U.S. patent application number 15/614185 was filed with the patent office on 2017-09-28 for nucleic acid sequencing by electrochemical detection.
The applicant listed for this patent is IBIS BIOSCIENCES, INC.. Invention is credited to Gordon Bruce Collier, Graham Davis, David J. Ecker, Mark Hayden, Jeffrey Huff, Dan Wang.
Application Number | 20170275687 15/614185 |
Document ID | / |
Family ID | 47668835 |
Filed Date | 2017-09-28 |
United States Patent
Application |
20170275687 |
Kind Code |
A1 |
Huff; Jeffrey ; et
al. |
September 28, 2017 |
NUCLEIC ACID SEQUENCING BY ELECTROCHEMICAL DETECTION
Abstract
Provided herein is technology relating to sequencing nucleic
acids and particularly, but not exclusively, to devices, methods,
and systems for sequencing-by-synthesis using changes in pH to
monitor base addition.
Inventors: |
Huff; Jeffrey;
(Lincolnshire, IL) ; Davis; Graham; (Princeton,
NJ) ; Hayden; Mark; (Ingleside, IL) ; Ecker;
David J.; (Encinitas, CA) ; Wang; Dan;
(Ottawa, CA) ; Collier; Gordon Bruce; (Fitzroy
Harbour, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
IBIS BIOSCIENCES, INC. |
Carlsbad |
CA |
US |
|
|
Family ID: |
47668835 |
Appl. No.: |
15/614185 |
Filed: |
June 5, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14237328 |
May 12, 2014 |
9670538 |
|
|
PCT/US2012/049585 |
Aug 3, 2012 |
|
|
|
15614185 |
|
|
|
|
61515673 |
Aug 5, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
Y02A 50/30 20180101;
G01N 27/44756 20130101; G01N 27/3275 20130101; G01N 27/333
20130101; C12Q 1/6869 20130101; Y02A 50/59 20180101; G01N 27/447
20130101; Y02A 50/60 20180101; C12Q 1/6869 20130101; C12Q 2565/607
20130101; C12Q 1/6869 20130101; C12Q 2563/113 20130101; C12Q
2563/116 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 27/333 20060101 G01N027/333; G01N 27/327 20060101
G01N027/327 |
Claims
1. A device for determining the sequence of a nucleic acid, the
device comprising a reaction vessel comprising a hydrogen
ion-sensitive electrode in contact with a sample comprising the
nucleic acid, wherein the hydrogen ion-sensitive electrode is
either: a) a microfabricated metal oxide electrode comprising: i)
an insulating material sensitive to hydrogen ions; and ii) a
conductive metal oxide; wherein the microfabricated metal oxide
electrode does not exhibit the bulk conductive properties of the
conductive metal oxide; or b) a membrane electrode comprising: i) a
photolithographic base layer; and ii) a hydrogen ion-sensitive
membrane; wherein the nucleic acid coats the surface of one or more
microparticles in an electrode well compartment.
2. The device of claim 1 further comprising a reference
electrode.
3. The device of claim 1 wherein the reaction vessel is a cylinder
having a diameter of approximately 200 .mu.m or less and a height
of approximately 30 .mu.m or less.
4. The device of claim 1 wherein the hydrogen ion-sensitive
electrode detects changes in pH greater than or equal to 0.1.
5. The device of claim 1 comprising a plurality of hydrogen
ion-sensitive electrodes.
6. The device of claim 1 comprising a plurality of nucleic acids
covering the one or more particles in an electrode well compartment
at a density equal to or greater than 2.2.times.10.sup.10
molecules/cm.sup.2.
7. The device of claim 1 wherein the insulating material has a
density of hydrogen ion binding sites that is greater than
10.sup.13/cm.sup.2.
8. The device of claim 1 wherein the insulating material is
selected from the group consisting of tantalum oxide, zirconium
oxide, and aluminum oxide.
9. The device of claim 1 wherein the conductive metal oxide is
selected from the group consisting of iridium oxide, ruthenium
oxide, platinum oxide, palladium oxide, rhodium oxide, and osmium
oxide.
10. The device of claim 1 comprising a clonal plurality of nucleic
acids.
11. The device of claim 1 wherein the hydrogen ion sensitive
membrane comprises: a) a solvent mixture comprising cyclohexanone
and propiophenone; b) sodium tetraphenylborate c) tridodecyl amine;
d) dibutyl sebacate or o-nitrophenyloctylether; and e)
high-molecular weight polyvinylchloride.
12. A method for determining the sequence of a nucleic acid, the
method comprising: a) providing a reaction solution comprising: 1)
the nucleic acid; 2) a polymerase; and 3) an oligonucleotide
complementary to the nucleic acid; b) adding a deoxynucleotide to
the reaction solution; and c) monitoring the pH of the reaction
solution using a device according to claim 1, wherein a change in
the pH of the reaction solution indicates that the deoxynucleotide
was polymerized to the 3' end of the oligonucleotide.
13. The method of claim 12 further comprising: d) removing the
deoxynucleotide from the reaction solution or inactivating the
deoxynucleotide.
14. A system for sequencing a nucleic acid comprising: i) a device
according to claim 1 comprising a cartridge and ii) a hand-held
reading apparatus.
15. The system of claim 14 wherein the cartridge comprises: 1) a
hydrogen ion-sensitive electrode; and 2) a first interface
component configured to mate with the reading apparatus and
communicate with the reading apparatus; and wherein the reading
apparatus comprises: 1) a second interface component configured to
mate with the cartridge and communicate with the cartridge; and 2)
a microprocessor configured to receive data from the cartridge.
16. The system of claim 15 wherein the data is raw data or
transformed data.
17. The system of claim 14 further comprising a user interface.
18. The system of claim 15 wherein the data indicates the presence
of a medical condition in a subject.
19. The system of claim 15 wherein the data indicates the absence
of a medical condition in a subject.
20. A device for determining the sequence of a nucleic acid, the
device comprising a reaction vessel comprising a hydrogen
ion-sensitive electrode in contact with a sample comprising the
nucleic acid, wherein the hydrogen ion-sensitive electrode is
either: a) a microfabricated metal oxide electrode comprising: i)
an insulating material sensitive to hydrogen ions; and ii) a
conductive metal oxide; wherein the microfabricated metal oxide
electrode does not exhibit the bulk conductive properties of the
conductive metal oxide; or b) a membrane electrode comprising: i) a
photolithographic base layer; and ii) a hydrogen ion-sensitive
membrane; wherein the nucleic acid comprises a plurality of nucleic
acids covering one or more microparticles in an electrode well
compartment.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is a continuation of U.S.
application Ser. No. 14/237,328 filed May 12, 2014, which is a
national phase application under 35 U.S.C. .sctn.371 of PCT
International Application No. PCT/US2012/049585, filed on Aug. 3,
2012, which claims priority to U.S. Provisional Application Ser.
No. 61/515,673 filed Aug. 5, 2011, the entirety of which is herein
incorporated by reference.
FIELD OF INVENTION
[0002] Provided herein is technology relating to sequencing nucleic
acids and particularly, but not exclusively, to devices, methods,
and systems for sequencing-by-synthesis using changes in pH to
monitor base addition.
BACKGROUND
[0003] DNA sequencing is an essential tool in molecular genetic
analysis. The ability to determine DNA nucleotide sequences has
become increasingly important as an integral component of many
medical diagnostics. Historically, the two most commonly used
methods for DNA sequencing were the enzymatic chain-termination
method of Sanger and the chemical cleavage technique of Maxam and
Gilbert. Both methods rely on gel electrophoresis to resolve,
according to their size, DNA fragments produced from a larger DNA
segment. Since the electrophoresis step as well as the subsequent
detection of the separated DNA-fragments were cumbersome
procedures, many efforts had been made to develop more efficient
sequencing methods, for example, by developing novel technologies
that do not use electrophoresis. Research efforts have produced
several such techniques including, e.g., sequencing using scanning
tunnel electron microscopy (see, e.g., Driscoll et al., Nature 346:
294-96 (1990)), sequencing by hybridization (see e.g., Bains et
al., J. Theo. Biol. 135: 308-07 (1988)), and single molecule
detection (Jeff et al., Biomol. Struct. Dynamics 7: 301-06 (1989)),
to overcome the disadvantages of gel electrophoresis.
[0004] In addition, some efforts focused on methods of sequencing
based on the concept of detecting the inorganic pyrophosphate
(PP.sub.i) that is released during a DNA polymerase reaction (e.g.,
as described in WO 93/23564 and WO 89/09283; see Seo et al.
"Four-color DNA sequencing by synthesis on a chip using
photocleavable fluorescent nucleotides," PNAS 102: 5926-59 (2005);
Hyman, "New method of sequencing DNA" Anal. Biochem. 174: 423-36
(1988)). In these "sequencing by synthesis" methods, as each
nucleotide is added to a growing nucleic acid strand during a
polymerase reaction, the released pyrophosphate molecule is
detected. It has been found that pyrophosphate released under these
conditions can be detected enzymatically, e.g., in some
applications by the generation of light in the luciferase-luciferin
reaction. Such methods allow a user to sequence DNA simply and
rapidly whilst avoiding the need for electrophoresis and the use of
harmful radiolabels. In addition, these methods have found use in
identifying single target bases, e.g., in the mapping of single
nucleotide polymorphisms.
[0005] One of the first sequencing by synthesis methods was
"Pyrosequencing.TM.", which was developed at the Royal Institute of
Technology in Stockholm (see Nyren, "Method for sequencing DNA
based on the detection of the release of pyrophosphate and
enzymatic nucleotide degradation", U.S. Pat. No. 6,258,568 (2001);
WO 98/28440; Ronaghi, et al. Science 281: 363 (1998); Alderbom et
al., (2000), each incorporated herein by reference in their
entireties for all purposes). The method, in contrast to
conventional Sanger sequencing, adds nucleotides one by one during
the sequencing reaction. In some implementations the principle is
as follows: A single stranded DNA fragment (attached to a solid
support), carrying an annealed sequencing primer acts as a template
for the reaction. In the first two dispensations, substrate and
enzyme mixes are added to the template. The enzyme mix consists of
four different enzymes; DNA polymerase, ATP-sulfurylase, luciferase
and apyrase. The nucleotides are sequentially added one by one
according to a specified order dependent on the template and
determined by the user. If the added nucleotide matches the
template, the DNA polymerase incorporates it into the growing DNA
strand and PP.sub.1 is released. The ATP-sulfurylase converts the
PP.sub.1 into ATP, and the third enzyme, luciferase, transforms the
ATP into a light signal. Following these reactions, the fourth
enzyme, apyrase, degrades the excess nucleotides and ATPs, and the
template is ready for the next reaction cycle, i.e. another
nucleotide addition. Since no PP.sub.1 is released unless a
nucleotide is incorporated, a light signal is produced only when
the correct nucleotide is incorporated.
[0006] In a related method, the incorporation of a nucleotide
during sequencing-by-synthesis is detected by a change in the heat
or pH of the reaction solution (see, e.g., U.S. Pat. No.
7,932,034). In one implementation of these methods, a template
strand having an attached primer is immobilized in a small volume
reaction mixture, with the reaction mixture in contact with a
sensitive calorimeter, which detects the heat of reaction from
incorporation of a complementary base (dNTP) in the presence of
appropriate reagents (DNA polymerase, and polymerase reaction
buffer). Alternatively, a pH meter may be used to measure changes
in pH resulting from the reaction. The bead will have template DNA
attached to it, where the sequence of the template DNA molecule is
the same in each of numerous strands attached to the bead, e.g.,
through biotin. In a known protocol, for example, 5 pg of
immobilized template DNA is used. The template DNA is prepared with
a known segment for attachment of a primer. In some applications,
calorimetric detection is the preferred detection scheme because it
allows for more sensitive detection than pH-based schemes.
[0007] In pH-based methods, pH monitoring is often performed by use
of a microcantilever or a field-effect transistor (FET) sensitive
to hydrogen ion concentration. In the microcantilever devices, a pH
sensor with ultrahigh sensitivity was developed based on a
microcantilever structure with a lithographically defined
crosslinked copolymeric hydrogel. Silicon-on-insulator wafers were
used to fabricate cantilevers on which a polymer consisting of poly
(methacrylic acid) (PMAA) with polyethylene glycoldimethacrylate
was patterned using free-radical UV polymerization. As the pH
around the cantilever was increased above the pK.sub.a of PMAA, the
polymer network expanded and resulted in a reversible change in
surface stress causing the microcantilever to bend. These devices
have a sensitivity reported to be 5.times.10.sup.-4 pH.
[0008] In the FET devices, a chemical-sensitive FET, or more
particularly an ion-sensitive FET (ISFET), is used to facilitate
measurement of the hydrogen ion concentration of a solution. An
ISFET is an impedance transformation device that is fabricated
using conventional complementary metal oxide semiconductor (CMOS)
technology, operates in a manner similar to that of a metal oxide
semiconductor field effect transistor (MOSFET), and is particularly
configured to selectively measure ion activity in a solution (e.g.,
hydrogen ion). Examples of these devices are provided, e.g., in
U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589, 20100301398,
20100197507, 20100188073, and 20100137143.
[0009] Other commercially available pH meters can measure pH
changes as low as 0.001. These meters contain several inputs for
indicator (e.g., ion-sensitive, redox), reference electrodes, and
temperature sensors such as thermoresistors or a thermocouple. The
electronic pH meters typically use potentiometric methods, that is,
one measures a potential difference between known reference
electrode and the measuring pH electrode.
[0010] However, the sequencing methods mentioned above are not
without drawbacks. For example, many methods rely on relatively
sophisticated detection schemes that rely on, for example,
chemiluminescence or a FET to detect the release of pyrophosphate
or pyrophosphate analogues. Chemiluminescence is detected by photon
counting devices and is associated with light-tight detection
methods. Field effect transistors remain fairly sophisticated to
fabricate and are subject to "salt effects" (e.g., Debye effects)
that can inhibit the sensitivity of detection. Consequently, a need
remains for a pragmatic and reliable technology for monitoring base
polymerization during a sequencing by synthesis reaction.
SUMMARY
[0011] To meet this need, provided herein are methods and devices
for performing a sequencing by synthesis reaction based on
monitoring pH changes associated with DNA polymerization. The
technology provides the sequence of one strand of DNA by
synthesizing the complementary strand, one base pair at a time, and
detecting the base that is incorporated at each step. Solutions of
each nucleotide triphosphate--e.g., A, G, C, and T--are
sequentially added to the reaction. After adding a nucleotide and
checking for incorporation or non-incorporation of the nucleotide,
that nucleotide solution is washed away and the next nucleotide
solution is added. When the nucleotide in the solution complements
the template at the next position to be incorporated to the growing
strand, the nucleotide is incorporated and a proton is released
among the reaction products. This proton causes a transient change
in the pH of the reaction solution that can be detected.
Alternatively, when a non-complementary nucleotide is added, there
is no incorporation and the corresponding reaction products are not
produced and there is no change in the pH. Monitoring the sequence
of A, G, C, and T solutions that produce a proton (e.g., a change
in the pH) at each step allows one to determine the sequence of the
template.
[0012] Electrochemical sensors provide a reliable technology for a
variety of sensing applications including the measurement of pH.
Accordingly, provided herein is technology related to a device for
determining the sequence of a nucleic acid, the device comprising a
reaction vessel for containing a sample comprising the nucleic
acid; and an electrochemical hydrogen ion sensor associated with
the reaction vessel. In some embodiments the electrochemical
hydrogen ion sensor is a microfabricated mixed metal oxide
electrode and in some embodiments the electrochemical hydrogen ion
sensor is a membrane electrode. Moreover, in some embodiments the
device further comprises a reference electrode. Performing the
sequencing reaction involves moving solutions and other fluids
(e.g., samples, nucleotide solutions, wash solutions) into and out
of the reaction vessel. Thus, in some embodiments, the device
further comprises a tube or other transport mechanism or pathway
attached to the reaction vessel.
[0013] In some embodiments, the technology is related to electrodes
adapted to sense changes in hydrogen ion concentration. Electrodes
can take a variety of sizes and shapes. In embodiments of the
technology provided herein, the electrochemical hydrogen ion sensor
in an electrode having a diameter of approximately 200 .mu.m or
less. The electrochemical hydrogen ion sensor is associated with a
reaction vessel in which the sequencing reaction proceeds. As such,
in some embodiments, the reaction vessel is a cylinder having a
diameter of approximately 200 .mu.m or less and a height of
approximately 30 .mu.m or less. The electrochemical hydrogen ion
sensor can detect small changes in pH--in some embodiments, the
electrochemical hydrogen ion sensor detects changes in pH greater
than or equal to 0.1. Since most enzymatic reactions are performed
in buffered conditions for proper function of the enzymes, some
embodiments of the technology comprise a low ionic strength buffer
to perform pH measurements. High ionic strength buffers would have
the undesired effect of suppressing pH changes and compromise the
usefulness of the technology. Also, some embodiments provide a
device comprising a plurality of electrochemical hydrogen ion
sensors.
[0014] The nucleic acid is provided in many forms. For example, in
some embodiments the nucleic acid coats the surface of the
electrochemical hydrogen ion sensor and in some embodiments the
nucleic acid is attached to a microparticle bead. In some
embodiments the nucleic acid is a single-stranded nucleic acid. A
change in pH depends on the change in the concentration of hydrogen
ions released into solution. Accordingly, to provide a detectable
pH change, embodiments provide that the sample introduced into the
device for sequencing comprises a plurality of nucleic acids that
covers the electrochemical hydrogen ion sensor at a density equal
to or greater than 2.2.times.10.sup.10 molecules/cm.sup.2. In some
embodiments, the plurality of nucleic acids is a clonal plurality
of nucleic acids, for example, as produced by an amplification
reaction.
[0015] Further is provided technology that finds use in methods for
determining the sequence of a nucleic acid. For example, some
embodiments provide methods comprising providing a reaction
solution comprising the nucleic acid; a polymerase; and an
oligonucleotide complementary to the nucleic acid; adding a
deoxynucleotide to the reaction solution; and monitoring the pH of
the reaction solution, wherein a change in the pH of the reaction
solution indicates that the deoxynucleotide was polymerized to the
3' end of the oligonucleotide. One aspect of the technology is that
in some embodiments the change in the pH of the reaction solution
is greater than or equal to 0.1. Some embodiments provide a method
further comprising removing the deoxynucleotide from the reaction
solution or inactivating the deoxynucleotide.
[0016] In another aspect of the technology, methods are provided
for identifying a target base in a single-stranded nucleic acid,
the method comprising providing a reaction solution comprising the
single-stranded nucleic acid; a polymerase; and an oligonucleotide
that hybridizes to the single-stranded nucleic acid at a binding
site, wherein the 5' end base of the binding site is directly
adjacent to the target base; adding a deoxynucleotide to the
reaction solution; and monitoring the pH of the reaction solution
with an electrochemical hydrogen ion sensor, wherein a change in
the pH of the reaction solution indicates that the deoxynucleotide
was polymerized to the 3' end of the oligonucleotide. Detecting a
change in the pH of the reaction solution indicates that the
nucleotide presently added to the reaction solution has been added
to the growing strand, which is complementary to the nucleic acid
being sequenced. Thus, in some embodiments a change in the pH of
the reaction solution identifies the target base on the strand
being sequenced according to a rule selected from the set
consisting of: if the deoxynucleotide comprises adenine, the target
base is thymine; if the deoxynucleotide comprises guanine, the
target base is cytosine; if the deoxynucleotide comprises thymine,
the target base is adenine; and if the deoxynucleotide comprises
cytosine, the target base is guanine.
[0017] In some embodiments the change in the pH of the reaction
solution is greater than or equal to 0.1. The electrode used for
monitoring pH changes is, in some embodiments, a microfabricated
mixed metal oxide electrode and in some embodiments the electrode
used for monitoring pH changes is a membrane electrode. In some
embodiments, monitoring the pH of the reaction solution comprises
comparing a signal from the electrochemical hydrogen ion sensor to
a signal from a reference electrode. In some embodiments, the
single-stranded nucleic acid covers the electrochemical hydrogen
ion sensor at a density of greater than or equal to
2.2.times.10.sup.10 molecules/cm.sup.2. Some embodiments provide
that the reaction solution comprises a low ionic strength buffer.
Aspects of the technology are embodied in methods and devices.
Accordingly, embodiments of the methods provided herein comprise
use of the devices described above.
[0018] Additional embodiments will be apparent to persons skilled
in the relevant art based on the teachings contained herein.
DETAILED DESCRIPTION
[0019] The technology provides an electrochemical sensing
technology that finds use to measure the associated pH change upon
addition of a base in a sequencing by synthesis approach. Per the
chemistry of the reaction of base extension, a proton is produced
and this leads to a difference in pH that can be measured by an
electrochemical analyte sensor. Depending on the nucleotide base
made available to the reaction (that includes the polymerase enzyme
and appropriate target template), the deduction can be made (based
on whether or not a pH change occurs) as to what specific
complementary DNA nucleotide base had been added in the process of
the extension reaction. For example, if a sample contains a
sequence that has an A in it, and a signal is seen when a T is
added then it is apparent that an A was present at that particular
location. This process can then be applied to deduce in a step by
step manner the sequence of a particular segment of nucleic acid by
repetitively employing the process and deducing sequence based on
pH change as sensed by a pH sensor.
Definitions
[0020] To facilitate an understanding of the present technology, a
number of terms and phrases are defined below. Additional
definitions are set forth throughout the detailed description.
[0021] As used herein, "a" or "an" or "the" can mean one or more
than one. For example, "a" cell can mean one cell or a plurality of
cells.
[0022] As used herein, a "low ionic strength" buffer refers to a
solution that comprises a concentration of the buffer sufficient to
maintain the buffer at low ionic strength, preferably in a range
from about 1 mM to about 100 mM. Suitable buffers for preparation
of a low-ionic-strength buffer include, but are not limited to,
e.g., glycine, aspartic acid, glutamic acid, sodium succinate,
formate, acetate, citrate, phosphate, histidine, and imidazole.
[0023] As used herein, the phrase "dNTP" means
deoxynucleotidetriphosphate, where the nucleotide is any
nucleotide, such as A, T, C, G or U.
[0024] As used herein, the phrase "a clonal plurality of nucleic
acids" refers to the nucleic acid products that are complete or
partial copies of a template nucleic acid from which they were
generated. These products are substantially or completely or
essentially identical to each other, and they are complementary
copies of the template nucleic acid strand from which they are
synthesized, assuming that the rate of nucleotide misincorporation
during the synthesis of the clonal nucleic acid molecules is
0%.
[0025] As used herein, a "nucleic acid" shall mean any nucleic acid
molecule, including, without limitation, DNA, RNA and hybrids
thereof. The nucleic acid bases that form nucleic acid molecules
can be the bases A, C, G, T and U, as well as derivatives thereof.
Derivatives of these bases are well known in the art. The term
should be understood to include, as equivalents, analogs of either
DNA or RNA made from nucleotide analogs. The term as used herein
also encompasses cDNA, that is complementary, or copy, DNA produced
from an RNA template, for example by the action of reverse
transcriptase.
[0026] As used herein, a "membrane electrode" is an electrode
comprising, for example, a silicon substrate on which is
established thin-film structures that make up an electrochemical
(e.g., amperometric, potentiometric, conductimetric) transducer, or
base sensor. In some embodiments, the base sensor is fabricated on
a substantially planar silicon substrate by means of
photolithography in combination with the plasma deposition of
metallic substances. In some embodiments, succeeding structures are
overlaid such as (i) a semipermeable solid film or permselective
layer, superimposed over at least a portion of the base sensor,
whose function is to promote the adhesion of succeeding layers over
the base sensor and most importantly to prevent interfering
electroactive species from reaching the catalytic electroactive
surface of the base sensor; (ii) a biolayer, superimposed over at
least a portion of the permselective layer, in which is
incorporated a sufficient amount of a bioactive molecule; and (iii)
a layer responsible for attenuating the transport of the analyte
species from the sample to the biolayer, thus limiting the amount
of analyte which reaches the enzyme to a given fraction of the bulk
concentration of analyte in the sample. The base sensor may
comprise a unit cell containing two catalytic electrodes of
identical geometry and area. This configuration allows a
differential type of measurement because on only one of these
catalytic electrodes is established a biolayer. Such a differential
measurement may, in turn, enable the device to measure a current
due to the activity of selected bioactive molecules over and above
a background level, especially in circumstances where an
interfering species may not be readily excluded by a permselective
membrane. In a particular embodiment, a hydrogen ion-sensitive
membrane electrode comprises a base layer and a hydrogen
ion-sensitive layer produced, for example, as follows: first,
combine equal volumes of cyclohexanone and propiophenone. To 1.5 g
of this solvent mixture add, with stirring and gently warming,
sodium tetraphenylborate (5 mg), tridodecyl amine (75 mg), dibutyl
sebacate (620 mg), and 300 mg of high-molecular weight polyvinyl
chloride. Also, o-nitrophenyloctylether (620 mg) may be used in
place of the dibutyl sebacate. The resulting composition is mixed
thoroughly before use and loaded into a microsyringe for to
establish the hydrogen ion-sensitive layer in a controllable
manner. The microsyringe is preferably equipped with a 25 to 30
gauge needle (EFD Inc.) having an internal diameter of 150 .mu.m
and an external diameter of 300 .mu.m. Typically, the microsyringe
needle, which includes an elongated member and a needle tip, is
made of a metallic material, like stainless steel. Additionally,
materials such as synthetic polymers may also be employed in
manufacturing the main body of the needle itself. Depending on the
pretreatment of the electrode surface and the volume amount of
fluid applied, membrane layers of a thickness ranging from about 1
to about 200 .mu.m can be obtained consistently. These and other
embodiments of membrane electrodes are described in U.S. Pat. No.
5,200,051, incorporated herein in its entirety for all
purposes.
[0027] As used herein, a "microfabricated metal oxide electrode" is
an ion-sensitive electrode comprising, for example, a conductive
metal oxide combined with an insulating material in such a manner
that the fundamental bulk conductive properties of the conductive
oxide are modified to reduce the redox current that distorts the
Nernstian response and therefore the accuracy of the measurement.
More particularly, in some embodiments the electrode comprises a
Group VIIIB metal oxide and an insulating material having a density
of proton binding sites sufficient to provide the sensitivity
desired and matrixed in such a way so as to reduce the density of
states at the Fermi level of the conductive metal oxide. This
combination provides an ion selective electrode having a fast
Nernstian ion response and reduced redox interference while
maintaining a high level of conductivity at the conductor, long
term electro-chemical stability, reduced stabilization time
appropriate to equilibrate fresh electrodes, resistance to
corrosion and chemical attack, low impedance, and easy adaptation
for miniaturization and a variety of electrode configurations.
[0028] The electrode material of the present invention may be
prepared in a variety of ways known to those skilled in the art.
However, the electrodes should be prepared in a manner such that
the morphology of the mixture is closely controlled. More
particularly, the electrode material should be prepared so that the
particle size of the conductive metal oxide in the mixture is
reduced enough to minimize redox interference while providing
adequate conductivity to permit the electrode to function as a
Faradaic electrode. The reduction in particle size of the
conductive metal oxide is sufficient that the particles no longer
exhibit the bulk properties of the conductive metal oxide,
specifically the bulk conductivity. The bulk conductivity property
of the conductive metal oxide provides for the rapid electronic
exchange which promotes redox reactions. The bulk conductivity
property depends on the number of conductive electrons which, in
turn, relates to the density of states of the Fermi level. By
reducing the particle size, the density states at the Fermi level
are reduced and the conductive metal oxide does not exhibit the
bulk conductive properties of the material. In the alternative, the
electrode material may be prepared by alloying the conductive metal
oxide to the insulating material. The amount of redox interference
is reduced while maintaining sufficient conductivity to support an
electrode in a Faradaic configuration.
[0029] The amount of conductivity the material should exhibit is
dependent upon the application, preferably upon the impedance of
the measurement circuit since the impedance of the material should
be less than the impedance of the measuring circuit. For example,
if the impedance of the measuring circuit is 10.sup.12 ohms, the
impedance of the material is preferably less than about 10.sup.10
ohms. In some embodiments, the insulating material used in the
electrode is of the type in which the surface of the material
readily exchanges protons. Proton exchange and, in particular, the
level of sensitivity in the electrode material to changes in ionic
concentration, is related to the density of proton binding sites in
the material. The greater the density of proton binding sites the
more rapid the proton exchange on the surface of the material and
the greater the sensitivity of the material to the ionic
concentration. Preferably the density of sites for proton exchange
in the insulating material is greater than 10.sup.13/cm.sup.2. The
metal oxide electrode may be used in conjunction with catalytic or
enzymatic layers to measure an ionic species and calculate the
concentration of specific components in the ambient. This may be
accomplished by placing at least one layer of material between the
metal oxide composition and the ambient to be sensed so as to
detect a change of the concentration of ionic species in the layer
resulting from exposure of that layer to the ambient. Through the
change in the concentration of the ionic species sensed by the
metal oxide electrode of the present invention, the concentration
can be determined of a species of interest in the ambient. These
and other embodiments of microfabricated metal oxide electrodes are
described in U.S. Pat. No. 5,009,766, incorporated herein in its
entirety for all purposes.
Embodiments of the Technology
[0030] The technology relates to using microfabricated mixed metal
oxide electrodes (e.g. as provided in U.S. Pat. No. 5,009,766,
incorporated herein by reference in its entirety for all purposes)
or membrane electrodes (e.g. as provided in U.S. Pat. No.
5,200,051, incorporated herein by reference in its entirety for all
purposes) in conjunction with a suitable reference electrode (e.g.
as provided in U.S. Pat. No. 4,933,048, incorporated herein by
reference in its entirety for all purposes) for sensing and
detecting ionic species, e.g. protons, generated from a chemical
reaction (e.g., DNA synthesis, DNA polymerization) that can be used
to indicate the presence or absence of a molecular target without
the use of ion-sensitive field effect transistors or voltage
clamped proton detectors. While not limited in the types of
electrodes that may be used, it is contemplated that the device
comprises microfabricated electrodes suitable for mass production
and capable of detecting a wide range of biological molecules
(e.g., hydrogen ion). Examples of electrodes are provided in U.S.
Pat. Nos. 4,613,422; 4,739,380; 4,933,048; 5,063,081; 5,200,051;
5,837,446; 5,837,454; 6,030,827; 6,379,883; 7,540,948; including
reference sensors in U.S. Pat. No. 7,723,099, all of which are
incorporated herein by reference in their entireties for all
purposes.
[0031] One such use is detecting a change in pH as protons are
generated or absorbed in different aqueous chemical reactions, more
specifically, detecting the proton released when a dNTP base is
incorporated in a DNA template by a polymerase enzyme. In this
reaction, DNA polymerase incorporates a complementary dNTP base
into a growing chain of DNA, with concurrent release of
pyrophosphate (PP.sub.1) and a single proton. If enough protons are
released in the vicinity of the metal oxide electrode surface, a
measurable pH change can be detected by the electrode, thereby
indicating successful integration of a base in the growing
complementary strand. Transduction of the hydrogen ion
concentration into a signal is by an electrochemical (e.g.,
amperometric, potentiometric (voltammetric), or conductimetric)
means. Potentiometric and amperometric techniques are preferred
because the output signal may most easily be related directly to
the response of the eletrode to a particular analyte.
[0032] Since most enzymatic reactions benefit from buffered
conditions for proper enzymatic function, it is natural for the
present invention to use low ionic strength buffers to carry out pH
measurements. High concentration buffer solutions would have the
undesirable effect of suppressing pH changes, thereby negating the
usefulness of the ion selective sensing electrode. For example, in
some embodiments a buffer (e.g., a Tris buffer) is used at 100 mM,
at 10 mM, or at 1 mM. In some embodiments, the reaction solution
comprises no buffer or has no added buffer (e.g., any buffer
present is residual and is carried over from other components added
to the reaction such as the enzyme, salts, and/or dNTPs). In some
embodiments the reaction solution comprises salts (at exemplary
concentrations) such as 0.5 M NaCl, 100 mM MgCl.sub.2, 10 mM
dithiothreitol (DTT).
[0033] Various pH electrodes have been employed as clinical
chemistry-based biosensors. As such, it has been demonstrated that
an ion-specific metal oxide electrode, when used in parallel with a
corresponding reference electrode, can detect pH changes as small
as 0.1 pH unit. For example, a small (200 .mu.m diameter) metal
oxide electrode surrounded by a wall 30 .mu.m high could be used as
a reaction container to monitor release of protons from a clonal
population of target DNA molecules. Target molecules may either be
coated on the electrode surface or attached to microparticle beads
that are placed inside each electrode well compartment. It is
assumed that the sequencing device would have a large array of such
electrodes.
[0034] As sequencing reagents are introduced into the device, a
single proton would be released for each target molecule in the
compartment. Depending on the surface density of bound DNA target
molecules, a change in localized pH would result in the electrode
compartment if a specific dNTP base was added to the target.
[0035] An example calculation of possible pH changes within the
electrode compartment is shown below. It assumes the sequencing
buffer used in the assay is a low concentration buffer with a pH of
8. A change of at least 0.1 pH unit would be detected by the
electrode. The magnitude of the actual pH change would be
proportional to the number of bound target molecules present in the
compartment.
TABLE-US-00001 target molecule pH unit electrode electrode wall
loading, localized difference diameter, .mu.m height, .mu.m
molecules/cm.sup.2 pH from pH 8.0 200 30 6.70E+11 6.4 1.6 200 30
3.00E+11 6.8 1.2 200 30 1.00E+11 7.3 0.7 200 30 5.00E+10 7.5 0.4
200 30 3.00E+10 7.8 0.2 200 30 2.20E+10 7.9 0.1
[0036] It is assumed that control measures should be in place to
control the rate of proton diffusion away from the electrode
surface into the surrounding solution. Such measures include, but
are not limited to, adding support micro particles in the electrode
compartment or placing a physical barrier over the top of the
compartment. Both methods work by restricting the movement of
highly diffusible protons after addition of the dNTP base, allowing
for a longer response time for measuring the localized proton
concentration.
[0037] The technology contemplates the use of a pH electrode to
monitor the sequencing of nucleic acids using any extant or future
sequencing technology and/or chemistry and/or reaction scheme
appropriate for the technology herein described. Accordingly, in
some embodiments, any suitable systems, devices, compositions, and
methods for nucleic acid sequence analysis are within the scope of
the present invention. Illustrative non-limiting examples of
nucleic acid sequencing techniques include, but are not limited to,
"next generation" sequencing techniques. While various of these
approaches employ different detection mechanisms, various aspects
of their sample preparation, sequencing reactions, and/or data
analysis may be employed in the approaches described herein.
[0038] In some embodiments, DNA sequencing methodologies provided
by the present invention comprise Second Generation (a.k.a. Next
Generation or Next-Gen), Third Generation (a.k.a. Next-Next-Gen),
or Fourth Generation (a.k.a. N3-Gen) sequencing technologies
including, but not limited to, pyrosequencing,
sequencing-by-ligation, single molecule sequencing,
sequence-by-synthesis (SBS), massive parallel clonal, massive
parallel single molecule SBS, massive parallel single molecule
real-time, massive parallel single molecule real-time nanopore
technology, etc. Morozova and Marra provide a review of some such
technologies in Genomics, 92: 255 (2008), herein incorporated by
reference in its entirety. Those of ordinary skill in the art will
recognize that because RNA is less stable in the cell and more
prone to nuclease attack experimentally RNA is usually reverse
transcribed to DNA before sequencing.
[0039] A number of DNA sequencing techniques are known in the art,
including fluorescence-based sequencing methodologies (See, e.g.,
Birren et al., Genome Analysis: Analyzing DNA, 1, Cold Spring
Harbor, N.Y.; herein incorporated by reference in its entirety). In
some embodiments, automated sequencing techniques understood in
that art are utilized. In some embodiments, the present invention
provides parallel sequencing of partitioned amplicons (PCT
Publication No: WO2006084132 to Kevin McKernan et al., herein
incorporated by reference in its entirety). In some embodiments,
DNA sequencing is achieved by parallel oligonucleotide extension
(See, e.g., U.S. Pat. No. 5,750,341 to Macevicz et al., and U.S.
Pat. No. 6,306,597 to Macevicz et al., both of which are herein
incorporated by reference in their entireties). Additional examples
of sequencing techniques include the Church polony technology
(Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure
et al., 2005 Science 309, 1728-1732; U.S. Pat. No. 6,432,360, U.S.
Pat. No. 6,485,944, U.S. Pat. No. 6,511,803; herein incorporated by
reference in their entireties), the 454 picotiter pyrosequencing
technology (Margulies et al., 2005 Nature 437, 376-380; US
20050130173; herein incorporated by reference in their entireties),
the Solexa single base addition technology (Bennett et al., 2005,
Pharmacogenomics, 6, 373-382; U.S. Pat. No. 6,787,308; U.S. Pat.
No. 6,833,246; herein incorporated by reference in their
entireties), the Lynx massively parallel signature sequencing
technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634;
U.S. Pat. No. 5,695,934; U.S. Pat. No. 5,714,330; herein
incorporated by reference in their entireties), and the Adessi PCR
colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87;
WO 00018957; herein incorporated by reference in its entirety).
[0040] Next-generation sequencing (NGS) methods share the common
feature of massively parallel, high-throughput strategies, with the
goal of lower costs in comparison to older sequencing methods (see,
e.g., Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296; each herein
incorporated by reference in their entirety). NGS methods can be
broadly divided into those that typically use template
amplification and those that do not. Amplification-requiring
methods include pyrosequencing commercialized by Roche as the 454
technology platforms (e.g., GS 20 and GS FLX), the Solexa platform
commercialized by Illumina, and the Supported Oligonucleotide
Ligation and Detection (SOLiD) platform commercialized by Applied
Biosystems. Non-amplification approaches, also known as
single-molecule sequencing, are exemplified by the HeliScope
platform commercialized by Helicos BioSciences, and emerging
platforms commercialized by VisiGen, Oxford Nanopore Technologies
Ltd., Life Technologies/Ion Torrent, and Pacific Biosciences,
respectively.
[0041] In pyrosequencing (Voelkerding et al., Clinical Chem., 55:
641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296;
U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568; each herein
incorporated by reference in its entirety), template DNA is
fragmented, end-repaired, ligated to adaptors, and clonally
amplified in-situ by capturing single template molecules with beads
bearing oligonucleotides complementary to the adaptors. Each bead
bearing a single template type is compartmentalized into a
water-in-oil microvesicle, and the template is clonally amplified
using a technique referred to as emulsion PCR. The emulsion is
disrupted after amplification and beads are deposited into
individual wells of a picotitre plate functioning as a flow cell
during the sequencing reactions. Ordered, iterative introduction of
each of the four dNTP reagents occurs in the flow cell in the
presence of sequencing enzymes and luminescent reporter such as
luciferase. In the event that an appropriate dNTP is added to the
3' end of the sequencing primer, the resulting production of ATP
causes a burst of luminescence within the well, which is recorded
using a CCD camera. It is possible to achieve read lengths greater
than or equal to 400 bases, and 10.sup.6 sequence reads can be
achieved, resulting in up to 500 million base pairs (Mb) of
sequence.
[0042] In the Solexa/Illumina platform (Voelkerding et al.,
Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev.
Microbiol., 7: 287-296; U.S. Pat. No. 6,833,246; U.S. Pat. No.
7,115,400; U.S. Pat. No. 6,969,488; each herein incorporated by
reference in its entirety), sequencing data are produced in the
form of shorter-length reads. In this method, single-stranded
fragmented DNA is end-repaired to generate 5'-phosphorylated blunt
ends, followed by Klenow-mediated addition of a single A base to
the 3' end of the fragments. A-addition facilitates addition of
T-overhang adaptor oligonucleotides, which are subsequently used to
capture the template-adaptor molecules on the surface of a flow
cell that is studded with oligonucleotide anchors. The anchor is
used as a PCR primer, but because of the length of the template and
its proximity to other nearby anchor oligonucleotides, extension by
PCR results in the "arching over" of the molecule to hybridize with
an adjacent anchor oligonucleotide to form a bridge structure on
the surface of the flow cell. These loops of DNA are denatured and
cleaved. Forward strands are then sequenced with reversible dye
terminators. The sequence of incorporated nucleotides is determined
by detection of post-incorporation fluorescence, with each fluor
and block removed prior to the next cycle of dNTP addition.
Sequence read length ranges from 36 nucleotides to over 50
nucleotides, with overall output exceeding 1 billion nucleotide
pairs per analytical run.
[0043] Sequencing nucleic acid molecules using SOLiD technology
(Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et
al., Nature Rev. Microbiol., 7: 287-296; U.S. Pat. No. 5,912,148;
U.S. Pat. No. 6,130,073; each herein incorporated by reference in
their entirety) also involves fragmentation of the template,
ligation to oligonucleotide adaptors, attachment to beads, and
clonal amplification by emulsion PCR. Following this, beads bearing
template are immobilized on a derivatized surface of a glass
flow-cell, and a primer complementary to the adaptor
oligonucleotide is annealed. However, rather than utilizing this
primer for 3' extension, it is instead used to provide a 5'
phosphate group for ligation to interrogation probes containing two
probe-specific bases followed by 6 degenerate bases and one of four
fluorescent labels. In the SOLiD system, interrogation probes have
16 possible combinations of the two bases at the 3' end of each
probe, and one of four fluors at the 5' end. Fluor color, and thus
identity of each probe, corresponds to specified color-space coding
schemes. Multiple rounds (usually 7) of probe annealing, ligation,
and fluor detection are followed by denaturation, and then a second
round of sequencing using a primer that is offset by one base
relative to the initial primer. In this manner, the template
sequence can be computationally re-constructed, and template bases
are interrogated twice, resulting in increased accuracy. Sequence
read length averages 35 nucleotides, and overall output exceeds 4
billion bases per sequencing run.
[0044] In certain embodiments, nanopore sequencing is employed
(see, e.g., Astier et al., J. Am. Chem. Soc. 2006 Feb. 8;
128(5):1705-10, herein incorporated by reference). The theory
behind nanopore sequencing has to do with what occurs when a
nanopore is immersed in a conducting fluid and a potential
(voltage) is applied across it. Under these conditions a slight
electric current due to conduction of ions through the nanopore can
be observed, and the amount of current is exceedingly sensitive to
the size of the nanopore. As each base of a nucleic acid passes
through the nanopore, this causes a change in the magnitude of the
current through the nanopore that is distinct for each of the four
bases, thereby allowing the sequence of the DNA molecule to be
determined.
[0045] In certain embodiments, HeliScope by Helicos BioSciences is
employed (Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296; U.S. Pat. No.
7,169,560; U.S. Pat. No. 7,282,337; U.S. Pat. No. 7,482,120; U.S.
Pat. No. 7,501,245; U.S. Pat. No. 6,818,395; U.S. Pat. No.
6,911,345; U.S. Pat. No. 7,501,245; each herein incorporated by
reference in their entirety). Template DNA is fragmented and
polyadenylated at the 3' end, with the final adenosine bearing a
fluorescent label. Denatured polyadenylated template fragments are
ligated to poly(dT) oligonucleotides on the surface of a flow cell.
Initial physical locations of captured template molecules are
recorded by a CCD camera, and then label is cleaved and washed
away. Sequencing is achieved by addition of polymerase and serial
addition of fluorescently-labeled dNTP reagents. Incorporation
events result in fluor signal corresponding to the dNTP, and signal
is captured by a CCD camera before each round of dNTP addition.
Sequence read length ranges from 25-50 nucleotides, with overall
output exceeding 1 billion nucleotide pairs per analytical run.
[0046] The Ion Torrent technology is a method of DNA sequencing
based on the detection of hydrogen ions that are released during
the polymerization of DNA (see, e.g., Science 327(5970): 1190
(2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589,
20100301398, 20100197507, 20100188073, and 20100137143,
incorporated by reference in their entireties for all purposes). A
microwell contains a template DNA strand to be sequenced. Beneath
the layer of microwells is a hypersensitive ISFET ion sensor. All
layers are contained within a CMOS semiconductor chip, similar to
that used in the electronics industry. When a dNTP is incorporated
into the growing complementary strand a hydrogen ion is released,
which triggers a hypersensitive ion sensor. If homopolymer repeats
are present in the template sequence, multiple dNTP molecules will
be incorporated in a single cycle. This leads to a corresponding
number of released hydrogens and a proportionally higher electronic
signal. This technology differs from other sequencing technologies
in that no modified nucleotides or optics are used. The per base
accuracy of the Ion Torrent sequencer is .about.99.6% for 50 base
reads, with .about.100 Mb generated per run. The read-length is 100
base pairs. The accuracy for homopolymer repeats of 5 repeats in
length is .about.98%. The benefits of ion semiconductor sequencing
are rapid sequencing speed and low upfront and operating costs.
However, the cost of acquiring a pH-mediated sequencer is
approximately $50,000, excluding sample preparation equipment and a
server for data analysis.
[0047] Another exemplary nucleic acid sequencing approach that may
be adapted for use with the present invention was developed by
Stratos Genomics, Inc. and involves the use of Xpandomers. This
sequencing process typically includes providing a daughter strand
produced by a template-directed synthesis. The daughter strand
generally includes a plurality of subunits coupled in a sequence
corresponding to a contiguous nucleotide sequence of all or a
portion of a target nucleic acid in which the individual subunits
comprise a tether, at least one probe or nucleobase residue, and at
least one selectively cleavable bond. The selectively cleavable
bond(s) is/are cleaved to yield an Xpandomer of a length longer
than the plurality of the subunits of the daughter strand. The
Xpandomer typically includes the tethers and reporter elements for
parsing genetic information in a sequence corresponding to the
contiguous nucleotide sequence of all or a portion of the target
nucleic acid. Reporter elements of the Xpandomer are then detected.
Additional details relating to Xpandomer-based approaches are
described in, for example, U.S. Pat. Pub No. 20090035777, entitled
"HIGH THROUGHPUT NUCLEIC ACID SEQUENCING BY EXPANSION," filed Jun.
19, 2008, which is incorporated herein in its entirety.
[0048] Other emerging single molecule sequencing methods include
real-time sequencing by synthesis using a VisiGen platform
(Voelkerding et al., Clinical Chem., 55: 641-58, 2009; U.S. Pat.
No. 7,329,492; U.S. patent application Ser. No. 11/671,956; U.S.
patent application Ser. No. 11/781,166; each herein incorporated by
reference in their entirety) in which immobilized, primed DNA
template is subjected to strand extension using a
fluorescently-modified polymerase and florescent acceptor
molecules, resulting in detectible fluorescence resonance energy
transfer (FRET) upon nucleotide addition.
[0049] Another real-time single molecule sequencing system
developed by Pacific Biosciences (Voelkerding et al., Clinical
Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol.,
7: 287-296; U.S. Pat. No. 7,170,050; U.S. Pat. No. 7,302,146; U.S.
Pat. No. 7,313,308; U.S. Pat. No. 7,476,503; all of which are
herein incorporated by reference) utilizes reaction wells 50-100 nm
in diameter and encompassing a reaction volume of approximately 20
zeptoliters (10.sup.-21 L). Sequencing reactions are performed
using immobilized template, modified phi29 DNA polymerase, and high
local concentrations of fluorescently labeled dNTPs. High local
concentrations and continuous reaction conditions allow
incorporation events to be captured in real time by fluor signal
detection using laser excitation, an optical waveguide, and a CCD
camera.
[0050] In certain embodiments, the single molecule real time (SMRT)
DNA sequencing methods using zero-mode waveguides (ZMWs) developed
by Pacific Biosciences, or similar methods, are employed. With this
technology, DNA sequencing is performed on SMRT chips, each
containing thousands of zero-mode waveguides (ZMWs). A ZMW is a
hole, tens of nanometers in diameter, fabricated in a 100 nm metal
film deposited on a silicon dioxide substrate. Each ZMW becomes a
nanophotonic visualization chamber providing a detection volume of
just 20 zeptoliters (10.sup.-21 L). At this volume, the activity of
a single molecule can be detected amongst a background of thousands
of labeled nucleotides. The ZMW provides a window for watching DNA
polymerase as it performs sequencing by synthesis. Within each
chamber, a single DNA polymerase molecule is attached to the bottom
surface such that it permanently resides within the detection
volume. Phospholinked nucleotides, each type labeled with a
different colored fluorophore, are then introduced into the
reaction solution at high concentrations which promote enzyme
speed, accuracy, and processivity. Due to the small size of the
ZMW, even at these high, biologically relevant concentrations, the
detection volume is occupied by nucleotides only a small fraction
of the time. In addition, visits to the detection volume are fast,
lasting only a few microseconds, due to the very small distance
that diffusion has to carry the nucleotides. The result is a very
low background.
[0051] Processes and systems for such real time sequencing that may
be adapted for use with the invention are described in, for
example, U.S. Pat. No. 7,405,281, entitled "Fluorescent nucleotide
analogs and uses therefor", issued Jul. 29, 2008 to Xu et al.; U.S.
Pat. No. 7,315,019, entitled "Arrays of optical confinements and
uses thereof", issued Jan. 1, 2008 to Turner et al.; U.S. Pat. No.
7,313,308, entitled "Optical analysis of molecules", issued Dec.
25, 2007 to Turner et al.; U.S. Pat. No. 7,302,146, entitled
"Apparatus and method for analysis of molecules", issued Nov. 27,
2007 to Turner et al.; and U.S. Pat. No. 7,170,050, entitled
"Apparatus and methods for optical analysis of molecules", issued
Jan. 30, 2007 to Turner et al.; and U.S. Pat. Pub. Nos.
20080212960, entitled "Methods and systems for simultaneous
real-time monitoring of optical signals from multiple sources",
filed Oct. 26, 2007 by Lundquist et al.; 20080206764, entitled
"Flowcell system for single molecule detection", filed Oct. 26,
2007 by Williams et al.; 20080199932, entitled "Active surface
coupled polymerases", filed Oct. 26, 2007 by Hanzel et al.;
20080199874, entitled "CONTROLLABLE STRAND SCISSION OF MINI CIRCLE
DNA", filed Feb. 11, 2008 by Otto et al.; 20080176769, entitled
"Articles having localized molecules disposed thereon and methods
of producing same", filed Oct. 26, 2007 by Rank et al.;
20080176316, entitled "Mitigation of photodamage in analytical
reactions", filed Oct. 31, 2007 by Eid et al.; 20080176241,
entitled "Mitigation of photodamage in analytical reactions", filed
Oct. 31, 2007 by Eid et al.; 20080165346, entitled "Methods and
systems for simultaneous real-time monitoring of optical signals
from multiple sources", filed Oct. 26, 2007 by Lundquist et al.;
20080160531, entitled "Uniform surfaces for hybrid material
substrates and methods for making and using same", filed Oct. 31,
2007 by Korlach; 20080157005, entitled "Methods and systems for
simultaneous real-time monitoring of optical signals from multiple
sources", filed Oct. 26, 2007 by Lundquist et al.; 20080153100,
entitled "Articles having localized molecules disposed thereon and
methods of producing same", filed Oct. 31, 2007 by Rank et al.;
20080153095, entitled "CHARGE SWITCH NUCLEOTIDES", filed Oct. 26,
2007 by Williams et al.; 20080152281, entitled "Substrates, systems
and methods for analyzing materials", filed Oct. 31, 2007 by
Lundquist et al.; 20080152280, entitled "Substrates, systems and
methods for analyzing materials", filed Oct. 31, 2007 by Lundquist
et al.; 20080145278, entitled "Uniform surfaces for hybrid material
substrates and methods for making and using same", filed Oct. 31,
2007 by Korlach; 20080128627, entitled "SUBSTRATES, SYSTEMS AND
METHODS FOR ANALYZING MATERIALS", filed Aug. 31, 2007 by Lundquist
et al.; 20080108082, entitled "Polymerase enzymes and reagents for
enhanced nucleic acid sequencing", filed Oct. 22, 2007 by Rank et
al.; 20080095488, entitled "SUBSTRATES FOR PERFORMING ANALYTICAL
REACTIONS", filed Jun. 11, 2007 by Foquet et al.; 20080080059,
entitled "MODULAR OPTICAL COMPONENTS AND SYSTEMS INCORPORATING
SAME", filed Sep. 27, 2007 by Dixon et al.; 20080050747, entitled
"Articles having localized molecules disposed thereon and methods
of producing and using same", filed Aug. 14, 2007 by Korlach et
al.; 20080032301, entitled "Articles having localized molecules
disposed thereon and methods of producing same", filed Mar. 29,
2007 by Rank et al.; 20080030628, entitled "Methods and systems for
simultaneous real-time monitoring of optical signals from multiple
sources", filed Feb. 9, 2007 by Lundquist et al.; 20080009007,
entitled "CONTROLLED INITIATION OF PRIMER EXTENSION", filed Jun.
15, 2007 by Lyle et al.; 20070238679, entitled "Articles having
localized molecules disposed thereon and methods of producing
same", filed Mar. 30, 2006 by Rank et al.; 20070231804, entitled
"Methods, systems and compositions for monitoring enzyme activity
and applications thereof", filed Mar. 31, 2006 by Korlach et al.;
20070206187, entitled "Methods and systems for simultaneous
real-time monitoring of optical signals from multiple sources",
filed Feb. 9, 2007 by Lundquist et al.; 20070196846, entitled
"Polymerases for nucleotide analogue incorporation", filed Dec. 21,
2006 by Hanzel et al.; 20070188750, entitled "Methods and systems
for simultaneous real-time monitoring of optical signals from
multiple sources", filed Jul. 7, 2006 by Lundquist et al.;
20070161017, entitled "MITIGATION OF PHOTODAMAGE IN ANALYTICAL
REACTIONS", filed Dec. 1, 2006 by Eid et al.; 20070141598, entitled
"Nucleotide Compositions and Uses Thereof", filed Nov. 3, 2006 by
Turner et al.; 20070134128, entitled "Uniform surfaces for hybrid
material substrate and methods for making and using same", filed
Nov. 27, 2006 by Korlach; 20070128133, entitled "Mitigation of
photodamage in analytical reactions", filed Dec. 2, 2005 by Eid et
al.; 20070077564, entitled "Reactive surfaces, substrates and
methods of producing same", filed Sep. 30, 2005 by Roitman et al.;
20070072196, entitled "Fluorescent nucleotide analogs and uses
therefore", filed Sep. 29, 2005 by Xu et al; and 20070036511,
entitled "Methods and systems for monitoring multiple optical
signals from a single source", filed Aug. 11, 2005 by Lundquist et
al.; and Korlach et al. (2008) "Selective aluminum passivation for
targeted immobilization of single DNA polymerase molecules in
zero-mode waveguide nanostructures" PNAS 105(4): 1176-81, all of
which are herein incorporated by reference in their entireties.
[0052] In some embodiments, the pH electrode(s) is/are incorporated
into a cartridge, e.g., a disposable cartridge for performing the
sequencing methods described herein. The cartridge's longest
dimension is on the order of approximately 1-10 cm (e.g., 1, 5, 10
cm, e.g., approximately the size of a deck of playing cards or
smaller), although larger and smaller dimensions may be
employed.
[0053] The cartridge comprises one or more pH electrodes and, in
some embodiments, one or more reference electrodes, one or more
chambers for holding fluids or other sample types. In some
embodiments the cartridge comprises a multiplexer for processing
signals received from the electrodes and sending data signals to an
output, and in some embodiments, to a reading apparatus. In some
embodiments the cartridge comprises a demultiplexer receiving
signals from the reading apparatus and routing signals to the
electrodes. The cartridge further comprises fluid handling
components (e.g., inlet ports, outlet ports, metering means to
measure and provide specific volumes of fluids, and conduits for
handling and transporting the sample and other fluids) and the
necessary electronic connections for sending and receiving
electronic signals among the multiplexer, demultiplexer, the
reading apparatus, and the electrodes. See, for example, U.S. Pat.
Appl. Ser. No. 61/481,592, incorporated herein by reference in its
entirety for all purposes.
[0054] The cartridge is adapted for insertion into a reading
apparatus (e.g., a hand-held device such as the Abbott Point of
Care i-STAT Portable Handheld) and accordingly has a plurality of
mechanical and electrical connections for physically and
electrically interfacing with the reading apparatus. The reading
apparatus is a hand-held device having dimensions of approximately
5-10 cm.times.5-10 cm.times.20-30 cm and weighs approximately
kilogram or less. Furthermore, in some embodiments the cartridge
comprises one or more chambers in which is stored a fluid for,
e.g., washing the electrodes, providing one or more nucleotides,
providing a solution to remove and/or inactivate one or more
nucleotides, providing a polymerase, or providing some other fluid
(e.g., a buffer, an amending solution, or some other solution) that
is appropriate for the sequencing.
[0055] Embodiments of the cartridges take many forms and
configurations and they are constructed from many suitable
materials. Cartridges having similar sizes and form factors are
provided, for example, in U.S. Pat. No. 7,419,821, incorporated
herein in its entirety for all purposes. Furthermore, other similar
cartridges include a disposable sensing device for measuring
analytes in a blood sample as disclosed in U.S. Pat. Nos.
5,096,669; 6,750,053; 7,723,099. Other devices are disclosed in
U.S. Pat. Nos. 5,628,961 and 5,447,440 for measuring clotting time.
These devices employ a reading apparatus and a cartridge that fits
into the reading apparatus for the purpose of measuring analyte
concentrations and viscosity changes in a blood sample as a
function of time.
[0056] In some embodiments, the cartridges are used with a single
sample. The use of such cartridges provides a convenient way to
test (e.g., sequence) samples (e.g., a nucleic acid) while
minimizing sample contamination and sample carry-over risks.
Appropriately, in some embodiments, the cartridges are
disposable.
[0057] Furthermore, embodiments of the technology provided herein
comprise a reading apparatus (e.g., a hand-held) that is configured
to accept a sequencing cartridge (and, accordingly, the technology
provides a sequencing cartridge configured to be inserted into and
interface with the reading apparatus). The reading apparatus is
configured to send and receive signals to and from the cartridge.
For example, these signals control the pH electrodes and process
data received from the pH electrodes. In some embodiments the
reading apparatus comprises a demultiplexer for decoding a signal
sent by the cartridge. Such a demultiplexer can be provided by
software, firmware, by a dedicated integrated circuit, or a
combination thereof. Software and firmware updates for providing
demultiplexer capabilities can be performed on reading apparatuses
currently being used by the installed user base.
[0058] Some embodiments of the technology provided herein further
comprise functionalities for collecting, storing, and/or analyzing
data (e.g., nucleotide sequence data). For example, in some
embodiments the reading apparatus comprises a processor, a memory,
and/or a database for, e.g., storing and executing instructions,
analyzing data, performing calculations using the data,
transforming the data, and storing the data. In some embodiments,
the reading apparatus is configured to calculate a function of data
received from the cartridge. In some embodiments the reading
apparatus comprises software configured for medical or clinical
results reporting and in some embodiments the apparatus comprises
software to support non-clinical results reporting.
[0059] Many diagnostics involve determining the presence of or
nucleotide sequence of one or more nucleic acids, and an equation
comprising variables representing the presence or sequence
properties of multiple nucleic acids produces a value that finds
use in making a diagnosis or assessing the presence or qualities of
a nucleic acid. As such, in some embodiments the reading apparatus
calculates this value and, in some embodiments, presents the value
to the user of the device, uses the value to produce an indicator
related to the result (e.g., an LED, an icon on an LCD, a sound, or
the like), stores the value, transmits the value, or uses the value
for additional calculations.
[0060] Moreover, in some embodiments a processor is configured to
control the reading apparatus. In some embodiments, the processor
is used to initiate and/or terminate the measurement and data
collection relating to a sequencing reaction. In some embodiments,
the device comprises a user interface (e.g., a keyboard, buttons,
dials, switches, and the like) for receiving user input that is
used by the processor to direct a measurement. In some embodiments,
the device further comprises a data output for transmitting (e.g.,
by a wired or wireless connection) data to an external destination,
e.g., a computer, a display, a network, and/or an external storage
medium. Some embodiments provide that the device is a small,
handheld, portable device incorporating these features and
components. Examples of a reading apparatus are provided in U.S.
Pat. Nos. 5,096,669 and 5,821,399, which are both hereby
incorporated by reference in their respective entireties for all
purposes.
[0061] The device finds use in assaying the presence of one or more
nucleic acids and/or providing the sequence of one or more nucleic
acids. Accordingly, the technology provided herein finds use in the
medical, clinical, and emergency medical fields. In some
embodiments the device is used to assay biological samples. In such
an assay, the biological sample comprises a nucleic acid and
sequencing the nucleic acid is indicative of a state or a property
of the sample and, in some embodiments, the subject from which the
sample was taken. Some relevant samples include, but are not
limited to, whole blood, lymph, plasma, serum, saliva, urine,
stool, perspiration, mucus, tears, cerebrospinal fluid, nasal
secretion, cervical or vaginal secretion, semen, pleural fluid,
amniotic fluid, peritoneal fluid, middle ear fluid, joint fluid,
gastric aspirate, a tissue homogenate, a cell homogenate, or the
like.
[0062] Furthermore, in some embodiments the sample comprises or is
suspected to comprise a composition associated with bioterrorism,
e.g., a biological agent. A biological agent is, or is derived
from, a living, typically pathogenic, biological organism (e.g., a
bacterium, a virus, a eukaryote such as a fungus or a parasite). In
some embodiments the sample comprises a biological toxin or other
substance derived from a biological source (e.g., a small molecule,
a protein, a prion). Bioterrorism agents are, or are derived from,
biological sources; thus, particular nucleic acid signature
sequences can be used to detect or identify the biological agent.
For example, the device can be used to detect a PCR amplicon, a
virulence factor gene, or genes encoding the production of a toxin,
and/or markers associated with drug resistance.
[0063] Biological agents, some of military importance include, but
are not limited to, Bacillus anthracis (causative agent of
anthrax); Staphylococcus spp.; Brucella abortus, Brucella
melitensis, and Brucella suis (causative agents of brucellosis);
Vibrio cholerae (causative agent of cholera); Corynebacterium
diphtheriae (causative agent of diphtheria); Cryptosporidium
parvum; Shigella dysenteriae and Escherichia coli (causative agents
of dysentery); Burkholderia mallei (causative agent of glanders);
Listeria monocytogenes (causative agent of listerosis);
Burkholderia pseudomallei (causative agent of meliodosis); Yersinia
pestis (causative agent of plague); Francisella tularensis
(causative agent of tularemia); Chlamydia psittaci (causative agent
of psittacosis); Coxiella burtetii (causative agent of Q fever);
Ricketsia rickettsii (causative agent of Rocky Mountain spotted
fever); Rickettsia prowazekii and Rickettsia typhi (causative
agents of typhus); Coccidioides immitis (causative agent of
coccidiomycosis); Eastern, Western, and Venezuelan equine
encephalitis viruses (causative agents of Equine encephalitis);
Japanese encephalitis virus (causative agent of Japanese
encephalitis); Rift Valley Fever virus (causative agent of Rift
Valley fever); Variola virus (causative agent of smallpox); Yellow
fever virus (causative agent of yellow fever); arenavirus
(causative agent of Lassa fever and the Argentine, Bolivian,
Brazilian, and Venezuelan hemorrhagic fevers); other viruses
causative of hemorrhagic fevers; other viruses causative of viral
encephalitis; Marburg virus; Ebola virus; Nipad virus; hantavirus;
SARS; H1N1 influenza virus.
[0064] Along with smallpox, anthrax, plague, botulism, and
tularemia, hemorrhagic fever viruses are among the six agents
identified by the Centers for Disease Control and Prevention (CDC)
as the most likely to be used as biological weapons. Hemorrhagic
fever viruses include, but are not limited to, the arenaviridae
(e.g., Lujo virus); the bunyaviridae (e.g., hantavirus); nairovirus
(e.g., the Crimean-Congo hemorrhagic fever virus); Phlebovirus
genus (Rift Valley fever virus); filoviridae (e.g., Ebola and
Marburg viruses); and flaviviridae (e.g., dengue, yellow fever,
Omsk hemorrhagic fever virus, and Kyasanur Forest disease
virus).
[0065] While the technology finds use in detecting these and other
agents in the context of bioterrorism, the technology is also used
to detect the same and/or other agents in other contexts and
applications. For example, the technology is useful to analyze
samples from diseased patients or other subjects suspected of
having a disease or having been exposed to a disease.
[0066] Although the disclosure herein refers to certain illustrated
embodiments, it is to be understood that these embodiments are
presented by way of example and not by way of limitation. These
embodiments are further understood by the following examples.
EXAMPLES
Example 1
[0067] During the development of embodiments of the technology
provided herein, it was demonstrated that DNA synthesis produces
measurable pH changes.
[0068] Oligonucleotides and Enzymes
[0069] Synthetic oligonucleotides (Integrated DNA Technologies,
Coralville, Iowa) were designed and synthesized to simulate the
first steps of DNA synthesis (see Table 1).
TABLE-US-00002 TABLE 1 oligonucleotide sequences SEQ ID name NO
oligonucletide sequence (5' to 3') isX001 1
5AmMC6-TTTTTTTTTTTTTTTTTTTTAGTTATGCAACG CGGGAGTTGTGTATGAAGT isX003
2 TGCATGCAACTTCATACACAACTCCCGCGTTGCATAACT isX006 3
GCATGCATACTTCATACACAACTCCCGCGTTGCATAACT
[0070] isX001 serves as the primer for DNA synthesis using either
isX003 or isX006 as the template for DNA synthesis. The underlined
sequence in isX003 and isX006 is the same and is complementary to
the underlined sequence in isX001. The non-underlined portions of
isX003 and isX006 are the regions that are synthesized by the
reaction. The free 3'-hydroxyl group of isX001 permits extension
with the appropriate complementary DNA sequence. The T-tail with an
amino group (designated by 5AmMC6) was selected as a potential
linkage group. The oligonucleotides are designed such that upon
annealing of isX003 to isX001, the first base to be added to the 3'
end of isX001 is a T as directed by the A in the isX003 template;
likewise, upon annealing of isX006 to isX001, the first base to be
added to the 3' end of isX001 is an A as directed by the T in the
isX006 template.
[0071] Klenow Exo.sup.- DNA polymerase (New England Biolabs,
Ipswitch, Mass.) was used for DNA synthesis. This enzyme lacks both
5'.fwdarw.3' and 3'.fwdarw.5' exonuclease activity and thus does
not cleave the bonds of linked bases in DNA.
[0072] Buffers
[0073] The use of a conventional buffered reaction solution
hindered initial attempts to monitor a pH change associated with
DNA synthesis. To address this issue, experiments were performed to
determine if reaction solutions comprising low concentrations of
Tris buffer would solve the problems presented by conventional
buffers. Three new 10.times. buffer solutions were prepared
comprising 0.5 M NaCl, 100 mM MgCl.sub.2, 10 mM DTT, and Tris at
100 mM, 10 mM, or 1 mM. These solutions are designated DSB-A,
DSB-B, and DSB-C, respectively. The composition of DSB-A is
equivalent to the commercial buffer NEBuffer 2 (New England
Biolabs), which thus served as a control.
[0074] The buffers were first tested to assess buffer conditions
suitable for the DNA synthesis reaction. To test the buffers, test
reactions comprising a final concentration of 1.times. DSB-A,
DSB-B, or DSB-C buffer (a final Tris concentration of 10 mM, 1 mM,
or 0.1 mM), 100 pmol of isX001, 100 pmol of isX006, 0.05 mM dATP,
3.3.times.10.sup.-9 mmol alpha-.sup.32P-dATP (0.74 MBq), and 10
units of DNA polymerase in 20 .mu.l were incubated at 37.degree. C.
for 1 hour. The reactions were loaded onto a 20% acrylamide gel
comprising 7 M urea and electrophoresed for approximately 1 hour
and then autoradiographed. The results showed that the DNA
synthesis reaction yields similar amounts of product in the
reaction solution comprising Tris buffer at 10 mM, 1 mM, and 0.1
mM.
[0075] Measurement of pH Changes Associated with DNA Synthesis
[0076] After development of buffers suitable for DNA synthesis,
experiments were performed to test if the buffers were appropriate
for detecting pH changes associated with DNA synthesis. It was
first determined that measuring pH changes in these buffers during
an extension reaction were problematic. Accordingly, the Tris
concentration was reduced further by preparing and using an
additional 10.times. reaction solution (DSB-D) comprising 0.5 M
NaCl, 100 mM MgCl.sub.2, and 10 mM DTT, but that did not comprise
Tris buffer.
[0077] A test reaction similar to that described above was
prepared. The reaction comprised a final concentration of
1.times.DSB-A, DSB-B, DSB-C, or DSB-D (a final Tris concentration
of 10 mM, 1 mM, or 0.1 mM, or lacking Tris), 100 pmol of isX001,
100 pmol of isX006, 0.05 mM dATP, 8.3.times.10.sup.-10 mmol
alpha-.sup.32P-dATP (0.19 MBq), and approximately 5 units of DNA
polymerase in 20 .mu.l. The reaction was incubated at 37.degree. C.
for 1 hour. The reactions were loaded onto a 20% acrylamide gel
comprising 7M urea and electrophoresed for approximately 1 hour and
autoradiographed with no intensifying screen. The results confirmed
that the DNA synthesis reaction yields similar amounts of product
in the Tris-deficient reaction solution and in Tris-buffered
reaction solutions.
[0078] Next, experiments were performed to determine the pH changes
associated with DNA synthesis that are detected in the
Tris-deficient reaction solution. First, to reduce further the Tris
concentration in the reaction, Tris was removed from the commercial
enzyme by dialyzing the enzyme in a solution that was the same as
the enzyme storage solution except that it lacked Tris. An aliquot
of the enzyme was concentrated by diafiltration. The enzyme was
stored at 4.degree. C. The dialyzed and concentrated Klenow exo
polymerase was used in subsequent experiments.
[0079] Test reactions were assembled according to Table 2:
TABLE-US-00003 TABLE 2 pH measurement reactions Concentration
Constituent Rxn D Rxn E Rxn F 3.5x cocktail 100 pmol/.mu.l isX001
10 .mu.l 10 .mu.l 10 .mu.l 35 .mu.l 100 pmol/.mu.l isX006 -- 10
.mu.l -- 35 .mu.l 100 pmol/.mu.l isX003 -- -- 10 .mu.l 10x DSC-D 20
.mu.l 20 .mu.l 20 .mu.l 70 .mu.l 1 mM dATP 10 .mu.l 10 .mu.l 10
.mu.l 35 .mu.l ~5 U/.mu.l Klenow exo.sup.- 4 .mu.l 4 .mu.l 4 .mu.l
14 .mu.l Water 146 .mu.l 146 .mu.l 146 .mu.l 511 .mu.l Extra Water
10 .mu.l -- -- -- Final 200 .mu.l 200 .mu.l 200 .mu.l 700 .mu.l
Volume
[0080] A pH meter was used to measure the pH of the reaction
solution before and after each DNA polymerization reaction. pH
readings were performed using an Accumet AB15 pH meter with an
Accumet microelectrode 1.5 stem (catalogue number 13-620-96). The
Accumet pH sensor was used as a dependable model for both the
i-STAT membrane pH electrode and the i-STAT mixed metal oxide pH
electrode based on observations that the response characteristics
of these sensors are substantially similar.
[0081] The pH was taken prior to incubation (Table 3, before
reaction) and then after incubating the reactions at 37.degree. C.
for 1 hour (Table 3, after reaction). Table 3 shows that there is a
significant pH change for the reaction using the isX006 template,
which is expected to effect incorporation of the dATP at the end of
the isX001 primer. The reaction with no primer shows a small
positive pH change and the reaction with the isX003 primer, which
is not expected to effect incorporation of the dATP into the isX001
primer, shows a small negative pH change. Accordingly, the results
show that a change in pH (e.g., a pH change greater than 0.1) is
indicative of nucleotide incorporation into a growing strand of
DNA.
TABLE-US-00004 TABLE 3 measured pH changes pH Rxn D Rxn E Rxn F
before reaction 6.29 5.94 6.13 after reaction 6.37 5.57 6.03 pH
change +0.08 -0.37 -0.1
[0082] All publications and patents mentioned in the above
specification are herein incorporated by reference in their
entirety for all purposes. Various modifications and variations of
the described compositions, methods, and uses of the technology
will be apparent to those skilled in the art without departing from
the scope and spirit of the technology as described. Although the
technology has been described in connection with specific exemplary
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention that are obvious to those skilled in pharmacology,
biochemistry, medical science, or related fields are intended to be
within the scope of the following claims.
Sequence CWU 1
1
3151DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide5'-5AmMC6 1tttttttttt tttttttttt
agttatgcaa cgcgggagtt gtgtatgaag t 51239DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2tgcatgcaac ttcatacaca actcccgcgt tgcataact
39339DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3gcatgcatac ttcatacaca actcccgcgt
tgcataact 39
* * * * *