U.S. patent application number 15/520328 was filed with the patent office on 2017-11-16 for compositions and methods for detecting an rna virus.
This patent application is currently assigned to Envirologix Inc.. The applicant listed for this patent is ENVIROLOGIX INC.. Invention is credited to Stephen A. JUDICE, Breck PARKER, Lars PETERS, Daniel SHAFFER.
Application Number | 20170327911 15/520328 |
Document ID | / |
Family ID | 55761744 |
Filed Date | 2017-11-16 |
United States Patent
Application |
20170327911 |
Kind Code |
A1 |
PETERS; Lars ; et
al. |
November 16, 2017 |
COMPOSITIONS AND METHODS FOR DETECTING AN RNA VIRUS
Abstract
The present invention provides methods for rapidly identifying
an RNA viral infection using an isothermal nucleic acid
amplification reaction that can be carried out extracted RNA in the
context of a crude biological sample.
Inventors: |
PETERS; Lars; (Portland,
ME) ; JUDICE; Stephen A.; (Portland, ME) ;
SHAFFER; Daniel; (Portland, ME) ; PARKER; Breck;
(Portland, ME) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ENVIROLOGIX INC. |
Portland |
ME |
US |
|
|
Assignee: |
Envirologix Inc.
Portland
ME
|
Family ID: |
55761744 |
Appl. No.: |
15/520328 |
Filed: |
October 20, 2015 |
PCT Filed: |
October 20, 2015 |
PCT NO: |
PCT/US2015/056491 |
371 Date: |
April 19, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62104008 |
Jan 15, 2015 |
|
|
|
62066277 |
Oct 20, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
Y02A 50/60 20180101;
C12Q 1/701 20130101; C12Q 2600/158 20130101; Y02A 50/30 20180101;
C12Q 1/6865 20130101; Y02A 50/53 20180101; C12Q 1/6865 20130101;
C12Q 2521/107 20130101 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70 |
Claims
1. A method of detecting a specific target polynucleotide in an
isothermal amplification reaction coupled with reverse
transcription, the method comprising: (a) contacting a target
polynucleotide molecule in a sample with a primer in the presence
of a reverse transcriptase and dNTPs under conditions permissive
for cDNA synthesis, thereby generating a cDNA; (b) contacting the
cDNA with forward and reverse primers each carrying at least one
nicking enzyme recognition sequence within their respective
5'-terminal regions which specifically bind the cDNA with their
respective 3'-terminal regions in the presence of a nicking enzyme,
dNTPs, a detectable oligonucleotide probe, and a
strand-displacement polymerase under conditions permissive for the
isothermal amplification of the cDNA; and (c) detecting a signal
specific for detectable oligonucleotide probe hybridization to the
amplicon, wherein detection of the signal indicates the presence or
quantity of the target polynucleotide present in the sample and
failure to detect the signal indicates the absence of target
polyribonucleotide in the sample.
2. A method of detecting an RNA virus in a sample, the method
comprising (a) contacting an RNA virus polynucleotide molecule in a
sample with a primer in the presence of a reverse transcriptase and
dNTPs under conditions permissive for cDNA synthesis, thereby
generating a cDNA; (b) contacting the cDNA with forward and reverse
primers each carrying at least one nicking enzyme recognition
sequence within their respective 5'-terminal regions which
specifically bind the cDNA with their respective 3'-terminal
regions in the presence of a nicking enzyme, dNTPs, a detectable
oligonucleotide probe, and a strand-displacement polymerase under
conditions permissive for the isothermal amplification of the cDNA;
and (c) detecting a signal specific for detectable oligonucleotide
probe hybridization to the amplicon, wherein detection of the
signal indicates the presence or quantity of the RNA virus
polynucleotide molecule present in the sample and failure to detect
the amplicon indicates the absence of an RNA virus.
3. The method of claim 2, wherein the RNA virus polynucleotide
molecule is an Ebola, HIV, dengue, influenza, bovine diarrhea
virus, yellow fever virus, west nile virus, hepatitis C, Lassa
virus, Flavivirus, or Arenavirus polynucleotide.
4. The method of claim 2, wherein the RNA virus is an Ebola
virus
5-6. (canceled)
7. The method of claim 1, wherein no detectable signal is present
in a control assay lacking a target polynucleotide at seven
minutes, ten minutes, and/or fifteen minutes following initiation
of the assay.
8. (canceled)
9. The method of claim 1, wherein steps (a)-(c) are carried out in
a single reaction.
10. The method of claim 1, wherein the reverse transcriptase enzyme
and the strand-displacement DNA polymerase are the same or
different enzymes.
11-14. (canceled)
15. The method of claim 1, wherein the limit of detection is 10 or
20 copies per reaction.
16. The method of claim 1, wherein the method is carried out in
about 5, 7, 10, 15, 20, 25 or thirty minutes.
17. (canceled)
18. The method of claim 3, wherein RNA is not purified or isolated
away from the biological sample.
19. (canceled)
20. The method of claim 2, wherein no separate reverse
transcriptase primer is required, but the forward and/or reverse
primers are used.
21-27. (canceled)
28. The method of claim 1, wherein the polymerase is a 5'-exo.sup.-
derivative selected from the group consisting of of Bst DNA
polymerase I, Gst DNA polymerase I, Gka DNA polymerase I, Gca DNA
polymerase I, Gan DNA polymerase I, Gbo DNA polymerase I, Gsp70 DNA
polymerase I, GspT3 DNA polymerase I, Gsp52 DNA polymerase I and/or
fragments thereof; the nicking enzyme is one or more of Nt.BstNBI,
Nt.BspD6I, Nt.BspQI, Nt.BsmAI, Nt.AlwI, N.Bst9I, or N.BstSEI; the
reverse transcriptase is M-MLV RT, AMV RT, RSV RT, and/or
mutants/derivatives thereof; and the detectable probe comprises a
molecular beacon.
29-31. (canceled) wherein the forward and reverse primers for
detection of influenza B comprise one or more of the following
sequences, respectively: TABLE-US-00223 Forward primer:
GACTCGATATCGAGTCAAATGCAmGATGGTCTCmAmGmCmTmA,
GACTCGATATCGAGTCAAATGCAmAATGGTCTCmAmGmCmTmA,
GACTCGATATCGAGTCAAATGCAmGATGGTTTCmAmGmCmTmA; and Reverse Primer:
GACTCGATATCGAGTCCTCCTTTmTCCCATTCCATmTmCmAmTmT,
GACTCGATATCGAGTCCTCCCTTmTCCCATTCCATmTmCmAmTmT,
GACTCGATATCGAGTCCTCCTTTmCCCCATTCCATmTmCmAmTmT;
and wherein amplification of influenza B is detected using a probe
having the following sequence; TABLE-US-00224
gccaaGCTATGAACACAGCAAActtggc.
wherein the forward and reverse primers for detection of BVDV1
comprise one or more of the following sequences, respectively:
TABLE-US-00225 Forward primer:
GACTCGATATCGAGTCGGCCCACmTGTATTGCTmAmCmTmGmAmAmA,
GACTCGATATCGAGTCGGCCCACmTGCACTGCTmAmCmTmAmAmAmA; and Reverse
Primer: GACTCGATATCGAGTCTGTGATCmAACTCCmAmTmGmTmGmCmC;
and amplification of BVDV1 is detected using a probe having the
following sequence: TABLE-US-00226
cgctacATCTCTGCTGTACATGgtagcg.
33. (canceled)
34. The method of claim 32, wherein the probe has a fluorescent dye
at the 5' end, and a quencher at the 3' end or a fluorescent dye at
the 3' end, and a quencher at 5' end.
35-47. (canceled)
48. The method of claim 1, wherein a forward or reverse primer
comprises at the 3' end one or more 2' modified nucleotides.
32. The method of claim 1, wherein the forward and reverse primers
for detection of EBOV comprise the following sequences,
respectively: TABLE-US-00227 Forward primer:
GACTCGATATCGAGTCGCTTCCA[MeOC]AGTTATC[MeOU][MeOA] [MeOC][MeOC][MeOG]
Reverse Primer: GACTCGATATCGAGTCGAAATGC[MeOA]ACGA[MeOC][MeOA]
[MeOC][MeOC][MeOU];
and amplification of EBOV is detected using a probe having the
following sequence: TABLE-US-00228 gctacACGACTTTYGCTGAAGgtagc;
wherein the forward and reverse primers for detection of HIV
comprise one or more of the following sequences, respectively:
TABLE-US-00229 Forward primer:
GACTCGATATCGAGTCTGACTAGmCGGAGGmCmTmAmGmAmAmG,
GACTCGATATCGAGTCTGACTAGmCAGAGGmCmTmAmGmAmAmG; and Reverse Primer:
GACTCGATATCGAGTCTATTGACmGCTCmTmCmGmCmAmC,
GACTCGATATCGAGTCTACTGACmGCTCmTmCmGmCmAmC;
and amplification of HIV is detected using a probe having the
following sequence: TABLE-US-00230 cgcaagGGAGAGAGATGGGTGcttgcg;
wherein the forward and reverse primers for detection of Dengue
comprise one or more of the following sequences, respectively:
TABLE-US-00231 Forward primer:
GACTCGATATCGAGTCCAAAAACmAGCATATTmGmAmCmGmC; and Reverse Primer:
GACTCGATATCGAGTCAGACAGCmAGGATCmTmCmTmGmG,
GACTCGATATCGAGTCAGACAGCmAGGATCmTmGmTmGmG;
and amplification of Dengue is detected using a probe having the
following sequence: TABLE-US-00232 cgcatcTGGTCTTTCCCAGCgatgcg;
49. The method of claim 48, wherein the one or more 2' modified
nucleotide is one or more of 2'-O-methyl, 2'-methoxyethoxy,
2'-fluoro, 2'-hydroxyl, 2'-alkyl, 2'-allyl,
2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio,
4'-CH.sub.2--O-2'-bridge, 4'-(CH.sub.2).sub.2--O-2'-bridge, 2'-LNA,
and 2'-O-(N-methylcarbamate).
50. A kit for detecting an RNA virus polynucleotide molecule
comprising primers that specifically bind an RNA viral sequence, a
detectable probe that specifically binds an RNA virus amplicon, a
reverse transcriptase enzyme, a nicking enzyme, and a
strand-displacement polymerase, wherein the RNA virus is EBOV, and
the primers comprise the following sequences: TABLE-US-00233
Forward primer: GACTCGATATCGAGTCGCTTCCA[MeOC]AGTTATC[MeOU][MeOA]
[MeOC][MeOC][MeOG] Reverse Primer:
GACTCGATATCGAGTCGAAATGC[MeOA]ACGA[MeOC][MeOA]
[MeOC][MeOC][MeOU].
wherein the probe comprises the following sequence
gctacACGACTTTYGCTGAAGgtagc; wherein the RNA virus is HIV, wherein
the primers comprise one or more of the following sequences,
respectively: TABLE-US-00234 Forward primer:
GACTCGATATCGAGTCTGACTAGmCGGAGGmCmTmAmGmAmAmG,
GACTCGATATCGAGTCTGACTAGmCAGAGGmCmTmAmGmAmAmG; and Reverse Primer:
GACTCGATATCGAGTCTATTGACmGCTCmTmCmGmCmAmC,
GACTCGATATCGAGTCTACTGACmGCTCmTmCmGmCmAmC;
and the probe comprises the following sequence:
cgcaagGGAGAGAGATGGGTGcttgcg; wherein the RNA virus is Dengue,
wherein the primers comprise one or more of the following
sequences, respectively: TABLE-US-00235 Forward primer:
GACTCGATATCGAGTCCAAAAACmAGCATATTmGmAmCmGmC; Reverse Primer:
GACTCGATATCGAGTCAGACAGCmAGGATCmTmCmTmGmG,
GACTCGATATCGAGTCAGACAGCmAGGATCmTmGmTmGmG;
and the probe comprises the following sequence:
cgcatcTGGTCTTTCCCAGCgatgcg. wherein the RNA virus is influenza B,
wherein the primers comprise one or more of the following
sequences, respectively: TABLE-US-00236 Forward primer:
GACTCGATATCGAGTCAAATGCAmGATGGTCTCmAmGmCmTmA,
GACTCGATATCGAGTCAAATGCAmAATGGTCTCmAmGmCmTmA,
GACTCGATATCGAGTCAAATGCAmGATGGTTTCmAmGmCmTmA; and Reverse Primer:
GACTCGATATCGAGTCCTCCTTTmTCCCATTCCATmTmCmAmTmT,
GACTCGATATCGAGTCCTCCCTTmTCCCATTCCATmTmCmAmTmT,
GACTCGATATCGAGTCCTCCTTTmCCCCATTCCATmTmCmAmTmT;
and the probe comprises the following sequence:
gccaaGCTATGAACACAGCAAActtggc. wherein the RNA virus is BVDV1,
wherein the primers comprise one or more of the following
sequences, respectively: TABLE-US-00237 Forward primer:
GACTCGATATCGAGTCGGCCCACmTGTATTGCTmAmCmTmGmAmAmA,
GACTCGATATCGAGTCGGCCCACmTGCACTGCTmAmCmTmAmAmAmA; and Reverse
Primer: GACTCGATATCGAGTCTGTGATCmAACTCCmAmTmGmTmGmCmC;
and the probe comprises the following sequence:
cgctacATCTCTGCTGTACATGgtagcg.
51-71. (canceled)
72. The kit of claim 50, wherein the kit further comprises one or
more of (a) a capillary tube that may or may not comprise
lyophilized lysis or RNA stabilization reagents for viral
polynucleotide extraction; (b) one or more vessels comprising a
buffer suitable for carrying out a reverse transcriptase and/or
amplification reaction; and/or (c) vessels comprising the reverse
transcriptase enzyme, nicking enzyme, and strand-displacement
polymerase in lyophilized form
73-74. (canceled)
75. A method of diagnosing a human or animal subject with an RNA
virus, the method comprising (a) contacting a sample of the subject
with an agent capable of extracting an RNA virus present in the
sample and an agent capable of stabilizing the extracted
polynucleotide molecule against degradation; (b) contacting the
polynucleotide molecule with a reverse transcriptase primer in the
presence of a reverse transcriptase and dNTPs under conditions
permissive for cDNA synthesis, thereby generating a cDNA copy of
the polynucleotide molecule; (c) contacting the cDNA with forward
and reverse primers carrying at least one nicking enzyme
recognition sequence within their respective 5'-terminal regions
which specifically bind the cDNA with their respective 3'-terminal
regions in the presence of a nicking enzyme, dNTPs, and a
strand-displacement polymerase under conditions permissive for the
isothermal amplification of the cDNA, thereby generating amplicons;
and (d) detecting the amplicons, wherein the presence of an RNA
viral amplicon diagnoses an RNA viral infection in the subject and
failure to detect the amplicon diagnoses the absence of an RNA
viral infection in the subject.
76. The method of claim 75, wherein the RNA virus is an Ebola
virus, HIV, dengue virus, influenza virus, bovine diarrhea virus,
yellow fever virus, west nile virus, hepatitis Cvirus , Lassa
virus, Flavivirus, Arenavirus, or single-stranded RNA virus.
77. The method of claim 75, wherein the agent capable of extracting
the virus is one or a combination of sodium dodecyl sulfate, sodium
lauryl sulfate, Guanidinium thiocyanate, and/or guanidine
hydrochloride.
78-79. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to and the benefit of U.S.
Provisional Patent Application Serial Nos. 62/066,277, filed Oct.
20, 2014, and 62/104,008 filed Jan. 15, 2015. The entire contents
of each of these applications are hereby incorporated by reference
herein.
BACKGROUND OF THE INVENTION
[0002] The Ebola virus causes hemorrhagic fever with mortality
rates reaching 50% to 90% of infected humans. Ebola virus (EBOV)
includes four species, Zaire EBOV, Sudan EBOV, Ivory Coast EBOV,
and Reston EBOV. Human infection with Ebola typically results from
contact with contaminated blood, tissues, and/or excretions of
animals or patients with an Ebola infection. Patients typically
exhibit symptoms 4 to 10 days after Ebola infection. This long
incubation period provides an opportunity for the virus to be
carried to new areas before the carrier displays any signs of
illness. Symptoms of Ebola include fever, chills, malaise, and
myalgia. Because such symptoms are displayed in a variety of
illnesses, there is a significant risk that Ebola infection may be
misdiagnosed in the early stages, thereby facilitating spread of
the disease. In later stages, Ebola -infected subjects typically
develop vomiting, diarrhea, coughing, vascular symptoms, headache,
confusion, coma, mucosal hemorrhages, bloody diarrhea and
ultimately multiorgan failure, resulting in death. The bodily
fluids of Ebola patients are highly infectious as are the dead
bodies of Ebola patients.
[0003] Public health concerns about Ebola infection are mounting as
Ebola infections in West Africa in late 2014 are predicted to rise
to 10,000 people per week. Because of their exposure to the bodily
fluids of Ebola patients, health care workers are at risk for
catching Ebola from infected patients. The risk of infection
increases as the extent and the frequency of contact increased. In
a 1976 Sudan Ebola outbreak 81% of healthcare workers nursing Ebola
patients were infected with the virus. In order for medical staff
and health care workers to avoid unnecessary infections, early
detection of Ebola is critical so that appropriate infection
control measures are instituted and the risk of transmission is
minimized
[0004] To stop the spread of Ebola within West Africa and
internationally, rapid diagnosis is essential so that infected
subjects may be immediately quarantined and proper protective
equipment used by health care workers caring for these subjects.
High titers of infectious filovirus are present in the blood and
tissues during early stages of illness. Currently, Ebola is
identified by virus isolation, reverse transcription-PCR (RT-PCR),
including real-time quantitative RT-PCR, antigen-capture
enzyme-linked immunosorbent assay (ELISA), antigen detection by
immunostaining, and IgG- and IgM-ELISA using authentic virus
antigens. Unfortunately, these tests are time-consuming because
they can only be carried out on purified and isolated RNA and
require access to laboratory equipment and trained technicians that
are scarce in many areas where Ebola is endemic.
[0005] Accordingly, improved methods for rapidly identifying
patients infected with Ebola virus are urgently required.
SUMMARY OF THE INVENTION
[0006] The present invention provides methods for rapidly
identifying an Ebola infection using an isothermal nucleic acid
amplification reaction that can be carried out on extracted RNA in
the context of a crude biological sample.
[0007] In one aspect, the invention provides a method of detecting
a specific target polynucleotide (e.g., RNA) in an isothermal
amplification reaction coupled with reverse transcription, the
method involving
[0008] (a) contacting a target polynucleotide molecule in a sample
with a primer in the presence of a reverse transcriptase and dNTPs
under conditions permissive for cDNA synthesis, thereby generating
a cDNA;
[0009] (b) contacting the cDNA with forward and reverse primers
each carrying at least one nicking enzyme recognition sequence
within their respective 5'-terminal regions which specifically bind
the cDNA with their respective 3'-terminal regions in the presence
of a nicking enzyme, dNTPs, a detectable oligonucleotide probe, and
a strand-displacement polymerase under conditions permissive for
the isothermal amplification of the cDNA; and
[0010] (c) detecting a signal specific for detectable
oligonucleotide probe hybridization to the amplicon, where
detection of the signal indicates the presence or quantity of the
target polynucleotide present in the sample and failure to detect
the signal indicates the absence of target polyribonucleotide in
the sample.
[0011] In another aspect, the invention provides a method of
detecting an RNA virus in a sample, the method involving
[0012] (a) contacting an RNA virus polynucleotide molecule in a
biological sample with a primer in the presence of a reverse
transcriptase and dNTPs under conditions permissive for cDNA
synthesis, thereby generating a cDNA;
[0013] (b) contacting the cDNA with forward and reverse primers
each carrying at least one nicking enzyme recognition sequence
within their respective 5'-terminal regions which specifically bind
the cDNA with their respective 3'-terminal regions in the presence
of a nicking enzyme, dNTPs, a detectable oligonucleotide probe, and
a strand-displacement polymerase under conditions permissive for
the isothermal amplification of the cDNA; and
[0014] (c) detecting a signal specific for detectable
oligonucleotide probe hybridization to the amplicon, where
detection of the signal indicates the presence or quantity of the
RNA virus polynucleotide molecule present in the sample and failure
to detect the amplicon indicates the absence of an RNA virus.
[0015] In a related aspect, the invention provides a method of
detecting an Ebola virus in a sample, the method involving
[0016] (a) contacting a Ebola polynucleotide molecule in a
biological sample with a primer in the presence of a reverse
transcriptase and dNTPs under conditions permissive for cDNA
synthesis, thereby generating a cDNA;
[0017] (b) contacting the cDNA with forward and reverse primers
each carrying at least one nicking enzyme recognition sequence
within their respective 5'-terminal regions which specifically bind
the cDNA with their respective 3'-terminal regions in the presence
of a nicking enzyme, dNTPs, a detectable oligonucleotide probe, and
a strand-displacement polymerase under conditions permissive for
the isothermal amplification of the cDNA; and
[0018] (c) detecting a signal specific for detectable
oligonucleotide probe hybridization to the amplicon, where
detection of the signal indicates the presence or quantity of the
Ebola polynucleotide present in the sample and failure to detect
the signal indicates the absence of Ebola polynucleotide present in
the sample.
[0019] In various embodiments of the above aspects or any other
aspect of the invention delineated herein, the Ebola polynucleotide
is obtained by contacting a biological sample with an agent capable
of extracting an RNA molecule present in the sample and an agent
capable of stabilizing an RNA molecule against degradation.
[0020] In yet another aspect, the invention provides a method of
detecting an Ebola virus in a sample, the method involving
[0021] (a) contacting a biological sample with an agent capable of
extracting a polynucleotide molecule present in the sample and an
agent capable of stabilizing a polynucleotide molecule against
degradation;
[0022] (b) contacting the extracted and stabilized Ebola RNA with a
primer in the presence of a reverse transcriptase and dNTPs under
conditions permissive for cDNA synthesis, thereby generating an
Ebola cDNA;
[0023] (c) contacting the Ebola cDNA with forward and reverse
primers each carrying at least one nicking enzyme recognition
sequence within their respective 5'-terminal regions which
specifically bind the Ebola cDNA with their respective 3'-terminal
regions in the presence of a nicking enzyme, dNTPs, and a
strand-displacement polymerase under conditions permissive for the
isothermal amplification of the cDNA, thereby generating amplicons;
and
[0024] (d) detecting the amplicons, where the presence of an Ebola
amplicon detects an Ebola polynucleotide in the sample and failure
to detect the amplicon indicates the absence of an Ebola
polynucleotide in the sample.
[0025] In yet another aspect, the invention provides a kit for
detecting an RNA virus polynucleotide molecule involving primers
that specifically bind an RNA viral sequence, a detectable probe
that specifically binds a viral (e.g., Ebola) amplicon, a reverse
transcriptase enzyme, a nicking enzyme, and a strand-displacement
polymerase. In one embodiment, the primers contain the following
sequences:
TABLE-US-00001 Forward primer:
GACTCGATATCGAGTCGCTTCCA[MeOC]AGTTATC[MeOU][MeOA] [MeOC][MeOC][MeOG]
Reverse Primer: GACTCGATATCGAGTCGAAATGC[MeOA]ACGA[MeOC][MeOA]
[MeOC][MeOC][MeOU];
and the probe contains the following sequence:
gctacACGACTTTYGCTGAAGgtagc. In another embodiment, the probe has a
fluorescent dye at the 5' end, and a quencher at the 3' end or vice
versa. In one embodiment, the probe is
[0026] 5'-CALRed.sub.610nm-gctacACGACTTTYGCTGAAGgtagc BHQ2-3'
or
[0027] 5'-FAM or FITC-gctacACGACTTTYGCTGAAGgtagc-BHQ1-3'. In one
embodiment, the 3' quencher is replaced by DABsyl.
[0028] In another aspect, the invention provides a kit for
amplifying an Ebola polynucleotide molecule in a reverse
transcriptase nicking amplification reaction, the kit containing
the following primers:
TABLE-US-00002 Forward primer:
GACTCGATATCGAGTCGCTTCCA[MeOC]AGTTATC[MeOU][MeOA] [MeOC][MeOC][MeOG]
Reverse Primer: GACTCGATATCGAGTCGAAATGC[MeOA]ACGA[MeOC][MeOA]
[MeOC][MeOC][MeOU];
the following probe:
TABLE-US-00003 gctacACGACTTTYGCTGAAGgtagc;
[0029] a reverse transcriptase enzyme, a nicking enzyme, a
strand-displacement polymerase, and directions for use of the
aforementioned primers, probes and enzymes for detecting an Ebola
polynucleotide molecule.
[0030] In one embodiment, the kit further contains a capillary tube
that may or may not contain lyophilized lysis or RNA stabilization
reagents for viral polynucleotide extraction. In another
embodiment, the kit further contains one or more vessels containing
a buffer suitable for carrying out a reverse transcriptase and/or
amplification reaction. In another embodiment, the kit further
contains vessels containing the reverse transcriptase enzyme,
nicking enzyme, and strand-displacement polymerase in lyophilized
form.
[0031] In yet another aspect, the invention provides a method of
diagnosing a human or animal subject with an RNA virus, the method
involving
[0032] (a) contacting a sample of the subject with an agent capable
of extracting an RNA virus present in the sample and an agent
capable of stabilizing the extracted polynucleotide molecule
against degradation;
[0033] (b) contacting the polynucleotide molecule with a reverse
transcriptase primer in the presence of a reverse transcriptase and
dNTPs under conditions permissive for cDNA synthesis, thereby
generating a cDNA copy of the polynucleotide molecule;
[0034] (c) contacting the cDNA with forward and reverse primers
carrying at least one nicking enzyme recognition sequence within
their respective 5'-terminal regions which specifically bind the
cDNA with their respective 3'-terminal regions in the presence of a
nicking enzyme, dNTPs, and a strand-displacement polymerase under
conditions permissive for the isothermal amplification of the cDNA,
thereby generating amplicons; and
[0035] (d) detecting the amplicons, where the presence of an RNA
viral amplicon diagnoses an RNA viral infection in the subject and
failure to detect the amplicon diagnoses the absence of an RNA
viral infection in the subject.
[0036] In various embodiments of any aspect delineated herein, no
detectable signal is present in a control assay lacking a target
polynucleotide at seven minutes, ten minutes, and/or fifteen
minutes following initiation of the assay. In other embodiments of
any aspect delineated herein, the primer used in step (a) has the
same sequence or a different sequence than a primer used in step
(b). In other embodiments of any of the above, steps (a)-(c) are
carried out in a single reaction. In still other embodiments of the
above aspects, the reverse transcriptase enzyme and the
strand-displacement DNA polymerase are the same or different
enzymes. In still other embodiments, the cDNA of step (a) is
generated in a first reaction vessel, then transferred to a second
reaction vessel where step (b) is carried out. In still other
embodiments of any aspect delineated herein, the polynucleotide
molecule is an Ebola polynucleotide. In still other embodiments of
any aspect delineated herein, the sample is a bodily fluid (e.g.,
saliva, sweat, tears, fluids accumulating in a bodily cavity,
urine, ejaculate, vaginal secretion, cerebrospinal fluid, lymph,
feces, sputum, decomposition fluid, vomit, sweat, breast milk,
blood, serum, and plasma). In still other embodiments of any aspect
delineated herein, the bodily cavity is peritoneal cavity or
pericardial cavity. In still other embodiments of any aspect
delineated herein, the limit of detection is 10 or 20 copies per
reaction. In still other embodiments of any aspect delineated
herein, the method is carried out in about 5, 7, 10, 15, 20, 25 or
thirty minutes. In still other embodiments of any aspect delineated
herein, steps a-d are carried out in the context of the biological
sample. In still other embodiments of any aspect delineated herein,
Ebola or other viral RNA is not purified or isolated away from the
biological sample (e.g, crude). In still other embodiments of any
aspect delineated herein, the method is carried out at a point of
care or diagnosis in a portable battery powered device. In still
other embodiments of any aspect delineated herein, no separate
reverse transcriptase primer is required, but the forward and/or
reverse primers are used. In still other embodiments of any aspect
delineated herein, the sample is a biological sample or an
environmental sample. In still other embodiments of any aspect
delineated herein, the biological sample is obtained from a
subject, bat, bush meat, or a domestic animal. In still other
embodiments of any aspect delineated herein, the biological sample
is a swab of a mucosal membrane that is any one or more of buccal,
nasal, eye, rectal, and vaginal or skin. In still other embodiments
of any aspect delineated herein, the biological sample is a tissue
sample obtained from a subject, necropsy, or culture media. In
still other embodiments of any aspect delineated herein, the
necropsy is of a human, primate, bat, or other mammal. In still
other embodiments of any aspect delineated herein, the
environmental sample is a material that may be contaminated with a
biological fluid of a subject having or having a propensity to
develop an Ebola viral infection. In still other embodiments of any
aspect delineated herein, the environmental sample is bedding, a
seat cushion, a rug, an air condition filter or other material. In
still other embodiments of any aspect delineated herein, the
polymerase are 5'-exo.sup.- derivatives of Bst DNA polymerase I,
Gst DNA polymerase I, Gka DNA polymerase I, Gca DNA polymerase I,
Gan DNA polymerase I, Gbo DNA polymerase I, Gsp70 DNA polymerase I,
GspT3 DNA polymerase I, Gsp52 DNA polymerase I and/or fragments
thereof. In still other embodiments of any aspect delineated
herein, the nicking enzyme is one or more of Nt.BstNBI, Nt.BspD6I,
Nt.BspQI, Nt.BsmAI, Nt.AlwI, N.Bst9I, or N.BstSEI. In still other
embodiments of any aspect delineated herein, the reverse
transcriptase is M-MLV RT, AMY RT, RSV RT, and/or mutants/derivates
thereof. In still other embodiments of any aspect delineated
herein, the detectable probe contains a molecular beacon. In
various embodiments of any aspect delineated herein, an
amplification primer (e.g., forward and/or reverse primer)
comprises one or more 2' modified nucleotides (e.g., 2'-O-methyl
ribonucleotides) in the 3' terminal region or recognition region.
In particular embodiments, the amplification primer comprises one
or more 2'-O-methyl modified nucleotides at the 3' end, including
for example 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-hydroxyl,
2'-alkyl, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio,
4'-CH.sub.2--O-2'-bridge, 4'-(CH.sub.2).sub.2--O-2'-bridge, 2'-LNA,
and 2'-O-(N-methylcarbamate). In still other embodiments of any
aspect delineated herein, the forward and reverse primers for
detection of Ebola virus contain the following sequences,
respectively:
TABLE-US-00004 Forward primer:
GACTCGATATCGAGTCGCTTCCA[MeOC]AGTTATC[MeOU][MeOA] [MeOC][MeOC][MeOG]
Reverse Primer: GACTCGATATCGAGTCGAAATGC[MeOA]ACGA[MeOC][MeOA]
[MeOC][MeOC][MeOU]
[0037] In still other embodiments of any aspect delineated herein,
amplification is detected using a probe having the following
sequence: gctacACGACTTTYGCTGAAGgtagc. In still other embodiments of
any aspect delineated herein, the probe has a fluorescent dye at 5'
end, and a quencher at 3' end or vice versa. In still other
embodiments of any aspect delineated herein, the probe is
TABLE-US-00005 5'-CALRed.sub.610mm-gctacACGACTTTYGCTGAAGgtagc
BHQ2-3' or 5'-FAM or FITC -gctacACGACTTTYGCTGAAGgtagc-BHQ1-3''
[0038] In still other embodiments of any aspect delineated herein,
the 3' quencher is replaced by DABsyl. In still other embodiments
of any aspect delineated herein, the forward and reverse primers
for detection of HIV virus contain one or more of the following
sequences, respectively:
TABLE-US-00006 Forward primer:
GACTCGATATCGAGTCTGACTAGmCGGAGGmCmTmAmGmAmAmG,
GACTCGATATCGAGTCTGACTAGmCAGAGGmCmTmAmGmAmAmG; and Reverse Primer:
GACTCGATATCGAGTCTATTGACmGCTCmTmCmGmCmAmC,
GACTCGATATCGAGTCTACTGACmGCTCmTmCmGmCmAmC.
In still other embodiments of any aspect delineated herein,
amplification is detected using a probe having the following
sequence: cgcaagGGAGAGAGATGGGTGcttgcg.
[0039] In still other embodiments of any aspect delineated herein,
the forward and reverse primers for detection of Dengue virus
contain one or more of the following sequences, respectively:
TABLE-US-00007 Forward primer:
GACTCGATATCGAGTCCAAAAACmAGCATATTmGmAmCmGmC; and Reverse Primer:
GACTCGATATCGAGTCAGACAGCmAGGATCmTmCmTmGmG,
GACTCGATATCGAGTCAGACAGCmAGGATCmTmGmTmGmG.
In still other embodiments of any aspect delineated herein,
amplification is detected using a probe having the following
sequence: cgcatcTGGTCTTTCCCAGCgatgcg.
[0040] In still other embodiments of any aspect delineated herein,
the forward and reverse primers for detection of influenza B virus
contain one or more of the following sequences, respectively:
TABLE-US-00008 Forward primer:
GACTCGATATCGAGTCAAATGCAmGATGGTCTCmAmGmCmTmA,
GACTCGATATCGAGTCAAATGCAmAATGGTCTCmAmGmCmTmA,
GACTCGATATCGAGTCAAATGCAmGATGGTTTCmAmGmCmTmA; and Reverse Primer:
GACTCGATATCGAGTCCTCCTTTmTCCCATTCCATmTmCmAmTmT,
GACTCGATATCGAGTCCTCCCTTmTCCCATTCCATmTmCmAmTmT,
GACTCGATATCGAGTCCTCCTTTmCCCCATTCCATmTmCmAmTmT.
In still other embodiments of any aspect delineated herein,
amplification is detected using a probe having the following
sequence: gccaaGCTATGAACACAGCAAActtggc.
[0041] In still other embodiments of any aspect delineated herein,
the forward and reverse primers for detection of BVDV1 virus
contain one or more of the following sequences, respectively:
TABLE-US-00009 Forward primer:
GACTCGATATCGAGTCGGCCCACmTGTATTGCTmAmCmTmGmAmAmA,
GACTCGATATCGAGTCGGCCCACmTGCACTGCTmAmCmTmAmAmAmA; and Reverse
Primer: GACTCGATATCGAGTCTGTGATCmAACTCCmAmTmGmTmGmCmC.
In still other embodiments of any aspect delineated herein,
amplification is detected using a probe having the following
sequence: cgctacATCTCTGCTGTACATGgtagcg. In still other embodiments
of any aspect delineated herein, the probe has a fluorescent dye at
the 5' end and a quencher at the 3' end, or a fluorescent dye at
the 3' end and a quencher at the 5' end. In particular embodiments,
the fluorescent dye is CALRed.sub.610nm, and the quencher is BHQ2
or DABsyl. In certain embodiments, the fluorescent dye is FAM or
FITC and the quencher is BHQ1 or DABsyl.
[0042] In still other embodiments of any aspect delineated herein,
the RNA virus is an Ebola virus, human immunodeficiency virus
(HIV), Dengue virus, influenza virus (e.g., influenza B), Bovine
Viral Diarrhea virus (e.g., BVDV Genotype 1), Yellow Fever virus,
West Nile virus, Hepatitis C, Lassa virus, Flavivirus, Arenavirus,
or single-stranded RNA virus. In still other embodiments of any
aspect delineated herein, the agent capable of extracting the virus
is one of or a combination of sodium dodecyl sulfate, sodium lauryl
sulfate, Guanidinium thiocyanate, and/or guanidine hydrochloride.
In various embodiments, the Guanidinium thiocyanate or other agent
capable of extracting the virus is used at a concentration of about
0.1, 0.5, 1.0, 2.5, 5.0, 7.5, 10, 15, 20, 25, 50, 100, 250, 500 mM
or more. In still other embodiments of any aspect delineated
herein, the method is used for daily screening of health care
workers. In still other embodiments of any aspect delineated
herein, the samples are pooled and the screening is carried out on
a human or animal population.
Definitions
[0043] By "Ebola virus (EBOV)" is meant a Filoviridae virus having
at least about 85% amino acid sequence identity to an Ebola virus.
Exemplary Ebola viruses include, but are not limited to,
Ebola-Zaire virus, Ebola-Sudan virus, Ebola-Ivory Coast virus, and
Ebola-Bundibugyo, which cause disease in humans, or Ebola-Reston
virus, which affects non-human primates.
[0044] The sequence of an exemplary Ebola Zaire genome is provided
at NCBI Accession No. KC242800.1, which is reproduced below:
TABLE-US-00010 1 cggacacaca aaaagaaaga agaattttta ggatcttttg
tgtgcgaata actatgagga 61 agattaataa ttttcctctc attgaaattt
atatcggaat ttaaattgaa attgttactg 121 taatcacacc tggtttgttt
cagagccaca tcacaaagat agagaacagc ctaggtctcc 181 gaagggaaca
agggcaccag tgtgctcagt tgaaaatccc ttgtcaacat ctaggtctta 241
tcacatcaca agttccacct cagactctgc agggtgatcc aacaacccta atagaaaaat
301 tattgttaac ggacagcatt agttcacagt caaacaagca agattgagaa
ttaaccttga 361 ttttgaactt caacacctag aggattggag attcaacaac
cctaaaactt ggggtaaaac 421 attggaaata gttgaaagac aaattgctcg
gaatcacaaa attccgagta tggattctcg 481 tcctcagaaa gtctggatga
cgccgagtct tactgaatct gacatggatt accacaagat 541 cttgacagca
ggtctgtccg ttcaacaggg gattgttcgg caaagagtca tcccagtgta 601
tcaagtaaac aatcttgagg aaatttgcca acttatcata caggcctttg aagcaggtgt
661 tgattttcaa gagagtgcgg acagtttcct tctcatgctt tgtcttcatc
atgcgtacca 721 aggagatcac aaacttttct tggaaagtgg tgcagtcaag
tatttggaag ggcacgggtt 781 ccgttttgaa gtcaagaaac gtgatggggt
gaagcgcctt gaggaattgc tgccagcagt 841 atctagtgga aaaaacatta
agagaacact tgctgccatg ccggaagagg agacgactga 901 agctaatgcc
ggtcagtttc tctcttttgc aagtctattc cttccgaaat tggtagtagg 961
agaaaaggct tgccttgaga aagttcaaag gcaaattcaa gtacatgcag agcaaggact
1021 gatacaatat ccaacagctt ggcaatcagt aggacacatg atggtgattt
tccgtttgat 1081 gcgaacaaat tttttgatca aatttctcct aatacaccaa
gggatgcaca tggttgccgg 1141 gcatgatgcc aacgatgctg tgatttcaaa
ttcagtggct caagctcgtt tttcaggttt 1201 attgattgtc aaaacagtcc
ttgatcatat cctacaaaag acagaacgag gagttcgtct 1261 ccatcctctt
gcaaggactg ccaaggtaaa aaatgaggtg aactccttta aggctgcact 1321
cagctccctg gccaagcatg gagagtatgc tcctttcgcc cgacttttga acctttctgg
1381 agtaaataat cttgagcatg gtcttttccc tcaactatcg gcaattgcac
tcggagtcgc 1441 cacagcacac gggagcaccc tcgcaggagt aaatgttgga
gaacagtatc aacagctcag 1501 agaggctgcc actgaagctg agaagcaact
ccaacaatat gcagaatctc gcgaacttga 1561 ccatcttgga cttgatgatc
aggaaaagaa aattcttatg aacttccatc agaaaaagaa 1621 cgaaatcagc
ttccagcaaa caaacgctat ggtaactcta agaaaagagc gcctggccaa 1681
gctgacagaa gctatcactg ctgcatcact gcccaaaaca agtggacctt acgatgatga
1741 tgacgacatt ccctttccag gacccatcaa tgatgacgac aatcctggcc
atcaagatga 1801 tgatccgact gactcacagg atacgaccat tcccgatgtg
gtggttgatc ccgatgatgg 1861 aagctacggc gaataccaga gttactcgga
aaacggcatg aatgcaccag atgacttggt 1921 cctattcgat ctagacgagg
acgacgagga cactaagcca gtgcctaaca gattgaccaa 1981 gggtggacaa
cagaaaaaca gtcaaaaggg ccagcataca gagggcagac agacacaatc 2041
caggccaact caaaatgtcc caggccctcg cagaacaatc caccacgcca gtgctccact
2101 cacggacaac gacagaggaa atgaaccctc cggctcaacc agccctcgca
tgctgacacc 2161 aattaacgaa gaggcagacc cactggacga tgccgacgac
gagacgtcta gtcttccgcc 2221 cttggagtca gacgatgaag aacaggacag
ggacgaaact tccaaccgca cacccactgt 2281 cgccccaccg gctcccgtat
acagagatca ctctgaaaag aaagaactcc cgcaagatga 2341 gcagcaagat
caggaccaca ctcaagaggc caggaaccag gacagtgaca acacccagcc 2401
agaacactct tttgaggaga tgtatcgcca cattctaaga tcacagggac catttgatgc
2461 tgttttgtat tatcatatga tgaaggatga gcctgtagtt ttcagtacta
gtgatggcaa 2521 agagtacacg tatccggact cccttgaaga ggaatatcca
ccatggctca ctgaaaaaga 2581 ggccatgaat gaagagaata gatttgttac
attggatggt caacaatttt attggccggt 2641 aatgaatcac aagaataaat
tcatggcaat cctgcaacat catcagtgaa tgagaatgga 2701 ataatgggat
gatttaaccg acaaatagct aacattaaat agtcaagaaa cgcaaacagg 2761
aagaattttt gatgtctaag gtgtgaatta ttatcacaat aaaagtgatt cttatttttg
2821 aatttaaagc tagcttatta ttactagccg tttttcaaag ttcaatttga
gtcttaatgc 2881 aaataggcgt taagccacag ttatagccat aattgtaact
caatatctta gctagcgatt 2941 tatctaaatt aaattacatt atgcttttat
aacttaccta ctagcctgcc caacatttac 3001 acgatcgttt tataattaag
aaaaaactaa tgatgaagat taaaaccttc atcatcctta 3061 cgtcaattga
attctctagc actcgaagct tattgtcttc aatgtaaaag aaaagctggt 3121
ccaacaagat gacaactaga acaaagggca ggggccatac tgtggccacg actcaaaacg
3181 acagaatgcc aggccctgag ctttcgggct ggatctccga gcagctaatg
accggaagaa 3241 ttcctgtaag cgacatcttc tgtgatattg agaacaatcc
aggattatgt tacgcatccc 3301 aaatgcaaca aacaaagcca aacccgaaga
tgcgcaacag tcaaacccaa acggacccaa 3361 tttgcaatca tagttttgag
gaggtagtac aaacattggc ttcattggct actgttgtgc 3421 aacaacaaac
tatcgcatca gaatcattag aacaacgtat tacgagtctt gagaatggtc 3481
taaagccagt ttatgatatg gcaaaaacaa tctcctcatt gaacagggtt tgtgctgaga
3541 tggttgcaaa atatgatctt ctggtgatga caaccggtcg ggcaacagca
accactgcgg 3601 caactgaggc ttattgggct gaacatggtc aaccaccacc
tggaccatca ctttatgaag 3661 aaagtgcaat tcggggtaag attgaatcta
gagatgagac cgtccctcaa agtgttaggg 3721 aggcattcaa caatctagac
agtaccactt cactaactga ggaaaatttt gggaaacctg 3781 acatttcagc
aaaggatttg agaaacatta tgtatgatca cttgcctggt tttggaactg 3841
ctttccacca attagtacaa gtgatttgta aattgggaaa agatagcaac tcattggata
3901 tcattcatgc tgagttccag gccagcctgg ctgaaggaga ctctcctcaa
tgtgccctaa 3961 ttcaaattac aaaaagagtt ccaatcttcc aagatgctgc
tccacctgtc atccacatcc 4021 gctctcgagg tgacattccc cgagcttgcc
agaaaagctt gcgtccagtc ccgccatcac 4081 ccaagattga tcgaggttgg
gtatgtgttt tccagcttca agatggtaaa acacttggac 4141 tcaaaatttg
agccaatctc ccttccctcc gaaagaggcg accaatagca gaggcttcaa 4201
ctgctgaact acagggtacg ttacattaat gatacacttg tgagtatcag ccctagataa
4261 tataagtcaa ttaaacgacc aagccaaaat tgttcatatc ccgctagcag
cttaaaatat 4321 aaatgaaata ggagctatat ctctgacagt attataatca
attgttatta agtaacccaa 4381 accaaaaatg atgaagatta agaaaaacct
acctcgactg agagagtgtt tttccattaa 4441 ccttcatctt gtaaacgttg
agcaaaattg ttacgaatat gaggcgggtt atattgccta 4501 ctgctcctcc
tgaatatatg gaggccatat accctgtcag gtcaaattca acaattgcta 4561
ggggtggcaa caacaataca ggcttcctga caccggagtc agtcaatgga gacactccat
4621 cgaatccact caggccaatt gctgatgaca ccatcgacca tgctagccac
acaccaggca 4681 gtgtgtcatc agcattcatc cttgaagcta tggtgaatgt
catatcgggc cccaaagtgc 4741 taatgaagca aattccaatt tggcttcctc
taggtgtcgc tgatcaaaag acctacagct 4801 ttgactcaac tacggccgcc
atcatgcttg cttcatatac tatcacccat ttcggcaagg 4861 caaccaatcc
acttgtcaga gtcaatcggc tgggtcctgg aatcccggat caccccctca 4921
ggctcctgcg aattggaaac caggccttcc tccaggagtt cgttcttccg ccagtccaac
4981 taccccagta tttcaccttt gatttgacag cactcaaact gatcacccaa
ccactgcctg 5041 ctgcaacatg gaccgatgac actccaacag gatcaaatgg
agcgctgcgt ccaggaattt 5101 cgtttcatcc aaaacttcgc cccattcttt
tacctaacaa aagtgggaag aaggggaaca 5161 gtgccgatct aacatctcca
gagaaaatcc aagcaataat gacttcactc caggacttta 5221 agatcgttcc
aattgatcca accaaaaata tcatgggtat cgaagtgcca gaaactctgg 5281
tccacaagct gaccggtaag aaggtgactt ctaaaaatgg acaaccaatc atccctgttc
5341 ttttgccaaa gtacattggg ttggacccgg tggctccagg agacctcacc
atggtaatca 5401 cacaggattg tgacacgtgt cattctcctg caagtcttcc
agctgtgatt gagaagtaat 5461 tgcaataatt gactcagatc cagttttaca
gaatcttctc agggatagtg ataacatcta 5521 tttagtaatc cgtctattag
aggagatact tttaattgat caatatacta aaggtgcttt 5581 acaccattgt
cttttttctc tcctaaatgt agaacttaac aaaagactca caatatactt 5641
gtcttaaaga gattgattga tgaaagatca tgactaataa cattacaaat aatcctacta
5701 taatcaatac ggtgattcaa atattaatct ttctaattgc acatactctc
tgcccctatc 5761 ctcaaattgc ctacatgcct acatctgagg atagccagtg
tgacttggat tggagatgta 5821 gggaagaaat cggaacccat ctccaggttg
ttcacaatcc aagcacagac atcgcccttc 5881 taattaagaa aaaatcggcg
atgaagatta agccgacagt gagcgcaatc ttcatctctc 5941 ttagattatt
tgttttccag agtaggggtc atcaggtcct ttccaatcat ataaccaaaa 6001
taaacttcac tagaaggata ttgtgaggca acaacacaat gggtattaca ggaatattgc
6061 agttacctcg tgatcgattc aagaggacat cattctttct ttgggtaatt
atccttttcc 6121 aaagaacatt ttccatccca cttggagtca tccacaatag
cacattacaa gttagtgatg 6181 tcgacaaact agtttgtcgt gacaaactgt
catccacaaa tcaattgaga tcagttggac 6241 tgaatctcga agggaatgga
gtggcaactg acgtgccatc tgcaactaaa agatggggct 6301 tcaggtccgg
tgtccctcca aaggtggtca attatgaagc tggtgaatgg gctgaaaact 6361
gctacaatct tgaaatcaaa aaacctgacg ggagtgagtg tctaccagca gcgccagacg
6421 ggattcgggg cttcccccgg tgccggtatg tgcacaaagt atcaggaacg
ggaccgtgtg 6481 ccggagactt tgccttccac aaagagggtg ctttcttcct
gtatgatcga cttgcttcca 6541 cagttatcta ccgaggaacg actttcgctg
aaggtgtcgt tgcatttctg atactgcccc 6601 aagctaagaa ggacttcttc
agctcacacc ccttgagaga gccggtcaat gcaacggagg 6661 acccgtccag
tggctactat tctaccacaa ttagatatca ggctaccggt tttggaacca 6721
atgagacgga gtacttgttc gaggttgaca atttgaccta cgtccaactt gaatcaagat
6781 tcacgccaca gtttttgctc cagctgaatg agacaatata tgcaagtggg
aaaaggagca 6841 acaccacggg aaaactaatt tggaaggtca accccgaaat
tgatacaaca atcggggagt 6901 gggccttctg ggaaactaaa aaaacctcac
tagaaaaatt cgcagtgaag agttgtcttt 6961 cacagctgta tcaaacggag
ccaaagacat cagtggtcag agtccggcgc gaacttcttc 7021 cgacccagag
acctacacaa caactgaaga ccacaaaatc atggcttcag aaaattcctc 7081
tgcaatggtt caagtgcaca atcaaggaag ggaagctgca gtgtcgcatc tgataaccct
7141 tgccacaatc tccacgagtc ctcaatcccc tacaaccaaa ccaggtcagg
acaacagcac 7201 ccataataca cccgtgtata aacttgacat ctctgaggca
actcaagttg aacaacatca 7261 tcgcagaaca gacaacgaca gcacagcctc
cgacactccc cccgccacga ccgcagccgg 7321 acccccaaaa gcagagaaca
tcaacacgag caagagcgct gactccctgg accccgccac 7381 cacgacaagt
ccccaaaact acagcgagac cgctggcaac aacaacactc atcaccaaga 7441
taccggagaa gagagtgccg gcagcgggaa gctgggcttg attgccaata
ctattgctgg
7501 agtcgcaggg ctgatcacag gcgggagaag aactcgaaga gaagcaattg
tcaatgctca 7561 acccaaatgc aaccccaatc tacattactg gactactcag
gatgaaggtg ctgcaatcgg 7621 attggcctgg ataccatatt tcgggccagc
agccgaggga atttacacag aggggctaat 7681 gcacaatcaa gatggtttaa
tctgtggatt gaggcagctg gccaatgaga cgactcaagc 7741 tcttcaactg
ttcctgagag ccacaactga gctacgcacc ttttcaatcc tcaaccgtaa 7801
ggcaattgat ttcttgctgc agcgatgggg cggcacatgc cacattttgg gaccggactg
7861 ctgtatcgaa ccacatgatt ggaccaagaa cataacagac aaaattgatc
agattattca 7921 tgattttgtt gataaaaccc ttccggacca gggggacaat
gacaattggt ggactggatg 7981 gagacaatgg ataccggcag gtattggagt
tacaggcgtt ataattgcag ttattgcttt 8041 attctgtata tgcaaatttg
tcttttagtt tttcttcaga ttgcttcatg gcaaagctca 8101 gcctcaaatc
aatgagatta ggatttaatt atatggatca cttgaatcta agattacttg 8161
acaaatgata atataataca ctggagcttt aaatatagcc aatgtgattc taactccttt
8221 aaactcacaa ttaatcataa acaaggtttg acatcaatct agttatatct
ttgagaatga 8281 taaacttgat gaagattaag aaaaaggtaa tctttcgatt
atctttagtc ttcatccttg 8341 attctacaat catgacagtt gtctttagtg
acaagggaaa gaagcctttt tagtaagttg 8401 taataatcag atctgcgaac
cggtagagtt taattgcaac ctaacacaca taaagcattg 8461 gtcaaaaagt
caatagaaat ttaaacagtg agtggagaca actttcaaat ggaagctcca 8521
tacgagagag gacgcccccg agctgccaga cagcattcaa gggatggaca cgaccatcat
8581 gttcgagcac gatcatcatc cagagagaat tatcgaggtg agtaccgtca
atcaaggagc 8641 gcctcacaag tgcgcgttcc tactgtattt cataagagga
gagttgaacc attaacagtt 8701 cctccagcac ctaaagacat atgtccgacc
ttgaaaaaag gatttttgtg tgacagtagt 8761 ttttgcaaaa aagatcacca
gttggaaagt ttaactgata gggaattact cctactaatc 8821 gcccgtaaga
cttgtggatc agtagaacaa caattaaata taactgcacc caaggactcg 8881
cgcttagcaa atccaacggc tgatgatttc cagcaagagg aaggtccaaa aattaccttg
8941 ttgacactga tcaagacggc agaacactgg gcgagacaag acatcaggac
cacagaggat 9001 tcaaaattaa gagcattgtt gactctatgt gctgtgatga
cgaggaaatt ctcaaaatcc 9061 cagctgagtc ttttatgtga gacacacctg
aggcgcgagg ggcttgggca agatcaggca 9121 gaacccgttc tcgaagtata
tcaacgatta cacagtgata aaggaggcag tttcgaagct 9181 gcactatggc
aacaatggga tcgacaatcc ctaattatgt ttatcactgc attcttgaat 9241
atcgctctcc agttaccgtg tgaaagttct gctgtcgttg tttcagggtt aagaacattg
9301 gttcctcaat cagataatga ggaagcttca accaacccgg ggacatgctc
atggtctgat 9361 gatggtaccc cttaataagg ctgactaaaa cactatataa
ccttctactt gatcacaata 9421 ctccgtatac ctatcatcat atattcaatc
aagacggtat cctttaaaac ttattcagta 9481 ctataatcac tctcgtttca
aattaataag atatgcataa ttgctttaat atatgaagag 9541 gtatgataca
accctaacag tgatcaaaga aaatcataat ctcttatcgc tcgtaatata 9601
acctgccaag catacctctt gcacaaagtg attcttgtac acaaataatg ttttactcta
9661 caggaggtag caacgatcca tcccatcaaa aaataagtat tttatgactt
actaatgatc 9721 tcttaaaata ttaagaaaaa ctgacggaac acaaattctt
tctgcttcaa gttgtggagg 9781 aggtctttgg tattggctat tgttatatta
caatcaataa caagcttgta aaaatattgt 9841 tcttgtttca agaggtagat
tgtgaccgga aacgctaaac taatgatgaa gattaatgcg 9901 gaggtctgat
aagaataaac cttattattc agattaggcc ccaagaggca ttcttcatct 9961
ccttttagca aagtactatt tcagggtagt ccaattagtg acacgtcttt tagctgtata
10021 tcagtcgccc ctgagatacg ccacaaaagt gtctctaagc taaattggtc
tgtacacatc 10081 tcatacattg tattaggggc aataatatct aattgaactt
agccgtttaa aatttagtgc 10141 ataaacctgg gctaactcca ccaggtcaac
tccattggct gaaaagaagc ccacctacaa 10201 cgaacatcac tttgagcgcc
cttacaatta aaaaatagga acgtcgttcc aacaattgag 10261 cgcaaggttt
caaggttgaa ctgagagtgc ctaaacacca aaatatcgat aattcagaca 10321
ccaagcaaga cctgagaagg aaccatggct aaagctacgg gacgatacaa tctaatatcg
10381 cccaaaaagg acctggagaa aggggttgtc ttaagcgacc tctgtaactt
cctagttagt 10441 caaactattc aagggtggaa ggtctattgg gctggtattg
agtttgatgt gactcacaaa 10501 ggaatggccc tattgcatag actgaaaact
aatgactttg cccctgcatg gtcaatgaca 10561 aggaatctat ttcctcattt
atttcaaaat ccgaattcca caattgagtc accactgtgg 10621 gcattgagag
tcatccttgc agcaggggta caggaccagc tgattgacca gtctttgatt 10681
gaacccttag caggagccct tggtctgatc tctgattggc tgctaacaac caacactaac
10741 catttcaaca tgcgaacaca acgtgttaag gaacaattga gcctaaaaat
gctgtcgttg 10801 attcgatcca atattctcaa gtttattaac caattggatg
ctctacatgt cgtgaactac 10861 aacgggttgt tgagcagtat tgaaattgga
actcaaaatc atacaatcat tataactcga 10921 actaacatgg gttttctggt
ggagctccaa gaacccgaca aatcggcaat gaaccgcaag 10981 aagcctgggc
cggcgaaatt ttccctcctt catgagtcca cactgaaagc atttacacaa 11041
gggtcctcga cacgaatgca aagtttgatt cttgaattta atagctctct tgctatctaa
11101 ttaagatgga atacttcata ttgagctaac tcatatatgc tgactcaata
gttatcttga 11161 catctctgct ttcataatca gatatataag cataataaat
aaatactcat atttcttgat 11221 aatttgttta accacagata aatcctaact
gtaagccagc ttccaagttg acacccttac 11281 aaaaaccagg actcagaatc
cctcaaataa gagattccaa gacaacatca tagaattgct 11341 ttattatatg
aataagcatg ttatcaccag aaatccaata tactaaatag ttaattgtaa 11401
ctgaacccgc aggtcacgtg tgttaggttt cacagattat atatattact aactccatac
11461 ccgtaattaa cattagataa gtagattaag aaaaacgctt gaggaagatt
aagaaaaact 11521 gcttattggg tctttccgtg ttttagatga agcagttgac
attcttcctc ttgatattaa 11581 atggctacac aacataccca atacccagac
gccaggttat catcaccaat tgtattggac 11641 caatgtgacc tagtcactag
agcttgcggg ttatattcat catactccct taatccgcaa 11701 ctacgcaact
gtaaactccc gaaacatatc taccgtttaa aatatgatgt aactgttacc 11761
aagttcttaa gtgatgtacc agtggcgaca ttgccaatag atttcatagt cccaattctt
11821 ctcaaggcac tgtcaggcaa tgggttctgt cctgttgagc cgcggtgtca
acagttctta 11881 gatgaaatca ttaagtacac aatgcaagat gctctcttcc
tgaaatatta tctcaaaaat 11941 gtgggtgctc aagaggactg tgttgatgac
cactttcaag agaaaatctt atcttcaatt 12001 cagggcaatg aatttttaca
tcaaatgttc ttctggtatg acctggctat tttgactcga 12061 aggggtagat
taaatcgagg aaactctaga tcaacatggt ttgttcatga tgatttaata 12121
gacatcttag gctatgggga ctatgttttt tggaagatcc caatttcaat gttacccctg
12181 aacacacaag gaatccccca tgctgctatg gattggtatc aggcatcagt
attcaaagaa 12241 gcggttcaag ggcatacaca cattgtttct gtttctactg
ccgacgtctt gataatgtgc 12301 aaagatttaa ttacatgtcg attcaacaca
actctaatct caaagatagc agaggttgag 12361 gatccagttt gttctgatta
tcccgatttt aagattgtgt ctatgcttta ccagagcgga 12421 gattacttac
tctccatatt agggtctgat gggtataaaa ttattaagtt cctcgaacca 12481
ttgtgcttgg ccaaaattca attatgctca aagtacaccg agaggaaggg ccgattctta
12541 acacaaatgc atttagctgt aaatcacacc ctggaagaaa ttacagaaat
gcgtgcacta 12601 aagccttcac aggatcaaaa gatccgtgaa ttccatagaa
cattgataag gctggagatg 12661 acgccacaac aactttgtga gctattttcc
attcaaaaac actgggggca tcctgtgcta 12721 catagtgaaa cagcaatcca
aaaagttaaa aaacatgcca cggtgctaaa agcattacgc 12781 cctatagtga
ttttcgagac atattgtgtt tttaaatata gtattgcaaa acattatttt 12841
gatagtcaag gatcttggta cagtgttact tcagatagga atttaacgcc aggtcttaat
12901 tcttatatca aaagaaatca attccccccg ttgccaatga ttaaagaact
actatgggaa 12961 ttttaccacc ttgaccatcc tccacttttc tcaaccaaaa
ttattagtga cttaagtatt 13021 tttataaaag acagagctac cgcagtggaa
aggacatgct gggatgcagt attcgagcct 13081 aatgttctag gatataatcc
acctcacaaa ttcagtacta aacgtgtacc agaacaattt 13141 ttagagcaag
aaaacttttc tattgagaat gttctttcct acgcgcaaaa actcgagtat 13201
ctactaccac aataccggaa tttttctttc tcattgaaag agaaagagtt gaatgtaggt
13261 agaactttcg gaaaattgcc ttatccgact cgcaatgttc aaacactttg
tgaagctctg 13321 ttagctgatg gtcttgctaa agcatttcct agcaatatga
tggtagtcac agagcgtgag 13381 caaaaagaaa gcttattgca tcaagcatca
tggcaccaca caagtgatga ttttggtgag 13441 catgccacag ttagagggag
tagctttgta actgatttag agaaatacaa tcttgcattt 13501 agatatgagt
ttacagcacc ttttatagaa tattgtaacc gttgctatgg tgttaagaat 13561
gtttttaatt ggatgcatta tacaatcccc cagtgttata tgcatgtcag tgattattat
13621 aatccaccgc ataacctcac tctggaaaat cgagacaacc cccccgaagg
gcccagttca 13681 tacagaggtc atatgggagg gattgaagga ctgcaacaaa
aactctggac aagtatttca 13741 tgtgctcaaa tttctttagt tgaaataaag
actggtttta agttacgctc agctgtgatg 13801 ggtgacaatc agtgcattac
cgttttatca gtcttcccct tagagactga cgcagacgag 13861 caggaacaga
gcgccgaaga caatgcagcg agggtggccg ccagcctagc aaaagttaca 13921
agtgcctgtg gaatcttttt aaaacctgat gaaacatttg tacattcagg ttttatctat
13981 tttggaaaaa aacaatattt gaatggggtc caattgcctc agtcccttaa
aacggctaca 14041 agaatggcac cattgtctga tgcaattttt gatgatcttc
aagggaccct ggctagtata 14101 ggcactgctt ttgaacgatc catctctgag
acacgacata tctttccttg caggataacc 14161 gcagctttcc atacgttttt
ttcggtgaga atcttgcaac atcatcacct cgggttcaat 14221 aagggttttg
accttggaca gttgacactt ggcaaacctc tggatttcgg aacaatatca 14281
ttggcactag cggtaccgca ggtgcttgga gggttatcct tcttgaatcc tgagaaatgt
14341 ttctaccgga atttaggaga tccagttacc tcaggcttat tccagttaaa
aacttatctc 14401 cgaatgattg agatggatga tttattctta cctttaattg
cgaagaaccc tgggaactgc 14461 actgccattg actttgtgct aaatcctagc
ggattaaatg tccccgggtc gcaagactta 14521 acttcatttc tgcgccagat
tgtgcgtagg actatcaccc taagtgcgaa aaacaaactt 14581 attaatactt
tatttcatgc gtcagctgac ttcgaagacg aaatggtttg taaatggcta 14641
ttatcatcaa ctcctgttat gagtcgtttt gcggccgata tcttttcacg cacgcccagt
14701 gggaagcgat tgcaaattct aggatacctg gaaggaacac gcacattatt
agcctctaag 14761 atcatcaaca ataatacaga aacaccggtt ttggacagac
tgaggaaaat aacattgcaa 14821 aggtggagtc tatggtttag ttatcttgat
cattgtgata atatcctggc agaggcttta 14881 acccaaataa cttgcacagt
tgatttagca cagatcctga gggaatattc atgggcacat 14941 attttagagg
ggagacctct tattggagcc acacttccat gtatgattga gcaattcaaa 15001
gtggtttggc tgaaacccta cgaacaatgt ccgcagtgtt caaatgcaaa
gcaacctggt
15061 gggaaaccat tcgtgtcagt ggcagtcaag aaacatattg ttagtgcatg
gccgaacgca 15121 tcccgaataa gctggactat cggggatgga atcccataca
ttggatcaag gacagaagat 15181 aagataggac aacctgctat taaaccaaaa
tgtccttccg cagccttaag agaggccatt 15241 gaactggcgt cccgtttaac
atgggtaact caaggcagtt cgaacagtga tttgctaata 15301 aaaccatttt
tggaagcacg agtaaattta agtgttcaag aaatacttca aatgacccct 15361
tcacattact caggaaatat tgttcacagg tacaacgatc aatatagtcc tcattctttc
15421 atggccaatc gtatgagtaa ttcagcgacg cgattgattg tttctactaa
cactttaggt 15481 gagttttcag gaggtggcca gtctgcacgc gacagcaata
ttattttcca gaatgttata 15541 aattatgcag ttgcactgtt cgatattaaa
tttagaaaca ctgaggctac agatatccaa 15601 tataatcgtg ctcaccttca
tctaactaag tgttgcaccc gggaagtacc agctcagtat 15661 ttaacataca
catctacatt ggatttagat ttaacaagat accgagaaaa cgaattgatt 15721
tatgacaata atcctctaaa aggaggactc aattgcaata tctcattcga taacccattt
15781 ttccaaggta aacggctaaa cattatagaa gatgatctta ttcgactgcc
tcacttatct 15841 ggatgggagc tagccaagac catcatgcaa tcaattattt
cagatagcaa caattcgtct 15901 acagacccaa ttagcagtgg agaaacaaga
tcattcacta cccatttctt aacttatccc 15961 aagataggac ttctgtacag
ttttggggcc tttataagtt attatcttgg caatacaatt 16021 cttcggacta
agaaattaac acttgacaat tttttatatt acttaactac ccaaattcat 16081
aatctaccac atcgctcatt gcgaatactt aagccaacat tcaaacatgc aagcgttatg
16141 tcacggttaa tgagtattga tcctcatttt tctatttaca taggcggtgc
ggcaggtgac 16201 agaggactct cagatgcggc caggttattt ttgagaacgt
ccatttcatc ttttcttgca 16261 tttataaaag agtggataat taatcgcgga
acaattgtcc ctttatggat agtatatccg 16321 ctagagggtc aaaacccaac
acctgttaat aatttcctcc atcagatcgt agaactgctg 16381 gtgcatgatt
catcaagaca acaggctttt aaaactacca taagtgatca tgtacatcct 16441
cacgacaatc ttgtttacac atgtaagagt acagccagca atttcttcca tgcgtcattg
16501 gcgtactgga gaagcaggca cagaaacagc aatcgaaaat acttggcaag
agactcttca 16561 actggatcaa gcacaaacaa cagtgatggt catattgaga
gaagtcaaga acaaaccacc 16621 agagatccac atgatggcac tgaacggaat
ctagtcctac aaatgagcca tgaaataaaa 16681 agaacgacaa ttccacaaga
aagcacgcac cagggtccgt cgttccagtc atttctaagt 16741 gactctgctt
gtggtacagc aaatccaaaa ctaaatttcg atagatcgag acataatgtg 16801
aaatctcagg atcataactc ggcatccaag agggaaggtc atcaaataat ctcacaccgt
16861 ctagtcctac ctttctttac attgtctcaa gggacgcgcc aattaacgtc
atccaatgag 16921 tcacaaaccc aagacgagat atcaaagtac ttacggcaat
tgagatccgt cattgatacc 16981 acagtttatt gtaggtttac cggtatagtc
tcgtccatgc attacaaact tgatgaggtc 17041 ctttgggaaa tagagagttt
taagtcggct gtgacgctag cagagggaga aggtgctggt 17101 gccttactat
tgattcagaa ataccaagtt aagaccttat ttttcaacac gctagctact 17161
gagtccagta tagagtcaga aatagtatca ggaacgacta ctcctaggat gcttctacct
17221 gttatgtcaa aattccataa tgaccaaatt gagattattc ttaacaattc
ggcaagccaa 17281 ataacagaca taacaaatcc tacttggttc aaagaccaaa
gagcaaggct acctaggcaa 17341 gtcgaggtta taaccatgga tgcagagacg
acagaaaata taaacagatc gaaattgtac 17401 gaagctgtat ataaattgat
cttacaccat attgatccca gcgtattgaa agcagtggtc 17461 cttaaagtct
ttctaagtga tactgagggt atgttatggc taaatgataa tttagccccg 17521
ttttttgcca ctggttattt aattaagcca ataacgtcaa gtgctagatc tagtgagtgg
17581 tatctttgtc tgacgaactt cttatcaact acacgtaaga tgccacacca
aaaccatctc 17641 agttgtaaac aggtaatact tacggcattg caactgcaaa
ttcaacggag cccatactgg 17701 ctaagtcatt taactcagta tgctgactgc
gatttacatt taagttatat ccgccttggt 17761 tttccatcat tagagaaagt
actataccac aggtataacc tcgtcgattc aaaaagaggt 17821 ccactagtct
ctatcactca gcacttggca catcttagag cagagattcg agaattgact 17881
aatgattata atcaacagcg acaaagtcgg actcaaacat atcactttat tcgtactgca
17941 aaaggacgaa tcacaaaact agtcaatgat tatttaaaat tctttcttat
tgtgcaagca 18001 ttaaaacata atgggacatg gcaagctgag tttaagaaat
taccagagtt gattagtgtg 18061 tgcaataggt tctatcatat tagagattgc
aattgtgaag aacgtttctt agttcaaacc 18121 ttatatctac atagaatgca
ggattctgaa gttaagctta tcgaaaggct gacagggctt 18181 ctgagtttat
tcccggatgg tctctacagg tttgattgaa ttaccgtgca tagtatcctg 18241
atacttgtga aggttgatta tcaacgtaca gattataaaa aactcacaaa ttgctctcat
18301 acatcatatt gatcgaattt caataaataa ctatttaaat aacgaaagaa
gtccttatat 18361 tatacactat atttagcctc tctccctgcg tgataatcaa
aaaattcaca atgcagcatg 18421 tgtgacatat tacttccgcg atgaatctaa
cgcaacataa taaactctgc actctttata 18481 attaagcttt aacaaaaggt
ctgggctcat attgttattg atataataat gttgtatcaa 18541 tatcctgtca
gatggaatag tgttttggtt gataacacga cttcttaaaa caaaattgat 18601
cttcaagatt aagtttttta taattatcat tactttaatt tgtcgattta aaaatggtga
18661 tagccttaat ctttgtgtaa aataagagat taggtgtaat aactttaaca
ttttgtctag 18721 taagctacta tttcatacag aatgataaaa ttaaaagaaa
aggcatgact gtaaaatcag 18781 aaataccttc tttacaatat agcagactag
ataataatct tcgtgttaat gataattaag 18841 acattgacca cgctcatcag
gaggctcgcc aggataaacg ttgcaaaaag gattcctgga 18901 aaaatggtcg
cacacaaaaa tttaaaaata aatctatttc ttcttttttg tgtgtcca
The invention further provides polynucleotides having at least
about 85, 90, 95, 96, 97, 98, 99, or 100% identity to this
sequence. Other Ebola Zaire genomes are known in the art and
described, for example, by Baize et al., N Engl J Med 2014;
371:1418-25., which is incorporated herein by reference.
[0045] By "Ribonuclease P RNA component H1 (RPPH1) is meant the RNA
component of the RNase P ribonucleoprotein, an endoribonuclease
that cleaves tRNA precursor molecules to form the mature 5-prime
termini of their tRNA sequences. An exemplary nucleic acid sequence
is provided at NCBI Accession No. NR 002312.
TABLE-US-00011 1 atagggcgga gggaagctca tcagtggggc cacgagctga
gtgcgtcctg tcactccact 61 cccatgtccc ttgggaaggt ctgagactag
ggccagaggc ggccctaaca gggctctccc 121 tgagcttcgg ggaggtgagt
tcccagagaa cggggctccg cgcgaggtca gactgggcag 181 gagatgccgt
ggaccccgcc cttcggggag gggcccggcg gatgcctcct ttgccggagc 241
ttggaacaga ctcacggcca gcgaagtgag ttcaatggct gaggtgaggt accccgcagg
301 ggacctcata acccaattca gactactctc ctccgcccat t
[0046] By "amplicon" is meant a polynucleotide generated during the
amplification of a polynucleotide of interest. In one example, an
amplicon is generated during a polymerase chain reaction.
[0047] By "amplification rate modifiers" is meant an agent capable
of affecting the rate of polymerase extension.
[0048] By "base substitution" is meant a substituent of a
nucleobase polymer that does not cause significant disruption of
the hybridization between complementary nucleotide strands.
[0049] In this disclosure, "comprises," "comprising," "containing"
and "having" and the like can have the meaning ascribed to them in
U.S. Patent law and can mean " includes," "including," and the
like; "consisting essentially of" or "consists essentially"
likewise has the meaning ascribed in U.S. Patent law and the term
is open-ended, allowing for the presence of more than that which is
recited so long as basic or novel characteristics of that which is
recited is not changed by the presence of more than that which is
recited, but excludes prior art embodiments.
[0050] By "complementary" or "complementarity" is meant that a
nucleic acid can form hydrogen bond(s) with another nucleic acid
sequence by either traditional Watson-Crick or Hoogsteen base
pairing. Complementary base pairing includes not only G-C and A-T
base pairing, but also includes base pairing involving universal
bases, such as inosine. A percent complementarity indicates the
percentage of contiguous residues in a nucleic acid molecule that
can form hydrogen bonds (e.g., Watson-Crick base pairing) with a
second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10
nucleotides out of a total of 10 nucleotides in the first
oligonucleotide being based paired to a second nucleic acid
sequence having 10 nucleotides represents 50%, 60%, 70%, 80%, 90%,
and 100% complementary respectively). To determine that a percent
complementarity is of at least a certain percentage, the percentage
of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence is calculated and rounded to the nearest
whole number (e.g., 12, 13, 14, 15, 16, or 17 nucleotides out of a
total of 23 nucleotides in the first oligonucleotide being based
paired to a second nucleic acid sequence having 23 nucleotides
represents 52%, 57%, 61%, 65%, 70%, and 74%, respectively; and has
at least 50%, 50%, 60%, 60%, 70%, and 70% complementarity,
respectively). As used herein, "substantially complementary" refers
to complementarity between the strands such that they are capable
of hybridizing under biological conditions. Substantially
complementary sequences have 60%, 70%, 80%, 90%, 95%, or even 100%
complementarity. Additionally, techniques to determine if two
strands are capable of hybridizing under biological conditions by
examining their nucleotide sequences are well known in the art.
[0051] As used herein, "duplex" refers to a double helical
structure formed by the interaction of two single stranded nucleic
acids. A duplex is typically formed by the pairwise hydrogen
bonding of bases, i.e., "base pairing", between two single stranded
nucleic acids which are oriented antiparallel with respect to each
other. Base pairing in duplexes generally occurs by Watson-Crick
base pairing, e.g., guanine (G) forms a base pair with cytosine (C)
in DNA and RNA, adenine (A) forms a base pair with thymine (T) in
DNA, and adenine (A) forms a base pair with uracil (U) in RNA.
Conditions under which base pairs can form include physiological or
biologically relevant conditions (e.g., intracellular: pH 7.2, 140
mM potassium ion; extracellular pH 7.4, 145 mM sodium ion).
Furthermore, duplexes are stabilized by stacking interactions
between adjacent nucleotides. As used herein, a duplex may be
established or maintained by base pairing or by stacking
interactions. A duplex is formed by two complementary nucleic acid
strands, which may be substantially complementary or fully
complementary. Single-stranded nucleic acids that base pair over a
number of bases are said to "hybridize."
[0052] "Detect" refers to identifying the presence, absence or
amount of the analyte to be detected. In one embodiment, the
analyte is an Ebola polynucleotide or other RNA viral
polynucleotide.
[0053] By "detectable moiety" is meant a composition that when
linked to a molecule of interest renders the latter detectable, via
spectroscopic, photochemical, biochemical, immunochemical, or
chemical means. For example, useful labels include radioactive
isotopes, magnetic beads, metallic beads, colloidal particles,
fluorescent dyes, electron-dense reagents, enzymes (for example, as
commonly used in an ELISA), biotin, digoxigenin, or haptens.
[0054] By "fragment" is meant a portion of a nucleic acid molecule.
This portion contains, preferably, at least 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, or 90% of the entire length of the reference
nucleic acid molecule or polypeptide. A fragment may contain 5, 10,
15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In one
embodiment, the fragment comprises at least about 50, 75, 80, 85,
89, 90, or 100 nucleotides of an Ebola polynucleotide or other RNA
viral polynucleotide.
[0055] By "free energy (.DELTA.G)" is meant the net exchange of
energy between the system and its environment at a constant
temperature and pressure described by the formula:
.DELTA.G=.DELTA.H-T.DELTA.S. Free energy represents how
thermodynamically stable a structure is, with formation of
structures having a negative .DELTA.G (e.g., expressed in
kcal/mole) being thermodynamically stable (i.e., a structure having
a lower .DELTA.G is more stable than one having a higher .DELTA.G).
The thermodynamic potential is minimized when a system reaches
equilibrium at constant pressure and temperature.
[0056] By "hybridize" is meant to form a double-stranded molecule
between complementary polynucleotide sequences (e.g., a gene
described herein), or portions thereof, under various conditions of
stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods
Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).
Hybridization occurs by hydrogen bonding, which may be
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding,
between complementary nucleobases. For example, adenine and thymine
are complementary nucleobases that pair through the formation of
hydrogen bonds.
[0057] By "isolated polynucleotide" is meant a nucleic acid (e.g.,
a DNA, RNA) that is free of the genes which, in the
naturally-occurring genome of the organism from which the nucleic
acid molecule of the invention is derived, flank the gene. The term
therefore includes, for example, a recombinant DNA that is
incorporated into a vector; into an autonomously replicating
plasmid or virus; or into the genomic DNA of a prokaryote or
eukaryote; or that exists as a separate molecule (for example, a
cDNA or a genomic or cDNA fragment produced by PCR or restriction
endonuclease digestion) independent of other sequences. In
addition, the term includes an RNA molecule that is transcribed
from a DNA molecule, as well as a recombinant DNA that is part of a
hybrid gene encoding additional polypeptide sequence.
[0058] The terms "isolated," "purified," or "biologically pure"
refer to material that is free to varying degrees from components
which normally accompany it as found in its native state. "Isolate"
denotes a degree of separation from original source or
surroundings. "Purify" denotes a degree of separation that is
higher than isolation. A "purified" or "biologically pure" protein
is sufficiently free of other materials such that any impurities do
not materially affect the biological properties of the protein or
cause other adverse consequences. That is, a nucleic acid or
peptide of this invention is purified if it is substantially free
of cellular material, viral material, or culture medium when
produced by recombinant DNA techniques, or chemical precursors or
other chemicals when chemically synthesized. Purity and homogeneity
are typically determined using analytical chemistry techniques, for
example, polyacrylamide gel electrophoresis or high performance
liquid chromatography. The term "purified" can denote that a
nucleic acid or protein gives rise to essentially one band in an
electrophoretic gel. For a protein that can be subjected to
modifications, for example, phosphorylation or glycosylation,
different modifications may give rise to different isolated
proteins, which can be separately purified.
[0059] By "melting temperature (Tm)" is meant the temperature of a
system in equilibrium where 50% of the molecular population is in
one state and 50% of the population is in another state. With
regard to the nucleic acids of the invention, Tm is the temperature
at which 50% of the population is single-stranded and 50% is
double-stranded (e.g., intramolecularly or intermolecularly).
[0060] By "monitoring a reaction" is meant detecting the progress
of a reaction. In one embodiment, monitoring reaction progression
involves detecting polymerase extension and/or detecting the
completion of an amplification reaction.
[0061] As used herein, "obtaining" as in "obtaining an agent"
includes synthesizing, purchasing, or otherwise acquiring the
agent.
[0062] As used herein, the term "nucleic acid" refers to
deoxyribonucleotides, ribonucleotides, or modified nucleotides, and
polymers thereof in single- or double-stranded form. The term
encompasses nucleic acids containing known nucleotide analogs or
modified backbone residues or linkages, which are synthetic,
naturally occurring, and non-naturally occurring, which have
similar binding properties as the reference nucleic acid, and which
are metabolized in a manner similar to the reference nucleotides.
Examples of such analogs include, without limitation, 2' modified
nucleotides (e.g., 2'-O-methyl ribonucleotides, 2'-F
nucleotides).
[0063] As used herein, "modified nucleotide" refers to a nucleotide
that has one or more modifications to the nucleoside, the
nucleobase, pentose ring, or phosphate group. For example, modified
nucleotides exclude ribonucleotides containing adenosine
monophosphate, guanosine monophosphate, uridine monophosphate, and
cytidine monophosphate and deoxyribonucleotides containing
deoxyadenosine monophosphate, deoxyguanosine monophosphate,
deoxythymidine monophosphate, and deoxycytidine monophosphate.
Modifications include those naturally occuring that result from
modification by enzymes that modify nucleotides, such as
methyltransferases. Modified nucleotides also include synthetic or
non-naturally occurring nucleotides. Synthetic or non-naturally
occurring modifications in nucleotides include those with 2'
modifications, e.g., 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro,
2'-hydroxyl (RNA), 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl],
4'-thio, 4'-CH.sub.2--O-2'-bridge,
4'-(CH.sub.2).sub.2--O-2'-bridge, and 2'-O-(N-methylcarbamate) or
those comprising base analogs.
[0064] By "nucleotide adduct" is meant a moiety that is bound
covalently or otherwise fixed to a standard nucleotide base.
[0065] By "nicking agent" is meant a chemical entity capable of
recognizing and binding to a specific structure in double stranded
nucleic acid molecules and breaking a phosphodiester bond between
adjoining nucleotides on a single strand upon binding to its
recognized specific structure, thereby creating a free 3'-hydroxyl
group on the terminal nucleotide preceding the nick site. In
preferred embodiments, the 3' end can be extended by an exonuclease
deficient polymerase. Exemplary nicking agents include nicking
enzymes, RNAzymes, DNAzymes, and transition metal chelators.
[0066] By "palindromic" is meant nucleic acid sequences that are
identical or substantially identical when read from 5' to 3' on one
strand or 5' to 3' on the complementary strand. A perfect
palindrome refers to a sequence having two adjacent subsequences,
such that when one subsequence is read from the 5' to 3' direction,
it is identical to the other subsequence read from the 3' to 5'
direction.
[0067] By "polymerase-arresting molecule" is meant a moiety
associated with a polynucleotide template/primer that prevents or
significantly reduces the progression of a polymerase on the
polynucleotide template. Preferably, the moiety is incorporated
into the polynucleotide. In one preferred embodiment, the moiety
prevents the polymerase from progressing on the template.
[0068] By "polymerase extension" is meant the forward progression
of a polymerase that matches incoming monomers to their binding
partners on a template polynucleotide.
[0069] As used herein, "primer-dimer" is meant a dimer of two
monomer oligonucleotide primers. In the oligonucleotide primers of
the invention, the 5' tail regions of monomer primers dimerize.
[0070] By "semi-quantitative" is meant providing an estimate of
relative quantity based on an internal control.
[0071] By "specific product" is meant a polynucleotide product
resulting from the hybridization of primer oligonucleotides to a
complementary target sequence and subsequent polymerase mediated
extension of the target sequence.
[0072] By "substantially isothermal condition" is meant at a single
temperature or within a narrow range of temperatures that does not
vary significantly. In one embodiment, a reaction carried out under
substantially isothermal conditions is carried out at a temperature
that varies by only about 1-5.degree. C. (e.g., varying by 1, 2, 3,
4, or 5 degrees). In another embodiment, the reaction is carried
out at a single temperature within the operating parameters of the
instrument utilized.
[0073] By "quantity threshold method" is meant providing an
estimate of quantity based on either exceeding or not exceeding in
quantity a comparative standard.
[0074] By "reference" is meant a standard or control condition. As
is apparent to one skilled in the art, an appropriate reference is
where an element is changed in order to determine the effect of the
element.
[0075] By "reverse transcriptase" is meant an enzyme that
replicates a primed single-stranded RNA template strand into a
complementary DNA strand in the presence of deoxyribonulceotides
and permissive reaction medium comprising, but not limited to, a
buffer (pH 7.0-9.0), sodium and/or potassium ions and magnesium
ions. As is apparent to one skilled in the art, concentration and
pH ranges of a permissive reaction media may vary in regard to a
particular reverse transcriptase enzyme. Examples of suitable
"reverse transcriptases" well known in the art, but not limited to,
are MmLV reverse transcriptase and its commercial derivatives
"Superscript I, II and III" (Life Technologies), "MaxiScript"
(Fermentas), RSV reverse transcriptase and its commercial
derivative "OmniScript" (Qiagen), AMV reverse transcriptase and its
commercial derivative "Thermoscript" (Sigma-Aldrich).
[0076] By "subject" is meant a mammal, including, but not limited
to, a human or non-human mammal, such as a bovine, equine, canine,
ovine, or feline.
[0077] By "target nucleic acid molecule" is meant a polynucleotide
to be analyzed. Such polynucleotide may be a sense or antisense
strand of the target sequence. The term "target nucleic acid
molecule" also refers to amplicons of the original target
sequence.
[0078] Ranges provided herein are understood to be shorthand for
all of the values within the range. For example, a range of 1 to 50
is understood to include any number, combination of numbers, or
sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, or 50.
[0079] Unless specifically stated or obvious from context, as used
herein, the term "or" is understood to be inclusive. Unless
specifically stated or obvious from context, as used herein, the
terms "a", "an", and "the" are understood to be singular or
plural.
[0080] Unless specifically stated or obvious from context, as used
herein, the term "about" is understood as within a range of normal
tolerance in the art, for example within 2 standard deviations of
the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%,
5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated
value. Unless otherwise clear from context, all numerical values
provided herein are modified by the term about.
[0081] The recitation of a listing of chemical groups in any
definition of a variable herein includes definitions of that
variable as any single group or combination of listed groups. The
recitation of an embodiment for a variable or aspect herein
includes that embodiment as any single embodiment or in combination
with any other embodiments or portions thereof.
[0082] Any compositions or methods provided herein can be combined
with one or more of any of the other compositions and methods
provided herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0083] FIG. 1 is a schematic diagram illustrating the design of
candidate assays for Ebola virus (EBOV).
[0084] FIG. 2 shows the various probes and primers tested, as well
as the Ebola gBlock sequence used in assay development. A gBlock is
a synthetic, double-stranded fragment of DNA ranging in size from
100 bp to 1000 bp that is entirely assembled in-vitro from
synthetic single-stranded oligonucleotides and which represents a
sequence-verified synthetic block of genomic DNA. Unless
specifically stated or obvious from context, as used herein, the
"gBlock.RTM." is used as a synthetic target nucleic acid whenever a
native target sequence or target genome is not available and/or not
useful. Sequence-verified blocks of genomic DNA for any target
sequence can be procured as a custom-order service from IDT
Technologies Inc. (1710 Commercial Park, Coralville, Iowa 52241,
USA) and the term "gBlock.RTM." is a registered trademark of that
company.
[0085] FIGS. 3A-3X show amplification results obtained with Assay 1
and Assay 2.
[0086] FIG. 4 shows detection of Ebola virus in a background of
total human RNA in a one-step assay.
[0087] FIG. 5 shows detection of synthetic Ebola virus RNA in a
background of total human RNA in a one-step assay.
[0088] FIGS. 6A-6C provide flow charts illustrating sample
processing for use in an amplification and detection instrument,
including, for example, a hand held device. FIG. 6A indicates that
a stabilization/lysis reagent (e.g., Guanidine isothiocyanate
(GITC)) is lyophilized onto the inside of the capillary tube. FIG.
6B illustrates use of a paper impregnated with lyophilized GITC and
buffer (e.g., Whatman.TM. FTA.TM. Elute Cards). FIG. 6C depicts a
lyophilized assay procedure in multiplex (e.g., an 8-well strip) or
single tube.
[0089] FIGS. 7A and 7B show sample preparation methods. FIG. 7A
depicts sample preparation from swab samples. FIG. 7B depicts
sample preparation from a blood sample.
[0090] FIG. 8 is a graph showing results obtained in a one-step
reaction process where the reverse transcriptase and polymerase are
included in a single reaction.
[0091] FIG. 9 is a graph showing results obtained in a two-step
reaction process where the reverse transcriptase reaction is
carried out at room temp or 56.degree. C. and the cDNA is
transferred to a second tube where the amplification reaction is
carried out at 56.degree. C.
[0092] FIG. 10 is a graph showing RT at 56.degree. C., DNAble at
56.degree. C. on 1.times.10e.sup.4 copies.
[0093] FIGS. 11A and 11B show the detection of a target RNA in a
sample containing total cellular RNA. FIG. 11A is a graph showing
detection of RPPH1 (RNase P RNA Component) in a 2-step reaction.
FIG. 11B is a graph showing detection of RPPH1 in a 1-step
reaction.
[0094] FIG. 12 is a graph showing the detection of Zaire Ebola in a
crude blood preparation in a 1-step reaction.
[0095] FIG. 13 is a graph depicting that the Zaire Ebola assay
specifically detects Zaire Ebola Mayinga but not Sudan Ebola
Boniface.
[0096] FIG. 14 are graphs depicting instrument comparison for the
detection of various dilutions of Zaire Ebolavirus Mayinga.
[0097] FIGS. 15A-15D depict the limit of detection of the Ebola
virus assay. FIG. 15A is a graph depicting detection in samples
containing 100 copies of Ebola virus target RNA. FIG. 15B is a
graph depicting detection in samples containing 50 copies of Ebola
virus target RNA. FIG. 15C is a graph depicting detection in
samples containing 25 copies of Ebola virus target RNA. FIG. 15D is
a graph depicting detection in samples containing 12 copies of
Ebola virus target RNA.
[0098] FIGS. 16A and 16B show detection of human immunodeficiency
virus (HIV) in a one-step assay. FIG. 16A is an amplicon map
showing sequences used in the design of assay primers and probes.
Population sequence variations in forward and reverse primers are
indicated. External primer sequence is specific to HIV subtype C
(for the purified RNA sample used). FIG. 16B shows real-time target
specific amplification of HIV in a one-step assay. Cp values are
shown across 5 technical replicates for each copy number (10 uL
reactions). Copies of purified HIV RNA (subtype C) (SeraCare) are
indicated, as quantified by COBAS TaqMan HIV-1 v2.0 test
[0099] FIGS. 17A and 17B show detection of dengue virus type 4
(DENV-4) in a one-step assay. FIG. 17A is an amplicon map showing
sequences used in the design of assay primers and probes.
Population sequence variations in reverse primers are indicated.
FIG. 17B shows real-time target specific amplification of DENV-4 in
a one-step assay. Cp values are shown across 4 technical replicates
(10 uL reactions). Isolated total RNA (20 pg) from cell culture
included both viral and host cell RNA and total copy number of
viral RNA was unknown.
[0100] FIGS. 18A and 18B show detection of influenza B in a
one-step assay. FIG. 18A is an amplicon map showing sequences used
in the design of assay primers and probes. Population sequence
variations in forward and reverse primers and external primers are
indicated. FIG. 18B shows real-time target specific amplification
of influenza B in a one-step assay. Cp values are shown across 4
technical replicates (10 uL reactions). Isolated total RNA (20 pg)
from cell culture included both viral and host cell RNA and total
copy number of viral RNA was unknown. Samples 1 and 2 are different
viral isolates.
[0101] FIGS. 19A and 19B show detection of Bovine Viral Diarrhea
Virus Genotype 1 (BVDV1) in a one-step assay. FIG. 19A is an
amplicon map showing sequences used in the design of assay primers
and probes. Population sequence variations in forward primers are
indicated. FIG. 19B shows real-time target specific amplification
of Bovine Viral Diarrhea Virus Genotype 1 (BVDV1) in a one-step
assay. Technical replicates (10 uL reactions) are shown. Isolated
total RNA (20 pg) from cell culture included both viral and host
cell RNA and total copy number of viral RNA was unknown. Cell
culture crude lysate was used undiluted and at 1:100 dilution.
DETAILED DESCRIPTION OF THE INVENTION
[0102] The present invention provides methods for rapidly
identifying an RNA viral infection (e.g., Ebola virus) using an
isothermal nucleic acid amplification reaction that can be carried
out on extracted RNA in the context of a crude biological
sample.
[0103] Ebola is clinically difficult to diagnose and to
distinguish. A rapid and reliable laboratory diagnosis is required
in suspected cases of Ebola. The present invention provides such an
assay. The invention is based, at least in part, on the discovery
that an Ebola viral polynucleotide (e.g., RNA) can be detected in a
one-step or two-step real-time reverse transcription-isothermal
amplification assay for an Ebola viral polynucleotide.
Ebola Virus
[0104] The Ebola viruses are filamentous viruses with a
negative-sense RNA genome. Virions are cylindrical/tubular
containing a viral envelope, matrix, and nucleocapsid components,
approximately 80 nm in diameter and 800-1000 nm in length. Ebola is
classified as a biosafety level 4 agent. The period of incubation
for the Ebola virus hemorrhagic fever is usually 5-18 days, but may
extend from 2-21 days depending on the viral strain contracted and
the condition of the infected individual. The Ebola virus acts
quickly. Initial symptoms of Ebola resemble symptoms of malaria,
influenza, or various bacterial infections. Therefore, days or
weeks may pass before Ebola is diagnosed.
[0105] Secondary symptoms include diarrhea, red eyes, vomiting
blood, bleeding from the nose, mouth or rectum, and even bleeding
in the brain. About 50%-90% of those infected with the virus go on
to systemic multi-organ failure and death.
Patient Diagnosis and Monitoring
[0106] The condition of a patient as having or not having Ebola can
be diagnosed by detecting an Ebola viral polynucleotide in a
biological sample and correlating this detection with the existence
of an Ebola infection. In one embodiment, a disease state of a
patient having Ebola virus can be detected using the methods and
compositions of the invention to detect Ebola virus in a biological
sample of the patient. Exemplary biological samples include body
fluids (e.g. saliva, sweat, tears, fluids accumulating in a bodily
cavity, urine, ejaculate, vaginal secretion, cerebrospinal fluid,
lymph, feces, sputum, decomposition fluid, vomit, sweat, breast
milk, blood, serum, and plasma), tissue extracts, culture media
(e.g., a liquid in which a cell, such as a pathogen cell, has been
grown), or environmental samples obtained, for example, from a
material that may be contaminated with a biological fluid of a
subject.
[0107] In one embodiment, the invention provides a method of
amplifying a target polynucleotide in a reverse transcriptase and
nicking amplification reaction involving:
[0108] (a) contacting a target RNA molecule (e.g., Ebola virus
genome) with a reverse transcriptase (RT) primer in the presence of
a reverse transcriptase and dNTPs under conditions permissive for
cDNA synthesis, thereby generating a cDNA; and
[0109] (b) contacting the cDNA with forward and reverse primers
carrying at least one nicking enzyme recognition sequence within
their respective 5'-terminal regions which specifically bind the
cDNA with their respective 3'-terminal regions in the presence of a
nicking enzyme, dNTPs, and a strand-displacement polymerase under
conditions permissive for the isothermal amplification of the cDNA,
thereby generating amplicons.
[0110] In one particular embodiment, the invention provides a
method of detecting an Ebola virus in a biological sample
involving:
[0111] (a) contacting a sample with an agent capable of extracting
an Ebola RNA present in the sample (e.g., SDS, sodium lauryl
sulfate, guanidium isothio-cyanate, guanidium hydrochloride) and an
agent capable of stabilizing Ebola RNA against degradation (e.g.,
SDS, RNAase inhibitors, antibodies against RNAse, competitive RNAse
inhibitor, or an agent capable of reversibly chemically modifying
RNA in situ (e.g., acetic anhydride);
[0112] (b) contacting the Ebola RNA with a RT primer in the
presence of a reverse transcriptase and dNTPs under conditions
permissive for cDNA synthesis, thereby generating a cDNA copy of
the Ebola RNA;
[0113] (c) contacting the Ebola cDNA with forward and reverse
primers carrying at least one nicking enzyme recognition sequence
within their respective 5'-terminal regions which specifically
binds the Ebola cDNA with their respective 3'-terminal regions in
the presence of a nicking enzyme, dNTPs, and a strand-displacement
polymerase under conditions permissive for the isothermal
amplification of the cDNA, thereby generating amplicons; and
[0114] (d) detecting the amplicons, wherein the presence of an
Ebola virus amplicon detects an Ebola virus infection in the sample
and failure to detect the amplicon indicates the absence of an
Ebola virus infection.
[0115] In one embodiment, the methods of the invention described
herein provide results in no longer than 5, 7, 10, 15, 20, 25 or 30
minutes. Advantageously, the methods of the invention can be
applied to RNAs extracted--but not purified or isolated from--a
crude biological sample (e.g., saliva, sweat, tears, fluids
accumulating in a bodily cavity, urine, ejaculate, vaginal
secretion, cerebrospinal fluid, lymph, feces, sputum, decomposition
fluid, vomit, sweat, breast milk, blood, serum, and plasma).
Because the test is carried out on-site (e.g., in a hospital,
clinic, physician's office, urgent care center, home, community
center, airport, ship (e.g., cruise ship or other vessel used for
transporting humans or animals), train or train station, or point
of entry into a nation (e.g., border crossing). Advantageously, in
one embodiment, the testing is carried out in a portable battery
powered device (e.g., Amplifire).
[0116] In one embodiment, the RNA is extracted from the biological
sample using a chaotropic salt (e.g., GITC, GHCL) or a detergent
(e.g., SDS, Tween and triton). If desired, an RNAse inhibitor is
added before, during, or after the extraction step.
[0117] In another embodiment, the reverse transcriptase enzyme and
the strand-displacement DNA polymerase are one and the same.
[0118] In another embodiment, no separate primer is required or the
RT primer same as forward and/or reverse primers.
[0119] In another embodiment, the invention provides for detection
of an EBOV or other viral amplicon using a Dual FRET molecular
beacon for mRNA detection (e.g., as described by Santagelo, Nucleic
Acids Res. 2004; 32(6): e57), turbidity release of pyrophosphate
from DNTPs and precipitation with magnesium or calcium.
[0120] In another embodiment, the invention provides for detection
of an Ebola viral amplicon using a lateral flow device where the
Ebola virus amplicon comprises one member of a pair of binding
partners (e.g., biotin and streptavidin) and the lateral flow
device comprises the other member of the pair, and provides a means
of detection (e.g., colorimetric) for the amplicon.
[0121] Reverse transcriptases used in the methods of the invention
include, but are not limited to, a Maloney murine leukemia virus
reverse transcriptase enzyme (MMLV RT) and derivatives or variants
thereof comprising a mutation relative to wild-type MMLV RT; avian
myeloblastosis virus (AMV RT) and derivatives or variants thereof
comprising a mutation relative to that render them thermostable,
Rous sarcoma virus (RSV) RT (e.g., Omniscript, Qiagen) and
derivatives or variants thereof, and a pyroreverse transcriptase
(e.g., Pyroscript luceigen) and derivatives or variants thereof, an
RT described in U.S. Pat. No. 7,094,539, which is incorporated
herein by reference in its entirety, or a commercially available
High-fidelity Thermostable Reverse Transcriptase for RT PCR and
Transcriptome analysis (e.g., Lucigen).
[0122] In one embodiment, at 56 degrees the primer and RNA or
amplicon forms a stable complex. In one embodiment, more than 50%
of primer sequence must be complementary to the target nucleic acid
molecule. In one embodiment, the rT primer is about 18 bases in
length. In one embodiment, the reverse transcriptase (RT) primer is
a random primer (e.g., in each sequence position any one of four
bases is possible, any of these primers hybridize with the target).
In one embodiment, the rT primer is a hexamer, heptamer, octamer,
or nonamer.
[0123] In one embodiment, the RT is derived from Geobacillus
stearothermophilus, is M-MLV RT (i.e. Superscript/LifeTech,
Maxima/Thermo-Fisher) and/or mutants/derivatives thereof, AMV RT
(i.e. Thermoscript/LifeTech) and/or mutants/ derivatives thereof,
RSV RT (i.e. OmniScript/Qiagen) and/or mutants/ derivatives
thereof.
[0124] Methods of the invention provide a high degree of
sensitivity. In one embodiment, EBOV is detected at
1.times.10.sup.3' 1.times.10.sup.4, 1.times.10.sup.5,
1.times.10.sup.6, 1.times.10.sup.7, or 1.times.10.sup.9 copies of
EBOV RNA per ml in blood. In another embodiment, the invention
provides for the detection of between about 1-10 (e.g, 1, 2, 3, 4,
5, 6, 7, 8, 9, 10) copies of RNA per reaction.
[0125] EBOV (or other virus) is detected by obtaining a sample
(e.g., biological sample) from a subject having or suspected of
having an EBOV infection or by obtaining an environmental sample
from a home, hospital room, means of transportation that is or is
suspected of being contaminated with an Ebola virus or
EBOV-containing biological fluid. In one embodiment, a biological
sample is obtained by obtaining a blood sample, mucous sample,
feces, or by swabbing an affected tissue. Swabs can be taken from
the nose, throat, eyes, or other mucosal membrane. At necropsy,
samples can be collected from blood or tissues of the deceased.
[0126] Advantageously, the diagnostic methods of the invention are
suitable for use in virtually any setting. EBOV is endemic in much
of west Africa including Liberia, Nigeria, Guinea, and Sierra
Leone. Many areas within west Africa lack access to basic medical
facilities and diagnostic laboratories. The present invention can
be used in a battery powered hand held device that is well-suited
to testing of biological samples in areas where access to
electricity is non-existent. Moreover, the present methods are
simple enough that they can easily be carried out by health workers
who have limited training in the use of diagnostic
technologies.
[0127] The present invention provides methods for rapidly
identifying an EBOV or other viral infection using an isothermal
nucleic acid amplification reaction that can be carried out on
extracted RNA in the context of a crude biological sample.
[0128] Early in the disease process, only low levels of virus are
present in a biological sample of the subject, such as a blood
sample. If desired, the virions present in the sample are enriched
using methods known in the art, for example, by precipitating the
virions from the sample by adding PEG and NaCl then filtering
virions out of the sample using a nanopore filter, thereby
providing for early detection of a viral polynucleotide.
[0129] The disease state or treatment of a subject that may have
been exposed to Ebola virus (or other virus) can be monitored using
the methods and compositions of the invention. In one embodiment,
the detection of an Ebola virus polynucleotide (or other virus
polynucleotide) is present in a bodily fluid, such as saliva,
sweat, tears, fluids accumulating in a bodily cavity, urine,
ejaculate, vaginal secretion, cerebrospinal fluid, lymph, feces,
sputum, decomposition fluid, vomit, sweat, breast milk, blood,
serum, and plasma, is monitored. Such monitoring may be useful, for
example, in diagnosing the subject as having Ebola (or other
virus), or determining the efficacy of a particular drug in a
subject or in assessing disease progression.
Nucleic Acid Amplification Methods
[0130] Nucleic acid amplification technologies have provided a
means of understanding complex biological processes, detection,
identification, and quantification of pathogenic organisms, such as
EBOV or other RNA viruses. The present invention provides for the
detection of an EBOV negative-sense RNA genome in a biological
sample by using reverse transcriptase to synthesize an EBOV DNA
molecule from the RNA genome and then amplifying the DNA in an
isothermal nicking amplification reaction.
[0131] The polymerase chain reaction (PCR) is a common thermal
cycling dependent nucleic acid amplification technology used to
amplify DNA consisting of cycles of repeated heating and cooling of
the reaction for DNA melting and enzymatic replication of the DNA
using a DNA polymerase. Real-Time quantitative PCR (qPCR) is a
technique used to quantify the number of copies of a given nucleic
acid sequence in a biological sample. Currently, qPCR utilizes the
detection of reaction products in real-time throughout the reaction
and compares the amplification profile to the amplification of
controls which contain a known quantity of nucleic acids at the
beginning of each reaction (or a known relative ratio of nucleic
acids to the unknown tested nucleic acid). The results of the
controls are used to construct standard curves, typically based on
the logarithmic portion of the standard reaction amplification
curves. These values are used to interpolate the quantity of the
unknowns based on where their amplification curves compared to the
standard control quantities.
[0132] In addition to PCR, non-thermal cycling dependent
amplification systems or isothermal nucleic acid amplification
technologies exist including, without limitation: Nicking
Amplification Reaction, Rolling Circle Amplification (RCA),
Helicase-Dependent Amplification (HDA), Loop-Mediated Amplification
(LAMP), Strand Displacement Amplification (SDA),
Transcription-Mediated Amplification (TMA), Self-Sustained Sequence
Replication (3SR), Nucleic Acid Sequence Based Amplification
(NASBA), Single Primer Isothermal Amplification (SPIA), Q-.beta.
Replicase System, and Recombinase Polymerase Amplification
(RPA).
[0133] Isothermal nicking amplification reactions have similarities
to PCR thermocycling. Like PCR, nicking amplification reactions
employ oligonucleotide sequences which are complementary to a
target sequences referred to as primers. In addition, nicking
amplification reactions of target sequences results in a
logarithmic increase in the target sequence, just as it does in
standard PCR. Unlike standard PCR, the nicking amplification
reactions progress isothermally. In standard PCR, the temperature
is increased to allow the two strands of DNA to separate. In
nicking amplification reactions, the target nucleic acid sequence
is nicked at specific nicking sites present in a test sample. The
polymerase infiltrates the nick site and begins complementary
strand synthesis of the nicked target nucleotide sequence (the
added exogenous DNA) along with displacement of the existing
complimentary DNA strand. The strand displacement replication
process obviates the need for increased temperature. At this point,
primer molecules anneal to the displaced complementary sequence
from the added exogenous DNA. The polymerase now extends from the
3' end of the template, creating a complementary strand to the
previously displaced strand. The second oligonucleotide primer then
anneals to the newly synthesized complementary strand and extends
making a duplex of DNA which includes the nicking enzyme
recognition sequence. This strand is then liable to be nicked with
subsequent strand displacement extension by the polymerase, which
leads to the production of a duplex of DNA which has nick sites on
either side of the original target DNA. Once this is synthesized,
the molecule continues to be amplified exponentially through
replication of the displaced strands with new template molecules.
In addition, amplification also proceeds linearly from each product
molecule through the repeated action of the nick translation
synthesis at the template introduced nick sites. The result is a
very rapid increase in target signal amplification; much more rapid
than PCR thermocycling, with amplification results in less than ten
minutes.
Nicking Amplification Assays
[0134] The invention provides for the detection of EBOV target
nucleic acid molecules amplified in an isothermal nicking
amplification assay.
[0135] Polymerases useful in the methods described herein are
capable of catalyzing the incorporation of nucleotides to extend a
3' hydroxyl terminus of an oligonucleotide (e.g., a primer) bound
to a target nucleic acid molecule and/or a 3' hydroxyl terminus at
a nick site in a double-stranded DNA molecule in conjunction with
strand displacement activity. Such polymerases also lack or have
substantially reduced 5'-3' exonuclease activity and may include
those that are thermophilic. DNA polymerases useful in methods
involving primers having 2'-modified nucleotides in the primer
region comprising the six 3'-terminal nucleotides include
derivatives and variants of the DNA polymerase I isolated from
Bacillus stearothermophilus, also classified as Geobacillus
stearothermophilus, and from closely related bacterial strains,
isolates and species comprising the genus Geobacillus, which lack
or have substantially reduced 5'-3' exonuclease activity and have
strand-displacement activity. Exemplary polymerases include, but
are not limited to, the large fragments of Bst DNA polymerase I,
Gst DNA polymerase I, and Gka DNA polymerase I.
[0136] A nicking agent useful in methods described herein is a
chemical entity capable of recognizing and binding to a specific
structure in double stranded nucleic acid molecules and breaking a
phosphodiester bond between adjoining nucleotides on the top strand
with a substantially higher rate than breaking the phosphodiester
bond between adjoining nucleotides on the bottom strand upon
binding to its recognized specific structure, thereby creating a
free 3'-hydroxyl group on the terminal nucleotide preceding the
nick site that can be extended by a 5'-3'-exonuclease deficient
strand displacement polymerase. In a preferred embodiment of the
methods disclosed herein, the top strand phosphodiester bond
cleavage rate of the "nicking agent" approaches 100%, while the
cleavage rate of the bottom strand phosphodiester bond approaches
0%. Nicking agents useful in methods described herein, can either
be enzymes, i.e self-regenerating catalysts turning over multiple
substrate molecules, or non-regenerating catalysts turning over
just a single substrate molecule at an equimolar ratio fashion.
[0137] A nicking enzyme binds double-stranded DNA and cleaves one
strand of a double-stranded duplex. In the methods of the
invention, the nicking enzyme cleaves the top stand (the strand
comprising the 5'-3' sequence of the nicking agent recognition
site). In a particular embodiment of the invention disclosed
herein, the nicking enzyme cleaves the top strand only and 3'
downstream of the recognition site. In exemplary embodiments, the
reaction comprises the use of a nicking enzyme that cleaves or
nicks downstream of the binding site such that the product sequence
does not contain the nicking site. Using an enzyme that cleaves
downstream of the binding site allows the polymerase to more easily
extend without having to displace the nicking enzyme. Ideally, the
nicking enzyme is functional under the same reaction conditions as
the polymerase. Exemplary nicking enzymes include, but are not
limited to, N.Bst9I, N.BstSEI, Nb.BbvCI(NEB), Nb.Bpu10I(Fermantas),
Nb.Bsml(NEB), Nb.BsrDI(NEB), Nb.Btsl(NEB), Nt.AlwI(NEB),
Nt.BbvCI(NEB), Nt.Bpu10I(Fermentas), Nt.BsmAI, Nt.BspD6I,
Nt.BspQI(NEB), Nt.BstNBI(NEB), and Nt.CviPII(NEB). Sequences of
nicking enzyme recognition sites are provided at Table 1.
TABLE-US-00012 TABLE 1 Nicking enzyme recognition sequences N.Bst9I
5'-GAGTCNNNNN.dwnarw.NN-3' |||||||||| || 3'-CTCAGNNNNN.cndot.NN-5'
N.BstSEI 5'-GAGTCNNNNN.dwnarw.NN-3' |||||||||| ||
3'-CTCAGNNNNN.cndot.NN-5' Nb.BbvCI(NEB) 5'-CCTCA.cndot.GC-3' |||||
|| 3'-GGAGT.uparw.CG-5' Nb.Bpu10I(Fermentas) 5'-CCTNA.cndot.GC-3'
||||| || 3'-GGANT.uparw.CG-5' Nb.BsmI(NEB) 5'-GAATG.cndot.CN-3'
||||| || 3'-CTTAC.uparw.GN-5' Nb.BsrDI(NEB) 5'-GCAATG.cndot.NN-3'
|||||| || 3'-CGTTAC.uparw.NN-5' Nb.BtsI(NEB) 5'-GCAGTG.cndot.NN-3'
|||||| || 3'-CGTCAC.uparw.NN-5' Nt.A1wI(NEB)
5'-GGATCNNNN.dwnarw.N-3' ||||||||| | 3'-CCTAGNNNN.cndot.N-5'
Nt.BbvCI(NEB) 5'-CC.dwnarw.TCAGC-3' || ||||| 3'-GG.cndot.AGTCG-5'
Nt.Bpu10I(Fermentas) 5'-CC.dwnarw.TNAGC-3' || |||||
3'-GG.cndot.ANTCG-5' Nt.BsmAI 5'-GTCTCN.dwnarw.N-3' |||||| |
3'-CAGAGN.cndot.N-5' Nt.BspD6I 5'-GAGTCNNNN.dwnarw.N-3' ||||||||| |
3'-CTCAGNNNN.cndot.N-5' Nt.BspQI(NEB) 5'-GCTCTTCN.dwnarw.-3'
|||||||| 3'-CGAGAAGN -5' Nt.BstNBI(NEB) 5'-GAGTCNNNN.dwnarw.N-3'
||||||||| | 3'-CTCAGNNNN.cndot.N-5' Nt.CviPII(NEB)
5'-.dwnarw.CCD-3' ||| 3'- GGH-5'
Nicking enzymes also include engineered nicking enzymes created by
modifying the cleavage activity of restrictuion endonucleases (NEB
expressions July 2006, vol 1.2). when restriction endonucleases
bind to their recognition sequences in DNA, two catalytic sites
within each enzyme for hydrolyzing each strand drive two
independent hydrolytic reactions which proceed in parallel. Altered
restriction enzymes can be engineered that hydrolyze only one
strand of the duplex, to produce DNA molecules that are "nicked"
(3'-hydroxyl, 5'-phosphate), rather than cleaved. Nicking enzymes
may also include modified CRISPR/Cas proteins, Transcription
activator-like effector nucleases (TALENs), and Zinc-finger
nucleases having nickase activity.
[0138] A nicking amplification reaction typically comprises
nucleotides, such as, for example, dideoxyribonucleoside
triphosphates (dNTPs). The reaction may also be carried out in the
presence of dNTPs that comprise a detectable moiety including but
not limited to a radiolabel (e.g., .sup.32P, .sup.33P, .sup.125I,
.sup.35S) an enzyme (e.g., alkaline phosphatase), a fluorescent
label (e.g., fluorescein isothiocyanate (FITC)), biotin, avidin,
digoxigenin, antigens, haptens, or fluorochromes. The reaction
further comprises certain salts and buffers that provide for the
activity of the nicking enzyme and polymerase.
[0139] Advantageously, the nicking amplification reaction is
carried out under substantially isothermal conditions where the
temperature of the reaction is more or less constant during the
course of the amplification reaction. Because the temperature does
not need to be cycled between an upper temperature and a lower
temperature, the nicking amplification reaction can be carried out
under conditions where it would be difficult to carry out
conventional PCR. Typically, the reaction is carried out at about
between 35 C and 90 C (e.g., about 35, 37, 42, 55, 60, 65, 70, 75,
80, or 85.degree. C.). Advantageously, it is not essential that the
temperature be maintained with a great degree of precision. Some
variability in temperature is acceptable.
[0140] Sets of primers for amplification reactions are selected as
having .DELTA..DELTA.G's.ltoreq.-15, -16, 17, -18, -19, -20, -25,
-30 kcal/mole or more. The performance characteristics of
amplification reactions may be altered by increasing the
concentration of one or more oligonucleotides (e.g., one or more
primers and/or probes) and/or their ratios. High concentrations of
primers also favor primer-dimer formation. In various embodiments,
concentration of a primers is 100, 200, 300, 400, 500, 600, 700,
800, 900, 1000 nM or more. Melt temperature (Tm) and reaction rate
modifiers may also be used to lower the melting temperature of the
oligonucleotides, such as (but not limited to) ethylene glycol and
glycerol. In addition, DNA polymerase reaction rate modifiers (such
as dNTP and magnesium concentration) may be used to alter the
reaction rate to lead to a greater quantification precision. In
particular embodiments, the 5' tail sequences of the forward and
reverse primers have the same nucleic acid sequence.
[0141] This invention provides methods of monitoring a nicking
amplification reaction in real time, including for example
utilizing the amplification strategy as described herein. In one
embodiment, quantitative nucleic acid amplification utilizes target
nucleic acids amplification alongside a control amplification of
known quantity. The amount of target nucleic acid can be calculated
as an absolute quantification or a relative quantification
(semi-quantitative) based on the source of the control (exogenous
or endogenous control).
[0142] Quantification of the unknown nucleotide sequence can be
achieved either through comparison of logarithmic threshold
amplification of the unknown to a series of known target sequences
in either a separate set of reactions or in the same reaction; or
as an internal endogenous or exogenous co-amplification product
which produces a threshold value, indicative of either a positive
result (if the unknown exceeds the threshold) or negative result
(if the unknown does not exceed the threshold).
[0143] The invention also provides a method of designing a nicking
agent-dependent isothermal strand-displacement amplification assay
without experimental screening of a multitude of combinations of
candidate forward primers and/or candidate reverse primers. A 35 to
70 bp long region within the target sequence is identified having a
12 to 20 bp sequence in the central portion with a Tm.gtoreq.the
assay temperature (e.g., .about.55.degree. C.). Adjacent sequences
12 bp to 20 bp long immediately downstream and upstream of the 15
to 20 bp long central region are identified, according to the above
criteria. The Tm of the chosen double stranded downstream and
upstream adjacent sequences deviate from each other by less than
.+-.3.degree. C. A target-specific pair of forward and reverse
primers are created by attaching a 5'-tail region for a stable
dimer-forming primer to the 5'-terminus of the 12-20 base upstream
adjacent sequence and to the 5'-terminus of the complementary
strand of the 12-20 base downstream adjacent sequence. When
combining the forward primer, reverse primer, and a probe, the
primer driving the synthesis of the strand complementary to the
probe is in excess over the other primer at a molar ratio of about
1.1:1 to 10:1. The combined concentration of a primer in the assay
is no higher than 1000 nM. The assay design method can also be used
to convert a pre-validated PCR assay for an amplicon.ltoreq.70 bp
to an nicking agent-dependent isothermal strand-displacement
amplification assay.
Primer Design
[0144] Conventional methods for primer design have focused on
primer melting temperature, primer annealing temperature, GC
(guaninine and cytosine) content, primer length, and minimizing
interactions of the primer with all but the target nucleic acid
(see e.g.,
www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html). Contrary
to these methods, it has been found that primers that form stable
primer/dimers, expressed in terms of free energy of formation
(.DELTA.G), function predictably in nucleic acid amplification
reactions. While Free Energy (.DELTA.G) and Melting Temperature
(Tm) share primary components Enthalpy (.DELTA.H) and Entropy
(.DELTA.S), .DELTA.G and Tm values are derived differently and have
no correlative relationship, and the only way to relate a given
.DELTA.G with a given Tm value is to explicitly know the value of
.DELTA.H and .DELTA.S from which they are derived (Manthey, "mFold,
Delta G, and Melting Temperature" .COPYRGT.2005 and 2011 Integrated
DNA Technologies). FIGS. 1-11 relate to the design of optimal
primers.
[0145] The free energy of formation (.DELTA.G) for intermolecular
primer structures may be calculated using formulas known in the
art. A number of programs are available for determining the
formation of various intramolecular and intermolecular primer
structures and calculating their AG's, including for example mfold
and UNAfold prediction algorithms (see e.g., Markham and Zuker.
UNAFold: Software for Nucleic Acid Folding and Hybridization.
Bioinformatics: Volume 2, Chapter 1, pp 3-31, Humana Press Inc.,
2008; Zuker et al. Algorithms and Thermodynamics for RNA Secondary
Structure Prediction: A Practical Guide In RNA Biochemistry and
Biotechnology, 11-43, NATO ASI Series, Kluwer Academic Publishers,
1999; M. Zuker. Prediction of RNA Secondary Structure by Energy
Minimization. Methods in Molecular Biology, 267-294, 1994; Jaeger
et al. Predicting Optimal and Suboptimal Secondary Structure for
RNA. In Molecular Evolution: Computer Analysis of Protein and
Nucleic Acid Sequences, Methods in Enzymology 183, 281-306, 1990;
Zuker. On Finding All Suboptimal Foldings of an RNA Molecule.
Science 244, 48-52, 1989). OligoAnalyzer 3.1 is one such
implementation of mfold for primer design
(www.idtdna.com/analyzer/Applications/OligoAnalyzer/). For example
with reference to OligoAnalyzer 3.1, AG calculations may be
performed using the following parameters: Target Type: DNA; Oligo
Concentration 0.25 .mu.M; Na.sup.+Concentration: 60 mM; Mg.sup.++
Concentration: 15 mM; and dNTPs Concentration: 0.3 mM.
3' Recognition Region
[0146] The invention provides a primer having a 3' recognition
sequence whose primer-target formation is stable
(.DELTA.G.ltoreq.about -20 kcal/mol or more) and has the potential
to enhance nucleic acid amplification reaction performance. The 3'
recognition region specifically binds to the a nucleic acid
molecule, for example a complementary sequence of the nucleic acid
molecule. In certain embodiments, the 3' recognition region has a
sequence that is complementary to 12, 13, 14, 15, 16, 17, 18, 19,
or 20 bases or more of a nucleic acid sequence. In particular
embodiments, the 3' recognition region comprises one or more
inosine bases. In specific embodiments, the 3' recognition region
comprises no more than 2/12 inosines. In various embodiments, the
primer-target melting temperature is equal to or greater than
8.degree. or 6.degree. C. below the reaction or extension
temperature of the assay (Tm.gtoreq.assay temperature -8.degree.).
In particular embodiments, the 3' recognition sequence comprises
12-20, 12-17, or 12-14 bases. In particular embodiments, the
primer-target formation is more stable than self dimer formation
(e.g., AAG about -15, -16, -17, -18, -19, -20 kcal/mol or more).
Preferably, the 3' recognition sequence does not contain
self-complementary sequences, short inverted repeats (e.g., >4
bases/repeat), or sequences that otherwise promote intramolecular
interactions, which have the potential to interfere with
primer-target annealing.
[0147] In one embodiment, a primer is designed having a Tm of
56.degree. C. with 4 sequence specific bases at the end of the
primer that may not contribute to annealing. In one embodiment, the
primer is a 16, 17, 18, 19, 20 or 21-mer.
[0148] In particular, a primer of the invention having a 3'
recognition sequence is useful in nicking amplification assays.
Additionally, the EBOV or other viral target specific 3'
recognition region comprises one or more 2' modified nucleotides
(e.g., 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-alkyl,
2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 2'-hydroxyl (RNA),
4'-thio, 4'-CH.sub.2-O-2'-bridge, 4'-(CH.sub.2).sub.2-O-2'-bridge,
and 2'-O-(N-methylcarbamate)). Without being bound to theory, it is
hypothesized that incorporating one or more 2' modified nucleotides
in the recognition regions reduces or eliminates intermolecular
and/or intramolecular interactions of primers/templates (e.g.,
primer-dimer formation), and, thereby, reduces or eliminates the
background signal in isothermal amplification. The 2' modified
nucleotide preferably has a base that base pairs with the target
sequence. In particular embodiments, two or more 2' modified
nucleotides (e.g., 2, 3, 4, 5 or more 2' modified nucleotides) in
the EBOV or other viral target specific recognition region are
contiguous (e.g., a block of modified nucleotides). In some
embodiments, the block of 2' modified nucleotides is positioned at
the 3' end of the target specific recognition region. In other
embodiments, the block of 2' modified nucleotides is positioned at
the 5' end of the EBOV or other viral target specific recognition
region. When the block of 2' modified nucleotides is positioned at
the 5' end of the target specific recognition region, the 2'
modified nucleotides may be separated from the nick site by one or
more non-modified nucleotides (e.g., 2, 3, 4, 5 or more 2'
unmodified nucleotides). Applicants have found that positioning of
one or more 2' modified nucleotides or of a block of 2' modified
nucleotides alters the kinetics of amplification. When the one or
more 2' modified nucleotides or block of 2' modified nucleotides
are positioned at or near the 5' end of the recognition region or
proximal to the nick site, real-time amplification reactions showed
decreased time to detection. Additionally, the signal curve is
contracted and the slope of the curve shifted.
[0149] In a related embodiment, ratios of a primer having one or
more 2' modified nucleotides can be used to alter the
time-to-detection and/or the efficiency of the reaction for the
`tuning` of reactions, resulting in a predictable control over
reaction kinetics. Increasing the ratio of primer having one or
more 2' modified nucleotides at the 3' end of the recognition
sequence to primer having one or more 2' modified nucleotides at
the 5' end of the recognition sequence contracted the signal curve
and shifted the slope of the curve. It is advantageous to be able
to "tune" a reaction providing a means to manipulate both the
time-to-detection as well as the efficiency of the reaction.
Relative quantification using an internal control requires that two
important conditions be met. First, it is beneficial to be able to
modify a reaction's time-to-detection creating a non-competitive
reaction condition. Thus, by affecting the control reaction to be
detectable at a later time-point (relative to the target of
interest) the control reaction does not out-compete the specific
target of interest even when the target of interest is in low
initial abundance. Second, to ensure a true relative abundance
calculation, it is required that the control and specific target
reactions have matched efficiencies. By controlling the efficiency
of each reaction using a "tuning" condition enables reactions to be
matched allowing for satisfactory relative quantification
calculations. Tuning the reactions can be used to match
efficiencies of target nucleic acid amplification and reference
nucleic amplification (e.g., internal standard) in quantitative PCR
(qPCR). Additionally, amplification curves of the target nucleic
acid and the internal standard may be altered so time of detection
of their amplification products are separated, while providing the
same efficiency for target nucleic acid amplification and internal
standard amplification. Through the use of specific combinations
and ratios of oligonucleotide structures within a reaction it is
possible to create conditions which enable tuned reaction
performance.
5' Tail Dimerization Region
[0150] The invention provides a primer having a 5' tail region
capable of self-dimerization that enhances EBOV or other viral
nucleic acid amplification reaction performance. Without being
bound to theory, in a nucleic acid amplification reaction the
primer anneals to the target nucleic acid as a primer-dimer. For
example, nicking amplification primers have a nicking agent
recognition site present at the 5' end that is unrelated to the
binding specificity of the primer for the target recognition
sequence. Non-specific background products from non-specific primer
interactions have the potential to sequester reaction components
that would otherwise have been utilized for the amplification of
the specific product. In various embodiments, homodimer formation
is stable (e.g., .DELTA.G.ltoreq.about -30, -35, -40, -45, -50,
-55, -60 kcal/mol or more). In various embodiments, the homodimer
has a melting temperature higher than the extension reaction
temperature. In particular embodiments, the 5' tail region has a
sequence that is a palindrome. In further embodiments, the 5' tail
region is at least 12 bases (e.g., 12, 13, 14,15, 16, 17, 18, 19,
20, 21, 22, 23, 24 bases) in length. In additional embodiments, the
5' tail region has a GC content of 80-90%. In certain embodiments,
homodimer formation is more stable than formation of other less
stable primer dimer conformations formation (e.g.,
.DELTA..DELTA.G.ltoreq.about -12, -13, -14, -15, -16, -17, -18,
-19, -20, -25, -30, -35, -40 kcal/mol or more).
[0151] In particular, a primer of the invention having a 5' tail
sequence is useful in nicking amplification reactions. For use in
nicking amplification reactions, the 5' tail region comprises one
or more nicking agent recognition sites and the 5' tail region has
a symmetrically inverted sequence. In particular embodiments, the
5' tail region contains an even number of nucleotides (e.g., 22, 24
nucleotides). The nick site is designed to be positioned between
the nucleotide at the 3' end of the 5' tail region and the
nucleotide at the 5' end of the 3' recognition region. Without
being bound to theory, the nicking enzyme does not cleave at the
nick site when the 3' recognition is single-stranded. However,
cleavage at the nick site occurs when the 3' recognition region is
double stranded (e.g., when the primer is incorporated into a
double-stranded target nucleic acid molecule during the course of
the nucleic acid amplification reaction).
[0152] In various embodiments, the 5' tail sequence comprises from
5' to 3' an inverted nicking enzyme recognition sequence that is
operatively linked to a palindromic sequence (or self-complementary
sequence) that is operatively linked to a nicking enzyme
recognition sequence. In certain embodiments, the spacer region is
an even number of nucleotides (e.g., 2, 4, 6, etc.). Exemplary 5'
tails based on the Nt.BstNBI nicking enzyme recognition sequence
(5'-GAGTC-3') having a 2, 4, and 6 nucleotide spacers comprise a
nucleic acid sequences according to the formula below:
TABLE-US-00013 5'-GACTCN.sub.1N.sub.1'GAGTC-3'
5'-GACTCN.sub.2N.sub.1N.sub.1'N.sub.2'GAGTC-3'
5'-GACTCN.sub.3N.sub.2N.sub.1N.sub.1'N.sub.2'N.sub.3'GAGTC-3'
where "N" is any nucleotide (e.g., having an adenine (A), thymine
(T), cytosine (C), or guanine (G) nucleobase), and N.sub.1 is
complementary to N.sub.1', N.sub.2 is complementary to N.sub.2',
and N.sub.3 is complementary to N.sub.3', etc.
[0153] Exemplary 5' tail region sequences 24 nucleotides in length
having a Nt.BstNBI recognition sequence can be generated based on
the following template 5'-NNNNGACTCGAGTCNNNN-3'. Based on this
template, there are 537,824 5' tail sequences having the following
properties: .DELTA.G=-48 Kcal/mole to -62 kcal/mole;
.DELTA..DELTA.G<-40 kcal/mole; and GC content 68% to 84%. Of
these, 1050 selected sequences are provided, representing 0.2% of
the entire sequence space (248,832). Exemplary 5' tail region
sequences 22 nucleotides in length having a Nt.BstNBI recognition
sequence and based on the following template
5'-NNNNGACTCNNNNGAGTCNNNN-3'. Based on this template, there are
248,832 5' tail sequences having the following properties:
.DELTA.G=-47 Kcal/mole to -55 kcal/mole; .DELTA..DELTA.G<-40
kcal/mole; and GC content 72% to 82%. Of these, 200 selected
sequences are provided, representing 0.08% of the entire sequence
space (248,832).
Target Nucleic Acid Molecules
[0154] Methods and compositions of the invention are useful for the
amplification and/or identification of an EBOV or other viral
nucleic acid molecule in a test sample. The target sequences are
amplified from virtually any samples that comprises a viral nucleic
acid molecule, including a EBOV nucleic acid molecule. In
particular, the methods and compositions of the invention are
useful for the amplification and/or identification of RNA viruses.
In addition to EBOV, exemplary RNA viruses that can be detected
using the methods and compositions of the invention include,
without limitation, Human Immunodeficiency Virus (HIV), Dengue
virus, influenza virus (e.g., influenza B), Bovine Viral Diarrhea
virus (e.g., BVDV Genotype 1), Yellow Fever virus, West Nile Virus,
Hepatitis C, Lassa virus, Flaviviridae, Arenaviridae, and
single-stranded RNA viruses.
[0155] Exemplary test samples include body fluids (e.g. bsaliva,
sweat, tears, fluids accumulating in a bodily cavity, urine,
ejaculate, vaginal secretion, cerebrospinal fluid, lymph, feces,
sputum, decomposition fluid, vomit, sweat, breast milk, blood,
serum, and plasma), tissue extracts, culture media (e.g., a liquid
in which a cell, such as a pathogen cell, has been grown),
environmental samples, agricultural products or other foodstuffs,
and their extracts, and DNA identification tags. If desired, the
sample is purified prior to inclusion in a nicking amplification
reaction using any standard method typically used for isolating a
nucleic acid molecule from a biological sample.
[0156] In one embodiment, primers amplify a target nucleic acid of
a pathogen to detect the presence of EBOV or other virus in a
sample. For environmental applications, test samples may include
water, liquid extracts of building materials (e.g., drywall,
ceiling tiles, wall board, fabrics, wall paper, and floor
coverings) that may have been exposed to a subject infected with
EBOV, environmental swabs, or any other sample.
[0157] Methods of the invention provide for the detection of
1.times.10.sup.3, 1.times.10.sup.4, 1.times.10.sup.5,
1.times.10.sup.6, 1.times.10.sup.7, or 1.times.10.sup.9 copies of
EBOV RNA per ml in blood.
Applications
[0158] Target nucleic acid amplification using primers of the
invention have characteristics useful for rapid detection of viral
(e.g., EBOV) nucleic acid molecules. Compositions and methods of
the invention are useful in human diagnostics, where a rapid
diagnostic answer is desired (e.g., detectable amplification in
under 20, 15, 10, 9, 8, 7, 6, 5 minutes or less). In particular
embodiments, the invention provides for the use of an EBOV nicking
amplification reaction assay in human or veterinary diagnostics in
clinical settings or in the field. In other embodiments, the
invention provides for the use of nicking amplification reaction
assays in diagnostic field work, where access to thermocycling
equipment is unavailable or would be prohibitively expensive. In
still other embodiments, the invention provides for the use of
nicking amplification reaction assays in a clinical setting where
rapid quantitative answers are desired.
Detectable Oligonucleotide Probes
[0159] The present invention provides for the detection of target
nucleic acid molecules or amplicons thereof in a nicking
amplification reaction using non-amplifiable detectable
polynucleotide probes comprising at least one polymerase-arresting
molecule (e.g., nucleotide modification or other moiety that
renders the oligonucleotide capable of binding a target nucleic
acid molecule, but incapable of supporting polymerase extension
utilizing the detectable oligonucleotide probe as a target).
Without wishing to be bound by theory, the presence of one or more
moieties which does not allow polymerase progression likely causes
polymerase arrest in non-nucleic acid backbone additions to the
oligonucleotide or through stalling of a replicative polymerase
(i.e. C3-spacer, damaged DNA bases, other spacer moiety, O-2-Me
bases). These constructs thus prevent or reduce illegitimate
amplification of the probe during the course of a nicking
amplification reaction. This distinguishes them from conventional
detection probes, which must be added at the end of the nicking
amplification reaction to prevent their amplification.
[0160] Conventional detection probes have proven impractical for
detecting a nicking amplification reaction in real time. If
conventional detection probes are incorporated into the nicking
amplification reaction, these conventional detection probes are
amplified concurrently with the target. The amplification of these
detection molecules masks the detection of legitimate target
amplicons due to the number of starting molecules of the detection
probe at the start of the reaction.
[0161] The invention provides non-amplifiable detectable
polynucleotide probe that comprise least one polymerase-arresting
molecule. A polymerase-arresting molecule of the invention
includes, but is not limited to, a nucleotide modification or other
moiety that blocks extension by replicative DNA polymerases,
thereby preventing the amplification of detection molecules; but
can allow proper hybridization or nucleotide spacing to the target
molecule or amplified copies of the target molecule. In one
embodiment, a detectable oligonucleotide probe of the invention
comprises a 3 carbon spacer (C3-spacer) that prevents or reduces
the illegitimate amplification of a detection molecule.
[0162] In one embodiment, a detectable oligonucleotide probe
comprises one or more modified nucleotide bases having enhanced
binding affinity to a complementary nucleotide. Examples of
modified bases include, but are not limited to 2' Fluoro amidites,
and 2'OMe RNA amidites (also functioning as a polymerase arresting
molecule). Detectable oligonucleotide probes of the invention can
be synthesized with different colored fluorophores and may be
designed to hybridize with virtually any target sequence. In view
of their remarkable specificity, a non-amplifiable detectable
polynucleotide probe of the invention is used to detect a single
target nucleic acid molecule in a sample, or is used in combination
with detectable oligonucleotide probes each of which binds a
different target nucleic acid molecule. Accordingly, the
non-amplifiable detectable polynucleotide probes of the invention
may be used to detect one or more target nucleic acid molecules in
the same reaction, allowing these targets to be detected
simultaneously. The present invention encompasses the use of such
fluorophores in conjunction with the detectable oligonucleotide
probes described herein.
Implementation in Hardware and/or Software
[0163] The methods described herein can be implemented on
general-purpose or specially programmed hardware or software. For
example, the methods can be implemented by a computer readable
medium. Accordingly, the present invention also provides a software
and/or a computer program product configured to perform the
algorithms and/or methods according to any embodiment of the
present invention. It is well-known to a skilled person in the art
how to configure software which can perform the algorithms and/or
methods provided in the present invention. The computer-readable
medium can be non-transitory and/or tangible. For example, the
computer readable medium can be volatile memory (e.g., random
access memory and the like) or non-volatile memory (e.g. ,
read-only memory, hard disks, floppy discs, magnetic tape, optical
discs, paper table, punch cards, and the like). The computer
executable instructions may be written in a suitable computer
language or combination of several languages. Basic computational
biology methods are described in, for example Setubal and Meidanis
et al., Introduction to Computational Biology Methods (PWS
Publishing Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.),
Computational Methods in Molecular Biology, (Elsevier, Amsterdam,
1998); Rashidi and Buehler, Bioinformatics Basics: Application in
Biological Science and Medicine (CRC Press, London, 2000) and
Ouelette and Bzevanis Bioinformatics: A Practical Guide for
Analysis of Gene and Proteins (Wiley & Sons, Inc., 2n.sup.d
ed., 2001).
[0164] The present invention may also make use of various computer
program products and software for a variety of purposes, such as
probe design, management of data, analysis, and instrument
operation. (See, U.S. Pat. Nos 5,593,839, 5,795,716, 5,733,729,
5,974,164, 6,066,454, 6,090,555, 6,185,561, 6,188,783, 6,223,127,
6,229,911 and 6,308,170.) Additionally, the present invention may
have preferred embodiments that include methods for providing
genetic information over networks such as the Internet as shown in
U.S. Ser. Nos. 10/197,621, 10/063,559 (US Pub No 20020183936), Ser.
Nos. 10/065,856, 10/065,868, 10/328,818, 10/328,872, 10/423,403,
and 60/482,389.
Kits
[0165] The invention also provides kits for the amplification of an
EBOV or other RNA virus nucleic acid molecule. Such kits are useful
for the detection or quantitation of an EBOV or other RNA nucleic
acid in a biological sample obtained from a subject. Kits of the
present invention may comprise, for example, one or more of reverse
transcriptase, DNA polymerases, forward and reverse primers, and
one or more nicking enzymes, as described herein, and a detectable
probe. Where EBOV or other RNA is to be amplified, one or two
nicking enzymes may be included in the kit. Where multiple pathogen
sequences are to be amplified, and the templates designed for those
target sequences comprise the nicking enzyme sites for the same
nicking enzyme, then one or two nicking enzymes may be included.
Where the templates are recognized by different nicking enzymes,
more nicking enzymes may be included in the kit, such as, for
example, 3 or more.
[0166] In one aspect, the invention provides a kit for nucleic acid
amplification comprising a reverse transcriptase, DNA polymerase; a
primary primer, a secondary primer, a nicking enzyme with
specificity to a nicking enzyme binding site within the primers,
and deoxynucleotide triphosphates (dNTP's) (e.g., in a buffered
solution containing components sufficient for amplification. In
various embodiments, the primary primer and secondary primer, each
have a 3'-end specific recognition region sequence complementary or
substantially complementary to the target sequence, where the end
specific recognition region comprises one or more 2' modified
nucleotides; a 5'-end tail region containing a nicking enzyme
binding site upstream of the 3'-end specific recognition region
sequences that is able to dimerize with itself (e.g.,
self-complementary). In particular embodiments, one or more primers
are in a primer-dimer configuration (e.g., produced by heating
about Tm and slow cooling).
[0167] The kits of the present invention may also comprise one or
more of the components in any number of separate containers,
packets, tubes (e.g., <0.2 ml, 0.2 ml, 0.6 ml, 1.5 ml, 5.0 ml,
>5.0 ml), vials, microtiter plates (e.g., <96-well, 96-well,
384-well, 1536-well, >1536-well), ArrayTape, and the like, or
the components may be combined in various combinations in such
containers. In various embodiments, the kit further comprises a
pair of primers capable of binding to and amplifying a reference
sequence. In particular embodiments, the kit comprises one or more
primers in a primer-dimer configuration (e.g., produced by heating
about Tm and slow cooling). In yet other embodiments, the kit
comprises a sterile container which contains the primers; such
containers can be boxes, ampules, bottles, vials, tubes, bags,
pouches, blister-packs, or other suitable container form known in
the art. Such containers can be made of plastic, glass, laminated
paper, metal foil, or other materials suitable for holding nucleic
acids.
[0168] The components of the kit may, for example, be present in
one or more containers, for example, all of the components may be
in one container, or, for example, the enzymes may be in a separate
container from the primers. The components may, for example, be
dried (e.g., powder) or in a stable buffer (e.g., chemically
stabilized, thermally stabilized). Dry components may, for example,
be prepared by lyophilization, vacuum and centrifugal assisted
drying and/or ambient drying. In various embodiments, the
polymerase and nicking enzymes are in lyophilized form in a single
container, and the primers are either lyophilized, freeze dried, or
in buffer, in a different container. In some embodiments, the
polymerase, nicking enzymes, and the primers are, in lyophilized
form, in a single container. In other embodiments, the polymerase
and the nicking enzyme may be separated into different
containers.
[0169] Kits may further comprise, for example, dNTPs used in the
reaction, or modified nucleotides, cuvettes or other containers
used for the reaction, or a vial of water or buffer for
re-hydrating lyophilized components. The buffer used may, for
example, be appropriate for both polymerase and nicking enzyme
activity.
[0170] The kits of the present invention may also comprise
instructions for performing one or more methods described herein
and/or a description of one or more compositions or reagents
described herein. Instructions and/or descriptions may be in
printed form and may be included in a kit insert. A kit also may
include a written description of an Internet location that provides
such instructions or descriptions.
[0171] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry and immunology, which are well within the purview of
the skilled artisan. Such techniques are explained fully in the
literature, such as, "Molecular Cloning: A Laboratory Manual",
second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait,
1984); "Animal Cell Culture" (Freshney, 1987); "Methods in
Enzymology" "Handbook of Experimental Immunology" (Weir, 1996);
"Gene Transfer Vectors for Mammalian Cells" (Miller and Calos,
1987); "Current Protocols in Molecular Biology" (Ausubel, 1987);
"PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current
Protocols in Immunology" (Coligan, 1991). These techniques are
applicable to the production of the polynucleotides and
polypeptides of the invention, and, as such, may be considered in
making and practicing the invention. Particularly useful techniques
for particular embodiments will be discussed in the sections that
follow.
[0172] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the assay, screening, and
therapeutic methods of the invention, and are not intended to limit
the scope of what the inventors regard as their invention.
EXAMPLES
Example 1. One-Step and Two-Step Real-Time Reverse
Transcription-Isothermal Amplification Assays for EBOV
[0173] A one-step reaction refers to a reverse transcriptase (RT)
reaction in which reverse transcription and amplification occur in
a single reaction protocol. A two-step reaction refers to an
reverse transcriptase reaction in which the reverse transcription
is carried out first; followed by a transfer to a second
amplification reaction.
[0174] Assays 1 and 2 were tested for their ability to detect an
EBOV polynucleotide EBOV (FIG. 1). Primers for these assays are
shown at FIG. 2.
[0175] FIGS. 3A-3X show amplification results obtained with Assay 1
and Assay 2. The assays were used to detect copies of EBOV gBlock
in a background of human cDNA. Reaction conditions are
specified.
[0176] FIG. 4 shows detection of EBOV in a background of total
human RNA in a one-step assay.
[0177] FIG. 5 shows detection of synthetic EBOV RNA in a background
of total human RNA in a one-step assay.
[0178] FIGS. 6A-6C provide flow charts illustrating sample
processing for use in an amplification and detection
instrument.
[0179] FIGS. 7A and 7B show sample preparation methods from swabs
and blood, respectively.
[0180] In one working example, Ebola virus was detected using the
following primers and probe sequences:
TABLE-US-00014 Forward GACTCGATATCGAGTCGCTTCCA[MeOC]AGTTATC Primer
[MeOU][MeOA][MeOC][MeOC][MeOG] Reverse
GACTCGATATCGAGTCGAAATGC[MeOA]ACGA[MeOC] Primer
[MeOA][MeOC][MeOC][MeOU] Probe gctacACGACTTTYGCTGAAGgtagc External
CTTCTTAGCTTGGGGCAGTATCA Primer Primers: [MeON] indicates methoxy
base Probe sequence: lowercase = stems, uppercase = recognition 1:5
1000 nM 0.3 U/ul nicking enzyme
[0181] In the sequences above, GAGTC is the nicking enzyme
recognition site. Pyrimidine provides for degeneracy detection of
Ebola strains including Zaire.
TABLE-US-00015 Synthetic DNA target:
AAGATGACTGCAGGAGTCAATGCGCAGTTGGTCCCGGCAGACCAGGCGA
ACATTACCGAATTTTACAACAAGTCCCTTTCATCCTACAAGGAGAATGA
GGAGAACATCCAGTGTGGGGAGAACTTCATGGACATGGAGTGCTTCATG
ATTCTGAACCCCAGTCAGCAGCTGGCAATTGCCGTCTTGTCTCTCACAC
TGGGCACCTTCACAGTTCTGGAGAACTTGCTGGTGCTGTGTGTCACCAC
AGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGTTGCATTTCTG
ATTCCTTCACTCCCGCAGCCTCCGCTGCCGGCCCTCTTACCACTTCATC
ATTAGCCTGGCCGTGGCCGACCTTCTGGGGAGTGTCATTTTTGTCTACA
GCTTTGTTGACTTTCATGTGTTCCACCGCAAGGACAGCCCCAACGTCTT
TCTCTTCAAATTGGGTGGGGTCACCGCCTCCTTCACGGCCTCTGTAGGC AGCCTCTTCC
Synthetic RNA target:
rGrArCrUrGrCrArGrGrArGrUrCrUrGrCrUrGrCrUrUrCrCrAr
CrArGrUrUrArUrCrUrArCrCrGrArGrGrArArCrGrArCrUrUrU
rCrGrCrUrGrArArGrGrUrGrUrCrGrUrUrGrCrArUrUrUrCrUr
GrArUrUrCrCrUrUrCrArCrUrCrCrCrG
[0182] Both 1-step and 2-step reactions contained a final
concentration of 166.7 nM forward primer and a final concentration
of 833.3 nM reverse primer with 200 nM concentration of Probe and
0.1.times. SYBR green (final concentration). In addition both 1 and
2 step reactions contained a final concentration of 1.times.
Extract Buffer 2, comprising Tris pH 8.0, NH.sub.4.sup.+, Na.sup.+,
and Mg.sup.2+; dNTPs; 0.4 U/ul BST polymerase; and 0.3 U/ul
Nt.BSTnbi nicking enzyme. In addition to these components; the 1
step reactions contained 10 U/ul of Maxima Reverse Transcriptase
enzyme; 1.0 U/ul of an RNAse inhibitor (SUBERase IN by life
technologies). Synthetic RNA had 1.0 U/ul of RNAse inhibitor added
as well to prevent degradation. All water used was purchased
nuclease free.
[0183] Reactions were mixed on ice and kept cold until run on the
Roche LC480. The Roche LC480 was run under a two color detection to
detect the calfluor red 610 beacon signal (Abs 590 nm/Em 610 nm)
and the SYBR green signal (Abs 495 nm/Em 520 nm). 1-Step reactions
were carried out at 56.degree. C. for 20 minutes. Results are shown
at FIG. 8.
[0184] 2-step reactions were carried out with the reverse
transcriptase step at 56.degree. C. for 5 minutes (in a heat block)
or at room temperature for 5 minutes following the setup condition
outlined by New England Biolabs
(https://www.neb.com/protocols/2012/10/03/first-strand-cdna-synthesis-kit-
-using-protoscript-ii-reverse-transcriptase-m0368) (FIG. 9). Both
these RT temperatures produced signal for 1.times.10.sup.5 copies
of target per reaction. The reverse transcriptase step was followed
by an amplification step at 56.degree. C. for 15 minutes on the
LC480. Results of this assay are shown at FIG. 10. The copy number
indicated per reaction was determined using the suppliers'
calculations.
Example 2. Detection of a Target RNA in a Complex RNA Mixture
[0185] To determine whether the 1-step and 2-step reactions could
detect a target RNA in complex mixtures of RNA molecules, assays
were designed for the detection of RPPH1 (RNase P RNA Component) in
total human RNA. In one working example, RPPH1 was detected using
the following primers and probe sequences:
TABLE-US-00016 Forward RPPH1.Fc
GACTCGATATCGAGTCCACGAGCmUGAGTGCmGmUmCmCmUmG Primer Reverse RPPH1.Rc
GACTCGATATCGAGTCAGACCTTmCCCAAGGmGmAmCmAmU Primer Probe
RPPH1.Probe.T CCACGCCTGTCACTCCACTCCGCGTGG External rpph1extprimR
CCTCTGGCCCTAGTCTCAG Primer Primers: mN indicates methoxy base
[0186] In a 2-step reaction, human RNA (10 ng) was converted to
cDNA with random hexamer primer and RPPH1 was detected by
amplification of a target specific sequence (FIG. 11A). In a 1-step
reaction, human RNA (20 ng) was detected by amplification of a
target specific sequence using specific reverse transcription
primers (FIG. 11B).
Example 3: Detection of Ebola Virus in a Biological Sample
[0187] In another working example, a synthetic Ebola virus RNA
target was detected when mixed with a crude blood preparation using
the 1-step assay. The crude blood preparation was prepared by
mixing whole blood (20 .mu.l) and sodium dodecyl sulfate (0.5% SDS;
20 .mu.l) and incubating the mixture at room temperature (3 min.).
After incubation, bovine serum albumin was added (2% BSA; 20 .mu.l)
and the resulting mixture was incubated at room temperature (1
min.). The crude blood preparation (1 .mu.l) was spiked with a
synthetic Ebola virus RNA target (1000 copies). Reactions were run
in triplicate at 56.degree. C. on a Roche LC480. Results are shown
at FIG. 12.
[0188] In an additional experiment, the 1-step assay was able to
distinguish between Zaire Ebolavirus Mayinga and Sudan Ebolavirus
Boniface RNA molecules. Vero E6 cells were infected with Zaire
Ebolavirus Mayinga or Sudan Ebolavirus Boniface virus and viral
RNAs were purified. Sets of reactions were run using purified RNA
Zaire Ebolavirus Mayinga (683 copies) or Sudan Ebolavirus Boniface
virus (650 copies). For each set, quadruplicate reactions (10
.mu.l) were run on a Roche LC480. The assay detected Zaire
Ebolavirus Mayinga RNA (FIG. 13; set of curves denoted A) and did
not detect Sudan Ebolavirus Boniface RNA (FIG. 13; set of curves
denoted B). Thus, the Zaire Ebola assay was specific for the
detection of Zaire Ebola Mayinga.
[0189] An instrument comparison was run using various dilutions of
Zaire Ebolavirus Mayinga RNA from about 10.sup.1-10.sup.7 copies of
target RNA, including a no target control (NTC) sample. Instruments
tested included the Roche Lightcycler 480 II, Axxin Detector, and
Douglas Scientific Amplifire amplification and detection
instruments. While some instrument variability was observed, all
instruments could detect copies of EBOV RNA over a wide range (FIG.
14).
[0190] To determine a lower limit of detection for the 1-step EBOV
assay, serially diluted samples containing 100, 50, 25, and 12
copies of Zaire Ebolavirus Mayinga RNA were tested. The 1-step
reactions (10 .mu.l) were run on the Roche LightCycler 480 using at
least 10 technical replicates for each dilution. Twenty (20)
technical replicates were run for the 100 and 50 copy reactions.
Forty (40) technical replicates were run for the 25 copy reactions.
A 100% (20/20) detection rate was observed for the detection of 100
and 50 copies per reaction (FIGS. 15A and 15B). A 95% (38/40)
detection rate was observed for the detection of 25 copies per
reaction (FIG. 15C). Thus, these results show the sensitivity and
specificity of the EBOV assay, even when performed as a 1-step
assay.
Example 4: Detection of Human Immunodeficiency Virus (HIV) in a
Biological Sample
[0191] In one working example, human immunodeficiency virus (HIV)
was detected in a 1-step RNAble.RTM. assay targeting a gag protein
sequence. Purified HIV RNA (subtype C) was obtained (SeraCare), and
known quantities of the HIV RNA, as quantified by COBAS TaqMan
HIV-1 v2.0 test, were tested in the 1-step HIV RNAble.RTM. assay.
The following primers and probe sequences were used:
TABLE-US-00017 Hgag (HIV gag target) Primer Sequence Hgag.F2a
GACTCGATATCGAGTCTGACTAGmCGGAGGmCm TmAmGmAmAmG Hgag.F2b
GACTCGATATCGAGTCTGACTAGmCAGAGGmCm TmAmGmAmAmG Hgag.R1a
GACTCGATATCGAGTCTATTGACmGCTCmTmCm GmCmAmC Hgag.R1b
GACTCGATATCGAGTCTACTGACmGCTCmTmCm GmCmAmC Hgag.rt3.subC*
GCATCTAATTTTTCGCC (external primer) Hgag.probe.T
cgcaagGGAGAGAGATGGGTGcttgcg Primers: mN indicates methoxy base
Probe sequence: lowercase = stems, uppercase = recognition
*External primer sequence is specific to HIV subtype C (for the
purified RNA sample used)
FIG. 16A is a map of the amplicon showing the locations of the
sequences used. The sequence of the external primer was specific to
HIV subtype C (for the purified RNA sample used). The 1-step HIV
RNAble.RTM. assay was designed with two sets of forward and reverse
primers to account for sequence variations in the population. In
the sequences above, GAGTC is the nicking enzyme recognition
site.
[0192] The 1-step reactions contained a final concentration of 9 nM
forward primer (1:1 mix of Hgag.F2a+Hgag.F2b) and a final
concentration of 91 nM reverse primer (1:1 mix of
Hgag.R1a+Hgag.R1b) in a primer ratio of about 1:10 forward to
reverse primers. Final concentrations of 200 nM probe and 100 nM
external primer were used. In addition, the 1 step reactions
contained a final concentration of 1.times. Run Buffer, comprising
Tris, K.sup.+, and Mg.sup.2+; Guanidinium thiocyanate (GITC);
dNTPs; 0.4 U/ul BST polymerase; and 0.3 U/ul Nt.BSTnbi nicking
enzyme. In addition to these components; the 1 step reactions
contained 0.2 U/ul of AMV Reverse Transcriptase High Spec Activity
XL (Life Sciences Advanced Technologies) and 0.5 U/ul of an RNAse
inhibitor (Superasin; Thermo Fisher). All water used was nuclease
free.
[0193] Reactions were run using real-time detection of calfluor red
610 beacon signal (Abs 590 nm/Em 610 nm). 1-Step reactions were
carried out at 56.degree. C. for 20 minutes using 125, 250, 500,
and 1000 copies of HIV RNA. Specific detection of HIV RNA at all
copy numbers was demonstrated in the 1-step HIV RNAble.RTM. assay
(FIG. 16B).
Example 5: Detection of Dengue Virus Type 4 (DENV-4) in a
Biological Sample
[0194] In one working example, dengue virus type 4 (DENV-4) was
detected in a 1-step RNAble.RTM. assay targeting a 3' UTR sequence.
Total RNA was isolated from cell culture, which included both viral
and host cell RNA, and used in the 1-step DENV-4 RNAble.RTM. assay.
Thus, total copy number was unknown. The following primers and
probe sequences were used:
TABLE-US-00018 Den4 (Dengue type 4) Primer Sequence Den4.F2
GACTCGATATCGAGTCCAAAAACmAGCATATTmGm AmCmGmC Den4.R1a
GACTCGATATCGAGTCAGACAGCmAGGATCmTmCm TmGmG Den4.R1b
GACTCGATATCGAGTCAGACAGCmAGGATCmTmGm TmGmG Den4.extRT1
TCTGTGCCTGGATTGAT (external primer) Den4.probe.B
cgcatcTGGTCTTTCCCAGCgatgcg Den4.F2
GACTCGATATCGAGTCCAAAAACmAGCATATTmGm AmCmGmC Primers: mN indicates
methoxy base Probe sequence: lowercase = stems, uppercase =
recognition
FIG. 17A is a map of the amplicon showing the locations of the
sequences used. The 1-step DENV-4 RiNAble.RTM. assay was designed
with two sets of reverse primers to account for sequence variations
in the population. In the sequences above, GAGTC is the nicking
enzyme recognition site.
[0195] The 1-step reactions contained a final concentration of 83
nM forward primer and a final concentration of 17 nM reverse primer
(1:1 mix of Den4.R1a+Den4.R1b) in a primer ratio of about 5:1
forward to reverse primers. Final concentrations of 200 nM probe
and 100 nM external primer were used. In addition, the 1 step
reactions contained a final concentration of 1.times. Run Buffer,
comprising Tris, K.sup.+, and Mg.sup.2+; dNTPs; 0.4 U/ul BST
polymerase; and 0.3 U/ul Nt.BSTnbi nicking enzyme. In addition to
these components; the 1 step reactions contained 0.2 U/ul of AMV
Reverse Transcriptase High Spec Activity XL (Life Sciences Advanced
Technologies) and 0.5 U/ul of an RNAse inhibitor (Superasin; Thermo
Fisher). All water used was nuclease free.
[0196] Reactions were run using real-time detection of calfluor red
610 beacon signal (Abs 590 nm/Em 610 nm). 1-Step reactions were
carried out at 56.degree. C. for 20 minutes using 20 pg total RNA.
Specific detection of Dengue 4 RNA was demonstrated in the 1-step
DENV-4 RNAble.RTM. assay (FIG. 17B).
Example 6: Detection of Influenza B in a Biological Sample
[0197] In one working example, influenza B was detected in a 1-step
RiNAble.RTM. assay targeting an influenza Segment 7 sequence. Total
RNA was isolated from cell culture, which included both viral and
host cell RNA, and used in the 1-step influenza B RiNAble.RTM.
assay. Thus, total copy number was unknown. The following primers
and probe sequences were used:
TABLE-US-00019 FluB (influenza B) Primer Sequence FluB.F2a
GACTCGATATCGAGTCAAATGCAmGATGGTCTCmA mGmCmTmA FluB.F2b
GACTCGATATCGAGTCAAATGCAmAATGGTCTCmA mGmCmTmA FluB.F2c
GACTCGATATCGAGTCAAATGCAmGATGGTTTCmA mGmCmTmA FluB.R3a
GACTCGATATCGAGTCCTCCTTTmTCCCATTCCAT mTmCmAmTmT FluB.R3b
GACTCGATATCGAGTCCTCCCTTmTCCCATTCCAT mTmCmAmTmT FluB.R3c
GACTCGATATCGAGTCCTCCTTTmCCCCATTCCAT mTmCmAmTmT FluB.extRT1a
TTTTGGACGTCTTCTCC (external primer) FluB.extRT1b TTTTGAACGTCTTCTCC
(external primer) FluB.probe.T gccaaGCTATGAACACAGCAAActtggc
Primers: mN indicates methoxy base Probe sequence: lowercase =
stems, uppercase = recognition
FIG. 18A is a map of the amplicon showing the locations of the
sequences used. The 1-step Influenza B RNAble.RTM. assay was
designed with three sets of forward and reverse primers and two
external primers to account for sequence variations in the
population. In the sequences above, GAGTC is the nicking enzyme
recognition site.
[0198] The 1-step reactions contained a final concentration of 9 nM
forward primer (1:1:1 mix of FluB.F2a+FluB.F2b+FluB.F2c) and a
final concentration of 91 nM reverse primer (1:1:1 mix of
FluB.R3a+FluB.R3b+FluB.R3c) in a primer ratio of about 1:10 forward
to reverse primers. Final concentrations of 200 nM probe and 100 nM
external primer were used. In addition, the 1 step reactions
contained a final concentration of 1.times. Run Buffer, comprising
Tris, K.sup.+, and Mg.sup.2+; dNTPs; 0.4 U/ul BST polymerase; and
0.3 U/ul Nt.BSTnbi nicking enzyme. In addition to these components;
the 1 step reactions contained 0.2 U/ul of AMV Reverse
Transcriptase High Spec Activity XL (Life Sciences Advanced
Technologies) and 0.5 U/ul of an RNAse inhibitor (Superasin; Thermo
Fisher). All water used was nuclease free.
[0199] Reactions were run using real-time detection of calfluor red
610 beacon signal (Abs 590 nm/Em 610 nm). 1-Step reactions were
carried out at 56.degree. C. for 20 minutes using total RNA from
different isolates. Specific detection of influenza B in all
isolates was demonstrated in the 1-step influenza B RiNAble.RTM.
assay (FIG. 18B).
Example 7: Detection of Bovine Viral Diarrhea Virus Genotype 1
(BVDV1) in a Biological Sample
[0200] In one working example, Bovine Viral Diarrhea Virus Genotype
1 (BVDV1) was detected in a 1-step RiNAble.RTM. assay targeting an
influenza Segment 7 sequence. Total RNA was isolated from cell
culture, which included both viral and host cell RNA, and used in
the 1-step BVDV1 RiNAble.RTM. assay. Thus, total copy number was
unknown. The following primers and probe sequences were used:
TABLE-US-00020 Bovine Viral Diarrhea Virus Type 1 (BVDV1) Primer
Sequence BVDV1.F1a GACTCGATATCGAGTCGGCCCACmTGTATTGCTmA mCmTmGmAmAmA
BVDV1.F1b GACTCGATATCGAGTCGGCCCACmTGCACTGCTmA mCmTmAmAmAmA BVDV1.R1
GACTCGATATCGAGTCTGTGATCmAACTCCmAmTm GmTmGmCmC BVDV1.RT1v
TATGTTTTGTATAAAAGTTCATTTG (external primer) BVDV1.ProbeT
cgctacATCTCTGCTGTACATGgtagcg Primers: mN indicates methoxy base
Probe sequence: lowercase = stems, uppercase = recognition
FIG. 19A is a map of the amplicon showing the locations of the
sequences used. The 1-step BVDV1 RiNAble.RTM. assay was designed
with two sets of forward primers to account for sequence variations
in the population. In the sequences above, GAGTC is the nicking
enzyme recognition site.
[0201] The 1-step reactions contained a final concentration of 9 nM
forward primer (1:1 mix of BVDV1.F1a+BVDV1.F1b) and a final
concentration of 91 nM reverse primer in a primer ratio of about
1:10 forward to reverse primers. Final concentrations of 200 nM
probe and 100 nM external primer were used. In addition, the 1 step
reactions contained a final concentration of 1.times. Run Buffer,
comprising Tris, K.sup.+, and Mg.sup.2+; dNTPs; 0.4 U/ul BST
polymerase; and 0.3 U/ul Nt.BSTnbi nicking enzyme. In addition to
these components; the 1 step reactions contained 0.2 U/ul of AMY
Reverse Transcriptase High Spec Activity XL (Life Sciences Advanced
Technologies) and 0.5 U/ul of an RNAse inhibitor (Superasin; Thermo
Fisher). All water used was nuclease free.
[0202] Reactions were run using real-time detection of calfluor red
610 beacon signal (Abs 590 nm/ Em 610 nm). 1-Step reactions were
carried out at 56.degree. C. for 20 minutes using purified RNA (20
pg/technical replicate) from BVDV1 virus culture (mixed bovine host
cell RNA and virus) and cell culture crude lysate (undiluted and
1:100 dilution). Specific detection of BVDV1 virus in all samples
was demonstrated in the 1-step BVDV1 RiNAble.RTM. assay (FIG.
19B).
Example 8: Molecular Beacon Recognition of Ebola Strains Exemplary
Beacon BLAST Alignment Output and Strains List
TABLE-US-00021 [0203] Zaire ebolavirus isolate H.
sapiens-tc/COD/1976/Yambuku-Ecran, complete genome Sequence ID:
gb|KM655246.1| Length: 18797 Number of Matches: 5 Range 1: 6513 to
6528 GenBank Graphics Next Match Previous Match Score Expect
Identities Gaps Strand 29.4 bits(14) 0.017 15/16(94%) 0/16(0%)
Plus/Plus Query 1 ACGACTTTYGCTGAAG 16 |||||||| ||||||| Sbjct 6513
ACGACTTTCGCTGAAG 6528
Beacon Alone Strains List
TABLE-US-00022 [0204] Zaire ebolavirus isolate
H.sapiens-tc/COD/1976/Yambuku-Ecran, complete genome 29.4 89.2 100%
0.017 94% KM655246.1
TABLE-US-00023 Zaire ebolavirus isolate
H.sapiens-wt/GIN/2014/Gueckedou-C05, complete genome 29.4 104 100%
0.017 94% KJ660348.2
TABLE-US-00024 Zaire ebolavirus isolate
H.sapiens-wt/GIN/2014/Gueckedou-C07, complete genome 29.4 104 100%
0.017 94% KJ660347.2
TABLE-US-00025 Zaire ebolavirus isolate
H.sapiens-wt/GIN/2014/Kissidougou-C15, complete genome 29.4 104
100% 0.017 94% KJ660346.2
TABLE-US-00026 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-NM042.3, partial genome 29.4 104
100% 0.017 94% KM233118.1
TABLE-US-00027 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-NM042.2, partial genome 29.4 104
100% 0.017 94% KM233117.1
TABLE-US-00028 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-NM042.1, partial genome 29.4 104
100% 0.017 94% KM233116.1
TABLE-US-00029 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3857, partial genome 29.4 104
100% 0.017 94% KM233115.1
TABLE-US-00030 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3856.3, partial genome 29.4 104
100% 0.017 94% KM233114.1
TABLE-US-00031 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3856.1, partial genome 29.4 104
100% 0.017 94% KM233113.1
TABLE-US-00032 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3851, partial genome 29.4 104
100% 0.017 94% KM233112.1
TABLE-US-00033 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3850, partial genome 29.4 104
100% 0.017 94% KM233111.1
TABLE-US-00034 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3848, partial genome 29.4 104
100% 0.017 94% KM233110.1
TABLE-US-00035 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3846, partial genome 29.4 104
100% 0.017 94% KM233109.1
TABLE-US-00036 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3841, partial genome 29.4 104
100% 0.017 94% KM233107.1
TABLE-US-00037 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3840, partial genome 29.4 104
100% 0.017 94% KM233106.1
TABLE-US-00038 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3838, partial genome 29.4 104
100% 0.017 94% KM233105.1
TABLE-US-00039 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3834, partial genome 29.4 104
100% 0.017 94% KM233104.1
TABLE-US-00040 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3831, partial genome 29.4 104
100% 0.017 94% KM233103.1
TABLE-US-00041 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3829, partial genome 29.4 104
100% 0.017 94% KM233102.1
TABLE-US-00042 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3827, partial genome 29.4 104 100% 0.017 94%
KM233101.1
TABLE-US-00043 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3826, partial genome 29.4 104 100% 0.017 94%
KM233100.1
TABLE-US-00044 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3825.2, partial genome 29.4 104 100% 0.017 94%
KM233099.1
TABLE-US-00045 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3825.1, partial genome 29.4 104 100% 0.017 94%
KM233098.1
TABLE-US-00046 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3823, partial genome 29.4 104 100% 0.017 94%
KM233097.1
TABLE-US-00047 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3822, partial genome 29.4 104 100% 0.017 94%
KM233096.1
TABLE-US-00048 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3821, partial genome 29.4 104 100% 0.017 94%
KM233095.1
TABLE-US-00049 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3819, partial genome 29.4 104 100% 0.017 94%
KM233093.1
TABLE-US-00050 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3818, partial genome 29.4 104 100% 0.017 94%
KM233092.1
TABLE-US-00051 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3817, partial genome 29.4 104 100% 0.017 94%
KM233091.1
TABLE-US-00052 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3816, partial genome 29.4 104 100% 0.017 94%
KM233090.1
TABLE-US-00053 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3814, partial genome 29.4 104 100% 0.017 94%
KM233089.1
TABLE-US-00054 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3810.2, partial genome 29.4 104 100% 0.017 94%
KM233088.1
TABLE-US-00055 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3810.1, partial genome 29.4 104 100% 0.017 94%
KM233087.1
TABLE-US-00056 Zaire ebolavirus isolate Ebola virus H. sapiens-wt/
SLE/2014/ManoRiver-G3809, partial genome 29.4 104 100% 0.017 94%
KM233086.1
TABLE-US-00057 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3808, partial genome 29.4 104 100%
0.017 94% KM233085.1
TABLE-US-00058 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3807, partial genome 29.4 104 100%
0.017 94% KM233084.1
TABLE-US-00059 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3805.2, partial genome 29.4 104
100% 0.017 94% KM233083.1
TABLE-US-00060 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3805.1, partial genome 29.4 104
100% 0.017 94% KM233082.1
TABLE-US-00061 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3800, partial genome 29.4 104 100%
0.017 94% KM233081.1
TABLE-US-00062 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ManoRiver- G3799, partial genome 29.4 104
100% 0.017 94% KM233080.1
TABLE-US-00063 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3798, partial genome 29.4 104 100%
0.017 94% KM233079.1
TABLE-US-00064 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3795, partial genome 29.4 104 100%
0.017 94% KM233077.1
TABLE-US-00065 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3789.1, partial genome 29.4 104
100% 0.017 94% KM233076.1
TABLE-US-00066 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3788, partial genome 29.4 104 100%
0.017 94% KM233075.1
TABLE-US-00067 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3787, partial genome 29.4 104 100%
0.017 94% KM233074.1
TABLE-US-00068 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3786, partial genome 29.4 104 100%
0.017 94% KM233073.1
TABLE-US-00069 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3782, partial genome 29.4 104 100%
0.017 94% KM233072.1
TABLE-US-00070 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3771, partial genome 29.4 104 100%
0.017 94% KM233071.1
TABLE-US-00071 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ManoRiver- G3770.2, partial genome 29.4 104
100% 0.017 94% KM233070.1
TABLE-US-00072 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3770.1, partial genome 29.4 104 100% 0.017 94%
KM233069.1
TABLE-US-00073 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3769.3, partial genome 29.4 104 100% 0.017 94%
KM233067.1
TABLE-US-00074 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3769.2, partial genome 29.4 104 100% 0.017 94%
KM233066.1
TABLE-US-00075 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3769.1, partial genome 29.4 104 100% 0.017 94%
KM233065.1
TABLE-US-00076 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3765.2, partial genome 29.4 104 100% 0.017 94%
KM233064.1
TABLE-US-00077 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3764, partial genome 29.4 104 100% 0.017 94%
KM233063.1
TABLE-US-00078 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3758, partial genome 29.4 104 100% 0.017 94%
KM233062.1
TABLE-US-00079 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3752, partial genome 29.4 104 100% 0.017 94%
KM233061.1
TABLE-US-00080 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3750.3, partial genome 29.4 104 100% 0.017 94%
KM233060.1
TABLE-US-00081 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3750.2, partial genome 29.4 104 100% 0.017 94%
KM233059.1
TABLE-US-00082 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3750.1, partial genome 29.4 104 100% 0.017 94%
KM233058.1
TABLE-US-00083 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3735.2, partial genome 29.4 104 100% 0.017 94%
KM233057.1
TABLE-US-00084 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3735.1, partial genome 29.4 104 100% 0.017 94%
KM233056.1
TABLE-US-00085 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3734.1, partial genome 29.4 104 100% 0.017 94%
KM233055.1
TABLE-US-00086 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3729, partial genome 29.4 104 100% 0.017 94%
KM233054.1
TABLE-US-00087 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3724, partial genome 29.4 104 100% 0.017 94%
KM233053.1
TABLE-US-00088 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3713.4, partial genome 29.4 104 100% 0.017 94%
KM233052.1
TABLE-US-00089 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3713.3, partial genome 29.4 104 100% 0.017 94%
KM233051.1
TABLE-US-00090 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3713.2, partial genome 29.4 104 100% 0.017 94%
KM233050.1
TABLE-US-00091 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-G3707, partial genome 29.4 104 100% 0.017 94%
KM233049.1
TABLE-US-00092 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM124.4, partial genome 29.4 104 100% 0.017 94%
KM233048.1
TABLE-US-00093 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM124.3, partial genome 29.4 104 100% 0.017 94%
KM233047.1
TABLE-US-00094 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM124.2, partial genome 29.4 104 100% 0.017 94%
KM233046.1
TABLE-US-00095 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM124.1, partial genome 29.4 104 100% 0.017 94%
KM233045.1
TABLE-US-00096 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM121, partial genome 29.4 104 100% 0.017 94%
KM233044.1
TABLE-US-00097 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM120, partial genome 29.4 104 100% 0.017 94%
KM233043.1
TABLE-US-00098 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM119, partial genome 29.4 104 100% 0.017 94%
KM233042.1
TABLE-US-00099 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM115, partial genome 29.4 104 100% 0.017 94%
KM233041.1
TABLE-US-00100 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM113, partial genome 29.4 104 100% 0.017 94%
KM233040.1
TABLE-US-00101 Zaire ebolavirus isolate Ebola virus H.sapiens-wt/
SLE/2014/ManoRiver-EM112, partial genome 29.4 104 100% 0.017 94%
KM233039.1
TABLE-US-00102 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM111, partial genome 29.4 104 100%
0.017 94% KM233038.1
TABLE-US-00103 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM110, partial genome 29.4 104 100%
0.017 94% KM233037.1
TABLE-US-00104 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM106, partial genome 29.4 104 100%
0.017 94% KM233036.1
TABLE-US-00105 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM104, partial genome 29.4 104 100%
0.017 94% KM233035.1
TABLE-US-00106 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3687.1, partial genome 29.4 104
100% 0.017 94% KM034563.1
TABLE-US-00107 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3686.1, partial genome 29.4 104
100% 0.017 94% KM034562.1
TABLE-US-00108 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3683.1, partial genome 29.4 104
100% 0.017 94% KM034561.1
TABLE-US-00109 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3682.1, partial genome 29.4 104
100% 0.017 94% KM034560.1
TABLE-US-00110 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3680.1, partial genome 29.4 104
100% 0.017 94% KM034559.1
TABLE-US-00111 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3679.1, partial genome 29.4 104
100% 0.017 94% KM034558.1
TABLE-US-00112 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3677.2, partial genome 29.4 104
100% 0.017 94% KM034557.1
TABLE-US-00113 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3677.1, partial genome 29.4 104
100% 0.017 94% KM034556.1
TABLE-US-00114 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3676.2, partial genome 29.4 104
100% 0.017 94% KM034555.1
TABLE-US-00115 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3676.1, partial genome 29.4 104
100% 0.017 94% KM034554.1
TABLE-US-00116 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3670.1, partial genome 29.4 104
100% 0.017 94% KM034553.1
TABLE-US-00117 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM098, partial genome 29.4 104 100%
0.017 94% KM034552.1
TABLE-US-00118 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM096, partial genome 29.4 104 100%
0.017 94% KM034551.1
TABLE-US-00119 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-EM095, partial genome 29.4 104 100%
0.017 94% KM034550.1
TABLE-US-00120 Zaire ebolavirus isolate H.
sapiens-wt/SLE/2014/ManoRiver- EM095B, partial genome 29.4 104 100%
0.017 94% KM034549.1
TABLE-US-00121 Mutant Zaire ebolavirus, complete sequence 29.4 89.2
100% 0.017 94% KF827427.1
Amplicon Similarity Analysis Across Ebola Strains
Exemplary BLAST Alignment Output and Strains List
TABLE-US-00122 [0205] Zaire ebolavirus isolate H.
sapiens-tc/COD/1976/Yambuku-Ecran, complete genome Sequence ID:
gb|KM655246.1| Length: 18797 Number of Matches: 1 Range 1: 6492 to
6547 GenBank Graphics Next Match Previous Match Score Expect
Identities Gaps Strand 102 bits(112) 1e-23 56/56(100%) 0/56(0%)
Plus/Plus Query 1
TCCACAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGTTGCATTTCTGAT 56
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6492
TCCACAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGTTGCATTTCTGAT 6547
Strains List
TABLE-US-00123 [0206] Zaire ebolavirus isolate H.
sapiens-tc/COD/1976/Yambuku- Ecran, complete genome 102 102 100%
1e-23 100% KM655246.1
TABLE-US-00124 Zaire ebolavirus isolate H.
sapiens-wt/GIN/2014/Gueckedou- C05, complete genome 102 102 100%
1e-23 100% KJ660348.2
TABLE-US-00125 Zaire ebolavirus isolate H.
sapiens-wt/GIN/2014/Gueckedou- C07, complete genome 102 102 100%
1e-23 100% KJ660347.2
TABLE-US-00126 Zaire ebolavirus isolate H.
sapiens-wt/GIN/2014/Kissidougou- C15, complete genome 102 102 100%
1e-23 100% KJ660346.2
TABLE-US-00127 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-NM042.3, partial genome 102 102 100%
1e-23 100% KM233118.1
TABLE-US-00128 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-NM042.2, partial genome 102 102 100%
1e-23 100% KM233117.1
TABLE-US-00129 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-NM042.1, partial genome 102 102 100%
1e-23 100% KM233116.1
TABLE-US-00130 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3857, partial genome 102 102 100%
1e-23 100% KM233115.1
TABLE-US-00131 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3856.3, partial genome 102 102 100%
1e-23 100% KM233114.1
TABLE-US-00132 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3856.1, partial genome 102 102 100%
1e-23 100% KM233113.1
TABLE-US-00133 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3851, partial genome 102 102 100%
1e-23 100% KM233112.1
TABLE-US-00134 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3850, partial genome 102 102 100%
1e-23 100% KM233111.1
TABLE-US-00135 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3848, partial genome 102 102 100%
1e-23 100% KM233110.1
TABLE-US-00136 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3846, partial genome 102 102 100%
1e-23 100% KM233109.1
TABLE-US-00137 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3841, partial genome 102 102 100%
1e-23 100% KM233107.1
TABLE-US-00138 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3840, partial genome 102 102 100%
1e-23 100% KM233106.1
TABLE-US-00139 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3838, partial genome 102 102 100%
1e-23 100% KM233105.1
TABLE-US-00140 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3834, partial genome 102 102 100%
1e-23 100% KM233104.1
TABLE-US-00141 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3831, partial genome 102 102 100%
1e-23 100% KM233103.1
TABLE-US-00142 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3829, partial genome 102 102 100%
1e-23 100% KM233102.1
TABLE-US-00143 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3827, partial genome 102 102 100%
1e-23 100% KM233101.1
TABLE-US-00144 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3826, partial genome 102 102 100%
1e-23 100% KM233100.1
TABLE-US-00145 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3825.2, partial genome 102 102 100%
1e-23 100% KM233099.1
TABLE-US-00146 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3825.1, partial genome 102 102 100%
1e-23 100% KM233098.1
TABLE-US-00147 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3823, partial genome 102 102 100%
1e-23 100% KM233097.1
TABLE-US-00148 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3822, partial genome 102 102 100%
1e-23 100% KM233096.1
TABLE-US-00149 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3821, partial genome 102 102 100%
1e-23 100% KM233095.1
TABLE-US-00150 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3819, partial genome 102 102 100%
1e-23 100% KM233093.1
TABLE-US-00151 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3818, partial genome 102 102 100%
1e-23 100% KM233092.1
TABLE-US-00152 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3817, partial genome 102 102 100%
1e-23 100% KM233091.1
TABLE-US-00153 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3816, partial genome 102 102 100%
1e-23 100% KM233090.1
TABLE-US-00154 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3814, partial genome 102 102 100%
1e-23 100% KM233089.1
TABLE-US-00155 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3810.2, partial genome 102 102 100%
1e-23 100% KM233088.1
TABLE-US-00156 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3810.1, partial genome 102 102 100%
1e-23 100% KM233087.1
TABLE-US-00157 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3809, partial genome 102 102 100%
1e-23 100% KM233086.1
TABLE-US-00158 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3808, partial genome 102 102 100%
1e-23 100% KM233085.1
TABLE-US-00159 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3807, partial genome 102 102 100%
1e-23 100% KM233084.1
TABLE-US-00160 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3805.2, partial genome 102 102 100%
1e-23 100% KM233083.1
TABLE-US-00161 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3805.1, partial genome 102 102 100%
1e-23 100% KM233082.1
TABLE-US-00162 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3800, partial genome 102 102 100%
1e-23 100% KM233081.1
TABLE-US-00163 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3799, partial genome 102 102 100%
1e-23 100% KM233080.1
TABLE-US-00164 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3798, partial genome 102 102 100%
1e-23 100% KM233079.1
TABLE-US-00165 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3795, partial genome 102 102 100%
1e-23 100% KM233077.1
TABLE-US-00166 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3789.1, partial genome 102 102 100%
1e-23 100% KM233076.1
TABLE-US-00167 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3788, partial genome 102 102 100%
1e-23 100% KM233075.1
TABLE-US-00168 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3787, partial genome 102 102 100%
1e-23 100% KM233074.1
TABLE-US-00169 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3786, partial genome 102 102 100%
1e-23 100% KM233073.1
TABLE-US-00170 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3782, partial genome 102 102 100%
1e-23 100% KM233072.1
TABLE-US-00171 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3771, partial genome 102 102 100%
1e-23 100% KM233071.1
TABLE-US-00172 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3770.2, partial genome 102 102 100%
1e-23 100% KM233070.1
TABLE-US-00173 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3770.1, partial genome 102 102 100%
1e-23 100% KM233069.1
TABLE-US-00174 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3769.3, partial genome 102 102 100%
1e-23 100% KM233067.1
TABLE-US-00175 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3769.2, partial genome 102 102 100%
1e-23 100% KM233066.1
TABLE-US-00176 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3769.1, partial genome 102 102 100%
1e-23 100% KM233065.1
TABLE-US-00177 Zaire ebolavirus isolate Ebola virus H.
sapiens-wt/SLE/2014/ ManoRiver-G3765.2, partial genome 102 102 100%
1e-23 100% KM233064.1
TABLE-US-00178 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3764, partial genome 102 102 100%
1e-23 100% KM233063.1
TABLE-US-00179 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3758, partial genome 102 102 100%
1e-23 100% KM233062.1
TABLE-US-00180 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3752, partial genome 102 102 100%
1e-23 100% KM233061.1
TABLE-US-00181 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3750.3, partial genome 102 102
100% 1e-23 100% KM233060.1
TABLE-US-00182 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3750.2, partial genome 102 102
100% 1e-23 100% KM233059.1
TABLE-US-00183 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3750.1, partial genome 102 102
100% 1e-23 100% KM233058.1
TABLE-US-00184 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3735.2, partial genome 102 102
100% 1e-23 100% KM233057.1
TABLE-US-00185 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3735.1, partial genome 102 102
100% 1e-23 100% KM233056.1
TABLE-US-00186 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3734.1, partial genome 102 102
100% 1e-23 100% KM233055.1
TABLE-US-00187 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3729, partial genome 102 102 100%
1e-23 100% KM233054.1
TABLE-US-00188 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3724, partial genome 102 102 100%
1e-23 100% KM233053.1
TABLE-US-00189 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3713.4, partial genome 102 102
100% 1e-23 100% KM233052.1
TABLE-US-00190 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3713.3, partial genome 102 102
100% 1e-23 100% KM233051.1
TABLE-US-00191 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3713.2, partial genome 102 102
100% 1e-23 100% KM233050.1
TABLE-US-00192 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3707, partial genome 102 102 100%
1e-23 100% KM233049.1
TABLE-US-00193 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM124.4, partial genome 102 102
100% 1e-23 100% KM233048.1
TABLE-US-00194 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM124.3, partial genome 102 102
100% 1e-23 100% KM233047.1
TABLE-US-00195 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM124.2, partial genome 102 102
100% 1e-23 100% KM233046.1
TABLE-US-00196 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM124.1, partial genome 102 102
100% 1e-23 100% KM233045.1
TABLE-US-00197 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM121, partial genome 102 102 100%
1e-23 100% KM233044.1
TABLE-US-00198 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM120, partial genome 102 102 100%
1e-23 100% KM233043.1
TABLE-US-00199 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM119, partial genome 102 102 100%
1e-23 100% KM233042.1
TABLE-US-00200 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM115, partial genome 102 102 100%
1e-23 100% KM233041.1
TABLE-US-00201 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM113, partial genome 102 102 100%
1e-23 100% KM233040.1
TABLE-US-00202 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM112, partial genome 102 102 100%
1e-23 100% KM233039.1
TABLE-US-00203 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM111, partial genome 102 102 100%
1e-23 100% KM233038.1
TABLE-US-00204 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM110, partial genome 102 102 100%
1e-23 100% KM233037.1
TABLE-US-00205 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM106, partial genome 102 102 100%
1e-23 100% KM233036.1
TABLE-US-00206 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM104, partial genome 102 102 100%
1e-23 100% KM233035.1
TABLE-US-00207 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3687.1, partial genome 102 102
100% 1e-23 100% KM034563.1
TABLE-US-00208 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3686.1, partial genome 102 102
100% le-23 100% KM034562.1
TABLE-US-00209 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3683.1, partial genome 102 102
100% le-23 100% KM034561.1
TABLE-US-00210 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3682.1, partial genome 102 102
100% le-23 100% KM034560.1
TABLE-US-00211 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3680.1, partial genome 102 102
100% le-23 100% KM034559.1
TABLE-US-00212 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3679.1, partial genome 102 102
100% le-23 100% KM034558.1
TABLE-US-00213 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3677.2, partial genome 102 102
100% le-23 100% KM034557.1
TABLE-US-00214 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3677.1, partial genome 102 102
100% le-23 100% KM034556.1
TABLE-US-00215 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3676.2, partial genome 102 102
100% le-23 100% KM034555.1
TABLE-US-00216 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3676.1, partial genome 102 102
100% le-23 100% KM034554.1
TABLE-US-00217 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-G3670.1, partial genome 102 102
100% le-23 100% KM034553.1
TABLE-US-00218 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM098, partial genome 102 102 100%
le-23 100% KM034552.1
TABLE-US-00219 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM096, partial genome 102 102 100%
le-23 100% KM034551.1
TABLE-US-00220 Zaire ebolavirus isolate Ebola virus
H.sapiens-wt/SLE/2014/ ManoRiver-EM095, partial genome 102 102 100%
le-23 100% KM034550.1
TABLE-US-00221 Zaire ebolavirus isolate H.sapiens-wt/SLE/2014/
ManoRiver-EM095B, partial genome 102 102 100% le-23 100%
KM034549.1
TABLE-US-00222 Mutant Zaire ebolavirus, complete sequence 102 102
100% le-23 100%
Other Embodiments
[0207] From the foregoing description, it will be apparent that
variations and modifications may be made to the invention described
herein to adopt it to various usages and conditions. Such
embodiments are also within the scope of the following claims.
[0208] The recitation of a listing of elements in any definition of
a variable herein includes definitions of that variable as any
single element or combination (or subcombination) of listed
elements. The recitation of an embodiment herein includes that
embodiment as any single embodiment or in combination with any
other embodiments or portions thereof
[0209] This application may be related to International Patent
Application No. PCT/US2013/035750, filed Apr. 9, 2013, which claims
the benefit of U.S. Provisional Application No.: 61/621,975, filed
Apr. 9, 2012, the entire contents of which are incorporated herein
by reference.
[0210] This application may be related to International Patent
Application No. PCT/US2011/047049, filed Aug. 9, 2011, which claims
the benefit of U.S. Provisional Application No.: 61/373,695, filed
Aug. 13, 2010, the entire contents of which are incorporated herein
by reference.
[0211] All patents and publications mentioned in this specification
are herein incorporated by reference to the same extent as if each
independent patent and publication was specifically and
individually indicated to be incorporated by reference.
Sequence CWU 1
1
75136DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primerDescription of Combined DNA/RNA Molecule Synthetic
primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 1gactcgatat cgagtcgctt
ccacagttat cuaccg 36233DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primerDescription of Combined DNA/RNA
Molecule Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 2gactcgatat cgagtcgaaa
tgcaacgaca ccu 33326DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 3gctacacgac tttygctgaa ggtagc
26426DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe5'-CALRed610nm-modified3'-BHQ2-modified 4gctacacgac
tttygctgaa ggtagc 26526DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe5'-FAM or
FITC-modified3'-BHQ1-modified 5gctacacgac tttygctgaa ggtagc
26636DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(30)..(36)Methoxy base 6gactcgatat cgagtctgac
tagcggaggc tagaag 36736DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(30)..(36)Methoxy base 7gactcgatat cgagtctgac
tagcagaggc tagaag 36833DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(28)..(33)Methoxy base 8gactcgatat cgagtctatt
gacgctctcg cac 33933DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(28)..(33)Methoxy base 9gactcgatat cgagtctact
gacgctctcg cac 331027DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 10cgcaagggag agagatgggt gcttgcg
271136DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 11gactcgatat cgagtccaaa
aacagcatat tgacgc 361234DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(30)..(34)Methoxy base 12gactcgatat cgagtcagac
agcaggatct ctgg 341334DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(30)..(34)Methoxy base 13gactcgatat cgagtcagac
agcaggatct gtgg 341426DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 14cgcatctggt ctttcccagc gatgcg
261537DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(33)..(37)Methoxy base 15gactcgatat cgagtcaaat
gcagatggtc tcagcta 371637DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(33)..(37)Methoxy base 16gactcgatat cgagtcaaat
gcaaatggtc tcagcta 371737DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(33)..(37)Methoxy base 17gactcgatat cgagtcaaat
gcagatggtt tcagcta 371839DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(35)..(39)Methoxy base 18gactcgatat cgagtcctcc
ttttcccatt ccattcatt 391939DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(35)..(39)Methoxy base 19gactcgatat cgagtcctcc
ctttcccatt ccattcatt 392039DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(35)..(39)Methoxy base 20gactcgatat cgagtcctcc
tttccccatt ccattcatt 392128DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 21gccaagctat gaacacagca
aacttggc 282239DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(33)..(39)Methoxy base 22gactcgatat cgagtcggcc
cactgtattg ctactgaaa 392339DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(33)..(39)Methoxy base 23gactcgatat cgagtcggcc
cactgcactg ctactaaaa 392436DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(30)..(36)Methoxy base 24gactcgatat cgagtctgtg
atcaactcca tgtgcc 362528DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 25cgctacatct ctgctgtaca
tggtagcg 282618958DNAZaire ebolavirus 26cggacacaca aaaagaaaga
agaattttta ggatcttttg tgtgcgaata actatgagga 60agattaataa ttttcctctc
attgaaattt atatcggaat ttaaattgaa attgttactg 120taatcacacc
tggtttgttt cagagccaca tcacaaagat agagaacagc ctaggtctcc
180gaagggaaca agggcaccag tgtgctcagt tgaaaatccc ttgtcaacat
ctaggtctta 240tcacatcaca agttccacct cagactctgc agggtgatcc
aacaacccta atagaaaaat 300tattgttaac ggacagcatt agttcacagt
caaacaagca agattgagaa ttaaccttga 360ttttgaactt caacacctag
aggattggag attcaacaac cctaaaactt ggggtaaaac 420attggaaata
gttgaaagac aaattgctcg gaatcacaaa attccgagta tggattctcg
480tcctcagaaa gtctggatga cgccgagtct tactgaatct gacatggatt
accacaagat 540cttgacagca ggtctgtccg ttcaacaggg gattgttcgg
caaagagtca tcccagtgta 600tcaagtaaac aatcttgagg aaatttgcca
acttatcata caggcctttg aagcaggtgt 660tgattttcaa gagagtgcgg
acagtttcct tctcatgctt tgtcttcatc atgcgtacca 720aggagatcac
aaacttttct tggaaagtgg tgcagtcaag tatttggaag ggcacgggtt
780ccgttttgaa gtcaagaaac gtgatggggt gaagcgcctt gaggaattgc
tgccagcagt 840atctagtgga aaaaacatta agagaacact tgctgccatg
ccggaagagg agacgactga 900agctaatgcc ggtcagtttc tctcttttgc
aagtctattc cttccgaaat tggtagtagg 960agaaaaggct tgccttgaga
aagttcaaag gcaaattcaa gtacatgcag agcaaggact 1020gatacaatat
ccaacagctt ggcaatcagt aggacacatg atggtgattt tccgtttgat
1080gcgaacaaat tttttgatca aatttctcct aatacaccaa gggatgcaca
tggttgccgg 1140gcatgatgcc aacgatgctg tgatttcaaa ttcagtggct
caagctcgtt tttcaggttt 1200attgattgtc aaaacagtcc ttgatcatat
cctacaaaag acagaacgag gagttcgtct 1260ccatcctctt gcaaggactg
ccaaggtaaa aaatgaggtg aactccttta aggctgcact 1320cagctccctg
gccaagcatg gagagtatgc tcctttcgcc cgacttttga acctttctgg
1380agtaaataat cttgagcatg gtcttttccc tcaactatcg gcaattgcac
tcggagtcgc 1440cacagcacac gggagcaccc tcgcaggagt aaatgttgga
gaacagtatc aacagctcag 1500agaggctgcc actgaagctg agaagcaact
ccaacaatat gcagaatctc gcgaacttga 1560ccatcttgga cttgatgatc
aggaaaagaa aattcttatg aacttccatc agaaaaagaa 1620cgaaatcagc
ttccagcaaa caaacgctat ggtaactcta agaaaagagc gcctggccaa
1680gctgacagaa gctatcactg ctgcatcact gcccaaaaca agtggacctt
acgatgatga 1740tgacgacatt ccctttccag gacccatcaa tgatgacgac
aatcctggcc atcaagatga 1800tgatccgact gactcacagg atacgaccat
tcccgatgtg gtggttgatc ccgatgatgg 1860aagctacggc gaataccaga
gttactcgga aaacggcatg aatgcaccag atgacttggt 1920cctattcgat
ctagacgagg acgacgagga cactaagcca gtgcctaaca gattgaccaa
1980gggtggacaa cagaaaaaca gtcaaaaggg ccagcataca gagggcagac
agacacaatc 2040caggccaact caaaatgtcc caggccctcg cagaacaatc
caccacgcca gtgctccact 2100cacggacaac gacagaggaa atgaaccctc
cggctcaacc agccctcgca tgctgacacc 2160aattaacgaa gaggcagacc
cactggacga tgccgacgac gagacgtcta gtcttccgcc 2220cttggagtca
gacgatgaag aacaggacag ggacgaaact tccaaccgca cacccactgt
2280cgccccaccg gctcccgtat acagagatca ctctgaaaag aaagaactcc
cgcaagatga 2340gcagcaagat caggaccaca ctcaagaggc caggaaccag
gacagtgaca acacccagcc 2400agaacactct tttgaggaga tgtatcgcca
cattctaaga tcacagggac catttgatgc 2460tgttttgtat tatcatatga
tgaaggatga gcctgtagtt ttcagtacta gtgatggcaa 2520agagtacacg
tatccggact cccttgaaga ggaatatcca ccatggctca ctgaaaaaga
2580ggccatgaat gaagagaata gatttgttac attggatggt caacaatttt
attggccggt 2640aatgaatcac aagaataaat tcatggcaat cctgcaacat
catcagtgaa tgagaatgga 2700ataatgggat gatttaaccg acaaatagct
aacattaaat agtcaagaaa cgcaaacagg 2760aagaattttt gatgtctaag
gtgtgaatta ttatcacaat aaaagtgatt cttatttttg 2820aatttaaagc
tagcttatta ttactagccg tttttcaaag ttcaatttga gtcttaatgc
2880aaataggcgt taagccacag ttatagccat aattgtaact caatatctta
gctagcgatt 2940tatctaaatt aaattacatt atgcttttat aacttaccta
ctagcctgcc caacatttac 3000acgatcgttt tataattaag aaaaaactaa
tgatgaagat taaaaccttc atcatcctta 3060cgtcaattga attctctagc
actcgaagct tattgtcttc aatgtaaaag aaaagctggt 3120ccaacaagat
gacaactaga acaaagggca ggggccatac tgtggccacg actcaaaacg
3180acagaatgcc aggccctgag ctttcgggct ggatctccga gcagctaatg
accggaagaa 3240ttcctgtaag cgacatcttc tgtgatattg agaacaatcc
aggattatgt tacgcatccc 3300aaatgcaaca aacaaagcca aacccgaaga
tgcgcaacag tcaaacccaa acggacccaa 3360tttgcaatca tagttttgag
gaggtagtac aaacattggc ttcattggct actgttgtgc 3420aacaacaaac
tatcgcatca gaatcattag aacaacgtat tacgagtctt gagaatggtc
3480taaagccagt ttatgatatg gcaaaaacaa tctcctcatt gaacagggtt
tgtgctgaga 3540tggttgcaaa atatgatctt ctggtgatga caaccggtcg
ggcaacagca accactgcgg 3600caactgaggc ttattgggct gaacatggtc
aaccaccacc tggaccatca ctttatgaag 3660aaagtgcaat tcggggtaag
attgaatcta gagatgagac cgtccctcaa agtgttaggg 3720aggcattcaa
caatctagac agtaccactt cactaactga ggaaaatttt gggaaacctg
3780acatttcagc aaaggatttg agaaacatta tgtatgatca cttgcctggt
tttggaactg 3840ctttccacca attagtacaa gtgatttgta aattgggaaa
agatagcaac tcattggata 3900tcattcatgc tgagttccag gccagcctgg
ctgaaggaga ctctcctcaa tgtgccctaa 3960ttcaaattac aaaaagagtt
ccaatcttcc aagatgctgc tccacctgtc atccacatcc 4020gctctcgagg
tgacattccc cgagcttgcc agaaaagctt gcgtccagtc ccgccatcac
4080ccaagattga tcgaggttgg gtatgtgttt tccagcttca agatggtaaa
acacttggac 4140tcaaaatttg agccaatctc ccttccctcc gaaagaggcg
accaatagca gaggcttcaa 4200ctgctgaact acagggtacg ttacattaat
gatacacttg tgagtatcag ccctagataa 4260tataagtcaa ttaaacgacc
aagccaaaat tgttcatatc ccgctagcag cttaaaatat 4320aaatgaaata
ggagctatat ctctgacagt attataatca attgttatta agtaacccaa
4380accaaaaatg atgaagatta agaaaaacct acctcgactg agagagtgtt
tttccattaa 4440ccttcatctt gtaaacgttg agcaaaattg ttacgaatat
gaggcgggtt atattgccta 4500ctgctcctcc tgaatatatg gaggccatat
accctgtcag gtcaaattca acaattgcta 4560ggggtggcaa caacaataca
ggcttcctga caccggagtc agtcaatgga gacactccat 4620cgaatccact
caggccaatt gctgatgaca ccatcgacca tgctagccac acaccaggca
4680gtgtgtcatc agcattcatc cttgaagcta tggtgaatgt catatcgggc
cccaaagtgc 4740taatgaagca aattccaatt tggcttcctc taggtgtcgc
tgatcaaaag acctacagct 4800ttgactcaac tacggccgcc atcatgcttg
cttcatatac tatcacccat ttcggcaagg 4860caaccaatcc acttgtcaga
gtcaatcggc tgggtcctgg aatcccggat caccccctca 4920ggctcctgcg
aattggaaac caggccttcc tccaggagtt cgttcttccg ccagtccaac
4980taccccagta tttcaccttt gatttgacag cactcaaact gatcacccaa
ccactgcctg 5040ctgcaacatg gaccgatgac actccaacag gatcaaatgg
agcgctgcgt ccaggaattt 5100cgtttcatcc aaaacttcgc cccattcttt
tacctaacaa aagtgggaag aaggggaaca 5160gtgccgatct aacatctcca
gagaaaatcc aagcaataat gacttcactc caggacttta 5220agatcgttcc
aattgatcca accaaaaata tcatgggtat cgaagtgcca gaaactctgg
5280tccacaagct gaccggtaag aaggtgactt ctaaaaatgg acaaccaatc
atccctgttc 5340ttttgccaaa gtacattggg ttggacccgg tggctccagg
agacctcacc atggtaatca 5400cacaggattg tgacacgtgt cattctcctg
caagtcttcc agctgtgatt gagaagtaat 5460tgcaataatt gactcagatc
cagttttaca gaatcttctc agggatagtg ataacatcta 5520tttagtaatc
cgtctattag aggagatact tttaattgat caatatacta aaggtgcttt
5580acaccattgt cttttttctc tcctaaatgt agaacttaac aaaagactca
caatatactt 5640gtcttaaaga gattgattga tgaaagatca tgactaataa
cattacaaat aatcctacta 5700taatcaatac ggtgattcaa atattaatct
ttctaattgc acatactctc tgcccctatc 5760ctcaaattgc ctacatgcct
acatctgagg atagccagtg tgacttggat tggagatgta 5820gggaagaaat
cggaacccat ctccaggttg ttcacaatcc aagcacagac atcgcccttc
5880taattaagaa aaaatcggcg atgaagatta agccgacagt gagcgcaatc
ttcatctctc 5940ttagattatt tgttttccag agtaggggtc atcaggtcct
ttccaatcat ataaccaaaa 6000taaacttcac tagaaggata ttgtgaggca
acaacacaat gggtattaca ggaatattgc 6060agttacctcg tgatcgattc
aagaggacat cattctttct ttgggtaatt atccttttcc 6120aaagaacatt
ttccatccca cttggagtca tccacaatag cacattacaa gttagtgatg
6180tcgacaaact agtttgtcgt gacaaactgt catccacaaa tcaattgaga
tcagttggac 6240tgaatctcga agggaatgga gtggcaactg acgtgccatc
tgcaactaaa agatggggct 6300tcaggtccgg tgtccctcca aaggtggtca
attatgaagc tggtgaatgg gctgaaaact 6360gctacaatct tgaaatcaaa
aaacctgacg ggagtgagtg tctaccagca gcgccagacg 6420ggattcgggg
cttcccccgg tgccggtatg tgcacaaagt atcaggaacg ggaccgtgtg
6480ccggagactt tgccttccac aaagagggtg ctttcttcct gtatgatcga
cttgcttcca 6540cagttatcta ccgaggaacg actttcgctg aaggtgtcgt
tgcatttctg atactgcccc 6600aagctaagaa ggacttcttc agctcacacc
ccttgagaga gccggtcaat gcaacggagg 6660acccgtccag tggctactat
tctaccacaa ttagatatca ggctaccggt tttggaacca 6720atgagacgga
gtacttgttc gaggttgaca atttgaccta cgtccaactt gaatcaagat
6780tcacgccaca gtttttgctc cagctgaatg agacaatata tgcaagtggg
aaaaggagca 6840acaccacggg aaaactaatt tggaaggtca accccgaaat
tgatacaaca atcggggagt 6900gggccttctg ggaaactaaa aaaacctcac
tagaaaaatt cgcagtgaag agttgtcttt 6960cacagctgta tcaaacggag
ccaaagacat cagtggtcag agtccggcgc gaacttcttc 7020cgacccagag
acctacacaa caactgaaga ccacaaaatc atggcttcag aaaattcctc
7080tgcaatggtt caagtgcaca atcaaggaag ggaagctgca gtgtcgcatc
tgataaccct 7140tgccacaatc tccacgagtc ctcaatcccc tacaaccaaa
ccaggtcagg acaacagcac 7200ccataataca cccgtgtata aacttgacat
ctctgaggca actcaagttg aacaacatca 7260tcgcagaaca gacaacgaca
gcacagcctc cgacactccc cccgccacga ccgcagccgg 7320acccccaaaa
gcagagaaca tcaacacgag caagagcgct gactccctgg accccgccac
7380cacgacaagt ccccaaaact acagcgagac cgctggcaac aacaacactc
atcaccaaga 7440taccggagaa gagagtgccg gcagcgggaa gctgggcttg
attgccaata ctattgctgg 7500agtcgcaggg ctgatcacag gcgggagaag
aactcgaaga gaagcaattg tcaatgctca 7560acccaaatgc aaccccaatc
tacattactg gactactcag gatgaaggtg ctgcaatcgg 7620attggcctgg
ataccatatt tcgggccagc agccgaggga atttacacag aggggctaat
7680gcacaatcaa gatggtttaa tctgtggatt gaggcagctg gccaatgaga
cgactcaagc 7740tcttcaactg ttcctgagag ccacaactga gctacgcacc
ttttcaatcc tcaaccgtaa 7800ggcaattgat ttcttgctgc agcgatgggg
cggcacatgc cacattttgg gaccggactg 7860ctgtatcgaa ccacatgatt
ggaccaagaa cataacagac aaaattgatc agattattca 7920tgattttgtt
gataaaaccc ttccggacca gggggacaat gacaattggt ggactggatg
7980gagacaatgg ataccggcag gtattggagt tacaggcgtt ataattgcag
ttattgcttt 8040attctgtata tgcaaatttg tcttttagtt tttcttcaga
ttgcttcatg gcaaagctca 8100gcctcaaatc aatgagatta ggatttaatt
atatggatca cttgaatcta agattacttg 8160acaaatgata atataataca
ctggagcttt aaatatagcc aatgtgattc taactccttt 8220aaactcacaa
ttaatcataa acaaggtttg acatcaatct agttatatct ttgagaatga
8280taaacttgat gaagattaag aaaaaggtaa tctttcgatt atctttagtc
ttcatccttg 8340attctacaat catgacagtt gtctttagtg acaagggaaa
gaagcctttt tagtaagttg 8400taataatcag atctgcgaac cggtagagtt
taattgcaac ctaacacaca taaagcattg 8460gtcaaaaagt caatagaaat
ttaaacagtg agtggagaca actttcaaat ggaagctcca 8520tacgagagag
gacgcccccg agctgccaga cagcattcaa gggatggaca cgaccatcat
8580gttcgagcac gatcatcatc cagagagaat tatcgaggtg agtaccgtca
atcaaggagc 8640gcctcacaag tgcgcgttcc tactgtattt cataagagga
gagttgaacc attaacagtt 8700cctccagcac ctaaagacat atgtccgacc
ttgaaaaaag gatttttgtg tgacagtagt 8760ttttgcaaaa aagatcacca
gttggaaagt ttaactgata gggaattact cctactaatc 8820gcccgtaaga
cttgtggatc agtagaacaa caattaaata taactgcacc caaggactcg
8880cgcttagcaa atccaacggc tgatgatttc cagcaagagg aaggtccaaa
aattaccttg 8940ttgacactga tcaagacggc agaacactgg gcgagacaag
acatcaggac cacagaggat 9000tcaaaattaa gagcattgtt gactctatgt
gctgtgatga cgaggaaatt ctcaaaatcc 9060cagctgagtc ttttatgtga
gacacacctg aggcgcgagg ggcttgggca agatcaggca 9120gaacccgttc
tcgaagtata tcaacgatta cacagtgata aaggaggcag tttcgaagct
9180gcactatggc aacaatggga tcgacaatcc ctaattatgt ttatcactgc
attcttgaat 9240atcgctctcc agttaccgtg tgaaagttct gctgtcgttg
tttcagggtt aagaacattg 9300gttcctcaat cagataatga ggaagcttca
accaacccgg ggacatgctc atggtctgat 9360gatggtaccc cttaataagg
ctgactaaaa cactatataa ccttctactt gatcacaata 9420ctccgtatac
ctatcatcat atattcaatc aagacggtat cctttaaaac ttattcagta
9480ctataatcac tctcgtttca aattaataag atatgcataa ttgctttaat
atatgaagag 9540gtatgataca accctaacag tgatcaaaga aaatcataat
ctcttatcgc tcgtaatata 9600acctgccaag catacctctt gcacaaagtg
attcttgtac acaaataatg ttttactcta 9660caggaggtag caacgatcca
tcccatcaaa aaataagtat tttatgactt actaatgatc 9720tcttaaaata
ttaagaaaaa ctgacggaac acaaattctt tctgcttcaa gttgtggagg
9780aggtctttgg tattggctat tgttatatta caatcaataa caagcttgta
aaaatattgt 9840tcttgtttca agaggtagat tgtgaccgga aacgctaaac
taatgatgaa gattaatgcg 9900gaggtctgat aagaataaac cttattattc
agattaggcc ccaagaggca ttcttcatct 9960ccttttagca aagtactatt
tcagggtagt ccaattagtg acacgtcttt tagctgtata 10020tcagtcgccc
ctgagatacg ccacaaaagt gtctctaagc taaattggtc tgtacacatc
10080tcatacattg tattaggggc aataatatct aattgaactt agccgtttaa
aatttagtgc 10140ataaacctgg gctaactcca ccaggtcaac
tccattggct gaaaagaagc ccacctacaa 10200cgaacatcac tttgagcgcc
cttacaatta aaaaatagga acgtcgttcc aacaattgag 10260cgcaaggttt
caaggttgaa ctgagagtgc ctaaacacca aaatatcgat aattcagaca
10320ccaagcaaga cctgagaagg aaccatggct aaagctacgg gacgatacaa
tctaatatcg 10380cccaaaaagg acctggagaa aggggttgtc ttaagcgacc
tctgtaactt cctagttagt 10440caaactattc aagggtggaa ggtctattgg
gctggtattg agtttgatgt gactcacaaa 10500ggaatggccc tattgcatag
actgaaaact aatgactttg cccctgcatg gtcaatgaca 10560aggaatctat
ttcctcattt atttcaaaat ccgaattcca caattgagtc accactgtgg
10620gcattgagag tcatccttgc agcaggggta caggaccagc tgattgacca
gtctttgatt 10680gaacccttag caggagccct tggtctgatc tctgattggc
tgctaacaac caacactaac 10740catttcaaca tgcgaacaca acgtgttaag
gaacaattga gcctaaaaat gctgtcgttg 10800attcgatcca atattctcaa
gtttattaac caattggatg ctctacatgt cgtgaactac 10860aacgggttgt
tgagcagtat tgaaattgga actcaaaatc atacaatcat tataactcga
10920actaacatgg gttttctggt ggagctccaa gaacccgaca aatcggcaat
gaaccgcaag 10980aagcctgggc cggcgaaatt ttccctcctt catgagtcca
cactgaaagc atttacacaa 11040gggtcctcga cacgaatgca aagtttgatt
cttgaattta atagctctct tgctatctaa 11100ttaagatgga atacttcata
ttgagctaac tcatatatgc tgactcaata gttatcttga 11160catctctgct
ttcataatca gatatataag cataataaat aaatactcat atttcttgat
11220aatttgttta accacagata aatcctaact gtaagccagc ttccaagttg
acacccttac 11280aaaaaccagg actcagaatc cctcaaataa gagattccaa
gacaacatca tagaattgct 11340ttattatatg aataagcatg ttatcaccag
aaatccaata tactaaatag ttaattgtaa 11400ctgaacccgc aggtcacgtg
tgttaggttt cacagattat atatattact aactccatac 11460ccgtaattaa
cattagataa gtagattaag aaaaacgctt gaggaagatt aagaaaaact
11520gcttattggg tctttccgtg ttttagatga agcagttgac attcttcctc
ttgatattaa 11580atggctacac aacataccca atacccagac gccaggttat
catcaccaat tgtattggac 11640caatgtgacc tagtcactag agcttgcggg
ttatattcat catactccct taatccgcaa 11700ctacgcaact gtaaactccc
gaaacatatc taccgtttaa aatatgatgt aactgttacc 11760aagttcttaa
gtgatgtacc agtggcgaca ttgccaatag atttcatagt cccaattctt
11820ctcaaggcac tgtcaggcaa tgggttctgt cctgttgagc cgcggtgtca
acagttctta 11880gatgaaatca ttaagtacac aatgcaagat gctctcttcc
tgaaatatta tctcaaaaat 11940gtgggtgctc aagaggactg tgttgatgac
cactttcaag agaaaatctt atcttcaatt 12000cagggcaatg aatttttaca
tcaaatgttc ttctggtatg acctggctat tttgactcga 12060aggggtagat
taaatcgagg aaactctaga tcaacatggt ttgttcatga tgatttaata
12120gacatcttag gctatgggga ctatgttttt tggaagatcc caatttcaat
gttacccctg 12180aacacacaag gaatccccca tgctgctatg gattggtatc
aggcatcagt attcaaagaa 12240gcggttcaag ggcatacaca cattgtttct
gtttctactg ccgacgtctt gataatgtgc 12300aaagatttaa ttacatgtcg
attcaacaca actctaatct caaagatagc agaggttgag 12360gatccagttt
gttctgatta tcccgatttt aagattgtgt ctatgcttta ccagagcgga
12420gattacttac tctccatatt agggtctgat gggtataaaa ttattaagtt
cctcgaacca 12480ttgtgcttgg ccaaaattca attatgctca aagtacaccg
agaggaaggg ccgattctta 12540acacaaatgc atttagctgt aaatcacacc
ctggaagaaa ttacagaaat gcgtgcacta 12600aagccttcac aggatcaaaa
gatccgtgaa ttccatagaa cattgataag gctggagatg 12660acgccacaac
aactttgtga gctattttcc attcaaaaac actgggggca tcctgtgcta
12720catagtgaaa cagcaatcca aaaagttaaa aaacatgcca cggtgctaaa
agcattacgc 12780cctatagtga ttttcgagac atattgtgtt tttaaatata
gtattgcaaa acattatttt 12840gatagtcaag gatcttggta cagtgttact
tcagatagga atttaacgcc aggtcttaat 12900tcttatatca aaagaaatca
attccccccg ttgccaatga ttaaagaact actatgggaa 12960ttttaccacc
ttgaccatcc tccacttttc tcaaccaaaa ttattagtga cttaagtatt
13020tttataaaag acagagctac cgcagtggaa aggacatgct gggatgcagt
attcgagcct 13080aatgttctag gatataatcc acctcacaaa ttcagtacta
aacgtgtacc agaacaattt 13140ttagagcaag aaaacttttc tattgagaat
gttctttcct acgcgcaaaa actcgagtat 13200ctactaccac aataccggaa
tttttctttc tcattgaaag agaaagagtt gaatgtaggt 13260agaactttcg
gaaaattgcc ttatccgact cgcaatgttc aaacactttg tgaagctctg
13320ttagctgatg gtcttgctaa agcatttcct agcaatatga tggtagtcac
agagcgtgag 13380caaaaagaaa gcttattgca tcaagcatca tggcaccaca
caagtgatga ttttggtgag 13440catgccacag ttagagggag tagctttgta
actgatttag agaaatacaa tcttgcattt 13500agatatgagt ttacagcacc
ttttatagaa tattgtaacc gttgctatgg tgttaagaat 13560gtttttaatt
ggatgcatta tacaatcccc cagtgttata tgcatgtcag tgattattat
13620aatccaccgc ataacctcac tctggaaaat cgagacaacc cccccgaagg
gcccagttca 13680tacagaggtc atatgggagg gattgaagga ctgcaacaaa
aactctggac aagtatttca 13740tgtgctcaaa tttctttagt tgaaataaag
actggtttta agttacgctc agctgtgatg 13800ggtgacaatc agtgcattac
cgttttatca gtcttcccct tagagactga cgcagacgag 13860caggaacaga
gcgccgaaga caatgcagcg agggtggccg ccagcctagc aaaagttaca
13920agtgcctgtg gaatcttttt aaaacctgat gaaacatttg tacattcagg
ttttatctat 13980tttggaaaaa aacaatattt gaatggggtc caattgcctc
agtcccttaa aacggctaca 14040agaatggcac cattgtctga tgcaattttt
gatgatcttc aagggaccct ggctagtata 14100ggcactgctt ttgaacgatc
catctctgag acacgacata tctttccttg caggataacc 14160gcagctttcc
atacgttttt ttcggtgaga atcttgcaac atcatcacct cgggttcaat
14220aagggttttg accttggaca gttgacactt ggcaaacctc tggatttcgg
aacaatatca 14280ttggcactag cggtaccgca ggtgcttgga gggttatcct
tcttgaatcc tgagaaatgt 14340ttctaccgga atttaggaga tccagttacc
tcaggcttat tccagttaaa aacttatctc 14400cgaatgattg agatggatga
tttattctta cctttaattg cgaagaaccc tgggaactgc 14460actgccattg
actttgtgct aaatcctagc ggattaaatg tccccgggtc gcaagactta
14520acttcatttc tgcgccagat tgtgcgtagg actatcaccc taagtgcgaa
aaacaaactt 14580attaatactt tatttcatgc gtcagctgac ttcgaagacg
aaatggtttg taaatggcta 14640ttatcatcaa ctcctgttat gagtcgtttt
gcggccgata tcttttcacg cacgcccagt 14700gggaagcgat tgcaaattct
aggatacctg gaaggaacac gcacattatt agcctctaag 14760atcatcaaca
ataatacaga aacaccggtt ttggacagac tgaggaaaat aacattgcaa
14820aggtggagtc tatggtttag ttatcttgat cattgtgata atatcctggc
agaggcttta 14880acccaaataa cttgcacagt tgatttagca cagatcctga
gggaatattc atgggcacat 14940attttagagg ggagacctct tattggagcc
acacttccat gtatgattga gcaattcaaa 15000gtggtttggc tgaaacccta
cgaacaatgt ccgcagtgtt caaatgcaaa gcaacctggt 15060gggaaaccat
tcgtgtcagt ggcagtcaag aaacatattg ttagtgcatg gccgaacgca
15120tcccgaataa gctggactat cggggatgga atcccataca ttggatcaag
gacagaagat 15180aagataggac aacctgctat taaaccaaaa tgtccttccg
cagccttaag agaggccatt 15240gaactggcgt cccgtttaac atgggtaact
caaggcagtt cgaacagtga tttgctaata 15300aaaccatttt tggaagcacg
agtaaattta agtgttcaag aaatacttca aatgacccct 15360tcacattact
caggaaatat tgttcacagg tacaacgatc aatatagtcc tcattctttc
15420atggccaatc gtatgagtaa ttcagcgacg cgattgattg tttctactaa
cactttaggt 15480gagttttcag gaggtggcca gtctgcacgc gacagcaata
ttattttcca gaatgttata 15540aattatgcag ttgcactgtt cgatattaaa
tttagaaaca ctgaggctac agatatccaa 15600tataatcgtg ctcaccttca
tctaactaag tgttgcaccc gggaagtacc agctcagtat 15660ttaacataca
catctacatt ggatttagat ttaacaagat accgagaaaa cgaattgatt
15720tatgacaata atcctctaaa aggaggactc aattgcaata tctcattcga
taacccattt 15780ttccaaggta aacggctaaa cattatagaa gatgatctta
ttcgactgcc tcacttatct 15840ggatgggagc tagccaagac catcatgcaa
tcaattattt cagatagcaa caattcgtct 15900acagacccaa ttagcagtgg
agaaacaaga tcattcacta cccatttctt aacttatccc 15960aagataggac
ttctgtacag ttttggggcc tttataagtt attatcttgg caatacaatt
16020cttcggacta agaaattaac acttgacaat tttttatatt acttaactac
ccaaattcat 16080aatctaccac atcgctcatt gcgaatactt aagccaacat
tcaaacatgc aagcgttatg 16140tcacggttaa tgagtattga tcctcatttt
tctatttaca taggcggtgc ggcaggtgac 16200agaggactct cagatgcggc
caggttattt ttgagaacgt ccatttcatc ttttcttgca 16260tttataaaag
agtggataat taatcgcgga acaattgtcc ctttatggat agtatatccg
16320ctagagggtc aaaacccaac acctgttaat aatttcctcc atcagatcgt
agaactgctg 16380gtgcatgatt catcaagaca acaggctttt aaaactacca
taagtgatca tgtacatcct 16440cacgacaatc ttgtttacac atgtaagagt
acagccagca atttcttcca tgcgtcattg 16500gcgtactgga gaagcaggca
cagaaacagc aatcgaaaat acttggcaag agactcttca 16560actggatcaa
gcacaaacaa cagtgatggt catattgaga gaagtcaaga acaaaccacc
16620agagatccac atgatggcac tgaacggaat ctagtcctac aaatgagcca
tgaaataaaa 16680agaacgacaa ttccacaaga aagcacgcac cagggtccgt
cgttccagtc atttctaagt 16740gactctgctt gtggtacagc aaatccaaaa
ctaaatttcg atagatcgag acataatgtg 16800aaatctcagg atcataactc
ggcatccaag agggaaggtc atcaaataat ctcacaccgt 16860ctagtcctac
ctttctttac attgtctcaa gggacgcgcc aattaacgtc atccaatgag
16920tcacaaaccc aagacgagat atcaaagtac ttacggcaat tgagatccgt
cattgatacc 16980acagtttatt gtaggtttac cggtatagtc tcgtccatgc
attacaaact tgatgaggtc 17040ctttgggaaa tagagagttt taagtcggct
gtgacgctag cagagggaga aggtgctggt 17100gccttactat tgattcagaa
ataccaagtt aagaccttat ttttcaacac gctagctact 17160gagtccagta
tagagtcaga aatagtatca ggaacgacta ctcctaggat gcttctacct
17220gttatgtcaa aattccataa tgaccaaatt gagattattc ttaacaattc
ggcaagccaa 17280ataacagaca taacaaatcc tacttggttc aaagaccaaa
gagcaaggct acctaggcaa 17340gtcgaggtta taaccatgga tgcagagacg
acagaaaata taaacagatc gaaattgtac 17400gaagctgtat ataaattgat
cttacaccat attgatccca gcgtattgaa agcagtggtc 17460cttaaagtct
ttctaagtga tactgagggt atgttatggc taaatgataa tttagccccg
17520ttttttgcca ctggttattt aattaagcca ataacgtcaa gtgctagatc
tagtgagtgg 17580tatctttgtc tgacgaactt cttatcaact acacgtaaga
tgccacacca aaaccatctc 17640agttgtaaac aggtaatact tacggcattg
caactgcaaa ttcaacggag cccatactgg 17700ctaagtcatt taactcagta
tgctgactgc gatttacatt taagttatat ccgccttggt 17760tttccatcat
tagagaaagt actataccac aggtataacc tcgtcgattc aaaaagaggt
17820ccactagtct ctatcactca gcacttggca catcttagag cagagattcg
agaattgact 17880aatgattata atcaacagcg acaaagtcgg actcaaacat
atcactttat tcgtactgca 17940aaaggacgaa tcacaaaact agtcaatgat
tatttaaaat tctttcttat tgtgcaagca 18000ttaaaacata atgggacatg
gcaagctgag tttaagaaat taccagagtt gattagtgtg 18060tgcaataggt
tctatcatat tagagattgc aattgtgaag aacgtttctt agttcaaacc
18120ttatatctac atagaatgca ggattctgaa gttaagctta tcgaaaggct
gacagggctt 18180ctgagtttat tcccggatgg tctctacagg tttgattgaa
ttaccgtgca tagtatcctg 18240atacttgtga aggttgatta tcaacgtaca
gattataaaa aactcacaaa ttgctctcat 18300acatcatatt gatcgaattt
caataaataa ctatttaaat aacgaaagaa gtccttatat 18360tatacactat
atttagcctc tctccctgcg tgataatcaa aaaattcaca atgcagcatg
18420tgtgacatat tacttccgcg atgaatctaa cgcaacataa taaactctgc
actctttata 18480attaagcttt aacaaaaggt ctgggctcat attgttattg
atataataat gttgtatcaa 18540tatcctgtca gatggaatag tgttttggtt
gataacacga cttcttaaaa caaaattgat 18600cttcaagatt aagtttttta
taattatcat tactttaatt tgtcgattta aaaatggtga 18660tagccttaat
ctttgtgtaa aataagagat taggtgtaat aactttaaca ttttgtctag
18720taagctacta tttcatacag aatgataaaa ttaaaagaaa aggcatgact
gtaaaatcag 18780aaataccttc tttacaatat agcagactag ataataatct
tcgtgttaat gataattaag 18840acattgacca cgctcatcag gaggctcgcc
aggataaacg ttgcaaaaag gattcctgga 18900aaaatggtcg cacacaaaaa
tttaaaaata aatctatttc ttcttttttg tgtgtcca 1895827341DNAHomo sapiens
27atagggcgga gggaagctca tcagtggggc cacgagctga gtgcgtcctg tcactccact
60cccatgtccc ttgggaaggt ctgagactag ggccagaggc ggccctaaca gggctctccc
120tgagcttcgg ggaggtgagt tcccagagaa cggggctccg cgcgaggtca
gactgggcag 180gagatgccgt ggaccccgcc cttcggggag gggcccggcg
gatgcctcct ttgccggagc 240ttggaacaga ctcacggcca gcgaagtgag
ttcaatggct gaggtgaggt accccgcagg 300ggacctcata acccaattca
gactactctc ctccgcccat t 3412812DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotidemodified_base(6)..(12)a, c, t, g, unknown or other
28gagtcnnnnn nn 122910DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotidemodified_base(6)..(10)a, c, t, g, unknown or other
29ggatcnnnnn 103010DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotidemodified_base(6)..(10)a, c, t, g,
unknown or other 30gagtcnnnnn 103112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotidemodified_base(6)..(7)a, c, t, g, unknown or other
31gactcnngag tc 123214DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotidemodified_base(6)..(9)a, c, t, g, unknown or other
32gactcnnnng agtc 143316DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotidemodified_base(6)..(11)a, c, t, g, unknown or other
33gactcnnnnn ngagtc 163424DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotidemodified_base(1)..(4)a, c, t, g, unknown or
othermodified_base(10)..(15)a, c, t, g, unknown or
othermodified_base(21)..(24)a, c, t, g, unknown or other
34nnnngactcn nnnnngagtc nnnn 243522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotidemodified_base(1)..(4)a, c, t, g, unknown or
othermodified_base(10)..(13)a, c, t, g, unknown or
othermodified_base(19)..(22)a, c, t, g, unknown or other
35nnnngactcn nnngagtcnn nn 223623DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 36cttcttagct tggggcagta tca
2337500DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 37aagatgactg caggagtcaa tgcgcagttg
gtcccggcag accaggcgaa cattaccgaa 60ttttacaaca agtccctttc atcctacaag
gagaatgagg agaacatcca gtgtggggag 120aacttcatgg acatggagtg
cttcatgatt ctgaacccca gtcagcagct ggcaattgcc 180gtcttgtctc
tcacactggg caccttcaca gttctggaga acttgctggt gctgtgtgtc
240accacagtta tctaccgagg aacgactttc gctgaaggtg tcgttgcatt
tctgattcct 300tcactcccgc agcctccgct gccggccctc ttaccacttc
atcattagcc tggccgtggc 360cgaccttctg gggagtgtca tttttgtcta
cagctttgtt gactttcatg tgttccaccg 420caaggacagc cccaacgtct
ttctcttcaa attgggtggg gtcaccgcct ccttcacggc 480ctctgtaggc
agcctcttcc 5003889RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 38gacugcagga gucugcugcu
uccacaguua ucuaccgagg aacgacuuuc gcugaaggug 60ucguugcauu ucugauuccu
ucacucccg 893936DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primerDescription of Combined DNA/RNA Molecule
Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(31)..(36)Methoxy base 39gactcgatat cgagtccacg
agcugagtgc guccug 364035DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primerDescription of Combined DNA/RNA
Molecule Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(31)..(35)Methoxy base 40gactcgatat cgagtcagac
cttcccaagg gacau 354127DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 41ccacgcctgt cactccactc cgcgtgg
274219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42cctctggccc tagtctcag 194317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43gcatctaatt tttcgcc 174417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 44tctgtgcctg gattgat
174517DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 45ttttggacgt cttctcc 174617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46ttttgaacgt cttctcc 174725DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 47tatgttttgt ataaaagttc atttg
254816DNAZaire ebolavirus 48acgactttyg ctgaag 164916DNAZaire
ebolavirus 49acgactttcg ctgaag 165056DNAZaire ebolavirus
50tccacagtta tctaccgagg aacgactttc gctgaaggtg tcgttgcatt tctgat
565159DNAZaire ebolavirus 51ttccacagtt atctaccgag gaacgacttt
cgctgaaggt gtcgttgcat ttctgatac 595226DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
probemodified_base(14)..(14)Methoxy base 52gctacacgac tttggctgaa
ggtagc 265325DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 53gctaccttca gcraaagtcg gtagc
255436DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 54gactcgatat cgagtccttc
cacagttatc taccga 365536DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 55gactcgatat cgagtcgctt
ccacagttat ctaccg 365636DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 56gactcgatat cgagtcacag
ttatctaccg aggaac 365733DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 57gactcgatat cgagtcaaat
gcaacgacac ctt 335833DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 58gactcgatat cgagtcgaaa
tgcaacgaca cct 335933DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 59gactcgatat cgagtcagaa
atgcaacgac acc 336036DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 60gactcgcgcg cgagtcacag
ttatctaccg aggaac 366136DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 61gactcgcgcg cgagtccaca
gttatctacc gaggaa 366236DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(32)..(36)Methoxy base 62gactcgcgcg cgagtcccac
agttatctac cgagga 366333DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 63gactcgcgcg cgagtcaaat
gcaacgacac ctt 336433DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 64gactcgcgcg cgagtcgaaa
tgcaacgaca cct 336533DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(24)..(24)Methoxy
basemodified_base(29)..(33)Methoxy base 65gactcgcgcg cgagtcagaa
atgcaacgac acc 336655DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 66ccacagttat ctaccgagga
acgactttcg ctgaaggtgt cgttgcattt ctgat 556771DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 67tgactagcgg aggctagaag gagagagatg ggtgcgagag
cgtcaatatt aagaggcgaa 60aaattagatg c 716848DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 68tgactagcag aggctagaag gagagagatg ggtgcgagag
cgtcagta 486971DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 69caaaaacagc atattgacgc
tgggaaagac cagagatcct gctgtctctr caacatcaat 60ccaggcacag a
717047DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 70caaaaacagc atattgacgc tgggaaagac
cacagatcct gctgtct 477173DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 71aaatgcagat
ggtctcagct atgaacacag caaaaacaat gaatggaatg ggaaaaggag 60aagacgtcca
aaa 737273DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 72aaatgcaaat ggtctcagct atgaacacag
caaagacaat gaatggaatg ggaaagggag 60aagacgttca aaa
737360DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 73aaatgcagat ggtttcagct atgaacacag
caaaagcaat gaatggaatg gggaaaggag 607481DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74ggcccactgt attgctactg aaaatctctg ctgtacatgg
cacatggagt tgatcacaaa 60tgaactttta tacaaaacat a 817558DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75ggcccactgc actgctacta aaaatctctg ctgtacatgg
cacatggagt tgatcaca 58
* * * * *
References