U.S. patent application number 15/710292 was filed with the patent office on 2018-01-25 for selective targeting of the cd40l/mac-1 interaction by small peptide inhibitors and its use for the treatment of inflammation and atherogenesis.
The applicant listed for this patent is Baker IDI Heart & Diabetes Institute Holdings Ltd., Universitaetsklinikum Freiburg. Invention is credited to Karlheinz PETER, Dennis WOLF, Andreas ZIRLIK.
Application Number | 20180021430 15/710292 |
Document ID | / |
Family ID | 43755250 |
Filed Date | 2018-01-25 |
United States Patent
Application |
20180021430 |
Kind Code |
A1 |
ZIRLIK; Andreas ; et
al. |
January 25, 2018 |
SELECTIVE TARGETING OF THE CD40L/MAC-1 INTERACTION BY SMALL PEPTIDE
INHIBITORS AND ITS USE FOR THE TREATMENT OF INFLAMMATION AND
ATHEROGENESIS
Abstract
The CD40L/Mac-1 interaction is selectively targeted by small
peptide inhibitors and/or antibodies and such peptides are used for
the specific treatment of inflammation and atherogenesis. In
particular, pharmaceutical compositions comprising a polypeptide
having the amino acid sequence EQLKKSKTL and antibodies
specifically binding to an epitope are disclosed.
Inventors: |
ZIRLIK; Andreas; (Freiburg,
DE) ; WOLF; Dennis; (Freiburg, DE) ; PETER;
Karlheinz; (Melbourne, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Universitaetsklinikum Freiburg
Baker IDI Heart & Diabetes Institute Holdings Ltd. |
Freiburg
Melbourne |
|
DE
AU |
|
|
Family ID: |
43755250 |
Appl. No.: |
15/710292 |
Filed: |
September 20, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13880498 |
Jun 28, 2013 |
9808522 |
|
|
PCT/EP2011/064132 |
Aug 17, 2011 |
|
|
|
15710292 |
|
|
|
|
Current U.S.
Class: |
424/139.1 ;
514/1.9; 514/21.1; 514/21.5; 514/21.6; 530/387.9; 530/389.2 |
Current CPC
Class: |
C07K 2317/76 20130101;
A61K 39/3955 20130101; A61K 38/1709 20130101; A61P 29/00 20180101;
A61K 38/12 20130101; A61K 38/10 20130101; A61P 9/10 20180101; C07K
16/2845 20130101; C07K 2317/70 20130101; C07K 2317/34 20130101;
A61K 38/08 20130101; C07K 16/241 20130101; C07K 2317/33
20130101 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 38/10 20060101 A61K038/10; A61K 38/08 20060101
A61K038/08; A61K 38/12 20060101 A61K038/12; A61K 38/17 20060101
A61K038/17; C07K 16/28 20060101 C07K016/28 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 21, 2010 |
EP |
10188325.4 |
Claims
1. An antibody capable of specifically binding to an epitope
comprising the amino acid sequence QLK.
2. The antibody according to claim 1, capable of specifically
binding to an epitope comprising at least part of the amino acid
sequence SEQ ID NO:19.
3. The antibody according to claim 1, capable of specifically
binding to an epitope comprising at least part of the amino acid
sequence SEQ ID NO:20.
4. The antibody according to claim 1, capable of specifically
binding to an epitope comprising at least part of the amino acid
sequence SEQ ID NO:3.
5. The antibody according to claim 1, capable of specifically
binding to an epitope comprising at least part of the amino acid
sequence SEQ ID NO:1.
6. The antibody according to claim 1, capable of specifically
binding to an epitope comprising at least part of the amino acid
sequence SEQ ID NO:2.
7. An antibody capable of inhibiting the binding of macrophage-1
antigen (Mac-1) to CD40L.
8. A pharmaceutical composition comprising the antibody according
to claim 1.
9. A process for the treatment of an atherosclerotic disease
comprising administering the pharmaceutical composition according
to claim 8 to a subject in need thereof.
Description
[0001] This application is a divisional of co-pending U.S. Ser. No.
13/880,498, filed Jun. 28, 2013, which is a US National Stage
application under 35 U.S.C. .sctn.371 of International Application
No. PCT/EP2011/064132, filed Aug. 17, 2011, which claims priority
from European Patent Application No. 10188325.4, filed Oct. 21,
2010, from which applications priority is claimed, and which are
incorporated herein by reference.
[0002] The present invention relates to CD40 ligand (CD40L) which
plays a role in diseases associated with inflammation and
atherogenesis. CD40 ligand, also known as human CD154, is a 33 kDa
type II transmembrane protein and is a member of the tumor necrosis
factor (TNF) gene superfamily. Although CD40L is expressed
preferentially on activated CD4.sup.+ T-cells and activated
platelets, it is also found on other hematopoietic and
non-hematopoietic cells such as epithelial and endothelial
cells.
[0003] In a similar manner to all other members of the TNF family
membrane-bound CD40L exists in a trimeric form, which is essential
for the full biological activity of the molecule. Soluble CD40L
mainly appears as monomer in blood but will trimerize in higher
concentrations. CD40L was initially identified as ligand for CD40,
but more recently additional receptors for CD40 have been
described, namely the integrins .alpha.IIb.beta.3, .alpha.5.beta.1
and Mac-1.
[0004] Macrophage-1 antigen (Mac-1) is also known as integrin
.alpha.M (ITGAM) which is one protein subunit that forms the
heterodimeric integrin .alpha.M.beta.-2 (.alpha..sub.M.beta..sub.2)
molecule. .alpha..sub.M.beta..sub.2 is expressed on the surface of
many leukocytes involved in the innate immune system, including
monocytes, granulocytes, macrophages and natural killer cells. It
mediates inflammation by regulating leukocyte adhesion and
migration and has been implicated in several immune processes such
as phagocytosis, cell-mediated cytotoxicity, chemotaxis and
cellular activation.
[0005] CD40L participates in chronic inflammatory diseases such as
atherosclerosis. Through interaction with its classic receptor
CD40, CD40 L regulates B-cell and T-cell function. CD40L also
stabilizes thrombi through interaction with the platelet integrin
.alpha..sub.IIb.beta..sub.3. While anti-CD40L antibody treatment
generated promising results in early clinical trials, elevated
thromboembolic complications prohibited the pursuit of this
strategy. In addition, long-term inhibition of CD40L--as is most
likely required for treatment of chronic inflammatory
diseases--severely compromises host defenses, rendering generalized
inhibition of CD40L an unappealing treatment strategy. Zirlik et
al., Circulation, 2007, 1571-1580 previously reported that CD40L
mediates atherogenesis independently of CD40 in mice, and proposed
a novel interaction with the leukocyte integrin Mac-1. In this
article it is not disclosed where the interaction of the whole
Mac-1 protein and CD40L takes place in vitro. No targeting by
peptides or specific antibodies was attempted.
[0006] WO 2004/045542 discloses therapeutic bioconjugates
comprising a hydrophilic polymer and peptides capable of binding
specifically to a ligand expressed on a cell surface. The
polypeptide can be derived from a huge variety of sequences, inter
alia the CD11bI domain.
[0007] WO 91/19511 discloses a method of controlling
phagocyte-mediated tissue damage (such as inflammation) to a human
patient whereby said method comprises the administration of a
therapeutic composition of a peptide comprising part of the .beta.2
integrin subunit of CD11b. The peptides disclosed differ, however,
from the peptides of the present invention. Moreover,
artherosclerosis is not a primary target of this publication.
[0008] Wolf et al., "Interaction of CD40L with the Leukocyte
Integrin Mac-1: A New Pathway for CD40L-Mediated Inflammation in
Atherogenesis", Heart, Lung and Circulation, vol. 17, Jan. 1, 2008,
p. S 240 mention the interaction of CD40L and Mac-1 as an
alternative pathway for CD40L-mediated inflammation. This mechanism
expands the understanding of inflammatory signaling during
atherogenesis. In the abstract there is, however, no mention of the
binding site and specific peptides or antibodies.
[0009] Li et al., The American Journal of Pathology, vol. 172
(2008), pp 1141-1151, describe an animal model of restenosis rather
than artherosclerosis. The induction of Mac-1 expression by CD40L
is disclosed, but binding between CD40L and Mac-1 or any
therapeutic use thereof is not disclosed. Zhang et al., J. Biol.
Chemistry (1996), pp 29953-29957, describe the identification of a
discrete site within the I domain of integrin
.alpha..sub.M.beta..sub.2 which modulates the adhesive activity of
this receptor. This region is described as composed of two short
and spatially proximal loops.
[0010] Here this interaction and its therapeutic use is
characterized on a molecular level, identifying the amino acids
E.sup.162-L.sup.170, located on an exposed loop between the
.alpha.1 helix and .beta.-sheet B of the Mac-1 I-domain, as a
distinct binding site for CD40L. Targeting of CD40L/Mac-1 binding
with a preferred stable inhibitory peptide, in the following: cM7,
proved specific and ultimately effective in attenuating
inflammation and atherosclerotic lesion formation in mice. Specific
inhibition of the CD40L/Mac-1 interaction might therefore represent
an attractive novel anti-inflammatory treatment strategy for
atherosclerosis and other chronic inflammatory diseases, avoiding
the unwanted effects of global inhibition of CD40 ligand
action.
[0011] Chronic inflammation drives atherosclerosis. CD40L, a member
of the tumor necrosis factor superfamily first described on
T-cells, participates as a key regulator of atherogenesis.
Functional blockade of CD40L not only reduced atherosclerotic
plaque formation and progression, but also attenuated monocyte and
lipid content of these lesions while increasing numbers of collagen
fibers and smooth-muscle cells--features commonly associated with
more stable plaques in humans. CD40L also augments
monocyte/macrophage expression of collagenases implicated in plaque
disruption and of tissue factor, a trigger of thrombosis following
plaque rupture. The surprising finding was previously reported that
CD40L promotes atherogenesis without participation of CD40L on bone
marrow--derived cells, and independently of its classic receptor
CD40. These findings point towards a role of CD40L on vascular
cells, such as endothelial or smooth-muscle cells, interacting with
an alternate receptor.
[0012] The present invention relates to the interaction of CD40L
with the leukocyte integrin Mac-1, an adhesive receptor interacting
with a variety of known ligands implicated in immunity,
inflammation, and hemostasis. Inhibition of Mac-1 by neutralizing
antibodies markedly attenuated atherosclerotic lesion formation by
impairing monocyte recruitment. Here the interaction between CD40L
and Mac-1 is used for potential therapeutic applications.
[0013] While inflammation drives many chronic diseases, including
atherosclerosis, few selective anti-inflammatory treatment options
currently exist. In the context of atherosclerosis, statins
(lipid-lowering drugs that exert various anti-inflammatory actions)
allow a glimpse at the therapeutic potential of such strategies.
Another class of drugs, the Cox-2 inhibitors, exemplifies the
impressive extent of therapeutic benefits but they also demonstrate
the difficulty in developing anti-inflammatory drugs without side
effects. Previous concepts aimed at the global inhibition of
cytokines such as CD40L largely failed due to acute or long-term
side effects.
[0014] The present invention relates to the specific inhibition of
the CD40L/Mac-1 interaction by using small peptide inhibitors
and/or antibodies which specifically bind to an epitope having a
well-defined amino acid sequence and the use thereof in
pharmaceutical compositions. The peptide comprising the sequence
EQLKKSKTL (SEQ ID NO:1) mimmicks part of Mac-1's I-domain and
therefore binds to its counterpart region on CD40L. The antibodies
are directed against the peptide sequence (after modification) and
therefore bind to EQLKKSKTL on Mac-1.
[0015] The relevant amino acid sequence has been identified in the
course of the present invention and the polypeptides comprise the
amino acid sequence EQLKKSKTL (SEQ ID NO:1). It is essential that
the peptide to be used has the amino acid sequence as shown in SEQ
ID NO:1. It is, however, possible to slightly modify the amino acid
sequence, for example by replacing single amino acids. When such
amino acids are replaced, the polarity of the amino acid is
maintained. This means that amino acids having hydrophobic or
hydrophilic character are replaced by other amino acids having the
same character. It is for example possible to replace a leucin
residue by an isoleucin residue or a leucin residue by an arginin.
Preferably only one amino acid of SEQ ID NO:1 is replaced.
[0016] In an alternative modification one or possibly also two
amino acids can be deleted whereby the biological activity is
maintained. It has, however, to be carefully checked which amino
acid can be deleted whereby the activity of the peptide has to be
carefully monitored.
[0017] The polypeptide has not more than 15 amino acids and more
preferable not more than 12 amino acids. The polypeptide of the
present invention may contain on the N-terminus and/or the
C-terminus thereof additional amino acids which do not negatively
influence the biological activity of the polypeptide.
[0018] The experiments show that the probably most important part
of the peptide sequence is the amino acid motif QLK which may be
the most important part of the peptide. Therefore, antibodies which
can be used for pharmaceutical purposes are preferably directed
against the motif QLK. In another preferred embodiment the motif
against which the antibodies are directed is EQLKK (SEQ ID NO: 19).
This motif can also be used in a cyclic structure, namely CEQLKKC
(SEQ ID NO: 20).
[0019] The polypeptide as used in the pharmaceutical composition
must be stabilized against degradation in the patient. Either the
peptide structure is chemically modified in such a manner that the
normal degradation of the peptide is inhibited or at least delayed.
Another preferred method of stabilizing the peptide is to form a
cyclic sequence which still has the desired biological effects. The
advantage of this cyclic peptide structure is the delayed
degradation and therefore enhanced bioavailability. In a preferred
embodiment the peptide has the amino acid sequence CEQLKKSKTLC (SEQ
ID NO:2).
[0020] In a further alternative approach the N-terminus or the
C-terminus is modified. One interesting approach is to bind
polyethyleneglycol units (PEG) directly or preferably via a linker
to the peptide molecule. This has the advantage that the stability
of the molecule is increased. On the other hand the bioavailability
of the modified molecule is improved since the molecule is
maintained for a longer period of time in the body to be treated
with the peptide. It should be mentioned, however, that by the
modification the steric conformation of the molecule should not be
changed in such a manner that the binding of the peptide to the
target area is not inhibited.
[0021] In a further alternative embodiment the peptide sequence is
at least partially replaced by peptide analoga.
[0022] The pharmaceutical compositions of the present invention can
be administered in a suitable form well-known to the person skilled
in the art. The composition can be administered either orally or in
the form of a suitable injection. Also topical administration in
form of creams or ointments is possible. In addition to the
polypeptide of the present invention the pharmaceutical composition
comprises commonly used additives to a pharmaceutical composition
such as stabilizers, pH regulators, preservative agents and the
like.
[0023] The pharmaceutical composition is preferably used in the
treatment of an inflammatory disease and/or in the treatment of an
atherosclerotic disease. In particular, the compositions can be
preferably used for the treatment of chronic inflammatory diseases
such as coronary heart disease, rheumatoid arthritis, lupus, asthma
and potentially all other conditions with which CD40L has been
implicated previously.
[0024] In another embodiment the present invention relates to an
antibody which specifically binds to an epitope which comprises at
least part of the amino acid sequence VMEQLKKSKTLFS (SEQ ID NO:3).
The preferred antibody is a human antibody. Such antibodies can be
prepared either by humanization of mouse antibodies or the
antibodies can be obtained by the so-called phage display method.
Since the epitope against which the antibody is directed is known
such antibodies can be easily obtained. Such antibodies
specifically bind to an epitope contained within the given sequence
and therefore the antibody inhibits the adhesion of Mac-1 to CD40L.
The antibodies are preferred IgG antibodies. In an alternative
embodiment also binding fragments (Fab) can also be used. Such
functionally active parts of antibodies are understood to be
covered by the term "antibody".
[0025] The disclosed peptide-based strategy might overcome some of
these limitations. CD40L has at least four different receptors,
including CD40 and the integrins .alpha..sub.IIb.beta..sub.3, Mac-1
(.alpha..sub.M.beta..sub.2), and .alpha..sub.v.beta..sub.1. This
invention uses a novel selective inhibitor to characterize
receptor-dependent properties of CD40L. The use of similar
strategies to block selectively other interaction partners and
their defined roles in inflammation, immunology, and hemostasis,
might enable development of tailored drugs for different
CD40L-dependent conditions. The preferred cyclic polypeptide having
SEQ ID NO:2 (cM7) was efficacious and specific in the inhibition of
CD40L/Mac-1 binding and its downstream effects, such as
inflammatory gene expression, inflammatory cell recruitment, and
atherogenesis. Therefore, cM7 may represent a fruitful novel
strategy to combat chronic inflammatory diseases such as
atherosclerosis.
[0026] One of the surprising results was that the polypeptides of
the present invention were able to specifically inhibit the
CD40L/Mac-1 interaction without, however, provoking other
unspecific and unwanted side effects. In particular the
polypeptides of the present invention did not interfere with
CD40L/GPIIb/IIIa mediated thrombus formation in vivo. The results
disclosed in the present application support the concept of a
therapeutic blockade of CD40L. Previously known concept aimed at
the global inhibition of CD40L and failed due to acute or long-term
side effects. In particular, clinical data revealed thromboembolic
complications most likely to destabilization of thrombi [Andre et
al. (2002), Nat.Med. 8, pp 247-252]. In contrast thereto the
specific inhibition of the CD40L/Mac-1 interaction obtainable by
the polypeptides and antibodies of the present invention hardly
affected thrombose integrity. In particular cM7 did not interfere
with CD40-CD40L binding in vitro and did not induce changes in
basic immunological characteristics such as alteration of
Th1/Th2-phenotype.
[0027] The results of the experiments are summarized in the figures
and explained in more detail in the figure legends.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1A to FIG. 1J show that CD40L binds to a distinct site
within Mac-1's I-domain.
[0029] FIG. 1A I-domain shown based on its crystal structure
(INA5): left, as a ribbon diagram; right, as a model of the
hydrated surface with linear peptides corresponding to sections, M1
to M8.
[0030] FIG. 1B Recombinant CD40L specifically bound to the
immobilized I-domain in a solid phase binding assay.
[0031] FIG. 1C I-domain concentration-dependently bound to
immobilized CD40L. The insert shows recombinant, purified CD40L and
I-domain on a Coomassie Blue-stained acrylamide gel. Different
clones specifically blocking Mac-1 (2LPM19c, ICRF44), CD40L (40804,
24-31), and LFA-1 (HI111) were tested for their capability to block
adhesion of Mac-1 expressing CHO cells to
[0032] immobilized fibrinogen FIG. 1D or
[0033] CD40L FIG. 1E.
[0034] Small peptide inhibitors, M1 to M8 (50 .mu.M), were used to
block binding of CD40L
[0035] to the immobilized I-domain in a solid phase binding assay
FIG. 1F (The sequences of M1 to M8 are shown in Table 1.),
[0036] to block adhesion of activated THP-1 cells to immobilized
CD40L in an adhesion assay FIG. 1G,
[0037] and to block binding of fluorescence-labeled CD40L to
freshly isolated human granulocytes and monocytes in flow cytometry
FIG. 1H.
[0038] FIG. 1I Peptides M1 to M8 were immobilized to highly
absorbent plastic plates, and direct binding of biotinylated CD40L
was quantified.
[0039] FIG. 1J I-domain peptides (50 .mu.M) were also tested for
the ability to block binding of CD40L to Mac-1 expressing CHO cells
in flow cytometry, as demonstrated by representative dot plots.
Data are presented as mean.+-.SEM of at least three independent
experiments (FIG. 1B, FIG. 1C, FIG. 1D, FIG. 1E, FIG. 1F, FIG. 1G,
FIG. 1I). Three healthy male donors are included in FIG. 1H. n.b.:
no binding
[0040] FIG. 2A to FIG. 2L show the In vitro and in vivo
characterization of the peptide antagonist.
[0041] FIG. 2A The peptide M7 mimicking the CD40L/Mac-1 binding
site was tested in a solid phase binding assay, and
concentration-dependently inhibited CD40L binding to the
immobilized I-domain.
[0042] FIG. 2B cM7, a cyclic variant of the specific peptide
inhibitor M7, optimized for in vivo use, inhibited adhesion of a
Mac-1 expressing CHO cell line to immobilized CD40L in a dynamic
flow chamber assay. Demonstrating specificity, cM7 failed to block
adhesion of Mac-1 expressing cells to
[0043] the alternative Mac-1 ligands ICAM-1 FIG. 2C, and
[0044] GPIb.alpha. FIG. 2D, whereas the GPIb.alpha.-specific
control peptide M2 efficiently blocked adhesion to the platelet
protein.
[0045] FIG. 2E cM7 and scM7 did not affect binding of CD40L to
immobilized CD40-Fc fragments, whereas a blocking anti-CD40
antibody concentration dependently blocked molecular
interaction.
[0046] FIG. 2F FITC-labeled cM7 specifically bound to
CD40L-transfected murine fibroblasts, but not to mock-transfected
fibroblasts, as demonstrated in flow cytometry.
[0047] FIG. 2G Pharmacokinetics of intraperitoneal-injected
cM7.
[0048] FIG. 2H Intraperitoneal-injected cM7 attenuated the
TNF.alpha.-induced inflammatory response compared with scM7 (n=8
per group) by lowering plasma levels of the chemoattractant MCP-1
and FIG. 2I increasing protective IL-10 plasma levels.
[0049] FIG. 2J Oxidative stress was reduced in granulocytes of
cM7-treated animals.
[0050] FIG. 2K, FIG. 2L Platelet activation was diminished after
cM7 injection, as demonstrated by decreased platelet P-selectin
expression and lowered platelet-leukocyte aggregates. Data are
presented as mean.+-.SEM of at least three independent
experiments.
[0051] FIG. 3A to FIG. 3L illustrate that the CD40L/Mac-1
interaction contributes to inflammatory cell recruitment in vitro
and in vivo.
[0052] FIG. 3A Treatment of WT (wild type) mice (n=6 per group)
with the specific peptide inhibitor cM7 inhibited the recruitment
of thioglycollate-elicited leukocytes to the peritoneal cavity,
compared with an unspecific peptide control, scM7, or a saline
injection. Treatment with peptides had no effect in CD40L.sup.-/-
mice (n=6 per group).
[0053] FIG. 3B Mac-1-expressing CHO cells were allowed to adhere on
TNF-.alpha.-primed human umbilical vein endothelial cells (HUVECs),
while both cell types were selectively blocked with antibodies
against Mac-1, CD40L, or LFA-1.
[0054] FIG. 3C Anti-CD40OL antibody blocked dynamic adhesion of
human monocytes to HUVECs comparable to anti-ICAM-1 or anti-Mac-1
(n.gtoreq.4).
[0055] FIG. 3D Mac-1-CHO-cells adhered to immobilized CD40L
preferably under flow conditions compared with fibrinogen.
[0056] FIG. 3E, FIG. 3F, FIG. 3G Numbers of adhering and rolling
murine leukocytes decreased when interacting with CD40L-deficient
endothelial cells (ECs), compared with wild-type ECs (n=5 per
group). The mean leukocyte rolling velocity increased on
CD40L-deficient ECs.
[0057] FIG. 3H CD40L deficiency did not regulate surface expression
of the adhesion molecules ICAM-1, ICAM-2, VCAM-1, or P-selectin.
FIG. 3I In intravital microscopy,
[0058] adhesion FIG. 3J and
[0059] rolling FIG. 3K of leukocytes in TNF.alpha.-challenged mice
were blocked by an intraperitoneal injection of cM7 (n=10), but not
of scM7 (n=9) or saline (n=12).
[0060] FIG. 3L Injected intravenously, cM7 directly blocked
leukocyte rolling in intravital microscopy. Data are presented as
mean.+-.SEM. Scale bar 20 .mu.m FIG. 3I.
[0061] FIG. 4A to FIG. 4I show that specific blockade of the
CD40L/Mac-1 interaction attenuates atherosclerosis in mice. LDLr-/-
mice consumed a high-cholesterol diet for 20 weeks. Mice were
injected with the specific inhibitor of the CD40L/Mac-1
interaction, cM7 (n=13), an unspecific peptide control, scM7
(n=12), or saline (n=12), three times a week.
[0062] FIG. 4A cM7 significantly reduced the intimal lesion area in
aortic roots compared with scM7 or the peptide control.
[0063] FIG. 4B Lipid deposition in the abdominal aorta was reduced
by cM7 treatment.
[0064] FIG. 4C Lipid content in aortic roots, as assessed by
quantification of Oil-red-O-positive area, was reduced in
cM7-treated animals, compared with controls.
[0065] The numbers of macrophages FIG. 4D and
[0066] smooth-muscle cells FIG. 4E within the atherosclerotic
plaque, as well as the content of collagen FIG. 4F, were quantified
by immunohistochemistry.
[0067] FIG. 4G Relative distribution of stable and unstable
collagen fibers was determined by polarizing microscopy using
picrosirius-red staining. cM7-treated animals exhibited a
significantly higher percentage of red-polarizing, stable collagen
fibers, compared with scM7-treated and saline-treated mice
(p=0.0081 vs. saline, p=0.0140 vs. scM7; n.gtoreq.9 per group).
[0068] FIG. 4H T-cell content and the proliferation marker Ki-67
FIG. 4I were quantified in atherosclerotic sections. Data are
presented as mean.+-.SEM, representative images for Oil red O-FIG.
4B, Mac-3-FIG. 4C, .alpha.-actin-FIG. 4E and picrosirius-red FIG.
4F-specific staining, as well as representative en face aortas
stained for Oil red O, shown on the right. Scale bar 1000 .mu.m
(FIG. 4A, FIG. 4B), 200 .mu.m (FIG. 4C, FIG. 4E, FIG. 4F).
[0069] FIG. 5A to FIG. 5C: Bacterial expression of recombinant
variants of the Mac-1 I-domain and CD40L. FIG. 5A The human Mac-1
amino residues R.sup.115 to S.sup.340, coding for the .alpha..sub.M
I-domain, were produced as soluble His-tag fusion protein
(.about.28 kDa) in a bacterial expression system and purified by
immobilized metal affinity chromatography (IMAC). FIG. 5B
Contaminating bacterial proteins were further removed by
anion-exchange chromatography and increasing concentrations of
sodium chloride. Elution fractions containing the isolated I-domain
as assessed by Coomassie stains were pooled and dialyzed against
PBS. FIG. 5C The TNF homologous region of human CD40L (E.sup.108 to
L.sup.261) was produced as c-myc-and His-tag-fusion protein. The
protein (.about.19 kDa) was extracted from insoluble inclusion
bodies, purified by IMAC and refolded by subsequent dialysis
against PBS. The purity of both protein preparation was>95% as
assessed by SDS-polyacrylamide gel. (W) washing fractions, (FT)
column flow through, (E) elution fractions, (M) protein size
marker.
[0070] FIG. 6A to FIG. 6D: Peptide treatment with cM7 did not cause
cellular apoptosis and cytotoxicity in vitro and in vivo. (FIG. 6A,
FIG. 6B) Macrophages recruited to the peritoneal cavity by
thioglycollate where challenged by intraperitoneal injections of
either cM7, scM7 or the blocking anti-Mac-1 antibody M1/70. After 4
hours, peritoneal exudates cells were harvested and quantified for
annexin V binding and propidium iodide loading. cM7 did not cause
an increase of apoptotic or necrotic cells in vivo compared with
scM7, whereas the antibody treatment resulted in a significant
higher percentage of cellular apoptosis and necrosis in peritoneal
macrophages. (FIG. 4C, FIG. 4D) In vitro cultivated human umbilical
vein endothelial cells (HUVECs) were incubated with cM7, scM7 or a
combination of CD40L or a blocking anti-CD40 antibody. As assessed
by caspase 3/7-activity, peptide treatment for 24 hours did not
induce cellular cytotoxicity.
[0071] Apoptosis of endothelial cells, as determined by
LDH-release, as slightly increased in CD40L primed HUVECs when
incubated with cM7. Data are presented as mean.+-.SEM of at least 3
independent experiments.
[0072] FIG. 7A to FIG. 7C: A monoclonal antibody specifically
recognizing the CD40L binding site on the Mac-1 I-domain modulates
leukocyte recruitment in vitro. Mice were immunized with the linear
peptide V.sup.160-S.sup.172. FIG. 7A Clone RC3 specifically bound
to the immobilized peptide M7, but not to the scrambled version sM7
or the Mac-1 I-domain fragment M8. FIG. 7B Anti-M7 blocked adhesion
of Mac-1 expressing CHO cells to immobilized CD40L comparable to
the pan I-domain blocking antibody clone 2LPM19c. CHO cells failed
to adhere on fibrinogen after pan I-domain blockade, but not after
blockade of the linear stretch V.sup.160-S.sup.172. FIG. 7C In a
dynamic flow chamber assay anti-M7 treatment blocked adhesion of
murine RAW246.7 cells to a confluent monolayer of activated
endothelial cells compared with the respective IgG-control. Data
are presented as mean.+-.SEM of at least 3 independent
experiments.
[0073] FIG. 8A to FIG. 8I show the effects of cM7-treatment on
basic inflammatory properties in vivo. C57/B6-mice were treated
with the specific inhibitor of CD40L/Mac-1 interaction, cM7, or
with the unspecific peptide control scM7 by intraperitoneal
injections. An inflammatory state was induced by injection of
TNF-.alpha.. (FIG. 8A, FIG. 8B, FIG. 8C).
[0074] In an acute model of inflammation (cytokine challenge by
TNF.alpha.) the compound of the present invention reduced levels of
the chemokines CXCL-1 (=MCP-1) and RANTES, both implicated with
inflammatory cells resulting in inflammatory diseases including
atherosclerosis. On the other hand the more anti-inflammatory TH2
cytokine IL-10 tended to be elevated. An acute model was chosen
since cytokine levels in atherosclerotic mice are hardly
systemically regulated. Plasma levels of chemokines CXCL-1 and
RANTES shifted towards a less inflammatory state, whereas
protective IL-10 plasma levels tended to increase in cM7-treated
mice. (FIG. 8D, FIG. 8E, FIG. 8F) Activation of leukocyte subsets
was evaluated by quantifying the surface expression of the adhesion
molecules ICAM-1, -2, and (CD26L) L-Selectin in flow cytometry.
TNF-.alpha. induced recruitment of monocytes FIG. 8G, neutrophils
FIG. 8H and Gr-1-positive inflammatory monocytes FIG. 8I was
determined in both groups. Data are presented as mean.+-.SEM of 8
animals per group.
[0075] FIG. 9A to FIG. 9J: Effects of long-term peptide treatment
on immunological properties in vivo. LDLR.sup.-/- mice consumed a
high cholesterol diet and were injected with the peptide inhibitor
cM7, the control peptide scM7, or saline three times a week for a
total period of 20 weeks. (FIG. 9A, FIG. 9B, FIG. 9C, FIG. 9D, FIG.
9E, FIG. 9F) Levels of plasma cytokines IL-6, IL-1, IL-12,
TNF-.alpha. and IFN-.gamma. were quantified by a cytometric bead
assay. T-cell subpopulations (FIG. 9G, FIG. 9H), B-cells FIG. 9I,
and Gr-1-positive inflammatory monocytes FIG. 9J were quantified by
flow cytometry.
[0076] FIG. 10A shows that treatment with an anti-CD40L blocking
antibody significantly prolonged tail vein bleeding time by
74.+-.12% (n.gtoreq.4p=0.04). Interestingly, selective blockade
with cM7 did not affect bleeding time, suggesting that CD40L-Mac-1
interaction is specific for CD40L's inflammatory pathways. FIG. 10B
shows that cM7 did not prolong vessel occlusion time in a model of
arterial thrombosis, whereas anti-CD40L and anti-CD40 treatment
impaired thrombus formation in mesenterial arterioles resulting in
a prolongation of the occlusion time by 113.+-.22% (n=5, p=0.005)
and 116.+-.22% (n=4, p=0.05), respectively. FIG. 10C and FIG. 10D
show that disruption of the CD40L-Mac-1 interaction by cM7 only
caused a slight increase in thromboembolization rate (n=5,
p=0.005). However, this was a negligible effect compared with
anti-CD40L and anti-CD40 treatment which increased embolization
rate by 339.+-.38% (n=6, p=0.001), and 173.+-.40% (n=3, p=0.008),
respectively. Interestingly, treatment with neutralizing anti-Mac-1
antibodies also increased the embolization rate--albeit mildly--by
131.+-.41% (n=4, p=0.03.)
EXAMPLE 1
[0077] Recombinant protein expression. Mac-1's I-domain was
produced as His-tag fusion protein by inserting the DNA-sequence
coding for the Mac-1 amino acids R.sup.115 to S.sup.340 in pET20b
(Novagen), and subsequent purification by Ni-NTA immobilized metal
affinity chromatography (Qiagen) and anion-exchange chromatography
using Q-Sepharose (GE Healthcare). CD40L was produced as His-and
c-myc-tag fusion protein by inserting the coding DNA for amino
acids E.sup.108 to L.sup.261 in pHOG-21.sup.34. CD40L was purified
by Ni-NTA immobilized metal affinity chromatography.
[0078] The Mac-1 I-domain was produced as fusion protein containing
an C-terminal His-tag by inserting the DNA-sequence coding for the
Mac-1 amino acids R.sup.115 to S.sup.340 in the expression vector
pET20b (Novagen) by a PCR-based strategy using the following
primers: 5'-AGAAGTTCCCAGAGGCCCT-3' (SEQ ID NO:4) and
5'-GAGTGCGGCCGCGGCAGCGCTGAAGCCTTCCTG-3' (SEQ ID NO:5). A CHO cell
line constitutively expressing the entire human Mac-1 .alpha.-chain
served as template. The resulting PCR-fragment was cloned in pGEMT
(Promega), released by Ncol and Notl (New England Biolabs) and
inserted into the Ncol-Notl-linearized pET20b. This expression
vector was transformed in BL-21 DE Star (Invitrogen) and expressed
by addition of 0.5 mM IPTG (Sigma). The protein was extracted by
BugBuster lysis (Novagen) and subsequently purified by Ni-NTA
immobilized metal affinity chromatography (Qiagen) in a standard
FPLC-system (GE Healthcare). After elution of the target protein by
250 nM imidiazol (Sigma) the fraction containing the Mac-1 I-domain
(.about.28 kDa) was dialyzed against 20 mM Tris-Cl, 20 mM NaCl, pH
8.0 and further purified by anion-exchange chromatography on a
Q-Sepharose-columns (GE Healthcare). CD40L was produced as fusion
protein containing a N-terminal His-and c-myc-tag, as well as a
trimerization domain.
[0079] The coding DNA sequence for amino acids E.sup.108 to
L.sup.26 were amplified by PCR using the following primers:
5'-CCTAGGCGGCCGCTATCAGAGTTTGAGTAAGCCAAAGGAC-3' (SEQ ID NO:6) and
5'-CTTCTAGAAAACAGCTTTGAAATGCAAAAAGA-3' (SEQ ID NO:7). A cDNA clone
coding for the human CD40L (Origene) served as template. The
His-and c-myc-tag were amplified by the following primers:
[0080] 5'-CCGGCCATGGCCGAACAAAAGCTGATCTCAGAAGAAG-3' (SEQ ID NO:8)
and 5'-TGAGGTACCTAGGTGATGGTGATGGTGATGTGAG-3' (SEQ ID NO:9). As
template for the trimerization domain served the primer 5'
ATGAAACAGATTGAAGATAAAATTGAAGAAATTCTGAGCAAAATTTATCATATTGA
AAACGAAATTGCGCGTATTAAAAAACTGATTGGAGAA-3' (SEQ ID NO:10). All PCR
fragments were cloned into pGEMT and released by Ncol, Kpnl
(His-and c-myc-Tag), Kpnl and Xbal (trimerization motif) and Xbal
and Notl (CD40L). Fragments were subsequently cloned into the
expression vector pHOG-21 (Schwarz et al., Circ.Res., 2006, p.
25-33) and transformed into TG-1 bacteria (Promega). CD40L was
expressed after induction with 1 mM IPTG. Proteins were extracted
as insoluble inclusion bodies, solubilized in 7 M Urea, 100 mM
NaH2PO4, 100 mM Tris-Cl, pH 8.0 and purified under denaturing
conditions by Ni-NTA immobilized metal affinity chromatography.
CD40L was refolded by dialysis against decreasing
Urea-concentrations. Both proteins were finally dialyzed against
PBS and stored at-80.degree. C. until further use. The purity of
both recombinant proteins was>90% as assessed by SDS gel
electrophoresis.
[0081] Because most of Mac-1's ligands--such as fibrinogen, ICAM-1,
GPIb.alpha., RAGE, C3bi, or heparin--bind to the Mac-1 I-domain, a
stretch of .about.200 amino acids within the .alpha..sub.M subunit
of the integrin (FIG. 1a), it was hypothesized that the I-domain
also serves as binding partner for CD40L. To test this hypothesis,
recombinant variants of the I-domain and CD40L were produced as
shown in FIG. 5.
[0082] In a solid phase binding assay, CD40L, either soluble or
immobilized, specifically bound to the isolated I-domain (FIG.
1b,c). A K.sub.d of .about.66 nM revealed a high-affinity
interaction comparable to the affinity of CD40L to
.alpha..sub.IIb.beta..sub.3 (.about.30 nM). To identify the binding
site used by CD40L, a peptide mapping strategy using linear
peptides M1-M8 was employed, originating from the hydrated surface
of the Mac-1 I-domain as shown in Table 1.
TABLE-US-00001 TABLE 1 Peptides used MW Peptide Sequence I-domain*
Structure (kDa) M1 PHDFRRMKEFVST P.sup.147-T.sup.159 linear 1.649
(SEQ ID NO: 11) M2 PITQLLGRTHTATGI P.sup.201-K.sup.217 linear 1.863
RK (SEQ ID NO: 12) M3 KFGDPLGYEDVIPEA K.sup.245-R.sup.261 linear
1.921 DR (SEQ ID NO: 13) M4 DAFRSEKSRQELNTI D.sup.273-I.sup.287
linear 1.793 (SEQ ID NO: 14) M5 FQVNNFEALKT F.sup.297-T.sup.307
linear 1.310 (SEQ ID NO: 15) M6 QNNPNPRS Q.sup.190-S.sup.197 linear
0.925 (SEQ ID NO: 16) M7 EQLKKSKTL E.sup.162-L.sup.170 linear 1.074
(SEQ ID NO: 1) M8 EEFRIHFT E.sup.178-T.sup.188 linear 1.078 (SEQ ID
NO: 17) sM7 KLSLEKQTK n/a linear 1.074 (SEQ ID NO: 18) cM7
C-EQLKKSKTL-C E.sup.162-L.sup.170 cyclic 1.280 (SEQ ID NO: 1) scM7
C-KLSLEKQTK-C n/a cyclic 1.280 (SEQ ID NO:18) FITC- C-EQLKKSKTL-C
E.sup.162-L.sup.170 cyclic, 1.638 cM7 (SEQ ID NO: 1) FITC
*indicates the stretch of the Mac-1 I-domain the peptide
corresponds to.
[0083] In an initial solid phase binding assay evaluating the
binding of the isolated Mac-1 I-domain to immobilized CD40L, the
Mac-1 fragments M3, M4, M5, and M7 emerged as potential candidate
inhibitors (FIG. 1f). In the more physiological setting with the
entire Mac-1 protein in a cell membrane environment, M7 most
efficiently blocked adhesion of THP-1 cells to CD40L. The extent of
inhibition resembled that of a pan I-domain blocking antibody (FIG.
1g). Moreover, M7 was the only peptide blocking binding of CD40L to
human granulocytes and monocytes in flow cytometry (FIG. 1h).
Finally, M7 mediated direct binding to CD40L in a solid phase
binding assay (FIG. 1i), and neutralized binding of CD40L to
chinese hamster ovarian cells expressing constitutively activated
Mac-1 (Mac-1-CHO) (FIG. 1j). M7 concentration dependently blocked
the binding of CD40L to the I-domain with an IC.sub.50 of .about.4
.mu.M (FIG. 2a).
[0084] Interestingly, the stretch of amino residues within the
Mac-1 I-domain corresponding to the peptide M7,
E.sup.162-L.sup.170, resides on an exposed loop between the
.alpha.1 helix and .beta.-sheet B in the tertiary structure, and
has not been implicated in binding of the alternative Mac-1 ligands
GPIb.alpha., NIF, C3bi, ICAM-1, or fibrinogen. This suggests a
distinct binding site for CD40L, and thus the potential to block
this interaction selectively. We modified peptide M7 by adding two
flanking cysteine residues and subsequent cyclization (cM7) to
augment plasma stability in vivo. A scrambled peptide, scM7, served
as control (see Table 1). To assess specificity of this peptide
inhibitor, the adhesion of Mac-1-CHO cells to different Mac-1
ligands in the flow chamber was tested. While cM7 potently blocked
cellular adhesion to CD40L (FIG. 2b), it did not affect adhesion to
ICAM-1 and GPIb.alpha. (FIG. 2c,d). In contrast, M2--but not
M7--blocked the interaction between Mac-1 and GPIb.alpha., as
previously described, while not affecting CD40L-Mac-1 binding.
Moreover, cM7 did not alter binding of CD40 to CD40L (FIG. 2e).
Also, cM7-treatment did not induce apoptosis or cytotoxicity in
vitro and in vivo, suggesting good tolerability of these agents as
shown in FIG. 6.
[0085] To provide further evidence on the specific importance of
the region E.sub.162-L.sup.170 for CD40L/Mac-1 binding, a
monoclonal antibody against the peptide V.sup.160-S.sup.172, termed
anti-M7 was raised. An antibody specific to a peptide corresponding
to the human Mac-1 I-domain sequence V160-S172 (termed anti-M7) was
obtained by immunizing mice with the peptide C-VMEQLKKSKTLFS-NH2
(SEQ ID NO:3) coupled to diphtheria toxoid (Monash Antibody
Technologies Facility, Monash University, Melbourne, Australia).
Solid phase assays demonstrated high anti-sera binding to
immobilized peptide M7. This antibody specifically bound to M7, but
not to the scrambled version sM7 or M8, another Mac-1 fragment of
similar length. Anti-M7 blocked the adhesion of Mac-1-CHO cells to
immobilized CD40L, but not to fibrinogen (FIG. 7).
[0086] Furthermore, FITC-labeled cM7 concentration-dependently
bound to murine fibroblasts over-expressing CD40L, but not to
respective mock-transfected control cells (FIG. 2f).
EXAMPLE 2
[0087] Solid phase binding assay. Recombinant CD40L was incubated
with immobilized Mac-1 I-domain in the presence or absence of
blocking peptides. Binding of sCD40L was detected by addition of
anti-cmyc-HRP (Invitrogen), TMB-substrate (Pierce), and
colorimetric reaction. Alternatively, CD40L (Provitro) was
immobilized, and binding of the recombinant Mac-1 I-domain was
quantified by addition of anti-His-Biotin (Qiagen), and HRP-coupled
streptavidin (Pierce). For the binding to immobilized peptides,
CD40L was biotinylated with the Micro Biotinylation Kit (Sigma). A
mixture of equal molarities of all peptides served as the positive
control in this assay.
[0088] The recombinant Mac-1 I-domain was immobilized in 96-well
plates (Nunc) in PBS at 4.degree. C. overnight. After blocking in
2% BSA/PBS and subsequent washing with PBS, recombinant CD40L was
added to the wells in the indicated concentrations and incubated
for 2 hours at 37.degree. C. Effect of the peptides M1-M8 was
assessed by incubating CD40L (10 .mu.g/ml) in the presence of
peptides (50 .mu.M). After removing of unbound CD40L by washing
with 0.1% Tween-20/PBS, anti-c-myc-HRP (Invitrogen) was added and
incubated for 2 hours at room temperature. Binding was quantified
by addition of TMB-substrate (Pierce), colorimetric reaction at 450
nm. Alternatively, CD40L without a His-tag (Provitro) was
immobilized and blocked as described above. Binding of the
recombinant Mac-1 I-domain was quantified by addition of
anti-His-Biotin monoclonal antibody (Qiagen), HRP-coupled
streptavidin (Pierce) and colorimetric reaction at 450 nm. For the
specific binding of the Mac-1 I-domain BSA-coated wells were
subtracted from the CD40L-coated. K.sub.d was estimated using a
one-site binding hyperbola nonlinear regression model with the
Software Prism (Graphpad). For quantification of the binding of
CD40L to peptides, peptides were immobilized in 96-well plates
overnight at 4.degree. C. in 50 mM sodium carbonate, pH 10.6. CD40L
was biotinylated using the Micro-Biotinylation-Kit (Sigma)
following the manufacturer's instructions and detected by
HRP-coupled streptavidin (Pierce) and colorimetric reaction. A
mixture of equal molarities of all peptides served as positive
control. Absorbance on BSA-coated wells served as negative control
and was subtracted.
EXAMPLE 3
[0089] 3.1 Dynamic and static adhesion assays. 96-well plates
(Nunc) were coated with sCD40L and incubated with CHO cells
expressing constitutively activated Mac-1, as described previously,
or THP-1 cells. Cells were allowed to adhere for 20 to 50 minutes.
Blocking antibodies (10 .mu.g/ml) were pre-incubating with the
cells. As indicated, assays were carried out in the presence of
peptides (50 .mu.M). Permeabilization buffer (6 mg/ml phosphatase
substrate (Sigma), 1% Triton X-100, 50 mM sodium acetate, pH 5.5)
was added to quantify adhering cells by colorimetric reaction.
Alternatively, adhering cells were counted. Murine EC were isolated
as previously described. Mac-1 expressing CHO were loaded with
CFDA-SE (Invitrogen), allowed to adhere for 45 minutes, and
quantified under the fluorescence microscope. For dynamic adhesion
assays, 35-mm dishes were coated with 1% BSA, or CD40L, GPlba
(Abnova), fibrinogen (Sigma), or ICAM-1 (R&D systems). Adhering
and rolling cells were quantified in a parallel flow chamber system
(Glycotech) at the indicated shear rates and in the presence of the
indicated peptides (1 .mu.M) or antibodies (10 .mu.g/ml).
Alternatively, adhesion and rolling of peritoneal exudate cells on
isolated murine endothelial cells were observed.
[0090] 3.2 Static adhesion assays. 96-well plates (Nunc) were
coated with sCD40L (10 .mu.g/ml) in PBS overnight at 4.degree. C.
After removal of unbound CD40L by washing with PBS, plates were
blocked with 0.1% agarose for 1 hour at room temperature and washed
with PBS. Blocking antibodies against CD40L (10 .mu.g/ml) were
given to the wells as indicated and incubated for 15 min at room
temperature, followed by subsequent washing with PBS. CHO cells
expressing constitutively activated Mac-1.sup.4 or THP-1 cells were
pre-incubated with function blocking antibodies against CD11 b or
CD11 a (10 .mu.g/ml) for 15 min at room temperature.
5.times.10.sup.4 cells/well were allowed to adhere for 20 to 50 min
at 37.degree. C. As indicated, static adhesion assays were carried
out in the presence of peptides at a concentration of 50 .mu.M.
After removal of unbound cells by washing with PBS,
permeabilization buffer (6 mg/ml phosphatase substrate (Sigma), 1%
Triton X-100, 50 mM sodium acetate, pH 5.5) was added for 1 hour at
37.degree. C. and adhering cells were quantified by colorimetric
reaction at 405 nm. Alternatively, adhering cells were counted
under the microscope (Zeiss). Alternatively, human umbilical vein
endothelial cells (HUVECs) were stimulated with 50 ng/ml
TNF-.alpha. prior to the experiment. Mac-1 expressing CHO were
loaded with carboxyfluorescein diacetate succinimidyl ester (CFDA,
Invitrogen) according to the manufacturer's protocol. HUVECs or
CHO-cells were selectively incubated with blocking antibodies (10
.mu.g/ml) as indicated, washed and cells were allowed to adhere on
HUVECs for 35 min at 37.degree. C. After removal of unbound cells
by washing with PBS adhering cells were counted under the
fluorescence microscope.
EXAMPLE 4
[0091] 4.1 Flow cytometry. Flow cytometric analysis, platelet
activation assays, and quantification of leukocyte-platelet
aggregates, were performed as previously described (Zirlik et al.,
2007). Binding of cM7 to CD40L-expressing murine fibroblasts was
determined by quantification of FITC-coupled cM7. Binding of CD40L
to Mac-1 expressing CHO-cells or human leukocytes was performed by
incubation with CD40L (10 .mu.g/ml) and subsequent detection with
anti-PentaHis antibody (Qiagen).
[0092] 4.2 Laminar flow chamber assay. For dynamic adhesion assays,
35 mm dishes were coated overnight at 4.degree. C. with 1% BSA,
CD40L, GPlb.alpha. (Abnova), ICAM-1 (R&D systems) or fibrinogen
(Sigma), at a concentration of 10 .mu.g/ml, and 30 .mu.g/ml,
respectively. Adhesion and rolling of Mac-1 expressing CHO-cells
was tested in a parallel flow chamber system (Glycotech) using
increasing flow rates from 0.5 dyne/cm.sup.2 (venous flow) up to 15
dyne/cm.sup.2 (arterial flow). Cells were quantified under the
microscope (Olympus). As indicated, effects of inhibitors were
tested at the indicated shear rates and in the presence of the
indicated peptides (1 .mu.M) or antibodies (10 .mu.g/mI).
Alternatively, murine endothelial cells were isolated and
TNF-.alpha. stimulated as described above. Adhesion and rolling of
peritoneal exudate cells on isolated murine endothelial cells was
quantified as described above. Rolling velocity was computed
employing Image Pro cell tracking tool (Media Cybernetics)
[0093] 4.3 Flow cytometry. Flow cytometric analyses, as well as
platelet activation assays and quantification of leukocyte-platelet
aggregates were performed as previously described (Quezada et al.,
Ann. Rev. Immunol. (2004), pp 307-328). Briefly, murine blood
samples were taken by intracardiac puncture. Red cells were lyzed
in 155 mM NH.sub.4Cl, 5.7 mM K.sub.2HPO.sub.4, 0.1 mM EDTA, pH 7.3.
Leukocytes were resuspendet in 0.1% BSA/PBS and Fc-Receptors were
blocked by anti-CD16/CD32 antibodies (Ebioscience). Antibodies for
epitope specific fluorescence-activated cell sorting (FACS Calibur,
BD) included anti-CD11 b, anti-CD115, anti-Gr-1, anti-CD4,
anti-CD8, anti-CD20, anti-CD41, anti-CD62P, anti-CD54, anti-CD102,
and anti-CD106 (all from Ebioscience). Binding of cM7 to CD40L-or
mock-transfected murine fibroblasts was determined by incubation of
FITC-cM7 at the indicated concentrations with cells for 30 min at
37.degree. C. and subsequent quantification of the fluorescence in
the FL-1 channel. Binding of CD40L to Mac-1 expressing CHO-cells or
human leukocytes was performed by incubation of the with the
His-tag-CD40L fusion protein (10 .mu.g/ml) for 30 min at 37.degree.
C. in PBS+Ca.sup.2+/Mg.sup.2+ and subsequent detection with
Alexa488-labeled anti-PentaHis (Qiagen). Human monocytes and
granulocytes were gated based on their properties in the
forward-and sideward scatter. For the analysis of the endothelial
expression of adhesion molecules, cells were TNF-.alpha. stimulated
for 24 hours, detached using accutase (Sigma) and incubated with
fluorochrome-coupled antibodies.
EXAMPLE 5
[0094] Cytokine challenge. 8 weeks old C57BL/6J mice received an
intraperitoneal injection of 200 ng of murine TNF-.alpha. (R&D
systems) and 100 .mu.g either of the peptides cM7, scM7 or an equal
volume of sterile saline. After 5 hours mice were euthanized with
CO.sub.2. The peritoneal cavity was flushed with 2 ml PBS and
supernatant was screened for cytokines. Blood was collected by an
intracardial puncture. Plasma concentrations of IL-6, IL-10,
IL-12p70, TNF-.alpha., IFN-.gamma., MCP-1, KC, and RANTES were
determined by the Cytometric Bead Array (CBA, BD Biosciences)
according to the manufacturer's instructions. Activation of
peripheral leukocytes and platelets was assessed by flow cytometry
as described above.
EXAMPLE 6
[0095] Oxidative stress assay. Murine leukocytes were pre-incubated
with Dihydrorhodamine (Invitrogen) according to the manufacturer's
instructions and formation of reactive oxidative stress was
monitored by flow cytometry.
EXAMPLE 8
[0096] Murine Peritonis model. WT or CD40L.sup.-/- mice (Jackson
Laboratories) received an injection of 2 ml of 4% thioglycollate
broth (Sigma). A peritoneal lavage was performed after 15 hours by
flushing the peritoneal cavity with PBS. Peritoneal exudate cells
(PECs) were quantified after red cell lysis.
EXAMPLE 9
[0097] Intravital microscopy. Mice received an intraperitoneal
injection 5 hours before surgery of 200 ng of murine TNF.alpha.
(R&D systems) and 100 .mu.g of peptides dissolved in sterile
saline 5 hours before surgery. Mice were anesthetized with an
intraperitoneal injection of ketamine hydrochloride (Essex) and
xylazin (Bayer) at a dose at 187.5 mg/kg of body weight and 62.5
mg/kg of body weight, respectively. The cremaster muscle was
exteriorized as described previously (lezzi et al., PNAS (2009), pp
876-881). For some experiments a catheter was placed in the jugular
vein and peptides were administered during microscopy. The
cremaster was superfused with thermo-controlled (36.degree. C.)
saline. Mice were placed on a heating pad to maintain body
temperature. Videos were taken with an intravital microscope
(AxioScope Vario, Carl Zeiss) fitted with a saline immersion
objective (WPlan-APOCHROMAT 20.times./1,0DIC IR, Carl Zeiss) a high
sensitivity camera system (AxioCam MRm, Carl Zeiss) for 30 seconds
each. Rolling leukocyte flux was defined as the number of
leukocytes moving at a velocity less than erythrocytes. Leukocyte
rolling velocity was measured by the average time required for
leukocytes to roll over a defined length of the venule at each time
point. Adherent leukocytes were defined as cells that remained
stationary for at least 30 s. Rolling leukocyte flux, adhering flux
were quantified by a blinded investigator.
EXAMPLE 10
[0098] Atherogenesis study. Eight-week-old male
LDL-receptor--deficient (LDLr.sup.-/-) mice (Jackson Laboratories)
consuming a high-cholesterol diet (HCD) were treated with
intraperitoneal injections of the peptides cM7, scM7 (Peptide
Specialty Laboratory) in a dose of 100 .mu.g, or sterile saline
three times a week. After 20 weeks blood samples were taken for
flow cytometric analysis of leukocyte subpopulations, cholesterol
and triglyceride plasma levels, as well as for the determination of
plasma cytokines and chemokines. Blood pressure was determined by a
non-invasive blood pressure measurement (NIBP, Harvard Apparatus).
Mice were euthanized, and aortic roots and arches were frozen in
OCT (OCT compound; Tissue-Tek). Thoracic and abdominal aortas were
fixed in 10% buffered formalin. Serial cryostat sections (6 .mu.m)
of mouse aortic tissues were fixed in acetone, and air-dried.
Nonspecific binding was blocked with 5% species-appropriate normal
serum (Vector Laboratories). Sections were then incubated with
primary antibodies diluted in phosphate-buffered saline,
supplemented with 5% species-appropriate normal serum. Incubation
with secondary antibodies was followed by avidin-biotin complex
(ABC, Vector Laboratories). Antibody binding was visualized with
3-amino-9-ethylcarbazole (AEC; Dako), followed by counterstaining
with Gill's hematoxylin solution (Sigma-Aldrich). Control stainings
included staining with the respective IgG isotypes (Pharmingen,
Dako). Antibodies used were rat anti-mouse Mac-3 for macrophage
specific staining, anti a-actin for smooth muscle cell specific
staining (Dako). For the visualization of Type I Collagen,
Formalin-fixed frozen sections were incubated for 4 hours in a
freshly prepared 0.1% solution of picrosirius red (Polysciences) in
saturated aqueous picric acid. After rinsing in 0.01 N HCl and
distilled water, sections were dehydrated in 70% ethanol and
mounted in Permount (Vector Laboratories). Picrosirius red staining
was analyzed by polarization microscopy. As the color of collagen
fibers assessed in the picrosirius red staining depends on the
thickness of collagen fibers and changes from green (thin fibers)
to yellow, orange, and red (thick fibers), color distribution in
stained collagen sections was quantified. Deposition of lipids was
determined by oil red O staining after formalin fixation in aortic
sections or in en face preparations of the abdominal aorta. To
quantify the composition of the aortic lesions, sections of the
aortic tissue were analyzed microscopically in all mice. Within the
aortic root, lesion areas were analyzed in cross-sections obtained
at the level of all 3 leaflets of the aortic valve, immediately
proximal to the right coronary artery ostium. The total aortic wall
area, lesion area in the aortic root, and the percentage of area
stained for macrophages, lipids, SMCs, or collagen were determined
via computer-assisted image quantification (ImagePro, Media
Cybernetics).
EXAMPLE 11
[0099] 11.1 Pharmakokinetics of the peptide inhibitor. C57BL/6J
mice were injected intraperitoneal with FITC-labeled cM7.
Fluorescence in Plasma samples was measured at the indicated time
points in Fluorescence Plate Reader (Spectramax). CM7-FITC diluted
in plasma samples served as standard.
[0100] 11.2 Structural modeling. Mac-1 I-domain structure was
visualized using Sirius visualization system 1.2 (San Diego
Supercomputer Center) and a crystallographic dataset for the Mac-1
I-domain (PDB ID: 1NA5).
[0101] 11.3 Antibodies and peptides. Epitope-specific antibodies
were purchased as follows: anti-human CD11b, clone 2LPM19c (Santa
Cruz Biotechnology); anti-human CD11b, clone ICRF44 (Biolegend);
anti-human CD11a, clone HI111 (Biolegend); anti-human CD40L, clone
24-31 (Calbiochem); anti-human CD40L, clone 40804 (R&D
systems); anti-human ICAM-1, clone BBIG-11 (R&D systems).
Peptides were synthesized from Peptide Specialty Laboratories
(Heidelberg), purified by HPLC, and cyclisized, if applicable.
Molecular mass was determined by mass spectrometry. Peptides had a
purity >95%.
[0102] 11.4 Cell culture. Human umbilical vein endothelial cells
(HUVECs) were purchased from Lonza and grown in M199, 20% fetal
calf serum (FCS), 1% Penicillin/Streptomycin, 0,1% Fungizone, 1%
non-essential amino acids (NEAA), 1% Na-Pyruvat, 1% Heparin, 1%
ECGS. Monocytic THP-1 were cultured in RPMI 1640, 1%
Penicillin/Streptomycin, 10% FCS, 0.05 mM 2-Mercaptoethanol. CHO
cells expressing constitutively activated Mac-1 have been described
previously' and were cultured in DMEM, 1% Penicillin/Streptomycin,
10% FCS, 1% NEAA, 1% L-Glutamin, 125 pg/ml Zeocin, 70 .mu.g/ml
Geniticin. CD40L-and mock-transfected murine fibroblasts were a
gift from Dr. K. Zirlik (University of Freiburg, Department for
Hematology, Freiburg, Germany) and were cultured in DMEM, 1%
Penicillin/Streptomycin, 10% FCS, 1% NEAA, 1% L-glutamin, 125
.mu.g/ml.
[0103] 11.5 Isolation of murine endothelial cells. For isolation of
murine endothelial cells corresponding wildtype or CD40L.sup.-/-
mice (all C57BL/6J) were euthanized with CO.sub.2, and lungs,
heart, brain, and liver were harvested employing sterile
techniques, minced with a razor blade, and digested in 0.2%
collagenase type-1/1% BSA (Worthington, Lakewood, N.J. and Sigma,
St. Louis, Mo.) for 90 min at 37.degree. C. After washing with 0.1%
BSA and filtering through a 70 .mu.m nylon mesh, cells were
resuspended in 0.1% BSA and incubated with an anti-mouse CD31
antibody conjugated to sheep anti-rat Dynabeads (Dynal Biotech,
Oslo, Norway) for 10 min at room temperature. Cells were then
separated and washed three times using a magnetic particle
concentrator (Dynal Biotech) and seeded into gelatin-coated plates.
After they reached confluence, a second magnetic sorting was
performed with a rat anti-mouse ICAM-2 antibody (BD Pharmingen).
Cells were grown in DMEM high glucose supplemented with 20% fetal
bovine serum (FBS), 1% sodium pyruvate, 1% heparin, 1% bovine
endothelial growth factor, 0.6% NEAA, and 1%
penicillin/streptomycin. Cells were maintained in M-199
supplemented with 0.1% FBS 24 h prior to experiments.
12. RESULTS OF THE EXAMPLES
[0104] The results of the above-described experiments are
summarized and shown in the figures and explained in the legend to
the figures and furthermore below:
[0105] Therapeutic application of peptides in vivo requires
adequate plasma availability. Following intraperitoneal injection,
cM7 persisted in plasma between 30 minutes and 4 hours (FIG. 2g).
It was tested whether the peptide inhibitor effectively modulated
inflammatory functions in vivo. Upon treatment with cM7, mice
challenged with TNF.alpha. intraperitoneally expressed lower plasma
levels of MCP-1, and by tendency also of CXCL-1 and RANTES, while
IL-10 levels increased both in plasma and in peritoneal fluid (FIG.
2h,i; FIG. 8 a-c). Treatment with cM7 also attenuated
TNF.alpha.-induced granulocytic oxidative burst (FIG. 2j) and
reduced platelet L-selectin expression, as well as aggregates of
granulocytes/monocytes and platelets (FIG. 2k,I), demonstrating
various anti-inflammatory properties of the agent of the present
invention.
[0106] Because Mac-1 classically functions as an adhesion factor in
inflammatory diseases, it was hypothesized that cM7 may limit
inflammatory cell recruitment. Indeed, cM7 potently decreased
thioglycollate-elicited peritoneal cell accumulation in wild-type
mice, but not in CD40L.sup.-/- mice (FIG. 3a). Mechanistically,
adhesion of Mac-1-CHO and human endothelial cells could be
abrogated by selective blockade of CD40L on EC or Mac-1 on CHO
cells, but not vice versa, rendering the interaction between
endothelial CD40L and leukocyte Mac-1 the most likely target for
our peptide.
[0107] Anti-CD40L treatment blocked adhesion to the same extent as
did treatment with anti-ICAM-1 or anti-Mac-1 (FIG. 3c). CD40L,
unlike fibrinogen, preferably bound cells under physiological flow
(FIG. 3d). Accordingly, CD40L-deficient EC were highly impaired in
recruiting murine leukocytes in the flow chamber (FIG. 3e-g), an
effect not caused by an altered expression of adhesion molecules
(FIG. 3h). Similarly, anti-M7 prevented leukocyte adhesion to
activated EC (FIG. 7).
[0108] Finally, intraperitoneal injection of cM7 potently reduced
rolling and firm adhesion in cremaster vessels of mice challenged
with TNF.alpha. (FIG. 3i-k), while blood pressure, leukocyte, or
platelet counts did not change (see Table 2).
TABLE-US-00002 TABLE 2 Intravital Microscopy Study Characteristics
saline p.sup.1 cM7 p.sup.2 scM7 p.sup.3 Mice (n) 12 n/a 10 n/a 9
n/a Venules (n) 93 n/a 87 n/a 66 n/a Diameter of 41.3 .+-. 16.7
0.08 37.0 .+-. 15.8 0.74 37.4 .+-. 15.3 0.21 venules (.mu.m)
Systolic blood 104.0 .+-. 12.7 0.17 97.6 .+-. 6.5 0.71 99.5 .+-.
14.3 0.46 pressure (mmHg) Heart rate (bpm) 653 .+-. 58 0.34 628
.+-. 63 0.24 659 .+-. 47 0.80 Leukocytes 11.9 .+-. 2.5 1.0 11.9
.+-. 2.3 0.44 13.0 .+-. 3.3 0.42 (.times.1000/.mu.l) Platelets 666
.+-. 150 0.12 552 .+-. 174 0.5 600 .+-. 98 0.28 (.times.1000/.mu.l)
Data are expressed as mean .+-. SD. .sup.1p-value saline vs. sM7,
.sup.2p-value cM7 vs. scM7, .sup.3p-value scM7 vs. saline.
[0109] Similar data were obtained when cM7 was injected
intravenously (FIG. 3I).
[0110] Collectively, these data identify CD40L/Mac-1 interaction as
a powerful regulator of leukocyte recruitment in vivo susceptible
to effective and specific targeting by cM7.
[0111] The recruitment of monocytes contributes critically to the
initiation and progression of most chronic inflammatory diseases.
It was therefore tested whether the peptide inhibitor could
mitigate atherosclerosis in vivo in mice. LDLr.sup.-/- mice
consuming a high-cholesterol diet for 20 weeks developed
significantly smaller lesions both in the aortic sinus and
abdominal aorta when treated with cM7 (FIG. 4a, 4b). Beyond a mere
reduction in size, atherosclerotic plaques from cM7-treated animals
contained significantly fewer macrophages and lower lipid
accumulation, while smooth-muscle cells increased (FIG. 4c-e).
Collagen content increased in plaques of both the treatment group
and the control group (FIG. 4f), but consisted of a higher
percentage of stable, large collagen fibers in that of cM7-treated
animals (FIG. 4g). This result shows that genetic or therapeutic
inhibition of CD40L attenuates atherosclerotic lesion formation and
remodels the plaque toward a morphology with more characteristics
of stability. Any changes in immunologic characteristics were not
observed--such as numbers of T cells, B cells, or
cytokines--indicating a Th1-/Th-2 phenotype--such as IL-10, IL-12,
or INF.gamma.--upon long-term treatment with cM7 (FIG. 9).
[0112] Lipid levels, weight, leukocyte subsets, blood pressure,
cytokine levels, and chemokine levels remained unchanged (see Table
3).
TABLE-US-00003 TABLE 3 Atherosclerosis Study Characteristics saline
p.sup.1 cM7 p.sup.2 scM7 p.sup.3 Weight (g) BF 23.8 .+-. 1.7 0.57
23.4 .+-. 2.3 0.23 24.2 .+-. 1.2 0.44 AF 36.4 .+-. 3.8 0.65 35.7
.+-. 3.8 0.74 35.3 .+-. 2.2 0.37 Cholesterol (mg/dl) AF 96.6 .+-.
29.7 0.63 91.5 .+-. 30.5 0.97 91.0 .+-. 33.6 0.65 Triglycerides
(mg/dl) AF 228 .+-. 97 0.18 277 .+-. 107 0.20 201 .+-. 190 0.63
Visceral fat pads (g) BF 2.3 .+-. 0.7 0.96 2.3 .+-. 0.7 0.81 2.2
.+-. 0.5 0.77 Systolic blood AF 103 .+-. 12 0.23 98 .+-. 7 0.79 97
.+-. 13 0.25 pressure (mmHg) Heart rate (bpm) AF 655 .+-. 54 0.44
638 .+-. 58 0.29 660 .+-. 42 0.80 Leukocytes BF 12.1 .+-. 2.8 0.41
11.2 .+-. 3.1 0.13 13.3 .+-. 3.9 0.35 (.times.1000/.mu.l) AF 5.23
.+-. 1.31 0.17 4.54 .+-. 1.28 0.90 4.62 .+-. 1.68 0.29 Platelets
(.times.1000/.mu.l) BF 557 .+-. 153 0.51 529 .+-. 53 0.25 562 .+-.
91 0.93 AF 663 .+-. 138 0.01 486 .+-. 198 0.30 556 .+-. 135 0.05
CD11b+ AF 16.8 .+-. 6.5 0.33 14.3 .+-. 4.4 0.68 13.4 .+-. 5.6 0.19
(% of leukocytes) Granulocytes AF 13.9 .+-. 4.3 0.60 13.0 .+-. 3.3
0.93 13.2 .+-. 4.8 0.70 (% of leukocytes) Monocytes AF 9.8 .+-. 3.6
0.06 7.2 .+-. 2.1 0.50 6.4 .+-. 3.1 0.03 (% of leukocytes) Datga
are expressed as mean .+-. SD. .sup.1p-value saline vs. sM7,
.sup.2p-value cM7 vs. scM7, .sup.3p-value scM7 vs. saline, AF:
after feeding, BF: before feeding.
EXAMPLE 12
[0113] Potential side effects were checked in an in vivo thrombosis
model. 3-4 weeks old C57BL/6J mice received an intraperitoneal
injection of either sterile saline (100 .mu.l), the peptides cM7,
scM7, or the indicated antibodies. A mesenteric arteriole was
chosen and injured with ferrichloride. Platelets were stained by
retroorbital injection of rhodamine 3G and visualized through an
intravital microscope (AxioScope Vario, Carl Zeiss). Vessel
occlusion time and thrombus embolization rate was analyzed. Tail
bleeding time was determined as previously reported (Andre et al.,
Loc.Cit.).
[0114] Haemostatic functioning of CD40L depends on interaction with
either CD40 or platelet integrin GPIlb/Illa (.alpha.IIb.beta.30)
(Andre et al. loc. cit). The inhibition of this interaction by
former therapeutic strategies employing antibodies neutralizing
total CD40L provoked thromboembolic complications. Thus, confirming
previous studies, treatment with an anti-CD40L blocking antibody
significantly prolonged tail vein bleeding time by 74.+-.12%
(n.gtoreq.4p=0.04) in our study. Interestingly, selective blockade
with cM7 did not affect bleeding time (FIG. 10A), suggesting that
CD40L-Mac-1 interaction is specific for CD40L's inflammatory
pathways. Accordingly, cM7 did not prolong vessel occlusion time in
a model of arterial thrombosis, whereas anti-CD40L and anti-CD40
treatment impaired thrombus formation in mesenterial arterioles
resulting in a prolongation of the occlusion time by 113.+-.22%
(n=5, p=0.005) and 116.+-.22% (n=4, p=0.05), respectively (FIG.
10B). Furthermore, disruption of the CD40L-Mac-1 interaction by cM7
only caused a slight increase in thromboembolization rate (n=5,
p=0.005). However, this was a negligible effect compared with
anti-CD40L and anti-CD40 treatment increasing embolization rate by
339.+-.38% (n=6, p=0.001), and 173.+-.40% (n=3, p=0.008),
respectively. Interestingly, treatment with neutralizing anti-Mac-1
antibodies also increased the embolization rate--albeit mildly--by
131.+-.41% (n=4, p=0.03, FIG. 10C, D).
[0115] The data show that CD40L specifically binds to a distinct
region within Mac-1 I-domain. The peptides disclosed herein blocked
binding of CD40L to Mac-1, but did not affect some of the other
receptor-ligand interactions. Therefore, the peptides disclosed
herein and the antibodies can be used as medicaments which do not
have undesired side effects.
Sequence CWU 1
1
2019PRTartificial sequencetherapeutically usable peptide 1Glu Gln
Leu Lys Lys Ser Lys Thr Leu 1 5 211PRTartificial
sequencetherapeutically usable peptide 2Cys Glu Gln Leu Lys Lys Ser
Lys Thr Leu Cys 1 5 10 313PRTartificial sequenceepitop comprising
peptide 3Val Met Glu Gln Leu Lys Lys Ser Lys Thr Leu Phe Ser 1 5 10
419DNAartificial sequenceprimer 4agaagttccc agaggccct
19533DNAartificial sequenceprimer 5gagtgcggcc gcggcagcgc tgaagccttc
ctg 33640DNAartificial sequenceprimer 6cctaggcggc cgctatcaga
gtttgagtaa gccaaaggac 40732DNAartificial sequenceprimer 7cttctagaaa
acagctttga aatgcaaaaa ga 32837DNAartificial sequenceprimer
8ccggccatgg ccgaacaaaa gctgatctca gaagaag 37934DNAartificial
sequenceprimer 9tgaggtacct aggtgatggt gatggtgatg tgag
341093DNAartificial sequenceprimer 10atgaaacaga ttgaagataa
aattgaagaa attctgagca aaatttatca tattgaaaac 60gaaattgcgc gtattaaaaa
actgattgga gaa 931113PRTartificial sequencetherapeutically usable
peptide 11Pro His Asp Phe Arg Arg Met Lys Glu Phe Val Ser Thr 1 5
10 1217PRTartificial sequencetherapeutically active peptide 12Pro
Ile Thr Gln Leu Leu Gly Arg Thr His Thr Ala Thr Gly Ile Arg 1 5 10
15 Lys 1317PRTartificial sequencetherapeutically active peptide
13Lys Phe Gly Asp Pro Leu Gly Tyr Glu Asp Val Ile Pro Glu Ala Asp 1
5 10 15 Arg 1415PRTartificial sequencetherapeutically active
peptide 14Asp Ala Phe Arg Ser Glu Lys Ser Arg Gln Glu Leu Asn Thr
Ile 1 5 10 15 1511PRTartificial sequencetherapeutically active
peptide 15Phe Gln Val Asn Asn Phe Glu Ala Leu Lys Thr 1 5 10
168PRTartificial sequencetherapeutically active peptide 16Gln Asn
Asn Pro Asn Pro Arg Ser 1 5 178PRTartificial
sequencetherapeutically active peptide 17Glu Glu Phe Arg Ile His
Phe Thr 1 5 189PRTartificial sequencetherapeutically active peptide
18Lys Leu Ser Leu Glu Lys Gln Thr Lys 1 5 195PRTartificial
sequencetherapeutically active peptide 19Glu Gln Leu Lys Lys1
5207PRTartificial sequencetherapeutically active peptide 20Cys Glu
Gln Leu Lys Lys Cys1 5
* * * * *