U.S. patent application number 15/403653 was filed with the patent office on 2017-09-21 for induced pluripotent stem cells.
The applicant listed for this patent is Regents of the University of Minnesota. Invention is credited to Hiroyuki Hirai, Nobuaki Kikyo.
Application Number | 20170267978 15/403653 |
Document ID | / |
Family ID | 45497190 |
Filed Date | 2017-09-21 |
United States Patent
Application |
20170267978 |
Kind Code |
A1 |
Kikyo; Nobuaki ; et
al. |
September 21, 2017 |
INDUCED PLURIPOTENT STEM CELLS
Abstract
Described herein is a major breakthrough in nuclear
reprogramming and induced pluripotent stem cell (iPSC) technology.
Fusion of the powerful transcription activation domain (TAD) of
MyoD to the Oct4 protein makes iPSCs generation faster, more
efficient, purer, safer and feeder-free. Also, disclosed herein is
the first report of the use of a TAD fused to a transcription
factor as a method for making iPSCs. By combining transcription
factors and TADs, this approach to nuclear reprogramming can have a
range of applications from inducing pluriopotency to inducing
transdifferentiation without transitioning through iPSCs.
Inventors: |
Kikyo; Nobuaki; (Edina,
MN) ; Hirai; Hiroyuki; (Ann Arbor, MI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regents of the University of Minnesota |
Minneapolis |
MN |
US |
|
|
Family ID: |
45497190 |
Appl. No.: |
15/403653 |
Filed: |
January 11, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13811572 |
Apr 5, 2013 |
9580689 |
|
|
PCT/US11/44995 |
Jul 22, 2011 |
|
|
|
15403653 |
|
|
|
|
61390454 |
Oct 6, 2010 |
|
|
|
61366821 |
Jul 22, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2207/12 20130101;
C07K 14/4702 20130101; C12N 2506/1307 20130101; A01K 2227/105
20130101; C12N 5/0696 20130101; C12N 2510/00 20130101; C12N 15/8509
20130101; C12N 2740/15041 20130101; C12N 2501/603 20130101; C07K
2319/71 20130101; C12N 2501/606 20130101; C12N 2501/602 20130101;
C12N 2501/604 20130101 |
International
Class: |
C12N 5/074 20060101
C12N005/074; C07K 14/47 20060101 C07K014/47; C12N 15/85 20060101
C12N015/85 |
Goverment Interests
STATEMENT OF GOVERNMENT RIGHTS
[0002] This invention was made with Government support under United
States Grant No. R01 DK082430-01 awarded by the National Institute
of Diabetes and Digestive and Kidney Diseases, National Institutes
of Health. The government has rights in the invention.
Claims
1. A composition comprising a nucleic acid encoding a fusion
protein comprising a transactivation domain from MyoD or VP16 fused
to the N-terminus or C-terminus of Oct4 operably linked to a
promoter.
2. The composition of claim 1, further comprising at least one
nucleic acid encoding Sox2, Klf4, and optionally c-Myc.
3. The composition of claim 1, wherein the transactivation domain
is obtained from MyoD.
4. The composition of claim 3, wherein the transactivation domain
of MyoD comprises an N-terminus region of MyoD.
5. The composition of claim 4, wherein the transactivation domain
comprising amino acids 1-62 of MyoD or is at least 95% identical
thereto.
6.-19. (canceled)
20. The composition of claim 1, wherein said composition is
contained within a cell.
21. The composition of claim 20, wherein said cell is a mammalian
cell.
22. The composition of claim 21, wherein said mammalian cell is
human.
23. The composition of claim 2, wherein said composition is
contained within a cell.
24. The composition of claim 23, wherein said cell is a mammalian
cell.
25. The composition of claim 24, wherein said mammalian cell is
human.
26. The composition of claim 2, wherein the nucleic acid is
polycistronic.
27. The composition of claim 2, wherein the proteins encoded by
said at least one nucleic acid are human.
28. The composition of claim 2, further comprising a cytokine.
29. The composition of claim 28, wherein the cytokine is basic
fibroblast growth factor and/or stem cell factor.
Description
RELATED APPLICATIONS
[0001] This application is a continuation application and claims
the benefit of priority of U.S. patent application Ser. No.
13/811,572, filed Apr. 5, 2013, which is a national stage
application under 35 U.S.C. .sctn.371 of PCT/US2011/044995, filed
Jul. 22, 2011, and published as WO 2012/012708 on Jan. 26, 2012,
which claims priority from U.S. Provisional Application Ser. Nos.
61/366,821 filed Jul. 22, 2010 and 61/390,454 filed Oct. 6, 2010,
which applications are herein incorporated by reference in their
entirety.
BACKGROUND OF THE INVENTION
[0003] Nuclear reprogramming, the process of converting one cell
type into another by resetting the pattern of gene expression, can
be achieved through forced expression of defined transcription
factors. One example is the induced pluripotent stem cells (iPSCs)
prepared by transducing four genes (e.g., Oct4, Sox2, Kif4 and
c-Myc, called OSKM hereafter) into a cell type to be
dedifferentiated. iPSCs are a type of pluripotent stem cell
artificially derived by reprogramming a somatic cell. iPSCs are
morphologically similar to embryonic stem cells and are capable of
differentiating into a variety of different somatic cell types.
This technology allows researchers to obtain pluripotent stem cells
for use in a research setting. iPSCs also have therapeutic uses for
the treatment of disease without the need for stem cells derived
from an embryonic source.
[0004] However, generally less than 1% of transduced cells are
reprogrammed to form iPSCs, and the entire process of establishing
iPSC clones is long (over a month).
SUMMARY OF THE INVENTION
[0005] Described herein is a novel approach to nuclear
reprogramming using a fusion protein (a protein created through the
joining of two or more genes or portions thereof in any orientation
or copy number (e.g., from about 1 to about 2, about 3, about 4,
about 5 or more copies of genes for example) which originally coded
for separate proteins or portions thereof) of a transcription
activation domain (TAD) of a gene, for example, MyoD and a
transcription factor, for example, Oct4 (such a fusion protein is
designated herein as M.sub.3O) that greatly improves the efficiency
of reprogramming and accelerates iPSC production. iPSC colonies
emerged five days after transduction of Sox2, Klf4 and c-Myc (SKM)
and M.sub.3O into fibroblasts, with colonies rapidly enlarging in
the absence of feeder cells. The pluripotency of iPSCs was
confirmed by genome-wide gene expression analysis, teratoma
formation, and chimera formation, including germline transmission.
Transduction of M.sub.3O and SKM increased chromatin accessibility
at the Oct4 promoter, facilitated recruitment of the Oct4-binding
Paf1 complex, and remodeled many histone modifications at
pluripotency genes to an embryonic stem cell (ESC)-like state more
efficiently than transduction of OSKM. Thus, discussed herein is a
novel approach to nuclear reprogramming in which a wide variety of
TADs can be combined with related or unrelated transcription
factors to reprogram the pattern of gene expression, with
applications ranging from induction of pluripotency to direct
transdifferentiation.
[0006] One embodiment provides iPSCs derived by nuclear
reprogramming of a somatic cell with a fusion protein. The somatic
cell can be a mammalian cell, for example a mouse cell or a human
cell. One embodiment provides a fusion protein for induction of
pluripotent stem cells. Another embodiment provides such a
pluripotent stem cell, wherein the reprogramming comprises
contacting the somatic cell with a fusion protein or DNA encoding
the fusion protein. The disclosed methods and fusion proteins can
be used to conveniently and reproducibly establish iPSCs having
pluripotency and growth ability similar to that of ES cells
(ESCs).
[0007] One embodiment provides a method for preparing an induced
pluripotent stem cell by nuclear reprogramming of a somatic cell.
which comprises introducing a nucleic acid sequence, by methods
available to one of skill in the art, coding for a fusion protein
of an unrelated/heterologous transactivation domain and a
transcription factor into the somatic cell. One embodiment provides
an induced pluripotent stem cell obtained by such a method. The
fusion protein can be the fusion of an unrelated/heterologous
transactivation domain and a transcription factor (e.g., the TAD is
not normally associated with the transcription factor), such as the
transactivation domain of MyoD (sequence information for MyoD is
provided, for example, at NM_002478.4; NM_010866.2; NP_002469.2;
NP_034996.2) or VP16 fused with Oct4 (full length or a bioactive
fragment thereof; octamer-binding transcription factor 4 also known
as POU5F1 (POU domain, class 5, transcription factor 1); sequence
includes, for example, NM_002701; NM_013633.2; NP_002692;
NP_038661.2; NM_001009178; NP_001009178; NM_131112; NP_571187).
Additional trans-activating domains can include, for example, but
are not limited to, those found in p53, VP16, MLL, E2A, HSF1,
NF-IL6, NFAT1 and NF-.kappa.B.
[0008] Additional factors to be introduced into the cell, and/or
used to generate a fusion protein with a transactivation domain,
can include, but is not limited to, a gene from the Sox family
(e.g., SOX genes encode a family of transcription factors that bind
to the minor groove in DNA, and belong to a super-family of genes
characterized by a homologous sequence called the HMG (high
mobility group) box and include, but are not limited to, SoxA, SRY
(e.g., NM_003140.1; NM_011564; NP_003131.1; NP_035694), SoxB1, Sox1
(e.g., NM_005986), Sox2 (e.g., NM_003106; NM_011443; NP_003097;
NP_035573). Sox3 (e.g., NM_005634; XM_988206; NP_005625;
XP_993300), SoxB2, Sox14 (e.g., NM_004189; XM_284529; NP_004180;
XP_284529), Sox21 (e.g., NM_007084; XM_979432; NP_009015;
XP_984526), SoxC, Sox4 (e.g., NM_003107; NM_009238; NP_003098;
NP_033264), Sox11 (e.g., XM_001128542; NM_009234; XP_001128542;
NP_033260), Sox12 (e.g., NM_006943; XM_973626: NP_008874;
XP_978720). SoxD, Sox5 (e.g., NM_006940; NM_011444; NP_008871;
NP_035574), Sox6 (e.g., NM_017508; NM_001025560; NP_059978;
NP_001020731), Sox13 (e.g., NM_005686; NM_011439; NP_005677;
NP_035569), SoxE, Sox8 (e.g., NM_014587; NM_011447; NP_055402;
NP_035577), Sox9 (e.g., NM_000346; NM_011448; NP_000337;
NP_035578), Sox10 (e.g., NM_006941; XM_001001494; NP_008872;
XP_001001494), SoxF, Sox7, Sox17, Sox18 (e.g., NM_018419;
NM_009236; NP_060889; NP_033262), SoxG, Sox15 (e.g., NM_006942;
NM_009235; NP_008873; NP_033261), SoxH, Sox30), the Klf
(Krueppel-like factor) family (e.g., KLF1 (e.g., NM_006563), KLF2
(e.g., NM_016270; XM_982078; NP_057354; XP_987172), KLF3 (e.g.,
NM_016531; XM_994052; NP_057615; XP_999146), KLF4 (e.g., NM_004235;
NM_010637; NP_004226; NP_034767), KLF5 (e.g., NM_001730; NM_009769;
NP_001721; NP_033899), KLF6 (e.g., NM_001008490; NM_011803;
NP_001008490; NP_035933), KLF7 (e.g., NM_003709; XM_992457;
NP_003700; XP_997551), KLF8 (e.g., NM_007250; NM_173780; NP_009181;
NP_776141), KLF9 (e.g., NM_001206; XM_988516; NP_001197;
XP_993610), KLF10 (e.g., NM_001032282; NM_013692; NP_001027453;
NP_038720), KLF11 (e.g., XM_001129527; NM_178357; XP_001129527:
NP_848134), KLF12 (e.g., NM_016285; NM_010636; NP_057369;
NP_034766), KLF13 (e.g., NM_015995; NM_021366; NP_057079;
NP_067341). KLF14 (e.g., NM_138693; NM_001135093; NP_619638;
NP_001128565), KLF15 (e.g., NM_014079; NM_023184; NP_054798;
NP_075673), KLF16, KLF17 (e.g., NM_173484.3; NM_029416.2;
NP_775755.3; NP_083692.2)), the Myc family (e.g., c-Myc (e.g.,
NM_002467.4; NM_010849; NP_002458.2; NP_034979)), nanog (e.g.,
NM_024865.2; NM_028016.2; NP_079141.2; NP_082292.1), Lin28 (e.g.,
NM_024674; NM_145833; NP_078950: NP_665832) or a combination
thereof. Additionally, the cell can also be contacted with a
cytokine, such as basic fibroblast growth factor (bFGF) and/or stem
cell factor (SCF). In one embodiment, the somatic cell is further
contacted with a DNA demethylation reagent.
[0009] One embodiment provides a somatic cell derived by inducing
differentiation of an induced pluripotent stem cell as disclosed
herein. One embodiment also provides a method for stem cell therapy
comprising: (1) isolating and collecting a somatic cell from a
subject; (2) inducing said somatic cell from the subject into an
iPSC (3) inducing differentiation of said iPSCs, and (4)
transplanting the differentiated cell from (3) into the subject
(e.g., a mammal, such as a human).
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIGS. 1A, 1B, 1C, 1D, 1E, 1F, 1G and 1H. Establishment of
mouse iPSCs with M.sub.3O-SKM. (A) Schematic drawing of MyoD-Oct4
chimeric constructs. Numbers indicate amino acid positions
delimiting MyoD fragments. The basic helix-loop-helix (bHLH) domain
of MyoD corresponds to amino acids 108-167, which was not used in
these chimeric constructs. EO indicates a polypeptide consisting of
one methionine and a chain of 20 glutamic acids fused to Oct4 (E
for glutamic acid). Right column shows percentage of GFP-positive
colonies derived from mouse embryonic fibroblasts (MEFs) transduced
with each MyoD-Oct4 chimeric construct along with SKM and cultured
on feeder cells (FIG. 1B, Protocol A). Data represent the
mean.+-.SEM from three independent experiments. (B) Schematic
drawings of two protocols for iPSC creation. Whereas transduced
MEFs were transferred onto feeder cells on day 4 in Protocol A,
MEFs were maintained feeder-free until the end of experiments in
Protocol B. (C) Emergence of GFP-positive colonies obtained with
M.sub.3O-SKM with Protocol B. Bar, 200 .mu.m. (D) Summary of the
efficiency of making GFP-positive colonies with various
combinations of the M.sub.3O, Sox2, Klf4, and c-Myc genes with
Protocol B. Number of GFP-positive colonies peaked by day 14. (E)
Drawings of various combinations of the M.sub.3 domain and Oct4.
The efficiency of making GFP-positive colonies with Protocol B in
the presence of SKM is shown on the right. (F) Drawings of TAD
replacement constructs in which TADs of Oct4 were replaced with the
M.sub.3 domain. Constructs were transduced with SKM. (G) Drawings
of fusion constructs between the M.sub.3 domain and Sox2 or Klf4.
Sox2 mutants were transduced with OKM or M.sub.3O-KM. The Klf4
mutant was transduced with OSM or M.sub.3O-SM. (H) Drawings of
fusion constructs between Oct4 and TADs taken from other
transactivators. Constructs were transduced with SKM.
[0011] FIGS. 2A, 2B and 2C. Characterization of mouse iPSCs
prepared with M.sub.3O-SKM (M.sub.3O-iPSCs). (A) Comparison of
GFP-positivity between colonies obtained with M.sub.3O-SKM and OSKM
using Protocol B. Representative images of the GFP expression
patterns used to categorize colonies are shown (top). Percentages
of colonies with different GFP expression patterns were calculated
from 300 colonies for M.sub.3O-SKM and OSKM (bottom). Bar, 200
.mu.m. (B) qRT-PCR analysis of expression levels of three
pluripotency genes in MEFs and GFP-positive colonies obtained with
M.sub.3O-SKM and OSKM. PCR primers specific to endogenous Oct4 and
Sox2 were used for these two genes. Although GFP-positive colonies
were harvested on different days based on the time when the GFP
signal first emerged for M.sub.3O-SKM (day 5) and OSKM (day 10),
the intervals between time points is equivalent (bottom of graphs).
Expression level of each gene in ESCs (CGR8.8 cells) was defined as
1.0. Five colonies were examined for each condition. Results
represent the mean+SEM of three independent experiments. (C)
qRT-PCR analysis of expression levels of three fibroblast-enriched
genes in MEFs and GFP-positive colonies obtained with M.sub.3O-SKM
and OSKM.
[0012] FIGS. 3A, 3B, 3C, 3D, 3E and 3F. Verification of
pluripotency of mouse M.sub.3O-iPSCs. (A) Expression level of
transcripts in M.sub.3O-iPSCs and ESCs relative to MEFs. Log 2
ratios are plotted for transcripts in ESCs/MEFs and iPSCs/MEFs. Red
lines indicate a 4-fold difference in transcript levels.
Transcripts in M.sub.3O-iPSCs were assayed 60 days after
transduction. (B) Hematoxylin and eosin staining of teratoma
sections derived from M.sub.3O-iPSCs. Neural tube and epidermis
(ectoderm), striated muscle and bone (mesoderm), and mucous gland
and respiratory epithelium (endoderm) are shown. Bar, 50 .mu.m. (C)
X gal staining for cells expressing the lacZ gene in a chimeric
embryo prepared with M.sub.3O-iPSCs and a control embryo at 13.5
dpc. (D) Chimeric mice prepared with M.sub.3O-iPSCs. The agouti
coat color indicates a high (right) and low (left) contribution of
iPSCs to the skin. The host embryos used to generate mice were
derived from the albino mouse strain ICR. (E) Germline contribution
of M.sub.3O-iPSCs as shown by GFP expression in the gonad of a 13.5
dpc chimeric embryo. (F) Pups obtained from crossing a wild-type
ICR female (bottom) with an M.sub.3O-iPSC chimeric male (left mouse
in panel D).
[0013] FIGS. 4A, 4B, 4C, 4D, 4E and 4F. Characterization of human
iPSCs established with M.sub.3O-SKM. (A) Immunofluorescence
staining of NANOG and SSEA4 in human iPSC colonies on day 8 and 15
obtained with M.sub.3O-SKM without subculture after day 3 when
transferred onto Matrigel. Bar, 100 .mu.m for (A) and (B). Note
that day 15 colonies are substantially larger than day 8 colonies
as indicated by the different magnifications. (B) Comparison of the
efficiency of making NANOG-positive colonies between M.sub.3O-SKM
and OSKM. The number of NANOG-positive colonies was divided by the
number of seeded dermal fibroblasts at each time point. (C)
Immunofluorescence staining of pluripotency markers in cloned human
iPSCs obtained with M.sub.3O-SKM on day 28 after four passages. (D)
Quantitative RT-PCR analysis of pluripotency genes expressed in
cloned human iPSCs prepared with M.sub.3O-SKM. Ten colonies were
harvested on day 30 and the mean+SEM was obtained. The expression
level of each gene in human ESCs H9 was defined as 1.0. Endogenous
genes were amplified for OCT4, SOX2. KLF4 and c-MYC. (E) Karyotype
analysis of a human iPSC established with M.sub.3O-SKM. (F)
Hematoxylin and eosin staining of teratoma sections derived from
human iPSCs prepared with M.sub.3O-SKM. Bar, 100 .mu.m.
[0014] FIGS. 5A, 5B, 5C, 5D, 5E and 5F. Chromatin analyses of the
Oct4 gene in MEFs transduced with M.sub.3O-SKM (M.sub.3O-MEFs) and
those with OSKM (O-MEFs). (A) DNA methylation patterns at the
proximal promoter of the Oct4 gene analyzed with bisulfite
sequencing. Black circles indicate methylated CpG and open circles,
unmethylated CpG. The proportion of unmethylated CpG sites was
calculated by dividing the number of unmethylated CpG sites by the
total number of CpG sites in each cell type. (B) Flow cytometry of
O-MEFs and M.sub.3O-MEFs prepared with Protocol B and harvested on
day 9. (C) ChIP analyses of the binding levels of Oct4, Sox2, and
the Paf1 complex subunits at the distal enhancer (Region 1) and
initiation site (Region 2) of the Oct4 gene in M.sub.3O-MEFs and
0-MEFs. Data represent the mean+SEM of three independent
experiments. All y axes indicate relative enrichment (fold).
Relative enrichment in ESCs was defined as 1.0. ESCs and MEFs were
mixed at a 13:87 ratio in the sample labeled as ESCs+MEFs (blue).
The difference of the values between the two samples indicated by
an asterisk was statistically significant (p<0.01). (D) Analyses
of the accessibility of the restriction enzyme NsiI to chromatin at
the distal enhancer of the Oct4 gene by Southern blotting.
Locations of the enzyme recognition site and probe are shown in
relation to the distal enhancer of the Oct4 gene (top). The
transcription initiation site was defined as position 1. Appearance
of new DNA fragments following digestion with NsiI are shown
(bottom). Percentage of digested chromatin was obtained by dividing
the combined signal intensity of the bands at 752 and 652 bp by the
combined signal intensity of the two bands and the band at 1404 bp.
Cloned O-iPSCs and M.sub.3O-iPSCs were used for day 30 lanes.
GFP-negative population was collected by a FACS and analyzed for
the day 9 GFP (-) lane of M.sub.3O-MEFs (far right). (E) ChIP
analyses of the levels of three histone modifications associated
with active genes at the initiation site (Region 2) and a coding
region (Region 3) of the Oct4 gene. (F) ChIP analyses of the levels
of two histone modifications associated with inactive genes at a
coding region of the Oct4 gene (Region 3). Relative enrichment in
MEFs was defined as 1.0.
[0015] FIGS. 6A, 6B, 6C, 6D and 6E. Effects of M.sub.3O-SKM and
OSKM on expression of pluripotency markers and cell proliferation.
(A) Temporal profiles of expression patterns of alkaline
phosphatase. Bar, 100 .mu.m. (B) Temporal profiles of expression
patterns of SSEA1. Bar, 100 .mu.m. (C) Flow cytometry comparing the
expression level of SSEA1 between MEFs transduced with OSKM and
those transduced with M.sub.3O-SKM. (D) Cell proliferation patterns
of MEFs transduced with M.sub.3O or Oct4. Means+SEM of three
independent experiments are shown. (E) Cell proliferation patterns
of MEFs transduced with M.sub.3O-SKM or OSKM.
[0016] FIGS. 7A, 7B, 7C, 7D, 7E and 7F. Chromatin analyses of day 9
at the Oct4 gene comparing transduction of MEFs with different gene
combinations. (A) Flow cytometry of MEFs transduced with
M.sub.3O-SK and OSK. (B) DNA methylation analysis by bisulfite
sequencing. MEFs were transduced with one (1F), two (2F), or three
(3F) transcription factor genes. (C) ChIP studies on transcription
factor binding at the distal enhancer. (D) Chip analyses on histone
modifications associated with active genes. (E) ChIP studies on
histone modifications associated with suppressed genes. (F)
Hypothetical summary of epigenetic remodeling induced by
M.sub.3O-SKM (right) in comparison to the lack of remodeling with
OSKM (left). Binding sites for Oct4 and Sox2 are located adjacent
to each other at the distal enhancer of Oct4.sup.1. Transduced Oct4
and Sox2 cannot bind to their respective binding sites (blue box
and gray box, respectively) in the majority of O-MEFs due to
condensed chromatin. In contrast, M.sub.3O and Sox2 can effectively
bind to each binding site in M.sub.3O-MEFs through the effects of
the unidentified binding proteins to the MyoD TAD domain.
Recruitment of these proteins eventually contributes to DNA
demethylation at the proximal promoter and a histone modification
pattern typical of active genes at the coding region.
[0017] FIG. 8. Immunoblotting of MyoD-Oct4 fusion proteins.
Expression of transduced MyoD-Oct4 fusion genes was evaluated with
an antibody against Oct4 (top). Expression of histone H2A was
examined as a loading control (bottom). Bands correspond to the
predicted molecular mass of each protein. Identities of extra bands
marked with asterisks are unknown.
[0018] FIGS. 9A, 9B and 9C. Chip analyses of the Sox2 gene. (A)
Binding of Oct4 and Sox2 at the enhancer. (B) Binding of
parafibromin and the levels of histone modifications associated
with active genes on day 9. (C) Levels of histone modifications
associated with suppressive genes on day 9.
[0019] FIGS. 10A and 10B. ChIP analyses on day 9 of the Oct4 gene
comparing transduction of one (1F), two (2F), three (3F) and four
(4F) transcription factor genes. (A) Transcription factor binding.
(B) Histone modifications associated with gene activation.
[0020] FIGS. 11A and 11B. ChIP analyses on day 9 of the Sox2 gene
comparing transduction of one (1F), two (2F), three (3F) and four
(4F) transcription factor genes. (A) Transcription factor binding
at the enhancer. (B) Histone modifications associated with gene
activation and suppression.
DETAILED DESCRIPTION OF THE INVENTION
[0021] iPSC technology is the process of converting an adult
specialized cell, such as a skin cell, into a stem cell, a process
known as dedifferentiation. iPSCs can be very useful in clinical as
well as preclinical settings. For example, iPSCs can be created
from human patients and differentiated into many tissues to provide
new materials for autologous transplantation, which can avoid
immune rejection of the transplanted tissues. For example,
pancreatic beta cells differentiated from a patient's iPSCs can be
transplanted into the original patient to treat diabetes. Also,
iPSCs derived from a patient can be differentiated into the ailing
tissue to be used in an in vitro disease model. For example, study
of dopaninergic neurons differentiated from a Parkinson's disease
patient can provide unprecedented clues for the pathogenesis of the
disease. In vitro-differentiated cells derived from iPSCs can be
used for drug screening. For instance, many drugs are metabolized
in the liver, but there have been no ideal liver cells that can be
cultured for a long term for in vitro screening of drug toxicity.
Also, iPSCs provide a new opportunity to understand the mechanisms
underlying the plasticity of cell differentiation. Thus, the
potential of iPSCs for many fields of life science is
tremendous.
[0022] However, the process of generating iPSCs is slow and
inefficient. With the standard protocol, MEFs are transduced with
OSKM on day 1 and the cells are transferred onto feeder cells
composed of irradiated fibroblasts, which provide a poorly
characterized, but optimal environment for the generation of iPSCs,
on day 5. iPSC colonies emerge around day 10, which are then picked
up and expanded over the next two to three weeks on feeder cells to
establish purified iPSC lines. Eventually, only 0.1% of the
transduced fibroblasts turn into iPSCs. This slow process and
extremely low efficiency make production of iPSCs costly.
[0023] It is disclosed herein that a fusion protein combining, for
example, the stem cell factor Oct4 (a homeodomain transcription
factor associated with undifferentiated cells) with a portion of
another protein factor, for example, a transactivation domain, such
as that of MyoD, can accelerate the process of making iPSCs. It is
also shown herein that heterologous transactivation domains,
including the MyoD TAD, promote global chromatin remodeling of stem
cell genes. Thus, the process disclosed herein improves the
efficiency and quality of iPSCs.
Definitions
[0024] As used herein, the terms below are defined by the following
meanings:
[0025] Induced pluripotent stem cells, commonly abbreviated as
iPSCs, are a type of pluripotent stem cell obtained from a
non-pluripotent cell, typically an adult somatic cell (a cell of
the body, rather than gametes or an embryo), by inducing a "forced"
expression of certain genes. iPSCs are believed to be similar to
natural pluripotent stem cells, such as ESCs in many respects, such
as the expression of certain stem cell genes and proteins,
chromatin methylation patterns, doubling time, embryoid body
formation, teratoma formation, viable chimera formation, and
potency and differentiability.
[0026] iPSCs are not adult stem cells, but rather reprogrammed
cells (e.g., epithelial cells) given pluripotent capabilities.
Using genetic reprogramming with protein transcription factors,
pluripotent stem cells equivalent to embryonic stem cells have been
derived from human adult skin tissue. Shinya Yamanaka and his
colleagues at Kyoto University used the transcription factors
Oct3/4, Sox2, c-Myc, and Klf4 in their experiments on cells from
humans. Junying Yu, James Thomson, and their colleagues at the
University of Wisconsin-Madison used a different set of factors,
Oct4, Sox2, Nanog and Lin28, and carried out their experiments
using cells from human foreskin to generate iPS cells.
[0027] The term "isolated" refers to a factor(s), cell or cells
which are not associated with one or more factors, cells or one or
more cellular components that are associated with the factor(s),
cell or cells in vivo.
[0028] "Cells" include cells from, or the "subject" is, a
vertebrate, such as a mammal, including a human. Mammals include,
but are not limited to, humans, farm animals, sport animals and
companion animals. Included in the term "animal" is dog, cat, fish,
gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey
(e.g., ape, gorilla, chimpanzee, orangutan), rat, sheep, goat, cow
and bird.
[0029] An "effective amount" generally means an amount which
provides the desired local or systemic effect and/or
performance.
[0030] "Pluripotency" refers to a stem cell that has the potential
to differentiate into one, two or three of the three germ layers:
endoderm (e.g., interior stomach lining, gastrointestinal tract,
the lungs), mesoderm (e.g., muscle, bone, blood, urogenital), or
ectoderm (e.g., epidermal tissues and nervous system). Pluripotent
stem cells can give rise to any fetal or adult cell type.
[0031] "Transdifferentiation" is when a non-stem cell transforms
into a different type of cell, or when an already differentiated
stem cell creates cells outside its already established
differentiation path.
[0032] A "transcription factor" (sometimes called a
sequence-specific DNA-binding factor) is a protein that binds to
specific DNA sequences, thereby controlling the transfer (or
transcription) of genetic information from DNA to mRNA.
Transcription factors perform this function alone or with other
proteins or factors in a complex, by promoting (as an activator),
or blocking (as a repressor) the recruitment of RNA polymerase (the
enzyme that performs the transcription of genetic information from
DNA to RNA) to specific genes. Generally, a defining feature of
transcription factors is that they contain one or more DNA-binding
domains (DBDs), which attach to specific sequences of DNA adjacent
to the genes that they regulate.
[0033] A "transcription activation domain," "transactivation
domain" or "trans-activating domain" is generally that portion of a
transcription factor that is responsible for recruitment of the
transcription machinery needed to transcribe RNA. Transactivation
is an increased rate of gene expression triggered either by
biological processes or by artificial means. Transactivation can be
triggered either by endogenous cellular or viral
proteins--transactivators. These protein factors act in trans
(i.e., intermolecularly). An "unrelated" or "heterologous
transactivation domain" refers to a transactivation domain that is
not normally associated with the gene/protein (e.g., transcription
factor) of interest (not wild-type).
[0034] By "pure" it is meant that the population of cells has the
desired purity. For example, iPSC populations can comprise mixed
populations of cells. Those skilled in the art can readily
determine the percentage of iPSCs in a population using various
well-known methods, such as fluorescence activated cell sorting
(FACS). Preferable ranges of purity in populations comprising iPSCs
are about 1 to about 5%, about 5 to about 10%, about 10 to about
15%, about 15 to about 20%, about 20 to about 25%, about 25 to
about 30%, about 30 to about 35%, about 35 to about 40%, about 40
to about 45%, about 45 to about 50%, about 50 to about 55%, about
55 to about 60%, about 60 to about 65%, about 65 to about 70%,
about 70 to about 75%, about 75 to about 80%, about 80 to about
85%, about 85 to about 90%, about 90% to about 95% or about 95 to
about 100%. Purity of the cells can be determined for example
according to the cell surface marker profile within a
population.
[0035] The terms "comprises." "comprising," and the like can have
the meaning ascribed to them in U.S. Patent Law and can mean
"includes," "including" and the like. As used herein, "including"
or "includes" or the like means including, without limitation.
Rapid and Efficient Production of iPSCs
[0036] Through the processes disclosed herein, iPSC colonies emerge
as early as about five days (day 5) after transduction of a
transactivator domain (or a portion thereof) fused to a
transcription factor (or a portion thereof), e.g., M.sub.3O (short
transactivation domain of MyoD (about 50 to 60 amino acids) fused
to the amino terminus of the full-length Oct4), Sox2, Klf4, and
c-Myc without feeder cells. The preparation of the nucleic acid
molecule coding for the fusion protein(s) as well as the
construct(s) of Sox, Klf, c-Myc etc. (either singly or on a
polycistronic RNA) can be carried out by methods available to an
art worker as well as the transduction thereof into cells (see, for
example, Sambrook, Molecular Cloning: A Laboratory Manual).
[0037] iPSCs established with the standard OSKM protocol frequently
contain partially reprogrammed cells and even established iPSCs
occasionally lose pluripotency during prolonged cultures. In
contrast, the iPSCs disclosed herein retain pluripotency more
tightly and heterogeneity among different colonies is much less
apparent than that with the OSKM iPSCs. In addition, iPSC colonies
can be obtained without c-Myc (use only M.sub.3O, Sox2 and Klf4) at
the efficiency of 0.44% around day 7. iPSCs have been prepared
without c-Myc (use OSK) before, but the efficiency was low
(<0.01%) and it generally took 30 to 40 days for iPSCs to
emerge.sup.2,3. Additionally, this transactivation domain-based
strategy can be applied to amplify the effects of other
transcription factors to facilitate their reprogramming capability
of cell differentiation. In summary, the use of a TAD, such as the
M.sub.3 domain, has made iPSC production faster, easier,
feeder-free and more efficient than the standard OSKM or other
protocols.
[0038] Thus, as discussed above, the fusion technology, such as the
M.sub.3O, technology disclosed herein has significant advantages
over wild-type Oct4 (or other transcription factors) in generating
iPSCs. First, the fusion technology is faster. While iPSC colonies
appear at about day 10 with the standard OSKM protocol (see, Cell
Stem Cell 2008, 3, 595 for a general protocol for making iPSCs),
iPSC colonies emerge on day 5 with the fusion technology (e.g.,
M.sub.3O-SKM). Second, efficiency of making iPSCs is more than
50-fold higher with the fusions technology (e.g., M.sub.3O-SKM)
than that with OSKM. Third, purer iPSCs populations can be obtained
with the fusions technology described herein (e.g., M.sub.3O-SKM)
compared with OSKM. Fourth, the fusion technology described herein
(e.g., M.sub.3O-SKM) does not require feeder cells unlike OSKM.
This is noted especially for making iPSCs for transplantation
purposes because one would generally need to use patient-derived
fibroblasts as feeder cells to avoid immune rejection. Also, the
use of feeder cells adds an extra step to make iPSCs. Feeder-free
iPSCs have been reported, but they are derived from already
undifferentiated cells, such as adipose stem cells. Fibroblasts
generally require feeder cells to become iPSCs. Finally, iPSCs can
be prepared using only M.sub.3O, Sox2 and Klf4 (without c-Myc).
[0039] Generally, genes which can be used to create induced
pluripotent stem cells, either singly, in combination or as fusions
with transactivation domains, include, but are not limited to, one
or more of the following: Oct4 (Oct3/4, Pou5f1), Sox (e.g., Sox1,
Sox2, Sox3, Sox18, or Sox15), Klf (e.g., Klf4, Klf1, Klf3, Klf2 or
Klf5), Myc (e.g., c-myc, N-myc or L-myc), nanog, or LIN28. As
examples of sequences for these genes and proteins, the following
accession numbers are provided: Mouse MyoD: M84918, NM_010866;
Mouse Oct4 (POU5F1): NM_013633; Mouse Sox2: NM_011443; Mouse Klf4:
NM_010637; Mouse c-Myc: NM_001177352, NM_001177353, NM_001177354
Mouse Nanog: NM_028016; Mouse Lin28: NM_145833: Human MyoD:
NM_002478; Human Oct4 (POU5F1): NM_002701, NM_203289, NM_001173531;
Human Sox2: NM_003106; Human Klf4: NM_004235; Human c-Myc:
NM_002467; Human Nanog: NM_024865; and/or Human Lin28: NM_024674,
for portions or fragments thereof and/or any related sequence
available to an art worker (these sequences are incorporated by
referenced herein). For example, sequences for use in the invention
have at least about 50% or about 60% or about 70%, about 71%, about
72%, about 73%, about 74%, about 75%, about 76%, about 77%, about
78%, or about 79%, or at least about 80%, about 81%, about 82%,
about 83%, about 84%, about 85%, about 86%, about 87%, about 88%,
or about 89%, or at least about 90%, about 91%, about 92%, about
93%, or about 94%, or at least about 95%, about 96%, about 97%,
about 98%, or about 99% sequence identity compared to the sequences
and/or accession numbers provided herein and/or any other such
sequence available to an art worker, using one of alignment
programs available in the art using standard parameters or
hybridization techniques. In one embodiment, the differences in
sequence are due to conservative amino acid changes. In another
embodiment, the protein sequence or DNA sequence has at least 80%
sequence identity with the sequences disclosed herein and is
bioactive (e.g., retains activity).
[0040] Methods of alignment of sequences for comparison are
available in the art. Thus, the determination of percent identity
between any two sequences can be accomplished using a mathematical
algorithm. Computer implementations of these mathematical
algorithms can be utilized for comparison of sequences to determine
sequence identity. Such implementations include, but are not
limited to: CLUSTAL in the PC/Gene program (available from
Intelligenetics, Mountain View, Calif.); the ALIGN program (Version
2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Version 8 (available from Genetics
Computer Group (GCG), 575 Science Drive. Madison, Wis., USA).
Alignments using these programs can be performed using the default
parameters.
[0041] During and after preparation of iPSCs, the cells can be
cultured in culture medium that is established in the art and
commercially available from the American Type Culture Collection
(ATCC), Invitrogen and other companies. Such media include, but are
not limited to, Dulbecco's Modified Eagle's Medium (DMEM), DMEM F12
medium, Eagle's Minimum Essential Medium, F-12K medium, Iscove's
Modified Dulbecco's Medium, Knockout DMEM, or RPMI-1640 medium. It
is within the skill of one in the art to modify or modulate
concentrations of media and/or media supplements as needed for the
cells used. It will also be apparent that many media are available
as low-glucose formulations, with or without sodium pyruvate.
[0042] Also contemplated is supplementation of cell culture medium
with mammalian sera. Sera often contain cellular factors and
components that are needed for viability and expansion. Examples of
sera include fetal bovine serum (FBS), bovine serum (BS), calf
serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat
serum (GS), horse serum (HS), human serum, chicken serum, porcine
serum, sheep serum, rabbit serum, rat serum (RS), serum
replacements (including, but not limited to, KnockOut Serum
Replacement (KSR, Invitrogen)), and bovine embryonic fluid. It is
understood that sera can be heat-inactivated at 55-65.degree. C. if
deemed needed to inactivate components of the complement cascade.
Modulation of serum concentrations, or withdrawal of serum from the
culture medium can also be used to promote survival of one or more
desired cell types. In one embodiment, the cells are cultured in
the presence of FBS/or serum specific for the species cell type.
For example, cells can be isolated and/or expanded with total serum
(e.g., FBS) or serum replacement concentrations of about 0.5% to
about 5% or greater including about 5% to about 15% or greater,
such as about 20%, about 25% or about 30%. Concentrations of serum
can be determined empirically.
[0043] Additional supplements can also be used to supply the cells
with trace elements for optimal growth and expansion. Such
supplements include insulin, transferrin, sodium selenium, and
combinations thereof. These components can be included in a salt
solution such as, but not limited to, Hanks' Balanced Salt
Solution.TM. (HBSS), Earle's Salt Solution.TM., antioxidant
supplements, MCDB-201.TM. supplements, phosphate buffered saline
(PBS), N-2-hydroxyethylpiperazine-N'-ethanesulfonic acid (HEPES),
nicotinamide, ascorbic acid and/or ascorbic acid-2-phosphate, as
well as additional amino acids. Many cell culture media already
contain amino acids; however some require supplementation prior to
culturing cells. Such amino acids include, but are not limited to,
L-alanine, L-arginine. L-aspartic acid. L-asparagine, L-cysteine,
L-cysteine, L-glutamic acid, L-glutamine, L-glycine, L-histidine,
L-inositol, L-isoleucine. L-leucine, L-lysine. L-methionine,
L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan,
L-tyrosine, and L-valine.
[0044] Antibiotics are also typically used in cell culture to
mitigate bacterial, mycoplasmal, and fungal contamination.
Typically, antibiotics or anti-mycotic compounds used are mixtures
of penicillin/streptomycin, but can also include, but are not
limited to, amphotericin (Fungizone.TM.), ampicillin, gentamicin,
bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid,
nalidixic acid, neomycin, nystatin, paromomycin, polymyxin,
puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and
zeocin.
[0045] Hormones can also be advantageously used in cell culture and
include, but are not limited to, D-aldosterone, diethylstilbestrol
(DES), dexamethasone, .beta.-estradiol, hydrocortisone, insulin,
prolactin, progesterone, somatostatin/human growth hormone (HGH),
thyrotropin, thyroxine, and L-thyronine. .beta.-mercaptoethanol can
also be supplemented in cell culture media.
[0046] Lipids and lipid carriers can also be used to supplement
cell culture media, depending on the type of cell and the fate of
the differentiated cell. Such lipids and carriers can include, but
are not limited to cyclodextrin (.alpha., .beta., .gamma.),
cholesterol, linoleic acid conjugated to albumin, linoleic acid and
oleic acid conjugated to albumin, unconjugated linoleic acid,
linoleic-oleic-arachidonic acid conjugated to albumin, oleic acid
unconjugated and conjugated to albumin, among others. Albumin can
similarly be used in fatty-acid free formulation.
[0047] Cells in culture can be maintained either in suspension or
attached to a solid support, such as extracellular matrix
components and synthetic or biopolymers. Cells often require
additional factors that encourage their attachment to a solid
support (e.g., attachment factors) such as type I, type II, and
type IV collagen, concanavalin A, chondroitin sulfate, fibronectin,
"superfibronectin" and/or fibronectin-like polymers, gelatin,
laminin, poly-D and poly-L-lysine, Matrigel.TM., thrombospondin,
and/or vitronectin.
[0048] Cells can be cultured at different densities, e.g., cells
can be seeded or maintained in the culture dish at different
densities. For example, for cells to be dedifferentiated or iPSCs,
the cells can be seeded or maintained at low or high cell
densities. For example, at densities, including, but not limited
to, densities of less than about 2000 cells/well of a 12-well plate
(for example, 12-well flat-bottom growth area: 3.8 cm.sup.2 well
volume: 6.0 ml or well ID.times.depth (mm) 22.1.times.17.5, well
capacity (ml) 6.5, growth area (cm.sup.2) 3.8), including less than
about 1500 cells/well of a 12-well plate, less than about 1,000
cells/well of a 12-well plate, less than about 500 cells/well of a
12-well plate, or less than about 200 cells/well of a 12-well
plate. The cells can also be seeded or maintained at higher
densities, for example, great than about 2,000 cells/well of a
12-well plate, greater than about 2,500 cells/well of a 12-well
plate, greater than about 3,000 cells/well of a 12-well plate,
greater than about 3,500 cells/well of a 12-well plate, greater
than about 4,000 cells/well of a 12-well plate, greater than about
4,500 cells/well of a 12-well plate, greater than about 5,000
cells/well of a 12-well plate, greater than about 5,500 cells/well
of a 12-well plate, greater than about 6,000 cells/well of a
12-well plate, greater than about 6,500 cells/well of a 12-well
plate, greater than about 7,000 cells/well of a 12-well plate,
greater than about 7,500 cells/well of a 12-well plate or greater
than about 8,000 cells/well of a 12-well plate.
[0049] The maintenance conditions of cells cultures can also
contain cellular factors that allow cells, such as the iPSCs of the
invention, to remain in an undifferentiated form. It may be
advantageous under conditions where the cell must remain in an
undifferentiated state of self-renewal for the medium to contain
epidermal growth factor (EGF), platelet derived growth factor
(PDGF), leukemia inhibitory factor (LIF), basic fibroblast growth
factor (bFGF) and combinations thereof. It is apparent to those
skilled in the art that supplements that allow the cell to
self-renew (e.g., to produce replicate daughter cells having
differentiation potential that is identical to those from which
they arose; a similar term used in this context is
"proliferation"), but not differentiate should be removed from the
culture medium prior to differentiation. It is also apparent that
not all cells will require these factors.
EXAMPLES
[0050] The following examples are provided in order to demonstrate
and further illustrate certain embodiments and aspects of the
present invention and are not to be construed as limiting the scope
thereof.
Example 1
Materials and Methods
Preparation of Mouse IPSCs
[0051] Full-length and deletion mutants of mouse Oct4 cDNA were
fused with various TADs and inserted into the pMXs-IP vector.sup.4.
Polycistronic cDNAs encoding Sox2, Klf4 and c-Myc were transferred
from the 4F2A lentiviral vector.sup.5 to the pMXs-IP vector,
pMXs-IP vectors encoding OSKM separately (Addgene) were also used
in some experiments. These pMXs-IP vectors were transfected into
Plat-E cells.sup.6 with Fugene 6 (Roche). Virus supernatant was
harvested 48 and 72 hr later and filtered through a 0.45 Cpm
syringe filter. MEFs were prepared from Oct4-GFP mice which harbour
an IRES-green fluorescence protein (GFP) fusion cassette downstream
of the stop codon of the Oct4 gene (Jackson Laboratory
#008214).sup.7. All animal experiments were conducted in accordance
with the animal experiment guidelines of University of Minnesota.
For chimera experiments, MEFs were prepared from mice that harbour
the Oct4-GFP allele and ROSA26-lacZ allele. MEFs were seeded at
3.times.10.sup.5 cells/6 cm dish on day -2 in DMEM with 10% fetal
bovine serum (FBS). Fresh virus supernatant was added to MEFs on
day -1 and day 0 with 10 .mu.g/ml polybrene. Culture medium was
then changed to iPSC medium (DMEM, 15% fetal bovine serum, 100
.mu.M MEM non-essential amino acids, 55 .mu.M 2-mercaptoethanol, 2
mM L-glutamine and 1000 u/ml leukemia inhibitory factor) on day 1.
Transduced MEFs were subcultured onto irradiated SNL feeder cells
at 2.times.10.sup.5 cells/6 cm dish on day 4 and maintained on the
feeder cells in Protocol A. The maximum number of GFP-positive
colonies obtained around day 18 was divided by 2.times.10.sup.5 to
obtain the efficiency of making iPSCs. In Protocol B, transduced
MEFs were maintained without feeder cells. GFP-positive colonies
were picked up around day 10 to clone without feeder cells for
pluripotency analyses. Retrovirus titer was measured using NIH3T3
cells as described 8. All recombinant DNA research was conducted
following the NIH guidelines.
Preparation of Human iPSCs
[0052] Full-length human OCT4 cDNA fused with the M.sub.3 domain of
human MYOD at the amino terminus was inserted into the pMXs-IP
vector. pMXs-IP vectors encoding human M.sub.3O, OCT4, SOX2, KLF4
and c-MYC (Addgene) were transfected into Plat-A cells (Cell
Biolabs) with Lipofectamin 2000 (Invitrogen). Virus supernatant was
harvested 48 and 72 hrs later (day -1 and 0, respectively below),
filtered through a 0.45 .mu.m syringe filter and transduced into
dermal fibroblasts obtained from a 34-year-old Caucasian female
(Cell Applications). On day -2, 2.7.times.10.sup.4 fibroblasts were
plated in each well of a 12-well plate in DMEM with 10% fetal
bovine serum. Fresh virus supernatant was added to the fibroblasts
on day -1 and day 0 with 10 .mu.g/ml polybrene. On day 3 cells were
harvested with trypsin and subcultured at 1.7.times.10.sup.4 cells
per well in 12-well plates coated with BD Matrigel hESC-qualified
Matrix (BD Biosciences) in human iPSC medium (KnockOut DMEMF-12
(Invitrogen), 20% Knockout Serum Replacement (Invitrogen), 100
.mu.M MEM non-essential amino acids, 1%
insulin-transferrin-selenium (Invitrogen), 0.1 mM
2-mercaptoethanol, 2 mM L-glutamine and 4 ng/ml basic FGF). The
medium was changed every other day.
Chromatin Accessibility to NsiI
[0053] One million cells were resuspended in ice-cold lysis buffer
containing 0.1% NP40 and incubated on ice for 5 min as previously
described.sup.9. Nuclei were isolated with centrifugation at
4,000.times.g for 5 min and digested with 200 u/ml NsiI for 2 hr at
37.degree. C. DNA was purified and double-digested with MspI and
BamHI, followed by Southern blotting using the radioactive probe
shown in FIG. 5D.
Immunoblotting
[0054] MEFs were transduced with MyoD-Oct4 fusion genes and
analyzed with immunoblotting five days after transduction. All
antibodies are listed in supplemental Table 1. SuperSignal West
Dura (Thermo Scientific) was used to detect chemiluminescence
signal.
TABLE-US-00001 TABLE 1 Antibodies used in immunoblotting,
immunofluorescence staining and ChIP Immunoblotting (primary
antibodies) Antigen Manufacturer Catalog # Oct4 Santa Cruz
Biotechnology sc-9081 Histone H2A IMAGENEX IMG-358 Immunoblotting
(secondary antibodies) Name Manufacturer Catalog #
Peroxidase-conjugated Jackson ImmunoResearch 211-032-171
anti-rabbit IgG Peroxidase-conjugated Jackson ImmunoResearch
115-035-174 anti-mouse IgG Immunofluorescence staining (primary
antibodies) Antigen Manufacturer Catalog # Oct4 Santa Cruz
Biotechnology sc-8628 Nanog Abcam ab21624 SSEA1 R&D Systems
FAB2155P SSEA4, Alexa Fluor BD Biosciences 560308 488-labeled
TRA-1-60, Alexa BD Biosciences 560121 Fluor 555-labeled TRA-1-81,
BD Biosciences 560161 phycoerythrin-labeled Immunofluorescence
staining (secondary antibodies) Name Manufacturer Catalo g#
PE-labeled anti- BD Biosciences 550589 mouse Ig(M + G) Alexa Fluor
555-labeled Invitrogen A21429 anti-rabbit IgG Alexa Fluor
488-labeled Invitrogen A11055 anti-goat IgG ChIP Antigen
Manufacturer Catalog # Oct4 Santa Cruz Biotechnology sc-9081 Sox2
Santa Cruz Biotechnology sc-17320 Parafibromin Bethyl Laboratories
A300-170A Paf1 Abcam ab-20662 Leo1 Abcam ab-70630 H3K4me3 Abcam
ab-1012 H3K9ac Abcam ab-4441 H3K14ac Millipore 07-353 H3K9me3
Millipore 07-523 H3K27me3 Millipore 07-449 Control IgG Santa Cruz
Biotechnology sc-2027
Fluorescence Microscopy
[0055] iPSCs were fixed with 4% formaldehyde for 10 min and
permeabilized with 0.5% Triton X-100 for 3 min. Cells were then
incubated with primary antibody and secondary antibody for 1 hr
each at 25.degree. C. DNA was counterstained with Hoechst 33342.
Used antibodies are listed in Table 1. Fluorescence signal was
captured with a 10.times. A-Plan Phi Var1 objective (numerical
aperture 0.25) and an AxioCam charge coupled device camera attached
to an Axiovert 200M fluorescence microscope (all from Zeiss).
Photoshop 7.0 (Adobe Systems) was used for image processing.
Alkaline Phosphatase Staining
[0056] Alkaline phosphatase was detected with an Alkaline
Phosphatase Detection Kit (Millipore SCR004).
Flow Cytometry
[0057] The percentage of GFP-positive or SSEA1-positive cells at
each time point was determined with a FACSCalibur flow cytometer
and analyzed using CellQuest Pro software (both BD
Biosciences).
Quantitative RT-PCR (qRT-PCR)
[0058] cDNA for mRNA was prepared from iPSC colonies using a
Cells-to-cDNA II kit (Ambion). qRT-PCR was performed with GoTaq
qPCR Master mix (Promega) on a Realplex 2S system (Eppendorf). PCR
primer sequences are listed in Table 2. Expression level of
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to
normalize the expression levels of mRNAs. The feeder-free ESC line
CGR8.8 was used as a positive control.
TABLE-US-00002 TABLE 2 Primers used for quantitative RT-PCR,
bisulfite sequencing and ChIP Gene Forward Reverse Quantitative
RT-PCR (mouse) Oct4 endogenous TCTTTCCACCAGGCCCCCGGCTC
TGCGGGCGGACATGGGGAGATCC (SEQ ID NO: 36) (SEQ ID NO: 37) Sox2
endogenous AAAGGAGAGAAGTTTGGAGCCCGA GGGCGAAGTGCAATTGGGATGAAA (SEQ
ID NO: 38) (SEQ ID NO: 39) Nanog AGCAGAAGATGCGGACTGTGTTCT
CCGCTTGCACTTCATCCTTTGGTT (SEQ ID NO: 40) (SEQ ID NO: 41) Thy1
GCCTGACCCGAGAGAAGAAGAAG TGGTGGTGAAGTTCGCTAGAGTAAG (SEQ ID NO: 42)
(SEQ ID NO: 43) Col6a2 CCACCACTGAAAGGAACAACAA
TCCAACACGAAATACACGTTGAC (SEQ ID NO: 44) (SEQ ID NO: 45) Fgf7
CCATGAACAAGGAAGGGAAA TCCGCTGTGTGTCCATTTAG (SEQ ID NO: 46) (SEQ ID
NO: 47) GAPDH TGCACCACCAACTGCTTAG GATGCAGGGATGATGTTC (SEQ ID NO:
48) (SEQ ID NO: 49) Quantitative RT-PCR (human) OCT4 endogenous
CCTCACTTCACTGCACTGTA CAGGTTTTCTTTCCCTAGCT (SEQ ID NO: 50) (SEQ ID
NO: 51) SOX2 endogenous CCCAGCAGACTTCACATGT CCTCCCATTTCCCTCGTTTT
(SEQ ID NO: 52) (SEQ ID NO: 53) KLF4 endogenous
GATGAACTGACCAGGCACTA GTGGGTCATATCCACTGTCT (SEQ ID NO: 54) (SEQ ID
NO: 55) c-MYC endo. TGCCTCAAATTGGACTTTGG GATTGAAATTCTGTGTAACTGC
(SEQ ID NO: 56) (SEQ ID NO: 57) NANOG TGAACCTCAGCTACAAACAG
TGGTGGTAGGAAGAGTAAAG (SEQ ID NO: 58) (SEQ ID NO: 59) LIN28
GAGCATGCAGAAGCGCAGATCAAA TATGGCTGATGCTCTGGCAGAAGT (SEQ ID NO: 60)
(SEQ ID NO: 61) DPPA2 AGGCTTCATAGGCATGCTTACCCT
TGAAGCCTTGCTCTCTTGGTCACT (SEQ ID NO: 62) (SEQ ID NO: 63) DPPA4
AGACACAGATGGTTGGGTTCACCT TGCACTCACTCTCCCTTCTTGCTT (SEQ ID NO: 64)
(SEQ ID NO: 65) GDF3 ACACCTGTGCCAGACTAAGATGCT
TGACGGTGGCAGAGGTTCTTACAA (SEQ ID NO: 66) (SEQ ID NO: 67) REX1
TGAATAGCTGACCACCAGCACACT ACAGGCTCCAGCCTCAGTACATTT (SEQ ID NO: 68)
(SEQ ID NO: 69) TERT TGTGCACCAACATCTACAAG GCGTTCTTGGCTTTCAGGAT (SEQ
ID NO: 70) (SEQ ID NO: 71) TDGF1 TGCCCAAGAAGTGTTCCCTGTGTA
AAAGTGGTAGTACGTGCAGACGGT (SEQ ID NO: 72) (SEQ ID NO: 73) GAPDH
AACAGCGACACCCACTCCTC CATACCAGGAAATGAGCTTGACAA (SEQ ID NO: 74) (SEQ
ID NO: 75) Bisulfite sequencing Oct4 AGGTTGAAAATGAAGGTTTTTT
TCCAACCCTACTAACCCATCACC (SEQ ID NO: 76) (SEQ ID NO: 77) ChIP Oct4
Region 1 GGAACTGGGTGTGGGGAGGTTGTA AGCAGATTAAGGAAGGGCTAGGACGAGAG
(SEQ ID NO: 78) (SEQ ID NO: 79) Oct4 Region 2
AGGTCAAGGGGCTAGAGGGTGGGATT TGAGAAGGCGAAGTCTGAAGCCA (SEQ ID NO: 80)
(SEQ ID NO: 81) Oct4 Region 3 TAGGAGCTCTTGTTTGGGCCATGT
ACAAGGGTCTGCTCGTGTAAAGGT (SEQ ID NO: 82) (SEQ ID NO: 83) Sox2
Region 1 TTTTGGTTTTTAGGGTAAGGTACTGGGAAG
CCACGTGAATAATCCTATATGCATCACAAT (SEQ ID NO: 84) (SEQ ID NO: 85) Sox2
Region 2 CACATGAAGGAGCACCCGGATTAT TCCGGGAAGCGTGTACTTATCCTT (SEQ ID
NO: 86) (SEQ ID NO: 87)
DNA Microarray Analysis
[0059] RNA was prepared from CGR8.8 cells, MEFs, and a mouse iPSC
clone prepared with the fusion gene between the M.sub.3 domain of
MyoD and Oct4 (M.sub.3O-iPSC) on day 60 with the PureLink RNA total
RNA purification system (Invitrogen). RNA was amplified and labeled
using the Agilent Quick AmpLabeling Kit (Agilent Technologies)
following the manufacturer's protocol. cRNA was hybridized
overnight to Agilent Whole Murine Genome Oligo Microarray using the
Agilent Gene Expression Hybridization Kit. The fluorescence signals
of the hybridized microarrays were detected using Agilent's DNA
Microarray Scanner. The Agilent Feature Extraction Software was
used to read out and process the image files. Data were processed
and visualized with Spotfire DecisionSite for Functional Genomics
software. DNA microarray data have been deposited in the NCBI GEO
database under the accession number GSE22327.
Karyotyping of Human IPSCs
[0060] Adherent cells were arrested with colcemid, harvested,
treated with 75 mM KCl hypotonic solution, and fixed with methanol
and acetic acid at 3:1. The cells were spread onto glass slides and
stained with Wright-Giemsa stain. G-banded metaphases were
evaluated using an Olympus BX61 microscope outfitted with 10.times.
and 100.times. objectives. Metaphase cells were imaged and
karyotyped using Applied Spectral Imaging (ASI) software.
Aggregation Chimera and Teratoma Formation
[0061] Ten M.sub.3O-iPSCs of a cloned line were transferred into a
microdrop of KSOMaa solution (Millipore) with a zona-free 8-cell
stage mouse embryo of the ICR strain (albino) after brief exposure
to acidic Tyrode's solution (Millipore). Aggregated morula stage
embryos at 2.5 days post coitum (dpc) that contained GFP-positive
iPSCs were transferred into the uteri of 2.5 dpc pseudopregnant
recipient mice. Embryos at 13.5 dpc were analyzed for chimera
formation with X gal stain or for germline transmission with a
fluorescence microscope. To prepare teratomas, one million cloned
mouse or human M.sub.3O-iPSCs were injected into the limb muscle of
NOD/SCID mice. Teratomas were fixed with 10% formalin and embedded
with paraffin after three weeks for mouse iPSCs and eight weeks for
human iPSCs. Five-.mu.m thick sections were stained with
haematoxylin and eosin for histological analysis.
Chromatin Immunoprecipitation (ChIP)
[0062] ChIP was performed as described in the instruction of the EZ
Magna ChIP G kit (Millipore). All antibodies are listed in Table 1.
PCR primer sequences are listed in Table 2. PCR amplification
levels were first normalized against the value obtained with
control IgG. The normalized values with ESCs or MEFs were then
defined as 1.0 depending on antibodies to obtain relative
expression levels in other cells.
DNA Methylation Analysis
[0063] Genomic DNA from mouse iPSCs was treated with bisulfite with
an EZ DNA Methylation-Gold kit (Zymo Research). The DNA sequence at
the Oct4 proximal promoter region was amplified with PCR using the
primers listed in Table 2 and cloned into the pCR2.1-TOPO vector
(Invitrogen) for sequencing.
Results
[0064] Generation of Mouse IPSCs with Heterologous Transactivation
Domains
[0065] Full-length mouse Oct4 was fused with various fragments of
mouse MyoD (FIG. 1A). The basic helix-loop-helix (bHLH) domain of
MyoD, used for dimerization and DNA binding, was not included in
these constructs to avoid activation of MyoD-target genes. Each
chimeric gene was co-transduced with a polycistronic retroviral
vector encoding mouse Sox2, Klf4, and c-Myc (SKM).sup.5 into MEFs
derived from Oct4-GFP mice, which contain the GFP gene knocked into
the Oct4 locus.sup.7. In this model, formation of GFP-positive
colonies indicates that individual MEFs develop into
Oct4-expressing cells capable of clonal growth. Expression of
chimeric proteins was confirmed through immunoblotting with
antibodies against Oct4 (FIG. 8). As a control, MEFs were
transduced with OSKM (O-MEFs) on day -1 and 0 and transferred these
cells onto SNL feeder cells on day 4 following a standard protocol
(FIG. 1B, Protocol A). GFP-positive colonies emerged around day 10,
gradually increasing in number until reaching a peak by day 18. To
calculate the percentage of MEFs that were reprogrammed into iPSCs,
the number of GFP-positive colonies were divided by the total
number of MEFs seeded in a culture dish. It was estimated that
0.08.+-.0.09% of O-MEFs were converted into GFP-positive cells,
which is similar to previous reports.sup.8,10 (FIG. 1A, right
column). MEFs were then transduced with each chimeric gene along
with SKM and followed the protocol described above (Protocol A).
M.sub.3O with SKM (M.sub.3O-SKM) increased the percentage of
GFP-positive colonies most drastically, with 5.10.+-.0.85% of MEFs
(M.sub.3O-MEFs) being transformed into GFP-positive cells by day
15. The M.sub.3 region encompasses the acidic transactivation
domain (TAD) of MyoD (amino acids 3-56).sup.11. However, the simple
presence of acidity was insufficient to facilitate iPSC formation,
as evidenced by a lack of increase in GFP-positive colonies in MEFs
transduced with M.sub.6O, which also contains the main acidic amino
acid cluster, or a chain of 20 glutamic acids attached to Oct4 (EO)
(FIG. 1A). The high efficiency with which M.sub.3O created iPSCs as
compared to Oct4 was not simply due to a difference in the
retrovirus titer for the two virus suspensions. The titer for the
M.sub.3O virus and Oct4 virus was 1.8.+-.0.2.times.10.sup.7 and
2.1.+-.0.4.times.10.sup.7 colony forming units/ml,
respectively.
[0066] While conducting the above experiments, it was noticed that
GFP-positive colonies emerged from M.sub.3O-MEFs on about day 5
without transfer onto feeder cells (FIG. 1B, Protocol B), and these
colonies steadily increased in size and number (FIG. 1C). By around
day 12, 3.6.+-.0.5% of M.sub.3O-MEFs formed GFP-positive colonies
in the absence of feeder cells, perhaps supported by the
surrounding MEFs serving as "autologous" feeder cells (FIG. 1D). In
contrast, GFP-positive colonies emerged from O-MEFs between day 16
and 18 at an extremely low efficiency (0.0035.+-.0.0006%) with the
same protocol. It was next tested if GFP-positive colonies could be
obtained without Sox2, Klf4, or c-Myc in the presence of M.sub.3O
with Protocol B (FIG. 1D). Although M.sub.3O still required Sox2
and Klf4, c-Myc was dispensable. Previous studies have reported
that iPSCs can be established without c-Myc.sup.2,3; however, the
uniqueness of M.sub.3O-SK lies in the speed and efficiency with
which GFP-positive colonies form. While it requires three to four
weeks and the presence of feeder cells for OSK to induce
GFP-positive colonies at an efficiency of around 0.01%.sup.2,3,
M.sub.3O-SK could generate GFP-positive colonies without feeder
cells by day 7 after transduction at an efficiency of 0.44%, over
40-fold more efficient than OSK.
[0067] These striking differences between M.sub.3O and Oct4
prompted the evaluation of the specificity of the M.sub.3O
configuration in relation to other host factors and TADs taken from
other transcription factors using Protocol B. First, the location
and number of the M.sub.3 domains in the fusion protein with Oct4
were changed (FIG. 1E). Second, the two TADs in Oct4.sup.12 were
replaced with the M.sub.3 domain in various combinations (FIG. 1F).
Third, the M.sub.3 domain was fused to Sox2 or Klf4 and tested in
combination with other members of OSKM and M.sub.3O (FIG. 1G).
OM.sub.3 was as effective as M.sub.3O in iPSC creation. In a fourth
experiment, TADs taken from other powerful transactivators were
fused to Oct4 (FIG. 1H), including the TADs from Tax of human
T-lymphotropic virus type 1 (HTLV-1).sup.13, Tat of human
immunodeficiency virus type 1 (HIV-1).sup.14,15, Gata4.sup.16,17
and Mef2c.sup.17.
Characterization of M.sub.3O-IPSCs
[0068] The GFP-positive colonies that emerged on day 5 following
transduction with M.sub.3O-SKM using Protocol B contained 31-143
cells in 12 colonies, with a median of 43 cells/colony. This number
of cells would be produced after less than seven cell divisions
assuming even division for each cell, which is strikingly small
compared to the median of 70 cell divisions needed before
GFP-positive cells appear with OSKM Is. The colonies that emerged
with M.sub.3O-SKM were usually homogenously GFP-positive from the
beginning. On day 7 over 97% of these colonies were homogeneously
GFP-positive with Protocol B compared to around 5% of colonies
derived with OSKM obtained on day 12 with Protocol A (FIG. 2A).
Protocol A was used for OSKM. As a result, GFP-positive colonies
were harvested at different time points corresponding to two days
after the onset of GFP activation.
[0069] The quality of GFP-positive colonies obtained with
M.sub.3O-SKM and OSKM were compared by quantitative RT-PCR
(qRT-PCR) analysis of three pluripotency genes (endogenous Oct4,
endogenous Sox2, and Nanog) and three fibroblast-enriched genes
(Thy1, Col6a2, and Fgf7).sup.19,21. Homogeneously GFP-positive
colonies obtained with M.sub.3O-SKM using Protocol B and those with
OSKM using Protocol A were selected to represent the colonies for
each group. Although cells were harvested at different time points
corresponding to the onset of GFP activation, the interval between
time points is the same. For OSKM, expression of the three
pluripotency genes gradually increased during the initial week
after emergence of GFP-positive colonies, indicating a slow
maturation process toward pluripotency (FIG. 2B). For M.sub.3O-SKM,
in contrast, levels of these transcripts reached or exceeded those
seen in ESCs at the time of the emergence of GFP-positive colonies
and remained at similar levels until day 30. This differential
efficiency of transcriptional reprogramming was also evident with
suppression of the three fibroblast-enriched genes. For
M.sub.3O-SKM, expression levels of these genes on day 5 when the
GFP signal was apparent were comparable to those seen in ESCs, but
it took around one week after the activation of GFP for OSKM to
accomplish the same level of gene suppression (FIG. 2C). Together,
these results indicate that M.sub.3O-SKM can reprogram MEFs to an
iPSC state more efficiently than OSKM.
[0070] The pluripotency of iPSC clones prepared with M.sub.3O-SKM
following Protocol B (M.sub.3O-iPSCs) was verified using three
standard approaches. First, genome-wide transcript analysis
demonstrated highly similar gene expression in M.sub.3O-iPSCs and
ESCs. Out of 41,160 probes, 3,293 were greater than 4-fold
differentially expressed (up- or down-regulated) in both ESCs and
cloned iPSCs compared to MEFs (FIG. 3A). The commonly up-regulated
genes included eight ECS-enriched genes, such as Oct4, Sox2 and
Nanog. In addition, Thy1, Col6a2 and Fgf7 were down-regulated more
than 16-fold in both ESCs and iPSCs. Second, intramuscular
injection of M.sub.3O-iPSCs into an NOD/SCID mouse resulted in
teratoma formation as shown by the presence of various tissues
derived from the three germ layers (FIG. 3B). Third, aggregation of
8-cell stage embryos of the ICR strain with M.sub.3O-iPSCs
containing the Oct4-GFP allele and ROSA26-lacZ allele formed
chimeric mice (FIG. 3C. 3D). M.sub.3O-iPSCs contributed to germ
cells in some chimeric mice (FIG. 3E). When one of the chimeric
males (FIG. 3D left) was crossed with a wild-type female ICR mouse
(FIG. 3F, white adult at bottom), all 11 pups showed agouti or
black coat color (FIG. 3F).
Establishment of Human iPSCs with M.sub.3O-SKM
[0071] Next it was evaluated if M.sub.3O could also facilitate
generation of human iPSCs in comparison to OSKM. Human M.sub.3O-SKM
and OSKM were transduced into human dermal fibroblasts prepared
from a 34-year-old female. Because these cells did not harbor a
transgene that could be used as a convenient marker for
reprogramming, expression of the pluripotency protein NANOG was
monitored by immunofluorescence staining as an iPSC indicator.
NANOG-positive human ESC-like colonies emerged around day 8 with
M.sub.3O-SKM, with the number increasing by around day 15 when
0.30.+-.0.033% of the original fibroblasts were converted to iPSC
colonies (FIG. 4A, 4B). In contrast, when OSKM was transduced,
NANOG-positive colonies did not emerge until around day 12 and
eventually only 0.0052.+-.0.0018% of the fibroblasts were turned
into iPSC colonies. This indicates 58-fold increased efficiency
with M.sub.3O-SKM in comparison to OSKM. Furthermore, while less
than 10% of the colonies that appeared with OSKM were NANOG
positive, more than 90% of the colonies produced with M.sub.3O-SKM
were NANOG-positive, consistent with the results for mouse iPSCs.
Cloned iPSCs prepared with M.sub.3O-SKM also expressed endogenous
OCT4 and surface markers SSEA4, TRA-1-60 and TRA-1-81 on day 28
(FIG. 4C). Transduced M.sub.3O was suppressed by this day (not
shown). In addition, iPSCs prepared with M.sub.3O-SKM expressed
twelve pluripotency genes as demonstrated by quantitative RT-PCR
(FIG. 4D). All twenty mitotic spreads prepared from a cloned
M.sub.3O-SKM iPSCs demonstrated normal karyotypes (FIG. 4E).
Finally, they formed teratomas when injected into an NOD/SCID mouse
(FIG. 4F), proving pluripotency of the cells.
Chromatin Analyses of Pluripotency Genes in M.sub.3O-MEFs
[0072] To understand how M.sub.3O-SKM facilitated nuclear
reprogramming at the molecular level, several chromatin changes at
the Oct4 gene were examined during the early phase of iPSC
generation. All analyses were performed with Protocol B on all MEFs
in a culture dish including GFP-positive and -negative cells
without subculture for 9 days. First, changes in DNA methylation at
the promoter of the Oct4 gene were studied. CpG dinucleotides at
the proximal promoter of the Oct4 gene are heavily methylated in
MEFs, unlike in ESCs and iPSCs.sup.22 (FIG. 5A), and this serves as
a major inhibitory mechanism for Oct4 transcription. While the
number of unmethylated CpG sites remained essentially the same on
day 9 in O-MEFs, the number increased approximately twofold in
M.sub.3O-MEFs on the same day (FIG. 5A, 25.5% vs 55.5%). The more
advanced demethylation in M.sub.3O-MEFs than in O-MEFs is
consistent with the higher percentage of GFP-positive cells in
M.sub.3O-MEFs than in O-MEFs on day 9 (12.77% vs 0.52%) as shown by
flow cytometry (FIG. 5B).
[0073] Next, the binding of Oct4 and Sox2 to the distal enhancer of
the Oct4 gene.sup.1 using chromatin immunoprecipitation (ChIP) was
studied. The binding of Oct4 and Sox2 to the distal enhancer
remained low with O-MEFs (FIG. 5C). However, Oct4, which was
identical to M.sub.3O in this case, was already highly bound to the
Oct4 distal enhancer in M.sub.3O-MEFs as early as day 3 when no
GFP-positive colonies had yet appeared (FIG. 5C, the red column in
the Oct4 panel). The Oct4-binding level gradually increased
subsequently, eventually reaching the level comparable to that seen
in ESCs on day 9. The chromatin binding of Sox2 displayed a similar
tendency. The binding levels of these two proteins in the mixture
of ESCs and MEFs at a 13:87 ratio was studied. This study showed
substantially lower binding of Oct4 and Sox2 in comparison to the
day 9 levels in M.sub.3O-MEFs (FIG. 5C, ESCs+MEFs in blue). This
observation indicates that Oct4 and Sox2 were bound to the Oct4
enhancer in the majority of M.sub.3O-MEFs including GFP-negative
cells on day 9. The increased binding of these two proteins to
chromatin in M.sub.3O-MEFs prompted us to investigate if chromatin
accessibility at the distal enhancer was also increased in
M.sub.3O-MEFs. Increased chromatin accessibility is generally
indicated by higher sensitivity to DNAses.sup.23. Chromatin from
M.sub.3O-MEFs and O-MEFs was digested with the restriction enzyme
NsiI and analyzed DNA fragments using Southern blotting. Indeed,
chromatin accessibility was consistently higher in M.sub.3O-MEFs
compared to O-MEFs between day 5 and day 9 (FIG. 5D). Additionally,
GFP-negative M.sub.3O-MEFs were selected with a FACS on day 9
followed by NsiI digestion analysis. This GFP-negative population
also demonstrated increased sensitivity to NsiI (FIG. 5D, far
right), indicating that the minor GFP-positive population did not
significantly influence the overall result of chromatin
accessibility.
[0074] Previous reports have shown that the Paf1 complex is
recruited to the distal enhancer of the Oct4 gene through binding
to the Oct4 protein.sup.24,25 and then generally moves to the
coding region of the gene.sup.26. Three Paf1 complex
subunits--parafibromin, Leo1 and Paf1--displayed a gradual increase
of binding to the distal enhancer and coding region of the Oct4
gene in M.sub.3O-MEFs, but not in O-MEFs, between days 3 and 9
following transduction (FIG. 5C). The Paf1 complex recruits the
histone methyltransferase complex COMPASS, which catalyzes
trimethylation of lysine 4 on histone H3 (H3K4me3).sup.26. This
histone modification, a marker for active genes, was also increased
specifically in M.sub.3O-MEFs in the coding region of the Oc4 gene
(FIG. 5E). Two other markers for active genes, acetylation of
lysines 9 and 14 on histone H3 (H3K9ac and H3K14ac).sup.27, were
also increased in M.sub.3O-MEFs (FIG. 5E). In addition, two markers
for suppressed genes, trimethylation of H3K9 (H3K9me3) and H3K27
(H3K27me3).sup.27, were more decreased in M.sub.3O-MEFs than those
in O-MEFs (FIG. 5F). Similar results were observed at the Sox2
locus (FIG. 9). Among these chromatin changes, the levels of
H3K9me3 and H3K27me3 in M.sub.3O-MEFs most quickly reached the
levels observed in ESCs (FIG. 5F), suggesting that the loss of
these suppressive histone markers precedes other chromatin
modifications. Taken together, these results demonstrate that
chromatin at Oct4 and Sox2 loci was generally remodeled in majority
of M.sub.3O-MEFs, including the GFP-negative population, toward an
ESC pattern during the first ten days after transduction, while
chromatin in the majority of O-MEFs was not significantly
altered.
[0075] In addition to global chromatin remodeling, M.sub.3O-SKM
also elicited wider expression of two pluripotency markers than
OSKM: alkaline phosphatase and SSEA1. Alkaline phosphatase was
almost ubiquitously expressed by day 9 in M.sub.3O-MEFs, unlike the
weak and heterogeneous expression observed in O-MEFs (FIG. 6A).
SSEA1 was also more widely expressed in M.sub.3O-MEFs than in
O-MEFs by day 9 as shown by immunofluorescence microscopy and flow
cytometory (FIG. 6B, 6C). While alkaline phosphatase and SSEA1 are
not exclusively expressed in pluripotent cells, these findings
support the interpretation that M.sub.3O-SKM remodeled the
chromatin in much more wider population of the cells to a certain
degree unlike OSKM. Rapid cell proliferation is known to facilitate
iPSC generation as shown using p53-null MEFs.sup.18; however,
neither M.sub.3O-SKM nor M.sub.3O alone facilitated MEF
proliferation during the initial 9 days after transduction (FIG.
6D, 6E).
Chromatin Analyses of Pluripotency Genes without c-Myc M.sub.3O-SK
induced GFP-positive colonies over 100-fold more efficiently than
OSKM with Protocol B (0.44% with M.sub.3O-SK in FIG. 1D vs 0.0035%
with OSKM in FIG. 1F). This observation suggests that the M.sub.3
domain could compensate for the lack of c-Myc when Oct4 activation
was used as an indicator. Although several roles of c-Myc have been
proposed, its precise function in iPSC formation remains
elusive.sup.28. To further understand the roles of c-Myc in the
activation of pluripotency genes, chromatin analyses at the Oct4
and Sox2 loci were repeated comparing MEFs transduced with three
genes (M.sub.3O-SK or OSK) and four genes (M.sub.3O-SKM of OSKM) on
day 9 when the effects of M.sub.3O-SKM were readily detectable. One
gene (M.sub.3O or Oct4) and two genes (M.sub.3O+Sox2 or Oct4+Sox2)
were transduced for comparison. At this time point, 3.16% of MEFs
were GFP-positive with M.sub.3O-SK (FIG. 7A), and no GFP-positive
cells were observed with other combinations of one, two, or three
genes. However, M.sub.3O-SK did not significantly decrease the
overall level of DNA methylation compared with other gene
combinations (FIG. 7B).
[0076] As for transcription factor binding to the enhancer,
M.sub.3O facilitated binding of Oct4, Sox2, and parafibromin in
combination with Sox2 or Sox2 and Klf4 (FIG. 7C, red), with some of
these binding levels comparable to levels achieved with
M.sub.3O-SKM. However, Leo1 and Paf1 were not recruited to the
enhancer without c-Myc (FIG. 7C). The binding of parafibromin,
Leo1, and Paf1 to the initiation site of Oct4 was also weak without
c-Myc (FIG. 10A). Consistent with this partial assembly of the Paf1
complex at the Oct4 gene, the level of H3K4me3 remained low without
c-Myc (FIG. 7D, 10B). Another active gene marker, H3K9ac, also
remained low without c-Myc (FIG. 7D, 10B). Whereas H3K9me3 was
effectively decreased by M.sub.3O-S and M.sub.3O-SK, H3K27me3 was
more resistant to demethylation by any of the gene combinations
without c-Myc (FIG. 7E). At the Sox2 gene, compared to the Oct4
gene. M.sub.3O did not substantially increase the binding of Oct4
or Sox2 to the enhancer alone or in combination with Sox2 or Sox2
and Klf4 (FIG. 11A). The changes in the levels of H3K4me3, H3K9ac,
H3K9me3 and H3K27me3 were all weak in the absence of c-Myc (FIG.
11B). Together, these chromatin studies indicate that while
M.sub.3O could facilitate formation of GFP-positive colonies
without c-Myc, the overall level of chromatin remodeling in
GFP-negative MEFs was low in the absence of c-Myc.
Discussion
[0077] The present study advances the field of iPSC biology by
showing that one of the rate-limiting steps in iPSC formation with
OSKM is poor chromatin accessibility at pluripotency genes and that
a strong transactivating domain can overcome this problem. Because
iPSC formation was dramatically improved with M.sub.3O-SKM, the
factors required to increase chromatin accessibility most likely
already exist within MEFs but are not effectively recruited to
pluripotency genes when using OSKM. Our current working model is
that the MyoD TAD overcomes the barrier of closed chromatin by
effectively attracting chromatin modifying proteins and thereby
facilitating the binding of Oct4 and other regulatory proteins as
well as epigenetic modifications at pluripotency genes (FIG. 7F).
Myc family proteins have been proposed to globally relax chromatin
in part through activation of the histone acetyltransferase GCN5
and in part through direct binding to thousands of genomic
loci.sup.28,29. The results also support c-Myc's potential roles in
chromatin remodeling.
[0078] One of the central questions related to the molecular
mechanisms of iPSC formation is how closed chromatin at the loci of
Oct4, Sox2, and Nanog are opened by OSKM. Little is known about
this mechanism. One potential mechanism is that chromatin
disruption occurs during repeated DNA replication as suggested by a
report that 92% of B lymphocytes derived from inducible OSKM
transgenic mice become iPSCs after 18 weeks of culture.sup.18.
Additionally, knockdown of p53 in B cells shortened both cell
doubling time and the time required to form iPSCs by twofold.
However, this does not seem to be the case for M.sub.3O-SKM since
it did not facilitate cell proliferation. Additionally, emerging
GFP-positive colonies contained far less cells than their
counterparts obtained from B cells. It has been difficult to
perform biochemical analysis of the early process of iPSC
formation, such as epigenetic remodeling at pluripotency genes,
because of the presence of feeder cells and non-responsive MEFs
that comprise more than 90% of transduced cells. However, the MyoD
TAD eliminated the requirement for feeder cells and achieved
significant levels of epigenetic remodeling even in those MEFs that
eventually fell short of activating GFP with Protocol B. Thus, the
MyoD TAD is expected to facilitate the dissection of epigenetic
processes during the early phase of iPSC formation.
[0079] By combining transcription factors with TADs, this approach
to nuclear reprogramming is expected to have a range of
applications from inducing pluripotency, as shown in this study, to
inducing direct conversion from one differentiated cell type to
another without transitioning through iPSCs.sup.17,33,34. The
strategy of TAD-fusion to potentiate transactivators will further
advance the study of nuclear reprogramming. The effect of each TAD
may be on dependent on cell types, host transcription factors, and
target genes. Other TADs have been used to amplify the activity of
transcription factors. For instance, the TAD of VP16 was fused to
the transcription factor Pdxl to facilitate conversion of
hepatocytes to pancreatic cells.sup.36,37. However, the MyoD TAD
has not been used in nuclear reprogramming. The TAD-fusion approach
is applicable to combinations of many other transcription factors
and TADs to amplify the activity of the host transcription factor
and control cell fate decisions.
Sequence Information of the Plasmid Constructs
[0080] Following is a list of plasmid constructs used in the above
work as well as two constructs based on the VP16 gene and data
therefor.
1) Mouse M.sub.3O
[0081] The M.sub.3 domain of the mouse MyoD cDNA was fused to the
amino terminus of the full-length mouse Oct4 cDNA using PCR and
inserted into the EcoRI site of the pMXs-IP vector.
PCR for Mouse M.sub.3O
[0082] The cDNA encoding the M.sub.3 domain of mouse MyoD (amino
acids 1-62) was amplified with two primer sets, MyoDOct4F4
(GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC; SEQ ID NO:1) and
MO.DELTA.63-109R1 (CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG; SEQ ID NO:2).
Full length Oct4 cDNA was amplified with two primer sets,
MO.DELTA.63-109F1 (CTGAAACCGGAGGAGCACATGGCTGGACACCTG; SEQ ID NO:3)
and MyoDOct4R5 (CGGAATTCTCTCAGTTGAATGCATGGGAGAG; SEQ ID NO:4). The
two PCR products of each first PCR were used as a template for the
secondary PCR with the primer set MyoDOct4F4 and MyoDOct4R5.
M.sub.3O was directly subcloned into EcoRI site of pMXs-IP.
TABLE-US-00003 PCR parameters Denature 94.degree. C. 2 min Denature
94.degree. C. 15 sec* Anneal 57.degree. C. 30 sec* Extend
68.degree. C. 1 min* Final extension 68.degree. C. 7 min *Repeat 25
cycles
TABLE-US-00004 The DNA sequence of mouse M.sub.3O taken from mouse
MyoD (SEQ ID NO: 5)
atggagcttctatcgccgccactccgggacatagacttgacaggccccg
acggctctctctgctcctttgagacagcagacgacttctatgatgatcc
gtgtttcgactcaccagacctgcgcttttttgaggacctggacccgcgc
ctggtgcacgtgggagccctcctgaaaccggaggagcacatggctggac
acctggcttcagacttcgccttctcacccccaccaggtgggggtgatgg
gtcagcagggctggagccgggctgggtggatcctcgaacctggctaagc
ttccaagggcctccaggtgggcctggaatcggaccaggctcagaggtat
tggggatctccccatgtccgcccgcatacgagttctgcggagggatggc
atactgtggacctcaggttggactgggcctagtcccccaagttggcgtg
gagactttgcagcctgagggccaggcaggagcacgagtggaaagcaact
cagagggaacctcctctgagccctgtgccgaccgccccaatgccgtgaa
gttggagaaggtggaaccaactcccgaggagtcccaggacatgaaagcc
ctgcagaaggagctagaacagtttgccaagctgctgaagcagaagagga
tcaccttggggtacacccaggccgacgtggggctcaccctgggcgttct
ctttggaaaggtgttcagccagaccaccatctgtcgcttcgaggccttg
cagctcagccttaagaacatgtgtaagctgcggcccctgctggagaagt
gggtggaggaagccgacaacaatgagaaccttcaggagatatgcaaatc
ggagaccctggtgcaggcccggaagagaaagcgaactagcattgagaac
cgtgtgaggtggagtctggagaccatgtttctgaagtgcccgaagccct
ccctacagcagatcactcacatcgccaatcagcttgggctagagaagga
tgtggttcgagtatggttctgtaaccggcgccagaagggcaaaagatca
agtattgagtattcccaacgagaagagtatgaggctacagggacacctt
tcccagggggggctgtatcctttcctctgcccccaggtccccactttgg
caccccaggctatggaagcccccacttcaccacactctactcagtccct
tttcctgagggcgaggcctttccctctgttcccgtcactgctctgggct
ctcccatgcattcaaactga Mouse M.sub.3O primer sequences MyoDOct4F4:
(SEQ ID NO: 6) GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC MO.DELTA.63-109R1:
(SEQ ID NO: 7) CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG MO.DELTA.63-109F1:
(SEQ ID NO: 8) CTGAAACCGGAGGAGCACATGGCTGGACACCTG MyoDOct4R5: (SEQ
ID NO: 9) CGGAATTCTCTCAGTTTGAATGCATGGGAGAG
Accession Numbers
Mouse MyoD: M84918, NM_010866
Mouse Oct4 (POU5F1): NM_013633
2) Mouse OM.sub.3
[0083] The M.sub.3 domain of the mouse MyoD cDNA was fused to the
carboxy terminus of the mouse full length Oct4 cDNA.
PCR for Mouse OM.sub.3
[0084] The M.sub.3 domain was prepared with PCR using the primer
pair M.sub.3F1 and M.sub.3R1 and inserted into the EcoRI and the
XhoI sites of the pMXs-IP vector to create the pMXs-IP M.sub.3
vector. Oct4 was then PCR amplified with the primer pair Oct4F1 and
Oct4R1, and inserted into the EcoRI site of pMXs-IP M.sub.3
vector.
TABLE-US-00005 Mouse OM.sub.3 sequence (SEQ ID NO: 10)
atggctggacacctggcttcagacttcgccttctcacccccaccaggtg
ggggtgatgggtcagcagggctggagccgggctgggtggatcctcgaac
ctggctaagcttccaagggcctccaggtgggcctggaatcggaccaggc
tcagaggtattggggatctccccatgtccgcccgcatacgagttctgcg
gagggatggcatactgtggacctcaggttggactgggcctagtccccca
agttggcgtggagactttgcagcctgagggccaggcaggagcacgagtg
gaaagcaactcagagggaacctcctctgagccctgtgccgaccgcccca
atgccgtgaagttggagaaggtggaaccaactcccgaggagtcccagga
catgaaagccctgcagaaggagctagaacagtttgccaagctgctgaag
cagaagaggatcaccttggggtacacccaggccgacgtggggctcaccc
tgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgctt
cgaggccttgcagctcagccttaagaacatgtgtaagctgcggcccctg
ctggagaagtgggtggaggaagccgacaacaatgagaaccttcaggaga
tatgcaaatcggagaccctggtgcaggcccggaagagaaagcgaactag
cattgagaaccgtgtgaggtggagtctggagaccatgtttctgaagtgc
ccgaagccctccctacagcagatcactcacatcgccaatcagcttgggc
tagagaaggatgtggttcgagtatggttctgtaaccggcgccagaaggg
caaaagatcaagtattgagtattcccaacgagaagagtatgaggctaca
gggacacctttcccagggggggctgtatcctttcctctgcccccaggtc
cccactttggcaccccaggctatggaagcccccacttcaccacactcta
ctcagtcccttttcctgagggcgaggcctttccctctgttcccgtcact
gctctgggctctcccatgcattcaaacgaattcatggagcttctatcgc
cgccactccgggacatagacttgacaggccccgacggctctctctgctc
ctttgagacagcagacgacttctatgatgatccgtgtttcgactcacca
gacctgcgcttttttgaggacctggacccgcgcctggtgcacgtgggag
ccctcctgaaaccggaggagcactga Mouse OM.sub.3 primer sequences Oct4F1:
(SEQ ID NO: 11) CGAGAATTCATGGCTGGACACCTG Oct4R1: (SEQ ID NO: 12)
CGAGAATTCGTTTGAATGCATGGGAGAG M.sub.3F1: (SEQ ID NO: 13)
CGAGAATTCATGGAGCTTCTATCGCCGCCAC M.sub.3R1: (SEQ ID NO: 14)
CGACTCGAGTCAGTGCTCCTCCGGTTTCAG
TABLE-US-00006 PCR parameters Denature 94.degree. C. 2 min Denature
94.degree. C. 15 sec* Anneal 57.degree. C. 30 sec* Extend
68.degree. C. 1 min* Final extension 68.degree. C. 7 min *Repeat 25
cycles
Accession Number for Mouse OM.sub.3
Mouse MyoD: M84918, NM_010866
Mouse Oct4 (POU5F1): NM_013633
[0085] Activity Test of Making iPSCs OM.sub.3 converts 3.2% of MEFs
to iPSCs. 3) Mouse M.sub.3OM.sub.3
[0086] Mouse M.sub.3 was fused to both the amino and carboxy
termini of mouse Oct4.
PCR for Mouse M.sub.3OM.sub.3
[0087] Mouse M.sub.3 domain was prepared from the mouse MyoD cDNA
with PCR using the primer pair M.sub.3OF1 and M.sub.3OR1. Mouse
full length Oct4 was prepared with PCR using the primer set
M.sub.3OF2 and Oct4R1. To make M.sub.3O, the above two PCR products
were used as templates for PCR with the primer pair M.sub.3OF1 and
Oct4R1. Finally, to make M.sub.3OM.sub.3, M.sub.3O was inserted
into the EcoRI site of the pMXs-IP M.sub.3 vector prepared in the
OM.sub.3 construct above.
TABLE-US-00007 Mouse M.sub.3OM.sub.3 sequence (SEQ ID NO: 15)
atggagcttctatcgccgccactccgggacatagacttgacaggcccc
gacggctctctctgctcctttgagacagcagacgacttctatgatgat
ccgtgtttcgactcaccagacctgcgcttttttgaggacctggacccg
cgcctggtgcacgtgggagccctcctgaaaccggaggagcacatggct
ggacacctggcttcagacttcgccttctcacccccaccaggtgggggt
gatgggtcagcagggctggagccgggctgggtggatcctcgaacctgg
ctaagcttccaagggcctccaggtgggcctggaatcggaccaggctca
gaggtattggggatctccccatgtccgcccgcatacgagttctgcgga
gggatggcatactgtggacctcaggttggactgggcctagtcccccaa
gttggcgtggagactttgcagcctgagggccaggcaggagcacgagtg
gaaagcaactcagagggaacctcctctgagccctgtgccgaccgcccc
aatgccgtgaagttggagaaggtggaaccaactcccgaggagtcccag
gacatgaaagccctgcagaaggagctagaacagtttgccaagctgctg
aagcagaagaggatcaccttggggtacacccaggccgacgtggggctc
accctgggcgttctctttggaaaggtgttcagccagaccaccatctgt
cgcttcgaggccttgcagctcagccttaagaacatgtgtaagctgcgg
cccctgctggagaagtgggtggaggaagccgacaacaatgagaacctt
caggagatatgcaaatcggagaccctggtgcaggcccggaagagaaag
cgaactagcattgagaaccgtgtgaggtggagtctggagaccatgttt
ctgaagtgcccgaagccctccctacagcagatcactcacatcgccaat
cagcttgggctagagaaggatgtggttcgagtatggttctgtaaccgg
cgccagaagggcaaaagatcaagtattgagtattcccaacgagaagag
tatgaggctacagggacacctttcccagggggggctgtatcctttcct
ctgcccccaggtccccactttggcaccccaggctatggaagcccccac
ttcaccacactctactcagtcccttttcctgagggcgaggcctttccc
tctgttcccgtcactgctctgggctctcccatgcattcaaacgaattc
atggagcttctatcgccgccactccgggacatagacttgacaggcccc
gacggctctctctgctcctttgagacagcagacgacttctatgatgat
ccgtgtttcgactcaccagacctgcgcttttttgaggacctggacccg
cgcctggtgcacgtgggagccctcctgaaaccggaggagcactga Mouse M.sub.3OM.sub.3
primer sequences M.sub.3OF1: (SEQ ID NO: 16)
GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC M.sub.3OR1: (SEQ ID NO: 17)
CAGGTGTCCAGCCATATCAGCGTTGGTGGTC M.sub.3OF2: (SEQ ID NO: 18)
GACCACCAACGCTGATATGGCTGGACACCTG Oct4R1: (SEQ ID NO: 19)
CGAGAATTCGTTTGAATGCATGGGAGAG
TABLE-US-00008 PCR parameters: the same as that for OM.sub.3
Denature 94.degree. C. 2 min Denature 94.degree. C. 15 sec* Anneal
57.degree. C. 30 sec* Extend 68.degree. C. 1 min* Final extension
68.degree. C. 7 min *Repeat 25 cycles
Accession Number for Mouse M.sub.3OM.sub.3
Mouse MyoD: M84918. NM_010866
Mouse Oct4 (POU5F1): NM_013633
4) Human M.sub.3O DNA
[0088] The M.sub.3 domain of the human MyoD cDNA was fused to the
amino terminus of the full-length human Oct4 cDNA using PCR and
inserted into the EcoRI site of the pMXs-IP vector.
PCR for Human M.sub.3O
[0089] The M.sub.3 domain of human MyoD was PCR amplified with the
primer pair of hM.sub.3OF1 (see below for sequence) and
hM.sub.3OR1. Human full length Oct4 was PCR amplified with the
primer pair of hM.sub.3OF2 and hM.sub.3OR2. These two PCR products
were used as templates for the third PCR with the primers
hM.sub.3OF1 and hM.sub.3OR2.
TABLE-US-00009 PCR parameters Denature 94.degree. C. 2 min Denature
94.degree. C. 15 sec* Anneal 57.degree. C. 30 sec* Extend
68.degree. C. 1 min* Final extension 68.degree. C. 7 min *Repeat 25
cycles
TABLE-US-00010 The DNA sequence of human M.sub.3O taken from human
MyoD (SEQ ID NO: 20)
atggagctactgtcgccaccgctccgcgacgtagacctgacggcccccg
acggctctctctgctcctttgccacaacggacgacttctatgacgaccc
gtgtttcgactccccggacctgcgcttcttcgaagacctggacccgcgc
ctgatgcacgtgggcgcgctcctgaaacccgaagagcacatggcgggac
acctggcttcggatttcgccttctcgccccctccaggtggtggaggtga
tgggccaggggggccggagccgggctgggttgatcctcggacctggcta
agcttccaaggccctcctggagggccaggaatcgggccgggggttgggc
caggctctgaggtgtgggggattcccccatgccccccgccgtatgagtt
ctgtggggggatggcgtactgtgggccccaggttggagtggggctagtg
ccccaaggcggcttggagacctctcagcctgagggcgaagcaggagtcg
gggtggagagcaactccgatggggcctccccggagccctgcaccgtcac
ccctggtgccgtgaagctggagaaggagaagctggagcaaaacccggag
gagtcccaggacatcaaagctctgcagaaagaactcgagcaatttgcca
agctcctgaagcagaagaggatcaccctgggatatacacaggccgatgt
ggggctcaccctgggggttctatttgggaaggtattcagccaaacgacc
atctgccgctttgaggctctgcagcttagcttcaagaacatgtgtaagc
tgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaa
tcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagaga
aagcgaaccagtatcgagaaccgagtgagaggcaacctggagaatttgt
tcctgcagtgcccgaaacccacactgcagcagatcagccacatcgccca
gcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccgg
cgccagaagggcaagcgatcaagcagcgactatgcacaacgagaggatt
ttgaggctgctgggtctcctttctcagggggaccagtgtcctttcctct
ggccccagggccccattttggtaccccaggctatgggagccctcacttc
actgcactgtactcctcggtccctttccctgagggggaagcctttcccc
ctgtctccgtcaccactctgggctctcccatgcattcaaactga Human M.sub.3O primer
sequences hM.sub.3OF1: (SEQ ID NO: 21)
CGAGAATTCGCCATGGAGCTACTGTCGCCAC hM.sub.3OR1: (SEQ ID NO: 22)
CAGGTGTCCCGCCATGTGCTCTTCGGGTTTCAG hM.sub.3OF2: (SEQ ID NO: 23)
CTGAAACCCGAAGAGCACATGGCGGGACACCTG hM.sub.3OR2: (SEQ ID NO: 24)
CGTGAATTCCTCGAGTCTCAGTTTGAATGCATGGGAGAG
Accession Numbers
Human MyoD: NM_002478
Human Oct4 (POU5F1): NM_002701
5) VP16LO
[0090] The full length of the TAD (amino acids 411-490) of VP16 was
fused to the amino terminus of the mouse full-length Oct4 cDNA.
VP16 is a protein expressed by the herpes simplex virus type I and
its transactivation domain is highly powerful.
PCR for VP16LO
[0091] The cDNA encoding the transactivation domain of VP16 (amino
acids 411-490) was amplified by PCR and inserted into the BamHI and
XhoI sites of the pMXs-IP vector to create the pMXs VP16-IP vector.
Then the full-length mouse Oct4 cDNA was inserted into the EcoRI
and XhoI sites of the pMXs VP16-IP vector.
TABLE-US-00011 PCR primers for VP16 VP16F1: (SEQ ID NO: 25)
CGAGGATCCGCCATGTCGACGGCCCCCCCGACCGATGTC VP16R1: (SEQ ID NO: 26)
CGACTCGAGGAATTCCCCACCGTACTCGTC
TABLE-US-00012 PCR parameters Denature 94.degree. C. 2 min Denature
94.degree. C. 15 sec* Anneal 57.degree. C. 30 sec* Extend
68.degree. C. 1 min* Final extension 68.degree. C. 7 min *Repeat 25
cycles
TABLE-US-00013 VP16LO DNA sequence (SEQ ID NO: 27)
atgtcgacgcccccccgaccgatgtcagcctgggggacgagctccactt
agacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttc
gatctggacatgttgggggacggggattccccgggtccgggatttaccc
cccacgactccgccccctacggcgctctggatatggccgacttcgagtt
tgagcagatgtttaccgatgcccttggaattgacgagtacggtggggaa
ttcatggctggacacctggcttcagacttcgccttctcacccccaccag
gtgggggtgatgggtcagcagggctggagccgggctgggtggatcctcg
aacctggctaagcttccaagggcctccaggtgggcctggaatcggacca
ggctcagaggtattggggatctccccatgtccgcccgcatacgagttct
gcggagggatggcatactgtggacctcaggttggactgggcctagtccc
ccaagttggcgtggagactttgcagcctgagggccaggcaggagcacga
gtggaaagcaactcagagggaacctcctctgagccctgtgccgaccgcc
ccaatgccgtgaagttggagaaggtggaaccaactcccgaggagtccca
ggacatgaaagccctgcagaaggagctagaacagtttgccaagctgctg
aagcagaagaggatcaccttggggtacacccaggccgacgtggggctca
ccctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcg
cttcgaggccttgcagctcagccttaagaacatgtgtaagctgcggccc
ctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcagg
agatatgcaaatcggagaccctggtgcaggcccggaagagaaagcgaac
tagcattgagaaccgtgtgaggtggagtctggagaccatgtttctgaag
tgcccgaagccctccctacagcagatcactcacatcgccaatcagcttg
ggctagagaaggatgtggttcgagtatggttctgtaaccggcgccagaa
gggcaaaagatcaagtattgagtattcccaacgagaagagtatgaggct
acagggacacctttcccagggggggctgtatcctttcctctgcccccag
gtccccactttggcaccccaggctatggaagcccccacttcaccacact
ctactcagtcccttttcctgagggcgaggcctttccctctgttcccgtc
actgctctgggctctcccatgcattcaaactga
Accession Number for VP16
[0092] Human herpesvirus 1 complete genome: X14112.1 Tegument
protein VP16 from human herpes simplex virus type 1: NP_044650
Activity Test of Making iPSCs VP16LO-SKM converts around 0.5% of
mouse embryonic fibroblasts to iPSCs, which is lower than
M.sub.3O-SKM (5.3%) but still higher than OSKM (0.08%). In
addition, VP16LO-SKM does not require feeder cells, unlike OSKM, to
make iPSCs.
6) VP16SO
[0093] A part of the TAD (amino acids 446-490) of VP16 was fused to
the amino terminus of the mouse full-length Oct4 cDNA.
PCR for VP16SO
[0094] The cDNA encoding a part of the transactivation domain of
VP16 (amino acids 446-490) was amplified with two primer sets,
V16F4 (CGAGAATTCGCCATGTTGGGGGACGGGGATC; SEQ ID NO: 28) and V16OR
(CAGGTGTCCAGCCATCCCACCGTACTCGTC; SEQ ID NO:29). Full length Oct4
cDNA was amplified with two primer sets. VP16OF
(GACGAGTACGGTGGGATGGCTGGACACCTG; SEQ ID NO:30) and Oct4R1
(GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG; SEQ ID NO:31). The two PCR
products of each first PCR were used as a template for the
secondary PCR with the primer set V16F4 and Oct4R1. VP16OS was
directly subcloned into EcoRI and XhoI site of pMXs-IP.
TABLE-US-00014 PCR primers for VP16SO V16F4: (SEQ ID NO: 32)
CGAGAATTCGCCATGTTGGGGGACGGGGATTC V16OR: (SEQ ID NO: 33)
CAGGTGTCCAGCCATCCCACCGTACTCGTC VP16OF: (SEQ ID NO: 34)
GACGAGTACGGTGGGATGGCTGGACACCTG OctR1: (SEQ ID NO: 35)
GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG
TABLE-US-00015 PCR parameters Denature 94.degree. C. 2 min Denature
94.degree. C. 15 sec* Anneal 57.degree. C. 30 sec* Extend
68.degree. C. 1 min* Final extension 68.degree. C. 7 min *Repeat 25
cycles
TABLE-US-00016 VP16SO DNA sequence (SEQ ID NO: 36)
atgttgggggacggggattccccgggtccgggatttaccccccacgac
tccgccccctacggcgctctggatatggccgacttcgagtttgagcag
atgtttaccgatgcccttggaattgacgagtacggtgggatggctgga
cacctggcttcagacttcgccttctcacccccaccaggtgggggtgat
gggtcagcagggctggagccgggctgggtggatcctcgaacctggcta
agcttccaagggcctccaggtgggcctggaatcggaccaggctcagag
gtattggggatctccccatgtccgcccgcatacgagttctgcggaggg
atggcatactgtggacctcaggttggactgggcctagtcccccaagtt
ggcgtggagactttgcagcctgagggccaggcaggagcacgagtggaa
agcaactcagagggaacctcctctgagccctgtgccgaccgccccaat
gccgtgaagttggagaaggtggaaccaactcccgaggagtcccaggac
atgaaagccctgcagaaggagctagaacagtttgccaagctgctgaag
cagaagaggatcaccttggggtacacccaggccgacgtggggctcacc
ctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgc
ttcgaggccttgcagctcagccttaagaacatgtgtaagctgcggccc
ctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcag
gagatatgcaaatcggagaccctggtgcaggcccggaagagaaagcga
actagcattgagaaccgtgtgaggtggagtctggagaccatgtttctg
aagtgcccgaagccctccctacagcagatcactcacatcgccaatcag
cttgggctagagaaggatgtggttcgagtatggttctgtaaccggcgc
cagaagggcaaaagatcaagtattgagtattcccaacgagaagagtat
gaggctacagggacacctttcccagggggggctgtatcctttcctctg
cccccaggtccccactttggcaccccaggctatggaagcccccacttc
accacactctactcagtcccttttcctgagggcgaggcctttccctct
gttcccgtcactgctctgggctctcccatgcattcaaactga
Accession Number for VP16
[0095] Human herpesvirus 1 complete genome: X14112.1 Tegument
protein VP16 from human herpes simplex virus type 1: NP_044650 The
combination of VP16SO and SKM induced mouse iPSCs at a frequency of
around 1%.
Example 2
[0096] MEFs transduced with M.sub.3O-SKM were seeded onto feeder
cells at the density of 2000 cells/well of a 12-well plate. This
cell density is around 15-fold lower than the density used in
protocol described above. In addition, 10% fetal bovine serum was
replaced with 15% KnockOut Serum Replacement (KSR, Invitrogen) in
the culture medium. Combination of the decreased cell density and
KSR increased the efficiency of making iPSCs to around 27% by day
12. In contrast, the efficiency with OSKM was around 1% under the
same condition.
[0097] The herpes simplex virus type 1 protein VP16 is a powerful
transactivator. To test if the VP16 TAD could also raise the
efficiency of making iPSCs, two fusion genes were prepared between
mouse Oct4 and the VP16 TAD. The first fusion gene called VP16LO is
composed of the full-length VP16 TAD (amino acids 411-490) fused to
the amino terminus of Oct4. The second fusion gene called VP16SO
comprises the second half of the VP16 TAD (amino acids 446-490)
fused to the amino terminus of Oct4. The efficiency of making mouse
iPSCs was around 5% with VP16LO-SKM and around 14% with VP16SO-SKM
on day 12 under the above-mentioned culture conditions (with
decreased cell density and KSR). The efficiency with these two
combinations was higher than the efficiency with OSKM.
BIBLIOGRAPHY
[0098] 1. Chew, J. L. et al. Mol Cell Biol 25, 6031-46 (2005).
[0099] 2. Nakagawa, M. et al. Nat Biotechnol 26, 101-6 (2008).
[0100] 3. Wernig, M., Meissner. A., Cassady, J. P. & Jaenisch,
R. Cell Stem Cell 2, 10-2 (2008). [0101] 4. Kitamura, T. et al. Exp
Hematol 31, 1007-14 (2003). [0102] 5. Carey, B. W. et al. Proc
NatlAcad Sci USA 106, 157-62 (2009). [0103] 6. Morita, S., Kojima,
T. & Kitamura. T. Gene Ther 7, 1063-6 (2000). [0104] 7.
Lengner, C. J. et al. Cell Stem Cell 1, 403-15 (2007). [0105] 8.
Takahashi, K. & Yamanaka, Cell 126, 663-76 (2006). [0106] 9.
Gerber, A. N et al. Genes Dev 11, 436-50 (1997). [0107] 10.
Huangfu, D. et al. Nat Biotechnol 26, 795-7 (2008). [0108] 11.
Weintraub, H. et al. Genes Dev 5, 1377-86 (1991). [0109] 12. Niwa,
H. et al. Cell 123, 917-29 (2005). [0110] 13. Boxus, M. et al.
Retrovirology 5, 76 (2008). [0111] 14. Romani, B., Engelbrecht, S.
& Glashoff, R. H. J Gen Virol 91, 1-12 (2010). [0112] 15.
Pumfery, A. et al. Curr HIV Res 1, 343-62 (2003). [0113] 16.
Cirillo. L. A. et al. Mol Cell 9, 279-89 (2002). [0114] 17. leda,
M. et al. Cell 142, 375-386 (2010). [0115] 18. Hanna, J. et al.
Nature 462, 595-601 (2009). [0116] 19. Stadtfeld, M. et al. Cell
Stem Cell 2, 230-40 (2008). [0117] 20. Gonzalez, F. et al. Proc
Natl Acad Sci USA 106, 8918-22 (2009). [0118] 21. Maherali, N. et
al. Cell Stem Cell 1, 55-70 (2007). [0119] 22. Okita, K., Ichisaka,
T. & Yamanaka, S. Nature 448, 313-7 (2007). [0120] 23. Carey,
M. F., Peterson, C. L. & Smale, S. T. In vivo analysis of an
endogenous control region, in Transcriptional regulation in
eukaryotes (eds. Carey, M. F., Peterson, C. L. & Smale, S. T.)
261-322 (Cold Spring Harbor Laboratory Press, 2009). [0121] 24.
Ding, L. et al. Cell Stem Cell 4, 403-15 (2009). [0122] 25.
Ponnusamy, M. P. et al. Stem Cells 27, 3001-11 (2009). [0123] 26.
Gerber, M. & Shilatifard, J Biol Chem 278, 26303-6 (2003).
[0124] 27. Kouzarides, T. Cell 128, 693-705 (2007). [0125] 28.
Knoepfler, P. S. Cell Stem Cell 2, 18-21 (2008). [0126] 29.
Knoepfler, P. S. et al. EMBO J 25, 2723-34 (2006). [0127] 33. Zhou.
Q. et al. Nature 455, 627-32 (2008). [0128] 34. Vierbuchen, T. et
al. Nature 463, 1035-41 (2010). [0129] 35. Yamanaka, S. & Blau,
H. M. Nature 465, 704-12 (2010). [0130] 36. Horb, M. E., Shen, C.
N., Tosh, D. & Slack, J. M. Curr Biol 13, 105-15 (2003). [0131]
37. Kaneto, H. et al. Diabetes 54, 1009-22 (2005).
[0132] All publications, patents and patent applications are
incorporated herein by reference. While in the foregoing
specification this invention has been described in relation to
certain preferred embodiments thereof, and many details have been
set forth for purposes of illustration, it will be apparent to
those skilled in the art that the invention is susceptible to
additional embodiments and that certain of the details described
herein may be varied considerably without departing from the basic
principles of the invention.
Sequence CWU 1
1
88133DNAArtificial SequenceA synthetic primer 1gagaattcgc
catggagctt ctatcgccgc cac 33233DNAArtificial SequenceA synthetic
primer 2caggtgtcca gccatgtgct cctccggttt cag 33333DNAArtificial
SequenceA synthetic primer 3ctgaaaccgg aggagcacat ggctggacac ctg
33432DNAArtificial SequenceA synthetic primer 4cggaattctc
tcagtttgaa tgcatgggag ag 3251245DNAMus musculus 5atggagcttc
tatcgccgcc actccgggac atagacttga caggccccga cggctctctc 60tgctcctttg
agacagcaga cgacttctat gatgatccgt gtttcgactc accagacctg
120cgcttttttg aggacctgga cccgcgcctg gtgcacgtgg gagccctcct
gaaaccggag 180gagcacatgg ctggacacct ggcttcagac ttcgccttct
cacccccacc aggtgggggt 240gatgggtcag cagggctgga gccgggctgg
gtggatcctc gaacctggct aagcttccaa 300gggcctccag gtgggcctgg
aatcggacca ggctcagagg tattggggat ctccccatgt 360ccgcccgcat
acgagttctg cggagggatg gcatactgtg gacctcaggt tggactgggc
420ctagtccccc aagttggcgt ggagactttg cagcctgagg gccaggcagg
agcacgagtg 480gaaagcaact cagagggaac ctcctctgag ccctgtgccg
accgccccaa tgccgtgaag 540ttggagaagg tggaaccaac tcccgaggag
tcccaggaca tgaaagccct gcagaaggag 600ctagaacagt ttgccaagct
gctgaagcag aagaggatca ccttggggta cacccaggcc 660gacgtggggc
tcaccctggg cgttctcttt ggaaaggtgt tcagccagac caccatctgt
720cgcttcgagg ccttgcagct cagccttaag aacatgtgta agctgcggcc
cctgctggag 780aagtgggtgg aggaagccga caacaatgag aaccttcagg
agatatgcaa atcggagacc 840ctggtgcagg cccggaagag aaagcgaact
agcattgaga accgtgtgag gtggagtctg 900gagaccatgt ttctgaagtg
cccgaagccc tccctacagc agatcactca catcgccaat 960cagcttgggc
tagagaagga tgtggttcga gtatggttct gtaaccggcg ccagaagggc
1020aaaagatcaa gtattgagta ttcccaacga gaagagtatg aggctacagg
gacacctttc 1080ccaggggggg ctgtatcctt tcctctgccc ccaggtcccc
actttggcac cccaggctat 1140ggaagccccc acttcaccac actctactca
gtcccttttc ctgagggcga ggcctttccc 1200tctgttcccg tcactgctct
gggctctccc atgcattcaa actga 1245633DNAArtificial SequenceA
synthetic primer 6gagaattcgc catggagctt ctatcgccgc cac
33733DNAArtificial SequenceA synthetic primer 7caggtgtcca
gccatgtgct cctccggttt cag 33833DNAArtificial SequenceA synthetic
primer 8ctgaaaccgg aggagcacat ggctggacac ctg 33932DNAArtificial
SequenceA synthetic primer 9cggaattctc tcagtttgaa tgcatgggag ag
32101251DNAMus musculus 10atggctggac acctggcttc agacttcgcc
ttctcacccc caccaggtgg gggtgatggg 60tcagcagggc tggagccggg ctgggtggat
cctcgaacct ggctaagctt ccaagggcct 120ccaggtgggc ctggaatcgg
accaggctca gaggtattgg ggatctcccc atgtccgccc 180gcatacgagt
tctgcggagg gatggcatac tgtggacctc aggttggact gggcctagtc
240ccccaagttg gcgtggagac tttgcagcct gagggccagg caggagcacg
agtggaaagc 300aactcagagg gaacctcctc tgagccctgt gccgaccgcc
ccaatgccgt gaagttggag 360aaggtggaac caactcccga ggagtcccag
gacatgaaag ccctgcagaa ggagctagaa 420cagtttgcca agctgctgaa
gcagaagagg atcaccttgg ggtacaccca ggccgacgtg 480gggctcaccc
tgggcgttct ctttggaaag gtgttcagcc agaccaccat ctgtcgcttc
540gaggccttgc agctcagcct taagaacatg tgtaagctgc ggcccctgct
ggagaagtgg 600gtggaggaag ccgacaacaa tgagaacctt caggagatat
gcaaatcgga gaccctggtg 660caggcccgga agagaaagcg aactagcatt
gagaaccgtg tgaggtggag tctggagacc 720atgtttctga agtgcccgaa
gccctcccta cagcagatca ctcacatcgc caatcagctt 780gggctagaga
aggatgtggt tcgagtatgg ttctgtaacc ggcgccagaa gggcaaaaga
840tcaagtattg agtattccca acgagaagag tatgaggcta cagggacacc
tttcccaggg 900ggggctgtat cctttcctct gcccccaggt ccccactttg
gcaccccagg ctatggaagc 960ccccacttca ccacactcta ctcagtccct
tttcctgagg gcgaggcctt tccctctgtt 1020cccgtcactg ctctgggctc
tcccatgcat tcaaacgaat tcatggagct tctatcgccg 1080ccactccggg
acatagactt gacaggcccc gacggctctc tctgctcctt tgagacagca
1140gacgacttct atgatgatcc gtgtttcgac tcaccagacc tgcgcttttt
tgaggacctg 1200gacccgcgcc tggtgcacgt gggagccctc ctgaaaccgg
aggagcactg a 12511124DNAArtificial SequenceA synthetic primer
11cgagaattca tggctggaca cctg 241228DNAArtificial SequenceA
synthetic primer 12cgagaattcg tttgaatgca tgggagag
281331DNAArtificial SequenceA synthetic primer 13cgagaattca
tggagcttct atcgccgcca c 311430DNAArtificial SequenceA synthetic
primer 14cgactcgagt cagtgctcct ccggtttcag 30151437DNAMus musculus
15atggagcttc tatcgccgcc actccgggac atagacttga caggccccga cggctctctc
60tgctcctttg agacagcaga cgacttctat gatgatccgt gtttcgactc accagacctg
120cgcttttttg aggacctgga cccgcgcctg gtgcacgtgg gagccctcct
gaaaccggag 180gagcacatgg ctggacacct ggcttcagac ttcgccttct
cacccccacc aggtgggggt 240gatgggtcag cagggctgga gccgggctgg
gtggatcctc gaacctggct aagcttccaa 300gggcctccag gtgggcctgg
aatcggacca ggctcagagg tattggggat ctccccatgt 360ccgcccgcat
acgagttctg cggagggatg gcatactgtg gacctcaggt tggactgggc
420ctagtccccc aagttggcgt ggagactttg cagcctgagg gccaggcagg
agcacgagtg 480gaaagcaact cagagggaac ctcctctgag ccctgtgccg
accgccccaa tgccgtgaag 540ttggagaagg tggaaccaac tcccgaggag
tcccaggaca tgaaagccct gcagaaggag 600ctagaacagt ttgccaagct
gctgaagcag aagaggatca ccttggggta cacccaggcc 660gacgtggggc
tcaccctggg cgttctcttt ggaaaggtgt tcagccagac caccatctgt
720cgcttcgagg ccttgcagct cagccttaag aacatgtgta agctgcggcc
cctgctggag 780aagtgggtgg aggaagccga caacaatgag aaccttcagg
agatatgcaa atcggagacc 840ctggtgcagg cccggaagag aaagcgaact
agcattgaga accgtgtgag gtggagtctg 900gagaccatgt ttctgaagtg
cccgaagccc tccctacagc agatcactca catcgccaat 960cagcttgggc
tagagaagga tgtggttcga gtatggttct gtaaccggcg ccagaagggc
1020aaaagatcaa gtattgagta ttcccaacga gaagagtatg aggctacagg
gacacctttc 1080ccaggggggg ctgtatcctt tcctctgccc ccaggtcccc
actttggcac cccaggctat 1140ggaagccccc acttcaccac actctactca
gtcccttttc ctgagggcga ggcctttccc 1200tctgttcccg tcactgctct
gggctctccc atgcattcaa acgaattcat ggagcttcta 1260tcgccgccac
tccgggacat agacttgaca ggccccgacg gctctctctg ctcctttgag
1320acagcagacg acttctatga tgatccgtgt ttcgactcac cagacctgcg
cttttttgag 1380gacctggacc cgcgcctggt gcacgtggga gccctcctga
aaccggagga gcactga 14371633DNAArtificial SequenceA synthetic primer
16gagaattcgc catggagctt ctatcgccgc cac 331731DNAArtificial
SequenceA synthetic primer 17caggtgtcca gccatatcag cgttggtggt c
311831DNAArtificial SequenceA synthetic primer 18gaccaccaac
gctgatatgg ctggacacct g 311928DNAArtificial SequenceA synthetic
primer 19cgagaattcg tttgaatgca tgggagag 28201269DNAHomo sapiens
20atggagctac tgtcgccacc gctccgcgac gtagacctga cggcccccga cggctctctc
60tgctcctttg ccacaacgga cgacttctat gacgacccgt gtttcgactc cccggacctg
120cgcttcttcg aagacctgga cccgcgcctg atgcacgtgg gcgcgctcct
gaaacccgaa 180gagcacatgg cgggacacct ggcttcggat ttcgccttct
cgccccctcc aggtggtgga 240ggtgatgggc caggggggcc ggagccgggc
tgggttgatc ctcggacctg gctaagcttc 300caaggccctc ctggagggcc
aggaatcggg ccgggggttg ggccaggctc tgaggtgtgg 360gggattcccc
catgcccccc gccgtatgag ttctgtgggg ggatggcgta ctgtgggccc
420caggttggag tggggctagt gccccaaggc ggcttggaga cctctcagcc
tgagggcgaa 480gcaggagtcg gggtggagag caactccgat ggggcctccc
cggagccctg caccgtcacc 540cctggtgccg tgaagctgga gaaggagaag
ctggagcaaa acccggagga gtcccaggac 600atcaaagctc tgcagaaaga
actcgagcaa tttgccaagc tcctgaagca gaagaggatc 660accctgggat
atacacaggc cgatgtgggg ctcaccctgg gggttctatt tgggaaggta
720ttcagccaaa cgaccatctg ccgctttgag gctctgcagc ttagcttcaa
gaacatgtgt 780aagctgcggc ccttgctgca gaagtgggtg gaggaagctg
acaacaatga aaatcttcag 840gagatatgca aagcagaaac cctcgtgcag
gcccgaaaga gaaagcgaac cagtatcgag 900aaccgagtga gaggcaacct
ggagaatttg ttcctgcagt gcccgaaacc cacactgcag 960cagatcagcc
acatcgccca gcagcttggg ctcgagaagg atgtggtccg agtgtggttc
1020tgtaaccggc gccagaaggg caagcgatca agcagcgact atgcacaacg
agaggatttt 1080gaggctgctg ggtctccttt ctcaggggga ccagtgtcct
ttcctctggc cccagggccc 1140cattttggta ccccaggcta tgggagccct
cacttcactg cactgtactc ctcggtccct 1200ttccctgagg gggaagcctt
tccccctgtc tccgtcacca ctctgggctc tcccatgcat 1260tcaaactga
12692131DNAArtificial SequenceA synthetic primer 21cgagaattcg
ccatggagct actgtcgcca c 312233DNAArtificial SequenceA synthetic
primer 22caggtgtccc gccatgtgct cttcgggttt cag 332333DNAArtificial
SequenceA synthetic primer 23ctgaaacccg aagagcacat ggcgggacac ctg
332439DNAArtificial SequenceA synthetic primer 24cgtgaattcc
tcgagtctca gtttgaatgc atgggagag 392539DNAArtificial SequenceA
synthetic primer 25cgaggatccg ccatgtcgac ggcccccccg accgatgtc
392630DNAArtificial SequenceA synthetic primer 26cgactcgagg
aattccccac cgtactcgtc 30271307DNAArtificial SequenceA synthetic
sequence 27atgtcgacgc ccccccgacc gatgtcagcc tgggggacga gctccactta
gacggcgagg 60acgtggcgat ggcgcatgcc gacgcgctag acgatttcga tctggacatg
ttgggggacg 120gggattcccc gggtccggga tttacccccc acgactccgc
cccctacggc gctctggata 180tggccgactt cgagtttgag cagatgttta
ccgatgccct tggaattgac gagtacggtg 240gggaattcat ggctggacac
ctggcttcag acttcgcctt ctcaccccca ccaggtgggg 300gtgatgggtc
agcagggctg gagccgggct gggtggatcc tcgaacctgg ctaagcttcc
360aagggcctcc aggtgggcct ggaatcggac caggctcaga ggtattgggg
atctccccat 420gtccgcccgc atacgagttc tgcggaggga tggcatactg
tggacctcag gttggactgg 480gcctagtccc ccaagttggc gtggagactt
tgcagcctga gggccaggca ggagcacgag 540tggaaagcaa ctcagaggga
acctcctctg agccctgtgc cgaccgcccc aatgccgtga 600agttggagaa
ggtggaacca actcccgagg agtcccagga catgaaagcc ctgcagaagg
660agctagaaca gtttgccaag ctgctgaagc agaagaggat caccttgggg
tacacccagg 720ccgacgtggg gctcaccctg ggcgttctct ttggaaaggt
gttcagccag accaccatct 780gtcgcttcga ggccttgcag ctcagcctta
agaacatgtg taagctgcgg cccctgctgg 840agaagtgggt ggaggaagcc
gacaacaatg agaaccttca ggagatatgc aaatcggaga 900ccctggtgca
ggcccggaag agaaagcgaa ctagcattga gaaccgtgtg aggtggagtc
960tggagaccat gtttctgaag tgcccgaagc cctccctaca gcagatcact
cacatcgcca 1020atcagcttgg gctagagaag gatgtggttc gagtatggtt
ctgtaaccgg cgccagaagg 1080gcaaaagatc aagtattgag tattcccaac
gagaagagta tgaggctaca gggacacctt 1140tcccaggggg ggctgtatcc
tttcctctgc ccccaggtcc ccactttggc accccaggct 1200atggaagccc
ccacttcacc acactctact cagtcccttt tcctgagggc gaggcctttc
1260cctctgttcc cgtcactgct ctgggctctc ccatgcattc aaactga
13072832DNAArtificial SequenceA synthetic primer 28cgagaattcg
ccatgttggg ggacggggat tc 322930DNAArtificial SequenceA synthetic
primer 29caggtgtcca gccatcccac cgtactcgtc 303030DNAArtificial
SequenceA synthetic primer 30gacgagtacg gtgggatggc tggacacctg
303133DNAArtificial SequenceA synthetic primer 31gcgctcgagt
ctcagtttga atgcatggga gag 333232DNAArtificial SequenceA synthetic
primer 32cgagaattcg ccatgttggg ggacggggat tc 323330DNAArtificial
SequenceA synthetic primer 33caggtgtcca gccatcccac cgtactcgtc
303430DNAArtificial SequenceA synthetic primer 34gacgagtacg
gtgggatggc tggacacctg 303533DNAArtificial SequenceA synthetic
primer 35gcgctcgagt ctcagtttga atgcatggga gag 333623DNAArtificial
SequenceA synthetic primer 36tctttccacc aggcccccgg ctc
233723DNAArtificial SequenceA synthetic primer 37tgcgggcgga
catggggaga tcc 233824DNAArtificial SequenceA synthetic primer
38aaaggagaga agtttggagc ccga 243924DNAArtificial SequenceA
synthetic primer 39gggcgaagtg caattgggat gaaa 244024DNAArtificial
SequenceA synthetic primer 40agcagaagat gcggactgtg ttct
244124DNAArtificial SequenceA synthetic primer 41ccgcttgcac
ttcatccttt ggtt 244223DNAArtificial SequenceA synthetic primer
42gcctgacccg agagaagaag aag 234325DNAArtificial SequenceA synthetic
primer 43tggtggtgaa gttcgctaga gtaag 254422DNAArtificial SequenceA
synthetic primer 44ccaccactga aaggaacaac aa 224523DNAArtificial
SequenceA synthetic primer 45tccaacacga aatacacgtt gac
234620DNAArtificial SequenceA synthetic primer 46ccatgaacaa
ggaagggaaa 204720DNAArtificial SequenceA synthetic primer
47tccgctgtgt gtccatttag 204819DNAArtificial SequenceA synthetic
primer 48tgcaccacca actgcttag 194918DNAArtificial SequenceA
synthetic primer 49gatgcaggga tgatgttc 185020DNAArtificial
SequenceA synthetic primer 50cctcacttca ctgcactgta
205120DNAArtificial SequenceA synthetic primer 51caggttttct
ttccctagct 205219DNAArtificial SequenceA synthetic primer
52cccagcagac ttcacatgt 195320DNAArtificial SequenceA synthetic
primer 53cctcccattt ccctcgtttt 205420DNAArtificial SequenceA
synthetic primer 54gatgaactga ccaggcacta 205520DNAArtificial
SequenceA synthetic primer 55gtgggtcata tccactgtct
205620DNAArtificial SequenceA synthetic primer 56tgcctcaaat
tggactttgg 205722DNAArtificial SequenceA synthetic primer
57gattgaaatt ctgtgtaact gc 225820DNAArtificial SequenceA synthetic
primer 58tgaacctcag ctacaaacag 205920DNAArtificial SequenceA
synthetic primer 59tggtggtagg aagagtaaag 206024DNAArtificial
SequenceA synthetic primer 60gagcatgcag aagcgcagat caaa
246124DNAArtificial SequenceA synthetic primer 61tatggctgat
gctctggcag aagt 246224DNAArtificial SequenceA synthetic primer
62aggcttcata ggcatgctta ccct 246324DNAArtificial SequenceA
synthetic primer 63tgaagccttg ctctcttggt cact 246424DNAArtificial
SequenceA synthetic primer 64agacacagat ggttgggttc acct
246524DNAArtificial SequenceA synthetic primer 65tgcactcact
ctcccttctt gctt 246624DNAArtificial SequenceA synthetic primer
66acacctgtgc cagactaaga tgct 246724DNAArtificial SequenceA
synthetic primer 67tgacggtggc agaggttctt acaa 246824DNAArtificial
SequenceA synthetic primer 68tgaatagctg accaccagca cact
246924DNAArtificial SequenceA synthetic primer 69acaggctcca
gcctcagtac attt 247020DNAArtificial SequenceA synthetic primer
70tgtgcaccaa catctacaag 207120DNAArtificial SequenceA synthetic
primer 71gcgttcttgg ctttcaggat 207224DNAArtificial SequenceA
synthetic primer 72tgcccaagaa gtgttccctg tgta 247324DNAArtificial
SequenceA synthetic primer 73aaagtggtag tacgtgcaga cggt
247420DNAArtificial SequenceA synthetic primer 74aacagcgaca
cccactcctc 207524DNAArtificial SequenceA synthetic primer
75cataccagga aatgagcttg acaa 247622DNAArtificial SequenceA
synthetic primer 76aggttgaaaa tgaaggtttt tt 227723DNAArtificial
SequenceA synthetic primer 77tccaacccta ctaacccatc acc
237824DNAArtificial SequenceA synthetic primer 78ggaactgggt
gtggggaggt tgta 247929DNAArtificial SequenceA synthetic primer
79agcagattaa ggaagggcta ggacgagag 298026DNAArtificial SequenceA
synthetic primer 80aggtcaaggg gctagagggt gggatt 268123DNAArtificial
SequenceA synthetic primer 81tgagaaggcg aagtctgaag cca
238224DNAArtificial SequenceA synthetic primer 82taggagctct
tgtttgggcc atgt 248324DNAArtificial SequenceA synthetic primer
83acaagggtct gctcgtgtaa aggt 248430DNAArtificial SequenceA
synthetic primer 84ttttggtttt tagggtaagg tactgggaag
308530DNAArtificial SequenceA synthetic primer 85ccacgtgaat
aatcctatat gcatcacaat 308624DNAArtificial SequenceA synthetic
primer 86cacatgaagg agcacccgga ttat 248724DNAArtificial SequenceA
synthetic primer 87tccgggaagc gtgtacttat cctt 24881194DNAArtificial
SequenceA synthetic sequence 88atgttggggg acggggattc cccgggtccg
ggatttaccc cccacgactc cgccccctac 60ggcgctctgg
atatggccga cttcgagttt gagcagatgt ttaccgatgc ccttggaatt
120gacgagtacg gtgggatggc tggacacctg gcttcagact tcgccttctc
acccccacca 180ggtgggggtg atgggtcagc agggctggag ccgggctggg
tggatcctcg aacctggcta 240agcttccaag ggcctccagg tgggcctgga
atcggaccag gctcagaggt attggggatc 300tccccatgtc cgcccgcata
cgagttctgc ggagggatgg catactgtgg acctcaggtt 360ggactgggcc
tagtccccca agttggcgtg gagactttgc agcctgaggg ccaggcagga
420gcacgagtgg aaagcaactc agagggaacc tcctctgagc cctgtgccga
ccgccccaat 480gccgtgaagt tggagaaggt ggaaccaact cccgaggagt
cccaggacat gaaagccctg 540cagaaggagc tagaacagtt tgccaagctg
ctgaagcaga agaggatcac cttggggtac 600acccaggccg acgtggggct
caccctgggc gttctctttg gaaaggtgtt cagccagacc 660accatctgtc
gcttcgaggc cttgcagctc agccttaaga acatgtgtaa gctgcggccc
720ctgctggaga agtgggtgga ggaagccgac aacaatgaga accttcagga
gatatgcaaa 780tcggagaccc tggtgcaggc ccggaagaga aagcgaacta
gcattgagaa ccgtgtgagg 840tggagtctgg agaccatgtt tctgaagtgc
ccgaagccct ccctacagca gatcactcac 900atcgccaatc agcttgggct
agagaaggat gtggttcgag tatggttctg taaccggcgc 960cagaagggca
aaagatcaag tattgagtat tcccaacgag aagagtatga ggctacaggg
1020acacctttcc cagggggggc tgtatccttt cctctgcccc caggtcccca
ctttggcacc 1080ccaggctatg gaagccccca cttcaccaca ctctactcag
tcccttttcc tgagggcgag 1140gcctttccct ctgttcccgt cactgctctg
ggctctccca tgcattcaaa ctga 1194
* * * * *