U.S. patent application number 15/414020 was filed with the patent office on 2017-12-21 for methods for making proteins containing free cysteine residues.
The applicant listed for this patent is BOLDER BIOTECHNOLOGY, INC.. Invention is credited to George N. Cox, Daniel H. Doherty, Mary S. Rosendahl.
Application Number | 20170362626 15/414020 |
Document ID | / |
Family ID | 45807084 |
Filed Date | 2017-12-21 |
United States Patent
Application |
20170362626 |
Kind Code |
A1 |
Cox; George N. ; et
al. |
December 21, 2017 |
METHODS FOR MAKING PROTEINS CONTAINING FREE CYSTEINE RESIDUES
Abstract
The present invention relates to novel methods of making soluble
proteins having free cysteines in which a host cell is exposed to a
cysteine blocking agent. The soluble proteins produced by the
methods can then be modified to increase their effectiveness. Such
modifications include attaching a PEG moiety to form pegylated
proteins.
Inventors: |
Cox; George N.; (Louisville,
CO) ; Doherty; Daniel H.; (Boulder, CO) ;
Rosendahl; Mary S.; (Broomfield, CO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BOLDER BIOTECHNOLOGY, INC. |
BOULDER |
CO |
US |
|
|
Family ID: |
45807084 |
Appl. No.: |
15/414020 |
Filed: |
January 24, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14598094 |
Jan 15, 2015 |
|
|
|
15414020 |
|
|
|
|
13616608 |
Sep 14, 2012 |
8957023 |
|
|
14598094 |
|
|
|
|
13088830 |
Apr 18, 2011 |
8288126 |
|
|
13616608 |
|
|
|
|
12604165 |
Oct 22, 2009 |
7947655 |
|
|
13088830 |
|
|
|
|
10857644 |
May 27, 2004 |
7629314 |
|
|
12604165 |
|
|
|
|
09889273 |
Sep 6, 2001 |
6753165 |
|
|
PCT/US00/00931 |
Jan 14, 2000 |
|
|
|
10857644 |
|
|
|
|
60116041 |
Jan 14, 1999 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/27 20130101;
C07K 14/505 20130101; A61K 47/60 20170801; C07K 14/61 20130101;
C07K 14/56 20130101; C07K 14/72 20130101; C07K 1/1133 20130101;
C12P 21/02 20130101; C12P 21/005 20130101 |
International
Class: |
C12P 21/02 20060101
C12P021/02; C07K 14/72 20060101 C07K014/72; C07K 14/61 20060101
C07K014/61; C07K 14/56 20060101 C07K014/56; C07K 14/505 20060101
C07K014/505; C07K 1/113 20060101 C07K001/113; A61K 38/27 20060101
A61K038/27; C12P 21/00 20060101 C12P021/00; A61K 47/60 20060101
A61K047/60 |
Claims
1.-31. (canceled)
32. An isolated, disulfide-linked growth hormone protein dimer
comprising two growth hormone protein monomers, wherein each growth
hormone protein monomer in the dimer comprises at least one added
cysteine residue, wherein at least one of the added cysteine
residues participates in a disulfide bond joining the two growth
hormone protein monomers together in the dimer, and wherein the
protein dimer stimulates proliferation of a cell line that
proliferates in response to growth hormone.
33. The isolated growth hormone protein of claim 32, where the
growth hormone protein is human Growth Hormone.
34. The isolated human Growth Hormone protein of claim 33, wherein
said human Growth Hormone protein comprises a cysteine residue
added preceding the F1 amino acid of the mature human Growth
Hormone protein.
35. The isolated human Growth Hormone protein of claim 33, where
said human Growth Hormone protein comprises a cysteine residue
added following the terminal F191 amino acid of the mature human
Growth Hormone protein.
36. The isolated human Growth Hormone protein of claim 33, where
said human Growth Hormone protein comprises a cysteine residue
substituted for at least one amino acid selected from the group
consisting of P2, T3, P5, A34, K38, Q40, S43, S55, S57, A98, N99,
S100, L101, V102, Y103, A105, S132, P133, R134, T135, Q137, K140,
Q141, Y143, S144, D147, T148, N149, E186, and G187.
37. The isolated human Growth Hormone protein of claim 33, where
said human Growth Hormone protein comprises a cysteine residue
substituted for T3.
38. The isolated human Growth Hormone protein of claim 33, where
said human Growth Hormone protein comprises a cysteine residue
substituted for A105.
39. The isolated human Growth Hormone protein of claim 33, where
said human Growth Hormone protein comprises a cysteine residue
substituted for T135.
40. The isolated human Growth Hormone of claim 33, wherein said
isolated Growth Hormone protein is modified with polyethylene
glycol.
41. The isolated human Growth Hormone protein of claim 33, wherein
said isolated Growth Hormone protein is modified with a
cysteine-reactive polyethylene glycol.
42. The isolated growth hormone protein dimer of claim 32, where
said growth hormone protein dimer is a recombinant protein.
43. The isolated growth hormone protein dimer of claim 32, wherein
the dimer is a homodimer.
44. A method for obtaining an isolated, disulfide-linked growth
hormone protein dimer comprising two growth hormone protein
monomers, wherein each growth hormone protein monomer in the dimer
comprises at least one added cysteine residue, and wherein the at
least one added cysteine residue participates in a disulfide bond
joining the two growth hormone protein monomers together in the
dimer, the method comprising: (a) obtaining a host cell capable of
expressing the growth hormone protein comprising at least one added
cysteine residue; (b) causing the host cell to express the growth
hormone protein comprising at least one added cysteine residue in a
soluble form; (c) exposing the growth hormone protein comprising at
least one added cysteine residue to a cysteine blocking agent prior
to step (d); and (d) isolating the growth hormone protein dimer by
column chromatography, wherein the buffers used to elute the growth
hormone protein from the column do not contain a cysteine blocking
agent.
45. The method of claim 44, wherein the column chromatography
method of step (d) is selected from the group consisting of
ion-exchange column chromatography, hydrophobic interaction column
chromatography, metal chelation affinity column chromatography,
size exclusion column chromatography, and combinations thereof.
46. The method of claim 44, where the column chromatography method
of step (d) is ion-exchange column chromatography.
47. The method of claim 44, wherein the cysteine blocking agent in
step (c) is selected from the group consisting of cystine, oxidized
glutathionine, and cystamine.
48. The method of claim 44, wherein the cysteine blocking agent in
step (c) is cystine.
49. A method of treating a disease treatable with growth hormone,
comprising administering to a patient in need thereof an effective
amount of a composition comprising an isolated, disulfide-linked
growth hormone protein dimer comprising two growth hormone protein
monomers, wherein each growth hormone protein monomer in the dimer
comprises at least one added cysteine residue, and wherein the at
least one added cysteine residue participates in a disulfide bond
joining the two growth hormone protein monomers together in the
dimer.
50. The method of claim 49, wherein the disease is selected from
the group consisting of: growth hormone deficiency, short stature
resulting from growth hormone deficiency, short stature resulting
from Turner's Syndrome, short stature resulting from renal failure,
and cachexia.
51. The method of claim 49, wherein the composition is administered
to the patient by a route selected from the group consisting of
intravenous administration, intraperitoneal administration, and
subcutaneous administration.
Description
FIELD OF THE INVENTION
[0001] The present invention relates generally to methods of making
proteins and more specifically to recombinant proteins containing a
"free" cysteine residue that does not form a disulfide bond.
BACKGROUND OF THE INVENTION
[0002] There is considerable interest on the part of patients and
healthcare providers in the development of low cost, long-acting,
"user-friendly" protein therapeutics. Proteins are expensive to
manufacture and unlike conventional small molecule drugs, are
usually not readily absorbed by the body. Moreover they are
digested if taken orally. Therefore, proteins must typically be
administered by injection. After injection most proteins are
cleared rapidly from the body, necessitating frequent, often daily,
injections. Patients dislike injections, which leads to reduced
compliance and reduced drug efficacy. Some proteins such as
erythropoietin (EPO) are effective when administered less often
(three times per week for EPO) but this is due to the fact that the
proteins are glycosylated. Glycosylation requires that the
recombinant proteins be manufactured using mammalian cell
expression systems, which is expensive and increases the cost of
protein pharmaceuticals.
[0003] Thus, there is a strong need to develop protein delivery
technologies that lower the costs of protein therapeutics to
patients and healthcare providers. One solution to this problem is
the development of methods to prolong the circulating half-lives of
protein therapeutics in the body so that the proteins do not have
to be injected frequently. This solution also satisfies the needs
and desires of patients for protein therapeutics that are
"user-friendly", i.e., protein therapeutics that do not require
frequent injections.
[0004] Covalent modification of proteins with polyethylene glycol
(PEG) has proven to be a useful method to extend the circulating
half-lives of proteins in the body (Abuchowski et al., 1984;
Hershfield, 1987; Meyers et al., 1991). Covalent attachment of PEG
to a protein increases the protein's effective size and reduces its
rate of clearance from the body. PEGs are commercially available in
several sizes, allowing the circulating half-lives of PEG-modified
proteins to be tailored for individual indications through use of
different size PEGs. Other documented in vivo benefits of PEG
modification are an increase in protein solubility, stability
(possibly due to protection of the protein from proteases) and a
decrease in protein immunogenicity (Katre et al., 1987; Katre,
1990).
[0005] One known method for PEGylating proteins uses compounds such
as N-hydroxy succinimide (NHS)-PEG to attach PEG to free amines,
typically at lysine residues or at the N-terminal amino acid. A
major limitation of this approach is that proteins typically
contain several lysines, in addition to the N-terminal amino acid,
and the PEG moiety attaches to the protein non-specifically at any
of the available free amines, resulting in a heterogeneous product
mixture. Many NHS-PEGylated proteins are unsuitable for commercial
use because of low specific activities and heterogeneity.
Inactivation results from covalent modification of one or more
lysine residues or the N-terminal amino acid required for
biological activity or from covalent attachment of the PEG moiety
near the active site of the protein.
[0006] Of particular relevance to this application is the finding
that modification of human growth hormone (hGH) with amine-reactive
reagents, including NHS-PEG reagents, reduces biological activity
of the protein by more than 10-fold (Teh and Chapman, 1988; Clark
et al., 1996). GH is a 22 kDa protein secreted by the pituitary
gland. GH stimulates metabolism of bone, cartilage and muscle and
is the body's primary hormone for stimulating somatic growth during
childhood. Recombinant human GH (rhGH) is used to treat short
stature resulting from GH inadequacy, Turner's Syndrome and renal
failure in children. GH is not glycosylated and is fully active
when produced in bacteria. The protein has a short in vivo
half-life and must be administered by daily subcutaneous injection
for maximum effectiveness (MacGillivray et al., 1996).
[0007] There is considerable interest in the development of
long-acting forms of hGH. Attempts to create long-acting forms of
hGH by PEGylating the protein with amine-reactive PEG reagents have
met with limited success due to significant reductions in
bioactivity upon PEGylation. Further, the protein becomes PEGylated
at multiple sites (Clark et al., 1996). hGH contains nine lysines,
in addition to the N-terminal amino acid. Certain of these lysines
are located in regions of the protein known to be critical for
receptor binding (Cunningham et al., 1989; Cunningham and Wells,
1989). Modification of these lysine residues significantly reduces
receptor binding and bioactivity of the protein (de la Llosa et
al., 1985; Marta' et al., 1985; Teh and Chapman, 1988; Cunningham
and Wells, 1989). hGH is readily modified by NHS-PEG reagents, but
biological activity of the NHS-PEG protein is severely compromised,
amounting to only 1% of wild type GH biological activity for a GH
protein modified with five 5 kDa PEG molecules (Clark et al.,
1996). The EC.sub.50 for this multiply PEGylated GH protein is 440
ng/ml or approximately 20 nM (Clark et al., 1996). In addition to
possessing significantly reduced biological activity, NHS-PEG-hGH
is very heterogeneous due to different numbers of PEG molecules
attached to the protein and at different amino acid residues, which
has an impact on its usefulness as a potential therapeutic. Clark
et al. (1996) showed that the circulating half-life of NHS-PEG-hGH
in animals is significantly prolonged relative to non-modified GH.
Despite possessing significantly reduced in vitro biological
activity, NHS-PEG-hGH was effective and could be administered less
often than non-modified hGH in a rat GH-deficiency model (Clark et
al., 1996). However, high doses of NHS-PEG-hGH (60-180 .mu.g per
injection per rat) were required for efficacy in the animal models
due to the low specific activity of the modified protein. There is
a clear need for better methods to create PEGylated hGH proteins
that retain greater bioactivity. There also is a need to develop
methods for PEGylating hGH in a way that creates a homogeneous
PEG-hGH product.
[0008] Biological activities of several other commercially
important proteins are significantly reduced by amine-reactive PEG
reagents. EPO contains several lysine residues that are critical
for bioactivity of the protein (Boissel et al., 1993; Matthews et
al., 1996) and modification of lysine residues in EPO results in
near complete loss of biological activity (Wojchowski and Caslake,
1989). Covalent modification of alpha-interferon-2 with
amine-reactive PEGs results in 40-75% loss of bioactivity (Goodson
and Katre, 1990; Karasiewicz et al., 1995). Loss of biological
activity is greatest with large (e.g., 10 kDa) PEGs (Karasiewicz et
al., 1995). Covalent modification of G-CSF with amine-reactive PEGs
results in greater than 60% loss of bioactivity (Tanaka et al.,
1991). Extensive modification of IL-2 with amine-reactive PEGs
results in greater than 90% loss of bioactivity (Goodson and Katre,
1990).
[0009] A second known method for PEGylating proteins covalently
attaches PEG to cysteine residues using cysteine-reactive PEGs. A
number of highly specific, cysteine-reactive PEGs with different
reactive groups (e.g., maleimide, vinylsulfone) and different size
PEGs (2-40 kDa) are commercially available. At neutral pH, these
PEG reagents selectively attach to "free" cysteine residues, i.e.,
cysteine residues not involved in disulfide bonds. Cysteine
residues in most proteins participate in disulfide bonds and are
not available for PEGylation using cysteine-reactive PEGs. Through
in vitro mutagenesis using recombinant DNA techniques, additional
cysteine residues can be introduced anywhere into the protein. The
newly added "free" cysteines can serve as sites for the specific
attachment of a PEG molecule using cysteine-reactive PEGs. The
added cysteine residue can be a substitution for an existing amino
acid in a protein, added preceding the amino-terminus of the
protein or after the carboxy-terminus of the protein, or inserted
between two amino acids in the protein. Alternatively, one of two
cysteines involved in a native disulfide bond may be deleted or
substituted with another amino acid, leaving a native cysteine (the
cysteine residue in the protein that normally would form a
disulfide bond with the deleted or substituted cysteine residue)
free and available for chemical modification. Preferably the amino
acid substituted for the cysteine would be a neutral amino acid
such as serine or alanine. Growth hormone has two disulfide bonds
that can be reduced and alkylated with iodoacetimide without
impairing biological activity (Bewley et al., (1969). Each of the
four cysteines would be reasonable targets for deletion or
substitution by another amino acid.
[0010] Several naturally-occurring proteins are known to contain
one or more "free" cysteine residues. Examples of such
naturally-occurring proteins include human Interleukin (IL)-2, beta
interferon (Mark et al., 1984), G-CSF (Lu et al., 1989) and basic
fibroblast growth factor (Thompson, 1992). IL-2, G-CSF and beta
interferon contain an odd number of cysteine residues, whereas
basic fibroblast growth factor contains an even number of cysteine
residues.
[0011] However, expression of recombinant proteins containing free
cysteine residues has been problematic due to reactivity of the
free sulfhydryl at physiological conditions. Several recombinant
proteins containing free cysteines have been expressed as
intracellular proteins in bacteria such as E. coli. Examples
include natural proteins such as IL-2, beta interferon, G-CSF,
basic fibroblast growth factor and engineered cysteine muteins of
IL-2 (Goodson and Katre, 1990), IL-3 (Shaw et al., 1992), Tumor
Necrosis Factor Binding Protein (Tuma et al., 1995), IGF-I (Cox and
McDermott, 1994), IGFBP-1 (Van Den Berg et al., 1997) and protease
nexin and related proteins (Braxton, 1998). All of these proteins
were insoluble when expressed intracellularly in bacteria. The
insoluble proteins could be refolded into their native
conformations by performing a series of denaturation, reduction and
refolding procedures. These steps add time and cost to the
manufacturing process for producing the proteins in bacteria.
Improved stability and yields of IL-2 (Mark et al., 1985) and beta
interferon (DeChiara et al., 1986) have been obtained by
substituting another amino acid, e.g., serine, for the free
cysteine residue. It would be preferable to express the recombinant
proteins in a soluble, biologically active form to eliminate these
extra steps.
[0012] One known method of expressing soluble recombinant proteins
in bacteria is to secrete them into the periplasmic space or into
the media. It is known that certain recombinant proteins such as GH
are expressed in a soluble active form when they are secreted into
the E. coli periplasm, whereas they are insoluble when expressed
intracellularly in E. coli. Secretion is achieved by fusing DNA
sequences encoding growth hormone or other proteins of interest to
DNA sequences encoding bacterial signal sequences such as those
derived from the stII (Fujimoto et al., 1988) and ompA proteins
(Ghrayeb et al., 1984). Secretion of recombinant proteins in
bacteria is desirable because the natural N-terminus of the
recombinant protein can be maintained. Intracellular expression of
recombinant proteins requires that an N-terminal methionine be
present at the amino-terminus of the recombinant protein.
Methionine is not normally present at the amino-terminus of the
mature forms of many human proteins. For example, the
amino-terminal amino acid of the mature form of human growth
hormone is phenylalanine. An amino-terminal methionine must be
added to the amino-terminus of a recombinant protein, if a
methionine is not present at this position, in order for the
protein to be expressed efficiently in bacteria. Typically addition
of the amino-terminal methionine is accomplished by adding an ATG
methionine codon preceding the DNA sequence encoding the
recombinant protein. The added N-terminal methionine often is not
removed from the recombinant protein, particularly if the
recombinant protein is insoluble. Such is the case with hGH, where
the N-terminal methionine is not removed when the protein is
expressed intracellularly in E. coli. The added N-terminal
methionine creates a "non-natural" protein that potentially can
stimulate an immune response in a human. In contrast, there is no
added methionine on hGH that is secreted into the periplasmic space
using stII (Chang et al., 1987) or ompA (Cheah et al., 1994) signal
sequences; the recombinant protein begins with the native
amino-terminal amino acid phenylalanine. The native hGH protein
sequence is maintained because of bacterial enzymes that cleave the
stII-hGH protein (or ompA-hGH protein) between the stII (or ompA)
signal sequence and the start of the mature hGH protein. While the
periplasmic space is believed to be an oxidizing environment that
should promote disulfide bond formation, coexpression of protein
disulfide isomerase with bovine pancreatic trypsin inhibitor
resulted in a six-fold increase in the yield of correctly folded
protein from the E. coli periplasm (Ostermeier et al., (1996). This
result would suggest that periplasmic protein folding can at times
be inefficient and is in need of improvement for large scale
protein production.
[0013] hGH has four cysteines that form two disulfides. hGH can be
secreted into the E. coli periplasm using stII or ompA signal
sequences. The secreted protein is soluble and biologically active
(Hsiung et al., 1986). The predominant secreted form of hGH is a
monomer with an apparent molecular weight by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) of 22 kDa.
Recombinant hGH can be isolated from the periplasmic space by using
an osmotic shock procedure (Koshland and Botstein, 1980), which
preferentially releases periplasmic, but not intracellular,
proteins into the osmotic shock buffer. The released hGH protein is
then purified by column chromatography ((Hsiung et al., 1986).
[0014] When similar procedures were attempted to secrete hGH
variants containing a free cysteine residue (five cysteines; 2N+1),
it was discovered that the recombinant hGH variants formed
multimers and aggregates when isolated using standard osmotic shock
and purification procedures developed for hGH. Very little of the
monomeric hGH variant proteins could be detected by non-reduced
SDS-PAGE in the osmotic shock lysates or during purification of the
proteins by column chromatography.
[0015] Alpha interferon (IFN-.alpha.2) also contains four cysteine
residues that form two disulfide bonds. IFN-.alpha.2 can be
secreted into the E. coli periplasm using the stII signal sequence
(Voss et al., 1994). The secreted protein is soluble and
biologically active (Voss et al., 1994). The predominant secreted
form of IFN-.alpha.2 is a monomer with an apparent molecular weight
by SDS-PAGE of 19 kDa. Secreted recombinant IFN-.alpha.2 can be
purified by column chromatography (Voss et al., 1994).
[0016] When similar procedures were attempted to secrete
IFN-.alpha.2 variants containing a free cysteine residue (five
cysteines; 2N+1), it was discovered that the recombinant
IFN-.alpha.2 variants formed multimers and aggregates when isolated
using standard purification procedures developed for IFN-.alpha.2.
The IFN-.alpha.2 variants eluted from the columns very differently
than IFN-.alpha.2 and very little of the monomeric IFN-.alpha.2
variant proteins could be purified using column chromatography
procedures developed for IFN-.alpha.2.
[0017] An alternative method to synthesizing a protein containing a
free cysteine residue is to introduce a thiol group into a protein
post-translationally via a chemical reaction with succinimidyl
6-[3-2-pyridyldithio)propionamido]hexanoate (LC-SPDP, commercially
available from Pierce Chemical Company). LC-SPDP reacts with lysine
residues to create a free sulfhydryl group. Chemically cross-linked
dimeric EPO was prepared using this reagent in conjunction with a
maleimide protein modifying reagent (Sytkowsk et al., 1998). A
heterologous mixture of chemically cross-linked EPO proteins was
recovered after purification due to non-specific modification of
the various lysine residues in EPO Enhanced pharmacokinetics and in
vivo potency of the chemically cross-linked EPO proteins were
observed.
[0018] Another method that has been used to increase the size of a
protein and improve its in vivo potency involves dimerization of
the protein using chemical crosslinking reagents. GH is thought to
transduce a cellular signal by cross-linking two GH receptors. A
GH-GH dimer might facilitate enhanced receptor dimerization and
subsequent amplification of the intracellular signal.
[0019] Chemically cross-linked dimeric hGH proteins have been
described by Mockridge et al. (1998). Using a water soluble
cross-linking reagent
1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), GH was
randomly derivatized to give predominantly amide-linked dimers but
also amide-linked multimers, depending on the concentration of EDC
reagent used. While an increase in in vivo potency was observed,
the final protein preparation was heterogeneous due to non-specific
reaction of the EDC reagent with various amino acids in the
protein, including lysine, aspartic acid and glutamic acid residues
and the amino- and carboxy-termini. Injection of such a preparation
into humans would be undesirable due to the toxic nature of EDC,
potential immunogenic response to the unnatural amide bond formed
between the proteins. Generating consistent batches of a purified
protein also would be difficult at the manufacturing scale.
[0020] Therefore, despite considerable effort, a need still exists
for a process for generating homogeneous preparations of long
acting recombinant proteins by enhancement of protein molecular
weight. A need also for methods that allow secretion and recovery
of recombinant proteins containing free cysteine residues in high
yield. The present invention satisfies these needs and provides
related advantages as well.
SUMMARY OF THE INVENTION
[0021] The present invention relates to methods for obtaining a
soluble protein having a free cysteine. The methods are generally
accomplished by obtaining a host cell capable of expressing the
soluble protein, exposing the host cell to a cysteine blocking
agent, and isolating the soluble protein from the host cell. In one
embodiment in which the protein is not secreted into the media by
the host cell, the host cell is disrupted in the presence of the
cysteine blocking agent and the soluble protein is isolated or
purified from the soluble fraction of the disrupted host cell. In
another embodiment in which the soluble protein is secreted by the
host cell into the media, the host cell is exposed to the cysteine
blocking agent before, during or after synthesis of the soluble
protein by the host cell.
[0022] Suitable host cells include bacteria, yeast, insect or
mammalian cells. Preferably, the host cell is a bacterial cell,
particularly E. coli.
[0023] Preferably, the soluble protein produced by the methods of
the present invention are recombinant proteins, especially cysteine
variants or muteins of a protein. The methods are useful for
producing proteins including, without limitation, human growth
hormone, EPO and interferon, especially alpha interferon, their
derivatives or antagonists. Other proteins include members of the
TGF-beta superfamily, platelet derived growth factor-A, platelet
derived growth factor-B, nerve growth factor, brain derived
neurotophic factor, neurotrophin-3, neurotrophin-4, vascular
endothelial growth factor, or a derivative or an antagonist
thereof. Cysteine muteins of heavy or light chain of an
immunoglobulin or a derivative thereof are also contemplated.
Useful cysteine blocking agents include any thiol-reactive
compound, including for example, cystine, cystamine, dithioglycolic
acid, oxidized glutathione, iodine, hydrogen peroxide,
dihydroascorbic acid, tetrathionate, O-iodosobenzoate or oxygen in
the presence of a metal ion.
[0024] The present methods further include various methods of
attaching a PEG moiety to the soluble protein to form pegylated
proteins in which the PEG moiety is attached to the soluble protein
through the free cysteine. Higher order multimeric proteins
involving the coupling of two or more of the soluble proteins are
also within the present invention.
[0025] The present invention further includes the soluble proteins
and their derivatives, including pegylated proteins, made by the
methods disclosed herein. Such pegylated proteins include
monopegylated hGh, EPO and alpha interferon.
[0026] The present invention also provides methods for pegylating
the soluble proteins obtained by the methods described herein. Such
methods include purifying the protein, reducing at least partially
the protein with a disulfie-reducing agent and exposing the protein
to a cysteine-reactive moiety. Optionally, the modified cysteine
protein can be isolated from unmodified protein.
[0027] Methods of treating conditions treatable by growth hormone,
EPO and alpha interferon are also within the present invention. The
soluble proteins or their derivatives, including pegylated
derivatives, are administered to patients suffering from conditions
in which known growth hormone, EPO or alpha interferon is
effective.
BRIEF DESCRIPTION OF THE FIGURE
[0028] FIG. 1 is a diagram of mutagenesis by overlap extension in
which two separate fragments are amplified from a target DNA
segment.
DESCRIPTION OF THE INVENTION
[0029] The present invention provides novel methods of obtaining
proteins having free cysteine residues. The invention further
provides novel proteins, particularly recombinant proteins,
produced by these novel methods as well as derivatives of such
recombinant proteins. The novel methods for preparing such proteins
are generally accomplished by: [0030] (a) obtaining a host cell
capable of expressing a protein having a free cysteine; [0031] (b)
exposing the host cell to a cysteine blocking agent; and [0032] (c)
isolating the protein from the host cell.
[0033] In one embodiment, the methods include the steps of
disrupting the host cell in the presence of the cysteine blocking
agent, followed by isolating the protein from the soluble fraction
of the disrupted cell.
[0034] In a further embodiment in which the proteins are secreted
into the media by prokaryotic or eukaryotic host cells, the methods
include the steps of: [0035] (a) obtaining a host cell capable of
expressing a protein having a free cysteine; [0036] (b) exposing
the host cell to a cysteine blocking agent during synthesis, or
after synthesis but prior to purification, of the protein having a
free cysteine residue; and [0037] (d) isolating the protein from
other cellular components in the media.
[0038] As identified above, the first step in these methods is to
obtain a host cell capable of expressing a protein having a free
cysteine residue. Suitable host cells can be prokaryotic or
eukaryotic. Examples of appropriate host cells that can be used to
express recombinant proteins include bacteria, yeast, insect and
mammalian cells. Bacteria cells are particularly useful, especially
E. coli.
[0039] As used herein, the term "protein having a free cysteine
residue" means any natural or recombinant protein peptide
containing 2N+1 cysteine residues, where N can be 0 or any integer,
and proteins or peptides containing 2N cysteines, where two or more
of the cysteines do not normally participate in a disulfide bond.
Thus, the methods of the present invention are useful in enhancing
the expression, recovery and purification of any protein or peptide
having a free cysteine, particularly cysteine added variant
recombinant proteins (referred to herein as "cysteine muteins" or
"cysteine variants") having one or more free cysteines and/or
having 2 or more cysteines that naturally form a disulfide bond.
Although the expression, recovery and purification of a natural
protein having a free cysteine expressed by its natural host cell
can be enhanced by the methods of the present invention, the
description herein predominantly refers to recombinant proteins for
illustrative purposes only. In addition, the proteins can be
derived from any animal species including human, companion animals
and farm animals.
[0040] Accordingly, the present invention encompasses a wide
variety of recombinant proteins. These proteins include, but are
not limited to, glial-derived neurotrophic factor (GDNF),
transforming growth factor-beta1 (TGF-beta1), TGF-beta2, TGF-beta3,
inhibin A, inhibin B, bone morphogenetic protein-2 (BMP-2), BMP-4,
inhibin alpha, Mullerian inhibiting substance (MIS), OP-1
(osteogenic protein 1), which are all members of the TGF-beta
superfamily. The monomer subunits of the TGF-beta superfamily share
certain structural features: they generally contain 8 highly
conserved cysteine residues that form 4 intramolecular disulfides.
Typically a ninth conserved cysteine is free in the monomeric form
of the protein but participates in an intermolecular disulfide bond
formed during the homodimerization or heterodimerication of the
monomer subunits. Other members of the TGF-beta superfamily are
described by Massague (1990), Daopin et al. (1992), Kingsley
(1994), Kutty et al. (1998), and Lawton et al. (1997), incorporated
herein by reference.
[0041] Immunoglobulin heavy and light chain monomers also contain
cysteine residues that participate in intramolecular disulfides as
well as free cysteines (Roitt et al., 1989 and Paul, 1989). These
free cysteines normally only participate in disulfide bonds as a
consequence of multimerization events such as heavy chain
homodimerization, heavy chain-light chain heterodimerization,
homodimerization of the (heavy chain-light chain) heterodimers, and
other higher order assemblies such as pentamerization of the (heavy
chain-light chain) heterodimers in the case of IgM. Thus, the
methods of the present invention can be employed to enhance the
expression, recovery and purification of heavy and/or light chains
(or various domains thereof) of human immunoglobulins such as IgG1,
IgG2, IgG3, IgG4, IgM IgA1, IgA2, secretory IgA, IgD and IgE.
Immunoglobulins from other species could also be similarly
expressed, recovered and purified. Proteins genetically fused to
immunoglobulins or immunoglobulin domains as described in Chamow
& Ashkenazi (1996) could also be similarly expressed, recovered
and purified.
[0042] The present methods can also enhance the expression,
recovery and purification of additional recombinant proteins
including members of growth hormone superfamily. The following
proteins are encoded by genes of the growth hormone (GH) supergene
family (Bazan (1990); Bazan (1991); Mott and Campbell (1995);
Silvennoinen and Ihle (1996); Martin et al., 1990; Hannum et al.,
1994): growth hormone, prolactin, placental lactogen,
erythropoietin (EPO), thrombopoietin (TPO), interleukin-2 (IL-2),
IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12 (p35
subunit), IL-13, IL-15, oncostatin M, ciliary neurotrophic factor,
leukemia inhibitory factor, alpha interferon, beta interferon,
gamma interferon, omega interferon, tau interferon,
granulocyte-colony stimulating factor (G-CSF),
granulocyte-macrophage colony stimulating factor (GM-CSF),
macrophage colony stimulating factor (M-CSF), cardiotrophin-1
(CT-1), Stem Cell Factor and the flt3/flk2 ligand ("the GH
supergene family"). It is anticipated that additional members of
this gene family will be identified in the future through gene
cloning and sequencing. Members of the GH supergene family have
similar secondary and tertiary structures, despite the fact that
they generally have limited amino acid or DNA sequence identity.
The shared structural features allow new members of the gene family
to be readily identified.
[0043] A group of proteins has been classed as a structural
superfamily based on the shared structural motif termed the
"cystine knot". The cystine knot is defined by six conserved
cysteine residues that form three intramolecular disulfide bonds
that are topologically "knotted" (McDonald and Hendrickson, 1993).
These proteins also form homo- or heterodimers and in some but not
all instances dimerization involves intermolecular disulfide
formation. Members of this family include the members of the
TGF-beta superfamily and other proteins such as platelet derived
growth factor-A (PDGF-A), PDGF-B, nerve growth factor (NGF), brain
derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4,
and vascular endothelial growth factor (VEGF). Cystine and other
cysteine blocking reagents could also enhance expression, recovery
and purification of proteins with this structural motif.
[0044] The present methods can also enhance the expression,
recovery and purification of other recombinant proteins and/or
cysteine added variants of those proteins. Classes of proteins
would include proteases and other enzymes, protease inhibitors,
cytokines, cytokine antagonists, allergens, chemokines,
gonadotrophins, chemotactins, lipid-binding proteins, pituitary
hormones, growth factors, somatomedans, immunoglobulins,
interleukins, interferons, soluble receptors, vaccines, and
hemoglobins. Specific examples of proteins include, for example,
leptin, insulin, insulin-like growth factor 1 (IGF1), superoxide
dismutase, catalase, asparaginase, uricase, fibroblast growth
factors, arginase, phenylalanine ammonia, angiostatin, endostatin,
Factor VIII, Factor IX, interleukin 1 receptor antagonist, protease
nexin and anti-thrombin III.
[0045] Other protein variants that would benefit from PEGylation
and would therefore be reasonable candidates for cysteine added
modifications include proteins or peptides with poor solubility or
a tendency to aggregate, proteins or peptides that are susceptable
to proteolysis, proteins or peptides needing improved mechanical
stability, proteins or peptides that are cleared rapidly from the
body, or proteins or peptides with undesirable immunogenic or
antigentic properties.
[0046] If desired, muteins of natural proteins can be generally
constructed using site-directed PCR-based mutagenesis as described
in general in Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and Applications edited by White, B. A. (1993)
Humana Press, Inc., Totowa, N.J. and PCR Protocols: A Guide to
Methods and Applications edited by Innis, M. A. et al. (1990)
Academic Press, Inc. San Diego, Calif. Typically, PCR primer
oligonucleotides are designed to incorporate nucleotide changes to
the coding sequence of proteins that result in substitution of a
cysteine residue for an amino acid at a specific position within
the protein. Such mutagenic oligonucleotide primers can also be
designed to incorporate an additional cysteine residue at the
carboxy terminus or amino terminus of the coding sequence of
proteins. In this latter case one or more additional amino acid
residues could also be incorporated amino terminal and/or carboxy
terminal to the added cysteine residue if that were desirable.
Moreover oligonucleotides can be designed to incorporate cysteine
residues as insertion mutations at specific positions within the
protein coding sequence if that were desirable. Again, one or more
additional amino acids could be inserted along with the cysteine
residue and these amino acids could be positioned amino terminal
and/or carboxy terminal to the cysteine residue.
[0047] The choice of sequences for mutagenic oligos is dictated by
the position where the desired cysteine residue is to be placed and
the propinquity of useful restriction endonuclease sites. Generally
it is desirable to place the mutation, i.e. the mis-matched segment
near the middle of the oligo to enhance the annealing of the oligo
to the template. It is also desirable for the mutagenic oligo to
span a unique restriction site so that the PCR product can be
cleaved to generate a fragment that can be readily cloned into a
suitable vector. An example would be one that can be used to
express the mutein or that provides convenient restriction sites
for excising the mutated gene and readily cloning it into such an
expression vector. It is generally desirable to employ mutagenic
oligos under 80 bases in length and lengths of 30-40 bases are more
preferable. Sometimes mutation sites and restriction sites are
separated by distances that are greater than that which is
desirable for synthesis of synthetic oligonucleotides. In such
instances, multiple rounds of PCR can be employed to incrementally
extend the length of the PCR product such that it includes the
desired useful restriction site or genes targeted for mutagenesis
can be reengineered or resynthesized to incorporate restriction
sites at appropriate positions. Alternatively, variations of PCR
mutagenesis protocols, such as the so-called "Megaprimer Method"
(Barik, S. pp277-286 in Methods in Molecular Biology, Vol. 15: PCR
Protocols: Current Methods and Applications edited by White, B. A.
(1993) Humana Press, Inc., Totowa, N.J.) or "Gene Splicing by
Overlap Extension" (Horton, R. M. pp251-261 in Methods in Molecular
Biology, Vol. 15: PCR Protocols: Current Methods and Applications
edited by White, B. A, (1993) Humana Press, Inc., Totowa, N.J.),
both incorporated herein by reference, can also be employed to
construct such mutations.
[0048] Next, the host cell is exposed to a cysteine blocking agent.
In one embodiment, the blocking agent is present at the time of
cell disruption, and preferably is added prior to disrupting the
cells. Cell disruption can be accomplished by, for example,
mechanical sheer such as a French pressure cell, enzymatic
digestion, sonication, homogenization, glass bead vortexing,
detergent treatment, organic solvents, freeze thaw, grinding with
alumina or sand and the like (Bollag et al., 1996).
[0049] In an alternative embodiment, the cysteine blocking agent
can be exposed to the host cell before, during or after the host
cell is induced to express the desired protein. For example, the
host cell can be cultured in the presence of the cysteine blocking
agent, which might be preferred for expression of proteins that are
secreted into the media such as erythropoietin, for example.
Alternatively, prior to or at the time of, exposing the host cell
to the cysteine blocking agent, the host cell can be induced to
express the desired protein, either as a secreted protein in the
periplasm or media, or as a cytoplasmic protein. Methods known in
the art can be used to induce such expression in the cytoplasm or
to direct secretion depending on cell origin, including, for
example, the methods described in the examples below. A wide
variety of signal peptides have been used successfully to transport
proteins to the periplasmic space. Examples of these include
prokaryotic signal sequences such as ompA, stII, PhoA signal
(Denefle et al., 1989), OmpT (Johnson et al., 1996), LamB and OmpF
(Hoffman and Wright, 1985), beta-lactamase (Kadonaga et al., 1984),
enterotoxins LT-A, LT-B (Morioka-Fujimoto et al., 1991), and
protein A from S. aureus (Abrahmsen et al., 1986). A number of
non-natural, synthetic, signal sequences that facilitate secretion
of certain proteins are also known to those skilled in the art.
[0050] For proteins secreted to the periplasm, an osmotic shock
treatment can be used to selectively disrupt the outer membrane of
the host cells with the resulting release of periplasmic proteins.
The osmotic shock buffer can be any known in the art, including,
for example, the osmotic shock buffer and procedures described in
Hsiung et al. (1986), or as described in the examples below. For
proteins secreted into the media, preferably the media should
contain the cysteine blocking agent during the time the cells
express and secrete the protein. The cysteine blocking agent also
could be added to the media following secretion of the protein but
prior to purification of the protein.
[0051] The cysteine blocking agent can be added to the culture
media at a concentration in the range of about 0.1 .mu.M to about
100 mM. Preferably, the concentration of cysteine blocking agent in
the media is about 50 .mu.M to about 5 mM
[0052] Although not wishing to be bound by any particular theory,
it is believed that the cysteine blocking agents used in the
present methods covalently attach to the "free" cysteine residue,
forming a mixed disulfide, thus stabilizing the free cysteine
residue and preventing multimerization and aggregation of the
protein. Alternatively, the presence of an oxidizing agent in the
osmotic shock buffers may be augmenting the protein refold process
in case incomplete renaturation had occurred following secretion of
the protein into the periplasmic space. However, as noted above,
periplasmic protein refolding can be inefficient. For this reason
it is believed that addition of cystine to osmotic shock buffers
also may increase the recovery of recombinant proteins containing
an even number of cysteine residues, even if the cysteines normally
form disulfide bonds. In addition, the inventors believe it may be
advantageous to add cystine or similar compounds to the
fermentation media during bacterial growth because these compounds
should diffuse into the periplasm due to the porous nature of the
bacterial outer membrane. Protein folding and blocking of the free
cysteine can be accomplished before cell recovery and lysis. Early
protein stabilization protects against proteolysis and can
contribute to higher recovery yields of recombinant proteins.
[0053] A number of thiol-reactive compounds can be used as cysteine
blocking agents to stabilize proteins containing free cysteines. In
addition to cystine, blocking agents can also include reagents
containing disulfide linkages such as cystamine, dithioglycolic
acid, oxidized glutathione, 5,5'-dithiobis(2-nitrobenzoic acid
(Ellman's reagent), pyridine disulfides, compounds of the type
R--S--S--CO--OCH.sub.3, other derivatives of cystine such as
diformylcystine, diacetylcystine, diglycylcystine, dialanylcystine
diglutaminylcystine, cystinyldiglycine, cystinyldiglutamine,
dialanylcystine dianhydride, cystine phenylhydantoin, homocystine,
dithiodipropionic acid, dimethylcystine, or any dithiol or chemical
capable of undergoing a disulfide exchange reaction. Sulfenyl
halides can also be used to prepare mixed disulfides. Other thiol
blocking agents that may find use in stabilizing cysteine added
protein variants include compounds that are able to reversibly
react with free thiols. These agents include certain heavy metals
salts or organic derivatives of zinc, mercury, and silver. Other
mercaptide forming agents or reversible thiol reactive compounds
are described by R. Cecil and J. R. McPhee (1959) and Torchinskii
(1971).
[0054] In the final step of the general method, the desired protein
is recovered and purified from the soluble cytoplasmic fraction,
the soluble periplasmic fraction or the soluble fraction of the
media. Any method for recovering and purifying proteins from the
media, cytoplasmic or periplasmic fraction can be used. Such
recovery and purification methods are known or readily determined
by those skilled in the art, including, for example,
centrifugation, filtration, dialysis, chromatography, including
size exclusion, procedures and the like. A suitable method for the
recovery and purification of a desired protein will depend, in
part, on the properties of the protein and the intended use.
[0055] The present invention further provides novel methods for
producing soluble interferon, particularly alpha interferon, that
results in a significant increase in the percent of the recovered
interferon that has been properly processed. These methods include
culturing host cells capable of expressing interferon at a pH range
of about 5 to about 6.5, and preferably about 5.5 to about 6.5.
Published reports (Voss et al. (1994)) using a higher pH only
resulted in 50% properly processed interferon, whereas the new
methods of the present invention at lower pHs recovered about
80-90%.
[0056] A discovery was made that certain of the monomeric hGH
cysteine variants formed disulfide-linked dimeric hGH proteins
during the chromatography procedures used to purify these proteins.
The disulfide-linked hGH dimers formed when cystine was removed
from the column buffers. New procedures were developed to purify
the disulfide-linked dimeric hGH proteins because the
disulfide-linked dimeric hGH proteins behaved differently than
monomeric hGH proteins during the column chromatography steps used
to purify the proteins. Unexpectedly, it was discovered that the
disulfide-linked dimeric hGH proteins were biologically active in
in vitro bioassays. Biologically active, homogeneous,
disulfide-linked dimeric hGH proteins are novel. Accordingly, the
present invention further relates to these biologically active,
homogeneous di-sulfide lined, dimeric hGH proteins as well. Higher
order multimers are also contemplated, including trimers, tetramers
and the like, as described in the examples below.
[0057] The purified proteins can then be further processed if
desired. For example, the proteins can be PEGylated at the free
cysteine site with various cysteine-reactive PEG reagents, and
subsequently purified as monoPEGylated proteins. The term
"monoPEGylated" is defined to mean a protein modified by covalent
attachment of a single PEG molecule at a specific site on the
protein. Any method known to those skilled in the art can be used,
including, for example, the methods described in the examples
below, particularly Example 11.
[0058] Braxton (1998) teaches methods for PEGylating cysteine
muteins of proteins, and in particular cysteine muteins of GH and
erythropoietin. Braxton (1998) specifically teaches that the
buffers used to PEGylate the cysteine muteins should not contain a
reducing agent. Examples of reducing agents provided by Braxton
(1998) are beta-mercaptoethanol (BME) and dithiothreitol (DTT).
When similar procedures were used to PEGylate cysteine muteins of
GH, erythropoietin and alpha interferon, it was discovered that the
cysteine muteins did not PEGylate. It has now been discovered that
treatment of the purified cysteine muteins with a reducing agent is
required for the proteins to be PEGylated. Although not wanting to
be bound by any particular theory, the inventors believe that the
reducing agent is required to reduce the mixed disulfide and expose
the free cysteine residue in the protein so that the free cysteine
can react with the PEG reagent. Thus, the present invention also
relates to methods for PEGylating cysteine muteins of GH,
erythopoietin, alpha interferon and other proteins containing 2N+1
cysteine residues, proteins containing 2N cysteine residues where
two or more of the cysteine residues are free, particularly those
muteins and proteins in which the free cysteine residue is blocked
by a mixed disulfide.
[0059] The present invention further relates to purified,
monoPEGylated protein variants produced by the methods disclosed
herein that are not only biologically active, but also retain high
specific activity in protein-dependent mammalian cell proliferation
assays. Such protein variants include, for example, the following
purified, monPEGylated cysteine muteins: hGH, EPO and alpha IFN.
For example, the in vitro biological activities of the
monoPEGylated hGH variants were 10- to 100-fold greater than the
biological activity of hGH that has been PEGylated using NHS-PEG
reagents.
[0060] In one embodiment of the monoPEGylated hGH, the polyethylene
glycol is attached to the C-D loop of hGH and the resulting
monoPEGylated hGH has an EC.sub.50 less than about 110 ng/ml (5
nM), preferably less than about 50 ng/ml (2.3 nM). Alternatively,
the polyethylene glycol moiety can be attached to a region proximal
to the Helix A of hGH and the resulting monoPEGylated hGH has an
EC.sub.50 less than about 110 ng/ml (5 nM), preferably less than 11
ng/ml (0.5 nM), and more preferably less than about 2.2 ng/ml (0.1
nM).
[0061] In one embodiment of the monoPEGylated EPO, the polyethylene
glycol is attached to the C-D loop of EPO and the resulting
monoPEGylated EPO has an EC.sub.50 less than about 1000 ng/ml (21
nM), preferably less than about 100 ng/ml (approximately 6 nM),
more preferably less than about 10 ng/ml (approximately 0.6 nM) and
most preferably less than about 1 ng/ml (approximately 0.06 nM).
Alternatively, the polyethylene glycol moiety can be attached to
the A-B loop of EPO and the resulting monoPEGylated EPO has an
EC.sub.50 less than about 100 ng/ml (approximately 5 nM),
preferably less than 20 ng/ml (approximately 1 nM), and more
preferably less than about 1 ng/ml (approximately 0.05 nM).
[0062] In one embodiment of the monoPEGylated alpha IFN, the
polyethylene glycol is attached to the region proximal to Helix A
of alpha IFN and the resulting monoPEGylated alpha IFN has an
IC.sub.50 less than about 100 .mu.g/ml (approximately 5 pM), more
preferably less than about 50 .mu.g/ml (approximately 2.5 pM) and
most preferably about 22 ng/ml (approximately 1.2 pM).
Alternatively, the polyethylene glycol moiety can be attached to
the C-D loop of IFN-.alpha.2 and the resulting monoPEGylated
IFN-.alpha.2 has an EC.sub.50 less than about 100 .mu.g/ml
(approximately 5 pM).
[0063] There are over 25 distinct IFN-.alpha. genes (Pestka et al.,
1987). Members of the IFN-.alpha. family share varying degrees of
amino acid homology and exhibit overlapping sets of biological
activities. Non-natural recombinant IFN-.alpha.s, created through
joining together regions of different IFN-.alpha. proteins are in
various stages of clinical development (Horisberger and DiMarco,
1995). A non-natural "consensus" interferon (Blatt et al., 1996),
which incorporates the most common amino acid at each position of
IFN-.alpha., also has been described. Appropriate sites for
PEGylating cysteine muteins of IFN-.alpha.2 should be directly
applicable to other members of the IFN-.alpha. gene family and to
non-natural IFN-.alpha.s. Kinstler et al., (1996) described
monoPEGylated consensus interferon in which the protein is
preferentially mono PEGylated at the N-terminal, non-natural
methionine residue. Bioactivity of the PEGylated protein was
reduced approximately 5-fold relative to non-modified consensus
interferon (Kinstler et al., 1996).
[0064] The present invention further provides protein variants that
can be covalently attached or conjugated to each other or to a
chemical group to produce higher order multimers, such as dimers,
trimers and tetramers. Such higher order multimers can be produced
according to methods known to those skilled in the art or as
described in Example 15 below. For example, such a conjugation can
produce a hGH, EPO or alpha IFN adduct having a greater molecular
weight than the corresponding native protein. Chemical groups
suitable for coupling are preferably non-toxic and non-immunogenic.
These chemical groups would include carbohydrates or polymers such
as polyols.
[0065] The "PEG moiety" useful for attaching to the cysteine
variants of the present invention to form "pegylated" proteins
include any suitable polymer, for example, a linear or branched
chained polyol. A preferred polyol is polyethylene glycol, which is
a synthetic polymer composed of ethylene oxide units. The ethylene
oxide units can vary such that PEGylated-protein variants can be
obtained with apparent molecular weights by size-exclusion
chromatography ranging from approximately 30-500,000. The size of
the PEG moiety directly impacts its circulating half-life Yamaoka
et al. (1994). Accordingly, one could engineer protein variants
with differing circulating half-lives for specific therapeutic
applications or preferred dosing regimes by varying the size or
structure of the PEG moiety. Thus, the present invention
encompasses GH protein variants having an apparent molecular weight
greater than about 30 kDa, and more preferably greater than about
70 kDa as determined by size exclusion chromatography, with an
EC.sub.50 less than about 400 ng/ml (18 nM), preferably less than
10 ng/ml (5 nM), more preferably less than about 10 ng/ml (0.5 nM),
and even more preferably less than about 2.2 ng/ml (0.1 nM). The
present invention further encompasses EPO protein variants having
an apparent molecular weight greater than about 30 kDa, and more
preferably greater than about 70 kDa as determined by size
exclusion chromatography, with an EC.sub.50 less than about 1000
ng/ml (21 nM), preferably less than 100 ng/ml (6 nM), more
preferably less than about 10 ng/ml (0.6 nM), and even more
preferably less than about 1 ng/ml (0.06 nM). The present invention
further encompasses alpha IFN (IFN-.alpha.) protein variants having
an apparent molecular weight greater than about 30 kDa, and more
preferably greater than about 70 kDa as determined by size
exclusion chromatography, with an IC.sub.50 less than about 1900
.mu.g/ml (100 pM), preferably less than 400 .mu.g/ml (21 pM), more
preferably less than 100 .mu.g/ml (5 nM), and even more preferably
less than about 38 .mu.g/ml (2 pM).
[0066] The reactive PEG end group for cysteine modification
includes but is not limited to vinylsulfone, maleimide and
iodoacetyl moieties. The PEG end group should be specific for free
thiols with the reaction occurring under conditions that are not
detrimental to the protein. Antagonist hGH variants also can be
prepared using a cysteine-added variant GH where chemical
derivatization does not interfere with receptor binding but does
prohibit the signaling process. Conditions that would benefit from
the administration of a GH antagonist include acromegaly, vascular
eye diseases, diabetic nephropathy, restenosis following
angioplasty and growth hormone responsive malignancies.
[0067] As used herein, the term "derivative" refers to any variant
of a protein expressed and recovered by the present methods. Such
variants include, but are not limited to, PEGylated versions,
dimers and other higher order variants, amino acid variants, fusion
proteins, changes in carbohydrate, phosphorylation or other
attached groups found on natural proteins, and any other variants
disclosed herein.
[0068] The compounds produced by the present methods can be used
for a variety of in vitro and in vivo uses. The proteins and their
derivatives of the present invention can be used for research,
diagnostic or therapeutic purposes that are known for their
wildtype, natural, or previously-known modified counterparts. In
vitro uses include, for example, the use of the protein for
screening, detecting and/or purifying other proteins.
[0069] For therapeutic uses, one skilled in the art can readily
determine the appropriate dose, frequency of dosing and route of
administration. Factors in making such determinations include,
without limitation, the nature of the protein to be administered,
the condition to be treated, potential patient compliance, the age
and weight of the patient, and the like. The compounds of the
present invention can also be used as delivery vehicles for
enhancement of the circulating half-life of the therapeutics that
are attached or for directing delivery to a specific target within
the body.
[0070] The following examples are not intended to be limiting, but
only exemplary of specific embodiments of the invention.
Example 1
Development of an In Vitro Bioassay for Human Growth Hormone
[0071] An hGH cell proliferation assay that uses the murine FDC-P1
cell line stably transfected with the rabbit GH receptor was
developed (Rowlinson et al., 1995). The mouse FDC-P1 cell line was
purchased from the American Type Culture Collection and routinely
propagated in RPMI 1640 media supplemented with 10% fetal calf
serum, 50 .mu.g/ml penicillin, 50 .mu.g/ml streptomycin, 2 mM
glutamine and 17-170 Units/ml mouse IL-3 (FDC-P1 media).
A. Cloning a cDNA Encoding the Rabbit GH Receptor
[0072] The rabbit GH receptor was cloned by PCR using forward
primer BB3 (5'-CCCCGGATCCGCCACCATGGATCTCTGG CAGCTGCTGTT-3')
(SEQ.ID.NO. 1) and reverse primer BB36 (5'-CCCCGTCGACTCTAGAGCCATTA
GATACAAAGCTCT TGGG-3') (SEQ.ID.NO. 2). BB3 anneals to the DNA
sequence encoding the initiator methionine and amino terminal
portion of the receptor. BB3 contains an optimized KOZAK sequence
preceding the initiator methionine and a Bam HI site for cloning
purposes. BB36 anneals to the 3' untranslated region of the rabbit
GH receptor mRNA and contains Xba I and Sal I restriction sites for
cloning purposes. Rabbit liver poly(A).sup.+mRNA (purchased from
CLONTECH, Inc.) was used as the substrate in first strand synthesis
of single-stranded cDNA to produce template for PCR amplification.
First strand synthesis of single-stranded cDNA was accomplished
using a 1st Strand cDNA Synthesis Kit for RT-PCR (AMV) from
Boehringer Mannheim Corp. Parallel first strand cDNA syntheses were
performed using random hexamers or BB36 as the primer. Subsequent
PCR reactions using the products of the first strand syntheses as
templates were carried out with primers BB3 and BB36. The expected
.about.1.9 kb PCR product was observed in PCR reactions using
random hexamer-primed or BB36-primed cDNA as template. The random
hexamer-primed cDNA was digested with Bam HI and Xba I, which
generates two fragments (.about.365 bp and .about.1600 bp) because
the rabbit GH receptor gene contains an internal Bam HI site. Both
fragments were gel-purified. The full-length rabbit GH receptor
cDNA was then cloned in two steps. First the .about.1600 bp Bam
HI-Xba I fragment was cloned into pCDNA3.1(+) (Invitrogen
Corporation) that had been digested with these same two enzymes.
These clones were readily obtained at reasonable frequencies and
showed no evidence of deletions as determined by restriction
digests and subsequent sequencing. To complete the rabbit receptor
cDNA clone, one of the sequenced plasmids containing the 1600 bp
Bam HI-Xba I fragment was digested with Bam HI, treated with calf
alkaline phosphatase, gel-purified and ligated with the
gel-purified .about.365 bp Bam HI fragment that contains the 5'
portion of the rabbit GH receptor gene. Transformants from this
ligation were picked and analyzed by restriction digestion and PCR
to confirm the presence of the .about.365 bp fragment and to
determine its orientation relative to the distal segment of the
rabbit GH receptor gene. The sequence for one full length clone was
then verified. This plasmid, designated pBBT118, was used to stably
transfect FDC-P1 cells.
B. Selection of Stably Transfected FDC-P1 Cells Expressing the
Rabbit GH Receptor
[0073] Endotoxin-free pBBT118 DNA was prepared using a Qiagen
"Endo-Free Plasmid Purification Kit" and used to transfect FDC-P1
cells. Mouse IL-3 was purchased from R&D Systems. FDC-P1 cells
were transfected with plasmid pBBT118 using DMRIE-C cationized
lipid reagent purchased from GIBCO, following the manufacturer's
recommended directions. Briefly, 4 .mu.g of plasmid DNA were
complexed with 4-30 .mu.l of the DMRIE-C reagent in 1 ml of OptiMEM
media (GIBCO) for 45 minutes in six well tissue culture dishes.
Following complex formation, 2.times.10.sup.6 FDC-P1 cells in 200
.mu.l of OptiMEM media supplemented with mouse IL-3 were added to
each well and the mixture left for 4 h at 37.degree. C. The final
mouse IL-3 concentration was 17 Units/ml. Two ml of FDC-P1 media
containing 15% fetal bovine serum were added to each well and the
cells left overnight at 37.degree. C. The next day transfected
cells were transferred to T-75 tissue culture flasks containing 15
ml FDC-P1 media supplemented with IL-3 (17 U/ml), hGH (5 nM) and
10% horse serum rather than fetal calf serum. Horse serum was used
because of reports that fetal calf serum contains a
growth-promoting activity for FDC-P1 cells. Three days later the
cells were centrifuged and resuspended in fresh FDC-P1 media
containing 400 .quadrature.g/ml G418, 17 U/ml IL-3, 5 nM hGH, 10%
horse serum and incubated at 37.degree. C. Media was changed every
few days. The cells from each transfection were split into T-75
tissue culture flasks containing fresh media and either mouse IL-3
(17 U/ml) or hGH (5 nM). G418 resistant cells were obtained from
both the IL-3- and hGH-containing flasks. The transformants used in
the bioassays originated from flasks containing hGH. Twelve
independent cell lines were selected by limiting dilution. Five of
the cell lines (GH-R3, -R4, -R5, -R6 and -R9) showed a good
proliferative response to hGH. Preliminary experiments indicated
that the EC.sub.50 for hGH was similar for each cell line, although
the magnitude of the growth response varied depending upon the
line. The GH-R4 cell line was studied in most detail and was used
for the assays presented below. The cell lines were routinely
propagated in RPMI 1640 media containing 10% horse serum, 50
Units/ml penicillin, 50 .mu.g/ml streptomycin, 2 mM glutamine, 400
.mu.g/ml G418 and 2-5 nM pituitary hGH or rhGH.
C. Development of an hGH Bioassay Using FDC-P1 Expressing the
Rabbit GH Receptor
[0074] A modified version of the MTT cell proliferation assay
described by Rowlinson et al. (1995) was developed to measure hGH
bioactivity. Our assay measures uptake and reduction of the dye
MTS, which creates a soluble product, rather than MTT, which
creates an insoluble product that must be solubilized with organic
solvents. The advantage of using MTS is that absorbance of the
wells can be determined without the need to lyse the cells with
organic solvents.
[0075] GH-R4 cells were washed three times with phenol red-free
RPMI 1640 media and suspended in assay media (phenol red-free RPMI
1640, 10% horse serum, 50 Units/ml penicillin, 50 .mu.g/ml
streptomycin, 400 .mu.g/ml G418) at a concentration of
1.times.10.sup.5 cells/ml. Fifty microliters of the cell suspension
(5.times.10.sup.3 cells) were added to wells of a 96 well flat
bottomed tissue culture plate. Serial three-fold dilutions of
protein samples were prepared in assay media and added to
microtiter wells in a volume of 50 .mu.l, yielding a final volume
of 100 .mu.l per well. Protein samples were assayed in triplicate
wells. Plates were incubated at 37.degree. C. in a humidified 5%
CO.sub.2 tissue culture incubator for 66-72 h, at which time 20
.mu.l of an MTS/PES (PES is an electron coupler) reagent mixture
(CellTiter 96 Aqueous One solution reagent, Promega Corporation)
was added to each well. Absorbance of the wells at 490 nm was
measured 2-4 h later. Absorbance value means+/-standard deviations
for the triplicate wells were calculated. Control wells contained
media but no cells. Absorbance values for the control wells
(typically 0.06-0.2 absorbance units) were subtracted from the
absorbance values for the sample wells. Control experiments
demonstrated that absorbance signals correlated with cell number up
to absorbance values of 2. All assays included a human pituitary GH
standard. Experiments utilizing the parental FDC-P1 cell line were
performed as described above except that the assay media did not
contain G418 and fetal calf serum was substituted for horse
serum.
Example 2
Cloning and Expression of rhGH
[0076] A. Cloning a cDNA Encoding Human Growth Hormone (GH)
[0077] A human GH cDNA was amplified from human pituitary
single-stranded cDNA (commercially available from CLONTECH, Inc.,
Palo Alto, Calif.) using the polymerase chain reaction (PCR)
technique and primers BB1 and BB2. The sequence of BB1 is
(5'-GGGGGTCGACCATATGTTCCCAACCATTCCCTTATCCAG-3')(SEQ.ID.NO. 3). The
sequence of BB2 is
(5'-GGGGGATCCTCACTAGAAGCCACAGCTGCCCTC-3')(SEQ.ID.NO. 4). Primer BB1
was designed to encode an initiator methionine preceding the first
amino acid of mature GH, phenylalalanine, and Sal I and Nde I sites
for cloning purposes. The reverse primer, BB2, contains a Bam HI
site for cloning purposes. The PCR reactions contained 20 pmoles of
each oligo primer, 1.times.PCR buffer (Perkin-Elmer buffer
containing MgCl.sub.2), 200 .mu.M concentration of each of the four
nucleotides dA, dC, dG and dT, 2 ng of single-stranded cDNA, 2.5
units of Taq polymerase (Perkin-Elmer) and 2.5 units of Pfu
polymerase (Stratagene, Inc). The PCR reaction conditions were:
96.degree. C. for 3 minutes, 35 cycles of (95.degree. C., 1 minute;
63.degree. C. for 30 seconds; 72.degree. C. for 1 minute), followed
by 10 minutes at 72.degree. C. The thermocycler employed was the
Amplitron II Thermal Cycler (Thermolyne) The approximate 600 bp PCR
product was digested with Sal I and Bam HI, gel-purified and cloned
into similarly digested plasmid pUC19 (commercially available from
New England BioLabs, Beverly, Mass.). The ligation mixture was
transformed into E. coli strain DH5alpha and transformants selected
on LB plates containing ampicillin. Several colonies were grown
overnight in LB media and plasmid DNA isolated using miniplasmid
DNA isolation kits purchased from Qiagen, Inc (Valencia, Calif.).
Clone LB6 was determined to have the correct DNA sequence.
[0078] For expression in E. coli, clone LB6 was digested with Nde I
and Eco RI, the approximate 600 bp fragment gel-purified, and
cloned into plasmid pCYB1 (commercially available from New England
Biolabs, Beverly, Mass.) that had been digested with the same
enzymes and treated with calf alkaline phosphatase. The ligation
mixture was transformed into E. coli DH5alpha and transformants
selected on LB ampicillin plates. Plasmid DNA was isolated from
several transformants and screened by digestion with Nde I and Eco
RI. A correct clone was identified and named pCYB1: wtGH (pBBT120).
This plasmid was transformed into E. coli strains JM109 or W3110
(available from New England BioLabs and the American Type Culture
Collection).
B. Construction of stII-GH
[0079] Wild type GH clone LB6 (pUC19: wild type GH) was used as the
template to construct a GH clone containing the E. coli stII signal
sequence. Because of its length, the stII sequence was added in two
sequential PCR reactions. The first reaction used forward primer
BB12 and reverse primer BB10. BB10 has the sequence (5'
CGCGGATCCGATTAGAATCCACAGCTCCCCTC 3')(SEQ.ID.NO. 5). BB12 has the
sequence (5'-GCATCTATGTTCGTTTTCTCTATCGCTACCAACGCTTACGCA
TTCCCAACCATTCCCTTATCCAG-3')(SEQ.ID.NO. 6). The PCR reactions were
as described for amplifying wild type GH. The approximate 630 bp
PCR product was gel-purified using the Qiaex II Gel Extraction Kit
(Qiagen, Inc), diluted 50-fold in water and 2 .quadrature.l used as
template for the second PCR reaction. The second PCR reaction used
reverse primer BB10 and forward primer BB11. BB11 has the sequence
(5'CCCCCTCTAGACATATGAAGAAGAACATCGCATTCCTGCTGGCATCT
ATGTTCGTTTTCTCTATCG-3')(SEQ.ID.NO. 7). Primer BB11 contains XbaI
and NdeI sites for cloning purposes. PCR conditions were as
described for the first reaction. The approximate 660 bp PCR
product was digested with XbaI and BamHI, gel-purified and cloned
into similarly cut plasmid pCDNA3.1(+) (Invitrogen, Inc. Carlsbad,
Calif.). Clone pCDNA3.1(+)::stII-GH(5C) or "5C" was determined to
have the correct DNA sequence.
[0080] Clone "5C" was cleaved with NdeI and BamHI and cloned into
similarly cut pBBT108 (a derivative of pUC19 which lacks a Pst I
site, this plasmid is described below). A clone with the correct
insert was identified following digestion with these enzymes. This
clone, designated pBBT111, was digested with Nde I and Sal I, the
660 bp fragment containing the stII-GH fusion gene, was
gel-purified and cloned into the plasmid expression vector pCYB1
(New England BioLabs) that had been digested with the same enzymes
and treated with calf alkaline phosphatase. A recombinant plasmid
containing the stII-GH insertion was identified by restriction
endonuclease digestions. One such isolate was chosen for further
studies and was designated pBBT114. This plasmid was transformed
into E. coli strains JM109 or W3110 (available from New England
BioLabs and the American Type Culture Collection).
C. Construction of ompA-GH
[0081] Wild type GH clone LB6 (pUC19: wild type GH) was used as the
template to construct a GH clone containing the E. coli ompA signal
sequence. Because of its length, the ompA sequence was added in two
sequential PCR reactions. The first reaction used forward primer
BB7 (5'GCAGTGGC
ACTGGCTGGTTTCGCTACCGTAGCGCAGGCCTTCCCAACCATTCCCTTATCCAG
3')(SEQ.ID.NO. 8) and reverse primer BB10: (5' CGCGGATCCGATTAGAATCC
ACAGCTCCCCTC 3')(SEQ.ID.NO. 5). The PCR reactions were as described
for amplifying wild type GH except that approximately 4 ng of
plasmid LB6 was used as the template rather than single-stranded
cDNA and the PCR conditions were 96.degree. C. for 3 minutes, 30
cycles of (95.degree. C. for 1 minute; 63.degree. C. for 30
seconds; 72.degree. C. for 1 minute) followed by 72.degree. C. for
10 minutes. The approximate 630 bp PCR product was gel-purified
using the Qiaex II Gel Extraction Kit (Qiagen, Inc), diluted
50-fold in water and 2 .quadrature.l used as template for the
second PCR reaction. The second PCR reaction used reverse primer
BB10 and forward primer BB6: (5'CCCCG
TCGACACATATGAAGAAGACAGCTATCGCGATTGCAGT GGCACTGGCTGGTTTC
3')(SEQ.ID.NO. 9). PCR conditions were as described for the first
reaction. The approximate 660 bp PCR product was gel-purified,
digested with Sal I and Bam H1 and cloned into pUC19 (New England
BioLabs) which was cut with Sal I and Bam H1 or pCDNA3.1(+)
(Invitrogen) which had been cut by Xho I and Bam H1 (Sal I and Xho
I produce compatible single-stranded overhangs). When several
clones were sequenced, it was discovered that all pUC19 (8/8)
clones contained errors in the region of the ompA sequence. Only
one pCDNA3.1(+) clone was sequenced and it contained a sequence
ambiguity in the ompA region. In order to generate a correct
ompA-GH fusion, gene segments of two sequenced clones, which
contained different errors separated by a convenient restriction
site were recombined and cloned into the pUC19-derivative that
lacks the Pst I site (see pBBT108 described below). The resulting
plasmid, termed pBBT112, carries the ompA-GH fusion gene cloned as
an Nde I-Bam H1 fragment into these same sites in pBBT108. This
plasmid is designated pBBT112 and is used in PCR-based,
site-specific mutagenesis of GH as described below.
D. Construction of Pst I.sup.-pUC19 (pBBT 108)
[0082] To facilitate mutagenesis of the cloned GH gene for
construction of selected cysteine substitution and insertion
mutations, a derivative of the plasmid pUC19 (New England BioLabs)
lacking a Pst I site was constructed as follows. pUC19 plasmid DNA
was digested with Pst I and subsequently treated at 75.degree. C.
with Pfu DNA Polymerase (Stratagene) using the vendor-supplied
reaction buffer supplemented with 200 .quadrature.M dNTPs. Under
these conditions the polymerase will digest the 3' single-stranded
overhang created by Pst I digestion but will not digest into the
double-stranded region and the net result will be the deletion of
the 4 single-stranded bases which comprise the middle four bases of
the Pst I recognition site. The resulting molecule has
double-stranded, i.e. "blunt", ends. Following these enzymatic
reactions the linear monomer was gel-purified using the Qiaex II
Gel Extraction Kit (Qiagen, Inc). This purified DNA was treated
with T4 DNA Ligase (New England BioLabs) according to the vendor
protocols, digested with Pst I, and used to transform E. coli
DH5alpha. Transformants were picked and analyzed by restriction
digestion with Pst I and Bam H1. One of the transformants which was
not cleaved by Pst I but was cleaved at the nearby Bam H1 site was
picked and designated pBBT108.
E. Expression of Met-hGH and stII-hGH in E. coli
[0083] pBBT120, which encodes met-hGH, and pBBT114, which encodes
stII-hGH were transformed into E. coli strain W3110. The parental
vector pCYB1 also was transformed into W3110. The resulting strains
were given the following designations: [0084] BOB130: W3110
(pCYB1)=vector only [0085] BOB133: W3110 (pBBT120)=met-hGH [0086]
BOB132: W3110 (pBBT114)=stII-hGH
[0087] These strains were grown overnight at 37.degree. C. in Luria
Broth (LB) containing 100 .mu.g/ml ampicillin. The saturated
overnight cultures were diluted to .about.0.025 O.D.s at A.sub.600
in LB containing 100 .mu.g/ml ampicillin and incubated at
37.degree. C. in shake flasks. When culture O.D.s reached
.about.0.25-0.5, IPTG was added to a final concentration of 0.5 mM
to induce expression of the recombinant proteins. For initial
experiments, cultures were sampled at 0, 1, 3, 5 and .about.16 h
post-induction. Samples of induced and uninduced cultures were
pelleted and resuspended in SDS-PAGE sample buffer with the
addition of 1% .beta.-mercaptoethanol (BME) when desirable. Samples
were electrophoresed on precast 14% Tris-glycine polyacrylamide
gels. Gels were stained with Coomassie Blue or were analyzed by
Western blotting.
[0088] Coomassie staining of whole cell lysates from strains
BOB133, expressing met-hGH, and BOB132, expressing stII-hGH, showed
a band of .about.22 kDa that co-migrated with a purified rhGH
standard purchased from Research Diagnostics Inc. The rhGH band was
most prominent in induced cultures following overnight induction.
Western blots using a polyclonal rabbit anti-hGH antiserum
purchased from United States Biological, Inc. confirmed the
presence of rhGH in lysates of induced cultures of BOB132 and
BOB133 at both 3 and 16 h post-induction. No rhGH was detected by
Western Blotting of induced cultures of the control strain BOB130
(vector only) at 3 or 16 h post-induction.
[0089] An induced culture of BOB132 (expressing stII-hGH) was
prepared as described above and subjected to osmotic shock based on
the analytical procedure of Koshland and Botstein (1980). This
procedure ruptures the E. coli outer membrane and releases the
contents of the periplasm into the surrounding medium. Subsequent
centrifugation separates the soluble periplasmic components
(recovered in the supernatant) from cytoplasmic, insoluble
periplasmic, and cell-associated components (recovered in the
pellet). Specifically, E. coli strain W3110 containing the st-II
hGH plasmid was grown at 37.degree. C. overnight in LB containing
100 .mu.g/ml ampicillin. The saturated overnight culture was
diluted to 0.03 O.D. at A.sub.600 in 25 ml of LB containing 100
.mu.g/ml ampicillin and incubated at 37.degree. C. in a 250 ml
shake flask. When the culture O.D. reached approximately 0.4, 100
mM IPTG was added for a final concentration of 0.5 mM to induce
expression of the recombinant protein. The induced culture was then
incubated at 37.degree. C. overnight (.about.16 h). The induced
overnight culture reached an O.D. of 3.3 at A.sub.600 and 4 O.D.s
(1.2 ml) was centrifuged in a Eppendorf model 5415C microfuge at
14,000 rpm for 5 minutes at 4.degree. C. The cell pellet was
resuspended to approximately 10 O.D. in ice cold 20% sucrose, 10 mM
Tris-HCl pH 8.0 by trituration and vortexing and EDTA pH 8.0 was
added for a final concentration of 17 mM. Resuspended cells were
incubated on ice for 10 minutes and centrifuged as above. The
resultant pellet was resuspended at 10 O.D.s in ice cold water by
trituration and vortexing and incubated on ice for 10 minutes. The
resuspended cells were then centrifuged as above and the resultant
supernatant (soluble periplasmic fraction) and cell pellet
(insoluble periplasmic and cell associated components) were
analyzed by SDS-PAGE.
[0090] The bulk of the rhGH synthesized by BOB132 was found to be
soluble and localized to the periplasm. The periplasmic rhGH
protein was indistinguishable in size from a purified pituitary hGH
standard indicating that the stII signal sequence was removed
during protein secretion.
Example 3
Purification and Bioactivity of rhGH
[0091] A. Purification of Wild-Type rhGH
[0092] In order to purify a significant quantity of wild-type rhGH,
a 330 ml culture of BOB132 (expressing stII-hGH) was induced,
cultured overnight and subjected to osmotic shock based on the
preparative procedure described by Hsiung et al. (1986).
Specifically, E. coli strain W3110 containing the st-II hGH plasmid
was grown at 37.degree. C. overnight in LB containing 100 .mu.g/ml
ampicillin. The saturated overnight culture was diluted to 0.03
O.D. at A.sub.600 in 2.times.250 ml (500 ml total volume) of LB
containing 100 .mu.g/ml ampicillin and incubated at 37.degree. C.
in 2 L shake flasks. When the culture's O.D. reached approximately
0.4, 100 mM IPTG was added for a final concentration of 0.5 mM to
induce expression of the recombinant protein. The induced culture
was incubated at 37.degree. C. overnight (.about.16 h). The induced
overnight cultures reached an O.D. of approximately 3.8 at
A.sub.600 and were centrifuged using a Sorval RC-5 centrifuge and a
GSA rotor at 8,000 rpm for 5 minutes at 4.degree. C. The cell
pellets were combined and resuspended to approximately 47 O.D. in
ice cold 20% sucrose, 10 mM Tris-HCl pH 8.0 by trituration and EDTA
pH 8.0 was added for a final concentration of .about.25 mM.
Resuspended cells were incubated on ice for 10 minutes and
centrifuged in an IEC Centra MP4R centrifuge with an 854 rotor at
8,500 rpm for 7 minutes at 4.degree. C. The resultant pellets were
resuspended at 47 O.D. in ice cold water by trituration and
vortexing and incubated on ice for 30 minutes. The resuspended
cells were centrifuged in the IEC centrifuge as above and the
resultant supernatant (soluble periplasmic fraction) and cell
pellet (insoluble periplasmic and cell associated components) were
analyzed by SDS-PAGE. Again the gel showed that rhGH produced was
soluble, periplasmic, and indistinguishable in size from the
pitutary hGH standard.
[0093] rhGH was purified in a two step procedure based on that
described by Becker and Hsiung (1986). The supernatant from the
osmotic shock was loaded onto a 5 ml Pharmacia HiTrap Q Sepharose
column equilibrated in 10 mM Tris-HCl pH 8.0 and the bound proteins
were eluted with a 15 column volume 50-250 mM linear NaCl gradient.
Column fractions were analyzed by SDS-PAGE. Fractions 22-25 eluting
at a salt concentration of around 100-125 mM were enriched for hGH,
and were pooled, concentrated and further fractionated on a
Superdex 200 HR 10/30 sizing column. Fractions 34-36 from the
Superdex column (representing MWs around 21-22 kDA based on the
elution profile of MW standards) contained most of the rhGH, were
pooled and stored as frozen aliquots at -80.degree. C. The final
yield of rhGH, as determined by absorbance at 280 nm and by using a
Bradford protein assay kit (Bio-Rad Laboratories), was about 2 mg.
Non-reduced pituitary hGH migrates with a slightly smaller apparent
molecular weight than reduced pituitary hGH when analyzed by
SDS-PAGE. This molecular weight change is indicative of proper
disulfide bond formation. Our purified rhGH co-migrated with
pituitary hGH under both reducing and non-reducing conditions
indicating that the rhGH was properly folded and disulfide-bonded.
Data presented below indicates that the biological activity of rhGH
is indistinguishable from that of pituitary hGH.
B. Bioassay Results for Pituitary hGH and rhGH
[0094] The parental FDC-P1 cell line shows a strong proliferative
response to mouse IL-3, but not to pituitary hGH. In the absence of
IL-3, the majority of FDC-P1 cells die, giving absorbance values
less than 0.2. In contrast, FDC-P1cells transformed with the rabbit
growth hormone receptor proliferate in response to pituitary hGH,
as evidenced by a dose-dependent increase in cell number and
absorbance values. The EC.sub.50 (protein concentration required to
achieve half-maximal stimulation) for this effect ranged from
0.75-1.2 ng/ml pituitary hGH (0.03-0.05 nM) in different
experiments, similar to what has been reported in the literature
(Rowlinson et al., 1995). A significant difference between the
parental FDC-P1 line and FDC-P1 cells transformed with the rabbit
growth hormone receptor is that the latter cells survive in the
absence of IL-3 or hGH, resulting in higher absorbance values
(typically 0.6-1.1, depending upon the assay and length of
incubation with MTS in the zero growth factor control wells). The
initial pool of rabbit growth hormone receptor transformants and
all five independent growth hormone receptor cell lines isolated
showed the same effect. A similar result was obtained with a second
set of independently isolated rabbit growth hormone receptor
transfectants. Rowlinson et al. (1995) observed a similar effect,
suggesting that IL-3/GH-independent survival is a consequence of
the transformation procedure. Although the growth hormone receptor
cell lines did not require IL-3 or hGH for growth, they still
showed a robust proliferative response to IL-3 and hGH. The
practical effect of the higher absorbance values in the absence of
hGH is to decrease the "window" of the hGH response (the difference
between the maximum and minimum absorbance values). This window
consistently ranged from 40-70% of the zero growth factor values,
similar to what was reported by Rowlinson et al.(1995).
[0095] Pituitary GH and wild-type rhGH prepared by us had similar
dose response curves in the bioassay with EC.sub.50s ranging from
0.6-1.2 ng/ml in different experiments (Table 1).
TABLE-US-00001 TABLE 1 Bioactivities of hGH and hGH Cysteine
Muteins Form Mean EC.sub.50 EC.sub.50 Range Assayed (ng/ml) (ng/ml)
.sup.1 Pituitary Monomer 1 +/- 0.1 (N = 11) 0.75-1.2 hGH RhGH
Monomer 0.8 +/- 0.3 (N = 3) 0.6, 0.8, 1.1 T3C Dimer 1.4 +/- 0.6 (N
= 7) 0.75-2.5 S144C Monomer 1.6 +/- 0.8 (N = 5) 1.1, 1.1, 1.5, 2.2,
2.7 T148C-lotA Monomer 0.5 (N = 2) 0.4, 0.5 T148C-lotB Monomer 2.5
+/- 1.0 (N = 4) 1.5, 1.9, 3.1, 3.6 N/A, not applicable .sup.1
EC.sub.50 values from individual experiments. An EC.sub.50 range is
shown when N > 5.
Example 4
Construction of hGH Cysteine Muteins
[0096] The cysteine substitution mutation T135C was constructed as
follows. The mutagenic reverse oligonucleotide BB28
(5>CTGCTTGAAGATCTGCCCACACCG GGGG CTGCCATC>3)(SEQ.ID.NO. 10)
was designed to change the codon ACT for threonine at amino acid
residue 135 to a TGT codon encoding cysteine and to span the nearby
Bgl II site. This oligo was used in PCR along with BB34
(5>GTAGCGCAGGCCTTCCCAACC ATT>3)(SEQ.ID.NO. 11) which anneals
to the junction region of the ompA-GH fusion gene and is not
mutagenic. The PCR was performed in a 50 .mu.l reaction in
1.times.PCR buffer (Perkin-Elmer buffer containing 1.5 mM
MgCl.sub.2), 200 .mu.M concentration of each of the four
nucleotides dA, dC, dG and dT, with each oligonucleotide primer
present at 0.5 .mu.M, 5 pg of pBBT112 (described above) as template
and 1.25 units of AmpliTaq DNA Polymerase (Perkin-Elmer) and 0.125
units of Pfu DNA Polymerase (Stratagene). Reactions were performed
in a Robocycler Gradient 96 thermal cycler (Stratagene). The
program used entailed: 95.degree. C. for 3 minutes followed by 25
cycles of [95.degree. C. for 60 seconds, 45.degree. C. or
50.degree. C. or 55.degree. C. for 75 seconds, 72.degree. C. for 60
seconds] followed by a hold at 6.degree. C. The PCR reactions were
analyzed by agarose gel electrophoresis which showed that all three
different annealing temperatures gave significant product of the
expected size; .about.430 bp. The 45.degree. C. reaction was
"cleaned up" using the QIAquick PCR Purification Kit (Qiagen) and
digested with Bgl II and Pst I. The resulting 278 bp Bgl II-Pst I
fragment, which includes the putative T135C mutation, was
gel-purified and ligated into pBBT111, the pUC19 derivative
carrying the stII-GH fusion gene (described above) which had been
digested with Bgl II and Pst I and gel-purified. Transformants from
this ligation were initially screened by digestion with Bgl II and
Pst I and subsequently one clone was sequenced to confirm the
presence of the T135C mutation and the absence of any additional
mutations that could potentially be introduced by the PCR reaction
or by the synthetic oligonucleotides. The sequenced clone was found
to have the correct sequence throughout the Bgl II-Pst I
segment.
[0097] The substitution mutation S132C was constructed using the
protocol described above for T135C with the following differences:
mutagenic reverse olignucleotide BB29 (5>CTGCTTGAA
GATCTGCCCAGTCCGGGGGCAGCCATCTTC>3)(SEQ.ID.NO. 12) was used
instead of BB28 and the PCR reaction with annealing temperature of
50.degree. C. was used for cloning. One of two clones sequenced was
found to have the correct sequence.
[0098] The substitution mutation T148C was constructed using an
analogous protocol but employing a different cloning strategy. The
mutagenic forward oligonucleotide BB30 (5>GGGCAGATCTT
CAAGCAGACCTACAGCAAGTTCGACTGCAACTCACACAAC>3)(SEQ.ID.NO. 13) was
used in PCR with the non-mutagenic reverse primer BB33
(5>CGCGGTACCCGGGATCCGATTAGAAT CCACAGCT>3)(SEQ.ID.NO. 14)
which anneals to the most 3' end of the GH coding sequence and
spans the Bam H1 site immediately downstream. PCR was performed as
described above with the exception that the annealing temperatures
used were 46, 51 and 56.degree. C. Following PCR and gel analysis
as described above the 46 and 51.degree. C. reactions were pooled
for cloning. These were digested with Bam H1 and Bgl II and the
resulting 188 bp fragment was gel-purified and cloned into pBBT111
which had been digested with Bam H1 and Bgl II, treated with calf
alkaline phosphatase (Promega) according to the vendor protocols,
and gel-purified. Tranformants from this ligation were analyzed by
digestion with Bam H1 and Bgl II to identify clones in which the
188 bp Bam H1-Bgl II mutagenic PCR fragment was cloned in the
proper orientation: because Bam H1 and Bgl II generate compatible
ends, this cloning step is not orientation specific. Five of six
clones tested were shown to be correctly oriented. One of these was
sequenced and was shown to contain the desired T148C mutation. The
sequence of the remainder of the 188 bp Bam H1-Bgl II mutagenic PCR
fragment in this clone was confirmed as correct.
[0099] The construction of the substitution mutation S144C was
identical to the construction of T148C with the following
exceptions. Mutagenic forward oligonucleotide BB31 (5>GGGCAGATCT
TCAAGCAGACCTACTGCAAGTTCGAC>3)(SEQ.ID.NO. 15) was used instead of
BB30. Two of six clones tested were shown to be correctly oriented.
One of these was sequenced and was shown to contain the desired
S144C mutation. The sequence of the remainder of the 188 bp Bam
H1-Bgl II mutagenic PCR fragment in this clone was also confirmed
as correct.
[0100] A mutation was also constructed that added a cysteine
residue to the natural carboxyterminus of GH. The construction of
this mutation, termed stp192C, was carried out using the procedures
described above for construction of the T148C mutein but employed
different oligonucleotide primers. The mutagenic reverse
oligonucleotide BB32 (5>CGCGGTACCGGATCCTTAGCAGAAGCCACAG
CTGCCCTCCAC>3)(SEQ.ID.NO. 16) which inserts a TGC codon for
cysteine between the codon for the carboxy terminal phe residue of
GH and the TAA translational stop codon and spans the nearby Bam H1
site was used along with BB34 which is described above. Following
PCR and gel analysis as described above the 46.degree. C. reaction
was used for cloning. Three of six clones tested were shown to be
correctly oriented. One of these was sequenced and was shown to
contain the desired stp192C mutation. The sequence of the remainder
of the 188 bp Bam H1-Bgl II mutagenic PCR fragment in this clone
was confirmed as correct.
[0101] The substitution mutation S100C was constructed using
mutagenic reverse oligonucleotide BB25
(5>GTCAGAGGCGCCGTACACCAGGCAGTTGGCGAAGAC>3)(SEQ.ID.NO. 17)
which alters the AGC codon for serine at amino acid residue 100 to
a TGC codon encoding cysteine. BB25 also spans the nearby Nar I
site. PCR reactions using BB25 and BB34 were carried out using the
PCR protocol described above for the construction of the T135C
mutation. Following gel analysis of the PCR products, the product
of the 50.degree. C. annealing reaction was cleaned up using the
QIAquick PCR Purification Kit (Qiagen), with digested with Pst I
and Nar I. The resulting 178 bp fragment was gel-purified and
ligated into pBBT111 which had been digested with Pst I and Nar I
and gel-purified. Plasmids isolated from transformants from this
ligation were screened by digestion with Pst I and Nar I and
subsequently one plasmid was sequenced to confirm the presence of
the S100C mutation and the absence of any other mutations in the
178 bp Pst I-Nar I segment.
[0102] The substitution mutation A98C was constructed using the
procedure described above for S100C with the following differences:
the mutagenic reverse oligonucleotide BB26 (5>GTCAG
AGGCGCCGTACACCAGGCTGTTGCAGAAGACACTCCT>3)(SEQ.ID.NO. 18) was used
for PCR in place of BB25 and the PCR reaction performed with an
annealing temperature of 45.degree. C. was used for cloning. One
clone was sequenced and found to have the correct sequence.
[0103] The substitution mutation A34C was constructed as follows.
The mutagenic reverse oligo BB23
(5>GCGCTGCAGGAATGAATACTTCTGTTCCTTTGGGATATAGCATTCTTC
AAACTC>3)(SEQ.ID.NO. 19) was designed to change the GCC codon
for alanine at amino acid residue 34 to a TGC codon encoding
cysteine and to span the Pst I site. This oligonucleotide was used
in PCR reactions along with BB11 (5>CCCCCTCTAGACAT
ATGAAGAAGAACATCGC
ATTCCTGCTGGCATCTATGTTCGTTTTCTCTATCG>3)(SEQ.ID.NO. 20) which
anneals to the 5' end of the coding sequence of the stII leader
sequence and spans the Nde I site that overlaps the initiator
methionine codon.
[0104] PCR reactions were performed in 50 .quadrature.l in
1.times.PCR buffer (Promega) containing 1.5 mM MgCl.sub.2, 200
.mu.M concentration of each of the four nucleotides dA, dC, dG and
dT, with each oligonucleotide primer present at 0.2 .quadrature.M,
1 ng of pBBT111 (described above) as template and 0.8 units of Tac
DNA Polymerase (Promega) and 0.33 units of Pfu DNA Polymerase
(Stratagene). Reactions were performed in a Robocycler Gradient 96
thermal cycler (Stratagene). The program used entailed: 96.degree.
C. for 3 minutes followed by 25 cycles of [95.degree. C. for 60
seconds, 50.degree. C. or 55.degree. C. or 60.degree. C. for 75
seconds, 72.degree. C. for 60 seconds] followed by a hold at
6.degree. C. The PCR reactions were analyzed by agaraose gel
electrophoresis which showed that all three different annealing
temperatures gave significant product of the expected size;
.about.220 bp. The 50 and 55.degree. C. reactions were pooled,
"cleaned up" using the QIAquick PCR Purification Kit (Qiagen) and
digested with Nde I and Pst I. The resulting 207 bp Nde I-Pst I
fragment, which includes the putative A34C mutation, was
gel-purified and ligated into pBBT111, which had been digested with
Nde I and Pst I, treated with alkaline phosphatase, and
gel-purified. Transformants from this ligation were initially
screened by digestion with Nde I and Pst I and subsequently one
clone was sequenced to confirm the presence of the A34C mutation
and the absence of any additional mutations that could potentially
be introduced by the PCR reaction or by the synthetic
oligonucleotides. The sequenced clone was found to have the correct
sequence throughout the Nde I-Pst I segment.
[0105] The substitution mutation S43C was constructed using the
protocol described above for A34C with the following differences:
mutagenic reverse oligonucleotide BB24 (5>GCGCTG
CAGGAAGCAATACTTCTGTTCCTTTGG>3)(SEQ.ID.NO. 21) was used instead
of BB23. One clone was sequenced and shown to contain the correct
sequence.
[0106] The substitution mutation T3C was constructed using two
sequential PCR steps. The first step created the desired mutation
while the second step extended the PCR product of the first
reaction to encompass a useful cloning site. The mutagenic forward
oligonucleotide BB78 (5>GCAT CTATGTTCGTTTTCTCTATCGCTACCAACGCT
TACGCATTCCCATGCATTCCCT TATCCAG>3)(SEQ.ID.NO. 22) was designed to
change the ACC codon for threonine at amino acid residue 3 to a TGC
codon encoding cysteine and to span and anneal to the junction of
the stII-hGH fusion gene. BB78 was used in the first step PCR along
with BB33 which is described above.
[0107] The first PCR reaction was performed in 50 .mu.l in
1.times.PCR buffer (Promega) containing 1.5 mM MgCl.sub.2, 200
.mu.M concentration of each of the four nucleotides dA, dC, dG and
dT, each oligonucleotide primer at 0.2 .mu.M, 1 ng of pBBT111
(described above) as template and 1.5 units of Tac DNA Polymerase
(Promega) and 0.25 units of Pfu DNA Polymerase (Stratagene).
Reactions were performed in a Robocycler Gradient 96 thermal cycler
(Stratagene). The program used entailed: 96.degree. C. for 3
minutes followed by 25 cycles of [94.degree. C. for 60 seconds,
60.degree. C. for 75 seconds, 72.degree. C. for 60 seconds]
followed by a hold at 6.degree. C. The PCR reaction was ethanol
precipitated and the .about.630 bp product was gel-purified and
recovered in 20 .mu.l 10 mM Tris-HCl (pH 8.5). An aliquot of this
gel-purified fragment was diluted 100-fold and 2 .mu.l of the
diluted fragment was used as template in the second PCR step. The
second PCR step employed oligonucleotides BB11 and BB33 (both
described above) and used the reaction conditions employed in the
first step PCR reaction. The second step PCR reaction was analyzed
by agarose gel electrophoresis and the expected .about.670 bp
fragment was observed. The PCR reaction was "cleaned up" using the
QIAquick PCR Purification Kit (Qiagen) and digested with Nde I and
Pst I. The resulting 207 bp Nde I-Pst I fragment, which includes
the putative T3C mutation, was gel-purified and ligated into
pBBT111, which had been digested with Nde I and Pst I, treated with
alkaline phosphatase, and gel-purified. Transformants from this
ligation were initially screened by digestion with Nde I and Pst I
and subsequently one clone was sequenced to confirm the presence of
the T3C mutation and the absence of any additional mutations that
could potentially be introduced by the PCR reaction or by the
synthetic oligonucleotides. The sequenced clone was found to have
the correct sequence throughout the Nde I-Pst I segment.
[0108] The substitution mutation A105C was constructed using the
technique of "mutagenesis by overlap extension" as described in
general by Horton, R. M. pp251-261 in Methods in Molecular Biology,
Vol. 15: PCR Protocols: Current Methods and Applications edited by
White, B. A. (1993) Humana Press, Inc., Totowa, N.J. With this
technique two separate fragments are amplified from the target DNA
segment as diagrammed in FIG. 1. One fragment is produced with
primers a and b to yield product AB. The second primer pair, c and
d, are used to produce product CD. Primers b and c introduce the
same sequence change into the right and left ends of products AB
and CD, respectively. Products AB and CD share a segment of
identical (mutated) sequence, the "overlap", which allows annealing
of the top strand of AB to the bottom strand of CD, and the
converse. Extension of these annealed overlaps by DNA polymerase in
a subsequent PCR reaction using primers a and d with products AB
and CD both added as template creates a full length mutant molecule
AD.
[0109] With the exception of the use of different oligonucleotide
primers, the initial PCR reactions for the A105C construction were
performed identically to those described in the construction of T3C
above. The primer pairs used were: (BB27+BB33) and (BB11+BB79).
BB11 and BB33 are described above. BB27 and BB79 are complementary
mutagenic oligonucleotides that change the GCC codon for alanine at
amino acid residue 105 to a TGC codon encoding cysteine. The
sequence of BB27 is (5>AGCCTGGTGTAC
GGCTGCTCTGACAGCAACGTC>3)(SEQ.ID.NO. 23) and the sequence of BB78
is 5>GACGTTGCTG TCAGAGCAGCCGTACACCAGGCT>3 (SEQ.ID.NO. 24).
The (BB27.times.BB33) and (BB11.times.BB79) PCR reactions were
ethanol precipitated, gel-purified, and recovered in 20 .mu.l 10 mM
Tris-HCl (pH 8.5). The preparative gel showed that the predominant
product from each PCR reaction was of the expected size: .about.290
bp for the (BB27.times.BB33) reaction and .about.408 bp for the
(BB11.times.BB79) reaction. These two mutagenized fragments were
then "spliced" together in a subsequent PCR reaction. In this
reaction 1 .mu.l of each of gel-purified fragments from the initial
reactions were added as template and BB11 and BB33 were used as
primers. Otherwise, the PCR reaction was performed using the same
conditions employed for the initial (BB27.times.BB33) and
(BB11.times.BB79) reactions. An aliquot of the secondary PCR
reaction was analyzed by agarose gel electrophoresis and the
expected .about.670 bp band was observed. The bulk of the PCR
reaction was then "cleaned up" using the QIAquick PCR Purification
Kit (Qiagen) and digested with Bgl II and Pst I. The resulting 276
bp Bgl II-Pst I fragment, which includes the putative A105C
mutation, was gel-purified and ligated into pBBT111, which had been
digested with Bgl II and Pst I, and gel-purified. Transformants
from this ligation were initially screened by digestion with Bgl II
and Pst I and subsequently one clone was sequenced to confirm the
presence of the A105C mutation and the absence of any additional
mutations that could potentially be introduced by the PCR reaction
or by the synthetic oligonucleotides. The sequenced clone was found
to have the correct sequence throughout the Bgl II-Pst I
segment.
[0110] For expression in E. coli as proteins secreted to the
periplasmic space, the stII-hGH genes encoding the 11 muteins were
excised from the pUC19-based pBBT111 derivatives as Nde I-Xba I
fragments of .about.650 bp and subcloned into the pCYB1 expression
vector that had been used to express rhGH. For expression
experiments, these plasmids were introduced into E. coli W3110.
[0111] Using procedures similar to those described here and in
Example 23, one can construct other cysteine muteins of GH. The
cysteine muteins can be substitution mutations that substitute
cysteine for a natural amino residue in the GH coding sequence,
insertion mutations that insert a cysteine residue between two
naturally occurring amino acids in the GH coding sequence, or
addition mutations that add a cysteine residue preceding the first
amino acid, F1, of the GH coding sequence or add a cysteine residue
following the terminal amino acid residue, F191, of the GH coding
sequence. The cysteine residues can be substituted for any amino
acid, or inserted between any two amino acids, anywhere in the GH
coding sequence. Preferred sites for substituting or inserting
cysteine residues in GH are in the region preceding Helix A, the
A-B loop, the B-C loop, the C-D loop and the region distal to Helix
D. Other preferred sites are the first or last three amino acids of
the A, B, C and D Helices. Preferred residues in these regions for
creating cysteine substitutions are F1, P2, P5, E33, K38, E39, Q40,
Q46, N47, P48, Q49, T50, S51, S55, S57, T60, Q69, N72, N99, L101,
V102, Y103, G104, S106, E129, D130, G131, P133, R134, G136, Q137,
K140, Q141, T142, Y143, K145, D147, N149, S150, H151, N152, D153,
S184, E186, G187, S188, and G190. Cysteine residues also can be
inserted immediately preceding or following these amino acids. One
preferred site for adding a cysteine residue would be preceding F1,
which is referred to herein as *-1C.
[0112] One also can construct GH muteins containing a free cysteine
by substituting another amino acid for one of the
naturally-occurring cysteine residues in GH. The naturally
occurring cysteine residue that normally forms a disulfide bond
with the substituted cysteine residue is now free. The
non-essential cysteine residue can be replaced with any of the
other 19 amino acids, but preferably with a serine or alanine
residue. A free cysteine residue also can be introduced into GH by
chemical modification of a naturally occurring amino acid using
procedures such as those described by Sytkowski et al. (1998),
incorporated herein by reference.
[0113] Using procedures similar to those described in Examples
1-15, one can express the proteins in prokaryotic cells such as E.
coli, purify the proteins, PEGylate the proteins and measure their
bioactivities in an in vitro bioassay. The GH muteins also can be
expressed in eukaryotic cells such as insect or mammalian cells
using procedures similar to those described in Examples 16-19, or
related procedures well known to those skilled in the art. If
secretion is desired, the natural GH signal sequence, or another
signal sequence, can be used to secrete the protein from eukaryotic
cells.
Example 5
Cystine Addition Improves Recovery of Cysteine Mutein T3C
[0114] E. coli strain W3110 containing the T3C mutation was grown
overnight in 3 ml of LB containing 100 .mu.g/ml ampicillin. The
saturated overnight culture was diluted to 0.03 O.D. at A.sub.600
in 300 ml of LB containing 100 .mu.g/ml ampicillin and incubated at
37.degree. C. in 2 L shake flasks. When the culture O.D. reached
0.420, 1.5 ml of 100 mM IPTG was added for a final concentration of
0.5 mM to induce expression of the recombinant protein. The induced
culture was incubated at 37.degree. C. overnight (.about.16 h).
[0115] The induced overnight culture reached an O.D of 3.6 at
A.sub.600 and was split into 2.times.135 ml volumes and centrifuged
using a Sorval RC-5 centrifuge with a GSA rotor at 8,000 rpm for 10
minutes at 4.degree. C. The supernatants were discarded and the
cell pellets subjected to osmotic shock treatment as follows. The
cell pellets were resuspended to approximately 49 O.D. in 10 ml of
ice cold Buffer A [20% sucrose, 10 mM Tris-HCl pH 7.5] or Buffer B
[20% sucrose, 10 mM Tris-HCl pH 7.5, 5.5 mM cystine (pH adjusted to
7.5-8.0)]. The pellets were resuspended by trituration and
vortexing and 1 ml of 0.25 M EDTA pH 8.0 was added to give a final
concentration of .about.25 mM. Resuspended cells were incubated on
ice for 30 minutes and centrifuged in an SS-34 rotor at 8,500 rpm
for 10 minutes at 4.degree. C. The supernatants were discarded and
the pellets resuspended by trituration and vortexing in 10 ml of
ice cold Buffer C [5 mM Tris-HCl pH 7.5] or Buffer D [5 mM Tris-HCl
pH 7.5, 5 mM cystine (pH adjusted to 7.5-8.0)] and incubated on ice
for 30 minutes. The resuspended cell pellet was centrifuged in an
SS-34 rotor at 8,500 rpm for 10 minutes at 4.degree. C. and the
resultant supernatant (soluble periplasmic fraction) was recovered
and stored at -80.degree. C. SDS-PAGE analysis of the various
supernatants revealed that by incorporating cystine into the
osmotic shock procedure, the amount of monomeric hGH species
recovered in the soluble periplasmic fraction can be significantly
improved. In the sample treated with cystine, we observed that a
majority of the hGH ran as a single band of about 22 kDa on a
non-reduced SDS-PAGE gel and that band co-migrated with pituitary
hGH. In the absence of cystine, a number of different molecular
weight species were observed in the monomeric range. Larger
molecular weight protein aggregates are visible when the gel is
developed using Western blotting.
Example 6
General Method for Expression and Purification of GH Cysteine Added
Variants
[0116] A standard protocol for isolation of the hGH cyteine muteins
is as follows. Cultures of W3110 E. coli strains containing the
stII-hGH mutein plasmids were grown to saturation in LB containing
100 .mu.g/ml ampicillin at 37.degree. C. The overnight cultures
were typically diluted to 0.025-0.030 O.D. at A.sub.600 in LB
containing 100 .mu.g/ml ampicillin and grown at 37.degree. C. in
shake flasks. When culture O.D.'s reached 0.300-0.500 at A.sub.600,
IPTG was added to a final concentration of 0.5 mM to induce
expression. The induced cultures were incubated at 37.degree. C.
overnight. Induced overnight cultures were pelleted by
centrifugation in a Sorval RC-5 centrifuge at 8,000-10,000.times.g
for 10 minutes at 4.degree. C. and the resultant pellets subjected
to osmotic shock based on the procedures of Koshland and Botstein
(1980) or Hsiung et al., (1986) depending on the size of the
culture. For osmotic shock, cell pellets were resuspended at 25-50
O.D. in 20% sucrose, 10 mM Tris-HCl pH7.5. In certain instances 5
or 25 mM EDTA pH 8.0 and/or 5 mM cystine (pH adjusted to 7.5-8.0)
were included in the resuspension buffer. The resuspended pellets
were incubated on ice for 15-30 minutes and centrifuged as above.
The supernatants were discarded and the pellets resuspended at
25-50 O.D. at A.sub.600 in 5 or 10 mM Tris-HCl pH 7.5. In certain
instances 5 mM EDTA pH 8.0 and/or 5 mM cystine (pH adjusted to
7.5-8.0) were included in the resuspension buffer. The resuspended
pellets were incubated on ice for 30 minutes and centrifuged as
above. The resulting supernatant contains the soluble periplasmic
components and the pellet is comprised of insoluble periplasmic,
and cell associated components.
[0117] Addition of cystine to the osmotic shock buffer resulted in
significantly improved recoveries and stabilization of many of the
cysteine muteins. In the presence of cystine the cysteine muteins
were largely monomeric, whereas in the absence of cystine, a
mixture of hGH monomers, dimers and higher order aggregates were
observed when the samples were analyzed by non-reducing SDS-PAGE
and Western blots. Presumably the higher order aggregates are a
consequence of the added cysteine residues in the proteins since
they were greatly reduced or absent with wild-type rhGH. Addition
of cystine to the osmotic shock buffer largely solved this problem.
We believe cystine reacts with the free cysteine residue in the
muteins to form a stable mixed disulfide, thus preventing disulfide
shuffling and aggregation. We have also tested a second dithiol,
cystamine and have seen a similar stabilizing effect on cysteine
muteins of hGH. Presumably other dithiols such as oxidized
glutathione would also lead to improved recoveries of proteins
containing a free cysteine.
[0118] Of the 11 hGH muteins analyzed, six expressed at levels
sufficient for isolation and purification. Non-reduced SDS-PAGE
analysis of the osmotic shock supernatants for the A34C, S43C,
A98C, S100C and S132C muteins showed little or no protein present
at the correct molecular weight. Addition of cystine did not
discernibly improve recovery of these proteins. The relatively low
expression levels of these muteins makes it difficult to observe
improved yields. Preliminary analyses of whole cell lysates
indicated that these mutant proteins were expressed, but insoluble.
The T3C, A105C, T135C, S144C, T148C and stp192C muteins showed
moderate to good expression levels. Five of these cysteine muteins
(T3C, T135C, S144C, T148C and stp192C) showed significantly
improved recoveries when cystine was present in the osmotic shock
buffer. A105C was not tested in the absence of cystine. General
protein purification protocols are described below.
[0119] WT-rhGH was purified by ion exchange and gel filtration
chromatography. The cysteine muteins were purified by an assortment
of chromatographic procedures including ion exchange, hydrophobic
interaction (HIC), metal chelation affinity chromatographies
(IMAC), Size Exclusion Chromatography (SEC) or a combination of
these techniques. Generally, the hGH mutein was captured from the
fresh osmotic shock supernatant using a Q-Sepharose fast flow resin
(Pharmacia) equilibrated in 20 mM Tris-HCl, pH 8.0. The column was
washed with 20 mM Tris-HCl, pH 8.0 and bound proteins eluted with a
linear 10 volume increasing salt gradient from 0 to 250 mM NaCl in
20 mM Tris-HCl, pH 8.0. Fractions containing the hGH muteins were
identified by SDS-PAGE and Western blotting. These fractions were
pooled and stored frozen. Alternative resins can be used to capture
hGH muteins from the osmotic shock mixture. These include HIC,
cation ion exchange resins or affinity resins.
[0120] For hydrophobic interaction chromatography (HIC), the Q
column pool was thawed to room temperature and NaCl added to a
final concentration of 2 M. The pool was loaded onto the
Butyl-Sepharose fast flow resin previously equilibrated in 2 M
NaCl, 20 mM sodium phosphate, pH 7.5. hGH muteins were eluted from
the resin using a reverse salt gradient form 2 M to 0 M NaCl in 20
mM phosphate, pH 7.5. Fractions containing the hGH muteins were
identified by SDS-PAGE and Western blotting, and pooled.
[0121] In some instances, the HIC pool was subsequently loaded
directly onto a nickel chelating resin (Qiagen) equilibrated in 10
mM sodium phosphate, 0.5 M NaCl, pH 7.5. Following a wash step,
muteins were recovered using a 0-30 mM imidizole gradient in 10 mM
sodium phosphate, 0.5 M NaCl, pH 7.5. hGH has a high affinity for
nickel, presumably through the divalent metal-binding site formed
by H18, H21 and E174. As a result, hGH can be obtained in highly
pure form using a metal chelation column (Maisano et al., 1989).
All of the muteins tested bound tightly to the nickel column and
eluted at similar imidazole concentrations (around 15 mM) as
wild-type rhGH.
Example 7
Purification of T3C
[0122] The soluble periplasmic fraction prepared in the presence of
cystine (Example 5) was loaded onto a 1 ml HiTrap Q-Sepharose
column (Pharmacia Biotech, Uppsala, Sweden) equilibrated in 10 mM
Tris-HCl pH 8.0 and the bound proteins were eluted with a 20 column
volume linear gradient of 0-250 mM NaCl. The column load and
recovered fractions were analyzed by 14% SDS-PAGE. T3C eluted at a
salt concentration around 170-200 mM which was significantly later
than WT-hGH. Surprisingly, T3C mutein was present in a monomeric
form when loaded on the column, but was recovered predominantly as
a stable disulfide linked homodimer following elution from the Q
column. When reduced, the T3C mutein co-migrated on a SDS-PAGE gel
with wild type hGH. Dimer formation occurred during the Q column
purification step. Cystine was not present in the Q column buffer
or the buffers used for the other column steps. The T3C dimer
remained intact throughout any further concentration or
purification procedures. The pool from the Q column was adjusted to
a final NaCl concentration of 0.5 M and loaded onto 1 ml Ni-agarose
column (Qiagen) previously equilibrated in 10 mM sodium phosphate,
0.5 M NaCl, pH 7.5. Following a wash step, highly purified T3C
dimers were recovered using a 0-30 mM imidizole gradient in 10 mM
sodium phosphate, 0.5 M NaCl, pH 7.5. T3C dimers were active in the
bioassay (Example 10 and Table 1).
[0123] The A105C, T135C and stp192C muteins also were recovered
from the Q column as disulfide-linked dimers. It appears that
certain muteins are capable of forming stable disulfide-linked
dimers, presumably through the added cysteine residue, once cystine
is removed. We believe monomeric forms of these proteins could be
stabilized by including cystine or other dithiol compounds and/or
cysteine blocking agents in all the column buffers and/or
maintaining the pH of the buffers below 7 to prevent disulfide
rearrangement.
Example 8
Purification of T148C
[0124] E. coli strain W3110 expressing the T148C mutein was grown
overnight in 3 ml of LB containing 100 .mu.g/ml ampicillin. The
saturated overnight culture was diluted to 0.025 O.D. at A.sub.600
in 500 ml of LB containing 100 .mu.g/ml ampicillin and divided into
2.times.250 ml volumes and incubated at 37.degree. C. in 2 L shake
flasks. When the culture O.D. reached approximately 0.35, 1.25 ml
of 100 mM IPTG was added to each flask for a final concentration of
0.5 mM to induce expression of the recombinant protein. The induced
culture was incubated at 37.degree. C. overnight (.about.16 h).
[0125] The induced overnight cultures reached an O.D of
approximately 3.5 at A.sub.600 and were centrifuged using a Sorval
RC-5 centrifuge with a GSA rotor at 8,000 rpm for 10 minutes at
4.degree. C. The supernatants were discarded and the cell pellets
subjected to osmotic shock treatment as follows. The cell pellets
were resuspended to approximately 43 O.D. in ice cold 20% sucrose,
10 mM Tris-HCl pH 7.5, 5.0 mM EDTA pH 8.0, 5.0 mM cystine (pH
adjusted to 7.5-8.0) by trituration and vortexing. Resuspended
cells were incubated on ice for 15 minutes, centrifuged in Sorval
centrifuge with an SS-34 rotor at 8,500 rpm for 10 minutes at
4.degree. C. The supernatants were discarded and the pellets
resuspended to approximately 43 O.D. in ice cold 1 mM Tris-HCl pH
7.5, 5 mM EDTA pH 8.0, 5 mM cystine (pH adjusted to 7.5-8.0) by
trituration and vortexing. Resuspended cells were incubated on ice
for 30 minutes and centrifuged in an SS-34 rotor at 8,500 rpm for
10 minutes at 4.degree. C. and the resultant supernatant (soluble
periplasmic fraction) was recovered and stored at -80.degree.
C.
[0126] A second culture of T148C was prepared in a similar manner
with the following exceptions: 1) the induced culture volume was
200 ml and reached an O.D. of approximately 4.0 at A.sub.600 after
overnight incubation at 37.degree. C., and 2) The cell pellet
resuspensions were done at approximately 30 O.D.s at A.sub.600.
[0127] The soluble periplasmic fraction from the above preparations
were combined and dialyzed against 1 L of 10 mM Tris-HCl pH 8.0
overnight at 4.degree. C. The dialysis retentate was loaded onto a
5 ml HiTrap Q-Sepharose column (Pharmacia Biotech, Uppsala, Sweden)
equilibrated in 10 mM Tris-HCl pH 8.0 and the bound proteins were
eluted with a 20 column volume linear gradient of 0-250 mM NaCl.
Column fractions were analyzed by 14% SDS-PAGE (Novex, San Diego,
Calif.). T148C mutein eluted as a sharp peak at a salt
concentration around 60-80 mM. The appropriate fractions were
pooled and concentrated on Centricon 10 concentrators (Amicon,
Inc., Beverly, Mass.). The concentrated pool was further purified
on a Superdex 200 HR 10/30 column (Pharmacia Biotech Inc., Uppsala,
Sweden.) equilibrated in 20 mM sodium phosphate pH 7.5, 150 mM
NaCl. The column fractions were again analyzed by SDS-PAGE and the
T148C mutein containing fractions were pooled. We observed that the
T148C remained monomeric after recovery from the Q-Sepharose column
and eluted from the Superdex column at a molecular weight similar
to wild type hGH. T148C prepared by Q-Sepharose and size exclusion
chromatography is referred to as Lot A.
[0128] Alternatively the Q-pool can be loaded directly onto a
nickel chelating resin (Qiagen) equilibrated in 10 mM sodium
phosphate, 0.5 M NaCl, pH 7.5. Following a wash step, T148C was
recovered using a 0-30 mM imidizole gradient in 10 mM sodium
phosphate, 0.5 M NaCl, pH 7.5. T148C protein prepared by
Q-Sepharose and nickel affinity chromatography is referred to as
Lot B.
[0129] An osmotic shock T148C supernatant was prepared in the
absence of cystine and purification over a Q-Sepharose column was
attempted. The identical protocol was followed as described above
except cystine was absent from the osmotic shock buffers. The T148C
protein product eluted from the Q column over a broad range of salt
concentrations, recoveries were lower and the protein preparation
was substantially less pure than the cystine treated T148C
sample.
Example 9
Purification of S144C
[0130] E. coli strain W3110 containing the S144C mutation was grown
overnight in 3 ml of LB containing 100 .mu.g/ml ampicillin. The
saturated overnight culture was diluted to 0.03 O.D.s at A.sub.600
in 250 ml of LB containing 100 .mu.g/ml ampicillin and incubated at
37.degree. C. in a 2 L shake flask. When the culture O.D. reached
approximately 0.3, 1.25 ml of 100 mM IPTG was added for a final
concentration of 0.5 mM to induce expression of the recombinant
protein. The induced culture was incubated at 37.degree. C.
overnight (.about.16 h).
[0131] The induced overnight culture reached an O.D of
approximately 3.3 at A.sub.600 and was centrifuged using a Sorval
RC-5 centrifuge with a GSA rotor at 8,000 rpm for 10 minutes at
4.degree. C. The supernatant was discarded and the cell pellet
subjected to osmotic shock treatment as follows. The cell pellet
was resuspended to approximately 33 O.D. in ice cold 20% sucrose,
10 mM Tris-HCl pH 7.5, 5.0 mM cystine (pH adjusted to 7.5-8.0) by
trituration and vortexing and 0.25 M EDTA pH 8.0 was added to a
final concentration of 25 mM. Resuspended cells were incubated on
ice for 30 minutes, centrifuged in the Sorval RC-5 centrifuge with
an SS-34 rotor at 8,500 rpm for 10 minutes at 4.degree. C. The
supernatants were discarded and the pellets resuspended to
approximately 33 O.D.s in ice cold 5 mM Tris-HCl pH 7.5, 5 mM
cystine (pH adjusted to 7.5-8.0) by trituration and vortexing.
Resuspended cells were incubated on ice for 30 minutes and
centrifuged in an SS-34 rotor at 8,500 rpm for 10 minutes at
4.degree. C. and the resultant supernatant (soluble periplasmic
fraction) was recovered and stored at -80.degree. C.
[0132] The soluble periplasmic fraction from the above preparation
was loaded onto a 5 ml HiTrap Q-Sepharose column (Pharmacia
Biotech, Uppsala, Sweden) equilibrated in 10 mM Tris-HCl pH 8.0 and
the bound proteins were eluted with a 20 column volume linear
gradient of 0-250 mM NaCl. Column fractions were analyzed by 14%
SDS-PAGE (Novex, San Diego, Calif.) and S144C mutein-containing
fractions, 125-150 mM NaCl, were pooled and frozen. The S144C
mutein was monomeric.
Example 10
Bioactivities of hGH Cysteine Muteins
[0133] The biological activities of the purified T3C, S144C and
T148C cysteine muteins were measured using the cell proliferation
assay described in Example 1. Protein concentrations were
determined using a Bradford assay. All three muteins were
biologically active. All of the muteins reached the same level of
maximum stimulation as pituitary hGH, within the error of the
assay. The mean EC.sub.50s for the T3C, S144C and T148C muteins
were similar to that of pituitary hGH and rhGH (Table 1). Two
independent preparations of the T148C mutein and one preparation
each of the S144C and T3C muteins (all prepared in the presence of
cystine) have been assayed multiple times (Table 1). The partially
purified A105C, T135C and stp192C muteins also have been assayed
and are biologically active.
Example 11
General Methods for Pegylation and Purification of Cysteine
Muteins
[0134] GH muteins can be PEGylated using a variety of
cysteine-reactive PEG-maleimide (or PEG-vinylsulfone) reagents that
are commercially available. Generally, methods for PEGylating the
proteins with these reagents will be similar to those described in
WO 9412219 (Cox and McDermott) and WO 9422466 (Cox and Russell),
both incorporated herein by reference, with minor modifications.
The recombinant proteins are generally partially reduced with
dithiothreitol (DTT), Tris (2-carboxyethyl) phosphine-HCl (TCEP) or
some other reducing agent in order to achieve optimal PEGylation of
the free cysteine. The free cysteine is relatively unreactive to
cysteine-reactive PEGs unless this partial reduction step is
performed. The amount of reducing agent required to partially
reduce each mutein can be determined empirically, using a range of
reducing agent concentrations at different pHs and temperatures.
Reducing agent concentrations typically vary from 0.5 equal molar
to 10-fold excess. Preferred temperatures are 4.degree. C. to
37.degree. C. The pH can range from 6.5 to 9.0 but is preferrably
7.5 to 8.5. The optimum conditions will also vary depending on the
reductant and time of exposure. Under the proper conditions, the
least stable disulfides (typically intermolecular disulfides and
mixed disulfides) are disrupted first rather than the more
thermodynamically stable native disulfides. Typically, a 5-10 fold
molar excess of DTT for 30 minutes at room temperature is
effective. Partial reduction can be detected by a slight shift in
the elution profile of the protein from a reversed-phase column. In
the case of a dimeric hGH, a shift in molecular weight is visible
by SDS-PAGE analysis run under non-reducing condition. Care must be
taken not to over-reduce the protein and expose additional cysteine
residues. Over-reduction can be detected by reversed phase-HPLC
(the over-reduced protein will have a retention time similar to the
fully reduced and denatured protein) and by the appearance of GH
molecules containing two PEGs following the PEGylation reaction
(detectable by a molecular weight change on SDS-PAGE). Wild type GH
can serve as a control since it should not PEGylate under
conditions that do not reduce the native intramolecular disulfides.
Excess reducing agent can be removed prior to PEGylation by size
exclusion chromatography or by dialysis. TCEP need not be removed
before addition of the PEGylation reagent as it is does not contain
a free thiol group. The partially reduced protein can be reacted
with various concentrations of PEG-maleimide or PEG-vinylsulfone
(typically PEG: protein molar ratios of 1:1, 5:1, 10:1 and 50:1) to
determine the optimum ratio of the two reagents. PEGylation of the
protein can be monitored by a molecular weight shift for example,
using SDS-PAGE. The lowest amount of PEG that gives significant
quantities of mono-pegylated product without giving di-pegylated
product is typically considered optimum (80% conversion to
mono-pegylated product is generally considered good). Generally,
mono-PEGylated protein can be purified from non-PEGylated protein
and unreacted PEG by size-exclusion, ion exchange, affinity,
reversed phase, or hydrophobic interaction chromatography. Other
purification protocols such as 2-phase organic extraction or salt
precipitation can be used. The purified PEGylated protein can be
tested in the cell proliferation assay described in Example 1 to
determine its specific activity.
[0135] Experiments can be performed to confirm that the PEG
molecule is attached to the protein at the proper site. This can be
accomplished by chemical or proteolytic digestion of the protein,
purification of the PEGylated peptide (which will have a large
molecular weight) by size exclusion, ion exchange or reversed phase
chromatography, followed by amino acid sequencing. The PEG-coupled
amino acid will appear as a blank in the amino acid sequencing
run.
Example 12
Preparation and Purification of PEG-T3C
[0136] A preliminary titration study was performed to determine
appropriate reducing agent and PEG reagent concentrations and to
avoid over-reduction of the protein. We monitored partial reduction
of the protein by conversion of dimer to non-reduced monomer
species on non-reduced SDS-PAGE. One pg aliquots of purified T3C
dimer were incubated with increasing concentrations of TCEP for 60
minutes at room temperature. The reactions were immediately
analyzed by non-reducing SDS-PAGE. The amount of TCEP that yielded
significant amounts of monomer T3C without overreducing and
denaturing the protein was used for subsequent experiments. TCEP is
a convenient reducing agent for small scale experiments because it
does not interfere with the PEGylation reaction; thus the
protein:TCEP mixture did not have to be dialyzed prior to PEG
addition. At a larger scale inexpensive reducing agents such as DTT
are preferred for reducing proteins. Generally, the protein is
treated with a reducing agent for an optimal amount of time. The pH
of the reaction is then adjusted to 6.5 or below to limit disulfide
rearrangements. The reducing agent is removed by dialysis or liquid
chromatography. The pH is then readjusted to greater than 6.5 or
preferably 7.5 to 8.5 and the PEG reagent is added.
[0137] The titration experiments at pH 7.5 indicated that a
five-fold molar excess of TCEP for 60 minutes at room temperature
converted the majority of the T3C dimer species into properly
disulfide-bonded monomer without over reducing the protein. Control
experiments indicated that, as expected, the T3C dimer needed to be
reduced with TCEP to be PEGylated. These reaction conditions were
then scaled to 100 .mu.g reaction scale. A 10-fold molar excess of
5 kDa maleimide-PEG (Fluka) was added to the T3C:TCEP mixture after
10 minutes and the PEGylation reaction was allowed to proceed for
60 minutes at room temperature. The sample was loaded quickly onto
a 1 ml Q-Sepharose column equilibrated in 20 mM Tris-HCl, pH 8.0.
The column was washed with 20 mM Tris-HCl, pH 8.0 and bound
proteins eluted with a linear 10 volume increasing salt gradient
from 0 to 250 mM NaCl in 20 mM Tris-HCl, pH 8.0. Fractions
containing mono-PEGylated T3C (a single PEG molecule attached to
the T3C monomer) were identified by SDS-PAGE and Western blotting.
These fractions were pooled and stored frozen. The presence of the
PEG moiety decreases the protein's affinity for the resin, allowing
the PEGylated protein to be separated from the non-PEGylated
protein.
Example 13
PEGylation of S144C and Other Cysteine Muteins
[0138] A preliminary titration study was also performed for S144C
to determine appropriate reducing agent, PEG reagent concentrations
and to avoid over-reduction of the protein as described in Example
12 for T3C. The larger scale PEGylation was carried out at pH 7.5
at room temperature for 2 h using a 2-fold molar excess of TCEP and
a 10-fold molar excess of 5 kDa maleimide-PEG. SDS-PAGE analysis of
the reaction mixture showed some species with two or more PEGs
present. These were separated from the mono-PEGylated S144C using a
Q-Sepharose column as described in Example 12. Separately we
performed a PEGylation reaction using 5 kDa vinylsulfone-PEG
(Fluka) which resulted in monopegylated S144C under identical
reducing conditions.
[0139] We have also performed small scale PEGylation reactions on
T148C, stp192C and T135C, all of which yielded mono-PEGylated
protein with 5 kDa maleimide-PEG and/or 5 kDa vinylsulfone-PEG.
Example 14
Bioactivity of the PEG-T3C and PEG-S144C hGH Proteins
[0140] The biological activity of the PEG-T3C and PEG-S144C
proteins were measured in the cell proliferation assay (Example 1).
The PEG-T3C protein showed a similar dose-response curve as
pituitary hGH and non-PEGylated T3C protein and reached the same
level of maximal stimulation. The mean EC.sub.50 value for PEG-T3C
was 1.6 ng/ml (0.07 nM) (values of 1.3, 1.5, 1.7, 1.8 ng/ml in four
experiments). Bioactivity of the PEG-T3C protein is at least
100-fold greater than that of rhGH that has been PEGylated using
non-specific NHS-PEG reagents (EC.sub.50 of 440 ng/ml (20 nM) as
described in Clark et al., (1996).
[0141] The mean EC.sub.50 value for PEG-S144C was 43 ng/ml (2 nM)
(40 and 45 ng/ml in two experiments). Bioactivity of the PEG-S144C
protein is approximately 10-fold greater than that of rhGH that has
been PEGylated using non-specific NHS-PEG reagents (EC.sub.50 of
440 ng/ml (20 nM); Clark et al., 1996).
Example 15
Construction of Disulfide-Linked Trimers and Disulfide-Linked
Higher Order Multimers of hGH
[0142] Additional hGH variants having more than one "free" cysteine
could be constructed and used to create higher order
disulfide-linked multimers of hGH. These multimers could include
trimers, tetramers, pentamers, hexamers, septamers, octamers, and
any higher order multimers. For example, an hGH variant having two
"free" cysteine residues could be constructed by using recombinant
DNA technology to recombine in vitro DNA plasmid vectors carrying
individual "free" cysteine mutations. Alternatively, mutagenesis of
an hGH cysteine variant could be employed to add an additional
"free" cysteine mutation. Further iterations of either of these two
procedures could be used to construct hGH variants having three or
more "free" cysteines.
[0143] An hGH variant having two free cysteine residues could be
used to generate hGH trimers and higher order multimers as follows.
Such a variant would be expressed in E. coli and recovered as a
monomer in the supernatant of an osmotic shock lysate as disclosed
in Examples 5-9 herein. Subsequent processing steps could then be
employed to induce di-sulfide bond formation, e.g. Q Sepharose
chromatography as described in Examples 6-9 herein. Under such
conditions some hGH variants having one free cysteine, such as T3C
and stp192C, are converted virtually quantitatively to
disulfide-linked dimers. Under the same or similar conditions
intermolecular disulfide formation by an hGH variant having two
free cysteines, e. g. a double mutant that combined T3C and
stp192C, would result in a polymerization of hGH molecules and the
chain length of such polymers would in principle be unlimited. The
chain length could be limited and to some extent controlled by
addition to the polymerization reaction of hGH molecules having
only one free cysteine such as the T3C variant and/or the stp192C
variant. Disulfide bond formation between the growing polymer and a
molecule having only one free cysteine will "cap" or prevent
further extension of one of the two polymerization sites in the
nascent polymer. A subsequent reaction of a second hGH molecule
that has only one free cysteine with the other polymerization site
of that nascent polymer terminates polymerization and fixes the
length of that polymeric molecule. The average polymer length could
be controlled by the stoichiometry of the reactants, i.e. the ratio
of hGH molecules with two free cysteines to hGH molecules with one
free cysteine. Average shorter polymers would be favored by lower
ratios and average longer polymers would be favored by higher
ratios. More complex "branched" polymers could be constructed from
reactions involving hGH variants with 3 or more free cysteines with
hGH variants having only one free cysteine.
[0144] Discrete size classes of certain polymers could subsequently
be purified by chromatographic methods such as size exclusion
chromatography, ion exchange chromatography, hydrophobic
interaction chromatography, and the like. Similar procedures to
those described for GH could be used to create disulfide-linked
dimers and higher order multimers of EPO and alpha interferon.
Example 16
Cloning, Expression and Purification of Baculovirus (BV)-Expressed
Recombinant Human Erythropoietin (rEPO)
[0145] A. Cloning a cDNA Encoding EPO.
[0146] A cDNA encoding human EPO was cloned by PCR using forward
primer BB45 (5>CCCGGAT CCATGGGGGTGCACGAATGTCCTG>3)(SEQ.ID.NO.
25) and reverse primer BB47 (5>CCCGA
ATTCTATGCCCAGGTGGACACACCTG>3)(SEQ.ID.NO. 26). BB45 anneals to
the DNA sequence encoding the initiator methionine and amino
terminal portion of the EPO signal sequence and contains a Bam HI
site for cloning purposes (Jacobs et al., 1985; Lin et al., 1985).
BB47 anneals to the 3' untranslated region of the EPO mRNA
immediately downstream of the translational stop signal and
contains an Eco RI restriction site for cloning purposes. Total RNA
isolated from the human liver cell line Hep3B was used in first
strand synthesis of single-stranded cDNA for PCR.
[0147] For preparation of total cellular RNA, Hep3B cells (American
Type Culture Collection) were grown in Delbecco's Modified Eagle's
media (DMEM) supplemented with 10% fetal bovine serum (FBS). EPO
expression was induced by treating the cells for 18 h with 130
Deferoxamine or 100 .mu.M cobalt chloride. Both compounds have been
shown to induce EPO mRNA and protein expression in Hep 3B cells
(Wang and Semenza, 1993). RNA was isolated from the cells using an
RNeasy Mini kit (Qiagen, Inc.), following the manufacturer's
directions. Approximately 320 .mu.g of total RNA was isolated from
1.4.times.10.sup.7 cells treated with cobalt chloride and 270 .mu.g
of total RNA isolated from 1.4.times.10.sup.7 cells treated with
Deferoxamine. First strand synthesis of single-stranded cDNA was
accomplished using a 1st Strand cDNA Synthesis Kit for RT-PCR (AMV)
from Boehringer Mannheim Corp and random hexamers were used as the
primer. Subsequent PCR reactions using the products of the first
strand syntheses as templates were carried out with primers BB45
and BB47. The expected .about.600 bp PCR product was observed when
reaction products were run out on an agarose gel. Both RNA
preparations yielded an EPO PCR product. The PCR product was
digested with Bam HI and Eco RI and cloned into vector pUC19 that
had been cut with Bam HI and Eco RI and treated with alkaline
phosphatase. DNA sequencing identified a clone containing the
correct coding sequence for the EPO gene. This plasmid was
designated pBBT131 and used in the construction of EPO variants by
site directed mutagenesis as described in Example 17.
B. Expression of BV rEPO in Insect Cells
[0148] For expression in insect cells the EPO cDNA in pBBT131 was
modified at both the 5' and 3' ends. At the 5' end, the sequence
CAAA was added immediately upstream of the initiator ATG to enhance
translation. This sequence comprises a proposed consensus
translational initiation sequence for baculovirus (Ayres et al.,
1994; Ranjan and Hasnain, 1995). At the 3' end, DNA encoding the 8
amino acid FLAG epitope sequence
(asp-tyr-lys-asp-asp-asp-asp-lys)(SEQ.ID.NO. 27) was added to
provide a purification system. The FLAG epitope was fused to the
EPO gene via a flexible linker: ser-gly-gly-ser-gly-gly-ser
(SEQ.ID.NO. 28). These modifications were made via PCR using
oligonucleotide primers that incorporated the desired additions to
the EPO sequence. Oligonucleotide primer BB63
(5>CGCGGATCCAAAATGGGGGTGCAC GAATGTCCT>3)(SEQ.ID.NO. 29) was
used to modify the 5' end of the gene. BB63 adds the CAAA sequence
upstream of the ATG, anneals to the DNA sequence encoding the
initiator methionine and amino terminal portion of the EPO signal
sequence, and contains a Bam HI site for cloning purposes. The
linker and FLAG sequences were added in two sequential PCR
reactions using reverse primers BB60
(5>GTCTTTGTAGTCCGAGCCTCCGCTTCCGCCCGATCT GTCC
CCTGTCCTGCA>3)(SEQ.ID.NO. 30) and BB61
(5>CGCGAATTCTTATTTATCGTCATCGTCTTTGTAGT
CCGAGCCTCC>3)(SEQ.ID.NO. 31). BB60 anneals to 3' of the EPO
coding sequence and contains the fused peptide linker sequence and
a portion of the FLAG sequence. BB61 overlaps a segment of the BB60
sequence annealing to the junction of the linker-FLAG sequence and
adds the remainder of the FLAG sequence followed by a translational
stop codon (TAA) and an Eco RI site for cloning purposes. The
modified EPO cDNA was cloned as a Bam HI-Eco RI fragment into pUC19
and the DNA sequence of this construct was confirmed. The resulting
plasmid was designated pBBT132 and used in the construction of EPO
variants as described in Example 17. For expression in baculovirus,
the "FLAG-tagged" EPO cDNA was excised from pBBT132 as .about.630
bp Bam HI-Eco RI fragment, gel purified, and cloned into the
baculovirus transfer vector pBlueBac4.5 (Invitrogen) which had been
cut with Bam HI and Eco RI and treated with alkaline phosphatase.
One clone was picked for further use and designated pBBT138.
[0149] pBBT138 DNA was used to cotransfect Spodoptera frupperda
derived cell line Sf 9 along with linearized (Bsu36 I digested)
Bac-N-Blue.TM. (Invitrogen Corporation) baculovirus DNA. The
Bac-N-Blue.TM. genome is engineered so that formation of
plaque-forming viral particles requires recombination between the
linear Bac-N-Blue.TM. DNA and the pBlueBac4.5 vector, resulting in
the incorporation of the cloned EPO gene into the baculovirus
genome. This obligate recombination also results in incorporation
of a functional .beta.-galactosidase gene into the baculovirus
genome. The co-transfection was performed according to the
Invitrogen "Bac-N-Blue.TM. Transfection Kit" protocols using
2.times.10.sup.6 Sf 9 cells to generate a .about.1 ml supernatant.
Dilutions of this supernatant were assayed on Sf 9 cells at
27.degree. C. for blue-plaque formation. Ten blue plaques were
picked and subcultured. Each plaque was used to inoculate
2.5.times.10.sup.6 Sf 9 cells in a T25 flask containing 5 ml of
Grace's Insect Media supplemented with 10% FBS. After 5 days the
supernatants from these infected cells (the "P1" stocks) were
collected and assayed by Western Blot for EPO expression. The ten
resultant supernatants were prepared in SDS sample buffer with the
addition of 1% .beta. mercaptoethanol (BME) and electrophoresed on
precast 14% Tris-glycine polyacrylamide gels (Novex). Uninfected
SF9 cell supernatant was included as a negative control. Following
electrophoresis, the proteins were transferred onto 0.45 .mu.m
nitrocellulose (Novex). The nitrocellulose membrane was blocked in
Tris Buffered Saline (TBS) with 0.05% Tween 20 and 4% powered milk
(blocking buffer). Anti-FLAG M2 mouse IgG.sub.1 monoclonal antibody
(Eastman KODAK) was used at 1:1500 or 1:2500 dilution in blocking
buffer and the blot routinely incubated overnight at 4.degree. C.
Alkaline phosphatase conjugated Sheep Anti-Mouse IgG.sub.1 (The
Binding Site Limited) was diluted 1:1000 in blocking buffer and the
blot incubated for 1 hour at room temperature. The Western blot was
developed using NBT\BCIP color development substrate (Promega).
Nine of the ten isolates were positive for EPO expression. The
molecular weight of the BV rEPO protein was approximately 30 kDa
under reducing conditions and consisted on one major and one to two
minor bands in this molecular weight range, which is consistent
with a variably glycosylated protein.
[0150] Two of the positive supernatants were tested in the in vitro
EPO bioassay described in Example 16.D below. Both supernatants
stimulated proliferation of the EPO-dependent cell line in a
dose-dependent manner, indicating that they contained active EPO.
Control supernatants of mock infected Sf 9 cells and the one
baculovirus supernatant that was negative for EPO expression by
Western blot showed no detectable activity in the EPO bioassay.
[0151] In order to produce and purify larger amounts of wild type
BV rEPO, one positive recombinant baculovirus, termed bvBBT138A,
was chosen for further amplification. A 500 ml high titer viral
stock was prepared by subculturing the P1 stock of isolate 138A at
27.degree. C. in a 500 ml spinner flask culture of Sf 9 cells in
Grace's Insect Media supplemented with 10% FBS. Grace's Insect
Media contains approximately 100 .mu.M L-cystine. The supernatant
from this culture was harvested after 7 days and found to have a
titer of .about.10.sup.8 plaque-forming-units/ml. An aliquot of
this lysate, termed the "P2" stock, was subsequently used to infect
a 500 ml culture for larger scale production of wild type BV rEPO.
A 500 ml culture of Sf 9 cells in Grace's Insect Media supplemented
with 10% FBS was grown in a spinner flask to a titer of
1.0.times.10.sup.6/ml and then infected with bvBBT138A at a
multiplicity of infection of 1. After 3 days the supernatant from
this culture was harvested and wild type BV rEPO-138A protein
purified as described in Example 16.C.
C. Affinity Purification of Wild Type Baculovirus-Produced rEPO
[0152] The cell supernatant was clarified by centrifugation and 0.2
.mu.M filtration. Expression of wild type BV rEPO was confirmed by
Western blot analysis. Wild type BV rEPO was purified in a single
step procedure using Anti-FLAG M2 Affinity Gel (Eastman KODAK).
Briefly, 5 ml of the M2 affinity gel was washed with 5 column
volumes of 50 mM Tris pH 7.4, 150 mM NaCl (TBS), 5 column volumes
of 0.1M glycine pH 3.5, then equilibrated in TBS. The clarified
baculoviral cell supernatant was adjusted to 150 mM NaCl and the
equilibrated resin was added. Batch loading was allowed to continue
at 4.degree. C. overnight on a roller bottle apparatus. After
overnight incubation, the resin was recovered using a Pharmacia XK
16/20 FPLC column and washed with TBS until the A280 reached
baseline. The bound protein was eluted with 0.1M glycine pH 3.5 and
fractions were collected and neutralized with 1.0M Tris pH 9.0.
Column fractions were prepared in SDS-PAGE sample buffer with the
addition of 1% BME when desirable and electrophoresed on precast
14% Tris-glycine polyacrylamide gels. Fractions from the M2
affinity column that contained most of the BV rEPO were pooled and
concentrated on a Centricon 10 spin concentrator (Amicon). The
final yield of wild type BV rEPO, as determined using a Bradford
protein assay kit (BIO-RAD Laboratories, Inc.) and bovine serum
albumin (BSA) as the standard, was approximately 360 .mu.g. The
protein was estimated to be greater than 90% pure by Coomassie Blue
staining of SDS gels.
D. In Vitro Bioactivity of Wild Type Baculovirus rEPO
[0153] A cell proliferation assay using the human UT7/epo cell line
(Komatsu et al., 1991) was developed to measure bioactivity of wild
type BV rEPO. The human UT7/epo cell line was obtained from Dr. F.
Bunn of Harvard Medical School. This cell line is dependent upon
EPO for cell proliferation and survival (Boissel et al., 1993). The
cells were maintained in Iscove's Modified Delbecco's Media (IMDM)
supplemented with 10% FBS, 50 units/ml penicillin, 50 .mu.g/ml
streptomycin and 1 unit/ml rEPO (CHO (Chinese Hamster Ovary)
cell-expressed; purchased from R&D Systems, Inc.). For
bioassays, the cells were washed three times with IMDM media and
resuspended at a concentration of 1.times.10.sup.5 cells/ml in IMDM
media containing 10% FBS, 50 units/ml penicillin and 50 .mu.g/ml
streptomycin. Fifty .mu.l (5.times.10.sup.3 cells) of the cell
suspension were aliquotted per test well of a flat bottom 96 well
tissue culture plate. Serial 3-fold dilutions of the protein
samples to be tested were prepared in phenol red-free IMDM media
containing 10% FBS, 50 units/ml penicillin and 50 .mu.g/ml
streptomycin. Fifty .mu.l of the diluted protein samples were added
to the test wells and the plates incubated at 37.degree. C. in a
humidified 5% CO.sub.2 tissue culture incubator. Protein samples
were assayed in triplicate wells. After 60-72 h, 20 .mu.l of
CellTiter 96 AQueous One Solution Reagent (Promega Corporation) was
added to each well and the plates incubated at 37.degree. C. in the
tissue culture incubator for 1-4 h. Absorbance of the wells was
read at 490 nm using a microplate reader. Control wells contained
media but no cells. Mean absorbance values for the triplicate
control wells were subtracted from mean values obtained for each
set of triplicate test wells. Serial dilutions of CHO
cell-expressed rEPO or wild type BV rEPO were analyzed in
parallel.
Example 17
Construction, Expression, Purification and Bioactivity of EPO
Cysteine Muteins
A. Construction of EPO Cysteine Muteins.
[0154] Eight mutant EPO genes were constructed using site-directed
PCR-based mutagenesis procedures similar to those used to construct
the Growth Hormone muteins described in Example 4 (Innis et al.,
1990; Horton et al., 1993). We constructed four muteins at or near
the two N-linked glycosylation sites in the A-B loop (N24C, T26C,
N38C and T40C), two muteins at or near the N-linked glycosylation
site in the B-C loop (N83C and S85C), one mutein at the O-linked
glycosylation site in the C-D loop (S126C) and one mutein (*167C),
that adds a cysteine between the natural carboxyterminal R166
residue and the 15 amino acid carboxyterminal extension consisting
of the peptide linker and FLAG sequences. The template for the
mutagenic PCR reactions was plasmid pBBT131, in which the
unmodified EPO gene is cloned as an Bam HI-Eco RI fragment into
pUC19. PCR products were digested with appropriate restriction
endonucleases, gel-purified and ligated with pBBT132 vector DNA
that had been cut with appropriate restriction enzymes, alkaline
phosphatase treated, and gel-purified. As detailed above, pBBT132
is a pUC19 derivative carrying the cloned modified (FLAG tagged)
EPO gene. Transformants from these ligations were grown up and
plasmid DNAs isolated and sequenced. The sequence of the entire
cloned mutagenized PCR fragment was determined to verify the
presence of the mutation of interest, and the absence of any
additional mutations that potentially could be introduced by the
PCR reaction or by the synthetic oligonucleotide primers.
[0155] The cysteine substitution mutation N24C was constructed as
follows. The mutagenic forward oligonucleotide BB64
(5>GAGGCCAAGGAGGCCGAGTGTATCACGACGGGCTGTGCT>3)(SEQ.ID.NO. 32)
was designed to change the codon AAT for asparagine at position 24
to a TGT encoding cysteine and to span the nearby Sty I site. This
oligo was used in PCR with the reverse, non-mutagenic, primer BB47
(5>CCCGAATTCTGGTGGATATGCCCAGGTGGAC>3)(SEQ.ID.NO. 33) which
anneals to DNA sequences 3' to the coding sequence of EPO. A 50
.mu.l PCR reaction was performed in 1.times.Promega PCR buffer
containing 1.5 mM MgCl.sub.2, each primer at 0.204, each of dATP,
dGTP, dTTP and dCTP at 200 .mu.M, 1 ng of template plasmid pBBT131
(described in Example 16), 1.5 units of Taq Polymerase (Promega),
and 0.25 units of Pfu Polymerase (Stratagene). Reactions were
performed in a Robocycler Gradient 96 thermal cycler (Stratagene).
The reaction program entailed: 96.degree. C. for 3 minutes, 25
cycles of [95.degree. C. for 1 minute, 60.degree. C. for 1.25
minutes, 72.degree. C. for 1 minute] followed by a hold at
6.degree. C. A 5 .mu.l aliquot of the PCR reaction was analyzed by
agarose gel electrophoresis and found to produce a single fragment
of the expected size .about.470 bp. The remainder of the reaction
was "cleaned up" using the QIAquick PCR Purification (Qiagen)
according to the vendor protocol, digested with Sty I and Bsr GI
(New England BioLabs) according to the vendor protocols,
ethanol-precipitated, resuspended in 20 .mu.l of 10 mM Tris-HCl pH
8.5 and run out on a 2% agarose gel. The .about.400 bp Sty I-Bsr GI
fragment of interest was gel purified using a QIAEX II Gel
Extraction Kit (Qiagen) according to the vendor protocol. This
fragment was ligated with pBBT132 (described in Example 16) that
had been cut with Sty I and Bsr GI, treated with calf intestinal
alkaline phosphatase (New England BioLabs) and gel purified. The
ligation reaction was used to transform E. coli and plasmids from
resulting transformants were sequenced to identify a clone
containing the N24C mutation and having the correct sequence
throughout the remainder of the .about.400 bp Sty I-Bsr GI
segment.
[0156] The substitution mutation T26C was constructed and its
sequence verified using the protocol described above for N24C
except that mutagenic forward oligo BB65 (5>GAGGCCAAGGA
GGCCGAGAAATCTGTACGGGCTGTGCT>3)(SEQ.ID.NO.34) was used instead of
BB64.
[0157] The substitution mutation N38C was constructed using the
technique of "mutagenesis by overlap extension" as described in
Example 4. With the exception of the use of different
oligonucleotide primers, the initial, or "primary" PCR reactions
for the N38C construction were performed identically to those
described in the construction of N24C above. The primer pairs used
were (BB66+BB47) and (BB67+BB45). BB47 is described above. The
forward, non-mutagenic, primer BB45
(5>CCCGGATCCATGGGGGTGCACGAATGTCCTG>3)(SEQ.ID.NO. 35) anneals
to the EPO sequence encoding the first seven amino acids of EPO.
BB66 and BB67 are complementary mutagenic oligonucleotides that
change the AAT codon for N38 to a TGT codon for cysteine. The
sequence of BB66 is
(5>AGCTTGAATGAGTGTATCACTGTCCCAGACACC>3)(SEQ.ID.NO. 36) and
the sequence of BB67 is (5>GGTGTCTGGGACAGTGATACACTCATT
CAAGCT>3)(SEQ.ID.NO. 37). The (BB66.times.BB47) and
(BB67.times.BB45) PCR reactions gave products of the expected
sizes: .about.420 bp for (BB66.times.BB47) and .about.220 bp for
(BB67.times.BB45). The PCR products were ethanol--precipitated,
gel-purified and recovered in 20 .mu.l 10 mM Tris-HCl as detailed
above. These two mutagenized fragments were then "spliced" together
in the subsequent, or "secondary" PCR reaction. In this reaction 1
.mu.l of each of the gel-purified PCR products of the primary
reactions were used as template and BB45 and BB47 were used as
primers. Otherwise, the reaction conditions identical to those used
in the primary reactions. An aliquot of the secondary PCR was
analyzed by agarose gel electrophoresis and the expected band of
.about.630 bp was observed. The bulk of the secondary PCR reaction
was "cleaned up" using the QIAquick PCR Purification (Qiagen)
according to the vendor protocol, digested with Sty I and Bsr GI
(New England BioLabs) according to the vendor protocols,
ethanol-precipitated, resuspended in 20 .mu.l of 10 mM Tris-HCl pH
8.5 and run out on a 2% agarose gel. The .about.400 bp Sty I-Bsr GI
fragment of interest was gel purified using a QIAEX II Gel
Extraction Kit (Qiagen) according to the vendor protocol. This
fragment was ligated with pBBT132 (described in Example 16) that
had been cut with Sty I and Bsr GI, treated with calf intestinal
alkaline phosphatase (New England BioLabs) and gel purified. The
ligation reaction was used to transform E. coli and plasmids from
resulting transformants were sequenced to identify a clone
containing the N38C mutation and having the correct sequence
throughout the .about.400 bp Sty I-Bsr GI segment.
[0158] The substitution mutation T40C was constructed and sequence
verified using the procedures described above for N38C except that
complementary mutagenic primers BB68 (5>AGCTTG AATGAGAATATCTG
TGTCCCAGACACC>3)(SEQ.ID.NO. 38) and BB69
(5>GGTGTCTGGGACACAGATATTCTC ATTCAAGCT>3)(SEQ.ID.NO. 39),
which change the ACT codon for T40 to a TGT codon for cysteine,
replaced BB66 and BB67 respectively in the primary PCR
reactions.
[0159] The substitution mutation N83C was constructed and sequence
verified using the procedures described above for N38C except that
complementary mutagenic primers BB70 (5>GCCCTGT
TGGTCTGCTCTTCCCAGCCGTGGGAGCCCCTG>3)(SEQ.ID.NO. 40) and BB71
(5>CAGGGGCTCCCACGGCTGG GAAGAGCAGACCA ACAGGGC>3)(SEQ.ID.NO.
41), which change the AAC codon for N83 to a TGC codon for
cysteine, replaced BB66 and BB67, respectively, in the primary PCR
reactions. The sizes of the products of the primary PCR reactions
were also different. The (BB70.times.BB47) reaction gave, as
predicted, a product of .about.300 bp and the (BB71.times.BB45)
reaction gave, as predicted, a product of .about.360 bp.
[0160] The substitution mutation S85C was constructed and sequence
verified using the procedures described above for N38C except that
complementary mutagenic primers primers BB72 (5>GCC CTGTTGGTCAAC
TCTTGCCAGCCGTGGGAGCCCCTG>3)(SEQ.ID.NO. 42) and BB73
(5>CAGGGGCTCCCACG GCTGGCAAGAGTTGACCAACAGGGC>3)(SEQ.ID.NO.
43), which change the TCC codon for S85 to a TGC codon for
cysteine, replaced BB66 and BB67 respectively in the primary PCR
reactions. The sizes of the products of the primary PCR reactions
were also different. The (BB72.times.BB47) reaction gave, as
predicted, a product of .about.300 bp and the (BB73.times.BB45)
reaction gave, as predicted, a product of .about.360 bp.
[0161] The substitution mutation S126C was constructed using the
procedures described above for N38C except that complementary
mutagenic primers BB74 (5>CCAGATGCGGCCTGTGCTGC
TCCACTC>3)(SEQ.ID.NO. 44) and BB75
(5>GAGTGGAGCAGCACAGGCCGCATCTGG>3)(SEQ.ID.NO. 45), which
change the TCA codon for S126 to a TGT codon for cysteine, replaced
BB66 and BB67 respectively in the primary PCR reactions. The sizes
of the products of the primary PCR reactions were also different.
The (BB74.times.BB47) reaction gave, as predicted, a product of 175
bp and the (BB75.times.BB45) reaction gave, as predicted, a product
of .about.480 bp.
[0162] A mutation was also constructed that added a cysteine
following the carboxyterminal amino acid of the EPO coding
sequence. This mutant, termed *167C was constructed as follows. A
PCR reaction was carried out under the conditions described above
for the construction of the N24C mutant, but employing
oligonucleotides BB45 (see above) and reverse mutagenic
oligonucleotide BB77 (5>TTTGTAGTCCGAG CCTCCGCTTCCGCCCGAACA
TCTGTCCCCTGTCCTGCA>3)(SEQ.ID.NO. 46) and using 2.5 units of Taq
Polymerase and 0.5 units of Pfu Polymerase. BB77 anneals to the
terminal 21 residues of EPO coding sequence and adds a TGT codon
for cysteine following the AGA codon for R166, which is the
terminal amino acid in the EPO coding sequence. BB77 also adds
sequences encoding the seven amino acid linker
-ser-gly-gly-ser-gly-gly-ser- (SEQ.ID.NO. 27), and a portion of the
FLAG epitope sequence. The .about.630 bp product of this PCR
reaction was gel purified and used as template in a subsequent PCR
reaction employing the same reaction conditions but using primers
BB47 and BB61 (5>CGCGAATTCTTATTTATCGTCATCGTCTTTGTAGTCCGAGCC
TCC>3)(SEQ.ID.NO.30), which adds the remainder of the FLAG
epitope sequence followed by a TAA stop codon and an Eco RI cloning
site. The .about.675 bp product of this PCR reaction was "cleaned
up" using the QIAquick PCR Purification (Qiagen) according to the
vendor protocol, digested with Sty I and Eco RI (New England
BioLabs) according to the vendor protocols, ethanol-precipitated,
resuspended in 20 .mu.l of 10 mM Tris-HCl pH 8.5 and run out on a
2% agarose gel. The .about.86 bp Eco RI-Bsr GI fragment of interest
was gel purified using a QIAEX II Gel Extraction Kit (Qiagen)
according to the vendor protocol. This fragment was ligated with
pBBT132 (described in Example 16) that had been cut with Eco RI and
Bsr GI, treated with calf intestinal alkaline phosphatase (New
England BioLabs) and gel purified. The ligation reaction was used
to transform E. coli and plasmids from resulting transformants were
sequenced to identify a clone containing the *167C mutation and
having the correct sequence throughout the .about.86 bp Eco RI-Bsr
GI segment.
[0163] For expression in baculovirus, the EPO genes encoding the 8
muteins were excised from the pUC19-based pBBT132 derivatives as
Bam H I-Eco RI fragments of 630 bp and subcloned into the
pBlueBac4.5 baculovirus transfer vector used to express wild type
EPO.
[0164] Using procedures similar to those described here, one can
construct other cysteine muteins of EPO. The cysteine muteins can
be substitution mutations that substitute cysteine for a natural
amino residue in the EPO coding sequence, insertion mutations that
insert a cysteine residue between two naturally occurring amino
acids in the EPO coding sequence, or addition mutations that add a
cysteine residue preceding the first amino acid, A1, of the EPO
coding sequence or add a cysteine residue following the terminal
amino acid residue, R166, of the EPO coding sequence. The cysteine
residues can be substituted for any amino acid, or inserted between
any two amino acids, anywhere in the EPO coding sequence. Preferred
sites for substituting or inserting cysteine residues in EPO are in
the region preceding Helix A, the A-B loop, the B-C loop, the C-D
loop and the region distal to Helix D. Other preferred sites are
the first or last three amino acids of the A, B, C and D Helices.
Preferred residues in these regions for creating cysteine
substitutions are A1, P2, P3, R4, L5, D8, S9, 125, T27, G28, A30,
E31, H32, S34, N36, 139, D43, T44, K45, N47, Y49, A50, K52, R53,
M54, E55, G57, Q58, G77, Q78, A79, S84, Q86, W88, E89, T107, R110,
A111, G113, A114, Q115, K116, E117, A118, S120, P121, P122, D123,
A124, A125, A127, A128, R131, T132, K154, Y156, T157, G158, E159,
A160, T163, G164, D165, R166. Cysteine residues also can be
inserted immediately preceding or following these amino acids.
Another preferred site for adding a cysteine residue would be
preceding A1, which we refer to as *-1C.
[0165] One also can construct EPO muteins containing a free
cysteine by substituting another amino acid for one of the
naturally-occurring cysteine residues in EPO. The
naturally-occurring cysteine residue that normally forms a
disulfide bond with the substituted cysteine residue is now free.
The non-essential cysteine residue can be replaced with any of the
other 19 amino acids, but preferably with a serine or alanine
residue. A free cysteine residue also can be introduced into EPO by
chemical modification of a naturally occurring amino acid using
procedures such as those described by Sytkowski et al. (1998).
[0166] Using procedures similar to those described in Examples
16-19, one can express the proteins in eukaryotic cells (e.g.,
insect cells or mammalian cells), purify the proteins, PEGylate the
proteins and measure their bioactivities in an in vitro bioassay.
The EPO muteins also can be expressed in prokaryotic cells such as
E. coli using procedures similar to those described in Examples
1-15, or related procedures well known to those skilled in the
art.
B. Insect Cell Expression of EPO-Cys Muteins.
[0167] For expression experiments, the eight plasmids encoding
mutant EPO genes were used to cotransfect Sf 9 cells along with
linearized Bac-N-Blue.TM. DNA using the procedures described above
for plasmid pBBT138, which encodes wild type EPO. The transfection
supernatants were assayed on Sf 9 cells for blue-plaque formation.
For each mutant, ten blue plaques were picked and subcultured as
described in Example 16. Five of the ten resulting supernatants
were screened by SDS-PAGE and Western blot to detect expression of
the EPO muteins. Western blot analysis was carried out using the
procedure described in Example 16 for wild type EPO. Western
results showed that at least 3 of the 5 supernatants screened from
each clone contained FLAG-tagged EPO protein. Western blot results
also revealed that plasmids encoding muteins that should prevent
glycosylation at one of the N-linked glycosylation sites (N24C,
T26C, N38C, T40C, N83C and S85C) yielded proteins with molecular
weights approximately 2,200-2,800 daltons smaller than wild type BV
rEPO. In contrast, the S126 mutein at the O-linked glycosylation
site, and *167C (C-terminal cysteine addition) yielded EPO proteins
that co-migrated with wild type BV rEPO. These results are
consistent with the observation that insect cells typically perform
N-linked glycosylation and that sugar groups attached to O-linked
glycosylation sites are generally small and cause minimal increases
in a protein's molecular weight. Insect cells are reported to
perform O-linked glycosylation (Davies, 1995).
[0168] In order to purify larger amounts of the EPO muteins one
positive recombinant baculovirus isolate that encoded each mutein
was chosen for further amplification. A 500 ml high titer viral
stock was prepared from each of the mutant P1 stocks by
subculturing as described above for the wild type isolate. An
aliquot of each of these P2 lysates was subsequently used to infect
a 500 ml culture for larger scale production of each of the EPO
muteins using the procedures described for wild type EPO in Example
16. The 500 ml supernatants from baculovirus infected cells were
subsequently sterile filtered and stored at 4.degree. C. rEPO-Cys
muteins were purified using an anti-FLAG M2 Affinity Gel column
(Eastman Kodak), using a different batch of resin for each mutein
to ensure no cross-contamination. 5 ml of resin was first washed
with 50 mM Tris, 150 mM NaCl, pH 7.4 (TBS), followed by 0.1 M
Glycine pH 3.0, and finally re-equilibrated in TBS. Sodium chloride
was added to the baculovirus culture filtrate to a final
concentration of 0.15 M before the affinity resin was added. The
resin was batch-loaded on a roller bottle apparatus overnight at
4.degree. C. The next morning the resin was captured using an XK16
Pharmacia column and washed with TBS until the A280 reached
baseline. The rEPO-Cys muteins were eluted with 0.1 M Glycine, pH
3.0. Fractions (1.5 ml) were collected into tubes containing 20
.mu.L of 1 M Tris Base, pH 9.0 to neutralize the solution. Based on
the chromatograms and SDS-PAGE analyses, fractions containing
predominantly pure rEPO-Cys proteins were pooled and frozen.
Protein recoveries from the 500 ml supernatant cultures varied from
75 to 800 .mu.g, depending upon the mutein (Table 2).
[0169] The purified rEPO-Cys muteins migrated with apparent
molecular weights of 27-30 kDa under non-reducing conditions,
consistent with the proteins being monomeric. The apparent
molecular weights of the rEPO-Cys muteins fell into two classes,
presumably due to glycosylation differences. rEPO-Cys proteins
containing mutations at the O-glycosylation site (S126C) and at the
C-terminus (*167C) migrated at a position similar to wild type BV
rEPO. Proteins containing mutations that should prevent
glycosylation of one of the N-linked glycosylation sites (N24C,
T26C, N38C, T40C, N83C and S85C proteins) migrated with apparent
molecular weights of 27-28 kDa, slightly smaller than wild type BV
rEPO. Surprisingly, the S85C protein migrated as a doublet under
both reducing and non-reducing conditions; the major band of the
doublet was the expected size for a protein lacking glycosylation
at one of the N-linked glycosylation sites, while the minor band
was the size expected for fully glycosylated wild-type BV rEPO. All
of the original recombinant Baculovirus plaques isolated for the
S85C mutein yielded rEPO proteins that migrated as doublets,
suggesting that the doublet is due to partial glycosylation at N83
(or another amino acid) rather than contamination of S85C with wild
type BV EPO or S126C or *167C proteins. Several of the muteins,
e.g., S126C, *167C, had small amounts of a second protein that
migrated with an apparent molecular weight of 45-55 kDa, depending
upon the mutein. This is the molecular weight expected for
disulfide-linked rEPO dimers. These bands reacted with the
anti-FLAG antibody in Western blots and were absent when the SDS
gels were run under reducing conditions. These data indicate that
the 45-55 kDa bands represent disulfide-linked rEPO-Cys dimers.
C. Bioactivities of EPO Cysteine Muteins.
[0170] Biological activities of the purified rEPO-Cys muteins were
measured in the UT7/epo cell proliferation assay described in
Example 16. Protein concentrations were determined using a Bradford
assay. Because of the large number of samples the muteins were
divided into two groups for analysis: muteins T26C, T40C, N83C and
S126C comprised one group and muteins N24C, N38C, S85C and *167C
comprised the second group. Muteins within a group were analyzed on
the same day. Wild type BV rEPO and CHO rEPO were analyzed in
parallel on the same days to control for interday variability in
the assays. All of the muteins stimulated proliferation of UT7/epo
cells and had EC.sub.50s that were within three-fold of the wild
type rEPO control proteins. Mean EC.sub.50s for the N24C, T26C,
N83C, S85C, S126 and *167C muteins were similar to the mean
EC.sub.50s for wild type BV rEPO and CHO rEPO, averaging 0.3-0.8
ng/ml (Table 2). Mean EC.sub.50s for the N38C and T40C proteins
were approximately 1 ng/ml (Table 2).
[0171] Bill et al., (1995) reported expression of the EPO cysteine
muteins, N24C, N38C and N83C, in E. coli. In contrast to our
results, they reported that bioactivities of these cysteine muteins
were significantly reduced relative to wild type EPO. Bioactivity
of the N38C mutein was reduced to less than 20% of wild type EPO
bioactivity and bioactivities of the N24C and N83C muteins were
reduced to less than 5% of wild type EPO bioactivity. EC.sub.50s
were not reported. Bill et al. (1995) postulated that the reduced
activities of the cysteine muteins were due to improper folding due
to incorrect formation of disulfide bridges resulting from the
extra cysteine residues introduced into the proteins. They did not
employ cystine or other cysteine-blocking agents in the solutions
used to purify the cysteine muteins.
[0172] Based upon the results of Bill et al. (1995), it was
surprising that our purified N24C, N38C and N83C muteins had
biological activities equal to, or within 3-fold of, wild type EPO.
The data indicate that our methods for expression and purification
of the EPO cysteine muteins results in proteins with superior in
vitro biological activities compared to the methods employed by
Bill et al. (1995).
TABLE-US-00002 TABLE 2 Properties of Human EPO Cysteine Muteins
Protein Expression Recovery Mutation Mean EC.sub.50 Plasmid EPO
Protein .mu.g/500 ml Location (ng/ml) EC.sub.50 Range .sup.1 --
rEPO (CHO) -- -- 0.50 0.29-0.65 (N = 6) pBBT138 rEPO (BV) 345 --
0.37 0.21-0.51 (N = 6) pBBT150 N24C 75 A-B loop 0.76 0.58, 0.85,
0.85 pBBT151 T26C 805 A-B loop 0.27 0.21, 0.22, 0.39 pBBT152 N38C
85 A-B loop 1.05 0.65, 1.20, 1.30 pBBT161 T40C 102 A-B loop 0.95
0.60, 0.75, 1.50 pBBT162 N83C 96 B-C loop 0.50 0.42, 0.49, 0.60
pBBT153 S85C 135 B-C loop 0.72 0.50, 0.80, 0.85 pBBT154 S126C 220
C-D loop 0.31 0.25, 0.25, 0.42 pBBT155 *167C 129 C-terminus 0.61
0.51, 0.65, 0.68 .sup.1 Data from individual experiments. A range
is shown when N > 3.
Example 18
PEGylation of EPO Cysteine Muteins
A. Small-Scale PEGylation of EPO Cysteine Muteins
[0173] Several cysteine muteins and wild type EPO were tested for
their ability to be PEGylated with a 5 kDa cysteine-reactive PEG
following treatment with the reducing agent TCEP (Tris
(2-carboxyethyl) phosphine-HCl). A titration study was performed
with the T26C mutein to identity appropriate TCEP and PEG reagent
concentrations for PEGylation, while avoiding over-reduction of the
protein. We monitored partial reduction of the protein by SDS-PAGE,
using wild type BV rEPO as a control. Increasing concentrations of
TCEP (0.5 M to 6.0 M excess) in the presence of a 10-40-fold molar
excess of either vinylsulfone or maleimide 5 kDa PEG (Fluka) were
tested. The reactions were analyzed by non-reducing SDS-PAGE. Wild
type BV rEPO was treated in parallel as a control to identify
partial reduction conditions that yielded significant amounts of
monoPEGylated EPO-Cys muteins (a single PEG molecule attached to
the EPO-Cys mutein), but no PEGylation of wild type BV rEPO. A
5-fold molar excess of TCEP and a 30-fold molar excess of 5 kDa
vinylsulfone-PEG yielded significant amounts of monoPEGylated T26C
protein without PEGylation of wild type BV rEPO.
[0174] Based on our findings with the T26C mutein, the following
conditions were used to PEGylate several other cysteine muteins.
Aliquots (1-2 .mu.g) of purified BV rEPO and EPO-Cys muteins were
incubated for 1 hr with a 5.times. molar excess of TCEP and a
30.times. molar excess of 5 kDa vinylsulfone PEG at pH 8.0 at room
temperature. The reactions were stopped by dilution into SDS sample
buffer (without reducing reagent) and analyzed by SDS-PAGE. Four
cysteine muteins (N24C, T26C, S126C and *167C) were readily
monoPEGylated under these conditions, as evidenced by the
appearance of a new protein band migrating at approximately 35 kDa.
The 35 kDa species is the size expected for mono-PEGylated EPO; no
diPEGylated species, which are expected to have molecular weights
of approximately 40 kDa, were detected for any of the EPO-cys
muteins under these reaction conditions. Control experiments
indicated that the cysteine muteins needed to be reduced with TCEP
in order to be PEGylated. Wild type BV EPO did not PEGylate under
identical partial reducing conditions. These data indicate that the
PEG molecule is attached to the free cysteine introduced into the
N24C, T26C, S126C and *167C EPO-Cys muteins.
B. Preparation of PEG-T26C and PEG-S126C for Bioactivity
Measurements.
[0175] We PEGylated larger quantities of the T26C and S126C
proteins so that the PEGylated proteins could be purified for
bioactivity measurements. PEGylation reactions were scaled to
include 75 .mu.g of each protein and the same molar ratios of TCEP
and 5 kDa-PEG used in the smaller 1 .mu.g reactions. After 1 hour,
the PEGylation mixture was diluted 10.times. with 20 mM Tris-HCl,
pH 8.0, 20% glycerol (Buffer A) and loaded immediately onto a 1 ml
Q-Sepharose column equilibrated in Buffer A. The column was washed
with equilibration buffer and bound proteins eluted with a linear
10 volume increasing salt gradient from 0 to 150 mM NaCl in 20 mM
Tris-HCl, pH 8.0, 20% glycerol. The presence of the PEG moiety
decreased the protein's affinity for the resin, allowing the
PEGylated protein to be separated from the non-PEGylated protein.
Fractions containing mono-PEGylated protein were identified by
SDS-PAGE, followed by Coomassie Blue staining. Fractions containing
PEG-T26C but no visible underivatized protein, were stored frozen
at -80.degree. C. and subsequently used in bioassays. Similar
procedures were used to obtain purified PEG-S126C. A Western blot
was performed to assess the purity of the PEG-T26C and PEG-S126C
preparations used in bioassays. The Western blot was performed as
described in Example 16. The Western blot gave strong signals at
the sizes expected for PEG-T26C and PEG-S126C, but failed to detect
any protein migrating at the positions expected for the unPEGylated
S126C and T26C proteins. From these results, we conclude there is
little (<5%) unPEGylated protein present in the purified
PEGylated muteins.
C. Bioactivities of PEG-T26C and PEG-S126C Cysteine Muteins
[0176] The biological activities of the purified PEG-T26C and
PEG-S126C proteins were measured in the UT7/epo cell proliferation
assay described in Example 16. Protein concentrations of the
PEG-EPO-Cys muteins were quantitated using a human EPO ELISA kit (R
& D Systems), following the manufacturer's suggested
directions. Protein concentrations of the non-PEGylated muteins and
wild type BV rEPO also were quantitated by ELISA. The ELISA assay
was performed on all the proteins on the same day. Serial
three-fold dilutions of the protein samples were prepared and
analyzed in the bioassay. Unused material from each serial dilution
was stored frozen at -80.degree. C. and later analyzed in the ELISA
to determine an accurate protein concentration for the starting
material. Several of the serial dilutions for each protein sample
were analyzed to ensure that the protein concentration in at least
one test sample fell within the linear range of the standard ELISA
curve, which is 0.0025-0.2 Units/ml or approximately 0.02-1.6
ng/ml. At least two of the serial dilutions for each sample fell
within this linear range.
[0177] Biological activities for the PEG-T26C and PEG-S126C muteins
were similar to those of the non-modified T26C and S126C proteins
and wild type BV rEPO. Mean EC.sub.50s for the PEG-T26C and
PEG-S126C muteins were similar to the mean EC.sub.50 values
determined for the non-PEGylated T26C and S126C muteins and wild
type BV rEPO, ranging from 0.48-0.82 ng/ml (Table 3). Biologically
active, PEGylated EPO proteins have not been described
previously.
TABLE-US-00003 TABLE 3 Bioactivities of PEG-Cys EPO Muteins Mean
EC.sub.50 EC.sub.50 Range .sup.1 EPO Protein (ng/ml) (ng/ml) BV EPO
0.82 0.55, 0.95, 0.95 T26C 0.73 0.50, 0.85, 0.85 PEG-T26C 0.58
0.35, 0.65, 0.75 S126C 0.74 0.65, 0.75, 0.82 PEG-S126C 0.48 0.38,
0.52, 0.55 .sup.1 Data from three experiments.
Example 19
Expression and Purification of EPO Cysteine Muteins in Mammalian
Cells
[0178] The EPO cysteine muteins also can be expressed in mammalian
cells and purified from the conditioned media. The EPO cysteine
muteins can be expressed by transient transfection of mammalian
cells or by constructing stably transformed mammalian cell lines
expressing the EPO cysteine muteins. For therapeutic applications
in humans, it is preferable that the EPO cysteine muteins be
expressed without the linker and FLAG sequences. Monkey COS cells
(available from the American Type culture Collection) can be used
for transient transfection experiments, using procedures well known
to those of skill in the art. A number of commercial sources, e.g.,
GIBCO/BRL sell lipid transfection reagents and provide detailed
protocols that can be used to express the EPO cysteine muteins by
transient transfection. Wild type EPO is manufactured for use in
humans using stably transformed Chinese hamster ovary (CHO) cells
expressing the protein. Stably transfected CHO cell lines are
widely used for high-level expression of recombinant proteins
(Geisse et al. 1996; Trill et al. 1995). In CHO cells, high level
expression of chromosomally integrated heterologous genes can be
achieved by gene amplification. Typically the gene of interest is
linked to a marker gene for which amplification is selectable. A
variety of genes which provide selections for amplification have
been described (Kaufman 1990) but murine dihydrofolate reductase
(dhfr) is frequently employed. Amplification of this gene confers
resistance to the folate analog methotrexate (MTX) and the level of
resistance increases with dhfr gene copy number (Alt et al., 1978).
Utility of MTX selection is enhanced by the availability of CHO
cell lines that are deficient in dhfr (Urlaub and Chasin,
1980).
[0179] One skilled in the art can construct expression vectors for
the EPO cysteine muteins that incorporate the murine dhfr gene into
the commercially available pCDNA3.1 expression vector (Invitrogen),
which includes the neomycin phosphotransferase (NPT) gene that
confers resistance to G418. The murine dhfr expression vector
pdhfr2.9 is available from the American Type Culture Collection
(catalogue No. 37165). This dhfr gene is selectable in dhfr.sup.-
CHO cell lines and can be amplified by standard selections for MTX
resistance (Crouse et al 1983). The dhfr coding sequence can be
excised from pdhfr2.9 as a .about.900 bp Bgl II fragment and cloned
into the unique Bam HI site of the polylinker of the expression
vector pREP4 (Invitrogen). This construct will position the gene
downstream of the strong RSV promoter, which is known to function
in CHO cells (Trill et al, 1995) and upstream of a polyadenylation
site derived from SV40. This dhfr expression cassette can then be
excised from pREP4 as a Sal I fragment since Sal I sites closely
flank the promoter and polyA addition site. Using oligonucleotide
linkers this Sal I fragment can be cloned into the unique Bgl II
site of pCDNA3.1.
[0180] For expression in mammalian cells such as COS or CHO cells,
the EPO cysteine mutein cDNAs can be modified by PCR-based
mutagenesis. At the 5' end one can add a Kozak consensus sequence
prior to the translational initiator ATG codon in order to enhance
translation in mammalian cells. At the 3' end, the linker and FLAG
sequences can be removed and the natural coding sequence and
translation termination signal restored. These modified EPO cDNAs
can then be cloned as Bam HI-Eco RI fragments into the polylinker
of pCDNA3.1 for transient transfection experiments or into the
polylinker of the the pCDNA3.1::dhfr vector for stable expression
in mammalian cells. For mammalian cell expression, the mutant EPO
genes encoding the cysteine muteins would be modified at the 5' end
to incorporate a Kozak consensus sequence (GCCACC) immediately
preceding the translational initiiatior ATG codon in order to
enhance translation in mammalian cells. At the 3' end the linker
and FLAG sequences would be removed and the natural coding sequence
restored. These modifications could be accomplished by a variety of
mutagensis techniques that are well known to those skilled in the
art. PCR-based mutagensis procedures based on those described in
Examples 4 and 17 could be employed. PCR primers BB302
(5>CGCGGATCCGCCACCATGGGGGTGCAC GAATGTCCT>3)(SEQ.ID.NO.47) and
BB303 (5>CGCGAATTCTCATCTGTCCCCTGTCCTGCAGCC>3)(SEQ.ID.NO. 48)
could be used to PCR the mutated EPO genes cloned in pUC19 or
pBlueBac4.5 as templates. Forward primer BB302 anneals to the EPO
gene sequence encoding the first seven amino acids of the EPO
secretion signal, adds a Kozak consensus sequence, GCCACC,
immediately preceding the translational initiator ATG codon, and
includes a Bam HI site for cloning purposes. The reverse primer
BB303 anneals to sequences encoding the carboxyterminal seven amino
acids of the EPO coding sequence, adds a TGA translational stop
codon following the EPO coding sequence and includes a Eco RI site
for cloning purposes. The products of the individual PCR reactions
using these primers and any mutant EPO gene template that has a
mutation between these two primers, e.g. amino acid substitutions
at amino acids 1 through 159 of the mature EPO coding sequence,
will produce PCR products that can be purified, digested with Bam
HI and Eco RI and cloned into a vector suitable for expression in
mammalian cells such as pCDNA3.1(+) (Invitrogen). PCR primers 302
and 303 also could be used to modify EPO cysteine muteins in which
a cysteine residue is added preceding the first amino acid, A1, of
the mature EPO coding sequence, but distal to the EPO signal
sequence. Mutations in the EPO sequence that encode the
carboxyterminal seven amino acids, or the *167C mutation described
in Example 17, would require the use of alternative reverse primers
in place of BB303. These primers would be individually designed to
include the mutated cysteine codon, at least 21 nucleotides at the
3' end of the oligo that exactly match the template target, and the
Eco RI site for cloning purposes. For example the reverse primer
BB304 (5>CGCGAATTCTCAACATCT GTCCCCTGTCCTG CAGCC>3)(SEQ.ID.NO.
49) and BB302 could be used in a PCR reaction with the mutated EPO
*167C gene cloned in pUC19 or pBlueBac4.5 as template to generate a
modified mutant EPO gene encoding the *167C mutein that would be
suitable for expression in mammalian cell expression systems.
[0181] Endotoxin free plasmid DNAs are preferred for transfecting
mammalian cells such as COS or dhfr.sup.- CHO cells. Dhfr.sup.- CHO
cell lines can be obtained from a number of sources such as Dr. L.
Chasin at Columbia University (CHO K1 DUKX B11) or from the
American Type Culture Collection (CHO duk.sup.-, ATCC No.
CRL-9096). The cells can be cultured in F12/DMEM medium
supplemented with 10% FBS, glutamine, glycine, hypoxanthine, and
thymidine (Lucas et al., 1996). Transfections can be carried out by
electroporation or by using transfection reagents well known to
those of skill in the art such as LipofectAMINE (Gibco BRL), using
the vendor protocols and/or those described in the literature
(Kaufman, 1990). One can select for dhfr.sup.+ trasfectants in
F12/DMEM supplemented with 7% dialyzed FCS and lacking glutamine,
glycine, hypoxanthine, and thymidine (Lucas et al., 1996).
Alternatively one can select for G418 resistance (encoded by the
NPT gene of pCDNA3.1) and subsequently screen transfectants for the
dhfr.sup.+ phenotype. Dhfr.sup.+ clones can be expanded in
selection medium and culture supernatants screened for EPO cysteine
mutein production using commercially available EPO ELISA kits
(available from R & D Systems) or by Western blot using
anti-EPO antisera (available from R&D Systems). Clones
expressing the EPO cysteine mutein can then be pooled and subjected
to multiple rounds of selection for MTX resistance at increasing
drug concentration as described by Kaufman (1990). After each round
of MTX selection, individual clones can be tested for EPO cysteine
mutein production. These procedures are well described in the
literature and have been used to express a variety of heterologous
protein in CHO cells (reviewed in Kaufman, 1990).
[0182] Preferably, the media used to grow the CHO cells expressing
the EPO cysteine muteins should contain cystine or another cysteine
blocking agent. The EPO cysteine muteins can be purified from the
conditioned medium of CHO cells using protocols similar to those
described by Imai et al. (1990). After removal of the CHO cells by
centrifugation, the EPO cysteine muteins can be purified from the
supernatant by column chromatography using techniques well known to
those of skill in the art. The column chromatography steps employed
for the purification of the EPO cysteine muteins could include Blue
Sepharose, hydroxyapatite, reversed phase, hydrophobic interaction,
size exclusion and ion-exchange chromatography.
Example 20
Cloning, Expression and Purification of IFN-.alpha.2
A. Cloning DNA Sequences Encoding IFN-.alpha.2.
[0183] There are at least 25 distinct IFN-.alpha. genes which
encode proteins that share 70% or greater amino acid identity
(Blatt et al., 1996). Due to the high degree of DNA sequence
homology between IFN-.alpha. species, the IFN-.alpha.2 gene was
cloned in two steps. First, the IFN-.alpha.2 gene was amplified by
PCR from human genomic DNA using primers corresponding to unique
sequences upstream and downstream of the IFN-.alpha.2 gene. This
PCR product was cloned and sequenced to confirm that it encodes the
IFN-.alpha.2 gene. Subsequently, the IFN-.alpha.2 coding sequence
was modified by PCR and subcloned for expression in E. coli and
site-directed mutagenesis. DNA encoding IFN-.alpha.2 was amplified
by PCR from human genomic DNA (CLONTECH). PCR reactions were
carried out with BB93 (5>CGCGAATTCGGATATGTAAA
TAGATACACAGTG>3) (SEQ.ID.NO. 50) and BB94
(5>CGCAAGCTTAAAAGATTTAAATCGTGTCATGGT>3) (SEQ.ID.NO.51). BB93
anneals to genomic sequences .about.300 bp upstream (i.e. 5' to) of
the IFN-.alpha.2 coding sequence and contains an Eco RI site for
cloning purposes. BB94 anneals to genomic sequences .about.100 bp
downstream (i.e. 3' to) of the IFN-.alpha.2 coding sequence and
contains a Hind III site for cloning purposes. The resulting
.about.1 kb PCR product was digested with Eco RI and Hind III and
cloned into similarly digested, and alkaline phosphatased,
pCDNA3.1(+) (Invitrogen). A clone having the correct DNA sequence
for IFN-.alpha.2 (Henco et al, 1985) was identified and designated
pBBT160.
[0184] For cytoplasmic expression in E. coli the cloned
IFN-.alpha.2 gene of pBBT160 was modified by PCR to incorporate a
methionine codon immediately prior to the first residue (C1) of the
mature IFN-.alpha.2 protein. A TAA stop codon was added following
the carboxy-terminal residue, E165. At the same time, Xba I and Sal
I sites were added and a Bgl II site was eliminated in order to
provide convenient restriction sites for subsequent mutagenesis. In
this reaction pBBT160 was used as template and amplified by primers
BB99 5>CGCAAGCTTCATATGTGTGATCTGCCTCAAACCCACAGCCTG
GGTTCTAGAAGGACCTTGATGCTC>3) (SEQ.ID.NO. 52) and BB100
(5>CGCGAATTCTTATT
CCTTACTTCTTAAACTTTCTTGCAAGTTTGTCGACAAAGAAAAGGATCTCATGAT>3)
(SEQ.ID.NO. 53). BB99 anneals to the 5' end of the coding sequence
of mature IFN-.alpha.2 and encodes an initiator methionine
preceding the first amino acid of mature IFN-.alpha.2. BB99
introduces an Xba I site .about.30 bp downstream of the initiator
ATG, but the amino acid sequence of the protein is unaltered. A
Hind III site and an Nde I site, which overlaps the ATG, were
included for cloning purposes. The reverse primer, BB100, anneals
to the 3' end of the coding sequence and adds a TAA stop codon.
BB100 introduces a Sal I site .about.30 bp upstream of the TAA
codon and eliminates a naturally occurring Bgl II site located
.about.15 bp further upstream. As a result, the naturally occurring
Bgl II site located .about.185 bp downstream of the initiator ATG
becomes a unique site. None of these alterations changed the amino
acid sequence. An Eco RI site was added immediately downstream of
the stop codon for cloning purposes. The .about.520 bp PCR product
was digested with Hind III and Eco RI, gel purified and cloned into
similarly digested plasmid pCDNA3.1(+). One clone was determined to
have the correct DNA sequence. This plasmid was designated pBBT164.
For cytoplasmic expression in E. coli, the .about.520 bp Nde I-Eco
RI fragment of pBBT164 was cloned into similarly digested
expression vector, pCYB1, (New England Biolabs). The plasmid vector
pCYB1 allows genes to be expressed as unfused proteins or as fusion
proteins; this construct was created so that the protein is
expressed as an unfused protein. The resulting plasmid was termed
pBBT170 and encodes met-IFN-.alpha.2. The Nde I-Eco RI fragment of
pBBT164 containing the met-IFN-.alpha.2 sequence also was subcloned
into Nde I-Eco RI-digested pUC18 to generate plasmid pBBT168.
[0185] IFN-.alpha.2 also can be expressed in an active form in E.
coli by secretion into the periplasmic space (Voss et al., 1994).
Secreted IFN-.alpha.2 lacks an N-terminal methionine and has an
amino acid sequence identical to naturally occurring IFN-.alpha.2.
In order to express a secreted form of IFN-.alpha.2, the leader
sequence of the E. coli heat-stable enterotoxin (STII) gene (Picken
et al., 1983) was fused to the coding sequence for mature
IFN-.alpha.2 via PCR. Because of its length, the STII sequence was
added in two sequential PCR reactions. The first reaction used
forward primer BB101
(5>GCATCTATGTTCGTTTTCTCTATCGCTACCAACGCTTACGCATGTGATCT
GCCTCAAACCCAC AGC>3) (SEQ.ID.NO. 54) and reverse primer BB100
with pBBT164 (described above) as template. The 3' end (21 bp) of
BB101 anneals to the 5' end of the coding sequence of mature
IFN-.alpha.2. The 5' segment (39 nucleotides) of BB101 encodes a
portion of the STII leader peptide. The .about.550 bp PCR product
of this reaction was gel purified and used as template for the
second PCR reaction. The second PCR reaction used reverse primer
BB100 and forward primer BB11 (5'-CCCCCTCTAGACATATGAAG
AAGAACATCGCATTCCTGCTGGCATCTATGTTCGTTTTCTC TATCG-3') (SEQ.ID.NO. 7).
BB11 adds the remainder of the STII leader peptide and contains an
Nde I site overlapping the initiator ATG of the STII leader. The
.about.590 bp product of this reaction was digested with Nde I and
Xba I. The .about.100 bp Nde I-XbaI fragment containing the STII
leader sequence and amino-terminal .about.30 bp of IFN-.alpha.2,
was gel-purified and ligated with pBBT168 [pUC18::met-IFN-.alpha.2]
that had been digested with Nde I and Xba I, treated with alkaline
phosphatase and gel purified. In this step the .about.30 bp Nde
I-Xba I amino-terminal segment of the met-IFN-.alpha.2 gene is
replaced with the PCR derived .about.100 bp Nde I-Xba I
amino-terminal segment of the STII-IFN-.alpha.2 PCR product. The
sequence of the resulting pUC18::STII-IFN-.alpha.2 construct was
confirmed and that plasmid was designated pBBT177. For expression
in E. coli, pBBT177 was digested with Nde I and Eco RI and the
.about.570 bp fragment containing the STII-IFN-.alpha.2 gene was
gel-purified and cloned into the expression vector pCYB1 under the
control of the tac promoter. The resulting plasmid was designated
pBBT178.
B. Expression of rIFN-.alpha.2 in E. coli.
[0186] pBBT170, which encodes met-IFN-.alpha.2, and parental
vector, pCYB1, were transformed into E. coli JM109. Experiments
with these strains resulted in expression of met-IFN.alpha.-2.
Secreted IFN-.alpha.2 is preferable to cytoplasmic met-IFN-.alpha.2
in that secreted IFN-.alpha.2 has the same amino acid sequence as
naturally occurring IFN-.alpha.2.
[0187] For expression of secreted rIFN-.alpha.2, pBBT178
[pCYB1::STII-IFN-.alpha.2] and the parental vector pCYB1 were
transformed into E. coli W3110. The resulting strains were
designated BOB202: W3110(pBBT178) and BOB130: W3110(pCYB1). We
performed a series of experiments testing growth and rIFN-.alpha.2
expression of BOB202 in phosphate- or MES-buffered LB media at
initial pHs ranging from 5.0 to 7.0. Saturated overnight cultures
were diluted to 0.025 O.D. at A.sub.600 in buffered LB containing
100 .mu.g/ml ampicillin and incubated at 37.degree. C. in shake
flasks. When culture O.D.s reached .about.0.3-0.5, IPTG was added
to a final concentration of 0.5 mM to induce expression of
rIFN-.alpha.2. For initial experiments, cultures were sampled at 0,
1, 3, 5 and .about.16 h post-induction. Samples of induced and
uninduced cultures were analyzed by SDS-PAGE on precast 14%
Tris-glycine polyacrylamide gels stained with Coomassie Blue. In
addition to the expected .about.19 kDa processed form of
IFN-.alpha.2, we observed a higher than expected molecular weight
(.about.21.5 kDa) form of the protein. The higher molecular weight
form could result from lack of proteolytic processing of the STII
leader peptide; the molecular weight of the leader peptide is
consistent with this hypothesis. Our results indicated that lower
pH enhanced accumulation of the correctly sized rIFN-.alpha.2 band.
We observed that at or above pH 6.5 the 21.5 kDa form was
predominant, while at or below pH 6.0 a band of .about.19 kDa,
which comigrated with an E. coli-expressed rIFN-.alpha.2 standard
(Endogen, Inc.), was the predominant form of the protein. At or
below pH 6.0, the 19 kDa band accounted for at least 80% and
probably greater than 90% of the IFN-.alpha.2 expressed by the E.
coli cells. Based on these findings, further expression experiments
used LB medium buffered with 100 mM MES to a pH of 5.5. Voss et al.
(1994) also reported secretion of IFN-.alpha.2 to the E. coli
periplasm using the STII leader sequence. They also observed that
the proportion of rIFN-.alpha.2 present in the 21.5 kDa band was
reduced, and the proportion migrating at 19 kDa was increased when
culture pH was maintained at 6.7 as compared to 7.0. At pH 7.0,
Voss et al. (1994) reported that 10-30% of the STII:IFN-.alpha.2
fusion protein was processed to yield the 19 kDa mature
IFN-.alpha.2 protein. The percentage of correctly processed 19 kDa
IFN-.alpha.2 protein could be increased to 50-60% by growing the E.
coli at pH 6.7. However, even at this pH, a substantial amount
(40-50%) of the STII:IFN-.alpha.2 fusion protein remained
unprocessed, reducing the yield of correctly processed 19 kDa
IFN-.alpha.2. Voss et al. (1994) suggested that pH 6.7 was optimal
for maximizing the amount of secreted rIFN-.alpha.2 migrating at 19
kDa. Voss et al. (1994) varied several growth parameters to attempt
to increase the percentage of correctly processed 19 kDa
IFN-.alpha.2 protein to greater than 50-60%, but were unsuccessful.
Our data indicate that lowering the pH to below 6.5, and preferably
to 5.5 to 6.0, maximizes the ratio of cleaved (19 kDa) to uncleaved
(21.5 kDa) rIFN-.alpha.2 product. At these lower pHs, the percent
of correctly processed 19 kDa IFN-.alpha.2 is increased to at least
80% and probably 90-100% of the total IFN-.alpha.2 synthesized by
the cells.
[0188] Cultures expressing rIFN-.alpha.2 were subjected to osmotic
shock based on the procedure of Koshland and Botstein (1980). This
procedure ruptures the E. coli outer membrane and releases the
contents of the periplasm into the surrounding medium. Subsequent
centrifugation separates the soluble periplasmic components
(recovered in the supernatant) from cytoplasmic, insoluble
periplasmic, and cell-associated components (recovered in the
pellet). Approximately 25-50% of the 19 kDa rIFN-.alpha.2
synthesized by BOB202 was recovered in the supernatant. None of the
21.5 kDa form of rIFN-.alpha.2 was observed in the soluble
periplasmic fraction.
C. Large-Scale Expression and Purification of rIFN-.alpha.2 in E.
coli:
[0189] In order to purify the wild type rIFN-.alpha.2 protein,
fresh saturated overnight cultures of BOB202 were inoculated at
.about.0.02 OD @ A.sub.600 in LB 100 mM MES (pH5.5) containing 100
.mu.g/ml ampicillin. Typically, a 325 ml culture was grown in a 2
liter shake flask at 37.degree. C. in a gyrotory shaker water bath
at .about.160-200 rpm. When cultures reached a density of
.about.0.3-0.4 OD, IPTG was added to a final concentration of 0.5
mM. The induced cultures were then incubated for .about.16 h.
Cultures were subjected to osmotic shock based on the procedure of
Hsuing et. al. (1986). The cells were pelleted by centrifugation
and resuspended at .about.25 OD/ml in ice cold 20% sucrose, 10 mM
Tris-HCl (pH 8.0). Resuspended cells were incubated on ice for 15
min and centrifuged at 9500.times.g for 10 min. Pellets were then
resuspended in ice cold 10 mM Tris-HCl pH (8.0), incubated on ice
for 15 min and centrifuged at 9500.times.g for 10 min. The
resulting supernatant (the osmotic shock lysate) was either
processed immediately or stored at -80.degree. C.
[0190] rIFN-.alpha.2 was purified as follows. The pH of the
supernatant from the osmotic shock was adjusted to 3, centrifuged
to remove any precipitate, and loaded onto a 5 ml Pharmacia HiTrap
S-Sepharose column equilibrated in 20 mM MES pH 5.0 (Buffer A). The
bound proteins were eluted with a linear salt gradient from 0-100%
Buffer B (500 mM NaCl, 20 mM MES, 10% ethylene glycol). Column
fractions were analyzed by non-reducing SDS-PAGE. rIFN-.alpha.2
eluted at approximately 225-235 mM NaCl. Fractions that were
enriched for rIFN-.alpha.2 were pooled and further fractionated on
a 1 mL Cu' IMAC (Immobilized Metal Affinity Chromatography) Hi Trap
column previously equilibrated in 40 mM sodium phosphate pH 6.0, 1
M NaCl, 0.1% Tween 20. rIFN-.alpha.2 was eluted with a reverse pH
gradient from 5.5 to 4.1 in 40 mM sodium phosphate, 1 M NaCl, 0.1%
Tween 20. rIFN-.alpha.2 eluted after the gradient reached 100%
buffer B, when the pH of the eluate finally reached pH 4.1.
Fractions from the Cu IMAC column that contained purified, properly
folded rIFN-.alpha.2 were pooled and stored as frozen aliquots at
-80.degree. C. A minor rIFN-.alpha.2 variant was detectable in some
of the earlier eluting fractions. This variant, which results from
incomplete disulfide formation and is biologically active, has been
described previously (Khan and Rai, 1990). Fractions containing
this variant were not added to the final pool of purified
rIFN-.alpha.2. The final yield of rIFN-.alpha.2, as determined by
absorbance at 280 nm and by Bradford analysis, was about 400 .mu.g
from 250 ml of culture. Reduced IFN-.alpha.2 migrates with a
slightly larger apparent molecular weight than non-reduced
IFN-.alpha.2 when analyzed by SDS-PAGE (Morehead et al., 1984).
This apparent molecular weight change is due to the reduction of
the native disulfides in IFN-.alpha.2. Our rIFN-.alpha.2 comigrated
with the commercial rIFN-.alpha.2 standard under both reducing and
non-reducing conditions.
D. In Vitro Bioactivity of Wild Type rIFN-.alpha.2.
[0191] IFN-.alpha. bioactivity can be measured using in vitro
antiviral assays or cell proliferation inhibition assays. We
developed a cell growth inhibition assay to measure bioactivity of
wild type rIFN-.alpha.2. The human Daudi B cell line (American Type
Culture Collection) is sensitive to the growth inhibiting
properties of IFN-.alpha. and is routinely used to measure
bioactivity of IFN-.alpha. (Horoszewicz et al., 1979; Evinger and
Pestka, 1981). Daudi cells were maintained in RPMI 1640 media
supplemented with 10% FBS, 50 units/ml penicillin and 50 .mu.g/ml
streptomycin. For bioassays, the cells were washed three times with
RPMI 1640 media and resuspended at a concentration of
4.times.10.sup.5 cells/ml in RPMI 1640 media containing 10% FBS, 50
units/ml penicillin and 50 .mu.g/ml streptomycin. Fifty .mu.l
(2.times.10.sup.4 cells) of the cell suspension were aliquotted per
test well of a flat bottom 96 well tissue culture plate. Serial
3-fold dilutions of the protein samples to be tested were prepared
in RPMI 1640 media containing 10% FBS, 50 units/ml penicillin and
50 .mu.g/ml streptomycin. Fifty .mu.l of the diluted protein
samples were added to the test wells and the plates incubated at
37.degree. C. in a humidified 5% CO.sub.2 tissue culture incubator.
Protein samples were assayed in triplicate wells. After 4 days, 20
.mu.l of CellTiter 96 AQueous One Solution Reagent (Promega
Corporation) was added to each well and the plates incubated at
37.degree. C. in the tissue culture incubator for 1-4 h. Absorbance
was read at 490 nm using a microplate reader. Control wells
contained media but no cells. Mean absorbance values for the
triplicate control wells were subtracted from mean values obtained
for each set of triplicate test wells. Serial dilutions of E.
coli-expressed rIFN-.alpha.2 (Endogen, Inc.) were analyzed in
parallel. IC.sub.50s (the concentration of protein required for
half maximal growth inhibition) were calculated for each sample and
used to compare bioactivities of the proteins.
[0192] Proliferation of the Daudi cell line is strongly inhibited
by rIFN-.alpha.2, as evidenced by a dose-dependent decrease in
absorbance values. Commercial rIFN-.alpha.2 (Endogen) and wild type
rIFN-.alpha.2 prepared by us reached the same maximal level of
growth inhibition, within the error of the assay, and had similar
mean IC.sub.50s of 13-16 .mu.g/ml (Table 4). IC.sub.50 values for
these proteins ranged from 7-29 .mu.g/ml in assays performed on
different days (Table 4); therefore comparisons between proteins
were made on samples analyzed on the same day.
Example 21
Construction, Expression, Purification and Bioactivity of
IFN-.alpha.2 Cysteine Muteins
A. Construction of IFN-.alpha.2 Cysteine Muteins.
[0193] Seventeen mutant IFN-.alpha.2 genes were constructed using
site-directed PCR-based mutagenesis procedures similar to those
described in Example 4. We constructed one mutein in the
amino-terminal region proximal to helix A [Q5C]; six muteins in the
A-B loop [N45C, Q46C, F47C, Q48C, A50C and 43C44 (an insertion of a
cysteine between residues 43 and 44); one mutein [D77C] in the
short, two residue, BC loop; four muteins in the CD loop [Q101C,
T106C, E107C, and T108C]; three muteins in the carboxy-terminal
region distal to the E helix [S163C, E165C, and *166C (the addition
of a cysteine residue to the natural carboxy-terminus)]. We also
constructed muteins C1S and C98S, which eliminate the naturally
occurring, but non-essential, C1-C98 disulfide (Lydon et al., 1985;
Morehead et al., 1994). The C1S substitution in the amino-terminal
region proximal to helix A generates a free cysteine in the C helix
(C98), whereas the C98S substitution in the C helix generates a
free cysteine in the region proximal to helix A (C1).
[0194] For mutagenesis, PCR primer oligonucleotides were designed
to incorporate nucleotide changes that resulted in the
incorporation of a cysteine residue at the chosen position within
the IFN-.alpha.2 coding sequence. Where feasible, the mutagenic
oligo also was designed to span a nearby restriction site that
could be used to clone the mutagenized PCR fragment into an
appropriate plasmid. When no useful restriction site was located
sufficiently near the position of the mutation, the technique of
"mutagenesis by overlap extension" was employed (Horton et al.,
1993). The template used for the mutagenic PCR reactions was
plasmid pBBT177 (described in Example 20) in which the
STII-IFN-.alpha.2 gene is cloned as an Nde I-Eco RI fragment into
pUC18. The PCR products were digested with appropriate restriction
endonucleases, gel-purified and ligated with pBBT177 vector DNA
that had been cut with those same restriction enzymes, alkaline
phosphatase treated, and gel-purified. Transformants from these
ligations were grown up and plasmid DNAs isolated and sequenced.
The sequence of the entire cloned mutagenized PCR fragment was
determined to verify the presence of the mutation of interest, and
the absence of any additional mutations that potentially could be
introduced by the PCR reaction or by the synthetic oligonucleotide
primers.
[0195] The substitution mutation Q5C was constructed using the
technique of "mutagenesis by overlap extension" as described in
Example 4. The initial, or "primary" PCR reactions for the Q5C
construction were performed in a 50 .mu.l reaction volume in
1.times. Promega PCR buffer containing 1.5 mM MgCl.sub.2, each
primer at 0.2 .mu.M, each of dATP, dGTP, dTTP and dCTP at 200
.mu.M, 1 ng of template plasmid pBBT177 (described in Example 20),
1.5 units of Taq Polymerase (Promega), and 0.25 units of Pfu
Polymerase (Stratagene). Reactions were performed in a Robocycler
Gradient 96 thermal cycler (Stratagene). The reaction program
entailed: 96.degree. C. for 3 minutes, 25 cycles of [95.degree. C.
for 1 minute, 60.degree. C. for 1.25 minutes, 72.degree. C. for 1
minute] followed by a hold at 6.degree. C. The primer pairs used
were [BB125.times.BB130] and [BB126.times.BB129]. BB125
(5>CTATGC GGCATCAGAGCAGATA>3)(SEQ.ID.NO. 55) anneals to the
pUC18 vector sequence .about.20 bp upstream of the cloned
IFN-.alpha.2 sequence. BB126
(5>TGTGGAATTGTGAGCGGATAAC>3)(SEQ.ID.NO. 56) anneals to the
pUC18 vector sequence .about.40 bp downstream of the cloned
IFN-.alpha.2 sequence. BB129 and BB130 are complementary mutagenic
oligonucleotides that change the CAA codon for Q5 to a TGT codon
for cysteine. The sequence of BB129 is
(5>TGTGATCTGCCTTGTACCCACAGCCTG>3)(SEQ.ID.NO. 57) and the
sequence of BB130 is (5>CAGGCTGT
GGGTACAAGGCAGATCACA>3)(SEQ.ID.NO. 58). The [BB125.times.BB130]
and [BB126.times.BB129] PCR reactions gave products of the expected
sizes: .about.140 bp for [BB125.times.BB130] and .about.560 bp for
[BB126.times.BB129]. The PCR products were "cleaned up" using the
QIAquick PCR Purification Kit (Qiagen) according to the vendor
protocol, run out on a 2% agarose gel, gel-purified using a QIAEX
II Gel Extraction Kit (Qiagen) according to the vendor protocol and
recovered in 20 .mu.l 10 mM Tris-HCl (pH 8.5). These two
mutagenized fragments were then "spliced" together in the
subsequent, or "secondary" PCR reaction. In this reaction 2.mu.1 of
each of the gel-purified PCR products of the primary reactions were
used as template and BB125 and BB126 were used as primers. The
reaction volume was 100 .mu.l and 2.5 units of Taq Polymerase and
0.5 units of Pfu Polymerase were employed. Otherwise, the reaction
conditions were identical to those used in the primary reactions.
An aliquot of the secondary PCR was analyzed by agarose gel
electrophoresis and the expected band of .about.670 bp was
observed. The bulk of the secondary PCR reaction was "cleaned up"
using the QIAquick PCR Purification (Qiagen), digested with Nde I
and Xba I (New England BioLabs) according to the vendor protocols,
"cleaned up" using the QIAquick PCR Purification Kit and run out on
a 2% agarose gel. The .about.100 bp Nde I-Xba I fragment of
interest was gel purified using a QIAEX II Gel Extraction Kit
(Qiagen) according to the vendor protocol. This fragment was
ligated with pBBT177 (described in Example 20) that had been cut
with Nde I and Xba I, treated with calf intestinal alkaline
phosphatase (New England BioLabs) and gel purified. The ligation
reaction was used to transform E. coli and plasmids from resulting
transformants were sequenced to identify a clone containing the Q5C
mutation and having the correct sequence throughout the .about.100
bp Nde I-Xba I segment.
[0196] The substitution mutation C1S was constructed and sequence
verified using the protocols detailed above for Q5C except that
complementary mutagenic primers BB128 (5>AGGCAGATC
AGATGCGTAAGC>3)(SEQ.ID.NO. 59) and BB127
(5>GCTTACGCATCTGATCTGCCT>3)(SEQ.ID.NO. 60), which change the
TGT codon for C1 to a TCT codon for serine, replaced BB130 and
BB129 respectively in the primary PCR reactions. The
[BB125.times.BB1128] and [BB126.times.BB127] PCR reactions gave
products of the expected sizes: .about.120 bp for
[BB125.times.BB128] and .about.570 bp for [BB126.times.BB127].
[0197] The substitution mutation N45C was constructed and sequence
verified using the protocols detailed above for Q5C with the
following differences. Complementary mutagenic primers BB134
(5>CTTTTG GAACTGGCAGCCAAACTCCTC>3)(SEQ.ID.NO. 61) and BB133
(5>GAGGAGTTTGGCTGCCAGTTCCAAAAG>3)(SEQ.ID.NO. 62), which
change the AAC codon for N45 to a TGC codon for cysteine, replaced
BB130 and BB129 respectively in the primary PCR reactions. The
[BB125.times.BB134] and [BB126.times.BB133] PCR reactions gave
products of the expected sizes: .about.255 bp for
[BB125.times.BB134] and .about.440 bp for [BB126.times.BB133]. The
product of the secondary PCR reaction was "cleaned up" using the
QIAquick PCR Purification (Qiagen), digested with Bgl II and Xba I
(New England BioLabs) according to the vendor protocols, "cleaned
up" using the QIAquick PCR Purification Kit and run out on a 2%
agarose gel. The .about.155 bp Bgl II-Xba I fragment of interest
was gel purified using a QIAEX II Gel Extraction Kit (Qiagen)
according to the vendor protocol. This fragment was ligated with
pBBT177 that had been cut with Bgl II and Xba I, treated with calf
intestinal alkaline phosphatase (New England BioLabs) and gel
purified. The ligation reaction was used to transform E. coli and
plasmids from resulting transformants were sequenced to identify a
clone containing the N45C mutation and having the correct sequence
throughout the .about.155 bp Bgl II-Xba I segment.
[0198] The substitution mutation F47C was constructed and sequence
verified using the protocols detailed above for N45C with the
following differences. Complementary mutagenic primers BB136
(5>TTCAGC CTTTTGGCACTGGTTGCCAAA>3)(SEQ.ID.NO. 63) and BB135
(5>TTTGGCAACCAGTGCCAAAAGGCTGAA>3)(SEQ.ID.NO. 64), which
change the TTC codon for F47 to a TGC codon for cysteine, replaced
BB134 and BB133 respectively in the primary PCR reactions. The
[BB125.times.BB136] and [BB126.times.BB135] PCR reactions gave
products of the expected sizes: .about.260 bp for
[BB125.times.BB136] and .about.435 bp for [BB126.times.BB135].
[0199] The insertion mutation 43C44 was constructed and sequence
verified using the protocols detailed above for N45C with the
following differences. Complementary mutagenic primers BB132
(5>TTCAGCCTT TTGGCACTGGTTGCCAAA>3)(SEQ.ID.NO. 65) and BB131
(5>TTTGGCAACCAGTGCCAAAAGGCTGAA>3)(SEQ.ID.NO. 66), which
insert a TGC codon for cysteine between the codons encoding amino
acid residues 43 and 44, replaced BB134 and BB133 respectively in
the primary PCR reactions. The [BB125.times.BB132] and
[BB126.times.BB131] PCR reactions gave products of the expected
sizes: .about.250 bp for [BB125.times.BB132] and .about.445 bp for
[BB126.times.BB131].
[0200] The substitution mutation Q46C was constructed and sequence
verified using the protocols detailed above for N45C with the
following differences. Complementary mutagenic primers BB154
(5>AGCCTT TTGGAAACAGTTGCCAAACTC>3)(SEQ.ID.NO. 67) and BB153
(5>GAGTTTGGCAACTGTTTCCAAAAGGCT>3)(SEQ.ID.NO. 68), which
change the CAG codon for Q46 to a TGT codon for cysteine, replaced
BB134 and BB133 respectively in the primary PCR reactions. The
primary reactions were performed in a Perkin-Elmer GeneAmp.RTM. PCR
System 2400 thermal cycler. The reaction program entailed:
95.degree. C. for 5 minutes, 30 cycles of [95.degree. C. for 30
seconds, 62.degree. C. for 30 seconds, 72.degree. C. for 1 minute]
followed by 72.degree. C. for 7 minutes and a hold at 4.degree. C.
The [BB125.times.BB154] and [BB126.times.BB153] PCR reactions gave
products of the expected sizes: .about.260 bp for
[BB125.times.BB154] and .about.440 bp for [BB126.times.BB153]. The
secondary PCR reaction was also performed in a Perkin-Elmer
GeneAmp.RTM. PCR System 2400 thermal cycler. This reaction program
entailed: 96.degree. C. for 5 minutes, 25 cycles of [95.degree. C.
for 30 seconds, 60.degree. C. for 30 seconds, 72.degree. C. for 1
minute] and a hold at 4.degree. C. Following digestion with Bgl II
and Xba I, the products of this reaction were cleaned up using the
QIAquick PCR Purification Kit but not gel purified prior to
ligation.
[0201] The substitution mutation Q48C was constructed and sequence
verified using the protocols detailed above for Q46C with the
following differences. Complementary mutagenic primers BB156
(5>GGTTTCA GCCTTACAGAACTGGTTGCC>3)(SEQ.ID.NO. 69) and BB155
(5>GGCAACCAGTTCTGTAAGGCTGAAACC>3)(SEQ.ID.NO. 70), which
change the CAA codon for Q48 to a TGT codon for cysteine, replaced
BB154 and BB153 respectively in the primary PCR reactions. The
[BB125.times.BB156] and [BB126.times.BB155] PCR reactions gave
products of the expected sizes: .about.265 bp for
[BB125.times.BB156] and .about.435 bp for [BB126.times.BB155].
[0202] The substitution mutation A50C was constructed and sequence
verified using the protocols detailed above for Q46C with the
following differences. Complementary mutagenic primers BB158
(5>AGGGATGGT TTCACACTTTTGGAACTG>3)(SEQ.ID.NO. 71) and BB157
(5>CAG TTCCAAAAGTGTGAAAC CATCCCT>3)(SEQ.ID.NO. 72), which
change the GCT codon for A50 to a TGT codon for cysteine, replaced
BB154 and BB153 respectively in the primary PCR reactions. The
[BB125.times.BB158] and [BB126.times.BB157] PCR reactions gave
products of the expected sizes: .about.270 bp for
[BB125.times.BB156] and .about.440 bp for [BB126.times.BB155].
[0203] The substitution mutation D77C was constructed and sequence
verified using the protocols detailed above for Q5C with the
following differences. Complementary mutagenic primers BB138
(5>TAGGAG GGTCTCACACCAAGCAGCAGA>3)(SEQ.ID.NO. 73) and BB137
(5>TCTGCTGCTTGGTGTGAGACCCTCCTA>3)(SEQ.ID.NO. 74), which
change the GAT codon for D77 to a TGT codon for cysteine, replaced
BB130 and BB129 respectively in the primary PCR reactions. The
[BB125.times.BB138] and [BB126.times.BB137] PCR reactions gave
products of the expected sizes: .about.350 bp for
[BB125.times.BB138] and .about.345 bp for [BB126.times.BB137]. The
product of the secondary PCR reaction was "cleaned up" using the
QIAquick PCR Purification (Qiagen), digested with Bgl II and Sal I
(New England BioLabs) according to the vendor protocols, "cleaned
up" using the QIAquick PCR Purification Kit and run out on a 2%
agarose gel. The .about.275 bp Bgl II-Sal I fragment of interest
was gel purified using a QIAEX II Gel Extraction Kit (Qiagen)
according to the vendor protocol. This fragment was ligated with
pBBT177 that had been cut with Bgl II and Sal I, treated with calf
intestinal alkaline phosphatase (New England BioLabs) and gel
purified. The ligation reaction was used to transform E. coli and
plasmids from resulting transformants were sequenced to identify a
clone containing the D77C mutation and having the correct sequence
throughout the .about.275 bp Bgl II-Sal I segment.
[0204] The substitution mutation T106C was constructed and sequence
verified using the protocols detailed above for D77C with the
following differences. Complementary mutagenic primers BB140
(5>CAGGGGAGTCTCACACACCCCCACCCC>3)(SEQ.ID.NO. 75) and BB139
(5>GGGGTGGGGGTGTGTGAGACTCCCCTG>3)(SEQ.ID.NO. 76), which
change the ACA codon for T106 to a TGT codon for cysteine, replaced
BB138 and BB137 respectively in the primary PCR reactions. The
[BB125.times.BB140] and [BB126.times.BB139] PCR reactions gave
products of the expected sizes: .about.435 bp for
[BB125.times.BB140] and .about.260 bp for [BB126.times.BB139].
[0205] The substitution mutation T108C was constructed and sequence
verified using the protocols detailed above for D77C with the
following differences. Complementary mutagenic primers BB142
(5>CTTCAT CAGGGGACACTCTGTCACCCC>3)(SEQ.ID.NO. 78) and BB141
(5>GGGGTGACAGAGTGTCCCCTGATGAAG>3)(SEQ.ID.NO. 79), which
change the ACT codon for T108 to a TGT codon for cysteine, replaced
BB138 and BB137 respectively in the primary PCR reactions. The
[BB125.times.BB142] and [BB126.times.BB141] PCR reactions gave
products of the expected sizes: .about.440 bp for
[BB125.times.BB142] and .about.250 bp for [BB126.times.BB141].
[0206] The substitution mutation Q101C was constructed and sequence
verified using the protocols detailed above for D77C with the
following differences. Complementary mutagenic primers BB162
(5>CACCCC CACCCCACATATCACACAGGC>3)(SEQ.ID.NO. 80) and BB161
(5>GCCTGTGTGATATGTGGGGTGGGGGTG>3)(SEQ.ID.NO. 81), which
change the CAG codon for Q101 to a TGT codon for cysteine, replaced
BB138 and BB137 respectively in the primary PCR reactions. The
primary reactions were performed in a Perkin-Elmer GeneAmp.RTM. PCR
System 2400 thermal cycler. The reaction program entailed:
95.degree. C. for 5 minutes, 30 cycles of [95.degree. C. for 30
seconds, 62.degree. C. for 30 seconds, 72.degree. C. for 1 minute]
followed by 72.degree. C. for 7 minutes and a hold at 4.degree. C.
The [BB125.times.BB162] and [BB126.times.BB161] PCR reactions gave
products of the expected sizes: .about.425 bp for
[BB125.times.BB162] and .about.275 bp for [BB126.times.BB161]. The
secondary PCR reaction was also performed in a Perkin-Elmer
GeneAmp.RTM. PCR System 2400 thermal cycler. This reaction program
entailed: 96.degree. C. for 5 minutes, 25 cycles of [95.degree. C.
for 30 seconds, 60.degree. C. for 30 seconds, 72.degree. C. for 1
minute] and a hold at 4.degree. C. Following digestion with Bgl II
and Sal I, the products of this reaction were cleaned up using the
QIAquick PCR Purification Kit but not gel purified prior to
ligation.
[0207] The substitution mutation E107C was constructed and sequence
verified using the protocols detailed above for Q101C with the
following differences. Complementary mutagenic primers BB164
(5>CAT CAGGGGAGTACATGTCACCCCCAC>3)(SEQ.ID.NO. 81) and BB163
(5>GTGGGGGTGACATGTACTCCCCTG ATG>3)(SEQ.ID.NO. 82), which
change the GAG codon for E107 to a TGT codon for cysteine, replaced
BB162 and BB161 respectively in the primary PCR reactions. The
[BB125.times.BB164] and [BB126.times.BB163] PCR reactions gave
products of the expected sizes: .about.440 bp for
[BB125.times.BB164] and .about.255 bp for [BB126.times.BB163].
[0208] The substitution mutation C98S was constructed and sequence
verified using the protocols detailed above for Q101C with the
following differences. Complementary mutagenic primers BB160
(5>CCC CTGTATCACAGAGGCTTCCAGGTC>3)(SEQ.ID.NO. 83) and BB159
(5>GACCTGGAAGCCTCTGTGATACA GGGG>3)(SEQ.ID.NO. 84), which
change the TGT codon for C98S to a TCT codon for serine, replaced
BB162 and BB161 respectively in the primary PCR reactions. The
[BB125.times.BB160] and [BB126.times.BB159] PCR reactions gave
products of the expected sizes: .about.415 bp for
[BB125.times.BB160] and .about.285 bp for [BB126.times.BB159].
[0209] The cysteine substitution mutation S163C was constructed as
follows. The mutagenic reverse oligonucleotide BB143
(5>CGCGAATTCTTATTCCTTACATCTTAAACTTTC>3)(SEQ.ID.NO. 85) was
designed to change the codon AGT for serine at position 163 to a
TGT encoding cysteine and to span the nearby Eco RI site. This
oligo was used in PCR with the forward, non-mutagenic, primer
BB125. A 50 .mu.l PCR reaction was performed in 1.times. Promega
PCR buffer containing 1.5 mM MgCl.sub.2, each primer at 0.204, each
of dATP, dGTP, dTTP and dCTP at 200 .mu.M, 1 ng of template plasmid
pBBT131 1.5 units of Taq Polymerase (Promega), and 0.25 units of
Pfu Polymerase (Stratagene). Reactions were performed in a
Robocycler Gradient 96 thermal cycler (Stratagene). The reaction
program entailed: 96.degree. C. for 3 minutes, 25 cycles of
[95.degree. C. for 1 minute, 60.degree. C. for 1.25 minutes,
72.degree. C. for 1 minute] followed by a hold at 6.degree. C. A 5
.mu.l aliquot of the PCR reaction was analyzed by agarose gel
electrophoresis and found to produce a single fragment of the
expected size .about.610 bp. The remainder of the reaction was
"cleaned up" using the QIAquick PCR Purification (Qiagen) according
to the vendor protocol, digested with Sal I and Eco RI (New England
BioLabs) according to the vendor protocols, ethanol-precipitated,
resuspended in 20 .mu.l of 10 mM Tris-HCl pH 8.5 and run out on a
2% agarose gel. The .about.42 bp Sal I-Eco RI fragment of interest
was gel purified using a QIAEX II Gel Extraction Kit (Qiagen)
according to the vendor protocol. This fragment was ligated with
pBBT132 that had been cut with Sal I and Eco RI, treated with calf
intestinal alkaline phosphatase (New England BioLabs) and gel
purified. The ligation reaction was used to transform E. coli and
plasmids from resulting transformants were sequenced to identify a
clone containing the E107C mutation and to have the correct
sequence throughout the .about.42 bp Sal I-Eco RI segment.
[0210] A mutation was also constructed that added a cysteine
following the carboxyterminal amino acid of the IFN-.alpha.2 coding
sequence. This mutant, termed *167C was constructed using the
protocols described above for the construction of the S163C mutant
with the following differences. The mutagenic reverse
oligonucleotide BB144
(5>CGCGAATTCTTAACATTCCTTACTTCTTAAACTTTC>3)(SEQ.ID.NO. 86)
which adds a TGT codon for cysteine between the GAA codon for E165
and the TAA stop codon and spans the nearby Eco RI site was used in
the PCR reaction in place of BB143.
[0211] The substitution mutation E165C was constructed and sequence
verified using the protocols detailed above for S163C with the
following differences. The mutagenic reverse oligonucleotide BB165
(5>CGCGAATTCTTA ACACTTACTTCTTAAACT>3)(SEQ.ID.NO. 87) which
changes the GAA codon for E165 to a TGT codon for cysteine and
spans the nearby Eco RI site was used in the PCR reaction in place
of BB143. The PCR reaction was performed in a Perkin-Elmer
GeneAmp.RTM. PCR System 2400 thermal cycler. The reaction program
entailed: 95.degree. C. for 5 minutes, 30 cycles of [95.degree. C.
for 30 seconds, 62.degree. C. for 30 seconds, 72.degree. C. for 1
minute] followed by 72.degree. C. for 7 minutes and a hold at
4.degree. C. Following digestion with Eco RI and Sal I, the
products of this reaction were cleaned up using the QIAquick PCR
Purification
[0212] For expression in E. coli as proteins secreted to the
periplasmic space, the STII-IFN-.alpha.2 genes encoding the 17
muteins were excised from the pUC18-based pBBT177 derivatives as
Nde I-Eco RI fragments of .about.590 bp and subcloned into the
pCYB1 expression vector that had been used to express wild type
STII-IFN.alpha.-2. For expression experiments, these plasmids were
introduced into E. coli W3110.
[0213] Using procedures similar to those described here, one can
construct other cysteine muteins of IFN-.alpha.2. The cysteine
muteins can be substitution mutations that substitute cysteine for
a natural amino residue in the IFN-.alpha.2 coding sequence,
insertion mutations that insert a cysteine residue between two
naturally occurring amino acids in the IFN-.alpha.2 coding
sequence, or addition mutations that add a cysteine residue
preceding the first amino acid, C1, of the IFN-.alpha.2 coding
sequence or add a cysteine residue following the terminal amino
acid residue, E165, of the IFN-.alpha.2 coding sequence. The
cysteine residues can be substituted for any amino acid, or
inserted between any two amino acids, anywhere in the IFN-.alpha.2
coding sequence. Preferred sites for substituting or inserting
cysteine residues in IFN-.alpha.2 are in the region preceding Helix
A, the A-B loop, the B-C loop, the C-D loop, the D-E loop and the
region distal to Helix E. Other preferred sites are the first or
last three amino acids of the A, B, C, D and E Helices. Preferred
residues in these regions for creating cysteine substitutions are
D2, L3, P4, T6, H7, S8, Q20, R22, K23, S25, F27, S28, K31, D32,
R33, D35, G37, F38, Q40, E41, E42, F43, G44, K49, T52, N65, S68,
T69, K70, D71, S72, S73, A74, A75, D77, E78, T79, Y89, Q90, Q91,
N93, D94, E96, A97, G102, V103, G104, V105, P109, M111, K112, E113,
D114, S115, K131, E132, K133, K134, Y135, S136, A139, S152, S154,
T155, N156, L157, Q158, E159, S160, L161, R162, and K164. Cysteine
residues also can be inserted immediately preceding or following
these amino acids. Another preferred site for adding a cysteine
residue would be preceding C1, which we refer to as *-1C.
[0214] One also can construct IFN-.alpha.2 muteins containing a
free cysteine by substituting another amino acid for one of the
naturally-occurring cysteine residues in IFN-.alpha.2. The
naturally-occurring cysteine residue that normally forms a
disulfide bond with the substituted cysteine residue is now free.
The non-essential cysteine residue can be replaced with any of the
other 19 amino acids, but preferably with a serine or alanine
residue. A free cysteine residue also can be introduced into
IFN-.alpha.2 by chemical modification of a naturally occurring
amino acid using procedures such as those described by Sytkowski et
al. (1998).
[0215] Using procedures similar to those described in Examples
20-22, one can express the proteins in E. coli, purify the
proteins, PEGylate the proteins and measure their bioactivities in
an in vitro bioassay. The IFN-.alpha.2 muteins also can be
expressed in eukaryotic cells such as insect or mammalian cells,
using procedures similar to those described in Examples 16-20, or
related procedures well known to those skilled in the art.
B. E. coli Expression of rIFN-.alpha.2 Cysteine Muteins.
[0216] To assess expression, cultures of the rIFN-.alpha.2 muteins
were grown and induced as described above for wild type
rIFN-.alpha.2. Typically, 45 ml cultures were grown in 250 ml shake
flasks at 37.degree. C. in a gyrotory shaker water bath at
.about.180-200 rpm. We observed that vigorous aeration of shake
flask cultures results in reduced levels of IFN-.alpha.2 protein in
the supernatants of the osmotic shock lysates. Therefore we
routinely used conditions that were sub-optimal for aeration but
preferable for soluble rIFN-.alpha.2 and rIFN-.alpha.2 mutein
production. The induced cultures were incubated for .about.16 h,
harvested and subjected to osmotic shock as detailed above for
wild-type rIFN-.alpha.2 with the exception that cystine was added
to a final concentration of 5 mM to the buffers used for the
osmotic shock procedure. Adding cystine to the osmotic shock
buffers resulted in significantly improved chromatographic
properties for the first two muteins analyzed, Q5C and S163C.
Interferon muteins not treated with cystine consistently eluted
from the S-Sepharose column as broad bands, which, when analyzed by
non-reducing SDS-PAGE, showed multiple molecular weight species at
and around the expected monomer molecular weight. These species
most likely represent misfolded or incompletely folded interferon
variants. In contrast, interferon muteins treated with cystine
during the osmotic shock procedure eluted from the S-Sepharose
column as sharp bands, which, when analyzed by non-reducing
SDS-PAGE, consisted of only one interferon species that co-migrated
with the interferon wild type standard. Recoveries of the purified
interferon muteins from the S-Sepharose column also were 1.5- to
2-fold greater when cystine was included in the osmotic shock
buffers. Based upon these results, 5 mM cystine was added to the
osmotic shock buffers used to purify all the cysteine muteins.
[0217] SDS-PAGE analysis of the osmotic shock supernatants of the
muteins showed most to have reduced (as compared to wild type)
levels of the 19 kDa rIFN-.alpha.2 band. Two muteins, Q5C and
S163C, were expressed at levels equivalent to wild type interferon,
and several hundred micrograms of each of these muteins were
readily purified as detailed below. Eight muteins (CIS, 43C44,
N45C, Q46C, Q48C, A50C, D77C and T108C) were essentially
undetectable in osmotic shock supernatants. The remaining seven
muteins (F47C, C98S, Q101C, T106C, E107C, E165C, *166C) were
detected at varyingly reduced levels (as compared to wild type) in
osmotic shock supernatants. Some of these muteins (T106C, C98S,
E107C, and Q101C) were purified from osmotic shock supernatants,
but only small quantities of the pure proteins were recovered.
Certain muteins, C98S, Q101C, T106C, E107C and *166C, were
expressed at relatively high levels but accumulated primarily in an
insoluble form, presumably in the periplasm. These proteins
comigrated with wild type rIFN-.alpha.2 standards under reducing
conditions indicating that the STII leader had been removed.
Qualitative assessments of relative expression levels of the
muteins are summarized in Table 4.
C. Purification of rIFN-.alpha.2 Cysteine Muteins.
[0218] In order to purify the rIFN-.alpha.2 muteins, typically, a
325 ml culture in a 2 liter shake flask, or a 500 ml culture in a 2
liter baffled shake flask, were grown at 37.degree. C. in a
gyrotory shaker water bath (New Brunswick Scientific)
.about.170-220 rpm. Cultures were grown, induced, harvested, and
subjected to osmotic shock as described in Example 20. Resulting
osmotic shock supernatants were processed immediately or stored at
-80.degree. C.
[0219] The soluble IFN-.alpha.2 muteins in the osmotic shock
supernatants were purified using S-Sepharose and Cu' IMAC
chromatography as detailed above for purification of wild type
rIFN-.alpha.2. All of the muteins tested bound tightly to the
copper column and eluted under conditions similar to wild-type
rIFN-.alpha.2. This result suggests that the conformations of the
cysteine muteins are similar to that of native rIFN-.alpha.2, at
least in the regions that comprise the metal-binding pocket.
[0220] Non-reducing SDS-PAGE analysis of the purified Q5C, C98S,
Q101C, T106C, E107C, S163C, and *166C cysteine muteins showed that
the muteins were recovered predominantly as monomers, migrating at
the expected molecular weight of .about.19 kDa. C98S migrated with
a slightly higher molecular weight than the other rINF-.alpha.2
muteins due to the absence of the native Cys1-Cys-98 disulfide
bond. Some of the purified muteins contained small amounts of
disulfide-linked rIFN-.alpha.2 dimers. The molecular weights of the
dimer species were approximately 37-38 kDa.
D. Bioactivities of rIFN-.alpha.2 Cysteine Muteins.
[0221] Biological activities of the purified Q5C and S163C
rIFN-.alpha.2 cysteine muteins were measured in the Daudi growth
inhibition assay described in Example 20. Protein concentrations
were determined using Bradford or BCA protein assay kits (Bio-Rad
Laboratories and Pierce). Commercial wild type rIFN-.alpha.2 and
rIFN-.alpha.2 prepared by us were analyzed in parallel on the same
days to control for interday variability in the assays. The muteins
inhibited proliferation of Daudi cells to the same extent as the
wild type rIFN-.alpha.2 control proteins, within the error of the
assay. The mean IC.sub.50 for the Q5C mutein was 13 .mu.g/ml, which
is similar to the mean IC.sub.50 s of the wild type rIFN-.alpha.
proteins. The mean IC.sub.50 for the S163C protein was 27 .mu.g/ml.
These data are summarized in Table 4.
TABLE-US-00004 TABLE 4 Expression and in vitro Bioactivities of
IFN-.alpha.2 Cysteine Muteins Relative Expression IFN-.alpha.2
Total Percent Mean IC.sub.50 IC.sub.50 Range.sup.3 Protein Mutation
Location Cellular .sup.1 Soluble .sup.2 (pg/ml) (pg/ml)
rIFN-.alpha.2 .sup.4 - - - 16 +/- 7 8-29 (n = 10) rIFN-.alpha.2
.sup.5 - ++++ ~33 13 +/- 4 7-19 (n = 10) C1S N-terminal
region.sup.6 +/- 0 Q5C N-terminal region ++++ ~20 13 9, 11, 15, 18
43C44 A-B loop ++ 0 N45C A-B loop ++ 0 Q46C A-B loop +/- 0 F47C A-B
loop ++++ ~5 Q48C A-B loop +/- 0 A50C A-B loop +/- 0 D77C B-C loop
+/- 0 C98S C-helix .sup.7 +++++ ~5-10 Q101C C-D loop +++++ ~5-10
T106C C-D loop +++++ ~5-10 E107C C-D loop +++++ ~5-10 T108C C-D
loop +/- 0 S163C C-terminal region ++++ ~33 27 +/- 8 18-40 (n = 6)
E165C C-terminal region +++ ~20 *166C C-terminus +++ ~20 .sup.1
Relative accumulation of the IFN-.alpha.2 protein in whole cell
extracts .sup.2 Portion of the IFN-.alpha.2 protein in the osmotic
shock supernatant, estimated from SDS-PAGE gels .sup.3IC.sub.50
values from individual experiments .sup.4 Commercial wild type
rIFN-.alpha.2 (Endogen, Inc.) .sup.5 Wild type rIFN-.alpha.2
prepared by Bolder Biotechnology, Inc. .sup.6Mutation creates a
free cysteine (C98) in the C-helix .sup.7 Mutation creates a free
cysteine (C1) in the N-terminal region
Example 22
PEGylation, Purification and Bioactivity of PEG-Q5C and
PEG-S163C
A. PEGylation of IFN-.alpha. Cysteine Muteins.
[0222] A small-scale PEGylation experiment was performed with the
purified rIFN-.alpha.2 cysteine muteins to identify conditions that
allowed the proteins to be monoPEGylated at the free cysteine
residue. Over-reduction of the proteins was monitored by
non-reducing SDS-PAGE, looking for a shift to a higher than
expected apparent molecular weight as a result of protein
unfolding, or for the appearance of multiple PEGylated species
generated as the result of native disulfide reduction. Initial
titration experiments were performed with the Q5C protein. One
.mu.g aliquots of purified Q5C were incubated with increasing
concentrations of TCEP [Tris (2-carboxyethyl) phosphine]-HCl at
room temperature in 100 mM Tris, pH 8.5 in the presence of varying
amounts of excess 5 kDa maleimide-PEG. After 60 min, the reactions
were stopped and immediately analyzed by non-reducing SDS-PAGE. The
amounts of TCEP and PEG reagent that yielded significant amounts of
monoPEGylated Q5C protein (molecular weight of approximately 28 kDa
by non-reducing SDS-PAGE), without modifying wild type
rIFN-.alpha.2, were used for further experiments. The titration
experiments indicated that a 10-fold molar excess of TCEP and
20-fold excess of 5 kDa maleimide PEG gave around 60% monoPEGylated
protein without detectable di or tri-PEGylated protein, or
modification of wild type rIFN-.alpha.2.
[0223] These conditions also were used to PEGylate several other
rIFN-.alpha.2 muteins. One .mu.g aliquots of purified wild type and
the rIFN-.alpha.2 muteins (Q5C, T106C, E107C, S163C) were incubated
for 1 hour with a 10-fold molar excess TCEP and a 20-fold molar
excess of 5 kDA maleimide PEG at pH 8.5 at room temperature. The
four muteins were monoPEGylated to varying degrees (estimated to be
from 30-60%) based on SDS-PAGE analysis of the reaction mixtures.
Wild-type rIFN-.alpha.2 showed no detectable PEGylation under these
conditions. Control experiments indicated that the Q5C, T106C,
E107C and S163C cysteine muteins needed to be reduced with TCEP to
be PEGylated. These data indicate that the PEG molecule is attached
to the cysteine residue introduced into the Q5C, T106C, E107C and
S163C proteins.
B. Preparation and Purification of PEG-Q5C IFN-.alpha.2 and
PEG-S163C:
[0224] Larger quantities of the Q5C and S163 muteins were PEGylated
so that biological activities of the PEGylated proteins could be
measured. For the Q5C protein, the PEGylation conditions used for
the small-scale experiments were scaled to 140 .mu.g protein to
give sufficient material for purification and characterization. The
larger PEGylation reaction was performed for 1 hr at room
temperature, diluted 10.times. with 20 mM MES, pH 5.0, adjusted to
pH 3.0, and then loaded quickly onto an S-Sepharose column using
conditions similar to those described for initial purification of
the rIFN-.alpha.2 muteins. The presence of the PEG moiety decreased
the protein's affinity for the resin, allowing the PEGylated
protein to be separated from the non-PEGylated protein. The
chromatogram from the S-Sepharose column showed two major protein
peaks eluting at approximately 190 mM NaCl and 230 mM NaCl. The
early eluting major peak (eluting at approximately 190 mM NaCl) was
determined to be mono-PEGylated Q5C by SDS-PAGE. The apparent
molecular weight of monoPEgylated Q5C is approximately 28 kDa by
SDS-PAGE. The later eluting major peak (eluting at approximately
230 mM NaCl) was determined to be unreacted Q5C protein. Fractions
from the early eluting peak containing predominantly PEG-were
pooled and used for bioactivity measurements.
[0225] The S163C cysteine mutant was PEGylated at a 90 pg scale and
purified using protocols essentially identical to those described
for PEG-Q5C.
C. Bioactivities of PEG-Q5C and PEG-S163C Cysteine Muteins:
[0226] Biological activity of the purified PEG-Q5C protein was
measured in the Daudi cell assay described in Example 20.
Concentration of the protein was determined using a Bradford dye
binding assay. The PEG-Q5C protein showed a similar dose-response
curve and reached the same level of maximal growth inhibition as
wild type rIFN-.alpha.2 and the non-modified Q5C protein, within
the error of the assay. The mean IC.sub.50 for the PEG-Q5C mutein
was .about.22 .mu.g/ml, which is within 2-fold of the IC.sub.50
values determined for wild type IFN-.alpha.2 and the unmodified Q5C
proteins analyzed on the same days (Table 5). Bioactivity of the
PEG-Q5C protein is significantly greater than that of rIFN-.alpha.2
that has been PEGylated with non-specific, amine-reactive PEG
reagents. The latter protein has an IC.sub.50 of 164 .mu.g/ml in
the Daudi cell assay (Monkarsh et al., 1997). These data are
summarized in Table 5.
[0227] Bioactivity experiments also were performed with the
PEG-S163C protein. The PEG-S163C protein also was biologically
active and inhibited Daudi cell proliferation to the same extent as
wild type rIFN-.alpha.2, within the error of the assay. The average
IC.sub.50 for the PEG-S163C protein was about 42 .mu.g/ml, which is
better than the amine-Pegylated IFN-.alpha.
TABLE-US-00005 TABLE 5 Bioactivity of PEG-Q5C IFN-.alpha. EC.sub.50
Range .sup.1 Mean EC.sub.50 (pg/ml) IFN-.alpha. Protein (pg/ml) Exp
A Exp B Exp C Endogen rIFN-.alpha. 13 9 11 20 rIFN-.alpha. .sup.2
12 10 10 16 Q5C 12 8.5 11 18 PEG-Q5C 22 18 18 30
Amine-PEGylated-IFN-.alpha. .sup.3 164 -- -- -- .sup.1 Data from
three experiments. .sup.2 rIFN-.alpha.2 prepared by Bolder
Biotechnology, Inc. .sup.3 Data from Monkarsh et al. (1997)
Example 23
[0228] In vivo efficacy of the PEGylated GH cysteine muteins can be
tested in hypophysectomized (HYPDX) rats. This is a
well-characterized model of GH deficiency (Cox et al., 1994; Clark
et al., 1996). GH stimulates body weight gain and bone and
cartilage growth in HYPDX rats (Cox et al., 1994; Clark et al.,
1996). Hypophysectomized Sprague-Dawley rats can be purchased from
a commercial supplier such as Charles River (Wilmington, Mass.).
Typically, rats are hypophysectomized between 40 and 50 days of age
and weigh approximately 120 g. Groups of 8 rats should receive
subcutaneous injections of rhGH, PEG-Cys-GH or placebo (vehicle
solution) at specified intervals and weight gain measured daily
over a 10 day period. Rats should be weighed daily at the same time
per day to eliminate possible variables associated with feeding. In
addition to overall weight gain, bone growth (tibial epiphysis
width) can be measured. At time of sacrifice, the right and left
proximal tibial epiphyses can be removed and fixed in formalin. The
fixed tibias can be split at the proximal end in a saggital plane,
stained with silver nitrate and exposed to a strong light
(Greenspan et al., 1949). The width of the cartilaginous epiphseal
plate can be measured using a stereomicroscope equipped with a
micrometer eyepiece. Ten measurements should be made for each
epiphysis and the means+/-SEM for the combined values for the left
and right tibias should be calculated. Comparisons between groups
can be made using a Students T test for single comparisons and
one-way analysis of variance for multiple comparisons. P<0.05
should be considered significant.
[0229] Efficacy of the GH cysteine muteins modified with 10 kDa or
20 kDa PEGS can be tested by administering the proteins to the rats
daily, every other day, every third day, every fourth day or
following a single injection. Five .mu.g of non-PEGylated hGH
administered twice a day (10 .mu.g BID) by subcutaneous injection
gives a strong growth response in the HYPDX rat model (Cox et al.,
1994; Clark et al., 1996). In initial experiments different groups
of rats should receive subcutaneous injections of 0.08, 0.4, 2, 10,
or 50 .mu.g of the PEGylated Cys-GH proteins/injection/rat. Control
rats should receive vehicle solution only. Additional control
groups should receive non-PEGylated rhGH (10 .mu.g/BID) and 10
.mu.g non-PEGylated hGH using the same dosing regimen as the
PEGylated Cys-GH proteins. Administration of the PEGylated GH
cysteine muteins to the HYPDX rats should result in an increase in
body weight gain and tibial epyphysis width growth compared to the
vehicle-treated group.
[0230] Efficacy of the PEGylated GH cysteine muteins also can be
tested in rodent models of cachexia. Dexamethasone (DEX) can be
administered to the rats to induce weight loss. Groups of normal
Sprague-Dawley rats (200-225 g) should receive daily subcutaneous
injections of dexamethasone (200 .mu.g/rat; approximately 1 mg/kg).
This amount of dexamethasone should induce a loss of approximately
5-6 g over an 8d period. Vehicle or varying doses of the PEGylated
GH cysteine muteins can be administered to the rats once, daily,
every other day, every third day or every fourth day in different
experiments. Different groups of rats should receive subcutaneous
injections of 0.08, 0.4, 2, 10, or 50 .mu.g of the PEGylated Cys-GH
proteins/injection/rat. Additional controls should include a group
of rats that will receive no DEX or injections, a group of rats
that receives DEX and non-PEGylated rhGH (10 .mu.g BID) and a group
of rats that receives DEX and non-PEGylated rhGH (10 .mu.g daily,
every other day, every third day, or every fourth day, depending
upon the experiment, i.e., frequency that the PEGylated GH cysteine
mutein is administered). Animals should be weighed daily. Food and
water consumption should be monitored daily. At time of sacrifice,
internal organs should be weighed. Statistical analyses should be
performed as described for the HYPDX rat studies. Animals treated
with the PEGylated GH cysteine muteins should lose less weight than
the vehicle-treated animals.
[0231] In vivo efficacy of the PEGylated EPO cysteine muteins can
be measured in normal rats by demonstrating that the proteins
stimulate increases in hemocrit and erythropoiesis compared to
vehicle-treated animals. EPO stimulates a significant increase in
hematocrit in rats when dosed on a daily basis (Matsumoto et al.,
1990; Vaziri et al., 1994; Baldwin et al., 1998). Sprague-Dawley
rats can be purchased from a commercial supplier such as Charles
River (Wilmington, Mass.). Groups of 5 rats should receive
subcutaneous injections of BV rEPO, PEGylated EPO cysteine mutein
or placebo (vehicle solution) at specified intervals for up to five
days. On day 6 the animals should be sacrificed and blood samples
collected for hematocrit and complete blood cell count (CBC)
analysis, which can be performed by a commercial laboratory.
Hematopoietic tissues (liver and spleen) should be collected,
weighed and fixed in formalin for histopathologic analyses to look
for evidence of increased erythropoiesis. Bone marrow should be
removed from various long bones and the sternum for unit particle
preparations and histopathologic analysis to look for evidence of
increased erythropoiesis. Comparisons between groups should be made
using a Students T test for single comparisons and one-way analysis
of variance for multiple comparisons. P<0.05 should be
considered significant. The PEGylated EPO cysteine muteins should
stimulate increases in hematocrit and erythropoiesis in the rats
compared to the vehicle-injected animals. Efficacy of the PEGylated
EPO cysteine muteins modified with 10 kDa or 20 kDa PEGs can be
tested when administered once, every other day or every third day.
100 IU/kg (.about.800 ng/kg) of non-PEGylated EPO administered once
per day (160 ng SID/200 g rat) by subcutaneous injection gives a
significant increase in hematocrit (Matsumoto et al., 1990; Vaziri
et al., 1994; Baldwin et al., 1998). In initial experiments
different groups of rats should receive subcutaneous injections of
0.32, 1.6, 8, 40 or 160 ng of the PEGylated EPO cysteine muteins.
Control rats should receive vehicle solution only. Additional
control groups should receive non-PEGylated rEPO (160 ng/SID) and
160 ng non-PEGylated rEPO using the same dosing regimen as the
PEGylated EPO cysteine muteins.
[0232] Efficacy of the PEGylated EPO muteins also can be tested in
chemotherapy-induced anemia models. Cisplatin-induced anemia is a
well-characterized rodent model of chemotherapy-induced anemia and
has direct relevance to the human clinical setting. rEPO reverses
the anemia in this model when administered at daily doses of 100
Units/kg (Matsumoto et al., 1990; Vaziri et al., 1994; Baldwin et
al. 1998). Sprague-Dawley rats (.about.200 g) should be treated on
day 0 with an intraperitoneal injection of Cisplatin (3.5 mg/kg) to
induce anemia and randomized to various treatment groups. Efficacy
of the PEGylated EPO cysteine muteins modified with 10 kDa or 20
kDa PEGs can be tested when administered once (on day 1), every
other day or every third day. Different groups of rats should
receive subcutaneous injections of 0.32, 1.6, 8, 40 or 160
ng/injection of the PEGylated EPO cysteine muteins. Rats should be
injected with the test compounds for up to 8 days. One control
group of rats should receive daily subcutaneous injections of rEPO
(100 Units/kg). Another control group should not receive the
initial Cisplatin injection but should receive injections of saline
using the same dosing schedules used for the PEGylated EPO cysteine
muteins. On day 9 the rats should be sacrificed and blood and
tissue samples obtained for comprehensive CBC and histopathology
analyses. The PEGylated EPO cysteine muteins should stimulate
increases in hemocrit and erythropoiesis in the rats compared to
the vehicle-injected control group.
[0233] IFN-.alpha. biological activity is relatively
species-specific, which limits the range of preclinical animal
models that can be studied. One model that can be used to measure
in vivo efficacy of PEGylated IFN-.alpha.2 cysteine muteins is
inhibition of human tumor xenograft growth in athymic nude mice.
Human IFN-.alpha.2 is not active on mouse cells and inhibition of
human tumor xenograft growth in nude mice occurs through a direct
antiproliferative effect on the human tumor cells. IFN-.alpha.2
inhibits growth of a variety of primary human tumor xenografts and
human tumor cell lines in athymic mice (Balkwill et al., 1985;
Balkwill, 1986; Johns et al., 1992; Lindner and Borden, 1997). The
primary endpoint for the studies should be tumor volume in treated
mice. We expect to find that the administration of the PEGylated
IFN-.alpha.2 cysteine muteins inhibits tumor growth (as measured by
tumor volume) in the mice relative to vehicle-treated animals.
Athymic nude mice can be purchased from a commercial vendor such as
Charles River. Each mouse should be injected with 2.times.10.sup.6
NIH-OVCAR-3 or MCF-7 tumor cells (the cell lines are available from
the American Type Culture collection) on day 0 and randomly
assigned to test groups, consisting of ten mice each. The tumor
cells should be injected into the dermis overlying the mammary
gland nearest the axillae. The different test groups should receive
subcutaneous injections of varying doses of wild type
rIFN-.alpha.2, 10 kDa-PEGylated IFN-.alpha.2 cysteine mutein, 20
kDa-PEGylated IFN-.alpha.2 cysteine mutein or placebo (vehicle
solution) at specified intervals: every day (SID), every other day
(EOD) or every third day (ETD). Tumor volumes should be determined
at 4 day intervals by measuring the length and width of the tumors
with calipers, as described by Linder and Borden (1997). At time of
sacrifice, the tumors should be excised and weighed. Mean tumor
volumes+/-SEM for each test group should be calculated for each
sampling point. Comparisons between groups should be made using a
Students T test for single comparisons and one-way analysis of
variance for multiple comparisons. Five .mu.g of non-PEGylated
IFN-.alpha.2 administered once per day by subcutaneous injection
inhibits growth of NIH-OVCAR-3 cells and MCF-7 cells in athymic
mice by 80% after 6 weeks (Lindner and Borden, 1997). Either cell
line can be used for these studies. The NIH-OVCAR-3 line (available
from the ATCC) does not require estrogen for growth, as do the
MCF-7 cells. Xenograft experiments with MCF-7 cells require that
the mice be oophorectomized and implanted with estrogen pellets
(Lindner and Borden, 1997). In initial experiments, different
groups of mice should receive subcutaneous injections of 1 or 5
.mu.g per injection of rIFN-.alpha.2, 10-kDa-PEGylated IFN-.alpha.2
cysteine mutein or 20-kDa-PEGylated IFN-.alpha.2 cysteine mutein
using every day, every other day or every third day dosing
schedules. Dosing should begin on day 2 following injection of the
tumor cells into the mice. Control mice should receive vehicle
solution only. In the every other day and every third day dosing
experiments, an additional positive control group should receive
daily subcutaneous injections of 5 .mu.g unmodified
rIFN-.alpha.2.
REFERENCES
[0234] Abdel-Meguid, S. S., Shieh, H-S., Smith W. W., Dayringer, H.
E., Violand, B. N. and Bentle, L. A. (1987) Proc. Natl. Acad. Sci.
USA 84: 6434-6437. [0235] Abrahmsen, L., Moks, T., Nilsson, B. and
Uhlen, M. (1986) Nucleic Acids Res. 14:7487-7500. [0236]
Abuchowski, A., Kazo, G. M., Verhoest, C. R., van Es, T.,
Kafkewitz, D., Nucci, M. L., Viau, A. T. and Davis, F. F. (1984)
Cancer Biochem. Biophys. 7: 175-186. [0237] Alt, F. W., Kellems, R.
E., Bertino, J. R., and Schimke, R. T. (1978) J. Biol. Chem.
253:1357-1370. [0238] Ayres, M. D., Howard, S. C., Kuzio, J.,
Lopez-Ferber, M., and Possee, R. D. (1994) Virology 202:586-605.
[0239] Barik, S. (1993) in "Methods in Molecular Biology", White,
B. A., ed. (Humana Press, Totawa, N.J.), 15: 277-286. [0240] Bazan,
F. (1991) Immunology Today 11: 350-354. [0241] Bazan, J. F. (1992)
Science 257: 410-411. [0242] Becker, G. W. and Hsiung, H. M. (1986)
FEBS Lett. 204: 145-150. [0243] Bewley et al., (1969) Biochem. 8:
4701-4708. [0244] Bill, R. M., Winter, P. C., McHale, C. M.,
Hodges, V. M., Elder, G. E., Caley, J., Flitsch, S. L., [0245]
Bicknell, R. and Lappin, T. R. J. (1995) Biochem. Biophys. Acta
126: 35-43. [0246] Blatt, L. M., Davis, J. M., Klein, S. B. and
Taylor, M. W. (1996) J. Interferon and Cytokine Research 16:
489-499. [0247] Boissel, J.-P., Lee, W.-R., Presnell, S. R., Cohen,
F. E. and Bunn, H. F. (1993) J. Biol. Chem. 268:15983-15993. [0248]
Bollag, D. M., Rozycki, M. D. and Edelstein, S. J. (1996) Protein
Methods, 415 pages, Wiley-Liss, NY, N.Y. [0249] Braxton, S. M.
(1998) U.S. Pat. No. 5,766,897. [0250] Chamow & Ashkenazi
(1996), Trends in biotech 14:52-60. [0251] Chang, C. N., Rey, B.,
Bochner, B., Heyneker, H. and Gray, G. (1987) Gene: 189-196. [0252]
Cheah, K-C., Harrison, S., King, R., Crocker, L., Wells, J. R. E.
and Robins, A. (1994) Gene, 138: 9-15. [0253] Clark, R., Olson, K.,
Fuh, G., Marian, M., Mortensen, D., Teshima, G., Chang, S., Chu,
H., [0254] Mukku, V., Canova-Davis, E., Somers, T., Cronin, M.,
Winkler, M. and Wells, J. A. (1996) J. Biol. Chem. 271:
21969-21977. [0255] Cox, G. N. and McDermott, M. J. (1994) WO
9412219. [0256] Cox, G. N., McDermott, M. J., Merkel, E., Stroh, C.
A., Ko, S. C., Squires, C. H., Gleason, T. M. and Russell, D.
(1994) Endocrinology 135: 1913-1920. [0257] Cox, G. N. and Russell,
D. (1994) WO 9,422,466. [0258] Crouse, G. F., McEwan, R. N., and
Pearson, M. L. (1983) Mol. Cell. Biol. 3:257-266. [0259]
Cunningham, B. C. and Wells, J. A. (1989) Science 244: 1081-1085.
[0260] Cunningham, B. C., Jhurani, P., Ng, P. and Wells, J. A.
(1989) Science 243: 1330-1336. [0261] Cunningham, B. C., Ultsch,
M., de Vos, A. M., Mulkerrin, M. G., Clauser, K. R. and Wells,
[0262] J. A. (1991) Science 254: 821-825. [0263] Daopin, S., Piez,
K. A., Ogawa, Y., and Davies, D. R. (1992) Science 257: 369-373.
Davis, S., Aldrich, T. H., Stahl, N., Pan, L., Taga, T., Kishimoto,
T., Ip, N. Y. and Yancopoulus, G. D. (1993) Science 260: 1805-1808.
[0264] Davies, A. H. (1995) Curr. Opin. Biotechnol. 6:543-547.
[0265] DeChiara, T. M., Erlitz, F. and Tarnowski, k, S. J. (1986)
Methods Enzymology, 119: 403-15. [0266] de la Llosa, P., Chene, N.
and Martal, J. (1985) FEBS Letts. 191: 211-215. [0267] Denefle, P.,
Kovarik, S., Ciora, T. Gosselet, M., Benichou, J.-C., Latta, M.
Guinet, F., Ryter, A. and Mayaux, J.-F. (1989) Gene 85, 499-510.
[0268] de Vos, A. M., Ultsch, M. and Kossiakoff, A. A. (1992)
Science 255: 306-312. [0269] Diederichs, K., Boone, T. and Karplus,
A. (1991) Science 154: 1779-1782. [0270] Evinger, M. and Pestka, S.
(1981) Methods Enzymol. 79:362-368. [0271] Fuh, G., Cunningham, B.
C., Fukunaga, R., Nagata, S., Goeddel, D. V. and Wells, J. A.
(1992) Science 256: 1677-1680. [0272] Fujimoto, K., Fukuda., T.,
and Marumoto., R. (1988) J. Biotechnol. 8:77-86. [0273] Geisse, S.,
Gram, H., Kleuser, B. and Kocher, H. P. (1996) Prot. Express.
Purif. 8:271-282. [0274] Goeddel, D. V., Heyneker, H. L., Hozumi,
T., Arentzen, R., Itakura, K., Yansura, D. G., Ross, M. J., [0275]
Miozzari, G., Crea, R. and Seeburg, P. H. (1979) Nature 281:
544-548. [0276] Goodson, R. J. and Katre, N. V. (1990)
Biotechnology 8: 343-346. [0277] Greenspan, F. S., Li., C. H.,
Simpson, M. E. and Evans, H. M. (1949) Endocrinology 45:455-463.
[0278] Ghrayeb, J., Kimura, H., Takahara, M., Hsiung, H., Masui, Y.
and Inouye, M. (1984) EMBO J. 3:2437-2442. [0279] Hannum, C.,
Culpepper, J., Campbell, D., McClanahan, T., Zurawski, S. et al.
(1994) Nature 368: 643-648 [0280] Hershfield, M. S., Buckley, R.
H., Greenberg, M. L. et al., (1987) N. Engl. J. Medicine 316:
589-596. [0281] Hill, C. P., Osslund, T. D. and Eisenberg, D.
(1993) Proc. Natl. Acad. Sci. USA 90:5167-5171. [0282] Horisberger,
M. A. and Di Marco, S. (1995) Pharmac. Ther. 66: 507-534. [0283]
Horoszewicz, J. S., Leong, S. S. and Carter, W. A. (1979) Science
206:1091-1093. [0284] Horton, R. M. (1993) in "Methods in Molecular
Biology", White, B. A., ed. (Humana Press. Totawa, N.J.), v.15,
214-250. [0285] Hsiung, H. M., Mayne, N. G. and Becker, G. W.
(1986) Biotechnology 4: 991-995. [0286] Imai, N., Kawamura, A.,
Higuchi, M., Oh-eda, M., Orita, T., Kawaguchi, T., and Ochi, N.
(1990) J. Biochem. 107:352-359. [0287] Innis, M. A., Gelfand, D. H,
Sninsky, J. J. and White, T. J. eds. (1998) "PCR Protocols: A Guide
to Methods and Applications" (Academic Press, San Diego, Calif.).
[0288] Jacobs, K., Shoemaker, C., Rudersdorf, R., Neill, S. D.,
Kaufman, R. J., Mufson, A., Seehra, J., Jones, [0289] S. S.,
Hewick, R., Fritsch, E. F., Kawakita, M., Shimizu, T. and Miyake,
T. (1985) Nature 313: 806-810. [0290] Johnson, D. L., Middleton, S.
A., McMahon, F. Barbone, F. P., Kroon, D., Tsao, E., Lee, W. H.,
[0291] Mulcahy, L. S. and Jolliffe, L. K. (1996) Protein Expression
Purif. 7:104-113. [0292] Kadonaga, J., Gautier, A. Straus, D. R.,
Charles, A. D., Edge, M. D. and Knowles, J. R. (1984) J. Biol.
Chem. 259: 2149-2154. [0293] Khan, F. R. and Rai, V. R. (1990)
Bioprocess Technology 7:161-169. [0294] Karasiewicz, R., Nalin, C.
and Rosen, P. (1995) U.S. Pat. No. 5,382,657. [0295] Katre, N. V.
(1990) J. Immunology 144: 209-213. [0296] Katre, N. V., Knauf, M.
J. and Laird, W. J. (1987) Proc. Natl. Acad. Sci. USA 84: 1487,
1491. [0297] Kaufman, R. J. (1990) Meth. Enzymol. 185:537-566.
[0298] Kingsley, D. M. (1994) Genes Dev. 8: 133-146. [0299]
Kinstler, O. B., Gabriel, N. E., Farrar, C. E. and DePrince, R. B.
(1996) International Patent Application Number WO 96/11953. [0300]
Knauf, M. J., Bell, D. P., Hirtzer, P., Luo, Z.-P., Young, P. D.
and Katre, N. V. (1988) J. Biol. Chem. 263: 15064-15070. [0301]
Komatsu, N., Nakauchi, H., Miwa, A., Ishihara, T., Eguchi, M.,
Moroi, M., Okada, M., Sato, Y., Wada, H., Yawata, Y., et al.,
(1991) Cancer Research 51: 341-348. [0302] Koshland, D. and
Botstein, D. (1980) Cell 20: 749-760. [0303] Kutty G., Kutty, R.
K., Samuel, W., Duncan, T., Jaworski, C., and Wiggert, B. (1998)
Biochem. Biophys. Res. Commun. 246: 644-649. [0304] Lawton, L. N.,
Bonaldo, M. F., Jelenc, P. C., Qiu, L., Baumes, S. A., Marcelino,
R. A., de Jesus, G. M., Wellington, S., Knowles, J. A., Warburton,
D., Brown, S., and Soares, M. B. (1997) Gene 203: 17-26. [0305] Li,
C. H. (1982) Mol. Cell. Biochem. 46: 31-41. [0306] Lin, F.-K.,
Suggs, S., Lin, C.-H., Browne, J. K., Smalling, R., Egrie, J. C.,
Chen, K. K., Fox, G. M., Martin, F., Stabinsky, Z., Badrawi, S. M.,
Lai, P.-H. and Goldwasser, E. Proc. Natl. Acad. Sci. USA 82:
7580-7584. [0307] Lu, H. S., Boone, T. C., Souza, L. M., and Lai,
P. H. (1989) Arch. Biochem. Biophys. 268: 81-92. [0308] Lucas, B.
K., Giere, L. M., DeMarco, M. A., Shen, A., Chisolm, V., and
Crowley, C. W. (1996) Nucleic Acids Res. 24:1774-1779. [0309]
Lydon, N. B., Favre, C., Bove, S., Neyret, O., Benureau, S.,
Levine, A. M., Seelig, G. F., Nagabhushan, T. L. and Trona, P. P.
(1985) Biochemistry 24: 4131-4141. [0310] MacGillivray, M. H.,
Baptista, J. and Johnson, A. (1996) J. Clin. Endocrinol. Metab. 81:
1806-1809. [0311] Maisano, F., Testori, S. A., and Grandi, G.
(1989) J. Chromatograph. 472: 422-427. [0312] Mark, D. F., Lin, L.
S. and Lu, S-D X. (1985) U.S. Pat. No. 4,518,584. [0313] Mark, D.
F., Lu, S. d., Creasey, A. a., Yamamoto, R. and Lin, L. S. (1984)
Proc. Natl. Acad. Sci. USA 81: 5662-5666. [0314] Martal, J., Chene,
N. and de la Llosa, P. (1985) FEBS. Letts. 180: 295-299. [0315]
Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J.,
Okino, K. H., Morris, F. C., McNiece, I. K., Jacobsen, F. W.,
Mendiaz, E. A., Birkett, N. C. et al., (1990) Cell 63: 203-211.
[0316] Massague, J. (1990) Annu. Rev. Cell Biol. 6: 597-641. [0317]
Matthews, D. J., Topping, R. S., Cass, R. T. and Giebel, L. B.
(1996) Proc. Natl. Acad. Sci. USA 93: 9471-9476. [0318] McDonald,
N. Q. and Hendrickson, W. A. (1993) Cell 73: 421-424. [0319] McKay,
D. B. (1992) Science 257: 412. [0320] Meyers, F. J., Paradise, C.,
Scudder, S. A., Goodman, G. and Konrad, M. (1991) Clin. Pharmacol.
Ther. 49: 307-313. [0321] Milburn, M. V., Hassell, A. M., Lambert,
M. H., Jordan, S. R., Proudfoot, A. E., Graber, P. and Wells, T. N.
C. (1993) Nature 363: 172-176. [0322] Mills, J. B., Kostyo, J. L.,
Reagan, C. R., Wagner, S. A., Moseley, M. H. and Wilhelm, A. E.
(1980) Endocrinology 107: 391-399. [0323] Mockridge, J. W., Aston,
R., Morrell, D. J. and Holder, A. T. (1998) Eur. J. Endocrin. 138:
449-459. [0324] Monkarsh, S. P., Ma, Y., Aglione, A., Bailon, P. et
al. (1997) Anal. Biochem. 247: 434-440. [0325] Mordenti, J., Chen,
S. A., Moore, J. A., Ferrailo, B. L. and Green, J. D. (1991)
Pharmacol. Res. 8:1351-1359. [0326] Morehead, H., Johnson, P. D.
and Wetzel, R. (1984) Biochemistry 23: 2500-2507. [0327]
Morioka-Fujimoto, K., Marumoto, R. and Fukuda, T. (1991) J. Biol.
Chem. 266: 1728-1732. [0328] Mott, H. R. and Campbell, I. D. (1995)
Current Opinion in Structural Biology 5: 114-121. [0329]
Ostermeier, M., De Sutter., K., Georgiou, G. (1996) J. Biol. Chem.
271: 10616-10622. [0330] Paonessa, G., Graziani, R., de Serio, A.,
Savino, R., Ciapponi, L., Lahm, A., Ssalvati, A. L., Toniatti, C.
and Ciliberto, G. (1995) EMBO J. 14: 1942-1951. [0331] Paul, W. E.
ed. (1989) "Fundamental Immunology" (Raven Press, New York, N.Y.).
[0332] Pestka, S., Langer, J. A., Zoon, K. C. and Samuel, C. E.
(1987) Ann. Rev. Biochem. 56: 727-777. [0333] Picken, R. N.,
Mazaitis, A. J., Maas, W. K., Rey, M. and Heyneker, H. (1983)
Infect. and Immun. 42: 269-275. [0334] Powers, R., Garrett, D. S.,
March, C. J., Frieden, E. A., Gronenborn, A. M. and Clore, G. M.
(1992) Science 256: 1673-1677. [0335] Ranjan, A. and Hasnain, S. E.
(1995) Virus Genes 2:149-153. [0336] Redfield, C., Smith L. J.,
Boyd, J., Lawrence, G. M. P., Edwards, R. G., Smith, R. A. G., and
Dobson, C. M. (1991) Biochemistry 30: 11029-11035. [0337] Roitt, I.
M., Brostoff, J., and Male, D. K. eds. (1989) "Immumology" (Gower
Medical Publishers, New York, N.Y. and London, UK) [0338]
Rowlinson, S. W. Barnard, R., Bastiras, S., Robins, A. J.,
Brinkworth, R. and Waters, M. J. (1995) J. Biol. Chem. 270:
16833-16839. [0339] Shaw, G., Veldman., G. and Wooters, J. L.
(1992) U.S. Pat. No. 5,166,322. [0340] Sytkowski, A. J., Lunn, E.
D., Davis, K. L., Feldman, L. and Siekman, S. (1998) Proc. Natl.
Acad. Sci. USA 95: 1184-1188. [0341] Tanaka, H., Satake-Ishikawa,
R., Ishikawa, M., Matsuki, S. and Asano, K. (1991) Cancer Research
51: 3710-3714. [0342] Teh, L.-C. and Chapman, G. E. (1988) Biochem.
Biophys. Res. Comm. 150: 391-398. [0343] Thompson, S. A. (1992) J.
Biol. Chem. 267: 2269-2273. [0344] Trill, J. J., Shatzman, A. R.,
and Ganguly, S. (1995) Curr. Opin. Biotechnol. 6:553-560. [0345]
Tuma, R., Rosendahl, M. and Thomas, G. (1995) Biochem. 34:
15150-15156. [0346] Urlaub, G. and Chasin, L. A. (1980) Proc. Natl.
Acad. Sci. USA 77:4216-4220. [0347] Van Den Berg, C. L., Stroh, C.,
Hilsenbeck, S. G., Weng, C.-N., McDermott, M. J., Cox, G. N. and
Yee, D. (1997) Eur. J. Cancer 33: 1108-1113. [0348] Voss, T.,
Falkner, E., Ahorn, H. Krystek, E. Maurer-Fogy, I. Bodo, G.,
Hauptmann, R. (1994) Biochem. J. 298, 719-725. [0349] Walter, M.
R., Cook, W. J., Ealick, S. E., Nagabhusan, T. L., Trona, P. T. and
Bugg, C. E. (1992) J. Mol. Biol. 224: 1075-1085. [0350] Wang, G. L.
and Semenza, G. L. (1993) Blood 82:3610-3615. [0351] White, B. A.
(1993) in Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and Applications edited by Humana Press, Inc.,
Totowa,N.J. [0352] Wojchowski, D. M., Orkin, S. H. and Sytkowshi,
A. J. (1987) Biochim. Biophys. Acta 910: 224-232. [0353] Wrighton,
N. C., Farrell, F. X., Chang, R. et al., (1996) Science 273:
458-463. [0354] Yamaoka, T., Tabata, Y. and Ikada, Y. (1994) J.
Pharm. Sci. 83: 601-606. [0355] Baldwin, M. D., Zhou, X. J., Ing,
T. S. and Vaziri, N. D. (1998) ASAIO J. 44: 44-47. [0356] Balkwill,
F. R., Goldstein, L. and Stebbing, N. (1985) Int. J. Cancer 35:
613-617. [0357] Balkwill, F. R. (1986) Methods Enzymology 119:
649-657. [0358] Cecil, R. and McPhee, J. R. (1959). Advances in
Protein Chemistry 14, 255-389. [0359] Cox, G. N., McDermott, M. J.,
Merkel, E., Stroh, C. A., Ko, S. C., Squires, C. H., Gleason, T. M.
and Russell, D. (1994) Endocrinology 135: 1913-1920. [0360]
Greenspan, F. S., Li., C. H., Simpson, M. E. and Evans, H. M.
(1949) Endocrinology 45: 455-463. [0361] Johns, T. G., Mackay, I.
R., Callister, K. A., Hertzog, P. J., Devenish, R. J. and Linnane,
A. W. (1992) J. Natl. Cancer Institute 84: 1185-1190. [0362]
Lindner, D. J. and Borden, E. C. (1997) J. Interferon and Cytokine
Research 17:681-693. [0363] Matsumoto, T., Endoh, K., Kamisango,
K., Akamatsu, K., Koizumi, K., Higuchi, M., Imai, N., Misui, H. and
Kawaguchi, T. (1990) Br. J. Haematol. 75: 463-468. [0364]
Torchinskii, Y. M. (1971) in "Sulfhydryl and Disulfide Groups of
Proteins" in Studies of Soviet Science (1971) Nauka Press, Moscow.
[0365] Trona, P. B. (1986) Seminars in Oncology XIII Supplement 2:
3-12. [0366] Vaziri, N. D., Zhou, X. J., and Liao, S. Y. (1994) Am.
J. Physiol. 266: F360-366.
[0367] While various embodiments of the present invention have been
described in detail, it is apparent that modifications and
adaptations of those embodiments will occur to those skilled in the
art. It is to be expressly understood, however, that such
modifications and adaptations are within the scope of the present
invention.
Sequence CWU 1
1
87139DNAartificial sequenceprimer 1ccccggatcc gccaccatgg atctctggca
gctgctgtt 39240DNAartificial sequenceprimer 2ccccgtcgac tctagagcca
ttagatacaa agctcttggg 40339DNAartificial sequenceprimer 3gggggtcgac
catatgttcc caaccattcc cttatccag 39433DNAartificial sequenceprimer
4gggggatcct cactagaagc cacagctgcc ctc 33532DNAartificial
sequenceprimer 5cgcggatccg attagaatcc acagctcccc tc
32665DNAartificial sequenceprimer 6gcatctatgt tcgttttctc tatcgctacc
aacgcttacg cattcccaac cattccctta 60tccag 65766DNAartificial
sequenceprimer 7ccccctctag acatatgaag aagaacatcg cattcctgct
ggcatctatg ttcgttttct 60ctatcg 66862DNAartificial sequenceprimer
8gcagtggcac tggctggttt cgctaccgta gcgcaggcct tcccaaccat tcccttatcc
60ag 62959DNAartificial sequenceprimer 9ccccgtcgac acatatgaag
aagacagcta tcgcgattgc agtggcactg gctggtttc 591036DNAartificial
sequenceprimer 10ctgcttgaag atctgcccac accgggggct gccatc
361124DNAartificial sequenceprimer 11gtagcgcagg ccttcccaac catt
241239DNAartificial sequenceprimer 12ctgcttgaag atctgcccag
tccgggggca gccatcttc 391351DNAartificial sequenceprimer
13gggcagatct tcaagcagac ctacagcaag ttcgactgca actcacacaa c
511434DNAartificial sequenceprimer 14cgcggtaccc gggatccgat
tagaatccac agct 341536DNAartificial sequenceprimer 15gggcagatct
tcaagcagac ctactgcaag ttcgac 361642DNAartificial sequenceprimer
16cgcggtaccg gatccttagc agaagccaca gctgccctcc ac
421736DNAartificial sequenceprimer 17gtcagaggcg ccgtacacca
ggcagttggc gaagac 361842DNAartificial sequenceprimer 18gtcagaggcg
ccgtacacca ggctgttgca gaagacactc ct 421954DNAartificial
sequenceprimer 19gcgctgcagg aatgaatact tctgttcctt tgggatatag
cattcttcaa actc 542066DNAartificial sequenceprimer 20ccccctctag
acatatgaag aagaacatcg cattcctgct ggcatctatg ttcgttttct 60ctatcg
662133DNAartificial sequenceprimer 21gcgctgcagg aagcaatact
tctgttcctt tgg 332265DNAartificial sequenceprimer 22gcatctatgt
tcgttttctc tatcgctacc aacgcttacg cattcccatg cattccctta 60tccag
652333DNAartificial sequenceprimer 23agcctggtgt acggctgctc
tgacagcaac gtc 332433DNAartificial sequenceprimer 24gacgttgctg
tcagagcagc cgtacaccag gct 332531DNAartificial sequenceprimer
25cccggatcca tgggggtgca cgaatgtcct g 312631DNAartificial
sequenceprimer 26cccgaattct atgcccaggt ggacacacct g
31278PRTArtificial sequencesynthetic peptide 27Asp Tyr Lys Asp Asp
Asp Asp Lys 1 5 287PRTArtificial sequencesynthetic peptide 28Ser
Gly Gly Ser Gly Gly Ser 1 5 2933DNAartificial sequenceprimer
29cgcggatcca aaatgggggt gcacgaatgt cct 333051DNAartificial
sequenceprimer 30gtctttgtag tccgagcctc cgcttccgcc cgatctgtcc
cctgtcctgc a 513145DNAartificial sequenceprimer 31cgcgaattct
tatttatcgt catcgtcttt gtagtccgag cctcc 453239DNAartificial
sequenceprimer 32gaggccaagg aggccgagtg tatcacgacg ggctgtgct
393331DNAartificial sequenceprimer 33cccgaattct ggtggatatg
cccaggtgga c 313438DNAartificial sequenceprimer 34gaggccaagg
aggccgagaa atctgtacgg gctgtgct 383531DNAartificial sequenceprimer
35cccggatcca tgggggtgca cgaatgtcct g 313633DNAartificial
sequenceprimer 36agcttgaatg agtgtatcac tgtcccagac acc
333733DNAartificial sequenceprimer 37ggtgtctggg acagtgatac
actcattcaa gct 333833DNAartificial sequenceprimer 38agcttgaatg
agaatatctg tgtcccagac acc 333933DNAartificial sequenceprimer
39ggtgtctggg acacagatat tctcattcaa gct 334039DNAartificial
sequenceprimer 40gccctgttgg tctgctcttc ccagccgtgg gagcccctg
394139DNAartificial sequenceprimer 41caggggctcc cacggctggg
aagagcagac caacagggc 394239DNAartificial sequenceprimer
42gccctgttgg tcaactcttg ccagccgtgg gagcccctg 394339DNAartificial
sequenceprimer 43caggggctcc cacggctggc aagagttgac caacagggc
394427DNAartificial sequenceprimer 44ccagatgcgg cctgtgctgc tccactc
274527DNAartificial sequenceprimer 45gagtggagca gcacaggccg catctgg
274651DNAartificial sequenceprimer 46tttgtagtcc gagcctccgc
ttccgcccga acatctgtcc cctgtcctgc a 514736DNAartificial
sequenceprimer 47cgcggatccg ccaccatggg ggtgcacgaa tgtcct
364833DNAartificial sequenceprimer 48cgcgaattct catctgtccc
ctgtcctgca gcc 334936DNAartificial sequenceprimer 49cgcgaattct
caacatctgt cccctgtcct gcagcc 365033DNAartificial sequenceprimer
50cgcgaattcg gatatgtaaa tagatacaca gtg 335133DNAartificial
sequenceprimer 51cgcaagctta aaagatttaa atcgtgtcat ggt
335266DNAartificial sequenceprimer 52cgcaagcttc atatgtgtga
tctgcctcaa acccacagcc tgggttctag aaggaccttg 60atgctc
665369DNAartificial sequenceprimer 53cgcgaattct tattccttac
ttcttaaact ttcttgcaag tttgtcgaca aagaaaagga 60tctcatgat
695466DNAartificial sequenceprimer 54gcatctatgt tcgttttctc
tatcgctacc aacgcttacg catgtgatct gcctcaaacc 60cacagc
665522DNAartificial sequenceprimer 55ctatgcggca tcagagcaga ta
225622DNAartificial sequenceprimer 56tgtggaattg tgagcggata ac
225727DNAartificial sequenceprimer 57tgtgatctgc cttgtaccca cagcctg
275827DNAartificial sequenceprimer 58caggctgtgg gtacaaggca gatcaca
275921DNAartificial sequenceprimer 59aggcagatca gatgcgtaag c
216021DNAartificial sequenceprimer 60gcttacgcat ctgatctgcc t
216127DNAartificial sequenceprimer 61cttttggaac tggcagccaa actcctc
276227DNAartificial sequenceprimer 62gaggagtttg gctgccagtt ccaaaag
276327DNAartificial sequenceprimer 63ttcagccttt tggcactggt tgccaaa
276427DNAartificial sequenceprimer 64tttggcaacc agtgccaaaa ggctgaa
276527DNAartificial sequenceprimer 65ttcagccttt tggcactggt tgccaaa
276627DNAartificial sequenceprimer 66tttggcaacc agtgccaaaa ggctgaa
276727DNAartificial sequenceprimer 67agccttttgg aaacagttgc caaactc
276827DNAartificial sequenceprimer 68gagtttggca actgtttcca aaaggct
276927DNAartificial sequenceprimer 69ggtttcagcc ttacagaact ggttgcc
277027DNAartificial sequenceprimer 70ggcaaccagt tctgtaaggc tgaaacc
277127DNAartificial sequenceprimer 71agggatggtt tcacactttt ggaactg
277227DNAartificial sequenceprimer 72cagttccaaa agtgtgaaac catccct
277327DNAartificial sequenceprimer 73taggagggtc tcacaccaag cagcaga
277427DNAartificial sequenceprimer 74tctgctgctt ggtgtgagac cctccta
277527DNAartificial sequenceprimer 75caggggagtc tcacacaccc ccacccc
277627DNAartificial sequenceprimer 76ggggtggggg tgtgtgagac tcccctg
277727DNAartificial sequenceprimer 77gcctgtgtga tatgtggggt gggggtg
277827DNAartificial sequenceprimer 78cttcatcagg ggacactctg tcacccc
277927DNAartificial sequenceprimer 79ggggtgacag agtgtcccct gatgaag
278027DNAartificial sequenceprimer 80cacccccacc ccacatatca cacaggc
278127DNAartificial sequenceprimer 81catcagggga gtacatgtca cccccac
278227DNAartificial sequenceprimer 82gtgggggtga catgtactcc cctgatg
278327DNAartificial sequenceprimer 83cccctgtatc acagaggctt ccaggtc
278427DNAartificial sequenceprimer 84gacctggaag cctctgtgat acagggg
278533DNAartificial sequenceprimer 85cgcgaattct tattccttac
atcttaaact ttc 338636DNAartificial sequenceprimer 86cgcgaattct
taacattcct tacttcttaa actttc 368730DNAartificial sequenceprimer
87cgcgaattct taacacttac ttcttaaact 30
* * * * *