U.S. patent application number 15/784360 was filed with the patent office on 2018-02-01 for methods for the biosynthesis of taurine or hypotaurine in cells.
This patent application is currently assigned to PLANT SENSORY SYSTEMS LLC. The applicant listed for this patent is PLANT SENSORY SYSTEMS LLC. Invention is credited to Peter S. CARLSON, Alan M. KINNERSLEY, Frank J. TURANO, Kathleen A. TURANO.
Application Number | 20180028474 15/784360 |
Document ID | / |
Family ID | 43609434 |
Filed Date | 2018-02-01 |
United States Patent
Application |
20180028474 |
Kind Code |
A1 |
TURANO; Frank J. ; et
al. |
February 1, 2018 |
METHODS FOR THE BIOSYNTHESIS OF TAURINE OR HYPOTAURINE IN CELLS
Abstract
The present invention describes an approach to increase taurine
or hypotaurine production in prokaryotes. More particularly, the
invention relates to genetic transformation of organisms with genes
that encode proteins that catalyze the conversion of cysteine to
taurine, methionine to taurine, cysteamine to taurine, or alanine
to taurine. The invention describes methods for the use of
polynucleotides that encode cysteine dioxygenase (CDO) and
sulfinoalanine decarboxylase (SAD) polypeptides in prokaryotes to
increase taurine, hypotaurine or taurine precursor production. The
preferred embodiment of the invention is in plants but other
organisms may be used. Increased taurine production in prokaryotes
could be used as nutraceutical, pharmaceutical, or therapeutic
compounds or as a supplement in animal feed.
Inventors: |
TURANO; Frank J.;
(Baltimore, MD) ; TURANO; Kathleen A.; (Baltimore,
MD) ; CARLSON; Peter S.; (Baltimore, MD) ;
KINNERSLEY; Alan M.; (Baltimore, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PLANT SENSORY SYSTEMS LLC |
Baltimore |
MD |
US |
|
|
Assignee: |
PLANT SENSORY SYSTEMS LLC
Baltimore
MD
|
Family ID: |
43609434 |
Appl. No.: |
15/784360 |
Filed: |
October 16, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14993519 |
Jan 12, 2016 |
|
|
|
15784360 |
|
|
|
|
13505415 |
May 1, 2012 |
9267148 |
|
|
PCT/US2010/054664 |
Oct 29, 2010 |
|
|
|
14993519 |
|
|
|
|
61263548 |
Nov 23, 2009 |
|
|
|
61257240 |
Nov 2, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12P 13/001 20130101; C12N 15/8273 20130101; C12N 15/8243 20130101;
C12Y 113/1102 20130101; A23K 20/10 20160501; A23V 2002/00 20130101;
A61K 31/185 20130101; A23L 33/10 20160801; C12N 15/8279 20130101;
Y02A 50/30 20180101; Y02A 50/473 20180101; A23K 10/12 20160501;
A61K 31/145 20130101; C12N 15/8253 20130101; C12N 15/8261 20130101;
C12N 9/0069 20130101; C12N 15/8271 20130101 |
International
Class: |
A61K 31/145 20060101
A61K031/145; A61K 31/185 20060101 A61K031/185; A23K 20/10 20060101
A23K020/10; A23L 33/10 20060101 A23L033/10; C12N 9/02 20060101
C12N009/02; C12P 13/00 20060101 C12P013/00; C12N 15/82 20060101
C12N015/82; A23K 10/12 20060101 A23K010/12 |
Claims
1. A cell comprising an expression cassette stably incorporated in
its genome, the expression cassette comprising a promoter operably
linked to an exogenous polynucleotide that is operably linked to a
terminator, wherein the exogenous polynucleotide encodes a
sulfinoalanine decarboxylase (SAD).
2. The cell of claim 1, wherein the SAD is encoded by a
polynucleotide comprising a nucleotide sequence selected from the
group consisting of the nucleotide sequence set forth in SEQ ID
NO:5 and the nucleotide sequence set forth in SEQ ID NO:6.
3. The cell of claim 1, wherein the SAD comprises an amino acid
sequence selected from the group consisting of the amino acid
sequence set forth in SEQ ID NO: 7 and the amino acid sequence set
forth in SEQ ID NO:8.
4. The cell of claim 1, wherein the promoter is a constitutive
promoter or a non-constitutive promoter selected from the group
consisting of a tissue-preferred promoter, a tissue-specific
promoter, a cell type-specific promoter, an inducible promoter, a
plant glutamate decarboxylase (GAD) promoter, a plant sulphate
transporter (SULTR) promoter, and a plant glutamate receptor (GLR)
promoter.
5. The cell of claim 1 which is a plant cell.
6. The cell of claim 1 which is an algae.
7. The cell of claim 1, wherein the expression cassette further
comprises a nucleotide sequence encoding a peptide subcellular
location sequence operatively linked to the SAD encoding nucleotide
sequence.
8. The cell of claim 7, wherein the peptide subcellular location
sequence targets a subcellular location selected from the group
consisting of an apoplast, vacuole, plastid, chloroplast,
proplastid, etioplast, chromoplast, mitochondrion, peroxisome,
glyoxysome, nucleus, lysosome, endomembrane system, endoplasmic
reticulum, vesicle, and Golgi apparatus.
9. A plant storage organ comprising the cell of claim 5, wherein
the plant storage organ is a seed, tuber, fruit, or root.
10. A seed having stably incorporated in its genome an exogenous
polynucleotide encoding a sulfinoalanine decarboxylase (SAD)
protein.
11. The seed of claim 10, wherein the exogenous polynucleotide
comprises a nucleotide sequence selected from the group consisting
of the nucleotide sequence set forth in SEQ ID NO:5 and the
nucleotide sequence set forth in SEQ ID NO:6.
12. The seed of claim 10, wherein the SAD comprises an amino acid
sequence selected from the group consisting of the amino acid
sequence set forth in SEQ ID NO:7 and the amino acid sequence set
forth in SEQ ID NO:8.
13. A plant grown from the seed of claim 10.
14. A plant having stably incorporated in its genome an exogenous
polynucleotide encoding a sulfinoalanine decarboxylase (SAD)
protein.
15. The plant of claim 14, wherein the plant has increased growth,
yield, or biomass, altered development, increased
water-use-efficiency, increased nitrogen-use-efficiency, or
increased tolerance to biotic stress (pests, pathogens, bacteria,
microbes, viruses, viroids, microorganisms, invertebrates, insects,
nematodes, vertebrates) or abiotic stress (osmotic stress,
oxidative damage, drought, salt, cold, freezing, heat, UV light,
limitations of nutrients such as nitrogen, sulfur, phosphorous or
other minerals).
16. The plant of claim 14 which is selected from the group
consisting of acacia, alfalfa, algae, aneth, apple, apricot,
artichoke, arugula, asparagus, avocado, banana, barley, beans,
beech, beet, Bermuda grass, blackberry, blueberry, Blue grass,
broccoli, brussels sprouts, cabbage, camelina, canola, cantaloupe,
carrot, cassava, cauliflower, celery, cherry, chicory, cilantro,
citrus, clementines, coffee, corn, cotton, cucumber, duckweed,
Douglas fir, eggplant, endive, escarole, eucalyptus, fennel,
fescue, figs, forest trees, garlic, gourd, grape, grapefruit, honey
dew, jatropha, jicama, kiwifruit, lettuce, leeks, lemon, lime,
Loblolly pine, maize, mango, melon, mushroom, nectarine, nut, oat,
okra, onion, orange, ornamental plants, palm, papaya, parsley, pea,
peach, peanut, pear, pepper, persimmon, pine, pineapple, plantain,
plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine,
radicchio, radish, rapeseed, raspberry, rice, rye, rye grass,
seaweed, scallion, sorghum, Southern pine, soybean, spinach,
squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato,
sweetgum, switchgrass, tangerine, tea, tobacco, tomato, turf,
turnip, a vine, watermelon, wheat, yam, and zucchini.
17. A method of producing a crop of plants having stably
incorporated in their genome an exogenous polynucleotide encoding a
SAD protein, the method comprising growing or multiplying the seed
of claim 10 to obtain a crop of plants.
18. A pharmaceutical composition comprising an extract of the plant
of claim 14.
19. A nutritional supplement comprising an extract of the plant of
claim 14.
20. An animal feed comprising the plant storage organ of claim
8.
21. The plant of claim 14, wherein the exogenous polynucleotide
comprises a nucleotide sequence selected from the group consisting
of the nucleotide sequence set forth in SEQ ID NO:5 and the
nucleotide sequence set forth in SEQ ID NO:6.
22. The plant of claim 14, wherein the SAD comprises an amino acid
sequence selected from the group consisting of the amino acid
sequence set forth in SEQ ID NO:7, and the amino acid sequence set
forth in SEQ ID NO:8.
23. A method of producing a crop of plants having stably
incorporated in their genome an exogenous polynucleotide encoding a
SAD protein, the method comprising growing, multiplying or breeding
the plant of claim 13 to obtain a crop of plants.
24. A method of producing a crop of plants having stably
incorporated in their genome an exogenous polynucleotide encoding
SAD protein, the method comprising growing, multiplying or breeding
the plant of claim 14 to obtain a crop of plants.
25. An animal feed supplement comprising the seed of claim 10.
26. An animal feed supplement comprising the plant of claim 14.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/993,519 filed 12 Jan. 2016, which in turn
is a continuation of U.S. patent application Ser. No. 13/505,415
filed 1 May 2012, now U.S. Pat. No. 9,267,148, which in turn is a
national stage filing under 35 U.S.C. .sctn.371 of
PCT/US2010/054664 filed 29 Oct. 2010 which in turn is related to
and claims the benefit of and U.S. Patent Application Ser. No.
61/263,548 filed 23 Nov. 2009 and U.S. Patent Application Ser. No.
61/257,240 filed 2 Nov. 2009. Each application is incorporated
herein in its entirety by reference.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is entitled
3834120SequenceListing.txt, created on 4 October and is 69 kb in
size. The information in the electronic format of the Sequence
Listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention is in the field of recombinant
production of taurine.
BACKGROUND OF THE INVENTION
[0004] Taurine as a Plant Growth Stimulator
[0005] Exogenous application of taurine has been reported to
increase crop harvest, yield, and biomass (1). Applications of
taurine by foliar spray, soil and roots application, and seed
immersion increase crop production and seedling growth (1).
Exogenous applications of taurine have also been shown to increase
photosynthetic capacity of isolated plant cells (protoplasts and
chloroplasts) (1). Increased taurine production in plants can
enhance plant growth and development, yield, or tolerance to biotic
and/or abiotic stresses. Increased yield, growth, or biomass may be
a result of increased nitrogen flow, sensing, uptake, storage,
transport or nitrogen use efficiency. Increased yield, growth or
biomass may also be a result of increased carbon metabolism due to
increased photosynthesis or increased carbohydrate metabolism by
increased sucrose production and/or transport or increase
biosynthesis or mobilization of starch, or oil. Increased yield,
growth or biomass may also be associated with increased phosphorus
uptake, transport or utilization. Increased yield, growth or
biomass may also be associated with increased sulfur or sulfate
uptake, transport or utilization. Increased yield, growth or
biomass may also be associated with increased water uptake,
transport, utilization or water-use-efficiency. Increased yield,
growth or biomass may also be due to changes in the cell cycle
modifications that improve growth rates and may increase early
vigor and accelerate maturation leading to improved yield.
Increased yield, growth or biomass may also be due to changes in
the production of hormones or signaling molecules that regulate and
improve plant growth and development leading to improvements in
yield and biotic or abiotic stress tolerance. Increases in carbon,
nitrogen, phosphorus, or sulfate flow, sensing, uptake, storage,
transport or efficiency may improve seed quality for starch, oil or
protein content. Increased yield, growth or biomass may also be a
result of increased tolerance to abiotic stress such as changes in
osmotic conditions, oxidative damage, drought, salt, cold,
freezing, heat, UV light or light intensity. Increased yield,
growth or biomass may also be a result of increased tolerance to
biotic stress such as challenges, infection or insult from pests,
pathogens, bacteria, microbes, viruses, viroids, microorganisms,
invertebrates, insects, nematodes, or vertebrate. Increased yield,
growth or biomass may be a result of increased tolerance to abiotic
stresses such as changes in osmotic conditions or light intensity,
oxidative damage, drought, salt, cold, freezing, heat, or UV
radiation.
[0006] Taurine is an Essential Compound for Animals
[0007] Taurine is essential for human neonatal development (2) and
plays an important role in brain development (3, 4). Taurine is
involved in the modulation of intracellular calcium homeostasis (5,
6) and may balance glutamate activity, protecting neurons against
glutamate excitotoxicity (7, 8). Taurine is also an osmoregulator
(9). Taurine is essential for heart function (10), protects the
integrity of hepatic tissue (11), and plays a role in
photoprotection (12).
[0008] Taurine as a Pharmaceutical or Therapeutic
[0009] Taurine is used as a pharmaceutical and therapeutic. Taurine
has been used in the treatment of cardiovascular diseases (13, 14),
elevated blood pressure (15), seizure disorders (16), hepatic
disorders (17), and alcoholism (18) and may be useful in the
treatment of diabetes (19), Alzheimer's disease (20), and ocular
disorders (21). Taurine has been shown to prevent obesity (22) and
control cholesterol (23, 24). Taurine acts as an antioxidant and
protects against toxicity of various substances (25-27). Taurine
has been shown to prevent oxidative stress induced by exercise
(28), and is used in energy drinks to improve performance (29).
Taurine can also be used in topical applications to treat
dermatological conditions (30).
[0010] Taurine as a Dietary Supplement
[0011] Taurine is biosynthesized in most animals and can be found
in meat and seafood. Those who do not eat these foods regularly
(e.g., vegetarians) or do not produce sufficient levels of taurine,
e.g., cats (31), must acquire it through dietary supplement. Trout
that are fed all-plant protein diets must acquire dietary taurine
for normal growth (32).
[0012] Metabolic Pathways that Synthesize Taurine
[0013] With few exceptions (33, 34), taurine is found in plants
only in low levels (35), and the metabolic pathway for taurine and
hypotaurine has not yet been identified in plants. Several
metabolic pathways that synthesize taurine and hypotaurine have
been identified in animals and bacteria (FIG. 1). In animals,
cysteine and oxygen are converted into 3-sulfinoalanine by cysteine
dioxygenase (CDO). 3-sulfinoalanine is converted into hypotaurine
by sulfinoalanine decarboxylase (SAD) or glutamate decarboxylase
(GAD). Hypotaurine is converted into taurine either by the activity
of hypotaurine dehydrogenase (HTDeHase) or by a spontaneous
conversion. Cysteamine (2-aminoethanethiol) and oxygen are
converted into hypotaurine by cysteamine dioxygenase (ADO), and
hypotaurine is converted into taurine. Alternatively cysteine and
sulfite are converted into cysteate and hydrogen sulfide by
cysteine lyase (cysteine sulfite lyase or cysteine
hydrogen-sulfide-lyase). Cysteate is converted into taurine by SAD
or GAD. In bacteria, the compound 2-sulfoacetaldehyde is
synthesized from acetyl phosphate and sulfite by sulfoacetaldehyde
acetyltransferase (SA). Alanine and 2-sulfoacetaldehyde are
converted into taurine and pyruvate by taurine-pyruvate
aminotransferase (TPAT). In addition, sulfoacetaldehyde and ammonia
(or ammonium) are converted into taurine and water in the presence
of ferrocytochrome C by taurine dehydrogenase. Sulfite,
aminoacetaldehyde, carbon dioxide and succinate are converted into
taurine, 2-oxoglutarate and oxygen by taurine dioxygenase
(TDO).
SUMMARY OF THE INVENTION
[0014] The invention provides methods and compositions for taurine
or taurine precursor production in organisms. More particularly,
the invention encompasses the use of polynucleotides that encode in
plants functional (1) cysteine dioxygenase (CDO), (2) CDO and
sulfinoalanine decarboxylase (SAD) or glutamate decarboxylase
(GAD), (3) cysteamine dioxygenase (ADO), (4) taurine-pyruvate
aminotransferase (TPAT), (5) TPAT and sulfoacetaldehyde
acetyltransferase (SA), (6) taurine dehydrogenase (TDeHase) or (7)
taurine dioxygenase (TDO). The invention provides methods for
transforming plants and constructing vector constructs and other
nucleic acid molecules for use therein. The transgenic plants will
have increased levels of taurine or taurine-precursors for enhanced
plant growth and development, yield, or tolerance to biotic and/or
abiotic stresses and can be used to provide nutraceuticals or
pharmaceuticals for improving physical or mental performance,
antioxidative activity, or therapeutic compounds in the treatment
of conditions including congestive heart failure, high blood
pressure, hepatitis, high cholesterol, diabetes, fibrosis,
epilepsy, autism, attention deficit-hyperactivity disorder, retinal
disorders, alcoholism, or as a food supplement in animal feed.
[0015] The invention provides isolated cells comprising exogenous
DNA which expresses enzymes of taurine biosynthetic pathways. In
one embodiment, an isolated cell comprises two separate expression
cassettes. A first expression cassette comprises a first promoter
operably linked to a first polynucleotide, and a second expression
cassette comprises a second promoter operably linked to a second
polynucleotide. In some embodiments, the first polynucleotide
encodes cysteine dioxygenase (CDO) and the second polynucleotide
encodes sulfinoalanine decarboxylase (SAD). In other embodiments
the first polynucleotide encodes cysteine dioxygenase (CDO) and the
second polynucleotide encodes glutamate decarboxylase (GAD). In
still other embodiments, the first polynucleotide encodes
taurine-pyruvate aminotransferase (TPAT) and the second
polynucleotide encodes sulfoacetaldehyde acetyltransferase (SA). In
yet other embodiments the first polynucleotide encodes a small
subunit of taurine dehydrogenase (ssTDeHase) and the second
polynucleotide encodes a large subunit of taurine dehydrogenase
(lsTDeHase).
[0016] Some isolated cells of the invention comprise exogenous DNA
which comprises a single expression cassette. The single expression
cassette comprises a promoter operably linked to a polynucleotide
which encodes (i) CDO and SAD; (ii) CDO and GAD; (iii) TPAT; (iv)
TPAT and SA; or (v) ssTDeHase and lsTDeHase.
[0017] Other isolated cells of the invention are plant cells which
comprise exogenous DNA which comprises a promoter operably linked
to a polynucleotide. The polynucleotide encodes CDO, ADO, or
taurine dioxygenase (TDO).
[0018] The invention also provides plant storage organs comprising
isolated cells of the invention; transgenic seeds with a genome
comprising exogenous DNA encoding one or more of CDO, SAD, GAD,
ADO, TPAT, SA, TDO, or TDeHase, and transgenic plants grown from
the transgenic seeds.
[0019] The invention provides methods of altering a property of a
transgenic plant of the invention by contacting the transgenic
plant with an agent which increases sulfur or nitrogen
concentration in cells of the transgenic plant.
[0020] The invention also provides pharmaceutical compositions and
nutritional supplements comprising an extract of a transgenic plant
of the invention, and feeds comprising a component, which can be
one or more of the plant storage organs, transgenic seeds, and
transgenic plants of the invention.
[0021] In one embodiment of the invention polynucleotides encoding
functional CDO and SAD or GAD enzymes are used to transform plant
cells or to transform plants. Inventive methods produce plants that
have advantages of enhanced taurine production, that result in
plants with enhanced plant growth characteristics, survival
characteristics and/or tolerance to environmental or other plant
stresses and increase nutritional, pharmaceutical, or therapeutic
value. Plants are genetically modified in accordance with the
invention to introduce into the plant a polynucleotide that encodes
a CDO enzyme and/or a polynucleotide that encodes a SAD or GAD that
functions in the formation of hypotaurine or taurine in the
plant.
[0022] Another embodiment of the invention describes the use of
ADO, TPAT, TDeHase, or TDO to produce hypotaurine or taurine in
plants.
[0023] Another embodiment of the invention describes the use of
TPAT and SA to produce taurine in plants.
[0024] Another embodiment of the invention describes the use of
polynucleotides that encode polypeptides for functional CDO, CDO
and SAD or GAD, ADO, TPAT, SA, TDeHase or TDO expressed in
eukaryotes or prokaryotes or in eukaryotic or prokaryotic cells,
for hypotaurine or taurine production.
BRIEF DESCRIPTION OF THE FIGURE
[0025] FIG. 1 shows taurine biosynthetic pathways.
DETAILED DESCRIPTION OF THE INVENTION
[0026] The present invention provides methods and materials for the
production of taurine (2-aminoethanesulfonic acid) in cells and
living organisms. In preferred embodiments, the invention provides
methods for the genetic transformation of organisms, preferably
plants, with genes that encode proteins that catalyze the
conversion of cysteine to taurine, methionine to taurine,
cysteamine to taurine, or alanine to taurine. The invention also
provides methods of using plants with increased levels of
endogenous taurine or taurine derivatives such as hypotaurine to
improve plant growth, development and performance, that is to
increase plant size, biomass, yield or tolerance to biotic or
abiotic stress. The invention also provides methods of using plants
with elevated levels of endogenous taurine or taurine derivatives
such as hypotaurine as a food- or feed-supplement, dietary
supplement, or as a component of a health supplement or
therapy.
[0027] The present invention describes the methods for the
synthesis of DNA constructs for taurine or taurine precursor
production from polynucleotides and vectors and the methods for
making transformed organisms including plants, photosynthetic
organisms, microbes, invertebrates, and vertebrates. The present
invention is unique in that it describes a method to produce plants
that have advantages of enhanced taurine production and that result
in plants with enhanced plant growth characteristics, survival
characteristics and/or tolerance to environmental or other plant
stresses and increased nutritional, pharmaceutical, or therapeutic
value.
[0028] The present invention describes the insertion of the taurine
biosynthetic pathway in organisms where the pathway does not exist
or has not clearly been identified. The invention describes methods
for the use of polynucleotides that encode functional cysteine
dioxygenase (CDO) and sulfinoalanine decarboxylase (SAD) or
glutamate decarboxylase (GAD), cysteamine dioxygenase (ADO),
taurine-pyruvate aminotransferase (TPAT), TPAT and
sulfoacetaldehyde acetyltransferase (SA), taurine dehydrogenase
(TDeHase) or taurine dioxygenase (TDO) in plants. The preferred
embodiment of the invention is in plants but other organisms may be
used.
[0029] Enzymes of Taurine Biosynthetic Pathways
[0030] Examples of amino acid sequences of enzymes of taurine
biosynthetic pathways are provided in the sequence listing: SEQ ID
NO:3 and SEQ ID NO:4 (CDO); SEQ ID NO:7 and SEQ ID NO:8 (SAD); SEQ
ID NO:11 and SEQ ID NO:12 (GAD); SEQ ID NO:18 (TPAT); SEQ ID NO:20
(SA); SEQ ID NO:22 (ssTDeHase); SEQ ID NO:22 (lsTDeHase); SEQ ID
NO:13 and SEQ ID NO:14 (ADO); and SEQ ID NO:26 (TDO). The invention
is not limited to the use of these amino acid sequences. Those of
ordinary skill in the art know that organisms of a wide variety of
species commonly express and utilize homologous proteins, which
include the insertions, substitutions and/or deletions discussed
above, and effectively provide similar function. For example, the
amino acid sequences for CDO, SAD, GAD, or ADO from zebra fish
(Danio rerio) or TPAT, SA, ssTDeHase or lsTDeHase from Roseobacter
denitrificans or TDO from Escherichia coli may differ to a certain
degree from the amino acid sequences of CDO, SAD, GAD, ADO, TPAT,
SA, ssTDeHase, lsTDeHase or TDO in another species and yet have
similar functionality with respect to catalytic and regulatory
function. Amino acid sequences comprising such variations are
included within the scope of the present invention and are
considered substantially or sufficiently similar to a reference
amino acid sequence. Although it is not intended that the present
invention be limited by any theory by which it achieves its
advantageous result, it is believed that the identity between amino
acid sequences that is necessary to maintain proper functionality
is related to maintenance of the tertiary structure of the
polypeptide such that specific interactive sequences will be
properly located and will have the desired activity, and it is
contemplated that a polypeptide including these interactive
sequences in proper spatial context will have activity.
[0031] Another manner in which similarity may exist between two
amino acid sequences is where there is conserved substitution
between a given amino acid of one group, such as a non-polar amino
acid, an uncharged polar amino acid, a charged polar acidic amino
acid, or a charged polar basic amino acid, with an amino acid from
the same amino acid group. For example, it is known that the
uncharged polar amino acid serine may commonly be substituted with
the uncharged polar amino acid threonine in a polypeptide without
substantially altering the functionality of the polypeptide.
Whether a given substitution will affect the functionality of the
enzyme may be determined without undue experimentation using
synthetic techniques and screening assays known to one with
ordinary skill in the art.
[0032] One of ordinary skill in the art will recognize that changes
in the amino acid sequences, such as individual substitutions,
deletions or additions to a nucleic acid, peptide, polypeptide, or
protein sequence which alters, adds or deletes a single amino acid
or a small percentage of amino acids in the encoded sequence is
"sufficiently similar" when the alteration results in the
substitution of an amino acid with a chemically similar amino acid.
Thus, any number of amino acid residues selected from the group of
integers consisting of from 1 to 15 can be so altered. Thus, for
example, 1, 2, 3, 4, 5, 7 or 10 alterations can be made.
Conservatively modified variants typically provide similar
biological activity as the unmodified polypeptide sequence from
which they are derived. For example, CDO, SAD, GAD, ADO, TPAT, SA,
ssTDeHase, lsTDeHase or TDO activity is generally at least 40%,
50%, 60%, 70%, 80% or 90%, preferably 60-90% of the native protein
for the native substrate. Tables of conserved substitution provide
lists of functionally similar amino acids.
[0033] The following three groups each contain amino acids that are
conserved substitutions for one another: (1) Alanine (A), Serine
(S), Threonine (T); (2) Aspartic acid (D), Glutamic acid (E); and
(3) Asparagine (N), Glutamine (Q);
[0034] Suitable polynucleotides for CDO, SAD, GAD, ADO, TPAT, SA,
TDO, ssTDeHase, and lsTDeHase
[0035] As examples, suitable polynucleotides encoding enzymes of
taurine biosynthetic pathways are described below. The invention is
not limited to use of these sequences, however. In fact, any
nucleotide sequence which encodes an enzyme of a taurine
biosynthetic pathway can be used in an expression vector to produce
that enzyme recombinantly.
[0036] Suitable polynucleotides for CDO are provided in SEQ ID NO:1
and SEQ ID NO:2 Other suitable polynucleotides for use in
accordance with the invention may be obtained by the identification
of polynucleotides that selectively hybridize to the
polynucleotides of SEQ ID NO:1 or SEQ ID NO:2 by hybridization
under low stringency conditions, moderate stringency conditions, or
high stringency conditions. Still other suitable polynucleotides
for use in accordance with the invention may be obtained by the
identification of polynucleotides that have substantial identity of
the nucleic acid of SEQ ID NO:1 or SEQ ID NO:2 when it used as a
reference for sequence comparison or polynucleotides that encode
polypeptides that have substantial identity to amino acid sequence
of SEQ ID NO:3 or SEQ ID NO:4 when it used as a reference for
sequence comparison.
[0037] Suitable polynucleotides for SAD are provided in SEQ ID NO:5
and SEQ ID NO:6. Other suitable polynucleotides for use in
accordance with the invention may be obtained by the identification
of polynucleotides that selectively hybridize to the
polynucleotides of SEQ ID NO:5 or SEQ ID NO:6 by hybridization
under low stringency conditions, moderate stringency conditions, or
high stringency conditions. Still other suitable polynucleotides
for use in accordance with the invention may be obtained by the
identification of polynucleotides that have substantial identity of
the nucleic acid of SEQ ID NO:5 or SEQ ID NO:6 when it used as a
reference for sequence comparison or polynucleotides that encode
polypeptides that have substantial identity to amino acid sequence
of SEQ ID NO:7 or SEQ ID NO:8 when it is used as a reference for
sequence comparison.
[0038] Suitable polynucleotides for GAD are provided in SEQ ID NO:9
and SEQ ID NO: 10. Other suitable polynucleotides for use in
accordance with the invention may be obtained by the identification
of polynucleotides that selectively hybridize to the
polynucleotides of SEQ ID NO:9 or SEQ ID NO: 10 by hybridization
under low stringency conditions, moderate stringency conditions, or
high stringency conditions. Still other suitable polynucleotides
for use in accordance with the invention may be obtained by the
identification of polynucleotides that have substantial identity of
the nucleic acid of SEQ ID NO:9 or SEQ ID NO: 10 when it used as a
reference for sequence comparison or polynucleotides that encode
polypeptides that have substantial identity to amino acid sequence
of SEQ ID NO: 11 or SEQ ID NO: 12 when it used as a reference for
sequence comparison.
[0039] Suitable polynucleotides for ADO are provided in SEQ ID NO:
13 and SEQ ID NO: 14. Other suitable polynucleotides for use in
accordance with the invention may be obtained by the identification
of polynucleotides that selectively hybridize to the
polynucleotides of SEQ ID NO: 13 or SEQ ID NO: 14 by hybridization
under low stringency conditions, moderate stringency conditions, or
high stringency conditions. Still other suitable polynucleotides
for use in accordance with the invention may be obtained by the
identification of polynucleotides that have substantial identity of
the nucleic acid of SEQ ID NO:13 or SEQ ID NO:14 when it used as a
reference for sequence comparison or polynucleotides that encode
polypeptides that have substantial identity to amino acid sequence
of SEQ ID NO:15 or SEQ ID NO:16 when it used as a reference for
sequence comparison.
[0040] A suitable polynucleotide for TPAT is provided in SEQ ID
NO:17. Other suitable polynucleotides for use in accordance with
the invention may be obtained by the identification of
polynucleotides that selectively hybridize to the polynucleotides
of SEQ ID NO:17 by hybridization under low stringency conditions,
moderate stringency conditions, or high stringency conditions.
Still other suitable polynucleotides for use in accordance with the
invention may be obtained by the identification of polynucleotides
that have substantial identity of the nucleic acid of SEQ ID NO: 17
when it used as a reference for sequence comparison or
polynucleotides that encode polypeptides that have substantial
identity to amino acid sequence of SEQ ID NO:18 when it used as a
reference for sequence comparison.
[0041] A suitable polynucleotide for SA is provided in SEQ ID
NO:19. Other suitable polynucleotides for use in accordance with
the invention may be obtained by the identification of
polynucleotides that selectively hybridize to the polynucleotides
of SEQ ID NO:19 by hybridization under low stringency conditions,
moderate stringency conditions, or high stringency conditions.
Still other suitable polynucleotides for use in accordance with the
invention may be obtained by the identification of polynucleotides
that have substantial identity of the nucleic acid of SEQ ID NO:19
when it used as a reference for sequence comparison or
polynucleotides that encode polypeptides that have substantial
identity to amino acid sequence of SEQ ID NO:20 when it used as a
reference for sequence comparison.
[0042] A suitable polynucleotide for ssTDeHase is provided in SEQ
ID NO:21. Other suitable polynucleotides for use in accordance with
the invention may be obtained by the identification of
polynucleotides that selectively hybridize to the polynucleotides
of SEQ ID NO:21 by hybridization under low stringency conditions,
moderate stringency conditions, or high stringency conditions.
Still other suitable polynucleotides for use in accordance with the
invention may be obtained by the identification of polynucleotides
that have substantial identity of the nucleic acid of SEQ ID NO:21
when it used as a reference for sequence comparison or
polynucleotides that encode polypeptides that have substantial
identity to amino acid sequence of SEQ ID NO:22 when it used as a
reference for sequence comparison.
[0043] A suitable polynucleotide for lsTDeHase is provided in SEQ
ID NO:23. Other suitable polynucleotides for use in accordance with
the invention may be obtained by the identification of
polynucleotides that selectively hybridize to the polynucleotides
of SEQ ID NO:23 by hybridization under low stringency conditions,
moderate stringency conditions, or high stringency conditions.
Still other suitable polynucleotides for use in accordance with the
invention may be obtained by the identification of polynucleotides
that have substantial identity of the nucleic acid of SEQ ID NO:23
when it used as a reference for sequence comparison or
polynucleotides that encode polypeptides that have substantial
identity to amino acid sequence of SEQ ID NO:24 when it used as a
reference for sequence comparison.
[0044] A suitable polynucleotide for TDO is provided in SEQ ID
NO:25. Other suitable polynucleotides for use in accordance with
the invention may be obtained by the identification of
polynucleotides that selectively hybridize to the polynucleotides
of SEQ ID NO:25 by hybridization under low stringency conditions,
moderate stringency conditions, or high stringency conditions.
Still other suitable polynucleotides for use in accordance with the
invention may be obtained by the identification of polynucleotides
that have substantial identity of the nucleic acid of SEQ ID NO:25
when it used as a reference for sequence comparison or
polynucleotides that encode polypeptides that have substantial
identity to amino acid sequence of SEQ ID NO:26 when it used as a
reference for sequence comparison.
[0045] Another embodiment of the invention is a polynucleotide
(e.g., a DNA construct) that encodes a protein that functions as a
CDO, SAD, GAD, ADO, TPAT, SA, ssTDeHase, lsTDeHase or TDO and
selectively hybridizes to either SEQ ID NO: 1, SEQ ID NO:2, SEQ ID
NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:13, SEQ ID
NO:14, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or
SEQ ID NO:25 respectively. Selectively hybridizing sequences
typically have at least 40% sequence identity, preferably 60-90%
sequence identity, and most preferably 100% sequence identity with
each other.
[0046] Another embodiment of the invention is a polynucleotide that
encodes a polypeptide that has substantial identity to the amino
acid sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID
NO:8, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID
NO:26. Substantial identity of amino acid sequences for these
purposes normally means sequence identity of between 50-100%,
preferably at least 55%, preferably at least 60%, more preferably
at least 70%, 80%, 90%, and most preferably at least 95%.
[0047] The process of encoding a specific amino acid sequence may
involve DNA sequences having one or more base changes (i.e.,
insertions, deletions, substitutions) that do not cause a change in
the encoded amino acid, or which involve base changes which may
alter one or more amino acids, but do not eliminate the functional
properties of the polypeptide encoded by the DNA sequence.
[0048] It is therefore understood that the invention encompasses
more than the specific polynucleotides encoding the proteins
described herein. For example, modifications to a sequence, such as
deletions, insertions, or substitutions in the sequence, which
produce "silent" changes that do not substantially affect the
functional properties of the resulting polypeptide are expressly
contemplated by the present invention. Furthermore, because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations" and represent one species
of conservatively modified variation. Every nucleic acid sequence
herein that encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of ordinary skill in the
art will recognize that each amino acid has more than one codon,
except for methionine and tryptophan that ordinarily have the
codons AUG and UGG, respectively. It is known by those of ordinary
skill in the art, "universal" code is not completely universal.
Some mitochondrial and bacterial genomes diverge from the universal
code, e.g., some termination codons in the universal code specify
amino acids in the mitochondria or bacterial codes. Thus each
silent variation of a nucleic acid, which encodes a polypeptide of
the present invention, is implicit in each described polypeptide
sequence and incorporated in the descriptions of the invention.
[0049] It is understood that alterations in a nucleotide sequence,
which reflect the degeneracy of the genetic code, or which result
in the production of a chemically equivalent amino acid at a given
site, are contemplated. Thus, a codon for the amino acid alanine, a
hydrophobic amino acid, may be substituted by a codon encoding
another less hydrophobic residue, such as glycine, or a more
hydrophobic residue, such as valine, leucine, or isoleucine.
Similarly, changes which result in substitution of one negatively
charged residue for another, such as aspartic acid for glutamic
acid, or one positively charged residue for another, such as lysine
for arginine, can also be expected to produce a biologically
equivalent product.
[0050] Nucleotide changes which result in alteration of the
amino-terminal and carboxy-terminal portions of the encoded
polypeptide molecule would also not generally be expected to alter
the activity of the polypeptide. In some cases, it may in fact be
desirable to make mutations in the sequence in order to study the
effect of alteration on the biological activity of the polypeptide.
Each of the proposed modifications is well within the routine skill
in the art.
[0051] When the nucleic acid is prepared or altered synthetically,
one of ordinary skill in the art can take into account the known
codon preferences for the intended host where the nucleic acid is
to be expressed. For example, although nucleic acid sequences of
the present invention may be expressed in both monocotyledonous and
dicotyledonous plant species, sequences can be modified to account
for the specific codon preferences and GC-content preferences of
monocotyledonous plants or dicotyledonous plants, as these
preferences have been shown to differ (36). An alternative approach
to the generation of variants of the sequences is to use random
recombination techniques such as "DNA shuffling" (37). An
alternative method to modify the sequences is by rapid molecular
evolution methods such as a staggered extension process (38).
[0052] Cloning Techniques
[0053] For purposes of promoting an understanding of the principles
of the invention, reference will now be made to particular
embodiments of the invention and specific language will be used to
describe the same. The materials, methods and examples are
illustrative only and not limiting. Unless mentioned otherwise, the
techniques employed or contemplated herein are standard
methodologies well known to one of ordinary skill in the art.
Specific terms, while employed below and defined at the end of this
section, are used in a descriptive sense only and not for purposes
of limitation. The practice of the present invention will employ,
unless otherwise indicated, conventional techniques of botany,
microbiology, tissue culture, molecular biology, chemistry,
biochemistry and recombinant DNA technology, which are within the
skill of the art (39-46).
[0054] A suitable polynucleotide for use in accordance with the
invention may be obtained by cloning techniques using cDNA or
genomic libraries, DNA, or cDNA from bacteria which are available
commercially or which may be constructed using standard methods
known to persons of ordinary skill in the art. Suitable nucleotide
sequences may be isolated from DNA libraries obtained from a wide
variety of species by means of nucleic acid hybridization or
amplification methods, such as polymerase chain reaction (PCR)
procedures, using as probes or primers nucleotide sequences
selected in accordance with the invention.
[0055] Furthermore, nucleic acid sequences may be constructed or
amplified using chemical synthesis. The product of amplification is
termed an amplicon. Moreover, if the particular nucleic acid
sequence is of a length that makes chemical synthesis of the entire
length impractical, the sequence may be broken up into smaller
segments that may be synthesized and ligated together to form the
entire desired sequence by methods known in the art. Alternatively,
individual components or DNA fragments may be amplified by PCR and
adjacent fragments can be amplified together using fusion-PCR (47),
overlap-PCR (48) or chemical (de novo) synthesis (49-53) by methods
known in the art.
[0056] A suitable polynucleotide for use in accordance with the
invention may be constructed by recombinant DNA technology, for
example, by cutting or splicing nucleic acids using restriction
enzymes and mixing with a cleaved (cut with a restriction enzyme)
vector with the cleaved insert (DNA of the invention) and ligated
using DNA ligase. Alternatively amplification techniques, such as
PCR, can be used, where restriction sites are incorporated in the
primers that otherwise match the nucleotide sequences (especially
at the 3' ends) selected in accordance with the invention. The
desired amplified recombinant molecule is cut or spliced using
restriction enzymes and mixed with a cleaved vector and ligated
using DNA ligase. In another method, after amplification of the
desired recombinant molecule, DNA linker sequences are ligated to
the 5' and 3' ends of the desired nucleotide insert with ligase,
the DNA insert is cleaved with a restriction enzyme that
specifically recognizes sequences present in the linker sequences
and the desired vector. The cleaved vector is mixed with the
cleaved insert, and the two fragments are ligated using DNA ligase.
In yet another method, the desired recombinant molecule is
amplified with primers that have recombination sites (e.g. Gateway)
incorporated in the primers, that otherwise match the nucleotide
sequences selected in accordance with the invention. The desired
amplified recombinant molecule is mixed with a vector containing
the recombination site and recombinase, the two molecules are
ligated together by recombination.
[0057] The recombinant expression cassette or DNA construct
includes a promoter that directs transcription in a plant cell,
operably linked to the polynucleotide encoding a CDO, SAD, GAD,
ADO, TPAT, SA, ssTDeHase or lsTDeHase. In various aspects of the
invention described herein, a variety of different types of
promoters are described and used. As used herein, a polynucleotide
is "operably linked" to a promoter or other nucleotide sequence
when it is placed into a functional relationship with the promoter
or other nucleotide sequence. The functional relationship between a
promoter and a desired polynucleotide insert typically involves the
polynucleotide and the promoter sequences being contiguous such
that transcription of the polynucleotide sequence will be
facilitated. Two nucleic acid sequences are further said to be
operably linked if the nature of the linkage between the two
sequences does not (1) result in the introduction of a frame-shift
mutation; (2) interfere with the ability of the promoter region
sequence to direct the transcription of the desired nucleotide
sequence, or (3) interfere with the ability of the desired
nucleotide sequence to be transcribed by the promoter sequence
region. Typically, the promoter element is generally upstream
(i.e., at the 5' end) of the nucleic acid insert coding
sequence.
[0058] While a promoter sequence can be ligated to a coding
sequence prior to insertion into a vector, in other embodiments, a
vector is selected that includes a promoter operable in the host
cell into which the vector is to be inserted. In addition, certain
preferred vectors have a region that codes a ribosome binding site
positioned between the promoter and the site at which the DNA
sequence is inserted so as to be operatively associated with the
DNA sequence of the invention to produce the desired polypeptide,
i.e., the DNA sequence of the invention in-frame.
[0059] Suitable Promoters
[0060] A wide variety of promoters are known to those of ordinary
skill in the art as are other regulatory elements that can be used
alone or in combination with promoters. A wide variety of promoters
that direct transcription in plants cells can be used in connection
with the present invention. For purposes of describing the present
invention, promoters are divided into two types, namely,
constitutive promoters and non-constitutive promoters. Constitutive
promoters are classified as providing for a range of constitutive
expression. Thus, some are weak constitutive promoters, and others
are strong constitutive promoters. Non-constitutive promoters
include tissue-preferred promoters, tissue-specific promoters,
cell-type specific promoters, and inducible-promoters.
[0061] Of particular interest in certain embodiments of the present
invention are inducible-promoters that respond to various forms of
environmental stresses, or other stimuli, including, for example,
mechanical shock, heat, cold, salt, flooding, drought, salt,
anoxia, pathogens, such as bacteria, fungi, and viruses, and
nutritional deprivation, including deprivation during times of
flowering and/or fruiting, and other forms of plant stress. For
example, the promoter selected in alternate forms of the invention,
can be a promoter is induced by one or more, but not limiting to
one of the following, abiotic stresses such as wounding, cold,
desiccation, ultraviolet-B (54), heat shock (55) or other heat
stress, drought stress or water stress. The promoter may further be
one induced by biotic stresses including pathogen stress, such as
stress induced by a virus (56) or fungi (57, 58), stresses induced
as part of the plant defense pathway (59) or by other environmental
signals, such as light (60), carbon dioxide (61, 62), hormones or
other signaling molecules such as auxin, hydrogen peroxide and
salicylic acid (63, 64), sugars and gibberellin (65) or abscissic
acid and ethylene (66).
[0062] In other embodiments of the invention, tissue-specific
promoters are used. Tissue-specific expression patterns as
controlled by tissue- or stage-specific promoters that include, but
is not limited to, fiber-specific, green tissue-specific,
root-specific, stem-specific, and flower-specific. Examples of the
utilization of tissue-specific expression includes, but is not
limited to, the expression in leaves of the desired peptide for the
protection of plants against foliar pathogens, the expression in
roots of the desired peptide for the protection of plants against
root pathogens, and the expression in roots or seedlings of the
desired peptide for the protection of seedlings against soil-borne
pathogens. In many cases, however, protection against more than one
type of pathogen may be sought, and expression in multiple tissues
will be desirable.
[0063] Although many promoters from dicotyledons have been shown to
be operational in monocotyledons and vice versa, ideally
dicotyledonous promoters are selected for expression in
dicotyledons, and monocotyledonous promoters are selected for
expression in monocotyledons. There are also promoters that control
expression of genes in green tissue or for genes involved in
photosynthesis from both monocotyledons and dicotyledons such as
the maize from the phosphenol carboxylase gene (67). There are
suitable promoters for root specific expression (68, 69). A
promoter selected can be an endogenous promoter, i.e. a promoter
native to the species and or cell type being transformed.
Alternatively, the promoter can be a foreign promoter, which
promotes transcription of a length of DNA of viral, microbes,
bacterial or eukaryotic origin, invertebrates, vertebrates
including those from plants and plant viruses. For example, in
certain preferred embodiments, the promoter may be of viral origin,
including a cauliflower mosaic virus promoter (CaMV), such as CaMV
35S or 19S, a figwort mosaic virus promoter (FMV 35S), or the coat
protein promoter of tobacco mosaic virus (TMV). The promoter may
further be, for example, a promoter for the small subunit of
ribulose-1, 3-biphosphate carboxylase. Promoters of bacterial
origin (microbe promoters) include the octopine synthase promoter,
the nopaline synthase promoter and other promoters derived from
native Ti plasmids (70).
[0064] The promoters may further be selected such that they require
activation by other elements known to those of ordinary skill in
the art, so that production of the protein encoded by the nucleic
acid sequence insert may be regulated as desired. In one embodiment
of the invention, a DNA construct comprising a non-constitutive
promoter operably linked to a polynucleotide encoding the desired
polypeptide of the invention is used to make a transformed plant
that selectively increases the level of the desired polypeptide of
the invention in response to a signal. The term "signal" is used to
refer to a condition, stress or stimulus that results in or causes
a non-constitutive promoter to direct expression of a coding
sequence operably linked to it. To make such a plant in accordance
with the invention, a DNA construct is provided that includes a
non-constitutive promoter operably linked to a polynucleotide
encoding the desired polypeptide of the invention. The construct is
incorporated into a plant genome to provide a transformed plant
that expresses the polynucleotide in response to a signal.
[0065] In alternate embodiments of the invention, the selected
promoter is a tissue-preferred promoter, a tissue-specific
promoter, a cell-type-specific promoter, an inducible promoter or
other type of non-constitutive promoter. It is readily apparent
that such a DNA construct causes a plant transformed thereby to
selectively express the gene for the desired polypeptide of the
invention. Therefore under specific conditions or in certain
tissue- or cell-types the desired polypeptide will be expressed.
The result of this expression in the plant depends upon the
activity of the promoter and in some cases the conditions of the
cell or cells in which it is expressed.
[0066] It is understood that the non-constitutive promoter does not
continuously produce the transcript or RNA of the invention. But in
this embodiment the selected promoter for inclusion of the
invention advantageously induces or increases transcription of gene
for the desired polypeptide of the invention in response to a
signal, such as an environmental cue or other stress signal
including biotic and/or abiotic stresses or other conditions.
[0067] In another embodiment of the invention, a DNA construct
comprising a plant GAD promoter operably linked to polynucleotides
that encode the desired polypeptide of the invention is used to
make a transformed plant that selectively increases the transcript
or RNA of the desired polypeptide of the invention in the same
cells, tissues, and under the environmental conditions that express
a plant glutamate decarboxylase. It is understood to those of
ordinary skill in the art that the regulatory sequences that
comprise a plant promoter driven by RNA polymerase II reside in the
region approximately 2900 to 1200 basepairs up-stream (5') of the
translation initiation site or start codon (ATG). For example, the
full-length promoter for the nodule-enhanced PEP carboxylase from
alfalfa is 1277 basepairs prior to the start codon (71), the
full-length promoter for cytokinin oxidase from orchid is 2189
basepairs prior to the start codon (72), the full-length promoter
for ACC oxidase from peach is 2919 basepairs prior to the start
codon (73), full-length promoter for cytokinin oxidase from orchid
is 2189 basepairs prior to the start codon, full-length promoter
for glutathione peroxidase1 from Citrus sinensis is 1600 basepairs
prior to the start codon (74), and the full-length promoter for
glucuronosyltransferase from cotton is 1647 basepairs prior to the
start codon (75). Most full-length promoters are 1700 basepairs
prior to the start codon. The accepted convention is to describe
this region (promoter) as -1700 to -1, where the numbers designate
the number of basepairs prior to the "A" in the start codon. In
this embodiment of the invention that the region of -2000 to -1
basepairs 5' to a plant GAD is operably linked to a polynucleotide
for the said encoded peptide to make a transformed plant that
selectively expresses the polynucleotide or increases the level of
the said protein where the plant GAD is expressed or accumulates. A
plant GAD promoter is the -2000 to -1 basepair region genes that
include, but is not limited to, the five Arabidopsis thaliana GADs
(AtGAD) (76), petunia GAD (77), tomato GAD (78), tobacco GAD (79),
rice (80), barely, poplar, soybean, mustard, orange, Medicago
truncatula, grape and pine. Those of ordinary skill in the art can
either digest the desired region using restriction enzymes and
ligase to clone the plant GAD promoters or use amplification, such
as PCR, techniques with the incorporation of restriction or
recombination sites to clone the plant GAD promoters 5' to the
desired polynucleotide. A plant GAD promoter for these purposes
normally means the following regions upstream (5') to the start
codon between -200 to -1 basepairs, preferably at least between
-500 to -1 basepairs, preferably at least between -1000 to -1
basepairs, more preferably at least between -1500 to -1 basepairs,
and most preferably at -2000 to -1 basepairs.
[0068] In another embodiment of the invention, a DNA construct
comprising a plant glutamate receptor promoter operably linked to
polynucleotides that encode the desired polypeptide of the
invention is used to make a transformed plant that selectively
increases the transcript or RNA of the desired polypeptide of the
invention in the same cells, tissues, and under the environmental
conditions that express a plant glutamate receptor. It is
understood to those of ordinary skill in the art that the
regulatory sequences that comprise a plant promoter driven by RNA
polymerase II reside in the region approximately 2900 to 1200
basepairs up-stream (5') of the translation initiation site or
start codon (ATG). A plant glutamate receptor promoter is the -2000
to -1 basepair region genes that include, but is not limited to,
the 20 Arabidopsis thaliana glutamate receptors (AtGLRs or AtGluRs)
and 23 rice glutamate receptors. The promoters for the following
AtGLRs genes, 1.1, 2.1, 3.1 (81), 3.2 (note this is designated as
GLR2 in the manuscript; (82), and 3.4 (83) have been shown to
control specific cell-type, tissue-type, developmental and
environmental expression patterns in plants. Those of ordinary
skill in the art can either digest the desired region using
restriction enzymes and ligase to clone the plant glutamate
promoters or use amplification, such as PCR, techniques with the
incorporation of restriction or recombination sites to clone the
plant glutamate receptor promoters 5' to the desired
polynucleotide. A plant glutamate receptor promoter for these
purposes normally means the following regions upstream (5') to the
start codon between -200 to -1 basepairs, preferably at least
between -500 to -1 basepairs, preferably at least between -1000 to
-1 basepairs, more preferably at least between -1500 to -1
basepairs, and most preferably at -2000 to -1 basepairs.
[0069] In another embodiment of the invention, a DNA construct
comprising a plant sulphate transporter promoter operably linked to
polynucleotides that encode the desired polypeptide of the
invention is used to make a transformed plant that selectively
increases the transcript or RNA of the desired polypeptide of the
invention in the same cells, tissues, and under the environmental
conditions that express a plant sulphate transporter. It is
understood to those of ordinary skill in the art that the
regulatory sequences that comprise a plant promoter driven by RNA
polymerase II reside in the region approximately 2900 to 1200
basepairs up-stream (5') of the translation initiation site or
start codon (ATG). A plant sulphate transporter promoter is the
-2000 to -1 basepair region genes that include, but is not limited
to, the Arabidopsis thaliana sulphate transporters (SULTR or
AtSULTR). The promoters for the following SULTR genes, SULTR1;1,
SULTR1;2 (84), SULTR 1;3; (85), SULTR2;1 (86), and SULTR3;5 (87)
have been shown to control specific cell-type, tissue-type,
developmental and environmental expression patterns in plants.
Those of ordinary skill in the art can either digest the desired
region using restriction enzymes and ligase to clone the plant
glutamate promoters or use amplification, such as PCR, techniques
with the incorporation of restriction or recombination sites to
clone the plant sulphate transporter promoters 5' to the desired
polynucleotide. A plant sulphate transporter promoter for these
purposes normally means the following regions upstream (5') to the
start codon between -200 to -1 basepairs, preferably at least
between -500 to -1 basepairs, preferably at least between -1000 to
-1 basepairs, more preferably at least between -1500 to -1
basepairs, and most preferably at -2000 to -1 basepairs.
[0070] Suitable Vectors
[0071] A wide variety of vectors may be employed to transform a
plant, plant cell or other cells with a construct made or selected
in accordance with the invention, including high- or low-copy
number plasmids, phage vectors and cosmids. Such vectors, as well
as other vectors, are well known in the art. Representative T-DNA
vector systems (70, 88) and numerous expression cassettes and
vectors and in vitro culture methods for plant cell or tissue
transformation and regeneration of plants are known and available
(89). The vectors can be chosen such that operably linked promoter
and polynucleotides that encode the desired polypeptide of the
invention are incorporated into the genome of the plant. Although
the preferred embodiment of the invention is expression in plants
or plant cells, other embodiments may include expression in
prokaryotic or eukaryotic photosynthetic organisms, microbes,
invertebrates or vertebrates.
[0072] It is known by those of ordinary skill in the art that there
exist numerous expression systems available for expression of a
nucleic acid encoding a protein of the present invention. There are
many commercially available recombinant vectors to transform a host
plant or plant cell. Standard molecular and cloning techniques (43,
46, 90) are available to make a recombinant expression cassette
that expresses the polynucleotide that encodes the desired
polypeptide of the invention. No attempt to describe in detail the
various methods known for the expression of proteins in prokaryotes
or eukaryotes will be made. In brief, the expression of isolated
nucleic acids encoding a protein of the present invention will
typically be achieved by operably linking, for example, the DNA or
cDNA to a promoter, followed by incorporation into an expression
vector. The vectors can be suitable for replication and integration
in either prokaryotes or eukaryotes. Typical expression vectors
contain transcription and translation terminators, initiation
sequences, and promoters useful for regulation of the expression of
the DNA encoding a protein of the present invention. To obtain
high-level expression of a cloned gene, it is desirable to
construct expression vectors that contain, at the minimum, a strong
promoter, such as ubiquitin, to direct transcription, a
ribosome-binding site for translational initiation, and a
transcription/translation terminator.
[0073] One of ordinary skill to the art recognizes that
modifications could be made to a protein of the present invention
without diminishing its biological activity. Some modifications may
be made to facilitate the cloning, expression, targeting or to
direct the location of the polypeptide in the host, or for the
purification or detection of the polypeptide by the addition of a
"tag" as a fusion protein. Such modifications are well known to
those of skill in the art and include, for example, a methionine
added at the amino terminus to provide an initiation site,
additional amino acids (tags) placed on either terminus to create a
tag, additional nucleic acids to insert a restriction site or a
termination.
[0074] In addition to the selection of a suitable promoter, the DNA
constructs requires an appropriate transcriptional terminator to be
attached downstream of the desired gene of the invention for proper
expression in plants. Several such terminators are available and
known to persons of ordinary skill in the art. These include, but
are not limited to, the tml from CaMV and E9 from rbcS. Another
example of a terminator sequence is the polyadenlyation sequence
from the bovine growth hormone gene. A wide variety of available
terminators known to function in plants can be used in the context
of this invention. Vectors may also have other control sequence
features that increase their suitability. These include an origin
of replication, enhancer sequences, ribosome binding sites, RNA
splice sites, polyadenylation sites, selectable markers and RNA
stability signal. Origin of replication is a gene sequence that
controls replication of the vector in the host cell. Enhancer
sequences cooperate with the promoter to increase expression of the
polynucleotide insert coding sequence. Enhancers can stimulate
promoter activity in host cell. An example of specific
polyadenylation sequence in higher eukaryotes is ATTTA. Examples of
plant polyadenylation signal sequences are AATAAA or AATAAT. RNA
splice sites are sequences that ensure accurate splicing of the
transcript. Selectable markers usually confer resistance to an
antibiotic, herbicide or chemical or provide color change, which
aid the identification of transformed organisms. The vectors also
include a RNA stability signal, which are 3'-regulatory sequence
elements that increase the stability of the transcribed RNA (91,
92).
[0075] In addition, polynucleotides that encode a CDO, SAD, GAD,
ADO, TPAT, SA, ssTDeHase, lsTDeHase or TDO can be placed in the
appropriate plant expression vector used to transform plant cells.
The polypeptide can then be isolated from plant callus or the
transformed cells can be used to regenerate transgenic plants. Such
transgenic plants can be harvested, and the appropriate tissues can
be subjected to large-scale protein extraction and purification
techniques.
[0076] The vectors may include another polynucleotide insert that
encodes a peptide or polypeptide used as a "tag" to aid in
purification or detection of the desired protein. The additional
polynucleotide is positioned in the vector such that upon cloning
and expression of the desired polynucleotide a fusion, or chimeric,
protein is obtained. The tag may be incorporated at the amino or
carboxy terminus. If the vector does not contain a tag, persons
with ordinary skill in the art know that the extra nucleotides
necessary to encode a tag can be added with the ligation of
linkers, adaptors, or spacers or by PCR using designed primers.
After expression of the peptide the tag can be used for
purification using affinity chromatography, and if desired, the tag
can be cleaved with an appropriate enzyme. The tag can also be
maintained, not cleaved, and used to detect the accumulation of the
desired polypeptide in the protein extracts from the host using
western blot analysis. In another embodiment, a vector includes the
polynucleotide for the tag that is fused in-frame to the
polynucleotide that encodes a functional CDO, SAD, GAD, ADO, TPAT,
SA, ssTDeHase, lsTDeHase or TDO to form a fusion protein. The tags
that may be used include, but are not limited to, Arg-tag,
calmodulin-binding peptide, cellulose-binding domain, DsbA,
c-myc-tag, glutathione S-transferase, FLAG-tag, HAT-tag, His-tag,
maltose-binding protein, NusA, S-tag, SBP-tag, Strep-tag, and
thioredoxin (Trx-Tag). These are available from a variety of
manufacturers Clontech Laboratories, Takara Bio Company GE
Healthcare, Invitrogen, Novagen Promega and QIAGEN.
[0077] The vector may include another polynucleotide that encodes a
signal polypeptide or signal sequence ("subcellular location
sequence") to direct the desired polypeptide in the host cell, so
that the polypeptide accumulates in a specific cellular
compartment, subcellular compartment, or membrane. The specific
cellular compartments include the apoplast, vacuole, plastids
chloroplast, mitochondrion, peroxisomes, secretory pathway,
lysosome, endoplasmic reticulum, nucleus or Golgi apparatus. A
signal polypeptide or signal sequence is usually at the amino
terminus and normally absent from the mature protein due to
protease that removes the signal peptide when the polypeptide
reaches its final destination. Signal sequences can be a primary
sequence located at the N-terminus (93-96), C-terminus (97, 98) or
internal (99-101) or tertiary structure (101). If a signal
polypeptide or signal sequence to direct the polypeptide does not
exist on the vector, it is expected that those of ordinary skill in
the art can incorporate the extra nucleotides necessary to encode a
signal polypeptide or signal sequence by the ligation of the
appropriate nucleotides or by PCR. Those of ordinary skill in the
art can identify the nucleotide sequence of a signal polypeptide or
signal sequence using computational tools. There are numerous
computational tools available for the identification of targeting
sequences or signal sequence. These include, but are not limited
to, TargetP (102, 103), iPSORT (104), SignalP (105), PrediSi (106),
ELSpred (107) HSLpred (108) and PSLpred (109), MultiLoc (110),
SherLoc (111), ChloroP (112), MITOPROT (113), Predotar (114) and
3D-PSSM (115). Additional methods and protocols are discussed in
the literature (110).
[0078] Fusion of Two Gene Products
[0079] Two gene products can be fused together to increase the
efficiency of an enzymatic reaction conducted by two enzymes
(116-118). The two genes can be fused in-frame to be expressed as a
single gene product with or without a linker. The linker can be a
sequence that encodes a "tag" or a peptide.
[0080] Transformation of Host Cells
[0081] Transformation of a plant can be accomplished in a wide
variety of ways within the scope of a person of ordinary skill in
the art. In one embodiment, a DNA construct is incorporated into a
plant by (i) transforming a cell, tissue or organ from a host plant
with the DNA construct; (ii) selecting a transformed cell, cell
callus, somatic embryo, or seed which contains the DNA construct;
(iii) regenerating a whole plant from the selected transformed
cell, cell callus, somatic embryo, or seed; and (iv) selecting a
regenerated whole plant that expresses the polynucleotide. Many
methods of transforming a plant, plant tissue or plant cell for the
construction of a transformed cell are suitable. Once transformed,
these cells can be used to regenerate transgenic plants (119).
[0082] Those of ordinary skill in the art can use different plant
gene transfer techniques found in references for, but not limited
to, the electroporation (120-124), microinjection (125, 126),
lipofection (127), liposome or spheroplast fusions (128-130),
Agrobacterium (131), direct gene transfer (132), T-DNA mediated
transformation of monocots (133), T-DNA mediated transformation of
dicots); (134, 135), microprojectile bombardment or ballistic
particle acceleration (136-139), chemical transfection including
CaCl.sub.2 precipitation, polyvinyl alcohol, or poly-L-ornithine
(140), silicon carbide whisker methods (141, 142), laser methods
(143, 144), sonication methods (145-147), polyethylene glycol
methods (148), and vacuum infiltration (149) and transbacter
(150).
[0083] In one embodiment of the invention, a transformed host cell
may be cultured to produce a transformed plant. In this regard, a
transformed plant can be made, for example, by transforming a cell,
tissue or organ from a host plant with an inventive DNA construct;
selecting a transformed cell, cell callus, somatic embryo, or seed
which contains the DNA construct; regenerating a whole plant from
the selected transformed cell, cell callus, somatic embryo, or
seed; and selecting a regenerated whole plant that expresses the
polynucleotide.
[0084] A wide variety of host cells may be used in the invention,
including prokaryotic and eukaryotic host cells. These cells or
organisms may include microbes, invertebrate, vertebrates or
photosynthetic organisms. Preferred host cells are eukaryotic,
preferably plant cells, such as those derived from monocotyledons,
such as duckweed, corn, rice, sugarcane, wheat, bent grass, rye
grass, Bermuda grass, Blue grass, and Fescue, or dicotyledons,
including canola, cotton, camelina, lettuce, rapeseed, radishes,
cabbage, sugarbeet, peppers, broccoli, potatoes and tomatoes, and
legumes such as soybeans and bush beans.
[0085] One embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0086] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO gene product;
[0087] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0088] 3. transform the vector containing the CDO construct into a
plant or plant cell;
[0089] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional SAD gene product;
[0090] 5. insert the polynucleotide construct (from step 4 above)
into a vector; and
[0091] 6. transform the vector containing the SAD construct into a
plant or plant cell carrying a CDO construct or one that expresses
a functional CDO gene product.
[0092] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0093] 1. operably link a promoter to the 5' end of the
polynucleotide for the functional CDO gene product;
[0094] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0095] 3. transform the vector containing the CDO construct into a
plant or plant cell;
[0096] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional SAD gene product;
[0097] 5. insert the polynucleotide construct (from step 4 above)
into a vector;
[0098] 6. transform the vector containing the SAD construct into a
plant or plant cell; and
[0099] 7. Sexually cross a plant (or fuse cells) carrying a CDO
construct or one that expresses a functional CDO with a plant (or
cells) carrying a SAD construct or one that expresses a functional
SAD gene product.
[0100] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0101] 1. In the same vector, operably link a promoter to the 5'
end of the polynucleotide for the functional CDO gene product;
[0102] 2. operably link a promoter to the 5' end of the
polynucleotide for the functional SAD gene product;
[0103] 3. insert the two polynucleotides into the vector in such a
manner that both polynucleotides are expressed by one promoter or
each polynucleotide is expressed by one promoter; and
[0104] 4. transform the vector containing the CDO and SAD
constructs into a plant or plant cell.
[0105] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0106] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO gene product;
[0107] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0108] 3. transform the vector containing the CDO construct into a
plant or plant cell;
[0109] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional GAD gene product;
[0110] 5. insert the polynucleotide construct (from step 4 above)
into a vector; and
[0111] 6. transform the vector containing the GAD construct into a
plant or plant cell carrying a CDO construct or one that expresses
a functional CDO gene product.
[0112] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0113] 1. operably link a promoter to the 5' end of the
polynucleotide for the functional CDO gene product;
[0114] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0115] 3. transform the vector containing the CDO construct into a
plant or plant cell;
[0116] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional GAD gene product;
[0117] 5. insert the polynucleotide construct (from step 4 above)
into a vector;
[0118] 6. transform the vector containing the GAD construct into a
plant or plant cell; and
[0119] 7. Sexually cross a plant (or fuse cells) carrying a CDO
construct or one that expresses a functional CDO with a plant (or
cells) carrying a GAD construct or one that expresses a functional
GAD gene product.
[0120] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0121] 1. In the same vector, operably link a promoter to the 5'
end of the polynucleotide for the functional CDO gene product;
[0122] 2. operably link a promoter to the 5' end of the
polynucleotide for the functional GAD gene product;
[0123] 3. insert the two polynucleotides into the vector in such a
manner that both polynucleotides are expressed by one promoter or
each polynucleotide is expressed by one promoter; and
[0124] 4. transform the vector containing the CDO and GAD
constructs into a plant or plant cell.
[0125] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0126] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO gene product;
[0127] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the CDO construct
into a plant or plant cell.
[0128] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0129] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional SAD gene product;
[0130] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the SAD construct
into a plant or plant cell.
[0131] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0132] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional ADO gene product;
[0133] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the ADO construct
into a plant or plant cell.
[0134] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0135] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional TPAT gene product;
[0136] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the TPAT construct
into a plant or plant cell.
[0137] One embodiment of the invention is a method for the
production of taurine by the following steps:
[0138] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional TPAT gene product;
[0139] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0140] 3. transform the vector containing the TPAT construct into a
plant or plant cell;
[0141] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional SA gene product;
[0142] 5. insert the polynucleotide construct (from step 4 above)
into a vector; and
[0143] 6. transform the vector containing the TPAT construct into a
plant or plant cell carrying a SA construct or one that expresses a
functional SA gene product.
[0144] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0145] 1. operably link a promoter to the 5' end of the
polynucleotide for the functional TPAT gene product;
[0146] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0147] 3. transform the vector containing the TPAT construct into a
plant or plant cell;
[0148] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional SA gene product;
[0149] 5. insert the polynucleotide construct (from step 4 above)
into a vector;
[0150] 6. transform the vector containing the SA construct into a
plant or plant cell; and
[0151] 7. Sexually cross a plant (or fuse cells) carrying a TPAT
construct or one that expresses a functional TPAT with a plant (or
cells) carrying a SA construct or one that expresses a functional
SA gene product.
[0152] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0153] 1. In the same vector, operably link a promoter to the 5'
end of the polynucleotide for the functional TPAT gene product;
[0154] 2. operably link a promoter to the 5' end of the
polynucleotide for the functional SA gene product;
[0155] 3. insert the two polynucleotides into the vector in such a
manner that both polynucleotides are expressed by one promoter or
each polynucleotide is expressed by one promoter; and
[0156] 4. transform the vector containing the TPAT and SA construct
into a plant or plant cell.
[0157] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0158] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional small subunit of TDeHase
(ssTDeHase) gene product;
[0159] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0160] 3. transform the vector containing the ssTDeHase construct
into a plant or plant cell;
[0161] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional large subunit of TDeHase
(lsTDeHase) gene product;
[0162] 5. insert the polynucleotide construct (from step 4 above)
into a vector; and
[0163] 6. transform the vector containing the lsTDeHase construct
into a plant or plant cell carrying a ssTDeHase construct or one
that expresses a functional ssTDeHase gene product.
[0164] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0165] 1. operably link a promoter to the 5' end of the
polynucleotide for the functional ssTDeHase gene product;
[0166] 2. insert the polynucleotide construct (from step 1 above)
into a vector;
[0167] 3. transform the vector containing the ssTDeHase construct
into a plant or plant cell;
[0168] 4. operably link a promoter to the 5' end of the
polynucleotide for the functional lsTDeHase gene product;
[0169] 5. insert the polynucleotide construct (from step 4 above)
into a vector;
[0170] 6. transform the vector containing the lsTDeHase construct
into a plant or plant cell; and
[0171] 7. Sexually cross a plant (or fuse cells) carrying a
ssTDeHase construct or one that expresses a functional ssTDeHase
with a plant (or cells) carrying a lsTDeHase construct or one that
expresses a functional lsTDeHase gene product.
[0172] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0173] 1. In the same vector, operably link a promoter to the 5'
end of the polynucleotide for the functional ssTDeHase gene
product;
[0174] 2. operably link a promoter to the 5' end of the
polynucleotide for the functional lsTDeHase gene product;
[0175] 3. insert the two polynucleotides into the vector in such a
manner that both polynucleotides are expressed by one promoter or
each polynucleotide is expressed by one promoter; and
[0176] 4. transform the vector containing the ssTDeHase and
lsTDeHase construct into a plant or plant cell.
[0177] Another embodiment of the invention is a method for the
production of taurine by the following steps:
[0178] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional TDO gene product;
[0179] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the TDO construct
into a plant or plant cell.
[0180] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0181] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO fused in-frame to a functional
SAD gene product;
[0182] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the CDO-SAD
construct into a plant or plant cell.
[0183] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0184] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO fused with a linker in-frame to
a functional SAD gene product;
[0185] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the CDO-linker-SAD
construct into a plant or plant cell.
[0186] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0187] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional SAD fused in-frame to a functional
CDO gene product;
[0188] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the SAD-CDO
construct into a plant or plant cell.
[0189] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0190] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional SAD fused with a linker in-frame to
a functional CDO gene product;
[0191] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the SAD-linker-CDO
construct into a plant or plant cell.
[0192] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0193] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO fused in-frame to a functional
GAD gene product;
[0194] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the CDO-GAD
construct into a plant or plant cell.
[0195] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0196] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional CDO fused with a linker in-frame to
a functional GAD gene product;
[0197] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the CDO-linker-GAD
construct into a plant or plant cell.
[0198] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0199] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional GAD fused in-frame to a functional
CDO gene product;
[0200] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the GAD-CDO
construct into a plant or plant cell.
[0201] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0202] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional GAD fused with a linker in-frame to
a functional CDO gene product;
[0203] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the GAD-linker-CDO
construct into a plant or plant cell.
[0204] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0205] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional TPAT fused in-frame to a functional
SA gene product;
[0206] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the TPAT-SA
construct into a plant or plant cell.
[0207] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0208] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional TPAT fused with a linker in-frame
to a functional SA gene product;
[0209] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the TPAT-linker-SA
construct into a plant or plant cell.
[0210] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0211] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional SA fused in-frame to a functional
TPAT gene product;
[0212] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the SA-TPAT
construct into a plant or plant cell.
[0213] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0214] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional SA fused with a linker in-frame to
a functional TPAT gene product;
[0215] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the SA-linker-TPAT
construct into a plant or plant cell.
[0216] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0217] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional ssTDeHase fused in-frame to a
functional lsTDeHase gene product;
[0218] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the
ssTDeHase-lsTDeHase construct into a plant or plant cell.
[0219] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0220] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional ssTDeHase fused with a linker
in-frame to a functional lsTDeHase gene product;
[0221] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the
ssTDeHase-linker-lsTDeHase construct into a plant or plant
cell.
[0222] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0223] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional lsTDeHase fused in-frame to a
functional ssTDeHase gene product;
[0224] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the
lsTDeHase-ssTDeHase construct into a plant or plant cell.
[0225] Another embodiment of the invention is a method for the
production of hypotaurine or taurine by the following steps:
[0226] 1. operably link a promoter to the 5' end of the
polynucleotide for a functional lsTDeHase fused with a linker
in-frame to a functional ssTDeHase gene product;
[0227] 2. insert the polynucleotide construct (from step 1 above)
into a vector; transform the vector containing the
lsTDeHase-linker-ssTDeHase construct into a plant or plant
cell.
[0228] Suitable Plants
[0229] The methods described above may be applied to transform a
wide variety of plants, including decorative or recreational plants
or crops, but are particularly useful for treating commercial and
ornamental crops. Examples of plants that may be transformed in the
present invention include, but are not limited to, Acacia, alfalfa,
algae, aneth, apple, apricot, artichoke, arugula, asparagus,
avocado, banana, barley, beans, beech, beet, Bermuda grass, bent
grass, blackberry, blueberry, Blue grass, broccoli, Brussels
sprouts, cabbage, camelina, canola, cantaloupe, carrot, cassava,
cauliflower, celery, cherry, chicory, cilantro, citrus,
clementines, coffee, corn, cotton, cucumber, duckweed, Douglas fir,
eggplant, endive, escarole, eucalyptus, fennel, fescue, figs,
forest trees, garlic, gourd, grape, grapefruit, honey dew, jicama,
kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, maize,
mango, melon, mushroom, nectarine, nut, oat, okra, onion, orange,
an ornamental plant, papaya, parsley, pea, peach, peanut, pear,
pepper, persimmon, pine, pineapple, plantain, plum, pomegranate,
poplar, potato, pumpkin, quince, radiata pine, radicchio, radish,
rapeseed, raspberry, rice, rye, rye grass, seaweed, scallion,
sorghum, Southern pine, soybean, spinach, squash, strawberry,
sugarbeet, sugarcane, sunflower, sweet potato, sweetgum,
switchgrass, tangerine, tea, tobacco, tomato, turf, turnip, a vine,
watermelon, wheat, yams, and zucchini. Other suitable hosts include
bacteria, fungi, algae and other photosynthetic organisms, and
animals including vertebrate and invertebrates.
[0230] Once transformed, the plant may be treated with other
"active agents" either prior to or during the exposure of the plant
to stress to further decrease the effects of plant stress. "Active
agent," as used herein, refers to an agent that has a beneficial
effect on the plant or increases production of amino acid
production by the plant. For example, the agent may have a
beneficial effect on the plant with respect to nutrition, and the
resistance against, or reduction of, the effects of plant stress.
Some of these agents may be precursors of end products for reaction
catalyzed by CDO, SAD, GAD, ADO, TPAT, SA, ssTDeHase or lsTDeHase.
These compounds could promote growth, development, biomass and
yield, and change in metabolism. In addition to the twenty amino
acids that are involved in protein synthesis specifically sulfur
containing amino acids methionine, and cysteine, other amino acids
such as glutamate, glutamine, serine, alanine and glycine, sulfur
containing compounds such as fertilizer, sulfite, sulfide, sulfate,
taurine, hypotaurine, cysteate, 2-sulfacetaldehyde, homotaurine,
homocysteine, cystathionine, N-acetyl thiazolidine 4 carboxylic
acid (ATCA), glutathione, or bile, or other non-protein amino
acids, such as GABA, citrulline and ornithine, or other nitrogen
containing compounds such as polyamines may also be used to
activate CDO, SAD, GAD, ADO, TPAT, SA, ssTDeHase, lsTDeHase or TDO.
Depending on the type of gene construct or recombinant expression
cassette, other metabolites and nutrients may be used to activate
CDO, SAD, GAD, ADO, TPAT, SA, ssTDeHase, lsTDeHase, or TDO. These
include, but are not limited to, sugars, carbohydrates, lipids,
oligopeptides, mono- (glucose, arabinose, fructose, xylose, and
ribose) di- (sucrose and trehalose) and polysaccharides, carboxylic
acids (succinate, malate and fumarate) and nutrients such as
phosphate, molybdate, or iron.
[0231] Accordingly, the active agent may include a wide variety of
fertilizers, pesticides and herbicides known to those of ordinary
skill in the art (151). Other greening agents fall within the
definition of "active agent" as well, including minerals such as
calcium, magnesium and iron. The pesticides protect the plant from
pests or disease and may be either chemical or biological and
include fungicides, bactericides, insecticides and anti-viral
agents as known to those of ordinary skill in the art.
[0232] In some embodiments properties of a transgenic plant are
altered using an agent which increases sulfur concentration in
cells of the transgenic plant, such as fertilizer, sulfur, sulfite,
sulfide, sulfate, taurine, hypotaurine, homotaurine, cysteate,
2-sulfacetaldehyde, N-acetyl thiazolidine 4 carboxylic acid (ATCA),
glutathione, and bile. In other embodiments, the agent increases
nitrogen concentration. Amino acids, either naturally occurring in
proteins (e.g., cysteine, methionine, glutamate, glutamine, serine,
alanine, or glycine) or which do not naturally occur in proteins
(e.g., GABA, citrulline, or ornithine) and/or polyamines can be
used for this purpose.
[0233] Expression in Prokaryotes
[0234] The use of prokaryotes as hosts includes strains of E. coli.
However, other microbial strains including, but not limited to,
Bacillus (152) and Salmonella may also be used. Commonly used
prokaryotic control sequences include promoters for transcription
initiation, optionally with an operator, along with ribosome
binding site sequences. Commonly used prokaryotic promoters include
the beta lactamase (153), lactose (153), and tryptophan (154)
promoters. The vectors usually contain selectable markers to
identify transfected or transformed cells. Some commonly used
selectable markers include the genes for resistance to ampicillin,
tetracycline, or chloramphenicol. The vectors are typically a
plasmid or phage. Bacterial cells are transfected or transformed
with the plasmid vector DNA. Phage DNA can be infected with phage
vector particles or transfected with naked phage DNA. The plasmid
and phage DNA for the vectors are commercially available from
numerous vendors known to those of ordinary skill in the art.
[0235] Expression in Non-Plant Eukaryotes
[0236] The present invention can be expressed in a variety of
eukaryotic expression systems such as yeast, insect cell lines, and
mammalian cells which are known to those of ordinary skill in the
art. For each host system there are suitable vectors that are
commercially available (e.g., Invitrogen, Startagene, GE Healthcare
Life Sciences). The vectors usually have expression control
sequences, such as promoters, an origin of replication, enhancer
sequences, termination sequences, ribosome binding sites, RNA
splice sites, polyadenylation sites, transcriptional terminator
sequences, and selectable markers. Synthesis of heterologous
proteins in yeast is well known to those of ordinary skill in the
art (155, 156). The most widely used yeasts are Saccharomyces
cerevisiae and Pichia pastoris. Insect cell lines that include, but
are not limited to, mosquito larvae, silkworm, armyworm, moth, and
Drosophila cell lines can be used to express proteins of the
present invention using baculovirus-derived vectors. Mammalian cell
systems often will be in the form of monolayers of cells although
mammalian cell suspensions may also be used. A number of suitable
host cell lines capable of expressing intact proteins have been
developed in the art, and include the HEK293, BHK21, and CHO cell
lines.
[0237] A protein of the present invention, once expressed in any of
the non-plant eukaryotic systems can be isolated from the organism
by lysing the cells and applying standard protein isolation
techniques to the lysates or the pellets. The monitoring of the
purification process can be accomplished by using western blot
techniques or radioimmunoassay of other standard immunoassay
techniques.
[0238] Pharmaceutical Compositions
[0239] The invention provides pharmaceutical compositions which
comprise extracts of one or more transgenic plants described above.
Plant extracts containing taurine and hypotaurine can be used to
synthesize or manufacture homotaurine or other taurine derivatives
(157, 158), taurine-conjugates (159) or taurine-polymers (160) that
may have a wide range of commercial and medicinal applications
(161). Some taurine derivatives can function as organogelators
(162) or dyes (163) and can be used in nanosensor synthesis (164).
Some taurine derivatives have anticonvulsant (157) or anti-cancer
(165) properties. Other taurine derivatives are used in the
treatment of alcoholism (166, 167). Taurine-conjugated
carboxyethylester-polyrotaxanes increase anticoagulant activity
(168). Taurine-containing polymers may increase wound healing (169,
170). Taurine linked polymers such as poly gamma-glutamic
acid-sulfonates are biodegradable and may have applications in the
development of drug delivery systems, environmental materials,
tissue engineering, and medical materials (171). Extracts from
taurine-containing plants may be used in pharmaceutical or
medicinal compositions to deliver taurine, hypotaurine,
taurine-conjugates, or taurine-polymers for use in the treatment of
congestive heart failure, high blood pressure, hepatitis, high
cholesterol, fibrosis, epilepsy, autism, attention
deficit-hyperactivity disorder, retinal degeneration, diabetes, and
alcoholism. It is also used to improve mental performance and as an
antioxidant.
[0240] Pharmaceutically acceptable vehicles of taurine, taurine
derivatives, taurine-conjugates, or taurine-polymers are tablets,
capsules, gel, ointment, film, patch, powder or dissolved in liquid
form.
[0241] Nutritional Supplements and Feeds
[0242] Transgenic plants containing taurine or hypotaurine may be
consumed or used to make extracts for nutritional supplements.
Transgenic plant parts that have elevated levels of taurine or
hypotaurine may be used for human consumption. The plant parts may
include but are not limited to leaves, stalks, stems, tubers,
stolons, roots, petioles, cotyledons, seeds, fruits, grain,
strover, nuts, flowers, petioles, pollen, buds, or pods. Extracts
from transgenic plants containing taurine or hypotaurine may be
used as nutritional supplements, as an antioxidant or to improve
physical or mental performance. The extracts may be used in the
form of a liquid, powder, capsule or tablet.
[0243] Transgenic plants containing taurine or hypotaurine may be
used as fish or animal feed or used to make extracts for the
supplementation of animal feed. Plant parts that have elevated
levels of taurine or hypotaurine may be used as animal or fish feed
include but are not limited to leaves, stalks, stems, tubers,
stolons, roots, petioles, cotyledons, seeds, fruits, grain,
strover, nuts, flowers, petioles, buds, pods, or husks. Extracts
from transgenic plants containing taurine or hypotaurine may be
used as feed supplements in the form of a liquid, powder, capsule
or tablet.
Definitions
[0244] The term "polynucleotide" refers to a natural or synthetic
linear and sequential array of nucleotides and/or nucleosides,
including deoxyribonucleic acid, ribonucleic acid, and derivatives
thereof. It includes chromosomal DNA, self-replicating plasmids,
infectious polymers of DNA or RNA and DNA or RNA that performs a
primarily structural role. Unless otherwise indicated, nucleic
acids or polynucleotide are written left to right in 5' to 3'
orientation, Nucleotides are referred to by their commonly accepted
single-letter codes. Numeric ranges are inclusive of the numbers
defining the range.
[0245] The terms "amplified" and "amplification" refer to the
construction of multiple copies of a nucleic acid sequence or
multiple copies complementary to the nucleic acid sequence using at
least one of the nucleic acid sequences as a template.
Amplification can be achieved by chemical synthesis using any of
the following methods, such as solid-phase phosphoramidate
technology or the polymerase chain reaction (PCR). Other
amplification systems include the ligase chain reaction system,
nucleic acid sequence based amplification, Q-Beta Replicase
systems, transcription-based amplification system, and strand
displacement amplification. The product of amplification is termed
an amplicon.
[0246] As used herein "promoter" includes reference to a region of
DNA upstream from the start of transcription and involved in
recognition and binding of RNA polymerase, either I, II or III, and
other proteins to initiate transcription. Promoters include
necessary nucleic acid sequences near the start site of
transcription, such as, in the case of a polymerase II type
promoter, a TATA element. A promoter also optionally includes
distal enhancer or repressor elements, which can be located as far
as several thousand base pairs from the start site of
transcription.
[0247] The term "plant promoter" refers to a promoter capable of
initiating transcription in plant cells.
[0248] The term "microbe promoter" refers to a promoter capable of
initiating transcription in microbes.
[0249] The term "foreign promoter" refers to a promoter, other than
the native, or natural, promoter, which promotes transcription of a
length of DNA of viral, bacterial or eukaryotic origin, including
those from microbes, plants, plant viruses, invertebrates or
vertebrates.
[0250] The term "microbe" refers to any microorganism (including
both eukaryotic and prokaryotic microorganisms), such as fungi,
yeast, bacteria, actinomycetes, algae and protozoa, as well as
other unicellular structures.
[0251] The term "plant" includes whole plants, and plant organs,
and progeny of same. Plant organs comprise, e.g., shoot vegetative
organs/structures (e.g. leaves, stems and tubers), roots, flowers
and floral organs/structures (e.g. bracts, sepals, petals, stamens,
carpels, anthers and ovules), seed (including embryo, endosperm,
and seed coat) and fruit (the mature ovary), plant tissue (e.g.
vascular tissue, ground tissue, and the like) and cells (e.g. guard
cells, egg cells, trichomes and the like). The class of plants that
can be used in the method of the invention is generally as broad as
the class of higher and lower plants amenable to transformation
techniques, including angiosperms (monocotyledonous and
dicotyledonous plants), gymnosperms, ferns, and multicellular
algae. It includes plants of a variety of ploidy levels, including
aneuploid, polyploid, diploid, haploid and hemizygous.
[0252] The term "plant storage organ" includes roots, seeds,
tubers, fruits, and specialized stems.
[0253] The term "constitutive" refers to a promoter that is active
under most environmental and developmental conditions, such as, for
example, but not limited to, the CaMV 35S promoter and the nopaline
synthase terminator.
[0254] The term "tissue-preferred promoter" refers to a promoter
that is under developmental control or a promoter that
preferentially initiates transcription in certain tissues.
[0255] The term "tissue-specific promoter" refers to a promoter
that initiates transcription only in certain tissues.
[0256] The term "cell-type specific promoter" refers to a promoter
that primarily initiates transcription only in certain cell types
in one or more organs.
[0257] The term "inducible promoter" refers to a promoter that is
under environmental control.
[0258] The terms "encoding" and "coding" refer to the process by
which a polynucleotide, through the mechanisms of transcription and
translation, provides the information to a cell from which a series
of amino acids can be assembled into a specific amino acid sequence
to produce a functional polypeptide, such as, for example, an
active enzyme or ligand binding protein.
[0259] The terms "polypeptide," "peptide," "protein" and "gene
product" are used interchangeably herein to refer to a polymer of
amino acid residues. The terms apply to amino acid polymers in
which one or more amino acid residue is an artificial chemical
analogue of a corresponding naturally occurring amino acid, as well
as to naturally occurring amino acid polymers. Amino acids may be
referred to by their commonly known three-letter or one-letter
symbols. Amino acid sequences are written left to right in amino to
carboxy orientation, respectively. Numeric ranges are inclusive of
the numbers defining the range.
[0260] The terms "residue," "amino acid residue," and "amino acid"
are used interchangeably herein to refer to an amino acid that is
incorporated into a protein, polypeptide, or peptide. The amino
acid may be a naturally occurring amino acid and may encompass
known analogs of natural amino acids that can function in a similar
manner as the naturally occurring amino acids.
[0261] The terms "cysteine dioxygenase" and "CDO" refer to the
protein (EC:1.13.11.20) that catalyzes the following reaction:
cysteine+oxygen=3-sulfinoalanine
[0262] NOTE: 3-sulfinoalanine is another name for cysteine sulfinic
acid, cysteine sulfinate, 3-sulphino-L-alanine, 3-sulfino-alanine,
3-sulfino-L-alanine, L-cysteine sulfinic acid, L-cysteine sulfinic
acid, cysteine hydrogen sulfite ester or alanine 3-sulfinic
acid
[0263] The terms "sulfinoalanine decarboxylase" and "SAD" refer to
the protein (4.1.1.29) that catalyzes the following reaction:
3-sulfinoalanine=hypotaurine=CO.sub.2
[0264] NOTE: SAD is another name for cysteine-sulfinate
decarboxylase, L-cysteine sulfinic acid decarboxylase,
cysteine-sulfinate decarboxylase, CADCase/CSADCase, CSAD, cysteic
decarboxylase, cysteine sulfinic acid decarboxylase, cysteine
sulfinate decarboxylase, sulfoalanine decarboxylase,
sulphinoalanine decarboxylase, and 3-sulfino-L-alanine
carboxy-lyase.
[0265] NOTE: the SAD reaction is also catalyzed by GAD (4.1.1.15)
(glutamic acid decarboxylase or glutamate decarboxylase).
[0266] Other names for hypotaurine are 2-aminoethane sulfinate,
2-aminoethylsulfinic acid, and 2-aminoethanesulfinic acid
[0267] Other names for taurine are 2-aminoethane sulfonic acid,
aminoethanesulfonate, L-taurine, taurine ethyl ester, and taurine
ketoisocaproic acid 2-aminoethane sulfinate.
[0268] The terms "cysteamine dioxygenase" and "ADO" refer to the
protein (EC 1.13.11.19) that catalyzes the following reaction:
2-aminoethanethiol+O.sub.2=hypotaurine
[0269] ADO is another name for 2-aminoethanethiol:oxygen
oxidoreductase, persulfurase, cysteamine oxygenase, and
cysteamine:oxygen oxidoreductase.
[0270] Other names for 2-aminoethanethiol are cysteamine or
2-aminoethane-1-thiol, b-mercaptoethylamine, 22-mercaptoethylamine,
decarboxycysteine, and thioethanolamine.
[0271] The terms "taurine-pyruvate aminotransferase" and "TPAT"
refer to the protein (EC 2.6.1.77) that catalyzes the following
reaction:
L-alanine+2-sulfoacetaldehyde=taurine+pyruvate
[0272] TPAT is another name for taurine transaminase or Tpa
[0273] The terms "sulfoacetaldehyde acetyltransferase" and "SA"
refer to the protein (EC:2.3.3.15) that catalyzes the following
reaction:
acetyl phosphate+sulfite=sulfoacetaldehyde+orthophosphate
[0274] SA is another name for acetyl-phosphate:sulfite
S-acetyltransferase or Xsc
[0275] The terms "taurine dehydrogenase" and "TDeHase" refer to the
protein (EC:1.4.2.-) that catalyzes the following reaction:
ammonia+2-sulfoacetaldehyde=taurine+water
[0276] TDeHase is another name for taurine:oxidoreductase,
taurine:ferricytochrome-c oxidoreductase, tauX or tauY
[0277] The terms "taurine dioxygenase" and "TDO" refer to the
protein (EC:1.14.11.17) that catalyzes the following reaction:
sulfite+aminoacetaldehyde+succinate+CO.sub.2=taurine+2-oxoglutarate+O.su-
b.2
[0278] TDO is another name for 2-aminoethanesulfonate dioxygenase,
alpha-ketoglutarate-dependent taurine dioxygenase, taurine,
2-oxoglutarate:O2 oxidoreductase or tauD
2-oxoglutarate is another name for alpha-ketoglutarate
[0279] The term "functional" with reference to CDO, SAD, GAD, ADO,
TPAT, SA, ssTDeHase, lsTDeHase or TDO refers to peptides, proteins
or enzymes that catalyze the CDO, SAD, GAD, ADO, TPAT, SA, TDeHase
or TDO reactions, respectively.
[0280] The term "recombinant" includes reference to a cell or
vector that has been modified by the introduction of a heterologous
nucleic acid. Recombinant cells express genes that are not normally
found in that cell or express native genes that are otherwise
abnormally expressed, underexpressed, or not expressed at all as a
result of deliberate human intervention, or expression of the
native gene may have reduced or eliminated as a result of
deliberate human intervention.
[0281] The term "recombinant expression cassette" refers to a
nucleic acid construct, generated recombinantly or synthetically,
with a series of specified nucleic acid elements, which permit
transcription of a particular nucleic acid in a target cell. The
recombinant expression cassette can be incorporated into a plasmid,
chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid
fragment. Typically, the recombinant expression cassette portion of
an expression vector includes, among other sequences, a nucleic
acid to be transcribed, and a promoter.
[0282] The term "transgenic plant" includes reference to a plant,
which comprises within its genome a heterologous polynucleotide.
Generally, the heterologous polynucleotide is integrated within the
genome such that the polynucleotide is passed on to successive
generations. The heterologous polynucleotide may be integrated into
the genome alone or as part of a recombinant expression cassette.
"Transgenic" is also used to include any cell, cell line, callus,
tissue, plant part or plant, the genotype of which has been altered
by the presence of heterologous nucleic acid including those
transgenic plants altered or created by sexual crosses or asexual
propagation from the initial transgenic plant. The term
"transgenic" does not encompass the alteration of the genome by
conventional plant breeding methods or by naturally occurring
events such as random cross-fertilization, non-recombinant viral
infection, non-recombinant bacterial transformation,
non-recombinant transposition, or spontaneous mutation.
[0283] The term "vector" includes reference to a nucleic acid used
in transfection or transformation of a host cell and into which can
be inserted a polynucleotide.
[0284] The term "selectively hybridizes" includes reference to
hybridization, under stringent hybridization conditions, of a
nucleic acid sequence to a specified nucleic acid target sequence
to a detectably greater degree (e.g., at least 2-fold over
background) than its hybridization to non-target nucleic acid
sequences and to the substantial exclusion of non-target nucleic
acids. Selectively hybridizing sequences typically have about at
least 40% sequence identity, preferably 60-90% sequence identity,
and most preferably 100% sequence identity (i.e., complementary)
with each other.
[0285] The terms "stringent conditions" and "stringent
hybridization conditions" include reference to conditions under
which a probe will hybridize to its target sequence, to a
detectably greater degree than other sequences (e.g., at least
2-fold over background). Stringent conditions are
sequence-dependent and will be different in different
circumstances. By controlling the stringency of the hybridization
and/or washing conditions, target sequences can be identified which
can be up to 100% complementary to the probe (homologous probing).
Alternatively, stringency conditions can be adjusted to allow some
mismatching in sequences so that lower degrees of similarity are
detected (heterologous probing). Optimally, the probe is
approximately 500 nucleotides in length, but can vary greatly in
length from less than 500 nucleotides to equal to the entire length
of the target sequence.
[0286] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide or Denhardt solution. Low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at
37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Moderate stringency conditions include hybridization
in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a
wash in 0.5.times. to 1.times.SSC at 55 to 60.degree. C. High
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Specificity is typically the function of
post-hybridization washes, the critical factors being the ionic
strength and temperature of the final wash solution. For DNA-DNA
hybrids, the T.sub.m can be approximated (172), where the
T.sub.m=81.5.degree. C.+16.6 (log M)+0.41 (% GC) -0.61 (% form)
-500/L; where M is the molarity of monovalent cations, % GC is the
percentage of guanosine and cytosine nucleotides in the DNA, % form
is the percentage of formamide in the hybridization solution, and L
is the length of the hybrid in base pairs. T.sub.m is the
temperature (under defined ionic strength and pH) at which 50% of a
complementary target sequence hybridizes to a perfectly matched
probe. T.sub.m is reduced by about 1.degree. C. for each 1% of
mismatching; thus, T.sub.m, hybridization and/or wash conditions
can be adjusted to hybridize to sequences of the desired identity.
For example, if sequences with .gtoreq.90% identity are sought, the
T.sub.m can be decreased 10.degree. C. Generally, stringent
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence and its
complement at a defined ionic strength and pH. However, severely
stringent conditions can utilize a hybridization and/or wash at 1,
2, 3 or 4.degree. C. lower than the thermal melting point
(T.sub.m); moderately stringent conditions can utilize a
hybridization and/or wash at 6, 7, 8, 9 or 10.degree. C. lower than
the thermal melting point (T.sub.m); low stringency conditions can
utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or
20.degree. C. lower than the thermal melting point (T.sub.m). Using
the equation, hybridization and wash compositions, and desired
T.sub.m, those of ordinary skill in the art will understand that
variations in the stringency of hybridization and/or wash solutions
are inherently described. An extensive guide to the hybridization
of nucleic acids is found in the scientific literature (90, 173).
Unless otherwise stated, in the present application high stringency
is defined as hybridization in 4.times.SSC, 5.times.Denhardt
solution (5 g Ficoll, 5 g polyvinypyrrolidone, 5 g bovine serum
albumin in 500 ml of water), 0.1 mg/ml boiled salmon sperm DNA, and
25 mM Na phosphate at 65.degree. C., and a wash in 0.1.times.SSC,
0.1% SDS at 65.degree. C.
[0287] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides
or polypeptides: "reference sequence," "comparison window,"
"sequence identity," "percentage of sequence identity," and
"substantial identity."
[0288] The term "reference sequence" is a defined sequence used as
a basis for sequence comparison. A reference sequence may be a
subset or the entirety of a specified sequence; for example, as a
segment of a full-length cDNA or gene sequence, or the complete
cDNA or gene sequence.
[0289] The term "comparison window" includes reference to a
contiguous and specified segment of a polynucleotide sequence,
where the polynucleotide sequence may be compared to a reference
sequence and the portion of the polynucleotide sequence in the
comparison window may comprise additions or deletions (i.e., gaps)
when it is compared to the reference sequence for optimal
alignment. The comparison window is usually at least 20 contiguous
nucleotides in length, and optionally can be 30, 40, 50, 100 or
longer. Those of ordinary skill in the art understand that the
inclusion of gaps in a polynucleotide sequence alignment introduces
a gap penalty, and it is subtracted from the number of matches.
[0290] Methods of alignment of nucleotide and amino acid sequences
for comparison are well known to those of ordinary skill in the
art. The local homology algorithm, BESTFIT, (174) can perform an
optimal alignment of sequences for comparison using a homology
alignment algorithm called GAP (175), search for similarity using
Tfasta and Fasta (176), by computerized implementations of these
algorithms widely available on-line or from various vendors
(Intelligenetics, Genetics Computer Group). CLUSTAL allows for the
alignment of multiple sequences (177-179) and program PileUp can be
used for optimal global alignment of multiple sequences (180). The
BLAST family of programs can be used for nucleotide or protein
database similarity searches. BLASTN searches a nucleotide database
using a nucleotide query. BLASTP searches a protein database using
a protein query. BLASTX searches a protein database using a
translated nucleotide query that is derived from a six-frame
translation of the nucleotide query sequence (both strands).
TBLASTN searches a translated nucleotide database using a protein
query that is derived by reverse-translation. TBLASTX search a
translated nucleotide database using a translated nucleotide
query.
[0291] GAP (175) maximizes the number of matches and minimizes the
number of gaps in an alignment of two complete sequences. GAP
considers all possible alignments and gap positions and creates the
alignment with the largest number of matched bases and the fewest
gaps. It also calculates a gap penalty and a gap extension penalty
in units of matched bases. Default gap creation penalty values and
gap extension penalty values in Version 10 of the Wisconsin
Genetics Software Package are 8 and 2, respectively. The gap
creation and gap extension penalties can be expressed as an integer
selected from the group of integers consisting of from 0 to 100.
GAP displays four figures of merit for alignments: Quality, Ratio,
Identity, and Similarity. The Quality is the metric maximized in
order to align the sequences. Ratio is the quality divided by the
number of bases in the shorter segment. Percent Identity is the
percent of the symbols that actually match. Percent Similarity is
the percent of the symbols that are similar. Symbols that are
across from gaps are ignored. A similarity is scored when the
scoring matrix value for a pair of symbols is greater than or equal
to 0.50, the similarity threshold. The scoring matrix used in
Version 10 of the Wisconsin Genetics Software Package is BLOSUM62
(181).
[0292] Unless otherwise stated, sequence identity or similarity
values refer to the value obtained using the BLAST 2.0 suite of
programs using default parameters (182). As those of ordinary skill
in the art understand that BLAST searches assume that proteins can
be modeled as random sequences and that proteins comprise regions
of nonrandom sequences, short repeats, or enriched for one or more
amino acid residues, called low-complexity regions. These
low-complexity regions may be aligned between unrelated proteins
even though other regions of the protein are entirely dissimilar.
Those of ordinary skill in the art can use low-complexity filter
programs to reduce number of low-complexity regions that are
aligned in a search. These filter programs include, but are not
limited to, the SEG (183, 184) and XNU (185).
[0293] The terms "sequence identity" and "identity" are used in the
context of two nucleic acid or polypeptide sequences and include
reference to the residues in the two sequences, which are the same
when aligned for maximum correspondence over a specified comparison
window. When the percentage of sequence identity is used in
reference to proteins it is recognized that residue positions which
are not identical often differ by conservative amino acid
substitutions, where amino acid residues are substituted for other
amino acid residues with similar chemical properties (e.g., charge
or hydrophobicity) and therefore do not change the functional
properties of the molecule. Where sequences differ in conserved
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conserved nature of the substitution.
Sequences, which differ by such conservative substitutions, are
said to have "sequence similarity" or "similarity." Scoring for a
conservative substitution allows for a partial rather than a full
mismatch (186), thereby increasing the percentage sequence
similarity.
[0294] The term "percentage of sequence identity" means the value
determined by comparing two optimally aligned sequences over a
comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise gaps (additions or
deletions) when compared to the reference sequence for optimal
alignment. The percentage is calculated by determining the number
of positions at which the identical nucleic acid base or amino acid
residue occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison and multiplying the
result by 100 to yield the percentage of sequence identity.
[0295] The term "substantial identity" of polynucleotide sequences
means that a polynucleotide comprises a sequence that has between
50-100% sequence identity, preferably at least 50% sequence
identity, preferably at least 60% sequence identity, preferably at
least 70%, more preferably at least 80%, more preferably at least
90%, and most preferably at least 95%, compared to a reference
sequence using one of the alignment programs described using
standard parameters. One of ordinary skill in the art will
recognize that these values can be appropriately adjusted to
determine corresponding identity of proteins encoded by two
nucleotide sequences by taking into account codon degeneracy, amino
acid similarity, reading frame positioning and the like.
Substantial identity of amino acid sequences for these purposes
normally means sequence identity of between 50-100%. Another
indication that nucleotide sequences are substantially identical is
if two molecules hybridize to each low stringency conditions,
moderate stringency conditions or high stringency conditions. Yet
another indication that two nucleic acid sequences are
substantially identical is if the two polypeptides immunologically
cross-react with the same antibody in a western blot, immunoblot or
ELISA assay.
[0296] The terms "substantial identity" in the context of a peptide
indicates that a peptide comprises a sequence with between 55-100%
sequence identity to a reference sequence preferably at least 55%
sequence identity, preferably 60% preferably 70%, more preferably
80%, most preferably at least 90% or 95% sequence identity to the
reference sequence over a specified comparison window. Preferably,
optimal alignment is conducted using the homology alignment
algorithm (175). Thus, a peptide is substantially identical to a
second peptide, for example, where the two peptides differ only by
a conserved substitution. Another indication that amino acid
sequences are substantially identical is if two polypeptides
immunologically cross-react with the same antibody in a western
blot, immunoblot or ELISA assay. In addition, a peptide can be
substantially identical to a second peptide when they differ by a
non-conservative change if the epitope that the antibody recognizes
is substantially identical.
REFERENCES
[0297] 1. Suzuki et al., 1989. U.S. Pat. No. 4,877,447. [0298] 2.
Sturman 1988. "Taurine in development." J Nutr, 118: 1169-1176.
[0299] 3. Sturman et al., 1980. "The biology of taurine in
nutrition and development." Adv Nutr Res, 3: 231-299. [0300] 4.
Chen et al., 1998. "Effect of taurine on human fetal neuron cells:
Proliferation and differentiation." Adv Exp Med Biol, 442: 397-403.
[0301] 5. El Idrissi et al., 1999. "Growth factors and taurine
protect against excitotoxicity by stabilizing calcium homeostasis
and energy metabolism." J Neurosci, 19: 9459-9468. [0302] 6. El
Idrissi et al., 2003. "Taurine regulates mitochondrial calcium
homeostasis." Adv Exp Med Biol, 526: 527-536. [0303] 7. Trenkner
1990. "Possible role of glutamate with taurine in neuron-glia
interaction during cerebellar development." Prog Clin Biol Res,
351: 133-140. [0304] 8. Wu et al., 2005. "Mode of action of taurine
as a neuroprotector." Brain Res, 1038: 123-131. [0305] 9. Schaffer
et al., 2000. "Role of osmoregulation in the actions of taurine."
Amino Acids, 19: 527-546. [0306] 10. Chapman et al., 1993. "Taurine
and the heart." Cardiovasc Res, 27: 358-363. [0307] 11. Tabassuma
et al., 2006. "Attenuation of tamoxifen-induced hepatotoxicity by
taurine in mice." Clin Chim Acta, 370: 129-136. [0308] 12. Rocket
et al., 2007. "The osmolyte taurine protects against ultraviolet B
radiation-induced immunosuppression." J Immunol, 179: 3604-3612.
[0309] 13. Milei et al., 1992. "Reduction of reperfusion injury
with preoperative rapid intravenous infusion of taurine during
myocardial revascularization." Am Heart J, 123: 339-345. [0310] 14.
Militante et al., 2002. "Treatment of hypertension with oral
taurine." Endocrinology, 147: 3276-3284. [0311] 15. Fujita et al.,
1987. "Effects of increased adrenomedullary activity and taurine in
young patients with borderline hypertension." Circulation, 75:
525-532. [0312] 16. McCown et al., 1987. "Amino acid influences on
seizures elicited within the inferior colliculus." J Pharmacol Exp
Ther, 243: 603-608. [0313] 17. Matsuyama et al., 1983. "The effect
of taurine administration on patients with acute hepatitis." Prog
Clin Biol Res, 125: 461-468. [0314] 18. Ikeda 1977. "Effects of
taurine on alcohol withdrawal." Lancet, 2: 509. [0315] 19. Franconi
et al., 2004. "Is taurine beneficial in reducing risk factors for
diabetes mellitus?" Neurochem Res, 29: 143-150. [0316] 20.
Paula-Lima et al., 2005. "Activation of GABAA receptors by taurine
and muscimol blocks the neurotoxicity of [beta]-amyloid in rat
hippocampal and cortical neurons." Neuropharmacology, 49:
1140-1148. [0317] 21. Nakamori et al., 1993. "Quantitative
evaluation of the effectiveness of taurine in protecting the ocular
surface against oxidant." Chem Pharm Bull, 41: 335-338. [0318] 22.
Zhang et al., 2004. "Beneficial effects of taurine on serum lipids
in overweight or obese non-diabetic subjects." Amino Acids, 26:
267-271. [0319] 23. Yokogoshi et al., 1999. "Dietary taurine
enhances cholesterol degradation and reduces serum and liver
cholesterol concentrations in rats fed a high-cholesterol diet." J
Nutr, 129: 1705-1712. [0320] 24. Yamamoto et al., 2000. "Dietary
taurine decreases hepatic secretion of cholesterol ester in rats
fed a high-cholesterol diet." Pharmacology, 60: 27-33. [0321] 25.
Green et al., 1991. "Antioxidant role and subcellular location of
hypotaurine and taurine in human neutrophils." Biochim Biophys
Acta, 1073: 91-97. [0322] 26. Giirer et al., 2001. "Antioxidant
effect of taurine against lead-induced oxidative stress." Arch
Environ Contam Toxicol, 41: 397-402. [0323] 27. Das et al., 2008.
"Taurine provides antioxidant defense against NaF-induced
cytotoxicity in murine hepatocytes." Pathophysiology, 15: 181-190.
[0324] 28. Zhang et al., 2004. "Role of taurine supplementation to
prevent exercise-induced oxidative stress in healthy young men."
Amino Acids, 26: 203-207. [0325] 29. Williams 2005. "Dietary
supplements and sports performance: Amino acids." Journal of the
International Society of Sports Nutrition, 2: 63-67. [0326] 30. da
Silva et al., 2008. "Penetration profile of taurine in the human
skin and its distribution in skin layers." Pharm Res, 25:
1846-1850. [0327] 31. Knopf et al., 1978. "Taurine: An essential
nutrient for the cat." J Nutr, 108: 773-778. [0328] 32. Gibson et
al., 2007. "Supplementation of taurine and methionine to all-plant
protein diets for rainbow trout (Oncorhynchus mykiss)."
Aquaculture, 269: 514-524. [0329] 33. Schweigen 1967.
"Low-molecular-weight compounds in Macrocystis pyrifera, a marine
algae." Arch Biochem Biophys, 118: 383-387. [0330] 34. Huxtable
1992. "Physiological actions of taurine." Physiol Rev, 72: 101-163.
[0331] 35. Kataoka et al., 1986. "Occurrence of taurine in plants."
Agric Biol Chem, 50: 1887-1888. [0332] 36. Murray et al., 1989.
"Codon usage in plant genes." Nucleic Acids Research, 17: 477-498.
[0333] 37. Stemmer 1997. U.S. Pat. No. 5,605,793. [0334] 38. Short
1999. U.S. Pat. No. 5,965,408. [0335] 39. Langenheim et al., 1982.
Botany: Plant Biology and its Relation to Human Affairs. New York:
John Wiley & Sons Inc. [0336] 40. Vasil 1984. Cell Culture and
Somatic Cell Genetics of Plants: Laboratory Procedures and Their
Applications. Orlando: Academic Press. [0337] 41. Stanier et al.,
1986. The Microbial World. New Jersey: Prentice-Hall. [0338] 42.
Dhringra et al., 1985. Basic plant pathology methods. Boca Raton,
Fla.: CRC Press. [0339] 43. Maniatis et al., 1985. Molecular
Cloning: A Laboratory Manual: DNA Cloning. New York: Cold Spring
Harbor. [0340] 44. Gait 1984. Oligonucleotide Synthesis-A Practical
Approach. Washington, D.C.: IRL Press. [0341] 45. Hames et al.,
1984. Nucleic Acid Hybridization: A Practical Approach. Washington
D.C.: IRL Press. [0342] 46. Watson et al., 1992. Recombinant DNA.
New York: Scientific American Books. [0343] 47. Szewczyk et al.,
2006. "Fusion PCR and gene targeting in Aspergillus nidulans." Nat
Protoc, 1: 3111-3121. [0344] 48. Ho et al., 1989. "Site-directed
mutagenesis by overlap extension using the polymerase chain
reaction." Gene, 77: 51-59. [0345] 49. Fuhrmann et al., 1999. "A
synthetic gene coding for the green fluorescent protein (GFP) is a
versatile reporter in Chlamydomonas reinhardtii." Plant J, 19:
353-361. [0346] 50. Mandecki et al., 1988. "FokI method of gene
synthesis." Gene, 68: 101-107. [0347] 51. Stemmer 1995.
"Single-step assembly of a gene and entire plasmid from large
numbers of oligodeoxyribonucleotides." Gene, 164: 49-53. [0348] 52.
Gao et al., 2003. "Thermodynamically balanced inside-out (TBIO)
PCR-based gene synthesis: a novel method of primer design for
high-fidelity assembly of longer gene sequences." Nucleic Acids
Res, 31: e143. [0349] 53. Young et al., 2004. "Two-step total gene
synthesis method." Nucleic Acids Res, 32: e59. [0350] 54. van Der
Krol et al., 1999. "Developmental and wound-, cold-, desiccation-,
ultraviolet-B-stress-induced modulations in the expression of the
petunia zinc finger transcription factor gene ZPT2-2." Plant
Physiol, 121: 1153-62. [0351] 55. Shinmyo et al., 1998. "Metabolic
engineering of cultured tobacco cells." Biotechnol Bioeng, 58:
329-32. [0352] 56. Sohal et al., 1999. "The promoter of a Brassica
napus lipid transfer protein gene is active in a range of tissues
and stimulated by light and viral infection in transgenic
Arabidopsis." Plant Mol Biol, 41: 75-87. [0353] 57. Cormack et al.,
2002. "Leucine zipper-containing WRKY proteins widen the spectrum
of immediate early elicitor-induced WRKY transcription factors in
parsley." Biochim Biophys Acta, 1576: 92-100. [0354] 58. Eulgem et
al., 1999. "Early nuclear events in plant defence signalling: rapid
gene activation by WRKY transcription factors." EMBO (Eur Mol Biol
Organ) J, 18: 4689-99. [0355] 59. Lebel et al., 1998. "Functional
analysis of regulatory sequences controlling PR-1 gene expression
in Arabidopsis." Plant J, 16: 223-33. [0356] 60. Ngai et al., 1997.
"Light-induced transcriptional repression of the pea AS1 gene:
identification of cis-elements and transfactors." Plant J, 12:
1021-34. [0357] 61. Kucho et al., 1999. "CO(2)-responsive
transcriptional regulation of CAH1 encoding carbonic anhydrase is
mediated by enhancer and silencer regions in Chlamydomonas
reinhardtii." Plant Physiol, 121: 1329-38. [0358] 62. Kucho et al.,
2003. "Cis-acting elements and DNA-binding proteins involved in
CO2-responsive transcriptional activation of Cah1 encoding a
periplasmic carbonic anhydrase in Chlamydomonas reinhardtii." Plant
Physiol, 133: 783-93. [0359] 63. Chen et al., 1996. "The promoter
of a H2O2-inducible, Arabidopsis glutathione S-transferase gene
contains closely linked OBF- and OBP1-binding sites." Plant J, 10:
955-66. [0360] 64. Chen et al., 1999. "The auxin, hydrogen peroxide
and salicylic acid induced expression of the Arabidopsis GST6
promoter is mediated in part by an ocs element." Plant J, 19:
667-77. [0361] 65. Lu et al., 1998. "Sugar response sequence in the
promoter of a rice alpha-amylase gene serves as a transcriptional
enhancer." J Biol Chem, 273: 10120-31. [0362] 66. Leubner-Metzger
et al., 1998. "Ethylene-responsive element binding protein (EREBP)
expression and the transcriptional regulation of class I
beta-1,3-glucanase during tobacco seed germination." Plant Mol
Biol, 38: 785-95. [0363] 67. Hudspeth et al., 1992. "Expression of
maize phosphoenolpyruvate carboxylase in transgenic tobacco:Effects
on biochemistry and physiology." Plant Physiol, 98: 458-464. [0364]
68. de Framond 1991. "A metallothionein-like gene from maize (Zea
mays). Cloning and characterization." FEBS Lett, 290: 103-6. [0365]
69. Hudspeth et al., 1996. "Characterization and expression of
metallothionein-like genes in cotton." Plant Mol Biol, 31: 701-5.
[0366] 70. Herrera-Estrella et al., 1983. "Expression of chimaeric
genes transferred into plant cells using a Ti-plasmid-derived
vector." Nature, 303: 209-213. [0367] 71. Pathirana et al., 1997.
"Analyses of phosphoenolpyruvate carboxylase gene structure and
expression in alfalfa nodules." Plant J, 12: 293-304. [0368] 72.
Yang et al., 2002. "Isolation and characterization of the orchid
cytokinin oxidase DSCKX1 promoter." J Exp Bot, 53: 1899-1907.
[0369] 73. Moon et al., 2004. "Developmental regulation of peach
ACC oxidase promoter-GUS fusions in transgenic tomato fruits." J
Exp Bot, 55: 1519-1528. [0370] 74. Avsian-Kretchmer et al., 2004.
"The salt-stress signal transduction pathway that activates the
gpx1 promoter is mediated by intracellular H2O2, different from the
pathway induced by extracellular H2O2." Plant Physiol, 135:
1685-96. [0371] 75. Wu et al., 2007. "Functional analysis of a
cotton glucuronosyltransferase promoter in transgenic tobaccos."
Cell Res, 17: 174-183. [0372] 76. Shelp et al., 1999. "Metabolism
and functions of gamma-aminobutyric acid." Trends Plant Sci, 41:
446-452. [0373] 77. Baum et al., 1993. "A plant glutamate
decarboxylase containing a calmodulin binding domain. Cloning,
sequence, and functional analysis." J Biol Chem, 268: 19610-19617.
[0374] 78. Gallego et al., 1995. "A role for glutamate
decarboxylase during tomato ripening: the characterisation of a
cDNA encoding a putative glutamate decarboxylase with a
calmodulin-binding site." Plant Mol Biol, 27: 1143-1151. [0375] 79.
Yun et al., 1998. "Cloning and characterization of tobacco cDNA
encoding calcium/calmodulin-dependent glutamate decarboxylase." Mol
Cell, 8: 125-129. [0376] 80. Oh et al., 2005. "Cloning and
characterization of a rice cDNA encoding glutamate decarboxylase."
J Biochem Mol Biol, 38: 595-601. [0377] 81. Chiu et al., 2002.
"Phylogenetic and expression analysis of the
glutamate-receptor-like gene family in Arabidopsis thaliana." Mol
Biol Evol, 19: 1066-1082. [0378] 82. Kim et al., 2001.
"Overexpression of the AtGluR2 gene encoding an Arabidopsis homolog
of mammalian glutamate receptors impairs calcium utilization and
sensitivity to ionic stress in transgenic plants." Plant Cell
Physiol, 42: 74-84. [0379] 83. Meyerhoff et al., 2005. "AtGLR3.4, a
glutamate receptor channel-like gene is sensitive to touch and
cold." Planta, 222: 418-27. [0380] 84. Maruyama-Nakashita et al.,
2004. "Regulation of high-affinity sulphate transporters in plants
towards systematic analysis of sulphur signalling and regulation."
J Exp Bot, 55: 1843-1849. [0381] 85. Yoshimoto et al., 2003.
"Phloem-localizing sulfate transporter, Sultr1;3, mediates
re-distribution of sulfur from source to sink organs in
Arabidopsis." Plant Physiol, 131: 1511-1517. [0382] 86. Awazuhara
et al., 2005. "The function of SULTR2;1 sulfate transporter during
seed development in Arabidopsis thaliana." Physiol Plant, 125:
95-105. [0383] 87. Kataoka et al., 2004. "Root-to-shoot transport
of sulfate in Arabidopsis: Evidence for the role of SULTR3;5 as a
component of low-affinity sulfate transport system in the root
vasculature." Plant Physiol, 136: 4198-4204. [0384] 88. An et al.,
1985. "New cloning vehicles for transformation of higher plants."
EMBO (Eur Mol Biol Organ) J, 4: 277-284. [0385] 89. Gruber et al.,
1993. Vectors for plant transformation. In Glick B R & J E
Thompson, editors. Methods in Plant Molecular Biology and
Biotechnology 89-119. Baco Raton, Fla.: CRC Press. [0386] 90.
Ausubel et al., 1995. Current Protocols in Molecular Biology. New
York: Greene Publishing and Wiley-Interscience. [0387] 91. Newman
et al., 1993. "DST sequences, highly conserved among plant SAUR
genes, target reporter transcripts for rapid decay in tobacco."
Plant Cell, 5: 701-14. [0388] 92. Ohme-Takagi et al., 1993. "The
effect of sequences with high AU content on mRNA stability in
tobacco." Proc Natl Acad Sci USA, 90: 11811-5. [0389] 93. von
Heijne 1986. "Mitochondrial targeting sequences may form
amphiphilic helices." EMBO (Eur Mol Biol Organ) J, 5: 1335-1342.
[0390] 94. Swinkels et al., 1991. "A novel, cleavable peroxisomal
targeting signal at the amino-terminus of the rat 3-ketoacyl-CoA
thiolase." EMBO (Eur Mol Biol Organ) J, 10: 3255-62. [0391] 95.
Rusch et al., 1995. "Protein transport via amino-terminal targeting
sequences: Common themes in diverse systems." Mol Membr Biol, 12:
295-307. [0392] 96. Soll et al., 1998. "Protein translocation into
and across the chloroplastic envelope membranes." Plant Mol Biol,
38: 191-207. [0393] 97. Gould et al., 1988. "Identification of
peroxisomal targeting signals located at the carboxy terminus of
four peroxisomal proteins." J Cell Biol, 107: 897-905. [0394] 98.
Gould et al., 1989. "A conserved tripeptide sorts proteins to
peroxisomes." J Cell Biol, 108: 1657-64. [0395] 99. McCammon et
al., 1994. "An internal region of the peroxisomal membrane protein
PMP47 is essential for sorting to peroxisomes." J Cell Biol, 124:
915-25. [0396] 100. Cokol et al., 2000. "Finding nuclear
localization signals." EMBO Rep, 1: 411-5. [0397] 101. Helenius et
al., 2001. "Intracellular functions of N-linked glycans." Science,
291: 2364-9. [0398] 102. Emanuelsson et al., 2007. "
Locating proteins in the cell using TargetP, SignalP and related
tools." Nat Protoc, 2: 953-971. [0399] 103. Emanuelsson et al.,
2000. "Predicting subcellular localization of proteins based on
their N-terminal amino acid sequence." J Mol Biol, 300: 1005-1016.
[0400] 104. Bannai et al., 2002. "Extensive feature detection of
N-terminal protein sorting signals." Bioinformatics, 18: 298-305.
[0401] 105. Bendtsen et al., 2004. "Improved prediction of signal
peptides: SignalP 3.0." J Mol Biol, 340: 783-95. [0402] 106. Hiller
et al., 2004. "PrediSi: prediction of signal peptides and their
cleavage positions." Nucleic Acids Res, 32: W375-9. [0403] 107.
Bhasin et al., 2004. "ESLpred: SVM-based method for subcellular
localization of eukaryotic proteins using dipeptide composition and
PSI-BLAST." Nucleic Acids Res, 32: W414-9. [0404] 108. Garg et al.,
2005. "Support vector machine-based method for subcellular
localization of human proteins using amino acid compositions, their
order, and similarity search." J Biol Chem, 280: 14427-32. [0405]
109. Bhasin et al., 2005. "PSLpred: prediction of subcellular
localization of bacterial proteins." Bioinformatics, 21: 2522-4.
[0406] 110. Hoglund et al., 2006. "MultiLoc: prediction of protein
subcellular localization using N-terminal targeting sequences,
sequence motifs and amino acid composition." Bioinformatics, 22:
1158-65. [0407] 111. Shatkay et al., 2007. "SherLoc: high-accuracy
prediction of protein subcellular localization by integrating text
and protein sequence data." Bioinformatics, 23: 1410-7. [0408] 112.
Emanuelsson et al., 1999. "ChloroP, a neural network-based method
for predicting chloroplast transit peptides and their cleavage
sites." Protein Sci, 8: 978-984. [0409] 113. Claros et al., 1996.
"Computational method to predict mitochondrially imported proteins
and their targeting sequences." Eur J Biochem, 241: 779-86. [0410]
114. Small et al., 2004. "Predotar: A tool for rapidly screening
proteomes for N-terminal targeting sequences." Proteomics, 4:
1581-1590. [0411] 115. Kelley et al., 2000. "Enhanced genome
annotation using structural profiles in the program 3D-PSSM." J Mol
Biol, 299: 499-520. [0412] 116. Bilow et al., 1991. "Multienzyme
systems obtained by gene fusion." Trends Biotechnol, 9: 226-231.
[0413] 117. Seo et al., 2000. "Characterization of a bifunctional
enzyme fusion of trehalose-6-phosphate synthetase and
trehalose-6-phosphate phosphatase of Escherichia coli." Appl
Environ Microbiol, 66: 2484-2490. [0414] 118. Honjoh et al., 2009.
"Enhancement of menadione stress tolerance in yeast by accumulation
of hypotaurine and taurine: co-expression of cDNA clones, from
Cyprinus carpio, for cysteine dioxygenase and cysteine sulfinate
decarboxylase in Saccharomyces cerevisiae." Amino Acids, [Epub
ahead of print]. [0415] 119. Shahin 1985. "Totipotency of tomato
protoplasts." Theor Appl Genet, 69: 235-240. [0416] 120. Fromm et
al., 1985. "Expression of genes transferred into monocot and dicot
plant cells by electroporation." Proc Natl Acad Sci USA, 82:
5824-5828. [0417] 121. Fromm et al., 1986. "Stable transformation
of maize after gene transfer by electroporation." Nature, 319:
791-3. [0418] 122. Riggs et al., 1986. "Stable transformation of
tobacco by electroporation: evidence for plasmid concatenation."
Proc Natl Acad Sci USA, 83: 5602-5606. [0419] 123. D'Halluin et
al., 1992. "Transgenic maize plants by tissue electroporation."
Plant Cell, 4: 1495-1505. [0420] 124. Laursen et al., 1994.
"Production of fertile transgenic maize by electroporation of
suspension culture cells" Plant Mol Biol, 24: 51-61 [0421] 125.
Crossway et al., 1986. "Integration of foreign DNA following
microinjection of tobacco mesophyll protoplasts." Mol Gen Genet,
202: 179-185. [0422] 126. Griesbach 1983. "Protoplast
microinjection." Plant Mol Biol Report, 1: 32-37. [0423] 127.
Sporlein et al., 1991. "Lipofectin: direct gene transfer to higher
plants using cationic liposomes." Theor Appl Genet, 83: 1-5. [0424]
128. Ohgawara et al., 1983. "Uptake of liposome-encapsulated
plasmid DNA by plant protoplasts and molecular fate of foreign DNA"
Protoplasma, 116: 145-148. [0425] 129. Deshayes et al., 1985.
"Liposome-mediated transformation of tobacco mesophyll protoplasts
by an Escherichia coli plasmid." EMBO (Eur Mol Biol Organ) J, 4:
2731-7. [0426] 130. Christou et al., 1987. "Stable transformation
of soybean by electroporation and root formation from transformed
callus." Proc Natl Acad Sci USA, 84: 3962-3966. [0427] 131. Horsch
et al., 1985. "A simple and general method for transferring genes
into plants." Science, 227: 1229-1231. [0428] 132. Paszkowski et
al., 1984. "Direct gene transfer to plants." Embo J, 3: 2717-2722.
[0429] 133. Hooykaas-Van Slogteren et al., 1984. "Expression of Ti
plasmid genes in monocotyledonous plants infected with
Agrobacterium tumefaciens." Nature, 311: 763-764. [0430] 134.
Rogers 1986. "Gene transfer in plants: Production of transformed
plants using Ti-plasmid vectors." Methods Enzymol, 118: 627-640.
[0431] 135. Bevan et al., 1982. "T-DNA of the Agrobacterium Ti and
Ri plasmids." Annu Rev Genet, 16: 357-384. [0432] 136. Klein et
al., 1988. "Transfer of foreign genes into intact maize cells with
high-velocity microprojectiles." Proc Natl Acad Sci USA, 85:
4305-4309. [0433] 137. Klein et al., 1988. "Factors influencing
gene delivery into Zea mays cells by high-velocity
microprojectiles." Biotechnology, 6: 559-563. [0434] 138. McCabe et
al., 1988. "Stable transformation of soybean (Glycine max) by
particle acceleration." Biotechnology, 6: 923-926. [0435] 139.
Sanford et al., 1993. Optimizing the biolistic process for
different biological application. In Wu R, editor. The Methods in
Enzymology 483-509. Orlando: Academic Press. [0436] 140. Freeman et
al., 1984. "A comparison of methods for plasmid delivery into plant
protoplasts." Plant Cell Physiol, 25: 1353-1365. [0437] 141. Frame
et al., 1994. "Production of fertile transgenic maize plants by
silicon carbide whisker-mediated transformation." Plant J, 6:
941-948. [0438] 142. Thompson et al., 1995. "Maize transformation
utilizing silicon carbide whiskers: a review." Euphytica, 85:
75-80. [0439] 143. Guo et al., 1995. "Laser-mediated gene transfer
in rice." Physiol Plant, 93: 19-24. [0440] 144. Badr et al., 2005.
"Production of fertile transgenic wheat plants by laser
micropuncture." Photochem Photobiol Sci, 4: 803-807. [0441] 145.
Bao et al., 1997. "Transfection of a reporter plasmid into cultured
cells by sonoporation in vitro." Ultrasound in Medicine and
Biology, 23: 953-959. [0442] 146. Finer et al., 2000. "Use of
Agrobacterium expressing green fluorescent protein to evaluate
colonization of sonication-assisted Agrobacterium-mediated
transformation-treated soybean cotyledons." Lett Appl Microbiol,
30: 406-10. [0443] 147. Amoah et al., 2001. "Factors influencing
Agrobacterium-mediated transient expression of uidA in wheat
inflorescence tissue." J Exp Bot, 52: 1135-42. [0444] 148. Krens et
al., 1982. "In Vitro transformation of plant protoplasts with
Ti-plasmid DNA." Nature, 296: 72-74. [0445] 149. Bechtold et al.,
1998. "In planta Agrobacterium-mediated transformation of adult
Arabidopsis thaliana plants by vacuum infiltration." Methods Mol
Biol, 82: 259-66. [0446] 150. Broothaerts et al., 2005. "Gene
transfer to plants by diverse species of bacteria." Nature, 433:
629-633. [0447] 151. Kirk et al., 1993. Concise Encyclopedia of
Chemical Technology: John Wiley & Sons. [0448] 152. Mosbach et
al., 1983. "Formation of proinsulin by immobilized Bacillus
subtilis." Nature, 302: 543-545. [0449] 153. Chan et al., 1974.
"Structural uniqueness of lactose operator." Nature, 252: 205-209.
[0450] 154. Goeddel et al., 1980. "Synthesis of human fibroblast
interferon by E. coli" Nucleic Acids Res, 8: 4057-4074. [0451] 155.
Sherman et al., 1982. Methods in Yeast Genetics. New York: Cold
Spring Harbor Laboratory. [0452] 156. Sherman 1991. Getting started
with yeast. In Guthrie C & G R Fink, editors. Methods in
Enzymology, Guide to Yeast Genetics and Molecular Biology 3-21. New
York: Acad. Press. [0453] 157. Andersen et al., 1984. "Synthesis
and anticonvulsant properties of some 2-Aminoethanesulfonic acid
(Taurine) derivatives." J Pharm Sci, 73: 106-108. [0454] 158.
Herdeis et al., 1999. U.S. Pat. No. 5,889,183. [0455] 159. Tserng
et al., 1977. "An improved procedure for the synthesis of glycine
and taurine conjugates of bile acids." J Lipid Res, 18: 404-407.
[0456] 160. Fong et al., 1992. U.S. Pat. No. 5,128,419. [0457] 161.
Seeberger et al., 2007. "A new strategy for the synthesis of
taurine derivatives using the `safety-catch` principle for the
protection of sulfonic acids." Org Biomol Chem, 5: 132-138. [0458]
162. Suzuki et al., 2006. "Fabrication of TiO2 using L-lysine-based
organogelators as organic templates: control of the
nanostructures." Chem Commun377-379. [0459] 163. Mikhalenko et al.,
2004. "Phthalocyanines and related compounds: XXXVIII. Synthesis of
symmetric taurine- and choline-substituted phthalocyanines." Russ J
Gen Chem, 74: 1775-1800. [0460] 164. Capone et al., 2007.
"Designing nanosensors based on charged derivatives of Gramicidin
A." J Am Chem Soc, 129: 9737-9745. [0461] 165. Gupta et al., 2005.
"Taurine analogues; A new class of therapeutics: Retrospect and
prospects" Curr Med Chem, 12: 2021-2039. [0462] 166. Johnson 2008.
"Update on neuropharmacological treatments for alcoholism:
Scientific basis and clinical findings." Biochem Pharmacol, 75:
34-56. [0463] 167. Tambour et al., 2007. "Preclinical and clinical
pharmacology of alcohol dependence." Fundam Clin Pharmacol, 21:
9-28. [0464] 168. Joung et al., 2005. "Anticoagulant
supramolecular-structured polymers: Synthesis and anticoagulant
activity of taurine-conjugated carboxyethylester-polyrotaxanes."
Sci Technol Adv Mater, 6: 484-490. [0465] 169. Ozmeric et al.,
2000. "Chitosan film enriched with an antioxidant agent, taurine,
in fenestration defects." J Biomed Mater Res A, 51: 500-503. [0466]
170. Degim et al., 2002. "An investigation on skin wound healing in
mice with a taurinechitosan gel formulation." Amino Acids, 22:
187-198. [0467] 171. Matsusaki et al., 2002. "Novel functional
biodegradable polymer: Synthesis and anticoagulant activity of
poly(.gamma.-Glutamic Acid)sulfonate (.gamma.-PGA-sulfonate)."
Bioconjugate Chem, 13: 23-28. [0468] 172. Meinkoth et al., 1984.
"Hybridization of nucleic acids immobilized on solid supports."
Anal Biochem, 138: 267-284. [0469] 173. Tijssen 1993. Overview of
principles of hybridization and the strategy of nucleic acid probe
assays. Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes: Part I. New York:
Elsevier. [0470] 174. Smith et al., 1981. "Comparison of
biosequences." Adv Appl Math, 2: 482-489. [0471] 175. Needleman et
al., 1970. "A general method applicable to the search for
similarities in the amino acid sequence of two proteins." J Mol
Biol, 48: 443-453. [0472] 176. Pearson et al., 1988. "Improved
tools for biological sequence comparison." Proc Natl Acad Sci USA,
85: 2444-2448. [0473] 177. Higgins et al., 1989. "Fast and
sensitive multiple sequence alignments on a microcomputer." Comput
Appl Biosci, 5: 151-153. [0474] 178. Higgins et al., 1988.
"CLUSTAL: a package for performing multiple sequence alignment on a
microcomputer." Gene, 73: 237-244. [0475] 179. Higgins et al.,
1992. "CLUSTAL V: improved software for multiple sequence
alignment." Comput Appl Biosci, 8: 189-191. [0476] 180. Feng et
al., 1987. "Progressive sequence alignment as a prerequisite to
correct phylogenetic trees." J Mol Evol, 25: 351-360. [0477] 181.
Henikoff et al., 1989. "Amino acid substitution matrices from
protein blocks" Proc Natl Acad Sci USA, 89: 10915-10919. [0478]
182. Altschul et al., 1997. "Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs." Nucleic Acids Res,
25: 3389-3402. [0479] 183. Wootton et al., 1993. "Statistics of
local complexity in amino acid sequences and sequence databases."
Comput Chem, 17: 149-163. [0480] 184. Wootton et al., 1996.
"Analysis of compositionally biased regions in sequence databases."
Methods Enzymol, 266: 554-571. [0481] 185. Claverie et al., 1993.
"Information enhancement methods for large scale sequence
analysis." Comput Chem, 17: 191-201. [0482] 186. Myers et al.,
1988. "Optimal alignments in linear-space." Comput Appl Biol Sci,
4: 11-17.
[0483] All patents, patent applications, and references cited in
this disclosure are expressly incorporated herein by reference. The
above disclosure generally describes the present invention. A more
complete understanding can be obtained by reference to the
following specific examples, which are provided for purposes of
illustration only and are not intended to limit the scope of the
invention.
Example 1
Development of a Transgenic Plant that Constitutively Expresses COD
Using Fusion PCR
[0484] Step 1: Make a DNA Construct that Contains an AtTUB5
Promoter with a CDO Gene and a NOS Terminator in the Following
Manner.
[0485] Step 1a. Use PCR to amplify the AtTUB5 promoter (-1851 to -1
bps) with a short overlap for the 5' end of CDO at the 3' end of
the promoter using 500 ng of genomic DNA isolated from an
Arabidopsis thaliana Col-0. Add 300 nM of the following primers:
5'KpnTub5prom (5'-ttttggtacccacatttgcaaaatgatgaatg-3'; SEQ ID
NO:27) and Tub5CDO
(5'-catgacttcagtctgctccatccaatctggttaccgcattg-3'; SEQ ID NO:28).
Run the fusion PCR as described by Szewczyk et al. (45).
[0486] Step 1b: Use PCR to amplify the CDO gene from 500 ng of cDNA
from a zebrafish (Danio rerio) cDNA library. Add 300 nM of the
following primers: 5'CDO (5'-atggagcagactgaagtcatg-3'; SEQ ID
NO:29) and 3'CDO (5'-tcagttattctcctgcgagac-3'; SEQ ID NO:30). Run
the fusion PCR as described by Szewczyk et al. (45).
[0487] Step 1c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of CDO at the 5' end of the terminator using
500 ng of pPV1. Add 300 nM of the following primers CDONOS
(5'-gtctcgcaggagaataactgagctaccgagctcgaatttcc-3'; SEQ ID NO:31) and
3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32). Run the fusion
PCR as described by Szewczyk et al. (45).
[0488] Step 1d: Combine the amplified fragments from Example 3:
steps 1a, 1b, and 1c and 300 nM of the following primers GP2
(5'-ttttggtaccgtttacatatggagatgatgtc-3'; SEQ ID NO:33) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0489] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence. Digest the plasmid with
Acc65I and XbaI, isolate DNA fragment and ligate into the vector
pCAMBIA2300 that has been predigested with Acc65I and XbaI.
[0490] Step 1f. Transform the ligated vector containing the DNA
construct by electroporation into E. coli. Select for kanamycin (50
.mu.g/ml) resistance on LB plates. Confirm the presence of the DNA
constructs in the selected colonies by PCR analysis with the GP2
and GP5 primers using the following program: 96.degree. C. for 3
min followed by 25 cycles of 94.degree. C. for 30 seconds,
55.degree. C. for 30 seconds, 72.degree. C. for 5 min, and
72.degree. C. for 3 min. Grow a colony that contains the proper DNA
construct overnight at 37.degree. C. in 6 ml LB plus spectinomycin
(100 .mu.g/ml) or streptomycin (200 .mu.g/ml). Isolate the plasmid
DNA that contains the DNA construct by Wizard Plus SV Minipreps DNA
Purification System (Promega Corporation, Madison, Wis., USA).
Sequence the DNA insert to confirm its identity and the fidelity of
the DNA construct.
[0491] Step 2: Transform Agrobacterium tumefaciens
[0492] Independently transform the vector construct into
electrocompetent Agrobacterium tumefaciens EHA105, as described by
the Green Lab Protocol (http colon slash slash www dot bch dot msu
dot edu slash pamgreen slash green.htm). Select positive
transformants using Terrific Broth plus kanamycin (50 .mu.g/ml) on
1% agar plates. Confirm Agrobacterium colonies by PCR using the
following primers: GP2 and GP5. Run the following PCR reaction:
96.degree. C. for 5 min followed by 20 cycles of 94.degree. C. for
45 seconds, 60.degree. C. for 30 seconds, 70.degree. C. for 5 min,
and 72.degree. C. for 3 min.
[0493] Step 3: Transform Plant, Arabidopsis thaliana
[0494] Step 3a: Sow Arabidopsis (L.) Heynh. ecotype Columbia
(Col-0) seeds in 248 cm.sup.2 plastic pots with moistened soil
(Promix H P, Premier Horticulture Inc., Redhill, Pa., Canada). Grow
plants at 20-21.degree. C., with 60-70% relative humidity, under
cool white fluorescent lights (140 .mu.mol m.sup.-2 s.sup.-1) with
a 16 h light/8 h dark cycle. Water plants as needed by
subirrigation. After two weeks, transfer five individual plants to
smaller pots (72 cm.sup.2) for use in the transformation protocol.
Grow the plants until the first floral buds and flowers form (2-3
additional weeks).
[0495] Step 3b: Grow Agrobacterium, the construct to be
transformed, in 500 ml of Terrific Broth plus kanamycin (50
.mu.g/ml) for 2 days at 29.degree. C. Collect cells by
centrifugation at 6000 rpm for 15 minutes, and resuspend cells in
5% sucrose plus 0.05% surfactant (Silwet L-77, Lehle Seeds, Round
Rock, Tex., USA) solution.
[0496] Step 3c: Transform plants by the floral dip transformation
(144). Keep the plants in sealed containers to maintain high
humidity for 16 to 24 h and maintain plants as described in step 4a
above. At 8 to 10 weeks, dry the plants, collect the seeds, and
select for the marker in each line. Select for kanamycin resistance
for the AtTUB5::CDO constructs in pCAMBIA2300 by incubating seeds
on plates containing 4.418 g/L Murashige and Skoog Salt and Vitamin
Mixture (MS medium, Life Technologies, Grand Island, N.Y., USA)
plus kanamycin (50 .mu.g/ml) and 0.8% (wt vol) Phytagar. Collect
and transfer positively selected plants into pots containing soil
and grow for 5 to 6 weeks. Allow the plants to self-pollinate.
Collect the seeds and repeat the selection process until
homozygotes are identified.
Example 2
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) CDO and SAD Using Fusion PCR
[0497] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a CDO gene and a NOS terminator in the
following manner.
[0498] Step 1a: Use PCR to amplify the AtPHYB promoter (-1960 to -1
bps) with a short overlap for the 5' end of CDO at the 3' end using
500 ng of genomic DNA isolated from an Arabidopsis thaliana Col-0.
Add 300 nM of the following primers: 5'AtPHYB
(5'-caatgcctaataatgtctagc-3'; SEQ ID NO:35) and AtPHYBCDO
(5'-catgacttcagtctgctccatgccgtttg attttgaatttgag-3'; SEQ ID NO:36).
Run the fusion PCR as described by Szewczyk et al. (45).
[0499] Step 1b: Use the CDO gene that was amplified in Example 1:
Step 1b.
[0500] Step 1c: Use the NOS terminator with a short overlap for the
3' end of CDO at the 5' end of the NOS terminator that was
amplified in Example 1: Step 1c.
[0501] Step 1d: Combine the PCR fragments (Example 2: 1a, 1b, and
1c) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and GP5
(5'-tttttttt ctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0502] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and XbaI.
[0503] Step 2: Make a DNA construct that contains an AtPHYB
promoter with a SAD gene and a NOS terminator to in the following
manner.
[0504] Step 2a: Use PCR to amplify the AtPHYB promoter (-1960 to -1
bps) with a short overlap for the 5' end of SAD at the 3' end using
500 ng of genomic DNA isolated from an Arabidopsis thaliana Col-0.
Add 300 nM of the following primers: 5'AtPHYB
(5'-caatgcctaataatgtctagc-3'; SEQ ID NO:35) and AtPHYBSAD
(5'-cagcttcccatcagactcgtccatgc cgtttgattttgaatttgag-3'; SEQ ID
NO:38). Run the fusion PCR as described by Szewczyk et al.
(45).
[0505] Step 2b: Use PCR to amplify the SAD gene from 500 ng of cDNA
from a zebrafish (Danio rerio) cDNA library. Add 300 nM of the
following primers: 5'SAD (5'-atggacgagtctgatgggaagctg-3'; SEQ ID
NO:39) and 3'SAD (5'-tcatagatccttcccgagtttc-3'; SEQ ID NO:40). Run
the fusion PCR as described by Szewczyk et al. (45).
[0506] Step 2c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of SAD at the 5' end of the terminator using
500 ng of pPV1. Add 300 nM of the following primers SADNOS
(5'-gaaactcgggaaggatctatgagctaccgagctcgaatttcc-3'; SEQ ID NO:41)
and 3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32). Run the
fusion PCR as described by Szewczyk et al. (45).
[0507] Step 2d: Combine the PCR fragments (Example 2: 2a, 2b, and
2c) and 300 nM of the following primers IP2
(5'-aaaaatctagaattcttgaattacgattgtac-3'; SEQ ID NO:42) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0508] Step 2e: Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify the plasmid that contains the DNA construct
to confirm its identity and the fidelity of the sequence as
described in Example 1: step 1e.purify. Digest the plasmid with
XbaI and SalI, isolate DNA fragment and ligate into the vector
pCAMBIA2300 that has been predigested with XbaI and SalI.
[0509] Step 3: Ligate the AtPHYB promoter-CDO-NOS terminator
construct upstream of the AtPHYB promoter-SAD-NOS terminator
construct into a plant expression vector.
[0510] Step 3a. Digest the pCambia2300-AtPHYB promoter-CDO-NOS
terminator clone (from Example 4: Step 1e) with XmaI and XbaI,
isolate DNA insert and ligate it into the vector pCambia2300-AtPHYB
promoter-SAD-NOS terminator (from Example 4: Step 2e) that has been
predigested with XmaI and XbaI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0511] Step 4: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0512] Step 5: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 3
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) CDO and GAD Using Fusion PCR
[0513] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a CDO gene and a NOS terminator in the
following manner.
[0514] Step 1a: Use the AtPHYB promoter with a short overlap for
the 5' end of CDO at the 3' end that was amplified in Example 2:
Step 1a
[0515] Step 1b: Use the CDO gene that was amplified in Example 1:
Step 1b.
[0516] Step 1c: Use the NOS terminator with a short overlap for the
3' end of CDO at the 5' end of the NOS terminator that was
amplified in Example 1: Step 1c.
[0517] Step 1d: Combine the PCR fragments (Example 3: 1a, 1b, and
1c), run the PCR and the clone the amplified fragment as described
in Example 2: Step 1d.
[0518] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and XbaI.
[0519] Step 2: Make a DNA construct that contains an AtPHYB
promoter with a GAD gene and a NOS terminator to in the following
manner.
[0520] Step 2a: Use PCR to amplify the AtPHYB promoter (-1960 to -1
bps) with a short overlap for the 5' end of GAD at the 3' end using
500 ng of genomic DNA isolated from an Arabidopsis thaliana Col-0.
Add 300 nM of the following primers: 5'AtPHYB (5'-caatgcctaataa
tgtctagc-3'; SEQ ID NO:35) and AtPHYBGAD
(5'-cgttacttgcttcttatccatgccgttt gattttgaatttgag-3'; SEQ ID NO:44).
Run the fusion PCR as described by Szewczyk et al. (45).
[0521] Step 2b: Use PCR to amplify the GAD gene from 500 ng of DNA
from E. coli strain K12. Add 300 nM of the following primers: 5'GAD
(5'-atggataagaagcaagtaacg-3'; SEQ ID NO:45) and 3'GAD
(5'-tcaggtatgtttaaagctgttc-3'; SEQ ID NO:46). Run the fusion PCR as
described by Szewczyk et al. (45).
[0522] Step 2c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of GAD at the 5' end of the terminator using
500 ng of pPV1. Add 300 nM of the following primers GADNOS
(5'-gaacagctttaaacatacctgagctaccgagctcgaatttcc-3'; SEQ ID NO:47)
and 3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32). Run the
fusion PCR as described by Szewczyk et al. (45).
[0523] Step 2d: Combine the PCR fragments (Example 3: 2a, 2b, and
2c) and 300 nM of the following primers IP2
(5'-aaaaatctagaattcttgaattacgattgtacc-3'; SEQ ID NO:42) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0524] Step 2e: Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify the plasmid that contains the DNA construct
to confirm its identity and the fidelity of the sequence as
described in Example 1: step 1e.purify. Digest the plasmid with
XbaI and SalI, isolate DNA fragment and ligate into the vector
pCAMBIA2300 that has been predigested with XbaI and SalI.
[0525] Step 3: Ligate the AtPHYB promoter-CDO-NOS terminator
construct upstream of the AtPHYB promoter-GAD-NOS terminator
construct into a plant expression vector.
[0526] Step 3a. Digest the pCambia2300-AtPHYB promoter-CDO-NOS
terminator clone (from Example 4: Step 1e) with XmaI and XbaI,
isolate DNA insert and ligate it into the vector pCambia2300-AtPHYB
promoter-GAD-NOS terminator (from Example 4: Step 2e) that has been
predigested with XmaI and XbaI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0527] Step 4: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0528] Step 5: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 4
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGAD1 Promoter) ADO Using Fusion PCR
[0529] Step 1: Make a DNA construct that contains an AtGAD1 (Locus
ID# At5g17330) promoter with an ADO gene and a NOS terminator in
the following manner.
[0530] Step 1a: Use PCR to amplify the AtGAD1 promoter (-1732 to -1
bps) with a short overlap for the 5' end of ADO at the 3' end of
the promoter using 500 ng of genomic DNA isolated from an
Arabidopsis thaliana Col-0. Add 300 nM of the following primers:
5'AtGAD1 (5'-accaaaggataccctgatttg-3'; SEQ ID NO:48) and AtGAD1ADO
(5'-gattttctggactgtggaagtcatc acggagatgagagagagag-3'; SEQ ID
NO:49). Run the fusion PCR as described by Szewczyk et al.
(45).
[0531] Step 1b: Use PCR to amplify the ADO gene from 500 ng of cDNA
from a zebrafish (Danio rerio) cDNA library. Add 300 nM of the
following primers: 5'ADO (5'-atgacttccacag tccagaaaatc-3'; SEQ ID
NO:50) and 3'ADO (5'-tcagagggtcactttaggc-3'; SEQ ID NO:51). Run the
fusion PCR as described by Szewczyk et al. (45).
[0532] Step 1c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of ADO at the 5' end of the terminator using
500 ng of pPV1. Add 300 nM of the following primers ADONOS
(5'-gcctaaagtgaccctctgagctaccgagctcgaatttcc-3'; SEQ ID NO:52) and
3'NOS (5'-cacg acgttgtaaaacgacggc-3'; SEQ ID NO:32). Run the fusion
PCR as described by Szewczyk et al. (45).
[0533] Step 1d: Combine the amplified fragments (Example 4: steps
1a, 1b, and 1c) and 300 nM of the following primers JP2
(5'-aaaaaggtaccgatatttgagcaaaactgtgg-3'; SEQ ID NO:30) and GP5
(5'-tttttttTCTAGAgatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0534] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0535] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0536] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0537] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 5
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGAD2 Promoter) TPAT Using Fusion PCR
[0538] Step 1: Make a DNA construct that contains an AtGAD2 (Locus
ID# At1g65960) promoter with a TPAT gene and a NOS terminator in
the following manner.
[0539] Step 1a: Use PCR to amplify the AtGAD2 promoter (-1714 to -1
bps) with a short overlap for the 5' end of TPAT at the 3' end
using 500 ng of genomic DNA isolated from an Arabidopsis thaliana
Col-0. Add 300 nM of the following primers: 5'AtGAD2
(5'-tcttaccttgtcctgcaacgag-3'; SEQ ID NO:54) and AtGAD2TPAT
(5'-cattgaaattgccgtccatctttgttt ctgtttagtgaaag-3'; SEQ ID NO:55).
Run the fusion PCR as described by Szewczyk et al. (45).
[0540] Step 1b: Use PCR to amplify the TPAT gene from 500 ng of DNA
from Roseobacter denitrificans strain. Add 300 nM of the following
primers: 5'TPAT (5'-atggacggcaatttcaatg-3'; SEQ ID NO:56) and
3'TPAT (5'-ttagccgaaaacgcgcgacag-3'; SEQ ID NO:57). Run the fusion
PCR as described by Szewczyk et al. (45).
[0541] Step 1c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of TPAT at the 5' end of the terminator
using 500 ng of pPV1. Add 300 nM of the following primers TPATNOS
(5'-ctgtcgcgcgttttcggctaagctaccgagctcgaatttcc-3'; SEQ ID NO:58) and
3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32). Run the fusion
PCR as described by Szewczyk et al. (45).
[0542] Step 1d: Combine the amplified fragments (Example 5: steps
1a, 1b, and 1c) and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0543] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0544] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0545] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0546] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 6
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGAD2 Promoter) TPAT and SA Using Fusion PCR
[0547] Step 1: Make a DNA construct that contains an AtGAD2 (Locus
ID#) promoter with a TPAT gene and a NOS terminator in the
following manner.
[0548] Step 1a: Use the AtGAD2 promoter that was amplified in
Example 5: Step 1b
[0549] Step 1b: Use the TPAT gene that was amplified in Example 5:
Step 1b.
[0550] Step 1c: Use the NOS terminator with a short overlap for the
3' end of TPAT at the 5' end of the NOS terminator that was
amplified in Example 5: Step 1c.
[0551] Step 1d: Combine the PCR fragments (Example 5: 1a, 1b, and
1c), run the PCR and the clone the amplified fragment as described
in Example 5: Step 1d.
[0552] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0553] Step 2: Make a DNA construct that contains an AtGAD2
promoter with a SA gene and a NOS terminator to in the following
manner.
[0554] Step 2a: Use PCR to amplify the AtGAD2 promoter (-1960 to -1
bps) with a short overlap for the 5' end of SA at the 3' end using
500 ng of genomic DNA isolated from an Arabidopsis thaliana Col-0.
Add 300 nM of the following primers: 5'AtGAD2
(5'-cttaccttgtcctgcaacgag-3'; SEQ ID NO:54) and AtGAD2SA
(5'-cttcagtggtcattttcatctttgtttctgtttag tgaaag-3'; SEQ ID NO:60).
Run the fusion PCR as described by Szewczyk et al. (45).
[0555] Step 2b: Use PCR to amplify the SA gene from 500 ng of DNA
from Roseobacter denitrificans. Add 300 nM of the following
primers: 5'SA (5'-atgaaaatgaccactgaag-3'; SEQ ID NO:61) and 3'SA
(5'-tcagacagtctgtggacgc-3'; SEQ ID NO:62). Run the fusion PCR as
described by Szewczyk et al. (45).
[0556] Step 2c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of SA at the 5' end of the terminator using
500 ng of pPV1. Add 300 nM of the following primers SANOS
(5'-gcgtccacagactgtctgagctaccgagctcgaatttcc-3'; SEQ ID NO:63) and
3'NOS; 5'-cacga cgttgtaaaacgacggc-3' SEQ ID NO:32). Run the fusion
PCR as described by Szewczyk et al. (45).
[0557] Step 2d: Combine the PCR fragments (Example 6: 2a, 2b, and
2c) and 300 nM of the following primers LP2
(5'-tttttctagagaacgagcttcaacgtagcc-3'; SEQ ID NO:64) and LP5
(5'-aaaaa aagcttgatctagtaacatagatgacac-3'; SEQ ID NO:65). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0558] Step 2e: Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify the plasmid that contains the DNA construct
to confirm its identity and the fidelity of the sequence as
described in Example 1: step 1e.purify. Digest the plasmid with
XbaI and HindIII, isolate DNA fragment and ligate into the vector
pCAMBIA2300 that has been predigested with XbaI and HindIII.
[0559] Step 3: Ligate the AtGAD2 promoter-TPAT-NOS terminator
construct upstream of the AtGAD2 promoter-SA-NOS terminator
construct into a plant expression vector.
[0560] Step 3a. Digest the pCambia2300-AtGAD2 promoter-TPAT-NOS
terminator clone (from Example 4: Step 1e) with Acc65I and XbaI,
isolate DNA insert and ligate it into the vector pCambia2300-AtGAD2
promoter-SA-NOS terminator (from Example 6: Step 2e) that has been
predigested with Acc65I and XbaI. Transform the DNA construct into
E. coli, select for antibiotic resistance and confirm the presence
of the DNA construct with PCR or by restriction digest
analysis.
[0561] Step 4: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0562] Step 5: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 7
Development of a Transgenic Plant that that Non-Constitutively
Expresses (AtGLR1.1 Promoter) ssTDeHase and lsTDeHase Using Fusion
PCR
[0563] Step 1: Make a DNA construct that contains an AtGLR1.1
(Locus ID # At3g04110) promoter with a ssTDeHase gene and a NOS
terminator in the following manner.
[0564] Step 1a: Use PCR to amplify the glutamate receptor 1.1
promoter (-1400 to -1 bps) with a short overlap for the 5' end of
ssTDeHase at the 3' end using 500 ng of genomic DNA isolated from
an Arabidopsis thaliana Col-0. Add 300 nM of the following primers:
5'AtGLR1.1 (5'-gatcatacatattcatacttgatg-3'; SEQ ID NO:66) and
AtGLR1.1ssTDeHase (5'-gagctgtcagtgttttggt
catataatttcttgtatagctctgtaac-3'; SEQ ID NO:67). Run the fusion PCR
as described by Szewczyk et al. (45).
[0565] Step 1b: Use PCR to amplify the ssTDeHase gene from 500 ng
of DNA from Roseobacter denitrificans. Add 300 nM of the following
primers: 5'ssTDeHase (5'-atgaccaaaacactgacagctc-3'; SEQ ID NO:68)
and 3'ssTDeHase (5'-ttaagccttgaagggcgggc-3'; SEQ ID NO:69). Run the
fusion PCR as described by Szewczyk et al. (45).
[0566] Step 1c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of ssTDeHase at the 5' end of the terminator
using 500 ng of pPV1. Add 300 nM of the following primers
ssTDeHaseNOS (5'-gcccgcccttcaaggcttaagctaccgagctcgaatttcc-3'; SEQ
ID NO:70) and 3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32).
Run the fusion PCR as described by Szewczyk et al. (45).
[0567] Step 1d: Combine the PCR fragments (Example 7: 1a, 1b, and
1c) and 300 nM of the following primers MP2
(5'-ttttggtacccgaagctcaatcgtctcgag-3'; SEQ ID NO:71) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0568] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI
[0569] Step 2: Make a DNA construct that contains an AtGLR1.1
promoter with a lsTDeHase gene and a NOS terminator to in the
following manner.
[0570] Step 2a: Use PCR to amplify the AtGLR1.1 promoter (-1714 to
-1 bps) with a short overlap for the 5' end of lsTDeHase at the 3'
end of the promoter using 500 ng of genomic DNA isolated from an
Arabidopsis thaliana Col-0. Add 300 nM of the following primers:
5'AtGLR1.1 (5'-gatcatacatattcatacttgatg-3'; SEQ ID NO:66) and
AtGLR1.1-lsTDeHase (5'-gtgctttggtctatgtggc
atataatttcttgtatagctctgtaac-3'; SEQ ID NO:72). Run the fusion PCR
as described by Szewczyk et al. (45).
[0571] Step 2b: Use PCR to amplify the lsTDeHase gene from 500 ng
of DNA from Roseobacter denitrificans. Add 300 nM of the following
primers: 5'lsTDeHase (5'-atgccacat agaccaaagcac-3'; SEQ ID NO:73)
and 3'lsTDeHase (5'-tcagagaatttcatcgcgaag-3'; SEQ ID NO:74). Run
the fusion PCR as described by Szewczyk et al. (45).
[0572] Step 2c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of lsTDeHase at the 5' end of the terminator
using 500 ng of pPV1. Add 300 nM of the following primers
lsTDeHaseNOS (5'-cttcgcgatgaaattctctgagctaccgagctcgaatttcc-3'; SEQ
ID NO:75) and 3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32).
Run the fusion PCR as described by Szewczyk et al. (45).
[0573] Step 2d: Combine the PCR fragments (Example 7: 2a, 2b, and
2c) and 300 nM of the following primers NP2
(5'-aaaaatctagacgaagctcaatcgtctcgag-3'; SEQ ID NO:76) and LP5
(5'-aaaaaaagcttgatctagtaacatagatgacac-3'; SEQ ID NO:65). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0574] Step 2e: Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify the plasmid that contains the DNA construct
to confirm its identity and the fidelity of the sequence as
described in Example 1: step 1e.purify. Digest the plasmid with
XbaI and HindIII, isolate the DNA fragment and ligate into the
vector pCAMBIA2300 that has been predigested with XbaI and
HindIII.
[0575] Step 3: Ligate the AtGLR1.1 promoter-ssTDeHase-NOS
terminator construct upstream of the AtGLR1.1
promoter-lsTDeHase-NOS terminator construct into a plant expression
vector.
[0576] Step 3a. Digest the pCambia2300-AtGLR1.1
promoter-ssTDeHase-NOS terminator clone (from Example 4: Step 1e)
with Acc65I and XbaI, isolate DNA insert and ligate it into the
vector pCambia2300-AtGLR1.1 promoter-lsTDeHase-NOS terminator (from
Example 4: Step 2e) that has been predigested with Acc65I and XbaI.
Transform the DNA construct into E. coli, select for antibiotic
resistance and confirm the presence of the DNA construct with PCR
or by restriction digest analysis.
[0577] Step 4: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0578] Step 5: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 8
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtSULTR1;3 Promoter) TDO Using Fusion PCR
[0579] Step 1: Make a DNA construct that contains an 5'AtSULTR1;3
promoter with a TDO gene and a NOS terminator in the following
manner.
[0580] Step 1a: Use PCR to amplify the AtSULTR1;3 promoter (-2406
to -1 bps) with a short overlap for the 5' end of TDO at the 3' end
using 500 ng of genomic DNA isolated from an Arabidopsis thaliana
Col-0. Add 300 nM of the following primers: 5'AtSULTR1;3
(5'-tcacaatc gatggactctc-3'; SEQ ID NO:77) and 5'AtSULTR1;3 TDO
(5'-gtaatgctcagacgttcactcattgctatgtgtg ttttgtagc-3'; SEQ ID NO:78).
Run the fusion PCR as described by Szewczyk et al. (45).
[0581] Step 1b: Use PCR to amplify the TDO gene from 500 ng of DNA
from E. coli strain K12. Add 300 nM of the following primers: 5'TDO
(5'-atgagtgaacgtctgagcattac-3'; SEQ ID NO:79) and 3'TDO
(5'-ttaccccgcccgataaaacg-3'; SEQ ID NO:80). Run the fusion PCR as
described by Szewczyk et al. (45).
[0582] Step 1c: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of ADO at the 5' end of the terminator using
500 ng of pPV1. Add 300 nM of the following primers TDONOS
(5'-cgttttatcgggcggggtaagctaccgagctcgaatttcc-3'; SEQ ID NO:81) and
3'NOS (5'-cacgacgttgtaaaacgacggc-3'; SEQ ID NO:32). Run the fusion
PCR as described by Szewczyk et al. (45).
[0583] Step 1d: Combine the amplified fragments from Example 3:
steps 1a, 1b, and 1c and 300 nM of the following primers OP2
(5'-ttttggtaccctatattggtgtcattttgcc-3'; SEQ ID NO:82) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0584] Step 1e. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0585] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0586] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0587] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 9
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) CDO Fused in-Frame with SAD (without a Linker)
Using Fusion PCR
[0588] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a CDO gene fused in-frame with a SAD
gene and a NOS terminator in the following manner.
[0589] Step 1a: Use the AtPHYB promoter (-1960 to -1 bps) with a
short overlap for the 5' end of CDO at the 3' end that was
amplified in Example 2: Step 1a.
[0590] Step 1b: Use the CDO gene that was amplified in Example 1:
Step 1b.
[0591] Step 1c: Use PCR to amplify the SAD gene with a short
overlap for the 3' end of CDO at the 5' end using 500 ng of cDNA
from a zebrafish (Danio rerio) cDNA library. Add 300 nM of the
following primers: CDO/SAD
(5'-gagcgtctcgcaggagaataacatggacgagtctgatgggaagctg-3'; SEQ ID
NO:83) and 3'SAD (5'-tcatagatccttcccgagtttc-3'; SEQ ID NO:40). Run
the fusion PCR as described by Szewczyk et al. (45).
[0592] Step 1d: Use the NOS terminator with a short overlap for the
3' end of SAD at the 5' end of the NOS terminator that was
amplified in Example 2: Step 2c.
[0593] Step 1e: Combine the PCR fragments (Example 9: 1a, 1b, 1c,
and 1d) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0594] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and SalI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and SalI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0595] Step 2: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0596] Step 3: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 10
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) CDO Fused in-Frame with a Linker to SAD Using
Fusion PCR
[0597] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a CDO gene fused in-frame with a
linker and the SAD gene and a NOS terminator in the following
manner.
[0598] Step 1a: Use the AtPHYB promoter (-1960 to -1 bps) with a
short overlap for the 5' end of CDO at the 3' end that was
amplified in Example 2: Step 1a.
[0599] Step 1b: Use the CDO gene that was amplified in Example 1:
Step 1b.
[0600] Step 1c: Use PCR to amplify the SAD gene with a short
overlap for the 3' end of CDO at the 5' end using 500 ng of cDNA
from a zebrafish (Danio rerio) cDNA library. Add 300 nM of the
following primers: CDOlinkerSAD
(5'-gagcgtctcgcaggagaataacagtactgaaggcgaagtta
acgcggaagaagaaggctttatggacgagtctgatgggaagctg-3'; SEQ ID NO:84) and
3'SAD (5'-tcatag atccttcccgagtttc-3'; SEQ ID NO:40). Run the fusion
PCR as described by Szewczyk et al. (45).
[0601] Step 1d: Use the NOS terminator with a short overlap for the
3' end of SAD at the 5' end of the NOS terminator that was
amplified in Example 2: Step 2c.
[0602] Step 1e: Combine the PCR fragments (Example 10: 1a, 1b, 1c,
and 1d) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0603] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and SalI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and SalI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0604] Step 2: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0605] Step 3: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 11
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) SAD Fused in-Frame with CDO with Linker Using
Fusion PCR
[0606] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a SAD gene fused in-frame with a CDO
gene with a linker and a NOS terminator in the following
manner.
[0607] Step 1a: Use the AtPHYB promoter (-1960 to -1 bps) with a
short overlap for the 5' end of SAD at the 3' end that was
amplified in Example 2: Step 2a.
[0608] Step 1b: Step Use the SAD gene that was amplified in Example
2: Step 2b.
[0609] Step 1c: Use PCR to amplify the CDO gene with a linker and
short overlap for the SAD at the 3' using 500 ng of cDNA from a
zebrafish (Danio rerio) cDNA library. Add 300 nM of the following
primers: SADlinkerCDO
(5'-gaaactcgggaaggatctaagtactgaaggcgaagttaacgcggaag
aagaaggctttatggagcagactgaagtcatg-3'; SEQ ID NO:85 and 3'CDO
(5'-tcagttattctcctgcgagac-3'; SEQ ID NO:30). Run the fusion PCR as
described by Szewczyk et al. (45).
[0610] Step 1d: Use the NOS terminator with a short overlap for the
3' end of CDO at the 5' end of the NOS terminator that was
amplified in Example 1: Step 1c.
[0611] Step 1e: Combine the PCR fragments (Example 11: 1a, 1b, 1c,
and 1d) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0612] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and XbaI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0613] Step 2: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0614] Step 3: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 12
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) CDO Fused in-Frame with GAD (without a Linker)
Using Fusion PCR
[0615] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a CDO gene fused in-frame with a GAD
gene and a NOS terminator in the following manner.
[0616] Step 1a: Use the AtPHYB promoter (-1960 to -1 bps) with a
short overlap for the 5' end of CDO at the 3' end that was
amplified in Example 2: Step 1a.
[0617] Step 1b: Use the CDO gene that was amplified in Example 1:
Step 1b.
[0618] Step 1c: Use PCR to amplify the GAD gene with a short
overlap for the 3' end of CDO at the 5' end using from 500 ng of
DNA from E. coli strain K12. Add 300 nM of the following primers:
CDO/GAD (5'-gagcgtctcgcaggagaataacAtggataagaagcaagtaacg-3'; SEQ ID
NO:86) and 3'GAD (5'-tcaggtatgtttaaagctgttc-3'; SEQ ID NO:46). Run
the fusion PCR as described by Szewczyk et al. (45).
[0619] Step 1d: Use the NOS terminator with a short overlap for the
3' end of GAD at the 5' end of the NOS terminator that was
amplified in Example 3: Step 2c.
[0620] Step 1e: Combine the PCR fragments (Example 12: 1a, 1b, 1c,
and 1d) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0621] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and SalI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and SalI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0622] Step 2: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0623] Step 3: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 13
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) CDO Fused in-Frame with a Linker to GAD Using
Fusion PCR
[0624] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a CDO gene fused in-frame with a
linker and the GAD gene and a NOS terminator in the following
manner.
[0625] Step 1a: Use the AtPHYB promoter (-1960 to -1 bps) with a
short overlap for the 5' end of CDO at the 3' end that was
amplified in Example 2: Step 1a.
[0626] Step 1b: Use the CDO gene that was amplified in Example 1:
Step 1b.
[0627] Step 1c: Use PCR to amplify the GAD gene with a short
overlap for the 3' end of CDO at the 5' end using 500 ng of DNA
from E. coli strain K12. Add 300 nM of the following primers:
CDOlinkerGAD
(5'-gagcgtctcgcaggagaataacagtactgaaggcgaagttaacgcggaagaagaaggcttt
atggataagaagcaagtaacg-3'; SEQ ID NO:87) and 3'GAD
(5'-tcaggtatgtttaaagctgttc-3'; SEQ ID NO:46). Run the fusion PCR as
described by Szewczyk et al. (45).
[0628] Step 1d: Use the NOS terminator with a short overlap for the
3' end of GAD at the 5' end of the NOS terminator that was
amplified in Example 3: Step 2c.
[0629] Step 1e: Combine the PCR fragments (Example 13: 1a, 1b, 1c,
and 1d) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0630] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and SalI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and SalI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0631] Step 2: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0632] Step 3: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 14
Development of a Transgenic Plant that Constitutively Expresses
(AtPHYB Promoter) GAD Fused in-Frame with a Linker to CDO Using
Fusion PCR
[0633] Step 1: Make a DNA construct that contains an AtPHYB (Locus
ID# At2g18790) promoter with a GAD gene fused in-frame with a
linker and the CDO gene and a NOS terminator in the following
manner.
[0634] Step 1a: Use the AtPHYB promoter (-1960 to -1 bps) with a
short overlap for the 5' end of GAD at the 3' end that was
amplified in Example 3: Step 2a.
[0635] Step 1b: Step Use the GAD gene that was amplified in Example
3: Step 2b.
[0636] Step 1c: Use PCR to amplify the GAD gene with a linker and
short overlap for the CDO at the 3' using 500 ng of cDNA from a
zebrafish (Danio rerio) cDNA library. Add 300 nM of the following
primers: GADlinkerCDO
(5'-gaacagctttaaacataccagtactgaaggcgaagttaacgc
ggaagaagaaggctttatggagcagactgaagtcatg-3'; SEQ ID NO:88) and 3'GAD
(5'-tcaggtatgtttaaagct gttc-3'; SEQ ID NO:46). Run the fusion PCR
as described by Szewczyk et al. (45).
[0637] Step 1d: Use the NOS terminator with a short overlap for the
3' end of CDO at the 5' end of the NOS terminator that was
amplified in Example 1: Step 1c.
[0638] Step 1e: Combine the PCR fragments (Example 14: 1a, 1b, 1c,
and 1d) and 300 nM of the following primers HP2
(5'-ttttcccgggattcttgaattacgattgtacc-3'; SEQ ID NO:37) and IP5
(5'-tttttttgtcgacgatctagtaacatagatgacac-3'; SEQ ID NO:43). Run the
fusion PCR as described by Szewczyk et al. (45). Clone into
pCR4.0-TOPO as described by the manufacturer (Invitrogen).
[0639] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with XmaI and SalI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with XmaI and SalI. Transform the DNA construct into E.
coli, select for antibiotic resistance and confirm the presence of
the DNA construct with PCR or by restriction digest analysis.
[0640] Step 2: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0641] Step 3: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 15
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGAD2 Promoter) SA Fused in-Frame to TPAT Using Fusion PCR
[0642] Step 1: Make a DNA construct that contains an AtGAD2 (Locus
ID# At1g65960) promoter with a SA gene fused in-frame with a TPAT
gene and a NOS terminator in the following manner.
[0643] Step 1a: Use the AtGAD2 promoter (-1714 to -1 bps) with a
short overlap for the 5' end of SA at the 3' end that was amplified
in Example 6: Step 2a.
[0644] Step 1b: Step Use the SA gene that was amplified in Example
6: Step 2b.
[0645] Step 1c: Use PCR to amplify the TPAT gene with a short
overlap for the 3'end of SA at the 5'end using 500 ng of DNA from
Roseobacter denitrificans strain. Add 300 nM of the following
primers: SA/TPAT (5'-catgcgtccacagactgtcatggacggcaatttcaatg-3'; SEQ
ID NO:89) and 3'TPAT (5'-ttagccgaaaacgcgcgacag-3'; SEQ ID NO:57).
Run the fusion PCR as described by Szewczyk et al. (45).
[0646] Step 1d: Use the NOS terminator with a short overlap for the
3' end of TPAT at the 5' end of the NOS terminator that was
amplified in Example 5: Step 1c.
[0647] Step 1e: Combine the amplified fragments (Example 15: steps
1a, 1b, 1c and 1d) and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0648] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0649] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0650] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0651] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 16
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGAD2 Promoter) SA Fused in-Frame with a Linker to TPAT Using
Fusion PCR
[0652] Step 1: Make a DNA construct that contains an AtGAD2 (Locus
ID# At1g65960) promoter with a SA gene fused in-frame with a linker
to a TPAT gene and a NOS terminator in the following manner.
[0653] Step 1a: Use the AtGAD2 promoter (-1714 to -1 bps) with a
short overlap for the 5' end of SA at the 3' end that was amplified
in Example 6: Step 2a.
[0654] Step 1b: Use the SA gene that was amplified in Example 6:
Step 2b.
[0655] Step 1c: Use PCR to amplify the TPAT gene with a linker and
short overlap for the 3'end of SA at the 5'end using 500 ng of DNA
from Roseobacter denitrificans strain. Add 300 nM of the following
primers: SAlinkerTPAT (5'-catgcgtccacagactgtcagtactgaaggcga
agttaacgcggaagaagaaggctttatggacggcaatttcaatg-3'; SEQ ID NO:90) and
3'TPAT (5'-ttagccgaa aacgcgcgacag-3'; SEQ ID NO:57). Run the fusion
PCR as described by Szewczyk et al. (45).
[0656] Step 1d: Use the NOS terminator with a short overlap for the
3' end of TPAT at the 5' end of the NOS terminator that was
amplified in Example 5: Step 1c.
[0657] Step 1e: Combine the amplified fragments (Example 16: steps
1a, 1b, 1c and 1d) 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0658] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0659] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0660] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0661] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 17
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGAD2 Promoter) TPAT Fused in-Frame with a Linker to a SA Gene
Using Fusion PCR
[0662] Step 1: Make a DNA construct that contains an AtGAD2 (Locus
ID# At1g65960) promoter with a TPAT gene fused in-frame with a
linker to a SA gene and a NOS terminator in the following
manner.
[0663] Step 1a: Use the AtGAD2 promoter (-1714 to -1 bps) with a
short overlap for the 5' end of TPAT at the 3' end that was
amplified in Example 5: Step 1a.
[0664] Step 1b: Use the TPAT gene that was amplified in Example 5:
Step 1b.
[0665] Step 1c: Use PCR to amplify the SA with a short overlap for
the 3' end of TPAT with a linker at the 5' end using 500 ng of DNA
from Roseobacter denitrificans strain. Add 300 nM of the following
primers: TPATlinkerSA
(5'-cgctgtcgcgcgttttcggcagtactgaaggcgaagttaacgcggaa
gaagaaggctttatgaaaatgaccactgaag-3'; SEQ ID NO:91) and 3'SA
(5'-tcagacagtctgtggacgc-3'; SEQ ID NO:62). Run the fusion PCR as
described by Szewczyk et al. (45).
[0666] Step 1d: Use PCR to amplify the NOS terminator with a short
overlap for the 3' end of SA that was amplified in Example 6:
Step2c.
[0667] Step 1e: Combine the amplified fragments (Example 17: steps
1a, 1b, 1c and 1d) and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0668] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0669] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0670] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0671] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 18
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGLR1.1 Promoter) ssTDeHase Fused in-Frame with lsTDeHase
(without a Linker) Using Fusion PCR
[0672] Step 1: Make a DNA construct that contains an AtGLR1.1
(Locus ID # At3g04110) promoter with a ssTDeHase gene fused
in-frame with a lsTDeHase gene and a NOS terminator in the
following manner.
[0673] Step 1a: Use the AtGLR1.1 promoter (-1960 to -1 bps) with a
short overlap for the 5' end of ssTDeHase at the 3' end that was
amplified in Example 7: Step 1a.
[0674] Step 1b: Use the ssTDeHase gene that was amplified in
Example 7: Step 1b.
[0675] Step 1c: Use PCR to amplify the lsTDeHase gene with a short
overlap for the 3' end of ssTDeHase at the 5' end using of DNA from
Roseobacter denitrificans. Add 300 nM of the following primers:
ssTDeHase/lsTDeHase (5'-gcccgcccttcaaggctatgccacatagaccaaagcac-3';
SEQ ID NO:92) and 3'lsTDeHase (5'-tcagagaatttcatcgcgaag-3'; SEQ ID
NO:74). Run the fusion PCR as described by Szewczyk et al.
(45).
[0676] Step 1d: Use the NOS terminator with a short overlap for the
3' end of lsTDeHase at the 5' end of the NOS terminator that was
amplified in Example 7: Step 2c.
[0677] Step 1e: Combine the amplified fragments (Example 18: steps
1a, 1b, 1c and 1d) and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0678] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0679] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0680] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0681] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 19
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGLR1.1 Promoter) ssTDeHase Fused in-Frame with a Linker to
lsTDeHase Using Fusion PCR
[0682] Step 1: Make a DNA construct that contains an AtGLR1.1
(Locus ID # At3g04110) promoter with a ssTDeHase gene fused
in-frame with a linker and the lsTDeHase gene and a NOS terminator
in the following manner.
[0683] Step 1a: Use the AtGLR1.1 promoter (-1960 to -1 bps) with a
short overlap for the 5' end of ssTDeHase at the 3' end that was
amplified in Example 7: Step 1a.
[0684] Step 1b: Use the ssTDeHase gene that was amplified in
Example 7: Step 1b.
[0685] Step 1c: Use PCR to amplify the lsTDeHase gene with a short
overlap for the 3' end of ssTDeHase at the 5' end using of DNA from
Roseobacter denitrificans. Add 300 nM of the following primers:
ssTDeHaselinkerlsTDeHase
(5'-gcccgcccttcaaggctagtactgaaggcgaagttaacgc
ggaagaagaaggctttatgccacatagaccaaagcac-3'; SEQ ID NO:93) and
3'lsTDeHase (5'-tcagaga atttcatcgcgaag-3'; SEQ ID NO:74). Run the
fusion PCR as described by Szewczyk et al. (45).
[0686] Step 1d: Use the NOS terminator with a short overlap for the
3' end of lsTDeHase at the 5' end of the NOS terminator that was
amplified in Example 7: Step 2c.
[0687] Step 1e: Combine the amplified fragments (Example 19: steps
1a, 1b, 1c and 1d) and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0688] Step 1f. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0689] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0690] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0691] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Example 20
Development of a Transgenic Plant that Non-Constitutively Expresses
(AtGLR1.1 Promoter) lsTDeHase Fused in-Frame with a Linker to
ssTDeHase Using Fusion PCR
[0692] Step 1: Make a DNA construct that contains an AtGLR1.1
(Locus ID # At3g04110) promoter with a lsTDeHase gene fused
in-frame with a linker and the ssTDeHase gene and a NOS terminator
in the following manner.
[0693] Step 1a: Use the AtGLR1.1 promoter (-1960 to -1 bps) with a
short overlap for the 5' end of lsTDeHase at the 3' end that was
amplified in Example 7: Step 2a.
[0694] Step 1b: Use the lsTDeHase gene that was amplified in
Example 7: Step 2b.
[0695] Step 1c: Use PCR to amplify the lsTDeHase gene with a short
overlap for the 3' end of ssTDeHase at the 5' end using of DNA from
Roseobacter denitrificans. Add 300 nM of the following primers:
lsTDeHaselinkerssTDeHase
(5'-cttcgcgatgaaattctcagtactgaaggcgaagttaacgc
ggaagaagaaggctttatgaccaaaacactgacagctc-3'; SEQ ID NO:94) and
3'ssTDeHase (5'-ttaagccttg aagggcgggc-3'; SEQ ID NO:69). Run the
fusion PCR as described by Szewczyk et al. (45).
[0696] Step 1d: Use the NOS terminator with a short overlap for the
3' end of ssTDeHase at the 5' end of the NOS terminator that was
amplified in Example 7: Step 1c.
[0697] Step 1e: Combine the amplified fragments (Example 3: steps
1a, 1b, 1c and 1d) and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0698] Step 1f: Combine the amplified fragments from Example 20:
steps 1a, 1b, 1c and 1d and 300 nM of the following primers KP2
(5'-ttttggtaccctctttcggaacgagcttcaac-3'; SEQ ID NO:59) and GP5
(5'-ttttttttctagagatctagtaacatagatgacac-3'; SEQ ID NO:34). Run the
fusion PCR as described by Szewczyk et al. (45). Clone the
amplified DNA fragment into pCR4.0-TOPO as described by the
manufacturer (Invitrogen).
[0699] Step 1g. Transform E. coli, select for antibiotic
resistance, conduct PCR identification of cloned DNA constructs in
transformants, purify DNA and sequence (described in Example 1:
step 1e). Digest the plasmid with Acc65I and XbaI, isolate DNA
fragment and ligate into the vector pCAMBIA2300 that has been
predigested with Acc65I and XbaI.
[0700] Step 2. Transform the DNA construct into E. coli, select for
antibiotic resistance and confirm the presence of the DNA construct
with PCR or by restriction digest analysis.
[0701] Step 3: Transform Agrobacterium tumefaciens: Transform the
DNA construct into Agrobacterium tumefaciens, select for antibiotic
resistance and confirm the presence of the DNA construct as
described in Example 1: Step 2.
[0702] Step 4: Transform plant, Arabidopsis thaliana: Transform the
construct into Arabidopsis thaliana, select for antibiotic
resistance, select for homozygote plants and confirm the presence
of the DNA constructs as described in Example 1: Step 3.
Sequence CWU 1
1
941603DNABos taurusprimer 1atggagcgga ccgaggtgct aaagccccgc
accctggccg atctgatccg cgtcctgcac 60cagctcttcg ccggcgagga gatcaacgtg
gaggaagtgc aggccgtcat ggaagcctat 120gagagcaacc ccgccgagtg
ggcagtgtac gccaagttcg accagtacag gtatactcga 180aatcttgtgg
atcaaggaaa tggaaagttt aatctcatga ttctatgctg gggtgaagga
240catggcagca gtatccatga tcacaccgac tcccactgct ttctgaagat
gctgcaggga 300aatctaaagg agacattgtt tgcctggcct gacaagaaat
ccaatgagat gatcaagaag 360tctgaaagaa tcttgaggga aaaccagtgt
gcctacatca atgattccat tggcttacat 420cgagtagaga atattagcca
tacagagcct gccgtgagcc ttcacttgta tagtccgcct 480tttgacacat
gccacgcctt tgatcaaaga acaggacata aaaacaaagt catcatgaca
540ttccatagca aatttggaat caagactcca tttacaactt caggatccct
ggagaacaac 600taa 6032606DNAZebrafishprimer 2atggagcaga ctgaagtcat
gaagcccgag actctggagg atctgatcaa aactctgcat 60cagatcttcc agagcgactc
catcaatgtg gaggaggtgc agaacctgat ggagtcctac 120cagagcaacc
cgcaggactg gatgaagttc gccaagttcg accagtacag gtacaccagg
180aacctcgtgg atgaaggaaa cggaaagttc aacctgatga tcctgtgctg
gggtgaagga 240cacggcagca gcatccatga ccacacagac tcgcactgct
tcctgaagct gctgcagggt 300cagctgaagg agacgctgtt cgactggccc
gaccgcaagc tgcagagcgg catgaagccc 360cgcggccaga gcgtgctgca
ggagaaccag tgcgcgtaca tcaacgactc tctgggactc 420caccgtgtgg
agaatgtgag ccacacagag ccggccgtga gtctgcacct ttacagtcct
480ccgttccaga gctgccgcac gtttgaccag cgcaccggac accacaacac
cgtcaagatg 540accttctgga gcaaatatgg cgagaggacg ccctatgagc
tgagcgtctc gcaggagaat 600aactga 6063200PRTBos taurusprimer 3Met Glu
Arg Thr Glu Val Leu Lys Pro Arg Thr Leu Ala Asp Leu Ile 1 5 10
15Arg Val Leu His Gln Leu Phe Ala Gly Glu Glu Ile Asn Val Glu Glu
20 25 30Val Gln Ala Val Met Glu Ala Tyr Glu Ser Asn Pro Ala Glu Trp
Ala 35 40 45Val Tyr Ala Lys Phe Asp Gln Tyr Arg Tyr Thr Arg Asn Leu
Val Asp 50 55 60Gln Gly Asn Gly Lys Phe Asn Leu Met Ile Leu Cys Trp
Gly Glu Gly65 70 75 80His Gly Ser Ser Ile His Asp His Thr Asp Ser
His Cys Phe Leu Lys 85 90 95Met Leu Gln Gly Asn Leu Lys Glu Thr Leu
Phe Ala Trp Pro Asp Lys 100 105 110Lys Ser Asn Glu Met Ile Lys Lys
Ser Glu Arg Ile Leu Arg Glu Asn 115 120 125Gln Cys Ala Tyr Ile Asn
Asp Ser Ile Gly Leu His Arg Val Glu Asn 130 135 140Ile Ser His Thr
Glu Pro Ala Val Ser Leu His Leu Tyr Ser Pro Pro145 150 155 160Phe
Asp Thr Cys His Ala Phe Asp Gln Arg Thr Gly His Lys Asn Lys 165 170
175Val Ile Met Thr Phe His Ser Lys Phe Gly Ile Lys Thr Pro Phe Thr
180 185 190Thr Ser Gly Ser Leu Glu Asn Asn 195
2004201PRTZebrafishprimer 4Met Glu Gln Thr Glu Val Met Lys Pro Glu
Thr Leu Glu Asp Leu Ile 1 5 10 15Lys Thr Leu His Gln Ile Phe Gln
Ser Asp Ser Ile Asn Val Glu Glu 20 25 30Val Gln Asn Leu Met Glu Ser
Tyr Gln Ser Asn Pro Gln Asp Trp Met 35 40 45Lys Phe Ala Lys Phe Asp
Gln Tyr Arg Tyr Thr Arg Asn Leu Val Asp 50 55 60Glu Gly Asn Gly Lys
Phe Asn Leu Met Ile Leu Cys Trp Gly Glu Gly65 70 75 80His Gly Ser
Ser Ile His Asp His Thr Asp Ser His Cys Phe Leu Lys 85 90 95Leu Leu
Gln Gly Gln Leu Lys Glu Thr Leu Phe Asp Trp Pro Asp Arg 100 105
110Lys Leu Gln Ser Gly Met Lys Pro Arg Gly Gln Ser Val Leu Gln Glu
115 120 125Asn Gln Cys Ala Tyr Ile Asn Asp Ser Leu Gly Leu His Arg
Val Glu 130 135 140Asn Val Ser His Thr Glu Pro Ala Val Ser Leu His
Leu Tyr Ser Pro145 150 155 160Pro Phe Gln Ser Cys Arg Thr Phe Asp
Gln Arg Thr Gly His His Asn 165 170 175Thr Val Lys Met Thr Phe Trp
Ser Lys Tyr Gly Glu Arg Thr Pro Tyr 180 185 190Glu Leu Ser Val Ser
Gln Glu Asn Asn 195 20051482DNAEquusprimer 5atggctgact ctgaaccgct
cctctccctt gatggggacc ccgtggctgc agaagccttg 60ctccgggatg tgtttgggat
cattgtggat gaggtcattc ggaaagggac cagtgcctcc 120gagaaggtct
gcgagtggaa ggagccggag gagctgaagc agctgctgga tttggagctg
180cggagccatg gggagtcacg ggagcagatc ctggagcggt gccgggctgt
catccgctac 240agcgtgaaga cctgtcaccc tcacttcttc aaccagctct
tctcagggtt ggatccccac 300gctctggccg ggcgcattgt caccgagagc
cttaacacca gccagtacac ttatgaaatc 360gcccccgtgt ttgtgctcat
ggaagaagag gtcctgaaga aactccgggc gctggtgggc 420tggagctctg
gcgatggggt cttctgccct ggtggctcca tctccaacat gtatgctgtg
480aacctggccc gctatcagcg ctacccggat tgcaagcaga ggggcctccg
ggcactgccg 540cccctggccc tcttcacatc gaaggagtgt cattactcca
tcaagaaggg agctgctttt 600ctgggacttg gcactgacag tgtccgagtg
gtcaaggcag atgagagagg gaaaatgatc 660cctgaggatc tggagaggca
gatcagtctg gccgaggcgg agggtgctgt gccattcctg 720gtcactgcca
cctctggcac gaccgtgctg ggggcctttg atcccctgga ggcgattgct
780gatgtgtgcc agcgtcatgg gctgtggctg catgtggacg ccgcctgggg
tgggagtgtc 840ctgctctcac agacacacag acatctcctg gctgggatcc
agagggcgga ctccgtggcc 900tggaatcccc acaagctcct cacagcaggc
ctgcagtgct cagctctcct gctccgggat 960acctcgaacc tgctcaagcg
ctgccacggg tcccaggcca gctacctctt ccagcaggac 1020aagttctacg
acgtggctct ggacacagga gacaaggtgg tgcagtgcgg ccgccgcgtg
1080gactgtctga agctgtggct catgtggaag gcccagggcg ggcaagggct
ggagcagcga 1140gtggaccagg ccttcgccct tgcccggtac ctggtggagg
aattgaagaa gcgggaagga 1200tttgagttgg ttatggagcc tgagtttgtc
aacgtgtgtt tctggttcgt cccgcccagc 1260ctgcggggga aacaggggag
tccagattat gctgaaaggc ttgccaaggt ggccccggta 1320cttaaagagc
gcatggtgaa ggagggctcc atgatggttg gctaccagcc ccacgggacc
1380cggggcaact ttttccgcat ggttgtggcc aacccggctc tgacccaggc
tgatatggac 1440ttcttcctca atgagctgga acggctaggc caggacctct ga
148261449DNAZebrafishprimer 6atggacgagt ctgatgggaa gctgttcctt
actgaggctt tcaacataat catggaagaa 60attcttaaca aaggaaggga cttgaaggag
aaggtttgtg agtggaaaga tccagatcag 120ctgagatctc tcctggacct
cgaacttcgg gatcatggag aatgtcatga gaagctgctg 180cagagggttc
gagatgtggc caaatacagc gtaaaaactt gtcatcctcg gttcttcaat
240cagctgtttg ctggcgtgga ctatcatgca ctgacaggac ggctcatcac
tgaaaccctc 300aataccagcc aatacaccta tgaagtggct ccagtgtttg
tcctgatgga ggaggaagtg 360atcagtaagc ttcgctctct ggttggctgg
tcagaaggag atgggatctt ttgtcctgga 420ggatccatgt ctaacatgta
tgccattaac gtcgctcggt actgggcttt tcctcaagtg 480aagacaaaag
gcttgtgggc cgcaccacgg atggctatat ttacatcaca acagagtcat
540tactccgtga aaaaaggagc tgcgtttctt ggtattggaa cagaaaatgt
tttcattgtg 600caagtggatg agagcggcag catgatacca gaagacctgg
aggcaaaaat tgtgcaggca 660aaatcccaag acgctgttcc gtttttcgta
aacgccacag ccggaaccac agtgcaggga 720gcctttgacc ctctgaagcg
catagctgac atatgtgaaa gaaacggcat gtggatgcat 780gttgacgccg
catggggagg aagcgtgctg ttttccaaaa agcacagaca tctggttgca
840ggaatagaaa gagcaaactc ggtgacttgg aatcctcaca aaatgcttct
gacgggactg 900cagtgctctg tgattttgtt cagagatact acgaatttgc
tcatgcactg tcacagtgcc 960aaagccacat acttgttcca gcaagacaag
ttctacgaca caagtctgga cacgggcgac 1020aaatccatcc agtgtggccg
gaaggtggat tgcctcaagc tctggctcat gtggaaggca 1080atcggagcta
gtggtctttc acagcgtgtc gataaggcct ttgccctcac taggtattta
1140gttgaagaaa tggagaaacg ggagaatttc cagctggtct gtaaggggcc
gtttgtgaac 1200gtttgcttct ggtttattcc acccagtctg aaaggaaagg
agaacagccc agattaccag 1260gaaagactat ccaaggtggc gccagtcatt
aaagagagga tgatgaagcg aggaacgatg 1320atggtgggat atcagccaat
ggatgaacac gtcaacttct tccgcatggt ggttgtttct 1380ccacagctca
caaccaaaga catggatttc ttccttgatg agatggagaa actcgggaag
1440gatctatga 14497493PRTEquusprimer 7Met Ala Asp Ser Glu Pro Leu
Leu Ser Leu Asp Gly Asp Pro Val Ala 1 5 10 15Ala Glu Ala Leu Leu
Arg Asp Val Phe Gly Ile Ile Val Asp Glu Val 20 25 30Ile Arg Lys Gly
Thr Ser Ala Ser Glu Lys Val Cys Glu Trp Lys Glu 35 40 45Pro Glu Glu
Leu Lys Gln Leu Leu Asp Leu Glu Leu Arg Ser His Gly 50 55 60Glu Ser
Arg Glu Gln Ile Leu Glu Arg Cys Arg Ala Val Ile Arg Tyr65 70 75
80Ser Val Lys Thr Cys His Pro His Phe Phe Asn Gln Leu Phe Ser Gly
85 90 95Leu Asp Pro His Ala Leu Ala Gly Arg Ile Val Thr Glu Ser Leu
Asn 100 105 110Thr Ser Gln Tyr Thr Tyr Glu Ile Ala Pro Val Phe Val
Leu Met Glu 115 120 125Glu Glu Val Leu Lys Lys Leu Arg Ala Leu Val
Gly Trp Ser Ser Gly 130 135 140Asp Gly Val Phe Cys Pro Gly Gly Ser
Ile Ser Asn Met Tyr Ala Val145 150 155 160Asn Leu Ala Arg Tyr Gln
Arg Tyr Pro Asp Cys Lys Gln Arg Gly Leu 165 170 175Arg Ala Leu Pro
Pro Leu Ala Leu Phe Thr Ser Lys Glu Cys His Tyr 180 185 190Ser Ile
Lys Lys Gly Ala Ala Phe Leu Gly Leu Gly Thr Asp Ser Val 195 200
205Arg Val Val Lys Ala Asp Glu Arg Gly Lys Met Ile Pro Glu Asp Leu
210 215 220Glu Arg Gln Ile Ser Leu Ala Glu Ala Glu Gly Ala Val Pro
Phe Leu225 230 235 240Val Thr Ala Thr Ser Gly Thr Thr Val Leu Gly
Ala Phe Asp Pro Leu 245 250 255Glu Ala Ile Ala Asp Val Cys Gln Arg
His Gly Leu Trp Leu His Val 260 265 270Asp Ala Ala Trp Gly Gly Ser
Val Leu Leu Ser Gln Thr His Arg His 275 280 285Leu Leu Ala Gly Ile
Gln Arg Ala Asp Ser Val Ala Trp Asn Pro His 290 295 300Lys Leu Leu
Thr Ala Gly Leu Gln Cys Ser Ala Leu Leu Leu Arg Asp305 310 315
320Thr Ser Asn Leu Leu Lys Arg Cys His Gly Ser Gln Ala Ser Tyr Leu
325 330 335Phe Gln Gln Asp Lys Phe Tyr Asp Val Ala Leu Asp Thr Gly
Asp Lys 340 345 350Val Val Gln Cys Gly Arg Arg Val Asp Cys Leu Lys
Leu Trp Leu Met 355 360 365Trp Lys Ala Gln Gly Gly Gln Gly Leu Glu
Gln Arg Val Asp Gln Ala 370 375 380Phe Ala Leu Ala Arg Tyr Leu Val
Glu Glu Leu Lys Lys Arg Glu Gly385 390 395 400Phe Glu Leu Val Met
Glu Pro Glu Phe Val Asn Val Cys Phe Trp Phe 405 410 415Val Pro Pro
Ser Leu Arg Gly Lys Gln Gly Ser Pro Asp Tyr Ala Glu 420 425 430Arg
Leu Ala Lys Val Ala Pro Val Leu Lys Glu Arg Met Val Lys Glu 435 440
445Gly Ser Met Met Val Gly Tyr Gln Pro His Gly Thr Arg Gly Asn Phe
450 455 460Phe Arg Met Val Val Ala Asn Pro Ala Leu Thr Gln Ala Asp
Met Asp465 470 475 480Phe Phe Leu Asn Glu Leu Glu Arg Leu Gly Gln
Asp Leu 485 4908482PRTZebrafishprimer 8Met Asp Glu Ser Asp Gly Lys
Leu Phe Leu Thr Glu Ala Phe Asn Ile 1 5 10 15Ile Met Glu Glu Ile
Leu Asn Lys Gly Arg Asp Leu Lys Glu Lys Val 20 25 30Cys Glu Trp Lys
Asp Pro Asp Gln Leu Arg Ser Leu Leu Asp Leu Glu 35 40 45Leu Arg Asp
His Gly Glu Cys His Glu Lys Leu Leu Gln Arg Val Arg 50 55 60Asp Val
Ala Lys Tyr Ser Val Lys Thr Cys His Pro Arg Phe Phe Asn65 70 75
80Gln Leu Phe Ala Gly Val Asp Tyr His Ala Leu Thr Gly Arg Leu Ile
85 90 95Thr Glu Thr Leu Asn Thr Ser Gln Tyr Thr Tyr Glu Val Ala Pro
Val 100 105 110Phe Val Leu Met Glu Glu Glu Val Ile Ser Lys Leu Arg
Ser Leu Val 115 120 125Gly Trp Ser Glu Gly Asp Gly Ile Phe Cys Pro
Gly Gly Ser Met Ser 130 135 140Asn Met Tyr Ala Ile Asn Val Ala Arg
Tyr Trp Ala Phe Pro Gln Val145 150 155 160Lys Thr Lys Gly Leu Trp
Ala Ala Pro Arg Met Ala Ile Phe Thr Ser 165 170 175Gln Gln Ser His
Tyr Ser Val Lys Lys Gly Ala Ala Phe Leu Gly Ile 180 185 190Gly Thr
Glu Asn Val Phe Ile Val Gln Val Asp Glu Ser Gly Ser Met 195 200
205Ile Pro Glu Asp Leu Glu Ala Lys Ile Val Gln Ala Lys Ser Gln Asp
210 215 220Ala Val Pro Phe Phe Val Asn Ala Thr Ala Gly Thr Thr Val
Gln Gly225 230 235 240Ala Phe Asp Pro Leu Lys Arg Ile Ala Asp Ile
Cys Glu Arg Asn Gly 245 250 255Met Trp Met His Val Asp Ala Ala Trp
Gly Gly Ser Val Leu Phe Ser 260 265 270Lys Lys His Arg His Leu Val
Ala Gly Ile Glu Arg Ala Asn Ser Val 275 280 285Thr Trp Asn Pro His
Lys Met Leu Leu Thr Gly Leu Gln Cys Ser Val 290 295 300Ile Leu Phe
Arg Asp Thr Thr Asn Leu Leu Met His Cys His Ser Ala305 310 315
320Lys Ala Thr Tyr Leu Phe Gln Gln Asp Lys Phe Tyr Asp Thr Ser Leu
325 330 335Asp Thr Gly Asp Lys Ser Ile Gln Cys Gly Arg Lys Val Asp
Cys Leu 340 345 350Lys Leu Trp Leu Met Trp Lys Ala Ile Gly Ala Ser
Gly Leu Ser Gln 355 360 365Arg Val Asp Lys Ala Phe Ala Leu Thr Arg
Tyr Leu Val Glu Glu Met 370 375 380Glu Lys Arg Glu Asn Phe Gln Leu
Val Cys Lys Gly Pro Phe Val Asn385 390 395 400Val Cys Phe Trp Phe
Ile Pro Pro Ser Leu Lys Gly Lys Glu Asn Ser 405 410 415Pro Asp Tyr
Gln Glu Arg Leu Ser Lys Val Ala Pro Val Ile Lys Glu 420 425 430Arg
Met Met Lys Arg Gly Thr Met Met Val Gly Tyr Gln Pro Met Asp 435 440
445Glu His Val Asn Phe Phe Arg Met Val Val Val Ser Pro Gln Leu Thr
450 455 460Thr Lys Asp Met Asp Phe Phe Leu Asp Glu Met Glu Lys Leu
Gly Lys465 470 475 480Asp Leu91401DNAE. coliprimer 9atggataaga
agcaagtaac ggatttaagg tcggaactac tcgattcacg ttttggtgcg 60aagtctattt
ccactatcgc agaatcaaaa cgttttccgc tgcacgaaat gcgcgacgat
120gtcgcattcc agattatcaa tgacgaatta tatcttgatg gcaacgctcg
tcagaacctg 180gccactttct gccagacctg ggacgacgaa aatgtccaca
aattgatgga tttatccatt 240aacaaaaact ggatcgacaa agaagaatat
ccgcaatccg cagccatcga cctgcgttgc 300gtaaatatgg ttgccgatct
gtggcatgcg cctgcgccga aaaatggtca ggccgttggc 360accaacacca
ttggttcttc cgaggcctgt atgctcggcg ggatggcgat gaaatggcgt
420tggcgcaagc gtatggaagc tgcaggcaaa ccaacggata aaccaaacct
ggtgtgcggt 480ccggtacaaa tctgctggca taaattcgcc cgctactggg
atgtggagct gcgtgagatc 540cctatgcgcc ccggtcagtt gtttatggac
ccgaaacgca tgattgaagc ctgtgacgaa 600aacaccatcg gcgtggtgcc
gactttcggc gtgacctaca ctggtaacta tgagttccca 660caaccgctgc
acgatgcgct ggataaattc caggccgata ccggtatcga catcgacatg
720cacatcgacg ctgccagcgg tggcttcctg gcaccgttcg tcgccccgga
tatcgtctgg 780gacttccgcc tgccgcgtgt gaaatcgatc agtgcttcag
gccataaatt cggtctggct 840ccgctgggct gcggctgggt tatctggcgt
gacgaagaag cgctgccgca ggaactggtg 900ttcaacgttg actacctggg
tggtcaaatt ggtacttttg ccatcaactt ctcccgcccg 960gcgggtcagg
taattgcaca gtactatgaa ttcctgcgcc tcggtcgtga aggctatacc
1020aaagtacaga acgcctctta ccaggttgcc gcttatctgg cggatgaaat
cgccaaactg 1080gggccgtatg agttcatctg tacgggtcgc ccggacgaag
gcatcccggc ggtttgcttc 1140aaactgaaag atggtgaaga tccgggatac
accctgtatg acctctctga acgtctgcgt 1200ctgcgcggct ggcaggttcc
ggccttcact ctcggcggtg aagccaccga catcgtggtg 1260atgcgcatta
tgtgtcgtcg cggcttcgaa atggactttg ctgaactgtt gctggaagac
1320tacaaagcct ccctgaaata tctcagcgat cacccgaaac tgcagggtat
tgcccaacag 1380aacagcttta aacatacctg a
1401101485DNAArabidopsisprimer 10atggttttga caaaaaccgc aacgaatgat
gaatctgtct gcaccatgtt cggatctcgc 60tatgttcgca ctacacttcc caagtatgag
attggtgaga attcgatacc gaaagacgct 120gcatatcaga tcataaaaga
tgagctgatg cttgatggta acccgaggct taacctagct 180tcgtttgtga
ctacatggat ggaaccagag tgtgacaaac tcatcatgga ctctatcaac
240aagaactacg ttgatatgga tgagtaccct gtcacaactg agctccagaa
ccgatgtgta 300aacattatag ctcgactgtt caatgcgcca ctcgaggaat
ctgagacggc ggtgggagta 360gggacagttg gttcttcaga agccatcatg
ttagccggat tggccttcaa aagaaaatgg 420cagaacaaac gcaaggctga
gggtaaaccc tatgacaaac ccaacattgt cactggagcc 480aatgttcaag
tttgctggga gaaattcgct cggtacttcg aggtggagct aaaggaagta
540aacctaagtg aaggttacta cgtgatggat ccagacaaag cagcagaaat
ggtagacgag 600aacacaatct gtgtcgcagc catattggga tccacactca
acggtgagtt cgaagacgtg 660aaacgtctca atgacttgct agtcaagaaa
aacgaggaga ctggttggaa cacaccgatc 720cacgtggatg cagcaagtgg
agggttcata gctccgttta tctatcctga attagaatgg 780gactttagac
ttcctttggt taagagtatc aacgtgagtg gtcacaagta tggactggtc
840tatgctggta ttggttgggt cgtgtggagg gcagcagagg atttgcctga
agagcttatc 900tttcatatta attatcttgg tgctgatcaa cccactttca
ctctcaattt ctccaaggga 960tcgagccaaa ttattgctca atactaccag
ctcattcgtc ttggattcga ggggtacaaa 1020aatgtgatgg agaattgcat
agagaacatg gtggttctca aagaagggat agagaaaaca 1080gagcgtttca
acatagtctc aaaggaccaa ggagtgccag tcgtagcctt ctctctcaag
1140gaccatagtt tccacaacga gttcgagatc tctgagatgc tacgtcgttt
tggctggatc 1200gtcccagctt acactatgcc tgccgatgca cagcacatca
cggttctgcg tgttgtcatc 1260agggaagatt tctcaagaac actcgcggag
agacttgttg ctgatatttc gaaggtgctt 1320catgagctag ataccttgcc
ttccaagata tctaagaaga tgggaataga agggatcgcg 1380gaaaatgtaa
aggagaagaa gatggagaag gagattctga tggaagttat tgttggatgg
1440aggaagtttg tgaaggagag gaagaagatg aatggtgtgt gctaa
148511466PRTE. coliprimer 11Met Asp Lys Lys Gln Val Thr Asp Leu Arg
Ser Glu Leu Leu Asp Ser 1 5 10 15Arg Phe Gly Ala Lys Ser Ile Ser
Thr Ile Ala Glu Ser Lys Arg Phe 20 25 30Pro Leu His Glu Met Arg Asp
Asp Val Ala Phe Gln Ile Ile Asn Asp 35 40 45Glu Leu Tyr Leu Asp Gly
Asn Ala Arg Gln Asn Leu Ala Thr Phe Cys 50 55 60Gln Thr Trp Asp Asp
Glu Asn Val His Lys Leu Met Asp Leu Ser Ile65 70 75 80Asn Lys Asn
Trp Ile Asp Lys Glu Glu Tyr Pro Gln Ser Ala Ala Ile 85 90 95Asp Leu
Arg Cys Val Asn Met Val Ala Asp Leu Trp His Ala Pro Ala 100 105
110Pro Lys Asn Gly Gln Ala Val Gly Thr Asn Thr Ile Gly Ser Ser Glu
115 120 125Ala Cys Met Leu Gly Gly Met Ala Met Lys Trp Arg Trp Arg
Lys Arg 130 135 140Met Glu Ala Ala Gly Lys Pro Thr Asp Lys Pro Asn
Leu Val Cys Gly145 150 155 160Pro Val Gln Ile Cys Trp His Lys Phe
Ala Arg Tyr Trp Asp Val Glu 165 170 175Leu Arg Glu Ile Pro Met Arg
Pro Gly Gln Leu Phe Met Asp Pro Lys 180 185 190Arg Met Ile Glu Ala
Cys Asp Glu Asn Thr Ile Gly Val Val Pro Thr 195 200 205Phe Gly Val
Thr Tyr Thr Gly Asn Tyr Glu Phe Pro Gln Pro Leu His 210 215 220Asp
Ala Leu Asp Lys Phe Gln Ala Asp Thr Gly Ile Asp Ile Asp Met225 230
235 240His Ile Asp Ala Ala Ser Gly Gly Phe Leu Ala Pro Phe Val Ala
Pro 245 250 255Asp Ile Val Trp Asp Phe Arg Leu Pro Arg Val Lys Ser
Ile Ser Ala 260 265 270Ser Gly His Lys Phe Gly Leu Ala Pro Leu Gly
Cys Gly Trp Val Ile 275 280 285Trp Arg Asp Glu Glu Ala Leu Pro Gln
Glu Leu Val Phe Asn Val Asp 290 295 300Tyr Leu Gly Gly Gln Ile Gly
Thr Phe Ala Ile Asn Phe Ser Arg Pro305 310 315 320Ala Gly Gln Val
Ile Ala Gln Tyr Tyr Glu Phe Leu Arg Leu Gly Arg 325 330 335Glu Gly
Tyr Thr Lys Val Gln Asn Ala Ser Tyr Gln Val Ala Ala Tyr 340 345
350Leu Ala Asp Glu Ile Ala Lys Leu Gly Pro Tyr Glu Phe Ile Cys Thr
355 360 365Gly Arg Pro Asp Glu Gly Ile Pro Ala Val Cys Phe Lys Leu
Lys Asp 370 375 380Gly Glu Asp Pro Gly Tyr Thr Leu Tyr Asp Leu Ser
Glu Arg Leu Arg385 390 395 400Leu Arg Gly Trp Gln Val Pro Ala Phe
Thr Leu Gly Gly Glu Ala Thr 405 410 415Asp Ile Val Val Met Arg Ile
Met Cys Arg Arg Gly Phe Glu Met Asp 420 425 430Phe Ala Glu Leu Leu
Leu Glu Asp Tyr Lys Ala Ser Leu Lys Tyr Leu 435 440 445Ser Asp His
Pro Lys Leu Gln Gly Ile Ala Gln Gln Asn Ser Phe Lys 450 455 460His
Thr46512494PRTArabidopsisprimer 12Met Val Leu Thr Lys Thr Ala Thr
Asn Asp Glu Ser Val Cys Thr Met 1 5 10 15Phe Gly Ser Arg Tyr Val
Arg Thr Thr Leu Pro Lys Tyr Glu Ile Gly 20 25 30Glu Asn Ser Ile Pro
Lys Asp Ala Ala Tyr Gln Ile Ile Lys Asp Glu 35 40 45Leu Met Leu Asp
Gly Asn Pro Arg Leu Asn Leu Ala Ser Phe Val Thr 50 55 60Thr Trp Met
Glu Pro Glu Cys Asp Lys Leu Ile Met Asp Ser Ile Asn65 70 75 80Lys
Asn Tyr Val Asp Met Asp Glu Tyr Pro Val Thr Thr Glu Leu Gln 85 90
95Asn Arg Cys Val Asn Ile Ile Ala Arg Leu Phe Asn Ala Pro Leu Glu
100 105 110Glu Ser Glu Thr Ala Val Gly Val Gly Thr Val Gly Ser Ser
Glu Ala 115 120 125Ile Met Leu Ala Gly Leu Ala Phe Lys Arg Lys Trp
Gln Asn Lys Arg 130 135 140Lys Ala Glu Gly Lys Pro Tyr Asp Lys Pro
Asn Ile Val Thr Gly Ala145 150 155 160Asn Val Gln Val Cys Trp Glu
Lys Phe Ala Arg Tyr Phe Glu Val Glu 165 170 175Leu Lys Glu Val Asn
Leu Ser Glu Gly Tyr Tyr Val Met Asp Pro Asp 180 185 190Lys Ala Ala
Glu Met Val Asp Glu Asn Thr Ile Cys Val Ala Ala Ile 195 200 205Leu
Gly Ser Thr Leu Asn Gly Glu Phe Glu Asp Val Lys Arg Leu Asn 210 215
220Asp Leu Leu Val Lys Lys Asn Glu Glu Thr Gly Trp Asn Thr Pro
Ile225 230 235 240His Val Asp Ala Ala Ser Gly Gly Phe Ile Ala Pro
Phe Ile Tyr Pro 245 250 255Glu Leu Glu Trp Asp Phe Arg Leu Pro Leu
Val Lys Ser Ile Asn Val 260 265 270Ser Gly His Lys Tyr Gly Leu Val
Tyr Ala Gly Ile Gly Trp Val Val 275 280 285Trp Arg Ala Ala Glu Asp
Leu Pro Glu Glu Leu Ile Phe His Ile Asn 290 295 300Tyr Leu Gly Ala
Asp Gln Pro Thr Phe Thr Leu Asn Phe Ser Lys Gly305 310 315 320Ser
Ser Gln Ile Ile Ala Gln Tyr Tyr Gln Leu Ile Arg Leu Gly Phe 325 330
335Glu Gly Tyr Lys Asn Val Met Glu Asn Cys Ile Glu Asn Met Val Val
340 345 350Leu Lys Glu Gly Ile Glu Lys Thr Glu Arg Phe Asn Ile Val
Ser Lys 355 360 365Asp Gln Gly Val Pro Val Val Ala Phe Ser Leu Lys
Asp His Ser Phe 370 375 380His Asn Glu Phe Glu Ile Ser Glu Met Leu
Arg Arg Phe Gly Trp Ile385 390 395 400Val Pro Ala Tyr Thr Met Pro
Ala Asp Ala Gln His Ile Thr Val Leu 405 410 415Arg Val Val Ile Arg
Glu Asp Phe Ser Arg Thr Leu Ala Glu Arg Leu 420 425 430Val Ala Asp
Ile Ser Lys Val Leu His Glu Leu Asp Thr Leu Pro Ser 435 440 445Lys
Ile Ser Lys Lys Met Gly Ile Glu Gly Ile Ala Glu Asn Val Lys 450 455
460Glu Lys Lys Met Glu Lys Glu Ile Leu Met Glu Val Ile Val Gly
Trp465 470 475 480Arg Lys Phe Val Lys Glu Arg Lys Lys Met Asn Gly
Val Cys 485 49013813DNASuisprimer 13atgccccgag acaacatggc
ctccctgatc caacggatcg cccgccaggc atgcctcacc 60ttccggggca gcgggggcgg
ccgcagctct tccgatcgcg gcgcggcgcc aggccctgag 120gcgcctgtgc
cgcagggctt cccggagaac ctgagcaagc tgaagagcct gctgacacag
180gtccgcgcag aggacctgaa catctccccg cgcaaggcca cgctgcagcc
gttgccaccc 240aacctgccgc ccgtcaccta tatgcacatc tacgagactg
acggcttcag cctcggcgtg 300ttcttgctta agagcggcac atccatcccg
ctccacgacc accctggcat gcatggcatg 360ctcaaggtgc tctatggcac
cgtgcgcatc agctgcatgg acaagctgga ggcaggcagc 420gggcaacggc
cgcgggcccc gccaccagag cagcagttcg aaccgccgct gctggcccgg
480gagcgggacg cggtgcggcc gggagtgctg cgctcgcggg ccgagtacac
tgaggccagc 540ggtccctgcg tcctcacgcc gcaccgggac aacctgcacc
agatcgacgc tgtggatggg 600cctgccgcct tcttggatat cctggccccg
ccctacgacc cggacgacgg ccgggactgt 660cactattacc gggtgctgga
gcctgtcagg gccaaagagg cctccgactc ggcctgtgac 720ctgccccgag
aggtgtggct tctggagacc ccgcaggccg atgacttttg gtgcgagggg
780gagccctatc caggtcccag ggtcttccct tga 81314750DNAZebrafishprimer
14atgacttcca cagtccagaa aatcgccaaa caggccctcg caacattccg aaacccgtct
60gtcatcggcg agcacaacaa agtgtttttg gagaaccaaa gcaagctgaa aagcctcttg
120gcggaggtca gagcggcgga cttgaagatc gcagcccgga cccccgagag
cgccccggtg 180ccgcatcagc gcatcgctcc tcccgtcaca tacatgcata
tctgcgagac cgactccttc 240agcatggggg tgtttctgct gaaaacgggg
gcttcgatac ccctgcacga ccatccgggg 300atgtacggca tgctgaaggt
gatctacggg aaggtgcgga tcagttgttt cgaccgcctg 360gataaaccga
gagacggcgc cagcggcgtg cagttcaacc ctccgctcat gcccttccag
420aggggctcct tacggccctc agtgctgaag tccgtcgggg agttcacaga
ggacagcagc 480ccgtgtgtgc tctcacccca gcaggacaat atccaccaga
tagacgctgt tgacggaccc 540accgctttcc tggacatctt agcacccccg
tacgacccag acgaagggag agactgccat 600tattataaag ttttgcaagc
tcattcagag gctgcagata aaaagagtga agtccaggat 660caaggggacg
tgtggctaat ggaaataccc cagcctagtg aattttggtg tggtggtgaa
720ccatacccag ggcctaaagt gaccctctga 75015270PRTSuisprimer 15Met Pro
Arg Asp Asn Met Ala Ser Leu Ile Gln Arg Ile Ala Arg Gln 1 5 10
15Ala Cys Leu Thr Phe Arg Gly Ser Gly Gly Gly Arg Ser Ser Ser Asp
20 25 30Arg Gly Ala Ala Pro Gly Pro Glu Ala Pro Val Pro Gln Gly Phe
Pro 35 40 45Glu Asn Leu Ser Lys Leu Lys Ser Leu Leu Thr Gln Val Arg
Ala Glu 50 55 60Asp Leu Asn Ile Ser Pro Arg Lys Ala Thr Leu Gln Pro
Leu Pro Pro65 70 75 80Asn Leu Pro Pro Val Thr Tyr Met His Ile Tyr
Glu Thr Asp Gly Phe 85 90 95Ser Leu Gly Val Phe Leu Leu Lys Ser Gly
Thr Ser Ile Pro Leu His 100 105 110Asp His Pro Gly Met His Gly Met
Leu Lys Val Leu Tyr Gly Thr Val 115 120 125Arg Ile Ser Cys Met Asp
Lys Leu Glu Ala Gly Ser Gly Gln Arg Pro 130 135 140Arg Ala Pro Pro
Pro Glu Gln Gln Phe Glu Pro Pro Leu Leu Ala Arg145 150 155 160Glu
Arg Asp Ala Val Arg Pro Gly Val Leu Arg Ser Arg Ala Glu Tyr 165 170
175Thr Glu Ala Ser Gly Pro Cys Val Leu Thr Pro His Arg Asp Asn Leu
180 185 190His Gln Ile Asp Ala Val Asp Gly Pro Ala Ala Phe Leu Asp
Ile Leu 195 200 205Ala Pro Pro Tyr Asp Pro Asp Asp Gly Arg Asp Cys
His Tyr Tyr Arg 210 215 220Val Leu Glu Pro Val Arg Ala Lys Glu Ala
Ser Asp Ser Ala Cys Asp225 230 235 240Leu Pro Arg Glu Val Trp Leu
Leu Glu Thr Pro Gln Ala Asp Asp Phe 245 250 255Trp Cys Glu Gly Glu
Pro Tyr Pro Gly Pro Arg Val Phe Pro 260 265
27016249PRTZebrafishprimer 16Met Thr Ser Thr Val Gln Lys Ile Ala
Lys Gln Ala Leu Ala Thr Phe 1 5 10 15Arg Asn Pro Ser Val Ile Gly
Glu His Asn Lys Val Phe Leu Glu Asn 20 25 30Gln Ser Lys Leu Lys Ser
Leu Leu Ala Glu Val Arg Ala Ala Asp Leu 35 40 45Lys Ile Ala Ala Arg
Thr Pro Glu Ser Ala Pro Val Pro His Gln Arg 50 55 60Ile Ala Pro Pro
Val Thr Tyr Met His Ile Cys Glu Thr Asp Ser Phe65 70 75 80Ser Met
Gly Val Phe Leu Leu Lys Thr Gly Ala Ser Ile Pro Leu His 85 90 95Asp
His Pro Gly Met Tyr Gly Met Leu Lys Val Ile Tyr Gly Lys Val 100 105
110Arg Ile Ser Cys Phe Asp Arg Leu Asp Lys Pro Arg Asp Gly Ala Ser
115 120 125Gly Val Gln Phe Asn Pro Pro Leu Met Pro Phe Gln Arg Gly
Ser Leu 130 135 140Arg Pro Ser Val Leu Lys Ser Val Gly Glu Phe Thr
Glu Asp Ser Ser145 150 155 160Pro Cys Val Leu Ser Pro Gln Gln Asp
Asn Ile His Gln Ile Asp Ala 165 170 175Val Asp Gly Pro Thr Ala Phe
Leu Asp Ile Leu Ala Pro Pro Tyr Asp 180 185 190Pro Asp Glu Gly Arg
Asp Cys His Tyr Tyr Lys Val Leu Gln Ala His 195 200 205Ser Glu Ala
Ala Asp Lys Lys Ser Glu Val Gln Asp Gln Gly Asp Val 210 215 220Trp
Leu Met Glu Ile Pro Gln Pro Ser Glu Phe Trp Cys Gly Gly Glu225 230
235 240Pro Tyr Pro Gly Pro Lys Val Thr Leu 245171392DNARoseobacter
denitrificansprimer 17atggacggca atttcaatga aaatgatatc tcccgcgtcg
tcgaagcaga ccgcgcgcat 60atctggcacc atctgagcca gcacaaacct tacgagacaa
cagacccgcg catcattgtc 120gaaggcaagg gcatgaaggt ttgggaccag
aagggcaaag agcatcttga tgccgtctcc 180ggtggggtct ggaccgtcaa
tgtcggctat ggccgcgaac gcatcgccaa cgccgtgcgg 240gaccagttgg
tcaagttgaa ctatttcgcc ggctccgcag gctccatccc cggtgccatg
300ttcgccgagc gtctgatcga gaagatgccg gggctgagcc gcgtttatta
ctgcaattcc 360ggctccgagg cgaatgaaaa agccttcaag atggtccgcc
agatcgcgca caaacgctat 420ggcggcaaaa agcacaaggt gctttatcgc
gagcgtgact atcacggcac caccatttcc 480gccctttccg caggcgggca
ggacgaacgg aacgcacaat atggcccctt cacgcccggt 540ttcgtgcgcg
tgccccattg ccttgaatac cgcgcctttg aacaggaagg ggcgccacag
600gaaaactacg gtgtctgggc ggcggatcag atcgaaaagg taatcctcgc
cgaagggccc 660gataccgtgg gcggcctgtg ccttgaaccg gtcactgcag
gtggcggggt gatcacgccc 720cccgatggct actgggagcg tgtgcaggaa
atctgccaca aatacgacat cctgctgcat 780atcgacgagg tcgtatgcgg
cgtcggtcgg accggcacat ggttcggcta tcagcactac 840ggcatccagc
cggatatggt cacgatggcc aagggtgtcg cgtccggtta cgcggcgatc
900gcctgccttg tgaccaatga aaaagtcttc gacatgttca aggatgacgc
ctcggatccg 960ctgaactact tccgcgacat ctcgaccttt gggggctgca
cggcgggtcc ggcagctgcg 1020ctggaaaacc tgtcgatcat cgaagaagaa
ggcctgctgg acaacaccac ggaacagggg 1080gcctatatgc tcgactgtct
gggcggcttg atggacaagc acaagatcat cggccaggtg 1140cgcggcaagg
ggctgttcct cggtgccgaa ctggtcgagg atcgcgacac gcgcaaaccg
1200gttgacgaaa ggctcgcgca agcggtggtc gcggactgca tgcaacaggg
tgtgatcatc 1260ggcgtgacca accgctctct gccgggcaag aacaacacgc
tgtgtttctc gcccgccctg 1320atcgccagca aggatgacat tgaccacatc
tgcgacgcgg tggacggtgc gctgtcgcgc 1380gttttcggct aa
139218463PRTRoseobacter denitrificansprimer 18Met Asp Gly Asn Phe
Asn Glu Asn Asp Ile Ser Arg Val Val Glu Ala 1 5 10 15Asp Arg Ala
His Ile Trp His His Leu Ser Gln His Lys Pro Tyr Glu 20 25 30Thr Thr
Asp Pro Arg Ile Ile Val Glu Gly Lys Gly Met Lys Val Trp 35 40 45Asp
Gln Lys Gly Lys Glu His Leu Asp Ala Val Ser Gly Gly Val Trp 50 55
60Thr Val Asn Val Gly Tyr Gly Arg Glu Arg Ile Ala Asn Ala Val Arg65
70 75 80Asp Gln Leu Val Lys Leu Asn Tyr Phe Ala Gly Ser Ala Gly Ser
Ile 85 90 95Pro Gly Ala Met Phe Ala Glu Arg Leu Ile Glu Lys Met Pro
Gly Leu 100 105 110Ser Arg Val Tyr Tyr Cys Asn Ser Gly Ser Glu Ala
Asn Glu Lys Ala 115 120 125Phe Lys Met Val Arg Gln Ile Ala His Lys
Arg Tyr Gly Gly Lys Lys 130 135 140His Lys Val Leu Tyr Arg Glu Arg
Asp Tyr His Gly Thr Thr Ile Ser145 150 155 160Ala Leu Ser Ala Gly
Gly Gln Asp Glu Arg Asn Ala Gln Tyr Gly Pro 165 170 175Phe Thr Pro
Gly Phe Val Arg Val Pro His Cys Leu Glu Tyr Arg Ala 180 185 190Phe
Glu Gln Glu Gly Ala Pro Gln Glu Asn Tyr Gly Val Trp Ala Ala 195 200
205Asp Gln Ile Glu Lys Val Ile Leu Ala Glu Gly Pro Asp Thr Val Gly
210 215 220Gly Leu Cys Leu Glu Pro Val Thr Ala Gly Gly Gly Val Ile
Thr Pro225 230 235 240Pro Asp Gly Tyr Trp Glu Arg Val Gln Glu Ile
Cys His Lys Tyr Asp 245 250 255Ile Leu Leu His Ile Asp Glu Val Val
Cys Gly Val Gly Arg Thr Gly 260 265 270Thr Trp Phe Gly Tyr Gln His
Tyr Gly Ile Gln Pro Asp Met Val Thr 275 280 285Met Ala Lys Gly Val
Ala Ser Gly Tyr Ala Ala Ile Ala Cys Leu Val 290 295 300Thr Asn Glu
Lys Val Phe Asp Met Phe Lys Asp Asp Ala Ser Asp Pro305 310 315
320Leu Asn Tyr Phe Arg Asp Ile Ser Thr Phe Gly Gly Cys Thr Ala
Gly
325 330 335Pro Ala Ala Ala Leu Glu Asn Leu Ser Ile Ile Glu Glu Glu
Gly Leu 340 345 350Leu Asp Asn Thr Thr Glu Gln Gly Ala Tyr Met Leu
Asp Cys Leu Gly 355 360 365Gly Leu Met Asp Lys His Lys Ile Ile Gly
Gln Val Arg Gly Lys Gly 370 375 380Leu Phe Leu Gly Ala Glu Leu Val
Glu Asp Arg Asp Thr Arg Lys Pro385 390 395 400Val Asp Glu Arg Leu
Ala Gln Ala Val Val Ala Asp Cys Met Gln Gln 405 410 415Gly Val Ile
Ile Gly Val Thr Asn Arg Ser Leu Pro Gly Lys Asn Asn 420 425 430Thr
Leu Cys Phe Ser Pro Ala Leu Ile Ala Ser Lys Asp Asp Ile Asp 435 440
445His Ile Cys Asp Ala Val Asp Gly Ala Leu Ser Arg Val Phe Gly 450
455 460191779DNARoseobacter denitrificansprimer 19atgaaaatga
ccactgaaga agcctttgta aaaaccctgc aagcgcatgg tatcgaacac 60gccttcggga
ttatcggctc ggccatgatg ccgatctccg acattttccc cgatgcgggc
120atcaaattct gggactgcgc gcatgaaggt tccgcaggca tgatgtctga
cggttacacc 180cgcgccaccg gcaaagtgtc gatgatgatc gcgcagaacg
gccccggcat caccaatttc 240gtgaccgccg tcaaaaccgc ctactggaac
cacacgccgc ttctgctcgt gacgccgcaa 300gccgcgaaca agaccatcgg
tcagggcggt tttcaggaag tcgaacagat gaaactcttc 360gaggacatgg
tcgcttatca ggaagaggtg cgcgacccga cccgtgtggc cgaggtcctg
420acccgcgtga ttgccaaggc aaaacgcctc agcggcccgg cgcagatcaa
catcccgcgt 480gatttctgga cgcaggtggt cgacatcgaa atccccgacc
cgattgaatt cgaagcctcc 540ccgggcggtg aaaactccgt tgcgcaagcc
gccgagatgc tctccaacgc caagaatccg 600gtgatcctga acggggcggg
cgtggtcctg tcaaaaggcg gcatcgacgc ctcccgcctt 660ctggcagaac
gtctggatgc ccccgtctgc gtgggctatc agcacaatga cgcctttccc
720ggcaaccatc cgctctttgc cggaccactt ggatacaacg gttccaaagc
gggcatgcag 780ctgatcaagg aagccgacgt ggttctgtgc ctcggcacgc
gtctcaaccc gttttcgacc 840ctgcccggct atggcatcga ctattggccc
gcagatgcga aaatcattca ggtggacatc 900aaccccgacc ggatcggcct
gaccaagaag gtctcggtcg ggatcgtcgg cgatgcagca 960aaggtggcca
aggggatcct gtcgcagctc tcggacaccg caggcgacga gggccgcgag
1020gcgcgcaaag cccatatcgc ccagacaaaa tccgcatggg cgcaggagtt
gacctcgctc 1080acccacgagc aggacgatcc gggcaccgac tggaacgtgc
gcgcacgcgc ggccaagcct 1140gactggatga gcccccgcat ggcgtggcgc
gcaatccaga gcgcgctgcc ggtggaggcg 1200atcatttcat ccgacatcgg
caacaactgc gccatcggca acgcctaccc ggccttcgaa 1260gaggggcgca
agtatctcgc gccgggtctc ttcggtccct gcggctacgg cctgcccgcc
1320attgtcggcg ccaagatcgg tcagccccat gtgccggttg tgggtttcgc
aggtgacggg 1380gcctttggca tcgccgtcaa cgaattgacc gccatcggcc
gtggtgagtg gcccgcgatc 1440acgcagatcg tgttccgcaa ctaccagtgg
ggcgctgaaa agcgcaactc gaccctgtgg 1500ttcgaagaca acttcgtcgg
caccgagctt gacgaggaag tctcctacgc tggcatcgcc 1560aatgcgtgcg
gcctcaaagg cgtcgtcgcc cgcacgcagg aggaactgac agatgccctc
1620aacgaggcga tcaaggacca gatggaaaac ggcatcacca cgctgatcga
ggccatgatc 1680aatcaggaac tcggcgatcc cttccgccgc gacgcgatga
aaaagcctgt tcaggttgct 1740gggatcagca aatccgacat gcgtccacag
actgtctga 177920592PRTRoseobacter denitrificansprimer 20Met Lys Met
Thr Thr Glu Glu Ala Phe Val Lys Thr Leu Gln Ala His 1 5 10 15Gly
Ile Glu His Ala Phe Gly Ile Ile Gly Ser Ala Met Met Pro Ile 20 25
30Ser Asp Ile Phe Pro Asp Ala Gly Ile Lys Phe Trp Asp Cys Ala His
35 40 45Glu Gly Ser Ala Gly Met Met Ser Asp Gly Tyr Thr Arg Ala Thr
Gly 50 55 60Lys Val Ser Met Met Ile Ala Gln Asn Gly Pro Gly Ile Thr
Asn Phe65 70 75 80Val Thr Ala Val Lys Thr Ala Tyr Trp Asn His Thr
Pro Leu Leu Leu 85 90 95Val Thr Pro Gln Ala Ala Asn Lys Thr Ile Gly
Gln Gly Gly Phe Gln 100 105 110Glu Val Glu Gln Met Lys Leu Phe Glu
Asp Met Val Ala Tyr Gln Glu 115 120 125Glu Val Arg Asp Pro Thr Arg
Val Ala Glu Val Leu Thr Arg Val Ile 130 135 140Ala Lys Ala Lys Arg
Leu Ser Gly Pro Ala Gln Ile Asn Ile Pro Arg145 150 155 160Asp Phe
Trp Thr Gln Val Val Asp Ile Glu Ile Pro Asp Pro Ile Glu 165 170
175Phe Glu Ala Ser Pro Gly Gly Glu Asn Ser Val Ala Gln Ala Ala Glu
180 185 190Met Leu Ser Asn Ala Lys Asn Pro Val Ile Leu Asn Gly Ala
Gly Val 195 200 205Val Leu Ser Lys Gly Gly Ile Asp Ala Ser Arg Leu
Leu Ala Glu Arg 210 215 220Leu Asp Ala Pro Val Cys Val Gly Tyr Gln
His Asn Asp Ala Phe Pro225 230 235 240Gly Asn His Pro Leu Phe Ala
Gly Pro Leu Gly Tyr Asn Gly Ser Lys 245 250 255Ala Gly Met Gln Leu
Ile Lys Glu Ala Asp Val Val Leu Cys Leu Gly 260 265 270Thr Arg Leu
Asn Pro Phe Ser Thr Leu Pro Gly Tyr Gly Ile Asp Tyr 275 280 285Trp
Pro Ala Asp Ala Lys Ile Ile Gln Val Asp Ile Asn Pro Asp Arg 290 295
300Ile Gly Leu Thr Lys Lys Val Ser Val Gly Ile Val Gly Asp Ala
Ala305 310 315 320Lys Val Ala Lys Gly Ile Leu Ser Gln Leu Ser Asp
Thr Ala Gly Asp 325 330 335Glu Gly Arg Glu Ala Arg Lys Ala His Ile
Ala Gln Thr Lys Ser Ala 340 345 350Trp Ala Gln Glu Leu Thr Ser Leu
Thr His Glu Gln Asp Asp Pro Gly 355 360 365Thr Asp Trp Asn Val Arg
Ala Arg Ala Ala Lys Pro Asp Trp Met Ser 370 375 380Pro Arg Met Ala
Trp Arg Ala Ile Gln Ser Ala Leu Pro Val Glu Ala385 390 395 400Ile
Ile Ser Ser Asp Ile Gly Asn Asn Cys Ala Ile Gly Asn Ala Tyr 405 410
415Pro Ala Phe Glu Glu Gly Arg Lys Tyr Leu Ala Pro Gly Leu Phe Gly
420 425 430Pro Cys Gly Tyr Gly Leu Pro Ala Ile Val Gly Ala Lys Ile
Gly Gln 435 440 445Pro His Val Pro Val Val Gly Phe Ala Gly Asp Gly
Ala Phe Gly Ile 450 455 460Ala Val Asn Glu Leu Thr Ala Ile Gly Arg
Gly Glu Trp Pro Ala Ile465 470 475 480Thr Gln Ile Val Phe Arg Asn
Tyr Gln Trp Gly Ala Glu Lys Arg Asn 485 490 495Ser Thr Leu Trp Phe
Glu Asp Asn Phe Val Gly Thr Glu Leu Asp Glu 500 505 510Glu Val Ser
Tyr Ala Gly Ile Ala Asn Ala Cys Gly Leu Lys Gly Val 515 520 525Val
Ala Arg Thr Gln Glu Glu Leu Thr Asp Ala Leu Asn Glu Ala Ile 530 535
540Lys Asp Gln Met Glu Asn Gly Ile Thr Thr Leu Ile Glu Ala Met
Ile545 550 555 560Asn Gln Glu Leu Gly Asp Pro Phe Arg Arg Asp Ala
Met Lys Lys Pro 565 570 575Val Gln Val Ala Gly Ile Ser Lys Ser Asp
Met Arg Pro Gln Thr Val 580 585 59021387DNARoseobacter
denitrificansprimer 21atgaccaaaa cactgacagc tcaggacttg tccgacacct
ttgacgcctt caatcgccat 60gacgttgatg gcgtcatgac acatttcgcc gatgattgcg
tgttctacac cgtgggcggg 120gatgaagcct atggcgccaa agtcgaaggc
gcagaagcga ttgccaaagc attctctgcc 180gtctgggcgg gcatgaagga
cgcccattgg gatcatcaca gccactttgt gcatggggat 240cgcgccgtat
ccgaatggac gttctccgga actggcgcgg acggcatgcg catcgaagca
300cagggcgctg acctctttac cctgcgcgac ggcaagatca tcgtgaaaca
ggccctgcgc 360aaatcccgcc cgcccttcaa ggcttaa 38722128PRTRoseobacter
denitrificansprimer 22Met Thr Lys Thr Leu Thr Ala Gln Asp Leu Ser
Asp Thr Phe Asp Ala 1 5 10 15Phe Asn Arg His Asp Val Asp Gly Val
Met Thr His Phe Ala Asp Asp 20 25 30Cys Val Phe Tyr Thr Val Gly Gly
Asp Glu Ala Tyr Gly Ala Lys Val 35 40 45Glu Gly Ala Glu Ala Ile Ala
Lys Ala Phe Ser Ala Val Trp Ala Gly 50 55 60Met Lys Asp Ala His Trp
Asp His His Ser His Phe Val His Gly Asp65 70 75 80Arg Ala Val Ser
Glu Trp Thr Phe Ser Gly Thr Gly Ala Asp Gly Met 85 90 95Arg Ile Glu
Ala Gln Gly Ala Asp Leu Phe Thr Leu Arg Asp Gly Lys 100 105 110Ile
Ile Val Lys Gln Ala Leu Arg Lys Ser Arg Pro Pro Phe Lys Ala 115 120
125231395DNARoseobacter denitrificansprimer 23atgccacata gaccaaagca
ctggcccaag gccagctacg atcccaaata cgatcctatc 60gtcgacgcgg gtcccggtca
caaccgggac cacgcaccga cctattggat tggtacggcg 120gggacgccac
ctgaagatga cgggccggtg tcgggtgaca tcgatgcgga tgtcgtcgtt
180gtcggctctg gctatacagg tctgtctacc gcaatccacc tggcgaagga
ccacggcatc 240aaggcgcatg tccttgaagc caacacagtc gcctggggct
gttccacccg caatggcggg 300caggcacaga tttcttccgg tcgtctcaag
cggtcggagt ggatcaagcg gtggggcgtg 360gatgtcgcca aaggcatgca
cgccgaggtc tgtgaagcct tcgaactgtt caatgatctg 420atcgggtcag
atgacattga ttgcgacccg caaaccgggg gccatttcta tattgcccac
480cgcgaaaagg tcatggcgaa gctggaaaag gaatgtgccg tcctgaacga
cacgtttggc 540tatggctctc gcattctgtc gcgcgacgaa ctacacgaaa
aatacgtgcg ggatcaggaa 600gcacacggtg ccctttggga accggacggg
acctcgatcc acgcggcaaa actggccttc 660agctacgtgc gtcttgcgcg
caaactcggc gccaagatcc acacggccag cccggtcatg 720gggtggaaga
ccgtgaacgg tgtgcatcac ctcaccacgc ccggtggcac ggtgcgcgca
780cgtgccgtgg ccttggcgac agcgggctac acaccgccgg ggctgaacga
aaagaccaag 840caccggctca tgccgatcct gtcaaactcc atcgtgacgc
gtccgctgag cgatgaggaa 900aaggcgggat gcggttttca ggtgaaatct
ccgctgactg acacgcgcac cttgcggcac 960tactaccgct atctgcccga
cggacgggtc cagatcggca gccgcagtgc gattacaggt 1020cgagacgcag
agaaccccag acatctggag cttctgcaga aaggtctcta tcgcaagttc
1080cccgtgctcg aaggcattga actggattac tcctggtggg gatgggtgga
tgtcagccat 1140gacatgatgc cacgcatttt ccagccaaac ccgaagcaaa
caatctttta tgcgatgggc 1200tacggcggca acggggtgat gtattccgca
caggccggca agcgcatggc gcaaatggtt 1260gcgggcgaag gcaaggacct
caaacttccg atcttcacct cgcaactgcc aagccacggt 1320gttctgacac
ccttccgcag gttgggccag cgcatggcct acccctacta ctaccttcgc
1380gatgaaattc tctga 139524464PRTRoseobacter denitrificansprimer
24Met Pro His Arg Pro Lys His Trp Pro Lys Ala Ser Tyr Asp Pro Lys 1
5 10 15Tyr Asp Pro Ile Val Asp Ala Gly Pro Gly His Asn Arg Asp His
Ala 20 25 30Pro Thr Tyr Trp Ile Gly Thr Ala Gly Thr Pro Pro Glu Asp
Asp Gly 35 40 45Pro Val Ser Gly Asp Ile Asp Ala Asp Val Val Val Val
Gly Ser Gly 50 55 60Tyr Thr Gly Leu Ser Thr Ala Ile His Leu Ala Lys
Asp His Gly Ile65 70 75 80Lys Ala His Val Leu Glu Ala Asn Thr Val
Ala Trp Gly Cys Ser Thr 85 90 95Arg Asn Gly Gly Gln Ala Gln Ile Ser
Ser Gly Arg Leu Lys Arg Ser 100 105 110Glu Trp Ile Lys Arg Trp Gly
Val Asp Val Ala Lys Gly Met His Ala 115 120 125Glu Val Cys Glu Ala
Phe Glu Leu Phe Asn Asp Leu Ile Gly Ser Asp 130 135 140Asp Ile Asp
Cys Asp Pro Gln Thr Gly Gly His Phe Tyr Ile Ala His145 150 155
160Arg Glu Lys Val Met Ala Lys Leu Glu Lys Glu Cys Ala Val Leu Asn
165 170 175Asp Thr Phe Gly Tyr Gly Ser Arg Ile Leu Ser Arg Asp Glu
Leu His 180 185 190Glu Lys Tyr Val Arg Asp Gln Glu Ala His Gly Ala
Leu Trp Glu Pro 195 200 205Asp Gly Thr Ser Ile His Ala Ala Lys Leu
Ala Phe Ser Tyr Val Arg 210 215 220Leu Ala Arg Lys Leu Gly Ala Lys
Ile His Thr Ala Ser Pro Val Met225 230 235 240Gly Trp Lys Thr Val
Asn Gly Val His His Leu Thr Thr Pro Gly Gly 245 250 255Thr Val Arg
Ala Arg Ala Val Ala Leu Ala Thr Ala Gly Tyr Thr Pro 260 265 270Pro
Gly Leu Asn Glu Lys Thr Lys His Arg Leu Met Pro Ile Leu Ser 275 280
285Asn Ser Ile Val Thr Arg Pro Leu Ser Asp Glu Glu Lys Ala Gly Cys
290 295 300Gly Phe Gln Val Lys Ser Pro Leu Thr Asp Thr Arg Thr Leu
Arg His305 310 315 320Tyr Tyr Arg Tyr Leu Pro Asp Gly Arg Val Gln
Ile Gly Ser Arg Ser 325 330 335Ala Ile Thr Gly Arg Asp Ala Glu Asn
Pro Arg His Leu Glu Leu Leu 340 345 350Gln Lys Gly Leu Tyr Arg Lys
Phe Pro Val Leu Glu Gly Ile Glu Leu 355 360 365Asp Tyr Ser Trp Trp
Gly Trp Val Asp Val Ser His Asp Met Met Pro 370 375 380Arg Ile Phe
Gln Pro Asn Pro Lys Gln Thr Ile Phe Tyr Ala Met Gly385 390 395
400Tyr Gly Gly Asn Gly Val Met Tyr Ser Ala Gln Ala Gly Lys Arg Met
405 410 415Ala Gln Met Val Ala Gly Glu Gly Lys Asp Leu Lys Leu Pro
Ile Phe 420 425 430Thr Ser Gln Leu Pro Ser His Gly Val Leu Thr Pro
Phe Arg Arg Leu 435 440 445Gly Gln Arg Met Ala Tyr Pro Tyr Tyr Tyr
Leu Arg Asp Glu Ile Leu 450 455 46025852DNAE. coliprimer
25atgagtgaac gtctgagcat taccccgctg gggccgtata tcggcgcaca aatttcgggt
60gccgacctga cgcgcccgtt aagcgataat cagtttgaac agctttacca tgcggtgctg
120cgccatcagg tggtgtttct acgcgatcaa gctattacgc cgcagcagca
acgcgcgctg 180gcccagcgtt ttggcgaatt gcatattcac cctgtttacc
cgcatgccga aggggttgac 240gagatcatcg tgctggatac ccataacgat
aatccgccag ataacgacaa ctggcatacc 300gatgtgacat ttattgaaac
gccacccgca ggggcgattc tggcagctaa agagttacct 360tcgaccggcg
gtgatacgct ctggaccagc ggtattgcgg cctatgaggc gctctctgtt
420cccttccgcc agctgctgag tgggctgcgt gcggagcatg atttccgtaa
atcgttcccg 480gaatacaaat accgcaaaac cgaggaggaa catcaacgct
ggcgcgaggc ggtcgcgaaa 540aacccgccgt tgctacatcc ggtggtgcga
acgcatccgg tgagcggtaa acaggcgctg 600tttgtgaatg aaggctttac
tacgcgaatt gttgatgtga gcgagaaaga gagcgaagcc 660ttgttaagtt
ttttgtttgc ccatatcacc aaaccggagt ttcaggtgcg ctggcgctgg
720caaccaaatg atattgcgat ttgggataac cgcgtgaccc agcactatgc
caatgccgat 780tacctgccac agcgacggat aatgcatcgg gcgacgatcc
ttggggataa accgttttat 840cgggcggggt aa 85226283PRTE. coliprimer
26Met Ser Glu Arg Leu Ser Ile Thr Pro Leu Gly Pro Tyr Ile Gly Ala 1
5 10 15Gln Ile Ser Gly Ala Asp Leu Thr Arg Pro Leu Ser Asp Asn Gln
Phe 20 25 30Glu Gln Leu Tyr His Ala Val Leu Arg His Gln Val Val Phe
Leu Arg 35 40 45Asp Gln Ala Ile Thr Pro Gln Gln Gln Arg Ala Leu Ala
Gln Arg Phe 50 55 60Gly Glu Leu His Ile His Pro Val Tyr Pro His Ala
Glu Gly Val Asp65 70 75 80Glu Ile Ile Val Leu Asp Thr His Asn Asp
Asn Pro Pro Asp Asn Asp 85 90 95Asn Trp His Thr Asp Val Thr Phe Ile
Glu Thr Pro Pro Ala Gly Ala 100 105 110Ile Leu Ala Ala Lys Glu Leu
Pro Ser Thr Gly Gly Asp Thr Leu Trp 115 120 125Thr Ser Gly Ile Ala
Ala Tyr Glu Ala Leu Ser Val Pro Phe Arg Gln 130 135 140Leu Leu Ser
Gly Leu Arg Ala Glu His Asp Phe Arg Lys Ser Phe Pro145 150 155
160Glu Tyr Lys Tyr Arg Lys Thr Glu Glu Glu His Gln Arg Trp Arg Glu
165 170 175Ala Val Ala Lys Asn Pro Pro Leu Leu His Pro Val Val Arg
Thr His 180 185 190Pro Val Ser Gly Lys Gln Ala Leu Phe Val Asn Glu
Gly Phe Thr Thr 195 200 205Arg Ile Val Asp Val Ser Glu Lys Glu Ser
Glu Ala Leu Leu Ser Phe 210 215 220Leu Phe Ala His Ile Thr Lys Pro
Glu Phe Gln Val Arg Trp Arg Trp225 230 235 240Gln Pro Asn Asp Ile
Ala Ile Trp Asp Asn Arg Val Thr Gln His Tyr 245 250 255Ala Asn Ala
Asp Tyr Leu Pro Gln Arg Arg Ile Met His Arg Ala Thr 260 265 270Ile
Leu Gly Asp Lys Pro Phe Tyr Arg Ala Gly 275 2802732DNAArtificial
Sequenceprimer 27ttttggtacc cacatttgca aaatgatgaa tg
322841DNAArtificial Sequenceprimer 28catgacttca gtctgctcca
tccaatctgg ttaccgcatt g 412921DNAArtificial Sequenceprimer
29atggagcaga ctgaagtcat g 213021DNAArtificial Sequenceprimer
30tcagttattc tcctgcgaga c 213141DNAArtificial Sequenceprimer
31gtctcgcagg agaataactg agctaccgag ctcgaatttc c 413222DNAArtificial
Sequenceprimer 32cacgacgttg taaaacgacg gc
223332DNAArtificial Sequenceprimer 33ttttggtacc gtttacatat
ggagatgatg tc 323435DNAArtificial Sequenceprimer 34ttttttttct
agagatctag taacatagat gacac 353521DNAArtificial Sequenceprimer
35caatgcctaa taatgtctag c 213643DNAArtificial Sequenceprimer
36catgacttca gtctgctcca tgccgtttga ttttgaattt gag
433732DNAArtificial Sequenceprimer 37ttttcccggg attcttgaat
tacgattgta cc 323846DNAArtificial Sequenceprimer 38cagcttccca
tcagactcgt ccatgccgtt tgattttgaa tttgag 463924DNAArtificial
Sequenceprimer 39atggacgagt ctgatgggaa gctg 244022DNAArtificial
Sequenceprimer 40tcatagatcc ttcccgagtt tc 224142DNAArtificial
Sequenceprimer 41gaaactcggg aaggatctat gagctaccga gctcgaattt cc
424233DNAArtificial Sequenceprimer 42aaaaatctag aattcttgaa
ttacgattgt acc 334335DNAArtificial Sequenceprimer 43tttttttgtc
gacgatctag taacatagat gacac 354443DNAArtificial Sequenceprimer
44cgttacttgc ttcttatcca tgccgtttga ttttgaattt gag
434521DNAArtificial Sequenceprimer 45atggataaga agcaagtaac g
214622DNAArtificial Sequenceprimer 46tcaggtatgt ttaaagctgt tc
224742DNAArtificial Sequenceprimer 47gaacagcttt aaacatacct
gagctaccga gctcgaattt cc 424821DNAArtificial Sequenceprimer
48accaaaggat accctgattt g 214944DNAArtificial Sequenceprimer
49gattttctgg actgtggaag tcatcacgga gatgagagag agag
445024DNAArtificial Sequenceprimer 50atgacttcca cagtccagaa aatc
245119DNAArtificial Sequenceprimer 51tcagagggtc actttaggc
195239DNAArtificial Sequenceprimer 52gcctaaagtg accctctgag
ctaccgagct cgaatttcc 395332DNAArtificial Sequenceprimer
53aaaaaggtac cgatatttga gcaaaactgt gg 325422DNAArtificial
Sequenceprimer 54tcttaccttg tcctgcaacg ag 225541DNAArtificial
Sequenceprimer 55cattgaaatt gccgtccatc tttgtttctg tttagtgaaa g
415619DNAArtificial Sequenceprimer 56atggacggca atttcaatg
195721DNAArtificial Sequenceprimer 57ttagccgaaa acgcgcgaca g
215841DNAArtificial Sequenceprimer 58ctgtcgcgcg ttttcggcta
agctaccgag ctcgaatttc c 415932DNAArtificial Sequenceprimer
59ttttggtacc ctctttcgga acgagcttca ac 326041DNAArtificial
Sequenceprimer 60cttcagtggt cattttcatc tttgtttctg tttagtgaaa g
416119DNAArtificial Sequenceprimer 61atgaaaatga ccactgaag
196219DNAArtificial Sequenceprimer 62tcagacagtc tgtggacgc
196339DNAArtificial Sequenceprimer 63gcgtccacag actgtctgag
ctaccgagct cgaatttcc 396430DNAArtificial Sequenceprimer
64tttttctaga gaacgagctt caacgtagcc 306533DNAArtificial
Sequenceprimer 65aaaaaaagct tgatctagta acatagatga cac
336624DNAArtificial Sequenceprimer 66gatcatacat attcatactt gatg
246747DNAArtificial Sequenceprimer 67gagctgtcag tgttttggtc
atataatttc ttgtatagct ctgtaac 476822DNAArtificial Sequenceprimer
68atgaccaaaa cactgacagc tc 226920DNAArtificial Sequenceprimer
69ttaagccttg aagggcgggc 207040DNAArtificial Sequenceprimer
70gcccgccctt caaggcttaa gctaccgagc tcgaatttcc 407130DNAArtificial
Sequenceprimer 71ttttggtacc cgaagctcaa tcgtctcgag
307246DNAArtificial Sequenceprimer 72gtgctttggt ctatgtggca
tataatttct tgtatagctc tgtaac 467321DNAArtificial Sequenceprimer
73atgccacata gaccaaagca c 217421DNAArtificial Sequenceprimer
74tcagagaatt tcatcgcgaa g 217541DNAArtificial Sequenceprimer
75cttcgcgatg aaattctctg agctaccgag ctcgaatttc c 417631DNAArtificial
Sequenceprimer 76aaaaatctag acgaagctca atcgtctcga g
317719DNAArtificial Sequenceprimer 77tcacaatcga tggactctc
197843DNAArtificial Sequenceprimer 78gtaatgctca gacgttcact
cattgctatg tgtgttttgt agc 437923DNAArtificial Sequenceprimer
79atgagtgaac gtctgagcat tac 238020DNAArtificial Sequenceprimer
80ttaccccgcc cgataaaacg 208140DNAArtificial Sequenceprimer
81cgttttatcg ggcggggtaa gctaccgagc tcgaatttcc 408231DNAArtificial
Sequenceprimer 82ttttggtacc ctatattggt gtcattttgc c
318346DNAArtificial Sequenceprimer 83gagcgtctcg caggagaata
acatggacga gtctgatggg aagctg 468485DNAArtificial Sequenceprimer
84gagcgtctcg caggagaata acagtactga aggcgaagtt aacgcggaag aagaaggctt
60tatggacgag tctgatggga agctg 858579DNAArtificial Sequenceprimer
85gaaactcggg aaggatctaa gtactgaagg cgaagttaac gcggaagaag aaggctttat
60ggagcagact gaagtcatg 798643DNAArtificial Sequenceprimer
86gagcgtctcg caggagaata acatggataa gaagcaagta acg
438782DNAArtificial Sequenceprimer 87gagcgtctcg caggagaata
acagtactga aggcgaagtt aacgcggaag aagaaggctt 60tatggataag aagcaagtaa
cg 828879DNAArtificial Sequenceprimer 88gaacagcttt aaacatacca
gtactgaagg cgaagttaac gcggaagaag aaggctttat 60ggagcagact gaagtcatg
798938DNAArtificial Sequenceprimer 89catgcgtcca cagactgtca
tggacggcaa tttcaatg 389077DNAArtificial Sequenceprimer 90catgcgtcca
cagactgtca gtactgaagg cgaagttaac gcggaagaag aaggctttat 60ggacggcaat
ttcaatg 779178DNAArtificial Sequenceprimer 91cgctgtcgcg cgttttcggc
agtactgaag gcgaagttaa cgcggaagaa gaaggcttta 60tgaaaatgac cactgaag
789238DNAArtificial Sequenceprimer 92gcccgccctt caaggctatg
ccacatagac caaagcac 389377DNAArtificial Sequenceprimer 93gcccgccctt
caaggctagt actgaaggcg aagttaacgc ggaagaagaa ggctttatgc 60cacatagacc
aaagcac 779479DNAArtificial Sequenceprimer 94cttcgcgatg aaattctcag
tactgaaggc gaagttaacg cggaagaaga aggctttatg 60accaaaacac tgacagctc
79
* * * * *