U.S. patent application number 15/516240 was filed with the patent office on 2017-11-23 for altering gene expression in cart cells and uses thereof.
The applicant listed for this patent is THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA. Invention is credited to Carl H. June, Xiaojun Liu, Jiangtao Ren, Yangbing Zhao.
Application Number | 20170335331 15/516240 |
Document ID | / |
Family ID | 55858177 |
Filed Date | 2017-11-23 |
United States Patent
Application |
20170335331 |
Kind Code |
A1 |
Zhao; Yangbing ; et
al. |
November 23, 2017 |
Altering Gene Expression in CART Cells and Uses Thereof
Abstract
The present invention relates to compositions and methods for
generating a modified T cell with a nucleic acid capable of
downregulating endogenous gene expression selected from the group
consisting of TCR .alpha. chain, TCR .beta. chain, beta-2
microglobulin, a HLA molecule, CTLA-4, PD1, and FAS and further
comprising a nucleic acid encoding a modified T cell receptor (TCR)
comprising affinity for a surface antigen on a target cell or an
electroporated nucleic acid encoding a chimeric antigen receptor
(CAR). Also included are methods and pharmaceutical compositions
comprising the modified T cell for adoptive therapy and treating a
condition, such as an autoimmune disease.
Inventors: |
Zhao; Yangbing; (Lumberton,
NJ) ; Ren; Jiangtao; (Philadelphia, PA) ; Liu;
Xiaojun; (Swarthmore, PA) ; June; Carl H.;
(Merion Station, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA |
Philadelphia |
PA |
US |
|
|
Family ID: |
55858177 |
Appl. No.: |
15/516240 |
Filed: |
October 15, 2015 |
PCT Filed: |
October 15, 2015 |
PCT NO: |
PCT/US15/55799 |
371 Date: |
March 31, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62073651 |
Oct 31, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2501/599 20130101;
A61K 35/26 20130101; C12N 2510/00 20130101; A61K 39/0011 20130101;
A61P 35/00 20180101; A61K 35/17 20130101; C12N 2501/515 20130101;
C12N 2501/48 20130101; A61P 37/06 20180101; C12N 2501/998 20130101;
C12N 2310/20 20170501; A61K 39/001102 20180801; C12N 15/1138
20130101; C12N 15/85 20130101; C12N 2310/10 20130101; A61K
2039/5158 20130101; A61K 2039/5156 20130101 |
International
Class: |
C12N 15/113 20100101
C12N015/113; A61K 35/26 20060101 A61K035/26; A61K 39/00 20060101
A61K039/00; C12N 15/85 20060101 C12N015/85; A61K 35/17 20060101
A61K035/17 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under
CA120409 awarded by the National Institute of Health. The
government has certain rights in the invention.
Claims
1. A modified T cell comprising: a nucleic acid capable of
downregulating gene expression of an endogenous gene selected from
the group consisting of TCR .alpha. chain, TCR .beta. chain, beta-2
microglobulin, a HLA molecule, CTLA-4, PD1, and FAS; and a nucleic
acid encoding a chimeric antigen receptor (CAR) comprising an
antigen binding domain, a transmembrane domain and an intracellular
domain of a co-stimulatory molecule.
2. The modified T cell of claim 1, wherein the nucleic acid capable
of downregulating gene expression is selected from the group
consisting of an antisense RNA, antigomer RNA, siRNA, shRNA, and a
CRISPR system.
3. The modified T cell of claim 2, wherein the CRISPR system
comprises an pAd5/F35-CRISPR vector.
4. The modified T cell of claim 1, wherein the antigen binding
domain of the CAR comprises an antibody selected from the group
consisting of a monoclonal antibody, a polyclonal antibody, a
synthetic antibody, human antibody, humanized antibody, single
domain antibody, single chain variable fragment, and
antigen-binding fragments thereof.
5. The modified T cell of claim 1, wherein the antigen binding
domain of the CAR specifically binds an antigen on a target
cell.
6. The modified T cell of claim 1, wherein the intracellular domain
of the CAR comprises dual signaling domains.
7. The modified T cell of claim 1 further comprising an exogenous
nucleic acid encoding a costimulatory molecule.
8. The modified T cell of claim 7, wherein the co-stimulatory
molecule is selected from the group consisting of CD3, CD27, CD28,
CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L.
9. The modified T cell of claim 8, wherein the CD3 comprises at
least two different CD3 chains.
10. The modified T cell of claim 9, wherein the different CD3
chains are CD3 zeta and CD3 epsilon chains.
11. A method for generating a modified T cell comprising:
introducing a nucleic acid capable of downregulating gene
expression of an endogenous gene selected from the group consisting
of TCR .alpha. chain, TCR .beta. chain, beta-2 microglobulin, a HLA
molecule, CTLA-4, PD1, and FAS into a T cell; and introducing a
nucleic acid encoding a chimeric antigen receptor (CAR) comprising
an antigen binding domain, a transmembrane domain.
12. The method of claim 11, wherein the nucleic acid capable of
downregulating gene expression is selected from the group
consisting of an antisense RNA, antigomer RNA, siRNA, shRNA, and a
CRISPR system.
13. The method of claim 12, wherein the CRISPR system comprises an
pAd5/F35-CRISPR vector.
14. The method of claim 11, wherein the antigen binding domain of
the CAR comprises an antibody selected from the group consisting of
a monoclonal antibody, a polyclonal antibody, a synthetic antibody,
human antibody, humanized antibody, single domain antibody, single
chain variable fragment, and antigen-binding fragments thereof.
15. The method of claim 11, wherein the antigen binding domain of
the CAR specifically binds an antigen on a target cell.
16. The method of claim 11, wherein the intracellular domain of the
CAR comprises dual signaling domains.
17. The method of claim 11, wherein the T cell is obtained from the
group consisting of peripheral blood mononuclear cells, cord blood
cells, a purified population of T cells, and a T cell line.
18. The method of claim 11, wherein the method further comprises
expanding the T cell.
19. The method of claim 18, wherein the step of expanding the T
cell comprises culturing the T cell with a factor selected from the
group consisting of flt3-L, IL-1, IL-3 and c-kit ligand.
20. The method of claim 11 further comprising cryopreserving the T
cell.
21. The method of claim 20 further comprising thawing the
cryopreserved T cell prior to introducing the nucleic acid into the
T cell.
22. The method of claim 11, wherein introducing the nucleic acid is
selected from the group consisting of transducing the expanded T
cells, transfecting the expanded T cells, and electroporating the
expanded T cells.
23. The method of claim 11 further comprising electroporating a RNA
encoding a co-stimulatory molecule into the T cell.
24. The method of claim 23, wherein the co-stimulatory molecule is
selected from the group consisting of CD3, CD27, CD28, CD83, CD86,
CD127, 4-1BB, 4-1BBL, PD1 and PD1L.
25. The method of claim 11 further comprising expressing Klf4,
Oct3/4 and Sox2 in the T cells to induce pluripotency of the T
cell.
26. A method of treating a disease or condition associated with
enhanced immunity in a subject comprising administering an
effective amount of a pharmaceutical composition comprising the
modified T cell of claim 1 to a subject in need thereof.
27. A method of treating a condition in a subject, comprising
administering to the subject a therapeutically effective amount of
a pharmaceutical composition comprising the modified T cell of
claim 1.
28. The method of claim 27, wherein the condition is an autoimmune
disease.
29. The method of claim 28, wherein the autoimmune disease is
selected from the group consisting of Acquired Immunodeficiency
Syndrome (AIDS), alopecia areata, ankylosing spondylitis,
antiphospholipid syndrome, autoimmune Addison's disease, autoimmune
hemolytic anemia, autoimmune hepatitis, autoimmune inner ear
disease (AIED), autoimmune lymphoproliferative syndrome (ALPS),
autoimmune thrombocytopenic purpura (ATP), Behcet's disease,
cardiomyopathy, celiac sprue-dermatitis hepetiformis; chronic
fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory
demyelinating polyneuropathy (CIPD), cicatricial pemphigold, cold
agglutinin disease, crest syndrome, Crohn's disease, Degos'
disease, dermatomyositis-juvenile, discoid lupus, essential mixed
cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease,
Guillain-Barre syndrome, Hashimoto's thyroiditis, idiopathic
pulmonary fibrosis, idiopathic thrombocytopenia purpura (ITP), IgA
nephropathy, insulin-dependent diabetes mellitus, juvenile chronic
arthritis (Still's disease), juvenile rheumatoid arthritis,
Meniere's disease, mixed connective tissue disease, multiple
sclerosis, myasthenia gravis, pernacious anemia, polyarteritis
nodosa, polychondritis, polyglandular syndromes, polymyalgia
rheumatica, polymyositis and dermatomyositis, primary
agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic
arthritis, Raynaud's phenomena, Reiter's syndrome, rheumatic fever,
rheumatoid arthritis, sarcoidosis, scleroderma (progressive
systemic sclerosis (PSS), also known as systemic sclerosis (SS)),
Sjogren's syndrome, stiff-man syndrome, systemic lupus
erythematosus, Takayasu arteritis, temporal arteritis/giant cell
arteritis, ulcerative colitis, uveitis, vitiligo, Wegener's
granulomatosis, and any combination thereof.
30. The method of claim 27, wherein the condition is a cancer.
31. The method of claim 30, wherein the cancer is selected from the
group consisting of breast cancer, prostate cancer, ovarian cancer,
cervical cancer, skin cancer, pancreatic cancer, colorectal cancer,
renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung
cancer, and any combination thereof.
32. A method for stimulating a T cell-mediated immune response to a
target cell or tissue in a subject comprising administering to a
subject an effective amount of a pharmaceutical composition
comprising the modified T cell of claim 1.
33. The method of claim 32 further comprising inducing lysis of the
target cell or tissue.
34. The method of claim 33, wherein the induced lysis is
antibody-dependent cell-mediated cytotoxicity (ADCC).
35. A method for adoptive cell transfer therapy comprising
administering an effective amount of a pharmaceutical composition
comprising the modified T cell of claim 1 to a subject in need
thereof to prevent or treat an immune reaction that is adverse to
the subject.
36. Use of the modified T cell of claim 1 in the manufacture of a
medicament for the treatment of an immune response in a subject in
need thereof.
37. A composition comprising the modified T cell generated
according to the method of claim 11.
38. A pharmaceutical composition comprising the modified T cell
generated according to the method of claim 11 and a
pharmaceutically acceptable carrier.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is entitled to priority under 35
U.S.C. .sctn.119(e) to U.S. Provisional Patent Application No.
62/073,651, filed Oct. 31, 2014, which is hereby incorporated by
reference in its entirety herein.
BACKGROUND OF THE INVENTION
[0003] Adoptive cell transfer (ACT) using chimeric antigen receptor
(CAR) modified T cells has been shown to be a promising strategy
for the treatment of cancers (Louis et al., 2011, Blood
118:6050-6056; Kochenderfer et al., 2010, Blood 116:3875-3886 and
Porter et al., 2011, N Engl J Med 365:725-733).
[0004] Integration associated safety concerns using lentiviral or
retroviral vectors are a major concern for modification of cells
used for ACT. Some advances have been made to avoid on-target or
off-target unwanted side effects, such as RNA transfection of T
cells with T cell receptor (TCR) or CAR RNA electroporation (Zhao,
2006, Mol Ther 13:151-159; Mitchell et al., Smits et al., 2004,
Leukemia 18:1898-1902). By minimizing dosage of both RNA and T
cells, such methods efficiently permit the introduction of multiple
genes into cells. However, the major constraint for transient
expression of CARs is the suboptimal effector activity and
functionality of RNA transfected T cells. Multiple T cell infusions
and/or significant use of low dose chemotherapy have been used to
improve CAR function (Barrett et al., 2013, Hum Gene Ther
24(8):717-27).
[0005] Various attempts have been made to improve effector activity
and functionality of CARs while in order to avoid the need for
combination therapies and additional treatments. Increasing RNA
during the transfection process poses a negative impact on T cell
function, especially in vivo anti-tumor activities (Barrett et al.,
2011, Hum Gene Ther 22:1575-1586). Alternative constructs fusing an
anti-CD3 antigen antibody fragment to an anti-tumor antigen
antibody fragment have also been tested in clinical trials for
cancer treatments (Bargou et al., 2008, Science 321:974-977;
Klinger et al., 2012, Blood 119:6226-6233.). Unfortunately, these
constructs were severely limited in functionality because of a
short half-life, poor accessibility to target cell sites, and a
lack of proper long term signaling function.
[0006] Clinical TCR studies have been hampered by low expression
levels of the transduced TCR, as well as mispairing of .alpha. and
.beta. chains. Because four TCRs can potentially be expressed at
the cell surface when a T cell transcribes the chains of two
different TCRs (native alpha/beta, exogenous alpha/beta, and
native/exogenous "mispaired" heterodimers), significant obstacles
to the use of this approach are evident. In studies performed to
date, preclinical studies have clearly demonstrated that TCR
miss-pairings have the potential to induce harmful recognition of
self-antigens.
[0007] Although early TCR and CAR T cell clinical data obtained in
treating cancers has shown promising results, the risk to the
patient is high, and some patients' T cells are not potent enough
for effective treatment even after TCR or CAR redirection, forcing
modification of allogeneic donor-derived T cells. However, the
endogenous .alpha..beta. T-cell receptor on infused allogeneic T
cells may recognize major and minor histocompatibility antigens in
the recipient, leading to graft-versus-host-disease (GVHD). As a
result, the majority of current clinical trials using infusion of
autologous CAR T cells rely on immune tolerance to prevent
TCR-mediated deleterious recognition of normal tissues after
adoptive cell transfer. This approach has achieved early clinical
successes but is limited by the time and expense to manufacture
patient-specific T-cell products. Therefore a need exists for safer
methods of modifying T cells, while circumventing the time and
expense to manufacture patient-specific T-cell products.
SUMMARY OF THE INVENTION
[0008] As described herein, the present invention relates to
compositions and methods for generating a modified T cell with a
nucleic acid capable of altering gene expression of an endogenous
gene selected from the group consisting of TCR .alpha. chain, TCR
.beta. chain, beta-2 microglobulin, a HLA molecule, CTLA-4, PD1,
and FAS and further comprising a nucleic acid encoding a chimeric
antigen receptor (CAR).
[0009] One aspect of the invention includes a modified T cell
comprising a nucleic acid capable of downregulating gene expression
of an endogenous gene selected from the group consisting of TCR
.alpha. chain, TCR .beta. chain, beta-2 microglobulin, a HLA
molecule, CTLA-4, PD1, and FAS; and a nucleic acid encoding a
chimeric antigen receptor (CAR) comprising an antigen binding
domain, a transmembrane domain and an intracellular domain of a
co-stimulatory molecule.
[0010] In another aspect, the invention includes a method for
generating a modified T cell comprising introducing a nucleic acid
capable of downregulating gene expression of an endogenous gene
selected from the group consisting of TCR .alpha. chain, TCR.beta.
chain, beta-2 microglobulin, a HLA molecule, CTLA-4, PD1, and FAS
into a T cell; and introducing a nucleic acid encoding a chimeric
antigen receptor (CAR) comprising an antigen binding domain, a
transmembrane domain.
[0011] In yet another aspect, the invention includes a method of
treating a disease or condition associated with enhanced immunity
in a subject comprising administering an effective amount of a
pharmaceutical composition comprising the modified T cell described
herein to a subject in need thereof.
[0012] In still another aspect, the invention includes a method of
treating a condition in a subject, comprising administering to the
subject a therapeutically effective amount of a pharmaceutical
composition comprising the modified T cell described herein.
[0013] In another aspect, the invention includes a method for
stimulating a T cell-mediated immune response to a target cell or
tissue in a subject comprising administering to a subject an
effective amount of a pharmaceutical composition comprising the
modified T cell described herein.
[0014] In yet another aspect, the invention includes a method for
adoptive cell transfer therapy comprising administering an
effective amount of a pharmaceutical composition comprising the
modified T cell described herein to a subject in need thereof to
prevent or treat an immune reaction that is adverse to the
subject.
[0015] In still another aspect, the invention includes use of the
modified T cell described herein in the manufacture of a medicament
for the treatment of an immune response in a subject in need
thereof.
[0016] In another aspect, the invention includes a composition
comprising the modified T cell generated according to the method
described herein.
[0017] In yet another aspect, the invention includes a
pharmaceutical composition comprising the modified T cell generated
according to the method described herein.
[0018] In various embodiments of the above aspects or any other
aspect of the invention delineated herein, the nucleic acid capable
of downregulating gene expression is selected from the group
consisting of an antisense RNA, antigomer RNA, siRNA, shRNA, and a
CRISPR system, such as an pAd5/F35-CRISPR vector.
[0019] In one embodiment, the the antigen binding domain of the CAR
comprises an antibody selected from the group consisting of a
monoclonal antibody, a polyclonal antibody, a synthetic antibody,
human antibody, humanized antibody, single domain antibody, single
chain variable fragment, and antigen-binding fragments thereof. In
another embodiment, the antigen binding domain of the CAR
specifically binds an antigen on a target cell. In yet another
embodiment, the intracellular domain of the CAR comprises dual
signaling domains.
[0020] In another embodiment, modified T cell described herein
further comprises an exogenous nucleic acid encoding a
costimulatory molecule, such as CD3, CD27, CD28, CD83, CD86, CD127,
4-1BB, 4-1BBL, PD1 and PD1L. In one embodiment, the method of
generating the modified T cell described herein further comprises
electroporating a RNA encoding a co-stimulatory molecule into the T
cell. In some embodiments where the costimulatory molecule is CD3,
the CD3 comprises at least two different CD3 chains, such as CD3
zeta and CD3 epsilon chains.
[0021] In another embodiment, the T cell is obtained from the group
consisting of peripheral blood mononuclear cells, cord blood cells,
a purified population of T cells, and a T cell line.
[0022] In yet another embodiment, the method of generating the
modified T cell as described herein further comprises expanding the
T cell. In one embodiment, expanding the T cell comprises culturing
the T cell with a factor selected from the group consisting of
flt3-L, IL-1, IL-3 and c-kit ligand.
[0023] In still another embodiment, the method of generating the
modified T cell as described herein further comprising
cryopreserving the T cell. In another embodiment, the method
described herein further comprises thawing the cryopreserved T cell
prior to introducing the nucleic acid into the T cell.
[0024] In one embodiment, introducing the nucleic acid is selected
from the group consisting of transducing the expanded T cells,
transfecting the expanded T cells, and electroporating the expanded
T cells.
[0025] In yet another embodiment, the method described herein
further comprises expressing Klf4, Oct3/4 and Sox2 in the T cells
to induce pluripotency of the T cell.
[0026] In various embodiments of the above aspects or any other
aspect of the invention delineated herein, the invention includes
administering the modified T cell to a subject. In one embodiment,
the subject has a condition, such as an autoimmune disease. In some
embodiments, the autoimmune disease is selected from the group
consisting of Acquired Immunodeficiency Syndrome (AIDS), alopecia
areata, ankylosing spondylitis, antiphospholipid syndrome,
autoimmune Addison's disease, autoimmune hemolytic anemia,
autoimmune hepatitis, autoimmune inner ear disease (AIED),
autoimmune lymphoproliferative syndrome (ALPS), autoimmune
thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy,
celiac sprue-dermatitis hepetiformis; chronic fatigue immune
dysfunction syndrome (CFIDS), chronic inflammatory demyelinating
polyneuropathy (CIPD), cicatricial pemphigold, cold agglutinin
disease, crest syndrome, Crohn's disease, Degos' disease,
dermatomyositis-juvenile, discoid lupus, essential mixed
cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease,
Guillain-Barre syndrome, Hashimoto's thyroiditis, idiopathic
pulmonary fibrosis, idiopathic thrombocytopenia purpura (ITP), IgA
nephropathy, insulin-dependent diabetes mellitus, juvenile chronic
arthritis (Still's disease), juvenile rheumatoid arthritis,
Meniere's disease, mixed connective tissue disease, multiple
sclerosis, myasthenia gravis, pernacious anemia, polyarteritis
nodosa, polychondritis, polyglandular syndromes, polymyalgia
rheumatica, polymyositis and dermatomyositis, primary
agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic
arthritis, Raynaud's phenomena, Reiter's syndrome, rheumatic fever,
rheumatoid arthritis, sarcoidosis, scleroderma (progressive
systemic sclerosis (PSS), also known as systemic sclerosis (SS)),
Sjogren's syndrome, stiff-man syndrome, systemic lupus
erythematosus, Takayasu arteritis, temporal arteritis/giant cell
arteritis, ulcerative colitis, uveitis, vitiligo, Wegener's
granulomatosis, and any combination thereof.
[0027] In another embodiment, the condition is a cancer, such as a
cancer selected from the group consisting of breast cancer,
prostate cancer, ovarian cancer, cervical cancer, skin cancer,
pancreatic cancer, colorectal cancer, renal cancer, liver cancer,
brain cancer, lymphoma, leukemia, lung cancer, and any combination
thereof.
[0028] In another embodiment, the method described herein further
comprises inducing lysis, such as antibody-dependent cell-mediated
cytotoxicity (ADCC), of the target cell or tissue.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] The following detailed description of preferred embodiments
of the invention will be better understood when read in conjunction
with the appended drawings. For the purpose of illustrating the
invention, there are shown in the drawings embodiments which are
presently preferred. It should be understood, however, that the
invention is not limited to the precise arrangements and
instrumentalities of the embodiments shown in the drawings.
[0030] FIG. 1, comprising FIGS. 1A-1C, is an illustration of the
CRISPR design and targeting of the TCR .alpha..beta.-CD3 complex in
293T cells. FIG. 1A shows the CRISPR gRNA targeting sites within
the genomic locus of TCR-.alpha. and .beta. constant region. Each
exon is shown by a block. Black blocks represent coding regions.
Grey columns represent non-coding regions. Thirteen gRNAs were
designed to target exon 1 of the TCR .alpha. constant region
(TRAC), 10 gRNAs target a conserved sequence on exon 1 of the TCR
.beta. constant regions 1 (TRBC1) and 2 (TRBC2), and 10 gRNAs
target exon1 of the beta-2 microglobin gene. FIG. 1B shows a
typical gRNA scaffold sequence. gRNA PCR products were generated by
overlap PCR and cloned into MSGV vector with a T7 promoter. FIG. 1C
shows Sanger sequencing results showing that multiple peaks exist
in 293T TCR TRAC and TRBC genomic PCR products after transfection
of CAS9 mRNA and gRNAs into the cells.
[0031] FIG. 2, comprising FIGS. 2A-2E, shows the disruption of the
TCR .alpha..beta.-CD3 complex in primary T cells. FIG. 2A is a
table showing the parameters used for electroporating CAS9 mRNA and
gRNA into primary T cells with BTX830. 360V 1 ms with 2 mm cuvettes
yielded the best mean fluorescent intensity (MFI) and efficiency
for electroporating day 3 beads stimulated primary T cells. FIG. 2B
is a panel of graphs showing T cells incubated at 32.degree. C. 5%
CO.sub.2 having a much higher MFI than normal 37.degree. C. 5%
CO.sub.2 condition. FIG. 2C is a schematic illustration of the
CRISPR system transferred into primary T cells. CAS9 mRNA and gRNA
were electro-transferred into T cells three days after bead
stimulation of primary T cells. T cells were then cultured with 100
IU/mL of IL-2 and some cells were incubated at 32.degree. C. 5%
CO.sub.2 for 1 day and then for another 7 to 9 days. CD3 expression
was analyzed on days 7-9 after electroporation by flow cytometry.
FIG. 2D is a panel of graphs showing that the targeting efficiency
at 37.degree. C. was about 2.5 times higher than at 32.degree. C.
FIG. 2E is a panel of graphs showing down regulation of CD3 on day
6 after electro-transfer of varying amounts and ratios of CAS9 and
gRNA targeting TCR.beta.. CD3 expression was analyzed by staining
for CD3. The representative flow data at day 6 after
electroporation is shown. Quadrant represent the percentage of CD3
negative cells in T-cell populations.
[0032] FIG. 3, comprising FIGS. 3A-3D, shows that TCR.sup.neg alpha
or beta knock out in T cells can be enriched by depletion of
TCR.sup.pos T cells. FIG. 3A is a panel of graphs showing CD3
expression before and after micro-bead depletion of TCR.sup.neg
alpha or beta knock out in T cells. Flow cytometry illustrates
expression of CD3. Numbers in the lower right quadrant represent
the percentage of CD3 negative cells in T-cell populations. FIG. 3B
is a panel of sequencing graphs showing that multiple peaks were
observed in CD3.sup.neg enriched T cell genomic PCR products. FIG.
3C is a panel of graphs showing the CD4 and CD8 T cell repertoire
analysis after CD3 micro-bead enrichment in single alpha chain,
beta chain, and alpha beta double knock out T cells modified with
CRISPR. Data shows the ratio of CD8 T cell population was enriched
by CRISPR modification, suggesting CD8 T cell may be more easily
modified than CD4 T cells. FIG. 3D shows sequencing results of
deletions and insertions introduced to the TCR alpha and beta locus
after CRISPR modification.
[0033] FIG. 4, comprising FIGS. 4A-4C, shows that multiple
electro-transfers of gRNA greatly improved the targeting efficiency
of CRISPR system in primary T cells. FIG. 4-A is a panel of graphs
showing that multiple electroporations of gRNAs greatly improved
the targeting efficiency. Electroporating T cells up to three times
within 24 hours gave the highest targeting efficiency, nearly 80%.
In the initial experiment, only a 15% percent of TCR targeting
efficiency was achieved in T cells. Sustained expression of CAS9
was observed after electro-transfer of CAS9 mRNA into the T cells.
A likely reason for low cleavage efficiency may be due to rapid
degradation of gRNAs. A higher CD3 negative population was
obtained. FIG. 4B is a panel of graphs showing that capping impairs
the function of gRNA, while early introduction of gRNAs in a second
round yielded higher efficiencies. FIG. 4C is a panel of graphs
showing that multiple electro-transfers of gRNA targeting TRAC and
TRBC in ND221 gave a cleavage rate of approximately 64.5% and
57.5%, respectively.
[0034] FIG. 5, comprising FIGS. 5A and 5B, shows TCR.sup.neg T
cells could be expanded under different stimulating conditions.
FIG. 5A is a panel of graphs showing that TCR.sup.neg T cells
restored CD3 expression after re-introduction of TCR alpha and beta
chains into TCR.sup.neg cells. CD3 and Vb13.1 were detected after
electroporating TCR alpha and beta chain into TCR.sup.neg T cells.
CD3 expression level was comparable to TCR.sup.pos T cells. FIG. 5B
is a panel of graphs showing fold of expansion after different
conditions used to stimulate TCR.sup.neg T cells. PBMC REP yielded
approximately 500 fold expansion, while CD3/CD28 beads, or K562
aAPC re-stimulation yielded about 25-58 fold expansion.
[0035] FIG. 6, comprising FIGS. 6A and 6B, shows TCR.sup.neg T cell
characteristics after expansion under different conditions. FIG. 6A
is a panel of graphs showing TCR.sup.neg T cell phenotype
characteristics after expansion under different conditions. FIG. 6B
is a panel of graphs showing TCR.sup.neg T cell phenotype
characteristics after expansion under different conditions.
[0036] FIG. 7, comprising FIGS. 7A-7C, shows expanded TCR.sup.neg T
cells with potent anti-tumor activity after re-direction in vitro.
FIG. 7A is a panel of graphs showing that TCR.sup.neg T cells could
be re-directed by introduction of an anti NY-ESO 1G4 TCR in the
cells. Compared with CAS9 MOCK group, when re-directed by 1G4 TCR,
TCR.sup.neg T cells showed a higher level of Vb13.1 expression due
to less miss-pairing of exo and endogenous TCR alpha and beta
chains. FIG. 7B is a panel of graphs showing that TCR.sup.neg T
cells re-directed with 1G4 TCR had high de-granulation activity
when cocultured with a tumor (Nalm6-ESO) cell line. FIG. 7C is a
graph showing that TCR.sup.neg T cells re-directed with 1G4 TCR had
high cytotoxicity against a tumor cell line.
[0037] FIG. 8 is a panel of illustrations showing that directed
TCR.sup.neg T cells control the growth of tumor in NSG mice after
re-direction.
[0038] FIG. 9, comprising FIG. 9A-9D, shows that HLA-CLASS I
elimination was obtained by disruption of beta-2 microglobin. FIG.
9A shows sequencing data of CRISPRs able to disrupt the beta-2
microglobin locus in HEK293 cells. FIG. 9B is a panel of graphs
showing that bHLA-CLASS I negative T cell population was generated
by disruption of beta-2 microglobin. FIG. 9C is a panel of graphs
showing that cIFNg improved the targeting efficiency of beta-2
microglobin in primary T cells. FIG. 9D is a panel of graphs
showing that HLA-CLASS I.sup.neg T cells were enriched by microbead
depletion.
[0039] FIG. 10 is a panel of graphs showing simultaneous knock out
of HI-LA-CLASS I and TCR in primary T cells. CD4 and CD8 T cells
were stimulated with CD3/CD28 dynabeads. Three days after
stimulation, expanded T cells were electroporated with CAS9 mRNA
together with TCR .beta. constant region (TRBC) and beta-2
microglobin targeting gRNAs. Both TCR expression and beta-2
microglobin expression were evaluated using anti-CD3 monoclonal
antibody (mAb) and anti-beta-2 microglobin mAb six days after
electroporation. Numbers represent the percentage of population in
each quadrant.
[0040] FIG. 11, comprising FIGS. 11A-11D, shows triple knock out of
HLA-CLASS I and TCR alpha and beta chain in primary T cells. FIG.
11A is a panel of graphs showing that CD4 and CD8 T cells were
stimulated with CD3/CD28 dynabeads. Three days after stimulation,
expanded T cells were electroporated with CAS9 mRNA, together with
TCR alpha, beta constant region (TRAC, TRBC) and beta-2 microglobin
targeting gRNAs. Both TCR expression and HLA-CLASS I expression
were evaluated using anti-CD3 monoclonal antibody (mAb) and
anti-beta-2 microglobin mAb six days after electroporation. Numbers
represent the percentage of population in each quadrant. FIG. 11B
is a schematic illustrating isolation of HLA-CLASS I and TCR alpha
and beta chain triple knock out T cells. FIG. 11C is a panel of
graphs showing electroporation efficiency tested by GFP expression.
FIG. 11D is a panel of graphs showing re-introduction of TCR alpha
and beta chains into TCR.sup.neg T cells measured by flow
cytometry. About 64% of alpha negative and about 14% beta negative
population was observed in total TCR.sup.neg T cells.
[0041] FIG. 12, comprising FIGS. 12A-12D, shows knock out of FAS in
293T cells. FIG. 12A is an image showing Sanger sequencing results
of multiple peaks when FAS was knocked out in 293T cells. FIG. 12B
is a panel of graphs showing FACS data revealing surface expression
of FAS protein was disrupted by CRISPRs. FIG. 12C is a panel of
images showing FAS protein was replaced by GFP after homologous
recombination with CRISPRs. FIG. 12D is a panel of graphs of FACS
data showing the percentage of homologous recombinations with
CRISPRs.
[0042] FIG. 13 shows knock out of FAS in primary T cells. FACS data
illustrated that surface FAS protein expression was abolished by
CRISPRs.
[0043] FIG. 14, comprising FIGS. 14A and 14B, shows knock out of
PD1 in 293T and primary T cells. FIG. 14A is an image showing
Sanger sequencing results of multiple peaks when PD1 were targeted
in 293T cells. FIG. 14B is a panel of graphs showing FACS data of
surface expression of PD1 protein disrupted by CRISPRs.
[0044] FIG. 15, comprising FIGS. 15A and 15B, shows knock out of
CTLA4 in 293T and primary cells, such as CCD1079-SK. FIG. 15A is an
image showing Sanger sequencing results of multiple peaks when
CTLA4 were targeted in 293T cells. FIG. 15B is an image showing
sequence data after limiting dilution and single cell expansion.
Sanger sequencing results identified the deletions and insertions
at the CTLA4 genomic locus.
[0045] FIG. 16 shows knock out of PPP2r2d in 293T. Sanger
sequencing data indicated PPP2r2d was targeted in 293T cells by
CRISPRs.
[0046] FIG. 17, comprising FIGS. 17A and 17B, shows generation of
iPSCs from FAS knock out T cells. FIG. 17A is a panel of images
showing morphological change during the process of reprogramming
FAS.sup.neg T cells to iPSCs. Typical embryonic stem cell
morphology formation indicating FAS.sup.neg T cells can be induced
to pluripotent state. FIG. 17B is a graph showing that FAS.sup.neg
T cells were reprogrammed to iPSCs at an efficiency of about 5
times of the wild type counterparts. p53 deficient cell lines have
been reported as easier to reprogram due to the hinderance of the
apoptosis pathway. FAS knock out may facilitate the reprogramming
process by a similar mechanism.
[0047] FIG. 18, comprising FIGS. 18A and 18B, show the generation
of iPSCs from CD3.sup.neg T cells. FIG. 18A is a panel of images
showing ES-like morphology formed by CD3.sup.neg TCR alpha or beta
chain knock out T cells under defined reprogramming conditions. The
morphology remains constant after several passages. FIG. 18B is a
series of graphs showing that reprogramming CD3.sup.neg T cells was
about 5 time more efficient than the wild type counterparts,
suggesting that TCR knock-out may play a role in the process of T
cell reprogramming or affect the cell viability after Sendai virus
infection.
[0048] FIG. 19 is a graph showing knockdown of endogenous T cell
receptors (TCRs) with siRNA and adding a second disulfide bond and
de-N-glycosylation to the beta chain.
[0049] FIG. 20, comprising FIGS. 20A and 20B, shows TCR knockout by
CAS9 RNA and gRNA. Six days after electroporation, cells were
analyzed for TCR expression by assessing CD3.
[0050] FIG. 21 is an illustration showing PCR sequencing results
after CD3 micro-bead depletion.
[0051] FIG. 22 is a panel of graphs showing re-expression of CD3
four hours after NY-ESO-1 TCR RNA electroporation.
[0052] FIG. 23, comprising FIGS. 23A-23D, is a panel of graphs
showing that knocking down endogenous TCR enhanced both transgene
expression and function of TCR RNA electroporated T cells. FIG. 23A
shows TCR expression of T cells electroporated with TCR siRNA
(solid open histogram), control siRNA (dotted open histogram) and T
cells without any siRNA (filled histogram). FIG. 23B shows
transgene (TCR vb13.1) expression of wild type NY-ESO-1 TCR (wt) or
modified TCR (SD) RNA electroporated T cells with TCR siRNA,
control siRNA, or no siRNA. FIG. 23C shows NY-ESO-1 tetramer
staining of wild type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA
electroporated T cells with TCR siRNA, control siRNA, or no siRNA.
FIG. 23D shows specific lysis of a HLA-A2/NY-ESO-1 positive tumor
line by TCR siRNA knockdown, wildtype NY-ESO-1 TCR RNA
electroporated T cells.
[0053] FIG. 24 is a graph showing fluorescence of tumor cells after
injection of T cells into a mouse model. Ten million
Nalm6-CBG-ESO-GFP (click beetle green) tumor cells that expressed
both NY-ESO-1 and GFP were intravenously injected into NOD/SCID
mice. Five days after tumor inoculation, CBR transduced and RNA
electroporated T cells were injected as indicated in the different
groups and tumor cells were detected by fluorescence.
[0054] FIG. 25 is a panel of images showing fluorescence of
injected tumor and hybrid TCR T cells in mouse models over
time.
[0055] FIG. 26 is a panel of images showing the generation of
universal CAR19 T cells. The top of the figure is an illustration
of the protocol to generate the universal CAR19 T cells. The graph
on the left shows the percentage of CAR19 positive T cells after
lentiviral-CAR19 gene transduction. The right panel of graphs shows
the percentage of TCR single negative and TCR/HLA-A double negative
T cells before and after sorting.
[0056] FIG. 27 is a panel of graphs and a table showing fold
expansion of CD19 positive cells after stimulation with irradiated
CD19 presenting K562 cells.
[0057] FIG. 28A is a panel of graphs showing the endogenous and
transgenic gene expression of K562-CD19 expanded cells.
[0058] FIG. 28B is a panel of graphs showing that endogenous TCR
expression remained negative in TCR single negative cells, while
TCR and HLA-A expression remained negative in TCR/HLA-A double
negative T cells after K562-CD19 stimulated expansion
[0059] FIG. 29A is a panel of graphs showing that the majority of
expanded universal CAR19 T cells are CD45RO positive and expressed
medium levels of CD28 expression.
[0060] FIG. 29B is a panel of graphs showing that the majority of
expanded universal CAR19 T cells retained high levels of CD62L
expression and low levels of CCR7 expression.
[0061] FIG. 30A is a graph showing that CRISPR gene editing did not
affect the anti-tumor activity of universal CAR19 T cells in
vitro.
[0062] FIG. 30B is a panel of graphs showing that the TCR single
and TCR/HLA-A double negative CAR19 T cells showed robust lytic
capacity when challenged with Nalm6 tumor cells.
[0063] FIG. 30C is a panel of graphs showing cytokine secretion as
part of the potent anti-tumor activity of these cells.
[0064] FIG. 30D is a panel of graphs showing TCR single ablation or
TCR and HLA-A double ablation in CAR19 T cells that exhibited
similar proliferation kinetics after challenge with Nalm6 tumor
cells.
[0065] FIG. 31 is a panel of images showing that CRISPR gene
editing did not affect the anti-tumor activity of universal CAR19 T
cells in vivo. All the mice receiving unmanipulated T cells and
mice infused with lentiviral GFP transduced wild type T cells died
within 3 weeks after tumor cell infusion. Objective tumor
regression was observed for mice receiving CAR19 T cells. CRISPR
edited TCR single or TCR/HLA-A double negative universal CAR19 T
cells showed the same anti-tumor activity.
[0066] FIG. 32A is a panel of graphs showing TCR single or TCR and
HLA-A double ablation in T cells sharply reduced
alloreactivity.
[0067] FIG. 32B is a panel of graphs showing elimination of HLA-A
molecule activated NK cells with a long period of co-culture (5
days).
[0068] FIG. 32C is a graph showing that no off-target activity was
observed when the cells were challenged by allogeneic whole blood
PBMC for 24 hours in an IFNr Eispot assay.
[0069] FIG. 33 is a panel of graphs showing that FAS ablation
enhanced the anti-tumor activity of CAR19 T cells. FAS negative
CAR19 T cells were generated. FAS ablation was confirmed by flow
cytometry analysis. CAR19 gene expression of FASneg T cells was
comparable to the wild type. Even after incubation with Nalm6 tumor
cells for a short period of 4 hours, CD107a expression was greatly
enhanced in FASneg CAR19 T cells compared the wild type
counterpart.
[0070] FIG. 34A is a graph showing that FAS ablation in CAR19 T
cells enhanced CART cell survival and proliferation under in vitro
antigenic conditions. FASneg CAR19 T cells expanded taster than
wild type CAR19 T cells when the cells were stimulated with high
levels of CD19+K562 cells.
[0071] FIG. 34B is a panel of graphs showing FASneg CAR19 T cells
had reduced apoptosis levels as measured by Annexin V staining.
[0072] FIG. 35A is a graph showing that FAS ablation in CAR19 T
cells enhanced CART cell function in an animal model. As had been
observed in vitro, FASneg T cells showed enhanced proliferation as
compared to the wild type T cells.
[0073] FIG. 35B is a panel of images showing FASneg CAR19 group
demonstrated superior anti-tumor activity when compared to wild
type group.
[0074] FIG. 35C is a graph showing significant differences in
bioluminescence data between FASneg CAR19 group and wild type
group.
[0075] FIG. 36 is a panel of graphs showing the generation of PD1
negative PSCA-CAR T cells. PD1 ablation was confirmed by flow
cytometric analysis. PD1 negative cells were enriched by microbead
depletion. Wild type or PD1 negative PSCA-CAR T cells were expanded
by stimulation with irradiated PSCA antigen presenting PC3 tumor
cells. PSCA-CAR positive cells were enriched after expansion.
[0076] FIG. 37 is a panel of graphs showing that PD1 ablation and
CD137 expression in PSCA-CAR T cells enhanced CART cell activation
under in vitro antigenic conditions.
[0077] FIG. 38A is a panel of images showing PD1 ablation in an in
vivo PC3-PSCA-PDL1 NSG model. The PSCA-CAR T cells demonstrated
enhanced CART cell in vivo anti-tumor activity as compared to wild
type group.
[0078] FIG. 38B is a graph showing the difference in tumor burden
between the PD1 negative and the wild type group.
[0079] FIG. 39 is a panel of histological images showing that T
cells with TCR or TCR/HLA-I ablated did not cause graft versus host
disease (GVHD). The mice treated with the double or triple knock
out CART cells did not develop any signs of GVHD. By contrast, 3
out of 4 mice from the wild-type CD19 CART group developed GVHD by
day 65, which was confirmed by histological examination of
different organs.
[0080] FIG. 40A is a graph showing the percent survival of animals
injected with T cells with TCR or TCR/HLA-I ablated. Mice were
sub-lethally irradiated and injected. Four out 5 mice receiving
wild type T cells died of GVHD during the 60 day study. PBS
treated, TCR single and TCR/HLA-I double ablated T cell treated
groups did not show any signs of GVHD.
[0081] FIG. 40B is a panel of graphs showing the body weight of
mice receiving wild type T cells, PBS treated, TCR single or
TCR/HLA-I double-ablated T cells.
[0082] FIG. 41A is a panel of images showing improved anti-tumor
activity of universal CART cells after blocking PD1 and Fas
pathways with CRISPR/Cas9. Superior anti-tumor activity was
detected in PD1 knock out universal CD19-CART cells when injected
into Nalm6-PDL1 bearing mice.
[0083] FIG. 41B is a graph showing quantitative bioluminescence
data of mice receiving different CRISPR/Cas9 edited T cells.
[0084] FIG. 42 is a panel of illustrations showing a one-shot
system to generate universal CART cells. As gRNAs are prone to
degrade, a simplified one-shot method was developed to
constitutively express gRNAs together with CAR in a single
lentiviral vector.
[0085] FIG. 43 is a panel of graphs showing efficient gene ablation
with the one-shot system. Different amounts of CD3 ablation were
observed after electro-transfer of Cas9 n RNA.
[0086] FIG. 44A is a panel of images showing the morphological
changes during the process of reprogramming of iPSCs from Fas knock
out T cells. Typical embryonic stem cell morphology formation
indicating FASneg T cells can be induced to pluripotent state.
[0087] FIG. 44B is a graph showing FASneg T cells reprogrammed to
iPSCs at an efficiency of about 5 times of the wild type
counterparts. p53 deficient cell lines have been reported as easier
to reprogram due to the hindrance of the apoptosis pathway. FAS
knock out may facilitate the reprogramming process using a similar
mechanism.
[0088] FIG. 45A is a panel of images showing the ES-like morphology
of iPSCs from CD3neg TCR alpha or beta chain knock out T cells
under defined reprogramming conditions. The morphology remained
constant after several passages.
[0089] FIG. 45B is a graph showing that reprogramming of CD3neg T
cells was about 5 times less efficient than the wild type
counterparts, suggesting that TCR knock-out may play a role in the
process of T cell reprogramming or affect the cell viability after
Sendai virus infection.
[0090] FIG. 45C is a panel of images showing phosphatase staining
of CD3neg iPSC cells.
[0091] FIG. 46 is a panel of graphs showing induction of endogenous
pluripotent stem cell genes in different T-iPSC cell lines.
[0092] FIG. 47A is a panel of images showing immunostaining for
Tra-1-60 and SSEA4 expression.
[0093] FIG. 47B is an image showing the confirmation of Fas knock
out of T-iPSC by Sanger sequencing.
[0094] FIG. 48A is a panel of graphs showing gene ablation in naive
T cells with a different version of Cas9. CD3 was knocked out with
dCas9 and FokI-Cas9.
[0095] FIG. 48B is a panel of graphs showing that two gRNAs were
needed for gene ablation of dCas9 and FokI-Cas9.
[0096] FIG. 48C is in image showing rare off-target events in gene
modified T cells with CRISPR/cas9.
[0097] FIG. 49 is a panel of images showing the strategy of
introducing CRISPR/Cas9 into T cells. Schematic representation of
gRNAs driven by the T7 promoter is shown on the left. Schematic
representation of the generation of gene-edited antigen-specific T
cells using the CRISPR system is shown on the right. T cells were
electroporated with Cas9 mRNA and gRNAs targeting a specific gene 3
days after CD3/CD28 bead stimulation and then cultured for 24 hours
at 32.degree. C. in the presence of IL2 before being returned to
the normal 37.degree. C. culture condition. Specific gene-disrupted
T cells were sorted on day 8 and redirected with CAR or TCR by
lentiviral transduction or mRNA electroporation gene transfer.
[0098] FIG. 50A is a panel of graphs showing CRISPR/Cas9 mediated
efficient TCR disruption in T cells. CD3 expression of CRISPR/Cas9
edited T cells cultured at 37.degree. C. or 32.degree. C.
[0099] FIG. 50B is a panel of graphs showing CD3 expression of
CRISPR/Cas9 edited T cells cultured after sequential CRISPR RNA
electroporation.
[0100] FIG. 51A is a panel of graphs showing the efficient CRISPR
gene disruption that occurred in T cells. CD3 expression of T cells
transferred with CRISPR using different Cas9:gRNA ratios (upper and
middle panel) and amount of total CRISPR RNA (lower panel).
[0101] FIG. 51B is a table showing the targeting efficiency
calculated by both flow cytometry and clonal sequencing.
[0102] FIG. 52 is an image showing the amount of TCR-targeted gene
disruption measured by a mismatch-selective T7 surveyor nuclease
assay on DNA amplified from the cells. The calculated amount of
targeted gene disruption in TRAC and TRBC is shown at the bottom.
Arrows indicate expected bands.
[0103] FIG. 53A is an image of indels (in gene disruption) observed
by clonal sequence analysis of PCR amplicons after CRISPR-mediated
recombination of the TCR .alpha. and .beta. locus.
[0104] FIG. 53B is an image of a diagram of the human locus
encoding the TCR .alpha. and .beta. CRISPR gRNA targeting sites
within the genomic locus of the TCR .alpha. and .beta. constant
region. Each exon is shown by a block. Arrow: sense strand gRNA
targeting site; blue arrow: anti-sense strand gRNA targeting site.
Multiple peaks in the Sanger sequencing results show the
CRISPR-mediated events of NHEJ at the TRAC and TRBC genomic
loci.
[0105] FIG. 54 is a panel of graphs showing CD3 expression in
purified TCR.sup.neg cells.
[0106] FIG. 55 is a panel of graphs showing redirection of TCR
CD3.sup.neg cells via the electrotransfer of 1G4 TCR (.alpha. and
.beta.) or CAR19 mRNA.
[0107] FIG. 56 is a graph showing TCR/CD3.sup.neg cell expansion
after 10 days using different stimulation conditions.
[0108] FIG. 57 is a panel of graphs showing that CRISPR/Cas9
editing did not impair antitumor efficacy of primary T cells. The
phenotypes of TCR/CD3.sup.neg cells after the four different
expansion techniques are shown.
[0109] FIG. 58 is a panel of graphs showing the relative CD19-CAR
expression after electrotransfer of CD19-CAR RNA into Cas9 MOCK and
TCR/CD3.sup.neg cells.
[0110] FIG. 59A is a panel of graphs showing that no significant
functional difference was observed between CD19-CA R redirected
Cas9 MOCK and TCR/CD3.sup.neg cells as confirmed by CD107 release
assay after incubation with Nalm6 target cells. Representative data
from 3 independent experiments are shown. Bars, standard error.
[0111] FIG. 59B is a graph showing that no significant functional
difference was observed between CD19-CAR redirected Cas9 MOCK and
TCR/CD3.sup.neg cells as confirmed by cytotoxicity assay after
incubation with Nalm6 target cells. Representative data from 3
independent experiments are shown. Bars, SE=standard error.
[0112] FIG. 59C is a panel of graphs showing that no significant
functional difference was observed between CD19-CAR redirected Cas9
MOCK and TCR/CD3.sup.neg cells as confirmed by IL2 and IFN.gamma.
secretion after incubation with the Nalm6 target cells.
Representative data from 3 independent experiments are shown. Bars,
SE=standard error.
[0113] FIG. 59D is a panel of images of NOD/scid/.gamma.c(-/-) mice
(n=12) injected with 1.times.10.sup.6 Nalm6 tumor cells (i.v.) the
mice were randomly sorted into three groups. Cas9 MOCK and
TCR/CD3.sup.neg T cells (10.times.10.sup.6) expressing the CD19-CAR
after electroporation were injected i.v. every 4 days for a total
of three injections (arrows). Mice treated with T cells
electroporated with no RNA served as controls. Images were obtained
from the surviving animals as indicated. Imaging commenced 1 day
before the start of T cell treatment. Bars, SE=standard error,
EP=electroporation; E:T=effector to tumor ratio; arrow, time point
of T cell infusion; ns, not significant. ****P<0.0001, ns by
two-way ANOVA plus the Bonferroni post test.
[0114] FIG. 59E is a graph showing the radiance of the fluorescent
cells.
[0115] FIG. 60 is a panel of graphs showing double and triple gene
ablation by CRISPR/Cas9 to generate universal effector cells. HLA-I
disruption with gRNA targeting B2M.
[0116] FIG. 61 is a flow chart of the protocol to generate
universal effector cells as described herein.
[0117] FIG. 62 is a panel of graphs showing that TCR ablation
abrogated non-specific killing activity. 624mel-CBG and PC3-CBG
tumor cell lines were incubated with T cells pre-treated with or
without PHA at an effector to target ratio of 20:1 for 24 hours and
cytotoxicity was calculated based on a luciferase assay. Data are
the means.+-.SD; n=3.
[0118] FIG. 63 is a panel of graphs showing an IFN.gamma. Elispot
assay to measure allo-reactivity of TCR and TCR/HLA disruption by
challenging the gene-ablated T cells with irradiated allogenic
PBMCs (left panel) or co-culturing allogenic PBMCs with irradiated
gene-ablated T cells. Specific spots are shown on the y axis as the
spots produced in the presence of stimulators minus the spots
produced by the effectors alone. **P<0.01 by Mann-Whitney
test.
[0119] FIG. 64 is a panel of graphs showing that the disruption of
the endogenous TCR by CRISPR/Cas9 improved TCR-redirected T cell
function. Vb13.1 and CD3 expression is shown in T cells transfected
with Cas9 mRNA alone (Cas9 Mock) or CD3.sup.neg T cells with
disrupted endogenous TCR .alpha. alone (.alpha. KO), .beta. alone
(.beta. KO), .alpha. and .beta. double (.alpha.+.beta. KO) that
were electroporated with NY-ESO-1 TCR .alpha. (1G4 .alpha., 2 ug),
.beta. (1G4 .beta., 2 ug) or .alpha.+.beta. RNA (1G4
.alpha.+.beta., 2+2 ug) RNA.
[0120] FIG. 65A is a panel of graphs showing CD107a up-regulation
of the TCR (1G4) .alpha./.beta. RNA electroporated TCR .alpha. or
.beta. single knockout or .alpha..beta..beta. double knockout T
cells stimulated with a HLA-A2/NY-ESO-1-positive cell line
(Nalm6-ESO) or the control cell line Nalm6.
[0121] FIG. 65B is a graphs showing the lytic ability of TCR
.alpha.+.beta. RNA (1G4 TCR) electroporated TCR .alpha. or .beta.
single-knockout or .alpha.+.beta. double-knockout T cells shown in
(a) in a luciferase-based CTL assay against Nalm6-ESO.
[0122] FIG. 66 is a panel of graphs showing Vbeta and CD3
expression in TCR .alpha.+.beta. double-disrupted T cells
(TCR.sup.neg T cells) electroporated with two different NY-ESO-1
TCR RNA (1G4 TCR, 10 ug or 8F TCR, 10 ug) compared with control
Cas9 Mock T cells.
[0123] FIG. 67A is a panel of graphs showing CD107a up-regulation
in NY-ESO-1 TCR (1G4 TCR or 8F TCR) RNA electroporated TCR
double-knockout CD8.sup.+ T cells stimulated with the
HLA-A2/NY-ESO-1-positive cell lines Nalm6-ESO, 624-mel or U266.
Nalm6 was used as the negative control.
[0124] FIG. 67B is a panel of graphs showing cytokine production
(IL-2 and TNF-.alpha.) of NY-ESO-1 TCR (1G4 TCR or 8F TCR) RNA
electroporated TCR double-knockout T cells after stimulation with
the HLA-A2/NY-ESO-1-positive cell lines Nalm6-ESO or U266; 888mel
melanoma cells were used as a negative control.*P<0.05,
**P<0.01 ****P<0.0001, by two-way ANOVA plus the Bonferroni
post test.
[0125] FIG. 68 is a panel of images showing the generation of
universal CART cells with a combination of lentiviral gene transfer
and CRISPR/Cas9 electroporation. A flow chart of the generation of
universal CD19-CART cells is shown. T cells were transduced with
lentiviral CD19-CAR on day 1 after stimulation, and Cas9 mRNA and
gRNAs targeting the TCR .alpha. and TCR .beta. chains and B2M were
electroporated in the T cells 2 days later. The TCR and HLA-1
double-negative cell population was enriched before re-simulation
for expansion.
[0126] FIG. 69 is a panel of graphs showing CD19-CAR expression in
gene-modified lenti-CD19-CAR T cells expanded by CD3/CD28 bead
stimulation after 1G4 TCR electroporation.
[0127] FIG. 70 is a panel of graphs showing the phenotype of
CD19-CAR T cells.
[0128] FIG. 71 is a graph showing CD107a release in TCR-negative
and TCR/HLA-I double-negative CD19-CAR T cells. Representative data
from 3 independent experiments are shown. Bars, SE=standard
error.
[0129] FIG. 72 is a panel of graphs showing cytokine secretion of
TCR-negative and TCR/HLA-I double-negative CD19-CAR T cells.
Representative data from 3 independent experiments are shown. Bars,
SE=standard error.
[0130] FIG. 73 is a graph showing tumor lytic capability of
TCR-negative and TCR/HLA-I double-negative CD19-CAR T cells.
Representative data from 3 independent experiments are shown. Bars,
SE=standard error.
[0131] FIG. 74 a panel of graphs showing CFSE-labeled CD19-CAR and
non-transduced T cells incubated with K562 and target K562-CD19
tumor cells at a ratio of 1 to 10 for 72 hours.
[0132] FIG. 75A is a graph showing BLI from mice treated with a
single injection on day 7 expressing CD19-CAR and GFP using a
lentiviral vector. ns, no difference by two-way ANOVA plus the
Bonferroni post test. Tumors were established in NSG mice (n=4 per
group) by i.v. injection of 1.times.10.sup.6 Nalm6 cells. Beginning
on day 7, T cells (1.times.10.sup.7) expressing lentiviral (LV)
transduced CD19-CAR were infused with a single injection. T cells
expressing LV GFP protein were injected as controls.
[0133] FIG. 75B is a graph showing the overall survival of mice
receiving LV-GFP, LV-CD19-CAR, LV-CD19-CAR-TCR/CD3.sup.neg and
LV-CD19-CAR-TCR/HLA-I.sup.neg T cells. ns, no difference by the
log-rank Mantel-Cox test.
[0134] FIG. 76 is a panel of images showing that gene-modified CAR
T cells retained antitumor efficacy and did not induce GVHD. Tumors
were established in NSG mice (n=4 per group) by i.v. injection with
1.times.10.sup.6 Nalm6 cells. Beginning on day 7, T cells
(2.times.10.sup.7) expressing LV-CD19-CAR were infused with a
single injection. T cells expressing LV GFP protein were injected
as controls. Imaging commenced 1 day before T cell treatment.
Organs of randomly chosen mice from different treatment groups were
collected on day 65 and used for CD3 immunohistochemistry staining.
FIG. 77 is a series of schematics of vectors showing the design of
pAd5F35-CRISPR targeting PD1, Fas and TCR alpha chain.
[0135] FIG. 78 is an illustration showing the design of penton
modified pAd5F35-CRISPR with anti-CD3 ScFv, and schematic delivery
of pAd5F35-CRISPR for knock in/out chimeric antigen receptor into T
cells in vitro and in vivo.
[0136] FIG. 79A is a graph showing Sanger sequencing of PCR
products flanking PD1-gRNA targeting site.
Adenoviral-pAd5F35-CRISPR-PD1 virus was transduced into MD231
cells. 3 days later, genomic DNA was extracted and performed
PCR.
[0137] FIG. 79B shows the sequences of the targeting events in
MDA231 cells after Adenoviral-CRISPR manipulation. PD1 PCR products
were cloned into TOPO vector and sequenced.
[0138] FIG. 80 is a chart showing that a decrease in gRNA use
improved T cell fold expansion and only slightly decreased knockout
efficiency.
[0139] FIG. 81 is a chart showing the parameters used for
optimizing electroporation conditions to obtain high CD3/B2M
knockout efficiency with improved T cell fold expansion. Compared
with standard electroporation (EP) conditions in a 2 mm cuvette
(EP#10-13) or 4 mm cuvette. High CD3/B2M knockout efficiency was
observed with improved T cell fold expansion (EP#1 and 5).
[0140] FIG. 82 is a chart showing optimization of EP conditions to
achieve maximum fold expansion with tolerable knockout
efficiency.
[0141] FIG. 83 is a chart showing additional optimization of EP
conditions to achieve maximum fold expansion with tolerable
knockout efficiency.
[0142] FIG. 84 diagrams the T cell stimulation, lentiviral
transduction and CRISPR electroporation procedure.
[0143] FIG. 85 is a chart showing T cell numbers (upper chart) and
fold expansion (lower chart) after the electroporation and
culturing procedure.
[0144] FIG. 86 is a panel of graphs showing the average expansion
of T cells. Fold expansion of the T cells transduced with CD19 CAR
alone (TD alone) or transduced with CD19 CAR and edited with CRISPR
(TD/KO) (left graph). Fold expansion of the T cells on day 10 is
shown in the right graph.
[0145] FIG. 87 is a panel of flow graphs showing CD3/B2M/CAR
expression at day 8 of expanded T cells.
[0146] FIG. 88 is a panel of graphs showing CD3/B12M expression
after CD3+ T cell depletion.
[0147] FIG. 89 is a panel of graphs showing CD3/B2M expression on
day 11 in CD19 CAR TD (transduced)/CRISPR electroporated, CD3
depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and
CD19 CAR TD T cells. ND463 non-transduced (NOTD) were used as a
negative control. FIG. 90 is a panel of graphs showing CD19 CAR
expression on day 11 in CD19 CAR TD (transduced)/CRISPR
electroporated, CD3 depleted T cells; CD19 CAR TD/CRISPR
electroporated T cells; and CD19 CAR TD T cells. ND463
non-transduced (NOTD) were used as a negative control.
[0148] FIG. 91 is a panel of graphs showing CD3/B2M/CAR expression
on day 11 in CD19 CAR TD (transduced)/CRISPR electroporated, CD3
depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and
CD19 CAR TD T cells. ND463 non-transduced (NOTD) were used as a
negative control.
[0149] FIG. 92 is a chart summarizing CD3/B2M/CAR expression in
CD19 CAR TD (transduced)/CRISPR electroporated, CD3 depleted T
cells; CD19 CAR TD/CRISPR electroporated T cells; and CD19 CAR TD T
cells.
[0150] FIG. 93 is a panel of graphs showing CD107a up-regulation in
CD19 CAR TD (transduced)/CRISPR electroporated, CD3 depleted T
cells; CD19 CAR TD/CRISPR electroporated T cells; and CD19 CAR TD T
cells.
[0151] FIG. 94 is a panel of graphs showing lytic activity of the T
cells on day 11.
[0152] FIG. 95 is a panel of graphs showing cytokine production of
the T cells on day 11.
[0153] FIG. 96 is a panel of graphs showing T cell expansion. No
abnormal T cell growth was observed.
DETAILED DESCRIPTION
Definitions
[0154] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the present
invention, the preferred materials and methods are described
herein. In describing and claiming the present invention, the
following terminology will be used.
[0155] It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting.
[0156] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0157] "About" as used herein when referring to a measurable value
such as an amount, a temporal duration, and the like, is meant to
encompass variations of .+-.20% or .+-.10%, more preferably .+-.5%,
even more preferably .+-.1%, and still more preferably .+-.0.1%
from the specified value, as such variations are appropriate to
perform the disclosed methods.
[0158] "Activation," as used herein, refers to the state of a T
cell that has been sufficiently stimulated to induce detectable
cellular proliferation. Activation can also be associated with
induced cytokine production, and detectable effector functions. The
term "activated T cells" refers to, among other things, T cells
that are undergoing cell division.
[0159] The term "antibody," as used herein, refers to an
immunoglobulin molecule which specifically binds with an antigen.
Antibodies can be intact immunoglobulins derived from natural
sources or from recombinant sources and can be immunoreactive
portions of intact immunoglobulins. Antibodies are typically
tetramers of immunoglobulin molecules. The antibodies in the
present invention may exist in a variety of forms including, for
example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and
F(ab).sub.2, as well as single chain antibodies (scFv) and
humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow
et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring
Harbor, N.Y.; Houston et al., 1988, Proc. Natl. Acad. Sci. USA
85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0160] The term "antibody fragment" refers to a portion of an
intact antibody and refers to the antigenic determining variable
regions of an intact antibody. Examples of antibody fragments
include, but are not limited to, Fab, Fab', F(ab')2, and Fv
fragments, linear antibodies, scFv antibodies, and multispecific
antibodies formed from antibody fragments.
[0161] An "antibody heavy chain," as used herein, refers to the
larger of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
[0162] An "antibody light chain," as used herein, refers to the
smaller of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations
.alpha. and .beta. light chains refer to the two major antibody
light chain isotypes.
[0163] By the term "synthetic antibody" as used herein, is meant an
antibody which is generated using recombinant DNA technology, such
as, for example, an antibody expressed by a bacteriophage as
described herein. The term should also be construed to mean an
antibody which has been generated by the synthesis of a DNA
molecule encoding the antibody and which DNA molecule expresses an
antibody protein, or an amino acid sequence specifying the
antibody, wherein the DNA or amino acid sequence has been obtained
using synthetic DNA or amino acid sequence technology which is
available and well known in the art.
[0164] The term "antigen" or "Ag" as used herein is defined as a
molecule that provokes an immune response. This immune response may
involve either antibody production, or the activation of specific
immunologically-competent cells, or both. The skilled artisan will
understand that any macromolecule, including virtually all proteins
or peptides, can serve as an antigen. Furthermore, antigens can be
derived from recombinant or genomic DNA. A skilled artisan will
understand that any DNA, which comprises a nucleotide sequences or
a partial nucleotide sequence encoding a protein that elicits an
immune response therefore encodes an "antigen" as that term is used
herein. Furthermore, one skilled in the art will understand that an
antigen need not be encoded solely by a full length nucleotide
sequence of a gene. It is readily apparent that the present
invention includes, but is not limited to, the use of partial
nucleotide sequences of more than one gene and that these
nucleotide sequences are arranged in various combinations to elicit
the desired immune response. Moreover, a skilled artisan will
understand that an antigen need not be encoded by a "gene" at all.
It is readily apparent that an antigen can be generated synthesized
or can be derived from a biological sample. Such a biological
sample can include, but is not limited to a tissue sample, a tumor
sample, a cell or a biological fluid.
[0165] The term "anti-tumor effect" as used herein, refers to a
biological effect which can be manifested by a decrease in tumor
volume, a decrease in the number of tumor cells, a decrease in the
number of metastases, an increase in life expectancy, or
amelioration of various physiological symptoms associated with the
cancerous condition. An "anti-tumor effect" can also be manifested
by the ability of the peptides, polynucleotides, cells and
antibodies of the invention in prevention of the occurrence of
tumor in the first place.
[0166] The term "auto-antigen" means, in accordance with the
present invention, any self-antigen which is recognized by the
immune system as being foreign. Auto-antigens comprise, but are not
limited to, cellular proteins, phosphoproteins, cellular surface
proteins, cellular lipids, nucleic acids, glycoproteins, including
cell surface receptors.
[0167] The term "autoimmune disease" as used herein is defined as a
disorder that results from an autoimmune response. An autoimmune
disease is the result of an inappropriate and excessive response to
a self-antigen. Examples of autoimmune diseases include but are not
limited to, Addision's disease, alopecia areata, ankylosing
spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's
disease, diabetes (Type I), dystrophic epidermolysis bullosa,
epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr
syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus
erythematosus, multiple sclerosis, myasthenia gravis, pemphigus
vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis,
sarcoidosis, scleroderma, Sjogren's syndrome,
spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema,
pernicious anemia, ulcerative colitis, among others.
[0168] As used herein, the term "autologous" is meant to refer to
any material derived from the same individual to which it is later
to be re-introduced into the individual.
[0169] "Allogeneic" refers to a graft derived from a different
animal of the same species.
[0170] "Xenogeneic" refers to a graft derived from an animal of a
different species.
[0171] The term "cancer" as used herein is defined as disease
characterized by the rapid and uncontrolled growth of aberrant
cells. Cancer cells can spread locally or through the bloodstream
and lymphatic system to other parts of the body. Examples of
various cancers include but are not limited to, breast cancer,
prostate cancer, ovarian cancer, cervical cancer, skin cancer,
pancreatic cancer, colorectal cancer, renal cancer, liver cancer,
brain cancer, lymphoma, leukemia, lung cancer and the like. In
certain embodiments, the cancer is medullary thyroid carcinoma.
[0172] The term "chimeric antigen receptor" or "CAR," as used
herein, refers to an artificial T cell receptor that is engineered
to be expressed on an immune effector cell and specifically bind an
antigen. CARs may be used as a therapy with adoptive cell transfer.
T cells are removed from a patient and modified so that they
express the receptors specific to a particular form of antigen. In
some embodiments, the CARs have been expressed with specificity to
a tumor associated antigen, for example. CARs may also comprise an
intracellular activation domain, a transmembrane domain and an
extracellular domain comprising a tumor associated antigen binding
region. In some aspects, CARs comprise fusions of single-chain
variable fragments (scFv) derived monoclonal antibodies, fused to
CD3-zeta transmembrane and intracellular domain. The specificity of
CAR designs may be derived from ligands of receptors (e.g.,
peptides). In some embodiments, a CAR can target cancers by
redirecting the specificity of a T cell expressing the CAR specific
or tumor associated antigens.
[0173] The term "cleavage" refers to the breakage of covalent
bonds, such as in the backbone of a nucleic acid molecule. Cleavage
can be initiated by a variety of methods, including, but not
limited to, enzymatic or chemical hydrolysis of a phosphodiester
bond. Both single-stranded cleavage and double-stranded cleavage
are possible. Double-stranded cleavage can occur as a result of two
distinct single-stranded cleavage events. DNA cleavage can result
in the production of either blunt ends or staggered ends. In
certain embodiments, fusion polypeptides may be used for targeting
cleaved double-stranded DNA.
[0174] As used herein, the term "conservative sequence
modifications" is intended to refer to amino acid modifications
that do not significantly affect or alter the binding
characteristics of the antibody containing the amino acid sequence.
Such conservative modifications include amino acid substitutions,
additions and deletions. Modifications can be introduced into an
antibody of the invention by standard techniques known in the art,
such as site-directed mutagenesis and PCR-mediated mutagenesis.
Conservative amino acid substitutions are ones in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine, tryptophan),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine,
proline, phenylalanine, methionine), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one
or more amino acid residues within the CDR regions of an antibody
can be replaced with other amino acid residues from the same side
chain family and the altered antibody can be tested for the ability
to bind antigens using the functional assays described herein.
[0175] "Co-stimulatory ligand," as the term is used herein,
includes a molecule on an antigen presenting cell (e.g., an aAPC,
dendritic cell, B cell, and the like) that specifically binds a
cognate co-stimulatory molecule on a T cell, thereby providing a
signal which, in addition to the primary signal provided by, for
instance, binding of a TCR/CD3 complex with an MHC molecule loaded
with peptide, mediates a T cell response, including, but not
limited to, proliferation, activation, differentiation, and the
like. A co-stimulatory ligand can include, but is not limited to,
CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L,
inducible costimulatory ligand (ICOS-L), intercellular adhesion
molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM,
lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, HVEM, an agonist or
antibody that binds Toll ligand receptor and a ligand that
specifically binds with B7-H3. A co-stimulatory ligand also
encompasses, inter alia, an antibody that specifically binds with a
co-stimulatory molecule present on a T cell, such as, but not
limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS,
lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT,
NKG2C, B7-H3, and a ligand that specifically binds with CD83.
[0176] A "co-stimulatory molecule" refers to the cognate binding
partner on a T cell that specifically binds with a co-stimulatory
ligand, thereby mediating a co-stimulatory response by the T cell,
such as, but not limited to, proliferation. Co-stimulatory
molecules include, but are not limited to an MHC class I molecule,
BTLA and a Toll ligand receptor.
[0177] A "co-stimulatory signal", as used herein, refers to a
signal, which in combination with a primary signal, such as TCR/CD3
ligation, leads to T cell proliferation and/or upregulation or
downregulation of key molecules.
[0178] The term "CRISPR/CAS," "clustered regularly interspaced
short palindromic repeats system," or "CRISPR" refers to DNA loci
containing short repetitions of base sequences. Each repetition is
followed by short segments of spacer DNA from previous exposures to
a virus. Bacteria and archaea have evolved adaptive immune defenses
termed CRISPR-CRISPR-associated (Cas) systems that use short RNA to
direct degradation of foreign nucleic acids. In bacteria, the
CRISPR system provides acquired immunity against invading foreign
DNA via RNA-guided DNA cleavage.
[0179] In the type II CRISPR/Cas system, short segments of foreign
DNA, termed "spacers" are integrated within the CRISPR genomic loci
and transcribed and processed into short CRISPR RNA (crRNA). These
crRNAs anneal to trans-activating crRNAs (tracrRNAs) and direct
sequence-specific cleavage and silencing of pathogenic DNA by Cas
proteins. Recent work has shown that target recognition by the Cas9
protein requires a "seed" sequence within the crRNA and a conserved
dinucleotide-containing protospacer adjacent motif (PAM) sequence
upstream of the crRNA-binding region.
[0180] To direct Cas9 to cleave sequences of interest,
crRNA-tracrRNA fusion transcripts, hereafter referred to as "guide
RNAs" or "gRNAs" may be designed, from human U6 polymerase III
promoter. CRISPR/CAS mediated genome editing and regulation,
highlighted its transformative potential for basic science,
cellular engineering and therapeutics.
[0181] The term "CRISPRi" refers to a CRISPR system for sequence
specific gene repression or inhibition of gene expression, such as
at the transcriptional level.
[0182] A "disease" is a state of health of an animal wherein the
animal cannot maintain homeostasis, and wherein if the disease is
not ameliorated then the animal's health continues to deteriorate.
In contrast, a "disorder" in an animal is a state of health in
which the animal is able to maintain homeostasis, but in which the
animal's state of health is less favorable than it would be in the
absence of the disorder. Left untreated, a disorder does not
necessarily cause a further decrease in the animal's state of
health.
[0183] The term "downregulation" as used herein refers to the
decrease or elimination of gene expression of one or more
genes.
[0184] "Effective amount" or "therapeutically effective amount" are
used interchangeably herein, and refer to an amount of a compound,
formulation, material, or composition, as described herein
effective to achieve a particular biological result or provides a
therapeutic or prophylactic benefit. Such results may include, but
are not limited to, anti-tumor activity as determined by any means
suitable in the art.
[0185] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0186] As used herein "endogenous" refers to any material from or
produced inside an organism, cell, tissue or system.
[0187] As used herein, the term "exogenous" refers to any material
introduced from or produced outside an organism, cell, tissue or
system.
[0188] The term "expand" as used herein refers to increasing in
number, as in an increase in the number of T cells. In one
embodiment, the T cells that are expanded ex vivo increase in
number relative to the number originally present in the culture. In
another embodiment, the T cells that are expanded ex vivo increase
in number relative to other cell types in the culture. The term "ex
vivo," as used herein, refers to cells that have been removed from
a living organism, (e.g., a human) and propagated outside the
organism (e.g., in a culture dish, test tube, or bioreactor).
[0189] The term "expression" as used herein is defined as the
transcription and/or translation of a particular nucleotide
sequence driven by its promoter.
[0190] "Expression vector" refers to a vector comprising a
recombinant polynucleotide comprising expression control sequences
operatively linked to a nucleotide sequence to be expressed. An
expression vector comprises sufficient cis-acting elements for
expression; other elements for expression can be supplied by the
host cell or in an in vitro expression system. Expression vectors
include all those known in the art, such as cosmids, plasmids
(e.g., naked or contained in liposomes) and viruses (e.g., Sendai
viruses, lentiviruses, retroviruses, adenoviruses, and
adeno-associated viruses) that incorporate the recombinant
polynucleotide.
[0191] "Homologous" as used herein, refers to the subunit sequence
identity between two polymeric molecules, e.g., between two nucleic
acid molecules, such as, two DNA molecules or two RNA molecules, or
between two polypeptide molecules. When a subunit position in both
of the two molecules is occupied by the same monomeric subunit;
e.g., if a position in each of two DNA molecules is occupied by
adenine, then they are homologous at that position. The homology
between two sequences is a direct function of the number of
matching or homologous positions; e.g., if half (e.g., five
positions in a polymer ten subunits in length) of the positions in
two sequences are homologous, the two sequences are 50% homologous;
if 90% of the positions (e.g., 9 of 10), are matched or homologous,
the two sequences are 90% homologous.
[0192] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding
subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. For the most part, humanized
antibodies are human immunoglobulins (recipient antibody) in which
residues from a complementary-determining region (CDR) of the
recipient are replaced by residues from a CDR of a non-human
species (donor antibody) such as mouse, rat or rabbit having the
desired specificity, affinity, and capacity. In some instances, Fv
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies can comprise residues which are found neither
in the recipient antibody nor in the imported CDR or framework
sequences. These modifications are made to further refine and
optimize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin sequence. The humanized antibody optimally also will
comprise at least a portion of an immunoglobulin constant region
(Fc), typically that of a human immunoglobulin. For further
details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et
al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol.,
2: 593-596, 1992.
[0193] "Fully human" refers to an immunoglobulin, such as an
antibody, where the whole molecule is of human origin or consists
of an amino acid sequence identical to a human form of the
antibody.
[0194] "Identity" as used herein refers to the subunit sequence
identity between two polymeric molecules particularly between two
amino acid molecules, such as, between two polypeptide molecules.
When two amino acid sequences have the same residues at the same
positions; e.g., if a position in each of two polypeptide molecules
is occupied by an Arginine, then they are identical at that
position. The identity or extent to which two amino acid sequences
have the same residues at the same positions in an alignment is
often expressed as a percentage. The identity between two amino
acid sequences is a direct function of the number of matching or
identical positions; e.g., if half (e.g., five positions in a
polymer ten amino acids in length) of the positions in two
sequences are identical, the two sequences are 50% identical; if
90% of the positions (e.g., 9 of 10), are matched or identical, the
two amino acids sequences are 90% identical.
[0195] The term "immunoglobulin" or "Ig," as used herein is defined
as a class of proteins, which function as antibodies. Antibodies
expressed by B cells are sometimes referred to as the BCR (B cell
receptor) or antigen receptor. The five members included in this
class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the
primary antibody that is present in body secretions, such as
saliva, tears, breast milk, gastrointestinal secretions and mucus
secretions of the respiratory and genitourinary tracts. IgG is the
most common circulating antibody. IgM is the main immunoglobulin
produced in the primary immune response in most subjects. It is the
most efficient immunoglobulin in agglutination, complement
fixation, and other antibody responses, and is important in defense
against bacteria and viruses. IgD is the immunoglobulin that has no
known antibody function, but may serve as an antigen receptor. IgE
is the immunoglobulin that mediates immediate hypersensitivity by
causing release of mediators from mast cells and basophils upon
exposure to allergen.
[0196] The term "immune response" as used herein is defined as a
cellular response to an antigen that occurs when lymphocytes
identify antigenic molecules as foreign and induce the formation of
antibodies and/or activate lymphocytes to remove the antigen.
[0197] As used here, "induced pluripotent stem cell" or "iPS cell"
refers to a pluripotent stem cell that is generated from adult
cells, such as T cells. The expression of reprogramming factors,
such as Klf4, Oct3/4 and Sox2, in adult cells convert the cells
into pluripotent cells capable of propagation and differentiation
into multiple cell types.
[0198] As used herein, an "instructional material" includes a
publication, a recording, a diagram, or any other medium of
expression which can be used to communicate the usefulness of the
compositions and methods of the invention. The instructional
material of the kit of the invention may, for example, be affixed
to a container which contains the nucleic acid, peptide, and/or
composition of the invention or be shipped together with a
container which contains the nucleic acid, peptide, and/or
composition. Alternatively, the instructional material may be
shipped separately from the container with the intention that the
instructional material and the compound be used cooperatively by
the recipient.
[0199] "Isolated" means altered or removed from the natural state.
For example, a nucleic acid or a peptide naturally present in a
living animal is not "isolated," but the same nucleic acid or
peptide partially or completely separated from the coexisting
materials of its natural state is "isolated." An isolated nucleic
acid or protein can exist in substantially purified form, or can
exist in a non-native environment such as, for example, a host
cell.
[0200] The term "knockdown" as used herein refers to a decrease in
gene expression of one or more genes.
[0201] The term "knockout" as used herein refers to the ablation of
gene expression of one or more genes.
[0202] A "lentivirus" as used herein refers to a genus of the
Retroviridae family. Lentiviruses are unique among the retroviruses
in being able to infect non-dividing cells; they can deliver a
significant amount of genetic information into the DNA of the host
cell, so they are one of the most efficient methods of a gene
delivery vector. HIV, SIV, and FIV are all examples of
lentiviruses. Vectors derived from lentiviruses offer the means to
achieve significant levels of gene transfer in vivo.
[0203] By the term "modified" as used herein, is meant a changed
state or structure of a molecule or cell of the invention.
Molecules may be modified in many ways, including chemically,
structurally, and functionally. Cells may be modified through the
introduction of nucleic acids.
[0204] By the term "modulating," as used herein, is meant mediating
a detectable increase or decrease in the level of a response in a
subject compared with the level of a response in the subject in the
absence of a treatment or compound, and/or compared with the level
of a response in an otherwise identical but untreated subject. The
term encompasses perturbing and/or affecting a native signal or
response thereby mediating a beneficial therapeutic response in a
subject, preferably, a human.
[0205] In the context of the present invention, the following
abbreviations for the commonly occurring nucleic acid bases are
used. "A" refers to adenosine, "C" refers to cytosine, "G" refers
to guanosine, "T" refers to thymidine, and "U" refers to
uridine.
[0206] Unless otherwise specified, a "nucleotide sequence encoding
an amino acid sequence" includes all nucleotide sequences that are
degenerate versions of each other and that encode the same amino
acid sequence. The phrase nucleotide sequence that encodes a
protein or an RNA may also include introns to the extent that the
nucleotide sequence encoding the protein may in some version
contain an intron(s).
[0207] The term "operably linked" refers to functional linkage
between a regulatory sequence and a heterologous nucleic acid
sequence resulting in expression of the latter. For example, a
first nucleic acid sequence is operably linked with a second
nucleic acid sequence when the first nucleic acid sequence is
placed in a functional relationship with the second nucleic acid
sequence. For instance, a promoter is operably linked to a coding
sequence if the promoter affects the transcription or expression of
the coding sequence. Generally, operably linked DNA sequences are
contiguous and, where necessary to join two protein coding regions,
in the same reading frame.
[0208] The term "overexpressed" tumor antigen or "overexpression"
of a tumor antigen is intended to indicate an abnormal level of
expression of a tumor antigen in a cell from a disease area like a
solid tumor within a specific tissue or organ of the patient
relative to the level of expression in a normal cell from that
tissue or organ. Patients having solid tumors or a hematological
malignancy characterized by overexpression of the tumor antigen can
be determined by standard assays known in the art.
[0209] "Parenteral" administration of an immunogenic composition
includes, e.g., subcutaneous (s.c.), intravenous (i.v.),
intramuscular (i.m.), or intrasternal injection, or infusion
techniques.
[0210] The term "polynucleotide" as used herein is defined as a
chain of nucleotides. Furthermore, nucleic acids are polymers of
nucleotides. Thus, nucleic acids and polynucleotides as used herein
are interchangeable. One skilled in the art has the general
knowledge that nucleic acids are polynucleotides, which can be
hydrolyzed into the monomeric "nucleotides." The monomeric
nucleotides can be hydrolyzed into nucleosides. As used herein
polynucleotides include, but are not limited to, all nucleic acid
sequences which are obtained by any means available in the art,
including, without limitation, recombinant means, i.e., the cloning
of nucleic acid sequences from a recombinant library or a cell
genome, using ordinary cloning technology and PCR.TM., and the
like, and by synthetic means.
[0211] As used herein, the terms "peptide," "polypeptide," and
"protein" are used interchangeably, and refer to a compound
comprised of amino acid residues covalently linked by peptide
bonds. A protein or peptide must contain at least two amino acids,
and no limitation is placed on the maximum number of amino acids
that can comprise a protein's or peptide's sequence. Polypeptides
include any peptide or protein comprising two or more amino acids
joined to each other by peptide bonds. As used herein, the term
refers to both short chains, which also commonly are referred to in
the art as peptides, oligopeptides and oligomers, for example, and
to longer chains, which generally are referred to in the art as
proteins, of which there are many types. "Polypeptides" include,
for example, biologically active fragments, substantially
homologous polypeptides, oligopeptides, homodimers, heterodimers,
variants of polypeptides, modified polypeptides, derivatives,
analogs, fusion proteins, among others. The polypeptides include
natural peptides, recombinant peptides, synthetic peptides, or a
combination thereof.
[0212] The term "promoter" as used herein is defined as a DNA
sequence recognized by the synthetic machinery of the cell, or
introduced synthetic machinery, required to initiate the specific
transcription of a polynucleotide sequence.
[0213] As used herein, the term "promoter/regulatory sequence"
means a nucleic acid sequence which is required for expression of a
gene product operably linked to the promoter/regulatory sequence.
In some instances, this sequence may be the core promoter sequence
and in other instances, this sequence may also include an enhancer
sequence and other regulatory elements which are required for
expression of the gene product. The promoter/regulatory sequence
may, for example, be one which expresses the gene product in a
tissue specific manner.
[0214] A "constitutive" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide which encodes or
specifies a gene product, causes the gene product to be produced in
a cell under most or all physiological conditions of the cell.
[0215] An "inducible" promoter is a nucleotide sequence which, when
operably linked with a polynucleotide which encodes or specifies a
gene product, causes the gene product to be produced in a cell
substantially only when an inducer which corresponds to the
promoter is present in the cell.
[0216] A "tissue-specific" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide encodes or specified by
a gene, causes the gene product to be produced in a cell
substantially only if the cell is a cell of the tissue type
corresponding to the promoter.
[0217] A "Sendai virus" refers to a genus of the Paramyxoviridae
family. Sendai viruses are negative, single stranded RNA viruses
that do not integrate into the host genome or alter the genetic
information of the host cell. Sendai viruses have an exceptionally
broad host range and are not pathogenic to humans. Used as a
recombinant viral vector, Sendai viruses are capable of transient
but strong gene expression.
[0218] A "signal transduction pathway" refers to the biochemical
relationship between a variety of signal transduction molecules
that play a role in the transmission of a signal from one portion
of a cell to another portion of a cell. The phrase "cell surface
receptor" includes molecules and complexes of molecules capable of
receiving a signal and transmitting signal across the plasma
membrane of a cell.
[0219] "Single chain antibodies" refer to antibodies formed by
recombinant DNA techniques in which immunoglobulin heavy and light
chain fragments are linked to the Fv region via an engineered span
of amino acids. Various methods of generating single chain
antibodies are known, including those described in U.S. Pat. No.
4,694,778; Bird (1988) Science 242:423-442; Huston et al. (1988)
Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et al. (1989) Nature
334:54454; Skerra et al. (1988) Science 242:1038-1041.
[0220] By the term "specifically binds," as used herein with
respect to an antibody, is meant an antibody which recognizes a
specific antigen, but does not substantially recognize or bind
other molecules in a sample. For example, an antibody that
specifically binds to an antigen from one species may also bind to
that antigen from one or more species. But, such cross-species
reactivity does not itself alter the classification of an antibody
as specific. In another example, an antibody that specifically
binds to an antigen may also bind to different allelic forms of the
antigen. However, such cross reactivity does not itself alter the
classification of an antibody as specific. In some instances, the
terms "specific binding" or "specifically binding," can be used in
reference to the interaction of an antibody, a protein, or a
peptide with a second chemical species, to mean that the
interaction is dependent upon the presence of a particular
structure (e.g., an antigenic determinant or epitope) on the
chemical species; for example, an antibody recognizes and binds to
a specific protein structure rather than to proteins generally. If
an antibody is specific for epitope "A", the presence of a molecule
containing epitope A (or free, unlabeled A), in a reaction
containing labeled "A" and the antibody, will reduce the amount of
labeled A bound to the antibody.
[0221] By the term "stimulation," is meant a primary response
induced by binding of a stimulatory molecule (e.g., a TCR/CD3
complex) with its cognate ligand thereby mediating a signal
transduction event, such as, but not limited to, signal
transduction via the TCR/CD3 complex. Stimulation can mediate
altered expression of certain molecules, such as downregulation of
TGF-beta, and/or reorganization of cytoskeletal structures, and the
like.
[0222] A "stimulatory molecule," as the term is used herein, means
a molecule on a T cell that specifically binds with a cognate
stimulatory ligand present on an antigen presenting cell.
[0223] A "stimulatory ligand," as used herein, means a ligand that
when present on an antigen presenting cell (e.g., an aAPC, a
dendritic cell, a B-cell, and the like) can specifically bind with
a cognate binding partner (referred to herein as a "stimulatory
molecule") on a T cell, thereby mediating a primary response by the
T cell, including, but not limited to, activation, initiation of an
immune response, proliferation, and the like. Stimulatory ligands
are well-known in the art and encompass, inter alia, an MHC Class I
molecule loaded with a peptide, an anti-CD3 antibody, a
superagonist anti-CD28 antibody, and a superagonist anti-CD2
antibody.
[0224] The term "subject" is intended to include living organisms
in which an immune response can be elicited (e.g., mammals). A
"subject" or "patient," as used therein, may be a human or
non-human mammal. Non-human mammals include, for example, livestock
and pets, such as ovine, bovine, porcine, canine, feline and murine
mammals. Preferably, the subject is human.
[0225] As used herein, a "substantially purified" cell is a cell
that is essentially free of other cell types. A substantially
purified cell also refers to a cell which has been separated from
other cell types with which it is normally associated in its
naturally occurring state. In some instances, a population of
substantially purified cells refers to a homogenous population of
cells. In other instances, this term refers simply to cell that
have been separated from the cells with which they are naturally
associated in their natural state. In some embodiments, the cells
are cultured in vitro. In other embodiments, the cells are not
cultured in vitro.
[0226] A "target site" or "target sequence" refers to a genomic
nucleic acid sequence that defines a portion of a nucleic acid to
which a binding molecule may specifically bind under conditions
sufficient for binding to occur.
[0227] As used herein, the term "T cell receptor" or "TCR" refers
to a complex of membrane proteins that participate in the
activation of T cells in response to the presentation of antigen.
The TCR is responsible for recognizing antigens bound to major
histocompatibility complex molecules. TCR is composed of a
heterodimer of an alpha (.alpha.) and beta (.beta.) chain, although
in some cells the TCR consists of gamma and delta (.gamma./.delta.)
chains. TCRs may exist in alpha/beta and gamma/delta forms, which
are structurally similar but have distinct anatomical locations and
functions. Each chain is composed of two extracellular domains, a
variable and constant domain. In some embodiments, the TCR may be
modified on any cell comprising a TCR, including, for example, a
helper T cell, a cytotoxic T cell, a memory T cell, regulatory T
cell, natural killer T cell, and gamma delta T cell.
[0228] The term "therapeutic" as used herein means a treatment
and/or prophylaxis. A therapeutic effect is obtained by
suppression, remission, or eradication of a disease state.
[0229] The term "transfected" or "transformed" or "transduced" as
used herein refers to a process by which exogenous nucleic acid is
transferred or introduced into the host cell. A "transfected" or
"transformed" or "transduced" cell is one which has been
transfected, transformed or transduced with exogenous nucleic acid.
The cell includes the primary subject cell and its progeny.
[0230] To "treat" a disease as the term is used herein, means to
reduce the frequency or severity of at least one sign or symptom of
a disease or disorder experienced by a subject.
[0231] The phrase "under transcriptional control" or "operatively
linked" as used herein means that the promoter is in the correct
location and orientation in relation to a polynucleotide to control
the initiation of transcription by RNA polymerase and expression of
the polynucleotide.
[0232] A "vector" is a composition of matter which comprises an
isolated nucleic acid and which can be used to deliver the isolated
nucleic acid to the interior of a cell. Numerous vectors are known
in the art including, but not limited to, linear polynucleotides,
polynucleotides associated with ionic or amphiphilic compounds,
plasmids, and viruses. Thus, the term "vector" includes an
autonomously replicating plasmid or a virus. The term should also
be construed to include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into cells, such as, for
example, polylysine compounds, liposomes, and the like. Examples of
viral vectors include, but are not limited to, Sendai viral
vectors, adenoviral vectors, adeno-associated virus vectors,
retroviral vectors, lentiviral vectors, and the like.
[0233] Ranges: throughout this disclosure, various aspects of the
invention can be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2,
2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of
the range.
Description
[0234] Universal T cells that avoid graft vs host disease (GVHD)
are highly desired in the clinical setting. However, use of
allogeneic T cells is a risk because of rejection by the host's
immune system through the recognition of HLA-A molecules. Targeting
strategies to manipulate multiple genes are complicated and efforts
have yielded low efficiency in T cells without preventing GVHD and
host vs graft reactions simultaneously.
[0235] The FAS receptor/FAS ligand FAS/FASL) apoptosis signaling
pathway negatively regulates T cell function. PD1 and CTLA4 are two
major inhibitory signaling pathways in T cells. The enhanced
anti-tumor immunity that results from antibody-mediated blockade of
CTLA-4, PD-1 or PD-L1 suggests the potential to improve efficiency
of immunotherapies by inhibiting these pathways. The invention
includes the generation of modified T cells where the TCR .alpha.
and .beta. chain, beta-2 microglobulin, a HLA molecule, CTLA-4,
PD-1, and/or FAS are depleted as a means to generate modified T
cells with reduced immunogenicity.
[0236] The present invention includes methods and compositions for
generating a modified T cell by knocking down endogenous gene
expression and expressing either a modified T cell receptor or a
chimeric antigen receptor. In some embodiments, the invention
includes a method for generating the modified T cell. Such a
modified T cell can be included in a therapeutic composition and
administered to a patient in need thereof.
Knockdown of Endogenous Gene Expression
[0237] The present invention includes downregulation of endogenous
gene expression in a T cell, such as downregulating an alpha and/or
beta chain of the T cell receptor (TCR), beta-2 microglobulin,
CTLA-4, FAS, PD1, or a major histocompatibility complex protein
such as a HLA molecule. In one embodiment, the T cell with
downregulated gene expression has reduced immunogenicity in an
allogeneic environment. In another embodiment, the T cell with
reduced immunogenicity expresses a modified TCR or a CAR for
targeted effector activity.
[0238] In one aspect, the invention includes a method for
generating a modified T cell comprising introducing a nucleic acid
into a T cell capable of downregulating endogenous gene expression,
where the gene is selected from the group consisting of TCR .alpha.
chain, TCR .beta. chain, beta-2 microglobulin, a HLA molecule,
CTLA-4, PD1, and FAS. Downregulating expression of an endogenous
gene that is involved in producing an immune response to a cell,
such as TCR .alpha. chain, TCR .beta. chain, beta-2 microglobulin,
or a HLA molecule, reduces immune-mediated rejection of the
modified T cell. For example, downregulating expression of
endogenous TCR, MHC or beta-2 microglobulin genes removes surface
presentation of alloantigens on the T cell that could cause
rejection by the host immune system. Also, downregulating an
endogenous gene that regulates inhibitory signaling pathways in T
cells, such as CTLA-4, PD1, and/or FAS, enhances anti-tumor
efficacy of the modified T cell when exposed to an
immunosuppressive microenvironment.
[0239] In one aspect, a nucleic acid capable of downregulating
endogenous gene expression is introduced, such as by
electroporation, transfection, or lenti- or other viral
transduction, into the T cell. In another aspect, the invention
includes a modified T cell comprising an electroporated nucleic
acid capable of downregulating endogenous gene expression. In yet
another aspect, a modified T cell includes an electroporated
nucleic acid capable of downregulating endogenous TCR gene
expression. In another aspect, the composition comprising the
modified T cell is generated according to a method described
herein. In yet another aspect, the invention includes a
pharmaceutical composition comprising the modified T cell or a
modified T cell generated according to the method described herein
and a pharmaceutically acceptable carrier.
[0240] The nucleic acid capable of regulating endogenous gene
expression may downregulate the endogenous gene expression. In one
embodiment, the nucleic acid capable of downregulating endogenous
gene expression is selected from the group consisting of an
antisense RNA, antigomer RNA, siRNA, shRNA, and a CRISPR system.
Endogenous gene expression may be downregulated, knocked-down,
decreased, and/or inhibited by, for example, an antisense RNA,
antigomer RNA, siRNA, shRNA, a CRISPR system, etc.
CRISPR/Cas
[0241] The CRISPR/Cas system is a facile and efficient system for
inducing targeted genetic alterations. Target recognition by the
Cas9 protein requires a `seed` sequence within the guide RNA (gRNA)
and a conserved di-nucleotide containing protospacer adjacent motif
(PAM) sequence upstream of the gRNA-binding region. The CRISPR/CAS
system can thereby be engineered to cleave virtually any DNA
sequence by redesigning the gRNA in cell lines (such as 293T
cells), primary cells, and CAR T cells. The CRISPR/CAS system can
simultaneously target multiple genomic loci by co-expressing a
single CAS9 protein with two or more gRNAs, making this system
uniquely suited for multiple gene editing or synergistic activation
of target genes.
[0242] One example of a CRISPR/Cas system used to inhibit gene
expression, CRISPRi, is described in U.S. Publication No.:
2014/0068797. CRISPRi induces permanent gene disruption that
utilizes the RNA-guided Cas9 endonuclease to introduce DNA double
stranded breaks which trigger error-prone repair pathways to result
in frame shift mutations. A catalytically dead Cas9 lacks
endonuclease activity. When coexpressed with a guide RNA, a DNA
recognition complex is generated that specifically interferes with
transcriptional elongation, RNA polymerase binding, or
transcription factor binding. This CRISPRi system efficiently
represses expression of targeted genes.
[0243] CRISPR/Cas gene disruption occurs when a guide nucleic acid
sequence specific for a target gene and a Cas endonuclease are
introduced into a cell and form a complex that enables the Cas
endonuclease to introduce a double strand break at the target gene.
In one embodiment, the CRISPR system comprises an expression
vector, such as, but not limited to, an pAd5F35-CRISPR vector. In
one embodiment, a modified T cell is generated by introducing a Cas
expression vector and a guide nucleic acid sequence specific for a
gene into a T cell. In another embodiment, the Cas expression
vector induces expression of Cas9 endonuclease. Other endonucleases
may also be used, including but not limited to, T7, Cas3, Cas8a,
Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1,
other nucleases known in the art, and any combination thereof.
[0244] In one embodiment, inducing the Cas expression vector
comprises exposing the T cell to an agent that activates an
inducible promoter in the Cas expression vector. In such an
embodiment, the Cas expression vector includes an inducible
promoter, such as one that is inducible by exposure to an
antibiotic (e.g., by tetracycline or a derivative of tetracycline,
for example doxycycline). However, it should be appreciated that
other inducible promoters can be used. The inducing agent can be a
selective condition (e.g., exposure to an agent, for example an
antibiotic) that results in induction of the inducible promoter.
This results in expression of the Cas expression vector.
[0245] The guide nucleic acid sequence is specific for a gene and
targets that gene for Cas endonuclease-induced double strand
breaks. The sequence of the guide nucleic acid sequence may be
within a loci of the gene. In one embodiment, the guide nucleic
acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40 or more nucleotides in length.
[0246] The guide nucleic acid sequence may be specific for any
gene, such as a gene that would reduce immunogenicity or reduce
sensitivity to an immunosuppressive microenvironment. In one
embodiment, the gene may include a sequence specific for a T cell
receptor (TCR) chain (such as an alpha, beta, gamma and/or delta
chain), beta-2 microglobulin, FAS, PD1, a major histocompatibility
complex protein (such as a HLA class I molecule and/or HLA class II
molecule), CTLA-4, or any combination thereof.
[0247] The guide nucleic acid sequence includes a RNA sequence, a
DNA sequence, a combination thereof (a RNA-DNA combination
sequence), or a sequence with synthetic nucleotides. The guide
nucleic acid sequence can be a single molecule or a double
molecule. In one embodiment, the guide nucleic acid sequence
comprises a single guide RNA.
T Cell Receptor
[0248] Adoptive immunotherapy with T cells harboring
antigen-specific TCRs have therapeutic potential in the treatment
of cancer and certain chronic viral infections. Gene-engineering of
T cells with a specific TCR has the advantage of redirecting the T
cell to an intracellular antigen. Given that most oncogenic
proteins are intracellular, development of a panel of TCRs specific
to an oncogenic driver protein has great appeal.
[0249] The present invention also includes a modified T cell with
downregulated gene expression as described herein and an exogenous
T cell receptor (TCR). In one aspect, the invention includes a
method for generating a modified T cell comprising introducing a
nucleic acid encoding a modified T cell receptor (TCR) comprising
affinity for a surface antigen on a target cell into the T cell and
a nucleic acid capable of regulating endogenous gene expression
selected from the group consisting of TCR .alpha. chain, TCR .beta.
chain, beta-2 microglobulin, PD1, and FAS, wherein the T cells are
capable of expressing the modified TCR.
[0250] In another aspect, the invention includes a modified T cell
comprising an exogenous nucleic acid encoding a modified T cell
receptor (TCR) comprising affinity for a surface antigen on a
target cell and a nucleic acid capable of downregulating endogenous
gene expression selected from the group consisting of TCR .alpha.
chain, TCR .beta. chain, beta-2 microglobulin, PD1, and FAS,
wherein the T cell expresses the modified TCR and wherein the
endogenous gene expression is downregulated in the T cell. The
invention also includes a population of cells comprising the
modified T cell described herein.
[0251] A T cell receptor is a complex of membrane proteins that
participate in the activation of T cells in response to the
presentation of antigen. Stimulation of the TCR is triggered by
major histocompatibility complex molecules (MHC) on antigen
presenting cells that present antigen peptides to the T cells and
bind to the TCR complexes to induce a series of intracellular
signaling cascades.
[0252] The TCR is generally composed of six different membrane
bound chains that form the TCR heterodimer responsible for ligand
recognition. TCRs exist in alpha/beta and gamma/delta forms, which
are structurally similar but have distinct anatomical locations and
functions. In one embodiment, the TCR comprises a TCR alpha and TCR
beta chain, such as the nucleic acid encoding the TCR comprises a
nucleic acid encoding a TCR alpha and a TCR beta chain. In another
embodiment, a TCR alpha chain or a TCR beta chain or both chains
comprise at least one N-deglycosylation.
[0253] Each chain is composed of two extracellular domains, a
variable and constant domain. In one embodiment, the TCR comprises
at least one murine constant region.
[0254] The constant domain is proximal to the cell membrane,
followed by a transmembrane domain and a short cytoplasmic tail. In
one embodiment, the modified TCR comprises a cytoplasmic domain
including a co-stimulatory signaling domain, such as a 4-1BB
co-stimulatory signaling domain. The variable domain contributes to
the determination of the particular antigen and MHC molecule to
which the TCR has binding specificity. In turn, the specificity of
a T cell for a unique antigen-MHC complex resides in the particular
TCR expressed by the T cell.
[0255] Each of the constant and variable domains may include an
intra-chain disulfide bond. In one embodiment, TCR comprises at
least one disulfide bond. The variable domains include the highly
polymorphic loops analogous to the complementarity determining
regions (CDRs) of antibodies. The diversity of TCR sequences is
generated via somatic rearrangement of linked variable (V),
diversity (D), joining (J), and constant genes.
[0256] Functional alpha and gamma chain polypeptides are formed by
rearranged V-J-C regions, whereas beta and delta chains consist of
V-D-J-C regions. The extracellular constant domain includes a
membrane proximal region and an immunoglobulin region.
[0257] In one embodiment, the TCR includes a wildtype TCR, a high
affinity TCR, and a chimeric TCR. When the TCR is modified, it may
have higher affinity for the target cell surface antigen than a
wildtype TCR. In embodiments where the TCR is a chimeric TCR, the
TCR may include chimeric domains, such as the TCR comprises a
co-stimulatory signaling domain at a C' terminal of at least one of
the chains. In other embodiment, the TCR may include a modified
chain, such as a modified alpha or beta chain. Such modifications
may include, but are not limited to, N-deglycosylation, altered
domain (such as an engineered variable region to target a specific
antigen or increase affinity), addition of one or more disulfide
bonds, entire or fragment of a chain derived from a different
species, and any combination thereof.
[0258] In one embodiment, the TCR comprises specificity to a target
cell antigen. The target cell surface antigen may include any type
of ligand that defines the surface of a target cell. For example,
the target cell surface antigen may be chosen to recognize a ligand
that acts as a cell surface marker on target cells associated with
a particular disease state. Thus examples of cell surface markers
that may act as ligands for the antigen binding domain of the TCR
including those associated with viral, bacterial and parasitic
infections, autoimmune disease and cancer cells. In one embodiment,
the target cell surface antigen includes any tumor associated
antigen (TAA) and viral antigen, disease cell associated antigen,
or any fragment thereof.
[0259] The target cell antigen may include any protein that can be
processed and presented by major histocompability complexes. For
example, the target antigen may be associated with a particular
disease state. Thus examples of cell markers that may act as
targets of the TCR include those associated with viral, bacterial
and parasitic infections, autoimmune disease and cancer cells. In
one embodiment, the target antigen includes any of tumor associated
antigens (TAA) and viral antigens, or any fragment thereof.
[0260] In one aspect, the invention includes a population of
modified T cells comprising a nucleic acid encoding a modified T
cell receptor (TCR) comprising affinity for a surface antigen on a
target cell and a nucleic acid capable of downregulating endogenous
gene expression selected from the group consisting of TCR .alpha.
chain, TCR .beta. chain, beta-2 microglobulin, a HLA molecule,
CTLA-4, PD1, and FAS, wherein the T cells are capable of expressing
the modified TCR.
[0261] Techniques for engineering and expressing T cell receptors
include, but are not limited to, the production of TCR heterodimers
which include the native disulphide bridge which connects the
respective subunits (Garboczi, et al., (1996), Nature 384(6605):
134-41; Garboczi, et al., (1996), J Immunol 157(12): 5403-10; Chang
et al., (1994), PNAS USA 91: 11408-11412; Davodeau et al., (1993),
J. Biol. Chem. 268(21): 15455-15460; Golden et al., (1997), J. Imm.
Meth. 206: 163-169; U.S. Pat. No. 6,080,840).
Chimeric Antigen Receptor (CAR)
[0262] The present invention also includes a modified T cell with
downregulated gene expression as described herein and a CAR. Thus,
the present invention encompasses the modified T cell comprising a
CAR or a nucleic acid encoding a CAR, wherein the CAR includes an
antigen binding domain, a transmembrane domain and an intracellular
domain.
[0263] In one aspect, the invention includes a method of generating
a modified T cell comprising introducing a nucleic acid capable of
downregulating endogenous gene expression selected from the group
consisting of TCR .alpha. chain, TCR .beta. chain, beta-2
microglobulin, a HLA molecule, CTLA-4, PD1, and FAS into a T cell
and a nucleic acid encoding a chimeric antigen receptor (CAR) into
the T cell, wherein the CAR comprises an antigen binding domain, a
transmembrane domain and an intracellular domain of a
co-stimulatory molecule.
[0264] In another aspect, the invention includes a modified T cell
comprising a nucleic acid capable of downregulating endogenous gene
expression and a nucleic acid encoding a chimeric antigen receptor
(CAR), wherein the downregulated gene expression is selected from
the group consisting of TCR .alpha. chain, TCR .beta. chain, beta-2
microglobulin, a HLA molecule, CTLA-4, PD1, and FAS, and wherein
the CAR comprises an antigen binding domain, a transmembrane domain
and an intracellular domain of a co-stimulatory molecule. In one
embodiment, the modified T cell further comprises an exogenous
nucleic acid encoding a modified TCR comprising affinity for a
surface antigen on a target cell as described elsewhere herein. The
invention also includes a population of cells comprising the
modified T cell described herein.
[0265] One or more domains or a fragment of a domain of the CAR may
be human. In one embodiment, the present invention includes a fully
human CAR. The nucleic acid sequences coding for the desired
domains can be obtained using recombinant methods known in the art,
such as, for example by screening libraries from cells expressing
the gene, by deriving the gene from a vector known to include the
same, or by isolating directly from cells and tissues containing
the same, using standard techniques. Alternatively, the gene of
interest can be produced synthetically, rather than as a cloned
molecule.
[0266] Example of CARs are described in U.S. Pat. Nos. 8,911,993,
8,906,682, 8,975,071, 8,916,381, 9,102,760, 9,101,584, and
9,102,761, all of which are incorporated herein by reference in
their entireties.
Antigen Binding Domain
[0267] In one embodiment, the CAR comprises an antigen binding
domain that binds to an antigen on a target cell. Examples of cell
surface markers that may act as an antigen that binds to the
antigen binding domain of the CAR include those associated with
viral, bacterial and parasitic infections, autoimmune disease, and
cancer cells.
[0268] The choice of antigen binding domain depends upon the type
and number of antigens that are present on the surface of a target
cell. For example, the antigen binding domain may be chosen to
recognize an antigen that acts as a cell surface marker on a target
cell associated with a particular disease state.
[0269] In one embodiment, the antigen binding domain binds to a
tumor antigen, such as an antigen that is specific for a tumor or
cancer of interest. In one embodiment, the tumor antigen of the
present invention comprises one or more antigenic cancer
epitopes.
[0270] The antigen binding domain can include any domain that binds
to the antigen and may include, but is not limited to, a monoclonal
antibody, a polyclonal antibody, a synthetic antibody, a human
antibody, a humanized antibody, a non-human antibody, and any
fragment thereof. Thus, in one embodiment, the antigen binding
domain portion comprises a mammalian antibody or a fragment
thereof.
[0271] The antigen binding domain may bind one or more antigens,
such as but not limited to CD19; CD123; CD22; CD30; CD171; CS-1
(also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and
19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33;
epidermal growth factor receptor variant III (EGFRvIII);
ganglioside G2 (GD2); ganglioside GD3
(aNeu5Ac(2-8)aNeu5.Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TNF receptor
family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or
(GalNAc.alpha.-Ser/Thr)); prostate-specific membrane antigen
(PSMA); Receptor tyrosine kinase-like orphan receptor 1 (ROR1);
Fms-Like Tyrosine Kinase 3 (FLT3); Tumor-associated glycoprotein 72
(TAG72); CD38; CD44v6; Carcinoembryonic antigen (CEA); Epithelial
cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117);
Interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2);
Mesothelin; Interleukin 11 receptor alpha (IL-11Ra); prostate stem
cell antigen (PSCA); Protease Serine 21 (Testisin or PRSS21);
vascular endothelial growth factor receptor 2 (VEGFR2); Lewis(Y)
antigen; CD24; Platelet-derived growth factor receptor beta
(PDGFR-beta); Stage-specific embryonic antigen-4 (SSEA-4); CD20;
Folate receptor alpha; Receptor tyrosine-protein kinase ERBB2
(Her2/neu); Mucin 1, cell surface associated (MUC1); epidermal
growth factor receptor (EGFR); neural cell adhesion molecule
(NCAM); Prostase; prostatic acid phosphatase (PAP); elongation
factor 2 mutated (ELF2M); Ephrin B2; fibroblast activation protein
alpha (FAP); insulin-like growth factor 1 receptor (IGF-I
receptor), carbonic anhydrase IX (CAIX); Proteasome (Prosome,
Macropain) Subunit, Beta Type, 9 (LMP2); glycoprotein 100 (gp 100);
oncogene fusion protein consisting of breakpoint cluster region
(BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl)
(bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); Fucosyl
GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3
(aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5);
high molecular weight-melanoma-associated antigen (HMWMAA);
o-acetyl-GD2 ganglioside (OAcGD2); Folate receptor beta; tumor
endothelial marker 1 (TEM1/CD248); tumor endothelial marker
7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone
receptor (TSHR); G protein-coupled receptor class C group 5, member
D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97;
CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid;
placenta-specific 1 (PLAC1); hexasaccharide portion of globoH
glycoceramide (GloboH); mammary gland differentiation antigen
(NY-BR-1); uroplakin 2 (UPK2); Hepatitis A virus cellular receptor
1 (HAVCR1); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G
protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex,
locus K 9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCR Gamma
Alternate Reading Frame Protein (TARP); Wilms tumor protein (WT1);
Cancer/testis antigen 1 (NY-ESO-1); Cancer/testis antigen 2
(LAGE-1a); Melanoma-associated antigen 1 (MAGE-A1); ETS
translocation-variant gene 6, located on chromosome 12p (ETV6-AML);
sperm protein 17 (SPA17); X Antigen Family, Member 1A (XAGE1);
angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma
cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis
antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53
(p53); p53 mutant; prostein; surviving; telomerase; prostate
carcinoma tumor antigen-1 (PCTA-1 or Galectin 8), melanoma antigen
recognized by T cells 1 (MelanA or MART 1); Rat sarcoma (Ras)
mutant; human Telomerase reverse transcriptase (hTERT); sarcoma
translocation breakpoints; melanoma inhibitor of apoptosis
(ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS
fusion gene); N-Acetyl glucosaminyl-transferase V (NA17); paired
box protein Pax-3 (PAX3); Androgen receptor; Cyclin B1; v-myc avian
myelocytomatosis viral oncogene neuroblastoma derived homolog
(MYCN); Ras Homolog Family Member C (RhoC); Tyrosinase-related
protein 2 (TRP-2); Cytochrome P450 1B1 (CYP1B1); CCCTC-Binding
Factor (Zinc Finger Protein)-Like (BORIS or Brother of the
Regulator of Imprinted Sites), Squamous Cell Carcinoma Antigen
Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5);
proacrosin binding protein sp32 (OY-TES1); lymphocyte-specific
protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4);
synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced
Glycation Endproducts (RAGE-1); renal ubiquitous 1 (RU1); renal
ubiquitous 2 (RU2); legumain; human papilloma virus E6 (HPV E6);
human papilloma virus E7 (HPV E7); intestinal carboxyl esterase;
heat shock protein 70-2 mutated (mut hsp70-2); CD79a; CD79b; CD72;
Leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc
fragment of IgA receptor (FCAR or CD89); Leukocyte
immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300
molecule-like family member f (CD300LF); C-type lectin domain
family 12 member A (CLEC12A); bone marrow stromal cell antigen 2
(BST2); EGF-like module-containing mucin-like hormone receptor-like
2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc
receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide
1 (IGLL1).
[0272] In some instances, it is beneficial for the antigen binding
domain to be derived from the same species in which the CAR will
ultimately be used in. For example, for use in humans, it may be
beneficial for the antigen binding domain of the CAR to comprise a
human antibody, humanized antibody as described elsewhere herein,
or a fragment thereof.
[0273] It is also beneficial that the antigen binding domain is
operably linked to another domain of the CAR, such as the
transmembrane domain or the intracellular domain, both described
elsewhere herein, for expression in the cell. In one embodiment, a
nucleic acid encoding the antigen binding domain is operably linked
to a nucleic acid encoding a transmembrane domain and a nucleic
acid encoding an intracellular domain.
[0274] Transmembrane Domain
[0275] With respect to the transmembrane domain, the CAR can be
designed to comprise a transmembrane domain that connects the
antigen binding domain of the CAR to the intracellular domain. In
one embodiment, the transmembrane domain is naturally associated
with one or more of the domains in the CAR. In some instances, the
transmembrane domain can be selected or modified by amino acid
substitution to avoid binding of such domains to the transmembrane
domains of the same or different surface membrane proteins to
minimize interactions with other members of the receptor
complex.
[0276] The transmembrane domain may be derived either from a
natural or from a synthetic source. Where the source is natural,
the domain may be derived from any membrane-bound or transmembrane
protein. Transmembrane regions of particular use in this invention
may be derived from (i.e. comprise at least the transmembrane
region(s) of) the alpha, beta or zeta chain of the T-cell receptor,
CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33,
CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some instances, a
variety of human hinges can be employed as well including the human
Ig (immunoglobulin) hinge.
[0277] In one embodiment, the transmembrane domain may be
synthetic, in which case it will comprise predominantly hydrophobic
residues such as leucine and valine. Preferably a triplet of
phenylalanine, tryptophan and valine will be found at each end of a
synthetic transmembrane domain.
[0278] Intracellular Domain
[0279] The intracellular domain or otherwise the cytoplasmic domain
of the CAR is responsible for activation of the cell in which the
CAR is expressed. The term "intracellular domain" is thus meant to
include any portion of the intracellular domain sufficient to
transduce the activation signal. In one embodiment, the
intracellular domain includes a domain responsible for an effector
function. The term "effector function" refers to a specialized
function of a cell. Effector function of a T cell, for example, may
be cytolytic activity or helper activity including the secretion of
cytokines.
[0280] In one embodiment, the intracellular domain of the CAR
includes a domain responsible for signal activation and/or
transduction. The intracellular domain may transmit signal
activation via protein-protein interactions, biochemical changes or
other response to alter the cell's metabolism, shape, gene
expression, or other cellular response to activation of the
chimeric intracellular signaling molecule.
[0281] Examples of an intracellular domain for use in the invention
include, but are not limited to, the cytoplasmic portion of the T
cell receptor (TCR) and any co-stimulatory molecule that acts in
concert to initiate signal transduction following antigen receptor
engagement, as well as any derivative or variant of these elements
and any synthetic sequence that has the same functional capability.
In one embodiment, the intracellular domain of the CAR comprises
dual signaling domains. The dual signaling domains may include a
fragment or domain from any of the molecules described herein.
[0282] Examples of the intracellular domain include a fragment or
domain from one or more molecules or receptors including, but are
not limited to, TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon,
CD86, common FcR gamma, FcR beta (Fc Epsilon Rib), CD79a, CD79b,
Fcgamma RIIa, DAP10, DAP12, T cell receptor (TCR), CD27, CD28,
4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte
function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C,
B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1,
GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160,
CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha,
ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD,
CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX,
CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE/RANKL,
DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1,
CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69,
SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8),
SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, NKp44, NKp30,
NKp46, NKG2D, other co-stimulatory molecules described herein, any
derivative, variant, or fragment thereof, any synthetic sequence of
a co-stimulatory molecule that has the same functional capability,
and any combination thereof.
[0283] In one embodiment, the intracellular domain of the CAR
includes any portion of a co-stimulatory molecule, such as at least
one signaling domain from CD3, CD27, CD28, ICOS, 4-1BB, PD-1, T
cell receptor (TCR), any derivative or variant thereof, any
synthetic sequence thereof that has the same functional capability,
and any combination thereof.
[0284] Between the antigen binding domain and the transmembrane
domain of the CAR, or between the intracellular domain and the
transmembrane domain of the CAR, a spacer domain may be
incorporated. As used herein, the term "spacer domain" generally
means any oligo- or polypeptide that functions to link the
transmembrane domain to, either the antigen binding domain or, the
intracellular domain in the polypeptide chain. In one embodiment,
the spacer domain may comprise up to 300 amino acids, preferably 10
to 100 amino acids and most preferably 25 to 50 amino acids. In
another embodiment, a short oligo- or polypeptide linker,
preferably between 2 and 10 amino acids in length may form the
linkage between the transmembrane domain and the intracellular
domain of the CAR. An example of a linker includes a glycine-serine
doublet.
Human Antibodies
[0285] It may be preferable to use human antibodies or fragments
thereof when using bispecific antibodies or the antigen binding
domains of a CAR. Completely human antibodies are particularly
desirable for therapeutic treatment of human subjects. Human
antibodies can be made by a variety of methods known in the art
including phage display methods using antibody libraries derived
from human immunoglobulin sequences, including improvements to
these techniques. See, also, U.S. Pat. Nos. 4,444,887 and
4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO
98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741;
each of which is incorporated herein by reference in its entirety.
The bispecific antibody can also include an antibody wherein the
heavy and light chains are encoded by a nucleotide sequence derived
from one or more sources of human DNA.
[0286] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. For example, it has been described that the
homozygous deletion of the antibody heavy chain joining region (JH)
gene in chimeric and germ-line mutant mice results in complete
inhibition of endogenous antibody production. The modified
embryonic stem cells are expanded and microinjected into
blastocysts to produce chimeric mice. The chimeric mice are then
bred to produce homozygous offspring which express human
antibodies. The transgenic mice are immunized in the normal fashion
with a selected antigen, e.g., all or a portion of a polypeptide of
the invention. Antibodies directed against the target of choice can
be obtained from the immunized, transgenic mice using conventional
hybridoma technology. The human immunoglobulin transgenes harbored
by the transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies, including, but not limited
to, IgG1 (gamma 1) and IgG3. For an overview of this technology for
producing human antibodies, see, Lonberg and Huszar (Int. Rev.
Immunol., 13:65-93 (1995)). For a detailed discussion of this
technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT Publication Nos. WO 98/24893, WO 96/34096, and WO 96/33735; and
U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825;
5,661,016; 5,545,806; 5,814,318; and 5,939,598, each of which is
incorporated by reference herein in their entirety. In addition,
companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm
(San Jose, Calif.) can be engaged to provide human antibodies
directed against a selected antigen using technology similar to
that described above. For a specific discussion of transfer of a
human germ-line immunoglobulin gene array in germ-line mutant mice
that will result in the production of human antibodies upon antigen
challenge see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA,
90:2551 (1993); Jakobovits et al., Nature, 362:255-258 (1993);
Bruggermann et al., Year in Immunol., 7:33 (1993); and Duchosal et
al., Nature, 355:258 (1992).
[0287] Human antibodies can also be derived from phage-display
libraries (Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks
et al., J. Mol. Biol., 222:581-597 (1991); Vaughan et al., Nature
Biotech., 14:309 (1996)). Phage display technology (McCafferty et
al., Nature, 348:552-553 (1990)) can be used to produce human
antibodies and antibody fragments in vitro, from immunoglobulin
variable (V) domain gene repertoires from unimmunized donors.
According to this technique, antibody V domain genes are cloned
in-frame into either a major or minor coat protein gene of a
filamentous bacteriophage, such as M13 or fd, and displayed as
functional antibody fragments on the surface of the phage particle.
Because the filamentous particle contains a single-stranded DNA
copy of the phage genome, selections based on the functional
properties of the antibody also result in selection of the gene
encoding the antibody exhibiting those properties. Thus, the phage
mimics some of the properties of the B cell. Phage display can be
performed in a variety of formats; for their review see, e.g.,
Johnson, Kevin S, and Chiswell, David J., Current Opinion in
Structural Biology 3:564-571 (1993). Several sources of V-gene
segments can be used for phage display. Clackson et al., Nature,
352:624-628 (1991) isolated a diverse array of anti-oxazolone
antibodies from a small random combinatorial library of V genes
derived from the spleens of unimmunized mice. A repertoire of V
genes from unimmunized human donors can be constructed and
antibodies to a diverse array of antigens (including self-antigens)
can be isolated essentially following the techniques described by
Marks et al., J. Mol. Biol., 222:581-597 (1991), or Griffith et
al., EMBO J., 12:725-734 (1993). See, also, U.S. Pat. Nos.
5,565,332 and 5,573,905, each of which is incorporated herein by
reference in its entirety.
[0288] Human antibodies may also be generated by in vitro activated
B cells (see, U.S. Pat. Nos. 5,567,610 and 5,229,275, each of which
is incorporated herein by reference in its entirety). Human
antibodies may also be generated in vitro using hybridoma
techniques such as, but not limited to, that described by Roder et
al. (Methods Enzymol., 121:140-167 (1986)).
Humanized Antibodies
[0289] Alternatively, in some embodiments, a non-human antibody can
be humanized, where specific sequences or regions of the antibody
are modified to increase similarity to an antibody naturally
produced in a human. For instance, in the present invention, the
antibody or fragment thereof may comprise a non-human mammalian
scFv. In one embodiment, the antigen binding domain portion is
humanized.
[0290] A humanized antibody can be produced using a variety of
techniques known in the art, including but not limited to,
CDR-grafting (see, e.g., European Patent No. EP 239,400;
International Publication No. WO 91/09967; and U.S. Pat. Nos.
5,225,539, 5,530,101, and 5,585,089, each of which is incorporated
herein in its entirety by reference), veneering or resurfacing
(see, e.g., European Patent Nos. EP 592,106 and EP 519,596; Padlan,
1991, Molecular Immunology, 28(4/5):489-498; Studnicka et al.,
1994, Protein Engineering, 7(6):805-814; and Roguska et al., 1994,
PNAS, 91:969-973, each of which is incorporated herein by its
entirety by reference), chain shuffling (see, e.g., U.S. Pat. No.
5,565,332, which is incorporated herein in its entirety by
reference), and techniques disclosed in, e.g., U.S. Patent
Application Publication No. US2005/0042664, U.S. Patent Application
Publication No. US2005/0048617, U.S. Pat. No. 6,407,213, U.S. Pat.
No. 5,766,886, International Publication No. WO 9317105, Tan et
al., J. Immunol., 169:1119-25 (2002), Caldas et al., Protein Eng.,
13(5):353-60 (2000), Morea et al., Methods, 20(3):267-79 (2000),
Baca et al., J. Biol. Chem., 272(16):10678-84 (1997), Roguska et
al., Protein Eng., 9(10):895-904 (1996), Couto et al., Cancer Res.,
55 (23 Supp):5973s-5977s (1995), Couto et al., Cancer Res.,
55(8):1717-22 (1995), Sandhu J S, Gene, 150(2):409-10 (1994), and
Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994), each of which
is incorporated herein in its entirety by reference. Often,
framework residues in the framework regions will be substituted
with the corresponding residue from the CDR donor antibody to
alter, preferably improve, antigen binding. These framework
substitutions are identified by methods well-known in the art,
e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; and Riechmann et al., 1988, Nature, 332:323,
which are incorporated herein by reference in their
entireties.)
[0291] A humanized antibody has one or more amino acid residues
introduced into it from a source which is nonhuman. These nonhuman
amino acid residues are often referred to as "import" residues,
which are typically taken from an "import" variable domain. Thus,
humanized antibodies comprise one or more CDRs from nonhuman
immunoglobulin molecules and framework regions from human.
Humanization of antibodies is well-known in the art and can
essentially be performed following the method of Winter and
co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et
al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences
for the corresponding sequences of a human antibody, i.e.,
CDR-grafting (EP 239,400; PCT Publication No. WO 91/09967; and U.S.
Pat. Nos. 4,816,567; 6,331,415; 5,225,539; 5,530,101; 5,585,089;
6,548,640, the contents of which are incorporated herein by
reference herein in their entirety). In such humanized chimeric
antibodies, substantially less than an intact human variable domain
has been substituted by the corresponding sequence from a nonhuman
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some framework
(FR) residues are substituted by residues from analogous sites in
rodent antibodies. Humanization of antibodies can also be achieved
by veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991,
Molecular Immunology, 28(4/5):489-498; Studnicka et al., Protein
Engineering, 7(6):805-814 (1994); and Roguska et al., PNAS,
91:969-973 (1994)) or chain shuffling (U.S. Pat. No. 5,565,332),
the contents of which are incorporated herein by reference herein
in their entirety.
[0292] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is to reduce
antigenicity. According to the so-called "best-fit" method, the
sequence of the variable domain of a rodent antibody is screened
against the entire library of known human variable-domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human framework (FR) for the
humanized antibody (Sims et al., J. Immunol., 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of
which are incorporated herein by reference herein in their
entirety). Another method uses a particular framework derived from
the consensus sequence of all human antibodies of a particular
subgroup of light or heavy chains. The same framework may be used
for several different humanized antibodies (Carter et al., Proc.
Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol.,
151:2623 (1993), the contents of which are incorporated herein by
reference herein in their entirety).
[0293] Antibodies can be humanized with retention of high affinity
for the target antigen and other favorable biological properties.
According to one aspect of the invention, humanized antibodies are
prepared by a process of analysis of the parental sequences and
various conceptual humanized products using three-dimensional
models of the parental and humanized sequences. Three-dimensional
immunoglobulin models are commonly available and are familiar to
those skilled in the art. Computer programs are available which
illustrate and display probable three-dimensional conformational
structures of selected candidate immunoglobulin sequences.
Inspection of these displays permits analysis of the likely role of
the residues in the functioning of the candidate immunoglobulin
sequence, i.e., the analysis of residues that influence the ability
of the candidate immunoglobulin to bind the target antigen. In this
way, FR residues can be selected and combined from the recipient
and import sequences so that the desired antibody characteristic,
such as increased affinity for the target antigen, is achieved. In
general, the CDR residues are directly and most substantially
involved in influencing antigen binding.
[0294] A humanized antibody retains a similar antigenic specificity
as the original antibody. However, using certain methods of
humanization, the affinity and/or specificity of binding of the
antibody to the target antigen may be increased using methods of
"directed evolution," as described by Wu et al., J. Mol. Biol.,
294:151 (1999), the contents of which are incorporated herein by
reference herein in their entirety.
Other Molecules
[0295] The present invention also includes the modified T cell
described herein further comprising a co-stimulatory molecule or a
nucleic acid encoding the co-stimulatory molecule. In one
embodiment, the modified T cell of the invention further includes
an exogenous nucleic acid encoding a co-stimulatory molecule, such
that the modified T cell expresses the co-stimulatory molecule. The
nucleic acid may be introduced into the T cell by transducing the T
cell, transfecting the T cell, or electroporating the T cell. In
another embodiment, the co-stimulatory molecule is selected from
CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. In
another embodiment, the so-stimulatory molecule includes CD3 and
comprises at least two different CD3 chains, such as CD3 zeta and
CD3 epsilon chains.
[0296] In another embodiment, the modified T cell further comprises
Klf4, Oct3/4, and/or Sox2 or a nucleic acid encoding Klf4, Oct3/4,
and/or Sox2 to induce pluripotency of the T cell. The T cell can be
induced to pluripotency by expressing Klf4, Oct3/4 and Sox2. Klf4,
Oct3/4 and Sox2 may be expressed from a nucleic acid, viral
vector(s) or RNA molecule(s). In one embodiment, a viral vector
encoding for Klf4, Oct3/4 and Sox2 is introduced into the T cell to
induce pluripotency. In another embodiment, a Sendai viral vector
is introduced into the T cells to induce pluripotency, wherein the
Sendai viral vector encodes Klf4 Oct3/4 and Sox2.
Introduction of Nucleic Acids
[0297] Methods of introducing nucleic acids into a cell include
physical, biological and chemical methods. Physical methods for
introducing a polynucleotide, such as RNA, into a host cell include
calcium phosphate precipitation, lipofection, particle bombardment,
microinjection, electroporation, and the like. RNA can be
introduced into target cells using commercially available methods
which include electroporation (Amaxa Nucleofector-II (Amaxa
Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard
Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver,
Colo.), Multiporator (Eppendort, Hamburg Germany). RNA can also be
introduced into cells using cationic liposome mediated transfection
using lipofection, using polymer encapsulation, using peptide
mediated transfection, or using biolistic particle delivery systems
such as "gene guns" (see, for example, Nishikawa, et al. Hum Gene
Ther., 12(8):861-70 (2001).
[0298] Biological methods for introducing a polynucleotide of
interest into a host cell include the use of DNA and RNA vectors.
Viral vectors, and especially retroviral vectors, have become the
most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from lentivirus,
poxviruses, herpes simplex virus I, adenoviruses and
adeno-associated viruses, and the like. See, for example, U.S. Pat.
Nos. 5,350,674 and 5,585,362.
[0299] Chemical means for introducing a polynucleotide into a host
cell include colloidal dispersion systems, such as macromolecule
complexes, nanocapsules, microspheres, beads, and lipid-based
systems including oil-in-water emulsions, micelles, mixed micelles,
and liposomes. An exemplary colloidal system for use as a delivery
vehicle in vitro and in vivo is a liposome (e.g., an artificial
membrane vesicle).
[0300] Lipids suitable for use can be obtained from commercial
sources. For example, dimyristyl phosphatidylcholine ("DMPC") can
be obtained from Sigma, St. Louis, Mo.; dicetyl phosphate ("DCP")
can be obtained from K & K Laboratories (Plainview, N.Y.);
cholesterol ("Choi") can be obtained from Calbiochem-Behring;
dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be
obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock
solutions of lipids in chloroform or chloroform/methanol can be
stored at about -20.degree. C. Chloroform is used as the only
solvent since it is more readily evaporated than methanol.
"Liposome" is a generic term encompassing a variety of single and
multilamellar lipid vehicles formed by the generation of enclosed
lipid bilayers or aggregates. Liposomes can be characterized as
having vesicular structures with a phospholipid bilayer membrane
and an inner aqueous medium. Multilamellar liposomes have multiple
lipid layers separated by aqueous medium. They form spontaneously
when phospholipids are suspended in an excess of aqueous solution.
The lipid components undergo self-rearrangement before the
formation of closed structures and entrap water and dissolved
solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology
5: 505-10). However, compositions that have different structures in
solution than the normal vesicular structure are also encompassed.
For example, the lipids may assume a micellar structure or merely
exist as nonuniform aggregates of lipid molecules. Also
contemplated are lipofectamine-nucleic acid complexes.
[0301] Regardless of the method used to introduce exogenous nucleic
acids into a host cell or otherwise expose a cell to the inhibitor
of the present invention, in order to confirm the presence of the
nucleic acids in the host cell, a variety of assays may be
performed. Such assays include, for example, "molecular biological"
assays well known to those of skill in the art, such as Southern
and Northern blotting, RT-PCR and PCR; "biochemical" assays, such
as detecting the presence or absence of a particular peptide, e.g.,
by immunological means (ELISAs and Western blots) or by assays
described herein to identify agents falling within the scope of the
invention.
[0302] In one embodiment, a nucleic acid encoding a T cell receptor
(TCR) comprising affinity for a surface antigen on a target cell is
introduced into the expanded T cells. The nucleic acid encoding the
TCR may be the same or separate nucleic acid that is capable of
downregulating endogenous TCR gene expression. The nucleic acid
encoding the TCR may be introduced into the T cell at the same time
or sequentially with the nucleic acid capable of downregulating
endogenous TCR gene expression. In one embodiment, the nucleic acid
encoding the TCR is introduced prior to the nucleic acid capable of
downregulating endogenous TCR gene expression.
[0303] Moreover, the nucleic acids may be introduced by any means,
such as transducing the expanded T cells, transfecting the expanded
T cells, and electroporating the expanded T cells. One nucleic acid
may be introduced by one method and another nucleic acid may be
introduced into the T cell by a different method.
[0304] RNA
[0305] In one embodiment, the nucleic acids introduced into the T
cell are RNA. In another embodiment, the RNA is mRNA that comprises
in vitro transcribed RNA or synthetic RNA. The RNA is produced by
in vitro transcription using a polymerase chain reaction
(PCR)-generated template. DNA of interest from any source can be
directly converted by PCR into a template for in vitro mRNA
synthesis using appropriate primers and RNA polymerase. The source
of the DNA can be, for example, genomic DNA, plasmid DNA, phage
DNA, cDNA, synthetic DNA sequence or any other appropriate source
of DNA. The desired template for in vitro transcription is a
chimeric membrane protein. By way of example, the template encodes
an antibody, a fragment of an antibody or a portion of an antibody.
By way of another example, the template comprises an extracellular
domain comprising a single chain variable domain of an antibody,
such as anti-CD3, and an intracellular domain of a co-stimulatory
molecule. In one embodiment, the template for the RNA chimeric
membrane protein encodes a chimeric membrane protein comprising an
extracellular domain comprising an antigen binding domain derived
from an antibody to a co-stimulatory molecule, and an intracellular
domain derived from a portion of an intracellular domain of CD28
and 4-1BB.
[0306] PCR can be used to generate a template for in vitro
transcription of mRNA which is then introduced into cells. Methods
for performing PCR are well known in the art. Primers for use in
PCR are designed to have regions that are substantially
complementary to regions of the DNA to be used as a template for
the PCR. "Substantially complementary", as used herein, refers to
sequences of nucleotides where a majority or all of the bases in
the primer sequence are complementary, or one or more bases are
non-complementary, or mismatched. Substantially complementary
sequences are able to anneal or hybridize with the intended DNA
target under annealing conditions used for PCR. The primers can be
designed to be substantially complementary to any portion of the
DNA template. For example, the primers can be designed to amplify
the portion of a gene that is normally transcribed in cells (the
open reading frame), including 5' and 3' UTRs. The primers can also
be designed to amplify a portion of a gene that encodes a
particular domain of interest. In one embodiment, the primers are
designed to amplify the coding region of a human cDNA, including
all or portions of the 5' and 3' UTRs. Primers useful for PCR are
generated by synthetic methods that are well known in the art.
"Forward primers" are primers that contain a region of nucleotides
that are substantially complementary to nucleotides on the DNA
template that are upstream of the DNA sequence that is to be
amplified. "Upstream" is used herein to refer to a location 5, to
the DNA sequence to be amplified relative to the coding strand.
"Reverse primers" are primers that contain a region of nucleotides
that are substantially complementary to a double-stranded DNA
template that are downstream of the DNA sequence that is to be
amplified. "Downstream" is used herein to refer to a location 3' to
the DNA sequence to be amplified relative to the coding strand.
[0307] Chemical structures that have the ability to promote
stability and/or translation efficiency of the RNA may also be
used. The RNA preferably has 5' and 3' UTRs. In one embodiment, the
5' UTR is between zero and 3000 nucleotides in length. The length
of 5' and 3' UTR sequences to be added to the coding region can be
altered by different methods, including, but not limited to,
designing primers for PCR that anneal to different regions of the
UTRs. Using this approach, one of ordinary skill in the art can
modify the 5' and 3' UTR lengths required to achieve optimal
translation efficiency following transfection of the transcribed
RNA.
[0308] The 5' and 3' UTRs can be the naturally occurring,
endogenous 5' and 3' UTRs for the gene of interest. Alternatively,
UTR sequences that are not endogenous to the gene of interest can
be added by incorporating the UTR sequences into the forward and
reverse primers or by any other modifications of the template. The
use of UTR sequences that are not endogenous to the gene of
interest can be useful for modifying the stability and/or
translation efficiency of the RNA. For example, it is known that
AU-rich elements in 3' UTR sequences can decrease the stability of
mRNA. Therefore, 3' UTRs can be selected or designed to increase
the stability of the transcribed RNA based on properties of UTRs
that are well known in the art.
[0309] In one embodiment, the 5' UTR can contain the Kozak sequence
of the endogenous gene. Alternatively, when a 5' UTR that is not
endogenous to the gene of interest is being added by PCR as
described above, a consensus Kozak sequence can be redesigned by
adding the 5' UTR sequence. Kozak sequences can increase the
efficiency of translation of some RNA transcripts, but does not
appear to be required for all RNAs to enable efficient translation.
The requirement for Kozak sequences for many mRNAs is known in the
art. In other embodiments the 5' UTR can be derived from an RNA
virus whose RNA genome is stable in cells. In other embodiments
various nucleotide analogues can be used in the 3' or 5' UTR to
impede exonuclease degradation of the mRNA.
[0310] To enable synthesis of RNA from a DNA template without the
need for gene cloning, a promoter of transcription should be
attached to the DNA template upstream of the sequence to be
transcribed. When a sequence that functions as a promoter for an
RNA polymerase is added to the 5' end of the forward primer, the
RNA polymerase promoter becomes incorporated into the PCR product
upstream of the open reading frame that is to be transcribed. In
one embodiment, the promoter is a T7 polymerase promoter, as
described elsewhere herein. Other useful promoters include, but are
not limited to, T3 and SP6 RNA polymerase promoters. Consensus
nucleotide sequences for T7, T3 and SP6 promoters are known in the
art.
[0311] In one embodiment, the mRNA has both a cap on the 5' end and
a 3' poly(A) tail which determine ribosome binding, initiation of
translation and stability mRNA in the cell. On a circular DNA
template, for instance, plasmid DNA, RNA polymerase produces a long
concatameric product which is not suitable for expression in
eukaryotic cells. The transcription of plasmid DNA linearized at
the end of the 3' UTR results in normal sized mRNA which is not
effective in eukaryotic transfection even if it is polyadenylated
after transcription.
[0312] On a linear DNA template, phage T7 RNA polymerase can extend
the 3' end of the transcript beyond the last base of the template
(Schenbom and Mierendorf, Nuc Acids Res., 13:6223-36 (1985);
Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65
(2003).
[0313] The conventional method of integration of polyA/T stretches
into a DNA template is molecular cloning. However polyA/T sequence
integrated into plasmid DNA can cause plasmid instability, which is
why plasmid DNA templates obtained from bacterial cells are often
highly contaminated with deletions and other aberrations. This
makes cloning procedures not only laborious and time consuming but
often not reliable. That is why a method which allows construction
of DNA templates with polyA/T 3' stretch without cloning highly
desirable.
[0314] The polyA/T segment of the transcriptional DNA template can
be produced during PCR by using a reverse primer containing a polyT
tail, such as 100T tail (size can be 50-5000 T), or after PCR by
any other method, including, but not limited to, DNA ligation or in
vitro recombination. Poly(A) tails also provide stability to RNAs
and reduce their degradation. Generally, the length of a poly(A)
tail positively correlates with the stability of the transcribed
RNA. In one embodiment, the poly(A) tail is between 100 and 5000
adenosines.
[0315] Poly(A) tails of RNAs can be further extended following in
vitro transcription with the use of a poly(A) polymerase, such as
E. coli polyA polymerase (E-PAP). In one embodiment, increasing the
length of a poly(A) tail from 100 nucleotides to between 300 and
400 nucleotides results in about a two-fold increase in the
translation efficiency of the RNA. Additionally, the attachment of
different chemical groups to the 3' end can increase mRNA
stability. Such attachment can contain modified/artificial
nucleotides, aptamers and other compounds. For example, ATP analogs
can be incorporated into the poly(A) tail using poly(A) polymerase.
ATP analogs can further increase the stability of the RNA.
[0316] 5' caps also provide stability to RNA molecules. In a
preferred embodiment, RNAs produced by the methods disclosed herein
include a 5' cap. The 5' cap is provided using techniques known in
the art and described herein (Cougot, et al., Trends in Biochem.
Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001);
Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966
(2005)).
[0317] The RNAs produced by the methods disclosed herein can also
contain an internal ribosome entry site (IRES) sequence. The IRES
sequence may be any viral, chromosomal or artificially designed
sequence which initiates cap-independent ribosome binding to mRNA
and facilitates the initiation of translation. Any solutes suitable
for cell electroporation, which can contain factors facilitating
cellular permeability and viability such as sugars, peptides,
lipids, proteins, antioxidants, and surfactants can be
included.
[0318] RNA Transfection
[0319] In some embodiments, the RNA encoding a TCR is
electroporated into the cells. In one embodiment, the RNA encoding
the TCR is in vitro transcribed RNA.
[0320] The disclosed methods can be applied to the modulation of T
cell activity in basic research and therapy, in the fields of
cancer, stem cells, acute and chronic infections, and autoimmune
diseases, including the assessment of the ability of the
genetically modified T cell to kill a target cancer cell.
[0321] The methods also provide the ability to control the level of
expression over a wide range by changing, for example, the promoter
or the amount of input RNA, making it possible to individually
regulate the expression level. Furthermore, the PCR-based technique
of mRNA production greatly facilitates the design of the mRNAs with
different structures and combination of their domains.
[0322] One advantage of RNA transfection methods of the invention
is that RNA transfection is essentially transient and a
vector-free. A RNA transgene can be delivered to a lymphocyte and
expressed therein following a brief in vitro cell activation, as a
minimal expressing cassette without the need for any additional
viral sequences. Under these conditions, integration of the
transgene into the host cell genome is unlikely. Cloning of cells
is not necessary because of the efficiency of transfection of the
RNA and its ability to uniformly modify the entire lymphocyte
population.
[0323] Genetic modification of T cells with in vitro-transcribed
RNA (IVT-RNA) makes use of two different strategies both of which
have been successively tested in various animal models. Cells are
transfected with in vitro-transcribed RNA by means of lipofection
or electroporation. It is desirable to stabilize IVT-RNA using
various modifications in order to achieve prolonged expression of
transferred IVT-RNA.
[0324] Some IVT vectors are known in the literature which are
utilized in a standardized manner as template for in vitro
transcription and which have been genetically modified in such a
way that stabilized RNA transcripts are produced. Currently
protocols used in the art are based on a plasmid vector with the
following structure: a 5' RNA polymerase promoter enabling RNA
transcription, followed by a gene of interest which is flanked
either 3' and/or 5' by untranslated regions (UTR), and a 3'
polyadenyl cassette containing 50-70 A nucleotides. Prior to in
vitro transcription, the circular plasmid is linearized downstream
of the polyadenyl cassette by type II restriction enzymes
(recognition sequence corresponds to cleavage site). The polyadenyl
cassette thus corresponds to the later poly(A) sequence in the
transcript. As a result of this procedure, some nucleotides remain
as part of the enzyme cleavage site after linearization and extend
or mask the poly(A) sequence at the 3' end. It is not clear,
whether this nonphysiological overhang affects the amount of
protein produced intracellularly from such a construct.
[0325] RNA has several advantages over more traditional plasmid or
viral approaches. Gene expression from an RNA source does not
require transcription and the protein product is produced rapidly
after the transfection. Further, since the RNA has to only gain
access to the cytoplasm, rather than the nucleus, and therefore
typical transfection methods result in an extremely high rate of
transfection. In addition, plasmid based approaches require that
the promoter driving the expression of the gene of interest be
active in the cells under study.
[0326] In another aspect, the RNA construct is delivered into the
cells by electroporation. See, e.g., the formulations and
methodology of electroporation of nucleic acid constructs into
mammalian cells as taught in US 2004/0014645, US 2005/0052630A1, US
2005/0070841A1, US 2004/0059285A1, US 2004/0092907A1. The various
parameters including electric field strength required for
electroporation of any known cell type are generally known in the
relevant research literature as well as numerous patents and
applications in the field. See e.g., U.S. Pat. No. 6,678,556, U.S.
Pat. No. 7,171,264, and U.S. Pat. No. 7,173,116. Apparatus for
therapeutic application of electroporation are available
commercially, e.g., the MedPulser.TM. DNA Electroporation Therapy
System (Inovio/Genetronics, San Diego, Calif.), and are described
in patents such as U.S. Pat. No. 6,567,694; U.S. Pat. No.
6,516,223, U.S. Pat. No. 5,993,434, U.S. Pat. No. 6,181,964, U.S.
Pat. No. 6,241,701, and U.S. Pat. No. 6,233,482; electroporation
may also be used for transfection of cells in vitro as described
e.g. in US20070128708A1. Electroporation may also be utilized to
deliver nucleic acids into cells in vitro. Accordingly,
electroporation-mediated administration into cells of nucleic acids
including expression constructs utilizing any of the many available
devices and electroporation systems known to those of skill in the
art presents an exciting new means for delivering an RNA of
interest to a target cell.
[0327] In one embodiment, the method includes electroporating a RNA
encoding a TCR alpha and beta chain. The TCR alpha and beta chain
can be encoded on the same or separate RNAs. When the alpha and
beta are encoded by separate RNAs, the RNA may be
co-electroporated.
[0328] In another embodiment, the method may further include
electroporating a nucleic acid encoding a costimulatory molecule.
The costimulatory molecule nucleic acid may be co-electroporated
with the TCR RNA.
Sources of T Cells
[0329] Prior to expansion, a source of T cells is obtained from a
subject. Non-limiting examples of subjects include humans, dogs,
cats, mice, rats, and transgenic species thereof. Preferably, the
subject is a human. T cells can be obtained from a number of
sources, including peripheral blood mononuclear cells, bone marrow,
lymph node tissue, spleen tissue, umbilical cord, and tumors. In
certain embodiments, any number of T cell lines available in the
art, may be used. In certain embodiments, T cells can be obtained
from a unit of blood collected from a subject using any number of
techniques known to the skilled artisan, such as Ficoll separation.
In one embodiment, cells from the circulating blood of an
individual are obtained by apheresis or leukapheresis. The
apheresis product typically contains lymphocytes, including T
cells, monocytes, granulocytes, B cells, other nucleated white
blood cells, red blood cells, and platelets. The cells collected by
apheresis may be washed to remove the plasma fraction and to place
the cells in an appropriate buffer or media, such as phosphate
buffered saline (PBS) or wash solution lacks calcium and may lack
magnesium or may lack many if not all divalent cations, for
subsequent processing steps. After washing, the cells may be
resuspended in a variety of biocompatible buffers, such as, for
example, Ca-free, Mg-free PBS. Alternatively, the undesirable
components of the apheresis sample may be removed and the cells
directly resuspended in culture media.
[0330] In another embodiment, T cells are isolated from peripheral
blood by lysing the red blood cells and depleting the monocytes,
for example, by centrifugation through a PERCOLL.TM. gradient.
Alternatively, T cells can be isolated from umbilical cord. In any
event, a specific subpopulation of T cells can be further isolated
by positive or negative selection techniques.
[0331] The cord blood mononuclear cells so isolated can be depleted
of cells expressing certain antigens, including, but not limited
to, CD34, CD8, CD14, CD19 and CD56. Depletion of these cells can be
accomplished using an isolated antibody, a biological sample
comprising an antibody, such as ascites, an antibody bound to a
physical support, and a cell bound antibody.
[0332] Enrichment of a T cell population by negative selection can
be accomplished using a combination of antibodies directed to
surface markers unique to the negatively selected cells. A
preferred method is cell sorting and/or selection via negative
magnetic immunoadherence or flow cytometry that uses a cocktail of
monoclonal antibodies directed to cell surface markers present on
the cells negatively selected. For example, to enrich for CD4+
cells by negative selection, a monoclonal antibody cocktail
typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR,
and CD8.
[0333] For isolation of a desired population of cells by positive
or negative selection, the concentration of cells and surface
(e.g., particles such as beads) can be varied. In certain
embodiments, it may be desirable to significantly decrease the
volume in which beads and cells are mixed together (i.e., increase
the concentration of cells), to ensure maximum contact of cells and
beads. For example, in one embodiment, a concentration of 2 billion
cells/ml is used. In one embodiment, a concentration of 1 billion
cells/ml is used. In a further embodiment, greater than 100 million
cells/ml is used. In a further embodiment, a concentration of cells
of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used.
In yet another embodiment, a concentration of cells from 75, 80,
85, 90, 95, or 100 million cells/ml is used. In further
embodiments, concentrations of 125 or 150 million cells/ml can be
used. Using high concentrations can result in increased cell yield,
cell activation, and cell expansion.
[0334] T cells can also be frozen after the washing step, which
does not require the monocyte-removal step. While not wishing to be
bound by theory, the freeze and subsequent thaw step provides a
more uniform product by removing granulocytes and to some extent
monocytes in the cell population. After the washing step that
removes plasma and platelets, the cells may be suspended in a
freezing solution. While many freezing solutions and parameters are
known in the art and will be useful in this context, in a
non-limiting example, one method involves using PBS containing 20%
DMSO and 8% human serum albumin, or other suitable cell freezing
media. The cells are then frozen to -80.degree. C. at a rate of 1
per minute and stored in the vapor phase of a liquid nitrogen
storage tank. Other methods of controlled freezing may be used as
well as uncontrolled freezing immediately at -20.degree. C. or in
liquid nitrogen.
[0335] In one embodiment, the population of T cells is comprised
within cells such as peripheral blood mononuclear cells, cord blood
cells, a purified population of T cells, and a T cell line. In
another embodiment, peripheral blood mononuclear cells comprise the
population of T cells. In yet another embodiment, purified T cells
comprise the population of T cells.
Chimeric Membrane Protein
[0336] Generally, T cells are expanded by contact with a surface
having attached thereto an agent that stimulates a CD3/TCR complex
associated signal and a ligand that stimulates a co-stimulatory
molecule on the surface of the T cells. The present invention
comprises a novel method of expanding a population of T cells
comprising electroporating the T cells with RNA encoding a chimeric
membrane protein and culturing the electroporated T cells, wherein
the electroporated T cells within the population expand at least 10
fold. The chimeric membrane protein of the invention comprises an
extracellular and intracellular domain. The extracellular domain
comprises a target-specific binding element, such as an antibody.
In one embodiment, the chimeric membrane protein comprises a single
chain variable fragment (scFv) against CD3 and an intracellular
domain derived from a portion of an intracellular domain of CD28
and 4-1BB.
[0337] Expression of the chimeric membrane protein allows
interaction with other cells in the population, such as cells that
express CD3, to stimulate and activate expansion of the
electroporated T cells. Not wishing to be held to any particular
theory, the cells that express CD3 may come into contact and bind
with the chimeric membrane protein that is expressed on the surface
of the electroporated T cells. At least one T cell expressing the
chimeric membrane protein interacts with another cell expressing
CD3. This interaction stimulates expansion of the electroporated T
cells.
[0338] In one embodiment, the T cells are expanded prior to
downregulation of an endogenous gene. In another embodiment, the
modified T cells are expanded.
[0339] Extracellular Domain
[0340] The present invention includes an extracellular domain
comprising an antigen binding domain derived from an antibody
directed against a co-stimulatory molecule. The co-stimulatory
molecule can include any molecule that co-stimulates T cells, such
as, but not limited to, CD3, CD28, or a combination thereof. In one
embodiment, the extracellular domain can include an antigen binding
domain derived from anti-CD3, anti-CD28, or a combination thereof.
In another embodiment, the extracellular domain comprises a single
chain variable fragment (scFv) against CD3.
[0341] In another embodiment, the extracellular domain can include
any portion of an antibody that binds to antigen including, but not
limited to, the antigen binding domain of a synthetic antibody,
human antibody, humanized antibody, single domain antibody, single
chain variable fragments, and fragments thereof. In some instances,
it is beneficial for the extracellular domain to be derived from
the same species in which the chimeric membrane protein will
ultimately be used in. For example, for use in humans, it may be
beneficial for the extracellular domain of the chimeric membrane
protein to comprise a human antibody or fragment thereof. Thus, in
one embodiment, the extracellular domain portion comprises a human
antibody or a fragment thereof as described elsewhere herein.
Alternatively, in some embodiments, the extracellular domain
portion comprises a non-human antibody that is humanized as
described elsewhere herein.
[0342] Intracellular Domain
[0343] The intracellular domain or cytoplasmic domain comprises a
costimulatory signaling region. The costimulatory signaling region
refers to an intracellular domain of a costimulatory molecule.
Costimulatory molecules are cell surface molecules other than
antigen receptors or their ligands that are required for an
efficient response of lymphocytes to antigen.
[0344] The cytoplasmic domain or the intracellular signaling domain
of the chimeric membrane protein is responsible for activation of
at least one of effector functions of the T cell. While usually the
entire intracellular signaling domain can be employed, in many
cases it is not necessary to use the entire chain. To the extent
that a truncated portion of the intracellular signaling domain is
used, such truncated portion may be used in place of the intact
chain as long as it transduces the effector function signal. The
intracellular signaling domain includes any truncated portion of
the intracellular signaling domain sufficient to transduce the
effector function signal.
[0345] Nonlimiting examples of intracellular signaling domains for
use in the chimeric membrane protein include any portion of the
intracellular domain of CD28, 4-1BB, T cell receptor (TCR),
co-stimulatory molecules, any derivative or variant of these
sequences, any synthetic sequence that has the same functional
capability, and any combination thereof. In one embodiment, the
intracellular domain comprises a portion of an intracellular domain
of CD28 and 4-1BB.
[0346] Other Domains of the Chimeric Membrane Protein
[0347] Between the extracellular domain and the transmembrane
domain of the chimeric membrane protein, or between the cytoplasmic
domain and the transmembrane domain of the chimeric membrane
protein, there may be incorporated a spacer domain, such as an
oligo- or polypeptide that functions to link the transmembrane
domain to, either the extracellular domain or, the cytoplasmic
domain in the polypeptide chain. The spacer domain may comprise up
to 300 amino acids, preferably 10 to 100 amino acids and most
preferably 25 to 50 amino acids.
[0348] In some embodiments, the chimeric membrane protein further
comprises a transmembrane domain. In some embodiment, the chimeric
membrane protein further comprises a hinge domain. In one
embodiment, the RNA encoding the chimeric membrane protein further
comprises a transmembrane and hinge domain, such as a CD28
transmembrane domain and a CD8-alpha hinge domain.
[0349] Expansion of T Cells
[0350] As demonstrated by the data disclosed herein, expanding the
T cells by the methods disclosed herein can be multiplied by about
10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80
fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold,
600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000
fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000
fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold,
or greater, and any and all whole or partial intergers
therebetween. In one embodiment, the T cells expand in the range of
about 20 fold to about 50 fold.
[0351] Following culturing, the T cells can be incubated in cell
medium in a culture apparatus for a period of time or until the
cells reach confluency or high cell density for optimal passage
before passing the cells to another culture apparatus. The
culturing apparatus can be of any culture apparatus commonly used
for culturing cells in vitro. Preferably, the level of confluence
is 70% or greater before passing the cells to another culture
apparatus. More preferably, the level of confluence is 90% or
greater. A period of time can be any time suitable for the culture
of cells in vitro. The T cell medium may be replaced during the
culture of the T cells at any time. Preferably, the T cell medium
is replaced about every 2 to 3 days. The T cells are then harvested
from the culture apparatus whereupon the T cells can be used
immediately or cryopreserved to be stored for use at a later time.
In one embodiment, the invention includes cryopreserving the
expanded T cells. The cryopreserved T cells are thawed prior to
introducing nucleic acids into the T cell.
[0352] In another embodiment, the method comprises isolating T
cells and expanding the T cells. In another embodiment, the
invention further comprises cryopreserving the T cells prior to
expansion. In yet another embodiment, the cryopreserved T cells are
thawed for electroporation with the RNA encoding the chimeric
membrane protein.
[0353] Another procedure for ex vivo expansion cells is described
in U.S. Pat. No. 5,199,942 (incorporated herein by reference).
Expansion, such as described in U.S. Pat. No. 5,199,942 can be an
alternative or in addition to other methods of expansion described
herein. Briefly, ex vivo culture and expansion of T cells comprises
the addition to the cellular growth factors, such as those
described in U.S. Pat. No. 5,199,942, or other factors, such as
flt3-L, IL-1, IL-3 and c-kit ligand. In one embodiment, expanding
the T cells comprises culturing the T cells with a factor selected
from the group consisting of flt3-L, IL-1, IL-3 and c-kit
ligand.
[0354] The culturing step as described herein (contact with agents
as described herein or after electroporation) can be very short,
for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours.
The culturing step as described further herein (contact with agents
as described herein) can be longer, for example 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, or more days.
[0355] Various terms are used to describe cells in culture. Cell
culture refers generally to cells taken from a living organism and
grown under controlled condition. A primary cell culture is a
culture of cells, tissues or organs taken directly from an organism
and before the first subculture. Cells are expanded in culture when
they are placed in a growth medium under conditions that facilitate
cell growth and/or division, resulting in a larger population of
the cells. When cells are expanded in culture, the rate of cell
proliferation is typically measured by the amount of time required
for the cells to double in number, otherwise known as the doubling
time.
[0356] Each round of subculturing is referred to as a passage. When
cells are subcultured, they are referred to as having been
passaged. A specific population of cells, or a cell line, is
sometimes referred to or characterized by the number of times it
has been passaged. For example, a cultured cell population that has
been passaged ten times may be referred to as a P10 culture. The
primary culture, i.e., the first culture following the isolation of
cells from tissue, is designated P0. Following the first
subculture, the cells are described as a secondary culture (P1 or
passage 1). After the second subculture, the cells become a
tertiary culture (P2 or passage 2), and so on. It will be
understood by those of skill in the art that there may be many
population doublings during the period of passaging; therefore the
number of population doublings of a culture is greater than the
passage number. The expansion of cells (i.e., the number of
population doublings) during the period between passaging depends
on many factors, including but is not limited to the seeding
density, substrate, medium, and time between passaging.
[0357] In one embodiment, the cells may be cultured for several
hours (about 3 hours) to about 14 days or any hourly integer value
in between. Conditions appropriate for T cell culture include an
appropriate media (e.g., Minimal Essential Media or RPMI Media 1640
or, X-vivo 15, (Lonza)) that may contain factors necessary for
proliferation and viability, including serum (e.g., fetal bovine or
human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7,
GM-CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-.alpha.. or any
other additives for the growth of cells known to the skilled
artisan. Other additives for the growth of cells include, but are
not limited to, surfactant, plasmanate, and reducing agents such as
N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI
1640, AIM-V, DMEM, MEM, .alpha.-MEM, F-12, X-Vivo 15, and X-Vivo
20, Optimizer, with added amino acids, sodium pyruvate, and
vitamins, either serum-free or supplemented with an appropriate
amount of serum (or plasma) or a defined set of hormones, and/or an
amount of cytokine(s) sufficient for the growth and expansion of T
cells. Antibiotics, e.g., penicillin and streptomycin, are included
only in experimental cultures, not in cultures of cells that are to
be infused into a subject. The target cells are maintained under
conditions necessary to support growth, for example, an appropriate
temperature (e.g., 37.degree. C.) and atmosphere (e.g., air plus 5%
CO.sub.2).
[0358] The medium used to culture the T cells may include an agent
that can co-stimulate the T cells. For example, an agent that can
stimulate CD3 is an antibody to CD3, and an agent that can
stimulate CD28 is an antibody to CD28. This is because, as
demonstrated by the data disclosed herein, a cell isolated by the
methods disclosed herein can be expanded approximately 10 fold, 20
fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90
fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold,
700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000
fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000
fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater. In
one embodiment, the T cells expand in the range of about 20 fold to
about 50 fold, or more by culturing the electroporated
population.
[0359] In one embodiment, the method includes introducing a nucleic
acid encoding a T cell receptor (TCR) comprising affinity for a
surface antigen on a target cell into the expanded T cells, and
electroporating a RNA encoding a co-stimulatory molecule into the T
cells, wherein the electroporated T cells are capable of expressing
the TCR and the co-stimulatory molecule.
[0360] In another embodiment, the method further comprises
stimulating the expanded T cells with at least one co-stimulatory
molecule selected from the group consisting of CD3, CD27, CD28,
CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. The stimulation may
include co-electroporation with RNA encoding the co-stimulatory
molecule. In such an embodiment, the expanded T cells are further
electroporated or co-electroporated with a RNA encoding CD3. The
CD3 includes comprises at least two different CD3 chains, such as
CD3 zeta and CD3 epsilon chains.
[0361] In another embodiment, the method of expanding the T cells
can further comprise isolating the expanded T cells for further
applications. In yet another embodiment, the method of expanding
can further comprise a subsequent electroporation of the expanded T
cells followed by culturing. The subsequent electroporation may
include introducing a nucleic acid encoding an agent, such as a
transducing the expanded T cells, transfecting the expanded T
cells, or electroporating the expanded T cells with a nucleic acid
encoding a TCR, into the expanded population of T cells, wherein
the agent further stimulates the T cell. The agent may stimulate
the T cells, such as by stimulating further expansion, effector
function, or another T cell function. In one embodiment, the agent
nucleic acid is co-electroporated with the chimeric membrane
protein RNA. In another embodiment, the agent nucleic acid, such as
a TCR RNA, is electroporated after culturing the electroporated
population. In a further embodiment, the agent nucleic acid, such
as a TCR RNA, is electroporated into expanded T cells that were
cryopreserved.
Therapy
[0362] The modified T cells described herein may be included in a
composition for therapy. The composition may include a
pharmaceutical composition and further include a pharmaceutically
acceptable carrier. A therapeutically effective amount of the
pharmaceutical composition comprising the modified T cells may be
administered.
[0363] In one aspect, the invention includes a method for
stimulating a T cell-mediated immune response to a target cell or
tissue in a subject comprising administering to a subject an
effective amount of a modified T cell. In this embodiment, the T
cell is modified as described elsewhere herein. The modified T
cells may be administered to induce lysis of the target cell or
tissue, such as where the induced lysis is antibody-dependent
cell-mediated cytotoxicity (ADCC).
[0364] In another aspect, the invention includes a method for
adoptive cell transfer therapy comprising administering an
effective amount of pharmaceutical composition comprising the
modified T cell described herein to a subject in need thereof to
prevent or treat an immune reaction that is adverse to the
subject.
[0365] In yet another embodiment, a method of treating a disease or
condition associated with enhanced immunity in a subject comprising
administering an effective amount of a pharmaceutical composition
comprising the modified T cell described herein to a subject in
need thereof.
[0366] The modified T cells generated as described herein can be
uniform and possess T cell function. Further, the modified T cells
can be administered to an animal, preferably a mammal, even more
preferably a human, to suppress an immune reaction, such as those
common to autoimmune diseases such as diabetes, psoriasis,
rheumatoid arthritis, multiple sclerosis, GVHD, enhancing allograft
tolerance induction, transplant rejection, and the like. In
addition, the cells of the present invention can be used for the
treatment of any condition in which a diminished or otherwise
inhibited immune response, especially a cell-mediated immune
response, is desirable to treat or alleviate the disease. In one
aspect, the invention includes treating a condition, such as an
autoimmune disease, in a subject, comprising administering to the
subject a therapeutically effective amount of a pharmaceutical
composition comprising the modified T cell described herein.
[0367] Examples of autoimmune disease include but are not limited
to, Acquired Immunodeficiency Syndrome (AIDS, which is a viral
disease with an autoimmune component), alopecia areata, ankylosing
spondylitis, antiphospholipid syndrome, autoimmune Addison's
disease, autoimmune hemolytic anemia, autoimmune hepatitis,
autoimmune inner ear disease (AIED), autoimmune lymphoproliferative
syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP),
Behcet's disease, cardiomyopathy, celiac sprue-dermatitis
hepetiformis; chronic fatigue immune dysfunction syndrome (CFIDS),
chronic inflammatory demyelinating polyneuropathy (CIPD),
cicatricial pemphigold, cold agglutinin disease, crest syndrome,
Crohn's disease, Degos' disease, dermatomyositis-juvenile, discoid
lupus, essential mixed cryoglobulinemia,
fibromyalgia-fibromyositis, Graves' disease, Guillain-Barre
syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis,
idiopathic thrombocytopenia purpura (ITP), IgA nephropathy,
insulin-dependent diabetes mellitus, juvenile chronic arthritis
(Still's disease), juvenile rheumatoid arthritis, Meniere's
disease, mixed connective tissue disease, multiple sclerosis,
myasthenia gravis, pernacious anemia, polyarteritis nodosa,
polychondritis, polyglandular syndromes, polymyalgia rheumatica,
polymyositis and dermatomyositis, primary agammaglobulinemia,
primary biliary cirrhosis, psoriasis, psoriatic arthritis,
Raynaud's phenomena, Reiter's syndrome, rheumatic fever, rheumatoid
arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis
(PSS), also known as systemic sclerosis (SS)), Sjogren's syndrome,
stiff-man syndrome, systemic lupus erythematosus, Takayasu
arteritis, temporal arteritis/giant cell arteritis, ulcerative
colitis, uveitis, vitiligo and Wegener's granulomatosis.
[0368] The T cells generated as described herein can also be
modified and used to treat inflammatory disorders. Examples of
inflammatory disorders include but are not limited to, chronic and
acute inflammatory disorders. Examples of inflammatory disorders
include Alzheimer's disease, asthma, atopic allergy, allergy,
atherosclerosis, bronchial asthma, eczema, glomerulonephritis,
graft vs. host disease, hemolytic anemias, osteoarthritis, sepsis,
stroke, transplantation of tissue and organs, vasculitis, diabetic
retinopathy and ventilator induced lung injury.
[0369] In another embodiment, the modified T cell described herein
may be used for the manufacture of a medicament for the treatment
of an immune response in a subject in need thereof.
[0370] Cells of the invention can be administered in dosages and
routes and at times to be determined in appropriate pre-clinical
and clinical experimentation and trials. Cell compositions may be
administered multiple times at dosages within these ranges.
Administration of the cells of the invention may be combined with
other methods useful to treat the desired disease or condition as
determined by those of skill in the art.
[0371] The cells of the invention to be administered may be
autologous, allogeneic or xenogeneic with respect to the subject
undergoing therapy.
[0372] The administration of the cells of the invention may be
carried out in any convenient manner known to those of skill in the
art. The cells of the present invention may be administered to a
subject by aerosol inhalation, injection, ingestion, transfusion,
implantation or transplantation. The compositions described herein
may be administered to a patient transarterially, subcutaneously,
intradermally, intratumorally, intranodally, intramedullary,
intramuscularly, by intravenous (i.v.) injection, or
intraperitoneally. In other instances, the cells of the invention
are injected directly into a site of inflammation in the subject, a
local disease site in the subject, a lymph node, an organ, a tumor,
and the like.
[0373] The cells described herein can also be administered using
any number of matrices. The present invention utilizes such
matrices within the novel context of acting as an artificial
lymphoid organ to support, maintain, or modulate the immune system,
typically through modulation of T cells. Accordingly, the present
invention can utilize those matrix compositions and formulations
which have demonstrated utility in tissue engineering. Accordingly,
the type of matrix that may be used in the compositions, devices
and methods of the invention is virtually limitless and may include
both biological and synthetic matrices. In one particular example,
the compositions and devices set forth by U.S. Pat. Nos. 5,980,889;
5,913,998; 5,902,745; 5,843,069; 5,787,900; or 5,626,561 are
utilized, as such these patents are incorporated herein by
reference in their entirety. Matrices comprise features commonly
associated with being biocompatible when administered to a
mammalian host. Matrices may be formed from natural and/or
synthetic materials. The matrices may be non-biodegradable in
instances where it is desirable to leave permanent structures or
removable structures in the body of an animal, such as an implant;
or biodegradable. The matrices may take the form of sponges,
implants, tubes, telfa pads, fibers, hollow fibers, lyophilized
components, gels, powders, porous compositions, or nanoparticles.
In addition, matrices can be designed to allow for sustained
release of seeded cells or produced cytokine or other active agent.
In certain embodiments, the matrix of the present invention is
flexible and elastic, and may be described as a semisolid scaffold
that is permeable to substances such as inorganic salts, aqueous
fluids and dissolved gaseous agents including oxygen.
[0374] A matrix is used herein as an example of a biocompatible
substance. However, the current invention is not limited to
matrices and thus, wherever the term matrix or matrices appears
these terms should be read to include devices and other substances
which allow for cellular retention or cellular traversal, are
biocompatible, and are capable of allowing traversal of
macromolecules either directly through the substance such that the
substance itself is a semi-permeable membrane or used in
conjunction with a particular semi-permeable substance.
[0375] Pharmaceutical Compositions
[0376] Pharmaceutical compositions of the present invention may
comprise the modified T cell as described herein, in combination
with one or more pharmaceutically or physiologically acceptable
carriers, diluents or excipients. Such compositions may comprise
buffers such as neutral buffered saline, phosphate buffered saline
and the like; carbohydrates such as glucose, mannose, sucrose or
dextrans, mannitol; proteins; polypeptides or amino acids such as
glycine; antioxidants; chelating agents such as EDTA or
glutathione; adjuvants (e.g., aluminum hydroxide); and
preservatives. Compositions of the present invention are preferably
formulated for intravenous administration.
[0377] Pharmaceutical compositions of the present invention may be
administered in a manner appropriate to the disease to be treated
(or prevented). The quantity and frequency of administration will
be determined by such factors as the condition of the patient, and
the type and severity of the patient's disease, although
appropriate dosages may be determined by clinical trials.
[0378] When "an immunologically effective amount", "an anti-immune
response effective amount", "an immune response-inhibiting
effective amount", or "therapeutic amount" is indicated, the
precise amount of the compositions of the present invention to be
administered can be determined by a physician with consideration of
individual differences in age, weight, immune response, and
condition of the patient (subject). It can generally be stated that
a pharmaceutical composition comprising the modified T cells
described herein may be administered at a dosage of 10.sup.4 to
10.sup.9 cells/kg body weight, preferably 10.sup.5 to 10.sup.6
cells/kg body weight, including all integer values within those
ranges. T cell compositions may also be administered multiple times
at these dosages. The cells can be administered by using infusion
techniques that are commonly known in immunotherapy (see, e.g.,
Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal
dosage and treatment regime for a particular patient can readily be
determined by one skilled in the art of medicine by monitoring the
patient for signs of disease and adjusting the treatment
accordingly.
[0379] In certain embodiments, it may be desired to administer
activated T cells to a subject and then subsequently redraw blood
(or have an apheresis performed), activate T cells therefrom
according to the present invention, and reinfuse the patient with
these activated and expanded T cells. This process can be carried
out multiple times every few weeks. In certain embodiments, T cells
can be activated from blood draws of from 10 ml to 400 ml. In
certain embodiments, T cells are activated from blood draws of 20
ml, 30 ml, 40 ml, 50 ml, 60 ml, 70 ml, 80 ml, 90 ml, or 100 ml. Not
to be bound by theory, using this multiple blood draw/multiple
reinfusion protocol, may select out certain populations of T
cells.
[0380] In certain embodiments of the present invention, cells
expanded and modified using the methods described herein, or other
methods known in the art where T cells are expanded to therapeutic
levels, are administered to a patient in conjunction with (e.g.,
before, simultaneously or following) any number of relevant
treatment modalities, including but not limited to treatment with
agents such as antiviral therapy, cidofovir and interleukin-2,
Cytarabine (also known as ARA-C) or natalizumab treatment for MS
patients or efalizumab treatment for psoriasis patients or other
treatments for PML patients. In further embodiments, the T cells of
the invention may be used in combination with chemotherapy,
radiation, immunosuppressive agents, such as cyclosporin,
azathioprine, methotrexate, mycophenolate, and FK506, antibodies,
or other immunoablative agents such as CAM PATH, anti-CD3
antibodies or other antibody therapies, cytoxin, fludaribine,
cyclosporin, FK506, rapamycin, mycophenolic acid, steroids,
FR901228, cytokines, and irradiation. These drugs inhibit either
the calcium dependent phosphatase calcineurin (cyclosporine and
FK506) or inhibit the p70S6 kinase that is important for growth
factor induced signaling (rapamycin). (Liu et al., Cell 66:807-815,
1991; Henderson et al., Immun. 73:316-321, 1991; Bierer et al.,
Curr. Opin. Immun. 5:763-773, 1993). In a further embodiment, the
cell compositions of the present invention are administered to a
patient in conjunction with (e.g., before, simultaneously or
following) bone marrow transplantation, T cell ablative therapy
using either chemotherapy agents such as, fludarabine,
external-beam radiation therapy (XRT), cyclophosphamide, or
antibodies such as OKT3 or CAMPATH. In another embodiment, the cell
compositions of the present invention are administered following
B-cell ablative therapy such as agents that react with CD20, e.g.,
Rituxan. For example, in one embodiment, subjects may undergo
standard treatment with high dose chemotherapy followed by
peripheral blood stem cell transplantation. In certain embodiments,
following the transplant, subjects receive an infusion of the
expanded immune cells of the present invention. In an additional
embodiment, expanded cells are administered before or following
surgery.
[0381] The dosage of the above treatments to be administered to a
patient will vary with the precise nature of the condition being
treated and the recipient of the treatment. The scaling of dosages
for human administration can be performed according to art-accepted
practices. The dose for CAMPATH, for example, will generally be in
the range 1 to about 100 mg for an adult patient, usually
administered daily for a period between 1 and 30 days. The
preferred daily dose is 1 to 10 mg per day although in some
instances larger doses of up to 40 mg per day may be used
(described in U.S. Pat. No. 6,120,766).
[0382] It should be understood that the method and compositions
that would be useful in the present invention are not limited to
the particular formulations set forth in the examples. The
following examples are put forth so as to provide those of ordinary
skill in the art with a complete disclosure and description of how
to make and use the cells, expansion and culture methods, and
therapeutic methods of the invention, and are not intended to limit
the scope of what the inventors regard as their invention.
[0383] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry and immunology, which are well within the purview of
the skilled artisan. Such techniques are explained fully in the
literature, such as, "Molecular Cloning: A Laboratory Manual",
fourth edition (Sambrook, 2012); "Oligonucleotide Synthesis" (Gait,
1984); "Culture of Animal Cells" (Freshney, 2010); "Methods in
Enzymology" "Handbook of Experimental Immunology" (Weir, 1997);
"Gene Transfer Vectors for Mammalian Cells" (Miller and Calos,
1987); "Short Protocols in Molecular Biology" (Ausubel, 2002);
"Polymerase Chain Reaction: Principles, Applications and
Troubleshooting", (Babar, 2011); "Current Protocols in Immunology"
(Coligan, 2002). These techniques are applicable to the production
of the polynucleotides and polypeptides of the invention, and, as
such, may be considered in making and practicing the invention.
Particularly useful techniques for particular embodiments will be
discussed in the sections that follow.
Experimental Examples
[0384] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0385] Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the compounds
of the present invention and practice the claimed methods. The
following working examples therefore, specifically point out the
preferred embodiments of the present invention, and are not to be
construed as limiting in any way the remainder of the
disclosure.
[0386] The materials and methods employed in these experiments are
now described.
[0387] Primary Human Lymphocytes.
[0388] Primary lymphocytes were stimulated with microbeads coated
with CD3 and CD28 stimulatory antibodies (Life Technologies, Grand
Island, N.Y., Catalog) as described (Human gene therapy 2011,
22(12):1575-1586). T cells were cryopreserved at day 10 in a
solution of 90% fetal calf serum and 10% dimethylsulfoxide (DMSO)
at 1.times.10.sup.8 cells/vial.
[0389] NALM-6 was purchased from the German DSMZ Cell Collection
(DSMZ catalog code: ACC 128). K562 and PC3 were purchased from
American Type Culture Collection. 624mel melanoma line was obtained
from the Surgery Branch (NCI/NIH). All the cell lines were cultured
as instructed and routinely tested for mycoplasma contamination and
confirmed as being negative.
[0390] Generation of TCR Constructs for mRNA Electroporation and
Lentiviral Transduction.
[0391] 1G4 NY-ESO-1 TCR with different mutations (1G4 and 8F) and
CARs (PSCA or CD19) were synthesized and/or amplified by PCR, based
on sequencing information provided by the relevant publications
(The Journal of experimental medicine 2005, 201(8):1243-1255; J
Immunol 2008, 180(9):6116-6131), and subcloned into pGEM.64A RNA
based vector or pTRPE lentiviral vectors.
[0392] Human Primary T Cell Preparation.
[0393] Primary human CD4 and CD8 T cells were isolated from healthy
volunteer donors following leukapheresis by negative selection
using RosetteSep kits (Stem Cell Technologies, Vancouver BC,
Canada). All specimens were collected under a University
Institutional Review Board-approved protocol, and written informed
consent was obtained from each donor.
[0394] Design and Construction of CRISPRs.
[0395] Cas9 DNA was synthesized by PCR then inserted to PGEM
vector. gRNAs were selected by GN19 with a NGG PAM site, with some
selected from N20 with a NGG PAM site. All gRNAs contained
complementary sequences comprised of more than 13 base pair
mispairs, with potential off-target mRNA sites excluded (Table 1).
GRNAs were designed, as shown in FIG. 1A, and synthesized by
overlap PCR. All gRNA PCR products were ligated into the MSGV
vector. In vitro transcribed CAS9 and gRNA targeted constant
regions of TCR .alpha., .beta. chains and beta-2 microglobin. gRNAs
were designed to target either a sequence within exon 1 of the TCR
.alpha. constant region, a consensus sequence common to exon 1 of
both TCR .beta. constant regions 1 and 2, beta-2 microglobulin or
PD1. Sequences encoding the gRNAs were assembled using overlap PCR
and cloned into the MSGV vector containing a T7 promoter. These
plasmids were linearized with EcoRI. gRNA was in vitro transcribed.
Cas9 mRNA was in vitro transcribed using mMESSAGE mMACHINE T7 ULTRA
kit (Life Technologies, Carlsbad, Calif.). The mRNA was stored at
-80.degree. C. in nuclease-free vials for single use. The gRNA
targeting sequences used for the animal study were as follows:
TABLE-US-00001 TRAC-gRNA: SEQ ID NO: 1 TGTGCTAGACATGAGGTCTA,
TRBC-gRNA: SEQ ID NO: 2 GCAGTATCTGGAGTCATTGA, B2M-gRNA: SEQ ID NO:
3 CGCGAGCACAGCTAAGGCCA, PD1-gRNA: SEQ ID NO: 4
GGCGCCCTGGCCAGTCGTCT, FAS-gRNA: SEQ ID NO: 5
GAGGGTCCAGATGCCCAGCA,
[0396] Flow Cytometry.
[0397] The following monoclonal antibodies and reagents were used
with indicated specificity and the appropriate isotype controls.
From BD Biosciences (San Jose, Calif.): APC-conjugated anti-CD3
(555335), FITC-anti-CD8 (555366), PE-anti-CD8 (555635),
FITC-anti-(CD27 (555440), PE-anti-CD107 (555801), PE-anti-beta-2
microglobin (551337), FITC-anti-HLA(555552); Biolegend (San Diego,
Calif.): FITC-anti-CD45RO(304204), APC-anti-CD62L(304814),
APC-anti-CCR7 (353214); and Beckman Coulter (Pasadena, Calif.):
PE-anti-Vb13.1(IM202IU). Data was acquired on a FACS Accuri (BD
Biosciences, San Jose, Calif.) using CellQuest version 3.3 (BD
Biosciences, San Jose, Calif.) and analyzed by FCS Express version
3.00 (De Novo Software, Los Angeles, Calif.) or FlowJo version
7.6.1 (Tree Star, Inc. Ashland, Oreg.).
[0398] Propagation of Primary T Cells.
[0399] Primary human T cells were cultured in RPMI 1640
supplemented with 10% FCS, 100-U/ml penicillin, 100-g/ml
streptomycin sulfate, 10-mM Hepes, and stimulated with magnetic
beads coated with anti-CD3/anti-CD28 at a 1:3 cell to bead ratio.
Cells were counted and fed every 2 days and once T cells appeared
to rest down, as determined by both decreased growth kinetics and
cell size, the T cells were either used for functional assays or
cryopreserved.
[0400] Generation of CD3.sup.neg T Cell.
[0401] DNA supercoiled plasmids were linearized by SpeI and EcoRI,
respectively. gRNA was in vitro transcribed by T7 mScript.TM.
Standard mRNA Production System (Cambio, C-MSC100625, Cambridge,
England). All mRNA (Cas9, TCR .alpha., TCR .beta. and CARs) was in
vitro transcribed using mMESSAGE mMACHINE T7 ULTRA kit (Life
Technologies, AM1345, Carlsbad, Calif.). T cells were stimulated by
CD3/CD28 dynabeads for three days prior to electroporation. Ten
million primary T cells were de-beaded prior to electro-transfer of
20 .mu.g Cas9, 10 .mu.g gRNA species into the cells with a 360V, 1
ms parameter by BTX830, following a second and/or a third
electro-transfer of 10 .mu.g gRNA. Also, T cells were washed three
times with OPTI-MEM and re-suspended in OPTI-MEM (Invitrogen) at a
final concentration of 1-3.times.10.sup.8 cells/ml. Subsequently,
0.1 ml of the cells was mixed with 10 .mu.g of IVT RNA (or as
indicated) and electroporated in a 2 mm cuvette. Ten million
primary T cells were de-beaded prior to the electrotransfer of 20
.mu.g of Cas9 and 10 .mu.g of gRNA species into the cells using a
BTX830 (Harvard Apparatus BTX) at 360 V and 1 ms; this process was
followed by a second and a third electrotransfer of 5 .mu.g of gRNA
12 to 24 hours later.
[0402] Following electroporation, cells were immediately placed in
2 m L of pre-warmed culture media and cultured at 37.degree. C., 5%
CO.sub.2, or 32.degree. C., 5% CO.sub.2 for 1 day then returned to
37.degree. C., 5% CO.sub.2.
[0403] TCR .alpha. and .beta. Double Disruption or TRAC, TRBC and
B2M Triple Disruption.
[0404] To generate TCR .alpha. and .beta. double-knockout T cells,
Cas9 mRNA was co-electroporated with two different gRNAs targeting
TCR .alpha. chain (TRAC), and TCR .beta. chain (TRBC). The TCR
.alpha. and .beta. double-knockout T cells could be purified in 2
steps: 1) depletion of TCR-positive and a chain single-knockout
cells with anti-CD3 microbeads after the electroporation of the 1G4
TCR .alpha. chain RNA, and 2) depletion of TCR .beta. chain
single-knockout cells with anti-CD3 microbeads after the
electroporation of the TCR .beta. chain RNA. For TRAC, TRBC and B2M
triple disruption, T cells were electroporated with Cas9 mRNA and
gRNAs targeting the TCR .alpha. and .beta. chains and beta-2
microglobulin 3 days after anti-CD3/CD28 bead stimulation. The
HLA-I-negative cell population was enriched on day 9 and
electroporated with TCR .alpha. chain RNA. The TCR-negative
population was enriched on day 10. Five days later, these cells
were electroporated with TCR .beta. chain RNA, and the TCR-negative
cell population was sorted the next day to obtain universal T
cells. On day 18, TCR or CAR RNA was electroporated into the
universal T cells to generate universal effector cells. TCR and
HLA-I molecule expression was confirmed at each step.
[0405] Generation of Universal CART Cells.
[0406] Universal CART cells were generated by combing the
lentiviral transduction of CD19 or PSCA CAR with the RNA
electroporation of CRISPR/gRNAs. 1 day after anti-CD3/CD28 beads
stimulation, T cells were transduced with lentiviral-CD19 or PSCA
CAR. 2 days later, Cas9 and gRNAs targeting TCR .alpha., .beta.
chain, B2M, PD1 were transferred into T cells by electroporation. 6
days after CRISPRs delivery, T cells negative for CD3, HLA-I, PD1
were sorted by microbeads depletion.
[0407] Enrichment of CD3.sup.neg T Cells.
[0408] Cells washed with Auto MACS buffer were incubated for 30
minutes with CD3 microbeads (Miltenyi Biotec, 130-050-101, Auburn,
Calif.) at 4.degree. C. After washing twice, cells were passed
through a LD column (MiltenyiBiotec, 130-042-901, Auburn, Calif.),
and the flow-through fraction was collected for further use. The
CD3 expression of CD3.sup.neg T cells was restored by
co-electroporation of 1G4TCR .alpha. and .beta. mRNA, and the cells
were expanded using a single Rapid Expansion Protocol (REP),
CD3/CD28 Dynabeads or K562-based aAPC.
[0409] Generation and Propagation of CD3.sup.neg T Cells.
[0410] CD3.sup.neg T cells had CD3 expression restored by
electro-transfer of exogenous 1G4TCR alpha chain and TCR beta chain
in vitro transcribed mRNA (5 .mu.g for each chain). These cells
were expanded using a single Rapid Expansion Protocol (REP). PBMCs
from three different donors: ND052 105.times.10.sup.6, ND405
83.times.10.sup.6, ND410 136.times.10.sup.6, were irradiated, then
mixed together, to obtain a total of 324.times.10.sup.6 PBMCs. The
PBMCs were re-suspended in a final volume of 90 ml then R10 were
added to 300 ml, mixed, and divided into two T150 ml flasks. OKT
were added to a final concentration of 30 ng/ml. On day 2, IL-2 was
added to 50 CU/ml. From day 5, cells were counted and fed every 2
days and once T cells appeared to rest down, as determined by both
decreased growth kinetics and cell size, they were either used for
functional assays or cryopreserved.
[0411] Sanger Sequencing.
[0412] The level of genomic disruption of TCR .alpha. chain (TRAC),
TCR .beta. chain 1 (TRBC1), and TCR .beta. chain 2 (TRBC2) in T
cells was determined by Surveyor Nuclease assay (Transgenomics,
Omaha, Nebr.). The percent target disruption was quantified by
densitometry. The PCR primers used for the amplification of target
locus were:
TABLE-US-00002 TRAC forward, SEQ ID NO: 6
5'-TCATGTCCTAACCCTGATCCTCTT-3' TRAC reverse, SEQ ID NO: 7
5'-TTGGACTTTTCCCAGCTGACAGA-3' TRBC total forward, SEQ ID NO: 8
5'-TACCAGGACCAGACAGCTCTTAGA-3'
[0413] TRBC total reverse, 5'-TCTCACCTAATCTCCTCCAGGCAT-3' SEQ ID
NO:9
[0414] PCR products were purified and ligated to TOPO cloning
vector (Invitrogen) then transformed in E. coli. Single clone was
picked and sequenced to calculate the indels.
[0415] Generation of siRNA and CRISPRi for Electroporation.
[0416] RNA duplex targeting TCR constant regions for either alpha
(5'-rArGrGrArGrGrArUrUrCrGrGrArArCrCrCrArArUrCrArCrUrGrArC-3' SEQ
ID NO:10 and 5'-rCrArGrUrGrArUrUrGrGrGrUrUrCrCrGrArArUrCrCrUrCCT-3'
SEQ ID NO: 11) or beta
(5'-rArCrCrUrCrCrUrUrCrCrCrArUrUrCrArCrCrCrArCrCrArGrCrUrC-3' SEQ
ID NO:12 and 5'-rGrCrUrGrGrUrGrGrGrUrGrArArUrGrGrGrArArGrGrArGGT-3'
SEQ ID NO:13) were designed using Custom RNAi Design Tool
(Integrated DNA Technologies, Coralville, Iowa) and the siRNA was
synthesized (Integrated DNA Technologies, Coralville, Iowa). siRNA
for both TCR alpha and beta was mixed and electroporated into
stimulated T cells for endogenous TCR knockdown.
[0417] mRNA In Vitro Transcription and T Cell Electroporation.
[0418] T7 mscript systems kit (CellScript) was used to generate in
vitro transcribed (IVT) RNA. CD3/CD28 bead stimulated T cells were
electroporated with IVT RNA using BTX EM830 (Harvard Apparatus BTX)
as previously described (Cancer research 2010, 70(22):9053-9061).
Briefly, T cells were washed three times and resuspended in
OPTI-MEM (Invitrogen) at a final concentration of
1-3.times.10.sup.8 cells/ml. Subsequently, 0.1 ml of cells were
mixed with 10 ug IVT RNA (or as indicated) and electroporated in a
2 mm cuvette.
[0419] ELISA Assays.
[0420] Target cells, different tumor cell lines expressing CD19,
were washed and suspended at 1.times.10.sup.6 cells/ml in R10
medium (RPMI 1640 supplemented with 10% fetal calf serum;
Invitrogen). 100 ul of each target cell type was added in duplicate
to a 96 well round bottom plate (Corning). Effector T cells were
washed, and re-suspended at 1.times.10.sup.6 cells/ml in R10 medium
and then 100 ul of T cells were combined with the target cells in
the indicated wells. In addition, wells containing T cells alone
were prepared as a control. The plates were incubated at 37.degree.
C. for 18 to 20 hours. After the incubation, supernatant was
harvested and subjected to an ELISA assay (eBioscience).
[0421] CD107a Staining Cells were Plated at an Effector Cell:
[0422] T cell ratio of 1:1 (1.times.10.sup.5 effectors to
1.times.10.sup.5 targets) in 160 .mu.l of complete RPMI medium in a
96 well plate. 20 .mu.l of phycoerythrin-labeled anti-CD107a
antibody (BD Biosciences, 555801) was added and the plate was
incubated at 37.degree. C. for 1 hour before adding Golgi Stop (2
ul Golgi Stop in 3 ml RPMI medium, 20 ul/well; BD Biosciences,
51-2092KZ) and incubating the plate for another 2.5 hours. Then 5
.mu.l FITC-anti-CD8 and 5 ul APC-anti-CD3 were added and incubated
at 37.degree. C. for 30 min. After incubation, the samples were
washed with FACS buffer and analyzed by flow cytometry.
[0423] Luciferase Based CTL Assay.
[0424] Naml6-CBG tumor cells were generated and employed in a
modified version of a luciferase based cytotoxic T lymphocyte
assay. Briefly, click beetle green luciferase (CBG) was cloned into
the pELNS vector, packaged into lentivirus, transduced into Naml6
tumor cells and sorted for CBG expression. The resulting Naml6-CBG
cells were washed and resuspended at 1.times.10.sup.5 cells/ml in
R10 medium, and 100 ul of CBG-labeled cells were incubated with
different ratios of T cells (e.g. 30:1, 15:1, etc) overnight at
37.degree. C. 100 ul of the mixture was transferred to a 96 well
white luminometerplate. 100 ul of substrate was added to the cells
and luminescence was immediately determined. The results are
reported as percent killing based on the luciferase activity in the
wells with tumor cells but no T cells (% killing=100-((RLU from
well with effector and target cell coculture)/(RLU from well with
target cells).times.100)).
[0425] Mouse Xenograft Studies.
[0426] Studies were performed as previously described with certain
modifications (Human gene therapy 2011, 22(12):1575-1586;
Proceedings of the National Academy of Sciences of the United
States of America 2009, 106(9):3360-3365). Briefly, 6-10 week old
NOD/SCID gamma (NSG) mice were injected subcutaneously with
1.times.10.sup.6 PC3-CBG tumors cells on the right flank at day 0
and the same mice were given SK-OV3-CBG tumor cells
(5.times.10.sup.6 cells/mouse, subcutaneously.) on the left flank
at day 5. The mice were treated with T cells via the tail vein at
day 23 post PC3-CBG tumor inoculation, such that both tumors were
approximately 200 mm.sup.3 in volume. Lentivirally transduced T
cells were given at 1.times.10.sup.7 cells/mouse (10M), or
3.times.10.sup.6 cells/mouse (3M). Briefly, for the Nalm6 tumor
model, 6- to 10-week-old NOD/SCID gamma (NSG) mice were injected
with 1.times.10.sup.6 click beetle green (CBG) transduced Nalm6
(Nalm6-CBG) cells through the tail vein on day 0. The T cell
treatment began on day 7 after the tumor inoculation. For the
PC3-PDL1 solid tumor model, 6- to 10-week-old NOD/SCID gamma (NSG)
mice were injected subcutaneously with 1.times.10.sup.6 PSCA, PD-L1
and CBG transduced PC3 (PC3-PSCA-PDL1-CBG) tumors cells in the
right flank on day 0. The mice were treated with T cells via the
tail vein at day 22 post PC3-PDL1-CBG tumor inoculation, such that
the tumors were approximately 200 mm.sup.3 in volume. T cells were
given at 2.times.10.sup.6 cells/mouse (2M). Animals were randomized
and grouped based on baseline tumor size. All animals were included
in the experiments and blinded tumor assessment was done for all
the animal experiments conducted.
[0427] T Cell Stimulation, Lentiviral Transduction and CRISPR
Electroporation Procedure.
[0428] FIG. 84 shows the procedure used to stimulate, lentiviral
transduce and CRISPR electroporate T cells. On day 0, T cells were
obtained from 3 donors (100.times.10.sup.6 cells/donor). The cells
were stimulated with anti-CD3/anti-CD28 beads at a T cell:bead
ratio of 1:3. The concentration of cells was adjusted to
0.5.times.10.sup.6/ml with 100 mL/flask. On day 1, stimulated T
cells were transduced with CD19 CAR lentivirus at multiplicity of
infection (MOI) of 2. 50 mL (25.times.10.sup.6 cells) of T cells
were reserved as unmodified T cells (Group 9). On Day 3, the beads
were removed, the cells washed 2.times. in Opti-MEM media, and the
transduced T cells from each donor were separated into two groups,
CART/mock EP (10 mL, 50.times.10.sup.6/mL) and CART/CRISPR (10 mL,
50.times.10.sup.6/mL). The cells were then electroporated with CAS9
RNA (1st EP) at 500V/1 ms with 120 .mu.g of CAS9 RNA/400 .mu.L of T
cells. After electroporation, Groups 1, 3, 5 and 7 cells were then
split by culturing T cells in half new medium and half cultured
medium. On day 4, the cells were washed twice and resuspended in
Opti-MEM at 50.times.10.sup.6/mL. 20 .mu.g TRBC4 and B2M gRNA was
electroporated into the 400 .mu.L of T cells. After
electroporation, the cells were cultured at 1.times.10.sup.6
cells/mL in half fresh medium and half cultured medium. On days 5
and 7, the cells were split and resuspended in half fresh medium
and half cultured medium. On day 8, CD3+ cells were removed from
Groups 2, 4 and 6 via a low-density column. The CD3-T cells were
resuspended at 0.5-1.times.10.sup.6 cells/mL in half fresh medium
and half cultured medium and cultured to expand the cells. On day
11, the T cells were harvested and 25.times.10.sup.5 cells from the
three donors were sent for karyotyping. The remaining cells were
aliquoted and frozen.
[0429] The results of the experiments are now described.
Example 1: Disruption of the TCR-CD3 Complex on T Cells Using
CRISPR
[0430] Thirteen gRNAs targeting the constant regions of TCR .alpha.
chain, 10 gRNAs targeting the constant regions TCR .beta. chain,
and 10 RNAs targeting the beta-2 microglobin gene. (FIGS. 1A-1C and
FIGS. 9A-9D) were developed and tested in 293T cells. Primary human
T cells were propagated ex vivo for three days with
anti-CD3/anti-CD28 dynabeads for three days. Since transient
expression of CRISPR is sufficient to mediate gene knockout, a
"hit-and-run" delivery strategy was developed to transiently
express the CRISPRs by utilizing electro-transfer of in vitro
transcribed RNA encoding CAS9 and gRNAs (FIG. 2C).
[0431] To measure TCR expression, a mAb specific for CD3 was used,
which is only present on the cell surface when TCR antibody is
expressed. Six days after electro-transfer, flow cytometric
analysis revealed that CRISPRs targeting TRBC eliminated CD3
expression on primary T cells at levels of 13.7 (FIG. 2D) in donor
ND147. The efficiency of TCR knockout correlated with the amount of
electro-transferred mRNA (FIG. 2D). Although the electro-transfer
of RNA in primary T cells was well-tolerated, a slight reduction in
cell viability was observed that correlated with increasing amounts
of introduced RNA. ZFN and TALEN mediated gene disruption has been
reported to be more efficient when cells were transiently exposed
to mild hypothermia. The same phenomenon was observed with this
CRISPR system.
[0432] The T cells were cultured for 1 day at 32.degree. C. after
electro-transfer. CRISPR-mediated disruption of CD3 was up to
2.5-fold better when electroporated T cells were cultured at
32.degree. C. versus 37.degree. C. Using this approach, 5.43% and
16.7% of electroporated T-cells lost expression of CD3 using the
CRISPRs targeting TRAC and TRBC, respectively, (FIG. 2D, lower
panel). No change in the levels of CD3 negative cells in the CAS9
MOCK samples and no appreciable decrease in viability (measured by
Trypan blue) were observed.
[0433] When gRNAs were electro-transferred for a second and a third
time, the efficiency of eliminating CD3 expression on primary T
cells at levels was greatly improved. [0434] Targeting TRAC: at
levels reaching 77% after three times electro-transfer of gRNA
(FIG. 4A), [0435] Targeting TRAC or TRBC at levels reaching 64.5%
or 57.5%, respectively, after a second electro-transfer of gRNAs
with a slight decreased viability (FIG. 4C).
[0436] To confirm that electroporated T cells had been genetically
modified at the intended gRNA target sites (TCR .alpha. or .beta.
loci), Sanger sequencing was performed using specific
oligonucleotide primers flanking target sites within TRAC, TRBC1,
or TRBC2. Multiple peaks at the indicated PCR products starting
from the target sites were present only after electro-transfer of
CRISPRs and the percent disruption correlated with loss of cell
surface CD3 expression (FIGS. 1C and 3B). These experiments in
primary T cells confirmed that CRISPRs designed to target TRAC or
TRBC led to permanent disruption of .alpha..beta. TCR expression,
as assessed by Sanger sequencing and confirmed by flow cytometric
analysis of CD3.
Example 2: Enrichment of TCR .alpha..beta. Negative T Cells
[0437] For future clinical applications, rapid and robust methods
for isolating sources of TCR disrupted populations may be utilized.
To begin to address this issue, the TCR/CD3.sup.neg population was
enriched by negative selection using clinically-approved
paramagnetic beads and a depletion column. With a single depletion
step, the CD3.sup.neg population was enhanced to over 99% (FIG.
3A). A CD3.sup.neg population could not be enriched from
untransfected control cells. Back-to-back depletion steps resulted
in >99% enrichment, without skewing the CD4 or CD8 T cell
subsets (FIG. 3C). Sequencing results also showed deletions and
insertions were introduced to TCR alpha and beta locus after CRISPR
modification (FIG. 3D).
Example 3: Generation of HLA-CLASS I.sup.neg T Cells by CRISPR
[0438] To test the ability of CRISPR to knock out HLA-CLASS I
expression from allogeneic T cells, gRNAs targeting beta-2
microglobin were designed. The beta-2 microglobin locus could be
manipulated by CRISPR in 293 T cells (FIG. 9A). Evidence showed
disruption of beta-2 microglobin abolished T cell surface HLA-CLASS
I expression (FIG. 9B).
[0439] IFN-gamma greatly improved, approximately 10 fold, targeting
efficiency of beta-2 microglobin in T cells (FIG. 9C). Multiple
electro-transfers of beta-2 microglobin gRNAs gave a 66% beta-2
microglobin negative population (FIG. 11A).
[0440] For future allograft transplantation clinical applications,
rapid and robust methods for isolating sources of HLA-CLASS I null
populations will be needed. To begin to address this issue, the
cells were labeled with PE-anti-beta-2 microglobin antibody, and
enriched for a HLA-CLASS I.sup.neg population by negative selection
using clinically-approved paramagnetic anti-PE microbeads and a
depletion column. With a single depletion step, the HLA-CLASS
I.sup.neg population was enhanced to over 99%. A HLA-CLASS
I.sup.neg population could not be enriched from untransfected
control cells. An analysis of HLA-CLASS I repertoire in enriched
HLA-CLASS I.sup.neg T cells via flow cytometry validated the
elimination of HLA-CLASS I expression from the cell surface (FIG.
9D).
Example 4: CD3.sup.neg T Cells can be Propagated by Different
Methods
[0441] CD3.sup.neg T cells restored CD3 expression after
electro-transfer of exogenous 1G4-TCR alpha and beta chain in vitro
transcribed mRNA (5 .mu.g each). These cells were expanded by: (1)
a single Rapid Expansion Protocol (REP), then tested for activity
and specificity. PBMCs were obtained from three different donors:
ND052 105.times.10.sup.6, ND405 83.times.10.sup.6, ND410
136.times.10.sup.6. Cell were after irradiated, then mixed
together, and a total 324.times.10.sup.6 PBMCs were obtained.
2.times.10.sup.6 cells were electro-transferred with RNA.
CD3.sup.neg T were re-suspended in a final volume of 90 ml and R10
media was added for a total volume of 300 ml. The cells were
divided into 2 T150 ml flasks. OKT was added to a final
concentration of 30 ng/ml. On day 2, IL-2 was added to 50 CU/ml
From day 5, cells were counted and fed every 2 days and once T
cells appeared to rest down, as determined by both decreased growth
kinetics and cell size, they were either used for functional assays
or cryopreserved.
[0442] After a single REP, CD3.sup.neg T cells were expanded for a
500 fold increase in number. These cells were expanded by: (2)
stimulated with magnetic beads coated with anti-CD3/anti-CD28 at a
1:3 cell to bead ratio.
[0443] After a single REP, CD3.sup.neg T cells were expanded for a
500 fold increase in number. These cells were expanded by: (3)
co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in
equal mixture at a concentration of 1.times.10.sup.6/ml.
[0444] After a single REP, CD3.sup.neg T cells were expanded for a
500 fold increase in number. These cells were expanded by: (4)
co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in
equal mixture at a concentration of 1.times.10.sup.6/ml with 30
ng/ml OKT
[0445] After a single REP, CD3.sup.neg T cells were expanded for a
500 fold increase in number. These cells were expanded by: (5)
co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in
equal mixture at a concentration of 1.times.10.sup.6/ml with 1
mg/ml NY-ESO peptide.
Example 5: Re-Direction of TCR.sup.neg T Cells by Electro-Transfer
of TCR
[0446] To test the function of TCR.sup.neg T cells, these cells
were re-directed by electro-transfer of TCR. By introducing TCR
alpha chain and TCR beta chain, these cells expressed high levels
of TCR. The expression of Vb13.1 was much higher in
electro-transferred TCR.sup.neg T cells compared to CAS9 MOCK
control (FIG. 7A). When the cells were co-cultured with the Nalm-6
NY-ESO leukemia cell line, positive for both HLA-A2 and NY-ESO, the
cells showed high levels of 107a, indicating elevated
de-granulation activity (FIG. 7B). The killing assay also showed
potent toxicity towards this cell line (FIG. 7C). This indicated
that these cells are potentially safer than traditional clinical
trials with T cell expressing CARs and TCRs, as these cells would
not trigger GVHD and have less miss-pair toxicity than normal T
cells with TCR treatment.
[0447] Some reports have shown that T cells can be genetically
edited by ZFNs or TALEN to eliminate expression of the endogenous
.alpha..beta. TCR. The methods and compositions described herein to
selectively deplete T cells expressing undesired .alpha..beta. TCR
also include incomplete knockout of the endogenous TCR to treat
GVHD and inhibit endogenous TCR from adversely affecting CAR
function (e.g., through competition for transcription factors).
Therefore, a genetic approach was designed using designer ZFNs to
permanently disrupt the .alpha. and .beta. constant region
sequences in T cells, thereby eliminating TCR expression.
[0448] ZFNs and TALENs are artificial restriction enzymes generated
by fusing a DNA binding domain to a DNA cleavage domain. When ZFNs
and TALENs do not work efficiently, it is often difficult to
determine the cause. Failure could reflect a problem with the
design, with accessibility of the target sequence, or a delivery
issue. At the same time, ZFN targeting efficiency is usually low in
T cells, making it difficult to manipulate multiple genes at one
time.
[0449] Distinct ZFNs and TALENs, the CRISPR/Cas system has recently
emerged as a potentially facile and efficient alternative to ZFNs
and TALENs for inducing targeted genetic alterations. Recent work
has shown that target recognition by the Cas9 protein requires a
`seed` sequence within the crRNA and a conserved
di-nucleotide-containing protospacer adjacent motif (PAM) sequence
upstream of the crRNA-binding region. The CRISPR/CAS system can
thereby be retargeted to cleave virtually any DNA sequence by
redesigning the crRNA. The data disclosed herein shows the
potential for gene editing by CRISPR/CAS in 293T cells and primary
T cells. The CRISPR/CAS system can simultaneously target multiple
genomic loci by co-expressing a single CAS9 protein with two or
more gRNAs, making this system uniquely suited for multiplex gene
editing or synergistic activation of target genes. By administering
different gRNAs together with CAS9, multiple genes can be
simultaneously disrupted in T cells.
Example 6: HLA CLASS I and TCR .alpha., .beta. Chain Triple
Knockout by CRISPR
[0450] To work toward "off-the-shelf" allogeneic t-cell therapies
for malignancies and infectious diseases, cell therapy by infusion
of T cells was designed to reconstitute immunity against pathogens
and malignancies. The amount of time required to manufacture T
cells with the desired properties and in sufficient numbers ex vive
is often incompatible with the treatment window for patients.
Furthermore, autologous T cells from patients with advanced disease
may have compromised function and be tolerant to desired
antigens.
[0451] To address this, patients can be infused with allogeneic T
cells to avoid immune-mediated rejection caused by host T cells
recognizing disparate major or minor histocompatibility antigens on
the infused cells. To broaden the application of T cell therapy,
and for future allograft transplantation, rapid and robust methods
for isolating sources of TCR and HLA-CLASS I disrupted populations
can be generated.
[0452] ZFN and TALEN comprise a zinc finger DNA-binding domain
designed to bind a specific DNA sequence fused to the cleavage
domain of Fokl endonuclease. The design and construction of ZFN and
TALEN is very complicated and time consuming if there is more than
one gene to be manipulated, because the genes must be targeted
individually. With the CRISPR system described herein, the
efficiency and shortened the time course of gene disruption can be
obtained.
[0453] To address this issue, CAS9 was electro-transferred with
three different gRNAs targeting TRAC, TRBC and beta-2 microglobin.
Cells were labeled with PE-anti-beta-2 microglobin antibody and
enriched for a HLA-CLASS I.sup.neg population by negative selection
using clinically-approved paramagnetic anti-PE microbeads and a
depletion column. With a single depletion step, the HLA-CLASS
I.sup.neg population was enhanced to over 99% (FIG. 9D). Then the
cells were re-introduced with TCR alpha chain, and HLA-CLASS
I.sup.neg CD3.sup.neg population was enriched by microbeads (FIG.
11). Five days later, the TCR beta chain was re-introduced into the
cells, and a HLA-CLASS I.sup.neg CD3.sup.neg population was
enriched by microbeads again. Two days later, TCR was
electro-transferred into these triple knock out cells. On the day
after electro-transformation, the cells were stimulated with
CD3/CD28 dynabeads. Then, the cells underwent lentiviral delivery
of antigen specific TCR the next day and culture expansion.
Example 7: FAS, PD1, CTLA4, PPP2R2D Knockout by CRISPR
[0454] The FAS receptor/FAS ligand (FAS/FASL) apoptosis signaling
pathway has been widely studied and is well characterized in T
cells. PD1 and CTLA4 are two major inhibitory signaling pathway in
T cells that have also been extensively studied. Direct evidence
for the potential therapeutic impact of targeting these pathways
came from studies in preclinical murine tumor models demonstrating
enhanced anti-tumor immunity after antibody-mediated blockade of
CTLA-4, PD-1 or PD-L1. Similar antibodies for use in humans have
been developed, and early clinical data showed promising results.
Ppp2r2d knockdown may also inhibit T-cell apoptosis and enhance
T-cell proliferation, as well as cytokine production. Ppp2r2d has
potential as a target to improve the function of human T cells.
[0455] To address this issue, CAS9 and three different gRNAs
targeting FAS, PD1, CTLA4, PPP2r2d were electro-transferred into T
cells. Sanger sequencing data showed that the indicated locus of
FAS, PD1, CTLA4, PPP2r2d had been modified by the CRISPRs. FAS was
also replaced by GFP with homologous recombination triggered by
CRISPR. FACS data showed the surface expression of FAS and PD1 was
abolished.
Example 8: Generation of IPS Cells with Gene Modified Primary and T
Cells
[0456] Progress in adoptive T-cell therapy for cancer and
infectious diseases is hampered by the lack of readily available
and antigen-specific human T lymphocytes. Pluripotent stem cells
could provide an unlimited source of T lymphocytes. To address this
issue, the expression of FAS, PD1, CTLA4, PPP2r2d were disrupted in
primary cells and T cells.
[0457] Sendai virus was used to reprogram primary cells and T
cells. There are multiple methods to generate iPSCs, including
virus-mediated gene transduction and chemical induction. While
lentiviral and retroviral vectors require integration into host
chromosomes to express reprogramming genes, DNA-based vectors, such
as adenovirus, adeno-associated virus, and plasmid vectors, exist
episomally and do not require integration. However, they may still
be integrated into host chromosomes at certain frequencies, and the
reprogramming efficiency is relatively low. Likewise, mRNA based
reprogramming is complicated and shown to be extremely
inefficient.
[0458] Unlike these methods, Sendai virus does not integrate into
the host genome or alter the genetic information of the host cell.
Sendai virus also has reprogramming potential comparable to
lentiviral- and retroviral-based gene transduction.
[0459] Each well in a 24 well plate was seeded with 0.1 million
wild type, FAS.sup.neg, CD3.sup.negTCR alpha chain and TCR beta
chain knock-out T cells. The cells were stimulated with CD3/CD28
beads. At day 3 post stimulation, the beads were removed, the cells
resuspended in 1 mL of pre-warmed T cell complete medium, and then
incubated with a calculated volume of CytoTune Sendai virus
comprising a polycistronic vector for expression of hKlf4, hOct3/4
and hSox2 in the cells (Lifetechnologies, Carlsbad, Calif.).
Treated T cells were seeded in 24 well plates, and centrifuged at
2250 rpm for 90 minutes at room temperature. An additional 1 mL of
complete T cell medium was added to each well and the plate was
incubated overnight at 37.degree. C. in a humidified atmosphere of
5% CO2.
[0460] On the day after transduction, Sendai virus was removed by
washing the T cells with fresh complete medium and culturing the
cells for 2 days. Media was half changed every day. On day 3 after
infection, cells were transferred to MEF feeder plates and cultured
in T cell medium without any cytokines. Four days after infection,
the cells were cultured in standard hES medium. Media was changed
every day. ES-like colonies were observed around day 7. The cells
were cultured in conditioned hES medium from day 15 and cultures
continued for an additional 10 days. Colonies were picked at around
25 to 30 days after transduction.
[0461] At around day 4, cell clumps were formed on feeder cells,
indicating that the initiation of the reprogramming process. T
cells went through dramatic morphological changes during the
process of reprogramming to iPSCs. At around day 12, large cell
clumps with loose edges began to emerge. At around day 18, T cells
were transformed to typical ES-like colonies with well defined
edges. Typical embryonic stem cell morphology was observed
indicating that the FAS.sup.neg, CD3.sup.neg TCR alpha chain and
TCR beta chain knock-out T cells were induced to a pluripotent
state under defined reprogramming conditions (FIGS. 17A and
18A).
[0462] FAS.sup.neg T cells were easier to reprogram to iPSCs, at an
efficiency of about 5 times of its wild type counterparts (FIG.
17B). Likewise, reprogramming CD3.sup.neg T cell was about 5 times
more efficient than the wild type counterparts (FIG. 18B). p53
deficient cell lines have been reported be easier to reprogram
since the apoptosis pathway is hindered. FAS knock-out further
induces apoptosis resistance. While loss of TCR expression makes T
cells less healthy, an indication that apoptosis plays an important
role in the process of reprogramming.
Example 9: Knockdown of TCR in T Cells with siRNA
[0463] FIG. 19 is a graph showing IFN-gamma production of wild type
NY-ESO-1 TCR (wt) or modified NY-ESO-1 TCR with a second disulfide
bond and de-N-glycosylation to the beta chain (S/SD). RNA was
electroporated into T cells with endogenous T cell receptors (TCRs)
knocked down with siRNA. IFN-gamma was detected by ELISA after the
T cells were stimulated with a HLA-A2 positive cell line pulsed
with NY-ESO-1 specific peptide, p156-165, for 18 h.
[0464] FIG. 20, comprising FIGS. 20A and 20B, shows TCR alpha
knockdown by CAS9 RNA and gRNA co-electroporation. Six days after
electroporation, cells were analyzed for TCR expression by
assessing CD3.
[0465] FIG. 21 shows Sanger sequencing. Results show multiple peaks
in CD3 negative enriched T cells, with either CAS9 mRNA and gRNAs
electroporated to knockdown TCR alpha (TRAC-5) or TCR beta
(TRBC-7).
[0466] FIG. 22 is a panel of graphs showing CD3 negative T cells
with endogenous TCR beta (TRB-7) knockdown re-expressed CD3 four
hours after NY-ESO-1 TCR alpha and beta (1G4LY95 TCR) RNA
electroporation. Normal T cells (ND424 Beads) were used as control,
which showed nearly 100% CD3 positive with 5.25% endogenous TCR
vb13.1 expression.
[0467] FIG. 23, comprising FIGS. 23A-23D, is a panel of graphs
showing knock down of endogenous TCR enhanced with both transgene
expression and function of TCR RNA electroporated T cells. FIG. 23A
shows TCR expression of T cells electroporated with TCR siRNA
(solid open histogram), control siRNA (dotted open histogram) and T
cells without any siRNA (filled histogram). FIG. 23B shows
transgene (TCR vb13.1) expression of wild type NY-ESO-1 TCR (wt) or
modified TCR (SD) RNA electroporated T cells with TCR siRNA,
control siRNA, or no siRNA. FIG. 23C shows NY-ESO-1 tetramer
staining of wild type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA
electroporated T cells with TCR siRNA, control siRNA, or no siRNA.
FIG. 23D shows specific lysis of a HLA-A2/NY-ESO-1 positive tumor
line by TCR siRNA knockdown, wildtype NY-ESO-1 TCR RNA
electroporated T cells.
[0468] FIG. 24 is a graph showing fluorescence of tumor cells after
injection of T cells into a mouse model. Ten million
Nalm6-CBG-ESO-GFP (click beetle green) tumor cells that expressed
both NY-ESO-1 and GFP were intravenously injected into NOD/SCID
mice. Five days after tumor inoculation, CBR (click beetle red)
transduced and RNA electroporated T cells were injected as
indicated in the different groups and tumor growth was monitored by
bioluminescent image (BLI).
[0469] FIG. 25 show bioluminescent images of the mice from two
groups that had been treated by CD19BBZ CAR RNA T cells or modified
NY-ESO-1 TCR RNA at different time points.
Example 10: Universal CAR19 T Cells Generated by Combination of
Lentiviral Transduction and Disruption of the TCR-CD3 Complex on T
Cells Using CRISPR
[0470] As shown in FIG. 26, primary T cell were stimulated with
anti-CD3/anti-CD28 beads at day 0, and then transduced with
lenti-CAR19. Over 70% of the cells were CAR19 positive as detected
by flow cytometry. Since transient expression of CRISPR is
sufficient to mediate gene knockout, a "hit-and-run" delivery
strategy was developed to transiently express CRISPR by utilizing
electro-transfer of in vitro transcribed RNA encoding CAS9 and
gRNAs targeting the constant regions of TCR .alpha. chain, TCR
.beta. chain, and beta-2 microglobulin gene on day 3. T cells were
cultured for 24 hours at 32.degree. C. after electrotransfer, then
returned to normal condition.
[0471] To measure TCR expression, a monoclonal antibody specific
for CD3 was used. CD3 was chosen as CD3 is only present on the cell
surface when TCRs are expressed. CRISPR constructs were
electroporated into primary T cells (FIG. 26). TCR single negative
and TCR/HLA-A double negative cells were expanded by exposure to
CD19 presenting K562 cells, which resulted in >100 fold
expansion (FIG. 27).
[0472] After expansion, the cells remained TCR single negative or
TCR/HLA-A double negative, and the CAR19 positive population was
enriched. Endogenous TCR expression remained negative in TCR single
negative cells, while TCR and HLA-A expression remained negative in
TCR/HLA-A double negative T cells after K562-CD19 stimulated
expansion (FIG. 28A). CAR19 positive cells were enriched by
K562-CD19 stimulated expansion (FIG. 28B).
[0473] The majority of expanded universal T cells were CD45RO
positive (FIG. 29A) and retained high levels of CD62L expression
(FIG. 291B), medium levels of CD28 expression (FIG. 29A) and low
levels of CCR7 expression (FIG. 29B).
[0474] CRISPR gene editing did not affect the anti-tumor activity
of universal CAR19 T cells in vitro (FIG. 30A). Depletion of TCR or
TCR/HLA-A had minimal effect on CAR19 expression and anti-tumor
activity (FIGS. 30B and 30C). TCR single and TCR/HLA-A double
negative CAR19 T showed robust lytic capacity when challenged with
Nalm6 tumor cells (FIG. 30B). CD107a release and cytokine secretion
also showed potent anti-tumor activity in the universal cells (FIG.
30C). TCR single ablation or TCR and HLA-A double ablation CAR19 T
cells exhibited similar proliferation kinetics after challenge with
CD19 expressing cells (FIG. 30D).
[0475] To test the anti-tumor activity of CRISPR/CAS9 edited CAR19
T cells, TCR single negative, TCR and HLA-A double negative CAR19 T
were infused into NSG mice bearing Nalm6 tumor cells. All the mice
receiving unmanipulated T cells and mice infused with lentiviral
GFP transduced wild type T cells died within 3 weeks after tumor
cell infusion. Objective tumor regression was observed for mice
receiving CAR19 T cells (FIG. 6). CRISPR/CAS9 was found to not
affect the in vivo tumor killing activity of CAR19 T cells, thus,
confirming the advantage of combining lentiviral gene transfer and
CRISPR/CAS9 for T cell therapy.
[0476] Full ablation of TCR .alpha. and .beta. chains and HLA-A
molecule on T cells completely abrogated non-specific killing when
the cells were challenged with HLA unmatched tumor cell lines (FIG.
32A), Elimination of HLA-A molecules activated NK cells after a
long period of co-culture (5 days). No off-target activity was
observed when these cells were challenged by allogeneic whole blood
PBMC after 24 hours in an IFNr Elispot assay. The lack of
off-target activity suggests T cells may play a dominant role in
acute immune responses after encountering allogeneic cells. All of
the results suggest that CRISPR/CAS9 edited TCR .alpha. and .beta.
chains and HLA-A molecules (triple negative) T cells could serve as
a source of universal effector donor cells.
[0477] CAS9 and different gRNAs targeting FAS were
electro-transferred into T cells. FASneg cells were sorted and then
transduced with lentiviral CAR19. Flow cytometry and Sanger
sequencing data showed that FAS had been modified by the CRISPRs
(FIG. 33). CAR19 gene expression of FASneg T cells was comparable
to the wild type. Even after a short period of incubation with
Nalm6 tumor cells, CD107a expression was greatly enhanced in FASneg
CAR19 T cells compared to wild type counterpart cells even within 4
hours of co-culture.
[0478] Some reports showed that even weak antigenic stimuli can
trigger FAS activation to promote T cell proliferation (Rethi, et
al, Blood, vol. 112(4):1195-1204, 2008). Interestingly, FASneg
CAR19 T cells expanded much quicker than the wild type CAR19 T
cells when the cells were stimulated by high levels of CD19+ K562
cells. This suggests that FAS/FASL triggered apoptosis instead of
activation under high level antigenic conditions (FIG. 34A). FASneg
CAR19 T cells further showed reduced apoptosis levels as measured
by Annexin V staining (FIG. 34B).
[0479] As had been observed in vitro, FASneg T cell showed enhanced
proliferation as compared to wild type T cells. Similar
proliferation results were observed when a True Count assay of
CAR19 T cells was performed after infusion of the cells into Nalm6
bearing mice. The FASneg CAR19 group showed superior anti-tumor
activity when compared to the wild type group (FIG. 35B). This
difference is illustrated in the graph of FIG. 35C showing the
bioilluminescence data between those two groups. These data
indicate that FAS ablation in CART cells enhanced its anti-tumor
activity.
[0480] CAS9 and different gRNAs targeting PD1 were
electro-transferred into T cells after lentiviral transduction with
PSCA-CAR. PD1 knock out cells were confirmed by surface PD1
expression after CD3/CD28 bead stimulation (FIG. 36). PD1 negative
cells were enriched by microbead depletion and then stimulated with
PSCA antigen presenting PC3 tumor cells. PSCA-CAR positive cells
were enriched both in the wild type and the PD1 negative groups.
After incubation with PC3-PSCA-PDL1 tumor cells, PD1 expression was
quickly upregulated on the surface of wild type PSCA-CAR T cells,
with very low levels of PD1 expression detected on PD1 negative
PSCA-CAR T cells (FIG. 37). PD1 negative PSCA-CAR T cells also
showed greatly enhanced and sustained high levels of CD137
expression (FIG. 37), a marker of T cell activation, indicating
that the PD1/PDL1 inhibitory signaling pathway was blocked.
[0481] When tested in an in vivo PC3-PSCA-PDL1 NSG model,
significant enhanced anti-tumor activity was detected in the PD1
negative PSCA-CAR T cell group compared to the wild type group
(FIGS. 38A and 38B) suggesting a therapeutic value of PD1 ablation
for CART cell therapy.
[0482] To test the graft vs host disease (GVHD) effect of CRISPR
engineered universal CART cells, a high T cell dose was given to
NSG mice with Nalm6 leukemia. The mice were treated with double or
triple knock out CART cells and did not show any signs of
developing GVHD. By contrast, 3 out of 4 mice from the wild-type
CD19 CART group developed GVHD by day 65, which was confirmed by
histological examination of different organs (FIG. 39).
[0483] In another experiment, the cells were resuspended in FBS and
infused intravenously into mice after a sub-lethal irradiation.
Clinical GVHD was monitored 2 to 3 times per week. Four out 5 mice
receiving wild type T cells died during the 60 day study, while PBS
treated, TCR single and TCR/HLA-I double ablated T cell treated
groups did not show any signs of GVHD. Mice receiving wild type T
cells underwent body weight loss. However, PBS treated, TCR single
and TCR/HLA-I double ablated T cell treated groups slightly gained
weight during the study (FIGS. 40A and 40B).
[0484] T cells were treated with Cas9 and gRNAs targeting CD3, B2M
and PD1 or Fas after lentiviral CD19-CAR transduction. Triple knock
out universal CART cells were injected into mice bearing Nalm6-PDL1
tumors. Superior anti-tumor activity was observed in mice receiving
PD1/CD3/HLA-I triple knock out cells as compared to CD3/HLA-I
double knock out cells, further indicating the therapeutic value of
blocking the PD1 signaling pathway (FIGS. 41A and 41B). These data
supply a way to enhance the treatment of universal CART cells with
CRISPR/Cas9.
[0485] As gRNAs are prone to degrade, a simplified one-shot method
was developed to generate universal CART cells. gRNAs were
constitutively expressed together with CARs in a single lentiviral
vector. Naive T cells were transduced by lentivirus encoding gRNAs
and CARs one day after stimulation with CD3/CD28 Dynabeads. The
cells were electroporated with Cas9 mRNA at day 3 (FIG. 42). This
system allows the manipulation of several genes with one vector
(FIG. 42). CD3 expression was confirmed by flow cytometry at day 6.
T cells treated with the one-shot system showed consistent gene
ablation as high as 90% in each of the different Cas9 mRNA groups
(FIG. 43).
[0486] Progress in adoptive T-cell therapy for cancer and
infectious diseases has been hampered by the lack of readily
available antigen-specific human T lymphocytes. Pluripotent stem
cells could provide an unlimited source of T lymphocytes. To
address this issue, expression of FAS, PD1, CTLA4, and PPP2r2d was
disrupted in primary cells and T cells.
[0487] Sendai virus was used to reprogram primary cells and T
cells. There are multiple methods available for the generation of
iPSCs, including virus-mediated gene transduction and chemical
induction. While lentiviral and retroviral vectors require
integration into host chromosomes to express reprogramming genes,
DNA-based vectors, such as adenovirus, adeno-associated virus, and
plasmid vectors, exist episomally and do not require integration,
however, they may still be integrated into host chromosomes at
certain frequencies, and the reprogramming efficiency is relatively
low. Likewise, mRNA based reprogramming is complicated and has
proven to be extremely inefficient. In contrast, Sendai virus does
not integrate into the host genome or alter the genetic information
of the host cell. Sendai virus also has reprogramming potential
comparable to lentiviral- and retroviral-based gene
transduction.
[0488] Each well in a 24 well plate was seeded with 0.1 million
wild type, FASneg, CD3neg TCR alpha and beta chain knock-out T
cells. The cells were stimulated with CD3/CD28 beads. At day 3 post
stimulation, the beads were removed, the cells were resuspended in
1 mL of pre-warmed T cell complete medium, and then incubated with
a calculated volume of CytoTune Sendai virus comprising a
polycistronic vector for expression of hKlf4, hOct3/4 and hSox2 in
the cells (Lifetechnologies, Carlsbad, Calif.). Treated T cells
were seeded in 24 well plates, and centrifuged at 2250 rpm for 90
minutes at room temperature. An additional 1 mL of complete T cell
medium was added to each well and the plate was incubated overnight
at 37.degree. C. in a humidified atmosphere of 5% CO2.
[0489] On the day after transduction, Sendai virus was removed by
washing the T cells with fresh complete medium and culturing the
cells for 2 days. Media was half changed every day. On day 3 after
infection, cells were transferred to MEF feeder plates and cultured
in T cell medium without any cytokines. Four days after infection,
the cells were cultured in standard hES medium. Media was changed
every day. ES-like colonies were observed around day 7. The cells
were cultured in conditioned hES medium from day 15 and cultures
continued for an additional 10 days. Colonies were picked at around
25 to 30 days after transduction.
[0490] Around day 4, cell clumps were formed on feeder cells,
indicating the initiation of the reprogramming process. T cells
went through dramatic morphological changes during the
reprogramming process to iPSCs (FIG. 44A). Around day 12, large
cell clumps with loose edges began to emerge. Around day 18, T
cells were transformed to typical ES-like colonies with
well-defined edges. FASneg T cells were reprogrammed to iPSCs at an
efficiency of about 5 times of the wild type counterparts (FIG.
44B). p53 deficient cell lines have been reported as easier to
reprogram due to the hindrance of the apoptosis pathway. FAS knock
out may facilitate the reprogramming process using a similar
mechanism.
[0491] ES-like morphology of iPSCs reprogrammed from CD3neg TCR
alpha or beta chain knock out T cells was observed (FIG. 45A). The
morphology remained constant after several passages. Reprogramming
of CD3neg T cells was about 5 times less efficient than the wild
type counterparts (FIG. 45B), suggesting that TCR knock-out may
play a role in the process of T cell reprogramming or affect the
cell viability after Sendai virus infection. FIG. 45C is a panel of
images showing phosphatase staining of CD3neg iPSC cells.
[0492] Typical embryonic stem cell morphology was observed
indicating that the FASneg, CD3neg TCR alpha and beta chain
knock-out T cells were induced to a pluripotent state under defined
reprogramming conditions. While loss of TCR expression makes T
cells less healthy, the data described herein suggests that
apoptosis plays an important role in the process of
reprogramming.
[0493] Induction of endogenous pluripotent stem cell genes was also
detected in the different T-iPSC cell lines (FIG. 46).
Immunostainings for Tra-1-60 and SSEA4 expression further indicated
the stem cell phenotype of the T-iPSC cells (FIG. 47A). Fas knock
out was confirmed in the T-iPSCs by Sanger sequencing (FIG.
47B).
[0494] dCas9 and Fok1-Cas9 were reported to have less off-target
activity. T cells were evaluated if they could be edited by a
modified version of the CRISPR/dCAS9 and CRISPR/Fok1-CAS9 system
(FIG. 48A). Flow cytometric data showed primary T cells were edited
by both CRISPR/dCAS9 and CRISPR/FokI-CAS9 (FIG. 48B). The
CRISPR/dCAS9 gene knock out system exhibited enhanced specificity
with at least one pair of gRNAs, rendering the knock out event more
precise and more specific.
[0495] To test the off-target events of CRISPR/CAS9 in T cells, a
surveyor assay was performed at off target sites. For the genes
tested, no obvious cleavage was observed at the genomic loci (FIG.
48C).
Example 11: Multiplex Genome Editing
[0496] CART cells were generated by using a CRISPR/Cas9 system to
simultaneously disrupt multiple genomic loci. The CART cells were
deficient in the expression of endogenous TCR and HLA class I
(HLA-I) molecules for use as allogeneic universal CART cells. T
cell receptor (TCR) .alpha. chain, TCR .beta. chain and beta-2
microglobulin (B2M) genes were disrupted with high efficiency
through the co-electroporation of mRNA encoding Cas9 with gRNAs
targeting these genes. Universal TCR or CART cells were generated
by combining lentiviral (LV) delivery of CAR and CRISPR RNA
electroporation to disrupt endogenous TCR and B2M genes
simultaneously. In addition, disruption of endogenous PD1 enhanced
the efficacy of CAR therapy in a solid tumor model.
Multiple Deliveries of gRNAs Disrupts Genes in Human Primary T
Cells with High Efficiency without Impairing Effector Function
[0497] Efficient multiplex genomic editing is required to generate
universal T cells that are deficient in TCR, HLA and other genes.
CRISPR/gRNA RNA electroporation was optimized to achieve efficient
gene disruption in T cells. First, Cas9 and gRNAs were
co-electroporated with RNA generated using an in vitro
transcription system (FIG. 49, left), and a "hit-and-run" delivery
strategy was developed to transiently deliver the Cas9 mRNA and
gRNAs to T cells by electroporation (FIG. 49, right).
[0498] An initial experiment targeting the TCR .alpha. constant
region (TRAC) or .beta. constant region (TRBC) with single
electroporation resulted in 1% to 3% CD3-negative (CD3.sup.neg) T
cells, respectively, (FIG. 50A, upper graphs). To determine if
transient exposure to mild hypothermia allowed more efficient gene
disruption, cells were edited at 37.degree. C. or 32-C.
CRISPR-mediated disruption of TRAC and TRB was increased up to
4-fold when T cells were cultured for 24 h at 32.degree. C. after
Cas9/gRNA co-electroporation (FIG. 50A, lower graphs). The optimal
molecular ratio of Cas9:gRNA for maximum disruption efficiency was
1:1 to 2:1, and the gene disruption efficiency was correlated with
the amount of electro-transferred mRNA (FIG. 51A).
[0499] Compared with mRNA, gRNAs are more prone to rapid
degradation, which potentially limits the targeting efficiency.
Thus, multiple, sequential electroporations of gRNA were tested
after the initial Cas9/gRNA electroporation. There was a marked
increase in disruption frequency at the protein level, as 82.4% of
cells were CD3.sup.neg after the third gRNA electroporation (FIG.
50B). Clonal sequencing showed that the genomic targeting
efficiency reached 89.4% after the third gRNA electroporation (FIG.
51B). A surveyor assay confirmed a cleavage rate of 81.7% and 49.3%
at the genomic loci of TRAC and TRBC, respectively, after a third
electroporation of gRNAs (FIG. 52). Multiple peaks in the Sanger
sequencing data flanking the TRAC and TRBC target sites confirmed
that the genomic reading frame shifted downstream of the target
sites (FIG. 53A). The occurrence of insertions or deletions
(indels) caused by the NHEJ mediated by CRISPR/Cas9 was confirmed
by clonal sequencing (FIG. 53B). The TCR disrupted TCR/CD3.sup.neg
population was enriched to over 99% (99.70.+-.0.20%) by a single
step of CD3 negative selection (FIG. 54).
[0500] To develop methods to expand the TCR/CD3.sup.neg T cells,
TCR/CD3.sup.neg T cells were co-electroporated with the HLA-A2
restricted 1G4 NY-ESO-1 TCR (.alpha.+.beta.) RNAs to restore CD3
expression (FIG. 55, left panel). Following T cell
stimulation/expansion methods, the following were compared: 1) a
rapid T cell expansion protocol (REP) using PBMC as feeder cells,
2) anti-CD3/CD28 Dynabeads (Beads), or 3) OKT3 loaded K562-based
artificial antigen-presenting cells expressing ligands for CD28 and
4-1BB (K562 aAPC). TCR/CD3.sup.neg T cells were also electroporated
with CD19 CAR RNA (FIG. 55, right panel) and then stimulated by
irradiated K562 aAPC that expressed CD19 (K562-CD19). Fold
expansion values of 751.0.+-.217.1, 35.7.+-.9.3, 46.3.+-.8.5 and
57.5.+-.5.0 were achieved for REP, Beads, K562 aAPC and K562-CD19,
respectively, after a single stimulation for 10 days (FIG. 56).
[0501] To test whether CRISPR/Cas9 gene editing would affect the
phenotype and function of the T cells, the phenotype of
TCR/CD3.sup.neg T cells expanded by the different methods was
examined and showed that all of the expanded cells remained CD3
negative and most retained a high level of CD27 (from 79.8% to
93.4%), consistent with a central memory cell phenotype (FIG. 57).
The expanded TCR/CD3.sup.neg T cells were electroporated a second
time with CD19 CAR mRNA to test their anti-tumor activities. The
surface CAR expression of the TCR/CD3.sup.neg T cells was equal to
that of the control group (FIG. 58). When the TCR/CD3.sup.neg CD19
CAR T cells were stimulated with CD19.sup.+ Nalm6 leukemia cells,
the CD107a up-regulation (FIG. 59A), cytokine secretion (FIG. 59C)
and killing activity (FIG. 59B) of CD19 CAR.sup.+ TCR/CD3.sup.neg T
cells was equivalent to those of the wild-type control cells. The
CD19 CAR TCR/CD3.sup.neg T cells were infused into Nalm6-bearing
NSG mice to test their in vivo anti-tumor activity. Tumor
regression was evident with an efficacy equivalent to that for the
CART 19 wild-type counterpart cells (FIGS. 59D and 59E). The
results indicate that CRISPR/Cas9 editing of the endogenous TCR did
not adversely affect the function of primary T cells for adoptive
immunotherapy.
Reduced Alloreactivity of TCR .alpha., .beta. and B2M
Triple-Disrupted T Cells.
[0502] Disrupting both TCR .alpha. and .beta. chains is required to
prevent TCR miss-pairing-associated toxicity for TCR-redirected T
cell adoptive immunotherapy and B2M is essential for the assembly
and expression of HLA-I complex. In view of this, TCR .alpha. and
.beta. chains and B2M triple disruption was developed to generate
universal T cells. First, the ability of eliminating HLA-I
expression on the T cells by disrupting B2M was tested. T cells
were electroporated with B2M-targeting Cas9/gRNA RNA. This resulted
in a B2M and HLA-I double-negative population of 79.9%. The
HLA-I.sup.neg population could be further enriched by negative
selection (FIG. 60).
[0503] To generate triple-knockout T cells lacking the TCR .alpha.,
.beta. chains and B2M, Cas9 mRNA was co-electroporated with three
different gRNAs targeting TRAC, TRBC and B2M. As a result, the CD3
and HLA-I double-negative cell population was 65.4% (FIG. 61).
After enrichment of the double and triple knockout cells, the TCR
.alpha. and .beta. chains and B2M triple-knockout T cells abrogated
the non-specific killing of HLA unmatched tumor cell lines (FIG.
62). No response was observed when these cells were challenged by
allogeneic whole-blood irradiated PBMCs in an IFN.gamma. Elispot
assay (FIG. 63, left panel). The ablation of HLA-I molecules also
sharply reduced the allo-reactivity, as confirmed by co-culture of
allogenic PBMCs with irradiated B2M-disrupted cells (FIG. 63, right
panel). The results above suggest that triple-negative T cells that
lack TCR .alpha. and .beta. chains and B2M could potentially serve
as a source of universal T cells for adoptive immunotherapy,
resisting rejection by the host immune system while unable to cause
graft versus host disease.
Improved Anti-Tumor Activity of TCR Redirected, Endogenous
TCR-Disrupted T Cells.
[0504] T cells with CRISPR/Cas9-disruption of TCR .alpha. and
.beta. chains showed elevated transgenic TCR expression on the cell
surface after being redirected with an NY-ESO-1 TCR (1G4).
Transgenic TCR expression was 67.6%, 78.8% or 94.3% for the TCR
.alpha. or .beta. chain single knockout or the .alpha./.beta.
double knockout, respectively, compared with 46.8% for wild-type T
cells. The improved transgenic TCR expression led to enhanced T
cell function, as evidenced by increased antigen-specific CD107a
expression (FIG. 65A) and enhanced cytotoxicity (FIG. 65B),
especially for the .alpha./.beta. double-knockout T cells.
[0505] In a separate experiment, .alpha./.beta. double-knockout T
cells were transfected with a different NY-ESO-1 TCR (8F). Relative
to 1G4 TCR, this 8F TCR exhibited a higher significant improvements
in both transgenic TCR expression (FIG. 66; 60.1% for
TCR/CD3.sup.neg versus 44.7% (with .about.5% endogenous TCR
V.beta.8 background) for wild-type T cells (Cas9 Mock T cells)) and
function (CD107a expression in FIG. 67A, and cytokine production in
FIG. 67B). These results highlight the differential influence of
endogenous TCR on transgenic TCR expression and function.
Universal CART Cells Retain Antitumor Efficacy and do not Cause
GVHD.
[0506] Universal CD19 CART cells were generated by combining LV
transduction of CD19 CAR with RNA electroporation of Cas9/gRNAs
(FIG. 68). The cells were expanded and the remaining CD3.sup.neg
cells had high levels of CD19 CAR expression (FIG. 69). The
majority of the expanded T cells were CD45RO positive and retained
a high level of CD62L expression and a medium level of CD28
expression, consistent with a central memory cell status (FIG. 70).
The expanded TCR/HLA-I double-negative CD19 CART showed robust in
vitro anti-tumor activities, such as CD107a release (FIG. 71),
cytokine secretion (FIG. 72), lytic capacity (FIG. 73), and
proliferation (FIG. 74), that was as potent as those of the
wild-type CD19 CART cells.
[0507] The T cells were infused into NSG mice bearing disseminated
Nalm6 leukemia. Mice treated with CART cells with a disrupted
endogenous TCR (LV-CD19 CAR TCR.sup.neg) or with a simultaneous
disruption of TCR and HLA-I (LV-CD19 CAR TCR/HLA-I.sup.neg)
exhibited tumor regression similar to that of mice treated with
wild-type CD19 CART cells (LV-CD19 CAR) (FIGS. 75A and 75B),
suggesting that the disruption of TCR alone or together with B2M
did not affect CART cell anti-tumor activity.
[0508] To test the GVHD effect of the engineered T cells, a high T
cell dose (20.times.10.sup.6/mouse) was given to NSG mice with
Nalm6 leukemia. As shown in FIG. 76, mice treated with CD19 CART
cells with TCR disruption alone (LV-CD19 CAR TCR/CD3.sup.neg) or
the simultaneous disruption of TCR and B2M (LV-CD19 CAR
TCR/HLA-I.sup.neg) exhibited similar tumor regression compared with
that of the wild-type CD19 CAR T cells (LV-CD19 CAR). Mice treated
with the double or triple knock out CAR T cells did not develop any
signs of GVHD. By contrast, 3 out of 4 mice from the wild-type CD19
CART (LV-CD19 CAR) group developed GVHD at day 65, which was
confirmed by histological examination of different organs. Thus,
the disruption of TCR alone or together with HLA-1 did not affect
the in vivo anti-tumor activity of CART cells while eliminating
alloreactivity.
Adenoviral CRISPR Delivery into Primary T Cells.
[0509] The CRISPR/Cas9 system are rapidly being harnessed for gene
regulation and gene editing purposes in model organisms and cell
lines. Viral vectors may be particularly fit to broaden the
applicability of CRISPR to other cell types, including dividing and
quiescent primary cells. Adenovirus, namely second-generation
fiber-modified adenovirus encoding Cas9 and single guide RNA (gRNA)
molecules, were used to bring Cas9 nuclease to the PD1, Fas and
TRAC loci (FIG. 77). Adenoviral-mediated transduction of CRISPR
into tumor cells (FIG. 78) yielded high rates of targeted
mutagenesis of up to about 71% (FIGS. 79A and 79B). Adenovirus
appears to constitute a valuable platform for introducing CRISPR
into human T cells regardless of their quiescent status. This
approach will aid investigating the potential for CRISPR gene
regulation and editing in numerous experimental settings.
Electroporation Optimization.
[0510] CD3 and B2M knock-out efficiency and T cell expansion were
assessed after Cas9 and gRNA electroporation (EP) in 4 mm cuvettes
and 2 mm cuvettes. Standard EP conditions with a 2 mm cuvette (360
v/1 ms, 1.sup.st EP -20 .mu.g Cas9 RNA+10 .mu.g gRNA/100 .mu.l T
cells, 2.sup.nd EP 5 .mu.g gRNA/100 .mu.l T cells) showed the
highest CD3 and B2M knockout percentages, 81.8% and 88.6%,
respectively, with T cell expansion at about 2.7 fold (EP#1),
compared with about 18.8 fold expansion of control EP T cells
(EP#12) Decreasing the gRNA dose (EP#2-5) dramatically increased T
cell expansion, but only slightly affected CD3 and B2M knock-out
efficiency. See FIG. 80. Standard EP conditions with a 4 mm cuvette
resulted in dramatically decreased CD3 and B2M knockout efficiency
(EP#8), suggesting that the EP conditions (voltage or/and pulse
length) need to be further optimized for use with 4 mm
cuvettes.
[0511] Compared with standard electroporation (EP) conditions in a
2 mm cuvette (EP#10-13) or 4 mm cuvette. High CD3/B2M knockout
efficiency was observed with improved T cell fold expansion (EP#1
and 5). See FIG. 81.
[0512] To further optimize EP conditions to achieve maximum T cell
fold expansion with CD3/B2M knockout efficiency over 60%, different
EP conditions and RNA amounts were tested. The results showed that
fold expansion was improved with relatively high CD3/B2M knockout
efficiency (63.5% for CD3 and 84.8% for B2M) for EP#4 (400 v/2
ms/120 .mu.g CAS9 RNA) for EP#1 and (500 v/1 ms/20 .mu.g gRNA) for
EP#2. See FIG. 82.
[0513] Additional experiments were performed to optimize EP
conditions. Results showed that compared with the most favorable
condition tested (EPI#1 in FIG. 82), using 500 v/1 ms/120 .mu.g
CAS9 RNA (EP#1) and 500 v/1 ms/20 .mu.g gRNA (EP#2) produced
increased CD3/B2M knockout efficiency and T cell expansion (EP#3).
See FIG. 83.
Large-Scale Electroporation and Expansion.
[0514] Experiments were performed to determine if large-scale
electroporations could yield high knock-out and expansion
efficiencies. On day 0, anti-CD3/anti-CD28 beads were used to
stimulate T cells obtained from 3 donors (100.times.10.sup.6
cells/donor, concentrated to 0.5.times.10.sup.6/ml). On day 1,
stimulated T cells were transduced with CD19 CAR lentivirus. 50 mL
(25.times.10.sup.6 cells) of T cells were reserved as unmodified T
cells (Group 9). On Day 3, the beads were removed and the
transduced T cells from each donor were separated into two groups,
CART/mock EP (10 mL, 5.times.10.sup.6) and CART/CRISPR (10 mL,
50.times.10.sup.6). The cells were then electroporated with CAS9
RNA (1st EP) and Groups 1, 3, 5 and 7 cells were split. On day 4,
the gRNA was electroporated into the T cells and the cells were
cultured at 1.times.10.sup.6 cells/mL, On days 5 and 7, the cells
were split. On day 8, CD3+ cells were removed from Groups 2, 4 and
6. On day 11, the T cells were harvested and 25.times.10.sup.5
cells from the three donors were sent for karyotyping.
TABLE-US-00003 TABLE 1 Experimental groups. Group # Donor T cells 1
ND391 CART/MOCK EP 2 ND391 CART/CRISPR 3 ND463 CART/MOCK EP 4 ND463
CART/CRISPR 5 ND463 UNMOD 6 ND469 CART/MOCK EP 7 ND469
CART/CRISPR
[0515] T cell numbers (upper chart of FIG. 85) and fold expansion
(lower chart of FIG. 85) were assessed after the electroporation
and culturing procedure. Fold expansion of the T cells transduced
with CD19 CAR alone (TD alone) or transduced with CD19 CAR and
edited with CRISPR (TD/KO) is shown in the left graph of FIG. 86
and fold expansion of the T cells on day 10 is shown in the right
graph of FIG. 86. By optimizing electroporation conditions and
CAS9/gRNA doses, approx. 60-70% CD3/B2M knock-down efficiency and
approx. 30 fold T cell expansion was observed after 10 days (FIG.
87 shows CD3/B2M/CAR expression at day 10).
[0516] Eight days after CD3/CD28 bead stimulation and CRISPR RNA
electroporation, CD3 positive T cells were removed. FIG. 88 shows
CD3/B2M expression in the three donor populations at day 8. On day
11, T cells were subjected to FACS staining to detect CD3, B2M and
CAR expression. ND463 non-transduced (NOTD) were used as a negative
control. FIG. 89 shows CD3 and B2M expression in CD19 CAR TD
(transduced)/CRISPR electroporated, CD3 depleted T cells; CD19 CAR
TD/CRISPR electroporated T cells; and CD19 CAR TD T cells. FIG. 90
shows CAR expression in CD19 CAR TD/CRISPR electroporated, CD3
depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and
CD19 CAR TD T cells. FIG. 91 shows CD3/B2M/CAR expression on day 11
in CD19 CAR TD (transduced)/CRISPR electroporated, CD3 depleted T
cells; CD19 CAR TD/CRISPR electroporated T cells; and CD19 CAR TD T
cells. FIG. 92 summarizes CD3/B2M/CAR expression in the different T
cells groups.
[0517] On day 11 the different T cell groups, as indicated in FIG.
93, were stimulated by a CD19 positive cell lines, Raji or Nalm6.
K562 was used as a CD19 negative control. After 4 hr of
coculturing, CD107a up-regulation was detected in each of the T
cell groups, except the negative controls.
[0518] On day 11, killing ability of the T cells, as indicated in
FIG. 94, were tested using a luminescent cytotoxic lymphocyte (CTL)
assay after coculturing the T cells with CD19 positive target
cells, Nalm6-CBG. Also on day 11, cytokine production of the T
cells was analyzed by stimulating the T cell groups with Nalm6
target cells, see FIG. 95.
[0519] The T cells were cultured in medium containing 100 U/ml of
IL-2 for up to 26 days. The results shown in FIG. 96 indicate no
abnormal T cell growth was observed for the CRISPR edited T cells
from the three donors.
[0520] As one of most attractive applications of the CRISPR/Cas9
system, multiplex genome editing holds great promise for advancing
T cell-based adoptive immunotherapy. However, the low targeting
efficiency of DNA transfection limits the use of multiplex genome
engineering in primary T cells. A "hit-and-run" delivery strategy
was developed to introduce CRISPRs to T cells via the
co-electroporation of Cas9 mRNA and gRNA.
[0521] Through a combination of up to three rounds of gRNA
electroporation with transient exposure to mild hypothermia, a
targeting efficiency of >80% at the protein level was routinely
achieved for a single gene disruption. More encouragingly, triple
gene disruption of TRAC, TRBC and B2M yielded double negative CD3
and HLA-I at about 65% without any purification and selection. The
results also demonstrate that enrichment to >99% purity of
gene-disrupted T cells was easily achieved using clinically
approved paramagnetic beads and that the purified T cells were
expanded up to 500-fold in 10 days. The expanded T cells maintained
their gene disruption phenotype and displayed features consistent
with central memory T cells. The disrupted T cells did not cause
GVHD, suggesting that they may be used as allogeneic CAR T cells.
Importantly, the gene-edited T cells showed anti-tumor activities
both in vitro and in different tumor mouse models that were as
potent or more potent than non-gene edited T cells. Thus, the
process described herein to generate synthetic cells could be
easily translated into current GMP-compliant manufacturing
procedures.
[0522] The data described herein demonstrates that CRISPR/Cas9 is a
powerful multiplex genome editing tool in primary human T cells.
Previous reports have shown that T cells can be genetically edited
by ZFNs or TALEN to eliminate the expression of the endogenous TCR
.alpha. and .beta. chains to avoid GVHD. Due to the complexity of
the targeting strategies for manipulating multiple genes by zinc
finger nucleases (ZFN) and TAL effector nuclease TALEN in T cells,
previous studies have not been able to prevent GVHD and
host-versus-graft reaction simultaneously in pre-clinical animal
models. NK cell activation can also be aborted by the ablation of
stimulatory NK ligands by CRISPR/Cas9 or by the expression of
nonclassical HLA class I molecules such as HLA-E, which could
potentially protect universal T cells from NK-cell-mediated
rejection.
[0523] In summary clinical scale universal CART cells, with potent
anti-tumor activity and reduced alloreactivity can be efficiently
generated using multiplex CRISPR technology. This approach can be
incorporated into current GMP-compliant manufacturing procedures
and has a high potential for translation, given the successful
translation of adoptive transfer therapy with ZFNs for HIV/AIDS. It
is possible that universal CAR and TCR T cells will provide an
alternative to autologous T cells. Indeed, it is conceivable that
universal CAR and TCR T cells with disabled checkpoint molecules
may be more efficacious and have wider use than current CART
therapy using autologous T cells against cancers and infectious
diseases.
Other Embodiments
[0524] The recitation of a listing of elements in any definition of
a variable herein includes definitions of that variable as any
single element or combination (or subcombination) of listed
elements. The recitation of an embodiment herein includes that
embodiment as any single embodiment or in combination with any
other embodiments or portions thereof.
[0525] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety. While this invention has
been disclosed with reference to specific embodiments, it is
apparent that other embodiments and variations of this invention
may be devised by others skilled in the art without departing from
the true spirit and scope of the invention. The appended claims are
intended to be construed to include all such embodiments and
equivalent variations.
Sequence CWU 1
1
13120DNAArtificial SequenceSynthetic sequence 1tgtgctagac
atgaggtcta 20220DNAArtificial SequenceSynthetic sequence
2gcagtatctg gagtcattga 20320DNAArtificial SequenceSynthetic
sequence 3cgcgagcaca gctaaggcca 20420DNAArtificial
SequenceSynthetic sequence 4ggcgccctgg ccagtcgtct
20520DNAArtificial SequenceSynthetic sequence 5gagggtccag
atgcccagca 20624DNAArtificial SequenceSynthetic sequence
6tcatgtccta accctgatcc tctt 24723DNAArtificial SequenceSynthetic
sequence 7ttggactttt cccagctgac aga 23824DNAArtificial
SequenceSynthetic sequence 8taccaggacc agacagctct taga
24924DNAArtificial SequenceSynthetic sequence 9tctcacctaa
tctcctccag gcat 241054RNAArtificial SequenceSynthetic sequence
10rargrgrarg rgrarururc rgrgrararc rcrcrararu rcrarcrurg rarc
541148DNAArtificial SequenceSynthetic sequence 11rcrargrurg
rarururgrg rgrururcrc rgrararurc rcrurcct 481254DNAArtificial
SequenceSynthetic sequence 12rarcrcrurc rcrururcrc rcrarururc
rarcrcrcra rcrcrargrc rurc 541348DNAArtificial SequenceSynthetic
sequence 13rgrcrurgrg rurgrgrgru rgrararurg rgrgrararg rgrarggt
48
* * * * *