U.S. patent application number 15/179696 was filed with the patent office on 2017-11-23 for inhibitors of ncca-atp channels for therapy.
The applicant listed for this patent is The United States of America as Represented by the Department of Veterans Affairs, University of Maryland, Baltimore. Invention is credited to J. Marc Simard.
Application Number | 20170333454 15/179696 |
Document ID | / |
Family ID | 40186245 |
Filed Date | 2017-11-23 |
United States Patent
Application |
20170333454 |
Kind Code |
A1 |
Simard; J. Marc |
November 23, 2017 |
INHIBITORS OF NCCA-ATP CHANNELS FOR THERAPY
Abstract
Methods and compositions are provided that are utilized for
treatment and/or prevention of intraventricular hemorrhage or
progressive hemorrhagic necrosis (PHN), particularly following
spinal cord injury. In particular, the methods and compositions are
inhibitors of a particular NC.sub.Ca-ATP channel and include, for
example, inhibitors of SUR1 and/or inhibitors of TRPM4. Kits for
treatment and/or prevention of intraventricular hemorrhage or
progressive hemorrhagic necrosis (PHN), particularly following
spinal cord injury, are also provided. The present invention also
concerns treatment and/or prevention of intraventricular hemorrhage
in infants, including premature infants utilizing one or more
inhibitors of the channel is provided to the infant, for example to
brain cells of the infant.
Inventors: |
Simard; J. Marc; (Baltimore,
MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Maryland, Baltimore
The United States of America as Represented by the Department of
Veterans Affairs |
Baltimore
Washington |
MD
DC |
US
US |
|
|
Family ID: |
40186245 |
Appl. No.: |
15/179696 |
Filed: |
June 10, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14040104 |
Sep 27, 2013 |
9375438 |
|
|
15179696 |
|
|
|
|
12665853 |
Jan 27, 2010 |
8557867 |
|
|
PCT/US2008/067640 |
Jun 20, 2008 |
|
|
|
14040104 |
|
|
|
|
60945825 |
Jun 22, 2007 |
|
|
|
60945811 |
Jun 22, 2007 |
|
|
|
60945636 |
Jun 22, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 45/06 20130101;
A61K 31/4453 20130101; A61K 31/64 20130101; A61K 31/454 20130101;
A61P 9/00 20180101; A61K 31/198 20130101; A61P 9/10 20180101; A61K
31/451 20130101; A61K 2300/00 20130101; A61P 25/00 20180101; A61K
31/195 20130101; A61P 7/04 20180101; A61K 31/64 20130101; A61K
31/00 20130101 |
International
Class: |
A61K 31/64 20060101
A61K031/64; A61K 31/454 20060101 A61K031/454; A61K 31/4453 20060101
A61K031/4453; A61K 31/00 20060101 A61K031/00; A61K 31/198 20060101
A61K031/198; A61K 31/195 20060101 A61K031/195; A61K 45/06 20060101
A61K045/06; A61K 31/451 20060101 A61K031/451 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under Grant
Numbers NS048260 and HL082517 awarded by the National Institutes of
Health. The government has certain rights in the invention.
Claims
1.-48. (canceled)
49. A method of targeting a plasma level of glyburide in an
individual, comprising the step of administering glyburide to the
individual as follows: (a) an intravenous loading dose of
glyburide; and (b) a maintenance dose of glyburide, which is
different than the loading dose.
50. The method of claim 49, wherein the loading dose of glyburide
is 30-90 times the amount of the maintenance dose.
51. The method of claim 50, wherein the loading dose of glyburide
is 40-80 times the amount of the maintenance dose.
52. The method of claim 50, wherein the loading dose of glyburide
is 50-60 times the amount of the maintenance dose.
53. The method of claim 49, wherein the loading dose is 15.7 ug to
665 ug.
54. The method of claim 53, wherein the loading dose is 15.7 ug to
117 ug.
55. The method of claim 49, wherein the loading dose is 117 ug to
665 ug.
56. The method of claim 49, wherein the maintenance dose is 0.3
ug/min to 11.8 ug/min.
57. The method of claim 56, wherein the maintenance dose is 0.3
ug/min to 2.1 ug/min.
58. The method of claim 49, wherein the total daily dose is 432
ug/day to 17 mg/day.
59. The method of claim 58, wherein the total daily dose is 432
ug/day to 3 mg/day.
60. The method of claim 49, wherein the targeted plasma level of
glyburide is from 4.07 ng/ml to 160.2 ng/ml.
61. The method of claim 60, wherein the targeted plasma level of
glyburide is from 4.07 ng/ml to 28.3 ng/ml.
62. The method of claim 49, wherein the glyburide is administered
to said individual for 3 days to 7 days.
63. The method of claim 62, wherein the glyburide is administered
to said individual for 3 days to 5 days.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/040,104 filed Sep. 27, 2013; which is a
continuation of U.S. Pat. No. 8,557,867 granted Oct. 15, 2013,
formerly application Ser. No. 12/665,853 filed Jan. 21, 2010; which
is a U.S. .sctn.371 national phase application of International
Patent Application No. PCT/US2008/067640 filed Jun. 20, 2008; which
claims priority to U.S. Provisional Patent Application No.
60/945,825 filed Jun. 22, 2007; and to U.S. Provisional Patent
Application No. 60/945,811 filed Jun. 22, 2007; and to U.S.
Provisional Patent Application No. 60/945,636 filed Jun. 22, 2007,
all of which applications are incorporated by reference herein in
their entirety.
FIELD OF THE INVENTION
[0003] The present invention concerns at least the fields of cell
biology, molecular biology, and medicine. In particular aspects,
the present invention concerns the fields of treatment and/or
prevention of intraventricular hemorrhage or spinal cord injury,
particularly related to progressive hemorrhagic necrosis, for
example.
BACKGROUND OF THE INVENTION
[0004] The present invention concerns therapy for a variety of
maladies, including at least spinal cord injury and
intraventricular hemorrhage.
Spinal Cord Injury
[0005] Acute spinal cord injury (SCI) results in physical
disruption of spinal cord neurons and axons leading to deficits in
motor, sensory, and autonomic function. SCI is a debilitating
neurological disorder common in young adults that often requires
life-long therapy and rehabilitative care, placing significant
burdens on healthcare systems. Although many patients exhibit
neuropathologically and clinically complete cord injuries following
SCI, many others have neuropathologically incomplete lesions (Hayes
and Kakulas, 1997; Tator and Fehlinds, 1991) giving hope that
proper treatment to minimize "secondary injury" may reduce the
functional impact.
[0006] The concept of secondary injury in SCI arises from the
observation that the lesion expands and evolves over time (Tator
and Fehlings, 1991; Kwon et al., 2004). Whereas primary injured
tissues are irrevocably damaged at the time of impact, tissues that
are destined to become "secondarily" injured are considered to be
potentially salvageable. Older observations based on histological
studies that gave rise to the concept of lesion-evolution have been
confirmed with non-invasive MRI (Bilgen et al., 2000).
[0007] Several mechanisms of secondary injury have been postulated,
including ischemia/hypoxia, oxidative stress and inflammation, all
of which have been considered to be responsible for the devastating
process termed "progressive hemorrhagic necrosis" (PHN) (Tator and
Fehlings, 1991; Nelson et al., 1977; Tator, 1991; Fitch et al.,
1999; Tator and Koyanagi, 1997). PHN is a mysterious condition,
first recognized over three decades ago, that has thus far eluded
understanding and treatment. Shortly after injury (10-15 min), a
small hemorrhagic lesion involving primarily the capillary-rich
central gray matter is observed, but over the following 3-24 h,
petechial hemorrhages emerge in more distant tissues, eventually
coalescing into the characteristic lesion of hemorrhagic necrosis
(Balentine, 1978; Kawata et al., 1993). The white matter
surrounding the hemorrhagic gray matter shows a variety of
abnormalities, including decreased hematoxylin and eosin staining,
disrupted myelin, and axonal and periaxonal swelling. White matter
lesions extend far from the injury site, especially in the
posterior columns (Tator and Koyanagi, 1997). The evolution of
hemorrhage and necrosis has been referred to as "autodestruction".
PHN results in loss of vital spinal cord tissue and, in some
species including humans, leads to post-traumatic cystic cavitation
surrounded by glial scar tissue.
[0008] The mechanism responsible for PHN is not known. Tator and
Koyanagi (1997) speculated that obstruction of small intramedullary
vessels by the initial mechanical stress or secondary injury might
be responsible for PHN, whereas Kawata and colleagues (Kawata et
al., 1993) attributed the progressive changes to leukocyte
infiltration around the injured area leading to plugging of
capillaries. Given that petechial hemorrhages, the pathognomonic
feature of PHN, form as a result of catastrophic failure of
vascular integrity, damage to the endothelium of spinal cord
capillaries and postcapillary venules has long been regarded as a
major factor in the pathogenesis of PHN (Nelson et al., 1977;
Griffiths et al., 1978; Kapadia, 1984). However, no molecular
mechanism for progressive dysfunction of endothelium has been
identified.
[0009] The sulfonylurea receptor-1 (SUR1)-regulated NC.sub.Ca-ATP
channel is a non-selective cation channel that is not
constitutively expressed, but is transcriptionally up-regulated in
astrocytes and neurons following an hypoxic or ischemic insult
(Chen and Simard, 2001; Chen et al., 2003; Simard et al., 2006).
The channel is inactive when expressed, but becomes activated when
intracellular ATP is depleted, with activation leading to cell
depolarization, cytotoxic edema and oncotic cell death. Block of
the channel in vitro by the sulfonylurea, glibenclamide, prevents
cell depolarization, cytotoxic edema and oncotic cell death induced
by ATP depletion. In rodent models of ischemic stroke, treatment
with glibenclamide results in significant improvements in edema,
lesion volume and mortality (Simard et al., 2006). In humans with
diabetes mellitus, use of sulfonylureas before and during
hospitalization for stroke is associated with significantly better
stroke outcomes (Kunte et al., 2007).
Intra-Axial Hemorrhage
[0010] Intra-axial hemorrhage is characterized by bleeding within
the brain itself. Intraparenchymal or intraventricular hemorrhages
are types of intra-axial hemorrhage.
[0011] Intraventricular Hemorrhage (IVH)
[0012] Intraventricular Hemorrhage (IVH), a bleeding from fragile
blood vessels in the brain, is a significant cause of morbidity and
mortality in premature infants and may have include, for example,
death, shunt-dependent hydrocephalus, and life-long neurological
consequences such as cerebral palsy, seizures, mental retardation,
and other neurodevelopmental disabilities. Neurological sequelae
include shunt-dependent hydrocephalus, seizures, neurodevelopmental
disabilities, and cerebral palsy. The vasculature is especially
fragile in preterm infants, particularly those born more than 8
weeks early, i.e., before 32 weeks of gestation. IVH is more
commonly seen in extremely premature infants; its incidence is over
50% in preterm infants with birth weight less than 750 grams, and
up to 25% in infants with birth weight less than 1000 to 1500
grams.
[0013] IVH encompasses a wide spectrum of intra-cranial vascular
injuries with bleeding into the brain ventricles, a pair of
C-shaped reservoirs, located in each half of the brain near its
center, that contain cerebrospinal fluid. Bleeding occur in the
subependymal germinal matrix, a region of the developing brain
located in close proximity to the ventricles. Within the germinal
matrix, during fetal development, there is intense neuronal
proliferation as neuroblasts divide and migrate into the cerebral
parenchyma. This migration is about complete by about the 24th week
of gestation, although glial cells can still be found within the
germinal matrix until term. The germinal matrix undergoes rapid
involution from the 26th to the 32nd week of gestation, at which
time regression is nearly complete, as glial precursors migrate out
to populate the cerebral hemispheres.
[0014] Supporting this intense cell differentiation and
proliferation activity there is a primitive and fragile capillary
network. These vessels have thin walls for their relatively large
size, lack a muscularis layer, have immature interendothelial
junctions and basal laminae, and often lack direct contact with
perivascular glial structures, suggesting diminished extravascular
support. It is in this fragile capillary network where IVH
originates. When a fetus is born prematurely, the infant is
suddenly thrust from a well-controlled, protective environment into
a stimulating, hostile one. Because of this physiologic stress and
shock, the infant may lose the ability to regulate cerebral blood
flow and may suffer alterations in blood flow and pressure and in
the amounts of substances dissolved in the blood such as oxygen,
glucose and sodium. The fragile capillaries may, and often do,
rupture.
[0015] The severity of the condition depends on the extent of the
vascular injury. There are four grades, or stages, of IVH as can be
seen using ultrasound or brain computer tomography. Grade I IVH,
the less severe stage, involves bleeding in the subependymal
germinal matrix, with less than 10% involvement of the adjacent
ventricles. Grade II IVH results when 10 to 40% of the ventricles
are filled with blood, but without enlargement of the ventricles.
Grade III IVH involves filling of over 50% of the ventricles with
blood, with significant ventricular enlargement. In Grade IV IVH,
the bleeding extends beyond the intraventricular area into the
brain parenchyma (intraparenchymal hemorrhage).
[0016] The major complications of IVH relate to the destruction of
the cerebral parenchyma and the development of posthemorrhagic
hydrocephalus. Following parenchymal hemorrhages (Grade IV IVH),
necrotic areas may form cysts that can become contiguous with the
ventricles. Cerebral palsy is the primary neurological disorder
observed in those cases, although mental retardation and seizures
may also occur. In addition, infants affected with Grade III to IV
IVH may develop posthemorrhagic hydrocephalus, a condition
characterized by rapid growth of the lateral ventricles and
excessive head growth within two weeks of the hemorrhage. Likely
causes are obstruction of the cerebrospinal fluid conduits by blood
clots or debris, impaired absorption of the cerebrospinal fluid at
the arachnoid villi, or both. Another form of the hydrocephalus
condition may develop weeks after the injury. In this case the
likely cause is obstruction of the cerebrospinal fluid flow due to
an obliterative arachnoiditis in the posterior fossa.
[0017] Several trials were conducted in the 1980s and 1990s to
evaluate prophylactic use of phenobarbitone in preterm infants to
reduce the risk of IVH, however, no statistical significance was
observed (Postnatal phenobarbitone for the prevention of
intraventricular hemorrhage in preterm infants, Whitelaw et al.,
2000; and Bedard M P, Shankaran S, Slovis T L, Pantoja A. Dayal B.
Poland R L. Effect of prophylactic phenobarbital on
intraventricular hemorrhage in high-risk infants. Pediatrics 1984;
73:435-9.). Other pharmacological interventions have been assessed,
such as indomethacin (Fowlie 1999), but without substantial
clinical impact and IVH remains a problem. (Whitelaw A, Placzek M,
Dubowitz L, Lary S, Levene M. Phenobarbitone for prevention of
periventricular haemorrhage in very low birth-weight infants. A
randomised double-blind trial. Lancet 1983; ii: 1168-70.).
[0018] Extra-Axial Hemorrhage
[0019] Extra-axial hemorrhage is characterized by bleeding that
occurs within the skull but outside of the brain tissue. Epidural
hemorrhage, subdural hemorrhage and subarachnoid hemorrhage are
types of extra-axial hemorrhage.
[0020] Subarachnoid Hemorrage (SAH)
[0021] SAH, like intraparenchymal hemorrhage, may result from
trauma (physical or physiological) or from ruptures of aneurysms or
arteriovenous malformations, or a combination thereof. SAH often
indicates the presence of blood within the subarachnoid space,
blood layering/layered into the brain along sulci and fissures, or
blood filling cisterns (such as the suprasellar cistern because of
the presence of the vessels of the circle of Willis and their
branchpoints within that space). The classic presentation of
subarachnoid hemorrhage is the sudden onset of a severe headache.
This can be a very dangerous entity, and requires emergent
neurosurgical evaluation, and sometimes urgent intervention. In the
United States, the annual incidence of nontraumatic SAH is about
6-25 per 100,000. Internationally, incidences have been reported
but vary to 2-49 per 100,000.
[0022] Unlike ischemic stroke, in SAH the entire cortex bathed in
blood is at risk from hemotoxicity-related inflammation. Also,
hemotoxicity-related inflammation is potentially more amenable to
treatment than ischemic stroke because it develops relatively
slowly, compared to rapid loss of penumbral tissues in ischemia. At
present, treatments for edema are limited because underlying
molecular mechanis are not well understood, and treatments aimed at
mechanism that have been implicated (Park et al., 2004) are not yet
available. Therefore, the present invention fulfills a
long-standing need in the art by providing a treatment for SAH
predicated on ameliorating (or otherwise inhibiting) post-SAH
hemotoxicity-related inflammation.
[0023] The present invention provides a solution for a long-felt
need in the art to treat progressive hemorrhagic necrosis following
spinal cord injury and to treat IVH, traumatic brain injury, and
subarachnoid hemorrhage. for example.
SUMMARY OF THE INVENTION
[0024] The present invention is directed to systems, methods, and
compositions that concern multiple conditions, including
progressive hemorrhagic necrosis following spinal cord injury,
traumatic brain injury, subarachnoid hemorrhage, and
intraventricular hemorrhage, for example.
[0025] In particular embodiments, the present invention concerns a
specific channel, the NC.sub.Ca-ATP channel. The NC.sub.Ca-ATP
channel is a unique non-selective cation channel that is activated
by intracellular calcium and blocked by intracellular ATP. In
particular aspects, the NC.sub.Ca-ATP channel of the present
invention has a single-channel conductance to potassium ion (K+)
between 20 and 50 pS. The NC.sub.Ca-ATP channel is also stimulated
by Ca.sup.2+ on the cytoplasmic side of the cell membrane in a
physiological concentration range, (from about 10.sup.-8 to about
10.sup.-5 M). The NC.sub.Ca-ATP channel is also inhibited by
cytoplasmic ATP in a physiological concentration range (from about
0.1 mM to about 10 mM, or more particularly about 0.2 mM to about 5
mM). The NC.sub.Ca-ATP channel is also permeable at least to the
following cations; K.sup.+, Cs.sup.+, Li.sup.+, Na.sup.+; with the
permeability ratio between any two of the cations typically being
greater than about 0.5 and less than about 2, for example.
[0026] The NC.sub.Ca-ATP channel includes at least a pore-forming
component (pore-forming subunit) and a regulatory component
(regulatory subunit); the regulatory subunit includes sulfonylurea
type 1 receptor (SUR1) and the pore-forming subunit includes a
non-selective cation channel subunit that is, or closely resembles,
a transient receptor potential melastatin 4 (TRPM4) pore. In some
embodiments, pathological diseases and conditions may be treated or
prevented by inhibition of the NC.sub.Ca-ATP channel. The
NC.sub.Ca-ATP channel may be inhibited by reducing its activity, by
reducing the numbers of such channels present in cell membranes,
and by other means. For example, the NC.sub.Ca-ATP channel may be
inhibited by administration of SUR1 antagonists; by administration
of TRPM4 antagonists; by administration of a combination of drugs
including a SUR1 antagonist and a TRPM4 antagonist; by reducing or
antagonizing the expression, transcription, or translation of
genetic message encoding the NC.sub.Ca-ATP channel; by reducing or
antagonizing the insertion of NC.sub.Ca-ATP channels into cell
membranes; and by other means.
[0027] In particular embodiments the NC.sub.Ca-ATP channel is
regulated by sulfonylurea receptor 1 (SUR1): e.g., it is opened by
ATP depletion. SUR1-regulated NC.sub.Ca-ATP channels have been
shown to play an important role in cytotoxic edema, oncotic cell
death, and hemorrhagic conversion in ischemic stroke and CNS
trauma. Moreover, SUR1 is blocked by SUR1 antagonists such as, for
example, glibenclamide and tolbutamide, providing an exemplary
avenue for treatment. TRPM4 pores may be blocked by TRPM4
antagonists (e.g., TRPM4 blockers such as, for example, pinkolant,
rimonabant, or a fenamate). In one aspect, the hypoxic-ischemic
environment in prematurity leads to transcriptional activation of
SUR1 and opening of NC.sub.Ca-ATP channels, initiating a cascade of
events culminating in acute hemorrhage in parallel with ischemic
stroke. Thus, hypoxic, ischemic, or hemorrhagic injury may be
treated by inhibition of the NC.sub.Ca-ATP channel, e.g., by
administration of a SUR1 antagonist, a TRPM4 antagonist, or
both.
[0028] In certain embodiments related at least to spinal cord
injury, for example, the channel is expressed in neural, glial, and
vascular cells and tissues, among others, including in capillary
endothelium, cells in the core near the spinal cord injury impact
site, and in reactive astrocytes although in alternative cases the
channel is expressed in neurons, glia and neural endothelial cells
after brain trauma, for example.
[0029] More particularly, the present invention relates to the
regulation and/or modulation of this NC.sub.Ca-ATP channel and how
its modulation can be used to prevent, ameliorate, or treat
intraventricular hemorrhage and/or spinal cord injury and/or
progressive hemorrhagic necrosis and/or traumatic brain injury
and/or subarachnoid hemorrhage or other hypoxic or ischemic injury,
disease, or condition. Administration of an antagonist or inhibitor
of the NC.sub.Ca-ATP channel is effective to modulate and/or
regulate the channel and to prevent or treat such injury, disease,
or condition in specific embodiments. Thus, depending upon the
disease, a composition (an antagonist, which may also be referred
to as an inhibitor) is administered to block or inhibit at least in
part the channel, for example to prevent cell death and/or to
prevent or reduce or modulate depolarization of the cells.
Administration of an antagonist or inhibitor of the NC.sub.Ca-ATP
channel includes administration of a SUR1 antagonist, a TRPM4
antagonist, or both, and may include such administration in
combination with administration of other agents as well.
[0030] The invention encompasses antagonists of the NC.sub.Ca-ATP
channel, including small molecules, large molecules, proteins,
(including antibodies), as well as nucleotide sequences that can be
used to inhibit NC.sub.Ca-ATP channel gene expression (e.g.,
antisense and ribozyme molecules). In certain cases, an antagonist
of the NC.sub.Ca-ATP channel includes one or more compounds capable
of one or more of the following: (1) blocking the channel; (2)
preventing channel opening; (3) inhibiting the channel; (4)
reducing the magnitude of membrane current through the channel; (5)
inhibiting transcriptional expression of the channel; and/or (6)
inhibiting post-translational assembly and/or trafficking of
channel subunits.
[0031] Another aspect of the present invention for the treatment of
ischemic, hypoxic, or other injury, including IVH or spinal cord
injury or progressive hemorrhagic conversion comprises
administration of an effective amount of a SUR1 antagonist and/or a
TRPM4 antagonist and administration of glucose. Glucose
administration may be by intravenous, or intraperitoneal, or other
suitable route and means of delivery. Additional glucose allows
administration of higher doses of an antagonist of the
NC.sub.Ca-ATP channel than might otherwise be possible, so that
combined glucose with an antagonist of the NC.sub.Ca-ATP channel
provides greater protection, and may allow treatment at later
times, than with an antagonist of the NC.sub.Ca-ATP channel alone.
Greater amounts of glucose are administered where larger doses of
an antagonist of the NC.sub.Ca-ATP channel are administered.
[0032] In certain aspects, antagonists of one or more proteins that
comprise the channel and/or antagonists for proteins that modulate
activity of the channel are utilized in methods and compositions of
the invention. The channel is expressed on neuronal cells,
neuroglia cells, neural epithelial cells, neural endothelial cells,
vascular cells, or a combination thereof, for example. In specific
embodiments, an inhibitor of the channel directly or indireclty
inhibits the channel, for example by the influx of cations, such as
Na+, into the cells, thereby preventing depolarization of the
cells. Inhibition of the influx of Na+ into the cells thereby at
least prevents or reduces cytotoxic edema and/or ionic edema,
and/or vasogenic edema and prevents or reduces hemorrhagic
conversion. Thus, this treatment reduces cell death or necrotic
death of at least neuronal, glial, vascular, endothelial, and/or
neural endothelial cells.
[0033] The NC.sub.Ca-ATP channel can be inhibited by an
NC.sub.Ca-ATP channel inhibitor, an NC.sub.Ca-ATP channel blocker,
a type 1 sulfonylurea receptor (SUR1) antagonist, SUR1 inhibitor, a
TRPM4 inhibitor, or a compound capable of reducing the magnitude of
membrane current through the channel, or a combination or mixture
thereof. In further specific embodiments, the SUR1 inhibitor is a
sulfonylurea compound or a benzamido derivative. A SUR1 inhibitor
such as iptakalim may be used. More specifically, the exemplary
SUR1 antagonist may be selected from the group consisting of
glibenclamide, tolbutamide, repaglinide, nateglinide, meglitinide,
midaglizole, LY397364, LY389382, glyclazide, glimepiride, estrogen,
estrogen related-compounds (estradiol, estrone, estriol, genistein,
non-steroidal estrogen (e.g., diethystilbestrol), phytoestrogen
(e.g., coumestrol), zearalenone, etc.), and compounds known to
inhibit or block K.sub.ATP channels. MgADP can also be used to
inhibit the channel. Other compounds that can be used to block or
inhibit K.sub.ATP channels include, but are not limited to
tolbutamide, glyburide (1[p-2[5-chloro-O-anisamido)ethyl] phenyl]
sulfonyl]-3-cyclohexyl-3-urea); chlopropamide
(1-[[(p-chlorophenyl)sulfonyl]-3-propylurea; glipizide
(1-cyclohexyl-3 [[p-[2(5-methylpyrazine carboxamido)ethyl] phenyl]
sulfonyl] urea); or
tolazamide(benzenesulfonamide-N-[[(hexahydro-1H-azepin-1yl)amino]
carbonyl]-4-methyl). In a specific embodiment, the cation channel
blocker is selected from the group consisting of pinkolant,
rimonabant, a fenamate (such as flufenamic acid, mefenamic acid,
meclofenamic acid, or niflumic acid),
1-(beta-[3-(4-methoxy-phenyl)propoxy]-4-methoxyphenethyl)-1H-imidazole
hydrochloride, and a biologically active derivative thereof. In
additional embodiments, non-sulfonyl urea compounds, such as 2,
3-butanedione and 5-hydroxydecanoic acid, quinine, and
therapeutically equivalent salts and derivatives thereof, may be
employed in the invention. The benzamido derivative may be selected
from the group consisting of repaglinide, nateglinide, and
meglitinide. The inhibitor may comprise a protein, a peptide, a
nucleic acid (such as an RNAi molecule or antisense RNA, including
siRNA), or a small molecule. In specific aspects, the inhibitor is
provided intravenously, subcutaneously, intramuscularly,
intracutaneously, intragastrically, or orally. In an additional
embodiment, the method further comprises administering MgADP to the
individual.
[0034] In one embodiment of the invention, NC.sub.Ca-ATP channels
are involved in progressive hemorrhagic necrosis (PHN) in SCI.
Although endothelial dysfunction has been implicated in PHN,
SUR1-regulated NC.sub.Ca-ATP channels have not previously been
shown in capillary endothelium. Here, development of the present
invention utilized a rodent model of unilateral cervical SCI and
endothelial cell cultures, wherein SUR1 was prominently
up-regulated in capillaries in the region of SCI, endothelial cells
subjected to hypoxic conditions express SUR1-regulated
NC.sub.Ca-ATP channels, and inhibition of SUR1 by a variety of
molecularly distinct mechanisms largely eliminated the progressive
extravasation of blood characteristic of PHN, reduced lesion size,
and was associated with marked neurobehavioral functional
improvement, consistent with a critical role for SUR1-regulated
NC.sub.Ca-ATP channels in PHN following SCI.
[0035] Thus, in one embodiment of the invention, there is a method
of treating and/or preventing progressive hemorrhagic necrosis in
an individual, comprising the step of providing to the individual
an effective amount of an inhibitor of a NC.sub.Ca-ATP channel. In
a specific embodiment, the progressive hemorrhagic necrosis is a
direct or indirect result of spinal cord injury. In another
specific embodiment, the inhibitor of the channel is a SUR1
inhibitor, a TRPM4 inhibitor, or a combination or mixture thereof.
The inhibitor may be provided intravenously, subcutaneously,
intramuscularly, intracutaneously, intragastrically, or orally. In
an additional specific embodiment, the method further comprises
administering MgADP to the individual.
[0036] An individual provided the methods of the invention may be
an individual that suffers from a spinal cord injury or that is at
risk for having a spinal cord injury, for example. Individuals at
risk for having spinal cord injuries may be of any kind, and in
certain cases the spinal cord injury is the result of an unexpected
accident. Still, some groups of the population have a higher risk
of sustaining a spinal cord injury, including at least, for
example, men; African-Americans; young adults; seniors; motor
vehicle accident victims; fall victims; victims of violence, for
example, gunshot wounds, stabbings and assaults; athletes,
including those who partake in football, rugby, wrestling,
gymnastics, diving, surfing, swimming, ice hockey, equestrian
activities, or downhill skiing, for example; individuals
participating in recreational activities, such as horseback riding,
swimming; and individuals with predisposing conditions, such as
conditions that affect the bones or joints, including arthritis or
osteoporosis.
[0037] The present invention is also directed to a system and
method that concern treatment and/or prevention of intraventricular
hemorrhage in an individual, and, in specific embodiments, in a
premature infant. In particular aspects, a premature infant is
defined as any infant that is recognized in the art to be
premature, although in specific aspects a premature infant is an
infant that is born before the 37th week of pregnancy.
[0038] The present invention relates to a novel ion channel whose
function underlies the swelling of a cell, for example, such as in
response to ATP depletion. Treatment methods are provided that
exploit the differential expression of such channels in response to
trauma, including but not limited to the use of inhibitors of the
channel function to prevent the cell swelling response. Several
adverse effects are associated with such physiological phenomenon,
including hemorrhagic stroke, intracranial hemorrhage, and further,
IVH and SAH.
[0039] In certain embodiments, the invention is drawn to methods of
treating intracranial hemorrhage, including but not limited to
intra-axial hemorrhage such as IVH and extra-axial hemorrhage such
as SAH. In specific embodiments, the methods comprise the
administration of an inhibitor of an NC.sub.Ca-ATP channel to a
cell and/or subject in need thereof.
[0040] In an exemplary embodiment of the present invention, the
treatment methods are effective for therapeutic and/or preventative
compositions and methods of the invention may be provided to the
premature infant following birth, the mother of the premature
infant during pregnancy, or the infant in utero. In a specific
embodiment, the inhibitor is provided to the mother prior to 37
weeks of gestation. In another specific embodiment, the mother is
at risk for premature labor. In a further specific embodiment, the
pregnancy is less than 37 weeks in gestation and the mother has one
or more symptoms of labor.
[0041] Thus, in one non-limiting embodiment, there is a method of
treating intraventricular hemorrhage in the brain of an infant or
preventing intraventricular hemorrhage in the brain of an infant at
risk for developing intraventricular hemorrhage, comprising
administering an effective amount of an inhibitor of NC.sub.Ca-ATP
channel to the infant following birth and/or the mother prior to
birth of the infant. In a specific embodiment, the infant is a
premature infant. In further specific embodiments, the infant
weighs less than 1500 grams at birth or weighs less than 1000 grams
at birth. In particular aspects, the infant is a premature infant
born at 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, or at
or prior to 23 weeks of gestation.
[0042] In an additional embodiment, there is a kit for treating
and/or preventing intraventricular hemorrhage or spinal cord injury
(including related to PHN), comprising an inhibitor of
NC.sub.Ca-ATP channel, including an inhibitor of TRPM4 and/or SUR1.
The channel inhibitor is a SUR1 inhibitor, a TRPM4 inhibitor, or a
mixture or combination thereof, in specific embodiments. The kit
may further comprise an additional compound for treating spinal
cord. The kit may further comprise an additional compound for
treating intraventricular hemorrhage, either for delivery to the
infant and/or to the mother. In some embodiments of the kit, the
kit comprises methylprednisone, one or more of a cation channel
blocker, and/or an antagonist of VEGF, MMP, NOS, or thrombin, for
example. The kit may also comprise suitable tools to administer
compositions of the invention to an individual. The inhibitor is
formulated for administration in utero, in specific embodiments for
intraventricular hemorrhage.
[0043] In yet another exemplary embodiment of the present
invention, the compositions and methods of the present invention
are predicated on the concept that cortical dysfunction is due to
hemotoxcity-related inflammation, which activates an immune
response cascade events, such as production of cytokines such as
TNFalpha and/or NF-kappaB, resulting in upregulation of
SUR1-regulated NC.sub.Ca-ATP channels, thereby predisposing the
cell/subject to edema and/or cell death. Thus, in a non-limiting
embodiment, the invention includes methods of treating and/or
preventing SAH comprising administration of an effective amount of
an inhibitor of an NC.sub.Ca-ATP channel to a cell and/or subject
in need thereof.
[0044] In specific embodiments, the methods of treating or
preventing SAH are useful in any subject at risk for SAH, such as
hypertensive patients, individuals at risk to trauma both physical
and physiological, and the like.
[0045] The methods of the present invention may include combination
therapies, such as co-administration of dexamethasone, glucose, an
antiinflammatory agent, an anticholesterol agent, an
antihyperlipoproteinemic agent, or other agent or combination of
agents, for example. In certain embodiments, methods of the present
invention may include combination therapies including
antithrombotic and or antifibrinolytic agents, such as
co-administration of tPA, for example to help remove a blood clot
from the ventricle or any condition that would not be
contra-indicated for co-administration of tPA. In fact, one of
skill in the art recognizes that at least some of the conditions
that are treatable with the methods of the present invention
(intraventricular hemorrhage, subarachnoid hemorrhage, progressive
secondary hemorrhage and progressive hemorrhagic necrosis, for
example) are all situations with excess bleeding, and tPA,
anti-platelet agents and anticoagulants are contraindicated,
because they could worsen the bleeding. Such compounds would not be
utilized in cases where there is bleeding or where bleeding is
suspected.
[0046] The present invention provides compounds that inhibit the
NC.sub.Ca-ATP channel for the treatment and/or prevention of
intraventricular hemorrhage in an individual, wherein the
individual is provided one or more inhibitors of the channel. The
inhibitor(s) may be of any kind, but in specific embodiments it is
an inhibitor of a regulatory subunit of the channel and/or a
pore-forming subunit of the channel. In certain aspects a
combination or mixture of an antagonist of a regulatory subunit of
the channel and an antagonist of a pore-forming subunit of the
channel are provided to the individual.
[0047] The therapeutic and/or preventative compositions and methods
of the invention may be provided to the premature infant following
birth, the mother of the premature infant during pregnancy, or the
infant in utero. In a specific embodiment, the inhibitor is
provided to the mother prior to 37 weeks of gestation. In another
specific embodiment, the mother is at risk for premature labor. In
a further specific embodiment, the pregnancy is less than 37 weeks
in gestation and the mother has one or more symptoms of labor.
[0048] Thus, in one embodiment, there is a method of treating
intraventricular hemorrhage in the brain of an infant or preventing
intraventricular hemorrhage in the brain of an infant at risk for
developing intraventricular hemorrhage, comprising administering an
effective amount of an inhibitor of NC.sub.Ca-ATP channel to the
infant following birth and/or the mother prior to birth. In a
specific embodiment, the infant is a premature infant. In further
specific embodiments, the infant weighs less than 1500 grams at
birth or weighs less than 1000 grams at birth. In particular
aspects, the infant was born at 36, 35, 34, 33, 32, 31, 30, 29, 28,
27, 26, 25, 24, or at or prior to 23 weeks of gestation.
[0049] In one aspect, the present invention provides novel methods
of treating a patient comprising administering at least a
therapeutic compound that targets the NC.sub.Ca-ATP channel, either
alone or in combination with an additional therapeutic compound,
and in specific embodiments the additional therapeutic compound is
methylprednisolone, cation channel blockers and antagonists of
VEGF, MMP, NOS, and/or thrombin, for example.
[0050] In one embodiment, the therapeutic combinatorial composition
can be administered to and/or into the spinal cord injury site, for
example. Such administration to the site includes injection
directly into the site, for example, particularly in the case where
the site has been rendered accessible to injection due to trauma to
the spine, for example.
[0051] Any compound(s) of the invention can be administered
alimentarily (e.g., orally, buccally, rectally or sublingually);
parenterally (e.g., intravenously, intradermally, intramuscularly,
intraarterially, intrathecally, subcutaneously, intraperitoneally,
intraventricularly); by intracavity; intravesically;
intrapleurally; and/or topically (e.g., transdermally), mucosally,
or by direct injection into the brain parenchyma.
[0052] In further embodiments, the compound that inhibits the
NC.sub.Ca-ATP channel can be administered in combination with, for
example, statins, diuretics, vasodilators (e.g., nitroglycerin),
mannitol, diazoxide and/or similar compounds that ameliorate
ischemic conditions. Yet further, another embodiment of the present
invention comprises a pharmaceutical composition comprising
statins, diuretics, vasodilators, mannitol, diazoxide or similar
compounds that ameliorate ischemic conditions or a pharmaceutically
acceptable salt thereof and a compound that inhibits a
NC.sub.Ca-ATP channel or a pharmaceutically acceptable salt
thereof. This pharmaceutical composition can be considered
neuroprotective, in specific embodiments. In only certain
embodiments of the invention, there are methods and compounds
(including pharmaceutical conditions) that concern administration
in combination with a compound that inhibits the NC.sub.Ca-ATP
channel, such as a thrombolytic agent (e.g., tissue plasminogen
activator (tPA), urokinase, prourokinase, streptokinase,
anistreplase, reteplase, tenecteplase), an anticoagulant or
antiplatelet (e.g., aspirin, warfarin or coumadin) may be employed,
wherein such compounds would not be contra-indicated. For example,
the pharmaceutical composition comprising a combination of the
thrombolytic agent and a compound that inhibits a NC.sub.Ca-ATP
channel is therapeutic, because it increases the therapeutic window
for the administration of the thrombolytic agent by several hours;
for example, the therapeutic window for administration of
thrombolytic agents may be increased by several hours (e.g. about
4-about 8 hrs) by co-administering one or more antagonists of the
NC.sub.Ca-ATP channel.
[0053] An effective amount of an antagonist of the NC.sub.Ca-ATP
channel or related-compounds thereof as treatment and/or prevention
varies depending upon the host treated and the particular mode of
administration. In one embodiment of the invention, the dose range
of the therapeutic combinatorial composition of the invention,
including an antagonist of NC.sub.Ca-ATP channel and/or the
additional therapeutic compound, will be about 0.01 .mu.g/kg body
weight to about 20,000 .mu.g/kg body weight. The term "body weight"
is applicable when an animal is being treated. When isolated cells
are being treated, "body weight" as used herein should read to mean
"total cell body weight". The term "total body weight" may be used
to apply to both isolated cell and animal treatment. All
concentrations and treatment levels are expressed as "body weight"
or simply "kg" in this application are also considered to cover the
analogous "total cell body weight" and "total body weight"
concentrations. However, those of skill will recognize the utility
of a variety of dosage range, for example, 0.01 .mu.g/kg body
weight to 20,000 .mu.g/kg body weight, 0.02 .mu.g/kg body weight to
15,000 .mu.g/kg body weight, 0.03 .mu.g/kg body weight to 10,000
.mu.g/kg body weight, 0.04 .mu.g/kg body weight to 5,000 .mu.g/kg
body weight, 0.05 .mu.g/kg body weight to 2,500 .mu.g/kg body
weight, 0.06 .mu.g/kg body weight to 1,000 .mu.g/kg body weight,
0.07 .mu.g/kg body weight to 500 .mu.g/kg body weight, 0.08
.mu.g/kg body weight to 400 .mu.g/kg body weight, 0.09 .mu.g/kg
body weight to 200 .mu.g/kg body weight or 0.1 .mu.g/kg body weight
to 100 .mu.g/kg body weight. Further, those of skill will recognize
that a variety of different dosage levels will be of use, for
example, 0.0001 .mu.g/kg, 0.0002 .mu.g/kg, 0.0003 .mu.g/kg, 0.0004
.mu.g/kg, 0.005 .mu.g/kg, 0.0007 .mu.g/kg, 0.001 .mu.g/kg, 0.1
.mu.g/kg, 1.0 .mu.g/kg, 1.5 .mu.g/kg, 2.0 .mu.g/kg, 5.0 .mu.g/kg,
10.0 .mu.g/kg, 15.0 .mu.g/kg, 30.0 .mu.g/kg, 50 .mu.g/kg, 75
.mu.g/kg, 80 .mu.g/kg, 90 .mu.g/kg, 100 .mu.g/kg, 120 .mu.g/kg, 140
.mu.g/kg, 150 .mu.g/kg, 160 .mu.g/kg, 180 .mu.g/kg, 200 .mu.g/kg,
225 .mu.g/kg, 250 .mu.g/kg, 275 .mu.g/kg, 300 .mu.g/kg, 325
.mu.g/kg, 350 .mu.g/kg, 375 .mu.g/kg, 400 .mu.g/kg, 450 .mu.g/kg,
500 .mu.g/kg, 550 .mu.g/kg, 600 .mu.g/kg, 700 .mu.g/kg, 750
.mu.g/kg, 800 .mu.g/kg, 900 .mu.g/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg,
12 mg/kg, 15 mg/kg, 20 mg/kg, and/or 30 mg/kg.
[0054] An effective amount of an inhibitor of NC.sub.Ca-ATP channel
that may be administered to an individual or a cell in a tissue or
organ thereof includes a dose of about 0.0001 nM to about 2000
.mu.M, for example. More specifically, doses of an antagonist to be
administered are from about 0.01 nM to about 2000 .mu.M; about 0.01
.mu.M to about 0.05 .mu.M; about 0.05 .mu.M to about 1.0 .mu.M;
about 1.0 .mu.M to about 1.5 .mu.M; about 1.5 .mu.M to about 2.0
.mu.M; about 2.0 .mu.M to about 3.0 .mu.M; about 3.0 .mu.M to about
4.0 .mu.M; about 4.0 .mu.M to about 5.0 .mu.M; about 5.0 .mu.M to
about 10 .mu.M; about 10 .mu.M to about 50 .mu.M; about 50 .mu.M to
about 100 .mu.M; about 100 .mu.M to about 200 .mu.M; about 200
.mu.M to about 300 .mu.M; about 300 .mu.M to about 500 .mu.M; about
500 .mu.M to about 1000 .mu.M; about 1000 .mu.M to about 1500 .mu.M
and about 1500 .mu.M to about 2000 .mu.M, for example. Of course,
all of these amounts are exemplary, and any amount in-between these
dosages is also expected to be of use in the invention.
[0055] An effective amount of an inhibitor of the NC.sub.Ca-ATP
channel or related-compounds thereof as a treatment varies
depending upon the host treated and the particular mode of
administration. In one embodiment of the invention the dose range
of the agonist or antagonist of the NC.sub.Ca-ATP channel or
related-compounds thereof will be about 0.01 .mu.g/kg body weight
to about 20,000 .mu.g/kg body weight.
[0056] In specific embodiments, the dosage is less than 0.8 mg/kg.
In particular aspects, the dosage range may be from 0.005 mg/kg to
0.8 mg/kg body weight, 0.006 mg/kg to 0.8 mg/kg body weight, 0.075
mg/kg to 0.8 mg/kg body weight, 0.08 mg/kg to 0.8 mg/kg body
weight, 0.09 mg/kg to 0.8 mg/kg body weight, 0.005 mg/kg to 0.75
mg/kg body weight, 0.005 mg/kg to 0.7 mg/kg body weight, 0.005
mg/kg to 0.65 mg/kg body weight, 0.005 mg/kg to 0.5 mg/kg body
weight, 0.09 mg/kg to 0.8 mg/kg body weight, 0.1 mg/kg to 0.75
mg/kg body weight, 0.1 mg/kg to 0.70 mg/kg body weight, 0.1 mg/kg
to 0.65 mg/kg body weight, 0.1 mg/kg to 0.6 mg/kg body weight, 0.1
mg/kg to 0.55 mg/kg body weight, 0.1 mg/kg to 0.5 mg/kg body
weight, 0.1 mg/kg to 0.45 mg/kg body weight, 0.1 mg/kg to 0.4 mg/kg
body weight, 0.1 mg/kg to 0.35 mg/kg body weight, 0.1 mg/kg to 0.3
mg/kg body weight, 0.1 mg/kg to 0.25 mg/kg body weight, 0.1 mg/kg
to 0.2 mg/kg body weight, or 0.1 mg/kg to 0.15 mg/kg body weight,
for example.
[0057] In specific embodiments, the dosage range may be from 0.2
mg/kg to 0.8 mg/kg body weight, 0.2 mg/kg to 0.75 mg/kg body
weight, 0.2 mg/kg to 0.70 mg/kg body weight, 0.2 mg/kg to 0.65
mg/kg body weight, 0.2 mg/kg to 0.6 mg/kg body weight, 0.2 mg/kg to
0.55 mg/kg body weight, 0.2 mg/kg to 0.5 mg/kg body weight, 0.2
mg/kg to 0.45 mg/kg body weight, 0.2 mg/kg to 0.4 mg/kg body
weight, 0.2 mg/kg to 0.35 mg/kg body weight, 0.2 mg/kg to 0.3 mg/kg
body weight, or 0.2 mg/kg to 0.25 mg/kg body weight, for
example.
[0058] In further specific embodiments, the dosage range may be
from 0.3 mg/kg to 0.8 mg/kg body weight, 0.3 mg/kg to 0.75 mg/kg
body weight, 0.3 mg/kg to 0.70 mg/kg body weight, 0.3 mg/kg to 0.65
mg/kg body weight, 0.3 mg/kg to 0.6 mg/kg body weight, 0.3 mg/kg to
0.55 mg/kg body weight, 0.3 mg/kg to 0.5 mg/kg body weight, 0.3
mg/kg to 0.45 mg/kg body weight, 0.3 mg/kg to 0.4 mg/kg body
weight, or 0.3 mg/kg to 0.35 mg/kg body weight, for example.
[0059] In specific embodiments, the dosage range may be from 0.4
mg/kg to 0.8 mg/kg body weight, 0.4 mg/kg to 0.75 mg/kg body
weight, 0.4 mg/kg to 0.70 mg/kg body weight, 0.4 mg/kg to 0.65
mg/kg body weight, 0.4 mg/kg to 0.6 mg/kg body weight, 0.4 mg/kg to
0.55 mg/kg body weight, 0.4 mg/kg to 0.5 mg/kg body weight, or 0.4
mg/kg to 0.45 mg/kg body weight, for example.
[0060] In specific embodiments, the dosage range may be from 0.5
mg/kg to 0.8 mg/kg body weight, 0.5 mg/kg to 0.75 mg/kg body
weight, 0.5 mg/kg to 0.70 mg/kg body weight, 0.5 mg/kg to 0.65
mg/kg body weight, 0.5 mg/kg to 0.6 mg/kg body weight, or 0.5 mg/kg
to 0.55 mg/kg body weight, for example. In specific embodiments,
the dosage range may be from 0.6 mg/kg to 0.8 mg/kg body weight,
0.6 mg/kg to 0.75 mg/kg body weight, 0.6 mg/kg to 0.70 mg/kg body
weight, or 0.6 mg/kg to 0.65 mg/kg body weight, for example. In
specific embodiments, the dosage range may be from 0.7 mg/kg to 0.8
mg/kg body weight or 0.7 mg/kg to 0.75 mg/kg body weight, for
example. In specific embodiments the dose range may be from 0.001
mg/day to 3.5 mg/day. In other embodiments, the dose range may be
from 0.001 mg/day to 10 mg/day. In other embodiments, the dose
range may be from 0.001 mg/day to 20 mg/day.
[0061] Further, those of skill will recognize that a variety of
different dosage levels will be of use, for example, 0.0001
.mu.g/kg, 0.0002 .mu.g/kg, 0.0003 .mu.g/kg, 0.0004 .mu.g/kg, 0.005
.mu.g/kg, 0.0007 .mu.g/kg, 0.001 .mu.g/kg, 0.1 .mu.g/kg, 1.0
.mu.g/kg, 1.5 .mu.g/kg, 2.0 .mu.g/kg, 5.0 .mu.g/kg, 10.0 .mu.g/kg,
15.0 .mu.g/kg, 30.0 .mu.g/kg, 50 .mu.g/kg, 75 .mu.g/kg, 80
.mu.g/kg, 90 .mu.g/kg, 100 .mu.g/kg, 120 .mu.g/kg, 140 .mu.g/kg,
150 .mu.g/kg, 160 .mu.g/kg, 180 .mu.g/kg, 200 .mu.g/kg, 225
.mu.g/kg, 250 .mu.g/kg, 275 .mu.g/kg, 300 .mu.g/kg, 325 .mu.g/kg,
350 .mu.g/kg, 375 .mu.g/kg, 400 .mu.g/kg, 450 .mu.g/kg, 500
.mu.g/kg, 550 .mu.g/kg, 600 .mu.g/kg, 700 .mu.g/kg, 750 .mu.g/kg,
800 .mu.g/kg, 900 .mu.g/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 12 mg/kg,
15 mg/kg, 20 mg/kg, and/or 30 mg/kg. In particular embodiments,
there may be dosing of from very low ranges (e.g. 1 mg/kg/day or
less; 5 mg/kg bolus; or 1 mg/kg/day) to moderate doses (e.g. 2 mg
bolus, 15 mg/day) to high doses (e.g. 5 mg bolus, 30-40 mg/day; and
even higher). Of course, all of these dosages are exemplary, and
any dosage in-between these dosages is also expected to be of use
in the invention. Any of the above dosage ranges or dosage levels
may be employed for an agonist or antagonist, or both, of
NC.sub.Ca-ATP channel or related-compounds thereof.
[0062] An effective amount of a therapeutic composition of the
invention, including an antagonist of NC.sub.Ca-ATP channel and/or
the additional therapeutic compound, that may be administered to a
cell includes a dose of about 0.0001 nM to about 2000 .mu.M, for
example. More specifically, doses to be administered are from about
0.01 nM to about 2000 .mu.M; about 0.01 .mu.M to about 0.05
.quadrature..mu.M; about 0.05 .mu.M to about 1.0 .mu.M; about 1.0
.mu.M to about 1.5 .mu.M; about 1.5 .mu.M to about 2.0 .mu.M; about
2.0 .quadrature..mu.M to about 3.0 .mu.M; about 3.0 .mu.M to about
4.0 .mu.M; about 4.0 .mu.M to about 5.0 .mu.M; about 5.0 .mu.M to
about 10 .mu.M; about 10 .mu.M to about 50 .mu.M; about 50 .mu.M to
about 100 .mu.M; about 100 .mu.M to about 200 .mu.M; about 200
.mu.M to about 300 .mu.M; about 300 .quadrature..mu.M to about 500
.mu.M; about 500 .mu.M to about 1000 .mu.M; about 1000 .mu.M to
about 1500 .mu.M and about 1500 .mu.M to about 2000 .mu.M, for
example. Of course, all of these amounts are exemplary, and any
amount in-between these dosages is also expected to be of use in
the invention.
[0063] In particular embodiments, there may be dosing of from very
low ranges (e.g. for glyburide 1 mg/day or less) to moderate doses
(e.g. 3.5 mg/day) to high doses (e.g. 10-40 mg/day; and even
higher). Of course, all of these dosages are exemplary, and any
dosage in-between these dosages is also expected to be of use in
the invention. Any of the above dosage ranges or dosage levels may
be employed for an agonist or antagonist, or both, of NC.sub.Ca-ATP
channel or related-compounds thereof.
[0064] In a particular embodiment, the dosage is about 0.5 mg/day
too about 10 mg/day.
[0065] In certain embodiments, the amount of the combinatorial
therapeutic composition administered to the subject is in the range
of about 0.0001 .mu.g/kg/day to about 20 mg/kg/day, about 0.01
.mu.g/kg/day to about 100 .mu.g/kg/day, or about 100 .mu.g/kg/day
to about 20 mg/kg/day. Still further, the combinatorial therapeutic
composition may be administered to the subject in the form of a
treatment in which the treatment may comprise the amount of the
combinatorial therapeutic composition or the dose of the
combinatorial therapeutic composition that is administered per day
(1, 2, 3, 4, etc.), week (1, 2, 3, 4, 5, etc.), month (1, 2, 3, 4,
5, etc.), etc. Treatments may be administered such that the amount
of combinatorial therapeutic composition administered to the
subject is in the range of about 0.0001 .mu.g/kg/treatment to about
20 mg/kg/treatment, about 0.01 .mu.g/kg/treatment to about 100
.mu.g/kg/treatment, or about 100 .mu.g/kg/treatment to about 20
mg/kg/treatment.
[0066] A typical dosing regime consists of a loading dose designed
to reach a target agent plasma level followed by an infusion of up
to 7 days to maintain that target level. One skilled in the art
will recognize that the pharmacokinetics of each agent will
determine the relationship between the load dose and infusion rate
for a targeted agent plasma level. In one example, for intravenous
glyburide administration, a 15.7 .mu.g bolus (also called a loading
dose) is followed by a maintenance dose of 0.3 .mu.g/min (432
.mu.g/day) for 120 hours (5 days). This dose regime is predicted to
result in a steady-state plasma concentration of 4.07 ng/mL. In
another example for intravenous glyburide, a 117 .mu.g bolus dose
is followed by a maintenance dose of 2.1 .mu.g/min (3 mg/day) for 3
days. This dose is predicted to result in a steady-state plasma
concentration of 28.3 ng/mL. In yet another example for glyburide,
a 665 .mu.g bolus dose is followed by a maintenance dose of 11.8
.mu.g/min (17 mg/day) for 120 hours (5 days). This dose is
predicted to result in a steady-state plasma concentration of 160.2
ng/mL. Once the pharmacokinetic parameters for an agent are known,
loading dose and infusion dose for any specified targeted plasma
level can be calculated. As an illustrative case for glyburide, the
bolus is generally 30-90 times, for example 40-80 times, such as
50-60 times, the amount of the maintenance dose, and one of skill
in the art can determine such parameters for other compounds based
on the guidance herein.
[0067] In cases where combination therapies are utilized, the
components of the combination may be of any kind. In specific
embodiments, the components are provided to an individual
substantially concomitantly, whereas in other cases the components
are provided at separate times. The ratio of the components may be
determined empirically, as is routine in the art. Exemplary ratios
include at least about the following: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10, 1:20, 1:25, 1:30, 1:40, 1:50, 1:60, 1:70,
1:80, 1:90, 1:100, 1:500, 1:750, 1:1000, 1:10000, and so forth.
[0068] In particular embodiments, there may be dosing of from very
low ranges (e.g. 1 mg/kg/day or less; 5 mg/kg bolus; or 1
mg/kg/day) to moderate doses (e.g. 2 mg bolus, 15 mg/day) to high
doses (e.g. 5 mg bolus, 30-40 mg/day; and even higher). Of course,
all of these dosages are exemplary, and any dosage between these
points is also expected to be of use in the invention. Any of the
above dosage ranges or dosage levels may be employed for an
antagonist of NC.sub.Ca-ATP channel or related-compounds thereof
and, in appropriate cases, of an additional compound.
[0069] In certain embodiments, the amount of the singular or
combinatorial therapeutic composition administered to the subject
is in the range of about 0.0001 .mu.g/kg/day to about 20 mg/kg/day,
about 0.01 .mu.g/kg/day to about 100 .mu.g/kg/day, or about 100
.mu.g/kg/day to about 20 mg/kg/day. Still further, the
combinatorial therapeutic composition may be administered to the
subject in the form of a treatment in which the treatment may
comprise the amount of the combinatorial therapeutic composition or
the dose of the combinatorial therapeutic composition that is
administered per day (1, 2, 3, 4, etc.), week (1, 2, 3, 4, 5,
etc.), month (1, 2, 3, 4, 5, etc.), etc. Treatments may be
administered such that the amount of combinatorial therapeutic
composition administered to the subject is in the range of about
0.0001 .mu.g/kg/treatment to about 20 mg/kg/treatment, about 0.01
.mu.g/kg/treatment to about 100 .mu.g/kg/treatment, or about 100
.mu.g/kg/treatment to about 20 mg/kg/treatment.
[0070] In those cases wherein more than one compound is provided to
an individual to treat intraventricular hemorrhage or spinal cord
injury and, in particular, progressive hemorrhagic necrosis, the
compounds may be provided in a mixture, may be provided
simultaneously, or may be provided sequentially. In cases where
more than one composition is provided to the individual, they may
be provided in a particular ratio including, for example, in a 1:1
ratio, a 1:2 ratio, a 1:3 ratio, a 1:4 ratio, and so forth.
[0071] In one embodiment of the invention, there is a composition,
comprising a compound that inhibits a NC.sub.Ca-ATP channel and an
additional therapeutic compound, wherein the additional therapeutic
compound is selected from the group consisting of: a) one or more
cation channel blockers; and b) one or more of a compound selected
from the group consisting of one or more antagonists of vascular
endothelial growth factor (VEGF), one or more antagonists of matrix
metalloprotease (MMP), one or more antagonists of nitric oxide
synthase (NOS), one or more antagonists of thrombin, aquaporin, or
a biologically active derivative thereof, wherein the NC.sub.Ca-ATP
channel has the following characteristics: 1) it is a non-selective
monovalent cation channel; 2) it is activated by an increase in
intracellular calcium or by a decrease in intracellular ATP, or
both; and 3) it is regulated by a SUR1.
[0072] In a further specific embodiment, one or more antagonists of
vascular endothelial growth factor (VEGF) are soluble neuropilin 1
(NRP-1), undersulfated LMW glycol-split heparin, VEGF TrapR1R2,
Bevacizumab, HuMV833, s-Flt-1, s-Flk-1, s-Flt-1/Flk-1, NM-3, GFB
116, or a combination or mixture thereof. In an additional specific
embodiment, the undersulfated, LMW glycol-split heparin comprises
ST2184. In an additional specific embodiment, the one or more
antagonists of matrix metalloprotease (MMP) are
(2R)-2-[(4-biphenylsulfonyl)amino]-3-phenylproprionic acid,
GM-6001, TIMP-1, TIMP-2, RS 132908, batimastat, marimastat, a
peptide inhibitor that comprises the amino acid sequence HWGF, or a
mixture or combination thereof.
[0073] In one aspect of the invention, the one or more antagonists
of nitric oxide synthase (NOS) are aminoguanidine (AG),
2-amino-5,6-dihydro-6-methyl-4H-1,3 thiazine (AMT),
S-ethylisothiourea (EIT), asymmetric dimethylarginine (ADMA),
N-nitro-L-arginine methylester (L-NAME), nitro-L-arginine (L-NA),
N-(3-aminomethyl) benzylacetamidine dihydrochloride (1400W),
NG-monomethyl-L-arginine (L-NMMA), 7-nitroindazole (7-NINA),
N-nitro-L-arginine (L-NNA), or a mixture or combination thereof. In
another aspect of the invention, the one or more antagonists of
thrombin are ivalirudi, hirudin, SSR182289, antithrombin III,
thrombomodulin, lepirudin, P-PACK II
(d-Phenylalanyl-L-Phenylalanylarginine-chloro-methyl ketone 2 HCl),
(BNas-Gly-(pAM)Phe-Pip), Argatroban, and mixtures or combinations
thereof.
[0074] In a specific embodiment wherein an additional compound
other than the channel inhibitor is employed, the compound that
inhibits the NC.sub.Ca-ATP channel and the additional therapeutic
compound are delivered to the individual successively. In another
specific embodiment, the compound that inhibits the NC.sub.Ca-ATP
channel is delivered to the individual prior to delivery of the
additional therapeutic compound. In a further specific embodiment,
the compound that inhibits the NC.sub.Ca-ATP channel is delivered
to the individual subsequent to delivery of the additional
therapeutic compound. In another aspect, the compound that inhibits
the NC.sub.Ca-ATP channel and the additional therapeutic compound
are delivered to the individual concomitantly. In an additional
aspect, the compound that inhibits the NC.sub.Ca-ATP channel and
the additional therapeutic compound being delivered as a mixture.
In an additional embodiment, the compound that inhibits the
NC.sub.Ca-ATP channel and the additional therapeutic compound act
synergistically in the individual. In a particular case, the
compound that inhibits the NC.sub.Ca-ATP channel and/or the
additional therapeutic compound is delivered to the individual at a
certain dosage or range thereof, such as is provided in exemplary
disclosure elsewhere herein.
[0075] In particular embodiments, the methods of the invention are
employed within a certain amount of time of a spinal cord injury or
intraventricular hemorrhage, for example. In specific embodiments,
the composition(s) is delivered to the individual within minutes,
hours, days, or months of the injury. In further specific
embodiments, the composition(s) are delivered to the individual
within 10 minutes, within 15 minutes, within 30 minutes, within 45
minutes, within 60 minutes, within 75 minutes, within 90 minutes,
within 2 hours, within 2.5 hours, within 3 hours, within 3.5 hours,
within 4 hours, within 4.5 hours, within 5 hours, within 5.5 hours,
within 6 hours, within 6.5 hours, within 7 hours, within 7.5 hours,
within 8 hours, within 8.5 hours, within 9 hours, within 9.5 hours,
within 10 hours, within 10.5 hours, within 11 hours, within 11.5
hours, within 12 hours, within 13 hours, within 14 hours, within 15
hours, within 16 hours, within 17 hours, within 18 hours, within 20
hours, within 22 hours, within 24 hours, and so on, of the time of
the spinal cord injury. In specific cases, the composition(s) of
the invention are present at places where spinal cord injury may
occur (swimming pools, stables, ski resorts, gymnasiums, nursing
homes, sports arenas or fields, schools, etc.), are present in
first aid kits, are present in emergency vehicles, are present in
hospitals, including emergency rooms, and/or are present in
doctors' offices.
[0076] In a specific embodiment of the invention, the compound that
inhibits the NC.sub.Ca-ATP channel is glibenclamide, and the
maximum dosage of glibenclamide for the individual is about 20
mg/day. In a further specific embodiment, the compound that
inhibits the NC.sub.Ca-ATP channel is glibenclamide, and the dosage
of glibenclamide for the individual is between about 2.5 mg/day and
about 20 mg/day. In an additional specific embodiment, the compound
that inhibits the NC.sub.Ca-ATP channel is glibenclamide, and the
dosage of glibenclamide for the individual is between about 5
mg/day and about 15 mg/day. In another specific embodiment, the
compound that inhibits the NC.sub.Ca-ATP channel is glibenclamide,
and the dosage of glibenclamide for the individual is between about
5 mg/day and about 10 mg/day. In a still further specific
embodiment, the compound that inhibits the NC.sub.Ca-ATP channel is
glibenclamide, and the dosage of glibenclamide for the individual
is about 7 mg/day.
[0077] In one exemplary embodiment concerning singular therapeutic
compositions of the invention, there is a method of inhibiting
neural cell swelling in an individual having traumatic brain
injury, cerebral ischemia, central nervous system (CNS) damage,
peripheral nervous system (PNS) damage, cerebral hypoxia, or edema,
comprising delivering to the individual a therapeutically effective
amount of an antagonist of TRMP4. In specific embodiments, the
antagonist of TRMP4 is a nucleic acid (such as a TRMP4 siRNA, for
example), a protein, a small molecule, or a combination thereof. In
particular aspects, the method further comprises delivering to the
individual a therapeutically effective amount of an additional
therapeutic compound selected from the group consisting of: a) a
SUR1 antagonist; b) one or more cation channel blockers; b) one or
more of a compound selected from the group consisting of one or
more antagonists of vascular endothelial growth factor (VEGF), one
or more antagonists of matrix metalloprotease (MMP), one or more
antagonists of nitric oxide synthase (NOS), one or more antagonists
of thrombin, aquaporin, a biologically active derivative thereof,
and a combination thereof; and d) a combination thereof.
[0078] In one embodiment of the invention, there is a method for
processing an insurance claim for treatment of a medical condition
of the invention using a composition(s) of the invention. In a
specific embodiment, the method employs a computer for said
processing. In further specific embodiments, the dosage for the
composition may be any suitable dosage for treatment of the medical
condition.
[0079] The foregoing has outlined rather broadly the features and
technical advantages of the present invention in order that the
detailed description of the invention that follows may be better
understood. Additional features and advantages of the invention
will be described hereinafter which form the subject of the claims
of the invention. It should be appreciated by those skilled in the
art that the conception and specific embodiment disclosed may be
readily utilized as a basis for modifying or designing other
structures for carrying out the same purposes of the present
invention. It should also be realized by those skilled in the art
that such equivalent constructions do not depart from the spirit
and scope of the invention as set forth in the appended claims. The
novel features which are believed to be characteristic of the
invention, both as to its organization and method of operation,
together with further objects and advantages will be better
understood from the following description when considered in
connection with the accompanying figures. It is to be expressly
understood, however, that each of the figures is provided for the
purpose of illustration and description only and is not intended as
a definition of the limits of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0080] For a more complete understanding of the present invention,
reference is now made to the following descriptions taken in
conjunction with the accompanying drawings.
[0081] FIGS. 1A-1G shows that SUR1 is up-regulated in SCI. FIG. 1A:
Immunohistochemical localization of SUR1 in control and at
different times post-SCI, as indicated, with montages constructed
from multiple individual images, and positive labeling shown in
black pseudocolor. FIG. 1B: Magnified views of SUR1 immunolabeled
sections taken from control and from the "core" (heavily labeled
area in FIG. 1A, 6 h). FIGS. 1C, 1D: Immunolabeling of capillaries
with vimentin and co-labeling with SUR1 in control (FIG. 1C), and
from the "penumbra" (tissue adjacent to the heavily labeled core in
FIG. 1A, 6 h) (FIG. 1D). FIG. 1E: Western blots for SUR1 of spinal
cord tissue from control (lanes 1,2), 6 h post-SCI (lanes 3,4) and
from an equivalent amount of blood (BL) as is present in the
injured cord (lane 5); 50 .mu.g protein in lanes 1-4, 2 .mu.l blood
in lane 5; blots representative of 5-6 CTR and SCI rats. FIGS. 1F,
1G: In situ hybridization for SUR1 in controls and in whole cords
(FIG. 1F) or in the penumbra (FIG. 1G) 6 h post-SCI using antisense
(AS) and sense (SE), as indicated. Images of immunohistochemistry
and in situ hybridization representative of findings in 3-5
rats/group.
[0082] FIGS. 2A-2D. SUR1-regulated NC.sub.Ca-ATP channel is
up-regulated in endothelial cells by hypoxia. FIG. 2A:
Immunolabeling and Western blots (lanes 1,2) for SUR1 in human
aortic endothelial cells (ENDO) cultured under normoxic (N) or
hypoxic (H) conditions, as indicated; Western blots for SUR1 of rat
insulinoma RIN-m5F cells (INSUL; lanes 3,4) cultured under normoxic
or hypoxic condition, with .beta.-actin also shown. FIGS. 2B, 2C:
Whole-cell currents during ramp pulses (4/min; HP, -50 mV) or at
the holding potential of -50 mV, before and after application of
diazoxide (FIG. 2B) or Na azide (FIG. 2C), in endothelial cells
exposed to normoxic or hypoxic conditions; the difference currents
are also shown (red); data are representative of 7-15 recordings
from human aortic endothelial cells (FIG. 2B) or bEnd.3 cells (FIG.
2C) for each condition. FIG. 2D: Single channel recordings of
inside-out patches with Cs.sup.+ as the principal cation, with
channel openings inhibited by ATP on the cytoplasmic side; channel
amplitude at various potentials indicated a slope conductance of 37
pS (data from 7 patches) from human brain microvascular endothelial
cells.
[0083] FIGS. 3A-3E. Block of SUR1 reduces hemorrhage after SCI.
FIG. 3A: whole cords and longitudinal sections of cords 24 h
post-SCI, from vehicle-treated (CTR) and glibenclamide-treated
(GLIB) rats; white circles indicate impact area. FIG. 3B: Cord
homogenates in test tubes at 24 h, and spectrophotometric
measurements of blood in cord homogenates at various times
post-SCI, from vehicle-treated (CTR; n=66) and
glibenclamide-treated (GLIB; n=62) rats; *, P<0.05; **,
P<0.01; ***, P<0.001. FIG. 3C: Cord sections immunolabeled
for vimentin to show capillaries, at two magnifications, from SCI
rats treated with vehicle (CTR) or glibenclamide (GLIB); central
canal marked by arrows; images representative of findings in 6
rats/group. FIG. 3D: Zymography of recombinant MMP-2 and MMP-9
performed under control conditions (CTR), in the presence of
glibenclamide (10 .mu.M; GLIB), and in the presence of
MMP-inhibitor II (300 nM; Calbiochem). FIG. 3E: bleeding times in
uninjured rats infused with vehicle (CTR) or glibenclamide (GLIB);
3 rats/group.
[0084] FIGS. 4A-4D. Block of SUR1 reduces lesion size and improves
neurobehavioral function after SCI. FIGS. 4A-4C: Cord sections
immunolabeled for GFAP (FIG. 4A) or stained with Eriochrome
cyanine-R (FIG. 4B) or hematoxylin and eosin (FIG. 4C), 1 d (FIGS.
4A and 4B) or 7 d (FIG. 4C) post-SCI, from vehicle-treated (CTR)
and glibenclamide-treated (GLIB) rats; images representative of
findings in 3 rats/group. FIG. 4D: Cascaded outlines of lesion
areas in serial sections 250 .mu.m apart, 7 d post-SCI, from
vehicle-treated (CTR) and glibenclamide-treated (GLIB) rats; lesion
volumes from vehicle-treated (CTR) and glibenclamide-treated (GLIB)
rats (n=4-6/group; excludes 2 CTR rats that died). FIG. 4E:
Performance on inclined plane (head-up and head-down), ipsilateral
paw placement and vertical exploration (rearing), at the times
indicated post-SCI, in vehicle-treated (CTR) and
glibenclamide-treated (GLIB) rats (same rats as in d); paw
placement measured 1 d post-SCI; *, P<0.05; **, P<0.01; ***,
P<0.001.
[0085] FIGS. 5A-5D. Gene suppression of SUR1 blocks expression of
functional NCCa-ATP channels and improves outcome in SCI. FIG. 5A:
Western blots for SUR1 in gliotic capsule from rats with infusion
of Scr-ODN (lanes 1,2) or AS-ODN (lanes 3,4) directly into the
brain injury site for 10-12 d prior to tissue harvest;
densitometric analysis of Western blots from the same groups of
rats (n=3/group). FIG. 5B: Membrane potential of astrocytes from
gliotic capsules of the same groups of rats, during application of
Na azide to deplete ATP; the average depolarization in the 2 groups
is shown; 3 cells/group. FIG. 5C: Cord sections immunolabeled for
SUR1, 1 d post-SCI, from rats treated with i.v. infusion of Scr-ODN
or AS-ODN; quantitative immunofluorescence for the same groups of
rats; (n=3/group). FIG. 5D: measurements of blood in cord
homogenates, performance on angled plane, and vertical exploration,
1 d post-SCI, for rats treated with i.v. infusion of Scr-ODN or
AS-ODN; *, P<0.05; **, P<0.01.
[0086] FIGS. 6A-6B demonstrate a western blot validating the
specificity of the anti-SUR1 antibody (FIG. 6B) compared to an
anti-FLAG control (FIG. 6A).
[0087] FIGS. 7A-7H show that SUR1 is upregulated in human SCI.
FIGS. 7A-7H: Low power (FIGS. 7A-7D) and high power (FIGS. 7E-7H)
views of cord sections stained with H&E (FIGS. 7A, 7B, 7E-7H)
or immunolabeled for SUR1; sections from the core of the lesion
(FIGS. 7A, 7C, 7E, 7G) or from uninvolved cord (FIGS. 7B, 7D, 7F,
7H).
[0088] FIGS. 8A-8D demonstrate that SUR1 is upregulated in human
SCI. FIGS. 8A-8D: Sections from core of the lesion immunolabeled
for SUR1, showing expression in microvessels (FIG. 8A), in
ballooned neuron (FIG. 8B), and in microvessels and arterioles
(FIGS. 8C, 8D).
[0089] FIG. 9 demonstrates that a knockout of SUR1 gene is
associated with significantly better short-term neurobehavioral
outcome post-SCI. Spinal cord injury was produced by impact on the
right side of the dura after laminectomy at T9. Hindpaw function
was assessed 24 hr post-SCI using the Basso Mouse Scale for
locomotion. In WT mice, function ipsilateral to the injury was
absent whereas in SUR1-KO, function was preserved. In WT mice,
function contralateral to the lesion was significantly more
impaired than in SUR1-KO mice. An important element of the
unilateral injury model is that it clearly demonstrates spread of
progressive hemorrhagic necrosis and prevention of that spread by
SUR1-KO.
[0090] FIGS. 10A-10D show that SUR1 is upregulated by prenatal
ischemia/hypoxia. FIGS. 10A-10D: Progenitor cells in
periventricular zones (FIG. 10A) and veins scattered throughout the
basal forebrain (FIGS. 10B-10D) showed prominent upregulation of
SUR1 (red); nuclei labeled with DAPI (blue).
[0091] FIGS. 11A-11M show that SUR1 and HIF1 are upregulated in the
germinal matrix of premature infants. A-C: Low power micrographs
(FIGS. 11A, 11B) or montage of micrographs (FIG. 11C) of
periventricular tissue stained with H&E (FIG. 11A), showing
densely packed neural progenitor cells of the GM, with an arrow
pointing to a small intraparenchymal hematoma, or labeled for mRNA
for Abcc8, which encodes SUR1, using in situ hybridization (FIG.
11B), or immunolabeled for SUR1 (FIG. 11C); the latter two
demonstrate regionally-specific labeling for SUR1 mRNA and protein
in the GM; the montage in (FIG. 11C) shows positive immunolabeling
in black pseudocolor; case #9 in Table 1: premature infant of 22 wk
gestation who lived .about.12 hr and was hypoxic prior to death,
necessitating intubation and mechanical ventilation; post-mortem
interval, 3 hr. FIGS. 11D-11F: Micrographs of cortical tissues
(FIG. 11D) or GM tissues (FIGS. 11E, 11F) processed for in situ
hybridization for mRNA for Abcc8, using antisense probe (FIGS. 11D,
11E) or sense probe (FIG. 11F). FIGS. 11G-11J: Micrographs of GM
tissues immunolabeled for SUR1 (red, CY3 for SUR1, and blue, DAPI
for nuclei), and double-labeled for von Willebrand factor (green;
FIGS. 11I and 11J only); co-labeling is indicated by yellow color;
SUR1 was identified in neural progenitor cells (FIG. 11G), and in
thin-walled veins from infants with GMH (FIG. 11H, red and FIG.
11I, yellow) but not in an infant without GMH (FIG. 11J, green);
FIGS. 11H, 11I, 11J are from cases #11, 10, 1 in Table 1,
respectively. FIGS. 11K-11M: Low (FIG. 11K) and high (FIGS. 11L,
11M) power micrographs of sections immunolabeled for HIF1.alpha.
(green, FITC for HIF1.alpha., and blue, DAPI for nuclei), showing
HIF1.alpha. in a microvessel (FIG. 11L) and in neural progenitor
cells (FIG. 11M). In FIGS. 11D-11M, the bars represent 50
.mu.m.
[0092] FIG. 12 illustrates exemplary events in the germinal matrix
of premature infants. Scheme depicting the reciprocal relationship
between O.sub.2 tension on the one hand, and HIF1 activation and
SUR1 expression on the other hand. Mild hypoxia, which may be the
norm due to the ventriculopetal blood supply, promotes
neurogenesis, whereas moderate hypoxia may promote apoptosis
resulting in involution of the GM. More severe hypoxia may promote
expression of SUR1-regulated NC.sub.Ca-ATP channels, which remain
inactive until critical ATP depletion is reached (.about.30 .mu.M),
at which point the channels open, leading to oncotic death of
cells, including endothelial cells, thereby compromising the
structural integrity of veins and predisposing to GMH during
episodes of venous hypertension.
[0093] FIG. 13 shows a pressure wave produced by percussion injury
model. Typical pressure wave produced by 10-cm drop of 10 gm weight
to produce 2.5-3.0 atm peak pressure, resulting in moderate-to
severe percussion injury.
[0094] FIGS. 14A-4B show that a percussion TBI model produces deep
contusion injury. FIGS. 14A, 14B: Unprocessed (FIG. 14A) and Niss1
stained (FIG. 14B) coronal sections from two different rats 24 hr
following moderate-to-severe percussion injury (2.5-3 atm) to the
posterior parasagittal parietal cortex, note extensive hemorrhagic
contusion involving cortex, corpus callosum and underlying
hippocampus.
[0095] FIGS. 15A-E demonstrates that SUR1 is upregulated in a rat
model of percussion TBI. FIGS. 15A, 15B: Montages of sections
immunolabeled for SUR1 3 hr (FIG. 15A) and 24 hr (FIG. 15B)
post-TBI (2.5-3 atm), showing progressive upregulation of SUR1
beyond regions of necrosis; rat in (FIG. 15B) same as in FIG. 14B.
FIGS. 15C, 15D: High power views of penumbral tissue 24-hr post-TBI
immunolabeled for SUR1 (FIG. 15C) and colabeled for vimentin (FIG.
15D) to show capillaries. FIG. 15E: Western blots for SUR1 for
uninjured rat brain, including parietal cortex and underlying
hippocampus (Sham) and for the same regions 24 hr post-TBI;
.beta.-actin shown as loading control.
[0096] FIGS. 16A-16F demonstrate that SUR1 is upregulated in human
brain following gunshot wound (GSW). FIGS. 16A-16F: High power
views of neurons (FIGS. 16A-16C) and capillaries (FIGS. 16D-16F)
immunolabeled for either NeuN (FIG. 16A) or vimentin (FIG. 16D) and
double labeled for SUR1 (FIGS. 16B, 16E); superimposed images are
also shown (FIGS. 16C, 16F); biopsy specimen from 24 year old male
obtained at the time of decompressive craniotomy/debridement, 24 hr
following GSW to the brain.
[0097] FIGS. 17A-17C show that progressive secondary hemorrhage
post-TBI is reduced by glibenclamide. FIGS. 17A, 17B: Unprocessed
coronal sections showing contusion injury in vehicle-treated
control (FIG. 17A) and in glibenclamide-treated rat (FIG. 17B)
24-hr post-TBI (2.5-3 atm). FIG. 17C: Extravasated blood quantified
at various times post-TBI in vehicle-treated and
glibenclamide-treated rats, with non-linear leastsquares fit to
Boltzman equation indicating half maximum blood at 5.2 hr;
representative brain homogenates at 24 hr from both groups are also
shown (insert); n=3-5/group; **, P<0.01.
[0098] FIG. 18 demonstrates that glibenclamide does not inhibit
matrix metalloproteinase (MMP) activity. Zymography showed that
gelatinase activity of recombinant MMP (Chemicon) was the same
under control conditions (CTR) and in the presence of glibenclamide
(10 .mu.M), but was significantly reduced by MMP-inhibitor II (300
nM; Calbiochem).
[0099] FIGS. 19A-19D demonstrate that glibenclamide reduces lesion
size and spares hippocampal neurons post-TBI. FIGS. 19A-19D:
Low-power (FIGS. 19A, 19B) and high-power (FIGS. 19C, 19D) views of
Niss1-stained coronal sections 7 days post-TBI (2.5-3 atm), with
high-power views showing ipsilateral hippocampus; note overall loss
of neurons, with many remaining neurons pyknotic, in
vehicle-treated rat (FIG. 19C) versus normal appearance of
hippocampus in glibenclamide-treated rat (FIG. 19D); note
hemosiderin staining (yellow discoloration) in vehicle-treated rat
(FIG. 19C); percussion site marked by asterisk; data shown are
representative of 5 rats/group.
[0100] FIG. 20 demonstrates that glibenclamide improves
neurobehavioral function post-TBI. Images of rats in the cylinder
used to assess spontaneous forelimb use (SFU) and spontaneous
vertical exploration (SVE) post-TBI (2.5-3 atm). SVE, quantified as
the time (in sec) spent with both forepaws raised above
shoulder-height during the first 3 min in the cylinder, was
significantly greater in glibenclamide treated rats compared to
vehicle-treated rats during repeated sessions over the first week
post-injury; 5 rats/group; P<0.01 by repeated measures ANOVA;
same rats as in FIG. 19.
[0101] FIG. 21 shows that TRPM4 physically associates with SUR1 to
form the SUR1-regulated NC.sub.Ca-ATP channel. Western blot for
TRPM4 of total lysate (TL) of injured tissues (middle lane), and of
the product of immunoprecipitation using SUR1 antibody (Co-IP)
(right lane); ladder also shown (left lane) (from Simard et al.,
submitted).
[0102] FIGS. 22A-22C demonstrate that TRPM4 is upregulated in
penumbral capillaries 24 hr post-TBI. FIGS. 22A-22C: Low-power
(FIGS. 22A, 22B) and highpower (FIG. 22C) views of uninjured
control (FIG. 22A) and post-TBI penumbral (FIGS. 22B, 22C) tissues
immunolabeled for TRPM4 or von-Willebrand factor (vWf), as
indicated; merged images also shown (FIG. 22C, right panel).
[0103] FIGS. 23A-23C show patch clamp of endothelial cells attached
to freshly isolated brain capillaries. FIG. 23A: Micrograph of
capillaries isolated using magnetic particles (black clump at top
of figure); arrows point to segments targeted for patch clamp.
FIGS. 23B, 23C: Currents (FIG. 23B) and I-V curve of peak currents
(FIG. 23C) recorded from endothelial cells still attached to
capillary; standard physiological solutions inside and outside;
n=5.
DETAILED DESCRIPTION OF THE INVENTION
[0104] Unless otherwise noted, technical terms are used according
to conventional usage. Definitions of common terms in molecular
biology may be found, for example, in Benjamin Lewin, Genes VII,
published by Oxford University Press, 2000 (ISBN 019879276X);
Kendrew et al. (eds.); The Encyclopedia of Molecular Biology,
published by Blackwell Publishers, 1994 (ISBN 0632021829); and
Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a
Comprehensive Desk Reference, published by Wiley, John & Sons,
Inc., 1995 (ISBN 0471186341); and other similar technical
references, for example.
[0105] As used herein the specification, "a" or "an" may mean one
or more. As used herein in the claim(s), when used in conjunction
with the word "comprising", the words "a" or "an" may mean one or
more than one. As used herein "another" may mean at least a second
or more. In specific embodiments, aspects of the invention may
"consist essentially of" or "consist of" one or more sequences of
the invention, for example. Some embodiments of the invention may
consist of or consist essentially of one or more elements, method
steps, and/or methods of the invention. It is contemplated that any
method or composition described herein can be implemented with
respect to any other method or composition described herein.
[0106] The present application incorporates by reference herein in
their entirety the following applications: U.S. patent application
Ser. No. 11/099,332, filed Apr. 5, 2005; U.S. patent application
Ser. No. 11/359,946, filed Feb. 22, 2006; U.S. patent application
Ser. No. 11/229,236, filed Sep. 16, 2005; U.S. patent application
Ser. No. 11/574,793, filed Jul. 25, 2005; U.S. Patent Application
Ser. No. 60/880,119, filed Jan. 12, 2007; and U.S. Patent
Application Ser. No. 60/889,065, filed Feb. 9, 2007.
I. Exemplary Definitions
[0107] As used herein, "about" refers to a numeric value,
including, for example, whole numbers, fractions, and percentages,
whether or not explicitly indicated. The term "about" generally
refers to a range of numerical values (e.g., +/-5-10% of the
recited value) that one would consider equivalent to the recited
value (e.g., having the same function or result). In some
instances, the term "about" may include numerical values that are
rounded to the nearest significant figure.
[0108] As used herein, the term "antagonist" refers to a biological
or chemical agent that acts within the body to reduce the
physiological activity of another chemical or biological substance.
In the present invention, the antagonist blocks, inhibits, reduces
and/or decreases the activity of a NC.sub.Ca-ATP channel of any
cell. In the present invention, the antagonist combines, binds,
associates with a NC.sub.Ca-ATP channel of a cell, such as an
endothelial cell, including cells in capillary endothelium, neurons
or neuron-like cells, or reactive astrocytes, for example, such
that the NC.sub.Ca-ATP channel is closed (deactivated), meaning
reduced biological activity with respect to the biological activity
in the diseased state. In certain embodiments, the antagonist
combines, binds and/or associates with a regulatory subunit of the
NC.sub.Ca-ATP channel, particularly a SUR1: combines, binds, and/or
associates with a pore-forming subunit of the NC.sub.Ca-ATP
channel, such as TRPM4; or both. The terms antagonist or inhibitor
can be used interchangeably.
[0109] As used herein, antagonists, inhibitors, and blockers of the
NC.sub.Ca-ATP channel are those agents that reduce the activity or
expression of the NC.sub.Ca-ATP channel, and may include (but are
not limited to) SUR1 antagonists, TRPM4 antagonists, anti-sense
molecules that inhibit expression of the NC.sub.Ca-ATP channel,
MgADP, blockers of K.sub.ATP channel, agents that inhibit
incorporation of the NC.sub.Ca-ATP channel into the cell membrane,
and other compounds and agents that prevent or reduce the activity
of the NC.sub.Ca-ATP channel. For example, non-sulfonyl urea
compounds, such as 2, 3-butanedione and 5-hydroxydecanoic acid,
quinine, and therapeutically equivalent salts and derivatives
thereof, may be employed as antagonists, inhibitors, and blockers
of the NC.sub.Ca-ATP channel. An inhibitor may comprise a protein,
a peptide, a nucleic acid (such as an RNAi molecule or antisense
RNA, including siRNA), or a small molecule.
[0110] As used herein, the term "depolarization" refers to a change
in the electrical potential difference across the cell membrane
(between the inside of the cell and the outside of the cell, with
outside taken as ground potential), where that electrical potential
difference is reduced, eliminated, or reversed in polarity.
Activation of a non-selective channel, such as the NC.sub.Ca-ATP
channel, will typically increase in the permeability of the cell
membrane to sodium and other ions effective to reduce the
magnitude, and may nearly or completely eliminate, the electrical
potential difference across a cell membrane.
[0111] As used herein, the terms "effective amount" or
"therapeutically effective amount" are interchangeable and refer to
an amount that results in an improvement or remediation of at least
one symptom of the disease or condition. Those of skill in the art
understand that the effective amount may improve the patient's or
subject's condition, but may not be a complete cure of the disease
and/or condition.
[0112] As used herein, the term "endothelium" refers to a layer of
cells that line the inside surfaces of body cavities, blood
vessels, and lymph vessels or that form capillaries.
[0113] As used herein, the term "endothelial cell" refers to a cell
of the endothelium or a cell that lines the surfaces of body
cavities, for example, blood or lymph vessels or capillaries. In
certain embodiments, the term endothelial cell refers to a neural
endothelial cell or an endothelial cell that is part of the nervous
system, for example the central nervous system or the brain or
spinal cord.
[0114] As used herein, the term "inhibit" refers to the ability of
the compound to block, partially block, interfere, decrease, reduce
or deactivate a channel such as the NC.sub.Ca-ATP channel. Thus,
one of skill in the art understands that the term inhibit
encompasses a complete and/or partial loss of activity of a
channel, such as the NC.sub.Ca-ATP channel. Channel activity may be
inhibited by channel block (occlusion or closure of the pore
region, preventing ionic current flow through the channel), by
changes in an opening rate or in the mean open time, changes in a
closing rate or in the mean closed time, or by other means. For
example, a complete and/or partial loss of activity of the
NC.sub.Ca-ATP channel as may be indicated by a reduction in cell
depolarization, reduction in sodium ion influx or any other
monovalent ion influx, reduction in an influx of water, reduction
in extravasation of blood, reduction in cell death, as well as an
improvement in cellular survival following an ischemic
challenge.
[0115] As used herein, the term "inhibits the NC.sub.Ca-ATP
channel" refers to a reduction in, cessation of, or blocking of,
the activity of the NC.sub.Ca-ATP channel, including inhibition of
current flow through the channel, inhibition of opening of the
channel, inhibition of activation of the channel, inhibition or
reduction of the expression of the channel, including inhibition or
reduction of genetic message encoding the channel and inhibition or
reduction of the production channel proteins, inhibition or
reduction of insertion of the channel into the plasma membrane of a
cell, or other forms of reducing the physiologic activity of the
NC.sub.Ca-ATP channel.
[0116] The term "morbidity" as used herein is the state of being
diseased. Yet further, morbidity can also refer to the disease rate
or the ratio of sick subjects or cases of disease in to a given
population.
[0117] The term "mortality" as used herein is the state of being
mortal or causing death. Yet further, mortality can also refer to
the death rate or the ratio of number of deaths to a given
population.
[0118] The term "preventing" as used herein refers to minimizing,
reducing or suppressing the risk of developing a disease state or
parameters relating to the disease state or progression or other
abnormal or deleterious conditions.
[0119] As used herein, the term "reduces" refers to a decrease in
cell death, inflammatory response, hemorrhagic conversion,
extravasation of blood, etc. as compared to no treatment with the
compound of the present invention. Thus, one of skill in the art is
able to determine the scope of the reduction of any of the symptoms
and/or conditions associated with a spinal cord injury in which the
subject has received the treatment of the present invention
compared to no treatment and/or what would otherwise have occurred
without intervention.
[0120] As used herein, the terms "SUR1 antagonist," "SUR1
inhibitor," and "SUR1 blocker" and their grammatical variants may
be used interchangeably and each refers to compounds that reduce
the activity or effect of the receptors SUR1, and include (but are
not limited to) such compounds as, for example, glibenclamide (also
known as glyburide), tolbutamide, repaglinide, nateglinide,
meglitinide, midaglizole, LY397364, LY389382, glyclazide,
glimepiride, estrogen, estrogen related-compounds (estradiol,
estrone, estriol, genistein, non-steroidal estrogen (e.g.,
diethystilbestrol), phytoestrogen (e.g., coumestrol), zearalenone,
etc.) and combinations thereof. Chemical names of some SUR1
antagonists include: glibenclamide
(1[p-2[5-chloro-O-anisamido)ethyl] phenyl]
sulfonyl]-3-cyclohexyl-3-urea); chlopropamide
(1-[[(p-chlorophenyl)sulfonyl]-3-propylurea; glipizide
(1-cyclohexyl-3 [[p-[2(5-methylpyrazine carboxamido) ethyl] phenyl]
sulfonyl] urea); and tolazamide
(benzenesulfonamide-N-[[(hexahydro-1H-azepin-1yl)amino]
carbonyl]-4-methyl)
[0121] As used herein, the terms "TRPM4 antagonist," "TRPM4
inhibitor," and "TRPM4 blocker" and their grammatical variants may
be used interchangeably and each refers to compounds that reduce
the activity or effect of the TRPM4 channel, e.g. by reducing or
blocking the flow of ions through the TRPM4 pore, and include (but
are not limited to) such compounds as, for example, pinkolant,
rimonabant, a fenamate (such as flufenamic acid, mefenamic acid,
meclofenamic acid, or niflumic acid),
1-(beta-[3-(4-methoxy-phenyl)propoxy]-4-methoxyphenethyl)-1H-imidazole
hydrochloride, and a biologically active derivatives thereof.
[0122] The terms "treating" and "treatment" as used herein refer to
administering to a subject a therapeutically effective amount of a
composition so that the subject has an improvement in the disease
or condition. The improvement is any observable or measurable
improvement. Thus, one of skill in the art realizes that a
treatment may improve the patient's condition, but may not be a
complete cure of the disease. Treating may also comprise treating
subjects at risk of developing a disease and/or condition.
II. Exemplary Embodiments of the Invention
[0123] In particular cases of the invention, there are methods
and/or compositions for the treatment and/or prevention of spinal
cord injury, brain injury, and other damage to the nervous system,
such as, e.g., injury related to progressive hemorrhagic necrosis,
and intraventricular hemorrhage.
[0124] A. Intraventricular Hemorrhage
[0125] In exemplary embodiments of the invention, there are methods
and compositions and kits for the treatment and/or prevention of
intraventricular hemorrhage in an individual. The present invention
concerns a specific channel, the NC.sub.Ca-ATP channel, which is
expressed, for example, in the vasculature endothelium and germinal
matrix following intraventricular hemorrhage (IVH). This unique
non-selective cation channel is activated by intracellular calcium
and blocked by intracellular ATP (NC.sub.Ca-ATP channel), and can
be also be expressed in, for example, neural cells, such as
neuronal cells, neuroglia cells (also termed glia, or glial cells,
e.g., astrocyte, ependymal cell, oligodentrocyte and microglia) or
endothelial cells (e.g., capillary endothelial cells) in which the
cells have been or are exposed to a traumatic insult, for example,
an acute insult (e.g., hypoxia, ischemia, tissue compression,
mechanical distortion, cerebral edema or cell swelling), toxic
compounds or metabolites, an acute injury, cancer, and brain
abscess.
[0126] Without being bound by theory, it is believed that the
hypoxic-ischemic environment in prematurity leads to
transcriptional activation of SUR1 and opening of NC(Ca-ATP)
channels in IVH, initiating a cascade of events culminating in
acute hemorrhage in parallel with ischemic stroke.
[0127] Intraventricular hemorrhage is bleeding into ventricular
spaces, which are spaces in the brain that carry cerebrospinal
fluid. Following birth, the premature infant's brain is exposed to
changes in blood flow and oxygen levels, which may cause the many
tiny, fragile blood vessels of the infant's brain to break and
bleeding to occur. Such an event happens usually in babies who are
extremely premature or who have medical problems during or after
birth. Intraventricular hemorrhage often occurs in very low
birthweight babies weighing less than 1,500 grams. Almost all IVH
occurs within the first week of life.
[0128] Babies with respiratory problems such as hyaline membrane
disease, or other complications of prematurity, are at greater risk
to have IVH. The smaller and more premature the baby, the more
likely IVH will occur. Although many babies have no symptoms at the
time that bleeding occurs, some infants do have symptoms, including
apnea, bradycardia, poor muscle tone, decreased activity, anemia,
seizures, high-pitched cry, weak suck, cyanosis, and/or bulging
fontanel.
[0129] Infants at risk for IVH may have an ultrasound of the head
to look for bleeding in the first days following birth. IVH is
graded on a scale of one to four, with grade IV being most severe.
Grade 1 is considered when bleeding occurs just in a small area of
the ventricles; in Grade 2, bleeding also occurs inside the
ventricles; in Grade 3, ventricles are enlarged by the blood; and
in Grade 4, there is bleeding into the brain tissues around the
ventricles.
[0130] More than half of babies born weighing less than 1,000 grams
have intraventricular hemorrhages, although most of these bleeds
are mild (Grade I or II), and many resolve with few or no problems,
wherein, for example, the body absorbs the blood. In more severe
cases (Grade III or IV), however, as blood absorbs there can be
damage to the brain tissue, and these cases (especially Grade IV)
can result in additional problems, such as enlarged ventricles,
hydrocephalus, cerebral palsy, hearing loss, vision problems,
and/or learning disabilities, for example.
[0131] In some cases, the infant develops hydrocephalus, which may
be treated by medicines to decrease the amount of spinal fluid that
the brain makes, frequent lumbar punctures (LPs), reservoir, or
shunt.
[0132] Long-term abnormalities that may occur following
intraventricular hemorrhage include at least motor (movement)
problems (tight or stiff muscles; slow to crawl, stand, or walk;
abnormal crawling, toe walking; moving one side more than the
other; frequent arching of the back (not just when angry or at
play); slow mental development (does not listen to the parent voice
by age 3-4 months after hospital discharge; does not make different
sounds by 8-9 months after discharge; does not seem to understand
or say any words by 12-13 months after discharge); seizure;
deafness; blindness; poor coordination or balance; specific
learning disabilities (math or reading); very short attention span;
behavioral problems; difficulty with activities that require
coordination of the eyes and hands, for example, catching a ball or
copying a simple drawing; and vision correction, for example.
[0133] Prior to the present invention, there was no treatment for
intraventricular hemorrhage itself, although mother's between 24
and 34 weeks of gestation and may be at risk for early delivery may
be provided corticosteroids before delivery, which has been shown
to lower the risk of IVH in the baby.
[0134] In other embodiments, the present invention is drawn to the
regulation and/or modulation of this NC.sub.Ca-ATP channel and how
its modulation can be used to treat various diseases and/or
conditions, for example, IVH. In specific embodiments, the
modulation and/or regulation of the channel results from
administration of an antagonist or inhibitor of the channel. Thus,
depending upon the disease state or progression, a composition (an
antagonist or inhibitor) is administered to block or inhibit at
least in part the channel to prevent cell death, for example, that
results from IVH. In these instances, the channel is blocked to
prevent or reduce or modulate, for example, depolarization of the
cells or other pathological conditions associated with IVH.
[0135] In one aspect, the present invention provides novel methods
of treating a patient comprising administering at least a
therapeutic compound that targets a unique non-selective cation
channel activated by intracellular calcium and blocked by
intracellular ATP (NC.sub.Ca-ATP channel), in combination with an
additional therapeutic compound. In specific embodiments, the
therapeutic compound that targets the channel may be an antagonist
(such as a SUR1 inhibitor or a TRPM4 inhibitor, for example) that
is employed in therapies, such as treatment of IVH, whereby
blocking and/or inhibiting the NC.sub.Ca-ATP channel ameliorates
pathological conditions associated with IVH.
[0136] In certain embodiments, additional compounds for the
compositions of the invention include cation channel blockers and
antagonists of VEGF, MMP, NOS, and/or thrombin, for example.
[0137] Further embodiments comprises a method of treating a subject
at risk of IVH comprising administering to the subject a
combinatorial therapeutic composition effective at least in part to
inhibit a NC.sub.Ca-ATP channel in a cell, such as, for example, an
endothelial cell, germinal matrix tissue, or a combination
thereof.
[0138] The invention also encompasses the use of such compounds in
combinatorial compositions that at least in part modulate
NC.sub.Ca-ATP channel activity to treat, for example, IVH. In
certain embodiments, IVH causes cell swelling resulting in cellular
damage (including, for example, cell death). Further provided by
the invention is a method of preventing cellular swelling and the
resulting cellular damage through the therapeutic use of
antagonists to the NC.sub.Ca-ATP channel, in combination with an
additional therapeutic compound. In one embodiment, the therapeutic
combinatorial composition can be administered to a premature infant
subject to or undergoing IVH. The invention further provides the
therapeutic use of sulfonylurea compounds as antagonists to the
NC.sub.Ca-ATP channel to treat IVH. In one embodiment the
sulfonylurea compound is glibenclamide. In another embodiment, the
sulfonylurea compound is tolbutamide, or any of the other compounds
that have been found to promote insulin secretion by acting on KATP
channels in pancreatic .beta. cells, as listed elsewhere
herein.
[0139] In certain embodiments, NC.sub.Ca-ATP channel is blocked,
inhibited, or otherwise is decreased in activity. In such examples,
an antagonist of the NC.sub.Ca-ATP channel is administered and/or
applied. The antagonist modulates the NC.sub.Ca-ATP channel such
that flux (ion and/or water) through the channel is reduced,
ceased, decreased and/or stopped. The antagonist may have a
reversible or an irreversible activity with respect to the activity
of the NC.sub.Ca-ATP channel IVH. Thus, inhibition of the
NC.sub.Ca-ATP channel can reduce cytotoxic edema and death of
endothelial cells which are associated IVH.
[0140] Accordingly, the present invention is useful in the
treatment or prevention of IVH. According to a specific embodiment
of the present invention the administration of effective amounts of
the active compound can block the channel, which if remained open
leads to cell swelling and cell death. A variety of antagonists to
SUR1 are suitable for blocking the channel. Examples of suitable
SUR1 antagonists include, but are not limited to glibenclamide,
tolbutamide, repaglinide, nateglinide, meglitinide, midaglizole,
LY397364, LY389382, glyclazide, glimepiride, estrogen, estrogen
related-compounds and combinations thereof. In a preferred
embodiment of the invention the SUR1 antagonists is selected from
the group consisting of glibenclamide and tolbutamide. Another
antagonist that can be used is MgADP. Still other therapeutic
"strategies" for preventing cell swelling and cell death can be
adopted including, but not limited to methods that maintain the
cell in a polarized state and methods that prevent strong
depolarization.
[0141] In certain embodiments, the invention encompasses
antagonists of the NC.sub.Ca-ATP channel, including small
molecules, large molecules, and antibodies, as well as nucleotide
sequences that can be used to inhibit NC.sub.Ca-ATP channel gene
expression (e.g., antisense and ribozyme molecules). An antagonist
of the NC.sub.Ca-ATP channel includes one or more compounds capable
of (1) blocking the channel; (2) preventing channel opening; (3)
reducing the magnitude of membrane current through the channel; (4)
inhibiting transcriptional expression of the channel; and/or (5)
inhibiting post-translational assembly and/or trafficking of
channel subunits.
[0142] In certain embodiments of the invention, several pathways to
cell death are involved in IVH, which require monovalent or
divalent cation influx, implicating non-selective cation (NC)
channels. In specific embodiments, NC channels are also likely to
be involved in the dysfunction of vascular endothelial cells that
leads to formation of edema IVH. In other specific embodiments,
blockers of NC channels, including pinokalant (LOE 908 MS) and
rimonabant (SR141716A) can be administered to treat IVH.
[0143] In other embodiments of the invention, IVH causes capillary
dysfunction, resulting in edema formation and hemorrhagic
conversion. In specific embodiments, the invention generally
concerns the central role of Starling's principle, which states
that edema formation is determined by the "driving force" and
capillary "permeability pore." In particular aspects related to the
invention, movements of fluids are driven largely without new
expenditure of energy. In one embodiment, the progressive changes
in osmotic and hydrostatic conductivity of abnormal capillaries is
organized into 3 phases: formation of ionic edema, formation of
vasogenic edema, and catastrophic failure with hemorrhagic
conversion. In certain embodiments, IVH capillary dysfunction is
attributed to de novo synthesis of a specific ensemble of proteins
that determine the terms for osmotic and hydraulic conductivity in
Starling's equation, and whose expression is driven by a distinct
transcriptional program.
[0144] Another embodiment of the present invention comprises a
method of reducing morbidity and morality of a subject suffering
from IVH comprising administering to the subject a therapeutic
composition comprising a single NC.sub.Ca-ATP channel inhibitor or
a combinatorial therapeutic composition effective to inhibit
NC.sub.Ca-ATP channels in a cell, including, for example, an
endothelial cell, germinal matrix tissue, or a combination thereof.
In specific embodiments, morbidity and mortality includes, for
example, death, shunt-dependent hydrocephalus, and life-long
neurological consequences such as cerebral palsy, seizures, mental
retardation, and other neurodevelopmental disabilities.
[0145] In specific embodiments, the individual is an infant,
including a premature infant, although in alternative embodiments
the individual is a child or adult. The treatment and/or prevention
may occur prior and/or following birth of the infant, and the
treatment and/or prevention may be directed to the mother during
pregnancy, in specific embodiments. In particular cases, the
pregnant mother is at risk for delivery prematurely and may be
provided methods and compositions of the invention to treat and/or
prevent intraventricular hemorrhage in the infant following birth.
Women at risk for preterm delivery include at least if they have
one or more of the following conditions or situations: pregnant
with multiples; have had a previous premature birth; have certain
uterine or cervical abnormalities; recurring bladder and/or kidney
infections; urinary tract infections, vaginal infections, and
sexually transmitted infections; infection with fever (greater than
101 degrees F.) during pregnancy; unexplained vaginal bleeding
after 20 weeks of pregnancy; chronic illness such as high blood
pressure, kidney disease or diabetes; multiple first trimester
abortions or one or more second trimester abortions; underweight or
overweight before pregnancy; clotting Disorder (thrombophilia);
being Pregnant with a single fetus after in vitro fertilization
(IVF); short time between pregnancies (less than 6-9 months between
birth and beginning of the next pregnancy); little or no prenatal
care; smoking; drinking alcohol; using illegal drugs; victim of
domestic violence, including physical, sexual or emotional abuse;
lack of social support; high levels of stress; low income; and/or
long working hours with long periods of standing.
[0146] Thus, in women at risk for preterm delivery, the mother or
infant (in utero) may be provided methods and/or compositions of
the invention, including women at risk for developing premature
labor or who have symptoms of having premature labor, such as
having labor symptoms prior to 37 weeks of gestation.
Alternatively, or in addition, the inventive methods and/or
compositions may be provided to the infant following birth.
[0147] The treatment and/or prevention of intraventricular
hemorrhage utilizes inhibitors of a NC.sub.Ca-ATP channel, and in
particular cases this channel is upregulated in brain tissues prior
to and/or during onset of intraventricular hemorrhage. In certain
aspects, the channel is upregulated in endothelial cells in the
brain, neural cells, including neuronal cells, and so forth. In
specific embodiments, the inhibitors are directed to a regulatory
component of the channel and/or a pore-forming subunit of the
channel, although other components of the channel may be targeted,
or example. The inhibitors, in particular cases, are directed to
SUR1, a regulatory subunit of the channel. TRPM4, a pore-forming
subunit of the channel, or they may be mixtures or combinations
thereof. SUR1 inhibitors include sulfonylurea compounds, benzamido
derivatives, or mixtures thereof.
[0148] In a specific embodiment, the inhibitor is provided to the
mother prior to 37 weeks of gestation. In another specific
embodiment, the mother is at risk for premature labor. In a further
specific embodiment, the pregnancy is less than 37 weeks in
gestation and the mother has one or more symptoms of labor.
Symptoms of labor are known in the art, although in specific
embodiments they include one or more of the following: a
contraction every 10 minutes, or more frequently within one hour
(five or more uterine contractions in an hour); watery fluid
leaking from the vagina, which could signal that the bag of water
has broken; menstrual-like cramps felt in the lower abdomen that
may be transient or constant; low, dull backache experienced below
the waistline that may be transient or constant; pelvic pressure;
abdominal cramps that may occur with or without diarrhea; and/or
increase or change in vaginal discharge.
[0149] B. Spinal Cord Injury and Progressive Hemorrhagic
Necrosis
[0150] Acute spinal cord injury (SCI) results in progressive
hemorrhagic necrosis (PHN), a poorly understood pathological
process characterized by hemorrhage and necrosis that leads to
devastating loss of spinal cord tissue, cyctic cavitation of the
cord, and debilitating neurological dysfunction. Using a rodent
model of severe cervical SCI, SUR1-regulated NC.sub.Ca-ATP channels
were characterized for involvement in PHN. In controls, SCI caused
a progressively expansive lesion with fragmentation of capillaries,
hemorrhage that doubled in volume over 12 h, tissue necrosis and
severe neurological dysfunction. Necrotic lesions were surrounded
by widespread up-regulation of SUR1 in capillaries and neurons.
Patch clamp of cultured endothelial cells exposed to hypoxia showed
that up-regulation of SUR1 was associated with expression of
functional SUR1-regulated NC.sub.Ca-ATP channels. Following SCI,
block of SUR1 by glibenclamide or repaglinide, or gene suppression
of SUR1 by phosphorothioated antisense oligodeoxynucleotide,
essentially eliminated capillary fragmentation and progressive
accumulation of blood, was associated with significant sparing of
white matter tracts and a 3-fold reduction in lesion volume, and
resulted in marked neurobehavioral functional improvement compared
to controls. Therefore, SUR1-regulated NC.sub.Ca-ATP channels in
capillary endothelium are critical to development of PHN and
constitute a major novel target for therapy in SCI.
[0151] 1. Spinal Cord Injury--the Clinical Problem
[0152] Acute spinal cord injury (SCI) results in physical
disruption of spinal cord neurons and axons leading to deficits in
motor, sensory, and autonomic function. This is a debilitating
neurological disorder common in young adults that often requires
life-long therapy and rehabilitative care, placing a significant
burden on healthcare systems. The fact that SCI impacts mostly
young people makes the tragedy all the more horrific, and the cost
to society in terms of lost "person-years" all the more enormous.
Sadly, many patients exhibit neuropathologically and clinically
complete cord injuries following SCI. However, many others have
neuropathologically incomplete lesions (Hayes and Kakulas, 1997;
Tator and Fehlings, 1991). giving hope that proper treatment to
minimize secondary injury may reduce the functional impact.
[0153] 2. Secondary Injury--Progressive Hemorrhagic Necrosis
(PHN)
[0154] The concept of secondary injury in SCI arises from the
observation that the volume of injured tissue increases with time
after injury, i.e., the lesion itself expands and evolves over
time. Whereas primary injured tissues are irrevocably damaged from
the very beginning, right after impact, tissues that are destined
to become "secondarily" injured are considered to be potentially
salvageable. Secondary injury in SCI has been reviewed in a classic
paper by Tator (1991), as well as in more recent reviews (Kwon et
al., 2004), wherein the overall concept of secondary injury is
validated. Older observations based on histological studies that
gave rise to the concept of lesion-evolution have been confirmed
with non-invasive MRI (Bilgen et al., 2000; Ohta et al., 1999;
Sasaki et al., 1978; Weirich et al., 1990).
[0155] Numerous mechanisms of secondary injury are recognized,
including edema, ischemia, oxidative stress and inflammation. In
SCI, however, one pathological entity in particular is recognized
that is relatively unique to the spinal cord and that has
especially devastating consequences--progressive hemorrhagic
necrosis (PHN) (Fitch et al., 1999; Kraus, 1996; nelson et al.,
1977; Tator, 1991; Tator and Fehlings, 1991; Tator and Koyanagi,
1997).
[0156] PHN is a rather mysterious condition, first recognized over
3 decades ago, that has previously eluded understanding and
treatment. As disclosed herein, the present invention provides
treatment for this condition. Following impact, petechial
hemorrhages form in surrounding tissues and later emerge in more
distant tissues, eventually coalescing into the characteristic
lesion of hemorrhagic necrosis. The specific time course and
magnitude of these changes remain to be determined, but papers by
Khan et al. (1985) and Kawata et al. (1993) nicely describe the
progressive increase in hemorrhage in the cord. After injury, a
small hemorrhagic lesion involving primarily the capillary-rich
central gray matter is observed at 15 min, but hemorrhage, necrosis
and edema in the central gray matter enlarge progressively over a
period of 3-24 h (Balentine, 1978; Iizuka et al., 1987; Kawata et
al., 1993). The white matter surrounding the hemorrhagic gray
matter shows a variety of abnormalities, including decreased
H&E staining, disrupted myelin, and axonal and periaxonal
swelling. Tator and Koyanagi (1997) noted that white matter lesions
extend far from the injury site, especially in the posterior
columns. The evolution of hemorrhage and necrosis has been referred
to as "autodestruction", and it is this that forms the key
observation that defines PHN. PHN eventually causes loss of vital
spinal cord tissue and, in some species including humans, leads to
post-traumatic cystic cavitation surrounded by glial scar
tissue.
[0157] 3. Mechanisms of Delayed Hemorrhage and PHN
[0158] Tator and Koyanagi (1997) expressed the view that
obstruction of small intramedullary vessels by the initial
mechanical stress or secondary injury may be responsible for PHN.
Kawata and colleagues (1993) attributed the progressive changes to
leukocyte infiltration around the injured area leading to plugging
of capillaries. Most importantly, damage to the endothelium of
spinal cord capillaries and postcapillary venules has been regarded
as a major factor in the pathogenesis of PHN (Griffiths et al.,
1978; Kapadia, 1984; Nelson et al., 1977). That endothelium is
involved is essentially certain, given that petechial hemorrhages,
the primary characteristic of PHN, arise from nothing less than
catastrophic failure of capillary or venular integrity. However, no
molecular mechanism for progressive dysfunction of endothelium has
heretofore been identified.
[0159] "Hemorrhagic conversion" is a term familiar to many from the
stroke literature, but not from the SCI literature. Hemorrhagic
conversion describes the process of conversion from a bland infarct
into a hemorrhagic infarct, and is typically associated with
post-ischemic reperfusion, either spontaneous or induced by
thrombolytic therapy. The molecular pathology involved in
hemorrhagic conversion has yet to be fully elucidated, but
considerable work has implicated enzymatic destruction of
capillaries by matrix-metalloproteinases (MMP) released by invading
neutrophils (Gidday et al., 2005; Justicia et al., 2003; Lorenzl et
al., 2003; Romanic et al., 1998). Maladaptive activation of MMP
compromises the structural integrity of capillaries, leading to
formation of petechial hemorrhages. In ischemic stroke, MMP
inhibitors reduce hemorrhagic conversion following
thrombolytic-induced reperfusion. MMPs are also implicated in
spinal cord injury (de et al., 2000; Duchossoy et al., 2001;
Duchossoy et al., 2001; Goussev et al., 2003; Hsu et al., 2006;
Noble et al., 2002; Wells et al., 2003). In SCI, however, their
role has been studied predominantly in the context of delayed
tissue healing, and no evidence has been put forth to suggest their
involvement in PHN.
[0160] Expression and activation of NC.sub.Ca-ATP channels (see
Simard et al., 2007) gives rise to PHN. The data demonstrate that
cells that express the NC.sub.Ca-ATP channel following an ischemic
or other injury-stimulus, later undergo oncotic (necrotic) cell
death when ATP is depleted. This is shown explicitly for astrocytes
(Simard et al., 2006), and in specific embodiments it also occurs
with capillary endothelial cells that express the channel. It
follows that if capillary endothelial cells undergo this process
leading to necrotic death, capillary integrity would be lost,
leading to extravasation of blood and formation of petechial
hemorrhages. Applicants disclose herein that inhibition of
NC.sub.Ca-ATP channels is useful to prevent and to treat PHN and
SCI.
[0161] 4. Therapies in SCI
[0162] No cure exists for the primary injury in SCI, but research
has identified various pharmacological compounds that specifically
antagonize secondary injury mechanisms responsible for worsened
outcome in SCI. Several compounds including methylprednisolone,
GM-1 ganglioside, thyrotropin releasing hormone, nimodipine, and
gacyclidine have been tested in prospective randomized clinical
trials of SCI, with only methylprednisolone and GM-1 ganglioside
showing evidence of a modest benefit (Fehlings and Baptiste, 2005).
At present, high dose methylprednisolone steroid therapy is the
only pharmacological therapy shown to have efficacy in a Phase
Three randomized trial when it can be administered within eight
hours of injury (Bracken, 2002; Bracken et al., 1997; Bracken et
al., 1998).
[0163] Of the numerous treatments assessed in SCI, very few have
been shown to actually decrease the hemorrhage and tissue loss
associated with PHN. Methylprednisolone, the only approved therapy
for SCI, improves edema, but does not alter the development of PHN
(Merola et al., 2002). A number of compounds have shown beneficial
effects related to sparing of white matter, including the NMDA
antagonist, MK801 (Faden et al., 1988), the AMPA antagonist, GYKI
52466 (Colak et al., 2003), Na.sup.+ channel blockers (Schwartz and
Fehlings, 2001; Teng and Wrathall, 1997), minocycline (Teng et al.,
2004), and estrogen (Chaovipoch et al., 2006).
[0164] However, no treatment has been previously reported that
reduces PHN and lesion volume, and that improves neurobehavioral
function to the extent that is disclosed herein in which the highly
selective but exemplary SUR1 antagonists, glibenclamide and
repaglinide, as well as with antisense-oligodeoxynucleotide
(AS-ODN) directed against SUR1, are able to treat PHN. It is useful
that the molecular mechanisms targeted by these 3 agents--SUR1 and
the SUR1-regulated NC.sub.Ca-ATP channel, are characterized to
further elucidate their role in PHN.
III. NC.sub.Ca-ATP Channel
[0165] A unique non-selective monovalent cationic ATP-sensitive
channel (NC.sub.Ca-ATP channel) was identified first in native
reactive astrocytes (NRAs) and later in neurons and capillary
endothelial cells after stroke or traumatic brain or spinal cord
injury (see International application WO 03/079987 to Simard et
al., and Chen and Simard, 2001, each incorporated by reference
herein in its entirety). As with the K.sub.ATP channel in
pancreatic .beta. cells, the NC.sub.CaATP channel is considered to
be a heteromultimer structure comprised of sulfonylurea receptor
type 1 (SUR1) regulatory subunits and pore-forming subunits (Chen
et al., 2003), which include TRPM4 pore subunits.
[0166] The invention is based, in part, on the discovery of a
specific channel, the NC.sub.Ca-ATP channel, defined as a channel
on astrocytes in U.S. Application Publication No. 20030215889,
which is incorporated herein by reference in its entirety. More
specifically, the present invention has further defined that this
channel is not only expressed on astrocytes, it is expressed at
least on neural cells, neuroglial cells, and/or neural endothelial
cells after brain and spinal cord trauma, for example, an hypoxic
event, an ischemic event, or other secondary neuronal injuries
relating to these events.
[0167] The NC.sub.Ca-ATP channel is activated by calcium ions
(Ca.sup.2+) and is sensitive to ATP. Thus, this channel is a
non-selective cation channel activated by intracellular Ca.sup.2+
and blocked by intracellular ATP. When opened by depletion of
intracellular ATP, this channel is responsible for complete
depolarization due to massive Na.sup.+ influx, which creates an
electrical gradient for Cl.sup.- and an osmotic gradient for
H.sub.2O, resulting in cytotoxic edema and cell death. When the
channel is blocked or inhibited, massive Na.sup.+ does not occur,
thereby preventing cytotoxic edema.
[0168] Certain functional characteristics distinguish the
NC.sub.Ca-ATP channel from other known ion channels. These
characteristics can include, but are not limited to, at least some
of the following: 1) it is a non-selective cation channel that
readily allows passage of Na.sup.+, K.sup.+ and other monovalent
cations; 2) it is activated by an increase in intracellular
calcium, and/or by a decrease in intracellular ATP; 3) it is
regulated by sulfonylurea receptor type 1 (SUR1), which heretofore
had been considered to be associated exclusively with K.sub.ATP
channels such as those found in pancreatic .beta. cells.
[0169] More specifically, the NC.sub.Ca-ATP channel of the present
invention has a single-channel conductance to potassium ion
(K.sup.+) between 20 and 50 pS. The NC.sub.Ca-ATP channel is also
stimulated by Ca.sup.2+ on the cytoplasmic side of the cell
membrane in a physiological concentration range, where
concentration range is from 10.sup.-8 to 10.sup.-5 M. The
NC.sub.Ca-ATP channel is also inhibited by cytoplasmic ATP in a
physiological concentration range, where the concentration range is
about 0.1 mM to about 10 mM, or more particularly about 0.2 mM to
about 5 mM. The NC.sub.Ca-ATP channel is also permeable to the
following cations; K.sup.+, Cs.sup.+, Li.sup.+, Na.sup.+; to the
extent that the permeability ratio between any two of the cations
is greater than 0.5 and less than 2.
[0170] SUR imparts sensitivity to antidiabetic sulfonylureas such
as glibenclamide and tolbutamide and is responsible for activation
by a chemically diverse group of agents termed "K.sup.+ channel
openers" such as diazoxide, pinacidil and cromakalin (Aguilar-Bryan
et al., 1995; Inagaki et al., 1996; Isomoto et al., 1996; Nichols
et al., 1996; Shyng et al., 1997). In various tissues, molecularly
distinct SURs are coupled to distinct pore-forming subunits to form
different K.sub.ATP channels with distinguishable physiological and
pharmacological characteristics. The K.sub.ATP channel in
pancreatic f cells is formed from SUR1 linked with Kir6.2, whereas
the cardiac and smooth muscle K.sub.ATP channels are formed from
SUR2A and SUR2B linked with Kir6.2 and Kir6.1, respectively (Fujita
et al., 2000). Despite being made up of distinctly different
pore-forming subunits, the NC.sub.Ca-ATP channel is also sensitive
to sulfonylurea compounds.
[0171] Also, unlike the K.sub.ATP channel, the NC.sub.Ca-ATP,
channel conducts sodium ions, potassium ions, cesium ions and other
monovalent cations with near equal facility (Chen and Simard, 2001)
suggesting further that the characterization, and consequently the
affinity to certain compounds, of the NC.sub.Ca-ATP channel differs
from the K.sub.ATP channel.
[0172] Other nonselective cation channels that are activated by
intracellular Ca.sup.2+ and inhibited by intracellular ATP have
been identified by others but not in astrocytes or neurons as
disclosed herein. Further, the NC.sub.Ca-ATP, channel expressed and
found in astrocytes differs physiologically from the other channels
with respect to calcium sensitivity and adenine nucleotide
sensitivity (Chen et al., 2001).
[0173] The NC.sub.Ca-ATP channel can be inhibited by an
NC.sub.Ca-ATP channel inhibitor, an NC.sub.Ca-ATP channel blocker,
a type 1 sulfonylurea receptor (SUR1) antagonist, SUR1 inhibitor,
or a compound capable of reducing the magnitude of membrane current
through the channel. More specifically, the exemplary SUR1
antagonist may be selected from the group consisting of
glibenclamide, tolbutamide, repaglinide, nateglinide, meglitinide,
midaglizole, LY397364, LY389382, glyclazide, glimepiride, estrogen,
estrogen related-compounds (estradiol, estrone, estriol, genistein,
non-steroidal estrogen (e.g., diethystilbestrol), phytoestrogen
(e.g., coumestrol), and zearalenone), and compounds known to
inhibit or block K.sub.ATP channels. MgADP can also be used to
inhibit the channel. Other compounds that can be used to block or
inhibit K.sub.ATP channels include, but are not limited to
tolbutamide, glyburide (1[[(p-2[5-chloro-O-anisamido)ethyl] phenyl]
sulfonyl]-3-cyclohexyl-3-urea); chlopropamide
(1-[[(p-chlorophenyl)sulfonyl]-3-propylurea; glipizide
(1-cyclohexyl-3 [[p-[2(5-methylpyrazine carboxamido)ethyl] phenyl]
sulfonyl] urea); or
tolazamide(benzenesulfonamide-N-[[(hexahydro-1H-azepin-1yl)amino]
carbonyl]-4-methyl). In additional embodiments, non-sulfonyl urea
compounds, such as 2, 3-butanedione and 5-hydroxydecanoic acid,
quinine, and therapeutically equivalent salts and derivatives
thereof, may be employed in the invention.
[0174] The channel is expressed on cells, including, for example,
vascular endothelial cells and germinal matrix tissue. In specific
embodiments, the inhibitor of the channel blocks the influx of Na+
into the cells thereby preventing depolarization or other
deleterious effects caused by the altered ionic concentration of
the cells. Inhibition of the influx of Na+ into the cells, thereby
at least prevents or reduces cytotoxic edema and/or ionic edema.
Thus, this treatment reduces cell death, including, for example,
necrotic cell death. In specific embodiments, the invention reduces
cell death of endothelial cells.
[0175] The compound can be administered alimentarily (e.g., orally,
buccally, rectally or sublingually); parenterally (e.g.,
intravenously, intradermally, intramuscularly, intraarterially,
intrathecally, subcutaneously, intraperitoneally,
intraventricularly); by intracavity; intravesically;
intrapleurally; and/or topically (e.g., transdermally), mucosally,
or by direct injection into the brain parenchyma.
[0176] Another embodiment of the present invention comprises a
method of treating a subject at risk for developing edema
comprising administering to the subject a therapeutic composition
effective to inhibit a NC.sub.Ca-ATP channel in at least an
endothelial cell, germinal matrix tissue, or combination thereof.
In specific embodiments, the composition is effective to inhibit a
NC.sub.Ca-ATP channel in an endothelial cell.
[0177] In further embodiments, the compound that inhibits the
NC.sub.Ca-ATP channel can be administered in combination with one
or more statins, diuretics, vasodilators (e.g., nitroglycerin),
mannitol, diazoxide or similar compounds that stimulate or promote
ischemic preconditioning.
[0178] Yet further, another embodiment of the present invention
comprises a pharmaceutical composition comprising or more statins,
diuretics, vasodilators, mannitol, diazoxide or similar compounds
that stimulate or promote ischemic preconditioning or a
pharmaceutically acceptable salt thereof and a compound that
inhibits a NC.sub.Ca-ATP channel or a pharmaceutically acceptable
salt thereof. This pharmaceutical composition can be considered
neuroprotective, in specific embodiments. For example, the
pharmaceutical composition comprising a combination of the second
agent and a compound that inhibits a NC.sub.Ca-ATP channel is
therapeutic or protective because it increases the therapeutic
window for the administration of the second agent by several hours;
for example the therapeutic window for administration of second
agents may be increased by several hours (e.g. about 4 to about 8
hrs) by co-administering antagonist of the NC.sub.Ca-ATP
channel.
[0179] An effective amount of a therapeutic composition of the
invention, including an antagonist of NC.sub.Ca-ATP channel and/or
the additional therapeutic compound, that may be administered to a
cell includes a dose of about 0.0001 nM to about 2000 .mu.M, for
example. More specifically, doses to be administered are from about
0.01 nM to about 2000 .mu.M; about 0.01 .mu.M to about 0.05 .mu.M;
about 0.05 .mu.M to about 1.0 .mu.M; about 1.0 .mu.M to about 1.5
.mu.M; about 1.5 .mu.M to about 2.0 .mu.M; about 2.0 .mu.M to about
3.0 .mu.M; about 3.0 .mu.M to about 4.0 .mu.M; about 4.0 .mu.M to
about 5.0 .mu.M; about 5.0 .mu.M to about 10 .mu.M; about 10 .mu.M
to about 50 .mu.M about 50 .mu.M to about 100 .mu.M; about 100
.mu.M to about 200 .mu.M; about 200 .mu.M to about 300 about 300 to
about 500 .mu.M; about 500 to about 1000 .mu.M; about 1000 .mu.M to
about 1500 .mu.M and about 1500 .mu.M to about 2000 .mu.M, for
example. Of course, all of these amounts are exemplary, and any
amount in-between these points is also expected to be of use in the
invention.
[0180] An effective amount of an antagonist of the NC.sub.Ca-ATP
channel or related-compounds thereof as a treatment varies
depending upon the host treated and the particular mode of
administration. In one embodiment of the invention, the dose range
of the therapeutic combinatorial composition of the invention,
including an antagonist of NC.sub.Ca-ATP channel and/or the
additional therapeutic compound, will be about 0.01 .mu.g/kg body
weight to about 20,000 g/kg body weight. The term "body weight" is
applicable when an animal is being treated. When isolated cells are
being treated, "body weight" as used herein should read to mean
"total cell body weight". The term "total body weight" may be used
to apply to both isolated cell and animal treatment. All
concentrations and treatment levels are expressed as "body weight"
or simply "kg" in this application are also considered to cover the
analogous "total cell body weight" and "total body weight"
concentrations. However, those of skill will recognize the utility
of a variety of dosage range, for example, 0.01 .mu.g/kg body
weight to 20,000 .mu.g/kg body weight, 0.02 .mu.g/kg body weight to
15,000 .mu.g/kg body weight, 0.03 .mu.g/kg body weight to 10,000
.mu.g/kg body weight, 0.04 .mu.g/kg body weight to 5,000 .mu.g/kg
body weight, 0.05 .mu.g/kg body weight to 2,500 .mu.g/kg body
weight, 0.06 .mu.g/kg body weight to 1,000 .mu.g/kg body weight,
0.07 .mu.g/kg body weight to 500 .mu.g/kg body weight, 0.08
.mu.g/kg body weight to 400 .mu.g/kg body weight, 0.09 .mu.g/kg
body weight to 200 .mu.g/kg body weight or 0.1 .mu.g/kg body weight
to 100 .mu.g/kg body weight. Further, those of skill will recognize
that a variety of different dosage levels will be of use, for
example, 0.0001 .mu.g/kg, 0.0002 .mu.g/kg, 0.0003 .mu.g/kg, 0.0004
.mu.g/kg, 0.005 .mu.g/kg, 0.0007 .mu.g/kg, 0.001 .mu.g/kg, 0.1
.mu.g/kg, 1.0 .mu.g/kg, 1.5 .mu.g/kg, 2.0 .mu.g/kg, 5.0 .mu.g/kg,
10.0 .mu.g/kg, 15.0 .mu.g/kg, 30.0 .mu.g/kg, 50 .mu.g/kg, 75
.mu.g/kg, 80 .mu.g/kg, 90 .mu.g/kg, 100 .mu.g/kg, 120 .mu.g/kg, 140
.mu.g/kg, 150 .mu.g/kg, 160 .mu.g/kg, 180 .mu.g/kg, 200 .mu.g/kg,
225 .mu.g/kg, 250 .mu.g/kg, 275 .mu.g/kg, 300 .mu.g/kg, 325
.mu.g/kg, 350 .mu.g/kg, 375 .mu.g/kg, 400 .mu.g/kg, 450 .mu.g/kg,
500 .mu.g/kg, 550 .mu.g/kg, 600 .mu.g/kg, 700 .mu.g/kg, 750
.mu.g/kg, 800 g/kg, 900 g/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 12 mg/kg,
15 mg/kg, 20 mg/kg, and/or 30 mg/kg.
[0181] In certain embodiments, there may be dosing of from very low
ranges (e.g. 1 mg/kg/day or less; 5 mg/kg bolus; or 1 mg/kg/day) to
moderate doses (e.g. 2 mg bolus, 15 mg/day) to high doses (e.g. 5
mg bolus, 30-40 mg/day; and even higher). Of course, all of these
dosages are exemplary, and any dosage in-between these points is
also expected to be of use in the invention. Any of the above
dosage ranges or dosage levels may be employed for an agonist or
antagonist, or both, of NC.sub.Ca-ATP channel or related-compounds
thereof.
[0182] In certain embodiments, the amount of the combinatorial
therapeutic composition administered to the subject is in the range
of about 0.0001 .mu.g/kg/day to about 20 mg/kg/day, about 0.01
.mu.g/kg/day to about 100 .mu.g/kg/day, or about 100 .mu.g/kg/day
to about 20 mg/kg/day. Still further, the combinatorial therapeutic
composition may be administered to the subject in the form of a
treatment in which the treatment may comprise the amount of the
combinatorial therapeutic composition or the dose of the
combinatorial therapeutic composition that is administered per day
(1, 2, 3, 4, etc.), week (1, 2, 3, 4, 5, etc.), month (1, 2, 3, 4,
5, etc.), etc. Treatments may be administered such that the amount
of combinatorial therapeutic composition administered to the
subject is in the range of about 0.0001 .mu.g/kg/treatment to about
20 mg/kg/treatment, about 0.01 .mu.g/kg/treatment to about 100
.mu.g/kg/treatment, or about 100 .mu.g/kg/treatment to about 20
mg/kg/treatment.
[0183] In another embodiment of the invention, there is a kit,
housed in a suitable container, that comprises an inhibitor of
NC.sub.Ca-ATP channel. In another embodiment of the invention, the
kit comprises an inhibitor of NC.sub.Ca-ATP channel and, for
example, one or more of a cation channel blocker and/or an
antagonist of VEGF, MMP, NOS, or thrombin. The kit may also
comprise suitable tools to administer compositions of the invention
to an individual.
[0184] The NC.sub.Ca-ATP channel of the present invention is
distinguished by certain functional characteristics, the
combination of which distinguishes it from known ion channels. The
characteristics that distinguish the NC.sub.Ca-ATP channel of the
present invention include, but are not necessarily limited to, the
following: 1) it is a non-selective cation channel that readily
allows passage of Na, K and other monovalent cations; 2) it is
activated by an increase in intracellular calcium, and/or by a
decrease in intracellular ATP; 3) it is regulated by sulfonylurea
receptor type 1 (SUR1), which heretofore had been considered to be
associated exclusively with K.sub.ATP channels such as those found
in pancreatic cells, for example.
[0185] More specifically, the NC.sub.Ca-ATP channel of the present
invention has a single-channel conductance to potassium ion
(K.sup.+) between 20 and 50 pS. The NC.sub.Ca-ATP channel is also
stimulated by Ca.sup.2+ on the cytoplasmic side of the cell
membrane in a physiological concentration range, where said
concentration range is from 10.sup.-8 to 10.sup.-5 M. The
NC.sub.Ca-ATP channel is also inhibited by cytoplasmic ATP in a
physiological concentration range, where said concentration range
is from about 10.sup.-1 mM to about 5 mM. The NC.sub.Ca-ATP channel
is also permeable to the following cations; K.sup.+, Cs.sup.+,
Li.sup.+, Na.sup.+; to the extent that the permeability ratio
between any two of said cations is greater than 0.5 and less than
2.
IV. Exemplary Therapeutic and Preventative Embodiments
[0186] Treatment methods may involve treating an individual with an
effective amount of a composition comprising an antagonist of
NC.sub.Ca-ATP channel or related-compound thereof. An effective
amount is described, generally, as that amount sufficient to
detectably and repeatedly ameliorate, reduce, minimize, limit the
extent of a medical condition or its symptoms or, to prevent a
disease or its medical condition. More specifically, it is
envisioned that the treatment and/or prevention with an antagonist
of NC.sub.Ca-ATP channel or related-compounds thereof will inhibit
cell depolarization, inhibit Na.sup.+ influx, inhibit an osmotic
gradient change, inhibit water influx into the cell, inhibit
cytotoxic cell edema, decrease stroke size, inhibit hemorrhagic
conversion, and/or decrease mortality of the subject, in specific
embodiments
[0187] The effective amount of an antagonist of NC.sub.Ca-ATP
channel or related-compounds thereof to be used are those amounts
effective to produce beneficial results, for example, with respect
to spinal cord injury or progressive hemorrhagic necrosis treatment
or prevention, in the recipient animal or patient. Such amounts may
be initially determined by reviewing the published literature, by
conducting in vitro tests and/or by conducting metabolic studies in
healthy experimental animals, for example, as is routine in the
art. Before use in a clinical setting, it may be beneficial to
conduct confirmatory studies in an animal model, preferably a
widely accepted animal model of the particular disease to be
treated. Preferred animal models for use in certain embodiments are
rodent models, which are preferred because they are economical to
use and, particularly, because the results gained are widely
accepted as predictive of clinical value.
[0188] As is well known in the art, a specific dose level of active
compounds such as an antagonist of the NC.sub.Ca-ATP channel or
related-compounds thereof for any particular patient depends upon a
variety of factors including the activity of the specific compound
employed, the age, body weight, general health, sex, diet, time of
administration, route of administration, rate of excretion, drug
combination, and the severity of the particular disease undergoing
therapy. The person responsible for administration will determine
the appropriate dose for the individual subject. Moreover, for
human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by
FDA Office of Biologics standards.
[0189] One of skill in the art realizes that the effective amount
of the antagonist or related-compound thereof can be the amount
that is required to achieve the desired result: reduction in the
risk of spinal cord injury or progressive hemorrhagic necrosis,
reduction in the amount of damage following spinal cord injury or
progressive hemorrhagic necrosis, reduction in cell death, and so
forth In specific embodiments, this amount also is an amount that
maintains a reasonable level of blood glucose in the patient, for
example, the amount of the antagonist maintains a blood glucose
level of at least 60 mmol/l, more preferably, the blood glucose
level is maintained in the range of about 60 mmol/l to about 150
mmol/l. Thus, the amounts prevents the subject from becoming
hypoglycemic. If glucose levels are not normal, then one of skill
in the art would administer either insulin or glucose, depending
upon if the patient is hypoglycemic or hyperglycemic.
[0190] Administration of the therapeutic antagonist of
NC.sub.Ca-ATP channel composition of the present invention to a
patient or subject will follow general protocols for the
administration of therapies used in spinal cord injury or
progressive hemorrhagic necrosis treatment, taking into account the
toxicity, if any, of the antagonist of the NC.sub.Ca-ATP channel.
It is expected that the treatment cycles would be repeated as
necessary. It also is contemplated that various standard therapies,
as well as surgical intervention, may be applied in combination
with the described therapy.
[0191] Another aspect of the present invention for the treatment of
IVH or spinal cord injury or progressive hemorrhagic conversion
comprises administration of an effective amount of a SUR1
antagonist and/or a TRPM4 antagonist and administration of glucose.
Glucose administration may precede the time of treatment with an
antagonist of the NC.sub.Ca-ATP channel, may be at the time of
treatment with an antagonist of the NC.sub.Ca-ATP channel, such as
a SUR1 and/or TRPM4 antagonist, or may follow treatment with an
antagonist of the NC.sub.Ca-ATP channel (e.g., at 15 minutes after
treatment with an antagonist of the NC.sub.Ca-ATP channel, or at
one half hour after treatment with an antagonist of the
NC.sub.Ca-ATP channel, or at one hour after treatment with an
antagonist of the NC.sub.Ca-ATP channel, or at two hours after
treatment with an antagonist of the NC.sub.Ca-ATP channel, or at
three hours after treatment with an antagonist of the N.sub.Ca-ATP
channel, for example). Glucose administration may be by
intravenous, or intraperitoneal, or other suitable route and means
of delivery. Additional glucose allows administration of higher
doses of an antagonist of the NC.sub.Ca-ATP channel than might
otherwise be possible, so that combined glucose with an antagonist
of the NC.sub.Ca-ATP channel provides greater protection, and may
allow treatment at later times, than with an antagonist of the
NC.sub.Ca-ATP channel alone. Greater amounts of glucose are
administered where larger doses of an antagonist of the
NC.sub.Ca-ATP channel are administered.
[0192] Yet further, the compositions of the present invention can
be used to produce neuroprotective kits that are used to treat
subjects at risk or suffering from conditions that are associated
with spinal cord injury, including progressive hemorrhagic
necrosis, for example.
V. Combinatorial Therapeutic Compositions
[0193] In certain embodiments of the present invention includes a
combinatorial therapeutic composition comprising an antagonist of
the NC.sub.Ca-ATP channel and another therapeutic compound, such as
a cation channel blocker and/or an antagonist of a specific
molecule, such as VEGF, MMP, NOS, thrombin, and so forth.
[0194] A. Inhibitors of NC.sub.Ca-ATP Channel
[0195] According to a specific embodiment of the present invention,
the administration of effective amounts of the active compound can
block the channel, which if it remained open would lead cell
swelling and cell death. A variety of antagonists to SUR1 are
suitable for blocking the channel. Examples of suitable SUR1
antagonists include, but are not limited to glibenclamide,
tolbutamide, repaglinide, nateglinide, meglitinide, midaglizole,
LY397364, LY3 89382, gliclazide, glimepiride, MgADP, and
combinations thereof. In a preferred embodiment of the invention
the SUR1 antagonists is selected from the group consisting of
glibenclamide and tolbutamide. A variety of TRPM4 antagonists are
suitable for blocking the channel. Examples of suitable TRPM4
antagonists include, but are not limited to, pinkolant, rimonabant,
a fenamate (such as flufenamic acid, mefenamic acid, meclofenamic
acid, or niflumic acid),
1-(beta-[3-(4-methoxy-phenyl)propoxy]-4-methoxyphenethyl)-1H-imidazole
hydrochloride, and a biologically active derivative thereof. Still
other therapeutic "strategies" for preventing cell swelling and
cell death can be adopted including, but not limited to methods
that maintain the cell in a polarized state and methods that
prevent strong depolarization.
[0196] The present invention comprises modulators of the channel,
for example one or more agonists and/or one or more antagonists of
the channel. Examples of antagonists or agonists of the present
invention may encompass respective antagonists and/or agonists
identified in US Application Publication No. 20030215889, which is
incorporated herein by reference in its entirety. One of skill in
the art is aware that the NC.sub.Ca-ATP channel is comprised of at
least two subunits: the regulatory subunit, SUR1, and the pore
forming subunit.
[0197] 1. Exemplary SUR1 Inhibitors
[0198] In certain embodiments, antagonists to sulfonylurea
receptor-1 (SUR1) are suitable for blocking the channel. Examples
of suitable SUR1 antagonists include, but are not limited to
glibenclamide, tolbutamide, repaglinide, nateglinide, meglitinide,
midaglizole, LY397364, LY389382, glyclazide, glimepiride, estrogen,
estrogen related-compounds estrogen related-compounds (estradiol,
estrone, estriol, genistein, non-steroidal estrogen (e.g.,
diethystilbestrol), phytoestrogen (e.g., coumestrol), zearalenone,
etc.) and combinations thereof. In a preferred embodiment of the
invention the SUR1 antagonists is selected from the group
consisting of glibenclamide and tolbutamide. Yet further, another
antagonist can be MgADP. Other antagonist include blockers of KATP
channels, for example, but not limited to tolbutamide,
glibenclamide (1[p-2[5-chloro-O-anisamido)ethyl] phenyl]
sulfonyl]-3-cyclohexyl-3-urea); chlopropamide
(1-[[(p-chlorophenyl)sulfonyl]-3-propylurea; glipizide
(1-cyclohexyl-3[[p-[2(5-methylpyrazine carboxamido) ethyl] phenyl]
sulfonyl] urea); or
tolazamide(benzenesulfonamide-N-[[(hexahydro-1H-azepin-1 yl)amino]
carbonyl]-4-methyl).
[0199] 2. Modulators of SUR1 Transcription and/or Translation
[0200] In certain embodiments, the modulator can comprise a
compound (protein, nucleic acid, siRNA, etc.) that modulates
transcription and/or translation of SUR1 (regulatory subunit)
and/or the molecular entities that comprise the pore-forming
subunit.
[0201] 3. Transcription Factors
[0202] Transcription factors are regulatory proteins that binds to
a specific DNA sequence (e.g., promoters and enhancers) and
regulate transcription of an encoding DNA region. Thus,
transcription factors can be used to modulate the expression of
SUR1. Typically, a transcription factor comprises a binding domain
that binds to DNA (a DNA-binding domain) and a regulatory domain
that controls transcription. Where a regulatory domain activates
transcription, that regulatory domain is designated an activation
domain. Where that regulatory domain inhibits transcription, that
regulatory domain is designated a repression domain. More
specifically, transcription factors such as Sp1, HIF1, and NFB can
be used to modulate expression of SUR1.
[0203] In particular embodiments of the invention, a transcription
factor may be targeted by a composition of the invention. The
transcription factor may be one that is associated with a pathway
in which SUR1 is involved. The transcription factor may be targeted
with an antagonist of the invention, including siRNA to
downregulate the transcription factor. Such antagonists can be
identified by standard methods in the art, and in particular
embodiments the antagonist is employed for treatment and or
prevention of an individual in need thereof. In an additional
embodiment, the antagonist is employed in conjunction with an
additional compound, such as a composition that modulates the
NC.sub.Ca-ATP channel of the invention. For example, the antagonist
may be used in combination with an inhibitor of the channel of the
invention. When employed in combination, the antagonist of a
transcription factor of a SUR1-related pathway may be administered
prior to, during, and/or subsequent to the additional compound.
[0204] 4. Antisense and Ribozymes
[0205] An antisense molecule that binds to a translational or
transcriptional start site, or splice junctions, are ideal
inhibitors. Antisense, ribozyme, and double-stranded RNA molecules
target a particular sequence to achieve a reduction or elimination
of a particular polypeptide, such as SUR1. Thus, it is contemplated
that antisense, ribozyme, and double-stranded RNA, and RNA
interference molecules are constructed and used to modulate SUR1
expression.
[0206] 5. Antisense Molecules
[0207] Antisense methodology takes advantage of the fact that
nucleic acids tend to pair with complementary sequences. By
complementary, it is meant that polynucleotides are those which are
capable of base-pairing according to the standard Watson-Crick
complementarity rules. That is, the larger purines will base pair
with the smaller pyrimidines to form combinations of guanine paired
with cytosine (G:C) and adenine paired with either thymine (A:T) in
the case of DNA, or adenine paired with uracil (A:U) in the case of
RNA. Inclusion of less common bases such as inosine,
5-methylcytosine, 6-methyladenine, hypoxanthine and others in
hybridizing sequences does not interfere with pairing.
[0208] Targeting double-stranded (ds) DNA with polynucleotides
leads to triple-helix formation; targeting RNA will lead to
double-helix formation. Antisense polynucleotides, when introduced
into a target cell, specifically bind to their target
polynucleotide and interfere with transcription, RNA processing,
transport, translation and/or stability. Antisense RNA constructs,
or DNA encoding such antisense RNAs, are employed to inhibit gene
transcription or translation or both within a host cell, either in
vitro or in vivo, such as within a host animal, including a human
subject.
[0209] constructs are designed to bind to the promoter and other
control regions, exons, introns or even exon-intron boundaries of a
gene. It is contemplated that the most effective antisense
constructs may include regions complementary to intron/exon splice
junctions. Thus, antisense constructs with complementarity to
regions within 50-200 bases of an intron-exon splice junction are
used. It has been observed that some exon sequences can be included
in the construct without seriously affecting the target selectivity
thereof. The amount of exonic material included will vary depending
on the particular exon and intron sequences used. One can readily
test whether too much exon DNA is included simply by testing the
constructs in vitro to determine whether normal cellular function
is affected or whether the expression of related genes having
complementary sequences is affected.
[0210] It is advantageous to combine portions of genomic DNA with
cDNA or synthetic sequences to generate specific constructs. For
example, where an intron is desired in the ultimate construct, a
genomic clone will need to be used. The cDNA or a synthesized
polynucleotide may provide more convenient restriction sites for
the remaining portion of the construct and, therefore, would be
used for the rest of the sequence.
[0211] 6. RNA Interference
[0212] It is also contemplated in the present invention that
double-stranded RNA is used as an interference molecule, e.g., RNA
interference (RNAi). RNA interference is used to "knock down" or
inhibit a particular gene of interest by simply injecting, bathing
or feeding to the organism of interest the double-stranded RNA
molecule. This technique selectively "knock downs" gene function
without requiring transfection or recombinant techniques (Giet,
2001; Hammond, 2001; Stein P, et al., 2002; Svoboda P, et al.,
2001; Svoboda P, et al., 2000).
[0213] Another type of RNAi is often referred to as small
interfering RNA (siRNA), which may also be utilized to inhibit
SUR1. A siRNA may comprises a double stranded structure or a single
stranded structure, the sequence of which is "substantially
identical" to at least a portion of the target gene (See WO
04/046320, which is incorporated herein by reference in its
entirety). "Identity," as known in the art, is the relationship
between two or more polynucleotide (or polypeptide) sequences, as
determined by comparing the sequences. In the art, identity also
means the degree of sequence relatedness between polynucleotide
sequences, as determined by the match of the order of nucleotides
between such sequences. Identity can be readily calculated. See,
for example: Computational Molecular Biology, Lesk, A. M., ed.
Oxford University Press, New York, 1988; Biocomputing: Informatics
and Genome Projects, Smith, D. W., ea., Academic Press, New York,
1993, and the methods disclosed in WO 99/32619, WO 01/68836, WO
00/44914, and WO 01/36646, specifically incorporated herein by
reference. While a number of methods exist for measuring identity
between two nucleotide sequences, the term is well known in the
art. Methods for determining identity are typically designed to
produce the greatest degree of matching of nucleotide sequence and
are also typically embodied in computer programs. Such programs are
readily available to those in the relevant art. For example, the
GCG program package (Devereux et al.), BLASTP, BLASTN, and FASTA
(Atschul et al.,) and CLUSTAL (Higgins et al., 1992; Thompson, et
al., 1994).
[0214] Thus, siRNA contains a nucleotide sequence that is
essentially identical to at least a portion of the target gene, for
example, SUR1, or any other molecular entity associated with the
NC.sub.Ca-ATP channel such as the pore-forming subunit. One of
skill in the art is aware that the nucleic acid sequences for SUR1
are readily available in GenBank, for example, GenBank accession
L40624, which is incorporated herein by reference in its entirety.
Preferably, the siRNA contains a nucleotide sequence that is
completely identical to at least a portion of the target gene. Of
course, when comparing an RNA sequence to a DNA sequence, an
"identical" RNA sequence will contain ribonucleotides where the DNA
sequence contains deoxyribonucleotides, and further that the RNA
sequence will typically contain a uracil at positions where the DNA
sequence contains thymidine.
[0215] One of skill in the art will appreciate that two
polynucleotides of different lengths may be compared over the
entire length of the longer fragment. Alternatively, small regions
may be compared. Normally sequences of the same length are compared
for a final estimation of their utility in the practice of the
present invention. It is preferred that there be 100% sequence
identity between the dsRNA for use as siRNA and at least 15
contiguous nucleotides of the target gene (e.g., SUR1), although a
dsRNA having 70%, 75%, 80%, 85%, 90%, or 95% or greater may also be
used in the present invention. A siRNA that is essentially
identical to a least a portion of the target gene may also be a
dsRNA wherein one of the two complementary strands (or, in the case
of a self-complementary RNA, one of the two self-complementary
portions) is either identical to the sequence of that portion or
the target gene or contains one or more insertions, deletions or
single point mutations relative to the nucleotide sequence of that
portion of the target gene. siRNA technology thus has the property
of being able to tolerate sequence variations that might be
expected to result from genetic mutation, strain polymorphism, or
evolutionary divergence.
[0216] There are several methods for preparing siRNA, such as
chemical synthesis, in vitro transcription, siRNA expression
vectors, and PCR expression cassettes. Irrespective of which method
one uses, the first step in designing an siRNA molecule is to
choose the siRNA target site, which can be any site in the target
gene. In certain embodiments, one of skill in the art may manually
select the target selecting region of the gene, which may be an ORF
(open reading frame) as the target selecting region and may
preferably be 50-100 nucleotides downstream of the "ATG" start
codon. However, there are several readily available programs
available to assist with the design of siRNA molecules, for example
siRNA Target Designer by Promega, siRNA Target Finder by GenScript
Corp., siRNA Retriever Program by Imgenex Corp., EMBOSS siRNA
algorithm, siRNA program by Qiagen, Ambion siRNA predictor, Ambion
siRNA predictor, Whitehead siRNA prediction, and Sfold. Thus, it is
envisioned that any of the above programs may be utilized to
produce siRNA molecules that can be used in the present
invention.
[0217] 7. Ribozymes
[0218] Ribozymes are RNA-protein complexes that cleave nucleic
acids in a site-specific fashion. Ribozymes have specific catalytic
domains that possess endonuclease activity (Kim and Cech, 1987;
Forster and Symons, 1987). For example, a large number of ribozymes
accelerate phosphoester transfer reactions with a high degree of
specificity, often cleaving only one of several phosphoesters in an
oligonucleotide substrate (Cech et al., 1981; Reinhold-Hurek and
Shub, 1992). This specificity has been attributed to the
requirement that the substrate bind via specific base-pairing
interactions to the internal guide sequence ("IGS") of the ribozyme
prior to chemical reaction.
[0219] Ribozyme catalysis has primarily been observed as part of
sequence specific cleavage/ligation reactions involving nucleic
acids (Joyce, 1989; Cech et al., 1981). For example, U.S. Pat. No.
5,354,855 reports that certain ribozymes can act as endonucleases
with a sequence specificity greater than that of known
ribonucleases and approaching that of the DNA restriction enzymes.
Thus, sequence-specific ribozyme-mediated inhibition of gene
expression is particularly suited to therapeutic applications
(Scanlon et al., 1991; Sarver et al., 1990; Sioud et al., 1992).
Most of this work involved the modification of a target mRNA, based
on a specific mutant codon that is cleaved by a specific ribozyme.
In light of the information included herein and the knowledge of
one of ordinary skill in the art, the preparation and use of
additional ribozymes that are specifically targeted to a given gene
will now be straightforward.
[0220] Other suitable ribozymes include sequences from RNase P with
RNA cleavage activity (Yuan et al., 1992; Yuan and Altman, 1994),
hairpin ribozyme structures (Berzal-Herranz et al., 1992; Chowrira
et al., 1993) and hepatitis d virus based ribozymes (Perrotta and
Been, 1992). The general design and optimization of ribozyme
directed RNA cleavage activity has been discussed in detail
(Haseloff and Gerlach, 1988; Symons, 1992; Chowrira, et al., 1994;
and Thompson, et al., 1995).
[0221] The other variable on ribozyme design is the selection of a
cleavage site on a given target RNA. Ribozymes are targeted to a
given sequence by virtue of annealing to a site by complimentary
base pair interactions. Two stretches of homology are required for
this targeting. These stretches of homologous sequences flank the
catalytic ribozyme structure defined above. Each stretch of
homologous sequence can vary in length from 7 to 15 nucleotides.
The only requirement for defining the homologous sequences is that,
on the target RNA, they are separated by a specific sequence which
is the cleavage site. For hammerhead ribozymes, the cleavage site
is a dinucleotide sequence on the target RNA, uracil (U) followed
by either an adenine, cytosine or uracil (A,C or U; Perriman, et
al., 1992; Thompson, et al., 1995). The frequency of this
dinucleotide occurring in any given RNA is statistically 3 out of
16.
[0222] Designing and testing ribozymes for efficient cleavage of a
target RNA is a process well known to those skilled in the art.
Examples of scientific methods for designing and testing ribozymes
are described by Chowrira et al. (1994) and Lieber and Strauss
(1995), each incorporated by reference. The identification of
operative and preferred sequences for use in SUR1 targeted
ribozymes is simply a matter of preparing and testing a given
sequence, and is a routinely practiced screening method known to
those of skill in the art.
[0223] 8. Inhibition of Post-Translational Assembly and
Trafficking
[0224] Following expression of individual regulatory and
pore-forming subunit proteins of the channel, and in particular
aspects of the invention, these proteins are modified by
glycosylation in the Golgi apparatus of the cell, assembled into
functional heteromultimers that comprise the channel, and then
transported to the plasmalemmal membrane where they are inserted to
form functional channels. The last of these processes is referred
to as "trafficking".
[0225] In specific embodiments of the invention, molecules that
bind to any of the constituent proteins interfere with
post-translational assembly and trafficking, and thereby interfere
with expression of functional channels. One such example is with
glibenclamide binding to SUR1 subunits. In additional embodiments,
glibenclamide, which binds with femtomolar affinity to SUR1,
interferes with post-translational assembly and trafficking
required for functional channel expression.
[0226] B. Cation Channel Blockers
[0227] In some embodiments of the present invention, the
combinatorial therapeutic composition comprises one or more cation
channel blockers (including, for example, TRPM4 blockers, Ca.sup.2+
channel blocker, K.sup.+ channel blocker, Na.sup.+ channel blocker,
and non-specific cation channel blocker). Exemplary TRPM4 blockers
include pinokalant (LOE 908 MS); rimonabant (SR141716A); fenamates
(flufenamic acid, mefenamic acid, niflumic acid, for example); SKF
96365
(1-(beta-[3-(4-methoxy-phenyl)propoxy]-4-methoxyphenethyl)-1H-imidazole
hydrochloride); and/or a combination or mixture thereof.
[0228] In certain embodiments a Ca2+ channel blocker includes, for
example, Amlodipine besylate, (R)-(+)-Bay K, Cilnidipine,
w-Conotoxin GVIA, w-Conotoxin MVIIC, Diltiazem hydrochloride,
Gabapentin, Isradipine, Loperamide hydrochloride, Mibefradil
dihydrochloride, Nifedipine, (R)-(-)-Niguldipine hydrochloride,
(S)-(+)-Niguldipine hydrochloride, Nimodipine, Nitrendipine, NNC
55-0396 dihydrochloride, Ruthenium Red, SKF 96365 hydrochloride, SR
33805 oxalate, Verapamil hydrochloride.
[0229] In certain embodiments a K+ channel blocker includes, for
example, Apamin, Charybdotoxin, Dequalinium dichloride,
Iberiotoxin, Paxilline, UCL 1684, Tertiapin-Q, AM 92016
hydrochloride, Chromanol 293B, (-)-[3R,4S]-Chromanol 293B, CP
339818 hydrochloride, DPO-1, E-4031 dihydrochloride, KN-93,
Linopirdine dihydrochloride, XE 991 dihydrochloride,
4-Aminopyridine, DMP 543, YS-035 hydrochloride.
[0230] In certain embodiments a Na+ channel blocker includes, for
example, Ambroxol hydrochloride, Amiloride hydrochloride,
Flecainide acetate, Flunarizine dihydrochloride, Mexiletine
hydrochloride, QX 222, QX 314 bromide, QX 314 chloride, Riluzole
hydrochloride, Tetrodotoxin, Vinpocetine.
[0231] In certain embodiments a non-specific cation channel blocker
includes, for example, Lamotrigine or Zonisamide.
[0232] In other embodiments of the present invention, the
combinatorial therapeutic composition comprises one or more
glutamate receptor blockers including, for example, D-AP5, DL-AP5,
L-AP5, D-AP7, DL-AP7, (R)-4-Carboxyphenylglycine, CGP 37849, CGP
39551, CGS 19755, (2R,3S)-Chlorpheg, Co 101244 hydrochloride,
(R)-CPP, (RS)-CPP, D-CPP-ene, LY 235959, PMPA, PPDA, PPPA, Ro
04-5595 hydrochloride, Ro 25-6981 maleate, SDZ 220-040, SDZ
220-581, (.+-.)-1-(1,2-Diphenylethyl)piperidine maleate, IEM 1460,
Loperamide hydrochloride, Memantine hydrochloride, (-)-MK 801
maleate, (+)-MK 801 maleate, N20C hydrochloride, Norketamine
hydrochloride, Remacemide hydrochloride, ACBC, CGP 78608
hydrochloride, 7-Chlorokynurenic acid, CNQX, 5,7-Dichlorokynurenic
acid, Felbamate, Gavestinel, (S)-(-)-HA-966, L-689,560, L-701,252,
L-701,324, Arcaine sulfate, Eliprodil,
N-(4-Hydroxyphenylacetyl)spermine, N-(4-Hydroxyphenylpropanoyl)
spermine trihydrochloride, Ifenprodil hemitartrate, Synthalin
sulfate, CFM-2, GYKI 52466 hydrochloride, IEM 1460, ZK 200775, NS
3763, UBP 296, UBP 301, UBP 302, CNQX, DNQX, Evans Blue tetrasodium
salt, NBQX, SYM 2206, UBP 282, and ZK 200775.
[0233] C. Antagonists of Specific Molecules
[0234] Antagonists of specific molecules may be employed, for
example, those related to endothelial dysfunction.
[0235] 1. Antagonists of VEGF
[0236] Antagonists of VEGF may be employed. The antagonists may be
synthetic or natural, and they may antagonize directly or
indirectly. VEGF TrapR1R2 (Regeneron Pharmaceuticals, Inc.);
Undersulfated, low-molecular-weight glycol-split heparin (Pisano et
al., 2005); soluble NRP-1 (sNRP-1); Avastin (Bevacizumab); HuMV833;
s-Fit-1, s-Flk-1; s-Flt-1/Flk-1; NM-3; and/or GFB 116.
[0237] 2. Antagonists of MMP
[0238] Antagonists of any MMP may be employed. The antagonists may
be synthetic or natural, and they may antagonize directly or
indirectly. Exemplary antagonists of MMPs include at least
(2R)-2-[(4-biphenylsulfonyl)amino]-3-phenylproprionic acid
(compound 5a), an organic inhibitor of MMP-2/MMP-9 (Nyormoi et al.,
2003); broad-spectrum MMP antagonist GM-6001 (Galardy et al., 1994;
Graesser et al., 1998); TIMP-1 and/or TIMP-2 (Rolli et al., 2003);
hydroxamate-based matrix metalloproteinase inhibitor (RS 132908)
(Moore et al., 1999); batimastat (Corbel et al., 2001); those
identified in United States Application 20060177448 (which is
incorporated by reference herein in its entirety); and/or
marimastat (Millar et al., 1998); peptide inhibitors that comprise
HWGF (including CTTHWGFTLC; SEQ ID NO:15) (Koivunen et al., 1999);
and combinations thereof.
[0239] 3. Antagonists of NOS
[0240] Antagonists of NOS may be employed. The antagonists may be
synthetic or natural, and they may antagonize directly or
indirectly. The antagonists may be antagonists of NOS I, NOS II,
NOS III, or may be nonselective NOS antagonists. Exemplary
antagonists include at least the following: aminoguanidine (AG);
2-amino-5,6-dihydro-6-methyl-4H-1,3 thiazine (AMT);
S-ethylisothiourea (EIT) (Rairigh et al., 1998); asymmetric
dimethylarginine (ADMA) (Vallance et al., 1992); N-nitro-L-arginine
methylester (L-NAME) (Papapetropoulos et al., 1997; Babaei et al.,
1998); nitro-L-arginine (L-NA) (Abman et al., 1990; Abman et al.,
1991; Cornfield et al., 1992; Fineman et al., 1994; McQueston et
al., 1993; Storme et al., 1999); the exemplary selective NOS II
antagonists, aminoguanidine (AG) and N-(3-aminomethyl)
benzylacetamidine dihydrochloride (1400W); NG-monomethyl-L-arginine
(L-NMMA); the exemplary selective NOS I antagonist, 7-nitroindazole
(7-NINA), and a nonselective NOS antagonist, N-nitro-L-arginine
(L-NNA), or a mixture or combination thereof.
[0241] 4. Antagonists of Thrombin
[0242] Antagonists of thrombin may be employed. The antagonists may
be synthetic or natural, and they may antagonize directly or
indirectly. Exemplary thrombin antagonists include at least the
following: ivalirudin (Kleiman et al., 2002); hirudin (Hoffman et
al., 2000); SSR182289 (Duplantier et al., 2004); antithrombin III;
thrombomodulin; Lepirudin (Refludan, a recombinant therapeutic
hirudin); P-PACK II
(d-Phenylalanyl-L-Phenylalanylarginine-chloro-methyl ketone 2 HCl);
Thromstop.RTM. (BNas-Gly-(pAM)Phe-Pip); Argatroban (Carr et al.,
2003); and mixtures or combinations thereof.
[0243] D. Others
[0244] Non-limiting examples of an additional pharmacological
therapeutic agent that may be used in the present invention include
an antihyperlipoproteinemic agent, an antiarteriosclerotic agent,
an anticholesterol agent, an antiinflammatory agent, an
antithrombotic/fibrinolytic agent, antiplatelet, vasodilator,
and/or diuretics. Anticholesterol agents include but are not
limited to HMG-CoA Reductase inhibitors, cholesterol absorption
inhibitors, bile acid sequestrants, nicotinic acid and derivatives
thereof, fibric acid and derivatives thereof. HMG-CoA Reductase
inhibitors include statins, for example, but not limited to
atorvastatin calcium (Lipitor.RTM.), cerivastatin sodium
(Baycol.RTM.), fluvastatin sodium (Lescol.RTM.), lovastatin
(Advicor.RTM.), pravastatin sodium (Pravachol.RTM.), and
simvastatin (Zocor.RTM.). Agents known to reduce the absorption of
ingested cholesterol include, for example, Zetia.RTM.. Bile acid
sequestrants include, but are not limited to cholestyramine,
cholestipol and colesevelam. Other anticholesterol agents include
fibric acids and derivatives thereof (e.g., gemfibrozil,
fenofibrate and clofibrate); nicotinic acids and derivatives
thereof (e.g., nician, lovastatin) and agents that extend the
release of nicotinic acid, for example niaspan. Antiinflammatory
agents include, but are not limited to non-steroidal
anti-inflammatory agents (e.g., naproxen, ibuprofen, celeoxib) and
steroidal anti-inflammatory agents (e.g., glucocorticoids).
Diuretics include, but are not limited to such as furosemide
(Lasix.RTM.), bumetanide (Bumex.RTM.), torsemide (Demadex.RTM.),
thiazide & thiazide-like diuretics (e.g., chlorothiazide
(Diuril.RTM.) and hydrochlorothiazide (Esidrix.RTM.), benzthiazide,
cyclothiazide, indapamide, chlorthalidone, bendroflumethizide,
metolazone), amiloride, triamterene, and spironolacton.
Vasodilators include, but are not limited to nitroglycerin.
[0245] In only certain embodiments that would not be
contraindicated for co-administration with an inhibitor of the
NC.sub.Ca-ATP channel, additional pharmacological therapeutic
agents include antithrombotic/fibrinolytic agent, anticoagulant,
antiplatelet, vasodilator, and/or diuretics. Thromoblytics that are
used can include, but are not limited to prourokinase,
streptokinase, and tissue plasminogen activator (tPA).
Anticoagulants include, but are not limited to heparin, warfarin,
and coumadin. Antiplatelets include, but are not limited to
aspirin, and aspirin related-compounds, for example acetaminophen.
Thus, in certain embodiments, the present invention comprises
co-administration of an antagonist of the NC.sub.Ca-ATP channel
with a thrombolytic agent. Co-administration of these two compounds
will increase the therapeutic window of the thrombolytic agent.
Examples of suitable thrombolytic agents that can be employed in
the methods and pharmaceutical compositions of this invention are
prourokinase, streptokinase, and tissue plasminogen activator
(tPA).
[0246] In certain embodiments, the present invention comprises
co-administration of an antagonist of the NC.sub.Ca-ATP channel
with glucose or related carbohydrate to maintain appropriate levels
of serum glucose. Appropriate levels of blood glucose are within
the range of about 60 mmol/l to about 150 mmol/liter. Thus, glucose
or a related carbohydrate is administered in combination to
maintain the serum glucose within this range.
VI. Exemplary Pharmaceutical Formulations and Methods of Use
[0247] In particular embodiments, the invention employs
pharmaceutical formulations comprising a singular or combinatorial
composition that inhibits a NC.sub.Ca-ATP channel.
[0248] A. Exemplary Compositions of the Present Invention
[0249] The present invention also contemplates therapeutic methods
employing compositions comprising the active substances disclosed
herein. Preferably, these compositions include pharmaceutical
compositions comprising a therapeutically effective amount of one
or more of the active compounds or substances along with a
pharmaceutically acceptable carrier.
[0250] As used herein, the term "pharmaceutically acceptable"
carrier means a non-toxic, inert solid, semi-solid liquid filler,
diluent, encapsulating material, formulation auxiliary of any type,
or simply a sterile aqueous medium, such as saline. Some examples
of the materials that can serve as pharmaceutically acceptable
carriers are sugars, such as lactose, glucose and sucrose, starches
such as corn starch and potato starch, cellulose and its
derivatives such as sodium carboxymethyl cellulose, ethyl cellulose
and cellulose acetate; powdered tragacanth; malt, gelatin, talc;
excipients such as cocoa butter and suppository waxes; oils such as
peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil,
corn oil and soybean oil; glycols, such as propylene glycol,
polyols such as glycerin, sorbitol, mannitol and polyethylene
glycol; esters such as ethyl oleate and ethyl laurate, agar;
buffering agents such as magnesium hydroxide and aluminum
hydroxide; alginic acid; pyrogen-free water; isotonic saline,
Ringer's solution; ethyl alcohol and phosphate buffer solutions, as
well as other non-toxic compatible substances used in
pharmaceutical formulations.
[0251] Wetting agents, emulsifiers and lubricants such as sodium
lauryl sulfate and magnesium stearate, as well as coloring agents,
releasing agents, coating agents, sweetening, flavoring and
perfuming agents, preservatives and antioxidants can also be
present in the composition, according to the judgment of the
formulator. Examples of pharmaceutically acceptable antioxidants
include, but are not limited to, water soluble antioxidants such as
ascorbic acid, cysteine hydrochloride, sodium bisulfite, sodium
metabisulfite, sodium sulfite, and the like; oil soluble
antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole
(BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate,
aloha-tocopherol and the like; and the metal chelating agents such
as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol,
tartaric acid, phosphoric acid and the like.
[0252] B. Dose Determinations
[0253] By a "therapeutically effective amount" or simply "effective
amount" of an active compound, such as glibenclamide or
tolbutamide, for example, is meant a sufficient amount of the
compound to treat or alleviate the spinal cord injury at a
reasonable benefit/risk ratio applicable to any medical treatment.
It will be understood, however, that the total daily usage of the
active compounds and compositions of the present invention will be
decided by the attending physician within the scope of sound
medical judgment. The specific therapeutically effective dose level
for any particular patient will depend upon a variety of factors
including the disorder being treated and the severity of the spinal
cord injury; activity of the specific compound employed; the
specific composition employed; the age, body weight, general
health, sex and diet of the patient; the time of administration,
route of administration, and rate of excretion of the specific
compound employed; the duration of the treatment; drugs used in
combination or coinciding with the specific compound employed; and
like factors well known in the medical arts.
[0254] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell assays or
experimental animals, e.g., for determining the LD.sub.50 (the dose
lethal to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds
that exhibit large therapeutic indices are preferred. While
compounds that exhibit toxic side effects may be used, care should
be taken to design a delivery system that targets such compounds to
the site of affected tissue in order to minimize potential damage
to uninfected cells and, thereby, reduce side effects.
[0255] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED.sub.50 with
little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any compound used in the method of the
invention, the therapeutically effective dose can be estimated
initially from cell based assays. A dose may be formulated in
animal models to achieve a circulating plasma concentration range
that includes the IC.sub.50 (i.e., the concentration of the test
compound which achieves a half-maximal inhibition of symptoms) as
determined in cell culture. Such information can be used to more
accurately determine useful doses in humans. Levels in plasma may
be measured, for example, by high performance liquid
chromatography.
[0256] The total daily dose of the active compounds of the present
invention administered to a subject in single or in divided doses
can be in amounts, for example, from 0.01 to 25 mg/kg body weight
or more usually from 0.1 to 15 mg/kg body weight. Single dose
compositions may contain such amounts or submultiples thereof to
make up the daily dose. In general, treatment regimens according to
the present invention comprise administration to a human or other
mammal in need of such treatment from about 1 mg to about 1000 mg
of the active substance(s) of this invention per day in multiple
doses or in a single dose of from 1 mg, 5 mg, 10 mg, 100 mg, 500 mg
or 1000 mg.
[0257] In certain situations, it may be important to maintain a
fairly high dose of the active agent in the blood stream of the
patient, particularly early in the treatment. Such a fairly high
dose may include a dose that is several times greater than its use
in other indications. For example, the typical anti-diabetic dose
of oral or IV glibenclamide is about 2.5 mg/kg to about 15 mg/kg
per day; the typical anti-diabetic dose of oral or IV tolbutamide
is about to 0.5 gm/kg to about 2.0 gm/kg per day; the typical
anti-diabetic dose for oral gliclazide is about 30 mg/kg to about
120 mg/kg per day; however, much larger doses may be required to
block spinal cord damage and/or PHN.
[0258] For example, in one embodiment of the present invention
directed to a method of preventing neuronal cell swelling in the
brain of a subject by administering to the subject a formulation
containing an effective amount of a compound that blocks the
NC.sub.Ca-ATP channel and a pharmaceutically acceptable carrier;
such formulations may contain from about 0.1 to about 100 grams of
tolbutamide or from about 0.5 to about 150 milligrams of
glibenclamide. In another embodiment of the present invention
directed to a method of alleviating the negative effects of
traumatic brain injury or cerebral ischemia stemming from neural
cell swelling in a subject by administering to the subject a
formulation containing an effective amount of a compound that
blocks the NC.sub.Ca-ATP channel and a pharmaceutically acceptable
carrier.
[0259] In situations of spinal cord injury and/or PHN, it may be
important to maintain a fairly high dose of the active agent to
ensure delivery to the brain of the patient, particularly early in
the treatment. Hence, at least initially, it may be important to
keep the dose relatively high and/or at a substantially constant
level for a given period of time, preferably, at least about six or
more hours, more preferably, at least about twelve or more hours
and, most preferably, at least about twenty-four or more hours. In
situations of traumatic brain injury or cerebral ischemia (such as
stroke), it may be important to maintain a fairly high dose of the
active agent to ensure delivery to the brain of the patient,
particularly early in the treatment.
[0260] C. Formulations and Administration
[0261] The compounds of the present invention may be administered
alone or in combination or in concurrent therapy with other agents
which affect the central or peripheral nervous system.
[0262] Liquid dosage forms for oral administration may include
pharmaceutically acceptable emulsions, microemulsions, solutions,
suspensions, syrups and elixirs containing inert diluents commonly
used in the art, such as water, isotonic solutions, or saline. Such
compositions may also comprise adjuvants, such as wetting agents;
emulsifying and suspending agents; sweetening, flavoring and
perfuming agents.
[0263] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions may be formulated according to
the known art using suitable dispersing or wetting agents and
suspending agents. The sterile injectable preparation may also be a
sterile injectable solution, suspension or emulsion in a nontoxic
parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that may be employed are water, Ringer's solution, U.S.P.
and isotonic sodium chloride solution. In addition, sterile, fixed
oils are conventionally employed as a solvent or suspending medium.
For this purpose any bland fixed oil can be employed including
synthetic mono- or diglycerides. In addition, fatty acids such as
oleic acid are used in the preparation of injectables.
[0264] The injectable formulation can be sterilized, for example,
by filtration through a bacteria-retaining filter, or by
incorporating sterilizing agents in the form of sterile solid
compositions, which can be dissolved or dispersed in sterile water
or other sterile injectable medium just prior to use.
[0265] In order to prolong the effect of a drug, it is often
desirable to slow the absorption of a drug from subcutaneous or
intramuscular injection. The most common way to accomplish this is
to inject a suspension of crystalline or amorphous material with
poor water solubility. The rate of absorption of the drug becomes
dependent on the rate of dissolution of the drug, which is, in
turn, dependent on the physical state of the drug, for example, the
crystal size and the crystalline form. Another approach to delaying
absorption of a drug is to administer the drug as a solution or
suspension in oil. Injectable depot forms can also be made by
forming microcapsule matrices of drugs and biodegradable polymers,
such as polylactide-polyglycoside. Depending on the ratio of drug
to polymer and the composition of the polymer, the rate of drug
release can be controlled. Examples of other biodegradable polymers
include polyorthoesters and polyanhydrides. The depot injectables
can also be made by entrapping the drug in liposomes or
microemulsions, which are compatible with body tissues.
[0266] Suppositories for rectal administration of the drug can be
prepared by mixing the drug with a suitable non-irritating
excipient, such as cocoa butter and polyethylene glycol which are
solid at ordinary temperature but liquid at the rectal temperature
and will, therefore, melt in the rectum and release the drug.
[0267] Solid dosage forms for oral administration may include
capsules, tablets, pills, powders, gelcaps and granules. In such
solid dosage forms the active compound may be admixed with at least
one inert diluent such as sucrose, lactose or starch. Such dosage
forms may also comprise, as is normal practice, additional
substances other than inert diluents, e.g., tableting lubricants
and other tableting aids such as magnesium stearate and
microcrystalline cellulose. In the case of capsules, tablets and
pills, the dosage forms may also comprise buffering agents. Tablets
and pills can additionally be prepared with enteric coatings and
other release-controlling coatings.
[0268] Solid compositions of a similar type may also be employed as
fillers in soft and hard-filled gelatin capsules using such
excipients as lactose or milk sugar as well as high molecular
weight polyethylene glycols and the like.
[0269] The active compounds can also be in micro-encapsulated form
with one or more excipients as noted above. The solid dosage forms
of tablets, capsules, pills, and granules can be prepared with
coatings and shells such as enteric coatings and other coatings
well known in the pharmaceutical formulating art. They may
optionally contain opacifying agents and can also be of a
composition that they release the active ingredient(s) only, or
preferably, in a certain part of the intestinal tract, optionally
in a delayed manner. Examples of embedding compositions which can
be used include polymeric substances and waxes.
[0270] Dosage forms for topical or transdermal administration of a
compound of this invention further include ointments, pastes,
creams, lotions, gels, powders, solutions, sprays, inhalants or
patches. Transdermal patches have the added advantage of providing
controlled delivery of active compound to the body. Such dosage
forms can be made by dissolving or dispersing the compound in the
proper medium. Absorption enhancers can also be used to increase
the flux of the compound across the skin. The rate can be
controlled by either providing a rate controlling membrane or by
dispersing the compound in a polymer matrix or gel. The ointments,
pastes, creams and gels may contain, in addition to an active
compound of this invention, excipients such as animal and vegetable
fats, oils, waxes, paraffins, starch, tragacanth, cellulose
derivatives, polyethylene glycols, silicones, bentonites, silicic
acid, talc and zinc oxide, or mixtures thereof.
[0271] The method of the present invention employs the compounds
identified herein for both in vitro and in vivo applications. For
in vivo applications, the invention compounds can be incorporated
into a pharmaceutically acceptable formulation for administration.
Those of skill in the art can readily determine suitable dosage
levels when the invention compounds are so used.
[0272] As employed herein, the phrase "suitable dosage levels"
refers to levels of compound sufficient to provide circulating
concentrations high enough to effectively block the NC.sub.Ca-ATP
channel and prevent or reduce spinal cord injury and/or PHN.
[0273] In accordance with a particular embodiment of the present
invention, compositions comprising at least one SUR1 antagonist
compound (as described above), and a pharmaceutically acceptable
carrier are contemplated.
[0274] In accordance with a particular embodiment of the present
invention, compositions comprising at least one TRPM4 antagonist
compound (as described above), and a pharmaceutically acceptable
carrier are contemplated.
[0275] In accordance with a particular embodiment of the present
invention, compositions comprising a combination of at least one
SUR1 antagonist compound and at least one TRPM4 antagonist compound
(as described above), and a pharmaceutically acceptable carrier are
contemplated.
[0276] Exemplary pharmaceutically acceptable carriers include
carriers suitable for oral, intravenous, subcutaneous,
intramuscular, intracutaneous, and the like administration.
Administration in the form of creams, lotions, tablets, dispersible
powders, granules, syrups, elixirs, sterile aqueous or non-aqueous
solutions, suspensions or emulsions, and the like, is
contemplated.
[0277] For the preparation of oral liquids, suitable carriers
include emulsions, solutions, suspensions, syrups, and the like,
optionally containing additives such as wetting agents, emulsifying
and suspending agents, sweetening, flavoring and perfuming agents,
and the like.
[0278] For the preparation of fluids for parenteral administration,
suitable carriers include sterile aqueous or non-aqueous solutions,
suspensions, or emulsions. Examples of non-aqueous solvents or
vehicles are propylene glycol, polyethylene glycol, vegetable oils,
such as olive oil and corn oil, gelatin, and injectable organic
esters such as ethyl oleate. Such dosage forms may also contain
adjuvants such as preserving, wetting, emulsifying, and dispersing
agents. They may be sterilized, for example, by filtration through
a bacteria-retaining filter, by incorporating sterilizing agents
into the compositions, by irradiating the compositions, or by
heating the compositions. They can also be manufactured in the form
of sterile water, or some other sterile injectable medium
immediately before use. The active compound is admixed under
sterile conditions with a pharmaceutically acceptable carrier and
any needed preservatives or buffers as may be required.
[0279] The treatments may include various "unit doses." Unit dose
is defined as containing a predetermined quantity of the
therapeutic composition (an antagonist of the NC.sub.Ca-ATP channel
or its related-compounds thereof) calculated to produce the desired
responses in association with its administration, e.g., the
appropriate route and treatment regimen. The quantity to be
administered, and the particular route and formulation, are within
the skill of those in the clinical arts. Also of import is the
subject to be treated, in particular, the state of the subject and
the protection desired. A unit dose need not be administered as a
single injection but may comprise continuous infusion over a set
period of time.
[0280] D. Formulations and Routes for Administration of
Compounds
[0281] Pharmaceutical compositions of the present invention
comprise an effective amount of one or more modulators of
NC.sub.Ca-ATP channel (antagonist) or related-compounds or
additional agent dissolved or dispersed in a pharmaceutically
acceptable carrier. The phrases "pharmaceutical or
pharmacologically acceptable" refers to molecular entities and
compositions that do not produce an adverse, allergic or other
untoward reaction when administered to an animal, such as, for
example, a human, as appropriate. The preparation of a
pharmaceutical composition that contains at least one modulators of
NC.sub.Ca-ATP channel (antagonist) or related-compounds or
additional active ingredient will be known to those of skill in the
art in light of the present disclosure, as exemplified by
Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing
Company, 1990, incorporated herein by reference. Moreover, for
animal (e.g., human) administration, it will be understood that
preparations should meet sterility, pyrogenicity, general safety
and purity standards as required by FDA Office of Biological
Standards.
[0282] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
surfactants, antioxidants, preservatives (e.g., antibacterial
agents, antifungal agents), isotonic agents, absorption delaying
agents, salts, preservatives, drugs, drug stabilizers, gels,
binders, excipients, disintegration agents, lubricants, sweetening
agents, flavoring agents, dyes, such like materials and
combinations thereof, as would be known to one of ordinary skill in
the art (see, for example, Remington's Pharmaceutical Sciences,
18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated
herein by reference). Except insofar as any conventional carrier is
incompatible with the active ingredient, its use in the
pharmaceutical compositions is contemplated.
[0283] The modulators of NC.sub.Ca-ATP channel (antagonist) or
related-compounds may comprise different types of carriers
depending on whether it is to be administered in solid, liquid or
aerosol form, and whether it need to be sterile for such routes of
administration as injection. The present invention can be
administered intravenously, intradermally, transdermally,
intrathecally, intraventricularly, intraarterially,
intraperitoneally, intranasally, intravaginally, intrarectally,
topically, intramuscularly, subcutaneously, mucosally, orally,
topically, locally, inhalation (e.g., aerosol inhalation),
injection, infusion, continuous infusion, localized perfusion
bathing target cells directly, via a catheter, via a lavage, in
cremes, in lipid compositions (e.g., liposomes), or by other method
or any combination of the forgoing as would be known to one of
ordinary skill in the art (see, for example, Remington's
Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990,
incorporated herein by reference).
[0284] The modulators of NC.sub.Ca-ATP channel (antagonist) or
related-compounds may be formulated into a composition in a free
base, neutral or salt form. Pharmaceutically acceptable salts,
include the acid addition salts, e.g., those formed with the free
amino groups of a proteinaceous composition, or which are formed
with inorganic acids such as for example, hydrochloric or
phosphoric acids, or such organic acids as acetic, oxalic, tartaric
or mandelic acid. Salts formed with the free carboxyl groups can
also be derived from inorganic bases such as for example, sodium,
potassium, ammonium, calcium or ferric hydroxides; or such organic
bases as isopropylamine, trimethylamine, histidine or procaine.
Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms such as formulated for parenteral
administrations such as injectable solutions, or aerosols for
delivery to the lungs, or formulated for alimentarily
administrations such as drug release capsules and the like.
[0285] Further in accordance with the present invention, the
composition of the present invention suitable for administration is
provided in a pharmaceutically acceptable carrier with or without
an inert diluent. The carrier should be assimilable and includes
liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar
as any conventional media, agent, diluent or carrier is detrimental
to the recipient or to the therapeutic effectiveness of the
composition contained therein, its use in administrable composition
for use in practicing the methods of the present invention is
appropriate. Examples of carriers or diluents include fats, oils,
water, saline solutions, lipids, liposomes, resins, binders,
fillers and the like, or combinations thereof. The composition may
also comprise various antioxidants to retard oxidation of one or
more component. Additionally, the prevention of the action of
microorganisms can be brought about by preservatives such as
various antibacterial and antifungal agents, including but not
limited to parabens (e.g., methylparabens, propylparabens),
chlorobutanol, phenol, sorbic acid, thimerosal or combinations
thereof.
[0286] In accordance with the present invention, the composition is
combined with the carrier in any convenient and practical manner,
i.e., by solution, suspension, emulsification, admixture,
encapsulation, absorption and the like. Such procedures are routine
for those skilled in the art.
[0287] In a specific embodiment of the present invention, the
composition is combined or mixed thoroughly with a semi-solid or
solid carrier. The mixing can be carried out in any convenient
manner such as grinding. Stabilizing agents can be also added in
the mixing process in order to protect the composition from loss of
therapeutic activity, i.e., denaturation in the stomach. Examples
of stabilizers for use in an the composition include buffers, amino
acids such as glycine and lysine, carbohydrates such as dextrose,
mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol,
mannitol, etc.
[0288] In further embodiments, the present invention may concern
the use of a pharmaceutical lipid vehicle compositions that include
modulators of NC.sub.Ca-ATP channel (antagonist) or
related-compounds, one or more lipids, and an aqueous solvent. As
used herein, the term "lipid" will be defined to include any of a
broad range of substances that is characteristically insoluble in
water and extractable with an organic solvent. This broad class of
compounds is well known to those of skill in the art, and as the
term "lipid" is used herein, it is not limited to any particular
structure. Examples include compounds which contain long-chain
aliphatic hydrocarbons and their derivatives. A lipid may be
naturally occurring or synthetic (i.e., designed or produced by
man). However, a lipid is usually a biological substance.
Biological lipids are well known in the art, and include for
example, neutral fats, phospholipids, phosphoglycerides, steroids,
terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides,
lipids with ether and ester-linked fatty acids and polymerizable
lipids, and combinations thereof. Of course, compounds other than
those specifically described herein that are understood by one of
skill in the art as lipids are also encompassed by the compositions
and methods of the present invention.
[0289] One of ordinary skill in the art would be familiar with the
range of techniques that can be employed for dispersing a
composition in a lipid vehicle. For example, the modulators of
NC.sub.Ca-ATP channel (antagonist) or related-compounds may be
dispersed in a solution containing a lipid, dissolved with a lipid,
emulsified with a lipid, mixed with a lipid, combined with a lipid,
covalently bonded to a lipid, contained as a suspension in a lipid,
contained or complexed with a micelle or liposome, or otherwise
associated with a lipid or lipid structure by any means known to
those of ordinary skill in the art. The dispersion may or may not
result in the formation of liposomes.
[0290] The actual dosage amount of a composition of the present
invention administered to an animal patient can be determined by
physical and physiological factors such as body weight, severity of
condition, the type of disease being treated, previous or
concurrent therapeutic and/or prophylatic interventions, idiopathy
of the patient and on the route of administration. Depending upon
the dosage and the route of administration, the number of
administrations of a preferred dosage and/or an effective amount
may vary according tot he response of the subject. The practitioner
responsible for administration will, in any event, determine the
concentration of active ingredient(s) in a composition and
appropriate dose(s) for the individual subject.
[0291] In certain embodiments, pharmaceutical compositions may
comprise, for example, at least about 0.1% of an active compound.
In other embodiments, the an active compound may comprise between
about 2% to about 75% of the weight of the unit, or between about
25% to about 60%, for example, and any range derivable therein.
Naturally, the amount of active compound(s) in each therapeutically
useful composition may be prepared is such a way that a suitable
dosage will be obtained in any given unit dose of the compound.
Factors such as solubility, bioavailability, biological half-life,
route of administration, product shelf life, as well as other
pharmacological considerations will be contemplated by one skilled
in the art of preparing such pharmaceutical formulations, and as
such, a variety of dosages and treatment regimens may be
desirable.
[0292] Pharmaceutical formulations may be administered by any
suitable route or means, including alimentarily, parenteral,
topical, mucosal or other route or means of administration.
Alimentarily routes of administration include administration oral,
buccal, rectal and sublingual routes. Parenteral routes of
administration include administration include injection into the
brain parenchyma, and intravenous, intradermal, intramuscular,
intraarterial, intrathecal, subcutaneous, intraperitoneal, and
intraventricular routes of administration. Topical routes of
administration include transdermal administration.
[0293] E. Alimentary Compositions and Formulations
[0294] In preferred embodiments of the present invention, the
modulators of NC.sub.Ca-ATP channel (antagonist) or
related-compounds are formulated to be administered via an
alimentarily route. Alimentarily routes include all possible routes
of administration in which the composition is in direct contact
with the alimentarily tract. Specifically, the pharmaceutical
compositions disclosed herein may be administered orally, buccally,
rectally, or sublingually. As such, these compositions may be
formulated with an inert diluent or with an assimilable edible
carrier, or they may be enclosed in hard- or soft-shell gelatin
capsule, or they may be compressed into tablets, or they may be
incorporated directly with the food of the diet.
[0295] In certain embodiments, the active compounds may be
incorporated with excipients and used in the form of ingestible
tablets, buccal tables, troches, capsules, elixirs, suspensions,
syrups, wafers, and the like (Mathiowitz et al., 1997; Hwang et
al., 1998; U.S. Pat. Nos. 5,641,515; 5,580,579 and 5,792, 451, each
specifically incorporated herein by reference in its entirety). The
tablets, troches, pills, capsules and the like may also contain the
following: a binder, such as, for example, gum tragacanth, acacia,
cornstarch, gelatin or combinations thereof; an excipient, such as,
for example, dicalcium phosphate, mannitol, lactose, starch,
magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate or combinations thereof; a disintegrating agent, such as,
for example, corn starch, potato starch, alginic acid or
combinations thereof; a lubricant, such as, for example, magnesium
stearate; a sweetening agent, such as, for example, sucrose,
lactose, saccharin or combinations thereof; a flavoring agent, such
as, for example peppermint, oil of wintergreen, cherry flavoring,
orange flavoring, etc. When the dosage unit form is a capsule, it
may contain, in addition to materials of the above type, a liquid
carrier. Various other materials may be present as coatings or to
otherwise modify the physical form of the dosage unit. For
instance, tablets, pills, or capsules may be coated with shellac,
sugar, or both. When the dosage form is a capsule, it may contain,
in addition to materials of the above type, carriers such as a
liquid carrier. Gelatin capsules, tablets, or pills may be
enterically coated. Enteric coatings prevent denaturation of the
composition in the stomach or upper bowel where the pH is acidic.
See, e.g., U.S. Pat. No. 5,629,001. Upon reaching the small
intestines, the basic pH therein dissolves the coating and permits
the composition to be released and absorbed by specialized cells,
e.g., epithelial enterocytes and Peyer's patch M cells. A syrup of
elixir may contain the active compound sucrose as a sweetening
agent methyl and propylparabens as preservatives, a dye and
flavoring, such as cherry or orange flavor. Of course, any material
used in preparing any dosage unit form should be pharmaceutically
pure and substantially non-toxic in the amounts employed. In
addition, the active compounds may be incorporated into
sustained-release preparation and formulations.
[0296] For oral administration the compositions of the present
invention may alternatively be incorporated with one or more
excipients in the form of a mouthwash, dentifrice, buccal tablet,
oral spray, or sublingual orally-administered formulation. For
example, a mouthwash may be prepared incorporating the active
ingredient in the required amount in an appropriate solvent, such
as a sodium borate solution (Dobell's Solution). Alternatively, the
active ingredient may be incorporated into an oral solution such as
one containing sodium borate, glycerin and potassium bicarbonate,
or dispersed in a dentifrice, or added in a
therapeutically-effective amount to a composition that may include
water, binders, abrasives, flavoring agents, foaming agents, and
humectants. Alternatively the compositions may be fashioned into a
tablet or solution form that may be placed under the tongue or
otherwise dissolved in the mouth.
[0297] Additional formulations which are suitable for other modes
of alimentarily administration include suppositories. Suppositories
are solid dosage forms of various weights and shapes, usually
medicated, for insertion into the rectum. After insertion,
suppositories soften, melt or dissolve in the cavity fluids. In
general, for suppositories, traditional carriers may include, for
example, polyalkylene glycols, triglycerides or combinations
thereof. In certain embodiments, suppositories may be formed from
mixtures containing, for example, the active ingredient in the
range of about 0.5% to about 10%, and preferably about 1% to about
2%.
[0298] F. Parenteral Compositions and Formulations
[0299] In further embodiments, modulators of NC.sub.Ca-ATP channel
(antagonist) or related-compounds may be administered via a
parenteral route. As used herein, the term "parenteral" includes
routes that bypass the alimentarily tract. Specifically, the
pharmaceutical compositions disclosed herein may be administered
for example, but not limited to intravenously, intradermally,
intramuscularly, intraarterially, intraventricularly,
intrathecally, subcutaneous, or intraperitoneally U.S. Pat. Nos.
6,7537,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and
5,399,363 (each specifically incorporated herein by reference in
its entirety).
[0300] Solutions of the active compounds as free base or
pharmacologically acceptable salts may be prepared in water
suitably mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions may also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms. The
pharmaceutical forms suitable for injectable use include sterile
aqueous solutions or dispersions and sterile powders for the
extemporaneous preparation of sterile injectable solutions or
dispersions (U.S. Pat. No. 5,466,468, specifically incorporated
herein by reference in its entirety). In all cases the form must be
sterile and must be fluid to the extent that easy injectability
exists. It must be stable under the conditions of manufacture and
storage and must be preserved against the contaminating action of
microorganisms, such as bacteria and fungi. The carrier can be a
solvent or dispersion medium containing, for example, water,
ethanol, DMSO, polyol (i.e., glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), suitable mixtures thereof,
and/or vegetable oils. Proper fluidity may be maintained, for
example, by the use of a coating, such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. The prevention of the action of
microorganisms can be brought about by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
sorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars or
sodium chloride. Prolonged absorption of the injectable
compositions can be brought about by the use in the compositions of
agents delaying absorption, for example, aluminum monostearate and
gelatin.
[0301] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered if necessary and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous, and
intraperitoneal administration. In this connection, sterile aqueous
media that can be employed will be known to those of skill in the
art in light of the present disclosure. For example, one dosage may
be dissolved in 1 ml of isotonic NaCl solution and either added to
1000 ml of hypodermoclysis fluid or injected at the proposed site
of infusion, (see for example, "Remington's Pharmaceutical
Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some
variation in dosage will necessarily occur depending on the
condition of the subject being treated. The person responsible for
administration will, in any event, determine the appropriate dose
for the individual subject. Moreover, for human administration,
preparations should meet sterility, pyrogenicity, general safety
and purity standards as required by FDA Office of Biologics
standards.
[0302] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof. A
powdered composition is combined with a liquid carrier such as,
e.g., water or a saline solution, with or without a stabilizing
agent.
[0303] G. Miscellaneous Pharmaceutical Compositions and
Formulations
[0304] In other preferred embodiments of the invention, the active
compound modulators of NC.sub.Ca-ATP channel (antagonist) or
related-compounds may be formulated for administration via various
miscellaneous routes, for example, topical (i.e., transdermal)
administration, mucosal administration (intranasal, vaginal, etc.)
and/or inhalation.
[0305] Pharmaceutical compositions for topical administration may
include the active compound formulated for a medicated application
such as an ointment, paste, cream or powder. Ointments include all
oleaginous, adsorption, emulsion and water-solubly based
compositions for topical application, while creams and lotions are
those compositions that include an emulsion base only. Topically
administered medications may contain a penetration enhancer to
facilitate adsorption of the active ingredients through the skin.
Suitable penetration enhancers include glycerin, alcohols, alkyl
methyl sulfoxides, pyrrolidones and luarocapram. Possible bases for
compositions for topical application include polyethylene glycol,
lanolin, cold cream and petrolatum as well as any other suitable
absorption, emulsion or water-soluble ointment base. Topical
preparations may also include emulsifiers, gelling agents, and
antimicrobial preservatives as necessary to preserve the active
ingredient and provide for a homogenous mixture. Transdermal
administration of the present invention may also comprise the use
of a "patch". For example, the patch may supply one or more active
substances at a predetermined rate and in a continuous manner over
a fixed period of time.
[0306] In certain embodiments, the pharmaceutical compositions may
be delivered by eye drops, intranasal sprays, inhalation, and/or
other aerosol delivery vehicles. Methods for delivering
compositions directly to the lungs via nasal aerosol sprays has
been described e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212
(each specifically incorporated herein by reference in its
entirety). Likewise, the delivery of drugs using intranasal
microparticle resins (Takenaga et al., 1998) and
lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871,
specifically incorporated herein by reference in its entirety) are
also well-known in the pharmaceutical arts. Likewise, transmucosal
drug delivery in the form of a polytetrafluoroetheylene support
matrix is described in U.S. Pat. No. 5,780,045 (specifically
incorporated herein by reference in its entirety).
[0307] The term aerosol refers to a colloidal system of finely
divided solid of liquid particles dispersed in a liquefied or
pressurized gas propellant. The typical aerosol of the present
invention for inhalation will consist of a suspension of active
ingredients in liquid propellant or a mixture of liquid propellant
and a suitable solvent. Suitable propellants include hydrocarbons
and hydrocarbon ethers. Suitable containers will vary according to
the pressure requirements of the propellant. Administration of the
aerosol will vary according to subject's age, weight and the
severity and response of the symptoms.
VII. Kits of the Invention
[0308] Any of the compositions described herein may be comprised in
a kit, and the kit may be employed for therapeutic and/or
preventative purposes, including for IVH, SCI, and/or PHN.
Antagonists of the channel (regulatory subunit or pore-forming)
that may be provided include but are not limited to sulfonylurea
compounds, benzamido derivatives, antibodies (monoclonal or
polyclonal, for example to SUR1 or TRPM4), SUR1 oligonucleotides,
SUR1 polypeptides, TRPM4 oligonucleotides, TRPM4 polypeptides,
small molecules or combinations thereof, antagonist, etc.
[0309] The components of the kits may be packaged either in aqueous
media or in lyophilized form. The container means of the kits will
generally include at least one vial, test tube, flask, bottle,
syringe or other container means, into which a component may be
placed, and preferably, suitably aliquoted. Where there are more
than one components in the kit, the kit also may generally contain
a second, third or other additional container into which additional
components may be separately placed. However, various combinations
of components may be comprised in a vial. The kits of the present
invention also will typically include a means for containing the
SUR1 inhibitor, lipid, additional agent, and any other reagent
containers in close confinement for commercial sale. Such
containers may include injection or blow molded plastic containers
into which the desired vials are retained.
[0310] When the components of the kit are provided in one and/or
more liquid solutions, the liquid solution is an aqueous solution,
with a sterile aqueous solution being particularly preferred. The
SUR1 antagonist or related-compounds thereof may also be formulated
into a syringeable composition. In which case, the container means
may itself be a syringe, pipette, and/or other such like apparatus,
from which the formulation may be applied to an infected area of
the body, injected into an animal, and/or even applied to and/or
mixed with the other components of the kit. Examples of aqueous
solutions include, but are not limited to ethanol, DMSO and/or
Ringer's solution. In certain embodiments, the concentration of
DMSO or ethanol that is used is no greater than 0.1% or (1 ml/1000
L).
[0311] However, the components of the kit may be provided as dried
powder(s). When reagents and/or components are provided as a dry
powder, the powder can be reconstituted by the addition of a
suitable solvent. It is envisioned that the solvent may also be
provided in another container means.
[0312] The container means will generally include at least one
vial, test tube, flask, bottle, syringe and/or other container
means, into which the SUR1 antagonist or related-compounds thereof
is suitably allocated. The kits may also comprise a second
container means for containing a sterile, pharmaceutically
acceptable buffer and/or other diluent.
[0313] The kits of the present invention will also typically
include a means for containing the vials in close confinement for
commercial sale, such as, e.g., injection and/or blow-molded
plastic containers into which the desired vials are retained.
[0314] Irrespective of the number and/or type of containers, the
kits of the invention may also comprise, and/or be packaged with,
an instrument for assisting with the injection/administration
and/or placement of the composition(s) of the invention within the
body of an animal. Such an instrument may be a syringe, pipette,
forceps, and/or any such medically approved delivery vehicle.
[0315] In addition to the SUR1 antagonist or related-compounds
thereof, the kits may also include a second active ingredient.
Examples of the second active ingredient include substances to
prevent hypoglycemia (e.g., glucose, D5W, glucagon, etc.), statins,
diuretics, vasodilators, etc. These second active ingredients may
be combined in the same vial as the SUR1 antagonist or
related-compounds thereof or they may be contained in a separate
vial. In a specific embodiment, a combinatorial therapeutic
composition is provided in a kit, and in some embodiments the two
or more compounds that make up the composition are housed
separately or as a mixture. Other second active ingredients may be
employed so long as they are not contra-indicated and would not
worsen bleeding, for example, such as thrombolytic agents,
anticoagulants, and/or antiplatelets, for example.
[0316] Still further, the kits of the present invention can also
include glucose-testing kits. Thus, the blood glucose of the
patient is measured using the glucose testing kit, then the SUR1
antagonist or related-compounds thereof can be administered to the
subject followed by measuring the blood glucose of the patient.
[0317] In addition to the above kits, the kits of the present
invention can be assembled such that an IV bag comprises a septum
or chamber which can be opened or broken to release the compound
into the IV bag. Another type of kit may include a bolus kit in
which the bolus kit comprises a pre-loaded syringe or similar easy
to use, rapidly administrable device. An infusion kit may comprise
the vials or ampoules and an IV solution (e.g., Ringer's solution)
for the vials or ampoules to be added prior to infusion. The
infusion kit may also comprise a bolus kit for a bolus/loading dose
to be administered to the subject prior, during or after the
infusion.
[0318] Any of the compositions described herein may be comprised in
a kit. In a specific embodiment, a combinatorial therapeutic
composition is provided in a kit, and in some embodiments the two
or more compounds that make up the composition are housed
separately or as a mixture. Antagonists of the channel that may be
provided include but are not limited to antibodies (monoclonal or
polyclonal), SUR1 oligonucleotides, SUR1 polypeptides, small
molecules or combinations thereof, antagonist, etc.
[0319] Therapeutic kits of the present invention are kits
comprising an antagonist or an related-compound thereof. Depending
upon the condition and/or disease that is being treated, the kit
may comprise an SUR1 antagonist or related-compound thereof to
block and/or inhibit the NC.sub.Ca-ATP channel. The kit may
comprise a TRPM4 antagonist or related-compound thereof to block
and/or inhibit the NC.sub.Ca-ATP channel. The kit may comprise both
a TRPM4 antagonist or related-compound thereof and a SUR1
antagonist or related compound thereof to block and/or inhibit the
NC.sub.Ca-ATP channel. Such kits will generally contain, in
suitable container means, a pharmaceutically acceptable formulation
of SUR1 antagonist, TRPM4 antagonist, or related-compound thereof.
The kit may have a single container means, and/or it may have
distinct container means for each compound. For example, the
therapeutic compound and solution may be contained within the same
container; alternatively, the therapeutic compound and solution may
each be contained within different containers. A kit may include a
container with the therapeutic compound that is contained within a
container of solution.
[0320] When the components of the kit are provided in one and/or
more liquid solutions, the liquid solution is an aqueous solution,
with a sterile aqueous solution being particularly preferred. The
SUR1 antagonist or related-compounds thereof may also be formulated
into a syringeable composition. In which case, the container means
may itself be a syringe, pipette, and/or other such like apparatus,
from which the formulation may be applied to an infected area of
the body, injected into an animal, and/or even applied to and/or
mixed with the other components of the kit.
[0321] Examples of aqueous solutions include, but are not limited
to ethanol, DMSO and/or Ringer's solution. In certain embodiments,
the concentration of DMSO or ethanol that is used is no greater
than 0.1% or (1 ml/1000 L). However, the components of the kit may
be provided as dried powder(s). When reagents and/or components are
provided as a dry powder, the powder can be reconstituted by the
addition of a suitable solvent. It is envisioned that the solvent
may also be provided in another container means.
VIII. Insurance Processing Embodiments
[0322] In one embodiment of the invention, there is provided a
method for processing an insurance claim for diagnosis and/or
treatment of a medical condition of the invention using a
composition(s) of the invention as disclosed herein and/or using a
treatment method as disclosed herein. In a specific embodiment, the
method employs a computer for said processing of an insurance
claim. In further specific embodiments, the dosage for the
composition may be any suitable dosage for treatment of the medical
condition.
[0323] In embodiments of the present invention, a subject, in
particular a human subject, may be examined and/or may be diagnosed
as suffering from, or being at risk of, a disease or condition
selected from, for example, progressive hemorrhagic necrosis
following spinal cord injury, traumatic brain injury, subarachnoid
hemorrhage, and/or intraventricular hemorrhage. Such an examination
may be performed by, for example, a physician, including a general
practice physician or a specialist, such as an emergency room
physician, a trauma specialist, an internist, a neurologist, a
cardiologist, or other specialist; may be performed by a nurse,
physician's assistant, medic, ambulance attendant, or other health
professional. Examination and/or diagnosis may be performed
anywhere, including at the scene of an accident or disaster; in an
ambulance or other medial transport vehicle; in a clinic; in an
examining room; in a hospital, including in any room or part of a
hospital; in an extended care facility; or other health care
facility. Such an examination may be an emergency examination,
and/or a perfunctory examination, and or a minimally detailed
examination, or may be an extended and detailed examination.
[0324] Such an examination may be performed without the use of
clinical equipment or devices, or with some use of clinical
equipment and devices, and may include the use of sophisticated
clinical and/or diagnostic equipment and/or devices, which may
include, for example, computer assisted tomography, magnetic
resonance imaging, positron emission tomography, X-ray, ultrasound,
or other imaging equipment; angiography, or other invasive
procedures; and other medical equipment and procedures.
[0325] Such a diagnosis may be made as a result of an examination
as discussed above, or may be made in the absence of an
examination.
[0326] A medical practitioner, nurse, clinical or emergency
technician or other person may provide medical assistance and
diagnostic assistance in the course of providing routine, elective,
or emergency medical care. In any case, all or part of the cost of
such care, such procedures, such diagnostic work, and such
diagnoses may be reimbursed by an insurance plan, employment
agreement, government program, or other arrangement from which the
subject may benefit. For example, a human subject may be covered by
an insurance policy which pays for and/or reimburses ("covers")
medical costs incurred by the subject.
[0327] As disclosed herein, a method for processing an insurance
claim for diagnosis and/or treatment of a medical condition of the
invention as disclosed herein, for a subject who has received
medical treatment for progressive hemorrhagic necrosis following
spinal cord injury, traumatic brain injury, subarachnoid
hemorrhage, and/or intraventricular hemorrhage, includes the steps
of:
[0328] i) receiving a claim for a medical treatment, procedure,
and/or medicament for treating for progressive hemorrhagic necrosis
following spinal cord injury, traumatic brain injury, subarachnoid
hemorrhage, and/or intraventricular hemorrhage with a SUR1
antagonist, a TRPM4 antagonist, or combination thereof; and
[0329] ii) providing reimbursement for the medical treatment,
procedure, and/or medicament.
[0330] In a further embodiment, a method for processing an
insurance claim for diagnosis and/or treatment of a medical
condition of the invention as disclosed herein, for a subject who
has received medical treatment for progressive hemorrhagic necrosis
following spinal cord injury, traumatic brain injury, subarachnoid
hemorrhage, and/or intraventricular hemorrhage, includes the steps
of:
[0331] i) receiving a claim for a medical treatment, procedure,
and/or medicament for treating for progressive hemorrhagic necrosis
following spinal cord injury, traumatic brain injury, subarachnoid
hemorrhage, and/or intraventricular hemorrhage with a SUR1
antagonist, a TRPM4 antagonist, or both;
[0332] ii) evaluating the claim for a medical treatment, procedure,
and/or medicament; and
[0333] ii) providing reimbursement for the medical treatment,
procedure, and/or medicament.
[0334] In embodiments of these methods for processing an insurance
claim, any one or more of the steps may involve the use of a
computer; any one or more of the steps may involve the use of
electronic data transfer; any one or more of the steps may involve
the use of a telephone and/or facsimile device; any one or more of
the steps may involve the use of mail and/or of a delivery service;
and any one or more of the steps may involve the use of electronic
fund transfer devices and/or methods.
[0335] In embodiments of these methods for processing an insurance
claim, the treatment may include a treatment or medicament
comprising any suitable dosage of a SUR1 antagonist, a TRPM4
antagonist, or combination thereof, for treatment of the medical
condition.
[0336] In particular embodiments of the methods for processing an
insurance claim, the treatment and/or medicament is directed to, or
affects, the NC.sub.Ca-ATP channel.
[0337] In particular embodiments of the methods for processing an
insurance claim, the treatment and/or medicament uses or includes a
SUR1 antagonist such as, for example, glibenclamide and
tolbutamide, repaglinide, nateglinide, meglitinide, midaglizole,
LY397364, LY389382, glyclazide, glimepiride, estrogen, estrogen
related-compounds (estradiol, estrone, estriol, genistein,
non-steroidal estrogen (e.g., diethystilbestrol), phytoestrogen
(e.g., coumestrol), zearalenone, etc.), and compounds known to
inhibit or block KATP channels.
[0338] In particular embodiments of the methods for processing an
insurance claim, the treatment and/or medicament uses or includes a
TRPM4 antagonist such as, for example, flufenamic acid, pinkolant,
rimonabant, or a fenamate (such as flufenamic acid, mefenamic acid,
meclofenamic acid, or niflumic acid),
1-(beta-[3-(4-methoxy-phenyl)propoxy]-4-methoxyphenethyl)-1H-imidazole
hydrochloride, and a biologically active derivative thereof.
[0339] In particular embodiments of the methods for processing an
insurance claim, the treatment and/or medicament uses or includes a
SUR1 antagonist and a TRPM4 antagonist.
[0340] In further embodiments of the methods for processing an
insurance claim, the treatment and/or medicament uses or includes a
treatment and/or medicament is directed to, or affects, the
NC.sub.Ca-ATP channel, where a treatment and/or medicament is
directed to, or affects, the NC.sub.Ca-ATP channel includes or uses
a non-sulfonyl urea compound, such as 2, 3-butanedione and
5-hydroxydecanoic acid, quinine, and therapeutically equivalent
salts and derivatives thereof; a protein, a peptide, a nucleic acid
(such as an RNAi molecule or antisense RNA, including siRNA), or a
small molecule that antagonizes or reduces the activity of the
NC.sub.Ca-ATP channel; and/or includes or uses MgADP.
EXAMPLES
[0341] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Up-Regulation of SUR1 in SCI
[0342] SUR1 expression was studied in spinal cords of uninjured
rats and rats after "severe" SCI (10-gm weight dropped 25 mm; 3-5
rats/group) (Soblosky et al. 2001; Gensel et al., 2006). In
controls, low levels of SUR1 expression were found in the dorsal
horns (FIG. 1A), due to constitutively expressed KATP channels
(Yamashita et al., 1994).
[0343] After unilateral SCI, the lesion itself as well as the
pattern of SUR1 expression changed with time and distance from the
impact site (FIG. 1A). Early post-SCI (3/4 h), the lesion was small
and was not immunolabeled by anti-SUR1 antibody (not shown). At 6
h, a necrotic lesion was apparent as a void in the ipsilateral
cord, and SUR1 up-regulation was prominent in tissues surrounding
the void. At 24 h, the necrotic lesion had enlarged (Nelson et al.,
1977; Tator, 1995), SUR1 up-regulation was still apparent in the
rim of the necrotic lesion, but now it extended to tissues more
distant from the impact site, including into the contralateral
hemi-cord. Immunolabeling for SUR2 was detected only in vascular
smooth muscle cells of pial arterioles, both pre- and post-SCI.
[0344] In the "core" of the lesion (heavily labeled area in FIG.
1A, 6 h), SUR1 up-regulation was present in various cells and
structures, including large ballooned neuron-like cells and
capillary-like elongated structures (FIG. 1B). In the "penumbra"
(tissue adjacent to the heavily labeled core in FIG. 1A, 6 h), SUR1
up-regulation was associated predominantly with capillaries (FIGS.
1C, 1D).
[0345] Up-regulation of SUR1 was confirmed with immunoblots. With
the amount of protein loaded, SUR1 was not detectable in normal
cords, whereas a prominent, single band at .about.190 kDa (Simard
et al., 2006) was observed 6 h post-SCI (FIG. 1E). The blood
introduced into the tissues by the injury did not account for the
increase in SUR1 (FIG. 1E). In situ hybridization confirmed
widespread expression of SUR1 after injury, especially in
capillaries and post-capillary venules in the penumbra (FIGS. 1F,
1G).
Example 2
SUR1 in Endothelium is Associated with NC.sub.Ca-ATP Channel
[0346] SUR1 forms the regulatory subunit of both NC.sub.Ca-ATP and
some K.sub.ATP channels (Chen et al., 2003). Our previous work
demonstrated that, following exposure to hypoxia or ischemia in
vivo, up-regulation of SUR1 in astrocytes and neurons is associated
with expression of functional NC.sub.Ca-ATP channels, not K.sub.ATP
channels (Chen et al., 2003, Simard et al., 2006). The same reports
also showed up-regulation of SUR1 in capillaries, as was found here
with SCI, but the associated channel was not identified.
Endothelial cells may normally express K.sub.ATP channels, but the
regulatory subunit of cardiovascular K.sub.ATP channels is
generally SUR2, not SUR1 (Jansen-Olesen et al., 2005).
Nevertheless, it was important to determine which of the two
channels, K.sub.ATP or NC.sub.Ca-ATP, the newly expressed SUR1 was
associated with in capillary endothelium.
[0347] Endothelial cell cultures from 3 sources, human brain
microvascular, human aorta, and murine brain microvascular, were
used to assess SUR1 expression and characterize channel properties
following exposure to hypoxia, with the same results observed with
all 3. Control cultures showed little expression of SUR1, but
exposure to hypoxia for 24 h resulted in significant up-regulation
of SUR1 (FIG. 2A). Insulinoma cells, which constitutively express
SUR1-regulated K.sub.ATP channels, showed no up-regulation of SUR1
when exposed to the same hypoxic conditions (FIG. 2A).
[0348] Patch clamp of endothelial cells was performed using a
nystatin-perforated patch technique, to maintain the metabolic
integrity of the cells. The identity of the activated channel can
be assessed by measurement of the "reversal potential", the
potential at which an ion channel current reverses from inward to
outward. With physiologically relevant concentrations of ions
intracellularly and extracellularly (high potassium inside, high
sodium outside), the reversal potential can unambiguously
distinguish between a K.sup.+ channel current such as K.sub.ATP,
which reverses negative to -50 mV and a non-selective cation
channel current such as NC.sub.Ca-ATP, which reverses near 0
mV.
[0349] Channel activation by diazoxide was studied, which opens
SUR-regulated channels without ATP depletion and, of SUR
activators, is the most selective for SUR1 over SUR2 (Chen et al.,
2003). Patch clamp of endothelial cells cultured under normoxic
conditions showed that diazoxide either had no effect or, in half
of the cells, activated an outwardly rectifying current that
reversed at potentials more negative than -50 mV, consistent with a
K.sub.ATP channel (FIG. 2B) (Seino, 1999). By contrast, in most
endothelial cells cultured under hypoxic conditions, diazoxide
activated an ohmic current that reversed near 0 mV and that was
inward at -50 mV (FIG. 2B), which is incompatible with K.sub.ATP,
but consistent with NC.sub.Ca-ATP channels (Chen and Simard, 2001;
Chen et al., 2003; Simard et al., 2006).
[0350] Channel activation induced by Na azide was also studied,
which is a mitochondrial uncoupler that depletes cellular ATP (Chen
and Simard, 2001). In most endothelial cells exposed to hypoxic
conditions, Na azide-induced ATP depletion activated an ohmic
current that was inward at -50 mV, that reversed near 0 mV, and
that was blocked by 1 .mu.M glibenclamide (FIG. 2C), again
consistent with NC.sub.Ca-ATP channels.
[0351] Single channel recordings were performed using inside-out
patches, with Cs.sup.+ as the only permeant cation. This confirmed
the presence of a channel that was sensitive to block by ATP on the
cytoplasmic side and that had a single channel conductance of 37 pS
(FIG. 2D). These findings are incompatible with K.sub.ATP channels,
which is not permeable to Cs.sup.+ and which has a slope
conductance of .about.75 pS, but are consistent with NC.sub.Ca-ATP
channels.
[0352] The characteristics of the channel identified in endothelial
cells from both aorta and brain capillaries from 2 species,
including expression only after exposure to hypoxia, activation by
depletion of cellular ATP or diazoxide, a reversal potential near 0
mV, conductance of Cs.sup.+, and single channel conductance of 37
pS, reproduce exactly our previous findings with NC.sub.Ca-ATP
channels in astrocytes and neurons (Chen and Simard, 2001; Chen et
al., 2003; Simard et al., 2006), and reaffirm that the
NC.sub.Ca-ATP channel is not constitutively expressed, is
up-regulated only with an appropriate insult, and when expressed,
is inactive until intracellular ATP is depleted.
Example 3
Glibenclamide Block of SUR1--Extravasation of Blood
[0353] To assess the role of SUR1 in SCI, the effect of
glibenclamide was studied, which is a sulfonylurea inhibitor that
binds with subnanomolar or nanomolar affinity (0.4-4.0 nM) to SUR1
(24). Immediately after injury, animals were implanted with
mini-osmotic pumps that delivered either vehicle or glibenclamide
(200 ng/h) s.q. Constant infusion of a low-dose of drug was used to
achieve sustained occupancy of only high-affinity receptors.
[0354] Cords of vehicle-treated animals examined 24 h post-SCI
showed prominent bleeding at the surface and internally, with
internal bleeding consisting of a central region of hemorrhage plus
numerous distinct petechial hemorrhages at the periphery (FIG. 3A,
arrows). By contrast, cords of glibenclamide-treated animals showed
visibly less hemorrhage and it was largely confined to the site of
impact, with fewer petechial hemorrhages in surrounding tissues
(FIG. 3A).
[0355] The amount of extravasated blood in tissue homogenates was
quantified at different times post-SCI, after first removing
intravascular blood (FIG. 3B). In cords from vehicle-treated
animals, measurements showed a progressive increase in the amount
of blood, with a maximum reached .about.12 h post-SCI (FIG. 3B). By
contrast, cords from glibenclamide-treated animals showed little
increase in extravasated blood during the 24 h after injury, with
most of the blood present at 24 h being attributable to the initial
impact (FIG. 3B).
[0356] Formation of petechial hemorrhages implies catastrophic
failure of capillary integrity. Capillaries in the region of injury
were examined by immunolabeling with vimentin, which is
up-regulated in endothelium following injury (Haseloff et al.,
2006). In controls, vimentin(+) capillaries appeared foreshortened
or fragmented, whereas in glibenclamide-treated animals, the
capillaries were elongated and appeared more normal (FIG. 3C).
[0357] In post-ischemic reperfusion of CNS tissues, catastrophic
failure of capillary integrity has been attributed to the action of
matrix metalloproteinases (MMP) (Wang et al., 2004). It was
assessed whether glibenclamide might have an effect on MMP activity
using zymography to measure gelatinase activity of recombinant MMP.
Gelatinase activity was not affected by glibenclamide, although it
was strongly inhibited by a specific MMP inhibitor (FIG. 3D),
indicating that the reduction in hemorrhage with glibenclamide
could not be attributed to MMP inhibition.
[0358] Glibenclamide did not affect bleeding time (FIG. 3E),
suggesting that the reduction in hemorrhage with glibenclamide
following SCI was unlikely to be due to an effect on coagulation or
platelet function (Chan et al., 1982).
[0359] The dose of glibenclamide used resulted in a small decrease
in serum glucose, from 236.+-.15 to 201.+-.20 (5 rats per group;
p=0.19) measured 3 h after SCI.
Example 4
Glibenclamide Block of SUR1--Lesion Size
[0360] Labeling of longitudinal sections for the astrocyte-marker,
glial fibrillary acidic protein (GFAP) and for myelin revealed that
glibenclamide-treatment was associated with smaller lesions, less
reactive gliosis and better myelin preservation 24 h post-SCI
compared to controls (FIGS. 4A,4B). Similarly, hematoxylin and
eosin staining of cross sections showed that
glibenclamide-treatment was associated with smaller lesions 7 d
post-SCI compared to controls (FIG. 4C). In vehicle-treated
controls at both 1 and 7 d, the lesions incorporated large voids of
necrotic tissue that involved most of the hemicord ipsilateral to
the impact site and that typically extended to the contralateral
hemicord. White matter tracts of the contralateral hemicord were
typically disrupted. By contrast, lesions in glibenclamide-treated
animals were smaller, typically did not cross the midline, and
contralateral as well as portions of ipsilateral white matter
tracts were spared. Lesion volumes at 7 d were .about.3-fold
smaller in glibenclamide-treated rats compared to controls (FIG.
4D). Notably, the lesion volumes we observed with glibenclamide
following a "severe" impact (10 gm.times.25 mm) were comparable to
those observed by other investigators in untreated rats using the
same cervical contusion model following a "mild" impact (10
gm.times.6.25 mm) (Gensel et al., 2006).
Example 5
Glibenclamide Block of SUR1--Neurobehavioral Function
[0361] Vehicle-treated rats were generally not mobile (Soblosky et
al., 2001), whereas glibenclamide-treated rats were typically
ambulatory and often exhibited proficient exploratory behavior.
When suspended by their tail, vehicle-treated rats hung passively
with little or no flexion of the trunk, whereas
glibenclamide-treated rats could typically flex their trunk,
bringing the snout to the level of the thorax or hindquarters.
[0362] The same animals used to assess lesion size on an inclined
plane were tested, which is a standard test that requires
more-and-more dexterous function of the limbs and paws as the angle
of the plane is increased (Rivlin and Tator, 1977). At 1, 3 and 7 d
post-SCI, glibenclamide-treatment was associated with significantly
better performance than vehicle-treatment (FIG. 4E).
[0363] Ipsilateral paw placement was quantified, which is
characteristically lost following cervical hemicord transection
(Nikulina et al., 2004). In the same animals tested 1 d post-SCI,
glibenclamide-treatment was associated with significantly better
performance than vehicle-treatment (FIG. 4E).
[0364] The BBB scale (Basso et al., 1995) is commonly used to
evaluate neurobehavioral function in rodents post-SCI. However, it
was designed for thoracic-level lesions, not cervical-level
lesions, and the highest level of performance that it records is
less than what our glibenclamide-treated rats could achieve. The
vertical exploratory behavior ("rearing") was quantified, a complex
exercise that requires balance, truncal stability, bilateral
hindlimb dexterity and strength, and at least unilateral forelimb
dexterity and strength, which together are excellent markers of
cervical spinal cord function. Testing the same rats as above at 1,
3 and 7 d post-SCI showed that glibenclamide-treatment was
associated with significantly better performance than
vehicle-treatment (FIG. 4E). In additional groups of rats tested
only at 1 d post-SCI, similar differences were observed (3.+-.1 vs.
42.+-.7 sec; P=0.001; 14-15 rats/group).
Example 6
Repaglinide Block of SUR1
[0365] Repaglinide is a member of a distinct class of insulin
secretagogues that are structurally unrelated to sulphonylureas and
whose binding site may differ from that of sulfonylureas (Hansen et
al., 2002). Like glibenclamide, repaglinide produces high-affinity
block of both native and recombinant .beta.-cell K.sub.ATP channels
(IC.sub.50=0.9-7 nM), and shows higher potency in inhibiting
pancreatic SUR1-regulated KATP channels than cardiovascular
SUR2-regulated channels (Stephan et al., 2006).
[0366] The effect of repaglinide on PHN was examined, using the
same treatment regimen as used for glibenclamide. As with
glibenclamide, repaglinide treatment reduced blood in cord
homogenates from 1.8.+-.0.2 to 1.2.+-.0.1 al at 1 d post-SCI
(P<0.01; 5-8 rats/group), and was associated with significantly
better performance on the inclined plane (head up: 40.+-.4 vs.
62.+-.2 degrees; P=0.01; head down: 29.+-.4 vs. 47.+-.3 degrees;
P=0.03; n=3-8/group) and in vertical exploration (3.+-.2 vs.
27.+-.6 sec. P=0.005; 5-6 rats/group) than vehicle-treated
controls.
Example 7
Gene Suppression of SUR1
[0367] Gene suppression was used to confirm involvement of SUR1 in
PHN, choosing an antisense-oligodeoxynucleotide strategy shown to
be effective in vitro (Yokoshiki et al., 1999).
[0368] To validate the antisense strategy, it was first implemented
in the model that was originally used for the discovery of the
NC.sub.Ca-ATP channel, wherein a gelatin sponge is implanted into
the parietal lobe to stimulate formation of a gliotic capsule (Chen
and Simard, 2001). Here, animals were also fitted with mini-osmotic
pumps that delivered oligodeoxynucleotides (ODN), either antisense
(AS) or scrambled (Scr), continuously for 7 d into the injury site.
Gliotic capsules from rats treated with AS-ODN showed a significant
reduction in SUR1 protein, compared to Scr-ODN (FIG. 5A). Patch
clamp of astrocytes from gliotic capsule of rats treated with
Scr-ODN showed that they rapidly depolarized when cellular ATP was
depleted by exposure to Na azide (FIG. 5B), an effect that was
previously shown was due to opening of NCCa-ATP channels (Chen et
al., 2003). By contrast, astrocytes from rats treated with AS-ODN
depolarized only slightly or not at all (FIG. 5B), demonstrating
that SUR1 is required for expression of functional NC.sub.Ca-ATP
channels, just as with K.sub.ATP channels (Sharma et al.,
1999).
[0369] For experiments with SCI, AS-ODN and Scr-ODN were used that
were phosphorothioated at 4 distal bonds to protect against
endogenous nucleases (Galderisi et al., 1999), with ODN's
administered i.v. starting immediately after injury. At 6 h
post-SCI, cords from rats treated with AS-ODN showed significantly
less immunolabeling for SUR1 than controls (FIG. 5C). With Scr-ODN,
the necrotic void beneath the impact site was surrounded by an
SUR1-positive shell of tissue, similar to observations in untreated
animals (FIG. 1A). With AS-ODN, however, only the small volume of
tissue immediately beneath the impact site was labeled for SUR1,
and no necrotic void was evident (FIG. 5C). AS-ODN did not affect
normal expression of SUR1 in dorsal horn cells (FIG. 5C). At 1 d
post-SCI, treatment with AS-ODN reduced blood in cord homogenates,
and was associated with significantly better performance on the
inclined plane and in vertical exploration compared to Scr-ODN
(FIG. 5D).
Example 8
Significance of Certain Embodiments of the Invention
[0370] The present invention includes the novel finding that SUR1
is strongly up-regulated following SCI, and that block of SUR1 is
associated with significant improvements in all of the
characteristic manifestations of PHN, including hemorrhage, tissue
necrosis, lesion evolution and neurological dysfunction. Although
one embodiment focused on SUR1 and NC.sub.Ca-ATP channels in
capillary endothelium, the data also showed early (<6 h)
up-regulation of SUR1 in large neuron-like cells in the core near
the impact site, and in other studies, late (12-24 h) up-regulation
of SUR1 in reactive astrocytes was observed. These responses to SCI
may be compared to findings previously reported for ischemic
stroke, wherein there is early up-regulation of SUR1 in neurons and
capillaries in the core, and later up-regulation of SUR1 in
capillaries and astrocytes in penumbral tissues (Simard et al.,
2006).
[0371] PHN has been linked to tissue ischemia (Nelson et al., 1977;
Tator, 1995), but has not previously been characterized at a
molecular level. PHN is probably a variant of "hemorrhagic
conversion", a mechanism of secondary injury in the CNS, wherein
capillaries or post-capillary venules undergo delayed catastrophic
failure that allows extravasation of blood to form petechial
hemorrhages, which in turn coalesce into a unified region of
"hemorrhagic necrosis" or "hemorrhagic infarction" (Simard et al.,
2007). Hemorrhagic conversion is common in traumatic brain injury
(Oertel et al., 2002) and following post-ischemic reperfusion (Wang
et al., 2004), with hypoxia and active perfusion being important
antecedents (Simard et al., 2007). The molecular pathology involved
in hemorrhagic conversion has not been fully elucidated, but work
in ischemic stroke has implicated enzymatic destruction of
capillaries by matrix-metalloproteinases (MMP) (Wang et al., 2004;
Gidday et al., 2005). MMPs have been implicated in SCI (Noble et
al., 2002; Pannu et al., 2007), but not in PHN.
[0372] The work reported here indicates that endothelial
SUR1-regulated NC.sub.Ca-ATP channels are involved in PHN. The data
show that PHN was associated with up-regulation of SUR1 in
capillaries and post-capillary venules, structures long held to be
responsible for PHN (Griffiths et al., 1978; Kapadia, 1984).
Moreover, the data show that block of SUR1 by 3 molecularly
distinct agents, glibenclamide, repaglinide and AS-ODN,
significantly reduced PHN. The remarkably similar outcomes obtained
with highly selective agents that act via distinct molecular
mechanisms underscore the important role of SUR1. These data also
provide evidence that de novo expression of SUR1 is necessary and
sufficient for development of PHN. Use of a knock-down strategy
employing AS-ODN appears to have been more informative than a gene
knock-out strategy, since the latter would not have distinguished
between constitutive and de novo expression of SUR1.
[0373] SUR1 forms the regulatory subunit of both NC.sub.Ca-ATP and
some K.sub.ATP channels (Chen et al., 2003; Simard et al., 2006).
Here, it is shown that up-regulation of SUR1 in endothelial cells
was associated with expression of functional NC.sub.Ca-ATP
channels, which was previously implicated in edema formation and
cell death in CNS ischemia/hypoxia (Simard et al., 2006; Simard et
al., 2007). Our patch clamp recordings confirmed the presence of
non-selective cation channel that was activated by diazoxide and
ATP-depletion, blocked by glibenclamide and cytoplasmic ATP,
conducted Cs.sup.+, and had a single channel conductance of
.about.35 pS, all of which are characteristic of the NC.sub.Ca-ATP
channel (Chen and Simard, 2001; Chen et al., 2003). It was
previously shown that this channel conducts only monovalent, not
divalent cations (Chen and Simard, 2001). The studies reported here
showing up-regulation of functional NC.sub.Ca-ATP channels were
performed using endothelial cells from CNS as well as non-CNS
sources from two species, suggesting a certain degree of generality
of the phenomenon. In the patch clamp studies, endothelial cells
from spinal cord were not explicitly studied, which could
potentially differ from those in brain. However, it seems unlikely
that the up-regulation of SUR1 in spinal cord capillaries that was
observed was associated with a different channel, such as
K.sub.ATP. Sulfonylurea block of K.sub.ATP would not be expected to
be neuroprotective (Sun et al., 2007), whereas block of
NC.sub.Ca-ATP is highly neuroprotective in both rodents and humans
(Simard et al., 2006; Kunte et al., 2007).
[0374] Of the numerous treatments assessed in SCI, very few have
been shown to actually decrease the hemorrhage and tissue loss
associated with PHN. Methylprednisolone, the only approved therapy
for SCI, improves edema, but does not alter the development of PHN
(Merola et al., 2002). A number of compounds have shown beneficial
effects related to tissue sparing, including the NMDA antagonist,
MK801 (Faden et al., 1988), the AMPA antagonist, GYKI 52466 (Colak
et al., 2003), Na.sup.+ channel blockers (Schwartz and Fehlings,
2001), and minocycline (Teng et al., 2004). Overall however, no
treatment has been reported that reduces PHN and lesion volume, and
that improves neurobehavioral function to the extent observed here
with glibenclamide, repaglinide and AS-ODN.
[0375] There are 2 mechanisms by which glibenclamide can
antagonizing SUR1-regulated NC.sub.Ca-ATP channels: (i) by block of
the channel once it is expressed and subsequently opened by ATP
depletion (Chen et al., 2003); (ii) by interfering with trafficking
of SUR1 to the cell membrane, a process that is required for
expression of functional channels (Partridge et al., 2001). Both
block of open channels (Simard et al., 2006) and SUR1 binding
(Nelson et al.,) needed to inhibit trafficking are increased an
order of magnitude or more at the low pH of ischemic tissues.
Either block of open channels or interference with trafficking or
both, coupled with the augmented efficacy imparted by low pH,
likely account for the high efficacy of glibenclamide found
previously with stroke (Simard et al., 2006) and here with SCI.
[0376] Half of patients with SCI initially present with an
incomplete lesion (Bracken et al., 1990), making it important to
identify therapeutic strategies to inhibit secondary injury
mechanisms. Glibenclamide has been used safely in humans for
several decades for treatment of type 2 diabetes, with no untoward
side-effects except hypoglycemia, and its continued use immediately
post-stroke improves outcome in patients with type 2 diabetes
(Kunte et al., 2007). The safety of glibenclamide, plus its unique
mechanism of action in targeting the capillary failure that leads
to PHN, indicate that this drug may be especially attractive for
translational use in human SCI.
Example 9
Exemplary Materials and Methods
[0377] SCI injury model. This study was performed in accordance
with the guidelines of the Institutional Animal Care and Use
Committee. Adult female Long-Evans rats (275-350 gm) were
anesthetized (Ketamine, 60 mg/kg plus Xylazine, 7.5 mg/kg, i.p.).
The dura at C4-5 was exposed via a left hemilaminectomy. A
hemi-cervical spinal cord contusion was created using a blunt force
impactor (1.3-mm impactor head driven by a 10 gm weight dropped
vertically 25 mm) (Soblosky et al., 2001; Gensel et al., 2006).
After SCI, animals were given 10 ml of glucose-free normal saline
s.q. Rectal temperature was maintained at .about.37.degree. C.
using a servo-controlled warming blanket. Blood gases and serum
glucose 10-15 min post-SCI were: pO.sub.2, 95.+-.6 mm Hg;
pCO.sub.2, 46.+-.3 mm Hg; pH, 7.33.+-.0.01 glucose 258.+-.17 mg/dl
in controls and pO.sub.2, 96.+-.7 mm Hg; pCO.sub.2, 45.+-.2 mm Hg;
pH, 7.37.+-.0.01; glucose 242.+-.14 mg/dl in glibenclamide-treated
animals.
[0378] Drug delivery. Within 2-3 min post-SCI, mini-osmotic pumps
(Alzet 2002, 0.5 .mu.l/h; Durect Corporation) were implanted that
delivered either vehicle (saline plus DMSO), glibenclamide (Sigma)
in vehicle, or repaglinide (Sigma) in vehicle subcutaneously.
During the course of the project, slightly different formulations
of drug were used, with the best results obtained using stock
solutions made by placing 50 mg (or 25 mg) of drug into 10 ml DMSO,
and infusion solutions made by placing 400 .mu.l (or 800 .mu.l)
stock into 4.6 ml (or 4.2 ml) unbuffered saline (0.9% NaCl) and
adjusting the pH to .about.8.5 using 0.1 N NaOH. Infusion solutions
of glibenclamide and repaglinide were delivered at 0.5 .mu.l/h,
yielding infusion doses of 200 ng/h.
[0379] For in vivo gene suppression of SUR1, we used
oligodeoxynucleotides that were phosphorothioated at 4 distal bonds
to protect against endogenous nucleases (35). Within a few min of
SCI, mini-osmotic pumps (Alzet 2002, 0.5 .mu.l/h; Durect
Corporation) with jugular vein catheters were implanted that
delivered either scrambled sequence ODN (Scr-ODN)
(5'-TGCCTGAGGCGTGGCTGT-3'; SEQ ID NO:1) or antisense ODN (AS-ODN)
(5'-GGCCGAGTGGTTCTCGGT-3'; SEQ ID NO:2) (Yokoshiki et al., 1999) in
PBS at a rate of 1 mg/rat/24 h.
[0380] Tissue blood. Rats were sacrificed at various times after
SCI (n=5-11 rats/group), were perfused with heparinized saline to
remove intravascular blood, and 5-mm segments of cord encompassing
the lesion were homogenized and processed as described (Choudhri et
al., 1997).
[0381] Lesion size. At 7 d post-SCI, cords were paraffin sectioned
and stained with H&E. Lesion volumes were calculated from
lesion areas measured on serial sections every 250 .mu.m.
[0382] Neurobehavioral assessment. All measurements were performed
by blinded evaluators. Performance on the inclined plane was
evaluated as described (Rivlin and Tator, 1977). To assess paw
placement and vertical exploration (rearing) (Nikulina et al.,
2004) animals were videotaped while in a translucent cylinder
(19.times.20 cm). Rearing was quantified as the number of seconds
spent with both front paws elevated above shoulder-height during a
3-min period of observation.
[0383] Bleeding times were measured using tail tip bleeding as
described (Lorrain et al., 2003).
[0384] Zymography of recombinant MMP-2 and MMP-9 (Sigma) was
performed as described (Sumii and Lo, 2002).
[0385] Cell culture. Endothelial cell cultures from human brain
microvessels, human aorta (ScienCell Research Laboratories), and
murine brain microvessels (bEnd.3: ATCC), were grown at low density
using media and supplements recommended by suppliers.
[0386] SUR1 knock-down in astrocytes was performed in triplicates
by implanting rats with gelatin sponges in the parietal lobe to
induce formation of a gliotic capsule containing reactive
astrocytes that express the SUR1-regulated NC.sub.Ca-ATP channel
(Chen and Simard, 2001; Chen et al., 2003). At the same time, they
were implanted with mini-osmotic pumps (Alzet, model 2002; 14-day
pump) placed in the dorsal thoracolumbar region that contained ODN
(711 .mu.g/ml delivered @ 0.5 .mu.l/h, yielding 1500
picomoles/day), with the delivery catheter placed directly into the
site of the gelatin sponge implant in the brain. Animals were
infused with Src-ODN or AS-ODN, as above but not phosphorothioated.
After 10-14 days, the gelatin sponge plus encapsulating gliotic
tissues were harvested and processed either for Western immunoblots
or to obtain fresh reactive astrocytes for patch clamp
electrophysiology.
[0387] Patch clamp electrophysiology for the NC.sub.Ca-ATP channel
in this lab has been described (Chen and Simard, 2001; Chen et al.,
2003).
[0388] Immunohistochemistry. Cryosections were immunolabeled (Chen
et al., 2003; Simard et al., 2006) using primary antibodies
directed against SUR1 (Santa Cruz, C-16; 1:200; 1 h at RT, 48 h at
4.degree. C.), SUR2 (Santa Cruz, H-80; 1:200; 1 h at RT, 48 h at
4.degree. C.), GFAP (Sigma, C-9205; 1:500), and vimentin (Sigma,
monoclonal CY3 conjugated; 1:100). Quantitative immunofluorescence
was performed as described (Gerzanich et al., 2003).
[0389] Immunoblots were prepared using antibodies directed against
SUR1. The specificity of the antibody (Chen and Simard, 2001; Chen
et al., 2003; Simard et al., 2006) is demonstrated by the
knock-down experiments of FIG. 5.
[0390] In situ hybridization. Fresh-frozen cord sections were fixed
in 5% formaldehyde for 5 min. Digoxigenin-labeled probes (sense:
'5-GCCCGGGCACCCTGCTGGCTCTGTGTGTCCTTCCGCGCCTGGGCATCG-3'; SEQ ID
NO:3) were designed and supplied by GeneDetect and hybridization
was performed according to the manufacturer's protocol (see website
for GeneDetect).
Example 10
Spinal Cord Injury, Progressive Hemorrhagic Necrosis and the
NC(Ca-ATP) Channel
[0391] Anti-SUR1 antibody. Because of the emerging importance of
the SUR1-regulated NC.sub.Ca-ATP channel in SCI and other disorders
(Simard et al., 2007), an antibody against SUR1 was developed. A
part of the rat SUR1 cDNA (Protein Id, NP_037171; amino acid
598-965) was subcloned into pQE31 (Qiagen, Chatsworth, Calif.) to
overexpress the protein in a hexa-histidine-tagged form in
bacterial cells. The fusion protein was purified using a
Ni+-agarose column and was used to raise antibodies in rabbits by a
commercial service (Covance, Denver, Pa.). To validate the
antibody, flag-tagged SUR1 was expressed in COS7 cells. Total
lysates from COS7 cells transfected with a control empty vector
(FIG. 6A lane 1, FIG. 6B lane 1) or with an expression vector
encoding FLAG-tagged SUR1 (FIG. 6A lanes 2 and 3, FIG. 6B lanes 2
and 3) were examined by immunoblot using FLAG monoclonal M2
antibody (FIG. 6A) and the anti-SUR1 polyclonal antibody generated
in this lab (FIG. 6B). Both antibodies detected the same band at
.about.160 kDa, as well as higher molecular weight products
believed to be due to poly-ubiquitination of SUR1, as reported
previously (Yan et al., 2005) Note that neither antibody detected
any specific band from lysates from cells transfected with a
control vector (FIG. 6A lane 1, FIG. 6B lane 1), consistent with a
high specificity of the antibody.
[0392] Exemplary data on human SCI. Because of the emerging
importance of the SUR1-regulated NC.sub.Ca-ATP channel in SCI and
other disorders (Simard et al., 2007) the upregulation of the
channel in human SCI was investigated. To date, SUR1 expression has
been studied in 3 human cases using the antibody referred to above.
The exemplary case illustrated here is that of a 59 yo male who
sustained a C3 level injury and expired 3 days later. Low power
views of H&E sections at the level of injury showed gross
tissue disruption, which was not present in "uninvolved" cord (FIG.
7A vs. FIG. 7B). Immunolabeling of adjacent sections demonstrated
diffuse upregulation of SUR1 throughout the area of involvement
(FIG. 7C vs. FIG. 7D). High power views of H&E sections
confirmed the presence of extravasated blood and fractured
microvessels within the core of the lesion, but not in "uninvolved"
cord (FIG. 7E vs. FIG. 7F), and confirmed the presence of dying
neurons in the core but not in "uninvolved" cord (FIG. 7G vs. FIG.
7H). Sections from the core showed prominent expression of SUR1 in
microvessels (FIG. 8A, arrows), in ballooned neurons (FIG. 8B), in
microvascular endothelium (FIG. 8C, arrow) and in endothelium of
arterioles (FIG. 8C, *.quadrature. and FIG. 8D, arrows). Each of
these findings in humans duplicates exactly recent findings in rats
(Simard et al., 2007). Notably, SUR1 is not normally expressed in
CNS microvessels (Sullivan and Harik, 1993), making these findings
in human microvessels post-SCI remarkably similar to the findings
in rodents. In specific embodiments, double labeling of these
tissues is employed to verify cellular identity and in situ
hybridization to confirm SUR1 upregulation. Nevertheless, these
exciting findings indicate that progressive secondary hemorrhage in
humans may be ameliorated, as in rodents, by block of SUR1 with
glibenclamide.
[0393] Exemplary data on SCI in SUR1-KO mice. A colony of SUR1-KO
mice is maintained to perform studies to demonstrate the beneficial
effect of SUR1-KO in SCI. An active colony of >20 SUR1-KO mice
that are successfully breeding now exists. Additional SCI
experiments have been performed (unilateral T9 lesion). The
behavioral response was evaluated at 24 hr in 14 WT and in 18
SUR1-KO mice using BMS, confirming that SUR1-KO is highly
protective against progressive hemorrhagic necrosis (FIG. 9). In
addition, longer term outcome in investigated, for example to
assess durability of the protective effect. Data at 7 days continue
to show highly significant differences between WT and SUR1-KO.
[0394] In certain embodiments of the invention, transfection of
plasmids into endothelial cells, both bEnd.3 cells and primary
cultured CNS microvascular endothelial cells, is employed. To
improve transfection efficiencies, the Nucleofector 96-well shuttle
system is utilized. Two experiments were performed with
transfection of plasmids that encode GFP: 1) with primary cultured
CNS microvascular cells, there was a survival rate of 30% at 24
hrs, with 90% of surviving cells showing fluorescent signal; 2)
with bEnd.3 cells, there was a survival rate of 60% at 24 hrs, with
>70% of surviving cells showing fluorescent signal. The
transfection parameters to improve cell survival rates with this
method were optimized.
Example 11
SUR1 Upregulation Predisposes Premature Infants to Intraventricular
Hemorrhage
[0395] Brain tissues were obtained at autopsy from 6 premature
infants with IVH and 3 controls without IVH. For routine
histopathology, sections of germinal matrix in affected areas were
dehydrated in graded ethanol and xylene solutions, embedded in
paraffin, and sectioned at 6 microns. For immunofluorescence for
SUR1, fixed and unprocessed tissues were suspended in sucrose and
snap frozen. Six micron cryostat sections were obtained.
Immunofluorescence for SUR1 was performed as previously described
(Nature Medicine 2006; 12:433-40).
[0396] Significant increased expression of SUR1 was observed in
vascular endothelium and germinal matrix tissue in one of the three
non-IVH cases; the clinical course of this case was complicated by
hypoxia necessitating intubation. A second non-IVH case showed an
intermediate level of fluorescence in germinal matrix only; this
infant expired of extreme prematurity shortly after delivery. The
third non-IVH also expiring of extreme prematurity following
delivery, showed no reactivity. The 6 IVH cases showed patchy
increased fluorescence consistent with up-regulation followed by
early ischemic necrosis.
[0397] These results indicate that SUR1 is increased in premature
infant brains, and particularly in germinal matrix regions of
infants who suffer hypoxia and IVH. This suggests that maladaptive
opening of the NC.sub.Ca-ATP channels may result in endothelial
injury and hemorrhage. Since SUR1 is blocked at least by
glibenclamide, these data provide a useful therapeutic and/or
preventative intervention in premature infants, including stressed
premature infants prior to IVH.
Example 12
In Utero Ischemia Leads to the Upregulation of Sulfonylurea
Receptor 1 in the Periventricular Zone in Rats
[0398] Periventricular leukomalacia (PVL) is a form of cerebral
palsy that involves deep white matter injury and that usually
occurs during fetal development. In specific embodiments of the
invention, hypoxic/ischemic insults during pregnancy induces the
expression of sulfonylurea receptor 1 (SUR1)-regulated NC(Ca-ATP)
channels, which were recently implicated in programmed oncotic cell
death in the central nervous system (CNS), and have been found to
play an important role in cerebral ischemia and spinal cord injury.
In this study, expression of the regulatory subunit of the channel,
SUR1, was evaluated in a rodent model of prenatal ischemia/hypoxia.
Transient (1 hr) unilateral uterine ischemia/reperfusion was
induced in pregnant rats at embryonic day 17 by clamping the right
uterine artery. Embryos in the left uterine horn, where blood flow
was not interrupted, served as controls.
[0399] Embryos were delivered by cesarean section 24 hr after
uterine ischemia/reperfusion. SUR1 was prominently upregulated in
the brains of embryos that were subjected to ischemia/reperfusion,
but not in controls.
[0400] Especially prominent upregulation of SUR1 was found in
neural progenitor cells in the subventricular zone, which
corresponds to the area of vulnerability that is affected in PVL.
Additionally, neurons in the cortex of ischemic embryos exhibited
increased SUR1 compared to control embryos. Thus, in certain
aspects of the invention, SUR1 is upregulated following
intrauterine transient ischemia. In specific embodiments, it is
determined whether the pore-forming subunit of the SUR1-regulated
NC(Ca-ATP) is also upregulated, and whether this novel pathological
mechanism accounts for PVL following intrauterine
ischemia/hypoxia.
Example 13
In Utero Ischemia Upregulates SUR1--Links to Periventricular
Leukomalacia and Germinal Matrix Hemorrhage
[0401] Premature infants often suffer from cerebral palsy (CP),
which leads to devastating lifelong disability. At present, there
is no good prevention for CP. CP is believed to arise from periods
of reduced blood flow to the brain in utero, which predisposes
premature infants to white matter injury (periventricular
leukomalacia) and bleeding in the brain (germinal matrix
hemorrhage) during the early post-natal period. The experiments
reported here were intended to model this condition in rats. Using
pregnant rats, the uterine artery was temporarily clamped on one
side to mimic placental insufficiency. The next day, the pups were
delivered "prematurely" by C-section. Shortly after birth, saline
was injected into the abdomen of the pups to raise central venous
pressure, to mimic complications associated with mechanical
ventilation often required in premature infants with "stiff" lungs.
The pups were later euthanized, within 1 hr of birth. The pups from
the opposite side, where the uterine artery was not clamped, were
used as controls. The brains of the pups were studied to detect the
regulatory subunit of the SUR1 regulated NC.sub.Ca-ATP channel.
SUR1 was found to be significantly upregulated in periventricular
progenitor cells and in veins, consistent with the embodiment that
SUR1-regulated NC.sub.Ca-ATP channels may be causally linked to the
brain damage in humans characterized as periventricular
leukomalacia and germinal matrix hemorrhage.
Introduction
[0402] The neuropathology underlying cerebral palsy includes white
matter injury, known as periventricular leukomalacia (PVL) and
germinal matrix (GM) hemorrhage (GMH) (Vergani et al., 2004;
Folkerth, 2005). Each has distinctive features, but both share
important risk factors, including prematurity and hypoxia/ischemia,
which may occur prenatally or may be due to post-natal ventilatory
difficulties that are complicated by mild-to-moderate hypotension
(Veragni et al., 2004; Kadri et al., 2006; Lou, 1993).
[0403] GMH is a common complication of prematurity, occurring in
20-45% of premature infants (Kadri et al., 2006). GMH may range in
severity from subependymal hemorrhage (grade 1) to intraventricular
hemorrhage without (grade 2) or with (grade 3) ventricular
dilatation, to parenchymal extension and periventricular venous
infarction (grade 4). In survivors, neurological sequelae,
particularly with higher grade GMH, include cerebral palsy,
hydrocephalus requiring ventricular shunting, learning
disabilities, and seizures (Levy et al., 1997; Pikus et al., 1997).
Numerous factors are believed to contribute to GMH, including
innate weakness of GM veins, autoregulatory dysfunction,
hypoxic/ischemic tissue damage, damage due to post-ischemic
reperfusion and increased venous pressure (Lou, 1993; Nakamura et
al., 1990; Wei et al., 2000; Anstrom et al., 2004; Berger et al.,
2002; Ghazi-Birry et al., 1997). The incidence of GMH increases
with the degree of prematurity (Kadri et al., 2006), suggesting
that advances in perinatal care that yield concomitant increases in
the number of extremely premature infants will continue to be
hampered by complications of GMH. At present, no effective
prevention is available.
[0404] Hypoxia/ischemia in human CNS, both in utero (Xia et al.,
1993) and in adults (Xia et al., 1993; Simard et al., 2007) results
in upregulation of sulfonylurea receptor 1 (SUR1). Under
pathological conditions, SUR1 upregulation is associated with
formation of SUR1-regulated NC.sub.Ca-ATP channels, not K.sub.ATP
channels (Simard et al., 2006; Simar et al., 2007a; Simard et al.,
2007b). Expression of SUR1-regulated NC.sub.Ca-ATP channels in
capillary endothelium has been causally implicated in progressive
secondary hemorrhage in CNS, with block of these channels by
infusion of low-dose (non-hypoglycemogenic) glibenclamide
(glyburide) completely preventing secondary hemorrhage (Simard et
al., 2007b). In specific embodiments, this channel is induced in
periventricular tissues, including the GM, by hypoxia/ischemia, and
thereby predispose to PVL and GMH. To assess this, expression of
the regulatory (SUR1) subunit of the channel in brain tissues was
studied from a rat model of intrauterine ischemia.
Methods
[0405] Pregnant female Wistar rats were shipped to arrive on
gestational day (GD) (Simard et al., 2006; Simard et al., 2007b;
Simard et al., 2007b). They were acclimatized, then on GD 17, they
underwent surgery for temporary clamping of the right uterine
artery. An animal was anesthetized to a surgical level with 3%
isoflurane in the mixture N.sub.2O/O.sub.2, 70.degree. %/30%, after
which anesthesia is maintained with 1.5% isoflurane during surgery.
Core temperature is maintained at 37.degree. C. Transient
unilateral uterine ischemia was induced as described (Nakai et al.,
201; Tanaka et al., 1994). Two sterile microvascular clips were
used to occlude the uterine vessels near the lower and upper ends
of the right uterine horn. The clips were removed after 60 min of
ischemia. For each experiment the fetuses in the right uterine horn
served as the ischemia group and those in the left horn as the
non-ischemia group.
[0406] 24 hr after induction of uterine ischemia, the rats were
re-anesthetized. The fetuses are delivered by cesarean section,
after which the dam was euthanized. All the pups delivered from the
left cornu (non-ischemic side) and half the pups delivered from the
right cornu (ischemic side) underwent no further intervention. The
other half of the pups from the right cornu (ischemic side)
underwent a single intraperitoneal injection of sterile, USP grade
normal saline (100 .mu.l). One hr after birth, all pups were
euthanized for tissue analysis. Results
[0407] Immunolabeling of brains from control pups showed no
appreciable SUR1. However, pups subjected to transient
ischemia/hypoxia showed significant upregulation of SUR1,
especially in the progenitor cells that were densely packed in
periventricular regions (FIG. 10A). In pups exposed to transient
ischemia/hypoxia plus an increase in central venous pressure, SUR1
was also found to be prominently upregulated in veins (FIGS.
10B-10D).
Conclusions
[0408] SUR1 is upregulated in periventricular progenitor cells in a
rodent model of in utero ischemia/hypoxia and, when central venous
pressure is increased, in veins as well. This pattern of SUR1
upregulation corresponds to the pattern observed in premature
infants at risk for or who sustain germinal matrix hemorrhages. The
known functions of the SUR1-regulated NC.sub.Ca-ATP indicate that
SUR1 upregulation following in utero ischemic/hypoxic insults is
causally linked to pathological disorders such as periventricular
leukomalacia and germinal matrix hemorrhage, for example.
Example 14
Sulfonylurea Receptor 1 in the Germinal Matrix of Premature
Infants
[0409] The present example concerns germinal matrix (GM) hemorrhage
(GMH), which is a major cause of mortality and of life-long
morbidity from cerebral palsy (CP). GMH is typically preceded by
hypoxic/ischemic events and is believed to arise from rupture of
weakened veins in the GM. In the CNS, hypoxia/ischemia upregulate
sulfonylurea receptor 1 (SUR1)-regulated NC.sub.Ca-ATP channels in
microvascular endothelium, with channel activation by depletion of
ATP being responsible for progressive secondary hemorrhage. In
specific embodiments of the invention, this channel is upregulated
in the GM of preterm infants at risk for GMH. Here, the expression
of the regulatory subunit of the channel, SUR1, and its
transcriptional antecedent, hypoxia inducible factor 1 (HIF1), were
examined in postmortem tissues of premature infants who either were
at risk for or who sustained GMH. Regionally specific upregulation
of HIF1 and of SUR1 protein and mRNA in GM tissues was identified,
compared to remote cortical tissues. Upregulation was prominent in
most progenitor cells, whereas in veins, SUR1 was found
predominantly in infants who had sustained GMH compared to those
without hemorrhage. The data indicate that the SUR1-regulated
NC.sub.Ca-ATP channel is associated with GMH, in certain
embodiments, and that pharmacological block of these channels
reduces the incidence of this devastating complication of
prematurity.
[0410] The neuropathology underlying cerebral palsy includes white
matter injury, such as periventricular leukomalacia (PVL) and
germinal matrix (GM) hemorrhage (GMH) (Vergani et al., 2004;
Folkerth, 2005). Each has distinctive features, but both share
important risk factors, including prematurity and hypoxia/ischemia,
which may occur prenatally or may be due to post-natal ventilatory
difficulties that are complicated by mild-to-moderate hypotension
(Vergani et al., 2004; Kadri et al., 2006; Lou, 1993).
[0411] GMH is a common complication of prematurity, occurring in
15-45% of premature infants (Kadri et al., 2006). GMH may range in
severity from subependymal hemorrhage (grade 1) to intraventricular
hemorrhage without (grade 2) or with (grade 3) ventricular
dilatation, to periventricular venous infarction (grade 4). In
survivors, neurological sequelae, particularly with higher grade
GMH, include cerebral palsy, hydrocephalus requiring ventricular
shunting, learning disabilities, and seizures (Levy et al., 1997;
Pikus et al., 1997). Numerous factors are believed to contribute to
GMH, including innate weakness of GM veins, autoregulatory
dysfunction, hypoxic/ischemic tissue damage, damage due to
post-ischemic reperfusion and increased venous pressure (Lou, 1993;
Nakamura et al., 1990; Wei et al., 2000; Anstrom et al., 2004;
Berger et al., 2002; Ghazi-Birry et al., 1997). The incidence of
GMH increases with the degree of prematurity (Kadri et al., 2006),
suggesting that advances in perinatal care that yield concomitant
increases in the number of extremely premature infants will
continue to be hampered by complications of GMH. At present, no
effective prevention is available.
[0412] Hypoxia/ischemia in rodent and human CNS, both in utero (Xia
et al., 1993) and in adults (Simard et al., 2006; Simard et al.,
2008), results in upregulation of sulfonylurea receptor 1 (SUR1).
Under pathological conditions, SUR1 upregulation is associated with
formation of SUR1-regulated NC.sub.Ca-ATP channels, not K.sub.ATP
channels (Simard et al., 2006; Simard et al., 2008; Simard et al.,
2007). Expression of SUR1-regulated NC.sub.Ca-ATP channels in
capillary endothelium has been causally implicated in progressive
secondary hemorrhage in CNS, with block of these channels by
infusion of low-dose (non-hypoglycemogenic) glibenclamide
(glyburide) completely preventing secondary hemorrhage (Simard et
al., 2007). Here, in certain embodiments, this channel is induced
in the GM by hypoxia/ischemia, and thereby predisposes one to GMH.
As an initial attempt to assess this embodiment, expression of the
regulatory subunit of the channel, SUR1, and its transcriptional
antecedent, hypoxia inducible factor 1 (HIF1) was studied (Bhatta,
2007) in postmortem tissues of premature infants who either were at
risk for or who sustained GMH. The findings are consistent with the
embodiment that the SUR1-regulated NC.sub.Ca-ATP channel is
causally linked to GMH.
Methods
[0413] Specimens from premature infants without and with clinically
diagnosed GMH were obtained from the Brain and Tissue Bank for
Developmental Disorders, University of Maryland, Baltimore, with
the collection protocol, including informed consent, reviewed and
approved by the Institutional Review Board of the University of
Maryland at Baltimore. The post-mortem interval was 3-24 hr. Cases
were selected for study based either on: (i) the documented
presence of GMH/IVH at autopsy or (ii) documented absence of GMH
(used as "best-available" controls). Independent histological
validation of presence or absence of GMH was made in all cases (see
Table 1). In all but one case, the cause of prematurity was preterm
rupture of membranes, with some cases also documenting
chorioamnionitis by pathological examination of the placenta, and
one case (without GMH) being induced for cardiac anomaly. The cause
of death was extreme prematurity in all but two cases, with the
others being listed as amniotic fluid aspiration syndrome or
elective termination.
TABLE-US-00001 TABLE 1 Summary of exemplary cases examined.
Gestational HIF1 Age @ Hemorrhage* protein SUR1 SUR1 birth
Hemorrhage in in protein protein Case # (weeks) clinically H&E
section cells** in cells.sup..sctn. in veins.sup. 1 19 none none +
+++ 0 2 19 none none ++ + 0/+ 3 22 none none ++ +++ + 4 22 none
none +++ ++ + 5 22 none none +++ + +/++ 6 23 none microscopic ++ +
+/++ 7 24 none microscopic +++ +++ +/++ 8 24 grade 1 grade 1 +++
+++ ++++ 9 22 grade 1 grade 1 ++++ ++++ ++++ 10 24 grade 2/3 none
++++ ++++ ++++ 11 30 grade 2/3 grade 1 +++++ +++ ++++ 12 23 grade
2/3 grade 2/3 +++++ ++ +++ *clinical information was available only
on "intraventricular hemorrhage" without differentiating further
into grade, hence the designation, grade 2/3; some discrepancies in
clinical vs. histological evaluation of hemorrhage may be due to
histological evaluation of the GM contralateral to the side of
hemorrhage, which available data were insufficient to resolve
**scale for HIF1 immunolabeling in progenitor cells within the GM:
+, present in most cells, similar in intensity to some distant
neurons; ++, present in most cells, somewhat more intense than in
neurons; +++, present in most cells, definitely more intense than
in neurons; ++++, present in all cells, more intense than in
neurons; +++++, present in all cells, many with very intense
labeling .sup..sctn.scale for SUR1 immunolabeling, in progenitor
cells within the GM: +, present in few single cells; ++, present in
a moderate number of scattered cells; +++, present in patches or
groups of cells; ++++ present in most cells scale for SUR1
immunolabeling in veins within the GM: 0, none; +, in 1-2 veins;
++, in a few veins; +++, in many veins; ++++, in nearly all
veins.
[0414] GM tissues and associated hemorrhages, when present, were
dissected from coronal slices of formalin-fixed cerebral
hemispheres. Cryosections and paraffin-embedded sections were
prepared. Sections were stained with hematoxylin and eosin
(H&E) or were immunolabeled using primary antibodies directed
against SUR1 (C-16; Santa Cruz Biotechnology Inc.; diluted 1:200; 1
hr at room temperature (RT), 48 hr at 4.degree. C.), or
HIF-1.alpha. (SC-10790; Santa Cruz; 1:100), or von Willebrand
factor (F-3520; Sigma; 1:200). CY-3 or FITC conjugated secondary
antibodies (Jackson Immunoresearch, West Grove, Pa.) were used.
Slides were cover slipped with ProLong Gold antifade reagent
containing 4',6-diamino-2-phenylindole (DAPI) for nuclear staining
(P36935, Invitrogen, Carlsbad, Calif.). For in situ hybridization,
digoxigenin-labeled probes (antisense,
5'-TGCAGGGGTCAGGGTCAGGGcGCTGTCGGTCCACTTGGCCAGCCAGTA-3'; SEQ ID
NO:4), designed to hybridize to nucleotides 3217-3264 located
within coding sequence of human Abcc8 gene (NM_000352; GenBank@
Accession number for the sequence, which is incorporated by
reference herein in its entirety), were supplied by GeneDetect
(Brandenton, Fla.). Hybridization was performed according to the
manufacturer's protocol, as previously described (Simard et al.,
2006).
Results
[0415] The germinal matrix appeared as a dense collection of small
cells located peri-ventricularly (FIG. 11A). In some cases,
evidence of a parenchymal hemorrhage was found (FIG. 11A,
arrow).
[0416] In situ hybridization for mRNA for Abcc8, which encodes
SUR1, showed regionally specific upregulation in the GM (FIGS. 11B,
11E) that was noticeably more prominent than in surrounding tissues
or in remote cortical tissues (FIG. 11D). Immunolabeling confirmed
regionally specific upregulation of SUR1 protein in the GM (FIG.
11C), with SUR1 protein located in neural progenitor cells in all
GM specimens examined (FIG. 11G). SUR1 protein was also identified
in veins from infants with GMH (FIGS. 11H, 11I), but was less
likely to be found in veins from infants without GMH (FIG. 11J).
Negative controls, including omission of primary antibody and use
of a blocking peptide, showed no immunolabeling for SUR1 (not
shown).
[0417] An important molecular antecedent of SUR1 is the
transcription factor, HIF1 (Bhatta, 2007), which is upregulated by
hypoxia (Wenger et al., 2005), a common condition associated with
prematurity. Immunolabeling for HIF1.alpha. showed that this
ubiquitous marker of hypoxia was prominently upregulated, with
characteristic nuclear localization, in all GM specimens examined
(FIGS. 11K-11M).
[0418] A semi-quantitative assessment was performed of HIF1.alpha.
and SUR1 expression in specimens from 12 premature infants, some of
whom had either clinical or histological evidence of GMH (Table 1).
All specimens showed HIF1 .alpha. expression, with all but one
showing more prominent expression in progenitor cells than in
remote neurons in the same tissue sections, supporting the
embodiment that physiologically meaningful hypoxia was present in
the GM of all of these cases. The most prominent expression of HIF1
.alpha. was found in specimens from infants with frank GMH. All
specimens showed SUR1 expression in progenitor cells. In 3
specimens, SUR1 was identified only in scattered cells, whereas in
most specimens, SUR1 expression was evident in contiguous sheets of
cells or in some cases, in nearly all cells. The clearest
distinction in SUR1 expression vis-a-vis GMH was in the veins of
the GM. In specimens without GMH, the veins typically exhibited
little to moderate SUR1 expression, as in FIG. 11J, whereas in all
specimens with frank GMH, all or nearly all veins exhibited strong
SUR1 expression, as in FIGS. 11H, 11I.
Significance of Certain Embodiments
[0419] Thus, expression of SUR1 is increased in neural progenitor
cells and in vascular endothelium of the GM of premature infants
who either are at risk for or who sustained GMH.
Immunohistochemical analysis of post-mortem tissues can sometimes
be complicated by non-specific binding of antibodies, especially if
necrosis is present. However, the specimens studied showed intact
cellular structures with H&E staining, as well as
regionally-specific immunolabeling of cellular and vascular
structures for SUR1 in the GM. Most importantly, in situ
hybridization was used to confirm that SUR1 was upregulated at the
mRNA level. Together, the two independent techniques using
molecularly distinct probes provide important corroborative
evidence that SUR1 was upregulated in GM tissues of premature
infants. Additional work is performed to demonstrate concomitant
upregulation of the pore-forming subunit of the channel (Simard et
al., 2008).
[0420] Pathophysiology. The pathophysiological antecedents of GMH
have been extensively discussed, but no fully encompassing theory
has been put forth to explain it. Considerable attention has been
focused on the structural weakness of GM microvessels (Wei et al.,
2000; Anstrom et al., 2004). However, it is evident that any innate
weakness of these vessels, by itself, would be insufficient to
cause GMH, since the same weakness exists during every gestation,
and most gestations are not complicated by GMH. Thus, an event must
transpire to weaken these vessels further and increase the
likelihood of their structural failure. In the premature brain, the
GM is at the terminal end of its afferent arteriolar supply
("ventriculopetal" vascular pattern) (Nakamura et al., 1994) and
therefore GM tissues and the vessels contained therein are highly
susceptible to global hypoxic/ischemic events. Apart from hypoxia
due to ventilatory abnormalities, one or more hypotensive episodes
may contribute to the overall hypoxic/ischemic burden that
adversely affects GM tissues. In addition, it is likely that yet
another hemodynamic stress must be applied to structurally
compromised vessels to cause an actual GMH. Because GMH most
frequently arises from veins (Nakamura et al., 1990; Ghazi-Birry et
al., 1997), it is thought that episodes of increased venous
pressure, as can occur with mechanical ventilation or airway
suctioning, may be important for triggering the actual structural
failure of weakened vessels that results in GMH.
[0421] Despite the important role of hypoxia/ischemia in producing
vascular changes that predispose to GMH, there is little
experimental evidence to elucidate the molecular mechanism
involved, either in animal models or in humans. The present
invention is the first report to show that the transcription
factor, HIF1, is upregulated in the GM of infants at risk. In many
organs including the CNS, hypoxia results in activation of HIF1,
which in turn stimulates the transcription of genes that are
essential for adaptation to hypoxia/ischemia, including genes
important for erythropoiesis, glycolysis and angiogenesis (Wenger
et al., 2005). HIF1 plays a critical role in expression of the
angiogenic factor, vascular endothelial growth factor (VEGF), which
is prominently upregulated in the GM of infants at risk (Ballabh et
al., 2007). Conversely, HIF1 also causes transcription of genes
with seemingly maladaptive effects (Simard et al., 2007) and, in
some settings, may promote ischemia-induced neuronal death (Chang
and Huang, 2006). HIF1 has not been extensively studied in the
premature infant brain, and a role for HIF1 has not previously been
suggested in the context of GMH. However, the localization of HIF1
with two of its important transcriptional targets, VEGF (Ballabh et
al., 2007) and SUR1 (Bhatta, 2007), in the GM of infants at risk
reaffirms the importance of this molecular response to hypoxia.
[0422] Events in the GM. Mild hypoxia activates quiescent neural
progenitor cells, resulting in their activation and differentiation
into neurons and glia, whereas severe hypoxia induces apoptotic
death in developing brain neurons (Pourie et al., 2006). Thus,
mild-to-moderate hypoxia, resulting from the position of the GM as
the distant-most tissue fed by a ventriculopetal blood supply
(Ballabh et al., 2007), may be involved not only in stimulating
neurogenesis from GM progenitor cells, but also in the normal
involution of the GM (FIG. 12). HIF1, the ubiquitous sensor of
hypoxia, may be a key molecular participant in both. Notably, the
same hypoxic signal working via HIF1 also leads to transcriptional
upregulation of SUR1 (Bhatta, 2007) and of SUR1-regulated
NC.sub.Ca-ATP channels (Simard et al., 2007). In all of the 12
cases studied, most of the progenitor cells exhibited both HIF1 and
SUR1, indicating that mild hypoxia may be a normal state in
germinal matrix parenchyma, and that this tissue may be normally
"primed" with SUR1. When the NC.sub.Ca-ATP channel is expressed in
response to an hypoxic stimulus, no adverse functional consequence
is expected, as long as intracellular ATP is maintained at
sufficient levels (>30 .mu.M) to keep the channel from opening
(Simard et al., 2008).
[0423] Under conditions of extreme duress, a normal hypoxic signal
may be magnified by one or more ischemic events, leading to more
profound hypoxia. Under such conditions, HIF1 activation and SUR1
expression would become more likely, especially in veins (FIG. 12).
Normally, cells of the vascular tree are less likely than
parenchymal cells to experience hypoxia, but under conditions of
extreme duress, when maximum extraction of O.sub.2 has already
occurred from hypoxic blood, venular cells will experience the
strongest hypoxic challenge. In the cases we studied, veins
generally were less likely to exhibit SUR1 than parenchymal cells,
but in cases with GMH, SUR1 expression was reliably found in most
veins--the very structures that are believed to be the source of
hemorrhage (Nakamura et al., 1990; Ghazi-Birry et al., 1997). When
ATP is depleted to critical levels, SUR1-regulated NC.sub.Ca-ATP
channels open, leading to oncotic cell death (Simard et al., 2006)
not only of progenitor cells but of vascular endothelial cells,
thereby further weakening thin walled, structurally compromised
veins. In this setting, increased venous pressure would almost
certainly cause extravasation of blood from damaged veins.
Petechial hemorrhages may enlarge to microhemorrhages or grade 1
GMH, or worse, depending on the severity and extent of GM tissues
involved. In specific embodiments, this sequence (FIG. 12), which
employs critical involvement of HIF1 and SUR1, accounts for
numerous observations and encompasses numerous hypotheses that have
been put forth to explain GMH.
[0424] Preventing GMH. Available strategies for preventing GMH are
limited. Currently, the most effective measures are those that
target the respiratory system (Cools and Offringa, 2005; Wright et
al., 1995). Vitamin E, phenobarbital, morphine, ibuprofen,
indomethacin, agents that target coagulation, and
magnesium/aminophylline have been tried, but are either ineffective
or their use remains controversial. In an animal model of GMH,
prenatal treatment with angiogenic inhibitors reduces the incidence
of GMH (Ballabh et al., 2007), but angiogenic suppression in
premature infants would be undesirable, since it could impair lung
maturation (Thebaud, 2007).
[0425] Novel treatment strategies are desperately needed to combat
GMH. Block of SUR1 using glibenclamide is such a treatment, in
particular aspects of the invention. Glibenclamide pretreatment in
humans is associated with significantly better outcomes from stroke
(Simard et al., 2008; Kunte et al., 2007), and constant infusion of
drug at doses below those that give hypoglycemia is highly
effective in preventing progressive secondary hemorrhage in the CNS
(Simard et al., 2007). The present example is consistent with the
embodiment that the SUR1-regulated NC.sub.Ca-ATP channel is
causally linked to GMH. In particular embodiments of the invention,
glibenclamide and other compounds that block the expression and/or
activity of the channel are useful in reducing the incidence of
this devastating complication of prematurity.
Example 15
Traumatic Brain Injury Embodiments
[0426] Traumatic brain injury (TBI) causes deficits in motor,
sensory, cognitive, and emotional functions. This debilitating
neurological disorder is common in young adults and often requires
life-long rehabilitation. A contusion injury to the brain is
typically aggravated by secondary injury, resulting in expansion of
the original lesion and concomitant worsening of neurological
outcome. Mechanisms of secondary injury are diverse and may include
cytotoxic processes, such as excitotoxicity, free radical damage,
apoptosis, inflammation, etc. In addition, secondary injury may
result from microvascular dysfunction, including ischemia, edema,
and "progressive secondary hemorrhage", a phenomenon wherein
capillaries gradually loose their structural integrity and become
fragmented, resulting in extravasation of blood and formation of
petechial hemorrhages. Whereas historically, ischemia and edema
have been targeted for treatment, progressive secondary hemorrhage
has not, simply because hemorrhage has not been viewed as being
preventable. However, blood is extremely toxic to neural tissues,
as it incites free radical formation and inflammatory responses
that are especially damaging to myelin of white matter tracks,
thereby worsening the overall neurological injury. Thus, if
secondary injury is to be minimized, it is important that
progressive secondary hemorrhage be reduced.
[0427] The inventor has discovered that the novel ion channel, the
SUR1-regulated NC.sub.Ca-ATP channel is highly relevant to
understanding secondary injury in TBI (Simard et al., 2008). This
channel is not constitutively expressed, but is expressed only
after injury to the CNS, with expression being particularly
prominent in endothelial cells of penumbral capillaries surrounding
the primary injury site (Simard et al., 2007). Originally, the work
indicated that an ischemic/hypoxic insult was required for de novo
expression (Simard et al., 2006), but recently, evidence was
obtained that this channel is also newly expressed following trauma
to the spinal cord (Simard et al., 2007) and brain (see below).
[0428] The NC.sub.Ca-ATP channel is unique (Simard et al., 2008).
It conveys monovalent but not divalent cations, it requires
intracellular Ca.sup.2+, and channel opening is triggered by
depletion of intracellular ATP. When opened, the channel
depolarizes the cell due to influx of Na.sup.+, drawing in Cl.sup.-
and water, leading to oncotic cell swelling and oncotic cell death.
When capillary endothelial cells undergo oncotic death, the
structural integrity of capillaries is lost, resulting in formation
of petechial hemorrhages. Of particular importance, this channel is
regulated by sulfonylurea receptor 1 (SUR1), just like pancreatic
K.sub.ATP channels. Unlike K.sub.ATP channels, whose opening leads
to hyperpolarization, opening of NC.sub.Ca-ATP channels leads to
cell depolarization. Opening of NC.sub.Ca-ATP channels is prevented
by the sulfonylurea, glibenclamide (glyburide), which protects
cells that express the channel from oncotic swelling and oncotic
death. In rodent models of stroke and spinal cord injury, systemic
administration of low-dose glibenclamide is highly neuroprotective
(Simard et al., 2006; 2007; 2008). In human diabetics who
coincidentally are taking sulfonylureas at the time of stroke,
outcomes are highly favorable compared to matched controls (Kunte
et al., 2007).
[0429] The inventor has obtained experimental data that indicate
that: (i) progressive secondary hemorrhage is prominent following
percussion-TBI, with hemorrhage doubling during the first 12-24 hr;
(ii) SUR1, the regulatory subunit of the channel, and TRPM4, the
pore forming subunit of the channel, are abundantly upregulated
post-TBI; (iii) progressive secondary hemorrhage can be
significantly reduced by low-dose glibenclamide; (iv)
glibenclamide-treatment is associated with significant neurological
and neurobehavioral functional improvement. Thus, in certain
embodiments of the invention, glibenclamide, for example, is useful
for preventing, ameliorating, and/or treating TBI.
[0430] In one embodiment, there is established a useful treatment
to reduce secondary injury related to microvascular dysfunction
post-TBI. Since glibenclamide (glyburide) is a safe drug that has
been used for over two decades to treat type 2 diabetes in humans,
providing treatment of TBI in humans that is critical to reducing
secondary injury and therefore optimizing rehabilitation
post-TBI.
[0431] In a specific embodiment as may be demonstrated in a rodent
model of TBI, properly timed treatment with the proper dose of the
SUR1 antagonist, glibenclamide, is believed to (i) minimize
secondary injury (formation of edema and secondary hemorrhage);
(ii) minimize lesion size, limiting it to the original site of
primary injury; and/or (iii) optimize neurofunctional, cognitive
and psychophysiological recovery. In another specific embodiment,
the time-course is determined for upregulation of the
glibenclamide-sensitive, SUR1-regulated NC.sub.Ca-ATP channel
following percussion-TBI. In an additional specific embodiment, the
time-window and optimal dose for treatment with glibenclamide is
determined.
[0432] In an additional embodiment, the therapeutic efficacy is
determined of glibenclamide in male and female rats using a
comprehensive battery of neurofunctional, cognitive and
psychophysiological tests assessed up to 6 months post-TBI, for
example.
TBI--the Clinical Problem
[0433] Each year, 1.5 million Americans sustain TBI. As a result of
these injuries, 50,000 people die, 230,000 people are hospitalized
and survive, and 80,000-90,000 people experience the onset of
long-term disability (Langlois et al., 2006; Thurman et al., 1999).
TBI is the leading cause of death and disability in children and
adults ages 1-44 years. As detailed above, warfighters and veterans
are also highly prone to suffer from TBI and its aftereffects
(Warden, 2006; Sayer et al., 2008). Overall, more than 5 million
Americans--2% of the U.S. population--currently live with
disabilities resulting from TBI. The consequences in terms of
physical impairments, functional limitations, disabilities,
societal restrictions, and economic impact are practically
immeasurable.
[0434] In spite of its importance to civilian and military
personnel, there is no effective therapy in clinical use that is
specifically directed towards ameliorating secondary brain injury
after trauma. An important reason for this unfortunate deficiency
in clinical care is an incomplete understanding of cellular and
molecular processes that underlie secondary brain injury. One
important area of deficiency concerns mechanisms of secondary
injury related to microvascular dysfunction, in particular,
progressive secondary hemorrhage.
TBI--Secondary Injury and Progressive Secondary Hemorrhage
(PSH)
[0435] The pathophysiology of TBI is complex and involves multiple
injury mechanisms that are spatially and temporally specific,
including both primary and secondary injury mechanisms. A
consistent pattern of cytotoxic and microvascular abnormalities can
be documented in the early posttraumatic period (Dietrich et al.,
1994) with many secondary injury mechanisms remaining active for
days to weeks after the primary insult. It is believed that by
successfully targeting one or more mechanism of secondary injury,
the burden of injury will be lessened, rehabilitation will be more
successful, and the overall outcome will improve pursuant to the
treatments and methods disclosed herein.
[0436] Numerous mechanisms of secondary injury have been
identified, including cytotoxic mechanisms involving
excitotoxicity, free radical production, apoptosis, inflammation
and others, as well as microvascular abnormalities responsible for
ischemia and edema (Bramlett and Dietrich, 2007; Raghupathi, 2004).
Notably, one pathophysiological process that is largely
unrecognized as a mechanism of secondary injury is "progressive
secondary hemorrhage" (PSH). Contusion of brain often results in
formation of intraparenchymal petechial hemorrhages (Dietrich et
al., 1994; Cortez et al., 1898; Oertel et al., 2002; Schmidt and
Grady, 1993). Formation of petechial hemorrhages has been
associated with small venules (Dietrich et al., 1994), but less
well appreciated is the fact that hemorrhages are frequently
complicated by "blossoming" or expansion (Cortez et al., 1989;
Oertel et al., 2002; Vajtr et al., 2008). Although sometimes
erroneously attributed to continued bleeding of vessels fractured
by the original trauma, this phenomenon actually represents a
secondary pathological process, as we have shown in spinal cord
injury (Simard et al., 2007). PSH occurs during the first several
hours after a traumatic insult. It results from progressive
catastrophic failure of the structural integrity of capillaries,
and is characterized by formation of small discrete satellite
(petechial) hemorrhages in tissues surrounding the site of primary
injury. With time, petechial hemorrhages increase in number and
eventually coalesce into a hemorrhagic lesion that encompasses the
entire site of primary injury. PSH is particularly damaging because
it greatly expands the volume of neural tissue destroyed by the
primary injury. The capillary dysfunction implicit with PSH causes
tissue ischemia and hypoxia, and the hemorrhage that characterizes
PSH is exquisitely toxic to CNS cells (Regan and Guo, 1998; Wang et
al., 2002), further injuring neural tissues due to oxidative stress
and inflammation. Together, these processes render PSH the most
destructive mechanism of secondary injury involving the CNS.
[0437] Two molecular mechanisms can potentially account for PSH:
(i) upregulation of matrix metalloproteinases (Vajtr et al., 2008;
Vilalta et al., 2008), (ii) upregulation of the capillary
endothelial SUR1-regulated NC.sub.Ca-ATP channel (see below and
Simard et al., 2007). Both occur post-TBI. In general, research has
identified various promising pharmacological compounds that
specifically antagonize many of the commonly identified secondary
mechanisms of injury that contribute to TBI. However, none
explicitly targets PSH post-TBI. In certain aspects, the role of
SUR1-regulated NC.sub.Ca-ATP channels is evaluated in PSH post-TBI
it is believed that glibenclamide has utility in reducing or
eliminating PSH post-TBI.
The SUR1-Regulated NC.sub.Ca-ATP Channel
[0438] Channel properties. The properties of the SUR1-regulated
NC.sub.Ca-ATP channel have been reviewed (Simard et al., 2007;
Simard et al., 2008; Simard et al., 2007). It is a 35 pS cation
channel that conducts inorganic monovalent cations, but is
impermeable to Ca.sup.2+ and Mg.sup.2+ (Chen and Simard, 2001).
Channel opening requires nanomolar concentrations of Ca.sup.2+ on
the cytoplasmic side, and is blocked by intracellular ATP
(EC.sub.50, 0.79 .mu.M). Like K.sub.ATP channels, SUR1-regulated
NC.sub.Ca-ATP channels are blocked by first and second generation
sulfonylureas, tolbutamide (EC.sub.50, 16.1 .mu.M) and
glibenclamide (EC.sub.50, 48 nM) (Chen et al., 2003). Recent work
has shown that the pore-forming subunit of the channel is TRPM4
(see below), (Simard et al., 2007), but at present, no high
affinity, high specificity drugs are available to block TRPM4.
[0439] Channel expression. The SUR1-regulated NC.sub.Ca-ATP channel
is not constitutively expressed, but is expressed in the CNS under
conditions of injury or hypoxia. The channel was first discovered
in reactive astrocytes obtained from the hypoxic inner zone of the
gliotic capsule post-stab injury and foreign body implantation
(Chen et al., 2001; Chen et al., 2003). Since then, it has been
identified using patch clamp electrophysiology in neurons from the
core of an ischemic stroke (Simard et al., 2006) and in cultured
human and mouse endothelial cells subjected to hypoxia (Simard et
al., 2007).
[0440] Apart from patch clamp recordings to demonstrate presence of
the channel, CNS tissues have been analyzed to detect the
regulatory subunit of the channel, SUR1, at protein and mRNA
levels. Normally, SUR1 is expressed in some neurons, but not in
astrocytes or capillaries. Post-injury, SUR1 is strongly
upregulated in several rodent models of CNS injury, including
models of cerebral ischemia (Simard et al., 2006), penetrating
brain injury with foreign body (Chen et al., 2003), and SCI (Simard
et al., 2007). Upregulation of SUR1 is found in all members of the
neurovascular unit, i.e., neurons, astrocytes and capillary
endothelial cells.
[0441] Channel function. The consequences of opening the
SUR1-regulated NC.sub.Ca-ATP channel have been studied in cells by
depleting ATP to mimic injury conditions. ATP depletion induces a
strong inward current that depolarizes the cell completely to 0 mV.
Cells subsequently undergo oncotic cell swelling (cytotoxic edema).
Eventually, ATP-depletion leads to cell death, predominantly by
non-apoptotic, propidium iodide-positive oncotic (necrotic) cell
death, which can be blocked by glibenclamide (Simard et al.,
2006).
Glibenclamide Block of SUR1--In Vivo Models of CNS Injury
[0442] The effect of glibenclamide was studied in rodent models of
ischemic stroke. In a model of malignant cerebral edema,
glibenclamide reduced mortality and cerebral edema (excess water)
by half (Simard et al., 2006). In a model of stroke induced by
thromboemboli, glibenclamide reduced lesion volume by half, and its
use was associated with cortical sparing that was attributed to
improved leptomeningeal collateral blood flow due to reduced mass
effect from edema (Simard et al., 2006).
[0443] The effect of glibenclamide was studied in a rodent model of
spinal cord injury (SCI) (Simard et al., 2007). Acutely, SCI
results in progressive secondary hemorrhage, characterized by a
progressively expansive lesion with fragmentation of capillaries,
hemorrhage that doubles in volume over 12 hr, tissue necrosis and
severe neurological dysfunction. Necrotic lesions are surrounded by
widespread upregulation of SUR1 in capillaries and neurons.
Following SCI, block of SUR1 by glibenclamide essentially
eliminates capillary fragmentation and progressive secondary
hemorrhage, is associated with a 3-fold reduction in lesion volume,
and results in marked neurobehavioral functional improvement.
[0444] Role of the channel in edema and hemorrhage. Edema and
progressive secondary hemorrhage are key mechanisms of secondary
injury post-TBI (Marmarou, 2007; Unterberg et al., 2004). Edema
resulting from TBI or ischemia can lead to raised ICP and brain
herniation. Early progressive hemorrhage occurs in almost 50% of
head-injured patients, usually following contusion injury, and it
too is associated with elevations in ICP (Oertel et al., 2002;
Smith et al., 2007; Xi et al., 2006).
[0445] Molecular mechanisms involved in cerebral ischemia,
including cytotoxic edema, vasogenic edema, and hemorrhagic
conversion were recently reviewed (Simard et al., 2007). Although
mechanisms are complex and not completely understood, evidence has
accumulated that SUR1-regulated NC.sub.Ca-ATP channels play a
critical role in each of these, and that block of the channel by
glibenclamide yields significant beneficial effects. To date, most
of the work has focused on brain ischemia and SCI, but strong data
presented below indicate that the same mechanisms are at play in
TBI.
Glibenclamide--Benefit in Human Stroke
[0446] An outcome analysis was carried out of patients with
diabetes mellitus (DM) hospitalized within 24 hr of onset of acute
ischemic stroke in the Neurology Clinic, Charite Hospital, Berlin,
Germany, during 1994-2000 (Kunte et al., 2007). After exclusions,
the cohort comprised 33 patients taking a sulfonylurea (e.g.,
glibenclamide) at admission through discharge (treatment group) and
28 patients not on a sulfonylurea (control group). The primary
outcome was a decrease in National Institutes of Health Stroke
Scale (NIHSS) of 4 points or more from admission to discharge or a
discharge NIHSS score=0, which is considered a "major neurological
improvement". The secondary outcome was a discharge modified Rankin
Scale (mRS) score of 2 or less, which signifies functional
independence. The primary outcome was reached by 36% of patients in
the treatment group and 7% in the control group (odds ratio=7.5 in
favor of sulfonylurea; P=0.007). The secondary outcome was reached
by 81.8% vs. 57.1% (odds ratio=3.4 in favor of sulfonylurea;
P=0.035).
[0447] In particular embodiments of the invention, secondary
hemorrhage and lesion expansion that develops over time following
percussion-TBI can be prevented by blocking NC.sub.Ca-ATP channels
with glibenclamide, and that by doing so, a substantial improvement
in neurofunctional outcome can be achieved.
Work on Rodent Model of Percussion-TBI
[0448] The model of percussion-TBI. The percussion-TBI model that
has been studied is an exemplary gravity-driven, parasagittal
mechanical percussion model similar to the gravity-driven,
parasagittal fluid percussion model (Thompson et al., 2005;
Fujimoto et al., 2004), except that the impact force is transmitted
via a blunt mechanical impactor instead of a fluid column. Unlike
typical weight drop devices that utilize a small diameter impactor
head with restricted penetration (Bullock et al., 1995; Suh et al.,
2000) in the model used by the inventor, TBI is created with an
impactor rod tipped with a 5-mm Teflon ball (4 gm total) activated
by vertical weight drop. Like fluid percussion, the model has
unrestricted penetration, disperses the force over an area of
.about.20 mm.sup.2 and transiently displaces a larger volume of
brain tissue than a small diameter impactor with restricted
penetration.
[0449] Young adult male Long-Evans rats, 240-280 gm, were studied.
Rats were anesthetized (Ketamine and Xylazine) and physiological
parameters including temperature and blood gases were maintained
within appropriate physiological ranges. With the head fixed in a
stereotaxic frame, a 6-mm circular craniectomy was created abutting
the sagittal and lambdoidal sutures. A posterior location was
chosen to emphasize damage to underlying hippocampus (Vink et al.,
2001; Floyd et al., 2002). The impactor was activated using a 10-gm
weight dropped from 10 cm, which produced a transient impact
pressure of 2.5-3 atm (FIG. 13). Sham controls underwent
craniectomy without percussion.
[0450] For some studies, the effect of treatment with glibenclamide
was assessed. Immediately after TBI, rats were implanted with
mini-osmotic pumps (Alzet 2002, 0.5 ml/hr; Durect Corporation,
Cupertino, Calif.) that delivered either vehicle (DMSO/saline) or
drug (glibenclamide, Sigma, in DMSO/saline) subcutaneously (Simard
et al., 2006; Simard et al., 2007). Pharmacokinetic analysis
indicated that 3 hr were required to achieve 90% steady-state serum
drug levels. The dose of glibenclamide delivered was 200 ng/hr,
which at 3 hr, resulted in a non-significant decrease in serum
glucose, from 236.+-.15 to 201.+-.20 (5-6 rats per group; p=0.19).
The dose of DMSO delivered was 40 nl/hr, which is 300 times less
than that associated with neuroprotection.
[0451] Mortality, pathology and behavior. The acute-stage outcome
(24 hr) produced in our percussion model with 2.5-3 atm transient
pressure was similar to reports with fluid percussion of 2.5-3 atm
(Thompson et al., 2005; Fujimoto et al., 2004; Dixon et al., 1987).
The mortality of 15% was similar (Dixon et al., 1987). As with
fluid percussion, a combined focal and diffuse injury was produced.
A hemorrhagic contusion was apparent at the site of percussion that
extended below the corpus callosum to involve much of the
ipsilateral hippocampus and deeper structures (FIGS. 14A-14B, and
15A-15E). There was significant cell and tissue loss in hippocampal
CA2/CA3 and hilus ipsilateral to the injury site (see FIGS.
19A,19C). Evidence of contralateral injury was also seen (FIG.
15B). Compared to sham controls, survivors exhibited marked
reduction in spontaneous movements, in startle response, in
exploratory movements in open field testing and much less frequent
vertical exploration in an open cylinder test (see FIG. 20).
[0452] SUR1 is upregulated in rats post-TBI. Rats were studied for
SUR1 expression. Montages of sections immunolabeled at 3 hr showed
little SUR1, but by 24 hr, SUR1 was prominent both ipsilaterally
and contralaterally (FIGS. 15A,15B). Co-immunolabeled sections
showed that newly expressed SUR1 co-localized with NeuN (neurons;
not shown) and with vonWillebrand factor or vimentin (capillaries;
FIGS. 15C,15D). Upregulation was confirmed with Western blots (FIG.
15E).
[0453] SUR1 is upregulated in humans post-TBI. To ascertain the
relevance of these observations to humans, we also studied SUR1
expression in biopsy specimens from patients who required
craniotomy for debridement/decompression 6-30 hr post-insult.
Immunohistochemistry for SUR1 and in situ hybridization for Abcc8,
which encodes SUR1, showed prominent upregulation in neurons and
microvessels in 2/2 patients studied with gunshot wound to the
brain (FIGS. 16A-16F) and in one patient with intracerebral
hematoma due to rupture of arteriovenous malformation (see Simard
et al., 2008). This is consistent with the methods and treatments
disclosed herein, and supports the use of SUR1 antagonists in the
treatment of human TBI patients.
[0454] In rat, progressive secondary hemorrhage manifests as an
increase in extravasated blood. Using the model of percussion-TBI,
data was obtained showing that the magnitude of the hemorrhage into
the brain increased progressively over the first 24 hr after
injury. Animals were sacrificed at 1/2, 6 and 24 hr after
percussion-TBI (n=3-5 rats per group). They were perfused with
heparinized saline to remove intravascular blood and portions of
brain encompassing the lesion were homogenized and processed using
Drabkin's reagent to convert hemoglobin to cyanomethemoglobin for
spectrophotometric measurements (Simard et al., 2007). Values rose
progressively over the first 24 hr, reaching half-maximum 5.2 hr
post-injury, and maximizing only .about.10 hr post-injury (FIGS.
17A-17C). The fact that secondary hemorrhage is progressive over
such a long period of time is seldom appreciated, but forms an
underlying rationale for directly attacking this severely harmful
cause of secondary injury post-TBI.
[0455] Block of SUR1 with glibenclamide reduces progressive
secondary hemorrhage. We assessed the effect of glibenclamide on
progressive secondary hemorrhage. As above, animals were sacrificed
at 1/2, 6 and 24 hr after percussion-TBI. Glibenclamide treatment
did not affect the volume of blood measured/2 hr post-injury,
indicated a comparable magnitude of injury between groups (FIGS.
17A-17C). However, glibenclamide prevented further increases in
blood that were observed at later times in vehicle-treated controls
(FIGS. 17A-17C). At 24 hr post-injury, tissue homogenates from
glibenclamide-treated animals were visibly less bloody that those
from vehicle-treated animals (FIGS. 17A-17C, insert). Overall,
these data indicate that glibenclamide was highly effective in
reducing progressive secondary hemorrhage post-TBI.
[0456] Glibenclamide effect on secondary hemorrhage is not due to
an effect on coagulation or to inhibition of MMP. In uninjured rats
given the same dose as above, glibenclamide had no effect on tail
bleeding time (19.3.+-.1.9 vs. 21.5.+-.3.1 sec; n=3-5; P=0.6).
[0457] In stroke, hemorrhagic conversion has been attributed to
activation of matrix metalloproteinases (MMP) (Justicia et al.,
2003; Lorenzl et al., 2003; Romanic et al., 1998). It was assessed
whether glibenclamide might be directly inhibiting MMPs. Zymography
of recombinant MMPs showed that gelatinase activity assayed in the
presence of glibenclamide was the same as that assayed without it,
although gelatinase activity was strongly inhibited by commercially
available MMP inhibitor II (FIG. 18). This finding makes it
unlikely that glibenclamide was acting directly via MMP inhibition
to decrease secondary hemorrhage post-TBI, and indicated instead
that a mechanism involving SUR1-regulated NC.sub.Ca-ATP channels in
capillary endothelium was likely to be involved, as we have shown
recently for SCI (Simard et al., 2007).
[0458] Block of SUR1 with glibenclamide reduces lesion size and
spares hippocampal neurons. The beneficial effect of glibenclamide
on progressive secondary hemorrhage was associated with a reduction
in lesion area on coronal sections at the epicenter of injury, from
8.2.+-.1.3 to 4.4.+-.0.8 mm.sup.2 (10 rats/group; P=0.025), at 7
days post-TBI (FIG. 19A versus FIG. 19B).
[0459] Niss1 stained sections also showed that glibenclamide
treatment was associated with sparing of hippocampus, including
sparing of neurons in CA1, CA3 and dentate gyrus regions (FIGS.
19A-19D). Neuronal loss, pyknotic cells and hemorrhages observed in
vehicle treated controls were much less likely to be seen with
glibenclamide treatment (FIGS. 19A-19D).
[0460] Block of SUR1 with glibenclamide improves neurobehavioral
function. The data included only simple testing of neurobehavioral
function. Spontaneous forelimb use (SFU) was quantified and
spontaneous vertical exploration (SVE) was quantified during 7 days
post-TBI. SFU measures sensorimotor asymmetry (Schallert et al.,
2000) whereas SVE measures not only vestibulomotor function but
also time spent in exploratory activity. At 2 days post-TBI,
glibenclamide treatment was associated with an increase in
spontaneous use of the forelimb contralateral to the injury from
3.5.+-.3.5% in controls to 16.5.+-.3.4% in the treatment group
(P=0.05). At 1, 2 and 7 days post-TBI, glibenclamide-treated rats
consistently exhibited significantly greater SVE scores than
controls (FIG. 20).
[0461] Transient receptor potential M4 (TRPM4) pores physically
associates with SUR1 and is upregulated in penumbral capillaries
post-TBI. The SUR1-regulated NC.sub.Ca-ATP channel is composed of
molecularly distinct regulatory and pore-forming subunits encoded
by different genes. SUR1 was previously identified as the
regulatory subunit (Simard et al., 2006; Chen et al., 2003) and it
is considered that TRPM4 forms the pore-forming subunit, based on
essentially identical biophysical properties of NC.sub.Ca-ATP and
TRPM4 channels (Simard et al., 2007). Co-immunoprecipitation
studies were carried out to examine the physical association
between SUR1 and TRPM4. Western blots showed that total lysate from
injured tissue exhibited abundant TRPM4 protein (FIG. 21, middle
lane), and that immunoprecipitation using anti-SUR1 antibody
yielded a product also identified as TRPM4 (FIG. 21, right lane),
confirming physical association between SUR1 and TRPM4. Moreover,
as with SUR1, TRPM4 is abundantly upregulated especially in
penumbral capillaries post-TBI (FIGS. 22A-22C). In certain aspects,
the temporal profile for SUR1 and TRPM4 mRNA and protein expression
post-TBI is determined.
[0462] Studies on isolation of brain microvascular complexes and
patch clamp of capillaries. Microvascular complexes were isolated
from normal (uninjured) rat brain using a method based on perfusion
with magnetic particles (details of method given below). Magnetic
separation yielded microvascular complexes that typically included
a precapillary arteriole plus attached capillaries (FIGS. 23A-23C).
As is evident from the image, unambiguous identification of
capillaries for precise positioning of the pipette for patch
clamping attached capillary endothelial cells is readily achievable
(FIG. 23A, arrows).
[0463] Capillary endothelial cells still attached to intact
microvascular complexes were patch clamped using a conventional
whole cell method. Cells were studied with standard physiological
solutions in the bath and in the pipette, including 2 mM ATP in the
pipette solution. Membrane currents showed time-dependent
activation (FIG. 23B) with a weakly rectifying current-voltage
(I-V) relationship that reversed near -50 mV (FIG. 23C). These
recordings demonstrate the feasibility of patch clamping freshly
isolated capillary endothelial cells still attached to intact
microvascular complexes from brain.
[0464] In certain embodiments of the invention, SUR1, which
regulates the novel NC.sub.Ca-ATP channel, is directly responsible
for critical pathological mechanisms of secondary injury, most
importantly, progressive secondary hemorrhage, and that by blocking
this channel with the highly potent and safe antagonist,
glibenclamide (glyburide), significant improvements in outcome can
be obtained post-TBI. Demonstrating these concepts advances
pharmaceutical treatments that greatly improves management of TBI
and improves existing strategies for rehabilitation. Modern
techniques of molecular biology, electrophysiology and
neurobehavioral may be employed, for example.
[0465] In one case, the time course for upregulation of the
molecular components of the channel as well as of functional
channels, which is required to define the time-window for
treatment, is determined. In another case, one can evaluate the
effect of channel inhibition on edema and hemorrhage using various
doses of glibenclamide beginning at various times post-injury, to
determine the allowable time-window and the optimal dose for
treatment. Finally, in an additional case, one can confirm the
therapeutic efficacy of glibenclamide in male and female rats using
a comprehensive battery of neurofunctional, cognitive and
psychophysiological tests assessed up to 6 months post-TBI.
[0466] The model of percussion-TBI. In certain aspects data were
obtained using a mechanical percussion device that was designed and
built, which produced injury forces (see FIG. 13) and yielded brain
damage (see FIGS. 14A and 14B) comparable to moderate-to-severe
fluid percussion (Thompson et al., 2005). Although the device
yielded quite reproducible results (FIGS. 14A, 14B, 17A, 19A are
from 4 different rats), fluid percussion injury (FPI) has long been
used and is widely accepted in TBI research (Thompson et al.,
2005). Although some injury parameters are better controlled using
a controlled cortical impact (CCI) device rather than a FPI device,
FPI is preferred over CCI, in certain cases, because CCI generally
produces a more focused injury compared with FPI and overall, TBI
is less severe with CCI compared to FPI (Obenaus et al., 2007).
Injuries produced by parasagittal FPI are more diffuse and,
importantly, are more likely to involve hippocampus. These
differences inevitably have implications with respect to behavioral
and functional outcomes (Fujimoto et al., 2004; Cernak, 2005).
[0467] Thus, a fluid percussion model, with a percussion pressure
of .about.3 atm may be used in studies as disclosed herein.
Controls undergo sham surgery (craniectomy without percussion).
Young adult (12 weeks) male (Objective 1-3) or female (Objective 3)
Long-Evans rats are suitable animals for use in the studies
disclosed herein.
[0468] Drug treatment following TBI. Typically, studies of drug
interventions post-TBI utilize one or more injections of drug
during the post-injury period. This technique yields plasma levels
of drug that can fluctuate widely between peaks and troughs,
depending on (usually unknown) pharmacokinetic parameters. A
constant infusion of drug is utilized, with the aim of achieving
constant occupancy of high-affinity receptors without potential
complications inherent with transiently excessive drug levels.
Thus, within 2-3 min of injury, mini-osmotic pumps (Alzet) are
implanted over the dorsal thorax to deliver either vehicle or drug
subcutaneously, with pumps fitted with "Lynch coils" to obtain any
desired delay in start of treatment. This technique has been
successfully employed in previous studies (Simard et al., 2006;
Simard et al., 2007).
[0469] For certain studies, glibenclamide was delivered at 200
ng/hr (no loading dose). For other studies, the effects of various
doses of glibenclamide, including use of a loading dose, are
characterized. The purpose is to mimic treatment that would be
implemented in humans, including use of a loading dose and constant
infusion, coupled with a delay in start of treatment. (One case use
i.p. and s.q. routes in rats instead of i.v., as would be used in
humans, for example.)
[0470] In certain embodiments of the invention, SUR1-regulated
NC.sub.Ca-ATP channels are upregulated in neurons and capillary
endothelial cells over several hours after TBI Previous work
identified SUR1 as the regulatory subunit of the NC.sub.Ca-ATP
channel (Simard et al., 2006; Simard et al., 2007; Chen et al.,
2003). New work has identified transient receptor potential
melastatin 4 (TRPM4) as the pore forming subunit. Thus, determining
the time course for channel upregulation post-TBI employs studying
expression of mRNA and protein for these two molecular components,
in certain cases. However, expression of subunits does not
necessarily assure expression of pathologically functional
channels. Therefore, full characterization of the time course of
channel expression also utilizes patch clamp experiments to
document the expression of functional channels in capillary
endothelial cells and neurons.
[0471] Specific embodiments on percussion-TBI indicate that SUR1
protein is upregulated 24 hr after injury in capillaries and
neurons. However, the beneficial effect of glibenclamide on
progressive secondary hemorrhage at 6 hr (FIGS. 17A-17C) indicates
that channels are upregulated much earlier than 24 hr. Indeed,
previous work in stroke indicated that SUR1 itself, as well as
functional SUR1-regulated NC.sub.Ca-ATP channels are upregulated in
neurons as early as 2-3 hr after onset of ischemia (Simard et al.,
2006). Channel upregulation in neurons and astrocytes is thought to
be critical for cytotoxic edema, whereas channel upregulation in
capillary endothelial cells is thought to be critical for ionic
edema, vasogenic edema and hemorrhagic conversion (Simard et al.,
2007). Understanding the time course for channel expression in
different cell types is crucial for determining the treatment
window for glibenclamide.
Overview of Studies
[0472] In certain cases, the time course for upregulation of
NC.sub.Ca-ATP channels following percussion-TBI is determined. This
utilizes three exemplary series of studies. First, Western blots
are used to measure the increase in SUR1 and TRPM4 protein and qPCR
is used to measure the increase in mRNA for SUR1 and TRPM4. The
qPCR experiments provide direct confirmation of involvement of
transcription, and also indirectly validate the Western blot
studies. As regards specificity of antibody, it was previously
shown that the anti-SUR1 antibody to be used for Westerns (and
immunochemistry, see below) exhibits a high degree of specificity
for SUR1, and labels only a single band (180 kDa) in the range
between 116-220 kDa (simard et al., 2006). Secondly, it is
determined which cells are actually upregulating transcriptional
expression of SUR1 and TRPM4. This is done using double
immunolabeling experiments, with validation provided at the mRNA
level using in situ hybridization. Third, it is determined whether
newly upregulated SUR1 and TRPM4 are associated with functional
NC.sub.Ca-ATP channels, which employs patch clamp experiments.
Experimental Design:
[0473] Time-course for SUR1 and TRPM4 protein and mRNA, using
Westerns and qPCR
[0474] SUR1 and TRPM4 protein is measured in 7 groups of animals:
in controls (sham surgery) and in animals with .about.3 atm
percussion-TBI at 6 times after injury, at 3/4, 1.5, 3, 6 12, 24
hr. Blots are stripped and re-blotted for Kir6.1 and Kir6.2, to
show non-involvement of K.sub.ATP, as previously (Simard et al.,
2006). Each of the seven groups requires 3 rats per group.
[0475] SUR1 and TRPM4 mRNA are measured in 7 groups of animals: in
controls (sham surgery) and in animals with .about.3 atm
percussion-TBI at 6 times after injury, at %, 1.5, 3, 6 12, 24 hr.
Each of the seven groups require 3 rats per group. (NB: separate
groups are required for protein and mRNA because tissues are
processed differently)
[0476] Specific Methods:
[0477] Preparation of tissues. After death, animals are perfused
with heparinized saline to remove blood from the intravascular
compartment. For the qPCR experiments, the perfusion solution
includes RNA later (Ambion, Auston Tex.), to prevent RNA
degradation and optimize quantification. The injured left
hemisphere is sectioned to include 5 mm rostral and 5 mm caudal to
the impact site (2.times.impact diameter), with sampling including
parietal lobe and underlying tissues, including hippocampus.
Harvested tissues are flash frozen in liquid nitrogen and stored at
-80.degree. C. until processed.
[0478] Western blots. Lysates of whole tissues are prepared by
homogenizing in RIPA lysis buffer, and electrophoretic gels
(NuPAGE.RTM. 3-8% Tris-Acetate gels; Novex, Invitrogen, Carlsbad,
Calif.) are processed as described (Perillan et al., 2002). Blots
are analyzed for SUR1 (SC-5789; Santa Cruz Biotechnology), TRPM4
(SC-27540; Santa Cruz), Kir6.1 or Kir6.2 (Santa Cruz). Membranes
are stripped and re-blotted for .beta.-actin (1:5000; Sigma), which
is used as loading control. Detection is carried out using the ECL
system (Amersham BioTBIences, Inc.) with routine imaging (Fuji
LAS-3000) and quantification (Scion Image, Scion Corp, Frederick,
Md.).
[0479] The specificity of the SUR1 antibody has been documented
(Simard et al., 2006). The specificity of the Kir6.x antibodies is
confirmed with Western blots on insulinoma RIN-m5f cells (Kir6.2)
and rat heart (Kir6.1). The specificity of the TRPM4 antibody using
TRPM4 heterologously expressed in COS-7 cells is confirmed.
[0480] qPCR. Lysates of whole tissues are prepared by homogenizing
in RNA lysis buffer (Promega). There is reverse transcription of 1
.mu.g of total RNA (normalized conditions) with random
hexonucleotides according to the manufacturer's protocol (Applied
Biosystems) and real-time PCR reactions with an ABI PRISM 7300
Sequence Detector System (Applied Biosystems) are performed using a
TaqMan based protocol in a 96-well plate format. Taq Man probes and
primers are selected with Primer Express 2.0 (Applied Biosystems)
software and synthesized by Applied Biosystems. Primer sequences:
H1 histone family member (housekeeping gene): CGGACCACCCCAAGTATTCA
(forward) (SEQ ID NO:5); GCCGGCACGGTTCTTCT (reverse) (SEQ ID NO:6);
CATGATCGTGGCTGCTATCCAGGCA (SEQ ID NO:7) (TaqMan Probe).
rSUR1(NM_013039.1): GAGTCGGACTTCTCGCCCT (forward) (SEQ ID NO:8);
CCTTGACAGTGGACCGAACC (reverse) (SEQ ID NO:9);
TTCCACATCCTGGTCACACCGCTGT (SEQ ID NO:10) (TaqMan Probe); rTRPM4
(XM_574447): AGTTGAGTTCCCCCTGGACT (forward) (SEQ ID NO:11);
AATTCCAGTCCCTCCCACTC (reverse) (SEQ ID NO:12). Amplification
reactions are performed using a TaqMan amplification kit (Applied
Biosystems) according to the manufacturer's protocol, in 25 .mu.l
of reaction volume with 2 .mu.l of cDNA. The amplification program
consists of a 5-min holding period at 95.degree. C., followed by 40
cycles of 95.degree. C. for 30 sec, 60.degree. C. for 30 sec and
72.degree. C. for 30 sec. Relative quantification is performed
using a standard curve method (User Bulletin #2, PE Applied
Biosystems). All samples are run in triplicate.
[0481] Statistical analysis: Means will be compared using
ANOVA.
Cellular Localization, Using Immunohistochemistry and In Situ
Hybridization, for SUR1 and TRPM4.
[0482] In these studies, SUR1 and TRPM4 are the focus, but now with
the intent of determining the cell types responsible for SUR1 and
TRPM4 upregulation. For this, one can perform double immunolabeling
experiments, labeling neurons with NeuN, astrocytes with GFAP, and
capillary endothelial cells with vonWillebrand factor and vimentin
(Schnittler et al., 1998). Also, one can perform in situ
hybridization experiments to further validate the SUR1 and TRPM4
immunohistochemistry.
[0483] Immunolabeling is performed for SUR1 and TRPM4 plus double
labeling for a cell-specific marker (NeuN, GFAP, vimentin, vWf) in
7 groups of animals: in controls (sham surgery) and in animals with
.about.3 atm percussion-TBI at 6 times after injury, at %, 1.5, 3,
6 12, 24 hr. Each of the seven groups may include, for example, 3
animals/group.
[0484] Confirmatory in situ hybridization studies are performed for
SUR1 mRNA in 4 groups of animals: in controls (sham surgery) and in
animals with .about.3 atm percussion-TBI at 3 times after injury,
at 1.5, 6 and 24 hr. These studies can utilize tissues from the
same rats as used for immunolabeling.
[0485] Specific Methods:
[0486] Preparation of tissues. After death, animals are perfused
with heparinized saline to remove blood from the intravascular
compartment followed by 4% paraformaldehyde. The brain is
harvested, cut to include 5 mm rostral and 5 mm caudal to the
impact site. The brain is cryoprotected using 30% w/v sucrose.
[0487] Immunohistochemistry. Cryosections are used for double
immunolabeling (SUR1+NeuN, SUR1+GFAP; SUR1+vWf) or (TRPM4+NeuN,
TRPM4+GFAP; TRPM4+vWf), using standard techniques (Chen et al.,
2003). After permeabilizing (0.3% Triton X-100 for 10 min),
sections are blocked (2% donkey serum for 1 hr; Sigma D-9663), then
incubated with primary antibody directed against SUR1 (1:200; 1 hr
at room temperature then 48 h at 4.degree. C.; SC-5789; Santa Cruz
Biotechnology) or TRPM4 (1:200 overnight at 4.degree. C.; Santa
Cruz). After washing, sections are incubated with fluorescent
secondary antibody (1:400; donkey anti-goat Alexa Fluor 555;
Molecular Probes, OR). For co-labeling, one can use primary
antibodies directed against NeuN (1:100; MAB377; Chemicon, CA);
GFAP (1:500; CY3 conjugated; C-9205; Sigma, St. Louis, Mo.);
vonWillebrand factor (1:200; F3520, Sigma) vimentin (1:200; CY3
conjugated; C-9060, Sigma) and, as needed, species-appropriate
fluorescent secondary antibodies. Fluorescent signals are
visualized using epifluorescence microscopy (Nikon Eclipse
E1000).
[0488] In situ hybridization. Fresh-frozen sections are post-fixed
in 5% formaldehyde for min. Digoxigenin-labeled probes (SUR1:
antisense: '5-GCCCGGGCACCCTGCTGGCTCTGTGTGTCCTTCCGCGCCTGGGCATCG-3'
(SEQ ID NO:13); TRPM4: (antisense:
'5-CCAGGGCAGGCCGCGAATGGAATTCCCGGATGAGGCTGTAGCGCTGCG-3' (SEQ ID
NO:14); GeneDetect)") are designed and supplied by GeneDetect
(Brandenton, Fla.) and hybridization is performed according to the
manufacturer's protocol (Simard et al., 2006; Simard et al.,
2007).
Channel Function Using Patch Clamp Electrophysiology on Isolated
Cells
[0489] It is determined electrophysiologically whether upregulated
SUR1 and TRPM4 subunits form functional NC.sub.Ca-ATP channels in
capillary endothelial cells and neurons. The salient biophysical
features of the channel (Simard et al., 2008) include: (i) the
channel conducts Cs.sup.+, so that recordings with Cs.sup.+ as the
only permeant cation unambiguously distinguish between
SUR1-regulated NC.sub.Ca-ATP channels and SUR1-regulated K.sub.ATP
channels; (ii) the channel is regulated by SUR1, so that block of a
Cs.sup.+ conductance by low concentrations of glibenclamide
identifies the channel with virtual certainty.
[0490] The data on TBI indicate that glibenclamide is highly
effective in reducing progressive secondary hemorrhage. In certain
aspects, this high potency reflects not only the high affinity of
the drug at the receptor (EC.sub.50=48 nM at neutral pH, 6 nM at pH
6.8) (Chen et al., 2003), but also the fact that ischemic or
injured tissues are at lower pH (.apprxeq.6.5), 42 coupled with the
relatively acidic pKa of glibenclamide (6.3), resulting in greater
lipid solubility and thus greater tissue concentration of the
compound in ischemic regions. This is tested directly.
[0491] Cell isolation is performed twice weekly, with each batch of
freshly isolated cells studied over the course of 2 days, allowing
patch clamp experiments .about.4 days/week.
[0492] Specific Methods:
[0493] Isolation of brain microvessels with attached capillaries.
The method used (see FIGS. 23A-23C) is adapted from Harder et al.
(1994) Tissues are prepared at 3-5 hr post-TBI. A rat undergoes
transcardiac perfusion of 50 ml of heparinized PBS containing a 1%
suspension of iron oxide particles (10 .mu.m; Aldrich Chemical
Co.). The contused brain is removed, the pia and pial vessels are
stripped away, the tissue is minced into pieces 1-2 mm3 with razor
blades. Tissue pieces are incubated with dispase II (2.4 U/ml;
Roche) for 30 min with agitation in the incubator. Tissues are
dispersed by trituration with a fire-polished Pasteur pipette.
Microvessels are adhered to the sides of 1.5 ml Eppendorf tubes by
rocking 20 min adjacent to a magnet (Dynal MPC-S magnetic particle
concentrator; Dynal Biotech, Oslo, Norway). Isolated microvessels
are washed in PBS.times.2 to remove cellular debris and are stored
at 4.degree. C. in physiological solution (Harder et al., 1994).
For patch clamp study of capillary cells, an aliquote of
microvessels is transferred to the recording chamber, and using
phase contrast microscopy, capillaries near the end of the
visualized microvascular tree are targeted for patch clamping.
[0494] Isolation of neurons. Neurons are isolated from vibratome
cut brain sections as we described. 2 Tissues are prepared at 3-5
hr post-TBI. The brain is removed and vibratome sections (300
.mu.m) are processed as described (Hainsworth et al., 2001) to
obtain single neurons for patch clamping. Selected portions of
slices are incubated at 35.degree. C. in HBSS bubbled with air.
After 30 min, the pieces are transferred to HBSS containing 1.5
mg/ml protease XIV (Sigma). After 30-40 min of protease treatment,
the pieces are rinsed in enzyme-free HBSS and mechanically
triturated. For controls, cells were utilized from sham animals.
Cells are allowed to settle in HBSS for 10-12 min in a plastic
Petri dish mounted on the stage of an inverted microscope. Large
and medium-sized pyramidal-shaped neurons are selected for
recordings.
[0495] Patch clamp electrophysiology. Numerous papers present
detailed accounts of the patch clamp methodologies that may be use,
including whole-cell, inside-out, outside-out and perforated patch
methods (Chen et al., 2001; Chen et al., 2003; Perillan et al.,
2002; Perillan et al., 1999; Perillan et al., 2000).
[0496] The overall design of the studies follows a strategy
previously used with reactive astrocytes and neurons for
characterizing the NC.sub.Ca-ATP channel (Simard et al., 2006; Chen
et al., 2001; Chen et al., 2003). Initial studies are carried out
using a whole-cell perforated patch configuration to characterize
macroscopic currents, and to test the overall response to ATP
depletion induced by exposure to the mitochondrial poisons, Na
azide or Na cyanide/2-deoxyglucose, as used in previously (Simard
et al., 2006; Simard et al., 2007; Chen et al., 2001). This
configuration is also useful for characterizing the response to the
SUR1 activators: if the cell expresses NC.sub.Ca-ATP channels,
diazoxide activates an inward current that reverses near zero
millivolts, whereas if the cell expresses K.sub.ATP channels,
diazoxide activates an outward current that reverses near -70
mV.
[0497] Additional characterization is carried out using inside-out
patches for single channel recordings. This method makes it simpler
to study endothelial cell patches, which can thus be obtained from
either intact isolated capillaries or from single isolated
endothelial cells. In addition, this method allows precise control
of Ca.sup.2+, H.sup.+ and ATP concentrations on the cytoplasmic
side, and for this reason is preferable to whole-cell recordings.
Also, as previously shown (Chen et al., 2003), in this
configuration anti-SUR1 antibody binds to the channel and inhibits
glibenclamide action, making positive, antibody-based
identification of the channel readily feasible during the patch
clamp study.
[0498] The single channel slope conductance is obtained by
measuring single channel currents at various membrane potentials
using Na.sup.+, K.sup.+ and Cs.sup.+ as the charge carrier, at
different pH's including pH 7.9, 7.4, 6.9 and 6.4.
[0499] The probability of channel opening (nP.sub.o) is measured at
different concentrations of intracellular calcium
([Ca.sup.2+].sub.i), at different pH's including pH 7.9, 7.4, 6.9
and 6.4. The NC.sub.Ca-ATP channel in astrocytes is regulated by
[Ca.sup.2+].sub.i, a unique feature that distinguishes the
NC.sub.Ca-ATP channel from K.sub.ATP channel.
[0500] The concentration-response relationship is measured for
channel inhibition by AMP, ADP, ATP at pH 7.9, 7.4, 6.9 and 6.4.
There is a potentially important interaction between hydrogen ion
and nucleotide binding that may also be very important in the
context of ischemia.
[0501] The concentration-response for channel inhibition by
glibenclamide is studied. The effect of glibenclamide will be
studied at different pH's (7.9, 7.4, 6.9 and 6.4). The importance
of these studies is several-fold. Pharmacological data at neutral
pH are critical to characterizing the channel and for comparison
with the channel in astrocytes. Values for half-maximum inhibition
by sulfonylureas provide useful information on involvement of SUR1
vs. other SUR isoforms and other potential targets. As discussed
above, because glibenclamide and other sulfonylureas are weak
acids, they are more lipid soluble at low pH and thus can be
expected to access the membrane more readily at low pH. See
detailed discussion and the effect of pH on channel inhibition by
glibenclamide in citation (Simard et al., 2008).
[0502] Statistical analysis. Means are compared using ANOVA.
[0503] In certain embodiments of the invention, SUR1 and TRPM4 are
progressively upregulated at both the protein and mRNA levels in
the region of percussion during the initial few hours post-injury,
that upregulation is prominent in neurons and capillary endothelial
cells, and that upregulation requires several hours to reach a
maximum. Moreover, in specific embodiments SUR1 and TRPM4
upregulation are associated with formation of functional
NC.sub.Ca-ATP channels and that Kir6.x pore forming subunits are
not involved.
[0504] Early treatment with the proper dose of the SUR1 antagonist,
glibenclamide, minimizes formation of edema and progressive
secondary hemorrhage, and glibenclamide shifts the injury-magnitude
vs. response curve to the right, in specific embodiments. There is
data showing a strong salutary effect of glibenclamide when
treatment is begun immediately after percussion-TBI. The findings
indicate that this drug is useful. Doses of drug and timing of drug
administration is optimized.
[0505] The endpoints for study, edema and secondary hemorrhage, are
reliably quantified by measuring extravasated sodium and
hemoglobin. The choice of these measures reflects the embodiment
that edema and secondary hemorrhage are reliable, quantifiable
indicators of lesion severity in the acute phase, and correlate
well with lesion size and neurobehavioral performance assessed at
later times, in certain cases.
Overview of Studies:
[0506] In a specific embodiment the effect of glibenclamide on
edema and hemorrhage is determined when dosing and timing are
varied. For these studies, rats re subjected to .about.3 atm
percussion-TBI; 4 different time delays (0-6 hr) before
administration of one dose of drug ("dose2", see below) are
studied, and 4 different doses of drug when drug is administered
with a 2-hr delay are studied Each animal is evaluated for edema
(sodium) and hemorrhage (hemoglobin) at 24 hr post-injury, at which
time hemorrhage has maximized (see FIGS. 17A-17C).
[0507] Experiments useful to assess the effect and extent of
glibenclamide on shifting the injury-magnitude vs. response curve
for edema and for hemorrhage, separate groups of rats are studied
that are injured with different percussion pressures (.about.1,
.about.2, .about.3, .about.4 atm), and are treated with the "best
dose" of glibenclamide, as determined in the foregoing studies,
with no delay in treatment.
[0508] Experimental Design:
[0509] Using edema (sodium) and hemorrhage (hemoglobin) as
treatment endpoints, one can measure the effect of treatment with
glibenclamide, starting at various times after injury (0-6 hr) and
with various doses (4 different doses) of glibenclamide
[0510] One can study 11 groups of male rats with percussion-TBI,
with 8 rats/group, as follows, for example:
TABLE-US-00002 1. 0-hr delay/vehicle control 2. 0-hr delay/dose 2
3. 2-hr delay/vehicle control 4. 2-hr delay/dose 2 5. 4-hr
delay/vehicle control 6. 4-hr delay/dose 2 7. 6-hr delay/vehicle
control 8. 6-hr delay/dose 2 9. 2-hr delay/dose 1 10. 2-hr
delay/dose 3 11. 2-hr delay/dose 4
[0511] where:
[0512] dose1=loading dose, 2.5 .mu.g/kg, i.p.; infusion rate, 75
ng/hr, s.q.
[0513] dose2=loading dose, 5 .mu.g/kg, i.p.; infusion rate, 150
ng/hr, s.q.
[0514] dose3=loading dose, 10 .mu.g/kg, i.p.; infusion rate, 300
ng/hr, s.q.
[0515] dose4=loading dose, 20 .mu.g/kg, i.p.; infusion rate, 600
ng/hr, s.q.
[0516] vehicle control=DMSO (same amount as in dose2) in NS
[0517] These doses are calculated based on the following:
[0518] 1. the volume of distribution for glibenclamide (in humans)
is 0.2 L/kg. 48
[0519] 2. for the loading doses, the serum concentrations are 25,
50, 100, 200 nM, based on the EC.sub.50 value for channel
inhibition (6 nM at pH 6.83).
[0520] 3. lacking specific pharmacokinetic data for the rat, we
base our infusion doses on our previous experience with stroke
(Simard et al., 2006) and data with TBI (see above), which indicate
that an infusion rate of 75-200 ng/hr are an effective rate.
Overall, the data indicate that 75 ng/hr, which has definite
positive effects (Simard et al., 2006; Simard et al., 2008) is a
suitable low dose, and that higher doses are also suitable and may
be preferred.
[0521] 4. testing in uninjured rats as well as on rats with stroke
and SCI to determine the effect of these doses on serum glucose; of
the doses suggested above, only the highest are hypoglycemogenic,
but only mildly so. Notably, the loading doses of glibenclamide are
40-400 times less than typically used to induce hypoglycemia in
rats (bd Elaziz et al., 1998).
[0522] Power analysis was performed with the following assumptions:
.alpha.=0.05; tails=2; N=8/group; ratio for (raw difference between
population means)/(S.D. of one population)=2/1 (a conservative
assumption, as suggested by FIGS. 17A-17C). These values yield a
power of 96% likelihood of detecting a significant effect.
[0523] Specific Methods:
[0524] Delay of treatment: Mini-osmotic pumps are implanted within
2-3 min of TBI. The pumps are fitted with widely-used "Lynch-coil"
catheters that provide a dead space that requires the designated
amount of time to fill. At the designated time, animals are also
given the loading dose of glibenclamide i.p.
[0525] Monitoring serum glucose: serum glucose is be monitored
every 3-12 hr during the first 24 hr after injury using a tail
puncture to obtain a droplet of blood, and a standard glucometer
for glucose measurements, to assure that levels are near euglycemic
(80-160 mg/dL).
[0526] Preparation of tissues. After death, animals are perfused
with heparinized PBS to remove intravascular blood. A 10-mm thick
section of the upper half of the hemisphere encompassing the
contusion is harvested.
[0527] Edema and hemorrhage: Tissue sodium and hemoglobin are
measured in samples from the same homogenates. Sodium content is
measured by flame photometry, as described (Xi et al., 2001)
Hemoglobin (Hgb) is quantified spectrophotometrically after
conversion to cyanomethemoglobin using Drabkin's reagent (Choudhri
et al., 1997; Pfefferkorn and Rosenberg, 2003). This method has
been used by us for quantifying hemorrhage following SCI in rats
(Simard et al., 2007).
[0528] Data analysis: data obtained from vehicle-treated animals
are compared with data obtained from glibenclamide-treated animals.
Statistical significance is assessed using ANOVA.
[0529] Using edema (sodium) and hemorrhage (hemoglobin) as
treatment endpoints, the shift in the stimulus-response curve with
the "best dose" of glibenclamide administered without delay
post-injury is measured, in separate groups of rats injured with
different impact pressures (.about.1, .about.2, .about.3, .about.4
atm)
[0530] These studies are similar to those above, except that the
"best dose" of glibenclamide (determined above) administered
immediately after injury is used. The choice of percussion
pressures (.about.1, .about.2, .about.3, .about.4 atm), is based in
part on the literature for fluid percussion (Thompson et al.,
2005), and on experience with the magnitude of injury produced in a
model with 2.5-3 atm injury levels (see elsewhere herein).
[0531] Power analysis was performed with the following assumptions:
.alpha.=0.05; tails=2; N=8/group; ratio for (raw difference between
population means)/(S.D. of one population)=2/1 (a conservative
assumption, as suggested by FIGS. 17A-17C). These values yield a
power of 96% likelihood of detecting a significant effect.
[0532] Specific methods: same as above
[0533] In specific embodiments, glibenclamide is beneficial in
reducing edema and hemorrhage in the area of percussion, at least
for some doses and with some delay in treatment, and shifts the
injury-magnitude vs. response curve to the right, i.e., converts a
"severe" injury to a "moderate" injury.
[0534] In certain embodiments, serum glucose levels are monitored
to assure that they do not drop too low (less than about 80 mg/dL).
In embodiments, the protocols are amended to correct for
hypoglycemia, in order to maintain levels between 80-160 mg/dL.
[0535] In certain embodiments, in a rodent model of TBI, treatment
with the "best dose" of the sulfonylurea receptor antagonist,
glibenclamide, improves early sensorimotor and later cognitive and
psychophysiological performance, and reduce lesion size and
hippocampal neuronal cell loss. The foregoing studies are conducted
with terminal endpoints (animals sacrificed to measure edema and
blood in contused brain at 24 hr). One can perform measurements of
neurofunctional, cognitive and psychophysiological endpoints out to
6 months in separate groups of male and female rats. These studies
determine whether early treatment-related gains in edema and
hemorrhage translate into long-term functional gains. In addition,
these studies assess the role of gender in the response to
glibenclamide treatment.
[0536] Animal and human studies have shown that the response to CNS
injury is different in females and males, and that gender affects
behavioral performance (Bimonte et al., 2000; Gresack and Frick,
2003; LaBuda et al., 2002). It is ascertained whether any
difference in response to glibenclamide treatment exists between
male and female rats, in certain aspects of the invention.
[0537] In humans post-TBI, the goals and targets of rehabilitation
differ based on time post-TBI. Early-on after injury, acute
rehabilitation tends to focus on recovery of sensorimotor
dysfunction, locomotion, etc. Later on, after sensorimotor
abnormalities have stabilized, long term cognitive and
psychophysiological effects become more important targets of
rehabilitation. One can assess the animals for effects of treatment
with this time-frame in mind:
[0538] 1. During the early phase, the following are assessed: (i) a
strength/reflex test (NEUROLOGICAL SEVERITY SCORE); (ii)
vestibulomotor tests (ROTAROD TEST and SPONTANEOUS FORELIMB USE
TASK).
[0539] 2. Animals are then allowed to survive for 6 months, at
which time one can assess: (iii) a cognitive test (MORRIS WATER
MAZE LEARNING PARADIGM); (iv) fear conditioning test
(SUSCEPTIBILITY TO STRESS-INDUCED NONHABITUATING STARTLE).
[0540] This comprehensive range of testing includes sensorimotor
tasks, cognitive and as well as a psychophysiological outcome
measure potentially related to delayed-onset PTSD, (Garrick et al.,
2001; Cohen et al., 2004), a critical sequelae of TBI in humans
(Andrews et al., 2007; Carty et al., 2006).
[0541] Overview of Experiments:
[0542] The animals undergo .about.3 atm percussion-TBI, are
administered either vehicle or drug, and later are assessed for
neurofunctional and neurobehavioral recovery. One can use the "best
dose" of glibenclamide, as determined in studies referred to above,
and one can use two different treatment times--treatment starting
immediately post-injury and treatment starting with a 4-hr delay,
with both treatments lasting for 1 week. However, an important
purpose of the studies is to ascertain whether a 4-hr delay in
treatment is effective. In certain cases the start of treatment is
delayed in one group as long as possible after injury, in order to
most usefully simulate the human situation.
[0543] Neurofunctional recovery is assessed using established
sensorimotor tests during post-injury days 1-28 (Fujimoto et al.,
2004). Cognitive and psychophysiological tests are assessed at 6
months. Body weight is measured periodically. Histological and
stereological evaluation of brains, includes determining overall
lesion size as well as neuronal counts in CA(1)/CA(3) hippocampal
regions at 6 months." (Grady et al., 2003; Hellmich et al.,
2005).
[0544] (A) NEUROLOGICAL SEVERITY SCORE (NSS). This is an aggregate
neurological testing strategy (Fujimoto et al., 2004). In the
Neurologic Severity Score (see Table 5 of Fujimoto et al., 2004),
animals are scored on an all-or-none scale for such tests as the
ability to exit from a circle, righting reflex, hemiplegia, limb
reflexes, pinna reflex, corneal reflex, startle reflex, beam
balance, and beam walking. An animal receives one point for the
ability to successfully perform each task and no points for the
inability to perform, with the overall NSS being the sum of these
scores.
[0545] (B) ROTAROD TEST. (Hamm et al., 1994; Lu et al., 2003) The
rotarod task is a sensitive index of injury-induced motor
dysfunction. The rotarod task measures aspects of motor impairment
that are not assessed by either the beam-balance or beam-walking
latency, and has been found to be a more sensitive and efficient
index for assessing motor impairment produced by brain injury.
(Hamm et al., 1994) Frequency of evaluation can affect
performance--daily assessment promotes functional recovery whereas
weekly assessment does not significantly affect outcome in injured
animals during a 4-week assessment. (O'Connor et al., 2003).
[0546] (C) SPONTANEOUS FORELIMB USE TASK (SFU). This task measures
sensorimotor asymmetry. (Schallert et al., 2000) It involves
placing the animal in a plastic cylinder and determining the amount
of time the animal spends rearing with the left, right, or both
forelimbs on the cylinder wall. The cylindrical shape encourages
vertical exploration of the walls with the forelimbs and it allows
evaluation of landing activity. This test has been shown to be
effective in detecting an injury deficit up to five months after
controlled cortical impact in a mouse model. (Baskin et al., 2003).
In addition, quantification of time spent in vertical exploration
gives an overall measure of spontaneous activity.
[0547] (D) MORRIS WATER MAZE LEARNING PARADIGM (MWM) (Thompson et
al., 2006; Dixon et al., 1999; Sanders et al., 1999; Kline et al.,
2002). The MWM is the most widely used test for cognitive
evaluation in experimental TBI. (Fujimoto et al., 2004). Deficits
in learning have been detected up to 1 year post-injury in rats.
(Fujimoto et al., 2004).
[0548] (E) STRESS-INDUCED NONHABITUATING STARTLE. The interest in
the startle response is two-fold. First, it is known that
percussion-TBI in rats yields a depressed startle response that can
persist for over 30 days (Dixon et al., 1987; Lu et al., 2003;
Wiley et al., 1996) possibly reflecting the overall decrease in
spontaneous activity post-TBI. Thus, in its simplest form, the
startle response provides a good test of the effect of
glibenclamide treatment, with treatment expected to normalize or
partially normalize this response. Note that the simple startle
response in part of the NSS, is assessed during the early recovery
phase (first 28 days).
[0549] It is believed that TBI-induced limbic system damage
observed in percussion models of TBI may predispose the animal to
delayed psychophysiological abnormalities. Months after injury,
maladaptive "rewiring" of limbic circuitry is believed to give rise
to altered psychophysiological responses, e.g., an increase in the
susceptibility to non-habituating startle induced by new,
consciously-experienced stress. A link between injury to limbic
structures with increased susceptibility to non-habituating or
augmented sensorimotor responses, has been discussed by Harvey et
al., 2003, and is based on the observation of the important role of
the hippocampus in the extinction of conditioned fear. (Brewin,
2001). Thus, whereas early-on, TBI is believed to be associated
with depressed startle responses, later "recovery" from TBI is
surprisingly believed to be lower the threshold for the "intensity"
of a new stress (strength, duration or number of repetitions) that
is required to induce non-habituating startle.
[0550] The interest in non-habituating startle resides in its
potential relevance to post-traumatic stress disorder (PTSD). In
humans following exposure to trauma, a vulnerable sub-population of
individuals develops PTSD with characteristic persistent autonomic
hyper-responsivity, increased sensory arousal, increased startle
response, and altered hypothalamo-pituitary-adrenal regulation.
Often, onset of these symptoms is delayed. (Andrews et al., 2007;
Carty et al., 2006). Similar effects are seen in (uninjured) rats
in a rodent models of PTSD, in which the (awake) animal is exposed
to repeated, randomly applied, inescapable stress. The stress
paradigm used by Manion et al. (2007) consisted of 2-hr sessions of
immobilization and randomly applied tailshocks each day for 3 days.
Seven days later, the rats developed non-habituating startle.
Slightly different paradigms have been used by others (Garrick et
al., 2001; Garrick et al., 1997; Rasmussen et al., 2008). The
methods disclosed herein may be used to evaluate the effect of
glibenclamide on this phenomenon post-TBI. one can assess this
question, and evaluate the effect of glibenclamide on this
phenomenon post-TBI.
[0551] Experimental Design:
[0552] The effect of the "best dose" of glibenclamide administered
at two treatment times on neurofunctional, cognitive and
psychophysiological recovery is assessed in animals in times
extending out to 6 months after injury.
[0553] 8 groups are studied in all, 4 groups of males and 4 groups
of females; for each gender, there is one sham-injured group and
three TBI groups; the three TBI groups include a vehicle-treated
group, a group treated with the "best dose" glibenclamide given
immediately after injury, and a group treated with the "best dose"
glibenclamide given 4 hr after injury. The "best dose" is
determined from studies described above.
[0554] On any given day, 2 rats undergo TBI and then enter into a
schedule of comprehensive testing during the subsequent 4 weeks
(followed by 5 month recovery and more testing). Gender and
treatment group are randomly assigned.
[0555] Power analysis was performed with the following assumptions:
.alpha.=0.05; tails=2; N=12/group; ratio for (raw difference
between population means)/(S.D. of one population)=3/2 (worse case
scenario). These values yield a power of 94% likelihood of
detecting a significant effect.
[0556] Specific Methods:
[0557] Neurological severity score (NSS). The Neurologic Severity
Score is obtained as detailed in Table 5 of Fujimoto et al.
(2004).
[0558] FREQUENCY OF TESTING POST-TBI: Rats are tested on days 1, 3,
7, 14, 21, 28 post-TBI.
[0559] STATISTICAL TEST: Repeated measures ANOVA.
[0560] Rotarod test. The accelerating Rotarod test has been
described. Rats are trained for 3 consecutive days before TBI,
measuring latency to fall off the rod (10 trials/day).
[0561] FREQUENCY OF TESTING POST-TBI: Rats are tested on days 3, 7,
14, 21, 28 post-TBI. This schedule avoids the potential confounder
that frequent assessments tend to promote functional recovery
whereas weekly assessments do not (O'Connor et al., 2003).
[0562] STATISTICAL TEST: Repeated measures ANOVA.
[0563] Spontaneous forelimb use task (SFU). Rats are placed in a
clear cylinder (diameter, 20 cm; height, 20 cm) in front of a
mirror. Activity is videotaped for 5-30 min, depending on activity
levels. Scoring is done by an experimenter blind to the condition
of the animal using a VCR with slow motion and frame by frame
capabilities. Asymmetrical forelimb usage is counted. This consists
of recording: (1) the limb (left or right) used to push off the
floor prior to rearing; (2) the limb used for single forelimb
support on the floor of the box; and (3) the limb used for single
forelimb support against the walls of the box (Schallert et al.,
2000). Usage of both forelimbs simultaneously is not counted. Data
are expressed as percentage of right (unaffected by injury)
forelimb use, i.e. (right forelimb use/right+left forelimb
use)0100.
[0564] FREQUENCY OF TESTING POST-TBI: Rats are tested on days 3, 7,
14, 21, 28 post-TBI, during the same session with Rotarod.
[0565] STATISTICAL TEST: Repeated measures ANOVA.
[0566] Morris water maze learning paradigm (MWM). The MWM will be
used to measure acquisition of spatial learning (DeFord et al.,
2001; Hamm et al., 1993). A standard apparatus is used. At each
trial, rats are placed by hand in the pool at one of four start
locations (north, south, east, west) facing the wall. Start
locations are randomly assigned to each animal. A computerized
video tracking system is used to record the animal's latency to
reach the goal. The tracking program calculates the distance from
the animal to the goal during each trial (at 0.2 sec intervals) and
adds these distances together as a measure of how close the animal
is swimming to the goal during the trial. This measure is defined
as "cumulative distance from the goal." To assess for the possible
confounding effect of motor impairment, swim speeds are also
measured on each trial. Rats are given a maximum of 120 sec to find
the hidden platform. If an animal fails to find the platform after
120 sec, it is placed on the platform by the experimenter. Rats are
allowed to remain on the platform for 30 sec and then are returned
to a cage with a lamp warmer between trials. There is a 4-min
inter-trial interval. Animals are tested 6 months post-TBI to allow
for recovery of motor deficits. Rats were given four trials per day
for five consecutive days.
[0567] FREQUENCY OF TESTING POST-TBI: 4 trials/day on 5 consecutive
days, beginning 6 months post-TBI).
[0568] STATISTICAL TEST: Repeated measures ANOVA.
[0569] Stress-induced non-habituating startle (SINHS) (Manion et
al., 2007). Animals are acclimated to the acoustic startle
equipment for 3 consecutive days, one day without sound followed by
two days with sound. This acclimation is finished 3 days prior to
baseline recordings in order to avoid desensitization effects. A
baseline recording of acoustic startle response (details below) is
taken for each animal on the day prior to beginning the stress
procedure. Stress exposure consists of a 2-h per day session of
immobilization and tail-shocks for three consecutive days.
Stressing is done during the dark or active phase of the light-dark
cycle. Animals are restrained by being wrapped in a cloth jacket
and having their head and torso immobilized in a ventilated
plexiglass tube. Forty electric shocks (2-3 mA, 3 s duration;
programmable animal shocker, Coulbourn Instruments) are delivered
to their tails at semi-random intervals of 150-210 s.
[0570] ASR testing is conducted with a Startle Response Acoustic
Test System (San Diego Instruments). This system includes
weight-sensitive platform(s) in a sound-attenuated chamber. The
animal's movements in response to stimuli are measured as a voltage
change by a strain gauge inside each platform and are converted to
grams of body weight change following analog to digital conversion.
These changes are recorded by an interfaced computer as the maximum
response occurring within 200 ms of the onset of the
startle-eliciting stimulus. All acoustic stimuli are administered
by an amplified speaker mounted 24 cm above the test cage. During
testing, animals are individually placed in holding cages
(14.5.times.7.times.6.5 cm) that are small enough to restrict
extensive locomotion but large enough to allow the subject to turn
around and make other small movements.
[0571] Following placement of the animal into the chamber, the
chamber lid is closed, leaving the subject in darkness. A 3 min
adaptation period occurs in which no startle stimulus is presented.
Startle stimuli consist of 110 dB sound pressure level (unweighted
scale; re: 0.0002 dynes/cm2) noise bursts of 20 ms duration,
sometimes preceded by 100 ms with 68 dB, 1 kHz pure tones
(pre-pulses). Decibel levels are verified by a sound meter. Each
stimulus had a 2 ms rise and decay time such that onset and offset
are abrupt, a primary criterion for startle. There are four types
of stimulus trials: 110 dB alone, with pre-pulse, pre-pulse alone
and no stimulus. Each trial type is presented eight times. Trial
types are presented in random order to avoid order effects and
habituation. Inter-trial intervals range randomly from 15 to 25 s.
All animals are tested 1, 4, 7 and 10 days following the final day
of the stress procedure, which will begin 1 week after the MWM, 6
months post-TBI.
[0572] FREQUENCY OF TESTING POST-TBI: 1 trial/day on 13 consecutive
days, starting 1 week after MWM, 6 months post-TBI.
[0573] STATISTICAL TEST: Repeated measures ANOVA.
[0574] The effect of the "best dose" of glibenclamide administered
at two treatment times on lesion size and hippocampal neuronal
count at 6 months post-injury is assessed.
[0575] These experiments utilize the brains of animals injured and
treated in the earlier portion of this example, using tissues from
5 rats from each of the 8 treatment groups. Coronal sections (25
.mu.m) spaced 200 .mu.m apart throughout the injury area (5 mm
rostral and 5 mm caudal to the epicentre) are stained with Niss1
stain and adjacent sections are immunolabeled for NeuN
(Chemicon).
[0576] A stereological system is used for efficient, unbiased and
accurate measurements of lesion volumes and of counts of surviving
neurons in different treatment groups. Niss1 stained sections are
used to measure lesion size. NeuN-immunolabeled sections are used
to count neurons in ipsilateral and contralateral hippocampus (CA1,
CA3 and dentate gyrus). All quantitative analyses are performed
blindly. Using the Stereoinvestigator software (Microbrightfield,
Williston, Vt., USA), counts of neurons (450.times.450 .mu.m grids)
and neuronal profiles within 50.times.50 .mu.m counting frames
spaced evenly throughout the ipsilateral and contralateral
hippocampus are obtained using a 20.times. objective. Using
Stereoinvestigator software, serial reconstruction of the
ipsilateral and contralateral hippocampus are performed to compute
total volumes. To determine if the neurons are decreasing in size,
cross-sectional areas of hippocampal neuronal profiles will be
determined by outlining the perimeter of all defined neurons within
50.times.50 .mu.m counting frames spaced evenly throughout the
sections (450.times.450 .mu.m grids).
[0577] [Statistical Test: ANOVA.
[0578] In particular embodiments, glibenclamide, as an example,
results in a significant improvement in standard measures
neurofunctional outcome, including the neurological severity score
and vestibulomotor assessments, and the beneficial effects endure
during the month of repeated testing.
REFERENCES
[0579] All patents and publications mentioned in the specification
are indicative of the level of those skilled in the art to which
the invention pertains. All patents and publications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication was specifically and individually
indicated to be incorporated by reference.
Patents and Patent Applications
[0580] U.S. Pat. No. 5,399,363
[0581] U.S. Pat. No. 5,466,468
[0582] U.S. Pat. No. 5,543,158
[0583] U.S. Pat. No. 5,580,579
[0584] U.S. Pat. No. 5,629,001
[0585] U.S. Pat. No. 5,641,515
[0586] U.S. Pat. No. 5,725,871
[0587] U.S. Pat. No. 5,756,353
[0588] U.S. Pat. No. 5,780,045
[0589] U.S. Pat. No. 5,792,451
[0590] U.S. Pat. No. 5,804,212
[0591] U.S. Pat. No. 6,613,308
Publications
[0592] Aguilar-Bryan, L., Nelson, D. A., Vu, Q. A., Humphrey, M.
B., and Boyd, A. E., III 1990. Photoaffinity labeling and partial
purification of the beta cell sulfonylurea receptor using a novel,
biologically active glyburide analog. J. Biol. Chem. 265:8218-8224.
[0593] Andrews, B., Brewin C R, Philpott R, Stewart L.
Delayed-onset posttraumatic stress disorder: a systematic review of
the evidence. Am J Psychiatry 2007 September; 164(9): 1319-26.
[0594] Anstrom, J A, Brown W R, Moody D M, Thore C R, Challa V R,
Block S M. Subependymal veins in premature neonates: implications
for hemorrhage. Pediatr Neurol 2004 January; 30(1):46-53. [0595]
Balentine, J. D., 1978. Pathology of experimental spinal cord
trauma. I. The necrotic lesion as a function of vascular injury.
Lab Invest 39:236-253. [0596] Ballabh, P., Xu H, Hu F, Braun A,
Smith K, Rivera A, Lou N, Ungvari Z, Goldman S A, Csiszar A,
Nedergaard M 2007 Angiogenic inhibition reduces germinal matrix
hemorrhage. Nat Med 13:477-485 [0597] Baskin, Y K, Dietrich W D,
Green E J. Two effective behavioral tasks for evaluating
sensorimotor dysfunction following traumatic brain injury in mice.
J Neurosci Methods 2003 Oct. 15; 129(1):87-93. [0598] Basso, D. M.,
Beattie, M. S., and Bresnahan, J. C. 1995. A sensitive and reliable
locomotor rating scale for open field testing in rats. J.
Neurotrauma 12:1-21. [0599] bd Elaziz M A, Al-Dhawailie A A, Tekle
A. The effect of stress on the pharmacokinetics and
pharmacodynamics of glibenclamide in diabetic rats. Eur J Drug
Metab Pharmacokinet 1998 July; 23(3):371-6. [0600] Berger, R,
Gamier Y, Jensen A. Perinatal brain damage: underlying mechanisms
and neuroprotective strategies. J Soc Gynecol Investig 2002
November; 9(6):319-28. [0601] Bhatta, S., Transcriptional
regulation of SUR1-regulated NC(Ca-ATP) channel by hypoxia
inducible factor 1a in brain injury. Doctoral Dissertation,
University of Maryland, 2007. [0602] Bilgen, M., Abbe, R., Liu, S.
J., and Narayana, P. A. 2000. Spatial and temporal evolution of
hemorrhage in the hyperacute phase of experimental spinal cord
injury: in vivo magnetic resonance imaging. Magn Reson. Med.
43:594-600. [0603] Bimonte, H A, Hyde L A, Hoplight B J, Denenberg
V H. In two species, females exhibit superior working memory and
inferior reference memory on the water radial-arm maze. Physiol
Behav 2000 August; 70(3-4):311-7. [0604] Bracken, M. B., Shepard,
M. J., Collins, W. F., Holford, T. R., Young, W., Baskin, D. S.,
Eisenberg, H. M., Flamm, E., Leo-Summers, L., Maroon, J. et al
1990. A randomized, controlled trial of methylprednisolone or
naloxone in the treatment of acute spinal-cord injury. Results of
the Second National Acute Spinal Cord Injury Study. N. Engl. J.
Med. 322:1405-1411. [0605] Bramlett, H. M., Dietrich W D.
Progressive damage after brain and spinal cord injury:
pathomechanisms and treatment strategies. Prog Brain Res 2007;
161:125-41. [0606] Brewin, C R., A cognitive neuroscience account
of posttraumatic stress disorder and its treatment. Behav Res Ther
2001 April; 39(4):373-93. [0607] Bullock, R., Zauner A, Myseros J
S, Marmarou A, Woodward J J, Young H F. Evidence for prolonged
release of excitatory amino acids in severe human head trauma.
Relationship to clinical events. Ann N Y Acad Sci 1995 Sep. 15;
765:290-7. [0608] Carty, J., O'Donnell M L, Creamer M.
Delayed-onset PTSD: a prospective study of injury survivors. J
Affect Disord 2006 February; 90(2-3):257-61. [0609] Cernak, I.,
Animal models of head trauma. NeuroRx 2005 Jul. 2(3):410-22. [0610]
Chan, T. K., Chan, V., Teng, C. S., and Yeung, R. T. 1982. Effects
of gliclazide and glibenclamide on platelet function, fibrinolysis
and metabolic control in diabetic patients with retinopathy. Sem.
Hop. 58:1197-1200. [0611] Chang, Y C, Huang C C 2006 Perinatal
brain injury and regulation of transcription. Curr Opin Neurol
19:141-147 [0612] Chen, M., Simard J M. Cell swelling and a
nonselective cation channel regulated by internal Ca2+ and ATP in
native reactive astrocytes from adult rat brain. J Neurosci 2001
Sep. 1; 21(17):6512-21. [0613] Chen, M., Dong Y, Simard J M.
Functional coupling between sulfonylurea receptor type 1 and a
nonselective cation channel in reactive astrocytes from adult rat
brain. J Neurosci 2003 Sep. 17; 23(24):8568-77. [0614] Choudhri, T
F, Hoh, B. L., Solomon, R. A., Connolly, E. S, Jr., and Pinsky, D.
J. Use of a spectrophotometric hemoglobin assay to objectively
quantify intracerebral hemorrhage in mice. Stroke 1997 November;
28(11):2296-302. [0615] Cohen H, Zohar J, Matar M A, Zeev K,
Loewenthal U. Richter-Levin G. Setting apart the affected: the use
of behavioral criteria in animal models of post traumatic stress
disorder. Neuropsychopharmacology 2004 November; 29(11): 1962-70.
[0616] Colak, A., Soy, O., Uzun, H., Aslan, O., Barut, S., Belce,
A., Akyildiz, A., and Tasyurekli, M. 2003. Neuroprotective effects
of GYKI 52466 on experimental spinal cord injury in rats. J.
Neurosurg. 98:275-281. [0617] Cools, F., Offringa M 2005
Neuromuscular paralysis for newborn infants receiving mechanical
ventilation. Cochrane Database Syst RevCD002773 [0618] Cortez, S C,
McIntosh T K, Noble L J. Experimental fluid percussion brain
injury: vascular disruption and neuronal and glial alterations.
Brain Res 1989 Mar. 20; 482(2):271-82 [0619] DeFord, S M, Wilson M
S, Gibson C J, Baranova A, Hamm R J. Nefiracetam improves Morris
water maze performance following traumatic brain injury in rats.
Pharmacol Biochem Behav 2001 July; 69(3-4):611-6. [0620] Dietrich,
W D, Alonso O, Halley M. Early microvascular and neuronal
consequences of traumatic brain injury: a light and electron
microscopic study in rats. J Neurotrauma 1994 June; 11(3):289-301.
[0621] Dixon, C E, Lyeth B G, Povlishock J T et al. A fluid
percussion model of experimental brain injury in the rat. J
Neurosurg 1987 July; 67(1): 110-9. [0622] Dixon, C E., Kochanek P
M, Yan H Q et al. One-year study of spatial memory performance,
brain morphology, and cholinergic markers after moderate controlled
cortical impact in rats. J Neurotrauma 1999 February; 16(2):109-22.
[0623] Faden, A. I., Lemke, M., Simon, R. P., and Noble, L. J.
1988. N-methyl-D-aspartate antagonist MK801 improves outcome
following traumatic spinal cord injury in rats: behavioral,
anatomic, and neurochemical studies. J. Neurotrauma 5:33-45. [0624]
Fitch, M. T., Doller, C., Combs, C. K., Landreth, G. E., and
Silver, J. 1999. Cellular and molecular mechanisms of glial
scarring and progressive cavitation: in vivo and in vitro analysis
of inflammation-induced secondary injury after CNS trauma. J.
Neurosci. 19:8182-8198. [0625] Floyd, C L, Golden K M, Black R T,
Hamm R J, Lyeth B G. Craniectomy position affects morris water maze
performance and hippocampal cell loss after parasagittal fluid
percussion. J Neurotrauma 2002 March; 19(3):303-16. [0626]
Folkerth, R D., Neuropathologic substrate of cerebral palsy. J
Child Neurol 2005 December; 20(12):940-9. [0627] Fujimoto S T,
Longhi L, Saatman K E, Conte V. Stocchetti N, McIntosh T K. Motor
and cognitive function evaluation following experimental traumatic
brain injury. Neurosci Biobehav Rev 2004 July; 28(4):365-78. [0628]
Galderisi, U., Cascino, A., and Giordano, A. 1999. Antisense
oligonucleotides as therapeutic agents. J. Cell Physiol
181:251-257. [0629] Garrick, T., Morrow N, Shalev A Y, Eth S.
Stress-induced enhancement of auditory startle: an animal model of
posttraumatic stress disorder. Psychiatry 2001; 64(4):346-54.
[0630] Garrick, T., Morrow N, Eth S, Marciano D, Shalev A.
Psychophysiologic parameters of traumatic stress disorder in rats.
Ann N Y Acad Sci 1997 Jun. 21; 821:533-7. [0631] Gedeon, C., Koren
G. Designing Pregnancy Centered Medications: Drugs Which Do Not
Cross the Human Placenta. Placenta 2005 Nov. 25. [0632] Gensel, J.
C., Tovar, C. A., Hamers, F. P., Deibert, R. J., Beattie, M. S.,
and Bresnahan, J. C. 2006. Behavioral and histological
characterization of unilateral cervical spinal cord contusion
injury in rats. J. Neurotrauma 23:36-54. [0633] Gerzanich, V.,
Ivanov, A., Ivanova, S., Yang, J. B., Zhou, H., Dong, Y., and
Simard, J. M. 2003. Alternative splicing of cGMP-dependent protein
kinase I in angiotensin-hypertension: novel mechanism for nitrate
tolerance in vascular smooth muscle. Circ. Res. 93:805-812. [0634]
Ghazi-Birry, H S, Brown W R, Moody D M, Challa V R, Block S M,
Reboussin D M. Human germinal matrix: venous origin of hemorrhage
and vascular characteristics. AJNR Am J Neuroradiol 1997 February;
18(2):219-29. [0635] Gidday, J. M., Gasche, Y. G., Copin, J. C.,
Shah, A. R., Perez, R. S., Shapiro, S. D., Chan, P. H., and Park,
T. S. 2005. Leukocyte-derived matrix metalloproteinase-9 mediates
blood-brain barrier breakdown and is proinflammatory after
transient focal cerebral ischemia. Am. J. Physiol Heart Circ.
Physiol 289:H558-H568. [0636] Grady M S, Charleston J S, Maris D,
Witgen B M, Lifshitz J. Neuronal and glial cell number in the
hippocampus after experimental traumatic brain injury: analysis by
stereological estimation. J Neurotrauma 2003 October;
20(10):929-41. [0637] Gresack, J E, Frick K M. Male mice exhibit
better spatial working and reference memory than females in a
water-escape radial arm maze task. Brain Res 2003 Aug. 22;
982(1):98-107. [0638] Griffiths, I. R., Burns, N., and Crawford, A.
R. 1978. Early vascular changes in the spinal grey matter following
impact injury. Acta Neuropathol. (Berl) 41:33-39. [0639]
Hainsworth, A H, Spadoni F, Lavaroni F, Bernardi G, Stefani A.
Effects of extracellular pH on the interaction of sipatrigine and
lamotrigine with high-voltage-activated (HVA) calcium channels in
dissociated neurones of rat cortex. Neuropharmacology 2001 May;
40(6):784-91. [0640] Hamm, R J, Pike B R, O'Dell D M, Lyeth B G,
Jenkins L W. The rotarod test: an evaluation of its effectiveness
in assessing motor deficits following traumatic brain injury. J
Neurotrauma 1994 April; 11(2): 187-96. [0641] Hamm, R J, Lyeth B G,
Jenkins L W, O'Dell D M, Pike B R. Selective cognitive impairment
following traumatic brain injury in rats. Behav Brain Res 1993 Dec.
31; 59(1-2): 169-73. [0642] Hansen, A. M., Christensen, I. T.,
Hansen, J. B., Carr, R. D., Ashcroft, F. M., and Wahl, P. 2002.
Differential interactions of nateglinide and repaglinide on the
human beta-cell sulphonylurea receptor 1. Diabetes 51:2789-2795.
[0643] Harder, D R, Gebremedhin D, Narayanan J et al. Formation and
action of a P-450 4A metabolite of arachidonic acid in cat cerebral
microvessels. Am J Physiol 1994 May; 266(5 Pt 2):H2098-H2107.
[0644] Harvey, A G, Brewin C R, Jones C, Kopelman M D. Coexistence
of posttraumatic stress disorder and traumatic brain injury:
towards a resolution of the paradox. J Int Neuropsychol Soc 2003
May; 9(4):663-76. [0645] Haseloff, R. F., Krause, E., Bigl, M.,
Mikoteit, K., Stanimirovic, D., and Blasig, I. E. 2006.
Differential protein expression in brain capillary endothelial
cells induced by hypoxia and posthypoxic reoxygenation. Proteomics.
6:1803-1809. [0646] Hayes, K. C., and Kakulas, B. A. 1997.
Neuropathology of human spinal cord injury sustained in
sports-related activities. J. Neurotrauma 14:235-248. [0647]
Hellmich H L, Capra B, Eidson K et al. Dose-dependent neuronal
injury after traumatic brain injury. Brain Res 2005 May 24;
1044(2):144-54. [0648] Jansen-Olesen, I., Mortensen, C. H.,
El-Bariaki, N., and Ploug, K. B. 2005. Characterization of
K(ATP)-channels in rat basilar and middle cerebral arteries:
studies of vasomotor responses and mRNA expression. Eur. J.
Pharmacol. 523:109-118. [0649] Justicia, C., Panes J. Sole S et al.
Neutrophil infiltration increases matrix metalloproteinase-9 in the
ischemic brain after occlusion/reperfusion of the middle cerebral
artery in rats. J Cereb Blood Flow Metab 2003 December;
23(12):1430-40. [0650] Kadri, H., Mawla A A, Kazah J. The
incidence, timing, and predisposing factors of germinal matrix and
intraventricular hemorrhage (GMH/IVH) in preterm neonates. Childs
Nerv Syst 2006 September; 22(9): 1086-90. [0651] Kapadia, S. E.,
1984. Ultrastructural alterations in blood vessels of the white
matter after experimental spinal cord trauma. J. Neurosurg.
61:539-544. [0652] Kawata, K., Morimoto, T., Ohashi, T., Tsujimoto,
S., Hoshida, T., Tsunoda, S., and Sakaki, T. 1993. Experimental
study of acute spinal cord injury: a histopathological study. No
Shinkei Geka 21:45-51. [0653] Kline A E, Massucci J L, Marion D W,
Dixon C E. Attenuation of working memory and spatial acquisition
deficits after a delayed and chronic bromocriptine treatment
regimen in rats subjected to traumatic brain injury by controlled
cortical impact. J Neurotrauma 2002 April; 19(4):415-25. [0654]
Kraus, K. H., 1996. The pathophysiology of spinal cord injury and
its clinical implications. Semin. Vet. Med. Surg. (Small Anim)
11:201-207. [0655] Kunte, H., Schmidt S, Eliasziw Mdel Zoppo G J,
Simard J M, Masuhr F, Weih M, Dirnagl U Sulfonylureas improve
outcome in patients with type 2 diabetes and acute ischemic stroke.
Stroke 2007 September; 38(9):2526-30. [0656] Kwon, B. K., Tetzlaff,
W., Grauer, J. N., Beiner, J., and Vaccaro, A. R. 2004.
Pathophysiology and pharmacologic treatment of acute spinal cord
injury. Spine J. 4:451-464. [0657] LaBuda, C J, Mellgren R L, Hale
R L. Sex differences in the acquisition of a radial maze task in
the CD-1 mouse. Physiol Behav 2002 Jun. 1; 76(2):213-7. [0658]
Langlois, J A, Rutland-Brown W, Wald M M. The epidemiology and
impact of traumatic brain injury: a brief overview. J Head Trauma
Rehabil 2006 September; 21(5):375-8. [0659] Levy, M L, Masri L S,
McComb J G. Outcome for preterm infants with germinal matrix
hemorrhage and progressive hydrocephalus. Neurosurgery 1997
November; 41(5): 1111-7. [0660] Lorenzl, S., De P G, Segal A Z,
Beal M F. Dysregulation of the levels of matrix metalloproteinases
and tissue inhibitors of matrix metalloproteinases in the early
phase of cerebral ischemia. Stroke 2003 June; 34(6):e37-e38. [0661]
Lorrain, J., Millet, L., Lechaire, I., Lochot, S., Ferrari, P.,
Visconte, C., Sainte-Marie, M., Lunven, C., Berry, C. N.,
Schaeffer, P. et al 2003. Antithrombotic properties of SSR182289A,
a new, orally active thrombin inhibitor. J. Pharmacol. Exp. Ther.
304:567-574. [0662] Lou, H C., On the pathogenesis of germinal
layer hemorrhage in the neonate. APMIS Suppl 1993, 40:97-102.
[0663] Lu, J., Moochhala S, Shirhan M et al. Neuroprotection by
aminoguanidine after lateral fluid-percussive brain injury in rats:
a combined magnetic resonance imaging, histopathologic and
functional study. Neuropharmacology 2003 February; 44(2):253-63.
[0664] Manion, S T, Gamble E H, Li H. Prazosin administered prior
to inescapable stressor blocks subsequent exaggeration of acoustic
startle response in rats. Pharmacol Biochem Behav 2007 March;
86(3):559-65. [0665] Marmarou, A. A review of progress in
understanding the pathophysiology and treatment of brain edema.
Neurosurg Focus 2007; 22(5):E1.
[0666] Merola, A., O'Brien, M. F., Castro, B. A., Smith, D. A.,
Eule, J. M., Lowe, T. G., Dwyer, A. P., Haher, T. R., and Espat, N.
J. 2002. Histologic characterization of acute spinal cord injury
treated with intravenous methylprednisolone. J. Orthop. Trauma
16:155-161. [0667] Nakai, A., Shibazaki Y, Taniuchi Y, Oya A,
Asakura H, Kuroda S, Koshino T, Araki T. Influence of mild
hypothermia on delayed mitochondrial dysfunction after transient
intrauterine ischemia in the immature rat brain. Brain Res Dev
Brain Res 2001 May 31; 128(1):1-7. [0668] Nakamura, Y., Okudera T,
Fukuda S, Hashimoto T. Germinal matrix hemorrhage of venous origin
in preterm neonates. Hum Pathol 1990 October; 21 (10): 1059-62.
[0669] Nakamura, Y., Okudera T, Hashimoto T 1994 Vascular
architecture in white matter of neonates: its relationship to
periventricular leukomalacia. J Neuropathol Exp Neurol 53:582-589
[0670] Nedergaard, M., Kraig R P, Tanabe J, Pulsinelli W A.
Dynamics of interstitial and intracellular pH in evolving brain
infarct. Am J Physiol 1991 March; 260(3 Pt 2):R581-R588. [0671]
Nelson, D. A., Bryan, J., Wechsler, S., Clement, J. P., and
guilar-Bryan, L. 1996. The high-affinity sulfonylurea receptor:
distribution, glycosylation, purification, and immunoprecipitation
of two forms from endocrine and neuroendocrine cell lines.
Biochemistry 35:14793-14799. [0672] Nelson, E., Gertz, S. D.,
Rennels, M. L., Ducker, T. B., and Blaumanis, O. R. 1977. Spinal
cord injury. The role of vascular damage in the pathogenesis of
central hemorrhagic necrosis. Arch. Neurol. 34:332-333. [0673]
Nikulina, E., Tidwell, J. L., Dai, H. N., Bregman, B. S., and
Filbin, M. T. 2004. The phosphodiesterase inhibitor rolipram
delivered after a spinal cord lesion promotes axonal regeneration
and functional recovery. Proc. Natl. Acad. Sci. U.S.A
101:8786-8790. [0674] Noble, L. J., Donovan, F., Igarashi, T.,
Goussev, S., and Werb, Z. 2002. Matrix metalloproteinases limit
functional recovery after spinal cord injury by modulation of early
vascular events. J. Neurosci. 22:7526-7535. [0675] Obenaus, A.,
Robbins M, Blanco G et al. Multi-modal magnetic resonance imaging
alterations in two rat models of mild neurotrauma. J Neurotrauma
2007 July; 24(7): 1147-60. [0676] O'Connor, C., Heath D L, Cernak
I, Nimmo A J, Vink R. Effects of daily versus weekly testing and
pre-training on the assessment of neurologic impairment following
diffuse traumatic brain injury in rats. J Neurotrauma 2003 October;
20(10):985-93. [0677] Oertel, M., Kelly D F, McArthur D, Boscardin,
W. J., Glenn, T. C., Lee, J. H., Gravori, T., Obukhov, D., McBride,
D. Q., and Martin, N. A. Progressive hemorrhage after head trauma:
predictors and consequences of the evolving injury. J Neurosurg
2002 January; 96(1): 109-16. [0678] Pannu, R., Christie, D. K.,
Barbosa, E., Singh, I., and Singh, A. K. 2007. Post-trauma Lipitor
treatment prevents endothelial dysfunction, facilitates
neuroprotection, and promotes locomotor recovery following spinal
cord injury. J. Neurochem. [0679] Park S, Yamaguchi M, Zhou C,
Calvert J W, Tang J. Zhang J H. Neurovascular protection reduces
early brain injury after subarachnoid hemorrhage. Stroke 2004,
35:2412-7. [0680] Partridge, C. J., Beech, D. J., and
Sivaprasadarao, A. 2001. Identification and pharmacological
correction of a membrane trafficking defect associated with a
mutation in the sulfonylurea receptor causing familial
hyperinsulinism. J. Biol. Chem. 276:35947-35952. [0681] Perillan, P
R, Chen M, Potts E A, Simard J M. Transforming growth factor-beta 1
regulates Kir2.3 inward rectifier K+ channels via phospholipase C
and protein kinase C-delta in reactive astrocytes from adult rat
brain. J Biol Chem 2002 Jan. 18; 277(3):1974-80. [0682] Perillan, P
R, Li X, Simard J M. K(+) inward rectifier currents in reactive
astrocytes from adult rat brain. Glia 1999 September; 27(3):213-25.
[0683] Perillan, P R, Li X, Potts E A, Chen M, Bredt D S, Simard J
M. Inward rectifier K(+) channel Kir2.3 (IRK3) in reactive
astrocytes from adult rat brain. Glia 2000 August; 31(2): 181-92.
[0684] Pfefferkorn, T., Rosenberg G A. Closure of the blood-brain
barrier by matrix metalloproteinase inhibition reduces
rtPA-mediated mortality in cerebral ischemia with delayed
reperfusion. Stroke 2003 August; 34(8):2025-30. [0685] Pikus, H J,
Levy M L, Gans W, Mendel E, McComb J G. Outcome, cost analysis, and
long-term follow-up in preterm infants with massive grade IV
germinal matrix hemorrhage and progressive hydrocephalus.
Neurosurgery 1997 May; 40(5):983-8. [0686] Pourie, G., Blaise S,
Trabalon M, Nedelec E, Gueant J L, Daval J L 2006 Mild,
non-lesioning transient hypoxia in the newborn rat induces delayed
brain neurogenesis associated with improved memory scores.
Neuroscience 140:1369-1379 [0687] Raghupathi, R., Cell death
mechanisms following traumatic brain injury. Brain Pathol 2004
April; 14(2):215-22. [0688] Rasmussen, D D, Crites N J, Burke B L.
Acoustic startle amplitude predicts vulnerability to develop
post-traumatic stress hyper-responsivity and associated plasma
corticosterone changes in rats. Psychoneuroendocrinology 2008
April; 33(3):282-91. [0689] Regan, R F, Guo Y. Toxic effect of
hemoglobin on spinal cord neurons in culture. J Neurotrauma 1998
August; 15(8):645-53. [0690] Rivlin, A. S., and Tator, C. H. 1977.
Objective clinical assessment of motor function after experimental
spinal cord injury in the rat. J. Neurosurg. 47:577-581. [0691]
Romanic, A M, White R F, Arleth A J, Ohlstein E H, Barone F C.
Matrix metalloproteinase expression increases after cerebral focal
ischemia in rats: inhibition of matrix metalloproteinase-9 reduces
infarct size. Stroke 1998 May; 29(5):1020-30. [0692] Sanders, M J,
Dietrich W D, Green E J. Cognitive function following traumatic
brain injury: effects of injury severity and recovery period in a
parasagittal fluid-percussive injury model. J Neurotrauma 1999
October; 16(10):915-25. [0693] Sayer, N A, SChiros C E, Sigford B
et al. Characteristics and rehabilitation outcomes among patients
with blast and other injuries sustained during the Global War on
Terror. Arch Phys Med Rehabil 2008 January; 89(1): 163-70. [0694]
Schallert, T., Fleming S M, Leasure J L, Tillerson J L, Bland S T.
CNS plasticity and assessment of forelimb sensorimotor outcome in
unilateral rat models of stroke, cortical ablation, parkinsonism
and spinal cord injury. Neuropharmacology 2000 Mar. 3;
39(5):777-87. [0695] Schmidt, R H, Grady M S. Regional patterns of
blood-brain barrier breakdown following central and lateral fluid
percussion injury in rodents. J Neurotrauma 1993; 10(4):415-30.
[0696] Schnittler, H J, Schmandra T, Drenckhahn D. Correlation of
endothelial vimentin content with hemodynamic parameters. Histochem
Cell Biol 1998 August; 110(2): 161-7. [0697] Schwartz, G., and
Fehlings, M. G. 2001. Evaluation of the neuroprotective effects of
sodium channel blockers after spinal cord injury: improved
behavioral and neuroanatomical recovery with riluzole. J.
Neurosurg. 94:245-256. [0698] Seidel, M F, Simard J M, Hunter S F,
Campbell G A. Isolation of arteriolar microvessels and culture of
smooth muscle cells from cerebral cortex of guinea pig. Cell Tissue
Res 1991 September; 265(3):579-87. [0699] Seino, S., 1999.
ATP-sensitive potassium channels: a model of heteromultimeric
potassium channel/receptor assemblies. Annu. Rev. Physiol
61:337-362. [0700] Sharma, N., Crane, A., Clement, J. P., Gonzalez,
G., Babenko, A. P., Bryan, J., and guilar-Bryan, L. 1999. The C
terminus of SUR1 is required for trafficking of KATP channels. J.
Biol. Chem. 274:20628-20632. [0701] Simard, J M, Chen M, Tarasov K
V, Bhatta, S., Ivanova, S., Melnitchenko, L., Tsymbalyuk, N., West,
G. A., and Gerzanich, V. 2006. Newly expressed SUR1-regulated
NC(Ca-ATP) channel mediates cerebral edema after ischemic stroke.
Nat Med 2006 April; 12(4):433-40. [0702] Simard, J M, Kent T A,
Chen M, Tarasov K V, Gerzanich V. Brain oedema in focal ischaemia:
molecular pathophysiology and theoretical implications. Lancet
Neurol 2007 March; 6(3):258-68. [0703] Simard, J M, Woo S K, Bhatta
S, Gerzanich V. Drugs acting on SUR1 to treat CNS ischemia and
trauma. Curr Opin Pharmacol 2008; 8(1):42-9. [0704] Simard, J M,
Tsymbalyuk O, Ivanov A, Ivanova S, Bhatta S, Geng Z, Woo S K,
Gerzanich V. Endothelial sulfonylurea receptor 1-regulated N C
Ca-ATP channels mediate progressive hemorrhagic necrosis following
spinal cord injury. J Clin Invest 2007 August; 117(8):2105-13.
[0705] Simard, J M, Tarasov K V, Gerzanich V. Non-selective cation
channels, transient receptor potential channels and ischemic
stroke. Biochim Biophys Acta 2007 August; 1772(8):947-57. [0706]
Simard, J M, Woo S K, Bhatta S. Gerzanich V. Drugs acting on SUR1
to treat CNS ischemia and trauma. Curr Opin Pharmacol 2007. [0707]
Soblosky, J. S., Song, J. H., and Dinh, D. H. 2001. Graded
unilateral cervical spinal cord injury in the rat: evaluation of
forelimb recovery and histological effects. Behav. Brain Res.
119:1-13. [0708] Stephan, D., Winkler, M., Kuhner, P., Russ, U.,
and Quast, U. 2006. Selectivity of repaglinide and glibenclamide
for the pancreatic over the cardiovascular K(ATP) channels.
Diabetologia 49:2039-2048. [0709] Suh, S W, Chen J W, Motamedi M et
al. Evidence that synaptically-released zinc contributes to
neuronal injury after traumatic brain injury. Brain Res 2000 Jan.
10; 852(2):268-73. [0710] Sullivan, H C, Harik S I. ATP-sensitive
potassium channels are not expressed in brain microvessels. Brain
Res 1993; 612:336-8. [0711] Sumii, T., and Lo, E. H. 2002.
Involvement of matrix metalloproteinase in thrombolysis-associated
hemorrhagic transformation after embolic focal ischemia in rats.
Stroke 33:831-836. [0712] Sun, H. S., Feng, Z. P., Barber, P. A.,
Buchan, A. M., and French, R. J. 2007. Kir6.2-containing
ATP-sensitive potassium channels protect cortical neurons from
ischemic/anoxic injury in vitro and in vivo. Neuroscience
144:1509-1515. [0713] Tanaka, M., Natori M, Ishimoto H, Miyazaki T,
Kobayashi T, Nozawa S. Experimental growth retardation produced by
transient period of uteroplacental ischemia in pregnant
Sprague-Dawley rats. Am J Obstet Gynecol 1994 November; 171(5):
1231-4. [0714] Tator, C. H., 1991. Review of experimental spinal
cord injury with emphasis on the local and systemic circulatory
effects. Neurochirurgie 37:291-302. [0715] Tator, C. H., 1995.
Update on the pathophysiology and pathology of acute spinal cord
injury. Brain Pathol. 5:407-413. [0716] Tator, C. H., and Fehlings,
M. G. 1991. Review of the secondary injury theory of acute spinal
cord trauma with emphasis on vascular mechanisms. J. Neurosurg.
75:15-26. [0717] Tator, C. H., and Koyanagi, I. 1997. Vascular
mechanisms in the pathophysiology of human spinal cord injury. J.
Neurosurg. 86:483-492. [0718] Teng, Y. D., Choi, H., Onario, R. C.,
Zhu, S., Desilets, F. C., Lan, S., Woodard, E. J., Snyder, E. Y.,
Eichler, M. E., and Friedlander, R. M. 2004. Minocycline inhibits
contusion-triggered mitochondrial cytochrome c release and
mitigates functional deficits after spinal cord injury. Proc. Natl.
Acad. Sci. U. S. A 101:3071-3076. [0719] Thebaud, B., 2007
Angiogenesis in lung development, injury and repair: implications
for chronic lung disease of prematurity. Neonatology 91:291-297
[0720] Thompson, H J, Lifshitz J, Marklund N et al. Lateral fluid
percussion brain injury: a 15-year review and evaluation. J
Neurotrauma 2005 January; 22(1):42-75. [0721] Thompson, H J, LeBold
D G, Marklund N, Morales D M, Hagner A P, McIntosh T K. Cognitive
evaluation of traumatically brain-injured rats using serial testing
in the Morris water maze. Restor Neurol Neurosci 2006; 24(2):
109-14. [0722] Thurman, D J, Alverson C, Dunn K A, Guerrero J,
Sniezek J E. Traumatic brain injury in the United States: A public
health perspective. J Head Trauma Rehabil 1999 December;
14(6):602-15. [0723] Unterberg, A W, Stover J, Kress B, Kiening K
L. Edema and brain trauma. Neuroscience 2004; 129(4):1021-9. [0724]
Smith, J S, Chang E F, Rosenthal G et al. The role of early
follow-up computed tomography imaging in the management of
traumatic brain injury patients with intracranial hemorrhage. J
Trauma 2007 July; 63(1):75-82. [0725] Vajtr, D., Benada O, Kukacka
J et al. Correlation of ultrastructural changes of endothelial
cells and astrocytes occurring during blood brain barrier damage
after traumatic brain injury with biochemical markers of BBB
leakage and inflammatory response. Physiol Res 2008 Apr. 1. [0726]
Vergani, P., Locatelli A, Doria V, Assi F, Paterlini G, Pezzullo J
C, Ghidini A. Intraventricular hemorrhage and periventricular
leukomalacia in preterm infants. Obstet Gynecol 2004 August;
104(2):225-31. [0727] Vilalta. A., Sahuquillo J, Rosell A, Poca M
A, Riveiro M, Montaner J. Moderate and severe traumatic brain
injury induce early overexpression of systemic and brain
gelatinases. Intensive Care Med 2008 Mar. 19. [0728] Vink, R.,
Mullins P G, Temple M D, Bao W, Faden Al. Small shifts in
craniotomy position in the lateral fluid percussion injury model
are associated with differential lesion development. J Neurotrauma
2001 August; 18(8):839-47. [0729] Wang, X., Mori T, Sumii T, Lo E
H. Hemoglobin-induced cytotoxicity in rat cerebral cortical
neurons: caspase activation and oxidative stress. Stroke 2002 July;
33(7): 1882-8. [0730] Wang, X., Tsuji, K., Lee, S. R., Ning, M.,
Furie, K. L., Buchan, A. M., and Lo, E. H. 2004. Mechanisms of
hemorrhagic transformation after tissue plasminogen activator
reperfusion therapy for ischemic stroke. Stroke 35:2726-2730.
[0731] Warden, D., Military TBI during the Iraq and Afghanistan
wars. J Head Trauma Rehabil 2006 September; 21(5):398-402. [0732]
Wei, W., Xin-Ya S, Cai-Dong L, Zhong-Han K, Chun-Peng C.
Relationship between extracellular matrix both in choroid plexus
and the wall of lateral ventricles and intraventricular hemorrhage
in preterm neonates. Clin Anat 2000; 13(6):422-8. [0733] Wenger, R
H, Stiehl D P, Camenisch G 2005 Integration of oxygen signaling at
the consensus HRE. Sci STKE 2005:re12 [0734] Wiley, J L, Compton A
D, Pike B R, Temple M D, McElderry J W, Hamm R J. Reduced
sensorimotor reactivity following traumatic brain injury in rats.
Brain Res 1996 Apr. 15; 716(1-2):47-52. [0735] Wright, L L, Horbar
J D, Gunkel H, Verter J, Younes N, Andrews E B, Long W 1995
Evidence from multicenter networks on the current use and
effectiveness of antenatal corticosteroids in low birth weight
infants. Am J Obstet Gynecol 173:263-269 [0736] Xi, G., Keep R F,
Hoff J T. Mechanisms of brain injury after intracerebral
haemorrhage. Lancet Neurol 2006 January; 5(1):53-63. [0737] Xi, G.,
Hua Y, Bhasin R R, Ennis S R, Keep R F, Hoff J T. Mechanisms of
edema formation after intracerebral hemorrhage: effects of
extravasated red blood cells on blood flow and blood-brain barrier
integrity. Stroke 2001 Dec. 1; 32(12):2932-8. [0738] Xia, Y.,
Eisenman D, Haddad G G. Sulfonylurea receptor expression in rat
brain: effect of chronic hypoxia during development. Pediatr Res
1993 November; 34(5):634-41.
[0739] Yamashita, S., Park, J. B., Ryu, P. D., Inukai, H.,
Tanifuji, M., and Murase, K. 1994. Possible presence of the
ATP-sensitive K+ channel in isolated spinal dorsal horn neurons of
the rat. Neurosci. Lett. 170:208-212. [0740] Yan, F F, Lin C W,
Cartier E A, Shyng S L. Role of ubiquitin-proteasome degradation
pathway in biogenesis efficiency of .beta.-cell ATP-sensitive
potassium channels. Am J Physiol Cell Physiol 2005;
289:C1351-C1359. [0741] Yokoshiki, H., Sunagawa, M., Seki, T., and
Sperelakis, N. 1999. Antisense oligodeoxynucleotides of
sulfonylurea receptors inhibit ATP-sensitive K+ channels in
cultured neonatal rat ventricular cells. Pflugers Arch.
437:400-408.
[0742] Although the present invention and its advantages have been
described in detail, it should be understood that various changes,
substitutions and alterations can be made herein without departing
from the spirit and scope of the invention as defined by the
appended claims. Moreover, the scope of the present application is
not intended to be limited to the particular embodiments of the
process, machine, manufacture, composition of matter, means,
methods and steps described in the specification. As one of
ordinary skill in the art will readily appreciate from the
disclosure of the present invention, processes, machines,
manufacture, compositions of matter, means, methods, or steps,
presently existing or later to be developed that perform
substantially the same function or achieve substantially the same
result as the corresponding embodiments described herein may be
utilized according to the present invention. Accordingly, the
appended claims are intended to include within their scope such
processes, machines, manufacture, compositions of matter, means,
methods, or steps.
Sequence CWU 1
1
15118DNAArtificial SequenceArtificial Primer 1tgcctgaggc gtggctgt
18218DNAArtificial SequenceArtificial Primer 2ggccgagtgg ttctcggt
18348DNAArtificial SequenceArtificial Primer 3gcccgggcac cctgctggct
ctgtgtgtcc ttccgcgcct gggcatcg 48448DNAArtificial
SequenceArtificial Primer 4tgcaggggtc agggtcaggg cgctgtcggt
ccacttggcc agccagta 48520DNAArtificial SequenceArtificial Primer
5cggaccaccc caagtattca 20617DNAArtificial SequenceArtificial Primer
6gccggcacgg ttcttct 17725DNAArtificial SequenceArtificial Primer
7catgatcgtg gctgctatcc aggca 25819DNAArtificial SequenceArtificial
Primer 8gagtcggact tctcgccct 19920DNAArtificial SequenceArtificial
Primer 9ccttgacagt ggaccgaacc 201025DNAArtificial
SequenceArtificial Primer 10ttccacatcc tggtcacacc gctgt
251120DNAArtificial SequenceArtificial Primer 11agttgagttc
cccctggact 201220DNAArtificial SequenceArtificial Primer
12aattccagtc cctcccactc 201348DNAArtificial SequenceArtificial
Primer 13gcccgggcac cctgctggct ctgtgtgtcc ttccgcgcct gggcatcg
481448DNAArtificial SequenceArtificial Primer 14ccagggcagg
ccgcgaatgg aattcccgga tgaggctgta gcgctgcg 481510PRTArtificial
SequenceSynthetic Peptide 15Cys Thr Thr His Trp Gly Phe Thr Leu Cys
1 5 10
* * * * *