macrophages, breast cancer, prostate cancer, pancreatic cancer,
Alzheimer's disease, sickle cell disease, beta-thalassemia, or
cardiovascular disease.
[0124] The disclosure also provides a method for treating or
ameliorating the symptoms of such a disease, injury, disorder, or
dysfunction in a mammal. Such methods generally involve at least
the step of administering to a mammal in need thereof, one or more
of the rAAV particles described herein, in an amount and for a time
sufficient to treat or ameliorate the symptoms of such a disease,
injury, disorder, or dysfunction in the mammal.
[0125] In some embodiments, a composition comprising an rAAV
particle comprising a modified AAV1 capsid protein as described
herein (e.g., a modified AAV1 capsid protein comprising replacement
of tyrosine residues with non-tyrosine residues and a replacement
of a threonine residue with a non-threonine residue at each of the
positions corresponding to Y705, Y731, and T492 of the wild-type
AAV1 capsid protein having the sequence of SEQ ID NO: 1) is used in
a method of treating, preventing or ameliorating one or more
symptoms of muscular dystrophy or alpha-1-antitripsin
deficiency.
[0126] In some embodiments, a composition comprising an rAAV
particle comprising a modified AAV5 capsid protein as described
herein (e.g., a modified AAV5 capsid protein comprising replacement
of tyrosine residues with non-tyrosine residues at each of the
positions corresponding to Y436, Y693, and Y719 of a wild-type AAV5
capsid protein having the sequence of SEQ ID NO: 2) is used in a
method of treating, preventing or ameliorating one or more symptoms
of retinitis pigmentosa, age-related macular degeneration, or
cystic fibrosis.
[0127] In some embodiments, a composition comprising an rAAV
particle comprising a modified AAV6 capsid protein as described
herein (e.g., a modified AAV6 capsid protein comprising replacement
of tyrosine residues with non-tyrosine residues and a replacement
of a threonine residue with a non-threonine residue at each of the
positions corresponding to Y705, Y731, and T492 of a wild-type AAV6
capsid protein having the sequence of SEQ ID NO: 3) is used in a
method of treating, preventing or ameliorating one or more symptoms
of an immune disease that involves treatment with
genetically-modified dendritic cells and/or macrophages, breast
cancer, prostate cancer, pancreatic cancer, Alzheimer's disease,
sickle cell disease, beta-thalassemia, or cardiovascular disease.
In some embodiments, a composition comprising an rAAV particle
comprising a modified AAV6 capsid protein as described herein is
used in a method of targeting blood cells, blood stem cells, blood
progenitor cells, dendritic cells, macrophages, and/or blood
differentiated cells, or a combination thereof.
[0128] Such treatment regimens are particularly contemplated in
human therapy, via administration of one or more compositions
either intramuscularly, intravenously, subcutaneously,
intrathecally, intraperitoneally, or by direct injection into an
organ or a tissue of the subject under care, such as injection into
the eye.
[0129] The disclosure also provides a method for providing to a
mammal in need thereof, a therapeutically-effective amount of the
rAAV compositions of the present disclosure, in an amount, and for
a time effective to provide the patient with a
therapeutically-effective amount of the desired therapeutic
agent(s) encoded by one or more nucleic acid segments comprised
within the rAAV vector. Preferably, the therapeutic agent is
selected from the group consisting of a polypeptide, a peptide, an
antibody, an antigen binding fragment, a ribozyme, a peptide
nucleic acid, a siRNA, an RNAi, an antisense oligonucleotide and an
antisense polynucleotide.
Pharmaceutical Compositions
[0130] The present disclosure also provides therapeutic or
pharmaceutical compositions comprising the active ingredient, such
as a rAAV particle described herein, in a form that can be combined
with a therapeutically or pharmaceutically acceptable carrier. The
rAAV particles may be prepared in a variety of compositions, and
may also be formulated in appropriate pharmaceutical vehicles for
administration to human or animal subjects.
[0131] The rAAV particles described herein and compositions
comprising them provide new and useful therapeutics for the
treatment, control, and amelioration of symptoms of a variety of
disorders.
[0132] The disclosure also provides compositions comprising one or
more of the disclosed nucleic acid molecules, rAAV nucleic acid
vectors, rAAV particles, or mammalian cells. As described herein,
such compositions may further comprise a pharmaceutical excipient,
buffer, or diluent, and may be formulated for administration to an
animal, and particularly a human being. Such compositions may
further optionally comprise a liposome, a lipid, a lipid complex, a
microsphere, a microparticle, a nanosphere, or a nanoparticle, or
may be otherwise formulated for administration to the cells,
tissues, organs, or body of a subject in need thereof. Such
compositions may be formulated for use in a variety of therapies,
such as for example, in the amelioration, prevention, and/or
treatment of conditions such as peptide deficiency, polypeptide
deficiency, peptide overexpression, polypeptide overexpression,
including for example, conditions which result in diseases or
disorders such as cancers, tumors, or other malignant growths,
neurological deficit dysfunction, autoimmune diseases, articular
diseases, cardiac or pulmonary diseases, ischemia, stroke,
cerebrovascular accidents, transient ischemic attacks (TIA);
diabetes and/or other diseases of the pancreas; cardiocirculatory
disease or dysfunction (including, e.g., hypotension, hypertension,
atherosclerosis, hypercholesterolemia, vascular damage or disease;
neural diseases (including, e.g., Alzheimer's, Huntington's,
Tay-Sach's and Parkinson's disease, memory loss, trauma, motor
impairment, neuropathy, and related disorders); biliary, renal or
hepatic disease or dysfunction; musculoskeletal or neuromuscular
diseases (including, e.g., arthritis, palsy, cystic fibrosis (CF),
amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS),
muscular dystrophy (MD), and such like).
[0133] In some embodiments, the rAAV particles may be administered
to a subject at concentrations ranging from 10.sup.6 to 10.sup.14
particles/ml or 10.sup.3 to 10.sup.13 particles/ml, or any values
therebetween for either range, such as for example, about 10.sup.6,
10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12,
10.sup.13, or 10.sup.14 particles/ml. In one embodiment, rAAV
particles of higher than 10.sup.13 particles/ml are to be
administered. In some embodiments, rAAV particles may be
administered to a subject at concentrations ranging from 10.sup.6
to 10.sup.14 vector genomes(vgs)/ml or 10.sup.3 to 10.sup.15
vgs/ml, or any values therebetween for either range, such as for
example, about 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10,
10.sup.11, 10.sup.12, 10.sup.13, or 10.sup.14 vgs/ml. In one
embodiment, rAAV particles of higher than 10.sup.13 vgs/ml are to
be administered. The rAAV particles can be administered as a single
dose, or divided into two or more administrations as may be
required to achieve therapy of the particular disease or disorder
being treated. In some embodiments, 0.0001 ml to 10 mls are
delivered to a subject.
[0134] In some embodiments of rAAV-based gene therapy regimens, a
lower titer of infectious particles can be used when using the
modified-capsid rAAV particles, than compared to conventional gene
therapy protocols.
[0135] In certain embodiments, the disclosure provides formulations
of one or more rAAV-based compositions disclosed herein in
pharmaceutically acceptable solutions for administration to a cell
or an animal, either alone or in combination with one or more other
modalities of therapy, and in particular, for therapy of human
cells, tissues, and diseases affecting man.
[0136] If desired, nucleic acid segments, RNA, DNA or PNA
compositions that express one or more of therapeutic gene products
may be administered in combination with other agents as well, such
as, e.g., proteins or polypeptides or various
pharmaceutically-active agents, including one or more systemic or
topical administrations of therapeutic polypeptides, biologically
active fragments, or variants thereof. In fact, there is virtually
no limit to other components that may also be included, given that
the additional agents do not cause a significant adverse effect
upon contact with the target cells or host tissues. The rAAV
particles may thus be delivered along with various other agents as
required in the particular instance. Such compositions may be
purified from host cells or other biological sources, or
alternatively may be chemically synthesized as described herein.
Likewise, such compositions may further comprise substituted or
derivatized RNA, DNA, siRNA, mRNA, tRNA, ribozyme, catalytic RNA
molecules, or PNA compositions and such like.
[0137] Formulation of pharmaceutically-acceptable excipients and
carrier solutions is well-known to those of skill in the art, as is
the development of suitable dosing and treatment regimens for using
the particular compositions described herein in a variety of
treatment regimens, including e.g., oral, parenteral, intravenous,
intranasal, intra-articular, intramuscular administration and
formulation.
[0138] Typically, these formulations may contain at least about
0.1% of the active compound or more, although the percentage of the
active ingredient(s) may, of course, be varied and may conveniently
be between about 1 or 2% and about 70% or 80% or more of the weight
or volume of the total formulation. Naturally, the amount of active
compound(s) in each therapeutically-useful composition may be
prepared is such a way that a suitable dosage will be obtained in
any given unit dose of the compound. Factors such as solubility,
bioavailability, biological half-life, route of administration,
product shelf life, as well as other pharmacological considerations
will be contemplated by one skilled in the art of preparing such
pharmaceutical formulations, and as such, a variety of dosages and
treatment regimens may be desirable.
[0139] In certain circumstances it will be desirable to deliver the
rAAV particles in suitably formulated pharmaceutical compositions
disclosed herein either subcutaneously, intraocularly,
intravitreally, parenterally, subcutaneously, intravenously,
intracerebro-ventricularly, intramuscularly, intrathecally, orally,
intraperitoneally, by oral or nasal inhalation, or by direct
injection to one or more cells, tissues, or organs by direct
injection. The methods of administration may also include those
modalities as described in U.S. Pat. Nos. 5,543,158, 5,641,515
and/or 5,399,363 (each of which is specifically incorporated herein
in its entirety by express reference thereto). Solutions of the
active compounds as freebase or pharmacologically acceptable salts
may be prepared in sterile water and may also suitably mixed with
one or more surfactants, such as hydroxypropylcellulose.
Dispersions may also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms.
[0140] The pharmaceutical forms of the rAAV particle compositions
suitable for injectable use include sterile aqueous solutions or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersions (U.S. Pat. No.
5,466,468, specifically incorporated herein in its entirety by
express reference thereto). In all cases the form must be sterile
and must be fluid to the extent that easy syringability exists. It
must be stable under the conditions of manufacture and storage and
must be preserved against the contaminating action of
microorganisms, such as bacteria and fungi. The carrier can be a
solvent or dispersion medium containing, for example, water,
saline, ethanol, polyol (e.g., glycerol, propylene glycol, and
liquid polyethylene glycol, and the like), suitable mixtures
thereof, and/or vegetable oils. Proper fluidity may be maintained,
for example, by the use of a coating, such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants.
[0141] The term "carrier" refers to a diluent, adjuvant, excipient,
or vehicle with which the compound is administered. Such
pharmaceutical carriers can be sterile liquids, such as water and
oils, including those of petroleum oil such as mineral oil,
vegetable oil such as peanut oil, soybean oil, and sesame oil,
animal oil, or oil of synthetic origin. Saline solutions and
aqueous dextrose and glycerol solutions can also be employed as
liquid carriers.
[0142] The compositions of the present disclosure can be
administered to the subject being treated by standard routes
including, but not limited to, pulmonary, intranasal, oral,
inhalation, parenteral such as intravenous, topical, transdermal,
intradermal, transmucosal, intraperitoneal, intramuscular,
intracapsular, intraorbital, intravitreal, intracardiac,
transtracheal, subcutaneous, subcuticular, intraarticular,
subcapsular, subarachnoid, intraspinal, epidural and intrasternal
injection.
[0143] For administration of an injectable aqueous solution, for
example, the solution may be suitably buffered, if necessary, and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, intravitreal, subcutaneous
and intraperitoneal administration. In this connection, a sterile
aqueous medium that can be employed will be known to those of skill
in the art in light of the present disclosure. For example, one
dosage may be dissolved in 1 mL of isotonic NaCl solution and
either added to 1000 mL of hypodermoclysis fluid or injected at the
proposed site of infusion, (see for example, "Remington's
Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and
1570-1580). Some variation in dosage will necessarily occur
depending on the condition of the subject being treated. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject. Moreover, for human
administration, preparations should meet sterility, pyrogenicity,
and the general safety and purity standards as required by, e.g.,
FDA Office of Biologics standards.
[0144] Sterile injectable solutions are prepared by incorporating
the rAAV particles in the required amount in the appropriate
solvent with several of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof.
[0145] The rAAV particle compositions disclosed herein may also be
formulated in a neutral or salt form. Pharmaceutically-acceptable
salts include the acid addition salts (formed with the free amino
groups of the protein) and which are formed with inorganic acids
such as, for example, hydrochloric or phosphoric acids, or such
organic acids as acetic, oxalic, tartaric, mandelic, and the like.
Salts formed with the free carboxyl groups can also be derived from
inorganic bases such as, for example, sodium, potassium, ammonium,
calcium, or ferric hydroxides, and such organic bases as
isopropylamine, trimethylamine, histidine, procaine and the like.
Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms such as injectable solutions,
drug-release capsules, and the like.
[0146] The amount of rAAV particle compositions and time of
administration of such compositions will be within the purview of
the skilled artisan having benefit of the present teachings. It is
likely, however, that the administration of
therapeutically-effective amounts of the disclosed compositions may
be achieved by a single administration, such as for example, a
single injection of sufficient numbers of infectious particles to
provide therapeutic benefit to the patient undergoing such
treatment. Alternatively, in some circumstances, it may be
desirable to provide multiple, or successive administrations of the
rAAV particle compositions, either over a relatively short, or a
relatively prolonged period of time, as may be determined by the
medical practitioner overseeing the administration of such
compositions.
[0147] The composition may include rAAV particles, either alone, or
in combination with one or more additional active ingredients,
which may be obtained from natural or recombinant sources or
chemically synthesized.
Expression Vectors
[0148] The present disclosure contemplates a variety of AAV-based
expression systems, and nucleic acid vectors. In one embodiment the
preferred AAV expression vectors comprise at least a first nucleic
acid segment that encodes a therapeutic peptide, protein, or
polypeptide. In another embodiment, the preferred AAV expression
vectors disclosed herein comprise at least a first nucleic acid
segment that encodes an antisense molecule. In another embodiment,
a promoter is operatively linked to a sequence region that encodes
a functional mRNA, a tRNA, a ribozyme or an antisense RNA.
[0149] The choice of which expression vector and ultimately to
which promoter a polypeptide coding region is operatively linked
depends directly on the functional properties desired, e.g., the
location and timing of protein expression, and the host cell to be
transformed. These are well known limitations inherent in the art
of constructing recombinant DNA molecules. However, a vector useful
in practicing the present disclosure is capable of directing the
expression of the functional RNA to which it is operatively
linked.
[0150] A variety of methods have been developed to operatively link
DNA to vectors via complementary cohesive termini or blunt ends.
For instance, complementary homopolymer tracts can be added to the
DNA segment to be inserted and to the vector DNA. The vector and
DNA segment are then joined by hydrogen bonding between the
complementary homopolymeric tails to form recombinant DNA
molecules.
[0151] To express a therapeutic agent in accordance with the
present disclosure one may prepare a rAAV particle comprising a
rAAV nucleic acid vector that comprises a therapeutic
agent-encoding nucleic acid segment under the control of one or
more promoters. To bring a sequence "under the control of" a
promoter, one positions the 5' end of the transcription initiation
site of the transcriptional reading frame generally between about 1
and about 50 nucleotides "downstream" of (i.e., 3' of) the chosen
promoter. The "upstream" promoter stimulates transcription of the
DNA and promotes expression of the encoded polypeptide. This is the
meaning of "recombinant expression" in this context. Particularly
preferred recombinant vector constructs are those that comprise a
rAAV nucleic acid vector. Such vectors are described in detail
herein.
[0152] When the use of such nucleic acid vectors is contemplated
for introduction of one or more exogenous proteins, polypeptides,
peptides, ribozymes, and/or antisense oligonucleotides, to a
particular cell transfected with the nucleic acid vector, one may
employ the rAAV nucleic acid vectors disclosed herein by
genetically modifying the vectors to further comprise at least a
first exogenous polynucleotide operably positioned downstream and
under the control of at least a first heterologous promoter that
expresses the polynucleotide in a cell comprising the vector to
produce the encoded peptide, protein, polypeptide, ribozyme, siRNA,
RNAi or antisense oligonucleotide. Such constructs may employ
heterologous promoters that are constitutive, inducible, or even
cell-specific promoters. Exemplary such promoters include, but are
not limited to, viral, mammalian, and avian promoters, including
for example a CMV promoter, a beta-actin promoter, a hybrid CMV
promoter, a hybrid beta-actin promoter, an EF1 promoter, a U1a
promoter, a U1b promoter, a Tet-inducible promoter, a VP16-LexA
promoter, and such like.
[0153] The nucleic acid vectors or expression systems may also
further comprise one or more enhancers, regulatory elements,
transcriptional elements, to alter or effect transcription of the
heterologous gene cloned in the rAAV vectors. For example, the rAAV
vectors of the present disclosure may further comprise at least a
first CMV enhancer, a synthetic enhancer, or a cell- or
tissue-specific enhancer. The exogenous polynucleotide may also
further comprise one or more intron sequences.
Therapeutic Kits
[0154] The disclosure also encompasses kits comprising one or more
of the rAAV particles, nucleic acid vectors, proteins, host cells,
and/or compositions described herein together with one or more
pharmaceutically-acceptable excipients, carriers, diluents,
adjuvants, and/or other components, as may be employed in the
formulation of particular delivery formulations, and in the
preparation of therapeutic agents for administration to a subject,
and in particularly, to a human. In particular, such kits may
comprise one or more of the disclosed rAAV particle compositions in
combination with instructions for using the composition in the
treatment of such disorders in a subject, and may typically further
include containers prepared for convenient commercial
packaging.
[0155] Therapeutic kits may also be prepared that comprise at least
one of the compositions disclosed herein and instructions for using
the composition as a therapeutic agent. The container means for
such kits may typically comprise at least one vial, test tube,
flask, bottle, syringe or other container means, into which the
disclosed rAAV particle composition(s) may be placed, and
preferably suitably aliquoted. Where a second therapeutic
polypeptide composition is also provided, the kit may also contain
a second distinct container means into which this second
composition may be placed. Alternatively, the plurality of
therapeutic biologically active compositions may be prepared in a
single pharmaceutical composition, and may be packaged in a single
container means, such as a vial, flask, syringe, bottle, or other
suitable single container means. The kits of the present disclosure
will also typically include a means for containing the vial(s) in
close confinement for commercial sale, such as, e.g., injection or
blow-molded plastic containers into which the desired vial(s) are
retained.
AAV Capsid Proteins
[0156] Supramolecular assembly of approximately 60 individual
capsid protein subunits into a non-enveloped, T-1 icosahedral
lattice capable of protecting the AAV DNA genome is a critical step
in the life-cycle of the helper-dependent human parvovirus,
adeno-associated virus (AAV), such as AAV2. The mature 20-nm
diameter AAV2 particle is composed of three structural proteins
designated VP1, VP2, and VP3 (molecular masses of 87, 73, and 62
kDa respectively) in a ratio of 1:1:18. Based on its symmetry and
these molecular weight estimates, of the 60 capsid proteins
comprising the particle, three are VP1 proteins, three are VP2
proteins, and fifty-four are VP3 proteins.
Biological Functional Equivalents
[0157] Also provided herein are modifications to the structure of
the AAV capsid proteins as described herein to obtain functional
rAAV particles that possess desirable characteristics, particularly
with respect to improved delivery of therapeutic gene constructs to
selected mammalian cell, tissues, and organs for the treatment,
prevention, and prophylaxis of various diseases and disorders, as
well as means for the amelioration of symptoms of such diseases,
and to facilitate the expression of exogenous therapeutic and/or
prophylactic polypeptides of interest via rAAV vector-mediated gene
therapy. As mentioned above, one of the key aspects of the
disclosure is the introduction of modifications into specific
capsid protein sequences to produce modified vectors with improved
properties for effecting gene therapy in mammalian systems.
[0158] For example, certain amino acids may be substituted for
other amino acids in a protein structure without appreciable loss
of interactive binding capacity with structures such as, for
example, antigen-binding regions of antibodies or binding sites on
substrate molecules. Since it is the interactive capacity and
nature of a protein that defines that protein's biological
functional activity, certain amino acid sequence substitutions can
be made in a protein sequence, and, of course, its underlying DNA
coding sequence, and nevertheless obtain a protein with like
properties. It is thus contemplated herein that various changes may
be made in the polynucleotide or polypeptide sequences disclosed
herein, without appreciable loss of their biological utility or
activity.
[0159] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte and Doolittle, 1982,
incorporated herein by reference). It is accepted that the relative
hydropathic character of the amino acid contributes to the
secondary structure of the resultant protein, which in turn defines
the interaction of the protein with other molecules, for example,
enzymes, substrates, receptors, DNA, antibodies, antigens, and the
like. Each amino acid has been assigned a hydropathic index on the
basis of their hydrophobicity and charge characteristics (Kyte and
Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
Exemplary Definitions
[0160] In accordance with the present disclosure, polynucleotides,
nucleic acid segments, nucleic acid sequences, and the like,
include, but are not limited to, DNAs (including and not limited to
genomic DNAs), genes, peptide nucleic acids (PNAs), RNAs
(including, but not limited to, rRNAs, mRNAs, miRNAs and tRNAs),
nucleosides, and suitable nucleic acid segments either obtained
from natural sources, chemically synthesized, modified, or
otherwise prepared or synthesized in whole or in part by the hand
of man.
[0161] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure pertains.
Although any methods and compositions similar or equivalent to
those described herein can be used in the practice or testing of
the present disclosure, the preferred methods and compositions are
described herein. For purposes of the present disclosure, the
following terms are defined below:
[0162] The term "promoter," as used herein refers to a region or
regions of a nucleic acid sequence that regulates
transcription.
[0163] The term "regulatory element," as used herein, refers to a
region or regions of a nucleic acid sequence that regulates
transcription. Exemplary regulatory elements include, but are not
limited to, enhancers, post-transcriptional elements,
transcriptional control sequences, and such like.
[0164] The term "vector," as used herein, refers to a nucleic acid
molecule (typically comprised of DNA) capable of replication in a
host cell and/or to which another nucleic acid segment can be
operatively linked so as to bring about replication of the attached
segment. A plasmid, cosmid, or a viral genome is an exemplary
vector.
[0165] The term "substantially corresponds to," "substantially
homologous," or "substantial identity," as used herein, denote a
characteristic of a nucleic acid or an amino acid sequence, wherein
a selected nucleic acid or amino acid sequence has at least about
70 or about 75 percent sequence identity as compared to a selected
reference nucleic acid or amino acid sequence. More typically, the
selected sequence and the reference sequence will have at least
about 76, 77, 78, 79, 80, 81, 82, 83, 84 or even 85 percent
sequence identity, and more preferably at least about 86, 87, 88,
89, 90, 91, 92, 93, 94, or 95 percent sequence identity. More
preferably still, highly homologous sequences often share greater
than at least about 96, 97, 98, or 99 percent sequence identity
between the selected sequence and the reference sequence to which
it was compared.
[0166] The percentage of sequence identity may be calculated over
the entire length of the sequences to be compared, or may be
calculated by excluding small deletions or additions which total
less than about 25 percent or so of the chosen reference sequence.
The reference sequence may be a subset of a larger sequence, such
as a portion of a gene or flanking sequence, or a repetitive
portion of a chromosome. However, in the case of sequence homology
of two or more polynucleotide sequences, the reference sequence
will typically comprise at least about 18-25 nucleotides, more
typically at least about 26 to 35 nucleotides, and even more
typically at least about 40, 50, 60, 70, 80, 90, or even 100 or so
nucleotides.
[0167] Desirably, which highly homologous fragments are desired,
the extent of percent identity between the two sequences will be at
least about 80%, preferably at least about 85%, and more preferably
about 90% or 95% or higher, as readily determined by one or more of
the sequence comparison algorithms well-known to those of skill in
the art, such as e.g., the FASTA program analysis described by
Pearson and Lipman (Proc. Natl. Acad. Sci. USA, 85(8):2444-8, April
1988).
[0168] The term "operably linked" or "operatively linked," as used
herein, refers to that the nucleic acid sequences being linked are
typically contiguous, or substantially contiguous, and, where
necessary to join two protein coding regions, contiguous and in
reading frame. However, since enhancers generally function when
separated from the promoter by several kilobases and intronic
sequences may be of variable lengths, some polynucleotide elements
may be operably linked but not contiguous.
[0169] Without further elaboration, it is believed that one skilled
in the art can, based on the above description, utilize the present
disclosure to its fullest extent. The following specific
embodiments are, therefore, to be construed as merely illustrative,
and not limitative of the remainder of the disclosure in any way
whatsoever. All publications cited herein are incorporated by
reference for the purposes or subject matter referenced herein.
EXAMPLES
Example 1. AAV1, AAV5, and AAV6 Capsid Mutants have Enhanced
Transgene Expression Levels
[0170] Specific AAV1, AAV5, AAV6 capsid mutants were tested for
transduction efficiency. The mutants tested are shown in the table
below. Exemplary tissues/organs for use with each serotype are also
shown.
TABLE-US-00003 Exemplary Serotypes Mutations Tissues/Organs AAV1
Y705F + Y731F + T492V Muscle (mouse) AAV5 Y436F + Y693F + Y719F
Retina (mouse) Airway epithelial cells (human) AAV6 Y705F + Y731F +
T492V Hematopoietic stem cells, dendritic cells, monocytes, airway
epithelial cells (human) Muscle (mouse, dog) Microglial cells,
pancreas, liver (mouse)
Transduction Efficiency of WT and Various Capsid-Modified AAV1
Serotype Vectors in a Murine Muscle Cell Line In Vitro [C2C12] and
in Murine Muscles In Vivo
[0171] Wild-type (WT) and mutant AAV1 vectors carrying a nucleic
acid encoding GFP or Alpha-1 antitrypsin (AAT) were produced using
standard methods and efficiency of each vector was evaluated in
vitro and in vivo.
[0172] For in vitro analysis, EGFP expression levels was measured
at 48 h post-infection following transduction at an MOI
(multiplicity of infection) of 1.times.10.sup.3 vgs/cell using
C2C12 cells. EGFP transgene expression was assessed as the total
area of green fluorescence (pixel.sup.2) per visual field
(mean.+-.SD).
[0173] For in vivo analysis, AAT expression levels were measured in
muscle by ELISA following intramuscular injection of WT (AAV1) and
mutant Y705-731F+T492V mutant AAV1 vectors (AAV1m) in C57BL6/J
mice.
[0174] The transduction efficiency of the AAV1 Y705F+Y731F+T492V
vector was significantly higher than that of the wild-type vector
both in vitro in C2C12 muscle cells (FIG. 1A) and in vivo in mouse
muscle (FIG. 1B).
Imaging of Major Organs for GFP Expression Following
Intraperitoneal Injection of Various Mutant scAAV6 Vectors in Mice
In Vivo
[0175] WT and mutant AAV6 vectors carrying a nucleic acid encoding
mCherry were produced using standard methods and efficiency of each
vector was evaluated in vivo.
[0176] mCherry expression analysis of different mice organs was
performed following i.p. injection of 10.sup.11 vgs of WT and
mutant AAV6 vectors. Organs were harvested two weeks post-injection
and analyzed using a UVP BioImaging System.
[0177] The transduction efficiency of the AAV6 Y705F+Y731F+T492V
was significantly higher than the wild-type vector in the liver and
pancreas (FIG. 2).
Transduction Efficiency of WT and Various Mutant scAAV6 Vectors in
Mouse Pancreas In Vivo WT and mutant AAV6 vectors carrying a
nucleic acid encoding EGFP were produced using standard methods and
efficiency of each vector was evaluated in vivo.
[0178] Mice pancreas were harvested two weeks post-injection of
10.sup.11 vgs of WT and mutant-AAV6 vectors and analyzed for EGFP
expression. DAPI and anti-insulin antibodies were used for nuclear
and cytoplasmic staining.
[0179] The transduction efficiency of the AAV6 Y705F+Y731F+T492V
was significantly higher than the wild-type vector in pancreas,
both at the edge of the organ and in the interior (FIG. 3).
Transduction Efficiency of WT and Mutant scAAV6 Vectors in Primary
Murine Glial Cells In Vivo
[0180] WT and mutant AAV6 vectors carrying a nucleic acid encoding
EGFP were produced using standard methods and efficiency of each
vector was evaluated in vivo.
[0181] Mice brains were harvested two weeks post-injection of
1.times.10.sup.10 vgs of WT and mutant-AAV6 vectors expressing
EGFP. Primary cells were cultured and the EGFP expression level was
analyzed by flourescence microscopy. Anti-CD11B antibodies were
used to identify glial cells.
[0182] The transduction efficiency of the AAV6 Y705F+Y731F+T492V
was significantly higher than the wild-type vector in glial cells
(FIG. 4).
Transduction Efficiency of Y705+731F+T492V Mutant scAAV6 Vectors in
Microglial Cells in Injected Brains in Mice In Vivo
[0183] WT and mutant AAV6 vectors carrying a nucleic acid encoding
EGFP were produced using standard methods and efficiency of each
vector was evaluated in vivo.
[0184] Mice brains were harvested two weeks post-injection of
1.times.10.sup.10 vgs of WT and mutant-AAV6 vectors expressing
EGFP. Microglia/macrophage-specific marker anti-IBA antibodies were
used to identify EGFP positive glial cells.
[0185] The transduction efficiency of the AAV6 Y705F+Y731F+T492V
was significantly higher than the wild-type vector in glial cells
in brain tissue (FIG. 5).
Transduction Efficiency of Y705+731F+T492V scAAV6 Vectors in
Neurons and Astrocytes in Injected Brains in Mice In Vivo
[0186] Mice brains were harvested two weeks post injection of
1.times.10.sup.10 vgs of WT and mutant-AAV6 vectors expressing
EGFP. Neurons and astrocytes were identified by cell-specific
morphology. Microglia/macrophage-specific marker anti-IBA
antibodies were used.
[0187] The AAV6 Y705F+Y731F+T492V was able to transduce neuronal
and astrocyte cells in brain tissue (FIG. 6).
Transduction Efficiency of WT and Various Mutant AAV Serotype
Vectors in Human Airway Epithelial Cells In Vitro
[0188] Human normal airway epithelial [4011] cells were infected
with WT and mutant AAV1, 2, 5, 6 vectors expressing EGFP at an MOI
2.times.10.sup.3 vg/cell. EGFP expression analysis was performed 48
hours post-infection by fluorescent microscopy. Transgene
expression was assessed as the total area of green fluorescence
(pixel2) per visual field (mean.+-.SD).
[0189] The transduction efficiency of the AAV6 Y705F+Y731F+T492V
was significantly higher than the wild-type vector of several
serotypes (AAV1, AAV2, AAV5, and AAV6) in human airway epithelial
cells (FIG. 7). Double and triple mutants of AAV5 (such as AAV5
triple mutant (Y436F+Y693F+Y719F)), were found to have improved
properties compared to the wild-type AAV5 vector (data not
shown).
Transduction Efficiency of WT and Various Mutant AAV2 and AAV6
Serotype Vectors in Primary Human Monocyte-Derived Dendritic Cells
In Vitro
[0190] WT and mutant AAV2 and AAV6 vectors carrying a nucleic acid
encoding EGFP were produced using standard methods and efficiency
of each vector was evaluated in vitro.
[0191] Leukapheresis-derived peripheral blood mononuclear cells
(PBMCs) were differentiated to dendritic cells (DCs) in the
presence of recombinant human IL-4 (500 U/mL) and GM-CSF (800
U/mL). EGFP expression analysis was performed at 48 hours
post-infection following transduction at an MOI of 2.times.10.sup.3
vgs/cell. Transgene expression was assessed as the total area of
green fluorescence (pixel.sup.2) per visual field (mean.+-.SD).
[0192] The transduction efficiency of the AAV6 Y705F+Y731F+T492V
was significantly higher than the wild-type vector of several
serotypes (AAV2 and AAV6) in primary human monocyte-derived
dendritic cells (FIGS. 8A and 8B).
Other Embodiments
[0193] All of the features disclosed in this specification may be
combined in any combination. Each feature disclosed in this
specification may be replaced by an alternative feature serving the
same, equivalent, or similar purpose. Thus, unless expressly stated
otherwise, each feature disclosed is only an example of a generic
series of equivalent or similar features.
[0194] From the above description, one skilled in the art can
easily ascertain the essential characteristics of the present
disclosure, and without departing from the spirit and scope
thereof, can make various changes and modifications of the
disclosure to adapt it to various usages and conditions. Thus,
other embodiments are also within the claims.
EQUIVALENTS
[0195] While several inventive embodiments have been described and
illustrated herein, those of ordinary skill in the art will readily
envision a variety of other means and/or structures for performing
the function and/or obtaining the results and/or one or more of the
advantages described herein, and each of such variations and/or
modifications is deemed to be within the scope of the inventive
embodiments described herein. More generally, those skilled in the
art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the inventive teachings is/are used. Those
skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific
inventive embodiments described herein. It is, therefore, to be
understood that the foregoing embodiments are presented by way of
example only and that, within the scope of the appended claims and
equivalents thereto, inventive embodiments may be practiced
otherwise than as specifically described and claimed. Inventive
embodiments of the present disclosure are directed to each
individual feature, system, article, material, kit, and/or method
described herein. In addition, any combination of two or more such
features, systems, articles, materials, kits, and/or methods, if
such features, systems, articles, materials, kits, and/or methods
are not mutually inconsistent, is included within the inventive
scope of the present disclosure.
[0196] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0197] All references, patents and patent applications disclosed
herein are incorporated by reference with respect to the subject
matter for which each is cited, which in some cases may encompass
the entirety of the document.
[0198] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0199] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0200] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of," will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e. "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of," "only one of,"
or "exactly one of." "Consisting essentially of," when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0201] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0202] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0203] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03.
Sequence CWU 1
1
61736PRTAdeno-associated virus serotype 1 1Met Ala Ala Asp Gly Tyr
Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg
Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala
Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr
Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr
Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala
Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly
Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser
Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr
Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175
Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180
185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly
Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val
Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu
Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala
Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser
Ala Ser Thr Gly Ala Ser Asn Asp Asn His 260 265 270 Tyr Phe Gly Tyr
Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe 275 280 285 His Cys
His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290 295 300
Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln 305
310 315 320 Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala
Asn Asn 325 330 335 Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu
Tyr Gln Leu Pro 340 345 350 Tyr Val Leu Gly Ser Ala His Gln Gly Cys
Leu Pro Pro Phe Pro Ala 355 360 365 Asp Val Phe Met Ile Pro Gln Tyr
Gly Tyr Leu Thr Leu Asn Asn Gly 370 375 380 Ser Gln Ala Val Gly Arg
Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro 385 390 395 400 Ser Gln Met
Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe 405 410 415 Glu
Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp 420 425
430 Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg
435 440 445 Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu
Phe Ser 450 455 460 Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys
Asn Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val
Ser Lys Thr Lys Thr Asp Asn 485 490 495 Asn Asn Ser Asn Phe Thr Trp
Thr Gly Ala Ser Lys Tyr Asn Leu Asn 500 505 510 Gly Arg Glu Ser Ile
Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu
Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly 530 535 540 Lys
Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile 545 550
555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu
Arg 565 570 575 Phe Gly Thr Val Ala Val Asn Phe Gln Ser Ser Ser Thr
Asp Pro Ala 580 585 590 Thr Gly Asp Val His Ala Met Gly Ala Leu Pro
Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro
Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro
Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys Asn Pro Pro
Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro
Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr 660 665 670
Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675
680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser
Asn 690 695 700 Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn
Asn Gly Leu 705 710 715 720 Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg
Tyr Leu Thr Arg Pro Leu 725 730 735 2724PRTAdeno-associated virus
serotype 5 2Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val
Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro
Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg
Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn
Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val
Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala
Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu
Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110
Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115
120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg
Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu
Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala
Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro
Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly
Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly
Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly
Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235
240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp
245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp
Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro
Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg
Pro Arg Ser Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys
Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn
Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr
Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu
Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360
365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser
370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr
Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val
Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys
Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val
Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu
Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly
Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480
Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485
490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met
Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn
Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr
Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser
Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly
Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro
Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser
Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605
Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610
615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys
Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp
Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln
Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser
Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn
Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu
Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr
Arg Pro Leu 3736PRTAdeno-associated virus serotype 6 3Met Ala Ala
Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu
Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25
30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro
35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly
Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp
Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr
Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu
Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val
Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Phe Gly Leu Val
Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val
Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155
160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175 Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu
Pro Pro 180 185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala
Ser Gly Gly Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala
Asp Gly Val Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser
Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg
Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln
Ile Ser Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn His 260 265 270 Tyr
Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe 275 280
285 His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn
290 295 300 Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn
Ile Gln 305 310 315 320 Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr
Thr Ile Ala Asn Asn 325 330 335 Leu Thr Ser Thr Val Gln Val Phe Ser
Asp Ser Glu Tyr Gln Leu Pro 340 345 350 Tyr Val Leu Gly Ser Ala His
Gln Gly Cys Leu Pro Pro Phe Pro Ala 355 360 365 Asp Val Phe Met Ile
Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly 370 375 380 Ser Gln Ala
Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro 385 390 395 400
Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe 405
410 415 Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
Asp 420 425 430 Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Phe
Leu Asn Arg 435 440 445 Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys
Asp Leu Leu Phe Ser 450 455 460 Arg Gly Ser Pro Ala Gly Met Ser Val
Gln Pro Lys Asn Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln
Gln Arg Val Ser Lys Thr Lys Thr Asp Asn 485 490 495 Asn Asn Ser Asn
Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu Asn 500 505 510 Gly Arg
Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys 515 520 525
Asp Asp Lys Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly 530
535 540 Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met
Ile 545 550 555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val
Ala Thr Glu Arg 565 570 575 Phe Gly Thr Val Ala Val Asn Leu Gln Ser
Ser Ser Thr Asp Pro Ala 580 585 590 Thr Gly Asp Val His Val Met Gly
Ala Leu Pro Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu
Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His
Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys
His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650
655 Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr
660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu
Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln
Tyr Thr Ser Asn 690 695 700 Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr
Val Asp Asn Asn Gly Leu 705 710 715 720 Tyr Thr Glu Pro Arg Pro Ile
Gly Thr Arg Tyr Leu Thr Arg Pro Leu 725 730 735 42211DNAArtificial
SequenceSynthetic Polynucleotide 4atggctgccg atggttatct tccagattgg
ctcgaggaca acctctctga gggcattcgc 60gagtggtggg acttgaaacc tggagccccg
aagcccaaag ccaaccagca aaagcaggac 120gacggccggg gtctggtgct
tcctggctac aagtacctcg gacccttcaa cggactcgac 180aagggggagc
ccgtcaacgc ggcggacgca gcggccctcg agcacgacaa ggcctacgac
240cagcagctca aagcgggtga caatccgtac ctgcggtata accacgccga
cgccgagttt 300caggagcgtc tgcaagaaga tacgtctttt gggggcaacc
tcgggcgagc agtcttccag 360gccaagaagc gggttctcga acctctcggt
ctggttgagg aaggcgctaa gacggctcct 420ggaaagaaac gtccggtaga
gcagtcgcca caagagccag actcctcctc gggcatcggc 480aagacaggcc
agcagcccgc taaaaagaga ctcaattttg gtcagactgg cgactcagag
540tcagtccccg atccacaacc tctcggagaa
cctccagcaa cccccgctgc tgtgggacct 600actacaatgg cttcaggcgg
tggcgcacca atggcagaca ataacgaagg cgccgacgga 660gtgggtaatg
cctcaggaaa ttggcattgc gattccacat ggctgggcga cagagtcatc
720accaccagca cccgcacctg ggccttgccc acctacaata accacctcta
caagcaaatc 780tccagtgctt caacgggggc cagcaacgac aaccactact
tcggctacag caccccctgg 840gggtattttg atttcaacag attccactgc
cacttttcac cacgtgactg gcagcgactc 900atcaacaaca attggggatt
ccggcccaag agactcaact tcaaactctt caacatccaa 960gtcaaggagg
tcacgacgaa tgatggcgtc acaaccatcg ctaataacct taccagcacg
1020gttcaagtct tctcggactc ggagtaccag cttccgtacg tcctcggctc
tgcgcaccag 1080ggctgcctcc ctccgttccc ggcggacgtg ttcatgattc
cgcaatacgg ctacctgacg 1140ctcaacaatg gcagccaagc cgtgggacgt
tcatcctttt actgcctgga atatttccct 1200tctcagatgc tgagaacggg
caacaacttt accttcagct acacctttga ggaagtgcct 1260ttccacagca
gctacgcgca cagccagagc ctggaccggc tgatgaatcc tctcatcgac
1320caatacctgt attacctgaa cagaactcaa aatcagtccg gaagtgccca
aaacaaggac 1380ttgctgttta gccgtgggtc tccagctggc atgtctgttc
agcccaaaaa ctggctacct 1440ggaccctgtt atcggcagca gcgcgtttct
aaagtaaaaa cagacaacaa caacagcaat 1500tttacctgga ctggtgcttc
aaaatataac ctcaatgggc gtgaatccat catcaaccct 1560ggcactgcta
tggcctcaca caaagacgac gaagacaagt tctttcccat gagcggtgtc
1620atgatttttg gaaaagagag cgccggagct tcaaacactg cattggacaa
tgtcatgatt 1680acagacgaag aggaaattaa agccactaac cctgtggcca
ccgaaagatt tgggaccgtg 1740gcagtcaatt tccagagcag cagcacagac
cctgcgaccg gagatgtgca tgctatggga 1800gcattacctg gcatggtgtg
gcaagataga gacgtgtacc tgcagggtcc catttgggcc 1860aaaattcctc
acacagatgg acactttcac ccgtctcctc ttatgggcgg ctttggactc
1920aagaacccgc ctcctcagat cctcatcaaa aacacgcctg ttcctgcgaa
tcctccggcg 1980gagttttcag ctacaaagtt tgcttcattc atcacccaat
actccacagg acaagtgagt 2040gtggaaattg aatgggagct gcagaaagaa
aacagcaagc gctggaatcc cgaagtgcag 2100tacacatcca attttgcaaa
atctgccaat gttgatttta ctgtggacaa caatggactt 2160tatactgagc
ctcgccccat tggcacgcgt ttccttaccc gtcccctgta a
221152175DNAArtificial SequenceSynthetic Polynucleotide 5atgtcttttg
ttgatcaccc tccagattgg ttggaagaag ttggtgaagg tcttcgcgag 60tttttgggcc
ttgaagcggg cccaccgaaa ccaaaaccca atcagcagca tcaagatcaa
120gcccgtggtc ttgtgctgcc tggttataac tatctcggac ccggaaacgg
tctcgatcga 180ggagagcctg tcaacagggc agacgaggtc gcgcgagagc
acgacatctc gtacaacgag 240cagcttgagg cgggagacaa cccctacctc
aagtacaacc acgcggacgc cgagtttcag 300gagaagctcg ccgacgacac
atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360aagaaaaggg
ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc
420ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga
agaggactcc 480aagccttcca cctcgtcaga cgccgaagct ggacccagcg
gatcccagca gctgcaaatc 540ccagcccaac cagcctcaag tttgggagct
gatacaatgt ctgcgggagg tggcggccca 600ttgggcgaca ataaccaagg
tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660gattccacgt
ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc
720agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg
aagcaacgcc 780aacgcgttct ttggatacag caccccctgg gggtactttg
actttaaccg cttccacagc 840cactggagcc cccgagactg gcaaagactc
atcaacaact actggggctt cagaccccgg 900tccctcagag tcaaaatctt
caacattcaa gtcaaagagg tcacggtgca ggactccacc 960accaccatcg
ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag
1020ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc
tccgcaggtc 1080tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg
acaacacaga aaatcccacc 1140gagaggagca gcttcttctg cctagagtac
tttcccagca agatgctgag aacgggcaac 1200aactttgagt ttacctacaa
ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260cagaacctct
tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc
1320acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata
cgccaacacc 1380tacaaaaact ggttcccggg gcccatgggc cgaacccagg
gctggaacct gggctccggg 1440gtcaaccgcg ccagtgtcag cgccttcgcc
acgaccaata ggatggagct cgagggcgcg 1500agttaccagg tgcccccgca
gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560tatgccctgg
agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc
1620acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc
ggtgaaccgc 1680gtggcgtaca acgtcggcgg gcagatggcc accaacaacc
agagctccac cactgccccc 1740gcgaccggca cgtacaacct ccaggaaatc
gtgcccggca gcgtgtggat ggagagggac 1800gtgtacctcc aaggacccat
ctgggccaag atcccagaga cgggggcgca ctttcacccc 1860tctccggcca
tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac
1920acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag
cttcatcacc 1980cagtacagca ccgggcaggt caccgtggag atggagtggg
agctcaagaa ggaaaactcc 2040aagaggtgga acccagagat ccagtacaca
aacaactaca acgaccccca gtttgtggac 2100tttgccccgg acagcaccgg
ggaatacaga accaccagac ctatcggaac gcgtttcctt 2160acccgacccc tttaa
217562211DNAArtificial SequenceSynthetic Polynucleotide 6atggctgccg
atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 60gagtggtggg
acttgaaacc tggagccccg aaacccaaag ccaaccagca aaagcaggac
120gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa
cggactcgac 180aagggggagc ccgtcaacgc ggcggatgca gcggccctcg
agcacgacaa ggcctacgac 240cagcagctca aagcgggtga caatccgtac
ctgcggtata accacgccga cgccgagttt 300caggagcgtc tgcaagaaga
tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360gccaagaaga
gggttctcga accttttggt ctggttgagg aaggtgctaa gacggctcct
420ggaaagaaac gtccggtaga gcagtcgcca caagagccag actcctcctc
gggcattggc 480aagacaggcc agcagcccgc taaaaagaga ctcaattttg
gtcagactgg cgactcagag 540tcagtccccg acccacaacc tctcggagaa
cctccagcaa cccccgctgc tgtgggacct 600actacaatgg cttcaggcgg
tggcgcacca atggcagaca ataacgaagg cgccgacgga 660gtgggtaatg
cctcaggaaa ttggcattgc gattccacat ggctgggcga cagagtcatc
720accaccagca cccgaacatg ggccttgccc acctataaca accacctcta
caagcaaatc 780tccagtgctt caacgggggc cagcaacgac aaccactact
tcggctacag caccccctgg 840gggtattttg atttcaacag attccactgc
catttctcac cacgtgactg gcagcgactc 900atcaacaaca attggggatt
ccggcccaag agactcaact tcaagctctt caacatccaa 960gtcaaggagg
tcacgacgaa tgatggcgtc acgaccatcg ctaataacct taccagcacg
1020gttcaagtct tctcggactc ggagtaccag ttgccgtacg tcctcggctc
tgcgcaccag 1080ggctgcctcc ctccgttccc ggcggacgtg ttcatgattc
cgcagtacgg ctacctaacg 1140ctcaacaatg gcagccaggc agtgggacgg
tcatcctttt actgcctgga atatttccca 1200tcgcagatgc tgagaacggg
caataacttt accttcagct acaccttcga ggacgtgcct 1260ttccacagca
gctacgcgca cagccagagc ctggaccggc tgatgaatcc tctcatcgac
1320cagtacctgt attacctgaa cagaactcag aatcagtccg gaagtgccca
aaacaaggac 1380ttgctgttta gccgggggtc tccagctggc atgtctgttc
agcccaaaaa ctggctacct 1440ggaccctgtt accggcagca gcgcgtttct
aaagtaaaaa cagacaacaa caacagcaac 1500tttacctgga ctggtgcttc
aaaatataac cttaatgggc gtgaatctat aatcaaccct 1560ggcactgcta
tggcctcaca caaagacgac aaagacaagt tctttcccat gagcggtgtc
1620atgatttttg gaaaggagag cgccggagct tcaaacactg cattggacaa
tgtcatgatc 1680acagacgaag aggaaatcaa agccactaac cccgtggcca
ccgaaagatt tgggactgtg 1740gcagtcaatc tccagagcag cagcacagac
cctgcgaccg gagatgtgca tgttatggga 1800gccttacctg gaatggtgtg
gcaagacaga gacgtatacc tgcagggtcc tatttgggcc 1860aaaattcctc
acacggatgg acactttcac ccgtctcctc tcatgggcgg ctttggactt
1920aagcacccgc ctcctcagat cctcatcaaa aacacgcctg ttcctgcgaa
tcctccggca 1980gagttttcgg ctacaaagtt tgcttcattc atcacccagt
attccacagg acaagtgagc 2040gtggagattg aatgggagct gcagaaagaa
aacagcaaac gctggaatcc cgaagtgcag 2100tatacatcta actttgccaa
atctgccaac gttgatttca ctgtggacaa caatggactt 2160tatactgagc
ctcgccccat tggcacacgt ttcctcaccc gtcccctgta a 2211
* * * * *