U.S. patent application number 15/334017 was filed with the patent office on 2017-09-14 for potatoes with reduced cold-induced sweetening.
The applicant listed for this patent is CELLECTIS. Invention is credited to Benjamin Clasen, William Haun, Luc Mathis, Thomas Stoddard, Daniel F. Voytas, Feng Zhang.
Application Number | 20170258024 15/334017 |
Document ID | / |
Family ID | 50928144 |
Filed Date | 2017-09-14 |
United States Patent
Application |
20170258024 |
Kind Code |
A1 |
Mathis; Luc ; et
al. |
September 14, 2017 |
POTATOES WITH REDUCED COLD-INDUCED SWEETENING
Abstract
Materials and methods are provided for making plants (e.g.,
Solanum varieties) with decreased accumulation of reducing sugars
and acrylamide in cold-stored potatoes, specifically, by making
TALE-nuclease-induced mutations in genes encoding vacuolar
invertase.
Inventors: |
Mathis; Luc; (Le Kremlin
Bicetre, FR) ; Voytas; Daniel F.; (Falcon Heights,
MN) ; Zhang; Feng; (Maple Grove, MN) ; Clasen;
Benjamin; (South St Paul, MN) ; Haun; William;
(St. Paul, MN) ; Stoddard; Thomas; (St. Louis
Park, MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CELLECTIS |
Paris |
|
FR |
|
|
Family ID: |
50928144 |
Appl. No.: |
15/334017 |
Filed: |
October 25, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14135766 |
Dec 20, 2013 |
|
|
|
15334017 |
|
|
|
|
61745003 |
Dec 21, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A23V 2002/00 20130101;
C12N 15/8245 20130101; C12N 15/01 20130101 |
International
Class: |
A01H 5/04 20060101
A01H005/04; C12N 15/82 20060101 C12N015/82; C12N 15/01 20060101
C12N015/01 |
Claims
1-41. (canceled)
42. A method for generating a plant comprising at least two
mutations, the method comprising: (a) providing protoplasts; (b)
transforming the protoplasts with a nucleic acid encoding a
rare-cutting endonuclease, wherein the rare-cutting endonuclease
targets a protein coding region endogenous to the protoplasts; (c)
culturing the protoplasts to generate plant lines; and (d)
identifying a plant line comprising the at least two mutations.
43. The method of claim 42, wherein the plant is a Solanum
tuberosum plant and the protoplasts are S. tuberosum
protoplasts.
44. The method of claim 42, wherein each mutation is a deletion of
more than one nucleotide base pair.
45. The method of claim 44, wherein at least two VInv alleles
exhibit a deletion of more than one nucleotide base pair.
46. The method of claim 44, wherein each VInv allele exhibits
removal of an endogenous nucleic acid and does not include any
exogenous nucleic acid.
47. The method of claim 44, wherein each deletion is at a target
sequence as set forth in SEQ ID NO:27, or at a target sequence
having at least 95 percent sequence identity to SEQ ID NO:27.
48. The method of claim 44, wherein each deletion is at a target
sequence as set forth in SEQ ID NO: 1, or at a target sequence
having at least 95 percent sequence identity to SEQ ID NO: 1.
49. The method of claim 45, wherein the at least two VInv alleles
comprise a deletion selected from a -4 bp deletion as shown in SEQ
ID NO:32, a -4 bp deletion as shown in SEQ ID NO:33, or a -17 bp
deletion as shown in SEQ ID NO:34.
50. The method of claim 49, wherein the plant comprises three
deletions, and wherein the deletions comprise a -4 bp deletion as
shown in SEQ ID NO: 32, a -4 bp deletion as shown in SEQ ID NO:33,
and a -17 bp deletion as shown in SEQ ID NO:34.
51. The method of claim 42, wherein the rare-cutting endonuclease
is a transcription activator-like effector (TALE) nuclease or an
RNA-guided Cas9 nuclease.
52. The method of claim 51, wherein the rare-cutting endonuclease
is a TALE-nuclease.
53. The method of claim 52, wherein the TALE-nuclease binds to a
sequence as set forth in any of SEQ ID NOS:18-23.
54. The method of claim 42, wherein the transforming is mediated by
PEG.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
14/135,766, filed Dec. 20, 2013, which claims benefit of priority
from U.S. Provisional Application Ser. No. 61/745,003, filed on
Dec. 21, 2012.
TECHNICAL FIELD
[0002] This document provides materials and methods for creating
potato varieties with reduced cold-induced sweetening.
BACKGROUND
[0003] Potato (Solanum tuberosum) is an important food crop, with
worldwide production estimated at 324 million metric tons in 2011
(Food and Agricultural Organization of the United Nations
(FAOSTAT), 2010 Crop Production Data, online at
faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor). A
large proportion of the total potato crop (61% of the 2010 crop in
the United States) is used by processors to produce potato chips,
French fries and other processed products. In order to have a
year-round supply of high-quality raw potatoes for the processing
industry, it is necessary to `cold-store` the potato tubers until
they are needed. Cold storage is variety/processor specific, with
temperatures ranging from 3.degree. C. to 13.degree. C. for up to
twelve months, which prevents sprouting, reduces losses due to
shrinkage/aging, and minimizes the spread of disease.
SUMMARY
[0004] This document provides materials and methods for creating
potato varieties that have reduced cold-induced sweetening (CIS),
which is a phenomenon by which starch is converted to the simple
reducing sugars, glucose and fructose, during cold storage. Upon
processing at high temperatures, the glucose/fructose can interact
with free amino acids in a Maillard reaction, which results in
bitter, dark-pigmented products that may have increased levels of
acrylamide--a suspected neurotoxin/carcinogen. Potato varieties
with reduced CIS also are provided.
[0005] The disclosure herein is based at least in part on the
discovery that potatoes having reduced CIS can be obtained by using
a sequence-specific nuclease to make a targeted mutation or
knockout in the vacuolar invertase (VInv) gene. The modified
potatoes can have improved storage characteristics and reduced
levels of acrylamide upon frying, as compared to the levels of
acrylamide in non-modified potatoes upon frying after cold storage.
Further, the potatoes do not carry any foreign DNA and therefore
may be considered by regulatory agencies as non-GM. This document
also is based at least in part on the development of potato
cultivars with loss-of-function VInv mutations that are created by
sequence-specific nucleases.
[0006] In one aspect, this document features a Solanum plant, plant
part, or plant cell comprising a mutation in at least two VInv
alleles endogenous to the plant, plant part, or plant cell, such
that the plant, plant part, or plant cell has reduced expression of
vacuolar invertase as compared to a control Solanum plant, plant
part, or plant cell that lacks the mutation. Each mutation can be a
deletion of more than one nucleotide base pair. Each mutation can
be at a target sequence as set forth in SEQ ID NO:27, or a target
sequence having at least 95 percent identity to SEQ ID NO:27; or at
a target sequence as set forth in SEQ ID NO:1, or a target sequence
having at least 95 percent identity to SEQ ID NO:1. The plant,
plant part, or plant cell can have been made using a rare-cutting
endonuclease [e.g., a transcription activator-like effector
endonuclease (TALE-nuclease)]. The TALE-nuclease can bind to a
sequence as set forth in any of SEQ ID NOS:18-23. Each of the at
two least VInv alleles can exhibit removal of an endogenous nucleic
acid and does not include any exogenous nucleic acid. Every
endogenous VInv allele can be mutated. Each VInv allele can exhibit
removal of an endogenous nucleic acid, without including any
exogenous nucleic acid. The plant, plant part, or plant cell may
have no detectable expression of vacuolar invertase. The Solanum
plant, plant part, or plant cell can be a S. tuberosum plant, plant
part, or plant cell. The plant, plant part, or plant cell can be
subjected to cold storage conditions. The plant, plant part, or
plant cell can have decreased levels of acrylamide as compared to a
control plant, plant part, or plant cell that lacks the
mutation.
[0007] In another aspect, this document features a method for
making a Solanum plant that has reduced cold-induced sweetening.
The method can include (a) contacting a population of Solanum plant
cells containing a functional VInv allele with a rare-cutting
endonuclease targeted to an endogenous VInv sequence, (b)
selecting, from the population, a cell in which at least two VInv
alleles have been inactivated, and (c) growing the selected plant
cell into a Solanum plant, wherein the Solanum plant has reduced
cold-induced sweetening as compared to a control Solanum plant in
which the VInv alleles have not been inactivated. The Solanum plant
cells can be protoplasts. The method can include transforming the
protoplasts with a nucleic acid encoding the rare-cutting
endonuclease. The nucleic acid can be an mRNA. The nucleic acid can
be contained within a vector. The method can include introducing
into the protoplasts a rare-cutting endonuclease protein. The
rare-cutting endonuclease can be a TALE-nuclease. The TALE-nuclease
can be targeted to a sequence as set forth in SEQ ID NO:27 or to a
sequence having at least 95 percent identity to the sequence set
forth in SEQ ID NO:27, or can be targeted to a sequence as set
forth in SEQ ID NO:1 or to a sequence having at least 95 percent
identity to the sequence set forth in SEQ ID NO:1. The
TALE-nuclease can bind to a sequence as set forth in any of SEQ ID
NOS:18-23. The method can further include culturing protoplasts to
generate plant lines. The method can include isolating genomic DNA
containing at least a portion of the VInv locus from the
protoplasts. The Solanum plant cells can be S. tuberosum plant
cells.
[0008] In another aspect, this document features a method for
producing a food product. The method can include (a) providing a
Solanum plant or plant part that (i) contains a mutation in at
least two VInv alleles endogenous to the plant or plant part, such
that the plant, plant part, or plant cell has reduced expression of
vacuolar invertase as compared to a control Solanum plant or plant
part that lacks the mutation, and (ii) has been subjected to cold
storage; and (b) producing a food product from the plant or plant
part. The method can further include (c) cooking the plant or plant
part to obtain a food product having reduced levels of acrylamide
as compared to a food product produced from a control cooked plant
or plant part that lacks the mutation and that was subjected to
cold-induced storage prior to being cooked. The cooked plant or
plant part can have about the same level of acrylamide as a cooked
Solanum plant or plant part that was not subjected to cold storage
prior to cooking. Each mutation can be at a target sequence as set
forth in SEQ ID NO:27 or a target sequence having at least 95
percent identity to SEQ ID NO:27, or at a target sequence as set
forth in SEQ ID NO:1 or a target sequence having at least 95
percent identity to SEQ ID NO:1. Each mutation can have been made
using a rare-cutting endonuclease (e.g., a TALE-nuclease). The
TALE-nuclease can bind to a sequence as set forth in any of SEQ ID
NOS:18-23. The Solanum plant or plant part can be a S. tuberosum
plant or plant part. The Solanum plant or plant part may have no
detectable expression of vacuolar invertase.
[0009] In still another aspect, this document features a food
product produced from a Solanum plant or plant part that (i)
contains a mutation in each VInv allele endogenous to the plant or
plant part, such that the plant, plant part, or plant cell has no
functional VInv allele, and (ii) has been subjected to cold
storage. Each mutation can be at a target sequence as set forth in
SEQ ID NO:27 or a target sequence having at least 95 percent
identity to SEQ ID NO:27, or at a target sequence as set forth in
SEQ ID NO:1 or a target sequence having at least 95 percent
identity to SEQ ID NO:1. Each mutation can have been made using a
rare-cutting endonuclease (e.g., a TALE-nuclease). The
TALE-nuclease can bind to a sequence as set forth in any of SEQ ID
NOS:18-23. The food product can have been cooked. The food product
can have decreased levels of acrylamide as compared to a cooked
food product made from a control plant or plant part that lacks the
mutation and that was subjected to cold storage prior to being
cooked. The cooked food product can have about the same level of
acrylamide as a Solanum plant or plant part that has not been
subjected to cold storage. The Solanum plant or plant part can be a
S. tuberosum plant or plant part (e.g., from a variety selected
from the group consisting of Ranger Russet, Atlantic, and Burbank).
The food product can be a potato chip or a French fry.
[0010] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used to practice the invention, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0011] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0012] FIG. 1 shows target sites for VInv TALE-nucleases. A DNA
sequence from the VInv gene is shown (SEQ ID NO:1). The underlined
sequences represent target sites (SEQ ID NOS:18-23) for
TALE-nucleases that recognize the VInv gene.
[0013] FIG. 2 shows examples of TALE-nuclease-induced mutations in
the VInv gene. The top line of each panel shows the DNA sequence of
the recognition site for the VInv TALE-nucleases (underlined). The
other sequences show representative mutations that were induced by
imprecise non-homologous end-joining (NHEJ). Deletion sizes are
given on the right.
[0014] FIG. 3 shows exemplary alleles of the VInv 2 locus for the
variety "Ranger Russet," which was the germplasm used for
development of a mutant plant. Diagnostic single nucleotide
polymorphisms (SNPs) that differentiate allele types are underlined
and in bold type.
[0015] FIG. 4 shows exemplary deletion profiles for a regenerated
mutant "Ranger Russet" plant. TALE nuclease recognition sites are
underlined, and SNP sites are shaded.
DETAILED DESCRIPTION
[0016] The potato genome contains a small family of enzymes called
invertases, which play an important role in regulating the carbon
partitioning between source tissues (leaves) and sink tissues
(tubers, fruits, seeds). The enzymes irreversibly catalyze the
starch.fwdarw.sucrose.fwdarw.glucose/fructose reaction. Plants have
three classes of invertase enzymes, but the vacuolar invertase
(VInv) is thought to play an important role in CIS.
[0017] This document provides potato plant varieties, particularly
of the species S. tuberosum, that have reduced or even lack VInv
activity. Methods for generating such plant varieties, methods for
using such plant varieties to produce food products, and food
products produced from such plant varieties also are provided.
[0018] As used herein, the terms "plant" and "plant part" refer to
cells, tissues, organs, seeds, and severed parts (e.g., roots,
leaves, and flowers) that retain the distinguishing characteristics
of the parent plant. "Seed" refers to any plant structure that is
formed by continued differentiation of the ovule of the plant,
following its normal maturation point at flower opening,
irrespective of whether it is formed in the presence or absence of
fertilization and irrespective of whether or not the seed structure
is fertile or infertile.
[0019] The term "allele(s)" means any of one or more alternative
forms of a gene at a particular locus. In a diploid (or
amphidiploid) cell of an organism, alleles of a given gene are
located at a specific location or locus on a chromosome, with one
allele being present on each chromosome of the pair of homologous
chromosomes. Similarly, in a tetraploid cell of an organism, one
allele is present on each chromosome of the group of four
homologous chromosomes. "Heterozygous" alleles are different
alleles residing at a specific locus, positioned individually on
corresponding homologous chromosomes. "Homozygous" alleles are
identical alleles residing at a specific locus, positioned
individually on corresponding homologous chromosomes in the
cell.
[0020] "Wild type" as used herein refers to a typical form of a
plant or a gene as it most commonly occurs in nature. A "wild type
VInv allele" is a naturally occurring VInv allele (e.g., as found
within naturally occurring S. tuberosum plants) that encodes a
functional VInv protein, while a "non-functional mutant VInv
allele" is a VInv allele that does not encode a functional VInv
protein. Such a "non-functional mutant VInv allele" can include one
or more mutations in its nucleic acid sequence, where the
mutation(s) result in no detectable amount of functional VInv
protein in the plant or plant cell in vivo.
[0021] The potato genome usually contains only one VInv gene, but
because cultivated potato is a tetraploid, multiple alleles of VInv
are present in each variety. The methods provided herein can be
used to inactivate at least one (e.g., at least two, at least
three, or all four) functional alleles of VInv, thereby removing at
least some full-length RNA transcripts and functional VInv protein
from potato cells, and in some cases completely removing all
full-length RNA transcripts and functional VInv protein.
[0022] A representative example of a naturally occurring S.
tuberosum VInv nucleotide sequence is shown in Table 4 herein. The
S. tuberosum plants, cells, plant parts, seeds, and progeny thereof
that are provided herein have a mutation in each endogenous VInv
allele, such that expression of the gene is reduced or completely
inhibited. Thus, in some cases, the plants, cells, plant parts,
seeds, and progeny do not exhibit detectable levels of vacuolar
invertase expressed from the VInv gene.
[0023] The plants, plant cells, plant parts, seeds, and progeny
provided herein can be generated using a TALE-nuclease system to
make a targeted knockout in each allele of the VInv gene. Thus,
this document provides materials and methods for using rare-cutting
endonucleases (e.g., TALE-nucleases) to generate potato plants and
related products (e.g., seeds and plant parts) that are
particularly suitable for cold storage before use in making food
products for human and animal consumption, due to targeted
knockouts in the VInv gene. Other sequence-specific nucleases also
may be used to generate the desired plant material, including
engineered homing endonucleases or zinc finger nucleases.
[0024] The term "rare-cutting endonucleases" herein refer to
natural or engineered proteins having endonuclease activity
directed to nucleic acid sequences having a recognition sequence
(target sequence) about 12-40 bp in length (e.g., 14-40, 15-36, or
16-32 bp in length). Typical rare-cutting endonucleases cause
cleavage inside their recognition site, leaving 4 nt staggered cuts
with 3'OH or 5'OH overhangs. These rare-cutting endonucleases may
be meganucleases, such as wild type or variant proteins of homing
endonucleases, more particularly belonging to the dodecapeptide
family (LAGLIDADG (SEQ ID NO:35); see, WO 2004/067736) or may
result from fusion proteins that associate a DNA binding domain and
a catalytic domain with cleavage activity. TAL-effector
endonucleases (TALE-nucleases) and zinc-finger-nucleases (ZFN) are
examples of fusions of DNA binding domains with the catalytic
domain of the endonuclease FokI. Customized TALE-nucleases are
commercially available under the trade name TALEN.TM. (Cellectis,
Paris, France). For a review of rare-cutting endonucleases, see
Baker, Nature Methods 9:23-26, 2012).
[0025] "Mutagenesis" as used herein refers to processes in which
mutations are introduced into a selected DNA sequence. Mutations
induced by endonucleases generally are obtained by a double strand
break, which results in insertion/deletion mutations ("indels")
that can be detected by deep-sequencing analysis. Such mutations
typically are deletions of several base pairs, and have the effect
of inactivating the mutated allele. In the methods described
herein, for example, mutagenesis occurs via double stranded DNA
breaks made by TALE-nucleases targeted to selected DNA sequences in
a plant cell. Such mutagenesis results in "TALE-nuclease-induced
mutations" (e.g., TALE-nuclease-induced knockouts) and reduced
expression of the targeted gene. Following mutagenesis, plants can
be regenerated from the treated cells using known techniques (e.g.,
planting seeds in accordance with conventional growing procedures,
followed by self-pollination).
[0026] The term "expression" as used herein refers to the
transcription of a particular nucleic acid sequence to produce
sense or antisense RNA or mRNA, and/or the translation of an mRNA
molecule to produce a polypeptide (e.g., a therapeutic protein),
with or without subsequent post-translational events.
[0027] "Reducing the expression" of a gene or polypeptide in a
plant or a plant cell includes inhibiting, interrupting,
knocking-out, or knocking-down the gene or polypeptide, such that
transcription of the gene and/or translation of the encoded
polypeptide is reduced as compared to a corresponding control plant
or plant cell in which expression of the gene or polypeptide is not
inhibited, interrupted, knocked-out, or knocked-down. Expression
levels can be measured using methods such as, for example, reverse
transcription-polymerase chain reaction (RT-PCR), Northern
blotting, dot-blot hybridization, in situ hybridization, nuclear
run-on and/or nuclear run-off, RNase protection, or immunological
and enzymatic methods such as ELISA, radioimmunoassay, and western
blotting.
[0028] In general, a Solanum plant, plant part, or plant cell can
have its expression of vacuolar invertase reduced by more than 60
percent (e.g., by more than 70 percent, more than 80 percent, or
more than 90 percent) as compared to a control Solanum plant that
lacks the mutation(s). The control Solanum plant can be, for
example, the wild-type of the Solanum plant of which the invertase
gene has been mutated.
[0029] In some cases, a nucleic acid can have a nucleotide sequence
with at least about 75 percent sequence identity to a
representative VInv nucleotide sequence. For example, a nucleotide
sequence can have at least 75 percent, at least 80 percent, at
least 85 percent, at least 90 percent, at least 91 percent, at
least 92 percent, at least 93 percent, at least 94 percent, at
least 95 percent, at least 96 percent, at least 97 percent, at
least 98 percent, or at least 99 percent sequence identity to a
representative, naturally occurring VInv nucleotide sequence.
[0030] In some cases, a mutation can be at a target sequence as set
forth in a VInv sequence as set forth here (e.g., SEQ ID NO:1 or
SEQ ID NO:27), or at a target sequence that is at least 95 percent
(e.g., at least 96 percent, at least 97 percent, at least 98
percent, or at least 99 percent) identical to the sequence set
forth in a VInv sequence as set forth here (e.g., SEQ ID NO:1 or
SEQ ID NO:27).
[0031] The percent sequence identity between a particular nucleic
acid or amino acid sequence and a sequence referenced by a
particular sequence identification number is determined as follows.
First, a nucleic acid or amino acid sequence is compared to the
sequence set forth in a particular sequence identification number
using the BLAST 2 Sequences (Bl2seq) program from the stand-alone
version of BLASTZ containing BLASTN version 2.0.14 and BLASTP
version 2.0.14. This stand-alone version of BLASTZ can be obtained
online at fr.com/blast or at ncbi.nlm.nih.gov. Instructions
explaining how to use the Bl2seq program can be found in the readme
file accompanying BLASTZ. Bl2seq performs a comparison between two
sequences using either the BLASTN or BLASTP algorithm. BLASTN is
used to compare nucleic acid sequences, while BLASTP is used to
compare amino acid sequences. To compare two nucleic acid
sequences, the options are set as follows: -i is set to a file
containing the first nucleic acid sequence to be compared (e.g.,
C:\seq1.txt); -j is set to a file containing the second nucleic
acid sequence to be compared (e.g., C:\seq2.txt); -p is set to
blastn; -o is set to any desired file name (e.g., C:\output.txt);
-q is set to -1; -r is set to 2; and all other options are left at
their default setting. For example, the following command can be
used to generate an output file containing a comparison between two
sequences: C:\Bl2seq c:\seq1.txt -j c:\seq2.txt -p blastn -o
c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the
options of Bl2seq are set as follows: -i is set to a file
containing the first amino acid sequence to be compared (e.g.,
C:\seq1.txt); -j is set to a file containing the second amino acid
sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp;
-o is set to any desired file name (e.g., C:\output.txt); and all
other options are left at their default setting. For example, the
following command can be used to generate an output file containing
a comparison between two amino acid sequences: C:\Bl2seq
c:\seq1.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two
compared sequences share homology, then the designated output file
will present those regions of homology as aligned sequences. If the
two compared sequences do not share homology, then the designated
output file will not present aligned sequences.
[0032] Once aligned, the number of matches is determined by
counting the number of positions where an identical nucleotide or
amino acid residue is presented in both sequences. The percent
sequence identity is determined by dividing the number of matches
either by the length of the sequence set forth in the identified
sequence (e.g., SEQ ID NO:1), or by an articulated length (e.g.,
100 consecutive nucleotides or amino acid residues from a sequence
set forth in an identified sequence), followed by multiplying the
resulting value by 100. For example, a nucleic acid sequence that
has 120 matches when aligned with the sequence set forth in SEQ ID
NO:1 is 86.3 percent identical to the sequence set forth in SEQ ID
NO:1 (i.e., 120.+-.139.times.100=86.3). It is noted that the
percent sequence identity value is rounded to the nearest tenth.
For example, 75.11, 75.12, 75.13, and 75.14 is rounded down to
75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 is rounded up to
75.2. It also is noted that the length value will always be an
integer.
[0033] Methods for selecting endogenous target sequences and
generating TALE-nucleases targeted to such sequences can be
performed as described elsewhere. See, for example, PCT Publication
No. WO 2011/072246, which is incorporated herein by reference in
its entirety. In some embodiments, software that specifically
identifies TALE-nuclease recognition sites, such as TALE-NT 2.0
(Doyle et al., Nucleic Acids Res 40:W117-122, 2012) can be
used.
[0034] Transcription activator-like (TAL) effectors are found in
plant pathogenic bacteria in the genus Xanthomonas. These proteins
play important roles in disease, or trigger defense, by binding
host DNA and activating effector-specific host genes (see, e.g., Gu
et al., Nature 435:1122-1125, 2005; Yang et al., Proc. Natl. Acad.
Sci. USA 103:10503-10508, 2006; Kay et al. Science 318:648-651,
2007; Sugio et al., Proc. Natl. Acad. Sci. USA 104:10720-10725,
2007; and Romer et al. Science 318:645-648, 2007). Specificity
depends on an effector-variable number of imperfect, typically 34
amino acid repeats (Schornack et al., J. Plant Physiol.
163:256-272, 2006; and WO 2011/072246). Polymorphisms are present
primarily at repeat positions 12 and 13, which are referred to
herein as the repeat variable-diresidue (RVD).
[0035] The RVDs of TAL effectors correspond to the nucleotides in
their target sites in a direct, linear fashion, one RVD to one
nucleotide, with some degeneracy and no apparent context
dependence. This mechanism for protein-DNA recognition enables
target site prediction for new target specific TAL effectors, as
well as target site selection and engineering of new TAL effectors
with binding specificity for the selected sites.
[0036] TAL effector DNA binding domains can be fused to other
sequences, such as endonuclease sequences, resulting in chimeric
endonucleases targeted to specific, selected DNA sequences, and
leading to subsequent cutting of the DNA at or near the targeted
sequences. Such cuts (i.e., double-stranded breaks) in DNA can
induce mutations into the wild type DNA sequence via NHEJ or
homologous recombination, for example. In some cases,
TALE-nucleases can be used to facilitate site directed mutagenesis
in complex genomes, knocking out or otherwise altering gene
function with great precision and high efficiency. As described in
the Examples below, TALE-nucleases targeted to the S. tuberosum
VInv gene can be used to mutagenize the endogenous gene, resulting
in plants without detectable expression of VInv. The fact that some
endonucleases (e.g., FokI) function as dimers can be used to
enhance the target specificity of the TALE-nuclease. For example,
in some cases a pair of TALE-nuclease monomers targeted to
different DNA sequences (e.g., the underlined target sequences
shown in FIG. 1) can be used. When the two TALE-nuclease
recognition sites are in close proximity, as depicted in FIG. 1,
the inactive monomers can come together to create a functional
enzyme that cleaves the DNA. By requiring DNA binding to activate
the nuclease, a highly site-specific restriction enzyme can be
created.
[0037] Methods for using TALE-nucleases to generate potato plants,
plant cells, or plant parts having mutations in endogenous genes
include, for example, those described in the Examples herein. For
example, one or more nucleic acids encoding TALE-nucleases targeted
to selected VInv sequences (e.g., the VInv sequences shown in FIG.
1) can be transformed into plant cells (e.g., protoplasts), where
they can be expressed. In some cases, one or more TALE-nuclease
proteins can be introduced into plant cells (e.g., protoplasts).
The cells, or a plant cell line or plant part generated from the
cells, can subsequently be analyzed to determine whether mutations
have been introduced at the target site(s), through nucleic
acid-based assays or protein-based assays to detect expression
levels as described above, for example, or using nucleic acid-based
assays (e.g., PCR and DNA sequencing, or PCR followed by a T7E1
assay; Mussolino et al., Nucleic Acids Res. 39:9283-9293, 2011) to
detect mutations at the genomic loci. In a T7E1 assay, genomic DNA
can be isolated from pooled calli, and sequences flanking
TALE-nuclease recognition sites for VInv can be PCR-amplified.
Amplification products then can be denatured and re-annealed. If
the re-annealed fragments form a heteroduplex, T7 endonuclease I
cuts at the site of mismatch. The digested products can be
visualized by gel electrophoresis to quantify mutagenesis activity
of the TALE-nuclease.
[0038] More recently, a new genome engineering tool has been
developed based on the RNA-guided Cas9 nuclease from the type II
prokaryotic CRISPR (Clustered Regularly Interspaced Short
palindromic Repeats) adaptive immune system (see, e.g., Belahj et
al., Plant Methods 9:39, 2013). This system allows for cleaving DNA
sequences that are flanked by a short sequence motif, referred as
proto-spacer adjacent motif (PAM). Cleavage is achieved by
engineering a specific crRNA that is complementary to the target
sequence, which associates into the living cell with the
endonuclease Cas9 from S. pyogenes that is heterologously
expressed. In the crRNA/Cas9 complex, a dual tracrRNA:crRNA
structure acts as guide RNA that directs the endonuclease Cas9 to
the cognate target sequence. Since there are several PAM motifs
present in the nucleotide sequence of the Vinv gene, crRNA specific
to Vinv gene may be designed to introduce mutations or to
inactivate all or part of the Vinv gene alleles within Solanum
plant cells in which the Cas9 endonuclease and the crRNA are
transfected and expressed. This approach can be used as an
alternative to TALE-nucleases in some instances, to obtain the
plants as described herein.
[0039] This document also encompasses further mutations that could
be introduced in other Solanum genes so as to, for example: [0040]
provide further acrylamide reduction by modifying the expression of
genes involved in asparagine synthesis; [0041] prevent black spot
bruise by reducing polyphenol oxidase-5 expression; [0042] prevent
Potato Virus Y by reducing elF4E gene expression; [0043] prevent
late blight; or [0044] improve nematode, herbicide, or insect
resistance.
[0045] Thus, the methods provided herein can be used to obtain gene
stacking in a Solanum trait.
[0046] This disclosure also provides methods for producing food
products using potato plant varieties with reduced CIS, as well as
food products made by such methods. The methods provided herein can
include, for example, providing or making S. tuberosum plants or
plant parts that contain a TALE-nuclease-induced mutation in two or
more endogenous VInv alleles and that have been subjected to cold
storage, and using standard cooking and/or manufacturing methods to
produce a food product (including, without limitation, potato
chips, French fries, potato flakes, and mashed potatoes) from the
plants or plant parts. In some embodiments, the reduced CIS can be
observed as a reduction in bitterness and/or dark-pigmentation as
compared to the bitterness and/or pigmentation observed in food
products made from control plants or plant parts that do not
contain the mutated VInv alleles and that have been subjected to
cold storage. In some embodiments, the food products (e.g., food
products made using methods that include cooking the plants or
plant parts) can have reduced acrylamide levels as compared to the
levels of acrylamide in food products made from S. tuberosum plants
or plant parts that do not have mutations in the endogenous VInv
alleles and that have been subjected to cold storage (e.g., prior
to cooking). In some cases, the food products can have levels of
acrylamide that are comparable to the levels of acrylamide in food
products made from S. tuberosum plants or plant parts that were not
subjected to cold storage.
[0047] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
Examples
Example 1--Engineering Sequence-Specific Nucleases to Mutagenize
the VInv Gene
[0048] To completely inactivate or knock-out the alleles of the
VInv gene in S. tuberosum, sequence-specific nucleases were
designed that target the protein coding region in the vicinity of
the start codon. Three TALE-nuclease pairs were designed to target
the VInv gene family within the first 200 bp of the coding sequence
using software that specifically identifies TALE-nuclease
recognition sites. The TALE-nuclease recognition sites for the VInv
genes are underlined in FIG. 1 and are listed in Table 1.
TALE-nucleases were synthesized using methods similar to those
described elsewhere (Cermak et al., Nucleic Acids Res. 39:e82,
2011; Reyon et al., Nat. Biotechnol. 30:460-465, 2012; and Zhang et
al., Nat. Biotechnol. 29:149-153, 2011).
Example 2--VInv TALE-Nuclease Activity in Yeast
[0049] To assess the activity of the TALE-nucleases targeting the
VInv gene, activity assays were performed in yeast by methods
similar to those described elsewhere (Christian et al., Genetics
186:757-761, 2010). For these assays, a target plasmid was
constructed with the TALE-nuclease recognition site cloned in a
non-functional .beta.-galactosidase reporter gene. The target site
was flanked by a direct repeat of .beta.-galactosidase coding
sequence such that if the reporter gene was cleaved by the
TALE-nuclease, recombination would occur between the direct repeats
and function would be restored to the .beta.-galactosidase gene.
.beta.-galactosidase activity, therefore, served as a measure of
TALE-nuclease cleavage activity.
[0050] In the yeast assay, all of the VInv TALE-nuclease pairs
(VInv_T01, VInv_T02 and VInv_T03) exhibited high cleavage activity
under two distinct temperature conditions (i.e., 37.degree. C. and
30.degree. C.). Cleavage activities were normalized to the
benchmark nuclease, I-SceI. Results are summarized in Table 2.
Example 3--Activity of VInv TALE-Nucleases at their Endogenous
Target Sites in S. tuberosum
[0051] TALE-nuclease activity at endogenous target sites in S.
tuberosum was measured by expressing the TALE-nucleases in
protoplasts and surveying the TALE-nuclease target sites for
mutations introduced by NHEJ. Methods for protoplast preparation
were performed as described elsewhere (Shepard, in: Genetic
Improvement of Crops/Emergent Techniques (pp. 185-219), Rubenstein,
Gengenbach, Philips, and Green (Eds.), Univ. of Minnesota Press,
Minneapolis, Minn., 1980; and Shepard and Totten, Plant Physiol.
60:313-316, 1977). Briefly, S. tuberosum mini tubers were planted
in moistened vermiculite and grown under low light conditions for
3-5 weeks. Young, fully expanded leaves were collected and surface
sterilized, and protoplasts were isolated.
[0052] TALE-nuclease-encoding plasmids, together with a
YFP-encoding plasmid, were introduced into S. tuberosum protoplasts
by PEG-mediated transformation as described elsewhere (Yoo et al.,
Nature Protocols 2:1565-1572, 2007). Twenty-four hours after
treatment, transformation efficiency was measured by evaluating an
aliquot of the transformed protoplasts using a fluorescent
microscope to monitor YFP fluorescence. The remainder of the
transformed protoplasts was harvested, and genomic DNA was prepared
using a CTAB-based method. Using genomic DNA prepared from the
protoplasts as a template, a 272-bp fragment encompassing the
TALE-nuclease recognition site was amplified by PCR. Allele types
were analyzed by individual clonal direct sequencing and 454
pyro-sequencing. Sequencing reads with indel mutations in the
spacer region were considered as having been derived from imprecise
repair of a cleaved TALE-nuclease recognition site by NHEJ.
Mutagenesis frequency was calculated as the number of sequencing
reads with NHEJ mutations out of the total sequencing reads. The
values were then normalized by the transformation efficiency.
[0053] The activity of the VInv TALE-nuclease pairs, VInv_T01,
VInv_T02 and VInv_T03, against their target gene is summarized in
Table 3. The TALE-nucleases induced NHEJ mutations in VInvT1,
VInvT2, and VInvT3, ranging from 3.6% to 9.5%. Examples of
TALE-nuclease-induced mutations in VInvT1, VInvT2, and VInvT3 are
shown in FIG. 2.
Example 4--Regeneration of S. tuberosum Lines with
TALE-Nuclease-Induced Mutations in VInv
[0054] S. tuberosum lines were created with mutations in one or
more alleles of the VInv gene. Protoplasts were isolated from
surface sterilized leaves, and transformed with plasmids encoding
one of the following: (i) TALE-nuclease VInv_T01 (ii) TALE-nuclease
VInv_T02; (iii) TALE-nuclease VInv_T03; or (iv) YFP. Transformation
efficiencies were monitored by the delivery of the YFP plasmid,
which is visualized using a fluorescent microscope or by flow
cytometry.
[0055] After PEG-mediated transformation, protoplasts were cultured
using methods and media described elsewhere (Gamborg et al., in:
Plant Tissue Culture Methods and Applications in Agriculture (pp.
115-153), Thorpe (Ed.), Academic Press, Inc., New York, N.Y.,
1981), with slight modifications. Protoplasts were re-suspended in
liquid plating medium at a cell density of 1.times.10.sup.5/ml in a
small petri dish, and stored at 25.degree. C. in the dark. At day
14 after transformation, when the majority of the protoplasts had
divided at least once, the protoplast culture was diluted two-fold
in a suspension of P.-medium. At day 28 after transformation, the
protoplast cultures were plated on a solid reservoir (10 ml) of CUL
medium (Haberlach et al., Plant Science 39:67-74, 1985). At this
point, protoplast-derived calli were visible to the eye.
[0056] At day 65 after transformation, protoplast-derived calli
identified as mutants (e.g., using methods as described in Example
5) were transferred to a solid reservoir of DIF medium (Haberlach
et al., supra). Calli were transferred to fresh DIF medium at
biweekly intervals. As shoots formed, they were excised and placed
into a solid reservoir of R.-medium (Gamborg et al., supra). These
individual calli were transferred to shoot-inducing medium. Once
roots formed, they were transferred to soil and grown to maturity
for tuber production.
Example 5--Verification of S. tuberosum Lines with
TALE-Nuclease-Induced Mutations in VInv
[0057] S. tuberosum lines with mutations in all alleles of the VInv
gene were assessed one month after transformation. Plants with
putative mutations in the VInv gene were verified by PCR
amplification of the target locus, and subsequently sequenced. FIG.
4 shows the mutations recovered in all alleles of a single plant,
designated St116_1. Whereas potato is a tetraploid, it has been
documented that many loci have three or fewer alleles (Draffehn et
al., BMC Plant Biol. 10:271, 2010). In the cultivar "Ranger
Russett," which was used in these experiments, only the three wild
type alleles were identified (SEQ ID NOS:28, 29, and 30; FIG. 3).
The mutations carried by plant St116_1 are set forth in SEQ ID
NOS:32, 33, and 34, and have 4 bp, 4 bp and 17 bp deletions,
respectively.
Example 6--Mutant S. tuberosum Lines have Desired Phenotypes
[0058] VInv transcript quantification is determined using
quantitative real-time PCR of cDNA generated from mutant and
control tuber mRNA extracts (Bhaskar et al., Plant Physiol.
154(2):939-948, 2010). The reduction of VInv expression is
quantified using the comparative cycle threshold method described
elsewhere (Livak and Schmittgen, Method. Methods 25:402-408, 2001).
To assess acrylamide levels, potato chips are processed from
cold-stored tubers without reconditioning. Potato tubers are cut
axially to obtain slices and fried in vegetable oil for 2 minutes
at 187.degree. C. or until the cessation of bubbles. Fried chips
are allowed to cool at room temperature (22.degree. C.) for 5 to 8
minutes and are ground thoroughly with a mortar and pestle, and the
powder is used for acrylamide analysis using methods described
elsewhere (Bhaskar et al., supra). To assess changes in sugar
composition in tubers after cold storage, a colorimetric glucose
assay is employed using previously validated methods (Bethke and
Busse, Am. J. Potato Res. 85:414-421, 2008).
TABLE-US-00001 TABLE 1 TALE-nuclease target sequences SEQ SEQ
Target Sequence ID Target Sequence ID Gene Left NO: Right NO: Vinv_
TTCCTCCCGGATCAACC 18 GAAGTCCCTTAAAATCA 19 T1 VInv_
TTCCTCTCCTCTTTCCT 20 CTTCTTTCCGATCCTCA 21 T2 Vinv_
TAGCCTTCTTTCCGATC 22 CCGGACTTGCAGAGTAA 23 T3
TABLE-US-00002 TABLE 2 VInv TALE-nuclease activity in yeast TALE-
SEQ Activity in nuclease TALE-nuclease Target ID Yeast* Pair Name
Sequence NO: 37.degree. C. 30.degree. C. VInv_T01
TTCCTCCCGGATCAACCCGATTCCG 24 0.94 0.95 GCCACCGGAAGTCCCTTAAAATCA
VInv_T02 TTCCTCTCCTCTTTCCTTTTGCTTT 25 0.92 0.89
CTGTAGCCTTCTTTCCGATCCTCA VInv_T03 TAGCCTTCTTTCCGATCCTCAACAA 26 0.96
0.82 CCAGTCACCGGACTTGCAGAGTAA *Normalized to I-SceI (max = 1.0)
TABLE-US-00003 TABLE 3 454 Pyro-Sequencing Data for VInv
TALE-nuclease Location of NHEJ mutagenesis freq. TALE-nuclease name
target site with TALE-nuclease* VInv_T01 VInvT1 3.6% (4614)
VInv_T02 VInvT2 9.5% (4957) VInv_T03 VInvT3 9.9% (3350) *The total
number of 454 sequencing reads used for this analysis was indicated
in parentheses.
TABLE-US-00004 TABLE 4 S. tubersoum VInv complete CDS; GenBank
JN661860; SEQ ID NO: 27)
ATGGCCACGCAGTACCATTCCAGTTATGACCCGGAAAACTCCGCCTCCCA
TTACACATTCCTCCCGGATCAACCCGATTCCGGCCACCGGAAGTCCCTTA
AAATCATCTCCGGCATTTTCCTCTCCTCTTTCCTTTTGCTTTCTGTAGCC
TTCTTTCCGATCCTCAACAACCAGTCACCGGACTTGCAGAGTAACTCCCG
TTCGCCGGCGCCGCCGTCAAGAGGTGTTTCTCAGGGAGTCTCCGATAAGA
CTTTTCGAGATGTCGTCAATGCTAGTCACGTTTCTTATGCGTGGTCCAAT
GCTATGCTTAGCTGGCAAAGAACTGCTTACCATTTTCAACCTCAAAAAAA
TTGGATGAACGATCCTAATGGTCCATTGTACCACAAGGGATGGTATCATC
TTTTTTATCAATACAATCCAGATTCAGCTATTTGGGGAAATATCACATGG
GGCCATGCCGTATCCAAGGACTTGATCCACTGGCTCTACTTGCCTTTTGC
CATGGTTCCTGATCAATGGTACGATATTAACGGTGTCTGGACTGGGTCCG
CTACCATCCTACCCGATGGTCAGATCATGATGCTTTATACCGGTGACACT
GATGATTATGTGCAAGTGCAAAATCTTGCGTACCCCACCAACTTATCTGA
TCCTCTCCTTCTAGACTGGGTCAAGTACAAAGGCAACCCGGTTCTGGTTC
CTCCACCCGGCATTGGTGTCAAGGACTTTAGAGACCCGACCACTGCTTGG
ACCGGACCCCAAAATGGGCAATGGCTCTTAACAATCGGGTCTAAGATTGG
TAAAACGGGTATTGCACTTGTTTATGAAACTTCCAACTTCACAAGCTTTA
AGCTATTGGATGAAGTGCTGCATGCGGTTCCGGGTACGGGTATGTGGGAG
TGTGTGGACTTTTACCCGGTATCGACTGAAAAAACAAACGGGTTGGACAC
ATCATATAACGGCCCGGGTGTAAAGCATGTGTTAAAAGCAAGTTTAGATG
ACAATAAGCAAGATCACTATGCTATTGGGACGTATGACTTGACAAAGAAC
AAATGGACACCCGATAAGCCGGAATTGGATTGTGGAATTGGGTTGAAGCT
GGATTATGGGAAATATTATGCATCAAAGACATTTTATGACCCGAAGAAAC
AACGAAGAGTACTGTGGGGATGGATTGGGGAAACTGATAGTGAATCTGCT
GACCTGCAGAAGGGATGGGCATCTGTACAGAGTATTCCAAGGACAGTGCT
TTACGACAAGAAGACAGGGACACATCTACTTCAGTGGCCAGTTGAAGAAA
TTGAAAGCTTAAGAGCGGGTGATCCTATTGTTAAGCAAGTCAATCTTCAA
CCAGGTTCAATTGAGCTACTCCATGTTGACTCAGCTGCAGAGTTGGATAT
AGAAGCCTCATTTGAAGTGGACAAAGTCGCGCTCCAGGGAATAATTGAAG
CAGATCATGTAGGTTTCAGCTGCTCTACTAGTGGAGGTGCTGCTAGCAGA
GGCATTTTGGGACCATTTGGTGTCGTTGTAATTGCTGATCAAACGCTATC
TGAGCTAACGCCAGTTTACTTCTTCATTTCTAAAGGAGCTGATGGTCGAG
CTGAGACTCACTTCTGTGCTGATCAAACTAGATCCTCAGAGGCTCCGGGA
GTTGCTAAACGAGTTTATGGTAGTTCAGTACCCGTGTTGGACGGTGAAAA
ACATTCGATGAGATTATTGGTGGACCACTCAATTGTGGAGAGCTTTGCTC
AAGGAGGAAGAACAGTCATAACATCGCGAATTTACCCAACAAAGGCAGTG
AATGGAGCAGCACGACTCTTCGTTTTCAATAATGCCACAGGGGCTAGCGT
GACTGCCTCCGTCAAGATTTGGTCACTTGAGTCGGCTAATATTCGATCCT
TCCCCTTGCAAGACTTGTAA
Other Embodiments
[0059] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
341139DNASolanum tuberosum 1attcctcccg gatcaacccg attccggcca
ccggaagtcc cttaaaatca tctccggcat 60tttcctctcc tctttccttt tgctttctgt
agccttcttt ccgatcctca acaaccagtc 120accggacttg cagagtaac
139249DNASolanum tuberosum 2ttcctcccgg atcaacccga ttccggccac
cggaagtccc ttaaaatca 49328DNAArtificial Sequencemutant 3ttcctcccgg
atcaactccc ttaaatca 28439DNAArtificial Sequencemutant 4ttcctcccgg
atcagccacc ggaaatccct taaaactca 39536DNAArtificial Sequencemutant
5ttcctcccgg atcaacccga ttgtccctta aaatca 36621DNAArtificial
Sequencemutant 6ttcctcccgg atcaacccga t 21727DNAArtificial
Sequencemutant 7ttcctcccgg atcaacccga ttccggc 27849DNASolanum
tuberosum 8ttcctctcct ctttcctttt gctttctgta gccttctttc cgatcctca
49943DNAArtificial Sequencemutant 9ttcctctcct ctttcctttt gctagccttc
tttccgatcc tca 431046DNAArtificial Sequencemutant 10ttcctctcct
ctctcctttt gcttttagtc ttctttccga tcctca 461145DNAArtificial
Sequencemutant 11ttcctctcct ctttcctttt gctgtagcct tctttccgat cctca
451244DNAArtificial Sequencemutant 12ttcctctcct ctttcctttt
gcgtagcctt ctttccgatc ctca 441349DNASolanum tuberosum 13tagccttctt
tccgatcctc aacaaccagt caccggactt gcagagtaa 491443DNAArtificial
Sequencemutant 14tagccttctt tccgatcctc aacacaccgg acttgcagag taa
431544DNAArtificial Sequencemutant 15tagccttctt tccgatcctc
aaagtcaccg gacttgcaga gtaa 441640DNAArtificial Sequencemutant
16tagccttctt tccgatcctc tcaccggact tgcagagtaa 401742DNAArtificial
Sequencemutant 17tagccttctt tccgatcctc agtcaccgga cttgcagagt aa
421817DNASolanum tuberosum 18ttcctcccgg atcaacc 171917DNASolanum
tuberosum 19gaagtccctt aaaatca 172017DNASolanum tuberosum
20ttcctctcct ctttcct 172117DNASolanum tuberosum 21cttctttccg
atcctca 172217DNASolanum tuberosum 22tagccttctt tccgatc
172317DNASolanum tuberosum 23ccggacttgc agagtaa 172449DNASolanum
tuberosum 24ttcctcccgg atcaacccga ttccggccac cggaagtccc ttaaaatca
492549DNASolanum tuberosum 25ttcctctcct ctttcctttt gctttctgta
gccttctttc cgatcctca 492649DNASolanum tuberosum 26tagccttctt
tccgatcctc aacaaccagt caccggactt gcagagtaa 49271920DNASolanum
tuberosum 27atggccacgc agtaccattc cagttatgac ccggaaaact ccgcctccca
ttacacattc 60ctcccggatc aacccgattc cggccaccgg aagtccctta aaatcatctc
cggcattttc 120ctctcctctt tccttttgct ttctgtagcc ttctttccga
tcctcaacaa ccagtcaccg 180gacttgcaga gtaactcccg ttcgccggcg
ccgccgtcaa gaggtgtttc tcagggagtc 240tccgataaga cttttcgaga
tgtcgtcaat gctagtcacg tttcttatgc gtggtccaat 300gctatgctta
gctggcaaag aactgcttac cattttcaac ctcaaaaaaa ttggatgaac
360gatcctaatg gtccattgta ccacaaggga tggtatcatc ttttttatca
atacaatcca 420gattcagcta tttggggaaa tatcacatgg ggccatgccg
tatccaagga cttgatccac 480tggctctact tgccttttgc catggttcct
gatcaatggt acgatattaa cggtgtctgg 540actgggtccg ctaccatcct
acccgatggt cagatcatga tgctttatac cggtgacact 600gatgattatg
tgcaagtgca aaatcttgcg taccccacca acttatctga tcctctcctt
660ctagactggg tcaagtacaa aggcaacccg gttctggttc ctccacccgg
cattggtgtc 720aaggacttta gagacccgac cactgcttgg accggacccc
aaaatgggca atggctctta 780acaatcgggt ctaagattgg taaaacgggt
attgcacttg tttatgaaac ttccaacttc 840acaagcttta agctattgga
tgaagtgctg catgcggttc cgggtacggg tatgtgggag 900tgtgtggact
tttacccggt atcgactgaa aaaacaaacg ggttggacac atcatataac
960ggcccgggtg taaagcatgt gttaaaagca agtttagatg acaataagca
agatcactat 1020gctattggga cgtatgactt gacaaagaac aaatggacac
ccgataagcc ggaattggat 1080tgtggaattg ggttgaagct ggattatggg
aaatattatg catcaaagac attttatgac 1140ccgaagaaac aacgaagagt
actgtgggga tggattgggg aaactgatag tgaatctgct 1200gacctgcaga
agggatgggc atctgtacag agtattccaa ggacagtgct ttacgacaag
1260aagacaggga cacatctact tcagtggcca gttgaagaaa ttgaaagctt
aagagcgggt 1320gatcctattg ttaagcaagt caatcttcaa ccaggttcaa
ttgagctact ccatgttgac 1380tcagctgcag agttggatat agaagcctca
tttgaagtgg acaaagtcgc gctccaggga 1440ataattgaag cagatcatgt
aggtttcagc tgctctacta gtggaggtgc tgctagcaga 1500ggcattttgg
gaccatttgg tgtcgttgta attgctgatc aaacgctatc tgagctaacg
1560ccagtttact tcttcatttc taaaggagct gatggtcgag ctgagactca
cttctgtgct 1620gatcaaacta gatcctcaga ggctccggga gttgctaaac
gagtttatgg tagttcagta 1680cccgtgttgg acggtgaaaa acattcgatg
agattattgg tggaccactc aattgtggag 1740agctttgctc aaggaggaag
aacagtcata acatcgcgaa tttacccaac aaaggcagtg 1800aatggagcag
cacgactctt cgttttcaat aatgccacag gggctagcgt gactgcctcc
1860gtcaagattt ggtcacttga gtcggctaat attcgatcct tccccttgca
agacttgtaa 192028230DNASolanum tuberosum 28atagctctcg cagttatgac
ccggaaactc cgcctcccat tacacattcc tcccggatca 60acctgattcc ggccaccgga
agtcccttaa aatcatctcc ggcattttcc tctcctcttt 120ccttttgctt
tctgtagcct tctttccgat cctcaacaac cagtcaccgg acttgcagag
180taactcccgt tcgccggcgc cgccgtcaag aggtgtttct cagggagtct
23029230DNASolanum tuberosum 29atagctctcg cagttatgac ccggaaactc
cgcctcccat tacacattcc tcccggatca 60acccgattcc ggccaccgga agtcccttaa
aatcatctcc ggcattttcc tctcctcttt 120ccttttgctt tctgtagcct
tctttccgat cctcaacaac cagtcaccgg acttgcagag 180taactcccgt
tcgccggcgc cgccgtcaag aggtgtttct cagggagtct 23030230DNASolanum
tuberosum 30atagctctcg cagttatgac ccggaaactc cgcctcccat tacacattcc
tcccggatca 60acacgattcc ggccaccgga aatcccttaa aatcatctcc ggcattttcc
tctcctctct 120ccttttgctt tctttatcct tctttccgat cctcaacaac
cagtcaccgg acttgaaaag 180taacgcccgt tcgccggcgc cgccgtcaag
aggtgtttct cagggagtct 2303149DNASolanum tuberosum 31ttcctctcct
ctctcctttt gctttcttta gtcttctttc cgatcctca 493245DNAArtificial
Sequencemutant 32ttcctctcct ctttcctttt gctgtagcct tctttccgat cctca
453345DNAArtificial Sequencemutant 33ttcctctcct ctctcctttt
gctttagtct tctttccgat cctca 453432DNAArtificial Sequencemutant
34ttcctctcct ctagccttct ttccgatcct ca 32
* * * * *