U.S. patent application number 15/353899 was filed with the patent office on 2017-10-05 for compositions and methods for treatment of cancer.
The applicant listed for this patent is The Trustees of the University of Pennsylvania. Invention is credited to Carl H. June, Michael D. Kalos, Bruce L. Levine, Michael C. Milone, David L. Porter.
Application Number | 20170283775 15/353899 |
Document ID | / |
Family ID | 46207528 |
Filed Date | 2017-10-05 |
United States Patent
Application |
20170283775 |
Kind Code |
A1 |
June; Carl H. ; et
al. |
October 5, 2017 |
Compositions and Methods for Treatment of Cancer
Abstract
The present invention provides compositions and methods for
treating cancer in a human. The invention includes relates to
administering a genetically modified T cell to express a CAR
wherein the CAR comprises an antigen binding domain, a
transmembrane domain, a costimulatory signaling region, and a CD3
zeta signaling domain.
Inventors: |
June; Carl H.; (Merion
Station, PA) ; Levine; Bruce L.; (Cherry Hill,
NJ) ; Porter; David L.; (Springfield, PA) ;
Kalos; Michael D.; (Philadelphila, PA) ; Milone;
Michael C.; (Cherry Hill, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Trustees of the University of Pennsylvania |
Philadelphia |
PA |
US |
|
|
Family ID: |
46207528 |
Appl. No.: |
15/353899 |
Filed: |
November 17, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13992622 |
Jul 9, 2013 |
9499629 |
|
|
PCT/US2011/064191 |
Dec 9, 2011 |
|
|
|
15353899 |
|
|
|
|
61421470 |
Dec 9, 2010 |
|
|
|
61502649 |
Jun 29, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/2896 20130101;
A61K 39/001112 20180801; A61P 43/00 20180101; C12N 15/85 20130101;
C12N 2501/51 20130101; C07K 2319/03 20130101; C07K 2319/33
20130101; C12N 2510/00 20130101; C07K 14/70517 20130101; C12N 7/00
20130101; A61K 2039/5256 20130101; C07K 16/30 20130101; C07K
2317/622 20130101; A61K 38/1774 20130101; C07K 2319/02 20130101;
A61K 48/005 20130101; C07K 14/70521 20130101; C07K 2317/76
20130101; C07K 14/7051 20130101; C12N 2740/15071 20130101; C12N
15/861 20130101; A61P 35/00 20180101; A61P 37/02 20180101; C07K
16/2803 20130101; C07K 16/3061 20130101; A61K 2039/5158 20130101;
A61P 35/02 20180101; C07K 2319/30 20130101; A61K 35/17 20130101;
C12N 2740/15043 20130101; C07K 2319/00 20130101; A61K 45/06
20130101; A61K 2039/5156 20130101; A61K 38/177 20130101; A61P 37/04
20180101; C07K 14/70578 20130101; C07K 2317/53 20130101; C12N
2740/15034 20130101; A61K 2039/585 20130101; C07K 14/70596
20130101; A61K 39/0011 20130101; A61K 39/39558 20130101; A61K
2039/505 20130101; C07K 2317/80 20130101; C12N 5/0636 20130101;
C07K 14/525 20130101; C07K 14/075 20130101; C07K 2319/74 20130101;
C12N 2501/515 20130101; A61K 39/39558 20130101; A61K 2300/00
20130101 |
International
Class: |
C12N 5/0783 20060101
C12N005/0783; C12N 15/861 20060101 C12N015/861; C07K 14/075
20060101 C07K014/075 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under grant
numbers K24 CA11787901, R01CA120409, 1RO1CA105216, RO1AI057838 and
RO11113482 awarded by the National Institutes of Health. The
Government therefore has certain rights in the invention.
Claims
1. A human memory T cell comprising a nucleic acid sequence that
encodes a chimeric antigen receptor (CAR), wherein the CAR
comprises a CD19 antigen binding domain, a transmembrane domain, a
co-stimulatory signaling region and a CD3 zeta signaling domain,
wherein the human memory T cell is of a human having cancer.
2. The human memory T cell of claim 1, wherein the CD19 antigen
binding domain is a Fab or scFv.
3. The human memory T cell of claim 2, wherein the CD19 antigen
binding domain is a scFv.
4. The human memory T cell of claim 1, wherein the transmembrane
domain comprises CD8 transmembrane domain.
5. The human memory T cell of claim 1, wherein the co-stimulatory
signaling region is CD27 or 4-1BB.
6. The human memory T cell of claim 1, wherein the CAR further
comprises a hinge region.
7. The human memory T cell of claim 6, wherein the hinge region
comprises a CD8.alpha. hinge region.
8. A human memory T cell comprising a chimeric antigen receptor
(CAR), wherein the CAR comprises a CD19 antigen binding domain, a
transmembrane domain, a co-stimulatory signaling region and a CD3
zeta signaling domain, wherein the human memory T cell is of a
human having cancer.
9. The human memory T cell of claim 8, wherein the CD19 antigen
binding domain is a Fab or scFv.
10. The human memory T cell of claim 9, wherein the CD19 antigen
binding domain is a scFv.
11. The human memory T cell of claim 8, wherein the transmembrane
domain comprises CD8 transmembrane domain.
12. The human memory T cell of claim 8, wherein the co-stimulatory
signaling region is CD27 or 4-1BB.
13. The human memory T cell of claim 8, wherein the CAR further
comprises a hinge region.
14. The human memory T cell of claim 13, wherein the hinge region
comprises a CD8.alpha. hinge region.
15. A persisting population of human T cells comprising a nucleic
acid sequence that encodes a chimeric antigen receptor (CAR),
wherein the CAR comprises a CD19 antigen binding domain, a
transmembrane domain, a co-stimulatory signaling region and a CD3
zeta signaling domain, wherein the persisting population of T cells
are of a human having cancer.
16. The persisting population of human T cells of claim 15, wherein
the CD19 antigen binding domain is a Fab or scFv.
17. The persisting population of human T cells of claim 16, wherein
the CD19 antigen binding domain is a scFv.
18. The persisting population of human T cells of claim 15, wherein
the transmembrane domain comprises CD8 transmembrane domain.
19. The persisting population of human T cells of claim 15, wherein
the co-stimulatory signaling region is CD27 or 4-1BB.
20. The persisting population of human T cells of claim 15, wherein
the CAR further comprises a hinge region.
21. The persisting population of human T cells of claim 20, wherein
the hinge region comprises a CD8.alpha. hinge region.
22. A persisting population of human T cells comprising a chimeric
antigen receptor (CAR), wherein the CAR comprises a CD19 antigen
binding domain, a transmembrane domain, a co-stimulatory signaling
region and a CD3 zeta signaling domain, wherein the persisting
population of T cells are of a human having cancer.
23. The persisting population of human T cells of claim 22, wherein
the CD19 antigen binding domain is a Fab or scFv.
24. The persisting population of human T cells of claim 23, wherein
the CD19 antigen binding domain is a scFv.
25. The persisting population of human T cells of claim 22, wherein
the transmembrane domain comprises CD8 transmembrane domain.
26. The persisting population of human T cells of claim 22, wherein
the co-stimulatory signaling region is CD27 or 4-1BB.
27. The persisting population of human T cells of claim 22, wherein
the CAR further comprises a hinge region.
28. The persisting population of human T cells of claim 27, wherein
the hinge region comprises a CD8.alpha. hinge region.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/992,622, filed Jun. 7, 2013, which is a
U.S. national phase application filed under 35 U.S.C. .sctn.371
claiming benefit to International Patent Application No.
PCT/US2011/064191, filed on Dec. 9, 2011, which is entitled to
priority under 35 U.S.C. .sctn.119(e) to U.S. Provisional Patent
Application No. 61/421,470, filed on Dec. 9, 2010 and U.S.
Provisional Patent Application No. 61/502,649, filed on Jun. 29,
2011, each of which application is hereby incorporated herein by
reference in its entirety.
BACKGROUND OF THE INVENTION
[0003] The large majority of patients having B-cell malignancies,
including chronic lymphocytic leukemia (CLL), will die from their
disease. One approach to treating these patients is to genetically
modify T cells to target antigens expressed on tumor cells through
the expression of chimeric antigen receptors (CARs). CARs are
antigen receptors that are designed to recognize cell surface
antigens in a human leukocyte antigen-independent manner. Attempts
in using genetically modified cells expressing CARs to treat these
types of patients have met with very limited success. See for
example, Brentjens et al., 2010, Molecular Therapy, 18:4, 666-668;
Morgan et al., 2010, Molecular Therapy, published online February
23, 2010, pages 1-9; and, Till et al., 2008, Blood,
112:2261-2271.
[0004] In most cancers, tumor-specific antigens are not yet well
defined, but in B cell malignancies, CD19 is an attractive tumor
target. Expression of CD19 is restricted to normal and malignant B
cells (Uckun, et al. Blood, 1988, 71:13-29), so that CD19 is a
widely accepted target to safely test CARs. While CARs can trigger
T-cell activation in a manner similar to an endogenous T-cell
receptor, a major impediment to the clinical application of this
technology to date has been limited in vivo expansion of CAR+ T
cells, rapid disappearance of the cells after infusion, and
disappointing clinical activity (Jena, et al., Blood, 2010,
116:1035-1044; Uckun, et al. Blood, 1988, 71:13-29).
[0005] Thus, there is an urgent need in the art for compositions
and methods for treatment of cancer using CARs that can expand in
vivo. The present invention addresses this need.
SUMMARY OF THE INVENTION
[0006] The present invention provides an isolated nucleic acid
sequence encoding a chimeric antigen receptor (CAR), wherein the
CAR comprises an antigen binding domain, a transmembrane domain, a
costimulatory signaling region, and a CD3 zeta signaling domain,
wherein the CD3 zeta signaling domain comprises the amino acid
sequence of SEQ ID NO: 24.
[0007] In one embodiment, the nucleic acid sequence encodes a CAR
comprising the amino acid sequence of SEQ ID NO: 12.
[0008] In one embodiment, the nucleic acid sequence encoding a CAR
comprises the nucleic acid sequence of SEQ ID NO: 8.
[0009] In one embodiment, the antigen binding domain in the CAR is
an antibody or an antigen-binding fragment thereof. Preferably, the
antigen-binding fragment is a Fab or a scFv.
[0010] In one embodiment, the antigen binding domain in the CAR
binds to a tumor antigen. In one embodiment, the tumor antigen is
associated with a hematologic malignancy. In another embodiment,
the tumor antigen is associated with a solid tumor. In yet another
embodiment, the tumor antigen is selected from the group consisting
of CD19, CD20, CD22, ROR1, mesothelin, CD33/IL3Ra, c-Met, PSMA,
Glycolipid F77, EGFRvIII, GD-2, NY-ESO-1 TCR, MAGE A3 TCR, and any
combination thereof.
[0011] In one embodiment, the costimulatory signaling region in the
CAR comprises the intracellular domain of a costimulatory molecule
selected from the group consisting of CD27, CD28, 4-1BB, OX40,
CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1
(LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically
binds with CD83, and any combination thereof.
[0012] In one embodiment, the CD3 zeta signaling domain in the CAR
is encoded by the nucleic acid sequence of SEQ ID NO: 18.
[0013] The invention also provides an isolated CAR comprising an
antigen binding domain, a transmembrane domain, a costimulatory
signaling region, and a CD3 zeta signaling domain, wherein the CD3
zeta signaling domain comprises the amino acid sequence of SEQ ID
NO: 24.
[0014] The invention also provides a cell comprising a nucleic acid
sequence encoding a CAR, wherein the CAR comprises an antigen
binding domain, a transmembrane domain, a costimulatory signaling
region, and a CD3 zeta signaling domain comprising the amino acid
sequence of SEQ ID NO: 24.
[0015] In one embodiment, the cell comprising the CAR is selected
from the group consisting of a T cell, a Natural Killer (NK) cell,
a cytotoxic T lymphocyte (CTL), and a regulatory T cell.
[0016] In one embodiment, the cell comprising the CAR exhibits an
anti-tumor immunity when the antigen binding domain of the CAR
binds to its corresponding antigen.
[0017] The invention also provides a vector comprising a nucleic
acid sequence encoding a CAR, wherein the CAR comprises an antigen
binding domain, a costimulatory signaling region, and a CD3 zeta
signaling domain, wherein the CD3 zeta signaling domain comprises
the amino acid sequence of SEQ ID NO: 24.
[0018] The invention also provides a method for stimulating a T
cell-mediated immune response to a target cell population or tissue
in a mammal. In one embodiment, the method comprises administering
to a mammal an effective amount of a cell genetically modified to
express a CAR wherein the CAR comprises an antigen binding domain,
a costimulatory signaling region, and a CD3 zeta signaling domain
comprising the amino acid sequence of SEQ ID NO: 24, wherein the
antigen binding domain is selected to specifically recognize the
target cell population or tissue.
[0019] The invention also provides a method of providing an
anti-tumor immunity in a mammal. In one embodiment, the method
comprises administering to a mammal an effective amount of a cell
genetically modified to express a CAR wherein the CAR comprises an
antigen binding domain, a costimulatory signaling region, and a CD3
zeta signaling domain comprising the amino acid sequence of SEQ ID
NO: 24, thereby providing an anti-tumor immunity in the mammal.
[0020] The invention also includes a method of treating a mammal
having a disease, disorder or condition associated with an elevated
expression of a tumor antigen. In one embodiment, the method
comprises administering to a mammal an effective amount of a cell
genetically modified to express a CAR wherein the CAR comprises an
antigen binding domain, a costimulatory signaling region, and a CD3
zeta signaling domain comprising the amino acid sequence of SEQ ID
NO: 24, thereby treating the mammal.
[0021] In one embodiment, the cell is an autologous T cell.
[0022] In one embodiment, the tumor antigen is selected from the
group consisting of CD19, CD20, CD22, ROR1, mesothelin, CD33/IL3Ra,
c-Met, PSMA, Glycolipid F77, EGFRvIII, GD-2, NY-ESO-1 TCR, MAGE A3
TCR, and any combination thereof.
[0023] The invention also provides a method of treating a human
with chronic lymphocytic leukemia. In one embodiment, the method
comprises administering to a human a T cell genetically engineered
to express a CAR wherein the CAR comprises an antigen binding
domain, a costimulatory signaling region, and a CD3 zeta signaling
domain comprising the amino acid sequence of SEQ ID NO: 24.
[0024] In one embodiment, the human is resistant to at least one
chemotherapeutic agent
[0025] In one embodiment, the chronic lymphocytic leukemia is
refractory CD19+ leukemia and lymphoma.
[0026] The invention also includes a method of generating a
persisting population of genetically engineered T cells in a human
diagnosed with cancer. In one embodiment, the method comprises
administering to a human a T cell genetically engineered to express
a CAR wherein the CAR comprises an antigen binding domain, a
costimulatory signaling region, and a CD3 zeta signaling domain
comprising the amino acid sequence of SEQ ID NO: 24, wherein the
persisting population of genetically engineered T cells persists in
the human for at least one month after administration.
[0027] In one embodiment, the persisting population of genetically
engineered T cells comprises at least one cell selected from the
group consisting of a T cell that was administered to the human, a
progeny of a T cell that was administered to the human, and a
combination thereof.
[0028] In one embodiment, the persisting population of genetically
engineered T cells comprises a memory T cell.
[0029] In one embodiment, the persisting population of genetically
engineered T cells persists in the human for at least three months
after administration. In another embodiment, the persisting
population of genetically engineered T cells persists in the human
for at least four months, five months, six months, seven months,
eight months, nine months, ten months, eleven months, twelve
months, two years, or three years after administration.
[0030] In one embodiment, the chronic lymphocytic leukemia is
treated.
[0031] The invention also provides a method of expanding a
population of genetically engineered T cells in a human diagnosed
with cancer. In one embodiment, the method comprises administering
to a human a T cell genetically engineered to express a CAR wherein
the CAR comprises an antigen binding domain, a costimulatory
signaling region, and a CD3 zeta signaling domain comprising the
amino acid sequence of SEQ ID NO: 24, wherein the administered
genetically engineered T cell produces a population of progeny T
cells in the human.
[0032] In one embodiment, the progeny T cells in the human comprise
a memory T cell.
[0033] In one embodiment, the T cell is an autologous T cell.
[0034] In another embodiment, the human is resistant to at least
one chemotherapeutic agent.
[0035] In one embodiment, the cancer is chronic lymphocytic
leukemia. In another embodiment, the chronic lymphocytic leukemia
is refractory CD19+ leukemia and lymphoma.
[0036] In one embodiment, the population of progeny T cells
persists in the human for at least three months after
administration. In another embodiment, the population of progeny T
cells persist in the human for at least four months, five months,
six months, seven months, eight months, nine months, ten months,
eleven months, twelve months, two years, or three years after
administration.
[0037] In one embodiment, the cancer is treated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The following detailed description of preferred embodiments
of the invention will be better understood when read in conjunction
with the appended drawings. For the purpose of illustrating the
invention, there are shown in the drawings embodiments which are
presently preferred. It should be understood, however, that the
invention is not limited to the precise arrangements and
instrumentalities of the embodiments shown in the drawings.
[0039] FIGS. 1A through 1C are a series of images of the schematic
representations of the gene-transfer vector and transgene, gene
modified T cell manufacturing and clinical protocol design. FIG. 1A
depicts the lentiviral vectors and transgene that show the major
functional elements. A vesicular stomatitis virus protein G
pseudotyped clinical grade lentiviral vector (designated pELPs
19BBz) directing expression of anti-CD19 scFv derived from FMC63
murine monoclonal antibody, human CD8.alpha. hinge and
transmembrane domain, and human 4-1BB and CD3zeta signaling domains
was produced. Constitutive expression of the transgene was directed
by inclusion of an EF-1.alpha. (elongation factor-1.alpha.
promoter); LTR, long terminal repeat; RRE, rev response element.
(cPPT) and the central termination sequence (CTS). Figure is not to
scale. FIG. 1B depicts T cell manufacturing. Autologous cells were
obtained via an apheresis, and T cells were enriched by mononuclear
cell elutriation, washed and residual leukemia cells depleted by
addition of anti-CD3/CD28 coated paramagnetic beads for positive
selection and activation of T cells. Lentiviral vector was added at
the time of cell activation and was washed out on day 3 post
culture initiation. Cells were expanded on a rocking platform
device (WAVE Bioreactor System) for 8-12 days. On the final day of
culture the beads were removed by passage over a magnetic field and
the CART19 T cells harvested and cryopreserved in infusible medium.
FIG. 1C depicts the clinical protocol design. Patients were given
lymphodepleting chemotherapy as described, followed by CART19
infusion #1 by i.v. gravity flow drip over a period of 15-20
minutes. The infusion was given using a split dose approach over 3
days (10%, 30%, 60%) beginning 1 to 5 days after completion of
chemotherapy. Endpoint assays were conducted on study week 4. At
the conclusion of active monitoring, subjects were transferred to a
destination protocol for long term follow up as per FDA
guidance.
[0040] FIGS. 2A through 2F are a series of images demonstrating
sustained in vivo expansion and persistence in blood and marrow of
CART19 cells. DNA isolated from whole blood as depicted in FIG. 2A
through 2C or marrow as depicted in FIG. 2D through 2F, samples
obtained from UPN 01 as depicted in FIGS. 2A and 2D, UPN 02 as
depicted in FIGS. 2B and 2E and UPN 03 as depicted in FIGS. 2C and
2F was subjected in bulk to Q-PCR analysis using a qualified assay
to detect and quantify CART19 sequences. Each data point represents
the average of triplicate measurements on 100-200 ng genomic DNA,
with maximal % CV less than 1.56%. Pass/fail parameters for the
assay included pre-established ranges for slope and efficiency of
amplification, and amplification of a reference sample. The lower
limit of quantification for the assay established by the standard
curve range was 2 copies transgene/microgram genomic DNA; sample
values below that number are considered estimates and presented if
at least 2/3 replicates generated a Ct value with % CV for the
values 15%. CART19 cells were infused at day 0, 1, and 2 for UPN 01
and UPN 03, and days 0, 1, 2 and 11 for UPN 02.
[0041] FIGS. 3A through 3D are a series of images demonstrating
serum and bone marrow cytokines before and after CAR T cell
infusion; longitudinal measurements of changes in serum cytokines,
chemokines and cytokine receptors in UPN 01 as depicted in FIG. 3A,
UPN 02 as depicted in FIG. 3B and UPN 03 as depicted in FIG. 3C, on
the indicated day after CART19 cell infusion and serial assessments
of the same analytes in the bone marrow from UPN 03 as depicted in
FIG. 3D. Samples were subjected multiplex analysis using Luminex
bead array technology and pre-assembled and validated multiplex
kits. Analytes with a >=3 fold change are indicated, and plotted
as relative change from baseline as depicted in FIG. 3A through 3C
or as absolute values as depicted in FIG. 3D. Absolute values for
each analyte at each time-point were derived from a recombinant
protein-based standard curve over a 3-fold 8-point dilution series,
with upper and lower limits of quantification (ULOQ, LLOQ)
determined by the 80-120% observed/expected cutoff values for the
standard curves. Each sample was evaluated in duplicate with
average values calculated and % CV in most cases less than 10%. To
accommodate consolidated data presentation in the context of the
wide range for the absolute values, data are presented as
fold-change over the baseline value for each analyte. In cases
where baseline values were not detectable, half of the lowest
standard curve value was used as the baseline value. Standard curve
ranges for analytes and baseline (day 0) values (listed in
parentheses sequentially for UPN01, 02 and 03), all in pg/ml:
IL1-R.alpha.: 35.5-29,318 (689, 301, 287); IL-6: 2.7-4,572 (7,
10.1, 8.7); IFN-.gamma.: 11.2-23,972 (2.8, ND, 4.2); CXCL10:
2.1-5,319 (481, 115, 287); MIP-1.beta.: 3.3-7,233 (99.7, 371, 174);
MCP-1: 4.8-3,600 (403, 560, 828); CXCL9: 48.2-3,700 (1,412, 126,
177); IL2-R.alpha.: 13.4-34,210 (4,319, 9,477, 610); IL-8:
2.4-5,278 (15.3, 14.5, 14.6); IL-10: 6.7-13,874 (8.5, 5.4, 0.7);
MIP-1.alpha.: 7.1-13,778 (57.6, 57.3, 48.1).
[0042] FIGS. 4A through 4D are a series of images depicting
prolonged surface CART19 expression and establishment of functional
memory CARs in vivo. FIG. 4A depicts detection of CAR-expressing
CD3+ lymphocytes and absence of B cells in periphery and marrow.
Freshly processed peripheral blood or marrow mononuclear cells
obtained from UPN 03 at day 169 post-CART19 cell infusion were
evaluated by flow-cytometry for surface expression of CAR19 (top)
or presence of B cells (bottom); as a control, PBMC obtained from a
healthy donor ND365 were stained. The gating strategy for the CD3+
and B cell populations is presented in FIG. 9. To evaluate CAR19
expression in CD3+ lymphocytes, samples were co-stained with
antibodies to CD14-PE-Cy7 and CD16-PE-Cy7 (dump channel) and
CD3-FITC, positively gated on CD3+, and evaluated for CAR19
expression in the CD8+ and CD8-lymphocyte compartments by
co-staining with CD8a-PE and the anti-CAR19 idiotype antibody
conjugated to Alexa-647. Data in plots are gated on the dump
channel-negative/CD3-positive cell population. To evaluate the
presence of B cells, samples were co-stained with antibodies to
CD14-APC and CD3-FITC (dump channels) and evaluated for the
presence of B cells in the dump channel-negative fraction by
co-staining with antibodies to CD20-PE and CD19-PE-Cy-7. In all
cases, negative gate quadrants were established on no-stain
controls as depicted in FIGS. 4B and 4C. T cell immunophenotyping
of CD4+ (FIG. 4B) and CD8+ (FIG. 4C) T cell subsets is shown.
Frozen peripheral blood samples from UPN 03 obtained by apheresis
at day 56 and 169 post T cell infusion were rested overnight in
culture medium with no added factors, washed, and subjected to
multi-parametric immunophenotyping for expression of markers of T
cell memory, activation, and exhaustion. The gating strategy, as
depicted in FIG. 8, involved an initial gating on dump channel
(CD14, CD16, Live/Dead Aqua)-negative and CD3-positive cells,
followed by positive gates on CD4+ and CD8+ cells. Gates and
quadrants were established using FMO controls (CAR, CD45RA, PD-1,
CD25, CD127, CCR7) or by gating on positive cell populations (CD3,
CD4, CD8) and clearly delineated subsets (CD27, CD28, CD57); data
were displayed after bi-exponential transformation for objective
visualization of events. FIG. 4D depicts functional competence of
persisting CAR cells. Frozen peripheral blood samples from UPN 03
obtained by apheresis at day 56 and 169 post T cell infusion were
rested overnight in culture medium with no added factors, washed,
and evaluated directly ex-vivo for the ability to recognize
CD19-expressing target cells using CD107 degranulation assays.
Following a two-hour incubation in the presence of anti-CD28,
anti-CD49d, and CD107-FITC, cell mixtures were harvested, washed,
and subjected to multi-parametric flow cytometric analysis to
evaluate the ability of CART19 cells to de-granulate in response to
CD19-expressing targets. The gating strategy involved an initial
gate on dump channels (CD14-PE-Cy7, CD16-PE-Cy7, Live/Dead
Aqua)-negative and CD3-PE-positive cells, followed by gating on
CD8-PE-Texas Red-positive cells; presented data is for the CD8+
gated population. In all cases, negative gate quadrants were
established on no-stain controls.
[0043] FIGS. 5A through 5C are a series of images depicting the
results of experiments evaluating clinical responses after infusion
of CART19 cells. FIG. 5A depicts that UPN 02 was treated with two
cycles of rituximab and bendamustine with minimal response (R/B,
arrow). CART19 T cells were infused beginning 4 days after
bendamustine only (B, arrow). The rituximab and
bendamustine-resistant leukemia was rapidly cleared from blood, as
indicated by a decrease in the absolute lymphocyte count (ALC) from
60,600/.mu.l to 200/.mu.l within 18 days of the infusion.
Corticosteroid treatment was started on day 18 post infusion due to
malaise and non-infectious febrile syndrome. The reference line
(dotted) indicates upper limit of normal for ALC. FIG. 5B depicts
the results of example experiments staining sequential bone marrow
biopsy or clot specimens from patient UPN 01 and 03 for CD20.
Pretreatment infiltration with leukemia present in both patients
was absent on post treatment specimens accompanied by normalization
of cellularity and trilineage hematopoiesis. UPN 01 has not had any
CLL cells detected as assessed by flow cytometry, cytogenetics and
fluorescence in-situ hybridization or normal B cells detected by
flow cytometry in bone marrow or blood. UPN 03 had 5% residual
normal CD5-negative B cells confirmed by flow cytometry on day +23,
which also showed them to be polyclonal; no normal B cells were
detected at day +176. FIG. 5C depicts the results of experiments
using sequential CT imaging to assess the rapid resolution of
chemotherapy-resistant generalized lymphadenopathy. Bilateral
axillary masses resolved by 83 (UPN 01) and 31 (UPN 03) days post
infusion, as indicated by arrows and circle.
[0044] FIGS. 6A through 6C are a series of images depicting
absolute lymphocyte counts and total CART19+ cells in circulation
for UPN 01, 02, 03. The total number of lymphocytes (Total normal
and CLL cells) vs. Total CART19+ cells in circulation is plotted
for all 3 subjects using the absolute lymphocyte count from CBC
values, and assuming a 5.0 L volume of blood. The total number of
CART19 cells in circulation was calculated by using the tandem CBC
values with absolute lymphocyte counts and the Q-PCR marking values
as depicted in FIG. 2, converting copies/.mu.g DNA to average %
marking as described elsewhere herein. The Q-PCR % marking was
found to correlate closely (<2 fold variation) with the flow
cytometric characterization of the infusion products and with data
from samples where concomitant flow cytometry data was available to
directly enumerate CART19 cells by staining.
[0045] FIGS. 7A through 7D are a series of images depicting
experiments involving the direct ex vivo detection of
CART19-positive cells in UPN-01 PBMC 71 days post-T cell infusion.
UPN-01 PBMC collected either fresh post-apheresis on day 71 day
post infusion, or frozen at the time of apheresis for manufacture
of the T cell product (baseline) and viably thawed prior to the
staining, were subjected to flow-cytometric analysis to detect the
presence of CART19 cells that express the CAR19 moiety on the
surface. To evaluate the expression of CAR19 in lymphocytes,
samples were co-stained with CD3-PE and the anti-CAR19 idiotype
antibody conjugated to Alexa-647, or co-stained with CD3-PE alone
(FMO for CAR19). FIG. 7A depicts that an initial lymphocyte gate
was established based on forward and side scatter (FSC vs SSC),
followed by gating on CD3+ cells. FIG. 7B depicts CD330 lymphocyte
gate; FIG. 7C depicts CAR idiotype stain; FIG. 7D depicts CAR
idiotype FMO. The CAR19-positive gate was established on the CAR19
FMO samples.
[0046] FIGS. 8A through 8C are a series of images depicting the
gating strategy to identify CART19 expression by using
polychromatic flow cytometry in UPN 03 blood specimens. The gating
strategy for FIG. 8C is shown for the UPN 03 Day 56 sample and is
representative of the strategy used on the UPN 03 Day 169 sample.
FIG. 8A depicts primary gate: Dump (CD14, CD16, LIVE/dead Aqua)
negative, CD3-positive. FIG. 8B depicts secondary gates:
CD4-positive, CD8-positive. FIG. 8C depicts tertiary gates:
CAR19-positive and CAR19-negative, established on CAR FMO samples
(right-most panels).
[0047] FIG. 9 depicts the gating strategy to directly identify
CART19 expression and B cells in blood and marrow specimens. The
gating strategy for FIG. 4A, which shows detection of
CAR-expressing CD3+ lymphocytes and absence of B cells in periphery
and marrow: Leftplot: Cell gate; Upper panel: positive gate for
CD3+ cells, Lower panel: negative gate (CD14-negative,
CD3-negative) for B cells. NC365, peripheral blood control cells
from a healthy donor
[0048] FIG. 10 is an image summarizing the patient demographics and
response.
[0049] FIG. 11 depicts the manufacturing process of CART-19
cells
[0050] FIGS. 12 12A through 12D are a series of images depicting
the clinical response in a patient. FIG. 12A shows the lentiviral
vector used to infect T cells from the patient. A pseudotyped,
clinical-grade lentiviral vector of vesicular stomatitis virus
protein G (pELPs 19-BB-z) directing expression of anti-CD19 scFv
derived from FMC63 murine monoclonal antibody, human CD8.alpha.
hinge and transmembrane domain, and human 4-1BB and CD3.xi.
signaling domains was produced. Details of the CAR19 transgene, at
the bottom of FIG. 12A, show the major functional elements. The
figure is not to scale. 3'LTR denotes 3' long terminal repeat;
5'LTR, 5' long terminal repeat; Amp R, ampicillin resistance gene;
Bovine GH Poly A, bovine growth hormone with polyadenylation tail;
cPPT/CTS, central polypurine tract with central termination
sequence; EF-1.alpha., elongation factor 1-alpha; env, envelope;
gag, group-specific antigen; pol, HIV gene encoding polymerase and
reverse transcriptase; R, repeat; RRE, rev response element; scFv,
single-chain variable fragment; TM, transmembrane; and WPRE,
woodchuck hepatitis virus post-transcriptional regulatory element.
FIG. 12B shows serum creatinine, uric acid, and lactate
dehydrogenase (LDH) levels from day 1 to day 28 after the first
CART19-cell infusion. The peak levels coincided with
hospitalization for the tumor lysis syndrome. FIG. 12C shows bone
marrow-biopsy specimens obtained 3 days after chemotherapy (day -1,
before CART19-cell infusion) and 23 days and 6 months after
CART19-cell infusion (hematoxylin and eosin). The baseline specimen
shows hypercellular bone marrow (60%) with trilineage
hematopoiesis, infiltrated by predominantly interstitial aggregates
of small, mature lymphocytes that account for 40% of total
cellularity. The specimen obtained on day 23 shows residual
lymphoid aggregates (10%) that were negative for chronic lymphoid
leukemia (CLL), with a mixture of T cells and CD5-negative B cells.
The specimen obtained 6 months after infusion shows trilineage
hematopoiesis, without lymphoid aggregates and continued absence of
CLL. FIG. 12D shows contrast-enhanced CT scans obtained before the
patient was enrolled in the study and 31 days and 104 days after
the first infusion. The preinfusion CT scan reveals 1-to-3-cm
bilateral masses. Regression of axillary lymphadenopathy occurred
within 1 month after infusion and was sustained. Arrows highlight
various enlarged lymph nodes before therapy and lymph-node
responses on comparable CT scans after therapy.
[0051] FIGS. 13A through 13E are a series of images depicting serum
and bone marrow cytokines before and after chimeric antigen
receptor T-cell infusion. Serial measurements of the cytokine
interferon-.gamma. (FIG. 13A), the interferon-.gamma.-stimulated
chemokines C-X-C motif chemokine 10 (CXCL10) (FIG. 13B) and C-X-C
motif ligand 9 (CXCL9) (FIG. 13C), and interleukin-6 (FIG. 13D)
were measured at the indicated time points. The increases in these
inflammatory cytokines and chemokines coincided with the onset of
the tumor lysis syndrome. Low levels of interleukin-6 were detected
at baseline, whereas interferon-.gamma., CXCL9, and CXCL10 were
below the limits of detection at baseline. Standard-curve ranges
for the analytes and baseline values in the patient, given in
parentheses, were as follows: interferon-.gamma., 11.2 to 23,972 pg
per milliliter (1.4 pg per milliliter); CXCL10, 2.1 to 5319 pg per
milliliter (274 pg per milliliter); CXCL9, 48.2 to 3700 pg per
milliliter (177 pg per milliliter); interleukin-6, 2.7 to 4572 pg
per milliliter (8.3 pg per milliliter); tumor necrosis factor .pi.
(TNF-.alpha.), 1.9 to 4005 pg per milliliter (not detectable); and
soluble interleukin-2 receptor, 13.4 to 34,210 pg per milliliter
(644 pg per milliliter). FIG. 13E shows the induction of the immune
response in bone marrow. The cytokines TNF-.alpha., interleukin-6,
interferon-.gamma., chemokine CXCL9, and soluble interleukin-2
receptor were measured in supernatant fluids obtained from bone
marrow aspirates on the indicated days before and after CART19-cell
infusion. The increases in levels of interleukin-6,
interferon-.gamma., CXCL9, and soluble interleukin-2 receptor
coincided with the tumor lysis syndrome, peak chimeric antigen
receptor T-cell infiltration, and eradication of the leukemic
infiltrate.
[0052] FIGS. 14A through 14C are a series of images depicting
expansion and persistence of chimeric antigen receptor T cells in
vivo. Genomic DNA (gDNA) was isolated from samples of the patient's
whole blood (FIG. 14A) and bone marrow aspirates (FIG. 14B)
collected at serial time points before and after chimeric antigen
receptor T-cell infusion and used for quantitative real-time
polymerase-chain-reaction (PCR) analysis. As assessed on the basis
of transgenic DNA and the percentage of lymphocytes expressing
CAR19, the chimeric antigen receptor T cells expanded to levels
that were more than 1000 times as high as initial engraftment
levels in the peripheral blood and bone marrow. Peak levels of
chimeric antigen receptor T cells were temporally correlated with
the tumor lysis syndrome. A blood sample obtained on day 0 and a
bone marrow sample obtained on day 1 had no PCR signal at baseline.
Flow-cytometric analysis of bone marrow aspirates at baseline (FIG.
14C) shows predominant infiltration with CD19+CD5+ cells that were
clonal, as assessed by means of immunoglobulin kappa light-chain
staining, with a paucity of T cells. On day 31 after infusion, CD5+
T cells were present, and no normal or malignant B cells were
detected. The numbers indicate the relative frequency of cells in
each quadrant. Both the x axis and the y axis show a log 10 scale.
The gating strategy involved an initial gating on CD19+ and CD5+
cells in the boxes on the left, and the subsequent identification
of immunoglobulin kappa and lambda expression on the CD19+CD5+
subset (boxes on the right)
DETAILED DESCRIPTION
[0053] The invention relates to compositions and methods for
treating cancer including but not limited to hematologic
malignancies and solid tumors. The present invention relates to a
strategy of adoptive cell transfer of T cells transduced to express
a chimeric antigen receptor (CAR). CARs are molecules that combine
antibody-based specificity for a desired antigen (e.g., tumor
antigen) with a T cell receptor-activating intracellular domain to
generate a chimeric protein that exhibits a specific anti-tumor
cellular immune activity.
[0054] The present invention relates generally to the use of T
cells genetically modified to stably express a desired CAR. T cells
expressing a CAR are referred to herein as CAR T cells or CAR
modified T cells. Preferably, the cell can be genetically modified
to stably express an antibody binding domain on its surface,
conferring novel antigen specificity that is MHC independent. In
some instances, the T cell is genetically modified to stably
express a CAR that combines an antigen recognition domain of a
specific antibody with an intracellular domain of the CD3-zeta
chain or Fc.gamma.RI protein into a single chimeric protein.
[0055] In one embodiment, the CAR of the invention comprises an
extracellular domain having an antigen recognition domain, a
transmembrane domain, and a cytoplasmic domain. In one embodiment,
the transmembrane domain that naturally is associated with one of
the domains in the CAR is used. In another embodiment, the
transmembrane domain can be selected or modified by amino acid
substitution to avoid binding of such domains to the transmembrane
domains of the same or different surface membrane proteins to
minimize interactions with other members of the receptor complex.
Preferably, the transmembrane domain is the CD8.alpha. hinge
domain.
[0056] With respect to the cytoplasmic domain, the CAR of the
invention can be designed to comprise the CD28 and/or 4-1BB
signaling domain by itself or be combined with any other desired
cytoplasmic domain(s) useful in the context of the CAR of the
invention. In one embodiment, the cytoplasmic domain of the CAR can
be designed to further comprise the signaling domain of CD3-zeta.
For example, the cytoplasmic domain of the CAR can include but is
not limited to CD3-zeta, 4-1BB and CD28 signaling modules and
combinations thereof. Accordingly, the invention provides CAR T
cells and methods of their use for adoptive therapy.
[0057] In one embodiment, the CAR T cells of the invention can be
generated by introducing a lentiviral vector comprising a desired
CAR, for example a CAR comprising anti-CD19, CD8.alpha. hinge and
transmembrane domain, and human 4-1BB and CD3zeta signaling
domains, into the cells. The CAR T cells of the invention are able
to replicate in vivo resulting in long-term persistence that can
lead to sustained tumor control.
[0058] In one embodiment the invention relates to administering a
genetically modified T cell expressing a CAR for the treatment of a
patient having cancer or at risk of having cancer using lymphocyte
infusion. Preferably, autologous lymphocyte infusion is used in the
treatment. Autologous PBMCs are collected from a patient in need of
treatment and T cells are activated and expanded using the methods
described herein and known in the art and then infused back into
the patient.
[0059] In yet another embodiment, the invention relates generally
to the treatment of a patient at risk of developing CLL. The
invention also includes treating a malignancy or an autoimmune
disease in which chemotherapy and/or immunotherapy in a patient
results in significant immunosuppression in the patient, thereby
increasing the risk of the patient of developing CLL.
[0060] The invention includes using T cells expressing an anti-CD19
CAR including both CD3-zeta and the 4-1BB costimulatory domain
(also referred to as CART19 T cells). The CART19 T cells of the
invention can undergo robust in vivo T cell expansion and can
establish CD19-specific memory cells that persist at high levels
for an extended amount of time in blood and bone marrow. In some
instances, the CART19 T cells of the invention infused into a
patient can eliminate leukemia cells in vivo in patients with
advanced chemotherapy-resistant CLL. However, the invention is not
limited to CART19 T cells. Rather, the invention includes any
antigen binding moiety fused with one or more intracellular domains
selected from the group of a CD137 (4-1BB) signaling domain, a CD28
signaling domain, a CD3zeta signal domain, and any combination
thereof.
DEFINITIONS
[0061] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the present
invention, the preferred materials and methods are described
herein. In describing and claiming the present invention, the
following terminology will be used.
[0062] It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting.
[0063] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0064] "About" as used herein when referring to a measurable value
such as an amount, a temporal duration, and the like, is meant to
encompass variations of .+-.20% or .+-.10%, more preferably .+-.5%,
even more preferably .+-.1%, and still more preferably .+-.0.1%
from the specified value, as such variations are appropriate to
perform the disclosed methods.
[0065] "Activation", as used herein, refers to the state of a T
cell that has been sufficiently stimulated to induce detectable
cellular proliferation. Activation can also be associated with
induced cytokine production, and detectable effector functions. The
term "activated T cells" refers to, among other things, T cells
that are undergoing cell division.
[0066] The term "antibody," as used herein, refers to an
immunoglobulin molecule which specifically binds with an antigen.
Antibodies can be intact immunoglobulins derived from natural
sources or from recombinant sources and can be immunoreactive
portions of intact immunoglobulins. Antibodies are typically
tetramers of immunoglobulin molecules. The antibodies in the
present invention may exist in a variety of forms including, for
example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and
F(ab).sub.2, as well as single chain antibodies and humanized
antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al.,
1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor,
N.Y.; Houston et al., 1988, Proc. Natl. Acad. Sci. USA
85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0067] The term "antibody fragment" refers to a portion of an
intact antibody and refers to the antigenic determining variable
regions of an intact antibody. Examples of antibody fragments
include, but are not limited to, Fab, Fab', F(ab')2, and Fv
fragments, linear antibodies, scFv antibodies, and multispecific
antibodies formed from antibody fragments.
[0068] An "antibody heavy chain," as used herein, refers to the
larger of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
[0069] An "antibody light chain," as used herein, refers to the
smaller of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
.kappa. and .lamda. light chains refer to the two major antibody
light chain isotypes.
[0070] By the term "synthetic antibody" as used herein, is meant an
antibody which is generated using recombinant DNA technology, such
as, for example, an antibody expressed by a bacteriophage as
described herein. The term should also be construed to mean an
antibody which has been generated by the synthesis of a DNA
molecule encoding the antibody and which DNA molecule expresses an
antibody protein, or an amino acid sequence specifying the
antibody, wherein the DNA or amino acid sequence has been obtained
using synthetic DNA or amino acid sequence technology which is
available and well known in the art.
[0071] The term "antigen" or "Ag" as used herein is defined as a
molecule that provokes an immune response. This immune response may
involve either antibody production, or the activation of specific
immunologically-competent cells, or both. The skilled artisan will
understand that any macromolecule, including virtually all proteins
or peptides, can serve as an antigen. Furthermore, antigens can be
derived from recombinant or genomic DNA. A skilled artisan will
understand that any DNA, which comprises a nucleotide sequences or
a partial nucleotide sequence encoding a protein that elicits an
immune response therefore encodes an "antigen" as that term is used
herein. Furthermore, one skilled in the art will understand that an
antigen need not be encoded solely by a full length nucleotide
sequence of a gene. It is readily apparent that the present
invention includes, but is not limited to, the use of partial
nucleotide sequences of more than one gene and that these
nucleotide sequences are arranged in various combinations to elicit
the desired immune response. Moreover, a skilled artisan will
understand that an antigen need not be encoded by a "gene" at all.
It is readily apparent that an antigen can be generated synthesized
or can be derived from a biological sample. Such a biological
sample can include, but is not limited to a tissue sample, a tumor
sample, a cell or a biological fluid.
[0072] The term "anti-tumor effect" as used herein, refers to a
biological effect which can be manifested by a decrease in tumor
volume, a decrease in the number of tumor cells, a decrease in the
number of metastases, an increase in life expectancy, or
amelioration of various physiological symptoms associated with the
cancerous condition. An "anti-tumor effect" can also be manifested
by the ability of the peptides, polynucleotides, cells and
antibodies of the invention in prevention of the occurrence of
tumor in the first place.
[0073] The term "auto-antigen" means, in accordance with the
present invention, any self-antigen which is mistakenly recognized
by the immune system as being foreign. Auto-antigens comprise, but
are not limited to, cellular proteins, phosphoproteins, cellular
surface proteins, cellular lipids, nucleic acids, glycoproteins,
including cell surface receptors.
[0074] The term "autoimmune disease" as used herein is defined as a
disorder that results from an autoimmune response. An autoimmune
disease is the result of an inappropriate and excessive response to
a self-antigen. Examples of autoimmune diseases include but are not
limited to, Addision's disease, alopecia greata, ankylosing
spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's
disease, diabetes (Type I), dystrophic epidermolysis bullosa,
epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr
syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus
erythematosus, multiple sclerosis, myasthenia gravis, pemphigus
vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis,
sarcoidosis, scleroderma, Sjogren's syndrome,
spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema,
pernicious anemia, ulcerative colitis, among others.
[0075] As used herein, the term "autologous" is meant to refer to
any material derived from the same individual to which it is later
to be re-introduced into the individual.
[0076] "Allogeneic" refers to a graft derived from a different
animal of the same species.
[0077] "Xenogeneic" refers to a graft derived from an animal of a
different species.
[0078] The term "cancer" as used herein is defined as disease
characterized by the rapid and uncontrolled growth of aberrant
cells. Cancer cells can spread locally or through the bloodstream
and lymphatic system to other parts of the body. Examples of
various cancers include but are not limited to, breast cancer,
prostate cancer, ovarian cancer, cervical cancer, skin cancer,
pancreatic cancer, colorectal cancer, renal cancer, liver cancer,
brain cancer, lymphoma, leukemia, lung cancer and the like.
[0079] "Co-stimulatory ligand," as the term is used herein,
includes a molecule on an antigen presenting cell (e.g., an aAPC,
dendritic cell, B cell, and the like) that specifically binds a
cognate co-stimulatory molecule on a T cell, thereby providing a
signal which, in addition to the primary signal provided by, for
instance, binding of a TCR/CD3 complex with an MHC molecule loaded
with peptide, mediates a T cell response, including, but not
limited to, proliferation, activation, differentiation, and the
like. A co-stimulatory ligand can include, but is not limited to,
CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L,
inducible costimulatory ligand (ICOS-L), intercellular adhesion
molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM,
lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, HVEM, an agonist or
antibody that binds Toll ligand receptor and a ligand that
specifically binds with B7-H3. A co-stimulatory ligand also
encompasses, inter alia, an antibody that specifically binds with a
co-stimulatory molecule present on a T cell, such as, but not
limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS,
lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT,
NKG2C, B7-H3, and a ligand that specifically binds with CD83.
[0080] A "co-stimulatory molecule" refers to the cognate binding
partner on a T cell that specifically binds with a co-stimulatory
ligand, thereby mediating a co-stimulatory response by the T cell,
such as, but not limited to, proliferation. Co-stimulatory
molecules include, but are not limited to an MHC class I molecule,
BTLA and a Toll ligand receptor.
[0081] A "co-stimulatory signal", as used herein, refers to a
signal, which in combination with a primary signal, such as TCR/CD3
ligation, leads to T cell proliferation and/or upregulation or
downregulation of key molecules.
[0082] A "disease" is a state of health of an animal wherein the
animal cannot maintain homeostasis, and wherein if the disease is
not ameliorated then the animal's health continues to deteriorate.
In contrast, a "disorder" in an animal is a state of health in
which the animal is able to maintain homeostasis, but in which the
animal's state of health is less favorable than it would be in the
absence of the disorder. Left untreated, a disorder does not
necessarily cause a further decrease in the animal's state of
health.
[0083] An "effective amount" as used herein, means an amount which
provides a therapeutic or prophylactic benefit.
[0084] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0085] As used herein "endogenous" refers to any material from or
produced inside an organism, cell, tissue or system.
[0086] As used herein, the term "exogenous" refers to any material
introduced from or produced outside an organism, cell, tissue or
system.
[0087] The term "expression" as used herein is defined as the
transcription and/or translation of a particular nucleotide
sequence driven by its promoter.
[0088] "Expression vector" refers to a vector comprising a
recombinant polynucleotide comprising expression control sequences
operatively linked to a nucleotide sequence to be expressed. An
expression vector comprises sufficient cis-acting elements for
expression; other elements for expression can be supplied by the
host cell or in an in vitro expression system. Expression vectors
include all those known in the art, such as cosmids, plasmids
(e.g., naked or contained in liposomes) and viruses (e.g.,
lentiviruses, retroviruses, adenoviruses, and adeno-associated
viruses) that incorporate the recombinant polynucleotide.
[0089] "Homologous" refers to the sequence similarity or sequence
identity between two polypeptides or between two nucleic acid
molecules. When a position in both of the two compared sequences is
occupied by the same base or amino acid monomer subunit, e.g., if a
position in each of two DNA molecules is occupied by adenine, then
the molecules are homologous at that position. The percent of
homology between two sequences is a function of the number of
matching or homologous positions shared by the two sequences
divided by the number of positions compared X 100. For example, if
6 of 10 of the positions in two sequences are matched or homologous
then the two sequences are 60% homologous. By way of example, the
DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a
comparison is made when two sequences are aligned to give maximum
homology.
[0090] The term "immunoglobulin" or "Ig," as used herein is defined
as a class of proteins, which function as antibodies. Antibodies
expressed by B cells are sometimes referred to as the BCR (B cell
receptor) or antigen receptor. The five members included in this
class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the
primary antibody that is present in body secretions, such as
saliva, tears, breast milk, gastrointestinal secretions and mucus
secretions of the respiratory and genitourinary tracts. IgG is the
most common circulating antibody. IgM is the main immunoglobulin
produced in the primary immune response in most subjects. It is the
most efficient immunoglobulin in agglutination, complement
fixation, and other antibody responses, and is important in defense
against bacteria and viruses. IgD is the immunoglobulin that has no
known antibody function, but may serve as an antigen receptor. IgE
is the immunoglobulin that mediates immediate hypersensitivity by
causing release of mediators from mast cells and basophils upon
exposure to allergen.
[0091] As used herein, an "instructional material" includes a
publication, a recording, a diagram, or any other medium of
expression which can be used to communicate the usefulness of the
compositions and methods of the invention. The instructional
material of the kit of the invention may, for example, be affixed
to a container which contains the nucleic acid, peptide, and/or
composition of the invention or be shipped together with a
container which contains the nucleic acid, peptide, and/or
composition. Alternatively, the instructional material may be
shipped separately from the container with the intention that the
instructional material and the compound be used cooperatively by
the recipient.
[0092] "Isolated" means altered or removed from the natural state.
For example, a nucleic acid or a peptide naturally present in a
living animal is not "isolated," but the same nucleic acid or
peptide partially or completely separated from the coexisting
materials of its natural state is "isolated." An isolated nucleic
acid or protein can exist in substantially purified form, or can
exist in a non-native environment such as, for example, a host
cell.
[0093] In the context of the present invention, the following
abbreviations for the commonly occurring nucleic acid bases are
used. "A" refers to adenosine, "C" refers to cytosine, "G" refers
to guanosine, "T" refers to thymidine, and "U" refers to
uridine.
[0094] Unless otherwise specified, a "nucleotide sequence encoding
an amino acid sequence" includes all nucleotide sequences that are
degenerate versions of each other and that encode the same amino
acid sequence. The phrase nucleotide sequence that encodes a
protein or an RNA may also include introns to the extent that the
nucleotide sequence encoding the protein may in some version
contain an intron(s).
[0095] A "lentivirus" as used herein refers to a genus of the
Retroviridae family. Lentiviruses are unique among the retroviruses
in being able to infect non-dividing cells; they can deliver a
significant amount of genetic information into the DNA of the host
cell, so they are one of the most efficient methods of a gene
delivery vector. HIV, SIV, and FIV are all examples of
lentiviruses. Vectors derived from lentiviruses offer the means to
achieve significant levels of gene transfer in vivo.
[0096] By the term "modulating," as used herein, is meant mediating
a detectable increase or decrease in the level of a response in a
subject compared with the level of a response in the subject in the
absence of a treatment or compound, and/or compared with the level
of a response in an otherwise identical but untreated subject. The
term encompasses perturbing and/or affecting a native signal or
response thereby mediating a beneficial therapeutic response in a
subject, preferably, a human.
[0097] Unless otherwise specified, a "nucleotide sequence encoding
an amino acid sequence" includes all nucleotide sequences that are
degenerate versions of each other and that encode the same amino
acid sequence. Nucleotide sequences that encode proteins and RNA
may include introns.
[0098] The term "operably linked" refers to functional linkage
between a regulatory sequence and a heterologous nucleic acid
sequence resulting in expression of the latter. For example, a
first nucleic acid sequence is operably linked with a second
nucleic acid sequence when the first nucleic acid sequence is
placed in a functional relationship with the second nucleic acid
sequence. For instance, a promoter is operably linked to a coding
sequence if the promoter affects the transcription or expression of
the coding sequence. Generally, operably linked DNA sequences are
contiguous and, where necessary to join two protein coding regions,
in the same reading frame.
[0099] The term "overexpressed" tumor antigen or "overexpression"
of the tumor antigen is intended to indicate an abnormal level of
expression of the tumor antigen in a cell from a disease area like
a solid tumor within a specific tissue or organ of the patient
relative to the level of expression in a normal cell from that
tissue or organ. Patients having solid tumors or a hematological
malignancy characterized by overexpression of the tumor antigen can
be determined by standard assays known in the art.
[0100] "Parenteral" administration of an immunogenic composition
includes, e.g., subcutaneous (s.c.), intravenous (i.v.),
intramuscular (i.m.), or intrasternal injection, or infusion
techniques.
[0101] The terms "patient," "subject," "individual," and the like
are used interchangeably herein, and refer to any animal, or cells
thereof whether in vitro or in situ, amenable to the methods
described herein. In certain non-limiting embodiments, the patient,
subject or individual is a human.
[0102] The term "polynucleotide" as used herein is defined as a
chain of nucleotides. Furthermore, nucleic acids are polymers of
nucleotides. Thus, nucleic acids and polynucleotides as used herein
are interchangeable. One skilled in the art has the general
knowledge that nucleic acids are polynucleotides, which can be
hydrolyzed into the monomeric "nucleotides." The monomeric
nucleotides can be hydrolyzed into nucleosides. As used herein
polynucleotides include, but are not limited to, all nucleic acid
sequences which are obtained by any means available in the art,
including, without limitation, recombinant means, i.e., the cloning
of nucleic acid sequences from a recombinant library or a cell
genome, using ordinary cloning technology and PCR.TM., and the
like, and by synthetic means.
[0103] As used herein, the terms "peptide," "polypeptide," and
"protein" are used interchangeably, and refer to a compound
comprised of amino acid residues covalently linked by peptide
bonds. A protein or peptide must contain at least two amino acids,
and no limitation is placed on the maximum number of amino acids
that can comprise a protein's or peptide's sequence. Polypeptides
include any peptide or protein comprising two or more amino acids
joined to each other by peptide bonds. As used herein, the term
refers to both short chains, which also commonly are referred to in
the art as peptides, oligopeptides and oligomers, for example, and
to longer chains, which generally are referred to in the art as
proteins, of which there are many types. "Polypeptides" include,
for example, biologically active fragments, substantially
homologous polypeptides, oligopeptides, homodimers, heterodimers,
variants of polypeptides, modified polypeptides, derivatives,
analogs, fusion proteins, among others. The polypeptides include
natural peptides, recombinant peptides, synthetic peptides, or a
combination thereof.
[0104] The term "promoter" as used herein is defined as a DNA
sequence recognized by the synthetic machinery of the cell, or
introduced synthetic machinery, required to initiate the specific
transcription of a polynucleotide sequence.
[0105] As used herein, the term "promoter/regulatory sequence"
means a nucleic acid sequence which is required for expression of a
gene product operably linked to the promoter/regulatory sequence.
In some instances, this sequence may be the core promoter sequence
and in other instances, this sequence may also include an enhancer
sequence and other regulatory elements which are required for
expression of the gene product. The promoter/regulatory sequence
may, for example, be one which expresses the gene product in a
tissue specific manner.
[0106] A "constitutive" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide which encodes or
specifies a gene product, causes the gene product to be produced in
a cell under most or all physiological conditions of the cell.
[0107] An "inducible" promoter is a nucleotide sequence which, when
operably linked with a polynucleotide which encodes or specifies a
gene product, causes the gene product to be produced in a cell
substantially only when an inducer which corresponds to the
promoter is present in the cell.
[0108] A "tissue-specific" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide encodes or specified by
a gene, causes the gene product to be produced in a cell
substantially only if the cell is a cell of the tissue type
corresponding to the promoter.
[0109] By the term "specifically binds," as used herein with
respect to an antibody, is meant an antibody which recognizes a
specific antigen, but does not substantially recognize or bind
other molecules in a sample. For example, an antibody that
specifically binds to an antigen from one species may also bind to
that antigen from one or more species. But, such cross-species
reactivity does not itself alter the classification of an antibody
as specific. In another example, an antibody that specifically
binds to an antigen may also bind to different allelic forms of the
antigen. However, such cross reactivity does not itself alter the
classification of an antibody as specific. In some instances, the
terms "specific binding" or "specifically binding," can be used in
reference to the interaction of an antibody, a protein, or a
peptide with a second chemical species, to mean that the
interaction is dependent upon the presence of a particular
structure (e.g., an antigenic determinant or epitope) on the
chemical species; for example, an antibody recognizes and binds to
a specific protein structure rather than to proteins generally. If
an antibody is specific for epitope "A", the presence of a molecule
containing epitope A (or free, unlabeled A), in a reaction
containing labeled "A" and the antibody, will reduce the amount of
labeled A bound to the antibody.
[0110] By the term "stimulation," is meant a primary response
induced by binding of a stimulatory molecule (e.g., a TCR/CD3
complex) with its cognate ligand thereby mediating a signal
transduction event, such as, but not limited to, signal
transduction via the TCR/CD3 complex. Stimulation can mediate
altered expression of certain molecules, such as downregulation of
TGF-.beta., and/or reorganization of cytoskeletal structures, and
the like.
[0111] A "stimulatory molecule," as the term is used herein, means
a molecule on a T cell that specifically binds with a cognate
stimulatory ligand present on an antigen presenting cell.
[0112] A "stimulatory ligand," as used herein, means a ligand that
when present on an antigen presenting cell (e.g., an aAPC, a
dendritic cell, a B-cell, and the like) can specifically bind with
a cognate binding partner (referred to herein as a "stimulatory
molecule") on a T cell, thereby mediating a primary response by the
T cell, including, but not limited to, activation, initiation of an
immune response, proliferation, and the like. Stimulatory ligands
are well-known in the art and encompass, inter alia, an MHC Class I
molecule loaded with a peptide, an anti-CD3 antibody, a
superagonist anti-CD28 antibody, and a superagonist anti-CD2
antibody.
[0113] The term "subject" is intended to include living organisms
in which an immune response can be elicited (e.g., mammals).
Examples of subjects include humans, dogs, cats, mice, rats, and
transgenic species thereof.
[0114] As used herein, a "substantially purified" cell is a cell
that is essentially free of other cell types. A substantially
purified cell also refers to a cell which has been separated from
other cell types with which it is normally associated in its
naturally occurring state. In some instances, a population of
substantially purified cells refers to a homogenous population of
cells. In other instances, this term refers simply to cell that
have been separated from the cells with which they are naturally
associated in their natural state. In some embodiments, the cells
are cultured in vitro. In other embodiments, the cells are not
cultured in vitro.
[0115] The term "therapeutic" as used herein means a treatment
and/or prophylaxis. A therapeutic effect is obtained by
suppression, remission, or eradication of a disease state.
[0116] The term "therapeutically effective amount" refers to the
amount of the subject compound that will elicit the biological or
medical response of a tissue, system, or subject that is being
sought by the researcher, veterinarian, medical doctor or other
clinician. The term "therapeutically effective amount" includes
that amount of a compound that, when administered, is sufficient to
prevent development of, or alleviate to some extent, one or more of
the signs or symptoms of the disorder or disease being treated. The
therapeutically effective amount will vary depending on the
compound, the disease and its severity and the age, weight, etc.,
of the subject to be treated.
[0117] To "treat" a disease as the term is used herein, means to
reduce the frequency or severity of at least one sign or symptom of
a disease or disorder experienced by a subject.
[0118] The term "transfected" or "transformed" or "transduced" as
used herein refers to a process by which exogenous nucleic acid is
transferred or introduced into the host cell. A "transfected" or
"transformed" or "transduced" cell is one which has been
transfected, transformed or transduced with exogenous nucleic acid.
The cell includes the primary subject cell and its progeny.
[0119] The phrase "under transcriptional control" or "operatively
linked" as used herein means that the promoter is in the correct
location and orientation in relation to a polynucleotide to control
the initiation of transcription by RNA polymerase and expression of
the polynucleotide.
[0120] A "vector" is a composition of matter which comprises an
isolated nucleic acid and which can be used to deliver the isolated
nucleic acid to the interior of a cell. Numerous vectors are known
in the art including, but not limited to, linear polynucleotides,
polynucleotides associated with ionic or amphiphilic compounds,
plasmids, and viruses. Thus, the term "vector" includes an
autonomously replicating plasmid or a virus. The term should also
be construed to include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into cells, such as, for
example, polylysine compounds, liposomes, and the like. Examples of
viral vectors include, but are not limited to, adenoviral vectors,
adeno-associated virus vectors, retroviral vectors, and the
like.
[0121] Ranges: throughout this disclosure, various aspects of the
invention can be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2,
2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of
the range.
DESCRIPTION
[0122] The present invention provides compositions and methods for
treating cancer among other diseases. The cancer may be a
hematological malignancy, a solid tumor, a primary or a
metatastizing tumor. Preferably, the cancer is a hematological
malignancy, and more preferably, the cancer is Chronic Lymphocytic
Leukemia (CLL). Other diseases treatable using the compositions and
methods of the invention include viral, bacterial and parasitic
infections as well as autoimmune diseases.
[0123] In one embodiment, the invention provides a cell (e.g., T
cell) engineered to express a CAR wherein the CAR T cell exhibits
an antitumor property. The CAR of the invention can be engineered
to comprise an extracellular domain having an antigen binding
domain fused to an intracellular signaling domain of the T cell
antigen receptor complex zeta chain (e.g., CD3 zeta). The CAR of
the invention when expressed in a T cell is able to redirect
antigen recognition based on the antigen binding specificity. An
exemplary antigen is CD19 because this antigen is expressed on
malignant B cells. However, the invention is not limited to
targeting CD19. Rather, the invention includes any antigen binding
moiety that when bound to its cognate antigen, affects a tumor cell
so that the tumor cell fails to grow, is prompted to die, or
otherwise is affected so that the tumor burden in a patient is
diminished or eliminated. The antigen binding moiety is preferably
fused with an intracellular domain from one or more of a
costimulatory molecule and a zeta chain. Preferably, the antigen
binding moiety is fused with one or more intracellular domains
selected from the group of a CD137 (4-1BB) signaling domain, a CD28
signaling domain, a CD3zeta signal domain, and any combination
thereof.
[0124] In one embodiment, the CAR of the invention comprises a
CD137 (4-1BB) signaling domain. This is because the present
invention is partly based on the discovery that CAR-mediated T-cell
responses can be further enhanced with the addition of
costimulatory domains. For example, inclusion of the CD137 (4-1BB)
signaling domain significantly increased anti-tumor activity and in
vivo persistence of CAR T cells compared to an otherwise identical
CAR T cell not engineered to express CD137 (4-1BB).
Composition
[0125] The present invention provides chimeric antigen receptor
(CAR) comprising an extracellular and intracellular domain. The
extracellular domain comprises a target-specific binding element
otherwise referred to as an antigen binding moiety. The
intracellular domain or otherwise the cytoplasmic domain comprises,
a costimulatory signaling region and a zeta chain portion. The
costimulatory signaling region refers to a portion of the CAR
comprising the intracellular domain of a costimulatory molecule.
Costimulatory molecules are cell surface molecules other than
antigens receptors or their ligands that are required for an
efficient response of lymphocytes to antigen.
[0126] Between the extracellular domain and the transmembrane
domain of the CAR, or between the cytoplasmic domain and the
transmembrane domain of the CAR, there may be incorporated a spacer
domain. As used herein, the term "spacer domain" generally means
any oligo- or polypeptide that functions to link the transmembrane
domain to, either the extracellular domain or, the cytoplasmic
domain in the polypeptide chain. A spacer domain may comprise up to
300 amino acids, preferably 10 to 100 amino acids and most
preferably 25 to 50 amino acids.
[0127] Antigen Binding Moiety
[0128] In one embodiment, the CAR of the invention comprises a
target-specific binding element otherwise referred to as an antigen
binding moiety. The choice of moiety depends upon the type and
number of ligands that define the surface of a target cell. For
example, the antigen binding domain may be chosen to recognize a
ligand that acts as a cell surface marker on target cells
associated with a particular disease state. Thus examples of cell
surface markers that may act as ligands for the antigen moiety
domain in the CAR of the invention include those associated with
viral, bacterial and parasitic infections, autoimmune disease and
cancer cells.
[0129] In one embodiment, the CAR of the invention can be
engineered to target a tumor antigen of interest by way of
engineering a desired antigen binding moiety that specifically
binds to an antigen on a tumor cell. In the context of the present
invention, "tumor antigen" or "hyperporoliferative disorder
antigen" or "antigen associated with a hyperproliferative
disorder," refers to antigens that are common to specific
hyperproliferative disorders such as cancer. The antigens discussed
herein are merely included by way of example. The list is not
intended to be exclusive and further examples will be readily
apparent to those of skill in the art.
[0130] Tumor antigens are proteins that are produced by tumor cells
that elicit an immune response, particularly T-cell mediated immune
responses. The selection of the antigen binding moiety of the
invention will depend on the particular type of cancer to be
treated. Tumor antigens are well known in the art and include, for
example, a glioma-associated antigen, carcinoembryonic antigen
(CEA), .beta.-human chorionic gonadotropin, alphafetoprotein (AFP),
lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human
telomerase reverse transcriptase, RU1 RU2 (AS), intestinal carboxyl
esterase, mut hsp70-2, M-CSF, prostase, prostate-specific antigen
(PSA), PAP, NY-ESO-1, LAGE-1.alpha., p53, prostein, PSMA, Her2/neu,
survivin and telomerase, prostate-carcinoma tumor antigen-1
(PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrinB2, CD22, insulin
growth factor (IGF)-I, IGF-II, IGF-I receptor and mesothelin.
[0131] In one embodiment, the tumor antigen comprises one or more
antigenic cancer epitopes associated with a malignant tumor.
Malignant tumors express a number of proteins that can serve as
target antigens for an immune attack. These molecules include but
are not limited to tissue-specific antigens such as MART-1,
tyrosinase and GP 100 in melanoma and prostatic acid phosphatase
(PAP) and prostate-specific antigen (PSA) in prostate cancer. Other
target molecules belong to the group of transformation-related
molecules such as the oncogene HER-2/Neu/ErbB-2. Yet another group
of target antigens are onco-fetal antigens such as carcinoembryonic
antigen (CEA). In B-cell lymphoma the tumor-specific idiotype
immunoglobulin constitutes a truly tumor-specific immunoglobulin
antigen that is unique to the individual tumor. B-cell
differentiation antigens such as CD19, CD20 and CD37 are other
candidates for target antigens in B-cell lymphoma. Some of these
antigens (CEA, HER-2, CD19, CD20, idiotype) have been used as
targets for passive immunotherapy with monoclonal antibodies with
limited success.
[0132] The type of tumor antigen referred to in the invention may
also be a tumor-specific antigen (TSA) or a tumor-associated
antigen (TAA). A TSA is unique to tumor cells and does not occur on
other cells in the body. A TAA associated antigen is not unique to
a tumor cell and instead is also expressed on a normal cell under
conditions that fail to induce a state of immunologic tolerance to
the antigen. The expression of the antigen on the tumor may occur
under conditions that enable the immune system to respond to the
antigen. TAAs may be antigens that are expressed on normal cells
during fetal development when the immune system is immature and
unable to respond or they may be antigens that are normally present
at extremely low levels on normal cells but which are expressed at
much higher levels on tumor cells.
[0133] Non-limiting examples of TSA or TAA antigens include the
following: Differentiation antigens such as MART-1/MelanA (MART-I),
gp100 (Pmel 17), tyrosinase, TRP-1, TRP-2 and tumor-specific
multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2,
p15; overexpressed embryonic antigens such as CEA; overexpressed
oncogenes and mutated tumor-suppressor genes such as p53, Ras,
HER-2/neu; unique tumor antigens resulting from chromosomal
translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR;
and viral antigens, such as the Epstein Barr virus antigens EBVA
and the human papillomavirus (HPV) antigens E6 and E7. Other large,
protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6,
RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72,
CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-Catenin, CDK4, Mum-1,
p 15, p 16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG,
BCA225, BTAA, CA 125, CA 15-3\CA 27.29\BCAA, CA 195, CA 242, CA-50,
CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344,
MA-50, MG7-Ag, MOV18, NB/70K, NY-CO-1, RCAS1, SDCCAG16, TA-90\Mac-2
binding protein\cyclophilin C-associated protein, TAAL6, TAG72,
TLP, and TPS.
[0134] In a preferred embodiment, the antigen binding moiety
portion of the CAR targets an antigen that includes but is not
limited to CD19, CD20, CD22, ROR1, Mesothelin, CD33/IL3Ra, c-Met,
PSMA, Glycolipid F77, EGFRvIII, GD-2, MY-ESO-1 TCR, MAGE A3 TCR,
and the like.
[0135] Depending on the desired antigen to be targeted, the CAR of
the invention can be engineered to include the appropriate antigen
bind moiety that is specific to the desired antigen target. For
example, if CD19 is the desired antigen that is to be targeted, an
antibody for CD19 can be used as the antigen bind moiety for
incorporation into the CAR of the invention.
[0136] In one embodiment, the antigen binding moiety portion of the
CAR of the invention targets CD19. Preferably, the antigen binding
moiety portion in the CAR of the invention is anti-CD19 scFV,
wherein the nucleic acid sequence of the anti-CD19 scFV comprises
the sequence set forth in SEQ ID: 14. In one embodiment, the
anti-CD19 scFV comprise the nucleic acid sequence that encodes the
amino acid sequence of SEQ ID NO: 20. In another embodiment, the
anti-CD19 scFV portion of the CAR of the invention comprises the
amino acid sequence set forth in SEQ ID NO: 20.
[0137] Transmembrane Domain
[0138] With respect to the transmembrane domain, the CAR can be
designed to comprise a transmembrane domain that is fused to the
extracellular domain of the CAR. In one embodiment, the
transmembrane domain that naturally is associated with one of the
domains in the CAR is used. In some instances, the transmembrane
domain can be selected or modified by amino acid substitution to
avoid binding of such domains to the transmembrane domains of the
same or different surface membrane proteins to minimize
interactions with other members of the receptor complex.
[0139] The transmembrane domain may be derived either from a
natural or from a synthetic source. Where the source is natural,
the domain may be derived from any membrane-bound or transmembrane
protein. Transmembrane regions of particular use in this invention
may be derived from (i.e. comprise at least the transmembrane
region(s) of) the alpha, beta or zeta chain of the T-cell receptor,
CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33,
CD37, CD64, CD80, CD86, CD134, CD137, CD154. Alternatively the
transmembrane domain may be synthetic, in which case it will
comprise predominantly hydrophobic residues such as leucine and
valine. Preferably a triplet of phenylalanine, tryptophan and
valine will be found at each end of a synthetic transmembrane
domain. Optionally, a short oligo- or polypeptide linker,
preferably between 2 and 10 amino acids in length may form the
linkage between the transmembrane domain and the cytoplasmic
signaling domain of the CAR. A glycine-serine doublet provides a
particularly suitable linker.
[0140] Preferably, the transmembrane domain in the CAR of the
invention is the CD8 transmembrane domain. In one embodiment, the
CD8 transmembrane domain comprises the nucleic acid sequence of SEQ
ID NO: 16. In one embodiment, the CD8 transmembrane domain
comprises the nucleic acid sequence that encodes the amino acid
sequence of SEQ ID NO: 22. In another embodiment, the CD8
transmembrane domain comprises the amino acid sequence of SEQ ID
NO: 22.
[0141] In some instances, the transmembrane domain of the CAR of
the invention comprises the CD8.alpha. hinge domain. In one
embodiment, the CD8 hinge domain comprises the nucleic acid
sequence of SEQ ID NO: 15. In one embodiment, the CD8 hinge domain
comprises the nucleic acid sequence that encodes the amino acid
sequence of SEQ ID NO: 21. In another embodiment, the CD8 hinge
domain comprises the amino acid sequence of SEQ ID NO: 21.
[0142] Cytoplasmic Domain
[0143] The cytoplasmic domain or otherwise the intracellular
signaling domain of the CAR of the invention is responsible for
activation of at least one of the normal effector functions of the
immune cell in which the CAR has been placed in. The term "effector
function" refers to a specialized function of a cell. Effector
function of a T cell, for example, may be cytolytic activity or
helper activity including the secretion of cytokines. Thus the term
"intracellular signaling domain" refers to the portion of a protein
which transduces the effector function signal and directs the cell
to perform a specialized function. While usually the entire
intracellular signaling domain can be employed, in many cases it is
not necessary to use the entire chain. To the extent that a
truncated portion of the intracellular signaling domain is used,
such truncated portion may be used in place of the intact chain as
long as it transduces the effector function signal. The term
intracellular signaling domain is thus meant to include any
truncated portion of the intracellular signaling domain sufficient
to transduce the effector function signal.
[0144] Preferred examples of intracellular signaling domains for
use in the CAR of the invention include the cytoplasmic sequences
of the T cell receptor (TCR) and co-receptors that act in concert
to initiate signal transduction following antigen receptor
engagement, as well as any derivative or variant of these sequences
and any synthetic sequence that has the same functional
capability.
[0145] It is known that signals generated through the TCR alone are
insufficient for full activation of the T cell and that a secondary
or co-stimulatory signal is also required. Thus, T cell activation
can be said to be mediated by two distinct classes of cytoplasmic
signaling sequence: those that initiate antigen-dependent primary
activation through the TCR (primary cytoplasmic signaling
sequences) and those that act in an antigen-independent manner to
provide a secondary or co-stimulatory signal (secondary cytoplasmic
signaling sequences).
[0146] Primary cytoplasmic signaling sequences regulate primary
activation of the TCR complex either in a stimulatory way, or in an
inhibitory way. Primary cytoplasmic signaling sequences that act in
a stimulatory manner may contain signaling motifs which are known
as immunoreceptor tyrosine-based activation motifs or ITAMs.
[0147] Examples of ITAM containing primary cytoplasmic signaling
sequences that are of particular use in the invention include those
derived from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta,
CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d. It is particularly
preferred that cytoplasmic signaling molecule in the CAR of the
invention comprises a cytoplasmic signaling sequence derived from
CD3 zeta.
[0148] In a preferred embodiment, the cytoplasmic domain of the CAR
can be designed to comprise the CD3-zeta signaling domain by itself
or combined with any other desired cytoplasmic domain(s) useful in
the context of the CAR of the invention. For example, the
cytoplasmic domain of the CAR can comprise a CD3 zeta chain portion
and a costimulatory signaling region. The costimulatory signaling
region refers to a portion of the CAR comprising the intracellular
domain of a costimulatory molecule. A costimulatory molecule is a
cell surface molecule other than an antigen receptor or their
ligands that is required for an efficient response of lymphocytes
to an antigen. Examples of such molecules include CD27, CD28, 4-1BB
(CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte
function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C,
B7-H3, and a ligand that specifically binds with CD83, and the
like. Thus, while the invention in exemplified primarily with 4-1BB
as the co-stimulatory signaling element, other costimulatory
elements are within the scope of the invention.
[0149] The cytoplasmic signaling sequences within the cytoplasmic
signaling portion of the CAR of the invention may be linked to each
other in a random or specified order. Optionally, a short oligo- or
polypeptide linker, preferably between 2 and 10 amino acids in
length may form the linkage. A glycine-serine doublet provides a
particularly suitable linker.
[0150] In one embodiment, the cytoplasmic domain is designed to
comprise the signaling domain of CD3-zeta and the signaling domain
of CD28. In another embodiment, the cytoplasmic domain is designed
to comprise the signaling domain of CD3-zeta and the signaling
domain of 4-1IBB. In yet another embodiment, the cytoplasmic domain
is designed to comprise the signaling domain of CD3-zeta and the
signaling domain of CD28 and 4-1IBB.
[0151] In one embodiment, the cytoplasmic domain in the CAR of the
invention is designed to comprise the signaling domain of 4-1IBB
and the signaling domain of CD3-zeta, wherein the signaling domain
of 4-1IBB comprises the nucleic acid sequence set forth in SEQ ID
NO: 17 and the signaling domain of CD3-zeta comprises the nucleic
acid sequence set forth in SEQ ID NO: 18.
[0152] In one embodiment, the cytoplasmic domain in the CAR of the
invention is designed to comprise the signaling domain of 4-1BB and
the signaling domain of CD3-zeta, wherein the signaling domain of
4-1BB comprises the nucleic acid sequence that encodes the amino
acid sequence of SEQ ID NO: 23 and the signaling domain of CD3-zeta
comprises the nucleic acid sequence that encodes the amino acid
sequence of SEQ ID NO: 24.
[0153] In one embodiment, the cytoplasmic domain in the CAR of the
invention is designed to comprise the signaling domain of 4-1BB and
the signaling domain of CD3-zeta, wherein the signaling domain of
4-1BB comprises the amino acid sequence set forth in SEQ ID NO: 23
and the signaling domain of CD3-zeta comprises the amino acid
sequence set forth in SEQ ID NO: 24.
Vectors
[0154] The present invention encompasses a DNA construct comprising
sequences of a CAR, wherein the sequence comprises the nucleic acid
sequence of an antigen binding moiety operably linked to the
nucleic acid sequence of an intracellular domain. An exemplary
intracellular domain that can be used in the CAR of the invention
includes but is not limited to the intracellular domain of
CD3-zeta, CD28, 4-1BB, and the like. In some instances, the CAR can
comprise any combination of CD3-zeta, CD28, 4-1BB, and the
like.
[0155] In one embodiment, the CAR of the invention comprises
anti-CD19 scFv, human CD8 hinge and transmembrane domain, and human
4-1BB and CD3zeta signaling domains. In one embodiment, the CAR of
the invention comprises the nucleic acid sequence set forth in SEQ
ID NO: 8. In another embodiment, the CAR of the invention comprises
the nucleic acid sequence that encodes the amino acid sequence of
SEQ ID NO: 12. In another embodiment, the CAR of the invention
comprises the amino acid sequence set forth in SEQ ID NO: 12.
[0156] The nucleic acid sequences coding for the desired molecules
can be obtained using recombinant methods known in the art, such
as, for example by screening libraries from cells expressing the
gene, by deriving the gene from a vector known to include the same,
or by isolating directly from cells and tissues containing the
same, using standard techniques. Alternatively, the gene of
interest can be produced synthetically, rather than cloned.
[0157] The present invention also provides vectors in which a DNA
of the present invention is inserted. Vectors derived from
retroviruses such as the lentivirus are suitable tools to achieve
long-term gene transfer since they allow long-term, stable
integration of a transgene and its propagation in daughter cells.
Lentiviral vectors have the added advantage over vectors derived
from onco-retroviruses such as murine leukemia viruses in that they
can transduce non-proliferating cells, such as hepatocytes. They
also have the added advantage of low immunogenicity.
[0158] In brief summary, the expression of natural or synthetic
nucleic acids encoding CARs is typically achieved by operably
linking a nucleic acid encoding the CAR polypeptide or portions
thereof to a promoter, and incorporating the construct into an
expression vector. The vectors can be suitable for replication and
integration eukaryotes. Typical cloning vectors contain
transcription and translation terminators, initiation sequences,
and promoters useful for regulation of the expression of the
desired nucleic acid sequence.
[0159] The expression constructs of the present invention may also
be used for nucleic acid immunization and gene therapy, using
standard gene delivery protocols. Methods for gene delivery are
known in the art. See, e.g., U.S. Pat. Nos. 5,399,346, 5,580,859,
5,589,466, incorporated by reference herein in their entireties. In
another embodiment, the invention provides a gene therapy
vector.
[0160] The nucleic acid can be cloned into a number of types of
vectors. For example, the nucleic acid can be cloned into a vector
including, but not limited to a plasmid, a phagemid, a phage
derivative, an animal virus, and a cosmid. Vectors of particular
interest include expression vectors, replication vectors, probe
generation vectors, and sequencing vectors.
[0161] Further, the expression vector may be provided to a cell in
the form of a viral vector. Viral vector technology is well known
in the art and is described, for example, in Sambrook et al. (2001,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, New York), and in other virology and molecular biology
manuals. Viruses, which are useful as vectors include, but are not
limited to, retroviruses, adenoviruses, adeno- associated viruses,
herpes viruses, and lentiviruses. In general, a suitable vector
contains an origin of replication functional in at least one
organism, a promoter sequence, convenient restriction endonuclease
sites, and one or more selectable markers, (e.g., WO 01/96584; WO
01/29058; and U.S. Pat. No. 6,326,193).
[0162] A number of viral based systems have been developed for gene
transfer into mammalian cells. For example, retroviruses provide a
convenient platform for gene delivery systems. A selected gene can
be inserted into a vector and packaged in retroviral particles
using techniques known in the art. The recombinant virus can then
be isolated and delivered to cells of the subject either in vivo or
ex vivo. A number of retroviral systems are known in the art. In
some embodiments, adenovirus vectors are used. A number of
adenovirus vectors are known in the art. In one embodiment,
lentivirus vectors are used.
[0163] Additional promoter elements, e.g., enhancers, regulate the
frequency of transcriptional initiation. Typically, these are
located in the region 30-110 bp upstream of the start site,
although a number of promoters have recently been shown to contain
functional elements downstream of the start site as well. The
spacing between promoter elements frequently is flexible, so that
promoter function is preserved when elements are inverted or moved
relative to one another. In the thymidine kinase (tk) promoter, the
spacing between promoter elements can be increased to 50 bp apart
before activity begins to decline. Depending on the promoter, it
appears that individual elements can function either cooperatively
or independently to activate transcription.
[0164] One example of a suitable promoter is the immediate early
cytomegalovirus (CMV) promoter sequence. This promoter sequence is
a strong constitutive promoter sequence capable of driving high
levels of expression of any polynucleotide sequence operatively
linked thereto. Another example of a suitable promoter is
Elongation Growth Factor -1.alpha. (EF-1.alpha.). However, other
constitutive promoter sequences may also be used, including, but
not limited to the simian virus 40 (SV40) early promoter, mouse
mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long
terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia
virus promoter, an Epstein-Barr virus immediate early promoter, a
Rous sarcoma virus promoter, as well as human gene promoters such
as, but not limited to, the actin promoter, the myosin promoter,
the hemoglobin promoter, and the creatine kinase promoter. Further,
the invention should not be limited to the use of constitutive
promoters. Inducible promoters are also contemplated as part of the
invention. The use of an inducible promoter provides a molecular
switch capable of turning on expression of the polynucleotide
sequence which it is operatively linked when such expression is
desired, or turning off the expression when expression is not
desired. Examples of inducible promoters include, but are not
limited to a metallothionine promoter, a glucocorticoid promoter, a
progesterone promoter, and a tetracycline promoter.
[0165] In order to assess the expression of a CAR polypeptide or
portions thereof, the expression vector to be introduced into a
cell can also contain either a selectable marker gene or a reporter
gene or both to facilitate identification and selection of
expressing cells from the population of cells sought to be
transfected or infected through viral vectors. In other aspects,
the selectable marker may be carried on a separate piece of DNA and
used in a co-transfection procedure. Both selectable markers and
reporter genes may be flanked with appropriate regulatory sequences
to enable expression in the host cells. Useful selectable markers
include, for example, antibiotic-resistance genes, such as neo and
the like.
[0166] Reporter genes are used for identifying potentially
transfected cells and for evaluating the functionality of
regulatory sequences. In general, a reporter gene is a gene that is
not present in or expressed by the recipient organism or tissue and
that encodes a polypeptide whose expression is manifested by some
easily detectable property, e.g., enzymatic activity. Expression of
the reporter gene is assayed at a suitable time after the DNA has
been introduced into the recipient cells. Suitable reporter genes
may include genes encoding luciferase, beta-galactosidase,
chloramphenicol acetyl transferase, secreted alkaline phosphatase,
or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000
FEBS Letters 479: 79-82). Suitable expression systems are well
known and may be prepared using known techniques or obtained
commercially. In general, the construct with the minimal 5'
flanking region showing the highest level of expression of reporter
gene is identified as the promoter. Such promoter regions may be
linked to a reporter gene and used to evaluate agents for the
ability to modulate promoter- driven transcription.
[0167] Methods of introducing and expressing genes into a cell are
known in the art. In the context of an expression vector, the
vector can be readily introduced into a host cell, e.g., mammalian,
bacterial, yeast, or insect cell by any method in the art. For
example, the expression vector can be transferred into a host cell
by physical, chemical, or biological means.
[0168] Physical methods for introducing a polynucleotide into a
host cell include calcium phosphate precipitation, lipofection,
particle bombardment, microinjection, electroporation, and the
like. Methods for producing cells comprising vectors and/or
exogenous nucleic acids are well-known in the art. See, for
example, Sambrook et al. (2001, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory, New York). A preferred
method for the introduction of a polynucleotide into a host cell is
calcium phosphate transfection.
[0169] Biological methods for introducing a polynucleotide of
interest into a host cell include the use of DNA and RNA vectors.
Viral vectors, and especially retroviral vectors, have become the
most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from lentivirus,
poxviruses, herpes simplex virus I, adenoviruses and
adeno-associated viruses, and the like. See, for example, U.S. Pat.
Nos. 5,350,674 and 5,585,362.
[0170] Chemical means for introducing a polynucleotide into a host
cell include colloidal dispersion systems, such as macromolecule
complexes, nanocapsules, microspheres, beads, and lipid-based
systems including oil-in-water emulsions, micelles, mixed micelles,
and liposomes. An exemplary colloidal system for use as a delivery
vehicle in vitro and in vivo is a liposome (e.g., an artificial
membrane vesicle).
[0171] In the case where a non-viral delivery system is utilized,
an exemplary delivery vehicle is a liposome. The use of lipid
formulations is contemplated for the introduction of the nucleic
acids into a host cell (in vitro, ex vivo or in vivo). In another
aspect, the nucleic acid may be associated with a lipid. The
nucleic acid associated with a lipid may be encapsulated in the
aqueous interior of a liposome, interspersed within the lipid
bilayer of a liposome, attached to a liposome via a linking
molecule that is associated with both the liposome and the
oligonucleotide, entrapped in a liposome, complexed with a
liposome, dispersed in a solution containing a lipid, mixed with a
lipid, combined with a lipid, contained as a suspension in a lipid,
contained or complexed with a micelle, or otherwise associated with
a lipid. Lipid, lipid/DNA or lipid/expression vector associated
compositions are not limited to any particular structure in
solution. For example, they may be present in a bilayer structure,
as micelles, or with a "collapsed" structure. They may also simply
be interspersed in a solution, possibly forming aggregates that are
not uniform in size or shape. Lipids are fatty substances which may
be naturally occurring or synthetic lipids. For example, lipids
include the fatty droplets that naturally occur in the cytoplasm as
well as the class of compounds which contain long-chain aliphatic
hydrocarbons and their derivatives, such as fatty acids, alcohols,
amines, amino alcohols, and aldehydes.
[0172] Lipids suitable for use can be obtained from commercial
sources. For example, dimyristyl phosphatidylcholine ("DMPC") can
be obtained from Sigma, St. Louis, Mo.; dicetyl phosphate ("DCP")
can be obtained from K & K Laboratories (Plainview, N.Y.);
cholesterol ("Choi") can be obtained from Calbiochem-Behring;
dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be
obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock
solutions of lipids in chloroform or chloroform/methanol can be
stored at about -20.degree. C. Chloroform is used as the only
solvent since it is more readily evaporated than methanol.
"Liposome" is a generic term encompassing a variety of single and
multilamellar lipid vehicles formed by the generation of enclosed
lipid bilayers or aggregates. Liposomes can be characterized as
having vesicular structures with a phospholipid bilayer membrane
and an inner aqueous medium. Multilamellar liposomes have multiple
lipid layers separated by aqueous medium. They form spontaneously
when phospholipids are suspended in an excess of aqueous solution.
The lipid components undergo self-rearrangement before the
formation of closed structures and entrap water and dissolved
solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology
5: 505-10). However, compositions that have different structures in
solution than the normal vesicular structure are also encompassed.
For example, the lipids may assume a micellar structure or merely
exist as nonuniform aggregates of lipid molecules. Also
contemplated are lipofectamine-nucleic acid complexes.
[0173] Regardless of the method used to introduce exogenous nucleic
acids into a host cell or otherwise expose a cell to the inhibitor
of the present invention, in order to confirm the presence of the
recombinant DNA sequence in the host cell, a variety of assays may
be performed. Such assays include, for example, "molecular
biological" assays well known to those of skill in the art, such as
Southern and Northern blotting, RT-PCR and PCR; "biochemical"
assays, such as detecting the presence or absence of a particular
peptide, e.g., by immunological means (ELISAs and Western blots) or
by assays described herein to identify agents falling within the
scope of the invention.
Sources of T Cells
[0174] Prior to expansion and genetic modification of the T cells
of the invention, a source of T cells is obtained from a subject. T
cells can be obtained from a number of sources, including
peripheral blood mononuclear cells, bone marrow, lymph node tissue,
cord blood, thymus tissue, tissue from a site of infection,
ascites, pleural effusion, spleen tissue, and tumors. In certain
embodiments of the present invention, any number of T cell lines
available in the art, may be used. In certain embodiments of the
present invention, T cells can be obtained from a unit of blood
collected from a subject using any number of techniques known to
the skilled artisan, such as Ficoll.TM. separation. In one
preferred embodiment, cells from the circulating blood of an
individual are obtained by apheresis. The apheresis product
typically contains lymphocytes, including T cells, monocytes,
granulocytes, B cells, other nucleated white blood cells, red blood
cells, and platelets. In one embodiment, the cells collected by
apheresis may be washed to remove the plasma fraction and to place
the cells in an appropriate buffer or media for subsequent
processing steps. In one embodiment of the invention, the cells are
washed with phosphate buffered saline (PBS). In an alternative
embodiment, the wash solution lacks calcium and may lack magnesium
or may lack many if not all divalent cations. Again, surprisingly,
initial activation steps in the absence of calcium lead to
magnified activation. As those of ordinary skill in the art would
readily appreciate a washing step may be accomplished by methods
known to those in the art, such as by using a semi-automated
"flow-through" centrifuge (for example, the Cobe 2991 cell
processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5)
according to the manufacturer's instructions. After washing, the
cells may be resuspended in a variety of biocompatible buffers,
such as, for example, Ca.sup.2+-free, Mg.sup.2+-free PBS,
PlasmaLyte A, or other saline solution with or without buffer.
Alternatively, the undesirable components of the apheresis sample
may be removed and the cells directly resuspended in culture
media.
[0175] In another embodiment, T cells are isolated from peripheral
blood-lymphocytes by lysing the red blood cells and depleting the
monocytes, for example, by centrifugation through a PERCOLL.TM.
gradient or by counterflow centrifugal elutriation. A specific
subpopulation of T cells, such as CD3.sup.+, CD28.sup.+, CD4.sup.+,
CD8.sup.+, CD45RA.sup.+, and CD45RO.sup.+T cells, can be further
isolated by positive or negative selection techniques. For example,
in one embodiment, T cells are isolated by incubation with
anti-CD.sup.3/anti-CD28 (i.e., 3.times.28)-conjugated beads, such
as DYNABEADS.RTM. M-450 CD3/CD28 T, for a time period sufficient
for positive selection of the desired T cells. In one embodiment,
the time period is about 30 minutes. In a further embodiment, the
time period ranges from 30 minutes to 36 hours or longer and all
integer values there between. In a further embodiment, the time
period is at least 1, 2, 3, 4, 5, or 6 hours. In yet another
preferred embodiment, the time period is 10 to 24 hours. In one
preferred embodiment, the incubation time period is 24 hours. For
isolation of T cells from patients with leukemia, use of longer
incubation times, such as 24 hours, can increase cell yield. Longer
incubation times may be used to isolate T cells in any situation
where there are few T cells as compared to other cell types, such
in isolating tumor infiltrating lymphocytes (TIL) from tumor tissue
or from immune-compromised individuals. Further, use of longer
incubation times can increase the efficiency of capture of CD8+T
cells. Thus, by simply shortening or lengthening the time T cells
are allowed to bind to the CD3/CD28 beads and/or by increasing or
decreasing the ratio of beads to T cells (as described further
herein), subpopulations of T cells can be preferentially selected
for or against at culture initiation or at other time points during
the process. Additionally, by increasing or decreasing the ratio of
anti-CD3 and/or anti-CD28 antibodies on the beads or other surface,
subpopulations of T cells can be preferentially selected for or
against at culture initiation or at other desired time points. The
skilled artisan would recognize that multiple rounds of selection
can also be used in the context of this invention. In certain
embodiments, it may be desirable to perform the selection procedure
and use the "unselected" cells in the activation and expansion
process. "Unselected" cells can also be subjected to further rounds
of selection.
[0176] Enrichment of a T cell population by negative selection can
be accomplished with a combination of antibodies directed to
surface markers unique to the negatively selected cells. One method
is cell sorting and/or selection via negative magnetic
immunoadherence or flow cytometry that uses a cocktail of
monoclonal antibodies directed to cell surface markers present on
the cells negatively selected. For example, to enrich for CD4.sup.+
cells by negative selection, a monoclonal antibody cocktail
typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR,
and CD8. In certain embodiments, it may be desirable to enrich for
or positively select for regulatory T cells which typically express
CD4.sup.+, CD25.sup.+, CD62L.sup.hi, GITR.sup.+, and FoxP3.sup.+.
Alternatively, in certain embodiments, T regulatory cells are
depleted by anti-C25 conjugated beads or other similar method of
selection.
[0177] For isolation of a desired population of cells by positive
or negative selection, the concentration of cells and surface
(e.g., particles such as beads) can be varied. In certain
embodiments, it may be desirable to significantly decrease the
volume in which beads and cells are mixed together (i.e., increase
the concentration of cells), to ensure maximum contact of cells and
beads. For example, in one embodiment, a concentration of 2 billion
cells/ml is used. In one embodiment, a concentration of 1 billion
cells/ml is used. In a further embodiment, greater than 100 million
cells/ml is used. In a further embodiment, a concentration of cells
of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used.
In yet another embodiment, a concentration of cells from 75, 80,
85, 90, 95, or 100 million cells/ml is used. In further
embodiments, concentrations of 125 or 150 million cells/ml can be
used. Using high concentrations can result in increased cell yield,
cell activation, and cell expansion. Further, use of high cell
concentrations allows more efficient capture of cells that may
weakly express target antigens of interest, such as CD28-negative T
cells, or from samples where there are many tumor cells present
(i.e., leukemic blood, tumor tissue, etc.). Such populations of
cells may have therapeutic value and would be desirable to obtain.
For example, using high concentration of cells allows more
efficient selection of CD8.sup.+ T cells that normally have weaker
CD28 expression.
[0178] In a related embodiment, it may be desirable to use lower
concentrations of cells. By significantly diluting the mixture of T
cells and surface (e.g., particles such as beads), interactions
between the particles and cells is minimized. This selects for
cells that express high amounts of desired antigens to be bound to
the particles. For example, CD4.sup.+ T cells express higher levels
of CD28 and are more efficiently captured than CD8.sup.+ T cells in
dilute concentrations. In one embodiment, the concentration of
cells used is 5.times.10.sup.6/ml. In other embodiments, the
concentration used can be from about 1.times.10.sup.5/ml to
1.times.10.sup.6/ml, and any integer value in between.
[0179] In other embodiments, the cells may be incubated on a
rotator for varying lengths of time at varying speeds at either
2-10.degree. C. or at room temperature.
[0180] T cells for stimulation can also be frozen after a washing
step. Wishing not to be bound by theory, the freeze and subsequent
thaw step provides a more uniform product by removing granulocytes
and to some extent monocytes in the cell population. After the
washing step that removes plasma and platelets, the cells may be
suspended in a freezing solution. While many freezing solutions and
parameters are known in the art and will be useful in this context,
one method involves using PBS containing 20% DMSO and 8% human
serum albumin, or culture media containing 10% Dextran 40 and 5%
Dextrose, 20% Human Serum Albumin and 7.5% DMSO, or 31.25%
Plasmalyte-A, 31.25% Dextrose 5%, 0.45% NaCl, 10% Dextran 40 and 5%
Dextrose, 20% Human Serum Albumin, and 7.5% DMSO or other suitable
cell freezing media containing for example, Hespan and PlasmaLyte
A, the cells then are frozen to -80.degree. C. at a rate of
1.degree. per minute and stored in the vapor phase of a liquid
nitrogen storage tank. Other methods of controlled freezing may be
used as well as uncontrolled freezing immediately at -20.degree. C.
or in liquid nitrogen.
[0181] In certain embodiments, cryopreserved cells are thawed and
washed as described herein and allowed to rest for one hour at room
temperature prior to activation using the methods of the present
invention.
[0182] Also contemplated in the context of the invention is the
collection of blood samples or apheresis product from a subject at
a time period prior to when the expanded cells as described herein
might be needed. As such, the source of the cells to be expanded
can be collected at any time point necessary, and desired cells,
such as T cells, isolated and frozen for later use in T cell
therapy for any number of diseases or conditions that would benefit
from T cell therapy, such as those described herein. In one
embodiment a blood sample or an apheresis is taken from a generally
healthy subject. In certain embodiments, a blood sample or an
apheresis is taken from a generally healthy subject who is at risk
of developing a disease, but who has not yet developed a disease,
and the cells of interest are isolated and frozen for later use. In
certain embodiments, the T cells may be expanded, frozen, and used
at a later time. In certain embodiments, samples are collected from
a patient shortly after diagnosis of a particular disease as
described herein but prior to any treatments. In a further
embodiment, the cells are isolated from a blood sample or an
apheresis from a subject prior to any number of relevant treatment
modalities, including but not limited to treatment with agents such
as natalizumab, efalizumab, antiviral agents, chemotherapy,
radiation, immunosuppressive agents, such as cyclosporin,
azathioprine, methotrexate, mycophenolate, and FK506, antibodies,
or other immunoablative agents such as CAMPATH, anti-CD3
antibodies, cytoxan, fludarabine, cyclosporin, FK506, rapamycin,
mycophenolic acid, steroids, FR901228, and irradiation. These drugs
inhibit either the calcium dependent phosphatase calcineurin
(cyclosporine and FK506) or inhibit the p70S6 kinase that is
important for growth factor induced signaling (rapamycin) (Liu et
al., Cell 66:807-815, 1991; Henderson et al., Immun. 73:316-321,
1991; Bierer et al., Curr. Opin. Immun. 5:763-773, 1993). In a
further embodiment, the cells are isolated for a patient and frozen
for later use in conjunction with (e.g., before, simultaneously or
following) bone marrow or stem cell transplantation, T cell
ablative therapy using either chemotherapy agents such as,
fludarabine, external-beam radiation therapy (XRT),
cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another
embodiment, the cells are isolated prior to and can be frozen for
later use for treatment following B-cell ablative therapy such as
agents that react with CD20, e.g., Rituxan.
[0183] In a further embodiment of the present invention, T cells
are obtained from a patient directly following treatment. In this
regard, it has been observed that following certain cancer
treatments, in particular treatments with drugs that damage the
immune system, shortly after treatment during the period when
patients would normally be recovering from the treatment, the
quality of T cells obtained may be optimal or improved for their
ability to expand ex vivo. Likewise, following ex vivo manipulation
using the methods described herein, these cells may be in a
preferred state for enhanced engraftment and in vivo expansion.
Thus, it is contemplated within the context of the present
invention to collect blood cells, including T cells, dendritic
cells, or other cells of the hematopoietic lineage, during this
recovery phase. Further, in certain embodiments, mobilization (for
example, mobilization with GM-CSF) and conditioning regimens can be
used to create a condition in a subject wherein repopulation,
recirculation, regeneration, and/or expansion of particular cell
types is favored, especially during a defined window of time
following therapy. Illustrative cell types include T cells, B
cells, dendritic cells, and other cells of the immune system.
Activation and Expansion of T Cells
[0184] Whether prior to or after genetic modification of the T
cells to express a desirable CAR, the T cells can be activated and
expanded generally using methods as described, for example, in U.S.
Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358;
6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566;
7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S.
Patent Application Publication No. 20060121005.
[0185] Generally, the T cells of the invention are expanded by
contact with a surface having attached thereto an agent that
stimulates a CD3/TCR complex associated signal and a ligand that
stimulates a co-stimulatory molecule on the surface of the T cells.
In particular, T cell populations may be stimulated as described
herein, such as by contact with an anti-CD3 antibody, or
antigen-binding fragment thereof, or an anti-CD2 antibody
immobilized on a surface, or by contact with a protein kinase C
activator (e.g., bryostatin) in conjunction with a calcium
ionophore. For co-stimulation of an accessory molecule on the
surface of the T cells, a ligand that binds the accessory molecule
is used. For example, a population of T cells can be contacted with
an anti-CD3 antibody and an anti-CD28 antibody, under conditions
appropriate for stimulating proliferation of the T cells. To
stimulate proliferation of either CD4.sup.+ T cells or CD8.sup.+ T
cells, an anti-CD3 antibody and an anti-CD28 antibody. Examples of
an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone,
Besancon, France) can be used as can other methods commonly known
in the art (Berg et al., Transplant Proc. 30(8):3975-3977, 1998;
Haanen et al., J. Exp. Med. 190(9):13191328, 1999; Garland et al.,
J. Immunol Meth. 227(1-2):53-63, 1999).
[0186] In certain embodiments, the primary stimulatory signal and
the co-stimulatory signal for the T cell may be provided by
different protocols. For example, the agents providing each signal
may be in solution or coupled to a surface. When coupled to a
surface, the agents may be coupled to the same surface (i.e., in
"cis" formation) or to separate surfaces (i.e., in "trans"
formation). Alternatively, one agent may be coupled to a surface
and the other agent in solution. In one embodiment, the agent
providing the co-stimulatory signal is bound to a cell surface and
the agent providing the primary activation signal is in solution or
coupled to a surface. In certain embodiments, both agents can be in
solution. In another embodiment, the agents may be in soluble form,
and then cross-linked to a surface, such as a cell expressing Fc
receptors or an antibody or other binding agent which will bind to
the agents. In this regard, see for example, U.S. Patent
Application Publication Nos. 20040101519 and 20060034810 for
artificial antigen presenting cells (aAPCs) that are contemplated
for use in activating and expanding T cells in the present
invention.
[0187] In one embodiment, the two agents are immobilized on beads,
either on the same bead, i.e., "cis," or to separate beads, i.e.,
"trans." By way of example, the agent providing the primary
activation signal is an anti-CD3 antibody or an antigen-binding
fragment thereof and the agent providing the co-stimulatory signal
is an anti-CD28 antibody or antigen-binding fragment thereof; and
both agents are co-immobilized to the same bead in equivalent
molecular amounts. In one embodiment, a 1:1 ratio of each antibody
bound to the beads for CD4.sup.+ T cell expansion and T cell growth
is used. In certain aspects of the present invention, a ratio of
anti CD3:CD28 antibodies bound to the beads is used such that an
increase in T cell expansion is observed as compared to the
expansion observed using a ratio of 1:1. In one particular
embodiment an increase of from about 1 to about 3 fold is observed
as compared to the expansion observed using a ratio of 1:1. In one
embodiment, the ratio of CD3:CD28 antibody bound to the beads
ranges from 100:1 to 1:100 and all integer values there between. In
one aspect of the present invention, more anti-CD28 antibody is
bound to the particles than anti-CD3 antibody, i.e., the ratio of
CD3:CD28 is less than one. In certain embodiments of the invention,
the ratio of anti CD28 antibody to anti CD3 antibody bound to the
beads is greater than 2:1. In one particular embodiment, a 1:100
CD3:CD28 ratio of antibody bound to beads is used. In another
embodiment, a 1:75 CD3:CD28 ratio of antibody bound to beads is
used. In a further embodiment, a 1:50 CD3:CD28 ratio of antibody
bound to beads is used. In another embodiment, a 1:30 CD3:CD28
ratio of antibody bound to beads is used. In one preferred
embodiment, a 1:10 CD3:CD28 ratio of antibody bound to beads is
used. In another embodiment, a 1:3 CD3:CD28 ratio of antibody bound
to the beads is used. In yet another embodiment, a 3:1 CD3:CD28
ratio of antibody bound to the beads is used.
[0188] Ratios of particles to cells from 1:500 to 500:1 and any
integer values in between may be used to stimulate T cells or other
target cells. As those of ordinary skill in the art can readily
appreciate, the ratio of particles to cells may depend on particle
size relative to the target cell. For example, small sized beads
could only bind a few cells, while larger beads could bind many. In
certain embodiments the ratio of cells to particles ranges from
1:100 to 100:1 and any integer values in-between and in further
embodiments the ratio comprises 1:9 to 9:1 and any integer values
in between, can also be used to stimulate T cells. The ratio of
anti-CD3- and anti-CD28-coupled particles to T cells that result in
T cell stimulation can vary as noted above, however certain
preferred values include 1:100, 1:50, 1:40, 1:30, 1:20, 1:10, 1:9,
1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1, and 15:1 with one preferred ratio being at
least 1:1 particles per T cell. In one embodiment, a ratio of
particles to cells of 1:1 or less is used. In one particular
embodiment, a preferred particle: cell ratio is 1:5. In further
embodiments, the ratio of particles to cells can be varied
depending on the day of stimulation. For example, in one
embodiment, the ratio of particles to cells is from 1:1 to 10:1 on
the first day and additional particles are added to the cells every
day or every other day thereafter for up to 10 days, at final
ratios of from 1:1 to 1:10 (based on cell counts on the day of
addition). In one particular embodiment, the ratio of particles to
cells is 1:1 on the first day of stimulation and adjusted to 1:5 on
the third and fifth days of stimulation. In another embodiment,
particles are added on a daily or every other day basis to a final
ratio of 1:1 on the first day, and 1:5 on the third and fifth days
of stimulation. In another embodiment, the ratio of particles to
cells is 2:1 on the first day of stimulation and adjusted to 1:10
on the third and fifth days of stimulation. In another embodiment,
particles are added on a daily or every other day basis to a final
ratio of 1:1 on the first day, and 1:10 on the third and fifth days
of stimulation. One of skill in the art will appreciate that a
variety of other ratios may be suitable for use in the present
invention. In particular, ratios will vary depending on particle
size and on cell size and type.
[0189] In further embodiments of the present invention, the cells,
such as T cells, are combined with agent-coated beads, the beads
and the cells are subsequently separated, and then the cells are
cultured. In an alternative embodiment, prior to culture, the
agent-coated beads and cells are not separated but are cultured
together. In a further embodiment, the beads and cells are first
concentrated by application of a force, such as a magnetic force,
resulting in increased ligation of cell surface markers, thereby
inducing cell stimulation.
[0190] By way of example, cell surface proteins may be ligated by
allowing paramagnetic beads to which anti-CD3 and anti-CD28 are
attached (3.times.28 beads) to contact the T cells. In one
embodiment the cells (for example, 10.sup.4 to 10.sup.9 T cells)
and beads (for example, DYNABEADS.RTM. M-450 CD3/CD28 T
paramagnetic beads at a ratio of 1:1) are combined in a buffer,
preferably PBS (without divalent cations such as, calcium and
magnesium). Again, those of ordinary skill in the art can readily
appreciate any cell concentration may be used. For example, the
target cell may be very rare in the sample and comprise only 0.01%
of the sample or the entire sample (i.e., 100%) may comprise the
target cell of interest. Accordingly, any cell number is within the
context of the present invention. In certain embodiments, it may be
desirable to significantly decrease the volume in which particles
and cells are mixed together (i.e., increase the concentration of
cells), to ensure maximum contact of cells and particles. For
example, in one embodiment, a concentration of about 2 billion
cells/ml is used. In another embodiment, greater than 100 million
cells/ml is used. In a further embodiment, a concentration of cells
of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used.
In yet another embodiment, a concentration of cells from 75, 80,
85, 90, 95, or 100 million cells/ml is used. In further
embodiments, concentrations of 125 or 150 million cells/ml can be
used. Using high concentrations can result in increased cell yield,
cell activation, and cell expansion. Further, use of high cell
concentrations allows more efficient capture of cells that may
weakly express target antigens of interest, such as CD28-negative T
cells. Such populations of cells may have therapeutic value and
would be desirable to obtain in certain embodiments. For example,
using high concentration of cells allows more efficient selection
of CD8+ T cells that normally have weaker CD28 expression.
[0191] In one embodiment of the present invention, the mixture may
be cultured for several hours (about 3 hours) to about 14 days or
any hourly integer value in between. In another embodiment, the
mixture may be cultured for 21 days. In one embodiment of the
invention the beads and the T cells are cultured together for about
eight days. In another embodiment, the beads and T cells are
cultured together for 2-3 days. Several cycles of stimulation may
also be desired such that culture time of T cells can be 60 days or
more. Conditions appropriate for T cell culture include an
appropriate media (e.g., Minimal Essential Media or RPMI Media 1640
or, X-vivo 15, (Lonza)) that may contain factors necessary for
proliferation and viability, including serum (e.g., fetal bovine or
human serum), interleukin-2 (IL-2), insulin, IFN-.gamma., IL-4,
IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF.beta., and TNF-.alpha. or
any other additives for the growth of cells known to the skilled
artisan. Other additives for the growth of cells include, but are
not limited to, surfactant, plasmanate, and reducing agents such as
N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI
1640, AIM-V, DMEM, MEM, .alpha.-MEM, F-12, X-Vivo 15, and X-Vivo
20, Optimizer, with added amino acids, sodium pyruvate, and
vitamins, either serum-free or supplemented with an appropriate
amount of serum (or plasma) or a defined set of hormones, and/or an
amount of cytokine(s) sufficient for the growth and expansion of T
cells. Antibiotics, e.g., penicillin and streptomycin, are included
only in experimental cultures, not in cultures of cells that are to
be infused into a subject. The target cells are maintained under
conditions necessary to support growth, for example, an appropriate
temperature (e.g., 37.degree. C.) and atmosphere (e.g., air plus 5%
CO.sub.2).
[0192] T cells that have been exposed to varied stimulation times
may exhibit different characteristics. For example, typical blood
or apheresed peripheral blood mononuclear cell products have a
helper T cell population (T.sub.H, CD4.sup.+) that is greater than
the cytotoxic or suppressor T cell population (T.sub.C, CD8.sup.+).
Ex vivo expansion of T cells by stimulating CD3 and CD28 receptors
produces a population of T cells that prior to about days 8-9
consists predominately of T.sub.H cells, while after about days
8-9, the population of T cells comprises an increasingly greater
population of T.sub.C cells. Accordingly, depending on the purpose
of treatment, infusing a subject with a T cell population
comprising predominately of T.sub.H cells may be advantageous.
Similarly, if an antigen-specific subset of T.sub.C cells has been
isolated it may be beneficial to expand this subset to a greater
degree.
[0193] Further, in addition to CD4 and CD8 markers, other
phenotypic markers vary significantly, but in large part,
reproducibly during the course of the cell expansion process. Thus,
such reproducibility enables the ability to tailor an activated T
cell product for specific purposes.
Therapeutic Application
[0194] The present invention encompasses a cell (e.g., T cell)
transduced with a lentiviral vector (LV). For example, the LV
encodes a CAR that combines an antigen recognition domain of a
specific antibody with an intracellular domain of CD3-zeta, CD28,
4-1BB, or any combinations thereof. Therefore, in some instances,
the transduced T cell can elicit a CAR-mediated T-cell
response.
[0195] The invention provides the use of a CAR to redirect the
specificity of a primary T cell to a tumor antigen. Thus, the
present invention also provides a method for stimulating a T
cell-mediated immune response to a target cell population or tissue
in a mammal comprising the step of administering to the mammal a T
cell that expresses a CAR, wherein the CAR comprises a binding
moiety that specifically interacts with a predetermined target, a
zeta chain portion comprising for example the intracellular domain
of human CD3zeta, and a costimulatory signaling region.
[0196] In one embodiment, the present invention includes a type of
cellular therapy where T cells are genetically modified to express
a CAR and the CAR T cell is infused to a recipient in need thereof.
The infused cell is able to kill tumor cells in the recipient.
Unlike antibody therapies, CAR T cells are able to replicate in
vivo resulting in long-term persistence that can lead to sustained
tumor control.
[0197] In one embodiment, the CAR T cells of the invention can
undergo robust in vivo T cell expansion and can persist for an
extended amount of time. In another embodiment, the CAR T cells of
the invention evolve into specific memory T cells that can be
reactivated to inhibit any additional tumor formation or growth.
For example, it was unexpected that the CART19 cells of the
invention can undergo robust in vivo T cell expansion and persist
at high levels for an extended amount of time in blood and bone
marrow and form specific memory T cells. Without wishing to be
bound by any particular theory, CAR T cells may differentiate in
vivo into a central memory-like state upon encounter and subsequent
elimination of target cells expressing the surrogate antigen.
[0198] Without wishing to be bound by any particular theory, the
anti-tumor immunity response elicited by the CAR-modified T cells
may be an active or a passive immune response. In addition, the CAR
mediated immune response may be part of an adoptive immunotherapy
approach in which CAR-modified T cells induce an immune response
specific to the antigen binding moiety in the CAR. For example, a
CART19 cells elicits an immune response specific against cells
expressing CD19.
[0199] While the data disclosed herein specifically disclose
lentiviral vector comprising anti-CD19 scFv derived from FMC63
murine monoclonal antibody, human CD8.alpha. hinge and
transmembrane domain, and human 4-1BB and CD3zeta signaling
domains, the invention should be construed to include any number of
variations for each of the components of the construct as described
elsewhere herein. That is, the invention includes the use of any
antigen binding moiety in the CAR to generate a CAR-mediated T-cell
response specific to the antigen binding moiety. For example, the
antigen binding moiety in the CAR of the invention can target a
tumor antigen for the purposes of treat cancer.
[0200] Cancers that may be treated include tumors that are not
vascularized, or not yet substantially vascularized, as well as
vascularized tumors. The cancers may comprise non-solid tumors
(such as hematological tumors, for example, leukemias and
lymphomas) or may comprise solid tumors. Types of cancers to be
treated with the CARs of the invention include, but are not limited
to, carcinoma, blastoma, and sarcoma, and certain leukemia or
lymphoid malignancies, benign and malignant tumors, and
malignancies e.g., sarcomas, carcinomas, and melanomas. Adult
tumors/cancers and pediatric tumors/cancers are also included.
[0201] Hematologic cancers are cancers of the blood or bone marrow.
Examples of hematological (or hematogenous) cancers include
leukemias, including acute leukemias (such as acute lymphocytic
leukemia, acute myelocytic leukemia, acute myelogenous leukemia and
myeloblastic, promyelocytic, myelomonocytic, monocytic and
erythroleukemia), chronic leukemias (such as chronic myelocytic
(granulocytic) leukemia, chronic myelogenous leukemia, and chronic
lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's
disease, non-Hodgkin's lymphoma (indolent and high grade forms),
multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain
disease, myelodysplastic syndrome, hairy cell leukemia and
myelodysplasia.
[0202] Solid tumors are abnormal masses of tissue that usually do
not contain cysts or liquid areas. Solid tumors can be benign or
malignant. Different types of solid tumors are named for the type
of cells that form them (such as sarcomas, carcinomas, and
lymphomas). Examples of solid tumors, such as sarcomas and
carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteosarcoma, and other sarcomas, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, lymphoid malignancy, pancreatic cancer, breast
cancer, lung cancers, ovarian cancer, prostate cancer,
hepatocellular carcinoma, squamous cell carcinoma, basal cell
carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid
carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous
gland carcinoma, papillary carcinoma, papillary adenocarcinomas,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor,
cervical cancer, testicular tumor, seminoma, bladder carcinoma,
melanoma, and CNS tumors (such as a glioma (such as brainstem
glioma and mixed gliomas), glioblastoma (also known as glioblastoma
multiforme) astrocytoma, CNS lymphoma, germinoma, medulloblastoma,
Schwannoma craniopharyogioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma,
neuroblastoma, retinoblastoma and brain metastases).
[0203] In one embodiment, the antigen bind moiety portion of the
CAR of the invention is designed to treat a particular cancer. For
example, the CAR designed to target CD19 can be used to treat
cancers and disorders including but are not limited to pre-B ALL
(pediatric indication), adult ALL, mantle cell lymphoma, diffuse
large B-cell lymphoma, salvage post allogenic bone marrow
transplantation, and the like.
[0204] In another embodiment, the CAR can be designed to target
CD22 to treat diffuse large B-cell lymphoma.
[0205] In one embodiment, cancers and disorders include but are not
limited to pre-B ALL (pediatric indication), adult ALL, mantle cell
lymphoma, diffuse large B-cell lymphoma, salvage post allogenic
bone marrow transplantation, and the like can be treated using a
combination of CARs that target CD19, CD20, CD22, and ROR1.
[0206] In one embodiment, the CAR can be designed to target
mesothelin to treat mesothelioma, pancreatic cancer, ovarian
cancer, and the like.
[0207] In one embodiment, the CAR can be designed to target
CD33/IL3Ra to treat acute myelogenous leukemia and the like.
[0208] In one embodiment, the CAR can be designed to target c-Met
to treat triple negative breast cancer, non-small cell lung cancer,
and the like.
[0209] In one embodiment, the CAR can be designed to target PSMA to
treat prostate cancer and the like.
[0210] In one embodiment, the CAR can be designed to target
Glycolipid F77 to treat prostate cancer and the like.
[0211] In one embodiment, the CAR can be designed to target
EGFRvIII to treat gliobastoma and the like.
[0212] In one embodiment, the CAR can be designed to target GD-2 to
treat neuroblastoma, melanoma, and the like.
[0213] In one embodiment, the CAR can be designed to target
NY-ESO-1 TCR to treat myeloma, sarcoma, melanoma, and the like.
[0214] In one embodiment, the CAR can be designed to target MAGE A3
TCR to treat myeloma, sarcoma, melanoma, and the like.
[0215] However, the invention should not be construed to be limited
to solely to the antigen targets and diseases disclosed herein.
Rather, the invention should be construed to include any antigenic
target that is associated with a disease where a CAR can be used to
treat the disease.
[0216] The CAR-modified T cells of the invention may also serve as
a type of vaccine for ex vivo immunization and/or in vivo therapy
in a mammal. Preferably, the mammal is a human.
[0217] With respect to ex vivo immunization, at least one of the
following occurs in vitro prior to administering the cell into a
mammal: i) expansion of the cells, ii) introducing a nucleic acid
encoding a CAR to the cells, and/or iii) cryopreservation of the
cells.
[0218] Ex vivo procedures are well known in the art and are
discussed more fully below. Briefly, cells are isolated from a
mammal (preferably a human) and genetically modified (i.e.,
transduced or transfected in vitro) with a vector expressing a CAR
disclosed herein. The CAR-modified cell can be administered to a
mammalian recipient to provide a therapeutic benefit. The mammalian
recipient may be a human and the CAR-modified cell can be
autologous with respect to the recipient. Alternatively, the cells
can be allogeneic, syngeneic or xenogeneic with respect to the
recipient.
[0219] The procedure for ex vivo expansion of hematopoietic stem
and progenitor cells is described in U.S. Pat. No. 5,199,942,
incorporated herein by reference, can be applied to the cells of
the present invention. Other suitable methods are known in the art,
therefore the present invention is not limited to any particular
method of ex vivo expansion of the cells. Briefly, ex vivo culture
and expansion of T cells comprises: (1) collecting CD34+
hematopoietic stem and progenitor cells from a mammal from
peripheral blood harvest or bone marrow explants; and (2) expanding
such cells ex vivo. In addition to the cellular growth factors
described in U.S. Pat. No. 5,199,942, other factors such as flt3-L,
IL-1, IL-3 and c-kit ligand, can be used for culturing and
expansion of the cells.
[0220] In addition to using a cell-based vaccine in terms of ex
vivo immunization, the present invention also provides compositions
and methods for in vivo immunization to elicit an immune response
directed against an antigen in a patient.
[0221] Generally, the cells activated and expanded as described
herein may be utilized in the treatment and prevention of diseases
that arise in individuals who are immunocompromised. In particular,
the CAR-modified T cells of the invention are used in the treatment
of CCL. In certain embodiments, the cells of the invention are used
in the treatment of patients at risk for developing CCL. Thus, the
present invention provides methods for the treatment or prevention
of CCL comprising administering to a subject in need thereof, a
therapeutically effective amount of the CAR-modified T cells of the
invention.
[0222] The CAR-modified T cells of the present invention may be
administered either alone, or as a pharmaceutical composition in
combination with diluents and/or with other components such as IL-2
or other cytokines or cell populations. Briefly, pharmaceutical
compositions of the present invention may comprise a target cell
population as described herein, in combination with one or more
pharmaceutically or physiologically acceptable carriers, diluents
or excipients. Such compositions may comprise buffers such as
neutral buffered saline, phosphate buffered saline and the like;
carbohydrates such as glucose, mannose, sucrose or dextrans,
mannitol; proteins; polypeptides or amino acids such as glycine;
antioxidants; chelating agents such as EDTA or glutathione;
adjuvants (e.g., aluminum hydroxide); and preservatives.
Compositions of the present invention are preferably formulated for
intravenous administration.
[0223] Pharmaceutical compositions of the present invention may be
administered in a manner appropriate to the disease to be treated
(or prevented). The quantity and frequency of administration will
be determined by such factors as the condition of the patient, and
the type and severity of the patient's disease, although
appropriate dosages may be determined by clinical trials.
[0224] When "an immunologically effective amount", "an anti-tumor
effective amount", "an tumor-inhibiting effective amount", or
"therapeutic amount" is indicated, the precise amount of the
compositions of the present invention to be administered can be
determined by a physician with consideration of individual
differences in age, weight, tumor size, extent of infection or
metastasis, and condition of the patient (subject). It can
generally be stated that a pharmaceutical composition comprising
the T cells described herein may be administered at a dosage of
10.sup.4 to 10.sup.9 cells/kg body weight, preferably 10.sup.5 to
10.sup.6 cells/kg body weight, including all integer values within
those ranges. T cell compositions may also be administered multiple
times at these dosages. The cells can be administered by using
infusion techniques that are commonly known in immunotherapy (see,
e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The
optimal dosage and treatment regime for a particular patient can
readily be determined by one skilled in the art of medicine by
monitoring the patient for signs of disease and adjusting the
treatment accordingly.
[0225] In certain embodiments, it may be desired to administer
activated T cells to a subject and then subsequently redraw blood
(or have an apheresis performed), activate T cells therefrom
according to the present invention, and reinfuse the patient with
these activated and expanded T cells. This process can be carried
out multiple times every few weeks. In certain embodiments, T cells
can be activated from blood draws of from 10 cc to 400 cc. In
certain embodiments, T cells are activated from blood draws of 20
cc, 30 cc, 40 cc, 50 cc, 60 cc, 70 cc, 80 cc, 90 cc, or 100 cc. Not
to be bound by theory, using this multiple blood draw/multiple
reinfusion protocol may serve to select out certain populations of
T cells.
[0226] The administration of the subject compositions may be
carried out in any convenient manner, including by aerosol
inhalation, injection, ingestion, transfusion, implantation or
transplantation. The compositions described herein may be
administered to a patient subcutaneously, intradermally,
intratumorally, intranodally, intramedullary, intramuscularly, by
intravenous (i. v.) injection, or intraperitoneally. In one
embodiment, the T cell compositions of the present invention are
administered to a patient by intradermal or subcutaneous injection.
In another embodiment, the T cell compositions of the present
invention are preferably administered by i.v. injection. The
compositions of T cells may be injected directly into a tumor,
lymph node, or site of infection.
[0227] In certain embodiments of the present invention, cells
activated and expanded using the methods described herein, or other
methods known in the art where T cells are expanded to therapeutic
levels, are administered to a patient in conjunction with (e.g.,
before, simultaneously or following) any number of relevant
treatment modalities, including but not limited to treatment with
agents such as antiviral therapy, cidofovir and interleukin-2,
Cytarabine (also known as ARA-C) or natalizumab treatment for MS
patients or efalizumab treatment for psoriasis patients or other
treatments for PML patients. In further embodiments, the T cells of
the invention may be used in combination with chemotherapy,
radiation, immunosuppressive agents, such as cyclosporin,
azathioprine, methotrexate, mycophenolate, and FK506, antibodies,
or other immunoablative agents such as CAM PATH, anti-CD3
antibodies or other antibody therapies, cytoxin, fludaribine,
cyclosporin, FK506, rapamycin, mycophenolic acid, steroids,
FR901228, cytokines, and irradiation. These drugs inhibit either
the calcium dependent phosphatase calcineurin (cyclosporine and
FK506) or inhibit the p70S6 kinase that is important for growth
factor induced signaling (rapamycin) (Liu et al., Cell 66:807-815,
1991; Henderson et al., Immun. 73:316-321, 1991; Bierer et al.,
Curr. Opin. Immun. 5:763-773, 1993). In a further embodiment, the
cell compositions of the present invention are administered to a
patient in conjunction with (e.g., before, simultaneously or
following) bone marrow transplantation, T cell ablative therapy
using either chemotherapy agents such as, fludarabine,
external-beam radiation therapy (XRT), cyclophosphamide, or
antibodies such as OKT3 or CAMPATH. In another embodiment, the cell
compositions of the present invention are administered following
B-cell ablative therapy such as agents that react with CD20, e.g.,
Rituxan. For example, in one embodiment, subjects may undergo
standard treatment with high dose chemotherapy followed by
peripheral blood stem cell transplantation. In certain embodiments,
following the transplant, subjects receive an infusion of the
expanded immune cells of the present invention. In an additional
embodiment, expanded cells are administered before or following
surgery.
[0228] The dosage of the above treatments to be administered to a
patient will vary with the precise nature of the condition being
treated and the recipient of the treatment. The scaling of dosages
for human administration can be performed according to art-accepted
practices. The dose for CAMPATH, for example, will generally be in
the range 1 to about 100 mg for an adult patient, usually
administered daily for a period between 1 and 30 days. The
preferred daily dose is 1 to 10 mg per day although in some
instances larger doses of up to 40 mg per day may be used
(described in U.S. Pat. No. 6,120,766).
EXPERIMENTAL EXAMPLES
[0229] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0230] Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the compounds
of the present invention and practice the claimed methods. The
following working examples therefore, specifically point out the
preferred embodiments of the present invention, and are not to be
construed as limiting in any way the remainder of the
disclosure.
Example 1
T Cells Expressing Chimeric Receptors Establish Memory and Potent
Antitumor Effects in Patients with Advanced Leukemia
[0231] Lymphocytes engineered to express chimeric antigen receptors
(CARs) have demonstrated minimal in vivo expansion and antitumor
effects in previous clinical trials. The results presented herein
demonstrate that that CAR T cells containing CD137 have potent
non-cross resistant clinical activity following infusion in three
of three patients treated with advanced chronic lymphocytic
leukemia (CLL). The engineered T cells expanded more than a
thousand-fold in vivo, trafficked to bone marrow and continued to
express functional CARs at high levels for at least 6 months. On
average, each infused CAR+ T cell eradicated at least 1000 CLL
cells. A CD19 specific immune response was demonstrated in the
blood and bone marrow, accompanied by complete remission in two of
three patients. A portion of the cells persist as memory CAR+ T
cells, indicating the potential of this non-MHC restricted approach
for the effective treatment of B cell malignancies.
[0232] The materials and methods employed in these experiments are
now described.
Materials and Methods
[0233] General Laboratory Statement
[0234] Research sample processing, freezing, and laboratory
analyses were performed in the Translational and Correlative
Studies Laboratory at the University of Pennsylvania which operates
under principles of Good Laboratory Practice with established SOP
and/or protocols for sample receipt, processing, freezing, and
analysis. Assay performance and data reporting conforms with MIATA
guidelines (Janetzki et al., 2009, Immunity 31:527-528).
[0235] Protocol Design
[0236] The clinical trial (NCT01029366) was conducted as diagramed
in FIG. 1. Patients with CD19 positive hematologic malignancy with
persistent disease following at least two prior treatment regimens
and who were not eligible for allogeneic stem cell transplantation
were eligible for the trial. Following tumor restaging, peripheral
blood T cells for CART19 manufacturing were collected by apheresis
and the subjects given a single course of chemotherapy as specified
in FIG. 10 during the week before infusion. CART19 cells were
administered by intravenous infusion using a 3 day split dose
regimen (10%, 30% and 60%) at the dose indicated in FIG. 10 and if
available, a second dose was administered on day 10; only patient
UPN 02 had sufficient cells for a second infusion. Subjects were
assessed for toxicity and response at frequent intervals for at
least 6 months. The protocol was approved by the US Food and Drug
Administration, the Recombinant DNA Advisory Committee and the
Institutional Review Board of the University of Pennsylvania. The
first day of infusion was set as study Day 0.
[0237] Subjects: Clinical Summary
[0238] The clinical summaries are outlined in FIG. 10 and detailed
histories are provided elsewhere herein. Patient UPN 01 was first
diagnosed with stage II B cell CLL at age 55. The patient was
asymptomatic and observed for approximately 11/2 years until
requiring therapy for progressive lymphocytosis, thrombocytopenia,
adenopathy, and splenomegaly. Over the course of time, the patient
received prior lines of therapy. The most recent therapy was 2
cycles of pentostatin, cyclophosphamide and rituximab 2 months
prior to CART19 cell infusion with a minimal response. The patient
then received one cycle of bendamustine as lymphodepleting
chemotherapy prior to CART-19 cell infusion.
[0239] Patient UPN 02 was first diagnosed with CLL at age 68 when
the patient was presented with fatigue and leukocytosis. The
patient was relatively stable for 4 years when the patient
developed progressive leukocytosis (195,000/.mu.l ), anemia and
thrombocytopenia requiring therapy. Karyotypic analysis showed that
the CLL cells had deletion of chromosome 17p. Because of
progressive disease, the patient was treated with alemtuzumab with
a partial response but within one and a half years the patient had
progressive disease. The patient was retreated with alemtuzumab for
18 weeks with a partial response and a 1 year progression free
interval. The patient then received 2 cycles of bendamustine with
rituximab without a significant response (FIG. 5A). The patient
received single agent bendamustine as lymphodepleting chemotherapy
prior to CART-19 cell infusion.
[0240] Patient UPN 03 presented at age 50 with asymptomatic stage I
CLL and was followed with observation for years. The patient had
progressive leukocytosis (white blood count 92,000/.mu.l) and
progressive adenopathy requiring therapy. The patient received 2
cycles of rituximab with fludarabine that resulted in normalization
of blood counts and significant improvement though not complete
resolution in adenopathy. The patient had an approximately 3 year
progression free interval. Karyotypic testing showed cells to
contain deletion of chromosome 17p with FISH demonstrating a TP53
deletion in 170 of 200 cells. Over the next years the patient
required 3 different lines of therapy (FIG. 10) for progressive
leukocytosis and adenopathy, last receiving alemtuzumab with a
partial response 6 months prior CART19 cell infusion. The patient
received pentostatin and cyclophosphamide as lymphodepleting
chemotherapy prior to CART-19 cell infusion.
[0241] Vector Production
[0242] The CD19-BB-z transgene (GeMCRIS 0607-793) was designed and
constructed as described (Milone et al., 2009, Mol Ther.
17:1453-1464). Lentiviral vector was produced according to current
good manufacturing practices using a three-plasmid production
approach at Lentigen Corporation as described (Zufferey et al.,
1997, Nature biotechnol 15:871-875).
[0243] Preparation of CART19 Cell Product
[0244] Methods of T cell preparation using paramagnetic polystyrene
beads coated with anti-CD3 and anti-CD28 monoclonal antibodies have
been described (Laport et al., 2003, Blood 102: 2004-2013).
Lentiviral transduction was performed as described (Levine et al.,
2006, Proc Natl Acad Sci USA 103:17372-17377).
[0245] Methods for Tumor Burden Calculation
[0246] CLL burden at baseline was estimated as shown in FIG. 10.
The amount of CLL cells were calculated in bone marrow, blood, and
secondary lymphoid tissues as described below.
[0247] Bone marrow: In healthy adults, the bone marrow represents
approximately 5% of total body weight (Woodard et al., 1960, Phys
Med Biol, 5:57-59; Bigler et al., 1976, Health Phys 31:213-218).
The bone marrow in iliac crest samples has an increasing percentage
of inactive (fatty) marrow with age, rising from 20% of the total
marrow at age 5 to about 50% by age 35, when it remains stable
until age 65, and then rises to about 67% inactive marrow by age 75
(Hartsock et al., 1965, Am J Clin Path 43:326-331). The
international reference value for the total skeletal weight of
active (red) and inactive (fatty) marrow for males at age 35 is
currently set at 1170 g and 2480 g, respectively (Basic anatomical
and physiological data for use in radiological protection: The
Skeleton in Annals of the ICRP, Vol. 25 (ed. Smith, H.) 58-68 (A
report of a Task Group of Committee 2 of the International
Commission on Radiological Protection, Oxford, 1995)). Adult males
between ages 35 to 65 have marrow that represents 5.0% total of
body weight, comprised of 1.6% as active (red) marrow and 3.4% as
inactive (fatty) marrow (Basic anatomical and physiological data
for use in radiological protection: The Skeleton in Annals of the
ICRP, Vol. 25 (ed. Smith, H.) 58-68 (A report of a Task Group of
Committee 2 of the International Commission on Radiological
Protection, Oxford, 1995)). Based on the bone marrow biopsy and
aspirate specimens, the weight of CLL cells for the three patients
at baseline was calculated as shown in the Table 1. These estimates
of total CLL marrow mass were then converted to total CLL cell
number in the marrow using 1 Kg=10.sup.12 cells, and the resulting
numbers are shown in FIG. 10. These calculations are based on the
assumption that the CLL has a uniform distribution in the bone
marrow. For patient UPN 01, calculations are shown for a marrow
biopsy that was obtained before bendamustine chemotherapy, and for
an aspirate obtained after bendamustine and pre-CART19 infusion.
The numbers are less precise for the day-1 aspirate compared to the
day -14 biopsy specimen due to technical limitations of the day-1
aspirate. Patient UPN 02 had a single pre-treatment biopsy specimen
showing complete replacement of marrow by CLL. This patient had an
unchanged specimen on day 30 post CART19. The marrow burden for
patient UPN 03 was calculated based on a post-chemotherapy and
pre-CART19 biopsy.
[0248] Blood: Only patient UPN 02 had substantial CLL tumor burden
in the blood pre-CART19 infusion. Flow cytometry showed that the
cells had a typical phenotype as a clonal population with a dim
surface kappa-restricted CD5+ CD10-CD19+ CD20(dim)+ CD23(variable)+
IgM-B cell population. Approximately 35% of the CLL cells
coexpressed CD38. The CLL burden did not clear with 3 cycles of
bendamustine chemotherapy and was present at the time of CART19
infusions. At the time of CART19 infusion, the CLL count in blood
was 55,000 cells/.mu.L. Assuming a blood volume of 5.0 L, patient
UPN 02 had 2.75.times.10.sup.11 CLL cells in blood on day 0. Given
the normal overall WBC in patients UPN 01 and 03, the circulating
disease burden in these patients was not calculated, which would
lead to a slight underestimate of total body burden.
[0249] Secondary lymphoid tissues: The volume of lymphadenopathy
and splenomegaly was quantified on axial CT scans using
FDA-approved software. The volumes are for chest, abdomen and
pelvis only. Masses from the T1 vertebral body to the level of the
bifurcation of the common femoral artery were measured in all
patients, and in some, the nodes in the inguinal area were also
included. Nodes in the head/neck and extremities were excluded from
analysis and excluded from the baseline CLL target cell number,
which would also lead to a slight underestimate of total body
burden. Patients UPN 01 and 03 have had sustained complete
remissions beyond 6 months, and thus the formula (baseline volume
-month 3 volume) was used to determine the reduction in tumor
burden from baseline; patient UPN 02 had stable disease in
adenopathy, and thus the baseline tumor mass is estimated by
subtracting the reference splenic volume from age matched healthy
males (Harris et al., 2010, Eur J Radiol 75:e97-e101). Baseline
tumor mass was converted to CLL cells using a density approach (1
Kg/L density, and 1 Kg=1012 cells) cells or a volume approach (CLL
cells are 10 .mu.M diameter or 600 fL, assuming spherical shape),
and both values presented in FIG. 10. The tumor volumes in
secondary lymphoid tissues in the three patients are shown below in
Table 2 as calculated from the available CT scans.
TABLE-US-00001 TABLE 2 Tumor Volumes LN volume Spleen volume Total
volume Patient Study Day (mm3) (mm3) (mm3) UPN 01 -37 239655
1619180 1858835 1 month 105005 1258575 1363580 3 month 65060
1176625 1241685 UPN 02 -24 115990 1166800 1282790 1 month 111755
940960 1052715 UPN 03 -10 239160 435825 674985 1 month 111525
371200 482725 3 month 47245 299860 347105
[0250] The baseline CT scan for patient UPN 01 was performed 8 days
after 2 cycles of pentostatin/cyclophosphamide/rituximab, and
showed no response to this chemotherapy regimen compared to the
previous CT scan. The patient had one cycle of bendamustine before
CART19, and thus, the change in tumor volume from Day -37 to Day
+31 for UPN 01 cannot exclude the potential contribution of the
bendamustine as well as CART19. Similarly, the change in tumor
volume for UPN 03 reflects the combined effect of 1 cycle of
pentastatin/cyclophosphamide and CART19.
[0251] Method for Estimating Effective In Vivo E:T Ratio in
Patients
[0252] The E:T ratio of infused CAR T cells to the number of tumor
cells killed was calculated using the number of tumor cells present
at the time of CAR T cell injection and the number of CART cells
injected (Carpenito et al., 2009, Proc Natl Acad Sci USA
106:3360-3365). For the present invention, the number of CART19+ T
cells injected as shown on FIG. 10 was used because it is not
possible to determine the absolute number of CART19+ T cells
present in vivo with sufficient accuracy or precision. The
available data on CART19 expansion in blood and marrow is robust as
depicted in FIG. 2 and FIG. 6. However it was not possible to
determine the trafficking of CART19 to other sites such as
secondary lymphoid tissues, creating substantial uncertainty on the
total number of CART19 cells achieved in vivo at the time of
maximal tumor reduction. The calculated values from Table 3 were
used to derive the effective E:T ratios.
TABLE-US-00002 TABLE 3 Calculated CART19 E:T ratios achieved in
vivo Tumor Burden (Baseline and Delta) Total Bone marrow Blood
Nodes/Spleen.sup.1 Change in CART19+ cells Patient Baseline
Baseline Baseline CLL Burden Infused In Vivo E:T UPN 01 1.70E+12
N/A 8.1E+11 2.51E+12 1.13E+09 1:2200 UPN 02 3.20E+12 2.75E+11
1.6E+12 .sup. 2.74E+11.sup.2 5.80E+08 1:1000 UPN 03 8.80E+11 N/A
4.4E+11 1.32E+12 1.42E+07 1:93,000 Range 1000-93,000 .sup.1=
average of density and volume method .sup.2= Patient UPN02 did not
respond in bone marrow and had a partial reduction in adenopathy
(3.1E+11 cells) in the tumor masses measured by CT in spleen and
lymph nodes. See FIG. 5A for response in blood.
[0253] Sample Processing and Freezing
[0254] Samples (peripheral blood, marrow) were collected in
lavender top (K2EDTA,) or red top (no additive) vacutainer tubes
(Becton Dickinson) and delivered to the TCSL within 2 hours of
draw. Samples were processed within 30 minutes of receipt according
to established laboratory SOP. Peripheral blood and marrow
mononuclear cells were purified via Ficoll density gradient
centrifugation using Ficoll-Paque (GE Health care, 17-1440-03) and
frozen in RPMI (Gibco 11875-135) supplemented with 4% human serum
albumin (Gemini Bio-Products, 800-120), 2% Hetastarch (Novaplus,
NDC0409-7248-49), and 10% DMSO (Sigma, D2650) using 5100 Cryo
1.degree. freezing containers; after 24-72 hours at -80.degree. C.,
cells were transferred to liquid Nitrogen for long-term storage.
Apheresis samples were obtained through the Hospital of the
University of Pennsylvania Blood Bank and processed in the CVPF by
Ficoll gradient purification and frozen as above. Viability
immediately post-thaw was greater than 85% when assessed. For serum
isolation, samples were allowed to coagulate for 1.5-2 hours at
room temperature; serum isolated by centrifugation, and single use
100 .mu.l aliquots frozen at -80.degree. C.
[0255] Cell Lines
[0256] K562 (CML, CD19-negative) was obtained from ATCC (CCL-243).
K562/CD19, a generous gift of Carmine Carpenito, and is K562
lentivirally transduced at 100% frequency to express the CD19
molecule. NALM-6, a CD19-positive non-T, non-B ALL precursor B cell
line (Hurwitz et al., 1979, Int J Cancer 23:174-180), and confirmed
to express the CD19 antigen was a generous gift of Laurence Cooper.
The above cell lines were maintained in R10 medium (RPMI 1640
(Gibco, 11875) supplemented with 10% fetal bovine serum (Hyclone),
and 1% Pen-Strep (Gibco, 15140-122). Peripheral mononuclear cells
(ND365) from a healthy donor were obtained by apheresis from the
Human Immunology Core at the University of Pennsylvania, processed,
and frozen as above.
[0257] DNA Isolation and Q-PCR Analysis
[0258] Whole-blood or marrow samples were collected in lavender top
(K3EDTA) BD vacutainer tubes (Becton Dickinson). Genomic DNA was
isolated directly from whole-blood using QIAamp DNA blood midi kits
(Qiagen) and established laboratory SOP, quantified by
spectrophotometer, and stored at -80.degree. C. Q-PCR analysis on
genomic DNA samples was performed in bulk using 123-200 ng genomic
DNA/time-point, ABI Taqman technology and a validated assay to
detect the integrated CD19 CAR transgene sequence. Pass/fail
parameter ranges, including standard curve slope and r.sup.2
values, ability to accurately quantify a reference sample (1000
copies/plasmid spike) and no amplification in healthy donor DNA
sample were calculated from the qualification studies and
pre-established acceptance ranges. Primer/probes for the CD19 CAR
transgene were as described (Milone et al., 2009, Mol Ther
17:1453-1464). To determine copy number/unit DNA an 8-point
standard curve was generated consisting of 10.sup.6-5 copies
lentivirus plasmid spiked into 100 ng non-transduced control
genomic DNA. Each data-point (samples, standard curve, reference
samples) was evaluated in triplicate with average values reported.
For patient UPN 01, all reported values were derived from a
positive Ct value in 3/3 replicates with % CV less than 0.46%. For
patient UPN 02, with the exception of the day +177 sample (2/3
replicates positive, high % CV), all reported values were derived
from a positive Ct value in 3/3 replicates with % CV less than
0.72%. For patient UPN 03, with the exception of the day +1 sample
(2/3 replicates positive, 0.8% CV) and the day +3 sample (2/3
replicates positive, 0.67% CV), all reported values were derived
from a positive Ct value in 3/3 replicates with % CV less than
1.56%. The lower limit of quantification (LLOQ) for the assay was
determined from the standard curve at 2 copies/microgram DNA (10
copies/200 ng input DNA); average values below LLOQ (i.e.
reportable not quantifiable) are considered approximate. A parallel
amplification reaction to control for the quality of interrogated
DNA was performed using 12-20 ng input genomic DNA, a primer/probe
combination specific for non-transcribed genomic sequence upstream
of the CDKN1A gene (GENEBANK: Z85996) (sense primer:
GAAAGCTGACTGCCCCTATTTG; SEQ ID NO. 25, antisense primer:
GAGAGGAAGTGCTGGGAACAAT; SEQ ID NO. 26, probe: VIC--CTC CCC AGT CTC
TTT; SEQ ID NO. 27), and an 8 point standard curve created by
dilution of control genomic DNA; these amplification reactions
produced a correction factor (CF) (ng detected/ng input). Copies
transgene/microgram DNA were calculated according to the formula:
copies calculated from CD19 standard curve/input DNA
(ng).times.CF.times.1000 ng. Accuracy of this assay was determined
by the ability to quantify marking of the infused cell product by
Q-PCR according to the formula: Average marking=detected
copies/input DNA.times.6.3 pg DNA/male somatic cell.times.CF versus
transgene positivity by flow cytometry using CAR-specific detection
reagents. These blinded determinations generated 22.68% marking for
the UPN 01infusion product (22.6% by flow cytometry), 32.33%
marking for UPN 02 infusion product (23% by flow cytometry), and
4.3% marking for the UPN 03 infusion product (4.7% marking by flow
cytometry).
[0259] Cytokine Analyses
[0260] Quantification of soluble cytokine factors was performed
using Luminex bead array technology and kits purchased from Life
technologies (Invitrogen). Assays were performed as per the
manufacturer protocol with an 8 point standard curve generated
using a 3-fold dilution series. Each standard point and sample was
evaluated in duplicate at 1:3 dilution; calculated % CV for the
duplicate measures were less than 15%. Data were acquired on a
Bioplex 200 and analyzed with Bioplex Manager version 5.0 software
using 5-parameter logistic regression analysis. Standard curve
quantification ranges were determined by the 80-120%
(observed/expected value) range. Individual analyte quantification
ranges are reported in the Figure legends.
[0261] Cellular Assay to Detect CAR Function
[0262] Cells were evaluated for functionality after thaw and
overnight rest in TCM by measuring CD107 degranulation in response
to target cells. Degranulation assays were performed using
1.times.10.sup.6 PBMC and 0.25.times.10.sup.6 target cells in a
final volume of 500 .mu.l in 48-well plates for 2 hours at
37.degree. C. in the presence of CD49d (Becton Dickinson),
anti-CD28, monensin (e-Bioscience) and CD107a-FITC antibody
(eBiosciences) essentially as described (Betts et al., 2003, J
Immunol Methods 281:6578).
[0263] Antibody Reagents
[0264] The following antibodies were used for these studies:
MDA-CAR, a murine anti CD19 CAR antibody conjugated to Alexa647 was
a generous gift of Drs. Bipulendu Jena and Laurence Cooper (MD
Anderson Cancer Center). For multi-parametric immunophenotyping and
functional assays: anti-CD3-A700, anti-CD8-PE-Cy7, anti-PD-1-FITC
anti-CD25-AF488, anti-CD28-PercP-Cy5.5, anti-CD57-eF450,
anti-CD27-APC-eF780, anti-CD17-APC-eF780, anti-CD45RA-eF605NC,
CD107a-FITC (all from e-Bioscience), anti-CD4-PE-Texas Red and
Live/Dead Aqua (from Life Technologies) and anti-CD14-V500,
anti-CD16-V500 (from Becton Dickinson). For general
immunophenotyping: CD3-PE, CD14-APC, CD14-PE-Cy7, CD16-FITC,
CD16PE-Cy7, CD19-PE-Cy7, CD20-PE, all from Becton Dickinson.
[0265] Multi-Parameter Flow Cytometry
[0266] Cells were evaluated by flow cytometry either fresh after
Ficoll-Paque processing or, if frozen, after overnight rest at a
density of 2.times.10.sup.6 cells/ml in T cell medium (TCM) (X-vivo
15 (Lonza, 04-418Q) supplemented with 5% human AB serum (GemCall,
100-512), 1% Hepes (Gibco, 15630-080), 1% Pen-Strep (Gibco,
15140-122), 1% Glutamax (Gibco, 35050-061), and 0.2% N-Acetyl
Cysteine (American Regent, NDC0517-7610-03). Multi-parametric
immunophenotyping was performed on 4.times.10.sup.6 total
cells/condition, using FMO stains as described in the text. Cells
were stained at a density of 1.times.10.sup.6 cells/100 .mu.l PBS
for 30 minutes on ice using antibody and reagent concentrations
recommended by the manufacturer, washed, re-suspended in 0.5%
paraformaldehyde and acquired using a modified LSRII (BD
Immunocytometry systems) equipped with Blue (488 nm) Violet (405
nm), Green (532), and Red (633 nm) lasers and appropriate filter
sets for the detection and separation of the above antibody
combinations. A minimum of 100,000 CD3+cells were acquired) for
each stain. For functional assays, cells were washed, stained for
surface markers, re-suspended in 0.5% paraformaldehyde and acquired
as above; a minimum of 50,000 CD3+ events were collected for each
staining condition. Compensation values were established using
single antibody stains and BD compensation beads (Becton Dickinson)
and were calculated and applied automatically by the instrument.
Data were analyzed using FlowJo software (Version 8.8.4, Treestar).
For general immunophenotyping cells were acquired using an Accuri
C6 cytometer equipped with a Blue (488) and Red (633 nm) laser.
Compensation values were established using single antibody stains
and BD compensation beads (Becton Dickinson) and were calculated
manually. Data were analyzed using C-Flow software analysis package
(version 1.0.264.9, Accuri cytometers).
[0267] Patient Past Medical Histories and Response to Therapy
[0268] The clinical treatment summaries are outlined in FIG. 10.
Patient UPN 01 was first diagnosed with stage II B cell CLL at age
55. The patient was asymptomatic and observed for approximately
11/2 years until requiring therapy for progressive lymphocytosis,
thrombocytopenia, adenopathy, and splenomegaly. After 4 cycles of
fludarabine the patient had complete normalization of blood counts
and a complete response by CT scans. Progression was noted within 5
months with asymptomatic lymphocytosis, thrombocytopenia, and
increasing adenopathy. The patient was observed without symptoms
for approximately 3 years, and later required treatment with
Rituximab and fludarabine for progressive leukocytosis, anemia, and
thrombocytopenia. The patient was treated with 4 cycles of
rituximab with fludarabine with partial improvement in blood
counts. The patient again had progression within one year requiring
therapy manifested by leukocytosis (WBC 150,000/.mu.l) and
thrombocytopenia (platelets 30,000/.mu.l) and was treated with
alemtuzumab with normalization of blood counts. Progression was
noted within 13 months. The patient then received single agent
rituximab without a significant response and followed by rituximab,
cyclophosphamide, vincristine, and prednisone (R-CVP) for 2 cycles
with minimal response and followed by lenalidomide. Lenalidomide
was discontinued because of toxicity. The patient received 2 cycles
of pentostatin, cyclophosphamide and rituximab with a minimal
response.
[0269] Later, the patient received bendamustine as lymphodepleting
chemotherapy 4 days prior to CART19 cell infusion. Prior to
therapy, WBC was 14,200/.mu.l, hemoglobin 11.4 gm/dl, platelet
count 78,000/.mu.l and ALC was 8000/.mu.l. The CT scan showed
diffuse adenopathy and bone marrow was extensively infiltrated with
CLL (67% of cells). The patient received 1.6.times.10.sup.7 CART-19
cells/kg (1.13.times.10.sup.9 total CART19 cells as assessed by
FACS). There were no infusional toxicities. The patient became
neutropenic approximately 10 days after bendamustine and 6 days
after CART19 cell infusions, and beginning 10 days after the first
CART19 infusion, the patient developed fevers, rigors and transient
hypotension. At the same time, a chest X-ray and CT scan
demonstrated a left upper lobe pneumonia treated with antibiotics.
The fevers persisted for approximately 2 weeks and resolved when
there was neutrophil recovery. The patient has had no further
infectious or constitutional symptoms.
[0270] The patient achieved a rapid and complete response as
depicted in FIG. 5. Between 1 and 6 months after infusion no
circulating CLL cells have been detected in the blood by flow
cytometry. Bone marrow at 1, 3 and 6 months after CART-19 cell
infusions shows sustained absence of the lymphocytic infiltrate by
morphology and flow cytometry testing. The CT scans at 1 and 3
months after infusion show complete resolution of abnormal
adenopathy. The patient has had a persistent leukopenia (WBC
1000-3900/ul) and thrombocytopenia (platelets .about.100,000/ul),
and mild hypogammaglobulinia (IgG 525 mg/dL, normal 650-2000 mg/dL)
but no infectious complications.
[0271] Patient UPN 02 was treated with CART19 cells at age 77. The
patient had a relevant history of coronary artery disease and was
first diagnosed with CLL in 2000 at age 68 when the patient
presented with fatigue and leukocytosis. The patient was relatively
stable for 4 years when the patient developed progressive
leukocytosis (195,000/.mu.l), anemia and thrombocytopenia requiring
therapy. Genetic testing at that time showed that the CLL cells had
deletion of chromosome 17p. Because of progressive disease, the
patient was treated with a 12 week course of alemtuzumab with a
partial response and improvement in blood counts. Within one and a
half years the patient had progressive leukocytosis, anemia,
thrombocytopenia, and splenomegaly. Karyotypic analysis confirmed
deletion of chromosome 17p now with a deletion of chromosome 13q.
The patient was retreated with alemtuzumab for 18 weeks with
improvement of leukocytosis and stabilization of anemia and
splenomegaly. The patient had evidence of progressive leukocytosis,
anemia, and thrombocytopenia within one year. Treatment included 2
cycles of bendamustine with rituximab resulting in stable disease
but no significant improvement as shown in FIG. 5A.
[0272] The patient received bendamustine alone as lymphodepleting
chemotherapy prior to CART-19 cell infusion. The patient received
4.3.times.10.sup.6 CART19 cells/kg (4.1.times.10.sup.8 total cells)
in 3 split infusions complicated by transient fevers as high as
102.degree. degrees for 24 hours. On day 11 after the first
infusion, the patient received a boost of 4.1.times.10.sup.8
(4.3.times.10.sup.6/kg) CART19 cells and this infusion was
complicated by fevers, rigors and shortness of breath without
hypoxia requiring a 24 hour hospitalization. There was no evidence
for cardiac ischemia, and the symptoms resolved. On day 15 after
the first CART-19 infusion and day 4 after the boost CART19 cell
infusion the patient was admitted to the hospital with high fevers
(up to 104.degree. F.), chills and rigors. Extensive testing with
blood and urine cultures and CXR failed to identify a source of
infection. The patient complained of shortness of breath but had no
hypoxia. An echocardiogram showed severe hypokinesis. Ejection
fraction was 20%. The patient received prednisone 1 mg per kilogram
for one day and 0.3 mg per kilogram for approximately one week.
This resulted in rapid resolution of fevers and cardiac
dysfunction.
[0273] Coincident with the onset of high fevers, the patient had a
rapid drop in lymphocytes from peripheral blood as depicted in FIG.
5A. Although the patient had normalization of white blood count,
the patient had persistent circulating CLL, stable moderate anemia
and thrombocytopenia. Bone marrow showed persistent extensive
infiltration of CLL one month after therapy despite dramatic
peripheral blood cytoreduction, and CT scans showed a partial
reduction of adenopathy and splenomegaly. Five months after CART19
cell infusions the patient developed progressive lymphocytosis.
Nine months after infusions the patient has lymphocytosis
(16,500/.mu.l) with stable modest anemia and thrombocytopenia with
stable adenopathy. The patient remains asymptomatic and has not had
further therapy.
[0274] Patient UPN 03 was diagnosed with asymptomatic stage I CLL
at age 50 and was followed with observation for 6 years. Later, the
patient had progressive leukocytosis (white blood count
92,000/.mu.l) and progressive adenopathy requiring therapy. The
patient received 2 cycles of rituximab with fludarabine that
resulted in normalization of blood counts and significant
improvement though not complete resolution in adenopathy. The
patient had approximately a 3 year progression free interval
followed over the next 6 months by rapidly progressive leukocytosis
(WBC 165,000/.mu.l) and progressive adenopathy requiring therapy.
The patient received one cycle of fludarabine and 3 cycles of
rituximab with fludarabine with normalization of blood counts and
resolution of palpable adenopathy. The patient had an approximate
20 month progression free interval until the patient again
developed rapidly progressing leukocytosis and adenopathy. At this
time, bone marrow was extensively infiltrated with CLL and
karyotypic analysis showed cells to contain deletion of chromosome
17p with FISH demonstrating a TP53 deletion in 170/200 cells. The
patient received one cycle of rituximab with bendamustine followed
by 4 cycles of bendamustine only (due to a severe allergic reaction
to rituximab). The patient had initial normalization of blood
counts but shortly after discontinuation of therapy had progressive
leukocytosis and adenopathy.
[0275] Autologous T cells were collected by apheresis and
cryopreserved from Patient UPN3. The patient was then treated with
alemtuzumab for 11 weeks through with an excellent hematologic
response. There was improvement though not complete resolution in
adenopathy. The patient had active but stable disease over the next
6 months. Later, the patient received pentostatin and
cyclophosphamide as lymphodepleting chemotherapy prior to CART19
cell infusion.
[0276] Three days after chemotherapy but prior to cell infusion,
the bone marrow was hypercellular (60%) with approximately 40%
involvement by CLL. Because of manufacturing limitations inherent
in apheresis collections from CLL patients as depicted in Table 3
and (Bonyhadi et al., 2005, J Immunol 174:2366-2375), the patient
was infused with a total of 1.46.times.10.sup.5 CART19+ cells per
kg (1.42.times.10.sup.7 total CART19+ cells) over 3 days. There
were no infusional toxicities. Fourteen days after the first
infusion, the patient began having chills, fevers as high as
102.degree. F., rigors, nausea and diarrhea treated
symptomatically. The patient had no respiratory or cardiac
symptoms. By day 22 after infusion, a tumor lysis syndrome was
diagnosed manifested by an elevated LDH, uric acid, and complicated
by renal insufficiency. The patient was hospitalized and treated
with fluid resuscitation and rasburicase with rapid normalization
of uric acid and renal function. A detailed clinical evaluation
with a CXR, blood, urine, and stool cultures were performed and
were all negative or normal.
[0277] Within 1 month of CART-19 infusions, the patient had
clearance of circulating CLL from the blood and bone marrow by
morphology, flow cytometry, cytogenetic, and FISH analysis and CT
scans showed resolution of abnormal adenopathy (FIG. 5C). The
patient's remission has been sustained beyond 8 months from the
initial CART19 cell infusion.
[0278] The results of the experiments are now described.
Clinical Protocol
[0279] Three patients with advanced, chemotherapy-resistant CLL
were enrolled on a pilot clinical trial as depicted in FIG. 1. All
patients were extensively pretreated with various chemotherapy and
biologic regimens as shown in FIG. 10. Two of the patients had p53
deficient CLL, a deletion that portends poor response to
conventional therapy and rapid progression (Dohner et al., 1995,
Blood, 851580-1589). Each of the patients had large tumor burdens
following the preparative chemotherapy, including extensive marrow
infiltration (40 to 95%) and lymphadenopathy; patient UPN 02 also
had significant peripheral lymphocytosis. The CART19 T cells were
prepared as depicted in FIG. 1B and details of the cell
manufacturing and product characterization for each patient are
shown in Table 4. All patients were pretreated 1-4 days before
CART19 T cell infusions with lymphodepleting chemotherapy. A split
dose cell infusion schedule was used because the trial testing a
CAR incorporating a 4-1BB costimulatory signaling domain as
depicted in FIG. 1A.
TABLE-US-00003 TABLE 4 Apheresis products and CART19 product
release criteria Assay Specification UPN 01 UPN 02 UPN 03 Aphersis
Product Flow N/A 4.46% 2.29% 2.67% Cytometry For CD3+ or CD45+
CART19 Product Total Cell ~2-5 .times. 10.sup.9 5 .times. 10.sup.9
1.275 .times. 10.sup.9 3 .times. 10.sup.8 Number 1.275 .times.
10.sup.9 Infused [2.55 .times. 10.sup.9 total] Cell Viability
>=70% 96.2% 95.3 (90.5).sup.1 90.3 % CD3+ Cells >=80% 88.9%
98.8 98.9 Residual <=100 beads/ 3.95 1 4 Bead # 3 .times.
10.sup.6 Cells Endotoxin <=3.5 EU/mL <0.5 EU/mL <0.5 EU/mL
<0.5 EU/mL Mycoplasma Negative Negative Negative Negative
Sterility No Growth No Growth No Growth No Growth (Bactec) Fungal
No Growth No Growth No Growth No Growth Culture BSA ELISA <=1
.mu.g/mL <0.5 ng/mL <0.5 ng/mL <0.5 ng/mL Replication RCL
Not Inconclusive.sup.2 Inconclusive.sup.2 Competent Not Detectable
Detectable Lentivirus (RCL) Transduction >=20% 22.6% 23% .sup.
4.74%.sup.4 Efficiency (scFv Expression) Vector DNA 0.2-3 .sup.
0.15.sup.3 0.275 0.101 Sequence copies/cell (CART19 PCR) .sup.1=
Dose #2. .sup.2= Assay value at Day 12 below LOQ and had been
decreasing from earlier in expansion consistent with carryover of
plasmid DNA from vector generation. Submitted to the FDA as an
informational amendment. .sup.3= Product release based on surface
staining by FACS. .sup.4= Treatment exception granted for release
criteria by external DSMC and IRB.
In Vivo Expansion and Persistence of CART19 and Trafficking to Bone
Marrow
[0280] CAR+ T cells expanded using CD3/CD28 beads and expressing a
4-1BB signaling domain is believed to be in improvement to CARs
lacking 4-1BB. A Q-PCR assay was developed to enable quantitative
tracking of CART19 cells in blood and bone marrow. All patients had
expansion and persistence of the CART19-cells in blood for at least
6 months as depicted in FIGS. 2A and 2C. Notably, patients UPN 01
and UPN 03 had a 1,000 to 10,000 fold expansion of CAR+ T cells in
blood during the first month post infusion. The peak expansion
levels coincided with onset of the post-infusion clinical symptoms
in patient UPN 01 (day 15) and patient UPN 03 (day 23).
Furthermore, following an initial decay that can be modeled with
first order kinetics, the CART19 T cell levels stabilized in all 3
patients from day 90 to 180 post infusion. Significantly, the
CART19 T cells also trafficked to bone marrow in all patients,
albeit at 5-to 10-fold lower levels than observed in blood as
depicted in FIGS. 2D through 2F. Patients UPN 01 and 03 had a log
linear decay in the marrow, with a disappearance T1/2 of .about.35
days.
Induction of Specific Immune Responses in the Blood and Bone Marrow
Compartments following CART19 Infusion
[0281] Serum samples from all patients were collected and batch
analyzed to quantitatively determine cytokine levels, assessing a
panel of cytokines, chemokines, and other soluble factors to assess
potential toxicities and to provide evidence of CART19 cell
function as depicted in FIG. 3. Of thirty analytes tested, eleven
had a 3-fold or more change from baseline, including 4 cytokines
(IL-6, INF-.gamma., IL-8 and IL-10), 5 chemokines (MIP-1.alpha.,
MIP-1.beta., MCP-1, CXCL9, CXCL10) and soluble receptors for
IL-1R.alpha. and IL-2R.alpha.. Of these, interferon-y had the
largest relative change from baseline. Interestingly, the peak time
of cytokine elevation in UPN 01 and UPN 03 correlated temporally
with the previously described clinical symptoms and the peak levels
of CART19 cells in the blood in each patient. Only modest changes
were noted in patient UPN 02, perhaps as a result of corticosteroid
treatment given to this patient. Elevation of soluble IL-2 was not
detected in the serum of the patients, even though one of the
pre-clinical rationales for developing CAR+ T cells with 4-1BB
signaling domains was the reduced propensity to trigger IL-2
secretion compared to CD28 signaling domains (Milone et al., 2009,
Mol Ther. 17:1453-1464). This may be relevant to sustained clinical
activity as previous studies have shown that CAR+ T cells are
potentially suppressed by regulatory T cells (Lee et al., 2011,
Cancer Res 71:2871-2881), cells that could be elicited by CARs that
secrete substantial amounts of IL-2 or by the provision of
exogenous IL-2 post-infusion. Finally, a robust induction of
cytokine secretion in the supernatants from bone marrow aspirates
of UPN 03 was observed as depicted in FIG. 3D that also coincided
with the development of tumor lysis syndrome and complete
remission.
Prolonged Expression and Establishment of a Population of Memory
CART19 Cells in Blood
[0282] A central question in CAR-mediated cancer immunotherapy is
whether optimized cell manufacturing and costimulation domains
enhance the persistence of genetically modified T cells and permit
the establishment of CAR+ memory T cells in patients. Previous
studies have not demonstrated robust expansion, prolonged
persistence and/or expression of CARs on T cells after infusion
(Kershaw et al., 2006, Clin Cancer Res 12:6106-6115; Lamers et al.,
2006, J Clin Oncol 24:e20-e22; Till et al., 2008, Blood, 112,
2261-2271; Savoldo et al., 2011, J Clin Invest
doi:10.1172/JCI46110). Flow-cytometric analysis of samples from
both blood and marrow at 169 days post infusion revealed the
presence of CAR19 expressing cells in UPN 03 (FIGS. 4A and 4B), and
an absence of B cells as depicted in FIG. 4A. Notably, by Q-PCR
assay, all three patients have persisting CAR+ cells at 4 months
and beyond as depicted in FIG. 2 and FIG. 6. The in vivo frequency
of CAR+ cells by flow cytometry closely matched the values obtained
from the PCR assay for the CART19 transgene. Importantly, in
patient UPN 03, only CD3+ cells expressed the CAR19, as CAR19+
cells were not detectable in CD16- or CD14-positive subsets as
depicted in FIG. 4A. CAR expression was also detected on the
surface of 4.2% of T cells in the blood of patient UPN 01 on day 71
post infusion as depicted in FIG. 7.
[0283] Next, polychromatic flow cytometry was used to perform
detailed studies to further characterize the expression, phenotype,
and function of CART19 cells in UPN 03 using an anti-CAR idiotype
antibody (MDA-647) and a gating strategy shown in FIG. 8. Notable
differences in the expression of memory and activation markers in
both CD8+ and CD4+ cells based on CAR19+ expression was observed.
At day 56, CART19 CD8+ cells displayed primarily an effector memory
phenotype (CCR7-CD27-CD28-) consistent with prolonged and robust
exposure to antigen as depicted in FIG. 4C. In contrast,
CAR-negative CD8+ cells consisted of mixtures of effector and
central memory cells, with CCR7 expression in a subset of cells,
and substantial numbers in the CD27+/CD28- and CD27+/CD28+
fractions. While both CART19 and CAR-negative cell populations
substantially expressed CD57, this molecule was uniformly
co-expressed with PD-1 in the CART19 cells, a possible reflection
of the extensive replicative history of these cells. In contrast to
the CAR-negative cell population, the entirety of the CART19 CD8+
population lacked expression of both CD25 and CD127. By day 169,
while the phenotype of the CAR-negative cell population remained
similar to the day 56 sample, the CART19 population had evolved to
contain a minority population with features of central memory
cells, notably expression of CCR7, higher levels of CD27 and CD28,
as well as CAR+ cells that were PD-1-negative, CD57-negative and
CD127-positive.
[0284] In the CD4+ compartment, at day 56 CART19 cells were
characterized by uniform lack of CCR7 and a predominance of
CD27+/CD28+/PD-1+ cells distributed within both CD57+ and
-compartments, and an essential absence of CD25 and CD127
expression as depicted in FIG. 4B. In contrast, CAR-negative cells
at this time-point were heterogeneous in CCR7, CD27 and PD-1
expression, expressed CD127 and also contained a substantial
CD25+/CD127-(potential regulatory T cell) population. By day 169,
while CD28 expression remained uniformly positive in all
CAR+CD4+cells, a fraction of the CART19 CD4+ cells had evolved
toward a central memory phenotype with expression of CCR7, a higher
percentage of CD27-cells, the appearance of a PD-1-negative subset,
and acquisition of CD127 expression. CAR-negative cells remained
reasonably consistent with their day 56 counterparts, with the
exception of a reduction in CD27 expression a decrease in the
percentage of CD25+/CD127-cells.
CART19 Cells can Retain Effector Function after 6 Months in
Blood
[0285] In addition to short persistence and inadequate in vivo
proliferation, a limitation of previous trials with CAR+T cells has
been the rapid loss of functional activity of the infused T cells
in vivo. The high level CART19 cell persistence and surface
expression of the CAR19 molecule in patient UPN 01 and 03 provided
the opportunity to directly test anti-CD19-specific effector
functions in cells recovered from cryopreserved peripheral blood
samples. PBMC from patient UPN 03 were cultured with target cells
that were either positive or negative for CD19 expression (FIG.
4d). Robust CD19-specific effector function of CART19 T cells was
demonstrated by specific degranulation against CD19-positive but
not CD19-negative target cells, as assessed by surface CD107a
expression. Notably, exposure of the CART19 population to
CD19-positive targets induced a rapid internalization of surface
CAR-19 as depicted in FIG. 8 for surface expression of CAR19 in the
same effector cells in standard flow-cytometric staining. The
presence of costimulatory molecules on target cells was not
required for triggering CART19 cell degranulation because the
NALM-6 line does not express CD80 or CD86 (Brentjens et al., 2007,
Clin Cancer Res 13:5426-5435). Effector function was evident at day
56 post infusion and was retained at the day 169 time-point. Robust
effector function of CAR+ and CAR- T cells could also be
demonstrated by pharmacologic stimulation.
Clinical Activity of CART19 Cells
[0286] There were no significant toxicities observed during the
four days following the infusion in any patient, other than
transient febrile reactions. However, all patients subsequently
developed significant clinical and laboratory toxicities between
day 7 and 21 following the first infusion. These toxicities were
short-term and reversible. Of the three patients treated to date,
there are 2 CRs and 1 PR at >6 months post CART19 infusion
according to standard criteria (Hallek et al., 2008, Blood
111:5446). Details of past medical history and response to therapy
for each patient are depicted in FIG. 10.
[0287] In brief, patient UPN 01 developed a febrile syndrome, with
rigors and transient hypotension beginning 10 days after infusion.
The fevers persisted for approximately 2 weeks and resolved; the
patient has had no further constitutional symptoms. The patient
achieved a rapid and complete response as depicted in FIG. 5.
Between 1 and 6 months after infusion, no circulating CLL cells
have been detected in the blood by flow cytometry. Bone marrow at
1, 3, and 6 months after CART19 cell infusions shows sustained
absence of the lymphocytic infiltrate by morphology and flow
cytometric analysis as depicted in FIG. 5B. CT scans at 1 and 3
months after infusion show resolution of adenopathy as depicted in
FIG. 5C. Complete remission was sustained for 10+ months at the
time of this report.
[0288] Patient UPN 02 was treated with 2 cycles of bendamustine
with rituximab resulting in stable disease as depicted in FIG. 5A.
The patient received a third dose of bendamustine as
lymphodepleting chemotherapy prior to CART19 T cell infusion. The
patient developed fevers to 40.degree. C., rigors and dyspnea
requiring a 24 hour hospitalization on day 11 after the first
infusion and on the day of the second CART19 cell boost. Fevers and
constitutional symptoms persisted and on day 15, the patient had
transient cardiac dysfunction; all symptoms resolved after
corticosteroid therapy was initiated on day 18. Following CART19
infusion, and coincident with the onset of high fevers, the patient
had rapid clearance of the p53-deficient CLL cells from peripheral
blood as depicted in FIG. 5A and a partial reduction of adenopathy,
bone marrow showed persistent extensive infiltration of CLL one
month after therapy despite dramatic peripheral blood
cytoreduction. The patient remains asymptomatic.
[0289] Patient UPN 03 received pentostatin and cyclophosphamide as
lymphodepleting chemotherapy prior to CART19 cell infusion. Three
days after chemotherapy but prior to cell infusion, bone marrow was
hypercellular (60%) with approximately 50% involvement by CLL. The
patient received a low dose of CART19 cells (1.5.times.10.sup.5
CAR+ T cells/kg divided over 3 days). Again, there were no acute
infusional toxicities. However, 14 days after the first infusion,
the patient began having rigors, fevers, nausea and diarrhea. By
day 22 after infusion, tumor lysis syndrome was diagnosed requiring
hospitalization. The patient had resolution of constitutional
symptoms, and within 1 month of CART19 infusions, the patient had
clearance of circulating CLL from the blood and bone marrow by
morphology, flow cytometry, cytogenetic, and FISH analysis. CT
scans showed resolution of abnormal adenopathy as depicted in FIGS.
5B and 5C. Complete remission was sustained beyond 8 months from
the initial CART19 cell infusion.
Considerations of In Vivo CART19 Effector to CLL Target Cell
Ratio
[0290] Pre-clinical studies showed that large tumors could be
ablated, and that the infusion of 2.2.times.10.sup.7CARs could
eradicate tumors comprised of 1.times.10.sup.9 cells, for an in
vivo E:T ratio of 1:42 in humanized mice (Carpenito et al., 2009,
Proc Natl Acad Sci USA 106:3360-3365), although these calculations
did not take into account the expansion of T cells after injection.
Estimation of CLL tumor burden over time permitted the calculation
of tumor reduction and the estimated CART19 E:T ratios achieved in
vivo in the three subjects based on number of CAR+T cells infused.
Tumor burdens were calculated by measuring CLL load in bone marrow,
blood and secondary lymphoid tissues. The baseline tumor burdens as
shown in FIG. 10 indicate that each patient had on the order of
10.sup.12 CLL cells (i.e. 1 kilogram tumor load) before CART19
infusion. Patient UPN 03 had an estimated baseline tumor burden of
8.8.times.10.sup.11 CLL cells in the bone marrow on day -1 (i.e.
post chemotherapy and pre-CART19 infusion), and a measured tumor
mass in secondary lymphoid tissues of 3.3-5.5.times.10.sup.11CLL
cells, depending on the method of volumetric CT scan analysis.
Given that UPN 03 was infused with only 1.4.times.10.sup.7CART19
cells, using the estimate of initial total tumor burden
(1.3.times.10.sup.12 CLL cells), and that no CLL cells are
detectable post treatment, a striking 1:93,000 E:T ratio was
achieved. By similar calculations, an effective E:T ratio in vivo
of 1:2200 and 1:1000 was calculated for UPN 01 and UPN 02 as shown
in Table 3). In the end, a contribution of serial killing by CART19
T cells, combined with in vivo CART19 expansion of >1,000-fold
likely contributed to the powerful anti-leukemic effects mediated
by CART19 cells.
T Cells Expressing Chimeric Receptors Establish Memory and Potent
Antitumor Effects in Patients with Advanced Leukemia
[0291] Limited in vivo expression and effector function of CARs has
been a central limitation in the trials testing first generation
CARs (Kershaw et al., 2006, Clin Cancer Res 12:6106-6115; Lamers et
al., 2006, J Clin Oncol 24:e20-e22; Till et al., 2008, Blood, 112,
2261-2271; Park et al., 2007, Mol Ther 15:825833; Pule et al.,
2008, Nat Med 14:1264-1270). Based on pre-clinical modeling
demonstrating enhanced persistence of CARs containing a 4-1BB
signaling module (Milone et al., 2009, Mol Ther. 17:1453-1464;
Carpenito et al., 2009, Proc Natl Acad Sci USA 106:3360-3365),
experiments were designed to develop a second generation of CARs
engineered with lentiviral vector technology. This second
generation of CARs was found to be safe in the setting of chronic
HIV infection (Levine et al., 2006, Proc Natl Acad Sci USA
103:17372-17377). The present results show that when this second
generation CAR was expressed in T cells and cultured under
conditions designed to promote engraftment of central memory T
cells (Rapoport et al., 2005, Nat Med 11:1230-1237; Bondanza et
al., 2006, Blood 107:1828-1836), improved expansion of CAR T cells
after infusion was observed compared to previous reports. CART19
cells established CD19-specific cellular memory, and killed tumor
cells at E:T ratios in vivo not previously achieved.
[0292] CART19 is the first CAR trial to incorporate a 4-1BB
signaling domain and the first to use lentiviral vector technology.
The present results demonstrate efficient tracking of CARs to sites
of tumor, with the de facto establishment of "tumor infiltrating
lymphocytes" that exhibited CD19 specificity. The pronounced in
vivo expansion permitted the first demonstration that CARs directly
recovered from patients can retain effector function in vivo for
months. A previous study had suggested that introduction of a first
generation CAR into virus specific T cells is preferable to primary
T cells (Pule et al., 2008, Nat Med 14:1264-1270), however the
results with second generation CARs introduced into optimally
costimulated primary T cells calls this notion into question.
Without wishing to be bound by any particular theory, a cautionary
note is raised that the clinical effects were profound and
unprecedented with the lysis of kilogram sized tumor burdens in all
three patients accompanied with the delayed release of potentially
dangerously high levels of cytokines in two of the patients.
Classical cytokine storm effects were not observed. However, the
present study was designed to mitigate this possibility by
deliberate infusion of CART19 over a period of three days.
[0293] It was found that very low doses of CARs can elicit potent
clinical responses. This was a pilot study that demonstrated safety
of the CART19 vector design. The observation that doses of CART19
cells several orders of magnitude below those tested in previous
trials can have clinical benefit may have important implications
for future implementation of CAR therapy on a wider scale, and for
the design of trials testing CARs directed against targets other
than CD19.
[0294] The present studies further indicate that CART19 is
expressed in both central memory and effector T cells, and this
likely contributes to their long term survival compared to previous
reports. Without wishing to be bound by any particular theory, CAR
T cells may differentiate in vivo into a central memory-like state
upon encounter and subsequent elimination of target cells (e.g. CLL
tumor cells or normal B cells) expressing the surrogate antigen.
Indeed signaling of 4-1BB has been reported to promote the
development of memory in the context of TCR signaling (Sabbagh et
al., 2007, Trends Immunol 28:333-339).
[0295] The extended proliferation and survival of CART19 has
revealed aspects of the pharmacokinetics of CAR T cells that have
not previously been reported. It was observed that the kinetics of
cytokine release in serum and marrow correlated with peak CART19
levels, so that it is possible that the decay is initiated when
cellular targets expressing CD19 become limiting. The mechanism of
the extended survival of CART19 may relate to the aforementioned
incorporation of the 4-1BB domain or to signaling through the
natural TCR and/or CAR. An intriguing possibility is that the
extended survival is related to the population of CART19 that has
been identified in marrow specimens, raising the hypothesis that
CD19 CARs could be maintained by encounter with B cell progenitors
in the bone marrow. Related to this question is what drives the
initial expansion of CART19 cells in vivo? With rare exceptions
(Savoldo et al., 2011, J Clin Invest doi:10.1172/JCI46110; Pule et
al., 2008, Nat Med 14:1264-1270), the present study is the only
trial to have omitted IL-2 infusions, so that the CART19 cells
likely either expanded in response to homeostatic cytokines or more
likely, to CD19 expressed on leukemic targets and/or normal B
cells. In the latter case, this could be an attractive feature for
CARs directed against targets on normal APCs such as CD19 and CD20,
as it is possible that self renewal of CART19 occurs on the normal
cells, providing a mechanism for CAR memory by means of "self
vaccination/boosting" and therefore, long term tumor
immunosurveillance. The mechanisms of CART19 homeostasis may
require further study to elucidate cell intrinsic and extrinsic
mechanisms of persistence. Previous to these results, most
investigators have viewed CAR therapy as a transient form of
immunotherapy, however CARs with optimized signaling domains may
have a role in both remission induction and consolidation as well
as for long term immunosurveillance.
[0296] Potent anti-leukemic effects have been observed in all three
patients, including two patients with p53 deficient leukemia.
Previous studies with CARs have had difficulty separating antitumor
effects from lymphodepleting chemotherapy. However, the delayed
cytokine release combined with the kinetics of tumor lysis in
fludarabine-refractory patients that was coincident, and possibly
dependent on in vivo CAR expansion in the present study, indicate
that CART19 mediates potent antitumor effects. The present results
do not exclude a role for chemotherapy in potentiating the effects
of CARs.
[0297] A thorough comparison of the vector, transgene and cell
manufacturing procedures with results from ongoing studies at other
centers may be required to gain a full understanding of the key
features required to obtain sustained function of CAR T cells in
vivo. Unlike antibody therapies, CAR-modified T cells have the
potential to replicate in vivo, and long-term persistence could
lead to sustained tumor control. The availability of an off the
shelf therapy comprised of non-cross resistant killer T cells has
the potential to improve the outcome of patients with B cell
malignancies. A limitation of antibody therapy, as for example,
with agents such as rituximab and bevicizumab, is that the therapy
requires repeated antibody infusions, that is inconvenient and
costly. The delivery of prolonged antibody therapy (in this case
for at least 6 months in 3 of 3 patients treated to date) with
anti-CD19 scFv expressed on T cells following a single infusion of
CART19 cells has a number of practical advantages, including
conveniences and cost savings.
Example 2
Chimeric Antigen Receptor-Modified T Cells in Chronic Lymphoid
Leukemia
[0298] A lentiviral vector expressing a chimeric antigen receptor
with specificity for the B-cell antigen CD19, coupled with CD137 (a
costimulatory receptor in T cells [4-1BB]) and CD3-zeta (a
signal-transduction component of the T-cell antigen receptor)
signaling domains, was designed. It was observed that a low dose
(approximately 1.5.times.10.sup.5 cells per kilogram of body
weight) of autologous chimeric antigen receptor-modified T cells
reinfused into a patient with refractory chronic lymphocytic
leukemia (CLL) expanded to a level that was more than 1000 times as
high as the initial engraftment level in vivo. It was also observed
that the patient exhibited delayed development of the tumor lysis
syndrome and with complete remission.
[0299] Apart from the tumor lysis syndrome, the only other grade
3/4 toxic effect related to chimeric antigen receptor T cells was
lymphopenia. Engineered cells persisted at high levels for at least
6 months in the blood and bone marrow and continued to express the
chimeric antigen receptor. A specific immune response was detected
in the bone marrow, accompanied by loss of normal B cells and
leukemia cells that express CD19. Remission was ongoing 10 months
after treatment. Hypogammaglobulinemia was an expected chronic
toxic effect.
[0300] The materials and methods employed in these experiments are
now described.
Materials and Methods
[0301] Study Procedures
[0302] A self-inactivating lentiviral vector (GeMCRIS 0607-793) was
designed, which was subjected to preclinical safety testing, as
reported previously (Milone et al., 2009, Mol Ther, 17: 1453-64).
Methods of T-cell preparation have also been described previously
(Porter et al, 2006, Blood, 107:1325-31). Quantitative
polymerase-chain-reaction (PCR) analysis was performed to detect
chimeric antigen receptor T cells in blood and bone marrow. The
lower limit of quantification was determined from the standard
curve; average values below the lower limit of quantification
(i.e., reportable but not quantifiable) are considered approximate.
The lower limit of quantification of the assay was 25 copies per
microgram of genomic DNA.
[0303] Soluble-factor analysis was performed with the use of serum
from whole blood and bone marrow that was separated into aliquots
for single use and stored at -80.degree. C. Quantification of
soluble cytokine factors was performed with the use of Luminex
bead-array technology and reagents (Life Technologies).
[0304] Apheresis #1
[0305] A 12-15 liter apheresis procedure is carried out at the
apheresis center. Peripheral blood mononuclear cells (PBMC) are
obtained for CART-19 T cell generation during this procedure. From
a single leukapheresis, at least 50.times.10.sup.9 white blood
cells are harvested to manufacture CART-19 T cells. Baseline blood
leukocytes are also obtained and cryopreserved.
[0306] Cytroreductive Chemotherapy
[0307] Chemotherapy is started approximately 5-10 days before
infusion so that CART-19 cells may be given 1-2 days after
completion of the chemotherapy. The timing of chemotherapy
initiation therefore depends on the length of the regimen. The
purpose of the chemotherapy is to induce lymphopenia in order to
facilitate engraftment and homeostatic expansion of CART-19 cells.
The chemotherapy may be chosen also to reduce disease tumor burden.
The cytoreductive chemotherapy is chosen and administered by
community oncologists. The choice of chemotherapy depends on the
patients underlying disease and prior therapies. Fludarabine (30
mg/m2/day.times.3 days) and cyclophosphamide (300 mg/m2/day.times.3
days) are the agents of choice, as there is the most experience
with the use of these agents in facilitating adoptive
immunotherapy. Several other acceptable regimens using FDA-approved
drugs are appropriate, including CHOP, HyperCVAD, EPOCH, DHAP, ICE
or other regimens.
[0308] Restaging Assessment
[0309] A limited restaging is performed at the completion of
chemotherapy in order to provide baseline tumor burden
measurements. This includes imaging, physical examination, and
minimal residual disease (MRD) assessments. Subjects undergo the
following for pre-infusing testing: physical exam, documentation of
adverse events and blood draws for hematology, chemistry and
pregnancy testing (if applicable).
[0310] Preparation of CART-19 T Cells
[0311] Autologous T cells are engineered to express an
extracellular single chain antibody (scFv) with specificity for
CD19. The extracellular scFv can redirect specificity of the
transduced T cells for cells that express CD19, a molecule that is
restricted in expression on the surface of the malignant cells and
on normal B cells. In addition to CD19 scFv, the cells are
transduced to express an intracellular signaling molecule comprised
of either the TCR.xi. chain or a tandem signaling domain comprised
of 4-1BB and TCR.xi. signaling modules. The scFv is derived from a
mouse monoclonal antibody, and thus contains mouse sequences, and
the signaling domains are entirely of the native human sequences.
CART-19 T cells are manufactured by isolating the T cells by
apheresis, and using lentiviral vector technology (Dropulic et al.,
2006, Human Gene Therapy, 17: 577-88; Naldini et al., 1996,
Science, 272: 263-7; Dull et al., 1998, J Virol, 72: 8463-71) to
introduce the scFv:TCR.xi.:4-1BB into CD4 and CD8 T cells. In some
patients, a control scFv:TCR.xi.K: is introduced into a portion of
the cells for a competitive repopulation experiment. These
receptors are "universal" in that they bind antigen in an
MHC-independent fashion, thus, one receptor construct can be used
to treat a population of patients with CD19 antigen-positive
tumors.
[0312] The CAR constructs were developed at the University of
Pennsylvania, and the clinical grade vector was manufactured at
Lentigen Corporation. The CART-19 cells are manufactured in the
Clinical Cell and Vaccine Production Facility at the University of
Pennsylvania according to the process shown in FIG. 11. At the end
of cell cultures, the cells are cryopreserved in infusible
cryomedia. A single dose of CART-19 transduced T cells comprising
of the infusion of 2.5.times.10.sup.9 to 5.times.10.sup.9 total
cells, are administered in either 1 or 2 bags. Each bag contains an
aliquot (volume dependent upon dose) of cryomedia containing the
following infusible grade reagents (% v/v): 31.25 plasmalyte-A,
31.25 dextrose (5%), 0.45 NaCl, up to 7.50 DMSO, 1.00 dextran 40,
5.00 human serum albumin with approximately 2.5-5.times.10.sup.9
autologous T cells per bag. For increased safety, the first dose is
given as a split dose on days 0,1 and 2, with .about.10% of the
cells on day 0, 30% on day 1, and 60% on day 2.
[0313] Storage
[0314] Bags (10 to 100 ml capacity) containing CART-19-transduced T
cells are stored in blood bank conditions in a monitored
-135.degree. C. freezer. Infusion bags are stored in the freezer
until needed.
[0315] Cell Thawing
[0316] After logging the cells in the investigational pharmacy,
frozen cells are transported in dry ice to the subject's bedside.
The cells are thawed at the bedside one bag at a time using a water
bath maintained at 36.degree. C. to 38.degree. C. The bag is gently
massaged until the cells have just thawed. There should be no
frozen clumps left in the container. If the CART-19 cell product
appears to have a damaged or leaking bag, or otherwise appears to
be compromised, it should not be infused.
[0317] Premedication
[0318] Side effects following T cell infusions may include
transient fever, chills, and/or nausea. It is recommended that the
subject be pre-medicated with acetaminophen 650 mg by mouth and
diphenhydramine hydrochloride 25-50 mg by mouth or IV, prior to the
infusion of CART-19 cells. These medications may be repeated every
six hours as needed. A course of non-steroidal anti-inflammatory
medication may be prescribed if the patient continues to have fever
not relieved by acetaminophen. It is recommended that patients not
receive systemic corticosteroids such as hydrocortisone,
prednisone, prednisolone (Solu-Medrol) or dexamethasone (Decadron)
at any time, except in the case of a life-threatening emergency,
since this may have an adverse effect on T cells. If
corticosteroids are required for an acute infusional reaction, an
initial dose of hydrocortisone 100 mg is recommended.
[0319] Administration/Infusion
[0320] Infusions begin 1 to 2 days after completion of
chemotherapy. The day of the first infusions, patients have a CBC
with differential, and assessment of CD3, CD4 and CD8 counts since
chemotherapy is given in part to induce lymphopenia. Without
wishing to be bound by any particular theory, it is believed that
an initial i.v. dose of 2.5-5.times.10.sup.9 CART-19 cells is
optimal for this protocol. Because there are about
1.times.10.sup.12 T cells in a healthy adult, the proposed total
dose is equivalent to about 0.5% of the total body mass of T cells
(Roederer, 1995, Nat Med, 1: 621-7; Macallan et al., 2003, Eur J
Immunol, 33: 2316-26). The first dose is administered using a split
dose on days 0 (10%), 1 (30%) and 2 (60%). Subjects receive
infusion in an isolated room. The cells are thawed at the patient's
bedside as described elsewhere herein. The thawed cells are given
at an infusion rate as quickly as tolerated so that the duration of
the infusion is approximately 10-15 minutes. The transduced T cells
are administered by rapid intravenous infusion at a flow rate of
approximately 10 mL to 20 mL per minute through an 18-gauge latex
free Y-type blood set with a 3-way stopcock. The duration of the
infusion is approximately 15 minutes. One or two bags of CART-19
modified cells are delivered on ice, and the cells are administered
to the subject while cold. In subjects receiving mixtures of
CART-19 cells, in order to facilitate mixing, the cells are
administered simultaneously using a Y-adapter. Subjects are infused
and premedicated as described elsewhere herein. Subjects' vital
signs are assessed and pulse oximetry is done prior to dosing, at
the end of the infusion and every 15 minutes thereafter for 1 hour
and until these are stable and satisfactory. A blood sample for
determination of baseline CART-19 level is obtained before infusion
and 20 minutes post infusion. Patients experiencing toxicities from
their preceding cytoreductive chemotherapy have their infusion
schedule delayed until these toxicities have resolved. The specific
toxicities warranting delay of T cell infusions include: 1)
Pulmonary: Requirement for supplemental oxygen to keep saturation
greater than 95% or presence of radiographic abnormalities on chest
x-ray that are progressive; 2) Cardiac: New cardiac arrhythmia not
controlled with medical management. 3) Hypotension requiring
pressor support. 4) Active Infection: Positive blood cultures for
bacteria, fungus, or virus within 48-hours of T cell infusion. A
serum sample for potassium and uric acid is collected before the
first infusion as well as two hours after each subsequent
infusion.
[0321] Post Infusion Laboratories to Assess Graftment and
Persistence
[0322] Subjects return at day 4 and 10 after the initial CART-19
cell infusion to have blood drawn for serum cytokine levels, and
CART-19 PCR in order to evaluate the presence of CART-19 cells.
Subjects return once a week for three weeks to undergo the
following: physical exam, documentation of adverse events and blood
draws for hematology, chemistry, engraftment and persistence of
CART-19 cells and research labs.
[0323] Second Infusion
[0324] Without wishing to be bound by any particular theory, it is
believed that a second dose of CART-19 cells can be given on day 11
to patients, provided that they exhibit adequate tolerance to the
first dose and sufficient CART-19 cells were manufactured. The dose
is 2-5.times.10.sup.9 total cells. A serum sample for potassium and
uric acid can be collected two hours after the infusion.
[0325] Second Apheresis
[0326] A 2 liter apheresis procedure is carried out at the
apheresis center. PBMC are obtained for research and cryopreserved.
Subjects undergo the following: physical exam, documentation of
adverse events and blood draws for hematology, chemistry,
engraftment and persistence of CART-19 cells and research labs. In
addition restaging is done in order to provide tumor burden
measurements. Restaging testing is determined by disease type and
includes imaging, MRD assessments, bone marrow aspirate and biopsy
and/or lymph node biopsy.
[0327] Monthly Evaluations 2 to 6 Months Post Infusion
[0328] Subjects return on a monthly basis during months 2 to 6 post
CART-19 cell infusion. At these study visits, subjects undergo the
following: concomitant medication, physical exam, documentation of
adverse events and blood draws for hematology, chemistry,
engraftment and persistence of CART-19 cells and research labs. The
HIV DNA assay is performed at months 2-6 post CART-19 cell infusion
to exclude the presence of detectable RCL.
[0329] Quarterly Evaluations up to 2 Years Post Infusion
[0330] Subjects are evaluated on a quarterly basis until 2 years
post infusion. At these study visits, subjects undergo the
following: concomitant medication, physical exam, documentation of
adverse events and blood draws for hematology, chemistry,
engraftment and persistence of CART-19 cells and research labs. The
HIV DNA assay is performed at months 3 and 6 post CART-19 cell
infusion to exclude the presence of detectable RCL.
[0331] The results of the experiments are now described
Patient History
[0332] The patient received a diagnosis of stage I CLL in 1996. He
first required treatment after 6 years of observation for
progressive leukocytosis and adenopathy. In 2002, he was treated
with two cycles of rituximab plus fludarabine; this treatment
resulted in normalization of blood counts and partial resolution of
adenopathy. In 2006, he received four cycles of rituximab and
fludarabine for disease progression, again with normalization of
blood counts and partial regression of adenopathy. This response
was followed by a 20-month progression-free interval and a 2-year
treatment-free interval. In February 2009, he had rapidly
progressive leukocytosis and recurrent adenopathy. His bone marrow
was extensively infiltrated with CLL. Cytogenetic analysis showed
that 3 of 15 cells contained a deletion of chromosome 17p, and
fluorescence in situ hybridization (FISH) testing showed that 170
of 200 cells had a deletion involving TP53 on chromosome 17p. He
received rituximab with bendamustine for one cycle and three
additional cycles of bendamustine without rituximab (because of a
severe allergic reaction). This treatment resulted in only
transient improvement in lymphocytosis. Progressive adenopathy was
documented by means of computed tomography (CT) after therapy.
[0333] Autologous T cells were collected by means of leukapheresis
and cryopreserved. The patient then received alemtuzumab (an
anti-CD52, mature-lymphocyte, cell-surface antigen) for 11 weeks,
with improved hematopoiesis and a partial resolution of adenopathy.
Over the next 6 months, he had stable disease with persistent,
extensive marrow involvement and diffuse adenopathy with multiple
1- to 3-cm lymph nodes. In July 2010, the patient was enrolled in a
phase 1 clinical trial of chimeric antigen receptor-modified T
cells.
Cell Infusions
[0334] Autologous T cells from the patient were thawed and
transduced with lentivirus to express the CD19-specific chimeric
antigen receptor (FIG. 12A); sequence identifiers for the
lentiviral vector and relevant sequences are depicted in Table 5.
Four days before cell infusion, the patient received chemotherapy
designed for depletion of lymphocytes (pentostatin at a dose of 4
mg per square meter of body-surface area and cyclophosphamide at a
dose of 600 mg per square meter) without rituximab (Lamanna et al.,
2006, J Clin Oncol, 24: 1575-81). Three days after chemotherapy but
before cell infusion, the bone marrow was hypercellular with
approximately 40% involvement by CLL. Leukemia cells expressed
kappa light chain and CD5, CD19, CD20, and CD23. Cytogenetic
analysis showed two separate clones, both resulting in loss of
chromosome 17p and the TP53 locus
(46,XY,del(17)(p12)[5]/46,XY,der(17)417;21)(q10;q10)[5]/46,XY[14]).
Four days after chemotherapy, the patient received a total of
3.times.10.sup.8 T cells, of which 5% were transduced, for a total
of 1.42.times.10.sup.7 transduced cells (1.46.times.10.sup.5 cells
per kilogram) split into three consecutive daily intravenous
infusions (10% on day 1, 30% on day 2, and 60% on day 3). No
postinfusion cytokines were administered. No toxic effects of
infusions were noted.
TABLE-US-00004 TABLE 5 Sequence identifiers for pELPS-CD19-BBz
transfer vector SEQ ID NO: # IDENTITY SEQ ID NO: 1 pELPS-CD19-BBZ
transfer vector (nucleic acid sequence) SEQ ID NO: 2 RSV's U3
(nucleic acid sequence) SEQ ID NO: 3 HIV R repeat (nucleic acid
sequence) SEQ ID NO: 4 HIV U5 Repeat (nucleic acid sequence) SEQ ID
NO: 5 Partial Gag/Pol (nucleic acid sequence) SEQ ID NO: 6 cPPT
(nucleic acid sequence) SEQ ID NO: 7 EF1 alpha Promoter (nucleic
acid sequence) SEQ ID NO: 8 CD19-BBzeta CAR (nucleic acid sequence)
SEQ ID NO: 9 Hu Woodchuck PRE (nucleic acid sequence) SEQ ID NO: 10
R Repeat (nucleic acid sequence)t SEQ ID NO: 11 U5 Repeat (nucleic
acid sequence) SEQ ID NO: 12 CD19-BBzeta CAR (amino acid sequence)
SEQ ID NO: 13 CD8 Leader (nucleic acid sequence) SEQ ID NO: 14
Anti-CD19scFv (nucleic acid sequence) SEQ ID NO: 15 CD8 Hinge
(nucleic acid sequence) SEQ ID NO: 16 CD8 Transmembrane (nucleic
acid sequence) SEQ ID NO: 17 4-1BB (nucleic acid sequence) SEQ ID
NO: 18 CD3zeta (nucleic acid sequence) SEQ ID NO: 19 CD8 Leader
(amino acid sequence) SEQ ID NO: 20 Anti-CD19scFv (amino acid
sequence) SEQ ID NO: 21 CD8 Hinge (amino acid sequence) SEQ ID NO:
22 CD8 Transmembrane (amino acid sequence) SEQ ID NO: 23 4-1BB
(amino acid sequence) SEQ ID NO: 24 CD3zeta (amino acid
sequence)
Clinical Response and Evaluations
[0335] Fourteen days after the first infusion, the patient began
having chills and low-grade fevers associated with grade 2 fatigue.
Over the next 5 days, the chills intensified, and his temperature
escalated to 39.2.degree. C. (102.5.degree. F.), associated with
rigors, diaphoresis, anorexia, nausea, and diarrhea. He had no
respiratory or cardiac symptoms. Because of the fevers, chest
radiography and blood, urine, and stool cultures were performed,
and were all negative or normal. The tumor lysis syndrome was
diagnosed on day 22 after infusion (FIG. 12B). The uric acid level
was 10.6 mg per deciliter (630.5 .mu.mol per liter), the phosphorus
level was 4.7 mg per deciliter (1.5 mmol per liter) (normal range,
2.4 to 4.7 mg per deciliter [0.8 to 1.5 mmol per liter]), and the
lactate dehydrogenase level was 1130 U per liter (normal range, 98
to 192). There was evidence of acute kidney injury, with a
creatinine level of 2.60 mg per deciliter (229.8 .mu.mol per liter)
(baseline level, <1.0 mg per deciliter [<88.4 .mu.mol per
liter]). The patient was hospitalized and treated with fluid
resuscitation and rasburicase. The uric acid level returned to the
normal range within 24 hours, and the creatinine level within 3
days; he was discharged on hospital day 4. The lactate
dehydrogenase level decreased gradually, becoming normal over the
following month.
[0336] By day 28 after CART19-cell infusion, adenopathy was no
longer palpable, and on day 23, there was no evidence of CLL in the
bone marrow (FIG. 12C). The karyotype was now normal in 15 of 15
cells (46,XY), and FISH testing was negative for deletion TP53 in
198 of 200 cells examined; this is considered to be within normal
limits in negative controls. Flow-cytometric analysis showed no
residual CLL, and B cells were not detectable (<1% of cells
within the CD5+CD10-CD19+CD23+ lymphocyte gate). CT scanning
performed on day 31 after infusion showed resolution of adenopathy
(FIG. 12D).
[0337] Three and 6 months after CART19-cell infusion, the physical
examination remained unremarkable, with no palpable adenopathy, and
CT scanning performed 3 months after CART19-cell infusion showed
sustained remission (FIG. 12D). Bone marrow studies at 3 and 6
months also showed no evidence of CLL by means of morphologic
analysis, karyotype analysis (46,XY), or flow-cytometric analysis,
with a continued lack of normal B cells as well. Remission had been
sustained for at least 10 months.
Toxicity of CART19 Cells
[0338] The cell infusions had no acute toxic effects. The only
serious (grade 3 or 4) adverse event noted was the grade 3 tumor
lysis syndrome described above. The patient had grade 1 lymphopenia
at baseline and grade 2 or 3 lymphopenia beginning on day 1 and
continuing through at least 10 months after therapy. Grade 4
lymphopenia, with an absolute lymphocyte count of 140 cells per
cubic millimeter, was recorded on day 19, but from day 22 through
at least 10 months, the absolute lymphocyte count ranged between
390 and 780 cells per cubic millimeter (grade 2 or 3 lymphopenia).
The patient had transient grade 1 thrombocytopenia (platelet count,
98,000 to 131,000 per cubic millimeter) from day 19 through day 26
and grade 1 or 2 neutropenia (absolute neutrophil count, 1090 to
1630 per cubic millimeter) from day 17 through day 33. Other signs
and symptoms that were probably related to the study treatment
included grade 1 and 2 elevations in aminotransferase and alkaline
phosphatase levels, which developed 17 days after the first
infusion and resolved by day 33. Grade 1 and 2 constitutional
symptoms consisted of fevers, chills, diaphoresis, myalgias,
headache, and fatigue. Grade 2 hypogammaglobulinemia was corrected
with infusions of intravenous immune globulin.
Analysis of Serum and Bone Marrow Cytokines
[0339] The patient's clinical response was accompanied by a delayed
increase in levels of inflammatory cytokines (FIG. 13A through FIG.
13D), with levels of interferon-.gamma., the
interferon-.gamma.-responsive chemokines CXCL9 and CXCL10, and
interleukin-6 that were 160 times as high as baseline levels. The
temporal rise in cytokine levels paralleled the clinical symptoms,
peaking 17 to 23 days after the first CART19-cell infusion.
[0340] The supernatants from serial bone marrow aspirates were
measured for cytokines and showed evidence of immune activation
(FIG. 13E). Significant increases in interferon-y, CXCL9,
interleukin-6, and soluble interleukin-2 receptor were noted, as
compared with the baseline levels on the day before T-cell
infusion; the values peaked on day 23 after the first CART19-cell
infusion. The increase in bone marrow cytokines coincided with the
elimination of leukemia cells from the marrow. Serum and marrow
tumor necrosis factor a remained unchanged.
Expansion and Persistence of Chimeric Antigen Receptor T Cells
[0341] Real-time PCR detected DNA encoding anti-CD19 chimeric
antigen receptor (CAR19) beginning on day 1 after the first
infusion (FIG. 14A). More than a 3-log expansion of the cells in
vivo was noted by day 21 after infusion. At peak levels, CART19
cells in blood accounted for more than 20% of circulating
lymphocytes; these peak levels coincided with the occurrence of
constitutional symptoms, the tumor lysis syndrome (FIG. 12B), and
elevations in serum cytokine levels (FIG. 13A through FIG. 13D).
CART19 cells remained detectable at high levels 6 months after the
infusions, though the values decreased by a factor of 10 from peak
levels. The doubling time of chimeric antigen receptor T cells in
blood was approximately 1.2 days, with an elimination half-life of
31 days.
Chimeric Antigen Receptor T Cells in Bone Marrow
[0342] CART19 cells were identified in bone marrow specimens
beginning 23 days after the first infusion (FIG. 14B) and persisted
for at least 6 months, with a decay half-life of 34 days. The
highest levels of CART19 cells in the bone marrow were identified
at the first assessment 23 days after the first infusion and
coincided with induction of an immune response, as indicated by
cytokine-secretion profiles (FIG. 13E). Flow-cytometric analysis of
bone marrow aspirates indicated a clonal expansion of CD5+CD19+
cells at baseline that was absent 1 month after infusion and in a
sample obtained 3 months after infusion (data not shown). Normal B
cells were not detected after treatment (FIG. 14C).
Treatment with Autologous Genetically Modified CART19 Cells
[0343] Described herein is the delayed development of the tumor
lysis syndrome and a complete response 3 weeks after treatment with
autologous T cells genetically modified to target CD19 through
transduction with a lentivirus vector expressing anti-CD19 linked
to CD3-zeta and CD137 (4-1BB) signaling domains. Genetically
modified cells were present at high levels in bone marrow for at
least 6 months after infusion. The generation of a CD19-specific
immune response in bone marrow was demonstrated by temporal release
of cytokines and ablation of leukemia cells that coincided with
peak infiltration of chimeric antigen receptor T cells. Development
of the tumor lysis syndrome after cellular immunotherapy has not
been reported previously (Baeksgaard et al., 2003, Cancer Chemother
Pharacol, 51: 187-92).
[0344] Genetic manipulation of autologous T cells to target
specific tumor antigens is an attractive strategy for cancer
therapy (Sadelain et al., 2009, Curr Opin Immunol, 21: 215-23; Jena
et al., 2010, Blood, 116: 1035-44). An important feature of the
approach described herein is that chimeric antigen receptor T cells
can recognize tumor targets in an HLA-unrestricted manner, so that
"off-the-shelf" chimeric antigen receptors can be constructed for
tumors with a wide variety of histologic features. HIV-derived
lentiviral vectors were used for cancer therapy, an approach that
may have some advantages over the use of retroviral vectors (June
et al., 2009, Nat Rev Immunol, 9: 704-16).
[0345] In previous trials of chimeric antigen receptor T cells,
objective tumor responses have been modest, and in vivo
proliferation of modified cells has not been sustained (Kershaw et
al., 2006, Clin Cancer Res, 12: 6106-15; Till et al., 2008, Blood,
112: 2261-71; Pule et al., 2008, Nat Med, 14: 1264-70). Brentjens
and colleagues reported preliminary results of a clinical trial of
CD19-targeted chimeric antigen receptors linked to a CD28 signaling
domain and found transient tumor responses in two of three patients
with advanced CLL (Brentjens et al., 2010, Mol Ther, 18: 666-8);
however, the chimeric antigen receptors rapidly disappeared from
the circulation.
[0346] It was unexpected that the very low dose of chimeric antigen
receptor T cells that were infused would result in a clinically
evident antitumor response. Indeed, the infused dose of
1.5.times.10.sup.5 chimeric antigen receptor T cells per kilogram
was several orders of magnitude below doses used in previous
studies of T cells modified to express chimeric antigen receptors
or transgenic T-cell receptors (Kershaw et al., 2006, Clin Cancer
Res, 12: 6106-15; Brentjens et al., 2010, Mol Ther, 18: 666-8;
Morgan et al., 2010, Mol Ther, 18: 843-51; Johnson et al., 2009,
Blood, 114: 535-46). Without being held to any particular theory,
it is speculated that the chemotherapy may potentiate the effects
of chimeric antigen receptor.
[0347] The prolonged persistence of CART19 cells in the blood and
bone marrow of the patient results from inclusion of the 4-1BB
signaling domain. It is likely that the CART19-cell-mediated
elimination of normal B cells facilitated the induction of
immunologic tolerance to the chimeric antigen receptor, since the
CART19 cells that express the single-chain Fv antibody fragment
containing murine sequences were not rejected. Given the absence of
detectable CD19-positive leukemia cells in this patient, and
without being held to any particular theory, it is possible that
homeostasis of the chimeric antigen receptor T cells was achieved
at least in part from stimulation delivered by early B-cell
progenitors as they began to emerge in the bone marrow. The
invention relates to the discovery that a new mechanism may exist
to maintain "memory" chimeric antigen receptor T cells.
[0348] Although CD19 is an attractive tumor target, with expression
limited to normal and malignant B cells, there is concern that
persistence of the chimeric antigen receptor T cells may mediate
long-term B-cell deficiency. In fact, in the patient, B cells were
absent from the blood and bone marrow for at least 6 months after
infusion. This patient did not have recurrent infections. Targeting
B cells through CD20 with rituximab is an effective and relatively
safe strategy for patients with B-cell neoplasms, and long-term
B-cell lymphopenia is manageable (Molina, 2008, Ann Rev Med, 59:
237-50). Patients treated with rituximab have been reported to have
a return of B cells within months after discontinuation of therapy.
It is not yet clear whether such recovery occurs in patients whose
anti-B-cell T cells persist in vivo.
[0349] Patients who have CLL with TP53 deletions have short
remissions after standard therapies (Dohner et al., 1995, Blood,
85: 1580-9). Allogeneic bone marrow transplantation has been the
only approach that has induced long-term remissions in patients
with advanced CLL (Gribben et al., 2011, Biol Blood Marrow
Transplant, 17: Suppl:S63-S70). However, the resulting potent
graft-versus-tumor effect is associated with considerable morbidity
because of the high frequency of chronic graft-versus-host disease,
which is often especially severe in older patients--those who are
typically affected by CLL (Gribben et al., 2011, Biol Blood Marrow
Transplant, 17: Suppl:S63-S70; Sorror et al., 2008, Blood, 111:
446-52). The data presented herein suggests that genetically
modified autologous T cells may circumvent this limitation.
[0350] The delayed onset of the tumor lysis syndrome and cytokine
secretion, combined with vigorous in vivo chimeric antigen receptor
T-cell expansion and prominent antileukemia activity, points to
substantial and sustained effector functions of the CART19 cells.
Experiments described herein highlights the potency of this therapy
and provides support for the detailed study of autologous T cells
genetically modified to target CD19 (and other targets) through
transduction of a chimeric antigen receptor linked to potent
signaling domains. Unlike antibody-mediated therapy, chimeric
antigen receptor-modified T cells have the potential to replicate
in vivo, and long-term persistence could lead to sustained tumor
control. Two other patients with advanced CLL have also received
CART19 infusions according to this protocol, and all three have had
tumor responses. These findings warrant continued study of
CD19-redirected T cells for B-cell neoplasms.
[0351] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety. While this invention has
been disclosed with reference to specific embodiments, it is
apparent that other embodiments and variations of this invention
may be devised by others skilled in the art without departing from
the true spirit and scope of the invention. The appended claims are
intended to be construed to include all such embodiments and
equivalent variations.
Sequence CWU 1
1
2719174DNAArtificial SequenceChemically Synthesized 1gcgcgctcac
tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 60cttaatcgcc
ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc
120accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgggacgc
gccctgtagc 180ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg
tgaccgctac acttgccagc 240gccctagcgc ccgctccttt cgctttcttc
ccttcctttc tcgccacgtt cgccggcttt 300ccccgtcaag ctctaaatcg
ggggctccct ttagggttcc gatttagtgc tttacggcac 360ctcgacccca
aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag
420acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact
cttgttccaa 480actggaacaa cactcaaccc tatctcggtc tattcttttg
atttataagg gattttgccg 540atttcggcct attggttaaa aaatgagctg
atttaacaaa aatttaacgc gaattttaac 600aaaatattaa cgcttacaat
ttaggtggca cttttcgggg aaatgtgcgc ggaaccccta 660tttgtttatt
tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat
720aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc
cgtgtcgccc 780ttattccctt ttttgcggca ttttgccttc ctgtttttgc
tcacccagaa acgctggtga 840aagtaaaaga tgctgaagat cagttgggtg
cacgagtggg ttacatcgaa ctggatctca 900acagcggtaa gatccttgag
agttttcgcc ccgaagaacg ttttccaatg atgagcactt 960ttaaagttct
gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg
1020gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc
acagaaaagc 1080atcttacgga tggcatgaca gtaagagaat tatgcagtgc
tgccataacc atgagtgata 1140acactgcggc caacttactt ctgacaacga
tcggaggacc gaaggagcta accgcttttt 1200tgcacaacat gggggatcat
gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag 1260ccataccaaa
cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca
1320aactattaac tggcgaacta cttactctag cttcccggca acaattaata
gactggatgg 1380aggcggataa agttgcagga ccacttctgc gctcggccct
tccggctggc tggtttattg 1440ctgataaatc tggagccggt gagcgtgggt
ctcgcggtat cattgcagca ctggggccag 1500atggtaagcc ctcccgtatc
gtagttatct acacgacggg gagtcaggca actatggatg 1560aacgaaatag
acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag
1620accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa
tttaaaagga 1680tctaggtgaa gatccttttt gataatctca tgaccaaaat
cccttaacgt gagttttcgt 1740tccactgagc gtcagacccc gtagaaaaga
tcaaaggatc ttcttgagat cctttttttc 1800tgcgcgtaat ctgctgcttg
caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 1860cggatcaaga
gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac
1920caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac
tctgtagcac 1980cgcctacata cctcgctctg ctaatcctgt taccagtggc
tgctgccagt ggcgataagt 2040cgtgtcttac cgggttggac tcaagacgat
agttaccgga taaggcgcag cggtcgggct 2100gaacgggggg ttcgtgcaca
cagcccagct tggagcgaac gacctacacc gaactgagat 2160acctacagcg
tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt
2220atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca
gggggaaacg 2280cctggtatct ttatagtcct gtcgggtttc gccacctctg
acttgagcgt cgatttttgt 2340gatgctcgtc aggggggcgg agcctatgga
aaaacgccag caacgcggcc tttttacggt 2400tcctggcctt ttgctggcct
tttgctcaca tgttctttcc tgcgttatcc cctgattctg 2460tggataaccg
tattaccgcc tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg
2520agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa
ccgcctctcc 2580ccgcgcgttg gccgattcat taatgcagct ggcacgacag
gtttcccgac tggaaagcgg 2640gcagtgagcg caacgcaatt aatgtgagtt
agctcactca ttaggcaccc caggctttac 2700actttatgct tccggctcgt
atgttgtgtg gaattgtgag cggataacaa tttcacacag 2760gaaacagcta
tgaccatgat tacgccaagc gcgcaattaa ccctcactaa agggaacaaa
2820agctggagct gcaagcttaa tgtagtctta tgcaatactc ttgtagtctt
gcaacatggt 2880aacgatgagt tagcaacatg ccttacaagg agagaaaaag
caccgtgcat gccgattggt 2940ggaagtaagg tggtacgatc gtgccttatt
aggaaggcaa cagacgggtc tgacatggat 3000tggacgaacc actgaattgc
cgcattgcag agatattgta tttaagtgcc tagctcgata 3060cataaacggg
tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg
3120gaacccactg cttaagcctc aataaagctt gccttgagtg cttcaagtag
tgtgtgcccg 3180tctgttgtgt gactctggta actagagatc cctcagaccc
ttttagtcag tgtggaaaat 3240ctctagcagt ggcgcccgaa cagggacttg
aaagcgaaag ggaaaccaga ggagctctct 3300cgacgcagga ctcggcttgc
tgaagcgcgc acggcaagag gcgaggggcg gcgactggtg 3360agtacgccaa
aaattttgac tagcggaggc tagaaggaga gagatgggtg cgagagcgtc
3420agtattaagc gggggagaat tagatcgcga tgggaaaaaa ttcggttaag
gccaggggga 3480aagaaaaaat ataaattaaa acatatagta tgggcaagca
gggagctaga acgattcgca 3540gttaatcctg gcctgttaga aacatcagaa
ggctgtagac aaatactggg acagctacaa 3600ccatcccttc agacaggatc
agaagaactt agatcattat ataatacagt agcaaccctc 3660tattgtgtgc
atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag
3720gaagagcaaa acaaaagtaa gaccaccgca cagcaagcgg ccgctgatct
tcagacctgg 3780aggaggagat atgagggaca attggagaag tgaattatat
aaatataaag tagtaaaaat 3840tgaaccatta ggagtagcac ccaccaaggc
aaagagaaga gtggtgcaga gagaaaaaag 3900agcagtggga ataggagctt
tgttccttgg gttcttggga gcagcaggaa gcactatggg 3960cgcagcgtca
atgacgctga cggtacaggc cagacaatta ttgtctggta tagtgcagca
4020gcagaacaat ttgctgaggg ctattgaggc gcaacagcat ctgttgcaac
tcacagtctg 4080gggcatcaag cagctccagg caagaatcct ggctgtggaa
agatacctaa aggatcaaca 4140gctcctgggg atttggggtt gctctggaaa
actcatttgc accactgctg tgccttggaa 4200tgctagttgg agtaataaat
ctctggaaca gatttggaat cacacgacct ggatggagtg 4260ggacagagaa
attaacaatt acacaagctt aatacactcc ttaattgaag aatcgcaaaa
4320ccagcaagaa aagaatgaac aagaattatt ggaattagat aaatgggcaa
gtttgtggaa 4380ttggtttaac ataacaaatt ggctgtggta tataaaatta
ttcataatga tagtaggagg 4440cttggtaggt ttaagaatag tttttgctgt
actttctata gtgaatagag ttaggcaggg 4500atattcacca ttatcgtttc
agacccacct cccaaccccg aggggacccg acaggcccga 4560aggaatagaa
gaagaaggtg gagagagaga cagagacaga tccattcgat tagtgaacgg
4620atctcgacgg tatcgattag actgtagccc aggaatatgg cagctagatt
gtacacattt 4680agaaggaaaa gttatcttgg tagcagttca tgtagccagt
ggatatatag aagcagaagt 4740aattccagca gagacagggc aagaaacagc
atacttcctc ttaaaattag caggaagatg 4800gccagtaaaa acagtacata
cagacaatgg cagcaatttc accagtacta cagttaaggc 4860cgcctgttgg
tgggcgggga tcaagcagga atttggcatt ccctacaatc cccaaagtca
4920aggagtaata gaatctatga ataaagaatt aaagaaaatt ataggacagg
taagagatca 4980ggctgaacat cttaagacag cagtacaaat ggcagtattc
atccacaatt ttaaaagaaa 5040aggggggatt ggggggtaca gtgcagggga
aagaatagta gacataatag caacagacat 5100acaaactaaa gaattacaaa
aacaaattac aaaaattcaa aattttcggg tttattacag 5160ggacagcaga
gatccagttt ggctgcattg atcacgtgag gctccggtgc ccgtcagtgg
5220gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg
caattgaacc 5280ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg
atgtcgtgta ctggctccgc 5340ctttttcccg agggtggggg agaaccgtat
ataagtgcag tagtcgccgt gaacgttctt 5400tttcgcaacg ggtttgccgc
cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 5460ggcctcttta
cgggttatgg cccttgcgtg ccttgaatta cttccacctg gctgcagtac
5520gtgattcttg atcccgagct tcgggttgga agtgggtggg agagttcgag
gccttgcgct 5580taaggagccc cttcgcctcg tgcttgagtt gaggcctggc
ctgggcgctg gggccgccgc 5640gtgcgaatct ggtggcacct tcgcgcctgt
ctcgctgctt tcgataagtc tctagccatt 5700taaaattttt gatgacctgc
tgcgacgctt tttttctggc aagatagtct tgtaaatgcg 5760ggccaagatc
tgcacactgg tatttcggtt tttggggccg cgggcggcga cggggcccgt
5820gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag cgcggccacc
gagaatcgga 5880cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg
gcctcgcgcc gccgtgtatc 5940gccccgccct gggcggcaag gctggcccgg
tcggcaccag ttgcgtgagc ggaaagatgg 6000ccgcttcccg gccctgctgc
agggagctca aaatggagga cgcggcgctc gggagagcgg 6060gcgggtgagt
cacccacaca aaggaaaagg gcctttccgt cctcagccgt cgcttcatgt
6120gactccactg agtaccgggc gccgtccagg cacctcgatt agttctcgag
cttttggagt 6180acgtcgtctt taggttgggg ggaggggttt tatgcgatgg
agtttcccca cactgagtgg 6240gtggagactg aagttaggcc agcttggcac
ttgatgtaat tctccttgga atttgccctt 6300tttgagtttg gatcttggtt
cattctcaag cctcagacag tggttcaaag tttttttctt 6360ccatttcagg
tgtcgtgatc tagaggatcc atggccttac cagtgaccgc cttgctcctg
6420ccgctggcct tgctgctcca cgccgccagg ccggacatcc agatgacaca
gactacatcc 6480tccctgtctg cctctctggg agacagagtc accatcagtt
gcagggcaag tcaggacatt 6540agtaaatatt taaattggta tcagcagaaa
ccagatggaa ctgttaaact cctgatctac 6600catacatcaa gattacactc
aggagtccca tcaaggttca gtggcagtgg gtctggaaca 6660gattattctc
tcaccattag caacctggag caagaagata ttgccactta cttttgccaa
6720cagggtaata cgcttccgta cacgttcgga ggggggacca agctggagat
cacaggtggc 6780ggtggctcgg gcggtggtgg gtcgggtggc ggcggatctg
aggtgaaact gcaggagtca 6840ggacctggcc tggtggcgcc ctcacagagc
ctgtccgtca catgcactgt ctcaggggtc 6900tcattacccg actatggtgt
aagctggatt cgccagcctc cacgaaaggg tctggagtgg 6960ctgggagtaa
tatggggtag tgaaaccaca tactataatt cagctctcaa atccagactg
7020accatcatca aggacaactc caagagccaa gttttcttaa aaatgaacag
tctgcaaact 7080gatgacacag ccatttacta ctgtgccaaa cattattact
acggtggtag ctatgctatg 7140gactactggg gccaaggaac ctcagtcacc
gtctcctcaa ccacgacgcc agcgccgcga 7200ccaccaacac cggcgcccac
catcgcgtcg cagcccctgt ccctgcgccc agaggcgtgc 7260cggccagcgg
cggggggcgc agtgcacacg agggggctgg acttcgcctg tgatatctac
7320atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt
tatcaccctt 7380tactgcaaac ggggcagaaa gaaactcctg tatatattca
aacaaccatt tatgagacca 7440gtacaaacta ctcaagagga agatggctgt
agctgccgat ttccagaaga agaagaagga 7500ggatgtgaac tgagagtgaa
gttcagcagg agcgcagacg cccccgcgta caagcagggc 7560cagaaccagc
tctataacga gctcaatcta ggacgaagag aggagtacga tgttttggac
7620aagagacgtg gccgggaccc tgagatgggg ggaaagccga gaaggaagaa
ccctcaggaa 7680ggcctgtaca atgaactgca gaaagataag atggcggagg
cctacagtga gattgggatg 7740aaaggcgagc gccggagggg caaggggcac
gatggccttt accagggtct cagtacagcc 7800accaaggaca cctacgacgc
ccttcacatg caggccctgc cccctcgcta agtcgacaat 7860caacctctgg
attacaaaat ttgtgaaaga ttgactggta ttcttaacta tgttgctcct
7920tttacgctat gtggatacgc tgctttaatg cctttgtatc atgctattgc
ttcccgtatg 7980gctttcattt tctcctcctt gtataaatcc tggttgctgt
ctctttatga ggagttgtgg 8040cccgttgtca ggcaacgtgg cgtggtgtgc
actgtgtttg ctgacgcaac ccccactggt 8100tggggcattg ccaccacctg
tcagctcctt tccgggactt tcgctttccc cctccctatt 8160gccacggcgg
aactcatcgc cgcctgcctt gcccgctgct ggacaggggc tcggctgttg
8220ggcactgaca attccgtggt gttgtcgggg aagctgacgt cctttccatg
gctgctcgcc 8280tgtgttgcca cctggattct gcgcgggacg tccttctgct
acgtcccttc ggccctcaat 8340ccagcggacc ttccttcccg cggcctgctg
ccggctctgc ggcctcttcc gcgtcttcgc 8400cttcgccctc agacgagtcg
gatctccctt tgggccgcct ccccgcctgg aattcgagct 8460cggtaccttt
aagaccaatg acttacaagg cagctgtaga tcttagccac tttttaaaag
8520aaaagggggg actggaaggg ctaattcact cccaacgaag acaagatctg
ctttttgctt 8580gtactgggtc tctctggtta gaccagatct gagcctggga
gctctctggc taactaggga 8640acccactgct taagcctcaa taaagcttgc
cttgagtgct tcaagtagtg tgtgcccgtc 8700tgttgtgtga ctctggtaac
tagagatccc tcagaccctt ttagtcagtg tggaaaatct 8760ctagcagtag
tagttcatgt catcttatta ttcagtattt ataacttgca aagaaatgaa
8820tatcagagag tgagaggaac ttgtttattg cagcttataa tggttacaaa
taaagcaata 8880gcatcacaaa tttcacaaat aaagcatttt tttcactgca
ttctagttgt ggtttgtcca 8940aactcatcaa tgtatcttat catgtctggc
tctagctatc ccgcccctaa ctccgcccat 9000cccgccccta actccgccca
gttccgccca ttctccgccc catggctgac taattttttt 9060tatttatgca
gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg
9120cttttttgga ggcctaggga cgtacccaat tcgccctata gtgagtcgta ttac
91742228DNAArtificial SequenceChemically Synthesized 2atgtagtctt
atgcaatact cttgtagtct tgcaacatgg taacgatgag ttagcaacat 60gccttacaag
gagagaaaaa gcaccgtgca tgccgattgg tggaagtaag gtggtacgat
120cgtgccttat taggaaggca acagacgggt ctgacatgga ttggacgaac
cactgaattg 180ccgcattgca gagatattgt atttaagtgc ctagctcgat acataaac
228398DNAArtificial SequenceChemically Synthesized 3gggtctctct
ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60ctgcttaagc
ctcaataaag cttgccttga gtgcttca 98485DNAArtificial
SequenceChemically Synthesized 4agtagtgtgt gcccgtctgt tgtgtgactc
tggtaactag agatccctca gaccctttta 60gtcagtgtgg aaaatctcta gcagt
8551377DNAArtificial SequenceChemically Synthesized 5cgaacaggga
cttgaaagcg aaagggaaac cagaggagct ctctcgacgc aggactcggc 60ttgctgaagc
gcgcacggca agaggcgagg ggcggcgact ggtgagtacg ccaaaaattt
120tgactagcgg aggctagaag gagagagatg ggtgcgagag cgtcagtatt
aagcggggga 180gaattagatc gcgatgggaa aaaattcggt taaggccagg
gggaaagaaa aaatataaat 240taaaacatat agtatgggca agcagggagc
tagaacgatt cgcagttaat cctggcctgt 300tagaaacatc agaaggctgt
agacaaatac tgggacagct acaaccatcc cttcagacag 360gatcagaaga
acttagatca ttatataata cagtagcaac cctctattgt gtgcatcaaa
420ggatagagat aaaagacacc aaggaagctt tagacaagat agaggaagag
caaaacaaaa 480gtaagaccac cgcacagcaa gcggccgctg atcttcagac
ctggaggagg agatatgagg 540gacaattgga gaagtgaatt atataaatat
aaagtagtaa aaattgaacc attaggagta 600gcacccacca aggcaaagag
aagagtggtg cagagagaaa aaagagcagt gggaatagga 660gctttgttcc
ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg
720ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa
caatttgctg 780agggctattg aggcgcaaca gcatctgttg caactcacag
tctggggcat caagcagctc 840caggcaagaa tcctggctgt ggaaagatac
ctaaaggatc aacagctcct ggggatttgg 900ggttgctctg gaaaactcat
ttgcaccact gctgtgcctt ggaatgctag ttggagtaat 960aaatctctgg
aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac
1020aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca
agaaaagaat 1080gaacaagaat tattggaatt agataaatgg gcaagtttgt
ggaattggtt taacataaca 1140aattggctgt ggtatataaa attattcata
atgatagtag gaggcttggt aggtttaaga 1200atagtttttg ctgtactttc
tatagtgaat agagttaggc agggatattc accattatcg 1260tttcagaccc
acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa
1320ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtat
13776547DNAArtificial SequenceChemically Synthesized 6tagactgtag
cccaggaata tggcagctag attgtacaca tttagaagga aaagttatct 60tggtagcagt
tcatgtagcc agtggatata tagaagcaga agtaattcca gcagagacag
120ggcaagaaac agcatacttc ctcttaaaat tagcaggaag atggccagta
aaaacagtac 180atacagacaa tggcagcaat ttcaccagta ctacagttaa
ggccgcctgt tggtgggcgg 240ggatcaagca ggaatttggc attccctaca
atccccaaag tcaaggagta atagaatcta 300tgaataaaga attaaagaaa
attataggac aggtaagaga tcaggctgaa catcttaaga 360cagcagtaca
aatggcagta ttcatccaca attttaaaag aaaagggggg attggggggt
420acagtgcagg ggaaagaata gtagacataa tagcaacaga catacaaact
aaagaattac 480aaaaacaaat tacaaaaatt caaaattttc gggtttatta
cagggacagc agagatccag 540tttggct 54771178DNAArtificial
SequenceChemically Synthesized 7gctccggtgc ccgtcagtgg gcagagcgca
catcgcccac agtccccgag aagttggggg 60gaggggtcgg caattgaacc ggtgcctaga
gaaggtggcg cggggtaaac tgggaaagtg 120atgtcgtgta ctggctccgc
ctttttcccg agggtggggg agaaccgtat ataagtgcag 180tagtcgccgt
gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg
240tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg
ccttgaatta 300cttccacctg gctgcagtac gtgattcttg atcccgagct
tcgggttgga agtgggtggg 360agagttcgag gccttgcgct taaggagccc
cttcgcctcg tgcttgagtt gaggcctggc 420ctgggcgctg gggccgccgc
gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480tcgataagtc
tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc
540aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt
tttggggccg 600cgggcggcga cggggcccgt gcgtcccagc gcacatgttc
ggcgaggcgg ggcctgcgag 660cgcggccacc gagaatcgga cgggggtagt
ctcaagctgg ccggcctgct ctggtgcctg 720gcctcgcgcc gccgtgtatc
gccccgccct gggcggcaag gctggcccgg tcggcaccag 780ttgcgtgagc
ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga
840cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg
gcctttccgt 900cctcagccgt cgcttcatgt gactccactg agtaccgggc
gccgtccagg cacctcgatt 960agttctcgag cttttggagt acgtcgtctt
taggttgggg ggaggggttt tatgcgatgg 1020agtttcccca cactgagtgg
gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080tctccttgga
atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag
1140tggttcaaag tttttttctt ccatttcagg tgtcgtga
117881459DNAArtificial SequenceChemically Synthesized 8atggccttac
cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60ccggacatcc
agatgacaca gactacatcc tccctgtctg cctctctggg agacagagtc
120accatcagtt gcagggcaag tcaggacatt agtaaatatt taaattggta
tcagcagaaa 180ccagatggaa ctgttaaact cctgatctac catacatcaa
gattacactc aggagtccca 240tcaaggttca gtggcagtgg gtctggaaca
gattattctc tcaccattag caacctggag 300caagaagata ttgccactta
cttttgccaa cagggtaata cgcttccgta cacgttcgga 360ggggggacca
agctggagat cacaggtggc ggtggctcgg gcggtggtgg gtcgggtggc
420ggcggatctg aggtgaaact gcaggagtca ggacctggcc tggtggcgcc
ctcacagagc 480ctgtccgtca catgcactgt ctcaggggtc tcattacccg
actatggtgt aagctggatt 540cgccagcctc cacgaaaggg tctggagtgg
ctgggagtaa tatggggtag tgaaaccaca 600tactataatt cagctctcaa
atccagactg accatcatca aggacaactc caagagccaa 660gttttcttaa
aaatgaacag tctgcaaact gatgacacag ccatttacta ctgtgccaaa
720cattattact acggtggtag ctatgctatg gactactggg gccaaggaac
ctcagtcacc 780gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac
cggcgcccac catcgcgtcg 840cagcccctgt ccctgcgccc agaggcgtgc
cggccagcgg cggggggcgc agtgcacacg 900agggggctgg acttcgcctg
tgatatctac atctgggcgc ccttggccgg gacttgtggg 960gtccttctcc
tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg
1020tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga
agatggctgt 1080agctgccgat ttccagaaga agaagaagga ggatgtgaac
tgagagtgaa gttcagcagg 1140agcgcagacg cccccgcgta caagcagggc
cagaaccagc tctataacga gctcaatcta 1200ggacgaagag aggagtacga
tgttttggac aagagacgtg gccgggaccc tgagatgggg 1260ggaaagccga
gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag
1320atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg
caaggggcac 1380gatggccttt accagggtct cagtacagcc accaaggaca
cctacgacgc ccttcacatg 1440caggccctgc cccctcgct
14599591DNAArtificial SequenceChemically Synthesized 9atcaacctct
ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc 60cttttacgct
atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta
120tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat
gaggagttgt 180ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt
tgctgacgca
acccccactg 240gttggggcat tgccaccacc tgtcagctcc tttccgggac
tttcgctttc cccctcccta 300ttgccacggc ggaactcatc gccgcctgcc
ttgcccgctg ctggacaggg gctcggctgt 360tgggcactga caattccgtg
gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg 420cctgtgttgc
cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca
480atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt
ccgcgtcttc 540gccttcgccc tcagacgagt cggatctccc tttgggccgc
ctccccgcct g 5911098DNAArtificial SequenceChemically Synthezied
10gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca
60ctgcttaagc ctcaataaag cttgccttga gtgcttca 981184DNAArtificial
SequenceChemically Synthesized 11agtagtgtgt gcccgtctgt tgtgtgactc
tggtaactag agatccctca gaccctttta 60gtcagtgtgg aaaatctcta gcag
8412486PRTArtificial SequenceChemically Synthesized 12Met Ala Leu
Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His
Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu 20 25
30 Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln
35 40 45 Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp
Gly Thr 50 55 60 Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro 65 70 75 80 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Tyr Ser Leu Thr Ile 85 90 95 Ser Asn Leu Glu Gln Glu Asp Ile
Ala Thr Tyr Phe Cys Gln Gln Gly 100 105 110 Asn Thr Leu Pro Tyr Thr
Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr 115 120 125 Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu 130 135 140 Val Lys
Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser 145 150 155
160 Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly
165 170 175 Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp
Leu Gly 180 185 190 Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser
Ala Leu Lys Ser 195 200 205 Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys
Ser Gln Val Phe Leu Lys 210 215 220 Met Asn Ser Leu Gln Thr Asp Asp
Thr Ala Ile Tyr Tyr Cys Ala Lys 225 230 235 240 His Tyr Tyr Tyr Gly
Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly 245 250 255 Thr Ser Val
Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro 260 265 270 Thr
Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu 275 280
285 Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp
290 295 300 Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr
Cys Gly 305 310 315 320 Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr
Cys Lys Arg Gly Arg 325 330 335 Lys Lys Leu Leu Tyr Ile Phe Lys Gln
Pro Phe Met Arg Pro Val Gln 340 345 350 Thr Thr Gln Glu Glu Asp Gly
Cys Ser Cys Arg Phe Pro Glu Glu Glu 355 360 365 Glu Gly Gly Cys Glu
Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala 370 375 380 Pro Ala Tyr
Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu 385 390 395 400
Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp 405
410 415 Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly
Leu 420 425 430 Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr
Ser Glu Ile 435 440 445 Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly
His Asp Gly Leu Tyr 450 455 460 Gln Gly Leu Ser Thr Ala Thr Lys Asp
Thr Tyr Asp Ala Leu His Met 465 470 475 480 Gln Ala Leu Pro Pro Arg
485 1363DNAArtificial SequenceChemically Synthesized 13atggccttac
cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60ccg
6314726DNAArtificial SequenceChemically Synthesized 14gacatccaga
tgacacagac tacatcctcc ctgtctgcct ctctgggaga cagagtcacc 60atcagttgca
gggcaagtca ggacattagt aaatatttaa attggtatca gcagaaacca
120gatggaactg ttaaactcct gatctaccat acatcaagat tacactcagg
agtcccatca 180aggttcagtg gcagtgggtc tggaacagat tattctctca
ccattagcaa cctggagcaa 240gaagatattg ccacttactt ttgccaacag
ggtaatacgc ttccgtacac gttcggaggg 300gggaccaagc tggagatcac
aggtggcggt ggctcgggcg gtggtgggtc gggtggcggc 360ggatctgagg
tgaaactgca ggagtcagga cctggcctgg tggcgccctc acagagcctg
420tccgtcacat gcactgtctc aggggtctca ttacccgact atggtgtaag
ctggattcgc 480cagcctccac gaaagggtct ggagtggctg ggagtaatat
ggggtagtga aaccacatac 540tataattcag ctctcaaatc cagactgacc
atcatcaagg acaactccaa gagccaagtt 600ttcttaaaaa tgaacagtct
gcaaactgat gacacagcca tttactactg tgccaaacat 660tattactacg
gtggtagcta tgctatggac tactggggcc aaggaacctc agtcaccgtc 720tcctca
72615135DNAArtificial SequenceChemically Synthesized 15accacgacgc
cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60tccctgcgcc
cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg
120gacttcgcct gtgat 1351672DNAArtificial SequenceChemically
Synthesized 16atctacatct gggcgccctt ggccgggact tgtggggtcc
ttctcctgtc actggttatc 60accctttact gc 7217126DNAArtificial
SequenceChemically Synthesized 17aaacggggca gaaagaaact cctgtatata
ttcaaacaac catttatgag accagtacaa 60actactcaag aggaagatgg ctgtagctgc
cgatttccag aagaagaaga aggaggatgt 120gaactg 12618336DNAArtificial
SequenceChemically Synthesized 18agagtgaagt tcagcaggag cgcagacgcc
cccgcgtaca agcagggcca gaaccagctc 60tataacgagc tcaatctagg acgaagagag
gagtacgatg ttttggacaa gagacgtggc 120cgggaccctg agatgggggg
aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180gaactgcaga
aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc
240cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac
caaggacacc 300tacgacgccc ttcacatgca ggccctgccc cctcgc
3361921PRTArtificial SequenceChemically Synthesized 19Met Ala Leu
Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His
Ala Ala Arg Pro 20 20242PRTArtificial SequenceChemically
Synthesized 20Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala
Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln
Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp
Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile
Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Gly Gly Gly Ser 100 105
110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Lys Leu Gln Glu
115 120 125 Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val
Thr Cys 130 135 140 Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val
Ser Trp Ile Arg 145 150 155 160 Gln Pro Pro Arg Lys Gly Leu Glu Trp
Leu Gly Val Ile Trp Gly Ser 165 170 175 Glu Thr Thr Tyr Tyr Asn Ser
Ala Leu Lys Ser Arg Leu Thr Ile Ile 180 185 190 Lys Asp Asn Ser Lys
Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln 195 200 205 Thr Asp Asp
Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly 210 215 220 Gly
Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val 225 230
235 240 Ser Ser 2147PRTArtificial SequenceChemically Synthesized
21Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1
5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala
Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp
Ile Tyr 35 40 45 2222PRTArtificial SequenceChemically Synthesized
22Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu 1
5 10 15 Val Ile Thr Leu Tyr Cys 20 2342PRTArtificial
SequenceChemically Synthesized 23Lys Arg Gly Arg Lys Lys Leu Leu
Tyr Ile Phe Lys Gln Pro Phe Met 1 5 10 15 Arg Pro Val Gln Thr Thr
Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 Pro Glu Glu Glu
Glu Gly Gly Cys Glu Leu 35 40 24112PRTArtificial SequenceChemically
Synthesized 24Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr
Lys Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly
Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg
Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln
Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu
Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly
Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 85 90 95 Thr
Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105
110 2522DNAArtificial SequenceChemically Synthesized 25gaaagctgac
tgcccctatt tg 222622DNAArtificial SequenceChemically Synthesized
26gagaggaagt gctgggaaca at 222715DNAArtificial SequenceChemically
Synthesized 27ctccccagtc tcttt 15
* * * * *