U.S. patent application number 15/453733 was filed with the patent office on 2017-08-31 for system and method for nucleic acid amplification.
The applicant listed for this patent is 454 Life Sciences Corporation. Invention is credited to Gianni Calogero FERRERI, Brian Christopher GODWIN, Craig Elder MEALMAKER, Melinda PALMER, Priya SHANBHAG, Shally Hsueh-Wen WANG.
Application Number | 20170247734 15/453733 |
Document ID | / |
Family ID | 51355454 |
Filed Date | 2017-08-31 |
United States Patent
Application |
20170247734 |
Kind Code |
A1 |
GODWIN; Brian Christopher ;
et al. |
August 31, 2017 |
SYSTEM AND METHOD FOR NUCLEIC ACID AMPLIFICATION
Abstract
An embodiment of a method for generating a population of
amplified concatamer products is described that comprises
amplifying a template nucleic acid molecule using a first nucleic
acid primer immobilized on a bead substrate and a second nucleic
acid primer in solution to generate a population of substantially
identical copies of the template nucleic acid molecule immobilized
on the bead substrate; and amplifying the population of
substantially identical copies of the template nucleic acid
molecule using a concatamer primer that comprises a first region
complementary to an end region of the population of substantially
identical copies of the template nucleic acid molecule and a second
region to generate a population of immobilized concatamer products
of the substantially identical copies of the template nucleic acid
molecule.
Inventors: |
GODWIN; Brian Christopher;
(North Haven, CT) ; SHANBHAG; Priya; (Rocky Hill,
CT) ; MEALMAKER; Craig Elder; (Jersey City, NJ)
; FERRERI; Gianni Calogero; (Northford, CT) ;
PALMER; Melinda; (Hamden, CT) ; WANG; Shally
Hsueh-Wen; (Guilford, CT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
454 Life Sciences Corporation |
Branford |
CT |
US |
|
|
Family ID: |
51355454 |
Appl. No.: |
15/453733 |
Filed: |
March 8, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14466063 |
Aug 22, 2014 |
9624519 |
|
|
15453733 |
|
|
|
|
61869205 |
Aug 23, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6844 20130101;
C12Q 1/6853 20130101; C12Q 2525/191 20130101; C12Q 1/6869 20130101;
C12Q 1/6844 20130101; C12Q 2565/537 20130101; C12Q 2525/161
20130101; C12Q 2565/518 20130101; C12Q 2563/173 20130101; C12P
19/34 20130101; C12Q 1/6837 20130101 |
International
Class: |
C12P 19/34 20060101
C12P019/34; C12Q 1/68 20060101 C12Q001/68 |
Claims
1.-19. (canceled)
20. A system for generating a population of amplified concatamer
products, comprising a means for performing a method for generating
a population of amplified concatamer products, comprising:
amplifying a template nucleic acid molecule using a first nucleic
acid primer immobilized on a solid phase substrate and a second
nucleic acid primer in solution to generate a population of
substantially identical copies of the template nucleic acid
molecule immobilized on the solid phase substrate; amplifying the
population of substantially identical copies of the template
nucleic acid molecule using a concatamer primer that comprises a
first region complementary to a sequence of an end region of the
population of substantially identical copies of the template
nucleic acid molecule and a second region to generate a population
of immobilized concatamer products of the substantially identical
copies of the template nucleic acid molecule.
21. The system of claim 20, wherein, each of the population of
immobilized concatamer products comprise three or more concatamer
copies of one of the substantially identical copies of the template
nucleic acid molecule.
22. The system of claim 20, wherein, the end region of the
population of substantially identical copies of the template
nucleic acid molecule comprises an adaptor region.
23. The system of claim 20, wherein, the second region of the
concatamer primer is complementary to the first nucleic acid primer
immobilized on the solid phase substrate.
24. The system of claim 20, wherein, the solid phase substrate
which is fabricated from a material selected from the group
consisting of cellulose, a cellulose derivative, an acrylic resin,
glass, a silica gel, polystyrene, gelatin, polyvinyl pyrrolidone, a
co-polymer of vinyl and acrylamide, a polystyrene cross-linked with
divinylbenzene, polyacrylamide, a latex gel, polystyrene, dextran,
rubber, silicon, a plastic, nitrocellulose, a natural sponge, a
silica gel, control pore glass, a metal, a cross-linked dextran,
and agarose gel.
25. The system of claim 20, wherein, the template nucleic acid
molecule has a length of up to 1000 nucleic acid residues.
26. The system of claim 20, wherein, the template nucleic acid
molecule comprises one or more additional functional elements
selected from the group consisting of a primer sequence for
amplification or sequencing methods, a quality control element, an
adapter element, and a unique identifier.
27. The system of claim 26, wherein, the unique identifier is a
multiplex identifier (MID).
28. The system of claim 27, wherein, the MID identifies a feature
of a sample, wherein the feature is an experimental condition, a
treatment, a species, an individual subject, a tissue type, or a
cell type.
29. The system of claim 28, wherein, the template nucleic acid
molecule comprises more than one MID.
30. The system of claim 28, wherein, a position of the MID in the
template nucleic acid molecule is known relative to a feature of
the template nucleic acid molecule or to an adaptor element coupled
to the template molecule.
31. The system of claim 30, wherein, the feature of the template
nucleic acid molecule is a specific nucleic acid residue in the
molecule, a recognizable sequence marker, or one or more primer
elements.
32. The system of claim 31, wherein the recognizable sequence
marker is a Key element.
33. The system of claim 32, wherein, the Key element or the one or
more primer elements each has a known sequence composition.
34. The system of claim 20, wherein, amplifying the population of
substantially identical copies of the template nucleic acid
molecule using a concatamer primer occurs via polymerase chain
reaction (PCR) or emulsion PCR (emPCR).
35. The system of claim 20, wherein, the solid phase substrate is a
bead.
36. The system of claim 35, wherein, the bead has a diameter of
between about 1.4 .mu.m and about 20 .mu.m.
37. The system of claim 20, wherein, the solid phase substrate is a
planar substrate selected from the group consisting of a slide type
substrate, a semiconductor chip comprising well type structures, a
microwell array, a waveguide type reaction substrate, and a PTP
array.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/466,063, filed Aug. 22, 2014, which is
related to and claims priority from U.S. Provisional Patent
Application Ser. No. 61/869,205, titled "System and Method for
Nucleic Acid Amplification", filed Aug. 23, 2013, the contents of
each of which are herein incorporated by reference in their
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to the fields of nucleic acid
amplification. More specifically, the invention relates to systems
and methods for increasing the amplification yield of nucleic acid
templates via concatamerization.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0003] The contents of the text file named "454L058C01US_ST25.txt",
which was created on Mar. 8, 2017 and is 8.0 KB in size, are hereby
incorporated by reference in their entireties.
BACKGROUND OF THE INVENTION
[0004] Clonal amplification of nucleic acid template molecules has
proven to be very useful for a number of technologies, particularly
for nucleic acid sequencing technologies where clonal populations
of substantially identical copies amplified from a single template
are immobilized on to a solid phase surface and utilized in
subsequent sequencing operations. For example, a solid phase
surface may comprise an independent solid phase surface (generally
referred to as a "bead" substrate although such substrates are not
necessarily spherical) that may be disposed in wells. The solid
phase surface may also comprise other planar or non-planar surfaces
and are used for immobilization and sequencing of clonal
populations of amplified nucleic acid template. Typically, a
species of amplification primer is disposed on the outer surface of
the solid phase which may include surface within pores or cavities
(i.e. in the case of a porous bead substrate) or within defined
areas of a substrate surface (i.e. in the case of planar substrates
that comprise many areas or "features" for amplification of
individual template species of various possible shapes and sizes)
in order to allow for parallel processing of many different
template species.
[0005] Thus in many cases there are spatial limitations on the
amount of surface area available as primer attachment sites and
thus by extension on the amount of amplification product than can
be bound to the solid phase substrate. For example, using common
PCR reaction conditions, the total amount of nucleic acid template
that can be amplified is capped by the total number of primers
attached to the surface leading to a maximum 1:1 ratio of amplified
nucleic acid template to primers. This can be problematic for
downstream applications such as sequencing because the degree of
signal obtainable from the population is proportional to the number
of copies available to generate the signal where small numbers of
copies may not generate enough signal to distinguish from
experimental or background noise sources.
[0006] One solution has been to implement what is generally
referred to as a concatamer PCR approach that makes it possible to
increase the ratio of amplified nucleic acid template to primers to
greater than 1:1. In other words producing more amplified nucleic
acid template than there are primer sites on the surface.
[0007] To date concatamer PCR has been achieved in a couple of
ways. A first approach requires the initial templates to contain
tandem repeats of the starting template sequence which allow for
self-priming and amplification. A second approach employed includes
amplifying initial PCR products with a restriction enzyme site
engineered into both ends of the fragments which can be
subsequently digested producing "sticky" ends which can then be
ligated to form the initial tandem repeat templates. This template
would then be used in the concatamer PCR reaction.
[0008] The embodiments of the invention as described herein replace
the requirement of tandem copies in the initial template of the
concatamer PCR by employing a concatamer primer in the reaction and
enables solid surface amplification strategies that allow for
sequencing of the DNA template or other uses.
[0009] A number of references are cited herein, the entire
disclosures of which are incorporated herein, in their entirety, by
reference for all purposes. Further, none of these references,
regardless of how characterized above, is admitted as prior art to
the invention of the subject matter claimed herein.
SUMMARY OF THE INVENTION
[0010] Embodiments of the invention relate to the fields of nucleic
acid amplification and sequencing. More particularly, embodiments
of the invention relate to increasing the amplification yield of
nucleic acid templates via concatamerization.
[0011] An embodiment of a method for generating a population of
amplified concatamer products is described that comprises
amplifying a template nucleic acid molecule using a first nucleic
acid primer immobilized on a solid phase (e.g., bead) substrate and
a second nucleic acid primer in solution to generate a population
of substantially identical copies of the template nucleic acid
molecule immobilized on the solid phase (e.g., bead) substrate; and
amplifying the population of substantially identical copies of the
template nucleic acid molecule using a concatamer primer that
comprises a first region complementary to an end region of the
population of substantially identical copies of the template
nucleic acid molecule and a second region to generate a population
of immobilized concatamer products of the substantially identical
copies of the template nucleic acid molecule.
[0012] In some embodiments, each of the population of immobilized
concatamer products contains two or more concatamer copies of one
of the substantially identical copies of the template nucleic acid
molecule.
[0013] In the methods described herein, the end region of the
population of substantially identical copies of the template
nucleic acid molecule can include an adaptor region.
[0014] The second region of the concatamer primer can be
complementary to the first nucleic acid primer immobilized on the
solid phase substrate.
[0015] In any of the methods described herein, the solid phase
substrate can be fabricated from cellulose, a cellulose derivative,
an acrylic resin, glass, a silica gel, polystyrene, gelatin,
polyvinyl pyrrolidone, a co-polymer of vinyl and acrylamide, a
polystyrene cross-linked with divinylbenzene, polyacrylamide, a
latex gel, polystyrene, dextran, rubber, silicon, a plastic,
nitrocellulose, a natural sponge, a silica gel, control pore glass,
a metal, a cross-linked dextran, and/or agarose gel.
[0016] In the methods of the instant invention, the template
nucleic acid molecule may have a length of up to 1000 nucleic acid
residues (i.e., 25-30 nucleic acid residues, 50-100 nucleic acid
residues, 200-300 nucleic acid residues, 350-500 nucleic acid
residues, or 500-1000 nucleic acid residues).
[0017] Additionally, the template nucleic acid molecule may contain
one or more additional functional elements selected from a primer
sequence for amplification or sequencing methods, a quality control
element, an adapter element, and/or a unique identifier. In some
embodiments, the unique identifier is a multiplex identifier (MID),
which identifies a feature of a sample, wherein the feature is an
experimental condition, a treatment, a species, an individual
subject, a tissue type, and/or a cell type. In certain embodiments,
the template nucleic acid molecule can contain more than one MID.
The position of the MID in the template nucleic acid molecule may
be known relative to a feature of the template nucleic acid
molecule (e.g., a specific nucleic acid residue in the molecule, a
recognizable sequence marker such as a Key element, or one or more
primer elements) or to an adaptor element coupled to the template
molecule. The Key element or the one or more primer element may
each have a known sequence composition. In the methods described
herein, amplifying the population of substantially identical copies
of the template nucleic acid molecule using a concatamer primer
occurs via polymerase chain reaction (PCR) or emulsion PCR
(emPCR).
[0018] In certain embodiments, the solid phase substrate is a bead.
Such beads can have a diameter of between about 1.4 .mu.m and about
20 .mu.m. In other embodiments, the solid phase substrate is a
planar substrate selected from a slide type substrate, a
semiconductor chip comprising well type structures, a microwell
array, a waveguide type reaction substrate, and/or a PTP array.
[0019] Also provided are systems for generating a population of
amplified concatamer products, comprising a means for performing
any of the methods of the invention.
[0020] Any of the above aspects and embodiments can be combined
with any other aspect or embodiment.
[0021] The above embodiments and implementations are not
necessarily inclusive or exclusive of each other and may be
combined in any manner that is non-conflicting and otherwise
possible, whether they be presented in association with a same, or
a different, embodiment or implementation. The description of one
embodiment or implementation is not intended to be limiting with
respect to other embodiments and/or implementations. Also, any one
or more function, step, operation, or technique described elsewhere
in this specification may, in alternative implementations, be
combined with any one or more function, step, operation, or
technique described in the summary. Thus, the above embodiment and
implementations are illustrative rather than limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The above and further features will be more clearly
appreciated from the following detailed description when taken in
conjunction with the accompanying drawings. In the drawings, like
reference numerals indicate like structures, elements, or method
steps and the leftmost digit of a reference numeral indicates the
number of the figure in which the references element first appears.
All of these conventions, however, are intended to be typical or
illustrative, rather than limiting.
[0023] FIG. 1 is a functional block diagram of one embodiment of a
sequencing instrument under computer control and a reaction
substrate;
[0024] FIGS. 2A-D are a simplified graphical representation of one
embodiment of an amplification strategy using a concatamer primer
species;
[0025] FIG. 3 is a simplified graphical representation of one
embodiment of a result of the amplification strategy of FIG. 2 that
comprise immobilized concatamers copies of a template species;
[0026] FIG. 4 is a simplified graphical representation of one
embodiment of FACS analysis results of amplification products using
a concatamer primer species versus single primer species;
[0027] FIG. 5 is a simplified graphical representation of one
embodiment of analysis results of amplification products using a
concatamer primer species versus single primer species illustrating
a difference in size distribution of the products;
[0028] FIG. 6 is a simplified graphical representation of one
embodiment of analysis results of amplification products using a
concatamer primer species versus single primer species illustrating
a difference in signal per base in a sequencing analysis;
[0029] FIGS. 7A and 7B are simplified graphical representations of
one embodiment of analysis results of amplification products using
a concatamer primer species versus single primer species
illustrating a difference in sequencing flowgrams;
[0030] FIG. 8 is a simplified graphical representation of one
embodiment of analysis results of amplification products using a
concatamer primer species on a .about.1.4 .mu.m capture bead;
and
[0031] FIG. 9 is a simplified graphical representation of another
embodiment of analysis results of amplification products using a
concatamer primer species on a .about.1.4 .mu.m capture bead.
DETAILED DESCRIPTION OF THE INVENTION
[0032] As will be described in greater detail below, embodiments of
the presently described invention include systems and methods for
increasing the amount of amplification product relative to the
number of available primers of a primer species. In the embodiments
described in detail below a unique concatamer PCR approach enables
the production of a high ratio of amplified DNA copies relative to
the amount of primers attached to a surface. The amplified products
from concatamer PCR confer a number of advantages for subsequent
processing and/or analysis steps. For example, the concatamer PCR
products alleviate surface crowding issues due to the fact that the
products amplify away from the solid phase surface. Further,
inhibition caused by an increase in double stranded DNA ends is
reduced because amplification products can be formed without
increasing the number of double stranded ends. Lastly, the
Concatamer PCR process is less limited by the concentrations of
solution phase and solid phase primers due to the fact that the
ends regions of the amplification products act as primer sites.
a. General
[0033] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Methods
and materials similar or equivalent to those described herein can
be used in the practice of the present invention, and exemplified
suitable methods and materials are described below. For example,
methods may be described which comprise more than two steps. In
such methods, not all steps may be required to achieve a defined
goal and the invention envisions the use of isolated steps to
achieve these discrete goals. The disclosures of all publications,
patent applications, patents, and other references are incorporated
in toto herein by reference. In addition, the materials, methods,
and examples are illustrative only and not intended to be
limiting.
[0034] The term "flowgram" generally refers to a graphical
representation of sequence data generated by SBS methods,
particularly pyrophosphate based sequencing methods (also referred
to as "pyrosequencing") and may be referred to more specifically as
a "pyrogram".
[0035] The term "read" or "sequence read" as used herein generally
refers to the entire sequence data obtained from a single nucleic
acid template molecule or a population of a plurality of
substantially identical copies of the template nucleic acid
molecule.
[0036] The terms "run" or "sequencing run" as used herein generally
refer to a series of sequencing reactions performed in a sequencing
operation of one or more template nucleic acid molecules.
[0037] The term "flow" as used herein generally refers to a single
introduction of a nucleotide species or reagent into a reaction
environment that is typically part of an iterative sequencing by
synthesis process comprising a template nucleic acid molecule. For
example, a flow may include a solution comprising a nucleotide
species and/or one or more other reagents, such as buffers, wash
solutions, or enzymes that may be employed in a sequencing process
or to reduce carryover or noise effects from previous flows of
nucleotide species.
[0038] The term "flow order", "flow pattern", or "nucleotide
dispensation order" as used herein generally refers to a
pre-determined series of flows of a nucleotide species into a
reaction environment. In some embodiments a flow cycle may include
a sequential addition of 4 nucleotide species in the order of T, A,
C, G nucleotide species, or other order where one or more of the
nucleotide species may be repeated.
[0039] The term "flow cycle" as used herein generally refers to an
iteration of a flow order where in some embodiments the flow cycle
is a repeating cycle having the same flow order from cycle to
cycle, although in some embodiments the flow order may vary from
cycle to cycle.
[0040] The term "read length" as used herein generally refers to an
upper limit of the length of a template molecule that may be
reliably sequenced. There are numerous factors that contribute to
the read length of a system and/or process including, but not
limited to the degree of GC content in a template nucleic acid
molecule.
[0041] The term "signal droop" as used herein generally refers to a
decline in detected signal intensity as read length increases.
[0042] The term "test fragment" or "TF" as used herein generally
refers to a nucleic acid element of known sequence composition that
may be employed for quality control, calibration, or other related
purposes.
[0043] The term "primer" as used herein generally refers to an
oligonucleotide that acts as a point of initiation of DNA synthesis
under conditions in which synthesis of a primer extension product
complementary to a nucleic acid strand is induced in an appropriate
buffer at a suitable temperature. A primer is preferably a single
stranded oligodeoxyribonucleotide.
[0044] A "nascent molecule" generally refers to a DNA strand which
is being extended by the template-dependent DNA polymerase by
incorporation of nucleotide species which are complementary to the
corresponding nucleotide species in the template molecule.
[0045] The terms "template nucleic acid", "template molecule",
"target nucleic acid", or "target molecule" generally refer to a
nucleic acid molecule that is the subject of a sequencing reaction
from which sequence data or information is generated.
[0046] The term "nucleotide species" as used herein generally
refers to the identity of a nucleic acid monomer including purines
(Adenine, Guanine) and pyrimidines (Cytosine, Uracil, Thymine)
typically incorporated into a nascent nucleic acid molecule.
"Natural" nucleotide species include, e.g., adenine, guanine,
cytosine, uracil, and thymine. Modified versions of the above
natural nucleotide species include, without limitation,
alpha-thio-triphosphate derivatives (such as dATP alpha S),
hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, and
5-methylcytosine.
[0047] The term "monomer repeat" or "homopolymers" as used herein
generally refers to two or more sequence positions comprising the
same nucleotide species (i.e. a repeated nucleotide species).
[0048] The term "homogeneous extension" as used herein generally
refers to the relationship or phase of an extension reaction where
each member of a population of substantially identical template
molecules is homogenously performing the same extension step in the
reaction.
[0049] The term "completion efficiency" as used herein generally
refers to the percentage of nascent molecules that are properly
extended during a given flow.
[0050] The term "incomplete extension rate" as used herein
generally refers to the ratio of the number of nascent molecules
that fail to be properly extended over the number of all nascent
molecules.
[0051] The term "genomic library" or "shotgun library" as used
herein generally refers to a collection of molecules derived from
and/or representing an entire genome (i.e. all regions of a genome)
of an organism or individual.
[0052] The term "amplicon" as used herein generally refers to
selected amplification products, such as those produced from
Polymerase Chain Reaction (PCR) or Ligase Chain Reaction (LCR)
techniques.
[0053] The term "variant" or "allele" as used herein generally
refers to one of a plurality of species each encoding a similar
sequence composition, but with a degree of distinction from each
other. The distinction may include any type of variation known to
those of ordinary skill in the related art, that include, but are
not limited to, polymorphisms such as single nucleotide
polymorphisms (SNPs), insertions or deletions (the combination of
insertion/deletion events are also referred to as "indels"),
differences in the number of repeated sequences (also referred to
as tandem repeats), and structural variations.
[0054] The term "allele frequency" or "allelic frequency" as used
herein generally refers to the proportion of all variants in a
population that is comprised of a particular variant.
[0055] The term "key sequence" or "key element" as used herein
generally refers to a nucleic acid sequence element (typically of
about 4 sequence positions, i.e., TGAC or other combination of
nucleotide species) associated with a template nucleic acid
molecule in a known location (i.e., typically included in a ligated
adaptor element) comprising known sequence composition that is
employed as a quality control reference for sequence data generated
from template molecules. The sequence data passes the quality
control if it includes the known sequence composition associated
with a Key element in the correct location.
[0056] The term "keypass" or "keypass well" as used herein
generally refers to the sequencing of a full length nucleic acid
test sequence of known sequence composition (i.e., a "test
fragment" or "TF" as referred to above) in a reaction well, where
the accuracy of the sequence derived from TF sequence and/or Key
sequence associated with the TF or in an adaptor associated with a
target nucleic acid is compared to the known sequence composition
of the TF and/or Key and used to measure of the accuracy of the
sequencing and for quality control. In typical embodiments, a
proportion of the total number of wells in a sequencing run will be
keypass wells which may, in some embodiments, be regionally
distributed.
[0057] The term "blunt end" as used herein is interpreted
consistently with the understanding of one of ordinary skill in the
related art, and generally refers to a linear double stranded
nucleic acid molecule having an end that terminates with a pair of
complementary nucleotide base species, where a pair of blunt ends
are typically compatible for ligation to each other.
[0058] The term "sticky end" or "overhang" as used herein is
interpreted consistently with the understanding of one of ordinary
skill in the related art, and generally refers to a linear double
stranded nucleic acid molecule having one or more unpaired
nucleotide species at the end of one strand of the molecule, where
the unpaired nucleotide species may exist on either strand and
include a single base position or a plurality of base positions
(also sometimes referred to as "cohesive end").
[0059] The term "SPRI" as used herein is interpreted consistently
with the understanding of one of ordinary skill in the related art,
and generally refers to the patented technology of "Solid Phase
Reversible Immobilization" wherein target nucleic acids are
selectively precipitated under specific buffer conditions in the
presence of beads, where said beads are often carboxylated and
paramagnetic. The precipitated target nucleic acids immobilize to
said beads and remain bound until removed by an elution buffer
according to the operator's needs (DeAngelis, Margaret M. et al:
Solid-Phase Reversible Immobilization for the Isolation of PCR
Products. Nucleic Acids Res (1995), Vol. 23:22; 4742-4743, which is
hereby incorporated by reference herein in its entirety for all
purposes).
[0060] The term "carboxylated" as used herein is interpreted
consistently with the understanding of one of ordinary skill in the
related art, and generally refers to the modification of a
material, such as a microparticle, by the addition of at least one
carboxl group. A carboxyl group is either COOH or COO--.
[0061] The term "paramagnetic" as used herein is interpreted
consistently with the understanding of one of ordinary skill in the
related art, and generally refers to the characteristic of a
material wherein said material's magnetism occurs only in the
presence of an external, applied magnetic field and does not retain
any of the magnetization once the external, applied magnetic field
is removed.
[0062] The term "bead" or "bead substrate" as used herein generally
refers to any type of solid phase particle of any convenient size,
of irregular or regular shape and which is fabricated from any
number of known materials such as cellulose, cellulose derivatives,
acrylic resins, glass, silica gels, polystyrene, gelatin, polyvinyl
pyrrolidone, co-polymers of vinyl and acrylamide, polystyrene
cross-linked with divinylbenzene or the like (as described, e.g.,
in Merrifield, Biochemistry 1964, 3, 1385-1390), polyacrylamides,
latex gels, polystyrene, dextran, rubber, silicon, plastics,
nitrocellulose, natural sponges, silica gels, control pore glass,
metals, cross-linked dextrans (e.g., Sephadex.TM.) agarose gel
(Sepharose.TM.), and other solid phase bead supports known to those
of skill in the art although it will be appreciated that solid
phase substrates may include a degree of porosity enabling
penetration of fluids and/or biological molecule into the
pores.
[0063] The term "reaction environment" as used herein generally
refers to a volume of space in which a reaction can take place
typically where reactants are at least temporarily contained or
confined allowing for detection of at least one reaction product.
Examples of a reaction environment include but are not limited to
cuvettes, tubes, bottles, as well as one or more depressions,
wells, or chambers on a planar or non-planar substrate.
[0064] The term "virtual terminator" as used herein generally
refers to terminators substantially slow reaction kinetics where
additional steps may be employed to stop the reaction such as the
removal of reactants.
[0065] Unless specifically stated or obvious from context, as used
herein, the terms "a," "an," and "the" are understood to be
singular or plural. Unless specifically stated or obvious from
context, as used herein, the term "or" is understood to be
inclusive.
[0066] Unless specifically stated or obvious from context, as used
herein, the term "about" is understood as within a range of normal
tolerance in the art, for example within 2 standard deviations of
the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%,
5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated
value. Unless otherwise clear from the context, all numerical
values provided herein are modified by the term "about."
[0067] Some exemplary embodiments of systems and methods associated
with sample preparation and processing, generation of sequence
data, and analysis of sequence data are generally described below,
some or all of which are amenable for use with embodiments of the
presently described invention. In particular, the exemplary
embodiments of systems and methods for preparation of template
nucleic acid molecules, amplification of template molecules,
generating target specific amplicons and/or genomic libraries,
sequencing methods and instrumentation, and computer systems are
described.
[0068] In typical embodiments, the nucleic acid molecules derived
from an experimental or diagnostic sample should be prepared and
processed from its raw form into template molecules amenable for
high throughput sequencing. The processing methods may vary from
application to application, resulting in template molecules
comprising various characteristics. For example, in some
embodiments of high throughput sequencing, it is preferable to
generate template molecules with a sequence or read length that is
at least comparable to the length that a particular sequencing
method can accurately produce sequence data for. In the present
example, the length may include a range of about 25-30 bases, about
50-100 bases, about 200-300 bases, about 350-500 bases, about
500-1000 bases, greater than 1000 bases, or any other length
amenable for a particular sequencing application. In some
embodiments, nucleic acids from a sample, such as a genomic sample,
are fragmented using a number of methods known to those of ordinary
skill in the art. In preferred embodiments, methods that randomly
fragment (i.e. do not select for specific sequences or regions)
nucleic acids and may include what is referred to as nebulization
or sonication methods. It will, however, be appreciated that other
methods of fragmentation, such as digestion using restriction
endonucleases, may be employed for fragmentation purposes. Also in
the present example, some processing methods may employ size
selection methods known in the art to selectively isolate nucleic
acid fragments of the desired length.
[0069] Also, it is preferable in some embodiments to associate
additional functional elements with each template nucleic acid
molecule. The elements may be employed for a variety of functions
including, but not limited to, primer sequences for amplification
and/or sequencing methods, quality control elements (i.e. such as
Key elements or other type of quality control element), unique
identifiers (also referred to as a multiplex identifier or "MID")
that encode various associations such as with a sample of origin or
patient, or other functional element.
[0070] For example, some embodiments of the described invention
comprise associating one or more embodiments of an MID element
having a known and identifiable sequence composition with a sample,
and coupling the embodiments of MID element with template nucleic
acid molecules from the associated samples. The MID coupled
template nucleic acid molecules from a number of different samples
are pooled into a single "Multiplexed" sample or composition that
can then be efficiently processed to produce sequence data for each
MID coupled template nucleic acid molecule. The sequence data for
each template nucleic acid is de-convoluted to identify the
sequence composition of coupled MID elements and association with
sample of origin identified. In the present example, a multiplexed
composition may include representatives from about 384 samples,
about 96 samples, about 50 samples, about 20 samples, about 16
samples, about 12 samples, about 10 samples, or other number of
samples. Each sample may be associated with a different
experimental condition, treatment, species, or individual in a
research context. Similarly, each sample may be associated with a
different tissue, cell, individual, condition, drug or other
treatment in a diagnostic context. Those of ordinary skill in the
related art will appreciate that the numbers of samples listed
above are provided for exemplary purposes and thus should not be
considered limiting.
[0071] In preferred embodiments, the sequence composition of each
MID element is easily identifiable and resistant to introduced
error from sequencing processes. Some embodiments of MID element
comprise a unique sequence composition of nucleic acid species that
has minimal sequence similarity to a naturally occurring sequence.
Alternatively, embodiments of a MID element may include some degree
of sequence similarity to naturally occurring sequence.
[0072] Also, in preferred embodiments, the position of each MID
element is known relative to some feature of the template nucleic
acid molecule and/or adaptor elements coupled to the template
molecule. Having a known position of each MID is useful for finding
the MID element in sequence data and interpretation of the MID
sequence composition for possible errors and subsequent association
with the sample of origin.
[0073] For example, some features useful as anchors for positional
relationship to MID elements may include, but are not limited to,
the length of the template molecule (i.e. the MID element is known
to be so many sequence positions from the 5' or 3' end),
recognizable sequence markers such as a Key element and/or one or
more primer elements positioned adjacent to a MID element. In the
present example, the Key and primer elements generally comprise a
known sequence composition that typically does not vary from sample
to sample in the multiplex composition and may be employed as
positional references for searching for the MID element. An
analysis algorithm implemented by application 135 may be executed
on computer 130 to analyze generated sequence data for each MID
coupled template to identify the more easily recognizable Key
and/or primer elements, and extrapolate from those positions to
identify a sequence region presumed to include the sequence of the
MID element. Application 135 may then process the sequence
composition of the presumed region and possibly some distance away
in the flanking regions to positively identify the MID element and
its sequence composition.
[0074] Some or all of the described functional elements may be
combined into adaptor elements that are coupled to nucleotide
sequences in certain processing steps. For example, some
embodiments may associate priming sequence elements or regions
comprising complementary sequence composition to primer sequences
employed for amplification and/or sequencing. Further, the same
elements may be employed for what may be referred to as "strand
selection" and immobilization of nucleic acid molecules to a solid
phase substrate. In some embodiments, two sets of priming sequence
regions (hereafter referred to as priming sequence A, and priming
sequence B) may be employed for strand selection, where only single
strands having one copy of priming sequence A and one copy of
priming sequence B is selected and included as the prepared sample.
In alternative embodiments, design characteristics of the adaptor
elements eliminate the need for strand selection. The same priming
sequence regions may be employed in methods for amplification and
immobilization where, for instance, priming sequence B may be
immobilized upon a solid substrate and amplified products are
extended therefrom.
[0075] Additional examples of sample processing for fragmentation,
strand selection, and addition of functional elements and adaptors
are described in U.S. Publication No. 2004-0185484, titled "Method
for preparing single-stranded DNA libraries", filed Jan. 28, 2004;
U.S. Publication No. 2009-0105959, titled "System and Method for
Identification of Individual Samples from a Multiplex Mixture",
filed May 29, 2008; and U.S. Publication No. 2011-0003701, titled
"System and Method for Improved Processing of Nucleic Acids for
Production of Sequencable Libraries", filed Feb. 23, 2009, each of
which is hereby incorporated by reference herein in its entirety
for all purposes.
[0076] Various examples of systems and methods for performing
amplification of template nucleic acid molecules to generate
populations of substantially identical copies are described. It
will be apparent to those of ordinary skill that it is desirable in
some embodiments of SBS to generate many copies of each nucleic
acid element to generate a stronger signal when one or more
nucleotide species is incorporated into each nascent molecule
associated with a copy of the template molecule. There are many
techniques known in the art for generating copies of nucleic acid
molecules such as, for instance, amplification using what are
referred to as bacterial vectors, "Rolling Circle" amplification
(described in U.S. Pat. Nos. 6,274,320 and 7,211,390, incorporated
by reference above) and Polymerase Chain Reaction (PCR) methods,
each of the techniques are applicable for use with the presently
described invention. One PCR technique that is particularly
amenable to high throughput applications include what are referred
to as emulsion PCR methods (also referred to as emPCR methods).
[0077] Typical embodiments of emulsion PCR methods include creating
a stable emulsion of two immiscible substances creating aqueous
droplets within which reactions may occur. In particular, the
aqueous droplets of an emulsion amenable for use in PCR methods may
include a first fluid, such as a water based fluid suspended or
dispersed as droplets (also referred to as a discontinuous phase)
within another fluid, such as a hydrophobic fluid (also referred to
as a continuous phase) that typically includes some type of oil.
Examples of oil that may be employed include, but are not limited
to, mineral oils, silicone based oils, or fluorinated oils.
[0078] Further, some emulsion embodiments may employ surfactants
that act to stabilize the emulsion, which may be particularly
useful for specific processing methods such as PCR. Some
embodiments of surfactant may include one or more of a silicone or
fluorinated surfactant. For example, one or more non-ionic
surfactants may be employed that include, but are not limited to,
sorbitan monooleate (also referred to as Span.RTM. 80,
Sigma-Aldrich, USA), polyoxyethylenesorbitsan monooleate (also
referred to as Tween.RTM. 80, Sigma-Aldrich, USA), or in some
preferred embodiments, dimethicone copolyol (also referred to as
Abil.RTM. EM90), polysiloxane, polyalkyl polyether copolymer,
polyglycerol esters, poloxamers, and PVP/hexadecane copolymers
(also referred to as Unimer U-151), or in more preferred
embodiments, a high molecular weight silicone polyether in
cyclopentasiloxane (also referred to as Dow Corning.RTM. 5225C
available from Dow Corning).
[0079] The droplets of an emulsion may also be referred to as
compartments, microcapsules, microreactors, microenvironments, or
other name commonly used in the related art. The aqueous droplets
may range in size depending on the composition of the emulsion
components or composition, contents contained therein, and
formation technique employed. The described emulsions create the
microenvironments within which chemical reactions, such as PCR, may
be performed. For example, template nucleic acids and all reagents
necessary to perform a desired PCR reaction may be encapsulated and
chemically isolated in the droplets of an emulsion. Additional
surfactants or other stabilizing agent may be employed in some
embodiments to promote additional stability of the droplets as
described above. Thermocycling operations typical of PCR methods
may be executed using the droplets to amplify an encapsulated
nucleic acid template resulting in the generation of a population
comprising many substantially identical copies of the template
nucleic acid. In some embodiments, the population within the
droplet may be referred to as a "clonally isolated",
"compartmentalized", "sequestered", "encapsulated", or "localized"
population. Also in the present example, some or all of the
described droplets may further encapsulate a solid substrate such
as a bead for attachment of template and amplified copies of the
template, amplified copies complementary to the template, or
combination thereof. Further, the solid substrate may be enabled
for attachment of other type of nucleic acids, reagents, labels, or
other molecules of interest.
[0080] After emulsion breaking and bead recovery, it may also be
desirable in typical embodiments to "enrich" for beads having a
successfully amplified population of substantially identical copies
of a template nucleic acid molecule immobilized thereon. For
example, a process for enriching for "DNA positive" beads may
include hybridizing a primer species to a region on the free ends
of the immobilized amplified copies, typically found in an adaptor
sequence, extending the primer using a polymerase mediated
extension reaction, and binding the primer to an enrichment
substrate such as a magnetic or sepharose bead. A selective
condition may be applied to the solution comprising the beads, such
as a magnetic field or centrifugation, where the enrichment bead is
responsive to the selective condition and is separated from the
"DNA negative" beads (i.e. NO: or few immobilized copies).
[0081] Embodiments of an emulsion useful with the presently
described invention may include a very high density of droplets or
microcapsules enabling the described chemical reactions to be
performed in a massively parallel way. Additional examples of
emulsions employed for amplification and their uses for sequencing
applications are described in U.S. Pat. Nos. 7,638,276; 7,622,280;
7,842,457; 7,927,797; and 8,012,690 and U.S. Patent Publication No.
2011-0201526, each of which is hereby incorporated by reference
herein in its entirety for all purposes.
[0082] Also embodiments sometimes referred to as Ultra-Deep
Sequencing, generate target specific amplicons for sequencing may
be employed with the presently described invention that include
using sets of specific nucleic acid primers to amplify a selected
target region or regions from a sample comprising the target
nucleic acid. Further, the sample may include a population of
nucleic acid molecules that are known or suspected to contain
sequence variants comprising sequence composition associated with a
research or diagnostic utility where the primers may be employed to
amplify and provide insight into the distribution of sequence
variants in the sample. For example, a method for identifying a
sequence variant by specific amplification and sequencing of
multiple alleles in a nucleic acid sample may be performed. The
nucleic acid is first subjected to amplification by a pair of PCR
primers designed to amplify a region surrounding the region of
interest or segment common to the nucleic acid population. Each of
the products of the PCR reaction (first amplicons) is subsequently
further amplified individually in separate reaction vessels such as
an emulsion based vessel described above. The resulting amplicons
(referred to herein as second amplicons), each derived from one
member of the first population of amplicons, are sequenced and the
collection of sequences are used to determine an allelic frequency
of one or more variants present. Importantly, the method does not
require previous knowledge of the variants present and can
typically identify variants present at <1% frequency in the
population of nucleic acid molecules.
[0083] Some advantages of the described target specific
amplification and sequencing methods include a higher level of
sensitivity than previously achieved and are particularly useful
for strategies comprising mixed populations of template nucleic
acid molecules. Further, embodiments that employ high throughput
sequencing instrumentation, such as for instance embodiments that
employ what is referred to as a PicoTiterPlate array (also
sometimes referred to as a PTP plate or array) of wells provided by
454 Life Sciences Corporation, the described methods can be
employed to generate sequence composition for over 100,000, over
300,000, over 500,000, or over 1,000,000 nucleic acid regions per
run or experiment and may depend, at least in part, on user
preferences such as lane configurations enabled by the use of
gaskets, etc. Also, the described methods provide a sensitivity of
detection of low abundance alleles which may represent 1% or less
of the allelic variants present in a sample. Another advantage of
the methods includes generating data comprising the sequence of the
analyzed region. Importantly, it is not necessary to have prior
knowledge of the sequence of the locus being analyzed.
[0084] Additional examples of target specific amplicons for
sequencing are described in U.S. Publication No. 2006-0228721,
titled "Methods for determining sequence variants using ultra-deep
sequencing", filed Apr. 12, 2005; PCT Publication WO 2008115427,
titled "System and Method for Detection of HIV Drug Resistant
Variants", filed Mar. 14, 2008, which was patented in the United
States as U.S. Pat. No. 8,617,816 on Dec. 13, 2013; and U.S. Pat.
No. 7,888,034, titled "System and Method for Detection of HIV
Tropism Variants", filed Jun. 17, 2009; and US Publication No.
2010-0136516, titled "System and Method for Detection of HIV
Integrase Variants", filed Nov. 19, 2009, each of which is hereby
incorporated by reference herein in its entirety for all
purposes.
[0085] Further, embodiments of sequencing may include Sanger type
techniques, techniques generally referred to as Sequencing by
Hybridization (SBH), Sequencing by Ligation (SBL), or Sequencing by
Incorporation (SBI) techniques. The sequencing techniques may also
include what are referred to as polony sequencing techniques;
nanopore, waveguide and other single molecule detection techniques;
or reversible terminator techniques. As described above, a
preferred technique may include Sequencing by Synthesis methods.
For example, some SBS embodiments sequence populations of
substantially identical copies of a nucleic acid template and
typically employ one or more oligonucleotide primers designed to
anneal to a predetermined, complementary position of the sample
template molecule or one or more adaptors attached to the template
molecule. The primer/template complex is presented with a
nucleotide species in the presence of a nucleic acid polymerase
enzyme. If the nucleotide species is complementary to the nucleic
acid species corresponding to a sequence position on the sample
template molecule that is directly adjacent to the 3' end of the
oligonucleotide primer, then the polymerase will extend the primer
with the nucleotide species. Alternatively, in some embodiments the
primer/template complex is presented with a plurality of nucleotide
species of interest (typically A, G, C, and T) at once, and the
nucleotide species that is complementary at the corresponding
sequence position on the sample template molecule directly adjacent
to the 3' end of the oligonucleotide primer is incorporated. In
either of the described embodiments, the nucleotide species may be
chemically blocked (such as at the 3'-O position) to prevent
further extension, and need to be deblocked prior to the next round
of synthesis. It will also be appreciated that the process of
adding a nucleotide species to the end of a nascent molecule is
substantially the same as that described above for addition to the
end of a primer.
[0086] As described above, incorporation of the nucleotide species
can be detected by a variety of methods known in the art, e.g. by
detecting the release of pyrophosphate (PPi) using an enzymatic
reaction process to produce light or via detection the release of
H.sup.+ and measurement of pH change (examples described in U.S.
Pat. Nos. 6,210,891; 6,258,568; and 6,828,100, each of which is
hereby incorporated by reference herein in its entirety for all
purposes), or via detectable labels bound to the nucleotides. Some
examples of detectable labels include, but are not limited to, mass
tags and fluorescent or chemiluminescent labels. In typical
embodiments, unincorporated nucleotides are removed, for example by
washing. Further, in some embodiments, the unincorporated
nucleotides may be subjected to enzymatic degradation such as, for
instance, degradation using the apyrase or pyrophosphatase enzymes
as described in U.S. Publication No. 2009-0053724, titled "System
and Method for Adaptive Reagent Control in Nucleic Acid
Sequencing", filed Jun. 27, 2008; and U.S. Publication No.
2009-0203086, titled "System and Method for Improved Signal
Detection in Nucleic Acid Sequencing", filed Jan. 29, 2009; each of
which is hereby incorporated by reference herein in its entirety
for all purposes.
[0087] In the embodiments where detectable labels are used, they
will typically have to be inactivated (e.g. by chemical cleavage or
photobleaching) prior to the following cycle of synthesis. The next
sequence position in the template/polymerase complex can then be
queried with another nucleotide species, or a plurality of
nucleotide species of interest, as described above. Repeated cycles
of nucleotide addition, extension, signal acquisition, and washing
result in a determination of the nucleotide sequence of the
template strand. Continuing with the present example, a large
number or population of substantially identical template molecules
(e.g. 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6 or 10.sup.7 molecules)
are typically analyzed simultaneously in any one sequencing
reaction, in order to achieve a signal which is strong enough for
reliable detection.
[0088] In addition, it may be advantageous in some embodiments to
improve the read length capabilities and qualities of a sequencing
process by employing what may be referred to as a "paired-end"
sequencing strategy. For example, some embodiments of sequencing
method have limitations on the total length of molecule from which
a high quality and reliable read may be generated. In other words,
the total number of sequence positions for a reliable read length
may not exceed 25, 50, 100, or 500 bases depending on the
sequencing embodiment employed. A paired-end sequencing strategy
extends reliable read length by separately sequencing each end of a
molecule (sometimes referred to as a "tag" end) that comprise a
fragment of an original template nucleic acid molecule at each end
joined in the center by a linker sequence. The original positional
relationship of the template fragments is known and thus the data
from the sequence reads may be re-combined into a single read
having a longer high quality read length. Further examples of
paired-end sequencing embodiments are described in U.S. Pat. No.
7,601,499, titled "Paired end sequencing"; and in U.S. Publication
No. 2009-0233291, titled "Paired end sequencing", filed Jan. 28,
2009, each of which is hereby incorporated by reference herein in
its entirety for all purposes.
[0089] Some examples of SBS apparatus may implement some or all of
the methods described above and may include one or more of a
detection device such as a charge coupled device (i.e., CCD
camera), complementary metal oxide semiconductor (CMOS), or
confocal type architecture for optical detection, Ion-Sensitive
Field Effect Transistor (also referred to as "ISFET") or
Chemical-Sensitive Field Effect Transistor (also referred to as
"ChemFET") for architectures for ion or chemical detection, a
microfluidics chamber or flow cell, a reaction substrate, and/or a
pump and flow valves. Taking the example of pyrophosphate-based
sequencing, some embodiments of an apparatus may employ a
chemiluminescent detection strategy that produces an inherently low
level of background noise.
[0090] In some embodiments, the reaction substrate for sequencing
may include a planar substrate, such as a slide type substrate, a
semiconductor chip comprising well type structures with ISFET
detection elements contained therein, or waveguide type reaction
substrate that in some embodiments may comprise well type
structures. Further, the reaction substrate may include what is
referred to as a PTP array available from 454 Life Sciences
Corporation, as described above, formed from a fiber optic
faceplate that is acid-etched to yield hundreds of thousands or
more of very small wells each enabled to hold a population of
substantially identical template molecules (i.e., some preferred
embodiments comprise about 3.3 million wells on a 70.times.75 mm
PTP array at a 35 .mu.m well to well pitch). In some embodiments,
each population of substantially identical template molecule may be
disposed upon a solid substrate, such as a bead, each of which may
be disposed in one of said wells. For example, an apparatus may
include a reagent delivery element for providing fluid reagents to
the PTP plate holders, as well as a CCD type detection device
enabled to collect photons of light emitted from each well on the
PTP plate. An example of reaction substrates comprising
characteristics for improved signal recognition is described in
U.S. Pat. No. 7,682,816, titled "Thin-Film Coated Microwell Arrays
and Methods of Making Same", filed Aug. 30, 2005, which is hereby
incorporated by reference herein in its entirety for all purposes.
Further examples of apparatus and methods for performing SBS type
sequencing and pyrophosphate sequencing are described in U.S. Pat.
Nos. 7,323,305 and 7,575,865, both of which are incorporated by
reference above.
[0091] In addition, systems and methods may be employed that
automate one or more sample preparation processes, such as the
emPCR process described above. For example, automated systems may
be employed to provide an efficient solution for generating an
emulsion for emPCR processing, performing PCR Thermocycling
operations, and enriching for successfully prepared populations of
nucleic acid molecules for sequencing. Examples of automated sample
preparation systems are described in U.S. Pat. No. 7,927,797; and
U.S. Publication No. 2011-0177587, each of which is hereby
incorporated by reference herein in its entirety for all
purposes.
[0092] Also, the systems and methods of the presently described
embodiments of the invention may include implementation of some
design, analysis, or other operation using a computer readable
medium stored for execution on a computer system. For example,
several embodiments are described in detail below to process
detected signals and/or analyze data generated using SBS systems
and methods where the processing and analysis embodiments are
implementable on computer systems.
[0093] In some embodiments a data processing application includes
algorithms for correcting raw sequence data for the accumulations
of CAFIE error. For example, some or all of the CAIFE error factors
may be accurately approximated and applied to a theoretical
flowgram model to provide a representation of real data obtained
from an actual sequencing run and subsequently approximate a
theoretical flowgram from an observed flowgram using an inversion
of a mathematical model. Thus, an approximation of error may be
applied to actual sequencing data represented in an observed
flowgram to produce a theoretical flowgram representing the
sequence composition of a target nucleic acid with all or
substantially all of the error factors removed. Additional examples
of CAFIE correction embodiments are described in U.S. Pat. Nos.
8,301,394; and 8,364,417, each of which are hereby incorporated by
reference herein in its entirety for all purposes.
[0094] An exemplary embodiment of a computer system for use with
the presently described invention may include any type of computer
platform such as a workstation, a personal computer, a server, or
any other present or future computer. It will, however, be
appreciated by one of ordinary skill in the art that the
aforementioned computer platforms as described herein are
specifically configured to perform the specialized operations of
the described invention and are not considered general purpose
computers. Computers typically include known components, such as a
processor, an operating system, system memory, memory storage
devices, input-output controllers, input-output devices, and
display devices. It will also be understood by those of ordinary
skill in the relevant art that there are many possible
configurations and components of a computer and may also include
cache memory, a data backup unit, and many other devices.
[0095] Display devices may include display devices that provide
visual information, this information typically may be logically
and/or physically organized as an array of pixels. An interface
controller may also be included that may comprise any of a variety
of known or future software programs for providing input and output
interfaces. For example, interfaces may include what are generally
referred to as "Graphical User Interfaces" (often referred to as
GUI's) that provides one or more graphical representations to a
user. Interfaces are typically enabled to accept user inputs using
means of selection or input known to those of ordinary skill in the
related art.
[0096] In the same or alternative embodiments, applications on a
computer may employ an interface that includes what are referred to
as "command line interfaces" (often referred to as CLI's). CLI's
typically provide a text based interaction between an application
and a user. Typically, command line interfaces present output and
receive input as lines of text through display devices. For
example, some implementations may include what are referred to as a
"shell" such as Unix Shells known to those of ordinary skill in the
related art, or Microsoft Windows Powershell that employs
object-oriented type programming architectures such as the
Microsoft .NET framework.
[0097] Those of ordinary skill in the related art will appreciate
that interfaces may include one or more GUI's, CLI's or a
combination thereof.
[0098] A processor may include a commercially available processor
such as a Celeron, Core, or Pentium processor made by Intel
Corporation, a SPARC processor made by Sun Microsystems, an Athlon,
Sempron, Phenom, or Opteron processor made by AMD corporation, or
it may be one of other processors that are or will become
available. Some embodiments of a processor may include what is
referred to as Multi-core processor and/or be enabled to employ
parallel processing technology in a single or multi-core
configuration. For example, a multi-core architecture typically
comprises two or more processor "execution cores". In the present
example, each execution core may perform as an independent
processor that enables parallel execution of multiple threads. In
addition, those of ordinary skill in the related will appreciate
that a processor may be configured in what is generally referred to
as 32 or 64 bit architectures, or other architectural
configurations now known or that may be developed in the
future.
[0099] A processor typically executes an operating system, which
may be, for example, a Windows-type operating system (such as
Windows XP, Windows Vista, or Windows 7) from the Microsoft
Corporation; the Mac OS X operating system from Apple Computer
Corp. (such as Mac OS X v10.6 "Snow Leopard" operating systems); a
Unix or Linux-type operating system available from many vendors or
what is referred to as an open source; another or a future
operating system; or some combination thereof. An operating system
interfaces with firmware and hardware in a well-known manner, and
facilitates the processor in coordinating and executing the
functions of various computer programs that may be written in a
variety of programming languages. An operating system, typically in
cooperation with a processor, coordinates and executes functions of
the other components of a computer. An operating system also
provides scheduling, input-output control, file and data
management, memory management, and communication control and
related services, all in accordance with known techniques.
[0100] System memory may include any of a variety of known or
future memory storage devices. Examples include any commonly
available random access memory (RAM), magnetic medium, such as a
resident hard disk or tape, an optical medium such as a read and
write compact disc, or other memory storage device. Memory storage
devices may include any of a variety of known or future devices,
including a compact disk drive, a tape drive, a removable hard disk
drive, USB or flash drive, or a diskette drive. Such types of
memory storage devices typically read from, and/or write to, a
program storage medium such as, respectively, a compact disk,
magnetic tape, removable hard disk, USB or flash drive, or floppy
diskette. Any of these program storage media, or others now in use
or that may later be developed, may be considered a computer
program product. As will be appreciated, these program storage
media typically store a computer software program and/or data.
Computer software programs, also called computer control logic,
typically are stored in system memory and/or the program storage
device used in conjunction with memory storage device.
[0101] In some embodiments, a computer program product is described
comprising a computer usable medium having control logic (computer
software program, including program code) stored therein. The
control logic, when executed by a processor, causes the processor
to perform functions described herein. In other embodiments, some
functions are implemented primarily in hardware using, for example,
a hardware state machine. Implementation of the hardware state
machine so as to perform the functions described herein will be
apparent to those skilled in the relevant arts.
[0102] Input-output controllers could include any of a variety of
known devices for accepting and processing information from a user,
whether a human or a machine, whether local or remote. Such devices
include, for example, modem cards, wireless cards, network
interface cards, sound cards, or other types of controllers for any
of a variety of known input devices. Output controllers could
include controllers for any of a variety of known display devices
for presenting information to a user, whether a human or a machine,
whether local or remote. In the presently described embodiment, the
functional elements of a computer communicate with each other via a
system bus. Some embodiments of a computer may communicate with
some functional elements using network or other types of remote
communications.
[0103] As will be evident to those skilled in the relevant art, an
instrument control and/or a data processing application, if
implemented in software, may be loaded into and executed from
system memory and/or a memory storage device. All or portions of
the instrument control and/or data processing applications may also
reside in a read-only memory or similar device of the memory
storage device, such devices not requiring that the instrument
control and/or data processing applications first be loaded through
input-output controllers. It will be understood by those skilled in
the relevant art that the instrument control and/or data processing
applications, or portions of it, may be loaded by a processor in a
known manner into system memory, or cache memory, or both, as
advantageous for execution.
[0104] Also, a computer may include one or more library files,
experiment data files, and an internet client stored in system
memory. For example, experiment data could include data related to
one or more experiments or assays such as detected signal values,
or other values associated with one or more SBS experiments or
processes. Additionally, an internet client may include an
application enabled to accesses a remote service on another
computer using a network and may for instance comprise what are
generally referred to as "Web Browsers". In the present example,
some commonly employed web browsers include Microsoft Internet
Explorer available from Microsoft Corporation, Mozilla Firefox from
the Mozilla Corporation, Safari from Apple Computer Corp., Google
Chrome from the Google Corporation, or other type of web browser
currently known in the art or to be developed in the future. Also,
in the same or other embodiments an internet client may include, or
could be an element of, specialized software applications enabled
to access remote information via a network such as a data
processing application for biological applications.
[0105] A network may include one or more of the many various types
of networks well known to those of ordinary skill in the art. For
example, a network may include a local or wide area network that
may employ what is commonly referred to as a TCP/IP protocol suite
to communicate. A network may include a network comprising a
worldwide system of interconnected computer networks that is
commonly referred to as the internet, or could also include various
intranet architectures. Those of ordinary skill in the related arts
will also appreciate that some users in networked environments may
prefer to employ what are generally referred to as "firewalls"
(also sometimes referred to as Packet Filters, or Border Protection
Devices) to control information traffic to and from hardware and/or
software systems. For example, firewalls may comprise hardware or
software elements or some combination thereof and are typically
designed to enforce security policies put in place by users, such
as for instance network administrators, etc.
b. Embodiments of the Presently-Described Invention
[0106] As described above, the described invention relates to a
system and method for increasing the amount of amplification
product relative to the number of available primers of a primer
species by employing a unique Concatamer PCR approach that enables
the production of a high ratio of amplified DNA copies relative to
the amount of primers attached to a surface. In embodiments
described below, specialized "concatamer primer" species initiate
concatenation of a template DNA molecule in a first or early rounds
of a PCR type amplification reaction that self-perpetuates without
the need for the concatamer primer species in subsequent rounds. It
will also be appreciated that in some embodiments isothermal
methods such as helicase dependent amplification, recombinase
polymerase amplification, G-quadruplex amplification, "Wildfire"
amplification and other unidentified methods that produce PCR like
products may be able to take advantage of this concatamer method.
In particular the design of the concatamer primer species
alleviates the need to design self-priming regions into the
sequence composition of the template DNA molecule. The
amplification products from the concatamer PCR process described
herein are particularly useful for nucleic acid sequencing
embodiments.
[0107] In a typical sequencing embodiment, one or more instrument
elements may be employed that automate one or more process steps.
For example, embodiments of a sequencing method may be executed
using instrumentation to automate and carry out some or all process
steps. FIG. 1 provides an illustrative example of sequencing
instrument 100 constructed and arranged for sequencing processes
requiring capture of signals from one or more embodiments of
substrate 105. In some embodiments, reaction substrate 105
comprises a plurality of Ion Sensitive Field Effect Transistors
(often referred to as ISFET). Also in the same or alternative
embodiments, sequencing instrument 100 comprises a subsystem that
operatively couples with substrate 105 with one or more data
processing elements, and a fluidic subsystem that enables execution
of sequencing reactions on reaction substrate 105. It will,
however, be appreciated that for sequencing processes requiring
other modes of data capture (i.e. temperature, electric current,
electrochemical, etc.), a subsystem for the mode of data capture
may be employed which are known to those of ordinary skill in the
related art. For instance, a sample of template molecules may be
loaded onto reaction substrate 105 by user 101 or some automated
embodiment, then sequenced in a massively parallel manner using
sequencing instrument 100 to produce sequence data representing the
sequence composition of each template nucleic acid molecule.
Importantly, user 101 may include any type of user of sequencing
technologies.
[0108] In some embodiments, samples may be optionally prepared for
sequencing in a fully automated or partially automated fashion
using sample preparation instrument 180 configured to perform some
or all of the necessary sample preparation steps for sequencing
using instrument 100. Those of ordinary skill in the art will
appreciate that sample preparation instrument 180 is provided for
the purposes of illustration and may represent one or more
instruments each designed to carry out some or all of the steps
associated with sample preparation required for a particular
sequencing assay. Examples of sample preparation instruments may
include robotic and/or microfluidic platforms such as those
available from Hamilton Robotics, Fluidigm Corporation, Beckman
Coulter, Agilent Technologies, or Caliper Life Sciences.
[0109] Further, as illustrated in FIG. 1, sequencing instrument 100
may be operatively linked to one or more external computer
components, such as computer 130 that may, for instance, execute
system software or firmware, such as application 135 that may
provide instructional control of one or more of the instruments,
such as sequencing instrument 100 or sample preparation instrument
180, and/or signal processing/data analysis functions. Computer 130
may be additionally operatively connected to other computers or
servers via network 150 that may enable remote operation of
instrument systems and the export of large amounts of data to
systems capable of storage and processing. Also in some embodiments
network 150 may enable what is referred to as "cloud computing" for
signal processing and/or data analysis functions. In the present
example, sequencing instrument 100 and/or computer 130 may include
some or all of the components and characteristics of the
embodiments generally described herein.
[0110] An embodiment of the concatamer PCR process using an
embodiment of concatamer primer species is graphically illustrated
in FIG. 2. For example, panel (A) of FIG. 2 includes an embodiment
of concatamer primer 205 that comprises a first region and a second
region (illustrated as A and B' respectively) where the first
region is complementary to a region associated with template
molecule 210. In some embodiments the region complementary to
concatamer primer 205 includes a region of an adaptor sequence,
such as adaptor 212 region. Additional examples of sample
processing, strand selection, and addition of functional elements
and adaptors are described above.
[0111] It will also be appreciated that in some embodiments
standard PCR primers may also be employed to perform some function,
such as for instance to immobilization of a template molecule to a
bead substrate and extension of a first immobilized copy that
concatamer primer 205 may then hybridize to. This process could
include the immobilization of thousands or millions of
substantially identical copies of a template molecule on the bead
at about a one to one ratio of copies to the number of immobilized
primers on the bead. In the described embodiments there may be one
primer species (i.e. an A primer) in solution and a second primer
species (i.e. a B primer) immobilized on the bead substrate. For
instance, in the example of FIG. 2 template molecule 210 may
represent a complementary extension product from the bead
substrate. In the described example primer 214 (i.e. a B primer) is
immobilized on the bead surface that hybridized to a complementary
B' region of an adaptor ligated to an original template molecule
that may include a fragment from a larger molecule or an
amplification product.
[0112] Panel (B) of FIG. 2 illustrates the result of polymerase
extension products from concatamer primer 205 that includes a
complementary copy of template molecule 210 as well as a new B
region that is a complement to the second (B') region of concatamer
primer 205. Panel (C) illustrates the result of denaturation of the
strands in panel (B) and re-hybridization of the newly synthesized
B' region to the newly synthesized B region to the end of template
molecule 210. It will be appreciated, however, that some percentage
of molecules will re-hybridize to the original complement.
[0113] Panel (D) of FIG. 2 then illustrates the result of
polymerase extension from the re-hybridized product in panel (C)
that illustrates a concatamer comprising template molecule 210 and
a first copy, template molecule 210'.
[0114] It is important to note that some embodiments of polymerase
enzymes may performed better than others in the described
concatamer amplification embodiments. For example, an embodiment of
deep vent polymerase provided a superior result than other
polymerase enzymes both from a yield and specificity standpoint. In
general embodiments of polymerase enzymes that lack a 5' to 3'
exonuclease activity perform better than embodiments of taq
polymerase that retains its 5' to 3' exonuclease activity.
[0115] FIG. 3 provides an illustrative example, of the products of
multiple rounds of denaturation and extension the can produce
immobilized concatamer products having 2.times. and 3.times. the
number of original immobilized copies, although it will be
appreciated that greater than 3.times. concatamers are
possible.
EXAMPLES
Concatamer PCR on 20 .mu.m Beads
[0116] Standard emulsion creation, breaking and enriching
procedures were employed
Reaction Conditions
TABLE-US-00001 [0117] Reagent Concentration Tris-Sulfate 39 mM
(NH.sub.4).sub.2SO.sub.4 11.7 mM MgSO.sub.4 2.55 mM total dNTP***
3.52 mM Tween .RTM. 80 0.005% BSA 0.05% DNA template 0.04 uM
Standard PCR Primer 5.87 uM Concatemer primer 0.04 uM DeepVent Exo+
0.20 U/uL Ppiase 0.03 U/uL
Thermocycler Program: PCR_20
[0118] 94 for 4 minutes
[0119] 94 for 30 seconds
[0120] 58 for 60 seconds
[0121] 68 for 60 seconds
[0122] cycle 20 times
[0123] 68 for 2 minutes
[0124] 14 forever
TABLE-US-00002 MA2 primer and template set ID Name Final oligo A
primer (seq primer) MA2 CCCGCATAATCTCCCACTCc (SEQ ID NO: 1) B
primer on bead MMP3B CCTATCCCCTGTGTGCCTTG (SEQ ID NO: 2)
Concatamer Primers (Tested Separately as They Would Anneal to Each
Other if Used Together)
TABLE-US-00003 [0125] MApB2 primer (SEQ ID NO: 3)
GGAGTGGGAGATTATGCGGGCCTATCCCCTGTGTGCCTTG MBpA2 primer (SEQ ID NO:
4) CAAGGCACACAGGGGATAGGCCCGCATAATCTCCCACTCC Template (A-100 nt-B')
MAB2 100 nt (SEQ ID NO: 5)
CCCGCATAATCTCCCACTCcTCAGATGCCTAGTAAACAATGTTCGATCCG
GCGAAGTCTGCAAGAATCCAGCGCTGCCGGTTCGTCGGCGCTGTGCCGTG
GAGCTGACCTGATCGACGACTCGTCAAGGCACACAGGGGATAGG MA3 primer and
template set A primer (seq primer) MA3 (SEQ ID NO: 6)
CGCCCGTCTCTTTCTACCAc B primer on bead MMP3B (SEQ ID NO: 2)
CCTATCCCCTGTGTGCCTTG
Concatemer Primers (Tested Separately as They Would Anneal to Each
Other if Used Together)
TABLE-US-00004 [0126] MApB3 primer (SEQ ID NO: 7)
GTGGTAGAAAGAGACGGGCGCCTATCCCCTGTGTGCCTTG MBpA3 primer (SEQ ID NO:
8) CAAGGCACACAGGGGATAGGCGCCCGTCTCTTTCTACCAC Truncated Template
(A-100 nt-B') (SEQ ID NO: 9) 100
ntCGCCCGTCTCTTTCTACCAcTCAGATGCCTAGTAAACAATGTTC
GATCCGGCGAAGTCTGCAAGAATCCAGCGCTGCCGGTTCGTCGGCGCTGT
GCCGTGGAGCTGACCTGATCGACGACTCGTCAAGGCACACAGGGGATAGG
[0127] The bead immobilized products were recovered and subjected
to FACS analysis. A representation of analyzed signals are
represented in FIG. 4 that show that when using concatamer primers,
a higher signal is produced compared to standard primers are used
alone. This is indicative of product concatenation. Additionally,
in both cases the BpA primers produce higher signal than the
ApB.
[0128] Further, as illustrated in FIG. 5, the use of concatamer
primers results in multiple size products while the single standard
primer results in a single defined peak. When sequenced, the signal
per base is higher when using concatamer primers when compared to
the single standard primer alone as illustrated in FIG. 6.
[0129] In addition, as the sequencing flowgram in FIG. 7A
illustrates, the results on a GS-FLX instrument shows that the
concatamer reaction produces a sequencing pattern that matches the
expected flowgram. When the reaction begins to strand displace the
next sequencing primer, signals and patterns start to weaken as
expected due to the double stranded nature of the structure and
because not all strands will have a second concatamer copy.
Whereas, as expected, single primer standard PCR does not produce a
flowgram after the initial template is sequenced as illustrated in
FIG. 7B.
Concatamer PCR on .about.1.4 .nu.m Beads
[0130] Another challenge was amplifying enough templates onto a
smaller capture bead (.about.1.4 .mu.m) to enable sequencing.
Subsequently, evaluation of concatamer PCR onto a small .about.1.4
.mu.m capture bead was explored.
[0131] The experiment was non-emulsion solid phase amplification to
determine feasibility of amplification of the concatamer product
onto a smaller capture bead. PCR conditions evaluated listed in
Table 1. Post thermocycling, the beads underwent melt assay, where
PCR product not bound to the capture beads could be collected,
purified, and run on a gel. The PCR product bound to the capture
beads post clean-up would be annealed with a FAM complementary
primer and run on a flow cytometer.
TABLE-US-00005 TABLE 1 List of PCR reactions tested. Capture Beads
Samples ~1.4 .mu.m bead 1) MABT3 + MApB + MA3 ~1.4 .mu.m bead 2)
MABT3 + MBpA + MA3 ~1.4 .mu.m bead 3) MABT3 + MA3
[0132] Concatamer products purified from the melt assay were run on
an Agilent Bioanalyzer and the electropherogram, illustrated in
FIG. 8, shows that concatenation occurred when MApB or MABp
concatamer primers were used When, only the solution primer was
used, peak was observed .about.148 bp, the length of the MABT3
template.
[0133] In instances whether MApB or MBpA concatamer primers were
used, main peak height observed were .about.148 bp intervals
similar to what was observed for 20 .mu.m capture bead, as
illustrated in FIG. 9.
[0134] The fluorescence was measured with a BD Accuri.TM. C6 Flow
Cytometer on beads amplified with either concatamer primers when
compared to PCR reaction with just solution primer showed increase
in fluorescence Table 2. This suggested with same number of PCR
cycles, PCR reactions with concatamer primers yielded more
product.
TABLE-US-00006 TABLE 2 Median fluorescence observed for PCR
reactions with and without concatamer primers. Fluorescence was
normalized to PCR reaction without concatamer primers. Normalized
Plot 4: Multiple Samples Median to solution Gated on R1 FL1-A
primer A04 JSR MAB3T + MApB + MA3: This Plot 5,391.00 1.50 A05 JSR
MAB3T + MABp + MA3: This Plot 4,518.00 1.26 A06 JSR MAB3T + MA3:
This Plot 3,600.00 1
[0135] Non-Emulsion Based Solid Phase Amplification PCR
Reagents
TABLE-US-00007 Reaction conditions Reagent Concentration
Tris-Sulfate 39 mM (NH.sub.4).sub.2SO.sub.4 11.7 mM MgSO.sub.4 2.55
mM total dNTP 3.52 mM Tween 80 0.005% BSA 0.05% DNA template 0.08
uM Standard PCR Primer 5.87 uM Concatamer Primer 0.04 uM Deep Vent
Exo+ 0.38 U/uL PPiase 2.5 U/uL
TABLE-US-00008 Steps Temperature and Time 1 94.degree. C. for 4
minutes 2 94.degree. C. for 30 seconds 3 58.degree. C. for 60
seconds 4 68.degree. C. for 60 seconds 5 cycle steps 2-4 nineteen
times 6 68 for 2 minutes 7 14 forever
[0136] Having described various embodiments and implementations, it
should be apparent to those skilled in the relevant art that the
foregoing is illustrative only and not limiting, having been
presented by way of example only. Many other schemes for
distributing functions among the various functional elements of the
illustrated embodiments are possible. The functions of any element
may be carried out in various ways in alternative embodiments.
Other Embodiments
[0137] From the foregoing description, it will be apparent that
variations and modifications may be made to the invention described
herein to adopt it to various usages and conditions. Such
embodiments are also within the scope of the following claims.
[0138] The recitation of a listing of elements in any definition of
a variable herein includes definitions of that variable as any
single element or combination (or subcombination) of listed
elements. The recitation of an embodiment herein includes that
embodiment as any single embodiment or in combination with any
other embodiments or portions thereof.
Sequence CWU 1
1
17120DNAArtificial SequenceSynthetic Polynucleotide 1cccgcataat
ctcccactcc 20220DNAArtificial SequenceSynthetic polynucleotide
2cctatcccct gtgtgccttg 20340DNAArtificial SequenceSynthetic
polynucleotide 3ggagtgggag attatgcggg cctatcccct gtgtgccttg
40440DNAArtificial SequenceSynthetic polynucleotide 4caaggcacac
aggggatagg cccgcataat ctcccactcc 405143DNAArtificial
SequenceSynthetic polynucleotide 5ccgcataatc tcccactcct cagatgccta
gtaaacaatg ttcgatccgg cgaagtctgc 60aagaatccag cgctgccggt tcgtcggcgc
tgtgccgtgg agctgacctg atcgacgact 120cgtcaaggca cacaggggat agg
143620DNAArtificial SequenceSynthetic polynucleotide 6cgcccgtctc
tttctaccac 20740DNAArtificial SequenceSynthetic polynucleotide
7gtggtagaaa gagacgggcg cctatcccct gtgtgccttg 40840DNAArtificial
SequenceSynthetic polynucleotide 8caaggcacac aggggatagg cgcccgtctc
tttctaccac 409144DNAArtificial SequenceSynthetic polynucleotide
9cgcccgtctc tttctaccac tcagatgcct agtaaacaat gttcgatccg gcgaagtctg
60caagaatcca gcgctgccgg ttcgtcggcg ctgtgccgtg gagctgacct gatcgacgac
120tcgtcaaggc acacagggga tagg 1441044DNAArtificial
SequenceSynthetic polynucleotide 10aggtatgggt tggtgagtgg aaagacgcct
gccctcctta ctac 4411148DNAArtificial SequenceSynthetic
polynucleotide 11tgcggacggg aggaatgatg agtctacgga tcatttgtta
caagctaggc cgcttcagac 60gttcttaggt cgcgacggcc aagcagccgc gacacggcac
ctcgactgga ctagctgctg 120agcatccata cccaaccact cacctttc
14812172DNAArtificial SequenceSynthetic polynucleotide 12aggtatgggt
tggtgagtgg aaagacgcct gccctcctta ctactcagat gcctagtaaa 60caatgttcga
tccggcgaag tctgcaagaa tccagcgctg ccggttcgtc ggcgctgtgc
120cgtggagctg acctgatcga cgactcgtag gtatgggttg gtgagtggaa ag
17213172DNAArtificial SequenceSynthetic polynucleotide 13tccataccca
accactcacc tttctgcgga cgggaggaat gatgagtcta cggatcattt 60gttacaagct
aggccgcttc agacgttctt aggtcgcgac ggccaagcag ccgcgacacg
120gcacctcgac tggactagct gctgagcatc catacccaac cactcacctt tc
17214172DNAArtificial SequenceSynthetic polynucleotide 14aggtatgggt
tggtgagtgg aaagacgcct gccctcctta ctactcagat gcctagtaaa 60caatgttcga
tccggcgaag tctgcaagaa tccagcgctg ccggttcgtc ggcgctgtgc
120cgtggagctg acctgatcga cgactcgtag gtatgggttg gtgagtggaa ag
17215172DNAArtificial SequenceSynthetic polynucleotide 15tccataccca
accactcacc tttctgcgga cgggaggaat gatgagtcta cggatcattt 60gttacaagct
aggccgcttc agacgttctt aggtcgcgac ggccaagcag ccgcgacacg
120gcacctcgac tggactagct gctgagcatc catacccaac cactcacctt tc
17216320DNAArtificial SequenceSynthetic polynucleotide 16aggtatgggt
tggtgagtgg aaagacgcct gccctcctta ctactcagat gcctagtaaa 60caatgttcga
tccggcgaag tctgcaagaa tccagcgctg ccggttcgtc ggcgctgtgc
120cgtggagctg acctgatcga cgactcgtag gtatgggttg gtgagtggaa
agacgcctgc 180cctccttact actcagatgc ctagtaaaca atgttcgatc
cggcgaagtc tgcaagaatc 240cagcgctgcc ggttcgtcgg cgctgtgccg
tggagctgac ctgatcgacg actcgtaggt 300atgggttggt gagtggaaag
32017320DNAArtificial SequenceSynthetic polynucleotide 17tccataccca
accactcacc tttctgcgga cgggaggaat gatgagtcta cggatcattt 60gttacaagct
aggccgcttc agacgttctt aggtcgcgac ggccaagcag ccgcgacacg
120gcacctcgac tggactagct gctgagcatc catacccaac cactcacctt
tctgcggacg 180ggaggaatga tgagtctacg gatcatttgt tacaagctag
gccgcttcag acgttcttag 240gtcgcgacgg ccaagcagcc gcgacacggc
acctcgactg gactagctgc tgagcatcca 300tacccaacca ctcacctttc 320
* * * * *