U.S. patent application number 15/532916 was filed with the patent office on 2017-12-07 for nucleic acid complex, method for forming nucleic acid hybridization, pharmaceutical composition, nucleic acid probe, and complementary-strand nucleic acid complex.
This patent application is currently assigned to NATIONAL INSTITUTE OF ADVANCED INDUSTRIAL SCIENCE AND TECHNOLOGY. The applicant listed for this patent is NATIONAL INSTITUTE OF ADVANCED INDUSTRIAL SCIENCE AND TECHNOLOGY. Invention is credited to Yu Hirano, Yasuo Komatsu, Yasuhiro Mie.
Application Number | 20170349623 15/532916 |
Document ID | / |
Family ID | 56107409 |
Filed Date | 2017-12-07 |
United States Patent
Application |
20170349623 |
Kind Code |
A1 |
Komatsu; Yasuo ; et
al. |
December 7, 2017 |
NUCLEIC ACID COMPLEX, METHOD FOR FORMING NUCLEIC ACID
HYBRIDIZATION, PHARMACEUTICAL COMPOSITION, NUCLEIC ACID PROBE, AND
COMPLEMENTARY-STRAND NUCLEIC ACID COMPLEX
Abstract
A nucleic acid complex includes a single-stranded nucleic acid
and a cross-linked double-stranded nucleic acid including the first
nucleic acid strand linked to at least one of the 5' end and the 3'
end of the single-stranded nucleic acid and the second nucleic acid
strand including a base sequence that is completely or sufficiently
complementary to the first nucleic acid strand.
Inventors: |
Komatsu; Yasuo;
(Sapporo-shi, Hokkaido, JP) ; Hirano; Yu;
(Sapporo-shi, Hokkaido, JP) ; Mie; Yasuhiro;
(Sapporo-shi, Hokkaido, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NATIONAL INSTITUTE OF ADVANCED INDUSTRIAL SCIENCE AND
TECHNOLOGY |
Tokyo |
|
JP |
|
|
Assignee: |
NATIONAL INSTITUTE OF ADVANCED
INDUSTRIAL SCIENCE AND TECHNOLOGY
Tokyo
JP
|
Family ID: |
56107409 |
Appl. No.: |
15/532916 |
Filed: |
December 8, 2015 |
PCT Filed: |
December 8, 2015 |
PCT NO: |
PCT/JP2015/084402 |
371 Date: |
June 2, 2017 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/7088 20130101;
C12Q 1/6832 20130101; C12N 2310/321 20130101; C12N 15/00 20130101;
A61K 48/00 20130101; C07H 21/02 20130101; A61K 31/713 20130101;
C12N 15/113 20130101; A61P 43/00 20180101; C07H 21/04 20130101;
C12N 2310/141 20130101; C12N 15/09 20130101; C12Q 1/68
20130101 |
International
Class: |
C07H 21/04 20060101
C07H021/04; C12Q 1/68 20060101 C12Q001/68; C07H 21/02 20060101
C07H021/02; C12N 15/113 20100101 C12N015/113 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 12, 2014 |
JP |
2014-251847 |
Claims
1. A nucleic acid complex comprising: a single-stranded nucleic
acid; and a cross-linked double-stranded nucleic acid comprising a
first nucleic acid strand linked to at least one of a 5' end and a
3' end of the single-stranded nucleic acid and a second nucleic
acid strand comprising a base sequence that is completely or
sufficiently complementary to the first nucleic acid strand,
wherein the cross-linked double-stranded nucleic acid is
cross-linked by a bond between sugars of the first nucleic acid
strand and the second nucleic acid strand, wherein the sugars of
the first nucleic acid strand and the second nucleic acid strand
are linked by a cross-linking reagent having an aminooxy group or
an amino group, wherein the cross-linking reagent is a compound
represented by general formula 1:
R.sub.1--NH--O-L.sub.1-D-L.sub.2-A (1) (wherein R.sub.1 is a
protective group of a hydrogen atom, an alkyl group, or an amino
group, D is an aromatic group selected from a substituted or
unsubstituted phenylene group, a substituted or unsubstituted
anthrylene group, a substituted or unsubstituted naphthylene group,
a substituted or unsubstituted phenanthrylene group, a substituted
or unsubstituted anthraquinolylene group, and a substituted or
unsubstituted acridinylene group, or a C.sub.2-10 alkyl group, a
substituent of the aromatic group is selected from the group
consisting of a halogen atom, a C.sub.1-6 alkyl group, a nitro
group, a cyano group, a C.sub.2-6 alkenyl group, a C.sub.3-10
cycloalkyl group, a C.sub.1-10 alkoxy group, and a C.sub.1-10 acyl
group, L.sub.1 is a direct bond or a divalent group represented by
the following general formula 3 or 4; ##STR00011## (wherein R.sub.3
is a C.sub.1-9 alkylene group or
--(CH.sub.2).sub.o--(OCH.sub.2CH.sub.2).sub.p--(CH.sub.2).sub.q--,
o to q are each independently an integer of 0 to 15, o+p+q is 1 to
15), L.sub.2 is a direct bond or a divalent group represented by
the following general formula 5 or 6: ##STR00012## (wherein R.sub.4
is a C.sub.1-9 alkylene group or
--(CH.sub.2).sub.r(OCH.sub.2CH.sub.2).sub.s--(CH.sub.2).sub.t--, r
to t are each independently an integer of 0 to 15, r+s+t is 1 to
15), and A is an aminooxy group or a protected aminooxy group) or a
salt thereof.
2. The nucleic acid complex according to claim 1, wherein the
cross-linked double-stranded nucleic acid is linked to the 5' end
of the single-stranded nucleic acid.
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. The nucleic acid complex according to claim 1, wherein the
cross-linking reagent has/comprises the aminooxy group, and wherein
aldehyde groups in the sugar of the first nucleic acid strand and
the second nucleic acid strand are linked via the aminooxy group of
the cross-linking reagent in the cross-linked double-stranded
nucleic acid.
9. A method of nucleic acid hybridization comprising: the step of
hybridizing the nucleic acid complex according to claim 1 with a
target nucleic acid comprising a base sequence that is completely
or sufficiently complementary to a base sequence of a
single-stranded nucleic acid that forms the nucleic acid
complex.
10. (canceled)
11. (canceled)
12. (canceled)
13. (canceled)
Description
TECHNICAL FIELD
[0001] The present disclosure relates to nucleic acid complexes,
methods of nucleic acid hybridization, pharmaceutical compositions,
probes for nucleic acid detection, and complementary strand nucleic
acid complexes.
BACKGROUND ART
[0002] When nucleic acids are introduced into the body from the
outside, the nucleic acid introduced is readily broken down by
nucleases present in the blood or body fluids and is therefore
unable to stably form hybrids with DNA or RNA that has a target
sequence.
[0003] In view of this, for the purpose of improving nucleic acid's
stability within a living organism, techniques for chemically
modifying the nucleic acid have been developed.
[0004] Non Patent Literature 1 and 2 have reported that locked
nucleic acids (LNAs) developed as modified nucleic acids are highly
stabile in hybridization with RNA. In addition, Non Patent
Literature 3 has reported chemical modification (2'-O-methyl
(2'-OMe) nucleotides) of methylation of the 2' hydroxyl group of
the sugar moiety of nucleic acid to be hybridized.
[0005] In order to improve the durability of nucleic acids within a
living organism, approaches different from the modified nucleic
acid have been suggested.
[0006] Non Patent Literature 4 and 5 describe that formation of a
complementary double stranded nucleic acid structure adjacent to an
oligonucleotide sequence that hybridizes with miRNA improves
nuclease resistance of the oligonucleotide sequence. In addition,
Non Patent Literature 6 and 7 describe that a hairpin loop is
designed to form in a complementary double stranded nucleic acid
structure formed adjacent to an oligonucleotide sequence that
hybridizes with miRNA.
CITATION LIST
Non Patent Literature
[0007] Non Patent Literature 1: Koshkin, A., Singh, S., Nielsen,
P., Rajwanshi, V., Kumar, R., Meldgaard, M., Olsen, C. E. and
Wengel, J. (1998). LNA (locked nucleic acids): synthesis of the
adenine, cytosine, guanine, 5-methylcytosine, thymine and uracil
bicyclonucleoside monomers, oligomerisation, and unprecedented
nucleic acid recognition. Tetrahedron 54, 3607-3630.
[0008] Non Patent Literature 2: Obika, S., Nanbu, D., Hari, Y.,
Andoh, J., Morio, K., Doi, T. and Imanishi, T. (1998). Stability
and structural features of the duplexes containing nucleoside
analogues with a fixed N-type conformation,
2'-O,4'-C-methyleneribonucleosides. Tetrahedron Lett. 39,
5401-5404. [0009] Non Patent Literature 3: Inoue, H., Hayase, Y.,
Imura, A., Iwai, S., Miura, K. and Ohtsuka, E. (1987). Synthesis
and hybridization studies on two complementary
nona(2'-O-methyl)ribonucleotides. Nucleic Acids Res. 15, 6131-6148.
[0010] Non Patent Literature 4: Haraguchi, T., Ozaki, Y. & Iba,
H. (2009). Vectors expressing efficient RNA decoys achieve the
long-term suppression of specific microRNA activity in mammalian
cells. Nucleic Acids Res 37, e43. [0011] Non Patent Literature 5:
Haraguchi, T., Nakano, H., Tagawa, T., Ohki, T., Ueno, Y., Yoshida,
T. & Iba, H. (2012). A potent 2'-O-methylated RNA-based
microRNA inhibitor with unique secondary structures. Nucleic Acids
Res 40, e58. [0012] Non Patent Literature 6: Lennox, K. A. &
Behlke, M. A. (2010). A direct comparison of anti-microRNA
oligonucleotide potency. Pharm Res 27, 1788-1799. [0013] Non Patent
Literature 7: Vermeulen, A., Robertson, B., Dalby, A. B., Marshall,
W. S., Karpilow, J., Leake, D., Khvorova, A. & Baskerville, S.
(2007). Double-stranded regions are essential design components of
potent inhibitors of RISC function. RNA 13, 723-730.
SUMMARY OF INVENTION
Technical Problem
[0014] There have, however, been drawbacks in the methods of Non
Patent Literature 1 to 3; and the cost for the synthesis is high in
particular when multiple nucleic acids are modified in the
oligonucleotide sequence. In addition, the stability of the
complementary double stranded nucleic acid structure formed
adjacent to the oligonucleotide sequence that hybridizes with miRNA
fluctuates according to changes in external factors such as
temperature, ionic strength, or pH in the methods of Non Patent
Literature 4 to 7; and there have thus been some cases where the
complementary double stranded nucleic acid structure dissociates
into single strands within a living organism.
[0015] The present disclosure was made in light of the above
circumstances; and an objective thereof is to provide nucleic acid
complexes capable of stably hybridizing with a target nucleic acid,
methods of nucleic acid hybridization, pharmaceutical compositions,
probes for nucleic acid detection, and complementary strand nucleic
acid complexes.
Solution to Problem
[0016] In order to achieve the above objective, the nucleic acid
complex according to the first aspect of the present disclosure
comprises [0017] a single-stranded nucleic acid and [0018] a
cross-linked double-stranded nucleic acid comprising a first
nucleic acid strand linked to at least one of the 5' end and the 3'
end of the single-stranded nucleic acid and a second nucleic acid
strand comprising a base sequence that is completely or
sufficiently complementary to the first nucleic acid strand.
[0019] The above-mentioned cross-linked double-stranded nucleic
acid is, for example, linked to the 5' end of the single-stranded
nucleic acid.
[0020] The above-mentioned cross-linked double-stranded nucleic
acid is, for example, cross-linked by a bond via a sugar of at
least one of the first nucleic acid strand and the second nucleic
acid strand.
[0021] The above-mentioned cross-linked double-stranded nucleic
acid is, for example, cross-linked by a bond between sugars of the
first nucleic acid strand and the second nucleic acid strand.
[0022] The sugars of the first nucleic acid strand and the second
nucleic acid strand are, for example, bound by at least one kind of
covalent bond selected from the group consisting of an amide bond,
an oxime bond, an alkylamide bond, an S--S bond, and a
carbon-carbon bond.
[0023] The sugars of the first nucleic acid strand and the second
nucleic acid strand are, for example, linked by a cross-linking
reagent having an aminooxy group or an amino group.
[0024] The above-mentioned cross-linking reagent is, for example, a
compound represented by general formula 1:
R.sub.1--NH--O-L.sub.1-D-L.sub.2-A (1)
(wherein
[0025] R.sub.1 is a protective group of a hydrogen atom, an alkyl
group, or an amino group,
[0026] D is an aromatic group selected from a substituted or
unsubstituted phenylene group, a substituted or unsubstituted
anthrylene group, a substituted or unsubstituted naphthylene group,
a substituted or unsubstituted phenanthrylene group, a substituted
or unsubstituted anthraquinolylene group, and a substituted or
unsubstituted acridinylene group, or a C.sub.2-10 alkyl group,
[0027] a substituent of the aromatic group is selected from the
group consisting of a halogen atom, a C.sub.1-6 alkyl group, a
nitro group, a cyano group, a C.sub.2-6 alkenyl group, a C.sub.3-10
cycloalkyl group, a C.sub.1-10 alkoxy group, and a C.sub.1-10 acyl
group,
[0028] L.sub.1 is a direct bond or a divalent group represented by
the following general formula 3 or 4:
##STR00001##
(wherein R.sub.3 is a C.sub.1-9 alkylene group or
--(CH.sub.2).sub.o--(OCH.sub.2CH.sub.2).sub.p--(CH.sub.2).sub.q--,
o to q are each independently an integer of 0 to 15, o+p+q is 1 to
15), L.sub.2 is a direct bond or a divalent group represented by
the following general formula 5 or 6:
##STR00002##
(wherein R.sub.4 is a C.sub.1-9 alkylene group or
--(CH.sub.2).sub.r--(OCH.sub.2CH.sub.2).sub.s--(CH.sub.2).sub.t--,
r to t are each independently an integer of 0 to 15, r+s+t is 1 to
15), and
[0029] A is an aminooxy group or a protected aminooxy group)
or a salt thereof
[0030] The above-mentioned cross-linking reagent, for example, has
the aminooxy group, and
[0031] aldehyde groups in the sugar of the first nucleic acid
strand and the second nucleic acid strand are linked via the
aminooxy group of the cross-linking reagent in the cross-linked
double-stranded nucleic acid.
[0032] The method of nucleic acid hybridization according to the
second aspect of the present disclosure comprises [0033] the step
of hybridizing the nucleic acid complex according to the first
aspect of the present disclosure with a target nucleic acid
comprising a base sequence that is completely or sufficiently
complementary to a base sequence of a single-stranded nucleic acid
that forms the nucleic acid complex.
[0034] The pharmaceutical composition according to the third aspect
of the present disclosure comprises [0035] the nucleic acid complex
according to the first aspect of the present disclosure.
[0036] The probe for nucleic acid detection according to the fourth
aspect of the present disclosure comprises [0037] the nucleic acid
complex according to the first aspect of the present
disclosure.
[0038] The complementary strand nucleic acid complex according to
the fifth aspect of the present disclosure comprises [0039] the
first nucleic acid complex comprising the first single-stranded
nucleic acid and the first cross-linked double-stranded nucleic
acid linked to the 5' end or the 3' end of the first
single-stranded nucleic acid and [0040] the second nucleic acid
complex comprising the second single-stranded nucleic acid
comprising a base sequence that is completely or sufficiently
complementary to the base sequence of the first single-stranded
nucleic acid, [0041] wherein the first single-stranded nucleic acid
and the second single-stranded nucleic acid are hybridized.
[0042] The above-mentioned second nucleic acid complex, for
example, comprises the second cross-linked double-stranded nucleic
acid linked to the 3' end or the 5' end of the second
single-stranded nucleic acid.
Advantageous Effects of Invention
[0043] According to the present disclosure, it is possible to
provide nucleic acid complexes capable of stably hybridizing with a
target nucleic acid, methods of nucleic acid hybridization,
pharmaceutical compositions, probes for nucleic acid detection, and
complementary strand nucleic acid complexes.
BRIEF DESCRIPTION OF DRAWINGS
[0044] FIG. 1A is a figure showing schematically a nucleic acid
complex having a cross-linked double-stranded nucleic acid linked
to the 3' end of a single-stranded nucleic acid; FIG. 1B is a
figure showing schematically a nucleic acid complex having a
cross-linked double-stranded nucleic acid linked to the 5' end of a
single-stranded nucleic acid; FIG. 1C is a figure showing
schematically a nucleic acid complex having two cross-linked
double-stranded nucleic acids linked to both of the 5' end and the
3' end of a single-stranded nucleic acid; FIG. 1D is a figure
showing schematically a nucleic acid complex having a cross-linked
double-stranded nucleic acid with a hairpin loop structure;
[0045] FIG. 1E is a figure showing schematically a nucleic acid
complex having a cross-linked double-stranded nucleic acid of an
another aspect, which nucleic acid complex comprises the first
nucleic acid strand and the second nucleic acid strand with the
same length; FIG. 1F is a figure showing schematically a nucleic
acid complex having a cross-linked double-stranded nucleic acid of
an another aspect, which nucleic acid complex comprises the first
nucleic acid strand and the second nucleic acid strand with
different lengths; FIG. 1G is a figure showing schematically a
nucleic acid complex with a single-stranded nucleic acid being
linked to both of the 5' end and the 3' end of a first nucleic acid
strand; FIG. 1H is a figure showing schematically a nucleic acid
complex with a single-stranded nucleic acid being linked to the 3'
end of the first nucleic acid strand and further with a
single-stranded nucleic acid being linked to the 3' end of the
second nucleic acid strand; FIG. 1I is a figure showing
schematically a form in which two cross-linking sites are present;
FIG. 1J is a figure showing schematically a complementary strand
nucleic acid complex having a cross-linked double-stranded nucleic
acid with the first nucleic acid complex being linked to the 3' end
of a single-stranded nucleic acid; FIG. 1K is a figure showing
schematically a complementary strand nucleic acid complex having a
cross-linked double-stranded nucleic acid with the first nucleic
acid complex being linked to the 5' end of a single-stranded
nucleic acid; and FIG. 1L is a figure showing schematically a
complementary strand nucleic acid complex that further has nucleic
acid strand C1 linked to the 5' end of the first cross-linked
double-stranded nucleic acid and nucleic acid strand C2 linked to
the 5' end of the second cross-linked double-stranded nucleic
acid;
[0046] FIG. 2 is a figure showing schematically nucleic acid
complexes (products with one cross-link and a product with two
cross-links) of Examples and molecules (products with no
cross-links) of Comparative Examples;
[0047] FIG. 3 is a figure showing the base sequence of the nucleic
acid complexes (DNAs) of the Examples 1 to 10 and the base sequence
of the molecules (DNAs) of Comparative Examples 1 to 5;
[0048] FIG. 4 is a figure showing the base sequences of the nucleic
acid complexes (RNAs) of Examples 11 and 12 and the base sequences
of the molecules (RNAs) of Comparative Examples 6 to 9;
[0049] FIG. 5 a figure showing the base sequences of the nucleic
acid complexes (2'-OMe RNAs) of Examples 13 to 18 and the base
sequence of the molecules (2'-OMe RNAs) of Comparative Examples 10
to 18;
[0050] FIG. 6A is a figure illustrating the step of binding
aldehyde groups in sugars of the first nucleic acid strand and the
second nucleic acid strand in a cross-linked double-stranded
nucleic acid via a cross-linking reagent; and FIG. 6B is a figure
illustrating a reduction reaction by sodium cyanoborohydride
(NaBH.sub.3CN);
[0051] FIG. 7A is a figure showing the results of electrophoresis
carried out for the nucleic acid complexes of Examples 1 and 9; and
FIG. 7B is a figure showing the results of electrophoresis carried
out for the nucleic acid complexes of Examples 14 to 17;
[0052] FIG. 8 is a figure of showing the results of Tm value
measurement for the nucleic acid complexes of Examples 1 to 10;
[0053] FIG. 9 is a figure of showing the results of Tm value
measurement for the nucleic acid complexes of Examples 11 and
12;
[0054] FIG. 10 is a figure of showing the results of Tm value
measurement for the nucleic acid complexes of Examples 13 to 15,
and 17;
[0055] FIG. 11A is a figure showing the result of measurement of
miRNA-suppression activity for the nucleic acid complex of Example
14; FIG. 11B is a figure showing the result of measurement of
miRNA-suppression activity for the nucleic acid complex of Example
15; FIG. 11C is a figure showing the result of measurement of
miRNA-suppression activity for the nucleic acid complex of Example
17; and FIG. 11D is a figure showing the result of measurement of
miRNA-suppression activity for the nucleic acid complex of Example
17;
[0056] FIG. 12A is a figure showing the base sequences of
complementary strand nucleic acid complexes of Examples 19 and 20
and the base sequence of molecule of Comparative Example 19; FIG.
12B is a figure showing schematically the complementary strand
nucleic acid complex of Example 19; FIG. 12C is a figure showing
schematically the complementary strand nucleic acid complex of
Example 20; and FIG. 12D is a figure showing the results of Tm
value measurement for the complementary strand nucleic acid
complexes of Examples 19 and 20 and the molecule of Comparative
Example 19;
[0057] FIG. 13 is a figure showing the base sequence of the nucleic
acid complexes (2'-OMe RNAs) of Examples 15 and 21 to 23; and
[0058] FIG. 14A is a figure showing the result of measurement of
miRNA-suppression activity 48 hours after transfection for the
nucleic acid complex of Example 17; and FIG. 14B is a figure
showing the results of measurement of miRNA-suppression activity 48
hours after transfection for the nucleic acid complexes of Examples
14, 15, and 21 to 23.
DESCRIPTION OF EMBODIMENTS
[0059] First, the nucleic acid complex according to the present
disclosure will be described in detail.
[0060] The nucleic acid complex according to the present disclosure
comprises [0061] a single-stranded nucleic acid and [0062] a
cross-linked double-stranded nucleic acid comprising the first
nucleic acid strand linked to at least one of the 5' end and the 3'
end of the single-stranded nucleic acid and the second nucleic acid
strand comprising a base sequence that is completely or
sufficiently complementary to the first nucleic acid strand.
[0063] The term "single-stranded nucleic acid" described above
refers to a "nucleic acid comprising a base sequence that is
completely or sufficiently complementary to the base sequence of a
target nucleic acid." In the present specification, the
"single-stranded nucleic acid" may be DNA; RNA; a modified nucleic
acid obtained by derivatization of a sugar moiety of nucleic acid
such as 2'-O-methylated RNA (hereinafter referred to as 2'-OMe RNA)
and locked nucleic acid (hereinafter referred to as LNA); a
modified nucleic acid obtained by derivatization of a
phosphodiester bond (for example, a phosphothioester bond in which
an oxygen atom is replaced with a sulphur atom); other modified
nucleic acids; or a mixture thereof. It is to be noted that these
modified nucleic acids are disclosed in, for example, Deleavey, G.
F. and Damha, M. J., Chemistry & Biology, 19, 937-954,
2012.
[0064] In the present specification, a "target nucleic acid" may be
either DNA or RNA; and examples thereof can include non-coding RNA
(microRNA, ribosomal RNA, tRNA, or the like), mRNA, and
single-stranded DNA. The target nucleic acid may be those present
within a living organism or those present outside of a living
organism. The length of target nucleic acid is not particularly
restricted and is, for example, preferably 5 to 30 mer and more
preferably 10 to 25 mer.
[0065] In the present specification, "(a single-stranded nucleic
acid) comprising a base sequence that is completely complementary
(to the base sequence of a target nucleic acid)" means that the
single-stranded nucleic acid comprises only a base sequence capable
of pairing with all bases of the base sequence of a target nucleic
acid.
[0066] In the present specification, "(a single-stranded nucleic
acid) comprising a base sequence that is sufficiently complementary
(to the base sequence of a target nucleic acid)" is those
comprising a base sequence that can be paired with not less than
50% and less than 100%, preferably not less than 60% and less than
100%, more preferably not less than 70% and less than 100%, further
preferably not less than 80% and less than 100%, still more
preferably not less than 90% and less than 100% of bases in the
base sequence of a target nucleic acid. To be specific, examples
include cases where one or two to four bases in the nucleic acid
strand comprising a base sequence that is completely complementary
to the base sequence of a target nucleic acid are substituted with
other bases and, as a result, nucleotide residues at the
substitution positions become unable to make pairing (in these
cases, the position at which the substitution with other bases
takes place is referred to as a "mismatch site") and cases where
one or two to four bases in the nucleic acid strand comprising a
base sequence that is completely complementary to the base sequence
of a target nucleic acid are deleted and, as a result, nucleotide
residues at the deletion positions become unable to make
pairing.
[0067] In the present specification, a "single-stranded nucleic
acid comprising a base sequence that is completely complementary to
the base sequence of a target nucleic acid" and a "single-stranded
nucleic acid comprising a base sequence that is sufficiently
complementary to the base sequence of a target nucleic acid" may in
some cases be collectively referred to as simply a "single-stranded
nucleic acid". It is to be noted that the "single-stranded nucleic
acid" is shown using a lateral thin line in FIG. 1A to L.
[0068] The above-mentioned "cross-linked double-stranded nucleic
acid" includes those comprising two nucleic acid strands comprising
a completely or sufficiently complementary base sequence, which is
linked to at least one of the 5' end and the 3' end of a
single-stranded nucleic acid (the "cross-linked double-stranded
nucleic acid" is indicated by two lateral bold arrows in FIG. 1).
The "cross-linked double-stranded nucleic acid" comprises two
nucleic acid strands; and one nucleic acid strand (the first
nucleic acid strand) and the other nucleic acid strand (the second
nucleic acid strand) comprising a base sequence that is completely
or sufficiently complementary (in the same way as described above)
to the nucleic acid strand (the first nucleic acid strand) are
hybridized and, in addition, the first nucleic acid strand and the
second nucleic acid strand are bound and cross-linked in the
nucleic acid strand of the first nucleic acid strand and the second
nucleic acid strand (in FIG. 1, the vertical wide line indicates
that the first nucleic acid strand and the second nucleic acid
strand are cross-linked). Here, the "cross-linked double-stranded
nucleic acid" includes those in which two nucleic acid strands are
linked via a hairpin loop structure outside of the nucleic acid
strands (FIG. 1D). Examples of the link of the hairpin loop
structure in this case include a polynucleotide (for example, a
polynucleotide comprising 3 to 10 bases (for example, thymidine
residues)); an alkyl chain having 2 to 20 carbon atoms; a
polynucleotide (for example, 3 to 10 mer)+an alkyl chain having 2
to 20 carbon atoms; and a nucleotide or nucleotides+an alkyl chain
having 2 to 20 carbon atoms. An example of "a nucleotide or
nucleotides+alkyl chain having 2 to 20 carbon atoms" in this case
(thymidine+alkyl chain) is shown below.
##STR00003##
[0069] The two nucleic acid strands (that is, the first nucleic
acid strand and the second nucleic acid strand) in the cross-linked
double-stranded nucleic acid may be DNA; RNA; a modified nucleic
acid obtained by derivatization of a sugar moiety of a nucleic acid
such as 2'-OMe RNA and LNA; a modified nucleic acid obtained by
derivatization of a phosphodiester bond; other modified nucleic
acids; or a mixture thereof. It is to be noted that these modified
nucleic acids are the same as described above. Further, the length
of the first nucleic acid strand and the second nucleic acid strand
is not particularly restricted and is, for example, preferably 5 bp
to 30 bp, more preferably 7 bp to 20 bp, and still more preferably
9 bp to 12 bp. Further, the first nucleic acid strand and the
second nucleic acid strand may have the same lengths or may have
different lengths. In the case in which the length of the first
nucleic acid strand and the second nucleic acid strand is the same,
besides the mode shown in FIG. 1A to C, what is also includes is,
for example, as shown in FIG. 1E, a mode in which a sequence part
that is not completely or sufficiently complementary to the second
nucleic acid strand is present at the 3' side of the first nucleic
acid strand and, at the same time, a sequence part that is not
completely or sufficiently complementary to the first nucleic acid
strand is present at the 3' side of the second nucleic acid strand.
Further, examples of cases where the first nucleic acid strand and
the second nucleic acid strand have different lengths include a
mode in which, as shown in FIG. 1F, the first nucleic acid strand
is longer than the second nucleic acid strand and a sequence part
that is not completely or sufficiently complementary to the second
nucleic acid strand is present at both of the 5' side and the 3'
side of the first nucleic acid strand. Further, whereas the
single-stranded nucleic acid is linked to the 5' end of the first
nucleic acid strand of the cross-linked double-stranded nucleic
acid in FIG. 1A and the single-stranded nucleic acid is linked to
the 3' end of the first nucleic acid strand in FIG. 1B, the
single-stranded nucleic acid may be, as shown in FIG. 1G, linked to
both of the 5' end and the 3' end of the first nucleic acid strand.
Further, as shown in FIG. 1H, the single-stranded nucleic acid may
be linked to the 3' end of the first nucleic acid strand and the
single-stranded nucleic acid may be further the 3' end of the
second nucleic acid strand. (Similarly, the single-stranded nucleic
acid may be linked to the 5' end of the first nucleic acid strand
and the single-stranded nucleic acid may be further the 5' end of
the second nucleic acid strand.) Further, the cross-linked
double-stranded nucleic acid may be, as shown in FIG. 1A, linked to
the 3' end of the single-stranded nucleic acid or may be, as shown
in FIG. 1B, linked to the 5' end of the single-stranded nucleic
acid. Preferably, the cross-linked double-stranded nucleic acid is,
as shown in FIG. 1B, linked to the 5' end of single-stranded
nucleic acid. The cross-linking between the nucleic acid strands of
the first nucleic acid strand and the second nucleic acid strand
makes it possible to reduce dissociation between the nucleic acid
strands of the first nucleic acid strand and the second nucleic
acid strand in the cross-linked double-stranded nucleic acid and to
keep the single-stranded nucleic acid and a target nucleic acid
hybridized stably. It is to be noted that, in the present
specification, the "cross-linked double-stranded nucleic acid" may
in some cases be referred to as a "cross-linking adapter
sequence".
[0070] It is to be noted that the "single-stranded nucleic acid"
and the "cross-linked double-stranded nucleic acid" in the nucleic
acid complex according to the present disclosure may be the same
kind or different kinds of nucleic acids. For example, the
"single-stranded nucleic acid" may be RNA and the "cross-linked
double-stranded nucleic acid" may be DNA.
[0071] In the cross-linked double-stranded nucleic acid, two
nucleic acid strands of the first nucleic acid strand and the
second nucleic acid strand are bound and cross-linked; and a method
of cross-linking is not particularly restricted and any can be as
appropriate employed as long as it is a technique capable of
linking the two nucleic acid strands of the first nucleic acid
strand and the second nucleic acid strand. The two nucleic acid
strands of the first nucleic acid strand and the second nucleic
acid strand may be cross-linked by, for example, a bond via a sugar
of at least one of the first nucleic acid strand and the second
nucleic acid strand. Further, the two nucleic acid strands of the
first nucleic acid strand and the second nucleic acid strand may be
cross-linked by, for example, a bond between sugars of the first
nucleic acid strand and the second nucleic acid strand; and in this
case the sugars of the first nucleic acid strand and the second
nucleic acid strand may be bound by a covalent bond including an
amide bond, an oxime bond, an alkylamide bond, an S--S bond, and a
carbon-carbon bond (for example, a bond via an alkyl chain having 2
to 10 carbon atoms).
[0072] In the case in which the first nucleic acid strand and the
second nucleic acid strand are cross-linked between sugars thereof
in the cross-linked double-stranded nucleic acid, a reactive group
present in the sugar of the nucleic acid or a reactive group
introduced to the sugar of the nucleic acid may, for example, be
linked by a cross-linking reagent. Examples of the reactive group
in this case can include an aldehyde group, a thiol group, an azide
group, and an amino group.
[0073] The sugars in the nucleic acid strand of the first nucleic
acid strand and the second nucleic acid strand may be linked by a
cross-linking reagent having, for example, an aminooxy group or an
amino group. In this case, the reactive groups of the sugars are
linked by reacting a reactive group of the sugar (for example, an
aldehyde group, a thiol group, an azide group, an amino group, or
the like) with the aminooxy group or the amino group.
[0074] Examples of the cross-linking reagent with an aminooxy group
or an amino group can include a compound represented by
general formula 1:
R.sub.1--NH--O-L.sub.1-D-L.sub.2-A (1)
(wherein
[0075] R.sub.1 is a protective group of a hydrogen atom, an alkyl
group, or an amino group,
[0076] D is an aromatic group selected from a substituted or
unsubstituted phenylene group, a substituted or unsubstituted
anthrylene group, a substituted or unsubstituted naphthylene group,
a substituted or unsubstituted phenanthrylene group, a substituted
or unsubstituted anthraquinolylene group, and a substituted or
unsubstituted acridinylene group, or a C.sub.2-10 alkyl group,
[0077] a substituent of the aromatic group is selected from the
group consisting of a halogen atom, a C.sub.1-6 alkyl group, a
nitro group, a cyano group, a C.sub.2-6 alkenyl group, a C.sub.3-10
cycloalkyl group, a C.sub.1-10 alkoxy group, and a C.sub.1-10 acyl
group,
[0078] L.sub.1 is a direct bond or a divalent group represented by
the following general formula 3 or 4:
##STR00004##
(wherein R.sub.3 is a C.sub.1-9 alkylene group or
--(CH.sub.2).sub.o--(OCH.sub.2CH.sub.2).sub.p--(CH.sub.2).sub.q--,
o to q are each independently an integer of 0 to 15, o+p+q is 1 to
15),
[0079] L.sub.2 is a direct bond or a divalent group represented by
the following general formula 5 or 6:
##STR00005##
(wherein R.sub.4 is a C.sub.1-9 alkylene group or
--(CH.sub.2).sub.rOCH.sub.2CH.sub.2).sub.s--(CH.sub.2).sub.t, r to
t are each independently an integer of 0 to 15, r+s+t is 1 to 15),
and
[0080] A is an aminooxy group or a protected aminooxy group)
or a salt thereof. This cross-linking reagent is as described in
Japanese Patent No. 5196448.
[0081] In the cross-linked double-stranded nucleic acid, aldehyde
groups in the sugars of the first nucleic acid strand and the
second nucleic acid strand may be linked via an aminooxy group
(divalent) of a cross-linking reagent. In this case, a
cross-linking reagent having an aminooxy group is used; and
N.sup.1,N.sup.5-bis(aminooxyacetyl)-1,5-diaminonaphthalene (aoNao)
which is shown below may, for example, be used as the cross-linking
reagent.
##STR00006##
[0082] In the cross-linked double-stranded nucleic acid, in the
case in which the aldehyde groups of the sugars of the first
nucleic acid strand and the second nucleic acid strand are linked
via the aminooxy group (divalent) of the cross-linking reagent, an
example method is a method comprising synthesizing the first
nucleic acid strand and the second nucleic acid strand so as to
contain deoxyuridine at a position at which the first nucleic acid
strand and the second nucleic acid strand make pairing; treating
the first nucleic acid strand and the second nucleic acid strand
with Uracil DNA glycosylase (UDG) to allow an AP site to be formed
in the deoxyuridine of the first nucleic acid strand and the second
nucleic acid strand (FIG. 6A (i)) (the AP site exists in an
equilibrium state; and an open ring form has an aldehyde group);
and adding a cross-linking reagent thereto to bring into ligation
reaction with the aldehyde group, thereby cross-linking the first
nucleic acid strand and the second nucleic acid strand (FIG. 6A
(ii)).
[0083] The two nucleic acid strands of the first nucleic acid
strand and the second nucleic acid strand may be cross-linked via,
for example, a bond via a sugar of at least one of the first
nucleic acid strand and the second nucleic acid strand and may be
cross-linked by, for example, a bond between the sugar and the base
of the two nucleic acid strands. As for the bond between the sugar
and the base of the two nucleic acid strands of the first nucleic
acid strand and the second nucleic acid strand, an example method
is a method comprising treating, with Uracil DNA glycosylase (UDG),
the first nucleic acid strand or the second nucleic acid strand
synthesized so as to contain deoxyuridine allow an AP site to be
form at the deoxyuridine in the first nucleic acid strand or the
second nucleic acid strand; and reacting --NH group of guanine or
adenine of the second nucleic acid strand or the first nucleic acid
strand with the aldehyde group of the AP site formed in the first
nucleic acid strand or the second nucleic acid strand, thereby
cross-linking the first nucleic acid strand and the second nucleic
acid strand.
[0084] It is to be noted that, although FIG. 1A to C illustrate
cross-linked double-stranded nucleic acids in which the nucleic
acid strands of the first nucleic acid strand and the second
nucleic acid strand are cross-linked only at one site, the nucleic
acid strands of the first nucleic acid strand and the second
nucleic acid strand may be cross-linked at two sites or three or
more sites (FIG. 1I shows a mode with two cross-linking sites). The
more increased number of the sites at which the nucleic acid
strands of the first nucleic acid strand and the second nucleic
acid strand are cross-linked increases allows less dissociation of
the nucleic acid strands of the first nucleic acid strand and the
second nucleic acid strand in the cross-linked double-stranded
nucleic acid. It is to be noted that in cases where the nucleic
acid strands of the first nucleic acid strand and the second
nucleic acid strand are cross-linked at, for example, two sites or
three or more sites, each of the sites may be held by different
types of bonds may different from each site (for example, in the
case of the two sites, one of the sites may be cross-linked by, for
example, an amide bond whereas the other site may be cross-linked
by, for example, an oxime bond; and different cross-linking
reagents may, for example, be used from one site to the other
site.) Further, with regard to the site at which the nucleic acid
strands of the first nucleic acid strand and the second nucleic
acid strand are cross-linked, in the case in which 12-mer nucleic
acid strands are, for example, cross-linked at one site to form a
cross-linked double-stranded nucleic acid, the 12-mer nucleic acid
strands may be bound and cross-linked at a site located at a
substantially center (the sixth or seventh nucleic acid from the 5'
end).
[0085] In the nucleic acid complex according to the present
disclosure, the cross-linked double-stranded nucleic acid is linked
to at least one of the 5' end and the 3' end of a single-stranded
nucleic acid. That is, one cross-linked double-stranded nucleic
acid may be linked to the 3' end of the single-stranded nucleic
acid (FIG. 1A); one cross-linked double-stranded nucleic acid may
be linked to the 5' end of the single-stranded nucleic acid (FIG.
1B); or one cross-linked double-stranded nucleic acid may be linked
to each of both 5' end and 3' end of the single-stranded nucleic
acid (FIG. 1C). In the case in which one cross-linked
double-stranded nucleic acid is linked to each of both 5' end and
3' end of the single-stranded nucleic acid (FIG. 1C), the base
sequences of the two cross-linked double-stranded nucleic acids may
be the same or different. It is to be noted that, as just described
above, the cross-linked double-stranded nucleic acid may be linked
to the 3' end of the single-stranded nucleic acid as shown in FIG.
1A or may be linked to the 5' end of the single-stranded nucleic
acid as shown in FIG. 1B and is preferably linked to the 5' end of
the single-stranded nucleic acid as shown in FIG. 1B.
[0086] Means for linking the cross-linked double-stranded nucleic
acid to the single-stranded nucleic acid is not particularly
limited. In cases where the cross-linked double-stranded nucleic
acid is linked to, for example, the 5' end of the single-stranded
nucleic acid, the nucleoside of the 5' end of the single-stranded
nucleic acid form a phosphodiester bond to be linked with the
nucleoside of the 3' end of one nucleic acid strand of the
cross-linked double-stranded nucleic acid. In cases where the
cross-linked double-stranded nucleic acid is linked to, for
example, the 3' end of the single-stranded nucleic acid, the
nucleoside of the 3' end of the single-stranded nucleic acid form a
phosphodiester bond to be linked with the nucleoside of the 5' end
of one nucleic acid strand of the cross-linked double-stranded
nucleic acid. Further, a "linker (spacer)" may be inserted between
the single-stranded nucleic acid and one of the nucleic acid
strands of the cross-linked double-stranded nucleic acid. In the
present specification, the "linker (spacer)" may be, for example,
one nucleotide (for example, guanine or the like) or a 2- to 20-mer
polynucleotide (for example, several thymidine residues, GCC, or
the like), or may be a linear alkyl chain having 1 to 20 carbon
atoms. A propyl linker is shown below as an example of the "linear
alkyl chain having 1 to 20 carbon atoms" in this case.
##STR00007##
[0087] It is to be noted that he linker (spacer) described just
above may be inserted or may not be inserted between the
single-stranded nucleic acid and one of the nucleic acid strands of
the cross-linked double-stranded nucleic acid.
[0088] An example of a method of synthesizing a nucleic acid
complex (a nucleic acid complex in which both single-stranded
nucleic acid and cross-linked double-stranded nucleic acid make of
DNA) will be described. The first nucleic acid strand of the
cross-linked double-stranded nucleic acid and an oligonucleotide
having a base sequence of both of the second nucleic acid strand of
the cross-linked double-stranded nucleic acid and a single-stranded
nucleic acid, both strands being linked, are each synthesized by an
automated DNA synthesizer (the first nucleic acid strand and the
second nucleic acid strand are synthesized so as to contain
deoxyuridine at a position at which the first nucleic acid strand
and the second nucleic acid strand make pairing) and purified by a
known method. The thus synthesized two kinds of DNA strands are
placed in a solution containing Uracil DNA glycosylase (UDG) and
reacted with the enzyme. To the obtained reaction solution, UDG is
added for further reaction. To the obtained reaction solution,
aoNao was added as a cross-linking reagent to allow for a reaction,
thereby forming the cross-linked double-stranded nucleic acid.
Purification is then carried out by HPLC to obtain the nucleic acid
complex comprising DNA.
[0089] As described thus far, when the nucleic acid complex
according to the present disclosure is hybridized with a target
nucleic acid, the stability of hybridization between the target
nucleic acid and the single-stranded nucleic acid in the nucleic
acid complex is enhanced. Without wishing to be bound by a
particular theory, this is thought to be because the structure of
the cross-linked double-stranded nucleic acid becomes highly rigid
due to the cross-linking in the nucleic acid complex according to
the present disclosure and restricts physical movement, resulting
in stable hybridization (between the target nucleic acid and the
single-stranded nucleic acid) in adjacent sites. It is to be noted
that, as described later in Examples, in the case in which one
cross-linked double-stranded nucleic acid is linked to each of both
5' end and 3' end of the single-stranded nucleic acid (FIG. 1C),
the stability of hybridization between the target nucleic acid and
the single-stranded nucleic acid in the nucleic acid complex is
more enhanced because a structurally stable cross-linked
double-stranded nucleic acid is present at both ends.
[0090] Further because the cross-linked double-stranded nucleic
acids exhibits a very high resistance to nucleases, the nucleic
acid complex according to the present disclosure is able to
continuously produce the effect within a living organism.
[0091] Further, according to the nucleic acid complex according to
the present disclosure, because stable hybridization is feasible
without chemical modification for stabilizing a target nucleic acid
and a single-stranded nucleic acid hybridizing therewith, the cost
of synthesis can be reduced.
[0092] Next, the method of nucleic acid hybridization according to
the present disclosure will be described.
[0093] The method of nucleic acid hybridization according to the
present disclosure comprises the step of hybridizing the nucleic
acid complex described above with a target nucleic acid comprising
a base sequence that is completely or sufficiently complementary
(in the same way as described above) to the base sequence of the
single-stranded nucleic acid (as described above) composing the
nucleic acid complex. The step of "hybridizing the nucleic acid
complex with a target nucleic acid" include, for example,
introducing the nucleic acid complex to a living organism to
hybridize with a target nucleic acid present within a living
organism; adding the nucleic acid complex to a solution containing
a target nucleic acid to hybridize with the target nucleic acid;
bringing the nucleic acid complex into contact with a solid phase
on which a target nucleic acid is supported to hybridize with the
target nucleic acid; or the like. According to the method of
nucleic acid hybridization according to the present disclosure, the
stability of hybridization between the target nucleic acid and the
single-stranded nucleic acid in the nucleic acid complex is
enhanced.
[0094] Next, the pharmaceutical composition according to the
present disclosure will be described.
[0095] The pharmaceutical composition according to the present
disclosure contains the nucleic acid complex described above and
can be used as an antisense nucleic acid pharmaceutical product
targeting non-coding RNA (microRNA, Ribosomal RNA, tRNA, or the
like), mRNA, single-stranded DNA, or the like which is present
within a living organism. To be more specific, the entire sequence
or a partial sequence of non-coding RNA (microRNA, Ribosomal RNA,
tRNA, or the like), mRNA, single-stranded DNA, or the like which is
present within a living organism is regarded as the "target nucleic
acid"; and a nucleic acid complex containing a single-stranded
nucleic acid comprising a base sequence that is completely or
sufficiently complementary (in the same way as described above) to
the base sequence of the target nucleic acid can be used as an
antisense nucleic acid pharmaceutical product.
[0096] The pharmaceutical composition according to the present
disclosure can for example be used as a microRNA inhibitor. In this
case, the entire sequence or a partial sequence of microRNA present
within a living organism is regarded as the "target nucleic acid".
Examples of the microRNA can include miRNA21, miRNA122, miRNA224,
miRNA10b, miRNA221, miRNA222, miRNA20, miRNA18, miRNA23a, miRNA141,
miRNA200b, miRNA27a, miRNA342, miRNA26a, miRNA30d, miRNA26b,
miRNA107, miRNA203, miRNA204, miRNA211, miRNA105, miRNA181a,
miRNA155, miRNA181b, miRNA25, miRNA424, miRNA151, miRNA223,
miRNA25, miRNA17-5p, miRNA125b, miRNA106a, miRNA92, miRNA103,
miRNA93, miRNA100, miRNA106b, miRNA20a, miRNA190, miRNA33,
miRNA19a, miRNA140, miRNA123, miRNA188, miRNA154, miRNA217,
miRNA101, miRNA196, miRNA134, miRNA132, miRNA192, miRNA16, miRNA15,
miRNA200a, miRNA200c, miRNA191, miRNA210, miRNA32, miRNA182,
miRNA31, and miRNA146a.
[0097] The pharmaceutical composition according to the present
disclosure can, for example, be used to directly control mRNA. In
this case, the entire sequence or a partial sequence of mRNA
present within a living organism is regarded as the "target nucleic
acid".
[0098] Because the pharmaceutical composition according to the
present disclosure contains the nucleic acid complex, it is able to
enhance stable hybridization between the target nucleic acid and
the single-stranded nucleic acid in the nucleic acid complex and to
be thus highly effective as a pharmaceutical product. In addition,
because the pharmaceutical composition is able to stably hybridize
with the target nucleic acid, the amount of pharmaceutical
composition to be administered is expected to be reduced.
[0099] Next, the probe for nucleic acid detection according to the
present disclosure will be described.
[0100] The probe for nucleic acid detection according to the
present disclosure contains the nucleic acid complex described
above and can be used as a probe for nucleic acid detection
targeting non-coding RNA (microRNA, Ribosomal RNA, tRNA, or the
like), mRNA, single-stranded DNA, or the like which is present
within or outside of a living organism. To be specific, the entire
sequence or a partial sequence of non-coding RNA (microRNA,
Ribosomal RNA, tRNA, or the like), mRNA, single-stranded DNA, or
the like which is present within or outside of a living organism is
regarded as the "target nucleic acid"; and a nucleic acid complex
containing a single-stranded nucleic acid comprising a base
sequence that is completely or sufficiently complementary (in the
same way as described above) to the base sequence of the target
nucleic acid can be used as a probe for nucleic acid detection. In
order to detect the hybridization with the target nucleic acid, the
nucleic acid complex may be labeled with a fluorescent
substance.
[0101] Because the probe for nucleic acid detection according to
the present disclosure contains the nucleic acid complex described
above, enhanced stability of the hybridization between the target
nucleic acid and the single-stranded nucleic acid in the nucleic
acid complex can be attained, allowing highly sensitive detection
of nucleic acids.
[0102] Next, the complementary strand nucleic acid complex
according to the present disclosure will be described.
[0103] The complementary strand nucleic acid complex according to
the present disclosure comprises
[0104] the first nucleic acid complex containing the first
single-stranded nucleic acid and the first cross-linked
double-stranded nucleic acid linked to the 5' end or the 3' end of
the first single-stranded nucleic acid, and
[0105] the second nucleic acid complex containing the second
single-stranded nucleic acid comprising a base sequence that is
completely or sufficiently complementary to the base sequence of
the first single-stranded nucleic acid,
[0106] wherein the first single-stranded nucleic acid and the
second single-stranded nucleic acid are hybridized.
[0107] In the complementary strand nucleic acid complex according
to the present disclosure, the second nucleic acid complex may, for
example, contain the second cross-linked double-stranded nucleic
acid linked to the 3' end or the 5' end of the second
single-stranded nucleic acid. In this case, both of the first
nucleic acid complex and the second nucleic acid complex have the
cross-linked double-stranded nucleic acid. It is to be noted that
the first cross-linked double-stranded nucleic acid and the second
cross-linked double-stranded nucleic acid may have a hairpin loop
structure as shown in FIG. 1D.
[0108] FIG. 1J shows a schematic view of the first form of the
complementary strand nucleic acid complex in the case in which both
of the first nucleic acid complex and the second nucleic acid
complex have the cross-linked double-stranded nucleic acid. In the
first form of the complementary strand nucleic acid complex, the
first nucleic acid complex has the first cross-linked
double-stranded nucleic acid linked to the 3' end of the first
single-stranded nucleic acid and the second nucleic acid complex
has the second cross-linked double-stranded nucleic acid linked to
the 3' end of the second single-stranded nucleic acid, wherein the
first single-stranded nucleic acid and the second single-stranded
nucleic acid are hybridized.
[0109] FIG. 1K shows a schematic view of the second form of the
complementary strand nucleic acid complex in the case in which both
of the first nucleic acid complex and the second nucleic acid
complex have the cross-linked double-stranded nucleic acid. In the
first form of the complementary strand nucleic acid complex, the
first nucleic acid complex has the first cross-linked
double-stranded nucleic acid linked to the 5' end of the first
single-stranded nucleic acid and the second nucleic acid complex
has the second cross-linked double-stranded nucleic acid linked to
the 5' end of the second single-stranded nucleic acid, wherein the
first single-stranded nucleic acid and the second single-stranded
nucleic acid are hybridized.
[0110] It is to be noted that, in the case in which both of the
first nucleic acid complex and the second nucleic acid complex have
the cross-linked double-stranded nucleic acid, the first
cross-linked double-stranded nucleic acid and the second
cross-linked double-stranded nucleic acid may have the same base
sequence or may have different base sequences in each of the first
form of the complementary strand nucleic acid complex and the
second form of the complementary strand nucleic acid complex.
[0111] Because the complementary strand nucleic acid complex
according to the present disclosure has the first cross-linked
double-stranded nucleic acid or both of the first cross-linked
double-stranded nucleic acid and the second cross-linked
double-stranded nucleic acid, stable hybridization as double
strands can be achieved.
[0112] It is to be noted that the complementary strand nucleic acid
complex according to the present disclosure may further have, for
example, nucleic acid strand C1 linked to the 5' end of the first
cross-linked double-stranded nucleic acid and nucleic acid strand
C2 linked to the 5' end of the second cross-linked double-stranded
nucleic acid, as shown in FIG. 1L. The base sequence of the nucleic
acid strand C1 is a base sequence that is completely or
sufficiently complementary (in the same way as described above) to
the base sequence of the nucleic acid strand C2; and the nucleic
acid strand C1 and the nucleic acid strand C2 are able to stably
hybridized. Having the nucleic acid strand C1 and the nucleic acid
strand C2 may allow a stable polymerized structure with a chain of
two or more molecules. It is to be noted that the complementary
strand nucleic acid complex according to other aspects may be a
complementary strand nucleic acid complex that further has the
nucleic acid strand C1 linked to the 3' end of the first
cross-linked double-stranded nucleic acid and the nucleic acid
strand C2 linked to the 3' end of the second cross-linked
double-stranded nucleic acid (the nucleic acid strand C1 and the
nucleic acid strand C2 are the same as described above).
EXAMPLES
[0113] By way of example, the present disclosure will now be
specifically described below. The present disclosure is, however,
not limited to these examples.
Example A
(Outline of Oligonucleotides Synthesized)
[0114] As target nucleic acids (target RNAs), miR21 (SEQ ID NO: 1)
and miR21-M (miR21 with one base mismatch) (SEQ ID NO: 2) (both
have 22 mer) were selected; and an oligonucleotide complementary to
miR21 or miR21-M was synthesized.
[0115] The base sequences of miR21 and miR21-M are shown below.
TABLE-US-00001 miR21: (SEQ ID NO: 1) 5' UAGCUUAUCAGACUGAUGUUGA 3'
miR21-M: (SEQ ID NO: 2) 5' UAGCUUAUCACACUGAUGUUGA 3'
[0116] To be more specific with regard to the oligonucleotide
complementary to miR21 or miR21-M, products with one cross-link
(CL1) having a single-stranded nucleic acid comprising a base
sequence that is completely or sufficiently complementary to the
base sequence of a target nucleic acid (hereinafter referred to
simply as a "complementary binding-like sequence" in the present
Examples) and a double-stranded cross-linking adapter sequence at
the 5' side or the 3' side (including those having the
cross-linking adapter sequence with a hairpin loop structure and
those having a linker inserted between the cross-linking adapter
sequence and the complementary binding-like sequence); and products
with two cross-links (CL2) having the complementary binding-like
sequence and a double-stranded cross-linking adapter sequence at
both of the 5' side and the 3' side were, as shown in FIG. 2,
synthesized as Examples. In addition, products with no cross-links
(DS) having a single-stranded nucleic acid strand comprising a base
sequence complementary to the base sequence of a target RNA
(hereinafter, referred to simply as a "complementary binding-like
sequence" in the Examples) and a single-stranded nucleic acid
strand linked to the complementary binding-like sequence
(hereinafter, referred to simply as a "single-stranded adapter
sequence" in the Examples) at the 5' side; products with no
cross-links (DS) having the complementary binding-like sequence and
a double-stranded nucleic acid strand linked to the complementary
binding-like sequence (hereinafter, referred to simply as a
"double-stranded adapter sequence" in the Examples) at the 5' side
or the 3' side (including those with a double-stranded adapter
sequence having a hairpin loop structure); products with no
cross-links (DS) having the complementary binding-like sequence and
the single-stranded adapter sequence at both of the 5' side and the
3' side; and products with no cross-links (DS) having the
complementary binding-like sequence and the double-stranded adapter
sequence at both of the 5' side and the 3' side were, as shown in
FIG. 2, synthesized as Comparative Examples. In addition, a nucleic
acid strand was synthesized as a control (Comparative Example),
which nucleic acid strand did not have the cross-linking adapter
sequence and have only the complementary binding-like sequence.
Note that Comparative Example 18 (mCL2(12-I.times.2/34)) (FIG. 5)
is an exception and is a Comparative Example in which the nucleic
acid strand has the cross-linking adapter sequence but the length
of a region hybridizing with miR21 is about 10 bases. It is to be
noted that the direction of the arrow indicates from 5' to 3' in
FIG. 2.
[0117] As for the oligonucleotides synthesized, the sequence of DNA
(FIG. 3), RNA (FIG. 4), and 2'-O-methyl (2'-OMe)RNA (FIG. 5) is
shown in each figure. Each of the oligonucleotides will be
described below. It is to be noted that, in the Examples, the
double-stranded cross-linking adapter sequence is cross-linked by a
bond between sugars of two nucleic acid strands (FIG. 6A, described
later).
(DNAs Synthesized)
[0118] The sequences of DNAs synthesized are shown in FIG. 3. In
FIG. 3, the sequence complementary to miR21 is underlined; "X" in
the sequence represents a cross-linking site in the oligonucleotide
chain; and the vertical wide line indicates that the nucleic acid
strands are together cross-linked by a cross-linking reagent. It is
to be noted that "u" represents deoxyuridine in FIGS. 3 to 5. The
structural formula of deoxyuridine is shown below.
##STR00008##
[0119] As Example 1, d5'CL(12/34) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence was synthesized
(FIG. 3).
[0120] As Example 2, d5'CL(12/34T) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence with T (thymidine)
as a linker therebetween was synthesized (FIG. 3).
[0121] As Example 3, d5'CL(12/34P) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence with a propyl linker
of the following formula therebetween was synthesized (FIG. 3).
##STR00009##
[0122] As Example 4, d5'CL(12/34T8) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence with eight T
(thymidine) residues as a linker therebetween was synthesized (FIG.
3).
[0123] As Example 5, d5'CL(12-5M/34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded cross-linking adapter sequence with a
mismatched base pair in the 5' side of the cross-linking site was
synthesized (FIG. 3).
[0124] As Example 6, d5'CL(12-3M/34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded cross-linking adapter sequence with a
mismatched base pair in the 3' side of the cross-linking site was
synthesized (FIG. 3).
[0125] As Example 7, d5'CL(12/37) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence (the terminal site
of the cross-linking adapter sequence was cross-linked and three
thymidine residues were linked to the end of the cross-linking
adapter sequence) was synthesized (FIG. 3).
[0126] As Example 8, d5'HP CL(50) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence (having a hairpin
loop structure comprising four thymidine residues) in the 3' side
of the cross-linking site was synthesized (FIG. 3).
[0127] As Example 9, dCL2(12-I,II/46) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded cross-linking adapter sequence at both
ends was synthesized (FIG. 3).
[0128] As Example 10, dCL2 (12/34) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence (with the
cross-linking taking place at two sites) was synthesized (FIG.
3).
[0129] As Comparative Example 1, dSS(34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer single-stranded adapter sequence was synthesized (FIG.
3).
[0130] As Comparative Example 2, d5'DS(12/34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence was synthesized (FIG.
3).
[0131] As Comparative Example 3, d5'HP50 having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence, and having a hairpin
loop structure comprising four thymidine residues was synthesized
(FIG. 3).
[0132] As Comparative Example 4, d5'Lig(12/35) having a sequence
complementary to miR21 (a complementary binding-like sequence), and
a hairpin loop of linear alkyl linker that chemically linked a
12-mer DNA with a 35-mer DNA was synthesized (FIG. 3).
[0133] As Comparative Example 5, dSS(46) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer single-stranded adapter sequence at both ends was
synthesized (FIG. 3).
(RNAs Synthesized)
[0134] The sequences of RNAs synthesized are shown in FIG. 4. In
FIG. 4, a sequence complementary to miR21 is underlined; "X" in the
sequence represents a cross-linking site in the oligonucleotide
chain; and the vertical wide line indicates that the nucleic acid
strands are together cross-linked by a cross-linking reagent.
[0135] As Example 11, r5'CL(12/34) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence was synthesized
(FIG. 4).
[0136] As Example 12, dr5'CL(12/34) (chimeric molecule) having a
sequence complementary to miR21 (a complementary binding-like
sequence) (RNA) and a 12-mer double-stranded cross-linking adapter
sequence (DNA) was synthesized (FIG. 4).
[0137] As Comparative Example 6, r-asmi21 comprising a sequence
complementary to miR21 (a complementary binding-like sequence) was
synthesized (FIG. 4).
[0138] As Comparative Example 7, rSS(34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer single-stranded adapter sequence was synthesized (FIG.
4).
[0139] As Comparative Example 8, r5'DS(12/34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence was synthesized (FIG.
4).
[0140] As Comparative Example 9, rHP50 having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence and having a hairpin loop
structure comprising four uracil residues was synthesized (FIG.
4).
(2'-OMe RNAs Synthesized)
[0141] The sequences of 2'-OMe RNAs synthesized are shown in FIG.
5. In FIG. 5, a sequence complementary to miR21 is underlined; "X"
in the sequence represents a cross-linking site in the
oligonucleotide chain; the vertical wide line indicates that the
nucleic acid strands are together cross-linked by a cross-linking
reagent; and "m" in the sequence indicates the nucleic acid strand
in the parentheses is 2'-OMe RNA.
[0142] As Example 13, m5'CL(10/34) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 10-mer
double-stranded cross-linking adapter sequence was synthesized
(FIG. 5).
[0143] As Example 14, m5'CL(12/34) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence was synthesized
(FIG. 5).
[0144] As Example 15, m3'CL(12/34) having a sequence complementary
to miR21 (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence at the 3' side was
synthesized (FIG. 5).
[0145] As Example 16, m3'CL(12/34-M) having a sequence that is not
completely complementary to miR21 (with mismatch bases at two
sites) (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence at the 3' side was
synthesized (FIG. 5).
[0146] As Example 17, mCL2(12-I.times.2/46) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded cross-linking adapter sequence at both
ends was synthesized (FIG. 5).
[0147] As Example 18, mCL2(12-I.times.2/46M) having a sequence that
is not completely complementary to miR21 (with mismatch bases at
two sites) (a complementary binding-like sequence) and a 12-mer
double-stranded cross-linking adapter sequence at both ends was
synthesized (FIG. 5).
[0148] As Comparative Example 10, m-asmiR21 having a sequence
complementary to miR21 (a complementary binding-like sequence) was
synthesized (FIG. 5).
[0149] As Comparative Example 11, mSS(34)dU having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer single-stranded adapter sequence was synthesized (FIG.
5).
[0150] As Comparative Example 12, mSS(34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer single-stranded adapter sequence was synthesized (FIG.
5).
[0151] As Comparative Example 13, m5'DS(12/34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence was synthesized (FIG.
5).
[0152] As Comparative Example 14, mHP50 having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence and having a hairpin loop
structure comprising four uracil residues was synthesized (FIG.
5).
[0153] As Comparative Example 15, m3'DS(12/34) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer double-stranded adapter sequence at the 3' side was
synthesized (FIG. 5).
[0154] As Comparative Example 16, mSS(46) having a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 12-mer single-stranded cross-linking sequence at both ends was
synthesized (FIG. 5).
[0155] As Comparative Example 17, mDS2(12.times.2/46) having a
sequence complementary to miR21 (a complementary binding-like
sequence) and a 12-mer double-stranded cross-linking sequence at
both ends was synthesized (FIG. 5).
[0156] As Comparative Example 18, mCL2(12-I.times.2/34) having a
sequence with a region hybridizing with miR21 of about 10 bases and
a 12-mer double-stranded cross-linking adapter sequence at both
ends was synthesized (FIG. 5).
(Synthesis and Purification of Oligonucleotides)
[0157] In order to prepare the molecules of Examples 1 to 18 and
Comparative Examples 1 to 18, oligonucleotides were each
synthesized as shown in Table 1 and Table 2. It is to be noted
that, in Table 1 and Table 2, "m" in the sequence indicates that
the nucleic acid strand in the parentheses is 2'-OMe RNA and "X"
represents "u: deoxyuridine".
TABLE-US-00002 TABLE 1 Example 1 5' CGGAGCXGCAGC 3' SEQ ID NO: 3
d5' 3' GCCTCGXCGTCGATC SEQ ID NO: 4 CL(12/34) GAATAGTCTGACTACAAC T
5' Example 2 5' CGGAGCXGCAGC 3' SEQ ID NO: 3 d5' 3' GCCTCGXCGTCGTAT
SEQ ID NO: 5 CL(12/34T) CGAATAGTCTGACTACAA CT 5' Example 3 5'
CGGAGCXGCAGC 3' SEQ ID NO: 3 d5' 3' GCCTCGXCGTCGPAT SEQ ID NO: 6
CL(12/34P) CGAATAGTCTGACTACAA SEQ ID NO: 7 CT 5' SEQ ID NO: 6 SEQ
ID NO: 7 Example 4 5' CGGAGCXGCAGC 3' SEQ ID NO: 3 d5' 3'
GCCTCGXCGTCGTTT SEQ ID NO: 8 CL(12/34T8) TTTTTATCGAATAGTCTG
ACTACAACT 5' Example 5 5' CGGTGCXGCAGC 3' SEQ ID NO: 9 d5' 3'
GCCTCGXCGTCGATC SEQ ID NO: 4 CL(12-5M/34) GAATAGTCTGACTACAAC T 5'
Example 6 5' CGGAGCXGCTGC 3' SEQ ID NO: 10 d5' 3' GCCTCGXCGTCGATC
SEQ ID NO: 4 CL(12-3M/34) GAATAGTCTGACTACAAC T 5' Example 7 5'
XGGAGCCGCAGC 3' SEQ ID NO: 11 d5' 3' TTTXCCTCGGCGTCG SEQ ID NO: 12
CL(12/37) ATCGAATAGTCTGACTAC AACT 5' Example 8 3' CGACGXCGAGGCTTT
SEQ ID NO: 13 d5' TGCCTCGXCGTCGATCGA HP CL(50) ATAGTCTGACTACAAC T
5' Example 9 5' CGGAGCXGCAGC 3' SEQ ID NO: 3 dCL2 5' GTGCGXGATCGA
3' SEQ ID NO: 14 (12-10/46) 3' GCCTCGXCGTCGATC SEQ ID NO: 15
GAATAGTCTGACTACAAC TCACGCXCTAGCT 5' Example 10 5' CGXAGCGGCXGC 3'
SEQ ID NO: 16 dCL2 3' GCXTCGCCGXCGATC SEQ ID NO: 17 (12/34)
GAATAGTCTGACTACAAC T 5' Example 11 5' CGGAGCXGCAGC 3' SEQ ID NO: 18
r5' 3' GCCUCGXCGUCGAUC SEQ ID NO: 19 CL(12/34) GAAUAGUCUGACUACAAC U
5' Example 12 5' CGGAGCXGCAGC 3' SEQ ID NO: 20 dr5' 3'
GCCTCGXCGTCGAUC SEQ ID NO: 21 CL(12/34) GAAUAGUCUGACUACAAC U 5'
Example 13 5' m(CGGAGCXGCA) 3' SEQ ID NO: 22 m5' 3'
m(GCCUCGXCGUCGAU SEQ ID NO: 23 CL(10/34) CGAAUAGUCUGACUACAAC U) 5'
Example 14 5' m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 m5' 3'
m(GCCUCGXCGUCGAU SEQ ID NO: 23 CL(12/34) CGAAUAGUCUGACUACAAC U) 5'
Example 15 5' m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 m3' 3'
m(AUCGAAUAGUCUGA SEQ ID NO: 25 CL(12/34) CUACAACUGCCUCGXCGUC G) 5'
Example 16 5' m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 m3' 3'
m(AUAGACUAGUCUGA SEQ ID NO: 26 CL(12/34-M) CUACAACUGCCUCGXCGUC G)
5' Example 17 5' m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 mCL2 5'
m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 (12-lx2/46) 3' m(GCCUCGXCGUCGAU
SEQ ID NO: 27 CGAAUAGUCUGACUACAAC UGCCUCGXCGUCG) 5' Example 18 5'
m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 mCL2 5' m(CGGAGCXGCAGC) 3' SEQ ID
NO: 24 (12-lx2/46M) 5' m(GCCUCGXCGUCGAU SEQ ID NO: 28
AGACUAGUCUGACUACAAC UGCCUCGXCGUCG) 3'
TABLE-US-00003 TABLE 2 Comparative 3' GCCTCGuCGTCGATC SEQ ID NO: 29
Example 1 GAATAGTCTGACTACAAC dSS(34) T 5' (u: deoxyuridine)
Comparative 5' CGGAGCAGCAGC 3' SEQ ID NO: 30 Example 2 3'
GCCTCGuCGTCGATC SEQ ID NO: 29 d5' GAATAGTCTGACTACAAC DS(12/34) T 5'
(u: deoxyuridine) Comparative 3' CGACGTCGAGGCTTT SEQ ID NO: 31
Example 3 TGCCTCGACGTCGATCGA d5' HP50 ATAGTCTGACTACAAC T 5'
Comparative 5' CGGAGCAGCAGC 3' SEQ ID NO: 32 Example 4 3'
UGCCTCGuCGTCGAT SEQ ID NO: 32 d5'Lig CGAATAGTCTGACTACAA (12/35) CT
5' Comparative 3' GCCTCGuCGTCGATC SEQ ID NO: 34 Example 5
GAATAGTCTGACTACAAC dSS(46) TCACGCuCTAGCT 5' (u: deoxyuridine)
Comparative 3' AUCGAAUAGUCUGAC SEQ ID NO: 35 Example 6 UACAACU 5'
r-asmi21 Comparative 3' GCCUCGACGUCGAUC SEQ ID NO: 36 Example 7
GAAUAGUCUGACUACAAC rSS(34) U 5' Comparative 5' CGGAGCUGCAGC 3' SEQ
ID NO: 37 Example 8 3' GCCUCGACGUCGAUC SEQ ID NO: 36 r5'
GAAUAGUCUGACUACAAC DS(12/34) U 5' Comparative 3' CGACGUCGAGGCUUU
SEQ ID NO: 38 Example 9 UGCCUCGACGUCGAUCGA rHP50 AUAGUCUGACUACAAC U
5' Comparative 3' m(AUCGAAUAGUCUG SEQ ID NO: 39 Example 10
ACUACAACU) 5' m-asmiR21 Comparative 3' m(GCCUCGuCGUCGA SEQ ID NO:
40 Example 11 UCGAAUAGUCUGACUACA mSS(34)dU ACU) 5' (u:
deoxyuridine) Comparative 3' m(GCCUCGUCGUCGA SEQ ID NO: 41 Example
12 UCGAAUAGUCUGACUACA mSS(34) ACU) 5' Comparative 5'
m(CGGAGCAGCAGC) 3' SEQ ID NO: 42 Example 13 3' m(GCCUCGUCGUCGA SEQ
ID NO: 41 m5' UCGAAUAGUCUGACUACA DS(12/34) ACU) 5' Comparative 3'
m(CGACGACGAGGCU SEQ ID NO: 43 Example 14 UUUGCCUCGUCGUCGAUC mHP50
GAAUAGUCUGACUACAAC U)m 5' Comparative 5' m(CGGAGCAGCAGC) 3' SEQ ID
NO: 42 Example 15 3' m(AUCGAAUAGUCUG SEQ ID NO: 44 m3'
ACUACAACUGCCUCGUCG DS(12/34) UCG) 5' Comparative 3' m(GCCUCGUCGUCGA
SEQ ID NO: 45 Example 16 UCGAAUAGUCUGACUACA mSS(46)
ACUGCCUCGUCGUCG) 5' Comparative 5' m(CGGAGCAGCAGC) 3' SEQ ID NO: 42
Example 17 5' m(CGGAGCAGCAGC) 3' SEQ ID NO: 42 mDS2 3'
m(GCCUCGUCGUCGA SEQ ID NO: 45 (12x2/46) UCGAAUAGUCUGACUACA
ACUGCCUCGUCGUCG) 5' Comparative 5' m(GCCAGCXGCAGC) 3' SEQ ID NO: 24
Example 18 5' m(CGGAGCXGCAGC) 3' SEQ ID NO: 24 mCL2 3'
m(GCCUCGXCGUCGA SEQ ID NO: 46 (12-lx2/34) UCGAAUAGUGCCUCGXCG UCG)
5'
[0158] The synthesis of the oligonucleotide was carried out using
3'-phosphoramidite (Glen Research) on an automated DNA.RNA
synthesizer (model 3900; manufactured by PerkinElmer Japan Co.,
Ltd., Applied Biosystems division). The oligonucleotide was
synthesized at 0.2 .mu.mol scale. HPLC was carried out using
Gilson's device and analysis was carried out using Waters 996
photodiode array detector.
[0159] After the synthesis was completed, a CPG (Controlled Pore
Glass) to which the synthesized oligonucleotide was bound was
heated in an ammonia-methylamine mixture (28% conc. ammonium water:
40% methylamine in water=1:1.2 mL) at 65.degree. C. for 10 minutes
to 15 minutes to cleave the oligonucleotide from the CPG and to
carry out deprotection in the base moiety and the phosphodiester
moiety. A reaction solution was collected and the solvent was
evaporated to be removed.
[0160] DNA and 2'-O-methyl RNA (2'-OMe RNA) were dissolved in 2 mL
of 0.2 M triethylamine acetate (pH 7.0) and subjected to a reversed
phase open column (YMC cartridge 500 mg) to be thereby partially
purified.
[0161] As for RNA, the solvent was evaporated to be removed after
the deprotection reaction. The residues were added with dimethyl
sulfoxide (115 .mu.L), triethylamine (60 .mu.L), and triethylamine
trihydrofluoride (75 .mu.L) and stirred to be dissolved, followed
by heating at 65.degree. C. for 2.5 hours. To the reaction
solution, 1.75 mL of 1.8 M triethylamine acetate (pH 7.0); and the
resultant was subjected to a reversed phase open column for partial
purification.
[0162] The purified oligonucleotides (DNA, RNA, and 2'-OMe RNA)
were purified by high performance liquid chromatography (HPLC).
HPLC is carried out using Gilson's device connected to Waters
.mu.-Bondasphere C18 300A (inner diameter: 3.9 mm.times.length 150
mm, Waters Corporation). In the case of a reversed phase, a
concentration gradient of acetonitrile in 0.1 M triethylamine
acetate buffer (TEAA, pH 7.0) was employed as a mobile phase. The
types of the oligonucleotides synthesized and conditions for
reversed phase HPLC are shown below.
[0163] Solution A: 5% acetonitrile/0.1 M TEAA (pH 7.0)
[0164] Solution B: 25% acetonitrile/0.1 M TEAA (pH 7.0)
Preparation of DNA Products with One Cross-Link (CL1) and DNA
Products with Two Cross-Links (CL2) (Examples 1 to 10)
[0165] A product with one cross-link of d5'CL(12/34) (Example 1,
FIG. 3) was prepared by the following method. The nucleic acid
strand of SEQ ID NO: 3 (3.0 nmol) and the nucleic acid strand of
SEQ ID NO: 4 (2.52 nmol), both of which contained deoxyuridine
(hereinafter dU), were dissolved in a solution (the total amount of
198.5 .mu.L) containing a Uracil DNA glycosylase (UDG) buffer
(.times.10, NEW ENGLAND Labs., 20 .mu.L). The reaction solution was
heated at 90.degree. C. for a minute, cooled with ice, and allowed
gradually to cool to room temperature; and left to stand for five
minutes in the stages at room temperature and 0.degree. C.
Subsequently, UDG (NEW ENGLAND Labs., 7.5 units, 1.5 .mu.L) was
added to the reaction solution; and the mixture was reacted in the
total amount of 200 .mu.L at 37.degree. C. for 60 minutes and then
left to stand at 4.degree. C. for 15 minutes. To this reaction
solution, 2 mM aoNao (25.2 nmol, 12.6 .mu.L) was added; and the
mixture was reacted at 17.degree. C. for three hours. Purification
was thereafter carried out by using HPLC with a reversed phase
column to obtain a product with a cross-link or cross-links. The
following solutions were used for the purification.
[0166] Solution A: 5% acetonitrile/0.1 M TEAA (pH 7.0)
[0167] Solution B: 25% acetonitrile/0.1 M TEAA (pH 7.0)
[0168] A style of s bond between sugars of the nucleic acid strand
of SEQ ID NO: 3 and the nucleic acid strand of SEQ ID NO: 4 in
d5'CL(12/34) (Example 1) will be described (FIG. 6A). When the
nucleic acid strands of SEQ ID NO: 3 and SEQ ID NO: 4 are treated
with UDG, an AP site is formed in the deoxyuridine in the nucleic
acid strand (FIG. 6A (i)). AP sites exist in an equilibrium state;
and an open ring form thereof has an aldehyde group. When added
thereto, the cross-linking reagent (aoNao) binds and reacts with
the aldehyde group described above; and the nucleic acid strand of
SEQ ID NO: 3 and the nucleic acid strand of SEQ ID NO: 4 are
thereby cross-linked (FIG. 6A (ii)). In FIG. 6A, the reactions of
(i) and (ii) can proceed in stages or at the same time. It is to be
noted that the style of the bond between the sugars of the two
nucleic acid strands of the double-stranded cross-linking adapter
sequence in Examples 2 to 18 and Comparative Example 18 is the same
as that of the above Example 1.
[0169] Other products with one cross-link were prepared in the same
manner as described above using the nucleic acid strand of SEQ ID
NO: 3 and the nucleic acid strand of SEQ ID NO: 5 for d5'CL(12/34T)
(Example 2), using the nucleic acid strand of SEQ ID NO: 3 and a
sequence with SEQ ID NO: 6 and SEQ ID NO: 7 being linked via a
propyl linker (Table 1) for d5'CL(12/34P) (Example 3), using the
nucleic acid strand of SEQ ID NO: 3 and the nucleic acid strand of
SEQ ID NO: 8 for d5'CL(12/34T8) (Example 4), using the nucleic acid
strand of SEQ ID NO: 9 and the nucleic acid strand of SEQ ID NO: 4
for d5'CL(12-5M/34) (Example 5), and using the nucleic acid strand
of SEQ ID NO: 10 and the nucleic acid strand of SEQ ID NO: 4 for
d5'CL(12-3M/34) (Example 6).
[0170] d5'CL(12/37) (Example 7) having a cross-linking moiety at
the end was prepared by a cross-linking reaction of 12-mer (d12Z-I)
(SEQ ID NO: 11) in which an amidite reagent for 12-mer abasic site
(abasic II phosphoramidite, Glen research) is bound at the 5' end
with d37dU (SEQ ID NO: 12) having a sequence complementary thereto
(because UDG did not work on the end of oligonucleotide, a reagent
capable of generating the AP site was, for the preparation,
introduced at the stage of oligonucleotide synthesis and
cross-linked). For the purpose of presenting the abasic site to the
5' end, d12Z-I (4 nmol) was in advance subjected to acid treatment
(left to stand in 50 .mu.L of 80% acetic acid at room temperature
for 30 minutes) and added with 2 M TEAA (200 .mu.L) for
neutralization, followed by desalting on NAP-5. This resultant was
added to d37dU (2 nmol) that had been treated with UDG in the same
method as described for the above d5'CL(12/34) (Example 1) and
placed on ice for five minutes; and 2 mM aoNao (20 nmol, 10 .mu.L)
was added thereto to react at 17.degree. C. for 16 hours.
Purification was then carried out using HPLC with a reversed phase
column, thereby obtaining a product with a cross-link or
cross-links.
[0171] As for d5'HP CL(50) (Example 8) which was a 50-mer
single-stranded product with a cross-link having a hairpin loop,
the same reaction as described for the above d5'CL(12/34) (Example
1) was carried out using a 50-mer oligonucleotide (dHP50dUdU, SEQ
ID NO: 13) with deoxyuridines in a facing portion of double
strands, followed by the purification using reversed phase
HPLC.
[0172] As for dCL2(12-I,II/46) (Example 9) which is a product with
two cross-links, the nucleic acid strand of SEQ ID NO: 3 (7.56
nmol) and the nucleic acid strand of SEQ ID NO: 14 (7.56 nmol) was
mixed with the nucleic acid strand of SEQ ID NO: 15 (2.52 nmol) and
the mixture was subjected to a UDG reaction in the same method as
described for d5'CL(12/34) (Example 1). Thereafter, 2 mM aoNao
(50.4 nmol, 25.2 .mu.L) was added thereto and the mixture was
subjected to a cross-linking reaction and purification in the same
manner as described for d5'CL(12/34) (Example 1).
[0173] As for dCL2(12/34) (Example 10) which is a product with two
cross-links, d12dUdU (SEQ ID NO: 16) (2.4 nmol) and d34dUdU (SEQ ID
NO: 17) (2.0 nmol) were mixed and the mixture was subjected to a
UDG reaction in the same method as described for d5'CL(12/34)
(Example 1). Thereafter, 2 mM aoNao (40 nmol, 20 .mu.L) was added
thereto and the mixture was subjected to a cross-linking reaction
and purification in the same manner as described for d5'CL(12/34)
(Example 1).
Preparation of DNA Products with No Cross-Links (DS) (Comparative
Examples 2 to 4)
[0174] d5'DS(12/34) (Comparative Example 2) was prepared by adding
the nucleic acid strand of SEQ ID NO: 30 and the nucleic acid
strand of SEQ ID NO: 29 at equimolar amounts and carrying out
purification in the same manner as described for d5'CL(12/34)
(Example 1).
[0175] d5'HP50 (Comparative Example 3) having a hairpin loop was
prepared by carrying out a reaction using the nucleic acid strand
of SEQ ID NO: 31 in the same method as described for the above
d5'CL(12/34) (Example 1).
[0176] d5'Lig(12/35) (Comparative Example 4) which was a hairpin
loop oligonucleotide having an alkyl linker was prepared from the
following a ligation reaction. As for this reaction, employed was a
reaction in which the ligation was achieved by allowing an
oligonucleotide having a primary amino group to work on an
oligonucleotide with an aldehyde group being generated at 3' end to
reduce a Schiff base. At the time of the preparation, Kojima, N.,
Sugino, M., Mikami, A. Nonaka, K., Fujinawa, Y.; Muto, I.,
Matsubara, K., Ohtsuka, E. and Komatsu, Y. Enhanced reactivity of
amino-modified oligonucleotides by insertion of aromatic residue.
Bioorg. Med. Chem. Lett., 2006, 16, 5118-5121 was used as a
reference.
[0177] First, d35dU-rU (SEQ ID NO: 33) (2 nmol) in a 100 mM
phosphate buffer (pH 6) was acted on by periodate (16 nmol)
(reaction solution 48 .mu.L) and heated at 27.degree. C. for 90
minutes, thereby oxidizing the 3' end. Subsequently, aminated
oligonucleotide (ssH-d12A; 2.4 nmol) (SEQ ID NO: 32) which had a
sequence complementary to d35dU-rU and had an amino linker
(ssH-linker; Sigma Ald.) at the 5' end was dissolved in sterilized
water (6 .mu.L) and added to d35dU-rU that had been in advance
oxidized. The mixed solution was left to stand on ice for five
minutes and then a binding reaction was carried out in the presence
of 150 mM sodium cyanoborohydride (reaction solution 60 .mu.L) at
27.degree. C. for 16 hours. After the reaction, like the
cross-linked oligonucleotide, the linked product was purified by
reversed phase HPLC. A synthesis scheme for d5'Lig(12/35)
(Comparative Example 4) is shown below.
##STR00010##
[0178] With regard to the purified cross-linking adapter (Example 1
and Example 9), the molecular weight was checked by LC-MS and, at
the same time, whether the cross-linking was achieved was checked
by carrying out 20% denaturing polyacrylamide gel electrophoresis.
To be more specific, it was confirmed, as shown in FIG. 7A, that
the product with one cross-link of Example 1 migrated more slowly
than the nucleic acid strand of SEQ ID NO: 3 and the nucleic acid
strand of SEQ ID NO: 4 which were raw materials and the product
with two cross-links of Example 9 migrated more slowly than the
nucleic acid strand of SEQ ID NO: 15 which was a raw material. As
for gel analysis, the gel was stained with SYBR (registered
trademark) Gold (Life Technologies) after the electrophoresis and
analyzed by Typhoon FLA9000 (GE Healthcare).
[0179] HPLC conditions used in the purification of each molecule
and the results of molecular weight measurement for each molecule
are shown in Table 3.
TABLE-US-00004 TABLE 3 HPLC condition (B %/20 min, temperature)
ESI-MS Example 1 d5'CL(12/34) 20-35%, rt calc. 14097.44, found
14100.21 Example 2 d5'CL(12/34T) 25-40%, rt calc. 14401.4872, found
14404.13 Example 3 d5'CL(12/34P) 25-40%, rt calc. 14235.4492, found
14238.96 Example 4 d5'CL(12/34T8) 25-40%, rt calc. 16530.8122,
found 16533.6 Example 5 d5'CL(12-5M/34) 0-40%, 50.degree. C. calc.
14088.4292, found 14090.94 Example 6 d5'CL(12-3M/34) 0-40%,
50.degree. C. calc. 14088.4292, found 14091.01 Example 7 d5'HP
CL(12/37) 0-100%, 50.degree. C. calc. 15009.5792, found 15012.79
Example 8 d5'HP CL(50) 20-40%, 60.degree. C. calc. 15377.5852,
found 15378.75 Example 9 dCL2(12-I,II/46) 25-40%, rt calc.
21495.7254, found 21495.8 Example 10 dCL2(12/34) 25-40%, rt calc.
14141.4614, found 14143.84 Comparative d5'HP Lig(12/35) 10-50%,
50.degree. C. calc. 14579.53, Example 4 found 14581.59
Preparation of RNA Products with One Cross-Link (CL1) (Examples 11
and 12)
[0180] r5'CL(12/34) (Example 11, FIG. 4) which was a product with
one cross-link was prepared by the following method. The nucleic
acid strand of SEQ ID NO: 18 (7.56 nmol) and the nucleic acid
strand of SEQ ID NO: 19 (2.52 nmol) were dissolved in a solution
containing a UDG buffer (.times.10, 20 .mu.L) (the total amount
198.5 .mu.L). The reaction solution was heated at 90.degree. C. for
a minute, cooled with ice, and allowed gradually to cool to room
temperature; and left to stand for five minutes in the stages at
room temperature and 0.degree. C. Subsequently, UDG (7.5 unit, 1.5
.mu.L) was added to the reaction solution. The mixture of the total
amount 200 .mu.L was then subjected to reaction at 37.degree. C.
for 60 minutes and thereafter left to stand at 4.degree. C. for 15
minutes. To this reaction solution, 2 mM aoNao (25.2 nmol, 12.6
.mu.L) was added; and the mixture was heated at 27.degree. C. to
carry out a cross-linking reaction. After two hours, the reaction
solution was subjected to a reduction reaction in a composition of
100 mM phosphate buffer solution (pH 1.07) and 200 mM sodium
cyanoborohydride (NaBH.sub.3CN) (FIG. 6B). After 30-minute reaction
at room temperature, 2 M buffer (420 .mu.L) was added for
neutralization; and a product with a cross-link was purified using
HPLC with a reversed phase column. As for the HPLC solution, the
purification was carried out using the same solution as used for
DNA. dr5'CL(12/34) (Example 12) which was also a product with one
cross-link was prepared using the nucleic acid strand of SEQ ID NO:
20 and the nucleic acid strand of SEQ ID NO: 21 in the same manner
as described above.
[0181] HPLC conditions used in the purification of each of the
products with a cross-link are shown in Table 4.
TABLE-US-00005 TABLE 4 HPLC condition (B %/20 min, temperature)
Example 11 r5'CL(12/34) 15-35%, rt Example 12 dr5'CL(12/34) 20-40%,
rt
Preparation of RNA Products with No Cross-Links (DS) (Comparative
Examples 8 and 9)
[0182] r5'DS(12/34) (Comparative Example 8) was prepared by adding
the nucleic acid strand of SEQ ID NO: 37 and the nucleic acid
strand of SEQ ID NO: 36 at equimolar amounts and carrying out
purification in the same manner as described for r5'CL(12/34)
(Example 11).
[0183] rHP50 (Comparative Example 9) having a hairpin loop was
prepared by carrying out a reaction using the nucleic acid strand
of SEQ ID NO: 38 in the same method as described for the above
r5'CL(12/34) (Example 11).
Preparation of 2'-OMe RNA Products with One Cross-Link (CL1) and
RNA Products with Two Cross-Links (CL2) (Examples 13 to 18)
[0184] m5'CL(12/34) (Example 14, FIG. 5) which was a product with
one cross-link in the 5' side was prepared by the following method.
The nucleic acid strand of SEQ ID NO: 24 (3.0 nmol) and the nucleic
acid strand of SEQ ID NO: 23 (2.52 nmol), both of which contained
dU, were dissolved in a solution containing a UDG buffer
(.times.10, 20 .mu.L) (the total amount 198.5 .mu.L). The reaction
solution was heated at 90.degree. C. for a minute, cooled with ice,
and allowed gradually to cool to room temperature; and left to
stand for five minutes in the stages at room temperature and
0.degree. C. Subsequently, UDG (7.5 unit, 1.5 .mu.L) was added to
the reaction solution. The mixture of the total amount 200 .mu.L
was then subjected to reaction at 37.degree. C. for 60 minutes and
thereafter left to stand at 4.degree. C. for 15 minutes. To this
reaction solution, 2 mM aoNao (25.2 nmol, 12.6 .mu.L) was added to
carry out a reaction at 27.degree. C. for three hours. Thereafter,
purification was carried out using HPLC with a reversed phase
column to obtain a product with a cross-link or cross-links. With
regard to other products with one cross-link, the same method as
described above was carried out from the reaction to the
purification using: the nucleic acid strand of SEQ ID NO: 23 and
the nucleic acid strand of SEQ ID NO: 22 for m5'CL(10/34) (Example
13, FIG. 5); the nucleic acid strand of SEQ ID NO: 25 and the
nucleic acid strand of SEQ ID NO: 24 for m3'CL(12/34) (Example 15,
FIG. 5); and the nucleic acid strand of SEQ ID NO: 26 and the
nucleic acid strand of SEQ ID NO: 24 for m3'CL(12/34-M) (Example
16, FIG. 5). As for the HPLC solution, the purification was carried
out using the same solution as described above (preparation of
DNAs).
[0185] With regard to mCL(12-I.times.2/46) (Example 17, FIG. 5)
which was a product with two cross-links, the nucleic acid strand
of SEQ ID NO: 24 (7.56 nmol) and the nucleic acid strand of SEQ ID
NO: 27 (2.52 nmol) were mixed and subjected to a UDG reaction by
the same method as described for the product with one cross-link of
m5'CL(12/34) (Example 14). Thereafter, 2 mM aoNao (50.4 nmol, 25.2
.mu.l) was added thereto and the mixture was subjected to a
cross-linking reaction and purification in the same manner as
described for m5'CL(12/34) (Example 14). mCL(12-I.times.2/46M)
(Example 18) which was also a product with two cross-links, the
same method as described above was carried out from the reaction to
the purification using the nucleic acid strand of SEQ ID NO: 24 and
the nucleic acid strand of SEQ ID NO: 28 in the same manner as
described above.
Preparation of 2'-OMe RNA molecules (Comparative Examples 13 to 15,
17, and 18)
[0186] m5'DS(12/34) (Comparative Example 13) was prepared by adding
the nucleic acid strand of SEQ ID NO: 42 and the nucleic acid
strand of SEQ ID NO: 41 at equimolar amounts and carrying out
purification in the same manner as described for m5'CL(12/34)
(Example 14); m3' DS(12/34) (Comparative Example 15) was prepared
by adding the nucleic acid strand of SEQ ID NO: 42 and the nucleic
acid strand of SEQ ID NO: 44 at equimolar amounts and carrying out
the purification; and mDS2(12.times.2/46) (Comparative Example 17)
was prepared by adding the nucleic acid strand of SEQ ID NO: 42 and
the nucleic acid strand of SEQ ID NO: 45 at equimolar amounts and
carrying out the purification.
[0187] mHP50 (Comparative Example 14) having a hairpin loop was
prepared by carrying out a reaction using the nucleic acid strand
of SEQ ID NO: 43 in the same method as described for the above
m5'CL(12/34)(Example 14).
[0188] mCL2(12-I.times.2/34)(Comparative Example 18) having the
cross-linking adapter sequence at both ends was prepared using the
nucleic acid strand of SEQ ID NO: 24 and the nucleic acid strand of
SEQ ID NO: 46 in the same manner as described for m5'CL(12/34)
(Example 14).
[0189] With regard to the purified molecule with the cross-linking
adapter, the molecular weight was checked by LC-MS and, at the same
time, whether the cross-linking was achieved was checked by
carrying out 20% denaturing polyacrylamide gel electrophoresis. To
be more specific, it was confirmed, as shown in FIG. 7B, that the
products with one cross-link of Examples 14 to 16 migrated more
slowly than the nucleic acid strand of SEQ ID NO: 24 and the
nucleic acid strand of mSS(34)dU(Comparative Example 11) which were
raw materials and the product with two cross-links of Example 17
and the molecule of Comparative Example 18 migrated more slowly
than the nucleic acid strand of SEQ ID NO: 27. As for gel analysis,
the gel was stained with SYBR (registered trademark) Gold (Life
Technologies) after the electrophoresis and analyzed by Typhoon
FLA9000 (GE Healthcare).
[0190] HPLC conditions used in the purification of each of the
products with a cross-link or cross-links and the results of
molecular weight measurement for each of the products with a
cross-link or cross-links are shown in Table 5.
TABLE-US-00006 TABLE 5 HPLC condition (B %/20 min, temperature)
ESI-MS Example 13 m5'CL(10/34) 0-100%, 50.degree. C. calc. found
Example 14 m5'CL(12/34) 0-100%, 50.degree. C. calc. 15306.78, found
15308.78 Example 15 m3'CL(12/34) 0-100%, 50.degree. C. calc.
15306.78, found 15309.10 Example 16 m3'CL(12/34-M) 0-100%,
50.degree. C. calc. 15306.7842, found 15309.1 Example 17
mCL2(12-Ix2/46) 0-100%, 50.degree. C. calc. 23336.26, found
23339.76 Example 18 mCL2(12-Ix2/46M) 0-100%, 50.degree. C. calc.
23336.2564, found 23339.69 Comparative mCL2(12-Ix2/34) 0-100%,
50.degree. C. calc. 19366.56, Example 18 found 19370.57
Example B
(Tm Measurement)
[0191] With regard to the molecules of the Examples and Comparative
Examples which had been prepared in Example A, a melting curve was
measured. As nucleic acids to be targeted, miR21 (SEQ ID NO: 1) and
miR21-M (SEQ ID NO: 2) were selected.
[0192] The molecules (130 pmol) of Examples 1 to 15, and 17 or
Comparative Examples 1 to 11 and 13 to 17 were mixed with miR-21 or
miR-21-M (130 pmol) and the mixture was dissolved in a Tm
measurement buffer (10 mM NaCl, 10 mM Na cacodylate (pH 7.0), 130
.mu.L). The sample was heated at 90.degree. C. for three minutes,
then allowed to gradually cool to room temperature to anneal, and
then left to stand at room temperature for five minutes; and 125
.mu.L of the resultant was placed in a measurement cuvette to
measure the melting curve. The measurement was carried out using
UV2500PC (manufactured by Shimadzu Corporation) in a temperature
range of 5.degree. C. to 90.degree. C. in conditions of a
temperature rate of 0.5.degree. C./min, a measurement interval of
0.2.degree. C., start hold 600 seconds, and standby prior to
measurement 0 seconds. FIG. 8, FIG. 9, and FIG. 10 show the results
of the Tm measurement for Examples 1 to 10 and Comparative Examples
1 to 5 (DNA), the results of the Tm measurement for Examples 11 and
12 and Comparative Examples 6 to 9 (RNA), and the results of the Tm
measurement for Examples 13 to 15 and 17 and Comparative Examples
10, 11, and 13 to 17 (2'-OMe RNA), respectively. It is to be noted
that, in FIGS. 8 to 10, numerical values in the parentheses shown
in the left of the bar chart indicate Tm values for miR21-M (SEQ ID
NO: 2).
[0193] As shown in FIG. 8, Comparative Example 2 which had the
double-stranded adapter sequence showed a Tm value comparable to
Comparative Examples 1 and 5 which had the single-stranded adapter
sequence. In addition, d5'HP50 (Comparative Example 3) and
d5'Lig(12/35) (Comparative Example 4, both of which had the hairpin
loop comprising nucleotides or an alkyl linker also showed a Tm
value comparable to Comparative Examples 1 and 5 which had the
single-stranded adapter sequence. On the other hand, Examples 1 to
8 which had the cross-linking adapter sequence exhibited a higher
Tm value by 10.degree. C. or more, as compared with that of
Comparative Examples 1 to 5; and Example 9 which was the product
with two cross-links (CL2) exhibited a much higher Tm value. While
the cross-linking of the double stranded part was observed to also
increase the Tm value of the oligonucleotide having the hairpin
loop (d5'HP CL(50): Example 8) to 56.degree. C., the
oligonucleotide before the cross-linking (d5'HP50dUdU, SEQ ID NO:
13) had a lower Tm value and did not produce the stabilization
effect, demonstrating therefore that the cross-linking required for
the increase in the Tm value. In addition, in the case in which the
cross-linking site was located at the end of the adapter
(d5'CL(12/37): Example 7), a higher Tm value was observed. It is to
be noted that the products with one cross-link (CL1) of Examples 5
and 6 which have a mismatch in the cross-linking adapter sequence
also exhibited a Tm value comparable to Examples 1 which was also
the product with one cross-link (CL1). Further, it was also
confirmed that Example 2 which was the product with one cross-link
(CL1) with the linker comprising one thymidine residue being
inserted between the cross-linking adapter sequence and the
single-stranded nucleic acid, Example 4 which was the product with
one cross-link (CL1) with the linker comprising eight thymidine
residues being inserted, and Example 3 which was product with one
cross-link (CL1) with the propyl linker being inserted exhibited a
slightly lower Tm value then Example 1 which was also the product
with one cross-link (CL1) but maintained a higher Tm value than the
double stranded product with no cross-links. These results
demonstrate the double stranded part stabilized by the
cross-linking is able to produce the stabilization effect even in
the case in which the double stranded part is not directly bound to
the hybridization region.
[0194] As shown in FIG. 9, Comparative Example 8 which had the
double-stranded adapter sequence exhibited Tm comparable to
Comparative Example 7 which had the single-stranded adapter
sequence. Further, Comparative Example 9 which had the hairpin loop
also exhibited Tm comparable to Comparative Example 7 which had the
single-stranded adapter sequence. On the other hand, Examples 11
and 12 which had the cross-linking adapter sequence exhibited a
higher Tm value by 10.degree. C. or more as compared with
Comparative Examples 6 to 9. Further, the chimeric molecule of
Example 12 (dr5'CL(12/34)) in which the single-stranded nucleic
acid part is RNA and the cross-linking adapter sequence part is DNA
exhibited a high Tm value.
[0195] As shown in FIG. 10, Comparative Examples 13, 15, and 17
which had the double-stranded adapter sequence exhibited a Tm value
comparable to Comparative Examples 11 and 16 which had the
single-stranded adapter sequence. Further, Comparative Example 14
which had the hairpin loop also exhibited Tm comparable to
Comparative Examples 11 and 16 which had the single-stranded
adapter sequence. On the other hand, Examples 13 to 15 and 17 which
had the cross-linking adapter sequence exhibited a higher Tm value
by 10.degree. C. or more as compared with Comparative Examples 10,
11, and 13 to 17; and Example 17 which was the product with two
cross-links (CL2) exhibited a much higher Tm value.
[0196] It is to be noted in FIGS. 8 to 10 that, for the target RNA
which make mismatched base pairs (miR21-M: SEQ ID NO: 2), the Tm
value was all decreased but the effect of stabilizing hybridization
appeared in the same way as for the target RNA with
perfectly-matched base pairs (miR21: SEQ ID NO: 1).
[0197] From the above, it has been demonstrated that the product
with one cross-link (CL1) and the product with two cross-links
(CL2) according to the Examples stabilize the hybridization with
the target nucleic acid. In addition, it has been confirmed that
this effect of stabilizing hybridization is able to be attained
regardless of whether the cross-linking adapter sequence is DNA,
RNA, or 2'-OMe RNA.
Example C
[0198] (Evaluation of miRNA-Suppression Activity)
[0199] 2'-OMe RNA has excellent stability in cells and is used as
an antisense. In view of this, Examples 14, 15, and 17 which were
2'-OMe RNA was evaluated for an inhibitory effect on a miRNA
activity in cells. It is to be noted that miR-21 (SEQ ID NO: 1) was
selected as a miRNA to be targeted.
[0200] A dual-luciferase assay system was employed to look at the
inhibitory effect on miR-21. A vector was constructed as described
below, which vector has a binding sequence for miR-21 introduced
only to the 3' UTR of a sequence encoding Renilla luciferase in
psiCHECK-2 (registered trademark) vector (Promega). First, a
double-stranded oligonucleotide was synthesized, the
double-stranded oligonucleotide corresponding to miR-21 with part
of the cleavage recognition sequence of restriction enzyme sites
SgfI and PmeI at both ends and a complementary strand thereof (SEQ
ID NO: 47 and SEQ ID NO: 48). A phosphate group necessary for
ligation to the vector was introduced to the 5' end of each
oligonucleotide at the stage of the synthesis. Subsequently, to
psiCHECK-2 (registered trademark) vector (Promega) that had been
treated with SgfI (Promega) and PmeI (Promega), the above double
stranded oligonucleotide that had been in advance annealed was
ligated using T4 DNA ligase (Promega). The obtained vector is
subjected to cloning and sequence confirmation by a common
technique using Escherichia coli; and a vector with the binding
sequence of miR-21 being inserted in an intended site
(psiCHECK-2-miR-21) was obtained.
TABLE-US-00007 SEQ ID NO: 47: 5'
pCGCAGTAGAGCTCTAGTTCAACATCAGTCTGATAAGCTA GTTT 3' (p: phosphate) SEQ
ID NO: 48: 3' TAGCGTCATCTCGAGATCAAGTTGTAGTCAGACTATTCGA TCAAAp 5'
(p: phosphate)
[0201] When the psiCHECK-2-miR-21 vector is introduced to cells,
miR-21 within cells binds to the 3' UTR of Renilla luciferase mRNA
to inhibit the expression of Renilla luciferase; and no
luminescence derived from the enzyme is detected. However, when a
nucleic acid molecule (anti-miRNA oligonucleotide: AMO) that has a
sequence complementary to miR-21 is introduced, the binding of
miR-21 to mRNA is competitively inhibited and the expression of
Renilla luciferase is induced to allow luminescence to be observed.
HeLa cells express a large amount of miR-21. The cells were thus
seeded at a concentration of 2.sup.4 cells/well in a 96-well plate
(Nunc) and cultured for 24 hours; and psiCHECK-2-miR-21 (0.1
mg/well) and the synthesized anti-miRNA oligonucleotide (0.05 to 50
nM/well) were introduced to the cells together with lipofectamine
(registered trademark) 2000 (Life technologies, 0.3 mL/well). In
addition, an experiment in which a vector (psiCHECK-2) having no
miR-21 binding sequences was introduced to the cells was
concurrently carried out as a positive control.
[0202] After the 24-hour culturing, the luminescence strength of
each of Renilla and Firefly luciferases was measured by using a
Dual-Glo (registered trademark) Luciferase assay system (Promega).
A ratio (Rluc/Fluc) of the luminescence strength of Renilla
luciferase with the luminescence strength of Firefly luciferase,
which served as an internal control, was calculated and further
normalized with a value calculated based on the vector having no
miR-21 binding sequences. A relative value of Rluc/Fluc was plotted
against the corresponding concentration of the anti-miRNA
oligonucleotide to evaluate the inhibitory effect on the miRNA
activity (FIG. 11). In addition, commercially-available anti-miRNA
oligonucleotides (LNA-miRCURY, LNA NC, meridian, and Tough Decoy)
were worked on the cells under the same conditions to examine the
inhibitory effect on miRNA.
[0203] Commercially available anti-miRNA oligonucleotides used for
comparison were shown below. [0204] LNA-miRCURY (miRCURY, LNA miRNA
inhibitor hsa-miR21, Exiqon) [0205] LNA NC (miRCURY LNA microRNA
Inhibitor Negative Control A, Exiqon) [0206] meridian (miRIDIAN
microRNA hsa-miR-21-5p haripin inhibitor, GE Healthcare) [0207]
Tough decoy (MISSION, Synthetic microRNA Inhibitor Human
hsa-miR-21-5p, Sigma)
[0208] The results are shown in FIG. 11A to D. It is to be noted
that, as for the concentration of each molecule added in FIG. 11A
to D, the four bars, from left to right, correspond 0 nM, 0.5 nM, 2
nM, and 10 nM.
[0209] As shown in FIG. 11A, Comparative Example 13 (m5'DS(12/34))
which had the double-stranded adapter sequence exhibited a higher
miRNA-suppression activity, as compared with Comparative Example 10
(m-asmiR21) which did not have the double-stranded adapter
sequence. In addition, Example 14 (m5'CL(12/34)) which had the
cross-linking adapter sequence exhibited a much higher
miRNA-suppression activity, as compared with Comparative Example 13
(m5'DS(12/34)) which had the double-stranded adapter sequence.
[0210] As shown in FIG. 11B, Comparative Example 15 (m3'DS(12/34)
which had the double-stranded adapter sequence exhibited a higher
miRNA-suppression activity, as compared with Comparative Example 10
(m-asmiR21) and 3'Me34U (the nucleic acid strand of SEQ ID NO: 44)
which did not have the double-stranded adapter sequence. In
addition, Example 15 (m3'CL(12/34)) which had the cross-linking
adapter sequence exhibited a much higher miRNA-suppression
activity, as compared with Comparative Example 15 (m3'DS(12/34)
which had the double-stranded adapter sequence.
[0211] As shown in FIG. 11C, Comparative Example 17 (mDS2(12 2/46))
which had the double-stranded adapter sequence at both ends
exhibited a higher miRNA-suppression activity, as compared with
Comparative Example 10 (m-asmiR21) and Comparative Example 16
(mSS(46)) which did not have the double-stranded adapter sequence.
In addition, Example 17 (mCL2(12-I.times.2/46)) which had the
cross-linking adapter sequence at both ends exhibited a much higher
miRNA-suppression activity, as compared with Comparative Example 17
(mDS2(12.times.2/46)) which had the double-stranded adapter
sequence. It is to be noted that Comparative Example 18
(mCL2(12-I.times.2/34)) in which a region hybridizing with miR-21
comprised about 10 bases exhibited a significantly decreased
miRNA-suppression activity, implying thus stable binding with miRNA
is important in order to attain a sufficient amount of
miRNA-suppression activity.
[0212] As shown in FIG. 11D, Example 17 (mCL2(12-I.times.2/46))
which had the cross-linking adapter sequence at both ends exhibited
a higher miRNA-suppression activity, as compared with LNA
(miRCURY), LNA NC, miRIDIAN, and Tough Decoy. Even though the
commercially available anti-miRNA oligonucleotides (LNA-miRCURY,
LNA NC, meridian, Tough Decoy) also exhibited the suppression
effect, mCL2(12-I.times.2/46) (Example 17) had a higher inhibitory
effect than those and was confirmed to also function effectively in
cells.
[0213] From the above, it has been demonstrated that the product
with one cross-link (CL1) and the product with two cross-links
(CL2) according to the Examples have a higher miRNA-suppression
activity.
Example D
[0214] A complementary strand nucleic acid complex was prepared and
a melting curve was measured. As a nucleic acid to be targeted,
miR21 (SEQ ID NO: 1) was selected.
[0215] As Example 19, a complementary strand nucleic acid complex
d5'CL(12/34)/dc34dU was prepared by mixing, at equimolar amounts,
d5'CL(12/34) (Example 1) and the nucleic acid strand of SEQ ID NO:
49 which had a sequence complementary to the single-stranded region
of d5'CL(12/34) to allow hybridization (FIG. 12A). A schematic
diagram for d5'CL(12/34)/dc34dU (Example 19) is shown in FIG.
12B.
TABLE-US-00008 SEQ ID NO: 49: 5' TAGCTTATCAGACTGATGTTGAGCTGCuGCTCCG
3'
[0216] As Example 20, a complementary strand nucleic acid complex
d5'CL(12/34)/dcCL(12/34) was prepared by mixing, at equimolar
amounts, d5'CL(12/34) (Example 1) and dcCL(12/34) which had a
sequence complementary to a single-stranded region of d5'CL(12/34)
and had the cross-linking adapter sequence to allow hybridization
(FIG. 12A). dcCL(12/34) was prepared using a nucleic acid strand of
SEQ ID NO: 50 and a nucleic acid strand of SEQ ID NO: 51 in the
same manner as described for d5'CL(12/34) (Example 1). A schematic
diagram for d5'CL(12/34)/dcCL(12/34) (Example 20) is shown in FIG.
12C.
TABLE-US-00009 SEQ ID NO: 50: 5' TAGCTTATCAGACTGATGTTGAGCTGCXGCTCCG
3' (X = u: deoxyuridine) SEQ ID NO: 51: 3' CGACGXCGAGGC 5' (X = u:
deoxyuridine)
[0217] As Comparative Example 19, a molecule d34dU/dc34dU was
prepared by mixing, at equimolar amounts, dc34dU (the nucleic acid
strand of SEQ ID NO: 49) and a nucleic acid strand d34dU (SEQ ID
NO: 52) which had a sequence complementary to dc34dU to allow
hybridization (FIG. 12A).
TABLE-US-00010 SEQ ID NO: 52: 3' GCCTCGXCGTCGATCGAATAGTCTGACTACAACT
5' (X = u: deoxyuridine)
[0218] With regard to Examples 19 and 20 and Comparative Example
19, Tm was measured by the same method as described in Example B.
The results are shown in FIG. 12D. The complementary strand nucleic
acid complex d5'CL(12/34)/dc34dU (Example 19) which had the
cross-linking adapter exhibited a significantly higher Tm value (an
increase by about 7.degree. C.), as compared with the nucleic acid
d34dU/dc34dU (Comparative Example 19) which had the single-stranded
structure alone. Further, the complementary strand nucleic acid
complex d5'CL(12/34)/dcCL(12/34) (Example 20) in which the nucleic
acid molecules having the cross-linking adapter were together
hybridized exhibited an additional increases in Tm to the same
extent (an increase by about 7.degree. C.), which confirmed a
synergistic effect on Tm stabilization.
[0219] From the above, it has been demonstrated that the
complementary strand nucleic acid complex according to this Example
is stably hybridized.
Example E
[0220] With regard to Examples 14, 15, and 17 and Examples 21 to 23
(described later), each of which was 2'-OMe RNA, an inhibitory
effect on a miRNA activity was evaluated 48 hours after
transfection.
[0221] By the same method as described in Example A, the following
molecules of Examples 21 to 23 were synthesized.
[0222] As Example 21, m3'CL(11/34) which had a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 11-mer double-stranded cross-linking adapter sequence with, as a
spacer (linker), a G (guanine) residue therebetween was synthesized
(FIG. 13).
[0223] As Example 22, m3'CL(9/34) which had a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 9-mer double-stranded cross-linking adapter sequence with, as a
spacer (linker), a 3-mer oligonucleotide (GCC) therebetween was
synthesized (FIG. 13).
[0224] As Example 23, m3'CL(10/34) which had a sequence
complementary to miR21 (a complementary binding-like sequence) and
a 10-mer double-stranded cross-linking adapter sequence was
synthesized (FIG. 13).
[0225] In order to prepare the molecules of Examples 21 to 23, each
of oligonucleotides shown in Table 6 was used. With regard to "m"
and "X", the same as described in Example A is also applied
here.
TABLE-US-00011 TABLE 6 Example 21 5' m(GGAGCXGCAGC) 3' SEQ ID m3'
CL(11/34) NO: 53 3' m(AUCGAAUAGUCUGACUA SEQ ID CAACUGCCUCGXCGUCG)
5' NO: 25 Example 22 5' m(AGCXGCAGC) 3' SEQ ID m3' CL(9/34) NO: 54
3' m(AUCGAAAGUCUGACUAC SEQ ID AACUGCCUCGXCGUCG) 5' NO: 25 Example
23 5' m(CGGAGCXGCA) 3' SEQ ID m3'CL(10/34) NO: 55 3'
m(AUCGAAUAGUCUGACUA SEQ ID CAACUGCCUCGXCGUCG) 5' NO: 25
[0226] To look at an inhibitory effect on miR-21, the
dual-luciferase assay system as described in Example C was employed
and carried out in the same manner as described in Example C.
Transfection was also carried out in the same manner as described
in Example C.
[0227] Forty-eight hours after the culturing, the inhibitory effect
on an miR-21 activity was evaluated by the same method as described
in Example C (FIG. 14).
[0228] As for miRIDIAN and Tough decoy which were used for a
comparison purpose, the evaluation was carried out in the same
manner as described in Example C.
[0229] The results are shown in FIGS. 14A and B. It is to be noted
that, as for the concentration of each molecule added in FIGS. 14A
and B, the bars, from left to right, correspond 0 nM, 0.5 nM, 1 nM,
2 nM, 3 nM, 4 nM, 5 nM, and 10 nM.
[0230] As shown in FIG. 14A, as compared with Comparative Example
17 (mDS2(12.times.2/46)) which had the simple double-stranded
adapter sequence, Example 17 (mCL2(12-I.times.2/46)) which had the
cross-linking adapter sequence exhibits a higher miRNA-suppression
activity; and a difference in the miRNA-suppression activity became
more apparent, as compared with the counterpart 24 hour after
transfection. This suggests that the product with cross-links
(Example 17) has a more sustained miRNA-suppression activity.
[0231] As shown in FIG. 14B, when compared with Example 14
(m5'CL(12/34)) which had the cross-linking adapter sequence at the
3' end of the complementary binding-like sequence (single-stranded
nucleic acid), Example 21 (m3'CL(11/34)), Example 22 (m3'CL(9/34)),
and Example 23 (m3'CL(10/34)) which had the cross-linking adapter
sequence at the 5' terminal side of the complementary binding-like
sequence (single-stranded nucleic acid) exhibited a higher
miRNA-suppression activity. Further, when the results at 48 hour
after transfection were compared with those at 24 hour after
transfection, a difference in the miRNA-suppression activity was
found more significant, revealing that the structure with the
cross-linking adapter sequence at the 5' terminal side of the
complementary binding-like sequence (single-stranded nucleic acid)
is important. Further, when compared with Example 21 (m3'CL(11/34))
and Example 22 (m3'CL(9/34)) which had the spacer (linker) between
the sequence complementary to miR21 (a complementary binding-like
sequence) (single-stranded nucleic acid) and the cross-linking
adapter sequence, Example 23 (m3'CL(10/34)) which did not have such
a spacer exhibited a higher miRNA-suppression activity, revealing
that the miRNA-suppression activity was higher in the case in which
the complementary binding-like sequence (single-stranded nucleic
acid) came directly next to the cross-linking adapter sequence
without the spacer.
[0232] From the above, it has been demonstrated that the product
with one cross-link (CL1) which had the cross-linking adapter
sequence at the 5' terminal side of the complementary binding-like
sequence (single-stranded nucleic acid) had a higher
miRNA-suppression activity.
[0233] The foregoing describes some example embodiments for
explanatory purposes. Although the foregoing discussion has
presented specific embodiments, persons skilled in the art will
recognize that changes may be made in form and detail without
departing from the broader spirit and scope of the invention.
Accordingly, the specification and drawings are to be regarded in
an illustrative rather than a restrictive sense. This detailed
description, therefore, is not to be taken in a limiting sense, and
the scope of the invention is defined only by the included claims,
along with the full range of equivalents to which such claims are
entitled.
[0234] The present application is based on Japanese Patent
Application No. 2014-251847 filed on Dec. 12, 2014 and includes the
specifications, claims, drawings, and abstract thereof. The
disclosure in the above Japanese Patent Application is incorporated
in the present specification by reference in their entirety.
INDUSTRIAL APPLICABILITY
[0235] The stabilization effect on the hybridization by the
cross-linked double stranded structure of the present disclosure is
believed to be useful in improving sensitivity of nucleic acid
detection with RNA, DNA, or the like as a target and producing high
pharmacological effects in nucleic acid medicines. In addition,
because the present disclosure is a unique nucleic acid structure,
it is possible to use in combination with various existing nucleic
acid derivative monomers and to further improve effects of existing
techniques. This enables the new structure of the nucleic acid of
the present disclosure to use across a wide range of areas
utilizing nucleic acids and to also offer high availability in
industries.
SEQUENCE LISTING
[0236] 15F074-PCT_Sequence Listing.txt
Sequence CWU 1
1
55122RNAArtificial SequencemiR21 1uagcuuauca gacugauguu ga
22222RNAArtificial SequencemiR21-M 2uagcuuauca cacugauguu ga
22312DNAArtificial Sequencesynthetic DNAmisc_feature(7)..(7)n is
deoxyuridine 3cggagcngca gc 12434DNAArtificial Sequencesynthetic
DNAmisc_feature(28)..(28)n is deoxyuridine 4tcaacatcag tctgataagc
tagctgcngc tccg 34535DNAArtificial Sequencesynthetic
DNAmisc_feature(29)..(29)n is deoxyuridine 5tcaacatcag tctgataagc
tatgctgcng ctccg 35612DNAArtificial Sequencesynthetic
DNAmisc_feature(6)..(6)n is deoxyuridine 6gctgcngctc cg
12722DNAArtificial Sequencesynthetic DNA 7tcaacatcag tctgataagc ta
22842DNAArtificial Sequencesynthetic DNAmisc_feature(36)..(36)n is
deoxyuridine 8tcaacatcag tctgataagc tatttttttt gctgcngctc cg
42912DNAArtificial Sequencesynthetic DNAmisc_feature(7)..(7)n is
deoxyuridine 9cggtgcngca gc 121012DNAArtificial Sequencesynthetic
DNAmisc_feature(7)..(7)n is deoxyuridine 10cggagcngct gc
121112DNAArtificial Sequencesynthetic DNAmisc_feature(1)..(1)n is
deoxyuridine 11nggagccgca gc 121237DNAArtificial Sequencesynthetic
DNAmisc_feature(34)..(34)n is deoxyuridine 12tcaacatcag tctgataagc
tagctgcggc tccnttt 371350DNAArtificial Sequencesynthetic
DNAmisc_feature(28)..(28)n is deoxyuridinemisc_feature(45)..(45)n
is deoxyuridine 13tcaacatcag tctgataagc tagctgcngc tccgttttcg
gagcngcagc 501412DNAArtificial Sequencesynthetic
DNAmisc_feature(6)..(6)n is deoxyuridine 14gtgcgngatc ga
121546DNAArtificial Sequencesynthetic DNAmisc_feature(7)..(7)n is
deoxyuridinemisc_feature(40)..(40)n is deoxyuridine 15tcgatcncgc
actcaacatc agtctgataa gctagctgcn gctccg 461612DNAArtificial
Sequencesynthetic DNAmisc_feature(3)..(3)n is
deoxyuridinemisc_feature(10)..(10)n is deoxyuridine 16cgnagcggcn gc
121734DNAArtificial Sequencesynthetic DNAmisc_feature(25)..(25)n is
deoxyuridinemisc_feature(32)..(32)n is deoxyuridine 17tcaacatcag
tctgataagc tagcngccgc tncg 341812RNAArtificial Sequencesynthetic
RNAmisc_feature(7)..(7)n is deoxyuridine 18cggagcngca gc
121934RNAArtificial Sequencesynthetic RNAmisc_feature(28)..(28)n is
deoxyuridine 19ucaacaucag ucugauaagc uagcugcngc uccg
342012RNAArtificial Sequencesynthetic RNAmisc_feature(7)..(7)n is
deoxyuridine 20cggagcngca gc 122134DNAArtificial Sequencesynthetic
DNA and
RNAmisc_feature(1)..(22)RNAmisc_feature(23)..(34)DNAmisc_feature(28)..(28-
)n is deoxyuridine 21ucaacaucag ucugauaagc uagctgcngc tccg
342210RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(10)2'-0-methyl RNAmisc_feature(7)..(7)n is
deoxyuridine 22cggagcngca 102334RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(34)2'-0-methyl RNAmisc_feature(28)..(28)n is
deoxyuridine 23ucaacaucag ucugauaagc uagcugcngc uccg
342412RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(12)2'-0-methyl RNAmisc_feature(7)..(7)n is
deoxyuridine 24cggagcngca gc 122534RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(34)2'-0-methyl RNAmisc_feature(6)..(6)n is
deoxyuridine 25gcugcngcuc cgucaacauc agucugauaa gcua
342634RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(34)2'-0-methyl RNAmisc_feature(6)..(6)n is
deoxyuridine 26gcugcngcuc cgucaacauc agucugauca gaua
342746RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(46)2'-0-methyl RNAmisc_feature(6)..(6)n is
deoxyuridinemisc_feature(40)..(40)n is deoxyuridine 27gcugcngcuc
cgucaacauc agucugauaa gcuagcugcn gcuccg 462846RNAArtificial
Sequencesynthetic RNAmisc_feature(1)..(46)2'-0-methyl
RNAmisc_feature(6)..(6)n is deoxyuridinemisc_feature(40)..(40)n is
deoxyuridine 28gcugcngcuc cgucaacauc agucugauca gauagcugcn gcuccg
462934DNAArtificial Sequencesynthetic DNAmisc_feature(28)..(28)n is
deoxyuridine 29tcaacatcag tctgataagc tagctgcngc tccg
343012DNAArtificial Sequencesynthetic DNA 30cggagcagca gc
123150DNAArtificial Sequencesynthetic DNA 31tcaacatcag tctgataagc
tagctgcagc tccgttttcg gagctgcagc 503212DNAArtificial
Sequencesynthetic DNA 32cggagcagca gc 123335DNAArtificial
Sequencesynthetic DNA and
RNAmisc_feature(1)..(34)DNAmisc_feature(35)..(35)RNAmisc_feature(28)..(28-
)n is deoxyuridine 33tcaacatcag tctgataagc tagctgcngc tccgu
353446DNAArtificial Sequencesynthetic DNAmisc_feature(7)..(7)n is
deoxyuridinemisc_feature(40)..(40)n is deoxyuridine 34tcgatcncgc
actcaacatc agtctgataa gctagctgcn gctccg 463522RNAArtificial
Sequencesynthetic RNA 35ucaacaucag ucugauaagc ua
223634RNAArtificial Sequencesynthetic RNA 36ucaacaucag ucugauaagc
uagcugcagc uccg 343712RNAArtificial Sequencesynthetic RNA
37cggagcugca gc 123850RNAArtificial Sequencesynthetic RNA
38ucaacaucag ucugauaagc uagcugcagc uccguuuucg gagcugcagc
503922RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(22)2'-0-methyl RNA 39ucaacaucag ucugauaagc ua
224034RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(34)2'-0-methyl RNAmisc_feature(28)..(28)n is
deoxyuridine 40ucaacaucag ucugauaagc uagcugcngc uccg
344134RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(34)2'-0-methyl RNA 41ucaacaucag ucugauaagc
uagcugcugc uccg 344212RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(12)2'-0-methyl RNA 42cggagcagca gc
124350RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(50)2'-0-methyl RNA 43ucaacaucag ucugauaagc
uagcugcugc uccguuuucg gagcagcagc 504434RNAArtificial
Sequencesynthetic RNAmisc_feature(1)..(34)2'-0-methyl RNA
44gcugcugcuc cgucaacauc agucugauaa gcua 344546RNAArtificial
Sequencesynthetic RNAmisc_feature(1)..(46)2'-0-methyl RNA
45gcugcugcuc cgucaacauc agucugauaa gcuagcugcu gcuccg
464634RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(34)2'-0-methyl RNAmisc_feature(6)..(6)n is
deoxyuridinemisc_feature(28)..(28)n is deoxyuridine 46gcugcngcuc
cgugauaagc uagcugcngc uccg 344743DNAArtificial Sequencesynthetic
DNA 47cgcagtagag ctctagttca acatcagtct gataagctag ttt
434845DNAArtificial Sequencesynthetic DNA 48aaactagctt atcagactga
tgttgaacta gagctctact gcgat 454934DNAArtificial Sequencesynthetic
DNAmisc_feature(28)..(28)n is deoxyuridine 49tagcttatca gactgatgtt
gagctgcngc tccg 345034DNAArtificial Sequencesynthetic
DNAmisc_feature(28)..(28)n is deoxyuridine 50tagcttatca gactgatgtt
gagctgcngc tccg 345112DNAArtificial Sequencesynthetic
DNAmisc_feature(7)..(7)n is deoxyuridine 51cggagcngca gc
125234DNAArtificial Sequencesynthetic DNAmisc_feature(28)..(28)n is
deoxyuridine 52tcaacatcag tctgataagc tagctgcngc tccg
345311RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(11)2'-0-methyl RNAmisc_feature(6)..(6)n is
deoxyuridine 53ggagcngcag c 11549RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(9)2'-0-methyl RNAmisc_feature(4)..(4)n is
deoxyuridine 54agcngcagc 95510RNAArtificial Sequencesynthetic
RNAmisc_feature(1)..(10)2'-0-methyl RNAmisc_feature(7)..(7)n is
deoxyuridine 55cggagcngca 10
* * * * *