U.S. patent application number 15/683522 was filed with the patent office on 2017-12-07 for prostacyclin compositions for regulation of fracture repair and bone formation.
The applicant listed for this patent is MAYO FOUNDATION FOR MEDICAL EDUCATION AND RESEARCH. Invention is credited to Theodore A. Craig, Rajiv Kumar, Zachary C. Ryan, Jennifer J. Westendorf.
Application Number | 20170348275 15/683522 |
Document ID | / |
Family ID | 53367102 |
Filed Date | 2017-12-07 |
United States Patent
Application |
20170348275 |
Kind Code |
A1 |
Kumar; Rajiv ; et
al. |
December 7, 2017 |
PROSTACYCLIN COMPOSITIONS FOR REGULATION OF FRACTURE REPAIR AND
BONE FORMATION
Abstract
The present disclosure provides a prostacyclin coated implant to
enhance fracture repair and bone formation comprising: an implant;
and a prostacyclin coating comprising a prostacyclin compound
disposed in a polymer coating the implant, wherein the prostacyclin
coating releases the prostacyclin compound which enhances fracture
repair and bone formation.
Inventors: |
Kumar; Rajiv; (Rochester,
MN) ; Westendorf; Jennifer J.; (Rochester, MN)
; Craig; Theodore A.; (Rochester, MN) ; Ryan;
Zachary C.; (Rochester, MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MAYO FOUNDATION FOR MEDICAL EDUCATION AND RESEARCH |
Rochester |
MN |
US |
|
|
Family ID: |
53367102 |
Appl. No.: |
15/683522 |
Filed: |
August 22, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14563754 |
Dec 8, 2014 |
9763911 |
|
|
15683522 |
|
|
|
|
61915116 |
Dec 12, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/343 20130101;
A61L 27/34 20130101; A61L 31/16 20130101; A61K 45/06 20130101; A61L
2300/602 20130101; A61L 2300/606 20130101; A61L 31/10 20130101;
A61L 27/54 20130101; A61L 2300/22 20130101 |
International
Class: |
A61K 31/343 20060101
A61K031/343; A61L 31/10 20060101 A61L031/10; A61L 27/54 20060101
A61L027/54; A61K 45/06 20060101 A61K045/06; A61L 31/16 20060101
A61L031/16; A61L 27/34 20060101 A61L027/34 |
Claims
1. A composition that enhances fracture repair and bone formation
comprising: an extended release polymer; and a prostacyclin
disposed in the extended release polymer, wherein the prostacyclin
is provided in an amount sufficient to enhance fracture repair and
bone formation in situ.
2. The composition of claim 1, wherein the extended release polymer
is a hydrogel.
3. The composition of claim 1, wherein the extended release polymer
is a hydrogel selected from crosslinked poly(vinyl alcohol) and
poly(hydroxy ethylmethacrylate), acyl substituted cellulose
acetates and alkyl derivatives thereof, partially and completely
hydrolyzed alkylene-vinyl acetate copolymers, polyvinyl chloride,
homo- and copolymers of polyvinyl acetate, polyethylene,
polypropylene, crosslinked polyesters of acrylic acid and/or
methacrylic acid, alkyl acrylates such as methyl methacrylate or
methyl acrylate, polyacrylic acid, polyalkacrylic acids such as
polymethacrylic acid, polyvinyl alkyl ethers, polyvinyl fluoride,
polytetrafluoroethylene, polycarbonate, polyurethane, polyamide,
polysulphones, polystyrene, styrene acrylonitrile copolymers,
poly(ethylene oxide), poly(alkylenes), poly(vinyl imidazole),
poly(esters), poly(ethylene terephthalate), polyphosphazenes, and
chlorosulphonated polyolefins, and combinations thereof.
4. The composition of claim 1, wherein the extended release polymer
provides a release of the prostacyclin compound over less than 6
months.
5. The composition of claim 1, wherein the extended release polymer
comprises multiple layers of polymer coatings to provide a specific
release regime over an extended period of time.
6. The composition of claim 1, wherein the composition further
comprises bone fragments.
7. The composition of claim 1, wherein the composition is provided
in an implant, and wherein the implant is a cage, a wire, a staple,
a plate, a screw, a rod, a tubular structure, a scaffold, an
external fixation device or a combination thereof.
8. The composition of claim 7, wherein the implant comprises
stainless steel, titanium, polyether ether ketone, polyethelene or
a combination thereof.
9. The composition of claim 1, wherein the extended release polymer
is a biodegradable polymer.
10. The composition of claim 1, wherein the prostacyclin compound
is
(Z)-5-[(4R,5R)-5-hydroxy-4-((S,E)-3-hydroxyoct-1-enyl)hexahydro-2H-cyclop-
enta[b]furan-2-ylidene]pentanoic acid or
(5E)-5-[(3aS,4R,5R,6aS)-5-hydroxy-4-[(E,3S)-3-hydroxyoct-1-enyl]-3,3a,4,5-
,6,6a-hexahydro-1H-pentalen-2-ylidene]pentanoic acid.
11. The composition of claim 1, wherein the composition is adapted
for administration parenterally, enterally, injected (intravenous
(IV), intramuscular (IM), and subcutaneous (SC)), topically,
intraarticularly, or via intraosseous infusion.
12. A device for enhancing fracture repair and bone formation
comprising: an implant; and a prostacyclin disposed in a polymer
coating the implant, wherein the prostacyclin coating releases the
prostacyclin compound which enhance fracture repair and bone
formation.
13. The device of claim 12, wherein the polymer coating is an
extended release polymer that provides a release of the
prostacyclin compound over less than 6 months.
14. The device of claim 12, wherein the polymer coating comprises
multiple layers of polymer coatings to provide a specific release
regime over an extended period of time.
15. The device of claim 12, wherein the extended release polymer is
a hydrogel.
16. The device of claim 12, wherein the extended release polymer is
a hydrogel selected from crosslinked poly(vinyl alcohol) and
poly(hydroxy ethylmethacrylate), acyl substituted cellulose
acetates and alkyl derivatives thereof, partially and completely
hydrolyzed alkylene-vinyl acetate copolymers, polyvinyl chloride,
homo- and copolymers of polyvinyl acetate, polyethylene,
polypropylene, crosslinked polyesters of acrylic acid and/or
methacrylic acid, alkyl acrylates such as methyl methacrylate or
methyl acrylate, polyacrylic acid, polyalkacrylic acids such as
polymethacrylic acid, polyvinyl alkyl ethers, polyvinyl fluoride,
polytetrafluoroethylene, polycarbonate, polyurethane, polyamide,
polysulphones, polystyrene, styrene acrylonitrile copolymers,
poly(ethylene oxide), poly(alkylenes), poly(vinyl imidazole),
poly(esters), poly(ethylene terephthalate), polyphosphazenes, and
chlorosulphonated polyolefins, and combinations thereof.
17. The device of claim 12, wherein the implant is a cage, a wire,
a staple, a plate, a screw, a rod, a tubular structure, a scaffold,
an external fixation device or a combination thereof.
18. The device of claim 12, wherein the implant comprises stainless
steel, titanium, polyether ether ketone, polyethelene or a
combination thereof.
19. The device of claim 12, wherein the implant is a biodegradable
polymer.
20. The device of claim 12, wherein the prostacyclin is
(Z)-5-[(4R,5R)-5-hydroxy-4-((S,E)-3-hydroxyoct-1-enyl)hexahydro-2H-cyclop-
enta[b]furan-2-ylidene]pentanoic acid or
(5E)-5-[(3aS,4R,5R,6aS)-5-hydroxy-4-[(E,3S)-3-hydroxyoct-1-enyl]-3,3a,4,5-
,6,6a-hexahydro-1H-pentalen-2-ylidene]pentanoic acid.
21. The device of claim 12, wherein the composition is adapted for
administration parenterally, enterally, injected (intravenous (IV),
intramuscular (IM), and subcutaneous (SC)), topically,
intraarticularly, or via intraosseous infusion
22. A scaffold for accelerating bone healing comprising: an
extended release polymer and a prostacyclin in, on, or about the
scaffold, wherein the prostacyclin provided in an amount that
enhances bone formation about the scaffold.
23. The scaffold of claim 22, wherein the prostacyclin is disposed
in an extended release polymer to provide a release of the
prostacyclin compound over less than 6 months.
24. The scaffold of claim 22, wherein the extended release polymer
comprising multiple layers that provide a specific release regime
over an extended period of time.
25. The scaffold of claim 22, wherein the prostacyclin is
(Z)-5-[(4R,5R)-5-hydroxy-4-((S,E)-3-hydroxyoct-1-enyl)hexahydro-2H-cyclop-
enta[b]furan-2-ylidene]pentanoic acid or
(5E)-5-[(3aS,4R,5R,6aS)-5-hydroxy-4-[(E,3S)-3-hydroxyoct-1-enyl]-3,3a,4,5-
,6,6a-hexahydro-1H-pentalen-2-ylidene]pentanoic acid.
26. The scaffold of claim 22, further comprising a coating
comprising silver ions, zinc ions, or silver ions and zinc ions to
prevent or treat infection.
27. The scaffold of claim 22, wherein the composition is adapted
for administration parenterally, enterally, injected (intravenous
(IV), intramuscular (IM), and subcutaneous (SC)), topically,
intraarticularly, or via intraosseous infusion
28. A method for treating and enhancing fracture repair and bone
formation comprising the steps of: providing an implant having a
prostacyclin disposed in a polymer; and positioning the implant in
a position to provide prostacyclin at a bone healing interface,
wherein the prostacyclin about the bone healing interface to
enhance fracture repair and bone formation.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a Divisional patent application of U.S. Ser. No.
14/563,754, filed Dec. 8, 2014, entitled "PROSTACYCLIN COMPOSITIONS
FOR REGULATION OF FRACTURE REPAIR AND BONE FORMATION, and claims
benefit of Provisional Patent Application Ser. No. 61/915,116,
filed Dec. 12, 2013, entitled "PROSTACYCLIN COMPOSITIONS FOR
REGULATION OF FRACTURE REPAIR AND BONE FORMATION," the contents of
which is incorporated by reference herein in its entirety
TECHNICAL FIELD OF THE INVENTION
[0002] The present invention relates generally to methods and
compositions of prostacyclin and derivatives for the production of
a pharmaceutical agent for treating and enhancing fracture repair
and bone formation.
STATEMENT OF FEDERALLY FUNDED RESEARCH
[0003] None.
INCORPORATION-BY-REFERENCE OF MATERIALS FILED ON COMPACT DISC
[0004] None.
BACKGROUND OF THE INVENTION
[0005] Without limiting the scope of the invention, its background
is described in connection with treating and enhancing fracture
repair and bone formation.
[0006] The skeleton provides a number of functions, such as the
provision of support, the protection of internal organs and the
provision of sites for the attachment of muscles and tendons which
operatively function to enable an animal to move. Bone is a living
tissue which is being constantly resorbed, replaced and remodelled
during growth and development. This is particularly relevant during
skeleton development and fracture repair. When the adult skeleton
is formed it requires constant maintenance to ensure its functions
are adequately maintained.
[0007] The deposition, resorption and/or remodeling of bone tissue
is undertaken by specialized, anabolic cells known as osteoblasts
(involved in bone tissue deposition) and resorptive cells, known as
osteoclasts (involved in the resorption of bone tissue). Osteocytes
produce a number of factors that influence bone formation and
resorption. The activity of these specialized cells varies during
growth and development. During normal, early human development, new
bone tissue is formed faster than old bone is resorbed, resulting
in bone becoming larger, heavier and more dense. In the fully
developed human adult, peak bone density mass is achieved during
the late 20's. However, in later life, osteoclast activity exceeds
that of osteoblasts, resulting in a decrease in bone density and,
consequently, a reduction in bone mass.
[0008] Bone loss results in demineralizing disorders such as
osteoporosis and enhances the susceptibility to fractures that are
responsible for significant morbidity, mortality and excess health
care costs. With the anticipated aging of the U.S. population,
admissions for fractures are anticipated to rise with attendant
costs of $25 billion per year by 2025. New strategies aimed at
increasing bone mass are needed to address the significant costs
and co-morbidities associated with osteoporosis and fractures,
particularly in the aging population.
[0009] U.S. Patent Application Publication No. 2005/0101673,
entitled, "Use of Orally Available Prostacyclin Derivatives for the
Production of a Pharmaceutical Agent for Treating Diseases that are
Associated with Bone Marrow Edemas," discloses the use of orally
available prostacyclin derivatives for the production of a
pharmaceutical agent for treating diseases that are associated with
bone marrow edemas.
[0010] U.S. Patent Application Publication No. 2003/0139372, and
U.S. Patent Application Publication No. 2004/0171692 both entitled,
"Modulation of Bone Formation" discloses the use of an activator or
ligand of a peroxisome proliferator-activated receptor, other than
PPAR.gamma., or pharmaceutically acceptable derivative of said
activator or ligand, in the manufacture of a medicament for the
treatment or prophylaxis of bone disease allows, for the first
time, bone anabolism to enhance the deposition of bone in
conditions which would benefit from increased bone deposition. The
reverse, where there is inhibition and/or retardation of bone
deposition is also facilitated.
[0011] U.S. Pat. No. 8,580,800, entitled
"1,4-diaryl-pyrimidopyridazine-2,5-diones and their use" discloses
1,4-diarylpyrimido[4,5-d]pyridazine-2,5-dione derivatives for the
treatment and/or prevention of diseases and also to their use for
preparing medicaments for the treatment and/or prevention of
diseases, in particular for the treatment and/or prevention of
disorders of the lung and the cardiovascular system.
SUMMARY OF THE INVENTION
[0012] The present disclosure provides a method for treating and/or
enhancing fracture repair and bone formation by providing a
fracture; providing an implant having a prostacyclin coating
comprising a prostacyclin compound disposed in a polymer; and
positioning the implant to provide prostacyclin at the fracture
site, wherein the prostacyclin coating releases the prostacyclin
compound about the bone healing interface to enhance fracture
repair and bone formation. The implant may be a cage, a wire, a
staple, a plate, a screw, a rod, a tubular structure, a scaffold,
an external fixation device or a combination thereof and made of
stainless steel, titanium, polyether ether ketone, polyethelene,
and combinations thereof. The polymer may be an extended release
polymer that provides a release of the prostacyclin compound over
less than 6 months and may include multiple layers to provide a
specific release regime over an extended period of time. The
prostacyclin compound is
(Z)-5-[(4R,5R)-5-hydroxy-4-((S,E)-3-hydroxyoct-1-enyl)hexahydro-2H-cyc-
lopenta[b]furan-2-ylidene]pentanoic acid but may also include
derivatives, mimics and analogues thereof.
[0013] The present disclosure provides a prostacyclin coated
implant to enhance fracture repair and bone formation comprising:
an implant; and a prostacyclin coating comprising a prostacyclin
compound disposed in a polymer coating the implant, wherein the
prostacyclin coating releases the prostacyclin compound which
enhance fracture repair and bone formation.
[0014] The polymer coating may be an extended release polymer that
provides a release of the prostacyclin compound over less than 6
months and/or include multiple layers of polymer coatings to
provide a specific release regime over an extended period of time.
The implant may be made of a biodegradable polymer in instances
where the implant is not used to stabilize a fracture.
[0015] The present disclosure provides a bone scaffold implant for
accelerating bone healing comprising a scaffold implant containing
a prostacyclin compound for release to enhance bone formation about
the scaffold implant.
[0016] The prostacyclin compound may be disposed in an extended
release polymer to provide a release of the prostacyclin compound
over months. The prostacyclin compound may include multiple layers
positioned one over the other to provide a specific release regime
over an extended period of time an may be used in conjunction with
antibiotics and other infection control compositions, e.g., silver
ions, zinc ions, or silver ions and zinc ions to prevent or treat
infection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] For a more complete understanding of the features and
advantages of the present invention, reference is now made to the
detailed description of the invention along with the accompanying
figures and in which:
[0018] FIGS. 1A-C show prostaglandin concentrations, mRNAs for
prostaglandin synthases, and prostacyclin synthase in osteocytes in
extracts of bones, or decalcified bone sections from Sost WT or KO
mice.
[0019] FIG. 2 shows urinary prostaglandins in Sost KO and WT
mice.
[0020] FIG. 3A shows a phase contrast microscopy image of Sost WT
(left) and KO (right) osteocytes. Note dendritic extensions on
cells. FIG. 3B shows immunostaining using an antibody directed
against podoplanin (E11) in Sost WT (left) and KO (right)
osteocytes. FIG. 3C shows RT-PCR products in RNA derived from Sost
WT (left) and KO (right) osteocytes.
[0021] FIGS. 4A-4B shows mRNA transcripts for prostaglandin
synthases, Ptgis, Ptges, Ptgds, Tbxas1, Cox1, Cox 2, Pla2g4a,
Plcl2, and Plcd1 were measured in clonal Sost KO and WT
osteocytes.
[0022] FIGS. 5A-5F shows Enhanced b-catenin and
b-catenin-associated transcription is present in clonal osteocytes
from Sost KO mice. FIGS. 5A and 5B show total .beta.-catenin was
increased 583%, and non-phosphorylated active .beta.-catenin was
increased 872% in Sost KO OC clone vs. Sost WT OC clone. FIG. 5C
shows an increase in .beta.-catenin present in euchromatin of Sost
KO OC clone 8. FIG. 5D shows nuclear .beta.-catenin co-localized
with LEF over areas of euchromatin in Sost KO OC clone 8. FIG. 5E,
panels 1-5 the localization of .beta.-catenin in the nucleus of a
clonal Sost WT osteocyte, and in FIG. 5F, panels 1-5, localization
of .beta.-catenin in the nucleus of a clonal Sost KO osteocyte is
shown (red color).
[0023] FIGS. 6A and 6B show ChIP analysis of the Lef1 sites of Sost
WT OC clone 12 and Sost KO OC clone 8.
[0024] FIGS. 7A and 7B show inhibition of Wnt secretion with C-59
reduces intra-cellular activated .beta.-catenin concentrations and
6-keto PGF.sub.1.alpha. concentrations.
DETAILED DESCRIPTION OF THE INVENTION
[0025] While the making and using of various embodiments of the
present invention are discussed in detail below, it should be
appreciated that the present invention provides many applicable
inventive concepts that can be embodied in a wide variety of
specific contexts. The specific embodiments discussed herein are
merely illustrative of specific ways to make and use the invention
and do not delimit the scope of the invention.
[0026] To facilitate the understanding of this invention, a number
of terms are defined below. Terms defined herein have meanings as
commonly understood by a person of ordinary skill in the areas
relevant to the present invention. Terms such as "a", "an" and
"the" are not intended to refer to only a singular entity, but
include the general class of which a specific example may be used
for illustration. The terminology herein is used to describe
specific embodiments of the invention, but their usage does not
delimit the invention, except as outlined in the claims.
[0027] As used herein, the terms "about" or "approximately" mean
that the parameter so modified need not be exactly the value or
range of values stated herein to still come within the scope of
this invention. While circumstances and the knowledge of those
skilled in the art may require an even greater departure from the
indicated value or range of values, at a minimum "about" or
"approximately" is to be construed to be at least .+-. 15% of the
value so modified, in some embodiments at least plus or minus 5% of
the value.
[0028] As used herein, "biocompatible" refers to an intact polymer
and to its biodegradation products all of which are not, or at
least are minimally, toxic to living tissue; do not, or at least
minimally and reversibly, injure living tissue; and/or do not, or
at least minimally and/or controllably, cause an immunological
reaction in living tissue.
[0029] As used herein, "biodegradable" refers to the in vivo
cleaving of bonds in a polymer that link the monomer-derived
portions together resulting in the break-down of the polymer into
smaller and smaller fragments until the fragments are small enough
to be either absorbed and metabolized or excreted by the organism.
The primary mechanism of biodegradation for some embodiments of
this invention is enzyme-catalyzed hydrolysis of ester groups.
[0030] As used herein, "bone," refers to bone that is cortical,
cancellous or cortico-cancellous of autogenous, allogenic,
xenogenic, or transgenic origin.
[0031] As used herein, "coating" refers to a single layer or to
multiple layers of a substance or substances disposed over a
surface of an implantable medical device. It will be readily
apparent to those skilled in the art which meaning of coating is
intended in any particular aspect of the invention described herein
based on the context.
[0032] As used herein, to "dispose" a layer on a surface means to
form a layer of a polymer over the surface of an implantable
medical device or over the surface formed by a previously disposed
layer. The layer can be formed by any means presently known or as
such may become known in the future including at present, without
limitation, spraying, dipping, electrodeposition, roll coating,
brushing, direct droplet application and molding.
[0033] As used herein, a "surface" of an implantable medical
device, a bone or a bone fragment refers to an outer surface, that
is a surface that is directly in contact with the external
environment and/or an inner surface if the device comprises a lumen
and/or the edge of the device that connects the outer surface with
the lumen. Unless expressly stated to be otherwise, "surface" will
refer to all or any combination of the preceding.
[0034] As used herein, "optional" or "optionally" when used to
modify an element of this invention means that the element may be
present or it may not be present and both are within the ambit of
this invention.
[0035] As used herein, "Osteoconductive," refers to the ability of
a non-osteoinductive substance to serve as a suitable template or
substance along which bone may grow.
[0036] As used herein, "Osteogenic," refers to the ability of an
agent, material, or implant to enhance or accelerate the growth of
new bone tissue by one or more mechanisms such as osteogenesis,
osteoconduction, and/or osteoinduction.
[0037] As used herein, "Osteoinductive," refers to the quality of
being able to recruit cells from the host that have the potential
to stimulate new bone formation. Any material that can induce the
formation of ectopic bone in the soft tissue of an animal is
considered osteoinductive.
[0038] As used herein, "immediate release" refers to describe a
release profile to effect delivery of an active as soon as
possible, that is, as soon as practically made available to an
animal, whether in active form, as a precursor and/or as a
metabolite. Immediate release may also be defined functionally as
the release of over 80 to 90 percent (%) of the active ingredient
within about 1, 60, 90, 100 or 120 hours or less.
[0039] As used herein, "extended release" and "delayed release"
refers a release profile to effect delivery of an active over an
extended period of time. Extended release may also be defined
functionally as the release of over 80 to 90 percent (%) of the
active ingredient after about 1 day and about 1, 2, 4, 6 or even 8
weeks. Extended release as used herein may also be defined as
making the active ingredient available to the patient or subject
regardless of uptake, as some actives may never be absorbed by the
animal.
[0040] In instances where one or more bones are fractured, the
fracture is set, immobilized and stabilized so that the bones can
undergo fibrocartilaginous callus formation, bone callus formation,
and bone remodeling. However, it is often necessary for bone
fractured repair using medical implants (i.e., plates, nails,
screws, or pins) in addition it may be necessary to use bone grafts
to allow for proper healing or to assist in the healing process. In
addition, there are instances where the healing and repair process
must be supplemented using additional mechanisms to stimulate bone
growth, e.g., electrical stimulation of fracture site, ultrasound
treatment, free vascular fibular graft techniques, and/or bone
substitutes. The present invention provides compositions and
methods of treating and enhancing fracture repair and bone
formation by increasing the concentration of prostacyclin locally
to stimulate bone formation, growth and healing. In general, the
present invention can be used in treating and enhancing fracture
repair and bone formation of any bone in conjunction with the bone
repair methods and devices currently used in the art that repair,
mend, change the shape, pull together or compress bone throughout
the skeletal system.
[0041] In one embodiment the prostacyclin compositions may be
prostacyclin or a pharmaceutical composition comprising
prostacyclin. However, the present invention also includes
prostacyclin derivatives, prostacyclin analogues, prostacyclin
mimics and the like. In addition, the prostacyclin compositions may
be precursors of prostacyclin compositions that can be formed in to
the active prostacyclin composition locally. In addition, the
prostacyclin composition may function to indirectly increase the
concentration of prostacyclin by decreasing the metabolism of
prostacyclin or by affecting the pathways to increase the
availability of prostacyclin. The pharmaceutical composition may
include multiple approaches to increase the local prostacyclin
concentration, e.g., the pharmaceutical composition may include
prostacyclin and an active agent to decrease the degradation of the
prostacyclin and provide an increased concentration locally.
[0042] The present invention provides a pharmaceutical prostacyclin
composition that is applied as a coating to an implant used at a
bone repair site. The implant may be configured to align, biopsy,
fuse, and/or stabilize a bone and may be a bone screw wires,
screws, staples, rods, plates, screws, washers, cylindrical cages,
external fixators and combinations of these devices. In addition
the present invention can be used with shape changing cages that
are used to pull together and compress bone segments. The implant
can be constructed in part or entirely from stainless steel,
titanium, or a combination thereof. In addition, the bone implant
can include a shape memory metal, an elastic biocompatible metal,
an elastic biocompatible polymer, or a combination thereof. The
implant can also be synthetic and include polyether ether ketone
(PEEK), polyethelene, or a combination thereof.
[0043] A coating containing pharmaceutical composition may be
coated onto the implant prior to implantation. The coating serves
to increase prostacyclin concentration locally for treating and
enhancing fracture repair and bone formation. The pharmaceutical
composition may include prostacyclin derivatives, prostacyclin
analogues, prostacyclin mimics and the like or prostacyclin
precursors that can be formed into active prostacyclin compositions
locally. In addition, coating may actually be multiple coatings of
the same pharmaceutical composition or different pharmaceutical
compositions to enhancing fracture repair and bone formation. For
example, a first layer may include a prostacyclin pharmaceutical
composition and a second coating may include an active agent to
decrease the degradation of the prostacyclin to provide an
increased concentration locally. The present invention may also be
formulated into a polymer composition that is applied to the bone
junction, fracture or the bone fragments to increase the
prostacyclin concentration locally. This may be in the form of an
implant, biodegradable implant, a removable implant, a coating, or
a combination thereof.
[0044] In such cases the composition may be formulated with a
polymer, e.g., poly(vinylidene fluoride), poly(vinylidene
fluoride-co-chlorotrifluoroethylene), poly(vinylidene
fluoride-co-hexafluoropropylene), poly(vinylidene chloride),
poly(vinyl fluoride), poly(vinyl chloride), polyvinyl acetate,
polystyrene, polyisobutylene, copolymers of styrene and
isobutylene, poly(styrene-b-isobutylene-b-styrene), poly(n-butyl
methacrylate), poly(butyl methacrylates), polycaprolactone,
poly(trimethylene carbonate), poly(L-lactide), poly(L-lactic acid),
poly(lactide-co-glycolide), poly(hydroxyvalerate),
poly(3-hydroxyvalerate), poly(hydroxybutyrate),
poly(3-hydroxybutyrate), poly(4-hydroxybutyrate),
poly(hydroxybutyrate-co-valerate),
poly(3-hydroxybutyrate-co-3-hydroxyvalerate), poly(glycolide),
poly(glycolic acid), poly(D,L-lactide-co-L-lactide),
poly(D,L-lactide-co-glycolide), poly(D,L-lactide), poly(D,L-lactic
acid), poly(glycolic acid-co-trimethylene carbonate),
polyanhydride, polyorthoester, acrylic polymers and acrylic
copolymers, copolymers of vinyl monomers with each other and
olefins, ethylene-methyl methacrylate copolymers, ethylene-vinyl
acetate copolymers; ethylene-.alpha.-olefin copolymers,
poly(silicone-urethanes), poly(tyrosine arylates),
poly(tyrosine-derived carbonates); polyacrylates, polycarbonates,
poly-hydroxycarboxylic acids, polyisobutylene and
ethylene-.alpha.-olefin copolymers, polymethacrylates, polyolefins,
polyorthoesters, polyvinyl aromatics; polyvinyl esters, silicones,
vinyl copolymers, vinyl-olefin copolymers, vinyl halide polymers
and copolymers. In other embodiments, the polar polymer in the
coating is selected from a group consisting of
poly(ethylene-co-vinyl alcohol), poly(vinyl alcohol), ethylene
vinyl alcohol copolymers, poly(2-hydroxyethyl methacrylate),
poly(2-hydroxyethyl methacrylate-co-n-butyl methacrylate),
poly(2-hydroxyethyl methacrylate) copolymers, poly(2-methoxyethyl
methacrylate), poly(2-ethoxyethyl methacrylate),
poly(2-methoxy-1-methylethyl methacrylate), poly(carbamoylmethyl
methacrylate), poly(2-carbamoylethyl methacrylate),
poly(1-carbamoyl-1-methylmethyl methacrylate),
poly(N-(carbamoylmethyl) methacrylamide),
poly(N-(1-carbamoyl-1-methylmethyl) methacrylamide),
poly(phosphorylcholine methacrylate), poly(phosphoryl choline
methacrylate) copolymers, PC1036, PC2126, poly(cellulose ethers),
poly(amino acids), poly(ester amides), poly(ester-urethanes),
poly(ether-urethanes), poly(imino carbonates), poly(acrylic acids),
poly(alkylene oxalates), polyamides, poly(carboxylic acids),
polycyanoacrylates, polyethers, poly(mides), poly(ketones),
poly(oxymethylenes), poly(phosphazenes), poly(phosphoesters),
poly(phosphoester urethanes), poly(phosphoesters), polyurethanes,
poly(vinyl esters), poly(vinyl ethers), poly(vinyl ketones),
starch, sodium alginate, poly(vinyl pyrrolidone), poly(vinyl methyl
ether), poly(isocyanate), poly(ethylene glycol), poly(dioxanone),
poly(caprolactam), Nylon 66, hyaluronic acid, fibrinogen, fibrin,
elastin-collagen, collagen, cellulose propionate, cellulose
nitrate, cellulose butyrate, cellulose acetate butyrate, cellulose
acetate, cellulose, carboxymethyl cellulose, chitin, chitosan,
poly(N-acetylglucosamine), polyurethane, and PEO/PLA. In one
embodiment, the polymer coating is selected from a group consisting
of poly(vinyl fluoride), poly(vinyl chloride), polystyrene,
polyisobutylene, copolymers of styrene and isobutylene,
poly(styrene-b-isobutylene-b-styrene), poly(n-butyl methacrylate),
poly(butyl methacrylates), acrylic polymers, acrylic copolymers,
copolymers of vinyl monomers with each other and olefins,
ethylene-methyl methacrylate copolymers, ethylene-vinyl acetate
copolymers; ethylene-.alpha.-olefin copolymers,
poly(silicone-urethanes), poly(tyrosine arylates),
poly(tyrosine-derived carbonates), polyacrylates, polycarbonates,
polyisobutylene and ethylene-.alpha.-olefin copolymers,
polymethacrylates, polyolefins, polyorthoesters, polyvinyl
aromatics, polyvinyl esters, silicones, vinyl copolymers,
vinyl-olefin copolymers, and vinyl halide polymers and copolymers.
The polymer coating may include multiple layers of polymers with
different or similar properties depending on the specific
application. In certain embodiments, the coating further comprises
an optional finishing coating layer for enhancing biocompatibility
and generally refers to an outermost layer, that is, a layer that
is in contact with the external environment and that is coated over
all other layers. The topcoat layer may be a separate distinct
layer. Representative examples of the polymers of the
differentially permeable topcoat layer include, but are not limited
to, poly(vinyl fluoride), poly(vinyl chloride), polystyrene,
polyisobutylene, copolymers of styrene and isobutylene,
poly(styrene-b-isobutylene-b-styrene), poly(n-butyl methacrylate),
poly(butyl methacrylates), acrylic polymers, acrylic copolymers,
copolymers of vinyl monomers with each other and olefins,
ethylene-methyl methacrylate copolymers, ethylene-vinyl acetate
copolymers; ethylene-.alpha.-olefin copolymers,
poly(silicone-urethanes), poly(tyrosine arylates),
poly(tyrosine-derived carbonates), polyacrylates, polycarbonates,
polyisobutylene and ethylene-.alpha.-olefin copolymers,
polymethacrylates, polyolefins, polyorthoesters, polyvinyl
aromatics, polyvinyl esters, silicones, vinyl copolymers,
vinyl-olefin copolymers, and vinyl halide polymers and copolymers.
In a presently preferred embodiment, the topcoat layer comprises
styrene-isobutylene-styrene triblock polymer.
[0045] In such cases the composition may be formulated with
biocompatible polymers. The composition can include one or more
biocompatible polymers. The biocompatible polymers can be
biodegradable (either bioerodable or bioabsorbable) or
nondegradable and can be hydrophilic or hydrophobic. Representative
biocompatible polymers include, but are not limited to, poly(ester
amide), polyhydroxyalkanoates (PHA), poly(3-hydroxyalkanoates) such
as poly(3-hydroxypropanoate), poly(3-hydroxybutyrate),
poly(3-hydroxyvalerate), poly(3-hydroxyhexanoate),
poly(3-hydroxyheptanoate) and poly(3-hydroxyoctanoate),
poly(4-hydroxyalkanoate) such as poly(4-hydroxybutyrate),
poly(4-hydroxyvalerate), poly(4-hydroxyhexanoate),
poly(4-hydroxyheptanoate), poly(4-hydroxyoctanoate) and copolymers
including any of the 3-hydroxyalkanoate or 4-hydroxyalkanoate
monomers described herein or blends thereof, poly(D,L-lactide),
poly(L-lactide), polyglycolide, poly(D,L-lactide-co-glycolide),
poly(L-lactide-co-glycolide), polycaprolactone,
poly(lactide-co-caprolactone), poly(glycolide-co-caprolactone),
poly(dioxanone), poly(ortho esters), poly(anhydrides),
poly(tyrosine carbonates) and derivatives thereof, poly(tyrosine
ester) and derivatives thereof, poly(imino carbonates),
poly(glycolic acid-co-trimethylene carbonate), polyphosphoester,
polyphosphoester urethane, poly(amino acids), polycyanoacrylates,
poly(trimethylene carbonate), poly(iminocarbonate), polyurethanes,
polyphosphazenes, silicones, polyesters, polyolefins,
polyisobutylene and ethylene-alphaolefin copolymers, acrylic
polymers and copolymers, vinyl halide polymers and copolymers, such
as polyvinyl chloride, polyvinyl ethers, such as polyvinyl methyl
ether, polyvinylidene halides, such as polyvinylidene chloride,
polyacrylonitrile, polyvinyl ketones, polyvinyl aromatics, such as
polystyrene, polyvinyl esters, such as polyvinyl acetate,
copolymers of vinyl monomers with each other and olefins, such as
ethylene-methyl methacrylate copolymers, acrylonitrile-styrene
copolymers, ABS resins, and ethylene-vinyl acetate copolymers,
polyamides, such as Nylon 66 and polycaprolactam, alkyd resins,
polycarbonates, polyoxymethylenes, polyimides, polyethers,
poly(glyceryl sebacate), poly(propylene fumarate), poly(n-butyl
methacrylate), poly(sec-butyl methacrylate), poly(isobutyl
methacrylate), poly(tert-butyl methacrylate), poly(n-propyl
methacrylate), poly(isopropyl methacrylate), poly(ethyl
methacrylate), poly(methyl methacrylate), epoxy resins,
polyurethanes, rayon, rayon-triacetate, cellulose acetate,
cellulose butyrate, cellulose acetate butyrate, cellophane,
cellulose nitrate, cellulose propionate, cellulose ethers,
carboxymethyl cellulose, polyethers such as poly(ethylene glycol)
(PEG), copoly(ether-esters) (e.g. poly(ethylene oxide/poly(lactic
acid) (PEO/PLA)), polyalkylene oxides such as poly(ethylene oxide),
poly(propylene oxide), poly(ether ester), polyalkylene oxalates,
polyphosphazenes, phosphoryl choline, choline, poly(aspirin),
polymers and co-polymers of hydroxyl bearing monomers such as
2-hydroxyethyl methacrylate (HEMA), hydroxypropyl methacrylate
(HPMA), hydroxypropylmethacrylamide, PEG acrylate (PEGA), PEG
methacrylate, 2-methacryloyloxyethylphosphorylcholine (MPC) and
n-vinyl pyrrolidone (VP), carboxylic acid bearing monomers such as
methacrylic acid (MA), acrylic acid (AA), alkoxymethacrylate,
alkoxyacrylate, and 3-trimethylsilylpropyl methacrylate (TMSPMA),
poly(styrene-isoprene-styrene)-PEG (SIS-PEG), polystyrene-PEG,
polyisobutylene-PEG, polycaprolactone-PEG (PCL-PEG), PLA-PEG,
poly(methyl methacrylate)-PEG (PMMA-PEG),
polydimethylsiloxane-co-PEG (PDMS-PEG), surfactants (polypropylene
oxide-co-polyethylene glycol), poly(tetramethylene glycol), hydroxy
functional poly(vinyl pyrrolidone), biomolecules such as chitosan,
alginate, fibrin, fibrinogen, cellulose, starch, dextran, dextrin,
fragments and derivatives of hyaluronic acid, heparin, fragments
and derivatives of heparin, glycosamino glycan (GAG), GAG
derivatives, polysaccharide, chitosan, alginate, or combinations
thereof. In some embodiments, the copolymer described herein can
exclude any one or more of the aforementioned polymers. As used
herein, the terms poly(D,L-lactide), poly(L-lactide),
poly(D,L-lactide-co-glycolide), and poly(L-lactide-co-glycolide)
can be used interchangeably with the terms poly(D,L-lactic acid),
poly(L-lactic acid), poly(D,L-lactic acid-co-glycolic acid), or
poly(L-lactic acid-co-glycolic acid), respectively.
[0046] In addition the composition can be administered as in a
bulk-eroding biodegradable polymer. These water compatible polymers
absorb water and along with it the enzymes and other
biodegradation-causing components of a physiological system. The
absorbed components cause internal degradation of the polymer at a
rate that competes with the rate of surface erosion. That is,
degradation takes place simultaneously throughout the polymer
matrix. The result can be an extremely complex drug release profile
as differential degradation takes place in the bulk of the polymer
and the drug is released from throughout the polymer matrix. Rather
than a smooth, linear release profile such as that obtained with
surface-eroding polymers, burst releases of massive amounts of
drug, which can be detrimental to the health and safety of the
patient, may occur. Autocatalysis compounds this situation for
polyesters such as polylactides and polyglycolides. Unlike
surface-eroding polymers, when bulk eroding polymers degrade to
their component acids, the acids remain trapped for an extended
period of time within the remaining polymer matrix wherein they
catalyze further degradation, which further complicates the release
profile of an incorporated therapeutic agent. For example, the
amorphous biocompatible biodegradable polymer may be selected from
the group consisting of poly(D,L-lactide), poly(meso-lactide),
poly(L-lactide-co-glycolide),
poly(D-lactide-co-glycolide)-poly(D,L-lactide-co-glycolide),
poly(L-lactide-co-D,L-lactide), and
poly(meso-lactide-co-glycolide). As a result the present invention
provides the clinician the ability to implant the devices in their
proper position and provide a source of prostacyclin to stimulate
bone formation, growth and healing.
[0047] In addition the present compositions may be used in
conjunction with scaffolding and implants for conducting bone
formation through the scaffolding or implant. This further
facilitates the healing of bone segments. In addition, the
compositions and methods of enhancing bone healing may be used in
conjunction with bone implants or bone grafts including grafts of
artificial bone materials. The present invention provides
prostacyclin compositions and methods of stimulated bone to heal
with greater bone density and size.
[0048] The present invention also includes permeate, removable, or
biodegradable non-structural implants to provide a source of
prostacyclin to stimulate bone growth and healing. For example, the
composition of the present invention may be configured as a coating
on an implanted medical device to increase prostacyclin
concentration and thus stimulate bone growth and healing. The
prostacyclin may be deposited in a coating applied to an implanted
medical device to release the prostacyclin to increase the
concentration and promote bone growth.
[0049] An implant according to the present disclosure delivers a
source of prostacyclin or a composition that increases prostacyclin
in vivo. The implant device may be loaded or coated with the
prostacyclin composition for placement in vivo. The implant device
may be pre-loaded with the prostacyclin composition, thus loaded at
manufacture, or may be loaded in the operating room or at the
surgical site. Preloading/loading may be done with the prostacyclin
composition, prostacyclin derivatives, prostacyclin precursors,
prostacyclin analogues, and prostacyclin mimics, and the like.
Preloading/loading may also include other active agents, for
example, allograft such as DBM, synthetic calcium phosphates,
synthetic calcium sulfates, enhanced DBM, collagen, carrier for
stem cells, and expanded cells (stem cells or transgenic
cells).
[0050] The present invention also includes extended release
polymers that provide the release prostacyclin composition and/or
other active agents for extended periods of time to provide an
increase or constant concentration over an extended time to promote
bone growth. In some instances the implant may be non-structural in
nature and thus can be biodegradable to dissolve over time. In
other embodiments, the implant may be coated with an extended
release polymer that degrades over time after the prostacyclin
composition and/or other active agents are released.
[0051] The extended release polymers may disintegrate during
delivery so that it may not need to be removed after use. Examples
of extended release polymers include, but are not limited to:
polyesters, polyorthoesters, polyphosphoesters, polycarbonates,
polyanhydrides, polyphosphazenes, polyoxalates, polyaminoacids,
polyhydroxyalkanoates, polyethyleneglycol, polyvinylacetate,
polyhydroxyacids, polyanhydrides, copolymers and blends thereof,
and the like. In some embodiments, a biodegradable polymer may be a
co-polymer of lactic and glycolic acid.
[0052] The extended release polymers also includes nondegradable
polymer and include, but are not limited to: ethylene vinyl acetate
copolymer (EVA), silicone, hydrogels such as crosslinked poly(vinyl
alcohol) and poly(hydroxy ethylmethacrylate), acyl substituted
cellulose acetates and alkyl derivatives thereof, partially and
completely hydrolyzed alkylene-vinyl acetate copolymers, polyvinyl
chloride, homo- and copolymers of polyvinyl acetate, polyethylene,
polypropylene, crosslinked polyesters of acrylic acid and/or
methacrylic acid, alkyl acrylates such as methyl methacrylate or
methyl acrylate, polyacrylic acid, polyalkacrylic acids such as
polymethacrylic acid, polyvinyl alkyl ethers, polyvinyl fluoride,
polytetrafluoroethylene, polycarbonate, polyurethane, polyamide,
polysulphones, polystyrene, styrene acrylonitrile copolymers,
poly(ethylene oxide), poly(alkylenes), poly(vinyl imidazole),
poly(esters), poly(ethylene terephthalate), polyphosphazenes, and
chlorosulphonated polyolefins, and combinations thereof.
[0053] In addition some embodiments may include multiple layer and
multiple types of polymers to accomplish specific concentrations
over given durations to promote bone growth. For example, the metal
implant may include a first coating of prostacyclin composition in
an extended release polymer that erodes over time to expose a
second prostacyclin composition at a second concentration in an
extended release polymer to provide a different final prostacyclin
composition concentration. A topcoat position on the first coating
that is an immediate released polymer coating that contains one or
more antibiotics that are released to prevent or decrease the
chance of an infection. This combination of multiple layers allows
the extended release of the active agents for a predetermined
duration. In addition the multiple layers allow the customization
of the concentration of the active agent at any given point in the
treatment. Thus it is possible to provide a first dosage of
prostacyclin at the initial stage and include antibiotics and
growth factors and at a later time provide a different dosage of
prostacyclin near the end of the treatment regime. Thus, the
instant invention provides infinite flexibility for the dosage of
prostacyclin over the entire treatment regime.
[0054] The present invention may be used in conjunction with bone
grafts to stimulated bone growth and healing. Autologous bone
grafts, being obtained from the patient, require additional surgery
and present increased risks associated with its harvesting, such as
risk of infection, blood loss, and compromised structural integrity
at the donor site. Bone grafts using cortical bone remodel slowly
because of their limited porosity. Traditional bone substitute
materials and bone chips are more quickly remodeled but cannot
immediately provide mechanical support. With regards to bone
grafts, allograft bone is a reasonable bone graft substitute for
autologous bone. It is readily available from cadavers and avoids
the surgical complications and patient morbidity associated with
harvesting autologous bone. Allograft bone is essentially a
load-bearing matrix comprising cross-linked collagen,
hydroxyapatite, and osteoinductive bone morphogenetic proteins.
Human allograft tissue is widely used in orthopaedic surgery.
Non-bone composition such as a polymer composition, e.g.,
poly-ether-ether-ketone (PEEK) and/or other polymer compositions is
also widely used in orthopaedic surgery. The present invention can
be used to stimulate bone growth and healing in bone grafts.
[0055] The present invention can be used to promote growth in bone
scaffolds and in conjunction with fenestration for bone ingrowth.
The bone scaffold feature can be a fenestration for bone ingrowth,
an elongated fenestration for bone growth, a slot fenestration for
bone growth, a lumen for bone ingrowth, or a combination thereof.
The bone implant can include a shape memory metal, an elastic
biocompatible metal, an elastic biocompatible polymer, or a
combination thereof.
[0056] In any of the present embodiment the composition may include
multiple active agents, prostacyclin, prostacyclin derivatives,
prostacyclin analogues, prostacyclin mimics, precursors of
prostacyclin compositions and the like. The additional bioactive
agents may include but not limited to, osteogenic or chondrogenic
proteins or peptides; demineralized bone powder; collagen,
insoluble collagen derivatives, etc., and soluble solids and/or
liquids dissolved therein; anti-AIDS substances; anti-cancer
substances; antimicrobials and/or antibiotics such as erythromycin,
bacitracin, neomycin, penicillin, polymycin B, tetracyclines,
biomycin, chloromycetin, and streptomycins, cefazolin, ampicillin,
azactam, tobramycin, clindamycin and gentamycin, etc.;
immunosuppressants; anti-viral substances such as substances
effective against hepatitis; enzyme inhibitors; hormones;
neurotoxins; opioids; hypnotics; anti-histamines; lubricants;
tranquilizers; anti-convulsants; muscle relaxants and
anti-Parkinson substances; anti-spasmodics and muscle contractants
including channel blockers; miotics and anti-cholinergics;
anti-glaucoma compounds; anti-parasite and/or anti-protozoal
compounds; modulators of cell-extracellular matrix interactions
including cell growth inhibitors and antiadhesion molecules;
vasodilating agents; inhibitors of DNA, RNA, or protein synthesis;
anti-hypertensives; analgesics; anti-pyretics; steroidal and
non-steroidal anti-inflammatory agents; anti-angiogenic factors;
angiogenic factors and polymeric carriers containing such factors;
anti-secretory factors; anticoagulants and/or antithrombotic
agents; local anesthetics; ophthalmics; prostaglandins;
anti-depressants; anti-psychotic substances; anti-emetics; imaging
agents; biocidal/biostatic sugars such as dextran, glucose, etc.;
amino acids; peptides; vitamins; inorganic elements; co-factors for
protein synthesis; endocrine tissue or tissue fragments;
synthesizers; enzymes such as alkaline phosphatase, collagenase,
peptidases, oxidases, etc.; polymer cell scaffolds with parenchymal
cells; collagen lattices; antigenic agents; cytoskeletal agents;
cartilage fragments; living cells such as chondrocytes, bone marrow
cells, mesenchymal stem cells; natural extracts; genetically
engineered living cells or otherwise modified living cells;
expanded or cultured cells; DNA delivered by plasmid, viral
vectors, or other means; tissue transplants; autogenous tissues
such as blood, serum, soft tissue, bone marrow, etc.; bioadhesives;
bone morphogenic proteins (BMPs); osteoinductive factor (IFO);
fibronectin (FN); endothelial cell growth factor (ECGF); vascular
endothelial growth factor (VEGF); cementum attachment extracts
(CAE); ketanserin; human growth hormone (HGH); animal growth
hormones; epidermal growth factor (EGF); interleukins, e.g.,
interleukin-1 (IL-1), interleukin-2 (IL-2); human alpha thrombin;
transforming growth factor (TGF-.beta.); insulin-like growth
factors (IGF-1, IGF-2); parathyroid hormone (PTH); platelet derived
growth factors (PDGF); fibroblast growth factors (FGF, BFGF, etc.);
periodontal ligament chemotactic factor (PDLGF); enamel matrix
proteins; growth and differentiation factors (GDF); hedgehog family
of proteins; protein receptor molecules; small peptides derived
from growth factors above; bone promoters; cytokines; somatotropin;
bone digesters; antitumor agents; cellular attractants and
attachment agents; immuno-suppressants; permeation enhancers, e.g.,
fatty acid esters such as laureate, myristate and stearate
monoesters of polyethylene glycol, enamine derivatives, alpha-keto
aldehydes, etc.; and nucleic acids.
[0057] Prostacyclin (commonly called
(Z)-5-[(4R,5R)-5-hydroxy-4-((S,E)-3-hydroxyoct-1-enyl)hexahydro-2H-cyclop-
enta[b]furan-2-ylidene]pentanoic acid, prostaglandin 12, or PGI2)
is a prostaglandin member of the family of lipid molecules known as
eicosanoids. It inhibits platelet activation and is also an
effective vasodilator.
##STR00001##
[0058] Examples of prostacyclin derivatives, prostacyclin
analogues, prostacyclin mimics, precursors of prostacyclin
compositions include but are not limited to carboprostacyclin;
(5E)-5-[(3aS,4R,5R,6aS)-5-hydroxy-4-[(E,3S)-3-hydroxyoct-1-enyl]-3,3a,4,5-
,6,6a-hexahydro-1H-pentalen-2-ylidene]pentanoic acid;
3-(3-carboxypropyl)-7-exo-(3-hydroxy-trans-1-octenyl)-8-endo-hydroxy-cis--
bicyclo[4,3,0]nona-2-ene;
3-(3-carboxypropyl)-7-exo-(3-hydroxy-4-methyl-trans-1-nonen-6-ynyl)-8-end-
o-hydroxy-cis-bicyclo[4,3,0]nona-2-ene;
3-(4-carboxybutyl)-7-exo-(3-hydroxy-trans-1-octenyl)-8-endo-hydroxy-cis-b-
icyclo[4,3,0]nona-2-ene;
3-(4-carboxybutyl)-7-exo-(3-hydroxy-4-methyl-trans-1-nonen-6-ynyl)-8-endo-
-hydroxy-cis-bicyclo[4,3,0]nona-2-ene;
3-(4-carboxy-1-butenyl)-7-exo-(3-hydroxy-trans-1-octenyl)-8-endo-hydroxy--
cis-bicyclo[4,3,0]nona-2-ene;
3-(4-carboxy-1-butenyl)-7-exo-(3-hydroxy-4-methyltrans-1-nonen-6-ynyl)-8--
endo-hydroxy-cis-bicyclo[4,3,0]nona-2-ene;
[3-(3-oxa-4-carboxybutyl)-7-exo-(3.alpha.-hydroxy-4,8-dimethyl-1-trans-oc-
ten-6-ynyl)-8-endo-hydroxy-cis-bicyclo[4,3,0]nona-2-ene];
[3-(2-oxa-4-carboxybutyl)-7-exo-(3.alpha.-hydroxy-4,
8-dimethyl-1-trans-octen-6-ynyl)-8-endo-hydroxy-cis-bicyclo[4,3,0]nona-2--
ene]; (9) [3-(4-carboxybutyl)-7-exo-(3.alpha.-hydroxy-4,
8-dimethyl-1-trans-octen-6-ynyl)-8-endo-hydroxy-cis-bicyclo[4,3,0]nona-3--
ene];
(5Z,13E)-(8R,9S,11R,12R,15S)-9,11-15-Triacetoxy-2-(2-oxazolin-2-yl)--
1-nor-5,13-prostadiene;
(5Z,13E)-(8R,9S,11R,12R,15S)-2-(2-Oxazolin-2-yl)-1-nor-5,13-prostadiene-9-
,11,15-triol;
(5Z,13E)-(8R,9S,11R,12R,15S)-2-(2-Oxazolin-2-yl)-1-nor-5,13-prostadiene-9-
,11,15-triol;
(5Z,13E)-(8R,9S,11R,12R,15S)-2-(2-Oxazolin-2-yl)-1-nor-5,13-prostadiene-9-
,11,15-triol;
(5Z,13E)-(8R,9S,11R,12R,15S)-2-(4,4-Dimethyl-2-oxazolin-2-yl)-1-nor-5,13--
prostadiene-9,11,15-triol;
(5Z,13E)-(8R,9S,11R,12R,15S)-2-(2-Thiazolin-2-yl)-1-nor-5,13-prostadiene--
9, 11,15-trio;
1-Decarboxy-2-(oxazolin-2-yl)-(5R,6R)-5-bromoprostaglandin-I.sub.1;
1-Decarboxy-2-(oxazolin-2-yl)prostaglandin-I.sub.2;
2-{4-{(E)-(1S,5S,6R,7R)-7-Hydroxy-6-[(E)-(3S,4RS)-3-hydroxy-4-methyloct-1-
-en-6-ynyl]bicyclo[3.3.0]octan-3-ylidene)}-butyl}-2-oxazoline;
2-{(E)-(1S,5R,6R)-7-Hydroxy-6-[(E)-(3S,4RS)-3-hydroxy-4-methyl-1-octenyl]-
-2-oxabicyclo[3.3.0]octan-3-ylidene}-5-(2-oxazolin-2-yl)pentanenitrile;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-acetoxy-1-octenyl)--
7.alpha.-acetoxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-hydroxy-1-octenyl)--
7.alpha.-hydroxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-trimethylsilyloxy-1-
-octenyl)-7.alpha.-trimethylsilyloxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-hydroxy-1-octenyl)--
7.alpha.-hydroxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-hydroxy-4(R,S)-meth-
yl-1-octenyl)-7.alpha.-hydroxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-hydroxy-4,4-dimethy-
l-1-octenyl)-7.alpha.-hydroxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-4-(2-oxazolin-2-yl)butyl]-6-(3.alpha.-hydroxy-4-methyl-6,-
7-tetradehydro-1-nonenyl)-7.alpha.-hydroxybicyclo-[3.3.0]octene-2;
2-Aza-3-{1-thia-4-[2-(5,6-dihydro-4H-1,3-oxazin-2-yl)]-butyl}-6-(3.alpha.-
-hydroxy-4-phenoxy-1-butenyl)-7.alpha.-hydroxybicyclo[3.3.0]octene-2;
2-Aza-3-[1-thia-3,3-difluoro-4-(2-thiazolin-2-yl)butyl]-6-(3.alpha.-hydro-
xy-5-phenyl-1-pentenyl)-7.alpha.-hydroxybicyclo[3.3.0]octene-2; and
2-Aza-3-[1-thia-4-(2-imidazolin-2-yl)butyl]-6-[3.alpha.-hydroxy-4-(3-chlo-
ro phenoxy)-1-butynyl]-7.alpha.-hydroxybicyclo[3.3.0]-octene-2.
[0059] Another embodiment of the present invention includes the
delivery of the prostacyclin composition locally and systemically
to increase the prostacyclin to stimulate bone formation, growth
and healing. In that embodiment the composition is provided locally
as stated herein and administered systemically. Systemically
administration may be parenterally, enterally, injected (including
intravenous (IV), intramuscular (IM), and subcutaneous (SC)
administration), topically or by intraarticular, intraosseous
infusion. Thus allowing both a systemic and local source of the
prostacyclin composition to stimulate bone formation, growth and
healing. For example, the prostacyclin composition may be applied
locally as a coating on an implant or in a polymer administered at
the fracture and systemically through administering an oral
prostacyclin composition or injected at the fracture as an
injectable prostacyclin composition.
[0060] Generally, the Wnt signaling pathways are a group of signal
transduction pathways made of proteins that pass signals from
outside of a cell through cell surface receptors to the inside of
the cell, e.g., the canonical Wnt pathway, the noncanonical planar
cell polarity pathway, and the noncanonical Wnt/calcium pathway.
These Wnt signaling pathways are activated by the binding of a
Wnt-protein ligand to a receptor, which passes the biological
signal to the protein inside the cell. Wnt signaling controls
include body axis patterning, cell fate specification, cell
proliferation, and cell migration. These processes are necessary
for proper formation of important tissues including bone, heart,
and muscle.
[0061] The balance between bone loss and deposition is important
for normal bone growth and remodeling, and depends on a complex
interplay between resident bone cells such as osteoclasts,
osteoblasts, and osteocytes whose activities are altered by several
regulatory molecules produced by such cells. Increased bone mass in
human patients and mice with inactivating mutations of the
sclerostin (SOST, Sost) gene whose product, a secreted
glycoprotein, functions by altering Wnt, bone morphogenetic protein
and other signaling pathways. Inactivating or activating mutations
of the LDL receptor related protein 5 are associated with altered
Wnt signaling in bone, and low or high bone mass, respectively.
Sclerostin also influences Wnt activity in osteocytes in an
autocrine manner, and by doing so, alters the production of
prostacyclin (PGI.sub.2), a cyclic prostanoid, previously known to
be active in vascular tissues.
[0062] FIGS. 1A-C show prostaglandin concentrations, mRNAs for
prostaglandin synthases, and prostacyclin synthase in osteocytes in
extracts of bones, or decalcified bone sections from Sost WT or KO
mice. Specifically, FIG. 1A shows concentrations of 6-keto
PGF.sub.1.alpha., the stable metabolite of PGI.sub.2, or
prostacyclin, is elevated in extracts of bone from Sost KO mice
compared to extracts from WT mice. Concentrations of PGE.sub.2,
PGD.sub.2, TXB.sub.2, the stable metabolite of TXA.sub.2, and
PGF.sub.2.alpha. are similar in KO and WT mouse bone extracts. FIG.
1B shows concentrations of mRNA transcripts for the PG synthases,
Ptgis, Ptges, and Tbxas1 show an elevation in Ptgis and little
change in the other PG synthases. FIG. 1C shows Immunohistochemical
detection of Ptgis in decalcified bone from Sost WT (upper panels)
and Sost KO mice showing enhanced staining in KO mouse bone.
[0063] Arachadonic acid (AA) the precursor to prostaglandins is
converted via the cyclooxygenase pathway and the activity of
cyclooxygenase 1 and 2 to prostaglandin PGG.sub.2 and subsequently
PGH.sub.2. The latter is converted to PGI.sub.2, PGD.sub.2,
PGE.sub.2, PGF.sub.2 and thromboxane A.sub.2 by specific synthases;
PGF.sub.2 is also produced from PGE.sub.2 directly. We measured
concentrations of prostaglandins formed from prostaglandin H.sub.2
and the concentrations of messenger RNAs of key enzymes in the
prostaglandin synthetic pathway from intact bone tissue, mixed
osteocytes, and clonal populations of osteocytes from Sost knockout
(KO) or wild-type (WT) mice. In bone extracts, higher
concentrations of 6-keto PGF.sub.1.alpha., the stable metabolite of
PGI.sub.2, were detected in femoral bones from Sost KO mice
compared with those measured in wild-type (WT) mice, P=0.022 (FIG.
1A). Concentrations of PGE.sub.2, PGD.sub.2, TXB.sub.2 (the stable
metabolite of TXA.sub.2) and PGF.sub.2, were similar in Sost KO and
WT mice. The messenger RNA for the enzyme, PGI.sub.2 synthase
(Ptgis), was elevated in Sost KO mice compared with that measured
in WT mice, P=0.007 (FIG. 1B). Messenger RNAs for PGE.sub.2
synthase (Ptges) and thromboxane A synthase 1 (Tbxas1) were similar
in Sost KO and WT mice. The increase in prostacyclin concentrations
and Ptgis mRNA was confirmed by an increase in prostacyclin
synthase (Ptgis) protein detected via immunohistochemistry in
osteocytes of bones from Sost KO mice relative to osteocytes of
bones from WT mice (FIG. 1C, lower right panel). Western blot
analysis with Ptgis antibody showed a 57,000 kD band consistent
with Ptgis protein. The data are consistent with increased
prostacyclin production in bones from Sost KO mice. Urinary
concentrations of 6-keto PGF.sub.1.alpha., PGE.sub.2, PGD.sub.2,
PGF.sub.2, and TBXB.sub.2 were similar in Sost KO and WT mice,
reflecting the rapid metabolism of prostanoids produced in bone.
These data support the well-known autocrine and/or paracrine role
of prostaglandins in the regulation of cellular activities. FIG. 2
shows urinary prostaglandins in Sost KO and WT mice. Mice were kept
in glass metabolic cages for 24 hours and urine was collected under
mineral oil. Prostaglandins were measured using EIA as noted in the
methods.
[0064] The site of sclerostin synthesis (osteocytes) was isolated
and prostanoids were measured. Elevations in concentrations of
6-keto PGF.sub.1.alpha. were noted in primary osteocytes isolated
from bone of Sost KO mice (93.68.+-.23.39 pg 6-keto
PGF.sub.1.alpha./mg protein KO osteocytes vs. 31.24.+-.8.44 pg
6-keto PGF.sub.1.alpha./mg protein WT osteocytes, P=0.024), whereas
PGE.sub.2 concentrations were similar (1.52.+-.0.37 pg PGE.sub.2/mg
protein KO osteocytes vs. 1.936.+-.0.47 pg PGE.sub.2/mg protein WT
osteocytes, P=0.52). To further assess the production of PG in bone
we immortalized osteocytes, and examined prostaglandin metabolite
concentrations in mixed and clonal populations of such cells. In
mixed populations of immortalized osteocytes derived from Sost KO
mice and WT mice concentrations of 6-keto PGF.sub.1.alpha. were
increased in Sost KO mice osteocytes compared to WT osteocytes
(2823.509.+-.485.643 pg/mL KO vs. 163.410.+-.10.486 pg/mL WT,
P=0.005), whereas PGE.sub.2 concentrations were similar. These
changes are mirrored in the amounts of mRNA for the respective
synthetic enzymes.
[0065] Prostaglandin production in clonal populations of Sost KO OC
clone 8 and Sost WT osteocytes clone 12 displayed the phenotype
characteristic of osteocytes with several dendritic cell extensions
and staining for podoplanin (E11/GP38). FIG. 3A shows a phase
contrast microscopy image of Sost WT (left) and KO (right)
osteocytes. Note dendritic extensions on cells. FIG. 3B shows
immunostaining using an antibody directed against podoplanin (E11)
in Sost WT (left) and KO (right) osteocytes. FIG. 3C shows RT-PCR
products in RNA derived from Sost WT (left) and KO (right)
osteocytes. Specific PCR primers described below and size of the
predicted product in BP is also indicated below.
TABLE-US-00001 GENE mRNA PCR PRIMERS PRODUCT GENBANK SYMBOL
DESCRIPTION (5' TO 3') (BP) REFERENCE Dkk1 Mus musculus SEQ ID NO:
1 LEFT: (94 bp) NM_010051.3 dickkopf ccgggaactactgcaaaaat homolog 1
SEQ ID NO: 2 RIGHT: (Xenopus laevis) ccaaggttttcaatgatgctt Dmp1 Mus
musculus SEQ ID NO: 3 LEFT: (66 bp) NM_016779.2 dentin matrix
ggttttgaccttgtgggaaa protein 1 SEQ ID NO: 4 RIGHT:
catattgggatgcgattcct Fgf23 Mus musculus SEQ ID NO: 5 LEFT: (72 bp)
NM_022657.3 fibroblast growth tatggatctccacggcaac factor 23 SEQ ID
NO: 6 RIGHT: gtccactggcggaacttg Phex Mus musculus SEQ ID NO: 7
LEFT: (65 bp) NM_011077.2 phosphate ctgccagagaacaagtgcaa regulating
gene SEQ ID NO: 8 RIGHT: with homologies aatggcaccattgaccctaa to
endopeptidases on the X chromosome Pdpn Mus musculus SEQ ID NO: 9
LEFT: (95 bp) NM_010329.2 podoplanin/E11 cagtgttgttctgggttttgg SEQ
ID NO: 10 RIGHT: acctggggtcacaatatcatct Runx2 Mus musculus SEQ ID
NO: 11 LEFT: (96 bp) NM_001146038.1 runt related
cgtgtcagcaaagcttctttt transcription SEQ ID NO: 12 RIGHT: factor 2
(Runx2), ggctcacgtcgctcatct transcript variant 1 Sost Mus musculus
SEQ ID NO: 13 LEFT: (94 bp) NM_024449.5 sclerostin
tcctgagaacaaccagacca SEQ ID NO: 14 RIGHT: gcagctgtactcggacacatc Sp7
Mus musculus SEQ ID NO: 15 LEFT: (66 bp) NM_130458.3 Sp7
transcription tgcttcccaatcctatttgc factor 7 (Osterix) SEQ ID NO: 16
RIGHT: agctcagggggaatcgag
[0066] The osteocyte lines expressed messenger RNAs characteristic
of cells of the osteocyte lineage such as, Dmp1, Fgf23, Phex,
podoplanin/E11, and Sost (Sost only in WT line). Other expressed
RNAs included Runx2, Dkk1, and osterix. Prostaglandins in the cell
culture media of these cells showed an great increase in 6-keto
PGF.sub.1.alpha. (3302.411.+-.27.968 ng/mL KO OC clone 8 vs. WT
clone 12, 178.889.+-.66.486 ng/mL WT, P<0.001), whereas
PGE.sub.2 concentrations were slightly but statistically higher in
Sost KO OC clone 8 osteocytes (1298.9.+-.43.3 pg PGE.sub.2/mL KO OC
clone 8 osteocytes vs. 1093.2.+-.31.2 pg PGE.sub.2/mL WT clone 12
osteocytes, P=0.003). Analysis of mRNAs for synthetic enzymes in
the PG pathway.
[0067] FIGS. 4A-4B shows mRNA transcripts for prostaglandin
synthases, Ptgis, Ptges, Ptgds, Tbxas1, Cox1, Cox 2, Pla2g4a,
Plcl2, and Plcd1 were measured in clonal Sost KO and WT osteocytes.
Ptgis protein was measured in lystes of WT and KO osteocytes. FIG.
4A shows prostglandin synthase transcript levels expressed as a
ratio of amount observed in KO/WT cells. Note that Ptgis
transcripts are increased >400-fold. FIG. 4B shows Ptgis protein
is greatly increased in KO osteocytes (right 4 lanes). The protein
is barely detected in WT cells.
[0068] FIGS. 5A-5F shows Enhanced b-catenin and
b-catenin-associated transcription is present in clonal osteocytes
from Sost KO mice. FIG. 5A upper panel is an immunoblot of cellular
protein from WT (right 4 lanes in panel) and KO (left 4 lanes in
panel) clonal osteocytes with total b-catenin specific antibody.
b-Actin was used to correct for sample loading differences in
lanes. FIG. 5A lower panel is an immunoblot of cellular protein
from WT (right 4 lanes in panel) and KO (left 4 lanes in panel)
clonal osteocytes with non-phosphorylated (active) b-catenin
specific antibody. b-Actin was used to correct for sample loading
differences in lanes. FIG. 5B is an assessment of b-catenin
transcript levels in WT and KO osteocytes. FIG. 5C shows b-catenin
immunofluorescence (IF, red) in WT osteocyte. The nucleus of the
cell is stained blue. FIG. 5D shows b-catenin IF (red) in WT
osteocyte. The nucleus of the cell is stained blue. FIG. 5E panels
1-5 show localization of b-catenin (red, panel 4) and LEF (green,
panel 5) in the nucleus of a clonal Sost WT osteocyte. In panel 2
and 3, co-localization of b-catenin and LEF are shown. FIG. 5F
panels 1-5 show, localization of b-catenin (red, panel 4) and LEF
(green, panel 5) in the nucleus of a clonal Sost KO osteocyte. In
panel 2 and 3, co-localization of b-catenin and LEF are shown. More
intense IF is noted in the clonal KO than in the WT clonal
osteocytes. This is especially apparent in panels F3 vs. E3.
Sclerostin is thought to function in osteoblasts by activating Wnt
signaling. The amount of .beta.-catenin present in Sost KO OC clone
8 and Sost WT OC clone 12 was determined. As shown in FIG. 5A and
FIG. 5B, total .beta.-catenin was increased 583%, and
non-phosphorylated active .beta.-catenin was increased 872% in Sost
KO OC clone 8 vs. Sost WT OC clone 12 (P<0.001 and P=0.013,
respectively). There was an increase in mRNA for .beta.-catenin in
Sost KO OC clone 8 when compared to Sost WT OC clone 12 (215%
increase, P<0.001). This was associated with an increase in
.beta.-catenin present in euchromatin of Sost KO OC clone 8 (FIG.
5C) when compared to Sost WT OC clone 12 (FIG. 5B). The nuclear
.beta.-catenin co-localized with LEF over areas of euchromatin in
Sost KO OC clone 8 (FIG. 5D) and Sost WT OC clone 12 (FIG. 5D). In
FIG. 5E, panels 1 and 4, the localization of .beta.-catenin in the
nucleus of a clonal Sost WT osteocyte, and in FIG. 5F, panels 1 and
4, localization of .beta.-catenin in the nucleus of a clonal Sost
KO osteocyte is shown (red color). It is apparent that there is a
greater amount of .beta.-catenin localized in the nucleus of the
representative clonal Sost KO osteocyte compared with the amount of
.beta.-catenin seen in the nucleus of the clonal Sost WT osteocyte.
In FIG. 5F, panel 5, localization of LEF in the nucleus of the same
Sost WT OC osteocyte shown in panels 1 and 4, is shown (green
color). It is apparent that LEF is virtually absent in the nucleus
of the Sost WT OC osteocyte, whereas it is readily observed in the
nucleus of the Sost KO osteocyte. FIG. 5E, panel 2, and panel 3,
and FIG. 5F, panel 2, and panel 3, show merged images of
.beta.-catenin and LEF at low and high resolution in the nucleus of
previously imaged Sost WT and Sost KO osteocytes. Because of a
paucity of LEF nuclear localization in the imaged Sost WT
osteocyte, no yellow-orange color is noted over areas of 3-catenin
immunostaining. On the contrary, because of the presence of
increased amounts of LEF and .beta.-catenin in the nucleus of the
Sost KO osteocyte, the merged images clearly show yellow-orange
areas were both proteins co-localize.
[0069] FIGS. 6A and 6B show ChIP analysis of the Lef1 sites of Sost
WT OC clone 12 and Sost KO OC clone 8. FIG. 6A shows total percent
input of both clones, as well as associated mouse IgG controls.
FIG. 6 A shows percent Lef1 input of each clone normalized against
its associated mouse IgG control counterpart. .beta.-Catenin
increases the amount of LEF localized on genes activated by Wnt
signaling through the binding of LEF to specific binding sites on
the DNA of activated genes. We performed chromatin
immunoprecipitation experiments using Sost KO OC clone 8 and Sost
WT OC clone 12, and a specific antibody against LEF, to localize
LEF binding sites on the Ptgis gene. Mouse IgG was used as a
control antibody. An LEF-binding site was found using in silico
analysis at -1234 bp to -4567 bp on the Ptgis gene promoter. The
intensity of the PCR band using specific primers upstream and
downstream from this site (FIG. 6A) generated in CHIP experiments
performed with Sost KO OC clone 8 was greater than those generated
with Sost WT OC clone 12. These data are consistent with increased
occupancy of promoter binding sites by LEF in Sost KO osteocytes.
To assess whether there was an increase in .beta.-catenin binding
to LEF at the above noted DNA site, we used an activated
.beta.-catenin antibody to perform CHIP analysis with identical PCR
primers. Increased amounts of the PCR product were seen when CHIP
analysis was performed with a .beta.-catenin antibody and the Sost
KO OC clone 8 compared to Sost WT OC clone 12.
[0070] FIGS. 7A and 7B show inhibition of Wnt secretion with C-59
reduces intra-cellular activated .beta.-catenin concentrations and
6-keto PGF.sub.1.alpha. concentrations. FIG. 7A shows Activated
.beta.-catenin was measured in Sost KO clonal osteocytes treated
with C-59 or vehicle for 48 h. FIG. 7B shows Sost KO clonal
osteocytes were treated with C-59 and 48 h later, 6-keto
PGF.sub.1.alpha. was measured in culture medium. KO OC clone 8
cells were treated with a Wnt inhibitor, C-59
(2-(4-(2-methylpyridin-4-yl)phenyl)-N-(4(pyridine-3-yl)phenyl)acetamide)
to assess the functional importance of .beta.-catenin signaling in
sclerostin-mediated increases in PGI.sub.2 synthesis. Following
treatment of cells with C59 for 48 hours there was a statistically
significant decrease in .beta.-catenin protein concentration in
cells KO OC 8 cells, P<0.05 (FIG. 7A). There a concomitant
decrease in 6-keto PGF.sub.1.alpha. (536.409.+-.60.690 pg/mL C59 vs
274.964.+-.6.006 pg/mL vehicle, P=0.012) (FIG. 7B). Treatment with
a BMP receptor inhibitor (LDN) failed to change 6-keto
PGF.sub.1.alpha. concentrations.
[0071] All animal research was conducted according to National
Institutes of Health and the Institute of Laboratory Animal
Resources, National Research Council guidelines. The Mayo Clinic
Institutional Animal Care and Use Committee approved all animal
studies. Isolation of Osteocytes from Mouse Femurs: Osteocytes were
isolated from Sost KO and WT mice as described by Stern et. al.
Briefly, intact femurs were aseptically isolated from
eight-week-old Sost KO and WT mice. Soft tissues were removed,
epiphyses were trimmed and discarded, marrow was flushed from the
diaphysis with ice-cold isotonic saline, and the remaining bone was
trimmed into 1 mm pieces. Bone pieces were sequentially digested by
nine alternating treatments of Type 1A collagenase solution (300
AU/mL dissolved in .alpha.-Minimal Essential Medium (.alpha.-MEM))
and EDTA solution (5 mM EDTA in magnesium and calcium-free
Dulbecco's Phosphate Buffered Solution (DPBS)). After the final
digestion, bone pieces were placed in 6-well, collagen-treated
dishes (BioCoat.RTM., Becton Dickinson) with normal growth medium
(.alpha.-MEM, 8% fetal bovine serum (FBS), 2% calf serum (CS), and
1% penicillin and streptomycin (Life Technologies)), and left
undisturbed for 48 hours. Bone pieces were then removed to a
separate 6-well, collagen-treated plate with growth medium for an
additional 48 hours. After this this incubation, cells that
migrated from bone fragments were studied for osteocytic
characterization. Primary isolated osteocytes were grown at
37.degree. C., 5% CO.sub.2, in normal growth medium.
[0072] To immortalize the osteocytes, an SV40 T antigen viral
construct was obtained from PA317 cell supernatants. One mL of
viral supernatant was added to a 35-mm dish with 2 ml of growth
medium (.alpha.-MEM, 8% FBS, 2% CS, 1% P/S), and Polybrene was
added to a concentration of 4 mg/ml. The virus-containing medium
was left on the cells for 48 h at 34.degree. C., 5% CO.sub.2
atmosphere. The medium was then changed to growth medium containing
300 .mu.g/ml G418 for cell selection. Cells that survived after
three weeks in selection medium were assumed to have taken up the
viral DNA. Immortalized osteocytes were grown at 34.degree. C., 5%
CO.sub.2, in normal growth medium. Clonal populations of osteocytes
from Sost KO and WT mice were generated via dilution cloning.
[0073] Preparation of Decalcified Bone for Immunohistochemistry:
Femurs were decalcified for 7 days in 15% EDTA. Decalcified
diaphyseal segments were embedded in paraffin and sectioned
longitudinally to a thickness of 5 microns. Immunohistochemistry
was performed with antibodies to prostaglandin I.sub.2 synthase
(Cayman Chemical 100023, 1:50 dilution), or an IgG isotype control
(Vector Laboratories 1-1000). Chromogens were developed using a
polyvalent mouse and rabbit specific secondary HRP detection kit
(Abcam, ab93697), followed by incubation in 3,3-diaminobenzidine
(DAB) (Sigma Aldrich, D5905). Sections were counterstained with
fast green.
[0074] All prostaglandin metabolite measurements were performed by
enzyme immunoassay (EIA) using kits from Cayman Chemical (Ann
Arbor, Mich.). 6-Keto prostaglandin F1.alpha. (Catalog Number
515211), prostaglandin E.sub.2 (Catalog Number 514010),
Prostaglandin E Metabolite (Catalog Number 514531), prostaglandin
F.sub.2.alpha. (Catalog Number 516011), prostaglandin D.sub.2
(Catalog Number 512031), and thromboxane B.sub.2 (Catalog Number
519031) were all performed according to kit instructions. Culture
medium was diluted 1:2 in supplied buffer for each metabolite
measurement, solubilized bone proteins were diluted 1:100 in
supplied buffer for each metabolite measurement, and urine was
diluted 1:500 in supplied buffer for each metabolite
measurement.
[0075] Isolation of Media for Prostaglandin Measurements: For
culture medium studies, 0.2.times.10.sup.6 osteocytes from
wild-type and sclerostin knock-out mice were seeded in wells of a
collagen-treated 6-well BioCoat.RTM. culture dish (Becton
Dickinson, Catalog Number 354400), and culture medium was collected
after 48 hours, as cells reached near confluence. Isolated
osteocyte culture medium was centrifuged at 100.times.g, diluted
1:2 in supplied buffer, and used according to manufacturer's
instructions for prostaglandin measurement. Media from wild-type
and Sost knock-out osteocytes was either compared directly, or
normalized against a protein measurement (BCA) measured from total
protein in each well of a 6-well culture plate.
[0076] Intact femurs were isolated from eight-week-old WT and Sost
KO mice. After removal of epiphyses, each diaphysis was flushed
with ice-cold, isotonic saline to remove marrow. De-marrowed
diaphyses were weighed, snap-frozen in liquid nitrogen, ground to a
powder using a mortar and pestle, and re-weighed. Frozen bone
powder from each femur was re-suspended in 500 .mu.L of modified
RIPA Buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.25%
deoxycholate, 1 mM EDTA, mini-Complete Protease Inhibitor (Roche)),
sonicated, and centrifuged at 14,000.times.g. The supernatant was
isolated and used for prostaglandin measurements.
[0077] Eight-week-old male WT and Sost KO mice were placed in
siliconized glass metabolic cages for 24 hours. Water was provided
ad libitum, food was withheld, and a standard day/night cycle was
maintained. Urine was collected under a layer of mineral oil to
prevent evaporation. Urine creatinine was measured immediately upon
collection on an ABX Horiba Pentra 400 (Horiba Medical), and snap
frozen in liquid nitrogen prior to prostaglandin metabolite
measurement.
[0078] WT and Sost KO osteocytes were grown on 12-well, collagen
treated, glass bottom plates (MatTek Corporation). Upon near
confluence, cells were fixed in 4% PFA for 10 minutes, washed in
PBS, and blocked in 10% goat serum in PBS for 45 minutes. Primary
antibody was then added ((podoplanin (8.1.1, Catalog Number
sc-53533), Santa Cruz Biotechnology, Inc., 1:50 dilution in
blocking buffer (3% goat serum in PBS)), (LEF-1 (N-17, Catalog
Number 8591), Santa Cruz Biotechnology Inc., 1:50 dilution in
blocking buffer), (.beta.-Catenin (Catalog Number 9562S), Cell
Signaling Technologies, 1:1000 dilution in blocking buffer)
overnight at 4.degree. C. while gently shaking. After several PBS
washes, secondary antibody was added (for podoplanin (Alexa Fluor
488-labeled goat anti-hamster IgG (Life Technologies), 1:200
dilution in blocking buffer), for LEF-1 (Alexa Fluor 488-labeled
donkey anti-goat IgG (Life Technologies), 1:200 dilution in
blocking buffer), for .beta.-Catenin (AlexaFluor 594-labeled goat
anti-rabbit IgG (Life Technologies), 1:200 dilution in blocking
buffer)) for 1 hour at room temperature, with gentle agitation.
Cells were then washed several times in PBS, and counterstained
with Vectashield Hard Set Mounting Medium with DAPI
(4',6-diamidino-2-phenylindole, Vector Laboratories).
[0079] Wells in a 6-well collagen treated plate were seeded with
0.2.times.10.sup.6 sclerostin knock-out osteocytes (Clone KO8).
After 48 hours, normal growth medium was removed, and cells were
rinsed with PBS. Serum-free media was then added (.alpha.-MEM, 1%
P/S) to the osteocytes as was well as either 100 nM of the small
molecule Wnt inhibitor, C59
(2-(4-(2-methylpyridin-4-yl)phenyl)-N-(4-(pyridine-3-yl)phenyl)
acetamide), or a vehicle control. After a 48 hour incubation, media
was harvested from both vehicle and experimental wells and assayed
for 6-keto prostaglandin F.sub.1.alpha..
[0080] Cell lysates from 6- or 12-well plates were prepared by
scraping cells in lysis buffer (0.1% SDS, 150 mM NaCl, 2 mM sodium
vanadate, 0.5% sodium deoxycholate, 1% NP-40 50 mM Tris pH 8.2, 1
mM EDTA with one mini-complete protease inhibitor cocktail
EDTA-free tab (Roche Diagnostics, Indianapolis, Ind.)) per 7 ml
lysis solution or by direct addition of 1.times.SDS sample
containing 5 mM EDTA and protease inhibitor as above. Protein was
also prepared from RNA/Protein column flow-through by precipitation
and resuspension in protein solubilization buffer-trichloro ethyl
phosphine (PSB-TCEP), and protein was assayed using a
trichloroacetic acid precipitation turbidity assay, bovine serum
albumin (BSA) standard (Thermo Fisher Scientific, Waltham, Mass.)
from the RNA/protein kit (Clontech) and with reagents supplied with
the RNA/Protein kits (Clontech). Cell lysates were combined with
4.times.SDS sample buffer (25 mM Tris base, 20%
beta-mercaptoethanol, 40% glycerol 8% sodium dodecyl sulfate, 0.04%
bromophenol blue), heated to 100.degree. C. for 5 min before
loading to SDS-PAGE gels. One to five microgram protein/well or
pre-stained low molecular weight standard, were loaded to
mini-protean TGX any KD 15% polyacrylamide gels (Bio-Rad Hercules,
Calif.). Gels were soaked in transfer buffer (25 mM Tris, 192 mM
glycine, 20% methanol) for 10 min and proteins were transferred
electrophoretically to polyvinylidene difluoride (PVDF) membrane
(Bio-Rad). Before immunoblotting, membranes were blocked with 1%
blocking reagent (Roche Diagnostics) in TBST (50 mM Tris, 150 mM
NaCl, pH 7.5 with 0.05% Tween 20) for 1 h at room temperature.
Membranes were probed with primary antibodies in 5% BSA, TBST:
1:1000 dilutions of non-phospho (active .beta.-catenin)
.beta.-catenin (Ser33/37/Thr41) (D13A1) rabbit mAb (#8814),
.beta.-catenin (total .beta.-catenin) antibody (#9562),
phospho-.beta.-catenin (Ser33/37/Thr41) antibody (#9561) (Cell
Signaling Technology, Inc. Danvers, Mass.) antibody, or 1:1500
dilution prostaglandin I synthase (PGIS) (prostacyclin synthase)
polyclonal antibody made in rabbit (Cayman Chemical Co. Ann Arbor,
Mich.). After washing 1.times.10 min. with TBST, 1:2000 dilution
horseradish peroxidase labeled goat anti-rabbit secondary antibody
in 0.5.times.Roche block/TBST was applied for 1 hr (DAKO,
Carpinteria, Calif.). Podoplanin (1:200 dilution) antibody
(#sc-53533 Santa Cruz Biotechnology, Dallas, Tex.) was used with
1:2000 dilution anti-Syrian hamster IgG-horseradish peroxidase
secondary antibody (#sc-2493 Santa Cruz Biotechnology). After
washing 3.times.15 min with TBST blots were visualized using
chemiluminescent substrate (Roche Diagnostics). PVDF membranes were
washed 2.times.15 min at room temperature with stripping buffer
(mild strip buffer (0.2 M glycine, 0.1% SDS, 1% tween 20, pH 2.2)
followed by washing 2.times.10 min with PBS then 2.times.10 min
with TBST, or Restore western blot stripping buffer
(ThermoScientific/Pierce, Waltham, Mass.) and TBST washes or (harsh
strip buffer) 50 min. at 50.degree. C. in 2% SDS, 62.5 mM Tris pH
6.8, 114 mM 3-mercaptoethanol) followed by 1-2 hr wash in running
water, then TBST. Membranes were re-blocked and probed using
.beta.-actin monoclonal antibody (I2E5) (#4970P Cell Signaling
Technologies) in order to normalize lanes for protein loading, or
probed with other primary antibodies.
[0081] Reverse transcription of isolated RNAs was carried out using
oligo(dT) primers and SUPERSCRIPT.RTM. III First-Strand Synthesis
System for RT-PCR. (Life Technologies, Grand Island, N.Y.) using a
Perkin Elmer Cetus DNA Thermalcycler 480 (Norwalk, Conn.). PCR for
osteocyte markers was carried out on T Professional thermocycler
(Biometra GmbH, Gottingen, Germany) using platinum TAQ polymerase
(Life Technologies, Grand Island, N.Y.). 20 .mu.l aliquots of 50
.mu.l PCR reactions were electrophoresed on 4% agarose, 1.times.TAE
(Tris-acetate-EDTA buffer: 40 mM Tris, 20 mM acetic acid, and 2 mM
EDTA) gels, with 1.times.TAE. Gels were stained by immersion in
1.times.TAE containing 0.5 .mu.g/ml ethidium bromide and imaged
using a Gel Doc EZ Imaging System with Image Lab software
(Bio-Rad). Gels were also imaged after subsequently being destained
in 1.times.TAE without ethidium bromide.
[0082] RNA was prepared using RNA/protein spin columns (Clontech
Laboratories, Mountain View, Calif.). Lysis solution was added to
live cells in 6- or 24-well plates, frozen cell pellets or frozen
bone powder, prepared as detailed above. Lysates were passed
through 21- and 27-gauge needles to lyse tissues and to reduce
viscosity before being applied to a spin filter. Individual
clarified lysates were applied to RNA spin columns for
purification. RNA eluted into nuclease-free water was characterized
by UV absorbance (absorbance 260 nm/280 nm ratio), quantitated and
immediately frozen at -80.degree. C.
[0083] Quantitative PCR: qPCR was carried out using a Roche
LightCycler 480 QPCR apparatus in 96-well white QPCR plates and
using Lightcycler 480 SYBR Green Master I (Roche Diagnostics Corp.,
Indianapolis, Ind.). Intron-spanning qPCR primer pairs for mouse
genes were planned using the Universal Probe Library Assay Design
Center (Roche Diagnostics Corporation). QPCR primers are listed
below.
TABLE-US-00002 GENE mRNA PCR PRIMERS PRODUCT GENBANK SYMBOL
DESCRIPTION (5' TO 3') (BP) REFERENCE Alox5 Mus musculus SEQ ID NO:
17 LEFT: (75 BP) NM_009662.2 arachidonate 5- aggcacggcaaaaacagtat
lipoxygenase SEQ ID NO: 18 RIGHT: tgtggcatttggcatcaata Alox5ap Mus
musculus SEQ ID NO: 19 LEFT: (94 BP) NM_009663.1 arachidonate 5-
catgaaagcaaggcgcata lipoxygenase SEQ ID NO: 20 RIGHT: activating
protein catctacgcagttctggttgg Axin2 Mus musculus SEQ ID NO: 21
LEFT: (59 bp) NM_015732.4 axin2 cgccaccaagacctacatacg SEQ ID NO: 22
RIGHT: acatgaccgagccgatctgt Ptgs1 Mus musculus SEQ ID NO: 23 LEFT:
(70 BP) NM_008969.3 prostaglandin- cctctttccaggagctcaca
endoperoxide SEQ ID NO: 24 RIGHT: synthase 1 tcgatgtcaccgtacagctc
(COX-1) Ptgs2 Mus musculus SEQ ID NO: 25 LEFT: (75 BP) NM_011198.3
prostaglandin- gatgctcttccgagctgtg endoperoxide SEQ ID NO: 26
RIGHT: synthase 2 ggattggaacagcaaggattt (COX-2) Ctnnb1 Mus musculus
SEQ ID NO: 27 LEFT: (77 bp) NM_001165902.1 catenin (cadherin
tgcagatcttggactggaca associated SEQ ID NO: 28 RIGHT: protein), beta
1, aagaacggtagctgggatca transcript variant 2 Pla2g12a Mus musculus
SEQ ID NO: 29 LEFT: (108 bp) NM_023196.3 phospholipase
gactgtgacgaggagttccag A2, group XIIA, SEQ ID NO: 30 RIGHT:
transcript variant gagctccaccgttgtctcac 1 Pla2g4a Mus musculus SEQ
ID NO: 31 LEFT: (65 bp) NM_008869.3 phospholipase
gtgaggggctttattccaca A2, group IVA SEQ ID NO: 32 RIGHT: (cytosolic,
gaaacccccacctgaacc calcium- dependent) Plcd1 Mus musculus SEQ ID
NO: 33 LEFT: (62 BP) NM_019676.2 phospholipase C,
ccaactacagtcccgtggag delta 1 SEQ ID NO: 34 RIGHT:
ttggaagttcagagccacaa Plc12 Mus musculus SEQ ID NO: 35 LEFT: (75 BP)
NM_013880.3 phospholipase C- cgctgtgtatgaaaagatcgtg like 2 SEQ ID
NO: 36 RIGHT: gtgcctatgctgtgcaagtg Ptgds Mus musculus SEQ ID NO: 37
LEFT: (76 BP) NM_008963 .2 prostaglandin D2 ggctcctggacactacaccta
synthase (brain) SEQ ID NO: 38 RIGHT: atagttggcctccaccactg Ptges
Mus musculus SEQ ID NO: 39 LEFT: (101 BP) NM_022415.3 prostaglandin
E gcacactgctggtcatcaag synthase SEQ ID NO: 40 RIGHT:
acgtttcagcgcatcctc Ptgis Mus musculus SEQ ID NO: 41 LEFT: (92 BP)
NM_008968.3 prostaglandin I2 atgccatcaacagcatcaaa (prostacyclin)
SEQ ID NO: 42 RIGHT: synthase aaactcaggaacctctgtgtcc Rp113a Mus
musculus SEQ ID NO: 43 LEFT: (95 BP) NM_009438.5 ribosomal protein
ccctccaccctatgacaaga L13A SEQ ID NO: 44 RIGHT: gccccaggtaagcaaactt
Tbxas1 Mus musculus SEQ ID NO: 45 LEFT: (80 BP) NM_011539.3
thromboxane A ggatgtacccaccagctttc synthase 1, SEQ ID NO: 46 RIGHT:
platelet acctgcagggatacgttgtc
[0084] A SuperscriptIII RT-PCR kit (Life Technologies, Inc. Grand
Island, N.Y.) was used to generate template DNA from RNA. Reverse
transcribed Superscript III product was used to generate PCR
products with each primer pair. Product was used to generate
standard QPCR curves by serial dilution of template in each QPCR
plate. QPCR data were quantitated against murine Rpl13a run for
each primer pair, using software supplied with the instrument.
[0085] Chromatin Immunoprecipitation (ChIP) Assays: ChIP assays
were performed on primary osteocytes isolated from Sost.sup.+/+ and
Sost.sup.-/- animals. Briefly, cells were treated with formaldehyde
to cross-link protein and DNA complexes and sonicated to shear the
chromatin. Immunoprecipitations were performed with 2 .mu.g of
antibodies specific for Lef1 or an isotype-matched IgG control
(17-604, Millipore). Purified DNA was added to PCRs containing
primers (SEQ ID NO: 47 5'-GCACTGAGACACGGGAAGA-3' and SEQ ID NO: 48
5'-GTCTCTGCCTCCCAAGCTC-3') that flanked the putative Lef1 binding
site identified in the Ptgis promoter (SEQ ID NO: 49
5'-CCTTTGAT-3', beginning 1860 bp upstream of the translational
initiation codon). ChIP DNA was measured by real-time PCR, with
threshold values normalized to input DNA and the isotype control
immunoprecipitation.
TABLE-US-00003 Gene WT Gene/RPL13 SE KO Gene/RPL13 SE KO/WT p value
n Fold Change (KO/WT) qPCR Analasis, Sost Osteocytes Mixed
Population PTGIS 1.0689 0.0216 107.2421 2.2501 Up <0.001 9
100.3265 PTGES 0.1716 0.0012 0.2838 0.0125 Up <0.001 6 1.6540
qPCR Analasis, Sost Osteocytes KO#8 and WT#12 PTGIS 0.0022 0.0004
0.9057 0.0142 Up <0.001 12 405.4795 PTGES 0.0791 0.0227 1.0554
0.0499 Up <0.001 7 13.3477 PLCD1 0.2605 0.0024 0.9866 0.0136 Up
<0.001 12 3.7876 AXIN2 0.1249 0.0075 0.7388 0.0476 Up <0.001
12 5.9146 PTGDS 2.3996 0.0979 3.5101 0.1778 Up <0.001 6 1.4628
COX1 3.9415 0.1339 1.0434 0.0501 Down <0.001 12 0.2647 COX2
4.5692 0.1465 1.2894 0.1015 Down <0.001 12 0.2822 PLA2G12A
1.0296 0.0100 1.0035 0.0094 X 0.0703 12 0.9747 PLA2G4A 1.8023
0.0116 0.9881 0.0103 Down <0.001 12 0.5482 ALOX 2.8067 0.1389
1.1607 0.0742 Down <0.001 12 0.4135 ALOX5AP 1.4576 0.0544 1.0563
0.0334 Down <0.001 12 0.7247 PLCL2 1.3222 0.0275 0.9968 0.0124
Down <0.001 12 0.7540 TBXAS1 4.2321 0.1225 1.0493 0.0328 Down
<0.001 12 0.2479 qPCR Analysis, Bone PTGIS 1.0166 0.1075 2.1113
0.3096 Up 0.0075 6 2.0769 ALOX5P 0.7323 0.1598 2.6319 0.4868 Up
0.0207 3 3.5938 COX1 1.0565 0.0191 1.0728 0.0348 X 0.7010 3 1.0155
PTGES 1.5942 0.2132 1.0526 0.1314 X 0.0966 3 0.6602 TBXAS1 0.7282
0.1607 1.4539 0.4384 X 0.1951 3 1.9966 ALOX5 0.7695 0.0628 1.5397
0.4529 X 0.1674 3 2.0009
[0086] The balance between bone loss and deposition is regulated by
chemical signaling between resident bone cells. The enhanced
cellular production of prostacyclin and increased prostacyclin
synthase (Ptgis) messenger RNA and protein in bone and osteocytes
of sclerostin (Sost) knockout mice has been seen. .beta.-Catenin is
increased in Sost knockout osteocytes and the localization of
transcription factors, lymphoid-enhancer binding factor (LEF) and
T-cell factor on euchromatin is also increased. The blockade of Wnt
signaling reduces cellular .beta.-catenin, LEF nuclear
localization, and prostacyclin production. The Ptgis gene binds LEF
in its promoter and the occupancy of binding sites is increased in
Sost KO osteocytes. As such prostacyclin plays a role in bone
biology and reveal a signaling relationship that can be used to
enhance fracture repair and treat osteoporosis.
[0087] It is contemplated that any embodiment discussed in this
specification can be implemented with respect to any method, kit,
reagent, or composition of the invention, and vice versa.
Furthermore, compositions of the invention can be used to achieve
methods of the invention.
[0088] It will be understood that particular embodiments described
herein are shown by way of illustration and not as limitations of
the invention. The principal features of this invention can be
employed in various embodiments without departing from the scope of
the invention. Those skilled in the art will recognize, or be able
to ascertain using no more than routine experimentation, numerous
equivalents to the specific procedures described herein. Such
equivalents are considered to be within the scope of this invention
and are covered by the claims.
[0089] All publications and patent applications mentioned in the
specification are indicative of the level of skill of those skilled
in the art to which this invention pertains. All publications and
patent applications are herein incorporated by reference to the
same extent as if each individual publication or patent application
was specifically and individually indicated to be incorporated by
reference.
[0090] The use of the word "a" or "an" when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one." The use of
the term "or" in the claims is used to mean "and/or" unless
explicitly indicated to refer to alternatives only or the
alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[0091] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps.
[0092] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof" is intended
to include at least one of: A, B, C, AB, AC, BC, or ABC, and if
order is important in a particular context, also BA, CA, CB, CBA,
BCA, ACB, BAC, or CAB. Continuing with this example, expressly
included are combinations that contain repeats of one or more item
or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so
forth. The skilled artisan will understand that typically there is
no limit on the number of items or terms in any combination, unless
otherwise apparent from the context.
[0093] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. All such similar substitutes and modifications apparent
to those skilled in the art are deemed to be within the spirit,
scope and concept of the invention as defined by the appended
claims.
Sequence CWU 1
1
49120DNAArtificial SequenceSynthetic primer 1ccgggaacta ctgcaaaaat
20221DNAArtificial SequenceSynthetic primer 2ccaaggtttt caatgatgct
t 21320DNAArtificial SequenceSynthetic primer 3ggttttgacc
ttgtgggaaa 20420DNAArtificial SequenceSynthetic primer 4catattggga
tgcgattcct 20519DNAArtificial SequenceSynthetic primer 5tatggatctc
cacggcaac 19618DNAArtificial SequenceSynthetic primer 6gtccactggc
ggaacttg 18720DNAArtificial SequenceSynthetic primer 7ctgccagaga
acaagtgcaa 20820DNAArtificial SequenceSynthetic primer 8aatggcacca
ttgaccctaa 20921DNAArtificial SequenceSynthetic primer 9cagtgttgtt
ctgggttttg g 211022DNAArtificial SequenceSynthetic primer
10acctggggtc acaatatcat ct 221121DNAArtificial SequenceSynthetic
primer 11cgtgtcagca aagcttcttt t 211218DNAArtificial
SequenceSynthetic primer 12ggctcacgtc gctcatct 181320DNAArtificial
SequenceSynthetic primer 13tcctgagaac aaccagacca
201421DNAArtificial SequenceSynthetic primer 14gcagctgtac
tcggacacat c 211520DNAArtificial SequenceSynthetic primer
15tgcttcccaa tcctatttgc 201618DNAArtificial SequenceSynthetic
primer 16agctcagggg gaatcgag 181720DNAArtificial SequenceSynthetic
primer 17aggcacggca aaaacagtat 201820DNAArtificial
SequenceSynthetic primer 18tgtggcattt ggcatcaata
201919DNAArtificial SequenceSynthetic primer 19catgaaagca aggcgcata
192021DNAArtificial SequenceSynthetic primer 20catctacgca
gttctggttg g 212121DNAArtificial SequenceSynthetic primer
21cgccaccaag acctacatac g 212220DNAArtificial SequenceSynthetic
primer 22acatgaccga gccgatctgt 202320DNAArtificial
SequenceSynthetic primer 23cctctttcca ggagctcaca
202420DNAArtificial SequenceSynthetic primer 24tcgatgtcac
cgtacagctc 202519DNAArtificial SequenceSynthetic primer
25gatgctcttc cgagctgtg 192621DNAArtificial SequenceSynthetic primer
26ggattggaac agcaaggatt t 212720DNAArtificial SequenceSynthetic
primer 27tgcagatctt ggactggaca 202820DNAArtificial
SequenceSynthetic primer 28aagaacggta gctgggatca
202921DNAArtificial SequenceSynthetic primer 29gactgtgacg
aggagttcca g 213020DNAArtificial SequenceSynthetic primer
30gagctccacc gttgtctcac 203120DNAArtificial SequenceSynthetic
primer 31gtgaggggct ttattccaca 203218DNAArtificial
SequenceSynthetic primer 32gaaaccccca cctgaacc 183320DNAArtificial
SequenceSynthetic primer 33ccaactacag tcccgtggag
203420DNAArtificial SequenceSynthetic primer 34ttggaagttc
agagccacaa 203522DNAArtificial SequenceSynthetic primer
35cgctgtgtat gaaaagatcg tg 223620DNAArtificial SequenceSynthetic
primer 36gtgcctatgc tgtgcaagtg 203721DNAArtificial
SequenceSynthetic primer 37ggctcctgga cactacacct a
213820DNAArtificial SequenceSynthetic primer 38atagttggcc
tccaccactg 203920DNAArtificial SequenceSynthetic primer
39gcacactgct ggtcatcaag 204018DNAArtificial SequenceSynthetic
primer 40acgtttcagc gcatcctc 184120DNAArtificial SequenceSynthetic
primer 41atgccatcaa cagcatcaaa 204222DNAArtificial
SequenceSynthetic primer 42aaactcagga acctctgtgt cc
224320DNAArtificial SequenceSynthetic primer 43ccctccaccc
tatgacaaga 204419DNAArtificial SequenceSynthetic primer
44gccccaggta agcaaactt 194520DNAArtificial SequenceSynthetic primer
45ggatgtaccc accagctttc 204620DNAArtificial SequenceSynthetic
primer 46acctgcaggg atacgttgtc 204719DNAArtificial
SequenceSynthetic primer 47gcactgagac acgggaaga 194819DNAArtificial
SequenceSynthetic primer 48gtctctgcct cccaagctc 19498DNAArtificial
SequenceSynthetic primer 49cctttgat 8
* * * * *