U.S. patent application number 15/699546 was filed with the patent office on 2018-01-25 for micrornas in neurodegenerative disorders.
The applicant listed for this patent is The Brigham and Women`s Hospital, Inc., The General Hospital Corporation. Invention is credited to James Berry, Oleg Butovsky, Merit Cudkowicz, Howard Weiner.
Application Number | 20180023142 15/699546 |
Document ID | / |
Family ID | 48082415 |
Filed Date | 2018-01-25 |
United States Patent
Application |
20180023142 |
Kind Code |
A1 |
Weiner; Howard ; et
al. |
January 25, 2018 |
MICRORNAS IN NEURODEGENERATIVE DISORDERS
Abstract
Provided herein are methods of treating a neurodegenerative
disorder such as Amyotrophic Lateral Sclerosis (ALS) or Multiple
Sclerosis (MS) that include administering to a subject at least one
inhibitory nucleic acid that decreases the level or activity of
microRNA has-miR-155.
Inventors: |
Weiner; Howard; (Brookline,
MA) ; Butovsky; Oleg; (Boston, MA) ;
Cudkowicz; Merit; (Newton, MA) ; Berry; James;
(Belmont, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Brigham and Women`s Hospital, Inc.
The General Hospital Corporation |
Boston
Boston |
MA
MA |
US
US |
|
|
Family ID: |
48082415 |
Appl. No.: |
15/699546 |
Filed: |
September 8, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14350977 |
Apr 10, 2014 |
|
|
|
PCT/US2012/059671 |
Oct 11, 2012 |
|
|
|
15699546 |
|
|
|
|
61601205 |
Feb 21, 2012 |
|
|
|
61545968 |
Oct 11, 2011 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/6.12 |
Current CPC
Class: |
A61P 21/02 20180101;
C12Q 2600/158 20130101; C12Q 2600/178 20130101; A61P 25/00
20180101; C12N 2310/3231 20130101; C12Q 1/6883 20130101; C12N
15/113 20130101; C12N 2310/113 20130101; A61P 21/00 20180101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12N 15/113 20060101 C12N015/113 |
Claims
1. A method of treating a subject having Alzheimer's Disease (AD),
the method comprising identifying a subject who has AD and
administering to the subject having AD at least one inhibitory
nucleic acid comprising a sequence that is complementary to mature
microRNA hsa-miR-155 having the sequence of SEQ ID NO:58, wherein
the inhibitory nucleic acid reduces a level or activity of
hsa-miR-155 in monocytes of the subject.
2. The method of claim 1, wherein the at least one inhibitory
nucleic acid is an antisense oligonucleotide.
3. The method of claim 1, wherein the inhibitory nucleic acid
comprises a sequence that is complementary to at least five
nucleotides of the seed sequence of mature microRNA hsa-miR-155
4. The method of claim 1, wherein the at least one inhibitory
nucleic acid is administered intravenously or intrathecally.
5. The method of claim 1, wherein the at least one inhibitory
nucleic acid is administered by injection into the cerebrospinal
fluid.
6. The method of claim 1, wherein the at least one inhibitory
nucleic acid is complexed with one or more cationic polymers or
cationic lipids.
7. The method of claim 1, wherein the at least one inhibitory
nucleic acid is complementary to a contiguous sequence of at least
12 nucleotides present in hsa-miR-155.
8. The method of claim 1, wherein the at least one inhibitory
nucleic acid is complementary to a contiguous sequence of at least
14 nucleotides present in hsa-miR-155.
9. The method of claim 1, wherein the at least one inhibitory
nucleic acid is complementary to a contiguous sequence of at least
15 nucleotides present in hsa-miR-155.
10. The method of claim 1, wherein the at least one inhibitory
nucleic acid comprises at least one locked nucleic acid (LNA).
11. The method of claim 1, wherein the subject who has AD is human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/350,977, filed Apr. 10, 2014, which is a
U.S. National Phase Application under 35 U.S.C. .sctn.371 of
International Patent Application No. PCT/US2012/059671, filed on
Oct. 11, 2012, which claims prior to U.S. Provisional Patent
Application No. 61/545,968, filed Oct. 11, 2011, and U.S.
Provisional Patent Application No. 61/601,205, filed Feb. 21, 2012,
each of which is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] Inflammation has been implicated in a number of
neurodegenerative disorders (e.g., amyotrophic lateral sclerosis
(ALS) and multiple sclerosis). For example, increased inflammatory
responses have been observed in both human ALS patients and animal
models of ALS (McGreer et al., Muscle Nerve 26: 459-470, 2002;
Beers et al., Proc. Natl. Acad. Sci. U.S.A. 105: 15558-15563, 2008;
Banerjee et al., PLoS ONE 3:e2740, 2008; Chiu et al., Proc. Natl.
Acad. Sci. U.S.A. 105: 17913-17918, 2008; Chiu et al., Proc. Natl.
Acad. Sci. U.S.A. 106: 20960-20965, 2009; Beers et al., Proc. Natl.
Acad. Sci. U.S.A. 103: 16021-16026, 2006; Henkel et al., Ann.
Neurol. 55: 221-235, 2004; Meissner et al., Proc. Natl. Acad. Sci.
U.S.A. 107: 13046-13050, 2010). It has been reported that both
microglia and astrocytes are activated in the central nervous
system in a mouse model of familial ALS (Alexianu et al.,
Neurolog.sub.257: 1282-1289, 2001; Hall et al., Glia 23: 249-256,
1998), and that natural killer cells and peripheral T-cells
infiltrate the spinal cord during neurodegenerative disease
progression in a mouse model of ALS (Chiu et al., Proc. Natl. Acad.
Sci. U.S.A. 105: 17913-17918, 2008).
[0003] In the peripheral nervous system, degeneration of peripheral
motor axons is an early and significant pathological feature in ALS
patients and in animal models of ALS, and is preceded by the
recruitment and activation of macrophages (Chiu et al., Proc. Natl.
Acad. Sci. U.S.A. 106: 20960-20965, 2009). A specific monocyte
subset (Ly6C.sup.Hi) in mice participates in tissue damage and
disease pathogenesis in a mouse models of multiple sclerosis (King
et al., Blood 113: 3190-3197, 2009), and these monocytes are
recruited to inflamed tissues by CCL2 (Kim et al., Immunity 34:
769-780, 2011; Getts et al., J. Exp. Med. 205: 2319-2337,
2008).
SUMMARY OF THE INVENTION
[0004] The invention is based, at least in part, on the discovery
that specific microRNAs and inflammatory marker genes are increased
or decreased in the cerebrospinal fluid (CSF) and in
CD14.sup.+CD16.sup.- and CD14.sup.+CD16.sup.+ monocytes from
subjects having neurodegenerative diseases compared to the
expression level of these microRNAs and these inflammatory marker
genes in the CSF and in CD14.sup.+CD16.sup.- and
CD14.sup.+CD16.sup.+ monocytes from healthy subjects. The specific
microRNAs and inflammatory marker genes that have been identified
as being increased or decreased in the CSF and/or in
CD14.sup.+CD16.sup.- and/or CD14.sup.+CD16.sup.+ monocytes in
subjects having a neurodegenerative disease are listed in Tables
1-21. The inflammatory markers as described herein are listed in
Tables 20 and 21.
[0005] Provided herein are methods of diagnosing a
neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or
multiple sclerosis) in a subject that include determining a level
of one or more microRNAs and/or one or more inflammatory markers
listed in any one or more of Tables 1-21 in a monocyte (e.g.,
CD14.sup.+CD16.sup.- and CD14.sup.+CD16.sup.+ monocyte) or in CSF
from the subject, and comparing the level of the one or more
microRNAs and/or one or more inflammatory markers to a reference
level of the one or more microRNAs and/or one or more inflammatory
markers (e.g., a threshold level or a level present in the CSF, or
a CD14.sup.+CD16.sup.- or a CD14.sup.+CD16.sup.+ monocyte from a
healthy subject). In these methods, an increase or decrease in the
level of the one or more microRNAs and/or the one or more
inflammatory markers relative to the reference level indicates that
the subject has a neurodegenerative disorder.
[0006] Also provided are methods of identifying a subject at risk
of developing a neurodegenerative disorder (e.g., amyotrophic
lateral sclerosis or multiple sclerosis) that include determining a
level of one or more microRNAs and/or one or more inflammatory
markers listed in any one or more of Tables 1-21 in a monocyte
(e.g., CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte (e.g.,
a peripheral or blood-derived monocyte) or CSF from the subject,
and comparing the level of the one or more microRNAs and/or the one
or more inflammatory markers to a reference level of the one or
more microRNAs and/or the one or more inflammatory markers (e.g., a
threshold level or a level present in the CSF, or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte (e.g., a
peripheral or blood-derived monocyte) from a healthy subject). In
these methods, an increase or decrease in the level of the one or
more microRNAs and/or the one or more inflammatory markers relative
to the reference level indicates that the subject has an increased
or decreased risk of developing a neurodegenerative disorder (e.g.,
relative to a person who does not show an increase or decrease in
the level of the one or more microRNAs and/or the one or more
inflammatory markers relative to a reference level).
[0007] Also provided are methods of predicting the rate of disease
progression in a subject having a neurodegenerative disorder (e.g.,
amyotrophic lateral sclerosis or multiple sclerosis) that include
determining a level of one or more microRNAs and/or one or more
inflammatory markers listed in any one or more of Tables 1-21 in a
monocyte (e.g., CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+
monocyte (e.g., a peripheral or blood-derived monocyte) or CSF from
the subject, and comparing the level of the one or more microRNAs
and/or the one or more inflammatory markers to a reference level of
the one or more microRNAs and/or the one or more inflammatory
markers (e.g., a threshold level or a level present in the CSF or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.- monocyte (e.g., a
peripheral or blood-derived monocyte) from a healthy subject). In
these methods, an increase or decrease in the level of the one or
more microRNAs and/or the one or more inflammatory markers relative
to the reference level indicates that the subject will have an
increased or decreased rate of disease progression (e.g., relative
to a person who does not show an increase or decrease in the level
of the one or more microRNAs and/or the one or more inflammatory
markers relative to a reference level).
[0008] Also provided are methods of selecting a subject for
treatment of a neurodegenerative disorder (e.g., amyotrophic
lateral sclerosis or multiple sclerosis) that include determining a
level of one or more microRNAs and/or one or more inflammatory
markers listed in any one or more of Tables 1-21 in a monocyte
(e.g., a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte
(e.g., a periperhal or blood-derived monocyte) or CSF from the
subject; comparing the level of the one or more microRNAs and/or
the one or more inflammatory markers to a reference level of the
one or more microRNAs and/or the one or more inflammatory markers
(e.g., a threshold level or a level present in the CSF, or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte (e.g., a
peripheral or blood-derived monocyte) from a healthy subject); and
selecting a subject having an increase or decrease in the level of
the one or more microRNAs and/or the one or more inflammatory
markers relative to the reference level for treatment of a
neurodegenerative disorder.
[0009] Also provided are methods of determining the efficacy of
treatment of a neurodegenerative disorder (e.g., amyotrophic
lateral sclerosis or multiple sclerosis) in a subject that include
determining a level of one or more microRNAs and/or one or more
inflammatory markers listed in any one or more of Tables 1-21 in a
monocyte (e.g., a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+
monocyte (e.g., a peripheral or blood-derived monocyte)) or CSF
from the subject at a first time point; determining a level of the
one or more microRNAs and/or the one or more inflammatory markers
in a monocyte (e.g., a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+
monocyte (e.g., a peripheral or blood-derived monocyte) or CSF from
the subject at a second time point following administration of at
least one dose of a treatment; and comparing the level of the one
or more microRNAs and/or the one or more inflammatory markers at
the first time point to the level of the one or more microRNAs
and/or the one or more inflammatory markers at the second time
point. In these methods, a return or approach to levels in a
healthy subject at the second time point (e.g., a decrease or
increase in the level of the one or more microRNAs and/or the one
or more inflammatory markers at the second time point compared to
the levels at the first time point as described herein) indicates
that the treatment was effective in the subject (e.g., the
treatment was effective relative to a subject having the same
neurodegenerative disorder and receiving the same treatment, but
does not show a return or approach to levels in a healthy subject
at the second time point (e.g., an increase or decrease in the
level of the one or more microRNAs and/or the one or more
inflammatory markers compared to a reference value as described
herein), or does not show as significant of an increase or decrease
in the level of the one or more microRNAs and/or the one or more
inflammatory markers compared to a reference value as described
herein).
[0010] Also provided are methods for selecting a subject for
participation in a clinical study. These methods include
determining a level of one or more microRNAs and/or one or more
inflammatory markers listed in any one or more of Tables 1-21 in a
monocyte (e.g., CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+
monocyte (e.g., a peripheral or blood-derived monocyte) or CSF from
the subject; comparing the level of the one or more microRNAs
and/or the one or more inflammatory markers to a reference level of
the one or more microRNAs and/or the one or more inflammatory
markers (e.g., a threshold level or a level present in the CSF, or
a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte (e.g., a
peripheral or blood-derived monocyte) from a healthy subject); and
selecting a subject having an increase or a decrease in the level
of the one or more microRNAs and/or the one or more of the
inflammatory markers compared to the reference level for
participation in a clinical study.
[0011] Also provided are methods of treating a neurodegenerative
disorder (e.g., amyotrophic lateral sclerosis or multiple
sclerosis) in a subject that include administering to a subject at
least one agent (e.g., an inhibitory nucleic acid, e.g., an
antagomir) that decreases the expression or activity of one or more
of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18, or any of the inflammatory markers listed in Table 21. Also
provided are methods of treating a neurodegenerative disorder
(e.g., amyotrophic lateral sclerosis or multiple sclerosis) in a
subject that include administering to a subject at least one agent
(e.g., a nucleic acid containing a sense (protein-encoding) nucleic
acid) that increases the expression or activity of one or more of
the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19,
and/or one or more of the inflammatory markers listed in Table
20.
[0012] Also provided are methods of treating a neurodegenerative
disorder (e.g., ALS, such as sporadic ALS or familial ALS, or
multiple sclerosis) in a subject that include administering to a
subject having a neurodegenerative disorder (e.g., ALS, such as
sporadic ALS or familial ALS, or multiple sclerosis) at least one
inhibitory nucleic acid (e.g., siRNA, an antisense oligonucleotide,
an antagomir, and/or a ribozyme) comprising a sequence that is
complementary to a contiguous sequence present in hsa-miR-155
(e.g., a contiguous sequence present in the precursor or mature
form of hsa-miR-155).
[0013] Also provided is an inhibitory nucleic acid comprising a
sequence that is complementary to a contiguous sequence, e.g., a
contiguous sequence of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, present
in hsa-miR-155, hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21,
hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, hsa-miR-103, hsa-miR-532-3p, hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, hsa-miR-15b,
or hsa-miR-19a, for use in treating amyotrophic lateral sclerosis
(ALS) in a subject. Preferably the sequence is complementary to a
contiguous sequence of at least 7 or 8 nucleotides present in
hsa-miR-155.
[0014] Provided herein are methods of diagnosing amyotrophic
lateral sclerosis (ALS) in a subject that include: determining a
level of one or more microRNAs selected from the group consisting
of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21,
hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p,
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, and hsa-miR-580 in a CD14.sup.+CD16.sup.- monocyte
from the subject; and comparing the level of the one or more of
microRNA(s) in a CD14.sup.+CD16.sup.- monocyte from the subject
with a reference level of the one or more microRNA(s); whereby an
increase in the level of one or more of hsa-miR-19b, hsa-miR-106b,
hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16,
hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e,
hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b,
hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, and
hsa-miR-532-3p and/or a decrease in the level of one or more of
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, and hsa-miR-580 in a CD14.sup.+CD16.sup.- monocyte
from the subject as compared to the reference level indicates that
the subject has ALS.
[0015] Also provided are methods of diagnosing amyotrophic lateral
sclerosis (ALS) in a subject that include: determining a level of
one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a
subject; and comparing the level of one or more of hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in the CSF of the subject to a reference level of
the one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p, whereby an increase
in the level of one or more of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the
CSF of the subject compared to the reference level indicates that
the subject has ALS.
[0016] Also provided are methods of diagnosing familial amyotrophic
lateral sclerosis (ALS) in a subject that include: determining a
level of hsa-miR-27b and a level of one or more of hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in
cerebrospinal fluid (CSF) of a subject; and comparing the level of
hsa-miR-27b in the CSF of the subject to a reference level of
hsa-miR-27b, and the level of one or more of hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the
CSF of the subject to a reference level of one or more of
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p; whereby an increase in the level of hsa-miR-27b in
the CSF of the subject compared to the reference level of
hsa-miR-27b, and a decrease or no significant change in the level
of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject compared
to the reference level of one or more of hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p indicates that the
subject has familial ALS.
[0017] Also provided are methods of diagnosing sporadic amyotrophic
lateral sclerosis (ALS) in a subject that include: determining a
level of two or more microRNAs selected from the group consisting
of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) of a
subject; and comparing the level of the two or more microRNAs in
the CSF of the subject to a reference level of the two or more
microRNAs; whereby an increase in the level of the two or more
microRNAs in the CSF of the subject compared to the reference level
indicates that the subject has sporadic ALS.
[0018] Also provided are methods of identifying a subject at risk
of developing amyotrophic lateral sclerosis (ALS) that include:
determining a level of one or more microRNAs selected from the
group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b,
hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p,
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, and hsa-miR-580 in a CD14.sup.+CD16.sup.- monocyte
from the subject; and comparing the level of the one or more
microRNAs in a CD14.sup.+CD16.sup.- monocyte from the subject with
a reference level of the one or more microRNAs; whereby an increase
in the level of one or more of hsa-miR-19b, hsa-miR-106b,
hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16,
hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e,
hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b,
hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, and
hsa-miR-532-3p and/or a decrease in the level of one or more of
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, and hsa-miR-580 in a CD14.sup.+CD16.sup.- monocyte
from the subject as compared to the reference level indicates that
the subject has an increased risk of developing ALS.
[0019] Also provided are methods of identifying a subject at risk
of developing amyotrophic lateral sclerosis (ALS) in a subject that
include: determining a level of one or more of hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and
comparing the level of one or more of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the
CSF of the subject to a reference level of the one or more of
hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328,
and hsa-miR-532-3p, whereby an increase in the level of one or more
of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject compared
to the reference level indicates that the subject has an increased
risk of developing ALS.
[0020] Also provided are methods of identifying a subject at risk
of developing familial amyotrophic lateral sclerosis (ALS) that
include: determining a level of hsa-miR-27b and a level of one or
more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in cerebrospinal fluid (CSF) of a subject; and
comparing the level of hsa-miR-27b in the CSF of the subject to a
reference level of hsa-miR-27b, and the level of one or more of
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in the CSF of the subject to a reference level of
one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328,
and hsa-miR-532-3p, whereby an increase in the level of hsa-miR-27b
in the CSF of the subject compared to the reference level of
hsa-miR-27b, and a decrease or no significant change in the level
of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject compared
to the reference level of one or more of hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p indicates that the
subject has an increased risk of developing familial ALS.
[0021] Also provided are methods of identifying a subject at risk
of developing sporadic amyotrophic lateral sclerosis (ALS) that
include: determining a level of two or more microRNAs selected from
the group consisting of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid
(CSF) of a subject; and comparing the level of the two or more
microRNAs in the CSF of the subject with a reference level of the
two or more microRNAs, whereby an increase in the level of the two
or more microRNAs in the CSF of the subject compared to the
reference level indicates that the subject has an increased risk of
developing sporadic ALS.
[0022] Also provided are methods of predicting the rate of disease
progression in a subject having amyotrophic lateral sclerosis (ALS)
that include: determining a level of one or more microRNAs selected
from the group consisting of: hsa-miR-19b, hsa-miR-106b,
hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16,
hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e,
hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b,
hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p,
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, hsa-miR-580, hsa-miR-15b, and hsa-miR19a in a
CD14.sup.+CD16.sup.- monocyte from the subject; and comparing the
level of the one or more microRNAs in a CD14.sup.-CD16.sup.-
monocyte from the subject to a reference level of the one or more
microRNAs; whereby an increase in the level of one or more of
hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p,
hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101,
hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223,
hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103,
hsa-miR-155, hsa-miR-532-3p, hsa-miR-15b, and miR-19a and/or a
decrease in the level of one or more of hsa-miR-518f, hsa-miR-206,
hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603,
hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p,
hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584,
hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421,
and hsa-miR-580 in a CD14.sup.+CD16.sup.- monocyte from the subject
as compared to the reference level indicates that the subject will
have an increased rate of disease progression.
[0023] Also provided are methods of predicting the rate of disease
progression in a subject having amyotrophic lateral sclerosis (ALS)
that include: determining a level of one or more of hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and
comparing the level of one or more of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the
CSF of the subject to a reference level of the one or more of
hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328,
and hsa-miR-532-3p, whereby an increase in the level of one or more
of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject compared
to the reference level indicates that the subject will have an
increased rate of disease progression. In some embodiments, an
increase in the rate of disease progression is an increased rate of
onset of one or more symptoms of ALS, an increase in the worsening
of one or more symptoms of ALS, an increase in the frequency of one
or more symptoms of ALS, an increase in the duration of one or more
symptoms of ALS, or a decrease in the longevity of the subject.
[0024] Also provided are methods of selecting a subject for
treatment of amyotrophic lateral sclerosis (ALS) that include:
determining a level of one or more microRNAs selected from the
group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b,
hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p,
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, hsa-miR-580, hsa-miR-15b, and hsa-miR-19a in a
CD14.sup.+CD16.sup.- monocyte from the subject; comparing the level
of the one or more microRNAs in a CD14.sup.+CD16.sup.- monocyte
from the subject to a reference level of the one or more microRNAs;
and selecting a subject having an increase in the level of one or
more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21,
hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p,
hsa-miR-15b, and hsa-miR-19a and/or a decrease in the level of one
or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137,
hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192,
hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p,
hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300,
hsa-miR-302c, hsa-miR-328, hsa-miR-421, and hsa-miR-580 in a
CD14.sup.+CD16.sup.- monocyte as compared to the reference level
for treatment of ALS.
[0025] Also provided are methods for selecting a subject for
treatment of amyotrophic lateral sclerosis (ALS) that include:
determining a level of one or more of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in
cerebrospinal fluid (CSF) in a subject; and comparing the level of
one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject to a
reference level of the one or more of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p; and
selecting a subject having an increase in the level of one or more
of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF compared to the
reference level for treatment of ALS.
[0026] Also provided are methods for selecting a subject for
treatment of familial amyotrophic lateral sclerosis (ALS) that
include determining a level of hsa-miR-27b and a level of one or
more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in cerebrospinal fluid (CSF) of a subject; and
comparing the level of hsa-miR-27b in the CSF of the subject to a
reference level of hsa-miR-27b, and the level of one or more of
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in the CSF of the subject to a reference level of
one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328,
and hsa-miR-532-3p; and selecting a subject having an increase in
the level of hsa-miR-27b in the CSF compared to the reference level
of hsa-miR-27b, and a decrease or no significant change in the
level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the CSF compared to the
reference level of one or more of hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p for treatment of
familial ALS.
[0027] Also provided are methods for selecting a subject for
treatment of sporadic amyotrophic lateral sclerosis (ALS) that
include: determining a level of two or more microRNAs selected from
the group consisting of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal
fluid (CSF) of a subject; comparing the level of the two or more
microRNAs in the CSF of the subject to a reference level of the two
or more microRNAs; and selecting a subject having an increase in
the level of the two or more microRNAs in the CSF compared to the
reference level for treatment of sporadic ALS.
[0028] In some embodiments of the methods described herein, the
selected subject is further administered a treatment for ALS.
[0029] Also provided are methods of selecting a subject for
participation in a clinical study that include: determining a level
of one or more microRNAs selected from the group consisting of:
hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p,
hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101,
hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223,
hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103,
hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206,
hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603,
hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p,
hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584,
hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421,
hsa-miR-580, hsa-miR-15b, and hsa-miR-19a in a CD14.sup.+CD16.sup.-
monocyte from the subject; comparing the level of the one or more
microRNAs in a CD14.sup.+CD16.sup.- monocyte from the subject to a
reference level of the one or more microRNAs; and selecting a
subject having an increase in the level of one or more of
hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p,
hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101,
hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223,
hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103,
hsa-miR-155, hsa-miR-532-3p, hsa-miR-15b, and hsa-miR-19a and/or a
decrease in the level of one or more of hsa-miR-518f, hsa-miR-206,
hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603,
hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p,
hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584,
hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421,
and hsa-miR-580 in a CD14.sup.+CD16.sup.- monocyte as compared to
the reference level for participation in a clinical study.
[0030] Also provided are methods of selecting a subject for
participation in a clinical study that include: determining a level
of one or more microRNAs selected from the group consisting of
hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328,
and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject;
comparing the level of the one or more microRNAs in the CSF of the
subject to a reference level of the one or more microRNAs; and
selecting a subject having an increase in the level of the one or
more microRNAs in the CSF compared to the reference level for
participation in a clinical study.
[0031] Also provided are methods of determining the efficacy of
treatment of amyotrophic lateral sclerosis in a subject that
include: determining a level of one or more microRNAs selected from
the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b,
hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p,
hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453,
hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a,
hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p,
hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328,
hsa-miR-421, hsa-miR-580, hsa-miR-15b, and hsa-miR-19a in a
CD14.sup.+CD16.sup.- monocyte from the subject at a first time
point; determining a level of the one or more microRNAs in a
CD14.sup.+/CD16.sup.- monocyte from the subject at a second time
point following administration of at least one dose of a treatment;
and comparing the level of the one or more microRNAs at the first
time point to the level of the one or more microRNAs at the second
time point; whereby a decrease in the level of one or more of
hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p,
hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101,
hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223,
hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103,
hsa-miR-155, hsa-miR-532-3p, hsa-miR-15b, and hsa-miR-19a and/or an
increase in the level of one or more of hsa-miR-518f, hsa-miR-206,
hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603,
hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p,
hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584,
hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421,
and hsa-miR-580 at the second time point as compared to the
level(s) at the first time point indicates that the treatment was
effective in the subject.
[0032] Also provided are methods of determining the efficacy of
treatment of amyotrophic lateral sclerosis (ALS) in a subject that
include: determining a level of one or more of hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in cerebrospinal fluid of the subject at a first
time point; determining a level of one or more of hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in CSF of the subject at a second time point
following administration of at least one dose of a treatment; and
comparing the level of one or more of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p at the
first time point to the level of one or more of hsa-miR-27b,
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p at the second time point; whereby a decrease in the
level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p at the second time
point as compared to the level(s) at the first time point indicates
that the treatment was effective in the subject.
[0033] In some embodiments of any of the methods described herein,
the reference level is a threshold level. In some embodiments, the
reference level is a level found in a CD14.sup.+CD16.sup.- monocyte
(e.g., a peripheral or blood-derived monocyte) from a control
subject. In some embodiments, the reference level is a level found
in the CSF of a control subject.
[0034] Some embodiments of the methods described herein further
include obtaining a biological sample (e.g., a sample containing
blood, plasma, serum, or cerebrospinal fluid) containing a
CD14.sup.+CD16.sup.- monocyte from the subject. In some
embodiments, the method further comprises purifying a
CD14.sup.+CD16.sup.- monocyte from the biological sample.
[0035] Some embodiments of the methods described herein further
include obtaining a sample containing CSF from the subject.
[0036] In some embodiments of any of the methods described herein,
the microRNA or the one or more microRNA is a precursor microRNA.
In some embodiments of any of the methods described herein, the
microRNA or the one or more microRNA is a mature microRNA.
[0037] Also provided are methods of treating amyotrophic lateral
sclerosis (ALS) in a subject that include administering to a
subject having ALS at least one antagomir comprising a sequence
that is complementary to a contiguous sequence (e.g., a contiguous
sequence of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, preferably at least
7 or 8 nucleotides) present in any one of hsa-miR-19b,
hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a,
hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340,
hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a,
hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155,
hsa-miR-532-3p, hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150
hsa-miR-328, has-miR-19a, hsa-miR-15b, hsa-miR-15b, and
hsa-miR-19a.
[0038] Also provided are methods of treating amyotrophic lateral
sclerosis (ALS) in a subject that include administering to a
subject having ALS at least one inhibitory nucleic acid comprising
a sequence that is complementary to a contiguous sequence present
in hsa-miR-155. In some embodiments, the at least one inhibitory
nucleic acid is an antagomir (e.g., an antagomir contains or has a
sequence of SEQ ID NO: 262). In some embodiments, the at least one
inhibitory nucleic acid is an antisense oligonucleotide. In some
embodiments, the at least one inhibitory nucleic acid is a
ribozyme. In some embodiments, the at least one inhibitory
inhibitory nucleic acid is injected into the cerebrospinal fluid of
a subject (e.g., intracranial injection or intrathecal injection).
In some embodiments, the at least one inhibitory nucleic acid is
complexed with one or more cationic polymers and/or cationic
lipids. In some embodiments, the inhibitory nucleic acid is
delivered using a lentivirus vector.
[0039] Also provided are methods of using at least one antagomir
comprising a sequence that is complementary to a contiguous
sequence present in any one of hsa-miR-155, hsa-miR-19b,
hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a,
hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340,
hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a,
hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-532-3p,
hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328,
hsa-miR-15b, and hsa-miR-19a in the manufacture of a medicament for
treating amyotrophic lateral sclerosis in a subject. Also provided
herein are antagomirs comprising a sequence that is complementary
to a contiguous sequence present in any one of hsa-miR-155,
hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p,
hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101,
hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223,
hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103,
hsa-miR-532-3p, hsa-miR-27b, hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, hsa-miR-15b, and hsa-miR-19a for use in
treating amyotrophic lateral sclerosis in a subject.
[0040] Also provided are methods of using at least one inhibitory
nucleic acid (e.g., an antagomir) comprising a sequence that is
complementary to a contiguous sequence present in hsa-miR-155 in
the manufacture of a medicament for treating amyotrophic lateral
sclerosis in a subject. Also provided herein are inhibitory nucleic
acids (e.g., antagomirs) containing a sequence that is
complementary to a contiguous sequence present in hsa-miR-155 for
use in treating amyotrophic lateral sclerosis in a subject.
[0041] As used herein, "RNA" refers to a molecule comprising at
least one or more ribonucleotide residues. A "ribonucleotide" is a
nucleotide with a hydroxyl group at the 2' position of a beta-D-
ribofuranose moiety. The term RNA, as used herein, includes
double-stranded RNA, single- stranded RNA, isolated RNA, such as
partially purified RNA, essentially pure RNA, synthetic RNA,
recombinantly-produced RNA, as well as altered RNA that differs
from naturally-occurring RNA by the addition, deletion,
substitution and/or alteration of one or more nucleotides.
Nucleotides of the RNA molecules can also comprise non-standard
nucleotides, such as non-naturally occurring nucleotides or
chemically synthesized nucleotides or deoxynucleotides.
[0042] A "mature microRNA" (mature miRNA) typically refers to a
single-stranded RNA molecules of about 21-23 nucleotides in length,
which regulates gene expression. miRNAs are encoded by genes from
whose DNA they are transcribed, but miRNAs are not translated into
protein; instead each primary transcript (pri-miRNA) is processed
into a short stem-loop structure (precursor microRNA) before
undergoing further processing into a functional mature miRNA.
Mature miRNA molecules are partially complementary to one or more
messenger RNA (mRNA) molecules, and their main function is to
down-regulate gene expression. As used throughout, the term
"microRNA" or "miRNA" includes both mature microRNA and precursor
microRNA.
[0043] As used herein, the term "inflammatory marker" refers to any
of the proteins or mRNAs listed in Tables 20 and 21. The proteins
and mRNAs listed in Tables 20 and 21 have been implicated for a
role in inflammation. Methods for detecting the levels or activity
of the inflammatory markers are known in the art. Additional
methods for detecting the levels or activity of the inflammatory
markers are described herein.
[0044] By the term "reference level" is meant a control level of
one of the microRNAs listed in Tables 1-19 or one of the
inflammatory markers listed in Tables 20 and 21. A reference level
may represent a threshold level of a specific microRNA or
inflammatory marker. A reference level may also be a level of a
particular microRNA or inflammatory marker present in the
cerebrospinal fluid or in a monocyte (e.g., a CD14.sup.+CD16.sup.-
or CD14.sup.+CD16.sup.+ monocyte (e.g., a peripheral or
blood-derived monocyte)) from a healthy subject (e.g., a subject
that does not present with two or more symptoms of a
neurodegenerative disorder, a subject that has not been diagnosed
with a neurodegenerative disorder, and/or a subject that has no
family history of neurodegenerative disease).
[0045] By the term "increase" is meant an observable, detectable,
or significant increase in a level as compared to a reference level
or a level measured at an earlier or later time point in the same
subject.
[0046] By the term "decrease" is meant an observable, detectable,
or significant decrease in a level as compared to a reference level
or a level measured at an earlier or later time point in the same
subject.
[0047] By the term "neurodegenerative disorder" is meant a
neurological disorder characterized by a progressive loss of
neuronal function and structure, and neuron death. Non-limiting
examples of neurodegenerative disorders include Parkinson's disease
(PD), Alzheimer's disease (AD), Huntington's disease (HD), brain
stroke, brain tumors, cardiac ischemia, age-related macular
degeneration (AMD), retinitis pigmentosa (RP), amyotrophic lateral
sclerosis (ALS, e.g., familial ALS and sporadic ALS), and multiple
sclerosis (MS). Methods for diagnosing a neurodegenerative disorder
are described herein. Additional methods for diagnosing a
neurodegenerative disorder are known in the art.
[0048] By the term "inhibitory RNA" is meant a nucleic acid
molecule that contains a sequence that is complementary to a target
nucleic acid (e.g., a target microRNA or target inflammatory
marker, e.g., any of the microRNAs listed in Tables 1, 3, 5, 7, 9,
11, 12, 14, 16, or 18, or any of the inflammatory markers listed in
Table 21) that mediates a decrease in the level or activity of the
target nucleic acid (e.g., activity in CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte). Non-limiting examples of inhibitory
RNAs include interfering RNA, shRNA, siRNA, ribozymes, antagomirs,
and antisense oligonucleotides. Methods of making inhibitory RNAs
are described herein. Additional methods of making inhibitory RNAs
are known in the art.
[0049] As used herein, "an interfering RNA" refers to any double
stranded or single stranded RNA sequence, capable--either directly
or indirectly (i.e., upon conversion)--of inhibiting or down
regulating gene expression by mediating RNA interference.
Interfering RNA includes but is not limited to small interfering
RNA ("siRNA") and small hairpin RNA ("shRNA"). "RNA interference"
refers to the selective degradation of a sequence-compatible
messenger RNA transcript.
[0050] As used herein "an shRNA" (small hairpin RNA) refers to an
RNA molecule comprising an antisense region, a loop portion and a
sense region, wherein the sense region has complementary
nucleotides that base pair with the antisense region to form a
duplex stem. Following post-transcriptional processing, the small
hairpin RNA is converted into a small interfering RNA by a cleavage
event mediated by the enzyme Dicer, which is a member of the RNase
III family.
[0051] A "small interfering RNA" or "siRNA" as used herein refers
to any small RNA molecule capable of inhibiting or down regulating
gene expression by mediating RNA interference in a sequence
specific manner. The small RNA can be, for example, about 18 to 21
nucleotides long.
[0052] As used herein, an "antagomir" refers to a small synthetic
RNA having complementarity to a specific microRNA target,
optionally with either mispairing at the cleavage site or one or
more base modifications to inhibit cleavage.
[0053] As used herein, the phrase "post-transcriptional processing"
refers to mRNA processing that occurs after transcription and is
mediated, for example, by the enzymes Dicer and/or Drosha.
[0054] By the phrase "risk of developing disease" is meant the
relative probability that a subject will develop a
neurodegenerative disorder in the future as compared to a control
subject or population (e.g., a healthy subject or population).
Provided herein are methods for determining a subject's risk of
developing a neurodegenerative disease in the future that include
determining the level of one or more of the microRNAs listed in
Tables 1-19 and/or one or more of the inflammatory markers listed
in Tables 20-21.
[0055] By the phrase "rate of disease progression" is meant one or
more of the rate of onset of symptoms of a neurodegenerative
disorder in a subject, the rate of the increasing intensity
(worsening) of symptoms of a neurodegenerative disorder in a
subject, the frequency of one or more symptoms of a
neurodegenerative disorder in a subject, the duration of one or
more symptoms of a neurodegenerative disorder in a subject, or the
longevity of subject. For example, an increased rate of disease
progression can include one or more of: an increased rate of onset
of symptoms of a neurodegenerative disorder in a subject, an
increased frequency of one or more symptoms of a neurodegenerative
disorder in a subject, an increase in the duration of one or more
symptoms of a neurodegenerative disorder in a subject, or a
decrease in the longevity of a subject. Methods of predicting the
rate of disease progression in a subject having a neurodegenerative
disorder are described herein.
[0056] By the term "purifying" is meant a partial isolation of a
substance from its natural environment (e.g., partial removal of
contaminating biomolecules or cells). For example, a monocyte
(e.g., a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte) can
be purified from other cell types present in a sample of peripheral
blood (e.g., using fluorescence-assisted cell sorting).
[0057] The term "treating" includes reducing the number of symptoms
or reducing the severity, duration, or frequency of one or more
symptoms of disease (e.g., a neurodegenerative disease) in a
subject. The term treating can also include reducing the risk of
developing a neurodegenerative disorder in a subject, delaying the
onset of symptoms of a neurodegenerative disorder in a subject, or
increasing the longevity of a subject having a neurodegenerative
disorder.
[0058] By the term "cationic polymer" is meant a polymeric material
that is positively-charged at a physiological pH (e.g., a pH of
approximately 6.5 to 8.0) that is capable of condensing nucleic
acids into nanoparticles. Non-limiting examples of cationic
polymers include poly-L-lysine and poly(ethylenimine). Additional
examples of cationic polymers are known in the art.
[0059] By the term "cationic lipids" is meant a lipid that has at
least one positive charge at a physiological pH (e.g., a pH of
approximately 6.5 to 8.0) that is able to form a complex with a
nucleic acid. Non-limiting examples of cationic lipids include
1,2-dioleoyl-3-trimethylammonium propone (DOTAP),
N-methyl-4-(dioleyl)methylpyridinium, and
3.beta.-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol.
Additional examples of cationic lipids are known in the art and are
commercially available (e.g., Lipofectamine.TM. 2000; Life
Technologies Corporation, Carlsbad, Calif.).
[0060] Other definitions appear in context throughout this
disclosure. Unless otherwise defined, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this invention belongs.
Methods and materials are described herein for use in the present
invention; other, suitable methods and materials known in the art
can also be used. The materials, methods, and examples are
illustrative only and not intended to be limiting. All
publications, patent applications, patents, sequences, database
entries, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control.
[0061] Other features and advantages of the invention will be
apparent from the following detailed description and figures, and
from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0062] FIG. 1A is a volcano plot of significantly dysregulated
microRNAs in CD39.sup.+ microglia in SOD.sup.G93A mice compared to
the expression of microRNAs in CD39.sup.+ microglia from
non-transgenic litermates at a presymptomatic (60 days) time point
(Presymptomatic), at the time of onset of symptoms (Onset), and at
the end-stage of the disease (End-Stage). The x-axis represents
changes in expression (log.sub.2-fold change based on ddCT values)
and the y-axis shows the statistical significance of the change in
log-odds.
[0063] FIG. 1B is a Venn diagram of significantly dysregulated
microRNAs in CD39.sup.+ microglia in SOD.sup.G93A mice compared to
the expression of the microRNAs in CD39.sup.+ microglia from
non-transgenic litermates across all disease stages. The numbers
represent significantly dysregulated microRNAs at each disease
stage.
[0064] FIG. 1C is a summary of significantly dysregulated microRNAs
in CD39.sup.+ microglia in SOD.sup.G93A mice compared to the
expression of the microRNAs in CD39.sup.+ microglia from
non-transgenic litermates. These data were validated in singleplex
TaqMan PCR.
[0065] FIG. 2A is a volcano plot of significantly dysregulated
microRNAs in Ly6C.sup.Hi monocytes in SOD.sup.G93A mice compared to
the expression of the microRNAs in Ly6C.sup.Hi monocytes from
non-transgenic litermates at a presymptomatic (60 days) time point
(Presymptomatic), at the time of onset of symptoms (Onset), and at
the end-stage of disease (End-Stage). The x-axis represents changes
in expression (log.sub.2-fold change based on ddCT values) and the
y-axis shows statistical significance of the change in
log-odds.
[0066] FIG. 2B is a Venn diagram of significantly dysregulated
microRNAs in Ly6C.sup.Hi monocytes in SOD.sup.G93A mice compared to
the expression of the microRNAs in Ly6C.sup.Hi monocytes from
non-transgenic litermates across all disease stages
(presymptomatic, onset of symptoms, and the end-stage of disease).
The numbers represent significantly dysregulated microRNAs at each
disease stage.
[0067] FIG. 2C is a summary of significantly dysregulated microRNAs
in Ly6C.sup.Hi monocytes in SOD.sup.G93A mice compared to the
expression of the microRNAs in Ly6C.sup.Hi monocytes from
non-transgenic litermates. These data were validated in singleplex
TaqMan PCR.
[0068] FIG. 3A is a volcano plot of significantly dysregulated
microRNAs in Ly6C.sup.Low monocytes in SOD.sup.G93A mice compared
to the expression of the microRNAs in Ly6C.sup.Low monocytes from
non-transgenic litermates at a presymptomatic (60 days) time point,
at the time of onset of symptoms (Onset), and at the end-stage of
disease (End-Stage). The x-axis represents changes in expression
(log.sub.2-fold change based on ddCT values) and the y-axis shows
statistical significance of the change in log-odds.
[0069] FIG. 3B is a Venn diagram of significantly dysregulated
microRNAs in Ly6C.sup.Low monocytes in SOD.sup.G93A mice compared
to the expression of the microRNAs in Ly6C.sup.Low monocytes from
non-transgenic litermates across all disease stages. The numbers
represent significantly dysregulated microRNAs at each disease
stage.
[0070] FIG. 3C is a summary of significantly dysregulated microRNAs
in Ly6C.sup.Low monocytes in SOD.sup.G93A mice compared to the
expression of the microRNAs in Ly6C.sup.Low monocytes from
non-transgenic litermates. These data were validated in singleplex
TaqMan PCR.
[0071] FIG. 4 is a graph and a table showing the results of
Ingenuity pathway analysis of the 32 dysregulated microRNAs in
Ly6C.sup.Hi monocytes (as compared to non-transgenic litermate
controls) across all disease stages in SOD1 mice. The graph shows
patterns observed in skeletal diseases, muscular diseases, and
myopathic disorders.
[0072] FIG. 5 is a heatmap showing the nCounter expression
profiling of blood-derived CD14.sup.+CD16.sup.- monocytes for 664
microRNAs in sporadic ALS (8 subjects) and relapsing-remitting
multiple sclerosis (8 subjects) compared to the expression of the
microRNAs in CD14.sup.+CD16.sup.- monocytes from healthy controls
(8 subjects). The heatmap shows the results of analysis of variance
(ANOVA) using Dunnett's post hoc test (P<0.01). The microRNAs
upregulated or downregulated in CD14.sup.+CD16.sup.- monocytes from
ALS subjects (as compared to expression of these microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls) are
indicated. Each row of the heatmap represents an individual gene
and each column an individual.
[0073] FIG. 6 is a heatmap showing the nCounter expression
profiling of blood-derived CD14.sup.+CD16.sup.- monocytes for 664
microRNAs in sporadic ALS (8 subjects) and relapsing-remitting
multiple sclerosis (8 subjects) compared to the expression of these
microRNAs in CD14.sup.+CD16.sup.- monocytes from healthy controls
(8 subjects). The heatmap shows the results of ANOVA using
Dunnett's post hoc test (P<0.01). The microRNAs upregulated or
downregulated in CD14.sup.+CD16.sup.- monocytes from MS subjects
(as compared to the expression of the microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls) are
indicated. Each row of the heatmap represents an individual gene
and each column an individual.
[0074] FIG. 7A is a Venn diagram of the unique or similar
dysregulated (upregulated or downregulated) microRNAs in
CD14.sup.+CD16.sup.- monocytes from ALS and MS subjects as compared
to the expression of the microRNAs in CD14.sup.+CD16.sup.-
monocytes from healthy controls.
[0075] FIG. 7B is a volcano plot showing the significantly
dysregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from ALS
subjects as compared to the expression of the microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls.
[0076] FIG. 7C is a volcano plot showing the significantly
dysregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from MS
subjects as compared to the expression of the microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls.
[0077] FIG. 8 is a summary of the significantly dysregulated
microRNAs in CD14.sup.+CD16.sup.- monocytes from ALS and MS
subjects compare d to the expression of the microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls. The bars show
the relative expression of dysregulated microRNAs in
CD14.sup.+CD16.sup.- monocytes from ALS and MS subjects compared to
the expression of the microRNAs in CD14.sup.+CD16.sup.- monocytes
from healthy controls.
[0078] FIG. 9 is a set of six graphs showing the expression of six
different microRNAs in CD14.sup.+CD16.sup.- monocytes from healthy
subjects (8 subjects) and subjects having ALS (11 subjects) (as
determined by real-time PCR). A two-tiled Mann-Whitney t-test was
used to calculate the P values (*, P<0.05; **, P<0.01; ***,
P<0.001).
[0079] FIG. 10A is two graphs showing the clinical scoring (forced
vital capacity (FVC) score and Functional Rating Scale (FRS)) of
eight different ALS patients. A comparison of the microRNA
expression in CD14.sup.+CD16.sup.- monocytes from these eight
patients to microRNA expression in CD14.sup.+CD16.sup.- monocytes
from healthy controls and MS subjects are shown in FIG. 10C.
[0080] FIG. 10B is a list of the eight different ALS patients
described in FIGS. 10A and 10C.
[0081] FIG. 10C is twenty graphs showing the expression of twenty
upregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from
sporadic ALS subjects (8 subjects), healthy subjects, and subjects
having MS (determined using real-time PCR). A two-tiled
Mann-Whitney t-test was used to calculate the P values.
[0082] FIG. 11 is four graphs showing the real-time PCR analysis of
the expression of four upregulated microRNAs in
CD14.sup.+CD16.sup.- monocytes from sporadic ALS (n=11) subjects as
compared to healthy controls (n=8), and subjects with MS (n=8). The
data shown were generated using one-way ANOVA and the Dunett's
multiple comparison test (***, p<0.001).
[0083] FIG. 12A is two graphs showing the clinical scoring (forced
vital capacity (FVC) score and Functional Rating Scale (FRS)) of
eight different ALS patients. A comparison of the microRNA
expression in CD14.sup.+CD16.sup.- monocytes from these eight
patients to microRNA expression in CD14.sup.+CD16.sup.- monocytes
from healthy controls and MS subjects are shown in FIG. 10C.
[0084] FIG. 12B is a list of the eight different ALS patients
described in FIGS. 12A and 12C.
[0085] FIG. 12C is twenty graphs showing the expression of twenty
downregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from
sporadic ALS subjects as compared to healthy subjects, and subjects
having MS-relapsing remitting (MS-RR) (determined using real-time
PCR). A two-tiled Mann-Whitney t-test was used to calculate the P
values (*, P<0.05; **, P<0.01; ***, P<0.001).
[0086] FIG. 13 is eight graphs showing the expression of eight
upregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from
sporadic ALS and MS-RR as compared to healthy subjects, subjects (8
subjects in each group) (determined using real-time PCR). The data
shown were generated using one-way ANOVA and the Dunett's multiple
comparison test (**, P<0.01; ***, p<0.001).
[0087] FIG. 14 is five different graphs showing the expression of
five upregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from
MS-RR subjects as compared to healthy subjects and subjects having
ALS (8 subjects) (determined using real-time PCR). A two-tiled
Mann-Whitney t-test was used to calculate the P values (*,
P<0.05; **, P<0.01; ***, P<0.001).
[0088] FIG. 15 is five graphs showing the expression of five
downregulated microRNAs in CD14.sup.+CD16.sup.- monocytes from
MS-RR subjects as compared to healthy subjects, and subjects having
sporadic ALS (determined by real-time PCR). A two-tiled
Mann-Whitney t-test was used to calculate the P values (*,
P<0.05).
[0089] FIG. 16 is six graphs showing the expression of six
upregulated microRNAs in the cerebrospinal fluid (CSF) from healthy
subjects, subjects with familial ALS (n=5), and subjects with
sporadic ALS (n=10). The data were analyzed using ANOVA with
Bonfferoni's multiple comparison test. *, p<0.05; **, p<0.01;
and ***, p<0.001.
[0090] FIG. 17 is a heatmap showing the nCounter expression
profiles of 179 inflammation related genes ("inflammatory marker
genes") in CD14.sup.+CD16.sup.- monocytes from ALS subjects (n=8)
and MS subjects (n=11) compared to the levels of these inflammatory
marker genes in CD14.sup.+CD16.sup.- monocytes from healthy
controls (n=10). Data analysis was performed using ANOVA with
Dunnett's post hoc test (p<0.01). Each row of the heatmap
represents an individual gene and each column represents an
individual subject.
[0091] FIG. 18A is two volcano plots showing the significantly
dysregulated inflammatory marker genes in CD14.sup.+CD16.sup.-
monocytes from ALS subjects (left graph) and MS subjects (right
graph) compared to the level of the inflammatory marker genes in
CD14.sup.+CD16.sup.- monocytes from healthy controls.
[0092] FIG. 18B is a summary of the significantly dysregulated
inflammatory marker genes in CD14.sup.+CD16.sup.- monocytes from
ALS and MS subjects compared to the level of the inflammatory
marker genes in CD14.sup.+CD16.sup.- monocytes from healthy
controls. The bars show the relative expression of dysregulated
inflammatory marker genes in CD14.sup.-CD16.sup.- monocytes from
ALS and MS subjects compared to the expression of these genes in
CD14.sup.+CD16.sup.- monocytes from healthy controls.
[0093] FIG. 19 is eight graphs showing the expression of eight
different microRNAs in CD14.sup.+CD16.sup.+ monocytes from healthy
controls (n=8) and ALS subjects (n=11) (determined using real-time
PCR). The data were analyzed using the two-tiled Mann-Whitney
t-test (*, P <0.05).
[0094] FIG. 20A is a heatmap showing the nCounter expression
profiles of microRNAs in CD14.sup.+CD16.sup.+ monocytes from ALS
subjects (n=8) and MS subjects (n=8) compared to the expression of
these microRNAs in CD14.sup.+CD16.sup.+ monocytes from healthy
controls (n=8). Data analysis was performed using ANOVA with
Dunnett's post hoc test (p<0.01). Each row of the heatmap
represents an individual gene and each column represents an
individual subject. MicroRNAs upregulated or downregulated in
CD14.sup.+CD16.sup.+ monocytes from ALS subjects relative to
CD14.sup.+CD16.sup.+ monocytes from healthy subjects are
indicated.
[0095] FIG. 20B is a heatmap showing the nCounter expression
profiles of microRNAs in CD14.sup.+CD16.sup.+ monocytes from ALS
subjects (n=8) and MS subjects (n=8) compared to the expression of
the microRNAs in CD14.sup.+CD16.sup.+ monocytes from healthy
controls (n=8). Data analysis was performed using ANOVA with
Dunnett's post hoc test (p<0.01). Each row of the heatmap
represents an individual gene and each column represents an
individual subject. MicroRNAs upregulated or downregulated in
CD14.sup.+CD16.sup.+ monocytes from MS subjects relative to the
expression of the microRNAs in CD14.sup.+CD16.sup.+ monocytes from
healthy subjects are indicated.
[0096] FIG. 20C is a summary of the significantly dysregulated
microRNAs in CD14.sup.+CD16.sup.+ monocytes in ALS and MS subjects
compared to the expression of the microRNAs in CD14.sup.+CD16.sup.+
monocytes from healthy controls. The bars show the relative
expression of dysregulated microRNAs in CD14.sup.+CD16.sup.+
monocytes from ALS and MS subjects compared to the expression of
the microRNAs in CD14.sup.+CD16.sup.+ monocytes in healthy
controls.
[0097] FIG. 21A is nCounter expression profiles of 179 inflammatory
marker genes in Ly6C.sup.Hi spleen-derived monocyte subsets from
SOD1.sup.G93A mice compared to the same cells non-transgenic (Tg)
litermates at presymptomatic (60d), onset (defined by body weight
loss), and end-stage of disease. A heatmap of the ANOVA with
Dunett's post hoc test (P<0.01) results showing genes with at
least 2-fold altered transcription levels is shown. Each row of the
heatmap represents an individual gene and each column an individual
group in biological triplicates (n=3 arrays for each group of pool
of 4-5 mice at each time point). Non-transgenic replicates at each
disease stage were collapsed and genes hierarchically clustered.
Gene expression level was normalized against the geometric mean of
six house-keeping genes (CLTC, GAPDH, GUSB, HPRT1, PGK1, and
TUBB5).
[0098] FIG. 21B is nCounter expression profile data showing
inflammatory marker genes that are significantly downregulated in
Ly6C.sup.Hi spleen-derived monocyte subsets from SOD1.sup.G93A mice
compared to the same cells in non-transgenic (Tg) litermates at
presymptomatic (60 d), onset (defined by body weight loss), and
end-stage of disease.
[0099] FIG. 21C is a list of the major biological networks
activated in Ly6C.sup.Hi spleen-derived monocytes one month prior
to disease onset in SOD1.sup.G93A mice.
[0100] FIG. 21D shows the nCounter expression profile data of genes
upregulated in spinal cord-derived CD39.sup.+ microglia from
SOD1.sup.G93A mice compared to the same cells from non-transgenic
litermates.
[0101] FIG. 21E shows the nCounter expression profile data of genes
downregulated in spinal cord-derived CD39.sup.+ microglia from
SOD1.sup.G93A mice compared to the same cells from non-transgenic
litermates.
[0102] FIG. 21F is a list of the major biological pathways
activated in CD39.sup.- microglia the spinal cords of SOD1 mice at
the onset of disease
[0103] FIG. 21G is a comparative analysis of the significantly
upregulated genes in CD39.sup.+ microglia from spinal cords of SOD1
mice at the onset versus CD39.sup.+ microglia isolated from the
brain of the same SOD1 mice.
[0104] FIG. 22A is an nCounter expression profile of 184
inflammation-related genes in CD14.sup.+CD16.sup.- blood monocytes
from sporadic ALS (n=11) and MS (n=8) subjects compared to healthy
controls (n=10).
[0105] FIG. 22B is a graphic showing the fold differences in
expression of significantly dysregulated genes in sporadic ALS and
MS subjects as compared to healthy controls. Gene expression level
was normalized against the geometric mean of 6 internal reference
house-keeping genes (CLTC, GAPDH, GUSB, PGK1, and TUBB5).
[0106] FIG. 22C is a graphic showing the principal components
analysis (PCA) analysis of the identified dysregulated genes
between sporadic ALS subjects and MS subjects with spatial gene
distribution.
[0107] FIG. 23A is an nCounter expression profile of blood-sorted
CD14.sup.+CD16.sup.- monocytes for 511 immune- and
184-inflammation-related genes in sporadic ALS (10 subjects), and
familial SOD1 ALS (4 subjects) compared to healthy controls (10
subjects). The profile (heatmap) is an unsupervised hierarchial
clustering (Pearson correlation) that shows the significantly
dysregulated genes (Nonparametric Kruskal-Wallis test; significance
based on false discovery rate (FDR) determined by the
Benjamini-Hochberg method; selected FDR limit: 0.05; P<0.01).
Each row of the heatmap represents an individual gene and each
column an individual subject.
[0108] FIG. 23B is a graphic showing the fold differences of
significantly dysregulated genes in blood-sorted
CD14.sup.-CD16.sup.- monocytes from sporadic ALC and familial ALS
subjects versus healthy controls. Gene expression level was
normalized against the geometric mean of 15 internal reference
house-keeping genes (ABCF1, ALAS1, EEF1G, G6PD, GAPDH, GUSB, HPRT1,
OAZ1, POLR1B, POLR2A, PPIA, RPL19, DSHA, TBP, and TUBB).
[0109] FIG. 23C is a graphic of the PCA analysis of the identified
dysregulated genes in blood-sorted CD14.sup.-CD16.sup.- monocytes
from sporadic ALS and familial ALS subjects vs. healthy controls
with spatial gene distribution.
[0110] FIG. 24 is a set of eight graphs showing the real-time PCR
validation of eight genes that were the most significantly
dysregulated in blood-sorted CD14.sup.+CD16.sup.- monocytes from
familial and/or sporadic ALS subjects compared to blood-sorted
CD14.sup.+CD16.sup.- monocytes from healthy controls. The relative
expression in sporadic ALS and familial ALS against healthy
controls was calculated using the comparative Ct
(2-.DELTA..DELTA.Ct) method. Gene expression level was normalized
against the geometric mean of three house-keeping genes (GAPDH,
TUBB, and GRB2). The polymerase chain reactions were run in
duplicate for each subject. The graphs represent one-way analysis
of variance (ANOVA) and the Dunett's multiple comparison test of
significantly dysregulated genes in ALS subjects.
[0111] FIG. 25 is a graphic of the Ingenuity target filter analysis
showing the top 10 miRNA-mRNA interactions in CD14.sup.+CD16.sup.-
blood monocytes from ALS subjects based on the identified
significantly dysregulated miRNAs and mRNAs in CD14.sup.+CD16.sup.-
blood monocytes from ALS subjects.
[0112] FIG. 26 is a table of the results of the microRNA-mRNA
target analysis performed on the data gathered from
CD14.sup.+CD16.sup.- blood monocytes from ALS subjects (IPA;
Ingenuity). The results show 32 miRNAs targeting 27 mRNAs.
[0113] FIG. 27 is a graphic depicting the microRNA-mRNA
interactions in blood-sorted CD14.sup.+CD16.sup.- monocytes in ALS.
The graphic depicts the results for the significantly dysregulated
miRNA and immune-related genes in blood-sorted CD14.sup.+CD16.sup.-
monocytes from ALS subjects. A total of 32 miRNAs targeting 27
mRNAs are shown.
[0114] FIGS. 28A-B is two graphs showing the distribution of
possible random interactions between 1000 random and non-regulated
miRNA-mRNA pairs in comparison to the observed putative miRNA-mRNA
pairs in 41 non-regulated highly expressed miRNAs and the 47
dysregulated genes observed in splenic Lys6C.sup.Hi monocytes from
SOD1 mice (FIG. 28A), and 64 non-regulated highly expressed miRNAs
and the 59 dysregulated genes observed in CD14.sup.+CD16.sup.-
peripheral blood monocytes from ALS subjects (FIG. 28B) (Targetscan
4.1).
[0115] FIG. 29 is a table showing the top 20 transcription factors
and target genes dysregulated in blood-sorted CD14+CD16- monocytes
from ALS subjects (determined using GeneGo pathway analysis), and a
graphic showing the specificity protein-1 (SP1) transcription
factor and its targeted genes in blood-sorted CD14+CD16- monocytes
in ALS subjects.
[0116] FIG. 30 is a graph of the Kaplan-Meir analysis of the
probability of surviving for both the SOD1/miR-155.sup.-/- and the
SOD1/miR-155.sup.+/- mice. Mantel-Cox's F-test comparison between
groups SOD1/miR-155.sup.-/- vs. SOD1/miR-155.sup.+/- mice
(P<0.0001).
[0117] FIG. 31 is graph of the time-to-event analysis for disease
neurologic onset (neurological severity score 2). Disease onset was
significantly delayed (P<0.0001) in SOD1/miR-155.sup.-/- mice
compared to the SOD1/miR-155.sup.+/- mice.
[0118] FIG. 32 is a graph of the rotarod performance of the
SOD1/miR-155.sup.-/- and SOD1/miR-155.sup.+/- mice as a function of
age. **P<0.01; ***P<0.001; by factorial ANOVA and Fisher's
LSD post-hoc test.
[0119] FIG. 33 is a graph of the weight loss of
SOD1/miR-155.sup.-/- and SOD1/miR-155.sup.+/- mice. Statistical
analysis was performed using 2-way ANOVA, Bonferri post-hoc test.
***P<0.001.
[0120] FIG. 34 is a set of two graphs showing the duration of an
early disease phase (from onset to 5% weight loss) (left graph) and
duration of an later disease phase (from 5% weight loss to end
stage) for the SOD1/miR-155.sup.-/- and SOD1/miR-155.sup.+/-
mice.
[0121] FIG. 35A shows the fluorescence-activated cell sorting
(FACS) analysis data of spinal cord-derived mononuclear cells
stained with 4D4 (resident microglia) and CD11b (myeloid cells) in
wildtype, SOD1/miR155.sup.+/+, SOD1/miR155.sup.-/+, and
SOD1/miR155.sup.-/- mice.
[0122] FIG. 35B shows the absolute number of microglia (4D4
positive) and monocyte cells (CD11b positive) cells per spinal cord
in wildtype, SOD1/miR155+/+, SOD1/miR155-/+, and SOD1/miR155-/-
mice.
[0123] FIG. 36 is a set of four heat maps of showing the expression
of inflammation-related genes in spinal cord microglia and
Ly6C.sup.Hi splenic monocytes in WT, SOD1/miR155.sup.-/+, and
SOD1/miR155.sup.-/- mice. The heat maps labeled (a) are from
animals at end-stage. (Note that SOD1/miR155.sup.-/- mice are still
viable and breeding at the end of the study, while SOD1/miR.sup.-/+
mice experience an onset of symptoms (end stage)). All mice are
males C57/B16-SOD1 background. The heat maps labeled (b) indicate
the genes significantly affected by miR155 in SOD1 mice.
[0124] FIG. 37 is nCounter expression profile data showing the
expression of several mouse microRNAs in Ly6CHi spleen-derived
monocyte subsets from wild type, SOD1/miR155.sup.-/+,
SOD1/miR155.sup.-/- mice.
[0125] FIG. 38 is a heatmap and bar graphs showing the nCounter
expression profiling of blood-derived CD14.sup.+CD16.sup.-
monocytes for microRNAs in sporadic ALS (8 subjects) and
relapsing-remitting multiple sclerosis (8 subjects) compared to the
expression of the microRNAs in CD14.sup.+CD16.sup.- monocytes from
healthy controls (8 subjects). The heatmap shows the results of
analysis of variance (ANOVA) using Dunnett's post hoc test
(P<0.01). The microRNAs upregulated or downregulated in
CD14.sup.+CD16.sup.- monocytes from ALS subjects (as compared to
expression of these microRNAs in CD14.sup.+CD16.sup.- monocytes
from healthy controls) are indicated. Each row of the heatmap
represents an individual gene and each column an individual.
DETAILED DESCRIPTION OF THE INVENTION
[0126] The invention is based, at least in part, on the discovery
that specific microRNAs and inflammatory markers are dysregulated
in CD14.sup.+CD16.sup.- monocytes and/or CD14.sup.+CD16.sup.+
monocytes (e.g., peripheral or blood-derived monocytes) from
patients having a neurodegenerative disease, and that specific
microRNAs are present in increased or decreased levels in the
cerebrospinal fluid of patients having a neurodegenerative disorder
(e.g., ALS (e.g., sporadic ALS and familial ALS) and MS) compared
to healthy individuals. The invention is also based on the
discovery that hsa-miR-155 plays a significant role in the
development of disease in a mouse model of ALS. In view of this
discovery, methods for diagnosing a neurodegenerative disorder,
identifying a subject at risk (e.g., increased risk or decreased
risk) of developing a neurodegenerative disorder, predicting the
rate of disease progression in a subject having a neurodegenerative
disorder, selecting a subject for treatment of a neurodegenerative
disorder, selecting a treatment for a subject having a neurological
disorder, determining the efficacy of treatment of a
neurodegenerative disorder, and selecting a subject for
participation in a clinical study are provided herein. These
methods include measuring a level of one or more (e.g., at least 2,
3, 4, 5, 6, 7, 8, 9, or 10) microRNAs listed in one or more of
Tables 1-19 and/or one or more inflammatory markers listed in
Tables 20-21.
[0127] Also provided are methods of treating a neurodegenerative
disorder (e.g., ALS or MS) that include administering to a subject
an agent (e.g., a nucleic acid) that decreases the level or
activity of one or more of the microRNAs listed in Tables 1, 3, 5,
7, 9, 11, 12, 14, 16, or 18 (e.g., hsa-miR-155), and/or increases
the level or activity of one or more of the microRNAs listed in
Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19. Also provided are methods
of treating a neurological disorder (e.g., ALS or MS) that include
administering to a subject an agent (e.g., a nucleic acid) that
decreases the expression (e.g., protein or mRNA) and/or activity of
one or more of the inflammatory markers listed in Table 21 and/or
increases the expression (e.g., protein or mRNA) and/or activity of
one or more of the genes listed in Table 20.
[0128] Also provided are nucleic acids that contain a sequence
complementary to a sequence present in any one of the microRNAs
listed in Tables 1-19 or a sequence present in an mRNA that encodes
any of the genes listed in Tables 20 and 21 (e.g., a primer or
probe). Also provided are nucleic acids that contain a sequence
that is complementary to a sequence present in any one of the
microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18
(the target microRNA), or a sequence present in a mRNA encoded by
any of the genes listed in Table 21 (the target mRNA), that
decrease the expression or activity of the target microRNA or
target mRNA (e.g., an inhibitory RNA, e.g., any of the inhibitory
nucleic acids described herein). Also provided are compositions
that contain a nucleic acid that includes the sequence of any one
of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and
19 (the target microRNA), or a sequence present in an mRNA encoded
by any of the genes listed in Table 20 (the target mRNA), that
increase the expression or activity of the target microRNA or
target mRNA. Also included are compositions that contain at least
one antibody that specifically binds to any one of the proteins
listed in Table 20 and Table 21. Also included are compositions
that contain at least one protein listed in Table 20 and Table 21.
Also provided are kits that contain one or more of the above
nucleic acids, proteins, or antibodies (in any combination).
Neurodegenerative Disorders
[0129] Neurodegenerative disorders are a class of neurological
diseases that are characterized by the progressive loss of the
structure and function of neurons and neuronal cell death.
Inflammation has been implicated for a role in several
neurodegenerative disorders. Progressive loss of motor and sensory
neurons and the ability of the mind to refer sensory information to
an external object is affected in different kinds of
neurodegenerative disorders. Non-limiting examples of
neurodegenerative disorders include Parkinson's disease,
Alzheimer's disease, Huntington's disease, amyotrophic lateral
sclerosis (ALS, e.g., familial ALS and sporadic ALS), and multiple
sclerosis (MS).
[0130] A health care professional may diagnose a subject as having
a neurodegenerative disorder by the assessment of one or more
symptoms of a neurodegenerative disorder in the subject.
Non-limiting symptoms of a neurodegenerative disorder in a subject
include difficulty lifting the front part of the foot and toes;
weakness in arms, legs, feet, or ankles; hand weakness or
clumsiness; slurring of speech; difficulty swallowing; muscle
cramps; twitching in arms, shoulders, and tongue; difficulty
chewing; difficulty breathing; muscle paralysis; partial or
complete loss of vision; double vision; tingling or pain in parts
of body; electric shock sensations that occur with head movements;
tremor; unsteady gait; fatigue; dizziness; loss of memory;
disorientation; misinterpretation of spatial relationships;
difficulty reading or writing; difficulty concentrating and
thinking; difficulty making judgments and decisions; difficulty
planning and performing familiar tasks; depression; anxiety; social
withdrawal; mood swings; irritability; aggressiveness; changes in
sleeping habits; wandering; dementia; loss of automatic movements;
impaired posture and balance; rigid muscles; bradykinesia; slow or
abnormal eye movements; involuntary jerking or writhing movements
(chorea); involuntary, sustained contracture of muscles (dystonia);
lack of flexibility; lack of impulse control; and changes in
appetite. A health care professional may also base a diagnosis, in
part, on the subject's family history of a neurodegenerative
disorder. A health care professional may diagnose a subject as
having a neurodegenerative disorder upon presentation of a subject
to a health care facility (e.g., a clinic or a hospital). In some
instances, a health care professional may diagnose a subject as
having a neurodegenerative disorder while the subject is admitted
in an assisted care facility. Typically, a physician diagnoses a
neurodegenerative disorder in a subject after the presentation of
one or more symptoms.
[0131] Provided herein are additional methods for diagnosing a
neurodegenerative disorder in a subject (e.g., a subject presenting
with one or more symptoms of a neurodegenerative disorder or a
subject not presenting a symptom of a neurodegenerative disorder
(e.g., an undiagnosed and/or asymptomatic subject). Also provided
herein are prognostic methods and methods of treating a
neurodegenerative disorder in a subject (e.g., methods of
decreasing the rate of onset or the progression of symptoms (e.g.,
ataxia) of a neurodegenerative disorder in a subject).
Markers
[0132] Any combination of one or more of the markers described
herein can be used in any of the methods described herein, e.g.,
used in methods for diagnosing a neurodegenerative disorder in a
subject, identifying a subject at risk (e.g., increased or
decreased risk) of developing a neurodegenerative disorder,
predicting the rate of disease progression in a subject having a
neurodegenerative disorder, selecting a subject for treatment of a
neurodegenerative disorder, determining the efficacy of treatment
in a subject having a neurodegenerative disorder, or selecting a
subject for participation in a clinical study.
[0133] MicroRNA markers increased in monocytes
(CD14.sup.-CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes) or the CSF
in subjects having a neurodegenerative disorder relative to healthy
controls (CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes,
or the CSF in healthy controls) are listed in Table 1.
TABLE-US-00001 TABLE 1 List of microRNAs increased in
CD14.sup.+CD16.sup.- monocytes, CD14.sup.+CD16.sup.- monocytes, or
CSF from patients having neurodegenerative disorders compared to
healthy controls Mature miRNA MiRNA sequence Precursor miRNA
sequence hsa-miR-19b gugcaaauccaugcaaaac
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGC uga (SEQ ID NO: 1)
AUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUC CAUGCAAAACUGACUGUGGUAGUG (SEQ ID
NO: 3) ugugcaaauccaugcaaaa ACAUUGCUACUUACAAUUAGUUUUGCAGGUU cuga
(SEQ ID NO: 2) UGCAUUUCAGCGUAUAUAUGUAUAUGUGGCU
GUGCAAAUCCAUGCAAAACUGAUUGUGAUAA UGU (SEQ ID NO: 4) hsa-miR-106b
uaaagugcugacagugca CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAU gau (SEQ ID NO:
5) AGUGGUCCUCUCCGUGCUACCGCACUGUGGGU ACUUGCUGCUCCAGCAGG (SEQ ID NO:
6) hsa-miR-30b uguaaacauccuacacuca ACCAAGUUUCAGUUCAUGUAAACAUCCUACAC
gcu (SEQ ID NO: 7) UCAGCUGUAAUACAUGGAUUGGCUGGGAGGU
GGAUGUUUACUUCAGCUGACUUGGA (SEQ ID NO: 8) hsa-miR-21
uagcuuaucagacugaug UGUCGGGUAGCUUAUCAGACUGAUGUUGACU uuga (SEQ ID NO:
9) GUUGAAUCUCAUGGCAACACCAGUCGAUGGGC UGUCUGACA (SEQ ID NO: 10)
hsa-miR-142- cauaaaguagaaagcacua GACAGUGCAGUCACCCAUAAAGUAGAAAGCAC
5p cu (SEQ ID NO: 11) UACUAACAGCACUGGAGGGUGUAGUGUUUCC
UACUUUAUGGAUGAGUGUACUGUG (SEQ ID NO: 12) hsa-miR-27a
uucacaguggcuaaguuc CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCA cgc (SEQ ID NO:
GGGUCCACACCAAGUCGUGUUCACAGUGGCUA 265) AGUUCCGCCCCCCAG (SEQ ID NO:
13) hsa-miR-16 uagcagcacguaaauauu GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUG
ggcg (SEQ ID NO: GCGUUAAGAUUCUAAAAUUAUCUCCAGUAUU 14)
AACUGUGCUGCUGAAGUAAGGUUGAC (SEQ ID NO: 16) uagcagcacguaaauauu
GUUCCACUCUAGCAGCACGUAAAUAUUGGCGU ggcg (SEQ ID NO:
AGUGAAAUAUAUAUUAAACACCAAUAUUACU 15) GUGCUGCUUUAGUGUGAC (SEQ ID NO:
17) hsa-miR-374a uuauaauacaaccugauaa
UACAUCGGCCAUUAUAAUACAACCUGAUAAGU gug (SEQ ID NO: 18)
GUUAUAGCACUUAUCAGAUUGUAUUGUAAUU GUCUGUGUA (SEQ ID NO: 19)
hsa-miR-374b auauaauacaaccugcuaa ACUCGGAUGGAUAUAAUACAACCUGCUAAGU
gug (SEQ ID NO: 20) GUCCUAGCACUUAGCAGGUUGUAUUAUCAUU GUCCGUGUCU (SEQ
ID NO: 21) hsa-miR-101 uacaguacugugauaacu
UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCU gaa (SEQ ID NO: 22)
GUCUAUUCUAAAGGUACAGUACUGUGAUAAC UGAAGGAUGGCA (SEQ ID NO: 24)
uacaguacugugauaacu ACUGUCCUUUUUCGGUUAUCAUGGUACCGAUG gaa (SEQ ID NO:
23) CUGUAUAUCUGAAAGGUACAGUACUGUGAUA ACUGAAGAAUGGUGGU (SEQ ID NO:
25) hsa-miR-340 uuauaaagcaaugagacu UUGUACCUGGUGUGAUUAUAAAGCAAUGAGA
gauu (SEQ ID NO: CUGAUUGUCAUAUGUCGUUUGUGGGAUCCGU 26)
CUCAGUUACUUUAUAGCCAUACCUGGUAUCUU A (SEQ ID NO: 27) hsa-miR-30e
uguaaacauccuugacug GGGCAGUCUUUGCUACUGUAAACAUCCUUGAC gaag (SEQ ID
NO: UGGAAGCUGUAAGGUGUUCAGAGGAGCUUUC 28)
AGUCGGAUGUUUACAGCGGCAGGCUGCCA (SEQ ID NO: 29) hsa-miR-29c
uagcaccauuugaaaucg AUCUCUUACACAGGCUGACCGAUUUCUCCUGG guua (SEQ ID
NO: UGUUCAGAGUCUGUUUUUGUCUAGCACCAUU 30) UGAAAUCGGUUAUGAUGUAGGGGGA
(SEQ ID NO: 31) hsa-miR-29a uagcaccaucugaaaucg
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAA guua (SEQ ID NO:
UAUAAUUUUCUAGCACCAUCUGAAAUCGGUU 32) AU (SEQ ID NO: 33) hsa-miR-223
ugucaguuugucaaauac CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAU ccca (SEQ ID
NO: UUGACAAGCUGAGUUGGACACUCCAUGUGGU 34)
AGAGUGUCAGUUUGUCAAAUACCCCAAGUGCG GCACAUGCUUACCAG (SEQ ID NO: 35)
hsa-miR-26a uucaaguaauccaggaua GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUG
ggcu (SEQ ID NO: UGCAGGUCCCAAUGGGCCUAUUCUUGGUUACU 36) UGCACGGGGACGC
(SEQ ID NO: 38) uucaaguaauccaggaua GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUA
ggcu (SEQ ID NO: GGCUGUUUCCAUCUGUGAGGCCUAUUCUUGAU 37)
UACUUGUUUCUGGAGGCAGCU (SEQ ID NO: 39) hsa-miR-26b
uucaaguaauucaggaua CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGU ggu (SEQ ID NO:
40) UGUGUGCUGUCCAGCCUGUUCUCCAUUACUUG GCUCGGGGACCGG (SEQ ID NO: 41)
hsa-miR-24 uggcucaguucagcagga CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUC acag
(SEQ ID NO: AUUUUACACACUGGCUCAGUUCAGCAGGAACA 42) GGAG (SEQ ID NO:
44) uggcucaguucagcagga CUCUGCCUCCCGUGCCUACUGAGCUGAAACAC acag (SEQ
ID NO: AGUUGGUUUGUGUACACUGGCUCAGUUCAGC 43) AGGAACAGGG (SEQ ID NO:
45) hsa-miR-181a aacauucaacgcugucgg UGAGUUUUGAGGUUGCUUCAGUGAACAUUCA
ugagu (SEQ ID NO: ACGCUGUCGGUGAGUUUGGAAUUAAAAUCAA 46)
AACCAUCGACCGUUGAUUGUACCCUAUGGCUA ACCAUCAUCUACUCCA (SEQ ID NO: 48)
aacauucaacgcugucgg AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACU ugagu (SEQ ID
NO: CCAAGGAACAUUCAACGCUGUCGGUGAGUUUG 47)
GGAUUUGAAAAAACCACUGACCGUUGACUGU ACCUUGGGGUCCUUA (SEQ ID NO: 49)
hsa-miR-103 agcagcauuguacagggc UACUGCCCUCGGCUUCUUUACAGUGCUGCCUU
uauga (SEQ ID NO: GUUGCAUAUGGAUCAAGCAGCAUUGUACAGG 50)
GCUAUGAAGGCAUUG (SEQ ID NO: 54) agcagcauuguacagggc
UUGUGCUUUCAGCUUCUUUACAGUGCUGCCUU uauga (SEQ ID NO:
GUAGCAUUCAGGUCAAGCAGCAUUGUACAGG 51) GCUAUGAAAGAACCA (SEQ ID NO: 55)
ucauagcccuguacaaug UCAUAGCCCUGUACAAUGCUGCUUGAUCCAUA cugcu (SEQ ID
NO: UGCAACAAGGCAGCACUGUAAAGAAGCCGA 52) (SEQ ID NO: 56)
ucauagcccuguacaaug UCAUAGCCCUGUACAAUGCUGCUUGACCUGAA cugcu (SEQ ID
NO: UGCUACAAGGCAGCACUGUAAAGAAGCUGA 53) (SEQ ID NO: 57) hsa-miR-155
uuaaugcuaaucgugaua CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUG ggggu (SEQ ID
NO: CCUCCAACUGACUCCUACAUAUUAGCAUUAAC 58) AG (SEQ ID NO: 59)
hsa-miR-532- caugccuugaguguagga CGACUUGCUUUCUCUCCUCCAUGCCUUGAGUG 3p
ccgu (SEQ ID NO: UAGGACCGUUGGCAUCUUAAUUACCCUCCCAC 60)
ACCCAAGGCUUGCAAAAAAGCGAGCCU (SEQ ID NO: 61) hsa-miR-320c
aaaagcuggguugagagg UUUGCAUUAAAAAUGAGGCCUUCUCUUCCCAG gu (SEQ ID NO:
62) UUCUUCCCAGAGUCAGGAAAAGCUGGGUUGA GAGGGUAGAAAAAAAAUGAUGUAGG (SEQ
ID NO: 64) aaaagcuggguugagagg CUUCUCUUUCCAGUUCUUCCCAGAAUUGGGAA gu
(SEQ ID NO: 63) AAGCUGGGUUGAGAGGGU (SEQ ID NO: 65) hsa-miR-27b
uucacaguggcuaaguuc ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAU ugc (SEQ ID NO:
66) UGGUGAACAGUGAUUGGUUUCCGCUUUGUUC ACAGUGGCUAAGUUCUGCACCUGAAGAGAAG
GUG (SEQ ID NO: 67) hsa-miR-664 uauucauuuauccccagc
GAACAUUGAAACUGGCUAGGGAAAAUGAUUG cuaca (SEQ ID NO:
GAUAGAAACUAUUAUUCUAUUCAUUUAUCCCC 68) AGCCUACAAAAUGAAAAAA (SEQ ID
NO: 69) hsa-miR-432- ucuuggaguaggucauug
UGACUCCUCCAGGUCUUGGAGUAGGUCAUUGG 5p ggugg (SEQ ID NO:
GUGGAUCCUCUAUUUCCUUACGUGGGCCACUG 70) GAUGGCUCCUCCAUGUCUUGGAGUAGAUCA
(SEQ ID NO: 71) hsa-miR-92a uauugcacuugucccggc
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGC cugu (SEQ ID NO:
UGUGUUUCUGUAUGGUAUUGCACUUGUCCCG 72) GCCUGUUGAGUUUGG (SEQ ID NO: 74)
uauugcacuugucccggc UCAUCCCUGGGUGGGGAUUUGUUGCAUUACU cugu (SEQ ID NO:
UGUGUUCUAUAUAAAGUAUUGCACUUGUCCC 73) GGCCUGUGGAAGA (SEQ ID NO: 75)
hsa-miR-99b cacccguagaaccgaccuu GGCACCCACCCGUAGAACCGACCUUGCGGGGC
gcg (SEQ ID NO: 76) CUUCGCCGCACACAAGCUCGUGUCUGUGGGUC CGUGUC (SEQ ID
NO: 77) hsa-miR-146a ugagaacugaauuccaug
CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAU gguu (SEQ ID NO:
UCCAUGGGUUGUGUCAGUGUCAGACCUCUGAA 78)
AUUCAGUUCUUCAGCUGGGAUAUCUCUGUCAU CGU (SEQ ID NO: 79) hsa-miR-150
ucucccaacccuuguacca CUCCCCAUGGCCCUGUCUCCCAACCCUUGUAC gug (SEQ ID
NO: 80) CAGUGCUGGGCUCAGACCCUGGUACAGGCCUG GGGGACAGGGACCUGGGGAC (SEQ
ID NO: 81) hsa-miR-328 cuggcccucucugcccuu
UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAG ccgu (SEQ ID NO:
AAAGUGCAUACAGCCCCUGGCCCUCUCUGCCC 82) UUCCGUCCCCUG (SEQ ID NO: 83)
hsa-miR-532- ccucccacacccaaggcuu CGACUUGCUUUCUCUCCUCCAUGCCUUGAGUG
3p gca (SEQ ID NO: UAGGACCGUUGGCAUCUUAAUUACCCUCCCAC 84)
ACCCAAGGCUUGCAAAAAAGCGAGCCU (SEQ ID NO: 85) hsa-miR-1260
aucccaccucugccacca ACCUUUCCAGCUCAUCCCACCUCUGCCACCAA (SEQ ID NO: 86)
AACACUCAUCGCGGGGUCAGAGGGAGUGCCAA AAAAGGUAA (SEQ ID NO: 87)
hsa-miR-423 ugaggggcagagagcgag AUAAAGGAAGUUAGGCUGAGGGGCAGAGAGC
acuuu (SEQ ID NO: GAGACUUUUCUAUUUUCCAAAAGCUCGGUCUG 88)
AGGCCCCUCAGUCUUGCUUCCUAACCCGGC (SEQ ID NO: 89) hsa-miR-361-
uuaucagaaucuccaggg GGAGCUUAUCAGAAUCUCCAGGGGUACUUUA 5p guac (SEQ ID
NO: UAAUUUCAAAAAGUCCCCCAGGUGUGAUUCUG 90) AUUUGCUUC (SEQ ID NO: 91)
hsa-miR-93 caaagugcuguucgugca CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUA
gguag (SEQ ID NO: GUGUGAUUACCCAACCUACUGCUGAGCUAGCA 92)
CUUCCCGAGCCCCCGG (SEQ ID NO: 93) hsa-miR-221 agcuacauugucugcugg
UGAACAUCCAGGUCUGGGGCAUGAACCUGGCA guuuc (SEQ ID NO:
UACAAUGUAGAUUUCUGUGUUCGUUAGGCAA 94)
CAGCUACAUUGUCUGCUGGGUUUCAGGCUACC UGGAAACAUGUUCUC (SEQ ID NO: 95)
hsa-miR-20a uaaagugcuuauagugca GUAGCACUAAAGUGCUUAUAGUGCAGGUAGU
gguag (SEQ ID NO: GUUUAGUUAUCUACUGCAUUAUGAGCACUUA 96) AAGUACUGC
(SEQ ID NO: 97) hsa-miR-30c uguaaacauccuacacucu
ACCAUGCUGUAGUGUGUGUAAACAUCCUACAC cagc (SEQ ID NO:
UCUCAGCUGUGAGCUCAAGGUGGCUGGGAGA 98) GGGUUGUUUACUCCUUCUGCCAUGGA (SEQ
ID NO: 100) uguaaacauccuacacucu AGAUACUGUAAACAUCCUACACUCUCAGCUGU
cagc (SEQ ID NO: GGAAAGUAAGAAAGCUGGGAGAAGGCUGUUU 99) ACUCUUUCU (SEQ
ID NO: 101) hsa-miR-15b uagcagcacaucaugguu
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCA uaca (SEQ ID NO:
UGGUUUACAUGCUACAGUCAAGAUGCGAAUC 102)
AUUAUUUGCUGCUCUAGAAAUUUAAGGAAAU UCAU (SEQ ID NO: 103) hsa-let-7g
ugagguaguaguuuguac AGGCUGAGGUAGUAGUUUGUACAGUUUGAGG aguu (SEQ ID NO:
GUCUAUGAUACCACCCGGUACAGGAGAUAACU 104) GUACAGGCCACUGCCUUGCCA (SEQ ID
NO: 105) hsa-let-7b ugagguaguagguugugu
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAG gguu (SEQ ID NO:
GGCAGUGAUGUUGCCCCUCGGAAGAUAACUAU 106) ACAACCUACUGCCUUCCCUG (SEQ ID
NO: 107) hsa-let-7a ugagguaguagguuguau
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAG aguu (SEQ ID NO:
GGUCACACCCACCACUGGGAGAUAACUAUACA 108) AUCUACUGUCUUUCCUA (SEQ ID NO:
111) ugagguaguagguuguau AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAA aguu (SEQ
ID NO: UUACAUCAAGGGAGAUAACUGUACAGCCUCCU 109) AGCUUUCCU (SEQ ID NO:
112) ugagguaguagguuguau GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGC aguu (SEQ
ID NO: UCUGCCCUGCUAUGGGAUAACUAUACAAUCUA 110) CUGUCUUUCCU (SEQ ID
NO: 113) hsa-miR-574- ugaguguguguguguga
GGGACCUGCGUGGGUGCGGGCGUGUGAGUGU 3p gugugu (SEQ ID NO:
GUGUGUGUGAGUGUGUGUCGCUCCGGGUCCAC 114)
GCUCAUGCACACACCCACACGCCCACACUCAG G (SEQ ID NO: 115) hsa-miR-19a
ugugcaaaucuaugcaaa GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACU acuga (SEQ ID
NO: ACAAGAAGAAUGUAGUUGUGCAAAUCUAUGC
116) AAAACUGAUGGUGGCCUGC (SEQ ID NO: 117) hsa-let-7f
ugagguaguagauuguau UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUG aguu (SEQ ID NO:
GGGUAGUGAUUUUACCCUGUUCAGGAGAUAA 118) CUAUACAAUCUAUUGCCUUCCCUGA (SEQ
ID NO: 120) ugagguaguagauuguau UGUGGGAUGAGGUAGUAGAUUGUAUAGUUUU aguu
(SEQ ID NO: AGGGUCAUACCCCAUCUUGGAGAUAACUAUAC 119)
AGUCUACUGUCUUUCCCACG (SEQ ID NO: 121) hsa-miR-140-
cagugguuuuacccuaug UGUGUCUCUCUCUGUGUCCUGCCAGUGGUUUU 5p guag (SEQ ID
NO: ACCCUAUGGUAGGUUACGUCAUGCUGUUCUAC 122)
CACAGGGUAGAACCACGGACAGGAUACCGGGG CACC (SEQ ID NO: 123) hsa-miR-30a
uguaaacauccucgacug GCGACUGUAAACAUCCUCGACUGGAAGCUGUG gaag (SEQ ID
NO: AAGCCACAGAUGGGCUUUCAGUCGGAUGUUU 124) GCAGCUGC (SEQ ID NO: 125)
hsa-miR-190 ugauauguuugauauauu UGCAGGCCUCUGUGUGAUAUGUUUGAUAUAU aggu
(SEQ ID NO: UAGGUUGUUAUUUAAUCCAACUAUAUAUCAA 126)
ACAUAUUCCUACAGUGUCUUGCC (SEQ ID NO: 127) hsa-miR-500
uaauccuugcuaccuggg GCUCCCCCUCUCUAAUCCUUGCUACCUGGGUG ugaga (SEQ ID
NO: AGAGUGCUGUCUGAAUGCAAUGCACCUGGGCA 128) AGGAUUCUGAGAGCGAGAGC (SEQ
ID NO: 130) aauccuugcuaccugggu CCCCCUCUCUAAUCCUUGCUACCUGGGUGAGA
(SEQ ID NO: 129) GUGCUUUCUGAAUGCAGUGCACCCAGGCAAGG AUUCUGCAAGGGGGA
(SEQ ID NO: 131) hsa-let-7i ugagguaguaguuugugc
CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUC uguu (SEQ ID NO:
GGGUUGUGACAUUGCCCGCUGUGGAGAUAAC 132) UGCGCAAGCUACUGCCUUGCUA (SEQ ID
NO: 133) hsa-miR-23a aucacauugccagggauu
GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUG ucc (SEQ ID NO:
CUUCCUGUCACAAAUCACAUUGCCAGGGAUUU 134) CCAACCGACC (SEQ ID NO: 135)
hsa-miR-142- cauaaaguagaaagcacua GACAGUGCAGUCACCCAUAAAGUAGAAAGCAC
3p cu (SEQ ID NO: 136) UACUAACAGCACUGGAGGGUGUAGUGUUUCC
UACUUUAUGGAUGAGUGUACUGUG (SEQ ID NO: 137) hsa-miR-15a
uagcagcacauaaugguu CCUUGGAGUAAAGUAGCAGCACAUAAUGGUU ugug (SEQ ID NO:
UGUGGAUUUUGAAAAGGUGCAGGCCAUAUUG 138) UGCUGCCUCAAAAAUACAAGG (SEQ ID
NO: 139) hsa-miR-191 caacggaaucccaaaagca
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAG gcug (SEQ ID NO:
CAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGC 140) UUGGAUUUCGUCCCCUGCUCUCCUGCCU
(SEQ ID NO: 141) hsa-miR-720 ucucgcuggggccucca
CCGGAUCUCACACGGUGGUGUUAAUAUCUCGC (SEQ ID NO: 142)
UGGGGCCUCCAAAAUGUUGUGCCCAGGGGUGU UAGAGAAAACACCACACUUUGAGAUGAAUUA
AGAGUCCUUUAUUAG (SEQ ID NO: 143) hsa-miR-320a aaaagcuggguugagagg
GCUUCGCUCCCCUCCGCCUUCUCUUCCCGGUU gcga (SEQ ID NO:
CUUCCCGGAGUCGGGAAAAGCUGGGUUGAGA 144) GGGCGAAAAAGGAUGAGGU (SEQ ID
NO: 145) hsa-miR-520g acaaagugcuucccuuua
UCCCAUGCUGUGACCCUCUAGAGGAAGCACUU gagugu (SEQ ID NO:
UCUGUUUGUUGUCUGAGAAAAAACAAAGUGC 146) UUCCCUUUAGAGUGUUACCGUUUGGGA
(SEQ ID NO: 147) hsa-miR-204 uucccuuugucauccuau
GGCUACAGUCUUUCUUCAUGUGACUCGUGGAC gccu (SEQ ID NO:
UUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAU 148)
GAAGGAGGCUGGGAAGGCAAAGGGACGUUCA AUUGUCAUCACUGGC (SEQ ID NO: 149)
hsa-miR-708 aaggagcuuacaaucuag AACUGCCCUCAAGGAGCUUACAAUCUAGCUGG
cuggg (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACAACUAG 252)
ACUGUGAGCUUCUAGAGGGCAGGGA (SEQ ID NO: 253) hsa-miR-197
uucaccaccuucuccaccc GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGG agc (SEQ ID NO:
UAAGAGCUCUUCACCCUUCACCACCUUCUCCA 254) CCCAGCAUGGCC (SEQ ID NO: 255)
hsa-miR- GUCCCUGUUCAG 1274a GCGCCA (SEQ ID NO: 256) hsa-miR-
UCCCUGUUCGGG 1274b CGCCA (SEQ ID NO: 264)
[0134] MicroRNA markers decreased in CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocytes in subjects having a
neurodegenerative disorder relative to healthy controls
(CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes in healthy
controls) are listed in Table 2.
TABLE-US-00002 TABLE 2 List of microRNAs decreased in
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes from
subjects having a neurodegenerative disease compared to healthy
controls Mature miRNA miRNA sequence Precursor miRNA sequence
hsa-miR- gaaagcgcuucucuuuaga UCUCAUGCUGUGACCCUCUAGAGGGAAGCACU 518f
gg (SEQ ID NO: 150) UUCUCUUGUCUAAAAGAAAAGAAAGCGCUUC
UCUUUAGAGGAUUACUCUUUGAGA (SEQ ID NO: 151) hsa-miR-206
uggaauguaaggaagugug UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCC ugg (SEQ ID
NO: CCAUAUGGAUUACUUUGCUAUGGAAUGUAAG 152) GAAGUGUGUGGUUUCGGCAAGUG
(SEQ ID NO: 153) hsa-miR-204 uucccuuugucauccuaug
GGCUACAGUCUUUCUUCAUGUGACUCGUGGAC ccu (SEQ ID NO: 154)
UUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAU GAAGGAGGCUGGGAAGGCAAAGGGACGUUCA
AUUGUCAUCACUGGC (SEQ ID NO: 155) hsa-miR-137 uuauugcuuaagaauacgc
GGUCCUCUGACUCUCUUCGGUGACGGGUAUUC guag (SEQ ID NO:
UUGGGUGGAUAAUACGGAUUACGUUGUUAUU 156)
GCUUAAGAAUACGCGUAGUCGAGGAGAGUAC CAGCGGCA (SEQ ID NO: 157)
hsa-miR-453 AGGUUGUCCGUG UGGUACUCGGAGGGAGGUUGUCCGUGGUGAG
GUGAGUUCGCA UUCGCAUUAUUUAAUGAUGCCCAAUACACGGU (SEQ ID NO: 257)
CGACCUCUUUUCGGUAUCA (SEQ ID NO: 258) hsa-miR-603
cacacacugcaauuacuuu GAUUGAUGCUGUUGGUUUGGUGCAAAAGUAA ugc (SEQ ID NO:
UUGCAGUGCUUCCCAUUUAAAAGUAAUGGCAC 158)
ACACUGCAAUUACUUUUGCUCCAACUUAAUAC UU (SEQ ID NO: 159) hsa-miR-
uucaaguaauucaggug UGUUUAUCUCUAGGGUUGAUCUAUUAGAAUU 1297 (SEQ ID NO:
160) ACUUAUCUGAGCCAAAGUAAUUCAAGUAAUU CAGGUGUAGUGAAAC (SEQ ID NO:
161) hsa-miR-192 cugaccuaugaauugacag
GCCGAGACCGAGUGCACAGGGCUCUGACCUAU cc (SEQ ID NO: 162)
GAAUUGACAGCCAGUGCUCUCGUCUCCCCUCU GGCUGCCAAUUCCAUAGGUCACAGGUAUGUUC
GCCUCAAUGCCAGC (SEQ ID NO: 163) hsa-miR- cucuagagggaagcacuuu
CUCAGGCUGUGACCCUCUAGAGGGAAGCACUU 526a cug (SEQ ID NO:
UCUGUUGCUUGAAAGAAGAGAAAGCGCUUCC 164) UUUUAGAGGAUUACUCUUUGAG (SEQ ID
NO: 166) cucuagagggaagcacuuu GUGACCCUCUAGAGGGAAGCACUUUCUGUUGA cug
(SEQ ID NO: AAGAAAAGAACAUGCAUCCUUUCAGAGGGUU 165) AC (SEQ ID NO:
167) hsa-miR- ggggguccccggugcucgg CUCGGGAGGGGCGGGAGGGGGGUCCCCGGUGC
615-5p auc (SEQ ID NO: 168) UCGGAUCUCGAGGGUGCUUAUUGUUCGGUCCG
AGCCUGGGUCUCCCUCUUCCCCCCAACCCCCC (SEQ ID NO: 169) hsa-miR-655
auaauacaugguuaaccuc AACUAUGCAAGGAUAUUUGAGGAGAGGUUAU uuu (SEQ ID NO:
CCGUGUUAUGUUCGCUUCAUUCAUCAUGAAUA 170)
AUACAUGGUUAACCUCUUUUUGAAUAUCAGA CUC (SEQ ID NO: 171) hsa-miR-
uuuugcaauauguuccuga GCAGAAUUAUUUUUGCAAUAUGUUCCUGAAU 450b-5p aua
(SEQ ID NO: 172) AUGUAAUAUAAGUGUAUUGGGAUCAUUUUGC AUCCAUAGUUUUGUAU
(SEQ ID NO: 173) hsa-miR- aaaaguaauugugguuuug
CAGACUAUAUAUUUAGGUUGGCGCAAAAGUA 548b-3p gcc (SEQ ID NO: 174)
AUUGUGGUUUUGGCCUUUAUUUUCAAUGGCA AGAACCUCAGUUGCUUUUGUGCCAACCUAAUA
CUU (SEQ ID NO: 175) hsa-miR-584 uuaugguuugccugggacu
UAGGGUGACCAGCCAUUAUGGUUUGCCUGGG gag (SEQ ID NO:
ACUGAGGAAUUUGCUGGGAUAUGUCAGUUCC 176)
AGGCCAACCAGGCUGGUUGGUCUCCCUGAAGC AAC (SEQ ID NO: 177) hsa-miR-
aaaaacuguaauuacuuuu AUUAGGUUGGUGCAAAAGUAAUCACAGUUUU 548f (SEQ ID
NO: 178) UGACAUUACUUUCAAAGACAAAAACUGUAAU UACUUUUGGACCAACCUAAUAG
(SEQ ID NO: 183) aaaaacuguaauuacuuuu
UAAUAACUAUUAGGUUGGUGCGAACAUAAUU (SEQ ID NO: 179)
GCAGUUUUUAUCAUUACUUUUAAUGGCAAAA ACUGUAAUUACUUUUGCACCAACCUAAUAUUU
UAGU (SEQ ID NO: 184) aaaaacuguaauuacuuuu
AUUAGGUUGGUGCAAACCUAAUUGCAAUUUU (SEQ ID NO: 180)
UGCAGUUUUUUUAAGUAAUUGCAAAAACUGU AAUUACUUUUGCACCAACCUAAUAC (SEQ ID
NO: 185) aaaaacuguaauuacuuuu GAGUUCUAACGUAUUAGGUUGGUGCAAAAGU (SEQ
ID NO: 181) AAUAGUGGUUUUUGCCAUUAAAAGUAAUGAC
AAAAACUGUAAUUACUUUUGGAACAAUAUUA AUAGAAUUUCAG (SEQ ID NO: 186)
aaaaacuguaauuacuuuu UAUUAGGUUGCUGCAAAAGUAAUCAUGUUUU (SEQ ID NO:
182) UUUCCAUUGUAAGUAAUGGGAAAAACUGUAA UUACUUUUGUACCAACCUAAUAGC (SEQ
ID NO: 187) hsa-miR-300 uauacaagggcagacucuc
UGCUACUUGAAGAGAGGUAAUCCUUCACGCAU ucu (SEQ ID NO:
UUGCUUUACUUGCAAUGAUUAUACAAGGGCA 188) GACUCUCUCUGGGGAGCAAA (SEQ ID
NO: 189) hsa-miR- uaagugcuuccauguuuca
CCUUUGCUUUAACAUGGGGGUACCUGCUGUGU 302c gugg (SEQ ID NO:
GAAACAAAAGUAAGUGCUUCCAUGUUUCAGU 190) GGAGG (SEQ ID NO: 191)
hsa-miR-328 cuggcccucucugcccuuc UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAG cgu
(SEQ ID NO: 82) AAAGUGCAUACAGCCCCUGGCCCUCUCUGCCC UUCCGUCCCCUG (SEQ
ID NO: 83) hsa-miR-421 aucaacagacauuaauugg
GCACAUUGUAGGCCUCAUUAAAUGUUUGUUG gcgc (SEQ ID NO:
AAUGAAAAAAUGAAUCAUCAACAGACAUUAA 192) UUGGGCGCCUGCUCUGUGAUCUC (SEQ
ID NO: 193) hsa-miR-580 uugagaaugaugaaucauu
AUAAAAUUUCCAAUUGGAACCUAAUGAUUCA agg (SEQ ID NO:
UCAGACUCAGAUAUUUAAGUUAACAGUAUUU 194)
GAGAAUGAUGAAUCAUUAGGUUCCGGUCAGA AAUU (SEQ ID NO: 195) hsa-miR-651
uuuaggauaagcuugacuu AAUCUAUCACUGCUUUUUAGGAUAAGCUUGA uug (SEQ ID NO:
CUUUUGUUCAAAUAAAAAUGCAAAAGGAAAG 196)
UGUAUCCUAAAAGGCAAUGACAGUUUAAUGU GUUU (SEQ ID NO: 197) hsa-miR-379
ugguagacuauggaacgua AGAGAUGGUAGACUAUGGAACGUAGGCGUUA gg (SEQ ID NO:
198) UGAUUUCUGACCUAUGUAACAUGGUCCACUAA CUCU (SEQ ID NO: 199)
hsa-miR- ugggucuuugcgggcgaga CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGC
193a-3p uga (SEQ ID NO: GGGCGAGAUGAGGGUGUCGGAUCAACUGGCC 200)
UACAAAGUCCCAGUUCUCGGCCCCCG (SEQ ID NO: 201) hsa-miR-
uucuccaaaagaaagcacu UCUCAUGCAGUCAUUCUCCAAAAGAAAGCACU 515-3p uucug
(SEQ ID NO: UUCUGUUGUCUGAAAGCAGAGUGCCUUCUUU 202)
UGGAGCGUUACUGUUUGAGA (SEQ ID NO: 204) uucuccaaaagaaagcacu
UCUCAUGCAGUCAUUCUCCAAAAGAAAGCACU uucug (SEQ ID NO:
UUCUGUUGUCUGAAAGCAGAGUGCCUUCUUU 203) UGGAGCGUUACUGUUUGAGA (SEQ ID
NO: 205) hsa-miR-598 uacgucaucguugucaucg
GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAU uca (SEQ ID NO: 206)
CCCGAUGGUGUGAGCUGGAAAUGGGGUGCUA CGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCC
GAG (SEQ ID NO: 207) hsa-miR- uucacagggaggugucau
GGGAUGCCACAUUCAGCCAUUCAGCGUACAGU 513a-5p (SEQ ID NO: 208)
GCCUUUCACAGGGAGGUGUCAUUUAUGUGAA CUAAAAUAUAAAUUUCACCUUUCUGAGAAGG
GUAAUGUACAGCAUGCACUGCAUAUGUGGUG UCCC (SEQ ID NO: 210)
uucacagggaggugucau GGAUGCCACAUUCAGCCAUUCAGUGUGCAGUG (SEQ ID NO:
209) CCUUUCACAGGGAGGUGUCAUUUAUGUGAAC
UAAAAUAUAAAUUUCACCUUUCUGAGAAGGG UAAUGUACAGCAUGCACUGCAUAUGUGGUGU CC
(SEQ ID NO: 211) hsa-miR-640 augauccaggaaccugccu
GUGACCCUGGGCAAGUUCCUGAAGAUCAGACA cu (SEQ ID NO: 212)
CAUCAGAUCCCUUAUCUGUAAAAUGGGCAUGA UCCAGGAACCUGCCUCUACGGUUGCCUUGGGG
(SEQ ID NO: 213) hsa-miR- aaaacuguaauuacuuuug
AGUUAUUAGAUUAGUGCAAAAGUAAUUGCAG 548g uac (SEQ ID NO: 214)
UUUUUGCAUUACGUUCUAUGGCAAAACUGUA AUUACUUUUGUACCAACAUAAUACUUC (SEQ ID
NO: 215) hsa-miR- uguucauguagauguuuaa
CAGUGUUCAUGUAGAUGUUUAAGCUCUUGCA 1206 gc (SEQ ID NO: 216)
GUAGGUUUUUGCAAGCUAGUGAACGCUG (SEQ ID NO: 217) hsa-miR-383
agaucagaaggugauugug CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUG gcu (SEQ ID NO:
GGUGGAUAUUAAUCAGCCACAGCACUGCCUGG 218) UCAGAAAGAG (SEQ ID NO: 219)
hsa-miR-649 aaaccuguguuguucaaga GGCCUAGCCAAAUACUGUAUUUUUGAUCGACA
guc (SEQ ID NO: UUUGGUUGAAAAAUAUCUAUGUAUUAGUAAA 220)
CCUGUGUUGUUCAAGAGUCCACUGUGUUUUGC UG (SEQ ID NO: 221) hsa-miR-592
uugugucaauaugcgauga UAUUAUGCCAUGACAUUGUGUCAAUAUGCGA ugu (SEQ ID NO:
UGAUGUGUUGUGAUGGCACAGCGUCAUCACG 222)
UGGUGACGCAACAUCAUGACGUAAGACGUCAC AAC (SEQ ID NO: 223) hsa-miR-
cuguaauauaaauuuaauu CUGUAAUAUAAAUUUAAUUUAUUCUCUAUCA 2054 uauu (SEQ
ID NO: UUAAAAAAUGUAUUACAG (SEQ ID NO: 225) 224) hsa-miR-
uuuugcgauguguuccuaa AAACGAUACUAAACUGUUUUUGCGAUGUGUU 450a uau (SEQ
ID NO: CCUAAUAUGCACUAUAAAUAUAUUGGGAACA 226)
UUUUGCAUGUAUAGUUUUGUAUCAAUAUA (SEQ ID NO: 228) uuuugcgauguguuccuaa
CCAAAGAAAGAUGCUAAACUAUUUUUGCGAU uau (SEQ ID NO:
GUGUUCCUAAUAUGUAAUAUAAAUGUAUUGG 227)
GGACAUUUUGCAUUCAUAGUUUUGUAUCAAU AAUAUGG (SEQ ID NO: 229) hsa-miR-
aauccuuggaaccuaggug CUUGAAUCCUUGGAACCUAGGUGUGAGUGCU 362-3p ugagu
(SEQ ID NO: AUUUCAGUGCAACACACCUAUUCAAGGAUUCA 230) AA (SEQ ID NO:
231) hsa-miR- ugggucuuugcgggcgaga CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGC
193a-3p uga (SEQ ID NO: GGGCGAGAUGAGGGUGUCGGAUCAACUGGCC 232)
UACAAAGUCCCAGUUCUCGGCCCCCG (SEQ ID NO: 233) hsa-miR-566
gggcgccugugaucccaac GCUAGGCGUGGUGGCGGGCGCCUGUGAUCCCA (SEQ ID NO:
234) ACUACUCAGGAGGCUGGGGCAGCAGAAUCGCU
UGAACCCGGGAGGCGAAGGUUGCAGUGAGC (SEQ ID NO: 235) hsa-miR-
cauaaaguagaaagcacuac GACAGUGCAGUCACCCAUAAAGUAGAAAGCAC 142-3p u (SEQ
ID NO: 236) UACUAACAGCACUGGAGGGUGUAGUGUUUCC
UACUUUAUGGAUGAGUGUACUGUG (SEQ ID NO: 237) hsa-miR-15a
uagcagcacauaaugguuu CCUUGGAGUAAAGUAGCAGCACAUAAUGGUU gug (SEQ ID NO:
UGUGGAUUUUGAAAAGGUGCAGGCCAUAUUG 238) UGCUGCCUCAAAAAUACAAGG (SEQ ID
NO: 239) hsa-miR- aaaaccgucuaguuacagu
ACAGCUGUAAUUAGUCAGUUUUCUGUCCUGUC 1537 ugu (SEQ ID NO:
CACACAGAAAACCGUCUAGUUACAGUUGU 240) (SEQ ID NO: 241) hsa-miR-
ucagugcaucacagaacuu CAAGCACGAUUAGCAUUUGAGGUGAAGUUCU 148b ugu (SEQ
ID NO: GUUAUACACUCAGGCUGUGGCUCUCUGAAAGU 242)
CAGUGCAUCACAGAACUUUGUCUCGAAAGCUU UCUA (SEQ ID NO: 243) hsa-miR-494
ugaaacauacacgggaaacc GAUACUCGAAGGAGAGGUUGUCCGUGUUGUC uc (SEQ ID NO:
244) UUCUCUUUAUUUAUGAUGAAACAUACACGGG AAACCUCAGUAUC (SEQ ID NO: 245)
hsa-miR- agaucgaccguguuauauu UUGAAGGGAGAUCGACCGUGUUAUAUUCGCU 369-3p
cgc (SEQ ID NO: 246) UUAUUGACUUCGAAUAAUACAUGGUUGAUCU UUUCUCAG (SEQ
ID NO: 247) hsa-miR-10a uacccuguagauccgaauu
GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGA ugug (SEQ ID NO:
UCCGAAUUUGUGUAAGGAAUUUUGUGGUCAC 248)
AAAUUCGUAUCUAGGGGAAUAUGUAGUUGAC AUAAACACUCCGCUCU (SEQ ID NO: 249)
hsa-miR-30d uguaaacauccccgacugg GUUGUUGUAAACAUCCCCGACUGGAAGCUGUA
aag (SEQ ID NO: 250) AGACACAGCUAAGCUUUCAGUCAGAUGUUUGC UGCUAC (SEQ
ID NO: 251) hsa-miR-660 uacccauugcauaucggag
CUGCUCCUUCUCCCAUACCCAUUGCAUAUCGG uug (SEQ ID NO:
AGUUGUGAAUUCUCAAAACACCUCCUGUGUGC
260) AUGGAUUACAGGAGGGUGAGCCUUGUCAUCG UG (SEQ ID NO: 259)
accuccugugugcauggau ua (SEQ ID NO: 261)
[0135] MicroRNA markers increased in monocytes
(CD14.sup.-CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes) or the CSF
in subjects having ALS relative to healthy controls
(CD14.sup.+CD16.sup.- or CD14.sup.-CD16.sup.+ monocytes, or the CSF
in healthy controls) are listed in Table 3.
TABLE-US-00003 TABLE 3 List of microRNAs increased in
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes, or in the
CSF in subjects having ALS relative to healthy controls.
hsa-miR-19b hsa-miR-26b hsa-let-7a hsa-miR-106b hsa-miR-24
hsa-miR-574-3p hsa-miR-30b hsa-miR-181a hsa-miR-19a hsa-miR-21
hsa-miR-103 hsa-let-7f hsa-miR-142-5p hsa-miR-155 hsa-miR-140-5p
hsa-miR-27a hsa-miR-532-3p hsa-miR-30a hsa-miR-16 hsa-miR-1260
hsa-miR-190 hsa-miR-374a hsa-miR-423 hsa-miR-500 hsa-miR-374b
hsa-miR-361-5p hsa-let-7i hsa-miR-101 hsa-miR-93 hsa-miR-23a
hsa-miR-340 hsa-miR-221 hsa-miR-142-3p hsa-miR-30e hsa-miR-20a
hsa-miR-15a hsa-miR-29c hsa-miR-30c hsa-let-7b hsa-miR-29a
hsa-miR-15b hsa-miR-26a hsa-miR-223 hsa-let-7g
[0136] MicroRNA markers decreased in monocytes
(CD14.sup.+CD16.sup.- or CD14.sup.-CD16.sup.+ monocytes) in
subjects having ALS relative to healthy controls
(CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes in healthy
controls) are listed in Table 4.
TABLE-US-00004 TABLE 4 List of microRNAs decreased in
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes in subjects
having ALS compared to healthy controls. hsa-miR-518f hsa-miR-655
hsa-miR-421 hsa-miR-383 hsa-miR-206 hsa-miR-450b- hsa-miR-651
hsa-miR-649 5p hsa-miR-204 hsa-miR-548b- hsa-miR-379 hsa-miR-592 3p
hsa-miR-137 hsa-miR-584 hsa-miR-193a-3p hsa-miR-2054 hsa-miR-453
hsa-miR-548f hsa-miR-515-3p hsa-miR-566 hsa-miR-603 hsa-miR-300
hsa-miR-598 hsa-miR-494 hsa-miR-1297 hsa-miR-302c hsa-miR-513a-5p
hsa-miR-142-3p hsa-miR-192 hsa-miR-328 hsa-miR-640 hsa-miR-1206
hsa-miR-526a hsa-miR-421 hsa-miR-548g hsa-miR-580 hsa-miR-615-5p
hsa-miR-660
[0137] MicroRNA markers increased in CD14.sup.+CD16.sup.- monocytes
from ALS patients relative to CD14.sup.+CD16.sup.- monocytes from
healthy controls are listed in Table 5.
TABLE-US-00005 TABLE 5 List of microRNAs increased in
CD14.sup.+CD16.sup.- monocytes from ALS patients relative to
CD14.sup.+CD16.sup.- monocytes from healthy controls. hsa-miR-1260
hsa-let-7g hsa-miR-26a hsa-miR-500 hsa-miR-30a hsa-let-7b
hsa-miR-16 hsa-miR-150 hsa-miR-423 hsa-let-7a hsa-miR-374b
hsa-miR-30e hsa-miR-361-5p hsa-miR-574-3p hsa-miR-140-5p
hsa-miR-29c hsa-miR-93 hsa-miR-26b hsa-miR-101 hsa-miR-29a
hsa-miR-103 hsa-miR-532-3p hsa-miR-142-5p hsa-miR-223 hsa-miR-24
hsa-miR-19a hsa-miR-374a hsa-mIR-423 hsa-miR-221 hsa-let-7f
hsa-miR-340 hsa-miR-1260 hsa-miR-20a hsa-miR-27a hsa-miR-21
hsa-miR-30a hsa-miR-30c hsa-miR-106b hsa-miR-155 hsa-miR-30b
hsa-miR-181a hsa-miR-19b hsa-miR-146a hsa-miR-190 hsa-miR-15b
[0138] MicroRNAs that are decreased in CD14.sup.+CD16.sup.-
monocytes from ALS patients relative to CD14.sup.+CD16.sup.-
monocytes from healthy controls are listed in Table 6.
TABLE-US-00006 TABLE 6 List of microRNAs decreased in
CD14.sup.+CD16.sup.- monocytes from ALS patients relative to
CD14.sup.+CD16.sup.- monocytes from healthy controls. hsa-miR-328
hsa-miR-513a-5p hsa-miR-302c hsa-miR-453 hsa-miR-651 hsa-miR-640
hsa-miR-2054 hsa-miR-204 hsa-miR-379 hsa-miR-548g hsa-miR-584
hsa-miR-518f hsa-miR-300 hsa-miR-1206 hsa-miR-655 hsa-miR-206
hsa-miR-548f hsa-miR-450b-5p hsa-miR-421 hsa-miR-192
hsa-miR-193a-3p hsa-miR-548b-3p hsa-miR-615-5p hsa-miR-566
hsa-miR-137 hsa-miR-383 hsa-miR-526a hsa-miR-598 hsa-miR-580
hsa-miR-649 hsa-miR-603 hsa-miR-515-3p hsa-miR-592 hsa-miR-1297
hsa-miR-660
[0139] MicroRNA markers uniquely increased in CD14.sup.+CD16.sup.-
monocytes from ALS patients relative to CD14.sup.+CD16.sup.-
monocytes from both MS subjects and healthy controls are listed in
Table 7.
TABLE-US-00007 TABLE 7 List of microRNAs uniquely increased in
CD14.sup.+CD16.sup.- monocytes from ALS patients relative to
CD14.sup.+CD16.sup.- monocytes from both MS subjects and healthy
controls hsa-miR-19b hsa-miR-16 hsa-miR-29c hsa-miR-181a
hsa-miR-106b hsa-miR-374a hsa-miR-29a hsa-miR-103 hsa-miR-30b
hsa-miR-374b hsa-miR-223 hsa-miR-155 hsa-miR-21 hsa-miR-101
hsa-miR-26a hsa-miR-532-3p hsa-miR-142-5p hsa-miR-340 hsa-miR-26b
hsa-miR-24 hsa-miR-27a hsa-miR-30e
[0140] MicroRNA markers uniquely decreased in CD14.sup.+CD16.sup.-
monocytes from ALS patients relative to CD14.sup.+CD16.sup.-
monocytes from both MS subjects and healthy controls are listed in
Table 8.
TABLE-US-00008 TABLE 8 List of microRNAs uniquely decreased in
CD14.sup.+CD16.sup.- monocytes from ALS patients relative to
CD14.sup.+CD16.sup.- monocytes from both MS subjects and healthy
controls hsa-miR-518f hsa-miR-603 hsa-miR-655 hsa-miR-300
hsa-miR-206 hsa-miR-1297 hsa-miR-450b-5p hsa-miR-302c hsa-miR-204
hsa-miR-192 hsa-miR-548b-3p hsa-miR-328 hsa-miR-137 hsa-miR-526a
hsa-miR-584 hsa-miR-421 hsa-miR-453 hsa-miR-615-5p hsa-miR-548f
hsa-miR-580
[0141] MicroRNA markers increased in CD14.sup.+CD16.sup.+ monocytes
from ALS patients relative to CD14.sup.+CD16.sup.+ monocytes from
healthy controls are listed in Table 9.
TABLE-US-00009 TABLE 9 List of microRNAs increased in
CD14.sup.+CD16.sup.+ monocytes from ALS patients relative to
CD14.sup.+CD16.sup.+ monocytes from healthy controls hsa-miR-708
hsa-miR-24 hsa-miR-26a hsa-miR-21 hsa-miR-142-5p hsa-miR-103
hsa-miR-30b hsa-miR-142-3p hsa-miR-15b hsa-miR-23a hsa-miR-16
hsa-miR-340 hsa-miR-223 hsa-miR-29a hsa-miR-15a hsa-let-7i
[0142] MicroRNA markers decreased in CD14+CD16+ monocytes from ALS
patients relative to CD14.sup.+CD16.sup.+ monocytes from healthy
controls are listed in Table 10.
TABLE-US-00010 TABLE 10 List of microRNAs decreased in
CD14.sup.+CD16.sup.+ monocytes from ALS patients relative to
CD14.sup.+CD16.sup.+ monocytes from healthy controls hsa-miR-598
hsa-miR-494 hsa-miR-142-3p
[0143] MicroRNA markers uniquely increased in CSF from subjects
having sporadic ALS or familial ALS compared to CSF from healthy
controls are listed in Table 11.
TABLE-US-00011 TABLE 11 List of microRNAs uniquely increased in CSF
from subjects having sporadic ALS or familial ALS compared to CSF
from healthy controls miRNA Form of ALS hsa-miR-27b Familial and
sporadic ALS hsa-miR-99b Sporadic ALS hsa-miR-146a Sporadic ALS
hsa-miR-150 Sporadic ALS hsa-miR-328 Familial and Sporadic ALS
hsa-miR-532-3p Familial and Sporadic ALS
[0144] MicroRNA markers increased in monocytes
(CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes) in
subjects having MS relative to healthy controls
(CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ in healthy controls)
are listed in Table 12.
TABLE-US-00012 TABLE 12 List of microRNAs increased in
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes in subjects
having MS relative to CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+
monocytes in healthy controls. hsa-miR-320c hsa-miR-1260
hsa-miR-19b hsa-miR-340 hsa-let-320a hsa-miR-27b hsa-miR-720
hsa-miR-106b hsa-miR-26b hsa-miR-520g hsa-miR-664 hsa-miR-1274a
hsa-let-7g hsa-miR-1260 hsa-miR-204 hsa-miR-432-5p hsa-miR-423
hsa-miR-181a hsa-miR-361-5p hsa-miR-29a hsa-miR-92a hsa-miR-197
hsa-miR-140-5p hsa-miR-374b hsa-miR-23a hsa-miR-24 hsa-miR-30a
hsa-miR-142-5p hsa-let-7a hsa-miR-142-3p hsa-miR-93 hsa-miR-221
hsa-miR-19a hsa-miR-532-3p hsa-miR-103 hsa-miR-20a hsa-miR-361-5p
hsa-let-7b hsa-miR-155 hsa-miR-15a hsa-miR-let-7a hsa-miR-103
hsa-miR-221 hsa-miR-27a hsa-miR-21 hsa-miR-30c hsa-miR-16
hsa-miR-15b hsa-miR-146a hsa-miR-223 hsa-miR-181a hsa-miR-30b
hsa-miR-574-3p hsa-let-7i hsa-miR-1274b hsa-miR-423 hsa-miR-26a
hsa-let-7f hsa-let-191
[0145] MicroRNA markers decreased in monocytes
(CD14.sup.+CD16.sup.- or CD14.sup.-CD16.sup.+ monocytes) in
subjects having MS relative to healthy controls
(CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes in healthy
controls) are listed in Table 13.
TABLE-US-00013 TABLE 13 List of microRNAs decreased in
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocytes in subjects
having MS compared to CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+
monocytes in healthy controls hsa-miR-649 hsa-miR-362-3p
hsa-miR-603 hsa-miR-15a hsa-miR-383 hsa-miR-450b-5p hsa-miR-584
hsa-miR-1537 hsa-miR-1206 hsa-miR-302c hsa-miR-204 hsa-miR-148b
hsa-miR-548g hsa-miR-548f hsa-miR-526a hsa-miR-369-3p hsa-miR-640
hsa-miR-328 hsa-miR-453 hsa-miR-615-5p hsa-miR-592 hsa-miR-580
hsa-miR-2054 hsa-miR-10a hsa-miR-598 hsa-miR-421 hsa-miR-655
hsa-miR-30d hsa-miR-515-3p hsa-miR-1297 hsa-miR-518f hsa-miR-494
hsa-miR-513a-5p hsa-miR-548b-3p hsa-miR-206 hsa-miR-142-3p
hsa-miR-651 hsa-miR-615-5p hsa-miR-192 hsa-miR-651 hsa-miR-379
hsa-miR-137 hsa-miR-450a hsa-miR-193a-3p hsa-miR-300
hsa-miR-566
[0146] MicroRNA markers increased in CD14.sup.+CD16.sup.- monocytes
from MS patients relative to CD14.sup.+CD16.sup.- monocytes from MS
patients are listed in Table 14.
TABLE-US-00014 TABLE 14 List of microRNAs increased in
CD14.sup.+CD16.sup.- monocytes from MS patients relative to
CD14.sup.+CD16.sup.- monocytes from healthy controls. hsa-miR-720
hsa-miR-20a hsa-let-7g hsa-miR-26b hsa-miR-1274a hsa-miR-93
hsa-miR-181a hsa-miR-21 hsa-miR-320c hsa-miR-361-5p hsa-140-5p
hsa-miR-374b hsa-miR-27b hsa-miR-423 hsa-142-5p hsa-let-7a
hsa-miR-664 hsa-miR-24 hsa-miR-19a hsa-miR-532-3p hsa-miR-1260
hsa-miR-103 hsa-let-7b hsa-miR-155 hsa-miR-423 hsa-miR-16
hsa-miR-15b hsa-miR-27a hsa-miR-197 hsa-miR-30b hsa-miR-574-3p
hsa-miR-146a hsa-miR-30a hsa-miR-26a hsa-let-7f hsa-miR-92a
hsa-miR-30c hsa-miR-19b hsa-miR-340 hsa-miR-1274b hsa-miR-221
hsa-miR-106b hsa-miR-101
[0147] MicroRNA markers decreased in CD14.sup.+CD16.sup.- monocytes
from MS patients relative to CD14.sup.+CD16.sup.- monocytes from
healthy patients are listed in Table 15.
TABLE-US-00015 TABLE 15 List of microRNAs decreased in
CD14.sup.+CD16.sup.- monocytes from MS patients relative to
CD14.sup.+CD16.sup.- monocytes from healthy controls. hsa-miR-649
hsa-miR-193a-3p hsa-miR-615- hsa-miR-206 5p hsa-miR-383
hsa-miR-450a hsa-miR-137 hsa-miR-192 hsa-miR-1206 hsa-miR-362-3p
hsa-miR-300 hsa-miR-566 hsa-miR-548g hsa-miR-450b-5p hsa-miR-603
hsa-miR-142-3p hsa-miR-640 hsa-miR-302c hsa-miR-584 hsa-miR-15a
hsa-miR-592 hsa-miR-548f hsa-miR-204 hsa-miR-1537 hsa-miR-598
hsa-miR-328 hsa-miR-526a hsa-miR-148b hsa-miR-515-3p hsa-miR-580
hsa-miR-453 hsa-miR-379 hsa-miR-513a-5p hsa-miR-421 hsa-miR-2054
hsa-miR-548b-3p hsa-miR-651 hsa-miR-1297 hsa-miR-655
hsa-miR-518f
[0148] MicroRNA markers uniquely increased in CD14.sup.+CD16.sup.-
monocytes from MS patients relative to CD14.sup.+CD16.sup.-
monocytes from both ALS subjects and healthy controls are listed in
Table 16.
TABLE-US-00016 TABLE 16 List of microRNAs uniquely increased in
CD14.sup.+CD16.sup.- monocytes from MS patients relative to
CD14.sup.+CD16.sup.- monocytes from both ALS subjects and healthy
controls hsa-miR-320c hsa-miR-664 hsa-miR-92a hsa-miR-27b
hsa-miR-432-5p
[0149] MicroRNA markers uniquely decreased in CD14.sup.+CD16.sup.-
monocytes from MS patients relative to CD14.sup.+CD16.sup.-
monocytes from both ALS subjects and healthy controls are listed in
Table 17.
TABLE-US-00017 TABLE 17 List of microRNAs uniquely decreased in
CD14.sup.+CD16.sup.- monocytes from MS patients relative to
CD14.sup.+CD16.sup.- monocytes from both ALS subjects and healthy
controls hsa-miR-142-3p hsa-miR-1537 hsa-miR-148b hsa-miR-15a
hsa-miR-362-3p
[0150] MicroRNA markers increased in CD14.sup.+CD16.sup.+ monocytes
from MS patients compared to CD14.sup.+CD16.sup.+ monocytes from
healthy controls are shown in Table 18.
TABLE-US-00018 TABLE 18 List of microRNAs increased in
CD14.sup.+CD16.sup.+ monocytes from MS patients compared to
CD14+CD16+ monocytes from healthy controls hsa-let-7i hsa-miR-520g
hsa-miR-24 hsa-miR-21 hsa-miR-191 hsa-miR-204 hsa-miR-30b
hsa-miR-16 hsa-miR-1260 hsa-miR-340 hsa-miR-142-3p hsa-miR-142-5p
hsa-miR-720 hsa-miR-15b hsa-miR-103 hsa-miR-223 hsa-miR-1274a
hsa-miR-29a hsa-miR-15a hsa-miR-320a hsa-miR-23a hsa-miR-26a
[0151] MicroRNA markers decreased in CD14.sup.+CD16.sup.+ monocytes
from MS patients relative to CD14.sup.+CD16.sup.+ monocytes from
healthy controls are listed in Table 19.
TABLE-US-00019 TABLE 19 List of microRNAs decreased in
CD14.sup.+CD16.sup.+ monocytes from MS patients relative to
CD14.sup.+CD16.sup.+ monocytes from healthy controls hsa-miR-369-3p
hsa-miR-10a hsa-miR-598 hsa-miR-615-5p hsa-miR-30d hsa-miR-494
[0152] Inflammatory markers decreased in CD14.sup.+CD16.sup.-
monocytes from patients having neurodegenerative disorders relative
to CD14.sup.-CD16.sup.- monocytes from healthy controls are listed
in Table 20.
TABLE-US-00020 TABLE 20 List of inflammatory markers decreased in
CD14.sup.+CD16.sup.- monocytes from patients having
neurodegenerative disorders relative to CD14.sup.+CD16.sup.-
monocytes from healthy controls Protein sequence (NCBI Accession
No.; mRNA sequence (NCBI Accession No.; Marker Version No.) Version
No.) BCL6 NP_001128210; NP_001128210.1 NM_001134738; NM_001134738.1
NP_001124317; NP_001124317.1 NM_001130845; NM_001130845.1 IL1RAP
NP_001161401; NP_001161401.1 NM_001167929; NM_001167929.1
NP_001161402; NP_001161402.1 NM_001167930; NM_001167930.1
NP_001161403; NP_001161403.1 NM_001167931; NM_001167931.1 PLCB1
NP_056007; NP_056007.1 NM_015192; NM_015192.2 NP_877398;
NP_877398.1 NM_182734; NM_182734.1 MAFK AAC14426; AAC14426.1
AF059194; AF059194.1 NFE2L2 NP_006155; NP_006155.2 NM_006164;
NM_006164.3 NP_001138884; NP_001138884.1 NM_001145412;
NM_001145412.1 NP_001138885; NP_001138885.1 NM_001145413;
NM_001145413.1 DDIT3 NP_001181982; NP_001181982.1 NM_001195053;
NM_001195053.1 NP_001181983; NP_001181983.1 NM_001195054;
NM_001195054.1 NP_001181984TN; NP_001181984.1 NM_001195055;
NM_001195055.1 NP_001181985; NP_001181985.1 NM_001195056;
NM_001195056.1 NP_004074; NP_004074.2 NM_004083; NM_004083.5 GNAQ
NP_002063; NP_002063.2 NM_002072; NM_002072.3 RAPGEF2 NP_055062;
NP_055062.1 NM_014247; NM_014247.2 MAFG NP_002350; NP_002350.1
NM_002359; NM_002359.3 NP_116100; NP_116100.2 NM_032711;
NM_032711.3 PTK2N NP_722560; NP_722560.1 NM_153831; NM_153831.3
NP_005598; NP_005598.3 NM_005607; NM_005607.4 NP_001186578;
NP_001186578.1 NM_001199649; NM_001199649.1 MKNK1 NP_003675;
NP_003675.2 NM_003684; NM_003684.4 NP_945324; NP_945324.1
NM_198973; NM_198973.2 NP_001129025; NP_001129025.1 NM_001135553;
NM_001135553.1 RIPK1 NP_003795; NP_003795.2 NM_003804; NM_003804.3
IL15 NP_751915; NP_751915.1 NM_172175; NM_172175.2 NP_000576;
NP_000576.1 NM_000585; NM_000585.4 MAP3K1 NP_005912; NP_005912.1
NM_005921; NM_005921.1 PPP1R12B NP_001184060; NP_001184060.1
NM_001197131; NM_001197131.1 NP_001161330; NP_001161330.1
NM_001167858; NM_001167858.1 NP_001161329; NP_001161329.1
NM_001167857; NM_001167857.1 NP_115287; NP_115287.1 NM_032104;
NM_032104.2 NP_115286; NP_115286.1 NM_032103; NM_032103.2
NP_002472; NP_002472.2 NM_002481; NM_002481.3 MAPK14 NP_620582;
NP_620582.1 NM_139013; NM_139013.2 NP_001306; NP_001306.1
NM_001315; NM_001315.2 NP_620583; NP_620583.1 NM_139014;
NM_139014.2 NP_620581; NP_620581.1 NM_139012; NM_139012.2 CXCR4
NP_001008540; NP_001008540.1 NM_001008540; NM_001008540.1
NP_003458; NP_003458.1 NM_003467; NM_003467.2 MEF2A NP_001165365;
NP_001165365.1 NM_001171894; NM_001171894.1 NP_001124400;
NP_001124400.1 NM_001130928; NM_001130928.1 NP_001124399;
NP_001124399.1 NM_001130927; NM_001130927.1 NP_001124398;
NP_001124398.1 NM_001130926; NM_001130926.1 NP_005578; NP_005578.2
NM_005587; NM_005587.2 TGFB1 NP_000651; NP_000651.3 NM_000660;
NM_000660.4 NR3C1 NP_001191194; NP_001191194.1 NM_001204265;
NM_001204265.1 NP_001019265; NP_001019265.1 NM_001024094;
NM_001024094.1 NP_001018661; NP_001018661.1 NM_001020825;
NM_001020825.1 NP_001018087; NP_001018087.1 NM_001018077;
NM_001018077.1 NP_001018086; NP_001018086.1 NM_001018076;
NM_001018076.1 NP_001018085; NP_001018085.1 NM_001018075;
NM_001018075.1 NP_001018084; NP_001018084.1 NM_001018074;
NM_001018074.1 NP_000167; NP_000167.1 NM_000176; NM_000176.2 MAP3K5
NP_005914; NP_005914.1 NM_005923; NM_005923.3 CDC42 NP_426359;
NP_426359.1 NM_044472; NM_044472.2 NP_001782; NP_001782.1
NM_001791; NM_001791.3 NP_001034891; NP_001034891.1 NM_001039802;
NM_001039802.1 RAF1 NP_002871; NP_002871.1 NM_002880; NM_002880.3
CFB NP_001701; NP_001701.2 NM_001710; NM_001710.5 ITGB2 NP_000202;
NP_000202.2 NM_000211; NM_000211.3 NP_001120963; NP_001120963.1
NM_001127491; NM_001127491.1 ATF2 NP_001871; NP_001871.2 NM_001880;
NM_001880.2 CREB1 NP_004370; NP_004370.1 NM_004379; NM_004379.3
NP_604391; NP_604391.1 NM_134442; NM_134442.3 MAP2K6 NP_002749;
NP_002749.2 NM_002758; NM_002758.3 MAP3K7 NP_663306; NP_663306.1
NM_145333; NM_145333.1 NP_663305; NP_663305.1 NM_145332;
NM_145332.1 NP_663304; NP_663304.1 NM_145331; NM_145331.1
NP_003179; NP_003179.1 NM_003188; NM_003188.2 RPS6KA5 NP_004746;
NP_004746.2 NM_004755; NM_004755.2 NP_872198; NP_872198.1
NM_182398; NM_182398.1 TRADD NP_003780; NP_003780.1 NM_003789;
NM_003789.3 C5 NP_001726; NP_001726.2 NM_001735; NM_001735.2 NCR1
NP_004820; NP_004820.1 NM_004829; NM_004829.5 NP_001138929;
NP_001138929.1 NM_001145457; NM_001145457.1 NP_001138930;
NP_001138930.1 NM_001145458; NM_001145458.1 NP_001229285;
NP_001229285.1 NM_001242356; NM_001242356.1 NP_001229286;
NP_001229286.1 NM_001242357; NM_001242357.1 SOCS1 NP_003736;
NP_003736.1 NM_003745; NM_003745.1 TAGAP NP_687034; NP_687034.1
NM_152133; NM_152133.1 NP_473455; NP_473455.2 NM_054114;
NM_054114.3 NP_620165; NP_620165.1 NM_138810; NM_138810.2 PTGS2
NP_000954; NP_000954.1 NM_000963; NM_000963.2 PRDM1 NP_001189;
NP_001189.2 NM_001198; NM_001198.3 NP_878911; NP_878911.1
NM_182907; NM_182907.2 PLAUR NP_002650; NP_002650.1 NM_002659;
NM_002659.3 NP_001005376; NP_001005376.1 NM_00100537;
NM_001005376.2 FOS NP_005243; NP_005243.1 NM_005252; NM_005252.3
NFKBIZ NP_113607; NP_113607.1 NM_031419; NM_031419.3 NP_001005474;
NP_001005474.1 NM_001005474; NM_001005474.2 LILRA5 NP_067073;
NP_067073.1 NM_021250; NM_021250.2 NP_871714; NP_871714.1
NM_181985; NM_181985.2 NP_870994; NP_870994.1 NM_181879;
NM_181879.2 NP_871715; NP_871715.1 NM_181986; NM_181986.2 RIPK2
NP_003812; NP_003812.1 NM_003821; NM_003821.5 LCP2 NP_005556;
NP_005556.1 NM_005565; NM_005565.3 LITAF NP_004853; NP_004853.2
NM_004862; NM_004862.3 NP_037531; NP_037531.2 NM_013399;
NM_013399.2 NP_001129945; NP_001129945.1 NM_001136473;
NM_001136473.1 NR_024320; NR_024320.1 TNFRSF8 NP_001234;
NP_001234.2 NM_001243; NM_001243.3 NP_694421; NP_694421.1
NM_152942; NM_152942.2 MEF2D NP_005911; NP_005911.1 NM_005920;
NM_005920.2 CDKN1A NP_000380; NP_000380.1 NM_000389; NM_000389.2
NP_510867; NP_510867.1 NM_078467; NM_078467.2 NP_001207707;
NP_001207707.1 NM_001220778; NM_001220778.1 NP_001207706;
NP_001207706.1 NM_001220777; NM_001220777.1 CD83 NP_004224;
NP_004224.1 NM_004233; NM_004233.3 NP_001035370; NP_001035370.1
NM_001040280; NM_001040280.1 NP_001238830; NP_001238830.1
NM_001251901; NM_001251901.1 CASP10 NP_116759; NP_116759.2
NM_032977; NM_032977.3 NP_116756; NP_116756.2 NM_032974;
NM_032974.4 NP_001221; NP_001221.2 NM_001230; NM_001230.4
NP_116758; NP_116758.1 NM_032976; NM_032976.3 NP_001193471;
NP_001193471.1 NM_001206542; NM_001206542.1 NP_001193453;
NP_001193453.1 NM_001206524; NM_001206524.1 LTB4R NP_858043;
NP_858043.1 NM_181657; NM_181657.3 NP_001137391; NP_001137391.1
NM_001143919; NM_001143919.2
[0153] Inflammatory markers uniquely increased in
CD14.sup.+CD16.sup.- monocytes from patients having
neurodegenerative disorders relative to CD14.sup.+CD16.sup.-
monocytes from healthy controls are listed in Table 21.
TABLE-US-00021 TABLE 21 List of inflammatory markers increased in
CD14.sup.+CD16.sup.- monocytes from patients having
neurodegenerative disorders relative to CD14.sup.+CD16.sup.-
monocytes from healthy controls Protein sequence (NCBI Accession
No.; mRNA sequence (NCBI Accession No.; Marker Version No.) Version
No.) CSF1 NP_000748; NP_000748.3 NM_000757; NM_000757.5 NP_757351;
NP_757351.1 NM_172212; NM_172212.2 NP_757349; NP_757349.1
NM_172210; NM_172210.2 IL10 NP_000563; NP_000563.1 NM_000572;
NM_000572.2 IL1A NP_000566; NP_000566.3 NM_000575; NM_000575.3
HLA-DRA NP_061984; NP_061984.2 NM_019111; NM_019111.4 RAC1
NP_061485; NP_061485.1 NM_018890; NM_018890.3 NP_008839;
NP_008839.2 NM_006908; NM_006908.4 GRB2 NP_987102; NP_987102.1
NM_203506; NM_203506.2 NP_002077; NP_002077.1 NM_002086;
NM_002086.4 PLA2G4A NP_077734; NP_077734.1 NM_024420; NM_024420.2
GNAS NP_001070956; NP_001070956.1 NM_001077488; NM_001077488.2
NP_001070957; NP_001070957.1 NM_001077489; NM_001077489.2
NP_001070958; NP_001070958.1 NM_001077490; NM_001077490.1
NP_057676; NP_057676.1 NM_016592; NM_016592.2 NP_536351;
NP_536351.1 NM_080426; NM_080426.2 NP_536350; NP_536350.2
NM_080425; NM_080425.2 NP_000507; NP_000507.1 NM_000516;
NM_000516.4 GNB1 NP_002065; NP_002065.1 NM_002074; NM_002074.3
TGFB3 NP_003230; NP_003230.1 NM_003239; NM_003239.2 IL6R NP_000556;
NP_000556.1 NM_000565; NM_000565.3 NP_852004; NP_852004.1
NM_181359; NM_181359.2 NP_001193795; NP_001193795.1 NM_001206866;
NM_001206866.1 CXCL3 NP_002081; NP_002081.2 NM_002090; NM_002090.2
IL18 NP_001553; NP_001553.1 NM_001562; NM_001562.3 NP_001230140;
NP_001230140.1 NM_001243211; NM_001243211.1 IL1RN NP_776214;
NP_776214.1 NM_173842; NM_173842.2 NP_000568; NP_000568.1
NM_000577; NM_000577.4 NP_776213; NP_776213.1 NM_173841;
NM_173841.2 NP_776215; NP_776215.1 NM_173843; NM_173843.2 KEAP1
NP_036421; NP_036421.2 NM_012289; NM_012289.3 NP_987096;
NP_987096.1 NM_203500; NM_203500.1 LIMK1 NP_002305; NP_002305.1
NM_002314; NM_002314.3 NP_001191355; NP_001191355.1 NM_001204426;
NM_001204426.1 MYC NP_002458; NP_002458.2 NM_002467; NM_002467.4
NFKB1 NP_003989; NP_003989.2 NM_003998; NM_003998.2 SHC1 NP_892113;
NP_892113.4 NM_183001; NM_183001.4 NP_001123512; NP_001123512.1
NM_001130040; NM_001130040.1 NP_001123513; NP_001123513.1
NM_001130041; NM_001130041.1 NP_001189788; NP_001189788.1
NM_001202859; NM_001202859.1 NP_003020; NP_003020.2 NM_003029;
NM_003029.4 TLR2 NP_003255; NP_003255.2 NM_003264; NM_003264.3 TLR4
NP_612564; NP_612564.1 NM_138554; NM_138554.3 TNFSF14 NP_003798;
NP_003798.2 NM_003807; NM_003807.3 NP_742011; NP_742011.2
NM_172014; NM_172014.2 AHR NP_001612; NP_001612.1 NM_001621;
NM_001621.4 BCL3 NP_005169; NP_005169.1 NM_005178; NM_005178.4 CD44
NP_000601; NP_000601.3 NM_000610; NM_000610.3 NP_001001389;
NP_001001389.1 NM_001001389; NM_001001389.1 NP_001001390;
NP_001001390.1 NM_001001390; NM_001001390.1 NP_001001391;
NP_001001391.1 NM_001001391; NM_001001391.1 NP_001001392;
NP_001001392.1 NM_001001392; NM_001001392.1 NP_001189484;
NP_001189484.1 NM_001202555; NM_001202555.1 NP_001189485;
NP_001189485.1 NM_001202556; NM_001202556.1 NP_001189486;
NP_001189486.1 NM_001202557; NM_001202557.1 CD81 NP_004347;
NP_004347.1 NM_004356; NM_004356.3 CD82 NP_002222; NP_002222.1
NM_002231; NM_002231.3 NP_001020015; NP_001020015.1 NM_001024844;
NM_001024844.1 FCER1A NP_001992; NP_001992.1 NM_002001; NM_002001.2
FCER1G NP_004097; NP_004097.1 NM_004106; NM_004106.1 IL4R
NP_000409; NP_000409.1 NM_000418; NM_000418.2 NP_001008699;
NP_001008699.1 NM_001008699; NM_001008699.1 IL7R NP_002176;
NP_002176.2 NM_002185; NM_002185.2 ITGAM NP_000623; NP_000623.2
NM_000632; NM_000632.3 NP_001139280; NP_001139280.1 NM_001145808;
NM_001145808.1 JAK3 NP_000206; NP_000206.2 NM_000215; NM_000215.3
KLRB1 NP_002249; NP_002249.1 NM_002258; NM_002258.2 LILRB4
NP_001074907; NP_001074907.1 NM_001081438; NM_001081438.1
NP_006838; NP_006838.3 NM_006847; NM_006847.3 PTAFR NP_000943;
NP_000943.1 NM_000952; NM_000952.4 NP_001158193; NP_001158193.1
NM_001164721; NM_001164721.1 NP_001158194; NP_001158194.1
NM_001164722; NM_001164722.2 NP_001158195; NP_001158195.1
NM_001164723; NM_001164723.2 RUNX1 NP_001745; NP_001745.2
NM_001754; NM_001754.4 NP_001001890; NP_001001890.1 NM_001001890;
NM_001001890.2 NP_001116079; NP_001116079.1 NM_001122607;
NM_001122607.1 SELL NP_000646; NP_000646.2 NM_000655; NM_000655.4
TNFSF8 NP_001235; NP_001235.1; NM_001244; NM_001244.3 NP_001239219;
NP_001239219.1 NM_001252290; NM_001252290.1 TRAF3 NP_663777;
NP_663777.1 NM_145725; NM_145725.1 NP_001186356; NP_001186356.1
NM_001199427; NM_001199427.1 NP_003291; NP_003291.2 NM_003300;
NM_003300.3 NP_663778; NP_663778.1 NM_145726; NM_145726.2 CCL2
NP_002973; NP_002973.1 NM_002982; NM_002982.3 CCL4 NP_002975;
NP_002975.1 NM_002984; NM_002984.2 CCR1 NP_001286; NP_001286.1
NM_001295; NM_001295.2 TLR1 NP_003254; NP_003254.2 NM_003263;
NM_003263.3 AAC34137; AAC34137.1 U88540; U88540.1 AAI09094;
AAI09094.1 BC109093; BC109093.1 AAI09095; AAI09095.1 BC109094;
BC109094.1 AAH89403; AAH89403.1 BC089403; BC089403.1 AAY85642;
AAY85642.1 DQ012263; DQ012263.1 AAY85640; AAY85640.1 DQ012261;
DQ012261.1 AAY85638; AAY85638.1 DQ012259; DQ012259.1 AAY85636;
AAY85636.1 DQ012257; DQ012257.1 AAY85634; AAY85634.1 DQ012255;
DQ012255.1 AAY85643; AAY85643.1 DQ012264; DQ012264.1 AAY85641;
AAY85641.1 DQ012262; DQ012262.1 AAY85639; AAY85639.1 DQ012260;
DQ012260.1 AAY85637; AAY85637.1 DQ012258; DQ012258.1 AAY85635;
AAY85635.1 DQ012256; DQ012256.1 AAY85633; AAY85633.1 DQ012254;
DQ012254.1 TLR5 NP_003259; NP_003259.2 NM_003268; NM_003268.5
AAC34136; AAC34136.1 U88881; U88881.1 BAG55042; BAG55042.1
AB445645; AB445645.1 AAI09120; AAI09120.1 BC109119; BC109119.1
AAI09119; AAI09119.1 BC109118; BC109118.1 BAB43955; BAB43955.1
AB060695; AB060695.1
Diagnostic Methods
[0154] Provided herein are methods of diagnosing a
neurodegenerative disorder. These methods include determining a
level of one or more (e.g., at least two, three, four, five or six)
microRNAs listed in Tables 1-19 and/or one or more (e.g., at least
two, three, four, five or six) inflammatory markers listed in
Tables 20-21 in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte (e.g., peripheral or blood-derived
monocyte) from the subject, and comparing the level of the one or
more microRNAs and/or the one or more inflammatory markers with a
reference level of the one or more microRNAs and/or one or more
inflammatory markers. An increase or decrease in the level of the
one or more microRNAs and/or the level of the one or more
inflammatory markers as compared to the reference level(s)
indicates that the subject has a neurodegenerative disease as
outlined in detail below.
[0155] In some embodiments, a subject can be diagnosed as having a
neurodegenerative disorder if the level of one or more or more
(e.g., at least two, three, four, five or six) microRNAs listed in
Table 1 in the CSF or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte (e.g., peripheral or blood-derived
monocyte) from the subject is increased compared to a reference
level of the one or more microRNAs listed in Table 1, and/or if the
level of one or more (e.g., at least two, three, four, five or six)
microRNAs listed in Table 2 in the CSF or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte (e.g., peripheral or blood-derived
monocyte) from the subject is decreased compared to a reference
level of the one or more microRNAs listed in Table 2.
[0156] In some embodiments, a subject can be diagnosed as having a
neurodegenerative disorder if the level of one or more (e.g., at
least two, three, four, five or six) microRNAs listed in Tables 3
and 12 in a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte
from the subject is increased compared to a reference level of the
one or more (e.g., at least two, three, four, five or six)
microRNAs listed in Tables 3 and 12, and/or if the level of one or
more microRNAs listed in Tables 4 and 13 in a CD14+CD16.sup.- or
CD14+CD16+ monocyte from the subject is decreased compared to a
reference level of the one or more microRNAs listed in Tables 4 and
13.
[0157] In some embodiments, a subject can be diagnosed as having a
neurodegenerative disorder if the level of one or more (e.g., at
least two, three, four, five or six) microRNAs listed in Table 5
and Table 14, and/or one or more inflammatory markers (e.g., at
least two, three, four, five or six) in Table 21 in a
CD14.sup.+CD16.sup.- monocyte from the subject is increased
compared to a reference level of the one or more microRNAs listed
in Table 5 and Table 14 and/or a reference level of the one or more
inflammatory markers listed in Table 21; and/or if the level of one
or more (e.g., at least two, three, four, five or six) microRNAs
listed in Table 6 and Table 15, and/or one or more (e.g., at least
two, three, four, five or six) inflammatory markers in Table 20 in
a CD14.sup.+CD16.sup.- monocyte from the subject is decreased
compared to a reference level of the one or more microRNAs listed
in Table 6 and Table 15 and/or a reference level of the one or more
inflammatory markers listed in Table 20.
[0158] In some embodiments, a subject can be diagnosed as having
amyotrophic lateral sclerosis if the level of one or more (e.g., at
least two, three, four, five or six) microRNAs listed in Tables 5
and 7, and/or one or more (e.g., at least two, three, four, five or
six) inflammatory markers listed in Table 21 in a
CD14.sup.+CD16.sup.- monocyte from the subject is increased
compared to a reference level of the one or more microRNAs listed
in Tables 5 and 7, and/or a reference level of the one or more
inflammatory markers in Table 21; and/or if the level of one or
more (e.g., at least two, three, four, five or six) microRNAs
listed in Tables 6 and 8, and/or one or more (e.g., at least two,
three, four, five or six) inflammatory markers listed in Table 20
in a CD14.sup.+CD16.sup.- monocyte from the subject is decreased
compared to a reference level of the one or more microRNAs listed
in Tables 6 and 8, and/or a reference level of one or more
inflammatory markers listed in Table 20.
[0159] In some embodiments, a subject can be diagnosed as having
amyotrophic lateral sclerosis if the level of one or more (e.g., at
least two, three, four, five or six) microRNAs listed in Table 9 in
a CD14.sup.+CD16.sup.+ monocyte from the subject is increased
compared to a reference level of the one or more microRNAs listed
in Table 9, and/or if the level of one or more (e.g., one, two, or
three) microRNAs listed in Table 10 in a CD14.sup.+CD16.sup.+
monocyte from the subject is decreased as compared to a reference
level of the one or more microRNAs listed in Table 10.
[0160] In some embodiments, a subject can be diagnosed as having
amyotrophic lateral sclerosis if the level of one or more (e.g., at
least two, three, four, five or six) of hsa-miR-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p are
increased in cerebrospinal fluid of the subject compared to a
reference level of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p.
[0161] In some embodiments, a subject can be diagnosed as having
familial ALS if the level of hsa-miR-27b in the cerebrospinal fluid
from the subject is increased compared to a reference level of
hsa-miR-27b and the level of one or more (e.g., one, two, three,
four, or five) of hsa-miR-99b, hsa-miR-146a, hsa-miR-150,
hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal fluid from the
subject is decreased or not significantly changed compared to a
reference level of one or more of hsa-miR-99b, hsa-miR-146a,
hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p.
[0162] In embodiments, a subject can be diagnosed as having
sporadic ALS if the level of two or more (e.g., two, three, four,
five, or six) microRNAs selected from hsa-27b, hsa-miR-99b,
hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the
cerebrospinal fluid from the subject is increased compared to a
reference level of the one or more microRNAs. In embodiments, a
subject can be diagnosed as having sporadic ALS if the level of one
or more (e.g., two, three, four or five) microRNAs selected from
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p in the cerebrospinal fluid from the subject is
increased compared to a reference level of the one or more
microRNAs.
[0163] In some embodiments, a subject can be diagnosed as having
multiple sclerosis if the level of one or more (e.g., at least two,
three, four, five, or six) microRNAs in Table 14 and Table 16,
and/or one or more (e.g., at least two, three, four, five, or six)
inflammatory markers in Table 21 in a CD14.sup.+CD16.sup.- monocyte
from the subject is increased compared to a reference level of the
one or more microRNAs listed in Table 14 and Table 16 and/or the
reference level of the one or more inflammatory markers listed in
Table 21; and/or if the level of one or more (e.g., at least two,
three, four, five, or six) microRNAs in Table 15 and Table 17,
and/or one or more (e.g., at least two, three, four, five, or six)
inflammatory markers in Table 20 in a CD14.sup.+CD16.sup.- monocyte
from the subject is decreased compared to a reference level of the
one or more microRNAs listed in Table 15 and Table 17, and/or the
reference level of the one or more inflammatory markers listed in
Table 20.
[0164] In some embodiments, a subject can be diagnosed as having
multiple sclerosis if the level of one or more (e.g., at least two,
three, four, five, or six) microRNAs in Table 18 in
CD14.sup.+CD16.sup.+ monocyte from the subject is increased
compared to a reference level of the one or more microRNAs in Table
18 and/or if the level of one or more (e.g., at least two, three,
four, five, or six) microRNAs in Table 19 in a CD14.sup.+CD16.sup.+
monocyte from the subject is decreased compared to a reference
level of the one or more microRNAs listed in Table 19.
[0165] The levels of the one or more microRNAs (both the mature and
precursor microRNAs) described in Tables 1-19 can be determined
using molecular biology methods known in the art. For example,
levels of any of the microRNAs described herein can be measured
using techniques that include the use of a polymerase chain
reaction (PCR) and suitable primers, e.g., quantitative real-time
PCR (qRT-PCR). Primers for each of the mature and precursor
microRNAs described herein can be designed using methods known in
the art. Likewise, the levels of an mRNA encoding any of the
inflammatory markers in Tables 20 and 21 can be determined using
techniques that include the use of a PCR and suitable primers. For
example, a primer can contain at least 7 (e.g., at least 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) contiguous nucleotides
that are complementary to a sequence present in the target microRNA
or the target inflammatory marker mRNA. Primers can include one or
more of the modifications described herein (e.g., one or more
modifications in the backbone, one or more modifications in the
nucleobase(s), and one or more modifications in the sugar(s)). The
primers can also include a label (e.g., a radioisotope or a
fluorophore). The primers can also be conjugated to secondary
molecules or agents in order to improve the stability of the
primers (as described herein).
[0166] The levels of a protein encoded by the inflammatory marker
genes listed in Tables 20 and 21 can be detected using a number of
techniques known in the art which utilize antibodies that
specifically bind to one of the proteins listed in Tables 20 and 21
(e.g., immunoblotting).
[0167] Any of the methods described herein may further include
obtaining or collecting a sample from a subject (e.g., a biological
sample containing cerebrospinal fluid or peripheral blood). In some
embodiments, the methods (e.g., any of the methods described
herein) further include purifying a monocyte (e.g., a
CD14.sup.+CD16.sup.- monocyte or a CD14.sup.+CD16.sup.+ monocyte
from a biological sample from the subject). Methods of purifying a
CD14.sup.+CD16.sup.- monocyte or a CD14.sup.+CD16.sup.+ monocyte
can be performed using a variety of methods known in the art, e.g.,
antibody-based methods, such as fluorescence-assisted cell sorting
(FACS).
[0168] Any of the methods described herein can be performed on
patients presenting to a health care facility (e.g., a hospital,
clinic, or an assisted care facility). The subjects may present
with one or more symptoms of a neurodegenerative disorder (e.g.,
any of the symptoms of a neurodegenerative disorder described
herein). The subject can also present with no symptoms (an
asymptomatic subject) or just one symptom of a neurodegenerative
disorder. The subject can have a familial history of a
neurodegenerative disorder (e.g., familial ALS).
[0169] The diagnostic methods described herein can be performed by
any health care professional (e.g., a physician, a laboratory
technician, a nurse, a physician's assistant, and a nurse's
assistant). The diagnostic methods described herein can be used in
combination with any additional diagnostic testing methods known in
the art (e.g., the observation or assessment of one or more
symptoms of a neurodegenerative disorder in a subject).
Methods of Selecting a Subject for Treatment
[0170] Also provided are methods of selecting a subject for
treatment of a neurodegenerative disorder. These methods include
determining a level of one or more (e.g., at least two, three,
four, five, or six) of the microRNAs listed in Tables 1-19 and/or
the level of one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Tables 20 and 21 in
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject; comparing the level
of the one or more microRNAs in cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the
subject to a reference level of the one or more microRNAs and/or a
reference level of the one or more inflammatory markers; and
selecting a subject having an increase in the level of one or more
(e.g., at least two, three, four, five, or six) microRNAs listed in
Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more
(e.g., at least two, three, four, five, or six) inflammatory
markers listed in Table 21 in cerebrospinal fluid or a
CD14+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the subject
compared to a reference level of the one or more microRNAs listed
in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference
level of the one or more inflammatory markers listed in Table 21;
and/or a decrease in the level of one or more (e.g., at least two,
three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8,
10, 13, 15, 17, and 19, and/or a one or more (e.g., at least two,
three, four, five, or six) inflammatory markers listed in Table 20
in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject compared to a
reference level of the one or more microRNAs listed in Tables 2, 4,
6, 8, 10, 13, 15, 17, and 19, and/or a reference level of one or
more inflammatory markers listed in Table 20 for treatment of a
neurodegenerative disorder.
[0171] A subject may be selected for treatment on the basis of the
relative expression of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 1-19 and/or one or
more (e.g., at least two, three, four, five, or six) inflammatory
markers listed in Tables 20 and 21 as described in the above
section describing diagnostic methods. For example, an increase in
the level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18 and/or the level of one or more (e.g., at least two, three,
four, five, or six) inflammatory markers listed in Table 21
(compared to a reference level), as used to diagnose a subject as
having a neurodegenerative disorder, may likewise be used to select
a subject for treatment of a neurodegenerative disorder. Similarly,
a decrease in the level of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13,
15, 17, and 19 and/or the level of one or more (e.g., at least two,
three, four, five, or six) inflammatory markers listed in Table 20
(compared to a reference level), as used to diagnose a subject as
having a neurodegenerative disorder, may likewise be used to select
a subject for treatment of a neurodegenerative disorder.
[0172] The levels of the one or more microRNAs (both the mature and
precursor microRNAs) described in Tables 1-19 can be determined
using molecular biology methods known in the art. For example,
levels of any of the microRNAs described herein can be measured
using techniques that include the use of a polymerase chain
reaction (PCR) and suitable primers, e.g., quantitative real-time
PCR (qRT-PCR). Primers for each of the mature and precursor
microRNAs described herein can be designed using methods known in
the art. Likewise, the levels of an mRNA encoding any of the
inflammatory markers in Tables 20 and 21 can be determined using
techniques that include the use of a PCR and suitable primers. For
example, a primer can contain at least 7 (e.g., at least 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) contiguous nucleotides
that are complementary to a sequence present in the target microRNA
or the target inflammatory marker mRNA. Primers can include one or
more of the modifications described herein (e.g., one or more
modifications in the backbone, one or more modifications in the
nucleobase(s), and one or more modifications in the sugar(s)). The
primers can also include a label (e.g., a radioisotope or a
fluorophore). The primers can also be conjugated to secondary
molecules or agents in order to improve the stability of the
primers (as described herein). The methods can be performed by any
health care professional (e.g., a physician, a nurse, a physician's
assistant, a laboratory technician, or a nurse's assistant).
[0173] The subjects may present with one or more symptoms (e.g., at
least two, three, or four) of a neurodegenerative disorder (e.g.,
any of the symptoms of a neurodegenerative disorder described
herein). The subject can also present with no symptoms or just one
symptom of a neurodegenerative disorder. The subject can have a
familial history of a neurodegenerative disorder (e.g., familial
ALS). The subject can be previously diagnosed as having a
neurodegenerative disorder.
[0174] Treatments of neurodegenerative disorders that can be
administered to the subject include riluzole, corticosteroids,
beta-interferon, glatiramer, fingolimod, natalizumab, mitoxantrone,
muscle relaxants, and amantadine. Additional treatments of
neurodegenerative disorders include physical therapy and
plasmapheresis.
Methods of Identifying a Subject at Risk of Developing a
Neurodegenerative Disorder
[0175] Also provided are methods of identifying a subject at risk
of developing a neurodegenerative disorder. These methods include
determining a level of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 1-19 and/or one or
more (e.g., at least two, three, four, five, or six) inflammatory
markers listed in Tables 20 and 21 in the cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the
subject; comparing the level of the one or more microRNAs in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject to a reference level
of the one or more microRNAs and/or a reference level of the one or
more inflammatory markers. A subject is identified as having an
increased risk of developing a neurological disorder if the level
of one or more (e.g., at least two, three, four, five, or six)
microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18,
and/or one or more (e.g., at least two, three, four, five, or six)
inflammatory markers listed in
[0176] Table 21 in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte from the subject is increased compared
to a reference level of the one or more microRNAs listed in Tables
1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of
the one or more inflammatory markers listed in Table 21; and/or the
level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19,
and/or a one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Table 20 in cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject is decreased compared to a reference level of the one or
more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19,
and/or a reference level of one or more inflammatory markers listed
in Table 20.
[0177] In some embodiments, a subject is identified having a
decreased risk of developing a neurological disorder if the level
of one or more (e.g., at least two, three, four, five, or six)
microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18,
and/or one or more (e.g., at least two, three, four, five, or six)
inflammatory markers listed in Table 21 in cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject is decreased or not significantly changed compared to a
reference level of the one or more microRNAs listed in Tables 1, 3,
5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of the one
or more inflammatory markers listed in Table 21; and/or the level
of one or more (e.g., at least two, three, four, five, or six)
microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19,
and/or a one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Table 20 in cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject is increased or not significantly changed compared to a
reference level of the one or more microRNAs listed in Tables 2, 4,
6, 8, 10, 13, 15, 17, and 19, and/or a reference level of one or
more inflammatory markers listed in Table 20.
[0178] In some embodiments, a subject may be identified as having
an increased or decreased risk of developing a neurodegenerative
disorder on the basis of the relative expression of one or more
(e.g., at least two, three, four, five, or six) microRNAs listed in
Tables 1-19 and/or one or more (e.g., at least two, three, four,
five, or six) inflammatory markers listed in Tables 20 and 21 in
the cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject as compared to a
reference value as described in the above section describing
diagnostic methods. For example, an increase in the level of one or
more (e.g., at least two, three, four, five, or six) microRNAs
listed in Tables 1, 3, 5, 7, 9. 11, 12, 14, 16, and 18 and/or the
level of one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Table 21 in the cerebrospinal
fluid or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte
from the subject (compared to a reference level), as used to
diagnose a subject as having a neurodegenerative disorder, may
likewise be used to identify a subject at increased risk of
developing a neurodegenerative disorder. Similarly, a decrease in
the level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19
or the level of one or more (e.g., at least two, three, four, five,
or six) inflammatory markers listed in Table 20 in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte (compared to a reference level), as
used to diagnose a subject as having a neurodegenerative disorder,
may likewise be used to identify a subject at increased risk of
developing a neurodegenerative disorder.
[0179] In some embodiments, an increase in the level of one or more
(e.g., at least two, three, four, five, or six) microRNAs listed in
Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19 and/or the level of one or
more (e.g., at least two, three, four, five, or six) inflammatory
markers listed in Table 20 in the cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the
subject (compared to a reference level), when a decrease in the
level of the one or more microRNAs or a decrease in the level of
the one or more inflammatory markers indicates a diagnosis of a
neurodegenerative disease (as detailed in the section describing
diagnostic methods above), indicates that the subject is at
decreased risk of developing a neurodegenerative disorder. In some
embodiments, a decrease in the level of one or more (e.g., at least
two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5,
7, 9, 11, 12, 14, 16, and 18, or the level of one or more (e.g., at
least two, three, four, five, or six) inflammatory markers listed
in Table 21 in the cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte from the subject (compared to a
reference level), when an increase in the level of one or more
microRNAs or an increase in the level of the one or more
inflammatory markers indicates a diagnosis of a neurodegenerative
disorder (as detailed in the section describing diagnostic methods
above), indicates that the subject is at decreased risk of
developing a neurodegenerative disorder.
[0180] In any of the methods described herein, the increased or
decreased risk is relative to a subject that does not have an
increase or decrease in the levels of one or more (e.g., at least
two, three, four, five, or six) microRNA listed in Tables 1-19
and/or does not have an increase or decrease in the levels of one
or more (e.g., at least two, three, four, five, or six)
inflammatory markers listed in Tables 20 and 21 (e.g., a subject
that is not diagnosed as having a neurodegenerative disorder using
any of the methods described herein).
[0181] The levels of any of the microRNAs in Tables 1-19 or the
levels of any of the inflammatory markers listed in Tables 20 and
21 may be performed using standard molecular biology methods (e.g.,
the PCR-based and antibody-based methods described herein). The
methods can be performed by any health care professional (e.g., a
physician, a nurse, a physician's assistant, a laboratory
technician, or a nurse's assistant).
[0182] The subjects may present with one or more symptoms of a
neurodegenerative disorder (e.g., any of the symptoms of a
neurodegenerative disorder described herein). The subject can also
present with no symptoms or just one symptom of a neurodegenerative
disorder. The subject can have a family history of a
neurodegenerative disorder (e.g., familial ALS).
[0183] Subjects identified as having an increased risk of
developing a neurodegenerative disease may be administered a
treatment for a neurodegenerative disorder or may be administered a
new or alternative treatment for a neurodegenerative disorder.
Subjects identified as having an increased risk of developing a
neurodegenerative disorder can also undergo more aggressive
therapeutic treatment (e.g., increased periodicity of clinic or
hospital visits).
Methods of Predicting the Rate of Disease Progression
[0184] Also provided are methods of predicting the rate of disease
progression in a subject having a neurodegenerative disorder. These
methods include determining a level of one or more (e.g., at least
two, three, four, five, or six) microRNAs listed in Tables 1-19
and/or one or more (e.g., at least two, three, four, five, or six)
inflammatory markers listed in Tables 20 and 21 in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject; comparing the level
of the one or more microRNAs and/or the one or more inflammatory
markers to a reference level of the one or more microRNAs and/or a
reference level of the one or more inflammatory markers. A subject
is predicted to have an increased rate of disease progression if
the level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18, and/or one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Table 21 in cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.- monocyte from the
subject is increased compared to a reference level of the one or
more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18, and/or a reference level of the one or more inflammatory
markers listed in Table 21; and/or the level of one or more (e.g.,
at least two, three, four, five, or six) microRNAs listed in Tables
2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at
least two, three, four, five, or six) inflammatory markers listed
in Table 20 in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte from the subject is decreased compared
to a reference level of the one or more microRNAs listed in Tables
2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a reference level of one
or more inflammatory markers listed in Table 20.
[0185] In some embodiments, a subject is predicted to have a slower
or average rate of disease progression if the level of one or more
(e.g., at least two, three, four, five, or six) microRNAs listed in
Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more
(e.g., at least two, three, four, five, or six) inflammatory
markers listed in Table 21 in cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject is decreased or not significantly changed compared to a
reference level of the one or more microRNAs listed in Tables 1, 3,
5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of the one
or more inflammatory markers listed in Table 21; and/or the level
of one or more (e.g., at least two, three, four, five, or six)
microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19,
and/or a one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Table 20 in cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject is increased or not significantly changed compared to a
reference level of the one or more microRNAs listed in Tables 2, 4,
6, 8, 10, 13, 15, 17, and 19, and/or a reference level of one or
more inflammatory markers listed in Table 20.
[0186] In some embodiments, a subject may be predicted to have an
increased or decreased rate of disease progression on the basis of
the relative expression of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 1-19 and/or one or
more (e.g., at least two, three, four, five, or six) inflammatory
markers listed in Tables 20 and 21 in the cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject as compared to a reference value as described in the above
section describing diagnostic methods. For example, an increase in
the level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, and
18, and/or the level of one or more (e.g., at least two, three,
four, five, or six) inflammatory markers listed in Table 21 in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject (compared to a
reference level), as used to diagnose a subject as having a
neurodegenerative disorder, may likewise be used to predict an
increased rate of disease progression. Similarly, a decrease in the
level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19
and/or the level of one or more (e.g., at least two, three, four,
five, or six) inflammatory markers listed in Table 20 in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte (compared to a reference level), as
used to diagnose a subject as having a neurodegenerative disorder,
may likewise be used to predict an increased rate of disease
progression.
[0187] In some embodiments, an increase in the level of one or more
(e.g., at least two, three, four, five, or six) microRNAs listed in
Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or the level of one
or more (e.g., at least two, three, four, five, or six)
inflammatory markers in Table 20 in the cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the
subject (compared to a reference level), when a decrease in the
level of the one or more microRNAs and/or a decrease in the level
of the one or more inflammatory markers indicates a diagnosis of a
neurodegenerative disease (as detailed in the section describing
diagnostic methods above), can be used to predict a decreased or
average rate of disease progression. In some embodiments, a
decrease in the level of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11,
12, 14, 16, or 18, and/or the level of one or more (e.g., at least
two, three, four, five, or six) inflammatory markers listed in
Table 21 in the cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject (compared to a
reference level), when an increase in the level of the one or more
microRNAs and/or an increase in the level of the one or more
inflammatory markers indicates a diagnosis of a neurodegenerative
disorder (as detailed in the section describing diagnostic methods
above), can be used to predict a decreased or average rate of
disease progression.
[0188] In some embodiments, the rate of disease progression is the
rate of onset of one or more (e.g., one, two, three, or four)
symptoms (e.g., ataxia) of a neurodegenerative disorder, the rate
of increasing intensity (worsening) of symptoms of a
neurodegenerative disorder, the frequency of one or more symptoms
of a neurodegenerative disorder, the duration of one or more
symptoms of a neurodegenerative disorder, or the longevity of the
subject. For example, an increase in the rate of disease
progression can be manifested by one or more of: an increase in the
rate of onset of one or more (new) symptoms of a neurodegenerative
disorder, an increase in the rate of increasing intensity
(worsening) of one or more symptoms of a neurodegenerative
disorder, an increase in the duration of one or more symptoms of a
neurodegenerative disorder, and a decrease in the longevity of the
subject.
[0189] The rate of disease progression determined using the methods
described herein can be compared to the rate of disease progression
in subjects that do not have an increase or a decrease in the level
of the one or more (e.g., at least two, three, four, five, or six)
microRNAs listed in Tables 1-19 and/or do not have an increase or a
decrease in the level of the one or more (e.g., at least two,
three, four, five, or six) inflammatory markers listed in Tables 20
and 21 in their CSF or in a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte. In some embodiments, the rate of
disease progression can be compared to the average rate of disease
progression for all subjects diagnosed as having the same
neurodegenerative disease.
[0190] The levels of any of the microRNAs in Tables 1-19 or the
levels of any of the inflammatory markers listed in Tables 20 and
21 may be performed using standard molecular biology methods (e.g.,
the PCR-based and antibody-based methods described herein). The
methods can be performed by any health care professional (e.g., a
physician, a nurse, a physician's assistant, a laboratory
technician, or a nurse's assistant).
[0191] The subjects may present with one or more (e.g., one, two,
three, or four) symptoms of a neurodegenerative disorder (e.g., any
of the symptoms of a neurodegenerative disorder described herein).
The subject can also present with no symptoms or just one symptom
of a neurodegenerative disorder. The subject can have a family
history of a neurodegenerative disorder (e.g., familial ALS). In
some embodiments, the subject can already be diagnosed as having a
neurodegenerative disorder.
[0192] Some embodiments of these methods further include
administering a treatment to a subject predicted to have an
increased rate of disease progression. In some embodiments, a
subject predicted to have an increased rate of disease progression
is administered a more aggressive treatment (e.g., increased
periodicity of clinic visits).
Methods of Selecting a Subject for Participation in a Clinical
Study
[0193] Also provided are methods for selecting a subject for
participation in a clinical study. These methods include
determining a level of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 1-19 and/or one or
more (e.g., at least two, three, four, five, or six) inflammatory
markers listed in Tables 20 and 21 in the cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject; comparing the level of the one or more microRNAs and/or
the level of the one or more inflammatory markers to a reference
level of the one or more microRNAs and/or a reference level of the
one or more inflammatory markers, and selecting a subject having an
increase or decrease in the level of the one or more microRNAs
and/or one or more inflammatory markers in the cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the
subject compared to the reference level (as described in detail
below) for participation in a clinical study. In some embodiments,
a subject is selected for participation in a clinical study if the
level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18, and/or one or more (e.g., at least two, three, four, five, or
six) inflammatory markers listed in Table 21 in cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject is increased compared to a reference level of the one or
more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18, and/or a reference level of the one or more inflammatory
markers listed in Table 21; and/or the level of one or more (e.g.,
at least two, three, four, five, or six) microRNAs listed in Tables
2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at
least two, three, four, five, or six) inflammatory markers listed
in Table 20 in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.- monocyte from the subject is decreased
compared to a reference level of the one or more microRNAs listed
in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a reference
level of one or more inflammatory markers listed in Table 20.
[0194] In some embodiments, a subject is selected for participation
in a clinical study if the level of one or more (e.g., at least
two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5,
7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least
two, three, four, five, or six) inflammatory markers listed in
Table 21 in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte from the subject is decreased or not
significantly changed compared to a reference level of the one or
more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or
18, and/or a reference level of the one or more inflammatory
markers listed in Table 21; and/or the level of one or more (e.g.,
at least two, three, four, five, or six) microRNAs listed in Tables
2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at
least two, three, four, five, or six) inflammatory markers listed
in Table 20 in cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte from the subject is increased or not
significantly changed compared to a reference level of the one or
more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19,
and/or a reference level of one or more inflammatory markers listed
in Table 20.
[0195] In some embodiments, a subject can be selected for
participation in a clinical study on the basis of the relative
expression of one or more (e.g., at least two, three, four, five,
or six) microRNAs listed in Tables 1-19 and/or one or more (e.g.,
at least two, three, four, five, or six) inflammatory markers
listed in Tables 20 and 21 in the cerebrospinal fluid or a
CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+monocyte from the
subject as compared to a reference value as described in the above
section describing diagnostic methods. For example, an increase in
the level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, and
18, and/or the level of one or more (e.g., at least two, three,
four, five, or six) inflammatory markers listed in Table 21 in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+monocyte from the subject (compared to a
reference level), as used to diagnose a subject as having a
neurodegenerative disorder, may likewise be used to select a
subject for participation in a clinical study. Similarly, a
decrease in the level of one or more (e.g., at least two, three,
four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13,
15, 17, or 19 and/or the level of one or more (e.g., at least two,
three, four, five, or six) inflammatory markers listed in Table 20
in the cerebrospinal fluid or a CD14.sup.-CD16.sup.- or
CD14.sup.+CD16.sup.-monocyte (compared to a reference level), as
used to diagnose a subject as having a neurodegenerative disorder,
may likewise be used to select a subject for participation in a
clinical study.
[0196] In some embodiments, an increase or no significant change in
the level of one or more (e.g., at least two, three, four, five, or
six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19
and/or the level of one or more (e.g., at least two, three, four,
five, or six) inflammatory markers listed in Table 20 in the
cerebrospinal fluid or a CD14.sup.+CD16.sup.- or
CD14.sup.+CD16.sup.+ monocyte from the subject (compared to a
reference level), when a decrease in the level of the one or more
microRNAs and/or a decrease in the level of the one or more
inflammatory markers indicates a diagnosis of a neurodegenerative
disease (as detailed in the section describing diagnostic methods
above), can be used to select a subject for participation in a
clinical study (e.g., as a control subject). In some embodiments, a
decrease or no significant change in the level of one or more
(e.g., at least two, three, four, five, or six) microRNAs listed in
Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 and/or the level of one
or more (e.g., at least two, three, four, five, or six)
inflammatory markers listed in Table 21 in the cerebrospinal fluid
or a CD14.sup.+CD16.sup.- or CD14.sup.+CD16.sup.+ monocyte from the
subject (compared to a reference level), when an increase in the
level of the one or more microRNAs and/or an increase in the level
of the one or more inflammatory markers indicates a diagnosis of a
neurodegenerative disorder (as detailed in the section describing
diagnostic methods above), can be used to select a subject for
participation in a clinical study.
[0197] The levels of any of the microRNAs in Tables 1-19 or the
levels of any of the inflammatory markers listed in Tables 20 and
21 may be performed using standard molecular biology methods (e.g.,
the PCR-based and antibody-based methods described herein). The
methods can be performed by any health care professional (e.g., a
physician, a nurse, a physician's assistant, a laboratory
technician, or a nurse's assistant).
[0198] In some embodiments, the subject may present with one or
more symptoms of a neurodegenerative disorder (e.g., any of the
symptoms of a neurodegenerative disorder described herein). In some
embodiments, the subject can also present with no symptoms or just
one symptom of a neurodegenerative disorder. In some embodiments,
the subject can have a familial history of a neurodegenerative
disorder (e.g., familial ALS). In some embodiments, the subject can
already be diagnosed as having a neurodegenerative disorder.
Methods of Treatment
[0199] Also provided are methods of treating a neurodegenerative
disorder that include administering to a subject at least one
(e.g., at least two, three, four, five, or six) agent (e.g., a
nucleic acid) that decreases the level or activity of one or more
(e.g., at least two, three, four, five, or six) of the microRNAs
listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (e.g., an
inhibitory nucleic acid, e.g., an antagomir), and/or increases the
level or activity of one or more (e.g., at least two, three, four,
five, or six) of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13,
15, 17, or 19 (e.g., a sense nucleic acid). Also provided are
methods of treating a neurodegenerative disorder (e.g., ALS or MS)
that include administering to a subject at least one (e.g., at
least two, three, four, five, or six) agent (e.g., a nucleic acid)
that decreases the expression (e.g., protein or mRNA) or activity
of one or more (e.g., at least two, three, four, five, or six) of
the inflammatory markers listed in Table 21 (e.g., an inhibitory
nucleic acid or antibody) and/or increases the expression (e.g.,
protein or mRNA) and/or activity of one or more (e.g., at least
two, three, four, five, or six) of the genes listed in Table 20
(e.g., a sense nucleic acid). In some embodiments, the subject is
first identified or selected for treatment using any of the
diagnostic methods described herein or any of the methods of
predicting a subject at risk of developing a neurodegenerative
disorder described herein.
[0200] In some embodiments, the subject is administered at least
one inhibitory nucleic acid comprising a sequence that is
complementary to a contiguous sequence present in hsa-miR-155
(e.g., a contiguous sequence present in mature or precursor
hsa-miR-155). In non-limiting embodiments, the inhibitory nucleic
acid can be an antisense oligonucleotide, a ribozyme, an siRNA, or
an antagomir. In some embodiments, the at least one inhibitory
nucleic acid is injected into the cerebrospinal fluid of a subject.
In some embodiments, the injection is intracranial injection or
intrathecal injection. In some embodiments, the at least one
inhibitory nucleic acid is complexed with one or more cationic
polymers and/or cationic lipids (e.g., any of the cationic polymers
described herein or known in the art). Antagomirs to decrease the
expression and/or activity of a specific target miRNA (e.g.,
hsa-miR-155) can be designed using methods known in the art (see,
e.g., Krutzfeld et al., Nature 438: 685-689, 2005). Additional
exemplary methods for designing and making antagomirs and other
types of inhibitory nucleic acids are described herein.
[0201] In some embodiments, the inhibitory nucleic acid that
decreases miR-155 levels is the antogmir-155 LNA sequence
+TC+AC+A+A+TTA+G+C+AT+T+A (SEQ ID NO: 262) (wherein the + indicates
the presence of an LNA moiety). Methods for designing antagomirs to
target microRNA molecules are described in Obad et al., Nature
Genetics 43: 371-378, 2011. Additional inhibitory nucleic acids for
decreasing the levels or expression of hsa-miR-155 are described in
Worm et al., Nucleic Acids Res. 37: 5784-5792, 2009, and Murugaiyan
et al., J. Immunol. 187:2213-2221, 2011.
[0202] A subject can be administered at least one (e.g., at least
2, 3, 4, or 5) dose of the agent (e.g., one or more inhibitory
nucleic acids). The agent (e.g., one or more inhibitory nucleic
acids) can be administered to the subject at least once a day
(e.g., twice a day, three times a day, and four times a day), at
least once a week (e.g., twice a week, three times a week, four
times a week), and/or at least once a month. A subject can be
treated (e.g., periodically administered the agent) for a prolonged
period of time (e.g., at least one month, two months, six months,
one year, two years, three years, four years, or five years). As
described in detail herein, the dosage of the agent to be
administered to the subject can be determined by a physician by
consideration of a number of physiological factors including, but
not limited to, the sex of the subject, the weight of the subject,
the age of the subject, and the presence of other medical
conditions. The agent can be administered to the subject orally,
intravenously, intraarterially, subcutaneously, intramuscularly,
intracranially, or via injection into the cerebrospinal fluid.
Likewise, the agent may be formulated as a solid (e.g., for oral
administration) or a physiologically acceptable liquid carrier
(e.g., saline) (e.g., for intravenous, intraarterial, subcutaneous,
intramuscular, cerebrospinal (intrathecal), or intracranial
administration). In some embodiments, the agent (e.g., one or more
inhibitory nucleic acids) can be administered by injection or can
be administered by infusion over a period of time.
[0203] The agents to be administered to a subject for treatment of
a neurodegenerative disorder are described below, and can be used
in any combination (e.g., at least one, two, three, four, or five
of any combination of the agents or classes of agents described
below).
Inhibitory Nucleic Acids
[0204] Inhibitory agents useful in the methods of treatment
described herein include inhibitory nucleic acid molecules that
decrease the expression or activity of any of the microRNAs (e.g.,
mature microRNA or precursor microRNA) listed in Tables 1, 3, 5, 7,
9, 11, 12, 14, 16, or 18 (e.g., hsa-miR-155), or decrease the
expression or activity of any of the mRNAs encoding an inflammatory
marker listed in Table 21 (the target mRNA).
[0205] Inhibitory nucleic acids useful in the present methods and
compositions include antisense oligonucleotides, ribozymes,
external guide sequence (EGS) oligonucleotides, siRNA compounds,
single- or double-stranded RNA interference (RNAi) compounds, such
as siRNA compounds, modified bases/locked nucleic acids (LNAs),
antagomirs, peptide nucleic acids (PNAs), and other oligomeric
compounds, or oligonucleotide mimetics which hybridize to at least
a portion of the target nucleic acid and modulate its function. In
some embodiments, the inhibitory nucleic acids include antisense
RNA, antisense DNA, chimeric antisense oligonucleotides, antisense
oligonucleotides comprising modified linkages, interference RNA
(RNAi), short interfering RNA (siRNA); a micro, interfering RNA
(miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA
(shRNA); small RNA-induced gene activation (RNAa); small activating
RNAs (saRNAs), or combinations thereof. See, e.g., WO
2010/040112.
[0206] In some embodiments, the inhibitory nucleic acids are 10 to
50, 13 to 50, or 13 to 30 nucleotides in length. One having
ordinary skill in the art will appreciate that this embodies
oligonucleotides having antisense portions of 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, or 50 nucleotides in length, or any range therewithin. In some
embodiments, the oligonucleotides are 15 nucleotides in length. In
some embodiments, the antisense or oligonucleotide compounds of the
invention are 12 or 13 to 30 nucleotides in length. One having
ordinary skill in the art will appreciate that this embodies
inhibitory nucleic acids having antisense portions of 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
nucleotides in length, or any range therewithin.
[0207] In some embodiments, the inhibitory nucleic acids are
chimeric oligonucleotides that contain two or more chemically
distinct regions, each made up of at least one nucleotide. These
oligonucleotides typically contain at least one region of modified
nucleotides that confers one or more beneficial properties (such
as, for example, increased nuclease resistance, increased uptake
into cells, increased binding affinity for the target) and a region
that is a substrate for enzymes capable of cleaving RNA:DNA or
RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention
may be formed as composite structures of two or more
oligonucleotides, modified oligonucleotides, oligonucleosides,
and/or oligonucleotide mimetics as described above. Such compounds
have also been referred to in the art as hybrids or gapmers.
Representative United States patents that teach the preparation of
such hybrid structures comprise, but are not limited to, U.S. Pat.
Nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878;
5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356;
and 5,700,922, each of which is herein incorporated by
reference.
[0208] In some embodiments, the inhibitory nucleic acid comprises
at least one nucleotide modified at the 2' position of the sugar,
most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or
2'-fluoro-modified nucleotide. In other preferred embodiments, RNA
modifications include 2'-fluoro, 2'-amino, and 2' O-methyl
modifications on the ribose of pyrimidines, abasic residues, or an
inverted base at the 3' end of the RNA. Such modifications are
routinely incorporated into oligonucleotides and these
oligonucleotides have been shown to have a higher Tm (i.e., higher
target binding affinity) than 2'-deoxyoligonucleotides against a
given target.
[0209] A number of nucleotide and nucleoside modifications have
been shown to make the oligonucleotide into which they are
incorporated more resistant to nuclease digestion than the native
oligodeoxynucleotide--the modified oligos survive intact for a
longer time than unmodified oligonucleotides. Specific examples of
modified oligonucleotides include those comprising modified
backbones, for example, phosphorothioates, phosphotriesters, methyl
phosphonates, short-chain alkyl or cycloalkyl intersugar linkages,
or short-chain heteroatomic or heterocyclic intersugar linkages.
Most preferred are oligonucleotides with phosphorothioate backbones
and those with heteroatom backbones, particularly CH2-NH--O--CH2,
CH,.about.N(CH3)--O--CH2 (known as a methylene(methylimino) or MMI
backbone], CH2--O--N (CH3)--CH2, CH2--N (CH3)--N (CH3)--CH2 and
O--N (CH3)--CH2--CH2 backbones, wherein the native phosphodiester
backbone is represented as O--P--O--CH,); amide backbones (see De
Mesmaeker et al., Ace. Chem. Res. 28: 366-374, 1995); morpholino
backbone structures (see U.S. Pat. No. 5,034,506); peptide nucleic
acid (PNA) backbone (wherein the phosphodiester backbone of the
oligonucleotide is replaced with a polyamide backbone, the
nucleotides being bound directly or indirectly to the aza nitrogen
atoms of the polyamide backbone, see Nielsen et al., Science 254:
1497, 1991). Phosphorus-containing linkages include, but are not
limited to, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates comprising 3'alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates comprising 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs
of these, and those having inverted polarity wherein the adjacent
pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'; see U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563, 253; 5,571,799; 5,587,361; and 5,625,050 (each of which is
incorporated by reference).
[0210] Morpholino-based oligomeric compounds are described in
Braasch et al., Biochemistry 41(14):4503-4510, 2002; Genesis,
volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 243:209-214,
2002; Nasevicius et al., Nat. Genet. 26: 216-220, 2000; Lacerra et
al., Proc. Natl. Acad. Sci. U.S.A. 97: 9591-9596, 2000; and U.S.
Pat. No. 5,034,506. Cyclohexenyl nucleic acid oligonucleotide
mimetics are described in Wang et al., J. Am. Chem. Soc. 122,
8595-8602, 2000.
[0211] Modified oligonucleotide backbones that do not include a
phosphorus atom therein have backbones that are formed by
short-chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short-chain heteroatomic or heterocyclic internucleoside
linkages. These comprise those having morpholino linkages (formed
in part from the sugar portion of a nucleoside); siloxane
backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
O, S and CH2 component parts; see U.S. Pat. Nos. 5,034,506;
5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264, 562;
5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677;
5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623, 070; 5,663,312; 5,633,360;
5,677,437; and 5,677,439 (each of which is herein incorporated by
reference).
[0212] One or more substituted sugar moieties can also be included,
e.g., one of the following at the 2' position: OH, SH, SCH.sub.3,
F, OCN, OCH.sub.3 OCH.sub.3, OCH.sub.3 O(CH.sub.2)n CH.sub.3,
O(CH.sub.2)n NH.sub.2 or O(CH.sub.2)n CH.sub.3, where n is from 1
to about 10; Ci to C10 lower alkyl, alkoxyalkoxy, substituted lower
alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; OCF3; O-, S-, or
N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2;
heterocycloalkyl; heterocycloalkaryl; aminoalkylamino;
polyalkylamino; substituted silyl; an RNA cleaving group; a
reporter group; an intercalator; a group for improving the
pharmacokinetic properties of an oligonucleotide; or a group for
improving the pharmacodynamic properties of an oligonucleotide and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
[2'-0-CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl)] (Martin et al., Helv. Chim. Acta 78: 486,
1995). Other preferred modifications include 2'-methoxy
(2'-0-CH.sub.3), 2'-propoxy (2'-OCH.sub.2 CH.sub.2CH.sub.3) and
2'-fluoro (2'-F). Similar modifications may also be made at other
positions on the oligonucleotide, particularly the 3' position of
the sugar on the 3' terminal nucleotide and the 5' position of 5'
terminal nucleotide. Oligonucleotides may also have sugar mimetics,
such as cyclobutyls in place of the pentofuranosyl group.
[0213] Inhibitory nucleic acids can also include, additionally or
alternatively, nucleobase (often referred to in the art simply as
"base") modifications or substitutions. As used herein,
"unmodified" or "natural" nucleobases include adenine (A), guanine
(G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include nucleobases found only infrequently or transiently in
natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me
pyrimidines, particularly 5-methylcytosine (also referred to as
5-methyl-2' deoxycytosine and often referred to in the art as
5-Me--C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and
gentobiosyl HMC, as well as synthetic nucleobases, e.g.,
2-aminoadenine, 2- (methylamino)adenine,
2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other
heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine,
5-bromouracil, 5- hydroxymethyluracil, 8-azaguanine,
7-deazaguanine, N6 (6-aminohexyl)adenine, and 2,6- diaminopurine.
See Kornberg, A., DNA Replication, W. H. Freeman & Co., San
Francisco, 1980, pp75-77; and Gebeyehu et al., Nucl. Acids Res. 15:
4513, 1987. A "universal" base known in the art, e.g., inosine, can
also be included. 5-Me-C substitutions have been shown to increase
nucleic acid duplex stability by 0.6-1.2<0>C (Sanghvi, Y. S.,
in Crooke, S. T. and Lebleu, B., Eds., Antisense Research and
Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are
presently preferred base substitutions.
[0214] It is not necessary for all positions in a given
oligonucleotide to be uniformly modified, and in fact more than one
of the aforementioned modifications may be incorporated in a single
oligonucleotide or even at within a single nucleoside within an
oligonucleotide.
[0215] In some embodiments, both a sugar and an internucleoside
linkage, i.e., the backbone, of the nucleotide units are replaced
with novel groups. The base units are maintained for hybridization
with an appropriate nucleic acid target compound. One such
oligomeric compound, an oligonucleotide mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of
an oligonucleotide is replaced with an amide containing backbone,
for example, an aminoethylglycine backbone. The nucleobases are
retained and are bound directly or indirectly to aza nitrogen atoms
of the amide portion of the backbone. Representative United States
patents that teach the preparation of PNA compounds comprise, but
are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and
5,719,262, each of which is herein incorporated by reference.
Further teaching of PNA compounds can be found in Nielsen et al,
Science 254:1497-1500, 1991.
[0216] Inhibitory nucleic acids can also include one or more
nucleobase (often referred to in the art simply as "base")
modifications or substitutions. As used herein, "unmodified" or
"natural" nucleobases comprise the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C),
and uracil (U). Modified nucleobases comprise other synthetic and
natural nucleobases, such as 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl, and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine
and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo,
8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines, 5-halo particularly 5- bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine,
7-deazaguanine, and 7-deazaadenine, and 3-deazaguanine and
3-deazaadenine.
[0217] Further, nucleobases comprise those disclosed in U.S. Pat.
No. 3,687,808, those disclosed in `The Concise Encyclopedia of
Polymer Science And Engineering`, pages 858-859, Kroschwitz, J. I.,
Ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandle Chemie, International Edition', 1991, 30, page 613,
and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense
Research and Applications', pages 289-302, Crooke, S. T. and
Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are
particularly useful for increasing the binding affinity of the
oligomeric compounds of the invention. These include 5-substituted
pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted
purines, comprising 2-aminopropyladenine, 5-propynyluracil, and 5-
propynylcytosine. 5-methylcytosine substitutions have been shown to
increase nucleic acid duplex stability by 0.6-1.2<0>C
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds, `Antisense
Research and Applications`, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications. Modified nucleobases are described in U.S. Pat. Nos.
3,687,808, as well as 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692,
and 5,681,941 (each of which is herein incorporated by
reference).
[0218] In some embodiments, the inhibitory nucleic acids are
chemically linked to one or more moieties or conjugates that
enhance the activity, cellular distribution, or cellular uptake of
the oligonucleotide. Such moieties comprise but are not limited to,
lipid moieties such as a cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci. U.S.A. 86: 6553-6556, 1989), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Lett. 4: 1053-1060, 1994), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N. Y.
Acad. Sci. 660: 306-309, 1992; Manoharan et al., Bioorg. Med. Chem.
Lett. 3: 2765-2770, 1993), a thiocholesterol (Oberhauser et al.,
Nucl. Acids Res. 20, 533-538, 1992), an aliphatic chain, e.g.,
dodecandiol or undecyl residues (Kabanov et al., FEBS Lett. 259:
327-330, 1990; Svinarchuk et al., Biochimie 75: 49- 54, 1993), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl- rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett. 36: 3651-3654, 1995; Shea et al., Nucl. Acids
Res. 18: 3777-3783, 1990), a polyamine or a polyethylene glycol
chain (Mancharan et al., Nucleosides & Nucleotides 14: 969-973,
1995), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett. 36: 3651-3654, 1995), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta 1264: 229-237, 1995), or an octadecylamine
or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther. 277: 923-937, 1996). See also U.S. Pat. Nos.
4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730;
5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124;
5,118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718;
5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737;
4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830;
5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5, 245,022;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391, 723; 5,416,203, 5,451,463; 5,510,475; 5,512,667;
5,514,785; 5, 565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371;
5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941 (each of
which is herein incorporated by reference).
[0219] These moieties or conjugates can include conjugate groups
covalently bound to functional groups such as primary or secondary
hydroxyl groups. Conjugate groups of the invention include
intercalators, reporter molecules, polyamines, polyamides,
polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of oligomers, and groups that enhance
the pharmacokinetic properties of oligomers. Typical conjugate
groups include cholesterols, lipids, phospholipids, biotin,
phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve uptake, enhance resistance to
degradation, and/or strengthen sequence-specific hybridization with
the target nucleic acid. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve uptake, distribution, metabolism, or excretion of the
compounds of the present invention. Representative conjugate groups
are disclosed in International Patent Application No.
PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860,
which are incorporated herein by reference. Conjugate moieties
include, but are not limited to, lipid moieties such as a
cholesterol moiety, cholic acid, a thioether, e.g.,
hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g.,
dodecandiol or undecyl residues, a phospholipid, e.g.,
di-hexadecyl-rac- glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a
polyethylene glycol chain, or adamantane acetic acid, a palmityl
moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol
moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941 (each of which is incorporated by
reference).
[0220] The inhibitory nucleic acids useful in the present methods
are sufficiently complementary to the target miRNA, i.e., hybridize
sufficiently well and with sufficient specificity, to give the
desired effect. "Complementary" refers to the capacity for pairing,
through hydrogen bonding, between two sequences comprising
naturally or non-naturally occurring bases or analogs thereof. For
example, if a base at one position of an inhibitory nucleic acid is
capable of hydrogen bonding with a base at the corresponding
position of a miRNA, then the bases are considered to be
complementary to each other at that position. In some embodiments,
100% complementarity is not required. In some embodiments, 100%
complementarity is required. Routine methods can be used to design
an inhibitory nucleic acid that binds to the target sequence with
sufficient specificity.
[0221] While the specific sequences of certain exemplary target
segments are set forth herein, one of skill in the art will
recognize that these serve to illustrate and describe particular
embodiments within the scope of the present invention. Additional
target segments are readily identifiable by one having ordinary
skill in the art in view of this disclosure. Target segments of 5,
6, 7, 8, 9, 10 or more nucleotides in length comprising a stretch
of at least five (5) consecutive nucleotides within the seed
sequence, or immediately adjacent thereto, are considered to be
suitable for targeting as well. In some embodiments, target
segments can include sequences that comprise at least the 5
consecutive nucleotides from the 5'-terminus of one of the seed
sequence (the remaining nucleotides being a consecutive stretch of
the same RNA beginning immediately upstream of the 5'-terminus of
the seed sequence and continuing until the inhibitory nucleic acid
contains about 5 to about 30 nucleotides). In some embodiments,
target segments are represented by RNA sequences that comprise at
least the 5 consecutive nucleotides from the 3 `-terminus of one of
the seed sequence (the remaining nucleotides being a consecutive
stretch of the same miRNA beginning immediately downstream of the
3`-terminus of the target segment and continuing until the
inhibitory nucleic acid contains about 5 to about 30 nucleotides).
One having skill in the art armed with the sequences provided
herein will be able, without undue experimentation, to identify
further preferred regions to target. In some embodiments, an
inhibitory nucleic acid contain a sequence that is complementary to
at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, or 25 continguous nucleotides present in the target
(e.g., the target miRNA, e.g., mature or precursor hsa-miR-155, or
the target mRNA).
[0222] Once one or more target regions, segments or sites have been
identified, inhibitory nucleic acid compounds are chosen that are
sufficiently complementary to the target, i.e., that hybridize
sufficiently well and with sufficient specificity (i.e., do not
substantially bind to other non-target RNAs), to give the desired
effect.
[0223] In the context of this invention, hybridization means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. Complementary, as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a miRNA molecule or an mRNA molecule, then the inhibitory
nucleic acid and the miRNA or mRNA are considered to be
complementary to each other at that position. The inhibitory
nucleic acids and the miRNA or mRNA are complementary to each other
when a sufficient number of corresponding positions in each
molecule are occupied by nucleotides which can hydrogen bond with
each other. Thus, "specifically hybridizable" and "complementary"
are terms which are used to indicate a sufficient degree of
complementarity or precise pairing such that stable and specific
binding occurs between the inhibitory nucleic acid and the miRNA
target. For example, if a base at one position of an inhibitory
nucleic acid is capable of hydrogen bonding with a base at the
corresponding position of a miRNA or a mRNA, then the bases are
considered to be complementary to each other at that position. 100%
complementarity is not required.
[0224] It is understood in the art that a complementary nucleic
acid sequence need not be 100% complementary to that of its target
nucleic acid to be specifically hybridizable. A complementary
nucleic acid sequence for purposes of the present methods is
specifically hybridisable when binding of the sequence to the
target miRNA or mRNA molecule interferes with the normal function
of the target miRNA or mRNA to cause a loss of expression or
activity, and there is a sufficient degree of complementarity to
avoid non-specific binding of the sequence to non-target RNA
sequences under conditions in which specific binding is desired,
e.g., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed under suitable
conditions of stringency. For example, stringent salt concentration
will ordinarily be less than about 750 mM NaCl and 75 mM trisodium
citrate, preferably less than about 500 mM NaCl and 50 mM trisodium
citrate, and more preferably less than about 250 mM NaCl and 25 mM
trisodium citrate. Low stringency hybridization can be obtained in
the absence of organic solvent, e.g., formamide, while high
stringency hybridization can be obtained in the presence of at
least about 35% formamide, and more preferably at least about 50%
formamide. Stringent temperature conditions will ordinarily include
temperatures of at least about 30.degree. C., more preferably of at
least about 37.degree. C., and most preferably of at least about
42.degree. C. Varying additional parameters, such as hybridization
time, the concentration of detergent, e.g., sodium dodecyl sulfate
(SDS), and the inclusion or exclusion of carrier DNA, are well
known to those skilled in the art. Various levels of stringency are
accomplished by combining these various conditions as needed. In a
preferred embodiment, hybridization will occur at 30.degree. C. in
750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more
preferred embodiment, hybridization will occur at 37.degree. C. in
500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and
100 .mu.g/ml denatured salmon sperm DNA (ssDNA). In a most
preferred embodiment, hybridization will occur at 42.degree. C. in
250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and
200 .mu.g/ml ssDNA. Useful variations on these conditions will be
readily apparent to those skilled in the art.
[0225] For most applications, washing steps that follow
hybridization will also vary in stringency. Wash stringency
conditions can be defined by salt concentration and by temperature.
As above, wash stringency can be increased by decreasing salt
concentration or by increasing temperature. For example, stringent
salt concentration for the wash steps will preferably be less than
about 30 mM NaCl and 3 mM trisodium citrate, and most preferably
less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent
temperature conditions for the wash steps will ordinarily include a
temperature of at least about 25.degree. C., more preferably of at
least about 42.degree. C., and even more preferably of at least
about 68.degree. C. In a preferred embodiment, wash steps will
occur at 25.degree. C. in 30 mM NaCl, 3 mM trisodium citrate, and
0.1% SDS. In a more preferred embodiment, wash steps will occur at
42.degree. C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1%
SDS. In a more preferred embodiment, wash steps will occur at
68.degree. C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1%
SDS. Additional variations on these conditions will be readily
apparent to those skilled in the art. Hybridization techniques are
well known to those skilled in the art and are described, for
example, in Benton and Davis (Science 196: 180, 1977); Grunstein
and Hogness (Proc. Natl. Acad. Sci. U.S.A. 72: 3961, 1975); Ausubel
et al. (Current Protocols in Molecular Biology, Wiley Interscience,
New York, 2001); Berger and Kimmel (Guide to Molecular Cloning
Techniques, 1987, Academic Press, New York); and Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York.
[0226] In general, the inhibitory nucleic acids useful in the
methods described herein have at least 80% sequence complementarity
to a target region within the target nucleic acid, e.g., 90%, 95%,
or 100% sequence complementarity to the target region within an
miRNA. For example, an antisense compound in which 18 of 20
nucleobases of the antisense oligonucleotide are complementary, and
would therefore specifically hybridize, to a target region would
represent 90 percent complementarity. Percent complementarity of an
inhibitory nucleic acid with a region of a target nucleic acid can
be determined routinely using basic local alignment search tools
(BLAST programs) (Altschul et al., J. Mol. Biol. 215: 403-410,
1990; Zhang and Madden, Genome Res. 7: 649-656, 1997). Antisense
and other compounds of the invention that hybridize to an miRNA or
a mRNA are identified through routine experimentation. In general
the inhibitory nucleic acids must retain specificity for their
target, i.e., must not directly bind to, or directly significantly
affect expression levels of, transcripts other than the intended
target.
[0227] For further disclosure regarding inhibitory nucleic acids,
please see US2010/0317718 (antisense oligos); US2010/0249052
(double-stranded ribonucleic acid (dsRNA)); US2009/0181914 and
US2010/0234451 (LNAs); US2007/0191294 (siRNA analogues);
US2008/0249039 (modified siRNA); and WO2010/129746 and
WO2010/040112 (inhibitory nucleic acids).
[0228] Antisense
[0229] Antisense oligonucleotides are typically designed to block
expression of a DNA or RNA target by binding to the target and
halting expression at the level of transcription, translation, or
splicing. Antisense oligonucleotides of the present invention are
complementary nucleic acid sequences designed to hybridize under
stringent conditions to the target microRNA or the target
inflammatory marker mRNA. Thus, oligonucleotides are chosen that
are sufficiently complementary to the target, i.e., that hybridize
sufficiently well and with sufficient specificity, to give the
desired effect.
[0230] Modified Bases/Locked Nucleic Acids (LNAs)
[0231] In some embodiments, the inhibitory nucleic acids used in
the methods described herein comprise one or more modified bonds or
bases. Modified bases include phosphorothioate, methylphosphonate,
peptide nucleic acids, or locked nucleic acid (LNA) molecules.
Preferably, the modified nucleotides are locked nucleic acid
molecules, including [alpha]-L-LNAs. LNAs comprise ribonucleic acid
analogues wherein the ribose ring is "locked" by a methylene bridge
between the 2'-oxgygen and the 4'-carbon--i.e., oligonucleotides
containing at least one LNA monomer, that is, one
2'-O,4'-C-methylene-.beta.-D-ribofuranosyl nucleotide. LNA bases
form standard Watson-Crick base pairs but the locked configuration
increases the rate and stability of the base pairing reaction
(Jepsen et al., Oligonucleotides 14: 130-146, 2004). LNAs also have
increased affinity to base pair with RNA as compared to DNA. These
properties render LNAs especially useful as probes for fluorescence
in situ hybridization (FISH) and comparative genomic hybridization,
as knockdown tools for miRNAs, and as antisense oligonucleotides to
target mRNAs or other RNAs, e.g., miRNAs and mRNAs as described
herein.
[0232] The LNA molecules can include molecules comprising 10-30,
e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein
one of the strands is substantially identical, e.g., at least 80%
(or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3,
2, 1, or 0 mismatched nucleotide(s), to a target region in the
miRNA or the mRNA. The LNA molecules can be chemically synthesized
using methods known in the art.
[0233] The LNA molecules can be designed using any method known in
the art; a number of algorithms are known, and are commercially
available (e.g., on the internet, for example at exiqon.com). See,
e.g., You et al., Nuc. Acids. Res. 34:e60, 2006; McTigue et al.,
Biochemistry 43: 5388-405, 2004; and Levin et al., Nucl. Acids.
Res. 34:e142, 2006. For example, "gene walk" methods, similar to
those used to design antisense oligos, can be used to optimize the
inhibitory activity of the LNA; for example, a series of
oligonucleotides of 10-30 nucleotides spanning the length of a
target miRNA or mRNA can be prepared, followed by testing for
activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can
be left between the LNAs to reduce the number of oligonucleotides
synthesized and tested. GC content is preferably between about
30-60%. General guidelines for designing LNAs are known in the art;
for example, LNA sequences will bind very tightly to other LNA
sequences, so it is preferable to avoid significant complementarity
within an LNA. Contiguous runs of three or more Gs or Cs, or more
than four LNA residues, should be avoided where possible (for
example, it may not be possible with very short (e.g., about 9-10
nt) oligonucleotides). In some embodiments, the LNAs are
xylo-LNAs.
[0234] In some embodiments, the LNA molecules can be designed to
target a specific region of the miRNA. For example, a specific
functional region can be targeted, e.g., a region comprising a seed
sequence. Alternatively or in addition, highly conserved regions
can be targeted, e.g., regions identified by aligning sequences
from disparate species such as primate (e.g., human) and rodent
(e.g., mouse) and looking for regions with high degrees of
identity. Percent identity can be determined routinely using basic
local alignment search tools (BLAST programs) (Altschul et al., J.
Mol. Biol. 215: 403-410, 1990; Zhang and Madden, Genome Res.
7:649-656, 1997), e.g., using the default parameters.
[0235] For additional information regarding LNAs see U.S. Pat. Nos.
6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034,133; 7,053,207;
7,060,809; 7,084,125; and 7,572,582; and U.S. Pre-Grant Pub. Nos.
2010/0267018; 2010/0261175; and 2010/0035968; Koshkin et al.,
Tetrahedron 54: 3607-3630, 1998; Obika et al., Tetrahedron Lett.
39: 5401-5404, 1998; Jepsen et al., Oligonucleotides 14: 130-146 ,
2004; Kauppinen et al., Drug Disc. Today 2(3): 287-290, 2005; and
Ponting et al., Cell 136(4): 629-641, 2009, and references cited
therein.
[0236] See also U.S. Ser. No. 61/412,862, which is incorporated by
reference herein in its entirety.
[0237] Antagomirs
[0238] In some embodiments, the antisense is an antagomir.
Antagomirs are chemically-modified antisense oligonucleotides that
target a microRNA (e.g., target hsa-miR-155). For example, an
antagomir for use in the methods described herein can include a
nucleotide sequence sufficiently complementary to hybridize to a
miRNA target sequence of about 12 to 25 nucleotides, preferably
about 15 to 23 nucleotides.
[0239] In general, antagomirs include a cholesterol moiety, e.g.,
at the 3'-end. In some embodiments, antagomirs have various
modifications for RNase protection and pharmacologic properties
such as enhanced tissue and cellular uptake. For example, in
addition to the modifications discussed above for antisense oligos,
an antagomir can have one or more of complete or partial
2'-O-methylation of sugar and/or a phosphorothioate backbone.
Phosphorothioate modifications provide protection against RNase
activity and their lipophilicity contributes to enhanced tissue
uptake. In some embodiments, the antagomir can include six
phosphorothioate backbone modifications; two phosphorothioates are
located at the 5'-end and four at the 3'-end. See, e.g., Krutzfeldt
et al., Nature 438: 685-689, 2005; Czech, N. Engl. J. Med. 354:
1194-1195, 2006; Robertson et al., Silence 1: 10, 2010; Marquez and
McCaffrey, Human Gene Ther. 19(1):27-38, 2008; van Rooij et al.,
Circ. Res. 103(9): 919-928, 2008; and Liu et al., Int. J. Mol. Sci.
9:978-999, 2008.
[0240] Antagomirs useful in the present methods can also be
modified with respect to their length or otherwise the number of
nucleotides making up the antagomir. In general, the antagomirs are
about 20-21 nucleotides in length for optimal function, as this
size matches the size of most mature microRNAs. The antagomirs must
retain specificity for their target, i.e., must not directly bind
to, or directly significantly affect expression levels of,
transcripts other than the intended target.
[0241] In some embodiments, the inhibitory nucleic acid is locked
and includes a cholesterol moiety (e.g., a locked antagomir).
[0242] siRNA
[0243] In some embodiments, the nucleic acid sequence that is
complementary to a target miRNA or a target mRNA can be an
interfering RNA, including but not limited to a small interfering
RNA ("siRNA") or a small hairpin RNA ("shRNA"). Methods for
constructing interfering RNAs are well known in the art. For
example, the interfering RNA can be assembled from two separate
oligonucleotides, where one strand is the sense strand and the
other is the antisense strand, wherein the antisense and sense
strands are self-complementary (i.e., each strand comprises
nucleotide sequence that is complementary to nucleotide sequence in
the other strand; such as where the antisense strand and sense
strand form a duplex or double stranded structure); the antisense
strand comprises nucleotide sequence that is complementary to a
nucleotide sequence in a target nucleic acid molecule or a portion
thereof (i.e., an undesired gene) and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. Alternatively, interfering RNA is
assembled from a single oligonucleotide, where the
self-complementary sense and antisense regions are linked by means
of nucleic acid based or non-nucleic acid-based linker(s). The
interfering RNA can be a polynucleotide with a duplex, asymmetric
duplex, hairpin or asymmetric hairpin secondary structure, having
self-complementary sense and antisense regions, wherein the
antisense region comprises a nucleotide sequence that is
complementary to nucleotide sequence in a separate target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The interfering can be a circular
single-stranded polynucleotide having two or more loop structures
and a stem comprising self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof, and wherein the circular
polynucleotide can be processed either in vivo or in vitro to
generate an active siRNA molecule capable of mediating RNA
interference.
[0244] In some embodiments, the interfering RNA coding region
encodes a self-complementary RNA molecule having a sense region, an
antisense region and a loop region. Such an RNA molecule when
expressed desirably forms a "hairpin" structure, and is referred to
herein as an "shRNA." The loop region is generally between about 2
and about 10 nucleotides in length. In some embodiments, the loop
region is from about 6 to about 9 nucleotides in length. In some
embodiments, the sense region and the antisense region are between
about 15 and about 20 nucleotides in length. Following
post-transcriptional processing, the small hairpin RNA is converted
into a siRNA by a cleavage event mediated by the enzyme Dicer,
which is a member of the RNase III family. The siRNA is then
capable of inhibiting the expression of a gene with which it shares
homolog.sub.2. For details, see Brummelkamp et al., Science 296:
550-553, 2002; Lee et al., Nature Biotechnol., 20, 500-505, 2002;
Miyagishi and Taira, Nature Biotechnol. 20: 497-500, 2002; Paddison
et al., Genes & Dev. 16: 948-958, 2002; Paul, Nature
Biotechnol. 20, 505-508, 2002; Sui, Proc. Natl. Acad. Sci. U.S.A.,
99(6): 5515-5520, 2002; Yu et al., Proc. Natl. Acad. Sci. U.S.A.
99:6047-6052, 2002.
[0245] The target RNA cleavage reaction guided by siRNAs is highly
sequence specific. In general, siRNA containing a nucleotide
sequences identical to a portion of the target nucleic acid (i.e.,
a target region comprising the seed sequence of a target miRNA or
mRNA) are preferred for inhibition. However, 100% sequence identity
between the siRNA and the target gene is not required to practice
the present invention. Thus the invention has the advantage of
being able to tolerate sequence variations that might be expected
due to genetic mutation, strain polymorphism, or evolutionary
divergence. For example, siRNA sequences with insertions,
deletions, and single point mutations relative to the target
sequence have also been found to be effective for inhibition.
Alternatively, siRNA sequences with nucleotide analog substitutions
or insertions can be effective for inhibition. In general the
siRNAs must retain specificity for their target, i.e., must not
directly bind to, or directly significantly affect expression
levels of, transcripts other than the intended target.
[0246] Ribozymes
[0247] Trans-cleaving enzymatic nucleic acid molecules can also be
used; they have shown promise as therapeutic agents for human
disease (Usman & McSwiggen, Ann. Rep. Med. Chem. 30: 285-294,
1995; Christoffersen and Marr, J. Med. Chem. 38: 2023-2037, 1995).
Enzymatic nucleic acid molecules can be designed to cleave specific
miRNA or mRNA targets within the background of cellular RNA. Such a
cleavage event renders the miRNA or mRNA non-functional.
[0248] In general, enzymatic nucleic acids with RNA cleaving
activity act by first binding to a target RNA. Such binding occurs
through the target binding portion of an enzymatic nucleic acid
which is held in close proximity to an enzymatic portion of the
molecule that acts to cleave the target RNA. Thus, the enzymatic
nucleic acid first recognizes and then binds a target RNA through
complementary base pairing, and once bound to the correct site,
acts enzymatically to cut the target RNA. Strategic cleavage of
such a target RNA will destroy its activity. After an enzymatic
nucleic acid has bound and cleaved its RNA target, it is released
from that RNA to search for another target and can repeatedly bind
and cleave new targets.
[0249] Several approaches such as in vitro selection (evolution)
strategies (Orgel, Proc. R. Soc. London, B 205: 435, 1979) have
been used to evolve new nucleic acid catalysts capable of
catalyzing a variety of reactions, such as cleavage and ligation of
phosphodiester linkages and amide linkages, (Joyce, Gene, 82,
83-87, 1989; Beaudry et al., Science 257, 635-641, 1992; Joyce,
Scientific American 267, 90-97, 1992; Breaker et al., TIBTECH 12:
268, 1994; Bartel et al., Science 261: 1411-1418, 1993; Szostak,
TIBS 17, 89-93, 1993; Kumar et al., FASEB I, 9: 1183, 1995;
Breaker, Curr. Op. Biotech., 1: 442, 1996). The development of
ribozymes that are optimal for catalytic activity would contribute
significantly to any strategy that employs RNA-cleaving ribozymes
for the purpose of regulating gene expression. The hammerhead
ribozyme, for example, functions with a catalytic rate (kcat) of
about 1 min' in the presence of saturating (10 mM) concentrations
of Mg.sup.2+ cofactor. An artificial "RNA ligase" ribozyme has been
shown to catalyze the corresponding self-modification reaction with
a rate of about 100 min.sup.-1. In addition, it is known that
certain modified hammerhead ribozymes that have substrate binding
arms made of DNA catalyze RNA cleavage with multiple turn-over
rates that approach 100 min.sup.-1.
Sense Nucleic Acids
[0250] Agents useful in the methods of treatment described herein
include sense nucleic acid molecules that increase the expression
or activity of any of the microRNAs (e.g., mature microRNA or
precursor microRNA) listed in Tables 2, 4, 6, 8, 10, 13, 15, 17,
and 19, or increase the expression or activity of any of the mRNAs
encoding an inflammatory marker listed in Table 21. A sense nucleic
acid can be contain a sequence that is at least 80% (e.g., at least
90%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the sequence of
any one of the microRNAs (e.g., mature microRNA or precursor
microRNA) listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, or
the sequence of any one of the mRNAs listed in Table 21. Sense
nucleic acids can contain one or more of any of the modifications
(e.g., backbone modifications, nucleobase modifications, sugar
modifications, or one or more conjugated molecules) described
herein without limitation. Methods of making and administering
sense nucleic acids are known in the art. Additional methods of
making and using sense nucleic acids are described herein.
[0251] Making and Using Inhibitory Nucleic Acids and Sense Nucleic
Acids
[0252] The nucleic acid sequences used to practice the methods
described herein, whether RNA, cDNA, genomic DNA, vectors, viruses
or hybrids thereof, can be isolated from a variety of sources,
genetically engineered, amplified, and/or expressed/generated
recombinantly. Recombinant nucleic acid sequences can be
individually isolated or cloned and tested for a desired activity.
Any recombinant expression system can be used, including e.g., in
vitro, bacterial, fungal, mammalian, yeast, insect, or plant cell
expression systems.
[0253] Nucleic acid sequences of the invention (e.g., any of the
inhibitory nucleic acids or sense nucleic acids described herein)
can be inserted into delivery vectors and expressed from
transcription units within the vectors. The recombinant vectors can
be DNA plasmids or viral vectors. Generation of the vector
construct can be accomplished using any suitable genetic
engineering techniques well known in the art, including, without
limitation, the standard techniques of PCR, oligonucleotide
synthesis, restriction endonuclease digestion, ligation,
transformation, plasmid purification, and DNA sequencing, for
example as described in Sambrook et al. Molecular Cloning: A
Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997))
and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford
University Press, (2000)).
[0254] As will be apparent to one of ordinary skill in the art, a
variety of suitable vectors are available for transferring nucleic
acids of the invention into cells. The selection of an appropriate
vector to deliver nucleic acids and optimization of the conditions
for insertion of the selected expression vector into the cell, are
within the scope of one of ordinary skill in the art without the
need for undue experimentation. Viral vectors comprise a nucleotide
sequence having sequences for the production of recombinant virus
in a packaging cell. Viral vectors expressing nucleic acids of the
invention can be constructed based on viral backbones including,
but not limited to, a retrovirus, lentivirus, herpes virus,
adenovirus, adeno-associated virus, pox virus, or alphavirus. The
recombinant vectors (e.g., viral vectors) capable of expressing the
nucleic acids of the invention can be delivered as described
herein, and persist in target cells (e.g., stable transformants).
For example, such recombinant vectors (e.g., a recombinant vector
that results in the expression of an antisense oligomer that is
complementary to hsa-miR-155) can be administered into (e.g.,
injection or infusion into) the cerebrospinal fluid of the subject
(e.g., intracranial injection, intraparenchymal injection,
intraventricular injection, and intrathecal injection, see, e.g.,
Bergen et al., Pharmaceutical Res. 25: 983-998, 2007). A number of
exemplary recombinant viral vectors that can be used to express any
of the nucleic acids described herein are also described in Bergen
et al. (supra). Additional examples of recombinant viral vectors
are known in the art.
[0255] The nucleic acids provided herein (e.g., the inhibitory
nucleic acids) can be further be complexed with one or more
cationic polymers (e.g., poly-L-lysine and poly(ethylenimine),
cationic lipids (e.g., 1,2-dioleoyl-3-trimethylammonium propone
(DOTAP), N-methyl-4-(dioleyl)methylpyridinium, and
3.beta.-[N-(N',N'-dimethylaminoethane)-carbamoyl] cholesterol),
and/or nanoparticles (e.g., cationic polybutyl cyanoacrylate
nanoparticles, silica nanoparticles, or polyethylene glycol-based
nanoparticles) prior to administration to the subject (e.g.,
injection or infusion into the cerebrospinal fluid of the subject).
Additional examples of cationic polymers, cationic lipids, and
nanoparticles for the therapeutic delivery of nucleic acids are
known in the art. The therapeutic delivery of nucleic acids has
also been shown to be achieved following intrathecal injection of
polyethyleneimine/DNA complexes (Wang et al., Mol. Ther. 12:
314-320, 2005). The methods for delivery of nucleic acids described
herein are non-limiting. Additional methods for the therapeutic
delivery of nucleic acids to a subject are known in the art.
[0256] In some embodiments, the inhibitory nucleic acids (e.g., one
or more inhibitory nucleic acids targeting hsa-miR-155) can be
administered systemically (e.g., intravenously, intaarterially,
intramuscularly, subcutaneously, or intraperitoneally) or
intrathecally (e.g., epidural administration). In some embodiments,
the inhibitory nucleic acid is administered in a composition (e.g.,
complexed with) one or more cationic lipids. Non-limiting examples
of cationic lipids that can be used to administer one or more
inhibitory nucleic acids (e.g., any of the inhibitory nucleic acids
described herein) include: Lipofectamine, the cationic lipid
molecules described in WO 97/045069, and U.S. Patent Application
Publication Nos. 2012/0021044, 2012/0015865, 2011/0305769,
2011/0262527, 2011/0229581, 2010/0305198, 2010/0203112, and
2010/0104629 (each of which is herein incorporated by
reference).Nucleic acid sequences used to practice this invention
can be synthesized in vitro by well-known chemical synthesis
techniques, as described in, e.g., Adams, J. Am. Chem. Soc. 105:
661, 1983; Belousov, Nucleic Acids Res. 25: 3440-3444, 1997;
Frenkel, Free Radic. Biol. Med. 19: 373-380, 1995; Blommers,
Biochemistry 33: 7886-7896, 1994; Narang, Meth. Enzymol. 68: 90,
1994; Brown, Meth. Enzymol. 68: 109, 1979; Beaucage, Tetra. Lett.
22: 1859, 1981; and U.S. Pat. No. 4,458,066.
[0257] Nucleic acid sequences of the invention can be stabilized
against nucleolytic degradation such as by the incorporation of a
modification, e.g., a nucleotide modification. For example, nucleic
acid sequences of the invention includes a phosphorothioate at
least the first, second, or third internucleotide linkage at the 5'
or 3' end of the nucleotide sequence. As another example, the
nucleic acid sequence can include a 2'-modified nucleotide, e.g., a
2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl
(2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl
(2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP),
2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or
2'-O--N-methylacetamido (2'-O-NMA). As another example, the nucleic
acid sequence can include at least one 2'-O-methyl-modified
nucleotide, and in some embodiments, all of the nucleotides include
a 2'-O-methyl modification. In some embodiments, the nucleic acids
are "locked," i.e., comprise nucleic acid analogues in which the
ribose ring is "locked" by a methylene bridge connecting the 2'-O
atom and the 4'-C atom (see, e.g., Kaupinnen et al., Drug Disc.
Today 2(3): 287-290, 2005; Koshkin et al., J. Am. Chem. Soc.,
120(50): 13252-13253, 1998). For additional modifications see US
2010/0004320, US 2009/0298916, and US 2009/0143326 (each of which
is incorporated by reference).
[0258] Techniques for the manipulation of nucleic acids used to
practice this invention, such as, e.g., subcloning, labeling probes
(e.g., random-primer labeling using Klenow polymerase, nick
translation, amplification), sequencing, hybridization, and the
like are well described in the scientific and patent literature,
see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual
3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et
al., Eds. (John Wiley & Sons, Inc., New York 2010); Kriegler,
Gene Transfer and Expression: A Laboratory Manual (1990);
Laboratory Techniques In Biochemistry And Molecular Biolog.sub.2:
Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid Preparation, Tijssen, Ed. Elsevier, N.Y. (1993).
Antibodies and Recombinant Proteins
[0259] One or more antibodies that specifically bind to a protein
encoded by any of the inflammatory marker genes listed in Table 21
can also be administered to a subject to treat a neurodegenerative
disease. Antibodies that specifically bind to a protein listed in
Table 21 are either commercially available or can be generated
using standard methods known in the art. For example, a polyclonal
antibody that specifically binds to a protein listed in Table 21
can be generated by immunizing a mammal with the purified protein
and isolating antibodies from the mammal that specifically bind to
the purified protein. The antibodies used can be a monoclonal or
polyclonal antibody. The antibodies administered can be a
immunoglobulin G or immunoglobulin M. The antibodies administered
can be chimeric (e.g., a humanized antibody) or a human antibody.
The antibodies used can also be an antibody fragment (e.g., a Fab,
F(ab ).sub.2, Fv, and single chain Fv (scFv) fragment).
[0260] One or more inflammatory marker proteins listed in Table 20
can also be administered to a subject for the treatment of a
neurodegenerative disorder. Several methods are known in the art
for the production of a recombinant protein using molecular biology
and cell culture techniques. For example, an inflammatory marker
protein encoded by a mRNA sequence listed in Table 20 can be
transfected into a bacterial, yeast, or mammalian cell (using a
protein expression plasmid or viral vector) that allows for the
expression of the inflammatory by the transfected cell. The
transfected cells or the culture medium can be collected, and the
recombinant inflammatory marker protein purified using methods
known in the art. The inflammatory marker proteins administered to
the subject can contain a sequence having at least 80% (e.g., at
least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any
of the amino acid sequences listed in Table 20. The inflammatory
marker proteins administered to the subject can further contain a
modification (e.g., a polyethylene glycol or an HIV tat protein, or
any other moiety that increases the cellular permeability of the
inflammatory marker protein).
Pharmaceutical Compositions
[0261] The methods described herein can include the administration
of pharmaceutical compositions and formulations comprising any one
or more (e.g., two, three, four, or five) of the inhibitory nucleic
acids (e.g., one or more inhibitory nucleic acids targeting
hsa-miR-155), sense nucleic acids, inflammatory marker proteins, or
antibodies described herein.
[0262] In some embodiments, the compositions are formulated with a
pharmaceutically acceptable carrier. The pharmaceutical
compositions and formulations can be administered parenterally,
topically, orally or by local administration, such as by aerosol or
transdermally. The pharmaceutical compositions can be formulated in
any way and can be administered in a variety of unit dosage forms
depending upon the condition or disease and the degree of illness,
the general medical condition of each patient, the resulting
preferred method of administration and the like. Details on
techniques for formulation and administration of pharmaceuticals
are well described in the scientific and patent literature, see,
e.g., Remington: The Science and Practice of Pharmacy, 21st ed.,
2005.
[0263] The inhibitory nucleic acids can be administered alone or as
a component of a pharmaceutical formulation (composition). The
compounds may be formulated for administration, in any convenient
way for use in human or veterinary medicine. Wetting agents,
emulsifiers and lubricants, such as sodium lauryl sulfate and
magnesium stearate, as well as coloring agents, release agents,
coating agents, sweetening, flavoring and perfuming agents,
preservatives, and antioxidants can also be present in the
compositions. In some embodiments, one or more cationic lipids,
cationic polymers, or nanoparticles can be included in compositions
containing the one or more inhibitory nucleic acids (e.g.,
compositions containing one or more inhibitory nucleic acids
targeting hsa-miR-155).
[0264] Formulations of the compositions of the invention include
those suitable for intradermal, inhalation, oral/nasal, topical,
parenteral, rectal, and/or intravaginal administration. The
formulations may conveniently be presented in unit dosage form and
may be prepared by any methods well known in the art of pharmacy.
The amount of active ingredient (e.g., nucleic acid sequences of
this invention) which can be combined with a carrier material to
produce a single dosage form will vary depending upon the host
being treated, the particular mode of administration, e.g.,
intradermal or inhalation. The amount of active ingredient which
can be combined with a carrier material to produce a single dosage
form will generally be that amount of the compound which produces a
therapeutic effect.
[0265] Pharmaceutical formulations of this invention can be
prepared according to any method known to the art for the
manufacture of pharmaceuticals. Such drugs can contain sweetening
agents, flavoring agents, coloring agents, and preserving agents. A
formulation can be admixtured with nontoxic pharmaceutically
acceptable excipients which are suitable for manufacture.
Formulations may comprise one or more diluents, emulsifiers,
preservatives, buffers, excipients, etc., and may be provided in
such forms as liquids, powders, emulsions, lyophilized powders,
sprays, creams, lotions, controlled release formulations, tablets,
pills, gels, on patches, in implants, etc.
[0266] Pharmaceutical formulations for oral administration can be
formulated using pharmaceutically acceptable carriers well known in
the art in appropriate and suitable dosages. Such carriers enable
the pharmaceuticals to be formulated in unit dosage forms as
tablets, pills, powder, dragees, capsules, liquids, lozenges, gels,
syrups, slurries, suspensions, etc., suitable for ingestion by the
patient. Pharmaceutical preparations for oral use can be formulated
as a solid excipient, optionally grinding a resulting mixture, and
processing the mixture of granules, after adding suitable
additional compounds, if desired, to obtain tablets or dragee
cores. Suitable solid excipients are carbohydrate or protein
fillers include, e.g., sugars, including lactose, sucrose,
mannitol, or sorbitol; starch from corn, wheat, rice, potato, or
other plants; cellulose such as methyl cellulose,
hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose;
and gums including arabic and tragacanth; and proteins, e.g.,
gelatin and collagen. Disintegrating or solubilizing agents may be
added, such as the cross-linked polyvinyl pyrrolidone, agar,
alginic acid, or a salt thereof, such as sodium alginate. Push-fit
capsules can contain active agents mixed with a filler or binders
such as lactose or starches, lubricants such as talc or magnesium
stearate, and, optionally, stabilizers. In soft capsules, the
active agents can be dissolved or suspended in suitable liquids,
such as fatty oils, liquid paraffin, or liquid polyethylene glycol
with or without stabilizers.
[0267] Aqueous suspensions can contain an active agent (e.g.,
inhibitory nucleic acids or sense nucleic acids described herein)
in admixture with excipients suitable for the manufacture of
aqueous suspensions, e.g., for aqueous intradermal injections. Such
excipients include a suspending agent, such as sodium
carboxymethylcellulose, methylcellulose,
hydroxypropylmethylcellulose, sodium alginate,
polyvinylpyrrolidone, gum tragacanth, and gum acacia, and
dispersing or wetting agents such as a naturally occurring
phosphatide (e.g., lecithin), a condensation product of an alkylene
oxide with a fatty acid (e.g., polyoxyethylene stearate), a
condensation product of ethylene oxide with a long-chain aliphatic
alcohol (e.g., heptadecaethylene oxycetanol), a condensation
product of ethylene oxide with a partial ester derived from a fatty
acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or
a condensation product of ethylene oxide with a partial ester
derived from fatty acid and a hexitol anhydride (e.g.,
polyoxyethylene sorbitan mono-oleate). The aqueous suspension can
also contain one or more preservatives such as ethyl or n-propyl
p-hydroxybenzoate, one or more coloring agents, one or more
flavoring agents, and one or more sweetening agents, such as
sucrose, aspartame, or saccharin. Formulations can be adjusted for
osmolarity.
[0268] In some embodiments, oil-based pharmaceuticals are used for
administration of nucleic acid sequences of the invention.
Oil-based suspensions can be formulated by suspending an active
agent in a vegetable oil, such as arachis oil, olive oil, sesame
oil, or coconut oil, or in a mineral oil such as liquid paraffin;
or a mixture of these. See e.g., U.S. Pat. No. 5,716,928,
describing using essential oils or essential oil components for
increasing bioavailability and reducing inter- and intra-individual
variability of orally administered hydrophobic pharmaceutical
compounds (see also U.S. Pat. No. 5,858,401). The oil suspensions
can contain a thickening agent, such as beeswax, hard paraffin, or
cetyl alcohol. Sweetening agents can be added to provide a
palatable oral preparation, such as glycerol, sorbitol, or sucrose.
These formulations can be preserved by the addition of an
antioxidant such as ascorbic acid. As an example of an injectable
oil vehicle, see Minto, J. Pharmacol. Exp. Ther. 281: 93-102,
1997.
[0269] Pharmaceutical formulations can also be in the form of
oil-in-water emulsions. The oily phase can be a vegetable oil or a
mineral oil, described above, or a mixture of these. Suitable
emulsifying agents include naturally-occurring gums, such as gum
acacia and gum tragacanth, naturally occurring phosphatides, such
as soybean lecithin, esters, or partial esters derived from fatty
acids and hexitol anhydrides, such as sorbitan mono-oleate, and
condensation products of these partial esters with ethylene oxide,
such as polyoxyethylene sorbitan mono-oleate. The emulsion can also
contain sweetening agents and flavoring agents, as in the
formulation of syrups and elixirs. Such formulations can also
contain a demulcent, a preservative, or a coloring agent. In
alternative embodiments, these injectable oil-in-water emulsions of
the invention comprise a paraffin oil, a sorbitan monooleate, an
ethoxylated sorbitan monooleate, and/or an ethoxylated sorbitan
trioleate.
[0270] The pharmaceutical compounds can also be administered by in
intranasal, intraocular and intravaginal routes including
suppositories, insufflation, powders and aerosol formulations (for
examples of steroid inhalants, see e.g., Rohatagi, J. Clin.
Pharmacol. 35: 1187-1193, 1995; Tjwa, Ann. Allergy Asthma Immunol.
75: 107-111, 1995). Suppositories formulations can be prepared by
mixing the drug with a suitable non-irritating excipient which is
solid at ordinary temperatures but liquid at body temperatures and
will therefore melt in the body to release the drug. Such materials
are cocoa butter and polyethylene glycols.
[0271] In some embodiments, the pharmaceutical compounds can be
delivered transdermally, by a topical route, formulated as
applicator sticks, solutions, suspensions, emulsions, gels, creams,
ointments, pastes, jellies, paints, powders, and aerosols.
[0272] In some embodiments, the pharmaceutical compounds can also
be delivered as microspheres for slow release in the body. For
example, microspheres can be administered via intradermal injection
of drug which slowly release subcutaneously; see Rao, J. Biomater
Sci. Polym. Ed. 7: 623-645, 1995; as biodegradable and injectable
gel formulations, see, e.g., Gao, Pharm. Res. 12: 857-863, 1995;
or, as microspheres for oral administration, see, e.g., Eyles, J.
Pharm. Pharmacol. 49: 669-674, 1997.
[0273] In some embodiments, the pharmaceutical compounds can be
parenterally administered, such as by intravenous (IV)
administration or administration into a body cavity, a lumen of an
organ, or into the cranium (e.g., intracranial injection or
infusion) or the cerebrospinal fluid of a subject. These
formulations can comprise a solution of active agent dissolved in a
pharmaceutically acceptable carrier. Acceptable vehicles and
solvents that can be employed are water and Ringer's solution, an
isotonic sodium chloride. In addition, sterile fixed oils can be
employed as a solvent or suspending medium. For this purpose any
bland fixed oil can be employed including synthetic mono- or
diglycerides. In addition, fatty acids, such as oleic acid can
likewise be used in the preparation of injectables. These solutions
are sterile and generally free of undesirable matter. These
formulations may be sterilized by conventional, well known
sterilization techniques. The formulations may contain
pharmaceutically acceptable auxiliary substances as required to
approximate physiological conditions such as pH adjusting and
buffering agents, toxicity adjusting agents, e.g., sodium acetate,
sodium chloride, potassium chloride, calcium chloride, sodium
lactate, and the like. The concentration of active agent in these
formulations can vary widely, and will be selected primarily based
on fluid volumes, viscosities, body weight, and the like, in
accordance with the particular mode of administration selected and
the patient's needs. For IV administration, the formulation can be
a sterile injectable preparation, such as a sterile injectable
aqueous or oleaginous suspension. This suspension can be formulated
using those suitable dispersing or wetting agents and suspending
agents. The sterile injectable preparation can also be a suspension
in a nontoxic parenterally-acceptable diluent or solvent, such as a
solution of 1,3-butanediol. The administration can be by bolus or
continuous infusion (e.g., substantially uninterrupted introduction
into a blood vessel for a specified period of time).
[0274] In some embodiments, the pharmaceutical compounds and
formulations can be lyophilized. Stable lyophilized formulations
comprising an inhibitory nucleic acid or a sense nucleic acid can
be made by lyophilizing a solution comprising a pharmaceutical of
the invention and a bulking agent, e.g., mannitol, trehalose,
raffinose, and sucrose, or mixtures thereof. A process for
preparing a stable lyophilized formulation can include lyophilizing
a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about
19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than
5.5, but less than 6.5. See, e.g., US2004/0028670.
[0275] The compositions and formulations can be delivered by the
use of liposomes. By using liposomes, particularly where the
liposome surface carries ligands specific for target cells, or are
otherwise preferentially directed to a specific organ, one can
focus the delivery of the active agent into target cells in vivo.
See, e.g., U.S. Pat. Nos. 6,063,400; 6,007,839; Al-Muhammed, J.
Microencapsul. 13: 293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:
698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46: 1576-1587, 1989.
[0276] The formulations of the invention can be administered for
prophylactic and/or therapeutic treatments. In some embodiments,
for therapeutic applications, compositions are administered to a
subject who is at risk of or has a disorder described herein, in an
amount sufficient to cure, alleviate or partially arrest the
clinical manifestations of the disorder or its complications; this
can be called a therapeutically effective amount. For example, in
some embodiments, pharmaceutical compositions of the invention are
administered in an amount sufficient to reduce the number of
symptoms or reduce the severity, duration, or frequency of one or
more symptoms of a neurodegenerative disorder in a subject.
[0277] The amount of pharmaceutical composition adequate to
accomplish this is a therapeutically effective dose. The dosage
schedule and amounts effective for this use, i.e., the dosing
regimen, will depend upon a variety of factors, including the stage
of the disease or condition, the severity of the disease or
condition, the general state of the patient's health, the patient's
physical status, age, and the like. In calculating the dosage
regimen for a patient, the mode of administration also is taken
into consideration.
[0278] The dosage regimen also takes into consideration
pharmacokinetics parameters well known in the art, i.e., the active
agents' rate of absorption, bioavailability, metabolism, clearance,
and the like (see, e.g., Hidalgo-Aragones, J. Steroid Biochem. Mol.
Biol. 58: 611-617, 1996; Groning, Pharmazie 51: 337-341, 1996;
Fotherby, Contraception 54: 59-69, 1996; Johnson, J. Pharm. Sci.
84: 1144-1146, 1995; Rohatagi, Pharmazie 50: 610-613, 1995; Brophy,
Eur. J. Clin. Pharmacol. 24: 103-108, 1983; Remington: The Science
and Practice of Pharmacy, 21st ed., 2005). The state of the art
allows the clinician to determine the dosage regimen for each
individual patient, active agent, and disease or condition treated.
Guidelines provided for similar compositions used as
pharmaceuticals can be used as guidance to determine the dosage
regiment, i.e., dose schedule and dosage levels, administered
practicing the methods of the invention are correct and
appropriate.
[0279] Single or multiple administrations of formulations can be
given depending on for example: the dosage and frequency as
required and tolerated by the patient, and the like. The
formulations should provide a sufficient quantity of active agent
to effectively treat, prevent or ameliorate conditions, diseases,
or symptoms.
[0280] In alternative embodiments, pharmaceutical formulations for
oral administration are in a daily amount of between about 1 to 100
or more mg per kilogram of body weight per day. Lower dosages can
be used, in contrast to administration orally, into the blood
stream, into a body cavity or into a lumen of an organ.
Substantially higher dosages can be used in topical or oral
administration or administering by powders, spray, or inhalation.
Actual methods for preparing parenterally or non-parenterally
administrable formulations will be known or apparent to those
skilled in the art and are described in more detail in such
publications as Remington: The Science and Practice of Pharmacy,
21st ed., 2005.
[0281] Various studies have reported successful mammalian dosing
using complementary nucleic acid sequences. For example, Esau C.,
et al., Cell Metabolism, 3(2): 87-98, 2006, reported dosing of
normal mice with intraperitoneal doses of miR-122 antisense
oligonucleotide ranging from 12.5 to 75 mg/kg twice weekly for 4
weeks. The mice appeared healthy and normal at the end of
treatment, with no loss of body weight or reduced food intake.
Plasma transaminase levels were in the normal range (AST 3/445, ALT
3/435) for all doses with the exception of the 75 mg/kg dose of
miR-122 ASO, which showed a very mild increase in ALT and AST
levels. They concluded that 50 mg/kg was an effective, non-toxic
dose. Another study by Krutzfeldt J., et al., Nature 438, 685-689,
2005, injected anatgomirs to silence miR-122 in mice using a total
dose of 80, 160 or 240 mg per kg body weight. The highest dose
resulted in a complete loss of miR-122 signal. In yet another
study, locked nucleic acids ("LNAs") were successfully applied in
primates to silence miR-122. Elmen et al., Nature 452, 896-899,
2008, report that efficient silencing of miR-122 was achieved in
primates by three doses of 10 mg kg-1 LNA-antimiR, leading to a
long-lasting and reversible decrease in total plasma cholesterol
without any evidence for LNA-associated toxicities or
histopathological changes in the study animals.
[0282] In some embodiments, the methods described herein can
include co-administration with other drugs or pharmaceuticals,
e.g., any of the treatments of a neurodegenerative disorder
described herein.
Kits
[0283] Also provided herein are kits containing one or more (e.g.,
at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, or 20) of any
of the probes, inhibitory nucleic acids, sense nucleic acids,
inflammatory marker proteins, or antibodies described herein (in
any combination). In some embodiments, the kits can include
instructions for performing any of the methods described
herein.
[0284] In some embodiments, the kit can contain at least two
primers (e.g., at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32, 36, 38, or 40) for amplifying a sequence present
within any of the microRNAs listed in Tables 1-19 (e.g., mature
microRNA or precursor microRNA) or for amplifying a sequence
present within any of the mRNAs listed in Tables 20 and 21.
[0285] In some embodiments, the kits contain two or more sets of
primer (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,
86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
102, 103, 104, 105, 106, 107, 108, or 109 pairs of primers) that
amplify a sequence present within one or more (e.g., 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,
59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,
76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92,
93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,
108, or 109 pairs of primers) of the microRNAs listed in any one of
Tables 1-11 (e.g., one or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,
63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,
80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109) of
the microRNAs from Tables 1 and 2; Tables 3 and 4; Tables 5 and 6;
Tables 7 and 8; Tables 9 and 10; and Table 11) and/or that amplify
a sequence present within one or more (e.g., 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,
78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
or 95) of the mRNAs listed in Table 20 and/or Table 21 (e.g., ALS
diagnostic kits).
[0286] In some embodiments, the kits contain two or more sets of
primer (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,
86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
102, 103, 104, 105, 106, 107, 108, or 109 pairs of primers) that
amplify a sequence present within one or more (e.g., 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,
59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,
76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92,
93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,
108, or 109 pairs of primers) of the microRNAs listed in any one of
Tables 1-11 (e.g., one or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,
63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,
80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109) of
the microRNAs from Tables 1 and 2; Tables 3 and 4; Tables 5 and 6;
Tables 7 and 8; Tables 9 and 10; and Table 11) and/or that amplify
a sequence present within one or more (e.g., 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,
78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
or 95) of the mRNAs listed in Table 20 and/or Table 21 (e.g., ALS
diagnostic kits).
[0287] In some embodiments, the kits contain two or more antisense
oligonucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,
83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103, 104, 105, 106, 107, 108, or 109 pairs of
primers) that collectively are capable of hybridizing to one or
more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,
86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
102, 103, 104, 105, 106, 107, 108, or 109) of the microRNAs listed
in any one of Tables 1, 2, and12-19 (e.g., 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109
microRNAs from Tables 1 and 2; Tables 12 and 13; Tables 14 and 15;
Tables 16 and 17; and Tables 18 and 19) and/or that are
collectively capable of hybridizing to one or more (e.g., 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, or 95) of the mRNAs listed in Table 20 and/or Table 21
(e.g., MS diagnostic kits).
[0288] In some embodiments, the kits contain two or more antisense
oligonucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,
83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103, 104, 105, 106, 107, 108, or 109 antisense
oligonucleotides) that collectively are capable of hybridizing to
one or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67,
68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,
85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100,
101, 102, 103, 104, 105, 106, 107, 108, or 109) of the microRNAs
listed in any one of Tables 1, 2, and12-19 (e.g., 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93,
94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,
108, or 109 microRNAs from Tables 1 and 2; Tables 12 and 13; Tables
14 and 15; Tables 16 and 17; and Tables 18 and 19) and/or that
collectively are capable of hybridizing to one or more (e.g., 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,
74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
91, 92, 93, 94, or 95) of the mRNAs listed in Table 20 and/or Table
21 (e.g., MS diagnostic kits).
[0289] In some embodiments, the kit can contain at least two
antisense molecules (e.g., at least 4, 6, 8, 10, 12, 14, 16, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, or 40) for hybridizing with a
sequence present within any of the microRNAs listed in Tables 1-19
(e.g., mature microRNA or precursor microRNA) or a sequence within
any of the mRNAs listed in Tables 20 and 21.
[0290] In some embodiments, the kits can contain at least one
inhibitory nucleic acid and/or at least one sense nucleic acid
(e.g., any of the inhibitory nucleic acids or sense nucleic acids
described herein). In some embodiments, the kit contains at least
one inhibitory nucleic acid (e.g., at least one inhibitory nucleic
acid targeting hsa-miR-155) formulated for intrathecal or
intracranial injection or infusion.
[0291] In some embodiments, the kits can contain at least one
(e.g., at least two, three, four, five, or six) antibody that
specifically binds to any one of the proteins encoded by any of the
inflammatory marker genes listed in Table 20 or Table 21 (e.g., any
of the variety of antibodies or antibody fragments described
herein). In some embodiments, the antibodies can be labeled (e.g.,
labeled with a fluorophore, a radioisotope, an enzyme, biotin, or
avidin).
[0292] In some embodiments, the kit further contains at least one
additional therapeutic agent (e.g., one or more of KNS760704,
SB509, ceftriaxone, minocycline, rilutek, and riluzole). In some
embodiments, the kit further contains instructions for
administering the at least one agent (e.g., one or more inhibitory
nucleic acids) to a subject having or diagnosed as having a
neurodegenerative disease (e.g., sporadic ALS and/or familial ALS,
or MS).
[0293] The invention is further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1
MicroRNA Deregulation in Ly6C.sup.Hi Monocytes, Ly6C.sup.Low
Monocytes, and CD39.sup.+ Microglia in a Mouse Model of ALS
SOD1.sup.G93A Mice
[0294] Lys6C.sup.Hi/CCR2.sup.+ monocytes participate in tissue
damage and disease pathogenesis in a variety of conditions,
including an animal model of MS (King et al., Blood 113: 3190-3197,
2009). Experiments were to performed to compare the microRNA
expression profile in CD39.sup.+ microglia (FIG. 1A-1C),
Ly6C.sup.Hi monocytes (FIG. 2A-2C), and Ly6C.sup.Low monocytes
(FIG. 3A-3C), and in the mouse SOD1.sup.G93A model of ALS at the
presymptomatic stage (60 days), at the time of onset of symptoms,
and at the end stage of disease to the expression in the same cells
in non-transgenic litermates.
[0295] These data were gathered using rodent TaqMan Low Density
Arrays (TaqMan MicroRNA Assays containing 364 mouse microRNA assays
(n=2 arrays for each group; pool of 5-6 mice per group). The
microarray data were normalized using quantile (R software) to
remove variation between samples. MicroRNA expression level was
normalized using dCT against U6 miRNA (internal control) and
geometric mean across all samples. After the normalization step,
analysis of variants between groups (ANOVA) was used to define
significantly altered microRNAs across all disease stages in SOD1
mice (using a false discovery rate of.ltoreq.0.1).
[0296] MicroRNA profiling of spleen-derived Ly6C.sup.Hi and
Ly6C.sup.Low monocytes of the SOD1 mice during all stages of the
disease showed 32 significantly dysregulated microRNAs in
Ly6C.sup.Hi splenic monocytes and 23 dysregulated microRNAs in
Ly6C.sup.Low splenic monocytes. All of the dysregulated microRNAs
in the monocyte subsets were observed one month prior to clinical
onset and during disease progression. The majority of these
microRNAs were not overlapping between Lys6C.sup.Hi monocytes and
Ly6C.sup.Low monocytes, suggesting that these different monocyte
subsets have different functions during disease progression.
Inflammation-related microRNAs such as let-7a, miR-27a, miR-34a,
miR-132, miR-146a, miR-451, and miR-155 were significantly
upregulated in the Ly6C.sup.Hi monocytes in the spleen during
disease progression in the SOD1 mice (FIG. 2). Ingenuity pathway
analysis of the microRNA profile of Ly6C.sup.Hi monocytes in SOD1
mice identified patterns of microRNA expression observed in primary
muscular disorders (FIG. 4).
[0297] The data from microRNA expression profiling of CD39.sup.+
microglia in the SOD1 mouse show that 24 microRNAs were upregulated
and two microRNAs were downregulated compared to the same cells in
non-transgenic litermates. These microRNAs were different from the
microRNAs dysregulated in Ly6C.sup.Hi monocytes, with the exception
of 6 microRNAs (let-7a, miR-27a, miR-34a, miR-132, miR-146a, and
miR-155). These data demonstrate differences between resident
microglia identified by CD39 and infiltrating Ly6C monocytes, and
identify a unique microRNA pattern in microglia in SOD1 mice.
Example 2
MicroRNAs Dysregulated in CD14.sup.+CD16.sup.- Monocytes in
Subjects with ALS and MS
[0298] In view of the unique microRNA profiles observed in mouse
monocytes, microRNA expression profiling was performed on human
blood-derived CD14.sup.+CD16.sup.- monocytes (Ly6C.sup.Hi analog)
from ALS subjects and MS subjects. In these experiments, nCounter
expression profiling of 664 microRNAs in blood-derived
CD14.sup.+CD16.sup.- monocytes from subjects having sporadic ALS
(n=8), subjects having relapsing-remitting MS (n=8), and healthy
controls (n=8). The microRNA expression level was normalized
against a geometric mean of five house-keeping genes (ACTB, B2M,
GAPDH, RPL19, and RPLP0). A heatmap comparing the microRNA
expression in monocytes from ALS or MS subjects compared to the
expression in healthy controls was generated using ANOVA with
Dunnett's post hoc test (p<0.01) (FIGS. 5, 6, and 33,
respectively). FIG. 7A depicts the number of microRNAs uniquely
upregulated in CD14.sup.+CD16.sup.- monocytes from ALS and MS
subjects, as well as the number of microRNAs upregulated in
CD14.sup.-CD16.sup.- monocytes from both ALS and MS subjects. FIG.
7A also depicts the number of microRNAs uniquely downregulated in
CD14.sup.+CD16.sup.- monocytes from ALS and MS subjects, as well as
the number of microRNAs downregulated in CD14.sup.+CD16.sup.-
monocytes from both ALS and MS subjects. FIG. 7B is a volcano plot
showing the significantly deregulated microRNAs in
CD14.sup.+CD16.sup.- monocytes from ALS subjects compared to the
expression of the microRNAs in CD14.sup.+CD16.sup.- monocytes from
healthy controls. FIG. 7C is a volcano plot showing the
significantly deregulated microRNAs in CD14.sup.+CD16.sup.-
monocytes from MS subjects compared to the expression of the
microRNAs in CD14.sup.+CD16.sup.- monocytes from healthy controls.
FIG. 8 provides a summary of the microRNAs deregulated in
CD14.sup.+CD16.sup.- monocytes from ALS and MS subjects compared to
the expression of the microRNAs in CD14.sup.+CD16.sup.- monocytes
from healthy controls.
[0299] The dysregulation of specific microRNAs in
CD14.sup.+CD16.sup.- monocytes from ALS and MS subjects (as
compared to healthy controls) were confirmed using real-time PCR.
For example, real-time PCR was used to confirm the upregulation of
hsa-miR-27a, hsa-miR-190, hsa-miR-500, hsa-miR-155, and
hsa-miR-532-3p in CD14.sup.+CD16.sup.- monocytes from ALS subjects
(n=11) compared to the expression of these microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls (n=8)
(two-tiled Mann-Whitney t-test) (FIG. 9). Additional real-time PCR
experiments were performed to confirm the unique upregulation of
microRNAs in CD14.sup.+CD16.sup.- monocytes from ALS subjects (n=8;
clinical scoring of these subjects is shown in FIGS. 10A and 10B)
as compared to the expression of these microRNAs in
CD14.sup.+CD16.sup.- monocytes from both MS subjects and healthy
controls (FIG. 10C). The data in FIG. 10C show that 20 different
microRNAs are uniquely upregulated in CD14.sup.+CD16.sup.-
monocytes as compared the expression of these microRNAs in
CD14.sup.+CD16.sup.- monocytes from MS subjects and healthy
controls: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21,
hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a,
hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c,
hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24,
hsa-miR-181a, and hsa-miR-103. The unique upregulation of
hsa-miR-27a, hsa-miR-155, hsa-miR-146a, and hsa-miR-532-3p in
CD14.sup.+CD16.sup.- monocytes from ALS subjects as compared to the
expression of these microRNAs in CD14.sup.+CD16.sup.- monocytes
from MS subjects and healthy controls was also confirmed in a
second set of real-time PCR experiments (FIG. 11) (microRNA
expression was normalized against dCT using U6 miRNA). Additional
real-time PCR experiments were performed to confirm the unique
down-regulation of hsa-miR-518f, hsa-miR-206, hsa-miR-204,
hsa-miR-137, hsa-miR-453, hsa-miR-603, hsa-miR-1297, hsa-miR-192,
hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p,
hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300,
hsa-miR-302c, hsa-miR-328, hsa-miR-421, and hsa-miR-580 in
CD14.sup.+CD16.sup.+ monocytes from ALS subjects compared to the
expression of these microRNAs in CD14.sup.-CD16.sup.+ monocytes
from both MS subjects and healthy controls (FIG. 12).
[0300] A further set of real-time PCR experiments were performed to
verify the upregulation of hsa-miR-24, hsa-miR-93, hsa-miR-20a,
hsa-let-7a, hsa-miR-30c, hsa-miR-181a, hsa-miR-432-3p, and
hsa-miR-1260 in CD14.sup.+CD16.sup.- monocytes from both ALS and MS
subjects as compared to the expression of these microRNAs in
CD14.sup.+CD16.sup.- monocytes from healthy controls (FIG. 13). An
additional set of real-time PCR experiments were performed to
verify the upregulation of hsa-miR-320c, hsa-miR-27b, hsa-miR-664,
hsa-miR-423-5p, and hsa-miR-92a in CD14.sup.+CD16.sup.- monocytes
from MS subjects as compared to healthy controls (FIG. 14). These
data also show confirm that hsa-miR-664 is uniquely upregulated in
CD14.sup.+CD16.sup.- monocytes from MS subjects as compared the
expression of this microRNA in CD14.sup.+CD16.sup.- monocytes from
both ALS subjects and healthy controls (FIG. 14).
[0301] In addition, the unique downregulation of hsa-miR-142-3p,
hsa-miR-15a, hsa-miR-1537, hsa-miR-362-3p, and hsa-miR-148b in
CD14.sup.+CD16.sup.- monocytes from MS subjects compared to the
expression of these microRNAs in CD14.sup.+CD16.sup.- monocytes
from ALS subjects and healthy controls was confirmed using
real-time PCR (FIG. 15).
Example 3
Abnormal MicroRNA Levels in Cerebrospinal Fluid from Subjects
having Sporadic ALS and Familial ALS
[0302] MicroRNA expression profiling was also performed using
cerebrospinal fluid (CSF) from subjects having sporadic ALS and
familial ALS. The levels of microRNAs in the CSF from both sporadic
ALS (n=10) and familial ALS (n=5) subjects was compared to the
levels of microRNAs in the CSF of healthy controls (n=10). The
resulting data show that hsa-miR-27b is increased in the CSF of
subjects having both sporadic and familial ALS as compared to the
level of this microRNA in the CSF of healthy controls, and that
hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and
hsa-miR-532-3p are uniquely upregulated in CSF from subjects having
sporadic ALS compared to the levels of these microRNAs in CSF from
healthy controls or subjects having familial ALS (FIG. 16).
Example 4
Inflammation-Related Genes are also dysregulated in
CD14.sup.+CD16.sup.- monocytes from Subjects having ALS and MS
[0303] Expression profiling analysis of 179 inflammation-related
genes ("inflammatory marker genes") was performed using
CD14.sup.+CD16.sup.- monocytes from ALS subjects (n=8), MS subjects
(n=11), and healthy controls (n=10). A heatmap showing the change
in expression of different inflammatory marker genes in
CD14.sup.+CD16.sup.- monocytes from ALS or MS subjects, as compared
to the expression of these genes in CD14.sup.+CD16.sup.- monocytes
from healthy subjects is shown in FIG. 17). A volcano plot of
inflammatory marker genes dysregulated in CD14.sup.+CD16.sup.-
monocytes from ALS and MS subjects compared to the expression of
these genes in CD14.sup.+CD16.sup.- monocytes from healthy controls
is shown in FIG. 18A (left graph and right graph, respectively). A
list of the inflammatory marker genes upregulated or downregulated
in CD14.sup.+CD16.sup.- monocytes from ALS and MS subjects compared
to the expression of these genes in CD14.sup.+CD16.sup.- monocytes
from healthy controls is shown in FIG. 18B.
Example 5
MicroRNAs are also Dysregulated in CD14.sup.+CD16.sup.+ Monocytes
from ALS subjects
[0304] MicroRNA expression profiling was also performed using
CD14.sup.+CD16.sup.+ monocytes from both ALS subjects (n=11) and
healthy controls (n=8) (FIG. 19). These data show that hsa-miR-708
is increased in CD14.sup.+CD16.sup.+ monocytes from ALS subjects as
compared to the expression of this microRNA in CD14.sup.+CD16.sup.-
monocytes from healthy subjects.
[0305] nCounter expression profiling was performed to identify
additional microRNAs dysregulated in CD14.sup.+CD16.sup.+ monocytes
from ALS (n=8) and MS subjects (n=8) compared to the expression of
microRNAs in CD14.sup.+CD16.sup.+ monocytes from healthy subjects
(n=8). The data in these experiments were normalized against a
geometric mean of five different house-keeping genes (ACTB, B2M,
GAPDH, RPL19, and RPL10). In these experiments, the expression of
664 microRNAs were analyzed (FIGS. 20A-C). A heatmap of the
relative expression of microRNAs in CD14.sup.+CD16.sup.+ monocytes
from ALS subjects and MS subjects compared to the expression of
these microRNAs in CD14.sup.+CD16.sup.+ monocytes from healthy
controls is shown in FIG. 21A and FIG. 20B, respectively. A summary
of the microRNAs significantly deregulated in CD14.sup.+CD16.sup.+
monocytes from ALS and MS subjects compared to the expression of
these microRNAs in CD14.sup.+CD16.sup.+ monocytes from healthy
controls is shown in FIG. 20C.
Example 6
Proinflammatory Markers Expressed in Ly6C.sup.Hi Monocytes and
CD39.sup.+ Microglia from SOD1.sup.G93A Mice
[0306] The gene expression profile of Ly6C.sup.Hi monocytes
isolated from the spleen of SOD1 mice one month prior to clinical
disease onset and during disease progression. Pro-inflammatory
genes were expressed at both time points (FIG. 21A). Out of 179
inflammatory marker genes measured by nCounter, 97 were detected as
having altered expression (compared to Ly6C.sup.Hi monocytes from
non-transgenic litermates): 40 genes were upregulated in
Ly6C.sup.Hi monocytes from SOD1 mice (as compared to non-transgenic
litermates) at least one disease stage. Seven genes were
downregulated in Ly6C.sup.Hi monocytes in SOD1 mice compared to
Ly6C.sup.Himonocytes from non-transgenic litermates, including
TGF.beta.1 and the TGF.beta.1 receptor (FIG. 21B).
[0307] Biological network analysis demonstrates that the most
significantly affected pathways in the present analysis relative to
inflammatory responses, including CREB1, NF-kB, PU.1, and
PPAR.gamma. (FIG. 21C). These pathways have been shown to play an
important role in both monocyte activation and differentiation. The
gene expression profiling demonstrates an activated
pro-inflammatory Ly6C.sup.Hi monocyte population in the peripheral
immune compartment of SOD1 mice.
[0308] Expression profiling of CD11b.sup.+/CD39.sup.+ microglia
isolated from the spinal cord and brains of SOD1 mice was performed
at different stages of disease. Out of 179 inflammatory marker
genes, 120 were detected: 20 genes were upregulated in
CD11b.sup.+/CD39.sup.+ microglia from SOD1 mice (compared to
CD11b.sup.+/CD39.sup.+ microglia from non-transgenic litermates)
(FIG. 21D) and 38 genes were downregulated in
CD11b.sup.+/CD39.sup.+ microglia from SOD1 mice (compared to
CD11b.sup.+/CD39.sup.+ microglia from non-transgenic litermates)
(FIG. 21E). CD11b.sup.+/CD39.sup.+ microglia microglia from SOD1
mice as compared to the same cells in non-transgenic litermates had
prominent expression of genes related to chemotaxis (e.g., CCL2,
CCL3, CCL4, CCL5, CXCR4, and CXCR10). Interestingly, TGF.beta.1 and
the TGF.beta.1 receptor were among the downregulated genes.
Biological network analysis demonstrated activation of inflammatory
pathways with the most significant being chemotaxis (FIG. 21F). The
expression of these genes preceded symptom onset and was observed
in the spinal cord, but not in the brain (FIG. 21G).
Example 7
Proinflammatory Markers Expressed in CD14.sup.+CD16.sup.- Monocytes
in ALS Subjects
[0309] Immune-related gene expression in CD14.sup.+CD16.sup.-
monocytes from ALS subjects was analyzed as described in Example 6.
Several inflammatory-related genes were upregulated in
CD14.sup.+CD16.sup.- monocytes from ALS subjects as compared to
healthy controls. Although there were some differences in
immune-related gene expression between CD14.sup.+CD16.sup.-
monocytes from ALS subjects and MS subjects, the immune-related
gene expression pattern in CD14.sup.+CD16.sup.- monocytes from ALS
subjects and MS subjects were similar (FIG. 22A-C).
[0310] In a further set of experiments, the expression of 511
immune-related genes was analyzed in CD14.sup.+CD16.sup.- monocytes
from subjects having ALS (sporadic and familial ALS). These
experiments were performed using quantitative NanoString nCounter
technology. The data gathered from these experiments and the data
described in Example 6 were further analyzed using GeneGo and
Ingenuity.RTM. pathway analysis.
[0311] The differentially upregulated genes in spinal cord
CD39.sup.+ microglia and splenic Ly6C.sup.Hi monocytes in SOD1
mice, and in blood-derived CD14.sup.+CD16.sup.- monocytes from
sporadic ALS subjects vs. healthy controls were analyzed using
GeneGo Metacore pathway analysis (GeneGO, St. Joseph, Mich.). This
method identifies transcripts that are overrepresented in defined
ontologies. A false discovery rate (FDR) filter was applied to
preliminary P values using q-value calculation. After enrichment,
the P values were calculated for all the terms within the given
ontology and each term was tested as a separate hypothesis. The
resulting q-values represent corrected P values with an account of
the total terms in the given ontology and the rank order of the
particular term. The identified significantly dysregulated genes
were further analyzed to identify biological/disease processes and
the involved pathway/networks in SOD1 mice and human ALS. The whole
data set of 58 dysregulated genes in CD39.sup.+ microglia from the
spinal cord and 47 dysregulated genes in Ly6C.sup.Hi splenic
monocytes from SOD1 mice were imported into MetaCore to build an
analysis of functional ontologies using GeneGo process, GeneGo
disease process, canonical pathway maps, and networks. The
calculation of statistical significance throughout MetaCore for the
maps, networks, and processes were based on P values, which were
calculated based on a hypergeometric distribution. P values
represent the probability of a particular mapping arising by
chance, given the numbers of genes in the set of all genes present
in the maps/networks/processes, the genes on a particular
map/network/process, and the genes in the experiment. A P value of
0.01 was used for the cutoff. The degree of relevance for the
different categories of the uploaded data sets is defined by P
values, so that the lower P value indicates higher priority. The
experimental data were input to build the networks. The three
different scoring functions that were used to rank the small
subnetworks created by the network building algorithms were zScore,
gScore, and p value. The zScore ranks the subnetworks (within the
analyzed network) with regard to their saturation with genes from
the experiment. A high zScore means the network is highly saturated
with identified dysregulated genes from the experiment. In other
words, it means that relatively larger number of genes/analytes in
a particular network were present in the aqueous sample. Each
network is comprised of canonical pathways used to build the
network. If a network has a high gScore, it is saturated with
expressed genes (from the zScore), and it contains many canonical
pathways. The analysis was controlled for multiple testing by
estimating the false discovery rate. Out of 664 microRNAs measured,
56 were confidently detected, and twenty were differentially
expressed in at least one disease group.
[0312] Targetscan 14.1 was used to investigate the statistical
significance of miRNA-mRNA interactions. Targetscan 14.1 was used
for the prediction of 862044 conserved miRNA binding sites with
non-zero context score which is a measure of conservation. In the
SOD1 mouse data set: miRNA target filtering analysis using
Ingenuity.RTM. pathway analysis (IPA) results in 34 miRNA families
that are predicted to target 10797 mRNAs. These data were filtered
to include only those genes involved in the IPA Canonical Pathway
categories representing signaling pathways involved in cellular
immune response, humoral immune response, and cytokine signaling.
This resulted in filtering of the 34 microRNAs to target 971 mRNAs
possibly involved in immune response signaling. The mRNA expression
studies were integrated using the Nanostring platform into the
analysis. 971 filtered targets contain the 47 immune-related genes
that are dysregulated in SOD1 mice taking into account the opposite
nature of the miRNA-mRNA regulation. This resulted in a final 87
pairs of miRNA-mRNA interactions representing 27 miRNA families and
33 mRNAs. In the miRNA expression of ALS subjects study, 56 miRNAs
were found to be significantly dysregulated in ALS subjects.
Filtering the predicted 862044 sites to those containing only
targets of these 56 miRNAs lead to a reduction in the number of
predicted sites (a reduction to 34118 sites). The number of sites
was further reduced by limiting the data to mRNA targets to genes
found to be regulated with a fold change of>1.4 in the
immunological panel nanostring arrays. The final data indicate 68
unique miRNA-mRNA interaction pairs in which the mRNA and miRNA are
oppositely regulated. The statistical significance of these 68
miRNA-mRNA interactions formed by 56 dysregulated miRNAs were
further assessed as follows: 1) 1000 random networks in which 56
randomly selected, non-regulated miRNAs from the study were used to
find mRNAs which contained a 3'-UTR motif for their binding, and 2)
the miRNA-mRNA pairs were further filtered to contain only those 59
mRNAs that were dysregulated in ALS subjects. A mean of 44.88
interactions was observed (SD=9.99). The true interactions
determined in the expression studies is 68, and corresponds to a
significant P value (<1.1.times.10.sup.-15). A similar analysis
for the regulated miRNA-mRNA pairs in the SOD1 mice shows an
interaction distribution with a mean of 15.26 (SD=4.03), whereas
the true miRNA-mRNA interactions determined experimentally is 41,
with a significant P-value of<5.7.times.10.sup.-9.
[0313] The data show that CD14.sup.+CD16.sup.- monocytes from ALS
subjects have unique expression of immune-related genes as compared
to CD14.sup.+CD16.sup.- monocytes from healthy controls. In
addition, a few immune-related genes are differentially expressed
in CD14.sup.+CD16.sup.- monocytes from sporadic ALS subjects
compared to CD14.sup.+CD16.sup.- monocytes from familial ALS
subjects (FIGS. 23A-C). These results were validated using
singleplex qPCR in an independent cohort of ALS patients and
healthy controls (the changes in the expression of CCL2, AHR,
PTAFR, NF-.kappa.B, TRAF3, FCER1A, CXCR4, and SOCS1 were validated)
(FIG. 24). These data confirm that CCL2, AHR, PTAFR, NF-.kappa.B,
and TRAF3 are upregulated in CD14.sup.+CD16.sup.- monocytes from
ALS subjects as compared to CD14.sup.+CD16.sup.- monocytes from
healthy controls, and that CXCR4 and SOCS1 are downregulated in
CD14.sup.+CD16.sup.- monocytes from ALS subjects as compared to
CD14.sup.+CD16.sup.- monocytes from healthy controls.
[0314] Ingenuity microRNA-mRNA target filter analysis further
revealed that the top 10 microRNA-miRNA interactions in Ly6C.sup.Hi
cells from SOD1 mice were linked to the genes found to be the most
significantly dysregulated in CD14.sup.-CD16.sup.- monocytes from
ALS subjects (FIG. 25).
[0315] A further assessment of both the miRNA and mRNA expression
profile in CD14.sup.+CD16.sup.- monocytes from ALS subjects shows
that the abnormalities related to miRNA and gene expression in
CD14.sup.+CD16.sup.- monocytes is linked to inflammatory- and
immune-related genes (FIG. 26 and FIG. 27). When these miRNA-mRNA
interactions in CD14.sup.+CD16.sup.- monocytes were analyzed, the
interactions were shown to be statistically significant using
Targetscan 4.1 prediction analysis both in SOD1 mice and in ALS
subjects (FIG. 28). Furthermore, GeneGo pathway analysis identified
9 inflammation-related networks (FIG. 29). These inflammation
networks were identical to those that were observed (in the studies
described herein) to be dysregulated in Ly6C.sup.Hi monocytes in
SOD1 mice.
Example 8
Therapeutic role of miR-155 in the SOD1.sup.G93A model
[0316] Significant upregulation of miR-155 occurs in spleen-derived
Ly6C.sup.Hi monocytes and spinal cord-derived microglia before
clinical onset, which increased during all stages of disease
progression in SOD1.sup.G93A mice (see data above). Additional
experiments were performed to determine whether miR-155 plays a
role in the development/pathogenesis of ALS. In these experiments,
the SOD1 mouse (a model of ALS) was further genetically manipulated
to knockdown or knockout expression of miR-155.
Animals and Behavioral Analysis
[0317] B6/SJL-SOD1.sup.G93A Tg and SOD1-wild type (WT) were
provided by Prize4Life or purchased from the Jackson Laboratories.
ALS mice were analyzed at day 30 and 60 (presymptomatic), day
90-100 (early symptomatic), and day 120-140 (late
symptomatic/end-stage) time points. Onset of symptoms was defined
by the peak of the weight curve and visible signs of muscle
weakness. End-stage disease was determined by symptomatic
progression and animal care guidelines (thus it varied from the 135
time-point by.+-.5 days). Disease progression was documented
according to established methodology provided by Prize4Life and The
Jackson Laboratory. Symptomatic analysis was conducted by daily
monitoring and weight measurements every 3-4 days starting at day
80. Symptomatic onset was defined as the age at which animals began
to decline in weight. Neurological scores for both hind legs were
assessed daily for each mouse beginning at 50 days of age. The
neurological score used a scale of 0 to 4 developed by ALS Therapy
Development Institute (ALSTDI). Criteria used to assign each score
level were: 0=full extension of hind legs away from the lateral
midline when the mouse is suspended by its tail, and mouse can hold
this position for 2 seconds, suspended 2-3 times; 2=collapse or
partial collapse of leg extension towards lateral midline
(weakness) or trembling of hind legs during tail suspension;
2=curling of the toes and dragging of at least one limb during
walking; 3=rigid paralysis or minimal joint movement, foot not
being used for forward motion; and 4=mouse cannot right itself
within 30 seconds from either side, euthanasia.
Generation of SOD1.sup.G93A/miR-155.sup.-/-
[0318] Male SOD1.sup.G93A [B6.Cg-Tg(SOD1.sup.G93A)1Gur/J] mice were
bred with non-Tg C57B1/6 miR155.sup.-/- females. Non-transgenic
miR155.sup.-/- were backcross to F1-SOD1.sup.G93A/miR155.sup.-/+ to
produce F2-SOD1.sup.G93A/miR155.sup.-/- with a deletion of miR155.
The mice were assessed clinically by neurobehavioral testing
(rotarod performance and neurologic score) and the survival of
three experimental groups of SOD1 mice with different expression
levels of miR-155 was assessed: 1) SOD1.sup.G93A/miR155.sup.+/+; 2)
SOD1.sup.G93A/miR155.sup.-/-; and 3)
SOD1.sup.G93A/miR155.sup.-/-.
Targeting of miR-155 in SOD1 Mice
[0319] To prove a direct interaction between miRNAs and their
targets, a Luciferase reporter bearing 3'UTR with potential miRNA
binding sites is utilized. Site-directed mutagenesis of the miRNA
binding site abolishes responsiveness of the Luciferase reporter to
miRNA modulation, which will provide proof of direct targeting.
Flow Cytometry
[0320] Mononuclear cells were directly isolated from the spinal
cord of mice as described in Cardona et al. (Nat. Protoc. 1:
1947-1951, 2006) except that no dispase was used as we found that
dispase cleaves several surface molecules and can diminish surface
detection of surface molecules. Mice were transcardially perfused
with ice cold phosphate-buffer saline (PBS), and the spinal cords
and brains were separately dissected. Single cell suspensions were
prepared and centrifuged over a 37%/70% discontinuous Percoll
gradient (GE Healthcare), mononuclear cells were isolated from the
interface, and the total cell count determined. The cells were
pre-blocked with anti-CD16/CD32 (Fc Block BD Biosciences), and
stained on ice for 30 minutes with combinations of anti-Ly6C-FITC,
CD11b-PE-Cy.TM.7, and 4D4-APC (unique microglial antibody).
7AAD-PerCP was used to detect or exclude early apoptotic and dead
cells (BD Biosciences). The appropriate antibody IgG isotype
controls (BD Biosciences) were used for all stains.
Fluorescence-activated cell sorting (FACS) analysis was performed
on a LSR machine (BD Biosciences), and the data subsequently
analyzed with FlowJo Software (TreeStar Software).
Quantitative NanoString nCounter miRNA/Gene Expression Analysis
[0321] Nanostring nCounter technology was used to study the
expression of up to 800 inflammation-related genes. Multiplexed
target profiling of 179 inflammation-related transcripts which
consist of genes differentially expressed during inflammation and
immune responses was also performed as described above.
[0322] The resulting data show that SOD1.sup.G93A/miR155.sup.-/-
animals have a significant delay in disease onset and survival
compared to SOD1.sup.G93A animals. (Tables 22 and 23, and FIGS.
30-34). The body weight of the mice was assessed every 3-4 days
starting at day 80, the clinical neurologic score of the mice was
assessed daily, and rotarod performance was assessed 3 times a
week. The data show that genetic ablation of miR-155 prolonged
survival by 51 days (P<0.0001; FIG. 30), extended time to reach
a neurologic score of two by 49 days (P<0.0001; FIG. 31),
enhanced rotarod performance (FIG. 32), reduced body weight loss
(FIG. 33), and delayed early (P=0.0003) and late (P=0.0004) disease
onset (FIG. 34).
TABLE-US-00022 TABLE 22 Delayed onset and increased survival in
SOD1/miR155.sup.-/- (Summary of Preliminary Results SOD1.miR155+/+
SOD1/miR155-/- End-stage 145 days At 162 days, still breading
TABLE-US-00023 TABLE 23 Cumulative Results of Statistical Analysis
of SOD1/miR155.sup.+/- and SOD1/miR155.sup.-/- Mice Kaplan-Meier
Survival Fit Median time (days) P value Females
SOD1/miR-155.sup.+/- SOD1/miR-155.sup.-/- Change Log-rank Wilcoxon
Neurologic onset (Score 2) 138 187 49 <0.0001 <0.0001 Peak
body weight to death 32 80 48 <0.0001 <0.0001 50% survival
156 207 51 <0.0001 <0.0001 Median time (days) P value Males
SOD1/miR-155+/- SOD1/miR-155-/- Change Log-rank Wilcoxon Neurologic
onset (score 2) 144 168 24 <0.0001 0.0003 Peak body weight to
death 56 64 8 0.1397 0.0647 50% survival (age at death) 157 184 27
<0.0001 <0.0001
[0323] SOD1.sup.G93A/miR155.sup.-/- animals also have a
significantly reduction in the recruitment of peripheral monocytes
associated with microglia protection in the spinal cord, as
compared to SOD1.sup.G93A mice (FIG. 35), and significant reduction
in inflammation-related gene expression in spinal cord microglia
and Ly6C.sup.Hi monocytes as compared to SOD1.sup.G93A mice (FIG.
36). Fewer inflammation-related genes were affected in splenic T
cells, however, the expression of anti-inflammatory genes (IL4 and
IL10) reverted to the level of non-transgenic mice, suggesting that
miR-155 may primarily affect activation of the M1-associated
signature in Ly6C.sup.Hi monocytes in SOD1.sup.G93A mice.
[0324] These data indicate that miR-155 plays a significant role in
the development (pathogenesis) of ALS, and that treatment of
subjects having a neurodegenerative disorder (e.g., ALS, e.g.,
familial ALS and/or sporadic ALS) may be achieved by administering
at least one an inhibitory nucleic acid targeting hsa-miR-155
(e.g., precursor or mature hsa-miR-155) to a subject a
neurodegenerative disorder (e.g., ALS, e.g., familial ALS and/or
sporadic ALS). Exemplary inhibitory nucleic acids targeting
hsa-miR-155 (e.g., precursor or mature hsa-miR-155) that can be
administered to a subject having a neurodegenerative disorder are
described herein.
Example 9
Efficacy of miR-155 Antagomir for Treating SOD1.sup.G93A Mice
[0325] A first set of experiments was performed in the
SOD1.sup.G93A model of familial ALS to determine whether an
antagomir targeting miR-155 would alter miRNA expression and/or
inflammatory gene expression in spinal cord-derived microglia and
splenic Ly6C.sup.Hi monocytes. In these experiments the following
five experimental groups were studied. [0326] Group I. Control
scrambled miR-155 (intraperitoneal injection, 2 mg per injection,
every third day) (n=3). Control scrambled miR-155:
+TC+AA+C+A+TTA+G+A+CT+T+A (SEQ ID NO: 263) ("+" indicates the
presence of an LNA moiety). [0327] Group II. Antagomir miR-155 low
dose (intravenous injection, 0.2 mg per injection, every third day)
(n=3). Antogomir miR-155: +TC+AC+A+A+TTA+G+C+AT+T+A (SEQ ID NO:
262) (the "+" indicates the presence of an LNA moiety). [0328]
Group III. Antagomir miR-155 high dose (intravenous injection, 2 mg
per injection, every third day) (n=3). [0329] Group IV. Antagomir
miR-155 low dose (intraperitoneal injection, 0.2 mg per injection,
every third day) (n=3). [0330] Group V. Antagomir miR-155 high dose
(intraperitoneal injection, 2 mg per injection, every third day)
(n=3).
[0331] Nanostring inflammatory gene and miRNA expression analysis
was performed in spinal cord derived microglia and splenic
Ly6C.sup.Hi monocytes as described above.
[0332] A comparison of the data from microglia and splenic Ly6C
monocytes from SOD1 mice administered a low (0.2 mg/kg body weight
per injection) vs. high dose (2 mg/kg body weight per injection),
every third day (by i.p. or i.v.) show that the low dose doesn't
affect splenic Ly6C.sup.Hi monocyte M1-phenotype (the same miRNA
and inflammatory gene expression is observed in the these mice as
compared to untreated SOD1 mice). However, the high dose
(administered by either i.p. or i.v.) inhibited the expression of
pro-inflammatory cytokines as measured by quantitative nCounter
technology for inflammation-related genes. The data also show that
spinal-cord derived microglia were not affected by systemic
antagomir miR-155 treatment.
[0333] A second set of experiments is performed to determine the
effect of antagomir miR-155 on the behavior and survival of SOD1
mice. In these experiments, SOD1 mice are either administered a
scrambled miR-155 (n=10) or an antogomir miR-155 by intraperitoneal
injection at 2 mg/kg body weight per injection, every third day
(n=10). The treatment is initiated at the time of disease onset
(defined by body weight loss and neurologic score). The mice are
treated continuously until the end of the experiment or end-stage.
The behavior of the mice is determined, for example, by rotarod
performance, and the body weight and survival of the mice is
monitored.
[0334] A third set of experiments is designed to investigate
whether miR-155 in the central nervous system of SOD1 mice can be
targeted using lentivirus-mediated inhibition of miR-155. In these
experiments, the antigomer miR155 is delivered by lentivurus
infection. For miR-155 inhibition, a sequence encoding mutant
miR-155 or its specific inhibitor is cloned in a lentiviral vector
(Genecopoeia). The virus is produced by infecting target cells
according to the user's manual. Approximately 2.times.10.sup.7
transforming units of recombinant lentivirus is delivered to the
SOD1 mice by stereotaxic injection to the CSF or the lateral
ventricle. The treatment groups are:
[0335] Group I. Mice administered a control lentivirus-scrambled
miR-155-GFP-tagged high dose (n=10). (See, control scrambled
antagomir sequence of SEQ ID NO: 263.)
[0336] Group II. Mice administered an antigomer lentivirus
miR-155-GFP tagged high dose (n=10). (See, antogomir miR-155
sequence of SEQ ID NO: 262.)
[0337] The behavior of the mice is followed, e.g., by rotarod
performance, and monitoring the body weight and survival of the
mice. Nanostring miRNA and immune-related gene profiling of the
innate immune system and T-cell inflammatory-related gene profiling
is also performed on cells derived from these mice (e.g.,
peripheral Lys6C.sup.Hi cells).
[0338] nCounter expression analysis was also performed to determine
the expression of several microRNAs in Ly6C.sup.Hi spleen-derived
monocyte subsets from wild type, SOD1/miR155.sup.-/+,
SOD1/miR155.sup.-/- mice. The data show that several microRNAs were
differently expressed in wild type mice compared to the
SOD1/miR155.sup.-/+ mice, and between the SOD1/miR155.sup.-/+ mice
and the SOD1/miR155.sup.-/- mice (FIG. 37).
[0339] nCounter expression profiling of blood-derived
CD14.sup.+CD16.sup.- monocytes for microRNAs from sporadic ALS (8
human subjects) and relapsing-remitting multiple sclerosis (8 human
subjects) compared to the expression of the microRNAs in CD14+CD16-
monocytes from healthy controls (8 subjects) was also performed.
The resulting heatmap in FIG. 38 shows the results of analysis of
variance (ANOVA) using Dunnett's post hoc test (P<0.01). The
microRNAs upregulated or downregulated in CD14.sup.+CD16.sup.-
monocytes from ALS subjects (as compared to expression of these
microRNAs in CD14.sup.+CD16.sup.- monocytes from healthy controls)
are indicated.
Othere Embodiments
[0340] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
265122RNAHomo sapiens 1gugcaaaucc augcaaaacu ga 22223RNAHomo
sapiens 2ugugcaaauc caugcaaaac uga 23387RNAHomo sapiens 3cacuguucua
ugguuaguuu ugcagguuug cauccagcug ugugauauuc ugcugugcaa 60auccaugcaa
aacugacugu gguagug 87496RNAHomo sapiens 4acauugcuac uuacaauuag
uuuugcaggu uugcauuuca gcguauauau guauaugugg 60cugugcaaau ccaugcaaaa
cugauuguga uaaugu 96521RNAHomo sapiens 5uaaagugcug acagugcaga u
21682RNAHomo sapiens 6ccugccgggg cuaaagugcu gacagugcag auaguggucc
ucuccgugcu accgcacugu 60ggguacuugc ugcuccagca gg 82722RNAHomo
sapiens 7uguaaacauc cuacacucag cu 22888RNAHomo sapiens 8accaaguuuc
aguucaugua aacauccuac acucagcugu aauacaugga uuggcuggga 60gguggauguu
uacuucagcu gacuugga 88922RNAHomo sapiens 9uagcuuauca gacugauguu ga
221072RNAHomo sapiens 10ugucggguag cuuaucagac ugauguugac uguugaaucu
cauggcaaca ccagucgaug 60ggcugucuga ca 721121RNAHomo sapiens
11cauaaaguag aaagcacuac u 211287RNAHomo sapiens 12gacagugcag
ucacccauaa aguagaaagc acuacuaaca gcacuggagg guguaguguu 60uccuacuuua
uggaugagug uacugug 871378RNAHomo sapiens 13cugaggagca gggcuuagcu
gcuugugagc aggguccaca ccaagucgug uucacagugg 60cuaaguuccg ccccccag
781422RNAHomo sapiens 14uagcagcacg uaaauauugg cg 221522RNAHomo
sapiens 15uagcagcacg uaaauauugg cg 221689RNAHomo sapiens
16gucagcagug ccuuagcagc acguaaauau uggcguuaag auucuaaaau uaucuccagu
60auuaacugug cugcugaagu aagguugac 891781RNAHomo sapiens
17guuccacucu agcagcacgu aaauauuggc guagugaaau auauauuaaa caccaauauu
60acugugcugc uuuaguguga c 811822RNAHomo sapiens 18uuauaauaca
accugauaag ug 221972RNAHomo sapiens 19uacaucggcc auuauaauac
aaccugauaa guguuauagc acuuaucaga uuguauugua 60auugucugug ua
722022RNAHomo sapiens 20auauaauaca accugcuaag ug 222172RNAHomo
sapiens 21acucggaugg auauaauaca accugcuaag uguccuagca cuuagcaggu
uguauuauca 60uuguccgugu cu 722221RNAHomo sapiens 22uacaguacug
ugauaacuga a 212321RNAHomo sapiens 23uacaguacug ugauaacuga a
212475RNAHomo sapiens 24ugcccuggcu caguuaucac agugcugaug cugucuauuc
uaaagguaca guacugugau 60aacugaagga uggca 752579RNAHomo sapiens
25acuguccuuu uucgguuauc augguaccga ugcuguauau cugaaaggua caguacugug
60auaacugaag aaugguggu 792622RNAHomo sapiens 26uuauaaagca
augagacuga uu 222795RNAHomo sapiens 27uuguaccugg ugugauuaua
aagcaaugag acugauuguc auaugucguu ugugggaucc 60gucucaguua cuuuauagcc
auaccuggua ucuua 952822RNAHomo sapiens 28uguaaacauc cuugacugga ag
222992RNAHomo sapiens 29gggcagucuu ugcuacugua aacauccuug acuggaagcu
guaagguguu cagaggagcu 60uucagucgga uguuuacagc ggcaggcugc ca
923022RNAHomo sapiens 30uagcaccauu ugaaaucggu ua 223188RNAHomo
sapiens 31aucucuuaca caggcugacc gauuucuccu gguguucaga gucuguuuuu
gucuagcacc 60auuugaaauc gguuaugaug uaggggga 883222RNAHomo sapiens
32uagcaccauc ugaaaucggu ua 223364RNAHomo sapiens 33augacugauu
ucuuuuggug uucagaguca auauaauuuu cuagcaccau cugaaaucgg 60uuau
643422RNAHomo sapiens 34ugucaguuug ucaaauaccc ca 2235110RNAHomo
sapiens 35ccuggccucc ugcagugcca cgcuccgugu auuugacaag cugaguugga
cacuccaugu 60gguagagugu caguuuguca aauaccccaa gugcggcaca ugcuuaccag
1103622RNAHomo sapiens 36uucaaguaau ccaggauagg cu 223722RNAHomo
sapiens 37uucaaguaau ccaggauagg cu 223877RNAHomo sapiens
38guggccucgu ucaaguaauc caggauaggc ugugcagguc ccaaugggcc uauucuuggu
60uacuugcacg gggacgc 773984RNAHomo sapiens 39ggcuguggcu ggauucaagu
aauccaggau aggcuguuuc caucugugag gccuauucuu 60gauuacuugu uucuggaggc
agcu 844021RNAHomo sapiens 40uucaaguaau ucaggauagg u 214177RNAHomo
sapiens 41ccgggaccca guucaaguaa uucaggauag guugugugcu guccagccug
uucuccauua 60cuuggcucgg ggaccgg 774222RNAHomo sapiens 42uggcucaguu
cagcaggaac ag 224322RNAHomo sapiens 43uggcucaguu cagcaggaac ag
224468RNAHomo sapiens 44cuccggugcc uacugagcug auaucaguuc ucauuuuaca
cacuggcuca guucagcagg 60aacaggag 684573RNAHomo sapiens 45cucugccucc
cgugccuacu gagcugaaac acaguugguu uguguacacu ggcucaguuc 60agcaggaaca
ggg 734623RNAHomo sapiens 46aacauucaac gcugucggug agu 234723RNAHomo
sapiens 47aacauucaac gcugucggug agu 2348110RNAHomo sapiens
48ugaguuuuga gguugcuuca gugaacauuc aacgcugucg gugaguuugg aauuaaaauc
60aaaaccaucg accguugauu guacccuaug gcuaaccauc aucuacucca
11049110RNAHomo sapiens 49agaagggcua ucaggccagc cuucagagga
cuccaaggaa cauucaacgc ugucggugag 60uuugggauuu gaaaaaacca cugaccguug
acuguaccuu gggguccuua 1105023RNAHomo sapiens 50agcagcauug
uacagggcua uga 235123RNAHomo sapiens 51agcagcauug uacagggcua uga
235223RNAHomo sapiens 52ucauagcccu guacaaugcu gcu 235323RNAHomo
sapiens 53ucauagcccu guacaaugcu gcu 235478RNAHomo sapiens
54uacugcccuc ggcuucuuua cagugcugcc uuguugcaua uggaucaagc agcauuguac
60agggcuauga aggcauug 785578RNAHomo sapiens 55uugugcuuuc agcuucuuua
cagugcugcc uuguagcauu caggucaagc agcauuguac 60agggcuauga aagaacca
785662RNAHomo sapiens 56ucauagcccu guacaaugcu gcuugaucca uaugcaacaa
ggcagcacug uaaagaagcc 60ga 625762RNAHomo sapiens 57ucauagcccu
guacaaugcu gcuugaccug aaugcuacaa ggcagcacug uaaagaagcu 60ga
625823RNAHomo sapiens 58uuaaugcuaa ucgugauagg ggu 235965RNAHomo
sapiens 59cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca
uauuagcauu 60aacag 656022RNAHomo sapiens 60caugccuuga guguaggacc gu
226191RNAHomo sapiens 61cgacuugcuu ucucuccucc augccuugag uguaggaccg
uuggcaucuu aauuacccuc 60ccacacccaa ggcuugcaaa aaagcgagcc u
916220RNAHomo sapiens 62aaaagcuggg uugagagggu 206320RNAHomo sapiens
63aaaagcuggg uugagagggu 206488RNAHomo sapiens 64uuugcauuaa
aaaugaggcc uucucuuccc aguucuuccc agagucagga aaagcugggu 60ugagagggua
gaaaaaaaau gauguagg 886550RNAHomo sapiens 65cuucucuuuc caguucuucc
cagaauuggg aaaagcuggg uugagagggu 506621RNAHomo sapiens 66uucacagugg
cuaaguucug c 216797RNAHomo sapiens 67accucucuaa caaggugcag
agcuuagcug auuggugaac agugauuggu uuccgcuuug 60uucacagugg cuaaguucug
caccugaaga gaaggug 976823RNAHomo sapiens 68uauucauuua uccccagccu
aca 236982RNAHomo sapiens 69gaacauugaa acuggcuagg gaaaaugauu
ggauagaaac uauuauucua uucauuuauc 60cccagccuac aaaaugaaaa aa
827023RNAHomo sapiens 70ucuuggagua ggucauuggg ugg 237194RNAHomo
sapiens 71ugacuccucc aggucuugga guaggucauu ggguggaucc ucuauuuccu
uacgugggcc 60acuggauggc uccuccaugu cuuggaguag auca 947222RNAHomo
sapiens 72uauugcacuu gucccggccu gu 227322RNAHomo sapiens
73uauugcacuu gucccggccu gu 227478RNAHomo sapiens 74cuuucuacac
agguugggau cgguugcaau gcuguguuuc uguaugguau ugcacuuguc 60ccggccuguu
gaguuugg 787575RNAHomo sapiens 75ucaucccugg guggggauuu guugcauuac
uuguguucua uauaaaguau ugcacuuguc 60ccggccugug gaaga 757622RNAHomo
sapiens 76cacccguaga accgaccuug cg 227770RNAHomo sapiens
77ggcacccacc cguagaaccg accuugcggg gccuucgccg cacacaagcu cgugucugug
60gguccguguc 707822RNAHomo sapiens 78ugagaacuga auuccauggg uu
227999RNAHomo sapiens 79ccgaugugua uccucagcuu ugagaacuga auuccauggg
uugugucagu gucagaccuc 60ugaaauucag uucuucagcu gggauaucuc ugucaucgu
998022RNAHomo sapiens 80ucucccaacc cuuguaccag ug 228184RNAHomo
sapiens 81cuccccaugg cccugucucc caacccuugu accagugcug ggcucagacc
cugguacagg 60ccugggggac agggaccugg ggac 848222RNAHomo sapiens
82cuggcccucu cugcccuucc gu 228375RNAHomo sapiens 83uggagugggg
gggcaggagg ggcucaggga gaaagugcau acagccccug gcccucucug 60cccuuccguc
cccug 758422RNAHomo sapiens 84ccucccacac ccaaggcuug ca
228591RNAHomo sapiens 85cgacuugcuu ucucuccucc augccuugag uguaggaccg
uuggcaucuu aauuacccuc 60ccacacccaa ggcuugcaaa aaagcgagcc u
918618RNAHomo sapiens 86aucccaccuc ugccacca 188773RNAHomo sapiens
87accuuuccag cucaucccac cucugccacc aaaacacuca ucgcgggguc agagggagug
60ccaaaaaagg uaa 738823RNAHomo sapiens 88ugaggggcag agagcgagac uuu
238994RNAHomo sapiens 89auaaaggaag uuaggcugag gggcagagag cgagacuuuu
cuauuuucca aaagcucggu 60cugaggcccc ucagucuugc uuccuaaccc gcgc
949022RNAHomo sapiens 90uuaucagaau cuccaggggu ac 229172RNAHomo
sapiens 91ggagcuuauc agaaucucca gggguacuuu auaauuucaa aaaguccccc
aggugugauu 60cugauuugcu uc 729223RNAHomo sapiens 92caaagugcug
uucgugcagg uag 239380RNAHomo sapiens 93cugggggcuc caaagugcug
uucgugcagg uagugugauu acccaaccua cugcugagcu 60agcacuuccc gagcccccgg
809423RNAHomo sapiens 94agcuacauug ucugcugggu uuc 2395110RNAHomo
sapiens 95ugaacaucca ggucuggggc augaaccugg cauacaaugu agauuucugu
guucguuagg 60caacagcuac auugucugcu ggguuucagg cuaccuggaa acauguucuc
1109623RNAHomo sapiens 96uaaagugcuu auagugcagg uag 239771RNAHomo
sapiens 97guagcacuaa agugcuuaua gugcagguag uguuuaguua ucuacugcau
uaugagcacu 60uaaaguacug c 719823RNAHomo sapiens 98uguaaacauc
cuacacucuc agc 239923RNAHomo sapiens 99uguaaacauc cuacacucuc agc
2310089RNAHomo sapiens 100accaugcugu agugugugua aacauccuac
acucucagcu gugagcucaa gguggcuggg 60agaggguugu uuacuccuuc ugccaugga
8910172RNAHomo sapiens 101agauacugua aacauccuac acucucagcu
guggaaagua agaaagcugg gagaaggcug 60uuuacucuuu cu 7210222RNAHomo
sapiens 102uagcagcaca ucaugguuua ca 2210398RNAHomo sapiens
103uugaggccuu aaaguacugu agcagcacau caugguuuac augcuacagu
caagaugcga 60aucauuauuu gcugcucuag aaauuuaagg aaauucau
9810422RNAHomo sapiens 104ugagguagua guuuguacag uu 2210584RNAHomo
sapiens 105aggcugaggu aguaguuugu acaguuugag ggucuaugau accacccggu
acaggagaua 60acuguacagg ccacugccuu gcca 8410622RNAHomo sapiens
106ugagguagua gguugugugg uu 2210783RNAHomo sapiens 107cggggugagg
uaguagguug ugugguuuca gggcagugau guugccccuc ggaagauaac 60uauacaaccu
acugccuucc cug 8310822RNAHomo sapiens 108ugagguagua gguuguauag uu
2210922RNAHomo sapiens 109ugagguagua gguuguauag uu 2211022RNAHomo
sapiens 110ugagguagua gguuguauag uu 2211180RNAHomo sapiens
111ugggaugagg uaguagguug uauaguuuua gggucacacc caccacuggg
agauaacuau 60acaaucuacu gucuuuccua 8011272RNAHomo sapiens
112agguugaggu aguagguugu auaguuuaga auuacaucaa gggagauaac
uguacagccu 60ccuagcuuuc cu 7211374RNAHomo sapiens 113gggugaggua
guagguugua uaguuugggg cucugcccug cuaugggaua acuauacaau 60cuacugucuu
uccu 7411423RNAHomo sapiens 114ugagugugug ugugugagug ugu
2311596RNAHomo sapiens 115gggaccugcg ugggugcggg cgugugagug
ugugugugug aguguguguc gcuccggguc 60cacgcucaug cacacaccca cacgcccaca
cucagg 9611623RNAHomo sapiens 116ugugcaaauc uaugcaaaac uga
2311782RNAHomo sapiens 117gcaguccucu guuaguuuug cauaguugca
cuacaagaag aauguaguug ugcaaaucua 60ugcaaaacug augguggccu gc
8211822RNAHomo sapiens 118ugagguagua gauuguauag uu 2211922RNAHomo
sapiens 119ugagguagua gauuguauag uu 2212087RNAHomo sapiens
120ucagagugag guaguagauu guauaguugu gggguaguga uuuuacccug
uucaggagau 60aacuauacaa ucuauugccu ucccuga 8712183RNAHomo sapiens
121ugugggauga gguaguagau uguauaguuu uagggucaua ccccaucuug
gagauaacua 60uacagucuac ugucuuuccc acg 8312222RNAHomo sapiens
122cagugguuuu acccuauggu ag 22123100RNAHomo sapiens 123ugugucucuc
ucuguguccu gccagugguu uuacccuaug guagguuacg ucaugcuguu 60cuaccacagg
guagaaccac ggacaggaua ccggggcacc 10012422RNAHomo sapiens
124uguaaacauc cucgacugga ag 2212571RNAHomo sapiens 125gcgacuguaa
acauccucga cuggaagcug ugaagccaca gaugggcuuu cagucggaug 60uuugcagcug
c 7112622RNAHomo sapiens 126ugauauguuu gauauauuag gu 2212785RNAHomo
sapiens 127ugcaggccuc ugugugauau guuugauaua uuagguuguu auuuaaucca
acuauauauc 60aaacauauuc cuacaguguc uugcc 8512823RNAHomo sapiens
128uaauccuugc uaccugggug aga 2312918RNAHomo sapiens 129aauccuugcu
accugggu 1813084RNAHomo sapiens 130gcucccccuc ucuaauccuu gcuaccuggg
ugagagugcu gucugaaugc aaugcaccug 60ggcaaggauu cugagagcga gagc
8413179RNAHomo sapiens 131cccccucucu aauccuugcu accuggguga
gagugcuuuc ugaaugcagu gcacccaggc 60aaggauucug caaggggga
7913222RNAHomo sapiens 132ugagguagua guuugugcug uu 2213384RNAHomo
sapiens 133cuggcugagg uaguaguuug ugcuguuggu cggguuguga cauugcccgc
uguggagaua 60acugcgcaag cuacugccuu gcua 8413421RNAHomo sapiens
134aucacauugc cagggauuuc c 2113573RNAHomo sapiens 135ggccggcugg
gguuccuggg gaugggauuu gcuuccuguc acaaaucaca uugccaggga 60uuuccaaccg
acc 7313621RNAHomo sapiens 136cauaaaguag aaagcacuac u
2113787RNAHomo sapiens 137gacagugcag ucacccauaa aguagaaagc
acuacuaaca gcacuggagg guguaguguu 60uccuacuuua uggaugagug uacugug
8713822RNAHomo sapiens 138uagcagcaca uaaugguuug
ug 2213983RNAHomo sapiens 139ccuuggagua aaguagcagc acauaauggu
uuguggauuu ugaaaaggug caggccauau 60ugugcugccu caaaaauaca agg
8314023RNAHomo sapiens 140caacggaauc ccaaaagcag cug 2314192RNAHomo
sapiens 141cggcuggaca gcgggcaacg gaaucccaaa agcagcuguu gucuccagag
cauuccagcu 60gcgcuuggau uucguccccu gcucuccugc cu 9214217RNAHomo
sapiens 142ucucgcuggg gccucca 17143110RNAHomo sapiens 143ccggaucuca
cacgguggug uuaauaucuc gcuggggccu ccaaaauguu gugcccaggg 60guguuagaga
aaacaccaca cuuugagaug aauuaagagu ccuuuauuag 11014422RNAHomo sapiens
144aaaagcuggg uugagagggc ga 2214582RNAHomo sapiens 145gcuucgcucc
ccuccgccuu cucuucccgg uucuucccgg agucgggaaa agcuggguug 60agagggcgaa
aaaggaugag gu 8214624RNAHomo sapiens 146acaaagugcu ucccuuuaga gugu
2414790RNAHomo sapiens 147ucccaugcug ugacccucua gaggaagcac
uuucuguuug uugucugaga aaaaacaaag 60ugcuucccuu uagaguguua ccguuuggga
9014822RNAHomo sapiens 148uucccuuugu cauccuaugc cu 22149110RNAHomo
sapiens 149ggcuacaguc uuucuucaug ugacucgugg acuucccuuu gucauccuau
gccugagaau 60auaugaagga ggcugggaag gcaaagggac guucaauugu caucacuggc
11015021RNAHomo sapiens 150gaaagcgcuu cucuuuagag g 2115187RNAHomo
sapiens 151ucucaugcug ugacccucua gagggaagca cuuucucuug ucuaaaagaa
aagaaagcgc 60uucucuuuag aggauuacuc uuugaga 8715222RNAHomo sapiens
152uggaauguaa ggaagugugu gg 2215386RNAHomo sapiens 153ugcuucccga
ggccacaugc uucuuuauau ccccauaugg auuacuuugc uauggaaugu 60aaggaagugu
gugguuucgg caagug 8615422RNAHomo sapiens 154uucccuuugu cauccuaugc
cu 22155110RNAHomo sapiens 155ggcuacaguc uuucuucaug ugacucgugg
acuucccuuu gucauccuau gccugagaau 60auaugaagga ggcugggaag gcaaagggac
guucaauugu caucacuggc 11015623RNAHomo sapiens 156uuauugcuua
agaauacgcg uag 23157102RNAHomo sapiens 157gguccucuga cucucuucgg
ugacggguau ucuugggugg auaauacgga uuacguuguu 60auugcuuaag aauacgcgua
gucgaggaga guaccagcgg ca 10215822RNAHomo sapiens 158cacacacugc
aauuacuuuu gc 2215997RNAHomo sapiens 159gauugaugcu guugguuugg
ugcaaaagua auugcagugc uucccauuua aaaguaaugg 60cacacacugc aauuacuuuu
gcuccaacuu aauacuu 9716017RNAHomo sapiens 160uucaaguaau ucaggug
1716177RNAHomo sapiens 161uguuuaucuc uaggguugau cuauuagaau
uacuuaucug agccaaagua auucaaguaa 60uucaggugua gugaaac
7716221RNAHomo sapiens 162cugaccuaug aauugacagc c 21163110RNAHomo
sapiens 163gccgagaccg agugcacagg gcucugaccu augaauugac agccagugcu
cucgucuccc 60cucuggcugc caauuccaua ggucacaggu auguucgccu caaugccagc
11016422RNAHomo sapiens 164cucuagaggg aagcacuuuc ug 2216522RNAHomo
sapiens 165cucuagaggg aagcacuuuc ug 2216685RNAHomo sapiens
166cucaggcugu gacccucuag agggaagcac uuucuguugc uugaaagaag
agaaagcgcu 60uccuuuuaga ggauuacucu uugag 8516765RNAHomo sapiens
167gugacccucu agagggaagc acuuucuguu gaaagaaaag aacaugcauc
cuuucagagg 60guuac 6516822RNAHomo sapiens 168gggggucccc ggugcucgga
uc 2216996RNAHomo sapiens 169cucgggaggg gcgggagggg gguccccggu
gcucggaucu cgagggugcu uauuguucgg 60uccgagccug ggucucccuc uuccccccaa
cccccc 9617022RNAHomo sapiens 170auaauacaug guuaaccucu uu
2217197RNAHomo sapiens 171aacuaugcaa ggauauuuga ggagagguua
uccguguuau guucgcuuca uucaucauga 60auaauacaug guuaaccucu uuuugaauau
cagacuc 9717222RNAHomo sapiens 172uuuugcaaua uguuccugaa ua
2217378RNAHomo sapiens 173gcagaauuau uuuugcaaua uguuccugaa
uauguaauau aaguguauug ggaucauuuu 60gcauccauag uuuuguau
7817422RNAHomo sapiens 174aaaaguaauu gugguuuugg cc 2217597RNAHomo
sapiens 175cagacuauau auuuagguug gcgcaaaagu aauugugguu uuggccuuua
uuuucaaugg 60caagaaccuc aguugcuuuu gugccaaccu aauacuu
9717622RNAHomo sapiens 176uuaugguuug ccugggacug ag 2217797RNAHomo
sapiens 177uagggugacc agccauuaug guuugccugg gacugaggaa uuugcuggga
uaugucaguu 60ccaggccaac caggcugguu ggucucccug aagcaac
9717819RNAHomo sapiens 178aaaaacugua auuacuuuu 1917919RNAHomo
sapiens 179aaaaacugua auuacuuuu 1918019RNAHomo sapiens
180aaaaacugua auuacuuuu 1918119RNAHomo sapiens 181aaaaacugua
auuacuuuu 1918219RNAHomo sapiens 182aaaaacugua auuacuuuu
1918384RNAHomo sapiens 183auuagguugg ugcaaaagua aucacaguuu
uugacauuac uuucaaagac aaaaacugua 60auuacuuuug gaccaaccua auag
8418498RNAHomo sapiens 184uaauaacuau uagguuggug cgaacauaau
ugcaguuuuu aucauuacuu uuaauggcaa 60aaacuguaau uacuuuugca ccaaccuaau
auuuuagu 9818587RNAHomo sapiens 185auuagguugg ugcaaaccua auugcaauuu
uugcaguuuu uuuaaguaau ugcaaaaacu 60guaauuacuu uugcaccaac cuaauac
87186105RNAHomo sapiens 186gaguucuaac guauuagguu ggugcaaaag
uaauaguggu uuuugccauu aaaaguaaug 60acaaaaacug uaauuacuuu uggaacaaua
uuaauagaau uucag 10518786RNAHomo sapiens 187uauuagguug cugcaaaagu
aaucauguuu uuuuccauug uaaguaaugg gaaaaacugu 60aauuacuuuu guaccaaccu
aauagc 8618822RNAHomo sapiens 188uauacaaggg cagacucucu cu
2218983RNAHomo sapiens 189ugcuacuuga agagagguaa uccuucacgc
auuugcuuua cuugcaauga uuauacaagg 60gcagacucuc ucuggggagc aaa
8319023RNAHomo sapiens 190uaagugcuuc cauguuucag ugg 2319168RNAHomo
sapiens 191ccuuugcuuu aacauggggg uaccugcugu gugaaacaaa aguaagugcu
uccauguuuc 60aguggagg 6819223RNAHomo sapiens 192aucaacagac
auuaauuggg cgc 2319385RNAHomo sapiens 193gcacauugua ggccucauua
aauguuuguu gaaugaaaaa augaaucauc aacagacauu 60aauugggcgc cugcucugug
aucuc 8519422RNAHomo sapiens 194uugagaauga ugaaucauua gg
2219597RNAHomo sapiens 195auaaaauuuc caauuggaac cuaaugauuc
aucagacuca gauauuuaag uuaacaguau 60uugagaauga ugaaucauua gguuccgguc
agaaauu 9719622RNAHomo sapiens 196uuuaggauaa gcuugacuuu ug
2219797RNAHomo sapiens 197aaucuaucac ugcuuuuuag gauaagcuug
acuuuuguuc aaauaaaaau gcaaaaggaa 60aguguauccu aaaaggcaau gacaguuuaa
uguguuu 9719821RNAHomo sapiens 198ugguagacua uggaacguag g
2119967RNAHomo sapiens 199agagauggua gacuauggaa cguaggcguu
augauuucug accuauguaa caugguccac 60uaacucu 6720022RNAHomo sapiens
200ugggucuuug cgggcgagau ga 2220188RNAHomo sapiens 201cgaggauggg
agcugagggc ugggucuuug cgggcgagau gagggugucg gaucaacugg 60ccuacaaagu
cccaguucuc ggcccccg 8820224RNAHomo sapiens 202uucuccaaaa gaaagcacuu
ucug 2420324RNAHomo sapiens 203uucuccaaaa gaaagcacuu ucug
2420483RNAHomo sapiens 204ucucaugcag ucauucucca aaagaaagca
cuuucuguug ucugaaagca gagugccuuc 60uuuuggagcg uuacuguuug aga
8320583RNAHomo sapiens 205ucucaugcag ucauucucca aaagaaagca
cuuucuguug ucugaaagca gagugccuuc 60uuuuggagcg uuacuguuug aga
8320622RNAHomo sapiens 206uacgucaucg uugucaucgu ca 2220797RNAHomo
sapiens 207gcuugaugau gcugcugaug cuggcgguga ucccgauggu gugagcugga
aauggggugc 60uacgucaucg uugucaucgu caucaucauc auccgag
9720818RNAHomo sapiens 208uucacaggga ggugucau 1820918RNAHomo
sapiens 209uucacaggga ggugucau 18210129RNAHomo sapiens
210gggaugccac auucagccau ucagcguaca gugccuuuca cagggaggug
ucauuuaugu 60gaacuaaaau auaaauuuca ccuuucugag aaggguaaug uacagcaugc
acugcauaug 120ugguguccc 129211127RNAHomo sapiens 211ggaugccaca
uucagccauu cagugugcag ugccuuucac agggaggugu cauuuaugug 60aacuaaaaua
uaaauuucac cuuucugaga aggguaaugu acagcaugca cugcauaugu 120ggugucc
12721221RNAHomo sapiens 212augauccagg aaccugccuc u 2121396RNAHomo
sapiens 213gugacccugg gcaaguuccu gaagaucaga cacaucagau cccuuaucug
uaaaaugggc 60augauccagg aaccugccuc uacgguugcc uugggg 9621422RNAHomo
sapiens 214aaaacuguaa uuacuuuugu ac 2221589RNAHomo sapiens
215aguuauuaga uuagugcaaa aguaauugca guuuuugcau uacguucuau
ggcaaaacug 60uaauuacuuu uguaccaaca uaauacuuc 8921621RNAHomo sapiens
216uguucaugua gauguuuaag c 2121759RNAHomo sapiens 217caguguucau
guagauguuu aagcucuugc aguagguuuu ugcaagcuag ugaacgcug
5921822RNAHomo sapiens 218agaucagaag gugauugugg cu 2221973RNAHomo
sapiens 219cuccucagau cagaagguga uuguggcuuu ggguggauau uaaucagcca
cagcacugcc 60uggucagaaa gag 7322022RNAHomo sapiens 220aaaccugugu
uguucaagag uc 2222197RNAHomo sapiens 221ggccuagcca aauacuguau
uuuugaucga cauuugguug aaaaauaucu auguauuagu 60aaaccugugu uguucaagag
uccacugugu uuugcug 9722222RNAHomo sapiens 222uugugucaau augcgaugau
gu 2222397RNAHomo sapiens 223uauuaugcca ugacauugug ucaauaugcg
augauguguu gugauggcac agcgucauca 60cguggugacg caacaucaug acguaagacg
ucacaac 9722423RNAHomo sapiens 224cuguaauaua aauuuaauuu auu
2322549RNAHomo sapiens 225cuguaauaua aauuuaauuu auucucuauc
auuaaaaaau guauuacag 4922622RNAHomo sapiens 226uuuugcgaug
uguuccuaau au 2222722RNAHomo sapiens 227uuuugcgaug uguuccuaau au
2222891RNAHomo sapiens 228aaacgauacu aaacuguuuu ugcgaugugu
uccuaauaug cacuauaaau auauugggaa 60cauuuugcau guauaguuuu guaucaauau
a 91229100RNAHomo sapiens 229ccaaagaaag augcuaaacu auuuuugcga
uguguuccua auauguaaua uaaauguauu 60ggggacauuu ugcauucaua guuuuguauc
aauaauaugg 10023024RNAHomo sapiens 230aauccuugga accuaggugu gagu
2423165RNAHomo sapiens 231cuugaauccu uggaaccuag gugugagugc
uauuucagug caacacaccu auucaaggau 60ucaaa 6523222RNAHomo sapiens
232ugggucuuug cgggcgagau ga 2223388RNAHomo sapiens 233cgaggauggg
agcugagggc ugggucuuug cgggcgagau gagggugucg gaucaacugg 60ccuacaaagu
cccaguucuc ggcccccg 8823419RNAHomo sapiens 234gggcgccugu gaucccaac
1923594RNAHomo sapiens 235gcuaggcgug guggcgggcg ccugugaucc
caacuacuca ggaggcuggg gcagcagaau 60cgcuugaacc cgggaggcga agguugcagu
gagc 9423621RNAHomo sapiens 236cauaaaguag aaagcacuac u
2123787RNAHomo sapiens 237gacagugcag ucacccauaa aguagaaagc
acuacuaaca gcacuggagg guguaguguu 60uccuacuuua uggaugagug uacugug
8723822RNAHomo sapiens 238uagcagcaca uaaugguuug ug 2223983RNAHomo
sapiens 239ccuuggagua aaguagcagc acauaauggu uuguggauuu ugaaaaggug
caggccauau 60ugugcugccu caaaaauaca agg 8324022RNAHomo sapiens
240aaaaccgucu aguuacaguu gu 2224161RNAHomo sapiens 241acagcuguaa
uuagucaguu uucuguccug uccacacaga aaaccgucua guuacaguug 60u
6124222RNAHomo sapiens 242ucagugcauc acagaacuuu gu 2224399RNAHomo
sapiens 243caagcacgau uagcauuuga ggugaaguuc uguuauacac ucaggcugug
gcucucugaa 60agucagugca ucacagaacu uugucucgaa agcuuucua
9924422RNAHomo sapiens 244ugaaacauac acgggaaacc uc 2224581RNAHomo
sapiens 245gauacucgaa ggagagguug uccguguugu cuucucuuua uuuaugauga
aacauacacg 60ggaaaccucu uuuuuaguau c 8124622RNAHomo sapiens
246agaucgaccg uguuauauuc gc 2224770RNAHomo sapiens 247uugaagggag
aucgaccgug uuauauucgc uuuauugacu ucgaauaaua caugguugau 60cuuuucucag
7024823RNAHomo sapiens 248uacccuguag auccgaauuu gug 23249110RNAHomo
sapiens 249gaucugucug ucuucuguau auacccugua gauccgaauu uguguaagga
auuuuguggu 60cacaaauucg uaucuagggg aauauguagu ugacauaaac acuccgcucu
11025022RNAHomo sapiens 250uguaaacauc cccgacugga ag 2225170RNAHomo
sapiens 251guuguuguaa acauccccga cuggaagcug uaagacacag cuaagcuuuc
agucagaugu 60uugcugcuac 7025223RNAHomo sapiens 252aaggagcuua
caaucuagcu ggg 2325388RNAHomo sapiens 253aacugcccuc aaggagcuua
caaucuagcu ggggguaaau gacuugcaca ugaacacaac 60uagacuguga gcuucuagag
ggcaggga 8825422RNAHomo sapiens 254uucaccaccu ucuccaccca gc
2225575RNAHomo sapiens 255ggcugugccg gguagagagg gcagugggag
guaagagcuc uucacccuuc accaccuucu 60ccacccagca uggcc 7525618RNAHomo
sapiens 256gucccuguuc aggcgcca 1825723RNAHomo sapiens 257agguuguccg
uggugaguuc gca 2325882RNAHomo sapiens 258ugguacucgg agggagguug
uccgugguga guucgcauua uuuaaugaug cccaauacac 60ggucgaccuc uuuucgguau
ca 8225997RNAHomo sapiens 259cugcuccuuc ucccauaccc auugcauauc
ggaguuguga auucucaaaa caccuccugu 60gugcauggau uacaggaggg ugagccuugu
caucgug 9726022RNAHomo sapiens 260uacccauugc auaucggagu ug
2226121RNAHomo sapiens 261accuccugug ugcauggauu a
2126215DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(1)..(1)LNA
moietymodified_base(3)..(3)LNA moietymodified_base(5)..(7)LNA
moietymodified_base(10)..(12)LNA moietymodified_base(14)..(15)LNA
moiety 262tcacaattag catta 1526315DNAArtificial SequenceDescription
of Artificial Sequence Synthetic
oligonucleotidemodified_base(1)..(1)LNA
moietymodified_base(3)..(3)LNA moietymodified_base(5)..(7)LNA
moietymodified_base(10)..(12)LNA moietymodified_base(14)..(15)LNA
moiety 263tcaacattag actta 1526417RNAHomo sapiens 264ucccuguucg
ggcgcca 1726521RNAHomo sapiens 265uucacagugg cuaaguuccg c 21
* * * * *