U.S. patent application number 15/458528 was filed with the patent office on 2017-11-30 for hybrid multi-step nucleic acid amplification.
The applicant listed for this patent is Theranos, Inc.. Invention is credited to Zahra Kamila Belhocine, Josephine Lee, Pranav Patel, Aaron Richardson, Scott Tabakman, Indira Wu.
Application Number | 20170342476 15/458528 |
Document ID | / |
Family ID | 55533878 |
Filed Date | 2017-11-30 |
United States Patent
Application |
20170342476 |
Kind Code |
A1 |
Patel; Pranav ; et
al. |
November 30, 2017 |
Hybrid Multi-Step Nucleic Acid Amplification
Abstract
Improved methods for amplifying target nucleic acid sequences
are provided by 1) first amplifying the number of copies of target
nucleic acid sequences in a sample by a first nucleic acid
amplification method, and then 2) applying a second nucleic
amplification method to the amplified sample, or aliquot thereof,
further amplifying the number of copies of target sequences. In
embodiments, a first nucleic acid amplification method is a
thermocycling method, and a second nucleic acid amplification
method is an isothermal method.
Inventors: |
Patel; Pranav; (Fremont,
CA) ; Wu; Indira; (San Jose, CA) ; Richardson;
Aaron; (Palo Alto, CA) ; Belhocine; Zahra Kamila;
(Fremont, CA) ; Lee; Josephine; (Hayward, CA)
; Tabakman; Scott; (Palo Alto, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Theranos, Inc. |
Palo Alto |
CA |
US |
|
|
Family ID: |
55533878 |
Appl. No.: |
15/458528 |
Filed: |
March 14, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2015/050822 |
Sep 17, 2015 |
|
|
|
15458528 |
|
|
|
|
PCT/US2014/056151 |
Sep 17, 2014 |
|
|
|
PCT/US2015/050822 |
|
|
|
|
62051912 |
Sep 17, 2014 |
|
|
|
62051945 |
Sep 17, 2014 |
|
|
|
62068603 |
Oct 24, 2014 |
|
|
|
62068605 |
Oct 24, 2014 |
|
|
|
62151358 |
Apr 22, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/707 20130101;
C12Q 1/6858 20130101; C12M 1/00 20130101; C12Q 1/6844 20130101;
C12Q 2600/156 20130101; C12Q 2531/119 20130101; C12Q 2525/307
20130101; C12Q 2525/161 20130101; C12Q 2521/501 20130101; C12Q
2531/119 20130101; C12Q 2531/113 20130101; C12Q 2531/113 20130101;
C12Q 2521/501 20130101; C12N 15/00 20130101; C12Q 2525/161
20130101; C12Q 2525/307 20130101; C12Q 1/689 20130101; C12Q 1/706
20130101; C12Q 1/6844 20130101; C12Q 2600/158 20130101; C12Q 1/6858
20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12M 1/00 20060101 C12M001/00; C12Q 1/70 20060101
C12Q001/70 |
Claims
1. A method for amplifying a target nucleic acid sequence in a
sample, comprising: first amplifying the number of copies of one or
more target nucleic acid sequences in the sample by a first nucleic
acid amplification method; and next further amplifying the number
of copies of said one or more target nucleic acid sequences in the
sample, or an aliquot thereof, by a second nucleic amplification
method.
2. The method of claim 1, wherein said first nucleic acid
amplification method comprises a thermocycling nucleic acid
amplification method.
3. The method of claim 1, wherein said second nucleic acid
amplification method comprises an isothermal nucleic amplification
method.
4. The method of claim 1, wherein said first nucleic acid
amplification method comprises a thermocycling nucleic acid
amplification method, and said second nucleic acid amplification
method comprises an isothermal nucleic amplification method.
5. The method of claim 1, wherein said first nucleic acid
amplification method comprises a polymerase chain reaction (PCR)
nucleic acid amplification method.
6. The method of claim 1, wherein said second nucleic acid
amplification method comprises an isothermal nucleic
amplification.
7. The method of claim 5, wherein the nucleic acid amplified by the
PCR amplification method comprises DNA.
8. The method of claim 5, wherein the nucleic acid amplified by the
PCR amplification method comprises RNA.
9. The method of claim 1, wherein primers used in the amplification
methods are directed to a single target nucleic acid sequence, and
its complement.
10. The method of claim 1, wherein primers used in the
amplification methods are directed to a plurality of target nucleic
acid sequences, and complements thereof.
11. A method for detecting a first genetic element and a second
genetic element on a common nucleic acid molecule, the method
comprising: performing a first nucleic acid amplification reaction
using a first primer and a second primer, wherein both the first
primer and the second primer are phosphorylated on the 5' end of
the primer, wherein the first primer is complementary to the first
genetic element, wherein the second primer is complementary to the
second genetic element, and wherein a first reaction product is
formed, wherein the first reaction product contains at least a
portion of the first genetic element and at least a portion of the
second genetic element, wherein the least a portion of the first
genetic element and at least a portion of the second genetic
element are separated from each other in the first reaction product
by X number of nucleotides; incubating the first reaction product
with a ligase enzyme, to form at least a first ligation product
containing the first reaction product, wherein within the first
ligation product a copy of the at least a portion of the first
genetic element and a copy of the at least a portion of the second
genetic element are separated from each other by less than X number
of nucleotides; performing a second nucleic acid amplification
reaction using a third primer and a fourth primer, wherein the
third primer is complementary to the first genetic element, and
wherein the fourth primer is complementary to the second genetic
element, wherein a second reaction product is formed; and detecting
the second reaction product.
12. A method for amplifying a polynucleotide template, the method
comprising: A) generating multiple copies of a polynucleotide
template in a polymerase chain reaction (PCR) amplification
reaction mixture, wherein the PCR amplification reaction mixture
comprises a first PCR amplification reaction primer and a second
PCR amplification reaction primer, wherein in the PCR amplification
reaction mixture, the first PCR amplification reaction primer
anneals to the polynucleotide template and the second PCR
amplification reaction primer anneals to a polynucleotide which is
complementary to the polynucleotide template, and wherein in the
PCR amplification reaction mixture, multiple copies of a PCR
amplification reaction product are formed, wherein the PCR
amplification reaction product is a double-stranded nucleic acid
molecule comprising a first strand and a second strand, and wherein
a first strand of the PCR amplification reaction product is a copy
of the polynucleotide template; B) incubating copies of the
polynucleotide template in a non-thermocycling reaction mixture
comprising a non-thermocycling reaction first primer and a
non-thermocycling reaction second primer, wherein: the
polynucleotide template comprises a first portion, a second portion
and a third portion, wherein the third portion is situated in the
polynucleotide template between the first portion and the second
portion; the first primer comprises a first region and a second
region, wherein the second region of the first primer is
complementary to the first portion of the polynucleotide template;
and the second primer comprises a first region and a second region,
wherein the second region of the second primer is complementary to
a sequence in the PCR amplification reaction product second strand
which is complementary to the second portion of the polynucleotide
template, the first region of the second primer is complementary to
the first region of the first primer, and the first region of the
second primer is complementary to the third portion of the
polynucleotide template.
13. The method of claim 12, wherein the first portion and second
portion of the polynucleotide template are each between 6 and 30
nucleotides in length.
14. The method of claim 12, wherein the third portion of the
polynucleotide template is between 4 and 14 nucleotides in
length.
15. The method of claim 12, wherein the number of copies of the
polynucleotide template in the non-thermocycling reaction mixture
is increased at least 10-fold within 60 minutes of initiation of
the method.
16. The method of claim 12, wherein a concatemer strand comprising
at least three copies of the polynucleotide template is generated
during the incubation of the non-thermocycling reaction
mixture.
17. A vessel, comprising therein any one or more components of a
reaction mixture provided in claim 1.
18. A kit, comprising therein any one or more components of a
reaction mixture provided in claim 1.
Description
BACKGROUND
[0001] While multiple techniques for the amplification of nucleic
acids are known, current techniques suffer from various limitations
such as in relation to the speed, sensitivity, and/or specificity
of target nucleic acid amplification. Accordingly, improved nucleic
acid amplification techniques are needed.
INCORPORATION BY REFERENCE
[0002] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
SUMMARY
[0003] Applicant discloses improved methods for amplifying one or
more target nucleic acid sequences in a sample. Target nucleic
acids may be DNA sequences, or may be RNA sequences. Improved
nucleic acid amplification methods disclosed herein comprise
utilizing two different nucleic acid amplification methods
sequentially. In embodiments, a first nucleic amplification method
is applied to a sample, amplifying the number of copies of one or
more target nucleic acid sequences in the sample; followed by
application of a second nucleic amplification method to the sample,
or aliquot thereof, further amplifying the number of copies of one
or more target nucleic acid sequences in the sample. In
embodiments, any two nucleic amplification methods may be performed
sequentially, wherein a first nucleic amplification method is
applied to a sample, and then a second nucleic amplification method
is applied to that sample, or an aliquot thereof, after
amplification by the first nucleic amplification method. In
embodiments, an improved nucleic acid amplification method
comprises first utilizing a thermocycling amplification method, and
then utilizing a non-thermocycling (e.g., an isothermal)
amplification method, to amplify a target nucleic acid sequence, or
to amplify a plurality of target nucleic acid sequences, in a
sample. In embodiments, a first nucleic amplification method
comprises a polymerase chain reaction (PCR) amplification method.
Suitable PCR methods include two-step PCR, and include 3-step PCR
methods. In embodiments where the target nucleic acid is RNA,
reverse transcriptase PCR (rtPCR) may be used. In embodiments, a
second nucleic amplification method comprises an isothermal nucleic
acid amplification method as described in International Application
No. PCT/US14/30028, filed Mar. 15, 2014; in International
Application No. PCT/US14/30034, filed Mar. 15, 2014; in
International Application No. PCT/US14/56151, filed Sep. 17, 2014;
in International Application No. PCT/US14/30036, filed Mar. 15,
2014; or in International Application No. PCT/US15/50811, filed
Sep. 17, 2015, each of which applications are hereby incorporated
by reference herein in their entirety for all purposes.
[0004] Accordingly, a method for amplifying a target nucleic acid
sequence in a sample comprises: amplifying the number of copies of
one or more target nucleic acid sequences in the sample by a first
nucleic acid amplification method; and then further amplifying the
number of copies of said one or more target nucleic acid sequences
in the sample, or an aliquot thereof, by a second nucleic
amplification method. In embodiments, a method for amplifying a
target nucleic acid sequence in a sample comprises: amplifying the
number of copies of one or more target nucleic acid sequences in
the sample by a thermocycling nucleic acid amplification method;
and then further amplifying the number of copies of said one or
more target nucleic acid sequences in the sample, or an aliquot
thereof, by a non-thermocycling (e.g., an isothermal) nucleic
amplification method. In embodiments, a method for amplifying a
target nucleic acid sequence in a sample comprises: amplifying the
number of copies of one or more target nucleic acid sequences in
the sample by a polymerase chain reaction (PCR) nucleic acid
amplification method; and then further amplifying the number of
copies of said one or more target nucleic acid sequences in the
sample, or an aliquot thereof, by an isothermal nucleic
amplification method selected from an isothermal nucleic
amplification method as described in International Application No.
PCT/US14/30028, filed Mar. 15, 2014; in International Application
No. PCT/US14/30034, filed Mar. 15, 2014; in International
Application No. PCT/US14/56151, filed Sep. 17, 2014; in
International Application No. PCT/US14/30036, filed Mar. 15, 2014;
or in International Application No. PCT/US15/50811, filed Sep. 17,
2015.
[0005] In further embodiments, a method for amplifying a target
nucleic acid sequence in a sample comprises: contacting a sample
with a primer, or set of primers which hybridize to a target
nucleic acid sequence; amplifying the number of copies of said
target nucleic acid sequence in the sample by a first nucleic acid
amplification method; and then further amplifying the number of
copies of said target nucleic acid sequences in the sample, or an
aliquot thereof, by a second nucleic amplification method. Further
embodiments include contacting a sample with a plurality of
primers, or a plurality of sets of primers, which hybridize to a
plurality of target nucleic acid sequences; amplifying the number
of copies of said target nucleic acid sequence in the sample by a
first nucleic acid amplification method; and then further
amplifying the number of copies of said target nucleic acid
sequences in the sample, or an aliquot thereof, by a second nucleic
amplification method.
[0006] In further embodiments, an improved nucleic acid
amplification method comprises first utilizing a non-thermocycling
(e.g., an isothermal) amplification method to amplify a target
nucleic acid sequence, or to amplify a plurality of target nucleic
acid sequences, in a sample, and then second applying a
thermocycling amplification method to the amplified sample, or
aliquot thereof, to further amplify a target nucleic acid sequence,
or to amplify a plurality of target nucleic acid sequences, in the
sample.
[0007] Accordingly, Applicant discloses herein methods, devices,
systems, implements (e.g., vessels), and kits for performing
nucleic acid amplification. In embodiments, such methods, devices,
systems, implements (e.g., vessels), and kits for performing
nucleic acid amplification include methods, devices, systems,
implements (e.g., vessels), and kits for amplification of nucleic
acids from a sample, such as a clinical sample. In embodiments, a
portion (e.g., an aliquot) of a sample may be used to provide a
nucleic acid for amplification. In embodiments, such a sample may
be a blood, urine, saliva, or other clinical sample, or a portion
(e.g., an aliquot) of a blood, urine, saliva, or other clinical
sample.
[0008] Accordingly, in embodiments, Applicant discloses a method
for amplifying a target nucleic acid sequence in a sample,
comprising:
[0009] first amplifying the number of copies of one or more target
nucleic acid sequences in the sample by a first nucleic acid
amplification method; and
next further amplifying the number of copies of said one or more
target nucleic acid sequences in the sample, or an aliquot thereof,
by a second nucleic amplification method. In embodiments of such
methods, said first nucleic acid amplification method comprises a
thermocycling nucleic acid amplification method. In embodiments of
such methods, said second nucleic acid amplification method
comprises an isothermal nucleic amplification method. In
embodiments of such methods, said first nucleic acid amplification
method comprises a thermocycling nucleic acid amplification method,
and said second nucleic acid amplification method comprises an
isothermal nucleic amplification method. In embodiments of such
methods, said first nucleic acid amplification method comprises a
polymerase chain reaction (PCR) nucleic acid amplification method.
In embodiments of such methods, the nucleic acid amplified by the
PCR amplification method comprises DNA. In embodiments of such
methods, the nucleic acid amplified by the PCR amplification method
comprises RNA. In embodiments, the nucleic acid may include uracil,
and in embodiments may include dideoxyuracil (e.g., may include
dideoxyuracil in place of a thymine during amplification). In
embodiments of such methods, said second nucleic acid amplification
method comprises an isothermal nucleic amplification method.
[0010] In embodiments of the methods disclosed herein, primers used
in the amplification methods are directed to a single target
nucleic acid sequence, and its complement. In embodiments of the
methods disclosed herein, primers used in the amplification methods
are directed to a plurality of target nucleic acid sequences, and
complements thereof.
[0011] Accordingly, in embodiments, Applicant discloses a method
for detecting a first genetic element and a second genetic element
on a common nucleic acid molecule, the method comprising:
[0012] performing a first nucleic acid amplification reaction using
a first primer and a second primer, wherein both the first primer
and the second primer are phosphorylated on the 5' end of the
primer, wherein the first primer is complementary to the first
genetic element, wherein the second primer is complementary to the
second genetic element, and wherein a first reaction product is
formed, wherein the first reaction product contains at least a
portion of the first genetic element and at least a portion of the
second genetic element, wherein the least a portion of the first
genetic element and at least a portion of the second genetic
element are separated from each other in the first reaction product
by X number of nucleotides;
[0013] incubating the first reaction product with a ligase enzyme,
to form at least a first ligation product containing the first
reaction product, wherein within the first ligation product a copy
of the at least a portion of the first genetic element and a copy
of the at least a portion of the second genetic element are
separated from each other by less than X number of nucleotides;
[0014] performing a second nucleic acid amplification reaction
using a third primer and a fourth primer, wherein the third primer
is complementary to the first genetic element, and wherein the
fourth primer is complementary to the second genetic element,
wherein a second reaction product is formed; and
[0015] detecting the second reaction product.
[0016] Accordingly, in embodiments, Applicant discloses a method
for amplifying a polynucleotide template, the method
comprising:
[0017] A) generating multiple copies of a polynucleotide template
in a polymerase chain reaction (PCR) amplification reaction
mixture, wherein the PCR amplification reaction mixture comprises a
first PCR amplification reaction primer and a second PCR
amplification reaction primer, wherein in the PCR amplification
reaction mixture, the first PCR amplification reaction primer
anneals to the polynucleotide template and the second PCR
amplification reaction primer anneals to a polynucleotide which is
complementary to the polynucleotide template, and wherein in the
PCR amplification reaction mixture, multiple copies of a PCR
amplification reaction product are formed, wherein the PCR
amplification reaction product is a double-stranded nucleic acid
molecule comprising a first strand and a second strand, and wherein
a first strand of the PCR amplification reaction product is a copy
of the polynucleotide template;
[0018] B) incubating copies of the polynucleotide template in a
non-thermocycling reaction mixture comprising a non-thermocycling
reaction first primer and a non-thermocycling reaction second
primer, wherein:
[0019] the polynucleotide template comprises a first portion, a
second portion and a third portion, wherein the third portion is
situated in the polynucleotide template between the first portion
and the second portion;
[0020] the first primer comprises a first region and a second
region, wherein the second region of the first primer is
complementary to the first portion of the polynucleotide template;
and
[0021] the second primer comprises a first region and a second
region, wherein the second region of the second primer is
complementary to a sequence in the PCR amplification reaction
product second strand which is complementary to the second portion
of the polynucleotide template, the first region of the second
primer is complementary to the first region of the first primer,
and the first region of the second primer is complementary to the
third portion of the polynucleotide template.
[0022] In embodiments of the methods disclosed herein, the first
portion and second portion of the polynucleotide template are each
between 6 and 30 nucleotides in length. In embodiments of such
methods, the third portion of the polynucleotide template is
between 4 and 14 nucleotides in length. In embodiments of the
methods disclosed herein, the number of copies of the
polynucleotide template in the non-thermocycling reaction mixture
is increased at least 10-fold within 60 minutes of initiation of
the method. In embodiments of the methods disclosed herein, a
concatemer strand comprising at least three copies of the
polynucleotide template is generated during the incubation of the
non-thermocycling reaction mixture.
[0023] Applicants further disclose herein a vessel, and vessels,
comprising therein any one or more components of a reaction mixture
provided herein. Applicants further disclose herein a kit, and
kits, comprising therein any one or more components of a reaction
mixture provided herein.
[0024] The assays and methods disclosed herein may be performed on
a device, or on a system, for processing a sample. The assays and
methods disclosed herein can be readily incorporated into and used
in an automated assay device, and in an automated assay system. For
example, systems as disclosed herein may include a communication
assembly for transmitting or receiving a protocol based on the
analyte to be detected (e.g., one or more nucleic acid markers
indicative of a virus, a bacterium, or other target) or based on
other analytes to be detected by the device or system. In
embodiments, an assay protocol may be changed based on optimal
scheduling of a plurality of assays to be performed by a device, or
may be changed based on results previously obtained from a sample
from a subject, or based on results previously obtained from a
different sample from the subject. In embodiments, a communication
assembly may comprise a channel for communicating information from
said device to a computer, said wherein said channel is selected
from a computer network, a telephone network, a metal communication
link, an optical communication link, and a wireless communication
link. In embodiments, systems as disclosed herein may transmit
signals to a central location, or to an end user, and may include a
communication assembly for transmitting such signals. Systems as
disclosed herein may be configured for updating a protocol as
needed or on a regular basis.
[0025] Devices and systems configured to measure nucleic acid
markers (e.g., which may be indicative of a virus, a bacterium, or
other target) in a sample of blood according to a method disclosed
herein may be configured to determine from analysis of a portion of
a sample (e.g., a sample of blood, urine, sputum, tears, or other
sample) that comprises a volume of no more than about 1000 .mu.L,
or no more than about 500 .mu.L, no more than about 250 .mu.L, or
no more than about 150 .mu.L, or no more than about 100 .mu.L, or
no more than about 50 .mu.L, or, in embodiments, wherein the volume
of the sample comprises no more than about 25 .mu.L, or comprises
no more than about 10 .mu.L, or wherein said sample of blood
comprises less than about 10 .mu.L. Such devices may be configured
to measure target levels, or to detect the presence or absence of a
target in a sample, in less than about one hour, or, in
embodiments, in less than about 40 minutes, or in less than about
30 minutes.
[0026] Devices disclosed herein may be configured to perform an
assay for the measurement of a target nucleic acid and also to
perform an assay for the measurement of another analyte in the
blood sample. Devices disclosed herein may be configured to perform
an assay for the measurement of a target nucleic acid molecule, and
also to perform an assay comprising the measurement of a
morphological characteristic of a blood cell in the blood sample.
Devices disclosed herein may be configured to perform an assay for
the measurement of a target nucleic acid molecule and also to
perform an assay comprising the measurement of another blood
analyte, e.g., a vitamin, a hormone, a drug or metabolite of a
drug, or other analyte. Such devices may be configured wherein the
assays, or the order of performance of assays, that are performed
by said device may be altered by communication with another
device.
[0027] Applicants also disclose systems comprising a device as
disclosed herein. In embodiments, the system comprises a device
that is configured to perform an assay for the measurement of a
target nucleic acid molecule and also to perform an assay for the
measurement of another analyte in the sample. In embodiments, the
system comprises a device that is configured to perform an assay
for the measurement of a target nucleic acid molecule and also to
perform an assay for the measurement of a morphological
characteristic of a cell in the sample. In embodiments of such a
system, assays, or the order of performance of assays, that are
performed by said device may be altered by communication with
another device.
[0028] Methods, systems, devices, kits, and compositions disclosed
herein provide rapid assays which require only small amounts of
sample, such as only small amounts of blood, urine, tears, sweat,
tissue, or other sample. Device and systems disclosed herein are
configured to perform such rapid assays which require only small
amounts of sample, such as samples or sample portions having
volumes of less than about 250 .mu.L, or less than about 200 .mu.L,
or less than about 150 .mu.L, or less than about 100 .mu.L.
Accordingly, the methods, compositions, devices, and systems
provide rapid tests, which require only small biological samples,
and thus provide advantages over other methods, compositions,
assays, devices, and systems.
[0029] Applicant discloses herein compositions comprising one or
more of reagents, including primers, nucleotides, dyes, buffers,
and other reagents useful for methods disclosed herein. Applicant
discloses herein vessels for use in assay devices, assay systems,
including automated assay devices, automated assay systems (which
may also be termed sample analysis devices and systems, and
automated sample analysis devices and systems) useful for methods
disclosed herein. Applicant discloses herein implements, tools, and
disposables for use in assay devices, assay systems, including
automated assay devices and automated assay systems useful for
methods disclosed herein. Applicant discloses herein vessels
containing one or more of reagents, including primers, nucleotides,
dyes, and other reagents useful for methods disclosed herein.
Applicant discloses herein kits including compositions comprising
one or more of reagents, including primers, nucleotides, dyes,
buffers, and other reagents useful for methods disclosed herein;
kits including vessels for use in assay devices, assay systems,
including automated assay devices and automated assay systems
useful for methods disclosed herein; and kits including
compositions and vessels for use in assay devices, assay systems,
including automated assay devices and automated assay systems
useful for methods disclosed herein.
[0030] Methods, systems, devices, kits, and compositions disclosed
herein provide advantages including greater sensitivity than other
methods. Methods, systems, devices, kits, and compositions
disclosed herein provide advantages including improved ability to
multiplex two or more amplification reactions in a single nucleic
amplification device or system (which may be or include, e.g.,
automated assay devices, automated assay systems, which may also be
termed sample analysis devices and systems, and automated sample
analysis devices and systems). Methods, systems, devices, kits, and
compositions disclosed herein provide advantages including improved
ability to amplify two, three, or more target nucleic acids in a
single vessel in a first nucleic acid amplification step, and
follow up with steps directed to individual target nucleic acids in
multiple individual vessels in multiple second nucleic acid
amplification steps. Methods, systems, devices, kits, and
compositions disclosed herein provide advantages including improved
ability to amplify, detect, or identify, and combinations thereof,
single nucleotide polymorphisms (SNPs) in target nucleic acids.
Methods, systems, devices, kits, and compositions disclosed herein
provide advantages including improved ability to perform PCR
without use of dyes in a first nucleic acid amplification step, and
to follow up with a second nucleic acid amplification step
comprising the use of dyes, for detecting target nucleic acids
pursuant to a second nucleic acid amplification step; for example,
such methods systems, devices, kits, and compositions may be useful
for detection of SNPs.
[0031] Methods, systems, devices, kits, and compositions disclosed
herein provide advantages including the ability to utilize samples
with less pre-processing than might otherwise be required. Methods,
systems, devices, kits, and compositions disclosed herein provide
advantages including the ability to dilute samples to a greater
amount of dilution than might otherwise be required. Methods,
systems, devices, kits, and compositions disclosed herein provide
advantages including reducing susceptibility to contamination by
humans (e.g., operator) other than the subject than might otherwise
occur. Methods, systems, devices, kits, and compositions disclosed
herein provide advantages including the ability to apply these
techniques to the analysis of nasal swabs, where other methods
might require nasopharyngeal swabs.
[0032] Other goals and advantages of the invention will be further
appreciated and understood when considered in conjunction with the
following description and accompanying drawings. While the
following description may contain specific details describing
particular embodiments of the invention, these should not be
construed as limitations to the scope of the invention but rather
as exemplifications of possible embodiments. For each aspect of the
invention, many changes and modifications can be made within the
scope of the invention without departing from the spirit
thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] In the drawings,
[0034] FIG. 1 shows exemplary results according to a method
provided herein.
[0035] FIG. 2 shows exemplary results according to a method
provided herein.
[0036] FIG. 3 shows exemplary results according to a method
provided herein.
[0037] FIG. 4 shows exemplary results according to a method
provided herein.
[0038] FIG. 5 shows exemplary results according to a method
provided herein.
[0039] FIG. 6 depicts exemplary primer sequences which may be used
with a method provided herein.
[0040] FIG. 7 is a general schematic of method provided herein.
[0041] FIG. 8 are exemplary primer sequences which may be used with
a method provided herein.
[0042] FIG. 9 shows results from a method provided herein.
[0043] FIG. 10 shows primer sequences used for a method provided
herein.
[0044] It is noted that the drawings and elements therein are not
necessarily drawn to shape or scale. For example, the shape or
scale of elements of the drawings may be simplified or modified for
ease or clarity of presentation. It should further be understood
that the drawings and elements therein are for exemplary
illustrative purposes only, and not be construed as limiting in any
way.
DETAILED DESCRIPTION
[0045] This application hereby incorporates by reference for all
purposes and in their entirety the following patent applications:
U.S. Provisional Patent Application No. 62/051,912, filed Sep. 17,
2014; U.S. Provisional Patent Application No. 62/051,945, filed
Sep. 17, 2014; U.S. Provisional Patent Application No. 62/068,603,
filed Oct. 24, 2014; U.S. Provisional Patent Application No.
62/068,605, filed Oct. 24, 2014; U.S. Provisional Patent
Application No. 62/151,358, filed Apr. 22, 2015; U.S. Provisional
Patent Application No. 61/908,027, filed Nov. 22, 2013; U.S.
Provisional Patent Application No. 62/001,050, filed May 20, 2014;
and U.S. Provisional Patent Application No. 61/800,606, filed Mar.
15, 2013; U.S. Non-Provisional patent application Ser. No.
14/214,850, filed Mar. 15, 2014; International Patent Application
No. PCT/US14/30034, filed Mar. 15, 2014; International Patent
Application No. PCT/US14/56151, filed Sep. 17, 2014; and
International Application No. PCT/US15/50811, filed Sep. 17,
2015.
[0046] Provided herein are systems and methods for amplification of
nucleic acids. Various features described herein may be applied to
any of the particular embodiments set forth below or for any other
types systems for or involving nucleic acid amplification. Systems
and methods described herein may be applied as a standalone system
or method, or as part of an integrated system or method. It shall
be understood that different aspects of the disclosed systems and
methods can be appreciated individually, collectively, or in
combination with each other.
[0047] In embodiments, a method provided herein may be performed as
follows. A polynucleotide template may be amplified in a first
amplification reaction, wherein the first amplification reaction is
a thermocycling nucleic acid amplification reaction (e.g., a
polymerase chain reaction (PCR)). In the first amplification
reaction, a nucleic acid amplification reaction product may be
generated (e.g., a PCR amplification reaction product may be
generated). Amplification reaction product generated by the first
amplification reaction may then be amplified in a second
amplification reaction, wherein the second amplification reaction
is a non-thermocycling nucleic acid amplification reaction (e.g.,
an isothermal nucleic acid amplification reaction).
[0048] In embodiments, a method provided herein may be performed as
follows. A polynucleotide template may be amplified in a first
amplification reaction, wherein the first amplification reaction is
a polymerase chain reaction (PCR) reaction. In the first
amplification reaction, a PCR amplification reaction product may be
generated. The PCR amplification reaction product may be a
double-stranded nucleic acid molecule comprising a first strand and
a second strand, and wherein a first strand of the PCR
amplification reaction product is a copy of the polynucleotide
template. Next, the PCR reaction product (which comprises a copy of
the polynucleotide template) may be used as a template in a
non-thermocycling amplification reaction as provided in
PCT/US14/56151, in order to generate a non-thermocycling reaction
product as described in PCT/US14/56151. Such non-thermocycling
reaction products may include concatemers. In embodiments of this
method involving a PCR amplification reaction followed by a
non-thermocycling amplification reaction, only the
non-thermocycling reaction products are detected (not the PCR
reaction products). In embodiments, the non-thermocycling reaction
products are detected in real-time as they are formed. In
embodiments, a method of PCT/US14/56151 may involve a first primer
and a second primer. In embodiments, the first primer of a method
of PCT/US14/56151 contains a first region and a second region,
wherein the first region comprises a 5' end of the primer, the
second region comprises a 3' end of the primer, and the second
region is complementary to a least a portion of a first strand of a
double-stranded nucleic acid template (i.e. a double-stranded
nucleic acid molecule, such as a PCR amplification reaction
product). In embodiments, the second primer of a method of
PCT/US14/56151 contains a first region and a second region, wherein
the first region comprises a 5' end of the primer and is
complementary to the first region of the first primer, the second
region comprises a 3' end of the primer, and wherein the second
region is complementary to a least a portion of a second strand of
the double-stranded nucleic acid template. In embodiments, the
second region of a first primer of a method of PCT/US14/56151 may
anneal to a first strand of a PCR amplification reaction product in
methods herein in the same way as a first PCR amplification
reaction primer anneals to a polynucleotide template strand in PCR
amplification reactions provided herein, and the second region of a
second primer of a method of PCT/US14/56151 may anneal to a second
strand of a PCR amplification reaction product as provided in
methods herein in the same way as a second PCR amplification
reaction primer anneals to a polynucleotide which is complementary
to the polynucleotide template in PCR amplification reaction
methods provided herein.
[0049] In further embodiments, a method provided herein may be
performed as follows. A polynucleotide template may be amplified in
a first amplification reaction, wherein the first amplification
reaction is a non-thermocycling nucleic acid amplification reaction
(e.g., an isothermal nucleic acid amplification reaction). In the
first amplification reaction, a nucleic acid amplification reaction
product may be generated. Amplification reaction product generated
by the first amplification reaction may then be amplified in a
second amplification reaction, wherein the second amplification
reaction is a thermocycling nucleic acid amplification reaction
(e.g., a PCR reaction).
Definitions
[0050] As used herein, a "polynucleotide" refers to a polymeric
chain containing two or more nucleotides. "Polynucleotides"
includes primers, oligonucleotides, nucleic acid strands, etc. A
polynucleotide may contain standard or non-standard nucleotides.
Typically, a polynucleotide contains a 5' phosphate at one terminus
("5' terminus") and a 3' hydroxyl group at the other terminus ("3`
terminus) of the chain. The most 5' nucleotide of a polynucleotide
may be referred to herein as the "5' terminal nucleotide" of the
polynucleotide. The most 3' nucleotide of a polynucleotide may be
referred to herein as the "3' terminal nucleotide" of the
polynucleotide.
[0051] The term "downstream" as used herein in the context of a
polynucleotide containing a 5' terminal nucleotide and a 3'
terminal nucleotide refers to a position in the polynucleotide
which is closer to the 3' terminal nucleotide than a reference
position in the polynucleotide. For example, in a primer having the
sequence: 5' ATAAGC 3', the "G" is downstream from the "T" and all
of the "A"s.
[0052] The term "upstream" as used herein in the context of a
polynucleotide containing a 5' terminal nucleotide and a 3'
terminal nucleotide, refers to a position in the polynucleotide
which is closer to the 5' terminal nucleotide than a reference
position in the polynucleotide. For example, in a primer having the
sequence: 5' ATAAGC 3', the "T" is upstream from the "G", the "C",
and the two "A"s closest to the "G".
[0053] As used herein, "nucleic acid" includes both DNA and RNA,
including DNA and RNA containing non-standard nucleotides. A
"nucleic acid" contains at least one polynucleotide (a "nucleic
acid strand"). A "nucleic acid" may be single-stranded or
double-stranded.
[0054] As used herein, a "concatemer" refers to a nucleic acid
molecule which contains within it two or more copies of a
particular nucleic acid, wherein the copies are linked in series.
Within the concatemer, the copies of the particular nucleic acid
may be linked directly to each other, or they may be indirectly
linked (e.g. there may be nucleotides between the copies of the
particular nucleic acid). In an example, the particular nucleic
acid may be that of a double-stranded nucleic acid template, such
that a concatemer may contain two or more copies of the
double-stranded nucleic acid template. In another example, the
particular nucleic acid may be that of a polynucleotide template,
such that a concatemer may contain two or more copies of the
polynucleotide template.
[0055] As used herein, a "target" nucleic acid or molecule refers
to a nucleic acid of interest. A target nucleic acid/molecule may
be of any type, including single-stranded or double stranded DNA or
RNA (e.g. mRNA).
[0056] As used herein, "complementary" sequences refer to two
nucleotide sequences which, when aligned anti-parallel to each
other, contain multiple individual nucleotide bases which can pair
with each other according to standard base-pairing rules (e.g. A-T,
G-C, or A-U), such that molecules containing the sequences can
specifically anneal to each other. It is not necessary for every
nucleotide base in two sequences to be capable of pairing with each
other for the sequences to be considered "complementary". Sequences
may be considered complementary, for example, if at least 30%, 40%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%
of the nucleotide bases in two sequences can pair with each other
when the sequences are optimally aligned for complementation. In
addition, sequences may still be considered "complementary" when
the total lengths of the two sequences are significantly different
from each other. For example, a primer of 15 nucleotides may be
considered "complementary" to a longer polynucleotide containing
hundreds of nucleotides if multiple individual nucleotide bases of
the primer can pair with nucleotide bases in the longer
polynucleotide when the primer is aligned anti-parallel to a
particular region of the longer polynucleotide. Additionally,
"complementary" sequences may contain one or more nucleotide
analogs or nucleobase analogs. As used herein, "perfectly
complementary" or "perfect complementation" or the like refers two
sequences which are 100% complementary to each other (i.e. where
there are no mis-matches between the nucleotides of the sequences
when the sequences are paired for maximum complementation).
[0057] As used herein, the term "isolated" as applied to proteins,
nucleic acids, or other biomolecules refers to a molecule that has
been purified or separated from a component of its
naturally-occurring environment (e.g. a protein purified from a
cell in which it was naturally produced). An "isolated" molecule
may be in contact with other molecules (for example, as part of a
reaction mixture). As used herein, "isolated" molecules also
include recombinantly-produced proteins or nucleic acids which have
an amino acid or nucleotide sequence which occurs naturally.
"Isolated" nucleic acids include polypeptide-encoding nucleic acid
molecules contained in cells that ordinarily express the
polypeptide where, for example, the nucleic acid molecule is at a
chromosomal location different from that of natural cells. In some
embodiments, "isolated" polypeptides are purified to at least 50%,
60%, 70%, 80%, 90%, 95%, 98%, or 100% homogeneity as evidenced by
SDS-PAGE of the polypeptides followed by Coomassie blue, silver, or
other protein staining method.
[0058] As used herein, a nucleic acid molecule which is described
as containing the "sequence" of a template or other nucleic acid
may also be considered to contain the template or other nucleic
acid itself (e.g. a molecule which is described as containing the
sequence of a template may also be described as containing the
template), unless the context clearly dictates otherwise.
[0059] As used herein, when a first polynucleotide is described as
"annealed", "annealing" or the like to a second polynucleotide, the
entirety of the first polynucleotide or any portion thereof may
anneal to the second polynucleotide, and vice versa.
[0060] As used herein, a reference to "treating" a given object to
a condition or other object or the like refers to directly or
indirectly exposing the given object to the recited condition or
other object. Thus, while a "treating" step may involve a distinct
related action (e.g. adding an enzyme to a vessel, shaking a
vessel, etc.), not every "treating" step requires a distinct
related action. For example, a reaction involving one or more
reagents can be set up in a vessel, and once the reaction has been
initiated, multiple events or steps may occur in the vessel without
further human or mechanical intervention with the contents of the
vessel. One or more of these multiple events or steps in the vessel
may be described as "treating" an object in the vessel, even if no
separate intervention with the contents of the vessel occurs after
the initiation of the reaction.
[0061] In embodiments, provided herein is method for amplification
of a target nucleic acid, wherein the method includes at least two
different nucleic acid amplification processes. In embodiments, a
target nucleic acid may be first be amplified by a first nucleic
acid amplification method which involves thermocycling, and then
some or all of the target nucleic acid amplified in the
thermocycling reaction may then be used for a second nucleic acid
amplification reaction, wherein the second nucleic acid
amplification reaction is an isothermal amplification reaction. For
example, a target nucleic acid may be first amplified in a
polymerase chain reaction ("PCR") amplification reaction
(described, for example, in U.S. Pat. No. 4,683,202). PCR
amplification methods are thermocycling amplification methods.
[0062] Then, following amplification by a PCR method, some or all
of the amplified target nucleic acid from the PCR reaction may be
used in an isothermal nucleic acid amplification reaction, such as
is described in, for example, any of International Application No.
PCT/US14/30028, filed Mar. 15, 2014, International Application No.
PCT/US14/30034, filed Mar. 15, 2014, International Application No.
PCT/US14/56151, filed Sep. 17, 2014, or International Application
No. PCT/US14/30036, filed Mar. 15, 2014, are each herein
incorporated by reference in their entirety for all purposes. For
brevity hereafter, the isothermal nucleic acid amplification
methods described in PCT/US14/30028, in PCT/US14/30034, in
PCT/US14/56151, and in PCT/US14/30036 are collectively termed "NAA"
methods.
[0063] The present methods improve (i.e., lower) the limit of
detection (LOD) of nucleic acid amplification assays. That is, the
presence of smaller numbers of target nucleic acid sequences in a
sample can be detected when pre-amplification by thermal-cycling
methods are applied to the sample, and then isothermal nucleic acid
amplification methods are applied, as compared to when isothermal
methods are applied to a sample without such pre-amplification. As
few as 1 copy per microliter of target nucleic acid has been
detected in samples using PCR followed by NAA methods.
NAA Methods
[0064] It will be understood that complete description of the
isothermal nucleic acid amplification methods termed herein "NAA
methods" is to be found in PCT/US14/30028, in PCT/US14/30034, in
PCT/US14/56151, and in PCT/US14/30036; however, these methods are
also briefly summarized in the following.
[0065] NAA methods of nucleic acid amplification may be applied to
double-stranded DNA. However, target nucleic acid molecules need
not be limited to double-stranded DNA targets; for example,
double-stranded DNA for use in NAA methods described herein may be
prepared from viral RNA, or mRNA, or other single stranded RNA
target sources, by reverse transcriptase. In further example,
double-stranded DNA for use in NAA methods described herein may be
prepared from single-stranded DNA targets by DNA polymerase. Such
methods may be applied as an initial step, prior to application of
the NAA methods discussed below.
[0066] Amplification of a double-stranded DNA target, for example,
begins with a primary double-stranded DNA to be amplified (termed
the "primary nucleic acid" in the following). The primary nucleic
acid contains a target region termed a template region; the
template region has a template sequence. Such a double-stranded
template region contains a first DNA strand and a complementary
second DNA strand, and includes a 5' terminal nucleotide in one
strand and a 3' terminal nucleotide in the other strand that are
complementary to each other.
[0067] A first primer and a second primer are provided which each
have template-binding regions and tail regions; the primer
template-binding regions are complementary to the target template
regions. The tail regions of the primers may contain three
components: a) the 5' terminal nucleotide of the primer, b) an
innermost nucleotide, wherein the innermost nucleotide is
downstream from the 5' terminal nucleotide, and c) a middle section
between the 5' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides. In addition, at least portions
of the two primer tail regions may be complementary to each other
when properly aligned.
[0068] It should be noted that although the tail region of the
second primer may contain a nucleotide sequence which is
complementary to the nucleotide sequence of the tail region of the
first primer, typically, products formed by the annealing of the
first primer and second primer are not desirable or useful for
methods or compositions provided herein. Accordingly, in some
embodiments, steps may be taken to minimize the formation of first
primer-second primer annealed products. Such steps may include, for
example, not pre-incubating a first primer and a second primer
under conditions where the primers may anneal for an extended
period of time before initiating a method provided herein.
[0069] The primary nucleic acid may be treated with a polymerase
and a first copy of the first primer under conditions such that the
template-binding region of the first copy of the first primer
anneals to the first strand of the nucleic acid template. Under
these conditions, an extension product of the first copy of the
first primer is formed. The polymerase, which may have strand
displacement activity, may catalyze the formation of the extension
product of the first copy of the first primer. The first copy of
the first primer may be covalently linked to the synthesized
extension product, such that the first copy of the first primer
(which is complementary to the first strand of the nucleic acid
template) becomes part of the molecule described herein as the
"extension product of the first copy of the first primer." The
template-binding region but not the tail region of the first copy
of the first primer anneals to the first strand of the nucleic acid
template. Examples of conditions suitable for polymerase-based
nucleic acid synthesis are known in the art and are provided, for
example, in Molecular Cloning: A Laboratory Manual, M. R. Green and
J. Sambrook, Cold Spring Harbor Laboratory Press (2012), which is
incorporated by reference herein in its entirety.
[0070] The extension product of the first copy of the first primer
may be treated with a polymerase (which may have strand
displacement activity) and with the second primer under conditions
such that the template-binding region of the second primer anneals
to the extension product of the first copy of the first primer. In
this way, an extension product of the second primer may be formed.
The polymerase may displace the first strand of the nucleic acid
template from the extension product of the first copy of the first
primer during the synthesis of the extension product of the second
primer. The second primer may be covalently linked to the
synthesized extension product, such that the second primer becomes
part of the molecule described herein as the "extension product of
the second primer." The extension product of the second primer is
complementary to the extension product of the first copy of the
first primer. The template-binding region but not the tail region
of the second primer may anneal to the extension product of the
first copy of the first primer when the second primer anneals to
the extension product of the first copy of the first primer.
[0071] The extension product of the second primer may be treated
with a polymerase (which may have strand displacement activity) and
a second copy of the first primer so as to form an extension
product of the second copy of the first primer. During the
generation of the extension product of the second copy of the first
primer, the second copy of the first primer may be covalently
linked to the synthesized extension product, such that the second
copy of the first primer becomes part of the molecule described
herein as the "extension product of the second copy of the first
primer." The extension product of the second copy of the first
primer is complementary to the extension product of the second
primer.
[0072] Generation of the extension product of the second copy of
the first primer may result in the generation of a molecule
comprising the extension product of the second copy of the first
primer and the extension product of the second primer, which may be
referred to herein as the "secondary nucleic acid." A secondary
nucleic acid may comprise the 3' terminal region of the extension
product of the second primer (and the complement thereof) and may
comprise the 3' terminal region of the extension product of the
second copy of the first primer (and the complement thereof).
Secondary nucleic acid molecules include sequences of the template
region adjacent to tail sequences. In embodiments, double-stranded
nucleic acids are produced in which complementary template and tail
region sequences line up. In practice, multiple copies (e.g., two
or more) of the secondary nucleic acid are produced by any process
whereby a nucleic acid having the general structure of the
secondary nucleic acid may be generated, including by practice of
NAA methods discussed herein.
[0073] Thus, pairs of copies of the secondary nucleic acid may be
provided. Further numbers of copies may then be generated, for
example, by repetition of the foregoing steps and methods. For
example, the full process as described above for generating a
secondary nucleic acid from a primary nucleic acid may be repeated
two times, in order to generate a two pairs of copies of the
secondary nucleic acid; further repetitions may be performed to
amplify the number of copies further, e.g., to exponentially
amplify the number of copies (e.g., by powers of two).
[0074] In addition, since the secondary nucleic acid molecules
include sequences of the template region adjacent to tail
sequences, partially double-stranded nucleic acids may be produced
in which tail region sequences hybridize and line up. Since these
tail region sequences are attached to single-stranded template
regions, a cross-over structure having two nucleic acid strands
together held by the hybridized tail region sequences is produced.
These cross-over structures may be extended by a polymerase to form
extension products of both component strands. These extension
products which may be referred to as "concatemer strands." Two
concatemer strands may be annealed together, and may be
collectively referred to as a concatemer; such concatemers may
contain two or more copies of the nucleic acid template.
[0075] In some embodiments, even longer concatemers may be formed.
For example, concatemers may anneal together; or two concatemer
molecules may form a cross-over structure similar to those formed
by the shorter molecules termed concatemer strands, as discussed
above, followed by a larger concatemer molecule containing four
copies of the nucleic acid template. In another example, a
secondary nucleic acid and a concatemer may form a cross-over
structure, followed by a larger concatemer molecule containing
three copies of the nucleic acid template. In some embodiments,
multiple different concatemers of multiple different lengths may be
simultaneously generated.
[0076] Thus, concatemers generated according to such methods may be
of any length of nucleotides. In some embodiments, concatemer
molecules generated herein may be at least 30, 40, 50, 60, 70, 80,
90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000,
1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000,
15,000, 20,000, or 25,000 nucleotides in length. Concatemers
generated according to such methods may contain any number of
copies of a nucleic acid template. In some embodiments, concatemer
molecules generated herein may contain at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40,
45, 50, 60, 70, 80, 90, or 100 copies of a nucleic acid template.
Further examples are provided, and greater detail of these and
other examples, is provided in U.S. Patent Application 61/800,606,
filed Mar. 15, 2013.
Detection of Reactions
[0077] Progress of a method provided herein may be monitored in
multiple different ways. In one embodiment, a reaction may be
assayed for a nucleic acid amplification product (e.g. for the
level of the product or the rate of its generation). In another
embodiment, a reaction may be assayed for the activity of a
polymerase along a nucleic acid template (e.g. for movement of a
polymerase along a template strand). Thus, in some embodiments,
events of a method provided herein may observed due to the
accumulation of product from a method (which may be during or after
completion of steps of the method), or due to detectable events
occurring during the steps of a method.
[0078] The presence of amplified nucleic acids can be assayed, for
example, by detection of reaction products (amplified nucleic acids
or reaction by-products) or by detection of probes associated with
the reaction progress.
[0079] In some embodiments, reaction products may be identified by
staining the products with a dye. In some embodiments, a dye may
have greater fluorescence when bound to a nucleic acid than when
not bound to a nucleic acid. In some embodiments, a dye may
intercalate with a double-stranded nucleic acid or it may bind to
an external region of a nucleic acid. Nucleic acid dyes that may be
used with methods and compositions provided herein include, for
example, cyanine dyes, PicoGreen.RTM., OliGreen.RTM.,
RiboGreen.RTM., SYBR.RTM. dyes, SYBR.RTM. Gold, SYBR.RTM. Green I,
SYBR.RTM. Green II, ethidium bromide, dihydroethidium,
BlueView.TM., TOTO.RTM. dyes, TO-PRO.RTM. dyes, POPO.RTM. dyes,
YOYO.RTM. dyes, BOBO.RTM. dyes, JOJO.RTM. dyes, LOLO.RTM. dyes,
SYTOX.RTM. dyes, SYTO.RTM. dyes, propidium iodide, hexidium iodide,
methylene blue, DAPI, acridine orange, quinacrine, acridine dimers,
9-amino-6-chloro-2-methoxyacridine, bisbenzimide dyes, Hoechst
dyes, 7-aminoactinomycin D, actinomycin D, hydroxystilbamidine,
pyronin Y, Diamond.TM. dye, GelRed.TM., GelGreen.TM. and LDS
751.
[0080] Methods of detecting the presence of a target marker, such
as, e.g. a virus such as a flu virus, a bacterium such as a
Staphylococcus aureus bacterium, or other biological target may be
detected in a sample are disclosed herein, wherein the presence of
a plurality of possible targets are tested from a single sample
within a short period of time. In embodiments, the plurality of
possible targets comprise at least 5 possible targets, or at least
10 possible targets, or at least 15 possible targets, or at least
20 possible targets, or at least 25 possible targets, or at least
30 possible targets, or at least 35 possible targets, or at least
40 possible targets, or at least 45 possible targets, or at least
50 possible targets, or at least 55 possible targets, or at least
60 possible targets, or at least 64 possible targets, or at least
65 possible targets, or more. In embodiments, a short period of
time is a period of time that is five hours or less, or is four
hours or less, or is three hours or less, or is two hours or less,
or is one hour or less, or is 50 minutes or less, or is 40 minutes
or less, or is 30 minutes or less, or is 20 minutes or less, or is
10 minutes or less, or is 5 minutes or less.
[0081] In some embodiments, reaction products may be identified by
analysis of turbidity of amplification reactions for example, where
increased turbidity is correlated with formation of reaction
products and reaction by-products (e.g. pyrophosphate complexed
with magnesium).
[0082] In some embodiments, reaction products may be identified by
separating a reaction performed according to a method herein by gel
electrophoresis, followed by staining of the gel with a dye for
nucleic acids. The dye may be any nucleic acid dye disclosed herein
or otherwise known in the art.
[0083] In some embodiments, any method or composition known in the
art for the detection of nucleic acids or processes associated with
the generation of nucleic acids may be used with methods and
compositions provided herein.
[0084] In some embodiments, a nucleic acid probe which contains a
nucleotide sequence complementary to a portion of a nucleic acid
template strand (or strand having a similar or identical sequence)
and which contains one or both of a fluorescent reporter
(fluorophore) and a quencher are included in a reaction provided
herein.
[0085] In an example, a nucleic acid probe may contain a
fluorescent reporter at its 5' or 3' terminus, and a quencher at
the other terminus.
[0086] In another example, a nucleic acid probe may contain a
fluorescent reporter at its 5' or 3' terminus, and it may be
annealed to a nucleic acid primer containing a quencher. The
nucleic acid primer containing a quencher may contain the quencher
at a position in the primer such that when the nucleic acid probe
is annealed to the primer, the fluorescent reporter is
quenched.
[0087] In probes containing a fluorescent reporter and quencher
pair, the fluorescent reporter and quencher may be selected so that
the quencher can effectively quench the reporter. In some
embodiments, a fluorescent reporter is paired with a quencher where
the emission maximum of the fluorescent reporter is similar to the
absorption maximum of the quencher. Fluorophores that may be used
as the fluorescent reporter include, for example, CAL Fluor Gold,
CAL Fluor Orange, Quasar 570, CAL Fluor Red 590, CAL Fluor Red 610,
CAL Fluor Red 610, CAL Fluor Red 635, Quasar 670 (Biosearch
Technologies), VIC, NED (Life Technologies), Cy3, Cy5, Cy5.5 (GE
Healthcare Life Sciences), Oyster 556, Oyster 645 (Integrated DNA
Technologies), LC red 610, LC red 610, LC red 640, LC red 670, LC
red 705 (Roche Applied Science), Texas red, FAM, TET, HEX, JOE,
TMR, and ROX. Quenchers that may be used include, for example,
DDQ-I, DDQ-II (Eurogentec), Eclipse (Epoch Biosciences), Iowa Black
FQ, Iowa Black RQ (Integrated DNA Technologies), BHQ-1, BHQ-2,
BHQ-3 (Biosearch Technologies), QSY-7, QSY-21 (Molecular Probes),
and Dabcyl.
[0088] In some embodiments, a method provided herein may be
monitored in an apparatus containing a light source and an optical
sensor. In some situations, the reaction may be positioned in the
path of light from the light source, and light absorbed by the
sample (e.g. in the case of a turbid reaction), scattered by the
sample (e.g. in the case of a turbid reaction), or emitted by the
sample (e.g. in the case of a reaction containing a fluorescent
molecule) may be measured.
[0089] In embodiments, the sample may be diluted prior to testing
for the presence of a plurality of disease-causing agents. In
embodiments, such dilution of a sample is greater for subjects who
have a condition which indicates they may have higher levels of
disease-causing agents than subject who do not have that condition,
or than subjects who have a different condition.
Systems and Devices for Detection of Targets in Samples
[0090] The assays and methods disclosed herein may be performed on
a device, or on a system, for processing a sample. In embodiments,
Applicants disclose herein systems and devices suitable for use in
performing methods disclosed herein. The assays and methods
disclosed herein can be readily incorporated into and used in
device for processing a sample, or a system for processing a
sample, which may be an automated assay device, or may be an
automated assay system. Such a device, and such a system, may be
useful for the practice of the methods disclosed herein. For
example, a device may be useful for receiving a sample. A device
may be useful for preparing, or for processing a sample. A device
may be useful for performing an assay on a sample. A device may be
useful for obtaining data from a sample. A device may be useful for
transmitting data obtained from a sample. A device may be useful
for disposing of a sample following processing or assaying of a
sample.
[0091] A device may be part of a system, a component of which may
be an automatic assay device. A device may be an automatic assay
device. An automatic assay device may be configured to facilitate
collection of a sample, prepare a sample for a clinical test, or
effect a chemical reaction with one or more reagents or other
chemical or physical processing, as disclosed herein. An automatic
assay device may be configured to obtain data from a sample. An
automatic assay device may be configured to transmit data obtained
from a sample. An automatic assay device may be configured to
analyze data from a sample. An automatic assay device may be
configured to communicate with another device, or a laboratory, or
an individual affiliated with a laboratory, to analyze data
obtained from a sample.
[0092] An automatic assay device may be configured to be placed in
or on a subject. An automatic assay device may be configured to
accept a sample from a subject, either directly or indirectly. A
sample may be, for example, a blood sample (e.g., a sample obtained
from a fingerstick, or from venipuncture, or an arterial blood
sample), a urine sample, a biopsy sample, a tissue slice, stool
sample, or other biological sample; a water sample, a soil sample,
a food sample, an air sample; or other sample. A blood sample may
comprise, e.g., whole blood, plasma, or serum. An automatic assay
device may receive a sample from the subject through a housing of
the device. The sample collection may occur at a sample collection
site, or elsewhere. The sample may be provided to the device at a
sample collection site.
[0093] In some embodiments, an automatic assay device may be
configured to accept or hold a cartridge. In some embodiments, an
automatic assay device may comprise a cartridge. The cartridge may
be removable from the automatic assay device. In some embodiments,
a sample may be provided to the cartridge of the automatic assay
device. Alternatively, a sample may be provided to another portion
of an automatic assay device. The cartridge and/or device may
comprise a sample collection unit that may be configured to accept
a sample.
[0094] A cartridge may include a sample, and may include reagents
for use in processing or testing a sample, disposables for use in
processing or testing a sample, or other materials. Following
placement of a cartridge on, or insertion of a cartridge into, an
automatic assay device, one or more components of the cartridge may
be brought into fluid communication with other components of the
automatic assay device. For example, if a sample is collected at a
cartridge, the sample may be transferred to other portions of the
automatic assay device. Similarly, if one or more reagents are
provided on a cartridge, the reagents may be transferred to other
portions of the automatic assay device, or other components of the
automatic assay device may be brought to the reagents. In some
embodiments, the reagents or components of a cartridge may remain
on-board the cartridge. In some embodiments, no fluidics are
included that require tubing or that require maintenance (e.g.,
manual or automated maintenance).
[0095] A sample or reagent may be transferred to a device, such as
an automatic assay device. A sample or reagent may be transferred
within a device. Such transfer of sample or reagent may be
accomplished without providing a continuous fluid pathway from
cartridge to device. Such transfer of sample or reagent may be
accomplished without providing a continuous fluid pathway within a
device. In embodiments, such transfer of sample or reagent may be
accomplished by a sample handling system (e.g., a pipette); for
example, a sample, reagent, or aliquot thereof may be aspirated
into an open-tipped transfer component, such as a pipette tip,
which may be operably connected to a sample handling system which
transfers the tip, with the sample, reagent, or aliquot thereof
contained within the tip, to a location on or within the automatic
assay device. The sample, reagent, or aliquot thereof can be
deposited at a location on or within the automatic assay device.
Sample and reagent, or multiple reagents, may be mixed using a
sample handling system in a similar manner. One or more components
of the cartridge may be transferred in an automated fashion to
other portions of the automatic assay device, and vice versa.
[0096] A device, such as an automatic assay device, may have a
fluid handling system. A fluid handling system may perform, or may
aid in performing, transport, dilution, extraction, aliquotting,
mixing, and other actions with a fluid, such as a sample. In some
embodiments, a fluid handling system may be contained within a
device housing. A fluid handling system may permit the collection,
delivery, processing and/or transport of a fluid, dissolution of
dry reagents, mixing of liquid and/or dry reagents with a liquid,
as well as collection, delivery, processing and/or transport of
non-fluidic components, samples, or materials. The fluid may be a
sample, a reagent, diluent, wash, dye, or any other fluid that may
be used by the device, and may include, but not limited to,
homogenous fluids, different liquids, emulsions, suspensions, and
other fluids. A fluid handling system, including without limitation
a pipette, may also be used to transport vessels (with or without
fluid contained therein) around the device. The fluid handling
system may dispense or aspirate a fluid. The sample may include one
or more particulate or solid matter floating within a fluid.
[0097] In embodiments, a fluid handling system may comprise a
pipette, pipette tip, syringe, capillary, or other component. The
fluid handling system may have portion with an interior surface and
an exterior surface and an open end. The fluid handling system may
comprise a pipette, which may include a pipette body and a pipette
nozzle, and may comprise a pipette tip. A pipette tip may or may
not be removable from a pipette nozzle. In embodiments, a fluid
handling system may use a pipette mated with a pipette tip; a
pipette tip may be disposable. A tip may form a fluid-tight seal
when mated with a pipette. A pipette tip may be used once, twice,
or more times. In embodiments, a fluid handling system may use a
pipette or similar device, with or without a pipette tip, to
aspirate, dispense, mix, transport, or otherwise handle the fluid.
The fluid may be dispensed from the fluid handling system when
desired. The fluid may be contained within a pipette tip prior to
being dispensed, e.g., from an orifice in the pipette tip. In
embodiments, or instances during use, all of the fluid may be
dispensed; in other embodiments, or instances during use, a portion
of the fluid within a tip may be dispensed. A pipette may
selectively aspirate a fluid. The pipette may aspirate a selected
amount of fluid. The pipette may be capable of actuating stirring
mechanisms to mix the fluid within the tip or within a vessel. The
pipette may incorporate tips or vessels creating continuous flow
loops for mixing, including of materials or reagents that are in
non-liquid form. A pipette tip may also facilitate mixture by
metered delivery of multiple fluids simultaneously or in sequence,
such as in 2-part substrate reactions.
[0098] The fluid handling system may include one or more
fluidically isolated or hydraulically independent units. For
example, the fluid handling system may include one, two, or more
pipette tips. The pipette tips may be configured to accept and
confine a fluid. The tips may be fluidically isolated from or
hydraulically independent of one another. The fluid contained
within each tip may be fluidically isolated or hydraulically
independent from one fluids in other tips and from other fluids
within the device. The fluidically isolated or hydraulically
independent units may be movable relative to other portions of the
device and/or one another. The fluidically isolated or
hydraulically independent units may be individually movable. A
fluid handling system may comprise one or more base or support. A
base or support may support one or more pipette or pipette units. A
base or support may connect one or more pipettes of the fluid
handling system to one another.
[0099] An automatic assay device may be configured to perform
processing steps or actions on a sample obtained from a subject.
Sample processing may include sample preparation, including, e.g.,
sample dilution, division of a sample into aliquots, extraction,
contact with a reagent, filtration, separation, centrifugation, or
other preparatory or processing action or step. An automatic assay
device may be configured to perform one or more sample preparation
action or step on the sample. Optionally, a sample may be prepared
for a chemical reaction and/or physical processing step. A sample
preparation action or step may include one or more of the
following: centrifugation, separation, filtration, dilution,
enriching, purification, precipitation, incubation, pipetting,
transport, chromatography, cell lysis, cytometry, pulverization,
grinding, activation, ultrasonication, micro column processing,
processing with magnetic beads, processing with nanoparticles, or
other sample preparation action or steps. For example, sample
preparation may include one or more step to separate blood into
serum and/or particulate fractions, or to separate any other sample
into various components. Sample preparation may include one or more
step to dilute and/or concentrate a sample, such as a blood sample,
or other biological samples. Sample preparation may include adding
an anti-coagulant or other ingredients to a sample. Sample
preparation may also include purification of a sample. In
embodiments, all sample processing, preparation, or assay actions
or steps are performed by a single device. In embodiments, all
sample processing, preparation, or assay actions or steps are
performed within a housing of a single device. In embodiments, most
sample processing, preparation, or assay actions or steps are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, many sample processing,
preparation, or assay actions or steps are performed by a single
device, and may be performed within a housing of a single device.
In embodiments, sample processing, preparation, or assay actions or
steps may be performed by more than one device.
[0100] An automatic assay device may be configured to run one or
more assay on a sample, and to obtain data from the sample. An
assay may include one or more physical or chemical treatments, and
may include running one or more chemical or physical reactions. An
automatic assay device may be configured to perform one, two or
more assays on a small sample of bodily fluid. One or more chemical
reaction may take place on a sample having a volume, as described
elsewhere herein. For example one or more chemical reaction may
take place in a pill having less than femtoliter volumes. In an
instance, the sample collection unit is configured to receive a
volume of the bodily fluid sample equivalent to a single drop or
less of blood or interstitial fluid. In embodiments, the volume of
a sample may be a small volume, where a small volume may be a
volume that is less than about 1000 .mu.L, or less than about 500
.mu.L, or less than about 250 .mu.L, or less than about 150 .mu.L,
or less than about 100 .mu.L, or less than about 75 .mu.L, or less
than about 50 .mu.L, or less than about 40 .mu.L, or less than
about 20 .mu.L, or less than about 10 .mu.L, or other small volume.
In embodiments, all sample assay actions or steps are performed on
a single sample. In embodiments, all sample assay actions or steps
are performed by a single device. In embodiments, all sample assay
actions or steps are performed within a housing of a single device.
In embodiments, most sample assay actions or steps are performed by
a single device, and may be performed within a housing of a single
device. In embodiments, many sample assay actions or steps are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, sample processing, preparation,
or assay actions or steps may be performed by more than one
device.
[0101] An automatic assay device may be configured to perform a
plurality of assays on a sample. In embodiments, an automatic assay
device may be configured to perform a plurality of assays on a
single sample. In embodiments, an automatic assay device may be
configured to perform a plurality of assays on a single sample,
where the sample is a small sample. For example, a small sample may
have a sample volume that is a small volume of less than about 1000
.mu.L, or less than about 500 .mu.L, or less than about 250 .mu.L,
or less than about 150 .mu.L, or less than about 100 .mu.L, or less
than about 75 .mu.L, or less than about 50 .mu.L, or less than
about 40 .mu.L, or less than about 20 .mu.L, or less than about 10
.mu.L, or other small volume. An automatic assay device may be
capable of performing multiplexed assays on a single sample. A
plurality of assays may be run simultaneously; may be run
sequentially; or some assays may be run simultaneously while others
are run sequentially. One or more control assays and/or calibrators
(e.g., including a configuration with a control of a calibrator for
the assay/tests) can also be incorporated into the device; control
assays and assay on calibrators may be performed simultaneously
with assays performed on a sample, or may be performed before or
after assays performed on a sample, or any combination thereof. In
embodiments, all sample assay actions or steps are performed by a
single device. In embodiments, all of a plurality of assay actions
or steps are performed within a housing of a single device. In
embodiments, most sample assay actions or steps, of a plurality of
assays, are performed by a single device, and may be performed
within a housing of a single device. In embodiments, many sample
assay actions or steps, of a plurality of assays, are performed by
a single device, and may be performed within a housing of a single
device. In embodiments, sample processing, preparation, or assay
actions or steps may be performed by more than one device.
[0102] In embodiments, all of a plurality of assays may be
performed in a short time period. In embodiments, such a short time
period comprises less than about three hours, or less than about
two hours, or less than about one hour, or less than about 40
minutes, or less than about 30 minutes, or less than about 25
minutes, or less than about 20 minutes, or less than about 15
minutes, or less than about 10 minutes, or less than about 5
minutes, or less than about 4 minutes, or less than about 3
minutes, or less than about 2 minutes, or less than about 1 minute,
or other short time period.
[0103] An automatic assay device may perform nucleic acid assays,
including isothermal nucleic acid assays (e.g., assays for
detecting and measuring nucleic acid targets in a sample, including
DNA and RNA targets). In embodiments, an automatic assay device may
perform nucleic acid assays as disclosed in U.S. patent application
Ser. No. 14/183,503, filed Feb. 18, 2014; U.S. patent application
Ser. No. 14/214,850, filed Mar. 15, 2014; International Patent
Application PCT/US2014/030034, filed Mar. 15, 2014; and in
International Patent Application PCT/US2014/056151, filed Sep. 17,
2014. An automatic assay device may perform antibody assays,
including enzyme-linked immunosorbent assays (ELISA), and other
assays for detecting and measuring the amounts of proteins
(including antibodies), peptides, and small molecules in samples.
An automatic assay device may perform general chemistry assays,
including electrolyte assays (e.g., assays for detecting and
measuring the amounts of electrolytes such as sodium and potassium
in a sample).
[0104] An automatic assay device may be configured to detect one or
more signals relating to the sample. An automatic assay device may
be configured to identify one or more properties of the sample. For
instance, the automatic assay device may be configured to detect
the presence or concentration of one analyte or a plurality of
analytes or a disease condition in the sample (e.g., in or through
a bodily fluid, secretion, tissue, or other sample). Alternatively,
the automatic assay device may be configured to detect a signal or
signals that may be analyzed to detect the presence or
concentration of one or more analytes (which may be indicative of a
disease condition) or a disease condition in the sample. The
signals may be analyzed on board the device, or at another
location. Running a clinical test may or may not include any
analysis or comparison of data collected.
[0105] A chemical reaction or other processing step may be
performed, with or without the sample. Examples of steps, tests, or
assays that may be prepared or run by the device may include, but
are not limited to immunoassay, nucleic acid assay, receptor-based
assay, cytometric assay, colorimetric assay, enzymatic assay,
electrophoretic assay, electrochemical assay, spectroscopic assay,
chromatographic assay, microscopic assay, topographic assay,
calorimetric assay, turbidimetric assay, agglutination assay,
radioisotope assay, viscometric assay, coagulation assay, clotting
time assay, protein synthesis assay, histological assay, culture
assay, osmolarity assay, and/or other types of assays,
centrifugation, separation, filtration, dilution, enriching,
purification, precipitation, pulverization, incubation, pipetting,
transport, cell lysis, or other sample preparation action or steps,
or combinations thereof. Steps, tests, or assays that may be
prepared or run by the device may include imaging, including
microscopy, cytometry, and other techniques preparing or utilizing
images. Steps, tests, or assays that may be prepared or run by the
device may further include an assessment of histology, morphology,
kinematics, dynamics, and/or state of a sample, which may include
such assessment for cells.
[0106] A device may be capable of performing all on-board steps
(e.g., steps or actions performed by a single device) in a short
amount of time. A device may be capable of performing all on-board
steps on a single sample in a short amount of time. For example,
from sample collection from a subject to transmitting data and/or
to analysis may take about 3 hours or less, 2 hours or less, 1 hour
or less, 50 minutes or less, 45 minutes or less, 40 minutes or
less, 30 minutes or less, 20 minutes or less, 15 minutes or less,
10 minutes or less, 5 minutes or less, 4 minutes or less, 3 minutes
or less, 2 minutes or less, or 1 minute or less. The amount of time
from accepting a sample within the device to transmitting data
and/or to analysis from the device regarding such a sample may
depend on the type or number of steps, tests, or assays performed
on the sample. The amount of time from accepting a sample within
the device to transmitting data and/or to analysis from the device
regarding such a sample may take about 3 hours or less, 2 hours or
less, 1 hour or less, 50 minutes or less, 45 minutes or less, 40
minutes or less, 30 minutes or less, 20 minutes or less, 15 minutes
or less, 10 minutes or less, 5 minutes or less, 4 minutes or less,
3 minutes or less, 2 minutes or less, or 1 minute or less.
[0107] A device may be configured to prepare a sample for disposal,
or to dispose of a sample, such as a biological sample, following
processing or assaying of a sample.
[0108] In embodiments, an automatic assay device may be configured
to transmit data obtained from a sample. In embodiments, an
automatic assay device may be configured to communicate over a
network. An automatic assay device may include a communication
module that may interface with the network. An automatic assay
device may be connected to the network via a wired connection or
wirelessly. The network may be a local area network (LAN) or a wide
area network (WAN) such as the Internet. In some embodiments, the
network may be a personal area network. The network may include the
cloud. The automatic assay device may be connected to the network
without requiring an intermediary device, or an intermediary device
may be required to connect an automatic assay device to a network.
An automatic assay device may communicate over a network with
another device, which may be any type of networked device,
including but not limited to a personal computer, server computer,
or laptop computer; personal digital assistants (PDAs) such as a
Windows CE device; phones such as cellular phones, smartphones
(e.g., iPhone, Android, Blackberry, etc.), or location-aware
portable phones (such as GPS); a roaming device, such as a
network-connected roaming device; a wireless device such as a
wireless email device or other device capable of communicating
wireless with a computer network; or any other type of network
device that may communicate possibly over a network and handle
electronic transactions. Such communication may include providing
data to a cloud computing infrastructure or any other type of data
storage infrastructure which may be accessed by other devices.
[0109] An automatic assay device may provide data regarding a
sample to, e.g., a health care professional, a health care
professional location, such as a laboratory, or an affiliate
thereof. One or more of a laboratory, health care professional, or
subject may have a network device able to receive or access data
provided by the automatic assay device. An automatic assay device
may be configured to provide data regarding a sample to a database.
An automatic assay device may be configured to provide data
regarding a sample to an electronic medical records system, to a
laboratory information system, to a laboratory automation system,
or other system or software. An automatic assay device may provide
data in the form of a report.
[0110] A laboratory, device, or other entity or software may
perform analysis on data regarding a sample in real-time. A
software system may perform chemical analysis and/or pathological
analysis, or these could be distributed amongst combinations of
lab, clinical, and specialty or expert personnel. Analysis may
include qualitative and/or quantitative evaluation of a sample.
Data analysis may include a subsequent qualitative and/or
quantitative evaluation of a sample. Optionally, a report may be
generated based on raw data, pre-processed data, or analyzed data.
Such a report may be prepared so as to maintain confidentiality of
the data obtained from the sample, the identity and other
information regarding the subject from whom a sample was obtained,
analysis of the data, and other confidential information. The
report and/or the data may be transmitted to a health care
professional. Data obtained by an automatic assay device, or
analysis of such data, or reports, may be provided to a database,
an electronic medical records system, to a laboratory information
system (LIS), to a laboratory automation system (LAS), or other
system or software.
[0111] An example of an integrated system disclosed herein
comprises an integrated system for providing testing and diagnosis
of a subject suspected of suffering from a disease, said system
comprising a means for obtaining a sample (which may include, e.g.,
a sample collection device comprising a lancet, a syringe, a needle
and tube, or other blood collection device; or a nasal swab, a
mouth swab (e.g., a cheek swab), a throat swab, a vaginal swab, or
other swab, and fluid in which to immerse the swab following
contacting the swab with a subject); a cartridge comprising
reagents for assays for the disease; a device for running a
plurality of assays for detecting a plurality of diseases; a
device/means for displaying/communicating the detection of one or
more of said diseases. Such integrated systems may be configured
for uses wherein the sample is a small volume sample; for uses
wherein detection is performed in a short period of time; or for
uses both wherein the sample is a small volume sample and wherein
detection is performed in a short period of time.
[0112] Another example of an integrated system disclosed herein
comprises an integrated system for providing testing and diagnosis
of a subject suspected of suffering from a respiratory disorder,
said system comprising a means for obtaining a sample (which may
include, e.g., a nasal swab, a throat swab, a mouth swab (e.g., a
cheek swab), a vaginal swab, or other swab, and fluid in which to
immerse the swab following contacting the swab with a subject); a
cartridge comprising reagents for assays for respiratory disorders;
a device for running a plurality of assays for detecting a
plurality of respiratory disorders; a device/means for
displaying/communicating the detection of one or more of said
respiratory disorders. Such integrated systems may be configured
for uses wherein the sample is a small volume sample; for uses
wherein detection is performed in a short period of time; or for
uses both wherein the sample is a small volume sample and wherein
detection is performed in a short period of time.
[0113] A further example of an integrated system disclosed herein
comprises an integrated system for providing testing, diagnosis,
and prescription of a subject suspected of suffering from a
respiratory disorder, said system comprising a means for obtaining
a sample (which may include, e.g., a nasal swab, a throat swab, a
mouth swab (e.g., a cheek swab), a vaginal swab, or other swab, and
fluid in which to immerse the swab following contacting the swab
with a subject); a cartridge comprising reagents for assays for
respiratory disorders; a device for running a plurality of assays
for detecting a plurality of respiratory disorders; a device/means
for displaying/communicating the detection of one or more of said
respiratory disorders; and means for providing a prescription for
the treatment of a respiratory disorder detected in said sample.
Such integrated systems may be configured for uses wherein the
sample is a small volume sample; for uses wherein detection is
performed in a short period of time; or for uses both wherein the
sample is a small volume sample and wherein detection is performed
in a short period of time.
[0114] A yet further example of an integrated system as disclosed
herein comprises an integrated system for providing testing,
diagnosis, prescription, and treatment of a subject suspected of
suffering from a respiratory disorder, said system comprising a
means for obtaining a sample (which may include, e.g., a nasal
swab, a throat swab, a mouth swab (e.g., a cheek swab), a vaginal
swab, or other swab, and fluid in which to immerse the swab
following contacting the swab with a subject); a cartridge
comprising reagents for assays for respiratory disorders; a device
for running a plurality of assays for detecting a plurality of
respiratory disorders; a device/means for displaying/communicating
the detection of one or more of said respiratory disorders; means
for providing a prescription for the treatment of a respiratory
disorder detected in said sample; and means for
providing/selling/delivering a treatment (drug/pill/shot) to said
subject pursuant to said prescription. Such integrated systems may
be configured for uses wherein the sample is a small volume sample;
for uses wherein detection is performed in a short period of time;
or for uses both wherein the sample is a small volume sample and
wherein detection is performed in a short period of time.
[0115] Description and disclosure of examples of reagents, assays,
methods, kits, devices, and systems which may use, or be used with,
the methods, devices, and systems disclosed herein may be found,
for example, in U.S. Pat. No. 8,088,593; U.S. Pat. No. 8,380,541;
U.S. Pat. No. 8,435,738; U.S. Pat. No. 8,475,739; U.S. Pat. No.
8,840,838; U.S. patent application Ser. No. 14/183,503, filed Feb.
18, 2014; U.S. patent application Ser. No. 13/933,035, filed Jul.
1, 2013; U.S. patent application Ser. No. 13/769,820, filed Feb.
18, 2013; U.S. patent application Ser. No. 14/183,503, filed Feb.
18, 2014; patent application Ser. No. 14/214,850, filed Mar. 15,
2014; International Patent Application PCT/US2014/030034, filed
Mar. 15, 2014; International Patent Application PCT/US2014/056151,
filed Sep. 17, 2014; U.S. patent application Ser. No. 13/769,798,
filed Feb. 18, 2013; U.S. patent application Ser. No. 13/769,779,
filed Feb. 18, 2013; U.S. patent application Ser. No. 13/244,947
filed Sep. 26, 2011; PCT/US2012/57155, filed Sep. 25, 2012; U.S.
application Ser. No. 13/244,946, filed Sep. 26, 2011; U.S. patent
application Ser. No. 13/244,949, filed Sep. 26, 2011; and U.S.
application Ser. No. 13/945,202, filed Jul. 18, 2013, the
disclosures of which patents and patent applications are all hereby
incorporated by reference in their entireties.
EXAMPLES
[0116] The following examples are offered for illustrative purposes
only, and are not intended to limit the present disclosure in any
way.
Example 1
[0117] Thermocycling pre-amplification methods include any suitable
thermocycling method, including PCR, reverse-transcriptase PCR
(rtPCR), and other PCR methods. Two-step PCR methods include
methods with steps of incubating at a first temperature (e.g.,
between about 38-45.degree. C., or about 42.degree. C.); incubating
at a second, raised temperature (e.g., between about 90-105.degree.
C., or about 98.degree. C.); thermal cycling between two
temperatures where the two temperatures are a) a second, raised
temperature (e.g., between about 90-105.degree. C., or about
98.degree. C.) and b) a lower, annealing temperature (Tm, e.g.,
between about 50.degree. C. to about 80.degree. C.); and then
incubating at a third, lower temperature (e.g., a temperature
between about 65.degree. C. to about 75.degree. C.). Three-step PCR
methods include methods with steps of incubating at a first
temperature (e.g., between about 38-45.degree. C., or about
42.degree. C.); incubating at a second, raised temperature (e.g.,
between about 90-105.degree. C., or about 98.degree. C.); thermal
cycling between three temperatures where the three temperatures are
a) a second, raised temperature (e.g., between about 90-105.degree.
C., or about 98.degree. C.) and b) a lower, annealing temperature
(Tm, e.g., between about 50.degree. C. to about 80.degree. C.); and
c) a third, lower temperature (e.g., a temperature between about
65.degree. C. to about 75.degree. C.); and then, an incubation at a
third, lower temperature (e.g., a temperature between about
65.degree. C. to about 75.degree. C.). Following the last
incubation at the third, lower temperature, the amplified sample
may be used immediately, or may be stored (e.g., at 4.degree. C.)
until needed.
[0118] A method as provided herein was performed as follows:
[0119] PCR thermal cycling was performed on a sample, where the
sample was subjected to thermal cycling as follows:
[0120] 1) incubated for 30 minutes at 42.degree. C., then
[0121] 2) incubated at 98.degree. C. for 2 minutes, followed by
[0122] 3) 35 repeated thermal cycles as follows: [0123] i) 10
seconds at 98.degree. Cm, followed by [0124] ii) 15 seconds at Tm
.degree. C., followed by [0125] iii) 15 seconds at 72.degree. C.;
and then, after the 35 cycles,
[0126] 4) incubated for 2 minutes at 72.degree. C.
[0127] In alternative embodiments, the number of repeated cycles in
step 3) above may be altered; for example, the number of repeated
cycles may be reduced to, e.g., 30, or 25, or 20, or fewer cycles.
In other alternative embodiments, the number of repeated cycles in
step 3) above may be increased, e.g., to 40, or 45, or 50, or more
cycles. In alternative embodiments, step iii) above may be
shortened to less than 15 seconds, or may be eliminated altogether.
Where step iii) is eliminated, the PCR method becomes a "two-step"
PCR method.
[0128] Following the above steps 1 to 4, the amplified sample can
be immediately used for isothermal amplification (e.g., by NAA
methods) or may be stored at 4.degree. C. until needed. Steps 1) to
4) take approximately one hour to complete. The "Tm" indicates the
annealing temperature for a particular primer set; a primer set may
have a different Tm than other primer sets, or may have the same Tm
as another primer set. In many cases, Tm is typically between about
50.degree. C. to about 75.degree. C. For example, in the
experiments shown in the figures, Tm was 62.degree. C. for
RLX3539/40 primers, and was 72.degree. C. for RLX3547/48
primers.
[0129] Primers directed to nucleic acid sequences present in Ebola
virus were developed and synthesized. Two primer sets were used in
the experiments disclosed herein. Experiments were performed in
order to determine the limit of detection (LOD) of target Ebola
virus nucleic acid target sequences. These experiments were
performed with both pre-amplification primer sets RLX3539/40 and
RLX3547/48. For the primer set RLX3539/40, an annealing temperature
of 61.degree. C. was used. An annealing temperature of 62.degree.
C. may also be used with this primer set. An annealing temperature
of 71.degree. C. was used for primer set RLX3547/48.
[0130] In embodiments, the primers used for the PCR and the NAA
methods may be nested primers, where the nucleic acid targets of
one set of primers are internal to (encompassed within) the nucleic
acid sequences amplified by the other set of primers. For example,
primers used for NAA amplification may be targeted to nucleic acid
sequences that are amplified during PCR amplification, i.e., the
NAA target nucleic acids are internal to the target nucleic acids
to which the PCR primers hybridize.
[0131] Primer set RLX3539/40 had the following nucleic acid
sequence:
TABLE-US-00001 RLX3539 TGCCAACTTATCATACAGGC RLX3540
GACTGCGCCACTTTCC
[0132] Primer set RLX3547/48 had the following nucleic acid
sequence:
TABLE-US-00002 RLX3547 TGCCAACTTATCATACAGGCCTT RLX3548
TGCCCTTCCAAATACTTGACTGCGCCA
[0133] In the "pre-amplification" experiments shown in the figures,
rtPCR was used to amplify RNA target nucleic acids in a sample;
target nucleic acids were included with PCR reagents to a final
concentration of 10.sup.3, 10.sup.2, 10, 5, and 1 copy per
microliter (.mu.L), and PCR amplification performed; 2.5 .mu.L of
the resulting reagent, following the amplification, was combined
with NAA reagents and isothermal NAA amplification performed. In
the "control--no pre-amplification" experiments, target nucleic
acids were included with NAA reagents to a final concentration of
10.sup.3, 10.sup.2, 10, 5, and 1 copy per microliter (.mu.L), and
isothermal NAA amplification was performed. As shown in the
figures, these methods combining PCR pre-amplification with NAA
isothermal amplification were able to achieve an LOD of 1
copy/.mu.L (shown as "1 c/uL" in the figures); such an LOD means
there were 5 copies/RT PCR reaction. See results below for both
primers sets.
[0134] Detection of target is indicated by the inflection time
measured in the NAA assay (note that "NTC" (no-template control)
shows an inflection, but at much later times than a specific signal
detected for target sequences). Primer set RLX3539/40 was used for
the RT-PCR pre-amplification in the experiments shown in FIGS. 1
and 2. As shown in FIG. 1, target nucleic acid sequences were
detected in 20 minutes or less for all copy numbers in samples with
RT-PCR pre-amplification (left five columns, displaying inflection
times for 10.sup.3, 10.sup.2, 10, 5, and 1 copy per microliter
(.mu.L)). In contrast, the inflection times for control experiments
(NAA assays without RT-PCR pre-amplification, shown on the right)
were all greater than about 35 minutes (all but one were greater
than 60 minutes; the shortest inflection time being for the
greatest number of copies (10.sup.3 copies/.mu.L). Thus, target
nucleic acid sequences in samples were more readily detected by the
isothermal NAA methods as disclosed herein when the sample was
first "pre-amplified" by PCR (results labeled "pre-amplification"),
than by the NAA isothermal methods alone.
[0135] FIG. 2 shows some raw output of the experiments summarized
in FIG. 1. The traces shown in FIG. 2 are from NAA assays performed
following pre-amplification, with relative fluorescence shown in
the vertical direction, and time (as "cycles", where a cycle is
about 60 to 90 seconds, i.e., roughly about one minute) in the
horizontal direction.
[0136] Primer set RLX3547/48 was used for the RT-PCR
pre-amplification in the experiments shown in FIGS. 3, 4, and 5. As
shown in FIG. 3, target nucleic acid sequences were detected in
about 30 minutes or less for all copy numbers in samples with
RT-PCR pre-amplification (left five columns, displaying inflection
times for 10.sup.3, 10.sup.2, 10, 5, and 1 copy per microliter
(.mu.L)). In contrast, the inflection times for control experiments
(NAA assays without RT-PCR pre-amplification, shown on the right)
were all greater than about 35 minutes, and all but one, for
10.sup.3 copies/.mu.L, were greater than 60 minutes. Thus, in these
experiments as well, when the sample was first "pre-amplified" by
PCR, target nucleic acid sequences in samples were more readily
detected by the isothermal NAA methods than by the NAA isothermal
methods alone.
[0137] FIG. 4 shows some raw output from the NAA assays with
pre-amplification (summarized in FIG. 3), with relative
fluorescence shown in the vertical direction, and time (as
"cycles", where a cycle is about 60 to 90 seconds, i.e., roughly
about one minute) in the horizontal direction. In contrast, FIG. 5
shows some raw output from the NAA assays with no pre-amplification
(summarized in FIG. 3), with relative fluorescence shown in the
vertical direction, and time (as "cycles", where a cycle is about
60 to 90 seconds, i.e., roughly about one minute) in the horizontal
direction. Comparison of the traces in FIG. 4 and FIG. 5
illustrates the reduced time for detection (shorter inflection
time) when NAA isothermal methods are preceded by RT-PCR as
compared to the time for detection (inflection time) for NAA
isothermal methods alone (in the absence of RT-PCR
pre-amplification).
Example 2
[0138] In one non-limiting example, rapid identification of acute
and established HIV infection using a single test that is capable
of detecting HIV nucleic acids, antibodies, and antigens can have a
dramatic impact on public health by helping patients with positive
HIV results obtain the care and services they need faster. In one
embodiment, a single test for HIV is provided that is capable of
detecting HIV nucleic acids, antibodies, and antigens (for both
diagnostic and prognostic use), is simple to use on specimens,
processed or unprocessed, capable of either or both qualitative and
quantitative applications, may be performed in 5 hrs or less, 4 hrs
or less, 3 hrs or less, 2 hrs or less, or 60 minutes or less, and
suitable for commercial distribution.
[0139] In one embodiment, an HIV test of the invention tests for
all of the following from a sample obtained from a subject in a
single device or with the housing of one device: HIV-1 RNA, HIV-2
RNA, p24 antigen, HIV-1 antibodies, and HIV-2 antibodies. Thus, the
HIV test of the invention is also capable of differentiating
between HIV-1 and HIV-2 infection. In one embodiment, a simplified
sixth-generation HIV test comprises performing all the following
tests from one small sample: HIV-1 RNA, HIV-2 RNA, p24 antigen,
HIV-1 IgG, HIV-2 IgG, HIV-1 IgM, and HIV-2 IgM.
[0140] In one non-limiting example, the sample may be between about
100 to about 200 microliters of blood (venous or capillary). In
another non-limiting example, the small sample may be between about
10 to about 100 microliters of blood (venous or capillary). In some
embodiments, the blood is pre-processed so that the sample being
tested is plasma. In some embodiments, the blood is pre-processed
so that the sample being tested is serum. In some embodiments, the
blood is pre-processed so that the sample being tested is diluted
blood. In some embodiments, the sample being tested is undiluted
blood. In some embodiments, the pre-processing occurs on a device
separate from the sample processing device. Optionally, the
pre-processing and sample processing both occur in one device or
within the housing of one device. In an embodiment, the HIV-1 RNA,
HIV-2 RNA, p24 antigen, HIV-1 antibodies, and HIV-2 antibodies are
tested from a single sample obtained from the subject.
[0141] In one non-limiting example, by combining nucleic acid
testing and serological testing, this embodiment of the test will
provide information to detect acute infections as well as for
established infections. Optionally, this HIV test is fully
automated and will have on-board quality controls (QC) that are
processed in parallel with the patient sample. In one embodiment of
the on-board QC, the on-board quality controls will include
positive and negative controls as well as the human RNaseP gene to
act as a positive control with human clinical specimens to indicate
that adequate isolation of nucleic acid resulted from the
extraction of the clinical specimen. In one non-limiting example
the QC reagents and consumables are contained in the same cartridge
that has the reagents and consumables for the HIV test.
[0142] In one non-limiting example, this HIV test is designed to be
run from a capillary whole-blood sample. Optionally, in a still
further embodiment, it should be understood that the test can be
configured to run on capillary or venous whole blood, serum, or
plasma. In one embodiment, the test is processed automatically by a
sample processing without any user intervention. In one embodiment,
the test is processed automatically by a sample processing without
any user intervention after loading of the sample into the device.
Given the ease of sample collection, the ease of running the
sample, the high sensitivity/high specificity nucleic acid,
antigen, and serologic testing, this embodiment of the test can be
used for rapid diagnosis and differentiation of HIV-1 and HIV-2
infections.
[0143] By way of one non-limiting example, the steps of processing
a sample may comprise [0144] a. RNA extraction from the sample by a
beads-based method is performed; [0145] b. Reverse transcription
(RT) is performed; [0146] c. Pre-amplification is performed through
a series of polymerase chain reaction (PCR) amplification cycles,
[0147] d. Isothermal amplification and detection are performed;
[0148] e. Immunoassays to detect p24, HIV-1 antibodies, and HIV-2
antibodies are performed in parallel to the above nucleic acid
testing; [0149] f. On-board controls are processed in parallel to
the sample processing on the instrument.
[0150] The immunoassays may be direct or indirect immunoassays and
may be an ELISA (enzyme-linked immunosorbent assay). For example,
p24 may be detecting using an antibody-sandwich immunoassay using a
monoclonal antibody specific for p24. The HIV test of the invention
may also be capable of detecting IgG, IgM, or both, antibodies of
HIV-1 and HIV-2. In a particular embodiment, the test of the
invention is capable of detecting both IgG and IgM antibodies of
HIV-1 and HIV-2. In a non-limiting example, both the IgG and IgM
antibodies are detected using antigen sandwich immunoassays for
HIV-1 and HIV-2. In an embodiment, the immunoassays are capable of
distinguishing between HIV-1 and HIV-2 antibodies by, for example,
using antigens specific for HIV-1 and HIV-2, respectively. In
another embodiment, the HIV tests are capable of distinguishing
between antigen reactivity and antibody reactivity by, for example,
using different detection reagents, performing the assays
separately from one another, and/or different detection methods.
The capture reagent (eg. antigen, antibody, etc.) may be
immobilized on a solid support, including but not limited to,
beads, surface of wells, and inside assay tips.
[0151] Further, although many of embodiments herein describe
nucleic acid amplification using an isothermal technique, it should
be understood that other nucleic acid amplification techniques such
as PCR, qPCR, nested PCR, or other nucleic acid detection
techniques are not excluded. In another embodiment, the test is
capable of distinguishing between HIV-1 and HIV-2 RNA by using
primers that are specific to HIV-1 and HIV-2, respectively.
[0152] In one non-limiting example, raw data from the testing is
transmitted to a data analyzer for interpretation. In one
embodiment, the data analyzer is not at the same location as the
device that processes the sample using the above steps. Optionally,
other embodiments may have the data analyzer in the same location
as the sample processor. Optionally, other embodiments may combine
the data analyzer and the sample processor in the same device. It
should also be understood that in some embodiments, the raw data is
in the form of voltage, current, numeric, electronic, optical,
digital, or other non-final value that, if intercepted by another
party or device, is meaningless unless the intercepting party or
device has conversion information or an algorithm to convert such
raw data or other readout into health measurements.
[0153] In one embodiment, test cartridges are stored refrigerated
(4-8.degree. C.) prior to use. Optionally, the test cartridges are
stored refrigerated (2-10.degree. C.) prior to use. In one
embodiment, the test uses a single cartridge that provides all
reagents and consumables used for at least the nucleic acid testing
and serological testing. Optionally, the combined test uses a
single cartridge that provides all reagents and consumables used
for the nucleic acid testing, antibody testing, and antigen
testing. Optionally, the combined test uses a single cartridge that
provides all reagents and consumables used for the nucleic acid
testing, antibody testing, and antigen testing on blood and a
tissue sample contained in the cartridge. Optionally, the combined
test uses a single cartridge that provides all reagents and
consumables used for the nucleic acid testing, antibody testing,
and antigen testing on blood and a sample on a nasal swab contained
in the cartridge. Optionally, the combined test uses a single
cartridge that provides all reagents and consumables used for the
nucleic acid testing, antibody testing, and antigen testing on
blood and a sample on a throat swab contained in the cartridge.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on capillary blood.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on diluted capillary blood.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on diluted venous blood.
Optionally, the combined test uses a single cartridge that provides
all reagents and consumables used for the nucleic acid testing,
antibody testing, and antigen testing on venous blood.
[0154] The HIV test, as described in one embodiment herein, can be
deployed at urgent care centers with trained and certified medical
staff on-site to perform finger-stick tests and collect samples.
Optionally, some may have these test available at locations at
retail pharmacies, retail stores, or other locations accessible at
location that subjects may visit for other purposes (shopping or
the like) during hours when regular doctor offices are closed or
even when the doctor offices are open.
[0155] In one embodiment, fully automated production facilities can
support the production of tests in extremely high volumes
(sufficient for processing tens of millions of samples).
[0156] In one non-limiting example, the sensitivity of the HIV test
will be comparable to if not more sensitive than other FDA-approved
nucleic acid tests such as the Abbott RealTime HIV-1 test. In one
embodiment, the limit of detection (LOD) may be as low as 5, 8, 10,
15, 20, 50, 100, 500, or 1000 HIV copies in a sample.
[0157] In one embodiment herein, the nucleic acid tests are
highly-sensitive for low copy number sensitivity that can be used
for rapid diagnosis during acute infection. By way of non-limiting
example, the nucleic acid tests in this embodiment are specific to
HIV-1 Group M (A-H) and Group O, and HIV-2 subtypes A and B,
respectively.
[0158] In one embodiment of the test herein, the turnaround time
may be a run time that is less than 60 minutes. The traditional
turnaround time for existing nucleic acid testing is 6.5 hours (3.5
hours for extraction and 3 hours for amplification and detection)
for individual or pooled nucleic acid testing.
[0159] In terms of CLIA status and test complexity, given the ease
of sample collection, on-board QC, automated sample processing, and
automated analysis and results interpretation, the HIV may be
configured for a CLIA waiver or similar waiver from other
regulatory body regarding test complexity, while some may opt to
run it through CLIA certified or other regulatory agency certified
laboratories.
[0160] The embodiments herein may dramatically improve the ability
to rapidly identify acute and established HIV infection through
simplified nucleic acid tests for detecting and quantifying HIV,
and thus allow patients to receive care and services faster.
[0161] In some embodiments, the HIV test uses a quantitative
nucleic acid amplification process. Optionally, some embodiments
may use a qualitative nucleic acid amplification process.
Example 3 MRSA Detection
[0162] Methicillin-resistant Staphylococcus aureus (MRSA) is a type
of Staphylococcus aureus (S. aureus) which can cause infection in
humans and is resistant to beta-lactam antibiotics. As a result of
its resistance to certain antibiotics, MRSA infections can be
difficult to treat.
[0163] S. aureus bacteria typically become methicillin-resistant
through acquiring the mecA gene. The mecA gene is typically located
in the staphylococcal cassette chromosome mec (SCCmec), which is a
multi-gene, transferable genomic element. Different types of SCCmec
exist, with known SCCmec types ranging in size from approximately
21,000-67,000 nucleotides in length. Generally, within each type of
SCCmec, the mecA gene is surrounded by other genes or elements
which are other components of the SCCmec. In MRSA bacteria, SCCmec
containing the mecA gene is integrated into the S. aureus
chromosome.
[0164] In order identify and control MRSA bacteria, effective
reagents and methods for MRSA detection are needed.
[0165] Provided herein are systems and methods for MRSA detection.
Various features described herein may be applied to any of the
particular embodiments set forth below or for any other types
systems for or involving MRSA detection. Systems and methods
described herein may be applied as a standalone system or method,
or as part of an integrated system or method. It shall be
understood that different aspects of the disclosed systems and
methods can be appreciated individually, collectively, or in
combination with each other.
[0166] Prior methods for MRSA detection typically separately test a
sample for the mecA gene and for genetic material from the S.
aureus chromosome. If both the mecA gene and S. aureus genetic
material are found in the sample, a presumptive conclusion is made
that MRSA is present. However, this conclusion might not be
accurate, because the mecA gene can exist outside of S. aureus (as
part of the SCCmec, which is transferable between organisms). Thus,
a sample that contains both the mecA gene and S. aureus might not
actually contain MRSA; instead, it may contain non-MRSA S. aureus
bacteria, and a different bacteria or free genetic element which
contains the mecA gene. This situation thus may give rise to a
false-positive identification of MRSA in a sample.
[0167] Methods and compositions provided herein address the above
problem, and provide methods and compositions for identifying the
mecA gene in a S. aureus chromosome (and thus, true MRSA).
[0168] One approach to identifying a mecA gene in a S. aureus
chromosome might be to perform, for example, polymerase chain
reaction (PCR), where the PCR reaction would contain a sample which
might contain MRSA bacteria or MRSA genetic material, and wherein
one of the primers for the PCR reaction would anneal to portion of
the mecA gene and the other primer for the PCR reaction would
anneal to a portion of the S. aureus chromosome. If such a PCR
reaction yielded a reaction product, it would indicate that both
the mecA gene and genetic material from the S. aureus chromosome
were on the same strand (and thus, that the sample contained true
MRSA bacteria). However, typically this approach is not effective,
because in most MRSA bacteria, the mecA gene is many thousands of
nucleotides away from genetic material of the S. aureus chromosome.
This is due to the fact that in MRSA, the mecA gene is integrated
into the S. aureus chromosome as part of the SCCmec, and the mecA
gene is typically in an inner portion of the SCCmec, surrounded on
both sides by thousands of additional nucleic acids of the SCCmec
insert. The relatively large nucleotide distance between the mecA
gene and the S. aureus chromosome in most MRSA strains generally
results in the poor performance of traditional PCR reactions as
described above (e.g. with one primer annealing to a portion of the
mecA gene and the other primer annealing to a portion of the S.
aureus chromosome), as traditional PCR and many other nucleic acid
amplification techniques are not very effective at amplifying
relatively long nucleotide sequences.
[0169] Multiple different types of SCCmec have been identified. For
instance, the position of the mecA gene may differ between the
different SCCmec types; the content of the SCCmec elements may
differ between the different SCCmec types, and the locations in the
S. aureus chromosome where the SCCmec are inserted (e.g. attL and
attR) may differ between the different SCCmec types. The mecA gene
when present in a S. aureus chromosome is typically separated from
S. aureus genetic material by thousands or even tens of thousands
of nucleotides.
[0170] Provided herein are improved methods and compositions for
identifying the mecA gene in a S. aureus chromosome (and thus, true
MRSA).
[0171] In embodiments, methods provided herein comprise at least
two steps: 1) a step to generate a nucleic acid strand wherein at
least a portion of the mecA gene and the S. aureus chromosome are
in close physical proximity to each other within the strand; and 2)
a step to perform a nucleic acid amplification method using at
least a first primer, a second primer and the nucleic acid strand
of step 1), wherein the first primer anneals to a portion of the
mecA gene and the second primer anneals to a portion of the S.
aureus chromosome, and where an amplification product is generated
which includes portions of both the mecA gene and the S. aureus
chromosome.
[0172] In embodiments of systems and methods provided herein, a S.
aureus chromosome or portion thereof containing a SCCmec cassette
containing a mecA gene 200 may be provided (referred to as a "MRSA
chromosome"). The MRSA chromosome 200 may be incubated with a first
primer and a second primer, wherein the first primer is
complementary to a portion of the mecA gene (or, optionally, other
element of the SCCmec cassette), and the second primer is
complementary to a portion of the S. aureus chromosome. In
addition, one or both of the primers is phosphorylated at the 5'
end. The MRSA chromosome is incubated in a first DNA amplification
reaction with a DNA polymerase having high processivity. An
exemplary DNA polymerase with high processivity is phi29
polymerase. The first DNA amplification reaction may be, for
instance, an isothermal method. By use of a DNA polymerase with
high processivity, at least a small amount of amplification product
202 may be generated. The amplification product from this reaction
202 will contain both S. aureus and mecA genetic material, but
typically, only a small amount of amplified material 202 will be
generated. This amplified material 202 is generally difficult to
detect, due to the small amount generated. Accordingly, the
amplified material 202 is then incubated with a DNA ligase, which
can ligate amplification products 202 together due to the phosphate
groups on the 5' end of the primers used for the amplification
reaction. Incubation of the amplified material 202 with a ligase
may result in two general types of ligation products: a)
concatemers 204 formed by the end-to-end ligation of two or more
amplification products 202; or b) circularized products 206 formed
by the ligation of one end of an amplification product 202 to the
other end of the same amplification product 202. With both types of
ligation products (204 and 206), the mecA gene is brought into
close physical proximity with S. aureus genetic material (e.g.
attR, orfX). Accordingly, both types of ligation products are
suitable templates for nucleic acid amplification methods which are
most effective at amplification of relatively small amplicons (e.g.
2000 nucleotides or less). Thus, the next step of a method provided
herein involves using the ligation products for a second nucleic
acid amplification step. This second nucleic acid amplification
step will use at least a first primer which anneals to a portion of
the mecA gene (or optionally, another portion of the SCCmec
cassette), and a second primer which anneals to S. aureus genetic
material. Various nucleic acid amplification methods may be used
for the second nucleic acid amplification step, such as PCR or an
amplification method as described in PCT/US14/56151, filed Sep. 17,
2014, which is hereby incorporated by reference in its entirety for
all purposes. In embodiments, the first primer and second primer of
the second nucleic acid amplification step are different than the
first primer and second primer of the first nucleic acid
amplification step (which produced product 202). In embodiments,
the first primer and second primer of the second nucleic acid
amplification step have an opposite orientation as compared to the
first primer and second primer of the first nucleic acid
amplification step. In embodiments, the first primer and second
primer of the second nucleic acid amplification step are the same
as the first primer and second primer of the first nucleic acid
amplification step.
[0173] FIG. 6 provides exemplary primer sequences which may be used
with a method provided herein.
[0174] In embodiments, all of the steps of methods provided herein
may be permitted to occur simultaneously in the same vessel (e.g.
all reagents for methods provided herein may be provided in the
same vessel at the same time).
[0175] In addition to being used for the detection of true MRSA
bacteria, the method provided herein may also be used for the
detection of other genetic elements in other species or molecules,
in which, for example, there are two or more genetic elements which
may be on a common nucleic acid strand or part of a common
molecule, but for which the elements are separated from each other
by a large nucleotide distance. The general approach as provided
herein (i.e. to perform a first amplification reaction, followed by
a ligation reaction, followed by a second amplification reaction)
may be used for a wide range of genetic elements which present a
similar structural problem.
[0176] In addition, in embodiments, the first amplification
reaction provided herein may be omitted, if multiple copies of a
molecule containing genetic elements of interest are already
present, and such molecules may be ligated together to form
structures in which the elements of interest may be readily
amplified by, for example, as PCR or an amplification method as
described in PCT/US14/56151.
Example 4 SNP Detection
[0177] Within Hepatitis C genotype 1a, there is a polymorphic site
Q80K in the protease gene, NS3, that is associated with treatment
failure with the protease inhibitor boceprevir, which otherwise can
be effective in blocking peptide maturation in the virus. Assessing
the Q80 polymorphism in the NS3 gene in patients with subtype 1a
can be an important part of formulating a treatment plan.
[0178] Accordingly, improved reagents and methods for assessing the
Q80 polymorphism are needed. In addition, improved reagents and
methods for assessing other SNPs are needed.
[0179] Provided herein are systems and methods for assessing SNPs.
Various features described herein may be applied to any of the
particular embodiments set forth below or for any other types
systems for or involving assessing SNPs. Systems and methods
described herein may be applied as a standalone system or method,
or as part of an integrated system or method. It shall be
understood that different aspects of the disclosed systems and
methods can be appreciated individually, collectively, or in
combination with each other.
[0180] In embodiments, provided herein are compositions and methods
for evaluating a SNP, mutation, or other nucleotide of interest in
a target sequence. In some situations, a target sequence may have
multiple different polymorphisms which surround the position of the
nucleotide of interest. For example, the nucleotide of interest may
be located in the 60.sup.th nucleotide position of a target
sequence of 150 nucleotides (with the 5' most nucleotide being in
the first position, the nucleotide next to the 5' most nucleotide
being in the second position, etc.).
[0181] In embodiments, a nucleotide of interest may be evaluated
through use of a method for SNP detection as provided in
PCT/US14/56151, filed Sep. 17, 2014, which is hereby incorporated
by reference in its entirety for all purposes. In such a method, a
primer pair is used to amplify a target nucleic acid containing the
nucleotide of interest, wherein each primer contains a tail/first
region and a template-binding/second region. In embodiments, the
tail of the/first region of the second primer of the primer pair is
complementary to a portion of the target nucleic acid including the
nucleotide of interest. In a method as disclosed in PCT/US14/56151,
the identity of a nucleotide of interest may be determined, for
example, by comparing the rate or amount of amplification of a
target nucleic acid containing the nucleotide of interest by one or
more primer pairs having slightly different nucleotide sequences in
the first/tail region of the primer (typically by just a single
nucleotide difference between the primer pairs).
[0182] However, in some situations, it may be difficult to perform
a method for SNP detection as provided in PCT/US14/56151, if there
is a lot of sequence variance in the target nucleic acid one or
more positions near the nucleotide of interest. Such positions, for
example, may be in the region corresponding to the template-binding
regions of the first and/or second primer. If the primers as
described in PCT/US14/56151 for SNP detection are not able to
readily bind to a target nucleic acid sequence, the method
disclosed therein may not be effective for SNP detection.
[0183] Accordingly, provided herein are compositions and methods
which facilitate the identification of SNPs. In a first step, a
region of a target nucleic acid containing the nucleotide of
interest is amplified by a first amplification reaction (such as
PCR), to generate a first amplification product. In this first
amplification reaction, relatively long primer pairs (e.g. each
primer contains at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 80, 90, or 100 nucleotides) are used to amplify the target
nucleic acid. The long primers may tolerate relatively large
amounts of sequence diversity in the template-binding regions (i.e.
because the primers are long, they may still anneal to a target
sequence, even if multiple nucleotides are mis-matched).
Importantly, in the first amplification reaction, neither of the
primers is to anneal to the exact position of the nucleotide/SNP of
interest (i.e. the primers should only anneal to areas near the SNP
of interest). This is because with methods provided herein, it is
not desirable to change the identity of the nucleotide/SNP of
interest (since it is desired to identify the nucleotide/SNP of
interest). Once a first amplification product is generated in the
first amplification reaction, the first amplification product will
have a generally known nucleotide sequence (as a result of knowing
the nucleotide sequence of the primers used in the first
amplification reaction to generate the first amplification
product). However, the identity of the nucleotide/SNP of interest
will still be unknown in the first amplification product, since
neither of the primers used in the first amplification reaction
annealed to the location of the nucleotide/SNP of interest. The
first amplification product may then incubated with primers as
provided in PCT/US14/56151 for SNP detection. These primers may be
designed to have regions that are complementary to sequences that
are known to be present in the first amplification product, based
on the fact that the first amplification product was generated
through use of primers of known sequences. The identity of a
SNP/nucleotide of interest may then be determined as described in
PCT/US14/56151.
[0184] FIG. 7 provides a general schematic of a method provided
herein. A nucleic acid strand 100 containing a target nucleic acid
102 may be provided. The target nucleic acid 102 may contain
multiple polymorphisms/variant nucleotides 104. The target nucleic
acid 102 also contains a nucleotide/SNP of interest 106. The target
nucleic acid is incubated with a first primer 112 and second 114
primer, in order to generate a first amplification product 120. The
first amplification product 120 will have a generally known
nucleotide sequence, since it was amplified with the first primer
112 and second primer 114 (which have known nucleotide sequences).
During the process of generating the first amplification product
120, the multiple polymorphisms/variant nucleotides 104 are
replaced by the nucleotides of the first primer 112 and second
primer 114. However, the first amplification product 120 still has
an unknown nucleotide/SNP of interest 106. The first amplification
product 120 may then be used in a method as described in
PCT/US14/56151 for SNP detection.
[0185] In embodiments, methods provided herein may be used to
assess a SNP in the polymorphic site Q80K in the Hepatitis C
protease gene, NS3. FIG. 8 provides exemplary primer sequences
which may be used as part of a method for assessing the Q80K site.
Methods provided herein may be used to assess SNPs in many
different target nucleic acids, wherein the target nucleic acids
have a high level of sequence variability.
[0186] FIG. 9 provides results from steps of a method performed as
described herein. FIG. 10 provides primer sequences used for the
experiments of FIG. 9. In addition, nucleotide sequences also used
for the results of FIG. 9 were as follows:
TABLE-US-00003 T255Q sequence:
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATAC
CAATGTAGACCAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTGCCCGCT
CATTGACACCCTGCACCTGCG. T255K sequence:
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATAC
CAATGTAGACAAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTGCCCGCT
CATTGACACCCTGCACCTGCG
[0187] In embodiments, all of the steps of methods provided herein
may be permitted to occur simultaneously in the same vessel (e.g.
all reagents for methods provided herein may be provided in the
same vessel at the same time).
[0188] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. For example, a feature of one embodiment
may be combined with a feature of another embodiment, whether such
combination is described herein or not. It should also be
understood that while the invention provided herein has been
described herein using a limited number of terms and phrases for
purposes of expediency, the invention could also be described using
other terms and phrases not provided herein which also accurately
describe the invention.
[0189] Additionally, although some embodiments herein may describe
the initial thermal cycling as a "PCR" process, many embodiments
herein may perform only a thermal cycling style processing and not
any type of detection during the initial "PCR" process. In
embodiments, it should be understood that other processes that
provide an increased number of copy numbers may be used for the
initial sample enrichment. The term "initial" as used in the
examples herein does not necessarily imply that it is the first
step, but merely that it occurs before one or more follow-up
detection step(s). Some embodiments may view this as a
pre-amplification step. Some embodiments may view this as a sample
enrichment step.
[0190] In embodiments, it should also be understood that the
initial thermal cycling process may be performed on a bulk portion
and/or common portion of the sample with a plurality of different
binder types therein (ebola, malaria, etc. . . . ) for a plurality
of different loci, wherein post-thermal cycling, the process may be
processed for more specific detection such as but not limited to
DNA amplification or other detection processing currently known or
may be developed in the future. In such embodiments where there is
bulk processing of sample with a plurality of different binders, it
should be understood that detection in the initial stage, although
not specifically excluded, such detection is generally not done due
the variety of different binders in the sample that may or may not
yield actionable data. In embodiments, the hybrid process can be
configured to detect many targets from a single common sample that
is enriched, wherein the targets may be at least 5 or more. In
embodiments, the process may detect many targets from a single
sample, wherein the targets may be at least 7 or more. In
embodiments, the process may detect many targets from a single
sample, wherein the targets may be at least 10 or more. In
embodiments, the process may detect many targets from a single
sample, wherein the targets may be at least 20 or more.
[0191] In embodiments, the hybrid process herein may improve
sensitivity of the isothermal process, at least in part due to the
increase in copy numbers from the initial thermal cycling, but also
provides better specificity than PCR specificity, in part because
of the use of at least two different primers (for example, primer
in thermal cycling process and primer in the isothermal process).
In embodiments, the initial process may be coarser for the thermal
cycling step for enriching for the target(s) and not necessarily
for detection during the initial processing. In embodiments, the
initial processing may create non-specific product (along with
creating more copies of the target material) and the processing of
the sample in subsequent step provides at least a second layer of
detection that is more specific for the desired target(s) but
having the benefit of more copies to detect due to the enrichment
from the initial step (even if creating some non-specific product
in the process). In embodiments, the secondary or other later
detection process of the hybrid process may be viewed as an end
point detection that is sequence specific. In embodiments, the
hybrid process may be better than either a PCR process or
isothermal process individually in terms of sensitivity and
specificity
[0192] In embodiments, some may use parallel track processing
wherein at least one portion of the initial sample is processed
along one track using the hybrid process and at least another
portion is processed on at least one other track such as but not
limited to another PCR process or an isothermal detection process.
Because it may be the case that it is unknown if the sample has
sufficient copy numbers of a target in the sample, some situations
may occur where pre-amplification is not needed for detection to
occur in one of the non-hybrid processing tracks, particularly if
copy numbers are sufficient without sample enrichment. If one track
returns a signal sooner, the process may be stopped earlier if a
sufficient response is received on one track that reduces the need
to continue detection along one of the other parallel tracks. In
embodiments, a sample processing device may include at least one
thermal cycler and at least one non-cycling heater. Optionally,
some embodiments may have multiple thermal cyclers wherein at one
can be controlled not to cycle. In embodiments, some embodiments
may have a thermal cycler with fewer wells, chambers, or vessels
for thermal cycling that the subsequent detection process, but
optionally, each may be configured to hold larger volumes than the
wells of the follow-on detection method. Thus, one embodiment may
have one or two wells, chambers, or vessels for thermal cycling and
at least 10 or more wells, chambers, or vessels for the follow-on
detection, where each well, chamber, or vessel may be more specific
for certain loci. In such an embodiment, a division of the sample
into smaller aliquots may occur after the initial thermal cycling
step that enriches the sample. In one embodiments, a control sample
may also be thermal cycled for control purposes.
[0193] It should be understood that as used in the description
herein and throughout the claims that follow, the meaning of "a,"
"an," and "the" includes plural reference unless the context
clearly dictates otherwise. For example, a reference to "an assay"
may refer to a single assay or multiple assays. Also, as used in
the description herein and throughout the claims that follow, the
meaning of "in" includes "in" and "on" unless the context clearly
dictates otherwise. The appended claims are not to be interpreted
as including means-plus-function limitations, unless such a
limitation is explicitly recited in a given claim using the phrase
"means for." As used in the description herein and through the
claims that follow, a first object described as containing "at
least a portion" of a second object may contain the full amount
of/the complete second object.
[0194] As used in the description herein and throughout the claims
that follow, the terms "comprise", "include", and "contain" and
related tenses are inclusive and open-ended, and do not exclude
additional, unrecited elements or method steps. Also, the presence
of broadening words and phrases such as "one or more," "at least,"
"but not limited to" or other like phrases in some instances shall
not be read to mean that the narrower case is intended or required
in instances where such broadening phrases may be absent. Finally,
as used in the description herein and throughout the claims that
follow, the meaning of "or" includes both the conjunctive and
disjunctive unless the context expressly dictates otherwise. Thus,
the term "or" includes "and/or" unless the context expressly
dictates otherwise.
[0195] This document contains material subject to copyright
protection. The copyright owner (Applicant herein) has no objection
to facsimile reproduction by anyone of the patent documents or the
patent disclosure, as they appear in the US Patent and Trademark
Office patent file or records, but otherwise reserves all copyright
rights whatsoever. The following notice shall apply: Copyright
2013-15 Theranos, Inc.
Sequence CWU 1
1
24120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1tgccaactta tcatacaggc 20216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2gactgcgcca ctttcc 16323DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3tgccaactta tcatacaggc ctt
23427DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4tgcccttcca aatacttgac tgcgcca 275121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
5ggaacgagga ccatcgcatc acccaagggt cctgttatcc agatgtatac caatgtagac
60caagacctcg tgggctggcc cgctcctcaa ggtgcccgct cattgacacc ctgcacctgc
120g 1216121DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 6ggaacgagga ccatcgcatc acccaagggt
cctgttatcc agatgtatac caatgtagac 60aaagacctcg tgggctggcc cgctcctcaa
ggtgcccgct cattgacacc ctgcacctgc 120g 121720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7gaaccaacgc atgacccaag 20819DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8ttgaaccaac gcatgaccc
19920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9cagacgaaaa agcaccagaa 201021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10gcaccagaaa atatgagcga c 211120DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 11atccggtact gcagaactca
201220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12gcaaatccgg tactgcagaa 201320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13attggcaaat ccggtactgc 201420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14ggcagacaaa ttgggtggtt
201521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15gccaatgacg aatacaaagt c 211622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16taatagccat catcatgttt gg 221760DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 17ggaacgagga ccatcgcatc
acccaagggt cctgttatcc agatgtatac caatgtagac 601859DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18cgcaggtgca gggtgtcaat gagcgggcac cttgaggagc gggccagccc acgaggtct
591924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19tttgtctaaa gggtcctgtt atcc 242020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20tagacaaaca gcccacgagg 202123DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 21tttgtctagt tatccagatg tat
232223DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22tagacaaacc agcccacgag gtc 232324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23tcttggtcca agggtcctgt tatc 242423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24gaccaagaag ggtgtcaatg agc 23
* * * * *