U.S. patent application number 15/456196 was filed with the patent office on 2017-09-14 for antigen-binding fusion proteins with modified hsp70 domains.
The applicant listed for this patent is Aperisys, Inc., The General Hospital Corporation. Invention is credited to Timothy Brauns, Huabiao Chen, Jeffrey A. Gelfand, Stephen J. McCormack, Mark C. Poznansky.
Application Number | 20170260286 15/456196 |
Document ID | / |
Family ID | 59787756 |
Filed Date | 2017-09-14 |
United States Patent
Application |
20170260286 |
Kind Code |
A1 |
Brauns; Timothy ; et
al. |
September 14, 2017 |
Antigen-Binding Fusion Proteins with Modified HSP70 Domains
Abstract
The invention relates to fusion proteins comprising an antigen
binding domain fused with a modified heat shock 70 protein. The
invention further relates to methods of using the fusion proteins
to induce an immune response to antigens and to treat diseases
associated with antigens.
Inventors: |
Brauns; Timothy;
(Roslindale, MA) ; Poznansky; Mark C.; (Newton
Center, MA) ; Gelfand; Jeffrey A.; (Cambridge,
MA) ; Chen; Huabiao; (Winchester, MA) ;
McCormack; Stephen J.; (Las Vegas, NV) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The General Hospital Corporation
Aperisys, Inc. |
Boston
Cumming |
MA
GA |
US
US |
|
|
Family ID: |
59787756 |
Appl. No.: |
15/456196 |
Filed: |
March 10, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62306168 |
Mar 10, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 16/3069 20130101; C07K 2317/76 20130101; C07K 2319/33
20130101; A61P 35/00 20180101; C07K 2319/30 20130101; C07K 2319/70
20130101; C07K 2319/74 20130101; C07K 2317/622 20130101; A61K
2039/505 20130101; C07K 16/30 20130101; C07K 14/35 20130101 |
International
Class: |
C07K 16/30 20060101
C07K016/30; C07K 14/35 20060101 C07K014/35 |
Goverment Interests
STATEMENT OF FEDERAL SUPPORT
[0002] This invention was made with government support under Grant
No. W81XWH-14-1-0206 awarded by the Department of Defense. The
government has certain rights in this invention.
Claims
1. A fusion protein comprising an antigen binding domain fused in
frame to a fragment of Mycobacterium tuberculosis heat shock
protein 70 (HSP70) of less than 200 amino acids, wherein the HSP70
fragment comprises a minimal HSP70 sequence.
2. The fusion protein of claim 1, wherein the HSP70 fragment
consists of the minimal HSP70 sequence.
3. The fusion protein of claim 1, wherein the minimal HSP70
sequence is amino acid residues 368-495 of M. tuberculosis HSP70
(SEQ ID NO:1).
4. The fusion protein of claim 3, comprising the amino acid
sequence of SEQ ID NO:3.
5. The fusion protein of claim 1, wherein the HSP70 fragment
comprises a modified CD94 domain.
6. The fusion protein of claim 5 wherein the modified CD94 domain
consists of an amino acid sequence selected from: TABLE-US-00015
(SEQ ID NO: 16); AAHNNLLGSFELTG; (SEQ ID NO: 17) AAHNNLLGRFELTG;
(SEQ ID NO: 18) AAHNNLLGRFELSG; (SEQ ID NO: 19) TKENNLLGRFELSG; or
(SEQ ID NO: 20) TRDNNLLGRFELSG.
7. (canceled)
8. The fusion protein of claim 6, comprising the amino acid
sequence of SEQ ID NO:5.
9. (canceled)
10. The fusion protein of claim 6, comprising an amino acid
sequence at least 90% identical to SEQ ID NO:7.
11. The fusion protein of claim 1, further comprising the
modification V410F (numbering according to SEQ ID NO:1).
12. The fusion protein of claim 1, further comprising a linker
between the antigen binding domain and the HSP70 fragment.
13. The fusion protein of claim 12, wherein said linker comprises
an amino acid sequence selected from the group consisting of:
GGSSRSS (SEQ ID NO: 21), (GGGSGGG) (SEQ ID NO: 22), GGGGSGGGGSGGGGS
(SEQ ID NO: 23), GGSSRSSSSGGGGSGGGG (SEQ ID NO: 24), and
GGSSESSSSGGGGSGGGG (SEQ ID NO: 25).
14. (canceled)
15. The fusion protein of claim 13, comprising the amino acid
sequence of SEQ ID NO:9.
16. (canceled)
17. The fusion protein of claim 13, comprising the amino acid
sequence of SEQ ID NO: 11.
18. A fusion protein comprising an antigen binding domain fused in
frame to a fragment of Mycobacterium tuberculosis heat shock
protein 70 (HSP70) of at least 100 amino acids and comprising no
more than amino acids 1-495 of SEQ IP NO:1.
19-26. (canceled)
27. A fusion protein comprising an antigen binding domain fused in
frame to a fragment of Mycobacterium tuberculosis heat shock
protein 70 (HSP70) comprising the amino acid sequence of SEQ ID
NO:26.
28. A fusion protein comprising an antigen binding domain fused in
frame to a chimeric Mycobacterium tuberculosis heat shock protein
70 (HSP70), wherein the chimeric HSP70 comprises a backbone of a
human HSP70 amino acid sequence wherein a beta sheet domain
of-about amino acid residues 367 to 479 (numbering based on SEQ ID
NO:29) are substituted with a beta sheet domain of about amino acid
residues 395 to 541 of M. tuberculosis HSP70 (numbering based on
SEQ ID NO:1).
29. The fusion protein of claim 1, wherein the antigen binding
domain is an engineered antibody or fragment thereof.
30. The fusion protein of claim 1, wherein the antigen binding
domain is an scFv.
31. The fusion protein of claim 1, wherein the antigen binding
domain binds specifically to mesothelin.
32. The fusion protein of claim 1, wherein the antigen binding
domain is a scFv that binds specifically to mesothelin.
33. The fusion protein of claim 32, wherein the scFv comprises the
amino acid sequence of SEQ ID NO:30.
34. The fusion protein of claim 1, further comprising a leader
sequence on the N-terminus.
35. The fusion protein of claim 34, wherein the leader sequence is
a plant leader sequence.
36. A pharmaceutical composition comprising an effective amount of
the fusion protein of claim 1 and a pharmaceutical acceptable
carrier.
37. An immunogenic composition or vaccine comprising the fusion
protein of claim 1.
38. A kit comprising the fusion protein of claim 1 and packaging
means thereof.
39. An isolated nucleic acid encoding the fusion protein of claim
1.
40-45. (canceled)
46. An expression vector comprising the nucleic acid of claim
39.
47. A cell comprising the isolated nucleic acid of claim 39.
48-49. (canceled)
50. A method for inducing an immune response to an antigen in a
subject, comprising administering to the subject the fusion protein
of claim 1 that specifically binds the antigen, thereby inducing an
immune response.
51. A method of treating a disease associated with an antigen in a
subject in need thereof, comprising administering to the subject a
therapeutically effective amount of the fusion protein of claim 1
that specifically binds the antigen, thereby treating the
disease.
52-57. (canceled)
Description
STATEMENT OF PRIORITY
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 62/306,168, filed Mar. 10, 2016, the entire
contents of which are incorporated by reference herein.
FIELD OF THE INVENTION
[0003] The invention relates to fusion proteins comprising an
antigen binding domain fused with a modified heat shock 70 protein.
The invention further relates to methods of using the fusion
proteins to induce an immune response to antigens and to treat
diseases associated with antigens.
BACKGROUND OF THE INVENTION
[0004] Mesothelin is a differentiation antigen whose expression in
normal human tissues is limited to mesothelial cells lining the
pleura, pericardium and peritoneum. However, mesothelin is highly
expressed in several human cancers, including mesotheliomas,
pancreatic adenocarcinomas, ovarian cancers and lung
adenocarcinomas. Mesothelin is an appropriate target for methods of
disease prevention or treatment and antibodies specific for
mesothelin, and vaccines comprising mesothelin are useful for
prophylactic and therapeutic methods.
[0005] Classical monoclonal antibodies are currently produced in
mammalian cells. Drawbacks of this method of production include the
difficulty of producing and selecting appropriate clones, and the
expense of culturing mammalian cells. The "next generation" of
monoclonal antibodies are being engineered in E. coli. Recently,
microbial expression of V.sub.H and V.sub.L domains tethered
together by polypeptide linkers has created the capability of
generating engineered "mini-antibodies." These mini-bodies can be
generated in E. coli in a virtually combinatorial fashion. These
artificially created Fab or single chain Fv (scFv) can be linked
together to form multimers, e.g., diabodies, triabodies and
tetrabodies. Although they are capable of binding to antigens with
almost antibody-like efficiency, these engineered, Fc deficient
mini-antibodies lack the ability to interact with antigen
presenting cells and are poorly immunogenic. Existing solutions to
the lack of immunogenicity of engineered antibodies involve
directing one of the antigen binding sites to bind directly with
immune cells. This brings them in apposition, but does not result
in the same MHC class I priming as would be observed for a
monoclonal antibody.
[0006] Immunization with vaccines remains a cornerstone of
protection against threat of disease and infection. The key
difficulty in vaccine development is rapidly matching a vaccine, or
antitoxin, to a specific threat. Current vaccine development
strategies rely on the identification and characterization of
antigens that can be targeted to successfully eradicate infection
or disease. Current vaccine development strategies are time- and
labor-intensive and can only commence once a threat emerges. Such
strategies are also impractical for generating personalized
vaccines to combat disease for which target antigens varies among
individuals. Current vaccine development strategies are therefore
insufficient if a new and serious threat were to emerge, for which
sufficient time were not available to identify and characterize
target antigens before such a threat could be contained. Current
vaccine development strategies are also insufficient for generating
personalized vaccines for the general population.
[0007] U.S. Pat. Nos. 7,749,501 and 7,943,133 describe fusion
proteins comprising an engineered antibody fused to a stress
protein to enhance the immune response to an antigen.
[0008] The present invention addresses previous shortcomings in the
art by disclosing modified fusion proteins with enhanced
immunostimulatory and therapeutic properties.
SUMMARY OF THE INVENTION
[0009] The present invention is based, in part, on the development
of several modifications of Mycobacterium tuberculosis heat shock
protein 70 (HSP70) that, alone or in combination, enhance the
effectiveness of an antigen-binding fusion protein comprising the
modified HSP70 to stimulate an immune response against an antigen
and to treat diseases associated with an antigen.
[0010] Thus, one aspect of the invention relates to a fusion
protein comprising an antigen binding domain fused in frame to a
fragment of Mycobacterium tuberculosis heat shock protein 70
(HSP7O) of less than 200 amino acids, wherein the HSP70 fragment
comprises a minimal HSP70 sequence.
[0011] Another aspect of the invention relates to a fusion protein
comprising an antigen binding domain fused in frame to a fragment
of Mycobacterium tuberculosis heat shock protein 70 (HSP70) of at
least 100 amino acids and comprising no more than amino acids 1-495
of SEQ ID NO:1.
[0012] A further aspect of the invention relates to a fusion
protein comprising an antigen binding domain fused in frame to a
fragment of Mycobacterium tuberculosis heat shock protein 70
(HSP70) comprising the amino acid sequence of SEQ ID NO:26
(sequence from provisional).
[0013] Another aspect of the invention relates to a fusion protein
comprising an antigen binding domain fused in frame to a chimeric
Mycobacterium tuberculosis heat shock protein 70 (HSP70), wherein
the chimeric HSP70 comprises a backbone of a human HSP70 amino acid
sequence wherein a beta sheet domain of about amino acid residues
367 to 479 (numbering based on SEQ ID NO:29) are substituted with a
beta sheet domain of about amino acid residues 395 to 541 of M.
tuberculosis HSP70 (numbering based on SEQ ID NO:1).
[0014] An additional aspect of the invention relates to a
pharmaceutical composition comprising an effective amount of the
fusion protein of the invention and a pharmaceutically acceptable
carrier.
[0015] Another aspect of the invention relates to an immunogenic
composition or vaccine comprising the fusion protein of the
invention.
[0016] A further aspect of the invention relates to a kit
comprising the fusion protein of the invention and packaging means
thereof.
[0017] An additional aspect of the invention relates to an isolated
nucleic acid encoding the fusion protein of the invention and
expression vectors and cells comprising the nucleic acid.
[0018] Another aspect of the invention relates to a method for
inducing an immune response to an antigen in a subject, comprising
administering to the subject the fusion protein of the invention
that specifically binds the antigen, thereby inducing an immune
response.
[0019] A further aspect of the invention relates to a method of
treating a disease associated with an antigen in a subject in need
thereof, comprising administering to the subject a therapeutically
effective amount of the fusion protein of the invention that
specifically binds the antigen, thereby treating the disease.
[0020] These and other aspects of the invention are set forth in
more detail in the description of the invention below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 shows the amino acid sequences of VIC-007 (SEQ ID
NO:28) and VIC-008 (SEQ ID NO:27). VIC-008 was reconstructed from
VIC-007 by removal of redundant amino acids GSS, SGILEQQG, and
AAAMRS indicated in bold and italic and introduction of a single
amino acid mutation, phenylalanine (F) in place of valine (V), at
position 410 of MtbHsp70.
[0022] FIGS. 2A-2B show tumor growth. Quantitative analysis of
bioluminescence signals was performed using IVIS Spectrum on
Luc-ID8 tumor inoculated mice (n=8 or 9) at a week after tumor
inoculation and subsequently weekly. (A) Longitudinal images of a
representative mouse from each treatment group were presented from
a week after tumor inoculation before treatment (W0) and subsequent
five weeks (W1-W5). (B) The arrows indicated 4 treatments at 7-day
intervals starting at a week after tumor inoculation. Total photons
were calculated by IVIS Lumina Series III. Statistical differences
were analyzed using Two-Way ANOVA followed by Tukey's multiple
comparison tests. ****, p<0.0001. Data were indicated as the
mean.+-.sem.
[0023] FIG. 3 shows mouse survival after treatment. The mice were
observed daily 1 week after treatment. At the endpoint the mice
were euthanized and the survival time were calculated as life span
from the day of tumor inoculation. The median survival and p values
were determined using the Log-rank test.
[0024] FIG. 4 shows ovarian cancer tumor growth in the first five
weeks after start of therapy (week 0). C57BL/6 mice
intraperitoneally injected with 5.times.10.sup.6
luciferase-expressing ID8 mouse ovarian cancer cells. 10 mice in
saline-treated control group; 11 mice in VIC-008 treatment group.
Mice received four weekly treatments starting one week after tumor
introduction. Treatment dose of VIC-008 was 20 .mu.g per mouse.
Luciferase signal was monitored by IVIS. Statistical significance
was established using two-way ANOVA test.
[0025] FIG. 5 shows mouse survival after injection with ovarian
cancer cells. C57BL/6 mice intraperitoneally injected with
5.times.10.sup.6 luciferase-expressing ID8 mouse ovarian cancer
cells. 10 mice in saline-treated control group; 11 mice in VIC-008
treatment group. Mice received four weekly treatments starting one
week after tumor introduction. Treatment dose of VIC-008 was 20
.mu.g per mouse. Statistical significance was established using
log-rank (Mantel-Cox) test.
[0026] FIG. 6 shows intratumoral CD8+ T cell infiltration. Tumor
samples were collected two weeks after the fourth and final
treatment of either saline or VIC-008. Tumor tissue was collected
and immunoprofiled using flow cytometry to detect CD3+CD8+ T cells.
T cells were counted as a percentage of gated live cells.
[0027] FIG. 7 shows intratumoral Treg T cell infiltration. Tumor
samples were collected two weeks after the fourth and final
treatment of either saline or VIC-008. Tumor tissue was collected
and immunoprofiled using flow cytometry to detect CD4+CD25+FoxP3+ T
regulatory cells. T regulatory cells were counted as a percentage
of all CD3+CD4+ cells.
[0028] FIG. 8 shows the ratio of CD8+ T cells to T regulatory cells
in tumor. Tumor samples were collected two weeks after the fourth
and final treatment of either saline or VIC-008. Tumor tissue was
collected and immunoprofiled using flow cytometry to detect both
CD3+CD8+ T cells and CD4+CD25+FoxP3+ T regulatory cells. Ratio was
calculated based on percentages of the observed population.
[0029] FIG. 9 shows intratumoral central memory CD8+ T cell
infiltration. Tumor samples were collected two weeks after the
fourth and final treatment of either saline or VIC-008. Tumor
tissue was collected and immunoprofiled using flow cytometry to
detect CD8+CD44+CD27+ central memory T cells. CD8+ central memory T
cells were counted as a percentage of all CD3+CD8+ cells.
DETAILED DESCRIPTION OF THE INVENTION
[0030] The present invention will now be described in more detail
with reference to the accompanying drawings, in which preferred
embodiments of the invention are shown. This invention may,
however, be embodied in different forms and should not be construed
as limited to the embodiments set forth herein. Rather, these
embodiments are provided so that this disclosure will be thorough
and complete, and will fully convey the scope of the invention to
those skilled in the art.
[0031] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
skill in the art to which this invention belongs. The terminology
used in the description of the invention herein is for the purpose
of describing particular embodiments only and is not intended to be
limiting of the invention. All publications, patent applications,
patents, patent publications and other references cited herein are
incorporated by reference in their entireties for the teachings
relevant to the sentence and/or paragraph in which the reference is
presented.
[0032] Unless the context indicates otherwise, it is specifically
intended that the various features of the invention described
herein can be used in any combination.
[0033] Moreover, the present invention also contemplates that in
some embodiments of the invention, any feature or combination of
features set forth herein can be excluded or omitted.
[0034] To illustrate, if the specification states that a complex
comprises components A, B and C, it is specifically intended that
any of A, B or C, or a combination thereof, can be omitted and
disclaimed singularly or in any combination.
[0035] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference herein in
their entirety.
[0036] Amino acids are represented herein in the manner recommended
by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino
acids) by either the one-letter code, or the three letter code,
both in accordance with 37 C.P.R. .sctn.1.822 and established
usage.
[0037] As used in the description of the invention and the appended
claims, the singular forms "a", "an," and "the" are intended to
include the plural forms a well, unless the context clearly
indicates otherwise.
[0038] Also as used herein, "and/or" refers to and encompasses any
and all possible combinations of one or more of the associated
listed items, as well, as the lack of combinations when interpreted
in the alternative ("or").
[0039] The term "about," as used herein, when referring to a
measurable value such as an amount of polypeptide, dose, time,
temperature, enzymatic activity or other biological activity and
the like, is meant to encompass variations of .+-.10%, .+-.5%,
.+-.1%, .+-.0.5%, or even .+-.0.1% of the specified amount.
[0040] In this disclosure, "comprises," "comprising," "containing,"
and "having" and the like have the open-ended meaning ascribed to
them in U.S. patent law and mean "includes," "including," and the
like.
[0041] As used herein, the transitional phrase "consisting
essentially of" (and grammatical variants) is to be interpreted as
encompassing the recited materials or steps and those that do not
materially affect the basic and novel characteristic(s) of the
claimed invention. Thus, the term "consisting essentially of" as
used herein should not be interpreted as equivalent to
"comprising."
[0042] The term "consists essentially of" (and grammatical
variants), as applied to a polypeptide or polynucleotide sequence
of this invention, means a polypeptide or polynucleotide that
consists of both the recited sequence (e.g., SEQ ID NO) and a total
often or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional
amino acids on the N-terminal and/or C-terminal ends of the recited
sequence or additional nucleotides on the 5' and/or 3' ends such
that the function of the polypeptide or polynucleotide is not
materially altered. The total of ten or less additional amino acids
or nucleotides includes the total number of additional amino acids
or nucleotides on both ends added together. The term "materially
altered," as applied to polypeptides of the invention, refers to an
increase or decrease in immunostimulatory activity (e.g., towards a
mesothelin-containing tumor) of at least about 50% or more as
compared to the activity of a polypeptide consisting of the recited
sequence. The term "materially altered," as applied to
polynucleotides of the invention, refers to an increase or decrease
in ability to express an encoded polypeptide of at least about 50%
or more as compared to the activity of a polynucleotide consisting
of the recited sequence.
[0043] The term "modulate," "modulates," or "modulation" refers to
enhancement (e.g., an increase) or inhibition (e.g., a decrease) in
the specified level or activity.
[0044] The term "enhance" or "increase" refers to an increase in
the specified parameter of at least about 1.25-fold, 1.5-fold,
2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold,
twelve-fold, or even fifteen-fold.
[0045] The term "inhibit" or "reduce" or grammatical variations
thereof as used herein refers to a decrease or diminishment in the
specified level or activity of at least about 15%, 25%, 35%, 40%,
50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments,
the inhibition or reduction results in little or essentially no
detectible activity (at most, an insignificant amount, e.g., less
than about 10% or even 5%).
[0046] The term "contact" or grammatical variations thereof as used
with respect to a polypeptide and a calcium channel, refers to
bringing the polypeptide and the calcium channel in sufficiently
close proximity to each other for one to exert a biological effect
on the other. In some embodiments, the term contact means binding
of the polypeptide to the calcium channel.
[0047] By the terms "treat," "treating," or "treatment of," it is
intended that the severity of the subject's condition is reduced or
at least partially improved or modified and that some alleviation,
mitigation or decrease in at least one clinical symptom is
achieved.
[0048] The terms "prevent," "preventing," and "prevention" (and
grammatical variations thereof) refer to prevention and/or delay of
the onset of a disease, disorder and/or a clinical symptom(s) in a
subject and/or a reduction in the severity of the onset of the
disease, disorder and/or clinical symptom(s) relative to what would
occur in the absence of the methods of the invention. The
prevention can be complete, e.g., the total absence of the disease,
disorder and/or clinical symptom(s). The prevention can also be
partial, such that the occurrence of the disease, disorder and/or
clinical symptom(s) in the subject and/or the severity of onset is
less than what would occur in the absence of the present
invention.
[0049] A "therapeutically effective" amount as used herein is an
amount that provides some improvement or benefit to the subject.
Alternatively stated, a "therapeutically effective" amount is an
amount that will provide some alleviation, mitigation, or decrease
in at least one clinical symptom in the subject. Those skilled in
the art will appreciate that the therapeutic effects need not be
complete or curative, as long as some benefit is provided to the
subject.
[0050] A "prophylactically effective" amount as used herein is an
amount that is sufficient to prevent and/or delay the onset of a
disease, disorder and/or clinical symptoms in a subject and/or to
reduce and/or delay the severity of the onset of a disease,
disorder and/or clinical symptoms in a subject relative to what
would occur in the absence of the methods of the invention. Those
skilled in the art will appreciate that the level of prevention
need not be complete, as long as some benefit is provided to the
subject.
[0051] As used herein "mesothelin" refers to a differentiation
antigen whose expression in normal human tissues is limited to
mesothelial cells lining the pleura, pericardium and peritoneum.
However, mesothelin is highly expressed in several human cancers,
including mesotheliomas, pancreatic adenocarcinomas, ovarian
cancers and lung adenocarcinomas. The mesothelin gene encodes a
precursor protein of 71 kDa that is processed to a 31 kDa shed
protein called megakaryocyte potentiating factor (MPF) and a 40 kDa
fragment, mesothelin, that is attached to the cell membrane by a
glycosyl-phosphatidylinositol (GPI) anchor.
[0052] There are three (3) variants of mesothelin: soluble
mesothelin-1, a unique mesothelin-2 transcript, and a mesothelin-3
variant with an extended C-terminus. Mesothelin-1 is found in
pleura, pericardium and peritoneum and on surface epithelium of the
ovaries, tonsils, and fallopian tubes (Ordonez, 2003). Mesothelin
is also overexpressed in mesotheliomas, pancreatic adenocarcinomas,
and squamous cell carcinomas of the head, neck, lung, esophagus,
cervix, and vulva (Chang and Pastan 1992, 1996; Frierson et al.
2003).
[0053] The term "administering" includes any method of delivery of
a compound of the present invention, including but not limited to,
a pharmaceutical composition or therapeutic agent, into a subject's
system or to a particular region in or on a subject, including
systemic or localized administration. The phrases "systemic
administration," "administered systemically," "peripheral
administration," and "administered peripherally" as used herein
mean the administration of a compound, drug or other material other
than directly into the central nervous system, such that it enters
the patient's system and, thus, is subject to metabolism and other
like processes, for example, subcutaneous administration.
"Parenteral administration" and "administered parenterally" means
modes of administration other than enteral and topical
administration, usually by injection, and includes, without
limitation, intravenous, intramuscular, intralesional,
intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac, intradermal, intraperitoneal, transtracheal,
subcutaneous, subcuticular, intra-articular, subcapsular,
subarachnoid, intraspinal and intrasternal injection, oral,
epidural, intranasal and infusion.
[0054] The term "amino acid" is intended to embrace all molecules,
whether natural or synthetic, which include both an amino
functionality and an acid functionality and capable of being
included in a polymer of naturally-occurring amino acids. Exemplary
amino acids include naturally-occurring amino acids; analogs,
derivatives and congeners thereof; amino acid analogs having
variant side chains; and all stereoisomers of any of any of the
foregoing.
[0055] The term "antibody" refers to an immunoglobulin, derivatives
thereof which maintain specific binding ability, and proteins
having a binding domain which is homologous or largely homologous
to an immunoglobulin binding domain. These proteins may be derived
from natural sources, or partly or wholly synthetically produced.
An antibody may be monoclonal or polyclonal. The antibody may be a
member of any immunoglobulin class, including any of the human
classes: IgG, IgM, IgA, IgD, IgE and IgY. In exemplary embodiments,
antibodies used with the methods and compositions described herein
are derivatives of the IgG class. The term "antibody" also includes
an antibody fragment as defined herein.
[0056] The term "antibody fragment" refers to any derivative of an
antibody which is less than full-length. In exemplary embodiments,
the antibody fragment retains at least a significant portion of the
full-length antibody's specific binding ability. Examples of
antibody fragments include, but are not limited to, Fab, Fab',
F(ab').sub.2, scFv, Fv, dsFv diabody, and Fd fragments. The
antibody fragment may be produced by any means. For instance the
antibody fragment may be enzymatically or chemically produced by
fragmentation of an intact antibody, it may be recombinantly
produced from a gene encoding the partial antibody sequence, or it
may be wholly or partially synthetically produced. The antibody
fragment may optionally be a single chain antibody fragment.
Alternatively, the fragment may comprise multiple chains which are
linked together, for instance, by disulfide linkages. The fragment
may also optionally be a multimolecular complex. A functional
antibody fragment will typically comprise at least about 50 amino
acids and more typically will comprise at least about 200 amino
acids.
[0057] The term "Fab fragment" refers to a fragment of an antibody
comprising an antigen-binding site generated by cleavage of the
antibody with the enzyme papain, which cuts at the hinge region
N-terminally to the inter-H-chain disulfide bond and generates two
Fab fragments from one antibody molecule.
[0058] The term "F(ab').sub.2 fragment" refers to a fragment of an
antibody containing two antigen-binding sites, generated by
cleavage of the antibody molecule with the enzyme pepsin which cuts
at the hinge region C-terminally to the inter-H-chain disulfide
bond.
[0059] The term "Fc fragment" refers to the fragment of an antibody
comprising the constant domain of its heavy chain.
[0060] The term "Fv fragment" refers to the fragment of an antibody
comprising the variable domains of its heavy chain and light
chain.
[0061] The term "engineered antibody" refers to a recombinant
molecule that comprises at least an antibody fragment comprising an
antigen binding site derived from the variable domain of the heavy
chain and/or light chain of an antibody and may optionally comprise
the entire or part of the variable and/or constant domains of an
antibody from any of the Ig classes (for example IgA, IgD, IgE,
IgG, IgM and IgY). Examples of engineered antibodies include
enhanced single chain monoclonal antibodies and enhanced monoclonal
antibodies. Examples of engineered antibodies are further described
in PCT/US2007/061554, the entire contents of which are incorporated
herein by reference. An "engineered antibody" includes an
engineered antibody fragment, according to the method of the
invention, and as defined herein.
[0062] The term "single chain variable fragment or scFv" refers to
an Fv fragment in which the heavy chain domain and the light chain
domain are linked. One or more scFv fragments may be linked to
other antibody fragments (such as the constant domain of a heavy
chain or a light chain) to form antibody constructs having one or
more antigen recognition sites.
[0063] The term "multivalent antibody" refers to an antibody or
engineered antibody comprising more than one antigen recognition
site. For example, a "bivalent" antibody has two antigen
recognition sites, whereas a "tetravalent" antibody has four
antigen recognition sites. The terms "monospecific," "bispecific,"
"trispecific," "tetraspecific," etc., refer to the number of
different antigen recognition site specificities (as opposed to the
number of antigen recognition sites) present in a multivalent
antibody. For example, a "monospecific" antibody's antigen
recognition sites all bind the same epitope. A "bispecific"
antibody has at least one antigen recognition site that hinds a
first epitope and at least one antigen recognition site that binds
a second epitope that is different from the first epitope. A
"multivalent monospecific" antibody has multiple antigen
recognition sites that all bind the same epitope. A "multivalent
bispecific" antibody has multiple antigen recognition sites, some
number of which bind a first epitope and some number of which bind
a second epitope that is different from the first epitope.
[0064] The term "epitope" refers to the region of an antigen to
which an antibody binds preferentially and specifically. A
monoclonal antibody binds preferentially to a single specific
epitope of a molecule that can be molecularly defined. In the
present invention, multiple epitopes can be recognized by a
multispecific antibody.
[0065] An "antigen" refers to a target of an immune response
induced by a composition described herein. An antigen may be a
protein antigen and is understood to include an entire protein,
fragment of the protein exhibited on the surface of a virus or an
infected, foreign, or tumor cell of a subject, as well as a peptide
displayed by an infected, foreign, or tumor cell as a result of
processing and presentation of the protein, for example, through
the typical MHC class I or II pathways. Examples of such foreign
cells include bacteria, fungi, and protozoa. Examples of bacterial
antigens include Protein A (PrA), Protein G (PrG), and Protein L
(PrL).
[0066] The term "antigen binding site" refers to a region of an
antibody or fragment thereof, that specifically binds an epitope on
an antigen.
[0067] The term "costimulatory molecule" as used herein includes
any molecule which is able to either enhance the stimulating effect
of an antigen-specific primary T cell stimulant or to raise
activity beyond the threshold level required for cellular
activation resulting in activation of naive T cells. Such a
costimulatory molecule can be a membrane-resident receptor
protein.
[0068] The term "effective amount" refers to that amount of a
compound, material, or composition which is sufficient to effect a
desired result. An effective amount of a compound can be
administered in one or more administrations.
[0069] A "fusion protein" or "fusion polypeptide" refers to a
hybrid polypeptide which comprises polypeptide portions from at
least two different polypeptides. A "fusion protein" as defined
herein, is a fusion of a first amino acid sequence (protein)
comprising, for example a stress protein of the invention, joined
to a second amino acid sequence comprising an antibody or fragment
thereof that binds specifically to mesothelin or a biotin-binding
protein. A fusion protein also includes a fusion protein comprising
a first amino acid sequence comprising a stress protein, and a
second amino sequence comprising a biotin binding protein. A fusion
protein also includes a fusion protein comprising a first amino
acid sequence comprising a stress protein and second amino acid
sequence comprising an antibody binding protein. A fusion protein
also includes a fusion protein comprising a first amino acid
sequence comprising an antibody or fragment thereof that binds
specifically to mesothelin and a second amino acid sequence
comprising a biotin binding protein or an antibody binding
protein.
[0070] The portions may be from proteins of the same organism, in
which case the fusion protein is said to be "interspecies,"
"intergenic," etc. In various embodiments, the fusion polypeptide
may comprise one or more amino acid sequences linked to a first
polypeptide. In the case where more than one amino acid sequence is
fused to a first polypeptide, the fusion sequences may be multiple
copies of the same sequence, or alternatively, may be different
amino acid sequences. A first polypeptide may be fused to the
N-terminus, the C-terminus, or the N- and C-terminus of a second
polypeptide. Furthermore, a first polypeptide may be inserted
within the sequence of a second polypeptide.
[0071] The term "linker" is art-recognized and refers to a molecule
(including but not limited to unmodified or modified nucleic acids
or amino acids) or group of molecules (for example, 2 or more,
e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) connecting two
compounds, such as two polypeptides. The linker may be comprised of
a single linking molecule or may comprise a linking molecule and at
least one spacer molecule, intended to separate the linking
molecule and a compound by a specific distance.
[0072] A "spacer molecule" includes any amino acid segment that is
not related to the two protein segments it separates. For example,
in a fusion consisting of a stress protein and a biotin protein, a
spacer molecule would consist of a stretch of amino acids that is
unrelated to the proteins comprising the fusion protein. A "spacer
molecule" useful according to the invention includes neutral ammo
acids such as glycine, leucine, valine, alanine, rather than acidic
or basic amino acids like aspartate, or arginine respectively.
[0073] "Gene construct" refers to a nucleic acid, such as a vector,
plasmid, viral genome or the like which includes a "coding
sequence" for a polypeptide or which is otherwise transcribable to
a biologically active RNA (e.g., antisense, decoy, ribozyme, etc.),
may be transfected into cells, e.g., in certain embodiments
mammalian cells, and may cause expression of the coding sequence in
cells transfected with the construct. The gene construct may
include one or more regulatory elements operably linked to the
coding sequence, as well as intronic sequences, polyadenylation
sites, origins of replication, marker genes, etc.
[0074] "Host cell" refers to a cell that may be transduced with a
specified transfer vector. The cell is optionally selected from in
vitro cells such as those derived from cell culture, ex vivo cells,
such as those derived from an organism, and in vivo cells, such as
those in an organism. It is understood that such terms refer not
only to the particular subject cell but to the progeny or potential
progeny of such a cell. Because certain modifications may occur in
succeeding generations due to either mutation or environmental
influences, such progeny may not, in fact, be identical to the
parent cell, but are still included within the scope of the term as
used herein.
[0075] The term "including" is used herein to mean "including but
not limited to." "Including" and "including but not limited to" are
used interchangeably.
[0076] The term "immunogenic" refers to the ability of a substance
to elicit an immune response. An "immunogenic composition" or
"immunogenic substance" is a composition or substance which elicits
an immune response. An "immune response" refers to the reaction of
a subject to the presence of an antigen, which may include at least
one of the following: antibody production, inflammation, developing
immunity, developing hypersensitivity to an antigen, the response
of antigen specific lymphocytes to antigen, tolerance, and
transplant or graft rejection.
[0077] As used herein, "an immune response to an antigen" means,
for example, a humoral or cellular response to the antigen.
[0078] If a patient is mounting a humoral immune response to the
antigen, anti-antigen antibody titer is measured. A typical
immunoassay consists of coating the wells of an immunoassay plate
with the antigen (for example by adding recombinant antigen or
using a capture anti-antigen antibody) and then adding serial
dilutions of patient serum to the wells. After washing away the
sera, human immunoglobulins are detected with a conjugated
anti-human immunoglobulin.
[0079] A cellular immune response is measured by using a
cell-killing assay. Patients peripheral blood lymphocytes (PBL) are
isolated and added at different ratios to a CHO cell line
expressing the antigen (non-transfected CHO cells or CHO cells
transfected with a non-antigen construct are used as negative
control). The antigen expressing CHO cells are transfected with an
antigen construct and selected to express antigen on their surface.
Killing is measured using radioactivity or release of a specific
dye.
[0080] As used herein, "treating a disease" means reducing the
amount of soluble antigen in the plasma of patients. Treating a
disease also refers to reducing the tumor burden as measured by
clinical means (for example by ecography or other methods known in
the art. Treating a disease also refers to reducing tumor size/mass
and/or prevention of metastases.
[0081] The enhanced mesothelin antibody as described herein, will
reduce (eliminate) the tumor burden in patients diagnosed with,
e.g., ovarian cancer, meningiomas, gliomas and metastases to the
leptomininges, mesotheliomas, adenocarcinoma of the uterus,
malignant mesothelioma, pancreatic cancer, and lung
adenocarcinoma.
[0082] The term "isolated polypeptide" or "isolated protein" refers
to a polypeptide, which may be prepared from recombinant DNA or
RNA, or be of synthetic origin, some combination thereof, or which
may be a naturally-occurring polypeptide, which (1) is not
associated with proteins with which it is normally associated in
nature, (2) is isolated from the cell in which it normally occurs,
(3) is essentially free of other proteins from the same cellular
source, (4) is expressed by a cell from a different species, or (5)
does not occur in nature.
[0083] "Isolating" a polypeptide or protein refers to the process
of removing a polypeptide from a tissue, cell or any mixture of
polypeptides which are not polypeptides or proteins of interest. An
isolated polypeptide or protein will be generally free from
contamination by other polypeptides or proteins. An isolated
polypeptide or protein can exist in the presence of a small
fraction of other polypeptides or proteins which do not interfere
with the utilization of the polypeptide or protein of interest.
Isolated polypeptides or proteins will generally be at least 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%,
96%, 97%, 98%, 99% or 100% pure. In one embodiment, isolated
polypeptides or proteins according to the invention will be at
least 98% or 99% pure.
[0084] The term "isolated nucleic acid" refers to a polynucleotide
of genomic, cDNA, synthetic, or natural origin or some combination
thereof, which (1) is not associated with the cell in which the
"isolated nucleic acid" is found in nature, or (2) is operably
linked to a polynucleotide to which it is not linked in nature.
[0085] "Isolating" a nucleic acid refers to the process of removing
a nucleic acid from a tissue, cell or any mixture of nucleic acids
which are not nucleic acids of interest. An isolated nucleic acid
will be generally free from contamination by other nucleic acids.
An isolated nucleic acid can exist in the presence of a small
fraction of other nucleic acids which do not interfere with the
utilization of the nucleic acid of interest. Isolated nucleic acids
will generally be at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% pure. In
one embodiment, isolated nucleic acids according to the invention
will be at least 98% or 99% pure.
[0086] It will be appreciated by those skilled in the art that
there can be variability in the polynucleotides that encode the
polypeptides (and fragments thereof) of the present invention due
to the degeneracy of the genetic code. The degeneracy of the
genetic code, which allows different nucleic acid sequences to code
for the same polypeptide, is well known in the literature (See,
e.g., Table 1).
[0087] As is known in the art, a number of different programs can
be used to identify whether a polynucleotide or polypeptide has
sequence identity or similarity to a known sequence. Sequence
identity or similarity may be determined using standard techniques
known in the art, including, but not limited to, the local sequence
identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482
(1981), by the sequence identity alignment algorithm of Needleman
& Wunsch, J. Mol. Biol. 48:443 (1970), by the search for
similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci.
USA 85:2444 (1988), by computerized implementations of these
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Drive, Madison, Wis.), the Best Fit sequence program described by
Devereux et al., Nucl. Acid Res. 12:387 (1984), preferably using
the default settings, or by inspection.
[0088] An example of a useful algorithm is PILEUP. PILEUP creates a
multiple sequence alignment from a group of related sequences using
progressive, pairwise alignments. It can also plot a tree showing
the clustering relationships used to create the alignment. PILEUP
uses a simplification of the progressive alignment method of Feng
& Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar
to that described by Higgins & Sharp, CABIOS 5:151 (1989).
[0089] Another example of a useful algorithm is the BLAST
algorithm, described in Altschul et al., J. Mol. Biol. 215:403
(1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873
(1993). A particularly useful BLAST program is the WU-BLAST-2
program which was obtained from Altschul et al., Meth. Enzymol.,
266:460 (1996); blast.wustl/edu/blast/README.html. WU-BLAST-2 uses
several search parameters, which are preferably set to the default
values. The parameters are dynamic values and are established by
the program itself depending upon the composition of the particular
sequence and composition of the particular database against which
the sequence of interest is being searched; however, the values may
be adjusted to increase sensitivity.
[0090] An additional useful algorithm is gapped BLAST as reported
by Altschul et al., Nucleic Acids Res. 25:3389 (1997).
[0091] A percentage amino acid sequence identity value is
determined by the number of matching identical residues divided by
the total number of residues of the "longer" sequence in the
aligned region. The "longer" sequence is the one having the most
actual residues in the aligned region (gaps introduced by
WU-Blast-2 to maximize the alignment score are ignored).
[0092] In a similar manner, percent nucleic acid sequence identity
with respect to the coding sequence of the polypeptides disclosed
herein is defined as the percentage of nucleotide residues in the
candidate sequence that are identical with the nucleotides in the
polynucleotide specifically disclosed herein.
[0093] The alignment may include the introduction of gaps in the
sequences to be aligned. In addition, for sequences which contain
either more or fewer amino acids than the polypeptides specifically
disclosed herein, it is understood that in one embodiment, the
percentage of sequence identity will be determined based on the
number of identical amino acids in relation to the total number of
amino acids. Thus, for example, sequence identity of sequences
shorter than a sequence specifically disclosed herein, will be
determined using the number of amino acids in the shorter sequence,
in one embodiment. In percent identity calculations relative weight
is not assigned to various manifestations of sequence variation,
such as insertions, deletions, substitutions, etc.
[0094] In one embodiment, only identities are scored positively
(+1) and all forms of sequence variation including gaps are
assigned a value of "0," which obviates the need fix a weighted
scale or parameters as described below for sequence similarity
calculations. Percent sequence identity can be calculated, for
example, by dividing the number of matching identical residues by
the total number of residues of the "shorter" sequence in the
aligned region and multiplying by 100. The "longer" sequence is the
one having the most actual residues in the aligned region.
[0095] When referring to "polypeptide" herein, a person of skill
the art will recognize that a protein can be used instead, unless
the context clearly indicates otherwise. A "protein" may also refer
to an association of one or more polypeptides.
[0096] The term "nucleic acid" refers to a polymeric form
nucleotides, either ribonucleotides or deoxynucleotides, a
combination of ribo and deoxyribonucleotides or a modified form of
either type of nucleotide. The terms should also be understood to
include, as equivalents, analogs of either RNA or DNA made from
nucleotide analogs, and, as applicable to the embodiment being
described, single-stranded (such as sense or antisense) and
double-stranded polynucleotides.
[0097] Unless the context clearly indicates otherwise, "protein,"
"polypeptide," and "peptide" are used interchangeably herein when
referring to a gene expression product, e.g., an amino acid
sequence as encoded by a coding sequence. A "protein" may also
refer to an association of one or more proteins, such as an
antibody. A "protein" may also refer to a protein fragment. A
protein may be a post-translationally modified protein such as a
glycosylated protein.
[0098] A "protein" according to the invention includes a protein
wherein one or more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
20, 30, 40, 50, 60, 70, 80, 90, 100 or more) amino acids are not
identical to the amino acids of the corresponding wild type
protein. A "protein" according to the invention includes a protein
wherein one or more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
20, 30, 40, 50, 60, 70, 80, 90, 100 or more) amino acids have been
deleted as compared to the corresponding wild type protein. A
"protein" according to the invention includes a protein wherein one
or more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) amino
acids have been added and/or substituted as compared the
corresponding wild type protein.
[0099] It will be understood that the polypeptides specifically
disclosed herein will typically tolerate substitutions (e.g.,
conservative substitutions) in the amino acid sequence and
substantially retain biological activity. To identify polypeptides
of the invention other than those specifically disclosed herein,
amino acid substitutions may be based on any characteristic known
in the art, including the relative similarity or differences of the
amino acid side-chain substituents, for example, their
hydrophobicity, hydrophilicity, charge, size, and the like.
[0100] Amino acid substitutions other than those disclosed herein
may be achieved by changing the codons of the DNA sequence (or RNA
sequence), according to the following codon table:
TABLE-US-00001 TABLE 1 Amino Acid Codons Alanine Ala A GCA GCC GCG
GCT Cysteine Cys C TGC TGT Aspartic acid Asp D GAC GAT Glutamic
acid Glu E GAA GAG Phenylalanine Phe F TTC TTT Glycine Gly G GGA
GGC GGG GGT Histidine His H CAC CAT Isoleucine Ile I ATA ATC ATT
Lysine Lys K AAA AAG Leucine Leu L TTA TTG CTA CTC CTG CTT
Methionine Met M ATG Asparagine Asn N AAC AAT Proline Pro P CCA CCC
CCG CCT Glutamine Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG
CGT Serine Ser S AGC ACT TCA TCC TCG TCT Threonine Thr T ACA ACC
ACG ACT Valine Val V GTA GTC GTG GTT Tryptophan Trp W TGG Tyrosine
Tyr Y TAC TAT
[0101] In identifying amino acid sequences encoding polypeptides
other than those specifically disclosed herein, the hydropathic
index of amino acids may be considered. The importance of the
hydropathic amino acid index in conferring interactive biologic
function on a protein, is generally understood in the art and
Doolittle. J. Mol. Biol. 157:105 (1982); incorporated herein by
reference in its entirety). It is accepted that the relative
hydropathic character of the amino acid contributes to the
secondary structure of the resultant protein, which in turn defines
the interaction of the protein with other molecules, for example,
enzymes, substrates, receptors, DNA, antibodies, antigens, and the
like.
[0102] Each amino acid has been assigned a hydropathic index on the
basis of its hydrophobicity and charge characteristics (Kyte and
Doolittle, id.), these are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
[0103] Accordingly, the hydropathic index of the amino acid (or
amino acid sequence) may be considered when modifying the
polypeptides specifically disclosed herein.
[0104] It is also understood in the art that the substitution of
amino acids can be made on the basis of hydrophilicity. U.S. Pat.
No. 4,554,101 (incorporated herein by reference in its entirety)
states that the greatest local average hydrophilicity of a protein,
as governed by the hydrophilicity of its adjacent amino acids,
correlates with a biological property of the protein.
[0105] As detailed in U.S. Pat. No. 4,554,401, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (.+-.3.0); lysine (.+-.3.0); aspartate (+3.0.+-.1);
glutamate (+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine
(+0.2); glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine
(-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3);
valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryprophan (-3.4).
[0106] Thus, the hydrophilicity of the amino acid (or amino acid
sequence) may be considered when identifying additional
polypeptides beyond those specifically disclosed herein.
[0107] As used herein, the term "homolog" is used to refer to a
molecule which differs from a naturally occurring polypeptide by
minor modifications to the naturally occurring polypeptide, but
which significantly retains a biological activity of the naturally
occurring polypeptide. Minor modifications include, without
limitation, changes in one or a few amino acid side chains, changes
to one or a few amino acids (including deletions, insertions,
and/or substitutions), changes in stereochemistry of one or a few
atoms, and minor derivatizations, including, without limitation,
methylation, glycosylation, phosphorylation, acetylation,
myristoylation, prenylation, palmitoylation, amidation, and
addition of glycosylphosphatidyl inositol. The term "substantially
retains," as used herein, refers to a fragment, homolog, or other
variant of a polypeptide that retains at least about 50% of the
activity of the naturally occurring polypeptide (e.g., binding to
or inhibiting a calcium channel), e.g., about 70%, 80%, 90% or
more. Other biological activities, depending on the polypeptide,
may include pH sensitivity, enzyme activity, receptor binding,
ligand binding, induction of a growth factor, a cell signal
transduction event, etc.
[0108] In certain embodiments, the polypeptide of the invention
comprises at least one modified terminus, e.g., to protect the
polypeptide against degradation. In some embodiments, the
N-terminus is acetylated and/or the C-terminus is amidated. In some
embodiments, the polypeptide comprises one or two D-alanines at the
amino- and/or carboxyl-terminal ends.
[0109] In certain embodiments, the polypeptide of the invention
comprises at least one non-natural amino acid (e.g., 1, 2, 3, or
more) or at least one terminal modification (e.g., 1 or 2). In some
embodiments, the peptide comprises at least one non-natural amino
acid and at least one terminal modification.
[0110] By "gene expression product" is meant a molecule that is
produced as a result of transcription of an entire gene or a
portion of a gene. Gene products include RNA molecules transcribed
from a gene, as well as proteins translated from such transcripts.
Proteins may be naturally occurring isolated proteins or may be the
product of recombinant or chemical synthesis. The term "protein
fragment" refers to a protein in which amino acid residues are
deleted as compared to the reference protein itself, but where the
remaining amino acid sequence is usually identical to or
substantially identical (for example, 100%, 99%, 95%, 90%, 85%,
80%, 75%, 70%, 65%, or 60% identical) to that of the reference
protein. Such deletions may occur at the amino-terminus or
carboxy-terminus of the reference protein, or alternatively both.
Deletions may also occur internally.
[0111] Fragments typically are at least about 5, 6, 8 or 10 amino
acids long, at least about 14 amino acids long, at least about 20,
30, 40 or 50 amino acids long, at least about 75 amino acids long,
or at least about 100, 150, 200, 300, 500 or more amino acids long.
Fragments may be obtained using proteinases to fragment a larger
protein, or by recombinant methods, such as the expression of only
part of a protein-encoding nucleotide sequence (either alone or
fused with another protein-encoding nucleic acid sequence). In
various embodiments, a fragment may comprise an enzymatic activity
and/or an interaction site of the reference protein to, e.g., a
cell receptor. In another embodiment, a fragment may have
immunogenic properties. The proteins may include mutations
introduced at particular loci by a variety of known techniques,
which do not adversely effect, but may enhance, their use in the
methods provided herein. A fragment can retain one or more of the
biological activities of the reference protein.
[0112] As used herein, a "functional" peptide or "functional
fragment" is one that substantially retains at least one biological
activity normally associated with that peptide (e.g., binding to or
inhibiting a calcium channel). In particular embodiments, the
"functional" peptide or "functional fragment" substantially retains
all of the activities possessed by the unmodified peptide. By
"substantially retains" biological activity, it is meant that the
peptide retains at least about 50%, 60%, 75%, 85%, 90%, 95%, 97%,
98%, 99%, or more, of the biological activity of the native
polypeptide (and can even have a higher level of activity than the
native peptide). A "non-functional" peptide is one that exhibits
little or essentially no detectable biological activity normally
associated with the peptide (e.g., at most, only an insignificant
amount, e.g., less than about 10% or even 5%). Biological
activities such as protein binding and calcium channel inhibitory
activity can be measured using assays that are well known in the
art and as described herein.
[0113] A "patient" or "subject" or "host" refers to either a human
or non-human animal.
[0114] A "subject" includes both avians and mammals, with mammals
being preferred. The term "avian" as used herein includes, but is
not limited to, chickens, ducks, geese, quail, turkeys, and
pheasants. The term "mammal" as used herein includes, but is not
limited to, humans, bovines, ovines, caprines, equines, felines,
canines, lagomorphs, etc. Human subjects include neonates, infants,
juveniles, and adults.
[0115] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication, commensurate with a reasonable
benefit/risk ratio.
[0116] A "pharmaceutically-acceptable carrier" as used herein means
a pharmaceutically-acceptable material, composition or vehicle,
such as a liquid or solid filler, diluent, excipient, or solvent
encapsulating material, involved in carrying or transporting the
subject compound from one organ, or portion of the body, to another
organ, or portion of the body. Each carrier must be "acceptable" in
the sense of being compatible with the other ingredients of the
formulation and not injurious to the patient. Some examples of
materials which can serve as pharmaceutically-acceptable carriers
include: (1) sugars, such as lactose, glucose and sucrose; (2)
starches, such as corn starch and potato starch; (3) cellulose, and
its derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt;
(6) gelatin; (7) talc; (8) excipients, such as cocoa butter and
suppository waxes; (9) oils, such as peanut oil, cottonseed oil,
safflower oil, sesame oil, olive oil, corn oil and soybean oil;
(10) glycols, such as propylene glycol; (11) polyols, such as
glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters,
such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering
agents, such as magnesium hydroxide and aluminum hydroxide; (15)
alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18)
Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions;
(21) polyesters, polycarbonates and/or polyanhydrides; and (22)
other non-toxic compatible substances employed in pharmaceutical
formulations.
[0117] A "pharmaceutically-acceptable salt" refers to the
relatively non-toxic, inorganic and organic acid addition salts of
compounds.
[0118] As used herein, a "stress protein," also known as a "heat
shock protein" or "Hsp," is a protein that is encoded by a stress
gene, and is therefore typically produced in significantly greater
amounts upon the contact or exposure of the stressor to the
organism. The term "stress protein" as used herein is intended to
include such portions and peptides of a stress protein A "stress
gene," also known as "heat shock gene", as used herein, refers to a
gene that is activated or otherwise detectably upregulated due to
the contact or exposure of an organism (containing the gene) to a
stressor, such as heat shock, hypoxia, glucose deprivation, heavy
metal salts inhibitors of energy metabolism and electron transport,
and protein denaturants, or to certain benzoquinone ansamycins.
Nover, L., Heat Shock Response, CRC Press, Inc., Boca Raton, Fla.
(1991). "Stress gene" also includes homologous genes within known
stress gene families, such as certain genes within the Hsp70 and
Hsp90 stress gene families, even though such homologous genes are
not themselves induced by a stressor. Each of the terms stress gene
and stress protein as used in the present specification may be
inclusive of the other, unless the context indicates otherwise.
[0119] The term "vaccine" refers to a substance that elicits an
immune response and also confers protective immunity upon a
subject.
[0120] "Vector" refers to a nucleic acid molecule capable of
transporting another nucleic acid to which it has been linked. One
type of preferred vector is an episome, i.e., a nucleic acid
capable of extra-chromosomal replication. Preferred vectors are
those capable of autonomous replication and/or expression of
nucleic acids to which they are linked. Vectors capable of
directing the expression of genes to which they are operatively
linked are referred to herein as "expression vectors." In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of "plasmids" which refer generally to circular
double stranded DNA loops, which, in their vector form are not
bound to the chromosome. In the present specification, "plasmid"
and "vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, as will be appreciated by
those skilled in the art, the invention is intended to include such
other forms of expression vectors, such as viral vectors, which
serve equivalent functions and which become subsequently known in
the art.
[0121] As used herein, "specifically binds" means via covalent or
hydrogen bonding or electrostatic attraction.
[0122] As used herein, an "immune response" or a "detectable
response" includes a detectable level of a response that occurs in
a subject that has been exposed to a fusion protein of the
invention, as described herein, but not in a subject that has not
been exposed to a fusion protein of the invention. A "response"
that is detected includes but is not limited to an increase in an
immune response or an increase in immunogenicity.
[0123] A "detectable response" means a response that is at least
0.01%, 0.5%, 1% or more than the response of a subject that has not
been exposed to a fusion protein of the invention. A "detectable
response" also means a response that is at least 0.5, 1, 2, 3, 4,
5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1000-fold or more
greater than the response of a subject that has not been exposed to
a fusion protein of the invention.
[0124] As used herein, "immunogenicity" refers to the ability, for
example the ability of a fusion protein of the invention to induce
humoral and/or cell-mediated immune responses.
[0125] As used herein, "immune response" refers to a response made
by the immune system of an organism to a substance, which includes
but is not limited to foreign or self proteins. There are three
general types of "immune response" including, but not limited to
mucosal, humoral and cellular "immune responses." A "mucosal immune
response" results from the production of secretory IgA (sIgA)
antibodies in secretions that bathe all mucosal surfaces of the
respiratory tract, gastrointestinal tract and the genitourinary
tract and in secretions from all secretory glands (McGhee, J. R.,
et al., 1983, Annals NY Acad. Sci. 409). These sIgA antibodies act
to prevent colonization of pathogens on a mucosal surface
(Williams, R. C. et al., Science 177, 697 (1972); McNabb, P. C., et
al., Ann. Rev. Microbiol. 35, 477 (1981)) and thus act as a first
line of defense to prevent colonization or invasion through a
mucosal surface. The production of sIgA can be stimulated either by
local immunization of the secretory gland or tissue or by
presentation of an antigen to either the gut-associated lymphoid
tissue (GALT or Peyer's patches) or the bronchial-associated
lymphoid tissue (BALT; Cebra, J. J., et al., Cold Spring Harbor
Symp. Quant. Biol. 41, 210 (1976); Bienenstock, J. M., Adv. Exp.
Med. Biol. 107, 53 (1978); Weisz-Carrington, P. et al., J. Immunol.
123, 1705 (1979); McCaughan, C. et al., Internal Rev. Physiol 28,
131 (1983)). Membranous microfold cells, otherwise known as M
cells, cover the surface of the GALT and BALT and may be associated
with other secretory mucosal surfaces. M cells act to sample
antigens from the luminal space adjacent to the mucosal surface and
transfer such antigens to antigen-presenting cells (dendritic cells
and macrophages), which in turn present the antigen to a T
lymphocyte (in the case of T-dependent antigens), which process the
antigen for presentation to a committed B cell. B cells are then
stimulated to proliferate, migrate and ultimately be transformed
into an antibody-secreting plasma cell producing IgA against the
presented antigen. When the antigen is taken up by M cells
overlying the GALT and BALT, a generalized mucosal immunity results
with sIgA against the antigen being produced by all secretory
tissues in the body (Cebra et al., supra; Bienenstock et al.,
supra; Weinz-Carrington et al., supra; McCaughan et al., supra).
Oral immunization is therefore an important route to stimulate a
generalized mucosal immune response and, in addition, leads to
local stimulation of a secretory immune response in the oral cavity
and in the gastrointestinal tract.
[0126] An "immune response" may be measured using techniques known
to those of skill in the art. For example, serum, blood or other
secretions may be obtained from an organism for which an "immune
response" is suspected to be present, and assayed for the presence
of the above mentioned immunoglobulins using an enzyme-linked
immuno-absorbant assay (ELISA; U.S. Pat. No. 5,951,988; Ausubel et
al., Short Protocols in Molecular Biology 3.sup.rd Ed. John Wiley
& Sons, Inc. 1995). A statistical test known in the art may be
used to determine the difference in measured immunoglobolin levels
including, but not limited to ANOVA, Student's T-test, and the
like, wherein the P value is at least <0.1, <0.05, <0.01,
<0.005, <0.001, and even <0.0001.
[0127] An "immune response" may be measured using other techniques
such as immunohistochemistry using labeled antibodies which are
specific for portions of the immunoglobulins raised during the
"immune response." Microscopic data obtained by
immunohistochemistry may be quantitated by scanning the
immunohistochemically stained tissue sample and quantiating the
level of staining using a computer software program known to those
of skill in the art including, but not limited to NIH Image
(National Institutes of Health, Bethesda, Md.). According to the
present invention, a fusion protein of the present invention can be
said to stimulate an "immune response" if the quantitative measure
of immunohistochemical staining in a subject treated with a fusion
protein is statistically different from the measure of
immunohistochemical staining detected in a subject not treated with
a fusion protein. A statistical test known in the art may be used
to determine the difference in measured immunohistochemical
staining levels including, but not limited to ANOVA, Student's
T-test, and the like, wherein the P value is at least <0.1,
<0.05, <0.01, <0.005, <0.001, and even <0.0001.
1. Engineered Fusion Proteins
[0128] Provided are fusion proteins comprising an antigen binding
domain fused in frame to a modified Mycobacterium tuberculosis heat
shock protein 70 (HSP70).
[0129] The antigen binding domain may be an engineered antibody or
antibody mimetic and may comprise, for example, at least one scFv,
at least one Fab fragment, at least one Fv fragment, etc. It may be
monovalent or it may be multivalent. In embodiments wherein the
engineered antibody is multivalent, it may be bivalent, trivalent,
tetravalent, etc. The multivalent antibodies may be monospecific or
multispecific, e.g., bispecific, trispecific, tetraspecific, etc.
The multivalent antibodies may be in any form, such as a diabody,
triabody, tetrabody, etc. In certain embodiments, the engineered
antibody is a Tandab. The modified HSP70 may be, for example, a
fragment of the natural sequence, a modification of the natural
amino acid sequence (e.g., a deletion, addition, and/or
substitution) or any combination thereof. The full-length
polypeptide sequence of Mycobacterium tuberculosis HSP70 is shown
in SEQ ID NO:1.
TABLE-US-00002 (SEQ ID NO: 1) MARAVGIDLG TTNSVVSVLE GGDPVVVANS
EGSRTTPSIV AFARNGEVLV GQPAKNQAVT NVDRTVRSVK RHMGSDWSIE IDGKKYTAPE
ISARILMKLK RDAEAYLGED ITDAVITTPA YFNDAQRQAT KDAGQIAGLN VLRIVNEPTA
AALAYGLDKG EKEQRILVFD LGGGTFDVSL LEIGEGVVEV RATSGDNHLG GDDWDQRVVD
WLVDKFKGTS GIDLTKDKMA MQRLREAAEK AKIELSSSQS TSINLPYITV DADKNPLFLD
EQLTRAEFQR ITQDLLDRTR KPFQSVIADT GISVSEIDHV VLVGGSTRMP AVTDLVKELT
GGKEPNKGVN PDEVVAVGAA LQAGVLKGEV KDVLLLDVTP LSLGIETKGG VMTRLIERNT
TIPTKRSETF TTADDNQPSV QIQVYQGERE IAAHNKLLGS FELTGIPPAP RGIPQIEVTF
DIDANGIVHV TAKDKGTGKE NTIRIQEGSG LSKEDIDRMI KDAEAHAEED RKRREEADVR
NQAETLVYQT EKFVKEQREA EGGSKVPEDT LNKVDAAVAE AKAALGGSDI SAIKSAMEKL
GQESQALGQA IYEAAQAASQ ATGAAHPGGE PGGAHPGSAD DVVDAEVVDD GREAK
[0130] Further details about antigen binding domains and modified
HSP70 sequences which may be incorporated into the subject fusion
polypeptides is provided below.
A. Antigen Binding Domains
[0131] An antigen binding domain is any peptide sequence that
specifically binds to an antigen and can function as part of a
fusion protein. The antigen binding domain may be a natural
sequence, e.g., an antibody or a fragment thereof, a ficolin, a
collection, etc. The antigen binding domain may be a synthetic
sequence, e.g., an engineered antibody, an antibody-like peptide,
an antibody mimetic, an aptamer, etc.
[0132] The antigen binding domain may specifically bind to an
antigen of interest. The antigen binding domain may specifically
bind, e.g., to a tumor cell antigen of a cancer to be treated or
prevented by the methods of the present invention. Such antigens
include, but are not limited to, for example, antigens of a human
sarcoma cell or carcinoma cell, e.g., fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, ostcogenic sarcoma, chordoma,
angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
colorectal cancer, pancreatic cancer, breast cancer, ovarian
cancer, prostate cancer, squamous cell carcinoma, basal cell
carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland
carcinoma, papillary carcinoma, papillary adenocarcinomas,
cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma,
renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor,
cervical cancer, testicular tumor, lung carcinoma, small cell lung
carcinoma, bladder carcinoma, epithelial carcinoma, glioma,
astrocytoma, medulloblastoma, craniopharyngioma, ependymoma,
pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma,
meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias,
e.g., acute lymphocytic leukemia and acute myelocytic leukemia
(myeloblastic, promyelocytic, myelomonocytic, monocytic and
erythroleukemia); chronic leukemia (chronic myelocytic
(granulocytic) leukemia and chronic lymphocytic leukemia); and
polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkin's
disease), multiple myeloma, Waldenstrom's macroglobulinemia, or
heavy chain disease cell.
[0133] The antigen binding domain may specifically bind other
antigens, including disease-associated and/or viral antigens. The
antigen binding domain may specifically bind diseased and/or
virally infected cells expressing antigen on their surface.
[0134] Infectious diseases that can be treated or prevented by the
methods of the present invention are caused by infectious agents.
Such infectious agents or antigens derived therefrom, that may be
targeted by the antigen binding domain of the present invention,
include, but are not limited to, viruses, bacteria, fungi, and
protozoa. The invention is not limited to treating or preventing
infectious diseases caused by intracellular pathogens but is
intended to include extracellular pathogens as well. Many medically
relevant microorganisms have been described extensively in the
literature, e.g., see C. G. A Thomas, Medical Microbiology,
Bailliere Tindall, Great Britain 1983, the entire contents of which
is hereby incorporated by reference.
[0135] Infectious viruses of both human and non-human vertebrates,
include retroviruses, RNA viruses and DNA viruses expressing
antigen. Examples of viral antigens include but are not limited to
antigens of Retroviridae (e.g., human immunodeficiency viruses,
such as HIV-I (also referred to as HTLV-III, LAV or HTLV-III/LAV,
or HIV-III; and other isolates, such as HIV-LP; Picornaviridae
(e.g., polio viruses, hepatitis A virus; enteroviruses, human
Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g.,
strains that cause gastroenteritis); Togaviridae (e.g., equine
encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue
viruses, encephalitis viruses, yellow fever viruses); Coronaviridae
(e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis
viruses, rabies viruses); Filoviridae (e.g., ebola viruses);
Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles
virus, respiratory syncytial virus); Orthomyxoviridae (e.g.,
influenza viruses); Bungaviridae (e.g., Hantaan viruses, bunga
viruses, phleboviruses and Nairo viruses); Arena viridae
(hemorrhagic fever viruses); Reoviridae (e.g., reoviruses,
orbiviurses and rotaviruses); Bimaviridae; Hepadnaviridae
(Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae
(papilloma viruses, polyoma viruses); Adenoviridae (most
adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2,
varicella zoster virus, cytomegalovirus (CMV), herpes virus;
Poxyiridae (variola viruses, vaccinia viruses, pox viruses); and
Iridoviridae (e.g., African swine fever virus); and unclassified
viruses (e.g., the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitis (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class I=internally transmitted; class
2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related
viruses, and astroviruses).
[0136] Retroviral antigens that may be targeted include antigens of
both simple retroviruses and complex retroviruses. The simple
retroviruses include the subgroups of B-type retroviruses, C-type
retroviruses and D-type retroviruses. An example of a B-type
retrovirus is mouse mammary tumor virus (MMTV). The C-type
retroviruses include subgroups C-type group A (including Rous
sarcoma virus (RSV), avian leukemia virus (ALV), and avian
myeloblastosis virus (AMV)) and C-type group B (including, murine
leukemia virus (MLV), feline leukemia virus (FeLV), murine sarcoma
virus (MSV), gibbon ape leukemia virus (GALV), spleen necrosis
virus (SNV), reticuloendotheliosis virus (RV) and simian sarcoma
virus (SSV)). The D-type retroviruses include Mason-Pfizer monkey
virus (MPMV) and simian retrovirus type 1 (SRV-1). The complex
retroviruses include the subgroups of lentiviruses T-cell leukemia
viruses and the foamy viruses. Lentiviruses include HIV-1, but also
include HIV-2, SIV, Visna virus, feline immunodeficiency virus
(FIV), and equine infectious anemia virus (EIAV). The T-cell
leukemia viruses include HTLV-I, HTLV-II, simian T-cell leukemia
virus (STLV), and bovine leukemia virus (BLV). The foamy viruses
include human foamy virus (HFV), simian foamy virus (SFV) and
bovine foamy virus (BFV).
[0137] Examples of antigens of RNA viruses that may be bound by an
antigen binding domain include, but are not limited to, antigens of
the following: members of the family Reoviridae, including the
genus Orthoreovirus (multiple serotypes of both mammalian and avian
retroviruses), the genus Orbivirus (Bluetongue virus, Eugenangee
virus, Kemerovo virus, African horse sickness virus, and Colorado
Tick Fever virus), the genus Rotavirus (human rotavirus, Nebraska
calf diarrhea virus, murine rotavirus, simian rotavirus, bovine or
ovine rotavirus, avian rotavirus); the family Picornaviridae,
including the genus Enterovirus (poliovirus, Coxsackie virus A and
B, enteric cytopathic human orphan (ECHO) viruses, hepatitis A
virus, Simian enteroviruses, Murine encephalomyelitis (ME) viruses,
Poliovirus muris, Bovine enteroviruses, Porcine enteroviruses, the
genus Cardiovirus (Encephalomyocarditis virus (EMC), Mengovirus),
the genus Rhinovirus (Human rhinoviruses including at least 113
subtypes; other rhinoviruses), the genus Apthovirus (Foot and Mouth
disease (FMDV); the family Calciviridae, including Vesicular
exanthema of swine virus, San Miguel sea lion virus, Feline
picornavirus and Norwalk virus; the family Togaviridae, including
the genus Alphavirus (Eastern equine encephalitis virus, Semliki
forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong
virus, Ross river virus, Venezuelan equine encephalitis virus,
Western equine encephalitis virus), the genus Flavirus (Mosquito
home yellow fever virus, Dengue virus, Japanese encephalitis virus,
St. Louis encephalitis virus, Murray Valley encephalitis virus,
West Nile virus, Kunjin virus, Central European tick borne virus,
Far Eastern tick borne virus, Kyasanur forest virus, Louping III
virus, Powassan virus, Omsk hemorrhagic fever virus), the genus
Rubivirus (Rubella virus), the genus Pestivirus (Mucosal disease
virus, Hog cholera virus, Border disease virus); the family
Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related
viruses, California encephalitis group viruses), the genus
Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever
virus), the genus Nairovirus (Crimean-Congo hemorrhagic fever
virus, Nairobi sheep disease virus), and the genus Uukuvirus
(Unkuniemi and related viruses); the family Orthomyxoviridae,
including the genus Influenza virus (Influenza virus type A, many
human subtypes); Swine influenza virus, and Avian and Equine
influenza viruses; influenza type B (many human subtypes), and
influenza type C (possible separate genus); the family
paramyxoviridae, including the genus Paramyxovirus (Parainfluenza
virus type 1, Sendai virus, Hemadsorption virus, Parainfluenza
viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the
genus Morbillivirus (Measles virus, subacute sclerosing
panencephalitis virus, distemper virus, Rinderpest virus), the
genus Pneumovirus (respiratory syncytial virus (RSV), Bovine
respiratory syncytial virus and Pneumonia virus of mice); forest
virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross
river virus, Venezuelan equine encephalitis virus, Western equine
encephalitis virus), the genus Flavirius (Mosquito borne yellow
fever virus, Dengue virus, Japanese encephalitis virus, St. Louis
encephalitis virus, Murray Valley encephalitis virus, West Nile
virus, Kunjin virus, Central European tick borne virus, Far Eastern
tick borne virus, Kyasanur forest virus, Louping III virus,
Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus
(Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog
cholera virus, Border disease virus); the family Bunyaviridae,
including the genus Bunyvirus (Bunyamwera and related viruses,
California encephalitis group viruses), the genus Phlebovirus
(Sandfly fever Sicilian virus, Rift Valley fever virus), the genus
Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep
disease virus), and the genus Uukuvirus (Uukuniemi and related
viruses); the family Orthomyxoviridae, including the genus
Influenza virus (Influenza virus type A, many human subtypes);
Swine influenza virus, and Avian and Equine influenza viruses;
influenza type B (many human subtypes), and influenza type C
(possible separate genus); the family paramyxoviridae, including
the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus
of mice); the family Rhabdoviridae, including the genus
Vesiculovirus (VSV), ChanBipura virus, Flanders-Hart Park virus),
the genus Lyssavirus (Rabies virus), fish Rhabdoviruses, and two
probable Rhabdoviruses (Marburg virus and Ebola virus); the family
Arenaviridae, including Lymphocytic choriomeningitis virus (LCM),
Tacaribe virus complex, and Lassa virus; the family Coronoaviridae,
including Infectious Bronchitis Virus (IBV), Mouse Hepatitis virus,
Human enteric corona virus, and Feline infectious peritonitis
(Feline coronavirus).
[0138] Illustrative DNA viral antigens include, but are not limited
to antigens of the family Poxyiridae, including the genus
Orthopoxvirus (Variola major, Variola minor, Monkey pox Vaccinia,
Cowpox, Buffalopox, Rabbitpox, Ectromelia), the genus
Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus (Fowlpox,
other avian poxvirus), the genus Capripoxvirus (sheeppox, goatpox),
the genus Suipoxvirus (Swinepox), the genus Parapoxvirus
(contagious postular dermatitis virus, pseudocowpox, bovine papular
stomatitis virus); the family Inidoviridae (African swine fever
virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the
family Herpesviridae, including the alpha-Herpesviruses (Herpes
Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus,
Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine
keratoconjunctivitis virus, infectious bovine rhinotracheitis
virus, feline rhinotracheitis virus, infectious laryngotracheitis
virus) the Beta-herpesviruses (Human cytomegalovirus and
cytomegaloviruses of swine, monkeys and rodents); the
gramma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease
virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus,
guinea pig herpes virus, Lucke tumor virus); the family
Adenoviridae, including the genus Mastadenovirus (Human subgroups
A, B, C, D, E and ungrouped; simian adenoviruses (at least 23
serotypes), infectious canine hepatitis, and adenoviruses of
cattle, pigs, sheep, frogs and many other species, the genus
Aviadenovirus (Avian adenoviruses); and non-cultivatable
adenoviruses; the family Papoviridae, including the genus
Papillomavirus (Human papilloma viruses, bovine papilloma viruses,
Shope rabbit papilloma virus, and various pathogenic papilloma
viruses of other species), the genus Polyomavirus (polyomavirus,
Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K
virus, BK virus, JC virus, and other primate polyoma viruses such
as Lymphotrophic papilloma virus); the family Parvoviridae
including the genus Adeno-associated viruses, the genus Parvovirus
(Feline panleukopenia virus, bovine parvovirus, canine parvovirus.
Aleutian mink disease virus, etc). Finally, DNA viral antigens may
include viral antigens of viruses which do not fit into the above
families such as Kuru and Creutzfeldt-Jacob disease viruses and
chronic infectious neuropathic agents.
B. Engineered Antibodies
[0139] Natural antibodies are themselves dimers, and thus,
bivalent. If two hybridoma cells producing different antibodies are
artificially fused, some of the antibodies produced by the hybrid
hybridoma are composed of two monomers with different
specificities. Such bispecific antibodies can also be produced by
chemically conjugating two antibodies. Natural antibodies and their
bispecific derivatives are relatively large and expensive to
produce. The constant domains of mouse antibodies are also a major
cause of the human anti-mouse antibody (HAMA) response, which
prevents their extensive use as therapeutic agents. They can also
give rise to unwanted effects due to their binding of Fc-receptors.
For these reasons, molecular immunologists have been concentrating
on the production of the much smaller Fab- and Fv-fragments in
microorganisms. These smaller fragments are not only much easier to
produce, they are also less immunogenic, have no effector
functions, and, because of their relatively small size, they are
better able to penetrate tissues and tumors. In the case of the
Fab-fragments, the constant domains adjacent to the variable
domains play a major role in stabilizing the heavy and light chain
dimer. Accordingly, while full-length or nearly full length
engineered antibodies may comprise the subject fusion polypeptides,
smaller, single domain engineered antibodies (that may be
multivalent and multispecific) are preferred for use in the fusion
polypeptides.
[0140] The Fv-fragment is much less stable, and a peptide linker
may therefore be introduced between the heavy and light chain
variable domains to increase stability. This construct is known as
a single chain Fv (scFv)-fragment. A disulfide bond is sometimes
introduced between the two domains for extra stability. Thus far,
tetravalent scFv-based antibodies have been produced by fusion to
extra polymerizing domains such as the streptavidin monomer that
forms tetramers, and to amphipathic alpha helices. However, these
extra domains can increase the immunogenicity of the tetravalent
molecule.
[0141] Bivalent and bispecific antibodies can be constructed using
only antibody variable domains. A fairly efficient and relatively
simple method is to make the linker sequence between the V.sub.H
and V.sub.L domains so short that they cannot fold over and bind
one another. Reduction of the linker length to 3-12 residues
prevents the monomeric configuration of the scFv molecule and
favors intermolecular V.sub.H-V.sub.L pairings with formation of a
60 kDa non-covalent scFv dimer "diabody" (Holliger et al., 1993,
Proc. Natl. Acad., Sci. USA 90, 6444-6448). The diabody format can
also be used for generation of recombinant bispecific antibodies,
which are obtained by the noncovalent association of two
single-chain fusion products, consisting of the V.sub.H domain from
one antibody connected by a short linker to the V.sub.L domain of
another antibody. Reducing the linker length still further below
three residues can result in the formation of trimers ("triabody,"
about 90 kDa) or tetramers ("tetrabody," about 120 kDa) (Le Gall et
al., 1999, FEBS Letters 453, 164-168). For a review of engineered
antibodies, particularly single domain fragments, see Holliger and
Hudson, 2005, Nature Biotechnology, 23:1126-1136. All of such
engineered antibodies may be used in the fusion polypeptides
provided herein.
[0142] Other multivalent engineered antibodies that may comprise
the subject fusion polypeptides are described in Lu, et al., 2003,
J. Immunol. Meth. 279:219-232 (di-diabodies or tetravalent
bispecific antibodies); US Published Application 20050079170
(multimeric Fv molecules or "flexibodies"); and WO99/57150 and
Kipriyanov, et al., 1999, J. Mol. Biol. 293:41-56 (tandem
diabodies, or "Tandabs").
[0143] Any of the above-described multivalent engineered antibodies
may be developed by one of skill in the art using routine
recombinant DNA techniques, for example as described in PCT
international Application No. PCT/US86/02269; European Patent
Application No. 184,187; European Parent Application No. 171,496;
European Patent Application No. 173,494; PCT International
Publication No. WO 86/01533; U.S. Pat. No. 4,816,567; European
Patent Application No. 125,023; Better et al. (1988) Science
240:1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA
84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et
al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al.
(1987) Cancer Res. 47:999-1005; Wood et al. (1985) Nature
314:446-449; Shaw et al. (1988) J. Natl. Cancer Inst.
80:1553-1559); Morrison (1985) Science 229:1202-1207; Oi et al.
(1986) BioTechniques 4:214; U.S. Pat. No. 5,225,539; Jones et al.
(1986) Nature 321:552-525; Verhoeyan et al. (1988) Science
239:1534; Beidler et al. (1988) J. Immunol. 141:4053-4060; and
Winter and Milstein, Nature, 349, pp 293-99 (1991)). Preferably
non-human antibodies are "humanized" by linking the non-human
antigen binding domain with a human constant domain (e.g., Cabilly
et al., U.S. Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad.
Sci. U.S.A., 81, pp 6851-55 (1984)).
[0144] The antigen recognition sites or entire variable regions of
the engineered antibodies may be derived from one or more parental
antibodies directed against mesothelin. The parental antibodies can
include naturally occurring antibodies or antibody fragments,
antibodies or antibody fragments adapted from naturally occurring
antibodies, antibodies constructed de novo using sequences of
antibodies or antibody fragments known to be specific for an
antigen of interest. Sequences that may be derived from parental
antibodies include heavy and/or light chain variable regions and/or
CDRs, framework regions or other portions thereof.
[0145] Multivalent, multispecific antibodies may contain a heavy
chain comprising two or more variable regions and/or a light chain
comprising one or more variable regions wherein at least two of the
variable regions recognize different epitopes on the same
antigen.
[0146] Candidate engineered antibodies for inclusion in the fusion
polypeptides, or the fusion polypeptides themselves, may be
screened for activity using a variety of known assays. For example,
screening assays to determine binding specificity are well known
and routinely practiced in the art. For a comprehensive discussion
of such assays, see Harlow et al., (Eds.), ANTIBODIES: A LABORATORY
MANUAL; Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.,
1988, Chapter 6.
C. Stress Proteins
[0147] Any suitable stress protein (heat shock protein (hsp)) can
be used in the fusion polypeptides of the present invention. The
stress protein preferably is HSP70, e.g., from M. tuberculosis.
[0148] A "heat shock protein" is encoded by a "heat shock gene" or
a stress gene, refers to the protein product of a gene that is
activated or otherwise detectably upregulated due to the contact or
exposure of an organism (containing the gene) to a stressor, such
as heat shock, hypoxia, glucose deprivation, heavy metal salts,
inhibitors of energy metabolism and electron transport, and protein
denaturants, or to certain benzoquinone ansamycins. Nover L., Heat
Shock Response, CRC Press, Inc., Boca Raton, Fla. (1991). "Heat
shock protein" also includes homologous proteins encoded by genes
within known stress gene families, even though such homologous
genes are not themselves induced by a stressor. A "heat shock
protein fusion" refers to a heat shock protein or portion thereof,
linked to an antigen binding domain.
[0149] Cells respond to a stressor (typically heat shock treatment)
by increasing the expression of a group of genes commonly referred
to as stress, or heat shock genes. Heat shock treatment involves
exposure of cells or organisms to temperatures that are one to
several degrees Celsius above the temperature to which the cells
are adapted. In coordination with the induction of such genes, the
levels of corresponding stress proteins increase in stressed
cells.
[0150] For example, a heat shock protein may be C- or N-terminally
joined to a antigen-specific antigen binding domain to generate a
heat shock protein fusion. A heat shock protein fusion comprising a
heat shock protein and an antigen binding domain is capable of
stimulating humoral and/or cellular immune responses, including CD8
cytotoxic T cell (CTL) responses, to the antigen.
[0151] For example, but not by way of limitation, heat shock
proteins which may be used according to the invention include BiP
(also referred to as grp78), Hsp10, Hsp20-30, Hsp60 hsp70, hsc70,
gp96 (grp94), hsp60, hsp40, and Hsp100-200, Hsp100, Hsp90, and
members of the families thereof. Especially preferred heat shock
proteins are BiP, gp96, and hsp70, as exemplified below. A
particular group of heat shock proteins includes Hsp90, Hsp70,
Hsp60, Hsp20-30, further preferably Hsp70 and Hsp60. Most preferred
is a member of the hsp70 family.
[0152] In bacteria, the predominant stress proteins are proteins
with molecular sizes of about 70 and 60 kDa, respectively, that are
commonly referred to as Hsp70 and Hsp60, respectively. These and
other specific stress proteins and the genes encoding them are
discussed further below. In bacteria, Hsp70 and Hsp60 typically
represent about 1-3% of cell protein based on the staining pattern
using sodium dodecyl sulfate polyacrylamide gel electrophoresis and
the stain Coomassie blue, but accumulate to levels as high as 25%
under stressful conditions. Stress proteins appear to participate
in important cellular processes such as protein synthesis,
intracellular trafficking, and assembly and disassembly of protein
complexes. It appears that the increased amounts of stress proteins
synthesized during stress serve primarily to minimize the
consequences of induced protein unfolding. Indeed, the preexposure
of cells to mildly stressful conditions that induce the synthesis
of stress proteins affords protection to the cells from the
deleterious effects of a subsequent more extreme stress.
[0153] The major stress proteins appear to be expressed in every
organism and tissue type examined so far. Also, it appears that
stress proteins represent the most highly conserved group of
proteins identified to date. For example, when stress proteins in
widely diverse organisms are compared, Hsp90 and Hsp70 exhibit 50%
or higher identity at the amino acid level and share many
similarities at non-identical positions. It is noted that similar
or higher levels of homology exist between different members of a
particular stress protein family within species.
[0154] The stress proteins, particularly Hsp70, Hsp60, Hsp20-30 and
Hsp 10, we among the major determinants recognized by the host
immune system in the immune response to infection by Mycobacterium
tuberculosis and Mycobacterium leprae. Young. R. A. and Elliott, T.
J., Stress Proteins, Infection, And immune Surveillance, Cell 50:58
(1989). Further, some rat arthritogenic T cells recognize Hsp60
epitopes, Van Eden, W. et al., Nature 331:171-173 (1988). However,
individuals, including healthy individuals, with no history
mycobacterial infection or autoimmune disease also carry T cells
that recognize both bacterial and human Hsp60 epitopes; a
considerable fraction of T cells in healthy individuals that are
characterized by expression of the gamma-delta T cell receptor
recognize both self and foreign stress proteins. O'Brien R. et al.,
Cell 57:664-674 (1989). Thus, individuals, even healthy
individuals, possess T-cell populations that recognize both foreign
and self stress protein epitopes.
[0155] This system recognizing stress protein epitopes presumably
constitutes an "early defense system" against invading organisms.
Murray, P. J. and Young, R. A., J. Bacteriol 174: 4193-6 (1992).
The system may be maintained by frequent stimulation by bacteria
and viruses. As discussed before, healthy individuals have T cell
populations recognizing self stress proteins. Thus, the presence of
autoreactive T cells is compatible with normal health and does not
cause autoimmune disease; this demonstrates the safety of stress
proteins within an individual. The safety of stress proteins is
additionally demonstrated by the success and relative safety of BCG
(Bacille Calmette Guerin, a strain of Mycobacterium bovis)
vaccinations, which induce an immune response against stress
proteins that is also protective against Mycobacterium
tuberculosis.
[0156] Hsp70 examples include Hsp72 and Hsc73 from mammalian cells,
DnaK from bacteria, particularly mycobacteria such as Mycobacterium
leprae, Mycobacterium tuberculosis, and Mycobacterium bovis (such
as Bacille-Calmette Guerin: referred to herein as Hsp71), DnaK from
Escherichia coli, yeast, and other prokaryotes, and BiP and Grp78.
Hsp70 is capable of specifically binding ATP as well as unfolded
polypeptides and peptides, thereby participating in protein folding
and unfolding as well as in the assembly and disassembly of protein
complexes.
[0157] In particular embodiments, the stress proteins of the
present invention are obtained from enterobacteria, mycobacteria
(particularly M. leprae, M. tuberculosis, M. vaccae, M. smegmatis
and M. bovis), E. coli, yeast, Drosophila, vertebrates, avians,
chickens, mammals, rats, mice, primates, or humans.
[0158] Naturally occurring or recombinantly derived mutants of heat
shock proteins may be used according to the invention, including
fragments and modified sequences. For example, but not by way of
limitation, the present invention provides for the use of heat
shock proteins mutated so as to facilitate their secretion from the
cell (for example having mutation or deletion of an element which
facilitates endoplasmic reticulum recapture, such as KDEL (SEQ ID
NO:14) or its homologues; such mutants are described in PCT
Application No. PCT/US96/13233 (WO 97/06685), which is incorporated
herein by reference.
[0159] In particular embodiments, e.g., in cases involving chemical
conjugates between a stress protein and an engineered antibody, the
stress proteins used are isolated stress proteins, which means that
the stress proteins have been selected and separated from the host
cell in which they were produced. Such isolation can be carried out
as described herein and using routine methods of protein isolation
known in the art. The stress proteins may be in the form of acidic
or basic salts, or in neutral form. In addition, individual amino
acid residues may be modified by oxidation or reduction.
Furthermore, various substitutions, deletions, or additions may be
made to the amino acid or nucleic acid sequences, the net effect of
which is to retain or further enhance the increased biological
activity of the stress protein. Due to code degeneracy, for
example, there may be considerable variation in nucleotide
sequences encoding the same amino acid sequence. Portions of stress
proteins or peptides obtained from stress proteins may be used in
the fusion polypeptides, provided such portions or peptides include
the epitopes involved with enhancing the immune response. Portions
of stress proteins may be obtained by fragmentation using
proteinases, or by recombinant methods, such as the expression of
only part of a stress protein-encoding nucleotide sequence (either
alone or fused with another protein-encoding nucleic acid
sequence). Peptides may also be produced by such methods, or by
chemical synthesis. The stress proteins may include mutations
introduced at particular loci by a variety of known techniques.
See, e.g., Sambrook et. al., Molecular Cloning: A Laboratory
Manual. 2d Ed., Cold Spring Harbor Laboratory Press (1989);
Drinkwater and Klinedinst Proc. Natl, Acad, Sci. USA 83:3402-3406
(1986); Liao and Wise, Gene 88:107-111 (1990); Horwitz et al.,
Genome 3:112-117(1989).
[0160] The pharmaceutical compositions provided herein may have
individual amino acid residues that are modified by oxidation or
reduction. Furthermore, various substitutions, deletions, or
additions may be made to the amino acid or nucleic acid sequences,
the net effect of which is to retain or further enhance the
increased biological activity of the heat shock protein. Due to
codon degeneracy, for example, there may be considerable variation
in nucleotide sequences encoding the same amino acid sequence.
[0161] The term "heat shock protein" is intended to encompass
fragments of heat shock proteins obtained from heat shock proteins,
provided such fragments include the epitopes involved with
enhancing the immune response to mesothelin. Fragments of heat
shock proteins may be obtained using proteinases, or by recombinant
methods, such as the expression of only part of a stress
protein-encoding nucleotide sequence (either alone or fused with
another protein-encoding nucleic acid sequence). The heat shock
proteins may include mutations introduced at particular loci by a
variety of known techniques to enhance its effect on the immune
system. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2d Ed., Cold Spring Harbor Laboratory Press (1989);
Drinkwater and Klinedinst Proc. Natl. Acad. Sci. USA 83:3402-3406
(1986); Liao and Wise, Gene 88:107-111 (1990); Horwitz et al.,
Genome 3:112-117 (1989).
[0162] In particular embodiments, the heat shock proteins used in
the present invention are isolated heat shock proteins, which means
that the heat shock proteins have been selected and separated from
the host cell in which they were produced. Such isolation can be
carried out as described herein and using routine methods of
protein isolation known in the art. Maniatis et al., Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y.. (1982); Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press
(1989); Deutscher, M., Guide to Protein Purification Methods
Enzymology, vol. 182, Academic Press, Inc., San Diego, Calif.
(1990).
C. Fusion Protein Embodiments
[0163] One aspect of the invention relates to a fusion protein
comprising an antigen binding domain fused in frame to a fragment
of Mycobacterium tuberculosis heat shock protein 70 (HSP70) of less
than 200 amino acids, wherein the HSP70 fragment comprises a
minimal HSP70 sequence. The HSP70 fragment may comprise, consist
essentially of, or consist of the minimal HSP sequence.
[0164] The minimal HSP70 sequence refers to a fragment of HSP70
that provides all of the biological functions desired in the fusion
proteins of the present invention. In some embodiments, the minimal
HSP70 sequence is at least 40 amino acids in length, e.g., at least
about 40, 50, 60, 70, 80, 90, 100, 110, or 120 amino acids in
length. In some embodiments, the minimal HSP70 sequence is less
than 400 amino acids in length, e.g., less than about 400, 350,
300, 250, 200, 190, 180, 170, 160, 150, 140, or 130 amino acids in
length. In certain embodiments, the minimal HSP70 sequence
comprises, consists essentially of, or consists of the fragment
from about amino acid residues 368 (e.g., plus or minus 20, 15, 10,
or 5 residues) to about amino acid residue 495 (e.g., plus or minus
20, 15, 10, or 5 residues) of M. tuberculosis HSP70 (SEQ ID NO:1).
In some embodiments, the minimal HSP70 region is about amino acid
residues 368-495 or about 368-479 of SEQ ID NO:1.
[0165] In one embodiment, the fusion protein comprising the minimal
HSP sequence comprises, consists essentially of, or consist of the
amino acid sequence of SEQ ID NO:3. The underline indicates the
linker between the V.sub.H and V.sub.L domains of the scFv, the
italics indicates the linker between the scFv and the HSP70, and
the bold indicates the CD94 domain.
TABLE-US-00003 (SEQ ID NO: 3) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG GGSGGGGSGG
GGSVTPLSLG IETKGGFMTR LIERNTTIPT KRSETFTTAD DNQPSVQIQV YQGEREIAAH
NKLLGSFELT GIPPAPRGIP QIEVTFDIDA NGIVHVTAKD KGTGKENTIR IQEGSGLSKE
DIDRMIKDAE A
[0166] In some embodiments, the minimal HSP sequence comprises a
modified CD94 domain, i.e., the amino acid sequence of the CD94
domain is modified. As used herein, the term "CD94 domain" refers
to amino acid residues 422-435 of Mbt HSP70 (SEQ ID NO:1) having
the sequence AAHNKLLGSFELTG (SEQ ID NO:15) or the equivalent
sequence in other HSP70 proteins.
[0167] In some embodiments, the modified CD94 domain consists of an
amino acid sequence selected from:
TABLE-US-00004 (SEQ ID NO: 16) AAHNNLLGSFELTG (SEQ ID NO: 17)
AAHNNLLGRFELTG (SEQ ID NO: 18) AAHNNLLGRFFLSG (SEQ ID NO: 19)
TKENNLLGRFELSG (SEQ ID NO: 20) TRDNNLLGRFELSG.
[0168] In certain embodiments, the modified CD94 domain consists of
the amino acid sequence TKENNLLGRFELSG (SEQ ID NO:19). In one
embodiment, the fusion protein comprising the minimal HSP sequence
with the CD94 domain sequence TKENNLLGRFELSG (SEQ ID NO:19)
comprises, consists essentially of, or consist of the amino acid
sequence of SEQ ID NO:5.
TABLE-US-00005 (SEQ ID NO: 5) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG GGSGGGGSGG
GGSVTPLSLG IETKGGFMTR LIERNTTIPT KRSETFTTAD DNQPSVQIQV YQGEREITKE
NNLLGRFELS GIPPAPRGIP QIEVTFDIDA NGIVHVTAKD KGTGKENTIR IQEGSGLSKE
DIDRMIKDAE A
[0169] In certain embodiments, the modified CD94 domain consists of
the amino acid sequence TKDNNLLGRFELSG (SEQ ID NO:20). In one
embodiment, the fusion protein comprising the minimal HSP sequence
with the CD94 domain sequence TKDNNLLGRFELSG (SEQ ID NO:20)
comprises, consists essentially of, or consist of the amino acid
sequence of SEQ ID NO:7.
TABLE-US-00006 (SEQ ID NO: 7) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG GGSGGGGSGG
GGSVTPLSLG IETKGGFMTR LIERNTTIPT KRSETFTTAD DNQPSVQIQV YQGEREITKD
NNLLGRFELS GIPPAPRGIP QIEVTFDIDA NGIVHVTAKD KGTGKENTIR IQEGSGLSKE
DIDRMIKDAE A
[0170] In certain embodiments, the minimal HSP70 sequence may
contain one or more amino acid additions, deletions or
substitutions that enhance the effectiveness of the fusion protein
of the invention. In one embodiment, the minimal HSP70 sequence
comprises a V410F substitution (numbering based on SEQ ID NO:1),
which decreases the peptide binding activity of HSP70, thereby
minimizing non-specific antigen delivery.
[0171] In some embodiments, the fusion protein further comprises a
linker between the antibody binding domain and the HSP70 fragment.
In certain embodiments, linker comprises, consists essentially of,
or consists of an amino acid sequence selected from the group
consisting of: GGSSRSS (SEQ ID NO:21), (GGGSGGG), (SEQ ID NO:22),
GGGGSGGGGSGGGGS (SEQ ID NO:23), GGSSRSSSSGGGGSGGGG (SEQ ID NO:24),
and GGSSESSSSGGGGSGGGG (SEQ ID NO:25).
[0172] In certain embodiments, the linker is GGSRSSSSGGGGSGGGG (SEQ
ID NO:24). In one embodiment, the fusion protein comprising the
minimal HSP70 sequence and the linker GGSSRSSSSGGGGSGGGG (SEQ ID
NO:24) comprises, consists essentially of, or consist of the amino
acid sequence of SEQ ID NO:9.
TABLE-US-00007 (SEQ ID NO: 9) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG SSRSSSSGGG
GSGGGGVTPL SLGIETKGGF MTRLIERNTT IPTKRSETFT TADDNQPSVQ IQVYQGEREI
TKENNLLGRF ELSGIPPAPR GIPQIEVTFD IDANGIVHVT AKDKGTGKEN TITIQEGSGL
SKEDIDRMIK DAEA
[0173] In certain embodiments, the linker is GGSSESSSSGGGGSGGGG
(SEQ ID NO:25). In one embodiment, the fusion protein comprising
the minimal HSP70 sequence and the linker GGSSESSSSGGGGSGGGG (SEQ
ID NO:25) comprises, consists essentially of, or consist of the
amino acid sequence of SEQ ID NO:11.
TABLE-US-00008 (SEQ ID NO: 11) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG SSESSSSGGG
GSGGGGVTPL SLGIETKGGF MTRLIERNTT IPTKRSETFT TADDNQPSVQ IQVYQGEREI
TKENNLLGRF ELSGIPPAPR GIPQIEVTFD IDANGIVHVT AKDKGTGKEN TIRIQEGSGL
SKEDIDRMIK DAEA
[0174] A further aspect of the invention relates to a fusion
protein comprising an antigen binding domain fused in frame to a
fragment of Mycobacterium tuberculosis heat shock protein 70
(HSP70) of at least 100 amino acids and comprising no more than
amino acids 1-495 of SEQ ID NO:1. This fragment does not comprise
the C-terminal lid sequence, the deletion providing enhanced
biological activity for the fusion proteins of the invention. The
HSP70 lid deletion fragment of this aspect of the invention has a
maximum length of 495 amino acid residues starting with amino acid
1 or the natural M. tuberculosis amino acid sequence. The HSP lid
deletion fragment may have a length of less than about 495, 490,
480, 470, 460, 450, 425, 400, 375, 350, 325, or 300 amino acid
residues. The HSP fragment may have a length of at least about 100,
125, 150, 175, 200, 225, 250, 275, or 300 amino acid residues.
[0175] In certain embodiments, the HSP70 lid deletion fragment may
contain one or more amino acid additions, deletions or
substitutions that enhance the effectiveness of the fusion protein
of the invention. In one embodiment, the HSP70 lid deletion
fragment comprises one or more of the modifications (a) F176A or b)
R318A (in the LPS binding site in subdomain II to alter LPS
binding) or c) V410F (in the peptide binding domain to alter
peptide binding) in any combination (numbering based on SEQ ID
NO:1). In one embodiment, the fusion protein comprising the HSP70
lid deletion fragment and additional modifications comprises,
consists essentially of, or consists of the amino acid sequence of
SEQ ID NOS:12, 13, or 31.
TABLE-US-00009 (SEQ ID NO: 12) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG SSRSSSSGGG
GSGGGGMARA VGIDLGTTNS VVSVLEGGDP VVVANSEGSR TTPSIVAFAR NGEVLVGQPA
KNQAVTNVDR TVRSVKRHMG SDWSIEIDGK KYTAPEISAR ILMKLKRDAE AYLGEDITDA
VITTPAYFND AQRQATKDAG QIAGLNVLRI VNEPTAAALA YGLDKGEKEQ RILVFDLGGG
TFDVSLLEIG EGVVEVRATS GDNHLGGDDW DQRVVDWLVD KFKGTSGIDL TKDKMAMQRL
REAAEKAKIE LSSSQSTSIN LPYITVDADK NPLFLDEQLT RAEFQRITQD LLDRTRKPFQ
SVIADTGISV SEIDHVVLVG GSTAMPAVTD LVKELTGGKE PNKGVNPDEV VAVGAALQAG
VLKGEVKDVL LLDVTPLSLG IETKGGFMTR LIERNTTIPT KRSETFTTAD DNQPSVQIQV
YQGEREITKE NNLLGRFELS GIPPAPRGIP QIEVTFDIDA NGIVHVTAKD KGTGKENTIR
IQEGSGLSKE DIDRMIKDAE A (SEQ ID NO: 13) QVQLQQSGPG LVTPSQTLSL
TCAISGDSVS SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN
QFSLQLNSVT PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG
GGSQPVLTQS SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD
KQQGSGVPSR FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG
SSESSSSGGG GSGGGGMARA VGIDLGTTNS VVSVLEGGDP VVVANSEGSR TTPSIVAFAR
NGEVLVGQPA KNQAVTNVDR TVRSVKRHMG SDWSIEIDGK KYTAPEISAR ILMKLKRDAE
AYLGEDITDA VITTPAYFND AQRQATKDAG QIAGLNVLRI VNEPTAAALA YGLDKGEKEQ
RILVFDLGGG TFDVSLLEIG EGVVEVRATS GDNHLGGDDW DQRVVDWLVD KFKGTSGIDL
TKDKMAMQRL REAAEKAKIE LSSSQSTSIN LPYITVDADK NPLFLDEQLT RAEFQRITQD
LLDRTRKPFQ SVIADTGISV SEIDHVVLVG GSTAMPAVTD LVKELTGGKE PNKGVNPDEV
VAVGAALQAG VLKGEVKDVL LLDVTPLSLG IETKGGFMTR LIERNTTIPT KRSETFTTAD
DNQPSVQIQV YQGEREITKE NNLLGRFELS GIPPAPRGIP QIEVTFDIDA NGIVHVTAKD
KGTGKENTIR IQEGSGLSKE DIDRMIKDAE A (SEQ ID NO: 31) QVQLQQSGPG
LVTPSQTLSL TCAISGDSVS SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR
MSINPDTSKN QFSLQLNSVT PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG
GGSGGGGSGG GGSQPVLTQS SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ
YLLNYKSDSD KQQGSGVPSR FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG
GGTQLTVLGG SSESSSSGGG GSGGGGMARA VGIDLGTTNS VVSVLEGGDP VVVANSEGSR
TTPSIVAFAR NGEVLVGQPA KNQAVTNVDR TVRSVKRHMG SDWSIEIDGK KYTAPEISAR
ILMKLKRDAE AYLGEDITDA VITTPAYFND AQRQATKDAG QIAGLNVLRI VNEPTAAALA
YGLDKGEKEQ RILVFDLGGG TFDVSLLEIG EGVVEVRATS GDNHLGGDDW DQRVVDWLVD
KFKGTSGIDL TKDKMAMQRL REAAEKAKIE LSSSQSTSIN LPYITVDADK NPLFLDEQLT
RAEFQRITQD LLDRTRKPFQ SVIADTGISV SEIDHVVLVG GSTAMPAVTD LVKELTGGKE
PNKGVNPDEV VAVGAALQAG VLKGEVKDVL LLDVTPLSLG IETKGGFMTR LIERNTTIPT
KRSETFTTAD DNQPSVQIQV YQGEREITKE NNLLGRFELS GIPPAPRGIP QIEVTFDIDA
NGIVHVTAKD KGTGKENTIR IQEGSGLSKE DIDRMIKDAE A
[0176] In some embodiments, in any of the modified HSP70, including
the sequence of SEQ ID NO:31, the Treg domain (amino acid residues
141-155) may be modified, e.g., to one of VLRIVNEPMAAALAY (SEQ ID
NO:32), VLRIVNEPTAAALAF (SEQ ID NO:33), or VLRIVNEPMAAALAF (SEQ ID
NO:34).
[0177] In some embodiments, the HSP70 lid deletion fragment further
comprises a modified CD94 domain as described above.
[0178] In some embodiments, the fusion protein comprising the HSP70
lid deletion fragment further comprises a linker as described
above.
[0179] In some embodiments, the HSP70 lid deletion fragment further
comprises a modification to the Treg domain. The Treg domain of
HSP70 is well known and corresponds to amino acid residues 141-155
of SEQ ID NO:1 or the equivalent domain from other HSP70 proteins.
The Treg domain may be modified, for example, by replacing the
domain from the M. tuberculosis sequence with a Treg domain from
another HSP70, e.g., a human HSP70 protein, or deleting and/or
substituting one or more amino acid residues, e.g., one or more of
the residues that are conserved among members of the HSP70
family.
[0180] An additional aspect of the invention relates to a fusion
protein comprising an antigen binding domain fused in frame to a
fragment of Mycobacterium tuberculosis heat shock protein 70
(HSP70) comprising, consisting essentially of, or consisting of the
amino acid sequence of SEQ ID NO:26 (VIC-008 sequence from
provisional).
TABLE-US-00010 (SEQ ID NO: 26) MARAVGIDLG TTNSVVSVLE GGDPVVVANS
EGSRTTPSIV AFARNGEVLV GQPAKNQAVT NVDRTVRSVK RHMGSDWSIE IDGKKYTAPE
ISARILMKLF RDAEAYLGED ITDAVITTPA YFNDAQRQAT KDAGQIAGLN VLRIVNEPTA
AALAYGLDKG EKEQRILVFD LGGGTFDVSL LEIGEGVVEV RATSGDNHLG GDDWDQRVVD
WLVDKFKGTS GIDLTKDKMA MQRLREAAEK AKIELSSSQS TSINLPYITV DADKNPLFLD
EQLTRAEFQR ITQDLLDRTR KPFQSVIADT GISVSEIDHV VLVGGSTRMP AVTDLVKELT
GGKEPNKGVN PDEVVAVGAA LQAGVLKGEV KDVLLLDVTP LSLGIETKGG FMTRLIERNT
TIPTKRSETF TTADDNQPSV QIQVYQGERE IAAHNKLLGS FELTGIPPAP RGIPQIEVTF
DIDANGIVHV TAKDKGTGKE NTIRIQEGSG LSKEDIDRMI KDAEAHAEED RKRREEADVR
NQAETLVYQT EKFVKEQREA EGGSKVPEDT LNKVDAAVAE AKAALGGSDI SAIKSAMEKL
GQESQALGQA IYEAAQAASQ ATGAAHPGGE PGGAHPGSAD DVVDAEVVDD GREAK
[0181] The modified HSP70 sequence of SEQ ID NO:26 may be part of a
fusion protein comprising, consisting essentially of, or consisting
of SEQ ID NO:27
TABLE-US-00011 (SEQ ID NO: 27) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVLGG GGSGGGGSGG
GGSGGMARAV GIDLGTTNSV VSVLEGGDPV VVANSEGSRT TPSIVAFARN GEVLVGQPAK
NQAVTNVDRT VRSVKRHMGS DWSIEIDGKK YTAPEISARI LMKLKRDAEA YLGEDITDAV
ITTPAYFNDA QRQATKDAGQ IAGLNVLRIV NEPTAAALAY GLDKGEKEQR ILVFDLGGGT
FDVSLLEIGE GVVEVRATSG DNHLGGDDWD QRVVDWLVDK FKGTSGIDLT KDKMAMQRLR
EAAEKAKIEL SSSQSTSINL PYITVDADKN PLFLDEQLTR AEFQRITQDL LDRTRKPFQS
VIADTGISVS EIDHVVLVGG STAMPAVTDL VKELTGGKEP NKGVNPDEVV AVGAALQAGV
LKGEVKDVLL LDVTPLSLGI ETKGGFMTRL IERNTTIPTK RSETFTTADD NQPSVQIQVY
QGEREIAAHN KLLGSFELTG IPPAPRGIPQ IEVTFDIDAN GIVHVTAKDK GTGKENTIRI
QEGSGLSKED IDRMIKDAEA HAEEDRKRRE EADVRNQAET LVYQTEKFVK EQREAEGGSK
VPEDTLNKVD AAVAEAKAAL GGSDISAIKS AMEKLGQESQ ALGQAIYEAA QAASQATGAA
HPGGEPGGAH PGSADDVVDA EVVDDGREAK
[0182] The modified HSP70 of SEQ ID NO:26 or SEQ ID NO:27 may
comprise one or more further modifications as described above, e.g.
the CD94 domain and/or Treg domain and or LPS domain and/or peptide
binding domain modifications and/or linker sequences described
above.
[0183] Another aspect of the invention relates to a fusion protein
comprising an antigen binding domain fused in frame to a chimeric
M. tuberculosis HSP70, wherein the chimeric HSP70 comprises a
backbone of a human HSP70 amino acid sequence wherein the beta
sheet structure (e.g., about residue 367 to about residue 479
(e.g., plus or minus 20, 15, 10, or 5 residues)) (numbering based
on SEQ ID NO:29)) is substituted with the beta sheet structure
(e.g., about residue 395 to about residue 541 (e.g., plus or minus
20, 15, 10, or 5 residues)) of M. tuberculosis HSP70 (numbering
based on SEQ ID NO:1).
TABLE-US-00012 (SEQ ID NO: 29) MAKAAAIGID LGTTYSCVGV FQHGKVEITA
NDQGNRTTPS YVAFTDTERL IGDAAKNQVA LNPQNTVFDA KRLIGRKFGD PVVQSDMKHW
PFQVINDGDK PKVQVSYKGD TKAFYPEEIS SMVLTKMKEI AEAYLGYPVT NAVITVPAYF
NDSQRQATKD AGVIAGLNVL RIINEPTAAA IAYGLDRTGK GERNVLIFDL GGGTFDVSIL
TIDDGIFEVK ATAGDTHLGG EDFDNRLVNH FVEEFKRKHK KDISQNKRAV RRLRTACERA
KRTLSSSTQA SLEIDSLFEG IDFYTSITRA RFEELCSDLF RSTLEPVEKA LRDAKLDKAQ
IHDLVLVGGS TRIPKVQKLL QDFFNGRDLN KSINPDEAVA YGAAVQAAIL MGDKSENVQD
LLLLDVAPLS LGLETAGGVM TALIKRNSTI PTKQTQIFTT YSDNQPGVLI QVYEGERAMT
KDNNLLGRFE LSGIPPAPRG VPQIEVTFDI DANGILNVTA TDKSTGKANK ITITNDKGRL
SKEEIERMVQ. EAEKYKAEDE VQRERVSAKN ALESYAFNMK SAVEDEGLKG KISEADKKKV
LDKCQEVISW LDANTLAEKD EFEHKRKELE QVCNPIISGL YQGAGGPGPG GFGAQGPKGG
SGSGPTIEEV D
[0184] The human HSP70 backbone may be from any known human HSP70
family member, e.g., HSP70-1a, HSP70-1b, HSP70-1t, HSP70-2,
HSP70-5, HSP70-6, HSC70, and HSP70-9.
[0185] All of the modified HSP70 proteins described above may be
fused to an antigen binding domain, which may be an engineered
antibody or fragment thereof. In some embodiments, the antigen
binding domain is an scFv.
[0186] The antigen binding domain may bind any antigen of interest.
In some embodiments, the antigen is a cancer antigen. In some
embodiments, the antigen binding domain binds specifically to
mesothelin, e.g., a scFv that binds specifically to mesothelin.
Examples of mesothelin antibodies include those disclosed in WO
2009/068204, incorporated by reference in its entirety. In one
embodiment the scFv that binds specifically to mesothelin
comprises, consists essentially of, or consists of the amino acid
sequence of SEQ ID NO:30.
TABLE-US-00013 (SEQ ID NO: 30) QVQLQQSGPG LVTPSQTLSL TCAISGDSVS
SNSATWNWIR QSPSRGLEWL GRTYYRSKWY NDYAVSVKSR MSINPDTSKN QFSLQLNSVT
PEDTAVYYCA RGMMTYYYGM DVWGQGTTVT VSSGILGSGG GGSGGGGSGG GGSQPVLTQS
SSLSASPGAS ASLTCTLRSG INVGPYRIYW YQQKPGSPPQ YLLNYKSDSD KQQGSGVPSR
FSGSKDASAN AGVLLISGLR SEDEADYYCM IWHSSAAVFG GGTQLTVL
[0187] The fusion proteins of the invention may further comprise a
leader sequence on the N-terminus, e.g., such that the fusion
protein is secreted from the host cell in which it is expressed.
The leader sequence may be any suitable leader sequence, e.g., from
a secreted protein that is native to the host. In some embodiments,
the leader sequence is a plant protein leader sequence, e.g., from
Arabidopsis extensin, Nicotiana extensin, barley alpha amylase, or
PR1A.
[0188] The fusion proteins of the present invention encompass
variants of any of the sequences disclosed above, e.g., sequences
that are at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, or 99% identical to one of the sequences disclosed
above.
[0189] A further aspect of the invention relates to a composition
comprising one or more of the fusion proteins of the present
invention. In some embodiments, the composition is a pharmaceutical
composition comprising an effective amount of the fusion protein of
the invention and a pharmaceutically acceptable carrier. In some
embodiments, the composition is an immunogenic composition or
vaccine comprising the fusion protein of the invention.
2. Methods of Making the Fusion Proteins
[0190] Provided also are compositions and methods for making fusion
proteins according to the invention. Any of the fusion proteins
described herein can be produced by recombinant means. For example,
a nucleic acid encoding a HSP70 protein can be joined to either end
of a nucleic acid sequence encoding an antigen binding domain, such
that the protein-coding sequences are sharing a common
translational reading frame and can be expressed as a fusion
protein including, for example, the antigen binding domain and the
HSP70 protein.
[0191] The combined sequence is inserted into a suitable vector
chosen based on the expression features desired and the nature of
the host cell. In the examples provided hereinafter, the nucleic
acid sequences are assembled in a vector suitable for protein
expression in CHO cells. Following expression in the chosen host
cell, the fusion protein can be purified by routine biochemical
separation techniques or by immunoaffinity methods using an
antibody to one of the components of the fusion protein.
Alternatively, the selected vector can add a tag to the fusion
protein sequence, e.g., an oligohistidine tag, permitting
expression of a tagged fusion protein that can be purified by
affinity methods using an antibody or other material having an
appropriately high affinity for the tag. Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2d Ed,, Cold Spring Harbor Laboratory
Press (1989); Deutscher, M. Guide to Protein Purification Methods
Enzymology, vol. 182, Academic Press, Inc. San Diego, Calif.
(1990). If a vector suitable for expression in mammalian cells is
used, e.g., one of the vectors discussed below, the fusion protein
can be expressed and purified from mammalian cells. Alternatively,
the mammalian expression vector (including fusion protein-coding
sequences) can be administered to a subject to direct expression of
a fusion protein according to the method of the invention in the
subjects cells. If a vector suitable for expression in bacteria,
yeast, insect cells, or the like is used, the fusion protein can be
expressed and purified from cultures of the cells. If a vector
suitable for expression in plants is used, the fusion protein can
be expressed and purified from transgenic plants expressing the
protein. A nucleic acid encoding the fusion protein of the
invention can also be produced chemically and then inserted into a
suitable vector for fusion protein production and purification or
administration to a subject. Finally, a fusion protein can also be
prepared chemically.
[0192] Techniques for making fusion genes are well known in the
art. Essentially, the joining of various DNA fragments coding for
different polypeptide sequences is performed in accordance with
conventional techniques, employing blunt-ended or stagger-ended
termini for ligation, restriction enzyme digestion to provide for
appropriate termini, filling-in of cohesive ends as appropriate,
alkaline phosphatase treatment to avoid undesirable joining, and
enzymatic ligation. In another embodiment, the fusion gene may be
synthesized by conventional techniques including automated DNA
synthesizers. Alternatively, PCR amplification of gene fragments
may be carried out using anchor primers which give rise to
complementary overhangs between two consecutive gene fragments
which may subsequently be annealed to generate a chimeric gene
sequence (see, for example, Current Protocols in Molecular Biology,
eds. Ausubel et al., John Wiley & Sons: 1992). Accordingly,
provided is an isolated nucleic acid comprising a fusion gene of a
gene encoding at least one engineered antibody and a gene encoding
at least one stress protein. The isolated nucleic acid may be
codon-optimized to maximize expression in a host cell.
[0193] The nucleic acid may be provided in a vector comprising a
nucleotide sequence encoding an engineered fusion protein according
to the invention, and operably linked to at least one regulatory
sequence. It should be understood that the design of the expression
vector may depend on such factors as the choice of the host cell to
be transformed and/or the type of protein desired to be expressed.
The vector's copy number, the ability to control that copy number
and the expression of any other protein encoded by the vector, such
as antibiotic markers, should be considered. Such vectors may be
administered in any biologically effective carrier, e.g., any
formulation or composition capable of effectively transfecting
cells either ex vivo or in vivo with genetic material encoding a
chimeric polypeptide. Approaches include insertion of the nucleic
acid into viral vectors including recombinant retroviruses,
adenoviruses, adeno-associated viruses, human immunodeficiency
viruses, and herpes simplex viruses-1, or recombinant bacterial or
eukaryotic plasmids. Viral vectors may be used to transfect cells
directly; plasmid DNA may be delivered alone with the help of, for
example, cationic liposomes (lipofectin) or derivatized (e.g.,
antibody conjugated), polylysine conjugates, gramicidin S,
artificial viral envelopes or other such intracellular carriers.
Nucleic acids may also be directly injected. Alternatively, calcium
phosphate precipitation may be carried out to facilitate entry of a
nucleic acid into a cell.
[0194] The subject nucleic acids may be used to cause expression
and over-expression of a fusion protein of the invention in cells
propagated in culture, e.g., to produce fusion proteins or
polypeptides.
[0195] Provided also is a host cell transfected with a recombinant
gene in order to express an engineered fusion protein. The host
cell may be any prokaryotic or eukaryotic cell. For example, a
HSP70 fusion may be expressed in bacterial cells, such as E. coli,
insect cells (baculovirus), yeast, insect, plant, or mammalian
cells. In those instances when the host cell is human, it may or
may not be in a live subject. Other suitable host cells are known
to those skilled in the art. Additionally, the host cell may be
supplemented with tRNA molecules not typically found in the host so
as to optimize expression of the polypeptide. Other methods
suitable for maximizing expression of the fusion polypeptde will be
known to those in the art.
[0196] A cell culture includes host cells, media and other
byproducts. Suitable media for cell culture are well known in the
art. A fusion polypeptide may be secreted and isolated from a
mixture of cells and medium comprising the polypeptide.
Alternatively, a fusion polypeptide may be retained cytoplasmically
and the cells harvested, lysed and the protein isolated. A fusion
polypeptide may be isolated from cell culture medium, host cells,
or both using techniques known in the art for purifying proteins,
including ion-exchange chromatography, gel filtration
chromatography, ultrafiltration, electrophoresis, and
immunoaffinity purification with antibodies specific for particular
epitopes of a fusion.
[0197] Thus, a nucleotide sequence encoding all or part of a fusion
protein of the invention may be used to produce a recombinant form
of a protein via microbial or eukaryotic cellular processes.
Ligating the sequence into a polynucleotide construct, such as an
expression vector, and transforming or transfecting into hosts,
either eukaryotic (yeast, avian, insect, plant, or mammalian) or
prokaryotic (bacterial cells), are standard procedures. Similar
procedures, or modifications thereof, may be employed to prepare
recombinant fusion polypeptides by microbial means or
tissue-culture technology in accord with the subject invention.
[0198] Expression vehicles for production of a recombinant protein
include plasmids and other vectors. For instance, suitable vectors
for the expression of a fusion polypeptide include plasmids of the
types: pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived
plasmids, pBTac-derived plasmids, and pUC-derived plasmids for
expression in prokaryotic cells, such as E. coli.
[0199] In another embodiment, the nucleic acid is a fusion protein
operably linked to a bacterial promoter, e.g., the anaerobic E.
coli, NirB promoter or the E. coli lipoprotein lip promoter,
described, e.g., in Inouye et al. (1985) Nucl. Acids Res. 13:3101;
Salmonella page promoter (Miller et al., supra), Shigella ent
promoter (Schmitt and Payne, J. Bacteriol. 173:816 (1991)), the tet
promoter on Tn10 (Miller et al., supra), or the etx promoter of
Vibrio cholera. Any other promoter can be used. The bacterial
promoter can be a constitutive promoter or an inducible promoter.
An exemplary inducible promoter is a promoter which is inducible by
iron or in non-limiting conditions. In fact, some bacteria, e.g.,
intracellular organisms, are believed to encounter iron-limiting
conditions in the host cytoplasm. Examples at iron-regulated
promoters of FepA and TonB are known in the art and are described,
e.g., in the following references: Headley, V. et al. (1997)
Infection & Immunity 65:818; Ochsner, U. A. et al. (1995)
Journal of Bacteriology 177:7194; Hunt, M. D. et al. (1994) Journal
of Bacteriology 176:3944; Svinarich, D. M. and S. Palchaudhuri.
(1992) Journal of Diarrhoeal Diseases Research 10:139; Prince, R.
W. et al. (1991) Molecular Microbiology 5:2823; Goldberg, M. B. et
al. (1990) Journal of Bacteriology 172:6863; de Lorenzo, V. et al.
(1987) Journal of Bacteriology 169:2624; and Hantke, K. (1981)
Molecular & General Genetics 182:288.
[0200] A plasmid preferably comprises sequences required for
appropriate transcription of the nucleic acid in bacteria, e.g., a
transcription termination signal. The vector can further comprise
sequences encoding factors allowing for the selection of bacteria
comprising the nucleic acid of interest, e.g., gene encoding a
protein providing resistance to an antibiotic, sequences required
for the amplification of the nucleic acid, e.g., a bacterial origin
of replication.
[0201] In one embodiment, the powerful phage T5 promoter, that is
recognized by E. coli RNA polymerase is used together with a lac
operator repression module to provide tightly regulated, high level
expression or recombinant proteins in E. coli. In this system,
protein expression is blocked in the presence of high levels of lac
repressor. In one embodiment, the DNA is operably linked to a first
promoter and the bacterium further comprises a second DNA encoding
a first polymerase which is capable of mediating transcription from
the first promoter, wherein the DNA encoding the first polymerase
is operably linked to a second promoter. In a preferred embodiment,
the second promoter is a bacterial promoter, such as those
delineated above. In an even more preferred embodiment, the
polymerase is a bacteriophage polymerase, e.g., SP6, T3, or T7
polymerase and the first promoter is a bacteriophage promoter,
e.g., an SP6, T3, or T7 promoter, respectively. Plasmids comprising
bacteriophage promoters and plasmids encoding bacteriophage
polymerases can be obtained commercially, e.g., from Promega Corp.
(Madison, Wis.) and InVitrogen (San Diego, Calif.), or can be
obtained directly from the bacteriophage using standard recombinant
DNA techniques (J. Sambrook, E. Fritsch, T. Maniatis, Molecular
Cloning: A Laboratory Manual, Cold Spring Laboratory Press, 1989).
Bacteriophage polymerases and promoters are further described,
e.g., in the following references: Sagawa, H. et al. (1996) Gene
168:37; Cheng, X. et al. (1994) PNAS USA 91:4034; Dubendorff, J. W.
and F. W. Studier (1991) Journal of Molecular Biology 219:45;
Bujarski, J. J. and P. Kaesberg (1987) Nucleic Acids Research
15:1337; and Studier, F. W. et al. (1990) Methods in Enzymology
185:60). Such plasmids can be modified further according to the
specific embodiment of the fusion polypeptide to be expressed.
[0202] In another embodiment, the bacterium further comprises a DNA
encoding a second polymerase which is capable of mediating
transcription from the second promoter, wherein the DNA encoding
the second polymerase is operably linked to a third promoter. The
third promoter may be a bacterial promoter. However, more than two
different polymerases and promoters could be introduced in a
bacterium to obtain high levels of transcription. The use of one or
more polymerases for mediating transcription in the bacterium can
provide a significant increase in the amount of polypeptide in the
bacterium relative to a bacterium in which the DNA is directly
under the control of a bacterial promoter. The selection of the
system to adopt will vary depending on the specific use, e.g., on
the amount of protein that one desires to produce.
[0203] Generally, a nucleic acid encoding a fusion protein of the
invention is introduced into a host cell, such as by transfection,
and the host cell is cultured under conditions allowing expression
of the fusion polypeptide. Methods of introducing nucleic acids
into prokaryotic and eukaryotic cells are well known in the art.
Suitable media for mammalian and prokaryotic host cell culture are
well known in the art. Generally, the nucleic acid encoding the
subject fusion polypeptide is under the control of an inducible
promoter, which is induced once the host cells comprising the
nucleic acid have divided a certain number of times. For example,
where a nucleic acid is under the control of a beta-galactose
operator and repressor, isopropyl beta-D-thiogalactopyranoside
(IPTG) is added to the culture when the bacterial host cells have
attained a density of about OD.sub.600 0.45-0.60. The culture is
then grown for some more time to give the host cell the time to
synthesize the polypeptide. Cultures are then typically frozen and
may be stored frozen for some time, prior to isolation and
purification of the polypeptide.
[0204] When using a prokaryotic host cell, the host cell may
include a plasmid which expresses an internal T7 lysozyme, e.g.,
expressed from plasmid pLysSL. Lysis of such host cells liberates
the lysozyme which then degrades the bacterial membrane.
[0205] Other sequences that may be included in a vector for
expression in bacterial or other prokaryotic cells include a
synthetic ribosomal binding site; strong transcriptional
terminators, e.g., t.sub.0 from phage lambda and t.sub.4 from the
rmB operon in E. coli, to prevent read through transcription and
ensure stability of the expressed polypeptide; an origin of
replication, e.g., ColE1; and beta-lactamase gene, conferring
ampicillin resistance.
[0206] Other host cells include prokaryotic host cells. Even more
preferred host cells are bacteria, e.g., E. coli. Other bacteria
that can be used include Shigella spp., Salmonella spp., Listeria
spp., Rickettsia spp., Yersinia spp., Escherichia spp., Klebsiella
spp., Bordetella spp., Neisseria spp., Aeromonas spp., Francisella
spp., Corynebacterium spp., Citrobacter spp., Chlamydia spp.,
Hemophilus spp., Brucella spp., Mycobacterium spp., Legionella
spp., Rhodococcus spp., Pseudomonas spp., Helicobacter spp., Vibrio
spp., Bacillus spp., and Erysipelothrix spp. Most of these bacteria
can be obtained from the American Type Culture Collection (ATCC;
10801 University Blvd., Manassas, Va. 20110-2209).
[0207] A number of vectors exist for the expression of recombinant
proteins in yeast. For instance, YEP24, YIP5, YEP51, YEP52, pYES2,
and YRP17 are cloning and expression vehicles used in the
introduction of genetic constructs into S. cerevisiae (see, for
example, Broach et al., (1983) in Experimental Manipulation of Gene
Expression, ed. M. Inouye Academic Press, p. 83). These vectors may
replicate in E. coli due to the presence of the pBR322 ori, and in
S. cerevisiae due to the replication determinant of the yeast 2
micron plasmid. In addition, drug resistance markers such as
amplicillin may be used.
[0208] In certain embodiments, mammalian expression vectors contain
both prokaryotic sequences to facilitate the propagation of the
vector in bacteria, and one or more eukaryotic transcription units
that are expressed in eukaryotic cells. The pcDNAI/amp, pcDNAI/neo,
pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, PMSG, pSVT7,
pko-neo and pHyg derived vectors ate examples of mammalian
expression vectors suitable for transfection of eukaryotic cells.
Some of these vectors are modified with sequences from bacterial
plasmids, such as pBR322, to facilitate replication and drug
resistance selection in both prokaryotic and eukaryotic cells.
Alternatively, derivatives of viruses such as the bovine papilloma
virus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205)
can be used for transient expression of proteins in eukaryotic
cells. The various methods employed in the preparation of the
plasmids and transformation of host organisms are well known in the
art. For other suitable expression systems for both prokaryotic and
eukaryotic cells, as well as general recombinant procedures, see
Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook,
Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 1989)
Chapters 16 and 17. In some instances, it may be desirable to
express the recombinant protein by the use of a baculovirus
expression system. Examples of such baculovirus expression systems
include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941),
pAcUW-derived vectors (such as pAcUW1), and pBlueBac-derived
vectors (such as the .beta.-gal comprising pBlueBac III).
[0209] In another variation, protein production may be achieved
using in vitro translation systems. In vitro translation systems
are, generally, a translation system which is a cell-free extract
comprising at least the minimum elements necessary for translation
of an RNA molecule into a protein. An in vitro translation system
typically comprises at least ribosomes, tRNAs, initiator
methionyl-tRNAMet, proteins or complexes involved in translation,
e.g., eIF2, eIF3, the cap-binding (CB) complex, comprising the
cap-binding protein (CBP) and eukaryotic initiation factor 4F
(eIF4F). A variety of in vitro translation systems are well known
in the art and include commercially available kits. Examples of in
vitro translation systems include eukaryotic lysates, such as
rabbit reticulocyte lysates, rabbit oocyte lysates, human cell
lysates, insect cell lysates and wheat germ extracts. Lysates are
commercially available from manufacturers such as Promega Corp.,
Madison, Wis.; Stratagene La Jolla, Calif.; Amersham, Arlington
Heights, Ill.; and GIBCO/BRL, Grand Island, N.Y. In vitro
translation systems typically comprise macromolecules, such as
enzymes, translation, initiation and elongation factors, chemical
reagents, and ribosomes. In addition, an in vitro transcription
system may be used. Such systems typically comprise at least an RNA
polymerase holoenzyme, ribonucleotides and any necessary
transcription initiation, elongation and termination factors. An
RNA nucleotide for in vitro translation may be produced using
methods known in the art. In vitro transcription and translation
may be coupled in a one-pot reaction to produce proteins from one
or more isolated DNAs.
[0210] When expression of a carboxy terminal fragment of a
polypeptide is desired, i.e., a truncation mutant, it may be
necessary to add a start codon (ATG) to the oligonucleotide
fragment comprising the desired sequence to be expressed. It is
well known in the art that a methionine at the N-terminal position
may be enzymatically cleaved by the use of the enzyme methionine
aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat
et al., (1987) J. Bacteriol. 169:751-757) and Salmonella
typhimurium and its in vitro activity has been demonstrated on
recombinant proteins (Miller et al., (1987) PNAS USA 84:2718-1722).
Therefore, removal of an N-terminal methionine, if desired, may be
achieved either in vivo by expressing such recombinant polypeptides
in a host which produces MAP (e.g., E. coli or CM89 or S.
cerevisiae), or in vitro by use of purified MAP (e.g., procedure of
Miller et al.).
[0211] In cases where plant expression vectors are used, the
expression of a fusion protein may be driven by any of a number of
promoters, e.g., a promoter suitable for expression in tobacco. For
example, viral promoters such as the 35S RNA and 19S RNA promoters
of CaMV (Brisson et al., 1984, Nature, 310:511-514), or the coat
protein promoter of TMV (Takamatsu et al., 1987, EMBO J.,
6:307-311) may be used; alternatively, plant promoters such as the
small subunit of RUBISCO (Coruzzi et al., 1994, EMBO J.,
3:1671-1680; Broglie et al., 1984, Science, 224:838-843); or heat
shock promoters, e.g., soybean hsp 17.5-E or hsp 17.3-B (Gurley et
al., 1986, Mol. Cell. Biol., 6:559-565) may be used. These
constructs can be introduced into plant cells using Ti plasmids, Ri
plasmids, plant virus vectors; direct DNA transformation;
microinjection, electroporation, etc. For reviews of such
techniques see, for example, Weissbach & Weissbach, 1988,
Methods for Plant Molecular Biology, Academic Press, New York,
Section VIII, pp. 421-463; and Grierson & Corey, 1988, Plant
Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9.
[0212] An alternative expression system which can be used to
express a polypeptide tag or fusion protein comprising a
polypeptide tag is an insect system. In one such system, Autographa
californica nuclear polyhedrosis virus (AcNPV) is used as a vector
to express foreign genes. The virus grows in Spodoptera frugiperda
cells. The PGHS-2 sequence may be cloned into non-essential regions
(for example the polyhedrin gene) of the virus and placed under
control of an AcNPV promoter (for example the polyhedrin promoter).
Successful insertion of the coding sequence will result in
inactivation of the polyhedrin gene and production of non-occluded
recombinant virus (i.e., virus lacking the proteinaceous coat coded
for by the polyhedrin gene). These recombinant viruses are then
used to infect Spodoptera frugiperda cells in which the inserted
gene is expressed (e.g., see Smith et al., 1983, J. Virol., 46:584,
Smith, U.S. Pat. No. 4,215,051).
[0213] In a specific embodiment of an insect system, the DNA
encoding fusion protein is cloned into the pBlueBacIII recombinant
transfer vector (Invitrogen, San Diego, Calif.) downstream of the
polyhedrin promoter and transfected into Sf9 insect cells (derived
from Spodoptera frugiperda Spodoptera frugiperda ovarian cells,
available from Invitrogen, San Diego, Calif.) to generate
recombinant virus. After plaque purification of the recombinant
virus high-titer viral stocks are prepared that in turn would be
used to infect Sf9 or High Five.TM. (BTI-TN-5B1-4 cells derived
from Trichoplusia ni egg cell homogenates; available from
Invitrogen, San Diego, Calif.) insect cells, to produce large
quantities of appropriately post-translationally modified subject
polypeptide.
[0214] In other embodiments, the components of any the fusion
proteins of the invention are produced separately and then linked,
e.g., covalently linked, to each other.
[0215] For example, an antigen binding domain and a modified HSP70
protein are produced separately in vitro, purified, and mixed
together under conditions under which a tag, for example, a biotin
or antibody binding protein, will be able to be linked to the
polypeptide of interest. For example, the HSP70 protein and/or the
antigen binding domain can be obtained (isolated) from a source in
which they are known to occur, can be produced and harvested from
cell cultures, can be produced by cloning and expressing a gene
encoding the desired HSP70 protein or antigen binding domain, or
can be synthesized chemically. Furthermore, a nucleic acid sequence
encoding the desired HSP70 protein or antigen binding domain, or
any component of the fusion proteins of the invention, can be
synthesized chemically. Such mixtures of conjugated proteins may
have properties different from single fusion proteins.
[0216] Linkers (also known as "linker molecules" or
"cross-linkers") may be used to conjugate the components of an
fusion protein according to the invention. Linkers include
chemicals able to react with a defined chemical group of several,
usually two, molecules and thus conjugate them. The majority of
known cross-linkers react with amine, carboxyl, and sulfhydryl
groups. The choice of target chemical group is crucial if the group
may be involved in the biological activity of the polypeptides to
be conjugated. For example, maleimides, which react with sulfhydryl
groups, may inactivate Cys-comprising peptides or proteins that
require the Cys to bind to a target. Linkers may be homofunctional
(comprising reactive groups of the same type), heterofunctional
(comprising different reactive groups), or photoreactive
(comprising groups that become reactive on illumination.
[0217] Linker molecules may be responsible for different properties
of the conjugated compositions. The length of the linker should be
considered in light of molecular flexibility during the conjugation
step, and the availability of the conjugated molecule for its
target (cell surface molecules and the like). Longer linkers may
thus improve the biological activity of the compositions of the
present invention, as well as the ease of preparation of them. The
geometry of the linker may be used to orient a molecule for optimal
reaction with a target. A linker with flexible geometry may allow
the cross-linked polypeptides to conformationally adapt as they
bind other polypeptides. The nature of the linker may be altered
for other various purposes. For example, the aryl-structure of MBuS
was found to be less immunogenic than the aromatic spacer of MBS.
Furthermore, the hydrophobicity and functionality of the linker
molecules may be controlled by the physical properties of component
molecules. For example, the hydrophobicity of a polymeric linker
may be controlled by the order of monomeric units along the
polymer, e.g., a block polymer in which these is a block of
hydrophobic monomers interspersed with a block of hydrophilic
monomers.
[0218] A linker or cross-linker that is useful according to the
invention can facilitate proper folding of the fusion protein,
improve the biological activity of the fusion proteins of the
invention, can facilitate preparation of the fusion proteins of the
invention, etc.
[0219] A linker can also function to provide for proper folding of
the heavy and light chain segments of the scFv. A "linker"
according to the invention may also contribute to target
recognition.
[0220] Any suitable amino acid linker that does not interfere with
proper protein folding and function is useful according to the
invention.
[0221] In one embodiment, a linker is a combination of nucleic
acids that yields a series of neutral or slightly polar amino acids
that facilitates proper folding of the fusion protein.
[0222] If an amino acid side chain cannot be ionized it is
considered polar but neutral. For example, aspartate is polar and
acidic because the carboxylic side chain can be ionized. Tyrosine
is polar. The hydroxyl group on the phenyl ring is not easily
ionized thus it is considered polar but neutral.
[0223] In one embodiment, a linker consists of nucleic acids
encoding the following amino acid sequence: GGSSRSS (SEQ ID NO:
21). In another embodiment, the linker consists of nucleic acids
encoding the following amino acid sequence: (GGGSGGG)X4 (SEQ ID NO:
22).
[0224] In another embodiment the linker sequence comprises the
sequence GGGGSGGGGSGGGGS ((Gly.sub.4Ser).sub.3) SEQ ID NO: 23). In
another embodiment the linker sequence comprises the sequence
GGSSRSSSSGGGGSGGGG (SEQ ID NO: 24) or GGSSESSSSGGGGSGGGG (SEQ ID
NO: 25). It is preferable to include glycine in the linker sequence
because it has an H-side chain whereas all other amino acids have
bulkier side chains.
[0225] The chemistry of preparing and utilizing a wide variety of
molecular linkers is well-known in the art and many pre-made
linkers for use in conjugating molecules are commercially available
from vendors such as Pierce Chemical Co., Roche Molecular
Biochemicals, United States Biological, and the like.
A. Fusion Protein Production Embodiments
[0226] One aspect of the invention relates to an isolated nucleic
acid encoding the fusion protein of the invention. In some
embodiments, the nucleic acid encodes any of the fusion protein
sequences disclosed above.
[0227] In certain embodiments, the isolated nucleic acid comprises,
consists essentially of, or consists of a nucleic acid selected
from: [0228] a) the nucleotide sequence of any one of SEQ ID NOS:2,
4, 6, 8, or 10; [0229] b) a nucleotide sequence that is at least
about 80% identical to the nucleotide sequence of a); [0230] c) a
nucleotide sequence complementary to (a) or (b); [0231] d) a
nucleotide sequence that is the reverse complement of to (a) or
(b); or [0232] e) any combination of (a) to (d).
TABLE-US-00014 [0232] (SEQ ID NO: 2) CAAGTTCAAC TTCAACAATC
TGGTCCTGGT CTTGTTACTC CTTCTCAAAC TCTTTCTCTT ACTTGTGCTA TTTGTGGTGA
TTCTGTTTCT TCTAATTCTG CTACTTGGAA TTGGATTAGA CAATCTCCTT CTAGAGGTCT
TGAATGGCTT GGTAGAACTT ATTATAGATC TAAGTGGTAT AATGATTATG CTGTTTCTGT
TAAGTCTAGA ATGTCTATTA ATCCTGATAC TTCTAAGAAT CAATTTTCTC TTCAACTTAA
TTCTGTTACT CCTGAAGATA CTGCTGTTTA TTATTGTGCT AGAGGTATGA TGACTTATTA
TTATGGTATG GATGTTTGGG GTCAAGGTAC TACTGTTACT GTTTCTTCTG GTATTCTTGG
TTCTGGTGGA GGTGGATCTG GTGGAGGTGG ATCAGGTGGA GGTGGTTCTC AACCTGTTCT
TACTCAATCT TCTTCTCTTT CTGCTTCTCC TGGTGCTTCT GCTTCTCTTA CTTGTACTCT
TAGATCTGGT ATTAATGTTG GTCCTTATAG AATTTATTGG TATCAACAAA AGCCTGGTTC
TCCTCCTCAA TATCTTCTTA ATTATAAGTC TGATTCTGAT AAGCAACAAG GTTCTGGTGT
TCCTTCTAGA TTTTCTGGTT CTAAGGATGC TTCTGCTAAT GCTGGTGTTC TTCTTATTTC
TGGTCTTAGA TCTGAAGATG AAGCTGATTA TTATTGTATG ATTTGGCATT CTTCTGCTGC
TGTTTTTGGT GGTGGTACTC AACTTACTGT TCTTGGTGGA GGTGGATCTG GTGGAGGTGG
ATCAGGTGGA GGTGGTTCTG TGACCCCTTT GTCTTTGGGT ATTGAAACTA AAGGAGGTTT
TATGACTAGA CTTATTGAAC GTAATACCAC TATTCCTACG AAGAGATCAG AGACTTTTAC
TACTGCTGAT GACAATCAAC CTAGTGTTCA GATCCAAGTG TATCAAGGAG AGAGGGAAAT
TGCTGCACAT AATAAGTTGC TTGGCTCATT TGAACTTACT GGAATTCCAC CTGCTCCTAG
AGGTATTCCA CAAATAGAAG TGACATTTGA CATTGACGCA AATGGGATAG TTCATGTGAC
TGCTAAGGAT AAAGGAACTG GTAAACAGAA TACTATTCGT ATTCAGGAAG GTAGTGGACT
GTCTAAGGAA GATATTGACA GAATGATAAA GGACGCAGAA (SEQ ID NO: 4)
CAAGTTCAAC TTCAACAATC TGGTCCTGGT CTTGTTACTC CTTCTCAAAC TCTTTCTCTT
ACTTGTGCTA TTTCTGGTGA TTCTGTTTCT TCTAATTCTG CTACTTGGAA TTGGATTAGA
CAATCTCCTT CTAGAGGTCT TGAATGGCTT GGTAGAACTT ATTATAGATC TAAGTGGTAT
AATGATTATG CTGTTTCTGT TAAGTCTAGA ATGTCTATTA ATCCTGATAC TTCTAAGAAT
CAATTTTCTC TTCAACTTAA TTCTGTTACT CCTGAAGATA CTGCTGTTTA TTATTGTGCT
AGAGGTATGA TGACTTATTA TTATGGTATG GATGTTTGGG GTCAAGGTAC TACTGTTACT
GTTTCTTCTG GTATTCTTGG TTCTGGTGGA GGTGGATCTG GTGGAGGTGG ATCAGGTGGA
GGTGGTTCTC AACCTGTTCT TACTCAATCT TCTTCTCTTT CTGCTTCTCC TGGTGCTTCT
GCTTCTCTTA CTTGTACTCT TAGATCTGGT ATTAATGTTG GTCCTTATAG AATTTATTGG
TATCAACAAA AGCCTGGTTC TCCTCCTCAA TATCTTCTTA ATTATAAGTC TGATTCTGAT
AAGCAACAAG GTTCTGGTGT TCCTTCTAGA TTTTCTGGTT CTAAGGATGC TTCTGCTAAT
GCTGGTGTTC TTCTTATTTC TGGTCTTAGA TCTGAAGATG AAGCTGATTA TTATTGTATG
ATTTGGCATT CTTCTGCTGC TGTTTTTGGT GGTGGTACTC AACTTACTGT TCTTGGTGGA
GGTGGATCTG GTGGAGGTGG ATCAGGTGGA GGTGGTTCTG TGACCCCTTT GTCTTTGGGT
ATTGAAACTA AAGGAGGTTT TATGACTAGA CTTATTGAAC GTAATACCAC TATTCCTACG
AAGAGATCAG AGACATTTAC TACTGCTGAT GACAATCAAC CTAGTGTTCA GATCCAAGTG
TATCAAGGAG AGAGGGAAAT TACTAAGGAG AATAATCTTC TTGGTAGATT TGAATTGTCT
GGTATTCCAC CTGCTCCTAG AGGTATTCCA CAAATAGAAG TGACATTTGA CATTGACGCA
AATGGGATAG TTCATGTGAC TGCTAAGGAT AAAGGAACTG GTAAAGAGAA TACTATTCGT
ATTCAGGAAG GTAGTGGACT GTCTAAGGAA GATATTGACA GAATGATAAA GGACGCAGAA
(SEQ ID NO: 6) CAAGTTCAAC TTCAACAATC TGGTCCTGGT CTTGTTACTC
CTTCTCAAAC TCTTTCTCTT ACTTGTGCTA TTTCTGGTGA TTCTGTTTCT TCTAATTCTG
CTACTTGGAA TTGGATTAGA CAATCTCCTT CTAGAGGTCT TGAATGGCTT GGTAGAACTT
ATTATAGATC TAAGTGGTAT AATGATTATG CTGTTTCTGT TAAGTCTAGA ATGTCTATTA
ATCCTGATAC TTCTAAGAAT CAATTTTCTC TTCAACTTAA TTCTGTTACT CCTGAAGATA
CTGCTGTTTA TTATTGTGCT AGAGGTATGA TGACTTATTA TTATGGTATG GATGTTTGGG
GTCAAGGTAC TACTGTTACT GTTTCTTCTG GTATTCTTGG TTCTGGTGGA GGTGGATCTG
GTGGAGGTGG ATCAGGTGGA GGTGGTTCTC AACCTCTTCT TACTCAATCT TCTTCTCTTT
CTGCTTCTCC TGGTGCTTCT GCTTCTCTTA CTTGTACTCT TAGATCTGGT ATTAATGTTG
GTCCTTATAG AATTTATTGG TATCAACAAA AGCCTGGTTC TCCTCCTCAA TATCTTCTTA
ATTATAAGTC TGATTCTGAT AAGCAACAAG GTTCTGGTGT TCCTTCTAGA TTTTCTGGTT
CTAAGGATGC TTCTGCTAAT GCTGGTGTTC TTCTTATTTC TGGTCTTAGA TCTGAAGATG
AAGCTGATTA TTATTGTATG ATTTGGCATT CTTCTGCTGC TGTTTTTGGT GGTGGTACTC
AACTTACTGT TCTTGGTGGA GGTGGATCTG GTGGAGGTGG ATCAGGTGGA GGTGGTTCTG
TGACCCCTTT GTCTTTGGGT ATTGAAACTA AAGGAGGTTT TATGACTAGA CTTATTGAAC
GTAATACCAC TATTCCTACG AAGAGATCAG AGACATTTAC TACTGCTGAT GACAATCAAC
CTAGTGTTCA GATCCAAGTG TATCAAGGAGAGAGGGAAATT ACTAAGGATA ATAATCTTCT
TGGTAGATTT GAACTTTCTGG TATTCCACCT GCTCCTAGAG GTATTCCACA AATAGAAGTG
ACATTTGACA TTGACGCAAA TGGGATAGTT CATGTGACTG CTAAGGATAA AGGAACTGGT
AAAGAGAATA CTATTCGTAT TCAGGAAGGT AGTGGACTGT CTAAGGAAGA TATTGACAGA
ATGATAAAGG ACGCAGAA (SEQ ID NO: 8) CAAGTTCAAC TTCAACAATC TGGTCCTGGT
CTTGTTACTC CTTCTCAAAC TCTTTCTCTT ACTTGTGCTA TTTCTGGTGA TTCTGTTTCT
TCTAATTCTG CTACTTGGAA TTGGATTAGA CAATCTCCTT CTAGAGGTCT TGAATGGCTT
GGTAGAACTT ATTATAGATC TAAGTGGTAT AATGATTATG CTGTTTCTGT TAAGTCTAGA
ATGTCTATTA ATCCTGATAC TTCTAAGAAT CAATTTTCTC TTCAACTTAA TTCTGTTACT
CCTGAAGATA CTGCTGTTTA TTATTGTGCT AGAGGTATGA TGACTTATTA TTATGGTATG
GATGTTTGGG GTCAAGGTAC TACTGTTACT GTTTCTTCTG GTATTCTTGG TTCTGGTGGA
GGTGGATCTG GTGGAGGTGG ATCAGGTGGA GGTGGTTCTC AACCTGTTCT TACTCAATCT
TCTTCTCTTT CTGCTTCTCC TGGTGCTTCT GCTTCTCTTA CTTGTACTCT TAGATCTGGT
ATTAATGTTG GTCCTTATAG AATTTATTGG TATCAACAAA AGCCTGGTTC TCCTCCTCAA
TATCTTCTTA ATTATAAGTC TGATTCTGAT AAGCAACAAG GTTCTGGTGT TCCTTCTAGA
TTTTCTGGTT CTAAGGATGC TTCTGCTAAT GCTGGTGTTC TTCTTATTTC TGGTCTTAGA
TCTGAAGATG AAGCTGATTA TTATTGTATG ATTTGGCATT CTTCTGCTGC TGTTTTTGGT
GGTGGTACTC AACTTACTGT TCTTGGTGGA TCTTCAAGAT CTTCAAGTTC TGGTGGAGGA
GGTTCTGGTG GAGGTGGTGT GACCCCTTTG TCTTTGGGTA TTGAAACTAA AGGAGGTTTT
ATGACTAGAC TTATTGAACG TAATACCACT ATTCCTACGA AGAGATCAGA GACATTTACT
ACTGCTGATG ACAATCAACC TAGTGTTCAG ATCCAAGTGT ATCAAGGAGA GAGGGAAATT
ACTAAGGAGA ATAATCTTCT TGGTAGATTT GAATTGTCTG GTATTCCACC TGCTCCTAGA
GGTATTCCAC AAATAGAAGT GACATTTGAC ATTGACGCAA ATGGGATAGT TCATGTGACT
GCTAAGGATA AAGGAACTGG TAAAGAGAAT ACTATTCGTA TTCAGGAAGG TAGTGGACTG
TCTAAGGAAG ATATTCACAG AATGATAAAG GACGCAGAA (SEQ ID NO: 10)
CAAGTTCAAC TTCAACAATC TGGTCCTGGT CTTGTTACTC CTTCTCAAAC TCTTTCTCTT
ACTTGTGCTA TTTCTGGTGA
TTCTGTTTCT TCTAATTCTG CTACTTGGAA TTGGATTAGA CAATCTCCTT CTAGAGGTCT
TGAATGGCTT GGTAGAACTT ATTATAGATC TAAGTGGTAT AATGATTATG CTGTTTCTGT
TAAGTCTAGA ATGTCTATTA ATCCTGATAC TTCTAAGAAT CAATTTTCTC TTCAACTTAA
TTCTGTTACT CCTGAAGATA CTGCTGTTTA TTATTGTGCT AGAGGTATGA TGACTTATTA
TTATCGTATG GATGTTTGGG GTCAAGGTAC TACTGTTACT GTTTCTTCTG GTATTCTTGG
TTCTGGTGGA GGTGGATCTG GTGGAGGTGG ATCAGGTGGA GGTGGTTCTC AACCTGTTCT
TACTCAATCT TCTTCTCTTT CTGCTTCTCC TGGTGCTTCT GCTTCTCTTA CTTGTACTCT
TAGATCTGCT ATTAATGTTG GTCCTTATAG AATTTATTGG TATCAACAAA AGCCTGGTTC
TCCTCCTCAA TATCTTCTTA ATTATAAGTC TGATTCTGAT AAGCAACAAG GTTCTGGTGT
TCCTTCTAGA TTTTCTGGTT CTAAGGATGC TTCTGCTAAT GCTGGTGTTC TTCTTATTTC
TGGTCTTAGA TCTGAAGATG AAGCTGATTA TTATTGTATG ATTTGGCATT CTTCTGCTGC
TGTTTTTGGT GGTGGTACTC AACTTACTGT TCTTGGTGGA TCTTCAGAAT CTTCAAGTTC
TGGTGGAGGA GGTTCTGGTG GAGGTGGTGT GACCCCTTTG TCTTTGGGTA TTGAAACTAA
AGGAGGTTTT ATGACTAGAC TTATTGAACG TAATACCACT ATTCCTACGA AGAGATCAGA
GACATTTACT ACTGCTGATG ACAATCAACC TAGTGTTCAG ATCCAAGTGT ATCAAGGAGA
GAGGGAAATT ACTAAGGAGA ATAATCTTCT TGGTAGATTT GAATTGTCTG GTATTCCACC
TGCTCCTAGA GGTATTCCAC AAATAGAAGT GACATTTGAC ATTGACGCAA ATGGGATAGT
TCATGTGACT GCTAAGGATA AAGGAACTGG TAAAGAGAAT ACTATTCGTA TTCAGGAAGG
TAGTGGACTG TCTAAGGAAG ATATTGACAG AATGATAAAG GACGCAGAA
[0233] In some embodiments, the isolated nucleic acid is at least
about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
identical to the nucleotide sequence of any one of SEQ ID NOS:2, 4,
6, 8, or 10.
[0234] In certain embodiments, the isolated nucleic acid is
codon-optimized for expression in a host cell, e.g., a bacterial
cell, a mammalian cell, an insect cell, or a plant cell. In some
embodiments, the isolated nucleic acid is codon optimized for
expression in a plant cell, e.g., wherein the plant is Nicotiana
benthamiana or Nicotiana tabacum.
[0235] The isolated nucleic acid may be operably linked to a
promoter, e.g., a promoter that is suitable for expression in the
host cell of interest. In some embodiments, the promoter is a plant
promoter.
[0236] Another aspect of the invention relates to an expression
vector comprising the nucleic acid of the invention.
[0237] The invention further relates to a cell comprising the
isolated nucleic acid or the expression vector of the invention.
The cell may be a bacterial cell, a mammalian cell, an insect cell,
or a plant cell, e.g., a plant cell selected from N. benthamiana
and N. tabacum.
[0238] An additional aspect of the invention relates to a
transgenic plant cell, plant part, or plant comprising the isolated
nucleic acid of the invention.
3. Methods of Using the Fusion Proteins
[0239] The fusion proteins described herein can be administered to
a subject to enhance that subject's immune response, particularly a
cell-mediated cytolytic response, against a cell expressing the
antigen recognized by the antigen binding domain. The fusion
protein may simply enhance the immune response (thus serving as an
immunogenic composition), or confer protective immunity (thus
serving as a vaccine).
[0240] Thus, the protein fusion polypeptides produced as described
above may be purified to a suitable purity for use as a
pharmaceutical composition. Generally, a purified composition will
have one species that comprises more than about 85 percent of all
species present in the composition, more than about 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more
of all species present. The object species may be purified to
essential homogeneity (contaminant species cannot be detected in
the composition by conventional detection methods) wherein the
composition consists essentially of a single species. A skilled
artisan may purify a fusion protein using standard techniques for
protein purification, for example, immunoaffinity chromatography,
size exclusion chromatography, etc., in light of the teachings
herein. Purity of a polypeptide may be determined by a number of
methods known to those of skill in the art, including for example,
amino-terminal amino acid sequence analysis, gel electrophoresis
and mass-spectrometry analysis.
[0241] Accordingly, provided are pharmaceutical compositions
comprising the above-described fusion proteins. In one aspect,
provided are pharmaceutically acceptable compositions which
comprise a therapeutically-effective amount of one or more of the
compounds described above and below, formulated together with one
or more pharmaceutically acceptable carriers (additives) and/or
diluents. In another aspect, in certain embodiments, the compounds
may be administered as such or in admixtures with pharmaceutically
acceptable carriers and may also be administered in conjunction
with other agents. (Conjunctive (combination) therapy thus includes
sequential, simultaneous and separate, or coadministration of the
active compound in a way that the therapeutic effects of the first
administered one has not entirely disappeared when the subsequent
is administered.
[0242] The fusion proteins described herein can be administered to
a subject in a variety of ways. The routes of administration
include intradermal, transdermal (e.g., slow release polymers),
intramuscular, intraperitoneal, intravenous, subcutaneous, oral,
epidural and intranasal routes. Any other convenient route of
administration can be used, for example, infusion or bolus
injection, or absorption through epithelial or mucocutaneous
linings. In addition, the compositions described herein can contain
and be administered together with other pharmacologically
acceptable components such as biologically active agents (e.g.,
adjuvants such as alum), surfactants (e.g., glycerides), excipients
(e.g., lactose), carriers, diluents and vehicles. Furthermore, the
compositions can be used ex vivo as a means of stimulating while
blood cells obtained from a subject to elicit, expand and propagate
antigen-specific immune cells in vitro that are subsequently
reintroduced into the subject.
[0243] Further, a fusion protein can be administered by in vivo
expression of a nucleic acid encoding such protein sequences into a
human subject. Expression of such a nucleic acid can also be
achieved ex vivo as a means of stimulating white blood cells
obtained from a subject to elicit, expand and propagate
antigen-specific immune cells in vitro that are subsequently
reintroduced into the subject. Expression vectors suitable for
directing the expression of a fusion protein of interest can be
selected from the large variety of vectors currently used in the
field. Preferred will be vectors that are capable of producing high
levels of expression as well as are effective in transducing a gene
of interest. For example, recombinant adenovirus vector pJM17 (All
et al., Gene Therapy 1:367-84 (1994); Berkner K. L., Biotechniques
6:616-24 1988), second generation adenovirus vectors DE1/DE4 (Wang
and Finer, Nature Medicine 2:714-6 (1996)), or adeno-associated
viral vector AAV/Neo (Muro-Cacho et al., J. Immunotherapy 11:231-7
(1992)) can be used. Furthermore, recombinant retroviral vectors
MFG (Jaffee et al., Cancer Res. 53:2221-6 (1993)) or LN, LNSX,
LNCX, LXSN (Miller and Rosman, Biotechniques 7:980-9 (1989)) can be
employed. Herpes simplex virus-based vectors such as pHSV1 ((Geller
et al., Proc. Nat'l Acad. Sci. 87:8950-4 (1990) or vaccinia viral
vectors such as MVA (Sutter and Moss. Proc. Nat'l Acad. Sci. 89:
10847-51 (1992)) can serve as alternatives.
[0244] Frequently used specific expression units including promoter
and 3' sequences are those found in plasmid cDNA3 (Invitrogen),
plasmid AH5, pRC/CMV (Invitrogen), pCMU II (Paabo et al., EMBO J.
5:1921-1927 (1986)), pZip-Neo SV (Cepko et al., Cell 37:1053-1062
(1984)) and pSRa (DNAX, Palo Alto, Calif.). The introduction of
genes into expression units and/or vectors can be accomplished
using genetic engineering techniques, as described in manuals like
Molecular Cloning and Current Protocols in Molecular Biology
(Sambrook, J., et al., Molecular Cloning, Cold Spring Harbor Press
(1989); Ausubel, F. M. et al., Current Protocols in Molecular
Biology, Greene Publishing Associates and Wiley-Interscience
(1989)). A resulting expressible nucleic acid can be introduced
into cells of a human subject by any method capable of placing the
nucleic acid into cells in an expressible form, for example as part
of a viral vector such as described above, as naked plasmid or
other DNA, or encapsulated in targeted liposomes or in erythrocyte
ghosts (Friedman, T., Science, 244:1275-1281 (1989); Rabinovich, N.
R. et al., Science 265:1401-1.404 (1994)). Methods of transduction
include direct injection into tissues and tumors, liposomal
transfection (Fraley et al., Nature 370:111-117 (1980)),
receptor-mediated endocytosis (Zatloukal et al., Ann. N.Y. Acad.
Sci. 660:136-153 (1992)), and particle bombardment-mediated gene
transfer (Eisenbraun et al., DNA & Cell. Biol. 12:791-797
(1993)).
[0245] The amount of fusion polypeptide (fused, conjugated or
noncovalently joined as discussed before) in the compositions of
the present invention is an amount which produces an effective
immunostimulatory response in a subject as determined by the
methods described herein. An effective amount is an amount such
that when administered, it induces an immune response. In addition,
the amount of fusion protein administered to the subject will vary
depending on a variety of factors, including the engineered
antibody and stress protein employed, the size, age, body weight,
general health, sex, and diet of the subject as well as on the
subject's general immunological responsiveness. Adjustment and
manipulation of established dose ranges are well within the ability
of those skilled in the art. For example, the amount of engineered
fusion protein according to the invention, for example, mesothelin
antibody-modified HSP70 fusion protein, can be from about 1
microgram to about 1 gram, preferably from about 100 microgram to
about 1 gram, and from about 1 milligram to about 1 gram. An
effective amount of a composition comprising an expression vector
is an amount such that when administered, it induces an immune
response against the antigen against which the antigen binding
domain is directed. Furthermore, the amount of expression vector
administered to the subject will vary depending on a variety of
factors, including the antigen binding domain and HSP70 protein
expressed, the size, age, body weight, general health, sex, and
diet of the subject, as well as on the subject's general
immunological responsiveness. Additional factors that need to be
considered are the route of application and the type of vector
used. For example, when prophylactic or therapeutic treatment is
carried out with a viral vector containing a nucleic acid encoding
an engineered fusion protein according to the invention, the
effective amount will be in the range of 10.sup.4 to 10.sup.12
helper-free, replication-defective virus per kg body weight,
preferably in the range of 10.sup.5 to 10.sup.11 virus per kg body
weight and most preferably in the range of 10.sup.6 to 10.sup.10
virus per kg body weight.
[0246] An effective dose can be estimated initially from in vitro
assays. For example, a dose can be formulated in animal models to
achieve an induction of an immune response using techniques that
are well known in the art. One having skill in the art could
readily optimize administration to humans based on animal data.
Dosage amount and interval may be adjusted individually. For
example, when used as a vaccine, the proteins and/or strains of the
invention may be administered in about 1 to 3 doses for a 1-36 week
period. Preferably, 3 doses are administered, at intervals of about
3-4 months, and booster vaccinations may be given periodically
thereafter. Alternate protocols may be appropriate for individual
patients. A suitable dose is an amount of protein or strain that,
when administered as described above, is capable of raising an
immune response in an immunized patient sufficient to protect the
patient from the condition or infection for at least 1-2 years.
[0247] The compositions may also include adjuvants to enhance
immune responses. In addition, such proteins may be further
suspended in an oil emulsion to cause a slower release of the
proteins in vivo upon injection. The optimal ratios of each
component in the formulation may be determined by techniques well
known to those skilled in the art.
[0248] Any of a variety of adjuvants may be employed in the
vaccines of this invention to enhance the immune response. Most
adjuvants contain a substance designed to protect the antigen from
rapid catabolism, such as aluminum hydroxide or mineral oil, and a
specific or nonspecific stimulator of immune responses, such as
lipid A, or Bortadella pertussis. Suitable adjuvants are
commercially available and include, for example, Freund's
Incomplete Adjuvant and Freund's Complete Adjuvant (Difco
Laboratories) and Merck Adjuvant 65 (Merck and Company, Inc.,
Rahway, N.J.). Other suitable adjuvants include alum, biodegradable
microspheres, monophosphoryl lipid A, quil A, SBAS1c, SBAS2 (Ling
et al., 1.997, Vaccine 15:1562-1567), SBAS7, Al(OH).sub.3 and CpG
oligonucleotide (WO96/02555).
[0249] In the vaccines of the present invention, the adjuvant may
induce a Th1 type immune response. Suitable adjuvant systems
include, for example, a combination of monophosphoryl lipid A,
preferably 3-de-O-acylated monophosphoryl lipid A (3D-MPL) together
with an aluminum salt. An enhanced system involves the combination
of a monophosphoryl lipid A and a saponium derivative, particularly
the combination of 3D-MLP and the saponin QS21 as disclosed in WO
94/00153, or a less reactogenic composition where the QS21 is
quenched with cholesterol as disclosed in WO 96/33739. Previous
experiments have demonstrated a clear synergistic effect of
combinations of 3D-MLP and QS21 in the induction of both humoral
and Th1 type cellular immune responses. A particularly potent
adjuvant formation involving QS21, 3D-MLP and tocopherol in an
oil-in-water emulsion is described in WO 95/17210 and may comprise
a formulation.
[0250] In particular embodiments of the invention, more than one
administration (e.g., two, three, four, or more administrations)
can be employed over a variety of time intervals (e.g., hourly,
daily, weekly, monthly, etc.) to achieve therapeutic effects.
A. Method of Use Embodiments
[0251] One aspect of the invention relates to a method for inducing
an immune response to an antigen in a subject, comprising
administering to the subject the fusion protein of the invention
that specifically binds the antigen, thereby inducing an immune
response.
[0252] Another aspect of the invention relates to a method of
treating a disease associated with an antigen in a subject in need
thereof, comprising administering to the subject a therapeutically
effective amount of the fusion protein of any one of claims 1-31
that specifically binds the antigen, thereby treating the
disease.
[0253] In some embodiments, the antigen is a disease antigen. The
antigen may be a viral antigen, bacterial antigen, pathogen
antigen, or cancer antigen as described above. In some embodiments,
the antigen is a cancer antigen, e.g., mesothelin.
[0254] In certain embodiments, the disease associated with an
antigen is a pathogen infection, e.g., a viral infection. In some
embodiments, the disease associated with an antigen is a cancer
that expresses the antigen, e.g., mesothelin. In some embodiments,
the mesothelin-expressing cancer is ovarian cancer, meningioma,
glioma, metastases to the leptomininges, mesothelioma,
adenocarcinoma of the uterus, malignant mesothelioma, pancreatic
cancer, or lung adenocarcinoma.
[0255] In some embodiments, the methods of the invention further
comprise administering to the subject an additional active agent.
The additional active agent may be a therapeutic agent, e.g., an
anti-pathogen agent or an anti-cancer agent
[0256] Anti-cancer agents, include, without limitation, 1) vinca
alkaloids (e.g., vinblastine, vincristine); 2) epipodophyillotoxins
(e.g., etoposide and teniposide); 3) antibiotics (e.g.,
dactinomycin (actinomycin D), daunorubicin (daunomycin;
rubidomycin), doxorubic, bleomycin, plicamycin (mithramycin), and
mitomycin (mitomycin C)); 4) enzymes (e.g., L-asparaginase); 5)
biological response modifiers (e.g., interferon-alfa); 6) platinum
coordinating complexes (e.g., cisplatin and carboplatin); 7)
anthracenediones (e.g., mitoxantrone); 8) substituted ureas (e.g.,
hydroxyurea); 9) methylhydrazine derivatives (e.g., procarbazine
(N-methylhydrazine; MIH)); 10) adrenocortical suppressants (e.g.,
mitotane (o,p'-DDD) and aminoglutethimide); 11)
adrenocorticosteroids (e.g., prednisone); 12) progestins (e.g.,
hydroxyprogesterone caproate, medroxyprogesterone acetate, and
megestrol acetate); 13) estrogens (e.g., diethylstilbestrol and
ethinyl estradiol); 14) antiestrogens (e.g., tamoxifen); 15)
androgens (e.g., testosterone propionate and fluoxymesterone); 16)
antiandrogens (e.g., flutamide); and 17) gonadotropin-releasing
hormone analogs (e.g., leuprolide). In another embodiment, the
compounds of the invention are administered in conjunction with
anti-angiogenesis agents, such as antibodies to VEGF (e.g.,
bevacizumab (AVASTIN), ranibizumab (LUCENTIS)) and other promoters
of angiogenesis (e.g., bFGF, angiopoietin-1), antibodies to
alpha-v/beta-3 vascular integrin (e.g., VITAXIN), angiostatin,
endostatin, dalteparin, ABT-510, CNGRC peptide TNF alpha conjugate,
cyclophosphamide, combretastatin A4 phosphate, dimethylxanthenone
acetic acid, docetaxel, lenalidomide, enzastaurin, paclitaxel,
paclitaxel albumin-stabilized nanoparticle formulation (Abraxane),
soy isoflavone (Genistein), tamoxifen citrate, thalidomide, ADH-1
(EXHERIN), AG-013736, AMG-706, AZD2171, sorafenib tosylate,
BMS-582664, CHIR-265, pazopanib, P1-88, vatalanib, everolimus,
suramin, sunitinib malate, XL184, ZD6474, ATN-161, cilenigtide, and
celecoxib.
[0257] Suitable antiviral agents include, for example,
virus-inactivating agents such as nonionic, anionic and cationic
surfactants, and C31 G (amine oxide and alkyl betaine),
polybiguanides, docosanol, acylcarnitine analogs, octyl glycerol,
and antimicrobial peptides such as magainins, gramicidins,
protegrins, and retrocyclins. Mild surfactants, e.g., sorbitan
monolaurate, may advantageously be used as antiviral agents in the
compositions described herein. Other antiviral agents that may
advantageously be utilized in the compositions described herein
include nucleotide or nucleoside analogs, such as tenfovir,
acyclovir, amantadine, didanosine, foscarnet, ganciclovir,
ribavirin, vidarabine, zalcitabine, and zidovudine. Further
antiviral agents that may be used include non-nucleoside reverse
transcriptase inhibitors, such as UC-781 (thiocarboxanilide),
pyridinones, TIBO, nevaripine, delavirdine, calanolide A,
capravirine and efavirenz. Other antiviral agents that may be used
are those in the category of HIV entry blockers, such as
cyanovirin-N, cyclodextrins, carregeenans, sulfated or sulfonated
polymers, mandelic acid condensation polymers, monoclonal
antibodies, chemokine receptor antagonists such as TAK-779,
SCH-C/D, and AMD-3100, and fusion inhibitors such as T-20 and
1249.
[0258] Suitable antibacterial agents include antibiotics, such as
aminoglycosides, cephalosporins, including first, second and third
generation cephalosporins; macrolides, including erythromycins,
penicillins, including natural penicillins, penicillinase-resistant
penicillins, aminopenicillins, extended spectrum penicillins;
sulfonamides, tetracyclines, fluoroquinolones, metronidazole and
urinary tract antiseptics.
[0259] Suitable antifungal agents include amphotericin B, nystatin,
griseofulvin, flucytosine, fluconazole, potassium iodide,
intraconazole, clortrimazole, miconazole, ketoconazole, and
tolnaftate.
[0260] Suitable antiprotozoal agents include antimalarial agents,
such as chloroquine, primaquine, pyrimethamine, quinine, fansidar,
and mefloquine; amebicides, such as dioloxamide, emetine,
iodoquinol, metronidazole, paromomycine and quinacrine; pentamidine
isethionate, atovaquone, and eflornithine.
[0261] The additional active agent may be an agent that treats or
enhances the effect of a treatment against a symptom or side effect
of a disease or treatment. In one embodiment, the additional active
agent is an anti-inflammatory agent. Examples include, without
limitation, H1-antihistamines (e.g., cetirizine), H2-antihistamines
(e.g., ranitidine, famotidine), antileukotrienes (e.g.,
montelukast, zileuton), and nonsteroidal anti-inflammatory
drugs.
[0262] The additional active agent may be an immunostimulatory
agent and/or an immune checkpoint inhibitor that enhances the
immunostimulatory effect of the fusion protein of the invention.
Immunostimulatory agents include, without limitation, interleukin,
interferon, cytokine, toll-like receptor (TLR) agonist, cytokine
receptor agonist, CD40 agonist, Fc receptor agonist, CpG-containing
immunostimulatory nucleic acid, complement receptor agonist,
adjuvant, or CXCL12/CXCR4 axis inhibitors such as AMD3100,
KRH-1636, T-20, T-22, T-140, TE-14011, T-14012, or TN14003, or an
antibody that interferes with the dimerization of CXCR4. Immune
checkpoint inhibitors include, without limitation, inhibitors of
PD-1, PD-L1, CTLA4, B7-H3, B7-H4, BTLA, IDO, KIR, LAG3, A2AR,
TIM-3, and VISTA, such as nivolumab, pembrolizumab, ipilimumab,
durvalumab, or atezolizumab.
[0263] In some embodiments, the methods of the invention further
comprise administering to the subject an additional therapy. The
additional therapy may be any therapy known to be effective for
treating a disease, e.g., therapies known to be effective for
cancer treatment, e.g., surgery, radiotherapy, proton beam therapy,
light-based therapy, etc.
4. Kits
[0264] The present invention provides kits for expressing an
engineered fusion protein according to the invention. Such kits may
be comprised of nucleic acids encoding an engineered fusion protein
of the invention. The nucleic acids may be included in a plasmid or
a vector, e.g., a bacterial plasmid or viral vector. Other kits
comprise an engineered fusion polypeptide. Furthermore, the present
invention provides kits for producing and/or purifying fusion
polypeptides according to the invention.
[0265] The present invention provides kits for preventing or
treating infectious, inflammatory, autoimmune or malignant disease
in a patient. For example, a kit may comprise one or more
pharmaceutical compositions as described above and optionally
instructions for their use. In still other embodiments, the
invention provides kits comprising one more pharmaceutical
composition and one or more devices for accomplishing
administration of such compositions.
[0266] Kit components may be packaged for either manual or
partially or wholly automated practice of the foregoing methods. In
other embodiments involving kits, instructions for their use may be
provided.
[0267] The present invention is more particularly described in the
following examples that are intended as illustrative only since
numerous modifications and variations therein will be apparent to
those skilled in the art.
EXAMPLE 1
Preparation and Therapeutic Activity of VIC-008
[0268] A novel fusion protein, VIC-007 (SEQ ID NO:28), consists of
the broadly immune-activating Mycobacterium tuberculosis-derived
heat shock protein 70 (MtbHsp70) and the tumor antigen targeting
activity of a single-chain variable fragment (scFv) binding
mesothelin (MSLN), a validated immunotherapy target (4-6). MSLN is
highly overexpressed on the surface of common epithelial cancers
including epithelial malignant mesothelioma and ovarian cancer,
while expressed at relatively low levels only in mesothelial cells
lining the pleura, pericardium, and peritoneum in healthy
individuals (7-10). MtbHsp70 is well characterized and functions as
a potent immune-activating adjuvant. It stimulates monocytes and
dendritic cells (DCs) to produce CC-chemokines (11, 12), which
attract antigen processing and presenting macrophages, DCs, and
effector T and B cells (13). In theory, fusion of anti-MSLN scFv
and MtbHsp70 takes advantage of the immune-activating action of
MtbHsp70 and the tumor-targeting activity of the scFv, which will
yield anti-tumor responses against the broadest profile of tumo
antigens.
[0269] Although our previous studies showed that VIC-007
significantly enhanced survival of immune competent mice with
ovarian or malignant mesothelioma tumors through the augmentation
of tumor-specific cell-mediated immune responses (14), the fusion
protein did not result in long-term remission. In this study a new
version of the fusion protein, VIC-008 (SEQ ID NO:27), was
reconstructed from VIC-007 to remove redundant amino acids and
minimize the activity of the natural peptide-binding site of
MtbHsp70. VIC-007 and VIC-008 were compared side by side in the
same set of mice and it was found that VIC-008 conferred
significantly improved antitumoral efficacy in a syngeneic,
orthotopic and immune competent murine model of ovarian cancer.
Materials and Methods
[0270] Cells: The ID8 ovarian cancer cells, a kind gift from Kathy
Roby (University of Kansas Medical Center, Kansas City, Kans. (15),
were transfected with luciferase lentiviral vector and stably
expressed luciferase, here named Luc-ID8. Cells were maintained at
37.degree. C. in DMEM with 2 mmol/L L-glutamine, 10 units/ml
penicillin, 10 .mu.g/ml streptomycin, and 10% fetal bovine serum in
humidified atmosphere with 5% CO.sub.2. Cells were cultured until
80% confluent, and harvested with Trypsin EDTA (Mediatech) for
animal injections.
[0271] Animal Model and Treatment: Ovarian cancer was established
by Intraperitoneal (i.p.) injection of syngeneic cancer cells
Luc-ID8 (5.times.10.sup.6 cells per mouse) into 6-week old female
C57BL/6 mice. All mice were purchased from Jackson laboratories.
Mice with ovarian tumors were treated 7 days after tumor cell
inoculation with i.p. injections of VIC-007 (4 .mu.g per mouse),
VIC-008 (4 .mu.g per mouse), or normal saline. This was followed by
3 further treatments at 7-day intervals. All studies were performed
in a manner that was blinded to the observer under protocols that
were approved by the Massachusetts General Hospital Subcommittee on
Research Animal Care (SRAC).
[0272] In Vivo Imaging of Tumor Growth: Intraperitoneal tumor
growth was monitored weekly after tumor cell inoculation using in
vivo live imaging by IVIS Spectrum (PerkinElmer). Mice were
injected intraperitoneally with 150 mg/kg body weight of
D-luciferin 10 min in advance and subsequently imaged by IVIS
Spectrum.
[0273] Mouse Survival: For survival studies, we observed the mice
daily 1 week after inoculation of tumor cells. Tumor generations
were consistently first evident via abdominal distension secondary
to malignant ascites, and tumor-bearing mice were euthanized at the
endpoint when there were signs of distress, including fur ruffling,
rapid respiratory rate, hunched posture, reduced activity, and
progressive ascites formation as previously described (16).
[0274] Statistical Analysis: Statistical differences between three
or more experimental groups were analyzed using Two-Way ANOVA,
followed by Tukey's multiple comparison tests when mean of each
group is compared with that of every other group. Survival was
analyzed with the Log-rank test. Prism 6.0 software (GraphPad
Software) was used for all the statistical analysis.
Results and Discussion
[0275] Reconstruction of the Fusion Protein scFv-MtbHsp70: The
fusion protein scFv-MtbHsp70 was constructed with V.sub.H and
V.sub.L from anti-MSLN p4 scFv (17) fused to full length MtbHsp70
with a (G4S)3 linker in between, which has been shown in our
previous study (14). The previous version of the fusion protein
VIC-007 achieved significant control of tumor growth and
prolongation of the survival of tumor-bearing mice, but the
antitumaral efficacy of the treatment regimen used needed to be
improved. Antigenic peptides linked to MtbHsp70 through both
non-covalent binding and by genetic fusion can elicit both MHC
class I-restricted CD8+ and MHC class II-restricted CD4+ T-cell
responses (18-22). In this study a new version of the scFv-MtbHsp70
fusion protein was developed. VIC-008, which was modified from the
original VIC-007 by the elimination of redundant amino acids and
the introduction of a single amino acid mutation, valine (V) in
place of phenylalanine (F), at position 410 of MtbHsp70 (FIG. 1).
This change is designed to prevent peptide binding (23) while
retaining the immune-stimulatory capacity of the protein, in order
to reduce the possibility that MtbHsp70 might incidentally bind and
deliver other antigens that could result in off target effects or
the induction of tolerance or autoimmunity.
[0276] The fusion proteins were constructed and expressed by WuXi
App Tech (Shanghai, China) in CHO cells and provided at a purity of
above 95% by HPLC and an endotoxin level of less than 1.0
EU/mg.
[0277] VIC-008 Enhances the Control of Tumor Growth: Murine ovarian
cancer was established by i.p. injection of syngeneic cancer cells
Luc-ID8 in immune competent C57BL/6 mice and treated with VIC-007
and VIC-008 as described in the section of materials and methods.
As shown in FIG. 2, both VIC-007 and VIC-008 significantly slowed
tumor growth as recorded by bioluminescence signals compared to
saline (p<0.0001 and p<0.0001) while VIC-008 further
significantly delayed tumor growth compared to VIC-007
(p<0.0001).
[0278] VIC-008 Enhances the Prolongation of Mouse Survival: The
efficacy of VIC-007 and VIC-008 to prolong survival in the
tumor-bearing mice was further evaluated. As shown in FIG. 3, both
VIC-007 and VIC-008 significantly enhanced the survival of
tumor-bearing mice compared to saline (p=0.0253 and p=0.0002) with
increased median survival of 55 days from saline to 60 days from
VIC-007 and further to 65 days from VIC-008. VIC-008 further
significantly prolonged the survival of the tumor-bearing mice
compared to VIC-007 (p=0.0301).
[0279] Taken together, these data showed that the new version of
the fusion protein VIC-008 significantly delayed the tumor growth
and prolonged the survival in a syngeneic murine model of ovarian
cancer. Improved mouse survival of VIC-008 compared to VIC-007 is
likely related to the changes made to the protein sequences. This
study provides a definitive preclinical validation of the
mesothelin targeted immune activating fusion protein as a
therapeutic agent for ovarian cancer.
REFERENCES
[0280] 1. Siegel R, DeSantis C, Virgo K, Stein K, Mariotto A, Smith
T, et al. Cancer treatment and survivorship statistics, 2012. CA: a
cancer journal for clinicians. 2012; 62 (4):220-41. Epub 2012 Jun.
16. [0281] 2. Bast R C, Jr., Hennessy B, Mills G B. The biology of
ovarian cancer: new opportunities for translation. Nature reviews
Cancer. 2009; 9 (6):415-28. Epub 2009 May 23. [0282] 3.
Mantia-Smaldone G M, Corr B, Chu C S. Immunotherapy in ovarian
cancer. Human vaccines & immunotherapeutics. 2012; 8
(9):1179-91. Epub 2012 Aug. 22. [0283] 4. Hassan R, Cohen S J,
Phillips M, Pastan I, Sharon E, Kelly R J, et al. Phase I clinical
trial of the chimeric anti-mesothelin monoclonal antibody MORAb-009
in patients with mesothelin-expressing cancers. Clinical cancer
research: an official journal of the American Association for
Cancer Research. 2010; 16 (24):6132-8. Epub 2010 Nov. 3. [0284] 5.
Hassan R, Ho M. Mesothelin targeted cancer immunotherapy. Eur J
Cancer. 2008; 44 (1):46-53. Epub 2007 Oct. 20. [0285] 6. Kreitman R
J, Hassan R, Fitzgerald D J, Pastan I. Phase I trial of continuous
infusion anti-mesothelin recombinant immunotoxin SS1P. Clinical
cancer research: an official journal of the American Association
for Cancer Research. 2009; 15 (16):5274-9. Epub 2009 Aug. 13.
[0286] 7. Chang K, Pastan I. Molecular cloning of mesothelin, a
differentiation antigen present on mesothelium, mesotheliomas, and
ovarian cancers. Proceedings of the National Academy of Sciences of
the United States of America. 1996; 93 (1):136-40. Epub 1996 Jan.
9. [0287] 8. Argani P, Iacobuzio-Donahue C, Ryu B, Rosty C, Goggins
M, Wilentz R E, et al. Mesothelin is overexpressed in the vast
majority of ductal adenocarcinomas of the pancreas: identification
of a new pancreatic cancer marker by serial analysis of gene
expression (SAGE). Clinical cancer research: an official journal of
the American Association for Cancer Research. 2001; 7 (12):3862-8.
Epub 2001 Dec. 26. [0288] 9. Ho M, Bera T K, Willingham M C, Onda
M, Hassan R, FitzGerald D, et al. Mesothelin expression in human
lung cancer. Clinical cancer research: an official journal of the
American Association for Cancer Research. 2007; 13 (5):1571-5. Epub
2007 Mar. 3. [0289] 10. Tang Z, Qian M, Ho M. The role of
mesothelin in tumor progression and targeted therapy. Anti-cancer
agents in medicinal chemistry. 2013; 13 (2):276-80. Epub 2012 Jun.
23. [0290] 11. Floto R A, MacAry P A, Boname J M, Mien T S,
Kampmann B, Hair J R, or al., Dendritic cell stimulation by
mycobacterial Hsp70 is mediated through CCR5. Science. 2006; 314
(5798):454-8. Epub 2006 Oct. 21. [0291] 12. Wang Y, Kelly C G,
Karttunen J T, Whittall T, Lehner P J, Duncan L, et al. CD40 is a
cellular receptor mediating mycobacterial heat shock protein 70
stimulation of CC-chemokines. Immunity. 2001; 15 (6):971-83. Epub
2002 Jan. 5. [0292] 13:. Baggiolini M, Chemokines and leukocyte
traffic. Nature. 1998; 392 (6676):565-8. Epub 1998 Apr. 29. [0293]
14. Yuan J, Kashiwagi S, Reeves P, Nezivar J, Yang Y, Arrifin N H,
et al. A novel mycobacterial Hsp70-containing fusion protein
targeting mesothelin augments antitumor immunity and prolongs
survival in murine models of ovarian cancer and mesothelioma.
Journal of hematology & oncology. 2014; 7:15. Epub 2014 Feb.
26. [0294] 15. Rohy K F, Taylor C C, Sweetwood J P, Cheng Y, Pace J
L Tawfik O, et al. Development of a syngeneic mouse model for
events related to ovarian cancer. Carcinogenesis. 2000; 21
(4):585-91. Epub 2000 Apr. 7. [0295] 16. Righi E, Kashiwagi S, Yuan
J, Santosuosso M, Leblanc P, Ingraham R, et al. CXCL12/CXCR4
blockade induces multimodal antitumor effects that prolong survival
in an immunocompetent mouse model of ovarian cancer. Cancer
research. 2011; 71 (16):5522-34, Epub 2011 Jul. 12. [0296] 17.
Bergan L, Gross J A, Nevin B, Urban N, Scholler N. Development and
in vitro validation of anti-mesothelin biobodies that prevent
CA125/Mesothelin-dependent cell attachment, Cancer letters. 2007;
255 (2):263-74. Epub 2007 Jun. 15. [0297] 18. Udono H, Srivastava P
K. Heat shock protein 70-associated peptides elicit specific cancer
immunity. The Journal of experimental medicine. 1993; 178
(4):1391-6. Epub 1993 Oct. 1. [0298] 19. Suto R, Srivastava P K. A
mechanism for the specific immunogenicity of heat shock
protein-chaperoned peptides. Science. 1995; 269 (5230):1585-8. Epub
1995 Sep. 15. [0299] 20. Suzue K, Young R A, Adjuvant-free hsp70
fusion protein system elicits humoral and cellular immune responses
to HIV-I p 24. J Immunol. 1996; 156 (2):873-9. Epub 1996 Jan. 15.
[0300] 21. Huang Q. Richmond J F, Suzue K, Eisen H N, Young R A. In
vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock
protein 70 fusion proteins maps to a discrete domain and is CD4(+)
T cell independent. The Journal of experimental medicine, 2000; 191
(2):403-8. Epub 2000 Jan. 19. [0301] 22. Ciupitu A-M T, Petersson
M, C'Donneill C L, Williams K, Jindal S, Kiessling R, et al.
Immunization with a Lymphocylic Choriomeningjtis Virus. Peptide
Mixed with Heat Shock Protein 70 Results in Protective Antiviral
immunity and Specific Cytotoxic T Lymphocytes. The journal of
experimental medicine. 1998; 198 (5): 685-91. [0302] 23. MacAry P
A, Javid B, Fioto R A, Smith K G, Oehlmnann W, Singh M, et al.
HSP70 peptide binding mutants separate antigen delivery from
dendritic cell stimulation. Immunity, 2004:20(1 ):95-106. Epub
2004/01/24.
EXAMPLE 2
Additional Studies on VIC-008
[0303] C57BL/6 mice were injected intraperitoneally injected with
5.times.10.sup.6 luciferase-expressing ID8 mouse ovarian cancer
cells. Mice received four weekly treatments of VIC-008 (20 .mu.g)
starting one week after tumor introduction. Results are shown in
FIG. 4. The survival curve is shown in FIG 5.
[0304] Tumor samples were collected two weeks after the fourth and
final treatment of either saline or VIC-008. Tumor tissue was
collected and immunoprofiled using flow cytometry to detect
CD3+CD8+ T cells. Results are shown in FIG. 6.
[0305] CD4+CD25+FoxP3+ T regulatory cells were detected by flow
cytometry. T regulatory cells were counted as a percentage of all
CD3+CD4+ cells. Results are shown in FIG. 7.
[0306] FIG. 8 shows the ratio of CD8+ T cells to T regulatory cells
in the tumors. CD3+CD8+ T cells and CD4+CD25+FoxP3+ T regulatory
cells were detected by flow cytometry. The ratio was calculated
based on percentages of the observed population.
[0307] FIG. 9 shows intratumoral central memory CD8+ T cell
infiltration. Flow cytometry was used to detect CD8+CD44+CD27+
central memory T cells. CD8+ central memory T cells were counted as
a percentage of all CD3+CD8+ cells.
[0308] The foregoing is illustrative of the present invention, and
is not to be construed as limiting thereof. The invention is
defined by the following claims, with equivalents of the claims to
be included therein.
Sequence CWU 1
1
301625PRTMycobacterium tuberculosis 1Met Ala Arg Ala Val Gly Ile
Asp Leu Gly Thr Thr Asn Ser Val Val 1 5 10 15 Ser Val Leu Glu Gly
Gly Asp Pro Val Val Val Ala Asn Ser Glu Gly 20 25 30 Ser Arg Thr
Thr Pro Ser Ile Val Ala Phe Ala Arg Asn Gly Glu Val 35 40 45 Leu
Val Gly Gln Pro Ala Lys Asn Gln Ala Val Thr Asn Val Asp Arg 50 55
60 Thr Val Arg Ser Val Lys Arg His Met Gly Ser Asp Trp Ser Ile Glu
65 70 75 80 Ile Asp Gly Lys Lys Tyr Thr Ala Pro Glu Ile Ser Ala Arg
Ile Leu 85 90 95 Met Lys Leu Lys Arg Asp Ala Glu Ala Tyr Leu Gly
Glu Asp Ile Thr 100 105 110 Asp Ala Val Ile Thr Thr Pro Ala Tyr Phe
Asn Asp Ala Gln Arg Gln 115 120 125 Ala Thr Lys Asp Ala Gly Gln Ile
Ala Gly Leu Asn Val Leu Arg Ile 130 135 140 Val Asn Glu Pro Thr Ala
Ala Ala Leu Ala Tyr Gly Leu Asp Lys Gly 145 150 155 160 Glu Lys Glu
Gln Arg Ile Leu Val Phe Asp Leu Gly Gly Gly Thr Phe 165 170 175 Asp
Val Ser Leu Leu Glu Ile Gly Glu Gly Val Val Glu Val Arg Ala 180 185
190 Thr Ser Gly Asp Asn His Leu Gly Gly Asp Asp Trp Asp Gln Arg Val
195 200 205 Val Asp Trp Leu Val Asp Lys Phe Lys Gly Thr Ser Gly Ile
Asp Leu 210 215 220 Thr Lys Asp Lys Met Ala Met Gln Arg Leu Arg Glu
Ala Ala Glu Lys 225 230 235 240 Ala Lys Ile Glu Leu Ser Ser Ser Gln
Ser Thr Ser Ile Asn Leu Pro 245 250 255 Tyr Ile Thr Val Asp Ala Asp
Lys Asn Pro Leu Phe Leu Asp Glu Gln 260 265 270 Leu Thr Arg Ala Glu
Phe Gln Arg Ile Thr Gln Asp Leu Leu Asp Arg 275 280 285 Thr Arg Lys
Pro Phe Gln Ser Val Ile Ala Asp Thr Gly Ile Ser Val 290 295 300 Ser
Glu Ile Asp His Val Val Leu Val Gly Gly Ser Thr Arg Met Pro 305 310
315 320 Ala Val Thr Asp Leu Val Lys Glu Leu Thr Gly Gly Lys Glu Pro
Asn 325 330 335 Lys Gly Val Asn Pro Asp Glu Val Val Ala Val Gly Ala
Ala Leu Gln 340 345 350 Ala Gly Val Leu Lys Gly Glu Val Lys Asp Val
Leu Leu Leu Asp Val 355 360 365 Thr Pro Leu Ser Leu Gly Ile Glu Thr
Lys Gly Gly Val Met Thr Arg 370 375 380 Leu Ile Glu Arg Asn Thr Thr
Ile Pro Thr Lys Arg Ser Glu Thr Phe 385 390 395 400 Thr Thr Ala Asp
Asp Asn Gln Pro Ser Val Gln Ile Gln Val Tyr Gln 405 410 415 Gly Glu
Arg Glu Ile Ala Ala His Asn Lys Leu Leu Gly Ser Phe Glu 420 425 430
Leu Thr Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile Glu Val 435
440 445 Thr Phe Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala Lys
Asp 450 455 460 Lys Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu
Gly Ser Gly 465 470 475 480 Leu Ser Lys Glu Asp Ile Asp Arg Met Ile
Lys Asp Ala Glu Ala His 485 490 495 Ala Glu Glu Asp Arg Lys Arg Arg
Glu Glu Ala Asp Val Arg Asn Gln 500 505 510 Ala Glu Thr Leu Val Tyr
Gln Thr Glu Lys Phe Val Lys Glu Gln Arg 515 520 525 Glu Ala Glu Gly
Gly Ser Lys Val Pro Glu Asp Thr Leu Asn Lys Val 530 535 540 Asp Ala
Ala Val Ala Glu Ala Lys Ala Ala Leu Gly Gly Ser Asp Ile 545 550 555
560 Ser Ala Ile Lys Ser Ala Met Glu Lys Leu Gly Gln Glu Ser Gln Ala
565 570 575 Leu Gly Gln Ala Ile Tyr Glu Ala Ala Gln Ala Ala Ser Gln
Ala Thr 580 585 590 Gly Ala Ala His Pro Gly Gly Glu Pro Gly Gly Ala
His Pro Gly Ser 595 600 605 Ala Asp Asp Val Val Asp Ala Glu Val Val
Asp Asp Gly Arg Glu Ala 610 615 620 Lys 625
21200DNAArtificialencodes fusion protein 2caagttcaac ttcaacaatc
tggtcctggt cttgttactc cttctcaaac tctttctctt 60acttgtgcta tttctggtga
ttctgtttct tctaattctg ctacttggaa ttggattaga 120caatctcctt
ctagaggtct tgaatggctt ggtagaactt attatagatc taagtggtat
180aatgattatg ctgtttctgt taagtctaga atgtctatta atcctgatac
ttctaagaat 240caattttctc ttcaacttaa ttctgttact cctgaagata
ctgctgttta ttattgtgct 300agaggtatga tgacttatta ttatggtatg
gatgtttggg gtcaaggtac tactgttact 360gtttcttctg gtattcttgg
ttctggtgga ggtggatctg gtggaggtgg atcaggtgga 420ggtggttctc
aacctgttct tactcaatct tcttctcttt ctgcttctcc tggtgcttct
480gcttctctta cttgtactct tagatctggt attaatgttg gtccttatag
aatttattgg 540tatcaacaaa agcctggttc tcctcctcaa tatcttctta
attataagtc tgattctgat 600aagcaacaag gttctggtgt tccttctaga
ttttctggtt ctaaggatgc ttctgctaat 660gctggtgttc ttcttatttc
tggtcttaga tctgaagatg aagctgatta ttattgtatg 720atttggcatt
cttctgctgc tgtttttggt ggtggtactc aacttactgt tcttggtgga
780ggtggatctg gtggaggtgg atcaggtgga ggtggttctg tgaccccttt
gtctttgggt 840attgaaacta aaggaggttt tatgactaga cttattgaac
gtaataccac tattcctacg 900aagagatcag agacatttac tactgctgat
gacaatcaac ctagtgttca gatccaagtg 960tatcaaggag agagggaaat
tgctgcacat aataagttgc ttggctcatt tgaacttact 1020ggaattccac
ctgctcctag aggtattcca caaatagaag tgacatttga cattgacgca
1080aatgggatag ttcatgtgac tgctaaggat aaaggaactg gtaaagagaa
tactattcgt 1140attcaggaag gtagtggact gtctaaggaa gatattgaca
gaatgataaa ggacgcagaa 12003401PRTArtificialfusion protein 3Gln Val
Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20
25 30 Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu
Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn
Asp Tyr Ala 50 55 60 Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro
Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val
Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met
Met Thr Tyr Tyr Tyr Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr
Thr Val Thr Val Ser Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro
Val Leu Thr Gln Ser Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150
155 160 Ala Ser Leu Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro
Tyr 165 170 175 Arg Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro
Gln Tyr Leu 180 185 190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln
Gly Ser Gly Val Pro 195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala
Ser Ala Asn Ala Gly Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser
Glu Asp Glu Ala Asp Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser
Ser Ala Ala Val Phe Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 260 265 270
Ser Val Thr Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly Gly Phe Met 275
280 285 Thr Arg Leu Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys Arg Ser
Glu 290 295 300 Thr Phe Thr Thr Ala Asp Asp Asn Gln Pro Ser Val Gln
Ile Gln Val 305 310 315 320 Tyr Gln Gly Glu Arg Glu Ile Ala Ala His
Asn Lys Leu Leu Gly Ser 325 330 335 Phe Glu Leu Thr Gly Ile Pro Pro
Ala Pro Arg Gly Ile Pro Gln Ile 340 345 350 Glu Val Thr Phe Asp Ile
Asp Ala Asn Gly Ile Val His Val Thr Ala 355 360 365 Lys Asp Lys Gly
Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu Gly 370 375 380 Ser Gly
Leu Ser Lys Glu Asp Ile Asp Arg Met Ile Lys Asp Ala Glu 385 390 395
400 Ala 41200DNAArtificialencodes fusion protein 4caagttcaac
ttcaacaatc tggtcctggt cttgttactc cttctcaaac tctttctctt 60acttgtgcta
tttctggtga ttctgtttct tctaattctg ctacttggaa ttggattaga
120caatctcctt ctagaggtct tgaatggctt ggtagaactt attatagatc
taagtggtat 180aatgattatg ctgtttctgt taagtctaga atgtctatta
atcctgatac ttctaagaat 240caattttctc ttcaacttaa ttctgttact
cctgaagata ctgctgttta ttattgtgct 300agaggtatga tgacttatta
ttatggtatg gatgtttggg gtcaaggtac tactgttact 360gtttcttctg
gtattcttgg ttctggtgga ggtggatctg gtggaggtgg atcaggtgga
420ggtggttctc aacctgttct tactcaatct tcttctcttt ctgcttctcc
tggtgcttct 480gcttctctta cttgtactct tagatctggt attaatgttg
gtccttatag aatttattgg 540tatcaacaaa agcctggttc tcctcctcaa
tatcttctta attataagtc tgattctgat 600aagcaacaag gttctggtgt
tccttctaga ttttctggtt ctaaggatgc ttctgctaat 660gctggtgttc
ttcttatttc tggtcttaga tctgaagatg aagctgatta ttattgtatg
720atttggcatt cttctgctgc tgtttttggt ggtggtactc aacttactgt
tcttggtgga 780ggtggatctg gtggaggtgg atcaggtgga ggtggttctg
tgaccccttt gtctttgggt 840attgaaacta aaggaggttt tatgactaga
cttattgaac gtaataccac tattcctacg 900aagagatcag agacatttac
tactgctgat gacaatcaac ctagtgttca gatccaagtg 960tatcaaggag
agagggaaat tactaaggag aataatcttc ttggtagatt tgaattgtct
1020ggtattccac ctgctcctag aggtattcca caaatagaag tgacatttga
cattgacgca 1080aatgggatag ttcatgtgac tgctaaggat aaaggaactg
gtaaagagaa tactattcgt 1140attcaggaag gtagtggact gtctaaggaa
gatattgaca gaatgataaa ggacgcagaa 12005401PRTArtificialfusion
protein 5Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Thr Pro
Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser
Val Ser Ser Asn 20 25 30 Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser
Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg
Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Val Ser Val Lys Ser Arg
Met Ser Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu
Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr
Cys Ala Arg Gly Met Met Thr Tyr Tyr Tyr Gly Met Asp Val 100 105 110
Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Ile Leu Gly Ser 115
120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gln 130 135 140 Pro Val Leu Thr Gln Ser Ser Ser Leu Ser Ala Ser Pro
Gly Ala Ser 145 150 155 160 Ala Ser Leu Thr Cys Thr Leu Arg Ser Gly
Ile Asn Val Gly Pro Tyr 165 170 175 Arg Ile Tyr Trp Tyr Gln Gln Lys
Pro Gly Ser Pro Pro Gln Tyr Leu 180 185 190 Leu Asn Tyr Lys Ser Asp
Ser Asp Lys Gln Gln Gly Ser Gly Val Pro 195 200 205 Ser Arg Phe Ser
Gly Ser Lys Asp Ala Ser Ala Asn Ala Gly Val Leu 210 215 220 Leu Ile
Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Met 225 230 235
240 Ile Trp His Ser Ser Ala Ala Val Phe Gly Gly Gly Thr Gln Leu Thr
245 250 255 Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly 260 265 270 Ser Val Thr Pro Leu Ser Leu Gly Ile Glu Thr Lys
Gly Gly Phe Met 275 280 285 Thr Arg Leu Ile Glu Arg Asn Thr Thr Ile
Pro Thr Lys Arg Ser Glu 290 295 300 Thr Phe Thr Thr Ala Asp Asp Asn
Gln Pro Ser Val Gln Ile Gln Val 305 310 315 320 Tyr Gln Gly Glu Arg
Glu Ile Thr Lys Glu Asn Asn Leu Leu Gly Arg 325 330 335 Phe Glu Leu
Ser Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile 340 345 350 Glu
Val Thr Phe Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala 355 360
365 Lys Asp Lys Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu Gly
370 375 380 Ser Gly Leu Ser Lys Glu Asp Ile Asp Arg Met Ile Lys Asp
Ala Glu 385 390 395 400 Ala 61200DNAArtificialencodes fusion
protein 6caagttcaac ttcaacaatc tggtcctggt cttgttactc cttctcaaac
tctttctctt 60acttgtgcta tttctggtga ttctgtttct tctaattctg ctacttggaa
ttggattaga 120caatctcctt ctagaggtct tgaatggctt ggtagaactt
attatagatc taagtggtat 180aatgattatg ctgtttctgt taagtctaga
atgtctatta atcctgatac ttctaagaat 240caattttctc ttcaacttaa
ttctgttact cctgaagata ctgctgttta ttattgtgct 300agaggtatga
tgacttatta ttatggtatg gatgtttggg gtcaaggtac tactgttact
360gtttcttctg gtattcttgg ttctggtgga ggtggatctg gtggaggtgg
atcaggtgga 420ggtggttctc aacctgttct tactcaatct tcttctcttt
ctgcttctcc tggtgcttct 480gcttctctta cttgtactct tagatctggt
attaatgttg gtccttatag aatttattgg 540tatcaacaaa agcctggttc
tcctcctcaa tatcttctta attataagtc tgattctgat 600aagcaacaag
gttctggtgt tccttctaga ttttctggtt ctaaggatgc ttctgctaat
660gctggtgttc ttcttatttc tggtcttaga tctgaagatg aagctgatta
ttattgtatg 720atttggcatt cttctgctgc tgtttttggt ggtggtactc
aacttactgt tcttggtgga 780ggtggatctg gtggaggtgg atcaggtgga
ggtggttctg tgaccccttt gtctttgggt 840attgaaacta aaggaggttt
tatgactaga cttattgaac gtaataccac tattcctacg 900aagagatcag
agacatttac tactgctgat gacaatcaac ctagtgttca gatccaagtg
960tatcaaggag agagggaaat tactaaggat aataatcttc ttggtagatt
tgaactttct 1020ggtattccac ctgctcctag aggtattcca caaatagaag
tgacatttga cattgacgca 1080aatgggatag ttcatgtgac tgctaaggat
aaaggaactg gtaaagagaa tactattcgt 1140attcaggaag gtagtggact
gtctaaggaa gatattgaca gaatgataaa ggacgcagaa
12007401PRTArtificialfusion protein 7Gln Val Gln Leu Gln Gln Ser
Gly Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr
Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr
Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp
Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55
60 Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr Ser Lys Asn
65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr
Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr Tyr
Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val Thr Val Ser
Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu Thr Gln Ser
Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160 Ala Ser Leu
Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165 170 175 Arg
Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr Leu 180 185
190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser Gly Val Pro
195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala Asn Ala Gly
Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp
Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala Ala Val Phe
Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly 260 265 270 Ser Val Thr Pro Leu
Ser Leu Gly Ile Glu Thr Lys Gly Gly Phe Met 275 280 285 Thr Arg Leu
Ile Glu Arg Asn Thr
Thr Ile Pro Thr Lys Arg Ser Glu 290 295 300 Thr Phe Thr Thr Ala Asp
Asp Asn Gln Pro Ser Val Gln Ile Gln Val 305 310 315 320 Tyr Gln Gly
Glu Arg Glu Ile Thr Lys Asp Asn Asn Leu Leu Gly Arg 325 330 335 Phe
Glu Leu Ser Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile 340 345
350 Glu Val Thr Phe Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala
355 360 365 Lys Asp Lys Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln
Glu Gly 370 375 380 Ser Gly Leu Ser Lys Glu Asp Ile Asp Arg Met Ile
Lys Asp Ala Glu 385 390 395 400 Ala 81209DNAArtificialencodes
fusion protein 8caagttcaac ttcaacaatc tggtcctggt cttgttactc
cttctcaaac tctttctctt 60acttgtgcta tttctggtga ttctgtttct tctaattctg
ctacttggaa ttggattaga 120caatctcctt ctagaggtct tgaatggctt
ggtagaactt attatagatc taagtggtat 180aatgattatg ctgtttctgt
taagtctaga atgtctatta atcctgatac ttctaagaat 240caattttctc
ttcaacttaa ttctgttact cctgaagata ctgctgttta ttattgtgct
300agaggtatga tgacttatta ttatggtatg gatgtttggg gtcaaggtac
tactgttact 360gtttcttctg gtattcttgg ttctggtgga ggtggatctg
gtggaggtgg atcaggtgga 420ggtggttctc aacctgttct tactcaatct
tcttctcttt ctgcttctcc tggtgcttct 480gcttctctta cttgtactct
tagatctggt attaatgttg gtccttatag aatttattgg 540tatcaacaaa
agcctggttc tcctcctcaa tatcttctta attataagtc tgattctgat
600aagcaacaag gttctggtgt tccttctaga ttttctggtt ctaaggatgc
ttctgctaat 660gctggtgttc ttcttatttc tggtcttaga tctgaagatg
aagctgatta ttattgtatg 720atttggcatt cttctgctgc tgtttttggt
ggtggtactc aacttactgt tcttggtgga 780tcttcaagat cttcaagttc
tggtggagga ggttctggtg gaggtggtgt gacccctttg 840tctttgggta
ttgaaactaa aggaggtttt atgactagac ttattgaacg taataccact
900attcctacga agagatcaga gacatttact actgctgatg acaatcaacc
tagtgttcag 960atccaagtgt atcaaggaga gagggaaatt actaaggaga
ataatcttct tggtagattt 1020gaattgtctg gtattccacc tgctcctaga
ggtattccac aaatagaagt gacatttgac 1080attgacgcaa atgggatagt
tcatgtgact gctaaggata aaggaactgg taaagagaat 1140actattcgta
ttcaggaagg tagtggactg tctaaggaag atattgacag aatgataaag
1200gacgcagaa 12099404PRTArtificialfusion protein 9Gln Val Gln Leu
Gln Gln Ser Gly Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu
Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30
Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35
40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr
Ala 50 55 60 Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr
Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro
Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr
Tyr Tyr Tyr Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val
Thr Val Ser Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu
Thr Gln Ser Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160
Ala Ser Leu Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165
170 175 Arg Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr
Leu 180 185 190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser
Gly Val Pro 195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala
Asn Ala Gly Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp
Glu Ala Asp Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala
Ala Val Phe Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu Gly Gly
Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 260 265 270 Gly Gly
Gly Gly Val Thr Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly 275 280 285
Gly Phe Met Thr Arg Leu Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys 290
295 300 Arg Ser Glu Thr Phe Thr Thr Ala Asp Asp Asn Gln Pro Ser Val
Gln 305 310 315 320 Ile Gln Val Tyr Gln Gly Glu Arg Glu Ile Thr Lys
Glu Asn Asn Leu 325 330 335 Leu Gly Arg Phe Glu Leu Ser Gly Ile Pro
Pro Ala Pro Arg Gly Ile 340 345 350 Pro Gln Ile Glu Val Thr Phe Asp
Ile Asp Ala Asn Gly Ile Val His 355 360 365 Val Thr Ala Lys Asp Lys
Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile 370 375 380 Gln Glu Gly Ser
Gly Leu Ser Lys Glu Asp Ile Asp Arg Met Ile Lys 385 390 395 400 Asp
Ala Glu Ala 101209DNAArtificialencodes fusion protein 10caagttcaac
ttcaacaatc tggtcctggt cttgttactc cttctcaaac tctttctctt 60acttgtgcta
tttctggtga ttctgtttct tctaattctg ctacttggaa ttggattaga
120caatctcctt ctagaggtct tgaatggctt ggtagaactt attatagatc
taagtggtat 180aatgattatg ctgtttctgt taagtctaga atgtctatta
atcctgatac ttctaagaat 240caattttctc ttcaacttaa ttctgttact
cctgaagata ctgctgttta ttattgtgct 300agaggtatga tgacttatta
ttatggtatg gatgtttggg gtcaaggtac tactgttact 360gtttcttctg
gtattcttgg ttctggtgga ggtggatctg gtggaggtgg atcaggtgga
420ggtggttctc aacctgttct tactcaatct tcttctcttt ctgcttctcc
tggtgcttct 480gcttctctta cttgtactct tagatctggt attaatgttg
gtccttatag aatttattgg 540tatcaacaaa agcctggttc tcctcctcaa
tatcttctta attataagtc tgattctgat 600aagcaacaag gttctggtgt
tccttctaga ttttctggtt ctaaggatgc ttctgctaat 660gctggtgttc
ttcttatttc tggtcttaga tctgaagatg aagctgatta ttattgtatg
720atttggcatt cttctgctgc tgtttttggt ggtggtactc aacttactgt
tcttggtgga 780tcttcagaat cttcaagttc tggtggagga ggttctggtg
gaggtggtgt gacccctttg 840tctttgggta ttgaaactaa aggaggtttt
atgactagac ttattgaacg taataccact 900attcctacga agagatcaga
gacatttact actgctgatg acaatcaacc tagtgttcag 960atccaagtgt
atcaaggaga gagggaaatt actaaggaga ataatcttct tggtagattt
1020gaattgtctg gtattccacc tgctcctaga ggtattccac aaatagaagt
gacatttgac 1080attgacgcaa atgggatagt tcatgtgact gctaaggata
aaggaactgg taaagagaat 1140actattcgta ttcaggaagg tagtggactg
tctaaggaag atattgacag aatgataaag 1200gacgcagaa
120911404PRTArtificialfusion protein 11Gln Val Gln Leu Gln Gln Ser
Gly Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr
Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr
Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp
Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55
60 Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr Ser Lys Asn
65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr
Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr Tyr
Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val Thr Val Ser
Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu Thr Gln Ser
Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160 Ala Ser Leu
Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165 170 175 Arg
Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr Leu 180 185
190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser Gly Val Pro
195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala Asn Ala Gly
Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp
Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala Ala Val Phe
Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu Gly Gly Ser Ser Glu
Ser Ser Ser Ser Gly Gly Gly Gly Ser 260 265 270 Gly Gly Gly Gly Val
Thr Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly 275 280 285 Gly Phe Met
Thr Arg Leu Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys 290 295 300 Arg
Ser Glu Thr Phe Thr Thr Ala Asp Asp Asn Gln Pro Ser Val Gln 305 310
315 320 Ile Gln Val Tyr Gln Gly Glu Arg Glu Ile Thr Lys Glu Asn Asn
Leu 325 330 335 Leu Gly Arg Phe Glu Leu Ser Gly Ile Pro Pro Ala Pro
Arg Gly Ile 340 345 350 Pro Gln Ile Glu Val Thr Phe Asp Ile Asp Ala
Asn Gly Ile Val His 355 360 365 Val Thr Ala Lys Asp Lys Gly Thr Gly
Lys Glu Asn Thr Ile Arg Ile 370 375 380 Gln Glu Gly Ser Gly Leu Ser
Lys Glu Asp Ile Asp Arg Met Ile Lys 385 390 395 400 Asp Ala Glu Ala
12771PRTArtificialfusion protein 12Gln Val Gln Leu Gln Gln Ser Gly
Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys
Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr Trp
Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu
Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60
Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr Ser Lys Asn 65
70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr
Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr Tyr
Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val Thr Val Ser
Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu Thr Gln Ser
Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160 Ala Ser Leu
Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165 170 175 Arg
Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr Leu 180 185
190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser Gly Val Pro
195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala Asn Ala Gly
Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp
Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala Ala Val Phe
Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu Gly Gly Ser Ser Arg
Ser Ser Ser Ser Gly Gly Gly Gly Ser 260 265 270 Gly Gly Gly Gly Met
Ala Arg Ala Val Gly Ile Asp Leu Gly Thr Thr 275 280 285 Asn Ser Val
Val Ser Val Leu Glu Gly Gly Asp Pro Val Val Val Ala 290 295 300 Asn
Ser Glu Gly Ser Arg Thr Thr Pro Ser Ile Val Ala Phe Ala Arg 305 310
315 320 Asn Gly Glu Val Leu Val Gly Gln Pro Ala Lys Asn Gln Ala Val
Thr 325 330 335 Asn Val Asp Arg Thr Val Arg Ser Val Lys Arg His Met
Gly Ser Asp 340 345 350 Trp Ser Ile Glu Ile Asp Gly Lys Lys Tyr Thr
Ala Pro Glu Ile Ser 355 360 365 Ala Arg Ile Leu Met Lys Leu Lys Arg
Asp Ala Glu Ala Tyr Leu Gly 370 375 380 Glu Asp Ile Thr Asp Ala Val
Ile Thr Thr Pro Ala Tyr Phe Asn Asp 385 390 395 400 Ala Gln Arg Gln
Ala Thr Lys Asp Ala Gly Gln Ile Ala Gly Leu Asn 405 410 415 Val Leu
Arg Ile Val Asn Glu Pro Thr Ala Ala Ala Leu Ala Tyr Gly 420 425 430
Leu Asp Lys Gly Glu Lys Glu Gln Arg Ile Leu Val Phe Asp Leu Gly 435
440 445 Gly Gly Thr Phe Asp Val Ser Leu Leu Glu Ile Gly Glu Gly Val
Val 450 455 460 Glu Val Arg Ala Thr Ser Gly Asp Asn His Leu Gly Gly
Asp Asp Trp 465 470 475 480 Asp Gln Arg Val Val Asp Trp Leu Val Asp
Lys Phe Lys Gly Thr Ser 485 490 495 Gly Ile Asp Leu Thr Lys Asp Lys
Met Ala Met Gln Arg Leu Arg Glu 500 505 510 Ala Ala Glu Lys Ala Lys
Ile Glu Leu Ser Ser Ser Gln Ser Thr Ser 515 520 525 Ile Asn Leu Pro
Tyr Ile Thr Val Asp Ala Asp Lys Asn Pro Leu Phe 530 535 540 Leu Asp
Glu Gln Leu Thr Arg Ala Glu Phe Gln Arg Ile Thr Gln Asp 545 550 555
560 Leu Leu Asp Arg Thr Arg Lys Pro Phe Gln Ser Val Ile Ala Asp Thr
565 570 575 Gly Ile Ser Val Ser Glu Ile Asp His Val Val Leu Val Gly
Gly Ser 580 585 590 Thr Ala Met Pro Ala Val Thr Asp Leu Val Lys Glu
Leu Thr Gly Gly 595 600 605 Lys Glu Pro Asn Lys Gly Val Asn Pro Asp
Glu Val Val Ala Val Gly 610 615 620 Ala Ala Leu Gln Ala Gly Val Leu
Lys Gly Glu Val Lys Asp Val Leu 625 630 635 640 Leu Leu Asp Val Thr
Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly Gly 645 650 655 Phe Met Thr
Arg Leu Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys Arg 660 665 670 Ser
Glu Thr Phe Thr Thr Ala Asp Asp Asn Gln Pro Ser Val Gln Ile 675 680
685 Gln Val Tyr Gln Gly Glu Arg Glu Ile Thr Lys Glu Asn Asn Leu Leu
690 695 700 Gly Arg Phe Glu Leu Ser Gly Ile Pro Pro Ala Pro Arg Gly
Ile Pro 705 710 715 720 Gln Ile Glu Val Thr Phe Asp Ile Asp Ala Asn
Gly Ile Val His Val 725 730 735 Thr Ala Lys Asp Lys Gly Thr Gly Lys
Glu Asn Thr Ile Arg Ile Gln 740 745 750 Glu Gly Ser Gly Leu Ser Lys
Glu Asp Ile Asp Arg Met Ile Lys Asp 755 760 765 Ala Glu Ala 770
13771PRTArtificialfusion protein 13Gln Val Gln Leu Gln Gln Ser Gly
Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys
Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr Trp
Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu
Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60
Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr Ser Lys Asn 65
70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr
Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr Tyr
Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val Thr Val Ser
Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu Thr Gln Ser
Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160 Ala Ser Leu
Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165 170 175 Arg
Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr Leu 180 185
190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser Gly Val Pro
195
200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala Asn Ala Gly Val
Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr
Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala Ala Val Phe Gly
Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu Gly Gly Ser Ser Glu Ser
Ser Ser Ser Gly Gly Gly Gly Ser 260 265 270 Gly Gly Gly Gly Met Ala
Arg Ala Val Gly Ile Asp Leu Gly Thr Thr 275 280 285 Asn Ser Val Val
Ser Val Leu Glu Gly Gly Asp Pro Val Val Val Ala 290 295 300 Asn Ser
Glu Gly Ser Arg Thr Thr Pro Ser Ile Val Ala Phe Ala Arg 305 310 315
320 Asn Gly Glu Val Leu Val Gly Gln Pro Ala Lys Asn Gln Ala Val Thr
325 330 335 Asn Val Asp Arg Thr Val Arg Ser Val Lys Arg His Met Gly
Ser Asp 340 345 350 Trp Ser Ile Glu Ile Asp Gly Lys Lys Tyr Thr Ala
Pro Glu Ile Ser 355 360 365 Ala Arg Ile Leu Met Lys Leu Lys Arg Asp
Ala Glu Ala Tyr Leu Gly 370 375 380 Glu Asp Ile Thr Asp Ala Val Ile
Thr Thr Pro Ala Tyr Phe Asn Asp 385 390 395 400 Ala Gln Arg Gln Ala
Thr Lys Asp Ala Gly Gln Ile Ala Gly Leu Asn 405 410 415 Val Leu Arg
Ile Val Asn Glu Pro Thr Ala Ala Ala Leu Ala Tyr Gly 420 425 430 Leu
Asp Lys Gly Glu Lys Glu Gln Arg Ile Leu Val Phe Asp Leu Gly 435 440
445 Gly Gly Thr Phe Asp Val Ser Leu Leu Glu Ile Gly Glu Gly Val Val
450 455 460 Glu Val Arg Ala Thr Ser Gly Asp Asn His Leu Gly Gly Asp
Asp Trp 465 470 475 480 Asp Gln Arg Val Val Asp Trp Leu Val Asp Lys
Phe Lys Gly Thr Ser 485 490 495 Gly Ile Asp Leu Thr Lys Asp Lys Met
Ala Met Gln Arg Leu Arg Glu 500 505 510 Ala Ala Glu Lys Ala Lys Ile
Glu Leu Ser Ser Ser Gln Ser Thr Ser 515 520 525 Ile Asn Leu Pro Tyr
Ile Thr Val Asp Ala Asp Lys Asn Pro Leu Phe 530 535 540 Leu Asp Glu
Gln Leu Thr Arg Ala Glu Phe Gln Arg Ile Thr Gln Asp 545 550 555 560
Leu Leu Asp Arg Thr Arg Lys Pro Phe Gln Ser Val Ile Ala Asp Thr 565
570 575 Gly Ile Ser Val Ser Glu Ile Asp His Val Val Leu Val Gly Gly
Ser 580 585 590 Thr Ala Met Pro Ala Val Thr Asp Leu Val Lys Glu Leu
Thr Gly Gly 595 600 605 Lys Glu Pro Asn Lys Gly Val Asn Pro Asp Glu
Val Val Ala Val Gly 610 615 620 Ala Ala Leu Gln Ala Gly Val Leu Lys
Gly Glu Val Lys Asp Val Leu 625 630 635 640 Leu Leu Asp Val Thr Pro
Leu Ser Leu Gly Ile Glu Thr Lys Gly Gly 645 650 655 Phe Met Thr Arg
Leu Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys Arg 660 665 670 Ser Glu
Thr Phe Thr Thr Ala Asp Asp Asn Gln Pro Ser Val Gln Ile 675 680 685
Gln Val Tyr Gln Gly Glu Arg Glu Ile Thr Lys Glu Asn Asn Leu Leu 690
695 700 Gly Arg Phe Glu Leu Ser Gly Ile Pro Pro Ala Pro Arg Gly Ile
Pro 705 710 715 720 Gln Ile Glu Val Thr Phe Asp Ile Asp Ala Asn Gly
Ile Val His Val 725 730 735 Thr Ala Lys Asp Lys Gly Thr Gly Lys Glu
Asn Thr Ile Arg Ile Gln 740 745 750 Glu Gly Ser Gly Leu Ser Lys Glu
Asp Ile Asp Arg Met Ile Lys Asp 755 760 765 Ala Glu Ala 770
144PRTMycobacterium tuberculosis 14Lys Asp Glu Leu 1
1514PRTMycobacterium tuberculosis 15Ala Ala His Asn Lys Leu Leu Gly
Ser Phe Glu Leu Thr Gly 1 5 10 1614PRTArtificialmodified CD94
domain 16Ala Ala His Asn Asn Leu Leu Gly Ser Phe Glu Leu Thr Gly 1
5 10 1714PRTArtificialmodified CD94 domain 17Ala Ala His Asn Asn
Leu Leu Gly Arg Phe Glu Leu Thr Gly 1 5 10
1814PRTArtificialmodified CD94 domain 18Ala Ala His Asn Asn Leu Leu
Gly Arg Phe Glu Leu Ser Gly 1 5 10 1914PRTArtificialmodified CD94
domain 19Thr Lys Glu Asn Asn Leu Leu Gly Arg Phe Glu Leu Ser Gly 1
5 10 2014PRTArtificialmodified CD94 domain 20Thr Arg Asp Asn Asn
Leu Leu Gly Arg Phe Glu Leu Ser Gly 1 5 10 217PRTArtificiallinker
21Gly Gly Ser Ser Arg Ser Ser 1 5 2228PRTArtificiallinker 22Gly Gly
Gly Ser Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly 1 5 10 15
Gly Ser Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly 20 25
2315PRTArtificiallinker 23Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser 1 5 10 15 2418PRTArtificiallinker 24Gly Gly Ser
Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly Gly 1 5 10 15 Gly
Gly 2518PRTArtificiallinker 25Gly Gly Ser Ser Glu Ser Ser Ser Ser
Gly Gly Gly Gly Ser Gly Gly 1 5 10 15 Gly Gly
26625PRTArtificialfusion protein 26Met Ala Arg Ala Val Gly Ile Asp
Leu Gly Thr Thr Asn Ser Val Val 1 5 10 15 Ser Val Leu Glu Gly Gly
Asp Pro Val Val Val Ala Asn Ser Glu Gly 20 25 30 Ser Arg Thr Thr
Pro Ser Ile Val Ala Phe Ala Arg Asn Gly Glu Val 35 40 45 Leu Val
Gly Gln Pro Ala Lys Asn Gln Ala Val Thr Asn Val Asp Arg 50 55 60
Thr Val Arg Ser Val Lys Arg His Met Gly Ser Asp Trp Ser Ile Glu 65
70 75 80 Ile Asp Gly Lys Lys Tyr Thr Ala Pro Glu Ile Ser Ala Arg
Ile Leu 85 90 95 Met Lys Leu Lys Arg Asp Ala Glu Ala Tyr Leu Gly
Glu Asp Ile Thr 100 105 110 Asp Ala Val Ile Thr Thr Pro Ala Tyr Phe
Asn Asp Ala Gln Arg Gln 115 120 125 Ala Thr Lys Asp Ala Gly Gln Ile
Ala Gly Leu Asn Val Leu Arg Ile 130 135 140 Val Asn Glu Pro Thr Ala
Ala Ala Leu Ala Tyr Gly Leu Asp Lys Gly 145 150 155 160 Glu Lys Glu
Gln Arg Ile Leu Val Phe Asp Leu Gly Gly Gly Thr Phe 165 170 175 Asp
Val Ser Leu Leu Glu Ile Gly Glu Gly Val Val Glu Val Arg Ala 180 185
190 Thr Ser Gly Asp Asn His Leu Gly Gly Asp Asp Trp Asp Gln Arg Val
195 200 205 Val Asp Trp Leu Val Asp Lys Phe Lys Gly Thr Ser Gly Ile
Asp Leu 210 215 220 Thr Lys Asp Lys Met Ala Met Gln Arg Leu Arg Glu
Ala Ala Glu Lys 225 230 235 240 Ala Lys Ile Glu Leu Ser Ser Ser Gln
Ser Thr Ser Ile Asn Leu Pro 245 250 255 Tyr Ile Thr Val Asp Ala Asp
Lys Asn Pro Leu Phe Leu Asp Glu Gln 260 265 270 Leu Thr Arg Ala Glu
Phe Gln Arg Ile Thr Gln Asp Leu Leu Asp Arg 275 280 285 Thr Arg Lys
Pro Phe Gln Ser Val Ile Ala Asp Thr Gly Ile Ser Val 290 295 300 Ser
Glu Ile Asp His Val Val Leu Val Gly Gly Ser Thr Arg Met Pro 305 310
315 320 Ala Val Thr Asp Leu Val Lys Glu Leu Thr Gly Gly Lys Glu Pro
Asn 325 330 335 Lys Gly Val Asn Pro Asp Glu Val Val Ala Val Gly Ala
Ala Leu Gln 340 345 350 Ala Gly Val Leu Lys Gly Glu Val Lys Asp Val
Leu Leu Leu Asp Val 355 360 365 Thr Pro Leu Ser Leu Gly Ile Glu Thr
Lys Gly Gly Phe Met Thr Arg 370 375 380 Leu Ile Glu Arg Asn Thr Thr
Ile Pro Thr Lys Arg Ser Glu Thr Phe 385 390 395 400 Thr Thr Ala Asp
Asp Asn Gln Pro Ser Val Gln Ile Gln Val Tyr Gln 405 410 415 Gly Glu
Arg Glu Ile Ala Ala His Asn Lys Leu Leu Gly Ser Phe Glu 420 425 430
Leu Thr Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile Glu Val 435
440 445 Thr Phe Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala Lys
Asp 450 455 460 Lys Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu
Gly Ser Gly 465 470 475 480 Leu Ser Lys Glu Asp Ile Asp Arg Met Ile
Lys Asp Ala Glu Ala His 485 490 495 Ala Glu Glu Asp Arg Lys Arg Arg
Glu Glu Ala Asp Val Arg Asn Gln 500 505 510 Ala Glu Thr Leu Val Tyr
Gln Thr Glu Lys Phe Val Lys Glu Gln Arg 515 520 525 Glu Ala Glu Gly
Gly Ser Lys Val Pro Glu Asp Thr Leu Asn Lys Val 530 535 540 Asp Ala
Ala Val Ala Glu Ala Lys Ala Ala Leu Gly Gly Ser Asp Ile 545 550 555
560 Ser Ala Ile Lys Ser Ala Met Glu Lys Leu Gly Gln Glu Ser Gln Ala
565 570 575 Leu Gly Gln Ala Ile Tyr Glu Ala Ala Gln Ala Ala Ser Gln
Ala Thr 580 585 590 Gly Ala Ala His Pro Gly Gly Glu Pro Gly Gly Ala
His Pro Gly Ser 595 600 605 Ala Asp Asp Val Val Asp Ala Glu Val Val
Asp Asp Gly Arg Glu Ala 610 615 620 Lys 625
27898PRTArtificialfusion protein 27Gln Val Gln Leu Gln Gln Ser Gly
Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys
Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr Trp
Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu
Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60
Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr Ser Lys Asn 65
70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr
Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr Tyr
Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val Thr Val Ser
Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu Thr Gln Ser
Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160 Ala Ser Leu
Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165 170 175 Arg
Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr Leu 180 185
190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser Gly Val Pro
195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala Asn Ala Gly
Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp
Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala Ala Val Phe
Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly 260 265 270 Ser Met Ala Arg Ala
Val Gly Ile Asp Leu Gly Thr Thr Asn Ser Val 275 280 285 Val Ser Val
Leu Glu Gly Gly Asp Pro Val Val Val Ala Asn Ser Glu 290 295 300 Gly
Ser Arg Thr Thr Pro Ser Ile Val Ala Phe Ala Arg Asn Gly Glu 305 310
315 320 Val Leu Val Gly Gln Pro Ala Lys Asn Gln Ala Val Thr Asn Val
Asp 325 330 335 Arg Thr Val Arg Ser Val Lys Arg His Met Gly Ser Asp
Trp Ser Ile 340 345 350 Glu Ile Asp Gly Lys Lys Tyr Thr Ala Pro Glu
Ile Ser Ala Arg Ile 355 360 365 Leu Met Lys Leu Lys Arg Asp Ala Glu
Ala Tyr Leu Gly Glu Asp Ile 370 375 380 Thr Asp Ala Val Ile Thr Thr
Pro Ala Tyr Phe Asn Asp Ala Gln Arg 385 390 395 400 Gln Ala Thr Lys
Asp Ala Gly Gln Ile Ala Gly Leu Asn Val Leu Arg 405 410 415 Ile Val
Asn Glu Pro Thr Ala Ala Ala Leu Ala Tyr Gly Leu Asp Lys 420 425 430
Gly Glu Lys Glu Gln Arg Ile Leu Val Phe Asp Leu Gly Gly Gly Thr 435
440 445 Phe Asp Val Ser Leu Leu Glu Ile Gly Glu Gly Val Val Glu Val
Arg 450 455 460 Ala Thr Ser Gly Asp Asn His Leu Gly Gly Asp Asp Trp
Asp Gln Arg 465 470 475 480 Val Val Asp Trp Leu Val Asp Lys Phe Lys
Gly Thr Ser Gly Ile Asp 485 490 495 Leu Thr Lys Asp Lys Met Ala Met
Gln Arg Leu Arg Glu Ala Ala Glu 500 505 510 Lys Ala Lys Ile Glu Leu
Ser Ser Ser Gln Ser Thr Ser Ile Asn Leu 515 520 525 Pro Tyr Ile Thr
Val Asp Ala Asp Lys Asn Pro Leu Phe Leu Asp Glu 530 535 540 Gln Leu
Thr Arg Ala Glu Phe Gln Arg Ile Thr Gln Asp Leu Leu Asp 545 550 555
560 Arg Thr Arg Lys Pro Phe Gln Ser Val Ile Ala Asp Thr Gly Ile Ser
565 570 575 Val Ser Glu Ile Asp His Val Val Leu Val Gly Gly Ser Thr
Arg Met 580 585 590 Pro Ala Val Thr Asp Leu Val Lys Glu Leu Thr Gly
Gly Lys Glu Pro 595 600 605 Asn Lys Gly Val Asn Pro Asp Glu Val Val
Ala Val Gly Ala Ala Leu 610 615 620 Gln Ala Gly Val Leu Lys Gly Glu
Val Lys Asp Val Leu Leu Leu Asp 625 630 635 640 Val Thr Pro Leu Ser
Leu Gly Ile Glu Thr Lys Gly Gly Phe Met Thr 645 650 655 Arg Leu Ile
Glu Arg Asn Thr Thr Ile Pro Thr Lys Arg Ser Glu Thr 660 665 670 Phe
Thr Thr Ala Asp Asp Asn Gln Pro Ser Val Gln Ile Gln Val Tyr 675 680
685 Gln Gly Glu Arg Glu Ile Ala Ala His Asn Lys Leu Leu Gly Ser Phe
690 695 700 Glu Leu Thr Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln
Ile Glu 705 710 715 720 Val Thr Phe Asp Ile Asp Ala Asn Gly Ile Val
His Val Thr Ala Lys 725 730 735 Asp Lys Gly Thr Gly Lys Glu Asn Thr
Ile Arg Ile Gln Glu Gly Ser 740 745 750 Gly Leu Ser Lys Glu Asp Ile
Asp Arg Met Ile Lys Asp Ala Glu Ala 755 760 765 His Ala Glu Glu Asp
Arg Lys Arg Arg Glu Glu Ala Asp Val Arg Asn 770 775 780 Gln Ala Glu
Thr Leu Val Tyr Gln Thr Glu Lys Phe Val Lys Glu Gln 785 790 795 800
Arg Glu Ala Glu Gly Gly Ser Lys Val Pro Glu Asp Thr Leu Asn Lys 805
810 815 Val Asp Ala Ala Val Ala Glu Ala Lys Ala Ala Leu Gly Gly Ser
Asp 820 825 830 Ile Ser Ala Ile Lys Ser Ala Met Glu Lys Leu Gly Gln
Glu Ser Gln 835 840 845 Ala Leu Gly Gln Ala Ile Tyr Glu Ala Ala Gln
Ala Ala Ser Gln Ala 850 855 860 Thr Gly Ala Ala His Pro Gly Gly Glu
Pro Gly Gly Ala His Pro Gly 865 870
875 880 Ser Ala Asp Asp Val Val Asp Ala Glu Val Val Asp Asp Gly Arg
Glu 885 890 895 Ala Lys 28915PRTArtificialfusion protein 28Gly Ser
Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Thr 1 5 10 15
Pro Ser Gln Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val 20
25 30 Ser Ser Asn Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser Pro Ser
Arg 35 40 45 Gly Leu Glu Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys
Trp Tyr Asn 50 55 60 Asp Tyr Ala Val Ser Val Lys Ser Arg Met Ser
Ile Asn Pro Asp Thr 65 70 75 80 Ser Lys Asn Gln Phe Ser Leu Gln Leu
Asn Ser Val Thr Pro Glu Asp 85 90 95 Thr Ala Val Tyr Tyr Cys Ala
Arg Gly Met Met Thr Tyr Tyr Tyr Gly 100 105 110 Met Asp Val Trp Gly
Gln Gly Thr Thr Val Thr Val Ser Ser Gly Ile 115 120 125 Leu Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 130 135 140 Gly
Ser Gln Pro Val Leu Thr Gln Ser Ser Ser Leu Ser Ala Ser Pro 145 150
155 160 Gly Ala Ser Ala Ser Leu Thr Cys Thr Leu Arg Ser Gly Ile Asn
Val 165 170 175 Gly Pro Tyr Arg Ile Tyr Trp Tyr Gln Gln Lys Pro Gly
Ser Pro Pro 180 185 190 Gln Tyr Leu Leu Asn Tyr Lys Ser Asp Ser Asp
Lys Gln Gln Gly Ser 195 200 205 Gly Val Pro Ser Arg Phe Ser Gly Ser
Lys Asp Ala Ser Ala Asn Ala 210 215 220 Gly Val Leu Leu Ile Ser Gly
Leu Arg Ser Glu Asp Glu Ala Asp Tyr 225 230 235 240 Tyr Cys Met Ile
Trp His Ser Ser Ala Ala Val Phe Gly Gly Gly Thr 245 250 255 Gln Leu
Thr Val Leu Ser Gly Ile Leu Glu Gln Gln Gly Gly Gly Gly 260 265 270
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Ala Ala Met 275
280 285 Arg Ser Met Ala Arg Ala Val Gly Ile Asp Leu Gly Thr Thr Asn
Ser 290 295 300 Val Val Ser Val Leu Glu Gly Gly Asp Pro Val Val Val
Ala Asn Ser 305 310 315 320 Glu Gly Ser Arg Thr Thr Pro Ser Ile Val
Ala Phe Ala Arg Asn Gly 325 330 335 Glu Val Leu Val Gly Gln Pro Ala
Lys Asn Gln Ala Val Thr Asn Val 340 345 350 Asp Arg Thr Val Arg Ser
Val Lys Arg His Met Gly Ser Asp Trp Ser 355 360 365 Ile Glu Ile Asp
Gly Lys Lys Tyr Thr Ala Pro Glu Ile Ser Ala Arg 370 375 380 Ile Leu
Met Lys Leu Lys Arg Asp Ala Glu Ala Tyr Leu Gly Glu Asp 385 390 395
400 Ile Thr Asp Ala Val Ile Thr Thr Pro Ala Tyr Phe Asn Asp Ala Gln
405 410 415 Arg Gln Ala Thr Lys Asp Ala Gly Gln Ile Ala Gly Leu Asn
Val Leu 420 425 430 Arg Ile Val Asn Glu Pro Thr Ala Ala Ala Leu Ala
Tyr Gly Leu Asp 435 440 445 Lys Gly Glu Lys Glu Gln Arg Ile Leu Val
Phe Asp Leu Gly Gly Gly 450 455 460 Thr Phe Asp Val Ser Leu Leu Glu
Ile Gly Glu Gly Val Val Glu Val 465 470 475 480 Arg Ala Thr Ser Gly
Asp Asn His Leu Gly Gly Asp Asp Trp Asp Gln 485 490 495 Arg Val Val
Asp Trp Leu Val Asp Lys Phe Lys Gly Thr Ser Gly Ile 500 505 510 Asp
Leu Thr Lys Asp Lys Met Ala Met Gln Arg Leu Arg Glu Ala Ala 515 520
525 Glu Lys Ala Lys Ile Glu Leu Ser Ser Ser Gln Ser Thr Ser Ile Asn
530 535 540 Leu Pro Tyr Ile Thr Val Asp Ala Asp Lys Asn Pro Leu Phe
Leu Asp 545 550 555 560 Glu Gln Leu Thr Arg Ala Glu Phe Gln Arg Ile
Thr Gln Asp Leu Leu 565 570 575 Asp Arg Thr Arg Lys Pro Phe Gln Ser
Val Ile Ala Asp Thr Gly Ile 580 585 590 Ser Val Ser Glu Ile Asp His
Val Val Leu Val Gly Gly Ser Thr Arg 595 600 605 Met Pro Ala Val Thr
Asp Leu Val Lys Glu Leu Thr Gly Gly Lys Glu 610 615 620 Pro Asn Lys
Gly Val Asn Pro Asp Glu Val Val Ala Val Gly Ala Ala 625 630 635 640
Leu Gln Ala Gly Val Leu Lys Gly Glu Val Lys Asp Val Leu Leu Leu 645
650 655 Asp Val Thr Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly Gly Phe
Met 660 665 670 Thr Arg Leu Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys
Arg Ser Glu 675 680 685 Thr Phe Thr Thr Ala Asp Asp Asn Gln Pro Ser
Val Gln Ile Gln Val 690 695 700 Tyr Gln Gly Glu Arg Glu Ile Ala Ala
His Asn Lys Leu Leu Gly Ser 705 710 715 720 Phe Glu Leu Thr Gly Ile
Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile 725 730 735 Glu Val Thr Phe
Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala 740 745 750 Lys Asp
Lys Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu Gly 755 760 765
Ser Gly Leu Ser Lys Glu Asp Ile Asp Arg Met Ile Lys Asp Ala Glu 770
775 780 Ala His Ala Glu Glu Asp Arg Lys Arg Arg Glu Glu Ala Asp Val
Arg 785 790 795 800 Asn Gln Ala Glu Thr Leu Val Tyr Gln Thr Glu Lys
Phe Val Lys Glu 805 810 815 Gln Arg Glu Ala Glu Gly Gly Ser Lys Val
Pro Glu Asp Thr Leu Asn 820 825 830 Lys Val Asp Ala Ala Val Ala Glu
Ala Lys Ala Ala Leu Gly Gly Ser 835 840 845 Asp Ile Ser Ala Ile Lys
Ser Ala Met Glu Lys Leu Gly Gln Glu Ser 850 855 860 Gln Ala Leu Gly
Gln Ala Ile Tyr Glu Ala Ala Gln Ala Ala Ser Gln 865 870 875 880 Ala
Thr Gly Ala Ala His Pro Gly Gly Glu Pro Gly Gly Ala His Pro 885 890
895 Gly Ser Ala Asp Asp Val Val Asp Ala Glu Val Val Asp Asp Gly Arg
900 905 910 Glu Ala Lys 915 29641PRTArtificialfusion protein 29Met
Ala Lys Ala Ala Ala Ile Gly Ile Asp Leu Gly Thr Thr Tyr Ser 1 5 10
15 Cys Val Gly Val Phe Gln His Gly Lys Val Glu Ile Ile Ala Asn Asp
20 25 30 Gln Gly Asn Arg Thr Thr Pro Ser Tyr Val Ala Phe Thr Asp
Thr Glu 35 40 45 Arg Leu Ile Gly Asp Ala Ala Lys Asn Gln Val Ala
Leu Asn Pro Gln 50 55 60 Asn Thr Val Phe Asp Ala Lys Arg Leu Ile
Gly Arg Lys Phe Gly Asp 65 70 75 80 Pro Val Val Gln Ser Asp Met Lys
His Trp Pro Phe Gln Val Ile Asn 85 90 95 Asp Gly Asp Lys Pro Lys
Val Gln Val Ser Tyr Lys Gly Asp Thr Lys 100 105 110 Ala Phe Tyr Pro
Glu Glu Ile Ser Ser Met Val Leu Thr Lys Met Lys 115 120 125 Glu Ile
Ala Glu Ala Tyr Leu Gly Tyr Pro Val Thr Asn Ala Val Ile 130 135 140
Thr Val Pro Ala Tyr Phe Asn Asp Ser Gln Arg Gln Ala Thr Lys Asp 145
150 155 160 Ala Gly Val Ile Ala Gly Leu Asn Val Leu Arg Ile Ile Asn
Glu Pro 165 170 175 Thr Ala Ala Ala Ile Ala Tyr Gly Leu Asp Arg Thr
Gly Lys Gly Glu 180 185 190 Arg Asn Val Leu Ile Phe Asp Leu Gly Gly
Gly Thr Phe Asp Val Ser 195 200 205 Ile Leu Thr Ile Asp Asp Gly Ile
Phe Glu Val Lys Ala Thr Ala Gly 210 215 220 Asp Thr His Leu Gly Gly
Glu Asp Phe Asp Asn Arg Leu Val Asn His 225 230 235 240 Phe Val Glu
Glu Phe Lys Arg Lys His Lys Lys Asp Ile Ser Gln Asn 245 250 255 Lys
Arg Ala Val Arg Arg Leu Arg Thr Ala Cys Glu Arg Ala Lys Arg 260 265
270 Thr Leu Ser Ser Ser Thr Gln Ala Ser Leu Glu Ile Asp Ser Leu Phe
275 280 285 Glu Gly Ile Asp Phe Tyr Thr Ser Ile Thr Arg Ala Arg Phe
Glu Glu 290 295 300 Leu Cys Ser Asp Leu Phe Arg Ser Thr Leu Glu Pro
Val Glu Lys Ala 305 310 315 320 Leu Arg Asp Ala Lys Leu Asp Lys Ala
Gln Ile His Asp Leu Val Leu 325 330 335 Val Gly Gly Ser Thr Arg Ile
Pro Lys Val Gln Lys Leu Leu Gln Asp 340 345 350 Phe Phe Asn Gly Arg
Asp Leu Asn Lys Ser Ile Asn Pro Asp Glu Ala 355 360 365 Val Ala Tyr
Gly Ala Ala Val Gln Ala Ala Ile Leu Met Gly Asp Lys 370 375 380 Ser
Glu Asn Val Gln Asp Leu Leu Leu Leu Asp Val Ala Pro Leu Ser 385 390
395 400 Leu Gly Leu Glu Thr Ala Gly Gly Val Met Thr Ala Leu Ile Lys
Arg 405 410 415 Asn Ser Thr Ile Pro Thr Lys Gln Thr Gln Ile Phe Thr
Thr Tyr Ser 420 425 430 Asp Asn Gln Pro Gly Val Leu Ile Gln Val Tyr
Glu Gly Glu Arg Ala 435 440 445 Met Thr Lys Asp Asn Asn Leu Leu Gly
Arg Phe Glu Leu Ser Gly Ile 450 455 460 Pro Pro Ala Pro Arg Gly Val
Pro Gln Ile Glu Val Thr Phe Asp Ile 465 470 475 480 Asp Ala Asn Gly
Ile Leu Asn Val Thr Ala Thr Asp Lys Ser Thr Gly 485 490 495 Lys Ala
Asn Lys Ile Thr Ile Thr Asn Asp Lys Gly Arg Leu Ser Lys 500 505 510
Glu Glu Ile Glu Arg Met Val Gln Glu Ala Glu Lys Tyr Lys Ala Glu 515
520 525 Asp Glu Val Gln Arg Glu Arg Val Ser Ala Lys Asn Ala Leu Glu
Ser 530 535 540 Tyr Ala Phe Asn Met Lys Ser Ala Val Glu Asp Glu Gly
Leu Lys Gly 545 550 555 560 Lys Ile Ser Glu Ala Asp Lys Lys Lys Val
Leu Asp Lys Cys Gln Glu 565 570 575 Val Ile Ser Trp Leu Asp Ala Asn
Thr Leu Ala Glu Lys Asp Glu Phe 580 585 590 Glu His Lys Arg Lys Glu
Leu Glu Gln Val Cys Asn Pro Ile Ile Ser 595 600 605 Gly Leu Tyr Gln
Gly Ala Gly Gly Pro Gly Pro Gly Gly Phe Gly Ala 610 615 620 Gln Gly
Pro Lys Gly Gly Ser Gly Ser Gly Pro Thr Ile Glu Glu Val 625 630 635
640 Asp 30258PRTArtificialfusion protein 30Gln Val Gln Leu Gln Gln
Ser Gly Pro Gly Leu Val Thr Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu
Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala
Thr Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45
Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50
55 60 Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro Asp Thr Ser Lys
Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp
Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr
Tyr Gly Met Asp Val 100 105 110 Trp Gly Gln Gly Thr Thr Val Thr Val
Ser Ser Gly Ile Leu Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gln 130 135 140 Pro Val Leu Thr Gln
Ser Ser Ser Leu Ser Ala Ser Pro Gly Ala Ser 145 150 155 160 Ala Ser
Leu Thr Cys Thr Leu Arg Ser Gly Ile Asn Val Gly Pro Tyr 165 170 175
Arg Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Pro Pro Gln Tyr Leu 180
185 190 Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln Gly Ser Gly Val
Pro 195 200 205 Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala Asn Ala
Gly Val Leu 210 215 220 Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala
Asp Tyr Tyr Cys Met 225 230 235 240 Ile Trp His Ser Ser Ala Ala Val
Phe Gly Gly Gly Thr Gln Leu Thr 245 250 255 Val Leu
* * * * *