U.S. patent application number 15/643354 was filed with the patent office on 2017-10-26 for brassica napus seed specific promoters identified by microarray analysis.
The applicant listed for this patent is Dow AgroSciences LLC. Invention is credited to Scott Alan BEVAN, Holly Jean BUTLER, Delkin Orlando GONZALEZ, Cory M. Larsen, William MOSKAL.
Application Number | 20170306340 15/643354 |
Document ID | / |
Family ID | 56356316 |
Filed Date | 2017-10-26 |
United States Patent
Application |
20170306340 |
Kind Code |
A1 |
BUTLER; Holly Jean ; et
al. |
October 26, 2017 |
BRASSICA NAPUS SEED SPECIFIC PROMOTERS IDENTIFIED BY MICROARRAY
ANALYSIS
Abstract
Provided are constructs and methods for expressing a transgene
in plant cells and/or plant tissues using gene regulatory elements
obtained from Brassica napus.
Inventors: |
BUTLER; Holly Jean;
(Indianapolis, IN) ; BEVAN; Scott Alan;
(Indianapolis, IN) ; Larsen; Cory M.; (Zionsville,
IN) ; MOSKAL; William; (Indianapolis, IN) ;
GONZALEZ; Delkin Orlando; (Indianapolis, IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dow AgroSciences LLC |
Indianapolis |
IN |
US |
|
|
Family ID: |
56356316 |
Appl. No.: |
15/643354 |
Filed: |
July 6, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15542037 |
|
|
|
|
PCT/US2015/067584 |
Dec 28, 2015 |
|
|
|
15643354 |
|
|
|
|
62100389 |
Jan 6, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/415 20130101;
C12N 15/8234 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 15/82 20060101 C12N015/82; C12N 15/82 20060101
C12N015/82 |
Claims
1. A method for expressing a heterologous coding sequence in a
transgenic plant, the method comprising: transforming a plant cell
with a gene expression cassette comprising a polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1 operably linked to the heterologous coding sequence, which is
operably linked to a 3'-untranslated region; isolating the
transformed plant cell comprising the gene expression cassette;
regenerating the transformed plant cell into a transgenic plant;
and, obtaining the transgenic plant, wherein the transgenic plant
comprises the gene expression cassette comprising the
polynucleotide sequence comprising SEQ ID NO:1.
2. The method of claim 1, wherein the polynucleotide sequence
comprises an intron having at least 90% sequence identity to an
intron selected from the group consisting of a rice actin intron, a
maize ubiquitin intron, and an Arabadiopsis thaliana ubiquitin 10
intron.
3. The method of claim 1, wherein the polynucleotide sequence
comprises a 5'-untranslated region.
4. The method of claim 1, wherein transferring the plant cell is
selected from the group consisting of an Agrobacterium-mediated
transformation method, a biolistics transformation method, a
silicon carbide transformation method, a protoplast transformation
method, and a liposome transformation method.
5. The method of claim 1, wherein the transgenic plant is selected
from the group consisting of an Arabidopsis plant, a tobacco plant,
a soybean plant, a canola plant and a cotton plant.
6. A transgenic seed from the transgenic plant of claim 1.
7. The method of claim 1, wherein the polynucleotide sequence
comprises a sequence of nucleotides 1-1429 of SEQ ID NO:1.
8. A method for isolating a polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1, the method
comprising: identifying the polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1; producing a
plurality of oligonucleotide primer sequences, wherein the
oligonucleotide primer sequences bind to the polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1; amplifying the polynucleotide sequence comprising a sequence
identity of at least 90% to SEQ ID NO:1 from a DNA sample with
oligonucleotide primer sequences selected from the plurality of
oligonucleotide primer sequences; and, isolating the polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1.
9. The method of claim 8, wherein the isolated polynucleotide
sequence comprises an intron having at least 90% sequence identity
to an intron selected from the group consisting of a rice actin
intron, a maize ubiquitin intron, and an Arabadiopsis thaliana
ubiquitin 10 intron.
10. The method of claim 8, wherein the isolated polynucleotide
sequence comprises a 5'-untranslated region.
11. The method of claim 8, wherein the isolated polynucleotide
sequence is operably linked to a transgene.
12. A gene expression cassette comprising a polynucleotide sequence
with at least 90% sequence identity to SEQ ID NO:1 operably linked
to a transgene, wherein the transgene is operably linked to a
3'-untranslated region.
13. The gene expression cassette of claim 12, wherein the transgene
is selected from the group consisting of insecticidal resistance
coding sequences, herbicide tolerance coding sequences, nitrogen
use efficiency coding sequences, water use efficiency coding
sequences, nutritional quality coding sequences, DNA binding coding
sequences, and selectable marker coding sequences.
14. The gene expression cassette of claim 12, wherein the
3'-untranslated region has at least 90% sequence identity to SEQ ID
NO:2.
15. A recombinant vector comprising the gene expression cassette of
claim 12.
16. A transgenic cell comprising the gene expression cassette of
claim 12.
17. A transgenic plant comprising the transgenic cell of claim
16.
18. The transgenic plant of claim 17, wherein the dicotyledonous
plant is selected from the group consisting of an Arabidopsis
plant, a tobacco plant, a soybean plant, a canola plant and a
cotton plant.
19. A transgenic seed from the transgenic plant of claim 17.
20. The method of claim 1, wherein the isolated polynucleotide
sequence comprises a sequence of nucleotides 1-1429 of SEQ ID
NO:1.
21. A method for manufacturing a synthetic polynucleotide sequence
comprising a sequence identity of at least 90% to SEQ ID NO:1, the
method comprising: identifying the polynucleotide sequence
comprising SEQ ID NO:1; isolating the polynucleotide sequence
comprising SEQ ID NO:1; defining a plurality of polynucleotide
sequences that comprise a sequence identity of at least 90% to SEQ
ID NO:1; synthesizing a polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1; and,
manufacturing a synthetic polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1.
22. The method of claim 21, wherein the synthesizing comprises:
identifying the polynucleotide sequence comprising a sequence
identity of at least 90% to SEQ ID NO:1; producing a plurality of
oligonucleotide primer sequences, wherein the oligonucleotide
primer sequences bind to the polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1; ligating the
plurality of oligonucleotide primer sequences to synthesize the
polynucleotide sequence comprising a sequence identity of at least
90% to SEQ ID NO:1.
23. The method of claim 22, wherein the synthetic polynucleotide
sequence comprises an intron having at least 90% sequence identity
to an intron selected from the group consisting of a rice actin
intron, a maize ubiquitin intron, and an Arabadiopsis thaliana
ubiquitin 10 intron.
24. The method of claim 21, wherein the synthetic polynucleotide
sequence comprises a 5'-untranslated region.
25. The method of claim 21, wherein the synthesized polynucleotide
sequence is operably linked to a transgene.
26. The method of claim 25, wherein the operably linked transgene
encodes a polypeptide.
27. A gene expression cassette comprising the synthesized
polynucleotide sequence comprising a sequence identity of at least
90% to SEQ ID NO:1 operably linked to a transgene that is operably
linked to a 3'-untranslated region.
28. The gene expression cassette of claim 27, wherein the
3'-untranslated region has at least 90% sequence identity to SEQ ID
NO:2.
29. A recombinant vector comprising the gene expression cassette of
claim 26.
30. A transgenic cell comprising the gene expression cassette of
claim 26.
31. A transgenic plant comprising the transgenic cell of claim
30.
32. The transgenic plant of claim 31, wherein the plant is selected
from the group consisting of an Arabidopsis plant, a tobacco plant,
a soybean plant, a canola plant and a cotton plant.
33. A transgenic seed from the transgenic plant of claim 31.
34. The method of claim 21, wherein the synthetic polynucleotide
sequence comprises a sequence of nucleotides 1-1429 of SEQ ID NO:1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation of U.S. patent application Ser. No.
15/542,037 filed Jul. 6, 2017, which is a national phase entry
under 35 U.S.C. .sctn.371 of international Patent Application
PCT/US2015/067584, filed Dec. 28, 2015, published in English as
International Patent Publication No. WO2016111859 on Jul. 14, 2016,
which claims priority to U.S. Patent Application No. 62/100,389
filed on Jan. 6, 2015, all of which are incorporated in their
entirety by reference herein.
TECHNICAL FIELD
[0002] This invention is generally related to the field of plant
molecular biology, and more specifically, to the field of
expression of transgenes in plants.
BACKGROUND
[0003] Many plant species are capable of being transformed with
transgenes to introduce agronomically desirable traits or
characteristics. The resulting transgenic plant species are
developed and/or modified to have particular desirable traits.
Generally, desirable traits include, for example, improving
nutritional value quality, increasing yield, conferring pest or
disease resistance, increasing drought and stress tolerance,
improving horticultural qualities (e.g., pigmentation and growth),
imparting herbicide tolerance, enabling the production of
industrially useful compounds and/or materials from the plant,
and/or enabling the production of pharmaceuticals.
[0004] Transgenic plant species comprising multiple transgenes
stacked at a single genomic locus are produced via plant
transformation technologies. Plant transformation technologies
result in the introduction of a transgene into a plant cell,
recovery of a fertile transgenic plant that contains the stably
integrated copy of the transgene in the plant genome, and
subsequent transgene expression via transcription and translation
of the plant genome results in transgenic plants that possess
desirable traits and phenotypes. However, mechanisms that allow the
production of transgenic plant species to highly express multiple
transgenes engineered as a trait stack are desirable.
[0005] Likewise, mechanisms that allow the expression of a
transgene within particular tissues or organs of a plant are
desirable. For example, increased resistance of a plant to
infection by soil-borne pathogens might be accomplished by
transforming the plant genome with a pathogen-resistance gene such
that pathogen-resistance protein is robustly expressed within the
roots of the plant. Alternatively, it may be desirable to express a
transgene in plant tissues that are in a particular growth or
developmental phase such as, for example, cell division or
elongation. Furthermore, it may be desirable to express a transgene
in leaf and stem tissues of a plant.
[0006] Described herein are Brassica napus GALE1 gene promoter
regulatory elements, constructs/vectors containing the Brassica
napus GALE1 gene promoter regulatory, and methods utilizing
Brassica napus GALE1 gene promoter regulatory elements.
DISCLOSURE
[0007] Disclosed herein are sequences, constructs, and methods for
expressing a transgene in plant cells and/or plant tissues. In an
embodiment the disclosure relates to a gene expression cassette
comprising a promoter operably linked to a transgene, wherein the
promoter comprises a polynucleotide that hybridizes under stringent
conditions to a polynucleotide probe comprising a sequence identity
of at least 90% to a complement of SEQ ID NO:1. In further
embodiments, the promoter comprises a polynucleotide that has at
least 90% sequence identity to SEQ ID NO:1. In additional
embodiments, the promoter comprises a polynucleotide comprising an
intron. In other embodiments, the intron has at least 90% sequence
identity to a rice actin intron, a maize ubiquitin intron, or an
Arabadiopsis thaliana ubiquitin 10 intron. In an embodiment the
promoter comprises a polynucleotide comprising a 5'-untranslated
region. In other embodiments, the operably linked transgene encodes
a polypeptide or a small RNA. In a subsequent embodiment, the
transgene is selected from the group consisting of insecticidal
resistance transgene, herbicide tolerance transgene, nitrogen use
efficiency transgene, water use efficiency transgene, nutritional
quality transgene, DNA binding transgene, and selectable marker
transgene. In yet another embodiment, the gene expression cassette
further comprises a 3'-untranslated region. In an embodiment the
3'-untranslated region comprises a polynucleotide that has a
sequence identity of at least 90% to SEQ ID NO:2. In an embodiment,
a recombinant vector comprises the gene expression cassette. In a
further aspect of the embodiment, the recombinant vector is
selected from the group consisting of a plasmid, a cosmid, a
bacterial artificial chromosome, a virus, and a bacteriophage. In
an embodiment, a transgenic cell comprises the gene expression
cassette. In a subsequent aspect of the embodiment, the cell is a
transgenic plant cell. In an embodiment, a transgenic plant
comprises the transgenic plant cell. In a further aspect of the
embodiment, the transgenic plant is a monocotyledonous plant or
dicotyledonous plant. In other aspects of the embodiment, the
dicotyledonous plant is selected from the group consisting of an
Arabidopsis plant, a tobacco plant, a soybean plant, a canola plant
and a cotton plant. In an embodiment, a transgenic seed is obtained
from the transgenic plant. In a subsequent embodiment, the promoter
is a tissue-preferred promoter. In an additional embodiment, the
tissue-preferred promoter is an ovule or seed tissue-preferred
promoter. In an embodiment, the seed tissue-preferred promoter is
an endosperm tissue-preferred promoter. In yet another embodiment,
the promoter comprises a polynucleotide sequence of nucleotides
1-1429 of SEQ ID NO:1.
[0008] In an embodiment the disclosure relates to a transgenic cell
comprising a synthetic polynucleotide that hybridizes under
stringent conditions to a polynucleotide probe comprising a
sequence identity of at least 90% to a complement of SEQ ID NO:1.
In an additional embodiment, the synthetic polynucleotide has at
least 90% sequence identity to SEQ ID NO:1. In additional
embodiments, the synthetic polynucleotide comprises a
polynucleotide comprising an intron. In other embodiments, the
intron has a sequence identity of at least 90% to a rice actin
intron, a maize ubiquitin intron, or an Arabadiopsis thaliana
ubiquitin 10 intron. In an embodiment, the synthetic polynucleotide
comprises a 5'-untranslated region. In a further embodiment, the
transgenic cell is a transgenic plant cell. In a subsequent
embodiment, the transgenic plant cell is produced by a plant
transformation method. In an additional embodiment, the plant
transformation method is selected from the group consisting of an
Agrobacterium-mediated transformation method, a biolistics
transformation method, a silicon carbide transformation method, a
protoplast transformation method, and a liposome transformation
method. In an embodiment, a transgenic plant comprises the
transgenic plant cell. In a further embodiment, the transgenic
plant is a monocotyledonous plant or dicotyledonous plant. In other
embodiments, the monocotyledonous plant is selected from the group
consisting of a maize plant, a rice plant, and a wheat plant. In
other aspects of the embodiment, the dicotyledonous plant is
selected from the group consisting of an Arabidopsis plant, a
tobacco plant, a soybean plant, a canola plant and a cotton plant.
In an embodiment, a transgenic seed is obtained from the transgenic
plant. In an additional embodiment, the promoter is a
tissue-preferred promoter. In an additional embodiment, the
tissue-preferred promoter is an ovule or seed tissue-preferred
promoter. In an embodiment, the seed tissue-preferred promoter is
an endosperm tissue-preferred promoter. In another embodiment, the
synthetic polynucleotide comprises a polynucleotide sequence of
nucleotides 1-1429 of SEQ ID NO:1.
[0009] In an embodiment the disclosure relates to a purified
polynucleotide promoter, wherein the promoter comprises a
polynucleotide that hybridizes under stringent conditions to a
polynucleotide probe comprising a sequence identity of at least 90%
to a complement of SEQ ID NO:1. In further embodiments, the
purified polynucleotide promoter has at least 90% sequence identity
to SEQ ID NO:1. In additional embodiments, the purified
polynucleotide promoter comprises a polynucleotide comprising an
intron. In other embodiments, the intron has at least 90% identity
to a rice actin intron, a maize ubiquitin intron, or an
Arabadiopsis thaliana ubiquitin 10 intron. In an embodiment, the
purified polynucleotide promoter comprises a 5'-untranslated
region. In another embodiment, the purified polynucleotide is
operably linked to a transgene. In a subsequent embodiment, the
operably linked transgene encodes a polypeptide or is a small RNA.
In an embodiment, a gene expression cassette comprises the purified
polynucleotide sequence operably linked to the transgene, which is
operably linked to a 3'-untranslated region. In an embodiment the
3'-untranslated region comprises a polynucleotide that has a
sequence identity of at least 90% to SEQ ID NO:2. In another
embodiment, the transgene is selected from the group consisting of
insecticidal resistance transgene, herbicide tolerance transgene,
nitrogen use efficiency transgene, water use efficiency transgene,
nutritional quality transgene, DNA binding transgene, and
selectable marker transgene. In an embodiment, a recombinant vector
comprises the gene expression cassette. In an additional
embodiment, the recombinant vector is selected from the group
consisting of a plasmid vector, a cosmid vector, and a BAC vector.
In an embodiment, a transgenic cell comprises the gene expression
cassette. In a subsequent embodiment the transgenic cell is a
transgenic plant cell. In an embodiment, a transgenic plant
comprises the transgenic plant cell. In an additional embodiment,
the transgenic plant is a monocotyledonous or dicotyledonous plant.
In yet a further embodiment, the monocotyledonous plant is selected
from the group consisting of a maize plant, a wheat plant, and a
rice plant. In other aspects of the embodiment, the dicotyledonous
plant is selected from the group consisting of an Arabidopsis
plant, a tobacco plant, a soybean plant, a canola plant and a
cotton plant. In an embodiment, a transgenic seed is obtained from
the transgenic plant. In a subsequent embodiment, the purified
polynucleotide sequence promotes tissue-preferred expression of a
transgene. In an additional embodiment, the tissue-preferred
promoter is an ovule or seed tissue-preferred promoter. In an
embodiment, the seed tissue-preferred promoter is an endosperm
tissue-preferred promoter. In other embodiments, the purified
polynucleotide comprises a polynucleotide sequence of nucleotides
1-1429 of SEQ ID NO:1.
[0010] In an embodiment the disclosure relates to a method for
expressing a heterologous coding sequence in a transgenic plant,
the method comprising: [0011] a) transforming a plant cell with a
gene expression cassette comprising a polynucleotide sequence
comprising a sequence identity of at least 90% to SEQ ID NO:1
operably linked to the heterologous coding sequence, which is
operably linked to a 3'-untranslated region; [0012] b) isolating
the transformed plant cell comprising the gene expression cassette;
[0013] c) regenerating the transformed plant cell into a transgenic
plant; and, [0014] d) obtaining the transgenic plant, wherein the
transgenic plant comprises the gene expression cassette comprising
the polynucleotide sequence comprising SEQ ID NO:1.
[0015] In additional embodiments, the polynucleotide sequence
comprises an intron. In other embodiments, the intron has a
sequence identity of at least 90% to a rice actin intron, a maize
ubiquitin intron, or an Arabadiopsis thaliana ubiquitin 10 intron.
In an embodiment, the polynucleotide sequence has at least 90%
sequence identity to SEQ ID NO:1. In a further embodiment, the
heterologous coding sequence is selected from the group consisting
of insecticidal resistance coding sequences, herbicide tolerance
coding sequences, nitrogen use efficiency coding sequences, water
use efficiency coding sequences, nutritional quality coding
sequences, DNA binding coding sequences, and selectable marker
coding sequences. In an additional embodiment, transforming of a
plant cell utilizes a plant transformation method. In yet another
embodiment, the plant transformation method is selected from the
group consisting of an Agrobacterium-mediated transformation
method, a biolistics transformation method, a silicon carbide
transformation method, a protoplast transformation method, and a
liposome transformation method. In other embodiments, the
transgenic plant is a monocotyledonous transgenic plant or a
dicotyledonous transgenic plant. In further embodiments, the
monocotyledonous transgenic plant is selected from the group
consisting of a maize plant, a wheat plant, and a rice plant. In an
embodiment, a transgenic seed is obtained from the transgenic
plant. In other aspects of the embodiment, the dicotyledonous plant
is selected from the group consisting of an Arabidopsis plant, a
tobacco plant, a soybean plant, a canola plant and a cotton plant.
In a further embodiment, the heterologous coding sequence is
preferentially expressed in a tissue. In an additional embodiment,
the tissue-preferred promoter is an ovule or seed tissue-preferred
promoter. In an embodiment, the seed tissue-preferred promoter is
an endosperm tissue-preferred promoter. In other embodiments, the
polynucleotide comprises a sequence of nucleotides 1-1429 of SEQ ID
NO:1.
[0016] In an embodiment the disclosure relates to a method for
isolating a polynucleotide sequence comprising a sequence identity
of at least 90% to SEQ ID NO:1, the method comprising: [0017] a)
identifying the polynucleotide sequence comprising a sequence
identity of at least 90% to SEQ ID NO:1; [0018] b) producing a
plurality of oligonucleotide primer sequences, wherein the
oligonucleotide primer sequences bind to the polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1; [0019] c) amplifying the polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1 from a DNA sample
with oligonucleotide primer sequences selected from the plurality
of oligonucleotide primer sequences; and, [0020] d) isolating the
polynucleotide sequence comprising a sequence identity of at least
90% to SEQ ID NO:1.
[0021] In additional embodiments, the polynucleotide sequence
comprises an intron. In other embodiments, the intron has a
sequence identity of at least 90% to a rice actin intron, a maize
ubiquitin intron, or an Arabadiopsis thaliana ubiquitin 10 intron.
In an embodiment, the polynucleotide sequence comprise a
5'-untranslated region. In an additional embodiment, the isolated
polynucleotide sequence comprising a sequence identity of at least
90% to SEQ ID NO:1 is operably linked to a transgene. In a further
embodiment, the operably linked transgene encodes a polypeptide. In
an embodiment, a gene expression cassette comprises a
polynucleotide sequence with at least 90% sequence identity to SEQ
ID NO:1 operably linked to a transgene, wherein the transgene is
operably linked to a 3'-untranslated region. In an embodiment the
3'-untranslated region comprises a polynucleotide that has a
sequence identity of at least 90% to SEQ ID NO:2. In a further
embodiment, the transgene is selected from the group consisting of
insecticidal resistance coding sequences, herbicide tolerance
coding sequences, nitrogen use efficiency coding sequences, water
use efficiency coding sequences, nutritional quality coding
sequences, DNA binding coding sequences, and selectable marker
coding sequences. In an embodiment, a recombinant vector comprises
the gene expression cassette. In a further embodiment, the vector
is selected from the group consisting of a plasmid vector, a cosmid
vector, and a BAC vector. In an embodiment, a transgenic cell
comprises the gene expression cassette. In an additional
embodiment, the transgenic cell is a transgenic plant cell. In an
embodiment, a transgenic plant comprises the transgenic plant cell.
In an additional embodiment, the transgenic plant is a
monocotyledonous plant or a dicotyledonous plant. In a further
embodiment, the monocotyledonous plant is selected from the group
consisting of a maize plant, a wheat plant, and a rice plant. In an
embodiment, a transgenic seed is obtained from the transgenic
plant. In other aspects of the embodiment, the dicotyledonous plant
is selected from the group consisting of an Arabidopsis plant, a
tobacco plant, a soybean plant, a canola plant and a cotton plant.
In other embodiments, the isolated polynucleotide comprises a
polynucleotide sequence of nucleotides 1-1429 of SEQ ID NO:1.
[0022] In an embodiment the disclosure relates to a method for
manufacturing a synthetic polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1, the method
comprising: [0023] a) identifying the polynucleotide sequence
comprising SEQ ID NO:1; [0024] b) isolating the polynucleotide
sequence comprising SEQ ID NO:1; [0025] c) defining a plurality of
polynucleotide sequences that comprise a sequence identity of at
least 90% to SEQ ID NO:1; [0026] d) synthesizing a polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1; and, [0027] e) manufacturing a synthetic polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1.
[0028] In a further embodiment, the synthesizing comprises: [0029]
a) identifying the polynucleotide sequence comprising a sequence
identity of at least 90% to SEQ ID NO:1; [0030] b) producing a
plurality of oligonucleotide primer sequences, wherein the
oligonucleotide primer sequences bind to the polynucleotide
sequence comprising a sequence identity of at least 90% to SEQ ID
NO:1; [0031] c) ligating the plurality of oligonucleotide primer
sequences to synthesize the polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1.
[0032] In additional embodiments, the synthesized polynucleotide
sequence comprises an intron. In other embodiments, the intron has
a sequence identity of at least 90% to a rice actin intron, a maize
ubiquitin intron, or an Arabadiopsis thaliana ubiquitin 10 intron.
In an embodiment, the synthesized polynucleotide sequence comprises
a 5'-untranslated region. In an additional embodiment, the
synthesized polynucleotide sequence comprises a sequence identity
of at least 90% to SEQ ID NO:1 that is operably linked to a
transgene. In yet another embodiment, the operably linked transgene
encodes a polypeptide. In an embodiment, a gene expression cassette
comprises the synthesized polynucleotide sequence comprising a
sequence identity of at least 90% to SEQ ID NO:1 operably linked to
the transgene, that is operably linked to a 3'-untranslated region.
In an embodiment the 3'-untranslated region comprises a
polynucleotide that has a sequence identity of at least 90% to SEQ
ID NO:2. In yet another embodiment, the transgene is selected from
the group consisting of insecticidal resistance transgene,
herbicide tolerance transgene, nitrogen use efficiency transgene,
water use efficiency transgene, nutritional quality transgene, DNA
binding transgene, and selectable marker transgene. In an
embodiment, a recombinant vector comprises the gene expression
cassette. In an additional embodiment, the recombinant vector is
selected from the group consisting of a plasmid vector, a cosmid
vector, and a BAC vector. In an embodiment, a transgenic cell
comprises the gene expression cassette. In a further embodiment,
the transgenic cell is a transgenic plant cell. In an embodiment, a
transgenic plant comprises the transgenic plant cell. In a further
embodiment, the transgenic plant is a monocotyledonous or
dicotyledonous plant. In other embodiments, the monocotyledonous
plant is selected from the group consisting of a maize plant, a
wheat plant and a rice plant. In other aspects of the embodiment,
the dicotyledonous plant is selected from the group consisting of
an Arabidopsis plant, a tobacco plant, a soybean plant, a canola
plant and a cotton plant. In an embodiment, a transgenic seed is
obtained from the transgenic plant. In other embodiments, the
synthetic polynucleotide comprises a polynucleotide sequence of
nucleotides 1-1429 of SEQ ID NO:1.
[0033] In an embodiment, a construct includes a gene expression
cassette comprising a Brassica napus GALE1 gene promoter of SEQ ID
NO:1. In an embodiment, a gene expression cassette includes a
Brassica napus GALE1 gene promoter of SEQ ID NO:1 operably linked
to a transgene or a heterologous coding sequence. In an embodiment,
a gene expression cassette includes a Brassica napus GALE1 gene
3'-UTR of SEQ ID NO:2 operably linked to a transgene. In an
embodiment, a gene expression cassette includes a Brassica napus
GALE1 gene 3'-UTR of SEQ ID NO:2 operably linked to a promoter. In
a further embodiment, a gene expression cassette includes a
Brassica napus GALE1 gene 3'-UTR of SEQ ID NO:2 operably linked to
a Brassica napus GALE1 gene promoter of SEQ ID NO:1. In an
embodiment, a gene expression cassette includes a Brassica napus
GALE1 gene promoter of SEQ ID NO:1 operably linked to a transgene
or a heterologous coding sequence. In an embodiment, a gene
expression cassette includes at least one, two, three, four, five,
six, seven, eight, nine, ten, or more transgenes.
[0034] In an embodiment, a gene expression cassette includes
independently a) a Brassica napus GALE1 gene promoter of SEQ ID
NO:1, and b) a Brassica napus GALE1 gene 3'-UTR of SEQ ID NO:2.
[0035] Methods of growing plants expressing a transgene using
Brassica napus GALE1 gene promoters of SEQ ID NO:1, and 3'-UTRs of
SEQ ID NO:2 are disclosed herein. Methods of culturing plant
tissues and cells expressing a transgene using the Brassica napus
GALE1 gene promoters of SEQ ID NO:1, and 3'-UTRs of SEQ ID NO:2 are
also disclosed herein. In an embodiment, methods, as disclosed
herein, include tissue-specific gene expression in plant leaves and
stems.
[0036] In an embodiment, a gene expression cassette includes a
promoter polynucleotide sequence of SEQ ID NO:1 that was obtained
from the Brassica napus GALE1 gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1 shows a plasmid map of pDAB113903.
[0038] FIG. 2 shows a plasmid map of pDAB9381.
[0039] FIG. 3 is a microscopy image of Yellow Fluorescent Protein
expression patterns in transgenic Arabidopsis plant tissues. The
image provided in Panel D shows early ovule expression that was
localized in the endosperm for the YFP protein, driven by the
Brassica napus GALE1 promoter and terminated by 3' UTR regulatory
elements as described in pDAB113903. The image provided in Panel E
shows expression of the YFP protein, driven by the Brassica napus
GALE1 promoter and terminated by 3' UTR regulatory elements as
described in pDAB113903, in other plant tissues such as roots,
petioles and flowers. The expression of the YFP protein in the
root, petiole and flower tissue was observed in multi-copy number
events.
MODE(S) FOR CARRYING OUT THE INVENTION
Definitions
[0040] As used herein, the articles, "a," "an," and "the" include
plural references unless the context clearly and unambiguously
dictates otherwise.
[0041] As used herein, the term "backcrossing" refers to a process
in which a breeder crosses hybrid progeny back to one of the
parents, for example, a first generation hybrid F1 with one of the
parental genotypes of the F1 hybrid.
[0042] As used herein, the term "intron" refers to any nucleic acid
sequence comprised in a gene (or expressed nucleotide sequence of
interest) that is transcribed but not translated. Introns include
untranslated nucleic acid sequence within an expressed sequence of
DNA, as well as corresponding sequence in RNA molecules transcribed
therefrom.
[0043] A construct described herein can also contain sequences that
enhance translation and/or mRNA stability such as introns. An
example of one such intron is the first intron of gene II of the
histone variant of Arabidopsis thaliana or any other commonly known
intron sequence. Introns can be used in combination with a promoter
sequence to enhance translation and/or mRNA stability.
[0044] As used herein, the terms "5' untranslated region" or
"5'-UTR" refer to an untranslated segment in the 5' terminus of
pre-mRNAs or mature mRNAs. For example, on mature mRNAs, a 5'-UTR
typically harbors on its 5' end a 7-methylguanosine cap and is
involved in many processes such as splicing, polyadenylation, mRNA
export towards the cytoplasm, identification of the 5' end of the
mRNA by the translational machinery, and protection of the mRNAs
against degradation.
[0045] As used herein, the term "3' untranslated region" or
"3'-UTR" refers to an untranslated segment in a 3' terminus of the
pre-mRNAs or mature mRNAs. For example, on mature mRNAs this region
harbors the poly-(A) tail and is known to have many roles in mRNA
stability, translation initiation, and mRNA export.
[0046] As used herein, the term "polyadenylation signal" refers to
a nucleic acid sequence present in mRNA transcripts that allows for
transcripts, when in the presence of a poly-(A) polymerase, to be
polyadenylated on the polyadenylation site, for example, located 10
to 30 bases downstream of the poly-(A) signal. Many polyadenylation
signals are known in the art and are useful for the present
invention. An exemplary sequence includes AAUAAA and variants
thereof, as described in Loke J., et al., (2005) Plant Physiology
138(3); 1457-1468.
[0047] As used herein, the term "isolated" refers to a biological
component (including a nucleic acid or protein) that has been
separated from other biological components in the cell of the
organism in which the component naturally occurs (i.e., other
chromosomal and extra-chromosomal DNA).
[0048] As used herein, the term "purified" in reference to nucleic
acid molecules does not require absolute purity (such as a
homogeneous preparation); instead, it represents an indication that
the sequence is relatively more pure than in its native cellular
environment (compared to the natural level this level should be at
least 2-5 fold greater, e.g., in terms of concentration or gene
expression levels). The DNA molecules may be obtained directly from
total genomic DNA or from total genomic RNA. In addition, cDNA
clones are not naturally occurring, but rather are preferably
obtained via manipulation of a partially purified, naturally
occurring substance (messenger RNA that is reverse transcribed by a
reverse transcriptase polymerase). The construction of a cDNA
library from mRNA involves the creation of a synthetic substance
(cDNA). Individual cDNA clones can be purified from the synthetic
library by clonal selection of the cells carrying the cDNA library.
Thus, the process which includes the construction of a cDNA library
from mRNA and purification of distinct cDNA clones yields an
approximately 10.sup.6-fold purification of the native message.
Likewise, a promoter DNA sequence could be cloned into a plasmid.
Such a clone is not naturally occurring, but rather is preferably
obtained via manipulation of a partially purified, naturally
occurring substance such as a genomic DNA library or directly from
genomic DNA. Thus, purification of at least one order of magnitude,
preferably two or three orders, and more preferably four or five
orders of magnitude is favored in these techniques.
[0049] Similarly, purification represents an indication that a
chemical or functional change in the component DNA sequence has
occurred. Nucleic acid molecules and proteins that have been
"purified" include nucleic acid molecules and proteins purified by
standard purification methods. The term "purified" also embraces
nucleic acids and proteins prepared by recombinant DNA methods in a
host cell (e.g., plant cells), as well as chemically-synthesized
nucleic acid molecules, proteins, and peptides.
[0050] The term "recombinant" refers to a cell or organism in which
genetic recombination has occurred. It also includes a molecule
(e.g., a vector, plasmid, nucleic acid, polypeptide, or a small
RNA) that has been artificially or synthetically (i.e.,
non-naturally) altered by human intervention. The alteration can be
performed on the molecule within, or removed from, its natural
environment or state.
[0051] As used herein, the term "expression" refers to the process
by which a polynucleotide is transcribed into mRNA (including small
RNA molecules) and/or the process by which the transcribed mRNA
(also referred to as "transcript") is subsequently translated into
peptides, polypeptides, or proteins. Gene expression can be
influenced by external signals, for example, exposure of a cell,
tissue, or organism to an agent that increases or decreases gene
expression. Expression of a gene can also be regulated anywhere in
the pathway from DNA to RNA to protein. Regulation of gene
expression occurs, for example, through controls acting on
transcription, translation, RNA transport and processing,
degradation of intermediary molecules such as mRNA, or through
activation, inactivation, compartmentalization, or degradation of
specific protein molecules after they have been made, or by
combinations thereof. Gene expression can be measured at the RNA
level or the protein level by any method known in the art,
including, without limitation, Northern blot, RT-PCR, Western blot,
or in vitro, in situ, or in vivo protein activity assay(s).
[0052] As used herein, the terms "homology-based gene silencing" or
"HBGS" are generic tams that include both transcriptional gene
silencing and post-transcriptional gene silencing. Silencing of a
target locus by an unlinked silencing locus can result from
transcription inhibition (transcriptional gene silencing; TGS) or
mRNA degradation (post-transcriptional gene silencing; PTGS), owing
to the production of double-stranded RNA (dsRNA) corresponding to
promoter or transcribed sequences, respectively. Involvement of
distinct cellular components in each process suggests that
dsRNA-induced TGS and PTGS likely result from the diversification
of an ancient common mechanism. However, a strict comparison of TGS
and PTGS has been difficult to achieve because it generally relies
on the analysis of distinct silencing loci. A single transgene
locus can be described to trigger both TGS and PTGS, owing to the
production of dsRNA corresponding to promoter and transcribed
sequences of different target genes.
[0053] As used herein, the terms "nucleic acid molecule," "nucleic
acid," or "polynucleotide" (all three terms are synonymous with one
another) refer to a polymeric form of nucleotides, which may
include both sense and anti-sense strands of RNA, cDNA, genomic
DNA, and synthetic forms, and mixed polymers thereof. "A
nucleotide" may refer to a ribonucleotide, deoxyribonucleotide, or
a modified form of either type of nucleotide. A nucleic acid
molecule is usually at least 10 bases in length, unless otherwise
specified. The terms may refer to a molecule of RNA or DNA of
indeterminate length. The terms include single- and double-stranded
forms of DNA. A nucleic acid molecule may include either or both
naturally-occurring and modified nucleotides linked together by
naturally occurring and/or non-naturally occurring nucleotide
linkages.
[0054] Nucleic acid molecules may be modified chemically or
biochemically, or may contain non-natural or derivatized nucleotide
bases, as will be readily appreciated by those of skill in the art.
Such modifications include, for example, labels, methylation,
substitution of one or more of the naturally occurring nucleotides
with an analog, internucleotide modifications (e.g., uncharged
linkages: for example, methyl phosphonates, phosphotriesters,
phosphoramidates, carbamates, etc.; charged linkages: for example,
phosphorothioates, phosphorodithioates, etc.; pendent moieties: for
example, peptides; intercalators: for example, acridine, psoralen,
etc.; chelators; alkylators; and modified linkages: for example,
alpha anomeric nucleic acids, etc.). The term "nucleic acid
molecule" also includes any topological conformation, including
single-stranded, double-stranded, partially duplexed, triplexed,
hairpinned, circular, and padlocked conformations.
[0055] Transcription proceeds in a 5' to 3' manner along a DNA
strand. This indicates that RNA is made by sequential addition of
ribonucleotide-5'-triphosphates to the 3' terminus of the growing
chain (with a requisite elimination of the pyrophosphate). In
either a linear or circular nucleic acid molecule, discrete
elements (e.g., particular nucleotide sequences) may be referred to
as being "upstream" relative to a further element if they are
bonded or would be bonded to the same nucleic acid in the 5'
direction from that element. Similarly, discrete elements may be
"downstream" relative to a further element if they are or would be
bonded to the same nucleic acid in the 3' direction from that
element.
[0056] As used herein, the term "base position" refers to the
location of a given base or nucleotide residue within a designated
nucleic acid. A designated nucleic acid may be defined by alignment
with a reference nucleic acid.
[0057] As used herein, the term "hybridization" refers to a process
where oligonucleotides and their analogs hybridize by hydrogen
bonding, which includes Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary bases. Generally,
nucleic acid molecules consist of nitrogenous bases that are either
pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines
(adenine (A) and guanine (G)). These nitrogenous bases form
hydrogen bonds between a pyrimidine and a purine, and bonding of a
pyrimidine to a purine is referred to as "base pairing." More
specifically, A will hydrogen bond to T or U, and G will bond to C.
"Complementary" refers to the base pairing that occurs between two
distinct nucleic acid sequences or two distinct regions of the same
nucleic acid sequence.
[0058] As used herein, the terms "specifically hybridizable" and
"specifically complementary" refers to a sufficient degree of
complementarity such that stable and specific binding occurs
between an oligonucleotide and the DNA or RNA target.
Oligonucleotides need not be 100% complementary to the target
sequence to specifically hybridize. An oligonucleotide is
specifically hybridizable when binding of the oligonucleotide to
the target DNA or RNA molecule interferes with the normal function
of the target DNA or RNA, and there is sufficient degree of
complementarity to avoid non-specific binding of an oligonucleotide
to non-target sequences under conditions where specific binding is
desired, for example, under physiological conditions in the case of
in vivo assays or systems. Such binding is referred to as specific
hybridization. Hybridization conditions resulting in particular
degrees of stringency will vary depending upon the nature of the
chosen hybridization method and the composition and length of the
hybridizing nucleic acid sequences. Generally, the temperature of
hybridization and the ionic strength (especially Na' and/or Mgt'
concentration) of a hybridization buffer will contribute to the
stringency of hybridization, though wash times also influence
stringency. Calculations regarding hybridization conditions
required for attaining particular degrees of stringency are
discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory
Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., 1989.
[0059] As used herein, the term "stringent conditions" encompasses
conditions under which hybridization will only occur if there is
less than 50% mismatch between the hybridization molecule and the
DNA target. "Stringent conditions" include further particular
levels of stringency. Thus, as used herein, "moderate stringency"
conditions are those under which molecules with more than 50%
sequence mismatch will not hybridize; conditions of "high
stringency" are those under which sequences with more than 20%
mismatch will not hybridize; and conditions of "very high
stringency" are those under which sequences with more than 10%
mismatch will not hybridize.
[0060] In particular embodiments, stringent conditions can include
hybridization at 65.degree. C., followed by washes at 65.degree. C.
with 0.1.times.SSC/0.1% SDS for 40 minutes. The following are
representative, non-limiting hybridization conditions:
[0061] Very High Stringency: hybridization in 5.times.SSC buffer at
65.degree. C. for 16 hours; wash twice in 2.times.SSC buffer at
room temperature for 15 minutes each; and wash twice in
0.5.times.SSC buffer at 65.degree. C. for 20 minutes each.
[0062] High Stringency: Hybridization in 5-6.times.SSC buffer at
65-70.degree. C. for 16-20 hours; wash twice in 2.times.SSC buffer
at room temperature for 5-20 minutes each; and wash twice in
1.times.SSC buffer at 55-70.degree. C. for 30 minutes each.
[0063] Moderate Stringency: Hybridization in 6.times.SSC buffer at
room temperature to 55.degree. C. for 16-20 hours; wash at least
twice in 2-3.times.SSC buffer at room temperature to 55.degree. C.
for 20-30 minutes each.
[0064] In an embodiment, specifically hybridizable nucleic acid
molecules can remain bound under very high stringency hybridization
conditions. In an embodiment, specifically hybridizable nucleic
acid molecules can remain bound under high stringency hybridization
conditions. In an embodiment, specifically hybridizable nucleic
acid molecules can remain bound under moderate stringency
hybridization conditions.
[0065] As used herein, the term "oligonucleotide" refers to a short
nucleic acid polymer. Oligonucleotides may be formed by cleavage of
longer nucleic acid segments, or by polymerizing individual
nucleotide precursors. Automated synthesizers allow the synthesis
of oligonucleotides up to several hundred base pairs in length.
Because oligonucleotides may bind to a complementary nucleotide
sequence, they may be used as probes for detecting DNA or RNA.
Oligonucleotides composed of DNA (oligodeoxyribonucleotides) may be
used in polymerase chain reaction, a technique for the
amplification of small DNA sequences. In polymerase chain reaction,
an oligonucleotide is typically referred to as a "primer" which
allows a DNA polymerase to extend the oligonucleotide and replicate
the complementary strand.
[0066] As used herein, the terms "Polymerase Chain Reaction" or
"PCR" refer to a procedure or technique in which minute amounts of
nucleic acid, RNA and/or DNA, are amplified as described in U.S.
Pat. No. 4,683,195. Generally, sequence information from the ends
of the region of interest or beyond needs to be available, such
that oligonucleotide primers can be designed; these primers will be
identical or similar in sequence to opposite strands of the
template to be amplified. The 5' terminal nucleotides of the two
primers may coincide with the ends of the amplified material. PCR
can be used to amplify specific RNA sequences, specific DNA
sequences from total genomic DNA, and cDNA transcribed from total
cellular RNA, bacteriophage or plasmid sequences, etc. See
generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol.,
51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, N Y,
1989).
[0067] As used herein, the term "primer" refers to an
oligonucleotide capable of acting as a point of initiation of
synthesis along a complementary strand when conditions are suitable
for synthesis of a primer extension product. The synthesizing
conditions include the presence of four different
deoxyribonucleotide triphosphates and at least one
polymerization-inducing agent such as reverse transcriptase or DNA
polymerase. These are present in a suitable buffer that may include
constituents which are co-factors or which affect conditions such
as pH and the like at various suitable temperatures. A primer is
preferably a single strand sequence, such that amplification
efficiency is optimized, but double stranded sequences can be
utilized.
[0068] As used herein, the term "probe" refers to an
oligonucleotide or polynucleotide sequence that hybridizes to a
target sequence. In the TAQMAN.RTM. or TAQMAN.RTM.-style assay
procedure, the probe hybridizes to a portion of the target situated
between the annealing site of the two primers. A probe includes
about eight nucleotides, about ten nucleotides, about fifteen
nucleotides, about twenty nucleotides, about thirty nucleotides,
about forty nucleotides, or about fifty nucleotides. In some
embodiments, a probe includes from about eight nucleotides to about
fifteen nucleotides.
[0069] In the Southern blot assay procedure, the probe hybridizes
to a DNA fragment that is attached to a membrane. A probe includes
about ten nucleotides, about 100 nucleotides, about 250
nucleotides, about 500 nucleotides, about 1,000 nucleotides, about
2,500 nucleotides, or about 5,000 nucleotides. In some embodiments,
a probe includes from about 500 nucleotides to about 2,500
nucleotides.
[0070] A probe can further include a detectable label, e.g., a
radioactive label, a biotinylated label, a fluorophore
(TEXAS-RED.RTM., fluorescein isothiocyanate, etc.). The detectable
label can be covalently attached directly to the probe
oligonucleotide, e.g., located at the probe's 5' end or at the
probe's 3' end. A probe including a fluorophore may also further
include a quencher, e.g., BLACK HOLE QUENCHER.RTM., IOWA BLACK.TM.,
etc.
[0071] As used herein, the terms "sequence identity" or "identity"
can be used interchangeably and refer to nucleic acid residues in
two sequences that share similar base compositions when aligned for
maximum correspondence over a specified comparison window for
either a polynucleotide or protein fragment.
[0072] As used herein, the tam "percentage of sequence identity"
refers to a value determined by comparing two optimally aligned
sequences (e.g., nucleic acid sequences or amino acid sequences)
over a comparison window, wherein the portion of a sequence in the
comparison window may comprise additions or deletions (i.e., gaps)
as compared to a reference sequence (that does not comprise
additions or deletions) for optimal alignment of the two sequences.
A percentage is calculated by determining the number of positions
at which an identical nucleic acid or amino acid residue occurs in
both sequences to yield the number of matched positions, dividing
the number of matched positions by the total number of positions in
the comparison window, and multiplying the result by 100 to yield
the percentage of sequence identity. Methods for aligning sequences
for comparison are well known. Various programs and alignment
algorithms are described in, for example: Smith and Waterman (1981)
Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol.
48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A.
85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp
(1989) CABIOS 5:151-3; Corpet et al., (1988) Nucleic Acids Res.
16:10881-90; Huang et al., (1992) Comp. Appl. Biosci. 8:155-65;
Pearson et al., (1994) Methods Mol. Biol. 24:307-31; Tatiana et
al., (1999) FEMS Microbiol. Lett. 174:247-50.
[0073] The National Center for Biotechnology Information (NCBI)
Basic Local Alignment Search Tool (BLAST; Altschul et al., (1990)
J. Mol. Biol. 215:403-10) is available from several sources,
including the National Center for Biotechnology Information
(Bethesda, Md.), and on the internet, for use in connection with
several sequence analysis programs. A description of how to
determine sequence identity using this program is available on the
internet under the "help" section for BLAST. For comparisons of
nucleic acid sequences, the "Blast 2 sequences" function of the
BLAST (Blastn) program may be employed using the default
parameters. Nucleic acid sequences with even greater similarity to
the reference sequences will show increasing percentage identity
when assessed by this method.
[0074] As used herein, the term "operably linked" refers to a
nucleic acid placed into a functional relationship with another
nucleic acid. Generally, "operably linked" can mean that linked
nucleic acids are contiguous. Linking can be accomplished by
ligation at convenient restriction sites. If such sites do not
exist, synthetic oligonucleotide adaptors or linkers are ligated or
annealed to the nucleic acid and used to link the contiguous
polynucleotide fragment. However, elements need not be contiguous
to be operably linked.
[0075] As used herein, the term "promoter" refers to a region of
DNA that generally is located upstream (towards the 5' region of a
gene) of a gene and is needed to initiate and drive transcription
of the gene. A promoter may permit proper activation or repression
of a gene that it controls. A promoter may contain specific
sequences that are recognized by transcription factors. These
factors may bind to a promoter DNA sequence, which results in the
recruitment of RNA polymerase, an enzyme that synthesizes RNA from
the coding region of the gene. The promoter generally refers to all
gene regulatory elements located upstream of the gene, including,
upstream promoters, 5'-UTR, introns, and leader sequences.
[0076] As used herein, the term "upstream-promoter" refers to a
contiguous polynucleotide sequence that is sufficient to direct
initiation of transcription. As used herein, an upstream-promoter
encompasses the site of initiation of transcription with several
sequence motifs, which include TATA Box, initiator sequence, TFIIB
recognition elements and other promoter motifs (Jennifer, E. F. et
al., (2002) Genes & Dev., 16: 2583-2592). The upstream promoter
provides the site of action to RNA polymerase II which is a
multi-subunit enzyme with the basal or general transcription
factors like, TFIIA, B, D, E, F and H. These factors assemble into
a transcription pre initiation complex that catalyzes the synthesis
of RNA from DNA template.
[0077] The activation of the upstream-promoter is done by the
additional sequence of regulatory DNA sequence elements to which
various proteins bind and subsequently interact with the
transcription initiation complex to activate gene expression. These
gene regulatory elements sequences interact with specific
DNA-binding factors. These sequence motifs may sometimes referred
to as cis-elements. Such cis-elements, to which tissue-specific or
development-specific transcription factors bind, individually or in
combination, may determine the spatiotemporal expression pattern of
a promoter at the transcriptional level. These cis-elements vary
widely in the type of control they exert on operably linked genes.
Some elements act to increase the transcription of operably-linked
genes in response to environmental responses (e.g., temperature,
moisture, and wounding). Other cis-elements may respond to
developmental cues (e.g., germination, seed maturation, and
flowering) or to spatial information (e.g., tissue specificity).
See, for example, Langridge et al., (1989) Proc. Natl. Acad. Sci.
USA 86:3219-23. These cis-elements are located at a varying
distance from transcription start point, some cis-elements (called
proximal elements) are adjacent to a minimal core promoter region
while other elements can be positioned several kilobases upstream
or downstream of the promoter (enhancers).
[0078] A "DNA binding transgene" is a polynucleotide coding
sequence that encodes a DNA binding protein. The DNA binding
protein is subsequently able to bind to another molecule. A binding
protein can bind to, for example, a DNA molecule (a DNA-binding
protein), an RNA molecule (an RNA-binding protein) and/or a protein
molecule (a protein-binding protein). In the case of a
protein-binding protein, it can bind to itself (to form homodimers,
homotrimers, etc.) and/or it can bind to one or more molecules of a
different protein or proteins. A binding protein can have more than
one type of binding activity. For example, zinc finger proteins
have DNA-binding, RNA-binding and protein-binding activity.
[0079] Examples of DNA binding proteins include; meganucleases,
zinc fingers, CRISPRs and TALE binding domains that can be
"engineered" to bind to a predetermined nucleotide sequence.
Typically, the engineered DNA binding proteins (e.g., zinc fingers,
CRISPRs, or TALEs) are proteins that are non-naturally occurring.
Non-limiting examples of methods for engineering DNA-binding
proteins are design and selection. A designed DNA binding protein
is a protein not occurring in nature whose design/composition
results principally from rational criteria. Rational criteria for
design include application of substitution rules and computerized
algorithms for processing information in a database storing
information of existing ZFP, CRISPR, and/or TALE designs and
binding data. See, for example, U.S. Pat. Nos. 6,140,081;
6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO
98/53060; WO 02/016536 and WO 03/016496 and U.S. Publication Nos.
20110301073, 20110239315 and 20119145940.
[0080] A "zinc finger DNA binding protein" (or binding domain) is a
protein, or a domain within a larger protein, that binds DNA in a
sequence-specific manner through one or more zinc fingers, which
are regions of amino acid sequence within the binding domain whose
structure is stabilized through coordination of a zinc ion. The
term zinc finger DNA binding protein is often abbreviated as zinc
finger protein or ZFP. Zinc finger binding domains can be
"engineered" to bind to a predetermined nucleotide sequence.
Non-limiting examples of methods for engineering zinc finger
proteins are design and selection. A designed zinc finger protein
is a protein not occurring in nature whose design/composition
results principally from rational criteria. Rational criteria for
design include application of substitution rules and computerized
algorithms for processing information in a database storing
information of existing ZFP designs and binding data. See, for
example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261 and
6,794,136; see also WO 98/53058; WO 98/53059; WO 98/53060; WO
02/016536 and WO 03/016496.
[0081] In other examples, the DNA-binding domain of one or more of
the nucleases comprises a naturally occurring or engineered
(non-naturally occurring) TAL effector DNA binding domain. See,
e.g., U.S. Patent Publication No. 20110301073, incorporated by
reference in its entirety herein. The plant pathogenic bacteria of
the genus Xanthomonas are known to cause many diseases in important
crop plants. Pathogenicity of Xanthomonas depends on a conserved
type III secretion (T3S) system which injects more than different
effector proteins into the plant cell. Among these injected
proteins are transcription activator-like (TALEN) effectors which
mimic plant transcriptional activators and manipulate the plant
transcriptome (see Kay et al., (2007) Science 318:648-651). These
proteins contain a DNA binding domain and a transcriptional
activation domain. One of the most well characterized TAL-effectors
is AvrBs3 from Xanthomonas campestgris pv. Vesicatoria (see Bonas
et al., (1989) Mol Gen Genet 218: 127-136 and WO2010079430).
TAL-effectors contain a centralized domain of tandem repeats, each
repeat containing approximately 34 amino acids, which are key to
the DNA binding specificity of these proteins. In addition, they
contain a nuclear localization sequence and an acidic
transcriptional activation domain (for a review see Schornack S, et
al., (2006) J Plant Physiol 163(3): 256-272). In addition, in the
phytopathogenic bacteria Ralstonia solanacearum two genes,
designated brg11 and hpx17 have been found that are homologous to
the AvrBs3 family of Xanthomonas in the R. solanacearum biovar
strain GMI1000 and in the biovar 4 strain RS1000 (see Heuer et al.,
(2007) Appl and Enviro Micro 73(13): 4379-4384). These genes are
98.9% identical in nucleotide sequence to each other but differ by
a deletion of 1,575 bp in the repeat domain of hpx17. However, both
gene products have less than 40% sequence identity with AvrBs3
family proteins of Xanthomonas. See, e.g., U.S. Patent Publication
No. 20110301073, incorporated by reference in its entirety.
[0082] Specificity of these TAL effectors depends on the sequences
found in the tandem repeats. The repeated sequence comprises
approximately 102 bp and the repeats are typically 91-100%
homologous with each other (Bonas et al. ibid). Polymorphism of the
repeats is usually located at positions 12 and 13 and there appears
to be a one-to-one correspondence between the identity of the
hypervariable diresidues at positions 12 and 13 with the identity
of the contiguous nucleotides in the TAL-effector's target sequence
(see Moscou and Bogdanove, (2009) Science 326:1501 and Boch et al.,
(2009) Science 326:1509-1512). Experimentally, the natural code for
DNA recognition of these TAL-effectors has been determined such
that an HD sequence at positions 12 and 13 leads to a binding to
cytosine (C), NG binds to T, NI to A, C, G or T, NN binds to A or
G, and ING binds to T. These DNA binding repeats have been
assembled into proteins with new combinations and numbers of
repeats, to make artificial transcription factors that are able to
interact with new sequences and activate the expression of a
non-endogenous reporter gene in plant cells (Boch et al. ibid).
Engineered TAL proteins have been linked to a FokI cleavage half
domain to yield a TAL effector domain nuclease fusion (TALEN)
exhibiting activity in a yeast reporter assay (plasmid based
target).
[0083] The CRISPR (Clustered Regularly Interspaced Short
Palindromic Repeats)/Cas (CRISPR Associated) nuclease system is a
recently engineered nuclease system based on a bacterial system
that can be used for genome engineering. It is based on part of the
adaptive immune response of many bacteria and Archea. When a virus
or plasmid invades a bacterium, segments of the invader's DNA are
converted into CRISPR RNAs (crRNA) by the `immune` response. This
crRNA then associates, through a region of partial complementarity,
with another type of RNA called tracrRNA to guide the Cas9 nuclease
to a region homologous to the crRNA in the target DNA called a
"protospacer." Cas9 cleaves the DNA to generate blunt ends at the
DSB at sites specified by a 20-nucleotide guide sequence contained
within the crRNA transcript. Cas9 requires both the crRNA and the
tracrRNA for site specific DNA recognition and cleavage. This
system has now been engineered such that the crRNA and tracrRNA can
be combined into one molecule (the "single guide RNA"), and the
crRNA equivalent portion of the single guide RNA can be engineered
to guide the Cas9 nuclease to target any desired sequence (see
Jinek et al., (2012) Science 337, p. 816-821, Jinek et al., (2013),
eLife 2:e00471, and David Segal, (2013) eLife 2:e00563). Thus, the
CRISPR/Cas system can be engineered to create a double-stranded
break (DSB) at a desired target in a genome, and repair of the DSB
can be influenced by the use of repair inhibitors to cause an
increase in error prone repair.
[0084] In other examples, the DNA binding transgene is a site
specific nuclease that comprises an engineered (non-naturally
occurring) Meganuclease (also described as a homing endonuclease).
The recognition sequences of homing endonucleases or meganucleases
such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PauI,
I-PpoI, I-SceIII, I-CreI, I-TeeI, I-TevII and I-TevIII are known.
See also U.S. Pat. No. 5,420,032; U.S. Pat. No. 6,833,252; Belfort
et al., (1997) Nucleic Acids Res. 25:3379-30 3388; Dujon et al.,
(1989) Gene 82:115-118; Perler et al., (1994) Nucleic Acids Res.
22, 11127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al.,
(1996) J. Mol. Biol. 263:163-180; Argast et al., (1998) J. Mol.
Biol. 280:345-353 and the New England Biolabs catalogue. In
addition, the DNA-binding specificity of horning endonucleases and
meganucleases can be engineered to bind non-natural target sites.
See, for example, Chevalier et al., (2002) Molec. Cell 10:895-905;
Epinat et al., (2003) Nucleic Acids Res. 5 31:2952-2962; Ashworth
et al., (2006) Nature 441:656-659; Paques et al., (2007) Current
Gene Therapy 7:49-66; U.S. Patent Publication No. 20070117128. The
DNA-binding domains of the homing endonucleases and meganucleases
may be altered in the context of the nuclease as a whole (i.e.,
such that the nuclease includes the cognate cleavage domain) or may
be fused to a heterologous cleavage domain.
[0085] As used herein, the term "transformation" encompasses all
techniques that a nucleic acid molecule can be introduced into such
a cell. Examples include, but are not limited to: transfection with
viral vectors; transformation with plasmid vectors;
electroporation; lipofection; microinjection (Mueller et al.,
(1978) Cell 15:579-85); Agrobacterium-mediated transfer; direct DNA
uptake; WHISKERS.TM.-mediated transformation; and microprojectile
bombardment. These techniques may be used for both stable
transformation and transient transformation of a plant cell.
"Stable transformation" refers to the introduction of a nucleic
acid fragment into a genome of a host organism resulting in
genetically stable inheritance. Once stably transformed, the
nucleic acid fragment is stably integrated in the genome of the
host organism and any subsequent generation. Host organisms
containing the transformed nucleic acid fragments are referred to
as "transgenic" organisms. "Transient transformation" refers to the
introduction of a nucleic acid fragment into the nucleus, or
DNA-containing organelle, of a host organism resulting in gene
expression without genetically stable inheritance.
[0086] As used herein, the term "transgene" refers to an exogenous
nucleic acid sequence. In one example, a transgene is a gene
sequence (e.g., an herbicide-resistance gene), a gene encoding an
industrially or pharmaceutically useful compound, or a gene
encoding a desirable agricultural trait. In yet another example, a
transgene is a small RNA, such as an antisense nucleic acid
sequence, wherein expression of the small RNA sequence inhibits
expression of a target nucleic acid sequence. A transgene may
contain regulatory sequences operably linked to the transgene
(e.g., a promoter, intron, or 3'-UTR). In some embodiments, a
nucleic acid of interest (or alternatively described as a gene of
interest) is a transgene. However, in other embodiments, a nucleic
acid of interest is an endogenous nucleic acid, wherein additional
genomic copies of the endogenous nucleic acid are desired, or a
nucleic acid that is in the antisense orientation with respect to
the sequence of a target nucleic acid in a host organism.
[0087] As used herein, the term "small RNA" refers to several
classes of non-coding ribonucleic acid (ncRNA). The term small RNA
describes the short chains of ncRNA produced in bacterial cells,
animals, plants, and fungi. These short chains of ncRNA may be
produced naturally within the cell or may be produced by the
introduction of an exogenous sequence that expresses the short
chain or ncRNA. The small RNA sequences do not directly code for a
protein, and differ in function from other RNA in that small RNA
sequences are only transcribed and not translated. The small RNA
sequences are involved in other cellular functions, including gene
expression and modification. Small RNA molecules are usually made
up of about 20 to 30 nucleotides. The small RNA sequences may be
derived from longer precursors. The precursors form structures that
fold back on each other in self-complementary regions; they are
then processed by the nuclease Dicer in animals or DCL1 in
plants.
[0088] Many types of small RNA exist either naturally or produced
artificially, including microRNAs (miRNAs), short interfering RNAs
(siRNAs), antisense RNA, short hairpin RNA (shRNA), and small
nucleolar RNAs (snoRNAs). Certain types of small RNA, such as
microRNA, and siRNA, are important in gene silencing and RNA
interference (RNAi). Gene silencing is a process of genetic
regulation in which a gene that would normally be expressed is
"turned off" by an intracellular element, in this case, the small
RNA. The protein that would normally be formed by this genetic
information is not formed due to interference, and the information
coded in the gene is blocked from expression.
[0089] As used herein, the term "small RNA" encompasses RNA
molecules described in the literature as "tiny RNA" (Storz, (2002)
Science 296:1260-3; Illangasekare et al., (1999) RNA 5:1482-1489);
prokaryotic "small RNA" (sRNA) (Wassarman et al., (1999) Trends
Microbiol. 7:37-45); eukaryotic "noncoding RNA (ncRNA)"; "micro-RNA
(miRNA)"; "small non-mRNA (snmRNA)"; "functional RNA (fRNA)";
"transfer RNA (tRNA)"; "catalytic RNA" [e.g., ribozymes, including
self-acylating ribozymes (Illangaskare et al., (1999) RNA
5:1482-1489); "small nucleolar RNAs (snoRNAs)"; "tmRNA" (a.k.a.
"10S RNA," Muto et al., (1998) Trends Biochem Sci. 23:25-29; and
Gillet et al., (2001) Mol Microbiol. 42:879-885); RNAi molecules
including without limitation "small interfering RNA (siRNA),"
"endoribonuclease-prepared siRNA (e-siRNA)," "short hairpin RNA
(shRNA)," and "small temporally regulated RNA (stRNA)," "diced
siRNA (d-siRNA)," and aptamers, oligonucleotides and other
synthetic nucleic acids that comprise at least one uracil base.
[0090] As used herein, the term "vector" refers to a nucleic acid
molecule as introduced into a cell, thereby producing a transformed
cell. A vector may include nucleic acid sequences that permit it to
replicate in the host cell, such as an origin of replication.
Examples include, but are not limited to, a plasmid, cosmid,
bacteriophage, bacterial artificial chromosome (BAC), or virus that
carries exogenous DNA into a cell. A vector can also include one or
more genes, antisense molecules, and/or selectable marker genes and
other genetic elements known in the art. A vector may transduce,
transform, or infect a cell, thereby causing the cell to express
the nucleic acid molecules and/or proteins encoded by the vector. A
vector may optionally include materials to aid in achieving entry
of the nucleic acid molecule into the cell (e.g., a liposome).
[0091] As used herein, the terms "cassette," "expression cassette,"
and "gene expression cassette" refer to a segment of DNA that can
be inserted into a nucleic acid or polynucleotide at specific
restriction sites or by homologous recombination. A segment of DNA
comprises a polynucleotide containing a gene of interest that
encodes a small RNA or a polypeptide of interest, and the cassette
and restriction sites are designed to ensure insertion of the
cassette in the proper reading frame for transcription and
translation. In an embodiment, an expression cassette can include a
polynucleotide that encodes a small RNA or a polypeptide of
interest and having elements in addition to the polynucleotide that
facilitate transformation of a particular host cell. In an
embodiment, a gene expression cassette may also include elements
that allow for enhanced expression of a small RNA or a
polynucleotide encoding a polypeptide of interest in a host cell.
These elements may include, but are not limited to: a promoter, a
minimal promoter, an enhancer, a response element, an intron, a 5'
untranslated, a 3' untranslated region sequence, a terminator
sequence, a polyadenylation sequence, and the like.
[0092] As used herein, the term "heterologous coding sequence" is
used to indicate any polynucleotide that codes for, or ultimately
codes for, a peptide or protein or its equivalent amino acid
sequence, e.g., an enzyme, that is not normally present in the host
organism and can be expressed in the host cell under proper
conditions. As such, "heterologous coding sequences" may include
one or additional copies of coding sequences that are not normally
present in the host cell, such that the cell is expressing
additional copies of a coding sequence that are not normally
present in the cells. The heterologous coding sequences can be RNA
or any type thereof, e.g., mRNA, DNA or any type thereof, e.g.,
cDNA, or a hybrid of RNA/DNA. Examples of coding sequences include,
but are not limited to, full-length transcription units that
comprise such features as the coding sequence, introns, promoter
regions, 5'-UTR, 30-UTRs and enhancer regions.
[0093] "Heterologous coding sequences" also includes the coding
portion of the peptide or enzyme, i.e., the cDNA or mRNA sequence,
of the peptide or enzyme, as well as the coding portion of the
full-length transcriptional unit, i.e., the gene comprising introns
and exons, as well as "codon optimized" sequences, truncated
sequences or other forms of altered sequences that code for the
enzyme or code for its equivalent amino acid sequence, provided
that the equivalent amino acid sequence produces a functional
protein. Such equivalent amino acid sequences can have a deletion
of one or more amino acids, with the deletion being N-terminal,
C-terminal or internal. Truncated forms are envisioned as long as
they have the catalytic capability indicated herein.
[0094] As used herein, the term "control" refers to a sample used
in an analytical procedure for comparison purposes. A control can
be "positive" or "negative." For example, where the purpose of an
analytical procedure is to detect a differentially expressed
transcript or polypeptide in cells or tissue, it is generally
preferable to include a positive control, such as a sample from a
known plant exhibiting the desired expression, and a negative
control, such as a sample from a known plant lacking the desired
expression.
[0095] As used herein, the term "plant" includes plants and plant
parts including, but not limited to, plant cells and plant tissues
such as leaves, stems, roots, flowers, pollen, and seeds. A class
of plant that can be used in the present invention is generally as
broad as the class of higher and lower plants amenable to
mutagenesis including angiosperms, gymnosperms, ferns and
multicellular algae. Thus, "plant" includes dicot and monocot
plants. Examples of dicotyledonous plants include tobacco,
Arabidopsis, soybean, tomato, papaya, canola, sunflower, cotton,
alfalfa, potato, grapevine, pigeon pea, pea, Brassica, chickpea,
sugar beet, rapeseed, watermelon, melon, pepper, peanut, pumpkin,
radish, spinach, squash, broccoli, cabbage, carrot, cauliflower,
celery, Chinese cabbage, cucumber, eggplant, and lettuce. Examples
of monocotyledonous plants include corn, rice, wheat, sugarcane,
barley, rye, sorghum, orchids, bamboo, banana, cattails, lilies,
oat, onion, millet, and triticale.
[0096] As used herein, the term "plant material" refers to leaves,
stems, roots, flowers or flower parts, fruits, pollen, egg cells,
zygotes, seeds, cuttings, cell or tissue cultures, or any other
part or product of a plant. In an embodiment, plant material
includes cotyledon and leaf. In an embodiment, plant material
includes seed, embryo, or ovule. In an embodiment, plant material
includes root tissues and other plant tissues located
underground.
[0097] As used herein, the term "selectable marker gene" refers to
a gene that is optionally used in plant transformation to, for
example, protect plant cells from a selective agent or provide
resistance/tolerance to a selective agent. In addition, "selectable
marker gene" is meant to encompass reporter genes. Only those cells
or plants that receive a functional selectable marker are capable
of dividing or growing under conditions having a selective agent.
Examples of selective agents can include, for example, antibiotics,
including spectinomycin, neomycin, kanamycin, paromomycin,
gentamicin, and hygromycin. These selectable markers include
neomycin phosphotransferase (npt II), which expresses an enzyme
conferring resistance to the antibiotic kanamycin, and genes for
the related antibiotics neomycin, paromomycin, gentamicin, and
G418, or the gene for hygromycin phosphotransferase (hpt), which
expresses an enzyme conferring resistance to hygromycin. Other
selectable marker genes can include genes encoding herbicide
resistance including bar or pat (resistance against glufosinate
ammonium or phosphinothricin), acetolactate synthase (ALS,
resistance against inhibitors such as sulfonylureas (SUs),
imidazolinones (IMIs), triazolopyrimidines (TPs), pyrimidinyl
oxybenzoates (POBs), and sulfonylamino carbonyl triazolinones that
prevent the first step in the synthesis of the branched-chain amino
acids), glyphosate, 2,4-D, and metal resistance or sensitivity.
Examples of "reporter genes" that can be used as a selectable
marker gene include the visual observation of expressed reporter
gene proteins such as proteins encoding .quadrature.-glucuronidase
(GUS), luciferase, green fluorescent protein (GFP), yellow
fluorescent protein (YFP), DsRed, .quadrature.-galactosidase,
chloramphenicol acetyltransferase (CAT), alkaline phosphatase, and
the like. The phrase "marker-positive" refers to plants that have
been transformed to include a selectable marker gene.
[0098] As used herein, the term "detectable marker" refers to a
label capable of detection, such as, for example, a radioisotope,
fluorescent compound, bioluminescent compound, a chemiluminescent
compound, metal chelator, or enzyme. Examples of detectable markers
include, but are not limited to, the following: fluorescent labels
(e.g., FITC, rhodamine, lanthanide phosphors), enzymatic labels
(e.g., horseradish peroxidase, .quadrature.-galactosidase,
luciferase, alkaline phosphatase), chemiluminescent, biotinyl
groups, predetermined polypeptide epitopes recognized by a
secondary reporter (e.g., leucine zipper pair sequences, binding
sites for secondary antibodies, metal binding domains, epitope
tags). In an embodiment, a detectable marker can be attached by
spacer arms of various lengths to reduce potential steric
hindrance.
[0099] As used herein, the term "detecting" is used in the broadest
sense to include both qualitative and quantitative measurements of
a specific molecule, for example, measurements of a specific
polypeptide.
[0100] Unless otherwise specifically explained, all technical and
scientific terms used herein have the same meaning as commonly
understood by those of ordinary skill in the art that this
disclosure belongs. Definitions of common terms in molecular
biology can be found in, for example: Lewin, Genes V, Oxford
University Press, 1994; Kendrew et al. (eds.), The Encyclopedia of
Molecular Biology, Blackwell Science Ltd., 1994; and Meyers (ed.),
Molecular Biology and Biotechnology: A Comprehensive Desk
Reference, VCH Publishers, Inc., 1995.
[0101] Regulatory Elements
[0102] Plant promoters used for basic research or biotechnological
applications are generally unidirectional, directing the expression
of a transgene that has been fused at its 3' end (downstream). It
is often necessary to robustly express transgenes within plants for
metabolic engineering and trait stacking. In addition, multiple
novel promoters are typically required in transgenic crops to drive
the expression of multiple genes. Disclosed, herein is a promoter
that can direct the expression of a first gene that has been fused
at its 3' end (downstream).
[0103] Development of transgenic products is becoming increasingly
complex, which requires robustly expressing transgenes and stacking
multiple transgenes into a single locus. Traditionally, each
transgene requires a unique promoter for expression wherein
multiple promoters are required to express different transgenes
within one gene stack. With an increasing size of gene stacks, this
frequently leads to repeated use of the same promoter to obtain
similar levels of expression patterns of different transgenes for
expression of a single polygenic trait. Multi-gene constructs
driven by the same promoter are known to cause gene silencing
resulting in less efficacious transgenic products in the field.
Excess of transcription factor (TF)-binding sites due to promoter
repetition can cause depletion of endogenous TFs leading to
transcriptional inactivation. The silencing of transgenes will
likely undesirably affect performance of a transgenic plant
produced to express transgenes. Repetitive sequences within a
transgene may lead to gene intra-locus homologous recombination
resulting in polynucleotide rearrangements.
[0104] Tissue specific (i.e., tissue-preferred) or organ specific
promoters drive gene expression in a certain tissue such as in the
ovule, embryo, seed, kernel, root, leaf or tapetum of the plant.
Tissue and developmental stage specific promoters derive the
expression of genes, which are expressed in particular tissues or
at particular time periods during plant development. Tissue
specific promoters are required for certain applications in the
transgenic plants industry and are desirable as they permit
specific expression of heterologous genes in a tissue and/or
developmental stage selective manner, indicating expression of the
heterologous gene differentially at a various organs, tissues
and/or times, but not in other. For example, increased resistance
of a plant to infection by soil-borne pathogens might be
accomplished by transforming the plant genome with a
pathogen-resistance gene such that pathogen-resistance protein is
robustly expressed within the roots of the plant. Alternatively, it
may be desirable to express a transgene in plant tissues that are
in a particular growth or developmental phase such as, for example,
cell division or elongation. Another application is the
desirability of using tissue specific promoters, e.g., such that
would confine the expression of the transgenes encoding an
agronomic trait in developing xylem. Another application is for
driving expression of a transgene within a seed, ovule, or embryo.
One particular problem remaining in the identification of tissue
specific promoters is how to identify the potentially most
important genes and their corresponding promoters, and to relate
these to specific developmental properties of the cell. Another
problem is to clone all relevant cis-acting transcriptional control
elements so that the cloned DNA fragment drives transcription in
the wanted specific expression pattern. A particular problem is to
identify tissue-specific promoters, related to specific cell types,
developmental stages and/or functions in the plant that are not
expressed in other plant tissues.
[0105] Provided are methods and constructs using Brassica napus
GALE gene promoter regulatory elements to express transgenes in
plant. In an embodiment, a promoter can be a Brassica napus GALE
gene promoter of:
TABLE-US-00001 (SEQ ID NO: 1)
caacaaaaatgcactttttcgccaaaaatacatttttcttcaaaaaccgc
aaaaatattttctgccaaacccgtaaaaatactatttttctgccgaaacg
taaaaaaaaatattttaattattttattaacaagtccacttggatgtaga
tgaaaatttaaaaaatgaaaagcaaacgaacatagttgcattcagatgat
tcatctggatgcatggacgaaatgaagaaacgaacaacacccatatagag
catctggataagacatctagatggatcattacaaaagaacagggcctaaa
catgtgagatgtttgaagcaatcagtcaaaagtaaccaccaaatcgaatt
atgaaagcgttgattggatggacaagtttaacaaccattgtttgattgga
caacgccgttatctaaacttttagtgtgctgtgtacatcattactatgaa
tcagttagttaaaaatattatggtcagtgaatgacagtaagattacttca
gaacttgagagatttaccgcaaaaagaaacacaataacgcgtaggaaaaa
tatcctctgttttttgcaattattctcgtagatttggttatcagtaggta
tcacgttttacaaaaatagaattacaatacatgccgcaagaaaaagactt
tctctttttaatttccccaatttggttatcagtattcagtaagtttcaca
tttttacaaaaatataaattaaaatacatactgcaagaaaaatacttttt
taatttcgccaatttggttatcagtagttttcacatttttacaaaaatat
aattaaaatataaactgcaacaaaaagacttatctttttaatttccccaa
tttggttatcagtattcagtaggtttcacatttacaaaaatattattaaa
atacatactgcaagaaacatacctttttaatttcgccaatctggttatca
gtagttttcacatttttacaaaaatagaattaaaatacaaactgcaacaa
aaagacttatctttttaatttccaccaataagttatttatttatttaatc
ctcccgtgaggaaaaagacaagattgaggatgaatatacgtaactgaaaa
ttgaggaaacagagccatcaacctttcaacacggatgatcatcatcatca
ctctctgccgcctttaaatagaaaccaacaaagacattcttgagcccaca
ctcactcctttcctatttcttcgctttgcgtgccttccttccttcttatc
tacttgtatcccacaaaaagctacttaataccatttaataaagaccccaa
ctttcttgtgtcttctctcttatcatcttcgctgtgatctctctgtctcc
ctctctcttatccaaaagattagtataaaaggatcgatctttccttgtgg
gttcttccataaaacttcgattctcgact.
[0106] In an embodiment, a gene expression cassette comprises a
promoter. In an embodiment, a promoter can be a Brassica napus
GALE1 gene promoter of the subject disclosure. In an embodiment, a
gene expression cassette comprises a promoter, wherein the promoter
is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO:1. In an
embodiment, a gene expression cassette comprises a Brassica napus
GALE1 gene promoter that is operably linked to a transgene. In an
embodiment, a gene expression cassette comprising the Brassica
napus GALE1 gene promoter may drive expression of two or more
transgenes. In an illustrative embodiment, a gene expression
cassette comprises a Brassica napus GALE1 gene promoter that is
operably linked to a transgene, wherein the transgene can be an
insecticidal resistance transgene, a herbicide tolerance transgene,
a nitrogen use efficiency transgene, a water use efficiency
transgene, a nutritional quality transgene, a DNA binding
transgene, a selectable marker transgene, or combinations
thereof.
[0107] Transgene expression may also be regulated by a
3'-untranslated gene region (i.e., 3'-UTR) located downstream of
the gene's coding sequence. Both a promoter and a 3'-UTR can
regulate transgene expression. While a promoter is necessary to
drive transcription, a 3'-UTR gene region can terminate
transcription and initiate polyadenylation of a resulting mRNA
transcript for translation and protein synthesis. A 3'-UTR gene
region aids stable expression of a transgene. In an embodiment, a
3'-UTR can be a Brassica napus GALE1 gene 3'-UTR of:
TABLE-US-00002 (SEQ ID NO: 2)
actttactctttctctctaatcgctcaatatacaaaagaaaagtgtttac
atacacacatcatatatagtttgcttttagtttccatgtaaccgaacggg
tctgtttacttctatgaataaaatagctagttgatgattctgttgattga
tacactctatggatagttcaagattttattacaatccaacgatgatttgt
atcaaatagagcccaccagatcaagaaagcatactccagaagcttttgtt
caatctaccatcagataacatatcaataaccatcttcatggtggaaccat
ctgcagcaaacccacacctcttcatttcttctatgagttcaactgaagcg
actacaccactacctccgagatgaactcggatcagtgtgttgtatgtaca
ctcatttggcgcaatcccatcctcctctcccatctttttaaacaacatat
ccgcttcagacagtgagcctttcttacacagtcctgcaatcattatggt a.
[0108] In an embodiment, a gene expression cassette comprises a
3'-UTR. In an embodiment, a 3'-UTR can be a Brassica napus GALE1
gene 3'-UTR. In an embodiment, a gene expression cassette comprises
a 3'-UTR, wherein the 3'-UTR is at least 80%, 85%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical
to SEQ ID NO:2. In an embodiment, a gene expression cassette
comprises a Brassica napus GALE1 gene 3'-UTR that is operably
linked to a transgene. In an illustrative embodiment, a gene
expression cassette comprises a 3'-UTR that is operably linked to a
transgene, wherein the transgene can be an insecticidal resistance
transgene, an herbicide tolerance transgene, a nitrogen use
efficiency transgene, a water use efficiency transgene, a
nutritional quality transgene, a DNA binding transgene, a
selectable marker transgene, or combinations thereof.
[0109] In an embodiment, a gene expression cassette comprises a
promoter and a 3'-UTR purified from the Brassica napus GALE1 gene.
In an embodiment, a gene expression cassette comprises: a) a
promoter, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical
to SEQ ID NO:1, and/or, b) a 3'-UTR, wherein the 3'-UTR is at least
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%,
99.8%, or 100% identical to SEQ ID NO:2.
[0110] For example, a gene expression cassette may include both a
promoter and a 3'-UTR wherein the promoter is a polynucleotide of
SEQ ID NO:1, and the 3'-UTR is a polynucleotide of SEQ ID NO:2. A
promoter and 3'-UTR can be operably linked to different transgenes
within a gene expression cassette when a gene expression cassette
includes one or more transgenes. In an illustrative embodiment, a
gene expression cassette comprises a Brassica napus GALE1 gene
promoter (SEQ ID NO:1) that is operably linked to a transgene,
wherein the transgene can be an insecticidal resistance transgene,
an herbicide tolerance transgene, a nitrogen use efficiency
transgene, a water use efficiency transgene, a nutritional quality
transgene, a DNA binding transgene, a selectable marker transgene,
or combinations thereof. In an illustrative embodiment, a gene
expression cassette comprises a Brassica napus GALE1 gene 3'-UTR
(SEQ ID NO:2) that is operably linked to a transgene, wherein the
transgene can be an insecticidal resistance transgene, an herbicide
tolerance transgene, a nitrogen use efficiency transgene, a water
us efficiency transgene, a nutritional quality transgene, a DNA
binding transgene, a selectable marker transgene, or combinations
thereof.
[0111] In an embodiment, a vector comprises a gene expression
cassette, as disclosed herein. In an embodiment, a vector can be a
plasmid, a cosmid, a bacterial artificial chromosome (BAC), a
bacteriophage, a virus, or an excised polynucleotide fragment for
use in transformation or gene targeting such as a donor DNA.
[0112] In an embodiment, a cell or plant comprises a gene
expression cassette, as disclosed herein. In an embodiment, a cell
or plant comprises a vector comprising a gene expression cassette,
as disclosed herein. In an embodiment, a vector can be a plasmid, a
cosmid, a bacterial artificial chromosome (BAC), a bacteriophage,
or a virus. Thereby, a cell or plant comprising a gene expression
cassette, as disclosed herein, is a transgenic cell or transgenic
plant, respectively. In an embodiment, a transgenic plant can be a
monocotyledonous plant. In an embodiment, a transgenic
monocotyledonous plant can be, but is not limited to, maize, wheat,
rice, sorghum, oats, rye, bananas, sugar cane, and millet. In an
embodiment, a transgenic plant can be a dicotyledonous plant. In an
embodiment, a transgenic dicotyledonous plant can be, but is not
limited to, soybean, cotton, sunflower, and canola. An embodiment
also includes a transgenic seed from a transgenic plant, as
disclosed herein.
[0113] In an embodiment, a gene expression cassette includes two or
more transgenes. The two or more transgenes may be operably linked
to a Brassica napus GALE1 gene promoter or 3'-UTR, as disclosed
herein. In an embodiment, a gene expression cassette includes one
or more transgenes. In an embodiment with one or more transgenes,
at least one transgene is operably linked to a Brassica napus GALE1
gene promoter or 3'-UTR or the subject disclosure.
[0114] Selectable Markers
[0115] Various selectable markers, also described as reporter
genes, can be incorporated into a chosen expression vector to allow
for identification and selection of transformed plants
("transformants"). Many methods are available to confirm expression
of selectable markers in transformed plants, including, for
example, DNA sequencing and PCR (polymerase chain reaction),
Southern blotting, RNA blotting, immunological methods for
detection of a protein expressed from the vector, eg., precipitated
protein that mediates phosphinothricin resistance, or visual
observation of other proteins such as reporter genes encoding
.quadrature.-glucuronidase (GUS), luciferase, green fluorescent
protein (GFP), yellow fluorescent protein (YFP), red fluorescent
protein (DsRed), .quadrature.-galactosidase, chloramphenicol
acetyltransferase (CAT), alkaline phosphatase, and the like (see
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third
Edition, Cold Spring Harbor Press, N.Y., 2001, the content is
incorporated herein by reference in its entirety).
[0116] Selectable marker genes are utilized for selection of
transformed cells or tissues. Selectable marker genes include genes
encoding antibiotic resistance, such as those encoding neomycin
phosphotransferase II (NptII) and hygromycin phosphotransferase
(HPT) as well as genes conferring resistance to herbicidal
compounds. Herbicide resistance genes generally code for a modified
target protein insensitive to the herbicide or for an enzyme that
degrades or detoxifies the herbicide in the plant before it can
act. For example, resistance to glyphosate has been obtained by
using genes coding for mutant target enzymes,
5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Genes and
mutants for EPSPS are well known, and further described below.
Resistance to glufosinate ammonium, bromoxynil, and
2,4-dichlorophenoxyacetate (2,4-D) have been obtained by using
bacterial genes encoding pat or DSM-2, a nitrilase, an aad-1 or an
aad-12 gene, which detoxifies the respective herbicides.
[0117] In an embodiment, herbicides can inhibit the growing point
or meristem, including imidazolinone or sulfonylurea, and genes for
resistance/tolerance of acetohydroxyacid synthase (AHAS) and
acetolactate synthase (ALS) for these herbicides are well known.
Glyphosate resistance genes include mutant
5-enolpyruvylshikimate-3-phosphate synthase (EPSPs) and dgt-28
genes (via the introduction of recombinant nucleic acids and/or
various forms of in vivo mutagenesis of native EPSPs genes), aroA
genes and glyphosate acetyl transferase (GAT) genes, respectively).
Resistance genes for other phosphono compounds include bar genes
from Streptomyces species, including Streptomyces hygroscopicus and
Streptomyces viridichromogenes, and pyridinoxy or phenoxy
proprionic acids and cyclohexones (ACCase inhibitor-encoding
genes). Exemplary genes conferring resistance to cyclohexanediones
and/or aryloxyphenoxypropanoic acid (including Haloxyfop, Diclofop,
Fenoxyprop, Fluazifop, Quizalofop) include genes of acetyl coenzyme
A carboxylase (ACCase)-Accl-S1, Accl-S2 and Accl-S3. In an
embodiment, herbicides can inhibit photosynthesis, including
triazine (psbA and ls+ genes) or benzonitrile (nitrilase gene).
[0118] In an embodiment, selectable marker genes include, but are
not limited to, genes encoding: neomycin phosphotransferase II;
cyanamide hydratase; aspartate kinase; dihydrodipicolinate
synthase; tryptophan decarboxylase; dihydrodipicolinate synthase
and desensitized aspartate kinase; bar gene; tryptophan
decarboxylase; neomycin phosphotransferase (NEO); hygromycin
phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR);
phosphinothricin acetyltransferase; 2,2-dichloropropionic acid
dehalogenase; acetohydroxyacid synthase;
5-enolpyruvyl-shikimate-phosphate synthase (aroA);
haloarylnitrilase; acetyl-coenzyme A carboxylase; dihydropteroate
synthase (sul I); and 32 kD photosystem II polypeptide (psbA).
[0119] An embodiment also includes genes encoding resistance to:
2,4-D; chloramphenicol; methotrexate; hygromycin; spectinomycin;
bromoxynil; glyphosate; and phosphinothricin.
[0120] The above list of selectable marker genes is not meant to be
limiting. Any reporter or selectable marker gene are encompassed by
the present invention.
[0121] Selectable marker genes are synthesized for optimal
expression in a plant. For example, in an embodiment, a coding
sequence of a gene has been modified by codon optimization to
enhance expression in plants. A selectable marker gene can be
optimized for expression in a particular plant species or
alternatively can be modified for optimal expression in
dicotyledonous or monocotyledonous plants. Plant preferred codons
may be determined from the codons of highest frequency in the
proteins expressed in the largest amount in the particular plant
species of interest. In an embodiment, a selectable marker gene is
designed to be expressed in plants at a higher level resulting in
higher transformation efficiency. Methods for plant optimization of
genes are well known. Guidance regarding the optimization and
manufacture of synthetic polynucleotide sequences can be found in,
for example, WO2013016546, WO2011146524, WO1997013402, U.S. Pat.
No. 6,166,302, and U.S. Pat. No. 5,380,831, herein incorporated by
reference.
[0122] Transgenes
[0123] The disclosed methods and compositions can be used to
express polynucleotide gene sequences within the plant genome.
Accordingly, expression of genes encoding herbicide tolerance,
insect resistance, nutrients, antibiotics or therapeutic molecules
can be driven by a plant promoter.
[0124] In one embodiment the Brassica napus GALE1 gene regulatory
element of the subject disclosure is combined or operably linked
with gene encoding polynucleotide sequences that provide resistance
or tolerance to glyphosate or another herbicide, and/or provides
resistance to select insects or diseases and/or nutritional
enhancements, and/or improved agronomic characteristics, and/or
proteins or other products useful in feed, food, industrial,
pharmaceutical or other uses. The transgenes can be "stacked" with
two or more nucleic acid sequences of interest within a plant
genome. Stacking can be accomplished, for example, via conventional
plant breeding using two or more events, transformation of a plant
with a construct which contains the sequences of interest,
re-transformation of a transgenic plant, or addition of new traits
through targeted integration via homologous recombination.
[0125] Such polynucleotide sequences of interest include, but are
not limited to, those examples provided below:
[0126] 1. Genes or Coding Sequence (e.g., iRNA) That Confer
Resistance to Pests or Disease
[0127] (A) Plant Disease Resistance Genes. Plant defenses are often
activated by specific interaction between the product of a disease
resistance gene (R) in the plant and the product of a corresponding
avirulence (Avr) gene in the pathogen. A plant variety can be
transformed with cloned resistance gene to engineer plants that are
resistant to specific pathogen strains. Examples of such genes
include, the tomato Cf-9 gene for resistance to Cladosporium flavum
(Jones et al., 1994 Science 266:789), tomato Pto gene, which
encodes a protein kinase, for resistance to Pseudomonas syringaepv.
tomato (Martin et al., 1993 Science 262:1432), and Arabidopsis
RSSP2 gene for resistance to Pseudomonas syringae (Mindrinos et
al., 1994 Cell 78:1089).
[0128] (B) A Bacillus thuringiensis protein, a derivative thereof
or a synthetic polypeptide modeled thereon, such as, a nucleotide
sequence of a Bt .quadrature.-endotoxin gene (Geiser et al., 1986
Gene 48:109), and a vegetative insecticidal (VIP) gene (see, e.g.,
Estruch et al., (1996) Proc. Natl. Acad. Sci. 93:5389-94).
Moreover, DNA molecules encoding .quadrature.-endotoxin genes can
be purchased from American Type Culture Collection (Rockville,
Md.), under ATCC accession numbers 40098, 67136, 31995 and
31998.
[0129] (C) A lectin, such as, nucleotide sequences of several
Clivia miniata mannose-binding lectin genes (Van Damme et al., 1994
Plant Molec. Biol. 24:825).
[0130] (D) A vitamin binding protein, such as avidin and avidin
homologs which are useful as larvicides against insect pests. See
U.S. Pat. No. 5,659,026.
[0131] (E) An enzyme inhibitor, e.g., a protease inhibitor or an
amylase inhibitor. Examples of such genes include a rice cysteine
proteinase inhibitor (Abe et al., 19871 Biol. Chem. 262:16793), a
tobacco proteinase inhibitor I (Huub et al., 1993 Plant Molec.
Biol. 21:985), and an .quadrature.-amylase inhibitor (Sumitani et
al., 1993 Biosci. Biotech. Biochem. 57:1243).
[0132] (F) An insect-specific hormone or pheromone such as an
ecdysteroid and juvenile hormone a variant thereof, a mimetic based
thereon, or an antagonist or agonist thereof, such as baculovirus
expression of cloned juvenile hormone esterase, an inactivator of
juvenile hormone (Hammock et al., 1990 Nature 344:458).
[0133] (G) An insect-specific peptide or neuropeptide which, upon
expression, disrupts the physiology of the affected pest (J. Biol.
Chem. 269:9). Examples of such genes include an insect diuretic
hormone receptor (Regan, 1994), an allostatin identified in
Diploptera punctata (Pratt, 1989), and insect-specific, paralytic
neurotoxins (U.S. Pat. No. 5,266,361).
[0134] (H) An insect-specific venom produced in nature by a snake,
a wasp, etc., such as a scorpion insectotoxic peptide (Pang, 1992
Gene 116:165).
[0135] (I) An enzyme responsible for a hyperaccumulation of
monoterpene, a sesquiterpene, a steroid, hydroxamic acid, a
phenylpropanoid derivative or another non-protein molecule with
insecticidal activity.
[0136] (J) An enzyme involved in the modification, including the
post-translational modification, of a biologically active molecule;
for example, glycolytic enzyme, a proteolytic enzyme, a lipolytic
enzyme, a nuclease, a cyclase, a transaminase, an esterase, a
hydrolase, a phosphatase, a kinase, a phosphorylase, a polymerase,
an elastase, a chitinase and a glucanase, whether natural or
synthetic. Examples of such genes include, a callas gene (PCT
published application WO93/02197), chitinase-encoding sequences
(which can be obtained, for example, from the ATCC under accession
numbers 3999637 and 67152), tobacco hookworm chitinase (Kramer et
al., 1993 Insect Molec. Biol. 23:691), and parsley ubi4-2
polyubiquitin gene (Kawalleck et al., 1993 Plant Molec. Biol.
21:673).
[0137] (K) A molecule that stimulates signal transduction. Examples
of such molecules include nucleotide sequences for mung bean
calmodulin cDNA clones (Botella et al., 1994 Plant Molec. Biol.
24:757) and a nucleotide sequence of a maize calmodulin cDNA clone
(Griess et al., 1994 Plant Physiol. 104:1467).
[0138] (L) A hydrophobic moment peptide. See U.S. Pat. Nos.
5,659,026 and 5,607,914; the latter teaches synthetic antimicrobial
peptides that confer disease resistance.
[0139] (M) A membrane permease, a channel former or a channel
blocker, such as a cecropin-.quadrature. lytic peptide analog
(Jaynes et al., 1993 Plant Sci. 89:43) which renders transgenic
tobacco plants resistant to Pseudomonas solanacearum.
[0140] (N) A viral-invasive protein or a complex toxin derived
therefrom. For example, the accumulation of viral coat proteins in
transformed plant cells imparts resistance to viral infection
and/or disease development effected by the virus from which the
coat protein gene is derived, as well as by related viruses. Coat
protein-mediated resistance has been conferred upon transformed
plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco
streak virus, potato virus X, potato virus Y, tobacco etch virus,
tobacco rattle virus and tobacco mosaic virus. See, for example,
Beachy et al., (1990) Ann. Rev. Phytopathol. 28:451.
[0141] (O) An insect-specific antibody or an immunotoxin derived
therefrom. Thus, an antibody targeted to a critical metabolic
function in the insect gut would inactivate an affected enzyme,
killing the insect. For example, Taylor et al., (1994) Abstract
#497, Seventh Intl. Symposium on Molecular Plant-Microbe
Interactions shows enzymatic inactivation in transgenic tobacco via
production of single-chain antibody fragments.
[0142] (P) A virus-specific antibody. See, for example, Tavladoraki
et al., (1993) Nature 266:469, which shows that transgenic plants
expressing recombinant antibody genes are protected from virus
attack
[0143] (Q) A developmental-arrestive protein produced in nature by
a pathogen or a parasite. Thus, fungal endo .quadrature.-1,4-D
polygalacturonases facilitate fungal colonization and plant
nutrient release by solubilizing plant cell wall
homo-.quadrature.-1,4-D-galacturonase (Lamb et al., 1992)
Bio/Technology 10:1436. The cloning and characterization of a gene
which encodes a bean endopolygalacturonase-inhibiting protein is
described by Toubart et al., (1992 Plant J. 2:367).
[0144] (R) A developmental-arrestive protein produced in nature by
a plant, such as the barley ribosome-inactivating gene that
provides an increased resistance to fungal disease (Longemann et
al., 1992). Bio/Technology 10:3305.
[0145] (S) RNA interference, in which an RNA molecule is used to
inhibit expression of a target gene. An RNA molecule in one example
is partially or fully double stranded, which triggers a silencing
response, resulting in cleavage of dsRNA into small interfering
RNAs, which are then incorporated into a targeting complex that
destroys homologous mRNAs. See, e.g., Fire et al. U.S. Pat. No.
6,506,559; Graham et al. 6,573,099.
[0146] 2. Genes that Confer Resistance to a Herbicide
[0147] (A) Genes encoding resistance or tolerance to a herbicide
that inhibits the growing point or meristem, such as an
imidazalinone, sulfonanilide or sulfonylurea herbicide. Exemplary
genes in this category code for mutant acetolactate synthase (ALS)
(Lee et al., 1988 EMBOJ. 7:1241) also known as acetohydroxyacid
synthase (AHAS) enzyme (Mild et al., 1990 Theor. Appl. Genet.
80:449).
[0148] (B) One or more additional genes encoding resistance or
tolerance to glyphosate imparted by mutant EPSP synthase and aroA
genes, or through metabolic inactivation by genes such as DGT-28,
2mEPSPS, GAT (glyphosate acetyltransferase) or GOX (glyphosate
oxidase) and other phosphono compounds such as glufosinate (pat,
bar, and dsm-2 genes), and aryloxyphenoxypropionic acids and
cyclohexanediones (ACCase inhibitor encoding genes). See, for
example, U.S. Pat. No. 4,940,835, which discloses the nucleotide
sequence of a form of EPSP which can confer glyphosate resistance.
A DNA molecule encoding a mutant aroA gene can be obtained under
ATCC Accession Number 39256, and the nucleotide sequence of the
mutant gene is disclosed in U.S. Pat. No. 4,769,061. European
patent application No. 0 333 033 and U.S. Pat. No. 4,975,374
disclose nucleotide sequences of glutamine synthetase genes which
confer resistance to herbicides such as L-phosphinothricin. The
nucleotide sequence of a phosphinothricinacetyl-transferase gene is
provided in European application No. 0 242 246. De Greef et al.,
(1989) Bio/Technology 7:61 describes the production of transgenic
plants that express chimeric bar genes coding for phosphinothricin
acetyl transferase activity. Exemplary of genes conferring
resistance to aryloxyphenoxypropionic acids and cyclohexanediones,
such as sethoxydim and haloxyfop, are the Accl-S1, Accl-S2 and
Accl-S3 genes described by Marshall et al., (1992) Theor. Appl.
Genet. 83:435.
[0149] (C) Genes encoding resistance or tolerance to a herbicide
that inhibits photosynthesis, such as a triazine (psbA and gs+
genes) and a benzonitrile (nitrilase gene). Przibilla et al.,
(1991) Plant Cell 3:169 describe the use of plasmids encoding
mutant psbA genes to transform Chlamydomonas. Nucleotide sequences
for nitrilase genes are disclosed in U.S. Pat. No. 4,810,648, and
DNA molecules containing these genes are available under ATCC
accession numbers 53435, 67441 and 67442. Cloning and expression of
DNA coding for a glutathione S-transferase is described by Hayes et
al., (1992) Biochem. J. 285:173.
[0150] (D) Genes encoding resistance or tolerance to a herbicide
that bind to hydroxyphenylpyruvate dioxygenases (HPPD), enzymes
which catalyze the reaction in which para-hydroxyphenylpyruvate
(HPP) is transformed into homogentisate. This includes herbicides
such as isoxazoles (EP418175, EP470856, EP487352, EP527036,
EP560482, EP682659, U.S. Pat. No. 5,424,276), in particular
isoxaflutole, which is a selective herbicide for maize,
diketonitriles (EP496630, EP496631), in particular
2-cyano-3-cyclopropyl-1-(2-SO2CH3-4-CF3 phenyl)propane-1,3-dione
and 2-cyano-3-cyclopropyl-1-(2-SO2CH3-4-2,3Cl2phenyl)
propane-1,3-dione, triketones (EP625505, EP625508, U.S. Pat. No.
5,506,195), in particular sulcotrione, and pyrazolinates. A gene
that produces an overabundance of HPPD in plants can provide
tolerance or resistance to such herbicides, including, for example,
genes described in U.S. Pat. Nos. 6,268,549 and 6,245,968 and U.S.
Patent Application, Publication No. 20030066102.
[0151] (E) Genes encoding resistance or tolerance to phenoxy auxin
herbicides, such as 2,4-dichlorophenoxyacetic acid (2,4-D) and
which may also confer resistance or tolerance to
aryloxyphenoxypropionate (AOPP) herbicides. Examples of such genes
include the .quadrature.-ketoglutarate-dependent dioxygenase enzyme
(aad-1) gene, described in U.S. Pat. No. 7,838,733.
[0152] (F) Genes encoding resistance or tolerance to phenoxy auxin
herbicides, such as 2,4-dichlorophenoxyacetic acid (2,4-D) and
which may also confer resistance or tolerance to pyridyloxy auxin
herbicides, such as fluroxypyr or triclopyr. Examples of such genes
include the .quadrature.-ketoglutarate-dependent dioxygenase enzyme
gene (aad-12), described in WO 2007/053482 A2.
[0153] (G) Genes encoding resistance or tolerance to dicamba (see,
e.g., U.S. Patent Publication No. 20030135879).
[0154] (H) Genes providing resistance or tolerance to herbicides
that inhibit protoporphyrinogen oxidase (PPO) (see U.S. Pat. No.
5,767,373).
[0155] (I) Genes providing resistance or tolerance to triazine
herbicides (such as atrazine) and urea derivatives (such as diuron)
herbicides which bind to core proteins of photosystem II reaction
centers (PS II) (see Brussian et al., (1989) EMBO J. 1989, 8(4):
1237-1245.
[0156] 3. Genes that Confer or Contribute to a Value-Added
Trait
[0157] (A) Modified fatty acid metabolism, for example, by
transforming maize or Brassica with an antisense gene or
stearoyl-ACP desaturase to increase stearic acid content of the
plant (Knultzon et al., 1992) Proc. Nat. Acad. Sci. USA
89:2624.
[0158] (B) Decreased phytate content
[0159] (1) Introduction of a phytase-encoding gene, such as the
Aspergillus niger phytase gene (Van Hartingsveldt et al., 1993 Gene
127:87), enhances breakdown of phytate, adding more free phosphate
to the transformed plant.
[0160] (2) A gene could be introduced that reduces phytate content.
In maize, this, for example, could be accomplished by cloning and
then reintroducing DNA associated with the single allele which is
responsible for maize mutants characterized by low levels of phytic
acid (Raboy et al., 1990 Maydica 35:383).
[0161] (C) Modified carbohydrate composition effected, for example,
by transforming plants with a gene coding for an enzyme that alters
the branching pattern of starch. Examples of such enzymes include,
Streptococcus mucus fructosyltransferase gene (Shiroza et al.,
1988) J. Bacteriol. 170:810, Bacillus subtilis levansucrase gene
(Steinmetz et al., 1985 Mol. Gen. Genel. 200:220), Bacillus
licheniformis .quadrature.-amylase (Pen et al., 1992 Bio/Technology
10:292), tomato invertase genes (Elliot et al., 1993), barley
amylase gene (Sogaard et al., 1993 J. Biol. Chem. 268:22480), and
maize endosperm starch branching enzyme II (Fisher et al., 1993
Plant Physiol. 102:10450).
[0162] Transformation
[0163] Suitable methods for transformation of plants include any
method that DNA can be introduced into a cell, for example, and
without limitation: electroporation (see, e.g., U.S. Pat. No.
5,384,253); micro-projectile bombardment (see, e.g., U.S. Pat. Nos.
5,015,580; 5,550,318; 5,538,880; 6,160,208; 6,399,861; and
6,403,865); Agrobacterium-mediated transformation (see, e.g., U.S.
Pat. Nos. 5,635,055; 5,824,877; 5,591,616; 5,981,840; and
6,384,301); and protoplast transformation (see, e.g., U.S. Pat. No.
5,508,184). These methods may be used to stably transform or
transiently transform a plant.
[0164] A DNA construct may be introduced directly into the genomic
DNA of the plant cell using techniques such as agitation with
silicon carbide fibers (see, e.g., U.S. Pat. Nos. 5,302,523 and
5,464,765), or the DNA constructs can be introduced directly to
plant tissue using biolistic methods, such as DNA particle
bombardment (see, e.g., Klein et al., (1987) Nature 327:70-73).
Alternatively, the DNA construct can be introduced into the plant
cell via nanoparticle transformation (see, e.g., U.S. Patent
Publication No. 2009/0104700, incorporated herein by reference in
its entirety).
[0165] In addition, gene transfer may be achieved using
non-Agrobacterium bacteria or viruses such as Rhizobium sp. NGR234,
Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X,
cauliflower mosaic virus and cassava vein mosaic virus and/or
tobacco mosaic virus, see, e.g., Chung et al., (2006) Trends Plant
Sci. 11(1):1-4.
[0166] Through the application of transformation techniques, cells
of virtually any plant species may be stably transformed, and these
cells may be developed into transgenic plants by well-known
techniques. For example, techniques that may be particularly useful
in the context of cotton transformation are described in U.S. Pat.
Nos. 5,846,797; 5,159,135; 5,004,863; and 6,624,344; techniques for
transforming Brassica plants in particular are described, for
example, in U.S. Pat. No. 5,750,871; techniques for transforming
soy bean are described, for example, in U.S. Pat. No. 6,384,301;
and techniques for transforming maize are described, for example,
in U.S. Pat. Nos. 7,060,876 and 5,591,616, and International PCT
Publication WO 95/06722.
[0167] After effecting delivery of an exogenous nucleic acid to a
recipient cell, a transformed cell is generally identified for
further culturing and plant regeneration. In order to improve the
ability to identify transformants, one may desire to employ a
selectable marker gene with the transformation vector used to
generate the transformant. In an illustrative embodiment, a
transformed cell population can be assayed by exposing the cells to
a selective agent or agents, or the cells can be screened for the
desired marker gene trait.
[0168] Cells that survive exposure to a selective agent, or cells
that have been scored positive in a screening assay, may be
cultured in media that supports regeneration of plants. In an
embodiment, any suitable plant tissue culture media may be modified
by including further substances, such as growth regulators. Tissue
may be maintained on a basic media with growth regulators until
sufficient tissue is available to begin plant regeneration efforts,
or following repeated rounds of manual selection, until the
morphology of the tissue is suitable for regeneration (e.g., at
least 2 weeks), then transferred to media conducive to shoot
formation. Cultures are transferred periodically until sufficient
shoot formation has occurred. Once shoots are formed, they are
transferred to media conducive to root formation. Once sufficient
roots are formed, plants can be transferred to soil for further
growth and maturity.
[0169] To confirm the presence of a desired nucleic acid comprising
constructs provided in regenerating plants, a variety of assays may
be performed. Such assays may include: molecular biological assays,
such as Southern and Northern blotting and PCR; biochemical assays,
such as detecting the presence of a protein product, e.g., by
immunological methodology (ELISA, western blots, and/or LC-MS MS
spectrophotometry) or by enzymatic function; plant part assays,
such as leaf or root assays; and/or analysis of the phenotype of
the whole regenerated plant.
[0170] Transgenic events may be screened, for example, by PCR
amplification using, e.g., oligonucleotide primers specific for
nucleic acid molecules of interest. PCR genotyping is understood to
include, but not be limited to, polymerase-chain reaction (PCR)
amplification of genomic DNA derived from isolated host plant
callus tissue predicted to contain a nucleic acid molecule of
interest integrated into the genome, followed by standard cloning
and sequence analysis of PCR amplification products. Methods of PCR
genotyping have been well described (see, e.g., Rios et al., (2002)
Plant J. 32:243-53), and may be applied to genomic DNA derived from
any plant species or tissue type, including cell cultures.
Combinations of oligonucleotide primers that bind to both target
sequence and introduced sequence may be used sequentially or
multiplexed in PCR amplification reactions. Oligonucleotide primers
designed to anneal to the target site, introduced nucleic acid
sequences, and/or combinations of the two may be produced. Thus,
PCR genotyping strategies may include, for example, and without
limitation: amplification of specific sequences in the plant
genome; amplification of multiple specific sequences in the plant
genome; amplification of non-specific sequences in the plant
genome; and combinations of any of the foregoing. One skilled in
the art may devise additional combinations of primers and
amplification reactions to interrogate the genome. For example, a
set of forward and reverse oligonucleotide primers may be designed
to anneal to nucleic acid sequence(s) specific for the target
outside the boundaries of the introduced nucleic acid sequence.
[0171] Forward and reverse oligonucleotide primers may be designed
to anneal specifically to an introduced nucleic acid molecule, for
example, at a sequence corresponding to a coding region within a
nucleotide sequence of interest comprised therein, or other parts
of the nucleic acid molecule. Primers may be used in conjunction
with primers described herein. Oligonucleotide primers may be
synthesized according to a desired sequence and are commercially
available (e.g., from Integrated DNA Technologies, Inc.,
Coralville, Iowa). Amplification may be followed by cloning and
sequencing, or by direct sequence analysis of amplification
products. In an embodiment, oligonucleotide primers specific for
the gene target are employed in PCR amplifications.
[0172] Method of Expressing a Transgene
[0173] In an embodiment, a method of expressing at least one
transgene in a plant comprises growing a plant comprising a
Brassica napus GALE1 gene promoter operably linked to at least one
transgene. In an embodiment, a method of expressing at least one
transgene in a plant comprising growing a plant comprising a
Brassica napus GALE1 gene 3'-UTR operably linked to at least one
transgene. In an embodiment, a method of expressing at least one
transgene in a plant comprises growing a plant comprising a
Brassica napus GALE1 gene promoter and 3'-UTR operably linked to at
least one transgene.
[0174] In an embodiment, a method of expressing at least one
transgene in a plant tissue or plant cell comprising culturing a
plant tissue or plant cell comprising a Brassica napus GALE1 gene
promoter operably linked to at least one transgene. In an
embodiment, a method of expressing at least one transgene in a
plant tissue or plant cell comprising culturing a plant tissue or
plant cell comprising a Brassica napus GALE1 gene 3'-UTR operably
linked to at least one transgene. In an embodiment, a method of
expressing at least one transgene in a plant tissue or plant cell
comprising culturing a plant tissue or plant cell comprising a
Brassica napus GALE1 gene promoter and a Brassica napus GALE1 gene
3'-UTR operably linked to at least one transgene.
[0175] In an embodiment, a method of expressing at least one
transgene in a plant comprises growing a plant comprising a gene
expression cassette comprising a Brassica napus GALE1 gene promoter
operably linked to at least one transgene. In an embodiment, a
method of expressing at least one transgene in a plant comprises
growing a plant comprising a gene expression cassette comprising a
Brassica napus GALE1 gene 3'-UTR operably linked to at least one
transgene. In an embodiment, a method of expressing at least one
transgene in a plant comprises growing a plant comprising a gene
expression cassette comprising a Brassica napus GALE1 gene promoter
and a Zea mays chlorophyll a/b binding gene 3'-UTR operably linked
to at least one transgene.
[0176] In an embodiment, a method of expressing at least one
transgene in a plant tissue or plant cell comprises culturing a
plant tissue or plant cell comprising a gene expression cassette a
Brassica napus GALE1 gene promoter operably linked to at least one
transgene. In an embodiment, a method of expressing at least one
transgene in a plant tissue or plant cell comprises culturing a
plant tissue or plant cell comprising a gene expression cassette a
Brassica napus GALE1 gene 3'-UTR operably linked to at least one
transgene. In an embodiment, a method of expressing at least one
transgene in a plant tissue or plant cell comprises culturing a
plant tissue or plant cell comprising a gene expression cassette a
Brassica napus GALE1 gene promoter and a Brassica napus GALE1 gene
3'-UTR operably linked to at least one transgene.
[0177] In an embodiment, a plant, plant tissue, or plant cell
comprises a Brassica napus GALE1 gene promoter (also including an
upstream-promoter). In an embodiment, a Brassica napus GALE1 gene
promoter can be SEQ ID NO:1. In an embodiment, a plant, plant
tissue, or plant cell comprises a gene expression cassette
comprising Brassica napus GALE1 gene promoter, wherein the promoter
is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO:1. In an
embodiment, a plant, plant tissue, or plant cell comprises a gene
expression cassette comprising a Brassica napus GALE1 gene promoter
that is operably linked to a transgene. In an illustrative
embodiment, a plant, plant tissue, or plant cell comprises a gene
expression cassette comprising a Brassica napus GALE1 gene promoter
that is operably linked to a transgene, wherein the transgene can
be an insecticidal resistance transgene, an herbicide tolerance
transgene, a nitrogen use efficiency transgene, a water use
efficiency transgene, a nutritional quality transgene, a DNA
binding transgene, a selectable marker transgene, or combinations
thereof.
[0178] In an embodiment, a plant, plant tissue, or plant cell
comprises a gene expression cassette comprising a Brassica napus
GALE1 gene 3'-UTR. In an embodiment, a plant, plant tissue, or
plant cell comprises a gene expression cassette comprising a
Brassica napus GALE1 gene 3'-UTR. In an embodiment, the Brassica
napus GALE1 gene 3'-UTR is a polynucleotide of SEQ ID NO:2. In an
embodiment, a plant, plant tissue, or plant cell comprises a gene
expression cassette comprising a Brassica napus GALE1 gene 3'-UTR,
wherein the Brassica napus GALE1 gene 3'-UTR is at least 80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or
100% identical to SEQ ID NO:2. In an embodiment, a gene expression
cassette comprises a Brassica napus GALE1 gene 3'-UTR that is
operably linked to a promoter, wherein the promoter is a Brassica
napus GALE1 gene promoter, or a promoter that originates from a
plant (e.g., Arabidopsis thahana ubiquitin 10 promoter), a virus
(e.g., Cassava vein mosaic virus promoter) or a bacteria (e.g.,
Agrobacterium tumefaciens delta mas). In an embodiment, a plant,
plant tissue, or plant cell comprises a gene expression cassette
comprising a Brassica napus GALE1 gene 3'-UTR that is operably
linked to a transgene. In an illustrative embodiment, a plant,
plant tissue, or plant cell comprising a gene expression cassette
comprising a Brassica napus GALE1 gene 3'-UTR that is operably
linked to a transgene, wherein the transgene can be an insecticidal
resistance transgene, an herbicide tolerance transgene, a nitrogen
use efficiency transgene, a water use efficiency transgene, a
nutritional quality transgene, a DNA binding transgene, a
selectable marker transgene, or combinations thereof.
[0179] In an embodiment, a plant, plant tissue, or plant cell
comprises a gene expression cassette comprising a Brassica napus
GALE1 gene promoter and Brassica napus GALE1 gene 3'-UTR that are
operably linked to a transgene. The promoter and 3'-UTR can be
operably linked to different transgenes within a gene expression
cassette when a gene expression cassette includes two or more
transgenes. In an illustrative embodiment, a gene expression
cassette comprises a Brassica napus GALE1 gene promoter that is
operably linked to a transgene, wherein the transgene can be an
insecticidal resistance transgene, an herbicide tolerance
transgene, a nitrogen use efficiency transgene, a water use
efficiency transgene, a nutritional quality transgene, a DNA
binding transgene, a selectable marker transgene, or combinations
thereof. In an illustrative embodiment, a gene expression cassette
comprises a Brassica napus GALE1 gene 3'-UTR that is operably
linked to a transgene, wherein the transgene can be an insecticidal
resistance transgene, an herbicide tolerance transgene, a nitrogen
use efficiency transgene, a water use efficiency transgene, a
nutritional quality transgene, a DNA binding transgene, a
selectable marker transgene, or combinations thereof.
[0180] In an embodiment, transgene expression using methods
described herein is expressed within a plant's ovule and seed
tissues. In an embodiment, transgene expression includes more than
one transgene expressed in the plant's ovule and seed tissues. In
an embodiment, a method of growing a transgenic plant as described
herein includes ovule and seed-preferred transgene expression. In
an embodiment, a method of expressing a transgene in a plant tissue
or plant cell includes ovule and seed-preferred tissues and ovule
and seed-preferred cells. In an embodiment, the ovule and
seed-preferred expression includes dicotyledonous leaf and
stem-preferred expression.
[0181] In a further embodiment, transgene expression using methods
described herein is expressed within above ground plant tissues
(e.g., ovule or seed). In an embodiment, transgene expression
includes more than one transgene expressed in above ground plant
tissues such as ovule or seed. In other embodiments, the expression
of the transgene is within the endosperm tissue of seeds. In an
embodiment, a method of growing a transgenic plant as described
herein includes above ground plant tissues transgene expression. In
an embodiment, a method of expressing a transgene in a plant tissue
or plant cell above ground plant tissues and above ground plant
cells. In an embodiment, the above ground plant tissue expression
includes dicotyledonous above ground plant tissue expression.
[0182] In an embodiment, a plant, plant tissue, or plant cell
comprises a vector comprising a Brassica napus GALE1 gene promoter,
or 3'-UTR regulatory element, as disclosed herein. In an
embodiment, a plant, plant tissue, or plant cell comprises a vector
comprising a Brassica napus GALE1 gene promoter, or 3'-UTR
regulatory element, as disclosed herein, operably linked to a
transgene. In an embodiment, a plant, plant tissue, or plant cell
comprises a vector comprising a gene expression cassette, as
disclosed herein. In an embodiment, a vector can be a plasmid, a
cosmid, a bacterial artificial chromosome (BAC), a bacteriophage,
or a virus fragment.
[0183] In an embodiment, a plant, plant tissue, or plant cell
according to the methods disclosed herein can be monocotyledonous.
The monocotyledon plant, plant tissue, or plant cell can be, but
not limited to, corn, rice, wheat, sugarcane, barley, rye, sorghum,
orchids, bamboo, banana, cattails, lilies, oat, onion, millet, and
triticale.
[0184] In an embodiment, a plant, plant tissue, or plant cell
according to the methods disclosed herein can be dicotyledonous.
The dicotyledon plant, plant tissue, or plant cell can be, but is
not limited to, rapeseed, canola, Indian mustard, Ethiopian
mustard, soybean, sunflower, and cotton.
[0185] With regard to the production of genetically modified
plants, methods for the genetic engineering of plants are well
known in the art. For instance, numerous methods for plant
transformation have been developed, including biological and
physical transformation protocols for dicotyledonous plants as well
as monocotyledonous plants (e.g., Goto-Fumiyuki et al., Nature
Biotech 17:282-286 (1999); Mild et al., Methods in Plant Molecular
Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds.,
CRC Press, Inc., Boca Raton, pp. 67-88 (1993)). In addition,
vectors and in vitro culture methods for plant cell or tissue
transformation and regeneration of plants are available, for
example, in Gruber et al., Methods in Plant Molecular Biology and
Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press,
Inc., Boca Raton, pp. 89-119 (1993).
[0186] One of skill in the art will recognize that after the
exogenous sequence is stably incorporated in transgenic plants and
confirmed to be operable, it can be introduced into other plants by
sexual crossing. Any of a number of standard breeding techniques
can be used, depending upon the species to be crossed.
[0187] A transformed plant cell, callus, tissue or plant may be
identified and isolated by selecting or screening the engineered
plant material for traits encoded by the marker genes present on
the transforming DNA. For instance, selection can be performed by
growing the engineered plant material on media containing an
inhibitory amount of the antibiotic or herbicide to which the
transforming gene construct confers resistance. Further,
transformed cells can also be identified by screening for the
activities of any visible marker genes (e.g., the yfp, gfp,
.quadrature.-glucuronidase, luciferase, B or Cl genes) that may be
present on the recombinant nucleic acid constructs. Such selection
and screening methodologies are well known to those skilled in the
art.
[0188] Physical and biochemical methods also may be used to
identify plant or plant cell transformants containing inserted gene
constructs. In certain embodiments, the disclosure relates to a
method that includes confirming a modification of genomic DNA such
as the a gene expression cassette inserted into the genome of
plants. In certain embodiments, the method of confirming such a
modification of the genome includes confirmation by a PCR based
assay, Southern blot assay, Northern blot assay, protein expression
assay, Western blot assay, ELISA assay, or Next Generation
Sequencing assay.
[0189] Accordingly, a modification of genomic DNA such as a gene
expression cassette inserted into the genome of plants can be
confirmed in a variety of ways, including using a primer or probe
of the sequence. In certain embodiments, the stably integrated
transgene may be detected based on the constitutive or selective
expression of the transgene in some tissues of the plant or at some
developmental stages, or the transgene may be expressed in
substantially all plant tissues, substantially along its entire
life cycle.
[0190] Confirmation of a gene expression cassette inserted into the
genome of plants may be carried out by any suitable method of
amplification. See generally, Kwoh et al., Am. Biotechnol. Lab. 8,
14-25 (1990). Examples of suitable amplification techniques
include, but are not limited to, polymerase chain reaction, ligase
chain reaction, strand displacement amplification (see generally G.
Walker et al., Proc. Natl. Acad. Sci. USA 89, 392-396 (1992); G.
Walker et al., Nucleic Acids Res. 20, 1691-1696 (1992)),
transcription-based amplification (see D. Kwoh et al., Proc. Natl.
Acad Sci. USA 86, 1173-1177 (1989)), self-sustained sequence
replication (or "35R") (see J. Guatelli et al., Proc. Natl. Acad.
Sci. USA 87, 1874-1878 (1990)), the Q0 replicase system (see P.
Lizardi et al., BioTechnology 6, 1197-1202 (1988)), nucleic acid
sequence-based amplification (or "NASBA") (see R. Lewis, Genetic
Engineering News 12 (9), 1 (1992)), the repair chain reaction (or
"RCR") (see R. Lewis, supra), and boomerang DNA amplification (or
"BDA") (see R. Lewis, supra). Polymerase chain reaction is
generally preferred.
[0191] "Amplification" is a special case of nucleic acid
replication involving template specificity. It is to be contrasted
with non-specific template replication (i.e., replication that is
template-dependent but not dependent on a specific template).
Template specificity is here distinguished from fidelity of
replication (i.e., synthesis of the proper polynucleotide sequence)
and nucleotide (ribo- or deoxyribo-) specificity. Template
specificity is frequently described in terms of "target"
specificity.
[0192] As used herein, the term "polymerase chain reaction" and
"PCR" generally refers to the method for increasing the
concentration of a segment of a target sequence in a mixture of
genomic DNA without cloning or purification (U.S. Pat. Nos.
4,683,195; 4,683,202; and 4,965,188; herein incorporated by
reference). This process for amplifying the target sequence
comprises introducing an excess of two oligonucleotide primers to
the DNA mixture containing the desired target sequence, followed by
a precise sequence of thermal cycling in the presence of a DNA
polymerase. The two primers are complementary to their respective
strands of the double stranded target sequence. To effect
amplification, the mixture is denatured and the primers then
annealed to their complementary sequences within the target
molecule. Following annealing, the primers are extended with a
polymerase so as to form a new pair of complementary strands. The
steps of denaturation, primer annealing and polymerase extension
can be repeated many times (i.e., denaturation, annealing and
extension constitute one "cycle"; there can be numerous "cycles")
to obtain a high concentration of an amplified segment of the
desired target sequence. The length of the amplified segment of the
desired target sequence is determined by the relative positions of
the primers with respect to each other, and, therefore, this length
is a controllable parameter. By virtue of the repeating aspect of
the process, the method is referred to as the "polymerase chain
reaction" (hereinafter "PCR"). Because the desired amplified
segments of the target sequence become the predominant sequences
(in tams of concentration) in the mixture, they are said to be "PCR
amplified.
[0193] The term "reverse-transcriptase" or "RT-PCR" refers to a
type of PCR where the starting material is mRNA. The starting mRNA
is enzymatically converted to complementary DNA or "cDNA" using a
reverse transcriptase enzyme. The cDNA is then used as a "template"
for a "PCR" reaction.
[0194] In an embodiment, the amplification reaction is quantified.
In other embodiments, the amplification reaction is quantitated
using a signature profile, in which the signature profile is
selected from the group consisting of a melting temperature or a
fluorescence signature profile.
[0195] The nucleic acid molecule of embodiments of the disclosure,
or segments thereof, can be used as primers for PCR amplification.
In performing PCR amplification, a certain degree of mismatch can
be tolerated between primer and template. Therefore, mutations,
deletions, and insertions (especially additions of nucleotides to
the 5' or 3' end) of the exemplified primers fall within the scope
of the subject disclosure. Mutations, insertions, and deletions can
be produced in a given primer by methods known to an ordinarily
skilled artisan.
[0196] Molecular Beacons have been described for use in sequence
detection. Briefly, a FRET oligonucleotide probe is designed that
overlaps the flanking genomic and insert DNA junction. The unique
structure of the FRET probe results in it containing a secondary
structure that keeps the fluorescent and quenching moieties in
close proximity. The FRET probe and PCR primers (one primer in the
insert DNA sequence and one in the flanking genomic sequence) are
cycled in the presence of a thermostable polymerase and dNTPs.
Following successful PCR amplification, hybridization of the FRET
probe(s) to the target sequence results in the removal of the probe
secondary structure and spatial separation of the fluorescent and
quenching moieties. A fluorescent signal indicates the presence of
the flanking genomic/transgene insert sequence due to successful
amplification and hybridization. Such a molecular beacon assay for
detection of as an amplification reaction is an embodiment of the
subject disclosure.
[0197] Hydrolysis probe assay, otherwise known as TAQMAN.RTM. (Life
Technologies, Foster City, Calif.), is a method of detecting and
quantifying the presence of a DNA sequence. Briefly, a FRET
oligonucleotide probe is designed with one oligo within the
transgene and one in the flanking genomic sequence for
event-specific detection. The FRET probe and PCR primers (one
primer in the insert DNA sequence and one in the flanking genomic
sequence) are cycled in the presence of a thermostable polymerase
and dNTPs. Hybridization of the FRET probe results in cleavage and
release of the fluorescent moiety away from the quenching moiety on
the FRET probe. A fluorescent signal indicates the presence of the
flanking/transgene insert sequence due to successful amplification
and hybridization. Such a hydrolysis probe assay for detection of
as an amplification reaction is an embodiment of the subject
disclosure.
[0198] KASPar assays are a method of detecting and quantifying the
presence of a DNA sequence. Briefly, the genomic DNA sample
comprising the a gene expression cassette inserted into the genome
of plants is screened using a polymerase chain reaction (PCR) based
assay known as a KASPAR.RTM. assay system. The KASPAR.RTM. assay
used in the practice of the subject disclosure can utilize a
KASPAR.RTM. PCR assay mixture which contains multiple primers. The
primers used in the PCR assay mixture can comprise at least one
forward primers and at least one reverse primer. The forward primer
contains a sequence corresponding to a specific region of the donor
DNA polynucleotide, and the reverse primer contains a sequence
corresponding to a specific region of the genomic sequence. In
addition, the primers used in the PCR assay mixture can comprise at
least one forward primers and at least one reverse primer. For
example, the KASPAR.RTM. PCR assay mixture can use two forward
primers corresponding to two different alleles and one reverse
primer. One of the forward primers contains a sequence
corresponding to specific region of the endogenous genomic
sequence. The second forward primer contains a sequence
corresponding to a specific region of the donor DNA polynucleotide.
The reverse primer contains a sequence corresponding to a specific
region of the genomic sequence. Such a KASPAR.RTM. assay for
detection of an amplification reaction is an embodiment of the
subject disclosure.
[0199] In some embodiments the fluorescent signal or fluorescent
dye is selected from the group consisting of a HEX fluorescent dye,
a FAM fluorescent dye, a JOE fluorescent dye, a TET fluorescent
dye, a Cy 3 fluorescent dye, a Cy 3.5 fluorescent dye, a Cy 5
fluorescent dye, a Cy 5.5 fluorescent dye, a Cy 7 fluorescent dye,
and a ROX fluorescent dye.
[0200] In other embodiments the amplification reaction is run using
suitable second fluorescent DNA dyes that are capable of staining
cellular DNA at a concentration range detectable by flow cytometry,
and have a fluorescent emission spectrum which is detectable by a
real time thermocycler. It should be appreciated by those of
ordinary skill in the art that other nucleic acid dyes are known
and are continually being identified. Any suitable nucleic acid dye
with appropriate excitation and emission spectra can be employed,
such as YO-PRO-1.RTM., SYTOX GREEN.RTM., SYBR GREEN I.RTM.,
SYTO11.RTM., SYTO12.RTM., SYTO13.RTM., BOBO.RTM., YOYO.RTM., and
TOTO.RTM.. In one embodiment, a second fluorescent DNA dye is
SYTO13.RTM. used at less than 10 .mu.M, less than 4 .mu.M, or less
than 2.7 .mu.M.
[0201] In further embodiments, Next Generation Sequencing (NGS) can
be used for confirming a gene expression cassette inserted into the
genome of plants. As described by Brautigma et al., 2010, DNA
sequence analysis can be used to determine the nucleotide sequence
of the isolated and amplified fragment. The amplified fragments can
be isolated and sub-cloned into a vector and sequenced using
chain-terminator method (also referred to as Sanger sequencing) or
Dye-terminator sequencing. In addition, the amplicon can be
sequenced with Next Generation Sequencing. NGS technologies do not
require the sub-cloning step, and multiple sequencing reads can be
completed in a single reaction. Three NGS platforms are
commercially available, the Genome Sequencer FLX from 454 Life
Sciences/Roche, the Illumina Genome Analyser from Solexa and
Applied Biosystems' SOLiD (acronym for: "Sequencing by Oligo
Ligation and Detection"). In addition, there are two single
molecule sequencing methods that are currently being developed.
These include the true Single Molecule Sequencing (ISMS) from
Helicos Bioscience and the Single Molecule Real Time sequencing
(SMRT) from Pacific Biosciences.
[0202] The Genome Sequencher FLX which is marketed by 454 Life
Sciences/Roche is a long read NGS, which uses emulsion PCR and
pyrosequencing to generate sequencing reads. DNA fragments of
300-800 bp or libraries containing fragments of 3-20 kbp can be
used. The reactions can produce over a million reads of about 250
to 400 bases per run for a total yield of 250 to 400 megabases.
This technology produces the longest reads but the total sequence
output per run is low compared to other NGS technologies.
[0203] The Illumina Genome Analyser which is marketed by Solexa is
a short read NGS which uses sequencing by synthesis approach with
fluorescent dye-labeled reversible terminator nucleotides and is
based on solid-phase bridge PCR. Construction of paired end
sequencing libraries containing DNA fragments of up to 10 kb can be
used. The reactions produce over 100 million short reads that are
35-76 bases in length. This data can produce from 3-6 gigabases per
run.
[0204] The Sequencing by Oligo Ligation and Detection (SOLiD)
system marketed by Applied Biosystems is a short read technology.
This NGS technology uses fragmented double stranded DNA that are up
to 10 kbp in length. The system uses sequencing by ligation of
dye-labelled oligonucleotide primers and emulsion PCR to generate
one billion short reads that result in a total sequence output of
up to 30 gigabases per run.
[0205] tSMS of Helicos Bioscience and SMRT of Pacific Biosciences
apply a different approach which uses single DNA molecules for the
sequence reactions. The tSMS Helicos system produces up to 800
million short reads that result in 21 gigabases per run. These
reactions are completed using fluorescent dye-labelled virtual
terminator nucleotides that is described as a "sequencing by
synthesis" approach.
[0206] The SMRT Next Generation Sequencing system marketed by
Pacific Biosciences uses a real time sequencing by synthesis. This
technology can produce reads of up to 1000 bp in length as a result
of not being limited by reversible terminators. Raw read throughput
that is equivalent to one-fold coverage of a diploid human genome
can be produced per day using this technology.
[0207] In another embodiment, the confirmation of a gene expression
cassette inserted into the genome of plants can be completed using
blotting assays, including Western blots, Northern blots, and
Southern blots. Such blotting assays are commonly used techniques
in biological research for the identification and quantification of
biological samples. These assays include first separating the
sample components in gels by an electrophoretic method, followed by
transfer of the electrophoretically separated components from the
gels to transfer membranes that are made of materials such as
nitrocellulose, polyvinylidene fluoride (PVDF), or Nylon. Analytes
can also be directly spotted on these supports or directed to
specific regions on the supports by applying vacuum, capillary
action, or pressure, without prior separation. The transfer
membranes are then commonly subjected to a post-transfer treatment
to enhance the ability of the analytes to be distinguished from
each other and detected, either visually or by automated
readers.
[0208] In a further embodiment the confirmation of a gene
expression cassette inserted into the genome of plants can be
completed using an ELISA assay, which uses a solid-phase enzyme
immunoassay to detect the presence of a substance, usually an
antigen, in a liquid sample or wet sample. Antigens from the sample
are attached to a surface of a plate. Then, a further specific
antibody is applied over the surface so it can bind to the antigen.
This antibody is linked to an enzyme, and, in the final step, a
substance containing the enzyme's substrate is added. The
subsequent reaction produces a detectable signal, most commonly a
color change in the substrate.
[0209] The present disclosure also encompasses seeds of the
transgenic plants described above wherein the seed comprises the
transgene or gene expression cassette. The present disclosure
further encompasses the progeny, clones, cell lines or cells of the
transgenic plants described above wherein said progeny, clone, cell
line or cell comprise the transgene or gene construct.
[0210] While the invention has been described with reference to
specific methods and embodiments, it will be appreciated that
various modifications and changes may be made without departing
from the invention.
EXAMPLES
Example 1: Identification of Regulatory Elements from Brassica
napus
[0211] Brassica napus gene regulatory elements were identified via
a microarray profiling approach. The regulatory elements were then
isolated and cloned to characterize the expression profile of the
regulatory elements for use in transgenic plants. Transgenic
Arabidopsis lines stably transformed with a Phiyfp gene and a pat
selectable marker gene were produced, and the transgene expression
levels and tissue specificity was assessed. As such, Brassica napus
regulatory elements were identified and characterized. Disclosed
for the first time are promoter and 3'-UTR regulatory elements for
use in gene expression constructs.
[0212] Microarray Profiling Approach
[0213] Developing Brassica napus seeds were collected from both a
transgenic homozygote line and untransformed wildtype plants at 15,
20, 25, 30, 35 and 42 days after pollination (DAP). Next, the seeds
were analyzed via a single-color, global gene expression profiling
design to determine global levels of gene expression for each of
the defined time points. Three identical replicates of individual
60-mer oligonucleotide arrays (Agilent Technologies Inc., Santa
Clara, Calif.) were hybridized with amplified, Cy3 labeled cRNA
from each sample. A custom designed 60-mer comprehensive
transcriptome-wide canola oligonucleotide array (eArray, Agilent
Technologies, Inc., Santa Clara, Calif.) was used to carry out the
hybridizations. The oligonucleotide array contains more than 37,000
different canola transcripts obtained from public data sources
(Agilent Technologies, Inc., Santa Clara, Calif.).
[0214] The 60-mer oligonucleotides were synthesized in-situ using
the SURE-PRINT.TM. technology from the manufacturer (Agilent
Technologies, Inc., Santa Clara, Calif.). To efficiently measure
the expression levels of each transcript, the oligonucleotides
present in the array were designed to be unique and specific for
each target to efficiently hybridize with the predicted target
sequence. Oligonucleotides that formed a duplex with more than one
transcript were eliminated from the array. Each oligonucleotide
also fulfilled the chemical and physical properties required for
optimal performance throughout microarray processing. In addition,
specific and unique oligonucleotides representing the newly
introduced genes as well as several other genes of interest were
also included in the custom designed canola oligonucleotide array.
These criteria were used to produce the custom designed 60-mer
comprehensive transcriptome-wide canola oligonucleotide array.
[0215] Samples of developing seeds were obtained at 15, 20, 25, 30,
35 and 42 days after pollination (DAP) from multiple plants of each
genotype (NEX710.RTM. wildtype and AnD9DS transgenic lines). The
seeds were frozen and pooled to be used as starting material for
RNA isolation and purification. For labeling, a total of 1.0 .mu.g
of purified total RNA from each sample was reverse transcribed,
amplified and labeled with Cy3-CTP following the Agilent One-Color
Microarray-Based Gene Expression QuickAmp Labeling Protocol.TM.
(Agilent, Santa Clara, Calif.). Oligonucleotide gene expression
arrays were hybridized using the Agilent Technologies Gene
Expression Hybridization Kit.TM. and WASH BUFFER KIT.TM. (Agilent,
Santa Clara, Calif.). Hybridizations were carried out on a fully
automated TECAN H54800 PRO.TM. (TECAN, Research Triangle Park,
N.C.) hybridization station.
[0216] After scanning and feature extraction, raw data files were
uploaded into GeneSpring GX version 10.0.2.TM. (Agilent
Technologies, Santa Clara, Calif.). Quality control on samples
based on spike-in controls was performed to ensure that the
generated data was of sufficient quality before generating a report
by GENESPRING.RTM.. Next, the resulting data was normalized using a
global percentile shift normalization method to minimize systematic
non-biological differences and standardize arrays for cross
comparisons. The normalized data was then filtered by selecting
entities that were flagged as "Present" in every single sample
under study, and eliminating entities flagged as "Marginal" or
"Absent." The normalized and filtered list of entities was used as
input for statistical analysis using a two-way ANOVA method with a
corrected p-value cut-off of p<0.05 defining DAP and genotype as
parameters. The global gene expression profile of Brassica napus
seed development was defined for all time points in the study. An
additional set of selection criteria was applied to identify genes
that consistently expressed at high levels (>50,000 pixels/spot)
in all samples during early Brassica napus seed development.
[0217] Additional genes were manually selected based upon gene
annotation to bring the total candidate pool to 88 targets. To
refine this pool, the expression level was verified against known
oils biosynthetic gene expression levels with quantitative Real
Time Polymerase Chain Reaction (RT-qPCR). RNA from the 15 and 20
DAP timepoints was examined, as was total RNA extracted and
purified from young canola leaves. cDNA synthesis for RT-qPCR was
conducted with SUPERSCRIPTIII.TM. (Invitrogen, Carlsbad, Calif.).
Real Time PCR reactions were carried out on a LIGHTCYCLER.RTM. 480
instrument (Roche, Indianapolis, Ind.) using AbGene Absolute Blue
SYBR green master Mix.TM. (Thermo Fisher). Primers for RT-qPCR were
designed using PRIMER3.TM. (MIT, Cambridge, Mass.). Primers were
designed to an optimal Tm of 60 C. Amplicon sizes ranged from
100-224 bp. Primers were selected to produce an amplicon in the 3'
region of the transcribed target sequence. For normalization
purposes, 4 endogenous oils biosynthetic genes were also measured,
including BnACP05 (acyl-carrier protein), BnKCS (ketoacyl-CoA
synthase), BnKASIII (ketoacyl-ACP synthase), and BnSAD
(stearoyl-ACP desaturase).
[0218] To further filter the candidate pool, genes which displayed
expression in early seeds higher than that of ACP05 (GenBank:
X16114.1) were selected. Genes also were required to exhibit
expression increases from leaf to early seed that were greater than
the seed/leaf expression differential of KASII (GenBank:
AF244520.1). These filters reduced the list of candidates down to a
specific gene for identification of a target promoter. Accordingly,
the microarray assay was used to identify promoter and 3'UTR gene
regulatory elements from Brassica napus that highly expressed cDNA
at 15 DAP, and was preferentially expressed in seed.
Example 2: Gene Regulatory Element Identification
[0219] A specific sequence was selected from the Brassica napus
microarray generated data using the screening parameters described
above. A PCR reaction was used to isolate the specific promoter and
3'UTR sequences from the Brassica napus c.v. Nex710. The PCR
primers were designed from the expressed sequence tag contig 27160,
assembled from publicly available ESTs Genbank: EV001081.1,
CD813186.1, ES989902.1 and EV088583.1), and the genomic contig
ctg7180009837416 from Brassica oleracea c.v. TO1000, identified as
having homology to the EST contig 27160. The extracted promoter and
3' UTR Brassica napus regulatory sequences were obtained and
further characterized via DNA sequencing. The promoter sequence of
the Brassica napus gene labeled as GALE1, from the Brassica napus
c.v. Nex710 genome is provided as a 1429 bp promoter sequence of
SEQ ID NO:1. The 500 bp 3'-UTR sequence is provided below as SEQ ID
NO:2.
TABLE-US-00003 SEQ ID NO: 1
caacaaaaatgcactttttcgccaaaaatacatttttcttcaaaaaccgc
aaaaatattttctgccaaacccgtaaaaatactatttttctgccgaaacg
taaaaaaaaatattttaattattttattaacaagtccacttggatgtaga
tgaaaatttaaaaaatgaaaagcaaacgaacatagttgcattcagatgat
tcatctggatgcatggacgaaatgaagaaacgaacaacacccatatagag
catctggataagacatctagatggatcattacaaaagaacagggcctaaa
catgtgagatgtttgaagcaatcagtcaaaagtaaccaccaaatcgaatt
atgaaagcgttgattggatggacaagtttaacaaccattgtttgattgga
caacgccgttatctaaacttttagtgtgctgtgtacatcattactatgaa
tcagttagttaaaaatattatggtcagtgaatgacagtaagattacttca
gaacttgagagatttaccgcaaaaagaaacacaataacgcgtaggaaaaa
tatcctctgttttttgcaattattctcgtagatttggttatcagtaggta
tcacgttttacaaaaatagaattacaatacatgccgcaagaaaaagactt
tctctttttaatttccccaatttggttatcagtattcagtaagtttcaca
tttttacaaaaatataaattaaaatacatactgcaagaaaaatacttttt
taatttcgccaatttggttatcagtagttttcacatttttacaaaaatat
aattaaaatataaactgcaacaaaaagacttatctttttaatttccccaa
tttggttatcagtattcagtaggtttcacatttacaaaaatattattaaa
atacatactgcaagaaacatacctttttaatttcgccaatctggttatca
gtagttttcacatttttacaaaaatagaattaaaatacaaactgcaacaa
aaagacttatctttttaatttccaccaataagttatttatttatttaatc
ctcccgtgaggaaaaagacaagattgaggatgaatatacgtaactgaaaa
ttgaggaaacagagccatcaacctttcaacacggatgatcatcatcatca
ctctctgccgcctttaaatagaaaccaacaaagacattcttgagcccaca
ctcactcctttcctatttcttcgctttgcgtgccttccttccttcttatc
tacttgtatcccacaaaaagctacttaataccatttaataaagaccccaa
ctttcttgtgtcttctctcttatcatcttcgctgtgatctctctgtctcc
ctctctcttatccaaaagattagtataaaaggatcgatctttccttgtgg
gttcttccataaaacttcgattctcgact SEQ ID NO: 2
Actttactctttctctctaatcgctcaatatacaaaagaaaagtgtttac
atacacacatcatatatagtttgcttttagtttccatgtaaccgaacggg
tctgtttacttctatgaataaaatagctagttgatgattctgttgattga
tacactctatggatagttcaagattttattacaatccaacgatgatttgt
atcaaatagagcccaccagatcaagaaagcatactccagaagcttttgtt
caatctaccatcagataacatatcaataaccatcttcatggtggaaccat
ctgcagcaaacccacacctcttcatttcttctatgagttcaactgaagcg
actacaccactacctccgagatgaactcggatcagtgtgttgtatgtaca
ctcatttggcgcaatcccatcctcctctcccatctttttaaacaacatat
ccgcttcagacagtgagcctttcttacacagtcctgcaatcattatggta
Example 3: Brassica napus Promoter and 3'UTR Construct
[0220] A gene expression cassette was constructed that was
comprised of the full-length Brassica napus GALE1 gene promoter of
SEQ ID NO:1, yellow fluorescent protein gene (Phiyfp; Shagin et
al., (2004) Mol Biol Evol 21; 841-50) which contains the Solanum
tuberosum, light specific tissue inducible LS-1 gene (ST-LS1
intron; Genbank Acc No. X04753), and the Brassica napus GALE13'UTR
of SEQ ID NO:2 using standard recombinant DNA techniques. This gene
expression cassette was flanked by att sites. Next, a GATEWAY.RTM.
LR CLONASE II.RTM. (Life Technologies, Carlsbad, Calif.) reaction
was performed with the resulting entry plasmid containing the yfp
gene expression cassette, under the control of the Brassica napus
GALE1 gene promoter and terminated by the Brassica napus GALE1 gene
3' UTR, and a destination vector leading to a final expression
vector, pDAB113903. The destination vector contained a selectable
marker cassette comprised of a pat gene (Wohlleben et al., Gene
70:25-37; 1988) driven by the Cassava vein mosaic virus promoter
(CsVMV promoter; Verdaguer et al., Plant Molecular Biology
31:1129-1139; 1996) and terminated by an Agrobacterium tumefaciens
open reading frame 13'-UTR (AtuORF13'UTR; Huang et al., J.
Bacteriol. 172:1814-1822; 1990). The resulting construct,
pDAB113903 is a heterologous expression construct that contains an
yfp gene expression cassette (SEQ ID NO:3) and a pat gene
expression construct (SEQ ID NO:4) is presented as a plasmid map in
FIG. 1.
TABLE-US-00004 (provides the nucleic acid sequence for the yellow
fluorescent protein gene expression cassette from pDAB113903) SEQ
ID NO: 3 caacaaaaatgcactttttcgccaaaaatacatttttcttcaaaaaccgc
aaaaatattttctgccaaacccgtaaaaatactatttttctgccgaaacg
taaaaaaaaatattttaattattttattaacaagtccacttggatgtaga
tgaaaatttaaaaaatgaaaagcaaacgaacatagttgcattcagatgat
tcatctggatgcatggacgaaatgaagaaacgaacaacacccatatagag
catctggataagacatctagatggatcattacaaaagaacagggcctaaa
catgtgagatgtttgaagcaatcagtcaaaagtaaccaccaaatcgaatt
atgaaagcgttgattggatggacaagtttaacaaccattgtttgattgga
caacgccgttatctaaacttttagtgtgctgtgtacatcattactatgaa
tcagttagttaaaaatattatggtcagtgaatgacagtaagattacttca
gaacttgagagatttaccgcaaaaagaaacacaataacgcgtaggaaaaa
tatcctctgttttttgcaattattctcgtagatttggttatcagtaggta
tcacgttttacaaaaatagaattacaatacatgccgcaagaaaaagactt
tctctttttaatttccccaatttggttatcagtattcagtaagtttcaca
tttttacaaaaatataaattaaaatacatactgcaagaaaaatacttttt
taatttcgccaatttggttatcagtagttttcacatttttacaaaaatat
aattaaaatataaactgcaacaaaaagacttatctttttaatttccccaa
tttggttatcagtattcagtaggtttcacatttacaaaaatattattaaa
atacatactgcaagaaacatacctttttaatttcgccaatctggttatca
gtagttttcacatttttacaaaaatagaattaaaatacaaactgcaacaa
aaagacttatctttttaatttccaccaataagttatttatttatttaatc
ctcccgtgaggaaaaagacaagattgaggatgaatatacgtaactgaaaa
ttgaggaaacagagccatcaacctttcaacacggatgatcatcatcatca
ctctctgccgcctttaaatagaaaccaacaaagacattcttgagcccaca
ctcactcctttcctatttcttcgctttgcgtgccttccttccttcttatc
tacttgtatcccacaaaaagctacttaataccatttaataaagaccccaa
ctttcttgtgtcttctctcttatcatcttcgctgtgatctctctgtctcc
ctctctcttatccaaaagattagtataaaaggatcgatctttccttgtgg
gttcttccataaaacttcgattctcgactggatctccatgtcatctggag
cacttctctttcatgggaagattccttacgttgtggagatggaagggaat
gttgatggccacacctttagcatacgtgggaaaggctacggagatgcctc
agtgggaaaggtatgtttctgcttctacctttgatatatatataataatt
atcactaattagtagtaatatagtatttcaagtatttttttcaaaataaa
agaatgtagtatatagctattgcttttctgtagtttataagtgtgtatat
tttaatttataacttttctaatatatgaccaaaacatggtgatgtgcagg
ttgatgcacaattcatctgtactaccggagatgttcctgtgccttggagc
acacttgtcaccactctcacctatggagcacagtgctttgccaagtatgg
tccagagttgaaggacttctacaagtcctgtatgccagatggctatgtgc
aagagcgcacaatcacctttgaaggagatggcaacttcaagactagggct
gaagtcacctttgagaatgggtctgtctacaatagggtcaaactcaatgg
tcaaggcttcaagaaagatggtcacgtgttgggaaagaacttggagttca
acttcactccccactgcctctacatctggggagaccaagccaaccacggt
ctcaagtcagccttcaagatatgtcatgagattactggcagcaaaggcga
cttcatagtggctgaccacacccagatgaacactcccattggtggaggtc
cagttcatgttccagagtatcatcatatgtcttaccatgtgaaactttcc
aaagatgtgacagaccacagagacaacatgagcttgaaagaaactgtcag
agctgttgactgtcgcaagacctacctttgagtagttagcttaatcacct
agagctcggtcaccactttactctttctctctaatcgctcaatatacaaa
agaaaagtgtttacatacacacatcatatatagtttgcttttagtttcca
tgtaaccgaacgggtctgtttacttctatgaataaaatagctagttgatg
attctgttgattgatacactctatggatagttcaagattttattacaatc
caacgatgatttgtatcaaatagagcccaccagatcaagaaagcatactc
cagaagcttttgttcaatctaccatcagataacatatcaataaccatctt
catggtggaaccatctgcagcaaacccacacctcttcatttcttctatga
gttcaactgaagcgactacaccactacctccgagatgaactcggatcagt
gtgttgtatgtacactcatttggcgcaatcccatcctcctctcccatctt
tttaaacaacatatccgcttcagacagtgagcctttcttacacagtcctg caatcattatggta.
(provides the nucleic acid sequence for the phosphinothricin acetyl
transferase gene expression cassette from pDAB113903) SEQ ID NO: 4
ccagaaggtaattatccaagatgtagcatcaagaatccaatgtttacggg
aaaaactatggaagtattatgtaagctcagcaagaagcagatcaatatgc
ggcacatatgcaacctatgttcaaaaatgaagaatgtacagatacaagat
cctatactgccagaatacgaagaagaatacgtagaaattgaaaaagaaga
accaggcgaagaaaagaatcttgaagacgtaagcactgacgacaacaatg
aaaagaagaagataaggtcggtgattgtgaaagagacatagaggacacat
gtaaggtggaaaatgtaagggcggaaagtaaccttatcacaaaggaatct
tatcccccactacttatccttttatatttttccgtgtcatttttgccctt
gagttttcctatataaggaaccaagttcggcatttgtgaaaacaagaaaa
aatttggtgtaagctattttctttgaagtactgaggatacaacttcagag
aaatttgtaagtttgtaggtaccagatctggatcccaaaccatgtctccg
gagaggagaccagttgagattaggccagctacagcagctgatatggccgc
ggtttgtgatatcgttaaccattacattgagacgtctacagtgaacttta
ggacagagccacaaacaccacaagagtggattgatgatctagagaggttg
caagatagatacccttggttggttgctgaggttgagggtgttgtggctgg
tattgcttacgctgggccctggaaggctaggaacgcttacgattggacag
ttgagagtactgtttacgtgtcacataggcatcaaaggttgggcctagga
tctacattgtacacacatttgcttaagtctatggaggcgcaaggttttaa
gtctgtggttgctgttataggccttccaaacgatccatctgttaggttgc
atgaggctttgggatacacagcccggggtacattgcgcgcagctggatac
aagcatggtggatggcatgatgttggtttttggcaaagggattttgagtt
gccagctcctccaaggccagttaggccagttacccaaatctgagtagtta
gcttaatcacctagagctcgatcggcggcaatagcttcttagcgccatcc
cgggttgatcctatctgtgttgaaatagttgcggtgggcaaggctctctt
tcagaaagacaggcggccaaaggaacccaaggtgaggtgggctatggctc
tcagttccttgtggaagcgcttggtctaaggtgcagaggtgttagcggga
tgaagcaaaagtgtccgattgtaacaagatatgttgatcctacgtaagga
tattaaagtatgtattcatcactaatataatcagtgtattccaatatgta
ctacgatttccaatgtctttattgtcgccgtatgtaatcggcgtcacaaa
ataatccccggtgactttcttttaatccaggatgaaataatatgttatta
taatttttgcgatttggtccgttataggaattgaagtgtgcttgaggtcg
gtcgccaccactcccatttcataattttacatgtatttgaaaaataaaaa
tttatggtattcaatttaaacacgtatacttgtaaagaatgatatcttga
aagaaatatagtttaaatatttattgataaaataacaagtcaggtattat
agtccaagcaaaaacataaatttattgatgcaagtttaaattcagaaata
tttcaataactgattatatcagctggtacattgccgtagatgaaagactg
agtgcgatattatggtgtaatacatagg.
[0221] A positive control construct, pDAB9381, was assembled
containing a yellow fluorescent protein (yfp) gene expression
cassette, and a phosphinothricin acetyltransferase gene expression
cassette. Specifically, the yellow fluorescent protein gene
expression cassette contains the Arabidopsis thaliana Ubiquitin 10
gene promoter (At Ubi10 promoter; Callis et al., 1990, J Biol Chem
265:12486-12493), yellow fluorescence protein coding sequence
(PhiYFP; Shagin et al., 2004 Molecular Biology and Evolution,
21(5), 841-850) which contains the Solanum tuberosum, light
specific tissue inducible LS-1 gene (ST-LS1 intron; Genbank Acc No.
X04753), and is terminated with the Agrobacterium tumefaciens Open
Reading Frame 23 3' Untranslated Region (AtuORF23 3'UTR). The
selectable marker gene expression cassette contains the Cassava
vein Mosaic Virus Promoter (CsVMV promoter; Verdaguer et al., Plant
Molecular Biology 31:1129-1139; 1996), phosphinothricin acetyl
transferase (PAT; Wohlleben et al., Gene 70:25-37; 1988) and
Agrobacterium tumefaciens ORF13' untranslated region (AtuORF13'
UTR; Huang et al., J. Bacteriol. 172:1814-1822; 1990). The
resulting construct, pDAB9381 is a heterologous expression
construct that contains an yfp gene expression cassette (SEQ ID
NO:5) and a pat gene expression construct (SEQ ID NO:5) is
presented as FIG. 2.
TABLE-US-00005 (provides the nucleic acid sequence for the yellow
fluorescent protein gene expression cassette from pDAB9381) SEQ ID
NO: 5 gtcgacctgcaggtcaacggatcaggatattcttgtttaagatgttgaac
tctatggaggtttgtatgaactgatgatctaggaccggataagttccctt
cttcatagcgaacttattcaaagaatgttttgtgtatcattcttgttaca
ttgttattaatgaaaaaatattattggtcattggactgaacacgagtgtt
aaatatggaccaggccccaaataagatccattgatatatgaattaaataa
caagaataaatcgagtcaccaaaccacttgccttttttaacgagacttgt
tcaccaacttgatacaaaagtcattatcctatgcaaatcaataatcatac
aaaaatatccaataacactaaaaaattaaaagaaatggataatttcacaa
tatgttatacgataaagaagttacttttccaagaaattcactgattttat
aagcccacttgcattagataaatggcaaaaaaaaacaaaaaggaaaagaa
ataaagcacgaagaattctagaaaatacgaaatacgcttcaatgcagtgg
gacccacggttcaattattgccaattttcagctccaccgtatatttaaaa
aataaaacgataatgctaaaaaaatataaatcgtaacgatcgttaaatct
caacggctggatcttatgacgaccgttagaaattgtggttgtcgacgagt
cagtaataaacggcgtcaaagtggttgcagccggcacacacgagtcgtgt
ttatcaactcaaagcacaaatacttttcctcaacctaaaaataaggcaat
tagccaaaaacaactttgcgtgtaaacaacgctcaatacacgtgtcattt
tattattagctattgcttcaccgccttagctttctcgtgacctagtcgtc
ctcgtcttttcttcttcttcttctataaaacaatacccaaagcttcttct
tcacaattcagatttcaatttctcaaaatcttaaaaactttctctcaatt
ctctctaccgtgatcaaggtaaatttctgtgttccttattctctcaaaat
cttcgattttgttttcgttcgatcccaatttcgtatatgttctttggttt
agattctgttaatcttagatcgaagacgattttctgggtttgatcgttag
atatcatcttaattctcgattagggtttcataaatatcatccgatttgtt
caaataatttgagttttgtcgaataattactcttcgatttgtgatttcta
tctagatctggtgttagtttctagtttgtgcgatcgaatttgtcgattaa
tctgagtttttctgattaacagagatctccatgtcatctggagcacttct
ctttcatgggaagattccttacgttgtggagatggaagggaatgttgatg
gccacacctttagcatacgtgggaaaggctacggagatgcctcagtggga
aaggtatgtttctgcttctacctttgatatatatataataattatcacta
attagtagtaatatagtatttcaagtatttttttcaaaataaaagaatgt
agtatatagctattgcttttctgtagtttataagtgtgtatattttaatt
tataacttttctaatatatgaccaaaacatggtgatgtgcaggttgatgc
acaattcatctgtactaccggagatgttcctgtgccttggagcacacttg
tcaccactctcacctatggagcacagtgctttgccaagtatggtccagag
ttgaaggacttctacaagtcctgtatgccagatggctatgtgcaagagcg
cacaatcacctttgaaggagatggcaacttcaagactagggctgaagtca
cctttgagaatgggtctgtctacaatagggtcaaactcaatggtcaaggc
ttcaagaaagatggtcacgtgttgggaaagaacttggagttcaacttcac
tccccactgcctctacatctggggagaccaagccaaccacggtctcaagt
cagccttcaagatatgtcatgagattactggcagcaaaggcgacttcata
gtggctgaccacacccagatgaacactcccattggtggaggtccagttca
tgttccagagtatcatcatatgtcttaccatgtgaaactttccaaagatg
tgacagaccacagagacaacatgagcttgaaagaaactgtcagagctgtt
gactgtcgcaagacctacctttgagtagttagcttaatcacctagagctc
ggtcaccagcataatttttattaatgtactaaattactgttttgttaaat
gcaattttgctttctcgggattttaatatcaaaatctatttagaaataca
caatattttgttgcaggcttgctggagaatcgatctgctatcataaaaat
tacaaaaaaattttatttgcctcaattattttaggattggtattaaggac
gcttaaattatttgtcgggtcactacgcatcattgtgattgagaagatca
gcgatacgaaatattcgtagtactatcgataatttatttgaaaattcata
agaaaagcaaacgttacatgaattgatgaaacaatacaaagacagataaa
gccacgcacatttaggatattggccgagattactgaatattgagtaagat
cacggaatttctgacaggagcatgtcttcaattcagcccaaatggcagtt
gaaatactcaaaccgccccatatgcaggagcggatcattcattgtttgtt
tggttgcctttgccaacatgggagtccaaggtt (provides the nucleic acid
sequence for the phosphinothricin acetyl transferase gene
expression cassette from pDAB9381) SEQ ID NO: 6
ccagaaggtaattatccaagatgtagcatcaagaatccaatgtttacggg
aaaaactatggaagtattatgtaagctcagcaagaagcagatcaatatgc
ggcacatatgcaacctatgttcaaaaatgaagaatgtacagatacaagat
cctatactgccagaatacgaagaagaatacgtagaaattgaaaaagaaga
accaggcgaagaaaagaatcttgaagacgtaagcactgacgacaacaatg
aaaagaagaagataaggtcggtgattgtgaaagagacatagaggacacat
gtaaggtggaaaatgtaagggcggaaagtaaccttatcacaaaggaatct
tatcccccactacttatccttttatatttttccgtgtcatttttgccctt
gagttttcctatataaggaaccaagttcggcatttgtgaaaacaagaaaa
aatttggtgtaagctattttctttgaagtactgaggatacaacttcagag
aaatttgtaagtttgtaggtaccagatctggatcccaaaccatgtctccg
gagaggagaccagttgagattaggccagctacagcagctgatatggccgc
ggtttgtgatatcgttaaccattacattgagacgtctacagtgaacttta
ggacagagccacaaacaccacaagagtggattgatgatctagagaggttg
caagatagatacccttggttggttgctgaggttgagggtgttgtggctgg
tattgcttacgctgggccctggaaggctaggaacgcttacgattggacag
ttgagagtactgtttacgtgtcacataggcatcaaaggttgggcctagga
tctacattgtacacacatttgcttaagtctatggaggcgcaaggttttaa
gtctgtggttgctgttataggccttccaaacgatccatctgttaggttgc
atgaggctttgggatacacagcccggggtacattgcgcgcagctggatac
aagcatggtggatggcatgatgttggtttttggcaaagggattttgagtt
gccagctcctccaaggccagttaggccagttacccaaatctgagtagtta
gcttaatcacctagagctcgatcggcggcaatagcttcttagcgccatcc
cgggttgatcctatctgtgttgaaatagttgcggtgggcaaggctctctt
tcagaaagacaggcggccaaaggaacccaaggtgaggtgggctatggctc
tcagttccttgtggaagcgcttggtctaaggtgcagaggtgttagcggga
tgaagcaaaagtgtccgattgtaacaagatatgttgatcctacgtaagga
tattaaagtatgtattcatcactaatataatcagtgtattccaatatgta
ctacgatttccaatgtctttattgtcgccgtatgtaatcggcgtcacaaa
ataatccccggtgactttcttttaatccaggatgaaataatatgttatta
taatttttgcgatttggtccgttataggaattgaagtgtgcttgaggtcg
gtcgccaccactcccatttcataattttacatgtatttgaaaaataaaaa
tttatggtattcaatttaaacacgtatacttgtaaagaatgatatcttga
aagaaatatagtttaaatatttattgataaaataacaagtcaggtattat
agtccaagcaaaaacataaatttattgatgcaagtttaaattcagaaata
tttcaataactgattatatcagctggtacattgccgtagatgaaagactg
agtgcgatattatggtgtaatacatagg
Example 4: Plant Transformation and Molecular Confirmation
[0222] Agrobacterium Preparation
[0223] Next, 60 .mu.l of an Agrobacterium strain, in 50% glycerol
(previously prepared and frozen at -80.degree. C.), containing
either one of the above described binary plasmids, was used to
prepare a 5 ml starter culture of YEP liquid (BACTO PEPTONE.TM.10.0
gm/L, Yeast Extract 10.0 gm/L, and sodium chloride 5.0 gm/L)
containing spectinomycin (100 mg/L), kanamycin (50 mg/L), and
rifampicin (10 mg/L) and incubated for overnight at 28.degree. C.
with aeration. The Agrobacterium starter was then inoculated into
300 mL YEP liquid with spectinomycin (100 mg/L), kanamycin (50
mg/L), and rifampicin (10 mg/L) into sterile 500 mL baffled
flask(s) and shaken at 200 rpm at 28.degree. C. overnight. The
cultures were centrifuged at 6000 rpm and resuspended in an equal
volume of 1/2.times.MS-medium containing 10% (w/v) sucrose, 10 ug/L
6-benzylaminopurine, and 0.03% Silwet L-77 prior to transformation
of plant tissue.
[0224] Arabidopsis Transformation
[0225] Arabidopsis was transformed using the floral dip method
adapted from Clough and Bent (1998). A validated Agrobacterium
glycerol stock containing one of the binary plasmids described
above was used to inoculate a 5 mL pre-culture of YEP broth
containing spectinomycin (100 mg/L), kanamycin (50 mg/L), and
rifampicin (10 mg/L). The culture was incubated overnight at
28.degree. C. with aeration. The pre-culture was then bulked up to
300 mL with the same antibiotic selection and incubated again at
28.degree. C. with constant agitation at 225 rpm. The cells were
pelleted at approximately 5,000.times.g for 15 minutes at 4.degree.
C., and the supernatant discarded. The cell pellet was gently
resuspended in 300 mL inoculation medium containing: 10% (w/v)
sucrose, 10 ug/L 6-benzylaminopurine, and 0.03% Silwet L-77. Plants
at 41 days old (primary inflorescences cut back at 35 days) were
inverted and dipped into the medium. The plants (now denoted as
T.sub.0) were placed on their sides in a transparent covered
plastic tub overnight, and then set upright in the growth chamber
the following day. The plants were grown at 22.degree. C., with a
16-hour light/8-hour dark photoperiod. Four weeks after dipping,
the water was cut off and plants were allowed to dry down for a
week in preparation for T.sub.1 seed harvesting.
[0226] T.sub.1 seed was sown on 10.5''.times.21'' germination
trays, each receiving a 200 mg aliquots of stratified T.sub.1 seed
(40,000 seed) that had previously been suspended in 40 mL of 0.1%
agar solution and stored at 4.degree. C. for 2 days to ensure
synchronous seed germination (vernalization).
[0227] Sunshine Mix LP5 soil media was covered with fine
vermiculite and subirrigated with Hoagland's solution until wet,
then allowed to gravity drain. Each 40 mL aliquot of stratified
seed was sown evenly onto the vermiculite with a pipette and
covered with humidity domes for 4-5 days. Domes were removed 1 day
prior to initial transformant selection using glufosinate
(Liberty).
[0228] Seven days after planting (DAP) and again at 9 DAP, T.sub.1
plants (cotyledon and 2-4-1f stage, respectively) were sprayed with
a 0.2% solution of Liberty herbicide (200 g ai/L glufosinate, Bayer
Crop Sciences, Kansas City, Mo.) at a spray volume of 10 ml/tray
(703 L/ha) using a DeVilbiss compressed air spray tip to deliver an
effective rate of 280 g ai/ha glufosinate per application.
Survivors (putative transformed plants actively growing) were
identified 3 days after the final spraying and transplanted
individually into 3-inch pots prepared with Sunshine Mix LP5 in the
greenhouse 7 days after the final spray selection (16 DAP). The
transplants were reared in the greenhouse (22.+-.5.degree. C.,
50.+-.30% RH, 14 h light:10 dark, minimum 500 .mu.E/m.sup.2 s.sup.1
natural+supplemental light). Molecular analysis was completed on
the surviving T.sub.1 plants to confirm that the pat herbicide
selectable marker gene had integrated into the genome of the
plants.
[0229] Molecular Confirmation
[0230] Putative transgenic Arabidopsis plants were sampled for
detection of transgene presence using a quantitative PCR assay for
pat. Total DNA was extracted from the leaf samples, using
QIAGEN.RTM. BioSprint96 Kit DNA extraction kit (Qiagen, Valencia,
Calif.) as per manufacturer's instructions.
[0231] To detect the genes of interest, gene-specific DNA fragments
were amplified with hydrolysis (analogous to TAQMAN.RTM.)
primer/probe sets containing a Cy5-labeled fluorescent probe for
the pat gene and a HEX-labeled fluorescent probe for the endogenous
TafII-15 reference gene control (Genbank ID: NC 003075; Duarte et
al., BMC Evol. Biol., 10:61). The following primers were used for
the pat and endogenous TafII-15 reference gene amplifications. The
primer sequences were as follows:
TABLE-US-00006 pat Primers/Probes: Pat Forward Primer: TQPATS: (SEQ
ID NO: 7) ACAAGAGTGGATTGATGATCTAGAGAGGT Pat Reverse Primer: TQPATA:
(SEQ ID NO: 8) CTTTGATGCCTATGTGACACGTAAACAGT Pat Probe: (SEQ ID NO:
9) 5'-/5Cy5/AGGGTGTTGTGGCTGGTATTGCTTACGCT/3BHQ_2/-3' TafII-15
Primers/Probes: Forward Primer: TafII-15 F: (SEQ ID NO: 10)
GAGGATTAGGGTTTCAACGGAG Reverse Primer: TafII-15 R: (SEQ ID NO: 11)
GAGAATTGAGCTGAGACGAGG TafII-15 Probe: (SEQ ID NO: 12)
5'-/5HEX/AGAGAAGTTTCGACGGATTTCGGGC/3BHQ_2/-3'
[0232] Next, the qPCR reactions were carried out in a final volume
of 10 .mu.l reaction containing 5 .mu.l of Roche LIGHTCYCLER.RTM.
480 Probes Master Mix (Roche Applied Sciences, Indianapolis, Ind.);
0.4 .mu.l each of TQPATA, TQPATS, TafII-15 F and TafII-15 R primers
from 10 .mu.M stocks to a final concentration of 400 nM; 0.4 .mu.l
each of Pat Probe and TafII-15 Probe from 5 .mu.M stocks to a final
concentration of 200 nM, 2 .mu.l of genomic DNA diluted 1:5 in
water, and 0.5 .mu.l water. The DNA was amplified in a Roche
LIGHTCYCLER.RTM. 480 System under the following conditions: 1 cycle
of 95.degree. C. for 10 min followed by 40 cycles of the following
3-steps: 95.degree. C. for 10 seconds; 60.degree. C. for 40 seconds
and 72.degree. C. for 1 second. The pat copy number was determined
by comparison of Target (gene of interest)/Reference (Invertase
gene) values for unknown samples (output by the LIGHTCYCLER.RTM.
480) to Target/Reference values of pat copy number controls.
[0233] From the molecular confirmation, specific Arabidopsis
transgenic events that contained a single transgene insert of the
above described plasmids were identified. These plants were
self-fertilized, and the resulting T.sub.1 seed was planted to
monitor and assay T.sub.1 seedlings for YFP protein expression in
different plant tissues at different developmental stages.
Example 5: Transgenic Plant Expression Screening
[0234] The Arabidopsis T.sub.1 transgenic events were grown into
seedlings and assessed for YFP fluorescence at 15 DAP via
fluorescent microscopy and visual observation. Additional,
observation of the Arabidopsis T.sub.1 transgenic events was
completed a 7 weeks after planting, wherein the leaves,
inflorescences and siliques were viewed via fluorescent microscopy
and visual observation. Finally, observation of the Arabidopsis
T.sub.1 transgenic events was completed a 10 weeks after planting,
wherein the developing seedlings were viewed via fluorescent
microscopy and visual observation. Seedlings and developing seeds
were imaged using a Leica DFC310 FX Stereoscope.TM. (Leica, Buffalo
Grove, Ill.) with the following settings (e.g., excitation max--525
nm and emission max--482 nm). Leaves, inflorescences and siliques
were imaged using the TYPHOON SCANNER.TM.' (GE Healthcare Life
Sciences, Piscataway, N.J.) with the following settings (e.g., Blue
488 nm laser, 670 BP 30 for chllorophyll, 520 BP 40 for Phiyfp, 350
PMT).
[0235] The YFP imaging of T.sub.1 seedlings and plant tissues
indicated that seed preferential expression of the protein
expressed under the control of the Brassica napus GALE1 gene
promoter and terminated by the Brassica napus GALE1 gene 3' UTR was
detected in single copy events. Visual observations suggest that
expression driven by these regulatory elements is specific to early
seed development, and early floral development. As such, the
expression pattern driven by the Brassica napus GALE1 regulatory
elements was observed within the ovules of developing
inflorescences (FIG. 3). The expression of the YFP protein tissue
is most likely localized within endosperm tissues during the
development of seed within Arabidopsis plants. The expression in
the endosperm tissue is significant, as this tissue type makes up
the majority of seed tissues during early seed development. Further
expression of the YFP protein was observed in the flowers, stems,
leaves, and seeds of transgenic events containing multiple copies
of the yfp transgene.
Example 6: Expression Protein Quantification in Arabidopsis
[0236] Samples of the Arabidopsis plant seeds were assayed via
PhiYFP ELISA seeds were collected and subjected to bead-milling.
About 10 mg of seed material was beat with 2 BBs (4.5 mm steel
balls; Daisy; Rogers, Ark.) for 1 minute in a KLECCO.TM. bead mil
300 .mu.l of extraction buffer (PBS supplemented with 0.05.degree.
4) Tween20 and 0.05%) bovine serum albumin was added. The samples
were suspended with gentle tapping and rocked on a platform shaker
for 30 minutes at room temperature. The samples were then spun down
in a centrifuge at 14,000.times.g for 5 minutes. The supernatant
was removed and analyzed via ELISA. Maxisorb Plates.TM. (Thermo
Fisher Scientific) were coated with an anti-YFP monoclonal antibody
(Origene #TA150028) at a concentration of 1.0 .mu.g/ml in
1.times.PBS. Following overnight incubation at 4.degree. C., plates
were blocked with PBST (PBS+0.5% TWEEN.RTM.-20) with 0.5% bovine
serum albumin for 2 hours at 37.degree. C. Prior to analysis,
plates were washed 4 times in a plate washer using 350 .mu.l of
PBST per wash. A purified protein reference antigen (Evrogen) was
diluted in blocking buffer to 2 ng/ml and used to generate a
standard curve of serial dilutions from 2 ng/ml to 0.0313 ng/ml.
Samples were diluted in blocking buffer to a starting dilution of
1:4 and diluted at a 1:4 rate 3 additional times (1:4, 1:16, 1:64,
1:256). Next, 100 .mu.l of all standards and sample dilutions were
loaded in duplicate onto the ELISA plate. Samples were incubated on
the ELISA plate at room temperature for 1 hour. Following
incubation, the plate was washed as above. A rabbit anti-PhiYFP
polyclonal antibody (Evrogen) was diluted to 1 .mu.g/ml in blocking
buffer and added to the plate at 100 .mu.l per well. The plate was
incubated at room temperature for 1 hour prior to washing. An
anti-rabbit horseradish peroxidase conjugated detection antibody
(Pierce) was added to the plate at a 1:5000 dilution. The plate was
incubated at room temperature for 1 hour and washed as above. Next,
1-Step Ultra TMB Substrate.TM. (Thermo Scientific) was added to the
plate at 100 .mu.l per well. As the wells with the lowest dilution
of the standard curve began to show blue color, the reaction was
stopped by adding 50 .mu.l of stop solution (0.4 N H2504). The
plate was read in a plate reader (Molecular Devices) using
SOFTMAX.RTM. Pro v5 (Molecular Devices) at a wavelength of 450 nm
minus a 650 nm reference. The PhiYFP concentration of test samples
was calculated by linear regression of a quadratic standard
curve.
[0237] The expression levels of YFP were quantitated and are
provided in Table 1 below. The expression of YEP by the Brassica
napus GALE regulatory elements ranged from 0.018 to 0.070 ng/mg
within the Arabidopsis seed for the transgenic events containing
low copy number events (i.e., I-2 copies). Furthermore, the results
indicated that the average expression of the low copy number event
was about 0.047 ng/mg. Finally, expression of YFP by the Brassica
napus GALE regulatory elements was 6.341 ng/mg within the seed of
Arabidopsis for the transgenic events containing high copy number
events (i.e., more than 2 copies),
TABLE-US-00007 TABLE 1 Quantitated expression of YFP in Arabidopsis
seed. PAT copy YFP copy Expression of Average Expression Seed Name
number number YFP ng/mg seed ng/mg seed 113903[2]-004.sx001. 0.98
0.92 0.018 0.047 ng/mg for 113903[2]-017.sx001. 0.93 0.86 0.047
single copy events 113903[2]-019.sx001. 1.04 0.86 0.070
113903[2]-034.sx001. 0.98 0.84 0.053 113903[2]-023.sx001. 7.02 6.2
6.341 6.341 ng/mg for multiple copy events Wt Negative 0.00 0.00
0.000 0.0000 Wt Negative 0.00 0.00 0.000
[0238] As such, Brassica napus GALE gene regulatory elements were
identified and characterized. Disclosed for the first time are
novel promoter and 3'-UTR regulatory elements for use in gene
expression constructs.
Sequence CWU 1
1
1211429DNABrassica napus 1caacaaaaat gcactttttc gccaaaaata
catttttctt caaaaaccgc aaaaatattt 60tctgccaaac ccgtaaaaat actatttttc
tgccgaaacg taaaaaaaaa tattttaatt 120attttattaa caagtccact
tggatgtaga tgaaaattta aaaaatgaaa agcaaacgaa 180catagttgca
ttcagatgat tcatctggat gcatggacga aatgaagaaa cgaacaacac
240ccatatagag catctggata agacatctag atggatcatt acaaaagaac
agggcctaaa 300catgtgagat gtttgaagca atcagtcaaa agtaaccacc
aaatcgaatt atgaaagcgt 360tgattggatg gacaagttta acaaccattg
tttgattgga caacgccgtt atctaaactt 420ttagtgtgct gtgtacatca
ttactatgaa tcagttagtt aaaaatatta tggtcagtga 480atgacagtaa
gattacttca gaacttgaga gatttaccgc aaaaagaaac acaataacgc
540gtaggaaaaa tatcctctgt tttttgcaat tattctcgta gatttggtta
tcagtaggta 600tcacgtttta caaaaataga attacaatac atgccgcaag
aaaaagactt tctcttttta 660atttccccaa tttggttatc agtattcagt
aagtttcaca tttttacaaa aatataaatt 720aaaatacata ctgcaagaaa
aatacttttt taatttcgcc aatttggtta tcagtagttt 780tcacattttt
acaaaaatat aattaaaata taaactgcaa caaaaagact tatcttttta
840atttccccaa tttggttatc agtattcagt aggtttcaca tttacaaaaa
tattattaaa 900atacatactg caagaaacat acctttttaa tttcgccaat
ctggttatca gtagttttca 960catttttaca aaaatagaat taaaatacaa
actgcaacaa aaagacttat ctttttaatt 1020tccaccaata agttatttat
ttatttaatc ctcccgtgag gaaaaagaca agattgagga 1080tgaatatacg
taactgaaaa ttgaggaaac agagccatca acctttcaac acggatgatc
1140atcatcatca ctctctgccg cctttaaata gaaaccaaca aagacattct
tgagcccaca 1200ctcactcctt tcctatttct tcgctttgcg tgccttcctt
ccttcttatc tacttgtatc 1260ccacaaaaag ctacttaata ccatttaata
aagaccccaa ctttcttgtg tcttctctct 1320tatcatcttc gctgtgatct
ctctgtctcc ctctctctta tccaaaagat tagtataaaa 1380ggatcgatct
ttccttgtgg gttcttccat aaaacttcga ttctcgact 14292500DNABrassica
napus 2actttactct ttctctctaa tcgctcaata tacaaaagaa aagtgtttac
atacacacat 60catatatagt ttgcttttag tttccatgta accgaacggg tctgtttact
tctatgaata 120aaatagctag ttgatgattc tgttgattga tacactctat
ggatagttca agattttatt 180acaatccaac gatgatttgt atcaaataga
gcccaccaga tcaagaaagc atactccaga 240agcttttgtt caatctacca
tcagataaca tatcaataac catcttcatg gtggaaccat 300ctgcagcaaa
cccacacctc ttcatttctt ctatgagttc aactgaagcg actacaccac
360tacctccgag atgaactcgg atcagtgtgt tgtatgtaca ctcatttggc
gcaatcccat 420cctcctctcc catcttttta aacaacatat ccgcttcaga
cagtgagcct ttcttacaca 480gtcctgcaat cattatggta
50032864DNAartificial sequenceyellow fluorescent protein gene
expression cassette from pDAB113903 3caacaaaaat gcactttttc
gccaaaaata catttttctt caaaaaccgc aaaaatattt 60tctgccaaac ccgtaaaaat
actatttttc tgccgaaacg taaaaaaaaa tattttaatt 120attttattaa
caagtccact tggatgtaga tgaaaattta aaaaatgaaa agcaaacgaa
180catagttgca ttcagatgat tcatctggat gcatggacga aatgaagaaa
cgaacaacac 240ccatatagag catctggata agacatctag atggatcatt
acaaaagaac agggcctaaa 300catgtgagat gtttgaagca atcagtcaaa
agtaaccacc aaatcgaatt atgaaagcgt 360tgattggatg gacaagttta
acaaccattg tttgattgga caacgccgtt atctaaactt 420ttagtgtgct
gtgtacatca ttactatgaa tcagttagtt aaaaatatta tggtcagtga
480atgacagtaa gattacttca gaacttgaga gatttaccgc aaaaagaaac
acaataacgc 540gtaggaaaaa tatcctctgt tttttgcaat tattctcgta
gatttggtta tcagtaggta 600tcacgtttta caaaaataga attacaatac
atgccgcaag aaaaagactt tctcttttta 660atttccccaa tttggttatc
agtattcagt aagtttcaca tttttacaaa aatataaatt 720aaaatacata
ctgcaagaaa aatacttttt taatttcgcc aatttggtta tcagtagttt
780tcacattttt acaaaaatat aattaaaata taaactgcaa caaaaagact
tatcttttta 840atttccccaa tttggttatc agtattcagt aggtttcaca
tttacaaaaa tattattaaa 900atacatactg caagaaacat acctttttaa
tttcgccaat ctggttatca gtagttttca 960catttttaca aaaatagaat
taaaatacaa actgcaacaa aaagacttat ctttttaatt 1020tccaccaata
agttatttat ttatttaatc ctcccgtgag gaaaaagaca agattgagga
1080tgaatatacg taactgaaaa ttgaggaaac agagccatca acctttcaac
acggatgatc 1140atcatcatca ctctctgccg cctttaaata gaaaccaaca
aagacattct tgagcccaca 1200ctcactcctt tcctatttct tcgctttgcg
tgccttcctt ccttcttatc tacttgtatc 1260ccacaaaaag ctacttaata
ccatttaata aagaccccaa ctttcttgtg tcttctctct 1320tatcatcttc
gctgtgatct ctctgtctcc ctctctctta tccaaaagat tagtataaaa
1380ggatcgatct ttccttgtgg gttcttccat aaaacttcga ttctcgactg
gatctccatg 1440tcatctggag cacttctctt tcatgggaag attccttacg
ttgtggagat ggaagggaat 1500gttgatggcc acacctttag catacgtggg
aaaggctacg gagatgcctc agtgggaaag 1560gtatgtttct gcttctacct
ttgatatata tataataatt atcactaatt agtagtaata 1620tagtatttca
agtatttttt tcaaaataaa agaatgtagt atatagctat tgcttttctg
1680tagtttataa gtgtgtatat tttaatttat aacttttcta atatatgacc
aaaacatggt 1740gatgtgcagg ttgatgcaca attcatctgt actaccggag
atgttcctgt gccttggagc 1800acacttgtca ccactctcac ctatggagca
cagtgctttg ccaagtatgg tccagagttg 1860aaggacttct acaagtcctg
tatgccagat ggctatgtgc aagagcgcac aatcaccttt 1920gaaggagatg
gcaacttcaa gactagggct gaagtcacct ttgagaatgg gtctgtctac
1980aatagggtca aactcaatgg tcaaggcttc aagaaagatg gtcacgtgtt
gggaaagaac 2040ttggagttca acttcactcc ccactgcctc tacatctggg
gagaccaagc caaccacggt 2100ctcaagtcag ccttcaagat atgtcatgag
attactggca gcaaaggcga cttcatagtg 2160gctgaccaca cccagatgaa
cactcccatt ggtggaggtc cagttcatgt tccagagtat 2220catcatatgt
cttaccatgt gaaactttcc aaagatgtga cagaccacag agacaacatg
2280agcttgaaag aaactgtcag agctgttgac tgtcgcaaga cctacctttg
agtagttagc 2340ttaatcacct agagctcggt caccacttta ctctttctct
ctaatcgctc aatatacaaa 2400agaaaagtgt ttacatacac acatcatata
tagtttgctt ttagtttcca tgtaaccgaa 2460cgggtctgtt tacttctatg
aataaaatag ctagttgatg attctgttga ttgatacact 2520ctatggatag
ttcaagattt tattacaatc caacgatgat ttgtatcaaa tagagcccac 2580
cagatcaaga aagcatactc cagaagcttt tgttcaatct accatcagat aacatatcaa
2640taaccatctt catggtggaa ccatctgcag caaacccaca cctcttcatt
tcttctatga 2700gttcaactga agcgactaca ccactacctc cgagatgaac
tcggatcagt gtgttgtatg 2760tacactcatt tggcgcaatc ccatcctcct
ctcccatctt tttaaacaac atatccgctt 2820cagacagtga gcctttctta
cacagtcctg caatcattat ggta 286441828DNAartificial
sequencephosphinothricin acetyl transferase gene expression
cassette from pDAB113903 4ccagaaggta attatccaag atgtagcatc
aagaatccaa tgtttacggg aaaaactatg 60gaagtattat gtaagctcag caagaagcag
atcaatatgc ggcacatatg caacctatgt 120tcaaaaatga agaatgtaca
gatacaagat cctatactgc cagaatacga agaagaatac 180gtagaaattg
aaaaagaaga accaggcgaa gaaaagaatc ttgaagacgt aagcactgac
240gacaacaatg aaaagaagaa gataaggtcg gtgattgtga aagagacata
gaggacacat 300gtaaggtgga aaatgtaagg gcggaaagta accttatcac
aaaggaatct tatcccccac 360tacttatcct tttatatttt tccgtgtcat
ttttgccctt gagttttcct atataaggaa 420ccaagttcgg catttgtgaa
aacaagaaaa aatttggtgt aagctatttt ctttgaagta 480ctgaggatac
aacttcagag aaatttgtaa gtttgtaggt accagatctg gatcccaaac
540catgtctccg gagaggagac cagttgagat taggccagct acagcagctg
atatggccgc 600ggtttgtgat atcgttaacc attacattga gacgtctaca
gtgaacttta ggacagagcc 660acaaacacca caagagtgga ttgatgatct
agagaggttg caagatagat acccttggtt 720ggttgctgag gttgagggtg
ttgtggctgg tattgcttac gctgggccct ggaaggctag 780gaacgcttac
gattggacag ttgagagtac tgtttacgtg tcacataggc atcaaaggtt
840gggcctagga tctacattgt acacacattt gcttaagtct atggaggcgc
aaggttttaa 900gtctgtggtt gctgttatag gccttccaaa cgatccatct
gttaggttgc atgaggcttt 960gggatacaca gcccggggta cattgcgcgc
agctggatac aagcatggtg gatggcatga 1020tgttggtttt tggcaaaggg
attttgagtt gccagctcct ccaaggccag ttaggccagt 1080tacccaaatc
tgagtagtta gcttaatcac ctagagctcg atcggcggca atagcttctt
1140agcgccatcc cgggttgatc ctatctgtgt tgaaatagtt gcggtgggca
aggctctctt 1200tcagaaagac aggcggccaa aggaacccaa ggtgaggtgg
gctatggctc tcagttcctt 1260gtggaagcgc ttggtctaag gtgcagaggt
gttagcggga tgaagcaaaa gtgtccgatt 1320gtaacaagat atgttgatcc
tacgtaagga tattaaagta tgtattcatc actaatataa 1380tcagtgtatt
ccaatatgta ctacgatttc caatgtcttt attgtcgccg tatgtaatcg
1440gcgtcacaaa ataatccccg gtgactttct tttaatccag gatgaaataa
tatgttatta 1500taatttttgc gatttggtcc gttataggaa ttgaagtgtg
cttgaggtcg gtcgccacca 1560ctcccatttc ataattttac atgtatttga
aaaataaaaa tttatggtat tcaatttaaa 1620cacgtatact tgtaaagaat
gatatcttga aagaaatata gtttaaatat ttattgataa 1680aataacaagt
caggtattat agtccaagca aaaacataaa tttattgatg caagtttaaa
1740ttcagaaata tttcaataac tgattatatc agctggtaca ttgccgtaga
tgaaagactg 1800agtgcgatat tatggtgtaa tacatagg
182852783DNAartificial sequenceyellow fluorescent protein gene
expression cassette from pDAB9381 5gtcgacctgc aggtcaacgg atcaggatat
tcttgtttaa gatgttgaac tctatggagg 60tttgtatgaa ctgatgatct aggaccggat
aagttccctt cttcatagcg aacttattca 120aagaatgttt tgtgtatcat
tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180ttggactgaa
cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg
240aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa
cgagacttgt 300tcaccaactt gatacaaaag tcattatcct atgcaaatca
ataatcatac aaaaatatcc 360aataacacta aaaaattaaa agaaatggat
aatttcacaa tatgttatac gataaagaag 420ttacttttcc aagaaattca
ctgattttat aagcccactt gcattagata aatggcaaaa 480aaaaacaaaa
aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc
540aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt
atatttaaaa 600aataaaacga taatgctaaa aaaatataaa tcgtaacgat
cgttaaatct caacggctgg 660atcttatgac gaccgttaga aattgtggtt
gtcgacgagt cagtaataaa cggcgtcaaa 720gtggttgcag ccggcacaca
cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780caacctaaaa
ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca
840cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga
cctagtcgtc 900ctcgtctttt cttcttcttc ttctataaaa caatacccaa
agcttcttct tcacaattca 960gatttcaatt tctcaaaatc ttaaaaactt
tctctcaatt ctctctaccg tgatcaaggt 1020aaatttctgt gttccttatt
ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080tcgtatatgt
tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt
1140tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat
ccgatttgtt 1200caaataattt gagttttgtc gaataattac tcttcgattt
gtgatttcta tctagatctg 1260gtgttagttt ctagtttgtg cgatcgaatt
tgtcgattaa tctgagtttt tctgattaac 1320agagatctcc atgtcatctg
gagcacttct ctttcatggg aagattcctt acgttgtgga 1380gatggaaggg
aatgttgatg gccacacctt tagcatacgt gggaaaggct acggagatgc
1440ctcagtggga aaggtatgtt tctgcttcta cctttgatat atatataata
attatcacta 1500attagtagta atatagtatt tcaagtattt ttttcaaaat
aaaagaatgt agtatatagc 1560tattgctttt ctgtagttta taagtgtgta
tattttaatt tataactttt ctaatatatg 1620accaaaacat ggtgatgtgc
aggttgatgc acaattcatc tgtactaccg gagatgttcc 1680tgtgccttgg
agcacacttg tcaccactct cacctatgga gcacagtgct ttgccaagta
1740tggtccagag ttgaaggact tctacaagtc ctgtatgcca gatggctatg
tgcaagagcg 1800cacaatcacc tttgaaggag atggcaactt caagactagg
gctgaagtca cctttgagaa 1860tgggtctgtc tacaataggg tcaaactcaa
tggtcaaggc ttcaagaaag atggtcacgt 1920gttgggaaag aacttggagt
tcaacttcac tccccactgc ctctacatct ggggagacca 1980agccaaccac
ggtctcaagt cagccttcaa gatatgtcat gagattactg gcagcaaagg
2040cgacttcata gtggctgacc acacccagat gaacactccc attggtggag
gtccagttca 2100tgttccagag tatcatcata tgtcttacca tgtgaaactt
tccaaagatg tgacagacca 2160cagagacaac atgagcttga aagaaactgt
cagagctgtt gactgtcgca agacctacct 2220ttgagtagtt agcttaatca
cctagagctc ggtcaccagc ataattttta ttaatgtact 2280aaattactgt
tttgttaaat gcaattttgc tttctcggga ttttaatatc aaaatctatt
2340tagaaataca caatattttg ttgcaggctt gctggagaat cgatctgcta
tcataaaaat 2400tacaaaaaaa ttttatttgc ctcaattatt ttaggattgg
tattaaggac gcttaaatta 2460tttgtcgggt cactacgcat cattgtgatt
gagaagatca gcgatacgaa atattcgtag 2520tactatcgat aatttatttg
aaaattcata agaaaagcaa acgttacatg aattgatgaa 2580acaatacaaa
gacagataaa gccacgcaca tttaggatat tggccgagat tactgaatat
2640tgagtaagat cacggaattt ctgacaggag catgtcttca attcagccca
aatggcagtt 2700gaaatactca aaccgcccca tatgcaggag cggatcattc
attgtttgtt tggttgcctt 2760tgccaacatg ggagtccaag gtt
278361828DNAArtificial Sequencephosphinothricin acetyl transferase
gene expression cassette from pDAB9381 6ccagaaggta attatccaag
atgtagcatc aagaatccaa tgtttacggg aaaaactatg 60gaagtattat gtaagctcag
caagaagcag atcaatatgc ggcacatatg caacctatgt 120tcaaaaatga
agaatgtaca gatacaagat cctatactgc cagaatacga agaagaatac
180gtagaaattg aaaaagaaga accaggcgaa gaaaagaatc ttgaagacgt
aagcactgac 240gacaacaatg aaaagaagaa gataaggtcg gtgattgtga
aagagacata gaggacacat 300gtaaggtgga aaatgtaagg gcggaaagta
accttatcac aaaggaatct tatcccccac 360tacttatcct tttatatttt
tccgtgtcat ttttgccctt gagttttcct atataaggaa 420ccaagttcgg
catttgtgaa aacaagaaaa aatttggtgt aagctatttt ctttgaagta
480ctgaggatac aacttcagag aaatttgtaa gtttgtaggt accagatctg
gatcccaaac 540catgtctccg gagaggagac cagttgagat taggccagct
acagcagctg atatggccgc 600ggtttgtgat atcgttaacc attacattga
gacgtctaca gtgaacttta ggacagagcc 660acaaacacca caagagtgga
ttgatgatct agagaggttg caagatagat acccttggtt 720ggttgctgag
gttgagggtg ttgtggctgg tattgcttac gctgggccct ggaaggctag
780gaacgcttac gattggacag ttgagagtac tgtttacgtg tcacataggc
atcaaaggtt 840gggcctagga tctacattgt acacacattt gcttaagtct
atggaggcgc aaggttttaa 900gtctgtggtt gctgttatag gccttccaaa
cgatccatct gttaggttgc atgaggcttt 960gggatacaca gcccggggta
cattgcgcgc agctggatac aagcatggtg gatggcatga 1020tgttggtttt
tggcaaaggg attttgagtt gccagctcct ccaaggccag ttaggccagt
1080tacccaaatc tgagtagtta gcttaatcac ctagagctcg atcggcggca
atagcttctt 1140agcgccatcc cgggttgatc ctatctgtgt tgaaatagtt
gcggtgggca aggctctctt 1200tcagaaagac aggcggccaa aggaacccaa
ggtgaggtgg gctatggctc tcagttcctt 1260gtggaagcgc ttggtctaag
gtgcagaggt gttagcggga tgaagcaaaa gtgtccgatt 1320gtaacaagat
atgttgatcc tacgtaagga tattaaagta tgtattcatc actaatataa
1380tcagtgtatt ccaatatgta ctacgatttc caatgtcttt attgtcgccg
tatgtaatcg 1440gcgtcacaaa ataatccccg gtgactttct tttaatccag
gatgaaataa tatgttatta 1500taatttttgc gatttggtcc gttataggaa
ttgaagtgtg cttgaggtcg gtcgccacca 1560ctcccatttc ataattttac
atgtatttga aaaataaaaa tttatggtat tcaatttaaa 1620cacgtatact
tgtaaagaat gatatcttga aagaaatata gtttaaatat ttattgataa
1680aataacaagt caggtattat agtccaagca aaaacataaa tttattgatg
caagtttaaa 1740ttcagaaata tttcaataac tgattatatc agctggtaca
ttgccgtaga tgaaagactg 1800agtgcgatat tatggtgtaa tacatagg
1828729DNAartificial sequenceoligonucleotide primer 7acaagagtgg
attgatgatc tagagaggt 29829DNAartificial sequenceoligonucleotide
primer 8ctttgatgcc tatgtgacac gtaaacagt 29929DNAartificial
sequenceoligonucleotide probe 9agggtgttgt ggctggtatt gcttacgct
291022DNAartificial sequenceoligonucleotide primer 10gaggattagg
gtttcaacgg ag 221121DNAartificial sequenceoligonucleotide primer
11gagaattgag ctgagacgag g 211225DNAartificial
sequenceoligonucleotide probe 12agagaagttt cgacggattt cgggc 25
* * * * *