U.S. patent application number 15/328348 was filed with the patent office on 2017-12-07 for method and composition for targeted delivery of therapeutic agents.
The applicant listed for this patent is MEMORIAL SLOAN-KETTERING CANCER CENTER. Invention is credited to Nima AKHAVEIN, Simone ALIDORI, Michael R. MCDEVITT, David A. SCHEINBERG.
Application Number | 20170348234 15/328348 |
Document ID | / |
Family ID | 55163766 |
Filed Date | 2017-12-07 |
United States Patent
Application |
20170348234 |
Kind Code |
A1 |
MCDEVITT; Michael R. ; et
al. |
December 7, 2017 |
METHOD AND COMPOSITION FOR TARGETED DELIVERY OF THERAPEUTIC
AGENTS
Abstract
Functionalized single walled or multi-walled carbon nanotubes
(f-CNTs) can be delivered into mammals to targeted organs, such as
the kidney and the liver. These f-CNTs may be non-covalently linked
or covalently linked to therapeutic agents. In particular, the
application delivers carbon nanotube-therapeutic agent conjugates
to a target organ, thereby preventing or reducing damages to the
organ caused by other agents or procedure.
Inventors: |
MCDEVITT; Michael R.;
(Bronx, NY) ; ALIDORI; Simone; (New York City,
NY) ; AKHAVEIN; Nima; (Philadelphia, PA) ;
SCHEINBERG; David A.; (New York City, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MEMORIAL SLOAN-KETTERING CANCER CENTER |
New York City |
NY |
US |
|
|
Family ID: |
55163766 |
Appl. No.: |
15/328348 |
Filed: |
July 23, 2015 |
PCT Filed: |
July 23, 2015 |
PCT NO: |
PCT/US15/41756 |
371 Date: |
January 23, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62028615 |
Jul 24, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/351 20130101;
A61K 47/52 20170801; A61K 47/6925 20170801; C12N 15/113 20130101;
A61K 9/0019 20130101; A61K 31/713 20130101; C12N 15/1135 20130101;
A61K 9/0092 20130101; A61K 47/6929 20170801; C12N 2320/32 20130101;
C12N 15/1137 20130101; A61K 51/1248 20130101; A61K 31/7105
20130101; A61K 31/711 20130101; C12N 2310/14 20130101 |
International
Class: |
A61K 9/00 20060101
A61K009/00; C12N 15/113 20100101 C12N015/113 |
Goverment Interests
[0002] This invention was made with Government support under grant
no. DE-SC0002456 awarded by the Department of Energy. The
Government has certain rights in the invention.
Claims
1. A method for preventing or reducing kidney or liver injury in a
subject, comprising administering to a subject in need thereof an
effective amount of a pharmaceutical composition comprising (1) one
or more therapeutic nucleic acids conjugated to functionalized
carbon nanotubes (f-CNTs) and (2) a pharmaceutically acceptable
carrier, wherein said one or more therapeutic nucleic acids inhibit
expression of one or more genes selected from the group consisting
of MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1, Egln2,
Egln3, PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN, Fra1,
Fra2, ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1
and C3 gene.
2. The method of claim 1, wherein said kidney or liver injury
includes injuries caused by hepatic toxins, nephrotoxins and
ischemia.
3. The method of claim 1, wherein said kidney injury is acute
kidney injury.
4. The method of claim 1, wherein the one or more therapeutic
nucleic acids are therapeutic RNAs that are non-covalently linked
to the f-CNTs.
5. The method of claim 1, wherein the one or more therapeutic
nucleic acids are therapeutic RNAs that are covalently linked to
the f-CNTs.
6. The method of claim 1, wherein the f-CNTs are functionalized
single walled carbon nanotubes (f-SWCNTs).
7. The method of claim 1, wherein the f-CNTs are functionalized
multi-walled carbon nanotubes.
8. The method of claim 1, wherein the f-CNTs are replaced by any
fibrillary molecule with an aspect ratio greater than 1.
9. The method of claim 1, wherein the pharmaceutical composition is
prophylactically administered before the occurrence of kidney or
liver injury.
10. The method of claim 1, wherein the pharmaceutical composition
is administered after the occurrence of kidney or liver injury.
11. The method of claim 1, wherein the one or more therapeutic
nucleic acids are selected from the group consisting of siRNAs,
miRNA precursors, single-stranded mature miRNAs, double-stranded
mature miRNAs and antisense RNAs, synthetic modified RNA, DNA, and
synthetic modified DNA.
12. The method of claim 1, wherein the one or more therapeutic RNAs
comprise an siRNA.
13. The method of claim 1, wherein the therapeutic RNAs comprise
siRNAs that inhibit expression of p53 and MEP1B genes.
14. A pharmaceutical composition for preventing or reducing kidney
and/or liver injury, comprising (1) one or more therapeutic RNAs
conjugated to functionalized carbon nanotubes (f-CNTs) and (2) a
pharmaceutically acceptable carrier, wherein the one or more RNA
inhibit expression of one or more genes selected from the group
consisting of MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1,
Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN,
Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1,
Kim-1 and C3 gene.
15. The pharmaceutical composition of claim 14, wherein the one or
more therapeutic RNAs are non-covalently linked to the f-CNTs.
16. The pharmaceutical composition of claim 14, wherein the one or
more therapeutic RNAs are covalently linked to the f-CNTs.
17. The pharmaceutical composition of claim 14, wherein the f-CNTs
are functionalized single walled carbon nanotubes (f-SWCNTs).
18. The pharmaceutical composition of claim 14, wherein the one or
more therapeutic RNAs are selected from the group consisting of
siRNAs, miRNA precursors, single-stranded mature miRNAs,
double-stranded mature miRNAs and antisense RNAs.
19. The pharmaceutical composition of claim 14, wherein the one or
more therapeutic RNAs comprise an siRNA.
20. The pharmaceutical composition of claim 14, wherein the
therapeutic RNAs comprise siRNAs that inhibit expression of p53 and
MEP1B genes.
21. A method for reducing acute kidney injury in a subject,
comprising administering to the subject an effective amount of a
pharmaceutical composition, comprising: (1) one or more siRNAs
conjugated to functionalized single wall carbon nanotubes
(f-SWCNTs); and (2) a pharmaceutically acceptable carrier, wherein
the one or more siRNAs inhibit expression of one or more genes
selected from the group consisting of MMP-9, JNK, Epas1, Hifl1an,
Ac1, Fih1, Irp1, Egln1, Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2,
cFOS, FOS, cJUN, JUN, Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM,
p53, FASR, FASL, COL3A1, Kim-1 and C3 gene.
22. The method of claim 21, wherein the one or more siRNAs are
non-covalently linked to the f-SWCNTs.
Description
CROSS-REFERENCE TO PRIOR APPLICATIONS
[0001] This application claims priority of U.S. Provisional
Application No. 62/028,615, filed on Jul. 24, 2014. The entirety of
the aforementioned application is incorporated herein by
reference.
FIELD
[0003] The present application relates generally to methods for
targeted delivery of therapeutic agents and, in particular, to
targeted delivery of therapeutic agents to kidney, spleen, and
liver tissue with carbon nanotubes.
BACKGROUND
[0004] Acute kidney injury (AKI) is described by an abrupt decline
in renal function, specifically, an inability to concentrate urine,
eliminate nitrogenous waste, and sustain homeostatic fluid levels.
Currently there is no FDA-approved pharmaceutical for the
prevention or treatment of AKI, which is associated to very high
rates of mortality and morbidity of hospitalized patients. The
operational definition of AKI includes increased serum creatinine
(.gtoreq.0.3 mg/dL) and oliguria (<0.5 mL/kg/h for more than 6
h). It is a ubiquitous medical condition that is seen in .about.7%
of hospitalized patients. Many conventional medical treatments and
procedures unavoidably produce nephrotoxic and renal ischemic
insults and are prominent contributors to renal injury. Nephrotoxic
drugs include antibiotics, such as aminoglycosides, sulfonamides,
amphotericin B, foscarnet, quionlones (e.g., ciprofloxacin),
rifampin, tetracycline, acyclovir, pentamidine, vanomycin;
chemotherapeutics and immunosuppressants, such as cisplatin,
methotrexate, mitomycin, cyclosporine, ifosphamide, zoledronic
acid; anti-hyperlipidemics, such as statin drugs (rhabdomyolysis)
or gemfibrozil; drugs of abuse, such as cocaine, heroin,
methamphetamine, or methadone; heavy metals, such as mercury, lead,
arsenic, bismuth, or lithium; miscellaneous drugs, such as chronic
stimulant laxative use, radiographic contrast, ACE inhibitors,
NSAIDs, aspirin, mesalamine (e.g., asacol, pentasa), and
aristocholic acid. Ischemic events resulting from surgical
procedures or crush accidents also contribute to AKI. AKI is also a
common development from sepsis.
[0005] There is a high rate of mortality in subjects with AKI.
Morbidity is severe and almost half of the elderly AKI-afflicted
population will succumb. An increasingly aged population
exacerbates the problem because of the decreased ability of this
patient subset to recover from renal damage.
[0006] The pathogenesis of AKI involves a nephrotoxic, ischemic, or
septic insult which results in loss of polarity of the epithelial
cell of the kidney with mislocation of adhesion molecules and
Na.sup.+, K.sup.+-ATPase and other proteins. If the insult is
severe, there is cell death by either necrosis or apoptosis. In
addition, because of the mislocation of adhesion molecules, viable
epithelial kidney cells slough off. Desquamated cells and cellular
debris can interact with luminal proteins to physically obstruct
the tubule lumen. If provided with the correct nutrients and oxygen
supply, the kidney can then initiate a repair process. Viable
epithelial cells dedifferentiate and migrate to replace the lost
cells. These cells may then proliferate so that a normal epithelium
is restored to the kidney.
[0007] Currently, treatment of AKI is largely supportive and
effective preventative therapies are needed. The high rates of
morbidity and mortality associated with AKI correlate with
protracted, expensive hospital stays. The pathogenesis of AKI has
been characterized by the loss of renal epithelial cell polarity,
de-differentiation, apoptosis, necrosis, fibrosis, and inflammation
following a renal insult. In particular, tubule damage results from
renal ischemia and nephrotoxins. Prophylaxis, directed at the PTC,
anticipating kidney damage from a prescribed drug therapy or
ischemia and reperfusion event must be developed.
SUMMARY
[0008] One aspect of the present application relates to a method
for preventing or reducing liver and/or kidney injury. The method
comprises the steps of administering to a subject in need thereof
an effective amount of a pharmaceutical composition comprising (1)
one or more therapeutic RNAs conjugated to functionalized carbon
nanotubes (f-CNTs) and (2) a pharmaceutically acceptable carrier,
wherein said one or more therapeutic RNAs inhibit expression of one
or more genes selected from the group consisting of MMP-9, JNK,
Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1, Egln2, Egln3, PHD1, PHD2,
PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN, Fra1, Fra2, ATP, AP-1,
MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1 and C3 gene.
[0009] In some embodiments, the liver and/or kidney injury include
injuries caused by hepatic toxins, nephrotoxins and ischemia.
[0010] In some embodiments, the one or more therapeutic RNAs are
non-covalently linked to the f-CNTs.
[0011] In some embodiments, the f-CNTs are functionalized single
walled carbon nanotubes (f-SWCNTs), functionalized multi-walled
carbon nanotubes (f-MWCNT), or any fibrillar (aspect ratio greater
than 1) macromolecule.
[0012] In some embodiments, the pharmaceutical composition is
prophylactically administered before the occurrence of liver or
kidney injury.
[0013] In some other embodiments, the pharmaceutical composition is
administered after the occurrence of liver or kidney injury.
[0014] In some embodiments, the one or more therapeutic RNAs are
selected from the group consisting of siRNAs, miRNA precursors,
single-stranded mature miRNAs, double-stranded mature miRNAs and
antisense RNAs.
[0015] Another aspect of the present application relates to a
pharmaceutical composition for preventing or reducing liver and/or
kidney injury, comprising (1) one or more therapeutic RNAs linked
to functionalized carbon nanotubes (f-CNTs) and (2) a
pharmaceutically acceptable carrier, wherein the one or more
therapeutic RNA inhibit expression of one or more genes selected
from the group consisting of MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1,
Irp1, Egln1, Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS,
cJUN, JUN, Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR,
FASL, COL3A1, Kim-1 and C3 gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] The above and other objects and advantages of the
application will be apparent upon consideration of the following
detailed description, taken in conjunction with the accompanying
figures.
[0017] FIGS. 1A-1C show blood clearance and tissue distribution of
f-CNT in a mouse model. FIG. 1A is a graphic illustration of the
key functional groups that were appended to
SWCNT-[([86Y]DOTA)(AF488)(AF680)](f-CNT) for the dynamic positron
emission topography (PET) study. The figure is not drawn to scale
and only contain the key appended moieties. FIG. 1B shows
time-activity curves generated from region-of-interest analysis (%
injected dose (ID)/g (mean.+-.s.d.)) of liver accumulation and
blood compartment clearance in four mice that were PET imaged. FIG.
1C shows biodistribution of f-CNT in select tissue and bile (% ID/g
(mean.+-.s.d.)) at 1 h post injection. FIG. 1D shows time-activity
curves generated from region-of-interest analysis (% injected dose
(ID)/g) of blood compartment clearance for multi-walled carbon
nanotubes. FIG. 1E shows biodistribution of multi-walled carbon
nanotubes in select tissue (% ID/g). FIG. 1F shows biodistribution
of siRNA/f-CNT in select tissue (% ID/g).
[0018] FIG. 2 shows that f-CNT is biocompatible and non-toxic to
human liver tissue. Organoids of human liver tissue (microspheres)
were exposed to (Panel a) only growth media (untreated control) for
1 d; and to fCNT at (Panel b) 15 mg/L for 1 d; (Panel c) 30 mg/L
for 1 d; (Panel d) 15 mg/L for 2 d; (Panel e) 30 mg/L for 2 d;
(Panel f) 15 mg/L for 3 d; and (Panel g) 30 mg/L for 3 d. The scale
bar applies to all images in the figure. Note that animal studies
in vivo administered 0.01 to 0.04 mg/L to mice with most of the
dose eliminated in less than 1 h by renal or hepatic clearance.
There was no evidence of toxicity to human liver tissue in vitro or
mouse liver tissue in vivo.
[0019] FIGS. 3A and 3B show renal expression of p53 and
meprin-1.beta. is reduced by fCNT-mediated RNAi. FIG. 3A shows
quantitative ROI analysis of these images described a significant
decrease of basal p53 expression in the fCNT/siTrp53 group versus
siTrp53 alone (P<0.0001) and PBS vehicle (P<0.0001). Similar
observations were made in the kidney cortices stained for
meprin-1.beta. expression. FIG. 3B shows ROI analysis of these
images described a significant decrease of basal meprin-1.beta.
expression in the fCNT/siMep1b group versus siMep1b alone
(P<0.0001) and PBS (P<0.0001).
[0020] FIGS. 4A-4F show that acute kidney injury (AKI) is mitigated
with renal-targeted f-CNT-interference and improved
progression-free survival after a cisplatin-induced injury. FIG. 4A
is a Kaplan-Meier plot of the percent survival as a function of
time from cisplatin administration showed the effects of each RNAi
treatment condition. The groups are as follows: f-CNT/siMep1b;
f-CNT/siTrp53; f-CNT/siScram; siMep1b only; siTrp53 only;
combination f-CNT/siMep1b/siTrp53 (the uppermost plotline after 10
days post-cisplatin administration); combination siMep1b/siTrp53;
and f-CNT/siCtr1. (n.b., These curves were nudged to permit full
view of the data lines). FIG. 4B is a Forest plot of the hazard
ratios of the various prophylactic control groups versus the
combination f-CNT/siMep1b/siTrp53 strongly favored this f-CNT drug
combination treatment in minimizing renal injury arising form
cisplatin toxicity. FIG. 4C shows analysis of the picrosirius red
staining of the combination group, f-CNT/siMep1b/siTrp53, right
bars, and of the control f-CNT/siScram group, left bars, after 14
and 180 days from cisplatin administration. No difference was
recorded at 14 days between the two groups, whereas the fibrosis
level was significantly higher for the f-CNT/siScram group
(p=0.0397) at 180 days. FIG. 4D shows analysis of the CD3
immunofluorescence of the combination group, fCNT/siMep1b/siTrp53,
red bar, and of the control fCNT/siScram group, blue bar, after 14
and 180 days from cisplatin administration. The level of CD3 was
significantly lower for the fCNT/siMep1b/siTrp53-treated group at
both 14 (p=0.0007) and 180 days (p=0.0006). FIG. 4E shows analysis
of CD45 immunofluorescence of the combination group,
f-CNT/siMep1b/siTrp53, right bars, and of the control f-CNT/siScram
group, left bars, after 14 and 180 days from cisplatin
administration. The level of CD45 was significantly lower for the
f-CNT/siMep1b/siTrp53-treated group at both 14 (p=0.0011) and 180
days (p=0.0100). FIG. 4F shows analysis of the Iba-1
immunofluorescence of the combination group, f-CNT/siMep1b/siTrp53,
right bars, and of the control f-CNT/siScram group, left bars,
after 14 and 180 days from cisplatin administration. The level of
Iba-1 was significantly lower for the f-CNT/siMep1b/siTrp53-treated
group at both 14 (p<0.0001) and 180 days (p<0.0001).
DETAILED DESCRIPTION
[0021] Some modes for carrying out the present invention are
presented in terms of its exemplary embodiments, herein discussed
below. However, the present invention is not limited to the
described embodiment and a person skilled in the art will
appreciate that many other embodiments of the present invention are
possible without deviating from the basic concept of the present
invention, and that any such work around will also fall under scope
of this application. It is envisioned that other styles and
configurations of the present invention can be easily incorporated
into the teachings of the present invention, and only one
particular configuration shall be shown and described for purposes
of clarity and disclosure and not by way of limitation of
scope.
[0022] Headings used herein are for organizational purposes only
and are not meant to be used to limit the scope of the description
or the claims. As used throughout this application, the word "may"
is used in a permissive sense (i.e., meaning having the potential
to), rather than the mandatory sense (i.e., meaning must). The
terms "a" and "an" herein do not denote a limitation of quantity,
but rather denote the presence of at least one of the referenced
items.
[0023] One aspect of the present application relates to a method
for preventing or reducing kidney and/or liver injury. The method
comprises the steps of administering to a subject in need thereof
an effective amount of a pharmaceutical composition comprising (1)
one or more therapeutic agents conjugated to functionalized carbon
nanotubes (f-CNTs) and (2) a pharmaceutically acceptable carrier,
wherein said one or more therapeutic agents inhibit expression of
one or more genes selected from the group consisting of MMP-9, JNK,
Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1, Egln2, Egln3, PHD1, PHD2,
PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN, Fra1, Fra2, ATP, AP-1,
MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1 and C3 gene.
[0024] The f-CNT provides a delivery vehicle that can be loaded
with the therapeutic agents and specifically directed to the kidney
and/or liver bearing the therapeutic cargo. The f-CNT-therapeutic
agent conjugates behave like small molecules in vivo and
effectively delivers the therapeutic agents to cells in kidney and
liver.
Functionalized Carbon Nanotubes
[0025] Carbon nanotubes (CNTs) are allotropes of carbon with a
cylindrical nanostructure. The carbon atoms are all surface atoms
formed in regular structures with defined periodicity. Nanotubes
have been constructed with an aspect (length-to-diameter) ratio of
up to 10.sup.6. In some embodiments, the CNTs have an aspect ratio
of 10.sup.0-10.sup.5. In some embodiments, the CNTs have about
.about.8000 carbon atoms per 100 nanometers of length (for a
d.about.1.4 nm). The CNTs of the present application may have
metallic or semiconducting properties. In some embodiments, the
CNTs of the present application are single-walled CNTs (SWCNTs),
functionalized multi-walled carbon nanotubes (f-MWCNT), or any
fibrillar (aspect ratio greater than 1) macromolecule.
[0026] In some embodiments, the CNTs of the present application are
functionalized to enhance solubility and reactivity. Commonly used
functionalization methods include covalent functionalization and
non-covalent functionalization. Covalent functionalization is based
on the formation of a covalent linkage between functional entities
and the carbon skeleton of nanotubes. It could also be divided into
direct covalent sidewall functionalization and indirect covalent
functionalization with carboxylic groups on the surface of CNTs.
Direct covalent sidewall functionalization is associated with a
change in hybridization from sp2 to sp3 and a simultaneous loss of
conjugation (e.g., fluorination of nanotubes). Indirect covalent
functionalization takes advantage of chemical transformations of
carboxylic groups at the open ends and holes in the sidewalls.
These carboxylic groups might have existed on the as-grown CNTs and
also be further generated during oxidative purification. In order
to increase the reactivity of CNTs, the carboxylic acid groups
usually need to be converted into acid chloride and then undergo an
esterification or amidation reaction.
[0027] Non-covalent functionalization is mainly based on
supramolecular complexation using various adsorption bonding
forces, such as Van der Waals force, hydrogen bonds, electrostatic
force and it-stacking interactions. Compared to the chemical
functionalization, non-covalent functionalization has the
advantages that it could be operated under relatively mild reaction
conditions to maintain the graphitic structure of CNTs.
[0028] In some embodiments, single-walled carbon nanotubes
(SWCNTs), multi-walled carbon nanotubes (f-MWCNT), or any fibrillar
(aspect ratio greater than 1) macromolecule are covalently
functionalized with aliphatic primary amino groups or other
ionizable molecular appendicies.
[0029] In some embodiments, the functionalized SWCNTs (fSWCNTs),
functionalized multi-walled carbon nanotubes (f-MWCNT), or any
fibrillar (aspect ratio greater than 1) macromolecule have an
average length of about 30-3000 nm, 30-1000 nm, 30-300 nm, 30-100
nm, 100-3000 nm, 100-1000 nm, 100-300 nm, 300-3000 nm or 300-1000
nm. In some embodiments, the functionalized SWCNTs (fSWCNTs),
functionalized multi-walled carbon nanotubes (f-MWCNT), or any
fibrillar (aspect ratio greater than 1) macromolecule have an
average length of about 100-600 nm, 100-500 nm, 100-400 nm, 200-600
nm, 200-500 nm, 200-400 nm or 250-350 nm. In some embodiments, the
functionalized SWCNTs (fSWCNTs), functionalized multi-walled carbon
nanotubes (f-MWCNT), or any fibrillar (aspect ratio greater than 1)
macromolecule have an average length of about 300 nm.
[0030] In some embodiments, the functionalized SWCNTs (fSWCNTs),
functionalized multi-walled carbon nanotubes (f-MWCNT), or any
fibrillar (aspect ratio greater than 1) macromolecule have an
average diameter of about 0.1-30 nm, 0.1-10 nm, 0.1-3 nm, 0.1-1 nm,
0.1-0.3 nm, 0.3-30 nm, 0.3-10 nm, 0.3-3 nm, 0.3-1 nm, 1-30 nm, 1-10
nm, 1-3 nm, 3-30 nm, 3-10 nm or 10-30 nm. In some embodiments, the
functionalized SWCNTs (f-SWCNTs) have an average diameter of about
0.5-1.5 nm, 0.6-1.4 nm, 0.7-1.3 nm, 0.8-1.2 nm or 0.9-1.1 nm. In
some embodiments, the functionalized SWCNTs (f-SWCNTs),
functionalized multi-walled carbon nanotubes (f-MWCNT), or any
fibrillar (aspect ratio greater than 1) macromolecule have an
average diameter of about 1 nm. In other embodiments, the
functionalized SWCNTs (f-SWCNTs) have an average diameter of about
1-1.8 nm, 1.2-1.6 nm or 1.3-1.5 nm. In some embodiments, the
functionalized SWCNTs (f-SWCNTs), functionalized multi-walled
carbon nanotubes (f-MWCNT), or any fibrillar (aspect ratio greater
than 1) macromolecule have an average diameter of about 1.4 nm.
Therapeutic Agents
[0031] The therapeutic agents include any agent that prevents or
reduces kidney or liver injury and is capable of attachment to
f-CNTs. In some embodiments, the therapeutic agents include small
molecule drugs, proteins, peptides, polynucleotides and mixtures
thereof. In some embodiments, the therapeutic agents are RNAs, such
as siRNAs, premature miRNAs, single-stranded mature miRNAs,
double-stranded mature miRNAs or antisense mRNAs targeting one or
more genes involved in kidney or liver injury. In some embodiments,
the one or more genes involved in kidney or liver injury are
selected from the group consisting of MMP-9, JNK, Epas1, Hifl1an,
Ac1, Fih1, Irp1, Egln1, Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2,
cFOS, FOS, cJUN, JUN, Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM,
p53, FASR, FASL, COL3A1, Kim-1 and C3 gene.
[0032] In some embodiments, therapeutic agents are therapeutic
RNAs, such as siRNAs, premature miRNAs, single-stranded mature
miRNAs and/or double-stranded mature miRNAs that inhibit expression
of the one or more genes involved in kidney or liver injury as
describe above. The therapeutic RNAs are non-covalently linked to
f-CNTs, preferably f-SWCNTs, through electrostatic and hydrogen
bonding to the carbon nanotubes via titration of nanotubes and RNA
complexes together. In some embodiments, the therapeutic RNAs are
mixed with nanotubes at a molar ratio ranging from 1:10, 1:5, 1:2,
preferably 1:2 or 1:1, followed with sonication. Sonication may be
performed in a variety of ways, including probe tip ultrasonication
and the milder bath sonication.
[0033] The RNA-f-CNT complex will remain linked at a certain
extracellular concentration (e.g., .gtoreq.50 nM). However, once
the RNA-f-CNT complex enters the intercellular environment, the
internalization and compartmentalization, plus the loss of
undelivered construct through renal elimination, will dilute the
concentration to levels where the therapeutic RNA will dissociate
from the f-CNT (e.g. <1 nM).
[0034] In other embodiments, the therapeutic RNAs are conjugated to
f-CNTs via a cleavable sulfide bond that will then be cleaved
within the intercellular environment to release the therapeutic
RNAs.
[0035] In some embodiments, f-CNT linked therapeutic RNAs are
prophylactically delivered to the specific cell types in the kidney
and/or liver where the f-CNTs localize, thereby reducing the damage
caused to the organ. For example, liver sinusoidal endothelial
cells (LESCs) form a barrier around hepatocytes and function as
scavengers, protecting hepatocytes from toxins in the bloodstream.
Damage to these cells can lead to vascular occlusive disorder,
which can cause liver problems. Such damage to the liver may be
prevented by prophylactic administration of therapeutic RNAs linked
to the f-CNTs. In some embodiments, the therapeutic RNAs are
designed to target genes whose knockdown may ameliorate the damage
caused to the kidney. Examples of such genes include, but are not
limited to: MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1,
Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN,
Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1,
Kim-1 and C3 gene.
[0036] In some embodiments, the therapeutic RNAs are designed to
target genes whose knockdown may ameliorate the damage to the
proximal tubule cells (PTC) of the kidney, which often lead to
acute kidney injury (AKI). Examples of such genes include, but are
not limited to: MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1,
Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN,
Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1,
Kim-1 and C3 gene.
[0037] In other embodiments, the therapeutic RNAs are designed to
target genes whose knockdown may ameliorate the damage caused to
the liver, Examples of such genes include, but are not limited to:
MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1, Egln2, Egln3,
PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN, Fra1, Fra2,
ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1 and C3
gene.
[0038] In some embodiments, the therapeutic RNAs are siRNAs. In
some embodiments, the siRNAs are siRNAs that inhibit expression of
genes selected from the group consisting of MMP-9, JNK, Epas1,
Hifl1an, Ac1, Fih1, Irp1, Egln1, Egln2, Egln3, PHD1, PHD2, PHD3,
CTR1, CTR2, cFOS, FOS, cJUN, JUN, Fra1, Fra2, ATP, AP-1, MEP1A,
MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1 and C3 gene. In some
embodiments, the siRNAs are siRNAs that inhibit expression of the
MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1, Egln2, Egln3,
PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN, Fra1, Fra2,
ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1 and C3
gene. In some embodiments, the siRNAs are selected from the groups
consisting of MMP-9, JNK, Epas1, Hifl1an, Ac1, Fih1, Irp1, Egln1,
Egln2, Egln3, PHD1, PHD2, PHD3, CTR1, CTR2, cFOS, FOS, cJUN, JUN,
Fra1, Fra2, ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1,
Kim-1 and C3 gene.
[0039] In some embodiments, the therapeutic RNAs are precursor
miRNAs. In some embodiments, the therapeutic RNAs are mature
single-stranded miRNAs. In some embodiments, the therapeutic RNAs
are mature double-stranded miRNAs. In some embodiments, the
therapeutic RNAs are antisense RNAs.
[0040] In some embodiments, the f-CNT-therapeutic RNA conjugates of
the present application have an average molecular weight of about
0.5-100 k, 5-10 k, 5-50 k, 5-100 k, 5-600 k, 100-500 k, 100-400 k,
100-300 k, 100-200 k, 200-600 k, 200-500 k, 200-400 k 200-300 k,
300-600 k, 300-500 k, 300-400 k, 400-600 k, 400-500 k or 500-600 k
Dalton. In some embodiments, the f-CNT-therapeutic RNA conjugates
of the present application have an average molecular weight of
about 1-500 k, 1-400 k or 2.5-400 k Dalton. In some embodiments,
the f-CNT-therapeutic RNA conjugates of the present application
have an average molecular weight of about 300-350 k, about 300 k or
about 350 k Dalton. In some embodiments, the f-CNT-therapeutic RNA
conjugates exhibit rapid blood clearance (e.g., t1/2 of about 120,
100, 90, 75, 60, 45, 30, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1
min.); minimal liver and kidney and spleen accumulation; and a
combination of renal and biliary elimination of 1-100%, 50-60%,
60-70%, 70-80%, 80-90%, or over 90% of the injected dose within one
hour of intravenous administration.
Pharmaceutically Acceptable Carrier
[0041] As used herein, the phrase "pharmaceutically acceptable
carrier" includes any and all molecular entities and compositions
that are of sufficient purity and quality for use in the
formulation of a composition or medicament of the present
application and that, when appropriately administered to an animal
or a human, do not produce an adverse, allergic or other untoward
reaction. Since both human use (clinical and over-the-counter) and
veterinary use are equally included within the scope of the present
invention, a pharmaceutically acceptable formulation would include
a composition or medicament for either human or veterinary use. In
one embodiment, the pharmaceutically acceptable carrier is water or
a water based solution. In another embodiment, the pharmaceutically
acceptable carrier is a non-aqueous polar liquid such as dimethyl
sulfoxide, polyethylene glycol and polar silicone liquids. In
another embodiment, the carrier could be liposomal or polymeric
agents. The use of such media and agents with pharmaceutically
active substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the
f-CNT-therapeutic agent conjugates, its use in the therapeutic
compositions is contemplated.
Formulation
[0042] The pharmaceutical composition of the present application
may be formulated in a dosage form for the desired route of
administration. The amount of the f-CNT-therapeutic agent
conjugates which can be combined with the carrier material to
produce a single dosage form will vary depending upon the host
being treated, and the particular mode of administration. The
amount of the f-CNT-therapeutic agent conjugates that can be
combined with the carrier material to produce a single dosage form
will generally be that amount of the conjugate which produces a
therapeutic effect.
[0043] Formulations suitable for parenteral administration comprise
the f-CNT-therapeutic agent conjugates in combination with one or
more pharmaceutically-acceptable sterile isotonic aqueous or
nonaqueous solutions, dispersions, suspensions or emulsions, or
sterile powders which may be reconstituted into sterile injectable
solutions or dispersions just prior to use, which may contain
sugars, alcohols, antioxidants, buffers, bacteriostats, solutes
which render the formulation isotonic with the blood of the
intended recipient or suspending or thickening agents.
[0044] Examples of suitable aqueous and nonaqueous carriers, which
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity can be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0045] The pharmaceutical compositions of the present application
may also contain adjuvants such as preservatives, wetting agents,
emulsifying agents and dispersing agents. Prevention of the action
of microorganisms upon the subject compositions may be ensured by
the inclusion of various antibacterial and antifungal agents, for
example, paraben, chlorobutanol, phenol sorbic acid, and the like.
It may also be desirable to include isotonic agents, such as
sugars, sodium chloride, and the like into the compositions.
Route of Administration
[0046] The pharmaceutical composition of the present application
may be administered intravenously, intra-arterially or in other
suitable ways to a subject in need of such treatment.
Administration of the pharmaceutical composition can occur for a
period of seconds, hours, days or weeks depending on the purpose of
the pharmaceutical composition usage. In some embodiments, the
pharmaceutical composition of the present application is
administered intravenously.
[0047] In some embodiments, the pharmaceutical composition of the
present application is administered by direct infusion into the
kidney through the renal vein. In other embodiments, the
pharmaceutical composition of the present application is
administered by direct infusion into the liver through the hepatic
vein.
[0048] In some embodiments, administration of the pharmaceutical
composition of the present application is performed parenterally.
The phrases "parenteral administration" and "administered
parenterally" as used herein means modes of administration other
than enteral and topical administration, usually by injection, and
includes, without limitation, intravenous, intramuscular,
intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac, intradermal, intraperitoneal, transtracheal,
subcutaneous, subcuticular, intraarticulare, subcapsular,
subarachnoid, intraspinal and intrasternal injection and
infusion.
Dose
[0049] The dosage level of the pharmaceutical composition of the
present application will depend upon a variety of factors including
the activity of the particular composition of the present invention
employed, the route of administration, the time of administration,
the rate of excretion or metabolism of the particular composition
being employed, the duration of the treatment, other drugs,
compounds and/or materials used in combination with the particular
composition employed, the age, sex, weight, condition, general
health and prior medical history of the patient being treated, and
like factors well known in the medical arts.
[0050] A physician or veterinarian having ordinary skill in the art
can readily determine and prescribe the effective amount of the
pharmaceutical composition required. For example, the physician or
veterinarian could start doses of the compositions of the invention
employed in the pharmaceutical composition at levels lower than
that required to achieve the desired therapeutic effect and then
gradually increasing the dosage until the desired effect is
achieved.
[0051] As a general proposition, the therapeutically effective
amount of the agent-f-CNT conjugate of the present application are
administered in the range of about 0.1 .mu.g/kg body weight/day to
about 100000 mg/kg body weight/day whether by one or more
administrations. In some embodiments, the range of each active
agent administered daily is from about 100 .mu.g/kg body weight/day
to about 50 mg/kg body weight/day, 100 .mu.g/kg body weight/day to
about 10 mg/kg body weight/day, 100 .mu.g/kg body weight/day to
about 1 mg/kg body weight/day, 100 .mu.g/kg body weight/day to
about 10 mg/kg body weight/day, 500 .mu.g/kg body weight/day to
about 100 mg/kg body weight/day, 500 .mu.g/kg body weight/day to
about 50 mg/kg body weight/day, 500 .mu.g/kg body weight/day to
about 5 mg/kg body weight/day, 1 mg/kg body weight/day to about 100
mg/kg body weight/day, 1 mg/kg body weight/day to about 50 mg/kg
body weight/day, 1 mg/kg body weight/day to about 10 mg/kg body
weight/day, 5 mg/kg body weight/dose to about 100 mg/kg body
weight/day, 5 mg/kg body weight/dose to about 50 mg/kg body
weight/day, 10 mg/kg body weight/day to about 100 mg/kg body
weight/day, and 10 mg/kg body weight/day to about 50 mg/kg body
weight/day. In some embodiments, the agent-f-CNT conjugate of the
present application is administrated daily at the above-described
doses for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days. In
some embodiments, the agent-f-CNT conjugate of the present
application is administrated daily at the above-described doses for
a period prescribed by the physician or veterinarian to chronically
treat a medically necessary condition.
[0052] In some embodiments, a therapeutically effective dose of
f-CNT/therapeutic RNA conjugate is in the range of 0.1-1000 mg
f-CNT+0.01-100 mg therapeutic RNA per kg per day for 3-7 days. In
some embodiments, the agent-f-CNT conjugate of the present
application is administrated daily at the above-described doses for
a period prescribed by the physician or veterinarian to chronically
treat a medically necessary condition.
Composition
[0053] Another aspect of the present application relates to
pharmaceutical compositions comprising the therapeutic agent-f-CNT
conjugates of the invention and pharmaceutically acceptable
excipients.
[0054] In another aspect of the present application, the present
invention includes a composition comprising single-walled carbon
nanotubes, multi walled carbon nanotubes, or other fibrillar
molecule that have been non-covalently linked to therapeutic RNA
molecules.
Disease Conditions
[0055] The compositions and methods of the present application may
be used for the treatment of disease conditions such as anemia,
liver sinusoidal injury, acute kidney injury or acute renal
failure, liver injury, rhabdomyolysis, contrast-induced
nephropathy, chronic kidney disease and any disease condition that
may be treated by a reduction in BUN-to-creatinine ratio. In
certain embodiments, the compositions and methods of the present
application may be used for the treatment of any acute and/or
chronic renal and/or hepatic injury or disease and any
complications arising from those injuries.
[0056] A "subject" refers to either a human or non-human animal.
Examples of non-human animals include vertebrates, e.g., mammals,
such as non-human primates (particularly higher primates), dogs,
rodents (e.g., mice, rats, or guinea pigs), pigs and cats, etc. In
a preferred embodiment, the subject is a human.
[0057] In certain embodiments, methods and pharmaceutical
compositions of the present application can be employed in
combination therapies, that is, the methods and pharmaceutical
compositions can be administered concurrently with, prior to, or
subsequent to, one or more other desired therapeutics or medical
procedures. The particular combination of therapies (therapeutics
or procedures) to employ in a combination regimen will take into
account compatibility of the desired therapeutics and/or procedures
and the desired therapeutic effect to be achieved. It will also be
appreciated that the therapies employed may achieve a desired
effect for the same disorder (for example, an inventive composition
may be administered concurrently with another anti-proliferative
agent), or they may achieve different effects (e.g., control of any
adverse effects).
[0058] In some embodiments, the pharmaceutical composition of the
present application is used before, after or concurrently, with a
nephrotoxic or hepatoxic drug or a medical procedure to prevent or
reduce renal injury or liver injury caused by the drug or medical
procedure. Nephrotoxic and/or hepatotoxic drugs include, but are
not limited to, antibiotics, such as aminoglycosides, sulfonamides,
amphotericin B, foscarnet, quionlones (e.g., ciprofloxacin),
rifampin, tetracycline, acyclovir, pentamidine, vanomycin;
chemotherapeutics and immunosuppressants, such as cisplatin,
methotrexate, mitomycin, cyclosporine, ifosphamide, zoledronic
acid; anti-hyperlipidemics, such as statin drugs (rhabdomyolysis)
or gemfibrozil; drugs of abuse, such as cocaine, heroin,
methamphetamine, or methadone; and other miscellaneous drugs, such
as chronic stimulant laxative use, radiographic contrast, ACE
inhibitors, NSAIDs, aspirin, mesalamine (e.g., asacol, pentasa),
and aristocholic acid. In some embodiments, the pharmaceutical
composition of the present application is used before, after or
concurrently, to a medical procedure to prevent ischemic injury or
treat or prevent injury from sepsis.
[0059] In one embodiment of the invention, ammonium functionalized
carbon nanotubes have been deployed to deliver bioactive siRNA to
renal PTC as a pharmacological strategy to prevent nephrotoxic
injury. A therapeutically effective dose of f-CNT/siRNA in mice was
1.6 mg f-CNT+0.087 mg siRNA per Kg per day for 3-5 days. These
doses of f-CNT/siRNA were also sufficient to achieve a relative
knock-down of Ctr1 and EGFP and were well tolerated by the host.
This regimen achieved prophylaxis with a cumulative dose of
.about.0.4 mg siRNA/Kg in comparison with other delivery platforms
for gene silencing that required cumulative dosages that approached
7.5 mg/kg in mouse models (1 log less siRNA). The drug constructs
and their components were found to be well tolerated and safe at
the doses employed. The analysis of kidneys from animals in the
f-CNT/siMep1b/siTrp53 group showed significantly lower levels of
macrophage, leukocyte, and T cell infiltration within the kidney
cortex at 14 and 180 days post cisplatin treatment compared to
controls. Longer term fibrosis was also reduced in the combination
drug group. These results show that fibrillar nanocarbon-mediated
RNAi treatment successfully minimizes renal injury from a
nephrotoxic cisplatin dose. Histopathology as assayed by H and E
staining also confirmed statistically improved tissue morphology.
Therefore, this is a pharmacological intervention that improves
progression-free survival, reduces fibrosis and decreases immune
cell infiltration in subjects.
[0060] Below are disclosed methods and systems for targeting the
delivery of therapeutic agents to specific cell types in mammals,
in particular the kidney and liver. Further aspects and advantages
of the application will appear from the following description taken
together with the accompanying drawings.
Examples
Example 1: Materials and Methods
[0061] Synthesis and Characterization of the Soluble,
Functionalized Single Walled Carbon Nanotube Construct.
[0062] The f-CNT were prepared and characterized via covalent
cycloaddition of azomethine ylides with SWCNT. McDevitt, et al.,
PloS One 2, e907 (2007); McDevitt, et al., Society of Nuclear
Medicine 48, 1180-1189 (2007); Ruggiero, et al., Proceedings of the
National Academy of Sciences of the United States of America 107,
12369-12374 (2010); Alidori, et al., The Journal of Physical
Chemistry. C, Nanomaterials and Interfaces 117, 5982-5992 (2013);
Villa, et al., Nano Letters 8, 4221-4228 (2008). Characterization
using different analytical techniques (Transmission Electron
Microscopy (TEM), Dynamic-Light-Scattering (DLS), Kaiser assay,
RP-HPLC and spectrofluorometric titration with siRNA sequences)
revealed an amine content of 0.3 mmol/g of f-CNT and chemical
purity >99%. Dicer validated RNA sequences (Hefner, et al.,
Journal of Biomolecular Techniques: JBT 19, 231-237 (2008)) were
designed to silence enhanced green fluorescent protein (EGFP),
murine copper transport protein 1 (Ctr1), meprin-1.beta. (Mep1b),
and p53 (Trp53); a non-specific scrambled sequence (Scram) was used
as a control. The non-covalent binding of f-CNT and siRNA was
quantified and the binding affinities were .about.5 nmol/L and up
to 4 siRNA could be loaded per f-CNT under physiological
conditions. Alidori, et al., The journal of physical chemistry. C,
Nanomaterials and interfaces 117, 5982-5992 (2013). TEM of solid
f-CNT and f-CNT/siEGFP (1:1 complex) was performed and showed a
f-CNT average length of 300 nm; both samples were water soluble (10
g/L), could be resolved chromatographically, and were rapidly
renally filtered in a murine model. Ruggiero, et al., Proceedings
of the National Academy of Sciences of the United States of America
107, 12369-12374 (2010); Mulvey, et al., Nature nanotechnology 8,
763-771 (2013). DLS analyses provided evidence in aqueous solution
that the molecular lengths of f-CNT and f-CNT/siEGFP (1:1) were
comparable (intensity-based mean diameters were 356.2.+-.14.2 nm
and 332.7.+-.10.6 nm, respectively) and indicated that the
assembled drug construct was not an aggregate of crosslinked
molecules.
[0063] High pressure carbon monoxide (HiPCO) produced single walled
carbon nanotubes (SWCNT, >90% purity) were purchased from
NanoLab, Inc. (Menlo Park, Calif.). Pristine SWCNT were mildly
oxidized in 3M nitric acid (Fisher Scientific, Waltham, Mass.) to
remove metallic impurities. These acid-treated SWCNT were then
reacted with the Boc-amine precursor,
2-(2-(2-(2-(tert-butoxycarbonyl)aminoethoxy)ethoxy)ethylamino)
acetic acid (Discovery ChemScience LLC, Princeton, N.J.) to yield
SWCNT-NHBoc. Georgakilas, et al., Chem Commun, 3050-3051 (2002);
Alidori, et al., The journal of physical chemistry. C,
Nanomaterials and interfaces 117, 5982-5992 (2013). The
SWCNT-NH.sub.2 product (f-CNT) was purified by reverse phase
chromatography after deprotecting the Boc-amine. Briefly, the crude
f-CNT was dissolved in 0.1 M tetraethylammonium acetate ((TEAA),
Fisher) and adjusted to pH 7. Acetonitrile (Fisher) was added to a
final v/v of 20%. A Seppak Plus C18 cartridge (Waters) was
equilibrated with 20% acetonitrile/0.1 M TEAA. The SWCNT-NH.sub.2
was loaded onto the cartridge and washed extensively with 20%
acetonitrile/0.1 M TEAA at 1 mL/min. The purified SWCNT-NH.sub.2
was eluted from the cartridge in 50% acetonitrile/water and the
solvent evaporated to yield the purified SWCNT-NH.sub.2 solid.
Purity and identity of the f-CNT were assessed by UV-Vis
spectroscopy, HPLC, transmission electron microscopy (TEM) and
dynamic light scattering (DLS). Alidori, et al., The journal of
physical chemistry. C, Nanomaterials and interfaces 117, 5982-5992
(2013). Analytical HPLC was performed on a Beckman Coulter System
Gold chromatography system equipped with in-line UV/Vis spectrum
detector and tunable multi-wavelength fluorescence detector (Jasco
FP-2020). Radioactivity was monitored through the use of an inline
.gamma.-RAM Model 3 radioactivity detector (IN/US). The stationary
phase was a Gemini (Phenomenex, Torrence, Calif.) C18 column
(5.mu., 250.times.4.6 mm) column. A 0-to-100% mobile phase gradient
of 0.1M TEAA, pH 6.5 and acetonitrile was used at a flow rate of
1.0 mL/min for 30 minutes. TEM analysis was performed using 200
mesh grids coated with carbon support film and viewed on a JEOL JEM
1400 TEM with a LaB6 filament. Images were taken using an Olympus
SIS Veleta 2 k.times.2 k side mount camera. DLS was performed using
a Zetasizer Nano ZS system equipped with a narrow bandwidth filter
(Malvern Instruments, MA).
[0064] All buffers were prepared with RNAse-free water rendered
metal-free by Chelex 100 resin pre-treatment. Briefly, 0.050 mL of
0.7 mM sense EGFP-NH.sub.2 was buffered to pH 9.5 with 0.100 mL of
a 0.1 M sodium bicarbonate solution. The buffered sense
EGFP-NH.sub.2 solution was then reacted with 0.100 mL of 10 mg/mL
aqueous solution of
2-(4-isothiocyanatobenzyl)-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraa-
cetic acid (p-SCN-Bz-DOTA, Macrocyclics). The reaction mixture was
stirred at ambient temperature for 1 h and then purified by size
exclusion with a 10-DG column (BioRad, Hercules, Calif.) eluted
using metal-free water to yield the sense EGFP-DOTA product. HPLC,
UV-Vis and MALDI-TOF mass spectrometry was used to characterize the
product. Radiolabeling was performed by buffering 0.200 mL of a
0.041 mM sense EGFP-DOTA to pH 5 with 0.090 mL of 1 M ammonium
acetate (NH.sub.4Ac, Fisher) and the subsequent addition of 14 MBq
of indium chloride (.sup.111InCl.sub.3, Perkin Elmer). The labeling
reaction mixture was heated at 60.degree. C. for 30 minutes and
then quenched with 0.200 mL of 0.01 M ethylenediaminetetraacetic
acid (EDTA, Fisher). The labeled EGFP was purified by size
exclusion with a 10-DG column eluted with PBS. The sense
EGFP-[.sup.111In]DOTA strand was then annealed with the
complementary anti-sense strand in annealing buffer (10 mM Tris, 50
mM NaCl, 1 mM EDTA, pH 7.5) with heating to 95.degree. C. for 4
minutes. The radiochemical purity of the product was assayed using
reverse-phase radio-HPLC and radioactivity was monitored through an
inline .gamma.-RAM Model 3 radioactivity detector.
[0065] The SWCNT-[([.sup.86Y]DOTA)(AF488)(AF680)] construct was
prepared by adding 300 MBq (8.1 mCi) of acidic .sup.86Y chloride
(Memorial Sloan-Kettering Cancer Center Cyclotron Core) to 0.400 mg
of a 1 g/L solution of f-CNT in metal-free water (MFW) and 0.050 mL
of 3M ammonium acetate (Aldrich) and 0.015 mL of 150 g/L 1-ascorbic
acid (Aldrich) to yield a pH 5.0 solution. The solution was clear
and dark green-brown in color. The reaction was heated at
61.degree. C. for 45 min., quenched with 0.040 mL of 50 mM
diethylenetriaminepentaacetic acid (DTPA, Aldrich), and then
purified by size exclusion chromatography using a P6 resin (BioRad)
as the stationary phase and 1% human serum albumin (HSA, Swiss Red
Cross) in 0.9% NaCl (Abbott Laboratories) as the mobile phase. An
aliquot of the final product, [.sup.86Y]f-CNT, was used to
determine the radiochemical purity by instant thin layer
chromatography using silica gel. Further spectroscopic,
radiometric, and chromatographic characterization of the construct
was performed by reverse phase HPLC. In-111 was obtained from MDS
Nordion (Vancouver) for other tracer experiments. The
SWCNT-[(DOTA)(AF488)(AF680)] and SWCNT-[DOTA] construct was labeled
using materials and methods similar to those described above for
the .sup.86Y radiochemical labeling process. Both radionuclides
have demonstrated similar labeling kinetics, purities, and yields
in reactions with SWCNT-[(DOTA)(AF488)(AF680)] and
SWCNT-[(DOTA].
siRNA Sequences
[0066] Dicer validated RNA sequences (Hefner, et al., Journal of
biomolecular techniques: JBT 19, 231-237 (2008)) were designed to
silence enhanced green fluorescent protein (EGFP), mouse copper
transport protein 1 (Ctr1), mouse meprin-1.beta. (Mep1b), mouse p53
(Trp53) and were obtained from Integrated DNA Technologies, Inc.
(IDT, Coralville, Iowa) along with a non-specific scrambled
sequence (Scram). The following (sense (s) and antisense (as))
sequences were used:
TABLE-US-00001 siEGFP: (SEQ ID. NO: 1) 5'GCAAGCUGACCCUGAAGUUCAUtt3'
(s), (SEQ ID. NO: 2) 5'AUGAACUUCAGGGUCAGCUUGCCG3' (as), and (SEQ
ID. NO: 3) 5'NH2-(CH2)6-GCAAGCUGACCCUGAAGUUCAUtt3' (amine-modified
sense); and (SEQ ID. NO: 4)
5'Cy3(CH2)2C(O)NH-(CH2)6-GCAAGCUGACCCUGAAGUUCAU tt3' (Cyanine 3
succinimidyl ester modified sense; TriLink Inc., San Diego, CA);
siScram: (SEQ ID. NO: 5) 5'CGUUAAUCGCGUAUAAUACGCGUAt3' (s) and (SEQ
ID. NO: 6) 5'CAGCAAUUAG CGCAUAUUAUGCGCAUA3'(as); siCtr1: (SEQ ID.
NO: 7) 5'GGCAUGAACAUGUGAAUUGCUGGTT3' (s) and (SEQ ID. NO: 8)
3'GUCCGUACUUGUACACUUAACGACCAA5' (as); siMep1b: (SEQ ID. NO: 9)
5'GGAAUUGACCAAGACAUAUUU GATA3' (s) and (SEQ ID. NO: 10)
3'CUCCUUAACUGGUUCUGUAUAAACUAU5' (as); and siTrp53: (SEQ ID. NO: 11)
5'AGGAGUCAC AGUCGGAUAUCAGCCT3' (s) and (SEQ ID. NO: 12)
3'CCUCCUCAGUGUCAGCCUAUAGUCGGA5' (as).
Cell Culture Experiments
[0067] HeLa cells expressing EGFP (EGFP.sup.+HeLa, Cell Biolabs,
San Diego, Calif.) were cultured at 37.degree. C. and 5% CO.sub.2
in high glucose DMEM (Life Technologies, Grand Island, N.Y.)
supplemented with 10% FBS (Life Technologies), 0.1 mM MEM
non-essential amino acid solution (NEAA, Life Technologies), 2 mM
L-Glutamine (Life Technologies), and 0.010 mg/mL Blasticidin (Life
Technologies).
[0068] The kinetics of internalization of f-CNT/siEGFP was
evaluated and quantified in EGFP.sup.+HeLa cells using two
different methods: [0069] (1) Confocal microscopy was used to image
internalization in real time and employed the fluorescent
siEGFP-Cy3 sequence. The f-CNT/siEGFP-Cy3 construct was prepared by
annealing equimolar amounts of f-CNT and siRNA and adjusted to a
final concentration of 50 nM in Opti-MEM (Life Technologies) in the
plate wells. The siEGFP-Cy3 alone was used as control at the same
concentration. Cells were seeded at a density of 2.5.times.10.sup.4
cells per well in a 24-well plate, using serum-free DMEM and
incubated overnight at 37.degree. C. and 5% CO.sub.2. The cells
(n=3 wells per group) were then suffused with 50 nM Opti-MEM
solutions of f-CNT/siEGFP-Cy3 or siEGFP-Cy3 alone. The
internalization of the Cy3-labeled oligonucleotide was imaged every
0.50 h for 5 h by confocal microscopy using a LSM 5 microscope
(Zeiss) (FITC laser excitation: 488 nm; TRITC laser excitation: 561
nm; DIC channel). Images were elaborated with Metamorph 7.8.1.0
(Molecular Devices, Sunnyvale, Calif.). [0070] (2)
Radionuclide-based internalization of siEGFP-[.sup.111In]DOTA was
quantified using a cell-stripping assay performed under similar
conditions. Cells were seeded at 80% confluence in 6-well plates
and incubated overnight as described above. The cells (n=3 wells
per group per time-point) were then suffused with 50 nM Opti-MEM
solutions containing 118.4 MBq of f-CNT/siEGFP-[.sup.111In]DOTA or
siEGFP-[.sup.111In]DOTA alone (specific activity of 59.2 MBq/g).
The supernatant was removed at each time-point (30, 60, 90, 120,
180, 240 and 300 min.) and the cells washed 3 times with 2 mL of
ice-cold PBS. The residual radioactivity on the outer cell membrane
was stripped-off at pH 2.8 with a 50 mM glycine/150 mM NaCl
solution for 10 minutes at 4.degree. C. Cells were again washed
with ice-cold PBS and detached from the plate with Trypsine-EDTA
(0.25%) (Mediatech, Inc., Manassas, Va.); counted on a
hemocytometer; pelleted; and the radioactivity counted on a
.gamma.-counter (Packard Cobra, GMI, Inc., Ramsey, Minn.) using the
15-550 keV window. Aliquots of the 50 nM Opti-MEM solutions that
contained f-CNT/siEGFP-[.sup.111In]DOTA or siEGFP-[.sup.111In]DOTA
were counted and used to quantify the amount of siRNA that
accumulated per cell.
[0071] EGFP.sup.+HeLa cells were used to investigate f-CNT/siEGFP
silencing in vitro using flow cytometry, confocal microscopy,
Western blot analyses, and quantitative RT-PCR. Cells were seeded
in 24-well plates at a density of 2.5.times.10.sup.4 cells per well
using serum-free DMEM and incubated overnight. Lipofectamine 2000
(Lf, Life Technologies) transfection was included as a positive
control to confirm that the siRNA was bioactive.
[0072] Flow cytometry was used to investigate the change in green
fluorescence intensity in cells that were cultured in a 50 nM
solution of (a) f-CNT/siEGFP, (b) siEGFP alone, (c) Lf/siEGFP, (d)
f-CNT/siScram, (e) f-CNT alone, or (f) PBS vehicle in triplicate at
37.degree. C. and 5% CO.sub.2. Cells were harvested and analyzed
with a BD Acuri C6 cytometer (BD Biosciences, San Jose Calif.) to
measure EGFP fluorescence intensity at 1, 2, and 3 days. Data were
analyzed using FlowJoX10 software (FlowJo, LLC, Ashland,
Oreg.).
[0073] Microscopy was used to image the change in green cell
fluorescence in real time. Cells were cultured in a 50 nM solution
of (a) f-CNT/siEGFP, (b) siEGFP alone, or (c) Lf/siEGFP incubated
at 37.degree. C. and 5% CO.sub.2 and imaged with a LSM 5 live
microscope (Zeiss). Images of cells from 3 regions per well were
collected every 30 minutes for 60 h post-transfection.
EGFP.sup.+HeLa cells were imaged using the FITC channel (Ex BP
450-490 nm, Em LP 515 nm) and the DIC channel. The images were
analyzed using Metamorph 7.8.1.0 (Molecular Devices).
[0074] Western blot analysis was used to measure EGFP protein
expression in EGFP.sup.+HeLa cells that were incubated with 50 nM
solution of (a) f-CNT/siEGFP, (b) siEGFP alone, (c) Lf/siEGFP, (d)
f-CNT/siScram, (e) f-CNT alone, or (f) PBS vehicle in triplicate at
37.degree. C. and 5% CO.sub.2. Cells were lysed with RIPA buffer
(25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium
deoxychlolate, 0.1% SDS) on ice for 1 hour. Lysates were
centrifuged at 13,000.times.g for 20 minutes. Supernatants were
collected and measured for total protein concentration using DC
Protein Assay (BioRad) according to the manufacturer's
instructions. Equal amounts of protein (0.0075 mg) were heated at
95.degree. C. for 5 minutes in 1.times. Laemlli sample buffer
containing 2-mercaptoethanol. SDS-PAGE was carried out at 120V for
1 hour using 12% acrylamide gels. Electrophoretically separated
proteins were transferred to a nitrocellulose membrane at 100V for
1 hour. Membrane was blocked in 5% non-fat milk in TBST buffer
overnight at 4.degree. C. On the following day, the nitrocellulose
membranes were incubated with mouse anti-EGFP antibodies (Roche) at
1:10,000 dilution for 1 h at ambient temperature followed by
horseradish peroxidase conjugated goat anti-mouse secondary
antibodies at 1:20,000 dilution for 1 hour at ambient temperature.
Protein bands were detected on X-ray film using an enhanced
chemiluminescence system (ChemiDoc MP imaging system, BioRad).
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or .beta.-actin
was included as loading controls and were measured to evaluate
protein loading using an anti-GAPDH pAb (R&D Systems) or
anti-.beta.-actin antibody.
[0075] Quantitative RT-PCR analysis was used to measure EGFP mRNA
expression in EGFP.sup.+HeLa cells that were incubated with 50 nM
solution of (a) f-CNT/siEGFP, (b) siEGFP alone, (c) Lf/siEGFP, (d)
f-CNT/siScram, (e) f-CNT alone, or (f) PBS vehicle in triplicate at
37.degree. C. and 5% CO.sub.2. RNA extraction was carried out using
RNeasy Plus Mini Kit (Qiagen) according the manufacturer's
instructions. RNA quality and concentration was measured at 260 nm
using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher
Scientific). Total RNA (150 ng) was reverse transcribed to cDNA
using a First Strand cDNA Synthesis kit (Thermo Scientific)
according to manufacturer's instructions. PCR reaction was carried
out by adding 0.002 mL of cDNA (15 ng) to 0.010 mL of TaqMan RT-PCR
Mastermix (Applied Biosystems), 0.001 mL of primers specific to
EGFP (IDT), and 0.007 mL of UltraPure DNase/RNase-Free distilled
water (Life Technologies). Data were normalized to GAPDH and are
expressed as fold-change relative to no treatment controls.
[0076] EGFP.sup.+HeLa cells were plated at 20% confluence in a
24-well plate and incubated for 24 h. Cells were seeded with 0.60
mL of f-CNT in high glucose DME media at different concentrations
(10 to 200 mg/L) in triplicate. Controls included triplicates of
untreated cells, and triplicates of cells seeded with 0.001 mL of
Lf mixed with 0.05 mL of Opti-MEM and 0.55 mL of high glucose DME
media. All cell groups were incubated at 37.degree. C. for 24 h,
washed, trypsinized with 0.20 mL of a mixture of 0.25% Trypsin and
1 mM EDTA for 5 minutes at 37.degree. C. and quenched with 0.50 mL
of high glucose DME media. Viability was evaluated by flow
cytometry with a BD Acuri C6 cytometer (BD Biosciences) using
propidium iodide (Life Technologies) to detect dead cells.
Immunohistochemical and Immunofluorescence Staining
[0077] Mice ( , NCr/nu/nu, Taconic) received an IV injection of
SWCNT-[([.sup.111In]DOTA)(AF488)(AF680)] and
SWCNT-[([.sup.111In]DOTA)] containing 0.04 mg of SWCNT construct
and 74 kBq (0.002 mCi) of .sup.111In per mouse via the retroorbital
sinus. The animals were placed into 4 groups of 3-5 mice per group.
Each group was sacrificed with CO2 aspiration at 1 h, 3 h, 24 h and
7 d. Tissue samples (blood, heart, kidneys, muscle, bone, lung,
stomach, spleen, liver, bile, small intestine (consisting of the
duodenum, jejunum, and ileum), contents of the small intestine,
large intestine (consisting of the cecum and colon), contents of
the large intestine), and feces were harvested, weighed, and
counted using a .gamma.-counter (Packard Instrument Co.) with a 315
to 435 keV energy window. Standards of the injected formulation
were counted to determine the % ID/g.
[0078] Mice (male, NCr/nu/nu, Taconic) received 0.01 mg of
f-CNT-(AF488)(AF680)(DOTA) in 0.10 mL of 1% human serum albumin
((HSA, Swiss Red Cross, Bern, Switzerland) in 0.9% NaCl (Abbott
Laboratories, North Chicago, Ill.)) administered intravenously (IV)
via the retroorbital sinus. f-CNT was covalently modified with
AlexaFluor 488 tetrafluorophenyl ester (AF488-TFP, Invitrogen),
AF680-SE, and
2-(4-isothiocyanatobenzyl)-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraa-
cetic acid (DOTA, Macrocyclics). Ruggiero, et al., Proceedings of
the National Academy of Sciences of the United States of America
107, 12369-12374 (2010). The f-CNT-(AF488)(AF680)(DOTA) was assayed
to contain 0.02, 0.04 and 0.4 mmol of AF488, AF680 and DOTA per
gram of f-CNT, respectively. Representative constructs (L.about.300
nm; MW-300 kD) displayed 7-10 AF488, 14-20 AF680, and 140-200 DOTA
moieties per f-CNT. Mice were euthanized at 1, 3, 5, 20, 40, 60,
180 min., 24 h and the liver, spleen and kidneys harvested for
immunofluorescence (IF) analyses. Controls included tissue from
mice that received no construct; mice the received only the
hydrolyzed-AF488 dye; and isotype-control staining of tissues with
a non-specific primary antibody. Harvested tissue was fixed
overnight in 4% paraformaldehyde at 4.degree. C., embedded in
paraffin, and sectioned to obtain 0.005 mm thick samples. Widefield
microscopy was performed with an Axioplan2 imaging microscope,
equipped with AxioCam MRm Camera (Zeiss, Inc), using filter cubes
for DAPI, AF488 and TRITC. Slides were also scanned with the FLASH
scanner (Perkin Elmer) to get an overview of the tissue. Confocal
microscopy was performed using an Inverted Leica TCS SP5 microscope
(Leica Microsystems, Inc). All 3D rendering was done with Imaris
(Bitplane).
[0079] The immunofluorescent staining was performed in the
Molecular Cytology Core Facility of Memorial Sloan Kettering Cancer
Center using Discovery XT processor (Ventana Medical Systems). The
tissue sections were deparaffinized with EZPrep buffer (Ventana
Medical Systems), antigen retrieval was performed with CC1 buffer
(Ventana Medical Systems) and sections were blocked for 30 minutes
with Background Buster solution (Innovex) for anti-Alexa488,
beta-catenin, Iba1, CSF-1R, GM130 and GFAP antibodies or with 10%
normal rabbit serum (Vector Labs) in PBS for anti-CD31, Lyve1 and
LAMP2 antibodies. Anti-AF488 (Molecular Probes, cat. no. A-11094, 5
.mu.g/mL), anti-.beta.-catenin (Sigma Aldrich, cat. no. C2206, 5
.mu.g/mL), anti-Iba1 (Wako, cat. no. 019-19741, 0.5 .mu.g/mL),
anti-CSF-1R (Santa Cruz, cat. no. sc-692, 0.5 .mu.g/mL) and
anti-GFAP (DAKO, cat. no. Z0334, 1 .mu.g/mL) antibodies were
applied and sections were incubated for 5 hours, followed by 60
min. incubation with biotinylated goat anti-rabbit IgG (Vector
labs, cat. no. PK6101) at 1:200 dilution. Anti-CD31 (DIANOVA, cat.
no. DIA-310, 1 .mu.g/mL) and anti-LAMP2 (Abeam, cat. no. ab13524,
0.5 .mu.g/mL) antibodies were applied and sections were incubated
for 5 hours, followed by 60 min. incubation with biotinylated
rabbit anti-rat IgG (Vector labs, cat. no. PK-4004) at 1:200
dilution. Anti-Lyve1 (R&D Systems, cat. no. AF2125, 1 .mu.g/mL)
antibodies were applied and sections were incubated for 3 h,
followed by 60 min. incubation with biotinylated rabbit anti-goat
IgG (Vector, cat #BA-5000) at 1:200 dilution. Anti-GM130 (BD
Pharmingen, cat. no. 610823, 1 .mu.g/mL) antibodies were applied
and sections were incubated for 3 h., followed by 60 min.
incubation with biotinylated horse anti-mouse IgG (Vector Labs,
cat. no. MKB-22258) at 1:200 dilution. The detection was performed
with Streptavidin-HRP D (DABMap kit, Ventana), followed by
incubation with one of the following Tyramide Alexa Fluors
(Invitrogen): AF488 (cat. no. T20922) only for anti-AF488,
anti-AF546 (cat. no. T20933), anti-AF568 (cat. no. T20914),
anti-AF594 (cat. no. T20935) or anti-AF647 (cat. no. T20936)
prepared according to the manufacturer instructions with
predetermined dilutions. Slides were counterstained with DAPI
(Sigma Aldrich, cat. no. D9542, 5 .mu.g/mL) for 10 min. and
coverslipped with Mowiol.
[0080] Kidney, spleen and liver tissue sections were stained using
a Discovery XT processor (Ventana Medical Systems) in the MSKCC
Molecular Cytology Core Facility. Mice were euthanized according to
approved protocols and tissues harvested and washed in ice-cold
PBS, fixed for 24 h in 4% paraformaldehyde, embedded in OCT, frozen
at -80.degree. C., and cryo-sectioned to obtain 0.005 mm thick
samples for fixed-frozen sections. The paraffin embedding process
involved tissue fixation for 24 h in 4% paraformaldehyde, washed
and stored at 4.degree. C. in 70% ethanol and embedded in paraffin.
The tissue sections were blocked for 30 min. in 10% normal goat
serum and 2% bovine serum albumin (BSA) in PBS. After staining with
the primary antibody, slides were incubated for 1 h with
biotinylated goat anti-rabbit IgG (Vector labs, cat#: PK6101) with
a 1:200 dilution. Secondary Antibody Blocker, Blocker D,
Streptavidin-HRP and DAB detection kit (Ventana) were used
according to the manufacturer's instructions for IHC. In the case
of IF, detection was performed with streptavidin-HRP (Ventana)
followed by incubation with green-fluorescent AlexaFluor 488
tyramide (Invitrogen, cat# T20922). Collagen type I and III
staining was performed using the picrosirius red kit (Polysciences,
Inc., Cat#24901) according to the manufacturer's instruction.
Animal Experiments
[0081] The experiments used female Balb/c mice (Taconic, Hudson,
N.Y.) aged 6-7 weeks or 49-52 weeks; male nu/nu aged 8-12 weeks
(Taconic); female C57BL/6 p53 null and female C57BL/6 wild-type
(Jackson Labs, Bar Harbor, Me.) 6-8 week old. The .beta.-actin-EGFP
transgenic C57BL/6 mice were kindly provided from the Joyce
laboratory at MSKCC (female, 8-10 week old).
[0082] Imaging was performed with the microPET Focus.TM. 120 (CTI
Molecular Imaging) in a naive mouse model. Mice ( , NCr/nu/nu,
Taconic) were maintained under 2% isoflurane/oxygen anesthesia
during the scanning. One-hour list-mode acquisitions were commenced
at the time of intravenous (IV) injection of 0.01 mg per mouse
(initially 2.78 MBq (0.075 mCi)) of
SWCNT-[([86Y]DOTA)(AF488)(AF680)] via a 27G tail vein catheter
(Vevo MicroMarker TVA, Visual Sonics) placed in the lateral tail
vein. For all in vivo experiments, housing and care were in
accordance with the Animal Welfare Act and the Guide for the Care
and Use of Laboratory Animals. The animal protocols were approved
by the Institutional Animal Care and Use Committee at MSKCC. An
energy window of 350-700 keV and a coincidence timing window of 6
ns were used. The resulting list-mode data were sorted into twelve
12-s (0-5 min), twelve 30-s (5-10 min) and fifty 60-s (10-60 min)
time bins and into 2-dimensional histograms by Fourier rebinning,
and transverse images were reconstructed in a
128.times.128.times.96 matrix by filtered back-projection. The
image data were corrected for nonuniformity of the scanner
response, dead time count losses, and physical decay to the time of
injection. No correction was applied for attenuation, scatter, or
partial-volume averaging. The measured reconstructed spatial
resolution of the Focus120 scanner is 1.6 mm full width at half
maximum at the center of the field of view. The counting rates in
the reconstructed images were converted to activity concentrations
(percentage injected dose per gram of tissue (% ID/g)) by use of an
empirically determined system calibration factor (MBq/mL/cps/voxel)
derived from the imaging of a mouse-size phantom containing
18F.
[0083] Biodistribution studies of f-CNT/siEGFP-[.sup.111In]DOTA
versus siEGFP-[.sup.111In]DOTA alone were conducted on 6-7 week old
female Balb/c mice. The 1:1 (mol:mol) complex of f-CNT/siEGFP was
assembled using the radiolabeled siEGFP-[.sup.111In]DOTA component
as the tracer. Briefly, the carrier siEGFP molecule (0.042 mL of a
0.020 mM solution) was mixed with the tracer
siEGFP-[.sup.111In]DOTA (0.094 mL containing 444 kBq of .sup.111In
activity) and this mixture was heated to 95.degree. C. for 4 min.
The annealed radiolabeled siEGFP was added to a solution of f-CNT
(0.558 mL of a 1.47 mM solution) at ambient temperature in PBS. The
siEGFP-only control was similarly annealed and used 0.042 mL of a
0.020 mM siEGFP solution mixed with siEGFP-[.sup.111In]DOTA (0.094
mL containing 444 kBq) and this mixture was added to 0.558 mL of
PBS at ambient temperature. A dose of 0.032 mg of
f-CNT/siEGFP-[.sup.111In]DOTA in 0.100 mL of 1% HSA was
administered IV to each mouse in the experimental group (n=5); each
animal in the control group (n=5) mice was injected with 0.002 mg
of siEGFP-[.sup.111In]DOTA in a 0.100 mL volume of HSA. Following
injection, the mice were maintained under isofluorane-induced
anesthesia for 1 h and then euthanized. Tissues (heart, kidneys,
lung, spleen, liver, stomach, intestine, muscle and bone), blood,
and urine were harvested, weighed, and counted using a
.gamma.-counter (Packard) with a 315 to 435 keV energy window.
Standards of the injected formulation were counted to determine the
percent of the injected dose (% ID) and % ID per gram (% ID/g) per
tissue. Samples of the injected formulations and urine samples from
each group were analyzed by HPLC.
[0084] The kidney accumulation of f-CNT/siEGFP-[.sup.111In]DOTA was
investigated as a function of dose and schedule. The following dose
regimens of f-CNT/siEGFP-[.sup.111In]DOTA in 1% HSA were
administered per mouse per group (n=3): (i) 1.times.0.015 mg; (ii)
1.times.0.03 mg; (iii) 2.times.0.03 mg (spaced 1 h apart); (iv)
3.times.0.03 mg (spaced 1 h apart); and (v) 1.times.0.09 mg.
Following injection, the mice were maintained under
isofluorane-induced anesthesia for 1 h and then euthanized. Kidneys
and blood were harvested, weighed, and counted using a
.gamma.-counter.
[0085] A characteristic daily dose to achieve RNAi was 0.032 mg of
f-CNT/siRNA per 20 g mouse (comprised of 0.030 mg of f-CNT and
0.0017 mg siRNA). The lower limit of concentration necessary to
assure that the f-CNT and siRNA remained bound in vivo was 0.015 mg
per mouse or a half-dose. The renal and blood accumulation of
activity following the administration of 0.5; 1; 2 (2.times.0.03
mg, spaced 1 h apart); 3 (3.times.0.03 mg, spaced 1 h apart); and 1
dose of 0.09 mg per mouse was studied. It was observed that the
renal accumulation appeared to increase linearly with dose and
further that the brush border reset after 1 hour. Ruggiero, et al.,
Proceedings of the National Academy of Sciences of the United
States of America 107, 12369-12374 (2010). The brush border was
saturated with the single 0.09 mg dose per mouse. Therefore, a
maximum single dose should be approximately 0.06 mg. The other
option could be multiple doses spaced 1 hour apart. This shows that
the brush border accumulated activity was rapidly internalized, and
the brush border resets within 1 h and is prepared to receive more
drug. While the daily 0.03 mg dose per mouse was sufficient to
achieve knock-down, there appears to be therapeutic window to
increase the dosage as necessary. The absence of radioactive counts
in the blood indicated that the biodistribution process was
completed.
[0086] The EGFP knock-down in vivo experiment was conducted on
.beta.-actin-EGFP transgenic C57BL/6 mice arranged in 4 groups of
mice (n=4 per group). The f-CNT/siEGFP drug for the Group I animals
was prepared by mixing 0.064 mL of a 0.020 mM solution of siEGFP
with a 0.576 mL of a 0.00112 mM f-CNT solution and 0.0704 mL of
10.times.PBS. The f-CNT/siScram control drug for the Group II
animals was prepared in a similar fashion. The Group III mice
received siEGFP alone that was prepared by mixing 0.064 mL of
siEGFP with 0.646 mL of PBS. Group IV mice received only the PBS
vehicle control. Each animal per group received a 0.220 mL IV daily
injection of the respective drug/control for 3 consecutive days.
Mice were sacrificed 1 day after the last injection. Tissues were
harvested and fixed frozen for histological studies. Images were
acquired with an inverted fluorescence microscope (Nikon Ti-Eclipse
run with NIS-Elements Ar) and processed with FIJI. Schindelin, et
al., Nature methods 9, 676-682 (2012). Region-of-interest (ROI)
analysis was done on 20.times. magnification 0.010 mm thick
sections imaged with WL (DIC like) DAPI and EGFP channel.
Approximately 50 tubules per experimental or control image were
quantified (over 300 cells per group). The FIJI Cell Counter
plug-in (ImageJ 1.47 k) was used. The Cell Counter plug-in was
developed by Kurt DeVos, University of Sheffield, Academic
Neurology.
[0087] The Ctr1 knock-down and copper-64 uptake into kidneys in
vivo study was conducted on 3 groups of 5 balb/c mice (female, 6-7
weeks old). The Group I mice received f-CNT/siCtr1 that was
prepared by mixing 0.042 mL of a 0.020 mM solution of siCtr1 with
0.164 mL of f-CNT (0.0039 mM) and 0.396 mL of PBS. Group II control
mice received a regimen of only the siCtr1 that was prepared my
mixing 0.042 mL of siCtr1 and 0.458 mL of PBS. The Group III mice
received only a regimen of the PBS vehicle. The dose regimens were
the following: 0.033 mg of f-CNT/siCtr1, 0.002 mg of siCtr1, or the
PBS vehicle administered in 0.100 mL PBS to each mouse per group
every day for 3 consecutive days. On the third day, every animal
received an IV injection of 133 kBq of .sup.64CuCl.sub.2
(Washington University) in NSS and were then sacrificed after 1 h.
The kidneys, liver, heart, and blood were harvested, weighed, and
radioactivity measured on a .gamma.-counter. The % ID/g was
evaluated by comparison with known standards.
[0088] Progression-free survival was evaluated in mice
prophylactically treated to silence the renal expression of Ctr1
protein in anticipation of a scheduled nephrotoxic dose of
cisplatin. The two groups of female balb/c mice (10-12 month old)
were (a) f-CNT/siCtr1 (n=7) and (b) PBS vehicle (n=3). Each animal
received a daily dose of 1.6 mg f-CNT+0.087 mg siCtr1 per kg (1:1,
mol/mol) or PBS vehicle in a volume of 0.100 mL by IV injection for
5 consecutive days. On day 3, a single IP dose of cisplatin (Sigma,
10 mg/Kg in NSS) was administered. Blood samples from each mouse
were collected on days 0, 1 and 6 (from cisplatin administration);
weights were recorded daily; and observations of activity were
noted. Progression-free survival was analyzed using the
Kaplan-Meier method to score outcomes of weight loss (.gtoreq.20%
of initial mass), renal biomarker values (.gtoreq.3 standard
deviations relative to untreated group mean), severe lethargy or
death.
[0089] The effective and biocompatible f-CNT-mediated knock-down of
p53 and Meprin-1.beta. in vivo study employed 5 groups of female
balb/c mice (2-3 months old) that were arranged as follows: (a)
f-CNT/siMep1b (n=7); (b) f-CNT/siTrp53 (n=7); (c) siMep1b (n=7);
(d) siTrp53 (n=7); and (e) PBS vehicle (n=3). Each animal received
a daily 0.100 mL IV injection of 0.032 mg of the 1:1 (mol/mol)
f-CNT/siRNA constructs, 0.002 mg of the siRNA alone, or the PBS
vehicle for 3 consecutive days. Renal health was assessed on day 4
using a metabolic panel that assayed blood urea nitrogen (BUN),
serum creatinine (sCr), phosphorous (P), and magnesium (Mg) as
biomarkers of kidney injury; these assays were performed by the
MSKCC Pathology Core laboratory. Kidneys were harvested on day 4,
fixed, sectioned and stained with hematoxylin and eosin (H&E)
to examine tissue morphology as a function of treatment. Tissue
morphology was examined and scored blindly scored by an
institutional veterinary pathologist. The expression of
meprin-1.beta., and p53 in the renal cortex was evaluated using
immunohistochemistry and quantitative ROI analysis. Tissues images
were analyzed by reporting the area of cells above a set intensity
threshold divided by the total area sampled. In addition to the
controls listed herein, the contribution from only the secondary
antibody was measured.
[0090] An evaluation was conducted of progression-free survival in
mice that were prophylactically treated to silence the renal
expression of p53 and meprin-1.beta., in anticipation of a
scheduled nephrotoxic dose of cisplatin, to test the medicinal
utility of f-CNT-mediated RNAi. Over a 5 day period, each animal
received a daily dose of 1.6 mg f-CNT+0.087 mg siRNA per kg (1:1
mol/mol) or 0.087 mg siRNA per kg or PBS vehicle in 0.100 mL by IV
injection. On day 3, a single IP dose of cisplatin (Sigma, 10 mg/Kg
in NSS) was administered. In this study 8 groups of female balb/c
mice (10-12 month old) were arranged as follows: (a) PBS vehicle
(n=5); (b) f-CNT/siMep1b (n=8); (c) f-CNT/siTrp53 (n=8); (d)
f-CNT/siScram (n=8); (e) siMep1b (n=8); (f) siTrp53 (n=8); (g) a
combination of f-CNT/siMep1b/siTrp53 (n=8); and (h) a combination
of siMep1b/siTrp53 (n=8). Blood samples from each mouse were
collected on days 0, 1, 5, 8 and 11 (from cisplatin
administration); weights were recorded daily; and observations of
activity were noted. Mice were sacrificed at day 14 and kidneys
were collected, fixed and embedded in paraffin for histological
studies. Progression-free survival was analyzed using the
Kaplan-Meier method to score outcomes of weight loss (.gtoreq.20%
of initial mass), renal biomarker values (.gtoreq.3 standard
deviations relative to untreated group mean), severe lethargy or
death. The 10 mg/Kg cisplatin dose was selected for use in these
mice to produce a nephrotoxic insult and was determined based on a
dose response study that measured renal damage biomarkers and
survival as a function of time from administration.
[0091] A dose response experiment was performed to assess
nephrotoxicity in Balb/c mice. Mice were weighed and then
administered an IP injection of different doses of cisplatin
(Sigma) in NSS (0, 7.5, 15, 22.5 and 30 mg/Kg). Blood was collected
at 24 h post-injection to assess changes in BUN, serum creatinine,
phosphorous and magnesium relative to control animals.
[0092] Cisplatin nephrotoxicity in Trp53 null mice was studied
using female C57BL/6 p53-null (n=5) and wild-type (n=5) mice which
received a 22.5 mg/Kg IP dose of cisplatin in NSS. Untreated
controls (n=5 mice per group) received only IP injections of NSS.
BUN and serum creatinine biomarkers were assayed at 24 h
post-administration.
Data Analyses
[0093] Three-dimensional region-of-interest analysis on PET images
was performed with AsiPRO VM 5.0 software (Concorde Microsystems).
Widefield and confocal microsopy images were evaluated using ImageJ
(NIH, http://rsb.info.nih.gov/ij/), AxioVision LE (Zeiss), and
Amira 4.1 (Visage Imaging, Inc.) software. Graphs were constructed
and statistical data were evaluated using Graphpad Prism 3.0
(Graphpad Software, Inc.). Statistical comparison between 2
experimental groups was performed using a t test (unpaired
comparison).
[0094] Incorporated herein by reference are all protocols and
methods disclosed in Ruggiero A, et al. (2010) Paradoxical
glomerular filtration of carbon nanotubes. Proc Natl Acad Sci USA
107(27):12369-12374; McDevitt M R, et al. (2007) PET imaging of
soluble yttrium-86-labeled carbon nanotubes in mice. PLoS One
2(9):e907; Ruggiero A, et al. (2010) Imaging and treating tumor
vasculature with targeted radiolabeled carbon nanotubes. Int J
Nanomedicine 5:783-802.
Example 2: Kinetics of f-CNT-Mediated siRNA Transport In Vitro
[0095] The kinetics of cellular internalization of the 1:1 complex
were investigated with HeLa cells that expressed EGFP
(EGFP.sup.+HeLa) using time-lapse confocal microscopy and a cyanine
dye-siRNA construct (siEGFP-Cy3). The EGFP.sup.+HeLa cells were
exposed to a 50 nM concentration of f-CNT/siEGFP-Cy3 (1:1) and
internalization was imaged as a function of time. In accordance
with a loading and off-loading mechanism, the molecular
f-CNT/siEGFP-Cy3 assembly did not fluoresce upon excitation (due to
the quenching of the cyanine emission by the f-CNT). The siEGFP-Cy3
began to dissociate from f-CNT and Cy3 emission was detected at 2 h
and peaked at 5 h as the f-CNT/siEGFP-Cy3 was internalized and
diluted intracellularly (relative to the initial concentration of
the f-CNT/siEGFP in the extracellular milieu). The siEGFP-Cy3 alone
exhibited negligible internalization. This dynamic fluorescence
microscopy result underscored the importance of the f-CNT as an
efficient delivery vehicle and validated a concentration-based
off-loading mechanism.
[0096] This kinetic result was confirmed with a radioassay that
measured f-CNT/siEGFP-[.sup.111In]DOTA internalization in the
EGFP.sup.+HeLa cell system. Cellular internalization occurred 1-3 h
post-transfection and the f-CNT-mediated siEGFP-[.sup.111In]DOTA
uptake was greater than the cellular uptake of
siEGFP-[.sup.111In]DOTA alone (control) for all time-points. This
radioassay permitted quantification of the mass of siEGFP delivered
by f-CNT to the cell based upon the specific activity. Accordingly,
approximately 10.sup.4 molecules of siRNA were delivered by f-CNT
per cell versus minimal uptake in the control.
[0097] A macromolecular singled-walled carbon
nanotube-[(DOTA)(AF488)(AF680)] nanomaterial (f-CNT) was used to
describe renal distribution and glomerular filtration and to probe
hepatic processing of f-CNT. This nanomaterial was designed to
investigate the global (whole body), local (liver), and cellular PK
profile in an animal model and report its location via multiple
imaging modalities.
[0098] f-CNT was prepared from amino-functionalized single-walled
carbon nanotubes that have been further functionalized with
multiple copies of fluorescent dyes and metal-ion chelates;
radiolabeled with yttrium-86 (86Y; .beta.+; t1/2=14.7 h) or
indium-111 (.sup.111In; .gamma.; t1/2=2.81 d) and characterized
before and after injection into mice. The f-CNT is assayed to
contain 0.02, 0.04 and 0.4 mmol of AF488, AF680 and DOTA per gram
of single-walled carbon nanotubes, respectively. Representative
constructs (L-300 nm; MW-300 kD) would display 7-10 AF488, 14-20
AF680, and 140-200 DOTA moieties per f-CNT. [.sup.86Y]f-CNT had a
specific activity of 322 GBq/g (8.7 Ci/g) and was .gtoreq.96%
radiochemically pure. Multi-walled carbon nanotubes and any
fibrillar molecule (aspect ratio greater than 1) can also be used
(FIGS. 1D-E). See Scheinberg D A, Villa C H, Escorcia F E, McDevitt
M R. "Carbon Nanotubes" In: Drug Delivery in Oncology. From Basic
Research to Cancer Therapy, 3 Vol., Klutz, Senter, and Steinhagen
(editors) Wiley-VCH, Weinheim, Germany (2011) pp. 1163-1185. ISBN:
978-3-527-32823-9.
[0099] The PK profile of the construct was determined with i)
dynamic positron emission tomography (PET) imaging; ii) tissue and
fluid harvest of the entire animal; and iii) immunofluorescence
(IF) staining and microscopy of the liver to mark f-CNT location.
IF co-staining serves to identify and demarcate specific hepatic
cell populations and associated organelles that process the
f-CNT.
[0100] f-CNT rapidly cleared the blood with a small fraction
accreted in the liver or transported via the bile into the gall
bladder and subsequently the lower alimentary canal for
elimination. Dynamic PET imaging, tissue biodistribution, and
chromatographic analysis of bile were performed to investigate the
whole body PK profile in a naive animal model. The whole body
projection image for a representative mouse showed that the
activity in the vascular compartment was cleared by 60 min. and
revealed high contrast images that emphasized only minimal tissue
(kidney, liver and spleen) activity.
[0101] The majority of the injected activity (.about.80-85%) was
rapidly eliminated in the urine as determined by bladder imaging.
The f-CNT demonstrated rapid blood clearance, predominantly renal
elimination (urine), and localization of only a fraction of the
injected dose in the liver, kidneys and spleen within 1 hour
post-administration. Time-activity curves for blood and liver (FIG.
1B) graphically showed the rapid clearance from the blood
compartment (t1/2.about.6 min.) and the swift accumulation of a
fraction of the injected dose (ID) in the liver. Biodistribution
experiments (FIG. 1C) measured the % ID that partitioned into the
blood, tissue, and bile as a function of time. Activity was
measured in the liver (1.39.+-.0.39% ID/g), bile (0.35.+-.0.15%
ID/g) and small intestines (the duodenum, jejunum, and ileum
contained 2.17.+-.2.31% ID/g) at 1 h. The liver had 2.26.+-.1.78%
ID/g and the bile had 0.22.+-.0.16% ID/g at 3 h. The activity
eliminated via the alimentary canal was in feces by 24 h as
determined by activity counts.
[0102] Intact f-CNT was transited into the gall bladder as shown
using radiochromatographic analysis of the radioactivity (eluted at
13-15 min.) that collected in the bile. Control experiments
examined an external physical mixture of the radiolabeled f-CNT
with bile removed from a naive animal which exhibited the same
retention time (13-15 min.). Little-to-no activity was observed in
the bile of control mice that were injected with only
[.sup.111In]DOTA and suggested that renal clearance was preferred
for this small molecule. A further control verified that the
radiolabeled chelate was still attached to the f-CNT as only the
[.sup.111In]DOTA component (externally mixed with naive bile)
eluted at an earlier time (8-9 min.) in the reverse phase
method.
[0103] The f-CNT that accumulated in the liver was not in the
hepatocytes, rather, it was limited to cells residing in the
sinusoidal space. IF microscopy revealed that f-CNT was localized
exclusively in the hepatic sinusoids, associated with small
nucleated cells lining the sinusoids. f-CNT was visualized using
anti-AF488 staining that was directed at the AF488 moieties
covalently appended onto the SWCNT sidewall (FIG. 1A). This
anti-AF488 probe was multiplexed with 4',6-diamidino-2-phenylindole
(DAPI) stain and an array of appropriate co-stains selected to
classify distinct cell types and organelles. The absence of f-CNT
in the HC population was corroborated with N-cadherin staining
which delineated the HC plasma membrane. Once the f-CNT cleared the
blood compartment there were no changes in tissue distribution
observed as a function of time.
[0104] The two experimental controls included mice that were
injected with only AF488 and a mouse that received only the
injection vehicle; neither control liver section stained with
anti-AF488. Additionally, a fraction of f-CNT that entered the
liver, but did not localize in the hepatic sinusoid, was found
intact in the bile and subsequently in the intestine (FIG. 1C).
However, the f-CNT that was eliminated intact via the bile was not
localized to the BDEC that provided the conduit to the gall
bladder.
[0105] Liver sinusoidal endothelial cells (LSEC) localized the
f-CNT which was compartmentalized in the lysozomes and Golgi
apparatus. The discontinuous LSEC that line the hepatic sinusoids
were the predominant cell type that localized the f-CNT as
confirmed by multiplex IF detection with CD31, Lyve1, anti-AF488,
and DAPI stained liver sections. CD31 is a pan-endothelial marker
and Lyve1 is a marker for lymphatic endothelial cells with the LSEC
being a notable exception. The CD31 and Lyve1 cell membrane markers
entirely circumscribed the anti-AF488 signal, substantiating f-CNT
uptake into the LSEC population. In some of these cells, the
punctuate anti-AF488 staining pattern was associated with both
Lamp2 stained lysozomal and GM130 stained Golgi compartments.
Continuous VE constituting the rest of the liver vasculature did
not show any accumulation of the f-CNT and called attention to the
differential capacities of specialized discontinuous LSEC and
continuous VE to accumulate and internalize f-CNT. Liver sections
stained with MECA32, another VE cell marker, confirmed this
finding.
[0106] The Kupffer cells (KC; predominant liver macrophages) did
not accumulate f-CNT to any extent. Surprisingly, KC engulfment of
f-CNT was very rarely observed in IF images of the liver sinusoid.
These data were generated by multiplex IF staining directed against
the AF488, CSF-1R, and DAPI. This result was confirmed using Iba-1,
another macrophage marker. In addition, 3-dimensional images
confirmed the absence of anti-AF488 and CSF-1R co-localized signal
in the sinusoid.
[0107] Stellate cells only rarely accumulated f-CNT. The SC
population in the liver perisinusoids was mapped with GFAP. Only a
very infrequent co-localization of anti-AF488 and GFAP was observed
as compared to the LSEC. Images employing anti-AF488, DAPI, Lyve1,
and GFAP only rarely showed f-CNT and SC association but
demonstrated predominant LSEC accumulation.
[0108] Splenic cell accumulation of f-CNT paralleled hepatic
localization. Biodistribution studies showed that the spleen was
another site of f-CNT uptake (<1% ID/g) (FIG. 1D). Splenic
tissue sections from mice injected with f-CNT stained positively
for AF488 versus tissue from a control animal that received only
AF488. IF imaging analyses showed that f-CNT accumulated in the
specialized splenic sinusoidal endothelium (SSEC) using
.beta.-catenin and CD31 stains. 3-D images confirmed the
co-localization of f-CNT and SSEC in the splenic sinusoid. The
splenic macrophage (SM) population (stained with Iba-1) did not
accrete f-CNT. This profile paralleled the cytodistribution
observed in the liver.
[0109] Nanoparticles, in general, are severely limited by untoward
hepatic uptake and lack of renal clearance. While the bulk of f-CNT
are renally cleared, the next most prominent organ contributing to
their clearance is the liver. However, the hepatic PK data reported
herein showed the surprising result that f-CNT either accumulated
chiefly in LSEC (professional endothelial scavengers) or cleared
intact by hepatobiliary elimination. The liver biocompatibity of
these nanomaterials is now explained by a combination of specific
and efficient LSEC scavenging and intact biliary clearance.
[0110] The various nonparenchymal cells that populate the liver
sinusoid are interleaved and difficult to distinguish. Multiple IF
stains differentiate between KC, LSEC, and SC. The data
demonstrated that most of the f-CNT was scavenged by LSEC,
presumably because this nanomaterial behaved like a macromolecule
rather than a large particulate which were expected to be
phagocytosed by KC. The presumed KC opsonophagocytosis of
single-walled carbon nanotubes was not observed with this f-CNT as
determined using discreet cell markers to unequivocally identify
phenotype. The lack of definitive evidence of KC uptake may well
reflect the distinct physicobiochemical properties of this
covalently modified f-CNT versus non-covalently modified
single-walled carbon nanotubes (e.g., dispersed with a surfactant
or polyethylene glycol). Non-covalently modified single-walled
carbon nanotubes exhibited only a brief half-life (minutes) in the
blood before displacement of the solubilizing agent by serum
proteins. The downside to such non-covalent dispersal was that the
nanocarbon construct was inherently unstable and aggregated,
rendering it susceptible to macrophage opsonophagocytosis. In
addition, since the surfactant dispersed materials were unable to
efficiently clear renally, a greater majority of the injected dose
was accumulated in liver, as compared to f-CNT that was rapidly
renally filtered and exhibited only minimal accumulation in liver
and spleen. This shows that macromolecular f-CNT remain soluble and
individualized.
[0111] The vascular endothelial termini in the liver, spleen and
marrow are tortuous sinusoids. The hepatic sinusoids interface
between the blood supply and the HC and mediate scavenging and
transport of blood-borne solutes. These LSEC exhibit a
discontinuous endothelium possessing numerous open fenestrae,
without diaphragm or basement membrane. This sieve plate morphology
and high endocytic capacity of LSEC support their unique role in
solute trafficking and active scavenging of macromolecules and
colloids that would escape KC phagocytosis. The punctuate staining
pattern of f-CNT in LSEC was shown by lysozome- and
Golgi-compartmentalized nanocarbon. Approximately 0.26% of the
cells in the porcine liver are LSEC. Assuming a similar ratio for
mouse liver, our biodistribution data indicated that only 3E6 LSEC
accumulated 3% ID; further if 3% ID was 1E-12 moles f-CNT (6E11
molecules), then each LSEC scavenged approximately 2E5 f-CNT
molecules. Therefore, a relatively small number of LSEC have a high
capacity to rapidly eliminate these macromolecules (at mg/L
concentrations) from the blood. However, considering their location
in the hepatic architecture, they were well-positioned to intercept
and efficiently capture the f-CNT.
[0112] Stellate cells reside in the hepatic perisinusoidal space of
Disse intimately positioned between LSEC and HC. The paracrine
secretion of VEGF by SC and HC sustains the LSEC population and
promotes autocrine production of NO by LSEC. SC also store
retinoids as retinyl palmitate in cytoplasmic globules. The HC
hydrolyze retinyl esters to retinol that is then transported into
SC as a complex with retinol-binding protein. It has been shown
that LSEC play an important role in maintenance of SC quiescence
and prevent their activation and loss of the VEGF paracrine effect.
While LSEC were the predominant target for f-CNT, there was
occasional evidence of f-CNT in SC. Because one function of the
LSEC is to guard the SC and prevent activation, it was evident that
a small amount of f-CNT was not scavenged and instead taken-up by
the SC.
[0113] The continuous VE architecture served as the primary conduit
to distribute f-CNT in vivo but there was no evidence that it
accumulated this nanomaterial. This called attention to the
differential functionality of these two endothelial cell types with
continuous (VE) or discontinuous (LSEC) cytoplasm. Cultured
endothelial cells were observed to accumulate SWCNT, albeit under
non-physiologic conditions over a prolonged time, however, our PET
imaging and IF studies have not tracked any f-CNT to the continuous
VE.
[0114] A small fraction of intact f-CNT cleared the liver via
secreted bile and was harvested downstream in the gall bladder and
assayed. The presence of activity in the bile, intestines and feces
strongly supported the role of hepatobiliary clearance of f-CNT.
The BDEC that comprise these ducts did not show any f-CNT
accretion. Some of the f-CNT in the sinusoid may be actively
endocytosed by the LSEC and another portion diffused from the Disse
space into the biliary canaliculi and subsequently into the bile.
Because no evidence was observed of accumulation of f-CNT in HC and
the bile contained intact nanomaterial, it was difficult to
reconcile a mechanism whereby the HC mediated transport of f-CNT
from blood to bile. Evidence for a permeable barrier permitting
bile pigments and cellular debris to bypass HC processing and
transit directly from blood to bile has been reported and scanning
electron microscopy has shown 100 nm zones between the space of
Disse and the bile canaliculi that were interpreted as sites for
molecular diffusion. These permeable Disse/canalicular junctions
may be utilized to effect retrograde, non-viral gene therapy to the
liver via infusion from the biliary tree. The conventional view of
HC-mediated elimination of blood-borne solutes into bile overlooks
this unexpected diffusion process.
[0115] The spleen was also evaluated for f-CNT uptake and
accumulated only a small amount of activity (<1% ID/g).
Unexpectedly, f-CNT partitioned into the SSEC and eschewed SM
uptake. The splenic sinusoids are tortuous VE termini lined with
specialized SSEC. The SSEC differ from LSEC in that they exhibit
continuous cytoplasm and disorganized basement membrane. The spleen
is another important reticuloendothelial tissue and it paralleled
the liver in the cell types that localized f-CNT. Significant
biodistibution of siRNA/f-CNT to the kidney versus siRNA alone was
observed (FIG. 1F).
[0116] Renal clearance remained the primary route of intact
elimination and accounted for approximately 80-85% of the excreted
f-CNT while the hepatobiliary clearance route was a secondary route
and accounted for approximately 3-5% of the excreted f-CNT.
[0117] The predominant hepatic cell type that accumulated fibrillar
nanocarbon was a professional scavenger that performed rapidly and
at high capacity. The fraction of f-CNT that transited the liver,
but was not scavenged, underwent biliary elimination. These
findings in conjunction with the known renal processing and
elimination of f-CNT accounted for elimination of approximately 90%
of the injected dose. Mouse LSEC have 14.+-.5 fenestrae per .mu.m2
(humans have 15-25 per .mu.m2) with diameters of 99.+-.18 nm
(humans, 50<d<300 nm). This is an avid, dedicated mammalian
scavenger cell and in combination with intact biliary elimination
of f-CNT has yielded a very favorable biological outcome in animal
models. This profile can be extrapolated to humans assuming
proportional LSEC capacity and capability. Biocompatibility has
always been observed with similarly modified non-toxic f-CNT in
animal models. These findings give explanation of the action of the
host on the f-CNT and support use in man. These findings indicate
that the complete pharmacokinetic profiles of other nanoparticles
can be revealed using the same paradigm employed herein to analyze
this fibrillar nanocarbon.
Example 3: EGFP Silencing by Delivery of siRNA Linked to f-CNT
[0118] Green fluorescent protein (GFP) is a protein that exhibits
bright green fluorescence when exposed to light in the blue to
ultraviolet range. GFP has a beta barrel structure with eleven
.beta.-sheets with six alpha helix(s) enveloping a covalently
bonded 4-(p-hydroxybenzylidene)imidazolidin-5-one chromopore. A
folding efficiency point mutation to this structure yields enhanced
GFP (EGFP).
[0119] The f-CNT-mediated delivery of siRNA that targeted green
fluorescent protein was first evaluated in EGFP.sup.+HeLa cells as
a proof-of-concept in vitro. Time-lapse confocal microscopy images
were collected over 60 h and region-of-interest (ROI) analyses
showed that f-CNT/siEGFP and a Lipofectamine/siEGFP (Lf/siEGFP)
positive control produced a significant decrease in HeLa cell
fluorescence, while the siEGFP alone control was less effective.
Several cycles of cell division were imaged during the course of
the experiment and confirmed both cell viability and
biocompatibility of the f-CNT transfection reagent. The
f-CNT-mediated siEGFP expression was reduced 70% at 24 h and 92% at
60 h (P<0.0001) and more significant than the control siEGFP
alone at 60 h (P=0.0003).
[0120] Confirmation of EGFP interference was obtained using flow
cytometry, Western blot analysis, and RT-PCR. Each method
demonstrated a decrease in either EGFP protein or gene expression
for the f-CNT-mediated RNAi compared to control groups. Flow
cytometry confirmed that f-CNT/siEGFP yielded a 2-log greater
fluorescence shift of EGFP expression compared to controls and was
also more effective than Lf-mediated interference. Western blots
demonstrated a reduction of EGFP expression after f-CNT/siEGFP
treatment compared to controls. RT-PCR data showed a significant
effect of the f-CNT/siEGFP compared to the controls; a kinetic
analysis indicated that the maximum mRNA interference occurred on
day 2. The cytotoxicity of the nanocarbon vector was evaluated with
HeLa cells by flow cytometry as a function of increasing dose of
f-CNT (or controls) for 3 d with no significant toxicity
observed.
[0121] Specific renal targeting of f-CNT/siRNA was substantiated by
evaluating the PK fate of f-CNT/siEGFP-[.sup.111In]DOTA in naive
balb/c mice. The kidneys accumulated 9.67.+-.2.58 percent of the
injected dose (% ID) of f-CNT/siEGFP-[.sup.111In]DOTA within 1 h
and were the principal tissue targeted. This result correlated with
previous f-CNT PK data and indicated that the siRNA vector remained
bound to the f-CNT in vivo. Carbon nanotube-mediated delivery
resulted in a 10-fold increase of siRNA delivered to the kidneys
compared to control (P=0.0001). The fraction of dose that was not
delivered to the kidney was rapidly (<1 h) eliminated. The
differential excretion between the two groups was significant
(P=0.0128) and a mass balance was accounted for by the preferential
renal accumulation of the f-CNT/siEGFP-[.sup.111In]DOTA. Radio-HPLC
of urine samples revealed that the retention time of the
f-CNT/siEGFP-[.sup.111In]DOTA-treated group was the same as the
injected formulation and confirmed that the siRNA cargo was
protected from serum degradation by f-CNT. Conversely, the urine
collected from animals that received the
siEGFP-[.sup.111In]DOTA-only showed a very different retention time
compared to the injected formulation. Control experiments with
RNAse added to siEGFP-[.sup.111In]DOTA implicated degradation of
the unprotected siRNA in vivo.
[0122] A fraction of glomerular-filtered f-CNT rapidly (<5 min.)
accumulated in the PTC brush border and transited into the
cytoplasm. PTC organelle trafficking was investigated using
confocal microscopy. The early-endosome, Golgi apparatus, and
lysosomes were identified with EEA-1, GM130, and LAMP1 co-staining,
respectively. Representative images of the early endosome, Golgi
and lysosomes all co-stained for AF488; and as expected, the early
endosome signal was evidenced earlier (5 min.) and the Golgi and
lysosome staining was more pronounced later (1 h). This data
supports a clathrin-mediated endocytic uptake mechanism for f-CNT
internalization by the PTC.
[0123] Nanocarbon-mediated interference with a specific gene in the
kidney was demonstrated using an actin-promoted EGFP transgenic
mouse model treated with the siEGFP sequence. Mice given
f-CNT/siEGFP showed a distinct decrease in renal cortical green
fluorescence versus the PBS, siEGFP alone, or f-CNT/siScram
controls. Individual renal cell fluorescence was quantified and
showed a significant decrease in EGFP-expressing cells in animals
treated with the f-CNT/siEGFP (P<0.0001) compared to controls.
Quantitative analysis of the fluorescence in the PTC showed a
decrease of about 75% of cells with observable green fluorescence,
whereas no significant difference was noticed in the control
groups. The morphology of the tubules were indistinguishable (7-8
cells per tubule) and decrease in number of fluorescent cells was
the only observable change in the f-CNT/siEGFP treated mice. A
Western blot analysis confirmed f-CNT-mediated knock-down of EGFP.
It is worthy of note that the untargeted renal vascular endothelial
and medullar cells still maintained EGFP expression because they
were not targeted.
Example 4: F-CNT-Mediated Ctr1 Knockdown Reduced Renal Copper
Uptake
[0124] Ctr1 is a transmembrane protein responsible for the cellular
uptake of copper and is expressed in human heart, kidney, muscle
and brain; in the kidney, Ctr1 is specifically expressed in the
PTC. Ctr1 has also been implicated as the key mediator of cisplatin
uptake into the renal tubule, the accumulation of which leads
ultimately to AKI during cancer therapy. Three groups of mice were
treated for 3 days with f-CNT/siCtr1, siCtr1 alone, or PBS (daily
doses were 1.6 mg f-CNT.+-.0.087 mg siRNA per kg). After the last
RNAi treatment, each animal received .sup.64CuCl.sub.2 and the
accumulated activity in the kidneys was determined. The
f-CNT/siCtr1 group showed a significant decrease in renal copper
uptake compared to the untreated group (P<0.0001) and the siCtr1
alone (P=0.0016). siCtr1 cargo administered without f-CNT transport
was unable to significantly decrease copper uptake versus PBS
control (P=0.2757). Progression-free survival was analyzed using
the Kaplan-Meier method and mice had a median time to injury of 4
d.
Example 5: PK Profile of F-CNT in a Non-Human Primate Model and
Non-Toxicity of F-CNT in Human Liver Tissue
[0125] The PK profile of [.sup.86Y]f-CNT was determined in a naive
non-human primate model using positron emission
tomography--computed tomography (PET/CT) imaging. The nanomaterial
exhibited similar tissue blood clearance, biodistribution, and
renal elimination in a 5 kg cynomolgus monkey (Macaca fascicularis)
as compared to 20 g murine models. A 1 mg/kg dose of
[.sup.86Y]f-CNT was administered intravenously and had a blood
half-life of 7 min. The majority of the dose was rapidly eliminated
in the urine with a fraction accumulated in the kidneys (SUV was
16). Furthermore, f-CNT was found to be biocompatible and non-toxic
to human liver tissue in vitro (FIG. 2, Panels A-G).
Example 6: Delivery of siRNA Linked to F-CNT as a Prophylaxis
Against Acute Kidney Injury
[0126] Two key proteins were selected as targets in our study
because of their involvement in the progression of AKI.
Meprin-1.beta. and p53 have key roles in the depolarization and
apoptotic processes of kidney injury and their mRNA was targeted
using the f-CNT platform to mediate siRNA delivery. Theses
preliminary experiments (i) established the ability of f-CNT to
deliver the siMep1b and siTrp53 cargoes and interfere with their
respective protein expression, and (ii) evaluated the safety of the
f-CNT/siRNA doses to be used prophylactically. Mice were grouped as
follows: f-CNT/siMep1b; f-CNT/siTrp53; siMep1b; siTrp53; and PBS
vehicle. Each animal received the f-CNT/siRNA constructs, the siRNA
alone, or the PBS vehicle for 3 consecutive days. The 0.10 nmol
dose of the f-CNT/siRNA per mouse was chosen to yield an on-board
[f-CNT/siRNA] of approximately 100 nM in order to insure that the
construct remained intact until delivered to the PTC. The schedule
administered 1.6 mg f-CNT and/or 0.087 mg siRNA per kg body weight
per mouse per day.
[0127] Immunohistochemistry (IHC) and ROI quantification (FIG. 3)
showed that the f-CNT-mediated RNAi reduced the expression of the
target proteins in the cortex. Basal expression of Trp53 was
visibly greater in the vehicle and siTrp53 groups versus
f-CNT/siTrp53. Quantitative ROI analysis of these images described
a significant decrease in basal Trp53 expression in the
f-CNT/siTrp53 group versus Trp53 alone (P<0.0001) and vehicle
(P<0.0001) (FIG. 3A). Control staining with only the secondary
antibody distinctly demonstrated that it was not contributing to
the signal. Similar observations were made in the kidney cortices
stained for meprin-1.beta. (FIG. 3B). Basal meprin-1.beta.
expression was significantly minimized when mediated by f-CNT
versus Mep1b alone (P<0.0001) and vehicle (P<0.0001). Control
staining with only the secondary antibody confirmed that it was not
contributing to the signal.
[0128] These nanocarbon drugs did not adversely affect renal
health. Renal function was assessed using a metabolic panel that
examined blood urea nitrogen (BUN), serum creatinine (sCr), and
phosphorous (P) as biomarkers of kidney injury. No statistical
changes were observed for any of the biomarkers indicating that
there was no injury arising from the prophylactic nanocarbon or
siRNA components. The tissue morphology was examined and scored
with no structural abnormalities to report.
[0129] A therapeutic strategy relied on simultaneous targeting and
down-regulation of meprin-1.beta. and p53 expression in the renal
proximal tubule cells. The ability of f-CNT-mediated delivery of a
combination of siMep1b and siTrp53 to protect mice from renal
injury resulted from mRNA degradation and reduced expression of two
proteins that contribute to loss of epithelial cell polarity and
apoptosis; the upregulation of either protein can initiate injury.
These findings indicate that the loss polarity and apoptosis in PTC
were distinct co-events that can each contribute to injury but the
co-administration of siMep1b and siTrp53 minimized injury. This
strategy focused on early injury events along the pathogenic axis
and minimized renal damage, inflammation, and fibrosis. This
mechanism is contingent upon the efficient delivery of combination
RNAi to the PTC afforded by the f-CNT.
[0130] f-CNT are rapidly cleared from the blood compartment and are
filtered by the kidneys in animal models. While most of the f-CNT
dose was excreted into the urine, a significant fraction of the
injected dose (10-15%) was reabsorbed by the renal proximal tubule
cells (PTC). The f-CNT have an extremely high aspect ratio
(diameter of 1 nm, and a mean length of .about.300 nm) and exhibit
fibrillar pharmacology. The present method takes advantage of f-CNT
fibrillar pharmacology to systematically deliver siRNA to PTCs to
silence key genes and minimize nephrotoxicity.
[0131] f-CNT can be used to transport, protect, and mediate the
specific delivery of small interfering RNA (siRNA) cargo to the PTC
in vivo. siRNA vectors can be very strongly bound to f-CNT
(Kd.about.5 nM) under physiological conditions; the supramolecular
siRNA/f-CNT construct exhibits the same pharmacokinetic profile as
the f-CNT vehicle; and the f-CNT specifically mediated the delivery
of siRNA to renal PTC and interfered with the expression of EGFP,
SLC3A1, Ctr1, p53, and meprin-.beta. in vivo. The f-CNT vehicle
yields a 10-fold improvement in the systemic delivery of siRNA to
the kidney versus siRNA-alone. Furthermore the nanocarbon platform
protected the siRNA cargo in vivo as the excreted portion of the
siRNA/f-CNT dose was found intact in the urine, but the siRNA-alone
control was serum degraded. Post-transcriptional gene silencing of
MMP-9, JNK, Epas1, Hif1an, Ac1, Fih1, Irp1, Egln1, Egln2, Egln3,
PHD1, PHD2, PHD3, CTRL, CTR2, cFOS, FOS, cJUN, JUN, Fra1, Fra2,
ATP, AP-1, MEP1A, MEP1B, VIM, p53, FASR, FASL, COL3A1, Kim-1 and C3
gene expression are all possible via siRNA delivery to kidney cells
via single-walled carbon nanotubes.
[0132] Nanocarbon-mediated RNAi as a treatment for AKI that
transforms the way in which a nephrotoxic renal insult can be
managed clinically in order to lessen injury. This f-CNT platform
technology has a major clinical impact in the prevention and
treatment of AKI as a consequence of the considerable nephron
accumulation, minimal off target distribution, rapid clearance of
undelivered cargo, and the protective packaging of siRNA. PET/CT
data in NHP showed that the f-CNT had similar distribution and
clearance in a large animal model compared to rodent models. This
parallel PK profile shows that f-CNT will scale similarly to human
use. Developing a robust prophylactic strategy to anticipate and
minimize AKI overcomes an unmet medical need. The application of
this approach to a large at-risk patient population will have a
broad and significant impact in health care. Moreover, this
technology serves as a precision tool in the study of biological
pathways in the nephron and aids in selecting appropriate targets
to facilitate the drug design process.
Simultaneously Targeting p53 and Meprin-.beta. Reduced Injury and
Reduced Fibrosis and Immune Infiltration
[0133] Fibrillar nanocarbon-mediated RNAi treatment successfully
minimized renal injury from a nephrotoxic cisplatin dose and
improved progression-free survival. Meprin-1.beta. and p53 were
targeted in the PTC and treatment (or control) was administered
over 5 d (daily doses were 1.6 mg f-CNT.+-.0.087 mg siRNA per kg).
The nephrotoxic insult was a single dose of cisplatin (10 mg/Kg) on
day 3. Mice were grouped as follows: PBS vehicle; f-CNT/siMep1b;
f-CNT/siTrp53; f-CNT/siScram; siMep1b; siTrp53; a combination of
f-CNT/siMep1b/siTrp53; and a combination of siMep1b/siTrp53.
Progression-free survival was analyzed using the Kaplan-Meier
method to score outcomes (FIG. 4A) and kidneys were histologically
examined. The cisplatin dose was selected based on a dose response
study.
[0134] The f-CNT/siMep1b/siTrp53 combination resulted in
statistically significant prophylaxis when compared to
f-CNT/siMep1b (P=0.0023); f-CNT/siTrp53 (P=0.0142); f-CNT/siScram
(P=0.0423); siMep1b alone (P=0.0110); siTrp53 alone (P=0.0003); or
a combination of the siMep1b and siTrp53 (P=0.0025). Median times
to injury and the complete results of statistical analyses are
reported in Table 1.
TABLE-US-00002 TABLE 1 Progression-free survival data from the
Kaplan-Meier analysis. Comparison with the Median
fCNT/siMeb1b/siTrp53 group time to P values and Hazard ratio and
95% Group injury (d) significance.sup.1 confidence interval.sup.2
fCNT/ undefined -- -- siMep1b/siTrp53 fCNT/siMep1b 4.5 0.0023 (**)
11.40 (2.380 .+-. 54.62) fCNT/siTrp53 5.5 0.0142 (*) 7.402 (1.494
.+-. 36.66) fCNT/siScram 5.0 0.0423 (*) 6.702 (1.068 .+-. 42.06)
siMep1b 5.0 0.0110 (*) 8.444 (1.632 .+-. 43.70) siTrp53 4.0 0.0003
(***) 15.96 (3.550 .+-. 71.72) siMep1b/siTrp53 6.0 0.0025 (**)
11.35 (2.478 .+-. 51.94) siCtr1 4.0 0.0006 (***) 17.71 (3.461 .+-.
90.59) PBS undefined 0.4292 (ns) 0.1969 (0.0035 .+-. 11.06) .sup.1P
values and statistical significance (ns = not significant) from the
Mantel-Cox test. .sup.2Hazard ratios and 95% confidence intervals
from the Mantel-Haenszel test.
[0135] A Forest plot of the hazard ratios strongly favored the
f-CNT/siMep1b/siTrp53 combination drug in minimizing renal injury
(FIG. 4B). The f-CNT-mediated combination treatment and the
vehicle-treated group both had undefined median survival and were
not significantly different (P=0.4292). There was no advantage in
the separate use of f-CNT/siMep1b or f-CNT/siTrp53 and the siRNA
vectors alone were ineffective because of degradation and/or low
delivery efficiency. The f-CNT/siScram therapy was also
ineffective.
[0136] Histological analysis of renal tissue from these mice was
performed at 14 days and 180 days post cisplatin injection. Kidney
fibrosis is a sign of chronic kidney disease (CKD) and was
evaluated via picrosirius red staining) of tissue from
f-CNT/siMep1b/siTrp53 and f-CNT/siScram treated animals (FIG. 4C).
As expected, there was no difference between the two groups in the
early time point, but surprisingly, after 180 days the interstitial
fibrotic level was significantly higher for the f-CNT/siScram group
(p=0.0397), indicating that the treatment decreased fibrosis. This
difference was observed in images of kidney sections of mice
sacrificed at 180 days post cisplatin injection.
[0137] Lymphocyte and macrophage infiltration is recognized to
occur in both the early and later phases of cisplatin-induced AKI.
Paradoxically, this immune infiltration can aggravate the injury
and facilitate repair after the insult. Therefore,
immunofluorescence staining for leukocytes, T lymphocytes and
macrophages was performed. The quantitative analysis of anti-CD3
antibody staining (FIG. 4D) showed a statistically significant
difference between the f-CNT/siScram and f-CNT/siMep1b/siTrp53
group at both early (p=0.0007) and later time points (p=0.0006).
This result indicated that the combination drug was capable of
minimizing T cell infiltration after cisplatin treatment. A similar
observation was conveyed for anti-CD45 antibody staining of the
same tissues, which indicated that lymphocyte infiltration was
different within the 2 groups, both at 14 (p=0.0011) and at 180
days (p=0.0100) (FIG. 4E). In addition, macrophage content within
the kidney cortex was also less in the f-CNT/siMep1b/siTrp53 group.
Anti-Iba-1 antibody staining of macrophages showed a decrease in
macrophage content at both early (p<0.0001) and late
(p<0.0001) time points (FIG. 4F). Renal tissue sections were
also assessed using H&E staining and the combination
prophylactic drug showed tissue morphology consistent with healthy
control mice.
[0138] One of ordinary skill will understand that the particular
form of RNA used for RNAi in the present invention is not limiting.
Activity in treating AKI has also been shown by the survival curve
and the weight loss plot for f-CNT that deliver precursor miRNA,
mature miRNA (single strand) and mature miRNA (double strand). One
of ordinary skill will also understand that compositions and
methods of the present application in certain embodiments may also
include use of DNA in conjunction with f-CNTs (Alidori, et al., The
journal of physical chemistry. C, Nanomaterials and interfaces 117,
5982-5992 (2013)). The compositions and methods of the present
application may include the use of any synthetic or modified RNA or
DNA. One of ordinary skill will understand that the compositions
and methods disclosed herein are applicable in any disease or
cancer where RNAi can be used as a therapeutic, but needs to be
delivered using a SWCNT, MWCNT or fibrillar macromolecular
vehicle.
[0139] The foregoing descriptions of specific embodiments of the
present application have been presented for purposes of
illustration and description. They are not intended to be
exhaustive or to limit the application and method of use to the
precise forms disclosed. Obviously many modifications and
variations are possible in light of the above teaching. It is
understood that various omissions or substitutions of equivalents
are contemplated as circumstance may suggest or render expedient,
but is intended to cover the application or implementation without
departing from the spirit or scope of the claims of the present
application.
Sequence CWU 1
1
12124DNAArtificial SequenceSynthetic Dicer validated RNA sequence
siEGFP 1gcaagcugac ccugaaguuc autt 24224RNAArtificial
SequenceSynthetic Dicer validated RNA sequence siEGFP 2augaacuuca
gggucagcuu gccg 24324DNAArtificial SequenceSynthetic Dicer
validated RNA sequence siEGFPmisc_feature(1)..(1)Amine modified RNA
sequence, NH2-(CH2)6- group at 5'- end 3gcaagcugac ccugaaguuc autt
24424DNAArtificial SequenceSynthetic Dicer validated RNA sequence
siEGFPmisc_feature(1)..(1)Cyanine 3 succinimidyl ester modified
sequence, Cy3(CH2)2C(O)NH-(CH2)6- group at 5'- end 4gcaagcugac
ccugaaguuc autt 24525DNAArtificial SequenceSynthetic Dicer
validated RNA sequence siScram 5cguuaaucgc guauaauacg cguat
25627RNAArtificial SequenceSynthetic Dicer validated RNA sequence
siScram 6cagcaauuag cgcauauuau gcgcaua 27725DNAArtificial
SequenceSynthetic Dicer validated RNA sequence siCtr1 7ggcaugaaca
ugugaauugc uggtt 25827RNAArtificial SequenceSynthetic Dicer
validated RNA sequence siCtr1 8aaccagcaau ucacauguuc augccug
27925DNAArtificial SequenceSynthetic Dicer validated RNA sequence
siMep1b 9ggaauugacc aagacauauu ugata 251027RNAArtificial
SequenceSynthetic Dicer validated RNA sequence siMep1b 10uaucaaauau
gucuugguca auuccuc 271125DNAArtificial SequenceSynthetic Dicer
validated RNA sequence siTrp53 11aggagucaca gucggauauc agcct
251227RNAArtificial SequenceSynthetic Dicer validated RNA sequence
siTrp53 12aggcugauau ccgacuguga cuccucc 27
* * * * *
References