U.S. patent application number 15/651910 was filed with the patent office on 2017-12-28 for direct conversion of cells to cells of other lineages.
The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Austin Ostermeier, Zhiping Pang, Thomas C. Sudhof, Thomas Vierbuchen, Marius Wernig.
Application Number | 20170369840 15/651910 |
Document ID | / |
Family ID | 44307189 |
Filed Date | 2017-12-28 |
![](/patent/app/20170369840/US20170369840A1-20171228-D00001.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00002.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00003.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00004.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00005.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00006.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00007.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00008.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00009.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00010.png)
![](/patent/app/20170369840/US20170369840A1-20171228-D00011.png)
View All Diagrams
United States Patent
Application |
20170369840 |
Kind Code |
A1 |
Wernig; Marius ; et
al. |
December 28, 2017 |
DIRECT CONVERSION OF CELLS TO CELLS OF OTHER LINEAGES
Abstract
Methods, compositions and kits for producing functional neurons,
astroctyes, oligodendrocytes and progenitor cells thereof are
provided. These methods, compositions and kits find use in
producing neurons, astrocytes, oligodendrocytes, and progenitor
cells thereof for transplantation, for experimental evaluation, as
a source of lineage- and cell-specific products, and the like, for
example for use in treating human disorders of the CNS. Also
provided are methods, compositions and kits for screening candidate
agents for activity in converting cells into neuronal cells,
astrocytes, oligodendrocytes, and progenitor cells thereof.
Inventors: |
Wernig; Marius; (Stanford,
CA) ; Sudhof; Thomas C.; (Stanford, CA) ;
Vierbuchen; Thomas; (Stanford, CA) ; Ostermeier;
Austin; (West Plains, MO) ; Pang; Zhiping;
(Stanford, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University |
Stanford |
CA |
US |
|
|
Family ID: |
44307189 |
Appl. No.: |
15/651910 |
Filed: |
July 17, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14711514 |
May 13, 2015 |
|
|
|
15651910 |
|
|
|
|
13522002 |
Oct 8, 2012 |
9057053 |
|
|
PCT/US2011/021731 |
Jan 19, 2011 |
|
|
|
14711514 |
|
|
|
|
61336309 |
Jan 19, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 37/00 20180101;
A61P 25/00 20180101; C12N 2506/14 20130101; C12N 2506/1307
20130101; C12N 5/0622 20130101; C12N 2501/60 20130101; C12N 5/0623
20130101; C12N 5/0619 20130101; G01N 33/5058 20130101; C12N 2506/45
20130101; A61P 25/28 20180101; C12N 2506/02 20130101; A61P 25/18
20180101; C12N 2510/00 20130101 |
International
Class: |
C12N 5/0793 20100101
C12N005/0793; C12N 5/079 20100101 C12N005/079; G01N 33/50 20060101
G01N033/50; C12N 5/0797 20100101 C12N005/0797 |
Goverment Interests
GOVERNMENT RIGHTS
[0002] This invention was made with Government support under
contract 5T32NS007280 awarded by the National Institutes of Health.
The Government has certain rights in the invention.
Claims
1. A method of converting human pluripotent cells into induced
neuronal cells, the method comprising: contacting a population of
human pluripotent cells with an effective dose of a neuron
reprogramming (NR) system comprising an Ascl agent and an DLX2
agent as neuron reprogramming (NR) factors for a period of time
sufficient to reprogram said pluripotent cells, wherein a
population of induced neuronal cells is produced.
2. The method of claim 1, wherein the pluripotent cells are human
cells.
3. The method of claim 1, wherein the efficiency of reprogramming
said pluripotent cells to become induced neuronal cells is at least
about 0.1%.
4. The method of claim 1, wherein the pluripotent cells are
reprogrammed into neuronal cells with functional properties within
10 days after contacting the cells with the reprogramming
factors.
5. The method of claim 1, wherein the pluripotent cells are induced
pluripotent (iPS) cells.
6. The method of claim 1, wherein the pluripotent cells are
embryonic stem cells.
7. The method of claim 1, wherein the Ascl agent is Ascl1.
8. The method of claim 1, wherein the reprogramming (NR) system
further comprising a Myt1 agent.
9. The method of claim 1, wherein the induced neuronal cells are
inhibitory neurons.
10. An in vitro cell culture system comprising an isolated
population of human pluripotent cells genetically engineered to
comprise a nucleic acid vector encoding Ascl polypeptide operably
linked to a promoter, and a nucleic acid vector encoding DLX2
polypeptide operably linked to a promoter.
11. The cell culture system of claim 10, wherein the pluripotent
cells are induced pluripotent (iPS) cells.
12. The cell culture system of claim 10, wherein the pluripotent
cells are embryonic stem cells.
13. The cell culture system of claim 10, wherein the isolated
population of human pluripotent cells genetically is engineered to
further comprise a nucleic acid vector encoding Myt1 polypeptide
operably linked to a promoter.
Description
CROSS REFERENCE
[0001] This application claims benefit and is a Divisional of
application Ser. No. 14/711,514 filed May 13, 2015, which is a
Divisional of application Ser. No. 13/522,002 filed Oct. 8, 2012,
now patented U.S. Pat. No. 9,057,053 issued Jun. 16, 2015, which is
a 371 application and claims the benefit of PCT Application No.
PCT/US2011/021731, filed Jan. 19, 2011, which claims benefit of
U.S. Provisional Patent Application No. 61/336,309, filed Jan. 19,
2010, which applications are incorporated herein by reference in
their entirety.
BACKGROUND OF THE INVENTION
[0003] The diverse cell types present in the adult organism are
produced during development by lineage-specific transcription
factors that define and reinforce cell type specific gene
expression patterns. Cellular phenotypes are further stabilized by
epigenetic modifications that allow faithful transmission of
cell-type specific gene expression patterns over the lifetime of an
organism (Jenuwein, T. & Allis, C. D. (2001) Science 293,
1074-80; Bernstein, B. E., et al. (2007) Cell 128, 669-81). Recent
work by Yamanaka and colleagues showing that four transcription
factors are sufficient to induce pluripotency in primary
fibroblasts demonstrated that fully differentiated cells can be
induced to undergo dramatic cell fate changes (Takahashi, K. &
Yamanaka, S. (206) Cell 126, 663-76). Similarly, the transfer of
somatic cell nuclei into oocytes, as well as cell fusion of
pluripotent cells with differentiated cells have proven to be
capable of inducing pluripotency (Briggs, R. & King, T. J.
(1952) Proc Natl Acad Sci USA 38, 455-63; Gurdon, J. B., et al.
(1958) Nature 182, 64-5; Campbell, K. H., et al. (1996) Nature 380,
64-6; Tada, M., et al. (2001) Curr Biol 11, 1553-8; Do, J. T. &
Scholer, H. R. (2004) Stem Cells 22, 941-9; Cowan, C. A., et al.
(2005) Science 309, 1369-73). This transformation has been
interpreted as a reversion of mature into more primitive
developmental states, with a concomitant erasure of developmentally
relevant epigenetic information (Silva, J. & Smith, A. (2008)
Cell 132, 532-6). The resultant cells may then be reprogrammed to a
new cell fate.
[0004] Reprogramming into an embryonic state with subsequent
differentiation of the embryonic-state cells into cells of the
Central Nervous System (CNS) is slow and inefficient, requiring
significant time and manipulation in vitro. More useful would be
direct reprogramming between divergent somatic lineages. It has
been observed that cell fusion or forced expression of
lineage-specific genes in somatic cells can induce traits of other
cell types (Blau, H. M. (1989) Trends Genet 5, 268-72; Zhou, Q.
& Melton, D. A. (2008) Cell Stem Cell 3, 382-8). For example,
the basic helix-loop-helix (bHLH) transcription factor MyoD can
induce muscle-specific properties in fibroblasts but not
hepatocytes (Davis, R. L., et al. (1987) Cell 51, 987-1000;
Schafer, B. W., et al. (1990) Nature 344, 454-8); ectopic
expression of IL2 and GM-CSF receptors can lead to myeloid
conversion in committed lymphoid progenitor cells (Kondo, M. et al.
(2000) Nature 407, 383-6); expression of CEBP.alpha. in B-cells or
Pu.1 and CEBP.alpha. in fibroblasts induces characteristics of
macrophages (Bussmann, L. H. et al. (2009) Cell Stem Cell 5,
554-66; Feng, R. et al. (2008) Proc Natl Acad Sci U S A 105,
6057-62; Xie, H., et al. (2004) Cell 117, 663-76) deletion of Pax5
can induce B-cells to de-differentiate toward a common lymphoid
progenitor (Cobaleda, C., et al. (2007) Nature 449, 473-7); and the
(bHLH) transcription factor neurogenin3, in combination with Pdx1
and MafA, can efficiently convert pancreatic exocrine cells into
functional 8-cells in vivo (Zhou, Q., et al. (2008) Nature 455,
627-32).
[0005] Publications relevant to conversion of pluripotent cells to
neurons include, inter alia, Wu, H. et al. Proc Natl Acad Sci U S A
104, 13821-13826 (2007); Johnson et al. J Neurosci 27, 3069-3077
(2007); Zhang et al. Nat Biotechnol 19, 1129-1133 (2001); Elkabetz,
et al., Genes Dev 22, 152-165 (2008); Koch et al. Proc Natl Aced
Sci U S A 106, 3225-3230 (2009); Chambers et al. Nat Biotechnol 27,
275-280 (2009).
SUMMARY OF THE INVENTION
[0006] Methods, compositions and kits for producing functional
neurons, astroctyes, oligodendrocytes and progenitor cells thereof
are provided. These methods, compositions and kits find use in
producing neurons, astrocytes, oligodendrocytes, and progenitor
cells thereof for transplantation, for experimental evaluation, as
a source of lineage- and cell-specific products, and the like, for
example for use in treating human disorders of the CNS. Also
provided are methods, compositions and kits for screening candidate
agents for activity in converting cells into neuronal cells,
astrocytes, oligodendrocytes, and progenitor cells thereof.
[0007] In some embodiments, methods are provided for converting
pluripotent cells including, without limitation, embryonic stem
cells, induced pluripotent stem cells, etc., into induced neuronal
cells (iNs) by contacting the pluripotent cell with a neuronal
reprogramming system (NR) comprising three or more factors selected
from an Ascl agent, a Ngn agent, a Brn agent, a NeuroD agent, a
Myt1 agent, an Olig agent or a Zic agent. In certain embodiments,
particularly for human cells, neuron reprogramming factors are
combination of an Ascl agent, a Brn agent, a NeuroD agent, and a
Myt1 agent, which combinations of interest include without
limitation, Ascl1, Brn2, Myt1l and NeuroD1. Cell culture systems
for such methods are also provided. The cells find use in
therapeutic methods, e.g. to provide cells for neuron replacement
therapy; in screening methods, and the like. In some embodiments,
the pluripotent cells are mammalian cells. In some embodiments, the
mammalian pluripotent cells are human or mouse cells. In some
embodiments, the cell population is combined with a reagent that
specifically recognizes a marker associated with cells of the
neuronal lineage, and cells that express the marker are selected
for to provide an enriched population of iN cells. An advantage of
the methods of the invention is the rapidity with which neuronal
cells with functional properties can be generated, for example as
early as 6, 7, 8, 9, 10 days after contacting the cells with the
reprogramming system.
[0008] In other embodiments, methods are provided for directly
converting somatic cells of one lineage into somatic cells of a
different cell lineage. In some embodiments, the methods are for
directly converting somatic cells into induced neuronal cells
(iNs). In some embodiments, a population of non-neuronal somatic
cells is contacted with a neuron reprogramming (NR) system
comprising one or more neuron reprogramming (NR) factors so as to
produce a population of iN cells. In some embodiments, the NR
factors are selected from an Ascl agent, a Ngn agent, a Brn agent,
a Myt1 agent, an Olig agent or a Zic agent. In some embodiments,
the somatic cells are mammalian cells. In some embodiments, the
mammalian somatic cells are human or mouse cells. In some
embodiments, the efficiency of reprogramming the somatic cells to
become induced neurons is at least about 0.1%. In some embodiments,
the NR system-contacted population is combined with a reagent that
specifically recognizes a marker associated with cells of the
neuronal lineage, and cells that express the marker are selected
for to provide an enriched population of iN cells. In some
embodiments, selection of the cells is effected by flow cytometry
(FACS). In some embodiments, selection of the cells is effected by
magnetic activated cell sorting (MACS). In some embodiments, the
marker associated with neural progenitors is Poly-Sialated Neural
Cell Adhesion Molecule (PSA-NCAM). In some embodiments, the reagent
that specifically recognizes PSA-NCAM is an anti-PSA-NCAM
antibody.
[0009] In some aspects of the invention, a cell culture system is
provided for directly converting somatic cells into somatic cells
of a different lineage. In some embodiments, the cell culture
system is for directly converting somatic cell into induced
neuronal cells (iNs). In some such embodiments, the cell culture
system comprises non-neuronal somatic cells and a neuron
reprogramming (NR) system. In some embodiments, the NR system
comprises one or more neuron reprogramming (NR) factors selected
from an Ascl agent, a Ngn agent, a Brn agent, a Myt agent, an Olig
agent or a Zic agent. In some embodiments, the somatic cells are
mammalian cells. In some embodiments, the mammalian somatic cells
are human or mouse cells.
[0010] In some aspects of the invention, methods are provided for
screening candidate agents for activity modulating the direct
conversion of somatic cells into somatic cells of a different cell
lineage. In some embodiments, the methods are for screening
candidate agents for activity modulating the direct conversion of
somatic cells into induced neuronal cells (iNs). In some such
embodiments, a cell culture system comprising non-neuronal somatic
cells and a neuron reprogramming (NR) system, or an incomplete NR
system (e.g. lacking one or more factors, comprising sub-optimal
levels of one or more factors, and the like) is contacted with a
candidate agent. The characteristics of the candidate-agent
contacted cell culture system are compared with those of a cell
culture system that has not been contacted with the candidate
agent, where differences in the characteristics between the cell
culture system that was contacted with candidate agent and the cell
culture system that was not contacted with candidate agent indicate
that the candidate agent modulates somatic cell conversion into
iNs.
[0011] In some aspects of the invention, methods are provided for
treating a subject in need of cell transplantation therapy in the
CNS. In some embodiments, the cell transplantation therapy is
neuron transplantation therapy. In some such embodiments, the
subject is contacted with a composition of induced neuronal cells
(iNs) prepared by converting somatic cells into induced neuronal
cells using the methods and compositions of the invention. In
certain embodiments, the somatic cells are derived from the
subject. In some embodiments, the subject is contacted with NR
factors. In some embodiments, the subject has a CNS condition. In
some embodiments, the CNS condition is a neurodegenerative disease,
a neuropsychiatric disorder, a channelopathy, a lysosomal storage
disorder, an autoimmune disease of the CNS, a cerebral infarction,
a stroke, or a spinal cord injury.
[0012] In some aspects of the invention, a neuronal cell induced by
the direct conversion of a non-neuronal somatic cell is provided,
where the reprogramming is performed directly on a somatic cell, in
the absence of pluripotent cells, such as eggs, embryos, embryonic
stem (ES) cells, induced pluripotent stem (iPS) cells, or embryonic
germ cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The invention is best understood from the following detailed
description when read in conjunction with the accompanying
drawings. The patent or application file contains at least one
drawing executed in color. Copies of this patent or patent
application publication with color drawing(s) will be provided by
the Office upon request and payment of the necessary fee. It is
emphasized that, according to common practice, the various features
of the drawings are not to-scale. On the contrary, the dimensions
of the various features are arbitrarily expanded or reduced for
clarity. Included in the drawings are the following figures.
[0014] FIG. 1A-1P. A screen for neuronal fate-inducing factors and
characterization of MEF-derived iN cells. FIG. 1A, Experimental
rationale. FIG. 1B, Uninfected, p3 TauEGFP MEFs contained rare
Tuj1-positive cells (red) with flat morphology. Blue: DAPI
counterstain. FIG. 1C, Tuj1-positive fibroblasts in panel b do not
express visible TauEGFP. FIG. 1D-1E, MEF-iN cells express Tuj1
(red) and TauEGFP (green) and display complex neuronal morphologies
32 days after infection with the 19-factor (19F) pool. FIG. 1F,
Tuj1 expression in MEFs 13 days after infection with the 5F pool.
FIG. 1G-1J, MEF-derived Tuj1-positive iN cells co-express the
pan-neuronal markers TauEGFP (FIG. 1H), NeuN (red, FIG. 1J) and
MAP2 (red, FIG. 1J). FIG. 1K, Representative traces of membrane
potential responding to step depolarization by current injection
(lower panel). Membrane potential was current-clamped at around -65
mV. FIG. 1L, Representative traces of whole-cell currents in
voltage-clamp mode, cell was held at -70 mV, step depolarization
from -90 mV to 60 mV at 10 mV interval were delivered (lower
panel). Insert showing Na.sup.+currents. FIG. 1M, Spontaneous
action potentials (AP) recorded from a 5F MEF-iN cell 8 days post
infection. No current injection was applied. FIG. 1N-1P, 22 days
post-infection 5F MEF-iN cells express synapsin (red, FIG. 1N) and
vesicular glutamate transporter 1 (vGLUT1) (red,o) or GABA FIG. 1P.
Scale bars=5 .mu.m (FIG. 10), 10 .mu.m (FIG. 1E, 1N, 1P) 20 .mu.m
(FIG. 1C, 1H, 1I), and 200 .mu.m FIG. 1F.
[0015] FIG. 2A-2H. Efficient induction of neurons from perinatal
tail-tip fibroblasts. FIG. 2A, Tuj1-stained tail-tip fibroblast 13
days after infection 5F pool. FIG. 2B-2C, TTF-iNs express the
pan-neuronal markers MAP2 (FIG. 2B) and NeuN (FIG. 2C). FIG. 2D,
Representative traces showing action potentials elicited at day 13
post infection. Nine of eleven cells recorded exhibited APs. FIG.
2E, Whole cell currents recorded in voltage-clamp mode. Inward fast
inactivating sodium currents (arrow) and outward currents can be
observed. FIG. 2F-2H, 21 days after infection TTF-iN cells express
synapsin (red, FIG. 2F), vGLUT1 (red, FIG. 2G) and GABA (FIG. 2H).
FIG. 2C, FIG. 2F, and FIG. 2G are overlay images with the indicated
marker (red) and Tuj1 (green). Scale bars=20 .mu.m (FIG. 2B, 2F,
2G), 100 .mu.m (FIG. 2H), 200 .mu.m (FIG. 2A).
[0016] FIG. 3A-3J. 5F pool-induced conversion is rapid and
efficient. FIG. 3A, Tuj1-positive iN cells (red) exhibit
morphological maturation over time after viral infections. At day
13, TauEGFP expression outlines neuronal processes. FIG. 3B, FACS
analysis of TauEGFP expression 8 and 13 days post infection.
Control=Uninfected TauEGFP MEFs. FIG. 3C, Representative traces
showing action potentials elicited from MEF-iN cells at days 8, 12,
and 20 post infection. Cells were maintained at a potential of
.about.-65 to -70 mV. Step current injection protocols were used
from -50 to +70 pA. Scale bars apply to all traces. FIG. 3D-3G,
Quantification of membrane properties in MEF-iN cells at 8, 12, and
20 days post infection. Numbers in the bars represent the numbers
of recorded cells. Data are presented as mean .+-.S.E.M.
*p<0.05; **p<0.01; ***p<0.001 (Student's t-test). AP:
Action Potentials; RMP: Resting Membrane Potentials; Rin: Membrane
input resistances; Cm: Membrane Capacitance. AP heights were
measured from the baseline. FIG. 3H, BrdU-positive iN cells
following BrdU treatment from day 0-13 or day 1-13 after transgene
induction. FIG. 3I, Example of a Tuj1 (green) positive cell not
labeled with BrdU (red) when added at day 0 after addition of
doxycycline. Data are presented as mean .+-.S.D. FIG. 3J,
Efficiency estimates for iN cell generation 13 days after infection
(see methods). Every bar represents an independent experiment.
Doxycycline was added to 48 hours after plating in MEF experiment
#1 and after 24 hours in MEF experiments #2, #3. Error bars=.+-.1
S.D. of cell counts. Scale Bars=10 .mu.m (FIG. 3J), 100 .mu.m (FIG.
3A).
[0017] FIG. 4A-4I. MEF-derived iN cells exhibit functional synaptic
properties. TauEGFP-positive iN cells were FACS purified 7-8 days
post infection of MEFs and plated on cortical neuronal cultures (7
days in vitro, a-f) or on monolayer glial cultures (FIG. 4G-4I).
Electrophysiological recordings were performed 7-10 days after
sorting. FIG. 4A, Recording electrode (Rec.) patched onto an
TauEGFP-positive cell (middle panel) with a stimulation electrode
(Sti.). right panel, merged picture of DIC and fluorescence images
showing the recorded cell is TauEGFP positive. FIG. 4B,
Representative traces of spontaneous synaptic network activities
and representative evoked postsynaptic currents (PSCs) following
stimulation. FIG. 4C, In the presence of 20 .mu.M CNQX and 50 .mu.M
D-APV, upper panel shows a representative trace of spontaneous
IPSCs. Evoked IPSC could be elicited (middle panel) and blocked by
the addition of picrotoxin. When a train of 10 stimulations was
applied at 10 Hz, evoked IPSCs exhibit depression (lower panel).
FIG. 4D, In the presence of 30 .mu.M picrotoxin, excitatory
synaptic activities from EGFP-positive cells were observed.
Spontaneous-(upper panel), and evoked-(middle panel) EPSCs. At a
holding potential of -70 mV, AMPA receptor (R)-mediated EPSCs were
monitored. When holding potential were set at +60 mV, both AMPA R-
and NMDA R-mediated EPSCs could be recorded. Lower panel shows the
short-term synaptic plasticity of both AMPA R- and NMDA R- mediated
synaptic activities. FIG. 4E, Example of a TauEGFP-positive iN cell
expressing MAP2 among cortical neurons. FIG. 4F, High magnification
of area marked with dotted lines in FIG. 4E. FIG. 4G,
Representative spontaneous postsynaptic currents (PSCs) recorded
from MEF-iN cells co-cultured with glia. FIG. 4H, Representative
traces of evoked EPSCs. NMDA-R-mediated EPSCs in the presence of 10
.mu.M NBQX were recorded at holding potential (Vh) of +60 mV.
Application of D-APV blocked the response. AMPA-R-mediated EPSCs
were recorded at Vh of -70 mV. AMPA-R-evoked response is blocked by
NBQX and APV. FIG. 4I, Current-voltage (I-V) relationship of
NMDA-R-mediated EPSCs, left panel; representative traces of evoked
EPSCs at different Vh as indicated. Right panel shows the
summarized I-V relationship. NMDA-R EPSC amplitudes (INMDA) are
normalized to EPSCs at Vh of +60 mV (indicated by *, n=5). NMDA-R
EPSCs show ratifications at negative holding potentials, presumably
because of the blockade of NMDA-R by Mg2.sup.+. Scale bars=10 .mu.m
(FIG. 4A, 4D).
[0018] FIG. 5A-5I. Defining a minimal pool for efficient induction
of functional iN cells. FIG. 5A, Quantification of Tuj1-positive iN
cells from TauEGFP MEFs infected with different 3-factor
combinations of the five genes. Each gene is represented by the
first letter in its name. Averages from 30 randomly selected visual
fields are shown (error bars=.+-.S.D.) FIG. 5B-5D, Representative
images of Tuj1 staining of MEFs infected with the 5F (FIG. 5B),
Ascl1+Brn2+Zic1 (ABZ) (FIG. 5C) and Ascl1+Brn2+Myt1L (BAM) (FIG.
5D) pools. FIG. 5E, Tuj1 staining of perinatal TTF-iN cells 13 days
after infection with the BAM pool. FIG. 5F, BAM-induced MEF-iN
cells express MAP2 (green) and synapsin (red) 22 days after
infection. FIG. 5G, Representative traces of synaptic responses
recorded from MEF-derived BAM (3F)-iN cells co-cultured with glia
after isolation by FACs. Vh: holding potential. At Vh of -70 mV,
AMPA R-mediated EPSCs were recorded; at Vh of +60 mV, NMDA
R-mediated EPSCs were revealed. FIG. 5H, Synaptic responses
recorded from TTF-derived 3F-iN cells. Scale bars in (FIG. 5H)
apply to traces in (FIG. 5G). FIG. 5I, Representative traces of
action potentials elicited from MEF-derived iN cells transduced
with the indicated gene combinations, recorded 12 days after
infection. Cells were maintained at a resting membrane potential of
.about.-65 to -70mV. Step current injection protocols were used
from -50 to +70 pA. Traces in each subgroup (left or right panels)
represent subpopulations of neurons with similar responses. Numbers
indicate the fraction of cells from each group that were
qualitatively similar to the traces shown. Right panels:
representative images of Tuj1 staining after recordings from each
condition. Scale bars=20 .mu.m (FIG. 5F) and 100 .mu.m (FIG. 5B,
5I).
[0019] FIG. 6A-6D. Characterization of MEF and tail-tip fibroblast
cultures. FIG. 6A, Passage 3 TauEGFP MEF, Balb/c MEF, and TauEGFP
TTF cultures were immunostained with antibodies against the listed
antigens. Each antibody was independently validated using an
appropriate positive control. The listed of antigens includes
multiple markers for neural stem cells (Sox2, Brn2, GFAP),
peripheral and spinal neural progenitor cells (p75, Pax3, Pax6,
Pax7, Nkx2-2, Olig1) and markers for neurons and astroglia (Tuj1,
TauEGFP, GFAP, Olig1). Listed percentages are out of >4500
cells. Absent means no positive cells were detected in the stained
field. n.d. means fibroblast cultures were not stained. FIG. 6B,
FACs analysis of uninfected P3 TauEGFP MEFs and control BALB/c MEFs
for GFP fluorescence. Graph plots GFP fluorescence (y-axis) against
APC (x-axis). FIG. 6C, Characterization of passage 3 TauEGFP MEFs
and perinatal TTFs after culturing in neural media. Cells were
either cultured in N3 media for 12 days (to promote the
differentiation of potentially contaminating neural progenitor
cells), N3 media with EGF and FGF2 for 12 days (a condition
promoting neural progenitor cell expansion), or N3 with EGF and
FGF2 for 8 days followed by growth factor withdrawal for 5 days (to
first expand and then differentiate any potentially existing neural
progenitor cells). Under no conditions could we detect the presence
of neural cell types, only in one condition rare cells were labeled
above background with a polyclonal antibody against GFAP. At least
10,000 cells were screened for each staining. FIG. 6D, Reverse
transcription-PCR on cDNA isolated from passage 3 TauEGFP MEF and
Rosa-rtTA TTF cultures. Sox1 and Sox10 could not be detected in
MEFs grown in MEF media (MEF-Start), MEFs grown in N3 media
(N3-MEF) for 8 days, or in MEFs grown in N3 with EGF and FGF2 for 8
days (N3EF-MEF). TTFs appear to express Sox10 at a low level.
Positive controls included E13.5 spinal cord, E13.5 dorsal root
ganglia (DRG), and E13.5 forebrain cDNAs. For each experimental
sample a control reaction was carried without reverse transcriptase
(No RT).
[0020] FIG. 7A-7B. Screen for enhancers of Ascl1-induced
conversion. FIG. 7A, the effect of 18 transcription factors in
combination with Ascl1 on neuronal induction 13 days post
infection. Shown are the average numbers of Tuj1-positive cells
with a process three times longer than the cell body derived from
two randomly selected, low magnification visual fields. FIG. 7B,
Representative Tuj1-positive cells 13 days after infection with
Ascl1 alone or in combination with the indicated genes. Note the
increased complexity of the neurites in the Ascl1+Myt1l
condition.
[0021] FIG. 8A-8H. Further immunohistochemical and
electrophysiological characterization of 5F-iN cells. FIG. 8A, iN
cells derived from Balb/c MEFs stained for MAP2 (red) and
Tuj1(green). FIG. 8B, FIG. 8C, At day 22 post-infection TauEGFP
MEF-derived 5F iN cells rarely express GAD6. (FIG. 8B) Calretinin
(red, FIG. 8C) and Tuj1 (green, FIG. 8C). FIG. 8D, An iN cell
derived from Rosa26-rtTA TTFs that expressed the peripheral neuron
marker peripherin (red) and Tuj1 (green). FIG. 8E, Representative
traces of an action potential (AP) elicited using a ramp protocol
(insert) from a TauEGFP MEF-derived iN cell at 8 days post
infection. AP was abolished after application of TTX (both traces
are from the same cell). FIG. 8F, Superimposed whole cell currents
recorded by using a ramp protocol (insert) revealing
fast-inactivating sodium current and inward calcium currents. FIG.
8G, TauEGFP MEF-derived iN cells respond to exogenous application
of 100 .mu.M GABA through a picosprizer. Lower panel showing that
the GABA induced current response could be blocked by application
of 30 .mu.M picrotoxin. FIG. 8H, TauEGFP-expressing 5F iN cell
observed in a MEF culture 5 days post infection. Scale bars=10
.mu.m (FIG. 8B, FIG. 8H) and 100 .mu.m (FIG. 8A, 8C, 8D).
[0022] FIG. 9A-9B. Synaptic integration of TTF-derived 5F-iN cells
in cortical neural networks. 5F perinatal TTF-iN cells were
FACS-sorted for EGFP expression 7-8 days post infection and plated
on cortical neuronal cultures (7 days in vitro).
Electrophysiological recordings from the TauEGFP cells were
performed 7 days after sorting. FIG. 9A, Representative consecutive
traces of spontaneous synaptic network activities recorded from a
TTF-iN cell. FIG. 9B, Representative evoked synaptic activity
following stimulation (indicated by arrow). Four superimposed
responses are shown.
[0023] FIG. 10A-10B. Immunofluorescence of 5F-iN cells co-cultured
with glial cells. FIG. 10A-10B, MEF-derived 5F-iN cells on glia
express markers of glutamatergic neurons. Immunostaining for
vGLUT1, MAP2, and synapsin. The second row in FIG. 10B is a
close-up of the outlined region in the first row. Scale Bars=10
.mu.m (upper panel FIG. 10A, 10B), 3 .mu.m (lower panel, FIG.
10A).
[0024] FIG. 11A-11B. Additional neuronal induction efficiency
estimates. FIG. 11A, Effect of removing single genes from the 5F
pool. The average number of Tuj1-positive neuronal cells visible in
a 20.times. field is normalized to the 5F condition. FIG. 11B,
Reproducibility of BAM-iN cell generation. Each bar represents an
independent experiment. % iN cells is calculated from the number of
plated cells (see methods). The low efficiency in BAM-3 is likely
due to suboptimal lentiviral titer, however, the iN cells that are
present in this condition still exhibit mature neuronal
morphologies. Error bar=S.D.
[0025] FIG. 12. Representative images from 1 to 5 factor
infections. Tuj1 stainings of iN cells induced by the indicated 1
to 5 factor combinations of the genes Ascl1 (A), Brn2 (B), Myt1L
(M), Olig2 (O) and Zic1 (Z) 12 days after infection. Total virus is
kept constant between different factor combinations. Scale bar=50
.mu.m.
[0026] FIG. 13A-13H. Additional characterization of BAM-iN cells.
FIG. 13A-13B, Day 12 TTF-derived BAM iN cells express the
pan-neuronal markers MAP2 (FIG. 13A, red) and NeuN (FIG. 13B, red)
FIG. 13C-13D, Day 21 TTF-derived BAM iN cells exhibit mature
neuronal morphologies and express TauEGFP. FIG. 13E, Day 21
TTF-derived BAM-iN cells exhibit punctate synapsin staining. FIG.
13F, MEF-derived BAM iN cells express Tbr1, a marker of cortical
neurons 22 days after infection. FIG. 13G-13H, A MEF-derived BAM-iN
cell expressing GAD6 (FIG. 13G, red, FIG. 13H) and Tuj1 (FIG. 13G,
green). Scale bars=20 .mu.m (FIG. 13A, FIG. 13B), 50 .mu.m (FIG.
13C, FIG. 13G), 10 .mu.m (FIG. 13E, FIG. 13F).
[0027] FIG. 14A-14D. BAM-iN cells derived from adult TTF. BAM iN
cells derived from TTF isolated from a six-week-old TauEGFP mouse
express Tuj1 (FIG. 14A, FIG. 14D, green), TauEGFP (FIG. 14B), MAP2
(FIG. 14C) and NeuN (FIG. 14D, red). Scale bars=20 .mu.m (FIG.
14A-14D).
[0028] FIG. 15A-15F. Rapid generation of functional neurons from
human ES cells. FIG. 15A, Biopolar neuronal morphologies 4 days
after dox treatments and 5 days after infection of human ES cells
with Brn2, Ascl1, Myt1l (BAM), and EGFP. FIG. 15B-15C, Eight days
after induction, BAM-ES cells displayed complex neuronal
morphologies and expressed the pan-neuronal markers Tuj1 (FIG. 15B)
and MAP2 (FIG. 15C). FIG. 15D, Spontaneous trains of action
potentials of a human ES-iN cell six days after induction of BAM
factors. Arrow indicates pronounced after hyperpolarization
potential (AHP). FIG. 15E, Whole cell recordings from human
ES-derived neuronal like cells. Representative traces of action
potentials in response to step current injections 15 days after
induction. Membrane potential was maintained at around -63 mV. FIG.
15F, Quantification of intrinsic membrane properties; membrane
input resistance (Rin), resting membrane potential (RMP),
capacitance (Cm), and after hyperpolarization potentials (AHP).
Scale bars: 10 .mu.m (FIG. 15A, FIG. 15B, FIG. 15C). *p<0.05,
Student t-test.
[0029] FIG. 16A-16H. NeuroD1 increases reprogramming efficiency in
primary human fetal fibroblasts. FIG. 16A, Frequency of
Tuj1-positive cells per 20-field displaying neuronal morphologies
after infection of HFF with BAM factors on combination with the
indicated candidate factors. Each well (3.8 cm.sup.2 surface area)
of the 12 well-plates contained 125,000 cells at the plating stage.
FIG. 16B-16F, Fourteen days after infection, BAM+NeuroD1 iN cells
exhibited stereotypical neuronal morphologies (FIG. 16B) and
expressed the pan-neuronal markers Tuj1 (FIG. 16C), NeuN (FIG.
16D), PSA-NCAM (FIG. 16E) and MAP2 (FIG. 16F). FIG. 16G-16H, A
fibroblast-derived iN cell labeled with antibodies against MAP2
(FIG. 16G) and synapsin (FIG. 16H) 4 weeks after infection and
co-cultured with primary astrocytes. No neuronal cells were seen in
parallel pure astrocyte cultures from the same preparation. Scale
bars: 100 .mu.m (FIG. 16B, FIG. 16C), 10 .mu.m (FIG. 16D-16H).
[0030] FIG. 17A-17H. Membrane properties of HFF-iN cells. FIG. 17A,
Patch clamp recording was conducted on HFF-iN cells identified by
EGFP fluorescence and DIC microcopy. FIG. 17B, Representative
traces of membrane potentials in response to step current
injections (low panel) from an HFF-iN cells 19 days after
infection. Membrane potential was maintained at .about.-63 mV. FIG.
17C, Spontaneous action potentials recorded from an iN cell 25 days
after infection. FIG. 17D, Representative traces of membrane
currents recorded following application of a 100 ms ramp protocol
from -80 mV to +60 mV (lower panel). Fast activating and
inactivating Na+ currents were prominent. Three traces are shown
superimposed from the same cell as shown in (FIG. 17C). FIG. 17E,
Representative traces of whole-cell currents measured in
voltage-clamp mode. Cell was held at -70 mV, voltage was increased
stepwise from -90 mV to +60 mV in 10 mV intervals. FIG. 17F,
Current-voltage relationship of outward whole-cell currents
recorded from iN cells. Currents were measured at 50 ms before the
end of the pulse (arrow indicated in FIG. 17E). Cells were held at
-70 mV, 500 ms durations of voltage steps from -90 mV to +80 mV, at
10 mV intervals, were applied (n=3). FIG. 17G Inward current
response following application of 10.sup.-4M GABA from a pipette
using a picospritzer (n=4); lower trace shows that application of
picrotoxin, a specific antagonist of GABA.sub.A receptors, blocks
the GABA-induced current response. The internal solution contained
.about.135 mM Cl explaining the inward current response. Cells were
held at -70 mV. FIG. 17H. Inward current responses following
application of 10.sup.-3 M L-glutamate from a pipette using a
picospritzer (n=4). Lower panel indicates that glutamate induced
current response could be blocked by CNQX, a specific antagonist of
AMPA receptors. Cells were held at -70 mV. Scale bar in (FIG. 17A)
represents 10 .mu.m.
[0031] FIG. 18A-18H. Synaptic responses of HFF-iN cells. FIG. 18A,
An HFF-iN cell with complex dendrite arborization and expressing
EGFP co-cultured with mouse cortical neurons at day 35 after viral
infection. FIG. 18B, Immunofluorescence image showing synaptic
puncta, visualized with an antibody against synapsin. Synapses
colocalize with neurites extending from HFF iN cells (arrow heads).
FIG. 18C, Thirty-five days after viral infection spontaneous
postsynaptic currents (PSCs) were recorded in HFF iN cells. The
slow kinetics of the responses (see insert) indicated that the
majority of these responses were GABAergic. FIG. 18D, These slow
responses could be blocked by perfusion with picrotoxin. In this
condition, bursting events of picrotoxin-resistant EPSCs were
recorded. The insert shows the fast kinetics of these bursting
postsynaptic responses. FIG. 18E, In the presence of picrotoxin and
CNQX, no spontaneous activities were observed. FIG. 18F, Evoked
postsynaptic current responses with mostly slow kinetics (see time
scale). A.P.=action potential. FIG. 18G, In the presence of
picrotoxin, also evoked fast-kinetic excitatory PSCs (EPSCs) could
be revealed. FIG. 18H, No evoked synaptic responses were observed
in the presence of picrotoxin and CNQX indicating that the
postsynaptic currents were mediated by GABAA and AMPA receptors.
Postsynaptic responses, either spontaneous or evoked, were recorded
from a total of 11 cells from 3 independent experiments. Scale
bars: 100 .mu.m (FIG. 18A); 10 .mu.m (FIG. 18B).
DETAILED DESCRIPTION OF THE INVENTION
[0032] Before the present methods and compositions are described,
it is to be understood that this invention is not limited to
particular method or composition described, as such may, of course,
vary. It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting, since the scope of the present
invention will be limited only by the appended claims.
[0033] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges may independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
[0034] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, some potential and preferred methods and materials are
now described. All publications mentioned herein are incorporated
herein by reference to disclose and describe the methods and/or
materials in connection with which the publications are cited. It
is understood that the present disclosure supercedes any disclosure
of an incorporated publication to the extent there is a
contradiction.
[0035] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a cell" includes a plurality of such cells
and reference to "the peptide" includes reference to one or more
peptides and equivalents thereof, e.g. polypeptides, known to those
skilled in the art, and so forth.
[0036] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
Definitions
[0037] Methods, compositions and kits for producing a population of
somatic cells of one cell lineage from a population of somatic
cells of a different cell lineage are provided. Alternatively
methods are provided for the conversion of pluripotent cells into
neuronal cells. These methods, compositions and kits find use in
producing neurons, astrocytes, oligodendrocytes, and progenitor
cells thereof for transplantation, for experimental evaluation, as
a source of lineage- and cell-specific products, and the like, for
example for use in treating human disorders of the CNS. Also
provided are methods, compositions and kits for screening candidate
agents for activity in directly converting somatic cells into
neurons, astrocytes, and oligodendrocytes. These and other objects,
advantages, and features of the invention will become apparent to
those persons skilled in the art upon reading the details of the
subject methods and compositions as more fully described below.
[0038] The terms "induced neuronal cell," "iN cell," "induced
neuron," or "iN" encompass cells of the neuronal lineage i.e.
mitotic neuronal progenitor cells and post-mitotic neuronal
precursor cells and mature neurons, that arise from a non-neuronal
cell by experimental manipulation. Induced neuronal cells express
markers specific for cells of the neuronal lineage, e.g. Tau, Tuj1,
MAP2, NeuN, and the like, and may have characteristics of
functional neurons, that is, they may be able to be depolarized,
i.e. propagate an action potential, and they may be able to make
and maintain synapses with other neurons.
[0039] The terms "induced astrocytic cell," "iA cell," "induced
astrocyte," or "iA" encompass cells of the astrocyte lineage, i.e.
glial progenitor cells, astrocyte precursor cells, and mature
astocytes, that arise from a non-astrocytic cell by experimental
manipulation. Induced astrocytes express markers specific for cells
of the astrocyte lineage, e.g. GFAP, S-100, Fgfr3 and the like, and
may have characteristics of functional astrocytes, that is, they
may have the capacity of promoting synaptogenesis in primary
neuronal cultures.
[0040] The terms "induced oligodendrocytic cell," "iO cell,"
"induced oligodendrocyte," or "iO" encompass cells of the
oligodendrocyte lineage, i.e. glial progenitor cells,
oligodendrocyte precursor cells, and mature oligodendrocytes that
arise from a non-oligodendrocytic cell by experimental
manipulation. Induced oligodendrocytes express markers specific for
cells of the oligodendrocyte lineage, e.g. Olig1/2, 04, MBP, NG2
and the like, and may have characteristics of functional
oligodendrocytes, that is, they may be able to myelinate neuronal
axons in vivo and in vitro.
[0041] The terms "induced neural stem cell" or "iNSC" encompass
neural stem cells that arise from a non-neuronal cell by
experimental manipulation. Neural stem cells are self-renewing
multipotent progenitor cells of the CNS. By self-renewing, it is
meant that when they undergo mitosis, they produce at least one
daughter cell that is a neural stem cell. By multipotent it is
meant that it is capable of giving rise to progenitor cell
(neuronal progenitors and glial progenitors) that give rise to all
cell types of the central nervous system (CNS), i.e. neurons,
astrocytes, and oligodendrocytes. They are not pluripotent, that
is, they are not capable of giving rise to cells of other organs.
Induced neural stem cells express the markers Nestin, GFAP, Pax6,
Brn2, and musashi. In addition, they are mitotic so can incorporate
BrdU into their DNA. They often grow as clumps or spheres
(neurospheres) in culture.
[0042] The term "somatic cell" encompasses any cell in an organism
that cannot give rise to all types of cells in an organism, i.e. it
is not pluripotent. In other words, somatic cells are cells that
have differentiated sufficiently that they will not naturally
generate cells of all three germ layers of the body, i.e. ectoderm,
mesoderm and endoderm.
[0043] The term "pluripotent" or "pluripotency" refers to cells
with the ability to give rise to progeny that can undergo
differentiation, under appropriate conditions, into cell types that
collectively exhibit characteristics associated with cell lineages
from the three germ layers (endoderm, mesoderm, and ectoderm). A
"stem cell" is a cell characterized by the ability of self-renewal
through mitotic cell division and the potential to differentiate
into a tissue or an organ. Among mammalian stem cells, embryonic
and somatic stem cells may be distinguished. Pluripotent stem
cells, which include embryonic stem cells, embryonic germ cells and
induced pluripotent cells, can contribute to tissues of a prenatal,
postnatal or adult organism.
[0044] The terms "primary cells", "primary cell lines", and
"primary cultures" are used interchangeably herein to refer to
cells and cell cultures that have been derived from a subject and
allowed to grow in vitro for a limited number of passages, i.e.
splittings, of the culture. For example primary cultures are
cultures that may have been passaged 0 times, 1 time, 2 times, 4
times, 5 times, 10 times, or 15 times, but not enough times go
through the crisis stage. Typically, the primary cell lines of the
present invention are maintained for fewer than 10 passages in
vitro.
[0045] The terms "neuron reprogramming factors" or "NR factors"
refer to one or more, i.e. a cocktail, of biologically active
factors that act on a non-neuronal cell to promote the
reprogramming, i.e. direct conversion, of the targeted cell into a
neuron.
[0046] The terms "astrocyte reprogramming factors" or "AR factors"
refer to one or more, i.e. a cocktail, of biologically active
factors that act on a non-astrocytic cell to promote the
reprogramming, i.e. direct conversion, of a non-astrocytic cell
into an astrocyte.
[0047] The terms "oligodendrocyte reprogramming factors" or "OR
factors" refer to one or more, i.e. a cocktail, of biologically
active factors that act on a non-oligodendrocytic cell to promote
the reprogramming, i.e. direct conversion, of a
non-oligodendrocytic cell into an oligodendrocyte.
[0048] The terms neural stem cell (NSC) reprogramming factors" or
"NSCR factors" refer to one or more, i.e. a cocktail, of
biologically active factors that act to promote the reprogramming,
i.e. direct conversion, of non-neuronal cell into a neural stem
cell.
[0049] The term "neuron reprogramming system" or "NR system" refers
to reagents and culture conditions that promote the reprogramming,
i.e. direct conversion, of non-neuronal cells to induced neuronal
cells (iNs), where the non-neuronal cells may be somatic cells or
may be pluripotent cells. An NR system comprises one or more, i.e.
a cocktail, of somatic cell-to-neuron reprogramming factors. An NR
may also optionally comprise other reagents, such as agents that
promote cell reprogramming, agents that promote the survival and
differentiation of neurons, agents that promote the differentiation
of subtypes of neurons, and the like, as known in the art. An NR
system does not induce a non-neuronal somatic cell to become
pluripotent, e.g. an induced pluripotent stem cell (iPS), in the
course of conversion into induced neuronal cells. In other words,
an NR system induces the direct conversion of somatic cells of one
lineage into induced neuronal cells (iNs), or induces pluripotent
cells to become neuronal cells. Thus, for example, the NR system
does not require iPS reprogramming factors as they are known in the
art, e.g. Oct3/4, SOX2, KLF4, MYC, Nanog, or Lin28; or culture
conditions developed in the art for culturing pluripotent stem
cells, e.g. culture in hanging droplets.
[0050] The term "astrocyte reprogramming system" or "AR system"
refers to reagents and culture conditions that promote the
reprogramming, i.e. direct conversion, of non-astrocytic cells into
induced astrocytes (iAs). An AR system comprises one or more, i.e.
a cocktail, of cell-to-astrocyte reprogramming factors. An AR may
also optionally comprise other reagents, such as agents that
promote cell reprogramming, agents that promote the survival and
differentiation of astrocytes, agents that promote the
differentiation of subtypes of astrocytes, and the like, as known
in the art. An AR system does not induce the non-astrocytic cell to
become pluripotent, e.g. an induced pluripotent stem cell (iPS), in
the course of conversion into an induced astrocyte. In other words,
an AR system induces the direct conversion of cells of a
non-astrocyte lineage into induced astrocytes.
[0051] The term "oligodendrocyte reprogramming system" or "OR
system" refers to reagents and culture conditions that promote the
reprogramming, i.e. direct conversion, of non-oligodendrocytic
cells to induced oligodendrocytes (iOs). An OR system comprises one
or more, i.e. a cocktail, of oligodendrocyte reprogramming factors.
An OR may also optionally comprise other reagents, such as agents
that promote cell reprogramming, agents that promote the survival
and differentiation of oligodendrocytes, agents that promote the
differentiation of subtypes of oligodendrocytes, and the like, as
known in the art. An OR system does not induce the
non-oligodendrocytic cell to become pluripotent, e.g. an induced
pluripotent stem cell (iPS), in the course of conversion into an
induced oligodendrocyte. In other words, an OR system induces the
direct conversion of cells of a non-oligodendrocyte lineage into
induced oligodendrocytes.
[0052] The term "neural stem cell (NSC) reprogramming system" or
"NSCR system" refers to reagents and culture conditions that
promote the reprogramming, i.e. direct conversion, of post-mitotic
somatic cells to induced neural stem cells (iNSCs). An NSCR system
comprises one or more, i.e. a cocktail, of cell-to-NSC
reprogramming factors. An NSCR may also optionally comprise other
reagents, such as agents that promote cell reprogramming, agents
that promote the survival and proliferation of neural stem cells,
and the like, as known in the art. An NSCR system does not induce
the cell to become pluripotent, e.g. an induced pluripotent stem
cell (iPS), in the course of conversion into an induced neural stem
cell. In other words, an NSCR system induces the direct conversion
of cells into induced neural stem cells.
[0053] The terms "efficiency of reprogramming", "reprogramming
efficiency", "efficiency of conversion", or "conversion efficiency"
are used interchangeably herein to refer to the ability of a
culture of cells of one cell lineage to give rise to an induced
cell of another cell lineage when contacted with the reprogramming
system, for example, the ability of a culture of somatic cells to
give rise to induced neurons (iNs) when contacted with a
cell-to-neuron reprogramming (NR) system. By "enhanced efficiency
of reprogramming" or "enhanced efficiency of conversion" it is
meant an enhanced ability of a culture of somatic cells to give
rise to the induced cell when contacted with the reprogramming
system relative to a culture of somatic cells that is not contacted
with the reprogramming system, for example, an enhanced ability of
a culture of cells to give rise to iN cells when contacted with an
NR system relative to a culture of cells that is not contacted with
the same NR system. By enhanced, it is meant that the primary cells
or primary cell cultures have an ability to give rise to the
induced cells (e.g. iN cells) that is greater than the ability of a
population that is not contacted with the reprogramming system
(e.g. a NR system), i.e. 150%, 200%, 300%, 400%, 600%, 800%, 1000%,
or 2000% of the ability of the uncontacted population. In other
words, the primary cells or primary cell cultures produce about
1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 6-fold,
about 8-fold, about 10-fold, about 20-fold, about 30-fold, about
50-fold, about 100-fold, about 200-fold the number of induced cells
(e.g. iN cells) as the uncontacted population, or more.
[0054] The terms "treatment", "treating", "treat" and the like are
used herein to generally refer to obtaining a desired pharmacologic
and/or physiologic effect. The effect may be prophylactic in terms
of completely or partially preventing a disease or symptom thereof
and/or may be therapeutic in terms of a partial or complete
stabilization or cure for a disease and/or adverse effect
attributable to the disease. "Treatment" as used herein covers any
treatment of a disease in a mammal, particularly a human, and
includes: (a) preventing the disease or symptom from occurring in a
subject which may be predisposed to the disease or symptom but has
not yet been diagnosed as having it; (b) inhibiting the disease
symptom, i.e., arresting its development; or (c) relieving the
disease symptom, i.e., causing regression of the disease or
symptom.
[0055] The terms "individual," "subject," "host," and "patient,"
are used interchangeably herein and refer to any mammalian subject
for whom diagnosis, treatment, or therapy is desired, particularly
humans.
[0056] The subject invention is directed to methods of
reprogramming, i.e. converting a somatic cell of one lineage into a
somatic cell of a different lineage by contacting the starting
somatic cell with a reprogramming system comprising one or more
somatic cell reprogramming factors; or of programming a pluripotent
cell to rapidly convert to a neuronal cell. Examples of neuronal
cells that may be generated by the methods of the invention include
neurons, astrocytes, oligodendrocytes, and progenitor cells
thereof. In some embodiments he following description focuses on
reprogramming, i.e. converting, non-neuronal somatic cells into
neurons by contacting them with a somatic cell-to-neuron
reprogramming system (NR system) comprising one or more somatic
cell-to-neuron reprogramming factors (NR factors). However, with
the exception of the reprogramming factors and the reprogramming
systems used in the method, the subject methods and the reagents,
devices and kits thereof also find use in converting non-astrocytic
somatic cells into astrocytes, non-oligodendrocytic somatic cells
into oligodendrocytes, and post-mitotic somatic cells of any
lineage into neural stem cells as well.
Neuron Reprogramming (NR) Factors and Systems
[0057] Neuron reprogramming (NR) factors are biologically active
factors that act on a cell to alter transcription so as to convert
the cell into a neuron, i.e. an induced neuron (iN). NR factors are
provided to somatic or pluripotent cells in the context of a NR
system. Examples of NR factors include an Ascl agent, a Ngn agent,
a NeuroD agent, a Brn agent, a Myt agent, an Olig agent and a Zic
agent In certain embodiments, particularly for human cells, neuron
reprogramming factors are combination of an Ascl agent, a Brn
agent, a NeuroD agent, and a Myt1 agent, which combinations of
interest include without limitation, Ascl1, Brn2, Myt1l and
NeuroD1.
[0058] The term Ascl agent is used to refer to Ascl
(achaete-scute-like) polypeptides and the nucleic acids that encode
them. Ascl polypeptides are basic helix-loop-helix transcription
factors of the achaete-scute family, which activate transcription
by binding to the E box (5'-CANNTG-3). The terms "Ascl gene
product", "Ascl polypeptide", and "Ascl protein" are used
interchangeably herein to refer to native sequence Ascl
polypeptides, Ascl polypeptide variants, Ascl polypeptide fragments
and chimeric Ascl polypeptides that can modulate transcription.
Native sequence Ascl polypeptides include the proteins Ascl1
(achaete-scute complex homolog 1 (Drosophila); ASH1; HASH1; MASH1;
bHLHa46; GenBank Accession Nos. NM_004316.3 and NP_004307.2); Ascl2
(achaete-scute complex homolog 2 (Drosophila); ASH2; HASH2; MASH2;
bHLHa45; GenBank Accession Nos. NM_005170.2 and NP_005161.1); Ascl3
(achaete-scute complex homolog 3 (Drosophila); SGN1; HASH3;
bHLHa42; GenBank Accession Nos. NM_020646.1 and NP_065697.1); Ascl4
(achaete-scute complex homolog 4 (Drosophila); HASH4; bHLHa44;
GenBank Accession Nos. NM_203436.2 and NP_982260.2; and Ascl5
(achaete-scute complex homolog 5 (Drosophila); bHLHa47; GenBank
Accession Nos. XM_001719321.2 and XP_001719373.2). Ascl
polypeptides, e.g. those that are at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical
to the sequence provided in the GenBank Accession Nos. above find
use as reprogramming factors in the present invention, as do
nucleic acids encoding these polypeptides or their
transcriptionally active domains and vectors comprising these
nucleic acids. In certain embodiments, the Ascl agent is an Ascl1
agent.
[0059] Ngn (neurogenin) polypeptides are basic helix-loop-helix
transcription factors of the neurogenin family of proteins. The
terms "Ngn gene product", "Ngn polypeptide", and "Ngn protein" are
used interchangeably herein to refer to native sequence Ngn
polypeptides, Ngn polypeptide variants, Ngn polypeptide fragments
and chimeric Ngn polypeptides that can modulate transcription.
Native sequence Ngn polypeptides include the proteins Ngn1
(NeuroG1; AKA; Math4C; bHLHa6; NeuroD3; GenBank Accession Nos.
NM_006161.2 and NP_006152.2); Ngn2 (NeuroG2; Atoh4; Math4A; bHLHa8;
MGC46562; GenBank Accession Nos. NM_024019.2 and NP_076924.1); and
Ngn3 (NeuroG3; Atoh5; Math4B; bHLHa7; GenBank Accession Nos.
NM_020999.2 and NP_066279.2). Ngn polypeptides, e.g. those that are
at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
95%, 97%, 99%, or are 100% identical to the sequence provided in
the GenBank Accession Nos. above find use as reprogramming factors
in the present invention, as do nucleic acids encoding these
polypeptides or their transcriptionally active domains and vectors
comprising these nucleic acids. In certain embodiments, the Ngn
agent is an Ngn1 agent or an Ngn2 agent.
[0060] NeuroD (neurogenic differentiation) polypeptides are basic
helix-loop-helix transcription factors of the neurogenic
differentiation family of proteins. The terms "NeuroD gene
product", "NeuroD polypeptide", and "NeuroD protein" are used
interchangeably herein to refer to native sequence NeuroD
polypeptides, NeuroD polypeptide variants, NeuroD polypeptide
fragments and chimeric NeuroD polypeptides that can modulate
transcription. Native sequence NeuroD polypeptides include the
proteins NeuroD1 (GenBank Accession Nos. NM_002500.2 and
NP_002491.2); NeuroD2 (GenBank Accession Nos. NM_006160.3 and
NP_006151.3); and NeuroD4 (GenBank Accession Nos. NM_021191.2 and
NP_067014.2). NeuroD polypeptides, e.g. those that are at least
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%,
99%, or are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the NeuroD agent is a
NeuroD1 agent.
[0061] Brn (Brain-specific homeobox) polypeptides are members of
the POU-domain containing family of transcription factors, which
bind with high affinity to octameric DNA sequences. The terms "Brn
gene product", "Brn polypeptide", and "Brn protein" are used
interchangeably herein to refer to native sequence Brn
polypeptides, Brn polypeptide variants, Brn polypeptide fragments
and chimeric Brn polypeptides. Native sequence Brn polypeptides
include the proteins Brn1 (POU class 3 homeobox 3; POU3F3; and
OTF8; GenBank Accession Nos. NM_006236.1 and NP_006227.1); Brn2
(POU class 3 homeobox 2; POU3F2; POU3F; OCT7; OTF7; GenBank
Accession Nos. NM_005604.2 and NP_005595.2); Brn3A (POU class 4
homeobox 1; POU4F1; RDC-1; Oct-T1; FLJ13449; GenBank Accession Nos.
NM_006237.3 and NP_006228.3); Brn3B (POU class 4 homeobox 2;
POU4F2; BRN3.2; GenBank Accession Nos. NM_004575.2 and
NP_004566.2); Brn3C (POU class 4 homeobox 3; POU4F3; DFNA15;
MGC138412; GenBank Accession Nos. NM_002700.2 and NP_002691.1);
Brn4 (POU class 3 homeobox 4; POU3F4; DFN3; OTF9; DFNX2; GenBank
Accession Nos. NM_000307.3 and NP_000298.2); and Brn5 (POU class 6
homeobox 1; POU6F1 MPOU; TCFB1; GenBank Accession Nos. NM_002702.3
and NP_002693.3). Brn polypeptides, e.g. those that are at least
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%,
99%, or are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Brn agent is a
Brn2 agent or a Brn4 agent.
[0062] Myt (myelin transcription factor) polypeptides are members
of the Myt family of zinc-finger transcription factors. The terms
"Myt gene product", "Myt polypeptide", and "Myt protein" are used
interchangeably herein to refer to native sequence Myt1
polypeptides, Myt polypeptide variants, Myt polypeptide fragments
and chimeric Myt polypeptides that can modulate transcription.
Native sequence Myt1 polypeptides include the proteins Myt1 (Nzf2;
Nztf2; and mKIAA0835; GenBank Accession Nos. NM_008665.3 and
NP_032691.2); and Myt1l (myelin transcription factor 1-like; NZF1;
Neural zinc finger transcription factor 1; GenBank Accession Nos.
NM_015025.2 and NP_055840.2). Myt polypeptides, e.g. those that are
at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
95%, 97%, 99%, or are 100% identical to the sequence provided in
the GenBank Accession Nos. above find use as reprogramming factors
in the present invention, as do nucleic acids encoding these
polypeptides or their transcriptionally active domains and vectors
comprising these nucleic acids. In certain embodiments, the Myt
agent is a Myt1l agent.
[0063] Olig (oligodendrocyte lineage transcription factor)
polypeptides are members of the basic helix-loop-helix family of
transcription factors. The terms "Olig gene product", "Olig
polypeptide", and "Olig protein" are used interchangeably herein to
refer to native sequence Olig polypeptides, Olig polypeptide
variants, Olig polypeptide fragments and chimeric Olig polypeptides
that can modulate transcription. Native sequence Olig polypeptides
include the proteins Olig1 (BHLHB6 and BHLHE21; GenBank Accession
Nos. NM_138983.2 and NP_620450.2); Olig2 (BHLHB1; OLIG02; RACK17;
PRKCBP2; bHLHe19; GenBank Accession Nos. NM_005806.2 and
NP_005797.1); and Olig3 (Bhlhb7; bHLHe20; GenBank Accession Nos.
NM_175747.2 and NP_786923.1). Olig polypeptides, e.g. those that
are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
95%, 97%, 99%, or are 100% identical to the sequence provided in
the GenBank Accession Nos. above find use as reprogramming factors
in the present invention, as do nucleic acids encoding these
polypeptides or their transcriptionally active domains and vectors
comprising these nucleic acids. In certain embodiments, the Olig
agent is an Olig2 agent.
[0064] Zic polypeptides are members of the C2H2-type zinc finger
family of transcription factors. The terms "Zic gene product", "Zic
polypeptide", and "Zic protein" are used interchangeably herein to
refer to native sequence Zic polypeptides, Zic polypeptide
variants, Zic polypeptide fragments and chimeric Zic polypeptides
that can modulate transcription. Native sequence Zic polypeptides
include the proteins Zic1 (ZIC, ZNF201; GenBank Accession Nos.
NM_003412.3 and NP_003403.2); Zic2 (HEPS; GenBank Accession Nos.
NM_007129.2 and NP_009060.2); Zic3 (HTX; HTX1; ZNF203; GenBank
Accession Nos. NM_003413.3 and NP_003404.1); Zic4 (FLJ42609;
FLJ45833; GenBank Accession Nos. NM_001168378.1 (isoform 1),
NM_001168379.1 (isoform 2), and NM_032153.4 (isoform 3)); and Zic5
(GenBank Accession Nos. NM_033132.3 and NP_149123.2). Zic
polypeptides, e.g. those that are at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical
to the sequence provided in the GenBank Accession Nos. above find
use as reprogramming factors in the present invention, as do
nucleic acids encoding these polypeptides or their
transcriptionally active domains and vectors comprising these
nucleic acids. In certain embodiments, the Zic agent is a Zic1
agent.
[0065] In some embodiments, the one or more NR factors are provided
as nuclear acting polypeptides. In other words, the subject cells
are contacted with NR polypeptides that act in the nucleus.
[0066] To promote transport of NR polypeptides across the cell
membrane, NR polypeptide sequences may be fused to a polypeptide
permeant domain. A number of permeant domains are known in the art
and may be used in the nuclear acting polypeptides of the present
invention, including peptides, peptidomimetics, and non-peptide
carriers. For example, a permeant peptide may be derived from the
third alpha helix of Drosophila melanogaster transcription factor
Antennapaedia, referred to as penetratin, which comprises the amino
acid sequence (SEQ ID NO:1) RQIKIWFQNRRMKWKK. As another example,
the permeant peptide comprises the HIV-1 that basic region amino
acid sequence, which may include, for example, amino acids 49-57 of
naturally-occurring that protein. Other permeant domains include
poly-arginine motifs, for example, the region of amino acids 34-56
of HIV-1 rev protein, nona-arginine, octa-arginine, and the like.
(See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003
Apr. 4(2): 87-96; and Wender et al. (2000) Proc. Natl. Acad. Sci.
U.S.A 2000 Nov. 21; 97(24):13003-8; published U.S. Patent
applications 20030220334; 20030083256; 20030032593; and
20030022831, herein specifically incorporated by reference for the
teachings of translocation peptides and peptoids). The
nona-arginine (R9) sequence is one of the more efficient PTDs that
have been characterized (Wender et al. 2000; Uemura et al.
2002).
[0067] The NR polypeptides may be prepared by in vitro synthesis,
using conventional methods as known in the art. Various commercial
synthetic apparatuses are available, for example, automated
synthesizers by Applied Biosystems, Inc., Beckman, etc. By using
synthesizers, naturally occurring amino acids may be substituted
with unnatural amino acids. The particular sequence and the manner
of preparation will be determined by convenience, economics, purity
required, and the like. Other methods of preparing polypeptides in
a cell-free system include, for example, those methods taught in
U.S. Application Ser. No. 61/271,000, which is incorporated herein
by reference.
[0068] The NR polypeptides may also be isolated and purified in
accordance with conventional methods of recombinant synthesis. A
lysate may be prepared of the expression host and the lysate
purified using HPLC, exclusion chromatography, gel electrophoresis,
affinity chromatography, or other purification technique. For the
most part, the compositions which are used will comprise at least
20% by weight of the desired product, more usually at least about
75% by weight, preferably at least about 95% by weight, and for
therapeutic purposes, usually at least about 99.5% by weight, in
relation to contaminants related to the method of preparation of
the product and its purification. Usually, the percentages will be
based upon total protein. NR polypeptides may be produced
recombinantly not only directly, but also as a fusion polypeptide
with a heterologous polypeptide, e.g. a polypeptide having a
specific cleavage site at the N-terminus of the mature protein or
polypeptide. Expression vectors usually contain a selection gene,
also termed a selectable marker. This gene encodes a protein
necessary for the survival or growth of transformed host cells
grown in a selective culture medium.
[0069] Following purification by commonly known methods in the art,
NR polypeptides are provided to the subject cells by standard
protein transduction methods. In some cases, the protein
transduction method includes contacting cells with a composition
containing a carrier agent and at least one purified NR
polypeptide. Examples of suitable carrier agents and methods for
their use include, but are not limited to, commercially available
reagents such as Chariot.TM. (Active Motif, Inc., Carlsbad, Calif.)
described in U.S. Pat. No. 6,841,535; Bioport.TM. (Gene Therapy
Systems, Inc., San Diego, Calif.), GenomeONE (Cosmo Bio Co., Ltd.,
Tokyo, Japan), and ProteoJuice.TM. (Novagen, Madison, Wis.), or
nanoparticle protein transduction reagents as described in, e.g.,
U.S. patent application Ser. No. 10/138,593.
[0070] In other embodiments, the one or more NR factors are nucleic
acids encoding NR polypeptides, i.e. NR nucleic acids. Vectors used
for providing NR nucleic acids to the subject cells will typically
comprise suitable promoters for driving the expression, that is,
transcriptional activation, of the nucleic acids. This may include
ubiquitously acting promoters, for example, the CMV-.beta.-actin
promoter, or inducible promoters, such as promoters that are active
in particular cell populations or that respond to the presence of
drugs such as tetracycline. By transcriptional activation, it is
intended that transcription will be increased above basal levels in
the target cell by at least about 10-fold, by at least about
100-fold, more usually by at least about 1000-fold. In addition,
vectors used for providing the nucleic acids may include genes that
must later be removed, e.g. using a recombinase system such as
Cre/Lox, or the cells that express them destroyed, e.g. by
including genes that allow selective toxicity such as herpesvirus
TK, bcl-xs, etc
[0071] NR nucleic acids may be provided directly to the subject
cells. In other words, the cells are contacted with vectors
comprising NR nucleic acids such that the vectors are taken up by
the cells. Methods for contacting cells with nucleic acid vectors,
such as electroporation, calcium chloride transfection, and
lipofection, are well known in the art. Vectors that deliver
nucleic acids in this manner are usually maintained episomally,
e.g. as plasmids or minicircle DNAs.
[0072] Alternatively, the nucleic acid may be provided to the
subject cells via a virus. In other words, the cells are contacted
with viral particles comprising the NR nucleic acids. Retroviruses,
for example, lentiviruses, are particularly suitable to such
methods. Commonly used retroviral vectors are "defective", i.e.
unable to produce viral proteins required for productive infection.
Rather, replication of the vector requires growth in a packaging
cell line. To generate viral particles comprising nucleic acids of
interest, the retroviral nucleic acids comprising the nucleic acid
are packaged into viral capsids by a packaging cell line. Different
packaging cell lines provide a different envelope protein to be
incorporated into the capsid, this envelope protein determining the
specificity of the viral particle for the cells. Envelope proteins
are of at least three types, ecotropic, amphotropic and xenotropic.
Retroviruses packaged with ecotropic envelope protein, e.g. MMLV,
are capable of infecting most murine and rat cell types, and are
generated by using ecotropic packaging cell lines such as BOSC23
(Pear et al. (1993) P.N.A.S. 90:8392-8396). Retroviruses bearing
amphotropic envelope protein, e.g. 4070A (Danos et al, supra.), are
capable of infecting most mammalian cell types, including human,
dog and mouse, and are generated by using amphotropic packaging
cell lines such as PA12 (Miller et al. (1985) Mol. Cell. Biol.
5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol.
6:2895-2902); GRIP (Danos et al. (1988) PNAS 85:6460-6464).
Retroviruses packaged with xenotropic envelope protein, e.g. AKR
env, are capable of infecting most mammalian cell types, except
murine cells. The appropriate packaging cell line may be used to
ensure that the subject cells are targeted by the packaged viral
particles. Methods of introducing the retroviral vectors comprising
NR nucleic acids into packaging cell lines and of collecting the
viral particles that are generated by the packaging lines are well
known in the art.
[0073] In some embodiments, only one NR factor is provided, e.g. an
Ascl agent (A), an Ngn agent (N); a NeuroD agent (Nd), a Brn agent
(B), a Myt agent (M), an Olig agent (0), or a Zic agent (Z). In
some embodiments, a set of at least two agents is provided, e.g. an
Ascl agent and a Brn agent; an Ascl agent and a Myt agent; an Ascl
agent and Olig agent; an Ascl agent and a Zic agent; a Ngn agent
and a Brn agent; a Ngn agent and a Myt agent; a Ngn agent and Olig
agent; a Ngn agent and a Zic agent; a NeuroD agent and a Brn agent;
a NeuroD agent and a Myt agent; a NeuroD agent and Olig agent; a
NeuroD agent and a Zic agent; a Brn agent and a Myt1 I agent. In
some embodiments, a set of at least three agents is provided, e.g.,
an Ascl agent, a Brn agent, and a Myt agent (BAM); an Ascl agent, a
Brn agent and a Zic agent (BAZ); an Ascl agent, a Myt agent and an
Olig agent (AMO); an Ascl agent, an Olig agent and a Zic agent
(AOZ); an Ascl agent, a Brn agent, and an Olig agent (ABO); an Ascl
agent, a Myt agent, and a Zic agent (AMZ); a Brn agent, a Myt
agent, and a Zic agent (BMZ); a Brn agent, a Myt agent, and an Olig
agent (BMO); an Ngn agent, a Brn agent, and a Myt agent (NBM); a
Ngn agent, a Brn agent and a Zic agent (NBZ); a Ngn agent, a Myt
agent and an Olig agent (NMO); a Ngn agent, an Olig agent and a Zic
agent (NOZ); a Ngn agent, a Brn agent, and an Olig agent (NBO); a
Ngn agent, a Myt agent, and a Zic agent (NMZ); a NeuroD agent, a
Brn agent, and a Myt agent (NdBM); a NeuroD agent, a Brn agent and
a Zic agent (NdBZ); a NeuroD agent, a Myt agent and an Olig agent
(NdMO); a NeuroD agent, an Olig agent and a Zic agent (NdOZ); a
NeuroD agent, a Brn agent, and an Olig agent (NdBO); a NeuroD
agent, a Myt agent, and a Zic agent (NdMZ). In some embodiments, a
set of at least four agents is provided, e.g., an Ascl agent, a Brn
agent, a Myt agent and an Olig agent (ABMO); an Ascl agent, a Brn
agent, a Myt agent, and a Zic agent (ABMZ); an Ascl agent, a Brn
agent, an Olig agent and a Zic agent (ABOZ); an Ascl agent, a Myt
agent, an Olig agent, and a Zic agent (AMOZ); a Ngn agent, a Brn
agent, a Myt and an Olig agent (NBMO); a Ngn agent, a Brn agent, a
Myt agent, and a Zic agent (NBMZ); a Ngn agent, a Brn agent, an
Olig agent and a Zic agent (NBOZ); a Ngn agent, a Myt agent, an
Olig agent, and a Zic agent (NMOZ); a NeuroD agent, a Brn agent, a
Myt and an Olig agent (NdBMO); a NeuroD agent, a Brn agent, a Myt
agent, and a Zic agent (NdBMZ); a NeuroD agent, a Brn agent, an
Olig agent and a Zic agent (NdBOZ); a NeuroD agent, a Myt agent, an
Olig agent, and a Zic agent (NdMOZ);a Brn agent, a Myt agent, an
Olig agent, and a Zic agent (BMOZ). In some embodiments, a set of
at least five agents is provided, e.g. an Ascl agent, a Brn agent,
a Myt agent, an Olig agent, and a Zic agent (ABMOZ); an Ngn agent,
a Brn agent, a Myt agent, an Olig agent, and a Zic agent (NBMOZ); a
NeuroD agent, a Brn agent, a Myt agent, an Olig agent, and a Zic
agent (NdBMOZ). In some embodiments, a set of six agents is
provided, e.g. an Ascl agent, an Ngn agent, a Brn agent, a Myt
agent, an Olig agent, and a Zic agent (ANBMOZ). In some
embodiments, a set of seven agents is provided, e.g. an Ascl agent,
an Ngn agent, a NeuroD agent, a Brn agent, a Myt agent, an Olig
agent, and a Zic agent (ANNdBMOZ).
[0074] When more than one NR factors is provided, the NR factors
may be provided individually or as a single composition, that is,
as a premixed composition, of factors. The NR factors may be added
to the subject cells simultaneously or sequentially at different
times. NR factors may be provided to non-neuronal somatic cells
individually or as a single composition, that is, as a premixed
composition, of NRs. The factors may be provided at the same molar
ratio or at different molar ratios. The factors may be provided
once or multiple times in the course of culturing the cells of the
subject invention. For example, the agent(s) may be provided to the
subject cells one or more times and the cells allowed to incubate
with the agents for some amount of time following each contacting
event, e.g. 16-24 hours, after which time the media is replaced
with fresh media and the cells are cultured further.
[0075] In addition to the one or more NR factors, the NR system may
include other reagents. For example, the NR system may include one
or more agents known in the art to promote cell reprogramming.
Examples of agents known in the art to promote cell reprogramming
include GSK-3 inhibitors (e.g. CHIR99021 and the like (see, e.g.,
Li, W. et al. (2009) Stem Cells, Epub Oct. 16 2009)); histone
deacetylase (HDAC) inhibitors (e.g., those described in
US20090191159, the disclosure of which is incorporated herein by
reference); histone methyltransferase inhibitors (e.g. G9a histone
methyltransferase inhibitors, e.g. BIX-01294, and the like (see,
e.g. Shi, Y et al. (2008) Cell Stem Cells 3(5):568-574)); agonists
of the dihydropyridine receptor (e.g. BayK8644, and the like (see,
e.g., Shi, Y et al. (2008) Cell Stem Cell 3(5):568-574)); and
inhibitors of TGF.beta. signaling (e.g. RepSox and the like (see,
e.g. Ichide, J K. et al. (2009) Cell Stem Cell 5(5):491-503)).
Examples of agents known in the art to promote cell reprogramming
also include agents that reduce the amount of methylated DNA in a
cell, for example by suppressing DNA methylation activity in the
cell or promoting DNA demethylation activity in a cell. Examples of
agents that suppress DNA methylation activity include, e.g., agents
that inhibit DNA methyltransferases (DNMTs), e.g. 5-aza-cytidine,
5-aza-2'-deoxycytidine, MG98, S-adenosyl-homocysteine (SAH) or an
analogue thereof (e.g. periodate-oxidized adenosine or
3-deazaadenosine), DNA-based inhibitors such as those described in
Bigey, P. et al (1999) J. Biol. Chem. 274:459-44606, antisense
nucleotides such as those described in Ramchandani, S et al, (1997)
Proc. Natl. Acad. Sci. USA 94: 684-689 and in Fournel, M et al,
(1999) J. Biol. Chem. 274:24250-24256, or any other DNMT inhibitor
known in the art. Examples of agents that promote DNA demethylation
activity include, e.g., cytidine deaminases, e.g. AID/APOBEC agents
(Bhutani, N et al. (2009) Nature. Dec 21. [Epub ahead of print];
Rai, K. et al. (2008) Cell 135:1201-1212), agents that promote G:T
mismatch-specific repair activity, e.g. Methyl binding domain
proteins (e.g. Mbp4) and thymine-DNA glycosylase (TDG) protein
(Rai, K. et al. (2008) Cell 135:1201-1212), agents that promote
growth arrest and DNA-damage-inducible 45 (GADD45) activity protein
(Rai, K. et al. (2008) Cell 135:1201-1212), and the like.
[0076] Other reagents of interest for optional inclusion in the NR
system are agents known in the art to promote the survival and
differentiation of stem cells into neurons and/or mitotic neuronal
progenitors or post-mitotic neuronal precursors into neurons. These
include, for example, B27 (Invitrogen), glucose, transferrin, serum
(e.g. fetal bovine serum, and the like), and the like. See, e.g.
the Examples section presented below.
[0077] Other reagents of interest for optional inclusion in the NR
system are agents that inhibit proliferation, e.g. AraC.
[0078] Other reagents of interest for optional inclusion in the NR
system are agents known in the art to promote the differentiation
of neuronal precursors into particular neuronal subtypes. For
example, to promote differentiation into excitatory (glutamatergic)
neurons, cells may also be contacted with Tlx polypeptides or
nucleic acids encoding these polypeptides (e.g. Cheng, L. et al.
(2004) Nat. Neurosci. 7(5):510-517). To promote differentiation
into inhibitory (GABAergic) neurons, cells may also be contacted
with Lbx1 polypeptides or nucleic acids encoding these polypeptides
(e.g. Cheng, L. et al. (2005) Nature Neuroscience 8(11):1510-1515).
To promote differentiation into dopaminergic (DA) neurons, cells
may also be co-cultured with a PA6 mouse stromal cell line under
serum-free conditions, see, e.g., Kawasaki et al., (2000) Neuron,
28(1):3140. To promote differentiation into cholinergic neurons,
cells may also be contacted with Lhx8 polypeptides or nucleic acids
encoding these polypeptides (Manabe, T. et al. (2007) Cell Death
and Differentiation 14: 1080-1085). To promote differentiation of
spinal cord motor neurons, cells may also be contacted with Mnx1
(Hb9) (Wichterle, H et al. (2002) Cell 110(3):385-397). To promote
differentiation into corticospinal projection neurons, e.g. motor
neurons, cells may also be contacted with Fezf2 or Ctip2
polypeptides or nucleic acids encoding those polypeptides (e.g.
Molyneaux et al. (2005) Neuron 47(6):817-31; Chen et al. (2008)
Proc Natl Acad Sci USA 105(32):11382-7). To promote differentiation
of corticocortical projection neurons, e.g. callosal neurons, cells
may be contacted with Satb2 polypeptides or nucleic acids encoding
those polypeptides (e.g. Alcamo et al. (2008) Neuron 57(3):364-77;
Britanova et al. (2008) Neuron 57(3):378-92). To promote
differentiation of corticothalamic neurons, cells may be contacted
with Sox5 polypeptides or nucleic acids encoding those polypeptides
(e.g. Lai et al. (2008) Neuron 57(2):232-47). Other methods have
also been described, see, e.g., Pomp et al., (2005), Stem Cells
23(7):923-30; U.S. Pat. No. 6,395,546, e.g., Lee et al., (2000),
Nature Biotechnol., 18:675-679.
[0079] Reagents in the NR system may be provided in any culture
media known in the art to promote cell survival, e.g. DMEM,
Iscoves, Neurobasal media, etc. In some cases, the media will be
DMEM. In some cases, with media will be N3. Media may be
supplemented with agents that inhibit the growth of bacterial or
yeast, e.g. penicillin/streptomycin, a fungicide, etc., with agents
that promote health, e.g. glutamate, and other agents typically
provided to culture media as are known in the art of tissue
culture.
[0080] Non-NR factor reagents of the NR system, e.g. agents that
promote demethylation, agents that promote the survival and/or
differentiation of neurons or subtypes of neurons, agents that
inhibit proliferation, and the like, may be provided to the cells
prior to providing the NR factors. Alternatively, they may be
provided concurrently with providing the NR factors. Alternatively,
they may be provided subsequently to providing the NR factors.
[0081] The NR system is provided to non-neuronal somatic cells so
as to reprogram, i.e. convert, those cells into induced neuronal
cells. Non-neuronal somatic cells include any somatic cell that
would not give rise to a neuron in the absence of experimental
manipulation. Examples of non-neuronal somatic cells include
differentiating or differentiated cells from ectodermal (e.g.,
keratinocytes), mesodermal (e.g., fibroblast), endodermal (e.g.,
pancreatic cells), hepatocytes, e.g. oval cells, etc.;or neural
crest lineages (e.g. melanocytes). The somatic cells may be, for
example, pancreatic beta cells, oligodendrocytes, astrocytes,
hepatocytes, hepatic stem cells, cardiomyocytes, skeletal muscle
cells, smooth muscle cells, hematopoietic cells, osteoclasts,
osteoblasts, pericytes, vascular endothelial cells, schwann cells,
and the like. They may be terminally differentiated cells, or they
may be capable of giving rise to cells of a specific, non-neuronal
lineage, e.g. cardiac stem cells, hepatic stem cells, and the like.
The somatic cells are readily identifiable as non-neuronal by the
absence of neuronal-specific markers that are well-known in the
art, as described above.
In Vitro Methods of Conversion, and Uses for Cells Converted In
Vitro
[0082] In some embodiments, the somatic cells are contacted in
vitro with the NR system comprising NR factor(s). The subject cells
may be from any mammal, including humans, primates, domestic and
farm animals, and zoo, laboratory or pet animals, such as dogs,
cats, cattle, horses, sheep, pigs, goats, rabbits, rats, mice etc.
They may be established cell lines or they may be primary cells,
where "primary cells", "primary cell lines", and "primary cultures"
are used interchangeably herein to refer to cells and cells
cultures that have been derived from a subject and allowed to grow
in vitro for a limited number of passages.
[0083] The subject cells may be isolated from fresh or frozen
cells, which may be from a neonate, a juvenile or an adult, and
from tissues including skin, muscle, bone marrow, peripheral blood,
umbilical cord blood, spleen, liver, pancreas, lung, intestine,
stomach, adipose, and other differentiated tissues. The tissue may
be obtained by biopsy or aphoresis from a live donor, or obtained
from a dead or dying donor within about 48 hours of death, or
freshly frozen tissue, tissue frozen within about 12 hours of death
and maintained at below about -20.degree. C., usually at about
liquid nitrogen temperature (-190.degree. C.) indefinitely. For
isolation of cells from tissue, an appropriate solution may be used
for dispersion or suspension. Such solution will generally be a
balanced salt solution, e.g. normal saline, PBS, Hank's balanced
salt solution, etc., conveniently supplemented with fetal calf
serum or other naturally occurring factors, in conjunction with an
acceptable buffer at low concentration, generally from 5-25 mM.
Convenient buffers include HEPES, phosphate buffers, lactate
buffers, etc.
[0084] Cells contacted in vitro with the NR system of reagents,
i.e. the one or more NR factors and optionally the one or more
other agents that promote reprogramming and promote the growth
and/or differentiation of neurons, and the like, may be incubated
in the presence of the reagent(s) for about 30 minutes to about 24
hours, e.g., 1 hours, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5
hours 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16
hours, 18 hours, 20 hours, or any other period from about 30
minutes to about 24 hours, which may be repeated with a frequency
of about every day to about every 4 days, e.g., every 1.5 days,
every 2 days, every 3 days, or any other frequency from about every
day to about every four days. The agent(s) may be provided to the
subject cells one or more times, e.g. one time, twice, three times,
or more than three times, and the cells allowed to incubate with
the agent(s) for some amount of time following each contacting
event e.g. 16-24 hours, after which time the media is replaced with
fresh media and the cells are cultured further.
[0085] After contacting the non-neuronal somatic cells with the NR
system, the contacted cells may be cultured so as to promote the
survival and differentiation of neurons. Methods and reagents for
culturing cells to promote the growth of neurons or particular
subtypes of neurons and for isolating neurons or particular
subtypes of neurons are well known in the art, any of which may be
used in the present invention to grow and isolate the induced
neuronal cells. For example, the somatic cells (either pre- or
post-contacting with the NR factors) may be plated on Matrigel or
other substrate as known in the art. The cells may be cultured in
media such as N3, supplemented with factors. Alternatively, the
contacted cells may be frozen at liquid nitrogen temperatures and
stored for long periods of time, being capable of use on thawing.
If frozen, the cells will usually be stored in a 10% DMSO, 50% FCS,
40% RPMI 1640 medium. Once thawed, the cells may be expanded by use
of growth factors and/or stromal cells associated with neuronal
survival and differentiation.
[0086] The effective amount of a NR system that may used to contact
the somatic cells is an amount that induces at least 0.01% of the
cells of the culture to increase expression of one or more genes
known in the art to become more highly expressed upon the
acquisition of a neuronal fate, e.g. Tau, Tuj1, MAP2, NeuN, and the
like. An effective amount is the amount that induces an increase in
expression of these genes that is about 1.5-fold or more, e.g. 1.5
fold, 2 fold, 3 fold, 4 fold, about 6 fold, about 10 fold greater
than the level of expression observed in the absence of the NR
system. The level of gene expression can be readily determined by
any of a number of well-known methods in the art, e.g. by measuring
RNA levels, e.g. by RT-PCR, quantitative RT-PCR, Northern blot,
etc., and by measuring protein levels, e.g. Western blot, ELISA,
fluorescence activated cell sorting, etc.
[0087] It is noted here that the contacted somatic cells do not
need to be cultured under methods known in the art to promote
pluripotency in order to be converted into induced neuronal cells.
By pluripotency, it is meant that the cells have the ability to
differentiate into all types of cells in an organism. In other
words, the methods of the present invention do not require that the
somatic cells of the present invention be provided with
reprogramming factors known in the art to reprogram somatic cells
to become pluripotent stem cells, i.e. iPS cells, e.g. Oct3/4,
SOX2, KLF4, MYC, Nanog, or Lin28, and be cultured under conditions
known in the art to promote pluripotent stem cell induction, e.g.,
as hanging droplets, in order for the subject cells to be
reprogrammed into induced neuronal (iN) cells.
[0088] Following the methods of the invention, the contacted
somatic cells will be converted into induced neuronal cells at an
efficiency of reprogramming/efficiency of conversion that is at
least about 0.01% of the total number of somatic cells cultured
initially, e.g., 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%,
7%, 8%, 9%, 10%, 12%, 14%, 16%, 20% or more. At times, depending on
the age of the donor, the origin of the tissue, or the culture
conditions, higher efficiencies may be achieved. This efficiency of
reprogramming is an enhanced efficiency over that which may be
observed in the absence of NR factor(s). In other words, somatic
cells and cell cultures have an enhanced ability to give rise to
the desired type of cell when contacted with one or more NR
factor(s) relative to cells that were not contacted with the NR
factors. By enhanced, it is meant that the somatic cell cultures
have the ability to give rise to the desired cell type that is 150%
or greater than the ability of a somatic cell culture that was not
contacted with the NR factor(s), e.g. 150%, 200%, 300%, 400%, 600%,
800%, 1000%, or 2000% of the ability of the uncontacted population.
In other words, the culture of somatic cells produces about 1.5
fold, about 2-fold, about 3-fold, about 4-fold, about 6-fold, about
10-fold, about 20-fold, about 30-fold, about 50-fold, about
100-fold, about 200-fold the number of iN cells that are produced
by a population of somatic cells that are not contacted with the NR
factor(s). The efficiency of reprogramming may be determined by
assaying the number of neurons that develop in the cell culture,
e.g. by assaying the number of cells that express genes that are
expressed by neurons, e.g. Tau, Tuj1, MAP2, and/or NeuN, and/or the
number of cells that being to extend processes and make synaptic
connections.
[0089] Induced neuronal (iN) cells produced by the above in vitro
methods may be used in cell replacement or cell transplantation
therapy to treat diseases. Specifically, iN cells may be
transferred to subjects suffering from a wide range of diseases or
disorders with a neuronal component, i.e. with neuronal symptoms,
for example to reconstitute or supplement differentiating or
differentiated neurons in a recipient.
[0090] The therapy may be directed at treating the cause of the
disease; or alternatively, the therapy may be to treat the effects
of the disease or condition. For example, the therapy may be
directed at replacing neurons whose death caused the disease, e.g.
motor neurons in Amyotrophic lateral sclerosis (ALS), or the
therapy may be directed at replacing neurons that died as a result
of the disease, e.g. photoreceptors in age related macular
degeneration (AMD).
[0091] The iN cells may be transferred to, or close to, an injured
site in a subject; or the cells can be introduced to the subject in
a manner allowing the cells to migrate, or home, to the injured
site. The transferred cells may advantageously replace the damaged
or injured cells and allow improvement in the overall condition of
the subject. In some instances, the transferred cells may stimulate
tissue regeneration or repair.
[0092] In some cases, the iN cells or a sub-population of iN cells
may be purified or isolated from the rest of the cell culture prior
to transferring to the subject. In other words, one or more steps
may be executed to enrich for the iN cells or a subpopulation of iN
cells, i.e. to provide an enriched population of iN cells or
subpopulation of iN cells. In some cases, one or more antibodies
specific for a marker of cells of the neuronal lineage or a marker
of a sub-population of cells of the neuronal lineage are incubated
with the cell population and those bound cells are isolated. In
other cases, the iN cells or a sub-population of the iN cells
express a marker that is a reporter gene, e.g. EGFP, dsRED, lacz,
and the like, that is under the control of a neuron-specific
promoter or neuron-subtype specific promoter, e.g. Tau, GAD65,
CAMK2A, VGLUT1, HB9, and the like, which is then used to purify or
isolate the iN cells or a subpopulation thereof.
[0093] By a marker it is meant that, in cultures comprising somatic
cells that have been reprogrammed to become iN cells, the marker is
expressed only by the cells of the culture that will develop, are
developing, and/or have developed into neurons. It will be
understood by those of skill in the art that the stated expression
levels reflect detectable amounts of the marker protein on or in
the cell. A cell that is negative for staining (the level of
binding of a marker-specific reagent is not detectably different
from an isotype matched control) may still express minor amounts of
the marker. And while it is commonplace in the art to refer to
cells as "positive" or "negative" for a particular marker, actual
expression levels are a quantitative trait. The number of molecules
on the cell surface can vary by several logs, yet still be
characterized as "positive".
[0094] Cells of interest, i.e. cells expressing the marker of
choice, may be enriched for, that is, separated from the rest of
the cell population, by a number of methods that are well known in
the art. For example, flow cytometry, e.g. fluorescence activated
cell sorting (FACS), may be used to separate the cell population
based on the intrinsic fluorescence of the marker, or the binding
of the marker to a specific fluorescent reagent, e.g. a
fluorophor-conjugated antibody, as well as other parameters such as
cell size and light scatter. In other words, selection of the cells
may be effected by flow cytometry Although the absolute level of
staining may differ with a particular fluorochrome and reagent
preparation, the data can be normalized to a control. To normalize
the distribution to a control, each cell is recorded as a data
point having a particular intensity of staining. These data points
may be displayed according to a log scale, where the unit of
measure is arbitrary staining intensity. In one example, the
brightest stained cells in a sample can be as much as 4 logs more
intense than unstained cells. When displayed in this manner, it is
clear that the cells falling in the highest log of staining
intensity are bright, while those in the lowest intensity are
negative. The "low" positively stained cells have a level of
staining above the brightness of an isotype matched control, but
are not as intense as the most brightly staining cells normally
found in the population. An alternative control may utilize a
substrate having a defined density of marker on its surface, for
example a fabricated bead or cell line, which provides the positive
control for intensity.
[0095] Other methods of separation, i.e. methods by which selection
of cells may be effected, based upon markers include, for example,
magnetic activated cell sorting (MACS), immunopanning, and laser
capture microdissection.
[0096] One example of a protein of interest that may be used as a
marker in the present invention is PSA-NCAM. PSA-NCAM is an NCAM
polypeptide (GenBank Accession Nos. NM_000615.5 (isoform 1),
NM_181351.3 (isoform 2) and NM_001076682.2 (isoform 3)) that is
post-translationally modified by the addition of poly-sialic acid.
A number of antibodies that are specific for PSA-NCAM are known in
the art, including, e.g., anti-PSA-NCAM Clone 2-2B antibody
(Millipore).
[0097] Another example of a marker that may be used is a
fluorescent protein, e.g. GFP,
[0098] RFP, dsRED, etc., operably linked to a neuron-specific
promoter, e.g. Tau, PSA-NCAM, etc. In such embodiments, the marker
and promoter are provided to the cell as an expression cassette on
a vector, e.g. encoded on a DNA plasmid, encoded in a virus, and
the like, The expression cassette may optionally contain other
elements, e.g. enhancer sequences, other proteins for expression in
the cell, and the like. In some embodiments, the expression
cassette is provided to the cell prior to contacting the cell with
NR factors, i.e. while the cell is still a somatic cell. In some
embodiments, the expression cassette is provided to the cell at the
same time as the cell is contacted with the NR factor. In some
embodiments, the expression cassette is provided to the cell after
the cell is contacted with the NR factors.
[0099] Enrichment of the iN population or a subpopulation of iNs
may be performed about 3 days or more after contacting the somatic
cells with the NR factors of the NR system, e.g. 3 days, 4 days, 5
days, 6 days, 7 days, 10 days, 14 days, or 21 days after contacting
the somatic cells with the NR factors. Populations that are
enriched by selecting for the expression of one or more markers
will usually have at least about 80% cells of the selected
phenotype, more usually at least 90% cells and may be 95% of the
cells, or more, of the selected phenotype.
[0100] In some cases, genes may be introduced into the somatic
cells or the cells derived therefrom, i.e. iNs, prior to
transferring to a subject for a variety of purposes, e.g. to
replace genes having a loss of function mutation, provide marker
genes, etc. Alternatively, vectors are introduced that express
antisense mRNA or ribozymes, thereby blocking expression of an
undesired gene. Other methods of gene therapy are the introduction
of drug resistance genes to enable normal progenitor cells to have
an advantage and be subject to selective pressure, for example the
multiple drug resistance gene (MDR), or anti-apoptosis genes, such
as bcl-2. Various techniques known in the art may be used to
introduce nucleic acids into the target cells, e.g.
electroporation, calcium precipitated DNA, fusion, transfection,
lipofection, infection and the like, as discussed above. The
particular manner in which the DNA is introduced is not critical to
the practice of the invention.
[0101] To prove that one has genetically modified the somatic cells
or the cells derived therefrom, i.e. iNs, various techniques may be
employed. The genome of the cells may be restricted and used with
or without amplification. The polymerase chain reaction; gel
electrophoresis; restriction analysis; Southern, Northern, and
Western blots; sequencing; or the like, may all be employed. The
cells may be grown under various conditions to ensure that the
cells are capable of maturation to all of the neuronal lineages
while maintaining the ability to express the introduced DNA.
Various tests in vitro and in vivo may be employed to ensure that
the neuronal phenotype of the derived cells has been
maintained.
[0102] Subjects in need of neuron transplantation therapy, e.g. a
subject suffering from a neurological condition associated with the
loss of neurons or with aberrantly functioning neurons, could
especially benefit from therapies that utilize cells derived by the
methods of the invention. Examples of such diseases, disorders and
conditions include neurodegenerative diseases (e.g. Parkinson's
Disease, Alzheimer's Disease, Huntington's Disease, Amyotrophic
Lateral Sclerosis (ALS), Spielmeyer-Vogt-Sjogren-Batten disease
(Batten Disease), Frontotemporal Dementia with Parkinsonism,
Progressive Supranuclear Palsy, Pick Disease, prion diseases (e.g.
Creutzfeldt-Jakob disease), Amyloidosis, glaucoma, diabetic
retinopathy, age related macular degeneration (AMD), and the like);
neuropsychiatric disorders (e.g. anxiety disorders (e.g. obsessive
compulsive disorder), mood disorders (e.g. depression), childhood
disorders (e.g. attention deficit disorder, autistic disorders),
cognitive disorders (e.g. delirium, dementia), schizophrenia,
substance related disorders (e.g. addiction), eating disorders, and
the like); channelopathies (e.g. epilepsy, migraine, and the like);
lysosomal storage disorders (e.g. Tay-Sachs disease, Gaucher
disease, Fabry disease, Pompe disease, Niemann-Pick disease,
Mucopolysaccharidosis (MPS) & related diseases, and the like);
autoimmune diseases of the CNS (e.g. Multiple Sclerosis,
encephalomyelitis, paraneoplastic syndromes (e.g. cerebellar
degeneration), autoimmune inner ear disease, opsoclonus myoclonus
syndrome, and the like); cerebral infarction, stroke, and spinal
cord injury.
[0103] In some approaches, the reprogrammed somatic cells, i.e.
iNs, may be transplanted directly to an injured site to treat a
neurological condition, see, e.g., Morizane et al., (2008), ell
Tissue Res., 331(1):323-326; Coutts and Keirstead (2008), Exp.
Neurol., 209(2):368-377; Goswami and Rao (2007), Drugs,
10(10):713-719. For example, for the treatment of Parkinson's
disease, neurons may be transplanted directly into the striate body
of a subject with Parkinson's disease. As another example, for
treatment of ALS, corticospinal motor neurons may be transplanted
directly into the motor cortex of the subject with ALS. In other
approaches, the cells derived by the methods of the invention are
engineered to respond to cues that can target their migration into
lesions for brain and spinal cord repair; see, e.g., Chen et al.
(2007) Stem Cell Rev. 3(4):280-288.
[0104] The iNs may be administered in any physiologically
acceptable medium. They may be provided prior to differentiation,
i.e. they may be provided in an undifferentiated state and allowed
to differentiate in vivo, or they may be allowed to differentiate
for a period of time ex vivo and provided following
differentiation. They may be provided alone or with a suitable
substrate or matrix, e.g. to support their growth and/or
organization in the tissue to which they are being transplanted.
Usually, at least 1.times.10.sup.5 cells will be administered,
preferably 1.times.10.sup.6 or more. The cells may be introduced to
the subject via any of the following routes: parenteral,
intravenous, intracranial, intraspinal, intraocular, or into spinal
fluid. The cells may be introduced by injection, catheter, or the
like. Examples of methods for local delivery, that is, delivery to
the site of injury, include, e.g. through an Ommaya reservoir, e.g.
for intrathecal delivery (see e.g. U.S. Pat. Nos. 5,222,982 and
5,385,582, incorporated herein by reference); by bolus injection,
e.g. by a syringe, e.g. intravitreally or intracranially; by
continuous infusion, e.g. by cannulation, e.g. with convection (see
e.g. US Application No. 20070254842, incorporated here by
reference); or by implanting a device upon which the cells have
been reversably affixed (see e.g. US Application Nos. 20080081064
and 20090196903, incorporated herein by reference).
[0105] The number of administrations of treatment to a subject may
vary. Introducing the iNs into the subject may be a one-time event;
but in certain situations, such treatment may elicit improvement
for a limited period of time and require an on-going series of
repeated treatments. In other situations, multiple administrations
of the iNs may be required before an effect is observed. The exact
protocols depend upon the disease or condition, the stage of the
disease and parameters of the individual subject being treated.
[0106] Additionally or alternatively, iNs produced by the above in
vitro methods may be used as a basic research or drug discovery
tool, for example to evaluate the phenotype of a genetic disease,
e.g. to better understand the etiology of the disease, to identify
target proteins for therapeutic treatment, to identify candidate
agents with disease-modifying activity, i.e. an activity in
modulating the survival or function of neurons in a subject
suffering from a neurological disease or disorder, e.g. to identify
an agent that will be efficacious in treating the subject. For
example, a candidate agent may be added to a cell culture
comprising iNs derived from the subject's somatic cells, and the
effect of the candidate agent assessed by monitoring output
parameters such as iN survival, the ability of the iNs to become
depolarized, the extent to which the iNs form synapses, and the
like, by methods described herein and in the art.
[0107] Parameters are quantifiable components of cells,
particularly components that can be accurately measured, desirably
in a high throughput system. A parameter can be any cell component
or cell product including cell surface determinant, receptor,
protein or conformational or posttranslational modification
thereof, lipid, carbohydrate, organic or inorganic molecule,
nucleic acid, e.g. mRNA, DNA, etc. or a portion derived from such a
cell component or combinations thereof. While most parameters will
provide a quantitative readout, in some instances a
semi-quantitative or qualitative result will be acceptable.
Readouts may include a single determined value, or may include
mean, median value or the variance, etc. Characteristically a range
of parameter readout values will be obtained for each parameter
from a multiplicity of the same assays. Variability is expected and
a range of values for each of the set of test parameters will be
obtained using standard statistical methods with a common
statistical method used to provide single values.
[0108] Candidate agents of interest for screening include known and
unknown compounds that encompass numerous chemical classes,
primarily organic molecules, which may include organometallic
molecules, inorganic molecules, genetic sequences, etc. An
important aspect of the invention is to evaluate candidate drugs,
including toxicity testing; and the like.
[0109] Candidate agents include organic molecules comprising
functional groups necessary for structural interactions,
particularly hydrogen bonding, and typically include at least an
amine, carbonyl, hydroxyl or carboxyl group, frequently at least
two of the functional chemical groups. The candidate agents often
comprise cyclical carbon or heterocyclic structures and/or aromatic
or polyaromatic structures substituted with one or more of the
above functional groups. Candidate agents are also found among
biomolecules, including peptides, polynucleotides, saccharides,
fatty acids, steroids, purines, pyrimidines, derivatives,
structural analogs or combinations thereof. Included are
pharmacologically active drugs, genetically active molecules, etc.
Compounds of interest include chemotherapeutic agents, hormones or
hormone antagonists, etc. Exemplary of pharmaceutical agents
suitable for this invention are those described in, "The
Pharmacological Basis of Therapeutics," Goodman and Gilman,
McGraw-Hill, New York, N.Y., (1996), Ninth edition.
[0110] Compounds, including candidate agents, are obtained from a
wide variety of sources including libraries of synthetic or natural
compounds. For example, numerous means are available for random and
directed synthesis of a wide variety of organic compounds,
including biomolecules, including expression of randomized
oligonucleotides and oligopeptides. Alternatively, libraries of
natural compounds in the form of bacterial, fungal, plant and
animal extracts are available or readily produced. Additionally,
natural or synthetically produced libraries and compounds are
readily modified through conventional chemical, physical and
biochemical means, and may be used to produce combinatorial
libraries. Known pharmacological agents may be subjected to
directed or random chemical modifications, such as acylation,
alkylation, esterification, amidification, etc. to produce
structural analogs.
[0111] Candidate agents are screened for biological activity by
adding the agent to one or a plurality of cell samples, usually in
conjunction with cells lacking the agent. The change in parameters
in response to the agent is measured, and the result evaluated by
comparison to reference cultures, e.g. in the presence and absence
of the agent, obtained with other agents, etc.
[0112] The agents are conveniently added in solution, or readily
soluble form, to the medium of cells in culture. The agents may be
added in a flow-through system, as a stream, intermittent or
continuous, or alternatively, adding a bolus of the compound,
singly or incrementally, to an otherwise static solution. In a
flow-through system, two fluids are used, where one is a
physiologically neutral solution, and the other is the same
solution with the test compound added. The first fluid is passed
over the cells, followed by the second. In a single solution
method, a bolus of the test compound is added to the volume of
medium surrounding the cells. The overall concentrations of the
components of the culture medium should not change significantly
with the addition of the bolus, or between the two solutions in a
flow through method.
[0113] A plurality of assays may be run in parallel with different
agent concentrations to obtain a differential response to the
various concentrations. As known in the art, determining the
effective concentration of an agent typically uses a range of
concentrations resulting from 1:10, or other log scale, dilutions.
The concentrations may be further refined with a second series of
dilutions, if necessary. Typically, one of these concentrations
serves as a negative control, i.e. at zero concentration or below
the level of detection of the agent or at or below the
concentration of agent that does not give a detectable change in
the phenotype.
In Vivo Methods of Conversion, and Uses for Cells Converted In
Vivo
[0114] In some embodiments, a somatic cell is contacted in vivo
with the NR system comprising NR factor(s), e.g. in a subject in
need of neuron replacement therapy. Cells in vivo may be contacted
with a SNTR system suitable for pharmaceutical use, i.e. a NR
pharmaceutical composition, by any of a number of well-known
methods in the art for the administration of polypeptides and
nucleic acids to a subject. The NR pharmaceutical composition can
be incorporated into a variety of formulations. More particularly,
the NR pharmaceutical composition can be formulated into
pharmaceutical compositions by combination with appropriate
pharmaceutically acceptable carriers or diluents, and may be
formulated into preparations in solid, semi-solid, liquid or
gaseous forms, such as tablets, capsules, powders, granules,
ointments, solutions, suppositories, injections, inhalants, gels,
microspheres, and aerosols. As such, administration of the NR
pharmaceutical composition can be achieved in various ways,
including oral, buccal, rectal, parenteral, intraperitoneal,
intradermal, transdermal, intracheal, etc., administration. The NR
pharmaceutical composition may be systemic after administration or
may be localized by the use of regional administration, intramural
administration, or use of an implant that acts to retain the active
dose at the site of implantation. The NR pharmaceutical composition
may be formulated for immediate activity or they may be formulated
for sustained release.
[0115] For some central nervous system conditions, it may be
necessary to formulate the
[0116] NR pharmaceutical composition, that is, the NR system
comprising NR factor(s), to cross the blood brain barrier (BBB).
One strategy for drug delivery through the blood brain barrier
(BBB) entails disruption of the BBB, either by osmotic means such
as mannitol or leukotrienes, or biochemically by the use of
vasoactive substances such as bradykinin. A BBB disrupting agent
can be co-administered with the therapeutic compositions of the
invention when the compositions are administered by intravascular
injection. Other strategies to go through the BBB may entail the
use of endogenous transport systems, including caveoil-1 mediated
transcytosis, carrier-mediated transporters such as glucose and
amino acid carriers, receptor-mediated transcytosis for insulin or
transferrin, and active efflux transporters such as p-glycoprotein.
Active transport moieties may also be conjugated to the therapeutic
compounds for use in the invention to facilitate transport across
the endothelial wall of the blood vessel. Alternatively, drug
delivery of the NR pharmaceutical composition behind the BBB may be
by local delivery, for example by intrathecal delivery, e.g.
through an Ommaya reservoir (see e.g. U.S. Pat. Nos. 5,222,982 and
5,385,582, incorporated herein by reference); by bolus injection,
e.g. by a syringe, e.g. intravitreally or intracranially; by
continuous infusion, e.g. by cannulation, e.g. with convection (see
e.g. US Application No. 20070254842, incorporated here by
reference); or by implanting a device upon which the NR
pharmaceutical composition has been reversably affixed (see e.g. US
Application Nos. 20080081064 and 20090196903, incorporated herein
by reference).
[0117] The calculation of the effective amount or effective dose of
the NR pharmaceutical composition to be administered is within the
skill of one of ordinary skill in the art, and will be routine to
those persons skilled in the art. Needless to say, the final amount
to be administered will be dependent upon the route of
administration and upon the nature of the disorder or condition
that is to be treated.
[0118] For inclusion in a medicament, the NR pharmaceutical
composition may be obtained from a suitable commercial source. As a
general proposition, the total pharmaceutically effective amount of
the compound administered parenterally per dose will be in a range
that can be measured by a dose response curve.
[0119] The NR pharmaceutical composition to be used for therapeutic
administration must be sterile. Sterility is readily accomplished
by filtration through sterile filtration membranes (e.g., 0.2 .mu.m
membranes). Therapeutic compositions generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle. The NR pharmaceutical composition ordinarily will
be stored in unit or multi-dose containers, for example, sealed
ampules or vials, as an aqueous solution or as a lyophilized
formulation for reconstitution. As an example of a lyophilized
formulation, 10-mL vials are filled with 5 ml of sterile-filtered
1% (w/v) aqueous solution of compound, and the resulting mixture is
lyophilized. The pharmaceutical composition comprising the
lyophilized NR factor(s) is prepared by reconstituting the
lyophilized compound, for example, by using bacteriostatic
Water-for-Injection.
[0120] A NR system for pharmaceutical use, i.e. a NR pharmaceutical
composition, can include, depending on the formulation desired,
pharmaceutically-acceptable, non-toxic carriers of diluents, which
are defined as vehicles commonly used to formulate pharmaceutical
compositions for animal or human administration. The diluent is
selected so as not to affect the biological activity of the
combination. Examples of such diluents are distilled water,
buffered water, physiological saline, PBS, Ringer's solution,
dextrose solution, and Hank's solution. In addition, the NR
pharmaceutical composition or formulation can include other
carriers, adjuvants, or non-toxic, nontherapeutic, nonimmunogenic
stabilizers, excipients and the like. The compositions can also
include additional substances to approximate physiological
conditions, such as pH adjusting and buffering agents, toxicity
adjusting agents, wetting agents and detergents.
[0121] The composition can also include any of a variety of
stabilizing agents, such as an antioxidant for example. When the
pharmaceutical composition includes a polypeptide, the polypeptide
can be complexed with various well-known compounds that enhance the
in vivo stability of the polypeptide, or otherwise enhance its
pharmacological properties (e.g., increase the half-life of the
polypeptide, reduce its toxicity, enhance solubility or uptake).
Examples of such modifications or complexing agents include
sulfate, gluconate, citrate and phosphate. The polypeptides of a
composition can also be complexed with molecules that enhance their
in vivo attributes. Such molecules include, for example,
carbohydrates, polyamines, amino acids, other peptides, ions (e.g.,
sodium, potassium, calcium, magnesium, manganese), and lipids.
[0122] Further guidance regarding formulations that are suitable
for various types of administration can be found in Remington's
Pharmaceutical Sciences, Mace Publishing Company, Philadelphia,
Pa., 17th ed. (1985). For a brief review of methods for drug
delivery, see, Langer, Science 249:1527-1533 (1990).
[0123] The NR pharmaceutical composition can be administered for
prophylactic and/or therapeutic treatments. Toxicity and
therapeutic efficacy of the active ingredient can be determined
according to standard pharmaceutical procedures in cell cultures
and/or experimental animals, including, for example, determining
the LD50 (the dose lethal to 50% of the population) and the ED50
(the dose therapeutically effective in 50% of the population). The
dose ratio between toxic and therapeutic effects is the therapeutic
index and it can be expressed as the ratio LD50/ED50. Compounds
that exhibit large therapeutic indices are preferred.
[0124] The data obtained from cell culture and/or animal studies
can be used in formulating a range of dosages for humans. The
dosage of the active ingredient typically lines within a range of
circulating concentrations that include the ED50 with low toxicity.
The dosage can vary within this range depending upon the dosage
form employed and the route of administration utilized.
[0125] The components used to formulate the pharmaceutical
compositions are preferably of high purity and are substantially
free of potentially harmful contaminants (e.g., at least National
Food (NF) grade, generally at least analytical grade, and more
typically at least pharmaceutical grade). Moreover, compositions
intended for in vivo use are usually sterile. To the extent that a
given compound must be synthesized prior to use, the resulting
product is typically substantially free of any potentially toxic
agents, particularly any endotoxins, which may be present during
the synthesis or purification process. Compositions for parental
administration are also sterile, substantially isotonic and made
under GMP conditions.
[0126] The effective amount of a therapeutic composition to be
given to a particular patient will depend on a variety of factors,
several of which will differ from patient to patient. A competent
clinician will be able to determine an effective amount of a
therapeutic agent to administer to a patient to halt or reverse the
progression the disease condition as required. Utilizing LD50
animal data, and other information available for the agent, a
clinician can determine the maximum safe dose for an individual,
depending on the route of administration. For instance, an
intravenously administered dose may be more than an intrathecally
administered dose, given the greater body of fluid into which the
therapeutic composition is being administered. Similarly,
compositions which are rapidly cleared from the body may be
administered at higher doses, or in repeated doses, in order to
maintain a therapeutic concentration. Utilizing ordinary skill, the
competent clinician will be able to optimize the dosage of a
particular therapeutic in the course of routine clinical
trials.
[0127] Mammalian species that may be treated with the present
methods include canines and felines; equines; bovines; ovines; etc.
and primates, particularly humans. Animal models, particularly
small mammals, e.g. murine, lagomorpha, etc. may be used for
experimental investigations.
[0128] More particularly, the present invention finds use in the
treatment of subjects, such as human patients, in need of neuron
replacement therapy. Examples of such subjects would be subjects
suffering from conditions associated with the loss of neurons or
with aberrantly functioning neurons. Patients having diseases and
disorders characterized by such conditions will benefit greatly by
a treatment protocol of the pending claimed invention. Examples of
such diseases, disorders and conditions include e.g.,
neurodegenerative diseases, neuropsychiatric disorders,
channelopathies, lysosomal storage disorders, autoimmune diseases
of the CNS, cerebral infarction, stroke, and spinal cord injury, as
described previously.
[0129] An effective amount of a NR pharmaceutical composition is
the amount that will result in an increase the number of neurons at
the site of injury, and/or will result in measurable reduction in
the rate of disease progression in vivo. For example, an effective
amount of a NR pharmaceutical composition will inhibit the
progression of symptoms e.g. loss of muscle control, loss of
cognition, hearing loss, vision loss, etc. by at least about 5%, at
least about 10%, at least about 20%, preferably from about 20% to
about 50%, and even more preferably, by greater than 50% (e.g.,
from about 50% to about 100%) as compared to the appropriate
control, the control typically being a subject not treated with the
NR pharmaceutical composition. An agent is effective in vivo if
administration of the agent at about 1 .mu.g/kg to about 100 mg/kg
body weight results in inhibition of symptoms within about 1 month
to 3 months from the first administration of the pharmaceutical
composition. In a specific aspect, body function may be improved
relative to the amount of function observed at the start of
therapy.
[0130] The methods of the present invention also find use in
combined therapies, e.g. in with therapies that are already known
in the art to provide relief from symptoms associated with the
aforementioned diseases, disorders and conditions. The combined use
of a NR pharmaceutical composition of the present invention and
these other agents may have the advantages that the required
dosages for the individual drugs is lower, and the effect of the
different drugs complementary.
Astrocyte Reprogramming (AR) Factors and Systems
[0131] As discussed above, with the exception of the reprogramming
factors and the reprogramming system used, the methods discussed
herein also find use in converting non-astrocytic cells to
astrocytes. For the conversion of non-astrocytic somatic cells to
astrocytes, astrocyte reprogramming (AR) factors are used in place
of NR factors. AR factors are biologically active factors that act
on a cell to alter transcription so as to convert the cell into an
astrocyte, i.e. an induced astrocyte (iA). AR factors are provided
to somatic cells in the context of a AR system. Examples of AR
factors include a Sox agent, a Tal agent, a Hes agent, an Id agent,
and an Ascl agent.
[0132] The term Sox agent is used to refer to SOX (SRY(sex
determining region Y)-box) polypeptides and the nucleic acids that
encode them. Sox polypeptides are members of the member of the SOX
(SRY-related HMG-box) family of transcription factors involved in
the regulation of embryonic development and in the determination of
the cell fate. The terms "Sox gene product", "Sox polypeptide", and
"Sox protein" are used interchangeably herein to refer to native
sequence Sox polypeptides, Sox polypeptide variants, Sox
polypeptide fragments and chimeric Sox polypeptides that can
modulate transcription. Native sequence Sox polypeptides include
the proteins Sox1 (GenBank Accession Nos. NM_005986.2 and
NP_005977.2); Sox 2 (GenBank Accession Nos. NM_003106.2 and
NP_003097.1); Sox3 (GenBank Accession Nos. NM_005634.2 and
NP_005625.2); Sox4 (GenBank Accession Nos. NM_003107.2 and
NP_003098.1); Sox5 (GenBank Accession Nos. NM_006940.4 and
NP_008871.3 (isoform a), NM_152989.2 and NP_694534.1 (isoform b),
and NM_178010.1 and NP_821078.1 (isoform c)); Sox6 (GenBank
Accession Nos. NM_017508.2 and NP_059978.1 (isoform 1), NM_033326.3
and NP_201583.2 (isoform 2), NM_001145811.1 and NP_001139283.1
(isoform 3), and NM_001145819.1 and NP_001139291.1 (isoform 4));
Sox7 (GenBank Accession Nos. NM_031439.2 and NP_113627.1); Sox8
(GenBank Accession Nos. NM_014587.3 and NP_055402.2); Sox9 (GenBank
Accession Nos. NM_000346.3 and NP_000337.1); Sox10 (GenBank
Accession Nos. NM_006941.3 and NP_008872.1); Soxl 1 (GenBank
Accession Nos. NM_003108.3 and NP_003099.1); Sox12 (also called
Sox22; GenBank Accession Nos. NM_006943.2 and NP_008874.2); Sox13
(GenBank Accession Nos. NM_005686.2 and NP_005677.2); Sox14 (also
called Sox28; GenBank Accession Nos. NM_004189.2 and NP_004180.1);
Sox15 (also called Sox20, Sox26, and Sox27; GenBank Accession Nos.
NM_006942.1 and NP_008873.1); Sox17 (GenBank Accession Nos.
NM_022454.3 and NP_071899.1); Sox18 (GenBank Accession Nos.
NM_018419.2 and NP_060889.1); Sox21 (also called Sox25; GenBank
Accession Nos. NM_007084.2 and NP_009015.1); and Sox30 (GenBank
Accession Nos. NM_178424.1 and NP_848511.1 (isoform a), and
NM_007017.2 and NP_008948.1 (isoform b)). Sox polypeptides, e.g.
those that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical to the sequence
provided in the GenBank Accession Nos. above find use as
reprogramming factors in the present invention, as do nucleic acids
encoding these polypeptides or their transcriptionally active
domains and vectors comprising these nucleic acids. In certain
embodiments, the Sox agent is a Sox9 agent.
[0133] The term Tal agent is used to refer to Tal (T-cell acute
lymphocytic leukemia) polypeptides and the nucleic acids that
encode them. Tal polypeptides are basic helix-loop-helix
transcription factors. The terms "Tal gene product", "Tal
polypeptide", and "Tal protein" are used interchangeably herein to
refer to native sequence Tal polypeptides, Tal polypeptide
variants, Tal polypeptide fragments and chimeric Tal polypeptides
that can modulate transcription. Native sequence Tal polypeptides
include the proteins Tal1 (also called Scl and bHLHal7; GenBank
Accession Nos. NM_003189.2 and NP_003180.1); and Tal2 (GenBank
Accession Nos. NM_005421.2 and NP_005412.1). Tal polypeptides, e.g.
those that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical to the sequence
provided in the GenBank Accession Nos. above find use as
reprogramming factors in the present invention, as do nucleic acids
encoding these polypeptides or their transcriptionally active
domains and vectors comprising these nucleic acids. In certain
embodiments, the Tal agent is a Tal1 (Scl) agent.
[0134] The term Hes agent is used to refer to HES (Hairy and
Enhancer of Split) polypeptides and the nucleic acids that encode
them. HES polypeptides are basic helix loop helix transcription
factors that act as a transcriptional repressors of other bHLH
transcription factors. The terms "HES gene product", "HES
polypeptide", and "HES protein" are used interchangeably herein to
refer to native sequence HES polypeptides, HES polypeptide
variants, HES polypeptide fragments and chimeric HES polypeptides
that can modulate transcription. Native sequence HES polypeptides
include the proteins Hes1 (GenBank Accession Nos. NM_005524.2 and
NP_005515.1); Hes2 (GenBank Accession Nos. NM_019089.4 and
NP_061962.2); Hes3 (GenBank Accession Nos. NM_001024598.2 and
NP_001019769.1); Hes4 (GenBank Accession Nos. NM_001142467.1 and
NP_001135939.1 (isoform 1), and NM_021170.3 and NP_066993.1
(isoform 2)); Hes5 (GenBank Accession Nos. NM_001010926.3 and
NP_001010926.1); Hes6 (GenBank Accession Nos. NM_018645.4 and
NP_061115.2 (isoform a), and NM_001142853.1 and NP_001136325.1
isoform b)); and Hes7 (GenBank Accession Nos. kNM_001165967.1 and
NP_001159439.1 (isoform 1), and NM_032580.3 and NP_115969.2
(isoform 2)). HES polypeptides, e.g. those that are at least 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or
are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the HES agent is a
Hes1 agent.
[0135] The term Id agent is used to refer to Id (Inhibitor of DNA
binding) polypeptides and the nucleic acids that encode them. Id
polypeptides are basic helix loop helix (bHLH) proteins that are
capable of dimerizing with other bHLH proteins to inhibit these
other bHLH proteins from binding DNA. The terms "Id gene product",
"Id polypeptide", and "Id protein" are used interchangeably herein
to refer to native sequence Id polypeptides, Id polypeptide
variants, Id polypeptide fragments and chimeric Id polypeptides
that can modulate transcription. Native sequence Id polypeptides
include the proteins Idi (GenBank Accession Nos. NM_002165.2 and
NP_002156.2 (isoform a) and NM_181353.1 and NP_851998.1 (isoform
b)); Id2 (GenBank Accession Nos. NM_002166.4 and NP_002157.2); Id3
(GenBank Accession Nos. NM_002167.3 and NP_002158.3); and Id4
(GenBank Accession Nos. NM_001546.2 and NP_001537.1). Id
polypeptides, e.g. those that are at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical
to the sequence provided in the GenBank Accession Nos. above find
use as reprogramming factors in the present invention, as do
nucleic acids encoding these polypeptides or their
transcriptionally active domains and vectors comprising these
nucleic acids. In certain embodiments, the Id agent is an Id1
agent.
[0136] Ascl agents are as described above, for NR factors. In
certain embodiments, the Ascl agent that is a AR factor is an Ascl1
agent.
[0137] As with NR factors, in some embodiments, AR factors are
provided as nuclear acting polypeptides. In some embodiments, AR
factors are provided as nucleic acids encoding AR polypeptides,
i.e. AR nucleic acids. Methods of preparing AR nuclear acting
polypeptides and AR nucleic acids and of providing AR nuclear
acting polypeptides and AR nucleic acids to the subject cells are
as described above for NR nuclear acting polypeptides and NR
nucleic acids.
[0138] As with NR factors, one or more AR factors may be provided
to the cells. When more than one AR factors is provided, the AR
factors may be provided individually or as a single composition,
that is, as a premixed composition, of factors, simultaneously or
sequentially, at the same molar ratio or at different molar ratios,
once or multiple times in the course of culturing the cells.
[0139] As with NR system, in addition to the one or more AR
factors, the AR system may include other reagents. Examples of such
reagents include those described above for the NR system that are
known in the art to promote cell reprogramming. Other reagents for
optional inclusion in the AR system include those known in the art
to promote the survival and differentiation of stem cells into
astrocytes (see, e.g. Di Giorgio, FP (2007) Nat. Neurosci
19)5):608-14) and/or glial progenitors or astrocyte precursors into
astrocytes (see, e.g. Christopherson, K S et al. (2005) Cell
120(3):421-433)
[0140] As with the NR system, reagents in the AR system may be
provided in any culture media known in the art to promote cell
survival.
[0141] The AR system is provided to non-astrocytic somatic cells or
pluripotent cells as described above, so as to reprogram, i.e.
convert, those cells into induced astrocytes. Non-astrocytic
somatic cells include any somatic cell that would not give rise to
an astrocyte in the absence of experimental manipulation. Examples
of non-astrocytic somatic cells include differentiating or
differentiated cells from ectodermal (e.g., keratinocytes),
mesodermal (e.g., fibroblasts), or endodermal (e.g., pancreatic
cells) lineages. The somatic cells may be, for example, pancreatic
beta cells, oligodendrocytes, neurons, hepatocytes, hepatic stem
cells, cardiomyocytes, skeletal muscle cells, smooth muscle cells,
hematopoietic cells, osteoclasts, osteoblasts, pericytes, vascular
endothelial cells, schwann cells, melanocytes and the like. They
may be terminally differentiated cells, or they may be capable of
giving rise to cells of a specific, non-astrocytic lineage, e.g.
cardiac stem cells, hepatic stem cells, and the like. The somatic
cells are readily identifiable as non-astrocytic by the absence of
astrocyte-specific markers that are well-known in the art, as
described above.
[0142] Induced astrocytes, be they induced in vitro and
transplanted or induced in vivo, find use in treating subjects in
need of astrocyte replacement therapy, e.g. subjects suffering from
a neurological disease, disorder or condition associated with the
loss of astrocytes or aberrantly functioning oligodendrocytes.
Examples of such diseases would include Alzheimer's Disease and
Amyotrophic Lateral Sclerosis.
[0143] Maybe I missed it, but iA cells could be of course also used
in vitro for disease modeling (e.g. in coculture with wt
neurons).
Oligodendrocyte Reprogramming (OR) Factors and Systems
[0144] As discussed above, with the exception of the reprogramming
factors used and the reprogramming system used, the methods
discussed herein for converting cells to neurons also find use in
converting non-oligodendrocytic somatic cells to oligodendrocytes.
Oligodendrocyte reprogramming (OR) factors are biologically active
factors that act on a cell to alter transcription so as to convert
the cell into an oligodendrocyte, i.e. an induced oligodendrocyte
(i0). OR factors are provided to somatic cells or pluripotent cells
in the context of an OR system. Examples of OR factors include a
Nkx2 agent, a MRF (Gm98) agent, an Olig agent, an Ascl1 agent, and
a Sox agent.
[0145] The term Nkx2 agent is used to refer to Nkx2 (also called
NK2, or NK2 transcription factor related, and TTF, for thyroid
transcription factor) polypeptides and the nucleic acids that
encode them. Nkx2 polypeptides are homeodomain containing
transcription factors. The terms "Nkx2 gene product", "Nkx2
polypeptide", and "Nkx2 protein" are used interchangeably herein to
refer to native sequence Nkx2 polypeptides, Nkx2 polypeptide
variants, Nkx2 polypeptide fragments and chimeric Nkx2 polypeptides
that can modulate transcription. Native sequence Nkx2 polypeptides
include the proteins Nkx2-1 (GenBank Accession Nos. NM_001079668.2
and NP_001073136.1 (isoform 1) and NM_003317.3 and NP_003308.1
(isoform 2)); Nkx2-2 (GenBank Accession Nos. NM_002509.2 and
NP_002500.1); Nkx2-3 (GenBank Accession Nos. NM_145285.2 and
NP_660328.2); Nkx2-4 (GenBank Accession Nos. NM_033176.1 and
NP_149416.1); Nkx2-5 (GenBank Accession Nos. NM_004387.3 and
NP_004378.1 (isoform 1), NM_001166175.1 and NP_001159647.1 (isoform
2), and NM_001166176.1 and NP_001159648.1 (isoform 3); Nkx2-6
(GenBank Accession Nos. NM_001136271.1 and NP_001129743.1); and
Nkx2-8 (also called Nkx2-9, GenBank Accession Nos. NM_014360.2 and
NP_055175.2) Nkx2 polypeptides, e.g. those that are at least 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or
are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Nkx2 agent is a
Nkx2-2 agent.
[0146] The term MRF agent is used to refer to MRF (for myelin gene
regulatory factor; or C11orf9, for chromosome 11 open reading frame
9; or Gm98) polypeptides and the nucleic acids that encode them.
The terms "MRF gene product", "MRF polypeptide", and "MRF protein"
are used interchangeably herein to refer to native sequence MRF
polypeptides, MRF polypeptide variants, MRF polypeptide fragments
and chimeric MRF polypeptides that can modulate transcription.
Native sequence MRF polypeptides include the proteins encoded by
GenBank Accession Nos. NM_013279.2 and NP_037411.1 (isoform 1) and
NM_001127392.1 and NP_001120864.1 (isoform 2). MRF polypeptides,
e.g. those that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical to the
sequence provided in the GenBank Accession Nos. above find use as
reprogramming factors in the present invention, as do nucleic acids
encoding these polypeptides or their transcriptionally active
domains and vectors comprising these nucleic acids.
[0147] Olig agents and Ascl agents are as described above for NR
factors. In certain embodiments, the Olig agent that is a OR factor
is an Olig1 or Olig 2 agent. In certain embodiments, the Ascl agent
that is a OR factor is an Ascl1 agent.
[0148] Sox agents are as described above, for AR factors. In
certain embodiments, the Sox agent that is an OR factor is a Sox10
agent.
[0149] As with NR factors, in some embodiments, OR factors are
provided as nuclear acting polypeptides. In some embodiments, OR
factors are provided as nucleic acids encoding OR polypeptides,
i.e. OR nucleic acids. Methods of preparing OR nuclear acting
polypeptides and OR nucleic acids and of providing OR nuclear
acting polypeptides and OR nucleic acids to the subject cells are
as described above for NR nuclear acting polypeptides and NR
nucleic acids.
[0150] As with NR factors, one or more OR factors may be provided
to the cells. When more than one OR factors is provided, the OR
factors may be provided individually or as a single composition,
that is, as a premixed composition, of factors, simultaneously or
sequentially, at the same molar ratio or at different molar ratios,
once or multiple times in the course of culturing the cells.
[0151] As with NR system, in addition to the one or more OR
factors, the OR system may include other reagents. Examples of such
reagents include those described above for the NR system that are
known in the art to promote cell reprogramming. Other reagents for
optional inclusion in the OR system include those known in the art
to promote the survival and differentiation of stem cells into
oligodendrocytes (see, e.g., Hu, B Y et al. (2009) Nat Protoc
4(11):1614-22; Parras, C M et al. (2007) J Neurosci
27(16):423-4242) and/or glial progenitors or oligodendrocyte
precursors into oligodendrocytes (see, e.g., Dugas, J C et al.
(2006) J Neurosci 26(43):10967-10983).
[0152] As with the NR system, reagents in the OR system may be
provided in any culture media known in the art to promote cell
survival.
[0153] The OR system is provided to non-oligodendrocytic somatic
cells or pluripotent cells so as to reprogram, i.e. convert, those
cells into induced oligodendrocytes. Non-oligodendrocytic somatic
cells include any somatic cell that would not give rise to an
oligodendrocyte in the absence of experimental manipulation.
Examples of non-oligodendrocytic somatic cells include
differentiating or differentiated cells from ectodermal (e.g.,
fibroblasts), mesodermal (e.g., myocytes), or endodermal (e.g.,
pancreatic cells) lineages. The somatic cells may be, for example,
pancreatic beta cells, astroctyes, neurons, hepatocytes, hepatic
stem cells, cardiomyocytes skeletal muscle cells, smooth muscle
cells, hematopoietic cells, osteoclasts, osteoblasts, pericytes,
vascular endothelial cells, and the like. They may be terminally
differentiated cells, or they may be capable of giving rise to
cells of a specific, non- oligodendrocytic lineage, e.g. cardiac
stem cells, hepatic stem cells, and the like. The somatic cells are
readily identifiable as non-oligodendrocytic by the absence of
oligodendrocyte-specific markers that are well-known in the art, as
described above.
[0154] Induced oligodendrocytes, be they induced in vitro and
transplanted into a subject or induced in vivo, i.e. in the
subject, find use in treating subjects in need of oligodendrocyte
replacement therapy, e.g. subjects suffering from a neurological
disease, disorder or condition associated with the loss of myelin,
as from the loss of oligodendrocytes or aberrantly functioning
oligodendrocytes. Examples of such diseases would include Multiple
Sclerosis and Leukodystrophies.
Same here: disease modeling also possible (myelination disorders
e.g. PMD or MS)
Neural Stem Cell Reprogramming (NSC)R Factors and Systems
[0155] As discussed above, with the exception of the reprogramming
factors and the reprogramming systems used, the methods discussed
herein for converting non-neuronal somatic cells into induced
neurons also find use in converting postmitotic somatic cells of
any cell lineage, or pluripotent stem cells, to neural stem cells
(NSCs). NSC reprogramming (NSC)R factors are biologically active
factors that act on a cell to alter transcription so as to convert
the cell into a neural stem cell, i.e. an induced NSC (iNSC).
(NSC)R factors are provided to somatic cells or pluripotent cells
in the context of a (NSC)R system. Examples of (NSC)R factors
include myc, Dlx, Klf, Lhx, Mef2, Nr2f, Pax, Rfx, Nkx2, Nkx6, FoxG,
Sall, .beta.-catenin, L3mbtl, Ascl, Brn, Myt, Zic, Sox, Hes, and
Id.
[0156] The term myc agent is used to refer to myc (also called
v-myc myelocytomatosis viral oncogene homolog (avian)) polypeptides
and the nucleic acids that encode them. myc polypeptides are
transcription factors. The terms "myc gene product", "myc
polypeptide", and "myc protein" are used interchangeably herein to
refer to native sequence myc polypeptides, myc polypeptide
variants, myc polypeptide fragments and chimeric myc polypeptides
that can modulate transcription. Native sequence myc polypeptides
include the proteins encoded by GenBank Accession Nos. NM_002467.4
and NP_002458.2. c-myc polypeptides, e.g. those that are at least
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%,
99%, or are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids.
[0157] The term Dlx agent is used to refer to Dlx (also called
"distal-less homeobox") polypeptides and the nucleic acids that
encode them. Dlx polypeptides are homeodomain containing
transcription factors. The terms "Dlx gene product", "Dlx
polypeptide", and "Dlx protein" are used interchangeably herein to
refer to native sequence Dlx polypeptides, Dlx polypeptide
variants, Dlx polypeptide fragments and chimeric Dlx polypeptides
that can modulate transcription. Native sequence Dlx polypeptides
include the proteins Dlx1 (GenBank Accession Nos. NM_178120.4 and
NP_835221.2 (isoform 1), and NM_001038493.1 and NP_001033582.1
(isoform 2)); Dlx2 (GenBank Accession Nos. NM_004405.3 and
NP_004396.1); Dlx3 (GenBank Accession Nos. NM_005220.2 and
NP_005211.1); Dlx4 (also called Dlx7, Dlx8, and Dlx9; GenBank
Accession Nos. NM_138281.2 and NP_612138.1 (isoform a), and
NM_001934.2 and NP_001925.2 (isoform b)); Dlx5 (GenBank Accession
Nos. NM_005221.5 and NP_005212.1); and Dlx6 (GenBank Accession Nos.
NM_005222.2 and NP_005213.2). Dlx polypeptides, e.g. those that are
at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
95%, 97%, 99%, or are 100% identical to the sequence provided in
the GenBank Accession Nos. above find use as reprogramming factors
in the present invention, as do nucleic acids encoding these
polypeptides or their transcriptionally active domains and vectors
comprising these nucleic acids. In certain embodiments, the Dlx
agent is a Dlx1 agent.
[0158] The term Klf agent is used to refer to Klf (also called
Kruppel like factor) polypeptides and the nucleic acids that encode
them. Klf polypeptides are zinc-finger containing transcription
factors. The terms "Klf gene product", "Klf polypeptide", and "Klf
protein" are used interchangeably herein to refer to native
sequence Klf polypeptides, Klf polypeptide variants, Klf
polypeptide fragments and chimeric Klf polypeptides that can
modulate transcription. Native sequence Klf polypeptides include
the proteins Klf1 (GenBank Accession Nos. NM_006563.3 and
NP_006554.1); Klf2 (GenBank Accession Nos. NM_016270.2 and
NP_057354.1); Klf3 (GenBank Accession Nos. NM_016531.5 and
NP_057615.3); Klf4 (GenBank Accession Nos. NM_004235.4 and
NP_004226.3) Klf5 (GenBank Accession Nos. NM_001730.3 and
NP_001721.2), Klf6 (GenBank Accession Nos. NM_001300.5 and
NP_001291.3 (isoform a), NM_001160124.1 and NP_001153596.1 (isoform
b), and NM_001160125.1 and NP_001153597.1 (isoform c)); Klf7
(GenBank Accession Nos. NM_003709.2 and NP_003700.1); Klf8 (GenBank
Accession Nos. NM_007250.4 and NP_009181.2 (isoform 1), and
NM_001159296.1 and NP_001152768.1 (isoform 2)); Klf9 (GenBank
Accession Nos. NM_001206.2 and NP_001197.1); Klf10 (GenBank
Accession Nos. NM_005655.2 and NP_005646.1 (isoform a) and
NM_001032282.2 and NP_001027453.1 (isoform b)); Klf11 (GenBank
Accession Nos. NM_003597.4 and NP_003588.1); Klf12 (GenBank
Accession Nos. NM_007249.4 and NP_009180.3); Klf13 (GenBank
Accession Nos. NM_015995.2 and NP_057079.2); Klf14 (GenBank
Accession Nos. NM_138693.2 and NP_619638.1); Klf15 (GenBank
Accession Nos. NM_014079.3 and NP_054798.1); Klf16 (GenBank
Accession Nos. NM_031918.3 and NP_114124.1); and Klf17 (GenBank
Accession Nos. NM_173484.3 and NP_775755.3). Klf polypeptides, e.g.
those that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical to the sequence
provided in the GenBank Accession Nos. above find use as
reprogramming factors in the present invention, as do nucleic acids
encoding these polypeptides or their transcriptionally active
domains and vectors comprising these nucleic acids. In certain
embodiments, the Klf agent is a Klf4 agent.
[0159] The term Lhx agent is used to refer to Lhx (also called LIM
homeobox) polypeptides and the nucleic acids that encode them. Lhx
polypeptides are homeodomain containing transcription factors with
a LIM domain, a cysteine-rich zinc binding domain. The terms "Lhx
gene product", "Lhx polypeptide", and "Lhx protein" are used
interchangeably herein to refer to native sequence Lhx
polypeptides, Lhx polypeptide variants, Lhx polypeptide fragments
and chimeric Lhx polypeptides that can modulate transcription.
Native sequence Lhx polypeptides include the proteins Lhx1 (also
called LIM1; GenBank Accession Nos. NM_005568.2 and NP_005559.2);
Lhx2 (GenBank Accession Nos. NM_004789.3 and NP_004780.3); Lhx3
(GenBank Accession Nos. NM_178138.3 and NP_835258.1 (isoform a),
and NM_014564.2 and NP_055379.1 (isoform b)); Lhx4 (GenBank
Accession Nos. NM_033343.2 and NP_203129.1); Lhx5 (GenBank
Accession Nos. NM_022363.2 and NP_071758.1); Lhx6 (GenBank
Accession Nos. NM_014368.3 and NP_055183.2 (isoform 1), and
NM_199160.2 and NP_954629.2 (isoform 2)); Lhx7 (also called Lhx8;
GenBank Accession Nos. NM_001001933.1 and NP_001001933.1); and Lhx9
(GenBank Accession Nos. NM_020204.2 and NP_064589.2 (isoform 1),
and NM_001014434.1 and NP_001014434.1 (isoform 2)). Lhx
polypeptides, e.g. those that are at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical
to the sequence provided in the GenBank Accession Nos. above find
use as reprogramming factors in the present invention, as do
nucleic acids encoding these polypeptides or their
transcriptionally active domains and vectors comprising these
nucleic acids. In certain embodiments, the Lhx agent is a Lhx2
agent.
[0160] The term Mef2 agent is used to refer to Mef2 (also called
myocyte enhancer factor 2) polypeptides and the nucleic acids that
encode them. Mef2 polypeptides are members of the MADS gene family
(so named for the yeast mating type-specific transcription factor
MCM1, the plant homeotic genes `agamous` and `deficiens` and the
human serum response factor SRF) of transcription factors. The
terms "Mef2 gene product", "Mef2 polypeptide", and "Mef2 protein"
are used interchangeably herein to refer to native sequence Mef2
polypeptides, Mef2 polypeptide variants, Mef2 polypeptide fragments
and chimeric Mef2 polypeptides that can modulate transcription.
Native sequence Mef2 polypeptides include the proteins Mef2a
(GenBank Accession Nos. NM_005587.2 and NP_005578.2 (isoform 1),
NM_001130926.1 and NP_001124398.1 (isoform 2), NM_001130927.1 and
NP_001124399.1 (isoform 3), and NM_001130928.1 and NP_001124400.1
(isoform 4); Mef2b (GenBank Accession Nos. NM_001145785.1 and
NP_001139257.1); Mef2c (GenBank Accession Nos. NM_002397.3 and
NP_002388.2 (isoform 1) and NM_001131005.1 and NP_001124477.1
(isoform 2)); and Mef2d (GenBank Accession Nos. NM_005920.2 and
NP_005911.1). Mef2 polypeptides, e.g. those that are at least 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or
are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Mef2 agent is a
Mef2c agent.
[0161] The term Nr2f agent is used to refer to Nr2f (also called
nuclear receptor subfamily 2, group F) polypeptides and the nucleic
acids that encode them. Nr2f polypeptides are transcription
factors. The terms "Nr2f gene product", "Nr2f polypeptide", and
"Nr2f protein" are used interchangeably herein to refer to native
sequence Nr2f polypeptides, Nr2f polypeptide variants, Nr2f
polypeptide fragments and chimeric Nr2f polypeptides that can
modulate transcription. Native sequence Nr2f polypeptides include
the proteins Nr2f1 (also called COUP-TF1; GenBank Accession Nos.
NM_005654.4 and NP_005645.1); and Nr2f2 (GenBank Accession Nos.
NM_021005.3 and NP_066285.1 (isoform a), NM_001145155.1 and
NP_001138627.1 (isoform b), and NM_001145156.1 and NP_001138628.1
(isoform c)). Nr2f polypeptides, e.g. those that are at least 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or
are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Nr2f agent is a
Nr2f1 agent.
[0162] The term Pax agent is used to refer to Pax (also called
Paired box) polypeptides and the nucleic acids that encode them.
Pax polypeptides are paired-box containing transcription factors.
The terms "Pax gene product", "Pax polypeptide", and "Pax protein"
are used interchangeably herein to refer to native sequence Pax
polypeptides, Pax polypeptide variants, Pax polypeptide fragments
and chimeric Pax polypeptides that can modulate transcription.
Native sequence Pax polypeptides include the proteins Pax1 (GenBank
Accession Nos. NM_006192.3 and NP_006183.2); Pax2 (GenBank
Accession Nos. NM_003987.3 and NP_003978.2 (isoform a), NM_000278.3
and NP_000269.2 (isoform b); NM_003988.3 and NP_003979.2 (isoform
c); NM_003989.3 and NP_003980.2 (isoform d), and NM_003990.3 and
NP_003981.2 (isoform e)); Pax3 (GenBank Accession Nos. NM_000438.4
and NP_000429.2); Pax4 (GenBank Accession Nos. NM_006193.2 and
NP_006184.2); Pax5 (GenBank Accession Nos. NM_016734.1 and
NP_057953.1); Pax6 (GenBank Accession Nos. NM_000280.3 and
NP_000271.1); Pax7 (GenBank Accession Nos. NM_002584.2 and
NP_002575.1); Pax8 (GenBank Accession Nos. NM_003466.3 and
NP_003457.1); and Pax9 (GenBank Accession Nos. NM_006194.3 and
NP_006185.1) Pax polypeptides, e.g. those that are at least 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or
are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Pax agent is a
Pax6 agent.
[0163] The term Rfx agent is used to refer to Rfx (also called
regulatory factor X (influences HLA class II expression))
polypeptides and the nucleic acids that encode them. Rfx
polypeptides are transcription factors that contain a winged-helix
DNA binding domain. The terms "Rfx gene product", "Rfx
polypeptide", and "Rfx protein" are used interchangeably herein to
refer to native sequence Rfx polypeptides, Rfx polypeptide
variants, Rfx polypeptide fragments and chimeric Rfx polypeptides
that can modulate transcription. Native sequence Rfx polypeptides
include the proteins Rfx1 (GenBank Accession Nos. NM_002918.4 and
NP_002909.4); Rfx2 (GenBank Accession Nos. NM_000635.3 and
NP_000626.2 (isoform a) and NM_134433.2 and NP_602309.1 (isoform
b)); Rfx3 (GenBank Accession Nos. NM_002919.2 and NP_002910.1
(isoform a), and NM_134428.1 and NP_602304.1 (isoform b)); Rfx4
(GenBank Accession Nos. NM_032491.4 and NP_115880.2 (isoform a),
NM_002920.3 and NP_002911.2 (isoform b); and NM_213594.1 and
NP_998759.1 (isoform c)); Rfx5 (GenBank Accession Nos. NM_000449.3
and NP_000440.1); Rfx6 (GenBank Accession Nos. NM_173560.2 and
NP_775831.2); Rfx7 (GenBank Accession Nos. NM_022841.5 and
NP_073752.5); and Rfx8 (GenBank Accession Nos. NM_001145664.1 and
NP_001139136.1). Rfx polypeptides, e.g. those that are at least
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%,
99%, or are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Rfx agent is a
Rfx4 agent.
[0164] The term Nkx6 agent is used to refer to Nkx6 (also called
NK6 homeobox) polypeptides and the nucleic acids that encode them.
Nkx6 polypeptides are homeodomain containing transcription factors.
The terms "Nkx6 gene product", "Nkx6 polypeptide", and "Nkx6
protein" are used interchangeably herein to refer to native
sequence Nkx6 polypeptides, Nkx6 polypeptide variants, Nkx6
polypeptide fragments and chimeric Nkx6 polypeptides that can
modulate transcription. Native sequence Nkx6 polypeptides include
the proteins Nkx6-1 (GenBank Accession Nos.
NM_006168.2.fwdarw.NP_006159.2); Nkx6-2
(NM_177400.2.fwdarw.NP_796374.1); and Nkx6-3
(NM_152568.2.fwdarw.NP_689781.1). Nkx6 polypeptides, e.g. those
that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 95%, 97%, 99%, or are 100% identical to the sequence provided
in the GenBank Accession Nos. above find use as reprogramming
factors in the present invention, as do nucleic acids encoding
these polypeptides or their transcriptionally active domains and
vectors comprising these nucleic acids. In certain embodiments, the
Nkx6 agent is a Nkx6-1 or an Nkx6-2 agent.
[0165] The term FoxG agent is used to refer to FoxG (also called
forkhead box G) polypeptides and the nucleic acids that encode
them. FoxG1 polypeptides are members of the forkhead family of
transcription factors, and contain a forkhead domain. The terms
"FoxG gene product", "FoxG polypeptide", and "FoxG protein" are
used interchangeably herein to refer to native sequence FoxG
polypeptides, FoxG polypeptide variants, FoxG polypeptide fragments
and chimeric FoxG polypeptides that can modulate transcription.
Native sequence FoxG polypeptides include the proteins FoxG1,
encoded by GenBank Accession Nos. NM_005249.3 and NP_005240.3. FoxG
polypeptides, e.g. those that are at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical
to the sequence provided in the GenBank Accession Nos. above find
use as reprogramming factors in the present invention, as do
nucleic acids encoding these polypeptides or their
transcriptionally active domains and vectors comprising these
nucleic acids. In certain embodiments, the FoxG agent is a FoxG1
agent.
[0166] The term Sall agent is used to refer to Sall (also called
Sal-like) polypeptides and the nucleic acids that encode them. Sall
polypeptides are C2H2 zinc finger-containing transcription factors.
The terms "Sall gene product", "Sall polypeptide", and "Sall
protein" are used interchangeably herein to refer to native
sequence Sall polypeptides, Sall polypeptide variants, Sall
polypeptide fragments and chimeric Sall polypeptides that can
modulate transcription. Native sequence Sall polypeptides include
the proteins Sall1 (GenBank Accession Nos. NM_002968.2 and
NP_002959.2 (isoform 1), and NM_001127892.1 and NP_001121364.1
(isoform 2)); Sall2 (GenBank Accession Nos. NM_005407.1 and
NP_005398.1); Sall3 (GenBank Accession Nos. NM_171999.2 and
NP_741996.2); and Sall4 (GenBank Accession Nos. NM_020436.3 and
NP_065169.1). Sall polypeptides, e.g. those that are at least 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or
are 100% identical to the sequence provided in the GenBank
Accession Nos. above find use as reprogramming factors in the
present invention, as do nucleic acids encoding these polypeptides
or their transcriptionally active domains and vectors comprising
these nucleic acids. In certain embodiments, the Sall agent is a
Sall3 agent.
[0167] The term .beta.-catenin agent is used to refer to
.beta.-catenin polypeptides and the nucleic acids that encode them.
The terms ".beta.-catenin gene product", ".beta.-catenin
polypeptide", and ".beta.-catenin protein" are used interchangeably
herein to refer to native sequence .beta.-catenin polypeptides,
.beta.-catenin polypeptide variants, .beta.-catenin polypeptide
fragments and chimeric .beta.-catenin polypeptides that can
modulate transcription. Native sequence .beta.-catenin polypeptides
include the proteins encoded by GenBank Accession Nos.
NM_001098209.1 and NP_001091679.1. .beta.-catenin polypeptides,
e.g. those that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100% identical to the
sequence provided in the GenBank Accession Nos. above find use as
reprogramming factors in the present invention, as do nucleic acids
encoding these polypeptides or their transcriptionally active
domains and vectors comprising these nucleic acids.
[0168] The term L3mbtl agent is used to refer to L3mbtl (for 1(3)
mbt-like (Drosophila)) polypeptides and the nucleic acids that
encode them. L3mbtl polypeptides are transcription factors that
localize to condensed chromosomes in mitotic cells. The terms
"L3mbtl gene product", "L3mbtl polypeptide", and "L3mbtl protein"
are used interchangeably herein to refer to native sequence L3mbtl
polypeptides, L3mbtl polypeptide variants, L3mbtl polypeptide
fragments and chimeric L3mbtl polypeptides that can modulate
transcription. Native sequence L3mbtl polypeptides include the
proteins L3mbtl1 (GenBank Accession Nos. NM_015478.5 and
NP_056293.4 (isoform 1), and NM_032107.3 and NP_115479.3 (isoform
2)); L3mbtl2 (GenBank Accession Nos. NM_031488.4 and NP_113676.2);
L3mbtl3 (GenBank Accession Nos. NM_032438.1 and NP_115814.1
(isoform a), and NM_001007102.1 and NP_001007103.1 (isoform b));
and L3mbtl4 (GenBank Accession Nos. NM_173464.3 and NP_775735.2).
L3mbtl polypeptides, e.g. those that are at least 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 95%, 97%, 99%, or are 100%
identical to the sequence provided in the GenBank Accession Nos.
above find use as reprogramming factors in the present invention,
as do nucleic acids encoding these polypeptides or their
transcriptionally active domains and vectors comprising these
nucleic acids. In certain embodiments, the L3mbtl agent is a
L3mbtl1 agent.
[0169] Ascl, Brn, Myt, and Zic agents are as described above for NR
factors. In certain embodiments, the Ascl agent that is a (NSC)R
factor is an Ascl1 agent. In certain embodiments, the Brn agent
that is a (NSC)R factor is an Brn2 or Brn4 agent. In certain
embodiments, the Myt agent that is a (NSC)R factor is a Myt1 agent.
In certain embodiments, the Zic agent that is a (NSC)R factor is a
Zic1 agent.
[0170] Sox, Hes, and Id agents are as described above for AR
factors. In certain embodiments, the Sox agent that is a (NSC)R
factor is a Sox2 agent. In certain embodiments, the Hes agent that
is a (NSC)R factor is a Hes1 or HesS agent. In certain embodiments,
the Id agent that is a (NSC)R factor is an Id1 or Id4 agent.
[0171] Nkx2 agents are as described above for OR factors. In
certain embodiments, the Nkx2 agent that is a (NSC)R factor is an
Nkx2-2 agent.
[0172] As with NR factors, in some embodiments, (NSC)R factor(s)
are provided as nuclear acting polypeptides. In some embodiments,
(NSC)R factors are provided as nucleic acids encoding (NSC)R
polypeptides, i.e. (NSC)R nucleic acids. Methods of preparing
(NSC)R nuclear acting polypeptides and (NSC)R nucleic acids and of
providing (NSC)R nuclear acting polypeptides and (NSC)R nucleic
acids to the subject cells are as described above for NR nuclear
acting polypeptides and NR nucleic acids.
[0173] As with NR factors, one or more (NSC)R factors may be
provided to the cells. When more than one (NSC)R factors is
provided, the (NSC)R factors may be provided individually or as a
single composition, that is, as a premixed composition, of factors,
simultaneously or sequentially, at the same molar ratio or at
different molar ratios, once or multiple times in the course of
culturing the cells.
[0174] As with NR system, in addition to the one or more (NSC)R
factors, the (NSC)R system may include other reagents. Examples of
such reagents include those described above for the NR system that
are known in the art to promote cell reprogramming. Other reagents
for optional inclusion in the (NSC)R system include those known in
the art to promote the survival and proliferation of neural stem
cells, e.g. EGF, FGF2, and the like.
[0175] As with the NR system, reagents in the (NSC)R system may be
provided in any culture media known in the art to promote cell
survival and proliferation and neural stem cells, e.g.
DMEM/F12.
[0176] One example of a (NSC)R system for use in the present
methods is a system comprising DMEM/F12, 25 .mu.g/ml insulin, 50
.mu.g/ml transferrin, 30 nM sodium selenite, 20 nM progesterone
(Sigma), 100 nM putrescine (Sigma), 10 ng/ml FGF2 (R&D
Systems), 10 ng/ml EGF, and penicillin/streptomycin (see, e.g.
Wernig M. et al. (2002) J. Neurosci Research 69:918-924). Daily
additions of fibroblast growth factor-2 direct neural stem cells to
become neuronal progenitor cells, and terminal differentiation into
neurons may be induced by FGF2 withdrawal (Okabe S. et al. (1996)
Mech Dev 59:89-102). Alternatively, daily additions of 10 ng/ml
FGF2 and 10 ng/ml platelet-derived growth factor (PDGF)-AA (R&D
Systems) direct neural stem cells to become glial progenitors,
after which terminal differentiation into astrocytes and
oligodendrocytes may be induced by growth factor withdrawal (for
details of glial differentiation protocols, see, e.g. Brustle, O.
et al. (1999) Science 285:754-756).
[0177] The (NSC)R system is provided to non-neural somatic cells or
pluripotent cells so as to reprogram, i.e. convert, those cells
into induced neural stem cells (iNSCs). Non-neural somatic cells
include any somatic cell that would not give rise to a neuron in
the absence of experimental manipulation. Examples of non-neural
somatic cells include differentiating or differentiated cells from
ectodermal (e.g., fibroblasts), mesodermal (e.g., myocytes), or
endodermal (e.g., pancreatic cells) lineages. The somatic cells may
be, for example, pancreatic beta cells, astroctyes,
oligodendrocytes, hepatocytes, hepatic stem cells, cardiomyocytes
skeletal muscle cells, smooth muscle cells, hematopoietic cells,
osteoclasts, osteoblasts, pericytes, vascular endothelial cells,
and the like. They may be terminally differentiated cells, or they
may be capable of giving rise to cells of a specific, non-neural
lineage, e.g. cardiac stem cells, hepatic stem cells, and the like.
The somatic cells are readily identifiable as non-neural by the
absence of neural-specific markers that are well-known in the art,
as described above.
[0178] Induced neural stem cells, be they induced in vitro and
transplanted into a subject or induced in vivo, i.e. in the
subject, find use in treating subjects in need of neuronal
replacement therapy, e.g. subjects suffering from a neurological
disease, disorder or condition as discussed above.
Screening Methods.
[0179] The methods described herein also provide a useful system
for screening candidate agents for activity in modulating cell
conversion into somatic cells of a neural lineage, e.g. neurons,
astrocytes, oligodendryocytes, or progenitor cells thereof. In
screening assays for biologically active agents, cells, usually
cultures of cells, are contacted with a candidate agent of interest
in the presence of the cell reprogramming system or an incomplete
cell reprogramming system, and the effect of the candidate agent is
assessed by monitoring output parameters such as the level of
expression of genes specific for the desired cell type, i.e.
neuron, astrocyte, oligodendrocyte, or neural stem cell, as is
known in the art, or the ability of the cells that are induced to
function like the desired cell type, e.g. to propagate an action
potential (for neurons), to promote synapse formation (for
astrocytes), to produce myelin (for oligodendryocytes), to exit
mitosis and differentiate into neurons, astroctyes, and/or
oligodendrocytes (for neural stem cells); etc. as is known in the
art.
[0180] For example, agents can be screened for an activity in
promoting reprogramming of cells to a neuronal cell fate. For such
a screen, a candidate agent may be added to a cell culture
comprising candidate cells and a NR system or an incomplete NR
system, where an observed increase in the level of RNA or protein
of a neuronal gene, e.g. a 1.5-fold, a 2-fold, a 3-fold or more
increase in the amount of RNA or protein from a neuronal-specific
gene, e.g., Tau, Beta-III-Tubulin (encoding the protein Tuj1),
MAP2, and the like, over that observed in the culture absent the
candidate agent would be an indication that the candidate agent was
an agent that promotes reprogramming to a neuronal fate.
Reciprocally, an observed decrease in the level of RNA or protein
of a neuronal gene, e.g. a 1.5-fold, a 2-fold, a 3-fold or more
decrease in the amount of RNA or protein from a neuronal-specific
gene, e.g., Tau, Tuji, MAP2, as compared to that observed in the
culture absent the candidate agent would be an indication that the
candidate agent was an agent that suppresses reprogramming to a
neuronal fate. Incomplete NR systems, e.g. a NR system lacking one
or more factors, or comprising sub-optimal levels of one or more
factors, and the like, may be used in place of a complete NR system
to increase the sensitivity of the screen.
[0181] As another example, agents can be screened for an activity
in promoting the development of a neuron, e.g. the development of
synapses by a neuron derived from a methods of the invention. In
such a case, a candidate agent may be added to a cell culture
comprising newly-induced neurons, e.g. neurons that were induced
with a NR system 3 days, 4 days, 5 days, 6 days, 7 days or 10 days
or more prior to contacting with the candidate agent. In some
embodiments, the induced neurons are purified/isolated from the NR
system-contacted culture and replated prior to contacting with the
candidate agent, e.g. by methods described above for enriching for
iN cells. In some embodiments, the induced neurons are contacted
with the candidate agent in the context of the NR system, e.g. 2
days, 3 days, 5 days, 7 days or 10 days or more after the initial
contact with the NR system. For example, in a screen of candidate
agents that modulate synapse development, an observed increase in
the spontaneous and rhythmic network activity at a holding
potential of -70 mV, in the number of excitatory (EPSC) and
inhibitory (IPSC) postsynaptic currents evoked, or in the number of
synapsin-positive puncta surrounding MAP-2 positive dendrites as
observed by immunohistochemistry, e.g. a 1.5-fold, a 2-fold, a
3-fold or more increase in these parameters, over that observed in
the culture absent the candidate agent would be an indication that
the candidate agent was an agent that promotes synapse formation.
Reciprocally, an observed decrease in the spontaneous and rhythmic
network activity at a holding potential of -70 mV, in the number of
excitatory (EPSC) and inhibitory (IPSC) postsynaptic currents
evoked, or in the number of synapsin-positive puncta surrounding
MAP-2 positive dendrites as observed by immunohistochemistry, e.g.
a 1.5-fold, a 2-fold, a 3-fold or more decrease in these
parameters, as compared to that observed in the culture absent the
candidate agent would be an indication that the candidate agent was
an agent that suppresses synapse formation.
[0182] As discussed above with regard to uses for iNs produced by
in vitro methods in screening candidate agents for those with an
activity in modulating the survival or activity of neurons in a
subject suffering from a neurological disease or disorder,
candidate agents of interest for screening include known and
unknown compounds that encompass numerous chemical classes,
primarily organic molecules, which may include organometallic
molecules, inorganic molecules, genetic sequences, etc. An
important aspect of the invention is to evaluate candidate drugs,
including toxicity testing; and the like.
[0183] Also as discussed above, compounds, including candidate
agents, may be obtained from a wide variety of sources including
libraries of synthetic or natural compounds. Additionally, natural
or synthetically produced libraries and compounds are readily
modified through conventional chemical, physical and biochemical
means, and may be used to produce combinatorial libraries. Known
pharmacological agents may be subjected to directed or random
chemical modifications, such as acylation, alkylation,
esterification, amidification, etc. to produce structural
analogs.
[0184] Also as discussed above, candidate agents are screened for
biological activity by adding the agent to one or a plurality of
cell samples, usually in conjunction with cells lacking the agent.
The change in parameters in response to the agent is measured, and
the result evaluated by comparison to reference cultures, e.g. in
the presence and absence of the agent, obtained with other agents,
etc. As discussed above, the agents are conveniently added in
solution, or readily soluble form, to the medium of cells in
culture. The agents may be added in a flow-through system, as a
stream, intermittent or continuous, or alternatively, adding a
bolus of the compound, singly or incrementally, to an otherwise
static solution.
[0185] A plurality of assays may be run in parallel with different
agent concentrations to obtain a differential response to the
various concentrations. As known in the art, determining the
effective concentration of an agent typically uses a range of
concentrations resulting from 1:10, or other log scale, dilutions.
The concentrations may be further refined with a second series of
dilutions, if necessary. Typically, one of these concentrations
serves as a negative control, i.e. at zero concentration or below
the level of detection of the agent or at or below the
concentration of agent that does not give a detectable change in
the phenotype.
[0186] Various methods can be utilized for quantifying the chosen
parameters. For example, a convention method of measuring the
presence or amount of a selected marker is to label a molecule with
a detectable moiety, which may be fluorescent, luminescent,
radioactive, enzymatically active, etc., particularly a molecule
specific for binding to the parameter with high affinity.
Fluorescent moieties are readily available for labeling virtually
any biomolecule, structure, or cell type. Immunofluorescent
moieties can be directed to bind not only to specific proteins but
also specific conformations, cleavage products, or site
modifications like phosphorylation. Individual peptides and
proteins can be engineered to autofluoresce, e.g. by expressing
them as green fluorescent protein chimeras inside cells (for a
review see Jones et al. (1999) Trends Biotechnol.
17(12):477-81).
[0187] Kits may be provided, where the kit will comprise one or
more factors to promote the conversion of cells into cells of a
neural lineage. A combination of interest may include one or more
NR, AR, OR or (NSC)R polypeptides or vectors comprising nucleic
acids encoding those polypeptides and one or more other reagents of
the NR, AR OR, or (NSC)R systems, respectively. Kits may further
include cells or reagents suitable for isolating and culturing
cells in preparation for conversion; reagents suitable for
culturing neurons, astrocytes, oligodendrocytes, or neural stem
cells following contacting with the NR, AR, OR, or (NSC)R system,
respectively; and reagents useful for determining the expression of
neuron-specific, astrocyte-specific, oligodendryocyte-specific, or
neural stem cell-specific genes in the contacted cells, e.g. to
determine effective doses of the NR/AR/OR/(NSC)R system. Kits may
also include tubes, buffers, etc., and instructions for use.
EXAMPLES
[0188] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
Example 1
Induction of Neuronal Cells from Mouse Fibroblasts
Materials and Methods
[0189] Embryonic fibroblast isolation. Homozygous TauEGFP knock-in
mice (Tucker, K. L., et al. (2001) Nat Neurosci 4, 29-37) were
purchased from the Jackson Laboratories and bred with C571316 mice
(Taconic) to generate TauEGFP heterozygous embryos. Balb/c mice
were purchased from Taconic. Rosa26-rtTA mice were obtained from
Rudolf Jaenisch (Beard, C., et al. (2006) Genesis 44, 23-8). MEFs
were isolated from E14.5 embryos under a dissection microscope
(Leica). The head, vertebral column (containing the spinal cord),
dorsal root ganglia, and all internal organs were removed and
discarded to ensure the removal of all cells with neurogenic
potential from the cultures. The remaining tissue was manually
dissociated and incubated in 0.25% Trypsin (Sigma) for 10-15
minutes to create a single cell suspension. The cells from each
embryo were plated onto a 15cm tissue culture dish in MEF media
(Dulbecco's Modified Eagle Medium (Invitrogen) containing 10% Fetal
Bovine Serum (FBS) (Hyclone), beta-mercaptoethanol (Sigma-Aldrich),
non-essential amino acids, sodium pyruvate, and
penicillin/streptomycin (all from Invitrogen). Cells were grown at
37.degree. C. for 4-7 days until confluent, and then split once
before being frozen. After thawing, cells were cultured on 15 cm
plates and allowed to become confluent before being split onto
plates for infections using 0.25% Trypsin. Postnatal tail tip
fibroblasts were prepared by removing the bottom third of tail from
3-day-old pups using surgical scissors. Cells were rinsed in
ethanol, washed with HBSS (Sigma), and then dissociated using
scissors and 0.25% Trypsin. Tail tip fibroblasts were cultured in
MEF media until confluent and passaged once before being pooled
together and frozen down for further use.
[0190] Cell culture, molecular cloning and infections. We had three
criteria for identifying candidates with neuron-inducing activity:
(i) we reasoned that cell-fate inducing factors should be enriched
in the gene category of transcriptional regulators. (ii) We
included factors previously involved in reprogramming to
pluripotency (Klf4, c-Myc, and Sox2). (iii) We searched for genes
specifically expressed in neural tissues. Those were selected based
on published expression arrays of MEFs, ES cells and neural
progenitor cells retrieved from the Gene Expression Omnibus
database GSE8024 and the EST Profile function of NCBI's Unigene
database. cDNAs for the factors included in the nineteen factor
pool were cloned into lentiviral constructs under the control of
the tetracycline operator (Wernig, M. et al. (2008) Nat Biotechnol
26, 916-24). Replication-incompetent, VSVg-coated lentiviral
particles were packaged in 293T cells as described (Wernig, M. et
al. (2008) Nat Biotechnol 26, 916-24). Passage three TauEGFP and
Balb/c MEFs were infected in MEF media containing polybrene (8
.mu.g/mL). After 16-20 hours in media containing lentivirus, the
cells were switched into fresh MEF media containing doxycycline (2
.mu.g/mL) to activate expression of the transduced genes. After 48
hours in MEF media with doxycycline (Sigma), the media was replaced
with N3 media 22containing doxycycline. The media was changed every
2-3 days for the duration of the culture period. For BrdU
experiments, 10 .mu.M BrdU was added to the culture media and was
maintained throughout media changes until the cells were fixed.
[0191] Immunofluorescence, RT-PCR and flow cytometry. Neuronal
cells were defined as cells, which stained positive for Tuj1 and
had a process at least 3 times longer than the cell body. For
immunofluorescence staining, cells were washed with PBS and then
fixed with 4% paraformaldehyde for 10 minutes at room temperature
(RT). Cells were then incubated in 0.2% Triton X-100 (Sigma) in PBS
for 5 minutes at RT. After washing twice with PBS, cells were
blocked in a solution of PBS containing 4% BSA, 1% FBS for 30
minutes at RT. Primary and secondary antibodies were diluted in a
solution of PBS containing 4% BSA and 1% FBS. Fields of cells for
staining were outlined with a PAP pen (DAKO). Primary and secondary
antibodies were typically applied for 1 hour and 30 minutes,
respectively. Cells were washed three times with PBS between
primary and secondary staining. For anti-BrdU staining, cells were
treated with 2N HCl in PBS for 10 minutes and washed twice with PBS
before permeablization with TritonX-100 (Sigma). The following
antibodies were used for our analysis: goat anti-ChAT (Millipore,
1:100), rabbit anti-GABA (Sigma, 1:4000), rabbit-GFAP (DAKO,
1:4000), mouse anti-MAP2 (Sigma, 1:500), mouse anti-NeuN
(Millipore, 1:100), mouse anti-Peripherin (Sigma, 1:100), mouse
anti-Sox2 (R&D Systems, 1:50), rabbit anti-Serotonin
(Biogenesis, 1:1000), rabbit anti-Tuj1 (Covance, 1:1000), mouse
anti-Tuj1 (Covance, 1:1000), goat anti-Brn2 (Santa Cruz
Biotechnology, 1:100), mouse anti-BrdU (Becton-Dickinson, 1:3.5),
mouse anti-Calretinin (DAKO, 1:100), sheep anti-Tyrosine
Hydroxylase (Pel-Freez, 1:1000), E028 rabbit anti-synapsin (gift
from Thomas Sudhof, 1:500), guinea pig anti-vGLUT1 (Millipore,
1:2000), mouse anti-GAD6 (Developmental Studies Hybridoma Bank
(DSHB), 1:500), mouse anti-Pax3 (DSHB, 1:250), mouse anti-Pax6
(DSHB, 1:50), mouse anti-Pax7 (DSHB, 1:250), mouse anti-Nkx2.2
(DSHB, 1:100), mouse anti-Olig1 (NeuroMab, 1:100). Fitc-, and
Cy3-conjugated secondary antibodies were obtained from Jackson
Immunoresearch. Alexa-488, Alexa-546 and Alexa-633-conjugated
secondary antibodies were obtained from Invitrogen. TauEGFP
expressing cells were analyzed and sorted on a FACS Aria 2 (Becton
Dickinson). Flow cytometry data was analyzed using Flowjo (Tree
Star). For RT-PCR analysis, RNA was isolated using Trizol
(Invitrogen) following the manufacturer's instructions, treated
with DNAse (NEB) and 1.5 .mu.g was reverse-transcribed with
Superscript II (Invitrogen). PCR was performed using the following
primers Sox1 (SEQ ID NO:2) (F-TCGAGCCCTTCTCACTTGTT, (SEQ ID NO:3)
R-TTGATGCATTTTGGGGGTAT), Sox10 (SEQ ID NO:4)
(F-GAACTGGGCAAGGTCAAGAA, (SEQ ID NO:5) R- CGCTTGTCACTTTCGTTCAG),
.beta.-Actin (SEQ ID NO:6) (F-CGTGGGCCGCCCTAGGCACCA, (SEQ ID NO:7)
R-CTTAGGGTTCAGGGGGGC). PCR products were analyzed on a 1% gel.
[0192] Efficiency Calculation. The following method was used to
calculate the efficiency of neuronal induction. The total number of
Tuj1+ cells with a neuronal morphology, defined as a cell with a
circular, three dimensional appearance and a thin process extending
at least three times the length of the cell body, were quantified
twelve days after infection. This estimate was based on the average
number of iN cells present in 30 randomly selected 20.times. visual
fields. The area of a 20.times. visual field was then measured, and
we used this estimated density of iN cells to determine the total
number of neurons present in the entire dish. We then divided this
number by the number of cells plated before infection to get a
percentage of the starting population of cells that adopted
neuron-like characteristics.
[0193] Cortical cultures. Primary cortical neurons were isolated
from newborn wildtype mice as described in Maximov, A., et al.
(2007) J Neurosci Methods 161, 75-87, with modifications. Briefly,
cortices were dissociated by papain (10 U/ml, with 1 .mu.M
Ca.sup.2+, and 0.5 .mu.M EGTA) digestions and plated on Matrigel
coated circle glass coverslips ( 11 mm). The neurons were cultured
in vitro in MEM (Invitrogen) supplemented with B27 (Invitrogen),
glucose, transferrin, FBS and Ara-C (Sigma).
[0194] Glial cell isolation. Forebrains were dissected from
postnatal day five wild-type mice and were manually dissociated
into .about.0.5 mm.sup.2 pieces in a total of 2 mL of HBSS. 500
.mu.L of 2.5% Trypsin and 1% DNase were added and dissociated
tissue was incubated at 37.degree. for 15 minutes. Solution was
mixed every 5 minutes. The supernatant was then transferred into
1.5 mL of Fetal bovine serum (FBS). 4 ml of HBSS, 500 .mu.l 2.5%
Trypsin, and 500 .mu.l DNase were again added to the remaining
dissociated tissue and incubated at 37.degree. for 15 minutes,
mixing every 5 minutes. The supernatant was again removed and added
to the FBS-containing solution. Using a pipette, the remaining
tissue was further dissociated and passed through a 70 .mu.M nylon
mesh filter (BD Biosciences) into the FBS-containing solution. The
cell mixture was then spun at 1000 rpm for 5 minutes and
resuspended in MEF media. Glial cells were passaged three times
before culturing with MEF or TTF-derived iN cells. Contaminating
neurons in p3 glial cell cultures could not be detected when
stained for either Tuj1 or MAP2.
[0195] Electrophysiology. Recordings were performed from MEF- and
tail cell-derived iN cells at 8, 12 and 20 days after viral
infection, or 7-13 days after co-culturing with cortical neurons.
Spontaneous or evoked synaptic responses were recorded in the
whole-cell voltage-clamp mode. Evoked synaptic responses were
triggered by 1 ms current injection through a local extracellular
electrode (FHC concentric bipolar electrode, Catalogue No. CBAEC75)
with a Model 2100 Isolated Pulse Stimulator (A-M Systems, Inc.),
and recorded in whole-cell mode using a Multiclamp 700B amplifier
(Molecular Devices, Inc.) (Maximov, A. & Sudhof, T. C. (2005)
Neuron 48, 547-54). Data were digitized at 10 kHz with a 2 kHz
low-pass filter. The whole-cell pipette solution for synaptic
current recordings contained: 135 mM CsCl, 10 mM HEPES, 1 mM EGTA,
4 mM Mg-ATP, 0.4 mM Na.sub.4GTP, and 10mM QX-314, pH 7.4. The bath
solution contained (in mM): 140 mM NaCl, 5 mM KCl, 2 mM CaCl.sub.2,
0.8 mM MgCl.sub.2, 10 mM HEPES, and 10 mM glucose, pH 7.4. IPSCs
were pharmacologically isolated by addition of 50 .mu.M D-AP5 and
20 .mu.M CNQX to the bath solution. EPSCs were pharmacologically
isolated by addition of 30 .mu.M picrotoxin and 50 .mu.M D-APV.
Data were analyzed using Clampfit 10.02 (Axon Instruments, Inc).
Action potentials (APs) were recorded with current-clamp whole-cell
configuration. The pipette solution for current clamp experiments
contained (in mM) 123 mM K-gluconate, 10 mM KCl, 1 mM MgCl.sub.2,
10 mM HEPES, 1 mM EGTA, 0.1 mM CaCl.sub.2, 1 mM K.sub.2ATP, 0.2 mM
Na.sub.4GTP, and 4 mM glucose, pH adjusted to 7.2 with KOH.
Membrane potentials were kept around --65 to -70 mV, and step
currents were injected to elicit action potential. Whole-cell
currents including sodium currents, potassium currents were
recorded at a holding potential of -70 mV, voltage steps ranging
from -80 mV to +90 mV were delivered at 10 mV increments.
Results
[0196] A screen for neuronal fate-inducing transcription factors.
Reasoning that multiple transcription factors would likely be
required to reprogram fibroblasts to a neuronal fate, we cloned a
total of nineteen genes that are specifically expressed in neural
tissues, play important roles in neural development, or have been
implicated in epigenetic reprogramming (Table 1).
TABLE-US-00001 TABLE 1 Transcription factors screened for
neuron-inducing activity in MEFs. Gene Name Gene Bank Ascl1
NM_008553 Brn2 NM_008899 Brn4 NM_008901 c-myc NM_010849 Dlx1
NM_010053 Hes5 NM_010419 Id1 NM_010495 Id4 NM_031166 Klf4 NM_010637
Lhx2 NM_010710 Mef2c NM_025282 Myt1l NM_001093775 NeuroD1 NM_010894
Nhlh1 NM_010916 Nr2f1 NM_010151 Olig2 NM_016967 Pax6 NM_013627 Sox2
NM_011443 Zic 1 NM_009573
[0197] A pool of lentiviruses containing all nineteen genes (19F
pool) was prepared to infect mouse embryonic fibroblasts (MEFs)
from TauEGFP knock-in mice, which express EGFP specifically in
neurons (Tucker, K. L., et al. (2001) Nat Neurosci 4, 29-37;
Wernig, M. et al. (2002) J Neurosci Res 69, 918-24) (see FIG. 1a
for experimental outline). Great care was taken to exclude neural
tissue for the MEF isolation, and we were unable to detect evidence
for the presence of neurons or neural progenitor cells in these
cultures using immunofluorescence, fluorescence activated cell
sorting (FACS), and RT-PCRanalyses (FIG. 6). However, uninfected
MEFs did contain rare Tujl-positive, TauEGFP-negative cells with
fibroblast-like morphology, indicative of weak Tujl (i.e.
.beta.-III-tubulin) expression in non-neuronal cells (FIG. 1b,c;
FIG. 6a). In contrast, 32 days after infection with the 19F pool,
we detected Tuj1-positive cells with typical neuronal morphologies
and bright TauEGFP fluorescence (FIG. 1d,e). Thus, some
combination(s) of the genes in the 19F pool was capable of
converting MEFs into induced neuronal (iN) cells.
[0198] We next set out to narrow down the number of transcription
factors required for generation of iN cells. Given their important
roles in neuronal cell fate determination (Lee, J. E. et al. (1995)
Science 268, 836-44; Guillemot, F. et al. (1993) Cell 75, 463-76;
Farah, M. H. et al. (2000) Development 127, 693-702; Guillemot, F.
(2005) Curr Opin Cell Biol 17, 639-47), we first tested the bHLH
transcription factors Ascl1 (also known as Mash1), Ngn2 and Neurod1
individually. Surprisingly, we observed occasional Tuj1-,
TauEGFP-positive cells exhibiting a simple mono- or bipolar
morphology after infection with only Ascl1 (FIG. 7b), Ngn2 or
NeuroD. However, 19F-iN cells exhibited more complex morphologies
(compare to FIG. 1d,e). We therefore tested the neuron-inducing
activity of Ascl1 in combination with each of the remaining
eighteen candidate genes (FIG. 7a). Five genes (Brn2, Brn4, Myt1l,
Zic1, and Olig2) substantially potentiated the neuron-inducing
activity of Ascl1 (FIG. 7a-b). Importantly, none of these five
genes generated iN cells when tested individually (data not shown).
Next, we tested whether combinatorial expression of these factors
with Ascl1 could further increase the induction of neuron-like
cells by infecting TauEGFP MEFs with a pool of Brn2, Myt1l, Zic1,
Olig2, and Ascl1 viruses (5F pool). Given its close similarity to
Brn2, we did not include Brn4 in the 5F pool. Twelve days after
infection, we detected a frequent Tuj1-positive iN cells with
highly complex morphologies (FIG. 1f). These 5F-iN cells also
expressed the pan-neuronal markers MAP2, NeuN, and synapsin (FIG.
1i-j, n). Similar results were obtained with iN cells derived from
Balb/c MEFs (FIG. 8a)
[0199] Functional and phenotypic characterization of 5-factor iN
cells. To explore whether iN cells have functional membrane
properties similar to neurons, we performed patch-clamp recordings
of TauEGFP-positive cells on days 8, 12, and 20 after infection
(see Tables 2, 3, 5-8, 10, 12-15, and 17-20 for detailed results).
Action potentials could be elicited by depolarizing the membrane in
current clamp mode the majority of the iN cells analyzed (85.1%,
n=47) (FIG. 1k-l). Six cells (14.2%, n=42) exhibited spontaneous
action potentials, some as early as eight days after transduction
(FIG. 1m). These action potentials could be blocked by tetradotoxin
(TTX), a specific inhibitor of Na+ion channels (FIG. 8e). Moreover,
in voltage-clamp mode we observed both fast, inactivating inward
and outward currents, which likely correspond to opening of
voltage-dependent K+- and Na+-channels, respectively, with a
possible contribution of Ca2+-channels to the whole cell currents
(FIG. 1l, FIG. 8f). The resting membrane potentials (RMP) ranged
between -30 and -69 mV with an average of .about.-55 mV on day 20
(n=12, FIG. 3c, Table 2). Additionally, we asked whether these
cells possessed functional ligand-gated ion channels. iN cells
responded to exogenous application of GABA, and this response could
be blocked by the GABA receptor antagonist picrotoxin (FIG. 8g).
Thus, MEF-derived iN cells appear to exhibit the functional
membrane properties of neurons and possess ligand-gated
GABA-receptors.
[0200] We then sought to characterize the neurotransmitter
phenotype of iN cells. After 21 days of culture in minimal neuronal
media, we detected vGLUT1-positive puncta outlining MAP2-positive
neurites of some cells, indicating the presence of excitatory,
glutamatergic neurons (FIG. 10). In addition, we found iN cells
labeled with antibodies against GABA, the major inhibitory
neurotransmitter in brain (FIG. 1p). Some iN cells (9 out of
.about.500) contained the Ca2+-binding protein calretinin, a marker
for cortical interneurons and other neuronal subtypes (FIG. 8c). No
expression of tyrosine hydroxylase (TH), choline acetyltransferase
(ChAT) or serotonin (5HT) was detected. The majority of iN cells
were negative for peripherin, an intermediate filament
characteristic of peripheral neurons (Escurat, M., et al. (1990) J
Neurosci 10, 764-84).
[0201] Functional neurons from tail fibroblasts. To evaluate
whether iN cells could also be derived from postnatal cells, we
isolated tail-tip fibroblasts (TTFs) from three-day-old TauEGFP and
Rosa26-rtTA mice. Similar to our MEF cultures, we could not detect
preexisting neurons, glia, or neural progenitor cells (FIG. 6a).
Twelve days after infecting TTFs with the 5F pool, Tuj1-positive iN
cells with a complex, neuronal morphology could be readily detected
(FIG. 2a). TTF-iN cells expressed the pan-neuronal markers NeuN,
MAP2, and synapsin (FIG. 2b-c, f). Electrophysiological recordings
twelve days after infection demonstrated an average RMP of
.about.-57 mV (range: -35 to -70 mV, n=11), firing of APs (81.8%,
n=11) (FIG. 2d), and expression of functional voltage-gated
membrane channel proteins (FIG. 2e, and Tables 4, 6, 9, 11, and
16). We were also able to detect vGLUT1- as well as GABA-positive
cells (FIG. 2g-h). Despite extensive screening (>1,000 iN cells
analyzed), we were unable to detect tyrosine hydroxylase,
choline-acetyltransferase, or serotonin expression. Individual iN
cells exhibited peripherin-positive filaments (FIG. 8d).
TABLE-US-00002 TABLE 2 Electrophysiological parameters recorded
from (MEF)-derived 5 factor (5F)-iN cells: Passive membrane
properties. Average SEM n P value (student t test) Resting Membrane
potentials (mV) Day 8 -30.8 3.2 16 D8 vs. D12 0.000166: D7 Vs. D20:
0.00004 Day 12 -47.7 2.8 18 D12 vs. D21: 0.0833 Day 20 -55.4 5.3 12
Membrane Input Resistance (G.OMEGA.) Day 8 1.40 0.20 17 D8 vs. D12:
0.000638: D8 vs. D20: 0.001962 Day 12 0.60 0.10 21 D12 vs. D20:
0.343235 Day 20 0.55 0.07 14 Membrane Capacitance (pF) Day 8 27.9
2.8 18 D8 vs. D12: 0.774473: D8 vs. D20: 0.020507 Day 12 28.9 2.5
21 D21 vs. D20: 0.016909 Day 20 44.6 6.9 14
TABLE-US-00003 TABLE 3 Electrophysiological parameters recorded
from MEF-derived 5 factor (5F)-iN cells: Active membrane
properties. Spontaneous action potential firing and Induced Action
potentials (AP) No. of total spontaneous Induced recordings Day 8 1
14 17 Day 12 3 14 18 Day 20 2 12 7 (spontaneous), 12 (induced)
Average SEM n P value (student t test) AP height (mV) Day 8 84.5
4.5 6 D 8 vs. D 12: 0.5612; D 8 vs. D 20: 0.03558 Day 12 81.3 3.0
14 D 12 vs. D 20: 0.001843 Day 20 94.9 2.3 12 AP Threshold (mV) Day
8 -25.2 1.5 6 D 8 vs. D 12: 0.093417; D 8 vs. D 20: 0.031866 Day 12
-29.0 1.3 14 D 12 vs. D 20: 0.436939 Day 20 -30.5 1.4 12 Maximal
sodium current (nA) Day 8 700.2 257.2 5 D 8 vs. D 12: 0.534945; D 8
vs. D 20: 0.091192 Day 12 532.7 105.2 6 D 12 vs. D 20: 0.050369 Day
20 3615.0 1287.6 7 Note: AP height was measured from baseline. APs
were analyzed when first appeared during step depolarization. 7
cells at D 8 are not included due to different protocol used; 1
cell at 7 days has clear AP but with distorted shape and thus not
included. Note: AP threshold was measured from the beginning of the
upstroke of the action potential. Note: Maximal sodium current were
measured at voltage clamp mode using step depolarization
protocol.
TABLE-US-00004 TABLE 4 Electrophysiological parameters recorded
from TTF-derived 5 factor (5F)-iN cells: Passive and active
membrane properties on day 12. Average SEM n Resting membrane
potential (mV) -57.2 7.2 11 Membrane input resistance (G.OMEGA.)
0.3 0.0 11 Membrane Capacitance (pF) 26.1 1.4 11 AP Observed in 9
out of 11 cells, 2 of them fire repetitively
TABLE-US-00005 TABLE 5 Electrophysiological parameters recorded
from MEF-derived BAM-iN cells: Passive and active membrane
properties (co-cultured with glia). Average SEM n Membrane input
resistance (G.OMEGA.) 0.9 0.1 18 Membrane Capacitance (pF) 33.9 3.9
18 AP Not assayed due to use CsCl internal solutions.
TABLE-US-00006 TABLE 6 Electrophysiological parameters recorded
from TTF-derived BAM-iN cells: Passive and active membrane
properties (co-cultured with glia). Average SEM n Membrane input
resistance (G.OMEGA.) 0.5 0.1 12 Membrane Capacitance (pF) 35.4 5.3
12 AP Not assayed due to use CsCl internal solutions.
TABLE-US-00007 TABLE 7 Electrophysiological parameters recorded
from MEF-derived 5F-iN cells: Synaptic functions (co-cultured with
glia). No. of total Average SEM n recordings AMPA EPSCS 229.6 75.2
8 11 NMDA EPSCS 743.9 224.8 9 11 Spontaneous observed in 5 cells 11
PSCs IPSCs No obvious events observed, 11 recordings without
blockers. 4 with APV + CNQX Note: AMPA EPSCs were recorded at Vh of
-70 mV; NMDA EPSCs were reorded at +60 mV and measured at 50 ms
after stimulation. Spontaneous PSCs were recorded in the absence of
blockers.
TABLE-US-00008 TABLE 8 Electrophysiological parameters recorded
from MEF-derived 5F-iN cells: Synaptic integrations (co-cultured
with cortical neurons). No. of total Average SEM n recordings IPSC
Amplitude (pA) 1228.2 275.1 13 15 AMPA EPSC 94.7 21.5 9 9 Amplitude
(pA) NMDA EPSC 280.4 89.4 9 9 Amplitude (pA) Spontaneous PSCs
observed in 6 cells 6 Evoked PSCs compound PSCs observed 6 in 6
cells Spontaneous IPSCs observed in 13 cells 15 Spontaneous EPSCS
observed in 4 cells 9 Note: PSCs were recorded without blockers;
IPSC: in APV and CNQX; EPSC: in picrotoxin.
TABLE-US-00009 TABLE 9 Electrophysiological parameters recorded
from TTF-derived 5F-iN cells: Synaptic integrations (co-cultured
with cortical neurons). Spontaneous PSCs observed in 2 out of 3
cells recorded Evoked PSCs compound evoked PSCs observed in 2 out
of 3 cells Note: No blockers were added to these recordings.
TABLE-US-00010 TABLE 10 Electrophysiological parameters recorded
from MEF-derived BAM-iN cells: Synaptic function (co-cultured with
cortical glia). No. of total Average SEM n recordings AMPA EPSC
Amplitude (pA) 41.7 11.9 9 16 NMDA EPSC Amplitude (pA) 130 33.8 11
16 Spontaneous PSCs observed in 3 cells 16 IPSC Amplitude (pA) not
detected 16 Note: AMPA EPSCs were recorded at Vh of -70 mV; NMDA
EPSCs were recorded at +60 mV and measured at 50 ms after
stimulation.
TABLE-US-00011 TABLE 11 Electrophysiological parameters recorded
from TTF-derived BAM-iN cells: Synaptic function (co-cultured with
glia). No. of total Average SEM n recordings AMPA EPSC Amplitude
(pA) 82.8 27.3 5 12 NMDA EPSC Amplitude (pA) 208.7 75.0 6 12
Spontaneous PSCs observed in 3 cells 12 IPSC Amplitude (pA) not
detected 12 Note: AMPA EPSCs were recorded Vh of -70 mV; NMDA EPSCs
were recorded at +60 mV and measured at 50 ms after
stimulation.
TABLE-US-00012 TABLE 12 Electrophysiological parameters recorded
from MEFs infected with Ascl1, Brn2, Myt1l: Membrane properties on
Day 12. Average SEM n P value (student t test) Ascl1 -48.6 3.4 11 A
vs. AB: 0.729261; A vs. AM: 0.318123 A vs. 3F: 0.378688 Ascl1 +
Brn2 -47.3 1.8 12 AB vs. AM: 0.08692; AB vs. 3F: 0.125888 Ascl1 +
Myt1l -52.9 2.6 12 AM vs. 3F: 0.685015 BAM -52.4 2.6 13 Membrane
Input resistance (m.OMEGA.) Ascl1 0.95 0.14 11 A vs. AB: 0.192394;
A vs. AM: 0.074357; A vs. 3F: 0.951576 Ascl1 + Brn2 1.31 0.22 12 AB
vs. AM: 0.010736; AB vs. 3F: 0.144018 Ascl1 + Myt1l 0.64 0.09 12 AM
vs. 3F: 0.019898 BAM 0.96 0.09 13 Membrane Capacitance (pF) Ascl1
18.7 1.1 11 A vs. AB: 0.60362; A vs. AM: 0.243535; A vs. ABM:
0.01028 Ascl1 + Brn2 19.8 1.7 12 AB vs. AM: 0.534332; AB vs. ABM:
0.025714 Ascl1 + Myt1l 21.5 2.0 12 AM vs. ABM: 0.076441 BAM 28.1
2.9 13 Spontaneous AP filing and induced AP No. of total
spontaneous induced recordings Ascl1 0 9 11 Ascl1 + Brn2 0 12 12
Ascl1 + Myt1l 1 11 12 BAM 3 13 13
TABLE-US-00013 TABLE 13 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived 5F-iN cells on
Day 8. RMP: resting membrane potential; Rm: membrane input
resistance; Cm: membrane capacitance. Note that in some cases,
different internal solutions were used, which did not allow for the
measurement of RMP. RMP (mV) Rm (G.OMEGA.) Cm (pF) MEF-derived
5F-iN cells: Day 8 Cell 1 -38 2.80 29 Cell 2 -34 2.10 13 Cell 3 -34
0.46 23 Cell 4 -30 1.10 30 Cell 5 -20 Cell 6 -20 0.96 32 Cell 7 -20
1.50 28 Cell 8 -16 3.70 24 Cell 9 2.70 46 Cell 10 -45 0.41 39 Cell
11 -30 1.60 22 Cell 12 -50 0.65 17 Cell 13 -33 2.00 12 Cell 14 -45
0.74 31 Cell 15 -28 1.80 29 Cell 16 -16 0.85 25 Cell 17 -35 1.60 26
Cell 18 -40 0.49 47 Cell 19 -16 1.00 33 Note: Cell 1 Rs is 40 Mohm,
not included in the quantitations. Cell5 parameter not recorded
fully, also not included in the final analysis
TABLE-US-00014 TABLE 14 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived 5F-iN cells on
Day 12. Rmp: resting membrane potential; Rm: membrane input
resistance; Cm: membrane capacitance. Note that in some cases,
different internal solutions were used, which did not allow for the
measurement of RMP. MEF-derived 5F-iN cells: Day 12 Cell 1 -30 0.42
25 Cell 2 -57 0.45 42 Cell 3 -65 0.38 32 Cell 4 -60 0.74 53 Cell 5
-46 0.86 22 Cell 6 -35 0.89 27 Cell 7 -27 1.10 25 Cell 8 1.10 19
Cell 9 0.95 21 Cell 10 0.62 19 Cell 11 -49 0.59 22 Cell 12 -65 0.13
26 Cell 13 -45 0.49 34 Cell 14 -47 0.49 53 Cell 15 -45 0.56 37 Cell
16 -56 0.50 27 Cell 17 -43 0.62 32 Cell 18 -26 0.36 22 Cell 19 -50
0.82 18 Cell 20 -55 0.63 29 Cell 21 -57 0.74 21
TABLE-US-00015 TABLE 15 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived 5F-iN cells on
Day 20. Rmp: resting membrane potential; Rm: membrane input
resistance; Cm: membrane capacitance. Note that in some cases,
different internal solutions were used, which did not allow for the
measurement of RMP. RMP (mV) Rm (G.OMEGA.) Cm (pF) MEF-derived
5F-iN cells: Day 20 Cell 1 0.90 45 Cell 2 0.48 40 Cell 3 -49 0.71
17 Cell 4 -64 0.50 39 Cell 5 -60 0.25 103 Cell 6 -30 0.74 22 Cell 7
-47 0.19 66 Cell 8 -61 0.24 87 Cell 9 -57 0.32 45 Cell 10 -52 0.67
30 Cell 11 -68 0.90 28 Cell 12 -56 0.65 24 Cell 13 -52 0.96 20 Cell
14 -69 0.26 58
TABLE-US-00016 TABLE 16 Resting membrane potentials, membrane input
resistances and membrane capacities of TTF-derived 5F-iN cells on
Day 12. Rmp: resting membrane potential; Rm: membrane input
resistance; Cm: membrane capacitance. Note that in some cases,
different internal solutions were used, which did not allow for the
measurement of RMP. TTF-derived 5F-iNs cells: Day 12 Cell 1 -62
0.27 22 Cell 2 -69 0.24 32 Cell 3 -55 0.42 35 Cell 4 -40 0.00 20
Cell 5 -35 0.21 29 Cell 6 -70 0.39 23 Cell 7 -62 0.16 27 Cell 8 -48
0.14 21 Cell 9 -64 0.24 26 Cell 10 -64 0.49 27 Cell 11 -60 0.31
25
TABLE-US-00017 TABLE 17 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived Ascl1-iN cells
on Day 12. Rmp: resting membrane potential; Rm: membrane input
resistance; Cm: membrane capacitance. Note that in some cases,
different internal solutions were used, which did not allow for the
measurement of RMP. MEF-derived Ascl1-iN cells: Day 12 Cell 1 -50
0.70 21 Cell 2 -45 0.60 23 Cell 3 -55 0.56 15 Cell 4 -55 0.49 21
Cell 5 -43 1.20 23 Cell 6 -30 2.00 22 Cell 7 -60 0.45 17 Cell 8 -54
1.20 13 Cell 9 -67 1.20 18 Cell 10 -43 1.20 13 Cell 11 -33 0.86
19
TABLE-US-00018 TABLE 18 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived Ascl1 + Brn2-iN
cells on Day 12. Rmp: resting membrane potential; Rm: membrane
input resistance; Cm: membrane capacitance. Note that in some
cases, different internal solutions were used, which did not allow
for the measurement of RMP. RMP (mV) Rm (G.OMEGA.) Cm (pF)
MEF-derived Ascl1 + Brn2-iN cells: Day 12 Cell 1 -58 1.20 9 Cell 2
-35 3.30 17 Cell 3 -43 1.80 21 Cell 4 -48 0.42 15 Cell 5 -55 0.95
23 Cell 6 -40 0 43 23 Cell 7 -50 1.20 21 Cell 8 -48 1.60 12 Cell 9
-49 0.96 20 Cell 10 -49 0.90 32 Cell 11 -48 1.80 19 Cell 12 -45
1.20 25
TABLE-US-00019 TABLE 19 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived Ascl1 + Myt1l-iN
cells on Day 12. Rmp: resting membrane potential; Rm: membrane
input resistance; Cm: membrane capacitance. Note that in some
cases, different internal solutions were used, which did not allow
for the measurement of RMP. MEF-derived Ascl1 + Myt1l-iN cells: Day
12 Cell 1 -49 0.63 15 Cell 2 -59 0.47 21 Cell 3 -62 0.85 22 Cell 4
-57 0.34 21 Cell 5 -40 1.30 11 Cell 6 -65 0.73 24 Cell 7 -64 0.63
13 Cell 8 -64 0.34 30 Cell 9 -41 0.53 25 Cell 10 -43 0.55 21 Cell
11 -47 1.10 18 Cell 12 -54 0.23 35
TABLE-US-00020 TABLE 20 Resting membrane potentials, membrane input
resistances and membrane capacities of MEF-derived Ascl1 + Brn2 +
Myt1l-iN cells on Day 12. Rmp: resting membrane potential; Rm:
membrane input resistance; Cm: membrane capacitance. MEF-derived
Ascl1 + Brn2 + Myt1l-iN cells: Day 12 Cell 1 -42 1.10 18 Cell 2 -60
0.62 20 Cell 3 -52 0.36 46 Cell 4 -61 1.40 21 Cell 5 -64 1.20 32
Cell 6 -66 1.10 30 Cell 7 -57 0.73 49 Cell 8 -59 0.51 31 Cell 9 -50
1.10 19 Cell 10 -42 1.00 36 Cell 11 -45 1.00 16 Cell 12 -40 0.96 25
Cell 13 -43 1.40 21
[0202] Neuronal conversion is rapid and efficient. Next, we
assessed the kinetics and efficiency of 5F-induced neuronal
conversion. In MEFs, Tuj1-positive cells with immature neuron-like
morphology were found as early as three days after infection (FIG.
3a). After five days, neuronal cells with long, branching processes
were readily detected, and over time increasingly complex
morphologies were evident, suggesting an active process of
maturation in newly formed iN cells (FIG. 3a). Similarly, we
detected TauEGFP expression as early as day five (FIG. 8h) The
fraction of TauEGFP-positive cells remained similar at eight and
thirteen days post-infection, as determined by FACS analysis
suggesting no de-novo generation of iN cells after day 8 (FIG. 3b).
Electrophysiological parameters such as action potential height,
resting membrane potential, membrane input resistance, and membrane
capacitance also showed signs of maturation over time (FIG. 3c-g,
Tables 2-20).
[0203] To estimate the conversion efficiency, we first determined
how many of the MEF-derived iN cells divided after induction of the
viral transgenes by treating the cells with BrdU throughout the
duration of the culture period and beginning one day after gene
induction. The results showed that the vast majority of iN cells
became postmitotic by 24 hours after transgene activation (FIG.
3h-i). This allowed us to roughly estimate the conversion
efficiency of our method by quantifying the total number of
Tuj1-positive iN cells in the entire dish on day twelve, and
dividing this number by the number of plated cells (see methods).
Using this method, the efficiency ranged from 1.8-7.7% in MEF and
TTF-iN cells (FIG. 3j) presumably due to slight variations in
titers of the viruses. These calculations might be an
underestimation of the true conversion rate because not all cells
receive the necessary complement of viral transgenes.
[0204] iN cells form functional synaptic contacts. Since iN cells
exhibit the membrane properties of neurons, we next wanted to
assess whether iN cells have the capacity to form functional
synapses. To accomplish this we used two independent methods.
First, we determined whether iN cells were capable of synaptically
integrating into preexisting neural networks. We employed FACS to
purify TauEGFP-positive iN cells seven days after infection and
re-plated the 5F-iN cells onto neonatal cortical neurons that had
been cultured for seven days in vitro. One week after re-plating,
we performed patch-clamp recordings from TauEGFP-positive iN cells
and observed spontaneous and rhythmic network activity typical of
cortical neurons in culture (FIG. 4a-b). Both excitatory and
inhibitory postsynaptic currents (EPSCs and IPSCs) could be evoked
following electrical stimulation delivered from a concentric
electrode placed 100-150 .mu.m away from the patched iN cells,
(FIG. 4b-d). In the presence of the AMPA and NMDA receptor channel
blockers CNQX and D-APV, spontaneous IPSCs were reliably detected
(FIG. 4c, upper panel). Evoked IPSCs could be blocked by further
addition of picrotoxin (FIG. 4c, middle panel). Similarly, at a
holding potential of -70 mV and in the presence of picrotoxin,
fast-decaying EPSCs mediated by AMPA-receptors could be evoced
(FIG. 4d, middle panel). Conversely, at a holding potential of +60
mV (which relieves the voltage-dependent blockade of Mg2+ to
NMDA-receptors), slow-decaying NMDA-receptor mediated EPSCs could
be recorded (FIG. 4d, middle panel).
[0205] Moreover, synaptic responses recorded from iN cells showed
signs of short-term synaptic plasticity, such as depression of
IPSCs and facilitation of EPSCs during a high frequency stimulus
train (FIG. 4c-d, lower panels). The presence of synaptic contacts
between iN cells and cortical neurons was independently
corroborated by the immunocytochemical detection of
synapsin-positive puncta surrounding MAP2-positive dendrites
originating from EGFP-positive cells (FIG. 4e-f). We were also able
to observe synaptic responses in similar experiments performed with
iN cells derived from TTFs, (FIG. 9). These data demonstrate that
iN cells can form functional postsynaptic compartments and receive
synaptic inputs from cortical neurons.
[0206] Next we asked whether iN cells were capable of forming
synapses with each other.
[0207] To address this question we plated FACS-sorted
TauEGFP-positive, MEF-derived 5F-iN cells eight days after
infection onto a monolayer culture of primary astrocytes, which are
thought to play an essential role in synaptogenesis
(Christopherson, K. S. et al. (2005) Cell 120, 421-33; Wu, H. et
al. (2007) Proc Natl Acad Sci USA 104, 13821-6). Importantly, we
confirmed that these cultures were free of preexisting Tuj1 or
MAP2-positive neurons. Patch clamp recordings at 12-17 days after
sorting indicated the presence of spontaneous post synaptic
currents in (5/11 cells) (FIG. 4g). Upon extracellular stimulation,
evoked EPSCs could be elicited in a majority of the cells (9/11
cells, FIG. 4h). Similar to iN cells cultured with primary cortical
neurons, we were able to record both NMDA receptor mediated (9/11
cells) and AMPA receptor-mediated EPSCs (8/11 cells; FIG. 4h-i).
Interestingly, we were unable to detect obvious IPSCs in a total of
fifteen recorded 5F-iN cells. These data indicate that iN cells are
capable of forming functional synapses with each other, and that
the majority of iN cells exhibit an excitatory phenotype.
[0208] Optimal factor combination for neuronal conversion. As
stated earlier, Ascl1 was the only gene from the 5F pool that was
sufficient to induce neuron-like cells in MEFs. We next attempted
to determine the relative contribution of each of the five genes by
removing each gene from the pool and assessing the efficiency of iN
cell generation. Surprisingly, only the omission of Ascl1 had a
dramatic effect on induction efficiency (FIG. 11a). Thus, we tested
the effects of removing two genes at a time by evaluating all
possible three gene combinations. Our results indicated that either
Ascl1 or both Brn2 and Myt1l must be present in order to generate
iN cells (FIG. 5a). The most efficient conversions were achieved
when Ascl1 and Brn2 were combined with either Myt1l (BAM pool) or
Zic1 (BAZ pool). The efficiencies in these conditions were two to
threefold higher than the 5F pool when the total amount of virus
was kept constant (FIG. 5a-d). In this experiment the BAM-iN cells
appeared to have a more complex morphology than the BAZ cells (FIG.
5c-d, FIG. 12). Therefore, we focused our further analysis on the
BAM pool.
[0209] MEF-derived BAM-iN cells expressed the pan-neuronal markers
MAP2 and synapsin (FIG. 5f). The BAM-pool was capable of
efficiently generating iN cells from perinatal tail tip fibroblasts
(FIG. 5e, FIG. 13a-e). After infecting tail tip fibroblasts from
adult mice with these three factors, we could detect neuronal cells
expressing TauEGFP, Tuj1, NeuN and MAP2 (FIG. 14). Importantly,
when co-cultured with astrocytes, both MEF and perinatal tail-tip
fibroblast-derived BAM-iN cells were capable of forming functional
synapses as determined by the presence of both NMDA- and
AMPA-receptor mediated EPSCs (FIG. 5g-h). Similar to 5F-iN cells,
no IPSCs were detected in MEF-derived (n=16) or tail-derived (n=12)
BAM-iN cells. This functional evidence suggests that a majority of
BAM-iN cells are excitatory. Indeed, 53% (111/211 cells) of MEF
BAM-iN cells expressed Tbr1, a marker of excitatory cortical
neurons, whereas less than 1% (3/.about.500 cells) were
GAD-positive (FIG. 13f).
[0210] Our results left open the possibility that one or two
factors might be able to induce functional neuronal properties in
MEFs. Thus, we tested smaller subsets of the BAM pool to determine
their functionality. In many Ascl1-induced cells, current injection
elicited action potentials, but their properties appeared to be
immature, consistent with their simple neurite morphology (FIG. 5i,
FIG. 7b). MEFs infected with Ascl1 and Brn2 or Myt1l generated more
mature action potentials and displayed more complex neuronal
morphologies. In contrast, the majority of BAM-iN cells exhibited
repetitive action potentials with more mature characteristics, and
displayed the most complex neuronal morphologies. Thus, it appears
likely that Ascl1 alone is sufficient to induce some neuronal
traits, such as expression of functional voltage-dependent channel
proteins that are necessary for the generation of APs, but that
co-infection of additional factors will facilitate neuronal
conversion and maturation.
Discussion
[0211] Here we show that expression of three transcription factors
can rapidly and efficiently convert mouse fibroblasts into
functional neurons (iN cells). While the single factor Ascl1 was
sufficient to induce immature neuronal features, the additional
expression of Brn2 and Myt1l generated mature iN cells with
efficiencies of up to 19.5% (FIG. 11b). Three factor iN cells
displayed functional neuronal properties such as the generation of
trains of action potentials and synapse formation. These
transcription factors were identified from a total of nineteen
candidates that we selected because of their specific expression in
neural cell types or their roles in reprogramming to pluripotency
(see methods)
[0212] Despite the heterogeneity of embryonic and tail-tip
fibroblast cultures, the highly efficient nature of this process
effectively rules out the possibility that directed differentiation
of rare stem or precursor cells with neurogenic potential can
explain our observations.
[0213] High expression levels of strong neural cell-fate
determining transcription factors can activate salient features of
the neuronal transcriptional program. Auto-regulatory feed-back and
feed-forward activation of downstream transcriptional regulators
may then reinforce the expression of important cell fate
determining genes and help to further stabilize the induced
transcriptional program. Robust changes in transcriptional activity
could also lead to genome-wide adjustments of repressive and active
epigenetic features such as DNA methylation, histone modifications,
and changes of chromatin remodeling complexes that further
stabilize the new transcriptional network (Zhou, Q. & Melton,
D. A. (2008) Cell Stem Cell 3, 382-8; Jaenisch, R. & Young, R.
(2008) Cell 132, 567-82). It is possible that certain
subpopulations of cells are "primed" to respond to these factors,
depending on their pre-existing transcriptional or epigenetic
states (Yamanaka, S. (2009) Nature 460, 49-52).
[0214] iN cells represent an alternative to generate
patient-specific neurons. The generation of iN cells is fast,
efficient, and devoid of pluripotent stem cells. Therefore, iN
cells provide a novel and powerful reagent for studying cellular
identity and plasticity, modeling neurological disease, discovering
novel drugs, and developing novel regenerative medicine-based
therapies.
Example 2
Induced Oligodendrocyte Production
[0215] 10 candidate genes were screened for oligodendrocytes
induction: Ascl1; Nkx6-1 Myt1; Zfp536; Nkx2-2; Olig2; Olig1; Sox10;
Nkx6-2; MRF. EGFP was induced as an aid to visualization. All ten
transcription factors, all of which are known to play a role in
oligodendrocyte specification or differentiation, were screened in
wild-type mouse embryonic fibroblasts (MEFs). Strikingly, when all
ten genes were combined, we observed cells with characteristic
oligodendrocyte morphology after 12 days of transgene expression.
These cells also expressed the oligodendrocyte specific surface
marker O4, which marks terminally differentiating OPCs and. In
parallel, we examined the effect of removing groups of genes from
this initial pool of ten, and we were able to derive
oligodendrocytes from some pools of six genes. These data indicate
that combination(s) of the ten transcription factors can induce
oligodendrocyte-like cells from embryonic fibroblast cultures.
Example 3
Neural Progenitor Cell Induction
[0216] Six factors were tested for induction of neural progenitor
cells: Sox2, Lhx2, FoxG1, Id4, Rfx4, and Zic1. Colonies form after
infection with a combination of the 6 NSC reprogramming factors
showing a morphology similar to a neurosphere, as it would appear
after expansion of brain-derived neural stem cells. A large
fraction of the cells in that colony express endogenous Sox2 as
judged from EGFP fluorescence originating from the Sox2:EGFP allele
knocked into the Sox2 locus. About 3 weeks after infection with the
NSCR factors a large number of neural stem cell marker genes are
induced.
Example 4
Induction of Neural Cells from Hepatocytes
[0217] Hepatocytes are the principal cell type in the liver
accounting for .about.70% of the mass of the adult organ.
Expression profiling suggests that hepatocytes are a relatively
homogeneous cell population despite functional differences
depending on histoanatomical location. First, we evaluated whether
iN cells can be derived from primary liver cells. To that end, we
established cell cultures of livers from postnatal days 2-5
wild-type mice and TauEGFP knock-in mice which express EGFP under
the control of a promoter specific for neurons. Four days after
isolation the hepatic cultures showed a typical epithelial
morphology and expressed hepatocyte markers such as albumin,
.alpha.-fetoprotein and -anti-trypsin. One week post explant a
typical culture was composed of 50-70% albumin-positive
hepatocytes, 16% myeloid cells (MAC-1 positive), 2% Kupffer cells
(F4/80 positive) and 2% endothelial cells (platelet/endothelial
cell adhesion molecule 1 PECAM1-positive). The remaining cells that
eluded our characterization presumably represent immature
hepatocytes, bile duct cells, various epithelial progenitor cells,
more immature hematopoietic cells, pericytes and liver fibroblasts.
Absence of neuronal or neural progenitor cell markers such as Sox2,
Brn2, MAP2, and NeuN in the culture was confirmed by
immunofluorescence. The rare (.ltoreq.1/5000) Tuj1-positive cells
were always characterized by round and flat morphology. EGFP signal
from TauEGFP reporter was not detectable at any time in the culture
by flow cytometry and fluorescence microscopy.
[0218] After one passage, the hepatocyte cultures were infected
with doxycycline (dox)-inducible lentiviruses containing the cDNAs
of Ascl1 (A), Brn2 (B) and Myt1l (M) in all possible combinations
(A, B, M, AB, AM, BM and BAM). To induce the transgenes, dox was
added to the media one day after infection. Hepatocyte culture
media was changed to a basic neuronal media (N3) in the presence of
dox after another two days. Thirteen days after dox induction,
TauEGFPpositive cells with a complex neuronal morphology were
readily detected in the wells that received all three factors
(BAM); all other factor combinations produced practically no
neuronal cells. Thus, in contrast to fibroblasts, liver cells
require all three factors to induce neuronal morphologies.
Immunofluorescence confirmed that all TauEGFP-positive cells
generated by the BAM factors were also Tuj1-positive, i.e.
expressed neuronal microtubules.
[0219] Three weeks after dox induction, the cells expressed the
additional pan-neuronal markers PSA-NCAM, NeuN, MAP2, and synapsin,
similar to our previously reported fibroblast iN cells. A fraction
(35/200 Tuj1-positive cells) of the cells also expressed vesicular
glutamate transporter 1 (vGLUT1). In contrast, no GAD67-positive
cells were detected (0/200 Tuj1-positive cells). To further
characterize liver-derived iN cells we purified TauEGFP-positive iN
cells from liver preparations by fluorescence activated cell
sorting (FACS) 21 days after dox induction. We then extracted total
RNA from both sorted cells and uninfected liver cultures and
performed quantitative PCR expression analysis. In TauEGFP-positive
population all transcripts characterizing the starting cell
population (albumin, MAC-1, F4/80 and PECAM-1) were significantly
down regulated, whereas neuronal transcripts such as Tuj1,
synapsin, vGLUT1 were up regulated. No GAD67 transcripts were
detectable in EGFP-sorted cells. This indicates that--similar to
fibroblasts iN cells--the majority of mature liver-derived iN cells
are excitatory and only few if any are inhibitory.
[0220] To unambiguously identify hepatocytes from primary liver
cultures we employed a Cre-LoxP lineage tracing system. We used
transgenic mice expressing Cre recombinase under the control of the
albumin promoter and enhancer (Albumin-Cre). Importantly, this
allele has been characterized extensively and shown to be specific
to hepatocytes in both fetal and adult mice. Albumin-Cre mice were
crossed with ROSA26-mTmG reporter mice which express membranous
tdTomato before and membranous EGFP after Cre-mediated
recombination. In double transgenic mice, hepatocytes are
permanently labeled with EGFP whereas the non-hepatocytes express
tdTomato. As expected, the EGFP fluorescence was confined to
epithelial cells in freshly isolated liver cultures from these mice
and cultures were composed of .about.80% EGFP-positive and
.about.20% tdTomato-positive cells. However, this ratio declined to
60% EGFP-/40% tdTomato-positive cells after one week in culture,
implying that hepatocytes were lost and/or other cells outgrew the
hepatocytes.
[0221] Next, we derived liver-iN cells from these cultures by
infecting them with the three
[0222] BAM factors as described above. Thirteen days after dox
induction we detected both red and green fluorescent cells with
neuronal morphologies. Subsequent analysis showed that
EGFP-positive cells with complex morphology also expressed the
neuronal markers Tuj1 and PSA-NCAM. Similar results were obtained
using an independent reporter allele (ROSA26-Bgeo) where expression
of .beta.-galactosidase is induced after Cre-mediated
recombination. Fourteen days after infection Xgal staining
identified numerous three-dimensional cells with long complex
processes. These experiments demonstrate that iN cells can be
derived from terminally differentiated hepatocytes.
[0223] To gain insight into the process of hepatocyte-derived
(Hep)-iN cell generation, we evaluated the cell division frequency
after induction of the BAM transgenes in liver cultures by a
5-bromodeoxyuridine (BrdU) incorporation assay. When BrdU was
present from the day of infection (i.e. one day before dox)
throughout the time of iN generation, 12% of the Tuj1-positive
cells at day 13 incorporated BrdU. However, when BrdU treatment was
begun on the day of transgene induction (dox addition) only 1% of
the Tuj1-positive cells were BrdU-positive suggesting that the vast
majority of hepatocytes generated iN cells without undergoing cell
division.
[0224] Next, we wanted to address the reprogramming kinetics from
hepatocytes to iN cells.
[0225] Toward this end, we generated transgenic mice containing the
TauEGFP allele together with Albumin-Cre and a ROSA26-tdTomato
reporter. In this lineage tracing system albumin-positive
hepatocytes and their progeny constitutively express tdTomato. We
established primary hepatocyte cultures from these mice and as
expected thirteen days after transduction with the BAM factors we
were able to identify Tau-EGFP/tdTomato-double positive cells with
neuronal morphology. The TauEGFP fluorescence allowed us to monitor
neuronal gene induction in live cells during the conversion
process. Cultures were analyzed by flow cytometry at days 1, 3, 7
and 13 after dox. Simultaneously, MEFs and tail tip fibroblasts
(TTFs) derived from TauEGFP mice were infected as control. The
EGFP-positive fraction was determined in tdTomato-positive and
tdTomato-negative subpopulations. Surprisingly, as early as one day
after transgene induction, a small but distinct fraction of
hepatocytes expressed TauEGFP already. The frequency of
EGFP-positive cells steadily increased over time with similar
kinetic for hepatocytes and fibroblasts.
[0226] Given that the fraction of EGFP-positive cells is strongly
influenced by survival and proliferation of non-converted cells in
the neural media we estimated the actual conversion efficiency by
determining the total number of TauEGFP-positive cells in the wells
at the various time points. This value was then expressed as
percentage of the total number of hepatocytes present at day 0 of
infection. This ratio should represent a good approximation of the
conversion efficiency as we had previously determined that over 99%
of hepatocytes converting to iN cells do not proliferate. Taking
into account that the infection rate was .gtoreq.98% in MEFs, TTFs
and non-hepatocyte liver cells but only 30% in hepatocytes the
efficiencies of converting hepatocytes were similar to the
postnatal fibroblasts (ca. 6% after two weeks) but lower than
embryonic fibroblasts (ca. 20% after two weeks).
[0227] We finally asked whether Hep-iN cells possess functional
neuronal properties. To this end, we performed patch-clamp
recordings on both Albumin-Cre/ROSA26-mTmG and
Albumin-Cre/ROSA26-tdTomato/TauEGFP Hep-iN cells 21 days after dox
induction. Hep-iN cells were identified as EGFP-positive cells in
the first case and as tdTomato positive cells in the second. The
average resting membrane potential of the Hep-iN cells was
-55.8.+-.2.1 mV (n=10). Moreover, spontaneous action potential
firing was detected in the cells (n=10). Also, all analyzed Hep-iN
cells showed action potentials when depolarized by current
injections.
[0228] When whole-cell currents were recorded, fast inactivation
sodium current and outward potassium currents could be revealed.
These results show that Hep-iN possess the membrane properties
typical of primary neurons.
[0229] In summary, we show that albumin-expressing hepatocytes can
be converted into functional iN cells by the three factors Ascl1,
Brn2 and Myt1l. Remarkably, the same three iN cell factors can
induce neuronal cells from completely different donor cell types,
as it has also been observed for iPS cell reprogramming. The
neuronal conversion efficiencies and dynamics of hepatocytes were
surprisingly similar to postnatal fibroblasts suggesting that the
age of donor cells may have a bigger impact on reprogramming
kinetics than the cell of origin. However, hepatocytes differ from
fibroblasts in that combinations of fewer factors have only little
effect on induction of neuronal traits. Our findings show that iN
cells generation is not limited to fibroblasts and can be extended
to a defined endoderm-derived cell type. This shows that
potentially any cell type that can be cultured in vitro may be able
to be converted into iN cells using the same factors.
Materials and Methods
[0230] Hepatocyte culture. Disaggregated mouse liver cells were
isolated by an adaptation of the two step collagenase perfusion
technique. Liver was extirpated 2 to 5 days after birth, incised,
washed with Kreb's Ringer Buffer 0.1 mM EDTA, minced and digested
in Kreb's Ringer Buffer 0.15 mM CalCl.sub.2, 0.54 mg/ml of
collagenase type I (Sigma C0130) 40 min at 37.degree. C. After two
wash in Kreb's Ringer Buffer primary hepatocytes were centrifuged
at 100 g 3 mins and plated on Collagen coated plates in hepatocytes
plating media consisting of DMEM (Invitrogen) supplemented with
bovine serum albumin (2.0 g/l), glucose (2.0 g/l), galactose (2.0
g/l), ornithine (0.1 g/l), proline (0.030 g/l), nicotinamide (0.610
g/l), Zncl2 (0.025 mg/l), ZnSO4:7H2O (0.750 mg/l), CuSO4:5H2O (0.20
mg/l), MnSO4 (0.025 mg/l), glutamine (5.0 mM), insulin (5.0 mg/l),
human transferring (5.0 mg/l), selenium (5.0 .mu.g/l),
dexamethasone (10-7 M), penicillin (100 mg/l), streptomycin (100
mg/l), and 10% calf serum. After 4 hrs media was changed with
hepatocyte culturing media, consisting of hepatocytes plating media
0% calf serum, HGF (40 ng/ml) and EGF (20 ng/ml).
[0231] Lentivirus preparation and infection. TetO-FUW-based
lentiviruses were prepared as previously described with some
modification for hepatocytes. Briefly, 293T/17 cells were seeded at
5.times.10.sup.6 per 100 mm plate in DMEM containing 10% Calf
Serum. On the next day, 10 .mu.g of lentiviral vectors together
with 5 .mu.g of PMDL, 2.5 .mu.g of VSVg and 2.5 .mu.g of RSV were
introduced into 293T/17 cells using calcium-phosphate
precipitation. After 16 hour, the medium was replaced with 4 ml. On
the next day, virus-containing supernatant was recovered, filtered
through 0.45 .mu.m cellulose acetate filter (Whatman), and spun at
16500 rpm for 1 h at 4 C. Pellet was resuspended in hepatocyte
culturing media in a volume 100 times smaller than the starting
supernatant and stored at -80 C. Three to five days after
establishing the primary culture cells were detached by trypsin and
seeded on collagen-coated plates at the density of 50 k
cells/cm.sup.2 in hepatocyte plating media. One day after medium
was changed to the hepatocyte culturing media containing 100
.mu.l/ml of concentrate lentivirus supplemented with polybrene at
the final concentration of 8 .mu.g/ml. Doxycycline (2 mg/ml) was
added 16 hrs later and media was switched to N3 48 hours later.
[0232] Immunofluorescence, RT-PCR, and flow cytometry. Neuronal
cells were defined as cells that stained positive for Tuj1 and had
a process at least three times longer than the cell body. For
immunofluorescence staining, cells were washed with PBS and then
fixed with 4% paraformaldehyde for 10 min at room temperature.
Cells were then incubated in 0.2% Triton X-100 (Sigma) in PBS for 5
min at room temperature. After washing twice with PBS, cells were
blocked in a solution of PBS containing 4% BSA, 1% FBS for 30 min
at room temperature.
[0233] Primary and secondary antibodies were diluted in a solution
of PBS containing 4%
[0234] BSA and 1% FBS. Fields of cells for staining were outlined
with a PAP pen (DAKO). Primary and secondary antibodies were
typically applied for 1 h and 30 min, respectively. Cells were
washed three times with PBS between primary and secondary staining.
For anti-BrdU staining, cells were treated with 2 N HCl in PBS for
10 min and washed twice with PBS before permeabilization with
Triton X-100 (Sigma). The following antibodies were used for our
analysis: goat anti-albumin (Bethyl, 1:200), rat anti PECAM-1
(Becton Dickinson, 1:400) mouse anti-MAP2 (Sigma, 1:500), mouse
anti-NeuN (Millipore, 1:100), rabbit anti-Tuj1 (Covance, 1:1,000),
mouse anti-Tuj1 (Covance, 1:1,000), mouse anti-BrdU (Becton
Dickinson, 1:50), E028 rabbit anti-synapsin (gift from T. Sudhof,
1:500), guinea-pig anti-vGLUT1 (Millipore, 1:2,000), anti-mouse
PSA-NCAM (DSHB, 1:20). FITC- and Cy3-conjugated secondary
antibodies were obtained from Jackson Immunoresearch. Alexa-488,
Alexa-555,and Alexa-350 conjugated secondary antibodies were
obtained from Invitrogen.
[0235] TauEGFP-expressing cells were analysed and sorted on a FACS
Aria II and flow cytometry data were analysed using FACSDiva
Software (Becton Dickinson). The following antibodies were used for
flow cytometry staining of the liver cells: APC conjugated rat anti
MAC-1 (eBioscience) at 1:400 dilution, FITC conjugated mouse
anti-F4/80 (ebioscience) at 1:100 diluition.
[0236] RNA isolation, reverse transcription and quantitative
real-time PCR analysis. Total RNA was isolated using the Qiagen
RNAeasy kit according to the manufacturer's instruction (Qiagen).
Concentration and purity of the RNA was determined by OD260/280
reading. Two hundred nanograms of total RNA were reverse
transcribed using SuperScript.RTM. First-Strand Synthesis System
(Invitrogen). Resulting cDNA was diluted 1:10 and real-time
polymerase chain reaction (PCR) was performed using the 7900HT
Real-Time PCR System (Applied Biosystems).
[0237] Amplification reactions were carried out in a 10 .mu.L
volume using SYBR Green I dye and the following amplification
conditions: 50.degree. C. for 2 minutes and 95.degree. C. for 10
minutes (95.degree. C., 15 seconds; 60.degree. C., 1 minute) for 40
cycles. Primers used are reported in Table S1. The mRNA/cDNA
abundance of each gene was calculated relative to the expression of
a housekeeping gene, GAPDH
(glyceraldehyde-3-phosphate-dehydrogenase).
[0238] X-gal staining. Cells were washed with PBS and fixed in the
plate with 1% glutaraldehyde for 5 minutes. Plates were stained
with a solution containing 0.04% of X-gal/DMSO, 1 mM of MgCl2, 3 mM
of K4[Fe(CN)6], and 3 mM of K3[Fe(CN)6] in PBS at 37.degree. C. for
12 hours.
[0239] Electrophysiology. Cells were analyzed at indicated time
points after dox induction.
[0240] Action potentials were recorded with current-clamp
whole-cell configuration. The pipette solution for current-clamp
experiments contained (in mM) 123 K-gluconate, 10 KCl, 1 MgCl2, 10
HEPES, 1 EGTA, 0.1 CaCl2, 1 K2ATP, 0.2 Na4GTP and 4 glucose, pH
adjusted to 7.2 with KOH. Membrane potentials were kept around -65
to -70 mV, and step currents were injected to elicit action
potentials. For voltage-clamp experiments, the internal solution
contained (in mM) CsCl 135, HEPES 10, EGTA 1, Mg-ATP 4, Na4GTP 0.4,
and QX-314 10, pH7.4. The bath solution contained (in mM): NaCl
140, KCl 5, CaCl2 2, MgCl2 2, HEPES 10, and glucose 10, pH7.4.
Whole-cell currents including Na+ and K+ currents were recorded at
a holding potential of -70 mV, voltage steps ranging from -80 mV to
+90 mV were delivered at 10 mV increments.
[0241] Mice. We first crossed heterozygous Albumin-Cre knock-in
mice with homozygous mTmG mice
(Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J.) (Jackson Laboratory)
or with ROSA26-Bgeo heterozygous mice. Secondly we crossed
homozygous TauEGFP knock-in mice (Jackson Laboratory) with
ROSA26-tdTomato homozygous mice
(B6;12956-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J) (Jackson
Laboratory). Obtained ROSA26-tdTomato/TauEGFP heterozygous mice
were then crossed with Albumin-Cre knock-in mice.
Example 5
Induction of Neuronal Cells from Human Fibroblasts
[0242] Cell lineage fates are considered stable once determined
during embryonic development. However, experimental manipulations
such as somatic cell nuclear transfer, cell fusion, or expression
of lineage-specific factors can induce cell fate changes in diverse
somatic cell types. As shown above, forced expression of a
combination of three transcription factors, Brn2 (also known as
Pou3f2), Ascl1, and Myt1l can rapidly and efficiently convert
fibroblasts into functional neuron-like cells termed induced
neuronal (iN) cells. It is shown herein that the same three factors
can induce functional neurons from human pluripotent stem cells in
a surprisingly rapid and efficient manner. Neuronal cells with
functional properties were observed as early as 6 days after gene
transduction, which is a substantial acceleration over current
differentiation strategies. When combined with the basic
helix-loop-helix transcription factor NeuroD1, the three factors
could also convert primary human fetal fibroblasts into functional
iN cells. Importantly, fibroblast-derived iN cells were able to
generate repetitive action potentials and to form synaptic contacts
with primary cortical neurons 4 to 5 weeks after transduction.
These data demonstrate that human non-neural somatic cells as well
as pluripotent stem cells can be directly converted into functional
neurons by lineage-determining transcription factors, allowing
robust generation of human neurons for in vitro studies and
applications in regenerative medicine.
[0243] Here, we show that (i) iN cell reprogramming factors greatly
enhance and accelerate the induction of functional neurons from
human ES cells and (ii) that iN cells can be derived from primary
human fetal fibroblasts.
[0244] We infected undifferentiated human ES cells (H9 line 33)
with the three iN cell factors Brn2, Ascl1, and Myt1l (BAM) encoded
in doxycycline (dox)-inducible lentiviral vectors in
chemically-defined N3 media 34 together with an EGFP virus to help
visualize the cells. One day after infection, we activated the
transgenes by the addition of dox. After 24 h, the majority of ES
cells were EGFP positive. To inhibit the growth of uninfected ES
cells, we added 4 .mu.M Cytosine .beta.-D-arabinofuranoside (Ara-C)
to the media 48 h after dox. Over the course of the following days
the cells underwent dramatic morphological changes. Surprisingly,
as early as three days after dox treatment, we observed bi- and
multipolar neuron-like cells surrounding nearly all ES cell
colonies (FIG. 15a). By day 8, cells with more mature neuronal
morphologies that expressed .beta.-III-tubulin (Tuj1) and MAP2 were
present throughout the plate (FIG. 15b,c). Thus, forced expression
of the BAM factors had induced neuronal differentiation from human
ES cells in an unexpectedly rapid manner. In contrast, after
infection with EGFP virus alone, no neuronal cells were generated
during the same timeframe, as the majority of the ES cells had died
due to Ara-C treatment.
[0245] We then performed electrophysiological recordings to
evaluate the functional properties of these neuronal cells. We
dissociated BAM-ES cultures 3-4 days after dox, and replated them
onto a monolayer culture of primary mouse glia. After another 3-4
days (i.e. as early as 6 days after induction), neuronal cells
already exhibited passive and active membrane properties resembling
immature neurons. Some cells fired series of action potentials
spontaneously (FIG. 15d). Upon current injection, the cells
generated single or repetitive action potentials (FIG. 15e). At day
15 after induction, the average membrane potential of neuronal
cells was -51 mV and the membrane capacitance was .about.16 pF
(FIG. 15f,. Moreover, prominent after-hyperpolarization potentials
(AHPs) were observed in these cells (FIG. 15d and f). Thus, the BAM
factors rapidly induced cells with morphological, biochemical and
functional properties of neurons from human ES cells which we
termed ES-iN cells to distinguish them from ES cell-derived neurons
generated using conventional differentiation protocols.
[0246] Finally, we determined whether fewer of the three factors
were sufficient to induce neurons in similar efficiencies and
infected human ES cells with the single factors and all the
two-factor combinations. Eight days after gene induction, ES cells
were fixed and stained for MAP2. We found that Ascl1 was sufficient
to induce pan-neuronal markers but the addition of Brn2 or Myt1l
generated more complex morphologies, however the BAM pool remained
the most effective condition, consistent with our observations in
mouse.
[0247] We then sought to explore whether transcription
factor-mediated neuronal induction can also be applied to human
somatic cells. We obtained the human fetal lung fibroblast cell
line IMR90 and also derived primary human fetal fibroblasts (HFFs)
from the distal portion of a lower extremity of a gestation week 9
fetus. We confirmed that the primary cultures did not contain cells
with neural character by screening for a panel of neuronal, glial
and neural precursor cell markers (see Methods). Seven to 10 days
after infection with the BAM factors and EGFP, cells exhibiting
neuronal morphologies were readily detectable, and
immunofluoresence analysis performed 21 days after infection
indicated the expression of the pan-neuronal marker Tuj1. However,
the induction of neuronal cells appeared inefficient, and most
cells exhibited immature morphologies. Electrophysiological
recordings showed that in these fibroblast-BAM-iN cells only action
potential-like responses could be elicited by depolarization but no
mature action potentials. In contrast, cells infected with the EGFP
virus alone did not induce any neuron-like morphologies up to 3
weeks post infection. Thus, the BAM factors induced some neuronal
features but appeared to be insufficient to generate fully
functional neurons from human fetal fibroblasts. This suggests that
other factor combinations may be required for the conversion of
human fibroblasts into neurons.
[0248] We therefore screened additional factors in combination with
the BAM pool, and determined the frequency of Tuj1-positive cells
displaying a neuronal morphology. Strikingly, NeuroD1, another
basic helix-loop-helix factor, improved the efficiency of
generating Tuj1-positive neuronal cells by more than two-fold when
analyzed 21 days after infection (FIG. 16a). The LIM homeodomain
transcription factor Lhx2 also slightly improved the efficiency.
Independent experiments confirmed the beneficial effect of NeuroD1,
but the effect of Lhx2 remained marginal (data not shown). The
BAM+NeuroD1 (BAMN) iN cells exhibited neuronal morphologies 2 weeks
after infection and expressed various pan-neuronal markers such as
Tuj1, MAP2, PSA-NCAM, and NeuN (FIG. 16b-f). However, the vast
majority of cells were negative for synapsin, a marker of more
mature neurons. When cultured in the presence of primary astrocytes
and in media conditions facilitating synapse formation, a few cells
began to express synapsin 4 weeks after infection (FIGS. 16g and
h).
[0249] We next asked if these BAMN HFF-iN cells exhibit functional
properties similar to human neurons. Neuronal cells were identified
by morphology using EGFP fluorescence and differential interference
contrast microscopy (FIG. 17a). Whole-cell recordings were
performed 14 to 35 days after infection. The average resting
membrane potential of these neuronal like cells was .about.-52 mV
(n=41) at 2 to 4 weeks after induction. Strikingly, when cells were
step depolarized, they fired repetitive action potentials (FIG.
17b). In some cases, spontaneous action potentials were also
observed (FIG. 17c). We then examined the whole-cell currents in
voltage-clamp mode and recorded fast-activating and inactivating
Na+ currents as well as outward currents, representing Na+- and K+
currents, respectively (FIG. 17d-f). These data indicate that the
BAMN pool can convert primary human fibroblast cultures into cells
with active membrane properties similar to neurons.
[0250] Next we asked whether BAMN-iN cells expressed functional
neurotransmitter receptors a key prerequisite for synaptic
transmission. Application of either GABA or L-glutamate through a
pipette using picospritzer induced current responses which could be
blocked by the channel inhibitors picrotoxin and CNQX, respectively
(FIGS. 17g and h). We then explored if these HFF-iN cells could
form functional synapses and integrate into pre-existing neuronal
networks. To that end, we dissociated the fibroblasts four days
after infection with the BAMN factors and EGFP and plated them onto
previously established primary mouse cortical cultures in
conditions that promote synapse formation (see Methods). These
co-cultures were maintained up to 5 weeks. Human iN cells could be
readily distinguished from mouse neurons by virtue of their EGFP
expression (FIG. 18a). Immunostaining with synapsin antibodies
showed scattered synaptic puncta on the neurites of EGFP-positive
cells (FIGS. 18b). At 4 to 5 weeks of co-culture, whole cell
recordings demonstrated that human iN cells exhibited spontaneous
postsynaptic currents (PSCs) with variable kinetics (FIG. 18c).
When the GABAA receptor inhibitor picrotoxin was added to the
culture, the majority of PSCs were blocked demonstrating that the
majority of postsynaptic events were inhibitory (IPSCs) (FIG. 18d).
The picrotoxin-resistant PSCs were abolished by further addition of
the AMPA receptor blocker CNQX, verifying that these bursting PSCs
were excitatory (EPSCs) and mediated by glutamate receptors (FIG.
18e). Focal stimulation through a bipolar electrode evoked slow
kinetic synaptic responses which could be blocked by picrotoxin
(FIG. 18f) again indicating that the majority of the responses were
mediated by GABAA receptors. In addition, evoked EPSC could be
recorded in this condition (FIG. 18g) which were sensitive to
further addition of CNQX (FIG. 18h). These results indicate that
HFF-iN cells can functionally integrate into neuronal networks and
form excitatory and inhibitory synaptic contacts, a principal
property of neurons.
[0251] The results of this study highlight the power of
lineage-specific transcription factors to induce specific cell
fates in somatic and pluripotent cells. Currently, one important
limitation of the potentially broad applications of iPS cell
technology is the variability and length of available
differentiation protocols. We propose ES-iN cells or iPS-iN cells
as valuable alternative approach to generate functional neuronal
cells from pluripotent stem cells in a rapid and reliable way
extending previous work utilizing transcription factors to enhance
ES cell differentiation. Compared to our previous experience with
mouse fibroblasts, the conversion of human fibroblasts into
neuronal cells was less efficient and robust.
Methods
[0252] Cell culture. H9 human ES cells were obtained from WiCell
Research Resources and expanded in mTeSR1 (Stem Cell Technologies).
Cells were routinely split with dispase every 4 to5 days and seeded
as small clumps on matrigel (Invitrogen). The day before infection,
cells were treated with accutase and seeded as single cells in 3.5
cm tissue culture dishes on matrigel in mTeSR1 containing 2 .mu.M
Thiazovivin (Bio Vision) as described in Xu et al. Approximately
1-210.sup.5 cells were seeded in a single dish. Primary human fetal
fibroblasts were isolated from the distal half of the leg of a GW9
embryo obtained from Advanced Bioscience Resources Inc. The tissue
was dissociated to small clumps using scissors before being
digested in 0.25% trypsin for 10 minutes at 37.degree. C. and
plated in MEF media (DMEM high glucose, calf serum, sodium
pyruvate, non-essential amino acids, penicillin/streptomycin and
.beta.-mercaptoethanol). Before being used for experiments, primary
cells were passaged 3-6 times. Primary mouse cortical cultures and
glial monolayer cultures were established as described
previously.
[0253] Characterization of primary human fibroblast culture. To
exclude potential rare neural precursor cells in the primary
fibroblast cultures we screened a number of marker proteins and
transcripts by immunofluorescence and RT-PCR. Each antibody and
primer pair was validated in the same reaction using an appropriate
positive control. We included antibodies recognizing antigens of
neural stem cells (SOX2, BRN2) and markers for neurons and
astroglia (Tuj1, MAP2, GFAP). Cells were analyzed following culture
in regular fibroblast medium (MEF medium) and in N3 media
supplemented with EGF and FGF2 for 12 days (a condition promoting
neural progenitor cell expansion). No positive cells were detected
out of at least 100,000 passage 5 fibroblasts screened for any
marker. In addition, using RT-PCR we could not detect the
expression of either GFAP, MUSASHI1, p75, PAX6, or WNT1. Primers
were validated on positive control cDNA from human embryonic stem
cell derived neurons, neural stem cells, and neural crest stem
cells. In contrast, two independent GAPDH primer pairs showed
robust RT-dependent amplification.
[0254] Lentiviral Infections. Lentiviral production and fibroblast
infections were performed as described previously. Briefly, primary
human fetal fibroblasts were plated on poly-ornithine coated dishes
and infected with lentiviral supernatant and polybrene (8
.mu.g/.mu.L) in fresh MEF media. Viral media was removed after
16-24 hours and replaced with MEF media containing doxycycline (2
.mu.g/.mu.L). After 24-48 hours, media was changed to N3 media
(DMEM/F2 (Invitrogen), apotransferrin (100 .mu.g/ml), insulin (5
.mu.g/ml), sodium selenite (30 nM), progesterone (20 nM),
putrescine (100 nM), penicillin/streptomycin) containing
doxycycline (2 .mu.g/.mu.L). For human ES cell infections, H9 human
embryonic stem cells were switched into N3 media containing
polybrene (2 .mu.g/.mu.L) 24-48 hours after re-plating, and
concentrated lentiviral particles were added. After 16-24 hours,
cultures were switched into N3 media containing doxycycline (2
.mu.g/.mu.L) and changed daily before dissociation. Forty-eight
hours after the initial addition of doxycycline, Ara-C (4
.mu.g/.mu.L) was added to the media to inhibit proliferation of ES
cells. Infected ES cultures were dissociated with papain 24-48
hours after addition of Ara-C (d4- d5 post infection) and replated
onto monolayer glial cultures in neuronal growth medium 12
containing Ara-C (2 .mu.g/.mu.L). All chemicals were purchased from
Sigma if not otherwise specified.
[0255] Molecular cloning and virus production. Complementary DNAs
for the transcription factors were reverse transcribed and PCR
amplified from RNA extracted from the developing mouse brain and
spinal cord or DNA plasmids as templates were purchased from Open
Biosystems and cloned into FUW-based lentiviral constructs under
the control of the tetracycline operator. Replication-incompetent,
VSVg-coated lentiviral particles were packaged in HEK293T cells
following transfection with calcium phosphate precipitation as
described. HFFs were infected with viral supernatant. For ES cell
infections, the virus was concentrated by ultracentrifugation
(Beckman; 25,000 RPM, 90min). The microRNA expression plasmids
(hsa-miR-9, -10a, -124a and -196a) contained the short hair-pin
sequences of indicated hsa-miRNAs under the transcriptional control
of human U6 promoter which were cloned into FG12 vector upstream of
a Ubiquitin C-EGFP expression cassette.
[0256] Electrophysiology. Cells were analyzed at indicated time
points after infection. Action potentials were recorded with
current-clamp whole-cell configuration. The pipette solution for
current-clamp experiments contained (in mM): 123 K-gluconate, 10
KCl, 1 MgCl.sub.2, 10 HEPES, 1 EGTA, 0.1 CaCl.sub.2, 1 K.sub.2ATP,
0.2 Na.sub.4GTP and 4 glucose, pH adjusted to 7.2 with KOH.
Membrane potentials were kept around -65 to -70 mV, and step
currents were injected to elicit action potentials. For whole-cell
voltage dependent current recordings, the same internal solution as
above mentioned were used. For synaptic functional evaluation, the
internal solution contained (in mM): CsCl 135, HEPES 10, EGTA 1,
Mg-ATP 4, Na4GTP 0.4, and QX-314 10, pH7.4. The bath solution
contained (in mM): NaCl 140, KCl 5, CaCl.sub.2 2, MgCl.sub.2 2,
HEPES 10, and glucose 10, pH7.4. Whole-cell currents including Na+
and K+ currents were recorded at a holding potential of -70 mV,
voltage steps ranging from -80 mV to +90 mV were delivered at 10 mV
increments. Synaptic responses were measured as described
previously.
[0257] Immunofluorescence and RT-PCR. For immunofluorescence
experiments, cells were fixed in 4% paraformaldehyde in PBS for 10
minutes at room temperature. Antibodies were diluted to indicated
concentrations (see below). Following fixation, cells were
incubated in 0.2% Triton X-100 in PBS for 5 minutes at RT. After
washing twice with PBS, cells were blocked in a solution of PBS
containing 4% BSA and 1% cosmic calf serum (CCS) for 30 minutes at
RT. Primary and secondary antibodies were diluted in a solution of
PBS containing 4% BSA and 1% CCS. Primary and secondary antibodies
were applied for 1 hour and 30 minutes, respectively. Cells were
washed three times with PBS between primary and secondary staining.
For cell counts, neuronal cells were defined as cells, which
stained positive for Tuj1 and had a process at least 3 times longer
than the cell body. The following antibodies were used for our
analysis: rabbit-GFAP (DAKO, 1:4000), mouse anti-MAP2 (Sigma,
1:500), mouse anti-NeuN (Millipore, 1:200), mouse anti-Peripherin
(Sigma, 1:100), mouse anti-Sox2 (R&D Systems, 1:50), rabbit
anti-Tuj1 (Covance, 1:1000), mouse anti-Tuj1 (Covance, 1:1000),
goat anti-Brn2 (clone C-20, Santa Cruz Biotechnology, 1:100), mouse
anti-BrdU (Becton-Dickinson, 1:50), sheep anti-Tyrosine Hydroxylase
(Pel-Freez, 1:500), rabbit anti-synapsin (clone E028, provided by
T.C.S., 1:1000), guinea pig anti-vGLUT1 (Millipore, 1:2000), mouse
anti-GAD6 (Developmental Studies Hybridoma Bank (DSHB), 1:500),
Ascl1 (Abcam, 1:200). FITC-, and Cy3-conjugated secondary
antibodies were obtained from Jackson Immunoresearch. Alexa-488,
Alexa-546 and Alexa-633-conjugated secondary antibodies were
obtained from Invitrogen. DAPI (Sigma, 1:10,000). For RT-PCR
analysis, RNA was isolated using Trizol (Invitrogen) following the
manufacturer's instructions, treated with DNAse (Invitrogen) and
reverse-transcribed with Superscript II (Invitrogen).
[0258] The preceding merely illustrates the principles of the
invention. It will be appreciated that those skilled in the art
will be able to devise various arrangements which, although not
explicitly described or shown herein, embody the principles of the
invention and are included within its spirit and scope.
Furthermore, all examples and conditional language recited herein
are principally intended to aid the reader in understanding the
principles of the invention and the concepts contributed by the
inventors to furthering the art, and are to be construed as being
without limitation to such specifically recited examples and
conditions. Moreover, all statements herein reciting principles,
aspects, and embodiments of the invention as well as specific
examples thereof, are intended to encompass both structural and
functional equivalents thereof. Additionally, it is intended that
such equivalents include both currently known equivalents and
equivalents developed in the future, i.e., any elements developed
that perform the same function, regardless of structure. The scope
of the present invention, therefore, is not intended to be limited
to the exemplary embodiments shown and described herein. Rather,
the scope and spirit of the present invention is embodied by the
appended claims.
Sequence CWU 1
1
7116PRTArtificial SequenceSynthetic polypeptide 1Arg Gln Ile Lys
Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1 5 10 15
220DNAArtificial SequenceSynthetic primer 2tcgagccctt ctcacttgtt
20320DNAArtificial SequenceSynthetic primer 3ttgatgcatt ttgggggtat
20420DNAArtificial SequenceSynthetic primer 4gaactgggca aggtcaagaa
20520DNAArtificial SequenceSynthetic primer 5cgcttgtcac tttcgttcag
20621DNAArtificial SequenceSynthetic primer 6cgtgggccgc cctaggcacc
a 21718DNAArtificial SequenceSynthetic primer 7cttagggttc aggggggc
18
* * * * *