U.S. patent application number 15/332301 was filed with the patent office on 2017-09-21 for ex vivo development, expansion and in vivo analysis of a novel lineage of dendritic cells.
The applicant listed for this patent is Lung-Ji Chang. Invention is credited to Lung-Ji Chang.
Application Number | 20170267974 15/332301 |
Document ID | / |
Family ID | 46051606 |
Filed Date | 2017-09-21 |
United States Patent
Application |
20170267974 |
Kind Code |
A1 |
Chang; Lung-Ji |
September 21, 2017 |
EX VIVO DEVELOPMENT, EXPANSION AND IN VIVO ANALYSIS OF A NOVEL
LINEAGE OF DENDRITIC CELLS
Abstract
Disclosed herein are new methods of producing a novel line of
dendritic cells. The method comprises subjecting a sample of
hematopoietic stem/precursor cells to a first feeder culture system
that is supplemented with a first set of factors and a second
feeder culture system supplemented with a second group of factors.
The disclosure also pertains to new cell types that may be used as
cancer immunotherapy.
Inventors: |
Chang; Lung-Ji;
(Gainesville, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Chang; Lung-Ji |
Gainesville |
FL |
US |
|
|
Family ID: |
46051606 |
Appl. No.: |
15/332301 |
Filed: |
October 24, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13885025 |
Aug 29, 2013 |
9476029 |
|
|
PCT/US2011/060560 |
Nov 14, 2011 |
|
|
|
15332301 |
|
|
|
|
61413436 |
Nov 13, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 5/0639 20130101;
C12N 2501/25 20130101; C12N 2501/2302 20130101; C12N 2501/2315
20130101; A61K 2039/5154 20130101; A61K 35/15 20130101; C12N
2501/2307 20130101; A61K 2039/5156 20130101; A61K 39/0011 20130101;
C12N 2501/052 20130101; C12N 2501/22 20130101; C12N 2510/00
20130101; C12N 2501/125 20130101; C12N 2501/145 20130101; C12N
2501/26 20130101; C12N 2501/2304 20130101; A61P 35/00 20180101 |
International
Class: |
C12N 5/0784 20100101
C12N005/0784; A61K 35/15 20150101 A61K035/15; A61K 39/00 20060101
A61K039/00 |
Claims
1. A method of producing a lineage of DC cells, said method
comprising: culturing a population of hematopoietic stem/progenitor
cells (HPCs) in a first feeder culture supplemented with kit ligand
(KL); fms-like tyrosine kinase 3 ligand (FL); thrombopoietin (TPO);
IL-3; IL-6 and/or basic fibroblast growth factor (bFGF) under
conditions to produce a population of first expanded cells;
culturing said first expanded cells in a second feeder culture
supplemented with KL, FL, TPO, GM-CSF, and/or IL-15 under
conditions to produce DC progenitor cells (DCPs).
2. The method of claim 1, wherein the first feeder culture
comprises cells engineered to produce KL, FL, TPO, IL-3, IL-6
and/or bFGF.
3. The method of claim 2, wherein said first feeder culture
comprises cells engineered via a viral vector comprising an
expression construct comprising a sequence encoding KL, FL, TPO,
IL-3, IL-6 and/or bFGF.
4. The method of claim 1, wherein the second feeder culture
comprises cells engineered to produce KL, FL, TPO, GM-CSF, and/or
IL-15.
5. The method of claim 1, wherein said first expanded cells possess
HPC phenotypic characteristics.
6. The method of claim 1, further comprising culturing said DC
progenitor cells in a third culture supplemented with GM-CSF and
IL-15 under conditions to produce a population of cells having a
phenotype similar to myeloid DCs.
7. The method of claim 6, wherein the third culture is feeder
free.
8. A sample of DCPs produced by the method of claim 1.
9. A sample of cells produced by the method of claim 6.
10. A method of treating a patient in need, said method comprising
administering a therapeutically effective amount of a sample of
cells according to claim 6, wherein said patient in need is one who
has cancer or infection related condition.
11. The method of claim 5, wherein said patient in need is one who
has multiple myeloma, acute myeloid leukemia, acute lymphoblastic
leukemia, Hodgkin's lymphoma or glioblastoma.
12. The method of claim 5, wherein said cells are autologous to or
compatible with said patient in need.
13. A method of treating a patient in need, said method comprising
administering a therapeutically effective amount of a sample of
cells according to claim 9, wherein said patient in need is one who
has cancer or infection related condition.
14. The method of claim 8, wherein said patient in need is one who
has multiple myeloma, acute myeloid leukemia, acute lymphoblastic
leukemia, Hodgkin's lymphoma orglioblastoma.
15. The method of claim 13, wherein said HPCs are autologous to or
compatible with said patient in need.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is related to U.S. Provisional Application
No. 61/413,436; filed Nov. 13, 2010, to which priority is claimed
under 35 USC 119, and which is incorporated herein in its
entirety.
BACKGROUND
[0002] Dendritic cells (DCs) initiate primary and memory immune
responses as well as activate innate immunity and therefore, play a
pivotal role in immunotherapy [1]. Accounting for only 0.02-0.2% of
the total white blood cells, the number of DCs that can be isolated
from peripheral blood is limited [2]. When cultured with supplement
of GM-CSF and IL-4, PBMCs or CD14-selected monocytes generate DCs
at about 50% of the starting cell number. Furthermore, patients
with cancer or chronic infections often suffer from a compromised
immune system with increased myeloid suppressor cells and
dysfunctional DCs [3-9].
[0003] The developmental origin and tissue distribution of various
lineages of human versus mouse DCs are still not well defined
[10-15]. Transgenic mouse studies have reported several
transcription factors implicated in regulating DC differentiation,
which include zinc finger protein Ikaros, PU.1, relB, the
helix-loop-helix (HLH) transcription factor inhibitor of DNA
binding or differentiation 2 (Id2), interferon regulatory factor
(IRF) 4 and 8, the Ets-domain transcription factor Spi-B, and the
Notch family of proteins [14, 16]. In addition, growth factors such
as Flt3L, KL, TPO, TNF.alpha., GM-CSF, IL-3, IL-4, and IL-6 have
been shown to promote development and maturation of DCs
[17-20].
[0004] Growth factors such as KL and Flt3L appear to be strictly
required for the generation of DC progenitors from HPCs in culture
[21]. In the laboratory, GM-CSF and IL-4 are routinely used to
generate DCs from adherent PBMCs, and GM-CSF and TNF-.alpha. can
induce differentiation of HPCs into interstitial DCs and
Langerhan's cells in 12-14 days [22]. GM-CSF and IL-15, on the
other hand, drive DC differentiation from monocytes and bone marrow
(BM) but the role of IL-15 in myeloid lineage development remains
poorly understood [23, 24]. IL-15 is a member of the .gamma.C
receptor family of cytokines which is expressed by a variety of
cell types important to the survival of fibroblasts, T cells and
natural killer cells. IL-15 has been shown to promote the survival
of mature DCs through an autocrine antiapoptotic mechanism [25,
26], and IL-15-derived DCs are reported to display Langerhans
cell-like features with strong T cell activation potential [23, 24,
27, 28].
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] FIG. 1. The ex vivo HPC to DC expansion and development
system. (A) Schematic representation of the LSC culture system and
the lentivector constructs. The two LSC lines, LSC-KFT63b and
LSC-KFT-GM15, produce the specified hematopoietic growth factors,
which support the expansion of HPCs and DCPs. (B) and (C)
Semi-quantitative RT-PCR analyses of lentiviral transgene
expression in the LSC lines. All of the growth factor genes are
human origin except for the mouse GM-CSF (mGM-CSF); the control
endogenous mouse GAPDH (mGAPDH) gene expression is shown at
bottom.
[0006] FIG. 2. Expansion of CD34+ HPCs and phenotype analysis. (A)
Ex vivo expansion kinetics of CD34+ HPCs in LSC culture. HPCs were
purified using anti-CD34 Ab magnetic heads and analyzed with
anti-CD34, anti-CD133, and anti-CD33 Abs by flow cytometry. The
expansion kinetics on LSC-KFT63b of HPCs from four donors are
plotted. (B) Flow cytometry analysis of hematopoietic progenitor
and differentiation markers after HPC expansion in LSC culture for
9 days. Both cord blood and adult PB CD34+ HPCs were analyzed.
[0007] FIG. 3. Ex vivo generation of functional DCs. (A) Schematic
illustration of expansion of human and mouse DCPs in culture. The
human (CD34.sup.+) or mouse (Scal.sup.+/Lin.sup.-) HPCs were
cultured on LSC-KFT63b for 10 days, and then transferred to
LSC-KFT-GM15 (LSC-KFT-mGM15 for mouse cells) to expand for 30 days.
The resulting DCPs were further cultured in medium supplemented
with GM-CSF, IL-15 and growth factors to induce immature and mature
DCs.
[0008] (B) Kinetic analysis of myeloid cell differentiation
markers. The expression kinetics of molecular markers for myeloid
cells including PU.1, Langerin, Id2, hIL7R-.alpha., CCL17, hCCR6,
and E-cadherin (E-CAD) in the developing human DCPs were examined
by RT-PCR. (C) Expression kinetics of DC surface markers of the
DCPs based on flow cytometry analysis. (D) Surface phenotype of day
37 DCPs from the LSC-KFT-GM15 culture. The number inside each of
the flow graph represents percentage of positive cells.
[0009] FIG. 4. Microarray dendogram analysis of the ex vivo
differentiated DCPs. Gene expression profiles of CD34.sup.+
HPC-derived DCPs at early (day 4) and late (day 23) time points
after differentiation in LSC-KFT-GM15 were examined using Illumina
human whole-genome RefSeq 8 expression BeadChip containing 24,000
genes. The related cell types are grouped in clusters in the
dendogram, including day 4 and day 23 DCP specimens, IL-4 DC
specimens (including a mixed IL-4 DCs from five donors), IL-15 DCs,
and three CD34+ HPC specimens. Stratagene universal human reference
RNA (SUHRR) was included for quality control.
[0010] FIG. 5. Functional analyses of the ex vivo expanded DCPs.
(A) Analysis of antigen capture function of the ex vivo derived
DCPs. Antigen capture was demonstrated using dextran-FITC or
OVA-FITC particle internalization followed by flow cytometry
analysis. Examples of FITC-positive control PBMC-derived DCs are
shown at top; antigen capture was detected at 37.degree. C. but not
at 4.degree. C. (B) Analysis of antigen-specific T cell stimulation
function. DCs were transduced with LVs encoding a control truncated
NGFR (tNGFR) protein or BMLF protein of EBV, and incubated with
autologous T cells (from the same HLA-A*0201 donor) for 10-12 days.
The BMLF-specific A*0201 TCR bearing T cells were detected using a
PE-conjugated MHC-peptide pentamer by flow cytometry (left panel).
Antigen-specific effector function was analyzed based on
intracellular expression of IFN-.gamma. as described in Materials
and Methods.
[0011] FIG. 6. DCPs derived from BM HPCs of tumor-bearing mice
suppress tumor growth in vivo. (A) Ex vivo expansion of DCPs from
BM HPCs of tumor-bearing Bulb/c mice. Balb/c mice were injected
with CT26/optE6E7 tumor cells, and after 14 days, BM HPCs
(Scal.sup.+/Lin.sup.-) were harvested and cultured on LSC-KFT
cells. After ten days, the expanded HPCs were transferred to
LSC-KFT-mGM15 to generate DCPs. A representative mouse DCP
expansion growth curve is shown. (B) Suppression of tumor growth in
Balb/c mice immunized with LV-modified DCPs. CT27/optE6E7 tumor
cells were first established in Balb/c mice. The mice were
immunized with the ex vivo expanded DCPs, which were derived from
the BM HPCs of CT26/optE67 tumor-bearing Balb/c mice. Two types of
LV-modified DCs were tested: DCs transduced either by LV-optE6E7
alone or by LV-optE6E7 plus LV-calnexin. The percentages of
survival of the two groups of mice are illustrated. Survival was
based on tumor size smaller than 1 cm.sup.3 without lesions.
DETAILED DESCRIPTION
[0012] Although DCs can be derived from PBMCs, BM or embryonic stem
cells, the source and the amount of these progenitor cells are
restricted. While ex vivo DC development and expansion approaches
have been attempted, only a moderate number of DCs can be generated
with the most efficient system reporting about 94 fold expansion of
DCs from BM cells [29, 30]. The scarcity and the variability of the
various DC subsets have significantly hindered fundamental studies
of this important lineage of immune cells. Innovative strategies
that can reproducibly generate a large amount of functional DCs
from a limited number of progenitor/stem cells are urgently
needed.
[0013] Disclosed herein is a novel ex vivo culture system that
combines expansion of HPCs and differentiation of a unique lineage
of DC progenitors (DCPs). This system supports expansion and
development of both human and mouse HPCs and DCs. The total number
of DCs generated under this system reached more than five orders of
magnitude in 30-40 days, and the ex vivo differentiated DCs
displayed antigen capture, T cell activation and tumor suppression
functions similar to that of the peripheral blood and BM-derived
DCs. Thus, a large number of autologous HPCs and DCs can now be
routinely generated from a small number of CD34.sup.+ HPCs for the
study of immune cell development with potential of translational
applications.
[0014] Embodiments of the invention relate to a new method of
production a new line of cells having properties of dendritic cells
(DCs) and DC progenitor cells (DCPs). Dendritic cells (DCs) play a
key role in innate and adaptive immunity but the access to
sufficient amount of DCs for basic and translational research has
been limited. Provided herein is a novel ex vivo system to develop
and expand DCs from hematopoietic stem/progenitor cells (HPCs).
Both human and mouse HPCs were expanded first in feeder culture
supplemented with c-Kit ligand (KL, stem cell factor, steel factor
or CD117 ligand), Flt3 ligand (fms-like tyrosine kinase 3, Flt3L,
FL), thrombopoietin (TPO), IL-3, IL-6, and basic fibroblast growth
factor (bFGF), and then in a second feeder culture ectopically
expressing all above growth factors plus GM-CSF and IL-15. The
techniques described herein can be implemented for human, and
non-human animal stem cells, such as HPCs.
[0015] When using the new dual culture system, CD34.sup.+ HPCs
differentiated toward DC progenitors (DCPs), which expanded more
than five orders of magnitude. The DCPs showed myeloid DC surface
phenotype with up-regulation of transcription factors PU.1 and Id2,
and DC-related factors homeostatic chemokine ligand 17 (CCL17) and
beta-chemokine receptor 6 (CCR6). Multiplex ELISA array and cDNA
microarray analyses revealed that the DCPs shared some features of
IL-4 and IL-15 DCs but displayed a pronounced proinflammatory
phenotype. DCP-derived DCs showed antigen-uptake and immune
activation functions analogous to that of the peripheral
blood-derived DCs. Furthermore, bone marrow HPC-derived DCP
vaccines of tumor-bearing mice suppressed tumor growth in vivo.
[0016] This novel approach of generating DCP-DCs, which are
different from known IL-4 and IL-15 DCs, overcomes both
quantitative and qualitative limitations in obtaining functional
autologous DCs from a small number of HPCs with great translational
potential.
[0017] According to one embodiment, disclosed herein is method of
producing a lineage of DC cells that includes culturing a
population of hematopoietic stem/progenitor cells (HPCs) in a
feeder culture supplemented with kit ligand (KL); fms-like tyrosine
kinase 3 ligand (FL); thrombopoietin (TPO); IL-3; IL-6 and/or basic
fibroblast growth factor (bFGF). The HPCs are cultured under
conditions to produce a population of first expanded cells and then
the first expanded cells are cultured in a second feeder culture
ectopically expressing KL, FL, TPO, GM-CSF, and IL-15 under
conditions to produce DC progenitor cells. According to a more
specific embodiment, the DC progenitor cells are cultured in media
in supplemented with GM-CSF and IL-15 under conditions to produce a
population of cells having a phenotype similar to myeloid DCs.
[0018] Another embodiment disclosed herein pertains to a sample of
DCPs produced by methods taught herein.
[0019] According to another embodiment, disclosed herein is method
of treating a patient in need. The method involves administering a
therapeutically effective amount of a sample of DCP cells produced
according methods taught herein, wherein the patient in need is one
who has cancer or infection related condition. In a specific
embodiment, the patient in need is one who has multiple myeloma,
acute myeloid leukemia, acute lymphoblastic leukemia, Hodgkin's
lymphoma and glioblastoma. According to another method, the DCPs
are derived from HPS that are autologous to or compatible with a
patient in need.
EXAMPLES
Example 1: Methods
[0020] Cells and Mice
[0021] CD34.sup.+ cells used in this study were purified from BM,
mobilized peripheral blood (MPB) or cord blood (CB) using magnetic
beads (Miltenyi Biotec) following the manufacturer's instructions
or purchased from AllCell Inc. (San Mateo, Calif.), Cambrex
(Baltimore, Md.) and National Disease Research Interchange
(Philadelphia, Pa.). Buffy coats of peripheral blood of healthy
donors were purchased from Civitan Blood Center (Gainesville,
Fla.). PBMCs were isolated from buffy coats of healthy donors or
from blood of cancer patients with approval of the Institutional
Review Board of University of Florida. B lymphoblastoid cell lines
(BLCLs) were generated by transforming peripheral blood B
lymphocytes with EBV as described previously [31]. The BLCLs were
propagated in complete RPMI-1640 medium (Gibco, Grand Island, N.Y.)
supplemented with 2 mM L-glutamine, 100 ug/ml streptomycin, 100
IU/ml penicillin and 10% heat inactivated fetal bovine serum (FBS)
at 37.degree. C. with 5% CO.sub.2. The mouse fetal stromal cells
were cultured in Minimal Essential Medium Alpha (Gibco, Grand
Island, N.Y.) supplemented with 2 mM L-glutamine, 100 ug/ml
streptomycin, 100 IU/ml penicillin and 20% heat inactivated FBS
(Gibco) at 37.degree. C. with 5% CO.sub.2. CT26 mouse colon
carcinoma cell line was purchased from ATCC (catalogue no.
CRL-2638) and cultured in Dulbecco Modified Eagle's Medium (Gibco,
Grand Island, N.Y.) supplemented with 2 mM L-glutamine, 100 ug/ml
streptomycin, 100 IU/ml penicillin and 10% heat inactivated FBS
(Gibco) at 37.degree. C. with 5% CO.sub.2. BALB/c mice were
obtained from Jackson Laboratory (Bar Harbor, Me.) with approval
from the Institutional Animal Care and Use Committee of University
of Florida.
[0022] Antibodies and Reagents
[0023] Fluorescein isothiocyanate (FITC)-conjugated Abs to CD4,
CD8, CD11c, CD33, CD34, CD38, CD86, IFN-.gamma., and HLA-DR,
phycoerythrin (PE)-conjugated Abs to CD4, CD8, CD11c, CD34, CD83,
CD90, CD123, HLA-DR, IFN-.gamma., and TNF.alpha., PerCP
Cy5.5-conjugated Ab to CD8, CD33, PE-Cy7-conjugated antibodies to
CD8, CD11b, CD11c, CD34, CD62L, CD40 and CD80, and allophycocyanin
(APC)-conjugated Abs to CD1a, CD3, CD11c, CD14, CD33, CD69, CD83,
CD90, CD133, IFN-.gamma. and TNF-.alpha. were purchased from BD
Pharmingen (San Diego, Calif.), eBioscience (San Diego, Calif.),
Miltenyi Biotec (Auburn, Calif.), and Caltag Laboratories
(Invitrogen, Carlsbad, Calif.) as listed in Supplemental Table 1.
Isotype-matched antibodies were included as controls. IILA-A2
restricted, EBV BMLF1 GLC-peptide (amino acid 280-288, GLCTLVAML)
pentamer was purchased from Proimmune (Springfield, Va.).
[0024] Lentivector Preparation and Gene Transfer
[0025] Lentivectors (LVs) were constructed as described previously
[32-34]. The growth factor cDNAs were amplified by PCR using
primers designed to contain an optimized translation initiation
sequence (-CCACC- 5' to the initiation codon). The primers used in
this study are listed in Supplemental Table 2. The amplified cDNAs
were cloned into the self-inactivating pTYF plasmid behind the
EF1.alpha. promoter. To generate feeder cells, mouse fetal stromal
cells were multiply transduced with LVs at 10-50 infectious
unit/cell in 12-well plates in a minimal volume of 0.3 ml per well.
After 2 h, 0.5 ml of fresh media was added and cells were incubated
at 37.degree. C. overnight. The infected cells were continuously
propagated for more than 50 passages and stable lentiviral
transgene expression was confirmed. The mouse CT26 tumor cells and
DCs were transduced with LVs encoding a codon-optimized human HPV
E6-E7 fusion protein and the chaperone protein calnexin as
previously described [35].
[0026] RNA Extraction, RT-PCR and Microarray Analysis
[0027] RNA was extracted using Tri-reagent (MRC Inc., Cincinnati,
Ohio) and oligo(dT).sub.15-primed cDNA was made with MMLV reverse
transcriptase (Promega Inc., Madison, Wis.). For semi-quantitative
PCR, all reactions used the same serially diluted cDNA normalized
to the mouse GAPDII (mGAPDII). The PCR amplification conditions
were as follows: denaturing temperature, 95.degree. C.; annealing
temperature, 55-62.degree. C.; extension temperature, 72.degree.
C.; the amplification cycles were 25-35 cycles. Products were
resolved by agarose gel electrophoresis and visualized by ethidium
bromide staining. The PCR primers used in this study are listed in
Supplemental Table 2.
[0028] For gene expression microarray analysis, RNA samples were
harvested from purified CD34.sup.+ HPCs, ex vivo cultured DCPs, and
adherent PBMC-derived IL-4 and IL-15 DCs. These RNA samples were
analyzed using Illumina Human RefSeq-8 Expression BeadChips. RNA
quantity was determined with the Agilent RNA 6000 Nano Kit and
Bioanalyzer. All samples displayed 28S and 5.8S peaks indicating
intact full length RNA. Synthesis of double-stranded cDNA and in
vitro transcription were performed with the Ambion Illumina
TotalPrep kit according to manufacturers' instructions. For each
sample, input quantity for the first strand synthesis was
normalized to 200 ng. After in vitro transcription reaction, yield
of purified cRNA was assessed with the RiboGreen assay and quality
was assessed with the Agilent Bioanalyzer. BeadChip hybridization,
staining and scanning were performed according to Illumina whole
genome expression for BeadStation. For each sample, input of cRNA
was normalized to 1500 ng. As control, Stratagene Universal Human
Reference (SUHR) RNA was labeled with the Ambion TotalPrep kit. The
labeled cRNA was used as interchip hybridization replicates and
showed strong correlation. Biological replicate pairs were analyzed
and for unnormalized data, the linear r.sup.2 was greater than 0.94
for all replicates.
[0029] Generation of Mature DCs and Antigen-Specific Immune
Cells
[0030] PBMCs were isolated after Ficoll-Hypaque density
centrifugation (Sigma Aldrich, St Louis, Mo.). After plastic
adherence, the adherent cells were cultured in 50 ng/ml GM-CSF and
25 ng/ml IL-4 (eBiosource International, Inc. Camarillo, Calif.) in
serum-free AIM-V medium (Invitrogen, San Diego, Calif.) to generate
immature DCs. Immature DCs were transduced with LVs, and treated
with LPS (1 ug/ml) and TNF.alpha. (20 u/ml) for 24 hr to induce
maturation. The mature DCs were loaded with 5 ug/ml of specific
peptides. The non-adherent PBMCs were cocultured with irradiated
(10 Gy) mature DCs, at a 20:1 ratio, in AIM-V supplemented with
IL-2 (12.5 U/ml) and IL-7 (10 ng/ml) in 24-well plates. At day 12
of coculture, the T cells were restimulated or harvested for
analysis as previously described [36, 37]. The DCs of BALB/c mice
were generated from BM of tumor-bearing mice and transduced with
LVs as previously described [38].
[0031] Quantitative Cytokine and Chemokine Multiplexed
Enzyme-Linked Immunosorbent Assay (ELISA) Arrays
[0032] DCs were washed twice with PBS and cultured in AIM-V without
growth factors and other supplements at a density of 10.sup.6
cells/ml for 24 hr. The supernatants were collected and delivered
to Quansys Biosciences (Logan, Utah) for custom multiplexed sample
testing as previously described [35]. Each sample was tested in
triplicate. The list of cytokines and chemokines tested included:
IL-1a, IL-1b, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-13,
IL-17, IL-23, IFN-.gamma., TNF-.alpha., TNF-.beta., Eotoxin,
growth-related oncogene-alpha (GRO-.alpha.), monocyte chemotactic
protein 1 (MCP-1), MCP-2, regulated upon activation, normal T-cell
expressed and secreted cytokine (RANTES), 1-309 and thymus and
activation-regulated chemokine (TARC).
[0033] Antibody and Pentamer Staining and Flow Cytometry
[0034] For antibody (Ab) staining, single-cells were suspended in
PBS containing 2% FBS and 0.05% sodium azide and pre-incubated with
anti-CD16/CD32 Ab for 10 min to block FcRs. Expression of cell
surface markers was analyzed by standard four-color staining using
FITC-, PE-, PE-Cy7 or PerCP and APC-conjugated primary Abs. To
evaluate the expression of intracellular molecules, cells were
washed and restimulated for 5 hr in the presence of brefeldin A (1
ug/ml) during the last 2.5 hr of culture. The stimulated cells were
stained with anti-surface marker Abs, washed and permeabilized with
the CytoFix-Cytoperm kit (RD Pharmingen), according to the
manufacturer's instruction, then stained with anti-intracellular
marker Abs, and analyzed by flow cytometry. For multimer staining,
the resting T cells were stained with PE-labelled pentamer
(Proimmune) for 12 min at room temperature, followed by
FITC-labeled or PE Cy7-labelled anti-CD8 antibody for 30 min on ice
and analyzed by flow cytometry. Data acquisition and analysis were
done on a FACSCalibur and FACSAria using CellQuest and FACSDiva
software, respectively (BD Biosciences, San Jose, Calif.), or
Flowjo software (Tree Star, Inc. Ashland, Oreg.).
[0035] Analysis of Antigen Uptake
[0036] Immature DCs were harvested and washed with AIM-V twice and
re-suspended in AIM-V at a concentration of 5.times.10.sup.5 cells
per ml. DCs were incubated with Dextran-FITC or OVA-FITC (Molecular
Probes, Inc., Eugene, Oreg.) at 37.degree. C. for 1 h; a parallel
control was incubated at 4.degree. C. for 1 h. Cells were washed
three times with cold FACS buffer, resuspended in 100 ul of cold
FACS buffer, stained with APC-conjugated anti-CD11c Ab (RD
Biosciences, CA) and analyzed by flow cytometry.
[0037] In Vivo DC Vaccine Tumor Model
[0038] BALB/c CT26 colon cancer cells were transduced with
LV-optE6E7 encoding a fusion protein of HPV16 E6/E7 to generate the
CT26-E6E7 cell line. The BALB/c mice were inoculated with
1.times.10.sup.5 CT26-E6E7 tumor cells subcutaneously. Seven days
later the mice were vaccinated with 2-5.times.10.sup.5 immature
DC/LV-optE6E7 or DC/LV-optE6E7/LV-calnexin derived from
tumor-bearing mice, weekly for 2 weeks (n=5 per group). Tumor size
was measured over time using calipers and mean tumor volume (in
mm.sup.3) was determined.
[0039] Statistical Analysis.
[0040] The statistical analysis was performed using Student's
t-test and GRAPHPAD PRISM 4 software.
Example 2: Results
[0041] Expansion of CD34.sup.+ HPCs and Development of DC
Progenitors (DCPs)
[0042] HPCs can expand in culture but have limited potential of
maintaining hematopoietic stem cell phenotype and function [39]. A
series of lentivector-modified stromal cell (LSC) lines were
established to provide cell-free and cell-associated signals that
can support continuous expansion of HPCs and differentiation of DCs
(FIG. 1). The LSC lines include LSC-KFT (KL, Flt3L, TPO), LSC-KFTb
(KL, Flt3L, TPO and bFGF), LSC-KFT63 (KL, Flt3L, TPO, IL-6, and
IL-3) and LSC-KFT63b (KT, Flt3L, TPO, bFGF, IL-6, IL-3 and bFGF)
for the expansion of HPCs, and LSC-KFT-GM15 (KL, Flt3L, TPO, GM-CSF
and IL-15) and LSC-KFT-mGM15 (KL, Flt3L, TPO, mouse GM-CSF, and
IL-15) for the differentiation and expansion of human and mouse
DCs, respectively. LSC-KFT, LSC-KFTb, LSC-KFT63 and LSC-KFT63b
supported HPC expansion to similar extents, and the total expansion
fold varied with individual donors. Under this culture condition,
HPCs consistently expanded twenty to one hundred-fold in twenty
days, followed by more than one thousand-fold differentiation and
expansion into DCPs in thirty days (FIG. 1A). This dual culture
system supports expansion and development of DCs from both human
and mouse HPCs.
[0043] To verify the expression of the various growth factors in
LSCs, RNAs harvested from LSCs were analyzed by semi-quantitative
RT-PCR (FIGS. 1B and 1C). It was confirmed that lentivector
expression was stable even after 50 passages in these cell lines
(data not shown). Highly enriched human CD34.sup.+ HPCs derived
from adult mobilized peripheral blood and BM expressed high level
of hematopoietic progenitor marker CD133 and low level of CD33
(FIG. 2A). This culture system supported HPC expansion for both
healthy donors and cancer patients; for example, adult peripheral
blood (PB) HPCs expanded in LSC-KFT63b to about one hundred-fold in
two to three weeks (FIG. 2A). Surface phenotype analysis indicated
that the ex vivo expanded HPCs gradually lost progenitor markers
(CD34, CD90, and CD133), which was accompanied by increased
expression of myeloid differentiation markers CD38 and CD33 (FIG.
2B). Similar results have been obtained with mouse BM
Scal.sup.+Lin.sup.- (lineage-minus) HPCs (data not shown).
[0044] Differentiation and Expansion of DCPs Toward Myeloid DC-Like
Phenotype
[0045] To see if the LSC culture system can generate functional
DCs, CD34.sup.+ HPCs were first expanded in LSC-KFT63b. After an
initial 20-40-fold expansion, the cells were transferred to
LSC-KFT-GM15. The DCPs continued to expand several orders of
magnitude in 30 days; they were then transferred to feeder-free
culture supplemented with GM-CSF and IL-15 to generate functional
immature DCs as illustrated in FIG. 3A.
[0046] Analysis of myeloid and DC lineage differentiation markers
including PU.1, Langerin, Id2, hIL7R-a, CCL17, hCCR6, and
E-cadherin (E-CAD) of the DCPs from day 0, 4, 9, 13, 23 and 39 by
semi-quantitative RT-PCR revealed a gradual increase in myeloid
(PU.1) and DC differentiation markers (Id2, hIL7R-a, CCL17, and
hCCR6), and a stochastic expression of differentiating Langerhans
cell markers (Langerin or CD207 and E-CAD) as compared with
monocyte-derived immature DCs (imDC, FIG. 3B). After 35 days, the
DCPs displayed a differentiation profile similar to that of
monocyte-derived imDCs, except for E-CAD, which was down-regulated.
Kinetic analysis of monocyte and DC markers including CD14, CD11c,
CD1a, CD1b, HLA-DR, CD83, CD40, CD123, and CD86 by flow cytometry
showed that the ex vivo-expanded DCPs gradually differentiated
toward mature DCs with increased expression kinetics of
costimulatory molecules CD40, CD86, and DC maturation marker CD83
(FIG. 3C). A representative flow cytometry analysis of DC markers
of day 39 DCPs is shown in FIG. 3D; at this time point, DCPs
displayed increased activation and maturation markers resembling
conventional mature DCs. Similar results were observed with mouse
DCPs expanded in the LSC-KFT-mGM15 culture (not shown).
[0047] We next examined the gene expression profile of the DCPs at
different time points after differentiation from HPCs using
Illumina BeadChip Human RefSeq-8 arrays. RNA samples were harvested
from an early time point (day 4) and a late time point (day 23),
and compared to RNAs harvested from CD34.sup.+ HPCs and adherent
PBMC-derived IL-4 and IL-15 DCs for comparison. Cluster analysis of
unnormalized sample data showed that all biological replicates (two
DCPs, two IL-4 DCs and three CD34.sup.+ HPCs) sorted into the same
groups (FIG. 4). Sample dendogram revealed that the day 4
differentiated DCPs displayed gene expression profile resembled
CD34.sup.+ HPCs, whereas the day 23 differentiated DCPs displayed
expression profile resembled IL-4 DCs (FIG. 4).
[0048] Cytokine and Chemokine Secretion Profiles of the Ex Vivo
Generated DCs
[0049] As the morphology and surface marker expression pattern of
the HPC-DCPs resembled myeloid DCs, we further examined the
expression profile of inflammatory cytokines and chemokines. For
comparison, we included the conventional IL-4 DCs and IL-15 DCs
generated from adherent PBMCs. HPC-DCPs from adult BM CD34.sup.+
HPCs were kept in feeder-free culture supplemented with GM-CSF and
IL-15 to generate immature DCs and then were treated with
TNF-.alpha. and LPS to induce maturation, and after extensive
washes, the cells were incubated in serum-free AIM-V medium at a
density of 1.times.10.sup.6 cells per ml for 24 hr. The
supernatants were collected and analyzed using a multiplex ELISA
array, which simultaneously measures a panel of 23 cytokines and
chemokines [35]. The results from two donors are summarized in
Table 1. We noted that HPC-DCPs displayed a trend of upregulation
of inflammatory cytokines and chemokines, with marked increase in
IL-1b, IL-6, GRO-.alpha.(CXCL1), I-309 (CCL1), MCP-1 (CCL2), and
MCP-2 (CCL8) compared with the traditional IL-4 DCs, suggesting
that the DCPs have potent proinflammatory leukocyte chemotactic and
activating functions. The overall cytokine and chemokine profile of
DCP-derived DCs mimicked those of the IL-15 DCs except that the
DCP-derived DCs produced reduced levels of IFN-.gamma. and
TNF.alpha., at levels similar to those of the IL-4 DCs, with
substantially increased expression of GRO-.alpha. and MCP-1.
[0050] Antigen Capture and T Cell Activation Functions of the Ex
Vivo Generated DCs
[0051] Professional antigen presenting cells can uptake and process
antigens and stimulate T cells. To examine these functions, we
compared the ex vivo generated DCs with immature adherent
PBMC-derived DCs (PBMC-DCs) for their antigen uptake function by
feeding them with fluorescent DQ-OVA (OVA-FITC) and dextran-FITC
particles. The PBMC-DCs captured fluorescent particles at
37.degree. C. but not at 4.degree. C., as demonstrated with flow
cytometry. The day 37 DCP-DCs, which contained a large number of
CD11c-positive cells, captured antigens as efficiently as did the
PBMC-DCs (FIG. 5A).
[0052] To see if the DCP-derived DCs were capable of activating
antigen-specific T cells, we set up a DC/T cell coculture system as
previously described [31, 35, 37]. The DCs were transduced with LVs
encoding a viral antigen, EBV BMLF (LV-BMLF), or a truncated
self-antigen tNGFR (LV-tNGFR). After maturation, the DCs were
cocultured with autologous monocyte-depleted PBMCs for 12 days to
generate antigen-specific T cells. The activated T cells were
restimulated with the corresponding DCs and incubated with a BMLF
peptide-specific (GLCTLVAML, HLA-A2*-restricted) MHC pentamer to
detect antigen-specific response. Both the DCP-DCs and the PBMC-DCs
induced antigen-specific T cell response when transduced with
LV-BMLF, but not LV-tNGFR (FIG. 5B, left panel). Intracellular
staining for IFN-.gamma. expression in CD4 and CD8 T cells
confirmed that the DCP-DCs activated BMLF-specific T cells as
effectively as did the PBMC-DCs (FIG. 5B, right panel). In
contrast, the self-antigen tNGFR did not register a substantial
response.
[0053] In Vivo Tumor Suppression Mediated by DCP-DCs Derived from
Tumor-Bearing Mice
[0054] The above assays demonstrated that the HPC-derived DCs
displayed antigen presentation and T cell activation functions
similar to that of monocyte-derived DCs. To examine their
therapeutic potential, experiment an experiment was designed using
a previously established syngeneic mouse tumor model. BALB/c mice
implanted with CT26 colon cancer cells expressing a codon-optimized
Human Papilloma Virus 16 (HPV 16) E6 and E7 fusion protein
(optE6E7) are protected through immunization with DCs transduced
with LVs encoding optE6E7 and calnexin, a chaperone protein [31,
35]. To mimic situation in a cancer patient, DCPs were derived from
BM of tumor-bearing mice to see if a protective anti-cancer immune
response can be induced. FIG. 6A illustrates the strategy of
generating DCPs from BM of tumor-bearing mice. CT26/optE6E7 tumors
were first established in BALB/c mice, after confirming tumor
growth, Scal.sup.+Lin.sup.- HPCs were purified from BM of the
tumor-bearing mice. The HPCs were expanded in the LSC culture
system as described; a representative mouse DCP expansion curve is
illustrated (FIG. 6A). The mouse DCPs expanded more than 6 orders
of magnitude within 30 days. To generate DC vaccines, the tumor
mouse-derived DCPs were differentiated for two days in IL-15 DC
medium as described in Example 1, and transduced with LV-optE6E7 or
LV-optE6E7 plus LV-calnexin. BALB/c mice bearing CT26/optE6E7
tumors were divided into two groups of five mice each group, and
received two DC vaccinations at a one-week interval. It was
observed that mice injected with DCs modified by LV-optE6E7 plus
LV-calnexin displayed increased survival rate than those modified
by LV-optE6E7 alone (FIG. 6B), a result consistent with previous
findings using BM-derived IL-4 DCs [35].
Example 3: Discussion Related to Examples 1 and 2
[0055] The access to good quality and sufficient amount of
functional DCs is critical to the success of immunotherapy against
cancer and infections. In such settings, it is desirable to
generate a large number of DCs capable of activating
antigen-specific effector T cells but not T regulatory cells
(Tregs). For examples, infusion of myeloid DCs and systemic
administration of IL-2 have been shown to induce and expand
CD4.sup.+FoxP3.sup.+ Tregs in myeloma and renal cancer patients
[31, 40-42]. Presented herein is a reliable and highly reproducible
strategy based on expansion of CD34.sup.+ HPCs as well as
differentiation of a unique lineage of functional DC progenitors
(DCPs) using stromal cells engineered with lentivectors encoding
multiple growth factors. The ex vivo generated DCs exhibited
canonical antigen presentation functions including antigen uptake,
processing and activation of T cells and in vivo anti-cancer
effects.
[0056] The CD34.sup.+ HPCs constitute a heterogeneous cell
population that can generate various lineages of DCs [10, 15, 19,
43, 44]. A culture condition was adopted which supports expansion
of CD34.sup.+ HPCs and DC differentiation through the combination
of cell-free and cell-associated signals including those supporting
hematopoietic stem cell proliferation (KL, FL, TPO, IL-3, IL-6,
bFGF), myeloid DC differentiation (GM-CSF), as well as IL-15 which
is known to promote leukocyte survival and expansion. This unique
ex vivo culture condition supports expansion of a novel lineage of
DCs that are different from the conventional myeloid DCs. It is
plausible that the continued renewal of differentiating DCPs in
such a system was due to the lack of IL-4 and TNF-.alpha., the two
common growth factors used in many reported methods and known to
induce DC maturation and block proliferation thus limiting their
expansion [30]. This novel lineage of DCs is different from the
commonly known IL-4 DCs or IL-15 DCs. Multiplex cytokine and
chemokine array analysis suggests that DCPs resemble IL-15 DCs
except that DCPs expressed less TNF.alpha. and IFN-.gamma., but
much higher levels of inflammatory cytokines (IL-1a, IL-1b, and
IL-6) associated with high levels of chemotactic factors
(GRO-.alpha. and MCP-1) as compared with IL-15 DCs (Table 1). The
beadchip microarray analysis of gene expression profile indicates
that the ex vivo differentiated DCPs share a common DC progenitor
but branched in between the peripheral blood adherent cell-derived
IL-4 DCs and IL-15 DCs (FIG. 4). Functional analysis shows that
DCP-DCs are fully capable of antigen presentation and stimulation
of antigen-specific T cells. It is concluded that the ex vivo
derived DCP-DCs represent a unique lineage of DCs displaying
phenotype and function between IL-4 DCs that have prominent
adaptive immune functions, and IL-15 DCs that have prominent innate
immune functions.
[0057] Several studies have reported that in addition to KL, FL and
TPO, other growth factors including bFGF, bone morphogenetic
protein 4 (BMP4), IL-3, IL-6 or stromal cell derived factor-1
(SDF-1 or CXCL12) can help increase CD34.sup.+ HPC expansion and
maintain their undifferentiated state [45-47]. Epigenetic
modification using DNA methyltransferase (DNMT) inhibitor
5-azacytidine (5-aza) and/or histone acetylase inhibitor
trichostatin A (TSA) can block differentiation of hematopoietic
stem cells and moderately promote their expansion [48].
Supplementation of these factors in the LSC system, however, does
not further increase HPC expansion potential (data not shown).
Nevertheless, this ex vivo system offers a convenient and
reproducible two-dimensional culture system for the study of
self-renewal and development of human HSC and DC. Analysis of
additional regulatory factors can be easily integrated into this
culture system.
[0058] The development and maturation of DCs in cancer patients may
be functionally defective, resulting in reduced expression of class
II MHC and diminished antigen cross-priming activity [7, 49-51]. In
a previous report, it was shown that IL-4 DCs from multiple myeloma
patients can be functionally improved through upregulation of the
chaperone protein calnexin, which substantially increases the
secretion of inflammatory cytokines and chemokines accompanied by a
strong memory T cell response [31, 35]; DCP-DCs, as illustrated
here, may accomplish the same without further modifications. As
IL-15 has been shown to reduce Treg activities and increase
antigen-specific CD8 T cell response in vitro and in vivo, the ex
vivo generated DCP-DCs have potential of overcoming DC dysfunctions
in cancer patients [26, 52, 53]. DCPs from cancer patients
including multiple myeloma, acute myeloid leukemia, acute
lymphoblastic leukemia, Hodgkin's lymphoma and glioblastoma
patients have been successfully generated from a small number of BM
CD34.sup.+ HPCs over several orders of magnitude (>10.sup.6)
(unpublished). Thus, this ex vivo approach avoids potential immune
suppressive microenvironment of DC development in patients. Further
efforts in process development and standardization, and GMP
validation of the feeder culture system are needed before DCP-DCs
are ready for clinical trials.
[0059] This ex vivo DC development system supports a robust
expansion of a novel DC lineage in culture from a small number of
CD34.sup.+HPCs, which provides a critical solution to problems
often encountered in immunotherapy.
List of Abbreviations
[0060] BM, bone marrow; PB, peripheral blood; HPC, hematopoietic
progenitor cell; PBM, peripheral blood monocyte; LSC,
lentivector-modified stromal cell; LV, lentiviral vector; TPO,
thrombopoietin; KL, kit-ligand; FL, Flt3-ligand; bFGF, basic
fibroblast growth factor; DC, dendritic cell; DCP, DC progenitor;
tNGFR, truncated nerve growth factor receptor; BLCL, B
lymphoblastoid cell line; ICCS, intracellular cytokine
staining.
REFERENCES
[0061] 1. Farkas A, Conrad C, Tonel G, Borbenyi Z, Kemeny L, Dobozy
A, Nestle F O: Current state and perspectives of dendritic cell
vaccination in cancer immunotherapy. Skin Pharmacol Physiol 2006,
19:124-131. [0062] 2. Talarn C, Urbano-Ispizua A, Martino R, Batlle
M, Fernandez-Aviles F, Herrera C, Perez-Simon J A, Gaya A, Aymerich
M, Petriz J, et al: G-CSF increases the number of peripheral blood
dendritic cells CD16+ and modifies the expression of the
costimulatory molecule CD86+. Bone Marrow Transplant 2006,
37:873-879. [0063] 3. Menetrier-Caux C, Montmain G, Dieu M C, Bain
C, Favrot M C, Caux C, Blay J Y: Inhibition of the differentiation
of dendritic cells from CD34(+) progenitors by tumor cells: role of
interleukin-6 and macrophage colony-stimulating factor. Blood 1998,
92:4778-4791. [0064] 4. Ninomiya T, Akbar S M, Masumoto T, Horiike
N, Onji M: Dendritic cells with immature phenotype and defective
function in the peripheral blood from patients with hepatocellular
carcinoma. J Hepatol 1999, 31:323-331. [0065] 5. Brown R D, Pope B,
Murray A, Esdale W, Sze D M, Gibson J, Ho P J, Hart D, Joshua D:
Dendritic cells from patients with myeloma are numerically normal
but functionally defective as they fail to up-regulate CD80 (B7-1)
expression after huCD40L T stimulation because of inhibition by
transforming growth factor-beta1 and interleukin-10. Blood 2001,
98:2992-2998. [0066] 6. Peguet-Navarro J, Sportouch M, Popa I,
Berthier O, Schmitt D, Portoukalian J: Gangliosides from human
melanoma tumors impair dendritic cell differentiation from
monocytes and induce their apoptosis. J Immunol 2003,
170:3488-3494. [0067] 7. Gabrilovich D: Mechanisms and functional
significance of tumour-induced dendritic-cell defects. Nat Rev
Immunol 2004, 4:941-952. [0068] 8. Gervais A, Leveque J,
Bouet-Toussaint F, Burtin F, Lesimple T, Sulpice L, Patard J J,
Genetet N, Catros-Quemener V: Dendritic cells are defective in
breast cancer patients: a potential role for polyamine in this
immunodeficiency. Breast Cancer Res 2005, 7:R326-335. [0069] 9.
Gottfried E, Kreutz M, Mackensen A: Tumor-induced modulation of
dendritic cell function. Cytokine Growth Factor Rev 2008, 19:65-77.
[0070] 10. Wu L, D'Amico A, Hochrein H, O'Keeffe M, Shortman K,
Lucas K: Development of thymic and splenic dendritic cell
populations from different hemopoietic precursors. Blood 2001,
98:3376-3382. [0071] 11. MacDonald K P, Munster D J, Clark G J,
Dzionek A, Schmitz J, Hart D N: Characterization of human blood
dendritic cell subsets. Blood 2002, 100:4512-4520. [0072] 12.
Shortman K, Liu Y J: Mouse and human dendritic cell subtypes. Nat
Rev Immunol 2002, 2:151-161. [0073] 13. Chicha L, Jarrossay D, Manz
M G: Clonal type I interferon-producing and dendritic cell
precursors are contained in both human lymphoid and myeloid
progenitor populations. J Exp Med 2004, 200:1519-1524. [0074] 14.
Blom B, Spits H: Development of human lymphoid cells. Annu Rev
Immunol 2006, 24:287-320. [0075] 15. Geissmann F, Manz M G, Jung S,
Sieweke M H, Merad M, Ley K: Development of monocytes, macrophages,
and dendritic cells. Science 2010, 327:656-661. [0076] 16. Zenke M,
Hieronymus T: Towards an understanding of the transcription factor
network of dendritic cell development. Trends Immunol 2006,
27:140-145. [0077] 17. Canque B, Camus S, Dalloul A, Kahn E,
Yagello M, Dezutter-Dambuyant C, Schmitt D, Schmitt C, Gluckman J
C: Characterization of dendritic cell differentiation pathways from
cord blood CD34(+)CD7(+)CD45RA(+) hematopoietic progenitor cells.
Blood 2000, 96:3748-3756. [0078] 18. Hao Q L, Zhu J, Price M A,
Payne K J, Barsky L W, Crooks G M: Identification of a novel, human
multilymphoid progenitor in cord blood. Blood 2001, 97:3683-3690.
[0079] 19. Ferlazzo G, Klein J, Paliard X, Wei W Z, Galy A:
Dendritic cells generated from CD34+ progenitor cells with flt3
ligand, c-kit ligand, GM-CSF, IL-4, and TNF-alpha are functional
antigen-presenting cells resembling mature monocyte-derived
dendritic cells. J Immunother 2000, 23:48-58. [0080] 20. Chen X, He
J, Chang L-J: Alteration of T cell immunity by lentiviral
transduction of human monocyte-derived dendritic cells.
Retrovirology 2004, 1:37. [0081] 21. Curti A, Fogli M, Ratta M,
Tura S, Lemoli R M: Stem cell factor and FLT3-ligand are strictly
required to sustain the long-term expansion of primitive CD34+DR-
dendritic cell precursors. J Immunol 2001, 166:848-854. [0082] 22.
Caux C, Vanbervliet B, Massacrier C, Dezutter-Dambuyant C, de
Saint-Vis B, Jacquet C, Yoneda K, Imamura S, Schmitt D, Banchereau
J: CD34+ hematopoietic progenitors from human cord blood
differentiate along two independent dendritic cell pathways in
response to GM-CSF+TNF alpha. J Exp Med 1996, 184:695-706. [0083]
23. Mohamadzadeh M, Berard F, Essert G, Chalouni C, Pulendran B,
Davoust J, Bridges G, Palucka A K, Banchereau J: Interleukin 15
skews monocyte differentiation into dendritic cells with features
of Langerhans cells. J Exp Med 2001, 194:1013-1020. [0084] 24.
Pulendran B, Dillon S, Joseph C, Curiel T, Banchereau J,
Mohamadzadeh M: Dendritic cells generated in the presence of GM-CSF
plus IL-15 prime potent CD8+ Tc1 responses in vivo. Eur J Immunol
2004, 34:66-73. [0085] 25. Schluns K S, Lefrancois L: Cytokine
control of memory T-cell development and survival. Nat Rev Immunol
2003, 3:269-279. [0086] 26. Dubois S P, Waldmann T A, Muller J R:
Survival adjustment of mature dendritic cells by IL-15. Proc Natl
Acad Sci USA 2005, 102:8662-8667. [0087] 27. Anguille S, Smits E L,
Cools N, Goossens H, Berneman Z N, Van Tendeloo VF: Short-term
cultured, interleukin-15 differentiated dendritic cells have potent
immunostimulatory properties. J Transl Med 2009, 7:109. [0088] 28.
Hardy M Y, Kassianos A J, Vulink A, Wilkinson R, Jongbloed S L,
Hart D N, Radford K J: N K cells enhance the induction of CTL
responses by IL-15 monocyte-derived dendritic cells. Immunol Cell
Biol 2009, 87:606-614. [0089] 29. Liu A, Takahashi M, Narita M,
Zheng Z, Kanazawa N, Abe T, Nikkuni K, Furukawa T, Toba K, Fuse I,
Aizawa Y: Generation of functional and mature dendritic cells from
cord blood and bone marrow CD34+ cells by two-step culture combined
with calcium ionophore treatment. J Immunol Methods 2002,
261:49-63. [0090] 30. Slukvin, I I, Vodyanik M A, Thomson J A,
Gumenyuk M E, Choi K D: Directed differentiation of human embryonic
stem cells into functional dendritic cells through the myeloid
pathway. J Immunol 2006, 176:2924-2932. [0091] 31. Han S, Wang B,
Cotter M J, Yang L J, Zucali J, Moreb J S, Chang L-J: Overcoming
immune tolerance against multiple myeloma with lentiviral
calnexin-engineered dendritic cells. Mol Ther 2008, 16:269-279.
[0092] 32. Chang L-J, Urlacher V, Iwakuma T, Cui Y, Zucali J:
Efficacy and safety analyses of a recombinant human
immunodeficiency virus type 1 derived vector system. Gene Therapy
1999, 6:715-728. [0093] 33. Chang L-J, Zaiss A-K: Self inactivating
lentiviral vectors in combination with a sensitive Cre/loxP
reporter system. In Methods in Molecular Medicine. Edited by Walker
J: Humana Press Inc.; 2001: 367-382: Viral Vectors for Gene
Therapy: Methods and Protocols]. [0094] 34. Zaiss A-K, Son S, Chang
L-J: RNA 3'-readthrough of oncoretrovirus and lentivirus:
implications in vector safety and efficacy. Journal of Virology
2002, 76:7209-7219. [0095] 35. Wang B, Han S, Lien L, Chang L-J:
Lentiviral calnexin-modified dendritic cells promote expansion of
high-avidity effector T cells with central memory phenotype
Immunology 2009, 128:43-57. [0096] 36. Han S, Chang L J: Immunity
of lentiviral vector-modified dendritic cells. Methods Mol Biol
2009, 542:245-259. [0097] 37. Han S, Huang Y, Liang Y, Ho Y, Wang
Y, Chang L-J: Phenotype and functional evaluation of ex vivo
generated antigen-specific immune effector cells with potential for
therapeutic applications. Journal of Hematology and Oncology 2009,
2:34. [0098] 38. Wang B, He J, Liu C, Chang L J: An effective
cancer vaccine modality: Lentiviral modification of dendritic cells
expressing multiple cancer-specific antigens. Vaccine 2006,
24:3477-3489. [0099] 39. Gammaitoni L, Bruno S, Sanavio F, Gunetti
M, Kollet O, Cavalloni G, Falda M, Fagioli F, Lapidot T, Aglietta
M, Piacibello W: Ex vivo expansion of human adult stem cells
capable of primary and secondary hemopoietic reconstitution. Exp
Hematol 2003, 31:261-270. [0100] 40. Yamazaki S, Iyoda T, Tarbell
K, Olson K, Velinzon K, Inaba K, Steinman R M: Direct expansion of
functional CD25+ CD4+ regulatory T cells by antigen-processing
dendritic cells. J Exp Med 2003, 198:235-247. [0101] 41. Banerjee D
K, Dhodapkar M V, Matayeva E, Steinman R M, Dhodapkar K M:
Expansion of FOXP3high regulatory T cells by human dendritic cells
(DCs) in vitro and after injection of cytokine-matured DCs in
myeloma patients. Blood 2006, 108:2655-2661. [0102] 42. Lemoine F
M, Cherai M, Giverne C, Dimitri D, Rosenzwajg M, Trebeden-Negre H,
Chaput N, Barrou B, Thioun N, Gattegnio B, et al: Massive expansion
of regulatory T-cells following interleukin 2 treatment during a
phase I-II dendritic cell-based immunotherapy of metastatic renal
cancer. Int J Oncol 2009, 35:569-581. [0103] 43. Luft T, Pang K C,
Thomas E, Bradley C J, Savoia H, Trapani J, Cebon J: A serum-free
culture model for studying the differentiation of human dendritic
cells from adult CD34+ progenitor cells. Exp Hematol 1998,
26:489-500. [0104] 44. Strobl H: Molecular mechanisms of dendritic
cell sublineage development from human hematopoietic
progenitor/stem cells. Int Arch Allergy Immunol 2003, 131:73-79.
[0105] 45. Bryder D, Jacobsen S E: Interleukin-3 supports expansion
of long-term multilineage repopulating activity after multiple stem
cell divisions in vitro. Blood 2000, 96:1748-1755. [0106] 46.
Hutton J F, Rozenkov V, Khor F S, D'Andrea R J, Lewis I D: Bone
morphogenetic protein 4 contributes to the maintenance of primitive
cord blood hematopoietic progenitors in an ex vivo
stroma-noncontact co-culture system. Stem Cells Dev 2006,
15:805-813. [0107] 47. Hwang J H, Kim S W, Park S E, Yun H J, Lee
Y, Kim S, Jo D Y: Overexpression of stromal cell-derived factor-1
enhances endothelium-supported transmigration, maintenance, and
proliferation of hematopoietic progenitor cells. Stem Cells Dev
2006, 15:260-268. [0108] 48. Milhem M, Mahmud N, Lavelle D, Araki
H, Desimone J, Saunthararajah Y, Hoffman R: Modification of
Hematopoietic Stem Cell Fate By 5aza 2'deoxycytidine and
Trichostatin A. Blood 2004. [0109] 49. Almand B, Clark J I,
Nikitina E, van Beynen J, English N R, Knight S C, Carbone D P,
Gabrilovich D I: Increased Production of Immature Myeloid Cells in
Cancer Patients: A Mechanism of Immunosuppression in Cancer. J
Immunol 2001, 166:678-689. [0110] 50. Menetrier-Caux C, Thomachot M
C, Alberti L, Montmain G, Blay J Y: IL-4 Prevents the Blockade of
Dendritic Cell Differentiation Induced by Tumor Cells. Cancer Res
2001, 61:3096-3104. [0111] 51. Gerner M Y, Casey K A, Mescher M F:
Defective MHC class II presentation by dendritic cells limits CD4 T
cell help for antitumor CD8 T cell responses. J Immunol 2008,
181:155-164. [0112] 52. Rubinstein M P, Kadima A N, Salem M L,
Nguyen C L, Gillanders W E, Cole D J: Systemic administration of
IL-15 augments the antigen-specific primary CD8+ T cell response
following vaccination with peptide-pulsed dendritic cells. J
Immunol 2002, 169:4928-4935. [0113] 53. Klebanoff C A, Finkelstein
S E, Surman D R, Lichtman M K, Gattinoni L, Theoret M R, Grewal N,
Spiess P J, Antony P A, Palmer D C, et al: IL-15 enhances the in
vivo antitumor activity of tumor-reactive CD8+ T cells. Proc Natl
Acad Sci USA 2004, 101:1969-1974.
[0114] It should be borne in mind that all patents, patent
applications, patent publications, technical publications,
scientific publications, and other references referenced herein and
in the accompanying appendices are hereby incorporated by reference
in this application to the extent not inconsistent with the
teachings herein.
[0115] It is important to an understanding of the present invention
to note that all technical and scientific terms used herein, unless
defined herein, are intended to have the same meaning as commonly
understood by one of ordinary skill in the art. The techniques
employed herein are also those that are known to one of ordinary
skill in the art, unless stated otherwise. For purposes of more
clearly facilitating an understanding the invention as disclosed
and claimed herein, the following definitions are provided.
[0116] While a number of embodiments of the present invention have
been shown and described herein in the present context, such
embodiments are provided by way of example only, and not of
limitation. Numerous variations, changes and substitutions will
occur to those skilled in the art without materially departing from
the invention herein. For example, the present invention need not
be limited to best mode disclosed herein, since other applications
can equally benefit from the teachings of the present invention.
Also, in the claims, means-plus-function and step-plus-function
clauses are intended to cover the structures and acts,
respectively, described herein as performing the recited function
and not only structural equivalents or act equivalents, but also
equivalent structures or equivalent acts, respectively.
Accordingly, all such modifications are intended to be included
within the scope of this invention as defined in the following
claims, in accordance with relevant law as to their
interpretation.
APPENDIX
[0117] Additional File 1--
[0118] Supplemental Table 1. Antibodies and their specific clones:
All antibodies were purchased from BD PharMingen, Invitrogen CALTAG
laboratories, eBiosciences and Cell Signaling.
[0119] Additional File 2--
[0120] Supplemental Table 2. Primer sequences for cDNA cloning and
RT-PCR.
TABLE-US-00001 TABLE 1 Analysis of cytokines and chemokines
secreted by mature DCs Cytokines/ IL-4 DCs IL-15 DCs DCPs
Chemokines (pg/ml) (pg/ml) (pg/ml) IL-1.alpha. 135 (32) 332
(1,228).uparw. 1,202 (239).uparw. IL-1.beta. 338 (92) 601
(2,696).uparw. 8,582 (2,440).uparw..uparw. IL-2 6 (5) 7 (7) 6 (4)
IL-4 3 (3) 2 (4) 2 (1).dwnarw. IL-5 2 (1) 4 (7).uparw. 9 (6).uparw.
IL-6 652 (53) 1,664 (8,036).uparw. 43,607 (4,605).uparw..uparw.
IL-8 154,440 (55,237) 155,499 (297,615).uparw. 303,222
(286,234).uparw. IL-10 68 (53) 7 (114) 110 (162).uparw. IL-12p70 6
(3) 16 (25).uparw. 8 (6).uparw. IL-13 6 (5) 170 (148).uparw..uparw.
10 (11).uparw. IL-15 25 (23) 2,359 (248).uparw..uparw. 87
(81).uparw. IL-17 8 (4) 12 (13).uparw. 5 (6) IL-23 17 (30) 79
(90).uparw. 215 (36).uparw. IFN-.gamma. <1 (<1) 2,331
(1,905).uparw..uparw. <1 (1) TNF.alpha. 149 (72) 1,439
(3,152).uparw..uparw. 226 (70) TNF.beta. <1 (2) 87 (67).uparw. 3
(6).uparw. Eotaxin 2 (3) 3 (3) 4 (2) GRO-.alpha. 8,394 (2,158)
2,142 (15,744) 131,310 (19,241).uparw..uparw. I-309 1,989 (533)
15,086 (28,758).uparw. 18,141 (42,805).uparw..uparw. MCP-1 342
(571) 547 (4,971).uparw. 184,457 (127,001).uparw..uparw. MCP-2 11
(9) 339 (2,512).uparw..uparw. 2,381 (46).uparw. RANTES 1,588 (179)
2,552 (1,875).uparw. 1,666 (3,085).uparw. TARC 469,352 (337,109)
1,783 (1,636).dwnarw. 20,739 (14,855).dwnarw. Results are averages
of triplicate analyses of cytokines and chemokines (pg/ml/10.sup.6
cells/24 hr) secreted by mature DCs of two donors (the 2.sup.nd
donor shown in parenthesis) using multiplex ELISA arrays. Up-
(.uparw.) and down-regulations (.dwnarw.) are depicted by arrows,
and double arrows indicate a difference more than ten-fold from the
IL-4 DCs.
TABLE-US-00002 TABLE 2 Primer sequences for cDNA cloning and
RT-PCR. Primer name Primer sequence (5' to 3') hIL-3 RT-PCR F
TGATCGACGAGATCATCACC hIL-3 RT-PCR R GCAGGTTCTTCAGGATGCTC hIL-6 ORF
F AAGGATCCACCATGAACTCCTTCTCCACAAGC hIL-6 ORF R
AAACTAGTCTACATTTGCCGAAGAGCC hIL-6 RT-PCR F GTAGCCGCCCCACACAGACAGCC
hIL-6 RT-PCR R GCCATCTTTGGAAGGTTCAGG hIL-15 ORF F
TTGGATCCACCATGAGAATTTCGAAACCACATTTG hIL-15 ORF R
TTACTAGTCAAGAAGTGTTGATGAAC hIL-15 RT-PCR F AGCTGGCATTCATGTCTTCA
hIL-15 RT-PCR R ACTTTGCAACTGGGGTGAAC hOM-CSF ORF F
CCCGGGAAGCTTCCACCATGTGGCTGCAGAGCCTG hGM-CSF ORF R
AATGGATCCTATCACTCCTGGACTGGCTC hGM-CSF RT-PCR F ATGTGAATGCCATCCAGGAG
hGM-CSF RT-PCR R AGGGCAGTGCTGCTTGTAGT mGM-CSF ORF F AAT CTA GAC CAC
CAT GTG GCT GCA GAA TTT AC mGM-CSF ORF R AAGAATTCCTCATTTTTGGACTGG
mGM-CSF RT-PCR F GGCCTTGGAAGCATGTAGAG mGM-CSF RT-PCR R
CCGTAGACCCTGCTCGAATA hbFGF ORF F AAGGATCCACCATGGTGGGTGTCGGGGGTGGAG
hbFGF ORF R AAACTAGTCAGCTCTTAGCAGACATTG hbFGF RT-PCR F
ATGGCAGCCGGGAGCATCACCACGC hbFGF RT-PCR R
CAGCTCTTAGCAGACATTGGAAGAAAAAG hSCF ORF F
TTTCTAGACCACCATGAAGAAGACACAAACTTG hSCF ORF R
CCOOATCCTTACACTTCTTGAAACTC hSCF RT-PCR F CTCCTATTTAATCCTCTCGTC hSCF
RT-PCR R TACTACCATCTCGCTTATCCA hFlt3-L ORF F
AAGGATCCGCAGGATGAGGCCTTG hFlt3-L ORF R CCCAGGATGAGGCCTTGG hFlt3-L
RT-PCR F GCT TCA AGA TTA CCC AGT CAC C hFlt3-L RT-PCR R GAC CCA GCG
ACA GTC TTG A hTPO ORF F TTTCTAGACCACCATGGAGCTGACTGAATTG hTPO ORF R
TTGAATTCTTACCCTTCCTGAGACAG hTPO RT-PCR F GAA TGG AAA ACC CAG ATG GA
hTPO RT-PCR R AGO GAT GAG AGG CAA GTG G EBV BMLF ORF F
AAGGATCCACCATGGAGGGCAGCGAAGAACAC EBV BMLF ORF R AAA CTA GTT ATT GAT
TTA ATC CAG GAA C hCCL17 RT-PCR F ATG GCC CCA CTG AAG ATG CTT
hCCL17 RT-PCR R TGA ACA CCA ACG GTG GAG G hPU.1 RT-PCR F TGG AAG
GGT TTC CCC TCG TC hPU.1 RT-PCR R TGC TGT CCT TCA TGT CGC CG hCCR6
RT-PCR F GGGGGAATATTCTGGTGGTGA hCCR6 RT-PCR R
CATCGCTGCCTTGGGTGTTGTAT hE-CAD RT-PCR F TCTACAGCATCACTGCCCAAGGAGCTG
hE-CAD RT-PCR R AGCTTGAACCACCAGGGTATACGTAGG hLangerine RT-PCR F
GCTTGGAGAATATGAGCAAGTTGC hLangerine RT-PCR R
GCACTTTGGACCTTGTTGAATGGC hId2 RT-PCR F ACGACCCGATGAGCCTGCTA hId2
RT-PCR R TCCTGGAGCGCTGGTTCTG hIL7Ra RT-PCR F ATTCAAGCTAGAGATGAAGTG
hIL7Ra RT-PCR F TTACTCTTTCATTCTTTCCTC PreT RT-PCR F AGT ACA CAG CCC
ATG CAT CTG TCA PreT RT-PCR R AAT GCT CCA AGA CTG GAG GAA GGA
mGAPDH RT-PCR F TCACCACCATGGAGAAGGC mGAPDH RT-PCR R
GCTAAGCAGTTGGTGGTGCA OW open reading frame; F, forward; R, reverse.
Sequence CWU 1
1
55120DNAArtificial SequenceSynthetic Polynucleotide 1tgatcgacga
gatcatcacc 20220DNAArtificial SequenceSynthetic Polynucleotide
2gcaggttctt caggatgctc 20332DNAArtificial SequenceSynthetic
Polynucleotide 3aaggatccac catgaactcc ttctccacaa gc
32427DNAArtificial SequenceSynthetic Polynucleotide 4aaactagtct
acatttgccg aagagcc 27523DNAArtificial SequenceSynthetic
Polynucleotide 5gtagccgccc cacacagaca gcc 23621DNAArtificial
SequenceSynthetic Polynucleotide 6gccatctttg gaaggttcag g
21735DNAArtificial SequenceSynthetic Polynucleotide 7ttggatccac
catgagaatt tcgaaaccac atttg 35826DNAArtificial SequenceSynthetic
Polynucleotide 8ttactagtca agaagtgttg atgaac 26920DNAArtificial
SequenceSynthetic Polynucleotide 9agctggcatt catgtcttca
201020DNAArtificial SequenceSynthetic Polynucleotide 10actttgcaac
tggggtgaac 201135DNAArtificial SequenceSynthetic Polynucleotide
11cccgggaagc ttccaccatg tggctgcaga gcctg 351229DNAArtificial
SequenceSynthetic Polynucleotide 12aatggatcct atcactcctg gactggctc
291320DNAArtificial SequenceSynthetic Polynucleotide 13atgtgaatgc
catccaggag 201420DNAArtificial SequenceSynthetic Polynucleotide
14agggcagtgc tgcttgtagt 201532DNAArtificial SequenceSynthetic
Polynucleotide 15aatctagacc accatgtggc tgcagaattt ac
321624DNAArtificial SequenceSynthetic Polynucleotide 16aagaattcct
catttttgga ctgg 241720DNAArtificial SequenceSynthetic
Polynucleotide 17ggccttggaa gcatgtagag 201820DNAArtificial
SequenceSynthetic Polynucleotide 18ccgtagaccc tgctcgaata
201933DNAArtificial SequenceSynthetic Polynucleotide 19aaggatccac
catggtgggt gtcgggggtg gag 332027DNAArtificial SequenceSynthetic
Polynucleotide 20aaactagtca gctcttagca gacattg 272125DNAArtificial
SequenceSynthetic Polynucleotide 21atggcagccg ggagcatcac cacgc
252229DNAArtificial SequenceSynthetic Polynucleotide 22cagctcttag
cagacattgg aagaaaaag 292333DNAArtificial SequenceSynthetic
Polynucleotide 23tttctagacc accatgaaga agacacaaac ttg
332426DNAArtificial SequenceSynthetic Polynucleotide 24ccggatcctt
acacttcttg aaactc 262521DNAArtificial SequenceSynthetic
Polynucleotide 25ctcctattta atcctctcgt c 212621DNAArtificial
SequenceSynthetic Polynucleotide 26tactaccatc tcgcttatcc a
212724DNAArtificial SequenceSynthetic Polynucleotide 27aaggatccgc
aggatgaggc cttg 242818DNAArtificial SequenceSynthetic
Polynucleotide 28cccaggatga ggccttgg 182922DNAArtificial
SequenceSynthetic Polynucleotide 29gcttcaagat tacccagtca cc
223019DNAArtificial SequenceSynthetic Polynucleotide 30gacccagcga
cagtcttga 193131DNAArtificial SequenceSynthetic Polynucleotide
31tttctagacc accatggagc tgactgaatt g 313226DNAArtificial
SequenceSynthetic Polynucleotide 32ttgaattctt acccttcctg agacag
263320DNAArtificial SequenceSynthetic Polynucleotide 33gaatggaaaa
cccagatgga 203419DNAArtificial SequenceSynthetic Polynucleotide
34agggatgaga ggcaagtgg 193532DNAArtificial SequenceSynthetic
Polynucleotide 35aaggatccac catggagggc agcgaagaac ac
323628DNAArtificial SequenceSynthetic Polynucleotide 36aaactagtta
ttgatttaat ccaggaac 283721DNAArtificial SequenceSynthetic
Polynucleotide 37atggccccac tgaagatgct t 213819DNAArtificial
SequenceSynthetic Polynucleotide 38tgaacaccaa cggtggagg
193920DNAArtificial SequenceSynthetic Polynucleotide 39tggaagggtt
tcccctcgtc 204020DNAArtificial SequenceSynthetic Polynucleotide
40tgctgtcctt catgtcgccg 204121DNAArtificial SequenceSynthetic
Polynucleotide 41gggggaatat tctggtggtg a 214223DNAArtificial
SequenceSynthetic Polynucleotide 42catcgctgcc ttgggtgttg tat
234327DNAArtificial SequenceSynthetic Polynucleotide 43tctacagcat
cactgcccaa ggagctg 274427DNAArtificial SequenceSynthetic
Polynucleotide 44agcttgaacc accagggtat acgtagg 274524DNAArtificial
SequenceSynthetic Polynucleotide 45gcttggagaa tatgagcaag ttgc
244624DNAArtificial SequenceSynthetic Polynucleotide 46gcactttgga
ccttgttgaa tggc 244720DNAArtificial SequenceSynthetic
Polynucleotide 47acgacccgat gagcctgcta 204819DNAArtificial
SequenceSynthetic Polynucleotide 48tcctggagcg ctggttctg
194921DNAArtificial SequenceSynthetic Polynucleotide 49attcaagcta
gagatgaagt g 215021DNAArtificial SequenceSynthetic Polynucleotide
50ttactctttc attctttcct c 215124DNAArtificial SequenceSynthetic
Polynucleotide 51agtacacagc ccatgcatct gtca 245224DNAArtificial
SequenceSynthetic Polynucleotide 52aatgctccaa gactggagga agga
245319DNAArtificial SequenceSynthetic Polynucleotide 53tcaccaccat
ggagaaggc 195420DNAArtificial SequenceSynthetic Polynucleotide
54gctaagcagt tggtggtgca 20559PRTArtificial SequenceSynthetic
Polypeptide 55Gly Leu Cys Thr Leu Val Ala Met Leu 1 5
* * * * *