U.S. patent application number 15/407998 was filed with the patent office on 2017-10-05 for use of transposase and y adapters to fragment and tag dna.
The applicant listed for this patent is AGILENT TECHNOLOGIES, INC.. Invention is credited to Robert A. Ach, Brian Jon Peter, Nicholas M. Sampas.
Application Number | 20170283864 15/407998 |
Document ID | / |
Family ID | 59959199 |
Filed Date | 2017-10-05 |
United States Patent
Application |
20170283864 |
Kind Code |
A1 |
Ach; Robert A. ; et
al. |
October 5, 2017 |
USE OF TRANSPOSASE AND Y ADAPTERS TO FRAGMENT AND TAG DNA
Abstract
Described herein, among other things, is an adapter comprising a
population of first oligonucleotides, a second oligonucleotide and
a third oligonucleotide, wherein the first oligonucleotides, the
second oligonucleotide and the third oligonucleotide are hybridized
together to produce a complex that comprises: (i) a first end
comprising a transposase recognition sequence, (ii) a central
single-stranded region of variable sequence and (iii) a second end
comprising sequences that are non-complementary. A method, as well
as a kit for practicing the method, are also provided.
Inventors: |
Ach; Robert A.; (San
Francisco, CA) ; Sampas; Nicholas M.; (San Jose,
CA) ; Peter; Brian Jon; (Los Altos, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AGILENT TECHNOLOGIES, INC. |
Santa Clara |
CA |
US |
|
|
Family ID: |
59959199 |
Appl. No.: |
15/407998 |
Filed: |
January 17, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62316385 |
Mar 31, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6869 20130101;
C12Q 1/6806 20130101; C12Q 1/6848 20130101; C12Q 1/6869 20130101;
C12Q 1/6806 20130101; C12Q 2563/179 20130101; C12Q 2521/507
20130101; C12Q 2525/179 20130101; C12Q 2565/514 20130101; C12Q
2525/155 20130101; C12Q 2525/191 20130101; C12Q 1/6874 20130101;
C12Q 1/6855 20130101; C12Q 1/6855 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. An adapter comprising a population of first oligonucleotides, a
second oligonucleotide and a third oligonucleotide, wherein the
first oligonucleotides, the second oligonucleotide and the third
oligonucleotide are hybridized together to produce a complex that
comprises: (i) a first end comprising a transposase recognition
sequence, (ii) a central single-stranded region of variable
sequence and (iii) a second end comprising sequences that are
non-complementary.
2. The adaptor of claim 1, wherein: a) the population of first
oligonucleotides comprise a 5' region, a 3' region, and a region of
variable sequence between the 5' region and the 3' region; b) the
second oligonucleotide is complementary to and hybridizes with the
3' region of the first oligonucleotides to form the transposase
recognition sequence; and c) the third oligonucleotide comprises 5'
end that is complementary to and is hybridized with the 3' end of
the 3' region of the first oligonucleotide and comprises a 3' tail
that is non-complementary to the 5' end of the 3' region of the
first oligonucleotide.
3. The adaptor of claim 1, wherein the 5' end of the first
oligonucleotide and the 3' tail of the third oligonucleotide are in
a single molecule and joined together by a cleavable region.
4. The adaptor of claim 1, wherein the variable sequence has a
complexity of at least 1,000.
5. The adaptor of claim 1, wherein the first, second, and third
oligonucleotides are formed by allowing self-annealing of a single
oligonucleotide molecule of greater than 60 nucleotides, followed
by cleavage of cleavable sites located between the sequences
between the first and third oligonucleotides and between the
sequences of the second and third oligonucleotide.
6. The adaptor of claim 1, wherein the transposase recognition
sequence is the recognition sequence for a Vibhar transposase or
variant thereof.
7. The adaptor of claim 1, wherein the 3' tail of the third
oligonucleotide comprises a modification rendering the 3' end
resistant to digestion by a 3'-5' exonuclease activity.
8. A method for tagmenting a sample, comprising: contacting a
sample comprising double-stranded DNA with a transposase loaded
with the adaptor of claim 1; and filling in and sealing the central
single-stranded region of the adaptor using a polymerase and
ligase, thereby producing a population of DNA fragments that are
tagged at both ends by a Y adaptor each comprising the variable
sequence of a first oligonucleotide on both strands.
9. The method of claim 8, wherein the method is done by combining,
in a single reaction vessel, the sample, the transposase loaded
with the adaptor, the polymerase and the ligase.
10. The method of claim 8 wherein the filling in is done by
Sulfolobus DNA polymerase IV, at a temperature less than 50 degrees
Celsius.
11. The method of claim 8, wherein the method further comprises
amplifying the population of DNA fragments using primers that
target the arms of the Y adaptor.
12. The method of claim 11, wherein the amplifying is done in
solution.
13. The method of claim 11, wherein the amplifying is done by
bridge PCR.
14. The method of claim 8, further comprising sequencing at least
some of the tagged DNA fragments.
15. A kit comprising: a transposase; an adaptor of claim 1; and a
polymerase.
16. The kit of claim 15, wherein the transposase is loaded with the
adaptor.
17. The kit of claim 16, wherein the loaded transposase,
polymerase, and ligase are in a mix.
18. The kit of claim 15, wherein the kit further comprises a pair
of primers that are complementary to or the same as the
non-complementary sequences at the second end of the adaptor.
Description
CROSS-REFERENCING
[0001] This application claims the benefit of U.S. provisional
application Ser. No. 62/316,385, filed on Mar. 31, 2016, which
application is incorporated by reference herein.
BACKGROUND
[0002] Next-generation Sequencing (NGS) technologies have made
whole-genome sequencing (WGS) routine, and various target
enrichment methods have enabled researchers to focus sequencing
power on the most important regions of interest. However, there is
still a need for better methods for making NGS sequencing
libraries. For example, genomic DNA can be prepared for
next-generation sequencing (NGS) by "tagmentation", where the
transposase causes staggered double-stranded breaks in the genomic
DNA and simultaneously inserts small oligonucleotide tags on the
ends. However, one problem with this method is that it requires
that there be different tags on the two ends of any particular
fragment after tagmentation in order to get PCR amplification,
since fragments with the same sequences at both ends will not
adequately PCR due to suppression PCR effects. However, in many
methods, in order to get different sequences on the ends of a
fragment, two different sequences must be loaded onto the
transposase before tagmentation. Since each end gets randomly
tagged, there is a 50% chance that both ends of a fragment will
have the same sequence added. These fragments then get lost in PCR
and/or sequencing.
[0003] Further, all sequencing methods result in sequence reads
that contain errors, e.g., PCR errors and sequencing errors. Some
errors can be corrected, but when the amount of sample is limiting
(e.g., when there are only a handful of mutant molecules relative
to non-mutant molecules) it is often impossible to determine out
whether a variation in a sequence is caused by an error or if it is
a "real" mutation.
SUMMARY
[0004] Described herein, among other things, is an adapter
comprising a population of first oligonucleotides, a second
oligonucleotide and a third oligonucleotide, wherein the first
oligonucleotides, the second oligonucleotide and the third
oligonucleotide are hybridized together to produce a complex that
comprises: (i) a first end comprising a transposase recognition
sequence, (ii) a central single-stranded region of variable
sequence and (iii) a second end comprising sequences that are
non-complementary.
[0005] Also described herein, among other things, is method for
tagmenting a sample, comprising: contacting a sample comprising
double-stranded DNA with a transposase loaded with the present
adaptor; and filling in and sealing the central single-stranded
region of the adaptor using a polymerase and ligase, thereby
producing a population of DNA fragments that are tagged at both
ends by a Y adaptor each comprising the variable sequence of a
first oligonucleotide on both strands.
[0006] Kits for practicing the method are also provided. In certain
embodiments, a kit may comprise a transposase; the present adaptor;
and a polymerase.
[0007] The compositions, methods and kits described herein find
particular use in analyzing samples of DNA in which the amount of
DNA is limited and that contain fragments having a low copy number
mutation (e.g. a sequence caused by a mutation that is present at
low copy number relative to sequences that do not contain the
mutation). In such samples, the mutant sequences may only be
present at a very limited copy number (e.g., less than 10 in a
background of hundreds or thousands of copies of the wild type
sequence) and there is a need for those sequences to be efficiently
captured and tagged in a way that adds the same molecular barcode
to both strands of each tagged molecule. True mutations should be
at the same positions in both strands and, as such, the ability to
add the same barcode to both strands of an initial double-stranded
molecule allows the sequence reads derived from both strands of the
initial molecule to be identified and compared. The confidence that
a potential sequence variation is a true variation (rather than a
PCR or sequencing error) increases if it is present in both strands
of the same molecule.
BRIEF DESCRIPTION OF THE FIGURES
[0008] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0009] FIG. 1 schematically illustrates some of the features of the
present adaptor.
[0010] FIG. 2 schematically illustrates an embodiment of the
present adaptor.
[0011] FIG. 3 schematically illustrates how a barcode can be copied
from one strand to the other in the present adaptor, thereby
allowing the same barcode to be added to both strands during
tagmentation.
[0012] FIG. 4 schematically illustrates how the present adaptor can
be used to tag genomic DNA.
[0013] FIG. 5 schematically illustrates another embodiment of the
present adaptor, wherein the single stranded regions are joined to
form a loop region.
[0014] FIGS. 6A, 6B, and 6C schematically illustrate other
embodiments of the present adaptor, wherein the loop region
comprises a cleavage site.
[0015] FIG. 7 schematically illustrates how another embodiment of
the present adaptor can be constructed, allowing the same barcode
to be added to both strands during tagmentation.
[0016] FIG. 8 schematically illustrates an adaptor with single
stranded regions comprising cleavable sites and degenerate base
region (DBR) barcode denoted as "NNN."
DEFINITIONS
[0017] Before describing exemplary embodiments in greater detail,
the following definitions are set forth to illustrate and define
the meaning and scope of the terms used in the description.
[0018] Numeric ranges are inclusive of the numbers defining the
range. Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation, respectively.
[0019] The practice of the present invention may employ, unless
otherwise indicated, conventional techniques and descriptions of
organic chemistry, polymer technology, molecular biology (including
recombinant techniques), cell biology, biochemistry, and
immunology, which are within the skill of the art. Such
conventional techniques include polymer array synthesis,
hybridization, ligation, and detection of hybridization using a
label. Specific illustrations of suitable techniques can be had by
reference to the example herein below. However, other equivalent
conventional procedures can, of course, also be used. Such
conventional techniques and descriptions can be found in standard
laboratory manuals such as Genome Analysis: A Laboratory Manual
Series (Vols. I-IV), Using Antibodies: A Laboratory Manual, Cells:
A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular
Cloning: A Laboratory Manual (all from Cold Spring Harbor
Laboratory Press), Stryer, L. (1995) Biochemistry (4th Ed.)
Freeman, New York, Gait, "Oligonucleotide Synthesis: A Practical
Approach" 1984, IRL Press, London, Nelson and Cox (2000),
Lehninger, A., Principles of Biochemistry 3.sup.rd Ed., W. H.
Freeman Pub., New York, N.Y. and Berg et al. (2002) Biochemistry,
5.sup.th Ed., W. H. Freeman Pub., New York, N.Y., all of which are
herein incorporated in their entirety by reference for all
purposes.
[0020] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. For
example, the term "a primer" refers to one or more primers, i.e., a
single primer and multiple primers. It is further noted that the
claims can be drafted to exclude any optional element. As such,
this statement is intended to serve as antecedent basis for use of
such exclusive terminology as "solely," "only" and the like in
connection with the recitation of claim elements, or use of a
"negative" limitation.
[0021] The term "sample" as used herein relates to a material or
mixture of materials, typically, although not necessarily, in
liquid form, containing one or more analytes of interest. In one
embodiment, the term as used in its broadest sense, refers to any
plant, animal or viral material containing DNA or RNA, such as, for
example, tissue or fluid isolated from an individual (including
without limitation plasma, serum, cerebrospinal fluid, lymph,
tears, saliva and tissue sections), from preserved tissue (such as
FFPE sections) or from in vitro cell culture constituents, as well
as samples from the environment.
[0022] The term "nucleic acid sample," as used herein denotes a
sample containing nucleic acids. A nucleic acid samples used herein
may be complex in that they contain multiple different molecules
that contain sequences. Genomic DNA samples from a mammal (e.g.,
mouse or human) are types of complex samples. Complex samples may
have more than 10.sup.4, 10.sup.5, 10.sup.6 or 10.sup.7 different
nucleic acid molecules. Also, a complex sample may comprise only a
few molecules, where the molecules collectively have more than
10.sup.4, 10.sup.5, 10.sup.6 or 10.sup.7 or more nucleotides. A DNA
target may originate from any source such as genomic DNA, or an
artificial DNA construct. Any sample containing nucleic acid, e.g.,
genomic DNA made from tissue culture cells or a sample of tissue,
may be employed herein.
[0023] The term "mixture", as used herein, refers to a combination
of elements, that are interspersed and not in any particular order.
A mixture is heterogeneous and not spatially separable into its
different constituents. Examples of mixtures of elements include a
number of different elements that are dissolved in the same aqueous
solution and a number of different elements attached to a solid
support at random positions (i.e., in no particular order). A
mixture is not addressable. To illustrate by example, an array of
spatially separated surface-bound polynucleotides, as is commonly
known in the art, is not a mixture of surface-bound polynucleotides
because the species of surface-bound polynucleotides are spatially
distinct and the array is addressable.
[0024] The term "nucleotide" is intended to include those moieties
that contain not only the known purine and pyrimidine bases, but
also other heterocyclic bases that have been modified. Such
modifications include methylated purines or pyrimidines, acylated
purines or pyrimidines, alkylated riboses or other heterocycles. In
addition, the term "nucleotide" includes those moieties that
contain hapten or fluorescent labels and may contain not only
conventional ribose and deoxyribose sugars, but other sugars as
well. Modified nucleosides or nucleotides also include
modifications on the sugar moiety, e.g., wherein one or more of the
hydroxyl groups are replaced with halogen atoms or aliphatic
groups, are functionalized as ethers, amines, or the likes.
[0025] The term "nucleic acid" and "polynucleotide" are used
interchangeably herein to describe a polymer of any length, e.g.,
greater than about 2 bases, greater than about 10 bases, greater
than about 100 bases, greater than about 500 bases, greater than
1000 bases, up to about 10,000 or more bases composed of
nucleotides, e.g., deoxyribonucleotides or ribonucleotides, and may
be produced enzymatically or synthetically (e.g., PNA as described
in U.S. Pat. No. 5,948,902 and the references cited therein) which
can hybridize with naturally occurring nucleic acids in a sequence
specific manner analogous to that of two naturally occurring
nucleic acids, e.g., can participate in Watson-Crick base pairing
interactions. Naturally-occurring nucleotides include guanine,
cytosine, adenine, thymine, uracil (G, C, A, T and U respectively).
DNA and RNA have a deoxyribose and ribose sugar backbone,
respectively, whereas PNA's backbone is composed of repeating
N-(2-aminoethyl)-glycine units linked by peptide bonds. In PNA
various purine and pyrimidine bases are linked to the backbone by
methylene carbonyl bonds. A locked nucleic acid (LNA), often
referred to as inaccessible RNA, is a modified RNA nucleotide. The
ribose moiety of an LNA nucleotide is modified with an extra bridge
connecting the 2' oxygen and 4' carbon. The bridge "locks" the
ribose in the 3'-endo (North) conformation, which is often found in
the A-form duplexes. LNA nucleotides can be mixed with DNA or RNA
residues in the oligonucleotide whenever desired. The term
"unstructured nucleic acid", or "UNA", is a nucleic acid containing
non-natural nucleotides that bind to each other with reduced
stability. For example, an unstructured nucleic acid may contain a
G' residue and a C' residue, where these residues correspond to
non-naturally occurring forms, i.e., analogs, of G and C that base
pair with each other with reduced stability, but retain an ability
to base pair with naturally occurring C and G residues,
respectively. Unstructured nucleic acid is described in
US20050233340, which is incorporated by reference herein for
disclosure of UNA.
[0026] The term "oligonucleotide" as used herein denotes a
single-stranded multimer of nucleotide of from about 2 to 200
nucleotides, up to 500 nucleotides in length. Oligonucleotides may
be synthetic or may be made enzymatically, and, in some
embodiments, are 30 to 150 nucleotides in length. Oligonucleotides
may contain ribonucleotide monomers (i.e., may be
oligoribonucleotides) or deoxyribonucleotide monomers, or both
ribonucleotide monomers and deoxyribonucleotide monomers. An
oligonucleotide may be 10 to 20, 11 to 30, 31 to 40, 41 to 50,
51-60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 or 150 to 200
nucleotides in length, for example.
[0027] The term "primer" means an oligonucleotide, either natural
or synthetic, that is capable, upon forming a duplex with a
polynucleotide template, of acting as a point of initiation of
nucleic acid synthesis and being extended from its 3' end along the
template so that an extended duplex is formed. The sequence of
nucleotides added during the extension process is determined by the
sequence of the template polynucleotide. Usually primers are
extended by a DNA polymerase. Primers are generally of a length
compatible with their use in synthesis of primer extension
products, and are usually are in the range of between 8 to 100
nucleotides in length, such as 10 to 75, 15 to 60, 15 to 40, 18 to
30, 20 to 40, 21 to 50, 22 to 45, 25 to 40, and so on, more
typically in the range of between 18-40, 20-35, 21-30 nucleotides
long, and any length between the stated ranges. Typical primers can
be in the range of between 10-50 nucleotides long, such as 15-45,
18-40, 20-30, 21-25 and so on, and any length between the stated
ranges. In some embodiments, the primers are usually not more than
about 10, 12, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35,
40, 45, 50, 55, 60, 65, or 70 nucleotides in length.
[0028] Primers are usually single-stranded for maximum efficiency
in amplification, but may alternatively be double-stranded. If
double-stranded, the primer is usually first treated to separate
its strands before being used to prepare extension products. This
denaturation step is typically effected by heat, but may
alternatively be carried out using alkali, followed by
neutralization. Thus, a "primer" is complementary to a template,
and complexes by hydrogen bonding or hybridization with the
template to give a primer/template complex for initiation of
synthesis by a polymerase, which is extended by the addition of
covalently bonded bases linked at its 3' end complementary to the
template in the process of DNA synthesis.
[0029] The term "hybridization" or "hybridizes" refers to a process
in which a nucleic acid strand anneals to and forms a stable
duplex, either a homoduplex or a heteroduplex, under normal
hybridization conditions with a second complementary nucleic acid
strand, and does not form a stable duplex with unrelated nucleic
acid molecules under the same normal hybridization conditions. The
formation of a duplex is accomplished by annealing two
complementary nucleic acid strands in a hybridization reaction. The
hybridization reaction can be made to be highly specific by
adjustment of the hybridization conditions (often referred to as
hybridization stringency) under which the hybridization reaction
takes place, such that hybridization between two nucleic acid
strands will not form a stable duplex, e.g., a duplex that retains
a region of double-strandedness under normal stringency conditions,
unless the two nucleic acid strands contain a certain number of
nucleotides in specific sequences which are substantially or
completely complementary. "Normal hybridization or normal
stringency conditions" are readily determined for any given
hybridization reaction. See, for example, Ausubel et al., Current
Protocols in Molecular Biology, John Wiley & Sons, Inc., New
York, or Sambrook et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory Press. As used herein, the term
"hybridizing" or "hybridization" refers to any process by which a
strand of nucleic acid binds with a complementary strand through
base pairing.
[0030] A nucleic acid is considered to be "selectively
hybridizable" to a reference nucleic acid sequence if the two
sequences specifically hybridize to one another under moderate to
high stringency hybridization and wash conditions. Moderate and
high stringency hybridization conditions are known (see, e.g.,
Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed.,
Wiley & Sons 1995 and Sambrook et al., Molecular Cloning: A
Laboratory Manual, Third Edition, 2001 Cold Spring Harbor, N.Y.).
One example of high stringency conditions include hybridization at
about 42.degree. C. in 50% formamide, 5.times.SSC,
5.times.Denhardt's solution, 0.5% SDS and 100 ug/ml denatured
carrier DNA followed by washing two times in 2.times.SSC and 0.5%
SDS at room temperature and two additional times in 0.1.times.SSC
and 0.5% SDS at 42.degree. C.
[0031] The term "duplex," or "duplexed," as used herein, describes
two complementary polynucleotides that are base-paired, i.e.,
hybridized together.
[0032] The term "amplifying" as used herein refers to the process
of synthesizing nucleic acid molecules that are complementary to
one or both strands of a template nucleic acid. Amplifying a
nucleic acid molecule may include denaturing the template nucleic
acid, annealing primers to the template nucleic acid at a
temperature that is below the melting temperatures of the primers,
and enzymatically elongating from the primers to generate an
amplification product. The denaturing, annealing and elongating
steps each can be performed one or more times. In certain cases,
the denaturing, annealing and elongating steps are performed
multiple times such that the amount of amplification product is
increasing, often times exponentially, although exponential
amplification is not required by the present methods. Amplification
typically requires the presence of deoxyribonucleo side
triphosphates, a DNA polymerase enzyme and an appropriate buffer
and/or co-factors for optimal activity of the polymerase enzyme.
The term "amplification product" refers to the nucleic acid
sequences, which are produced from the amplifying process as
defined herein.
[0033] The terms "determining", "measuring", "evaluating",
"assessing," "assaying," and "analyzing" are used interchangeably
herein to refer to any form of measurement, and include determining
if an element is present or not. These terms include both
quantitative and/or qualitative determinations. Assessing may be
relative or absolute. "Assessing the presence of" includes
determining the amount of something present, as well as determining
whether it is present or absent.
[0034] The term "using" has its conventional meaning, and, as such,
means employing, e.g., putting into service, a method or
composition to attain an end. For example, if a program is used to
create a file, a program is executed to make a file, the file
usually being the output of the program. In another example, if a
computer file is used, it is usually accessed, read, and the
information stored in the file employed to attain an end. Similarly
if a unique identifier, e.g., a barcode is used, the unique
identifier is usually read to identify, for example, an object or
file associated with the unique identifier.
[0035] A "plurality" contains at least 2 members. In certain cases,
a plurality may have at least 10, at least 100, at least 100, at
least 10,000, at least 100,000, at least 10.sup.6, at least
10.sup.7, at least 10.sup.8 or at least 10.sup.9 or more
members.
[0036] If two nucleic acids are "complementary", they hybridize
with one another under high stringency conditions. The term
"perfectly complementary" is used to describe a duplex in which
each base of one of the nucleic acids base pairs with a
complementary nucleotide in the other nucleic acid. In many cases,
two sequences that are complementary have at least 10, e.g., at
least 12 or 15 nucleotides of complementarity.
[0037] An "oligonucleotide binding site" refers to a site to which
an oligonucleotide hybridizes in a target polynucleotide. If an
oligonucleotide "provides" a binding site for a primer, then the
primer may hybridize to that oligonucleotide or its complement.
[0038] The term "covalently linking" refers to the production of a
covalent linkage between two separate molecules, e.g., the top and
bottom strands of a double stranded nucleic acid. Ligating is a
type of covalent linking.
[0039] The term "genotyping", as used herein, refers to any type of
analysis of a nucleic acid sequence, and includes sequencing,
polymorphism (SNP) analysis, and analysis to identify
rearrangements.
[0040] The term "sequencing", as used herein, refers to a method by
which the identity of at least 10 consecutive nucleotides (e.g.,
the identity of at least 20, at least 50, at least 100 or at least
200 or more consecutive nucleotides) of a polynucleotide are
obtained.
[0041] The term "next-generation sequencing" refers to the
so-called parallelized sequencing-by-synthesis or
sequencing-by-ligation platforms currently employed by Illumina,
Life Technologies, Pacific Bio, and Roche etc. Next-generation
sequencing methods may also include nanopore sequencing methods or
electronic-detection based methods such as Ion Torrent technology
commercialized by Life Technologies.
[0042] The term "extending", as used herein, refers to the
extension of a primer by the addition of nucleotides using a
polymerase. If a primer that is annealed to a nucleic acid is
extended, the nucleic acid acts as a template for extension
reaction.
[0043] The term "barcode sequence" or "molecular barcode", as used
herein, refers to a unique sequence of nucleotides can be used to
a) identify and/or track the source of a polynucleotide in a
reaction, b) count how many times an initial molecule is sequenced
and c) pair sequence reads from different strands of the same
molecule. Barcode sequences may vary widely in size and
composition; the following references provide guidance for
selecting sets of barcode sequences appropriate for particular
embodiments: Casbon (Nuc. Acids Res. 2011, 22 e81), Brenner, U.S.
Pat. No. 5,635,400; Brenner et al, Proc. Natl. Acad. Sci., 97:
1665-1670 (2000); Shoemaker et al, Nature Genetics, 14: 450-456
(1996); Morris et al, European patent publication 0799897A1;
Wallace, U.S. Pat. No. 5,981,179; and the like. In particular
embodiments, a barcode sequence may have a length in range of from
2 to 36 nucleotides, or from 6 to 30 nucleotides, or from 8 to 20
nucleotides.
[0044] In some cases, a barcode may contain a "degenerate base
region" or "DBR", where the terms "degenerate base region" and
"DBR" refers to a type of molecular barcode that has complexity
that is sufficient to help one distinguish between fragments to
which the DBR has been added. In some cases, substantially every
tagged fragment may have a different DBR sequence. In these
embodiments, a high complexity DBR may be used (e.g., one that is
composed of at least 10,000 or 100,000, or more sequences). In
other embodiments, some fragments may be tagged with the same DBR
sequence, but those fragments can still be distinguished by the
combination of i. the DBR sequence, ii. the sequence of the
fragment, iii. the sequence of the ends of the fragment, and/or iv.
the site of insertion of the DBR into the fragment. In some
embodiments, at least 95%, e.g., at least 96%, at least 97%, at
least 98%, at least 99% or at least 99.5% of the target
polynucleotides become associated with a different DBR sequence. In
some embodiments a DBR may comprise one or more (e.g., at least 2,
at least 3, at least 4, at least 5, or 5 to 30 or more) nucleotides
selected from R, Y, S, W, K, M, B, D, H, V, N (as defined by the
IUPAC code). In some cases, a double-stranded barcode can be made
by making an oligonucleotide containing degenerate sequence (e.g.,
an oligonucleotide that has a run of 2-10 or more "Ns") and then
copying the complement of the barcode onto the other strand, as
described below.
[0045] Oligonucleotides that contain a variable sequence, e.g., a
DBR, can be made by making a number of oligonucleotides separately,
mixing the oligonucleotides together, and by amplifying them en
masse. In other words, the population of oligonucleotides that
contain a variable sequence can be made as a single oligonucleotide
that contains degenerate positions (i.e., positions that contain
more than one type of nucleotide). Alternatively, such a population
of oligonucleotides can be made by fabricating them individually or
using an array of the oligonucleotides using in situ synthesis
methods, cleaving the oligonucleotides from the substrate and
optionally amplifying them. Examples of such methods are described
in, e.g., Cleary et al (Nature Methods 2004 1: 241-248) and
LeProust et al (Nucleic Acids Research 2010 38: 2522-2540).
[0046] In some cases, a barcode may be error correcting.
Descriptions of exemplary error identifying (or error correcting)
sequences can be found throughout the literature (e.g., in are
described in US patent application publications US2010/0323348 and
US2009/0105959 both incorporated herein by reference).
Error-correctable codes may be necessary for quantitating absolute
numbers of molecules. Many reports in the literature use codes that
were originally developed for error-correction of binary systems
(Hamming codes, Reed Solomon codes etc.) or apply these to
quaternary systems (e.g. quaternary Hamming codes; see Generalized
DNA barcode design based on Hamming codes, Bystrykh 2012 PLoS One.
2012 7: e36852).
[0047] In some embodiments, a barcode may additionally be used to
determine the number of initial target polynucleotide molecules
that have been analyzed, i.e., to "count" the number of initial
target polynucleotide molecules that have been analyzed. PCR
amplification of molecules that have been tagged with a barcode can
result in multiple sub-populations of products that are
clonally-related in that each of the different sub-populations is
amplified from a single tagged molecule. As would be apparent, even
though there may be several thousand or millions or more of
molecules in any of the clonally-related sub-populations of PCR
products and the number of target molecules in those
clonally-related sub-populations may vary greatly, the number of
molecules tagged in the first step of the method can be estimated
by counting the number of DBR sequences associated with a target
sequence that is represented in the population of PCR products.
This number is useful because, in certain embodiments, the
population of PCR products made using this method may be sequenced
to produce a plurality of sequences. The number of different
barcode sequences that are associated with the sequences of a
target polynucleotide can be counted, and this number can be used
(along with, e.g., the sequence of the fragment, the sequence of
the ends of the fragment, and/or the site of insertion of the DBR
into the fragment) to estimate the number of initial template
nucleic acid molecules that have been sequenced.
[0048] The terms "sample identifier sequence" or "sample index"
refer to a type of barcode that can be appended to a target
polynucleotide, where the sequence identifies the source of the
target polynucleotide (i.e., the sample from which sample the
target polynucleotide is derived). In use, each sample is tagged
with a different sample identifier sequence (e.g., one sequence is
appended to each sample, where the different samples are appended
to different sequences), and the tagged samples are pooled. After
the pooled sample is sequenced, the sample identifier sequence can
be used to identify the source of the sequences.
[0049] The term "strand" as used herein refers to a nucleic acid
made up of nucleotides covalently linked together by covalent
bonds, e.g., phosphodiester bonds. In a cell, DNA usually exists in
a double-stranded form, and as such, has two complementary strands
of nucleic acid referred to herein as the "top" and "bottom"
strands. In certain cases, complementary strands of a chromosomal
region may be referred to as "plus" and "minus" strands, the
"first" and "second" strands, the "coding" and "noncoding" strands,
the "Watson" and "Crick" strands or the "sense" and "antisense"
strands. The assignment of a strand as being a top or bottom strand
is arbitrary and does not imply any particular orientation,
function or structure. The nucleotide sequences of the first strand
of several exemplary mammalian chromosomal regions (e.g., BACs,
assemblies, chromosomes, etc.) is known, and may be found in NCBI's
Genbank database, for example.
[0050] The term "top strand," as used herein, refers to either
strand of a nucleic acid but not both strands of a nucleic acid.
When an oligonucleotide or a primer binds or anneals "only to a top
strand," it binds to only one strand but not the other. The term
"bottom strand," as used herein, refers to the strand that is
complementary to the "top strand." When an oligonucleotide binds or
anneals "only to one strand," it binds to only one strand, e.g.,
the first or second strand, but not the other strand.
[0051] The terms "reverse primer" and "forward primer" refer to
primers that hybridize to different strands in a double-stranded
DNA molecule, where extension of the primers by a polymerase is in
a direction that is towards the other primer.
[0052] The term "both ends of a fragment", as used herein, refers
to both ends of a double stranded DNA molecule (i.e., the left hand
end and the right hand end if the molecule is drawn out
horizontally).
[0053] The term "the sequence of a barcode", as used herein, refers
to the sequence of nucleotides that makes up the barcode. The
sequence of a barcode may be at lest 3 nucleotides in length, more
usually 5-30 or more nucleotides in length.
[0054] The term "match", as used herein, refers to an action in
which two sequences are compared and if they are identical,
complementary, or very similar (e.g., when error correcting
barcodes are used) they are indicated as being a match. In some
embodiments, matched sequences are placed into a group.
[0055] The term "or variant thereof", used herein, refers to a
protein that has an amino acid sequence that at least 80%, at least
85%, at least 90%, at least 95%, at least 97%, at least 98% or at
least 99% identical to a protein that has a known activity, wherein
the variant has at least some of the same activities as the protein
of known activity. For example, a variant of a wild type
transposase should be able to catalyze the insertion of a
corresponding transposon into DNA.
[0056] As used herein, the term "PCR reagents" refers to all
reagents that are required for performing a polymerase chain
reaction (PCR) on a template. As is known in the art, PCR reagents
essentially include a first primer, a second primer, a thermostable
polymerase, and nucleotides. Depending on the polymerase used, ions
(e.g., Mg.sup.2+) may also be present. PCR reagents may optionally
contain a template from which a target sequence can be
amplified.
[0057] The term "adjacent to" refers to a distance of less than the
longest dimension of a nucleotide. The term "ligatably adjacent to"
means that two nucleotides are immediately adjacent to one another
on a strand with no intervening nucleotides.
[0058] The term "tailed", in the context of a tailed
oligonucleotide or a oligonucleotide that has a 5' tail or 3' tail,
refers to an oligonucleotide that has a region (e.g., a region of
at least 12-50 nucleotides) at its 5' or 3' end that does not
hybridize to the same sequence as the other end of the primer.
[0059] The term "distinguishable sequences" refers to sequences
that are different to one another.
[0060] The term "target nucleic acid" as use herein, refers to a
polynucleotide of interest under study.
[0061] The term "target nucleic acid molecule" refers to a single
molecule that may or may not be present in a composition with other
target nucleic acid molecules. An isolated target nucleic acid
molecule refers to a single molecule that is present in a
composition that does not contain other target nucleic acid
molecules.
[0062] The term "region" refers to a sequence of nucleotides that
can be single-stranded or double-stranded.
[0063] The term "variable", in the context of two or more nucleic
acid sequences that are variable, refers to two or more nucleic
acids that have different sequences of nucleotides relative to one
another. In other words, if the polynucleotides of a population
have a variable sequence, then the nucleotide sequence of the
polynucleotide molecules of the population varies from molecule to
molecule. The term "variable" is not to be read to require that
every molecule in a population has a different sequence to the
other molecules in a population.
[0064] The term "transposon recognition sequence" refers to a
double-stranded sequence to which a transposase (e.g., the Tn5
transposase or variant thereof) binds, where the transposase
catalyzes simultaneous fragmentation of a double-stranded DNA
sample and tagging of the fragments with sequences that are
adjacent to the transposon end sequence (i.e., by "tagmentation").
Methods for tagmenting, as well as transposon end sequences, are
well known in the art (see, e.g., Picelli et al, Genome Res. 2014
24: 2033-40; Adey et al, Genome Biol. 2010 11:R119 and Caruccio et
al, Methods Mol. Biol. 2011 733: 241-55, US20100120098 and
US20130203605). Kits for performing tagmentation are commercially
sold under the tradename NEXTERA.TM. by Illumina (San Diego,
Calif.). The Tn5 transposon recognition sequence is 19 bp in
length, although many others are known and are typically 18-20 bp,
e.g., 19 bp in length.
[0065] The term "adaptor" refers to a nucleic acid that can be
joined, via a transposase-mediated reaction, to at least one strand
of a double-stranded DNA molecule. As would be apparent, one end of
an adaptor may contain a transposon end sequence. The term
"adaptor" refers to molecules that are at least partially
double-stranded. An adaptor may be 40 to 150 bases in length, e.g.,
50 to 120 bases, although adaptors outside of this range are
envisioned.
[0066] The term "adaptor-tagged," as used herein, refers to a
nucleic acid that has been tagged by an adaptor. An adaptor can be
joined to a 5' end and/or a 3' end of a nucleic acid molecule.
[0067] The term "tagged DNA" as used herein refers to DNA molecules
that have an added adaptor sequence, i.e., a "tag" of synthetic
origin. An adaptor sequence can be added (i.e., "appended") by a
transposase.
[0068] The term "Y-adaptor" refers to an adaptor that contains: a
double-stranded region and a single-stranded region in which the
opposing sequences are not complementary. The end of the
double-stranded region may be or can be joined to target molecules
such as double-stranded fragments of genomic DNA, e.g., by via a
transposase-catalyzed reaction. Each strand of an adaptor-tagged
double-stranded DNA that has been joined to a Y adaptor is
asymmetrically tagged in that it has the sequence of one strand of
the Y-adaptor at one end and the other strand of the Y-adaptor at
the other end. Amplification of nucleic acid molecules that have
been joined to Y-adaptors at both ends results in an asymmetrically
tagged nucleic acid, i.e., a nucleic acid that has a 5' end
containing one tag sequence and a 3' end that has another tag
sequence. The opposing, non-complementary sequences of a Y adaptor
are referred to as the "arms" of the adaptor. The double stranded
region of a Y adaptor is referred to the "stem" of the adaptor. The
structure of an exemplary Y adaptor is shown at the bottom of FIG.
3.
[0069] The term "an end comprising sequences that are
non-complementary" refers to an end of an at least partially
double-stranded molecule in which the opposing strands do not base
pair with each other.
[0070] The term "complexity" refers the total number of different
sequences in a population. For example, if a population has 4
different sequences then that population has a complexity of 4. A
population may have a complexity of at least 4, at least 8, at
least 16, at least 100, at least 1,000, at least 10,000 or at least
100,000 or more, depending on the desired result.
[0071] The term "tagmenting" as used herein refers to the
transposase-catalyzed combined fragmentation of a double-stranded
DNA sample and tagging of the fragments with sequences that are
adjacent to the transposon end sequence. Methods for tagmenting are
well known as are (see, e.g., Picelli et al, Genome Res. 2014 24:
2033-40; Adey et al, Genome Biol. 2010 11:R119 and Caruccio et al,
Methods Mol. Biol. 2011 733: 241-55, US20100120098 and
US20130203605). Kits for performing tagmentation are commercially
sold by a variety of manufacturers.
[0072] The term "loaded" refers to a process by which a transposase
and molecule containing a transposon end sequence are mixed
together to form complexes that contain the transposase bound to
the molecule.
[0073] The term "filling in and sealing" refers to a reaction in
which a single-stranded region between two double-stranded
sequences is filled in by the action of a polymerase, usually a
non-strand displacing polymerase, and joined by a ligase.
[0074] The term "same barcode on both strands" and grammatical
equivalents thereof refers to a double stranded molecule that has a
barcode sequence covalently linked at the 5' end of one strand and
the complement of the barcode sequence covalently linked at the 3'
end of the other strand.
[0075] Other definitions of terms may appear throughout the
specification.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0076] Before the various embodiments are described, it is to be
understood that the teachings of this disclosure are not limited to
the particular embodiments described, and as such can, of course,
vary. It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting, since the scope of the present
teachings will be limited only by the appended claims.
[0077] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described in any way. While the present teachings are
described in conjunction with various embodiments, it is not
intended that the present teachings be limited to such embodiments.
On the contrary, the present teachings encompass various
alternatives, modifications, and equivalents, as will be
appreciated by those of skill in the art.
[0078] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure belongs.
Although any methods and materials similar or equivalent to those
described herein can also be used in the practice or testing of the
present teachings, the some exemplary methods and materials are now
described.
[0079] The citation of any publication is for its disclosure prior
to the filing date and should not be construed as an admission that
the present claims are not entitled to antedate such publication by
virtue of prior invention. Further, the dates of publication
provided can be different from the actual publication dates which
can need to be independently confirmed.
[0080] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which can be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present teachings. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible.
[0081] All patents and publications, including all sequences
disclosed within such patents and publications, referred to herein
are expressly incorporated by reference.
[0082] Provided herein are various compositions, methods and kits
for tagging samples containing double stranded DNA molecules. The
compositions, methods and kits can be employed to analyze genomic
DNA from virtually any organism, including, but not limited to,
plants, animals (e.g., reptiles, mammals, insects, worms, fish,
etc.), tissue samples, bacteria, fungi (e.g., yeast), phage,
viruses, cadaveric tissue, archaeological/ancient samples, etc. In
certain embodiments, the genomic DNA used in the method may be
derived from a mammal, wherein in certain embodiments the mammal is
a human. In exemplary embodiments, the sample may contain genomic
DNA from a mammalian cell, such as, a human, mouse, rat, or monkey
cell. The sample may be made from cultured cells or cells of a
clinical sample, e.g., a tissue biopsy, scrape or lavage or cells
of a forensic sample (i.e., cells of a sample collected at a crime
scene). In particular embodiments, the nucleic acid sample may be
obtained from a biological sample such as cells, tissues, bodily
fluids, and stool. Bodily fluids of interest include but are not
limited to, blood, serum, plasma, saliva, mucous, phlegm, cerebral
spinal fluid, pleural fluid, tears, lactal duct fluid, lymph,
sputum, synovial fluid, urine, amniotic fluid, and semen. In
particular embodiments, a sample may be obtained from a subject,
e.g., a human.
[0083] In some embodiments, the sample comprises DNA fragments
obtained from a clinical sample, e.g., a patient that has or is
suspected of having a disease or condition such as a cancer,
inflammatory disease or pregnancy. In some embodiments, the sample
may be made by extracting fragmented DNA from an archived patient
sample, e.g., a formalin-fixed paraffin embedded tissue sample. In
other embodiments, the patient sample may be a sample of cell-free
circulating DNA from a bodily fluid, e.g., peripheral blood. The
DNA fragments used in the initial steps of the method should be
non-amplified DNA that has not been denatured beforehand. In other
embodiments, the DNA in the sample may already be partially
fragmented (e.g., as is the case for FFPE samples and circulating
cell-free DNA (cfDNA), e.g., ctDNA).
[0084] With reference to FIG. 1, the present adapter may comprising
a population of first oligonucleotides 1, a second oligonucleotide
3 and a third oligonucleotide 5, wherein the first
oligonucleotides, the second oligonucleotide and the third
oligonucleotide are hybridized together to produce a complex 2 that
comprises: (i) a first end comprising a transposase recognition
sequence 4, (ii) a central single-stranded region of variable
sequence 6 and (iii) a second end comprising sequences that are
non-complementary 8. In many embodiments, the first
oligonucleotides should have at least 10 base pairs of
complementarity with each of the second and third oligonucleotides
although, in practice, the first oligonucleotides may have at least
15 base pairs of complementarity with each of the second and third
oligonucleotides, as shown.
[0085] In some embodiments, the non-complementary sequences 8,
i.e., the "arms", may be of any suitable length, e.g., at least 10,
at least 12, at least 14 nucleotides in length, and may be designed
to be compatible with the sequencing platform being used
downstream. For example, as shown in FIG. 2, the adaptor may
contain P5 and P7 sequences, which are compatible with Illumina's
sequencing platform. In some embodiments, as shown in FIG. 5, the
non-complementary sequences may be joined to one another in a loop
structure 9. The variable sequence 6 may be at least 2, e.g., at
least 3, at least 4, at least 5, at least 6, at least 7 or at least
8 nucleotides in length, and may have a complexity of at least 4,
at least 8, at least 16, at least 100, at least 1,000, at least
10,000 or more, depending on how the variable sequence will be
used. The top strand of the complex shown in FIG. 2 may be in the
5' to `3 orientation or the 3` to 5' orientation.
[0086] As shown, in FIG. 2, in certain embodiments the population
of first oligonucleotides comprises a 5' region, a 3' region, and a
region of variable sequence between the 5' region and the 3'
region; the second oligonucleotide is complementary to and
hybridizes with the 3' region of the first oligonucleotides to form
the transposase recognition sequence (shown in black); and the
third oligonucleotide comprises 5' end that is complementary to and
is hybridized with the 3' end of the 3' region of the first
oligonucleotide and comprises a 3' tail that is non-complementary
to the 5' end of the 3' region of the first oligonucleotide. As
shown, both the second and third oligonucleotides have a 5'
phosphate.
[0087] The transposase recognition sequence of the adaptor may be
the transposase recognition sequence of a Tn transposase (e.g. Tn3,
Tn5, Tn7, Tn10, Tn552, Tn903), a MuA transposase, a Vibhar
transposase (e.g. from Vibrio harveyi), although the transposase
recognition sequence for other transposases (Ac-Ds, Ascot-1, Bs1,
Cin4, Copia, En/Spm, F element, hobo, Hsmar1, Hsmar2, IN (HIV),
IS1, IS2, IS3, IS4, IS5, IS6, IS10, IS21, IS30, IS50, IS51, IS150,
IS256, IS407, IS427, IS630, IS903, IS911, IS982, IS1031, ISL2, L1,
Mariner, P element, Tam3, Tc1, Tc3, Tel, THE-1, Tn/O, TnA, Tn3,
Tn5, Tn7, Tn10, Tn552, Tn903, Tol1, Tol2, TnlO, Tyl, including
variants thereof) can also be used.
[0088] The composition containing the adaptor may also contain a
transposase that recognizes the transposase recognition sequence
and in certain cases the transposase may be loaded with the
adaptor. The composition can also comprise a non-strand displacing
polymerase (e.g., T4 DNA polymerase) and a ligase.
[0089] As will be apparent from the discussion that follows below,
the variable sequence acts as a molecular barcode that helps
identify the fragment as well as the strand of the fragment after
sequencing. As will be explained in greater detail below (and as
shown in FIG. 3), the variable region can be readily copied to the
other strand of the adaptor during tagmentation, thereby providing
a way to tag both strands of a fragment of DNA with the same
molecular barcode. Specifically, the adaptor provides a way by
which both strands of a double-stranded molecule can be tagged with
the same barcode such that, after sequencing or amplification, the
sequence reads derived from the top strand can be linked and/or
compared to the sequence reads derived from the bottom strand. This
feature is significant because "real" mutations should be in both
strands (i.e., in both the top strand and the bottom strand), and
knowing whether a sequence read is from the top strand or the
bottom strand allows the top strand sequences to be compared with
bottom strand sequences to provide more confidence that a variation
in a sequence really corresponds to a mutation.
[0090] Also provided herein is a method for tagmenting a sample,
comprising contacting a sample comprising double-stranded DNA with
a transposase loaded with the above-described adaptor; and filling
in and sealing the central single-stranded region of the adaptor
using a polymerase and ligase. The properties of the DNA polymerase
used for filling and sealing reaction should be carefully
considered. In some embodiments, a non strand displacing polymerase
is used, so the second duplex region 5 remains annealed. In other
embodiments, a strand displacing polymerase may be used under
conditions such that the second duplex region 5 is only displaced
by a few nucleotides, and the resulting structure may be resolved
by flap endonuclease activity in conjunction with a ligase
activity. Examples of non-strand displacing polymerases include T4
or T7 polymerases. In some embodiments, a polymerase with reduced
or absent 3'-5' exonuclease activity may be used, so that the 3'
arm of the Y is not digested by the polymerase. For example, a
mutant T4 polymerase with reduced 3'-5' exo activity may be used.
For example, Sulfolobus DNA Polymerase IV may be used. This
reaction produces a population of DNA fragments that are tagged at
both ends by a Y adaptor each comprising the variable sequence of a
first oligonucleotide on both strands. FIG. 3 schematically
illustrates this fill in and sealing reaction. After this reaction,
both strands of one end of a fragment will be associated with a
first barcode and its complement, whereas both strands of the other
end of a fragment will be associated with a second barcode and its
complement. Further, because transposase insertion is directional,
every fragment generated by the method will be asymmetrically
tagged in that 5' end of every tagged strand of DNA will by linked
to one of the non-complementary sequences of 8 (e.g., the P5
sequence) and the 3' end of the strands will be linked to the other
the non-complementary sequence of 8 (e.g., the P3 sequence).
Asymmetrically tagged fragments can be efficiently amplified using
a pair of primers that target the non-complementary sequence (e.g.,
which target the P5 and p7 sequences, for example).
[0091] In particular embodiments, the filling and sealing reaction
may be done at in the same reaction as the filling in and sealing
reaction that occurs during tagmentation (and as shown in FIG. 4).
As such, in some embodiments, the method may be done by combining,
in a single reaction vessel, the sample, the transposase loaded
with the adaptor, the polymerase (e.g., T4 DNA polymerase) and the
ligase. In these embodiments, the polymerase and the ligase fill in
and seal the single stranded region of the adaptor, as well as
repair the gap (which is often 9 bp) that is between the 3' end of
the tagged fragment and the 5' end of the bottom strand of the
transposon recognition sequence.
[0092] With reference to FIG. 4, some embodiments of the method may
involve loading the adaptor into a transposase dimer, and mixing
the loaded adaptor with genomic DNA and other necessary reagents
(e.g., dNTPs, ligase, polymerase, etc.) under conditions in which
tagmentation occurs. The gaps in the resulting complex, caused by
the transposase breaks and by the single-stranded barcode region,
can be filled in with a non-strand displacing polymerase such as T4
DNA Polymerase, and the ends ligated with a DNA ligase, made
possible by the 5' phosphates on two of the second and third
oligonucleotides.
[0093] In an alternate embodiment the oligonucleotide containing
the sequencing primer and the P7 sequence is hybridized to the
genomic fragments after transposition rather than being loaded into
the transposase before transposition. This has several potential
advantages. First, it means that there will be no loss of assay
efficiency due to a loss of this third piece prior to ligation, for
example in storage or rehydration of the enzyme stock. Second,
double-stranded DNA is a potential target for transposases during
the transposition reaction. The double-stranded regions may be too
short for efficient transposition, but there may be significant
amount of cleavage activity. Third, its absence enables the melting
away of the 19 bp phosphorylated transposase recognition sequence
prior to ligation. This means that only a single ligation event is
necessary per end, which may be useful depending on the efficiency
of that step. These embodiments come at the expense of additional
hybridization reaction. However, since the hybridized stem sequence
can be identical for all ends, that hybridization reaction can be
done in excess and relatively fast.
[0094] In some embodiments, the adapter may comprise only one or
two molecules which form a stem-loop structure, with a duplex
region comprising the transposase recognition sequence (FIG. 5,
shown in black), and a single-stranded loop region (FIG. 5). One
example of transposase adapters using stem loop adapters is
described in US Patent Application 2010/0120098 A1. However, in the
embodiments we describe here, we use large loop regions comprising
specific amplification sequences. One advantage of this looped
configuration is that the single-stranded regions of the adaptor
will be resistant to exonuclease digestion, or the 3'-5'
exonuclease activity present in some polymerases. A second
advantage of this configuration is that only one or two
oligonucleotides are needed to form the adaptor, instead of three.
In embodiments, a single long oligonucleotide the loop region may
have a cleavable region, such as a region of ribonucleic acid
subject to cleavage by ribonucleases, or one or more deoxyuridine
residues, subject to cleavage by the USER enzyme, or one or more
abasic sites, or a chemically cleavable or photocleavable group
(FIG. 6A). In other embodiments, the cleavable region may comprise
another duplex region comprising a restriction digestion site. The
duplex region may be formed by using sequences which allow the
single stranded regions to anneal at their ends (FIG. 6B) or by
using a splint oligonucleotide which anneals to both of the ends of
the single stranded regions of the adaptor. Use of stem loop
structures as adaptors is described in U.S. Pat. Nos. 8,883,990,
8,029,993, and 8,288,097. In other embodiments, the single-stranded
loop region may also contain one or more sequences of random
nucleotides (DBR), which may act as unique molecular identifiers
(FIG. 6C). In these embodiments, the entire adaptor may be made
from a single oligonucleotide annealed to itself, and the filling
in and sealing step will only need to seal the 9 base gap created
by the transposition reaction. Additionally, the use of a single
loop structure in place of the arms of the Y will enable an
alternative method of adaptor construction (FIG. 7.) In this
embodiment, the adaptor can be constructed using a single
oligonucleotide, and primer extension by a polymerase will copy the
DBR barcode and the transposase binding site. These extended
adaptors can then be loaded into the transposase enzyme for
tagmentation, and as in FIG. 6C, the filling and sealing reaction
will only need to seal the 9 base gap created by the transposase
reaction.
[0095] In some embodiments, there is no cleavable region in the
single stranded loop. In these embodiments, the filling and sealing
reaction on the loop adaptors will convert the duplex target DNA
into a circular DNA. Methods for working with and sequencing
circular DNA targets have been described in Travers K J et al.,
Nucleic Acids Res. 2010 August; 38(15): e159, and some of these
methods have been commercialized as the SMRTbell technology by
Pacific Biosciences Corporation. In the embodiments described here,
after tagmentation with stem loop adaptors, the circular DNA
product that is formed can be resolved to a linear product after
amplification by PCR, using primers which bind within the loop.
[0096] FIG. 8 illustrates another embodiment of the adaptor,
wherein there are multiple single stranded regions comprising
cleavage sites. In this Figure, P5 and P7 represent primer
sequences necessary for bridge amplification on the Illumina
platform; these could be replaced by corresponding sequences for
another sequencing platform, e.g., Ion Torrent; "P" indicates 5'
phosphorylation, and Transposase binding sequence (shown in black)
is the 19 bp ES sequence. In embodiments, the single stranded
region opposite from the DBR (gray) may comprise one or more
clevable sites. For example, the region opposite the DBR may
comprise ribonucleic acid subject to cleavage by ribonucleases, or
one or more deoxyuridine residues, subject to cleavage by the USER
enzyme, or one or more abasic sites, or one or more chemically
cleavable or photocleavable groups. The cleavage sites opposite the
DBR and the cleavage site in the single stranded loop may be
cleaved by the same method, or may be cleaved by different
methods.
[0097] In other embodiments, adaptor structures other than the "Y"
adaptor in FIG. 1 or the stem loop adaptor in FIG. 5 are
envisioned. For example, if the Y adaptor is formed by annealing
two or three oligonucleotide molecules, as shown schematically in
FIG. 1, one or both single stranded regions of the Y may comprise
palindromic sequences which fold back onto themselves, creating a
hairpin and the 3' end, the 5' end, or both. This hairpin strategy
may be useful to reduce or eliminate digestion of the single
stranded regions by exonuclease activity, particular the strong
3'-5' exonuclease activity found in some DNA polymerases such as T4
DNA polymerase or T7 DNA polymerase. Alternatively, the linkages of
the Y adaptor may comprise 3'-3' linked nucleotides, or
phosphothioate linkages, rendering them nuclease resistant.
[0098] In any embodiment the method may further comprise amplifying
the population of tagged DNA fragments using primers that hybridize
or are complementary to the arms of the Y adaptor (i.e., using one
primer that is complementary to the sequence added to one end of
each strand and another primer that is the same as a sequence added
to the other end of the strand). As noted above, because the
fragments that result from this process are asymmetrically tagged,
this part of the method is at least twice as efficient as methods
in which two different adaptors are used. This amplification step
may be done in solution (i.e., using primers that are in solution)
or it may be done by bridge PCR (using primers, e.g., P5 and P7
primers that are tethered to a solid support). As such, in certain
cases the tagmented product may be applied directly to the
substrate used for sequencing and amplified by bridge PCR. As would
be apparent, if the fragments are to be sequenced without
amplification in solution, then the arms of the adaptor should be
compatible with the sequencing platform being used, e.g.,
Illumina's reversible terminator method, Roche's pyrosequencing
method (454), Life Technologies' sequencing by ligation (the SOLiD
platform) or Life Technologies' Ion Torrent platform, etc. In other
embodiments, the tagged may be amplified in solution prior to
sequencing, in which case other primers (e.g., primers that are
tailed with P5 and P7 sequences) may be used. In other words, the
tagged DNAs can either be purified and loaded directly onto the
Illumina sequencing chip, or subject to PCR with the P5 and P7
primer sequences to generate more target material, if desired. The
resulting tagmented DNA should represent 100% of the genomic DNA
starting sequences, and thus levels of allelic dropouts may be
minimized. It should be noted that this method could be used
without barcoding if that is not required. Other NGS methods that
do not utilize the P5 and P7 sequences could also be used with this
method, by modifying the initial adapter sequences accordingly.
[0099] Next, at least some of the tagged DNA fragments may be
sequenced. The tagged fragments may be sequenced directly or, in
some embodiments, the fragments may be amplified (e.g., by PCR) to
produce amplification products and then sequenced. Examples of next
generation sequencing methods are described in the following
references: Margulies et al (Nature 2005 437: 376-80); Ronaghi et
al (Analytical Biochemistry 1996 242: 84-9); Shendure et al
(Science 2005 309: 1728-32); Imelfort et al (Brief Bioinform. 2009
10:609-18); Fox et al (Methods Mol Biol. 2009; 553:79-108); Appleby
et al (Methods Mol Biol. 2009; 513:19-39) and Morozova et al
(Genomics. 2008 92:255-64), which are incorporated by reference for
the general descriptions of the methods and the particular steps of
the methods, including all starting products, reagents, and final
products for each of the steps.
[0100] The sequencing step may be done using any convenient next
generation sequencing method and may result in at least 10,000, at
least 50,000, at least 100,000, at least 500,000, at least 1M at
least 10M at least 100M or at least 1B sequence reads. In some
cases, the reads are paired-end reads. The products may be
sequenced using any suitable method including, but not limited to
Illumina's reversible terminator method, Roche's pyrosequencing
method (454), Life Technologies' sequencing by ligation (the SOLiD
platform), Life Technologies' Ion Torrent platform or Pacific
Biosciences' fluorescent base-cleavage method. Examples of such
methods are described in the following references: Margulies et al
(Nature 2005 437: 376-80); Ronaghi et al (Analytical Biochemistry
1996 242: 84-9); Shendure (Science 2005 309: 1728); Imelfort et al
(Brief Bioinform. 2009 10:609-18); Fox et al (Methods Mol Biol.
2009; 553:79-108); Appleby et al (Methods Mol Biol. 2009;
513:19-39) English (PLoS One. 2012 7: e47768) and Morozova
(Genomics. 2008 92:255-64), which are incorporated by reference for
the general descriptions of the methods and the particular steps of
the methods, including all starting products, reagents, and final
products for each of the steps.
[0101] In another embodiment, the tagged DNA may be sequenced using
nanopore sequencing (e.g., as described in Soni et al. Clin. Chem.
2007 53: 1996-2001, or as described by Oxford Nanopore
Technologies). Nanopore sequencing is a single-molecule sequencing
technology whereby a single molecule of DNA is sequenced directly
as it passes through a nanopore. A nanopore is a small hole, of the
order of 1 nanometer in diameter. Immersion of a nanopore in a
conducting fluid and application of a potential (voltage) across it
results in a slight electrical current due to conduction of ions
through the nanopore. The amount of current which flows is
sensitive to the size and shape of the nanopore. As a DNA molecule
passes through a nanopore, each nucleotide on the DNA molecule
obstructs the nanopore to a different degree, changing the
magnitude of the current through the nanopore in different degrees.
Thus, this change in the current as the DNA molecule passes through
the nanopore represents a reading of the DNA sequence. Nanopore
sequencing technology is disclosed in U.S. Pat. Nos. 5,795,782,
6,015,714, 6,627,067, 7,238,485 and 7,258,838 and U.S. Pat Appln
Nos. 2006003171 and 20090029477.
[0102] The molecular barcode sequence may be identified in the
sequence reads, and used to identify sequence errors, for allele
calling, for assigning confidence, to perform copy number analysis
and to estimate gene expression levels using methods that can be
adapted from known methods, see, e.g., Casbon (Nucl. Acids Res.
2011 39: e81), Fu (Proc. Natl. Acad. Sci. 2011 108: 9026-9031) and
Kivioia (Nat. Methods 2011 9: 72-74). If an error correctable
barcode is used, then such analyses may become more accurate
because, even if one barcode is mis-read, the error can be
corrected or the read can be eliminated.
[0103] The sequence reads may be analyzed by a computer and, as
such, instructions for performing the steps set forth below may be
set forth as programing that may be recorded in a suitable physical
computer readable storage medium. The general principles of some of
the analysis steps are described below.
[0104] As noted above, the method results in the same barcode
sequence (i.e., a barcode sequence and its complement) being
appended to both strands of a fragment, which allow one to match
reads that are derived from the top strand of an initial fragment
from reads that are derived from the bottom strand of that
fragment. In some cases, the barcode sequences may be seen at the
beginning of the sequence read or at the end of the sequence read.
In certain cases, a distal barcode may be identified at the
beginning of a paired end sequence read.
[0105] In some implementations, the sequence reads may undergo
initial processing to identify any molecular barcodes in the
sequence (including sample identifier sequences), and/or trimming
reads to remove low quality or unnecessary adaptor sequences. In
some embodiments, the sequence reads may be grouped by their
sequence and fragmentation breakpoints of the sequence read, where
a fragmentation breakpoint is represented by the "end" of the
sequence after the added sequences have been trimmed off. Assuming
the breaks are at random or semi-random positions, different
fragments having the same sequence can be distinguished by their
fragmentation breakpoints. Grouping the sequence reads by their
fragmentation breakpoints provides a way to determine if a sequence
(e.g., a variant) is present in more than one starting
molecule.
[0106] In certain embodiments, the method may further comprise
identifying a potential sequence variation in a group of sequence
reads that correspond to the top strand of a fragment and
determining if the potential sequence variation is in any of the
sequence reads that correspond to the bottom strand of the
fragment. These reads can be grouped because, as noted above, they
share the same barcode. If a potential sequence variation is not in
both strands of the fragment, it is more likely than not that the
potential sequence variation is due to a PCR or sequencing error.
If a potential sequence variation is in both strands of the
fragment, it is more likely than not that the potential sequence
variation corresponds to a "real" sequence variation in the sample.
The confidence that a potential sequence variation is a true
variation (rather than a PCR or sequencing error) therefore
increases if it is present in both strands of the same molecule in
sample. The ability to distinguish between sequence reads that are
derived from different fragments and sequence reads that are
derived from different strands of the same fragment allows one to
determine whether a sequence variation is real with more
confidence.
[0107] In certain embodiments, the sample sequenced may comprise a
pool of nucleic acids from a plurality of samples, wherein the
nucleic acids in the sample have a different molecular barcode to
indicate their source. In some embodiments the nucleic acids being
analyzed may be derived from a single source (e.g., from different
sites or a timecourse in a single subject), whereas in other
embodiments, the nucleic acid sample may be a pool of nucleic acids
extracted from a plurality of different sources (e.g., a pool of
nucleic acids from different subjects), where by "plurality" is
meant two or more. As such, in certain embodiments, a nucleic acid
sample can contain nucleic acids from 2 or more sources, 3 or more
sources, 5 or more sources, 10 or more sources, 50 or more sources,
100 or more sources, 500 or more sources, 1000 or more sources,
5000 or more sources, up to and including about 10,000 or more
sources. These molecular barcodes allow the sequences from
different sources to be distinguished after they are analyzed. Such
barcodes may be in the adaptor, or they may be added the
amplification process (after tagging).
Kit
[0108] Also provided by this disclosure are kits for practicing the
subject method, as described above. In certain embodiments, the kit
may comprise a transposase and an adaptor as described above. In
some embodiments, the kit may further comprise a ligase and
polymerase and, in certain embodiments, the transposase is loaded
with the adaptor. The loaded transposase, polymerase, and ligase
may be in a mix, i.e., in a single vessel. In some embodiments, the
kit further comprises a pair of primers that are complementary to
or the same as the non-complementary sequences at the second end of
the adaptor.
[0109] Either of the kits may additionally comprise suitable
reaction reagents (e.g., buffers etc.) for performing the method.
The various components of the kit may be present in separate
containers or certain compatible components may be precombined into
a single container, as desired. In addition to the reagents
described above, a kit may contain any of the additional components
used in the method described above, e.g., one or more enzymes
and/or buffers, etc.
[0110] In addition to above-mentioned components, the subject kits
may further include instructions for using the components of the
kit to practice the subject methods, i.e., to instructions for
sample analysis. The instructions for practicing the subject
methods are generally recorded on a suitable recording medium. For
example, the instructions may be printed on a substrate, such as
paper or plastic, etc. As such, the instructions may be present in
the kits as a package insert, in the labeling of the container of
the kit or components thereof (i.e., associated with the packaging
or subpackaging) etc. In other embodiments, the instructions are
present as an electronic storage data file present on a suitable
computer readable storage medium, e.g., CD-ROM, diskette, etc. In
yet other embodiments, the actual instructions are not present in
the kit, but means for obtaining the instructions from a remote
source, e.g., via the internet, are provided. An example of this
embodiment is a kit that includes a web address where the
instructions can be viewed and/or from which the instructions can
be downloaded. As with the instructions, this means for obtaining
the instructions is recorded on a suitable substrate.
EXAMPLE
[0111] Genomic DNA was successfully tagmented and sequenced using
Vibhar transposase loaded with Y adapter oligonucleotides in the
following manner. We first annealed two oligonucleotides with the
following sequences:
TABLE-US-00001 5'-AAGAACCAGGCTTGTCCTCATAGATCGCACTTGTGATCAAGAGA
CAG-3' and 5'-pCTGTCTCTTGATCACAAGTTAAGGCGATTTCTCAAGGCAATGG
GACT-3'
[0112] Annealing was performed by resuspending the lyophilized
oligonucleotides to a concentration of 800 micromolar in a solution
of 10 mM bicine (pH 7.9) and 20 mM KCl. The two oligonucleotides
were then mixed in a one-to-one ratio and heated to 70 degrees
Celsius for 10 minutes, then allowed to slowly cool to room
temperature for several hours. The resulting double-stranded DNA
was then bound to the Vibhar transposase by creating 50 microliters
of the following mixture: [0113] 116 .mu.M DNA [0114] 225 mM KCl
[0115] 9.4% glycerol [0116] 1 mM EDTA [0117] 2 mM DTT [0118] 0.05%
Igepal [0119] 3.07 mg/ml Vibhar transposase
[0120] The mixture was incubated at 25 degrees Celsius for 4 hours,
then at 4 degrees Celsius for three days. 4 .mu.l of this loaded
transposase mixture was then diluted by adding 118.8 .mu.l of [20
mM bicine-NH.sub.4, pH 7.9; 250 mM KCl; 2 mM DTT; 0.1 mM EDTA,
pH8.0; 50% glycerol].
[0121] To tagment human genomic DNA, 1 .mu.l of the above
transposase dilution was added to 2 .mu.l of 25 ng/.mu. human
genomic DNA in 17 .mu.l of Agilent SureSelect QXT Buffer from the
Agilent SureSelect QXT Library Prep Kit (Agilent Technologies,
catalog number G9682A). Tagmentation and subsequent purification on
AMPure XP beads (Beckman Coulter Genomics catalog number A63880)
was performed as described in the SureSelect QXT Library Prep Kit
protocol. The nine nucleotide gap in the transposase tagmented DNA
was then filled-in and ligated in the following reaction for 10
minutes at 30 degrees Celsius: [0122] 10 .mu.l Tagmented genomic
DNA [0123] 1 mM ATP [0124] 0.1 mM deoxynucleotide triphosphates
[0125] 20 mM Tris-HCl [0126] 10 mM (NH4)2SO4 [0127] 10 mM KCl
[0128] 2 mM MgSO4 [0129] 0.1% Triton X-100 [0130] 2 units
Sulfolobus DNA Polymerase IV (New England BioLabs) [0131] 3,000
units T3 DNA Ligase (New England BioLabs)
[0132] Reactions were again purified on AMPure beads and
subsequently amplified by PCR as described in the Agilent
SureSelect QXT Library Prep Kit protocol, except that 10 rounds of
PCR were performed using the following PCR primers:
TABLE-US-00002 5'-AATGATACGGCGACCACCGAGATCTACACCGACAGGTTCAGAAGAACC
AGGCTTGTCCTCA-3'
5'-CAAGCAGAAGACGGCATACGAGATGCGCGTCCGACGAGCAGTCCCATT
GCCTTGAGAAA-3'
[0133] Analysis of the PCR reaction products with the Agilent
Bioanalyzer and by sequencing on the Illumina MiSeq instrument
validated that the genomic DNA was successfully tagmented and
readily sequencable.
EMBODIMENTS
Embodiment 1
[0134] An adapter comprising a population of first
oligonucleotides, a second oligonucleotide and a third
oligonucleotide, wherein the first oligonucleotides, the second
oligonucleotide and the third oligonucleotide are hybridized
together to produce a complex that comprises: (i) a first end
comprising a transposase recognition sequence, (ii) a central
single-stranded region of variable sequence and (iii) a second end
comprising sequences that are non-complementary.
Embodiment 2
[0135] In some embodiments a) the population of first
oligonucleotides comprise a 5' region, a 3' region, and a region of
variable sequence between the 5' region and the 3' region; b) the
second oligonucleotide is complementary to and hybridizes with the
3' region of the first oligonucleotides to form the transposase
recognition sequence; and c) the third oligonucleotide comprises 5'
end that is complementary to and is hybridized with the 3' end of
the 3' region of the first oligonucleotide and comprises a 3' tail
that is non-complementary to the 5' end of the 3' region of the
first oligonucleotide.
Embodiment 3
[0136] The adaptor of any prior embodiment, wherein the variable
sequence has a complexity of at least 10.
[0137] In any embodiment, the 5' end of the first oligonucleotide
and the 3' tail of the third oligonucleotide may be joined together
by a cleavable region.
Embodiment 4
[0138] The adaptor of any prior embodiment, wherein the variable
sequence has a complexity of at least 1,000.
[0139] In any embodiment, the first, second, and third
oligonucleotides may be formed by allowing self-annealing of a
single oligonucleotide of greater than 60 nucleotides, followed by
cleavage of cleavable sites located between the sequences between
the first and third oligonucleotides and between the sequences of
the second and third oligonucleotide.
Embodiment 5
[0140] The adaptor of any prior embodiment, wherein the transposase
recognition sequence is the recognition sequence for a Tn5
transposase or variant thereof.
Embodiment 6
[0141] The adaptor of any prior embodiment, wherein the transposase
recognition sequence is the recognition sequence for a Vibhar
transposase or variant thereof.
Embodiment 7
[0142] The adaptor of any prior embodiment, wherein the first
oligonucleotides have at least 10 base pairs of complementarity
with each of the second and third oligonucleotides.
[0143] In any embodiment, the 3' tail of the third oligonucleotide
may comprises a modification rendering the 3' end resistant to
digestion by a 3'-5' exonuclease activity.
Embodiment 8
[0144] A composition comprising the adaptor of any of embodiments
1-7 and a transposase.
Embodiment 9
[0145] A method for tagmenting a sample, comprising; contacting a
sample comprising double-stranded DNA with a transposase loaded
with the adaptor of any of embodiments 1-7; and filling in and
sealing the central single-stranded region of the adaptor using a
polymerase and ligase, thereby producing a population of DNA
fragments that are tagged at both ends by a Y adaptor each
comprising the variable sequence of a first oligonucleotide on both
strands.
Embodiment 10
[0146] The method of any prior method embodiment, wherein the
method is done by combining, in a single reaction vessel, the
sample, the transposase loaded with the adaptor, the polymerase and
the ligase.
Embodiment 11
[0147] The method of any prior method embodiment, wherein the
filling in is done by T4 polymerase.
[0148] In any embodiment, the filling may be done by Sulfolobus DNA
polymerase IV, at a temperature less than 50 degrees Celsius.
Embodiment 12
[0149] The method of any prior method embodiment, wherein the
method further comprises amplifying the population of DNA fragments
using primers that target the arms of the Y adaptor.
Embodiment 13
[0150] The method of embodiment 12, wherein the amplifying is done
in solution.
Embodiment 14
[0151] The method of embodiment 12, wherein the amplifying is done
by bridge PCR.
Embodiment 15
[0152] The method of any prior method embodiment, further
comprising sequencing at least some of the tagged DNA
fragments.
Embodiment 16
[0153] The method of any prior method embodiment, further
comprising sequencing at least some of the tagged DNA
fragments.
Embodiment 17
[0154] The method of any prior method embodiment, wherein a) the
population of first oligonucleotides comprise a 5' region, a 3'
region, and a region of variable sequence between the 5' region and
the 3' region; b) the second oligonucleotide is complementary to
and hybridizes with the 3' region of the first oligonucleotides to
form the transposase recognition sequence; and c) the third
oligonucleotide comprises 5' end that is complementary to and is
hybridized with the 3' end of the 3' region of the first
oligonucleotide and comprises a 3' tail that is non-complementary
to the 5' end of the 3' region of the first oligonucleotide.
Embodiment 18
[0155] The method of any prior method embodiment, wherein the
variable sequence has a complexity of at least 10.
Embodiment 19
[0156] The method of any prior method embodiment, wherein the
variable sequence has a complexity of at least 1,000.
Embodiment 20
[0157] The method of any prior method embodiment, wherein the
transposase recognition sequence is the recognition sequence for a
Tn5 transposase or variant thereof.
Embodiment 21
[0158] The method of any prior method embodiment, wherein the
transposase recognition sequence is the recognition sequence for a
Vibhar transposase or variant thereof.
Embodiment 22
[0159] The method of any prior method embodiment, wherein the first
oligonucleotides have at least 10 base pairs of complementarity
with each of the second and third oligonucleotides.
Embodiment 23
[0160] A kit comprising: a transposase; an adaptor of any of
embodiments 1-7; and a polymerase.
Embodiment 24
[0161] The kit of any prior kit embodiment, wherein the transposase
is loaded with the adaptor.
Embodiment 25
[0162] The kit of any prior kit embodiment, wherein the loaded
transposase, polymerase, and ligase are in a mix.
Embodiment 26
[0163] The kit of any prior kit embodiment, wherein the kit further
comprises a pair of primers that are complementary to or the same
as the non-complementary sequences at the second end of the
adaptor.
[0164] In some embodiments: a) the population of first
oligonucleotides comprise a 5' region, a 3' region, and a region of
variable sequence between the 5' region and the 3' region; b) the
second oligonucleotide is complementary to and hybridizes with the
3' region of the first oligonucleotides to form the transposase
recognition sequence; and c) the third oligonucleotide comprises 5'
end that is complementary to and is hybridized with the 3' end of
the 3' region of the first oligonucleotide and comprises a 3' tail
that is non-complementary to the 5' end of the 3' region of the
first oligonucleotide.
Embodiment 27
[0165] The kit of any prior kit embodiment, wherein the variable
sequence has a complexity of at least 10.
Embodiment 28
[0166] The kit of any prior kit embodiment, wherein the variable
sequence has a complexity of at least 1,000.
Embodiment 29
[0167] The kit of any prior kit embodiment, wherein the transposase
recognition sequence is the recognition sequence for a Tn5
transposase or variant thereof.
Embodiment 30
[0168] The kit of any prior kit embodiment, wherein the transposase
recognition sequence is the recognition sequence for a Vibhar
transposase or variant thereof.
Embodiment 31
[0169] The kit of any prior kit embodiment, wherein the first
oligonucleotides have at least 10 base pairs of complementarity
with each of the second and third oligonucleotides.
Embodiment 32
[0170] An adapter comprising first oligonucleotide and a second
oligonucleotide, wherein the first and second oligonucleotides are
hybridized together to produce a complex that comprises: (i) a
first end comprising a double stranded transposase recognition
sequence and (ii) a second end comprising sequences that are
non-complementary. This two oligonucleotide adaptor may contain
many, if not all of the general characteristics of the three
oligonucleotide adaptor described above, e.g., barcodes, etc.,
except that the single stranded variable regions is now double
stranded and part of the stem of the adaptor. In some cases, in
this embodiment, one of the arms of the adaptor may contain a
barcode.
Embodiment 33
[0171] A method for tagmenting a sample, comprising; contacting a
sample comprising double-stranded DNA with a transposase loaded
with the adaptor of embodiment 31, thereby producing a population
of DNA fragments that are tagged at both ends by a Y adaptor each
comprising the variable sequence of a first oligonucleotide on both
strands.
Embodiment 34
[0172] an adapter containing a first oligonucleotide, wherein the
first oligonucleotide comprises: (i) a duplex region and a single
stranded loop region, (ii) the duplex region comprises a
transposase recognition sequence, and (iii) the single stranded
loop region comprises a cleavage region.
Embodiment 35
[0173] the adapter of any prior embodiment, wherein the adapter
comprises a region of variable sequence.
Embodiment 36
[0174] the adapter of any prior embodiment, wherein the adapter
comprises a region of variable sequence, wherein the variable
sequence is in the single-stranded region.
Embodiment 37
[0175] the adapter of any prior embodiment, wherein the adapter
comprises more than one region of variable sequence, wherein the
variable sequences are in the single-stranded region.
Embodiment 38
[0176] the adapter of any prior embodiment, wherein the adapter
comprises more than one cleavable region, wherein one cleavable
region is in the single-stranded region.
Embodiment 39
[0177] the adapter of any prior embodiment, wherein the adapter
comprises deoxynucleic acid and the cleavable region comprises
uracil or deoxyuracil.
Embodiment 40
[0178] the adapter of any prior embodiment, wherein the adapter
comprises deoxyribonucleic acid, and the cleavable region comprises
ribonucleic acid.
Embodiment 41
[0179] the adapter of any prior embodiment, wherein the adapter
comprises deoxyribonucleic acid, and the cleavable region comprises
a chemically cleavable group.
Embodiment 42
[0180] the adapter of any prior embodiment, wherein the adapter
comprises deoxyribonucleic acid, and the cleavable region comprises
a photocleavable group.
Embodiment 43
[0181] the adapter of any prior embodiment, wherein the 5' end of
the first oligonucleotide and the 3' tail of the third
oligonucleotide are joined together by a cleavable region.
Embodiment 44
[0182] the adapter of any prior embodiment, wherein the first,
second, and third oligonucleotides are formed by allowing
self-annealing of a single oligonucleotide of greater than 60
nucleotides, followed by cleavage of cleavable sites located
between the sequences between the first and third oligonucleotides
and between the sequences of the second and third
oligonucleotide.
Embodiment 45
[0183] the adapter of any prior embodiment, wherein the 3' tail of
the third oligonucleotide comprises a modification rendering the 3'
end resistant to digestion by a 3'-5' exonuclease activity, wherein
resistant is defined as having less exonuclease digestion than
native, single stranded DNA without modifications.
Embodiment 46
[0184] The method of any prior method embodiment, wherein the
filling in is done by a T4 polymerase mutant with reduced or absent
3'-5' exonuclease activity.
Embodiment 47
[0185] The method of any prior method embodiment, wherein the
filling in is done by a T7 polymerase mutant with reduced or absent
3'-5' exonuclease activity.
Embodiment 48
[0186] The method of any prior method embodiment, wherein the
filling in is done by a Sulfolobus DNA polymerase.
Embodiment 49
[0187] The method of any prior method embodiment, wherein the
filling in is done by a Sulfolobus DNA polymerase, at a temperature
less than 50 degrees Celsius.
Sequence CWU 1
1
4147DNAartificial sequencesynthetic oligonucleotide 1aagaaccagg
cttgtcctca tagatcgcac ttgtgatcaa gagacag 47247DNAartificial
sequencesynthetic oligonucleotide 2ctgtctcttg atcacaagtt aaggcgattt
ctcaaggcaa tgggact 47361DNAartificial sequencesynthetic
oligonucleotide 3aatgatacgg cgaccaccga gatctacacc gacaggttca
gaagaaccag gcttgtcctc 60a 61459DNAartificial sequencesynthetic
oligonucleotide 4caagcagaag acggcatacg agatgcgcgt ccgacgagca
gtcccattgc cttgagaaa 59
* * * * *