U.S. patent application number 15/288558 was filed with the patent office on 2017-08-31 for compounds modulating c-fms and/or c-kit activity and uses therefor.
The applicant listed for this patent is Plexxikon Inc.. Invention is credited to Dean R. Artis, Ryan Bremer, Prabha N. Ibrahim, Marika Nespi, Guoxian Wu, Chao Zhang, Jiazhong Zhang, Hongyao Zhu.
Application Number | 20170247370 15/288558 |
Document ID | / |
Family ID | 39322825 |
Filed Date | 2017-08-31 |
United States Patent
Application |
20170247370 |
Kind Code |
A1 |
Zhang; Jiazhong ; et
al. |
August 31, 2017 |
COMPOUNDS MODULATING C-FMS AND/OR C-KIT ACTIVITY AND USES
THEREFOR
Abstract
Compounds active on the receptor protein tyrosine kinases c-kit
and/or c-fms are provided herewith. Also provided herewith are
compositions useful for treatment of c-kit mediated diseases or
conditions and/or c-fms-mediated diseases or conditions, and
methods for the use thereof.
Inventors: |
Zhang; Jiazhong;
(Burlingame, CA) ; Ibrahim; Prabha N.; (Mountain
View, CA) ; Artis; Dean R.; (Kensington, CA) ;
Bremer; Ryan; (Emeryville, CA) ; Wu; Guoxian;
(Palo Alto, CA) ; Zhu; Hongyao; (Cedar Park,
TX) ; Nespi; Marika; (Berkeley, CA) ; Zhang;
Chao; (Moraga, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Plexxikon Inc. |
Berkeley |
CA |
US |
|
|
Family ID: |
39322825 |
Appl. No.: |
15/288558 |
Filed: |
October 7, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14733830 |
Jun 8, 2015 |
9487515 |
|
|
15288558 |
|
|
|
|
14250331 |
Apr 10, 2014 |
9169250 |
|
|
14733830 |
|
|
|
|
13776547 |
Feb 25, 2013 |
8722702 |
|
|
14250331 |
|
|
|
|
13546923 |
Jul 11, 2012 |
8404700 |
|
|
13776547 |
|
|
|
|
12958379 |
Dec 1, 2010 |
8461169 |
|
|
13546923 |
|
|
|
|
11986667 |
Nov 21, 2007 |
7893075 |
|
|
12958379 |
|
|
|
|
60860749 |
Nov 22, 2006 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 3/04 20180101; A61P
29/00 20180101; A61P 37/08 20180101; A61P 7/00 20180101; A61P 11/06
20180101; A61P 19/02 20180101; A61P 11/02 20180101; A61P 9/10
20180101; A61P 1/04 20180101; A61P 17/00 20180101; A61K 31/5377
20130101; A61P 15/00 20180101; A61P 13/12 20180101; A61P 25/16
20180101; A61P 5/50 20180101; A61K 31/444 20130101; A61P 25/04
20180101; A61P 35/00 20180101; C07D 471/04 20130101; A61P 15/08
20180101; A61P 35/02 20180101; A61P 3/00 20180101; A61K 31/506
20130101; A61P 37/06 20180101; A61K 31/497 20130101; A61P 3/10
20180101; A61P 19/08 20180101; A61P 25/00 20180101; A61P 37/02
20180101; A61P 43/00 20180101; A61P 25/28 20180101; A61P 35/04
20180101; A61P 19/04 20180101; A61K 45/06 20130101; A61P 11/08
20180101; A61P 19/10 20180101; A61P 11/00 20180101 |
International
Class: |
C07D 471/04 20060101
C07D471/04 |
Claims
1. A compound having the chemical structure of Formula II,
##STR00923## all salts, prodrugs, tautomers, and isomers thereof,
wherein: D has a structure selected from the group consisting of
##STR00924## in which ##STR00925## indicates the attachment point
of D to A.sub.2 of Formula II; A.sub.2 is selected from the group
consisting of --CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--,
--S(O)--, --S(O).sub.2--, --NR.sup.21--, and --O--, provided,
however, that when A.sub.2 is NR.sup.21, N is not bound to a
nitrogen of D; B is selected from the group consisting of hydrogen,
halogen, optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, --OH,
--NH.sub.2, --NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; M.sub.4 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--NR.sup.39CH.sub.2CH.sub.2--, or --NR.sup.39C(O)--; M.sub.5,
M.sub.6, M.sub.7, M.sub.9, M.sub.10, M.sub.11, M.sub.12, M.sub.13,
M.sub.14, M.sub.15 M.sub.16, M.sub.17 and M.sub.18 are selected
from the group consisting of a bond, --(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.t--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub-
.s--, and
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2NR.sup.26--(CR.s-
up.19R.sup.20).sub.s--; M.sub.8 is selected from the group
consisting of a bond, --(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.w--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(O)--R(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)O--)CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s--, --(CR.sup.19R.sup.20).sub.w,
--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub.s--, and
--(CR.sup.19R.sup.20).sub.w,
--NR.sup.26S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub.s--;
wherein R.sup.19 and R.sup.20 at each occurrence are independently
selected from the group consisting of hydrogen, fluoro, --OH,
--NH.sub.2, lower alkyl, lower alkoxy, lower alkylthio,
mono-alkylamino, di-alkylamino, and --NR.sup.27R.sup.28, wherein
the alkyl chain(s) of lower alkyl, lower alkoxy, lower alkylthio,
mono-alkylamino, or di-alkylamino are optionally substituted with
one or more substituents selected from the group consisting of
fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino; or any two of
R.sup.19 and R.sup.20 on the same or different carbons combine to
form a 3-7 membered monocyclic cycloalkyl or 5-7 membered
monocyclic heterocycloalkyl and any others of R.sup.19 and R.sup.20
are independently selected from the group consisting of hydrogen,
fluoro, --OH, --NH.sub.2, lower alkyl, lower alkoxy, lower
alkylthio, mono-alkylamino, di-alkylamino, and --NR.sup.27R.sup.28,
wherein the alkyl chain(s) of lower alkyl, lower alkoxy, lower
alkylthio, mono-alkylamino, or di-alkylamino are optionally
substituted with one or more substituents selected from the group
consisting of fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, and
wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl
are optionally substituted with one or more substituents selected
from the group consisting of halogen, --OH, --NH.sub.2, lower
alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R.sup.21 is hydrogen or optionally substituted lower alkyl;
R.sup.23 at each occurrence is independently selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted lower alkenyl, provided, however, that no alkene carbon
thereof is bound to any --C(O)--, --C(S)--, --S(O)--,
--S(O).sub.2--, --O--, --S--, or --N-- of any of --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O)R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O)NHR.sup.23,
--NR.sup.23S(O)NH.sub.23, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, or
--NR.sup.33S(O).sub.2NR.sup.23R.sup.23, optionally substituted
lower alkynyl, provided, however, that no alkyne carbon thereof is
bound to any --C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, --O--,
--S--, or --N-- of any of --NHR.sup.32, --OR.sup.23, --SR.sup.23,
--C(O)R.sup.23, --C(S)R.sup.23, --S(O)R.sup.23,
--S(O).sub.2R.sup.23, --C(O)NHR.sup.23, --C(O)NR.sup.23R.sup.23,
--C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23, --S(O).sub.2NHR.sup.23,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.25,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O)NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23, or
--NR.sup.13S(O).sub.2NR.sup.23R.sup.23, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, and optionally substituted heteroaryl; R.sup.24
and R.sup.25 at each occurrence are independently selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted lower alkenyl, provided, however, that no alkene carbon
thereof is bound to the nitrogen of --NR.sup.24R.sup.25, optionally
substituted lower alkynyl, provided, however, that no alkyne carbon
thereof is bound to the nitrogen of --NR.sup.24R.sup.25, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl, and optionally substituted heteroaryl;
or R.sup.24 and R.sup.25 together with the nitrogen to which they
are attached form a monocyclic 5-7 membered optionally substituted
heterocycloalkyl or a monocyclic 5 or 7 membered optionally
substituted nitrogen containing heteroaryl; R.sup.26 at each
occurrence is independently selected from the group consisting of
hydrogen, lower alkyl, and lower alkyl substituted with one or more
substituents selected from the group consisting of fluoro, --OH,
--NH.sub.2, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
fluoro substituted mono-alkylamino, di-alkylamino, fluoro
substituted di-alkylamino, and --NR.sup.27R.sup.28, provided,
however, that when R.sup.26 is substituted lower alkyl, any
substitution on the lower alkyl carbon bound to the --N-- of
--NR.sup.26-- is fluoro; R.sup.27 and R.sup.28 combine with the
nitrogen to which they are attached to form a 5-7 membered
heterocycloalkyl or 5-7 membered heterocycloalkyl substituted with
one or more substituents selected from the group consisting of
fluoro, --OH, --NH.sub.2, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, and fluoro substituted lower alkylthio; Q.sup.1 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHS(O).sub.2R.sup.43, --NHC(O)R.sup.43, --NHR.sup.43,
--NR.sup.43R.sup.43, --OR.sup.43, SR.sup.43, S(O)R.sup.43, and
--S(O).sub.2R.sup.43; Q.sup.11, Q.sup.21, Q.sup.31, Q.sup.41,
Q.sup.51, Q.sup.61, Q.sup.71, Q.sup.81, Q.sup.91, Q.sup.101,
Q.sup.111, Q.sup.121, Q.sup.131 and Q.sup.141 are selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted heteroaryl;
Q.sup.12 is fluoro, chloro or --CF.sub.3; Q.sup.13 and Q.sup.14 are
independently hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl; Q.sup.22, Q.sup.24, Q.sup.32, Q.sup.33,
Q.sup.43, Q.sup.44, Q.sup.52, Q.sup.54, Q.sup.102 and Q.sup.104 are
independently selected from the group consisting of hydrogen,
halogen, lower alkyl, fluoro substituted lower alkyl,
--NR.sup.44R.sup.44, --OR.sup.44, and --SR.sup.44, provided,
however, that at least one of Q.sup.22 and Q.sup.24, at least one
of Q.sup.32 and Q.sup.33, at least one of Q.sup.43 and Q.sup.44, at
least one of Q.sup.52 and Q.sup.54, and at least one of Q.sup.102
and Q.sup.104 is hydrogen, fluoro, chloro, lower alkyl or fluoro
substituted lower alkyl; Q.sup.62, Q.sup.74, Q.sup.112, Q.sup.124,
Q.sup.132, Q.sup.144,and Q.sup.152 are hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44; Q.sup.64, Q.sup.72, Q.sup.82, and
Q.sup.94 are hydrogen, lower alkyl or fluoro substituted lower
alkyl; R.sup.43 at each occurrence is independently optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl or optionally substituted heteroaryl; R.sup.39 is hydrogen or
lower alkyl; R.sup.40 is lower alkyl or fluoro substituted lower
alkyl; each R.sup.44 is independently hydrogen, lower alkyl or
fluoro substituted lower alkyl; w is 1, 2, or 3; u is 1-6; t is
0-3; and s is 0-3; provided, however, that the compound is not
##STR00926## ##STR00927## ##STR00928##
Description
RELATED PATENT APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/546,923, filed Jul. 11, 2012, which is a
continuation of U.S. patent application Ser. No. 12/958,379, filed
Dec. 1, 2010, which is a divisional application of U.S. patent
application Ser. No. 11/986,667, filed Nov. 21, 2007, now U.S. Pat.
No. 7,893,075, issued Feb. 22, 2011, which claims priority to U.S.
Provisional App. No. 60/860,749, filed Nov. 22, 2006, and is
related to U.S. patent application Ser. No. 11/435,381, filed May
16, 2006, now U.S. Pat. No. 7,846,941, which claims the benefit of
U.S. Provisional App. No. 60/682,063, filed May 17, 2005, U.S.
Provisional App. No. 60/682,051, filed May 17, 2005, U.S.
Provisional App. No. 60/682,042, filed May 17, 2005, U.S.
Provisional App. No. 60/692,750, filed Jun. 22, 2005, and U.S.
Provisional App. No. 60/692,960, filed Jun. 22, 2005, all of which
are incorporated herein by reference in their entireties and for
all purposes.
FIELD OF THE INVENTION
[0002] This invention relates to ligands for c-fms and c-kit, and
to methods for use thereof. The information provided is intended
solely to assist the understanding of the reader. None of the
information provided nor references cited is admitted to be prior
art to the present invention. Each of the references cited is
incorporated herein in its entirety and for any purpose.
BACKGROUND OF THE INVENTION
[0003] C-fms and c-kit are both type III transmembrane receptor
protein tyrosine kinases (RPTKs) that regulate key signal
transduction cascades that control cellular growth and
proliferation. Both receptors have similar structural features
comprising five extracellular immunoglobulin (IG) domains, a single
transmembrane domain, and a split cytoplasmic kinase domain
separated by a kinase insert segment.
[0004] c-Fms
[0005] C-fms is a member of the family of genes originally isolated
from the Susan McDonough strain of feline sarcoma viruses. The
cellular proto-oncogene FMS (c-fms, cellular feline McDonough
sarcoma) codes for the receptor for the macrophage
colony-stimulating factor (M-CSF). C-fms is crucial for the growth
and differentiation of the monocyte-macrophage lineage, and upon
binding of M-CSF to the extracellular domain of c-fms, the receptor
dimerizes and trans-autophosphorylates cytoplasmic tyrosine
residues.
[0006] M-CSF, first described by Robinson and co-workers (Blood.
1969, 33:396-9), is a cytokine that controls the production,
differentiation, and function of macrophages. M-CSF stimulates
differentiation of progenitor cells to mature monocytes, and
prolongs the survival of monocytes. Furthermore, M-CSF enhances
cytotoxicity, superoxide production, phagocytosis, chemotaxis, and
secondary cytokine production of additional factors in monocytes
and macrophages. Examples of such additional factors include
granulocyte colony stimulating factor (G-CSF), interleukin-6
(IL-6), and interleukin-8 (IL-8). M-CSF stimulates hematopoiesis,
promotes differentiation and proliferation of osteoclast progenitor
cells, and has profound effects on lipid metabolism. Furthermore,
M-CSF is important in pregnancy. Physiologically, large amounts of
M-CSF are produced in the placenta, and M-CSF is believed to play
an essential role in trophoblast differentiation (Motoyoshi, Int J
Hematol. 1998, 67:109-22). The elevated serum levels of M-CSF in
early pregnancy may participate in the immunologic mechanisms
responsible for the maintenance of the pregnancy (Flanagan &
Lader, Curr Opin Hematol. 1998, 5:181-5).
[0007] Related to c-fms and c-kit are two platelet-derived growth
factor receptors, alpha (i.e., pdgfra) and beta (pdgfrb) (PDGF).
The gene coding for pdgfra is located on chromosome 4q11-q12 in the
same region of chromosome 4 as the oncogene coding for c-kit. The
genes coding for pdgfra and c-fms appear to have evolved from a
common ancestral gene by gene duplication, inasmuch as these two
genes are tandemly linked on chromosome 5. They are oriented
head-to-tail with the 5-prime exon of the c-fms gene located only
500 bp from the last 3-prime exon of the gene coding for pdgfra.
Most gastrointestinal stromal tumors (GIST) have activating
mutations in c-kit, and most patients with GISTs respond well to
Gleevec, which inhibits c-kit. Heinrich et al. (Science 2003,
299:708-10) have shown that approximately 35% of GISTs lacking
c-kit mutations have intragenic activation mutations in the gene
encoding pdgfra, and that tumors expressing c-kit or pdgfra are
indistinguishable with respect to activation of downstream
signaling intermediates and cytogenetic changes associated with
tumor progression. Thus, c-kit and pdgfra mutations appear to be
alternative and mutually exclusive oncogenic mechanisms in
GISTs.
[0008] Similarly, the observation that production of M-CSF, the
major macrophage growth factor, is increased in tissues during
inflammation points out a role for c-fms in diseases, such as for
example inflammatory diseases. More particularly, because elevated
levels of M-CSF are found in the disease state, modulation of the
activity of c-fms can ameliorate disease associated with increased
levels of M-CSF.
[0009] c-Kit
[0010] The Stem Cell Factor (SCF) receptor c-kit plays an important
role in the development of melanocytes and mast, germ and
hematopoietic cells. Stem Cell Factor (SCF) is a protein encoded by
the S1 locus, and has also been called "kit ligand" (KL) and mast
cell growth factor (MGF), based on the biological properties used
to identify it (reviewed in Tsujimura, Pathol Int 1996, 46:933-938.
Loveland, et al., J. Endocrinol 1997, 153:337-344; Vliagoftis, et
al., Clin Immunol 1997, 100:435-440; Broudy, Blood 1997,
90:1345-1364; Pignon, Hermatol Cell Ther 1997, 39:114-116; and
Lyman, et al., Blood 1998, 91:1101-1134). Herein the abbreviation
SCF refers to the physiological ligand for c-kit.
[0011] SCF is synthesized as a transmembrane protein with a
molecular weight of 220 or 248 Dalton, depending on alternative
splicing of the mRNA to encode exon 6. The larger protein can be
proteolytically cleaved to form a soluble, glycosylated protein
which noncovalently dimerizes. Both the soluble and membrane-bound
forms of SCF can bind to and activate c-kit. For example, in the
skin, SCF is predominantly expressed by fibroblasts, keratinocytes,
and endothelial cells, which modulate the activity of melanocytes
and mast cells expressing c-kit. In bone, marrow stromal cells
express SCF and regulate hematopoiesis of c-kit expressing stem
cells. In the gastrointestinal tract, intestinal epithelial cells
express SCF and affect the interstitial cells of Cajal and
intraepithelial lymphocytes. In the testis, sertoli cells and
granulosa cells express SCF which regulates spermatogenesis by
interaction with c-kit on germ cells.
SUMMARY OF THE INVENTION
[0012] The present invention relates to compounds active on c-fms,
c-kit, or both c-fms and c-kit. In accordance with one aspect of
the present invention, it has been discovered that in the treatment
of diseases amenable to treatment by an effective amount of a
modulator of either c-fms alone or c-kit alone, the efficacy of
treatment can be enhanced if said compounds are dual inhibitors of
both c-fms and c-kit. In another aspect of the present invention,
compounds active on c-fms, c-kit, or both c-fms and c-kit are also
active on one or more of TrkA, TrkB and HGK. In particular, the
invention provides compounds of Formula I, and all sub-generic
formulae thereof, as well as methods of using such compounds as
described below. Thus, the invention provides methods of using
compounds that can be used therapeutically and/or prophylactically
involving modulation of c-fms, c-kit, or both c-fms and c-kit, or
involving one or more of TrkA, TrkB and HGK in addition to c-fms,
c-kit, or both c-fms and c-kit.
[0013] The compounds of Formula I have the following structure:
##STR00001##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0014] X.sub.1 is N or CR.sup.2, X.sub.2 is N or CR.sup.6, Y.sub.1
is N or CR.sup.4, and Y.sub.2 is N or CR.sup.5, provided, however,
that not more than one of X.sub.2, Y.sub.1 and Y.sub.2 is N; [0015]
L.sup.1 is selected from the group consisting of optionally
substituted lower alkylene, --S--, --O--, --C(O)--, --C(S)--,
--S(O)--, --S(O).sub.2--, and --NR.sup.7--; [0016] L.sup.2 is
selected from the group consisting of a bond, optionally
substituted lower alkylene, -(alk).sub.a-S-(alk).sub.b-,
-(alk).sub.a-O-(alk).sub.b-, -(alk).sub.a-OC(O)-(alk).sub.b-,
-(alk).sub.a-C(O)O-(alk).sub.b-, -(alk).sub.a-OC(S)-(alk).sub.b-,
-(alk).sub.a-C(S)O-(alk).sub.b-, -(alk).sub.a-C(O)-(alk).sub.b-,
-(alk).sub.a-C(S)-(alk).sub.b-,
-(alk).sub.a-C(O)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-OC(O)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-OC(S)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-C(S)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-S(O)-(alk).sub.b-,
-(alk).sub.a-S(O).sub.2-(alk).sub.b-,
-(alk).sub.a-S(O).sub.2NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(O)-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(S)-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(O)NR.sup.9-(alk).sub.b-,
(alk).sub.a-NR.sup.9C(S)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(O)O-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(S)O-(alk).sup.b-,
-(alk).sub.a-NR.sup.9S(O).sub.2-(alk).sub.b-, and
-(alk).sub.a-NR.sup.9S(O).sub.2NR.sup.9-(alk).sub.b-, wherein alk
is optionally substituted C.sub.1-3 alkylene and a and b are
independently 0 or 1; [0017] R.sup.1 is selected from the group
consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl, and optionally substituted heteroaryl;
[0018] R.sup.2, R.sup.4, R.sup.5 and R.sup.6 are independently
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted lower alkenyl,
optionally substituted lower alkynyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, --OH,
--NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2,
--C(S)NH.sub.2, --S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2,
--NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2, --NR.sup.10R.sup.11,
--NHR.sup.3, --OR.sup.3, --SR.sup.3, --C(O)R.sup.3, --C(S)R.sup.3,
--S(O)R.sup.3, --S(O).sub.2R.sup.3, --C(O)OR.sup.3, --C(S)OR.sup.3,
--C(O)NHR.sup.3, --C(O)NR.sup.3R.sup.3, --C(S)NHR.sup.3,
--C(S)NR.sup.3R.sup.3, --S(O).sub.2NHR.sup.3,
--S(O).sub.2NR.sup.3R.sup.3, --NHC(O)R.sup.3,
--NR.sup.3C(O)R.sup.3, --NHC(S)R.sup.3, --NR.sup.3C(S)R.sup.3,
--NHS(O).sub.2R.sup.3, --NR.sup.3S(O).sub.2R.sup.3,
--NHC(O)OR.sup.3, --NR.sup.3C(O)OH, --NR.sup.3C(O)OR.sup.3,
--NHC(S)OR.sup.3, --NR.sup.3C(S)OH, --NR.sup.3C(S)OR.sup.3,
--NHC(O)NHR.sup.3, --NHC(O)NR.sup.3R--, --NR.sup.3C(O)NH.sub.2,
--NR.sup.3C(O)NHR.sup.3, --NR.sup.3C(O)NR.sup.3R.sup.3,
--NHC(S)NHR.sup.3, --NHC(S)NR.sup.3R.sup.3, --NR.sup.3C(S)NH.sub.2,
--NR.sup.3C(S)NHR.sup.3, --NR.sup.3C(S)NR.sup.3R.sup.3,
--NHS(O).sub.2NHR.sup.3, --NHS(O).sub.2NR.sup.3R.sup.3,
--NR.sup.3S(O).sub.2NH.sub.2, --NR.sup.3S(O).sub.2NHR.sup.3, and
--NR.sup.3S(O).sub.2NR.sup.3R.sup.3; [0019] Ar.sub.1 is a 5 or 6
membered optionally substituted heteroarylene having the
structure
[0019] ##STR00002## [0020] wherein
[0020] ##STR00003## indicates the point of attachment of L.sup.1
and
##STR00004## indicates the point of attachment of L.sup.2, and
wherein the indicated N is either .dbd.N-- or --N.dbd.; [0021] n is
0 or 1; [0022] F and J are both C or one of F and J is C and the
other of F and J is N; [0023] P and Q are independently selected
from CR, N, NR, O or S; [0024] T is selected from CR or N; [0025]
wherein [0026] when n is 1, F and J are C, and P, T and Q are CR,
or any one of P, T and Q is N and the other two of P, T and Q are
CR. [0027] when n is 0 and F and J are both C, then one of P and Q
are CR, N or NR and the other of P and Q is C, N, NR, O or S,
provided both P and Q are not CR, [0028] when n is 0, one of F and
J is N and the other of F and J is C, then one of P and Q is N and
the other of P and Q is CR or both P and Q are CR, and [0029] R is
hydrogen or an optional substituent as defined herein for
optionally substituted heteroarylene that provides a stable
compound; [0030] R.sup.3 at each occurrence is independently
selected from the group consisting of optionally substituted lower
alkyl, optionally substituted lower alkenyl, provided, however,
that no alkene carbon thereof is bound to any --C(O)--, --C(S)--,
--S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- of any of
--OR.sup.3, --SR.sup.3, --C(O)R.sup.3, --C(S)R.sup.3,
--S(O)R.sup.3, --S(O).sub.2R.sup.3, --C(O)OR.sup.3, --C(S)OR.sup.3,
--C(O)NHR.sup.3, --C(O)NR.sup.3R.sup.3, --C(S)NHR.sup.3,
--C(S)NR.sup.3R.sup.3, --S(O).sub.2NHR.sup.3,
--S(O).sub.2NR.sup.3R.sup.3, --NHR.sup.3, --NHC(O)R.sup.3,
--NR.sup.3C(O)R.sup.3, --NHC(S)R.sup.3, --NR.sup.3C(S)R.sup.3,
--NHS(O).sub.2R.sup.3, --NR.sup.3S(O).sub.2R.sup.3,
--NHC(O)OR.sup.3, --NR.sup.3C(O)OH, --NR.sup.3C(O)OR.sup.3,
--NHC(S)OR.sup.3, --NR.sup.3C(S)OH, --NR.sup.3C(S)OR.sup.3,
--NHC(O)NHR.sup.3, --NHC(O)NR.sup.3R.sup.3, --NR.sup.3C(O)NH.sub.2,
--NR.sup.3C(O)NHR.sup.3, --NR.sup.3C(O)NR.sup.3R--,
--NHC(S)NHR.sup.3, --NHC(S)NR.sup.3R.sup.3, --NR.sup.3C(S)NH.sub.2,
--NR.sup.3C(S)NHR.sup.3, --NR.sup.3C(S)NR.sup.3R.sup.3,
--NHS(O).sub.2NHR.sup.3, --NHS(O).sub.2NR.sup.3R.sup.3,
--NR.sup.3S(O).sub.2NH.sub.2, --NR.sup.3S(O).sub.2NHR.sup.3, or
--NR.sup.3S(O).sub.2NR.sup.3R.sup.3, optionally substituted lower
alkynyl, provided, however, that no alkyne carbon thereof is bound
to any --C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, --O--, --S--,
or --N-- of any of --OR.sup.3, --SR.sup.3, --C(O)R.sup.3,
--C(S)R.sup.3, --S(O)R.sup.3, --S(O).sub.2R.sup.3, --C(O)OR.sup.3,
--C(S)OR.sup.3, --C(O)NHR.sup.3, --C(O)NR.sup.3R.sup.3,
--C(S)NHR.sup.3, --C(S)NR.sup.3R.sup.3, --S(O).sub.2NHR.sup.3,
--S(O).sub.2NR.sup.3R.sup.3, --NHR.sup.3, --NHC(O)R.sup.3,
--NR.sup.3C(O)R.sup.3, --NHC(S)R.sup.3, --NR.sup.3C(S)R.sup.3,
--NHS(O).sub.2R.sup.3, --NR.sup.3S(O).sub.2R.sup.3,
--NHC(O)OR.sup.3, --NR.sup.3C(O)OH, --NR.sup.3C(O)OR.sup.3,
--NHC(S)OR.sup.3, --NR.sup.3C(S)OH, --NR.sup.3C(S)OR.sup.3,
--NHC(O)NHR.sup.3, --NHC(O)NR.sup.3R.sup.3, --NR.sup.3C(O)NH.sub.2,
--NR.sup.3C(O)NHR.sup.3, --NR.sup.3C(O)NR.sup.3R.sup.3,
--NHC(S)NHR.sup.3, --NHC(S)NR.sup.3R.sup.3, --NR.sup.3C(S)NH.sub.2,
--NR.sup.3C(S)NHR.sup.3, --NR.sup.3C(S)NR.sup.3R.sup.3,
--NHS(O).sub.2NHR.sup.3, --NHS(O).sub.2NR.sup.3R.sup.3,
--NR.sup.3S(O).sub.2NH.sub.2, --NR.sup.3S(O).sub.2NHR.sup.3, or
--NR.sup.3S(O).sub.2NR.sup.3R.sup.3, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, and optionally substituted heteroaryl; [0031]
R.sup.7 is selected from the group consisting of hydrogen,
optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, --C(O)R.sup.8,
and --S(O).sub.2R.sup.8; [0032] R.sup.8 is selected from the group
consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted heteroaryl;
[0033] R.sup.9 at each occurrence is independently selected from
the group consisting of hydrogen, lower alkyl, and lower alkyl
substituted with one or more substituents selected from the group
consisting of fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, fluoro substituted mono-alkylamino,
di-alkylamino, fluoro substituted di-alkylamino, and
--NR.sup.12R.sup.13, provided, however, that when R.sup.9 is
substituted lower alkyl, any substitution on the alkyl carbon bound
to the --N-- of --NR.sup.9-- is fluoro; [0034] R.sup.10 and
R.sup.11 at each occurrence are independently selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted lower alkenyl, provided, however, that no alkene carbon
thereof is bound to the nitrogen of --NR.sup.10R.sup.11, optionally
substituted lower alkynyl, provided, however, that no alkyne carbon
thereof is bound to the nitrogen of --NR.sup.10R.sup.11, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl, and optionally substituted heteroaryl;
or [0035] R.sup.10 and R.sup.11 together with the nitrogen to which
they are attached form a monocyclic 5-7 membered optionally
substituted heterocycloalkyl or a monocyclic 5 or 7 membered
optionally substituted nitrogen containing heteroaryl; and [0036]
R.sup.12 and R.sup.13 combine with the nitrogen to which they are
attached to form a 5-7 membered heterocycloalkyl or 5-7 membered
heterocycloalkyl substituted with one or more substituents selected
from the group consisting of fluoro, --OH, --NH.sub.2, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, fluoro substituted
lower alkoxy, lower alkylthio, and fluoro substituted lower
alkylthio; [0037] provided, however that when compounds have the
structure
[0037] ##STR00005## [0038] and L.sup.1a is --CH.sub.2--,
--CH(OH)--, or --C(O)--, then R.sup.1a is not phenyl,
4-trifluoromethyl-phenyl, 4-methoxy-phenyl, 4-chloro-phenyl,
4-fluoro-phenyl, 4-methyl-phenyl, 3-fluoro-phenyl or thiophen-2-yl,
and compounds do not have the structure
##STR00006##
[0039] In reference to Formula I, the core structure shown above
with X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 as CH and with
L.sup.1-Ar.sub.1-L.sup.2-R.sup.1 replaced with H is referred to as
the "azaindole core." For that azaindole core, reference to ring
atoms or ring positions is as shown in the following structure:
##STR00007##
[0040] In one embodiment of compounds of Formula I, compounds have
a structure selected from the following:
##STR00008##
wherein L.sup.1, Ar.sub.1, L.sup.2, R.sup.1, R.sup.2, R.sup.4,
R.sup.5 and R.sup.6 are as defined for Formula I.
[0041] In one embodiment of compounds of Formula I, X.sub.1 and
X.sub.2 are N or CH. In another embodiment, X.sub.1, X.sub.2 and
Y.sub.1 are N or CH, where in a further embodiment, Y.sub.2 is
CR.sup.5 and R.sup.5 is other than hydrogen. In another embodiment,
X.sub.1, X.sub.2 and Y.sub.2 are N or CH, where in a further
embodiment Y.sub.1 is CR.sup.4 and R.sup.4 is other than hydrogen.
In another embodiment, X.sub.1, X.sub.2 and Y.sub.1 are CH, where
in a further embodiment, Y.sub.2 is CR.sup.5 and R.sup.5 is other
than hydrogen. In another embodiment, X.sub.1, X.sub.2 and Y.sub.2
are CH, where in a further embodiment Y.sub.1 is CR.sup.4 and
R.sup.4 is other than hydrogen.
[0042] In one embodiment of compounds of Formula I, wherein
X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are independently CR.sup.2,
CR.sup.6, CR.sup.4 and CR.sup.5 respectively, one of R.sup.4 or
R.sup.5 is other than hydrogen, preferably where R.sup.2 and
R.sup.6 are hydrogen. In one embodiment, wherein X.sub.1, X.sub.2,
Y.sub.1 and Y.sub.2 are independently CR.sup.2, CR.sup.6, CR.sup.4
and CR.sup.5 respectively, R.sup.2, R.sup.5 and R.sup.6 are
hydrogen and R.sup.4 is other than hydrogen. In one embodiment,
wherein X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are independently
CR.sup.2, CR.sup.6, CR.sup.4 and CR.sup.5 respectively, R.sup.2,
R.sup.4 and R.sup.6 are hydrogen and R.sup.5 is other than
hydrogen.
[0043] In one embodiment of compounds of Formula I, X.sub.1 and
X.sub.2 are N or CH, preferably wherein both X.sub.1 and X.sub.2
are CH.
[0044] In one embodiment of compounds of Formula I, L.sup.1 is
selected from the group consisting of --S--, --O--, lower alkylene,
--C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, and --NR.sup.7--,
wherein lower alkylene is optionally substituted with fluoro, and
wherein when L.sup.2 is optionally substituted lower alkylene or
comprises optionally substituted C.sub.1-3 alkylene, the alkylene
is optionally substituted with fluoro or lower alkyl. In one
embodiment, L.sup.1 is selected from the group consisting of --S--,
--O--, --CH.sub.2--, --CF.sub.2--, --C(O)--, --C(S)--, --S(O)--,
--S(O).sub.2--, and --NH--.
[0045] In one embodiment of compounds of Formula I, L.sup.2 is
selected from the group consisting of a bond, optionally
substituted lower alkylene, --O-(alk).sub.b-, --OC(O)-(alk).sub.b-,
--C(O)O-(alk).sub.b-, --OC(S)-(alk).sub.b-, --C(S)O-(alk).sub.b-,
--C(O)-(alk).sub.b-, --C(S)-(alk).sub.b-,
--C(O)NR.sup.9-(alk).sub.b-, --OC(O)NR.sup.9-(alk).sub.b-,
--OC(S)NR.sup.9-(alk).sub.b-, --C(S)NR.sup.9-(alk).sub.b-,
--S(O)-(alk).sub.b-, --S(O).sub.2-(alk).sub.b-,
S(O).sub.2NR.sup.9-(alk).sub.b-, --NR.sup.9-(alk).sub.b-,
--NR.sup.9C(O)-(alk).sub.b-, --NR.sup.9C(O)O-(alk).sub.b-,
--NR.sup.9C(S)-(alk).sub.b-, --NR.sup.9C(S)O-(alk).sub.b-,
--NR.sup.9C(O)NR.sup.9-(alk).sub.b-,
--NR.sup.9C(S)NR.sup.9-(alk).sub.b-, --NR.sup.9S(O)-(alk).sub.b-,
and --NR.sup.9S(O).sub.2NR.sup.9-(alk).sub.b-.
[0046] Further to any of the above embodiments of Formula I, when
L.sup.1 is substituted lower alkylene or when L.sup.2 is
substituted lower alkylene or comprises substituted C.sub.1-3
alkylene, the alkylene is substituted with one or more, preferably
1, 2, or 3 substituents selected from the group consisting of
fluoro, --OH, --NH.sub.2, lower alkoxy, lower alkylthio,
mono-alkylamino, di-alkylamino, and --NR.sup.12R.sup.13, wherein
the alkyl chain(s) of lower alkoxy, lower alkylthio,
mono-alkylamino or di-alkylamino are optionally substituted with
one or more, preferably 1, 2, or 3 substituents selected from the
group consisting of fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, or cycloalkylamino.
[0047] In one embodiment of the compounds of Formula I, the
variables P, J, Q, T, F, and n are selected to provide structures
of Art selected from the group consisting of
##STR00009## ##STR00010##
where each R is independently hydrogen or an optional substituent
as defined herein for optionally substituted heteroaryl.
[0048] In one embodiment, a compound of Formula I has a structure
according to the following sub-generic structure. Formula Ia,
##STR00011##
all salts, prodrugs, tautomers, and isomers thereof, wherein
L.sup.1, Ar.sub.1, R.sup.1, R.sup.2, R.sup.4, R.sup.5 and R.sup.6
are as defined for Formula I. [0049] L.sup.3 is selected from the
group consisting of a bond, optionally substituted lower alkylene,
--O-(alk).sub.b-, --S-(alk).sub.b-, --NR.sup.14-(alk).sub.b-,
--C(O)-(alk).sub.b-, --C(S)-(alk).sub.b-, --S(O)-(alk).sub.b-,
--S(O).sub.2-(alk).sub.b-, --NR.sup.14C(O)-(alk).sub.b-,
--C(O)NR.sup.14-(alk).sub.b-, --S(O).sub.2NR.sup.14-(alk).sub.b-,
--NR.sup.14S(O).sub.2-(alk).sub.b-,
--NR.sup.14C(O)NR.sup.14-(alk).sub.b-,
--NR.sup.14C(S)NR.sup.14-(alk).sub.b-, and
--NR.sup.14S(O).sub.2NR.sup.14-(alk).sub.b-; [0050] alk is
optionally substituted C.sub.1-3 alkylene; [0051] b is 0 or 1; and
[0052] R.sup.14 is hydrogen or lower alkyl.
[0053] In another embodiment of compounds of Formula Ia, R.sup.2,
R.sup.5 and R.sup.6 are hydrogen, further wherein R.sup.4 is other
than hydrogen. In another embodiment, R.sup.2, R.sup.4 and R.sup.6
are hydrogen, further wherein R.sup.5 is other than hydrogen.
[0054] In particular embodiments the compound of Formula I has a
structure according to the following sub-generic structure, Formula
Ib,
##STR00012##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0055] V and W are independently selected from the group consisting
of N and CH; [0056] U and Z are independently selected from the
group consisting of N and CR.sup.18, provided, however, that not
more than one of W, U and Z is N; [0057] A is selected from the
group consisting of --CR.sup.19R.sup.20--, --C(O)--, --C(S)--,
--S--, --S(O)--, --S(O).sub.2--, --NR.sup.21--, and --O--; [0058] n
is 0 or 1; [0059] F and J are both C or one of F and J is C and the
other of F and J is N; [0060] E and K are selected from C, N, O or
S; [0061] G is selected from C or N; [0062] wherein [0063] when n
is 1, F and J are C, and E, G and K are C, or any one of E, G and K
is N and the other two of E, G and K are C, provided that when E, G
or K is N, R.sup.15, R.sup.17 and R.sup.16, respectively, are
absent, [0064] when n is 0 and F and J are both C, then one of E
and K is C or N and the other of E and K is C, N, O or S, provided
both E and K are not C, and provided that when both E and K are N,
one of R.sup.15 and R.sup.16 is absent, and provided that when one
of E and K are N and the other is O or S, R.sup.15 and R.sup.16 are
absent, [0065] when n is 0, one of F and J is N and the other of F
and J is C, then one of E and K is N and the other of E and K is C,
or both E and K are C, provided that when E is N, R.sup.15 is
absent and when K is N, R.sup.16 is absent; [0066] R.sup.1 is
selected from the group consisting of optionally substituted lower
alkyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl and optionally
substituted heteroaryl; [0067] R.sup.15 is selected from the group
consisting of hydrogen, optionally substituted lower alkyl,
--OR.sup.22, --SR.sup.22 and halogen when E is C, is absent when E
is O or S or when n=1 and E is N, and is absent or selected from
the group consisting of hydrogen and optionally substituted lower
alkyl when n=0 and E is N; [0068] R.sup.16 is selected from the
group consisting of hydrogen, optionally substituted lower alkyl,
--OR.sup.22, --SR.sup.21 and halogen when K is C, is absent when K
is O or S or when n=1 and K is N, and is absent or selected from
the group consisting of hydrogen and optionally substituted lower
alkyl when n=0 and K is N; [0069] R.sup.17 is selected from the
group consisting of hydrogen, optionally substituted lower alkyl,
--OR.sup.22, --SR.sup.22 and halogen when G is C, or is absent when
G is N; [0070] R.sup.18 is selected from the group consisting of
hydrogen, halogen, optionally substituted lower alkyl, optionally
substituted aryl, optionally substituted heteroaryl, --OH,
--NH.sub.2, --NO.sub.2, --CN, --NHC(O)NH.sub.2. --NHC(S)NH.sub.2,
--NHS(O)NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23, --OR.sup.23,
--SR.sup.23, --NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23,
--NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0071] M is selected from
the group consisting of a bond, --(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.t--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub-
.s--, and
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O)NR.sup.26--(CR.sup.19R-
.sup.20).sub.s--; [0072] wherein R.sup.19 and R.sup.20 at each
occurrence are independently selected from the group consisting of
hydrogen, fluoro, --OH, --NH.sub.2, lower alkyl, lower alkoxy,
lower allylthio, mono-alkylamino, di-alkylamino, and
--NR.sup.27R.sup.28, wherein the alkyl chain(s) of lower alkyl,
lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino
are optionally substituted with one or more substituents selected
from the group consisting of fluoro, --OH, --NH.sub.2, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino; or [0073] any two of R.sup.19 and R.sup.20 on the
same or different carbons combine to form a 3-7 membered monocyclic
cycloalkyl or 5-7 membered monocyclic heterocycloalkyl and any
others of R.sup.19 and R.sup.20 are independently selected from the
group consisting of hydrogen, fluoro, --OH, --NH.sub.2, lower
alkyl, lower alkoxy, lower allylthio, mono-alkylamino,
di-alkylamino, and --NR.sup.27R.sup.28, wherein the alkyl chain(s)
of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, or
di-alkylamino are optionally substituted with one or more
substituents selected from the group consisting of fluoro, --OH,
--NH.sub.2, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino, and wherein the monocyclic
cycloalkyl or monocyclic heterocycloalkyl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, --OH, --NH.sub.2, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino; [0074]
R.sup.21 and R.sup.22 at each occurrence are independently hydrogen
or optionally substituted lower alkyl; [0075] R.sup.23 at each
occurrence is independently selected from the group consisting of
optionally substituted lower alkyl, optionally substituted lower
alkenyl, provided, however, that no alkene carbon thereof is bound
to any --C(O)--, --C(S)--, --S(O).sub.2--, --O--, --S--, or --N--
of any of --NHR.sup.23, --OR.sup.23, --SR.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.23, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23,
or --NR.sup.23S(O).sub.2NR.sup.23R.sup.23, optionally substituted
lower alkynyl, provided, however, that no alkyne carbon thereof is
bound to any --C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, --O--,
--S--, or --N-- of any of --NHR.sup.23, --OR.sup.23, --SR.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.3,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23 or
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, and optionally substituted heteroaryl; [0076]
R.sup.24 and R.sup.25 at each occurrence are independently selected
from the group consisting of optionally substituted lower alkyl,
optionally substituted lower alkenyl, provided, however, that no
alkene carbon thereof is bound to the nitrogen of
--NR.sup.24R.sup.25, optionally substituted lower alkynyl,
provided, however, that no alkyne carbon thereof is bound to the
nitrogen of --NR.sup.24R.sup.25, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, and optionally substituted heteroaryl; or [0077] R.sup.24 and
R.sup.25 together with the nitrogen to which they are attached form
a monocyclic 5-7 membered optionally substituted heterocycloalkyl
or a monocyclic 5 or 7 membered optionally substituted nitrogen
containing heteroaryl; [0078] R.sup.26 at each occurrence is
independently selected from the group consisting of hydrogen, lower
alkyl, and lower alkyl substituted with one or more substituents
selected from the group consisting of fluoro, --OH, --NH.sub.2,
lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio,
fluoro substituted lower alkylthio, mono-alkylamino, fluoro
substituted mono-alkylamino, di-alkylamino, fluoro substituted
di-alkylamino, and --NR.sup.27R.sup.28, provided, however, that
when R.sup.26 is substituted lower alkyl, any substitution on the
lower alkyl carbon bound to the --N-- of --NR.sup.26-- is fluoro;
[0079] R.sup.27 and R.sup.28 combine with the nitrogen to which
they are attached to form a 5-7 membered heterocycloalkyl or 5-7
membered heterocycloalkyl substituted with one or more substituents
selected from the group consisting of fluoro, --OH, --NH.sub.2,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, and fluoro substituted
lower alkylthio; [0080] u is 1-6; [0081] t is 0-3: and [0082] s is
0-3; [0083] provided that [0084] when V, W, U and Z are CH, n=1, E,
F, J, and K are C, R.sup.15, R.sup.16 and R.sup.17 are H, A is
--CH.sub.2--, --CH(OH)--, or --C(O)--, and M is --NHCH.sub.2--,
then R.sup.j is not phenyl, 4-trifluoromethyl-phenyl,
4-methoxy-phenyl, 4-chloro-phenyl, 4-fluoro-phenyl,
4-methyl-phenyl, 3-fluoro-phenyl or thiophen-2-yl, [0085] when V,
W, U and Z are CH, n=1, E, F, G, J, and K are C, R.sup.15, R.sup.16
and R.sup.17 are H, and A is --CH.sub.2--, then M-R.sup.1 is not
--NHCH.sub.2CH(CH.sub.3).sub.2, [0086] when V, W, and U are CH,
n=1, E, F, G, J, and K are C, R.sup.15, R.sup.16 and R.sup.17 are
H, A is --CH.sub.2--, M-R.sup.1 is --OCH.sub.3, and Z is CR.sup.18,
then R.sup.18 is not thiophen-3-yl, and [0087] when V, W, and U are
CH, n=0, F, J, and K are C, E is N, R.sup.15 is CH.sub.3, R.sup.16
is H, A is --C(O)--, M-R.sup.1 is --CH(CH.sub.3).sub.3, and Z is
CR.sup.18, then R.sup.18 is not 3-((E)-2-carboxy-vinyl)phenyl.
[0088] In one embodiment of the compounds of Formula Ib, E, J, K,
G, F, n, R.sup.15, R.sup.16 and R.sup.17 are selected to provide
structures selected from the group consisting of
##STR00013## ##STR00014##
wherein R.sup.15, R.sup.16 and R.sup.17 are as defined for
compounds of Formula Ib and wherein
##STR00015##
indicates the point of attachment of A and
##STR00016##
indicates the point of attachment of M.
[0089] In one embodiment of compounds of Formula Ib. M is selected
from the group consisting of --O--(CR.sup.19R.sup.20).sub.s,
--S--(CR.sup.19R.sup.20).sub.s,
--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s,
--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub.s--, and
--NR.sup.26S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub.s--.
[0090] In one embodiment of compounds of Formula Ib. R.sup.26 at
each occurrence is independently selected from the group consisting
of hydrogen, lower alkyl, and lower alkyl substituted with 1, 2, or
3 substituents selected from the group consisting of fluoro, --OH,
--NH.sub.2, alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino
and cycloalkylamino, provided that any substitution on the carbon
that is bound to the nitrogen of --NR.sup.26 is fluoro.
[0091] In one embodiment of compounds of Formula Ib, R.sup.1 is
selected from the group consisting of optionally substituted aryl
and optionally substituted heteroaryl.
[0092] In one embodiment of the compounds of Formula Ib, Z is N or
CH, n is 1, E-R.sup.15 is N or CH, K--R.sup.16 is N or CH, and
G-R.sup.17 is N or CH, provided no more than one of E-R.sup.15,
K--R.sup.16 and G-R.sup.17 is N. In one embodiment, Z is N or CH, n
is 1, and E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH.
[0093] In one embodiment of the compounds of Formula Ib, V, W and Z
are CH, U is CR.sup.18, n is 1, E-R.sup.15 is N or CH, K--R.sup.16
is N or CH, and G-R.sup.17 is N or CH, provided no more than one of
E-R.sup.15, K--R.sup.16 and G-R.sup.17 is N. In another embodiment,
V, W and Z are CH, U is CR.sup.18, n is 1, and E-R.sup.15,
K--R.sup.16 and G-R.sup.17 are CH.
[0094] In one embodiment of the compounds of Formula Ib, Z is N or
CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl. In another embodiment, V, Z, U and W
are CH, n is 1, E-R.sup.15 is N or CH, K--R.sup.16 is N or CH, and
G-R.sup.17 is N or CH, provided no more than one of E-R.sup.15,
K--R.sup.16 and G-R.sup.17 is N.
[0095] In one embodiment of the compounds of Formula Ib, Z is N or
CH, n is 1, E-R.sup.15 is N or CH, K--R.sup.16 is N or CH, and
G-R.sup.17 is N or CH, provided no more than one of E-R.sup.15,
K--R.sup.16 and G-R.sup.17 is N, and R.sup.1 is phenyl optionally
substituted with one or more substituents selected from the group
consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
optionally substituted lower alkyl and --OR.sup.29, where R.sup.29
is selected from the group consisting of optionally substituted
lower alkyl, optionally substituted cycloalkyl, optionally
substituted heterocycloalkyl, optionally substituted aryl and
optionally substituted heteroaryl.
[0096] In one embodiment of the compounds of Formula Ib, V, Z, U
and W are CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are
CH, A is --CH.sub.2--, M is --NHCH.sub.2, and R.sup.1 is optionally
substituted phenyl, further wherein R.sup.1 is phenyl optionally
substituted with one or more substituents selected from the group
consisting of halogen. --OH, --NH.sub.2, --NO.sub.2. --CN,
optionally substituted lower alkyl and --OR.sup.29, where R.sup.29
is selected from the group consisting of optionally substituted
lower alkyl, optionally substituted cycloalkyl, optionally
substituted heterocycloalkyl, optionally substituted aryl and
optionally substituted heteroaryl.
[0097] In one embodiment of the compounds of Formula Ib, V, W and Z
are CH, U is CR.sup.18, n is 1, E-R.sup.15, K--R.sup.16 and
G-R.sup.17 are CH, A is --CH.sub.2--, M is --NHCH.sub.2, and
R.sup.1 is optionally substituted phenyl, further wherein R.sup.1
is phenyl optionally substituted with one or more substituents
selected from the group consisting of halogen. --OH, --NH.sub.2,
--NO.sub.2, --CN, optionally substituted lower alkyl and
--OR.sup.29, where R.sup.29 is selected from the group consisting
of optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl and optionally substituted heteroaryl.
[0098] In one embodiment of the compounds of Formula Ib, when n is
1, and E, K and G are C, at least one of R.sup.15, R.sup.16 and
R.sup.17 is other than hydrogen. In another embodiment, n is 1, one
of E, K, and G are N and the other two of E, K, and G are C and at
least one of R.sup.15R.sup.16 and R.sup.17 is other than hydrogen.
In another embodiment, n is 1, E, K and G are C, and at least one
of R.sup.15, R.sup.16 and R.sup.17 is other than hydrogen.
[0099] In one embodiment of the compounds of Formula Ib, n is 1, V
and W are CH, U and Z are independently CR.sup.18, one of E, K, and
G are N and the other two of E. K, and G are C and at least one of
R.sup.15, R.sup.16 and R.sup.17 is other than hydrogen. In another
embodiment, n is 1, V and W are CH, U and Z are independently
CR.sup.18, E, K and G are C, and at least one of R.sup.15, R.sup.16
and R.sup.17 is other than hydrogen.
[0100] In one embodiment of the compounds of Formula Ib, n is 1,
one of E, K, and G are N and the other two of E, K, and G are C, at
least one of R.sup.15, R.sup.16 and R.sup.17 is other than
hydrogen, A is --CH.sub.2--, M is --NHCH.sub.2--, further wherein
R.sup.1 is optionally substituted phenyl. In another embodiment, n
is 1, E, K, and G are C, at least one of R.sup.15, R.sup.16 and
R.sup.17 is other than hydrogen, A is --CH.sub.2--, M is
--NHCH.sub.2--, further wherein R.sup.1 is optionally substituted
phenyl.
[0101] In one embodiment of the compounds of Formula Ib, n is 1, V,
Z, U and W are CH, one of E, K, and G are N and the other two of E,
K, and G are C and at least one of R.sup.15, R.sup.16 and R.sup.17
is other than hydrogen. In another embodiment, V, Z, U and W are
CH, E, K and G are C, and at least one of R.sup.15, R.sup.16 and
R.sup.17 is other than hydrogen.
[0102] In one embodiment of the compounds of Formula Ib, Z is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15 is N or CH, K--R.sup.16 is N or CH and G-R.sup.17 is N
or CH. In another embodiment, Z is CR.sup.18, wherein R.sup.18 is
other than hydrogen, n is 1, and E-R.sup.15, K--R.sup.16 and
G-R.sup.17 are CH. In another embodiment, Z is CR.sup.18, wherein
R.sup.18 is other than hydrogen. U is CR.sup.18, V and W are CH, n
is 1, and E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, further
wherein U is CH.
[0103] In one embodiment of the compounds of Formula Ib, Z is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is --CH.sub.2--, M
is --NHCH.sub.2--, further wherein R.sup.1 is optionally
substituted phenyl. In a further embodiment, Z is CR.sup.18,
wherein R.sup.18 is other than hydrogen, U is CR.sup.18, V and W
are CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl. In a further embodiment, Z is
CR.sup.18, wherein R.sup.18 is other than hydrogen, V, U and W are
CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl.
[0104] In one embodiment of the compounds of Formula Ib, U is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15 is N or CH, K--R.sup.16 is N or CH and G-R.sup.17 is N
or CH. In another embodiment, U is CR.sup.18, wherein R.sup.18 is
other than hydrogen, n is 1, and E-R.sup.15, K--R.sup.16 and
G-R.sup.17 are CH. In another embodiment, U is CR.sup.18, wherein
R.sup.18 is other than hydrogen, Z is CR.sup.18, V and W are CH, n
is 1, and E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, further
wherein Z is CH.
[0105] In one embodiment of the compounds of Formula Ib, U is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is --CH.sub.2--, M
is --NHCH.sub.2--, further wherein R.sup.1 is optionally
substituted phenyl. In a further embodiment, U is CR.sup.18,
wherein R.sup.18 is other than hydrogen, Z is CR.sup.18, V and W
are CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl. In a further embodiment, U is
CR.sup.18, wherein R.sup.18 is other than hydrogen, V, Z and W are
CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl.
[0106] In one embodiment of the compounds of Formula Ib, further to
any of the above embodiments, R.sup.15, R.sup.16 and R.sup.17 are
independently selected from the group consisting of halogen, --OH,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and
fluoro substituted lower alkoxy. Further to any of these
embodiments R.sup.1 is phenyl optionally substituted with one or
more substituents selected from the group consisting of halogen,
--OH, --NH.sub.2, --NO.sub.2, --CN, optionally substituted lower
alkyl and --OR.sup.29, where R.sup.29 is selected from the group
consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted
heteroaryl.
[0107] In one embodiment of the compounds of Formula Ib, further to
any of the above embodiments, R.sup.18 is selected from the group
consisting of halogen, --OH, optionally substituted lower alkyl and
--OR.sup.2, where R.sup.29 is selected from the group consisting of
optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl and optionally substituted heteroaryl. Further to
any of these embodiments, R.sup.1 is phenyl optionally substituted
with one or more substituents selected from the group consisting of
halogen, --OH, --NH.sub.2, --NO.sub.2, --CN, optionally substituted
lower alkyl and --OR.sup.29, where R.sup.29 is selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted
heteroaryl.
[0108] In another embodiment of compounds of Formula Ib, M is a
bond and R.sup.1 is other than thiophenyl.
[0109] In another embodiment of the compounds of Formula Ib, Z is N
or CR.sup.18 wherein R.sup.18 is not hydrogen. Further to this
embodiment, as allowed in the description of Formula Ib, E is
NR.sup.15 or CR.sup.15, K is NR.sup.16 or CR.sup.16 and G is
CR.sup.17, or combinations thereof, wherein at least one of
R.sup.15, R.sup.16 and R.sup.17 is not hydrogen.
[0110] In one embodiment, a compound of Formula I has a structure
according to the following sub-generic structure, Formula Ig,
##STR00017##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0111] Z.sub.1 is selected from the group consisting of N and
CR.sup.34; [0112] U.sub.1 is selected from the group consisting of
N and CR.sup.35; [0113] A.sub.1 is selected from the group
consisting of --CH.sub.2-- and --C(O)--; [0114] M.sub.3 is selected
from the group consisting of a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, --C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--,
--CH.sub.2NR.sup.39--, --CH(R.sup.40)NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--; [0115] n is 0 or 1;
[0116] v is 0, 1, 2 or 3; [0117] F.sub.1 and J.sub.1 are both C or
one of F.sub.1 and J.sub.1 is C and the other of F, and J, is N;
[0118] E.sub.1 and K.sub.1 are independently selected from C, N, O
or S; [0119] G is selected from C or N; [0120] wherein [0121] when
n is 1, F.sub.1 and J.sub.1 are C, and E.sub.1, G.sub.1 and K.sub.1
are C, or any one of E.sub.1, G.sub.1 and K.sub.1 is N and the
other two of E.sub.1, G.sub.1 and K.sub.1 are C, provided that when
E.sub.1, G.sub.1 or K.sub.1 is N, R.sup.36, R.sup.37 and R.sup.38,
respectively, are absent; [0122] when n is 0 and F.sub.1 and
J.sub.1 are both C, then one of E.sub.1 and K.sub.1 is C or N and
the other of E.sub.1 and K.sub.1 is C, N, O or S, provided both
E.sub.1 and K.sub.1 are not C, and provided that when both E.sub.1
and K.sub.1 are N, one of R.sup.36 and R.sup.37 is absent, and
provided that when one of E.sub.1 and K.sub.1 are N and the other
is O or S, R.sup.36 and R.sup.37 are absent; [0123] when n is 0,
one of F.sub.1 and J.sub.1 is N and the other of F.sub.1 and
J.sub.1 is C, then one of E.sub.1 and K.sub.1 is N and the other of
E.sub.1 and K.sub.1 is C, or both E.sub.1 and K.sub.1 are C,
provided that when E.sub.1 is N, R.sup.36 is absent and when
K.sub.1 is N, R.sup.37 is absent; [0124] Cy is selected from the
group consisting of cycloalkyl, heterocycloalkyl, aryl and
heteroaryl; [0125] R.sup.34 and R.sup.35 are independently selected
from the group consisting of hydrogen, --OR.sup.41, --SR.sup.41,
--NHR.sup.41, --NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, halogen, lower alkyl, cycloalkyl,
heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is
optionally substituted with one or more substituents selected from
the group consisting of fluoro, lower alkoxy, fluoro substituted
lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl,
and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl as R.sup.34 or R.sup.35, or as substituents of lower
alkyl are optionally substituted with one or more substituents
selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42,
--SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino; [0126] R.sup.45 at each
occurrence is independently selected from the group consisting of
--OR.sup.41, --SR.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R.sup.43, or
as substituents of lower alkyl are optionally substituted with one
or more substituents selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, --S(O)NH.sub.2, --C(O)NH.sub.2,
--OR.sup.42, --SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino; [0127] R.sup.36 is selected from
the group consisting of hydrogen, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy when E.sub.1 is C, is absent when E.sub.1 is O or S or when
n=1 and E.sub.1 is N, and is absent or selected from the group
consisting of hydrogen, lower alkyl, and fluoro substituted lower
alkyl when n=0 and E.sub.1 is N; [0128] R.sup.37 is selected from
the group consisting of hydrogen, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy when K.sub.1 is C, is absent when K.sub.1 is O or S or when
n=1 and K.sub.1 is N, and is absent or selected from the group
consisting of hydrogen, lower alkyl, and fluoro substituted lower
alkyl when n=0 and K.sub.1 is N; [0129] R.sup.38 is selected from
the group consisting of hydrogen, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy when G.sub.1 is C, or is absent when G.sub.1 is N; [0130]
R.sup.39 at each occurrence is independently hydrogen or lower
alkyl; [0131] R.sup.40 is lower alkyl or fluoro substituted lower
alkyl; [0132] R.sup.41 is selected from the group consisting of
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R.sup.41 or
as substituents of lower alkyl are optionally substituted with one
or more substituents selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2,
--OR.sup.42, --SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O)R.sup.42, halogen, lower alkyl, fluoro substituted lower
alkyl, and cycloalkylamino; and [0133] R.sup.42 at each occurrence
is independently selected from the group consisting of lower alkyl,
heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally
substituted with one or more substituents selected from the group
consisting of fluoro, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino, and
heterocycloalkyl and heteroaryl are optionally substituted with one
or more substituents selected from the group consisting of halogen,
--CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy and
fluoro substituted lower alkoxy.
[0134] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C.
[0135] In one embodiment of compounds of Formula Ig, M.sub.3 is
selected from the group consisting of --NR.sup.39--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, --CH.sub.2NR.sup.39--, --NR.sup.39C(O)--, and
--NR.sup.39S(O).sub.2--, preferably wherein M.sub.3 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, or --CH.sub.2NR.sup.39--.
[0136] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, and M.sub.3 is selected from the group consisting of
--NR.sup.39--, --O--, --NR.sup.39CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--CH.sub.2NR.sup.39--, --NR.sup.39C(O)--, and
--NR.sup.39S(O).sub.2--, preferably wherein M.sub.3 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, or --CH.sub.2NR.sup.39--.
[0137] In one embodiment of compounds of Formula Ig, each R.sup.45
is selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, halogen, lower alkyl, fluoro substituted lower alkyl,
lower alkoxy, fluoro substituted lower alkoxy, lower thioalkyl,
fluoro substituted lower thioalkyl, mono-alkylamino, di-alkylamino
and cycloalkylamino, preferably wherein v is 0, 1, or 2, also 0 or
1.
[0138] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, M.sub.3 is selected from the group consisting of --NR.sup.39--,
--O--, --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --CH.sub.2NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--, preferably wherein
M.sub.3 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, or --CH.sub.2NR.sup.39--, and each
R.sup.45 is selected from the group consisting of --OH, --NH.sub.2,
--CN, --NO.sub.2, halogen, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
thioalkyl, fluoro substituted lower thioalkyl, mono-alkylamino,
di-alkylamino and cycloalkylamino, preferably wherein v is 0, 1, or
2, also 0 or 1.
[0139] In one embodiment of compounds of Formula Ig, Z.sub.1 is
CR.sup.34, U.sub.1 is CR.sup.35, and R.sup.34 and R.sup.35 are both
hydrogen. In one embodiment, Z.sub.1 is CR.sup.34, U.sub.1 is
CR.sup.35, and R.sup.34 and R.sup.35 are independently selected
from the group consisting of hydrogen, --OR.sup.41, halogen, lower
alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino. In a further embodiment, one of R.sup.34 and
R.sup.35 is hydrogen, and the other of R.sup.34 and R.sup.35 is
selected from the group consisting of hydrogen, halogen, lower
alkyl, lower alkoxy, aryl and heteroaryl, wherein aryl and
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42,
--SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino, and wherein lower alkyl and lower
alkoxy are optionally substituted with one or more substituents
selected from the group consisting of fluoro, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
further wherein the other of R.sup.34 and R.sup.35 is selected from
the group consisting of halogen, lower alkyl, and lower alkoxy,
wherein lower alkyl and lower alkoxy are optionally substituted
with one or more substituents selected from the group consisting of
fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino.
[0140] In one embodiment of compound, of Formula Ig, each R.sup.45
is independently selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower thioalkyl, fluoro substituted lower thioalkyl,
mono-alkylamino, di-alkylamino and cycloalkylamino, preferably
wherein v is 0, 1, or 2, also 0 or 1, Z.sub.1 is CR.sup.34, U.sub.1
is CR.sup.35, and R.sup.34 and R.sup.35 are independently selected
from the group consisting of hydrogen, --OR.sup.41, halogen, lower
alkyl, cycloalkyl heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino. In a further embodiment, both of R.sup.34 and
R.sup.35 are hydrogen.
[0141] In one embodiment of compounds of Formula Ig, each R.sup.45
is selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, halogen, lower alkyl, fluoro substituted lower alkyl,
lower alkoxy, fluoro substituted lower alkoxy, lower thioalkyl,
fluoro substituted lower thioalkyl, mono-alkylamino, di-alkylamino
and cycloalkylamino, preferably wherein v is 0, 1, or 2, also 0 or
1, Z.sub.1 is CR.sup.34, U.sub.1 is CR.sup.35, one of R.sup.34 and
R.sup.35 is hydrogen, and the other of R.sup.34 and R.sup.35 is
selected from the group consisting of hydrogen, halogen, lower
alkyl, lower alkoxy, aryl and heteroaryl, wherein aryl and
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42,
--SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino, and wherein lower alkyl and lower
alkoxy are optionally substituted with one or more substituents
selected from the group consisting of fluoro, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
further wherein the other of R.sup.34 and R.sup.35 is selected from
the group consisting of halogen, lower alkyl, and lower alkoxy,
wherein lower alkyl and lower alkoxy are optionally substituted
with one or more substituents selected from the group consisting of
fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino.
[0142] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, M.sub.3 is selected from the group consisting of --NR.sup.39--,
--O--, --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --CH.sub.2NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--, preferably wherein
M.sub.3 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, or --CH.sub.2NR.sup.39, each R.sup.45
is selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, halogen, lower alkyl, fluoro substituted lower alkyl,
lower alkoxy, fluoro substituted lower alkoxy, lower thioalkyl,
fluoro substituted lower thioalkyl, mono-alkylamino, di-alkylamino
and cycloalkylamino, preferably wherein v is 0, 1, or 2, also 0 or
1, Z.sub.1 is CR.sup.34, U.sub.1 is CR.sup.35, and R.sup.34 and
R.sup.35 are both hydrogen.
[0143] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, M.sub.3 is selected from the group consisting of --NR.sup.39,
--O--, --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --CH.sub.2NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.3S(O).sub.2--, preferably wherein
M.sub.3 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, or --CH.sub.2NR.sup.39--, each
R.sup.45 is selected from the group consisting of --OH, --NH.sub.2,
--CN, --NO.sub.2, halogen, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
thioalkyl, fluoro substituted lower thioalkyl, mono-alkylamino,
di-alkylamino and cycloalkylamino, preferably wherein v is 0, 1, or
2, also 0 or 1, Z.sub.1 is CR.sup.34 and U.sub.1 is CR.sup.35, and
R.sup.34 and R.sup.35 are independently selected from the group
consisting of hydrogen, --OR.sup.41, halogen, lower alkyl,
cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino. In a further embodiment, one of R.sup.34 and
R.sup.35 is hydrogen, and the other of R.sup.34 and R.sup.35 is
selected from the group consisting of halogen, lower alkyl, lower
alkoxy, aryl and heteroaryl, wherein aryl and heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl and lower alkoxy are optionally substituted
with one or more substituents selected from the group consisting of
fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino, further wherein the other of
R.sup.34 and R.sup.35 is selected from the group consisting of
halogen, lower alkyl, and lower alkoxy, wherein lower alkyl and
lower alkoxy are optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino, further wherein R.sup.34 is hydrogen.
[0144] In one embodiment, a compound of Formula I has a structure
according to the following sub-generic structure, Formula II,
##STR00018##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0145] D has a structure selected from the group consisting of
[0145] ##STR00019## in which
##STR00020## indicates the attachment point of D to A.sub.2 of
Formula II; [0146] A.sub.2 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--. --NR.sup.21--, and --O--, provided, however, that
when A.sub.2 is NR.sup.21, N is not bound to a nitrogen of D;
[0147] B is selected from the group consisting of hydrogen,
halogen, optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl. --OH,
--NH.sub.2, --NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O)R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0148] M.sub.4 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--NR.sup.39CH.sub.2CH.sub.2--, or --NR.sup.39C(O)--; [0149]
M.sub.5, M.sub.6, M.sub.7, M.sub.9, M.sub.10, M.sub.11, M.sub.12,
M.sub.13, M.sub.14, M.sub.15 M.sub.16, M.sub.17 and M.sub.18 are
selected from the group consisting of a bond,
--(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.t--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub-
.s--, and
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2NR.sup.26--(CR.s-
up.19R.sup.20).sub.s--; [0150] M.sub.8 is selected from the group
consisting of a bond, --(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.w--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.w--OC(S)NR.sup.26(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)O--)CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub-
.s--, and
--(CR.sup.19R.sup.20).sub.w--NR.sup.26S(O).sub.2NR.sup.26--(CR.s-
up.19R.sup.20).sub.s--; [0151] Q.sup.1 is aryl or heteroaryl,
wherein aryl or heteroaryl are optionally substituted with one or
more substituents selected from the group consisting of halogen,
lower alkyl, fluoro substituted lower alkyl,
--NHS(O).sub.2R.sup.43, --NHC(O)R.sup.43, --NHR.sup.43,
--NR.sup.43R.sup.43, --OR.sup.43, SR.sup.43, S(O)R.sup.43, and
--S(O).sub.2R.sup.43; [0152] Q.sup.11, Q.sup.21, Q.sup.31,
Q.sup.41, Q.sup.51, Q.sup.61, Q.sup.71, Q.sup.81, Q.sup.91,
Q.sup.101, Q.sup.111, Q.sup.121, Q.sup.131, and Q.sup.141 are
selected from the group consisting of optionally substituted lower
alkyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl and optionally
substituted heteroaryl; [0153] Q.sup.12 is fluoro, chloro or
--CF.sub.3; [0154] Q.sup.13 and Q.sup.14 are independently
hydrogen, fluoro, chloro, lower alkyl, or fluoro substituted lower
alkyl; [0155] Q.sup.22, Q.sup.24, Q.sup.32, Q.sup.33, Q.sup.43,
Q.sup.44, Q.sup.52, Q.sup.54, Q.sup.102 and Q.sup.104 are
independently selected from the group consisting of hydrogen,
halogen, lower alkyl, fluoro substituted lower alkyl,
--NR.sup.44R.sup.44, --OR.sup.44, and --SR.sup.44, provided,
however, that at least one of Q.sup.22 and Q.sup.24, at least one
of Q.sup.32 and Q.sup.33, at least one of Q.sup.43 and Q.sup.44, at
least one of Q.sup.52 and Q.sup.54, and at least one of Q.sup.102
and Q.sup.104 is hydrogen, fluoro, chloro, lower alkyl or fluoro
substituted lower alkyl; [0156] Q.sup.62, Q.sup.74, Q.sup.112,
Q.sup.124, Q.sup.132, Q.sup.144, and Q.sup.152 are hydrogen,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
--NR.sup.44R.sup.44, --OR.sup.44, or --SR.sup.44; [0157] Q.sup.64,
Q.sup.72, Q.sup.82, and Q.sup.94 are hydrogen, lower alkyl or
fluoro substituted lower alkyl; [0158] R.sup.43 at each occurrence
is independently optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl or optionally substituted heteroaryl;
[0159] R.sup.39 and R.sup.40 are as defined for Formula Ig; [0160]
each R.sup.44 is independently hydrogen, lower alkyl or fluoro
substituted lower alkyl; [0161] w is 1, 2, or 3; and [0162]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, R.sup.25,
R.sup.26, s, t and u are as defined for Formula Ib; [0163]
provided, however, that the compound is not
##STR00021## ##STR00022## ##STR00023##
[0164] In one embodiment of compounds of Formula II, [0165] D has a
structure selected from the group consisting of
[0165] ##STR00024## [0166] in which
##STR00025##
[0166] indicates the attachment point of D to A.sub.2 of Formula
II; [0167] A.sub.2 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--, provided, however, that
when A.sub.2 is NR.sup.21, N is not bound to a nitrogen of D,
preferably A.sub.2 is --CH.sub.2-- or --C(O)--; [0168] B is
selected from the group consisting of hydrogen, --CN, --OR.sup.41,
--SR.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41,
--C(O)NR.sup.39R.sup.41, --C(O)R.sup.41,
--S(O).sub.2NR.sup.39R.sup.41, --S(O).sub.2R.sup.41, halogen, lower
alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
lower alkyl is optionally substituted with one or more substituents
selected from the group consisting of fluoro, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl as B, or as substituents of
lower alkyl are optionally substituted with one or more
substituents selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2,
--OR.sup.42, --SR.sup.4, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino; [0169] M.sub.4 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--NR.sup.39CH.sub.2CH.sub.2--, or --NR.sup.39C(O)--, preferably
--NHCH.sub.2-- or --NHC(O)--; [0170] M.sub.5, M.sub.10, and
M.sub.18 are selected from the group consisting of a bond,
--(CR.sup.19R.sup.20).sub.u,
--(CR.sup.19R.sup.20).sub.t--C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sup.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)O(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2--CR.sup.19R.sup.20).sub.-
s--, and
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2NR.sup.26--(CR.su-
p.19R.sup.20).sub.s--, preferably a bond, --NR.sup.39--, --S--,
--O--, --NR.sup.39CH.sub.2, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH.sub.2CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --C(O)NR.sup.39--,
--S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--, more preferably --NR.sup.39CH.sub.2--,
--NR.sup.39CH(R.sup.40)-- or --NR.sup.39C(O)--, more preferably
--NHCH.sub.2--, --NHCH(CH.sub.3)-- or --NHC(O)--; [0171] M.sub.8 is
selected from the group consisting of a bond,
--(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.w--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26C(S)NR.sup.26C(S)NR.sup.26--
-(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.w--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub-
.s--, and
--(CR.sup.19R.sup.20).sub.w--NR.sup.26S(O).sub.2NR.sup.26--(CR.s-
up.19R.sup.20).sub.s--, preferably a bond, --CH.sub.2--,
--CH.sub.2C(O)--, --S(O).sub.2--, --S(O).sub.2CH.sub.2--,
--S(O).sub.2CH(CH.sub.3)--, --S(O).sub.2CH.sub.2CH.sub.2--,
--S(O).sub.2NR.sup.39--, --S(O).sub.2N.sup.39CH.sub.2--,
--S(O).sub.2NR.sup.39CH(CH.sub.3)--,
--S(O).sub.2NR.sup.39CH.sub.2CH.sub.2--, --C(O)--,
--C(O)CH.sub.2--, --C(O)CH(CH.sub.3), --C(O)CH.sub.2CH.sub.2--,
--C(O)NR.sup.39--, --C(O)NR.sup.39CH.sub.2--,
--C(O)NR.sup.39CH(CH.sub.3)--, and
--C(O)NR.sup.39CH.sub.2CH.sub.2--, more preferably
--C(O)NR.sup.39CH.sub.2--, --C(O)NR.sup.39CH(R.sup.40)-- or
--C(O)NR.sup.39CH.sub.2CH.sub.2--, more preferably
--C(O)NHCH.sub.2--, --C(O)NHCH(CH.sub.3)-- or
--C(O)NHCH.sub.2CH.sub.2--; [0172] Q.sup.1, Q.sup.11, Q.sup.41,
Q.sup.61, and Q.sup.141 are aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, halogen, lower alkyl, cycloalkyl,
heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is
optionally substituted with one or more substituents selected from
the group consisting of fluoro, lower alkoxy, fluoro substituted
lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl,
and heteroaryl, and wherein cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl as a substituent of Q.sup.1, Q.sup.11, Q.sup.41,
Q.sup.61, or Q.sup.141, or as a substituent of lower alkyl are
optionally substituted with one or more substituents selected from
the group consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino,
preferably Q.sub.1, Q.sup.11, Q.sup.41, Q.sup.61, and Q.sup.141 are
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more halogen, lower alkyl, fluoro
substituted lower alkyl, --NHS(O).sub.2R.sup.41, --NHC(O)R.sup.41,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 or
--S(O).sub.2R.sup.41; [0173] Q.sup.12 is fluoro, chloro or
--CF.sub.3; [0174] Q.sup.13 and Q.sup.14 are independently
hydrogen, fluoro, chloro, lower alkyl, or fluoro substituted lower
alkyl; [0175] Q.sup.22, Q.sup.24, Q.sup.52 and Q.sup.54 are
independently selected from the group consisting of hydrogen,
halogen, lower alkyl, fluoro substituted lower alkyl,
--NR.sup.44R.sup.44, --OR.sup.44, and --SR.sup.44, provided,
however, that at least one of Q.sup.22 and Q.sup.24 and at least
one of Q.sup.52 and Q.sup.54 is hydrogen, fluoro, chloro, lower
alkyl or fluoro substituted lower alkyl; [0176] Q.sup.74 and
Q.sup.152 are hydrogen, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, --NR.sup.44R.sup.44, --OR.sup.44, or
--SR.sup.44; [0177] Q.sup.72 is hydrogen, lower alkyl or fluoro
substituted lower alkyl; [0178] R.sup.39, R.sup.40 and R.sup.41 are
as defined for Formula Ig; [0179] each R.sup.44 is independently
hydrogen, lower alkyl or fluoro substituted lower alkyl; and [0180]
R.sup.19, R.sup.20, R.sup.21, R.sup.26, s, t and u are as defined
for Formula Ib.
[0181] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIa,
##STR00026##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0182] A.sub.3 is --CH.sub.2-- or --C(O)--; [0183] Q.sup.1a is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, and --OR.sup.41; [0184] Q.sup.5
is hydrogen, --OR.sup.43, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.43, --NR.sup.43R.sup.43,
--OR.sup.43 and --S(O).sub.2R.sup.43; and [0185] M.sub.4, Q.sup.12,
Q.sup.13, Q.sup.14, R.sup.41, and R.sup.43 are as defined for
Formula II; [0186] provided, however, that the compound is not
##STR00027##
[0187] In one embodiment of compounds of Formula IIa, A.sub.3 is
--CH.sub.2-- and M.sub.4 is --NHCH.sub.2--. In one embodiment
A.sub.3 is --C(O)-- and M.sub.4 is --NHCH.sub.2--. In one
embodiment A.sub.3 is --C(O)-- and M.sub.4 is --NHC(O)--. In one
embodiment A.sub.3 is --CH.sub.2-- and M.sub.4 is --NHC(O)--.
[0188] In one embodiment of compounds of Formula IIa, A.sub.3 is
--CH.sub.2--, M.sub.4 is --NHCH.sub.2--, Q.sup.5 is --OR.sup.43,
--CN, C.sub.1-3 alkyl, fluoro substituted C.sub.1-3 alkyl, fluoro,
chloro, aryl or heteroaryl, wherein aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.43, --NR.sup.43R.sup.43, --OR.sup.43 and
--S(O).sub.2R.sup.43, and Q.sup.16 and Q.sup.14 are hydrogen.
[0189] In one embodiment of compounds of Formula IIa, A.sub.3 is
--C(O)--, M.sub.4 is --NHCH.sub.2--, Q.sup.5 is --OR.sup.43, --CN,
C.sub.1-3 alkyl, fluoro substituted C.sub.1-3 alkyl, fluoro,
chloro, aryl or heteroaryl, wherein aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.43, --NR.sup.43R.sup.43, --OR.sup.43 and
--S(O).sub.2R.sup.43, and Q.sup.13 and Q.sup.14 are hydrogen.
[0190] In one embodiment of compounds of Formula IIa, A.sub.3 is
--C(O)--, M.sub.4 is --NHC(O)--, Q.sup.5 is --OR.sup.43, --CN,
C.sub.1-3 alkyl, fluoro substituted C.sub.1-3 alkyl, fluoro,
chloro, aryl or heteroaryl, wherein aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.43, --NR.sup.43R.sup.43, --OR.sup.43 and
--S(O).sub.2R.sup.43, and Q.sup.13 and Q.sup.14 are hydrogen.
[0191] In one embodiment of compounds of Formula IIa, A.sub.3 is
--CH.sub.2--, M.sub.4 is --NHC(O)--, Q.sup.5 is --OR.sup.43, --CN,
C.sub.1-3 alkyl, fluoro substituted C.sub.1-3 alkyl, fluoro,
chloro, aryl or heteroaryl, wherein aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.43, --NR.sup.43R.sup.43, --OR.sup.43 and
--S(O).sub.2R.sup.43, and Q.sup.13 and Q.sup.14 are hydrogen.
[0192] In one embodiment of compounds of Formula IIa, A.sub.3 is
--CH.sub.2-- or --C(O)--; Q.sup.1a is aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.41,
--NR.sup.41R.sup.41, and --OR.sup.41; Q.sup.5 is hydrogen, --CN,
--OR.sup.41, fluoro, chloro, lower alkyl, fluoro substituted lower
alkyl, aryl or heteroaryl, wherein aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and --OR.sup.41;
M.sub.4 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--NR.sup.39CH.sub.2CH.sub.2--, or --NR.sup.39C(O)--; Q.sup.12 is
fluoro, chloro or --CF.sub.3; and Q.sup.13 and Q.sup.14 are
independently hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl, wherein R.sup.41 is as defined for Formula
II.
[0193] In one embodiment, further to any of the embodiments of
Formula IIa above, R.sup.43 is R.sup.41 as defined for Formula Ig.
In one embodiment, further to any of the embodiments of Formula IIa
above, R.sup.43 is R.sup.42 as defined for Formula Ig.
[0194] In one embodiment, further to any of the embodiments of
Formula IIa above, Q.sup.1a is phenyl or pyridinyl, wherein phenyl
or pyridinyl are substituted with 1 or 2 substituents selected from
the group consisting of fluoro, chloro, methyl, methoxy,
trifluoromethyl, difluoromethoxy and trifluoromethoxy; A.sub.3 is
--CH.sub.2--; M.sub.4 is --NHCH.sub.2--; and Q.sup.5 is --CN,
fluoro, chloro, methyl, trifluoromethyl, methoxy, difluoromethoxy,
trifluoromethoxy, aryl or heteroaryl, wherein aryl or heteroaryl
are optionally substituted with one or more halogen, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, or fluoro substituted
lower alkoxy. In one embodiment, further to any of the embodiments
of Formula Ha above, Q.sup.1a is phenyl mono substituted with
chloro, preferably at the 4-position; A.sub.3 is --CH.sub.2--;
M.sub.4 is --NHCH.sub.2--; and Q.sup.5 is --CN, fluoro, chloro,
methyl, trifluoromethyl, methoxy, difluoromethoxy,
trifluoromethoxy, aryl or heteroaryl, wherein aryl or heteroaryl
are optionally substituted with one or more halogen, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, or fluoro substituted
lower alkoxy. In one embodiment, further to any of the embodiments
of Formula IIa, Q.sup.1a is pyridin-3-yl monosubstituted with
methyl, methoxy, trifluoromethyl, difluoromethoxy or
trifluoromethoxy, preferably at the 6-position; A.sub.3 is
--CH.sub.2--; M.sub.4 is --NHCH.sub.2--; Q.sup.5 is --CN, fluoro,
chloro, methyl, trifluoromethyl, methoxy, difluoromethoxy,
trifluoromethoxy, aryl or heteroaryl, wherein aryl or heteroaryl
are optionally substituted with one or more halogen, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, or fluoro substituted
lower alkoxy.
[0195] In one embodiment of compounds of Formula IIa, A.sub.3 is
--CH.sub.2--; M.sub.4 is --NHCH.sub.2--; Q.sup.1a is phenyl or
pyridinyl, wherein phenyl or pyridinyl are substituted with 1 or 2
substituents selected from the group consisting of fluoro, chloro,
methyl, methoxy, trifluoromethyl, difluoromethoxy and
trifluoromethoxy; Q.sup.5 is hydrogen, fluoro, chloro, methyl,
methoxy, trifluoromethyl, trifluoromethoxy, --CN, or
1-methyl-1H-pyrazole-4-yl: Q.sup.12 is fluoro or chloro; and
Q.sup.13 and Q.sup.14 are hydrogen. In one embodiment, A.sub.3 is
--CH.sub.2--; M.sub.4 is --NHCH.sub.2--; Q.sup.1a is phenyl mono
substituted with chloro, preferably at the 4-position, Q.sup.5 is
hydrogen, chloro, methyl, methoxy, or --CN; Q.sup.12 is fluoro or
chloro; and Q.sup.13 and Q.sup.14 are hydrogen. In one embodiment,
A.sub.3 is --CH.sub.2--; M.sub.4 is --NHCH.sub.2--; Q.sup.1a is
pyridin-3-yl monosubstituted with methyl, methoxy, trifluoromethyl,
difluoromethoxy or trifluoromethoxy, preferably at the 6-position;
Q.sup.5 is hydrogen, chloro, methyl, methoxy, --CN, or
1-methyl-1H-pyrazole-4-yl; Q.sup.12 is fluoro or chloro; and
Q.sup.13 and Q.sup.14 are hydrogen.
[0196] In one embodiment of compounds of Formula IIa, the compound
is selected from the group consisting of: [0197]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-flu-
oro-pyridin-2-yl]-amine (P-0132), [0198]
(4-Chloro-benzyl)-[6-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0161), [0199]
[6-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-triflu-
oromethyl-pyridin-3-ylmethyl)-amine (P-0174). [0200]
[6-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0176), [0201]
(6-Chloro-5-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl]-pyridin-2-yl-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine
(P-0179), [0202]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fluoro-pyridin-
-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0186),
[0203]
[6-Fluoro-5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0187), [0204]
[6-Fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-triflu-
oromethyl-pyri din-3-ylmethyl)-amine (P-0188), [0205]
3-{2-Chloro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridin-3-yl-
methyl}-1H-pyrrolo[2,3-b]pyridine-5-carbonitrile (P-0232), [0206]
[6-Chloro-5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0233), [0207]
[6-Chloro-5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0234), [0208]
[6-Fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-methox-
y-pyridin-3-ylmethyl)-amine (P-0378), [0209]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fluoro-pyridin-2-yl]--
(6-methoxy-pyridin-3-ylmethyl)-amine (P-0379), [0210]
(5-Fluoro-pyridin-3-ylmethyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0414), [0211]
3-{2-Fluoro-6-[(5-fluoro-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1-
H-pyrrolo[2,3-b]pyridine-5-carbonitrile (P-0415), [0212]
3-[6-(4-Chloro-benzylamino)-2-fluoro-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0432), and all salts, prodrugs,
tautomers, and isomers thereof.
[0213] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIb.
##STR00028##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0214] A.sub.2 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O),
--S(O).sub.2--, --NR.sup.21--, and --O--; [0215] Q.sup.15 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --(C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O)R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.23,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; M.sub.5, Q.sup.11, Q.sup.22
and Q.sup.24 are as defined for Formula II; and [0216] R.sup.19,
R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are as defined
for Formula Ib; [0217] provided, however, that the compound is
no
##STR00029##
[0218] In one embodiment of compounds of Formula IIb, M.sub.5 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.26--C(O)--, wherein R.sup.39 is hydrogen or lower alkyl
and R.sup.40 is lower alkyl or fluoro substituted lower alkyl. In
one embodiment, A.sub.2 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.11 is
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23 and Q.sup.15 is hydrogen, --OR.sup.23, --CN,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23. Further to any of the above embodiments,
Q.sup.22 and Q.sup.24 are independently hydrogen, fluoro, chloro,
or --CF.sub.3, preferably Q.sup.22 and Q.sup.24 are hydrogen.
[0219] In one embodiment of compounds of Formula IIb, M.sub.5 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s, or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, and A.sub.2 is --CR.sup.19R.sup.20-- or
--C(O)--, preferably --CH.sub.2-- or --C(O)--. In one embodiment,
M.sub.5 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--; A.sub.2 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--; Q.sup.11 is cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.15 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. In one
embodiment, M.sub.5 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--; A.sub.2 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--; Q.sup.11 is cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23--;
Q.sup.15 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.22 and Q.sup.24 are independently hydrogen, fluoro, chloro,
or --CF.sub.3, preferably Q.sup.22 and Q.sup.24 are hydrogen.
[0220] In one embodiment of compounds of Formula IIb, M.sub.5 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--NR.sup.39CH.sub.2CH.sub.2--, or --NR.sup.39C(O)--; A.sub.2 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.11 is
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.15 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; Q.sup.22 and Q.sup.24 are
independently hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl, preferably hydrogen, fluoro, chloro, or
--CF.sub.3, more preferably both Q.sup.22 and Q.sup.24 are
hydrogen, wherein R.sup.41 is as defined for Formula Ig.
[0221] In one embodiment of compounds of Formula IIb, A.sub.2 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.11 is
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.11, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.15 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.4, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.5 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.22, and Q.sup.24, are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, --NR.sup.44R.sup.44, --OR.sup.44, or --SR.sup.44,
provided, however, that at least one of Q.sup.22 and Q.sup.24 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl, wherein R.sup.39, R.sup.40, R.sup.41, and R.sup.42 are as
defined for Formula Ig, and R.sup.44 is as defined for Formula
II.
[0222] In one embodiment of compounds of Formula IIb, A.sub.2 is
--CH.sub.2--; Q.sup.11 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, fluoro substituted
lower alkoxy, di-alkylamino, and heterocycloalkyl; Q.sup.15 is
hydrogen, --CN, fluoro, chloro, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, or fluoro substituted lower alkoxy;
M.sub.5 is --NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.22 and Q.sup.24 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, or fluoro substituted lower alkoxy,
provided, however, that at least one of Q.sup.22 and Q.sup.24 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl.
[0223] In one embodiment, further to any of the embodiments of
Formula IIb above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0224] In one embodiment of compounds of Formula IIb, M.sub.5 is
--NHCH.sub.2CH.sub.2--, --NHCH.sub.2--, --N(CH.sub.3)CH.sub.2--, or
--NHCH(CH.sub.3)--, preferably --NHCH.sub.2--; A.sub.2 is
--CH.sub.2--; Q.sup.11 is cycloalkyl, heterocycloalkyl, phenyl or
heteroaryl, wherein phenyl or heteroaryl are optionally substituted
with 1 or 2 substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
fluoro substituted lower alkoxy, di-alkylamino, and
heterocycloalkyl; Q.sup.15 is hydrogen, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy, and Q.sup.22 and Q.sup.24 are independently hydrogen,
fluoro, chloro, lower alkyl, or fluoro substituted lower alkyl,
preferably hydrogen, fluoro, chloro, or --CF.sub.3, more preferably
both Q.sup.22 and Q.sup.24 are hydrogen.
[0225] In one embodiment of compounds of Formula IIb, M.sub.5 is
--NHCH.sub.2--; A.sub.2 is --CH.sub.2--; Q.sup.11 is phenyl
substituted with 1 or 2 substituents selected from the group
consisting of fluoro, chlor, methyl, fluoro substituted methyl,
methoxy, and fluoro substituted methoxy; Q.sup.15 is hydrogen,
--CN, fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
lower alkoxy, fluoro substituted lower alkoxy, preferably hydrogen
or chloro; and Q.sup.22 and Q.sup.24 are hydrogen.
[0226] In one embodiment of compounds of Formula IIb, the compound
is selected from the group consisting of: [0227]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0260), [0228]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,6-di-
fluoro-benzyl)-amine (P-0261), [0229]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trif-
luoromethyl-benzyl)-amine (P-0262), [0230]
(2-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0263), [0231]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-fluo-
ro-benzyl)-amine (P-0264). [0232]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,4-di-
fluoro-benzyl)-amine (P-0265), [0233]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-trif-
luoromethyl-benzyl)-amine (P-0266), [0234]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,5-di-
fluoro-benzyl)-amine (P-0267), [0235]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3-trif-
luoromethyl-benzyl)-amine (P-0268), [0236]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin
2-yl]-(2-fluoro-5-trifluoromethyl-benzyl)-amine (P-0289), [0237]
(2-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0291), [0238]
(2,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0292), [0239]
(2-Chloro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0293), [0240]
(3-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0294), [0241]
(3,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0295), [0242]
(2-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl-
]-amine (P-0300). [0243]
(2-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl-
]-amine (P-0301), [0244]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-2-trifluoromethy-
l-benzyl)-amine (P-0302), [0245]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trifluorometh-
oxy-benzyl)-amine (P-0303), [0246]
(5-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0304), [0247]
(2,4-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0305). [0248]
(2,4-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0306), [0249]
(4-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl-
]-amine (P-0307), [0250]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-trifluorometh-
yl-benzyl)-amine (P-030). [0251]
(2-Fluoro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0309), [0252]
(2,5-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0310), [0253]
(3-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0311), [0254]
(2-Difluoromethoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0312), [0255]
(2,3-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0313), [0256]
(4-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0314), [0257]
(5-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]amine (P-0315), [0258]
(2-Chloro-4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0316), [0259]
(5-Chloro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0317), [0260]
(5-Fluoro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0318), [0261]
(2-Fluoro-4-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0319), [0262]
(4-Fluor-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyrimidin-2-yl]-amine (P-0320), [0263]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-difl-
uoromethoxy-benzyl)-amine (P-0390), [0264]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(5-fluo-
ro-2-trifluoromethyl-benzyl)-amine (P-0391), [0265]
(3-Chloro-2-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0392), [0266]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-fluo-
ro-3-trifluoromethyl-benzyl)-amine (P-0393), [0267]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-fluo-
ro-4-trifluoromethyl-benzyl)-amine (P-0394), [0268]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,3-di-
fluoro-benzyl)-amine (P-0395), [0269]
(2-Chloro-4-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0396), [0270]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trif-
luoromethoxy-benzyl)-amine (P-0402), [0271]
(2-Chloro-5-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-4047), [0272]
(2-Chloro-5-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]amine (P-0408), [0273]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-pyridin-
-4-ylmethyl-amine (P-0416), [0274]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-pyrr-
olidin-1-yl-ethyl)-amine (P-0417), [0275]
Benzyl-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]--
amine (P-0418), [0276]
Benzyl-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]--
methyl-amine (P-0419), [0277]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin
2-yl]-(4-trifluoromethoxy-benzyl)-amine (P-0420), [0278]
(3-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0421), [0279]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-pyridin-
-3-ylmethyl-amine (P-0422), [0280]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-fluo-
ro-benzyl)-amine (P-0423), [0281]
(3-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-methyl-amine (P-0424), [0282]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3,5-di-
fluoro-benzyl)-amine (P-0425), [0283]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin
2-yl]-[1-(2-fluoro-phenyl)-ethyl]-amine (P-0426). [0284]
[1-(4-Chloro-phenyl)-ethyl]-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyrimidin-2-yl]-amine (P-0427), [0285]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-[(S)-1--
(4-fluoro-phenyl)-ethyl]-amine (P-0428), [0286]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(6-trif-
luoromethyl-pyridin-3-ylmethyl)-amine (P-0429), [0287]
(2-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-methyl-amine (P-0430), [0288]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-meth-
yl-benzyl)-amine (P-0431), [0289]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-meth-
oxybenzyl)-amine (P-0433), [0290]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-morp-
holin-4-yl-ethyl)-amine (P-0434), [0291]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-cyclohe-
xylmethyl-amine (P-0435), [0292]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-pyridin-
-2-ylmethyl-amine (P-0436), [0293]
[2-(4-Chloro-phenyl)-ethyl]-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyrimidin-2-yl]-amine (P-0437), [0294]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-difl-
uoromethoxy-benzyl)-amine (P-0438), [0295]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-meth-
oxy-benzyl)-amine (P-0439), [0296]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-meth-
yl-benzyl)-amine (P-0440). [0297]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-meth-
oxy-ethyl)-amine (P-0441), [0298]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3-fluo-
ro-benzyl)-amine (P-0442), [0299]
(3-Chloro-4-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0443), [0300]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-etho-
xy-benzyl)-amine (P-0444), [0301]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-morp-
holin-4-yl-benzyl)-amine (P-0445), [0302]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3-difl-
uoromethoxy-benzyl)-amine (P-0446), [0303]
(4-Chloro-3-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin 2-yl]-amine (P-0447), [0304]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-[1-(3-f-
luoro-phenyl)-ethyl]-amine (P-0448), [0305]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-dime-
thylamino-benzyl)-amine (P-0449), and all salts, prodrugs,
tautomers, and isomers thereof.
[0306] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIc,
##STR00030##
all salts, prodrugs, tautomers, and isomers thereof. wherein:
[0307] A.sub.4 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--. --NR.sup.21--, and --O--; [0308] Q.sup.25 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2--NR.sup.24R.sup.25, --NHR.sup.23, --OR.sup.23,
--SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23, --S(O)R.sup.23,
--S(O).sub.2R.sup.23, --C(O)NHR.sup.23, --C(O)NR.sup.23R.sup.23,
--C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23, --S(O).sub.2NHR.sup.23,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23--C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O)NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0309] M.sub.6, Q.sup.21,
Q.sup.32 and Q.sup.33 are as defined for Formula II; and [0310]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib.
[0311] In one embodiment of compounds of Formula IIc, M.sub.6 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, wherein R.sup.39 is hydrogen or lower alkyl and
R.sup.40 is lower alkyl or fluoro substituted lower alkyl. In one
embodiment, A.sub.4 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.21 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23 and Q.sup.25 is hydrogen, --OR.sup.23, --CN,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and --S(O)R.sup.23.
Further to any of the above embodiments, Q.sup.32 and Q.sup.33 are
independently hydrogen, fluoro, chloro, or --CF.
[0312] In one embodiment of compounds of Formula IIc, M.sub.6 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, and A.sub.4 is --CR.sup.19R.sup.20-- or
--C(O)--, preferably --CH.sub.2-- or --C(O)--. In one embodiment,
M.sub.5 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--; A.sub.4 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--; Q.sup.21 is aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O)--R.sup.23; and Q.sup.25
is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23. In one embodiment, M.sub.6 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.30CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--; A.sub.4 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--; Q.sup.21 is aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.23R.sup.23:
Q.sup.25 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.32 and Q.sup.33 are independently hydrogen, fluoro, chloro,
or --CF.sub.3.
[0313] In one embodiment of compounds of Formula IIe, M.sub.6 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, preferably --NHCH.sub.2--; A.sub.4 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.21 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.25 is hydrogen, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; Q.sup.32 and Q.sup.33 are
independently hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl, preferably Q.sup.32 and Q.sup.33 are
independently hydrogen fluoro, chloro, or --CF.sub.3, wherein
R.sup.41 is as defined for Formula Ig.
[0314] In one embodiment of compounds of Formula IIc, A.sub.4 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.21 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.21, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.25 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.6 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.32 and Q.sup.33 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, --NR.sup.44R.sup.44, --OR.sup.44, or --SR.sup.44,
provided, however, that at least one of Q.sup.32 and Q.sup.33 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl, wherein R.sup.39, R.sup.40, R.sup.41, R.sup.42 and R.sup.44
are as defined for Formula II.
[0315] In one embodiment of compounds of Formula IIe, A.sub.4 is
--CH.sub.2--; Q.sup.21 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.25 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.6 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.32 and Q.sup.33 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, or fluoro substituted lower alkoxy,
provided, however, that at least one of Q.sup.32 and Q.sup.33 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl.
[0316] In one embodiment, further to any of the embodiments of
Formula IIc above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0317] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IId,
##STR00031##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0318] A.sub.5 is selected from the group consisting of
--CR.sup.19R.sup.20, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0319] Q.sup.35 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.2,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O)R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0320] M.sub.7, Q.sup.31,
Q.sup.43 and Q.sup.44 are as defined for Formula II; and [0321]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib.
[0322] In one embodiment of compounds of Formula IId, M.sub.7 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, wherein R.sup.39 is hydrogen or lower alkyl and
R.sup.40 is lower alkyl or fluoro substituted lower alkyl. In one
embodiment, A.sub.5 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.31 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23 and Q.sup.35 is hydrogen, --OR.sup.23, --CN,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23. Further to any of the above embodiments,
Q.sup.43 and Q.sup.44 are independently hydrogen, fluoro, chloro,
or --CF.sub.3.
[0323] In one embodiment of compounds of Formula IId, M.sub.7 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, and A.sub.5 is --CR.sup.19R.sup.20-- or
--C(O)--, preferably --CH.sub.2-- or --C(O)--. In one embodiment,
M.sub.7 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CH.sub.2, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--; A.sub.5 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--; Q.sup.31 is aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.26, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.35 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. In one
embodiment, M.sub.7 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.16--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.9CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--; A.sub.5 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--; Q.sup.31 is aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; Q.sup.35
is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23; and Q.sup.43 and Q.sup.44 are
independently hydrogen, fluoro, chloro, or --CF.sub.3.
[0324] In one embodiment of compounds of Formula IId, M.sub.7 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)-- or
--NR.sup.39C(O)--, preferably --NHCH.sub.2--; A.sub.5 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.31 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.35 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; Q.sup.43 and Q.sup.44 are
independently hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl, preferably Q.sup.43 and Q.sup.44 are
independently hydrogen, fluoro, chloro, or --CF.sub.3, wherein
R.sup.4' is as defined for Formula Ig.
[0325] In one embodiment of compounds of Formula IId, A.sub.5 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.31 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.4,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.19C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.31, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.43, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.35 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.19S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.7 is a bond. --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.43 and Q.sup.44 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, --NR.sup.44R.sup.44, --OR.sup.44, or --SR.sup.44,
provided, however, that at least one of Q.sup.43 and Q.sup.44 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl, wherein R.sup.39, R.sup.40, R.sup.41, R.sup.42 and R.sup.44
are as defined for Formula II.
[0326] In one embodiment of compounds of Formula IId, A.sub.5 is
--CH.sub.2--; Q.sup.31 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.35 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.7 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.43 and Q.sup.44 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, or fluoro substituted lower alkoxy,
provided, however, that at least one of Q.sup.43 and Q.sup.44 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl.
[0327] In one embodiment, further to any of the embodiments of
Formula IId above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0328] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIe,
##STR00032##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0329] A.sub.6 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0330] Q.sup.43 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23--, --C(S)NHR.sup.23,
--C(S)NR.sup.23R.sup.23, --S(O).sub.2NHR.sup.23,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O)R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.2C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.23NR.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0331] M.sub.8, Q.sup.41,
Q.sup.52 and Q.sup.54 are as defined in Formula II; and [0332]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib; [0333] provided, however, that the
compound is not
##STR00033## ##STR00034##
[0334] In one embodiment of compounds of Formula IIe, M.sub.8 is
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
preferably --C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--, more
preferably --C(O)NR.sup.39--CR.sup.80R.sup.80-- or
--C(O)NR.sup.39--(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.6 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.41 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23 and Q.sup.45 is hydrogen, --OR.sup.23, --CN,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23. Further to any of the above embodiments,
Q.sup.52 and Q.sup.54 are independently hydrogen, fluoro, chloro,
methyl, or --CF.sub.3.
[0335] In one embodiment of compounds of Formula IIe, M.sub.8 is
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
preferably --C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--, more
preferably --C(O)NR.sup.39--CR.sup.80R.sup.80-- or
--C(O)NR.sup.39--(CR.sup.80R.sup.80).sub.2--, and A.sub.6 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.8 is
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
preferably --C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--, more
preferably --C(O)NR.sup.39--CR.sup.80R.sup.80-- or
--C(O)NR.sup.39--(CR.sup.80R.sup.80).sub.2--; A.sub.6 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.41 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23; and Q.sup.45 is hydrogen,
--OR.sup.23, --CN, fluoro, chloro, lower alkyl, fluoro substituted
lower alkyl, cycloalkyl, heterocycloalkyl, aryl or heteroaryl,
wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23. In one embodiment, M.sub.8 is
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
preferably --C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--, more
preferably --C(O)NR.sup.39--CR.sup.80R.sup.80-- or
--C(O)NR.sup.39--(CR.sup.80R.sup.80).sub.2--; A.sub.6 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.41 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23; Q.sup.45 is hydrogen,
--OR.sup.2, --CN, fluoro, chloro, lower alkyl, fluoro substituted
lower alkyl, cycloalkyl, heterocycloalkyl, aryl or heteroaryl,
wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of halogen, lower alkyl, fluoro substituted
lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23, --OR.sup.23 and
--S(O).sub.2R.sup.23; and Q.sup.52 and Q.sup.54 are independently
hydrogen, fluoro, chloro, methyl, or --CF.sub.3.
[0336] In one embodiment of compounds of Formula IIe, M.sub.8 is
--C(O)NR.sup.19--CH.sub.2--, --C(O)NR.sup.39CH(CH.sub.3)--, or
--C(O)NR.sup.39--(CH.sub.2).sub.2--; A.sub.6 is --CH.sub.2-- or
--C(O)--, preferably --CH.sub.2--; Q.sup.41 is aryl or heteroaryl,
wherein aryl or heteroaryl are optionally substituted with one or
more substituents selected from the group consisting of halogen,
lower alkyl, fluoro substituted lower alkyl, --NHR.sup.41,
--NR.sup.41R.sup.41, --OR.sup.41 and --S(O).sub.2R.sup.41; Q.sup.45
is hydrogen, --CN, fluoro, chloro, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, fluoro substituted lower alkoxy,
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; and Q.sup.52 and Q.sup.54 are independently
hydrogen, fluoro, chloro, lower alkyl, or fluoro substituted lower
alkyl, preferably Q.sup.52 and Q.sup.54 are independently fluoro,
chloro, methyl, or --CF.sub.3, wherein R.sup.41 is as defined in
Formula Ig.
[0337] In one embodiment of compounds of Formula IIe, A.sub.6 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.41 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.41, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.45 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.8 is --C(O)NR.sup.39CH.sub.2--.
--C(O)NR.sup.39CH(R.sup.40)--, or
--C(O)NR.sup.39CH.sub.2CH.sub.2--; and Q.sup.52 and Q.sup.54 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, --NR.sup.44R.sup.44, --OR.sup.44, or --SR.sup.44,
provided, however, that at least one of Q.sup.52 and Q.sup.54 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl, wherein R.sup.19, R.sup.40, R.sup.41, R.sup.42 and R.sup.44
are as defined for Formula II.
[0338] In one embodiment of compounds of Formula IIe, A.sub.6 is
--CH.sub.2--; Q.sup.41 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.45 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.8 is
--C(O)NR.sup.39CH.sub.2--, --C(O)NR.sup.39CH(R.sup.40)--, or
--C(O)NR.sup.39CH.sub.2CH.sub.2--; and Q.sup.52 and Q.sup.54 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, or fluoro substituted lower alkoxy,
provided, however, that at least one of Q.sup.52 and Q.sup.54 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl.
[0339] In one embodiment, further to any of the embodiments of
Formula IIe above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0340] In one embodiment of compounds of Formula IIe, M.sub.8 is
--C(O)NHCH.sub.2--, --C(O)NH--CH(CH.sub.3)-- or
--C(O)NH--(CH.sub.2).sub.2--; A.sub.6 is --CH.sub.2-- or --C(O)--,
preferably --CH.sub.2--; Q.sup.41 is aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with 1 or 2
substituents selected from the group consisting of fluoro, chloro,
methyl, fluoro substituted methyl, methoxy, and fluoro substituted
methoxy; Q.sup.45 is hydrogen, --CN, fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, or fluoro substituted
lower alkoxy, preferably hydrogen or chloro; and Q.sup.52 and
Q.sup.54 are independently hydrogen, fluoro, chloro, lower alkyl,
or fluoro substituted lower alkyl, preferably Q.sup.52 and Q.sup.54
are methyl.
[0341] In one embodiment of compounds of Formula IIe, the compound
is selected from the group consisting of: [0342]
3-(1-Benzyl-3,5-dimethyl-1H-pyrazol-4-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0133), [0343]
2-[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-1-p-
henyl-ethanone (P-0134), [0344]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-methoxy-benzylamide (P-0135), [0345]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-chloro-benzylamide (P-0136), [0346]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-fluoro-benzylamide (P-0137), [0347]
3-[3,5-Dimethyl-4-(5-trifluoromethyl-furan-2-ylmethyl)-1H-pyrazol-4-ylmet-
hyl]-1H-pyrrolo[2,3-b]pyridine (P-0138), [0348]
3-[3,5-Dimethyl-1-(5-methyl-isoxazol-3-ylmethyl)-1H-pyrazol-4-ylmethyl]-1-
H-pyrrolo[2,3-b]pyridine (P-0139), [0349]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-chloro-benzylamide (P-0140), [0350]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(4-methoxy-phenyl)-ethyl]-amide (P-0141), [0351]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 3-methoxy-benzylamide (P-0142), [0352]
3-{3,5-Dimethyl-1-[4-methyl-2-(4-trifluoromethyl-phenyl)thiazol-5-ylmethy-
l]-1H-pyrazol-4-ylmethyl}-1H-pyrrolo[2,3-b]pyridine (P-0143),
[0353]
3-[3,5-Dimethyl-1-(4-methyl-2-phenyl-thiazol-5-ylmethyl)-1H-pyrazol-4-ylm-
ethyl]-1H-pyrrolo[2,3-b]pyridine (P-0144), [0354]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-methoxy-benzylamide (P-0145), [0355]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(2,4-dichloro-phenyl)-ethyl]-amide (P-0146), [0356]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(4-fluoro-phenyl)-ethyl]-amide (P-0147), [0357]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(2-fluoro-phenyl)-ethyl]-amide (P-0148), [0358]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid ((S)-1-phenyl-ethyl)-amide (P-0149), [0359]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 3-fluoro-benzylamide (P-0150), [0360]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-fluoro-benzylamide (P-0151), [0361]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-methyl-benzylamide (P-0152), [0362]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-methyl-benzylamide (P-0153), [0363]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid [2-(4-fluoro-phenyl)-ethyl]-amide (P-0157), [0364]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid 4-fluoro-benzylamide (P-0158), [0365]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid 4-chloro-benzylamide (P-0159), [0366]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid [(S)-1-(4-fluoro-phenyl)-ethyl]-amide (P-0160), and
all salts, prodrugs, tautomers, and isomers thereof.
[0367] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIf.
##STR00035##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0368] A.sub.7, is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0369] Q.sup.55 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0370] M.sub.9, Q.sup.51,
Q.sup.62, and Q.sup.64 are as defined for Formula II; and [0371]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib.
[0372] In one embodiment of compounds of Formula IIf, M.sub.9 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.7 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.51 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.55 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O)R.sup.23. Further to any
of the above embodiments, Q.sup.62 is hydrogen, fluoro, chloro,
lower alkyl or fluoro substituted lower alkyl.
[0373] In one embodiment of compounds of Formula IIf, M.sub.9 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.7 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.9 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s--, or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.3CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.7 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.54 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.55 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23--, --OR.sup.23 and --S(O).sub.2R.sup.23, In one
embodiment, M.sub.9 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80--, --NR.sup.39
(CR.sup.80R.sup.80).sub.2--; A.sub.7 is --CR.sup.19R.sup.20-- or
--C(O)--, preferably --CH.sub.2-- or --C(O)--; Q.sup.51 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.2; Q.sup.55
is hydrogen, --CN, fluoro, chloro, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, fluoro substituted lower alkoxy,
cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23; and Q.sup.62 is hydrogen,
fluoro, chloro, lower alkyl or fluoro substituted lower alkyl.
[0374] In one embodiment of compounds of Formula IIf, M.sub.9 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.7
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.51 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.55 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.41,
--NR.sup.41R.sup.41, --OR.sup.41 and --S(O).sub.2R.sup.41; and
Q.sup.62 is hydrogen, fluoro, chloro, lower alkyl or fluoro
substituted lower alkyl, wherein R.sup.41 is as defined in Formula
Ig.
[0375] In one embodiment of compounds of Formula IIf, A.sub.7 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.51 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.51, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.55 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.9 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39, --S(O).sub.2NR.sup.39, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; Q.sup.62 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.4, or --SR.sup.44; and Q.sup.64 is hydrogen, lower alkyl,
or fluoro substituted lower alkyl, wherein R.sup.39, R.sup.40,
R.sup.41, R.sup.42 and R.sup.44 are as defined for Formula II.
[0376] In one embodiment of compounds of Formula IIf, A.sub.7 is
--CH.sub.2--; Q.sup.51 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.55 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.9 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; Q.sup.62 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, or
fluoro substituted lower alkoxy; and Q.sup.64 is hydrogen, lower
alkyl, or fluoro substituted lower alkyl.
[0377] In one embodiment, further to any of the embodiments of
Formula IIf above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0378] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIg,
##STR00036##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0379] A.sub.8 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0380] Q.sup.65 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.2,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0381] M.sub.10, Q.sup.61,
Q.sup.72, Q.sup.74 are as defined for Formula II; and [0382]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25,
R.sup.26 are a defined for Formula Ib.
[0383] In one embodiment of compounds of Formula IIg, M.sub.10 is
--(CR.sup.19R.sup.21).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.8 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.61 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.65 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.2 and --S(O).sub.2R.sup.23. Further
to any of the above embodiments, Q.sup.74 is hydrogen, fluoro,
chloro, lower alkyl or fluoro substituted lower alkyl.
[0384] In one embodiment of compounds of Formula IIg, M.sub.10 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.3(CR.sup.80R.sup.80).sub.2--, and A.sub.8 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.10 is
--(CR.sup.19R.sup.20)--NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.8 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH-- or --C(O)--;
Q.sup.61 is optionally substituted lower alkyl, aryl or heteroaryl,
wherein aryl or heteroaryl are optionally substituted with one or
more substituents selected from the group consisting of halogen,
lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.13 and
Q.sup.65 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O)R.sup.23. In one
embodiment, M.sub.10 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.8 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.61 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.2,
--NR.sup.2R.sup.2, --OR.sup.23 and --S(O).sub.2R.sup.23; Q.sup.65
is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23; and Q.sup.74 is hydrogen,
fluoro, chloro, lower alkyl or fluoro substituted lower alkyl.
[0385] In one embodiment of compounds of Formula IIg, M.sub.10 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.8
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.61 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.65 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; and Q.sup.73 is hydrogen,
fluoro, chloro, lower alkyl or fluoro substituted lower alkyl,
wherein R.sup.41 is as defined for Formula Ig.
[0386] In one embodiment of compounds of Formula IIg, A.sub.8 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.61 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.61, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O)R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.65 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.19S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.10 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; Q.sup.74 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44; and Q.sup.72 is hydrogen, lower alkyl,
or fluoro substituted lower alkyl, wherein R.sup.39, R.sup.40,
R.sup.41, R.sup.42 and R.sup.44 are as defined for Formula II.
[0387] In one embodiment of compounds of Formula IIg, A.sub.8 is
--CH.sub.2--; Q.sup.61 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy, Q.sup.65 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.10 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; Q.sup.74 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, or
fluoro substituted lower alkoxy; and Q.sup.72 is hydrogen, lower
alkyl, or fluoro substituted lower alkyl.
[0388] In one embodiment, further to any of the embodiments of
Formula IIg above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0389] In one embodiment of compounds of Formula IIg, M.sub.10 is
--NHCH.sub.2, A.sub.8 is --CH.sub.2--, Q.sup.61 is phenyl
optionally substituted with 1 or 2 substituents selected from the
group consisting of fluoro, chloro, methyl, trifluoromethyl,
methoxy, difluoromethoxy, or trifluoromethoxy, Q.sup.65 is
hydrogen, fluoro, --CN, or 1-methyl-pyrazol-4-yl, Q.sup.72 is lower
alkyl or fluoro substituted lower alkyl, and Q.sup.74 is hydrogen,
fluoro, chloro, lower alkyl, or fluoro substituted lower alkyl. In
one embodiment, M.sub.10 is --NHCH.sub.2--, A.sub.8 is
--CH.sub.2--, Q.sup.61 is 4-fluoro-phenyl, Q.sup.65 is hydrogen,
chloro, --CN, or 1-methyl-pyrazol-4-yl, Q.sup.72 is methyl or ethyl
and Q.sup.74 is hydrogen or chloro.
[0390] In one embodiment, the compound of Formula IIg is selected
from the group consisting of: [0391]
[1-Ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl]-(4-fluo-
ro-benzyl)-amine (P-0165), [0392]
(4-Fluoro-benzyl)-[1-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-py-
razol-3-yl]-amine (P-0169), [0393]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyrazol-3-y-
l]-(4-fluoro-benzyl)-amine (P-0170), [0394]
(4-Fluoro-benzyl-{1-methyl-5-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-
-b]pyridin-3-ylmethyl]-1H-pyrazol-3-yl}-amine (P-0180), [0395]
(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[2-ethyl-5-(4-fluoro-benzylamino-
)-2H-pyrazol-3-yl]-methanone (P-0184), [0396]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-ethyl-1H-pyrazol-3-yl-
]-(4-fluoro-benzyl)-amine (P-0185), [0397]
3-[5-(4-Fluoro-benzylamino)-2-methyl-2H-pyrazol-3-ylmethyl]-1H-pyrrolo[2,-
3-b]pyridine-5-carbonitrile (P-0191), [0398]
(3-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-met-
hyl-1H-pyrazol-3-yl]-amine (P-0410), [0399]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyrazol-3-y-
l]-(2,5-difluoro-benzyl)-amine (P-0411), [0400]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyrazol-3-y-
l]-(2-fluoro-benzyl)-amine (P-0413), and all salts, prodrugs,
tautomers, and isomers thereof.
[0401] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIh,
##STR00037##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0402] A.sub.9 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0403] Q.sup.75 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R, --C(S)R.sup.23, --S(O).sub.2,
--S(O)R.sup.23, --C(O)NHR.sup.23, --C(O)NR.sup.23R.sup.23,
--C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23, --S(O)NHR.sup.23,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.23, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23,
and --NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0404] M.sub.11,
Q.sup.71, and Q.sup.82 are as defined for Formula II; and [0405]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib.
[0406] In one embodiment of compounds of Formula IIh, M.sub.11 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen, in one
embodiment, A.sub.9 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.71 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.75 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23.
[0407] In one embodiment of compounds of Formula IIh, M.sub.11 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.9 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.11 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.9 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.71 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.75 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O)R.sup.23.
[0408] In one embodiment of compounds of Formula IIh, M.sub.11 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.9
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.71 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.75 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41, wherein R.sup.41 is as
defined for Formula Ig.
[0409] In one embodiment of compounds of Formula IIh, A.sub.9 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.71 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.71, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.75 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.11 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR--CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.82 is hydrogen, lower alkyl, or
fluoro substituted lower alkyl, wherein R.sup.39, R.sup.40,
R.sup.41, R.sup.42 and R.sup.44 are as defined for Formula II.
[0410] In one embodiment of compounds of Formula IIh, A.sub.9 is
--CH.sub.2--; Q.sup.71 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.75 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.11 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.46)--; and Q.sup.82 is hydrogen, lower alkyl,
or fluoro substituted lower alkyl.
[0411] In one embodiment, further to any of the embodiments of
Formula IIh above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0412] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIi,
##STR00038##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0413] A.sub.10 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0414] Q.sup.85 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR--, --OR.sup.23,
--SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23, --S(O)R.sup.23,
--S(O)OR.sup.23, --C(O)NHR.sup.23, --C(O)NR.sup.23R.sup.23,
--C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23, --S(O).sub.2NHR.sup.2,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23,
and --NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0415] M.sub.12,
Q.sup.81, and Q.sup.94 are as defined for Formula II; and [0416]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib.
[0417] In one embodiment of compounds of Formula IIi, M.sub.12 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.10 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.81 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.85 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23.
[0418] In one embodiment of compounds of Formula IIi, M.sub.12 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80 or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.10 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.12 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.10 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.81 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.2,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.85 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23.
[0419] In one embodiment of compounds of Formula IIi, M.sub.12 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.10
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.81 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.85 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41, wherein R.sup.41 is as
defined for Formula Ig.
[0420] In one embodiment of compounds of Formula II, A.sub.10 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.81 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.81, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O)R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.85 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.12 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2; and Q.sup.94 is hydrogen, lower alkyl, or
fluoro substituted lower alkyl, wherein R.sup.39, R.sup.40,
R.sup.41, R.sup.42 and R.sup.44 are as defined for Formula II.
[0421] In one embodiment of compounds of Formula IIi, A.sub.10 is
--CH.sub.2--; Q.sup.81 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.85 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.12 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.94 is hydrogen, lower alkyl,
or fluoro substituted lower alkyl.
[0422] In one embodiment, further to any of the embodiments of
Formula IIi above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0423] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIj,
##STR00039##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0424] A.sub.11 is selected from the group consisting of
--CR.sup.19R.sup.20, --C(O)--, --C(S)--, --S(O)--, and --S(O)--;
[0425] Q.sup.95 is selected from the group consisting of hydrogen,
halogen, optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, --OH,
--NH.sub.2, --NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O)R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.2C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O)R.sup.23, --NHC(O)NHR.sup.2,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.2,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0426] M.sub.13, Q.sup.91,
Q.sup.102 and Q.sup.104 are as defined for Formula II; and [0427]
R.sup.19, R.sup.20, R.sup.23, R.sup.24, and R.sup.25 are as defined
for Formula Ib.
[0428] In one embodiment of compounds of Formula IIj, M.sub.13 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.11 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.91 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.33, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.95 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.22,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. Further
to any of the above embodiments, Q.sup.102 and Q.sup.104 are
independently hydrogen, fluoro, chloro, methyl, or --CF.
[0429] In one embodiment of compounds of Formula IIj, M.sub.13 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.11 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment. M.sub.13 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.11 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.91 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.95 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. In one
embodiment, M.sub.13 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.11 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.91 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; Q.sup.95
is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23; and Q.sup.102 and Q.sup.104
are independently hydrogen, fluoro, chloro, methyl, or
--CF.sub.3.
[0430] In one embodiment of compounds of Formula IIj, M.sub.13 is
--NR.sup.19CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.11
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.91 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.95 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; and Q.sup.102 and Q.sup.104
are independently hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl, preferably Q.sup.102 and Q.sup.104 are
independently hydrogen, fluoro, chloro, methyl, or --CF.sub.3,
wherein R.sup.41 is as defined for Formula Ig.
[0431] In one embodiment of compounds of Formula IIj, A.sub.11 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.91 is aryl
or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.91, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.95 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.13 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.102 and Q.sup.104 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, --NR.sup.44R.sup.44, --OR.sup.44, or --SR.sup.44,
provided, however, that at least one of Q.sup.102 and Q.sup.104 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl, wherein R.sup.39, R.sup.40, R.sup.41, R.sup.42 and R.sup.44
are as defined for Formula II.
[0432] In one embodiment of compounds of Formula IIj, A.sub.11 is
--CH.sub.2--; Q.sup.91 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.95 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.13 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.102 and Q.sup.104 are
independently hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, or fluoro substituted lower alkoxy,
provided, however, that at least one of Q.sup.102 and Q.sup.104 is
hydrogen, fluoro, chloro, lower alkyl or fluoro substituted lower
alkyl.
[0433] In one embodiment, further to any of the embodiments of
Formula IIj above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0434] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIk,
##STR00040##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0435] A.sub.12 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S(O)--, and
--S(O).sub.2--; [0436] Q.sup.105 is selected from the group
consisting of hydrogen, halogen, optionally substituted lower
alkyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl, optionally
substituted heteroaryl, --OH, --NH.sub.2, --NO.sub.2, --CN,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NR.sup.24R.sup.25, --NHR.sup.23, --OR.sup.23, --SR.sup.23,
--C(O)R.sup.23, --C(S)R.sup.23, --S(O)R.sup.23,
--S(O).sub.23R.sup.23, --C(O)NHR.sup.23, --C(O)NR.sup.23R.sup.23,
--C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23, --S(O).sub.2NHR.sup.23,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NHR.sup.23,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23,
and --NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0437] M.sub.14,
Q.sup.101, and Q.sup.112 are as defined for Formula II; and [0438]
R.sup.19, R.sup.20, R.sup.23, R.sup.24, and R.sup.25 are as defined
for Formula Ib.
[0439] In one embodiment of compounds of Formula IIk, M.sub.14 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.12 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.101
is optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.105 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O)R.sup.23. Further to any
of the above embodiments, Q.sup.112 is hydrogen, fluoro, chloro,
lower alkyl or fluoro substituted lower alkyl.
[0440] In one embodiment of compounds of Formula Ilk, M.sub.14 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.12 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.14 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.36C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.12 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.101 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR and --S(O).sub.2R.sup.23; and Q.sup.105
is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.23, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23. In one embodiment, M.sub.14
is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s--, or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.12 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--, Q.sup.101 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23;
Q.sup.105 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.112 is hydrogen, fluoro, chloro, lower alkyl or fluoro
substituted lower alkyl.
[0441] In one embodiment of compounds of Formula Ilk, M.sub.14 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.12
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.101 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.105 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; and Q.sup.112 is hydrogen,
fluoro, chloro, lower alkyl or fluoro substituted lower alkyl,
wherein R.sup.41 is as defined for Formula Ig.
[0442] In one embodiment of compounds of Formula IIk, A.sub.12 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.101 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.101, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.105 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.14 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.112 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44, wherein R.sup.39, R.sup.40, R.sup.41,
R.sup.42 and R.sup.44 are as defined for Formula II.
[0443] In one embodiment of compounds of Formula IIk, A.sub.12 is
--CH.sub.2--; Q.sup.101 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.105 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.14 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.112 is hydrogen, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy.
[0444] In one embodiment, further to any of the embodiments of
Formula Ilk above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0445] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIm,
##STR00041##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0446] A.sub.13 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0447] Q.sup.115 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23; --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0448] M.sub.15, Q.sup.111,
and Q.sup.124 are as defined for Formula II; and [0449] R.sup.19,
R.sup.20, R.sup.21, R.sup.23--, R.sup.24, and R.sup.25 are as
defined for Formula Ib.
[0450] In one embodiment of compounds of Formula IIm, M.sub.15 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment. A.sub.13 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.111
is optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.115 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23, Further
to any of the above embodiments, Q.sup.124 is hydrogen, fluoro,
chloro, lower alkyl or fluoro substituted lower alkyl.
[0451] In one embodiment of compounds of Formula IIm, M.sub.15 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.13 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.15 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s,
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.16--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.13 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.111 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.115 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O)R.sup.23. In one
embodiment, M.sub.15 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.13 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.111 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23;
Q.sup.115 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.124 is hydrogen, fluoro, chloro, lower alkyl or fluoro
substituted lower alkyl.
[0452] In one embodiment of compounds of Formula IIm, M.sub.15 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.13
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.111 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.115 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.42, --NR.sup.42R.sup.42,
--OR.sup.42 and --S(O).sub.2R.sup.42; and Q.sup.124 is hydrogen,
fluoro, chloro, lower alkyl or fluoro substituted lower alkyl,
wherein R.sup.41 is as defined for Formula Ig.
[0453] In one embodiment of compounds of Formula IIm, A.sub.13 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.111 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.111, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.115 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.15 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.3, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.124 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44, wherein R.sup.39, R.sup.40, R.sup.41,
R.sup.42 and R.sup.44 are as defined for Formula II.
[0454] In one embodiment of compounds of Formula IIm, A.sub.13 is
--CH.sub.2--; Q.sup.111 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy: Q.sup.115 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.15 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.124 is hydrogen, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy.
[0455] In one embodiment, further to any of the embodiments of
Formula IIm above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0456] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIn.
##STR00042##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0457] A.sub.14 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21, and --O--; [0458] Q.sup.125 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR(C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23--C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0459] M.sub.16, Q.sup.121,
and Q.sup.132 are as defined for Formula II; and R.sup.19,
R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are as defined
for Formula Ib.
[0460] In one embodiment of compounds of Formula IIn, M.sub.16 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.3(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is hydrogen
or lower alkyl and R.sup.80 is hydrogen, lower alkyl or fluoro
substituted lower alkyl, preferably hydrogen. In one embodiment,
A.sub.14 is --CR.sup.19R.sup.20-- or --C(O)--, preferably
--CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.121 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.125 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. Further
to any of the above embodiments, Q.sup.132 is hydrogen, fluoro,
chloro, lower alkyl or fluoro substituted lower alkyl.
[0461] In one embodiment of compounds of Formula IIn, M.sub.16 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.14 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.16 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.14 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.121 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.125 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. In one
embodiment, M.sub.16 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.14 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.121 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23;
Q.sup.125 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.132 is hydrogen, fluoro, chloro, lower alkyl or fluoro
substituted lower alkyl.
[0462] In one embodiment of compounds of Formula IIn, M.sub.16 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.14
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.121 is
optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.42,
--NR.sup.42R.sup.42, --OR.sup.42 and --S(O).sub.2R.sup.42;
Q.sup.125 is hydrogen, --CN, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; and Q.sup.132 is hydrogen, fluoro, chloro,
lower alkyl or fluoro substituted lower alkyl, wherein R.sup.41 is
as defined for Formula Ig.
[0463] In one embodiment of compounds of Formula IIn, A.sub.14 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.121 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.121, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.125 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.16 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.132 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44, wherein R.sup.39, R.sup.40, R.sup.41,
R.sup.42 and R.sup.44 are as defined for Formula II.
[0464] In one embodiment of compounds of Formula IIn, A.sub.14 is
--CH.sub.2--; Q.sup.121 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.125 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.16 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.132 is hydrogen, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy.
[0465] In one embodiment, further to any of the embodiments of
Formula IIn above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0466] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIo,
##STR00043##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0467] A.sub.15 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21, and --O--; [0468] Q.sup.135 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --(C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23,
--S(O)R.sup.23--, --S(O).sub.2R.sup.23, --C(O)NHR.sup.23,
--C(O)NR.sup.23R.sup.23, --C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23,
--S(O).sub.2NHR.sup.23, --S(O).sub.2NR.sup.23R.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NH--C(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, and
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0469] M.sub.17, Q.sup.131,
and Q.sup.144 are as defined for Formula II; and [0470] R.sup.19,
R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are as defined
for Formula Ib.
[0471] In one embodiment of compounds of Formula IIo, M.sub.17 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.tNR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.15 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.131
is optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.135 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl. --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. Further
to any of the above embodiment, Q.sup.144 is hydrogen, fluoro,
chloro, lower alkyl, or fluoro substituted lower alkyl.
[0472] In one embodiment of compounds of Formula Ho, M.sub.17 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80--,
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, and A.sub.15 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment. M.sub.17 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80--,
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.15 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.131 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.2,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.135 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. In one
embodiment, M.sub.17 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s--, or
--NR.sup.26C(O)(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80--,
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.15 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.131 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23,
Q.sup.135 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.2,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.144 is hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl.
[0473] In one embodiment of compounds of Formula IIo, M.sub.17 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.15
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.131 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.4, --NR.sup.42R.sup.42, --OR.sup.42 and
--S(O).sub.2R.sup.42; Q.sup.135 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; and Q.sup.144 is hydrogen,
fluoro, chloro, lower alkyl, or fluoro substituted lower alkyl,
wherein R.sup.41 is as defined for Formula Ig.
[0474] In one embodiment of compounds of Formula IIo, A.sub.15 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.131 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.131, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.135 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.15 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.144 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44, wherein R.sup.39, R.sup.40, R.sup.41,
R.sup.42 and R.sup.44 are as defined for Formula II.
[0475] In one embodiment of compounds of Formula IIo, A.sub.15 is
--CH.sub.2--; Q.sup.131 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.135 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy. M.sub.15 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.144 is hydrogen, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy.
[0476] In one embodiment, further to any of the embodiments of
Formula IIo above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0477] In one embodiment, a compound of Formula II has a structure
according to the following sub-generic structure, Formula IIp,
##STR00044##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0478] A.sub.16 is selected from the group consisting of
--CR.sup.19R.sup.20--, --C(O)--, --C(S)--, --S--, --S(O)--,
--S(O).sub.2--, --NR.sup.21--, and --O--; [0479] Q.sup.145 is
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, optionally substituted heteroaryl, --OH, --NH.sub.2,
--NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O)NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23, --OR.sup.23,
--SR.sup.23, --C(O)R.sup.23, --C(S)R.sup.23, --S(O)R.sup.23,
--S(O)R.sup.23, --C(O)NHR.sup.23--, --C(O)NR.sup.23R.sup.23,
--C(S)NHR.sup.23, --C(S)NR.sup.23R.sup.23, --S(O).sub.2NHR.sup.23,
--S(O).sub.2NR.sup.23R.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O)NH.sub.2,
--NR.sup.23--S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23,
and --NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0480] M.sub.18,
Q.sup.141, and Q.sup.152 are as defined for Formula II; and [0481]
R.sup.19, R.sup.20, R.sup.21, R.sup.23, R.sup.24, and R.sup.25 are
as defined for Formula Ib; [0482] provided, however, that the
compound is not or
##STR00045##
[0483] In one embodiment of compounds of Formula IIp, M.sub.18 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--, wherein R.sup.39 is
hydrogen or lower alkyl and R.sup.80 is hydrogen, lower alkyl or
fluoro substituted lower alkyl, preferably hydrogen. In one
embodiment, A.sub.16 is --CR.sup.19R.sup.20-- or --C(O)--,
preferably --CH.sub.2-- or --C(O)--. In one embodiment, Q.sup.141
is optionally substituted lower alkyl, aryl or heteroaryl, wherein
aryl or heteroaryl are optionally substituted with one or more
substituents selected from the group consisting of halogen, lower
alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23 and
Q.sup.145 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23. Further
to any of the above embodiments, Q.sup.152 is hydrogen, fluom,
chloro, lower alkyl, or fluoro substituted lower alkyl.
[0484] In one embodiment of compounds of Formula IIp, M.sup.18 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.19(CR.sup.80R.sup.80).sub.2--, and A.sub.16 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--. In one embodiment, M.sub.18 is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.16, is 13
CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.141 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl. --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.145 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl, heterocycloalkyl
aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.2, --NR.sup.23R.sup.23,
--OR.sup.23 and --S(O).sub.2R.sup.23. In one embodiment, M.sup.18
is
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--
or
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
preferably --NR.sup.26--(CR.sup.19R.sup.20).sub.s-- or
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--, more preferably
--NR.sup.39CR.sup.80R.sup.80-- or
--NR.sup.39(CR.sup.80R.sup.80).sub.2--; A.sub.16 is
--CR.sup.19R.sup.20-- or --C(O)--, preferably --CH.sub.2-- or
--C(O)--; Q.sup.141 is optionally substituted lower alkyl, aryl or
heteroaryl, wherein aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23:
Q.sup.145 is hydrogen, --OR.sup.23, --CN, fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, cycloalkyl,
heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl or heteroaryl are optionally substituted
with one or more substituents selected from the group consisting of
halogen, lower alkyl, fluoro substituted lower alkyl, --NHR.sup.23,
--NR.sup.23R.sup.23, --OR.sup.23 and --S(O).sub.2R.sup.23; and
Q.sup.152 is hydrogen, fluoro, chloro, lower alkyl, or fluoro
substituted lower alkyl.
[0485] In one embodiment of compounds of Formula IIp, M.sub.18 is
--NR.sup.39CH.sub.2-- or --NR.sup.39--(CH.sub.2).sub.2--; A.sub.16
is --CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.141 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; Q.sup.145 is hydrogen, --CN, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, cycloalkyl, heterocycloalkyl, aryl or
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41,
--OR.sup.41 and --S(O).sub.2R.sup.41; and Q.sup.152 is hydrogen,
fluoro, chloro, lower alkyl, or fluoro substituted lower alkyl,
wherein R.sup.41 is as defined for Formula Ig.
[0486] In one embodiment of compounds of Formula IIp, A.sub.16 is
--CH.sub.2-- or --C(O)--, preferably --CH.sub.2--; Q.sup.141 is
aryl or heteroaryl, wherein aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OR.sup.41, --SR.sup.41, --S(O)R.sup.41,
--S(O).sub.2R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as a substituent
of Q.sup.141, or as a substituent of lower alkyl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
Q.sup.145 is hydrogen, --CN, --OR.sup.41, --SR.sup.41,
--S(O)R.sup.41, --S(O).sub.2R.sup.41, --NHR.sup.41,
--NR.sup.41R.sup.41, --NR.sup.19C(O)R.sup.41,
--NR.sup.19S(O).sub.2R.sup.41, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, --NHR.sup.41, --NR.sup.41R.sup.41, and
--OR.sup.41; M.sub.18 is a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--, --CH.sub.2NR.sup.39--,
--CH(R.sup.40)NR.sup.39--, --NR.sup.39C(O)--, or
--NR.sup.39S(O).sub.2--; and Q.sup.152 is hydrogen, fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, --NR.sup.44R.sup.44,
--OR.sup.44, or --SR.sup.44, wherein R.sup.39, R.sup.40, R.sup.41,
R.sup.42 and R.sup.44 are as defined for Formula II.
[0487] In one embodiment of compounds of Formula IIp, A.sub.16 is
--CH.sub.2--; Q.sup.141 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, and fluoro
substituted lower alkoxy; Q.sup.145 is hydrogen, --CN, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy; M.sub.18 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH.sub.2CH.sub.2--, or
--NR.sup.39CH(R.sup.40)--; and Q.sup.152 is hydrogen, fluoro,
chloro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy,
or fluoro substituted lower alkoxy.
[0488] In one embodiment, further to any of the embodiments of
Formula IIp above, each occurrence of R.sup.41 is R.sup.42 as
defined for Formula Ig.
[0489] In one embodiment of compounds of Formula IIp, M.sub.18 is
--NH--CH.sub.2-- or --NH--(CH.sub.2).sub.2--, preferably
--NH--CH.sub.2--; A.sub.16 is --CH.sub.2-- or --C(O)--, preferably
--CH.sub.2--; Q.sup.141 is aryl or heteroaryl, wherein aryl or
heteroaryl are optionally substituted with 1 or 2 substituents
selected from the group consisting of fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, fluoro substituted
lower alkoxy, and heterocycloalkyl; Q.sup.145 is hydrogen. --CN,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl, lower
alkoxy, or fluoro substituted lower alkoxy, preferably hydrogen,
--CN, or chloro; and Q.sup.152 is hydrogen, fluoro, chloro, lower
alkyl, or fluoro substituted lower alkyl, preferably hydrogen or
chloro, more preferably chloro.
[0490] In one embodiment, the compound of Formula Ih is selected
from the group consisting of [0491]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-4-fluoro--
benzyl)-amine (P-0156), [0492]
[4-Ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro--
benzyl)-amine (P-0162). [0493]
(4-Fluoro-benzyl)-[4-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine (P-0163), [0494]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-3-
-ylmethyl-amine (P-0164), [0495]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-2-
-ylmethyl-amine (P-0167). [0496]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-4-
-ylmethyl-amine (P-0168), [0497]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(6-methyl-
-pyridin-2-ylmethyl)-amine (P-0171), [0498]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(1,5-dime-
thyl-1H-pyrazol-3-ylmethyl)-amine (P-0172), [0499]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(6-triflu-
oromethyl-pyridin-3-ylmethyl)-amine (P-0173), [0500]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2,5-dime-
thyl-2H-pyrazol-3-ylmethyl)-amine (P-0175), [0501]
[2-(4-Fluoro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone [0502] (P-0177), [0503]
{2-[(4-Chloro-benzyl)-methyl-amino]-thiazol-5-yl}-(1H-pyrrolo[2,3-b]pyrid-
in-3-yl)-methanone (P-0178), [0504]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
thiazol-2-ylmethyl-amine (P-0189), [0505]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methoxy-pyridin-3-ylmethyl)-amine (P-0190), [0506]
Benzyl-[4-chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-
-2-yl]-amine (P-0192), [0507]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-methoxy-benzyl)-amine (P-0193), [0508]
(4-Chloro-benzyl)-[4-chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-thiazol-2-yl]-amine (P-0194), [0509]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(4-fluoro-benzyl)-amine (P-0195), [0510]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2,4-dimethyl-thiazol-5-ylmethyl)-amine (P-0196), [0511]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-ethyl-5-methyl-3H-imidazol-4-ylmethyl)-amine (P-0197), [0512]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-ethyl-2H-pyrazol-3-ylmethyl)-amine (P-0198), [0513]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methoxy-pyridin-2-ylmethyl)-amine (P-0199), [0514]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-fluoro-pyridin-4-ylmethyl)-amine (P-0200), [0515]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-methyl-thiazol-4-ylmethyl)-amine (P-0201),
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(4-methyl-thiazol-5-ylmethyl)-amine (P-4202), [0516]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-chloro-pyridin-2-ylmethyl)-amine (P-0203), [0517]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2q4-dime-
thyl-thiazol-5-ylmethyl)-amine (P-0204), [0518]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2-ethyl--
5-methyl-3H-imidazol-4-ylmethyl)-amine (P-0205), [0519]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(5-fluoro-
-pyridin-2-ylmethyl)-amine (P-0206), [0520]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(5-methox-
y-pyridin-3-ylmethyl)-amine (P-0207), [0521]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4,5-dime-
thyl-thiophen-2-ylmethyl)-amine (P-0208), [0522]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2,5-dime-
thyl-thiophen-3-ylmethyl)-amine (P-0209), [0523]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-fluoro-pyridin-3-ylmethyl)-amine (P-0231), [0524]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
pyridin-3-ylmethyl-amine (P-0236), [0525]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-thiazol-2-yl]-p-
yridin-4-ylmethyl-amine (P-0237), [0526]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-chloro-pyridin-4-ylmethyl)-amine (P-0238). [0527]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(1-ethyl-1H-pyrazol-4-ylmethyl)-amine (P-0239), [0528]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-fluoro-pyridin-2-ylmethyl)-amine (P-4240), [0529]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-methoxy-pyridin-3-ylmethyl)-amine (P-0241), [0530]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0242), [0531]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-chloro-6-fluoro-benzyl)-amine (P-0243), [0532]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
phenethyl-amine (P-0244), [0533]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2,4-difluoro-benzyl)-amine (P-0245), [0534]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-fluoro-benzyl)-amine (P-0246), [0535]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-methoxy-pyridin-3-ylmethyl)-amine (P-0247), [0536]
(2-Chloro-benzyl)-[4-chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-thiazol-2-yl]-amine (P-0248), [0537]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-methyl-benzyl)-amine (P-0249), [0538]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-chloro-4-fluoro-benzyl)-amine (P-0250), [0539]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-fluoro-pyridin-2-ylmethyl)-amine (P-0251), [0540]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-morpholin-4-yl-pyridin-2-ylmethyl)-amine (P-0252), [0541]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3,5-dichloro-pyridin-4-ylmethyl)-amine (P-0253), [0542]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-trifluoromethyl-benzyl)-amine (P-0254), [0543]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methyl-pyridin-2-ylmethyl)-amine (P-0255), [0544]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-
-benzyl)-amine (P-0290), and all salts, prodrugs, tautomers, and
isomers thereof.
[0545] In one embodiment, a compound of Formula I has a structure
according to the following sub-generic structure, Formula III,
##STR00046##
all salts, prodrugs, tautomers, and isomers thereof, wherein;
[0546] L.sub.4 is --CH.sub.2--, --CH.sub.2CH.sub.2--,
--CH(R.sup.40)--, --C(O)--, or --C(O)NH--; [0547] R.sup.81 is
selected from the group consisting of hydrogen, --OR.sup.41, --CN,
fluoro, chloro, lower alkyl, fluoro substituted lower alkyl,
cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
--NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; [0548] R.sup.82 is selected from the group
consisting of hydrogen. C.sub.1-3 alkyl, fluoro substituted
C.sub.2-3alkyl, OH, C.sub.1-3 alkoxy, and fluoro substituted
C.sub.1-3 alkoxy; [0549] R.sup.83 is heterocycloalkyl, heteroaryl,
or
##STR00047##
[0549] in which
##STR00048##
indicates the attachment point of R.sup.83 to L.sub.4 of Formula
III, wherein heterocycloalkyl or heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, lower alkyl, fluoro substituted lower alkyl,
cycloalkylamino, --NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41 and
--S(O).sub.2R.sup.41; [0550] R.sup.92, R.sup.93, R.sup.94,
R.sup.95, and R.sup.96 are independently selected from the group
consisting of hydrogen, halogen, lower alkyl, fluoro substituted
lower alkyl, cycloalkylamino, --NHS(O).sub.2R.sup.41,
--NHC(O)R.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41, --OR.sup.41
and --S(O).sub.2R.sup.41; and [0551] R.sup.40 and R.sup.41 are as
defined for Formula Ig; [0552] provided, however, that the compound
is not
##STR00049## ##STR00050## ##STR00051## ##STR00052##
##STR00053##
[0553] In one embodiment of compounds of Formula III, L.sub.4 is
--CH.sub.2--, --CH.sub.2CH.sub.2--, --CH(CH.sub.3)-- or --C(O)--,
R.sup.81 is hydrogen, fluoro, chloro, --CN, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, or fluoro substituted lower
alkoxy, R.sup.82 is hydrogen, R.sup.83 is
##STR00054##
wherein R.sup.92, R.sup.93, R.sup.94, R.sup.95, and R.sup.96 are
independently hydrogen, fluoro, chloro, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, or fluoro substituted lower
alkoxy, provided, however, that when R.sup.94 is fluoro, chloro,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, or
fluoro substituted lower alkoxy, at least one of R.sup.92,
R.sup.93, R.sup.95, and R.sup.96 is fluoro, chloro, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, or fluoro substituted
lower alkoxy.
[0554] In one embodiment of compounds of Formula III, L.sub.4 is
--CH.sub.2--, --CH.sub.2CH.sub.2--, --CH(CH.sub.3)-- or --C(O)--,
R.sup.81 is hydrogen, fluoro, chloro, --CN, methyl, or methoxy,
preferably hydrogen, chloro, --CN, or methyl, R.sup.82 is hydrogen,
R.sup.83 is
##STR00055##
wherein R.sup.92, R.sup.93, R.sup.94, R.sup.95, and R.sup.96 are
independently hydrogen, fluoro, chloro, methyl, ethyl,
trifluoromethyl, methoxy, ethoxy, difluoromethoxy or
trifluoromethoxy, preferably hydrogen, chloro, methyl,
trifluoromethyl, methoxy, ethoxy, or trifluoromethoxy, provided,
however, that when R.sup.94 is fluoro, chloro, methyl, ethyl,
trifluoromethyl, methoxy, ethoxy, difluoromethoxy or
trifluoromethoxy, at least one of R.sup.92, R.sup.93, R.sup.95, and
R.sup.96 is fluoro, chloro, methyl, ethyl, trifluoromethyl,
methoxy, ethoxy, difluoromethoxy or trifluoromethoxy.
[0555] In one embodiment of compounds of Formula III, L.sub.4 is
--CH.sub.2--, R.sup.81 is fluoro, chloro, --CN, methyl, or methoxy,
preferably chloro, --CN, or methyl, R.sup.82 is hydrogen, R.sup.83
is
##STR00056##
wherein R.sup.94 is hydrogen and R.sup.92, R.sup.93, R.sup.95, and
R.sup.96 are independently hydrogen, fluoro, chloro, methyl,
trifluoromethyl, methoxy, ethoxy, difluoromethoxy or
trifluoromethoxy.
[0556] In one embodiment of compounds of Formula III, L.sub.4 is
--CH.sub.2--, --CH.sub.2CH.sub.2--, --C(O)--, or --CH(CH.sub.3)--,
preferably --CH.sub.2-- or --C(O)--, R.sup.81 is hydrogen, fluoro,
R.sup.82 is hydrogen, R.sup.83 is
##STR00057##
wherein R.sup.92 is fluoro, chloro, methyl, ethyl, trifluoromethyl,
methoxy, ethoxy, difluoromethoxy, or trifluoromethoxy, preferably
fluoro, chloro, methyl, or trifluoromethyl, and R.sup.93, R.sup.94,
R.sup.95, and R.sup.96 are independently hydrogen, fluoro, chloro,
methyl, trifluoromethyl, methoxy, difluoromethoxy, or
trifluoromethoxy, preferably hydrogen or fluoro. In one embodiment,
L.sub.4 is --CH.sub.2--, --C(O)--, or --CH(CH.sub.3)--, R.sup.81 is
hydrogen, R.sup.82 is hydrogen, R.sup.92 is fluoro, chloro, methyl,
ethyl, trifluoromethyl, methoxy, ethoxy, difluoromethoxy, or
trifluoromethoxy, preferably fluoro, methyl, or trifluoromethyl,
and R.sup.93, R.sup.94, R.sup.95, and R.sup.96 are hydrogen. In one
embodiment, L.sub.4 is --CH.sub.2--, --C(O)--, or --CH(CH.sub.3)--,
R.sup.81 is hydrogen, R.sup.82 is hydrogen, R.sup.92 is fluoro,
chloro, methyl, ethyl, trifluoromethyl, methoxy, ethoxy,
difluoromethoxy, or trifluoromethoxy, preferably fluoro, methyl, or
trifluoromethyl, R.sup.94, R.sup.95, and R.sup.96 are hydrogen, and
R.sup.93 is fluoro, chloro, methyl, ethyl, trifluoromethyl,
methoxy, ethoxy, difluoromethoxy, or trifluoromethoxy, preferably
fluoro, chloro, trifluoromethyl or methoxy, more preferably fluoro.
In one embodiment, L.sub.4 is --CH.sub.2--, --C(O)--, or
--CH(CH.sub.3)--, R.sup.81 is hydrogen, R.sup.52 is hydrogen,
R.sup.92 is fluoro, chloro, methyl, ethyl, trifluoromethyl,
methoxy, ethoxy, difluoromethoxy, or trifluoromethoxy, preferably
fluoro, methyl, or trifluoromethyl, R.sup.93, R.sup.95, and
R.sup.96 are hydrogen, and R.sup.94 is fluoro, chloro, methyl,
ethyl, trifluoromethyl, methoxy, ethoxy, difluoromethoxy, or
trifluoromethoxy, preferably fluoro, chloro, methyl or
trifluoromethyl, more preferably fluoro. In one embodiment, L.sub.4
is --CH.sub.2CH.sub.2-- or --C(O)--, R.sup.81 is hydrogen, R.sup.82
is hydrogen, R.sup.92, R.sup.95, and R.sup.96 are hydrogen,
R.sup.93 is hydrogen, fluoro, chloro, methyl, ethyl,
trifluoromethyl, methoxy, ethoxy, difluoromethoxy, or
trifluoromethoxy, preferably hydrogen, fluoro, chloro, methyl,
trifluoromethyl, methoxy, or trifluoromethoxy, more preferably
fluoro, chloro, trifluoromethyl or methoxy, and R.sup.94 is
hydrogen, fluoro, or chloro, provided, however, that when L.sub.4
is --C(O)-- and R.sup.94 is fluoro or chloro, R.sup.93 is not
hydrogen. In one embodiment, L.sub.4 is --CH.sub.2CH.sub.2--,
R.sup.81 is hydrogen, R.sup.82 is hydrogen, R.sup.92, R.sup.94,
R.sup.95, and R.sup.96 are hydrogen, and R.sup.93 is hydrogen,
fluoro, chloro, methyl, ethyl, trifluoromethyl, methoxy, ethoxy,
difluoromethoxy, or trifluoromethoxy, preferably hydrogen or
fluoro. In one embodiment, L.sub.4 is --C(O)--, R.sup.81 is
hydrogen, R.sup.82 is hydrogen, R.sup.92, R.sup.95, and R.sup.96
are hydrogen, R.sup.93 is fluoro, chloro, methyl, ethyl
trifluoromethyl, methoxy, ethoxy, difluoromethoxy, or
trifluoromethoxy, preferably fluoro, chloro, trifluoromethyl or
methoxy, and R.sup.94 is hydrogen, fluoro, or chloro.
[0557] In one embodiment of compounds of Formula III, R.sup.83 is
pyrrolidine, morpholine, pyridine, pyrimidine, pyrazine, pyrazole,
isoxazole, imidazol, or benzimidazole, wherein R.sup.83 is
optionally substituted with one or more substituents independently
selected from the group consisting of halogen, lower alkyl, fluoro
substituted lower alkyl, cycloalkylamino, --NHR.sup.41,
--NR.sup.41R.sup.41, --OR.sup.41 and --S(O).sub.2R.sup.41,
preferably wherein R.sup.83 is optionally substituted with 1 or 2
substituents independently selected from fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, or cycloalkylamino, more preferably
fluoro, chloro, methyl, trifluoromethyl, methoxy or morpholine.
[0558] In one embodiment of compounds of Formula III, L.sub.4 is
--CH.sub.2--, --CH.sub.2CH.sub.2--, --CH(CH.sub.3)-- or --C(O)--,
preferably --CH.sub.2--, --CH.sub.2CH.sub.2--, or --C(O)--,
R.sup.81 is hydrogen, fluoro, chloro, --CN, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, or fluoro substituted lower
alkoxy, preferably hydrogen, chloro, methyl or --CN, R.sup.82 is
hydrogen, and R.sup.83 is pyrrolidine, morpholine, pyridin,
pyrimidine, pyrazine, pyrazole, isoxazole, imidazole, or
benzimidazole, wherein R.sup.83 is optionally substituted with 1 or
2 substituents independently selected from fluoro, chloro, lower
alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, or cycloalkylamino, preferably fluoro,
chloro, methyl, trifluoromethyl, methoxy or morpholine.
[0559] In one embodiment of compounds of Formula III, the compound
is selected from the group consisting of: [0560]
Pyridin-3-ylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-4094). [0561]
(5-Methyl-isoxazol-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0095), [0562]
(2-Pyrrolidin-1-yl-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0096). [0563]
[1-(4-Methanesulfonyl-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyridin-2-yl]-amine (P-0097). [0564]
(2-Morpholin-4-yl-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-
-2-yl]-amine (P-0099), [0565]
3,4-Dichloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-yl
methyl)-pyridin-2-yl]-benzamide (P-0100), [0566]
2-Chloro-4-fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0101). [0567] 2,5-Dimethyl-2H-pyrazole-3-carboxylic
acid [5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0102), [0568] Thiophene-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0103), [0569]
2-Methoxy-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-isonicotinamide (P-0104). [0570]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-isonicotinamide
(P-0105), [0571] Pyrazine-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0106), [0572] Pyridine-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0107). [0573]
6-Methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
nicotinamide (P-0108), [0574]
4-Fluoro-3-methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0109), [0575] 5-Methyl-pyrazine-2-carboxylic acid
[5-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0110), [0576]
3-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
benzamide (P-0111), [0577]
4-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-3-trifl-
uoromethyl-benzamide (P-0112), [0578]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-3-trifluorometho-
xy-benzamide (P-0113), [0579]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-3-trifluoromethy-
l-benzamide (P-0114), [0580]
3-Chloro-4-fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0115), [0581]
3,4-Difluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-ben-
zamide (P-0116). [0582]
2-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0117), [0583]
5-Fluoro-2-methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0118), [0584]
2-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0119), [0585]
3-Methoxy-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzam-
ide (P-0120), [0586]
3-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0121), [0587]
3-Methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0122), [0588]
2-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-isonico-
tinamide (P-0123), [0589]
((R)-1-Phenyl-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-y-
l]-amine (P-0125), [0590]
(3-Morpholin-4-yl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0126), [0591]
[1-(2-Fluoro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0127), [0592]
[2-(3-Fluoro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0128), [0593]
(3-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0129), [0594]
(1-Methyl-1H-imidazol-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
)-pyridin-2-yl]-amine (P-0130). [0595]
(1,5-Dimethyl-1H-pyrazol-2,3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0131), [0596]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-triflu-
oromethyl-pyridin-3-ylmethyl)-amine (P-0181), [0597]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-trifluoromethyl-
-pyridin-3-ylmethyl)-amine (P-0182), [0598]
(3-Chloro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0183), [0599]
(2-Chloro-6-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0210). [0600]
Phenethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0211), [0601]
(2,4-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0212), [0602]
(2-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0213), [0603] (3-Bromo-pyridin-4
ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0214), [0604]
(2-Methoxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0215). [0605]
(2-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0216), [0606]
(2-Methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0217), [0607]
(1-Methyl-1H-benzoimidazol-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0218), [0608]
(6-Methoxy-pyridin-3-ylmethyl)-[5-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0219), [0609]
(1H-Benzoimidazol-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0220), [0610]
(2-Chloro-4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0221), [0611]
(5-Methoxy-pyridin-3-ylmethyl))-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-4222), [0612]
(3-Fluoro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0223), [0613]
(6-Methoxy-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0224), [0614]
(4-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0225), [0615]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-trifluoromethyl-
-benzyl)-amine (P-0226), [0616]
(3,5-Dichloro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
)-pyridin-2-yl]-amine (P-0227), [0617]
(6-Morpholin-4-yl-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine (P-0228), [0618]
(3-Fluoro-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0229), [0619]
(5-Fluoro-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0230), [0620]
(3-Chloro-pyridin-4-ylmethyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0235), [0621]
3-{6-[(3-Chloro-pyridin-4-ylmethyl)-amino]-pyridin-3-ylmethyl}-1H-pyrrolo-
[2,3-b]pyridine 5-carbonitrile (P-0256), [0622]
3-[6-(4-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0257), [0623] Propane-1-sulfonic acid
(2,4-difluoro-3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylami-
no]-methyl}-phenyl)-amide (P-0258), [0624] Propane-1-sulfonic acid
(3-{[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]--
methyl}-2,4-difluoro-phenyl)-amide (P-0259), [0625]
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0269), [0626]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-fluoro-
-benzyl)-amine (P-0270), [0627]
3-[6-(2-Fluoro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0271), [0628]
(2-Fluoro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0272), [0629]
3-{6-[(6-Trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1-
H-pyrrolo[2,3-b]pyridine-5-carbonitrile (P-0273), [0630]
3-[6-(2-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0274), [0631]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-triflu-
oromethyl-benzyl)-amine (P-0275), [0632]
[5-(5-Methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-triflu-
oromethyl-benzyl)-amine (P-0276), [0633]
3-[6-(2,6-Difluoro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyri-
dine-5-carbonitrile (P-0277), [0634]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2,6-difl-
uoro-benzyl)-amine (P-0278), [0635]
(2-Chloro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0279), [0636]
(2-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0280), [0637]
3-[6-(2-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-S-carbonitrile (P-0281), [0638]
(6-Methoxy-pyridin-3-ylmethyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
methyl)-pyridin-2-yl]-amine (P-0282), [0639]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-methox-
y-pyridin-3-ylmethyl)-amine (P-0283), [0640]
3-{6-[(6-Methoxy-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1H-pyrrol-
o[2,3-b]pyridine-5-carbonitrile (P-0284), [0641]
(2-Methoxy-pyridin-3-ylmethyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
methyl)-pyridin-2-yl]-amine (P-0285), [0642]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-methox-
y-pyridin-3-ylmethyl)-amine (P-0286), [0643]
3-{6-[(2-Methoxy-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1H-pyrrol-
o[2,3-b]pyridine-5-carbonitrile (P-0287), [0644]
(2-Ethoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0288). [0645]
(2,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0296), [0646]
(2,5-Difluoro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0297), [0647]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2,5-difl-
uoro-benzyl)-amine (P-0298), [0648]
3-[6-(2,5-Difluoro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyri-
dine-5-carbonitrile (P-0299), [0649]
3-[6-(2-Trifluoromethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3--
b]pyridine-5-carbonitrile (P-0321), [0650]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-trifluoromethox-
y-benzyl)-amine (P-0322), [0651]
3-[6-(2-Ethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0323), [0652]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(5-fluoro-
-pyridin-3-ylmethyl)-amine (P-0324), [0653]
[5-(5-Fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-triflu-
oroethyl-benzyl)-amine (P-0325), [0654]
[5-(5-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-trifl-
uoromethyl-benzyl)-amine (P-0326), [0655]
(2-Chloro-benzyl)-[5-(5-fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0327), [0656]
(2-Chlor-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0328), [0657]
(2,5-Difluoro-benzyl)-[5-(5-fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0329), [0658]
(2,5-Difluoro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0330), [0659]
[5-(5-Fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-methox-
y-pyridin-3-ylmethyl)-amine (P-0331), [0660]
(6-Methoxy-pyridin-3-ylmethyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-y-
lmethyl)-pyridin-2-yl]-amine (P-0332), [0661]
(2,6-Difluoro-benzyl)-[5-(5-fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0333), [0662]
(2,6-Difluoro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0334), [0663]
(2-Methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0336), [0664] 3-[6-(2-M
ethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-5-carbo-
nitrile (P-0337), [0665]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-difluo-
romethoxy-benzyl)-amine (P-0338), [0666]
3-[6-(2-Difluoromethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0339), [0667]
(2,6-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0340), [0668]
(2,6-Difluoro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0341), [0669]
(2,4-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0342), [0670]
(3-Fluoro-benzyl)[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-a-
mine (P-0343), [0671]
(2-Fluoro-4-Trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0344), [0672]
(4-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0345), [0673]
(3-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0346), [0674]
(2-Morpholin-4-yl-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine (P-0347), [0675]
(4-Chloro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0348), [0676]
(2-Chloro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0349), [0677]
(2-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0350), [0678]
(2,3-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0351), [0679]
(2-Fluoro-3-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0352), [0680]
Dimethyl-(5-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]--
methyl}-pyrimidin-2-yl)-amine (P-0353), [0681] (3-Chloro
2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-a-
mine (P-0354), [0682]
(5-Fluoro-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0355), [0683]
(3,5-Difluoro-benzyl)-[5-(1H=pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0356), [0684]
(2-Propoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0357), [0685]
(2-Morpholin-4-yl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0358), [0686]
(2-Chloro-3-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0359), [0687]
(2-Fluoro-6-trifluoromethyl-benzyl)-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl)-amine (P-0360). [0688]
[2-(2-Morpholin-4-yl-ethoxy)-benzyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyridin-2-yl]-amine (P-0361), [0689]
(2,3-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0362), [0690]
(2-Chloro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0363), [0691]
(2-Chloro-5-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0364). [0692]
(2-Fluoro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0365), [0693]
(5-Fluoro-2-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0366). [0694]
(2-Difluoromethoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0367), [0695]
(2-Fluoro-4-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-anine (P-4368), [0696]
[2-(3-Dimethoxylamino-propoxy)-benzyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0369), [0697]
(2,6-Dimethoxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyridin-2-yl]-amine (P-0370).
[0698]
(2-Fluoro-5-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyridin-2-yl]-amine (P-0371), [0699]
(4-Fluoro-2-methyl-benzyl)-[5-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P4372), [0700]
(3-Chloro-5-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0373), [0701]
(6-Cyclopentyloxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine (P-0374), [0702]
(5-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0375). [0703]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-[2-(2,2,2-trifluor-
o-ethoxy)-pyridin-3-ylmethyl]-amine (P-0376), [0704]
Propane-1-sulfonic acid
(2-fluoro-3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylam-
ino]-methyl}-phenyl)-amide (P-0377), [0705]
(2,5-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0380), [0706]
Pyrimidin-5-ylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-y-
l]-amine (P-0381). [0707]
(5-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0382), [0708]
(2-Ethyl-benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-am-
ine (P-0383), [0709]
2,2-Dimethyl-N-(3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yla-
mino]-methyl}-pyridin-2-yl)-propionamide (P-0384), [0710]
Methyl-(3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]-me-
thyl}-pyridin-2-yl)-amine (P-0385). [0711]
Methyl-(5-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]-me-
thyl}-pyrimidin-2-yl)-amine (P-0386), [0712]
(2-Chloro-4-methanesulfonyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0387), [0713]
{5-[1-(1H-Pyrrolo[2,3-b]pyridin-3-yl}-ethyl]-pyridin-2-yl)-(4-trifluorome-
thyl-benzyl)-amine (P-0388), [0714]
(5-Fluoro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0397), [0715]
Dimethyl-(3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]--
methyl}-pyridin-2-yl)-amine (P-0399), [0716]
(5-Chloro-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0400), [0717]
(2-Methoxy-pyrimidin-5-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl]-amine (P-0401), [0718]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-[6-(2,2,2-
-trifluoro-ethoxy)-pyridin-3-ylmethyl]-amine (P-0409), [0719]
1-(3-Fluoro-phenyl)-3-[5-(1H-pyrrolo[2-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-urea (P-0412), and all salts, prodrugs, tautomers, and isomers
thereof. [0720] In one embodiment, a compound of the invention is:
[0721]
(4-Chloro-benzyl)-[6-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridazin-3-yl-
]-amine (P-0092), [0722]
(4-Morpholin-4-ylmethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0093), [0723] (2-M
ethoxy-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-pyridin-2-yl]-amine
(P-0098), [0724]
[4-Chloro-1-ethyl-5-(1-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl]-
-[1-(4-fluoro-phenyl)-meth-(E)-ylidene]-amine (P-0166), [0725]
((2,2-Difluoro-benzo[1,3]dioxol-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin--
3-ylmethyl)-pyridin-2-yl]-amine (P-0398); or all salts, prodrugs,
tautomers, and isomers thereof.
[0726] In certain embodiments of the above compounds, compounds are
excluded where N (except where N is a heteroaryl ring atom), O, or
S is bound to a carbon that is also bound to N (except where N is a
heteroaryl ring atom), O, or S, except where the carbon forms a
double bond with one of the heteroatoms, such as in an amide,
carboxylic acid, and the like; or where N (except where N is a
heteroaryl ring atom), O, C(S), C(O), or S(O).sub.n (n is 0-2) is
bound to an alkene carbon of an alkenyl group or bound to an alkyne
carbon of an alkynyl group; accordingly, in certain embodiments
compounds which include linkages such as the following are excluded
from the present invention: --NR--CH.sub.2--NR--,
--O--CH.sub.2--NR--, --S--CH.sub.2--NR--, --NR--CH.sub.2--O--,
--O--CH.sub.2--O--, --S--CH.sub.2--O--, --NR--CH.sub.2--S--,
--O--CH.sub.2--S--, --S--CH.sub.2--S--, --NR--CH.dbd.CH--,
--CH.dbd.CH--NR--, --NR--C.ident.C--, --C.ident.C--NR--,
--O--CH.dbd.CH--, --CH.dbd.CH--O--, --O--C.ident.C--,
--C.ident.C--O--, --S(O).sub.0-2--CH.dbd.CH--,
--CH.dbd.CH--S(O).sub.0-2, --S(O).sub.0-2--C.ident.C--,
--C.ident.C--S(O).sub.0-2--, --C(O)--CH.dbd.CH--,
--CH.dbd.CH--C(O)--, --C.ident.C--C(O)--, or --C(O)--C.ident.C--,
--C(S)--CH.dbd.CH--, --CH.dbd.CH--C(S)--, --C.ident.C--C(S)--, or
--C(S)--C.ident.C--.
[0727] In reference to compounds herein, specification of a
compound or group of compounds includes pharmaceutically acceptable
salts of such compound(s), prodrug(s), and all stereoisomers,
unless clearly indicated to the contrary. In reference to compounds
of Formula II, unless clearly indicated to the contrary, it is
understood that such reference includes compounds of Formulae IIa,
IIb, IIc, IId, IIe, IIf, IIg, IIh, IIi, IIj, IIk, IIm, IIn, and
IIp, and all sub-embodiments thereof.
[0728] In another aspect, the invention provides methods for
treating a c-kit-mediated disease or condition in an animal subject
(e.g. a mammal such as a human, other primates, sports animals,
animals of commercial interest such as cattle, farm animals such as
horses, or pets such as dogs and cats), e.g., a disease or
condition characterized by abnormal c-kit activity (e.g. kinase
activity). Invention methods involve administering to the subject
suffering from or at risk of a c-kit-mediated disease or condition
an effective amount of a compound of Formula II or Formula III, and
all sub-embodiments thereof. In one embodiment, the c-kit mediated
disease is selected from the group consisting of malignancies,
including, but not limited to, mast cell tumors, small cell lung
cancer, testicular cancer, gastrointestinal stromal tumors (GISTs),
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myelocytic leukemia, acute
lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis,
melanoma, and canine mast cell tumors, and inflammatory diseases,
including, but not limited to, asthma, rheumatoid arthritis,
allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome,
transplant rejection, and hypereosinophilia.
[0729] In a related aspect, compounds of Formula II or Formula III,
and all sub-embodiments thereof, can be used in the preparation of
a medicament for the treatment of a c-kit-mediated disease or
condition selected from the group consisting of malignancies,
including, but not limited to, mast cell tumors, small cell lung
cancer, testicular cancer, gastrointestinal stromal tumors (GISTs),
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myelocytic leukemia, acute
lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis,
melanoma, and canine mast cell tumors, and inflammatory diseases,
including, but not limited to, asthma, rheumatoid arthritis,
allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome,
transplant rejection, and hypereosinophilia.
[0730] In a further aspect, the invention provides methods for
treating a c-fms-mediated disease or condition in an animal subject
(e.g. a mammal such as a human, other primates, sports animals,
animals of commercial interest such as cattle, farm animals such as
horses, or pets such as dogs and cats), e.g., a disease or
condition characterized by abnormal c-fms activity (e.g. kinase
activity). Invention methods involve administering to the subject
suffering from or at risk of a c-fms-mediated disease or condition
an effective amount of compound of Formula II or Formula III, and
all sub-embodiments thereof. In one embodiment, the c-fms mediated
disease is selected from the group consisting of immune disorders,
including, but not limited to, rheumatoid arthritis, systemic lupus
erythematosis (SLE), and transplant rejection; inflammatory
diseases including, but not limited to, osteoarthritis,
inflammatory bowel syndrome, ulcerative colitis. Crohn's disease,
chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's
Disease, hemophagocytic syndrome (macrophage activation syndrome),
multicentric reticulohistiocytosis, and atherosclerosis; metabolic
disorders, including, but not limited to, Type I diabetes, Type II
diabetes, insulin resistance, hyperglycemia, obesity, and
lipolysis; disorders of bone structure, mineralization and bone
formation and resorption, including, but not limited to,
osteoporosis, increased risk of fracture, Paget's disease,
hypercalcemia, infection-mediated osteolysis (e.g. osteomyelitis),
peri-prosthetic or wear-debris-mediated osteolysis, and metastasis
of cancer to bone; kidney and genitourinary diseases, including,
but not limited to, endometriosis, nephritis (e.g.
glomerulonephritis, interstitial nephritis, Lupus nephritis),
tubular necrosis, diabetes-associated renal complications (e.g.
diabetic nephropathy), and renal hypertrophy; disorders of the
central nervous system, including, but not limited to, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease;
inflammatory and chronic pain, including, but not limited to, bone
pain; and cancers, including, but not limited to, multiple myeloma,
acute myeloid leukemia (AML), chronic myeloid leukemia (CML),
prostate cancer, breast cancer, ovarian cancer, melanoma,
glioblastoma multiforme, metastasis of tumors to other tissues, and
other chronic myeloproliferative diseases such as
myelofibrosis.
[0731] In a related aspect, compounds of Formula II or Formula III,
and all sub-embodiments thereof, can be used in the preparation of
a medicament for the treatment of a c-fms-mediated disease or
condition selected from the group consisting of immune disorders,
including, but not limited to, rheumatoid arthritis, systemic lupus
erythematosis (SLE), and transplant rejection; inflammatory
diseases including, but not limited to, osteoarthritis,
inflammatory bowel syndrome, ulcerative colitis, Crohn's disease,
chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's
Disease, hemophagocytic syndrome (macrophage activation syndrome),
multicentric reticulohistiocytosis, and atherosclerosis; metabolic
disorders, including, but not limited to, Type I diabetes, Type II
diabetes, insulin resistance, hyperglycemia, obesity, and
lipolysis; disorders of bone structure, mineralization and bone
formation and resorption, including, but not limited to,
osteoporosis, increased risk of fracture, Paget's disease,
hypercalcemia, infection-mediated osteolysis (e.g. osteomyelitis),
peri-prosthetic or wear-debris-mediated osteolysis, and metastasis
of cancer to bone; kidney and genitourinary diseases, including,
but not limited to, endometriosis, nephritis (e.g.
glomerulonephritis, interstitial nephritis, Lupus nephritis),
tubular necrosis, diabetes-associated renal complications (e.g.
diabetic nephropathy), and renal hypertrophy; disorders of the
central nervous system, including, but not limited to, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease;
inflammatory and chronic pain, including, but not limited to, bone
pain; and cancers, including, but not limited to, multiple myeloma,
acute myeloid leukemia (AML), chronic myeloid leukemia (CML),
prostate cancer, breast cancer, ovarian cancer, melanoma,
glioblastoma multiforme, metastasis of tumors to other tissues, and
other chronic myeloproliferative diseases such as
myelofibrosis.
[0732] In a further aspect, the invention provides methods for
treating a c-fms-mediated disease or condition in an animal subject
(e.g. a mammal such as a human, other primates, sports animals,
animals of commercial interest such as cattle, farm animals such as
horses, or pets such as dogs and cats), e.g., a disease or
condition characterized by abnormal c-fms activity (e.g. kinase
activity). Invention methods involve administering to the subject
suffering from or at risk of a c-fms-mediated disease or condition
an effective amount of compound of Formula I, Formula Ia, Formula
Ib, or Formula Ig, and all sub-embodiments thereof. In one
embodiment, the c-fms mediated disease is selected from the group
consisting of osteoarthritis, inflammatory bowel syndrome,
ulcerative colitis, Crohn's disease, Kawasaki's Disease,
hemophagocytic syndrome (macrophage activation syndrome),
multicentric reticulohistiocytosis, Type I diabetes, Type II
diabetes, obesity, Paget's disease, infection-mediated osteolysis
(e.g. osteomyelitis), peri-prosthetic or wear-debris-mediated
osteolysis, endometriosis, diabetic nephropathy, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease,
inflammatory pain, chronic pain, bone pain, prostate cancer,
melanoma, glioblastoma multiforme, and metastasis of tumors to
tissues other than bone, preferably the c-fms mediated disease is
selected from the group consisting of inflammatory bowel syndrome,
ulcerative colitis, Crohn's disease, Type I diabetes, Type II
diabetes, Paget's disease, diabetic nephropathy, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease,
inflammatory pain, chronic pain, bone pain, prostate cancer,
metastasis of tumors to tissues other than bone, and other chronic
myeloproliferative diseases such as myelofibrosis.
[0733] In a related aspect, compounds of Formula I, Formula Ia,
Formula Ib, or Formula Ig, and all sub-embodiments thereof, can be
used in the preparation of a medicament for the treatment of a
c-fms-mediated disease or condition selected from the group
consisting of osteoarthritis, inflammatory bowel syndrome,
ulcerative colitis, Crohn's disease, Kawasaki's Disease,
hemophagocytic syndrome (macrophage activation syndrome),
multicentric reticulohistiocytosis, Type I diabetes, Type II
diabetes, obesity, Paget's disease, infection-mediated osteolysis
(e.g. osteomyelitis), peri-prosthetic or wear-debris-mediated
osteolysis, endometriosis, diabetic nephropathy, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease,
inflammatory pain, chronic pain, bone pain, prostate cancer,
melanoma, glioblastoma multiforme, and metastasis of tumors to
tissues other than bone, preferably the c-fms mediated disease is
selected from the group consisting of inflammatory bowel syndrome,
ulcerative colitis, Crohn's disease, Type I diabetes, Type II
diabetes, Paget's disease, diabetic nephropathy, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease,
inflammatory pain, chronic pain, bone pain, prostate cancer,
metastasis of tumors to tissues other than bone, and other chronic
myeloproliferative diseases such as myelofibrosis.
[0734] In a further aspect, the invention provides methods for
treating, in an animal subject (e.g. a mammal such as a human,
other primates, sports animals, animals of commercial interest such
as cattle, farm animals such as horses, or pets such as dogs and
cats), a disease or condition mediated by c-fms and c-kit, e.g., a
disease or condition characterized by abnormal c-fms activity
and/or c-kit activity (e.g. kinase activity). Invention methods
involve administering to the subject suffering from or at risk of a
disease or condition mediated by c-fms and c-kit an effective
amount of compound of Formula II or Formula III, and all
sub-embodiments thereof. In one embodiment, the condition mediated
by c-fms and c-kit is selected from the group consisting of mast
cell tumors, small cell lung cancer, testicular cancer,
gastrointestinal stromal tumors, glioblastoma, astrocytoma,
neuroblastoma, carcinomas of the female genital tract, sarcomas of
neuroectodermal origin, colorectal carcinoma, carcinoma in situ,
Schwann cell neoplasia associated with neurofibromatosis, acute
myeloid leukemia, acute lymphocytic leukemia, chronic myelogenous
leukemia, multiple myeloma, mastocytosis, melanoma, breast cancer,
ovarian cancer, prostate cancer, canine mast cell tumors,
metastasis of cancer to bone or other tissues, chronic
myeloproliferative diseases such as myelofibrosis, renal
hypertrophy, asthma, rheumatoid arthritis, allergic rhinitis,
multiple sclerosis, osteoarthritis, inflammatory bowel syndrome,
transplant rejection, systemic lupus erythematosis, ulcerative
colitis. Crohn's disease, chronic obstructive pulmonary disease,
emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage
activation syndrome), multicentric reticulohistiocytosis,
atherosclerosis, Type I diabetes, Type II diabetes, insulin
resistance, hyperglycemia, obesity, lipolysis, hypereosinophilia,
osteoporosis, increased risk of fracture, Paget's disease,
hypercalcemia, infection-mediated osteolysis (e.g. osteomyelitis),
peri-prosthetic or wear-debris-mediated osteolysis, endometriosis,
glomerulonephritis, interstitial nephritis, Lupus nephritis,
tubular necrosis, diabetic nephropathy, stroke, Alzheimer's
disease, Parkinson's disease, inflammatory pain, chronic pain, and
bone pain.
[0735] In a related aspect, compounds of Formula II or Formula III,
and all sub-embodiments thereof, can be used in the preparation of
a medicament for the treatment of a c-fms-mediated and/or c-kit
mediated disease or condition selected from the group consisting of
mast cell tumors, small cell lung cancer, testicular cancer,
gastrointestinal stromal tumors, glioblastoma, astrocytoma,
neuroblastoma, carcinomas of the female genital tract, sarcomas of
neuroectodermal origin, colorectal carcinoma, carcinoma in situ,
Schwann cell neoplasia associated with neurofibromatosis, acute
myeloid leukemia, acute lymphocytic leukemia, chronic myelogenous
leukemia, multiple myeloma, mastocytosis, melanoma, breast cancer,
ovarian cancer, prostate cancer, canine mast cell tumors,
metastasis of cancer to bone or other tissues, chronic
myeloproliferative diseases such as myelofibrosis, renal
hypertrophy, asthma, rheumatoid arthritis, allergic rhinitis,
multiple sclerosis, osteoarthritis, inflammatory bowel syndrome,
transplant rejection, systemic lupus erythematosis, ulcerative
colitis, Crohn's disease, chronic obstructive pulmonary disease,
emphysema, Kawasaki's Disease, hemophagocytic syndrome (macrophage
activation syndrome), multicentric reticulohistiocytosis,
atherosclerosis, Type I diabetes, Type II diabetes, insulin
resistance, hyperglycemia, obesity, lipolysis, hypereosinophilia,
osteoporosis, increased risk of fracture, Paget's disease,
hypercalcemia, infection-mediated osteolysis (e.g. osteomyelitis),
peri-prosthetic or wear-debris-mediated osteolysis, endometriosis,
glomerulonephritis, interstitial nephritis, Lupus nephritis,
tubular necrosis, diabetic nephropathy, stroke, Alzheimer's
disease, Parkinson's disease, inflammatory pain, chronic pain, and
bone pain.
[0736] In particular embodiments, the compound has an IC.sub.50 of
less than 100 nM, less than 50 nM, less than 20 nM, less than 10
nM, or less than 5 nM as determined in a generally accepted kinase
activity assay. In certain embodiments, the selectivity of the
compound is such that the compound is at least 2-fold, 5-fold,
10-fold, or 100-fold more active on c-kit than on Ret, PDGF, or
both Ret and PDGF. In certain embodiments, the selectivity of the
compound is such that the compound is at least 2-fold, 5-fold,
10-fold, or 100-fold more active on c-kit than on c-fms. In certain
embodiments, the selectivity of the compound is such that the
compound is at least 2-fold, 5-fold, 10-fold, or 100-fold more
active on c-fms than on c-kit. In certain embodiments, the compound
has in combination each pairing of activity (e.g. IC.sub.50) and/or
selectivity as specified in this paragraph.
[0737] In particular embodiments, the compound has an IC.sub.50 of
less than 100 nM, less than 50 nM, less than 20 nM, less than 10
nM, or less than 5 nM as determined in a generally accepted kinase
activity assay for c-kit, c-fms, or both c-kit and c-fms kinase
activity. In certain embodiments, the selectivity of the compound
is such that the compound is at least 2-fold, 5-fold, 10-fold, or
100-fold more active on c-kit, c-fms, or both c-kit and c-fms than
on Ret, PDGF, or both Ret and PDGF.
[0738] In particular embodiments, the compound has an IC.sub.50 of
less than 100 nM, less than 50 nM, less than 20 nM, less than 10
nM, or less than 5 nM as determined in a generally accepted kinase
activity assay for c-kit, c-fms, or both c-kit and c-fms kinase
activity, and further has an IC.sub.50 of less than 100 nM, less
than 50 nM, less than 20 nM, less than 10 nM, or less than 5 nM as
determined in a generally accepted kinase activity assay for at
least one of HGK, TrkA, or TrkB kinase activity.
[0739] An additional aspect of this invention relates to
compositions that include a therapeutically effective amount of a
compound of Formula II or Formula III and all sub-embodiments
thereof and at least one pharmaceutically acceptable carrier,
excipient, and/or diluent, including combinations of any two or
more compounds of Formula II or Formula III. The composition can
further include one or more different pharmacologically active
compounds, which can include one or more compounds of Formula I
(including Formula Ia, Ib, and Ig, and all sub-embodiments
thereof), Formula II or Formula III.
[0740] In one aspect, the invention provides a method of treating a
cancer by administering to the subject an effective amount of a
composition including a compound of Formula II or Formula III, in
combination with one or more other therapies or medical procedures
effective in treating the cancer. Other therapies or medical
procedures include suitable anticancer therapy (e.g. drug therapy,
vaccine therapy, gene therapy, photodynamic therapy) or medical
procedure (e.g. surgery, radiation treatment, hyperthermia heating,
bone marrow or stem cell transplant). In one aspect, the one or
more suitable anticancer therapies or medical procedures is
selected from treatment with a chemotherapeutic agent (e.g.
chemotherapeutic drug), radiation treatment (e.g. x-ray,
.gamma.-ray, or electron, proton, neutron, or a particle beam),
hyperthermia heating (e.g. microwave, ultrasound, radiofrequency
ablation), Vaccine therapy (e.g. AFP gene hepatocellular carcinoma
vaccine, AFP adenoviral vector vaccine, AG-858, allogeneic
GM-CSF-secretion breast cancer vaccine, dendritic cell peptide
vaccines), gene therapy (e.g. Ad5CMV-p53 vector, adenovector
encoding MDA7, adenovirus 5-tumor necrosis factor alpha),
photodynamic therapy (e.g. aminolevulinic acid, motexafin
lutetium), surgery, and bone marrow and stem cell
transplantation.
[0741] In one aspect, the invention provides a method of treating a
cancer by administering to the subject an effective amount of a
composition including a compound of Formula II or Formula III, in
combination with one or more suitable chemotherapeutic agents. In
one aspect, the one or more suitable chemotherapeutic agents is
selected from an alkylating agent, including, but not limited to,
adozelesin, altretamine, bizelesin, busulfan, carboplatin,
carboquone, carmustine, chlorambucil, cisplatin, cyclophosphamide,
dacarbazine, estramustine, fotemustine, hepsulfam, ifosfamide,
improsulfan, irofulven, lomustine, mechlorethamine, melphalan,
oxaliplatin, piposulfan, semustine, streptozocin, temozolomide,
thiotepa, and treosulfan; an antibiotic, including, but not limited
to, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin,
idarubicin, menogaril, mitomycin, mitoxantrone, neocarzinostatin,
pentostatin, and plicamycin; an antimetabolite, including, but not
limited to, azacitidine, capecitabine, cladribine, clofarabine,
cytarabine, decitabine, floxuridine, fludarabine, 5-fluorouracil,
ftorafur, gemcitabine, hydroxyurea, mercaptopurine, methotrexate,
nelarabine, pemetrexed, raltitrexed, thioguanine, and trimetrexate;
an immunotherapy, including, but not limited to, alemtuzumab,
bevacizumab, cetuximab, galiximab, gemtuzumab, panitumumab,
pertuzumab, rituximab, tositumomab, trastuzumab, and 90 Y
ibritumomab tiuxetan; a hormone or hormone antagonist, including,
but not limited to, anastrozole, androgens, buserelin,
diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelin,
idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen,
and toremifene; a taxane, including, but not limited to, DJ-927,
docetaxel, TPI 287, paclitaxel and DHA-paclitaxel; a retinoid,
including, but not limited to, alitretinoin, bexarotene,
fenretinide, isotretinoin, and tretinoin; an alkaloid, including,
but not limited to, etoposide, homoharringtonine, teniposide,
vinblastine, vincristine, vindesine, and vinorelbine; an
antiangiogenic agent, including, but not limited to, AE-941
(GW786034, Neovastat), ABT-510, 2-methoxyestradiol, lenalidomide,
and thalidomide; a topoisomerase inhibitor, including, but not
limited to, amsacrine, edotecarin, exatecan, irinotecan (also
active metabolite SN-38 (7-ethyl-10-hydroxy-camptothecin)),
rubitecan, topotecan, and 9-aminocamptothecin; a kinase inhibitor,
including, but not limited to, erlotinib, gefitinib, flavopiridol,
imatinib mesylate, lapatinib, sorafenib, sunitinib malate, AEE-788,
AG-013736, AMG 706, AMN 107, BMS-354825, BMS-599626, UCN-01
(7-hydroxystaurosporine), and vatalanib; a targeted signal
transduction inhibitor including, but not limited to bortezomib,
geldanamycin, and rapamycin; a biological response modifier,
including, but not limited to, imiquimod, interferon-.alpha., and
interleukin-2; and other chemotherapeutics, including, but not
limited to 3-AP (3-amino-2-carboxyaldehyde thiosemicarbazone),
aminoglutethimide, asparaginase, bryostatin-1, cilengitide, E7389,
ixabepilone, procarbazine, sulindac, temsirolimus, tipifarnib,
Preferably, the method of treating a cancer involves administering
to the subject an effective amount of a composition of Formula II,
Formula III or Formula IV in combination with a chemotherapeutic
agent selected from 5-fluorouracil, carboplatin, dacarbazine,
gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide,
vinblastine, bevacizumab, cetuximab, or erlotinib.
[0742] In another aspect, the invention provides a method of
treating or prophylaxis of a disease or condition in a mammal, by
administering to the mammal a therapeutically effective amount of a
compound of Formula II or Formula III, a prodrug of such compound,
or a pharmaceutically acceptable salt of such compound or prodrug.
The compound can be alone or can be part of a composition.
[0743] In a related aspect, the invention provides kits that
include a composition as described herein. In particular
embodiments, the composition is packaged, e.g. in a vial, bottle,
flask, which may be further packaged, e.g., within a box, envelope,
or bag; the composition is approved by the U.S. Food and Drug
Administration or similar regulatory agency for administration to a
mammal, e.g., a human; the composition is approved for
administration to a mammal, e.g., a human, for a c-kit- and/or
c-fms-mediated disease or condition; the kit of the invention
includes written instructions on use and/or other indication that
the composition is suitable or approved for administration to a
mammal, e.g., a human, for a c-kit- and/or c-fms-mediated disease
or condition; the composition is packaged in unit dose or single
dose form, e.g., single dose pills, capsules, or the like.
[0744] In another aspect, the present invention also provides a
method for modulating c-kit or c-fms activity by contacting c-kit
or c-fms with an effective amount of a compound of Formula II or
Formula III and all sub-embodiments thereof active on c-kit and/or
c-fms (such as compounds developed using methods described herein).
The compound is preferably provided at a level sufficient to
modulate the activity of the c-kit or c-fms by at least 10%, more
preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or
greater than 90%. In many embodiments, the compound will be at a
concentration of about 1 .mu.M, 100 .mu.M, or 1 mM, or in a range
of 1-100 nM, 100-500 nM, 500-1000 nM, 1-100 .mu.M, 100-500 .mu.M,
or 500-1000 .mu.M. In particular embodiments, the contacting is
carried out in vitro.
[0745] Additional aspects and embodiments will be apparent from the
following Detailed Description and from the claims.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0746] As used herein the following definitions apply:
[0747] "Halo" and "halogen" refer to all halogens, that is, chloro
(Cl), fluoro (F), bromo (Br), or iodo (I).
[0748] "Hydroxyl" and "hydroxy" refer to the group --OH.
[0749] "Thiol" refers to the group --SH.
[0750] "Lower alkyl" alone or in combination means an
alkane-derived radical containing from 1 to 6 carbon atoms (unless
specifically defined) that includes a straight chain alkyl or
branched alkyl. The straight chain or branched alkyl group is
attached at any available point to produce a stable compound. In
many embodiments, a lower alkyl is a straight or branched alkyl
group containing from 1-6, 1-4, or 1-2, carbon atoms, such as
methyl, ethyl, propyl, isopropyl, butyl, t-butyl, and the like.
"Optionally substituted lower alkyl" denotes lower alkyl that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
--F, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.a C(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.e, --R.sup.f, and
--R.sup.g. Further, possible substitutions include subsets of these
substitutions, such as are indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), attached at any available atom
to produce a stable compound. For example "fluoro substituted lower
alkyl" denotes a lower alkyl group substituted with one or more
fluoro atoms, such as perfluoroalkyl, where preferably the lower
alkyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2,
or 3 fluoro atoms. While it is understood that substitutions are
attached at any available atom to produce a stable compound, when
optionally substituted alkyl is an R group of a moiety such as
--OR, --NHR, --C(O)NHR, and the like, substitution of the alkyl R
group is such that substitution of the alkyl carbon bound to any
--O--, --S--, or --N-- of the moiety (except where --N-- is a
heteroaryl ring atom) excludes substituents that would result in
any --O--, --S--, or --N-- of the substituent (except where --N--
is a heteroaryl ring atom) being bound to the alkyl carbon bound to
any --O--, --S--, or --N-- of the moiety.
[0751] "Lower alkylene" refers to a divalent alkane-derived radical
containing 1-6 carbon atoms, straight chain or branched, from which
two hydrogen atoms are taken from the same carbon atom or from
different carbon atoms. Examples of lower alkylene include, but are
not limited to, methylene --CH.sub.2--, ethylene
--CH.sub.2CH.sub.2--, propylene --CH.sub.2CH.sub.2CH.sub.2--,
isopropylene --CH(CH.sub.3)CH--, and the like. "Optionally
substituted lower alkylene" denotes lower alkylene that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
--F, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.a, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a, --NHS(O).sub.2R,
--NR.sup.aS(O).sub.2R.sup.a, --NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a,
--NR.sup.aC(O)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(S)NHR.sup.a,
--NHC(O)NR.sup.aR.sup.a, --NHC(S)NR.sup.aR.sup.a,
--NR.sup.aC(O)NR.sup.aR.sup.a, --NR.sup.aC(S)NR.sup.aR.sup.a,
--NHS(O).sub.2NHR.sup.a, --NR.sup.aS(O).sub.2NH.sub.2,
--NR.sup.aS(O).sub.2NHR.sup.a, --NHS(O).sub.2NR.sup.aR.sup.a,
--NR.sup.aS(O).sub.2NR.sup.aR.sup.a, --NHR.sup.a,
--NR.sup.aR.sup.a, --R.sup.e, --R.sup.f, and --R.sup.g, or two
substituents on any one carbon or a substituent on each of any two
carbons in the alkylene chain may join to form a 3-7 membered
monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl
wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl
are optionally substituted with one or more substituents selected
from the group consisting of halogen, --OH, --NH.sub.2, lower
alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.
[0752] "Lower alkenyl" alone or in combination means a straight or
branched hydrocarbon containing 2-6 carbon atoms (unless
specifically defined) and at least one, preferably 1-3, more
preferably 1-2, most preferably one, carbon to carbon double bond.
Carbon to carbon double bonds may be either contained within a
straight chain or branched portion. Examples of lower alkenyl
groups include ethenyl, propenyl, isopropenyl, butenyl, and the
like. "Substituted lower alkenyl" denotes lower alkenyl that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
--F, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O)NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O)NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.f, --R.sup.f,
and --R.sup.g. Further, possible substitutions include subsets of
these substitutions, such as are indicated herein, for example, in
the description of compounds of Formula I (including Formulae Ia,
Ib, Ig and all sub-embodiments thereof), attached at any available
atom to produce a stable compound. For example "fluoro substituted
lower alkenyl" denotes a lower alkenyl group substituted with one
or more fluoro atoms, where preferably the lower alkenyl is
substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3
fluoro atoms. While it is understood that substitutions are
attached at any available atom to produce a stable compound,
substitution of alkenyl groups are such that --F, --C(O)--,
--C(S)--, --C(NH)--, --S(O)--, --S(O).sub.2--, --O--, --S--, or
--N-- (except where --N-- is a heteroaryl ring atom), are not bound
to an alkene carbon thereof. Further, where alkenyl is a
substituent of another moiety or an R group of a moiety such as
--OR, --NHR, --C(O)R, and the like, substitution of the moiety is
such that any --C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, --O--,
--S--, or --N-- thereof (except where --N-- is a heteroaryl ring
atom) are not bound to an alkene carbon of the alkenyl substituent
or R group. Further, where alkenyl is a substituent of another
moiety or an R group of a moiety such as --OR, --NHR, --C(O)NHR,
and the like, substitution of the alkenyl R group is such that
substitution of the alkenyl carbon bound to any --O--, --S--, or
--N-- of the moiety (except where --N-- is a heteroaryl ring atom)
excludes substituents that would result in any --O--, --S--, or
--N-- of the substituent (except where --N-- is a heteroaryl ring
atom) being bound to the alkenyl carbon bound to any --O--, --S--,
or --N-- of the moiety. An "alkenyl carbon" refers to any carbon
within an alkenyl group, whether saturated or part of the carbon to
carbon double bond. An "alkene carbon" refers to a carbon within an
alkenyl group that is part of a carbon to carbon double bond.
[0753] "Lower alkynyl" alone or in combination means a straight or
branched hydrocarbon containing 2-6 carbon atoms (unless
specifically defined) containing at least one, preferably one,
carbon to carbon triple bond. Examples of alkynyl groups include
ethynyl, propynyl, butynyl, and the like. "Substituted lower
alkynyl" denotes lower alkynyl that is independently substituted,
unless indicated otherwise, with one or more, preferably 1, 2, 3, 4
or 5, also 1, 2, or 3 substituents, attached at any available atom
to produce a stable compound, wherein the substituents are selected
from the group consisting of --F, --OH, --NH.sub.2, --NO.sub.2,
--CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O)NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O).sub.2R.sup.a,
--S(O).sub.2R.sup.a, --C(O)NHR.sup.a, --C(S)NHR.sup.a,
--C(O)NR.sup.aR.sup.a, --C(S)NR.sup.aR.sup.a,
--S(O).sub.2NHR.sup.a, --S(O).sub.2NR.sup.aR.sup.a,
--C(NH)NHR.sup.a, --C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a,
--NHC(S)R.sup.a, --NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.3,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, and
--R.sup.g. Further, possible substitutions include subsets of these
substitutions, such as are indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), attached at any available atom
to produce a stable compound. For example "fluoro substituted lower
alkynyl" denotes a lower alkynyl group substituted with one or more
fluoro atoms, where preferably the lower alkynyl is substituted
with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms.
While it is understood that substitutions are attached at any
available atom to produce a stable compound, substitution of
alkynyl groups are such that --F, --C(O)--, --C(S)--, --C(NH)--,
--S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- (except where
--N-- is a heteroaryl ring atom), are not bound to an alkyne carbon
thereof. Further, where alkynyl is a substituent of another moiety
or an R group of a moiety such as --OR, --NHR, --C(O)R, and the
like, substitution of the moiety is such that any --C(O)--,
--C(S)--, --S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- thereof
(except where --N-- is a heteroaryl ring atom) are not bound to an
alkyne carbon of the alkynyl substituent or R group. Further, where
alkynyl is a substituent of another moiety or an R group of a
moiety such as --OR, --NHR, --C(O)NHR, and the like, substitution
of the alkynyl R group is such that substitution of the alkynyl
carbon bound to any --O--, --S--, or --N-- of the moiety (except
where --N-- is a heteroaryl ring atom) excludes substituents that
would result in any --O--, --S--, or --N-- of the substituent
(except where --N-- is a heteroaryl ring atom) being bound to the
alkynyl carbon bound to any --O--, --S--, or --N-- of the moiety.
An "alkynyl carbon" refers to any carbon within an alkynyl group,
whether saturated or part of the carbon to carbon triple bond. An
"alkyne carbon" refers to a carbon within an alkynyl group that is
part of a carbon to carbon triple bond.
[0754] "Cycloalkyl" refers to saturated or unsaturated,
non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems
of 3-10, also 3-8, more preferably 3-6, ring members per ring, such
as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl, and the like.
"Cycloalkylene" is a divalent cycloalkyl. A "substituted
cycloalkyl" is a cycloalkyl that is independently substituted,
unless indicated otherwise, with one or more, preferably 1, 2, 3, 4
or 5, also 1, 2, or 3 substituents, attached at any available atom
to produce a stable compound, wherein the substituents are selected
from the group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2,
--CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.a, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a--NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f, and
--R.sup.g. "Substituted cycloalkylene" is a divalent substituted
cycloalkyl.
[0755] "Heterocycloalkyl" refers to a saturated or unsaturated
non-aromatic cycloalkyl group having from 5 to 10 atoms in which
from 1 to 3 carbon atoms in the ring are replaced by heteroatoms of
O, S or N, and are optionally fused with benzo or heteroaryl of 5-6
ring members. Heterocycloalkyl is also intended to include oxidized
S or N, such as sulfinyl, sulfonyl and N-oxide of a tertiary ring
nitrogen. Heterocycloalkyl is also intended to include compounds in
which one of the ring carbons is oxo substituted, i.e. the ring
carbon is a carbonyl group, such as lactones and lactams. The point
of attachment of the heterocycloalkyl ring is at a carbon or
nitrogen atom such that a stable ring is retained. Examples of
heterocycloalkyl groups include, but are not limited to,
morpholino, tetrahydrofuranyl, dihydropyridinyl, piperidinyl,
pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl, and
dihydroindolyl. "Heterocycloalkylene" is a divalent
heterocycloalkyl. A "substituted heterocycloalkyl" is a
heterocycloalkyl that is independently substituted, unless
indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5,
also 1, 2, or 3 substituents, attached at any available atom to
produce a stable compound, wherein the substituents are selected
from the group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2,
--CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a. --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.a, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.cC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g. "Substituted heterocycloalkylene" is a divalent
substituted heterocycloalkyl.
[0756] "Aryl" alone or in combination refers to a monocyclic or
bicyclic ring system containing aromatic hydrocarbons such as
phenyl or naphthyl, which may be optionally fused with a cycloalkyl
of preferably 5-7, more preferably 5-6, ring members. "Arylene" is
a divalent aryl. A "substituted aryl" is an aryl that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
halogen, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a.
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.aR.sup.a, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O)NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g. A "substituted arylene" is a divalent substituted
aryl.
[0757] "Heteroaryl" alone or in combination refers to a monocyclic
aromatic ring structure containing 5 or 6 ring atoms, or a bicyclic
aromatic group having 8 to 10 atoms, containing one or more,
preferably 1-4, more preferably 1-3, even more preferably 1-2,
heteroatoms independently selected from the group consisting of O,
S, and N. Heteroaryl is also intended to include oxidized S or N,
such as sulfinyl, sulfonyl and N-oxide of a tertiary ring nitrogen.
A carbon or nitrogen atom is the point of attachment of the
heteroaryl ring structure such that a stable compound is produced.
Examples of heteroaryl groups include, but are not limited to,
pyridinyl, pyridazinyl, pyrazinyl, quinaoxalyl, indolizinyl,
benzo[b]thienyl, quinazolinyl, purinyl, indolyl, quinolinyl,
pyrimidinyl, pyrrolyl oxazolyl, thiazolyl, thienyl, isoxazolyl,
oxathiadiazolyl, isothiazolyl, tetrazolyl, imidazolyl, triazinyl,
furanyl, benzofuryl, and indolyl. "Nitrogen containing heteroaryl"
refers to heteroaryl wherein any heteroatoms are N. "Heteroarylene"
is a divalent heteroaryl. A "substituted heteroaryl" is a
heteroaryl that is independently substituted, unless indicated
otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2,
or 3 substituents, attached at any available atom to produce a
stable compound, wherein the substituents are selected from the
group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
--C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g, "Substituted heteroarylene" is a divalent
substituted heteroaryl.
[0758] The variables R.sup.a, R.sup.b, R.sup.c, --R.sup.d,
--R.sup.e, --R.sup.f and --R.sup.g as used in the description of
optional substituents for alkyl, alkylene, alkenyl, alkynyl,
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are defined as
follows:
each R.sup.a, R.sup.b, and R.sup.c are independently selected from
the group consisting of --R.sup.d, --R.sup.e, --R.sup.f, and
--R.sup.g, or R.sup.b and R.sup.c combine with the nitrogen to
which they are attached to form a 5-7 membered heterocycloalkyl or
a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7
membered heterocycloalkyl or 5 or 7 membered nitrogen containing
heteroaryl are optionally substituted with one or more, preferably
1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the
group consisting of halogen, --NO.sub.2, --CN, --OH, --NH.sub.2,
OR.sup.u, --SR.sup.u, --NHR.sup.u, --NR.sup.uR.sup.u, --R.sup.x,
and --R.sup.y; each --R.sup.d is independently lower alkyl, wherein
lower alkyl is optionally substituted with one or more, preferably
1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the
group consisting of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN,
--C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k,
--OC(O)R.sup.k, --OC(S)R.sup.k, --C(O)R.sup.k, --C(S)R.sup.k,
--C(O)OR.sup.k, --C(S)OR.sup.k, --S(O)R.sup.k, --S(O).sub.2R.sup.k,
--C(O)NHR.sup.k, --C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k,
--C(S)NR.sup.kR.sup.k, --S(O).sub.2NHR.sup.k,
--S(O).sub.2NR.sup.kR.sup.k, --C(NH)NHR.sup.k,
--C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k, --NHC(S)R.sup.k,
--NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.i, and --R.sup.j; each
--R.sup.e is independently lower alkenyl, wherein lower alkenyl is
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2 or 3 substituents selected from the group consisting
of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NH--C(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k, --OC(O)R.sup.k,
--C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k, --C(S)NR.sup.kR.sup.k,
--S(O).sub.2NHR.sup.k, --S(O).sub.2NR.sup.kR.sup.k,
--C(NH)NHR.sup.k, --C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k,
--NHC(S)R.sup.k, --NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.h, and --R.sup.j; each
--R.sup.f is independently lower alkynyl, wherein lower alkynyl is
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2 or 3 substituents selected from the group consisting
of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2. --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k, --OC(O)R.sup.k,
--OC(S)R.sup.k, --C(O)R.sup.k, --C(S)R.sup.k, --C(O)OR.sup.k,
--C(S)OR.sup.k, --S(O)R.sup.k, --S(O).sub.2R.sup.k,
--C(O)NHR.sup.k, --C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k,
--C(S)NR.sup.kR.sup.k, --S(O).sub.2NHR.sup.k,
--S(O).sub.2NR.sup.kR.sup.k, --C(NH)NHR.sup.k,
--C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k, --NHC(S)R.sup.k,
--NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k, --NHS(O)R.sup.k,
--NR.sup.kS(O).sub.2R.sup.k, --NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k,
--NR.sup.kC(O)NH.sub.2, --NR.sup.kC(S)NH.sub.2,
--NR.sup.kC(O)NHR.sup.k, --NR.sup.kC(S)NHR.sup.k,
--NHC(O)NR.sup.kR.sup.k, --NHC(S)NR.sup.kR.sup.k,
--NR.sup.kC(O)NR.sup.kR.sup.k, NR.sup.kC(S)NR.sup.kR.sup.k,
--NHS(O).sub.2NHR.sup.k, --NR.sup.kS(O).sub.2NH.sub.2,
--NR.sup.kS(O).sub.2NHR.sup.k, --NHS(O).sub.2NR.sup.kR.sup.k,
--NR.sup.kS(O).sub.2NR.sup.kR.sup.k, --NHR.sup.k,
--NR.sup.kR.sup.k, --R.sup.h, and --R.sup.j; each --R.sup.g is
independently selected from the group consisting of cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl are optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3
substituents selected from the group consisting of halogen, --OH,
--NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2,
--C(S)NH.sub.2, --S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2,
--NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2,
--OR.sup.k, --SR.sup.k, --OC(O)R.sup.k, --OC(S)R.sup.k,
--C(O)R.sup.k, --C(S)R.sup.k, --C(O)OR.sup.k, --C(S)OR.sup.k,
--S(O)R.sup.k, --S(O).sub.2R.sup.k, --C(O)NHR.sup.k,
--C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k, --C(S)NR.sup.kR.sup.k,
--S(O).sub.2NHR.sup.k, --S(O).sub.2NR.sup.kR.sup.k,
--C(NH)NHR.sup.k, --C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k,
--NHC(S)R.sup.k, --NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.h, --R.sup.i, and
--R.sup.j; [0759] wherein R.sup.k, R.sup.m, and R.sup.n at each
occurrence are independently selected from the group consisting of
--R.sup.h, --R.sup.i, and --R.sup.j, or R.sup.m and R.sup.n combine
with the nitrogen to which they are attached form a 5-7 membered
heterocycloalkyl or a 5 or 7 membered nitrogen containing
heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7
membered nitrogen containing heteroaryl are optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of halogen,
--NO.sub.2, --CN, --OH, --NH.sub.2, OR.sup.u, --SR.sup.u,
--NHR.sup.u, --NR.sup.uR.sup.u, --R.sup.x, and --R.sup.y; [0760]
wherein each --R.sup.h is independently lower alkyl optionally
substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,
2, or 3 substituents selected from the group consisting of fluoro,
--OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.r, --SR.sup.r, --OC(O)R.sup.r,
--OC(S)R.sup.r, --C(O)R.sup.r, --C(S)R.sup.r, --C(O)OR.sup.r,
--C(S)OR.sup.r, --S(O)R.sup.r, --S(O).sub.2R.sup.r,
--C(O)NHR.sup.r, --C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r,
--C(S)NR.sup.rR.sup.r, --S(O).sub.2NHR.sup.r,
--S(O).sub.2NR.sup.rR.sup.r, --C(NH)NHR.sup.r,
--C(NH)NR.sup.sR.sup.t, --NHC(O)R.sup.r, --NHC(S)R.sup.r,
--NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NHS(O).sub.2R.sup.r, --NR.sup.rS(O).sub.2R.sup.r,
--NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r, --NR.sup.rC(O)NH.sub.2,
--NR.sup.rC(S)NH.sub.2, --NR.sup.rC(O)NHR.sup.r,
--NR.sup.rC(S)NHR.sup.r, --NHC(O)NR.sup.rR.sup.r,
--NHC(S)NR.sup.rR.sup.r, --NR.sup.rC(O)NR.sup.rR.sup.r,
--NR.sup.rC(S)NR.sup.rR.sup.r, --NHS(O).sub.2NHR.sup.r,
--NR.sup.rS(O).sub.2NH.sub.2, --NR.sup.rS(O).sub.2NHR.sup.r,
--NHS(O).sub.2NR.sup.rR.sup.r, --NR.sup.rS(O).sub.2NR.sup.rR.sup.r,
--NHR.sup.r, --NR.sup.rR.sup.r, and --R.sup.j; [0761] wherein each
--R.sup.i is independently selected from the group consisting of
lower alkenyl and lower alkynyl, wherein lower alkenyl or lower
alkynyl are optionally substituted with one or more, preferably 1,
2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group
consisting of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH,
--C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.r, --SR.sup.r, --OC(O)R.sup.r,
--OC(S)R.sup.r, --C(O)R.sup.r, --C(S)R.sup.r, --C(O)OR.sup.r,
--C(S)OR.sup.r, --S(O)R.sup.r, --S(O).sub.2R.sup.r,
--C(O)NHR.sup.r, --C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r,
--C(S)NR.sup.rR.sup.r, --S(O).sub.2NHR.sup.r,
--S(O).sub.2NR.sup.rR.sup.r, --C(NH)NHR.sup.r,
--C(NH)NR.sup.sR.sup.t, --NHC(O)R.sup.r, --NHC(S)R, --NR.sup.r
C(O)R.sup.r, --NR.sup.r C(S)R.sup.r, --NHS(O).sub.2R.sup.r,
--NR.sup.rS(O).sub.2R.sup.r, --NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r,
--NR.sup.r C(O)NH.sub.2, --NR.sup.r C(S)NH.sub.2,
--NR.sup.rC(O)NHR.sup.r, --NR.sup.rC(S)NHR.sup.r,
--NHC(O)NR.sup.rR.sup.r, --NHC(S)NR.sup.rR.sup.r,
--NR.sup.rC(O)NR.sup.rR.sup.r, --NR.sup.rC(S)NR.sup.rR.sup.r,
--NHS(O).sub.2NHR.sup.r, --NR.sup.rS(O).sub.2NH.sub.2,
--NR.sup.rS(O).sub.2NHR.sup.r, --NHS(O).sub.2NR.sup.rR.sup.r,
--NR.sup.aS(O).sub.2NR.sup.rR.sup.r, --NHR.sup.r,
--NR.sup.rR.sup.r, and --R.sup.j; [0762] wherein each --R.sup.j is
independently selected from the group consisting of cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl are optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3
substituents selected from the group consisting of halogen, --OH,
--NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2,
--C(S)NH.sub.2, --S(O)NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.r, --SR.sup.r,
--OC(O)R.sup.r, --OC(S)R.sup.r, --C(O)R.sup.r, --C(S)R.sup.r,
--C(O)OR.sup.r, --C(S)OR.sup.r, --S(O)R.sup.r, --S(O).sub.2R.sup.r,
--C(O)NHR.sup.r, --C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r,
--C(S)NR.sup.rR.sup.r, --S(O).sub.2NHR.sup.r,
--S(O).sub.2NR.sup.rR.sup.r, --C(NH)NHR.sup.r,
--C(NH)NR.sup.rR.sup.r, --NHC(O)R.sup.r, --NHC(S)R.sup.r,
--NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r, --NHS(O)R.sup.r,
--NR.sup.rS(O)R.sup.r, --NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r,
--NR.sup.rC(O)NH.sub.2, --NR.sup.rC(S)NH.sub.2,
--NR.sup.rC(O)NHR.sup.r, --NR.sup.rC(S)NHR.sup.r,
--NHC(O)NR.sup.rR.sup.r, --NHC(S)NR.sup.rR.sup.r,
--NR.sup.rC(O)NR.sup.rR.sup.r, --NR.sup.rC(S)NR.sup.rR.sup.r,
--NHS(O).sub.2NHR.sup.r, --NR.sup.rS(O).sub.2NH.sub.2,
--NR.sup.rS(O).sub.2NHR.sup.r, --NHS(O).sub.2NR.sup.rR.sup.r,
--NR.sup.rS(O).sub.2NR.sup.rR.sup.r, --NHR.sup.r,
--NR.sup.rR.sup.r, cycloalkylamino, and --R.sup.x; [0763] wherein
each R.sup.r, R.sup.s, and R.sup.t at each occurrence are
independently selected from the group consisting of lower alkyl,
C.sub.3-6 alkenyl, C.sub.3-6 alkynyl, cycloalkyl, heterocycloalkyl,
aryl and heteroaryl, wherein lower alkyl is optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of --R.sup.y,
fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino, provided that
any substitution of the lower alkyl carbon bound to any --O--,
--S--, or --N--, of --OR.sup.r, --SR.sup.r, --C(O)OR.sup.r,
--C(S)OR.sup.r, --C(O)NHR.sup.r, --C(S)NHR.sup.r,
--C(O)N.sub.rR.sup.r, --C(S)NR.sup.rR.sup.r, --S(O).sub.2NHR.sup.r,
--S(O).sub.2NR.sup.rR.sup.r, --C(NH)NHR.sup.r,
--NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NR.sup.rS(O).sub.2R.sup.r, --NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r,
--NR.sup.rC(O)NH.sub.2, --NR.sup.rC(S)NH.sub.2,
--NR.sup.rC(O)NHR.sup.r, --NR.sup.rC(S)NHR.sup.r,
--NHC(O)NR.sup.rR.sup.r, --NHC(S)NR.sup.rR.sup.r,
--NR.sup.rC(O)NR.sup.rR.sup.r, --NR.sup.rC(S)NR.sup.rR.sup.r,
--NHS(O).sub.2NHR.sup.r, --NR.sup.rS(O).sub.2NH.sub.2,
--NR.sup.rS(O).sub.2NHR.sup.r, --NHS(O).sub.2NR.sup.rR.sup.r,
--NR.sup.rS(O).sub.2NR.sup.rR.sup.r, --NHR.sup.r, or
--NR.sup.rR.sup.r is selected from the group consisting of fluoro
and --R.sup.y, and wherein C.sub.3-6 alkenyl or C.sub.3-6 alkynyl
are optionally substituted with one or more, preferably 1, 2, 3, 4
or 5, also 1, 2, or 3 substituents selected from the group
consisting of --R.sup.y, fluoro, lower alkyl, fluoro substituted
lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino, provided that any substitution
of the C.sub.3-6 alkenyl or C.sub.3-6 alkynyl carbon bound to any
--O--, --S--, or --N--, of --OR.sup.r, --SR.sup.r, --C(O)OR.sup.r,
--C(S)OR.sup.r, --C(O)NHR.sup.r, --C(S)NHR.sup.t,
--C(O)NR.sup.rR.sup.r, --C(S)NR.sup.rR.sup.r,
--S(O).sub.2NHR.sup.r, --S(O).sub.2NR.sup.rR.sup.r,
--C(NH)NHR.sup.r, --NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NR.sup.rS(O).sub.2R.sup.r, --NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r,
--NR.sup.rC(O)NH.sub.2, --NR.sup.rC(S)NH.sub.2,
--NR.sup.rC(O)NHR.sup.r, --NR.sup.rC(S)NHR.sup.r,
--NHC(O)NR.sup.rR.sup.r, --NHC(S)NR.sup.rR.sup.r,
--NR.sup.rC(O)NR.sup.rR.sup.r, --NR.sup.rC(S)NR.sup.rR.sup.r,
--NHS(O).sub.2NHR.sup.r, --NR.sup.rS(O).sub.2NH.sub.2,
--NR.sup.rS(O).sub.2NHR.sup.r, --NHS(O).sub.2NR.sup.rR.sup.r,
--NR.sup.rS(O).sub.2NR.sup.rR.sup.r, --NHR.sup.r, or
--NR.sup.rR.sup.r is selected from the group consisting of fluoro,
lower alkyl, fluoro substituted lower alkyl, or --R.sup.y, and
wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2, or 3 substituents selected from the group consisting
of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkyl amino, di-alkyl amino, and cycloalkylamino, or R.sup.s
and R.sup.t combine with the nitrogen to which they are attached
form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen
containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or
5 or 7 membered nitrogen containing heteroaryl are optionally
substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,
2, or 3 substituents selected from the group consisting of halogen,
--NO.sub.2, --CN, --OH, --NH.sub.2, OR.sup.u, --SR.sup.u,
--NHR.sup.u, --NR.sup.uR.sup.u, --R.sup.x, and --R.sup.y; [0764]
wherein each R.sup.u is independently selected from the group
consisting of lower alkyl, C.sub.3-6 alkenyl, C.sub.3-6 alkynyl,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower
alkyl is optionally substituted with one or more, preferably 1, 2,
3, 4 or 5, also 1, 2, or 3 substituents selected from the group
consisting of --R.sup.y, fluoro, --OH, --NH.sub.2, lower alkoxy,
fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino, provided that any substitution of the lower alkyl
carbon bound to the
--O-- of --OR.sup.u, --S-- of --SR.sub.u, or --N-- of --NHR.sup.u
is fluoro or --R.sup.y, and wherein C.sub.3-6 alkenyl or C.sub.3-6
alkynyl are optionally substituted with one or more, preferably 1,
2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group
consisting of --R.sup.y, fluoro, --OH, --NH, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino, provided that
any substitution of the C.sub.3-6 alkenyl or C.sub.3-6 alkynyl
carbon bound to the --O-- of --OR.sup.u, --S-- of --SR.sup.u, or
--N-- of --NHR.sup.u is fluoro, lower alkyl, fluoro substituted
lower alkyl, or --R.sup.y, and wherein cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl are optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of halogen, --OH,
--NH.sub.2, --NO.sub.2, --CN, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkyl amino,
di-alkyl amino, and cycloalkylamino; [0765] wherein each --R.sup.x
is selected from the group consisting of lower alkyl, lower alkenyl
and lower alkynyl, wherein lower alkyl is optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of --R.sup.y,
fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkyl amino, di-alkyl amino, and cycloalkylamino, and wherein
lower alkenyl or lower alkynyl are optionally substituted with one
or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents
selected from the group consisting of --R.sup.y, fluoro, --OH,
--NH.sub.2, lower alkyl, fluoro substituted lower alkyl, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkyl amino, di-alkyl amino, and
cycloalkylamino; [0766] wherein each --R.sup.y is selected from the
group consisting of cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl are optionally substituted with one or more, preferably
1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the
group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkyl amino, di-alkyl amino, and
cycloalkylamino.
[0767] "Lower alkoxy" denotes the group --OR.sup.z, where R.sup.z
is lower alkyl. "Substituted lower alkoxy" denotes lower alkoxy in
which R.sup.z is lower alkyl substituted with one or more
substituents as indicated herein, for example, in the description
of compounds of Formula I (including Formulae Ia, Ib, Ig and all
sub-embodiments thereof), including descriptions of substituted
cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached at any
available atom to produce a stable compound. Preferably,
substitution of lower alkoxy is with 1, 2, 3, 4, or 5 substituents,
also 1, 2, or 3 substituents. For example "fluoro substituted lower
alkoxy" denotes lower alkoxy in which the lower alkyl is
substituted with one or more fluoro atoms, where preferably the
lower alkoxy is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also
1, 2, or 3 fluoro atoms. While it is understood that substitutions
on alkoxy are attached at any available atom to produce a stable
compound, substitution of alkoxy is such that --O--, --S--, or
--N-- (except where N is a heteroaryl ring atom), are not bound to
the alkyl carbon bound to the alkoxy --O--. Further, where alkoxy
is described as a substituent of another moiety, the alkoxy oxygen
is not bound to a carbon atom that is bound to an --O--, --S--, or
--N-- of the other moiety (except where N is a heteroaryl ring
atom), or to an alkene or alkyne carbon of the other moiety.
[0768] "Lower alkylthio" denotes the group --SR.sup.aa, where
R.sup.aa is lower alkyl. "Substituted lower alkylthio" denotes
lower alkylthio in which R.sup.aa is lower alkyl substituted with
one or more substituents as indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), including descriptions of
substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl,
attached at any available atom to produce a stable compound.
Preferably, substitution of lower alkylthio is with 1, 2, 3, 4, or
5 substituents, also 1, 2, or 3 substituents. For example "fluoro
substituted lower alkylthio" denotes lower alkylthio in which the
lower alkyl is substituted with one or more fluoro atoms, where
preferably the lower alkylthio is substituted with 1, 2, 3, 4 or 5
fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood
that substitutions on alkylthio are attached at any available atom
to produce a stable compound, substitution of alkylthio is such
that --O--, --S--, or --N-- (except where N is a heteroaryl ring
atom), are not bound to the alkyl carbon bound to the alkylthio
--S--. Further, where alkylthio is described as a substituent of
another moiety, the alkylthio sulfur is not bound to a carbon atom
that is bound to an --O--, --S--, or --N-- of the other moiety
(except where N is a heteroaryl ring atom), or to an alkene or
alkyne carbon of the other moiety.
[0769] "Amino" or "amine" denotes the group --NH.sub.2.
"Mono-alkylamino" denotes the group --NHR.sup.bb where R.sup.bb is
lower alkyl. "Di-alkylamino" denotes the group --NR.sup.bbR.sup.cc,
where R.sup.bb and R.sup.cc are independently lower alkyl.
"Cycloalkylamino" denotes the group --NR.sup.ddR.sup.ee, where
R.sup.dd and R.sup.ee combine with the nitrogen to form a 5-7
membered heterocycloalkyl, where the heterocycloalkyl may contain
an additional heteroatom within the ring, such as --O--, --N--, or
--S--, and may also be further substituted with lower alkyl.
Examples of 5-7 membered heterocycloalkyl include, but are not
limited to, piperidine, piperazine, 4-methylpiperazine, morpholine,
and thiomorpholine. While it is understood that when
mono-alkylamino, di-alkylamino, or cycloalkylamino are substituents
on other moieties that are attached at any available atom to
produce a stable compound, the nitrogen of mono-alkylamino,
di-alkylamino, or cycloalkylamino as substituents is not bound to a
carbon atom that is bound to an --O--, --S--, or --N-- of the other
moiety.
[0770] As used herein, the term c-kit-mediated disease or condition
refers to a disease or condition in which the biological function
of c-kit affects the development and/or course of the disease or
condition, and/or in which modulation of c-kit alters the
development, course, and/or symptoms. For example, mutations in the
c-kit gene such as the W42, Wv, and W41 mutations reported by
Herbst et al al (J. Biol. Chem., 1992, 267: 13210-13216) confer
severe, intermediate, and mild phenotypic characteristics,
respectively. These mutations attenuate the intrinsic tyrosine
kinase activity of the receptor to different degrees and are models
for the effect of modulation of c-kit activity. A c-kit mediated
disease or condition includes a disease or condition for which
c-kit inhibition provides a therapeutic benefit, e.g. wherein
treatment with c-kit inhibitors, including compounds described
herein, provides a therapeutic benefit to the subject suffering
from or at risk of the disease or condition.
[0771] As used herein, the term c-fms-mediated disease or condition
refers to a disease or condition in which the biological function
of c-fms affects the development and/or course of the disease or
condition, and/or in which modulation of c-fms alters the
development, course, and/or symptoms. For example, the
Csf1r.sup.-/Csf1r.sup.- mutant mouse of Dai et al (Blood, 2002, 99:
111-120) which lacks c-fms is an animal model for diseases or
conditions wherein c-fms activity has been abolished. A c-fms
mediated disease or condition includes a disease or condition for
which c-fms inhibition provides a therapeutic benefit, e.g. wherein
treatment with c-fms inhibitors, including compounds described
herein, provides a therapeutic benefit to the subject suffering
from or at risk of the disease or condition.
[0772] As used herein, the term "composition" refers to a
formulation suitable for administration to an intended animal
subject for therapeutic purposes that contains at least one
pharmaceutically active compound and at least one pharmaceutically
acceptable carrier or excipient.
[0773] The term "pharmaceutically acceptable" indicates that the
indicated material does not have properties that would cause a
reasonably prudent medical practitioner to avoid administration of
the material to a patient, taking into consideration the disease or
conditions to be treated and the respective route of
administration. For example, it is commonly required that such a
material be essentially sterile, e.g., for injectibles.
[0774] In the present context, the terms "therapeutically
effective" and "effective amount" indicate that the materials or
amount of material is effective to prevent, alleviate, or
ameliorate one or more symptoms of a disease or medical condition,
and/or to prolong the survival of the subject being treated.
[0775] Reference to particular amino acid residues in human c-kit
polypeptide is defined by the numbering corresponding to the Kit
sequence in GenBank NP_000213 (SEQ ID NO:1). Reference to
particular nucleotide positions in a nucleotide sequence encoding
all or a portion of c-kit is defined by the numbering corresponding
to the sequence provided in GenBank NM_000222 (SEQ ID NO:2).
Reference to particular amino acid residues in human c-fms
polypeptide is defined by the numbering corresponding to the FMS
precursor sequence in GenBank NP 005202 (SEQ ID NO:3). Reference to
particular nucleotide positions in a nucleotide sequence encoding
all or a portion of c-fms is defined by the numbering corresponding
to the sequence provided in GenBank NM 005211 (SEQ ID NO:4).
[0776] The terms "kit", "c-kit", and "c-Kit" mean an enzymatically
active kinase that contains a portion with greater than 90% amino
acid sequence identity to amino acid residues including the ATP
binding site of full-length c-kit (e.g., human c-kit, e.g., the
sequence NP_000213, SEQ ID NO:1), for a maximal alignment over an
equal length segment; or that contains a portion with greater than
90% amino acid sequence identity to at least 200 contiguous amino
acids of native c-kit and retains kinase activity. Preferably the
sequence identity is at least 95, 97, 98, 99, or even 100%.
Preferably the specified level of sequence identity is over a
sequence at least 100-500, at least 200-400, or at least 300
contiguous amino acid residues in length. Unless indicated to the
contrary, the term includes reference to wild-type c-kit, allelic
variants, and mutated forms (e.g., having activating
mutations).
[0777] The terms "fms", "c-fms", "FMS", and "c-Fms" mean an
enzymatically active kinase that contains a portion with greater
than 90% amino acid sequence identity to amino acid residues
including the ATP binding site of full-length c-fms (e.g. human
c-fms, e.g. residues 20-972 of GenBank sequence NP 005202, SEQ ID
NO:3), for a maximal alignment over an equal length segment; or
that contains a portion with greater than 90% amino acid sequence
identity to at least 200 contiguous amino acids of native c-fms and
retains kinase activity. Preferably the sequence identity is at
least 95, 97, 98, 99, or 100%. Preferably the specified level of
sequence identity is over a sequence at least 100-150, at least
200-400, or at least 300 contiguous amino acid residues in length.
Unless indicated to the contrary, the term includes wild-type
c-fms, allelic variants, and mutated forms (e.g. having activating
mutations). The term "pFMS" refers to phosphorylated c-fms. The
term "c-fms activity" refers to a biological activity of c-fms,
particularly including kinase activity. The abbreviation "M-CSF"
refers to the ligand for the c-fms RPTK, and the abbreviation "SCF"
refers to the ligand for the c-Kit RPTK.
[0778] The term "c-kit kinase domain" refers to a reduced length
c-kit (i.e., shorter than a full-length c-kit by at least 100 amino
acids) that includes the kinase catalytic region in c-kit. The term
"c-fms kinase domain" refers to a c-fms of reduced length (i.e.,
shorter than a full-length c-fms by at least 100 amino acids) that
includes the kinase catalytic region of c-fms. Highly preferably
for use in this invention, the kinase domain retains kinase
activity, preferably at least 60, 70, 80, 90, or 100% of the native
c-fms kinase activity. The term "the kinase" or terms of similar
import relate to either c-kit or c-fms.
[0779] As used herein, the terms "ligand" and "modulator" are used
equivalently to refer to a compound that changes (i.e., increases
or decreases) the activity of a target biomolecule, e.g., an enzyme
such as a kinase or kinase. Generally a ligand or modulator will be
a small molecule, where "small molecule" refers to a compound with
a molecular weight of 1500 daltons or less, or preferably 1000
daltons or less, 800 daltons or less, or 600 daltons or less.
[0780] In the context of compounds binding to a target, the term
"greater affinity" indicates that the compound binds more tightly
than a reference compound, or than the same compound in a reference
condition, i.e. with a lower dissociation constant. In particular
embodiments, the greater affinity is at least 2, 3, 4, 5, 8, 10,
50, 100, 200, 400, 500, 1000, or 10,000-fold greater affinity.
[0781] Also in the context of compounds binding to a biomolecular
target, the term "greater specificity" indicates that a compound
binds to a specified target to a greater extent than to another
biomolecule or biomolecules that may be present under relevant
binding conditions, where binding to such other biomolecules
produces a different biological activity than binding to the
specified target. Typically, the specificity is with reference to a
limited set of other biomolecules, e.g. in the case of c-kit or
c-fms, other tyrosine kinases or even other type of enzymes. In
particular embodiments, the greater specificity is at least 2, 3,
4, 5, 8, 10, 50, 100, 200, 400, 500, or 1000-fold greater
specificity.
[0782] As used herein in connection with binding compounds or
ligands, the term "specific for c-kit kinase", "specific for
c-kit", and terms of like import mean that a particular compound
binds to c-kit to a statistically greater extent than to other
kinases that may be present in a particular sample. Also, where
biological activity other than binding is indicated, the term
"specific for c-kit" indicates that a particular compound has
greater biological effect associated with binding c-kit than to
other tyrosine kinases, e.g., kinase activity inhibition.
Preferably, the specificity is also with respect to other
biomolecules (not limited to tyrosine kinases) that may be present
in a particular sample. The term "specific for c-fms kinase",
"specific for c-fms", and terms of like import mean that a
particular compound binds to c-fms to a statistically greater
extent than to other kinases that may be present in a particular
sample. Also, where biological activity other than binding is
indicated, the term "specific for c-fms" indicates that a
particular compound has greater biological effect associated with
binding c-fms than to other tyrosine kinases, e.g., kinase activity
inhibition. Preferably, the specificity is also with respect to
other biomolecules (not limited to tyrosine kinases) that may be
present in a particular sample.
[0783] As used herein in connection with test compounds, binding
compounds, and modulators (ligands), the term "synthesizing" and
like terms means chemical synthesis from one or more precursor
materials.
[0784] By "assaying" is meant the creation of experimental
conditions and the gathering of data regarding a particular result
of the experimental conditions. For example, enzymes can be assayed
based on their ability to act upon a detectable substrate. A
compound or ligand can be assayed based on its ability to bind to a
particular target molecule or molecules.
[0785] As used herein, the term "modulating" or "modulate" refers
to an effect of altering a biological activity, especially a
biological activity associated with a particular biomolecule such
as c-kit or c-fms. For example, an agonist or antagonist of a
particular biomolecule modulates the activity of that biomolecule,
e.g., an enzyme.
[0786] The term "c-kit activity" refers to a biological activity of
c-kit, particularly including kinase activity. The term "c-fms
activity" refers to a biological activity of c-fms, particularly
including kinase activity.
[0787] In the context of the use, testing, or screening of
compounds that are or may be modulators, the term "contacting"
means that the compound(s) are caused to be in sufficient proximity
to a particular molecule, complex, cell, tissue, organism, or other
specified material that potential binding interactions and/or
chemical reaction between the compound and other specified material
can occur.
[0788] As used herein in connection with amino acid or nucleic acid
sequence, the term "isolate" indicates that the sequence is
separated from at least a portion of the amino acid and/or nucleic
acid sequences with which it would normally be associated.
[0789] In connection with amino acid or nucleic sequences, the term
"purified" indicates that the particular molecule constitutes a
significantly greater proportion of the biomolecules in a
composition than in a prior composition, e.g., in a cell culture.
The greater proportion can be 2-fold, 5-fold, 10-fold or more
greater.
I. General
[0790] In one aspect, the present invention concerns compounds of
Formula I, Formula Ia, Formula Ib, Formula Ig, Formula II, Formula
IIa, Formula IIb, Formula IIc, Formula IId, Formula IIe, Formula
IIf, Formula IIg, Formula IIh, Formula IIi, Formula IIj, Formula
IIk, Formula IIm, Formula IIn, Formula IIo, Formula IIp, or Formula
III, and all sub-embodiments thereof, that are inhibitors of c-kit,
c-fms, or both c-kit and c-fms, and the use of the compounds in
treating diseases that are mediated by c-kit, c-fms, or both c-kit
and c-fms.
[0791] Exemplary Diseases Associated with c-Kit.
[0792] The compounds described herein are useful for treating
disorders related to c-kit e.g., diseases related to unregulated
kinase signal transduction, including cell proliferative disorders,
fibrotic disorders and metabolic disorders, among others. As
described in more detail below and in Lipson et al., U.S.
20040002534 (U.S. application Ser. No. 10/600,868, filed Jun. 23,
2003) which is incorporated herein by reference in its entirety,
cell proliferative disorders which can be treated by the present
invention include cancers, and mast cell proliferative
disorders.
[0793] The presence of c-kit has also been associated with a number
of different types of cancers, as described below. In addition, the
association between abnormalities in c-kit and disease are not
restricted to cancer. As such, c-kit has been associated with
malignancies, including mast cell tumors, small cell lung cancer,
testicular cancer, gastrointestinal stromal tumors (GISTs),
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myelocytic leukemia, acute
lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis,
melanoma, and canine mast cell tumors, and inflammatory diseases,
including asthma, rheumatoid arthritis, allergic rhinitis, multiple
sclerosis, inflammatory bowel syndrome, transplant rejection, and
hypereosinophilia.
[0794] Exemplary Malignant Diseases Associated with c-Kit
[0795] Aberrant expression and/or activation of c-kit has been
implicated in a variety of cancers. Evidence for a contribution of
c-kit to neoplastic pathology includes its association with
leukemias and mast cell tumors, small cell lung cancer, testicular
cancer, and some cancers of the gastrointestinal tract and central
nervous system. In addition, c-kit has been implicated in playing a
role in carcinogenesis of the female genital tract (Inoue, et al.,
1994, Cancer Res. 54(11):3049-3053), sarcomas of neuroectodermal
origin (Ricotti, et al., 1998. Blood 91:2397-2405), and Schwann
cell neoplasia associated with neurofibromatosis (Ryan, et al.,
1994, J. Neuro. Res. 37:415-432). It was found that mast cells are
involved in modifying the tumor microenvironment and enhancing
tumor growth (Yang et al., 2003, J Clin Invest. 112:1851-1861;
Viskochil, 2003, J Clin Invest. 112:1791-1793). Thus, c-kit is a
useful target in treating neurofibromatosis as well as malignant
tumors.
[0796] Small cell lung carcinoma: c-kit kinase receptor has been
found to be aberrantly expressed in many cases of small cell lung
carcinoma (SCLC) cells (Hibi, et al., 1991, Oncogene 6:2291-2296).
Thus, as an example, inhibition of c-kit kinase can be beneficial
in treatment of SCLC, e.g. to improve the long term survival of
patients with SCLC.
[0797] Leukemias: SCF binding to the c-kit protects hematopoietic
stem and progenitor cells from apoptosis (Lee, et al., 1997, J.
Immunol. 159:3211-3219), thereby contributing to colony formation
and hematopoiesis. Expression of c-kit is frequently observed in
acute myelocytic leukemia (AML), and in some cases of acute
lymphocytic leukemia (ALL) (for reviews, see Sperling, et al.,
1997, Haemat 82:617-621; Escribano, et al., 1998, Leuk. Lymph.
30:459466). Although c-kit is expressed in the majority of AML
cells, its expression does not appear to be prognostic of disease
progression (Sperling, et al, 1997, Haemat 82:617-621). However,
SCF protected AML cells from apoptosis induced by chemotherapeutic
agents (Hassan, et al., 1996, Acta. Hem. 95:257-262). Inhibition of
c-kit by the present invention will enhance the efficacy of these
agents and can induce apoptosis of AML cells.
[0798] The clonal growth of cells from patients with
myelodysplastic syndrome (Sawada, et al., 1996, Blood 88:319-327)
or chronic myelogenous leukemia (CML) (Sawai, et al., 1996, Exp.
Hem. 2:116-122) was found to be significantly enhanced by SCF in
combination with other cytokines. CML is characterized by expansion
of Philadelphia chromosome positive cells of the marrow
(Verfaillie, et al., Leuk. 1998, 12:136-138), which appears to
primarily result from inhibition of apoptotic death (Jones, Curr.
Opin. Onec. 1997, 9:3-7). The product of the Philadelphia
chromosome, p210.sup.BCR-ABL, has been reported to mediate
inhibition of apoptosis (Bedi, et al., Blood 1995, 86:1148-1158).
Since p210.sup.BCR-ABL and c-kit both inhibit apoptosis and
p62.sup.dok has been suggested as a substrate (Carpino, et al.,
Cell 1997, 88:197-204), clonal expansion mediated by these kinases
may occur through a common signaling pathway. However, c-kit has
also been reported to interact directly with p210.sup.BCR-ABL
(Hallek, et al., Brit. J Haem. 1996, 94:5-16), which suggests that
c-kit has a more causative role in CML pathology. Therefore,
inhibition of c-kit will be useful in the treatment of the above
disorders.
[0799] Gastrointestinal cancers: Normal colorectal mucosa does not
express c-kit (Bellone, et al., 1997, J. Cell Physiol. 172:1-11).
However, c-kit is frequently expressed in colorectal carcinoma
(Bellone, et al., 1997, J. Cell Physiol. 172: 1-11), and autocrine
loops of SCF and c-kit have been observed in several colon
carcinoma cell lines (Toyota, et al., 1993, Turn Biol 14:295-302;
Lahm, et al., 1995, Cell Growth &Differ 6:1111-1118; Bellone,
et al., 1997, J. Cell Physiol. 172:1-11). Furthermore, disruption
of the autocrine loop by the use of neutralizing antibodies (Lahm,
et al., 1995, Cell Growth & Differ. 6:1111-1118) and
downregulation of c-kit and/or SCF significantly inhibits cell
proliferation (Lahm, et al., 1995, Cell Growth & Differ
6:1111-1118; Bellone, et al., 1997, J. Cell Physiol. 172:1-11).
[0800] SCF/c-kit autocrine loops have been observed in gastric
carcinoma cell lines (Turner, et al., 1992, Blood 80:374-381;
Hassan, et al. 1998, Digest. Dis. Science 43:8-14), and
constitutive c-kit activation also appears to be important for
gastrointestinal stromal tumors (GISTs). GISTs are the most common
mesenchymal tumor of the digestive system. More than 90% of GISTs
express c-kit, which is consistent with the putative origin of
these tumor cells from interstitial cells of Cajal (ICCs) (Hirota,
et al., 1998, Science 279:577-580). ICCs are thought to regulate
contraction of the gastrointestinal tract, and patients lacking
c-kit in their ICCs exhibited a myopathic form of chronic
idiopathic intestinal pseudo-obstruction (Isozaki, et al., 1997,
Amer. J. of Gast. 9 332-334). The c-kit expressed in GISTs from
several different patients was observed to have mutations in the
intracellular juxtamembrane domain leading to constitutive
activation of c-kit (Hirota. et al., 1998, Science 279:577-580).
Hence, inhibition of c-kit kinase will be an efficacious means for
the treatment of these cancers.
[0801] Testicular cancers: Male germ cell tumors have been
histologically categorized into seminomas, which retain germ cell
characteristics, and nonseminomas which can display characteristics
of embryonal differentiation. Both seminomas and nonseminomas are
thought to initiate from a preinvasive stage designated carcinoma
in situ (CIS) (Murty, et al., 1998, Sem. Oncol. 25:133-144). Both
c-kit and SCF have been reported to be essential for normal gonadal
development during embryogenesis (Loveland, et al., 1997, J.
Endocrinol 153:337-344). Loss of either the receptor or the ligand
resulted in animals devoid of germ cells. In postnatal testes,
c-kit has been found to be expressed in Leydig cells and
spermatogonia, while SCF was expressed in Sertoli cells (Loveland,
et al., 1997, J. Endocrinol 153:337-344). Testicular tumors develop
from Leydig cells with high frequency in transgenic mice expressing
human papilloma virus 16 (HPV 16) E6 and E7 oncogenes (Kondoh, et
al., 1991, J. Virol. 65:3335-3339; Kondoh, et al., 1994, J. Urol.
152:2151-2154). These tumors express both c-kit and SCF, and an
autocrine loop may contribute to the tumorigenesis (Kondoh, et al.,
1995, Oncogene 10:341-347) associated with cellular loss of
functional p53 and the retinoblastoma gene product by association
with E6 and E7 (Dyson, et al., 1989, Science 243:934-937; Werness,
et al., 1990, Science 248:76-79; Scheffner, et al., 1990, Cell
63:1129-1136). Defective signaling mutants of SCF (Kondoh, et al.,
1995, Oncogene 10:341-347) or c-kit (Li, et al., 1996, Canc. Res.
56:4343-4346) inhibited formation of testicular tumors in mice
expressing HPV 16 E6 and E7. The c-kit kinase activation is pivotal
to tumorigenesis in these animals and thus modulation of the c-kit
kinase pathway by the present invention will prevent or treat such
disorders.
[0802] Expression of c-kit in germ cell tumors shows that the
receptor is expressed by the majority of carcinomas in situ and
seminomas, but c-kit is expressed in only a minority of
nonseminomas (Strohmeyer, et al., 1991, Canc. Res. 51:1811-1816;
Rajpert-de Meyts, et al., 1994, Int. J. Androl. 17:85-92;
Izquierdo, et al., 1995, J. Pathol. 177:253-258; Strohmeyer, et
al., 1995, J. Urol. 153:511-515; Bokenmeyer, et al., 1996, J.
Cancer Res. Clin. Oncol. 122:301-306; Sandlow, et al., 1996, J.
Androl. 17:403-408). Therefore, inhibition of c-kit kinase provides
a means for treating these disorders.
[0803] CNS cancers: SCF and c-kit are expressed throughout the CNS
of developing rodents, and the pattern of expression indicates a
role in growth, migration and differentiation of neuroectodermal
cells. Expression of both receptor and ligand have also been
reported in the adult brain (Hamel, et al., 1997, J. Neuro-Onc.
35:327-333). Expression of c-kit has also been observed in normal
human brain tissue (Tada, et al. 1994, J. Neuro 80:1063-1073).
Glioblastoma and astrocytoma, which define the majority of
intracranial tumors, arise from neoplastic transformation of
astrocytes (Levin, et al., 1997, Principles & Practice of
Oncology: 2022-2082). Expression of c-kit has been observed in
glioblastoma cell lines and tissues (Berdel, et al., 1992, Canc.
Res. 52:3498-3502; Tada, et al. 1994, J. Neuro 80:1063-1073;
Stanulla, et al., 1995, Act Neuropath 89:158-165).
[0804] Cohen, et al., 1994, Blood 84:3465-3472 reported that all 14
neuroblastoma cell lines examined contained c-kit/SCF autocrine
loops, and expression of both the receptor and ligand were observed
in 45% of tumor samples examined. In two cell lines, anti-c-kit
antibodies inhibited cell proliferation, suggesting that the
SCF/c-kit autocrine loop contributed to growth (will Cohen, et al.,
1994, Blood 84:3465-3472). Hence, c-kit kinase inhibitors can be
used to treat these cancers.
[0805] Exemplary Mast Cell Diseases Involving c-Kit
[0806] Excessive activation of c-kit is also associated with
diseases resulting from an over-abundance of mast cells.
Mastocytosis is the term used to describe a heterogeneous group of
disorders characterized by excessive mast cell proliferation
(Metcalfe, 1991, J. Invest. Derm 93:2S-4S; Golkar, et al., 1997,
Lancet 349:1379-1385). Elevated c-kit expression was reported on
mast cells from patients with aggressive mastocytosis (Nagata, et
al., 1998, Leukemia 12:175-181).
[0807] Additionally, mast cells and eosinophils represent key cells
involved in allergy, inflammation and asthma (Thomas, et al., 1996,
Gen. Pharmacol 27:593-597: Metcalfe, et al., 1997, Physiol Rev
77:1033-1079; Naclerio, et al., 1997, JAMA 278:1842-1848; Costa, et
al., 1997, JAMA 278:1815-1822). SCF, and hence c-kit, directly and
indirectly regulates activation of both mast cells and eosinophils,
thereby influencing the primary cells involved in allergy and
asthma through multiple mechanisms. Because of this mutual
regulation of mast cell and eosinophil function, and the role that
SCF can play in this regulation, inhibition of c-kit can be used to
treat allergy-associated chronic rhinitis, inflammation and
asthma.
[0808] Mastocytosis: SCF (also known as mast cell growth factor)
stimulation of c-kit has been reported to be essential for the
growth and development of mast cells (Hamel, et al., 1997, J.
Neuro-Onc. 35:327-333: Kitamura, et al., 1995, Int. Arch. Aller.
Immunol. 107:54-56). Mice with mutations of c-kit that attenuate
its signaling activity have exhibited significantly fewer mast
cells in their skin (Tsujimura, 1996, Pathol Int 46:933-938).
Excessive activation of c-kit can be associated with diseases
resulting from an over abundance of mast cells.
[0809] Mastocytosis is limited to the skin in the majority of
patients, but can involve other organs in 15-20% of patients
(Valent, 1996, Wein/Klin Wochenschr 108:385-397; Golkar, et al.,
1997, Lancet 349:1379-1385). Even among patients with systemic
mastocytosis, the disease can range from having a relatively benign
prognosis to aggressive mastocytosis and mast cell leukemia.
(Valent, 1996, Wein/Klin Wochenschr 108:385-397; Golkar, et al.,
1997, Lancet 349:1379-1385). c-kit has been observed on malignant
mast cells from canine mast cell tumors (London, et al., 1996, J.
Compar. Pathol. 115:399-414), as well as on mast cells from
patients with aggressive systemic mastocytosis (Baghestanian, et
al., 1996, Leuk.: 116-122; Castells, et al., 1996, J. Aller. Clin.
Immunol. 98:831-840).
[0810] SCF has been shown to be expressed on stromal cells as a
membrane-bound protein, and its expression can be induced by
fibrogenic growth factors such as PDGF. It has also been shown to
be expressed on keratinocytes as a membrane-bound protein in normal
skin. However, in the skin of patients with mastocytosis, an
increased amount of soluble SCF has been observed (Longley, et al.,
1993, New Engl. J. Med. 328:1302-1307).
[0811] Mast cell chymase has been reported to cleave
membrane-associated SCF to a soluble and biologically active form.
This mast cell-mediated process can generate a feedback loop to
enhance mast cell proliferation and function (Longley, et al.,
1997, Proc. Natl. Acad. Sci. 94:9017-9021), and may be important
for the etiology of mastocytosis. Transgenic mice overexpressing a
form of SCF that could not be proteolytically released from
keratinocytes did not develop mastocytosis, while similar animals
expressing normal SCF in keratinocytes exhibited a phenotype
resembling human cutaneous mastocytosis (Kunisada, et al., 1998. J.
Exp. Med. 187:1565-1573). Formation of large amounts of soluble SCF
can contribute to the pathology associated with mastocytosis in
some patients and the present invention can treat or prevent such
disorders by modulating the interaction between SCF and c-kit
kinase. Several different mutations of c-kit that resulted in
constitutive kinase activity have been found in human and rodent
mast cell tumor cell lines (Furitsu, et al., 1993, J. Clin. Invest.
92:1736-1744; Tsujimura, et al., 1994, Blood 9:2619-2626;
Tsujimura, et al., 1995, Int. Arch. Aller. Immunol 106:377-385;
Tsujimura, 1996, Pathol Int 46:933-938). In addition, activating
mutations of the c-kit gene have been observed in peripheral
mononuclear cells isolated from patients with mastocytosis and
associated hematologic disorders (Nagata, et al., 1998,
Mastocytosis Leuk 12:175-181), and in mast cells from a patient
with urticaria pigmentosa and aggressive mastocytosis (Longley, et
al., 1996, Nat. Gen. 12:312-314). Inhibition of c-kit kinase will
therefore prove to have an excellent therapeutic role in the
treatment of these disorders.
[0812] In some patients, activating mutations of c-kit may be
responsible for the pathogenesis of the disease and these patients
can be treated, or their diseases prevented, by modulation of the
SCF interaction with c-kit kinase. SCF activation of c-kit as been
shown to prevent mast cell apoptosis which may be critical for
maintaining cutaneous mast cell homeostasis (Iemura, et al., 1994,
Amer. J. Pathol 144:321-328; Yee, et al., 1994, J. Exp. Med.
179:1777-1787; Mekori, et al., 1994, J. Immunol 153:2194-2203;
Mekori, et al., 1995, Int. Arch. Allergy Immunol. 107:137-138).
Inhibition of mast cell apoptosis can lead to the mast cell
accumulation associated with mastocytosis. Thus, observation of
c-kit activation resulting from overexpression of the receptor,
excessive formation of soluble SCF, or mutations of the c-kit gene
that constitutively activate its kinase, provides a rationale that
inhibition of the kinase activity of c-kit will decrease the number
of mast cells and provide benefit for patients with
mastocytosis.
[0813] For cells with activating c-kit mutations, it was found that
inhibitors of c-kit inhibit or even kill the cells (Ma et al.,
2000. J Invest Dermatol. 114:392-394), particularly for mutations
in the regulatory region (Ma et al., 2002. Blood 99:1741-1744). Ma
et al., 2002, also showed that for mutations in the catalytic
region, inhibitors ST1571 (Gleevec) and SU9529 did not inhibit the
cells, such that additional types of c-kit inhibitors are useful.
Thus, c-kit inhibitors can be used against both wild-type c-kit as
well as c-kit having mutations, e.g., activating mutations in the
regulatory region and/or catalytic region.
[0814] Asthma & Allergy: Mast cells and eosinophils represent
key cells in parasitic infection, allergy, inflammation, and asthma
(Thomas, et al., 1996, Gen. Pharmacol 27:593-597; Metcalfe, et al.,
1997, Physiol Rev 77:1033-1079; Holgate, 1997, CIBA Found. Symp.;
Naclerio, et al, 1997, JAMA 278:1842-1848; Costa. et al., 1997,
JAMA 778:1815-1822). SCF has been shown to be essential for mast
cell development, survival and growth (Kitamura, et al., 1995, Int.
Arch. Aller. Immunol. 107:54-56; Metcalfe, et al., 1997, Physiol
Rev 77:1033-1079). In addition, SCF cooperates with the
eosinophil-specific regulator, IL-5, to increase the development of
eosinophil progenitors (Metcalf, et al., 1998, Proc. Natl. Acad.
Sci., USA 95:6408-6412). SCF has also been reported to induce mast
cells to secrete factors (Okayama, et al., 1997, Int. Arch. Aller.
Immunol. 114:75-77; Okayama, et al., 1998, Eur. J. Immunol.
28:708-715) that promote the survival of eosinophils (Kay, et al.,
1997, Int. Arch. Aller. Immunol. 113:196-199), which may contribute
to chronic, eosinophil-mediated inflammation (Okayama, et al.,
1997, Int. Arch. Aller. Immunol. 114:75-77; Okayama, et al., 1998,
Eur. J. Immunol. 28:708-715). In this regard, SCF directly and
indirectly regulates activation of both mast cells and
eosinophils.
[0815] SCF induces mediator release from mast cells, as well as
priming these cells for IgE-induced degranulation (Columbo, et al.,
1992, J. Immunol 149:599-602) and sensitizing their responsiveness
to eosinophil-derived granule major basic protein (Furuta, et al.,
1998, Blood 92:1055-1061). Among the factors released by activated
mast cells are IL-5, GM-CSF and TNF-.alpha., which influence
eosinophil protein secretion (Okayama, et al., 1997, Int. Arch.
Aller. Immunol. 114:75-77; Okayama. et al., 1998, Eur. J. Immunol.
28:708-715). In addition to inducing histamine release from mast
cells (Luckacs, et al., 1996, J. Immunol. 156:3945-3951; Hogaboam,
et al., 1998, J. Immunol. 160:6166-6171), SCF promotes the mast
cell production of the eosinophil chemotactic factor, eotaxin
(Hogaboam, et al., 1998, J. Immunol. 160:6166-6171), and eosinophil
infiltration (Luckacs, et al., 1996, J. Immunol.
156:3945-3951).
[0816] SCF also directly influences the adhesion of both mast cells
(Dastych, et al., 1994, J. Immunol. 152:213-219; Kinashi, et al.,
1994, Blood 83:1033-1038) and eosinophils (Yuan, et al., 1997, J.
Exp. Med. 186:313-323), which in turn, regulates tissue
infiltration. Thus, SCF can influence the primary cells involved in
allergy and asthma through multiple mechanisms. Currently,
corticosteroids are the most effective treatment for chronic
rhinitis and inflammation associated with allergy (Naclerio, et
al., 1997, JAMA 278:1842-1848; Meltzer, 1997, Aller. 52:33-40).
These agents work through multiple mechanisms including reduction
of circulating and infiltrating mast cells and eosinophils, and
diminished survival of eosinophils associated with inhibition of
cytokine production (Meltzer, 1997, Aller. 52:33-40). Steroids have
also been reported to inhibit the expression of SCF by fibroblasts
and resident connective tissue cells, which leads to diminished
mast cell survival (Finotto, et al., 1997, J. Clin. Invest. 99
1721-1728). Because of the mutual regulation of mast cell and
eosinophil function, and the role that SCF can play in this
regulation, inhibition of c-kit kinase will provide a means to
treat allergy-associated chronic rhinitis, inflammation and
asthma.
[0817] Inflammatory arthritis (e.g. rheumatoid arthritis): Due to
the association of mast cells with the arthritic process (Lee et
al., 2002, Science 297:1689-1692), c-kit provides a useful target
for prevention, delay, and/or treatment of inflammatory arthritis,
such as rheumatoid arthritis.
[0818] Multiple sclerosis: Mast cells have been shown to play an
extensive role in autoimmune diseases, as demonstrated in the mouse
model of multiple sclerosis (MS), experimental allergic
encephalomyelitis (EAE). Mast cells were indicated to be required
for full manifestation of the disease. Secor et al., 2000, J Exp
Med 191:813-821. Thus, c-kit also provides a useful target for the
prevention, delay, and/or treatment of multiple sclerosis.
[0819] Exemplary Diseases Associated with c-Fms
[0820] The presence of c-fms has been associated with a number of
different types of diseases. As such, c-fms has been associated
with immune disorders, including rheumatoid arthritis, systemic
lupus erythematosis (SLE), and transplant rejection; inflammatory
diseases including, but not limited to, osteoarthritis,
inflammatory bowel syndrome, ulcerative colitis, Crohn's disease,
chronic obstructive pulmonary disease (COPD), emphysema, Kawasaki's
Disease, hemophagocytic syndrome (macrophage activation syndrome),
multicentric reticulohistiocytosis, and atherosclerosis; metabolic
disorders, including, but not limited to, Type I diabetes, Type II
diabetes, insulin resistance, hyperglycemia, obesity, and
lipolysis; disorders of bone structure, mineralization and bone
formation and resorption, including, but not limited to,
osteoporosis, increased risk of fracture. Paget's disease,
hypercalcemia, infection-mediated osteolysis (e.g., osteomyelitis),
pen-prosthetic or wear-debris-mediated osteolysis, and metastasis
of cancer to bone; kidney and genitourinary diseases, including,
but not limited to, endometriosis, nephritis (e.g.
glomerulonephritis, interstitial nephritis, Lupus nephritis),
tubular necrosis, diabetes-associated renal complications (e.g.
diapetic nephropathy), and renal hypertrophy; disorders of the
central nervous system, including, but not limited to, multiple
sclerosis, stroke, Alzheimer's disease and Parkinson's disease;
inflammatory and chronic pain, including, but not limited to bone
pain; and cancers, including, but not limited to, multiple myeloma,
acute myeloid leukemia (AML), chronic myeloid leukemia (CML),
prostate cancer, breast cancer, ovarian cancer, melanoma,
glioblastoma multiforme, metastasis of tumors to other tissues, and
other chronic myeloproliferative diseases such as
myelofibrosis.
[0821] Aberrant expression and/or activation of c-fms has been
implicated in acute myeloid leukemia, AML (Ridge et al, Proc. Nat.
Acad. Sci., 1990, 87:1377-1380). Mutations at codon 301 are
believed to lead to neoplastic transformation by ligand
independence and constitutive tyrosine kinase activity of the
receptor. The tyrosine residue at codon 969 has been shown to be
involved in a negative regulatory activity, which is disrupted by
amino acid substitutions. Accordingly, c-fms mutations are most
prevalent (20%) in chronic myelomonocytic leukemia and AML type M4
(23%), both of which are characterized by monocytic
differentiation.
[0822] A condition related to AML is chronic myeloid leukemia
(CML). During the myeloid blast crisis (BC) of CML, non-random
additional chromosome abnormalities occur in over 80% of patients.
However, these cytogenetic changes have been reported to precede
the clinical signs of CML-BC by several months to years suggesting
that other biological events may participate in the multistep
process of acute transformation of CML. The autocrine production of
growth factors has been shown to occur in several hematological
malignancies and particularly in AML. Specchia et al [Br J
Haematol. 1992 Mart 80(3):310-6] have demonstrated that IL-1 beta
gene is expressed in almost all cases of CML in myeloid blast
crisis, and that a high proportion of cases showed constitutive
expression of the M-CSF gene. Many of the same patients in the
Specchia et al study demonstrated simultaneous co-expression of
c-fms. After exposure of leukemic cells to phorbol myristate
acetate (PMA), release of M-CSF protein was documented in three of
five patients studied; however, no significant interleukin-3
(IL-3), granulocyte-macrophage colony-stimulating factor (GM-CSF)
or granulocyte colony-stimulating factor (G-CSF), was detected in
these patients. This demonstrates that different patterns of growth
factors secretion exist in AML and CML, and that distinct molecular
events are likely involved in the control of leukemic
proliferation.
[0823] The observation that production of M-CSF, the major
macrophage growth factor, is increased in tissues during
inflammation (Le Meur et al, J. Leukocyte Biology. 2002:72:530-537)
provides a role for c-fms in certain diseases. For example, COPD is
characterized by airflow limitation that is not fully reversible.
The airflow limitation is usually progressive and associated with
an abnormal inflammatory response of the lungs to noxious particles
or gases. The chronic inflammation of COPD is observed through the
airways, parenchyma, and pulmonary vasculature. The inflammatory
cell population consists of neutrophils, macrophages, and T
lymphocytes, along with eosinophils in some patients. Macrophages
are postulated to play an orchestrating role in COPD inflammation
by releasing mediators such as TNF-.alpha., IL-8 and LTB4, which
are capable of damaging lung structures and/or sustaining
neutrophilic inflammation.
[0824] Further, M-CSF/Fms signaling is critical to osteoclast
formation and survival of osteoclast precursors. For example,
estrogen loss in menopause results in increased M-CSF and thus
increased osteoclast number and bone resorption which leads to
increased risk of fracture and osteoporosis. Accordingly, blockage
of this signal is a target for the inhibition of bone resorption
(Teitelbaum, Science. 2000; 289:1504; Rohan, Science. 2000;
289:1508.)
[0825] Atherosclerosis, an inflammatory disease of the vessel
walls, is associated with significant morbidity and mortality. A
effect for c-fms inhibition in the treatment and prevention of
atherosclerosis depends on several observations (Libby. Nature.
2002; 420:868-874.) First, monocytes resident in the arterial
intima increase expression of scavenger receptors and internalize
modified lipoproteins. The resulting lipid-laden macrophages
develop into foam cells characteristic of the atherosclerotic
lesion. Macrophages in atheroma secrete cytokines and growth
factors involved in lesion progression. Additionally, macrophages
replicate within the intima. Through c-fms, M-CSF activates the
transition from monocyte to lipid-laden macrophage and augments
expression of scavenger receptor A. Indeed, atherosclerotic plaques
over-express M-CSF which is critical for atherosclerotic
progression. Mice deficient in M-CSF have been found to experience
less severe atherosclerosis than mice with normal M-CSF
(Rajavashisth, et. al., J. Clin. Invest. 1998; 101:2702-2710; Qiao,
et. al., Am. J. Path. 1997; 150:1687-1699). Accordingly, inhibitors
of c-fms disrupt M-CSF signaling, compromising monocyte to
macrophage foam cell progression, macrophage survival and
replication, and cytokine signaling that participates in lesion
progression.
[0826] The role of M-CSF and c-fms in emphysema appears to involve
the regulation of elastin metabolism through control of matrix
metalloproteins. M-CSF has a role in the modulation of the
accumulation and function of alveolar macrophages (AMs) in vivo
(Shibata et al, Blood 2001, 98: pp. 2845-2852). Osteopetrotic
(Op/Op) mice have no detectable M-CSF and show variable
tissue-specific reductions in macrophage numbers. Accordingly, it
was hypothesized that AMs would be decreased in number and have
altered function in Op/Op mice because of the absence of M-CSF.
Shibata et al found that lung macrophages identified in lung
sections were decreased in number in 20-day-old Op/Op mice but not
Op/Op mice older than 4 months compared with findings in
age-matched littermate controls. The numbers of AMs recovered by
bronchioalveolar lavage (BAL) were also reduced in young but not
adult Op/Op mice compared with controls. Importantly, AMs of Op/Op
mice spontaneously release higher levels of matrix
metalloproteinases (MMPs) than AMs of controls. Consistent with an
increased release of MMP, Op/Op mice have abnormal elastin
deposition and spontaneously develop emphysema in the absence of
molecular or cellular evidence of lung inflammation. Accordingly,
the modulation of metalloelastase activity in macrophages by M-CSF
may control the degradation of elastin fibers in lungs or blood
vessels.
[0827] Metastatic cancer cells cause bone destruction, with
associated fracture, pain, deformation, and hypercalcaemia, due to
production of osteoclasticogenic factors including M-CSF by tumor
cells (Clohisy et al, Clin. Orthop. 2000, 373: 104-14). Binding of
M-CSF to the c-fms product stimulates formation of osteoclasts and
osteolytic activity (Kodama et al, J. Exp. Med. 1991, 173: 269-72:
Feng et al, Endocrinology 2002, 143: 4868-74). Accordingly,
inhibition of osteoclast activity at the level of c-fms offers a
compelling target for amelioration of bone metastasis.
[0828] Macrophage accumulation is a prominent feature in many forms
of glomerulonephritis. Local proliferation of macrophages within
the kidney has been described in human and experimental
glomerulonephritis and may have an important role in augmenting the
inflammatory response. Isbel et al (Nephrol Dial Transplant 2001,
16: 1638-1647) examined the relationship between local macrophage
proliferation and renal expression of M-CSF. Glomerular and
tubulointerstitial M-CSF expression was found to be up-regulated in
human glomerulonephritis, being most prominent in proliferative
forms of disease. Because this correlates with local macrophage
proliferation, it suggests that increased renal M-CSF production
plays an important role in regulating local macrophage
proliferation in human glomerulonephritis. In a model of renal
inflammation (UUO-- unilateral ureteric obstruction) anti-c-fms
antibody treatment reduced macrophage accumulation (Le Meur et.
al., J Leukocyte Biology, 2002, 72: 530-537). Accordingly,
inhibition of c-fms offers a target for therapeutic intervention in
glomerulonephritis.
[0829] Insulin resistance and obesity are hallmark of type II
diabetes and there is a strong correlation between insulin
resistance and abdominal visceral fat accumulation (Bjorntrop,
Diabetes Metab. Res. Rev., 1999, 15: 427-441). Current evidence
indicates that macrophages accumulating in adipose tissue release
TNF-.alpha. and other factors that cause adipocyte changes
(hypertrophy, lipolysis, reduced insulin sensitivity) and also
promote insulin resistance in surrounding tissues. Therefore,
macrophage accumulation in type 2 diabetes is important for disease
progression. Accordingly, inhibition of c-fms has potential in
preventing the development of insulin resistance and
hyperglycemia.
[0830] Dewar et al. have recently demonstrated that the kinase
inhibitor imatinib also specifically targets the macrophage colony
stimulating factor receptor, c-fms, at therapeutic concentrations.
Although this finding has important implications with regard to
potential side effects in patients currently receiving imatinib
therapy, these results suggest that imatinib may also be useful in
the treatment of diseases where c-fms is implicated. This includes
breast and ovarian cancer and inflammatory conditions such as
rheumatoid arthritis. Dewar et al. also speculate that imatinib may
be used in diseases where bone destruction occurs due to excessive
osteoclast activity, such as in the haematologic malignancy,
multiple myeloma (Dewar et al., Cell Cycle 2005, 4(7):851-3).
[0831] To determine the importance of M-CSF in driving macrophage
proliferation during acute rejection, Jose et al. blocked the M-CSF
receptor, c-fms, in a mouse model of acute renal allograft
rejection. They observed that the severity of tubulointerstitial
rejection was reduced in the treatment group as shown by decreased
tubulitis and tubular cell proliferation. Macrophage proliferation
during acute allograft rejection is dependent on the interaction of
M-CSF with its receptor c-fms. They indicate that this pathway
plays a significant and specific role in the accumulation of
macrophages within a rejecting renal allograft (Jose et al., Am J
Transplant 2003, 3(3):294-300).
[0832] Further, modulators of both c-fms and c-kit function can be
used against diseases such as those indicated above, where in some
instances, the dual activity of the modulator for both c-fms and
c-kit provides distinct advantages in treating such diseases. The
complementary activities provided by a single compound would
provide added benefits over compounds targeting one or the other
activity, or separate compounds targeting these activities. For
example, by attenuating release of macrophage chemo-attractants by
mast cells or mast cell chemoattractants by macrophages, these
anti-inflammatory effects would synergize with the concomitant
inhibition of intrinsic cellular function. Limitations in
co-administration are absent in a dual inhibitor. Further, the dual
activity may result in much lower effective doses for
treatment.
[0833] Exemplary Diseases Associated with TrkA and TrkB
[0834] TrkA; Target kinase TrkA (i.e., neurotrophic tyrosine
kinase, receptor, type 1) is a 140 kDa tyrosine kinase encoded by
chromosome 1 q21-q22 (symbol: NTRK1). TrkA inhibitors may be useful
in treating pain (e.g. chronic pain, neuropathic pain), cancer
(e.g. prostate cancer, lung cancer, myeloid leukemia, pancreatic
cancer), allergic disorders (e.g. asthma), arthritis, diabetic
retinopathy, macular degeneration and psoriasis.
[0835] TrkA is a plasma member receptor composed of an
extracellular domain (responsible for high affinity binding to
nerve growth factor, NGF), a transmembrane segment and an
intracellular protein tyrosine kinase domain (responsible to
transmit the NGF signal to initiate and coordinate neuronal
responses). NGF binding induces TrkA clustering on the membrane and
activates the kinase. The kinase initiates a cascade of protein
phosphorylation events through multiple pathways including
SHC/Ras/MAPK, PI3K and PLCg1. A TrkA kinase inhibitor would not
prevent NGF/TrkA binding, but could prevent down-stream signal
transduction.
[0836] Nerve Growth Factor (NGF) is produced by a number of tissues
and inflammatory cells during tissue injury and host immune
response. It initiates and maintains hypersensitivity to incoming
stimulus (hyperalgesia) and the perception of non-noxious stimuli
(allodynia). Through its high-affinity receptor TrkA, NGF increases
the excitation state of sensory neurons leading to the central
nervous system (peripheral sensitization), and increases
transmitter release from the dorsal spinal cord (central
sensitization). In clinical trials, a single NGF subcutaneous
injection generated local hyperalgesia persisting up to 7 weeks. At
doses above 0.1 microgram/kg, NGF caused muscle pain that varied
from mild to moderate, primarily in the bulbar and truncal
musculature. Intravenous NGF produced earlier and more pronounced
systemic effects (Petty et al, 1994, Ann Neurol. 36: 244-6).
Conversely, TrkA kinase inhibitors could be used to treat diseases
of enhanced states of nociception.
[0837] In Complete Freund's Adjuvant (CFA)-induced hind-paw
inflammation, spinal nerve ligation and streptozoticin-induced
neuropathic pain models, a single intraperitoneal injection of
anti-NGF reversed established tactile allodynia from day 3 to day 7
following treatment. In the mouse CCI model, anti-NGF reversed
tactile allodynia when administered 2 weeks after surgery. Repeated
administration of this antibody to CCI mice for 3 weeks produced a
sustained reversal of tactile allodynia (Wild et al, 2007, J.
Pharmacol. Exp. Ther. 322:282-287).
[0838] Prostate tumors that have metastasized to bone frequently
induce bone pain which can be difficult to fully control as it
seems to be driven simultaneously by inflammatory, neuropathic, and
tumorigenic mechanisms. Anti-NGF produced a significant reduction
in both early and late stage bone cancer pain-related behaviors.
This therapy did not influence tumor-induced bone remodeling,
osteoblast proliferation, osteoclastogenesis, tumor growth, or
markers of sensory or sympathetic innervation in the skin or bone.
All nerve fibers that innervate the bone express TrkA and p75, and
these are the receptors through which NGF sensitizes and/or
activates nociceptors (Halvorson et al, 2005, Cancer Res.
65:9426-35).
[0839] In patients with mild asthma due to exposure to cat
allergen, NGF expression was strongly induced in epithelial cells,
fibroblasts, blood vessels, and a few infiltrating cells. TrkA mRNA
and protein levels in bronchial biopsies were increased
significantly after allergen exposure in infiltrating mast cells
before the onset of symptoms (Kassel et al, 2001, Clin Exp Allergy
31:1432-40).
[0840] The late phase reaction in asthma following allergen
provocation is dominated by an influx of activated eosinophils into
the bronchial lumen, which correlates with the release of
eosinophilic products into the airways to increase disease
severity. The viability and activation of eosinophils from patients
with mild asthma were significantly enhanced after NGF stimulation.
Addition of neutralizing anti-NGF antibodies ex vivo abrogated the
effects (Nassentein et al, 2003. J Exp Med 198:455-467). TrkA
kinase inhibitors could decrease this paracrine loop between the
respiratory tract and infiltrating mast cells as well as
endobronchial eosinophils, and thus be useful for the treatment of
asthma and other allergic disorders.
[0841] TrkB:
[0842] Target kinase TrkB (i.e., neurotrophic tyrosine kinase,
receptor, type 2) is a 145 kDa tyrosine kinase encoded by
chromosome 9q22.1 (symbol: NTRK2). TrkB inhibitors may be useful in
treating various cancers and their metastases (e.g. prostate
cancer, lung cancer, Wilms tumors, neuroblastoma, and pancreatic
cancer), and various neuropathies (e.g. stroke, multiple sclerosis,
transverse myelitis, and encephalitis).
[0843] In clinical trials with recombinant BDNF, paresthesia was
developed at the site of subcutaneous injection (Coulie et al,
2000, Gastroenterology 119:41-50). Intrathecal infusion of BDNF in
humans also induced paresthesia and warmth as side effects (Ochs et
al, 2000, Amyotroph Lateral Scler Other Motor Neuron Disord.
1:201-6). Chronic paresthesia is often a symptom of an underlying
neurological disease or traumatic nerve damage. Paresthesia can be
caused by disorders affecting the central nervous system, such as
stroke and transient ischemic attacks (mini-strokes), multiple
sclerosis, transverse myelitis, and encephalitis. Since BDNF binds
to TrkB specifically with high affinity these neuropath effects are
mediated through TrkB signaling. Thus Trkb kinase inhibitors could
be used to treat certain patients with neuropathy.
[0844] BDNF is known to act at the synapses between primary sensory
and spinal dorsal horn neurons to affect pain transmission during
inflammation. The primary afferent is the only source of BDNF in
the spinal cord, and it is up-regulated in the dorsal root ganglion
(DRG) by peripheral NGF a few days after inflammation, and is
transported and released into the superficial dorsal horn in an
activity-dependent manner. TrkB expression in the dorsal horn also
increases for a few days after inflammation. These findings suggest
that BDNF may act during the restricted period in the early phase
of inflammation. Through TrkB, BDNF activates two distinct
channels: (1) transient receptor potential canonicals (TRPC3),
which produces a slow response by opening of a non-selective cation
channel; and (2) Na+ channel, which mediates a rapid depolarization
in the hippocampus. These channels have been strongly associated
with inflammatory pain. Anti-BDNF significantly increased the
withdrawal threshold in CFA-treated rats, a model of inflammatory
pain. Since the swelling at the site of CFA injection was not
affected by antiserum, the residual component might be due to
peripheral sensitization (Matayoshi et al, 2005, J Physiol.
569:685-95).
[0845] In patients with neuroblastomas, co-expression of TrkB and
BDNF, co-expression of TrkB with N-Myc amplification, and
expression of truncated TrkB are found to be associated with poorer
clinical outcome (Nakagawara et al, 1994, Mol Cell Biol.
14:759-767). Co-expression of TrkB with its ligand BDNF could
generate a positive feedback loop through autocrine and paracrine
loops. Also TrkB truncations found in these tumors generate
activated forms of the intracellular protein tyrosine kinase. The
constitutively active TrkB signals through multiple pathways to
promote cancer initiation, progression and metastasis. These
truncated TrkB kinases were also found in hepatocellular carcinoma
(Yang et al, 2005, Cancer. Res 65:219-225). Thus TrkB inhibitors
could be used to treat a sub-population of cancer patients with an
activated TrkB pathway.
[0846] In patients with pancreatic cancer, TrkB expression is
correlated with perineural invasion, positive retroperitoneal
margin, and shorter latency to development of liver metastasis
(Sclabas et al, 2005, Clin. Cancer. Res VI 1:440-449).
Mechanistically, TrkB activates the PI3K pathway to suppress
anoikis (apoptosis resulting from loss of cell-matrix interactions)
which is one of the physiological barriers to metastasis. TrkB
kinase inhibition could break down resistance to anoikis of
metastasizing tumors (Douma et al, 2004, Nature 430:1034-9).
Therefore, TrkB inhibitors could have utility in a broad range of
tumor types.
[0847] Exemplary Diseases Associated with HGK
[0848] HGK:
[0849] Target kinase HGK (i.e., Hematopoietic progenitor
kinase/Germinal center kinase-like Kinase, aka mitogen-activated
protein kinase kinase kinase kinase 4) is a 130 kDa
serine/threonine kinase encoded by chromosome 2q11.2-q12 (symbol:
MAP4K4). It is a member of the human STE20/mitogen-activated
protein kinase kinase kinase kinase (MAP4K) family of
serine/threonine kinases and is the human ortholog of mouse NIK
(Nck-interacting kinase). The N-terminus of the mature HGK protein
has a catalytic kinase domain that shares 47% and 48% amino acid
sequence identity to the catalytic domain of Hematopoietic
progenitor kinase 1 (HPK1) and Germinal center kinase (GCK),
respectively. Yao et al. (J. Biol. Chem. 274: 2118-2125, 1999)
identified 2 HGK isoforms, one of which has no proline-rich
domains, and another, longer variant that contains such domains and
appears to be expressed in brain only. Northern blot analysis
revealed expression of 3 HGK transcripts of approximately 4.6, 6.5,
and 8.5 kb in heart, brain, skeletal muscle, pancreas, placenta,
liver, lung, and kidney. By Western blot analysis with a polyclonal
antibody, Yao et al. (J. Biol. Chem. 274; 2118-2125, 1999) found
that the 130-kD protein is expressed in multiple cell lines.
[0850] Expression of HGK in transfected cell lines resulted in
strong JNK activation and, in turn, c-jun transcriptional activity
(Yao et al. J. Biol. Chem. 274: 2118-2125, 1999). HGK-induced JNK
activation was inhibited by dominant-negative MAP2K4. MAP2K7, and
TAK1 mutants. TNF-alpha also stimulated HGK kinase activity. HGK
was identified as a putative effect of Rap2 to activate JNK
(Machida et al. J. Biol. Chem. 279: 15711-15714, 2004). This link
establishes HGK as a potential target for a range of metabolic
indications, since the JNK pathway clearly antagonizes insulin
signaling. An HGK inhibitor could re-sensitize fat and muscle cells
to insulin.
[0851] HGK is found to be broadly expressed in human tumor cells
and can modulate cellular transformation, invasion, and adhesion
(Wright et al. Mol. Cell. Biol. 23: 2068-2082, 2003). Wright et al
showed HGK to be highly expressed in most tumor cell lines relative
to normal tissue. An active role for this kinase in transformation
was suggested by an inhibition of H-Ras(V12)-induced focus
formation by expression of inactive, dominant-negative mutants of
HGK in both fibroblast and epithelial cell lines. Expression of an
inactive mutant of HGK also inhibited the anchorage-independent
growth of cells yet had no effect on proliferation in monolayer
culture. Expression of HGK mutants modulated integrin receptor
expression and had a striking effect on hepatocyte growth
factor-stimulated epithelial cell invasion. Together, these results
suggest an important role for HGK in cell transformation and
invasiveness. More recently, a small interfering RNA screen for
modulators of tumor cell motility identifies MAP4K4 as a
promigratory kinase (Collins et al. Proc. Natl. Acad. Sci. USA.
103: 3775-3780, 2006). Collins et al. showed that the knockdown of
the HGK transcript inhibited the migration of multiple carcinoma
cell lines, indicating a broad role in cell motility, and potently
suppressed the invasion of SKOV-3 cells in vitro. The effect of HGK
on cellular migration was found to be mediated through JNK kinase,
independent of AP activation and downstream transcription.
Accordingly, small molecule inhibition of c-Jun N-terminal kinase
suppressed SKOV-3 cell migration, underscoring the potential
therapeutic utility of mitogen-activated protein kinase pathway
inhibition in cancer progression (Collins et al. Proc. Natl. Acad.
Sci. USA. 103: 3775-3780, 2006). These studies strongly support HGK
as a target in a broad range of oncology indications. In
particular, an HGK inhibitor could have utility in blocking the
migration, invasion and metastasis in many different tumor
types.
[0852] Activation of T-cells by antigens initiates a complex series
of signal-transduction events that are critical for immune
responses. Mack et al. (Immunol. Lett. 96, 129-145, 2005) developed
a genetic screen to survey the functional roles of kinases in
antigen mediated T-cell activation and identified 19 protein
kinases that were previously implicated in T-cell signaling
processes and 12 kinases that were not previously linked to T-cell
activation, including HGK. siRNA studies showed a role for HGK in
antigen mediated T-cell responses in Jurkat and primary T-cells. In
addition, by analyzing multiple promoter elements using reporter
assays, Mack et al. have shown that MAP4K4 is implicated in the
activation of the TNF-alpha promoter. Therefore, inhibition of HGK
could have broad therapeutic utility for T-cell-mediated autoimmune
diseases.
[0853] Insulin-regulated glucose transporter GLUT4 is a key
modulator of whole body glucose homeostasis, and its selective loss
in adipose tissue or skeletal muscle causes insulin resistance and
diabetes. Using an RNA interference-based screen, Tang et al. (Proc
Natl Acad Sci USA. 103:2087-2092, 2006) found 4 negative regulators
of insulin-responsive glucose transport in mouse adipocytes: Pctk1,
Pftk1, Ikbka (CHUK), and HGK. HGK suppressed expression of
adipogenic transcription factors, C/EBPA, C/EBPB, and PPARG, and it
suppressed surface expression of GLUT4 (SLC2A4), resulting in
attenuated membrane hexose transport activity. RNA
interference-mediated depletion of HGK early in differentiation
enhanced adipogenesis and triglyceride deposition; in fully
differentiated adipocytes, loss of HGK upregulated GLUT4
expression. Conversely, conditions that inhibited adipogenesis,
such as TNF-alpha treatment or PPARG depletion, markedly
upregulated HGK. Tang et al. (Proc Natl Acad Sci USA.
103:2087-2092, 2006) concluded that MAP4K4-dependent signaling
inhibited PPARG-responsive gene expression, adipogenesis, and
insulin-stimulated glucose transport. Furthermore, TNF-alpha
signaling to down-regulate GLUT4 is impaired in the absence of HGK,
indicating that HOK expression is required for optimal TNF-alpha
action. This study further supports HOK as a target in metabolic
disease, and suggests a role for HGK inhibition in ameliorating the
pathology in adipocytes.
[0854] In a separate study (Bouzakri and Zierath J. Biol. Chem.
282:7783-7789, 2007), using small interfering RNA (siRNA) to
suppress the expression of HGK protein 85% in primary human
skeletal muscle cells, TNF-alpha-induced insulin resistance on
glucose uptake was completely prevented. HGK silencing inhibited
TNF-alpha-induced negative signaling inputs by preventing excessive
JNK and ERK-1/2 phosphorylation, as well as IRS-1 serine
phosphorylation. These results highlight the HGK/JNK/ERK/IRS module
in the negative regulation of insulin signaling to glucose
transport in response to TNF-alpha. Depletion of HGK also prevented
TNF-alpha-induced insulin resistance on AKT and the AKT substrate
160 (AS160), providing evidence that appropriate insulin signaling
inputs for glucose metabolism were rescued. The authors suggested
that strategies to inhibit HGK may be efficacious in the prevention
of TNF-alpha-induced inhibitory signals that cause skeletal muscle
insulin resistance on glucose metabolism in humans. Moreover, in
myotubes from insulin-resistant type II diabetic patients, siRNA
against HGK restored insulin action on glucose uptake to levels
observed in healthy subjects. This study further supports HGK as a
target in metabolic diseases such as type 11 diabetes, and suggests
a role for HGK inhibition in ameliorating the pathology in muscle
cells.
[0855] HGK inhibitors may be useful in treating metabolic
indications, including re-sensitizing fat and muscle cells to
insulin, ameliorating the pathology in adipocytes, ameliorating the
pathology in muscle cells, and type II diabetes; a broad range of
oncology indications, including blocking the migration, invasion
and metastasis in many different tumor types; and T-cell mediated
autoimmune diseases.
II. Production of c-Kit and c-Fms Related Polypeptides
[0856] The native and mutated kinase polypeptides described herein
may be chemically synthesized in whole or part using techniques
that are well-known in the art (see, e.g., Creighton (1983)
Biopolymers 22(1):49-58).
[0857] Alternatively, methods which are well known to those skilled
in the art can be used to construct expression vectors containing
the native or mutated kinase polypeptide coding sequence and
appropriate transcriptional/translational control signals. These
methods include in vitro recombinant DNA techniques, synthetic
techniques and in vivo recombination/genetic recombination. See,
for example, the techniques described in Maniatis, T (1989).
Molecular cloning: A laboratory Manual. Cold Spring Harbor
Laboratory, New York. Cold Spring Harbor Laboratory Press; and
Ausubel, F. M. et al. (1994) Current Protocols in Molecular
Biology. John Wiley & Sons, Secaucus, N.J.
[0858] A variety of host-expression vector systems may be utilized
to express the kinase coding sequence. These include but are not
limited to microorganisms such as bacteria transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing the kinase domain coding sequence; yeast
transformed with recombinant yeast expression vectors containing
the kinase domain coding sequence: insect cell systems infected
with recombinant virus expression vectors (e.g. baculovirus)
containing the kinase domain coding sequence; plant cell systems
infected with recombinant virus expression vectors (e.g.
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with recombinant plasmid expression vectors (e.g. Ti
plasmid) containing the kinase domain coding sequence; or animal
cell systems. The expression elements of these systems vary in
their strength and specificities.
[0859] Depending on the host/vector system utilized, any of a
number of suitable transcription and translation elements,
including constitutive and inducible promoters, may be used in the
expression vector. For example, when cloning in bacterial systems,
inducible promoters such as pL of bacteriophage .lamda., plac,
ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used;
when cloning in insect cell systems, promoters such as the
baculovirus polyhedrin promoter may be used; when cloning in plant
cell systems, promoters derived from the genome of plant cells
(e.g. heat shock promoters; the promoter for the small subunit of
RUBISCO; the promoter for the chlorophyll aib binding protein) or
from plant viruses (e.g. the 35S RNA promoter of CaMV; the coat
protein promoter of TMV) may be used; when cloning in mammalian
cell systems, promoters derived from the genome of mammalian cells
(e.g. metallothionein promoter) or from mammalian viruses (e.g. the
adenovirus late promoter; the vaccinia virus 7.5K promoter) may be
used; when generating cell lines that contain multiple copies of
the kinase domain DNA, SV4O-, BPV- and EBV-based vectors may be
used with an appropriate selectable marker.
[0860] Exemplary methods describing methods of DNA manipulation,
vectors, various types of cells used, methods of incorporating the
vectors into the cells, expression techniques, protein purification
and isolation methods, and protein concentration methods are
disclosed in detail in PCT publication WO 96/18738. This
publication is incorporated herein by reference in its entirety,
including any drawings. Those skilled in the art will appreciate
that such descriptions are applicable to the present invention and
can be easily adapted to it.
III. Binding Assays
[0861] The methods of the present invention can involve assays that
are able to detect the binding of compounds to a target molecule.
Such binding is at a statistically significant level, preferably
with a confidence level of at least 90%, more preferably at least
95, 97, 98, 99% or greater confidence level that the assay signal
represents binding to the target molecule, i.e. is distinguished
from background. Preferably controls are used to distinguish target
binding from non-specific binding. A large variety of assays
indicative of binding are known for different target types and can
be used for this invention.
[0862] Binding compounds can be characterized by their effect on
the activity of the target molecule. Thus, a "low activity"
compound has an inhibitory concentration (IC.sub.50) or effective
concentration (EC.sub.50) of greater than 1 .mu.M under standard
conditions. By "very low activity" is meant an IC.sub.50 r
EC.sub.50 of above 100 .mu.M under standard conditions. By
"extremely low activity" is meant an IC.sub.50 or EC.sub.50 of
above 1 mM under standard conditions. By "moderate activity" is
meant an IC.sub.50 or EC.sub.50 of 200 nM to 1 .mu.M under standard
conditions. By "moderately high activity" is meant an IC.sub.50 or
EC.sub.50 of 1 nM to 200 nM. By "high activity" is meant an
IC.sub.50 or EC.sub.50 of below 1 nM under standard conditions. The
IC.sub.50 or EC.sub.50 is defined as the concentration of compound
at which 50% of the activity of the target molecule (e.g. enzyme or
other protein) activity being measured is lost or gained relative
to the range of activity observed when no compound is present.
Activity can be measured using methods known to those of ordinary
skill in the art, e.g., by measuring any detectable product or
signal produced by occurrence of an enzymatic reaction, or other
activity by a protein being measured.
[0863] By "background signal" in reference to a binding assay is
meant the signal that is recorded under standard conditions for the
particular assay in the absence of a test compound, molecular
scaffold, or ligand that binds to the target molecule. Persons of
ordinary skill in the art will realize that accepted methods exist
and are widely available for determining background signal.
[0864] By "standard deviation" is meant the square root of the
variance. The variance is a measure of how spread out a
distribution is. It is computed as the average squared deviation of
each number from its mean. For example, for the numbers 1, 2, and
3, the mean is 2 and the variance is:
.sigma. 2 = ( 1 - 2 ) 2 + ( 2 - 2 ) 2 + ( 3 - 2 ) 2 3 = 0.667 .
##EQU00001##
[0865] Surface Plasmon Resonance
[0866] Binding parameters can be measured using surface plasmon
resonance, for example, with a BIAcore.RTM. chip (Biacore, Japan)
coated with immobilized binding components. Surface plasmon
resonance is used to characterize the microscopic association and
dissociation constants of reaction between an sFv or other ligand
directed against target molecules. Such methods are generally
described in the following references which are incorporated herein
by reference. Vely F. et al., (2000) BIAcore.RTM. analysis to test
phosphopeptide-SH2 domain interactions, Methods in Molecular
Biology. 121:313-21; Liparoto et al., (1999) Biosensor analysis of
the interleukin-2 receptor complex, Journal of Molecular
Recognition. 12:316-21; Lipschultz et al., (2000) Experimental
design for analysis of complex kinetics using surface plasmon
resonance, Methods. 20(3):310-8; Malmqvist., (1999) BIACORE: an
affinity biosensor system for characterization of biomolecular
interactions, Biochemical Society Transactions 27:335-40; Alfthan.
(1998) Surface plasmon resonance biosensors as a tool in antibody
engineering, Biosensors & Bioelectronics. 13:653-63; Fivash et
al., (1998) BIAcore for macromolecular interaction, Current Opinion
in Biotechnology. 9:97-101; Price et al.; (1998) Summary report on
the ISOBM TD-4 Workshop: analysis of 56 monoclonal antibodies
against the MUC1 mucin. Tumour Biology 19 Suppl 1:1-20; Malmqvist
et al, (1997) Biomolecular interaction analysis: affinity biosensor
technologies for functional analysis of proteins, Current Opinion
in Chemical Biology. 1:378-83; O'Shannessy et al., (1996)
Interpretation of deviations from pseudo-first-order kinetic
behavior in the characterization of ligand binding by biosensor
technology, Analytical Biochemistry. 236:275-83; Malmborg et al.,
(1995) BIAcore as a tool in antibody engineering, Journal of
Immunological Methods. 183:7-13; Van Regenmortel, (1994) Use of
biosensors to characterize recombinant proteins, Developments in
Biological Standardization. 83:143-51; and O'Shannessy, (1994)
Determination of kinetic rate and equilibrium binding constants for
macromolecular interactions: a critique of the surface plasmon
resonance literature, Current Opinions in Biotechnology.
5:65-71.
[0867] BIAcore.RTM. uses the optical properties of surface plasmon
resonance (SPR) to detect alterations in protein concentration
bound to a dextran matrix lying on the surface of a gold/glass
sensor chip interface, a dextran biosensor matrix. In brief,
proteins are covalently bound to the dextran matrix at a known
concentration and a ligand for the protein is injected through the
dextran matrix. Near infrared light, directed onto the opposite
side of the sensor chip surface is reflected and also induces an
evanescent wave in the gold film, which in turn, causes an
intensity dip in the reflected light at a particular angle known as
the resonance angle. If the refractive index of the sensor chip
surface is altered (e.g. by ligand binding to the bound protein) a
shift occurs in the resonance angle. This angle shift can be
measured and is expressed as resonance units (RUs) such that 1000
RUs is equivalent to a change in surface protein concentration of 1
ng/mm.sup.2. These changes are displayed with respect to time along
the y-axis of a sensorgram, which depicts the association and
dissociation of any biological reaction.
[0868] High Throughput Screening (HTS) Assays
[0869] HTS typically uses automated assays to search through large
numbers of compounds for a desired activity. Typically HTS assays
are used to find new drugs by screening for chemicals that act on a
particular enzyme or molecule. For example, if a chemical
inactivates an enzyme it might prove to be effective in preventing
a process in a cell which causes a disease. High throughput methods
enable researchers to assay thousands of different chemicals
against each target molecule very quickly using robotic handling
systems and automated analysis of results.
[0870] As used herein, "high throughput screening" or "HTS" refers
to the rapid in vitro screening of large numbers of compounds
(libraries); generally tens to hundreds of thousands of compounds,
using robotic screening assays. Ultra high-throughput Screening
(uHTS) generally refers to the high-throughput screening
accelerated to greater than 100,000 tests per day.
[0871] To achieve high-throughput screening, it is advantageous to
house samples on a multicontainer carrier or platform. A
multicontainer carrier facilitates measuring reactions of a
plurality of candidate compounds simultaneously. Multi-well
microplates may be used as the carrier. Such multi-well
microplates, and methods for their use in numerous assays, are both
known in the art and commercially available.
[0872] Screening assays may include controls for purposes of
calibration and confirmation of proper manipulation of the
components of the assay. Blank wells that contain all of the
reactants but no member of the chemical library are usually
included. As another example, a known inhibitor (or activator) of
an enzyme for which modulators are sought, can be incubated with
one sample of the assay, and the resulting decrease (or increase)
in the enzyme activity used as a comparator or control. It will be
appreciated that modulators can also be combined with the enzyme
activators or inhibitors to find modulators which inhibit the
enzyme activation or repression that is otherwise caused by the
presence of the known the enzyme modulator.
[0873] Measuring Enzymatic and Binding Reactions During Screening
Assays
[0874] Techniques for measuring the progression of enzymatic and
binding reactions. e.g. in multicontainer carriers, are known in
the art and include, but are not limited to, the following.
[0875] Spectrophotometric and spectrofluorometric assays are well
known in the art. Examples of such assays include the use of
colorimetric assays for the detection of peroxides, as described in
Gordon, A. J. and Ford, R. A., (1972) The Chemist's Companion: A
Handbook Of Practical Data. Techniques, And References, John Wiley
and Sons, N.Y., Page 437.
[0876] Fluorescence spectrometry may be used to monitor the
generation of reaction products. Fluorescence methodology is
generally more sensitive than the absorption methodology. The use
of fluorescent probes is well known to those skilled in the art.
For reviews, see Bashford et al., (1987) Spectrophotometry and
Spectrofluorometry: A Practical Approach, pp. 91-114, IRL Press
Ltd.; and Bell, (1981) Spectroscopy In Biochemistry, Vol. 1, pp.
155-194, CRC Press.
[0877] In spectrofluorometric methods, enzymes are exposed to
substrates that change their intrinsic fluorescence when processed
by the target enzyme. Typically, the substrate is nonfluorescent
and is converted to a fluorophore through one or more reactions. As
a non-limiting example, SMase activity can be detected using the
Amplex.RTM. Red reagent (Molecular Probes. Eugene, Oreg.). In order
to measure sphingomyelinase activity using Amplex.RTM. Red, the
following reactions occur. First, SMase hydrolyzes sphingomyelin to
yield ceramide and phosphorylcholine. Second, alkaline phosphatase
hydrolyzes phosphorylcholine to yield choline. Third, choline is
oxidized by choline oxidase to betaine. Finally, H.sub.2O.sub.2, in
the presence of horseradish peroxidase, reacts with Amplex.RTM. Red
to produce the fluorescent product, Resorufin, and the signal
therefrom is detected using spectrofluorometry.
[0878] Fluorescence polarization (FP) is based on a decrease in the
speed of molecular rotation of a fluorophore that occurs upon
binding to a larger molecule, such as a receptor protein, allowing
for polarized fluorescent emission by the bound ligand. FP is
empirically determined by measuring the vertical and horizontal
components of fluorophore emission following excitation with plane
polarized light. Polarized emission is increased when the molecular
rotation of a fluorophore is reduced. A fluorophore produces a
larger polarized signal when it is bound to a larger molecule (i.e.
a receptor), slowing molecular rotation of the fluorophore. The
magnitude of the polarized signal relates quantitatively to the
extent of fluorescent ligand binding. Accordingly, polarization of
the "bound" signal depends on maintenance of high affinity
binding.
[0879] FP is a homogeneous technology and reactions are very rapid,
taking seconds to minutes to reach equilibrium. The reagents are
stable, and large batches may be prepared, resulting in high
reproducibility. Because of these properties, FP has proven to be
highly automatable, often performed with a single incubation with a
single, premixed, tracer-receptor reagent. For a review, see Owicki
et al., (1997), Application of Fluorescence Polarization Assays in
High-Throughput Screening, Genetic Engineering News, 17:27.
[0880] FP is particularly desirable since its readout is
independent of the emission intensity (Checovich, W. J., et al.,
(1995) Nature 375:254-256; Dandliker, W. B., et al., (1981) Methods
in Enzymology 74:3-28) and is thus insensitive to the presence of
colored compounds that quench fluorescence emission. FP and FRET
(see below) are well-suited for identifying compounds that block
interactions between sphingolipid receptors and their ligands. See,
for example, Parker et al., (2000) Development of high throughput
screening assays using fluorescence polarization: nuclear
receptor-ligand-binding and kinase/phosphatase assays, J Biomol
Screen 5:77-88.
[0881] Fluorophores derived from sphingolipids that may be used in
FP assays are commercially available. For example. Molecular Probes
(Eugene, Oreg.) currently sells sphingomyelin and one ceramide
flurophores. These are, respectively.
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)sp-
hingosyl phosphocholine (BODIPY.RTM. FL C5-sphingomyelin);
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoyl)s-
phingosyl phosphocholine (BODIPY.RTM. FL C12-sphingomyelin); and
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)sp-
hingosine (BODIPY.RTM. FL C5-ceramide). U.S. Pat. No. 4,150,949,
(Immunoassay for gentamicin), discloses fluorescein-labelled
gentamicins, including fluoresceinthiocarbanyl gentamicin.
Additional fluorophores may be prepared using methods well known to
the skilled artisan.
[0882] Exemplary normal-and-polarized fluorescence readers include
the POLARION.RTM. fluorescence polarization system (Tecan AG.
Hombrechtikon, Switzerland). General multiwell plate readers for
other assays are available, such as the VERSAMAX.RTM. reader and
the SPECTRAMAX.RTM. multiwell plate spectrophotometer (both from
Molecular Devices).
[0883] Fluorescence resonance energy transfer (FRET) is another
useful assay for detecting interaction and has been described. See,
e.g., Heim et al., (1996) Curr. Biol. 6:178-182; Mitra et al.,
(1996) Gene 173:13-17; and Selvin et al., (1995) Meth. Enzymol.
246:300-345. FRET detects the transfer of energy between two
fluorescent substances in close proximity, having known excitation
and emission wavelengths. As an example, a protein can be expressed
as a fusion protein with green fluorescent protein (GFP). When two
fluorescent proteins are in proximity, such as when a protein
specifically interacts with a target molecule, the resonance energy
can be transferred from one excited molecule to the other. As a
result, the emission spectrum of the sample shifts, which can be
measured by a fluorometer, such as a fMAX multiwell fluorometer
(Molecular Devices, Sunnyvale Calif.).
[0884] Scintillation proximity assay (SPA) is a particularly useful
assay for detecting an interaction with the target molecule. SPA is
widely used in the pharmaceutical industry and has been described
(Hanselman et al., (1997) J. Lipid Res. 38:2365-2373; Kahl et al.,
(1996) Anal. Biochem. 243:282-283; Undenfriend et al., (1987) Anal.
Biochem. 161:494-500). See also U.S. Pat. Nos. 4,626,513 and
4,568,649, and European Patent No. 0,154,734. One commercially
available system uses FLASHPLATE.RTM. scintillant-coated plates
(NEN Life Science Products, Boston, Mass.).
[0885] The target molecule can be bound to the scintillator plates
by a variety of well known means. Scintillant plates are available
that are derivatized to bind to fusion proteins such as GST, His6
or Flag fusion proteins. Where the target molecule is a protein
complex or a multimer, one protein or subunit can be attached to
the plate first, then the other components of the complex added
later under binding conditions, resulting in a bound complex.
[0886] In a typical SPA assay, the gene products in the expression
pool will have been radiolabeled and added to the wells, and
allowed to interact with the solid phase, which is the immobilized
target molecule and scintillant coating in the wells. The assay can
be measured immediately or allowed to reach equilibrium. Either
way, when a radiolabel becomes sufficiently close to the
scintillant coating, it produces a signal detectable by a device
such as a TOPCOUNT NXT.RTM. microplate scintillation counter
(Packard BioScience Co., Meriden Conn.). If a radiolabeled
expression product binds to the target molecule, the radiolabel
remains in proximity to the scintillant long enough to produce a
detectable signal.
[0887] In contrast, the labeled proteins that do not bind to the
target molecule, or bind only briefly, will not remain near the
scintillant long enough to produce a signal above background. Any
time spent near the scintillant caused by random Brownian motion
will also not result in a significant amount of signal. Likewise,
residual unincorporated radiolabel used during the expression step
may be present, but will not generate significant signal because it
will be in solution rather than interacting with the target
molecule. These non-binding interactions will therefore cause a
certain level of background signal that can be mathematically
removed. If too many signals are obtained, salt or other modifiers
can be added directly to the assay plates until the desired
specificity is obtained (Nichols et al., (1998) Anal. Biochem.
257:112-119).
IV. Kinase Activity Assays
[0888] A number of different assays for kinase activity can be
utilized for assaying for active modulators and/or determining
specificity of a modulator for a particular kinase or group or
kinases. In addition to the assay mentioned in the Examples below,
one of ordinary skill in the art will know of other assays that can
be utilized and can modify an assay for a particular application.
For example, numerous papers concerning kinases described assays
that can be used.
[0889] Additional alternative assays can employ binding
determinations. For example, this sort of assay can be formatted
either in a fluorescence resonance energy transfer (FRET) format,
or using an AlphaScreen (amplified luminescent proximity
homogeneous assay) format by varying the donor and acceptor
reagents that are attached to streptavidin or the phospho-specific
antibody.
V. Organic Synthetic Techniques
[0890] A wide array of organic synthetic techniques exist in the
art to meet the challenge of constructing potential modulators.
Many of these organic synthetic methods are described in detail in
standard reference sources utilized by those skilled in the art.
One example of such a reference is March, 1994, Advanced Organic
Chemistry, Reactions, Mechanisms and Structure, New York, McGraw
Hill. Thus, the techniques useful to synthesize a potential
modulator of kinase function are readily available to those skilled
in the art of organic chemical synthesis.
[0891] Regarding the synthetic examples described herein, solvents
include polar and non-polar solvents known to those of skill in the
art, including polar aprotic and polar protic solvents. Polar
solvents include, without limitation, protic solvents such as
methanol, ethanol, isopropyl alcohol, t-butanol, n-butanol, acetic
acid, formic acid or water, or aprotic solvents such as
tetrahydrofuran (THF), acetonitrile, dioxane, methylene chloride,
dimethylsulfoxide (DMSO), acetone, N,N-dimethylformamide (DMF),
N,N-dimethylacetamide (DMA), ethyl acetate, 1,2-dimethoxyethane,
1,2-dichloroethane, chloroform, 1,2-dichloroethane, or pyridine.
Polar solvents include a mixture of water with any of the above, or
a mixture of any two or more of the above. A polar solvents
include, without limitation, toluene, benzene, chlorobenzene,
xylenes and hexanes.
[0892] Regarding the synthetic examples described herein, reducing
agent includes, without limitation, a reducing agent such as
catalytic reducing agents using hydrogen and transition metal
catalysts such as palladium, platinum, rhodium, etc. (e.g.
Pt/acetic acid/H.sub.2); a mixture of trifluoroacetic acid and
triethylsilane, borane tetrahydrofuran complex, diborane, borane
dimethylsulfide complex, and a combination of sodium borohydride
and boron trifluoride; metals such as reduced iron, zinc powder,
magnesium etc.; metal hydrogen complex compounds such as alkali
metal borohydrides (for example, potassium borohydride, sodium
borohydride, lithium borohydride, zinc borohydride, sodium
triacetoxyborohydride, etc.), aluminum lithium hydride, etc.; metal
hydrides such as sodium hydride, etc.; organic tin compounds
(triphenyltin hydride, etc.); and metal salts such as nickel
compounds, zinc compounds, tin compounds (for example tin(II)
chloride), and samarium iodide/pivalic acid/hexamethylphorphoric
triamide.
[0893] Regarding the synthetic examples described herein, oxidizing
agent includes, without limitation, an oxidizing agent such as
Dess-Martin reagent, TEMPO (2,2,6,6-tetramethylpiperidine-N-oxide).
DDQ (2,3-Dichloro-5,6-dicyano-1,4-benzoquinone), PDC (pyridinium
dichromate), PCC (pyridinium chlorochromate). Pyridine.SO3,
Chromium trioxide, p-nitroperbenzoic acid, magnesium
monoperoxyphthalate, sodium periodate, potassium periodate,
hydrogen peroxide, urea peroxide, alkali metal bromates, cumene
hydroperoxide, tert-butyl peroxide, peracids such as performic
acid, peracetic acid, pertrifluoroacetic acid, perbenzoic acid,
m-chloroperbenzoic acid, o-carboxyperbenzoic acid and the like;
sodium metaperiodate, bichromic acid: bichromates such as sodium
bichromate, potassium bichromate; permanganic acid; permanganates
such as potassium permanganate, sodium permanganate; and lead salts
such as lead tetraacetate.
VI. Alternative Compound Forms or Derivatives
[0894] (a) Isomers, Prodrugs, and Active Metabolites
[0895] Compounds contemplated herein are described with reference
to both generic formulae and specific compounds. In addition, the
invention compounds may exist in a number of different forms or
derivatives, all within the scope of the present invention. These
include, for example, tautomers, stereoisomers, racemic mixtures,
regioisomers, salts, prodrugs (e.g. carboxylic acid esters),
solvated forms, different crystal forms or polymorphs, and active
metabolites.
[0896] (b) Tautomers, Stereoisomers, Regioisomers, and Solvated
Forms
[0897] It is understood that some compounds may exhibit
tautomerism. In such cases, the formulae provided herein expressly
depict only one of the possible tautomeric forms. It is therefore
to be understood that the formulae provided herein are intended to
represent any tautomeric form of the depicted compounds and are not
to be limited merely to the specific tautomeric form depicted by
the drawings of the formulae.
[0898] Likewise, some of the compounds according to the present
invention may exist as stereoisomers, i.e. having the same atomic
connectivity of covalently bonded atoms yet differing in the
spatial orientation of the atoms. For example, compounds may be
optical stereoisomers, which contain one or more chiral centers,
and therefore, may exist in two or more stereoisomeric forms (e.g.
enantiomers or diastereomers). Thus, such compounds may be present
as single stereoisomers (i.e., essentially free of other
stereoisomers), racemates, and/or mixtures of enantiomers and/or
diastereomers. As another example, stereoisomers include geometric
isomers, such as cis- or trans-orientation of substituents on
adjacent carbons of a double bond. All such single stereoisomers,
racemates and mixtures thereof are intended to be within the scope
of the present invention. Unless specified to the contrary, all
such stereoisomeric forms are included within the formulae provided
herein.
[0899] In some embodiments, a chiral compound of the present
invention is in a form that contains at least 80% of a single
isomer (60% enantiomeric excess ("e.e.") or diastereomeric excess
("d.e.")), or at least 85% (70% e.e. or d.e.), 90% (80% e.e. or
d.e.), 95% (90% e.e. or d.e.). 97.5% (95% e.e. or d.e.), or 99%
(98% e.e. or d.e.). As generally understood by those skilled in the
art, an optically pure compound having one chiral center is one
that consists essentially of one of the two possible enantiomers
(i.e., is enantiomerically pure), and an optically pure compound
having more than one chiral center is one that is both
diastereomerically pure and enantiomerically pure. In some
embodiments, the compound is present in optically pure form.
[0900] For compounds in which synthesis involves addition of a
single group at a double bond, particularly a carbon-carbon double
bond, the addition may occur at either of the double bond-linked
atoms. For such compounds, the present invention includes both such
regioisomers.
[0901] Additionally, the formulae are intended to cover solvated as
well as unsolvated forms of the identified structures. For example,
the indicated structures include both hydrated and non-hydrated
forms. Other examples of solvates include the structures in
combination with a suitable solvent such as isopropanol, ethanol,
methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine.
[0902] (c) Prodrugs and Metabolites
[0903] In addition to the present formulae and compounds described
herein, the invention also includes prodrugs (generally
pharmaceutically acceptable prodrugs), active metabolic derivatives
(active metabolites), and their pharmaceutically acceptable
salts.
[0904] Prodrugs are compounds or pharmaceutically acceptable salts
thereof which, when metabolized under physiological conditions or
when converted by solvolysis, yield the desired active compound.
Prodrugs include, without limitation, esters, amides, carbamates,
carbonates, ureides, solvates, or hydrates of the active compound.
Typically, the prodrug is inactive, or less active than the active
compound, but may provide one or more of advantageous handling,
administration, and/or metabolic properties. For example, some
prodrugs are esters of the active compound; during metabolysis, the
ester group is cleaved to yield the active drug. Also, some
prodrugs are activated enzymatically to yield the active compound,
or a compound which, upon further chemical reaction, yields the
active compound.
[0905] In this context, a common example of a prodrug is an alkyl
ester of a carboxylic acid. Relative to compounds of Formula I,
Formula Ia, Formula Ib, Formula Ig, Formula II, Formula IIa,
Formula IIb, Formula IIc, Formula IId, Formula IIe, Formula IIf,
Formula IIg, Formula IIh, Formula IIi, Formula IIj, Formula IIk,
Formula IIm, Formula IIn, Formula IIo, Formula IIp, or Formula III,
further examples include, without limitation, an amide or carbamate
derivative at the pyrrole nitrogen (i.e. N1) of the azaindole
core.
[0906] As described in The Practice of Medicinal Chemistry, Ch.
31-32 (Ed. Wermnuth, Academic Press, San Diego, Calif., 2001),
prodrugs can be conceptually divided into two non-exclusive
categories, bioprecursor prodrugs and carrier prodrugs. Generally,
bioprecursor prodrugs are compounds that are inactive or have low
activity compared to the corresponding active drug compound, that
contain one or more protective groups and are converted to an
active form by metabolism or solvolysis. Both the active drug form
and any released metabolic products should have acceptably low
toxicity. Typically, the formation of active drug compound involves
a metabolic process or reaction that is one of the follow
types:
[0907] Oxidative Reactions:
[0908] Oxidative reactions are exemplified without limitation to
reactions such as oxidation of alcohol, carbonyl, and acid
functionalities, hydroxylation of aliphatic carbons, hydroxylation
of alicyclic carbon atoms, oxidation of aromatic carbon atoms,
oxidation of carbon-carbon double bonds, oxidation of
nitrogen-containing functional groups, oxidation of silicon,
phosphorus, arsenic, and sulfur, oxidative N-dealkylation,
oxidative O- and S-dealkylation, oxidative deamination, as well as
other oxidative reactions.
[0909] Reductive Reactions:
[0910] Reductive reactions are exemplified without limitation to
reactions such as reduction of carbonyl functionalities, reduction
of alcohol functionalities and carbon-carbon double bonds,
reduction of nitrogen-containing functional groups, and other
reduction reactions.
[0911] Reactions without Change in the Oxidation State:
[0912] Reactions without change in the state of oxidation are
exemplified without limitation to reactions such as hydrolysis of
esters and ethers, hydrolytic cleavage of carbon-nitrogen single
bonds, hydrolytic cleavage of non-aromatic heterocycles, hydration
and dehydration at multiple bonds, new atomic linkages resulting
from dehydration reactions, hydrolytic dehalogenation, removal of
hydrogen halide molecule, and other such reactions.
[0913] Carrier prodrugs are drug compounds that contain a transport
moiety, e.g., that improves uptake and/or localized delivery to a
site(s) of action. Desirably for such a carrier prodrug, the
linkage between the drug moiety and the transport moiety is a
covalent bond, the prodrug is inactive or less active than the drug
compound, the prodrug and any release transport moiety are
acceptably non-toxic. For prodrugs where the transport moiety is
intended to enhance uptake, typically the release of the transport
moiety should be rapid. In other cases, it is desirable to utilize
a moiety that provides slow release, e.g., certain polymers or
other moieties, such as cyclodextrins. (See, e.g., Cheng et al.,
U.S. Patent Publ. No. 2004/0077595, Application Ser. No.
10/656,838, incorporated herein by reference.) Such carrier
prodrugs are often advantageous for orally administered drugs.
Carrier prodrugs can, for example, be used to improve one or more
of the following properties: increased lipophilicity, increased
duration of pharmacological effects, increased site-specificity,
decreased toxicity and adverse reactions, and/or improvement in
drug formulation (e.g. stability, water solubility, suppression of
an undesirable organoleptic or physiochemical property). For
example, lipophilicity can be increased by esterification of
hydroxyl groups with lipophilic carboxylic acids, or of carboxylic
acid groups with alcohols, e.g., aliphatic alcohols. Wermuth,
supra.
[0914] Prodrugs may proceed from prodrug form to active form in a
single step or may have one or more intermediate forms which may
themselves have activity or may be inactive.
[0915] Metabolites, e.g., active metabolites, overlap with prodrugs
as described above, e.g., bioprecursor prodrugs. Thus, such
metabolites are pharmacologically active compounds or compounds
that further metabolize to pharmacologically active compounds that
are derivatives resulting from metabolic process in the body of a
subject. Of these, active metabolites are such pharmacologically
active derivative compounds. For prodrugs, the prodrug compound is
generally inactive or of lower activity than the metabolic product.
For active metabolites, the parent compound may be either an active
compound or may be an inactive prodrug.
[0916] Prodrugs and active metabolites may be identified using
routine techniques known in the art. See, e.g., Bertolini et al.,
1997, J. Med. Chem., 40:2011-2016; Shan et al., 1997, J Pharm Sci
86(7):756-757; Bagshawc. 1995, Drug Dev. Res., 34:220-230; Wermuth,
supra.
[0917] (d) Pharmaceutically Acceptable Salts
[0918] Compounds can be formulated as or be in the form of
pharmaceutically acceptable salts. Contemplated pharmaceutically
acceptable salt forms include, without limitation, mono, bis, tris,
tetrakis, and so on. Pharmaceutically acceptable salts are
non-toxic in the amounts and concentrations at which they are
administered. The preparation of such salts can facilitate the
pharmacological use by altering the physical characteristics of a
compound without preventing it from exerting its physiological
effect. Useful alterations in physical properties include lowering
the melting point to facilitate transmucosal administration and
increasing the solubility to facilitate administering higher
concentrations of the drug.
[0919] Pharmaceutically acceptable salts include acid addition
salts such as those containing sulfate, chloride, hydrochloride,
fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate,
tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate,
p-toluenesulfonate, cyclohexylsulfamate and quinate.
Pharmaceutically acceptable salts can be obtained from acids such
as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid,
sulfamic acid, acetic acid, citric acid, lactic acid, tartaric
acid, malonic acid, methanesulfonic acid, ethanesulfonic acid,
benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic
acid, fumaric acid, and quinic acid.
[0920] Pharmaceutically acceptable salts also include basic
addition salts such as those containing benzathine, chloroprocaine,
choline, diethanolamine, ethanolamine, t-butylamine,
ethylenediamine, meglumine, procaine, aluminum, calcium, lithium,
magnesium, potassium, sodium, ammonium, alkylamine, and zinc, when
acidic functional groups, such as carboxylic acid or phenol are
present. For example, see Remington's Pharmaceutical Sciences,
19.sup.th ed., Mack Publishing Co., Easton, Pa., Vol. 2, p. 1457,
1995. Such salts can be prepared using the appropriate
corresponding bases.
[0921] Pharmaceutically acceptable salts can be prepared by
standard techniques. For example, the free-base form of a compound
can be dissolved in a suitable solvent, such as an aqueous or
aqueous-alcohol solution containing the appropriate acid and then
isolated by evaporating the solution. In another example, a salt
can be prepared by reacting the free base and acid in an organic
solvent.
[0922] Thus, for example, if the particular compound is a base, the
desired pharmaceutically acceptable salt may be prepared by any
suitable method available in the art, for example, treatment of the
free base with an inorganic acid, such as hydrochloric acid,
hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and
the like, or with an organic acid, such as acetic acid, maleic
acid, succinic acid, mandelic acid, fumaric acid, malonic acid,
pyruvic acid, oxalic acid, glycolic acid, salicylic acid, a
pyranosidyl acid, such as glucuronic acid or galacturonic acid, an
alpha-hydroxy acid, such as citric acid or tartaric acid, an amino
acid, such as aspartic acid or glutamic acid, an aromatic acid,
such as benzoic acid or cinnamic acid, a sulfonic acid, such as
p-toluenesulfinic acid or ethanesulfonic acid, or the like.
[0923] Similarly, if the particular compound is an acid, the
desired pharmaceutically acceptable salt may be prepared by any
suitable method, for example, treatment of the free acid with an
inorganic or organic base, such as an amine (primary, secondary or
tertiary), an alkali metal hydroxide or alkaline earth metal
hydroxide, or the like. Illustrative examples of suitable salts
include organic salts derived from amino acids, such as L-glycine,
L-lysine, and L-arginine, ammonia, primary, secondary, and tertiary
amines, and cyclic amines, such as hydroxyethylpyrrolidine,
piperidine, morpholine or piperazine, and inorganic salts derived
from sodium, calcium, potassium, magnesium, manganese, iron,
copper, zinc, aluminum and lithium.
[0924] The pharmaceutically acceptable salt of the different
compounds may be present as a complex. Examples of complexes
include 8-chlorotheophylline complex (analogous to, e.g.,
dimenhydrinate: diphenhydramine 8-chlorotheophylline (1:1) complex;
Dramamine) and various cyclodextrin inclusion complexes.
[0925] Unless specified to the contrary, specification of a
compound herein includes pharmaceutically acceptable salts of such
compound.
[0926] (e) Polymorphic Forms
[0927] In the case of agents that are solids, it is understood by
those skilled in the art that the compounds and salts may exist in
different crystal or polymorphic forms, all of which are intended
to be within the scope of the present invention and specified
formulae.
VII. Administration
[0928] The methods and compounds will typically be used in therapy
for human subjects. However, they may also be used to treat similar
or identical indications in other animal subjects. In this context,
the terms "subject," "animal subject," and the like refer to human
and non-human vertebrates, e.g. mammals, such as non-human
primates, sports and commercial animals, e.g., equines, bovines,
porcines, ovines, rodents, and pets, e.g., canines and felines.
[0929] Suitable dosage forms, in part, depend upon the use or the
route of administration, for example, oral, transdermal,
transmucosal, inhalant, or by injection (parenteral). Such dosage
forms should allow the compound to reach target cells. Other
factors are well known in the art, and include considerations such
as toxicity and dosage forms that retard the compound or
composition from exerting its effects. Techniques and formulations
generally may be found in The Science and Practice of Pharmacy,
21.sup.st edition, Lippincott, Williams and Wilkins, Philadelphia,
Pa., 2005 (hereby incorporated by reference herein).
[0930] Compounds of the present invention (i.e. Formula I, Formula
Ia, Formula Ib, Formula Ig, Formula II, Formula IIa, Formula IIb,
Formula IIc, Formula IId, Formula IIe, Formula IIf, Formula IIg,
Formula IIh, Formula IIi, Formula IIj, Formula IIk, Formula IIm,
Formula IIn, Formula IIo, Formula IIp, or Formula III, and all
sub-embodiments disclosed herein) can be formulated as
pharmaceutically acceptable salts.
[0931] Carriers or excipients can be used to produce compositions.
The carriers or excipients can be chosen to facilitate
administration of the compound. Examples of carriers include
calcium carbonate, calcium phosphate, various sugars such as
lactose, glucose, or sucrose, or types of starch, cellulose
derivatives, gelatin, vegetable oils, polyethylene glycols and
physiologically compatible solvents. Examples of physiologically
compatible solvents include sterile solutions of water for
injection (WFI), saline solution, and dextrose.
[0932] The compounds can be administered by different routes
including intravenous, intraperitoneal, subcutaneous,
intramuscular, oral, transmucosal, rectal, transdermal, or
inhalant. In some embodiments, oral administration is preferred.
For oral administration, for example, the compounds can be
formulated into conventional oral dosage forms such as capsules,
tablets, and liquid preparations such as syrups, elixirs, and
concentrated drops.
[0933] For inhalants, compounds of the invention may be formulated
as dry powder or a suitable solution, suspension, or aerosol.
Powders and solutions may be formulated with suitable additives
known in the art. For example, powders may include a suitable
powder base such as lactose or starch, and solutions may comprise
propylene glycol, sterile water, ethanol, sodium chloride and other
additives, such as acid, alkali and buffer salts. Such solutions or
suspensions may be administered by inhaling via spray, pump,
atomizer, or nebulizer, and the like. The compounds of the
invention may also be used in combination with other inhaled
therapies, for example corticosteroids such as fluticasone
propionate, beclomethasone dipropionate, triamcinolone acetonide,
budesonide, and mometasone furoate; beta agonists such as
albuterol, salmeterol, and formoterol; anticholinergic agents such
as ipratropium bromide or tiotropium; vasodilators such as
treprostinal and iloprost; enzymes such as DNAase; therapeutic
proteins; immunoglobulin antibodies: an oligonucleotide, such as
single or double stranded DNA or RNA, siRNA; antibiotics such as
tobramycin; muscarinic receptor antagonists; leukotriene
antagonists; cytokine antagonists; protease inhibitors; cromolyn
sodium; nedocril sodium; and sodium cromoglycate.
[0934] Pharmaceutical preparations for oral use can be obtained,
for example, by combining the active compounds with solid
excipients, optionally grinding a resulting mixture, and processing
the mixture of granules, after adding suitable auxiliaries, if
desired, to obtain tablets or dragee cores. Suitable excipients
are, in particular, fillers such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose (CMC),
and/or polyvinylpyrrolidone (PVP: povidone). If desired,
disintegrating agents may be added, such as the cross-linked
polyvinylpyrrolidone, agar, or alginic acid, or a salt thereof such
as sodium alginate.
[0935] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain, for example, gum arabic, talc,
poly-vinylpyrrolidone, carbopol gel, polyethylene glycol (PEG),
and/or titanium dioxide, lacquer solutions, and suitable organic
solvents or solvent mixtures. Dye-stuffs or pigments may be added
to the tablets or dragee coatings for identification or to
characterize different combinations of active compound doses.
[0936] Pharmaceutical preparations that can be used orally include
push-fit capsules made of gelatin ("gelcaps"), as well as soft,
sealed capsules made of gelatin, and a plasticizer, such as
glycerol or sorbitol. The push-fit capsules can contain the active
ingredients in admixture with filler such as lactose, binders such
as starches, and/or lubricants such as talc or magnesium stearate
and, optionally, stabilizers. In soft capsules, the active
compounds may be dissolved or suspended in suitable liquids, such
as fatty oils, liquid paraffin, or liquid polyethylene glycols
(PEGs). In addition, stabilizers may be added.
[0937] Alternatively, injection (parenteral administration) may be
used, e.g., intramuscular, intravenous, intraperitoneal, and/or
subcutaneous. For injection, the compounds of the invention are
formulated in sterile liquid solutions, preferably in
physiologically compatible buffers or solutions, such as saline
solution, Hank's solution, or Ringer's solution. In addition, the
compounds may be formulated in solid form and redissolved or
suspended immediately prior to use. Lyophilized forms can also be
produced.
[0938] Administration can also be by transmucosal, topical,
transdermal, or inhalant means. For transmucosal, topical or
transdermal administration, penetrants appropriate to the barrier
to be permeated are used in the formulation. Such penetrants are
generally known in the art, and include, for example, for
transmucosal administration, bile salts and fusidic acid
derivatives. In addition, detergents may be used to facilitate
permeation. Transmucosal administration, for example, may be
through nasal sprays or suppositories (rectal or vaginal).
[0939] The topical compositions of this invention are formulated
preferably as oils, creams, lotions, ointments, and the like by
choice of appropriate carriers known in the art. Suitable carriers
include vegetable or mineral oils, white petrolatum (white soft
paraffin), branched chain fats or oils, animal fats and high
molecular weight alcohol (greater than C.sub.12). The preferred
carriers are those in which the active ingredient is soluble.
Emulsifiers, stabilizers, humectants and antioxidants may also be
included as well as agents imparting color or fragrance, if
desired. Creams for topical application are preferably formulated
from a mixture of mineral oil, self-emulsifying beeswax and water
in which mixture the active ingredient, dissolved in a small amount
solvent (e.g. an oil), is admixed. Additionally, administration by
transdermal means may comprise a transdermal patch or dressing such
as a bandage impregnated with an active ingredient and optionally
one or more carriers or diluents known in the art. To be
administered in the form of a transdermal delivery system, the
dosage administration will, of course, be continuous rather than
intermittent throughout the dosage regimen.
[0940] The amounts of various compounds to be administered can be
determined by standard procedures taking into account factors such
as the compound IC.sub.50, the biological half-life of the
compound, the age, size, and weight of the subject, and the
indication being treated. The importance of these and other factors
are well known to those of ordinary skill in the art. Generally, a
dose will be between about 0.01 and 50 mg/kg, preferably 0.1 and 20
mg/kg of the subject being treated. Multiple doses may be used.
[0941] The compounds of the invention may also be used in
combination with other therapies for treating the same disease.
Such combination use includes administration of the compounds and
one or more other therapeutics at different times, or
co-administration of the compound and one or more other therapies.
In some embodiments, dosage may be modified for one or more of the
compounds of the invention or other therapeutics used in
combination, e.g., reduction in the amount dosed relative to a
compound or therapy used alone, by methods well known to those of
ordinary skill in the art.
[0942] It is understood that use in combination includes use with
other therapies, drugs, medical procedures etc., where the other
therapy or procedure may be administered at different times (e.g.
within a short time, such as within hours (e.g. 1, 2, 3, 4-24
hours), or within a longer time (e.g. 1-2 days, 2-4 days, 4-7 days,
1-4 weeks)) than a compound of the present invention, or at the
same time as a compound of the invention. Use in combination also
includes use with a therapy or medical procedure that is
administered once or infrequently, such as surgery, along with a
compound of the invention administered within a short time or
longer time before or after the other therapy or procedure. In some
embodiments, the present invention provides for delivery of
compounds of the invention and one or more other drug therapeutics
delivered by a different route of administration or by the same
route of administration. The use in combination for any route of
administration includes delivery of compounds of the invention and
one or more other drug therapeutics delivered by the same route of
administration together in any formulation, including formulations
where the two compounds are chemically linked in such a way that
they maintain their therapeutic activity when administered. In one
aspect, the other drug therapy may be co-administered with one or
more compounds of the invention. Use in combination by
co-administration includes administration of co-formulations or
formulations of chemically joined compounds, or administration of
two or more compounds in separate formulations within a short time
of each other (e.g. within an hour, 2 hours, 3 hours, up to 24
hours), administered by the same or different routes.
Co-administration of separate formulations includes
co-administration by delivery via one device, for example the same
inhalant device, the same syringe, etc., or administration from
separate devices within a short time of each other. Co-formulations
of compounds of the invention and one or more additional drug
therapies delivered by the same route includes preparation of the
materials together such that they can be administered by one
device, including the separate compounds combined in one
formulation, or compounds that are modified such that they are
chemically joined, yet still maintain their biological activity.
Such chemically joined compounds may have a linkage that is
substantially maintained in vivo, or the linkage may break down in
vivo, separating the two active components.
VIII. Manipulation of c-Kit and c-Fms
[0943] As the full-length coding sequence and amino acid sequence
of c-kit and c-fms from various mammals including human is known,
cloning, construction of recombinant c-kit and c-fms, production
and purification of recombinant protein, introduction of c-kit or
c-fms into other organisms, and other molecular biological
manipulations of c-kit and c-fms are readily performed.
[0944] Techniques for the manipulation of nucleic acids, such as,
e.g., subcloning, labeling probes (e.g. random-primer labeling
using Klenow polymerase, nick translation, amplification),
sequencing, hybridization and the like are well disclosed in the
scientific and patent literature, see, e.g., Sambrook, ed.,
Molecular Cloning: a Laboratory Manual (2nd ed.), Vols. 1-3, Cold
Spring Harbor Laboratory, (1989); Current Protocols in Molecular
Biology, Ausubel, ed. John Wiley & Sons, Inc. New York (1997);
Laboratory Techniques in Biochemistry and Molecular Biology:
Hybridization With Nucleic Acid Probes, Part 1. Theory and Nucleic
Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
[0945] Nucleic acid sequences can be amplified as necessary for
further use using amplification methods, such as PCR, isothermal
methods, rolling circle methods, etc., are well known to the
skilled artisan. See, e.g., Saiki, "Amplification of Genomic DNA"
in PCR Protocols, Innis et al., Eds., Academic Press, San Diego,
Calif. 1990, pp 13-20; Wharam et al., Nucleic Acids Res. 2001 Jun.
1; 29(11):E54-E54; Hafner et al., Biotechniques 2001 April;
30(4):852-6, 858, 860 passim; Zhong et al., Biotechniques 2001
April; 30(4):852-6, 858, 860 passim.
[0946] Nucleic acids, vectors, capsids, polypeptides, and the like
can be analyzed and quantified by any of a number of general means
well known to those of skill in the art. These include, e.g.,
analytical biochemical methods such as NMR, spectrophotometry,
radiography, electrophoresis, capillary electrophoresis, high
performance liquid chromatography (HPLC), thin layer chromatography
(TLC), and hyperdiffusion chromatography, various immunological
methods, e.g. fluid or gel precipitin reactions, immunodiffusion,
immuno-electrophoresis, radioimmunoassays (RIAs), enzyme-linked
immunosorbent assays (ELISAs), immuno-fluorescent assays, Southern
analysis, Northern analysis, dot-blot analysis, gel electrophoresis
(e.g. SDS-PAGE), nucleic acid or target or signal amplification
methods, radiolabeling, scintillation counting, and affinity
chromatography.
[0947] Obtaining and manipulating nucleic acids used to practice
the methods of the invention can be performed by cloning from
genomic samples, and, if desired, screening and re-cloning inserts
isolated or amplified from, e.g., genomic clones or cDNA clones.
Sources of nucleic acid used in the methods of the invention
include genomic or cDNA libraries contained in, e.g., mammalian
artificial chromosomes (MACs), see, e.g., U.S. Pat. Nos. 5,721,118;
6,025,155; human artificial chromosomes, see, e.g., Rosenfeld
(1997) Nat. Genet. 15:333-335; yeast artificial chromosomes (YAC);
bacterial artificial chromosomes (BAC); P1 artificial chromosomes,
see, e.g., Woon (1998) Genomics 50:306-316; P1-derived vectors
(PACs), see, e.g., Kern (1997) Biotechniques 23:120-124; cosmids,
recombinant viruses, phages or plasmids.
[0948] The nucleic acids used to practice the methods of the
invention can be operatively linked to a promoter. A promoter can
be one motif or an array of nucleic acid control sequences which
direct transcription of a nucleic acid. A promoter can include
necessary nucleic acid sequences near the start site of
transcription, such as, in the case of a polymerase II type
promoter, a TATA element. A promoter also optionally includes
distal enhancer or repressor elements which can be located as much
as several thousand base pairs from the start site of
transcription. A "constitutive" promoter is a promoter which is
active under most environmental and developmental conditions. An
"inducible" promoter is a promoter which is under environmental or
developmental regulation. A "tissue specific" promoter is active in
certain tissue types of an organism, but not in other tissue types
from the same organism. The term "operably linked" refers to a
functional linkage between a nucleic acid expression control
sequence (such as a promoter, or array of transcription factor
binding sites) and a second nucleic acid sequence, wherein the
expression control sequence directs transcription of the nucleic
acid corresponding to the second sequence.
[0949] The nucleic acids used to practice the methods of the
invention can also be provided in expression vectors and cloning
vehicles. e.g. sequences encoding the polypeptides used to practice
the methods of the invention. Expression vectors and cloning
vehicles used to practice the methods of the invention can comprise
viral particles, baculovirus, phage, plasmids, phagemids, cosmids,
fosmids, bacterial artificial chromosomes, viral DNA (e.g.
vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives
of SV40), P1-based artificial chromosomes, yeast plasmids, yeast
artificial chromosomes, and any other vectors specific for specific
hosts of interest (such as bacillus, Aspergillus and yeast).
Vectors used to practice the methods of the invention can include
chromosomal, non-chromosomal and synthetic DNA sequences. Large
numbers of suitable vectors are known to those of skill in the art,
and are commercially available.
[0950] The nucleic acids used to practice the methods of the
invention can be cloned, if desired, into any of a variety of
vectors using routine molecular biological methods; methods for
cloning in vitro amplified nucleic acids are disclosed, e.g., U.S.
Pat. No. 5,426,039. To facilitate cloning of amplified sequences,
restriction enzyme sites can be "built into" a PCR primer pair.
Vectors may be introduced into a genome or into the cytoplasm or a
nucleus of a cell and expressed by a variety of conventional
techniques, well described in the scientific and patent literature.
See, e.g., Roberts (1987) Nature 328:731; Schneider (1995) Protein
Expr. Purif. 6435:10; Sambrook, Tijssen or Ausubel. The vectors can
be isolated from natural sources, obtained from such sources as
ATCC or GenBank libraries, or prepared by synthetic or recombinant
methods. For example, the nucleic acids used to practice the
methods of the invention can be expressed in expression cassettes,
vectors or viruses which are stably or transiently expressed in
cells (e.g. episomal expression systems). Selection markers can be
incorporated into expression cassettes and vectors to confer a
selectable phenotype on transformed cells and sequences. For
example, selection markers can code for episomal maintenance and
replication such that integration into the host genome is not
required.
[0951] In one aspect, the nucleic acids used to practice the
methods of the invention are administered in vivo for in situ
expression of the peptides or polypeptides used to practice the
methods of the invention. The nucleic acids can be administered as
"naked DNA" (see, e.g., U.S. Pat. No. 5,580,859) or in the form of
an expression vector. e.g., a recombinant virus. The nucleic acids
can be administered by any mute, including peri- or
intra-tumorally, as described below. Vectors administered in vivo
can be derived from viral genomes, including recombinantly modified
enveloped or non-enveloped DNA and RNA viruses, preferably selected
from baculoviridiae, parvoviridiae, picornoviridiae,
herpesveridiae, poxviridae, adenoviridiae, or picornnaviridiae.
Chimeric vectors may also be employed which exploit advantageous
merits of each of the parent vector properties (See e.g., Feng
(1997) Nature Biotechnology 15:866-870). Such viral genomes may be
modified by recombinant DNA techniques to include the nucleic acids
used to practice the methods of the invention; and may be further
engineered to be replication deficient, conditionally replicating
or replication competent. In alternative aspects, vectors are
derived from the adenoviral (e.g. replication incompetent vectors
derived from the human adenovirus genome, see, e.g., U.S. Pat. Nos.
6,096,718; 6,110,458; 6,113,913; 5,631,236); adeno-associated viral
and retroviral genomes. Retroviral vectors can include those based
upon murine leukemia virus (MuLV), gibbon ape leukemia virus
(GaLV). Simian Immuno deficiency virus (SIV), human immuno
deficiency virus (HIV), and combinations thereof; see, e.g., U.S.
Pat. Nos. 6,117,681; 6,107,478; 5,658,775; 5,449,614: Buchscher
(1992) J. Virol. 66:2731-2739; Johann (1992) J. Virol.
66:1635-1640). Adeno-associated virus (AAV)-based vectors can be
used to transduce cells with target nucleic acids, e.g., in the in
vitro production of nucleic acids and peptides, and in in vivo and
ex vivo gene therapy procedures; see, e.g., U.S. Pat. Nos.
6,110,456; 5,474,935; Okada (1996) Gene Ther. 3:957-964.
[0952] The present invention also relates to use of fusion
proteins, and nucleic acids encoding them. A polypeptide used to
practice the methods of the invention can be fused to a
heterologous peptide or polypeptide, such as N-terminal
identification peptides which impart desired characteristics, such
as increased stability or simplified purification. Peptides and
polypeptides used to practice the methods of the invention can also
be synthesized and expressed as fusion proteins with one or more
additional domains linked thereto for, e.g., producing a more
immunogenic peptide, to more readily isolate a recombinantly
synthesized peptide, to identify and isolate antibodies and
antibody-expressing B cells, and the like. Detection and
purification facilitating domains include, e.g. metal chelating
peptides such as polyhistidine tracts and histidine-tryptophan
modules that allow purification on immobilized metals, protein A
domains that allow purification on immobilized immunoglobulin, and
the domain utilized in the FLAGS extension/affinity purification
system (Immunex Corp, Seattle Wash.). The inclusion of a cleavable
linker sequences such as Factor Xa or enterokinase (Invitrogen, San
Diego Calif.) between a purification domain and the
motif-comprising peptide or polypeptide to facilitate purification.
For example, an expression vector can include an epitope-encoding
nucleic acid sequence linked to six histidine residues followed by
a thioredoxin and an enterokinase cleavage site (see e.g., Williams
(1995) Biochemistry 34:1787-1797: Dobeli (1998) Protein Expr.
Purif. 12:404-414). The histidine residues facilitate detection and
purification while the enterokinase cleavage site provides a means
for purifying the epitope from the remainder of the fusion protein.
In one aspect, a nucleic acid encoding a polypeptide used to
practice the methods of the invention is assembled in appropriate
phase with a leader sequence capable of directing secretion of the
translated polypeptide or fragment thereof. Technology pertaining
to vectors encoding fusion proteins and application of fusion
proteins are well disclosed in the scientific and patent
literature, see e.g., Kroll (1993) DNA Cell. Biol. 12:441-53.
[0953] The nucleic acids and polypeptides used to practice the
methods of the invention can be bound to a solid support, e.g., for
use in screening and diagnostic methods. Solid supports can
include, e.g., membranes (e.g. nitrocellulose or nylon), a
microtiter dish (e.g. PVC, polypropylene, or polystyrene), a test
tube (glass or plastic), a dip stick (e.g. glass, PVC,
polypropylene, polystyrene, latex and the like), a microfuge tube,
or a glass, silica, plastic, metallic or polymer bead or other
substrate such as paper. One solid support uses a metal (e.g.
cobalt or nickel)-comprising column which binds with specificity to
a histidine tag engineered onto a peptide.
[0954] Adhesion of molecules to a solid support can be direct
(i.e., the molecule contacts the solid support) or indirect (a
"linker" is bound to the support and the molecule of interest binds
to this linker). Molecules can be immobilized either covalently
(e.g. utilizing single reactive thiol groups of cysteine residues
(see, e.g., Colliuod (1993) Bioconjugate Chem. 4:528-536) or
non-covalently but specifically (e.g. via immobilized antibodies
(see, e.g., Schuhmann (1991) Adv. Mater. 3:388-391; Lu (1995) Anal.
Chem. 67:83-87: the biotin/strepavidin system (see, e.g., lwane
(1997) Biophys. Biochem. Res. Comm. 230:76-80); metal chelating,
e.g., Langmuir-Blodgett films (see, e.g., Ng (1995) Langmuir
11:4048-55); metal-chelating self-assembled monolayers (see, e.g.,
Sigal (1996) Anal. Chem. 68:490-497) for binding of polyhistidine
fusions.
[0955] Indirect binding can be achieved using a variety of linkers
which are commercially available. The reactive ends can be any of a
variety of functionalities including, but not limited to: amino
reacting ends such as N-hydroxysuccinimide (NHS) active esters,
imidoesters, aldehydes, epoxides, sulfonyl halides, isocyanate,
isothiocyanate, and nitroaryl halides; and thiol reacting ends such
as pyridyl disulfides, maleimides, thiophthalimides, and active
halogens. The heterobifunctional crosslinking reagents have two
different reactive ends, e.g., an amino-reactive end and a
thiol-reactive end, while homobifunctional reagents have two
similar reactive ends, e.g., bismaleimidohexane (BMH) which permits
the cross-linking of sulfhydryl-containing compounds. The spacer
can be of varying length and be aliphatic or aromatic. Examples of
commercially available homobifunctional cross-linking reagents
include, but are not limited to, the imidoesters such as dimethyl
adipimidate dihydrochloride (DMA); dimethyl pimelimidate
dihydrochloride (DMP); and dimethyl suberimidate dihydrochloride
(DMS). Heterobifunctional reagents include commercially available
active halogen-NHS active esters coupling agents such as
N-succinimidyl bromoacetate and N-succinimidyl
(4-iodoacetyl)aminobnzoate (SIAB) and the sulfosuccinimidyl
derivatives such as sulfosuccinimidyl(4-iodoacetyl)aminobenzoate
(sulfo-SIAB) (Pierce). Another group of coupling agents is the
hetcrobifunctional and thiol cleavable agents such as
N-succinimidyl 3-(2-pyridyidithio)propionate (SPDP) (Pierce
Chemicals, Rockford, Ill.).
[0956] Antibodies can also be used for binding polypeptides and
peptides used to practice the methods of the invention to a solid
support. This can be done directly by binding peptide-specific
antibodies to the column or it can be done by creating fusion
protein chimeras comprising motif-containing peptides linked to,
e.g., a known epitope (e.g. a tag (e.g. FLAG, myc) or an
appropriate immunoglobulin constant domain sequence (an
"immunoadhesin," see, e.g., Capon (1989) Nature 377:525-531
(1989).
[0957] Nucleic acids or polypeptides used to practice the methods
of the invention can be immobilized to or applied to an array.
Arrays can be used to screen for or monitor libraries of
compositions (e.g. small molecules, antibodies, nucleic acids,
etc.) for their ability to bind to or modulate the activity of a
nucleic acid or a polypeptide used to practice the methods of the
invention. For example, in one aspect of the invention, a monitored
parameter is transcript expression of a gene comprising a nucleic
acid used to practice the methods of the invention. One or more, or
all the transcripts of a cell can be measured by hybridization of a
sample comprising transcripts of the cell, or nucleic acids
representative of or complementary to transcripts of a cell, by
hybridization to immobilized nucleic acids on an array, or
"biochip." By using an "array" of nucleic acids on a microchip,
some or all of the transcripts of a cell can be simultaneously
quantified. Alternatively, arrays comprising genomic nucleic acid
can also be used to determine the genotype of a newly engineered
strain made by the methods of the invention. Polypeptide arrays"
can also be used to simultaneously quantify a plurality of
proteins.
[0958] The terms "array" or "microarray" or "biochip" or "chip" as
used herein is a plurality of target elements, each target element
comprising a defined amount of one or more polypeptides (including
antibodies) or nucleic acids immobilized onto a defined area of a
substrate surface. In practicing the methods of the invention, any
known array and/or method of making and using arrays can be
incorporated in whole or in part, or variations thereof, as
disclosed, for example, in U.S. Pat. Nos. 6,277,628; 6,277,489;
6,261,776; 6,258,606; 6,054,270; 6,048,695; 6,045,996; 6,022,963;
6,013,440; 5,965,452; 5,959,098; 5,856,174; 5,830,645; 5,770,456;
5,632,957; 5,556,752; 5,143,854; 5,807,522; 5,800,992; 5,744,305;
5,700,637; 5,556,752; 5,434,049; sec also, e.g., WO 99/51773; WO
99/09217; WO 97/46313; WO 96/17958; see also, e.g., Johnston (1998)
Curr. Biol. 8:R171-R174; Schummer (1997) Biotechniques
23:1087-1092; Kern (1997) Biotechniques 23:120-124; Solinas-Toldo
(1997) Genes. Chromosomes & Cancer 20:399-407; Bowtell (1999)
Nature Genetics Supp. 21:25-32. See also published U.S. patent
application Nos. 20010018642; 20010019827; 20010016322;
20010014449; 20010014448; 20010012537; 20010008765.
[0959] Host Cells and Transformed Cells
[0960] The invention also provides a transformed cell comprising a
nucleic acid sequence used to practice the methods of the
invention, e.g., a sequence encoding a polypeptide used to practice
the methods of the invention, or a vector used to practice the
methods of the invention. The host cell may be any of the host
cells familiar to those skilled in the art, including prokaryotic
cells, eukaryotic cells, such as bacterial cells, fungal cells,
yeast cells, mammalian cells, insect cells, or plant cells.
Exemplary bacterial cells include E. coli, Streptomyces, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus. Exemplary
insect cells include Drosophila S2 and Spodoptera Sf9. Exemplary
animal cells include CHO, COS or Bowes melanoma or any mouse or
human cell line. The selection of an appropriate host is within the
abilities of those skilled in the art.
[0961] Vectors may be introduced into the host cells using any of a
variety of techniques, including transformation, transfection,
transduction, viral infection, gene guns, or Ti-mediated gene
transfer. Particular methods include calcium phosphate
transfection, DEAE-Dextran mediated transfection, lipofection, or
electroporation.
[0962] Engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating promoters,
selecting transformants or amplifying the genes used to practice
the methods of the invention. Following transformation of a
suitable host strain and growth of the host strain to an
appropriate cell density, the selected promoter may be induced by
appropriate means (e.g. temperature shift or chemical induction)
and the eel Is may be cultured for an additional period to allow
them to produce the desired polypeptide or fragment thereof.
[0963] Cells can be harvested by centrifugation, disrupted by
physical or chemical means, and the resulting crude extract is
retained for further purification. Microbial cells employed for
expression of proteins can be disrupted by any convenient method,
including freeze-thaw cycling, sonication, mechanical disruption,
or use of cell lysing agents. Such methods are well known to those
skilled in the art. The expressed polypeptide or fragment can be
recovered and purified from recombinant cell cultures by methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
polypeptide. If desired, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0964] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts and
other cell lines capable of expressing proteins from a compatible
vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines.
[0965] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Depending upon the host employed in a recombinant
production procedure, the polypeptides produced by host cells
containing the vector may be glycosylated or may be
non-glycosylated. Polypeptides used to practice the methods of the
invention may or may not also include an initial methionine amino
acid residue.
[0966] Cell-free translation systems can also be employed to
produce a polypeptide used to practice the methods of the
invention. Cell-free translation systems can use mRNAs transcribed
from a DNA construct comprising a promoter operably linked to a
nucleic acid encoding the polypeptide or fragment thereof. In some
aspects, the DNA construct may be linearized prior to conducting an
in vitro transcription reaction. The transcribed mRNA is then
incubated with an appropriate cell-free translation extract, such
as a rabbit reticulocyte extract, to produce the desired
polypeptide or fragment thereof.
[0967] The expression vectors can contain one or more selectable
marker genes to provide a phenotypic trait for selection of
transformed host cells such as dihydrofolate reductase or neomycin
resistance for eukaryotic cell culture, or such as tetracycline or
ampicillin resistance in E. coli.
[0968] For transient expression in mammalian cells, cDNA encoding a
polypeptide of interest may be incorporated into a mammalian
expression vector, e.g. pcDNA 1, which is available commercially
from Invitrogen Corporation (San Diego, Calif., U.S.A.; catalogue
number V490-20). This is a multifunctional 4.2 kb plasmid vector
designed for cDNA expression in eukaryotic systems, and cDNA
analysis in prokaryotes, incorporated on the vector are the CMV
promoter and enhancer, splice segment and polyadenylation signal,
an SV40 and Polyoma virus origin of replication, and M13 origin to
rescue single strand DNA for sequencing and mutagenesis. Sp6 and T7
RNA promoters for the production of sense and anti-sense RNA
transcripts and a Col E1-like high copy plasmid origin. A
polylinker is located appropriately downstream of the CMV promoter
(and 3' of the T7 promoter).
[0969] The cDNA insert may be first released from the above
phagemid incorporated at appropriate restriction sites in the
pcDNAI polylinker. Sequencing across the junctions may be performed
to confirm proper insert orientation in pcDNAI. The resulting
plasmid may then be introduced for transient expression into a
selected mammalian cell host, for example, the monkey-derived,
fibroblast like cells of the COS-1 lineage (available from the
American Type Culture Collection, Rockville, Md. as ATCC CRL
1650).
[0970] For transient expression of the protein-encoding DNA, for
example, COS-1 cells may be transfected with approximately 8 .mu.g
DNA per 10.sup.6 COS cells, by DEAE-mediated DNA transfection and
treated with chloroquine according to the procedures described by
Sambrook et al. Molecular Cloning: A Laboratory Manual, 1989, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor N.Y. pp.
16.30-16.37. An exemplary method is as follows. Briefly, COS-1
cells are plated at a density of 5.times.10.sup.6 cells/dish and
then grown for 24 hours in FBS-supplemented DMEM/F12 medium. Medium
is then removed and cells are washed in PBS and then in medium. A
transfection solution containing DEAE dextran (0.4 mg/ml), 100
.mu.M chloroquine. 10% NuScrum, DNA (0.4 mg/ml) in DMEM/F12 medium
is then applied on the cells 10 ml volume. After incubation for 3
hours at 37.degree. C., cells are washed in PBS and medium as just
described and then shocked for 1 minute with 10% DMSO in DMEM/F12
medium. Cells are allowed to grow for 2-3 days in 10%
FBS-supplemented medium, and at the end of incubation dishes are
placed on ice, washed with ice cold PBS and then removed by
scraping. Cells are then harvested by centrifugation at 1000 rpm
for 10 minutes and the cellular pellet is frozen in liquid
nitrogen, for subsequent use in protein expression. Northern blot
analysis of a thawed aliquot of frozen cells may be used to confirm
expression of receptor-encoding cDNA in cells under storage.
[0971] In a like manner, stably transfected cell lines can also
prepared, for example, using two different cell types as host: CHO
K1 and CHO Pro5. To construct these cell lines, cDNA coding for the
relevant protein may be incorporated into the mammalian expression
vector pRC/CMV (Invitrogen), which enables stable expression.
Insertion at this site places the cDNA under the expression control
of the cytomegalovirus promoter and upstream of the polyadenylation
site and terminator of the bovine growth hormone gene, and into a
vector background comprising the neomycin resistance gene (driven
by the SV40 early promoter) as selectable marker.
[0972] An exemplary protocol to introduce plasmids constructed as
described above is as follows. The host CHO cells are first seeded
at a density of 5.times.10.sup.5 in 10% FBS-supplemented MEM
medium. After growth for 24 hours, fresh medium is added to the
plates and three hours later, the cells are transfected using the
calcium phosphate-DNA co-precipitation procedure (Sambrook et al,
supra). Briefly, 3 g of DNA is mixed and incubated with buffered
calcium solution for 10 minutes at room temperature. An equal
volume of buffered phosphate solution is added and the suspension
is incubated for 15 minutes at room temperature. Next, the
incubated suspension is applied to the cells for 4 hours, removed
and cells were shocked with medium containing 15% glycerol. Three
minutes later, cells are washed with medium and incubated for 24
hours at normal growth conditions. Cells resistant to neomycin are
selected in 10% FBS-supplemented alpha-MEM medium containing G418
(1 mg/ml). Individual colonies of G418-resistant cells are isolated
about 2-3 weeks later, clonally selected and then propagated for
assay purposes.
EXAMPLES
[0973] A number of examples illustrative of the present invention
are described below. In most cases, alternative techniques could
also be used. The examples are intended to be illustrative and are
not limiting or restrictive to the scope of the invention. Unless
specifically noted to the contrary, in cases where a compound
number is not preceeded by a "P-" (e.g., "P-0001") in the Examples
section, compound naming and/or enumeration is not related to
naming and/or enumeration employed in other sections of this
application. Similarly, structure and substituent naming and
enumeration within the Examples are independent of structure and
substituent naming and enumeration in above sections of this
application unless clearly indicated otherwise.
[0974] In the following Examples, it is understood that the
solvents and reagents used or suggested are not limiting, and can
be substituted appropriately with solvents and rcagents known to
those of skill in the art. Reaction products may be isolated by
means known in the art, such as extraction with a suitable solvent,
precipitation from a suitable solvent, chromatography using a
suitable solvent system, including silica gel column
chromatography, HPLC, preparative TLC, and the like. Exemplary
methods for synthesis of compounds of the present invention may be
found in US Patent Application Publication number US 2007/0032519,
the disclosure of which is hereby incorporated by reference. The
1H-pyrrolo[2,3-b]pyridine core of compounds described in the
examples may also be referred to as 7-azaindole in the
examples.
Example 1; Synthesis of Compound of Formula I, where X.sub.1,
X.sub.2, Y.sub.1 and Y.sub.2 are CH and L.sup.1 is --CH.sub.2--
[0975] Compounds of Formula I, as described in paragraph [0011],
where X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH and L.sup.1 is
--CH.sub.2-- or --CO-- may be synthesized from 7-azaindole
according to one of the following Schemes 1-3, where R.sup.24 is
consistent with Art, which can be further substituted to provide
compounds where R.sup.24 is Ar.sub.1-L.sup.2-R.sup.1 as described
for Formula I.
##STR00058##
Step-1--Synthesis of Compound 2.
[0976] Compound 2 is synthesized from commercially available
7-azaindole following the literature procedure (Robinson, J. Am.
Chem. Soc., 1955, 77, p. 457).
Step-2--Synthesis of Compound of Formula II
[0977] Compound of Formula II, where P is a protecting group, is
synthesized by deprotonation using base (e.g. BuLi. NaH) in aprotic
solvent like tetrahydrofuran or ether and reacting the anion with a
silyl chloride (e.g. TIPS) or an anhydride (e.g. Boc anhydride).
The compound is isolated by following standard procedure (quenching
with ice-cold brine, work up, and purification by flash silica gel
chromatography).
Steps--3 and 4--Synthesis of Compound of Formula I
[0978] Compounds of Formula I, wherein R.sup.24 is Ar.sub.1 as
defined in Formula I, is synthesized through the reaction of
compounds of Formula II with isopropyl chloroformate (or ethyl
chloroformate) at room temperature in toluene to give a
3-chloromethyl intermediate. This intermediate is cooled to
-78.degree. C. and immediately reacted with an organocopper
reagent, which is generated from the reaction between a Grignard
reagent (or organolithium reagent) and a solution of copper cyanide
and LiCl. The mixture is stirred at -78.degree. C. for one hour and
allowed to warm to room temperature. The reaction is quenched with
a solution of 4:1 ammonium chloride:ammonium hydroxide. The
reaction is worked up in the usual manner and purified by flash
silica gel chromatography to give the nitrogen-protected compound.
The final compound can be realized through the deprotection of the
protecting group (Boc, TIPS) using standard conditions (TFA or
NH.sub.4F) at room temperature.
##STR00059##
Step-1--Synthesis of Compound 3
[0979] Compound 3 is synthesized by reacting commercially available
7-azaindole, compound 1, with hexamethyltetramine and acetic acid
in water with heating to reflux for two hours. After cooling, the
desired compound is precipitated and collected by filtration.
Step-2--Synthesis of Compound of Formula III
[0980] Compound of Formula III, where P is a protecting group, is
synthesized by reacting compound 3 with an appropriate reagent to
introduce a protecting group (e.g. tert-butyloxycarbonyl di
anhydride) and a base (e.g. sodium hydride) in an appropriate
solvent (e.g. tetrahydrofuran) typically at room temperature for
12-18 hours. The compound can be isolated by conventional means
(e.g. extraction).
Step-3--Synthesis of Compound of Formula IV
[0981] Compound of Formula IV, wherein R.sup.24 is Ar.sub.1, is
synthesized by reacting compound of Formula III in an appropriate
solvent (e.g. 1,2-dimethoxyethane) with a Grignard reagent of the
formula R.sup.24MgCl or R.sup.24MgBr (e.g. pyridinyl magnesium
bromide) or an equivalent nucleophile in an appropriate solvent
(e.g. tetrahydrofuran) under inert atmosphere cooled typically to
-10.degree. C. The reaction is typically allowed to warm to room
temperature and stirred for 12-18 hours. The desired compound is
purified by reverse phase high pressure liquid chromatography.
Steps--4 and 5--Synthesis of an Intermediate of Compound of Formula
I
[0982] An intermediate of compound of Formula I is synthesized by
reacting compound of Formula IV with a reducing agent (e.g. sodium
borohydride) in a polar solvent (e.g. ethanol) typically with
heating to 80.degree. C. for 1-4 hours. The reaction is quenched
with the addition of methanol and concentrated and purified by
reverse phase high performance liquid chromatography. Compound of
Formula I where R.sup.24 is Ar.sub.1 is synthesized by reacting
this intermediate with an appropriate reagent to remove the
protecting group, P, (e.g. hydrochloric acid) in an apolar solvent
(e.g. dioxane). The final compound is isolated by standard
procedures (e.g. reverse phase preparative high pressure liquid
chromatography).
##STR00060##
Step-1--Synthesis of Compound of Formula I'
[0983] Compound of Formula I' where R.sup.24 is Ar.sub.1, is
synthesized by reacting compound 1 with an activating agent (e.g.
methyl magnesium bromide and zinc dichloride or anhydrous aluminum
chloride) and a heteroaryl acid chloride (e.g. nicotinic acid
chloride) in a non-reactive solvent (e.g. dichloromethane), under
inert atmosphere (e.g. argon), at room temperature or with heating
up to reflux for 18-24 hours. The compound is isolated by standard
procedures (e.g. extraction and silica-gel chromatography).
Example 2: Synthesis of Intermediate
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine (6) and
(3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine) (6a)
[0984] Compound 6, an intermediate to compounds of Formula I, as
described in paragraph [0011], where X.sub.1, X.sub.2, Y.sub.1 and
Y.sub.2 are CH, n is 1, P, Q and T are CH and L.sup.1 is
--CH.sub.2--, may be synthesized in four steps from 7-azaindole
according to the following Scheme 4.
##STR00061##
Step-1--Synthesis of
dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-amine (2)
[0985] Into a 3-neck round bottom flask was added Isopropyl alcohol
(320.0 mL) followed by the addition of 1H-pyrrolo[2,3-b]pyridine 1
(7.10 g, 60.1 mmol), dimethylamine hydrochloride (5.4 g, 0.066
mol), and formaldehyde (2.0 g, 0.066 mol). The reaction mixture was
stirred at room temperature for 12 hours, and then refluxed for 30
minutes. The suspension solution was evaporated to dryness in
vacuo. To the residue was added water (60.0 mL, 3.33 mol) and
concentrated hydrochloric acid (6.0 mL, 0.20 mol). The water layer
was extracted with ether and the aqueous layer was neutralized with
potassium carbonate. The aqueous layer was extracted with
dichloromethane, dried over sodium sulfate and concentrated to give
the compound, which was then further washed with ether and dried to
afford compound 2 (7.1 g, yield=67.4%), as a white solid.
Step-2--Synthesis of
dimethyl-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amin-
e (4)
[0986] Into a round bottom flask 7-Azagramine 2 (5.38 g, 30.7
mmol), N,N-dimethylformamide (25.0 mL), and sodium hydride (1.35 g,
33.8 mol) were combined. Into the reaction was added
triisopropylsilyl chloride (6.8 mL, 0.032 mol). The reaction was
stirred at 20.degree. C. for 12 hours. The reaction mixture was
poured into water and extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate,
concentrated and purified with biotage to give compound 4 (6.0 g,
yield=58.8%) as a colorless oil.
Step-3--Synthesis of
3-chloromethyl-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine
(5)
[0987] Into a round bottom flask was added compound 4 (500.0 mg,
1.51 mmol) and toluene (5.0 mL, 0.047 mol) under an atmosphere of
nitrogen. Into the reaction mixture 1.0 M isopropyl chloroformate
in toluene (1.6 mL) was added slowly at room temperature. The
reaction mixture was stirred for another 2 hours to give desired
compound 5 used for next step without purification.
Step-4--Synthesis of
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine (6)
[0988] Into a round bottom flask was added 5-iodo-2-chloro-pyridine
(315.0 mg, 1.32 mmol) and tetrahydrofuran (12.0 mL, 0.15 mol) at
-40.degree. C. under an atmosphere of nitrogen. Into the reaction
2.0 M of isopropylmagnesium chloride in tetrahydrofuran (0.72 mL,
1.44 mmol) was added. The reaction mixture was stirred for 40
minutes at -40.degree. C. TLC (hexane/ethyl acetate 2:1) indicated
no starting material. Into the reaction mixture 0.6 M of CuCN.2LiCl
in tetrahydrofuran (2.4 mL, 1.44 mmol) was added. The reaction
mixture was allowed to come to room temperature for 5 minutes and
trimethyl phosphite (0.29 mL, 2.4 mmol) was added. After 10
minutes, this solution was added into a round bottom flask
containing compound 5 (315.0 mg) and toluene (8.0 mL). The reaction
was stirred at 20.degree. C. for 40 hours. The reaction mixture was
poured into water and the compound extracted with ethyl acetate.
The organic layer was washed with brine, dried over sodium sulfate,
concentrated and purified with biotage (dichloromethane/methanol
1:10) to give compound 6 (230 mg, yield=59.0%) as a white solid.
Compound 6a
(3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine) (MS (ESI) [M+H.sup.+].sup.+=288.1, 290.1) was prepared
substituting 5-iodo-2-chloro-pyridine with 5-iodo-2-bromo-pyridine
in Step 4, with reaction conditions and work up procedure the same
as that for the synthesis of compound 6.
Example 3: Synthesis of Intermediate
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7)
[0989] Compound 7, an intermediate to compounds of Formula I, as
described in paragraph [0011], where X.sub.1, X.sub.2, Y.sub.1 and
Y.sub.2 are CH, n is 1, P, Q and T are CH and L.sup.1 is --CO--,
may be synthesized in one step from 7-azaindole according to the
following Scheme 5.
##STR00062##
[0990] Into a round bottom flask was added aluminum trichloride
(16.0 g, 0.12 mol) and dichloromethane (100.0 mL) under an
atmosphere of nitrogen. Into the reaction mixture
1H-Pyrrolo[2,3-b]pyridine 1 (3.2 g, 0.027 mol) in dichloromethane
(20.0 mL) was added. The reaction was stirred at room temperature
for 70.0 minutes and 6-Chloropyridine-3-carbonyl chloride 8 (5.4 g,
0.031 mol) in dichloromethane (10.0 mL) was added. The reaction
mixture was stirred at room temperature for 3 hours. Methanol (10
mL) was added to the reaction mixture and the solvent was
evaporated in vacuo. The residue was poured into water and the
precipitated compound was removed by filtration. The aqueous layer
was extracted with ethyl acetate and die organic layer was dried
and concentrated and combined with the solid isolated by filtration
to give 7 (6.2 g, yield=88.6%) as a white solid. MS (ESI)
[M+H.sup.+].sup.+=258.
Example 4: Synthesis of
benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001)
[0991]
Benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001) was prepared in two steps from
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine (6) according to Scheme 6.
##STR00063##
Step-1--Synthesis of
benzyl-[5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyr-
idin-2-yl]-amine (10)
[0992] Into a round bottom flask was added
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine 6 (160.0 mg, 0.40 mmol, prepared as described in Example 2),
benzylamine (32, 0.1 mL, 0.90 mmol), palladium acetate (17.0 mg,
0.076 mmol), toluene (10.0 mL), potassium tert-butoxide (80.0 mg,
0.71 mmol) and 2-(di-t-butylphosphino)biphenyl (31.4 mg, 0.11 mmol)
under an atmosphere of nitrogen. The reaction was stirred under
reflux for 3 hours. TLC and MS indicated no starting material. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified with biotage
(dichloromethane/methanol 1:20) to give compound 10 (110 mg,
yield=58.5%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=471.
Step-2--Synthesis of
benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001)
[0993] Into a round bottom flask was added
benzyl-[5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyr-
idin-2-yl]-amine 10 (400.0 mg, 0.85 mmol), tetrahydrofuran (20.0
mL) and tetra-n-butylammonium fluoride (240 mg, 0.93 mmol). The
reaction mixture was stirred at 20.degree. C. for 30 minutes. TLC
indicated no starting material. The reaction mixture was poured
into water and extracted with ethyl acetate. The organic layer was
washed with brine, dried over sodium sulfate, concentrated and
purified with biotage (dichloromethane/methanol 1:10) to give
compound P-0001 (220 mg, Yield=82.4%) as a white solid. MS (ESI)
[M+H.sup.+].sup.+=315.
[0994] Additional compounds were prepared following the protocol of
Scheme 6, substituting benzyl amine with a suitable amine in Step
1, and using either
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2-
,3-b]pyridine 6 or
3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyr-
idine 6a, in Step 1. The following compounds were made following
this procedure: [0995]
Dimethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0021), [0996]
(4-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0004), [0997]
(4-chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0005), [0998]
(4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0006), [0999]
(4-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0007), and [1000]
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-thiophen-2-ylmethy-
l-amine (P-0008). The following table indicates the amine used in
Step 1 in place of benzyl amine in Column 3, and whether
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine or
3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[-
2,3-b]pyridine was used in Step 1 in Column 2 (Cl or Br,
respectively), with the compound structure in Column 4,
experimental mass spectrometry result in Column 5, and compound
number in Column 1.
TABLE-US-00001 [1000] MS(ESI) Starting [M + H.sup.+].sup.+
azaindole Amine Compound observed P-0021 Cl ##STR00064##
##STR00065## 253 P-0004 Br ##STR00066## ##STR00067## 344.4 P-0005
Br ##STR00068## ##STR00069## 348.8 P-0006 Br ##STR00070##
##STR00071## 332.4 P-0007 Br ##STR00072## ##STR00073## 328.4 P-0008
Br ##STR00074## ##STR00075## 330.4
Example 5; Synthesis of
(6-Benzylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0002)
[1001]
(6-Benzylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methan-
one (P0002) was prepared in one step from
(6-(chloro-pyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7) according to Scheme 7.
##STR00076##
[1002] Into a pressure tube was added
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 7
(270.0 mg, 1.05 mmol, prepared as described in Example 3), and
benzylamine (32, 0.7 mL, 0.006 mol) and tetrahydrofuran (25.0 mL)
under an atmosphere of nitrogen. The reaction mixture was heated to
185.degree. C. for 60 hours. The reaction mixture was concentrated
to remove most of the solvent and the residue was poured into water
and extracted with ethyl acetate. The organic layer was dried over
sodium sulfate, concentrated and purified with biotage
(dichloromethane/methanol 1:20) to give compound P-0002 (30 mg,
yield=8.7%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=329.
[1003] Additional compounds were prepared following the protocol of
Scheme 7, replacing benzylamine with a suitable amine. The
following compounds were made following this procedure: [1004]
[6-(4-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0015), [1005]
[6-(3-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0016), [1006]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone (P-0017), [1007]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-{6-[(thiophen-2-ylmethyl)-amino]-pyridin--
3-yl}-methanone (P-0018), [1008]
(6-Phenylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0023), [1009]
(6-Isopropylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0024), [1010] (6-Isobutyl
amino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0025), [1011]
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyrid-
in-3-yl)-methanone (P-0026), [1012]
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone (P-0030), [1013]
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanone (P-0031), The following table indicates the amine
substituted in place of benzylamine in column 2, to provide these
compounds, shown by structure in column 3. Column 1 provides the
compound number and column 4 gives the experimental mass
spectrometry result.
TABLE-US-00002 [1013] MS(ESI) [M + H.sup.+].sup.+ Amine Compound
observed P-0015 ##STR00077## ##STR00078## 347.0 P-0016 ##STR00079##
##STR00080## 347.1 P-0017 ##STR00081## ##STR00082## 396.9 P-0018
##STR00083## ##STR00084## 335.0 P-0023 ##STR00085## ##STR00086##
315.1 P-0024 ##STR00087## ##STR00088## 279 [M - H.sup.+].sup.-
P-0025 ##STR00089## ##STR00090## 293 [M - H.sup.+].sup.- P-0026
##STR00091## ##STR00092## 419 [M - H.sup.+].sup.- P-0030
##STR00093## ##STR00094## 293.1 P-0031 ##STR00095## ##STR00096##
335.2
Example 6: Synthesis of
Isobutyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
P-0028
[1014] Compound P-0028 was synthesized in 1 step from
6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
P-0025 as shown in Scheme 8.
##STR00097##
Step-1--Synthesis of
Isobutyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0028)
[1015] To
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0025, 60.0 mg, 0.20 mmol, prepared as described in
Example 5) in 1,2-ethanediol (5.0 mL) was added hydrazine (1.0 mL,
0.032 mol) and potassium hydroxide (200.0 mg, 3.56 mmol). The
reaction mixture was heated to 180.degree. C. overnight. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 10% methanol in dichloromethane to give
compound (P-0028, 10 mg, 16.7%). MS (ESI)
[M+H.sup.+].sup.+=281.
[1016]
Cyclopropylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-yl]-amine (P-0032)
##STR00098##
was prepared following the protocol of Scheme 8, substituting
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
P-0025 with
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone P-0030 (prepared as described in Example 5). MS (ESI)
[M+H.sup.+].sup.+=279.
[1017]
Cyclohexylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-
-yl]-amine (P-0033)
##STR00099##
was prepared following the protocol of Scheme 8, substituting
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
P-0025 with
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanone P-0031, (prepared as described in Example 5). MS (ESI)
[M+H.sup.+].sup.+=321.
Example 7:
3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0019
[1018] 3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0019 was synthesized in 2 steps from
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine 6 as shown in Scheme 9.
##STR00100##
Step-1--Synthesis of
3-(6-Isopropyl-pyridin-3-ylmethyl-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]-
pyridine (39)
[1019] To
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo-
[2,3-b]pyridine (6, 54.0 mg, 0.000135 mol, prepared as described in
Example 2) in Tetrahydrofuran (4.0 mL) were added
[1,1'-bis(diphenylphosphino)ferrocene]-dichloropalladium(II) (23.0
mg) and Isopropylmagnesium Chloride (0.15 mL, 2.0 M in
Tetrahydrofuran). The reaction was stirred at 20.degree. C. under
an atmosphere of Nitrogen for 3 hours. The reaction mixture was
poured into water and extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate,
concentrated and purified by silica gel column chromatography
eluting with 10% methanol in dichloromethane to give compound 39
(38 mg. 70.4%).
Step-2--Synthesis of
3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0019)
[1020] To
3-(6-Isopropyl-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrr-
olo[2,3-b]pyridine (39, 35.0 mg, 0.086 mmol) in tetrahydrofuran
(3.0 mL) was added tetra-n-butylammonium fluoride (29 mg, 0.11
mmol). The reaction was stirred at 20.degree. C. for 30 minutes.
The reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 10% methanol in dichloromethane to give
compound (P-0019, 18.0 mg, 81.9%). MS (ESI)
[M+H.sup.+].sup.+=252.
Example 8: Synthesis of
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifluoromethyl-
-benzyl)-amine (P-0003)
[1021]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifluoro-
methyl-benzyl)-amine (P-0003) was prepared in three steps from
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7) according to Scheme 10.
##STR00101##
Step-1--Synthesis of
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone (P-0017)
[1022] Into a pressure flask was added
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 7
(3.5 g, 0.014 mol, prepared as described in Example 3),
4-(trifluoromethyl)benzylamine (30, 9.0 g, 0.051 mol),
tetrahydrofuran (30.0 mL, 0.37 mol), palladium acetate (200.0 mg,
0.890 mmol) and 2-(di-t-butylphosphino)biphenyl (200.0 mg. 0.67
mmol). The reaction mixture was stirred at 180.degree. C.
overnight, poured into water and extracted with ethyl acetate. The
organic layer was washed with brine, dried over sodium sulfate and
concentrated. To the residue was added acetic acid (15.0 mL) and
H.sub.2O (5.0 mL). The reaction mixture was stirred at 100.degree.
C. for 5 hours and concentrated to remove the acetic acid. The
residue was then treated with aqueous Na.sub.2HCO.sub.3 and
extracted with ethyl acetate. The organic layer was washed, dried,
concentrated and purified to give compound P-0017 (1.0 g,
yield=18.5%) as a light yellow solid. MS (ESI)
[M+H.sup.+].sup.+=397.
Step-2--Synthesis of
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanol (14)
[1023] Into a round bottom flask was added
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone P-0017 (210.0 mg, 0.53 mmol) and sodium
tetrahydroborate (80.0 mg, 2.11 mmol), dissolved in
N,N-dimethylformamide (5.0 mL) and ethanol (20.0 mL). The reaction
was stirred at room temperature overnight, poured into water and
extracted with ethyl acetate. The organic layer was washed with
brine, dried over sodium sulfate, concentrated and purified with
biotage (dichloromethane/methanol 1:20) to give compound 14 (63 mg,
yield=30%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=399.
Step-3--Synthesis of
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifluoromethyl-
-benzyl)-amine (P-0003)
[1024] Into a round bottom flask was added
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanol 14 (200.0 mg, 0.50 mmol), trifluoroacetic acid
(5.0 mL, 0.065 mol) and triethylsilane (3.0 mL, 0.019 mol). The
reaction was stirred at room temperature for 30 min. poured into
aqueous sodium bicarbonate, and extracted with ethyl acetate. The
organic layer was washed with brine, dried over sodium sulfate,
concentrated and purified to give pure compound P-0003 (120.0 mg,
yield=62.8%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=383.
Example 9. Synthesis of Compounds of Formula I where n is 1, P, Q
and T are CH X.sub.1, X.sub.2 and Y.sub.2 are CH, Y.sub.1 is
CR.sup.4, L.sup.1 is --CH.sub.2--, L.sup.2 is --NHCH.sub.2--, and
R.sup.1 is 4 Substituted Phenyl (Formula Ic)
[1025] Compounds of Formula Ic, where R.sup.4 is as defined for
Formula I (paragraph [0011]) and Z is a substituent as defined for
optionally substituted aryl, can be synthesized in five Steps from
2-amino-5-bromopyridines as shown in the following general Scheme
11.
##STR00102## ##STR00103##
Step-1--Preparation of Compounds of Formula V
[1026] To a solution of an appropriately substituted benzaldehyde
(e.g. p-trifluoromethyl benzaldehyde) in a non-reactive solvent
(e.g. tetrahydrofuran) is added an appropriate
2-amino-5-bromo-pyridine 15, followed by appropriate reagents to
effect the reduction (e.g. dibutyltin dichloride and phenylsilane).
Typically the reaction is heated (e.g. 50.degree. C.) overnight.
The solvent is removed at reduced pressure after heating to
50.degree. C. overnight. Isolation by conventional means (e.g.
extraction) affords compounds of Formula V.
Step-2--Preparation of Compounds of Formula VI
[1027] Compound of Formula V is dissolved in a non-reactive solvent
(e.g. tetrahydrofuran) and typically cooled at -78.degree. C. under
an inert atmosphere. To this mixture is added an organo lithium
reagent (e.g. methyl lithium). The reaction mixture is typically
stirred at -78.degree. C. for several hours. To this mixture is
added an organo lithium reagent (e.g. tert-butyl lithium), and the
mixture is stirred for several hours. The reaction mixture is
maintained at -78.degree. C., and an appropriate formylating
reagent (e.g. 1-piperidine carboxaldehyde) is added. Typically, the
reaction is allowed to stir at -78.degree. C. for an additional
several hours and slowly warmed to room temperature. Isolation by
conventional means (e.g. extraction) affords compounds of Formula
VI.
Step-3--Preparation of Compounds of Formula VII
[1028] Compound of Formula VI is dissolved in a non-reactive
solvent (e.g. tetrahydrofuran) and stirred under an inert
atmosphere. To this solution is added a base (e.g. triethylamine)
and typically a catalyst (e.g. 4-dimethylaminopyridine). Typically,
the mixture is stirred for a few minutes and then a reagent
appropriate for the introduction of a protecting group (e.g.
di-tert-butyldicarbonate) is added. Typically, the reaction is
stirred overnight. Isolation by conventional means (e.g.
extraction) affords compounds of Formula VII.
Step-4--Preparation of Compounds of Formula VIII and LV
[1029] 4-Substituted 1H-pyrrolo[2,3-b]pyridine XXX is added to a
stirring solution of base (e.g. potassium hydroxide) in an
appropriate polar protic solvent (e.g. methanol). Compound of
Formula VII is added, and the mixture is typically stirred at room
temperature for several days. The solvent is evaporated, and 1 M
HCl is added to the residue. Isolation by conventional means (e.g.
extraction, silica gel chromatography) affords compounds of Formula
VIII and IX.
Step-5--Preparation of Compounds of Formula Ic
[1030] Typically, compounds of Formula VIII and IX is combined and
dissolved in an appropriate polar aprotic solvent (e.g.
acetonitrile). Reagents appropriate to effect the reduction (e.g.
triethylsilane and trifluoroacetic acid) are added. Typically, the
reactions are stirred at room temperature for several days.
Isolation by conventional means (e.g. extraction, silica gel
chromatography) affords compounds of Formula Ic.
Example 10. Synthesis of
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0011)
##STR00104##
[1032]
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-
-trifluoromethyl-benzyl)-amine P-0011 was synthesized as shown in
Scheme 12:
##STR00105## ##STR00106##
Step 1: Preparation of
(5-Bromo-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine (17)
[1033] Into a round bottom flask fitted with stirrer and reflux
condenser was added 2-amino-5-bromopyridine (15, 1.73 mol, 300 g)
and p-trifluoromethylbenzaldehyde (16, 1.723 mol, 300 g) to a
solution of trifluoroacetic acid (400 mL), triethylsilane (825 mL)
and acetonitrile (7500 mL). The reaction was heated to reflux
overnight (24 hours). Solvents were removed and the residue was
poured into aqueous K.sub.2CO.sub.3 and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, and concentrated. The crude compound was crystallized with
diethyl ether/hexane to afford compound 17, 420 g (73.6%) as off
white solid. MS (ESI) [M+H.sup.+].sup.+=331.1 and 333.1 (1:1
ratio).
Step 2: Preparation of
6-(4-Trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde (18)
[1034] Into a 5 L round bottom flask was added compound 17 (0.6
mol, 198.6 g) and tetrahydrofuran (2.5 L) under an atmosphere of
argon at -78.degree. C. Into the reaction mixture was added 1.7 M
tert-butyllithium in pentane (800 mL) over 60 mins. Two hours after
the addition of tert-butyllithium, N,N-dimethylformamide (100 mL)
was added. The reaction mixture was stirred at -78.degree. C. for 2
hours, then allowed to stand at room temperature for another 1
hour. The reaction mixture was poured into saturated ammonium
chloride solution and extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate,
concentrated and triturated with hexane/isopropyl ether (1:1) to
give aldehyde compound 18.
Step 3: Preparation of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic Acid
Tert-Butyl Ester (19)
[1035] Into a 2 L round bottom flask was added
di-tert-butyldicarbonate (90 g), aldehyde 18 (75 g), diisopropyl
ethyl amine (60 g), 4-dimethylaminopyridine (2.0 g) and
dichloromethane (1000.0 mL). The reaction was stirred at room
temperature overnight (18 hours) and the solvent was evaporated to
give compound 19 (94 g).
Steps 4 and 5: Preparation of
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0011)
[1036] Step 4: Into a solution of methanol (20 mL, 0.5 mol) was
added sodium hydroxide (0.62 g, 0.016 mol), followed by
4-methoxy-7-azaindole (20, 600 mg, 4 mmol, prepared as described in
Example 12). Once the mixture was homogeneous, compound 19 (1.7 g,
4.46 mmol) was added and the mixture was stirred at room
temperature for 48 hours. The solvent was evaporated and dilute HCl
was added to the residue. The residue was extracted with ethyl
acetate and washed with 10% sodium bicarbonate, followed by brine.
The organic layer was dried over MgSO.sub.4, filtered and
evaporated to give a mixture of crude compounds 21 and 22, which
was used in the next step.
[1037] Step 5: The mixture of 21 and 22 from Step 4 (2.36 g, 4.46
mmol) was dissolved in dichloromethane (60 mL, 0.9 mol) to which
triethylsilane (3.6 mL, 0.022 mol) and trifluoroacetic Acid (2.1
mL, 0.027 mol) were added. The resulting mixture was stirred for 48
hours at room temperature. The solvent was evaporated and the
mixture was extracted with dichloromethane:methanol (3:1). The
organic layer was washed with saturated bicarbonate followed by
brine. The organic layer was dried over MgSO.sub.4, filtered and
evaporated to give crude compound as a residue. The residue was
purified by flash silica gel chromatography to give 1.15 g of solid
P-0011 for a 60% yield.
[1038] MS (ESI) [M+H.sup.+].sup.+=413.24.
[1039]
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-
-chloro-benzyl)-amine P-0010
##STR00107##
was prepared following the protocol of Scheme 12, substituting
4-trifluoro-benzylamine with 4-chloro-benzylamine in Step 1. MS
(ESI) [M+H.sup.+].sup.+=379.2 and 381.2 (3:1 ratio).
[1040]
[5-(4-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4--
chloro-benzyl)-amine P-0009
##STR00108##
was prepared following the protocol of Scheme 12, substituting
4-trifluoro-benzylamine with 4-chloro-benzylamine in Step 1 and
4-methoxy-7-azaindole with 4-chloro-7-azaindole (24, prepared as
described in Example 11) in Step 4. MS (ESI)
[M+H.sub.+].sup.+=381.1 and 383.0.
Example 11: Synthesis of 4-chloro-7-azaindole (24)
[1041] 4-chloro-7-azaindole 24 was synthesized in two Steps from
7-azaindole according to the protocol of Scheme 13.
##STR00109##
Step-1--Synthesis of 1H-Pyrrolo[2,3-b]pyridine 7-oxide (23)
[1042] 1H-Pyrrolo[2,3-b]pyridine 7-oxide 23 was synthesized by
reacting commercially available 7-azaindole 1 with an oxidizing
agent (e.g. m-CPBA) in a non-reactive solvent (e.g.
dimethoxyethane) as described by Schneller, S. W.; Luo, Jiann-Kuan.
J. Org. Chem. 1980, 45:4045-4048. The compound was isolated by
filtration of the resulting solid that forms upon standing at
5.degree. C. for typically 1-3 h.
Step-2--Synthesis of 4-chloro-7-azaindole (24)
[1043] 4-chloro-7-azaindole 24 was synthesized by reacting
1H-Pyrrolo[2,3-b]pyridine 7-oxide 23 with a chlorinating agent
(e.g. POCl.sub.3) neat as described by Schneller, S. W.; Luo,
Jiann-Kuan. J. Org. Chem. 1980, 45:4045-4048. The resulting
solution after heating for 3-5 h at elevated temperatures
(100-150.degree. C.) was neutralized with a base (e.g. NH.sub.4OH)
until a solid precipitated. The solid was isolated by
filtration.
Example 12: Synthesis of 4-methoxy-7-azaindole (20)
[1044] 4-methoxy-7-azaindole 20 was synthesized in one Step from
4-chloro-7-azaindole according to the protocol of Scheme 14.
##STR00110##
[1045] 4-methoxy-7-azaindole 20 was prepared by reacting
4-chloro-7-azaindole 24 (prepared as described in Example 9) with
sodium hydroxide in methanol as described by Girgis, N. et. al., J.
Heterocyclic. Chem. 1989, 26:317-325.
Example 13: Synthesis of Compounds of Formula I where n is 1, P is
CR.sup.30, Q, T, X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH,
L.sup.1 is --CH.sub.2--, L.sup.2 is --NHCH.sub.2--, and R.sup.31 is
Substituted Phenyl (Formula Id)
[1046] Compounds of Formula Id, where R.sup.30 is a substituent as
defined for optionally substituted heteroarylene (further defined
in Scheme 13 below) and R.sup.31 is a substituent as defined for
optionally substituted aryl, can be synthesized in six Steps from
appropriately substituted 2-halopyridines as shown in the following
general Scheme 15.
##STR00111##
Step 1--Preparation of Compounds of Formula XI
[1047] To an appropriately substituted 2-halopyridine X (e.g.
2-chloro-6-methoxypyridine), where Y is a halogen, preferably
chlorine or bromine, and R.sup.30 is a group appropriate to direct
the following lithiation to the 5-position (e.g. R.sup.30=methoxy),
in a non-reactive solvent (e.g. tetrahydrofuran) typically cooled
in a -78.degree. C. acetone/dry ice bath is added a solution of
organolithium reagent (e.g. tert-butyllithium). The reaction is
allowed to stir for a period, typically 1 hour. An appropriate
formylating agent (e.g. dimethylformamide) is added and the
reaction is allowed to stir cooled for a period and then warmed to
room temperature for a period, typically 30 minutes. The reaction
can be placed back in the dry-ice bath and quenched with 6 N HCl
(1.5 mL) followed by water and allowed to warm to room temperature.
Isolation by conventional means (e.g. extraction) provides
compounds of Formula XI.
Step 2--Preparation of Compounds of Formula XII
[1048] To 1H-pyrrolo[2,3-b]pyridine 1 and a compound of Formula XI
is added an appropriate polar solvent (e.g. methanol) followed by
an appropriate base (e.g. potassium hydroxide). The reaction is
typically allowed to stir at room temperature overnight. Isolation
by convention means (e.g. extraction, washing and filtering)
affords compounds of Formula XII.
Step 3--Preparation of Compounds of Formula XIII
[1049] To a compound of Formula XII in an appropriate polar solvent
(e.g. acetonitrile) is added a reducing agent (e.g. trifluoroacetic
acid and triethylsilane). Typically, the reaction is allowed to
stir at room temperature overnight. Isolation by conventional means
(e.g. extraction and silica gel chromatography) affords compounds
of Formula XIII.
Step 4--Preparation of Compounds of Formula XIV
[1050] To a solution of compound of Formula XIII in an appropriate
polar solvent (e.g. dimethylformamide) is added a base (e.g. sodium
hydride). Typically, the reaction is stirred at room temperature
for 30 minutes, and then an appropriate reagent to introduce a
protecting group ("P") is added (e.g. triisopropylsilyl chloride).
The reaction typically is stirred at room temperature for several
hours. Isolation by conventional means (e.g. extraction and silica
gel chromatography) affords compounds of Formula XIV.
Step 5--Preparation of Compounds of Formula XVI
[1051] To a compound of Formula XIV, an appropriately substituted
benzylamine XV (e.g. 4-(trifluoromethyl)benzylamine), a base (e.g.
sodium tert-butoxide), a catalyst (e.g.
tris(dibenzylideneacetone)dipalladium(0)), and ligand (e.g.
2,2'-Bis(diphenylphosphino)-1,1'-binaphthyl) are added a
non-reactive solvent (e.g. toluene) under an inert atmosphere.
Typically, the reaction is heated (e.g. 80.degree. C.) for several
hours. Isolation by conventional means (e.g. extraction and silica
gel chromatography) affords compounds of Formula XVI.
Step 6--Preparation of Compounds of Formula Id
[1052] To compound of Formula XVI is added an appropriate polar
solvent (e.g. tetrahydrofuran) followed by an appropriate reagent
to remove the protecting group (e.g. tetra-n-butylammonium
fluoride). Typically, the reaction is allowed to stir at room
temperature for several hours. Isolation by conventional means
(e.g. extraction and silica gel chromatography) affords compounds
of Formula Id.
Example 14: Synthesis of Compounds of Formula I where n is 1, P is
CR.sup.32, Q, T, X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH,
L.sup.1 is --CH.sub.2--, L.sup.2 is --NHCH.sub.2--, and R.sup.1 is
substituted phenyl (Formula Ie)
[1053] Compounds of Formula Id, where R.sup.32 is a substituent as
defined for optionally substituted heteroarylene and R.sup.33 is a
substituent as defined for optionally substituted aryl, can be
synthesized in five Steps from appropriately substituted
2-amino-5-bromopyridines as shown in the following general Scheme
16.
##STR00112## ##STR00113##
Step-1--Preparation of Compounds of Formula XIX
[1054] To a solution of an appropriately substituted benzaldehyde
XVIII (e.g. p-trifluoromethyl benzaldehyde) in a non-reactive
solvent (e.g. tetrahydrofuran) can be added an appropriate
2-amino-5-bromo-pyridine XVII (e.g.
2-amino-5-bromo-6-methylpyridine), followed by appropriate reagents
to effect the reduction (e.g. dibutyltin dichloride and
phenylsilane). Typically the reaction is heated (e.g. 50.degree.
C.) overnight. Isolation by conventional means (e.g. extraction)
affords compounds of Formula XIX.
Step-2--Preparation of Compounds of Formula XX
[1055] Compound of Formula XIX is dissolved in a non-reactive
solvent (e.g. tetrahydrofuran) and typically cooled at -78.degree.
C. under an inert atmosphere. To this mixture is added an
organolithium reagent (e.g. methyllithium). The reaction mixture is
typically stirred at -78.degree. C. for several hours. To this
mixture is added an organolithium reagent (e.g. tert-butyllithium)
and the mixture is stirred for several hours. The reaction mixture
is maintained at -78.degree. C., and an appropriate formylating
reagent (e.g. 1-piperidine carboxaldehyde) is added. Typically, the
reaction is allowed to stir at -78.degree. C. for an additional
several hours and slowly warmed to room temperature. Isolation by
conventional means (e.g. extraction) affords compounds of Formula
XX.
Step-3--Preparation of Compounds of Formula XXI
[1056] Compound of Formula XX is dissolved in a non-reactive
solvent (e.g. tetrahydrofuran) and stirred under an inert
atmosphere. To this solution is added a base (e.g. triethylamine)
and typically a catalyst (e.g. 4-dimethylaminopyridine). Typically,
the mixture is stirred for a few minutes, and then a reagent
appropriate for the introduction of a protecting group (e.g.
di-tert-butyldicarbonate) is added. Typically, the reaction is
stirred overnight. Isolation by conventional means (e.g.
extraction) affords compounds of Formula XXI.
Step-4--Preparation of Compounds of Formula XXII and XIII
[1057] 1H-Pyrrolo[2,3-b]pyridine 1 is added to a stirred solution
of base (e.g. potassium hydroxide) in an appropriate polar solvent
(e.g. methanol). Compound of Formula XXI is added, and the mixture
is typically stirred at room temperature for several days. The
solvent is evaporated and 1 M HCl is added to the residue.
Isolation by conventional means (e.g. extraction, silica gel
chromatography) affords compounds of Formula XXII and XXIII.
Step-5--Preparation of Compounds of Formula Ie
[1058] Typically, compounds of Formula XII and XIII are combined
and dissolved in an appropriate polar aprotic solvent (e.g.
acetonitrile). Reagents appropriate to effect the reduction (e.g.
triethylsilane and trifluoroacetic acid) are added. Typically, the
reaction is stirred at room temperature for several days. Isolation
by conventional means (e.g. extraction, silica gel chromatography)
affords compounds of Formula Ie.
Example 15: Synthesis of
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0012)
[1059]
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-
-trifluoromethyl-benzyl)-amine P-0012 was synthesized in five steps
from commercially available 2-chloro-6-methoxypyridine and
7-azaindole as shown in Scheme 17.
##STR00114##
Step 1--Preparation of 6-chloro-2-methoxypyridine-3-carbaldehyde
(26)
[1060] To 2-Chloro-6-methoxypyridine (25, 0.511 g, 3.56 mmol) in
tetrahydrofuran (10 mL) cooled in a -78.degree. C. acetone/dry ice
bath was added tert-butyllithium (1.7 M in pentane, 5.0 mL, 7.66
mmol). The reaction was allowed to stir for 1 hour.
Dimethylformamide (0.673 mL, 17.4 mmol) was added and the reaction
was allowed to continue for an additional 30 minutes at -78.degree.
C., then stirred for 30 minutes outside of the dry-ice bath. The
reaction was placed back in the dry-ice bath and quenched with 6 N
HCl (1.5 m L) followed by water and allowed to warm to room
temperature. The reaction was extracted with diethyl ether and
aqueous (1M) sodium bicarbonate. The organic layer was separated,
dried with anhydrous magnesium sulfate, filtered and volatiles
removed by rotary evaporation, and the resulting yellow solid was
dried under vacuum to provide 561 mg of compound 26 (3.27 mmol, 92%
yield). MS (ESI) [M+H.sup.+].sup.+=172.0.
Step 2--Preparation of
(6-chloro-2-methoxypyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-yl)methanol
(27)
[1061] To 1H-Pyrrolo[2,3-b]pyridine (1, 0.455 g, 3.85 mmol) and
6-chloro-2-methoxypyridine-3-carbaldehyde (26, 0.661 g, 3.85 mmol)
was added methanol (10 mL) followed by potassium hydroxide (0.310
g, 5.52 mmol). The reaction was allowed to stir at room temperature
overnight. The reaction was extracted with diethyl ether/ethyl
acetate and water. The organic layer was separated, dried over
anhydrous magnesium sulfate, filtered and volatiles were removed by
rotary evaporation to provide a solid that was treated with
dichloromethane and stored in a freezer overnight. The white solid
was collected by vacuum filtration and dried in vacuo to give 613
mg of compound 27 (2.12 mmol, 55%). MS (ESI)
[M+H.sup.+].sup.+=290.1.
Step 3--Preparation
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(28)
[1062] To
(6-chloro-2-methoxypyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-yl)m-
ethanol (27, 0.613 g, 2.12 mmol) in acetonitrile (10 mL) was added
trifluoroacetic acid (0.82 mL, 10.0 mmol) followed by
triethylsilane (1.69 mL, 10.6 mmol). The reaction was allowed to
stir at room temperature for 2 days, then 60.degree. C. for 4
hours. The reaction was extracted with diethyl ether and aqueous
sodium bicarbonate. The organic layer was dried over anhydrous
magnesium sulfate and filtered. The desired material was isolated
from the filtrate by silica gel column chromatography eluting with
1% methanol in dichloromethane to give 516 mg of a white solid
compound 28 (1.88 mmol, 89%). MS (ESI) [M+H.sup.+].sup.+=274.1.
Step 4--Preparation
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1-(triisopropylsilyl-1H-pyrrolo[-
2,3-b]pyridine (29)
[1063] To a clear solution of
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(28, 0.516 g, 1.88 mmol) in dimethylformamide (10 mL) was added
sodium hydride (60% dispersion, 0.113 g, 2.82 mmol). After stirring
at room temperature for 30 minutes, triisopropylsilyl chloride (600
.mu.L, 2.83 mmol) was added. The reaction was stirred at room
temperature for 2 hours, then poured into aqueous (1M) sodium
bicarbonate and extracted with ethyl acetate. The organic layer was
separated, dried (magnesium sulfate), filtered and volatiles were
removed by rotary evaporation to give a crude solid. The compound
was purified by silica gel column chromatography eluting with 2%
ethyl acetate in hexanes. This provided 732 mg of the desired
compound as a white, crystalline solid (29, 1.70 mmol, 90%). MS
(ESI) [M+H.sup.+].sup.+=430.2.
Step 5--Preparation of
[6-Methoxy-5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-(4-trifluoromethyl-benzyl)-amine (31)
[1064]
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1-(triisopropylsilyl)-1H-p-
yrrolo[2,3-b]pyridine (29, 0.104 g, 0.242 mmol),
4-(Trifluoromethyl)benzylamine (30, 0.047 g, 0.266 mmol), sodium
tert-butoxide (0.0325 g, 0.338 mmol)
Tris(dibenzylideneacetone)-dipalladium (0) (0.00062 g, 0.0006
mmol), and 2,2'-Bis(diphenylphosphino)-1,1'-binaphthyl (0.0011 g,
0.0018 mmol) were added to toluene (2 mL) under nitrogen. The
reaction vial was placed in an oil bath at 80.degree. C. for 3
hours. The reaction was poured into water and extracted with ethyl
acetate. The organic layer was dried (magnesium sulfate), filtered,
and volatiles were removed by rotary evaporation. The residue was
purified by silica gel column chromatography eluting with 2% ethyl
acetate in hexanes. This provided 34 mg of the desired compound 31
(0.060 mmol, 25%). MS (ESI) [M+H.sup.+].sup.+=569.3.
Step 6--Preparation of
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0012)
[1065] To
[6-Methoxy-5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-y-
lmethyl)-pyridin-2-yl]44-trifluoromethyl-benzyl)-amine (31, 0.0340
g, 0.0598 mmol) was added tetrahydrofuran (5 mL) followed by
tetra-n-butylammonium fluoride (1M solution in tetrahydrofuran, 66
.mu.L, 0.0658 mmol). The reaction was allowed to stir at room
temperature for 2 hours, then poured into 1:1 water:saturated
sodium bicarbonate and extracted with ethyl acetate. The organic
layer was separated, dried over magnesium sulfate, filtered and the
volatiles were removed by rotary evaporation. The resulting residue
was purified by silica gel column chromatography, eluting with
dichloromethane followed by 1% methanol in dichloromethane and
finally 3% methanol in dichloromethane. This provided 20 mg of the
desired compound as a white solid (P-0012, 0.048 mmol, 81%). MS
(ESI) [M+H.sup.+].sup.+=413.2.
Example 16: Synthesis of
[6-Methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-triflu-
oromethyl-benzyl)-amine (P-0013)
[1066]
[6-Methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4--
trifluoromethyl-benzyl)-amine (P-0013) was synthesized in five
steps from commercially available 2-amino-5-bromo-6-methylpyridine
and 7-azaindole as shown in Scheme 18.
##STR00115## ##STR00116##
Step-1--Preparation of
(5-Bromo-6-methyl-pyridin-yl)-(4-trifluoromethyl-benzyl)-amine
(34)
[1067] To a solution of p-trifluoromethylbenzaldehyde (16, 1.00 g,
5.74 mmol) in tetrahydrofuran (9 mL) was added
2-amino-5-bromo-6-methylpyridine (33, 1.08 g, 5.77 mmol), followed
by dibutyltin dichloride (40 mg, 0.13 mmol). The mixture was
stirred for 5 minutes at 25.degree. C. and phenylsilane (0.69 g.
6.4 mmol) was added. The reaction was heated at 50.degree. C.
overnight, then the solvent was removed at reduced pressure. Ethyl
acetate was added to the resulting solid which was washed with
saturated sodium carbonate, dried over magnesium sulfate and
filtered. Concentration under reduced pressure afforded a light
yellow solid (34, 1.7 g, 4.93 mmol). MS (ESI)
[M+H.sup.+].sup.+=345.1.
Step-2--Preparation of
2-Methy-6-(4-trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde
(35)
[1068]
(5-Bromo-6-methyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine
(34, 1.7 g, 4.93 mmol) was dissolved in tetrahydrofuran (40 mL) and
cooled at -78.degree. C. under a nitrogen atmosphere. To this
mixture was added methyllithium (1.6 M in diethyl ether, 5.91 mmol)
dropwise over 20 minutes. After the addition of methyllithium was
completed, the reaction mixture was stirred at -78.degree. C. for 2
hours. To this mixture was added tert-butyllithium (1.7 M in
pentane. 10.85 mmol) and the mixture was stirred for 4 hours. The
reaction mixture was maintained at -78.degree. C., and
1-piperidinecarboxaldehyde (0.60 mL, 5.42 mmol) was added dropwise.
The reaction was allowed to stir at -78.degree. C. for an
additional 2 hours and warming to 25.degree. C. was achieved from
the slow evaporation of the dry ice/acetone cooling bath. The
reaction was quenched with ice cold saturated sodium chloride and
the resulting mixture was extracted with ethyl acetate. The organic
layer was dried over magnesium sulfate and filtered. Concentration
under reduced pressure afforded an orange oil (35, 1.4 g, 4.93
mmol). MS (ESI) [M+H.sup.+].sup.+=295.1.
Step-3--Preparation of
(5-Formyl-6-methyl-1-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic
acid tert-butyl ester (36)
[1069]
2-Methyl-6-(4-trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde
(35, 1.4 g, 4.9 mmol) was dissolved in tetrahydrofuran (22 mL) and
was stirred under an atmosphere of nitrogen. To this solution was
added 4-dimethylaminopyridine (150 mg, 1.23 mmol) and triethylamine
(0.66 mL, 4.9 mmol). The mixture was stirred for 5 minutes before
solid di-tert-butyldicarbonate (1.0 g, 4.9 mmol) was added directly
to the reaction mixture. The mixture was stirred overnight at
25.degree. C. and was diluted with ethyl acetate and washed with
sodium bicarbonate, followed by washing with saturated sodium
chloride. The resulting organic layer was dried over magnesium
sulfate, filtered and evaporated to give a beige solid (36, 1.8 g,
4.6 mmol). MS (ESI) [M+H.sup.+].sup.+=395.2.
Step-4--Preparation of
{5-[Hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester (37)
and
{5-[Methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester
(38)
[1070] 1H-Pyrrolo[2,3-b]pyridine (1, 540 mg, 4.57 mmol) was added
to a stirring solution of potassium hydroxide (868 mg, 10.08 mmol)
in methanol (33 mL). Once the mixture was homogeneous,
(5-formyl-6-methyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic
acid tert-butyl ester (36, 1.8 g, 4.6 mmol) was added and the
mixture was stirred at 25.degree. C. for 72 hours. The solvent was
evaporated and 1 M HCl was added to the residue. The organic
material was extracted with ethyl acetate and washed with 10%
sodium bicarbonate, followed by washing with saturated sodium
chloride. The organic layer was dried over magnesium sulfate.
Concentration under reduced pressure afforded the crude material,
which was purified by silica gel column chromatography (0-5%
methanol in dichloromethane) to yield the desired compounds as a
light yellow solid (37 and 38 as a mixture, 294 mg; 13% yield). MS
(ESI) [M+H.sup.+].sup.+=511.2 for 37 and MS (ESI)
[M+H.sup.+].sup.+=525.2 for 38.
Step-5 Preparation of
[6-Methyl-5-(1H-pyrrolo[2,3-b]bipyridin-3-ylmethyl)-pyridin-2-yl]-(4-trif-
luoromethyl-benzyl)-amine (P-0013)
[1071] The combined materials of
{5-[Hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester (37)
and
(5-[Methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
)-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester (38)
(194 mg, 0.378 mmol) were dissolved in acetonitrile (3 mL) and
triethylsilane (0.30 mL, 1.9 mmol) and trifluoroacetic acid (0.17
mL, 2.3 mmol) were added. After stirring at 25.degree. C. for
overnight. TLC analysis indicated that the reaction was about 50%
complete. To the reaction mixture was added triethylsilane (0.30
mL, 1.9 mmol), and trifluoroacetic acid (0.17 mL, 2.3 mmol). The
mixture was allowed to stir for another 48 hours at 25.degree. C.
and the solvent, excess triethylsilane and trifluoroacetic acid
were removed by evaporation. Ethyl acetate was added and washed
with saturated sodium bicarbonate. The organic layer was dried over
magnesium sulfate, filtered and concentrated at reduced pressure to
afford a brown oil. Purification of 80 mg of the crude material was
carried out using preparatory chromatography (50% ethyl acetate in
hexanes) to afford the compound as an off-white solid (P-013, 10
mg, 0.025 mmol). MS (ESI) [M+H.sup.+].sup.+=397.2.
[1072]
(4-Chloro-benzyl)-[6-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl]-amine P-0014
##STR00117##
was prepared following the protocol of Scheme 18, substituting
4-trifluoromethyl benzaldehyde with 4-chlorobenzaldehyde (40) in
Step 1. MS (ESI) [M+H.sup.+].sup.+=363.1.
Example 17: Synthesis of
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro--
benzyl)-amine (P-0038)
[1073]
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-c-
hloro-benzyl)-amine P-0038 was synthesized in 5 steps from
commercially available 2-Amino-5-bromopyridine 15 as shown in
Scheme 19.
##STR00118## ##STR00119##
Step 1--Synthesis of (5-Bromo-pyridin-2-yl)-(4-chloro-benzyl)-amine
(41)
[1074] To 2-Amino-5-bromopyridine (15, 6.10 g, 0.0352 mol) in
toluene (90.0 mL) were added 4-chlorobenzaldehyde (40, 5.00 g,
0.0356 mol), trifluoroacetic acid (8.0 mL, 0.10 mol) and
triethylsilane (16.5 mL, 0.103 mol). The reaction was heated to
reflux for 48 hours. The reaction was concentrated, poured into
aqueous potassium carbonate and extracted with ethyl acetate. The
organic layer was washed with brine, dried over sodium sulfate and
concentrated. The crude residue was crystallized with ethyl acetate
to give compound (41, 6.8 g, 65.4%).
Step 2--Synthesis of
6-(4-Chloro-benzylamino)-pyridine-3-carbaldehyde (42)
[1075] To (5-Bromo-pyridin-2-yl)-(4-chloro-benzyl)-amine (41, 10.00
g, 0.03360 mol) in tetrahydrofuran (400.0 mL) under an atmosphere
of nitrogen at -78.degree. C. was added n-butyllithium (17.5 mL,
2.00 M in cyclohexane). After 90 minutes, tert-butyllithium (42.00
mL, 1.70 M in hexane) was added to the reaction. After 80 minutes,
N,N-dimethylformamide (6.9 mL, 0.089 mol) was added to the
reaction. The reaction mixture was stirred at -78.degree. C. for 2
hours, then allowed to warm to room temperature for 1 hour. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate and concentrated to give the crude compound, which was
crystallized from tert-butoxyl methyl ether to provide compound
(42, 7.66 g, 92.2%).
Step 3--Synthesis of
(4-Chloro-benzyl)-(5-formyl-pyridin-2-yl-carbamic Acid Tert-Butyl
Ester (43)
[1076] To 6-(4-Chloro-benzylamino)-pyridine-3-carbaldehyde (42,
2.00 g, 8.11 mmol) in dichloromethane (20.0 mL) were added
triethylamine (1.70 mL, 12.2 mmol), di-tert-butyldicarbonate (2.00
g, 9.16 mmol) and 4-dimethylaminopyridine (52.3 mg, 0.43 mmol). The
reaction was stirred at room temperature for 48 hours. The reaction
was concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give compound (43, 2.50
g, 89.3%).
Step 4--Synthesis of
{5-[(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-pyridin-2-yl}-
-(4-chloro-benzyl)-carbamic acid tert-butyl ester (45)
[1077] To 5-bromo-7-azaindole (44, 198.0 mg, 1.01 mmol) in methanol
(30.0 mL, 0.741 mol) were added
(4-Chloro-benzyl)-(5-formyl-pyridin-2-yl)-carbamic acid tert-butyl
ester (43, 355.0 mg, 1.02 mmol) and potassium hydroxide (80.0 mg,
1.42 mmol). The reaction was stirred at room temperature 48 hours.
The reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 8% methanol in dichloromethane to give
compound (45, 200.0 mg, 36.8%).
Step 5--Synthesis of
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro--
benzyl)-amine (P-0038)
[1078] To
{5-[(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-pyri-
din-2-yl}-(4-chloro-benzyl)-carbamic acid tert-butyl ester (45,
180.0 mg, 0.33 mmol) in acetonitrile (30.0 mL) were added
trifluoroacetic acid (2.0 mL, 0.026 mol) and triethylsilane (4.0
mL, 0.025 mol). The reaction was heated to reflux for 4 hours. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 10% methanol in dichloromethane to give
compound (P-0038, 120 mg. 85.2%). MS (ESI)[M+H.sup.+].sup.+=427.2,
429.2.
[1079] Additional compounds were prepared following the protocol of
Scheme 19, optionally replacing 4-chlorobenzaldehyde 40 with an
appropriate aldehyde in Step 1 and optionally replacing
5-bromo-7-azindole 44 with an appropriate azaindole in Step 4. The
following compounds were made following this procedure: [1080]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-triflu-
oromethyl-pyridin-3-ylmethyl)-amine (P-0181). [1081]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl-pyridin-2-yl]-(6-trifluoromethyl--
pyridin-3-ylmethyl)-amine (P-0182), [1082]
3-[6-(4-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0257), [1083]
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0269), [1084]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-fluoro-
-benzyl)-amine (P-0270), [1085]
3-[6-(2-Fluoro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0271), [1086]
(2-Fluoro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0272), [1087]
3-{6-[(6-Trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1-
H-pyrrolo[2,3-b]pyridine-5-carbonitrile (P-0273), [1088]
3-[6-(2-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0274), [1089]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-triflu-
oromethyl-benzyl)-amine (P-0275), [1090]
[5-(5-Methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-triflu-
oromethyl-benzyl)-amine (P-0276), [1091]
3-[6-(2,6-Difluoro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyri-
dine-5-carbonitrile (P-0277), [1092]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2,6-di
fluoro-benzyl)-amine (P-0278), [1093]
(2-Chloro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0279), [1094]
(2-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0280), [1095]
3-[6-(2-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0281), [1096]
(6-Methoxy-pyridin-3-ylmethyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
methyl)-pyridin-2-yl]-amine (P-0282), [1097]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-methox-
y-pyridin-3-ylmethyl)-amine (P-0283), [1098]
3-{6-[(6-Methoxy-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1H-pyrrol-
o[2,3-b]pyridine-5-carbonitrile (P-0284), [1099]
(2-Methoxy-pyridin-3-ylmethyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
methyl)-pyridin-2-yl]-amine (P-0285), [1100]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-methox-
y-pyridin-3-ylmethyl)-amine (P-0286), [1101]
3-{6-[(2-Methoxy-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl}-1H-pyrrol-
o[2,3-b]pyridine-5-carbonitrile (P-0287), [1102]
(2-Ethoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl)]-
-amine (P-0288), [1103]
(2,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0296), [1104]
(2,5-Difluoro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0297), [1105]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2,5-difl-
uoro-benzyl)-amine (P-0298), [1106]
3-[6-(2,5-Difluoro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyri-
dine-5-carbonitrile (P-0299), [1107]
3-[6-(2-Trifluoromethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3--
b]pyridine-5-carbonitrile (P-0321), [1108]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-trifluoromethox-
y-benzyl)-amine (P-0322), [1109]
3-[6-(2-Ethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine-
-5-carbonitrile (P-0323), [1110]
[5-(5-Fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-triflu-
oromethyl-benzyl)-amine (P-0325), [1111]
[5-(5-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-trifl-
uoromethyl-benzyl)-amine (P-0326), [1112]
(2-Chloro-benzyl)-[5-(5-fluoro-1H-pyrrolo[1,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0327). [1113]
(2-Chloro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0328), [1114]
(2,5-Difluoro-benzyl)-[5-(5-fluoro-1H-pyrrolo[1,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0329), [1115]
(2,5-Difluoro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0330), [1116]
[5-(5-Fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-methox-
y-pyridin-3-ylmethyl)-amine (P-0331), [1117]
(6-Methoxy-pyridin-3-ylmethyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-y-
lmethyl)-pyridin-2-yl]-amine (P-0332), [1118]
(2,6-Difluoro-benzyl)-[5-(5-fluoro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0333), [1119]
(2,6-Difluoro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0334), [1120]
(2-Methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0336), [1121]
3-[6-(2-Methoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridin-
-5-carbonitrile (P-0337), [1122]
(2,6-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0340), and [1123]
(2,6-Difluoro-benzyl)-[5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0341). The following table indicates the
aldehyde used in Step 1 in Column 3 and the azaindole used in Step
4 in Column 2 to provide the compound of Column 4. Column 1
provides the compound number and Column 5 the measured mass
spectrometry result.
TABLE-US-00003 [1123] Com- pound Azaindole Aldehyde MS number in
Step 4 in Step 1 Compound structure [M + H.sup.+].sup.+ P-0181
##STR00120## ##STR00121## ##STR00122## 418.2 P-0182 ##STR00123##
##STR00124## ##STR00125## 384.2 P-0257 ##STR00126## ##STR00127##
##STR00128## 374.2 P-0269 ##STR00129## ##STR00130## ##STR00131##
408.7 P-0270 ##STR00132## ##STR00133## ##STR00134## 367.0 P-0271
##STR00135## ##STR00136## ##STR00137## 358.0 P-0272 ##STR00138##
##STR00139## ##STR00140## 347.0 P-0273 ##STR00141## ##STR00142##
##STR00143## 409.4 P-0274 ##STR00144## ##STR00145## ##STR00146##
408.5 P-0275 ##STR00147## ##STR00148## ##STR00149## 417.0 P-0276
##STR00150## ##STR00151## ##STR00152## 397.6 P-0277 ##STR00153##
##STR00154## ##STR00155## 376.5 P-0278 ##STR00156## ##STR00157##
##STR00158## 385.0 P-0279 ##STR00159## ##STR00160## ##STR00161##
363.0 P-0280 ##STR00162## ##STR00163## ##STR00164## 383.3 P-0281
##STR00165## ##STR00166## ##STR00167## 374.0 P-0282 ##STR00168##
##STR00169## ##STR00170## 360.8 P-0283 ##STR00171## ##STR00172##
##STR00173## 380.0 P-0284 ##STR00174## ##STR00175## ##STR00176##
371.5 P-0285 ##STR00177## ##STR00178## ##STR00179## 360.1 P-0286
##STR00180## ##STR00181## ##STR00182## 380.0 P-0287 ##STR00183##
##STR00184## ##STR00185## 371.0 P-0288 ##STR00186## ##STR00187##
##STR00188## 359.6 P-0296 ##STR00189## ##STR00190## ##STR00191##
351.6 P-0297 ##STR00192## ##STR00193## ##STR00194## 365.5 P-0298
##STR00195## ##STR00196## ##STR00197## 385.9 P-0299 ##STR00198##
##STR00199## ##STR00200## 376.4 P-0321 ##STR00201## ##STR00202##
##STR00203## 424.6 P-0322 ##STR00204## ##STR00205## ##STR00206##
399.5 P-0323 ##STR00207## ##STR00208## ##STR00209## 384.7 P-0325
##STR00210## ##STR00211## ##STR00212## 401.5 P-0326 ##STR00213##
##STR00214## ##STR00215## 413.4 P-0327 ##STR00216## ##STR00217##
##STR00218## 367.2 P-0328 ##STR00219## ##STR00220## ##STR00221##
379.0 P-0329 ##STR00222## ##STR00223## ##STR00224## 369.7 P-0330
##STR00225## ##STR00226## ##STR00227## 381.6 P-0331 ##STR00228##
##STR00229## ##STR00230## 364.5 P-0332 ##STR00231## ##STR00232##
##STR00233## 376.4 P-0333 ##STR00234## ##STR00235## ##STR00236##
369.6 P-0334 ##STR00237## ##STR00238## ##STR00239## 381.6 P-0336
##STR00240## ##STR00241## ##STR00242## 345.7 P-0337 ##STR00243##
##STR00244## ##STR00245## 370.7 P-0340 ##STR00246## ##STR00247##
##STR00248## 351.5 P-0341 ##STR00249## ##STR00250## ##STR00251##
365.5
[1124] Additional compounds were prepared following the protocol of
Scheme 19, Steps, 4 and 5, replacing
(4-Chloro-benzyl)-(5-formyl-pyridin-2-yl)-carbamic acid tert-butyl
ester 43 with an appropriate protected aldehyde and
5-bromo-7-azaindole 44 with an appropriate azaindole in Step 4.
Aldehydes were prepared as described in Example 60. The following
compounds were made following this procedure: [1125]
3-{2-Chloro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridin-3-yl-
methyl}-1H-pyrrolo[2,3-b]pyridine-5-carbonitrile (P-0232), [1126]
[6-Chloro-5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0233), [1127]
[6-Chloro-5-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0234), [1128]
(3-Chloro-pyridin-4-ylmethyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0235), [1129]
3-{6-[(3-Chloro-pyridin-4-ylmethyl)-amino]-pyridin-3-ylmethyl}-1H-pyrrolo-
[2,3-b]pyridine-5-carbonitrile (P-0236), [1130]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-difluo-
romethoxy-benzyl)-amine (P-0338), [1131]
3-[6-(2-Difluoromethoxy-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridine-5-carbonitrile (P-0339), The following table indicates
the aldehyde used in Column 2 and the azaindole used in Column 3 to
provide the compound of Column 4. Column 1 provides the compound
number and Column 5 the measured mass spectrometry result.
TABLE-US-00004 [1131] Com- MS pound number Aldehyde Azaindole
Compound [M + H.sup.+].sup.+ P-0232 ##STR00252## ##STR00253##
##STR00254## 443.0 P-0233 ##STR00255## ##STR00256## ##STR00257## [M
- H.sup.+].sup.- = 446.1 P-0234 ##STR00258## ##STR00259##
##STR00260## 430.1 P-0235 ##STR00261## ##STR00262## ##STR00263##
383.9 P-0256 ##STR00264## ##STR00265## ##STR00266## 375.2 P-0338
##STR00267## ##STR00268## ##STR00269## 415.0 P-0339 ##STR00270##
##STR00271## ##STR00272## 406.6
Example 18: Synthesis of
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
47
[1132] Compound 47 was synthesized in 2 steps from 7-azaindole 1 as
described in Scheme 20.
##STR00273##
Step 1--Preparation of 1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
(46)
[1133] To 1H-Pyrrolo[2,3-b]pyridine (1, 16.0 g, 135 mmol) in water
(110 mL), were added hexamethylenetetramine (26.0 g, 185 mmol), and
acetic acid (55.0 mL, 967 mmol). The reaction was refluxed for 12
hours. Water (329 mL) was added and the reaction was cooled to room
temperature. The reaction was filtrated and washed with water to
give compound (46, 15.0 g, 76%). MS(ES) [M+H.sup.+].sup.+=147.
Step 2--Preparation of
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
(47)
[1134] To 1H-Pyrrolo[2,3-b]pyridine-3-carbaldehyde (46, 4.05 g,
27.71 mmol) in tetrahydrofuran (30.0 mL) were added sodium hydride
(60% in mineral oil, 1.5 g, 38 mmol) and triisopropylsilyl chloride
(8.0 mL, 38 mmol) under an atmosphere of nitrogen. The reaction was
stirred for 2 hours at room temperature. The reaction was poured
into water and extracted with ethyl acetate. The organic layer was
washed with brine, dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 10% ethyl acetate in hexane to
give compound (47, 3.0 g, 36%). MS (ESI) [M+H.sup.+].sup.+=303.
[1135]
1-(tert-Butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3-b]pyridine
66
##STR00274##
was prepared following the protocol of Scheme 20 Step 2,
substituting 1H-Pyrrolo[2,3-b]pyridine-3-carbaldehyde 46 with
3-iodo-1H-pyrrolo[2,3-b]pyridine and triisopropylsilyl chloride
with tert-Butyl-dimethyl-silyl chloride.
[1136] 1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
55
##STR00275##
was prepared following the protocol of Scheme 20, substituting
triisopropylsilyl chloride with benzenesulfonyl chloride in Step
2.
Example 19: Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzenesulfonamide (P-0071)
[1137]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluor-
omethyl-benzenesulfonamide P-4071 was synthesized in 3 steps from
2-Amino-5-bromopyridine 15 as shown in Scheme 21.
##STR00276##
Step 1--Synthesis of
N-(5-Bromo-pyridin-2-yl)-4-trifluoromethyl-benzenesulfonamide
(49)
[1138] To 2-Amino-5-bromopyridine (15, 1.50 g, 8.67 mmol) in
acetonitrile (20.0 mL) were added pyridine (6.0 mL, 0.074 mol),
4-dimethylaminopyridine (0.10 g. 0.82 mmol) and
4-trifluoromethyl-benzenesulfonyl chloride (48, 2.14 g, 8.75 mmol).
The reaction mixture was stirred at room temperature overnight. The
reaction was concentrated, poured into water, acidified with 1N HCl
to pH=2, and extracted with ethyl acetate. The organic layer was
washed with brine, dried over anhydrous sodium sulfate and
concentrated. The residue was washed with ethyl acetate to give a
white solid as desired compound (49, 2.80 g, 84.8%). MS (ESI)
[M+H.sup.+].sup.+=381.0, 383.0.
Step 2--Synthesis of
N-5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl-
]-pyridin-2-yl-4-trifluoromethyl-benzenesulfonamide (50)
[1139] To
N-(5-Bromo-pyridin-2-yl)-4-trifluoromethyl-benzenesulfonamide (49,
0.96 g, 2.5 mmol) in tetrahydrofuran (50.0 mL) under an atmosphere
of nitrogen at -78.degree. C., tert-butyllithium (4.62 mL, 1.70 M
in hexane) was added slowly. After 15 minutes,
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (47,
0.30 g, 0.99 mmol, prepared as described in Example 18) in
tetrahydrofuran (15.0 mL) was added to the reaction. After 30
minutes, the reaction was allowed to come to room temperature for
10 minutes. The reaction was poured into water, acidified with 1N
HCl to pH around 2, and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% ethyl acetate in hexane to give a
white solid compound (50, 0.55 g, 90.1%). MS (ESI)
[M+H.sup.+].sup.+=605.3.
Step 3--Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzenesulfonamide (P-0071)
[1140] To
N-5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-y-
l)-methyl]-pyridin-2-yl-4-trifluoromethyl-benzenesulfonamide (50,
0.27 g. 0.45 mmol) in acetonitrile (15.0 mL) were added
trifluoroacetic acid (1.0 mL, 0.013 mol) and triethylsilane (2.0
mL, 0.012 mol). The reaction was heated to 85.degree. C. for 1
hour. The reaction was concentrated, poured into water and
extracted with ethyl acetate. The organic layer was purified with
silica gel column chromatography eluting with 50% ethyl acetate in
hexane to give a white solid compound (P-0071, 28.5 mg, 14.7%). MS
(ESI) [M+H.sup.+].sup.+=433.2.
[1141]
4-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-b-
enzamide P-0074
##STR00277##
was prepared following the protocol of Scheme 21, substituting
4-trifluoromethyl-benzenesulfonyl chloride 48 with 4-chloro-benzoyl
chloride in step 1. MS (ESI) [M+H.sup.+].sup.+=363.2.
Example 20: Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzamide (P-0072)
[1142]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluor-
omethyl-benzamide P-0072 was synthesized in one step from
(3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopopylsilanyl-1H-pyrrolo[2,3-b]pyr-
idine 6a as shown in Scheme 22.
##STR00278##
Step 1--Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzamide (P-0072)
[1143] To 3-(6-Bromo-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(6a, 50.0 mg, 0.000174 mol, prepared as described in Example 2) in
1,4-dioxane (4.0 mL) were added 4-trifluoromethyl-benzamide (51,
70.0 mg, 0.37 mmol), Xanthphos (15.0 mg, 0.026 mmol), cesium
carbonate (130.0 mg, 0.40 mmol) and
Tris(dibenzylideneacetone)-dipalladium(0) (25.0 mg, 0.024 mmol)
under an atmosphere of nitrogen. The reaction was heated to
120.degree. C. for 10 minutes in a CEM Discover microwave
instrument. The reaction was poured into water and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was concentrated and purified by
silica gel column chromatography eluting with 50% ethyl acetate in
hexane to give a white solid (P-0072.4.7 mg, 6.8%). MS (ESI)
[M+H.sup.+].sup.+=397.2.
[1144]
4-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-b-
enzamide P-0073
##STR00279##
was prepared following the protocol of Scheme 22, substituting
4-trifluoromethyl-benzamide with 4-fluoromethyl-benzamide. MS (ESI)
[M+H.sup.+].sup.+=347.2.
Example 21: Synthesis of
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylme-
thyl]-amine (P-0078)
[1145]
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-ylmethyl]-amine P-0078 was synthesized in 3 steps from
5-Bromo-pyridine-2-carbaldehyde 52 as shown in Scheme 23.
##STR00280##
Step 1--Synthesis of
(5-Bromo-pyridin-2-ylmethyl)-(4-chloro-phenyl)-amine (54)
[1146] To 5-Bromo-pyridine-2-carbaldehyde (52, 1.00 g, 5.38 mmol)
in acetonitrile (50.0 mL) were added p-chloroaniline (53, 0.686 g,
5.38 mmol), triethylsilane (6.00 mL, 0.0376 mol) and
trifluoroacetic acid (3.00 mL, 0.0389 mol). The reaction was heated
to reflux for 3 hours. The reaction was concentrated, poured into
water and then extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give a white solid (54,
0.75 g, 47.0%).
Step 2--Synthesis of
(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(4-chloro-phenylamin-
o)-methyl]-pyridin-3-yl-methanol (56)
[1147] To (5-Bromo-pyridin-2-ylmethyl)-(4-chloro-phenyl)-amine (54,
0.380 g, 1.28 mmol) in tetrahydrofuran (15.0 mL) under an
atmosphere of nitrogen at -78.degree. C., was added n-butyllithium
(0.850 mL, 1.60 M in hexane). After 10 minutes,
1,2-bis-(chloro-dimethyl-silanyl)-ethane (0.135 g. 0.627 mmol) in
tetrahydrofuran (5.0 mL) was added to the reaction. The reaction
was allowed to warm to room temperature for 40 minutes. The
reaction was cooled to -78.degree. C., followed by addition of 1.70
M tert-butyllithium in hexane (1.58 mL). After 30 minutes,
1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (55,
0.380 g, 1.33 mmol, prepared as described in Example 18) in
tetrahydrofuran (10.0 mL) was added to the reaction. After 20
minutes, the reaction was allowed to warm to room temperature. The
reaction was poured into water and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 50% ethyl acetate in hexane to
give compound (56, 0.30 g, 46.0%). MS (ESI)
[M+H.sup.+].sup.+=505.3.
Step
3-(4-Chloro-phenyl)-5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl-
]-pyridin-2-ylmethyl-amine (57)
[1148] To
(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(4-chloro-p-
henylamino)-methyl]-pyridin-3-yl-methanol (56, 120.0 mg, 0.24 mmol)
in methanol (20.0 mL) were added potassium hydroxide (0.400 g, 7.13
mmol) and water (5.0 mL, 0.28 mol). The reaction was heated to
50.degree. C. for 10 hours. The reaction was poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give compound (57, 30
mg, 33.0%). MS (ESI) [M+H.sup.+].sup.+=379.4.
Step 4--Synthesis of
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylme-
thyl]-amine (P-0078)
[1149] To
(4-Chloro-phenyl)-5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-met-
hyl]-pyridin-2-ylmethyl-amine (57, 20.8 mg, 0.055 mmol) in
acetonitrile (10.0 mL) were added trifluoroacetic acid (0.50 mL,
6.5 mmol) and triethylsilane (1.00 mL, 6.26 mmol). The reaction was
heated to reflux for 3 hours, then poured into water and extracted
with ethyl acetate. The organic layer was dried over anhydrous
sodium sulfate and filtered. The filtrate was concentrated and
purified by silica gel column chromatography elating with 10%
methanol in dichloromethane to give compound (P-0078, 6.1 mg,
32.0%). MS (ESI) [M+H.sup.+].sup.+=349.4.
Example 22: Synthesis of
(4-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0082)
[1150]
(4-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl]-amine P-0082 was synthesized in 8 steps from
2,6-Difluoropyridine 58 as shown in Scheme 24.
##STR00281## ##STR00282##
Step 1--Synthesis of 2,6-Difluoro-nicotinic Acid (59)
[1151] To 2,6-difluoropyridine (58, 7.10 g, 0.0617 mol) in
tetrahydrofuran (150.0 mL) under an atmosphere of nitrogen at
-78.degree. C., n-butyllithium (26.0 mL, 2.50 M in hexane) was
added slowly. After 30 minutes, dry ice (3.0 g) was added to the
reaction. After 1 hour, the reaction was allowed to warm to room
temperature, then poured into water and extracted with ethyl
acetate. The aqueous layer was acidified with 1 N HCl to pH=4-5 and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate, filtered and concentrated to give the
crude compound as a light yellow solid (59, 5.6 g, 57.0%).
Step 2--Synthesis of 2,6-Difluoro-nicotinic Acid Methyl Ester
(60)
[1152] To 2,6-difluoro-nicotinic acid (59, 5.60 g, 0.0352 mol) in
methanol (60.0 mL) was added concentrated sulfuric acid (1.0 mL,
0.019 mol). The reaction was heated to reflux overnight, then
poured into water, basified with 1M potassium carbonate to pH
around 9, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and concentrated to give a
yellow oil (60, 3.5 g, 57.0%).
Step 3--Synthesis of 6-(4-Chloro-benzylamino)-2-fluoro-nicotinic
Acid Methyl Ester (62)
[1153] To 2,6-difluoro-nicotinic acid methyl ester (60, 2.00 g,
0.0116 mol) in N,N-dimethylformamide (20.0 mL), under an atmosphere
of nitrogen at -40.degree. C., was added p-chlorobenzylamine (61,
2.60 mL, 0.0214 mol). The reaction was stirred at -40.degree. C. to
-20.degree. C. for 2 hours, then poured into water and extracted
with ethyl acetate. The organic layer was dried over anhydrous
sodium sulfate and filtered. The filtrate was concentrated and
purified by silica gel column chromatography eluting with 25% ethyl
acetate in hexane to give compound (62, 2.0 g, 58.7%).
Step 4--Synthesis of
[6-(4-Chloro-benzylamino)-2-fluoro-pyridin-3-yl]-methanol (63)
[1154] To 6-(4-Chloro-benzylamino)-2-fluoro-nicotinic acid methyl
ester (62, 2.00 g, 6.79 mmol) in tetrahydrofuran (100.0 mL) was
added lithium tetrahydroaluminate (13.6 mL, 1.00 M in
Tetrahydrofuran) under an atmosphere of nitrogen. The reaction was
stirred at room temperature overnight. To the reaction was added an
excessive amount of NaSO.sub.4.10H.sub.2O, and then stirred for 1
hour. Filtration, concentration and purification with silica gel
column chromatography eluting with 30% ethyl acetate in hexane
provided compound 63 (1.0 g, 55.0%).
Step 5--Synthesis of
6-(4-Chloro-benzylamino)-2-fluoro-pyridine-3-carbaldehyde (64)
[1155] To [6-(4-Chloro-benzylamino)-2-fluoro-pyridin-3-yl]-methanol
(63, 1.0 g, 3.7 mmol) in tetrahydrofuran (50.0 mL) was added
Dess-Martin periodinane (1.75 g, 4.12 mmol). The reaction was
stirred at room temperature for 10 minutes, then poured into water
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give a white solid (64,
0.67 g, 68.0%).
Step 6--Synthesis of
(4-Chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic Acid
Tert-Butyl Ester (65)
[1156] To 6-(4-Chloro-benzylamino)-2-fluoro-pyridine-3-carbaldehyde
(64, 670.0 mg, 2.53 mmol) in dichloromethane (16.2 mL) were added
di-tert-butyldicarbonate (1.23 g, 5.65 mmol) and
4-dimethylaminopyridine (16.2 mg. 0.133 mmol). The reaction was
stirred at room temperature overnight. The reaction was
concentrated and purified by silica gel column chromatography
eluting with 30% ethyl acetate in hexane to give a white solid (65,
0.63 g, 68.0%).
Step 7--Synthesis of
(5-[1-(tert-Butyl-dimethyl-silanyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-hydrox-
y-methyl-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-carbamic Acid
Tert-Butyl Ester (67)
[1157] To
1-(tert-butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3-b]pyridine
(66, 0.53 g, 0.0015 mol) and tetrahydrofuran (15.0 mL), under an
atmosphere of nitrogen at -20.degree. C., was added
isopropylmagnesium chloride (0.78 mL. 2.0 M in tetrahydrofuran).
The reaction was allowed to warm to 0.degree. C. (around 80
minutes), then cooled to -20.degree. C., followed by addition of
(4-Chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester (65, 0.200 g, 0.55 mmol) in tetrahydrofuran (6.0
mL). The reaction was allowed to warm to room temperature in 1
hour, then poured into water and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate, and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 20% ethyl acetate in hexane to
give a yellow solid (67, 0.20 g, 61.1%). MS (ESI)
[M+H.sup.+].sup.+=597.4.
Step 8--Synthesis of
(4-Chloro-benzyl-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0082)
[1158] To
(5-[1-(tert-Butyl-dimethyl-silanyl)-1H-pyrrolo[2,3-b]pyridin-3-y-
l]-hydroxy-methyl-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-carbamic
acid tert-butyl ester (67, 0.10 g. 0.17 mmol) in acetonitrile (10.0
mL) were added triethylsilane (1.00 mL, 6.26 mmol) and
trifluoroacetic acid (0.50 mL, 6.5 mmol). The reaction was heated
to reflux for 2 hours, then poured into aqueous potassium
carbonate, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate, and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 30% ethyl acetate in hexane to give a white solid
(P-0082, 43.2 mg, 70.0%). MS (ESI) [M+H.sup.+].sup.+=367.4.
Example 23: Synthesis of
(4-Chloro-benzyl)-[6-methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0081)
[1159]
(4-Chloro-benzyl)-[6-methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
)-pyridin-2-yl]-amine P-0081 was synthesized in 2 steps from
(4-Chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester 65 as shown in Scheme 25.
##STR00283##
Step 1--Synthesis of
(4-Chloro-benzyl)-5-[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-me-
thoxy-pyridin-2-yl-carbamic acid tert-butyl ester (68)
[1160] To 1H-Pyrrolo[2,3-b]pyridine (1, 90.0 mg, 0.76 mmol) in
methanol (30.0 mL) were added
(4-chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yi)-carbamic acid
tert-butyl ester (65, 300.0 mg, 0.82 mmol) and potassium hydroxide
(720.0 mg, 12.83 mmol) under an atmosphere of nitrogen. The
reaction was stirred at room temperature for 2 hours, then poured
into water and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give the compound (68,
60 mg, 15.9%). MS (ESI) [M+H.sup.+].sup.+=495.3.
Step 2--Synthesis of
(4-Chloro-benzyl)-[6-methoxy-5-(1-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0081)
[1161] To
(4-Chloro-benzyl)-5-[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-met-
hyl]-6-methoxy-pyridin-2-yl-carbamic acid tert-butyl ester (68,
40.0 mg, 0.081 mmol) in acetonitrile (10.0 mL) were added
trifluoroacetic acid (0.30 mL, 0.0039 mol) and triethylsilane (0.60
mL. 0.0038 mol). The reaction was heated to reflux for 3 hours. The
reaction was concentrated to remove the solvents, then purified
with silica gel column chromatography eluting with 40% ethyl
acetate in hexane to give compound (P-081, 10 mg, 32.7%). MS (ESI)
[M+H.sup.+].sup.+=379.4.
Example 24: Synthesis of
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic Acid
(4-chloro-phenyl)-amide (P-0076)
[1162]
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide P-0076 was synthesized in 3 Steps from
5-Bromo-pyridine-2-carbonyl chloride 69 as shown in Scheme 26.
##STR00284##
[1163] Step 1--Synthesis of S-Bromo-pyridine-2-carboxylic acid
(4-chloro-phenyl-amide (70):
[1164] To 5-Bromo-pyridine-2-carbonyl chloride (69, 0.76 g, 3.4
mmol) in acetonitrile (29.0 mL) were added p-chloroaniline (53,
0.702 g, 5.50 mmol), 4-dimethylamino-pyridine (0.12 g. 0.96 mmol)
and pyridine (2.9 mL, 0.036 mol). The reaction was stirred at
68.degree. C. overnight, then poured into water, acidified with 1 N
HCl to pH around 1 and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with dichloromethane to give a white solid
(70, 0.75 g, 70.0%).
Step 2--Synthesis of
5-[Hydroxy-(1-triisopropylsilyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-py-
ridine-2-carboxylic acid (4-chloro-phenyl)-amide (71)
[1165] To 5-Bromo-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (70, 0.50 g, 1.60 mmol) in tetrahydrofuran
(20.0 mL), under an atmosphere of nitrogen at -78.degree. C.,
tert-butyllithium (3.02 mL, 1.70 M in Hexane) was added. After 20
minutes,
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (47,
0.39 g, 1.3 mmol, prepared as described in Example 18) in
tetrahydrofuran (10.0 mL) was added to the reaction. The reaction
was stirred at -78.degree. C. for 1 hour, then allowed to warm to
room temperature for 10 minutes. The reaction was poured into water
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give the compound as
colorless oil (71, 100 mg, 14%). MS (ESI)
[M+H.sup.+].sup.+=535.3.
Step 3--Synthesis of
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (P-0076)
[1166] To
5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methyl]-pyridine-2-carboxylic acid (4-chloro-phenyl)-amide (71,
100.0 mg, 0.19 mmol) in acetonitrile (10.0 mL) were added
trifluoroacetic acid (0.20 mL, 2.6 mmol) and triethylsilane (0.40
mL, 2.5 mmol). The reaction was stirred at 80.degree. C. for 2
hours. The reaction was concentrated and purified by silica gel
column chromatography eluting with 20% ethyl acetate in hexane to
give a yellow solid compound (P-0076, 5.5 mg, 8.1%). MS (ESI)
[M-H.sup.+].sup.+=361.1.
Example 25: Synthesis of
[6-(3-Hydroxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)--
methanone (P-0027)
[1167]
[6-(3-Hydroxy-phenylamino)-pyridin-3-yl]-1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone P-0027 was synthesized in 1 Step from
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone P-0026 as shown in Scheme 27. Scheme 27
##STR00285##
[1168] To
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyr-
idin-3-yl)-methanone (P-0026, 12.0 mg, 0.0285 mmol) in methanol
(5.0 mL) was added 20% palladium hydroxide on carbon (10.0 mg)
under an atmosphere of hydrogen. The reaction was stirred at room
temperature for 5 hours. Filtration and concentration gave compound
(P-0027, 3.5 mg, 37%). MS (ESI) [M+H.sup.+].sup.+=331.
Example 26: Synthesis of
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine P-0057
[1169]
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2-
,3-b]pyridine P-0057 was synthesized in 4 steps from commercially
available 7-azaindole as shown in Scheme 28.
##STR00286##
Step 1--Preparation of
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7)
[1170] To 7-azaindole 1 in dichloromethane was added
6-chloronicotinoyl chloride 8, followed by aluminum chloride, under
an atmosphere of nitrogen at -10.degree. C. The reaction was
stirred and allowed to warm to room temperature overnight. The
reaction was quenched with 3 N hydrochloric acid and concentrated
hydrochloric acid was added until all solids dissolved. The mixture
was extracted with dichloromethane and the combined organic
portions were dried with magnesium sulfate, filtered, and the
filtrate was concentrated. The resulting solid material was
recrystallized from chloroform/hexane to provide
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 7
and used in the next step without further purification.
Step 2--Preparation of
(1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanone (73)
[1171] To
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanon- e
7 in DMSO was added (3-trifluoromethyl-phenyl)-methanol 72. Sodium
hydride was added and the reaction was heated to 60.degree. C. for
two hours. The reaction was quenched with water and extracted with
ethyl acetate. The organic portion was dried with magnesium sulfate
and concentrated to provide
(1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanone 73, which was used in the next step without
additional purification.
Step 3--Preparation
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanol (74)
[1172] To
(1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-
-pyridin-3-yl]-methanone 73 in ethanol was added sodium
borohydride. After one hour, the reaction was quenched with water
and extracted with ethyl acetate. The organic portion was dried
with magnesium sulfate and concentrated to provide
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanol 74, which was used in the next step without
additional purification.
Step 4--Preparation of
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine, P-0057
[1173]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-py-
ridin-3-yl]-methanol 74 was dissolved in 9:1 trifluoroacetic acid:
triethylsilane. The reaction was stirred at room temperature for 15
hours. The reaction was diluted with water and extracted with ethyl
acetate and concentrated. The crude material was purified by
reverse phase HPLC to provide
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine P-0057. MS (ESI) [M+H.sup.+].sup.+=384.3.
[1174] Additional compounds may be prepared using steps 2-4 of
Scheme 28, replacing (3-trifluoromethyl-phenyl)-methanol with an
appropriate benzyl alcohol. The following compounds were made
following this procedure:
3-[6-(4-Chloro-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine
(P-0056)
3-[6-(3-Chloro-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine (P-0055) The benzyl alcohols used in step 2 of this
procedure are indicated in column 2 of the following table, with
the compound structure indicated in column 3. Column 1 provides the
compound number and Column 4 the measured mass spectrometry
result.
TABLE-US-00005 MS(ESI) [M + H.sup.+].sup.+ Benzyl alcohol Compound
observed P-0056 ##STR00287## ##STR00288## 350.3 P-0055 ##STR00289##
##STR00290## 350.3
Example 27: Synthesis of
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone P-0048
[1175]
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]-
pyridin-3-yl)-methanone P-0048 was synthesized in 3 steps from
commercially available 2,6-dichloropyridine-3-carboxylic acid 75 as
shown in Scheme 29.
##STR00291##
Step 1--Preparation of 2,6-dichloropyridine-3-carbonyl chloride
(76)
[1176] To 2,6-dichloropyridine-3-carboxylic acid (75, 1.00 g,
0.00521 mol) in dichloromethane (75 mL) was added 2 M Oxalyl
chloride (2.61 mL, 0.727 g, 0.00573 mol). The solution began to
show vigorous gas evolution, which slowed but continued for about 2
hours. The reaction was allowed to continue at room temperature for
an additional 3 hours. The reaction was concentrated to give the
compound as a brown oil that crystallized on standing (76, 0.1.09
g, 99%).
Step 2--Preparation of
(2,6-dichloropyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone
(77)
[1177] To Aluminum trichloride (4.18 g, 0.0314 mol) and
dichloromethane (97.5 mL. 1.52 mol) under an atmosphere of nitrogen
was added 1H-Pyrrolo[2,3-b]pyridine (1, 828.5 mg, 0.0070 mol) in
dichloromethane (5.0 mL). The reaction was stirred at room
temperature for 60 minutes, then added
2,6-dichloropyridine-3-carbonyl chloride (76, 1.09 g, 0.00523 mol)
in dichloromethane (6.0 mL). The reaction was stirred at room
temperature for 2 hours. A precipitate formed, and nitromethane was
added in .about.1 mL portions until almost all solid dissolved (8
mL). After an additional 60 minutes at room temperature, the
reaction was slowly poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous magnesium
sulfate and filtered. The filtrate was concentrated to give 1.54 g
of solid, which turned dark purple on sitting overnight. The solid
was treated with dichloromethane, and the insoluble material was
collected by vacuum filtration to give compound (77, 863 mg, 57%).
MS (ESI) [M+H.sup.+].sup.+=292.2.
Step 3--Preparation of
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone (P-0048)
[1178] To
(2,6-dichloropyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-yl)methano-
ne (77, 0.0570 g, 0.195 mmol) was added 2-propanol (1.5 mL)
followed by p-chlorobenzylamine (61, 49.8 .mu.L, 0.410 mmol). The
reaction was microwaved at 300 watts. 100.degree. C. for 10
minutes, at 120.degree. C. for 10 minutes, and finally at
150.degree. C. for 10 minutes. Additional p-chlorobenzylamine (50
.mu.L, 0.410 mmol) was added and the reaction continued at
150.degree. C. for 20 minutes. The reaction was extracted with
ethyl acetate and 1 M sodium bicarbonate. The organic layer was
dried over anhydrous magnesium sulfate and filtered. The filtrate
was concentrated and purified by silica gel column chromatography
eluting with dichloromethane followed by 1% methanol to give
compound (P-0048, 47 mg, 61%). MS (ESI) [M+H.sup.+]: =397.3.
[1179] Additional compounds may be prepared according to Scheme 29,
replacing 2,6-dichloropyridine-3-carboxylic acid with an
appropriate carboxylic acid.
(6-(4-chlorobenzylamino)-2-(trifluoromethyl)pyridin-3-yl)(1H-pyrrolo[2,3--
b]pyridin-3-yl)methanone P-0070
##STR00292##
was made following this protocol, using
6-Chloro-2-trifluoromethyl-nicotinic acid as the carboxylic acid
(prepared in two steps from commercially available
2-chloro-6-(trifluoromethyl)pyridine according to Cottet, F. and
Schlosser. M. Eur. J. Org. Chem. 2004, 3793-3798). MS (ESI)
[M+H.sup.+].sup.+=431.2.
Example 28: Synthesis of
3-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-6-(4-chlorobenzylamino)pyridin--
2-ol P-0051
[1180]
3-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-6-(4-chlorobenzylamino)py-
ridin-2-ol P-0051 was synthesized in 2 steps from
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone P-0048 as shown in Scheme 30.
##STR00293##
Step 1--Preparation of
(6-(4-chlorobenzylamino)-2-chloropyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-
-yl)methanol (P-0050)
[1181] To
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-
-b]pyridin-3-yl)-methanone (P-0048, 0.045 g, 0.00011 mol, prepared
as described in Example 27) was added methanol (10 mL) and sodium
borohydride (0.00428 g, 0.000113 mol). The reaction was allowed to
stir at 50.degree. C. overnight. The volatiles were removed from
the reaction, and the resulting material was extracted with ethyl
acetate and 1M aqueous sodium bicarbonate. The organic layer was
dried over magnesium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with dichloromethane followed by 1% methanol in
dichloromethane to give the compound (P-0050, 31 ng, 68%). MS (ESI)
[M+H.sub.+].sub.+=399.2.
Step 2--Preparation of
3-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-6-(4-chlorobenzylamino)pyridin--
2-ol (P-0051)
[1182] To
(6-(4-chlorobenzylamino)-2-chloropyridin-3-yl)(1H-pyrrolo[2,3-b]-
pyridin-3-yl)methanol (P-0050, 0.028 g, 0.000070 mol) dissolved in
acetonitrile (1 mL) was added triethylsilane (42.6 uL, 0.000266
mol) and trifluoroacetic acid (28.4 uL, 0.000368 mol). The reaction
was heated at 85.degree. C. overnight. The reaction was extracted
with ethyl acetate and saturated sodium bicarbonate. The organic
layer was separated, dried over magnesium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with dichloromethane, 3%, 5% and finally 10%
methanol in dichloromethane to give the compound as a white solid
(P-0051, 20 mg, 78%). MS (ESI) [M+H]=365.3.
Example 29: Synthesis of 5 Substituted 7-Azaindole
Intermediates
[1183] 5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine 79 was
synthesized in 1 Step from commercially available 5-bromo-azaindole
as shown in Scheme 31.
##STR00294##
Step 1--5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine
(79)
[1184] To 4-morpholineethanol (30 mL, 0.2 mol) in N,
N-dimethylformamide (30 mL) was slowly added sodium hydride (7 g,
60% dispersion in mineral oil, 0.2 mol). After the solution turned
clear, a solution of 5-bromo-7-azaindole (44, 1.0 g, 0.0051 mol) in
N,N-dimethylformamide (5 mL) and copper(I) bromide (1.4 g, 0.0098
mol) were added. The reaction mixture was stirred at 120.degree. C.
under nitrogen for 2 hours. The reaction mixture was concentrated
and the residue was dissolved in ethyl acetate and water. The
organic layer was collected, washed with a solution of ammonium
chloride and ammonium hydroxide (4:1), brine, and dried over
magnesium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as an off-white solid
(79, 0.62 g, 50%). MS (ESI) [M+H.sup.+].sup.+=248.25.
[1185] Additional 5-substituted 7-azaindoles were prepared
following the protocol of Scheme 31, replacing 4-morpholineethanol
with either 2-diethylamino-ethanol, 3-diethylamino-propan-1-ol,
2-piperidin-1-yl-ethanol, or 2-pyrrolidin-1-yl-ethanol to provide
diethyl-[2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)-ethyl]-amine.
Diethyl-[3-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)-propyl]-amine,
5-(2-piperidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine, and
5-(2-pyrrolidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine,
respectively.
Example 30: Synthesis of
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyri-
din-2-yl}-(4-trifluoromethyl-benzyl)-amine P-0065
[1186]
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
]-pyridin-2-yl}-(4-trifluoromethyl-benzyl)-amine P-0065 was
synthesized in 4 Steps from
(5-bromo-pyridin-2-yl)-(4-trifluoromethylbenzyl)-amine 17 as shown
in Scheme 32.
##STR00295##
Step 1--Preparation of
6-(4-Trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde (18)
[1187] To a solution of
(5-bromo-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine (17, 3.55
g, 0.0107 mol, commercially available, or prepared as described in
Example 10) in tetrahydrofuran (150 mL) was added tert-butyllithium
(13.2 mL, 1.70 M in pentane, 0.0224 mol) slowly under an atmosphere
of nitrogen at -78.degree. C. over 10 minutes. The reaction mixture
was stirred at -78.degree. C. for 90 minutes. N,
N-Dimethylformamide (2.2 mL, 0.028 mol) was added slowly into the
reaction mixture. The reaction mixture was stirred at -78.degree.
C. for 2 hours, then allowed to warm to room temperature. After
stirring at room temperature for 2 hours, the reaction mixture was
poured into ice water and extracted with ethyl acetate. The organic
phase was washed with saturated sodium bicarbonate, brine, and
dried over magnesium sulfate. After removal of solvent, the residue
was purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as a light yellow solid
(18, 1.67 g, 56%).
Step 2--Preparation of
(5-Formyl-pyridin-2-yl)-(4-trifluormethyl-benzyl)-carbamic Acid
Tert-Butyl Ester (19)
[1188] To a solution of
6-(4-trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde (18, 3.7
g, 0.013 mol) and di-tert-butyldicarbonate (3.4 g, 0.016 mol) in
dichloromethane (100 mL) was added N,N-diisopropylethylamine (4.6
mL, 0.026 mol) and 4-diethylaminopyridine (0.2 g, 0.002 mol). The
reaction mixture was stirred at room temperature overnight. The
reaction mixture was concentrated and then dissolved in ethyl
acetate. The solution was washed with hydrochloric acid (10%),
saturated sodium bicarbonate, brine, and dried over magnesium
sulfate. After removal of solvent, the residue was purified by
silica gel column chromatography eluting with ethyl acetate in
hexane to provide the compound as a white solid (19, 4.38 g,
87%).
Step 4--Preparation of
(5-{Hydroxy-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-yl]-m-
ethyl}-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic Acid
Tert-Butyl Ester (80)
[1189] A mixture of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (19, 315 mg. 0.828 mmol),
5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine (79, 205 mg,
0.829 mmol, prepared as described in Example 29), and potassium
hydroxide (70 mg, 1 mmol) in methanol (25 mL) was stirred at room
temperature overnight. The reaction mixture was poured into ice
water, extracted with ethyl acetate, washed with brine, and dried
over sodium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with methanol
in dichloromethane to provide the compound as a yellow solid (80,
0.2 g, 40%). MS (ESI) [M+H.sup.+].sup.+=628.42.
Step 5--Preparation of
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyri-
din-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0065)
[1190] A mixture of
(5-{Hydroxy-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-yl]-m-
ethyl}-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (80, 0.2 g, 0.3 mmol), triethylsilane (4 mL, 0.02
mol), and trifluoroacetic acid (2 mL, 0.02 mol) in acetonitrile (30
mL) was refluxed for 2 hours. After removal of solvent, the residue
was dissolved in ethyl acetate, washed with saturated sodium
bicarbonate, brine, and dried over magnesium sulfate. After removal
of solvent, the residue was purified by silica gel column
chromatography eluting with methanol in dichloromethane to provide
the compound as a light yellow solid (P-0065, 17 mg, 10%). MS (ESI)
[M+H.sup.+].sup.+=512.42.
[1191] Additional compounds may be prepared using steps 3 and 4 of
Scheme 32, using
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester 19 or replacing it with
(5-Formyl-pyridin-2-yl)-(4-chloro-benzyl)-carbamic acid tert-butyl
ester (43, prepared as described in Example 17) and replacing
5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine 79 with an
appropriate azaindole, prepared as in Example 29 or
5-methoxy-7-azaindole (prepared as described in Example 31) or with
commercially available 5-chloro-7-azaindole. The following
compounds were made following this procedure: [1192]
[5-(5-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0053). [1193]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-triflu-
oromethyl-benzyl)-amine (P-0054), [1194]
(4-Chloro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0059), [1195]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0059), [1196]
{5-[5-(2-Diethylamino-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyridi-
n-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0060), [1197]
(4-Chloro-benzyl)-{5-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridi-
n-3-ylmethyl]-pyridin-2-yl}-amine (P-0063), [1198]
{5-[5-(2-Pyrrolidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyr-
idin-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0064), [1199]
{5-[5-(3-Diethylamino-propoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyrid-
in-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0066). [1200]
(4-Chloro-benzyl)-{5-[5-(3-diethylamino-propoxy)-1H-pyrrolo[2,3-b]pyridin-
-3-ylmethyl]-pyridin-2-yl}-amine (P-0069), The aldehyde and
azaindole used in step 4 of this procedure are indicated in columns
2 and 3 of the following table, respectively, with the compound
structure indicated in column 4. Column 0.1 provides the compound
reference number and Column 5 the experimental mass spectrometry
result.
TABLE-US-00006 [1200] MS(ESI) [M + H.sup.+].sup.+ Aldehyde
Azaindole Compound observed P-0053 ##STR00296## ##STR00297##
##STR00298## 413.2 P-0054 ##STR00299## ##STR00300## ##STR00301##
417.2 P-0058 ##STR00302## ##STR00303## ##STR00304## 379.2 P-0059
##STR00305## ##STR00306## ##STR00307## 383.2 P-0060 ##STR00308##
##STR00309## ##STR00310## 498.4 P-0063 ##STR00311## ##STR00312##
##STR00313## 478.3 P-0064 ##STR00314## ##STR00315## ##STR00316##
496.3 P-0066 ##STR00317## ##STR00318## ##STR00319## 512.3 P-0069
##STR00320## ##STR00321## ##STR00322## 478.3
Example 31: Synthesis of
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridin-5-ol P-0061
[1201]
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo-
[2,3-b]pyridin-5-ol P-0061 was synthesized in 6 Steps from
5-bromo-7-azaindole 44 as described in Scheme 33.
##STR00323##
Step 1--Preparation if 5-Methoxy-1H-pyrrolo[2,3-b]pyridine (81)
[1202] To a mixture of 5-bromo-7-azaindole (1 g, 0.005 mol) in N,
N-Dimethylformamide (20 mL) and methanol (20 mL) were added sodium
methoxide (13 g, 0.24 mol) and Copper (I) bromide (0.7 g, 0.0048
mol) at room temperature. The reaction mixture was stirred at
120.degree. C. under nitrogen for 3 hours. The reaction mixture was
concentrated and the residue was dissolved in ethyl acetate and
water. The organic layer was collected, washed with a solution of
ammonium chloride and ammonium hydroxide (4:1), brine, and dried
over magnesium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as a white solid (81, 0.4
g, 50%). MS (ESI) [M+H.sup.+].sup.+=149.09.
Step 2--Preparation of 1H-Pyrrolo[2,3-b]pyridin-5-ol (82)
[1203] To a solution of 5-methoxy-1H-pyrrolo[2,3-b]pyridine (81,
0.5 g, 3 mmol) in tetrahydrofuran (20 mL) was added boron
tribromide (1.5 g, 6.0 mmol) at 0.degree. C. The reaction mixture
was allowed to warm to room temperature, then stirred at room
temperature for 3 hours. The reaction mixture was quenched by
methanol. After repeated addition of methanol and removal of
solvent, the concentrated reaction mixture was dissolved in ethyl
acetate and water. The organic layer was collected, washed with
brine, and dried over magnesium sulfate. After removal of solvent,
the residue was purified by silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as an
off-white solid (82, 0.18 g, 40%).
Step 3--Preparation of
5-Triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridine (83)
[1204] To a solution of 1H-Pyrrolo[2,3-b]pyridin-5-ol (0.5 g, 0.004
mol) and 1H-imidazole (0.98 g. 0.014 mol) in N,N-dimethylformamide
(5 mL) was added triisopropylsilyl chloride (1 mL, 0.005 mol). The
reaction mixture was stirred at room temperature overnight.
Dichloromethane (10 mL) was added and the solution was washed with
brine and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with ethyl acetate in hexane to provide the compound as a viscous
liquid (83, 0.4 g, 40%).
Step 4--Preparation of
{5-[Hydroxy-(5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-meth-
yl]-pyridin-2-yl}-(4-trifluoromethyl-benzyl)-carbamic Acid
Tert-Butyl Ester (84)
[1205] A mixture of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (19, 41 mg, 0.11 mmol, prepared as described in
Example 30), 5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridine
(83, 34 mg, 0.12 mmol) and potassium hydroxide (9.8 mg, 0.17 mmol)
in methanol (10 mL) was stirred at room temperature overnight. The
reaction mixture was poured into water, extracted with ethyl
acetate, washed with brine and dried over sodium sulfate. After
removal of solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as a viscous liquid (84, 0.05 g. 70%). MS (ESI)
[M+H.sup.+].sup.+=671.38.
Step 5--Preparation of
(4-Trifluoromethyl-benzyl)-[5-(5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]-
pyridin-3-ylmethyl)-pyridin-2-yl]-amine (85)
[1206] A mixture of
{5-[hydroxy-(5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-meth-
yl]-pyridin-2-yl}-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (84, 0.05 g, 0.07 mmol), trifluoroacetic acid (0.5
mL. 0.006 mol), and triethylsilane (1 mL, 0.006 mol) in
acetonitrile (10 mL) was refluxed for 2 hours. The reaction mixture
was poured into ice water, extracted with ethyl acetate, washed
with saturated sodium bicarbonate, brine, and dried over sodium
sulfate. After removal of solvent, the residue was purified by
silica gel column chromatography eluting with ethyl acetate in
hexane to provide the compound as a viscous liquid (85, 0.04 g,
97%). MS (ESI) [M+H.sup.+].sup.+=555.38.
Step 6--Preparation of
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridin-5-ol (P-0061)
[1207] To
(4-Trifluoromethyl-benzyl)-[5-(5-triisopropylsilanyloxy-1H-pyrro-
lo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine (85, 0.13 g, 0.23
mmol) in tetrahydrofuran (10 mL) was added tetrabutylammonium
fluoride (3 mL, 1.0 M in tetrahydrofuran, 3 mmol). The reaction
mixture was stirred at room temperature overnight, and then was
stirred at 65.degree. C. for 48 hours. The reaction mixture was
concentrated and purified by silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as a
viscous liquid (P-0061, 0.062 g, 66%). MS (ESI)
[M+H.sup.+].sup.+=399.19.
[1208]
3-[6-(4-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]py-
ridin-5-ol P-0062
##STR00324##
was prepared following the protocol of Scheme 33, replacing
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester 19 with
(5-Formyl-pyridin-2-yl)-(4-chloro-benzyl)-carbamic acid tert-butyl
ester (43, prepared as described in Example 17). MS (ESI)
[M+H.sup.+].sup.+=365.2.
Example 32: Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluorometh-
yl-benzamide P-0067
[1209]
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluo-
romethyl-benzamide P-0067 was synthesized in 2 Steps from
7-azaindole 1 as described in Scheme 34.
##STR00325##
Step 1--Preparation of
(6-Bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(87)
[1210] To a solution of 1H-Pyrrolo[2,3-b]pyridine (1, 1.2 g, 0.010
mol) in dichloromethane (50 mL) was added 6-bromo-nicotinoyl
chloride (86, 2.6 g, 0.012 mol) at -10.degree. C. After the
solution turned clear, aluminum trichloride (10.2 g, 0.0765 mol)
was added in one portion with vigorous stirring. The reaction
mixture was stirred at -10.degree. C. for 30 minutes, then was
allowed to warm to room temperature and stirred at room temperature
overnight. The reaction was quenched with ice water and neutralized
with sodium bicarbonate. The solution was extracted with
dichloromethane, washed with brine, and dried over sodium sulfate.
After removal of solvent, the residue was purified by silica gel
column chromatography eluting with methanol in dichloromethane to
provide the compound as a white solid (87, 0.35 g, 11%).
Step 2--Preparation of
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluorometh-
yl-benzamide (P-0067)
[1211] A mixture of
(6-bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(87, 160 mg, 0.53 mmol), 4-trifluoromethyl benzamide (51, 130 mg,
0.69 mmol), xanthphos (9 mg, 0.02 mmol), cesium carbonate (245 mg,
0.752 mmol), and tris(dibenzylideneacetone)dipalladium (0) (5 mg,
0.005 mmol) in toluene (2 mL) in a sealed tube was stirred at
110.degree. C. for 1 hour. The reaction was quenched with water and
extracted with dichloromethane. The organic layer was collected,
washed with brine and dried over sodium sulfate. After removal of
the solvent, the residue was purified with silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as an off-white solid (P-0067, 0.42 mg, 19%). MS (ESI)
[M+H.sup.+]=411.17.
[1212]
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluo-
romethyl-benzenesulfonamide P-0068
##STR00326##
was prepared following the protocol of Scheme 34, replacing
4-trifluoromethyl benzamide 51 with
4-trifluoromethyl-benzenesulfonamide in Step 2. MS (ESI)
[M+H.sup.+].sup.+=445.1.
Example 33: Synthesis of
[(S)-1-(4-Chloro-phenyl)ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine P-0075
[1213]
[(S)-1-(4-Chloro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine P-0075 was synthesized in 3 Steps from
7-azaindole 1 as described in Scheme 35.
##STR00327##
[1214] Step 1--Preparation of
(6-Bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol
(89):
[1215] A mixture of 1H-Pyrrolo[2,3-b]pyridine (1, 1.2 g, 0.010
mol), 6-bromo-pyridine-3-carbaldehyde (88, 1.8 g, 0.0097 mol), and
potassium hydroxide (1.8 g, 0.032 mol) in methanol (25 mL) was
stirred at room temperature overnight. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
brine, and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with methanol in dichloromethane to provide the compound as a white
solid (89, 1.4 g, 45%), or may be used as mixture of 89 and 90 in
Step 2.
Step 2--Preparation of
3-(6-Bromo-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine (91)
[1216] A mixture of
(6-bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol
(89, 1 g, 0.003 mol) and
3-[(6-bromo-pyridin-3-yl)-methoxy-methyl]-1H-pyrrolo[2,3-b]pyridine
(90, 2 g, 0.006 mol), triethylsilane (1 mL, 0.006 mol), and
trifluoroacetic acid (0.5 mL, 0.006 mol) in acetonitrile (25 mL)
was refluxed for 2 hours. The reaction mixture was concentrated and
the residue was dissolved in ethyl acetate and water. The organic
layer was collected, washed with saturated sodium bicarbonate,
brine, and dried over sodium sulfate. After removal of the solvent,
the residue was purified with silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as an
off-white solid (91, 0.75 g, 60%). MS (ESI)
[M+H.sup.+].sup.+=288.06, 290.00.
Step 3--Preparation of
[(S)-1-(4-Chloro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine P-0075
[1217] A mixture of
3-(6-bromo-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine (91, 100
mg, 0.0003 mol) and (S)-1-(4-chloro-phenyl)-ethylamine (92, 0.5 g,
0.003 mol) in N-methylpyrrolidine (3 mL) was stirred at 150.degree.
C. in microwave for 100 minutes. The reaction mixture was
concentrated under vacuum and the residue was purified with silica
gel column chromatography eluting with ethyl acetate in hexane to
provide the compound as a white solid (P-0075, 0.03 g, 20%). MS
(ESI) [M+H.sup.+].sup.+=363.18.
Example 34: Synthesis of
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine P-0083
[1218]
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-thiazol-2-yl]-amine P-0083 was synthesized in 4 steps from
2,4-Dichloro-thiazole-5-carbaldehyde 93 as described in Scheme
36.
##STR00328##
Step 1--Preparation of
4-Chloro-2-(4-chloro-benzylamino)-thiazole-5-carbaldehyde (94)
[1219] To a solution of p-chlorobenzylamine (61, 283 mg, 2.00 mmol)
and N,N-Diisopropylethylamine (0.697 mL) in tetrahydrofuran (20 mL)
was slowly added 2,4-Dichloro-thiazole-5-carbaldehyde (93, 364 mg,
2.00 mmol) in tetrahydrofuran (10 mL) at room temperature. The
reaction was stirred at room temperature overnight. The reaction
mixture was poured into iced water, extracted with ethyl acetate,
washed with brine, and dried over sodium sulfate. After removal of
solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as a yellow solid (94, 0.3 g, 50%). MS (ESI)
[M-H+]=286.97.
Step 2--Preparation of
(4-Chloro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic Acid
Tert-Butyl Ester (95)
[1220] To a solution of
4-Chloro-2-(4-chloro-benzylamino)-thiazole-5-carbaldehyde (94, 0.32
g, 0.0011 mol) in dichloromethane (20 mL) was slowly added
N,N-diisopropylethylamine (0.4 mL, 0.002 mol),
4-dimethylaminopyridine (27 mg, 0.22 mmol), and a solution of
di-tert-butyldicarbonate (290 mg, 0.0013 mol) in dichloromethane (5
mL) at room temperature. The reaction mixture was stirred at room
temperature overnight, then poured into iced water, extracted with
dichloromethane, washed with brine, and dried over sodium sulfate.
After removal of solvent, the residue was purified by silica gel
column chromatography eluting with ethyl acetate in hexane to
provide the compound as a light brown solid (95, 0.32 g. 74%). MS
(ESI) [M+H+]=387.26.
Step 3--Preparation of
(4-Chloro-benzyl)-{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[-
2,3-b]pyridin-3-yl)-methyl]-thiazol-2-yl}-carbamic Acid Tert-Butyl
Ester (97)
[1221] To a solution of
3-Iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (96, 99 mg,
0.25 mmol) in tetrahydrofuran (5 ml) at -20.degree. C. under
nitrogen was added 2.0 M solution isopropylmagnesium chloride in
tetrahydrofuran (0.2 ml, 0.31 mmol). The reaction mixture was
stirred for 1.5 hours, then allowed to warm to 5.degree. C. After
the reaction mixture was cooled down to -20.degree. C., a solution
of (4-Chloro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester (95, 80 mg. 0.2 mmol) in tetrahydrofuran (5 mL)
was slowly added. The reaction mixture was stirred for 2.5 hrs,
then allowed to warm to 5.degree. C. The reaction mixture was
poured into iced water, extracted with ethyl acetate, washed with
brine, and dried over magnesium sulfate. After removal of solvent,
the residue was purified by silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as an
off-white solid (97, 76 mg, 50%). MS (ESI) [M+H+]=661.32,
663.32.
Step 4--Preparation of
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine (P-0083)
[1222] A mixture of
(4-Chloro-benzyl)-{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[-
2,3-b]pyridin-3-yl)-methyl]-thiazol-2-yl}-carbamic acid tert-butyl
ester (97, 76 mg, 0.11 mmol), triethylsilane (0.5 mL, 3 mmol), and
trifluoroacetic acid (0.25 mL, 3.2 mmol) in acetonitrile (5 mL) was
refluxed for 3 hours. The reaction mixture was poured into iced
water, extracted with ethyl acetate, washed with sodium
bicarbonate, brine, and dried over sodium sulfate. After removal of
solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as a yellow solid (P-0083, 5.6 mg, 14%). MS (ESI)
[M+H+]=389.35, 390.36.
Example 35: Synthesis of
[2-(4-Chloro-benzylamino)thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-me-
thanone P-0077
[1223]
[2-(4-Chloro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone P-0077 was synthesized in 2 steps from
2-Bromo-thiazole-5-carboxylic acid 98 and 1H-pyrrolo[2,3-b]pyridine
1 as shown in Scheme 37.
##STR00329##
Step 1--Preparation of
(2-Bromo-thiazol-5-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(99)
[1224] A suspension of 2-Bromo-thiazole-5-carboxylic acid (98, 0.5
g, 0.002 mol) in oxalyl chloride (3 mL) was stirred at room
temperature until it turned into a clear solution. Solvent was
removed and the residue was dried over vacuum. A light yellow solid
was obtained and was dissolved in dichloromethane (10 mL) and
slowly added to a solution of 1H-Pyrrolo[2,3-b]pyridine (1, 0.34 g,
0.0029 mol) in dichloromethane (30 mL) at -10.degree. C. To the
mixture was then added aluminum trichloride (2.6 g. 0.019 mol) in
one portion with vigorous stirring. The reaction was held at
-10.degree. C. for 30 minutes, then allowed to warm to room
temperature. The reaction mixture was stirred at ambient
temperature overnight. The reaction was quenched with ice-water and
acidified with hydrochloric acid (I 0%) to pH 4. The solution was
then extracted with dichloromethane. The organic layer was
collected, washed with brine, and dried over magnesium sulfate.
After removal of solvent, the residue was purified by silica gel
column chromatography eluting with ethyl acetate in hexane to
provide the compound as a white solid (99, 12 mg, 2%). MS (ESI)
[M-H+]=369.09.
Step 2--Preparation of
[2-(4-Chloro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0077)
[1225] A mixture of
(2-Bromo-thiazol-5-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(99, 5 mg, 0.02 mmol), p-chlorobenzylamine (61, 10 mg, 0.08 mmol),
and N,N-Diisopropylethylamine (10 .mu.L, 0.08 mmol) in
tetrahydrofuran (10 mL), in a sealed reaction vessel, was stirred
room temperature overnight. The reaction mixture was poured into
iced water, extracted with ethyl acetate, washed with brine, and
dried over magnesium sulfate. After removal of solvent, the residue
was purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as a light yellow solid
(P-0077, 2 mg, 30%). MS (ESI) [M+H+]=305.90, 307.88.
Example 36: Synthesis of
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methyl)-1H-pyrrolo[2,3-b]p-
yridine P-0080
[1226]
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methyl)-1H-pyrrolo[2-
,3-b]pyridine P-0080 was synthesized in 2 steps from
5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde 100 and
7-azaindole 1 as shown in Scheme 38.
##STR00330##
Step 1--Preparation of
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)(methoxy)methyl)-1H-pyrrol-
o[2,3-b]pyridine (P-0079)
[1227] To 1H-Pyrrolo[2,3-b]pyridine (1, 0.100 g, 0.846 mmol) and
5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde (100, 0.205
g. 0.931 mmol) was added 2 mL of methanol to give a solution.
Potassium hydroxide (0.0475 g, 0.846 mmol) was added and the
reaction was allowed to stir at room temperature for 48 hours. The
reaction was extracted with ethyl acetate and water. The organic
layer was dried over anhydrous magnesium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with a gradient of 0-5% methanol in
dichloromethane to give the compound (P-0079, 32 mg, 11%). MS (ESI)
[M+H.sup.+].sup.+=353.2.
Step 2--Preparation of
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methyl)-1H-pyrrolo[2,3-b]p-
yridine (P-0080)
[1228] To
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methoxy)methyl)-1-
H-pyrrolo[2,3-b]pyridine (P-0079, 0.030 g, 0.085 mmol) was added
acetonitrile (10 mL, 0.2 mol). Trifluoroacetic acid (500 uL, 0.006
mol) and triethylsilane (500 uL, 0.003 mol) were added and the
reaction allowed to stir at room temperature for 16 hours. The
reaction was extracted with ethyl acetate and water. The organic
layer was dried over anhydrous magnesium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with dichloromethane followed 5% methanol in
dichloromethane to give the compound as a yellowish foam (P-0080,
29 mg, 98%). MS (ESI) [M+H.sup.+].sup.+=323.2.
Example 37: cKit Kinase Domain and Construction of c-Kit
Sequences
[1229] c-Kit cDNA sequence is available from NCBI, e.g., as GenBank
accession number NM_000222. Using this sequence, c-kit DNA
sequences can be cloned from commercially available libraries (e.g.
cDNA libraries) or can be synthesized by conventional cloning
methods.
[1230] Using conventional cloning methods, constructs encoding
three c-kit polypeptides were prepared, and used to express c-kit
kinase domain polypeptides. One such active c-kit kinase domain
sequence included residues P551-S948, with the deletion of residues
Q694-T753.
Example 38: Expression and Purification of c-Kit Kinase Domain
[1231] Purified c-kit kinase domain can be obtained using
conventional expression and purification methods. Exemplary methods
are described, for example, in Lipson et al., U.S. 20040002534
(U.S. application Ser. No. 10/600,868, filed Jun. 23, 2003), which
is incorporated herein by reference in its entirety.
Example 39: Binding Assays
[1232] Binding assays can be performed in a variety of ways,
including a variety of ways known in the art. For example, as
indicated above, binding assays can be performed using fluorescence
resonance energy transfer (FRET) format, or using an
AlphaScreen.
[1233] Alternatively, any method which can measure binding of a
ligand to the ATP-binding site can be used. For example, a
fluorescent ligand can be used. When bound to c-kit, the emitted
fluorescence is polarized. Once displaced by inhibitor binding, the
polarization decreases.
[1234] Determination of IC.sub.50 for compounds by competitive
binding assays. (Note that K.sub.D is the dissociation constant for
inhibitor binding: K.sub.D is the dissociation constant for
substrate binding.) For this system, the IC50, inhibitor binding
constant and substrate binding constant can be interrelated
according to the following Formula:
[1235] When using radiolabeled substrate
K I = IC 50 1 + [ L * ] / K D , ##EQU00002##
[1236] the IC.sub.50.about.K.sub.I when there is a small amount of
labeled substrate.
Example 40: Cell-Based Assays of c-Fms Kinase Activity or c-Kit
Kinase Activity
[1237] M-CSF dependent RAW264.7 cells were seeded on a 12 well
plate, 2.5.times.10.sup.5 cells/well and the cells were allowed to
attach overnight at 37.degree. C., 5% CO.sub.2. The cells were then
starved in serum-free medium overnight at 37.degree. C., 5%
CO.sub.2. The cells were treated with compound for 1 hour in
serum-free media (1% DMSO final concentration); and then stimulated
with 20 ng/ml M-CSF for 5 minutes. After stimulation, the cells
were lysed on ice, and the lysates were centrifuged at 13,000 rpm
for 1 minute. The amount of protein in the sample was quantitated,
sample buffer was added, and the samples were boiled at 95.degree.
C. for 10 minutes. The samples were then centrifuged at 13,000 rpm
for 1 minute. The samples (15-20 .mu.g/lane) were loaded and run on
4-12% tris-glycine gel at 75V, and then transferred onto a PVDF
membrane. The membrane was blocked for 1 hour with 5% BSA in PBS/1%
Tween-20 (PBST); or 5% milk, depending on the primary antibody
used. Then the blots were incubated with primary antibody overnight
at 4 degrees with gentle shaking. After incubation with the capture
antibody, the membranes were washed 3.times.10 minutes with PBST;
then incubated with detection antibody Goat Anti-Rabbit-HRP for 1
hour, with gentle shaking. The membranes were washed again
3.times.10 minutes with PBST. ECL Plus substrate was then added to
the blots, the image captured with chemiluminescence camera, and
the bands quantitated for pFMS and FMS levels.
[1238] The Fins inhibitors may also be assessed using M-NFS-60
mouse myelogenous leukemia cell line (ATCC catalog #CRL-1838). This
cell line proliferation is stimulated by M-CSF, which binds and
activates the fins tyrosine kinase receptor. Inhibitors of fins
kinase activity reduce or eliminate the M-CSF stimulated kinase
activity, resulting in reduced cell proliferation. This inhibition
is measured as a function of compound concentration to assess
IC.sub.50 values. M-NFS-60 cells were seeded at 5.times.10.sup.4
cells per well of a 96 well cell culture plate in 50 .mu.l of cell
culture medium of RPMI 1640 (CellGro Mediatech catalog #10-040-CV)
supplemented with 10% FBS (HyClone catalog #SH30071.03). Compounds
were dissolved in DMSO at a concentration of 1 mM and were serially
diluted 1:3 for a total of eight points and added to the cells to
final concentrations of 10, 3.3, 1.1, 0.37, 0.12, 0.041, 0.014 and
0.0046 .mu.M in 100 .mu.l cell culture medium (final concentration
0.2% DMSO). Cells were also treated with staurosporine as a
positive control. The cells were stimulated by adding 20 .mu.l of
372 ng/ml M-CSF to a final concentration of 62 ng/ml (R&D
Systems catalog #216-MC). The cells were incubated at 37.degree.
C., 5% CO.sub.2 for three days. CellTiter-Glo Buffer (Promega Cell
Viability Assay catalog #G7573) and substrate were equilibrated to
room temperature, and enzyme/substrate Recombinant Firefly
Luciferase/Beetle Luciferin was reconstituted. The cell plates were
equilibrated to room temperature for 30 minutes, then lysed by
addition of an equivalent volume of the Celltiter-Glo Reagent. The
plate was mixed for 2 minutes on a plate shaker to lyse the cells,
then incubated for 10 minutes at room temperature. The plates were
read on a Victor Wallac II using Luminescence protocol modified to
read 0.1 s per well. The luminescence reading assesses the ATP
content, which correlates directly with cell number such that the
reading as a function of compound concentration was used to
determine the IC.sub.50 value.
[1239] The c-Kit inhibitors were assessed using M-07e cell line
(DSMZ catalog #ACC 104). The M-07e proliferation is stimulated by
SCF (Stem Cell Factor), which binds and activates c-Kit tyrosine
kinase receptor. Inhibitors of c-Kit kinase reduce or eliminate the
SCF mediated kinase activation, resulting in reduced cell
proliferation of SCF stimulated cells. This inhibition is measured
by the effect of compound concentration on cell growth to assess
IC.sub.50 values. M-07e cells were seeded at 5.times.10.sup.4 cells
per well of a 96 well cell culture plate in 50 .mu.l of cell
culture medium of Iscove's Medium 1.times. (MOD, CellGro Mediatech
catalog #15-016-CV) supplemented with 10% FBS (HyClone catalog
#SH30071.03). Compounds were dissolved in DMSO at a concentration
of 0.1 mM and were serially diluted 1:3 for a total of eight points
and added to the cells to final concentrations of 1, 0.33, 0.11,
0.037, 0.012, 0.0041, 0.0014 and 0.00046 .mu.M in 100 .mu.l cell
culture medium (final concentration 0.2% DMSO). Cells were also
treated with staurosporine as a positive control. Cells were
stimulated by adding 20 .mu.l of 600 ng/ml SCF to a final
concentration of 100 ng/ml (Biosource International SCF kit ligand
catalog #PHC2115) in cell culture medium. The cells were incubated
at 37.degree. C., 5% CO.sub.2 for three days. CellTiter-Glo Buffer
(Promega Cell Viability Assay catalog #G7573) and substrate were
equilibrated to room temperature, and enzyme/substrate Recombinant
Firefly Luciferase/Beetle Luciferin was reconstituted. The cell
plates were equilibrated to room temperature for 30 minutes, then
lysed by addition of an equivalent volume of the Celltiter-Glo
Reagent. The plate was mixed for 2 minutes on a plate shaker to
lyse the cells, then incubated for 10 minutes at room temperature.
The plates were read on a Victor Wallac II using Luminescence
protocol modified to read 0.1 s per well. The luminescence reading
assesses the ATP content, which correlates directly with cell
number such that the reading as a function of compound
concentration is used to determine the IC.sub.50 value.
[1240] This cell based assay was also used to assess
phosphorylation. Samples were prepared with compounds as described
for the growth inhibition assay only M-07e cells were seeded at
2.times.10.sup.5 cells per well in a 96 well filter plate. Cells
were incubated for 1 hour at 37.degree. C. with the compounds as
described above, and then stimulated by adding SCF to a final
concentration of 50 ng/ml and incubated for 10 minutes at
37.degree. C. The culture medium was removed by centrifugation and
the cells were lysed by addition of 30 .mu.l lysis buffer (25 mM
Tris HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X 100, 5 mM NaF,
1 mM NaVanadate, 10 mM Beta-glycerophosphate, no EDTA
(Boehringer-Roche catalog #1873580) and placed on ice for 30
minutes. A 15 .mu.l aliquot of the lysate was taken and assayed
according to Biosource Immunoassay Kit: Human c-Kit [pY823]
(Catalog #KHO0401) by diluting the aliquot with 85 .mu.l dilution
buffer in the assay plate, incubating for 2 hours at room
temperature and washing the plate 4 times with wash buffer.
Detection antibody (100 .mu.l) was added to the plate and samples
incubated for 1 hour at room temperature, then washed 4 times with
wash buffer. HRP anti-rabbit antibody (100 .mu.l) was added and
samples incubated for 30 minutes at room temperature, then washed 4
times with wash buffer. Stabilized chromogen (100 .mu.l) was added
and samples incubated for 15-25 minutes at room temperature, then
washed 4 times with wash buffer. Stop solution (100 .mu.l) was
added and the samples read on a Wallac Victor reader at 450 nm. The
absorbance was plotted against the compound concentration and the
IC.sub.50 concentration was determined.
[1241] Additional cell based assays can be correlated to the Fms
activity of compounds of the invention. For example, the ability of
osteoclast precursor cells (commercially available from Lonza) to
differentiate into mature osteoclasts, due to stimulation by M-CSF
and RANKL, in the presence of compounds, can be measured using a
method analogous to that previously reported (Hudson et al.,
Journal of Urology, 1947, 58:89-92), where the amount of acid
phosphatase in the supernatant (i.e. TRAP5b excreted by mature
osteoclasts) is proportional to the number of mature osteoclasts
present. In another example, the ability of M-CSF-dependent murine
macrophage cells (BAC 1.2F5) to proliferate in the presence of
compounds can be measured by culturing cells as previously
described (Morgan et al., Journal of Cellular Physiology, 1987,
130:420-427) and determining cell viability by analysis of ATP
levels in the cell culture (Crouch et al., Journal of Immunological
Methods, 1993, 160:81-8).
Example 41: c-Kit, c-Fms, TrkA, and HGK Activity Assays
[1242] The effect of potential modulators of kinase activity of
c-kit and other kinases can be measured in a variety of different
assays known in the art, e.g. biochemical assays, cell-based
assays, and in vivo testing (e.g. model system testing). Such in
vitro and/or in vivo assays and tests can be used in the present
invention. As an exemplary kinase assay, the kinase activity of
c-kit or Fins is measured in AlphaScreening (Packard
BioScience).
[1243] Exemplary c-Kit Biochemical Assay
[1244] The c-kit (or kinase domain thereof) is an active kinase in
AlphaScreen. IC.sub.50 values are determined with respect to
inhibition of c-Kit kinase activity, where inhibition of
phosphorylation of a peptide substrate is measured as a function of
compound concentration. Compounds to be tested were dissolved in
DMSO to a concentration of 20 mM. These were diluted 30 .mu.l into
120 .mu.l of DMSO (4 mM) and 1 .mu.l was added to an assay plate.
These were then serially diluted 1:3 (50 .mu.l to 100 .mu.l DMSO)
for a total of 8 points. Plates were prepared such that each kinase
reaction is 20 .mu.l in 1.times. kinase buffer (50 mM HEPES, pH
7.2, 5 mM MgCl.sub.2, 5 mM MnCl.sub.2, 0.01% NP-40, 0.2% BSA), 5%
DMSO and 10 .mu.M ATP. Substrate was 100 nM biotin-(E4Y)3 (Open
Source Biotech, Inc.). C-kit kinase was at 0.1 ng per sample. After
incubation of the kinase reaction for 1 hour at room temperature, 5
.mu.l of donor beads (Streptavidin coated beads (Perkin Elmer Life
Science) final concentration 1 .mu.g/ml) in stop buffer (50 mM EDTA
in 1.times. kinase buffer) was added, the sample was mixed and
incubated for 20 minutes at room temperature before adding 5 .mu.l
of acceptor beads (PY20 coated beads (Perkin Elmer Life Science)
final concentration 1 .mu.g/ml) in stop buffer. The samples were
incubated for 60 minutes at room temperature and the signal per
well was read on AlphaQuest reader. Phosphorylated substrate
results in binding of the PY20 antibody and association of the
donor and acceptor beads such that signal correlates with kinase
activity. The signal vs. compound concentration was used to
determine the IC.sub.50.
[1245] Compounds were also tested using a similar assay with a
10-fold higher ATP concentration. For these samples, compounds to
be tested were dissolved in DMSO to a concentration of 20 mM. These
were diluted 30 .mu.l into 120 .mu.l of DMSO (4 mM) and 1 .mu.l was
added to an assay plate. These were then serially diluted 1:3 (50
.mu.l to 100 .mu.l DMSO) for a total of 8 points. Plates were
prepared such that each kinase reaction is 20 .mu.l in 1.times.
kinase buffer (25 mM HEPES, pH 7.5, 2 mM MgCl.sub.2, 2 mM
MnCl.sub.2, 0.01% Tween-20, 1 mM DTT, and 0.001% BSA), 5% DMSO and
100 .mu.M ATP. Substrate was 30 nM biotin-(E4Y)10 (Upstate Biotech,
Cat#12-440). C-kit kinase was at 1 ng per sample. After incubation
of the kinase reaction for 1 hour at room temperature, 5 .mu.l of
donor beads (Streptavidin coated beads (Perkin Elmer Life Science)
final concentration 10 .mu.g/ml) in stop buffer (25 mM HEPES pH
7.5, 100 mM EDTA, 0.3% BSA) was added, the sample was mixed and
incubated for 20 minutes at room temperature before adding 5 .mu.l
of acceptor beads (PY20 coated beads (Perkin Elmer Life Science)
final concentration 10 .mu.g/ml) in stop buffer. The samples were
incubated for 60 minutes at room temperature and the signal per
well was read on AlphaQuest or Envision reader (Perkin Elmer Life
Science). Phosphorylated substrate results in binding of the PY20
antibody and association of the donor and acceptor beads such that
signal correlates with kinase activity. The signal vs. compound
concentration was used to determine the IC.sub.50.
[1246] The c-kit enzyme used in the above assay was either obtained
from Cell Signaling Technology (Cat. #7754) or was prepared as
follows: A plasmid encoding kit (DNA and encoded protein sequences
shown below) was engineered using common polymerase chain reaction
(PCR) methods. Complementary DNA cloned from various human tissues
were purchased from Invitrogen, and these were used as substrates
in the PCR reactions. Specific custom synthetic oligonucleotide
primers were designed to initiate the PCR product, and also to
provide the appropriate restriction enzyme cleavage sites for
ligation with the plasmids. The entire sequence encoding the enzyme
was made through a gene synthesis procedure, using custom synthetic
oligonucleotides covering the entire coding sequence (Invitrogen,
see below).
[1247] The plasmid used for ligation with the kinase-encoding
inserts was derivative of pET (Novagen) for expression using E.
coli. The Kit kinase was engineered to include a Histidine tag for
purification using metal affinity chromatography. The
kinase-encoding plasmid was engineered as bicistronic mRNA to
co-express a second protein that modifies the kinase protein during
its expression in the host cell. Protein tyrosine phosphatase 1B
(PTP), was co-expressed for dephosphorylation of the
phospho-Tyrosines.
[1248] For protein expression, the plasmid containing the Kit gene
was transformed into E. coli strains BL21(DE3)RIL and transformants
selected for growth on LB agar plates containing appropriate
antibiotics. Single colonies were grown overnight at 37.degree. C.
in 200 ml TB (Terrific broth) media. 16.times.1 L of fresh TB media
in 2.8 L flasks were inoculated with 10 ml of overnight culture and
grown with constant shaking at 37.degree. C. Once cultures reached
an absorbance of 1.0 at 600 nm, IPTG was added and cultures were
allowed to grow for a further 12 to 18 hrs at temperatures ranging
from 12-30.degree. C. Cells were harvested by centrifugation and
pellets frozen at -80.degree. C. until ready for lysis.
[1249] For protein Purification; frozen E. coli cell pellets were
resuspended in lysis buffer and lysed using standard mechanical
methods. Protein was purified via poly-Histidine tags using
immobilized metal affinity purification IMAC. The Kit kinase was
purified using a 3 step purification process utilizing; IMAC, size
exclusion chromatography and ion exchange chromatography. The
poly-Histidine tag was removed using Thrombin (Calbiochem).
[1250] Compounds were assayed using a similar assay to that
described above, using in a final reaction volume of 25 .mu.l:
c-Kit (h) (5-10 mU) in 8 mM MOPS pH 7.0, 0.2 mM EDTA, 10 mM
MnCl.sub.2, 0.1 mg/ml poly (Glu, Tyr) 4:1, 10 mM MgAcetate and
.gamma.-.sup.33P-ATP (approximately 500 cpm/pmol), with appropriate
concentrations of compound. Incubated for 40 minutes at room
temperature and stopped by addition of 5 .mu.l of 3% phosphoric
acid. Spotted 10 .mu.l of each sample onto Filtermat A and washed
3.times. with 75 mM phosphoric acid, once with methanol, dried and
measured on scintillation counter (performed at Upstate USA,
Charlottesville, Va.).
[1251] Compounds P-0001, P-0002, P-0003, P-0004, P-0005, P-0006,
P-0007, P-0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014,
P-0015, P-0016, P-0017, P-0018, P-0020, P-0022, P-0024, P-0025,
P-0026, P-0027, P-0028, P-0030, P-0031, P-0032, P-0033, P-0038,
P-0053, P-0054, P-0055, P-0056, P-0057, P-0058, P-0059, P-0060,
P-0061, P-0062, P-0063, P-0064, P-0065, P-0066. P-0069, P-0071,
P-0072, P-0073, P-0074. P-0075, P-0078, P-0082, P-0092, P-0093,
P-0094, P-0095, P-0096, P-0097, P-0098, P-0099, P-0100, P-0101,
P-0102, P-0103, P-0104, P-0105, P-0107, P-0108, P-0109, P-0111,
P-0112. P-0113, P-0114, P-0115, P-0116, P-0118, P-0120, P-0121,
P-0122, P-0123, P-0125, P-0126, P-0127, P-0128, P-0129, P-0131,
P-0132, P-0138, P-0143, P-0144, P-0145, P-0148, P-0154, P-0156,
P-0157, P-0159, P-0161. P-0163, P-0170, P-0171, P-0173, P-0174.
P-0176, P-0177, P-0179, P-0180, P-0181, P-0182, P-0186, P-0187,
P-0188, P-0190, P-0192, P-0193, P-0194, P-0195, P-0197, P-0199,
P-0201, P-0203, P-0205, P-0206, P-0208, P-0211, P-0212, P-0213,
P-0214, P-0215. P-0216, P-0217, P-218, P-0219, P-0221, P-0222,
P-0224, P-0225, P-0226, P-0228, P-0234, P-0237, P-0239, P-0240,
P-0242, P-0243, P-0244, P-0245, P-0246, P-0252, P-0253, P-0255,
P-0257, P-0258, P-0259, P-0260, P-0262, P-0263, P-0264, P-0265,
P-0266, P-0267, P-0268, P-0269, P-0270, P-0271, P-0272, P-0273,
P-0274, P-0275, P-0276, P-0277, P-0278, P-0279, P-0280, P-0281,
P-0282, P-0283, P-0284, P-0285, P-0286, P-0287, P-0288, P-0289,
P-0290, P-0291, P-0294, P-0297, P-0298, P-0301, P-0302, P-0303,
P-0305, P-0306, P-0307, P-0308, P-0309, P-0311, P-0312, P-0313,
P-0314, P-0316, P-0319, P-0320, P-0321, P-0322, P-0323, P-0324,
P-0325, P-0326, P-0327, P-0328, P-0329, P-0330, P-0331. P-0332,
P-0334, P-0336, P-0337, P-0338, P-0339. P-0340, P-0341, P-0342,
P-0343, P-0344, P-0345. P-0346, P-0347, P-0348, P-0350, P-0351,
P-0352, P-0354, P-0355, P-0356, P-0357, P-0358, P-0359, P-0361,
P-0362, P-0363, P-0365, P-0366, P-0367, P-0368, P-0369, P-0370.
P-0371, P-0372, P-0373, P-0375, P-0376, P-0377, P-0379, P-0379,
P-0382, P-0383, P-0385, P-0387, P-0390, P-0392, P-0393, P-0394,
P-0395, P-0396, P-0402, P-0404, P-0406, P-0407, P-0408, P-0409, and
P-0412 had IC.sub.50 of less than 1 .mu.M in at least one of the
c-kit assays described above in Examples 40 and 41.
TABLE-US-00007 Kit PCR primers KIT 8K1A
ATGTACCAAGTTCAGTGGAAAGTTGTTGAAGAAATCAACGG 1776 (SEQ ID NO: 5) 8K1B
GGTCGATGTALACGTAGTTGTTACCGTTGATTTCTTCAACAACTTT 1777 (SEQ ID NO: 6)
8K2A AACAACTACGTTTACATCGACCCGACCCAGCTGCCGTACGAC 1779 (SEQ ID NO: 7)
8K2B GTTACGCGGGAACTCCCATTTGTGGTCGTACGGCAGCTGGGTC 1781 (SEQ ID NO:
8) 8K3A AAATGGGAGTTCCCGCGTAACCGTCTGTCTTTCGGTAAAACCC 1782 (SEQ ID
NO: 9) 8K3B ACCGAACGCACCCGCACCCAGGGTTTTACCGAAAGACAGAC 1783 (SEQ ID
NO: 10) 8K4A GGTGCGGGTGCGTTCGGTAAAGTTGTTGAAGCGACCGCGTACG 1784 (SEQ
ID NO: 11) 8K4B GCCGCGTCAGATTTGATCAGACCGTACGCGGTCGCTTCAAC 1785 (SEQ
ID NO: 12) 8K5A CTGATCAAATCTGACGCGGCGATGACCGTTGCGGTTAAAATGC 1786
(SEQ ID NO: 13) 8K5B GTCAGGTGCGCAGACGGTTTCAGCATTTTAACCGCAACGGTCA
1787 (SEQ ID NO: 14) 8K6A
AAACCGTCTGCGCACCTGACCGAACGTGAAGCGCTGATGTCTG 1788 (SEQ ID NO: 15)
8K6B CCAGGTAAGACAGGAACTTTCAGTTCAGACATCAGCGCTTCACGT 1789 (SEQ ID NO:
16) 8K7A CTGAAAGTTCTGTCTTACCTGGGTAACCACATGAACATCGTTAA 1791 (SEQ ID
NO: 17) 8K7B GGTGCACGCACCCAGCAGGTTAACGATGTTCATGTGGTTAC 1792 (SEQ ID
NO: 18) 8K8A CTGCTGGGTGCGTGCACCATCGGTGGTCCGACCCTGGTTATCA 1793 (SEQ
ID NO: 19) 8K8B GTCACCGTAGCAGCAGTATTCGGTGATAACCAGGGTCGGACCA 1794
(SEQ ID NO: 20) 8K9A GAATACTGCTGCTACGGTGACCTGCTGAACTTCCTGCGTCGTA
1795 (SEQ ID NO: 21) 8K9B
AGAGCAGATGAAAGAGTCACGTTTACGACGCAGGAAGTTCAGC 1796 (SEQ ID NO: 22)
8K10A CGTGACTCTTTCATCTGCTCTAAACAGGAAGACCACGCGGAAG 1797 (SEQ ID NO:
23) 8K10B CAGCAGGTTTTTGTACAGCGCCGCTTCCGCGTGGTCTTCCTGT 1798 (SEQ ID
NO: 24) 8K11A GCGCTGTACAAAAACCTGCTGACTCTAAAGAATCTTCTTGCTC 1799 (SEQ
ID NO: 25) 8K11B CCATGTATTCGTTGGTAGAGTCAGAGCAAGAAGATTCTTTAGAGT 1811
(SEQ ID NO: 26) 8K11A GACTCTACCCAACGAATACATGGACATGAAACCGGGTGTTTCTTA
1812 (SEQ ID NO: 27) 8K11B
TCCGCTTTGGTCGGAACAACGTAAGAAACACCCGGTTTCATGT 1813 (SEQ ID NO: 28)
8K12A GTTGTTCCGACCAAAGCGGACAAACGTCGTTCTGTTCGTATCG 1814 (SEQ ID NO:
29) 8K12B TAACGTCACGTTCGATGTAAGAACCGATACGAACAGAACGACGTTT 1815 (SEQ
ID NO: 30) 8K13A TCTTACATCGAACGTGACGTTACCCCGGCGATCATGGAAGACG 1816
(SEQ ID NO: 31) 8K13B CCAGGTCCAGCGCCAGTTCGTCGTCTTCCATGATCGCCGG 1817
(SEQ ID NO: 32) 8K14A GAACTGGCGCTGGACCTGGAAGACCTGCTGTCTTTCTCTTACC
1818 (SEQ ID NO: 33) 8K14B
GAACGCCATACCTTTCGCAACCTGGTAAGAGAAAGACAGCAGGT 1819 (SEQ ID NO: 34)
8K15A GTTGCGAAAGGTATGGCGTTCCTGGCGTCTAAAAACTGCATCCA 1821 (SEQ ID NO:
35) 8K15B CGCGCCGCCAGGTCACGGTGGATGCAGTTTTTAGACGCC 1822 (SEQ ID NO:
36) 8K16A CGTGACCTGGCGGCGCGTAACATCCTGCTGACCCACGGTCG 1823 (SEQ ID
NO: 37) 8K16B ACCGAAGTCGCAGATTTTGGTGATACGACCGTGGGTCAGCAGG 1824 (SEQ
ID NO: 38) 8K17A ACCAAAATCTGCGACTTCGGTCTGGCGCGTGACATCAAAAACG 1825
(SEQ ID NO: 39) 8K17B
GTTACCTTTAACAACGTAGTTAGAGTCGTTTTTGATGTCACGCGCC 1826 (SEQ ID NO: 40)
8K18A TCTAACTACGTTGTTAAAGGTAACGCGCGTCTGCCGGTTAAATG 1827 (SEQ ID NO:
41) 8K18B GAAGATAGATTCCGGCGCCATCCATTTAACCGGCAGACGCGC 1829 (SEQ ID
NO: 42) 8K19A ATGGCGCCGGAATCTATCTTCAACTGCGTTTACACCTTCGAATC 1831
(SEQ ID NO: 43) 8K19B GATACCGTAAGACCAAACGTCAGATTCGAAGGTGTAAACGCAG
1832 (SEQ ID NO: 44) 8K20A
GACGTTTGGTCTTACGGTATCTTCCTGTGGGAACTGTTCTCTC 1833 (SEQ ID NO: 45)
8K20B CCTGTGGGAACTGTTCTCTCTGGGTTCTTCTCCGTACCCGG 1834 (SEQ ID NO:
46) 8K21A GGTTCTTCTCCGTACCCGGGTATGCCGGTTGACTCTAAATTCTAT 1835 (SEQ
ID NO: 47) 8K21B CGGAAACCTTCTTTGATCATTTTGTAGAATTTAGAGTCAACCGGC 1836
(SEQ ID NO: 48) 8K22A AAAATGATCAAAGAAGGTTTCCGTATGCTGTCTCCGGAACACG
1837 (SEQ ID NO: 49) 8K22B
ATGTCGTACATTTCCGCCGGCGCGTGTTCCGGAGACAGCATA 1838 (SEQ ID NO: 50)
8K23A CCGGCGGAAATGTACGACATCATGAAAACCTGCTGGGACGCG 1839 (SEQ ID NO:
51) 8K23B AAGGTCGGACGTTTCAGCGGGTCCGCGTCCCAGCAGGTTTTC 1841 (SEQ ID
NO: 52) 8K24A CCGCTGAAACGTCCGACCTTCAAACAGATCGTTCAGCTGATCG 1842 (SEQ
ID NO: 53) 8K24B TTGGTAGATTCAGAGATCTGTTTTTCGATCAGCTGAACGATCTGTT
1843 (SEQ ID NO: 54) 8K25A
AAACAGATCTCTGAATCTACCAACCACATCTACTCTAACCTGGC 1844 (SEQ ID NO: 55)
8K25B TGACGGTTCGGAGAGCAGTTCGCCAGGTTAGAGTAGATGTGG 1845 (SEQ ID NO:
56) 8K26A AACTGCTCTCCGAACCGTCAGAAACCGGTTGTTGACCACTCTG 1846 (SEQ ID
NO: 57) 8K26B GTAGAACCAACAGAGTTGATACGAACAGAGTGGTCAACAACCGGT 1847
(SEQ ID NO: 58) 8K27A CGTATCAACTCTGTTGGTTCTACCGCGTCTTCTTCTCAGCCG
1848 (SEQ ID NO: 59) 8K27B AACGTCGTCGTGAACCAGCAGCGGCTGAGAAGAAGACGCG
1849 (SEQ ID NO: 60) 8K-F GTTGTTCATATGTACGAAGTTCAGTGGAAAG 1851 (SEQ
ID NO: 61) 8K-R GTTGTTTGTCGACTAAACGTCGTCGTGAACCAGCAG 1852 (SEQ ID
NO: 62) KIT COD- GTTCTTGTCGACTAtttctgacggttcggagagc 3411 K948X (SEQ
ID NO: 63)
[1252] Additional Biochemical and Cell-Based Assays
[1253] In general, any protein kinase assay can be adapted for use
with c-kit. For example, assays (e.g. biochemical and cell-based
assays) as described in Lipson et al., U.S. Patent Publ.
20040002534 (incorporated herein by reference in its entirety) can
be used in the present invention.
[1254] In Vivo Model System Testing
[1255] For in vivo testing, a suitable animal model system can be
selected for use. For example, for multiple sclerosis, the rodent
experimental allergic encephalomyelitis (EAE) is commonly used.
This system is well-known, and is described, for example, in
Steinman, 1996, Cell 85:299-302 and Secor et al., 2000, J Exp. Med
5:813-821, which are incorporated herein by reference in their
entireties.
[1256] Similarly, other model systems can be selected and used in
the present invention.
[1257] Exemplary Fms Biochemical Assay
[1258] IC.sub.50 values were determined with respect to inhibition
of Fins kinase activity, where inhibition of phosphorylation of a
peptide substrate is measured as a function of compound
concentration. Compounds to be tested, dissolved in DMSO (1 .mu.L),
were added to a white 384-well plate (Costar #3705). Working stocks
of Fms kinase (Upstate Biotech, #14-551), biotin-(E4Y).sub.10
substrate (Upstate Biotech, Cat#12-440), and ATP (Sigma,
Cat#A-3377) were prepared in 8 mM MOPS pH 7.4, 2 mM MgCl.sub.2, 0.8
mM MnCl.sub.2, 2 mM DTT, and 0.01% Tween-20. All components were
added to the 384-well plate for a final concentration of 0.5
ng/well Fms, 30 nM biotin-(E4Y).sub.10 (Upstate Biotechnology) and
10 .mu.M ATP in a volume of 20 .mu.L. Each sample was at 5% DMSO.
The plate was then incubated for 60 minutes at room temperature.
Just before use, working stocks of donor and acceptor beads from
the AlphaScreen PY20 Detection Kit (PerkinElmer, Cat#676601M) were
prepared in 8 mM MOPS, pH 7.4, 100 mM EDTA, 0.3% BSA. To stop the
reaction, the plate was uncovered in the dark and 5 .mu.l of Donor
Beads solution (Streptavidin beads) was added to each well. The
plate was incubated at room temperature for 20 minutes. Five
microliters of Acceptor Beads solution (PY20 coated beads) were
then added to each well. The final concentration of each bead was
20 .mu.g/mL. The plates were incubated at room temperature for 60
minutes. Fluorescence signal was recorded on the Fusion Alpha
reader or AlphaQuest reader. Phosphorylated substrate results in
binding of the PY20 antibody and association of the donor and
acceptor beads such that signal correlates with kinase activity.
The signal vs. compound concentration was used to determine the
IC.sub.50.
[1259] Compounds were also tested using a similar assay with a
10-fold higher ATP concentration. Compounds to be tested, dissolved
in DMSO (1 .mu.L), were added to a white 384-well plate (Costar
#3705). Working stocks of Fms kinase (Upstate Biotech, #14-551),
biotin-(E4Y).sub.10 substrate (Upstate Biotech, Cat#12-440), and
ATP (Sigma. Cat#A-3377) were prepared in 25 mM HEPES pH 7.5, 0.5 mM
MgCl.sub.2, 0.2 mM MnCl.sub.2, 2 mM DTT. 0.01% BSA, and 0.01%
Tween-20. All components were added to the 384-well plate for a
final concentration of 0.5 ng/well Fms, 30 nM biotin-(E4Y).sub.10
(Upstate Biotechnology) and 100 .mu.M ATP in a volume of 20 .mu.L.
Each sample was at 5% DMSO. The plate was then incubated for 30
minutes at room temperature. Just before use, working stocks of
donor and acceptor beads from the AlphaScreen PY20 Detection Kit
(PerkinElmer. Cat#676601M) were prepared in 25 mM HEPES pH 7.5, 100
mM EDTA, 0.01% BSA. To stop the reaction, the plate was uncovered
in the dark and 5 .mu.l of Donor Beads solution (Streptavidin
beads) was added to each well. The plate was incubated at room
temperature for 20 minutes. Five microliters of Acceptor Beads
solution (PY20 coated beads) were then added to each well. The
final concentration of each bead was 10 .mu.g/mL. The plates were
incubated at room temperature for 60 minutes. Fluorescence signal
was recorded on the AlphaQuest or Envision reader. Phosphorylated
substrate results in binding of the PY20 antibody and association
of the donor and acceptor beads such that signal correlates with
kinase activity. The signal vs. compound concentration was used to
determine the IC.sub.50.
[1260] Compounds were assayed using a similar assay to that
described above, using in a final reaction volume of 25 .mu.l: Fins
(h) (5-10 mU) in 8 mM MOPS pH 7.0, 0.2 mM EDTA, 250 mM
KKKSPGEYVNIEFG (SEQ ID NO:66), 10 mM MgAcetate and
.gamma.-.sup.33P-ATP (approximately 500 cpm/pmol), with appropriate
concentrations of compound. Samples were incubated for 40 minutes
at room temperature and stopped by addition of 5 .mu.l of 3%
phosphoric acid. 10 .mu.l of each sample is spotted onto a P30
filtermat and washed 3.times. with 75 mM phosphoric acid, once with
methanol, dried and measured on scintillation counter (Upstate USA,
Charlottesville, Va.).
[1261] Compounds P-0001, P-0002, P-0003, P-0004, P-0005, P-0006,
P-0007, P-0008, P-0009, P-0010, P-0011, P-0013, P-0014, P-0015,
P-0016, P-0028, P-0032, P-0033, P-0038, P-0053, P-0054, P-0055,
P-0056, P-0057, P-0058, P-0059, P-0060, P-0061, P-0062, P-0063,
P-0064, P-0065, P-0066, P-0069, P-0072, P-0073, P-0074, P-0075,
P-0076, P-0078, P-0081, P-0082, P-0092, P-0093, P-0094, P-0095,
P-0096, P-0097, P-0098, P-0099, P-0100, P-0101, P-0102, P-0103,
P-0104, P-0105, P-0106, P-0107, P-0108, P-0109. P-0110, P-0111,
P-0112, P-0113, P-0114, P-0115, P-0116, P-0117, P-0118. P-0119,
P-0120, P-0121, P-0122, P-0123, P-0125, P-0126, P-0127. P-0128,
P-0129, P-0130, P-0131, P-0132, P-0134, P-0135, P-0136, P-0137,
P-0140, P-0141. P-0142, P-0143, P-0144, P-0145, P-0146, P-0147,
P-0148, P-0149, P-0150, P-0151, P-0152, P-0153, P-0154, P-0156,
P-0157. P-0158, P-0159, P-0160, P-0161, P-0163, P-0164, P-0165.
P-0167, P-0168, P-0169, P-0170, P-0171, P-0172, P-0173. P-0174,
P-0175, P-0176, P-0179, P-0180, P-0181, P-0182, P-0183, P-0185,
P-0186, P-0187, P-0188, P-0189, P-0190, P-0191, P-0192. P-0193,
P-0194, P-0195, P-0196, P-0197, P-0198, P-0199, P-0200, P-0201,
P-0202, P-0203, P-0204, P-0205, P-0206, P-0207, P-0208, P-0209,
P-0210, P-0211, P-0212, P-0213, P-0214, P-0215, P-0216, P-0217,
P-0218, P-0219, P-0220, P-0221, P-0222, P-0223, P-0224, P-0225,
P-0226, P-0227, P-0228, P-0229, P-0230, P-0231, P-0232, P-0233,
P-0234, P-0235, P-0236, P-0237, P-0238, P-0239, P-0240, P-0241,
P-0242, P-0243, P-0244, P-0245, P-0246, P-0247, P-0248. P-0249.
P-0250, P-0251, P-0252, P-0253, P-0254, P-0255, P-0256, P-0257,
P-0258, P-0259, P-0260, P-0261, P-0262, P-0263, P-0264, P-0265,
P-0266, P-0267, P-0268, P-0269, P-0270, P-0271, P-0272, P-0273,
P-0274, P-0275, P-0276, P-0277, P-0278, P-0279, P-0280, P-0281,
P-0282, P-0283, P-0284, P-0285, P-0286, P-0287, P-0288, P-0289,
P-0290, P-0291, P-0292, P-0293, P-0294, P-0295, P-0296, P-0297,
P-0298, P-0299, P-0300, P-0301, P-0302. P-0303, P-0304, P-0305,
P-0306, P-0307, P-0308, P-0309, P-0310, P-0311, P-0312, P-0313,
P-0314, P-0315, P-0316, P-0317, P-0318, P-0319, P-0320, P-0321,
P-0322, P-0323. P-0324, P-0325, P-0326, P-0327, P-0328, P-0329,
P-0330, P-0331, P-0332, P-0333, P-0334, P-0335, P-0336, P-0337,
P-0338, P-0339, P-0340, P-0341, P-0342, P-0343, P-0344, P-0345,
P-0346, P-0347, P-0348, P-0349, P-0350, P-0351, P-0352, P-0353,
P-0354, P-0355, P-0356, P-0357, P-0358, P-0359, P-0360, P-0361,
P-0362, P-0363, P-0364, P-0365, P-0366. P-0367, P-0368, P-0369,
P-0370, P-0371, P-0372, P-0373, P-0374, P-0375, P-0376, P-0377,
P-0378, P-0379, P-0380, P-0381, P-0382, P-0383, P-0384, P-0385,
P-0386, P-0387, P-0390, P-0391, P-0392, P-0393, P-0394, P-0395,
P-0396. P-0402, P-0403, P-0404, P-0405, P-0406, P-0407, P-0408,
P-0409, and P-0412 had IC.sub.50 of less than 1 .mu.M in at least
one of the Fins assays described above in Examples 40 or 41.
[1262] Exemplary TrkA Biochemical Assay
[1263] Compounds were similarly assayed to determine IC.sub.50
values with respect to inhibition of TrkA kinase activity, where
inhibition of phosphorylation of a peptide substrate was measured
as a function of compound concentration. Compounds tested were
dissolved in DMSO (1 .mu.L) and added to a white 384-well plate
(Costar #3705). Working stocks of TrkA kinase (Upstate Biotech,
#14-571), biotin-(E4Y).sub.10 substrate (Upstate Biotech,
Cat#12-440), and ATP (Sigma, Cat#A-3377) were prepared in 25 mM
Hepes pH 7.5, 10 mM MnCl.sub.2, 1 mM DTT, and 0.01% Tween-20. All
components were added to the 384-well plate for a final
concentration of 1 ng/well TrkA, 30 nM biotin-(E4Y).sub.10 (Upstate
Biotechnology) and 100 .mu.M ATP in a volume of 20 .mu.L. Each
sample was at 5% DMSO. The plate was then incubated for 40 minutes
at room temperature. Just before use, working stocks of donor and
acceptor beads from the AlphaScreen PY20 Detection Kit
(PerkinElmer, Cat#676601M) were prepared in 25 mM Hepes pH 7.5, 100
mM EDTA, 0.3% BSA. To stop the reaction, the plate was uncovered in
the dark and 5 .mu.l of Donor Beads solution (Streptavidin beads)
was added to each well. The plate was incubated at room temperature
for 20 minutes. Five microliters of Acceptor Beads solution (PY20
coated beads) were then added to each well. The final concentration
of each bead was 10 .mu.g/mL. The plates were incubated at mom
temperature for 60 minutes. Fluorescence signal was recorded on the
AlphaQuest or Envision reader. Phosphorylated substrate results in
binding of the PY20 antibody and association of the donor and
acceptor beads such that signal correlates with kinase activity.
The signal vs. compound concentration was used to determine the
IC.sub.50. Compounds P-0157, P-0171, P-0179, P-0180, P-0303, and
P-0412 had IC.sub.50 of less than 1 .mu.M in this TrkA assay.
[1264] Exemplary HGK Biochemical Assay
[1265] The MAP4K4 (or kinase domain thereof) is an active kinase in
AlphaScreen. IC.sub.50 values are determined with respect to
inhibition of MAP4K4 kinase activity, where inhibition of
phosphorylation of a peptide substrate is measured as a function of
compound concentration. Compounds to be tested were dissolved in
DMSO to a concentration of 20 mM. These were diluted 30 .mu.l into
120 d of DMSO (4 mM) and 1 .mu.l was added to an assay plate. These
were then serially diluted 1:3 (50 .mu.l to 100 .mu.l DMSO) for a
total of 8 points. Plates were prepared such that each kinase
reaction is 20 .mu.l in 1.times. kinase buffer (20 mM Tris, pH 7.4,
10 mM MgCl.sub.2, 1 mM DTT, 0.01% Tween-20), 5% DMSO and 10 .mu.M
ATP. Substrate was 10 nM biotin-ERM (T567/T564/T558, Cell
Signaling, Inc., cat#1344). MAP4K4 kinase was at 0.5 ng per sample.
After incubation of the kinase reaction for 40 min at room
temperature, 5 .mu.l of donor beads and protein A acceptor beads
(Perkin Elmer Life Science, cat#67606017) at final concentration 1
.mu.g/ml in stop buffer (20 mM Tris, pH 7.4, 200 mM Nacl, 100 mM
EDTA, 0.03% BSA) was added, along with Phospho-ERM Antibody
(T567/T564/T558, Cell Signaling. Inc., cat#3141) at 1:1000
dilution. The samples were incubated for 2 hours at room
temperature and the signal per well was read on AlphaQuest reader.
Phosphorylated substrate results in binding of the antibody which
binds to protein A acceptor bead and association of the donor and
acceptor beads is such that the signal correlates with kinase
activity. The signal vs. compound concentration was used to
determine the IC.sub.50. Compounds P-0156, P-0177, P-0179. P-0195,
P-0201, P-0203, P-0206, P-0207, P-0231, P-0240, P-0241, P-0255,
P-0324, P-0341, and P-0403 had IC.sub.50 of less than 1 .mu.M in
this HGK assay.
Example 42: Site-Directed Mutagenesis of c-Kit, c-Fms and Other
Kinases
[1266] Mutagenesis of c-kit and other kinases (as well as other
sequences of interest) can be carried out according to the
following procedure as described in Molecular Biology: Current
Innovations and Future Trends. Eds. A. M. Griffin and H. G.
Griffin. (1995) ISBN 1-898486-01-8, Horizon Scientific Press, PO
Box 1, Wymondham, Norfolk, U.K., among others.
[1267] In vitro site-directed mutagenesis is an invaluable
technique for studying protein structure-function relationships,
gene expression and vector modification. Several methods have
appeared in the literature, but many of these methods require
single-stranded DNA as the template. The reason for this,
historically, has been the need for separating the complementary
strands to prevent reannealing. Use of PCR in site-directed
mutagenesis accomplishes strand separation by using a denaturing
step to separate the complementing strands and allowing efficient
polymerization of the PCR primers. PCR site-directed methods thus
allow site-specific mutations to be incorporated in virtually any
double-stranded plasmid; eliminating the need for M13-based vectors
or single-stranded rescue.
[1268] It is often desirable to reduce the number of cycles during
PCR when performing PCR-based site-directed mutagenesis to prevent
clonal expansion of any (undesired) second-site mutations. Limited
cycling which would result in reduced product yield, is offset by
increasing the starting template concentration. A selection is used
to reduce the number of parental molecules coming through the
reaction. Also, in order to use a single PCR primer set, it is
desirable to optimize the long PCR method. Further, because of the
extendase activity of some thermostable polymerases it is often
necessary to incorporate an end-polishing step into the procedure
prior to end-to-end ligation of the PCR-generated product
containing the incorporated mutations in one or both PCR
primers.
[1269] The following protocol provides a facile method for
site-directed mutagenesis and accomplishes the above desired
features by the incorporation of the following steps: (i)
increasing template concentration approximately 1000-fold over
conventional PCR conditions; (ii) reducing the number of cycles
from 25-30 to 5-10; (iii) adding the restriction endonuclease DpnI
(recognition target sequence: 5-Gm6ATC-3, where the A residue is
methylated) to select against parental DNA (note: DNA isolated from
almost all common strains of E. coli is Dam-methylated at the
sequence 5-C ATC-3); (iv) using Taq Extender in the PCR mix for
increased reliability for PCR to 10 kb; (v) using Pfu DNA
polymerase to polish the ends of the PCR product, and (vi)
efficient intramolecular ligation in the presence of T4 DNA
ligase.
[1270] Plasmid template DNA (approximately 0.5 pmole) is added to a
PCR cocktail containing, in 25 ul of 1.times. mutagenesis buffer:
(20 mM Tris HCl, pH 7.5; 8 mM MgCl2; 40 ug/ml BSA); 12-20 pmole of
each primer (one of which must contain a 5-prime phosphate), 250 uM
each dNTP, 2.5 U Taq DNA polymerase, 2.5 U of Taq Extender
(Stratagene).
[1271] The PCR cycling parameters are 1 cycle of: 4 min at
94.degree. C., 2 min at 50.degree. C. and 2 min at 72.degree. C.;
followed by 5-10 cycles of 1 min at 94.degree. C., 2 min at
54.degree. C. and 1 min at 72.degree. C. (step 1).
[1272] The parental template DNA and the linear, mutagenesis-primer
incorporating newly synthesized DNA are treated with DpnI (10 U)
and Pfu DNA polymerase (2.5U). This results in the DpnI digestion
of the in vivo methylated parental template and hybrid DNA and the
removal, by Pfu DNA polymerase, of the Taq DNA polymerase-extended
base(s) on the linear PCR product.
[1273] The reaction is incubated at 37.degree. C. for 30 min and
then transferred to 72.degree. C. for an additional 30 min (step
2).
[1274] Mutagenesis buffer (1.times., 115 ul, containing 0.5 mM ATP)
is added to the DpnI-digested, Pfu DNA polymerase-polished PCR
products.
[1275] The solution is mixed and 10 ul is removed to a new
microfuge tube and T4 DNA ligase (2-4 U) added.
[1276] The ligation is incubated for greater than 60 min at
37.degree. C. (step 3).
[1277] The treated solution is transformed into competent E. coli
(step 4).
[1278] In addition to the PCR-based site-directed mutagenesis
described above, other methods are available. Examples include
those described in Kunkel (1985) Proc. Natl. Acad. Sci. 82:488-492;
Eckstein et al. (1985) Nucl. Acids Res. 13:8764-8785; and using the
GeneEditor.TM. Site-Directed Mutagenesis System from Promega.
Example 43 Synthesis of
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c Acid Benzylamide P-0084
[1279]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-car-
boxylic acid benzylamide P-0084 was synthesized in 6 steps from
dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine 2 as shown in
Scheme 158.
##STR00331##
[1280] Step 1: Preparation of
3-Dimethylaminomethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (511)
[1281] To dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine (2,
2.50 g, 14.3 mmol, prepared as described in Example 2, Scheme 4,
Step 1) in tetrahydrofuran (200.0 mL) was added sodium hydride
(0.685 g. 60% in mineral oil, 17.1 mmol). After 10 minutes,
di-tert-butyldicarbonate (3.74 g, 17.1 mmol) was added to the
reaction. The reaction was stirred at room temperature overnight.
The reaction was poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 30% ethyl acetate in hexane
to give as a white solid (511, 3.80 g, 96.7%).
Step 2: Preparation of
3-Chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid tert-butyl
ester (512)
[1282] To 3-dimethylaminomethyl-pyrrolo[2,3-b]pyridine-1-carboxylic
acid tert-butyl ester (511, 2.60 g, 9.44 mmol) in toluene (50.00
mL) was added isopropyl chloroformate (11.3 mL, 1.0 M in toluene)
under an atmosphere of nitrogen. The reaction was stirred at room
temperature for 3 hours. The reaction was poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give a white solid
(512, 2.0 g, 79.4%).
Step 3--Preparation of
3-(2-Acetyl-3-oxo-butyl)-pyrrolo[2,3-b]pyridine-1-carboxylic Acid
Tert-Butyl Ester (513)
[1283] To acetylacetone (0.563 g. 5.62 mmol) in dimethyl sulfoxide
(29.0 mL) was added sodium hydride (0.225 g. 60% in mineral oil,
5.62 mmol). After 20 minutes,
3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid tert-butyl
ester (512, 1.00 g, 3.75 mmol) was added to the reaction. The
reaction was stirred at room temperature for 2 hours. The reaction
was poured into water and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 40% ethyl acetate in hexane to give a
colorless oil (513, 0.59 g, 48.0%). MS (ESI)
[M+H.sup.+].sup.+=331.4.
Step 4--Preparation of
3-(3,5-Dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine-1-carboxyli-
c Acid Tert-Butyl Ester (514)
[1284] To
3-(2-acetyl-3-oxo-butyl)-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (513, 1.20 g. 3.63 mmol) in methanol (15.0 mL),
cooled to -20.degree. C. under an atmosphere of nitrogen, was added
hydrazine (0.128 g, 4.00 mmol) in dichloromethane (6.0 mL). The
reaction was stirred for 2 hours. The reaction was concentrated to
remove the solvents, and the residue was poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 60% ethyl acetate in hexane to give a white solid
(514, 1.0 g, 84.4%). MS (ESI) [M+H.sup.+].sub.+=327.4.
Step 5--Preparation of
3-(1-Benzylcarbamoyl-3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]py-
ridine-1-carboxylic Acid Tert-Butyl Ester (515)
[1285] To
3-(3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine-1--
carboxylic acid tert-butyl ester (514, 60.0 mg, 0.18 mmol) in
dichloromethane (6.0 mL) were added
1,8-diazabicyclo[5.4.0]undec-7-ene (0.033 mL, 0.220 mmol) and
benzyl isocyanate (29.4 mg, 0.220 mmol) under an atmosphere of
nitrogen. The reaction was stirred at room temperature for 2 hours.
The reaction was concentrated and purified by silica gel column
chromatography eluting with 30% ethyl acetate in hexane to give
crude compound (515, approx. 50 mg) that was used in the next step
directly. MS (ESI) [M+H.sub.+].sup.+=460.5.
Step
6--3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-ca-
rboxylic Acid Benzylamide (P-0084)
[1286] To
3-(1-benzylcarbamoyl-3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo-
[2,3-b]pyridine-1-carboxylic acid tert-butyl ester (515, 50.0 mg,
0.11 mmol) in dichloromethane (6.0 mL) was added trifluoroacetic
acid (0.20 mL, 2.6 mmol) under an atmosphere of nitrogen. The
reaction was stirred at room temperature for 20 minutes. The
reaction was poured into aqueous potassium carbonate and extracted
with ethyl acetate. The organic layer was dried over anhydrous
sodium sulfate and filtered. The filtrate was concentrated and
purified by silica gel column chromatography eluting with 30% ethyl
acetate in hexane to give a white solid (P-0084, 11.0 mg, 28.1%).
MS (ESI) [M+H.sup.+].sup.+=360.5.
[1287]
3-(3,5-Dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine
P-0124
##STR00332##
was prepared from
3-(3,5-Dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine-1-carboxyli-
c acid tert-butyl ester (514, 15.0 mg, 0.046 mmol) by dissolving in
dichloromethane (10.0 mL) to which trifluoroacetic acid (0.10 mL,
1.3 mmol) was added. The reaction was stirred at room temperature
for 1 hour, then poured into aqueous potassium carbonate and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and washed with ethyl acetate in hexane to give an
off-white solid (P-0124, 7.5 mg. 72.0%). MS (ESI)
[M+H.sup.+].sup.+=227.3.
[1288] Additional compounds were prepared following the protocol of
Scheme 158, replacing benzyl isocyanate with an appropriate
electrophile in Step 5. The following compounds were made following
this procedure: [1289]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid phenylamide (P-0085), [1290]
[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-pheny-
l-methanone (P-0086), [1291]
1-[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-3-p-
henyl-propan-1-one (P-0087), [1292]
3-(3,5-Dimethyl-1-phenylmethanesulfonyl-1H-pyrazol-4-ylmethyl)-1H-pyrrolo-
[2,3-b]pyridine (P-0088), [1293]
3-[1-(Butane-1-sulfonyl)-3,5-dimethyl-1H-pyrazol-4-ylmethyl]-1H-pyrrolo[2-
,3-b]pyridine (P-0089), [1294]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid butylamide (P-0090), and [1295]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid phenethyl-amide (P-0091).
[1296] The electrophile used in place of benzyl isocyanate in Step
5 is indicated in Column 2 of the following table, with the
compound structure given in Column 3. Column 1 provides the
compound number and Column 4 the experimental mass spectrometry
result.
TABLE-US-00008 MS(ESI) [M + H.sup.+].sup.+ Electrophile Compound
observed P-0085 ##STR00333## ##STR00334## 346.4 P-0086 ##STR00335##
##STR00336## 331.2 P-0087 ##STR00337## ##STR00338## 359.2 P-0088
##STR00339## ##STR00340## 381.2 P-0089 ##STR00341## ##STR00342##
347.2 P-0090 ##STR00343## ##STR00344## 326.2 P-0091 ##STR00345##
##STR00346##
[1297] Additional compounds were prepared following the protocol of
Scheme 158, replacing
dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine 2 with
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-dimethyl-amine
(prepared as described in Example 107, Scheme 164, isolated after
step 1) in Step 1 and replacing benzyl isocyanate with an
appropriate electrophile in Step 5. The following compounds were
made following this procedure: [1298]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid [2-(4-fluoro-phenyl)-ethyl]-amide (P-0157), [1299]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid 4-fluoro-benzylamide (P-0158), [1300]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid 4-chloro-benzylamide (P-0159), and [1301]
4-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-3,5-dimethyl-pyrazole-1--
carboxylic acid [(S)-1-(4-fluoro-phenyl)-ethyl]-amide (P-0160).
[1302] The electrophile used in place of benzyl isocyanate in Step
5 is indicated in Column 2 of the following table, with the
compound structure given in Column 3. Column 1 provides the
compound number and Column 4 the experimental mass spectrometry
result.
TABLE-US-00009 MS(ESI) [M + H.sup.+].sup.+ Electrophile Compound
observed P-0157 ##STR00347## ##STR00348## 426.2 P-0158 ##STR00349##
##STR00350## 412.2 P-0159 ##STR00351## ##STR00352## 428.2 P-0160
##STR00353## ##STR00354## 426.2
Example 44 Synthesis of
[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-4-
-ylmethyl-amine P-0168
[1303]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyr-
idin-4-ylmethyl-amine P-0168 was synthesized in 5 steps as shown in
Scheme 159.
##STR00355## ##STR00356##
Step 1--Preparation of
4-chloro-2-[(pyridin-4-ylmethyl)-amino]-thiazole-5-carbaldehyde
(517)
[1304] To a solution of 4-(aminomethyl)pyridine (516, 1.16 mL, 11.5
mmol) and N,N-diisopropylethylamine (3.8 mL, 22 mmol) in
tetrahydrofuran (50 mL) was added
2,4-dichloro-thiazole-5-carbaldehyde (93, 2.0 g, 11.0 mmol) in
tetrahydrofuran (5 mL) at room temperature. The reaction mixture
was stirred at room temperature overnight. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
brine, and dried over sodium sulfate. The crude compound
4-chloro-2-[(pyridin-4-ylmethyl)-amino]-thiazole-5-carbaldehyde
(517) was used for the next step without purification.
Step 2--Preparation of
(4-chloro-5-formyl-thiazol-2-yl)-pyridin-4-ylmethyl-carbamic Acid
Tert-Butyl Ester (518)
[1305] A mixture of
4-chloro-2-[(pyridin-4-ylmethyl)-amino]-thiazole-5-carbaldehyde
(517, 3.28 g, 11.0 mmol), di-tert-butyldicarbonate (4.0 g, 18 mol)
and triethylamine (10 mL, 74 mmol) in dichloromethane (120 mL) was
stirred at room temperature for 6 hours. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
brine, and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with ethyl acetate in hexanes to provide the desired compound as a
yellow solid (518, 564 mg, 15%). MS (ESI)
[M+H.sup.+].sup.+=354.1.
Step 3--Preparation of
{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-H-pyrrolo[2,3-b]pyridin-3-yl)-
-methyl]-thiazol-2-yl}-pyridin-4-ylmethyl-carbamic Acid Tert-Butyl
Ester (519)
[1306] To a solution of
3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (96, 0.44 g,
1.1 mmol) in tetrahydrofuran (20 mL) at -20.degree. C.,
isopropylmagnesium chloride (2 M in tetrahydrofuran, 0.6 mL, 1.2
mmol) was added dropwise. The reaction mixture was allowed to warm
to 0.degree. C. in 10 minutes. The reaction mixture was then cooled
to -40.degree. C. A solution of
(4-chloro-5-formyl-thiazol-2-yl)-pyridin-4-ylmethyl-carbamic acid
tert-butyl ester (518, 0.26 g, 0.73 mmol) in tetrahydrofuran (4 mL)
was added to the reaction mixture. The reaction mixture was allowed
to warm to -10.degree. C. over 30 minutes. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
brine, and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with ethyl acetate in hexanes to provide the desired compound as a
yellow solid (519, 397 mg, 86%). MS (ESI)
[M+H.sup.+].sup.+=628.3.
Step 4--Preparation of
[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-thiazol-2-yl]-pyridin-4--
ylmethyl-carbamic Acid Tert-Butyl Ester (520)
[1307] A mixture of
{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methyl]-thiazol-2-yl}-pyridin-4-ylmethyl-carbamic acid tert-butyl
ester (519, 0.397 g, 0.57 mmol), triethylsilane (1.0 mL, 6.3 mmol),
and trifluoroacetic acid (0.5 mL, 6 mmol) in acetonitrile (10 mL)
was stirred at 40.degree. C. for 2 hours. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
sodium bicarbonate, washed with brine, and dried over sodium
sulfate. After removal of solvent, the residue was purified by
silica gel column chromatography eluting with methanol in
dichloromethane to provide the desired compound as a yellow solid
(520, 126 mg, 49%). MS (ESI) [M+H.sup.+].sup.+=456.2.
Step 5--Preparation of
[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-4-
-ylmethyl-amine (P-0168)
[1308] To a solution of
[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-4-
-ylmethyl-carbamic acid tert-butyl ester (520, 126 mg, 0.000276
mol) in dichloromethane (2 mL) was added hydrogen chloride (4 M in
1,4-dioxane, 2 mL). The reaction mixture was stirred at room
temperature overnight. The reaction mixture was poured into cold
sodium bicarbonate solution, extracted with ethyl acetate, washed
with brine and dried over magnesium sulfate. After removal of
solvents, the residue was washed with ethyl acetate to provide the
desired compound as a light yellow solid (P-0168, 68.4 mg, 70%). MS
(ESI) [M+H.sup.+].sup.+=356.2.
[1309] Additional compounds were prepared following the protocol of
Scheme 159, replacing 4-(aminomethyl)pyridine 516 with an
appropriate amine. The following compounds were made following this
procedure: [1310]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-3-
-ylmethyl-amine (P-0164), [1311]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-pyridin-2-
-ylmethyl-amine (P-0167), [1312]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]46-methyl--
pyridin-2-ylmethyl)-amine (P-0171), [1313]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(6-triflu-
oromethyl-pyridin-3-ylmethyl)-amine (P-0173), [1314]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(1,5-dime-
thyl-1H-pyrazol-3-ylmethyl)-amine (P-0172), [1315]
[4-Chloro-5-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2,5-dimet-
hyl-2H-pyrazol-3-ylmethyl)-amine (P-0175), and [1316]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-
-benzyl)-amine (P-0156). The following table indicates the amine
(Column 2) used in Scheme 159 to provide the compounds (Column 3).
Column 1 provides the compound number and Column 4 the observed
mass.
TABLE-US-00010 [1316] Compound MS(ESI) [M + H.sup.+].sup.+ number
Amine Compound observed P-0164 ##STR00357## ##STR00358## 356.1
P-0167 ##STR00359## ##STR00360## 356.1 P-0171 ##STR00361##
##STR00362## 370.2 P-0173 ##STR00363## ##STR00364## 424.2 P-1072
##STR00365## ##STR00366## 373.2 P-0175 ##STR00367## ##STR00368##
373.2 P-0156 ##STR00369## ##STR00370## 373.1
Example 45 Synthesis of
[4-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro--
benzyl)-amine P-0162 and
(4-fluoro-benzyl)-[4-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine P-0162
[1317] [4-Ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-yl
methyl)-thiazol-2-yl]-(4-fluoro-benzyl)-amine P-0162 was
synthesized in 1 step from [4-chloro-5-(1H-pyrrolo[2, 3-b]
pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-benzyl)-amine P-0156 as
shown in Scheme 160.
##STR00371##
[1318] Step 1--Preparation of
[4-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro--
benzyl)-amine (P-0162):
[1319] Into a round bottom flask, under an atmosphere of nitrogen,
[1,1'-bis(diphenyl phosphino) ferrocene] dichloro palladium (II),
complex with dichloromethane (1:1), was placed with toluene (15 mL,
140 mmol). [4-Chloro-5-(1H-pyrrolo[2,3-b]
pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-benzyl)-amine
(P-0156,145 mg, 0.4 mmol) was added in 5 ml of toluene at room
temperature. The mixture was stirred for 10 minutes. To the
stirring reaction, a solution of 3.13 M ethyl magnesium bromide in
ether (1.86 mL) was added dropwise at room temperature. The opaque
solution was heated to 60.degree. C. Tetrahydrofuran (10 mL) was
added to the warm solution. The mixture was heated to reflux for an
additional two hours. After cooling to 0.degree. C., the reaction
was quenched with a solution of citric acid at pH 4-5 in ice-water
and stirred to room temperature. The mixture was diluted with ethyl
acetate and washed with saturated sodium bicarbonate and brine. The
organic layer was dried over anhydrous sodium sulfate and the
solvent was removed under reduced pressure. Purification with flash
chromatography, eluting with a gradient of ethyl acetate:hexanes
(20:100), gave a yellow solid that was further washed with ethyl
acetate to give P-0162 (15 mg, 10%) as an off-white solid. MS (ESI)
[M+H.sup.+].sup.+=367.2.
[1320]
(4-Fluoro-benzyl)-[4-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-thiazol-2-yl]-amine P-0163
##STR00372##
was prepared using the protocol of Scheme 160, substituting the
3.13 M ethyl magnesium bromide in ether solution with 1.4 M of
methylmagnesium bromide in tetrahydrofuran. MS (ESI)
[M+H.sup.+].sup.+=353.2.
Example 46 Synthesis of
(4-Chloro-benzyl)-[6-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridazin-3-yl-
]-amine P-0092
[1321]
(4-Chloro-benzyl)-[6-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridazi-
n-3-yl]-amine P-0092 was synthesized in 3 steps as shown in Scheme
161.
##STR00373##
[1322] Step 1--Synthesis of
(6-bromo-pyridazin-3-yl)-(4-chloro-benzyl)-amine (522):
[1323] To 6-bromo-pyridazin-3-ylamine (521, 0.85 g, 0.0049 mol) in
acetonitrile (30.0 mL) were added 4-chlorobenzaldehyde (40, 0.82 g.
0.0058 mol), triethylsilane (4.0 mL, 0.025 mol) and trifluoroacetic
acid (2.0 mL, 0.026 mol). The reaction was heated to reflux for 4
hours, then poured into water, and extracted with ethyl acetate.
The organic layer was washed with brine, dried over anhydrous
sodium sulfate, and filtered. The filtrate was concentrated and
washed with ethyl acetate to give a white solid (522, 1.0 g). MS
(ESI) [M+H.sup.+].sup.+=298.3, 300.2.
Step 2--Preparation of
3-[6-(4-chloro-benzylamino)-pyridazin-3-ylmethyl]-pyrrolo[2,3-b]pyridine--
1-carboxylic Acid Tert-Butyl Ester (523)
[1324] To (6-bromo-pyridazin-3-yl)-(4-chloro-benzyl)-amine (522,
0.560 g, 1.88 mmol) in tetrahydrofuran (45.0 mL), under an
atmosphere of nitrogen at -78.degree. C., was added n-butyllithium
(2.50 M in hexane, 0.760 mL) slowly. After 10 minutes,
1,2-bis-(chloro-dimethyl-silanyl)-ethane (0.201 g, 0.94 mmol) in
tetrahydrofuran (5.0 mL) was added to the reaction. The reaction
mixture was allowed to stir at room temperature for 3 hours. The
reaction was cooled to -78.degree. C., followed by addition of 1.70
M of tert-butyllithium in hexane (1.20 mL) slowly. The reaction was
stirred for 20 minutes, followed by addition of a solution of
CuCN.2LiCl (0.6 M in tetrahydrofuran, 3.00 mL) and
3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid tert-butyl
ester (512, 0.47 g, 1.8 mol) in tetrahydrofuran (10.0 mL). After 30
minutes, the reaction was allowed to warm to room temperature for
10 minutes. The reaction was poured into water and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was treated with trifluoroacetic
acid (1.0 mL) dissolved in dichloromethane (10.0 mL) for 10
minutes. The reaction was concentrated, poured into aqueous
potassium carbonate and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified with silica gel column
chromatography eluting with 60% ethyl acetate in hexane to give the
desired compound (523, 0.10 g, 23.8%). MS (ESI)
[M+H.sup.+].sup.+=450.1.
Step 3--Preparation of
(4-chloro-benzyl)-[6-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridazin-3-yl-
]-amine (P-0092)
[1325] To
3-[6-(4-chloro-benzylamino)-pyridazin-3-ylmethyl]-pyrrolo[2,3-b]-
pyridine-1-carboxylic acid tert-butyl ester (523, 50.0 mg, 0.111
mmol) in dichloromethane (10.0 mL) was added trifluoroacetic acid
(0.30 mL, 0.0039 mol). The reaction was stirred at room temperature
overnight. The reaction was concentrated, poured into aqueous
potassium carbonate and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and washed with ethyl acetate and hexane
to give an off-white solid (P-0092, 7.3 mg, 19.0%). MS (ESI)
[M+H.sup.+].sup.+=350.1.
Example 47 Synthesis of
[1-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl]-(4-fluo-
ro-benzyl)-amine P-0165
[1326]
[1-Ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl]-(-
4-fluoro-benzyl)-amine P-0165 was synthesized in 7 steps as shown
in Scheme 162.
##STR00374## ##STR00375##
Step 1--Preparation of 5-nitro-2H-pyrazole-3-carboxylic Acid Methyl
Ester (525)
[1327] To 5-nitro-2H-pyrazole-3-carboxylic acid (524, 10.0 g,
0.0637 mol) in methanol (100.0 mL) was added concentrated sulfuric
acid (1.00 mL, 0.0180 mol). The reaction was stirred at room
temperature overnight. The reaction was poured into aqueous
potassium carbonate and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% ethyl acetate in hexane to give a
white solid (525, 1.5 g, 13.8%).
Step 2--Preparation of 2-ethyl-5-nitro-2H-pyrazole-3-carboxylic
acid methyl ester (526)
[1328] To 5-nitro-2H-pyrazole-3-carboxylic acid methyl ester (525,
2.50 g, 0.0146 mol) in N,N-dimethylformamide (62.5 mL) were added
iodoethane (1.2 mL, 0.016 mol) and potassium carbonate (4.17 g,
0.0301 mol) under an atmosphere of nitrogen. The reaction was
stirred at room temperature overnight. The reaction was poured into
water and extracted with ethyl acetate. The organic layer was dried
over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give a white
solid (526, 1.3 g, 44.7%).
Step 3--Preparation of 5-amino-2-ethyl-2H-pyrazole-3-carboxylic
Acid Methyl Ester (527)
[1329] To 2-ethyl-5-nitro-2H-pyrazole-3-carboxylic acid methyl
ester (526, 1.30 g, 6.53 mmol) in methanol (60.0 mL) was added 20%
Pd(OH).sub.2/C (0.1 g). The reaction was stirred under an
atmosphere of hydrogen overnight. The reaction was filtered and
concentrated to give a light yellow solid (527, 1.0 g, 90.6%).
Step 4--Preparation of
2-ethyl-5-(4-fluoro-benzylamino)-2H-pyrazole-3-carboxylic Acid
Methyl Ester (529)
[1330] To 5-amino-2-ethyl-2H-pyrazole-3-carboxylic acid methyl
ester (527, 1.00 g, 5.91 mmol) in acetonitrile (27.5 mL) were added
4-fluorobenzaldehyde (528, 0.660 mL, 6.26 mmol), triethylsilane
(4.77 mL, 0.0298 mol) and trifluoroacetic acid (2.38 mL, 0.0310
mol). The reaction was stirred at 80.degree. C. for 4 hours, then
concentrated, poured into aqueous potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give a white
solid (529, 1.00 g, 61%).
Step 5--Preparation of
2-ethyl-5-(4-fluoro-benzylamino)-2H-pyrazole-3-carbaldehyde
(530)
[1331] To 2-ethyl-5-(4-fluoro-benzylamino)-2H-pyrazole-3-carboxylic
acid methyl ester (529, 1.00 g, 3.61 mol) in tetrahydrofuran (70.0
mL) under an atmosphere of nitrogen at room temperature, lithium
tetrahydroaluminate (1.00 M of in tetrahydrofuran, 10.00 mL) was
slowly added. The reaction was stirred at room temperature
overnight, followed by slowly adding sodium sulfate decahydrate
(15.0 g). After 2 hours, the reaction was filtered, concentrated
and purified with silica gel column chromatography eluting with 20%
to 100% ethyl acetate in hexane to give a yellow oil (530, 0.16 g,
18%). MS (ESI) [M+H.sup.+].sup.+=248.2.
Step 6--Preparation of
1-ethyl-5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-1H-pyrazol-3-y-
l-(4-fluoro-benzyl)-amine (531)
[1332] To 1H-Pyrrolo[2,3-b]pyridine (1, 54.0 mg. 0.46 mmol) in
methanol (15.0 mL) were added
2-ethyl-5-(4-fluoro-benzylamino)-2H-pyrazole-3-carbaldehyde (530,
110.0 mg. 0.44 mmol) and potassium hydroxide (0.60 g, 0.011 mol)
under an atmosphere of nitrogen. The reaction was stirred at room
temperature overnight, then poured into water and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was concentrated and purified by
silica gel column chromatography eluting with 40% ethyl acetate in
hexane to give a white solid (531, 0.12 g, 71.1%). MS (ESI)
[M-H.sup.+].sup.+=378.2.
Step 7--Preparation of
[1-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl]-(4-fluo-
ro-benzyl)-amine (P-0165)
[1333] To
1-ethyl-5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-1H-py-
razol-3-yl-(4-fluoro-benzyl)-amine (531, 0.12 g, 0.32 mmol) in
acetonitrile (10.0 mL, 0.191 mol) were added triethylsilane (0.60
mL, 0.0038 mol) and trifluoroacetic acid (0.30 mL, 0.0039 mol). The
reaction was stirred at 80.degree. C. for 2 hours. The reaction was
poured into aqueous potassium carbonate and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and washed with ethyl
acetate and hexane to give crude compound. .sup.1H NMR indicated
that the reaction was incomplete. The crude compound was dissolved
in dichloromethane (15.0 mL), trifluoroacetic acid (0.30 mL) and
triethylsilane (0.60 mL). The reaction was stirred at 43.degree. C.
for 72 hours. The reaction was concentrated, poured into aqueous
potassium carbonate and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and washed with ethyl acetate and hexane
to give an off-white solid (P-0165, 18.7 mg, 17%). MS (ESI)
[M+H.sup.+].sup.+=350.3.
[1334]
(4-Fluoro-benzyl)-[l-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-1H-pyrazol-3-yl]-amine P-0169
##STR00376##
was prepared using the protocol of Scheme 162, substituting
iodoethane with iodomethane in Step 2. MS (ESI)
[M+H.sup.+].sup.+=336.3.
[1335]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyraz-
ol-3-yl]-(4-fluoro-benzyl)-amine P-0170
##STR00377##
was prepared using the protocol of Scheme 162, substituting
iodoethane with iodomethane in step 2 and 1H-pyrrolo[2,3-b]pyridine
1 with 5-chloro-1H-pyrrolo[2,3-b]pyridine in step 6. MS (ESI)
[M+H.sup.+].sup.+=370.3
[1336]
(4-Fluoro-benzyl)-{1-methyl-5-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrr-
olo[2,3-b]pyridin-3-ylmethyl]-1H-pyrazol-3-yl}-amine P-0180
##STR00378##
was prepared using the protocol of Scheme 162, substituting
iodoethane with iodomethane in step 2 and 1H-Pyrrolo[2,3-b]pyridine
1 with 5-(1-Methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine
(prepared as described in Example 115, Scheme 172) in step 6. MS
(ESI) [M+H.sup.+].sup.+=416.2.
[1337]
3-[5-(4-Fluoro-benzylamino)-2-methyl-2H-pyrazol-3-ylmethyl]-1H-pyrr-
olo[2,3-b]pyridine-5-carbonitrile P-0191
##STR00379##
was prepared using the protocol of Scheme 162, substituting
1H-Pyrrolo[2,3-b]pyridine 1 with
1H-Pyrrolo[2,3-b]pyridine-5-carbonitrile in Step 6. MS (ESI)
[M+H.sup.+].sup.+=361.5.
Example 48 Synthesis of
[4-chloro-1-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl-
]-[1-(4-fluoro-phenyl)-meth-(E)-ylidene]-amine P-0166
[1338]
[4-chloro-1-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazo-
l-3-yl]-[1-(4-fluoro-phenyl)-meth-(E)-ylidene]-amine P-0166 was
synthesized in 1 step as shown in Scheme 163.
##STR00380##
Step 1--Preparation of
[4-chloro-1-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl-
]-[1-(4-fluoro-phenyl)-meth-(E)-ylidene]-amine (P-0166)
[1339] To
[1-ethyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1H-pyrazol-3-yl-
]-(4-fluoro-benzyl)-amine (P-0165, 10.1 mg, 0.0289 mmol, prepared
as described in Example 105. Scheme 162) in acetonitrile (8.0 mL)
was added N-chloro-succinimide (4.18 mg. 0.0318 mmol). The reaction
was stirred at room temperature for 2 hours. The reaction was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give a white
solid (P-0166, 1.1 mg). MS (ESI) [M+H.sup.+].sup.+=382.1.
Example 49 Synthesis of
5-chloro-3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic Acid
Tert-Butyl Ester
[1340] 5-chloro-3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic
acid tert-butyl ester was synthesized in 3 steps as shown in Scheme
164.
##STR00381##
[1341] Step 1--Preparation of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-dimethyl-amine
(533):
[1342] To 5-Chloro-1H-pyrrolo[2,3-b]pyridine (532, 8.00 g, 0.0524
mol) in isopropyl alcohol (250.0 mL) were added dimethylamine
hydrochloride (4.79 g. 0.0587 mol) and formaldehyde (1.77 g, 0.0589
mol). The reaction was stirred at room temperature overnight,
followed by refluxing for 4 hours. The reaction was concentrated,
poured into water, and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated to give crude compound (533, 10.0 g,
91%), that was used directly in the next step.
Step 2 and 3--Preparation of
5-chloro-3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic Acid
Tert-Butyl Ester (535)
[1343] 5-Chloro-3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic
acid tert-butyl ester 535 was prepared following the protocol of
Scheme 158 (Example 101) steps 1 and 2, substituting
dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine 2 with
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-dimethyl-amine 533
in step 1.
Example 50 Synthesis of
(4-chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-flu-
oro-pyridin-2-yl]-amine P-0132
[1344]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-6-fluoro-pyridin-2-yl]-amine P-0132 was synthesized in 3 steps as
shown in Scheme 165.
##STR00382##
Step 1--Preparation of
(4-chloro-benzyl)-(6-fluoro-pyridin-2-yl)-amine (536)
[1345] To 2,6-difluoropyridine (58, 9.85 g, 0.0856 mol) in
N-methylpyrrolidinone (50.0 mL) were added p-chlorobenzylamine (61,
10.5 mL, 8.63 mmol) and N,N-diisopropylethylamine (30.0 mL, 0.172
mol). The reaction was stirred at 90.degree. C. overnight. The
reaction was poured into water and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 25% ethyl acetate in hexane,
then washed with ethyl acetate/hexane to give a white solid (536,
10 g, 50%).
Step 2--Preparation of
(5-bromo-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-amine (537)
[1346] To (4-chloro-benzyl)-(6-fluoro-pyridin-2-yl)-amine (536,
1.03 g, 4.35 mmol) in acetonitrile (30.0 mL), under an atmosphere
of nitrogen, N-bromosuccinimide (0.820 g, 4.61 mol) was added
slowly. After 2 hours, the reaction was poured into a solution of
sodium thiosulfate and extracted with ethyl acetate. The organic
layer was dried over sodium sulfate, concentrated and crystallized
with ethyl acetate and hexane to give a white solid (537, 1.10 g,
80.1%).
Step 3--Preparation oft
4-chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fluo-
ro-pyridin-2-yl]-amine (P-0132)
[1347] To (5-bromo-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-amine
(537, 2.76 g. 8.75 mol) in tetrahydrofuran (90.0 mL), under an
atmosphere of nitrogen at -78.degree. C., n-butyllithium (2.50 M in
hexane, 3.64 mL) was added slowly. After 60 minutes,
1,2-bis-(chloro-dimethyl-silanyl)-ethane (0.942 g, 4.38 mol) in
tetrahydrofuran (8.0 mL) was added to the reaction. The reaction
mixture was allowed to stir at room temperature for 2 hours. The
reaction was cooled to -78.degree. C. followed by addition of
tert-butyllithium (1.70 M in hexane, 10.50 mL). The reaction was
stirred for 30 minutes, followed by addition of 0.65 M of
CuCN.2LiCl in tetrahydrofuran (14.0 mL). The reaction was stirred
at -35.degree. C. for 10 minutes, followed by addition of
5-chloro-3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (535, 1.70 g. 5.64 mol, prepared as described in
Example 49, Scheme 164) in tetrahydrofuran (10.0 mL). The reaction
was allowed to warm to room temperature for 1 hour and 2 N HCl (30
mL) was added to the reaction mixture, then stirred for 30 minutes.
The reaction was poured into aqueous ammonia and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was concentrated and purified
with silica gel column chromatography eluting with 30% ethyl
acetate in hexane to give the desired compound (P-0132, 0.75 g,
33.1%). MS (ESI) [M+H.sup.+].sup.+=401.1.
Example 51 Synthesis of
5-chloro-3-(2,6-difluoro-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0155
[1348]
5-Chloro-3-(2,6-difluoro-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyrid-
ine P-0155 was synthesized in 1 step as shown in Scheme 166.
##STR00383##
Step 1--Preparation of
5-chloro-3-(2,6-difluoro-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0155)
[1349] To 2,6-Difluoropyridine (58, 3.40 g, 0.0295 mol) in
tetrahydrofuran (200.0 mL), under an atmosphere of nitrogen at
-78.degree. C., 2.50 M of n-butyllithium in hexane (12.0 mL) was
added slowly. After 60 minutes. CuCN.2LiCl (0.75 M in
tetrahydrofuran, 40.0 mL) was added to the reaction mixture. After
5 minutes,
5-chloro-3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (535, 4.20 g, 0.0139 mol, prepared as described in
Example 49. Scheme 164) in tetrahydrofuran (20 mL) was added to the
reaction. The reaction was stirred at -78.degree. C. overnight,
then poured into water and ammonia (10 mL), and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was concentrated and purified by
silica gel column chromatography eluting with 15% ethyl acetate in
hexane to give a white solid (P-0155, 300 mg, 7.7%). MS (ESI)
[M-H.sup.+].sup.-=278.1.
Example 52 Synthesis of
3-(2,6-difluoro-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0154
[1350]
3-(2,6-difluoro-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0154 was synthesized in 1 step as shown in Scheme 167.
##STR00384##
Step 1--Preparation of 3-2,
6-difluoro-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0154)
[1351] To
3-(2,6-difluoro-pyridin-3-ylmethyl)-pyrrolo[2,3-b]pyridine-1-car-
boxylic acid tert-butyl ester (536, 0.35 g, 1.0 mmol, prepared as
described in Example 49, Scheme 164, replacing
5-chloro-1H-pyrrolo[2,3-b]pyridine 532 with
1H-pyrrolo[2,3-b]pyridine in step 1) in N-methylpyrrolidinone (3.00
mL) were added p-chlorobenzylamine (0.20 mL, 1.6 mmol) and
N,N-diisopropylethylamine (0.30 mL, 0.0017 mol). The reaction was
stirred at 50.degree. C. for 72 hours. The reaction was poured into
water and extracted with ethyl acetate. The organic layer was dried
over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and the crude intermediate was dissolve in
dichloromethane (15.0 mL) and trifluoroacetic acid (0.5 mL). The
reaction was stirred at room temperature for 2 hours, then
concentrated, poured into aqueous potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 35% ethyl acetate in hexane to give a white solid
(P-0154, 0.18 g, 72%). MS (ESI) [M+H.sup.+].sup.+=246.2.
Example 53 Synthesis of
5-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-N-(4-chlorobenzyl)-6-chloropyri-
din-2-amine P-0161
[1352]
5-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-N-(4-chlorobenzyl)-6-chlo-
ropyridin-2-amine P-0161 was synthesized in 6 steps as shown in
Scheme 168.
##STR00385## ##STR00386##
Step 1--Preparation of
(4-chloro-benzyl)-(6-chloro-pyridin-2-yl)-amine (538)
[1353] To 6-chloro-pyridin-2-ylamine (537, 5.60 g, 0.0436 mol) in
acetonitrile (300 mL) were added 4-chlorobenzaldehyde (40, 6.7 g.
0.048 tool), trifluoroacetic acid (13 mL, 0.17 mol) and
triethylsilane (21 mL, 0.13 mol). The reaction was heated to reflux
for 4 hours, then concentrated, poured into water, extracted with
ethyl acetate, and washed with sodium bicarbonate and brine. The
organic layer was dried over anhydrous sodium sulfate, filtered and
concentrated. The filtrate was purified with silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give a white solid (538, 6.5 g, 59%). MS (ESI)
[M+H.sup.+].sup.+=255.1.
Step 2--Preparation of
(5-bromo-6-chloro-pyridin-2-yl)-(4-chloro-benzyl)-amine (539)
[1354] To (4-chloro-benzyl)-(6-chloro-pyridin-2-yl)-amine (538,
4.00 g, 0.0158 mol) in acetonitrile (66.7 mL, 1.28 mol) under an
atmosphere of nitrogen, N-bromosuccinimide (2.81 g, 0.0158 mol) in
acetonitrile (20 mL) was added slowly. The reaction was stirred at
room temperature overnight, then poured into water and extracted
with ethyl acetate. The organic layer was dried over sodium
sulfate, concentrated and crystallized with ethyl acetate in hexane
to give a white solid (539, 2.60 g, 95.3%).
Step 3--Preparation of
2-chloro-6-(4-chloro-benzylamino)-pyridine-3-carbaldehyde (540)
[1355] To (5-bromo-6-chloro-pyridin-2-yl)-(4-chloro-benzyl)-amine
(539, 2.60 g, 7.83 mmol) in tetrahydrofuran (60.0 mL) under an
atmosphere of nitrogen at -78.degree. C., isopropylmagnesium
chloride (2.00 M in tetrahydrofuran 4.20 mL) was added over 10
minutes. The reaction was stirred at -78.degree. C. for 20 minutes,
then allowed to warm to room temperature for 10 minutes. The
reaction was cooled to -78.degree. C. tert-Butyllithium (1.70 M in
hexane, 10.2 mL) was added to the reaction over 10 minutes. After
40 minutes, N,N-dimethylformamide (1.80 mL, 0.0232 mol) was added
to the reaction. The reaction was stirred at -78.degree. C. for 40
minutes, then allowed to warm to room temperature for another 30
minutes. The reaction mixture was poured into water and extracted
with ethyl acetate. The organic layer was washed with brine, dried
over sodium sulfate, concentrated and purified by silica gel column
chromatography eluting with 35% to 100% ethyl acetate in hexane to
give a light yellow solid (540, 1.0 g, 45.4%). MS (ESI)
[M-H.sup.+].sup.+=279.0.
Step 4--Preparation of
(4-chloro-benzyl)-(6-chloro-5-formyl-pyridin-2-yl)-carbamic Acid
Tert-Butyl Ester (541)
[1356] To 2-chloro-6-(4-chloro-benzylamino)-pyridine-3-carbaldehyde
(540, 0.40 g, 1.42 mmol) in dichloromethane (10.0 mL) were added
4-dimethylaminopyridine (10.0 mg. 0.082 mmol),
di-tert-butyldicarbonate (0.693 g, 3.17 mmol) and triethylamine
(0.50 mL, 0.0036 mol). The reaction was stirred at room temperature
overnight, then concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (541, 0.45 g, 83.0%).
Step 5--Preparation of
(4-chloro-benzyl)-6-chloro-5-[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-met-
hyl]-pyridin-2-yl-carbamic Acid Tert-Butyl Ester (542)
[1357] To 1H-Pyrrolo[2,3-b]pyridine (1, 465 mg, 3.93 mmol) in
methanol (50 mL) were added sodium hydroxide (0.630 g, 0.0157 mol)
and (4-chloro-benzyl)-(6-chloro-5-formyl-pyridin-2-yl)-carbamic
acid tert-butyl ester (541, 1.5 g, 0.0039 mol). The reaction was
stirred at room temperature overnight, then poured into water and
extracted with ethyl acetate. The organic layer was washed with
brine, dried over sodium sulfate, concentrated and purified with
silica gel column chromatography eluting with 20% to 100% ethyl
acetate in hexane to give the desired compound (542, 1.0 g, 51%).
MS (ESI) [M+H.sup.+].sup.+=499.1.
Step 6--Preparation of
5-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-N-(4-chlorobenzyl)-6-chloropyri-
din-2-amine (P-0161)
[1358] To
(4-chloro-benzyl)-6-chloro-5-[hydroxy-(1H-pyrrolo[2,3-b]pyridin--
3-yl)-methyl]-pyridin-2-yl-carbamic acid tert-butyl ester (542,
1.00 g, 2.00 mmol) in acetonitrile (130.0 mL) were added
triethylsilane (11.5 mL, 0.0720 mol) and trifluoroacetic acid (5.5
mL, 0.071 mol). The reaction was heated to reflux for 2 hours, then
concentrated, poured into aqueous potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and washed with ethyl acetate and hexane to give a
light yellow solid (P-0161,480 mg, 62%). MS (ESI)
[M+H.sup.+].sup.+=383.1, 385.1.
[1359]
[6-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6--
trifluoromethyl-pyridin-3-ylmethyl)-amine P-0174
##STR00387##
was prepared following the protocol of Scheme 168, substituting
4-chloro-benzaldehyde 40 with
6-trifluoromethyl-pyridine-3-carbaldehyde in step 1. MS (ESI)
[M+H.sup.+].sup.+=418.2.
[1360]
[6-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine P-0176
##STR00388##
was prepared following the protocol of Scheme 168, substituting
4-chloro-benzaldehyde 40 with
6-trifluoromethyl-pyridine-3-carbaldehyde in step 1 and
1H-Pyrrolo[2,3-b]pyridine 1 with 5-chloro-1H-pyrrolo[2,3-b]pyridine
in step 5. MS (ESI) [M+H.sup.+].sup.+=452.0.
[1361]
{6-Chloro-5-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridin--
3-ylmethyl]-pyridin-2-yl}-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine
P-0179
##STR00389##
was prepared following the protocol of Scheme 168, substituting
4-chloro-benzaldehyde 40 with
6-trifluoromethyl-pyridine-3-carbaldehyde in step 1 and
1H-Pyrrolo[2,3-b]pyridine 1 with
5-(1-Methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine (prepared as
described in Example 57, Scheme 172) in step 5. MS (ESI)
[M+H.sup.+].sup.+=498.0.
Example 54 Synthesis of
(3-chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine P-0129
[1362]
(3-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-yl]-amine P-0129 was synthesized in 1 step as shown in Scheme
169.
##STR00390##
Step 1--Preparation of
(3-chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
anine (P-0129)
[1363]
3-(6-bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-
-b]pyridine (6a, 10 mg, 0.023 mmol, prepared as described in
Example 2. Scheme 4) was combined with 3-chlorobenzyl amine (543,
13 mg, 0.093 mmol) in dioxane (0.3 mL).
Tris(dibenzylideneacetone)-dipalladium(0) (3 mg),
4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (Xantphos, 3 mg)
and sodium tert-butoxide (15 mg) were added. The mixture was heated
at 100.degree. C. overnight. Acetic acid (0.1 mL) was added and the
solvents removed under reduced pressure. The remaining residue was
dissolved in DMSO and purified by reverse phase HPLC on a YMC-Pack
ODS-A C-18 column (50 mm.times.10 mm ID), eluting with water with
0.1% trifluoroacetic acid and 5-40% acetonitrile with 0.1%
trifluoroacetic acid over 13 minutes at a flow rate of 6 mL/minute
to provide the desired compound P-0129. MS (ESI)
[M+H.sup.+].sup.+=349.1.
[1364] Additional compounds were prepared following the protocol of
Scheme 169, replacing 3-chlorobenzyl amine 543 with an appropriate
amine. The following compounds were made following this procedure:
[1365]
(4-Morpholin-4-ylmethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0093), [1366]
Pyridin-3-ylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0094), [1367]
(5-Methyl-isoxazol-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0095), [1368]
(2-Pyrrolidin-1-yl-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0096), [1369]
[1-(4-Methanesulfonyl-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyridin-2-yl]-amine (P-0097), [1370]
(2-Methoxy-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0098), [1371]
(2-Morpholin-4-yl-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-
-2-yl]-amine (P-0099), [1372]
((R)-1-Phenyl-ethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-y-
l]-amine (P-0125), [1373]
(3-Morpholin-4-yl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0126), [1374]
[1-(2-Fluoro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0127), [1375]
[2-(3-Fluoro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0128), [1376]
(1-Methyl-1H-imidazol-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
)-pyridin-2-yl]-amine (P-0130), and [1377]
(1,5-Dimethyl-1H-pyrazol-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyridin-2-yl]-amine (P-0131).
[1378] The following table indicates the amine (Column 2) used in
Scheme 169 to provide the compounds (Column 3). Column 1 provides
the compound number and column 4 the observed mass.
TABLE-US-00011 MS(ESI) Compound [M + H.sup.+].sup.+ number Amine
Compound observed P-0093 ##STR00391## ##STR00392## 414.3 P-0094
##STR00393## ##STR00394## 316.3 P-0095 ##STR00395## ##STR00396##
319.9 P-0096 ##STR00397## ##STR00398## 322.3 P-0097 ##STR00399##
##STR00400## 407.1 P-0098 ##STR00401## ##STR00402## 283.5 P-0099
##STR00403## ##STR00404## 338.3 P-0125 ##STR00405## ##STR00406##
329.1 P-0126 ##STR00407## ##STR00408## 400.3 P-0127 ##STR00409##
##STR00410## 347.1 P-0128 ##STR00411## ##STR00412## 347.1 P-0130
##STR00413## ##STR00414## 319.1 P-0131 ##STR00415## ##STR00416##
333.1
Example 55 Synthesis of
3-chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de P-0111
[1379]
3-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-b-
enzamide P-0111 was synthesized in 1 step as shown in Scheme
170.
##STR00417##
Step 1--Preparation of
3-chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0111)
[1380]
3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-
-b]pyridine (6a. 10 mg, 0.023 mmol, prepared as described in
Example 2, Scheme 4) was combined with 3-chloro-benzamide (544, 5
mg, 0.096 mmol) in dioxane (0.4 mL).
Tris(dibenzylideneacetone)-dipalladium(0) (3 mg),
4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (Xantphos, 3 mg),
and sodium tert-butoxide (15 mg) were added. Cesium carbonate (20
mg) was added and the mixture was heated at 100.degree. C.
overnight. Acetic acid (0.1 mL) was added and the solvents removed
under reduced pressure. The remaining residue was dissolved in DMSO
(0.2 mL) and purified by reverse phase HPLC on a YMC-Pack ODS-A
C-18 column (50 mm.times.10 mm ID), eluting with water with 0.1%
trifluoroacetic acid and 5-40% acetonitrile with 0.1%
trifluoroacetic acid over 13 minutes at a flow rate of 6 mL/minute
to provide the desired compound P-0111. MS (ESI)
[M+H.sup.+].sup.+=363.1.
[1381] Additional compounds were prepared following the protocol of
Scheme 170, replacing 3-chloro-benzamide 544 with an appropriate
amide. The following compounds were made following this procedure:
[1382]
3,4-Dichloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-ben-
zamide (P-0100), [1383] 2-Chloro-4-fluoro-N-[5-(1H
pyrrolo[2,3-b]pyridin-3-ylmethyl-pyridin-2-yl]-benzamide (P-0101),
[1384] 2,5-Dimethyl-2H-pyrazole-3-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-4102), [1385] Thiophene-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0103), [1386]
2-Methoxy-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-isonicotinamide (P-0104), [1387]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-isonicotinamide
(P-0105). [1388] Pyrazine-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0106), [1389] Pyridine-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0107), [1390]
6-Methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
nicotinamide (P-0108), [1391]
4-Fluoro-3-methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0109). [1392] 5-Methyl-pyrazine-2-carboxylic acid
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amide
(P-0110), [1393]
4-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
3-trifluoromethyl-benzamide (P-0112), [1394]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-3-trifluorometho-
xy-benzamide (P-0113), [1395]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-3-trifluoromethy-
l-benzamide (P-0114), [1396]
3-Chloro-4-fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0115), [1397]
3,4-Difluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-ben-
zamide (P-4116), [1398]
2-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-4117), [1399]
5-Fluoro-2-methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-benzamide (P-0118), [1400]
2-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0119), [1401]
3-Methoxy-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzam-
ide (P-0120), [1402]
3-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0121), [1403]
3-Methyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0122), and [1404]
2-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-isonico-
tinamide (P-0123).
[1405] The following table indicates the amide (Column 2) used in
Scheme 170 to provide the compounds (Column 3). Column 1 provides
the compound number and column 4 the observed mass.
TABLE-US-00012 Compound MS(ESI) [M + H.sup.+].sup.+ number Amide
Compound observed P-0100 ##STR00418## ##STR00419## 397.1 P-0101
##STR00420## ##STR00421## 381.1 P-0102 ##STR00422## ##STR00423##
347.1 P-0103 ##STR00424## ##STR00425## 335.1 P-0104 ##STR00426##
##STR00427## 360.3 P-0105 ##STR00428## ##STR00429## 329.9 P-0106
##STR00430## ##STR00431## 331.1 P-0107 ##STR00432## ##STR00433##
329.9 P-0108 ##STR00434## ##STR00435## 344.3 P-0109 ##STR00436##
##STR00437## 361.1 P-0110 ##STR00438## ##STR00439## 345.1 P-0112
##STR00440## ##STR00441## 415.1 P-0113 ##STR00442## ##STR00443##
413.1 P-0114 ##STR00444## ##STR00445## 397.1 P-0115 ##STR00446##
##STR00447## 381.1 P-0116 ##STR00448## ##STR00449## 365.1 P-0117
##STR00450## ##STR00451## 363.1 P-0118 ##STR00452## ##STR00453##
361.1 P-0119 ##STR00454## ##STR00455## 347.1 P-0120 ##STR00456##
##STR00457## 359.1 P-0121 ##STR00458## ##STR00459## 347.1 P-0122
##STR00460## ##STR00461## 343.1 P-0123 ##STR00462## ##STR00463##
364.3
Example 56 Synthesis of
3,5-dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-methoxy-benzylamide P-0135
[1406]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-car-
boxylic acid 4-methoxy-benzylamide P-0135 was synthesized in 1 step
as shown in Scheme 171.
##STR00464##
Step 1--Preparation of
3,5-dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-methoxy-benzylamide (P-0135)
[1407]
3-(3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine-1-car-
boxylic acid tert-butyl ester (514, 10 mg, 0.03 mmol) was dissolved
in dichloromethane (0.5 mL). 1,8-Diazabicylo[5.4.0]unde-7-ene (6
mg. 0.04 mmol) was added. 1-Isocyanatomethyl-4-methoxy-benzene
(545, 6.5 mg, 0.04 mmol) was added. The reaction was allowed to
proceed at room temperature for 30 minutes. Acetic acid (0.2 mL)
was added to the reaction. The solvents were removed under reduced
pressure. The residue was dissolved in dimethyl sulfoxide (0.2 mL)
and purified by reverse phase HPLC on a Phenomenex column (50
mm.times.10 mm ID), eluting with water with 0.1% trifluoroacetic
acid and 20-100% acetonitrile with 0.1% trifluoroacetic acid over
16 minutes at a flow rate of 6 mL/minute to provide the desired
compound P-0135. MS (ES) [M+H.sup.+].sup.+=390.3.
[1408] Additional compounds were prepared following the protocol of
Scheme 171, replacing 1-isocyanatomethyl-4-methoxy-benzene 545 with
an appropriate isocyanate or bromide. The following compounds were
made following this procedure: [1409]
3-(1-Benzyl-3,5-dimethyl-1H-pyrazol-4-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0133), [1410]
2-[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-1-p-
henyl-ethanone (P-0134). [1411]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-chloro-benzylamide (P-0136), [1412]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-fluoro-benzylamide (P-0137), [1413]
3-[3,5-Dimethyl-1-(5-trifluoromethyl-furan-2-ylmethyl)-1H-pyrazol-4-ylmet-
hyl]-1H-pyrrolo[2,3-b]pyridine (P-0138), [1414]
3-[3,5-Dimethyl-1-(5-methyl-isoxazol-3-ylmethyl)-1H-pyrazol-4-ylmethyl]-1-
H-pyrrolo[2,3-b]pyridine (P-0139), [1415]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-chloro-benzylamide (P-0140), [1416]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(4-ethoxy-phenyl)-ethyl]-amide (P-0141), [1417]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 3-methoxy-benzylamide (P-0142). [1418]
3-{3,5-Dimethyl-1-[4-methyl-2-(4-trifluoromethyl-phenyl)-thiazol-5-ylmeth-
yl]-1H-pyrazol-4-ylmethyl}-1H-pyrrolo[2,3-b]pyridine (P-0143),
[1419]
3-[3,5-Dimethyl-1-(4-methyl-2-phenyl-thiazol-5-ylmethyl)-1H-pyrazol-4-ylm-
ethyl]-1H-pyrrolo[2,3-b]pyridine (P-0144), [1420]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 2-methoxy-benzylamide (P-0145), [1421]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(2,4-dichloro-phenyl)-ethyl]-amide (P-0146), [1422]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(4-fluoro-phenyl)-ethyl]-amide (P-0147), [1423]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid [2-(2-fluoro-phenyl)-ethyl]-amide (P-0148), [1424]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid ((S)-1-phenyl-ethyl)-amide (P-4149). [1425]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 3-fluoro-benzylamide (P-0150), [1426]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-fluoro-benzylamide (P-4151), [1427]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid 4-methyl-benzylamide (P-0152), and [1428]
3,5-Dimethyl-4-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxylic
acid 2-methyl-benzylamide (P-4153).
[1429] The following table indicates the isocyanate or bromide
(Column 2) used in Scheme 171 to provide the compounds (Column 3).
Column 1 provides the compound number and Column 4 the observed
mass.
TABLE-US-00013 MS(ESI) Compound Isocyanate or [M + H.sup.+].sup.+
number bromide Compound observed P-0133 ##STR00465## ##STR00466##
317.1 P-0134 ##STR00467## ##STR00468## 345.1 P-0136 ##STR00469##
##STR00470## 394.3 P-0137 ##STR00471## ##STR00472## 378.3 P-0138
##STR00473## ##STR00474## 375.1 P-0139 ##STR00475## ##STR00476##
322.3 P-0140 ##STR00477## ##STR00478## 393.9 P-0141 ##STR00479##
##STR00480## 404.3 P-0142 ##STR00481## ##STR00482## 390.3 P-0143
##STR00483## ##STR00484## 482.3 P-0144 ##STR00485## ##STR00486##
414.3 P-0145 ##STR00487## ##STR00488## 390.3 P-0146 ##STR00489##
##STR00490## 442.3 P-0147 ##STR00491## ##STR00492## 392.3 P-0148
##STR00493## ##STR00494## 392.3 P-0149 ##STR00495## ##STR00496##
374.3 P-0150 ##STR00497## ##STR00498## 378.3 P-0151 ##STR00499##
##STR00500## 378.3 P-0152 ##STR00501## ##STR00502## 374.3 P-0153
##STR00503## ##STR00504## 374.3
Example 57: Synthesis of
5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine 547
[1430] 5-(1-M ethyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine 547
was synthesized in 1 step from 5-bromo-1H-pyrrolo[2,3-b]pyridine 44
as shown in Scheme 172.
##STR00505##
Step 1--Preparation of
5-(1-Methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine (547)
[1431] To 5-bromo-7-azaindole (44, 1.04 g, 5.28 mmol) in 1.00 M
potassium carbonate in water (15.8 mL) and tetrahydrofuran (50.0
mL) were added
1-methyl-4-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-1H-pyrazole
(546, 1.65 g, 7.92 mmol), Tetrakis(triphenylphosphine)palladium(0)
(0.305 mg, 0.26 mmol) and tetra-n-butylammonium iodide (0.20 g,
0.53 mmol). The reaction mixture was stirred at 70.degree. C.
overnight. The reaction mixture was poured into water and the
organic layer was washed with brine, dried over sodium sulfate, and
concentrated. The residue was purified with silica gel column
chromatography eluting with 25% ethyl acetate in hexane to provide
a light yellow solid (547, 670 mg, 64.0%). MS (ESI)
[M+H.sup.+].sup.+=199.4.
Example 58: Synthesis of
[2-(4-fluoro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone P-0177
[1432]
[2-(4-Fluoro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone P-0177 was synthesized in 2 steps as shown in Scheme
173.
##STR00506##
Step 1--Preparation of
(4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-thiazol-2-yl]-
-carbamic Acid Tert-Butyl Ester (549)
[1433] A mixture of
{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methyl]-thiazol-2-yl}-pyridin-4-ylmethyl-carbamic acid tert-butyl
ester (548, 0.397 g, 0.57 mmol, prepared according to the protocol
of Scheme 159, Example 44, replacing 4-(aminomethyl)pyridine 516
with 4-fluoro-benzylamine in step 1, isolated after step 3),
triethylsilane (1.0 mL, 6.3 mmol), and trifluoroacetic acid (0.5
mL, 6 mmol) in acetonitrile (10 mL) was stirred at 40.degree. C.
for 2 hours. The reaction mixture was poured into ice water,
extracted with ethyl acetate, washed with sodium bicarbonate and
brine, and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with methanol in dichloromethane to provide the desired compound as
a yellow solid (549, 0.11 g, 9%). MS (ESI)
[M-H.sup.+].sup.+=451.10.
Step 2--Preparation of
[2-(4-fluoro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0177)
[1434] To a solution of (4-fluoro-benzyl)-[5-(1H-pyrrolo[2,
3-b]pyridine-3-carbonyl)-thiazol-2-yl]-carbamic acid tert-butyl
ester (549, 0.11 g, 0.2 mmol) in dichloromethane (2 mL) was added
hydrogen chloride (4 M in 1,4-dioxane, 2 mL). The reaction mixture
was stirred at room temperature overnight. The reaction mixture was
poured into cold sodium bicarbonate solution, extracted with ethyl
acetate, washed with brine and dried over magnesium sulfate. After
removal of solvents, the residue was washed with ethyl acetate to
provide the desired compound as a yellow solid (P-0177, 9 mg, 10%).
MS (ESI) [M+H.sup.+].sup.+=353.12.
Example 59: Synthesis of
{2-[(4-chloro-benzyl)-methyl-amino]-thiazol-5-yl}-(1H-pyrrolo[2,3-b]pyrid-
in-3-yl)-methanone P-0178
[1435]
{2-[(4-Chloro-benzyl)-methyl-amino]-thiazol-5-yl}-(1H-pyrrolo[2,3-b-
]pyridin-3-yl)-methanone P-0178 was synthesized in 3 steps as shown
in Scheme 174.
##STR00507##
Step 1--Preparation of
4-chloro-2-[(4-chloro-benzyl)-methyl-amino]-thiazole-5-carbaldehyde
(551)
[1436] To a solution of (4-chloro-benzyl)-methyl-amine (550, 2 g,
0.01 mol) and N,N-diisopropylethylamine (4 mL, 0.03 mol) in
tetrahydrofuran (50 mL) was added
2,4-dichloro-thiazole-S-carbaldehyde (93, 3 g, 0.01 mmol) in
tetrahydrofuran (20 mL) at room temperature. The reaction mixture
was stirred at room temperature overnight. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
brine, and dried over sodium sulfate. After removal of solvent, the
residue was collected by filtration and washed with hexanes to
provide the desired compound as a light-yellow solid (551, 3.6 g,
90%).
Step 2--Preparation of
{(4-chloro-2-[(4-chlor-benzyl)-methyl-amino]-thiazol-5-yl}-(1-triisopropy-
lsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (552)
[1437] To a solution of
3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (96, 0.82 g,
2.0 mmol) in tetrahydrofuran (5 mL) at -20.degree. C.,
isopropylmagnesium chloride (2 M in tetrahydrofuran, 1.1 mL, 2.2
mmol) was added dropwise. The reaction mixture was allowed to warm
to 0.degree. C. in 10 minutes. The reaction mixture was then cooled
to -40.degree. C. To the reaction mixture was added a solution of
4-chloro-2-[(4-chloro-benzyl)-methyl-amino]-thiazole-5-carbaldehyde
(551, 0.41 g. 1.4 mmol) in tetrahydrofuran (10 mL). The reaction
mixture was allowed to warm to -10.degree. C. in 30 minutes. The
reaction mixture was poured into ice water, extracted with ethyl
acetate, washed with brine, and dried over sodium sulfate. After
removal of solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexanes to provide the
desired compound as a yellow solid (552, 0.5 g, 60%). MS (ESI)
[M+H.sup.+].sup.+=575.29.
Step 3--Preparation of
{2-[(4-chloro-benzyl)-methyl-amino]-thiazol-5-yl}-(1H-pyrrolo[2,3-b]pyrid-
in-3-yl)-methanone (P-0178)
[1438] A mixture of
{4-chloro-2-[(4-chloro-benzyl)-methyl-amino]-thiazol-5-yl}-(1-triisopropy-
lsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (552, 1 g, 2
mmol), triethylsilane (2 mL, 12 mmol), and trifluoroacetic acid (1
mL, 13 mmol) in acetonitrile (10 mL) was stirred at 40.degree. C.
for 2 hours. The reaction mixture was poured into ice water,
extracted with ethyl acetate, washed with sodium bicarbonate and
brine, and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with methanol in dichloromethane to provide the desired compound as
a yellow solid (P-0178, 0.17 g, 30%). MS (ESI)
[M+H.sup.+].sup.+=383.09.
Example 60: Synthesis of Aldehyde Intermediates
[1439]
(3-Chloro-pyridin-4-ylmethyl)-(5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester 558 was synthesized in 4 steps from
6-amino-nicotinic acid methyl ester 553 as shown in Scheme 175.
##STR00508##
Step 1--Synthesis of
6-[(3-chloro-pyridin-4-ylmethyl)-amino]-nicotinic acid methyl ester
(555)
[1440] To 6-amino-nicotinic acid methyl ester (553, 2.15 g, 0.014
mol) in acetonitrile (60.0 mL) were added
3-chloro-pyridine-4-carbaldehyde (554, 2.00 g. 0.014 mol),
triethylsilane (11.00 mL, 0.069 mol) and trifluoroacetic acid (5.00
mL, 0.065 mol). The reaction was stirred at 80.degree. C.
overnight. The reaction was concentrated, poured into aqueous
potassium carbonate, and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (555, 1.5 g, 38.2%). MS (ESI)
[M+H.sup.+].sup.+=278.9.
Step 2--Synthesis of
6-[(3-Chloro-pyridin-4-ylmethyl)-amino]-pyridin-3-yl-methanol
(556)
[1441] To 6-[(3-chloro-pyridin-4-ylmethyl)-amino]-nicotinic acid
methyl ester (555, 1.00 g, 3.60 mmol) in tetrahydrofuran (120 mL)
was added a solution of lithium tetrahydroaluminate (1.00 M in
tetrahydrofuran, 5.00 mL) under an atmosphere of nitrogen at room
temperature. The reaction was stirred at room temperature
overnight, followed with addition of sodium sulfate decahydrate.
After 1 hour, the reaction mixture was filtered, concentrated, and
purified with silica gel column chromatography eluting with 2% to
20% methanol in dichloromethane to give the desired compound as a
white solid (556, 0.5 g. 56%). MS (ESI)
[M+H.sup.+].sup.+=250.1.
Step 3--Synthesis of
6-[(3-chloro-pyridin-4-ylmethyl)-amino]-pyridine-3-carbaldehyde
(557)
[1442] To
6-[(3-chloro-pyridin-4-ylmethyl)-amino]-pyridin-3-yl-methanol (556,
0.50 g, 2.00 mmol) in tetrahydrofuran (20.0 mL) was added
Dess-Martin periodinane (1.02 g, 2.40 mmol). The reaction was
stirred at room temperature for 10 minutes, then poured into
aqueous potassium carbonate, and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated to give crude compound (557, 0.45 g,
91%) that was used in the next step without further
purification.
Step 4--Synthesis of
(3-chloro-pyridin-4-ylmethyl)-(5-formyl-pyridin-2-yl)-carbamic Acid
Tert-Butyl Ester (558)
[1443] To
6-[(3-chloro-pyridin-4-ylmethyl)-amino]-pyridine-3-carbaldehyde
(557, 0.45 g, 1.80 mmol) in dichloromethane (20.0 mL) were added
di-tert-butyldicarbonate (0.65 g, 3.00 mmol),
4-dimethylaminopyridine (0.012 g, 0.010 mmol) and triethylamine
(0.28 mL, 2.00 mmol). The reaction was stirred at room temperature
overnight, then concentrated and purified with silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (558, 250 mg, 40.0%).
[1444] (2-Difluoromethoxy-benzyl)-(5-formyl-pyridin-2-yl)-carbamic
acid tert-butyl ester 559
##STR00509##
was prepared following the protocol of Scheme 175, substituting
3-chloro-pyridine-4-carbaldehyde 554 with
2-difluoromethoxy-benzaldehyde in Step 1.
[1445]
[2,6-Difluoro-3-(propane-1-sulfonylamino)-benzyl]-(5-formyl-pyridin-
-2-yl)-carbamic acid tert-butyl ester 560
##STR00510##
was prepared following the protocol of Scheme 175, substituting
3-chloro-pyridine-4-carbaldehyde 554 with propane-1-sulfonic acid
(2,4-difluoro-3-formyl-phenyl)-amide in Step 1. MS (ESI)
[M+H.sup.+].sup.+=470.3.
[1446]
(6-Fluoro-5-formyl-pyridin-2-yl)-rifluoromethyl-pyridin-3-ylmethyl)-
-carbamic acid tert-butyl ester 565 was synthesized in 4 steps from
2,6-Difluoro-nicotinic acid methyl ester 60 as shown in Scheme
176.
##STR00511##
Step 1--Synthesis of
2-fluoro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-nicotinic
Acid Methyl Ester (562)
[1447] To 2,6-difluoro-nicotinic acid methyl ester (60, 1.82 g,
0.0105 mol, prepared as described in Example 22, Scheme 24, Step 2)
in N,N-dimethylformamide (20.0 mL), under an atmosphere of nitrogen
at -40.degree. C., C-(6-trifluoromethyl-pyridin-3-yl)-methylamine
(561, 1.00 g, 5.68 mmol) was added. The reaction was stirred at
-40.degree. C., then allowed to warm to room temperature for 2
hours. The reaction was poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 35% to 100% ethyl acetate in
hexane to give a white solid (562, 1.40 g, 74.9). MS (ESI)
[M+H.sup.+].sup.+=330.1.
Step 2--Synthesis of
2-fluoro-6-[6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridin-3-yl-met-
hanol (563)
[1448] To
2-fluoro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-nicoti-
nic acid methyl ester (562, 1.40 g, 4.25 mmol) in tetrahydrofuran
(100.0 mL) under an atmosphere of nitrogen at room temperature, a
solution of lithium tetrahydroaluminate (1.00 M in tetrahydrofuran,
10.0 mL) was added slowly. The reaction was stirred at room
temperature overnight, followed by addition of an appropriate
amount of sodium sulfate decahydrate. After 1 hour, the reaction
mixture was filtered and concentrated to give crude compound (563,
1.2 g, 93.7%) that was used in the next step without further
purification.
Step 3--Synthesis of
2-fluoro-6-[6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridine-3-carba-
ldehyde (564)
[1449] To
2-fluoro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridi-
n-3-yl-methanol (563, 1.20 g, 3.98 mmol) in dichloromethane (40.0
mL) was added Dess-Martin periodinane (1.86 g. 4.38 mmol). The
reaction was stirred at room temperature for 10 minutes, then
poured into aqueous sodium thiosulfate and potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (564, 0.28 g, 23.5%).
Step 4--Synthesis of
(6-fluoro-5-formyl-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylmethyl)-c-
arbamic acid tert-butyl ester (565)
[1450] To
2-fluoro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridi-
ne-3-carbaldehyde (564, 0.28 g, 0.94 mmol) in tetrahydrofuran (10.0
mL) were added di-tert-butyldicarbonate (0.245 g. 1.12 mmol) and
4-dimethylaminopyridine (0.050 g. 0.41 mmol). The reaction was
stirred at room temperature overnight, then concentrated and
purified with silica gel column chromatography eluting with 20% to
100% ethyl acetate in hexane to give the desired compound (565,
0.22 g, 59%).
[1451]
(6-Chloro-5-formyl-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylmet-
hyl)-carbamic acid tert-butyl ester 570 was synthesized in 4 steps
from 6-chloro-pyridin-2-ylamine 537 as shown in Scheme 177.
##STR00512##
Step 1--Synthesis of
(6-chloro-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine
(567)
[1452] To 6-chloro-pyridin-2-ylamine (537, 0.760 g, 5.91 mmol) in
acetonitrile (30.0 mL), 6-trifluoromethyl-pyridine-3-carbaldehyde
(566, 1.06 g, 6.05 mmol), trifluoroacetic acid (3.00 mL, 0.0389
mol) and triethylsilane (6.00 mL, 0.0376 mol) were added. The
reaction was heated to reflux for 4 hours. The reaction was
concentrated, poured into aqueous potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate, filtered and concentrated and purified
with silica gel column chromatography eluting with 20% to 100%
ethyl acetate in hexane to give a white solid (567, 1.60 g,
94.1%).
Step 2--Synthesis of
(5-bromo-6-chloro-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylmethyl)-am-
ine (568)
[1453] To
(6-chloro-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylmethyl)-a-
mine (567, 4.50 g, 0.0156 mol) in acetonitrile (120.0 mL) under an
atmosphere of nitrogen, N-bromosuccinimide (3.03 g, 0.0170 mol) in
acetonitrile (50 mL) was added slowly. The reaction was stirred at
room temperature overnight, then poured into water, and extracted
with ethyl acetate. The organic layer was dried over sodium
sulfate, concentrated and purified with silica gel column
chromatography eluting with 25% to 100% ethyl acetate in hexane to
give a white solid (568, 6.20 g, 80.2%).
Step 3--Synthesis of
2-chloro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridine-3-carb-
aldehyde (569)
[1454] To
(5-bromo-6-chloro-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylm-
ethyl)-amine (568, 4.60 g, 0.0125 mol) in tetrahydrofuran (60.0 m
L) under an atmosphere of nitrogen at -78.degree. C.,
isopropylmagnesium chloride (2.00 M in tetrahydrofuran, 6.44 mL)
was added over 10 minutes. The reaction was stirred at -78.degree.
C. for 20 minutes, and then allowed to warm to room temperature for
10 minutes. The reaction was cooled to -78.degree. C., followed by
adding tert-butyllithium (1.70 M in hexane, 15.3 mL) over 10
minutes. After 40 minutes, N,N-dimethylformamide (1.23 mL, 0.0158
mol) was added and the reaction was stirred at -78.degree. C. for
40 minutes, then allowed to warm to room temperature for 30
minutes. The reaction mixture was poured into water and extracted
with ethyl acetate. The organic layer was washed with brine, dried
over sodium sulfate, concentrated and purified by silica gel column
chromatography eluting with 35% to 100% ethyl acetate in hexane to
give a light yellow solid (569, 2.84 g, 71.7%).
Step 4--Synthesis of
(6-chloro-5-formyl-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-ylmethyl)-c-
arbamic Acid Tert-Butyl Ester (570)
[1455] To a solution of
2-chloro-6-[(6-trifluoromethyl-pyridin-3-ylmethyl)-amino]-pyridine-3-carb-
aldehyde (569, 0.545 g, 1.73 mmol) in tetrahydrofuran (10 mL),
N,N-diisopropylethylamine (0.60 mL, 3.40 mmol),
4-dimethylaminopyridine (20 mg, 0.10 mmol), and a solution of
di-tert-butyldicarbonate (0.41 g. 0.0019 mol) were added. The
reaction mixture was stirred at room temperature overnight, then
concentrated, poured into water, and extracted with ethyl acetate.
The organic layer was washed with brine, dried over sodium sulfite,
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (570, 0.60 g, 83.6%).
[1456] (5-Bromo-6-fluoro-pyridin-2-yl)-(2-chloro-benzyl)-amine
571
##STR00513##
was prepared following the protocol of Steps 1 and 2 of Scheme 177,
substituting 6-chloro-pyridin-2-ylamine 537 and
6-trifluoromethyl-pyridine-3-carbaldehyde 566 with
6-fluoro-pyridin-2-ylamine and 2-chloro-benzaldehyde, respectively
in Step 1.
[1457]
(6-Fluoro-5-formyl-pyridin-2-yl)-(6-methoxy-pyridin-3-ylmethyl)-car-
bamic acid tert-butyl ester 572
##STR00514##
was prepared following the protocol of Scheme 177, substituting
6-chloro-pyridin-2-ylamine 537 and
6-trifluoromethyl-pyridine-3-carbaldehyde 566 with
6-fluoro-pyridin-2-ylamine and 6-methoxy-pyridine-3-carbaldehyde,
respectively in step 1.
[1458]
(5-bromo-6-fluoro-pyridin-2-yl)-(5-fluoro-pyridin-3-ylmethyl)-carba-
mic acid tert-butyl ester 631
##STR00515##
was prepared following the protocol of Scheme 177, substituting
6-chloro-pyridin-2-ylamine 537 and
6-trifluoromethyl-pyridine-3-carbaldehyde 566 with
6-fluoro-pyridin-2-ylamine and 5-fluoro-pyridine-3-carbaldehyde,
respectively in Step 1, without Step 3 (i.e. the product of Step 2
is reacted according to Step 4).
[1459] (5-Bromo-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-carbamic
acid tert-butyl ester 637
##STR00516##
was prepared following the protocol of Scheme 177, substituting
6-chloro-pyridin-2-ylamine 537 and
6-trifluoromethyl-pyridine-3-carbaldehyde 566 with
6-fluoropyridin-2-ylamine and 5-chloro-benzaldehyde, respectively
in Step 1, without Step 3 (i.e. the product of Step 2 is reacted
according to Step 4).
Example 61: Synthesis of propane-1-sulfonic acid
(2,4-difluoro-3-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamin-
o]-methyl-phenyl)-amide P-0258
[1460] Propane-1-sulfonic acid
(2,4-difluoro-3-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamin-
o]-methyl-phenyl)-amide P-0258 was synthesized in 2 steps from
3-Iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine 96 as shown
in Scheme 17S.
##STR00517##
Step 1--Synthesis of
[2,6-difluoro-3-(propane-1-sulfonylamino)-benzyl]-5-[hydroxy-(1-triisopro-
pylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-pyridin-2-yl-carbamic
Acid Tert-Butyl Ester (574)
[1461] To a solution of
3-Iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (96, 0.644
g, 1.61 mmol) in tetrahydrofuran (10.0 mL) at -40.degree. C. under
nitrogen, isopropylmagnesium chloride (2.0 M in tetrahydrofuran,
0.80 mL) was added slowly. The reaction was allowed to warm to
15.degree. C. over 100 minutes, then cooled to -40.degree. C.,
followed by adding
[2,6-difluoro-3-(propane-1-sulfonylamino)-benzyl]-(5-formyl-pyridin-2-yl)-
-carbamic acid tert-butyl ester (560, 0.100 g, 0.21 mmol, prepared
as described in Example 60, Scheme 175) in tetrahydrofuran (2.0
mL). The reaction was allowed to warm to 5.degree. C. over 2 hours,
then poured into aqueous ammonium chloride, and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate, and filtered. The filtrate was concentrated and purified
by silica gel column chromatography eluting with 20% to 100% ethyl
acetate in hexane to give a yellow solid (574, 75 mg, 47%). MS
(ESI) [M+H.sup.+].sup.+=744.7.
Step 2--Synthesis of Propane-1-sulfonic acid
(2,4-difluoro-3-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamin-
o]-methyl-phenyl)-amide (P-0258)
[1462] To
[2,6-difluoro-3-(propane-1-sulfonylamino)-benzyl]-5-[hydroxy-(1--
triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-pyridin-2-yl-ca-
rbamic acid ten-butyl ester (574, 75.0 rag, 0.10 mmol) in
acetonitrile (10.0 mL) were added triethylsilane (0.40 mL, 2.5
mmol) and trifluoroacetic acid (0.20 mL, 2.6 mmol). The reaction
was stirred at 80.degree. C. for 4 hours. The reaction was poured
into aqueous potassium carbonate, and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate, and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 2% to 15% methanol in
dichloromethane to give an off-white solid (P-0258, 29.3 rag,
61.6%). MS (ESI) [M+H.sup.+].sup.+=472.4.
[1463] Propane-1-sulfonic acid
(3-{[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]--
methyl}-2,4-difluoro-phenyl)-amide (P-0259),
[6-Fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-methox-
y-pyridin-3-ylmethyl)-amine (P-0378), and
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fluoro-pyridin-2-yl]--
(6-methoxy-pyridin-3-ylmethyl)-amine (P-0379),
##STR00518##
respectively, were prepared following the protocol of Scheme 178.
P-0259 was prepared by replacing
3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine 96 with
5-chloro-3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine in
Step 1 (MS [M+H.sup.+].sup.+=506.1). P-0378 was prepared by
replacing
[2,6-difluoro-3-(propane-1-sulfonylamino)-benzyl]-(5-formyl-pyridin-2-yl)-
-carbamic acid tert-butyl ester 560 with
(6-Fluoro-5-formyl-pyridin-2-yl)-6-methoxy-pyridin-3-ylmethyl)-carbamic
acid tert-butyl ester 572 (prepared as described in Example 60,
Scheme 177) in Step 1 (MS [M+H.sup.+].sup.+=364.1). P-0379 was
prepared by replacing both azaindole 96 with
5-chloro-3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine and
aldehyde 560 with aldehyde 572 in Step 1 (MS
[M+H.sup.+].sup.+=400.0).
Example 62: Synthesis of
[6-fluoro-5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine P-0187
[1464]
[6-Fluoro-5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-
-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine P-0187 was
synthesized in 3 steps from
1-benzenesulfonyl-3-iodo-5-methoxy-1H-pyrrolo[2,3-b]pyridine 575 as
shown in Scheme 179.
##STR00519##
Step 1--Synthesis of
5-[(1-benzenesulfonyl-5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-me-
thyl]-6-fluoro-pyridin-2-yl-(6-trifluoromethyl-pyridin-3-ylmethyl)-carbami-
c Acid Tert-Butyl Ester (576)
[1465] To
1-benzenesulfonyl-3-iodo-5-methoxy-1H-pyrrolo[2,3-b]pyridine (575,
0.326 g, 0.000788 mol) in tetrahydrofuran (3.00 mL) at -45.degree.
C. under nitrogen, isopropylmagnesium chloride (2.0 M in
tetrahydrofuran, 0.380 mL) was added slowly. The reaction was
allowed to warm to -25.degree. C. in 30 minutes, and then cooled to
-45.degree. C. followed by adding
(6-fluoro-5-formyl-pyridin-2-yl)-(6-trifluoromethyl-pyridin-3-y-
lmethyl)-carbamic acid tert-butyl ester (565, 80.0 mg. 0.20 mmol,
prepared as described in Example 60, Scheme 176) in tetrahydrofuran
(1.0 mL). The reaction was allowed to warm to room temperature over
2 hours. The reaction was poured into aqueous ammonium chloride,
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (576, 0.080 g, 60%). MS (ESI)
[M+H.sup.+].sup.+=688.1.
Step 2--Synthesis of
[5-(1-Benzenesulfonyl-5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fl-
uoro-pyridin-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine
(577)
[1466] To
5-[(1-benzenesulfonyl-5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-h-
ydroxy-methyl]-6-fluoro-pyridin-2-yl-(6-trifluoromethyl-pyridin-3-ylmethyl-
)-carbamic acid tert-butyl ester (576, 0.100 g, 0.15 mmol) in
acetonitrile (12.6 mL) were added triethylsilane (0.34 mL, 2.10
mmol) and trifluoroacetic acid (0.17 mL, 2.20 mmol). The reaction
was heated to 80.degree. C. for 2 hours. The reaction was poured
into aqueous potassium carbonate, and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate, and
filtered. The filtrate was concentrated to give the crude compound
(577, 90 mg, 100%) that was used in the next step without further
purification.
Step 3--Synthesis of
[6-Fluoro-5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0187)
[1467] To
[5-(1-benzenesulfonyl-5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-6-fluoro-pyridin-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine
(577, 0.08 g. 0.13 mmol) in tetrahydrofuran (10.0 mL) was added
tetrabutylammonium fluoride, trihydrate (0.110 g, 0.35 mmol). The
reaction was stirred at room temperature overnight, then poured
into water, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give an
off-white solid (P-0187, 8.1 mg, 10%). MS (ESI)
[M+H.sup.+].sup.+=431.9.
[1468]
[6-Fluoro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine P-0186 and
[6-Fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-triflu-
oromethyl-pyridin-3-ylmethyl)-amine P-0188,
##STR00520##
respectively, were prepared following the protocol of Scheme 179,
substituting
1-benzenesulfonyl-3-iodo-5-methoxy-1H-pyrrolo[2,3-b]pyridine 575
with 1-benzenesulfonyl-3-iodo-5-chloro-1H-pyrrolo[2,3-b]pyridine or
1-Benzenesulfonyl-3-iodo-1H-pyrrolo[2,3-b]pyridine, respectively,
in Step 1. MS (ESI) [M+H.sup.+].sup.+=435.7 and 401.6,
respectively.
Example 63; Synthesis of
[6-(2-fluoro-benzylamino-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-me-
thanone P-0403
[1469]
[6-(2-fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone P-0403 was synthesized in 2 steps from
3-Iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine 96 as shown
in Scheme 180.
##STR00521##
Step
1--(2-Fluoro-benzyl-[5-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridi-
n-2-yl]-carbamic acid Tert-Butyl Ester (580)
[1470] To 3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine
(96, 0.550 g, 1.37 mmol) in tetrahydrofuran (15.0 nm L) at
-40.degree. C. under nitrogen, isopropylmagnesium chloride (2.0 M
in tetrahydrofuran, 0.65 mL) was added slowly. The reaction was
allowed to warm to 5.degree. C. over 70 minutes, then cooled to
-40.degree. C., followed by adding
(2-fluoro-benzyl)-(5-formyl-pyridin-2-yl)-carbamic acid tert-butyl
ester (579, prepared according to the protocol of Example 17,
Scheme 19, Steps 1-3, replacing 4-chlorobenzaldehyde 40 with
2-fluoro-benzaldehyde in Step 1) in tetrahydrofuran (4.0 mL). The
reaction was allowed to warm to room temperature over 1 hour, then
poured into aqueous ammonium chloride, and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 20% to 100% ethyl acetate in
hexane to give the desired compound (580, 0.14 g, 26%). MS (ESI)
[M+H.sup.+].sup.+=447.0.
Step 2--Synthesis of
[6-(2-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0403)
[1471] To
(2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-pyri-
din-2-yl]-carbamic acid tert-butyl ester (580, 0.080 g, 0.18 mmol)
in dichloromethane (3.0 mL) was added trifluoroacetic acid (1.0 mL,
0.013 mol). The reaction was stirred at room temperature overnight,
then concentrated, poured into water, and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 2% to 15% methanol in
dichloromethane to give the desired compound (P-0403, 15.0 mg,
23.0%). MS (ESI) [M+H.sup.+]=347.5.
Example 64: Synthesis of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(2-fluoro-benzylamino)-pyridi-
n-3-yl]-methanone P-0404
[1472]
(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(2-fluoro-benzylamino)--
pyridin-3-yl]-methanone P-0404 was synthesized in 4 steps from
1-benzenesulfonyl-5-chloro-3-iodo-1H-pyrrolo[2,3-b]pyridine 581 as
shown in Scheme 181.
##STR00522##
Step 1--Synthesis of
5-[(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-met-
hyl]-pyridin-2-yl-(2-fluoro-benzyl)-carbamic acid tert-butyl ester
(582)
[1473] To a solution of
1-benzenesulfonyl-5-chloro-3-iodo-1H-pyrrolo[2,3-b]pyridine (581,
0.420 g, 1.00 mmol) in tetrahydrofuran (15.0 mL) at -40.degree. C.
under nitrogen, isopropylmagnesium chloride (2.0 M in
tetrahydrofuran, 0.49 mL) was added slowly. The reaction was
allowed to warm to 5.degree. C. over 70 minutes, then cooled to
-40.degree. C., followed by adding
(2-fluoro-benzyl)-(5-formyl-pyridin-2-yl)-carbamic acid tert-butyl
ester 579 in tetrahydrofuran (6.0 mL). The reaction was allowed to
warm to room temperature over 1 hour, then poured into aqueous
ammonium chloride, and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate, and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (582, 0.25 g, 41%). MS (ESI)
[M+H.sup.+].sup.+=623.1.
Step 2--Synthesis of
[5-(1-Benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-pyri-
din-2-yl]-(2-fluoro-benzyl)-carbamic Acid Tert-Butyl Ester
(583)
[1474] To
5-[(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-hy-
droxy-methyl]-pyridin-2-yl-(2-fluoro-benzyl)-carbamic acid
tert-butyl ester (582, 0.25 g, 0.40 mmol) in dichloromethane (5.0
mL) was added Dess-Martin periodinane (0.20 g, 0.48 mmol). The
reaction was stirred at room temperature for 10 minutes, then
poured into aqueous potassium carbonate, and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 20% to 100% ethyl acetate in
hexane to give the desired compound (583, 0.060 g., 24%).
Step 3--Synthesis of
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl-pyridin-2-yl]-(2-fluoro-
-benzyl)-carbamic Acid Tert-Butyl Ester (584)
[1475] To
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbo-
nyl)-pyridin-2-yl]-(2-fluoro-benzyl)-carbamic acid tert-butyl ester
(583, 60.0 mg, 0.097 mmol) in tetrahydrofuran (1.0 mL) was added
aqueous potassium carbonate (1.0 M, 1.0 mL). The reaction was
irradiated with microwave on 300 watts, 100.degree. C. for 10
minutes, then poured into water and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated to give crude compound
(584, 0.040 g, 64%) that was used in the next step without further
purification.
Step 4--Synthesis of
(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(2-fluoro-benzylamino)-pyridi-
n-3-yl]-methanone (P-0404)
[1476] To
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-
-(2-fluoro-benzyl)-carbamic acid tert-butyl ester (584, 0.030 g,
0.062 mmol) in dichloromethane (1.0 mL) was added trifluoroacetic
acid (1.0 mL, 0.013 mol). The reaction was stirred at room
temperature overnight, then poured into aqueous potassium
carbonate, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 2% to 15% methanol in dichloromethane to give the
desired compound (P-0404, 2.8 mg, 12%). MS (ESI)
[M+H.sup.+].sup.+=381.0.
Example 65: Synthesis of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(6-methoxy-pyridin-3-ylmethyl-
)-amino]-pyridin-3-yl-methanone P-0405
[1477]
(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(6-methoxy-pyridin-3-yl-
methyl)-amino]-pyridin-3-yl-methanone P-0405 was synthesized in 3
steps from 5-Chloro-1H-pyrrolo[2,3-b]pyridine 532 as shown in
Scheme 182.
##STR00523##
Step 1--Synthesis of
5-[(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-pyridin-2-yl--
(6-methoxy-pyridin-3-ylmethyl)-carbamic acid tert-butyl ester
(586)
[1478] To 5-chloro-1H-pyrrolo[2,3-b]pyridine (532, 0.092 g, 0.60
mmol) in methanol (15.0 mL) were added
(5-formyl-pyridin-2-yl)-(6-methoxy-pyridin-3-ylmethyl)-carbamic
acid tert-butyl ester (585, 0.240 g, 0.70 mmol, prepared according
to the protocol of Example 17, Scheme 19, Steps 1-3, replacing
4-chlorobenzaldehyde 40 with 6-methoxy-pyridine-3-carbaldehyde in
Step 1) and potassium hydroxide (1.2 g, 0.021 nmol). The reaction
was stirred at room temperature overnight, then poured into water,
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (586, 0.110 g, 37%).
Step 2--Synthesis of
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-(6-metho-
xy-pyridin-3-ylmethyl)-carbamic Acid Tert-Butyl Ester (587)
[1479] To
5-[(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-pyri-
din-2-yl-(6-methoxy-pyridin-3-ylmethyl)-carbamic acid tert-butyl
ester (586, 0.060 g, 0.12 mmol) in dichloromethane (10.0 mL) was
added Dess-Martin periodinane (0.062 g, 0.15 mmol). The reaction
was stirred at room temperature for 10 minutes. The reaction was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (587, 0.020 g, 33%).
Step 3--Synthesis of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(6-methoxy-pyridin-3-ylmethyl-
)-amino]-pyridin-3-yl-methanone (P-0405)
[1480] To
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-
-(6-methoxy-pyridin-3-ylmethyl)-carbamic acid tert-butyl ester
(587, 0.020 g, 0.040 mmol) in dichloromethane (2.0 mL) was added
trifluoroacetic acid (0.30 mL, 0.0039 mol). The reaction was
stirred at room temperature for 2 hours, then poured into aqueous
potassium carbonate, and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (P-0405, 5.5 mg, 34%). MS (ESI)
[M+H.sup.+].sup.+=394.3.
[1481]
{6-[(6-Methoxy-pyridin-3-ylmethyl)-amino]-pyridin-3-yl}-(1H-pyrrolo-
[2,3-b]pyridin-3-yl)-methanone P-0406
##STR00524##
was prepared following the protocol of Scheme 182, substituting
5-chloro-1H-pyrrolo[2,3-b]pyridine 532 with
5-methoxy-1H-pyrrolo[2,3-b]pyridine in step 1. MS (ESI)
[M+H.sup.+]=390.1.
Example 66: Synthesis of Intermediate
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chlo-
ro-thiazol-2-ylamine 592
[1482]
5-(1-Benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
4-chloro-thiazol-2-ylamine 592 was synthesized in 4 steps from
2-amino-4-chloro-thiazole-5-carbaldehyde 588 as shown in Scheme
183.
##STR00525##
Step 1--Synthesis of (4-chloro-5-formyl-thiazol-2-yl)-carbamic Acid
Tert-Butyl Ester (589)
[1483] To 2-amino-4-chloro-thiazole-5-carbaldehyde (588, 5.00 g,
0.0308 mol) in tetrahydrofuran (122 mL) were added
di-tert-butyldicarbonate (7.38 g, 0.0338 mol) and
4-dimethylaminopyridine (0.35 g, 0.0029 mol). The reaction was
stirred at 58.degree. C. for 2 hours, then concentrated and
purified with silica gel column chromatography eluting with 20% to
80% ethyl acetate in hexane to give a yellow solid (589, 7.0 g.
87%).
Step 2--Synthesis of
5-[(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-met-
hyl]-4-chloro-thiazol-2-yl-carbamic Acid Tert-Butyl Ester (590)
[1484] To a solution of
1-benzenesulfonyl-5-chloro-3-iodo-1H-pyrrolo[2,3-b]pyridine (581,
4.40 g, 10.5 mmol) in tetrahydrofuran (30.0 mL) at -45.degree. C.
under nitrogen, a solution of isopropylmagnesium chloride (2.0 M in
tetrahydrofuran, 5.4 mL) was added slowly over 10 minutes. The
reaction was allowed to warm to -25.degree. C. over 30 minutes. The
reaction was cooled to -65.degree. C. followed by adding the cold
deprotonated (4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester 589, which was prepared in situ by adding
isopropylmagnesium chloride (2.0 M in tetrahydrofuran, 5.0 mL) to
(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid tert-butyl ester
(589, 2.51 g. 9.55 mmol) in tetrahydrofuran (23.0 mL) at
-78.degree. C. under an atmosphere of nitrogen. The reaction was
allowed to warm to room temperature in 2 hours, then poured into
aqueous ammonium chloride, and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated and purified by silica gel column
chromatography eluting with 25% to 100% ethyl acetate in hexane to
give the desired compound (590, 3.70 g, 60.3%). MS (ESI)
[M+H.sup.+].sup.+=554.2.
Step 3--Synthesis of
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chl-
oro-thiazol-2-yl]-carbamic acid tert-butyl ester (591)
[1485] To
5-[(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-hy-
droxy-methyl]-4-chloro-thiazol-2-yl-carbamic acid tert-butyl ester
(590, 0.200 g, 0.32 mmol) in dichloromethane (15.0 mL) were added
triethylsilane (0.600 mL, 376 mmol) and trifluoroacetic acid (0.300
mL, 3.89 mmol). The reaction was stirred at room temperature for 3
hours, then concentrated, poured into aqueous potassium carbonate,
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 25% to 100% ethyl acetate in hexane to give the
desired compound (591, 0.155 g, 88.7%). MS (ESI)
[M+H.sup.+].sup.+=538.9.
Step 4--Synthesis of
5-(1-Benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chlo-
ro-thiazol-2-ylamine (592)
[1486] To
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-4-chloro-thiazol-2-yl]-carbamic acid tert-butyl ester (591,
4.30 g, 7.97 mmol) in dichloromethane (70.0 mL) was added a
solution of hydrogen chloride (4.00 M in 1,4-dioxane, 42.0 mL). The
reaction was stirred at room temperature for 2 days, then
concentrated, and triturated with ethyl ether and ethyl acetate to
give the desired compound (592, 2.60 g, 74.2%). MS (ESI)
[M+H.sup.+].sup.+=439.0.
[1487]
5-(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chloro--
thiazol-2-ylamine 593
##STR00526##
was prepared following the protocol of Scheme 183, substituting
1-benzenesulfonyl-5-chloro-3-iodo-1H-pyrrolo[2,3-b]pyridine 581
with 1-benzenesulfonyl-3-iodo-1H-pyrrolo[2,3-b]pyridine in Step 2.
MS (ESI) [M+H.sup.+].sup.+=404.4.
Example 67: Synthesis of
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-fluoro-pyridin-3-ylmethyl)-amine P-0231
[1488]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol--
2-yl]-(5-fluoro-pyridin-3-ylmethyl)-amine P-0231 was synthesized in
2 steps from
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chlo-
ro-thiazol-2-ylamine 592 as shown in Scheme 184.
##STR00527##
Step 1--Synthesis of
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chl-
oro-thiazol-2-yl]-(5-fluoro-pyridin-3-ylmethyl)-amine (595)
[1489] To
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-4-chloro-thiazol-2-ylamine (592, 50.0 mg, 0.11 mmol, prepared as
described in Example 66, Scheme 183) in ethanol (1.60 mL) and
acetic acid (0.08 mL) were added 5-fluoro-pyridine-3-carbaldehyde
(594, 43 mg. 0.34 mmol) and silica supported cyanoborohydride (1.21
mmol/g, 0.180 g). The reaction was irradiated with microwave on 300
watts, 100.degree. C. for 7 minutes. The reaction was poured into
aqueous potassium carbonate, and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% ethyl acetate in hexane to give the
desired compound (595, 0.030 g, 48%).
Step 2--Synthesis of
[4-chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-fluoro-pyridin-3-ylmethyl)-amine (P-0231)
[1490] To
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-4-chloro-thiazol-2-yl]-(5-fluoro-pyridin-3-ylmethyl)-amine
(595, 0.030 g, 0.055 mmol) in tetrahydrofuran (6.0 mL) was added
tetrabutylammonium fluoride, trihydrate (0.034 g, 0.11 mmol) under
an atmosphere of nitrogen. The reaction was stirred at room
temperature for 3 hours, then poured into water and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was concentrated and purified by
silica gel column chromatography eluting with 20% to 100% ethyl
acetate in hexane to give the desired compound (P-0231, 1.5 mg,
6.7%). MS (ESI) [M+H.sup.+].sup.+=408.1.
Example 68: Synthesis of
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-ylamine 599
[1491]
5-(1-Benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-ylamine 599 was synthesized in 4 steps from
5-chloro-1H-pyrrolo[2,3-b]pyridine 532 as shown in Scheme 185.
##STR00528##
Step 1--Synthesis of
5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (596)
[1492] To 5-chloro-1H-pyrrolo[2,3-b]pyridine (532, 10.0 g, 65.5
mmol) in acetic acid (28.3 mL) were added hexamethylenetetramine
(11.9 g, 85.2 mmol) and water (56.7 mL). The reaction was refluxed
overnight, followed by addition of 200 mL of water. After 30
minutes, the reaction was filtered to recover the solid, then dried
under air to give the desired compound (596, 7.0 g. 59%).
Step 2--Synthesis of
1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
(597)
[1493] To 5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (596,
3.60 g, 0.0199 mol) in dichloromethane (100 mL) were added a
solution of potassium hydroxide (9 M in water, 50 mL),
tetrabutylammonium hydrogen sulfate (400 mg, 0.001 mol) and
benzenesulfonyl chloride (2.9 mL, 0.023 mol). The reaction was
stirred at room temperature for 3 hours, then poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and washed with ethyl acetate to give a white solid
(597, 2.3 g. 36.0%).
Step 3--Synthesis of
(6-amino-pyridin-3-yl)-(1-benzenesulfonyl)-5-chloro-1H-pyrrolo[2,3-b]pyri-
din-3-yl)-methanol (598)
[1494] To 2-amino-5-bromopyridine (15, 3.10 g, 17.9 mmol) in
tetrahydrofuran (80.0 mL) under an atmosphere of nitrogen at
-78.degree. C. a solution n-butyllithium (2.50 M in hexane, 7.10
mL) was added slowly. After 30 minutes,
1,2-bis-(chloro-dimethyl-silanyl)-ethane (3.90 g dissolved in
tetrahydrofuran 20.0 mL, 18.1 mmol) was added to the reaction
mixture slowly, and then allowed to warm to room temperature for 1
hour. The reaction was cooled to -78.degree. C. followed by adding
a solution of n-butyllithium (2.50 M in Hexane, 7.10 mL). The
reaction mixture was stirred at -78.degree. C. for 30 minutes, then
allowed to warm to room temperature for 60 minutes. The reaction
mixture was cooled to -78.degree. C., followed by adding a solution
of n-butyllithium (2.50 M in Hexane, 7.50 mL) slowly. After 60
minutes,
1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
(597, 1.90 g in 30 mL tetrahydrofuran, 5.92 mmol) was added to the
reaction mixture. The reaction mixture was stirred at -78.degree.
C. for 2 hours, then allowed to warm to room temperature for 1
hour. The reaction was poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 2% to 20% methanol in
dichloromethane to give the desired compound (598, 1.25 g, 50.9%).
MS (ESI) [M+H.sup.+].sup.+=415.2.
Step 4--Synthesis of
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-ylamine (599)
[1495] To
(6-amino-pyridin-3-yl)-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,-
3-b]pyridin-3-yl)-methanol (598, 1.00 g, 0.00241 mol) in
dichloromethane (25.0 mL) were added triethylsilane (3.00 mL,
0.0188 mol) and trifluoroacetic acid (1.50 mL, 0.0195 mol). The
reaction was stirred at room temperature overnight, then
concentrated, poured into aqueous potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate, and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (599, 0.70 g, 73%).
[1496]
5-(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-
-ylamine 600
##STR00529##
was prepared following the protocol of Scheme 185, substituting
5-chloro-1H-pyrrolo[2,3-b]pyridine 532 with
1H-pyrrolo[2,3-b]pyridine in Step 1. MS (ESI)
[M+H.sup.+].sup.+=365.2.
Example 69: Synthesis of
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(5-fluoro-
-pyridin-3-ylmethyl)-amine P-0324
[1497]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(5--
fluoro-pyridin-3-ylmethyl)-amine P-0324 was synthesized in 2 steps
from
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-ylamine 599 as shown in Scheme 186.
##STR00530##
Step 1--Synthesis of
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-(5-fluoro-pyridin-3-ylmethyl)-amine (601)
[1498] To
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyridin-2-ylamine (599, 80.0 mg, 0.20 mmol, prepared as
described in Example 68, Scheme 185) in ethanol (2.0 mL) and acetic
acid (0.10 mL, 0.0018 mol) were added
5-fluoro-pyridine-3-carbaldehyde (594, 62.7 mg, 0.50 mmol) and
sodium cyanoborohydride on silica gel (1.200 mmol/g loading; 0.251
g, 0.30 mmol). The reaction was irradiated with microwave on 300
watts, 100.degree. C. for 10 minutes. The reaction was poured into
aqueous potassium carbonate and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (601, 0.060 g, 59%).
Step 2--Synthesis of
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(5-fluoro-
-pyridin-3-ylmethyl)-amine (P-0324)
[1499] To
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-(5-fluoro-pyridin-3-ylmethyl)-amine (601, 0.060
g, 0.12 mmol) in tetrahydrofuran (10.0 mL) was added
tetrabutylammonium fluoride, trihydrate (0.11 g. 0.35 mmol). The
reaction was stirred at room temperature overnight, then poured
into water and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
elating with 20% to 100% ethyl acetate in hexane to give the
desired compound (P-0324, 13.5 mg. 31%). MS (ESI)
[M+H.sup.+].sup.+=368.0.
Example 70: Synthesis of
(3-Chloro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine P-0183
[1500]
(3-Chloro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine P-0183 was synthesized in 2 steps from
5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylami-
ne 600 as shown in Scheme 187.
##STR00531##
Step 1--Synthesis of
[5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(4-chloro-pyridin-3-ylmethyl)-amine (602)
[1501] To
5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-ylamine (600, 120.0 mg, 0.33 mmol, prepared as described in
Example 68, Scheme 185) in acetonitrile (10.0 mL) were added
3-chloro-pyridine-4-carbaldehyde (554, 51.3 mg, 0.36 mmol),
trifluoroacetic acid (0.30 mL, 0.0039 mol) and triethylsilane (0.60
mL, 0.0038 mol). The reaction was heated to reflux overnight, then
poured into aqueous potassium carbonate and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 30% to 100% ethyl acetate in
hexane to give the desired compound (602, 80 mg, 49.6%). MS
[M+H.sup.+].sup.+=490.2.
Step 2--Synthesis of
(3-chloro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth)-pyri-
din-2-yl]-amine (P-0183)
[1502] To
[5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-(4-chloro-pyridin-3-ylmethyl)-amine (602, 0.08 g, 0.16
mmol) in tetrahydrofuran (10.0 mL) was added tetrabutylammonium
fluoride, trihydrate (0.240 g, 0.76 mmol). The reaction was stirred
at room temperature overnight. The reaction was concentrated and
purified by silica gel column chromatography eluting with 20% to
100% ethyl acetate in hexane to give a yellow solid (P-0183, 4.0
mg, 7%). MS (ESI) [M+H.sup.+].sup.+=350.2.
Example 71: Synthesis of
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-[6-(2,2,2-
-trifluoro-ethoxy)-pyridin-3-ylmethyl]-amine P-0409
[1503]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(5--
fluoro-pyridin-3-ylmethyl)-amine P-0409 was synthesized in 1 step
from
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)pyridin-
-2-ylamine 599 as shown in Scheme 188.
##STR00532##
Step 1--Synthesis of
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-[6-(2,2,2-
-trifluoro-ethoxy)-pyridin-3-ylmethyl]-amine (P-0409)
[1504] To
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyridin-2-ylamine (599, 124.1 mg, 0.31 mmol, prepared as
described in Example 68, Scheme 185) in ethanol (3.00 mL) and
acetic acid (0.2 mL) were added
6-(2,2,2-trifluoro-ethoxy)-pyridine-3-carbaldehyde (603, 164.0 mg,
0.80 mmol) and silica supported cyanoborohydride (1.21 mmol/g,
0.700 g). The reaction was irradiated with microwave on 300 watts,
100.degree. C. for 150 minutes. To the reaction was added a
solution of potassium hydroxide (9.0 M in water, 1.0 mL). The
reaction was irradiated with microwave on 300 watts, 100.degree. C.
for 10 minutes. The reaction was poured into aqueous potassium
carbonate and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (P-0409, 10.6 mg, 7.6%). MS ESI)
[M+H.sup.+].sup.+=448.4.
Example 72: Synthesis of
1-(3-fluoro-phenyl)-3-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-urea P-0412
[1505]
1-(3-Fluoro-phenyl)-3-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-urea P-0412 was synthesized in 2 steps from
5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylami-
ne 600 as shown in Scheme 189.
##STR00533##
Step 1--Synthesis of
1-[5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl-
]-3-(3-fluoro-phenyl)-urea (605)
[1506] To
5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-ylamine (600, 150.0 mg, 0.41 mmol, prepared as described in
Example 68, Scheme 185) in acetonitrile (12.5 mL) were added
3-fluoro-isocyanato-benzene (604, 61.6 mg, 0.45 mmol),
4-dimethylaminopyridine (10.0 mg, 0.082 mmol) and triethylamine
(0.25 mL, 0.0018 mol). The reaction mixture was heated at
70.degree. C. overnight, then poured into water, and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate, and filtered. The filtrate was concentrated and purified
by silica gel column chromatography eluting with 20% to 100% ethyl
acetate in hexane to give a white solid (605, 0.100 g, 48.4%).
Step 2--Synthesis of
1-(3-Fluoro-phenyl)-3-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-urea (P-0412)
[1507] To
1-[5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyr-
idin-2-yl]-3-(3-fluoro-phenyl)-urea (605, 0.100 g, 0.20 mmol) in
tetrahydrofuran (10.0 mL) was added tetrabutylammonium fluoride,
trihydrate (0.240 g, 0.76 mmol). The reaction was stirred at room
temperature for 5 hours, then poured into water, and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate, and filtered. The filtrate was concentrated and purified
by silica gel column chromatography eluting with 20% to 100% ethyl
acetate in hexane to give a white solid (P-0412, 17.9 mg, 24.8%).
MS (ESI) [M+H.sup.+].sup.+=362.2.
Example 73: Synthesis of
(2-chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine P-0335
[1508]
(2-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl]-amine P-0335 was synthesized in 2 steps from
(5-bromo-6-fluoro-pyridin-2-yl)-(2-chloro-benzyl)-amine 571 as
shown in Scheme 190.
##STR00534##
Step 1--Synthesis of
[6-(2-chloro-benzylamino)-2-fluoro-pyridin-3-yl]-(1-triisopropylsilanyl-1-
H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (606)
[1509] To (5-bromo-6-fluoro-pyridin-2-yl)-(2-chloro-benzyl)-amine
(571, 0.635 g. 2.01 mmol, prepared as described in Example 60,
Scheme 177) in tetrahydrofuran (25.0 mL) under an atmosphere of
nitrogen at -78.degree. C., a solution of n-butyllithium (2.50 M in
hexane, 0.80 mL) was added slowly. After 20 minutes,
tert-butyllithium (1.7 M in hexane, 2.40 mL) was added to the
reaction and after 30 minutes,
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (47,
0.575 g, 1.90 mmol, prepared as described in Example 18) in
tetrahydrofuran (8.0 mL) was added to the reaction. The reaction
mixture was stirred at -78.degree. C. for 60 minutes, then allowed
to warm to room temperature for another 10 minutes. The reaction
mixture was poured into aqueous ammonium chloride and extracted
with ethyl acetate. The organic layer was washed with brine, dried
over sodium sulfate, concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give the desired compound (606, 0.180 g, 17.6%). MS (ESI)
[M+H.sup.+].sup.+=539.2.
Step 2--Synthesis of
(2-chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0335)
[1510] To
[6-(2-chloro-benzylamino)-2-fluoro-pyridin-3-yl]-(1-triisopropyl-
silanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (606, 180.0 mg.
0.33 mmol) in acetonitrile (15.0 mL) were added triethylsilane
(1.00 mL, 6.26 mmol) and trifluoroacetic acid (0.50 mL, 6.50 mmol).
The reaction was heated to reflux for 2 hours, then poured into
aqueous potassium carbonate and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give a white solid (P-0335, 24.9 mg, 19.4%). MS (ESI)
[M+H.sup.+].sup.+=367.0.
Example 74: Synthesis of
1-benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-5-ylmethyl)-1H--
pyrrolo[2,3-b]pyridine 610
[1511]
1-Benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-5-ylmethy-
l)-1H-pyrrolo[2,3-b]pyridine 610 was synthesized in 3 steps from
1-benzenesulfonyl-5-chloro-3-iodo-1H-pyrrolo[2,3-b]pyridine 581 as
shown in Scheme 191.
##STR00535##
[1512] Step 1--Synthesis of
(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-(2-methylsulfa-
nyl-pyrimidin-5-yl)-methanol (608):
[1513] To a solution of
1-Benzenesulfonyl-5-chloro-3-iodo-1H-pyrrolo[2,3-b]pyridine (581,
4.36 g, 10.4 mmol) in tetrahydrofuran (100.0 mL) at -40.degree. C.
under nitrogen, isopropylmagnesium chloride (2.0 M in
tetrahydrofuran. 5.06 mL) was added slowly. The reaction was
allowed to warm to 5.degree. C. over 60 minutes, then cooled to
-40.degree. C., followed by adding
2-methylsulfanyl-pyrimidine-5-carbaldehyde (607, 1.30 g, 8.43 mmol,
dissolved in tetrahydrofuran 15.0 mL). The reaction was allowed to
warm to 10.degree. C. over 2 hours. The reaction was poured into
aqueous ammonium chloride and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated and purified by silica gel column
chromatography eluting with 2% to 15% methanol in dichloromethane
to give the desired compound (608, 3.00 g, 79.6%). MS (ESI)
[M+H.sup.+].sup.+=447.2.
Step 2--Synthesis of
1-benzenesulfinyl-5-chloro-3-(2-methylsulfanyl-pyrimidin-5-ylmethyl)-1H-p-
yrrolo[2,3-b]pyridine (609)
[1514] To
(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-(2-me-
thylsulfanyl-pyrimidin-5-yl)-methanol (608, 0.35 g, 0.78 mmol) in
dichloromethane (15.0 mL) were added triethylsilane (2.00 mL, 12.52
mmol) and trifluoroacetic acid (1.00 mL, 13.0 mmol). The reaction
was stirred at 35.degree. C. overnight, then concentrated, poured
into aqueous potassium carbonate, and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 20% to 100% ethyl acetate in
hexane to give the desired compound (609, 0.25 g, 74%). MS (ESI)
[M+H.sup.+].sup.+=430.9.
Step 3--Synthesis of
1-benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-S-ylmethyl)-1H--
pyrrolo[2,3-b]pyridine (610) and
1-benzenesulfonyl-5-chloro-3-(2-methanesulfinyl-pyrimidin-5-ylmethyl)-1H--
pyrrolo[2,3-b]pyridine (611)
[1515] To
1-benzenesulfonyl-5-chlor-3-(2-methylsulfanyl-pyrimidin-5-ylmeth-
yl)-1H-pyrrolo[2,3-b]pyridine (609, 0.500 g, 1.16 mmol) in
dichloromethane (15.0 mL) was added meta-chloroperoxybenzoic acid
(max. 77%, 0.572 g. 2.55 mmol) at 0.degree. C. The reaction was
stirred at 0.degree. C. for 70 minutes, then poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compounds (610, 0.310 g, 57.7%), MS (ESI)
[M+H.sup.+].sup.+=463.1; and (611, 0.200 g, 38.6%), MS (ESI)
[M+H.sup.+]=447.2.
1-Benzenesulfonyl-3-(2-methanesulfonyl-pyrimidin-5-ylmethyl)-1H-pyrrolo[2,-
3-b]pyridine 612
##STR00536##
[1516] was prepared following the protocol of Scheme 191,
substituting
1-benzenesulfonyl-5-chloroo-3-iodo-1H-pyrrolo[2,3-b]pyridine 581
with 1-benzenesulfonyl-3-iodo-1H-pyrrolo[2,3-b]pyridine in Step
1.
Example 75: Synthesis of
(4-chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine P-4260
[1517]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyrimidin-2-yl]-amine P-0260 was synthesized in 2 steps from
1-benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-5-ylmethyl)-1H--
pyrrolo[2,3-b]pyridine 610 as shown in Scheme 192.
##STR00537##
Step 1--Synthesis of
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-pyrimi-
din-2-yl]-(4-chloro-benzyl)-amine (613)
[1518] To
1-benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-5-ylme-
thyl)-1H-pyrrolo[2,3-b]pyridine (610, 0.060 g, 0.13 mmol, prepared
as described in Example 74, Scheme 191) in N-methylpyrrolidinone
(1.80 mL) was added p-chlorobenzylamine (61, 0.20 g, 1.4 mmol). The
reaction was irradiated with microwave on 300 watts, 150.degree. C.
for 15 minutes, then poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 20% to 100% ethyl acetate in
hexane to give the desired compound (613, 0.05 g, 74%). MS (ESI)
[M+H.sup.+].sup.+=524.3.
Step 2--Synthesis of
(4-chloro-benzyl-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimi-
din-2-yl]-amine (P-0260)
[1519] To
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-(4-chloro-benzyl)-amine (613, 0.050 g, 0.095
mmol) in tetrahydrofuran (10.0 mL) was added tetrabutylammonium
fluoride, trihydrate (0.20 g. 0.63 mmol) under an atmosphere of
nitrogen. The reaction was stirred at room temperature overnight,
then poured into water, and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate and filtered.
The filtrate was concentrated and washed with ethyl acetate in
hexane to give an off-white solid (P-0260, 16.9 mg, 46%). MS (ESI)
[M+H.sup.+].sup.+=385.9.
[1520] Additional compounds were prepared following the protocol of
Scheme 192, substituting p-chlorobenzylamine 61 with a suitable
amine in Step 1. The following compounds were prepared following
this protocol: [1521]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,6-di-
fluoro-benzyl)-amine (P-0261), [1522]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trif-
luoromethyl-benzyl)-amine (P-0262), [1523]
(2-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0263), [1524]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-fluo-
ro-benzyl)-amine (P-0264). [1525]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,4-di-
fluoro-benzyl)-amine (P-0265), [1526]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-trif-
luoromethyl-benzyl)-amine (P-0266), [1527]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,5-di-
fluoro-benzyl)-amine (P-0267), and [1528]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3-trif-
luoromethyl-benzyl)-amine (P-0268). The following table indicates
the amine (Column 2) used in Scheme 192 to provide the compounds
(Column 3). Column 1 provides the compound number and Column 4 the
experimental mass spectrometry result.
TABLE-US-00014 [1528] MS (ESI) Compound [M + H.sup.+].sup.+ number
Amine in Step 1 Compound observed P-0261 ##STR00538## ##STR00539##
384.1 P-0262 ##STR00540## ##STR00541## 418.9 P-0263 ##STR00542##
##STR00543## 384.2 P-0264 ##STR00544## ##STR00545## 368.2 P-0265
##STR00546## ##STR00547## 386.2 P-0266 ##STR00548## ##STR00549##
418.9 P-0267 ##STR00550## ##STR00551## [M - H.sup.+].sup.- = 384.0
P-0268 ##STR00552## ##STR00553## 419.2
Example 76: Synthesis of
(2-fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine P-0291
[1529]
(2-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3--
ylmethyl)-pyrimidin-2-yl]-amine P-0291 was synthesized in 1 step
from
1-benzenesulfonyl-3-(2-methanesulfonyl-pyrimidin-5-ylmethyl)-1H-pyrrolo[2-
,3-b]pyridine 612 as shown in Scheme 193.
##STR00554##
Step 1--Synthesis of
(2-fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0291)
[1530] To
1-benzenesulfonyl-3-(2-methanesulfonyl-pyrimidin-5-ylmethyl)-1H--
pyrrolo[2,3-b]pyridine (612, 0.080 g, 0.19 mmol, prepared as
described in Example 74, Scheme 191) in N-methylpyrrolidinone (1.00
mL) was added 2-fluoro-5-trifluoromethyl-benzylamine (614, 0.20 g,
1.0 mmol). The reaction was irradated with microwave on 300 watts,
150.degree. C. for 15 minutes. Potassium hydroxide in water (1.00
M, 2.00 mL) was added to the reaction. The reaction was irradiated
with microwave on 300 watts, 90.degree. C. for 10 minutes, then
poured into water and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give a white solid (P-0291, 37.4 mg, 50%). MS (ESI)
[M+H.sup.+].sup.+=402.6.
[1531] Additional compounds were prepared following the protocol of
Scheme 193, substituting 2-fluoro-5-trifluoromethyl-benzylamine 614
with a suitable amine. The following compounds were prepared
following this protocol: [1532]
(2,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0292), [1533]
(2-Chlor-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyrimidinyl-2-yl]-amine (P-0293) [1534]
(3-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0294), [1535]
(3,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0295), [1536]
(2-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl-
]-amine (P0300), [1537]
(2-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl-
]-amine (P-0301), [1538]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trifluorometh-
yl-benzyl)-amine (P-0302), [1539]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trifluorometh-
oxy-benzyl)-amine (P-0303), [1540]
(5-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0304), [1541]
(2,4-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0305), [1542]
(2,4-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0306), [1543]
(4-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl-
]-amine (P-0307), [1544]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-trifluorometh-
yl-benzyl)-amine (P-0308), [1545]
(2-Fluoro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0309), [1546]
(2,5-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0310), [1547]
(3-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0311), [1548]
(2-Difluoromethoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0312), [1549]
(2,3-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin--
2-yl]-amine (P-0313). [1550]
(4-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0314), [1551]
(5-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0315), [1552]
(2-Chloro-4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0316), [1553]
(5-Chloro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0317), [1554]
(5-Fluoro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0318). [1555]
(2-Fluoro-4-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0319), [1556]
(4-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0320), and [1557]
(2-Chloro-5-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0407). The following table indicates the amine
(Column 2) used in Scheme 193 to provide the compounds (Column 3).
Column 1 provides the compound number and Column 4 the experimental
mass spectrometry result.
TABLE-US-00015 [1557] MS (ESI) Compound [M + H.sup.+].sup.+ number
Amine Compound observed P-0292 ##STR00555## ##STR00556## 352.3
P-0293 ##STR00557## ##STR00558## 418.2 P-0294 ##STR00559##
##STR00560## 402.5 P-0295 ##STR00561## ##STR00562## 352.3 P-0300
##STR00563## ##STR00564## 334.5 P-0301 ##STR00565## ##STR00566##
349.9 P-0302 ##STR00567## ##STR00568## 384.0 P-0303 ##STR00569##
##STR00570## 400.5 P-0304 ##STR00571## ##STR00572## 367.9 P-0305
##STR00573## ##STR00574## 383.9 P-0306 ##STR00575## ##STR00576##
352.4 P-0307 ##STR00577## ##STR00578## 352.0 P-0308 ##STR00579##
##STR00580## 384.0 P-0309 ##STR00581## ##STR00582## 402.5 P-0310
##STR00583## ##STR00584## 389.0 P-0311 ##STR00585## ##STR00586##
368.0 P-0312 ##STR00587## ##STR00588## 382.5 P-0313 ##STR00589##
##STR00590## 385.0 P-0314 ##STR00591## ##STR00592## 367.9 P-0315
##STR00593## ##STR00594## 402.4 P-0316 ##STR00595## ##STR00596##
368.2 P-0317 ##STR00597## ##STR00598## 364.8 P-0318 ##STR00599##
##STR00600## 348.6 P-0319 ##STR00601## ##STR00602## 402.5 P-0320
##STR00603## ##STR00604## 402.5 P-0407 ##STR00605## ##STR00606##
368.3
Example 77: Synthesis of
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-difl-
uoromethoxy-benzyl)-amine P-0390
[1558]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(-
2-difluoromethoxy-benzyl)-amine P-0390 was synthesized in 1 step
from
1-benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-5-ylmethyl)-1H--
pyrrolo[2,3-b]pyridine 610 as shown in Scheme 194.
##STR00607##
Step 1--Synthesis of
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyrimidin-3-ylmethyl)-pyrimidin-2-yl]-(2-di-
fluoromethoxy-benzyl)-amine (P-0390)
[1559] To
1-benzenesulfonyl-5-chloro-3-(2-methanesulfonyl-pyrimidin-5-ylme-
thyl)-1H-pyrrolo[2,3-b]pyridine (610, 0.060 g, 0.13 mmol, prepared
as described in Example 74, Scheme 191) in N-methylpyrrolidinone
(1.40 mL) was added 2-difluoromethoxy-benzylamine (615, 0.200 g,
1.16 mmol). The reaction was irradiated with microwave on 300
watts. 150.degree. C. for 15 minutes. Potassium hydroxide in water
(1.00 M, 2.00 mL) was added to the reaction. The reaction was
irradiated with microwave on 300 watts, 90.degree. C. for 10
minutes, then poured into ethyl acetate and water. The organic
layer was concentrated and purified by silica gel column
chromatography eluting with 20% to 100% ethyl acetate in hexane to
give a white solid (P-0390, 10.9 mug, 20%). MS (ESI)
[M+H.sup.+].sup.+=418.0.
[1560] Additional compounds were prepared following the protocol of
Scheme 194, substituting 2-difluoromethoxy-benzylamine 615 with a
suitable amine. The following compounds were prepared following
this protocol: [1561]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]--
(2-fluoro-5-trifluoromethyl-benzyl)-amine (P-0289), [1562]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(5-fluo-
ro-2-trifluoromethyl-benzyl)-amine (P-0391), [1563]
(3-Chloro-2-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0392), [1564]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-fluo-
ro-3-trifluoromethyl-benzyl)-amine (P-0393). [1565]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-fluo-
ro-4-trifluoromethyl-benzyl)-amine (P-0394), [1566]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2,3-di-
fluoro-benzyl)-amine (P-0395). [1567]
(2-Chloro-4-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0396), [1568]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-trif-
luoromethoxy-benzyl)-amine (P-0402), [1569]
(2-Chloro-S-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0408), [1570]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-pyridin-
-4-ylmethyl-amine (P-0416), [1571]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-pyrr-
olidin-1-yl-ethyl)-amine (P-0417), [1572]
Benzyl-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]--
amine (P-0418).
Benzyl-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]--
methyl-amine (P0419). [1573]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin
2-yl]-4-trifluoromethoxy-benzyl)-amine (P-0420), [1574]
(3-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-amine (P-0421), [1575]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-pyridin-
-3-ylmethyl-amine (P-0422), [1576]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-fluo-
ro-benzyl)-amine (P-0423), [1577]
(3-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-methyl-amine (P-0424), [1578]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3,5-di-
fluoro-benzyl)-amine (P-4425), [1579]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-[1-(2-f-
luoro-phenyl)-ethyl]-amine (P-0426), [1580]
[1-(4-Chloro-phenyl)-ethyl]-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyrimidin-2-yl]-amine (P-0427), [1581]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-[(S)-1-(4-
-fluoro-phenyl)-ethyl]-amine (P-0428), [1582]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin
2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0429), [1583]
(2-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrim-
idin-2-yl]-methyl-amine (P-0430), [1584]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-meth-
yl-benzyl)-amine (P-0431), [1585]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-meth-
oxy-benzyl)-amine (P-0433), [1586]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-morp-
holin-4-yl-ethyl)-amine (P-0434), [1587]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-cyclohe-
xylmethyl-amine (P-0435). [1588]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-pyridin-
-2-ylmethyl-amine (P-0436). [1589]
[2-(4-Chloro-phenyl)-ethyl]-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyrimidin-2-yl]-amine (P-0437), [1590]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-difl-
uomomethoxy-benzyl)-amine (P-0438), [1591]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-meth-
oxy-benzyl)-amine (P-0439), [1592]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-meth-
yl-benzyl)-amine (P-0440). [1593]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-meth-
oxy-ethyl)-amine (P-0441), [1594]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3-fluo-
ro-benzyl)-amine (P-0442), [1595]
(3-Chloro-4-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0443), [1596]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-etho-
xy-benzyl)-amine (P-0444), [1597]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(4-morp-
holin-4-yl-benzyl)-amine (P-0445), [1598]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(3-difl-
uoromethoxy-benzyl)-amine (P-0446). [1599]
(4-Chloro-3-fluoro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyrimidin-2-yl]-amine (P-0447), [1600]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-[1-(3-f-
luoro-phenyl)-ethyl]-amine (P-0448), and [1601]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrimidin-2-yl]-(2-dime-
thylamino-benzyl)-amine (P-0449). The following table indicates the
amine (Column 2) used in Scheme 194 to provide the compounds
(Column 3). Column 1 provides the compound number and Column 4 the
experimental mass spectrometry result.
TABLE-US-00016 [1601] Com- MS (ESI) pound [M + H.sup.+].sup.+
number Amine Compound observed P-0289 ##STR00608## ##STR00609##
436.0 P-0391 ##STR00610## ##STR00611## 436.0 P-0392 ##STR00612##
##STR00613## 402.0 P-0393 ##STR00614## ##STR00615## [M -
H.sup.+].sup.- = 434.1 P-0394 ##STR00616## ##STR00617## 437.3
P-0395 ##STR00618## ##STR00619## 386.0 P-0396 ##STR00620##
##STR00621## 402.0 P-0402 ##STR00622## ##STR00623## 434.3 P-0408
##STR00624## ##STR00625## 402.0 P-0416 ##STR00626## ##STR00627##
351.1 P-0417 ##STR00628## ##STR00629## 357.1 P-0418 ##STR00630##
##STR00631## 350.3 P-0419 ##STR00632## ##STR00633## 364.3 P-0420
##STR00634## ##STR00635## 434.3 P-0421 ##STR00636## ##STR00637##
383.9 P-0422 ##STR00638## ##STR00639## 351.1 P-0423 ##STR00640##
##STR00641## 368.3 P-0424 ##STR00642## ##STR00643## 398.3 P-0425
##STR00644## ##STR00645## 386.3 P-0426 ##STR00646## ##STR00647##
382.3 P-0427 ##STR00648## ##STR00649## 398.3 P-0428 ##STR00650##
##STR00651## 382.3 P-0429 ##STR00652## ##STR00653## 419.1 P-0430
##STR00654## ##STR00655## 397.9 P-0431 ##STR00656## ##STR00657##
364.3 P-0433 ##STR00658## ##STR00659## 380.3 P-0434 ##STR00660##
##STR00661## 373.1 P-0435 ##STR00662## ##STR00663## 356.3 P-0436
##STR00664## ##STR00665## 351.1 P-0437 ##STR00666## ##STR00667##
397.9 P-0438 ##STR00668## ##STR00669## 416.3 P-0439 ##STR00670##
##STR00671## 380.3 P-0440 ##STR00672## ##STR00673## 364.3 P-0441
##STR00674## ##STR00675## 317.9 P-0442 ##STR00676## ##STR00677##
368.3 P-0443 ##STR00678## ##STR00679## 401.9 P-0444 ##STR00680##
##STR00681## 393.9 P-0445 ##STR00682## ##STR00683## 435.1 P-0446
##STR00684## ##STR00685## 416.3 P-0447 ##STR00686## ##STR00687##
402.3 P-0448 ##STR00688## ##STR00689## 382.3 P-0449 ##STR00690##
##STR00691## 393.1
Example 78: Synthesis of
(2-chloro-6-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine P-0210
[1602]
(2-Chloro-6-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl]-amine P-0210 was synthesized in 2 steps from
5-(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylami-
ne 600 as shown in Scheme 195.
##STR00692##
Step 1--Preparation of
[5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
(2-chloro-6-fluoro-benzyl)-amine (617)
[1603]
5-(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-
-ylamine (600, 30 mg, 0.083 mmol, prepared as described in Example
68, Scheme 185) was combined with 2-chloro-6-fluoro-benzaldehyde
(616, 26.2 mg, 0.165 mmol) in a 2 mL microwave reaction vial. The
mixture was dissolved in ethanol:acetic acid (95:5, 0.6 mL). Silica
supported cyanoborohydride (1.0 mmol/g, 83 mg, 0.083 mmol) was
added and the mixture was irradiated with microwave on 300 watts
for 5 minutes at 100.degree. C. The silica was separated by
centrifuging and the supernatant solution was decanted. The silica
residue was rinsed with ethanol (0.500 mL) and centrifuged. The
solvents were combined and removed under reduced pressure to give
compound 617, which was used in the next step without further
purification.
Step 2--Preparation of
(2-chloro-6-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0210)
[1604]
[5-(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-yl]-(2-chloro-6-fluoro-benzyl)-amine 617 was combined with
methanol:potassium hydroxide (1M) (1:1, 0.5 mL). The mixture was
heated at 80.degree. C. for 2 hours. Acetic acid (0.1 mL) was added
and the solvents removed under reduced pressure. The remaining
residue was dissolved in dimethylsulfoxide (0.4 mL) and purified by
reverse phase HPLC on a Phenomenex column (50 mm.times.10 mm ID)
eluting with 0.1% trifluoroacetic acid in water and 20-100%
acetonitrile with 0.1% trifluoroacetic acid over 16 minutes at a
flow rate of 6 mL minute to provide the desired compound P-0210. MS
(ESI) [M+H.sup.+].sup.+=367.1.
[1605] Additional compounds were prepared following the protocol of
Scheme 195, replacing 2-chloro-6-fluoro-benzaldehyde 616 with an
appropriate aldehyde in Step 1. The following compounds were made
following this procedure: [1606]
Phenethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0211). [1607]
(2,4-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0212), [1608]
(2-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0213), [1609]
(3-Bromo-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyr-
idin-2-yl]-amine (P-0214), [1610]
(2-Methoxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0215), [1611]
(2-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0216), [1612]
(2-Methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0217), [1613]
(1-Methyl-1H-benzoimidazol-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylm-
ethyl)-pyridin-2-yl]-amine (P-0218), [1614]
(6-Methoxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0219), [1615]
(1H-Benzoimidazol-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0220), [1616]
(2-Chloro-4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]I-amine (P-0221). [1617]
(5-Methoxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0222), [1618]
(3-Fluoro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0223). [1619]
(6-Methoxy-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-p-
yridin-2-yl]-amine (P-0224), [1620]
(4-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-4225), [1621]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(2-trifluoromethyl-
-benzyl)-amine (P-0226), [1622]
(3,5-Dichloro-pyridin-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
)-pyridin-2-yl]-amine (P-0227), [1623]
(6-Morpholin-4-yl-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine (P-0228), [1624]
(3-Fluoro-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0229), [1625]
(5-Fluoro-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-4230), [1626]
(2,4-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0342), [1627]
(3-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin
2-yl]-amine (P-4343), [1628]
(2-Fluoro-4-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0344), [1629]
(4-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0345), [1630]
(3-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0346). [1631]
(2-Morpholin-4-yl-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine (P-0347), [1632]
(4-Chloro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0348), [1633]
(2-Chloro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0349), [1634]
(2-Fluoro-5-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0350), [1635]
(2,3-Dichloro-benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-y-
l]-amine (P-0351), [1636]
(2-Fluoro-3-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0352), [1637]
Dimethyl-(5-([5{(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]--
methyl}-pyrimidin-2-yl)-amine (P-0353), [1638]
(3-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0354), [1639]
(5-Fluoro-pyridin-2-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0355). [1640]
(3,5-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0356), [1641]
(2-Propoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin
2-yl]-amine (P-0357). [1642]
(2-Morpholin-4-yl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine (P-0358), [1643]
(2-Chloro-3-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0359), [1644]
(2-Fluoro-6-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0360), [1645]
[2-(2-Morpholin-4-yl-ethoxy)-benzyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyridin-2-yl]-amine (P-0361), [1646]
(2,3-Difluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0362), [1647]
(2-Chloro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0363), [1648]
(2-Chloro-5-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0364), [1649]
(2-Fluoro-3-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0365), [1650]
(5-Fluoro-2-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0366), [1651]
(2-Difluoromethoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0367), [1652]
(2-Fluoro-4-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0368), [1653]
[2-(3-Dimethylamino-propoxy)-benzyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmet-
hyl)-pyridin-2-yl]-amine (P-0369), [1654]
(2,6-Dimethoxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-pyridin-2-yl]-amine (P-0370), [1655]
(2-Fluoro-5-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0371), [1656]
(4-Fluoro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0372), [1657]
(3-Chloro-5-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0373), [1658]
(6-Cyclopentyloxy-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine (P-0374). [1659]
(5-Fluoro-2-trifluoromethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0375), [1660]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-[2-(2,2,2-trifluor-
o-ethoxy)-pyridin-3-ylmethyl]-amine (P-0376), [1661]
Propane-1-sulfonic acid
(2-fluoro-3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylam-
ino]-methyl}-phenyl)-amide (P-0377), [1662]
(2,5-Dichloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2--
yl]-amine (P-0380), [1663]
Pyrimidin-5-ylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-y-
l]-amine (P-0381), [1664]
(5-Chloro-2-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0382), [1665]
(2-Ethyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-a-
mine (P-4383), [1666]
2,2-Dimethyl-N-(3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yla-
mino]-methyl}-pyridin-2-yl)-propionamide (P-0384), [1667]
Methyl-(3-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]-me-
thyl}-pyridin-2-yl)-amine (P-0385), [1668]
Methyl-(5-{[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino]-me-
thyl}-pyrimidin-2-yl)-amine (P-0386), [1669]
(2-Chloro-4-methanesulfonyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-pyridin-2-yl]-amine (P-0387), [1670]
(5-Fluoro-2-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0397). [1671]
(2,2-Difluoro-benzo[1,3]dioxol-4-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-
-ylmethyl)-pyridin-2-yl]-amine (P-0398), [1672]
Dimethyl-(3-{[5-(1H-pyrrolo-2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylamino)--
methyl}-pyridin-2-yl)-amine (P-0399), [1673]
(5-Chloro-pyridin-3-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-py-
ridin-2-yl]-amine (P-0400), and [1674]
(2-Methoxy-pyrimidin-5-ylmethyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-pyridin-2-yl]-amine (P-0401). The following table indicates the
aldehyde (Column 2) used in Step 1 of Scheme 195 to provide the
compounds (Column 3). Column 1 provides the compound number and
Column 4 the experimental mass spectrometry result.
TABLE-US-00017 [1674] MS (ESI) Compound [M + H.sup.+].sup.+ number
Aldehyde Compound observed P-0211 ##STR00693## ##STR00694## 329.1
P-0212 ##STR00695## ##STR00696## 351.1 P-0213 ##STR00697##
##STR00698## 338.1 P-0214 ##STR00699## ##STR00700## 395.9 P-0215
##STR00701## ##STR00702## 345.9 P-0216 ##STR00703## ##STR00704##
349.1 P-0217 ##STR00705## ##STR00706## 329.1 P-0218 ##STR00707##
##STR00708## 369.1 P-0219 ##STR00709## ##STR00710## 345.9 P-0220
##STR00711## ##STR00712## 355.1 P-0221 ##STR00713## ##STR00714##
367.1 P-0222 ##STR00715## ##STR00716## 345.9 P-0223 ##STR00717##
##STR00718## 334.3 P-0224 ##STR00719## ##STR00720## 345.9 P-0225
##STR00721## ##STR00722## 401.1 P-0226 ##STR00723## ##STR00724##
383.1 P-0227 ##STR00725## ##STR00726## 383.9 P-0228 ##STR00727##
##STR00728## 401.1 P-0229 ##STR00729## ##STR00730## 334.3 P-0230
##STR00731## ##STR00732## 334.3 P-0342 ##STR00733## ##STR00734##
383.1 P-0343 ##STR00735## ##STR00736## 333.1 P-0344 ##STR00737##
##STR00738## 401.1 P-0345 ##STR00739## ##STR00740## 367.1 P-0346
##STR00741## ##STR00742## 401.1 P-0347 ##STR00743## ##STR00744##
401.1 P-0348 ##STR00745## ##STR00746## 417.1 P-0349 ##STR00747##
##STR00748## 417.1 P-0350 ##STR00749## ##STR00750## 401.1 P-0351
##STR00751## ##STR00752## 383.1 P-0352 ##STR00753## ##STR00754##
363.1 P-0353 ##STR00755## ##STR00756## 360.3 P-0354 ##STR00757##
##STR00758## 367.1 P-0355 ##STR00759## ##STR00760## 334.3 P-0356
##STR00761## ##STR00762## 351.1 P-0357 ##STR00763## ##STR00764##
373.1 P-0358 ##STR00765## ##STR00766## 400.3 P-0359 ##STR00767##
##STR00768## 379.1 P-0360 ##STR00769## ##STR00770## 401.1 P-0361
##STR00771## ##STR00772## 444.3 P-0362 ##STR00773## ##STR00774##
351.1 P-0363 ##STR00775## ##STR00776## 417.1 P-0364 ##STR00777##
##STR00778## 367.1 P-0365 ##STR00779## ##STR00780## 401.1 P-0366
##STR00781## ##STR00782## 363.1 P-0367 ##STR00783## ##STR00784##
381.1 P-0368 ##STR00785## ##STR00786## 347.1 P-0369 ##STR00787##
##STR00788## 416.3 P-0370 ##STR00789## ##STR00790## 376.3 P-0371
##STR00791## ##STR00792## 363.1 P-0372 ##STR00793## ##STR00794##
347.1 P-0373 ##STR00795## ##STR00796## 367.1 P-0374 ##STR00797##
##STR00798## 400.3 P-0375 ##STR00799## ##STR00800## 401.1 P-0376
##STR00801## ##STR00802## 413.9 P-0377 ##STR00803## ##STR00804##
453.9 P-0380 ##STR00805## ##STR00806## 383.1 P-0381 ##STR00807##
##STR00808## 317.2 P-0382 ##STR00809## ##STR00810## 367.1 P-0383
##STR00811## ##STR00812## 343.1 P-0384 ##STR00813## ##STR00814##
415.2 P-0385 ##STR00815## ##STR00816## 345.4 P-0386 ##STR00817##
##STR00818## 345.2 P-0387 ##STR00819## ##STR00820## 427.1 P-0397
##STR00821## ##STR00822## 347.1 P-0398 ##STR00823## ##STR00824##
396.1 P-0399 ##STR00825## ##STR00826## 359.1 P-0400 ##STR00827##
##STR00828## 350.3 P-0401 ##STR00829## ##STR00830## 347.1
Example 79: Synthesis of
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methoxy-pyridin-3-ylmethyl)-amine P-0190
[1675]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol--
2-yl]-(6-methoxy-pyridin-3-ylmethyl)amine P0190 was synthesized in
2 steps from
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-
-chloro-thiazol-2-ylamine 592 as shown in Scheme 196.
##STR00831##
Step 1--Preparation of
[5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chl-
oro-thiazol-2-yl]-(6-methoxy-pyridin-3-ylmethyl)-amine (619)
[1676]
5-(1-Benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
4-chloro-thiazol-2-ylamine (592, 30 mg, 0.083 mmol, prepared as
described in Example 66, Scheme 183) was combined with
6-methoxy-pyridine-3-carbaldehyde (618, 26.2 mg, 0.165 mmol) in a 2
mL microwave reaction vial. The mixture was dissolved in ethanol:
acetic acid (95:5, 0.6 mL). Silica supported cyanoborohydride (1.0
mmol/g, 83 mg, 0.083 mmol) was added and the mixture was irradiated
with microwave on 300 watts for 5 minutes at 100.degree. C. The
silica was separated by centrifuging and the supernatant solution
was decanted. The silica residue was rinsed with ethanol (0.500 mL)
and centrifuged. The solvents were combined and removed under
reduced pressure to give the desired compound 619, which was used
without further purification.
Step II--Preparation of
[4-chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methoxy-pyridin-3-ylmethyl)-amine (P-0190)
[1677]
[5-(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chlor--
thiazol-2-yl]-(6-methoxy-pyridin-3-ylmethyl)-amine 619 was combined
with methanol: potassium hydroxide (1M) (1:1, 0.5 mL). The mixture
was heated at 80.degree. C. for 2 hours. Acetic acid (0.1 mL) was
added and the solvents removed under reduced pressure. The
remaining residue was dissolved in dimethylsulfoxide (0.4 mL) and
purified by reverse phase HPLC on a Phenomenex column (50
mm.times.10 mm ID) eluting with 0.1% trifluoroacetic acid in water
and 20-100% acetonitrile with 0.1% trifluoroacetic acid over 16
minutes at a flow rate of 6 mL/minute to provide the desired
compound P-0190. MS (ESI) [M+H.sup.+].sup.+=419.9.
[1678] Additional compounds were prepared following the protocol of
Scheme 196, replacing 6-methoxy-pyridine-3-carbaldehyde 618 with a
suitable aldehyde in Step 1. The following compounds were made
following this procedure: [1679]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
thiazol-2-ylmethyl-amine (P-0189), [1680]
Benzyl-[4-chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-
-2-yl]-amine (P-4192), [1681]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-methoxy-benzyl)-amine (P-0193), [1682]
(4-Chloro-benzyl)-[4-Cloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethy-
l)-thiazol-2-yl]-amine (P-0194), [1683]
[4-Chloro-5-(5-chloro)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-
-(4-fluoro-benzyl)-amine (P-0195). [1684]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2,4-dimethyl-thiazol-5-ylmethyl)-amine (P-0196), [1685]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-ethyl-5-methyl-3H-imidazol-4-ylmethyl)-amine (P-0197) [1686]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-ethyl-2H-pyrazol-3-ylmethyl)-amine (P-0198), [1687]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methoxy-pyridin-2-ylmethyl)-amine (P-0199). [1688]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-fluoro-pyridin-4-ylmethyl)-amine (P-0200), [1689]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-methyl-thiazol-4-ylmethyl)-amine (P-0201). [1690]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(4-methyl-thiazol-5-ylmethyl)-amine (P-0202), [1691]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-chloro-pyridin-2-ylmethyl)-amine (P-0203), [1692]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
pyridin-3-ylmethyl-amine (P-0236), [1693]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3b]pyridin-3-ylmethyl)-thiazol-2-yl]-p-
yridin-4-ylmethyl-amine (P-01237), [1694]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-chloro-pyridin-4-ylmethyl)-amine (P-4238), [1695]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(1-ethyl-1H-pyrazol-4-ylmethyl)-amine (P-0239), [1696]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-fluoro-pyridin-2-ylmethyl)-amine (P-0240), [1697]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(5-methoxy-pyridin-3-ylmethyl)-amine (P-0241), [1698]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-trifluoromethyl-pyridin-3-ylmethyl)-amine (P-0242), [1699]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-chloro-6-fluoro-benzyl)-amine (P-0243), [1700]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
phenethyl-amine (P-044), [1701]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2,4-difluoro-benzyl)-amine (P-0245), [1702]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-fluoro-benzyl)-amine (P-4246). [1703]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-methoxy-pyridin-3-ylmethyl)-amine (P-0247), [1704]
(2-Chloro-benzyl)-[4-chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmeth-
yl)-thiazol-2-yl]-amine (P-0248), [1705]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-methyl-benzyl)-amine (P-0249), [1706]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(2-Chloro-4-fluoro-benzyl)-amine (P-0250), [1707]
[4-Chloro-5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(3-fluoro-pyridin-2-ylmethyl)-amine (P-4251), [1708]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-morpholin-4-yl-pyridin-2-ylmethyl)-amine (P-0252), [1709]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-triazol-2-yl]--
(3,5-dichloro-pyridin-4-ylmethyl)-amine (P-0253). [1710]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)thiazol-2-yl]-(-
2-trifluoromethyl-benzyl)-amine (P-0254), and [1711]
[4-Chloro-5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]--
(6-methyl-pyridin-2-ylmethyl)-amine (P-0255). The following table
indicates the aldehyde (Column 2) used in Step 1 of Scheme 196 to
provide the compounds (Column 3). Column 1 provides the compound
number and Column 4 the experimental mass spectrometry result.
TABLE-US-00018 [1711] MS (ESI) Compound [M + H.sup.+].sup.+ number
Aldehyde Compound observed P-0189 ##STR00832## ##STR00833## 395.9
P-0192 ##STR00834## ##STR00835## 389.1 P-0193 ##STR00836##
##STR00837## 419.1 P-0194 ##STR00838## ##STR00839## 425.1 P-0195
##STR00840## ##STR00841## 407.1 P-0196 ##STR00842## ##STR00843##
423.9 P-0197 ##STR00844## ##STR00845## 421.1 P-0198 ##STR00846##
##STR00847## 407.1 P-0199 ##STR00848## ##STR00849## 419.9 P-0200
##STR00850## ##STR00851## 407.9 P-0201 ##STR00852## ##STR00853##
409.9 P-0202 ##STR00854## ##STR00855## 409.9 P-0203 ##STR00856##
##STR00857## 423.9 P-0236 ##STR00858## ##STR00859## 390.3 P-0237
##STR00860## ##STR00861## 390.3 P-0238 ##STR00862## ##STR00863##
425.9 P-0239 ##STR00864## ##STR00865## 407.1 P-0240 ##STR00866##
##STR00867## 407.9 P-0241 ##STR00868## ##STR00869## 419.9 P-0242
##STR00870## ##STR00871## 458.3 P-0243 ##STR00872## ##STR00873##
443.1 P-0244 ##STR00874## ##STR00875## 403.1 P-0245 ##STR00876##
##STR00877## 424.7 P-0246 ##STR00878## ##STR00879## 407.1 P-0247
##STR00880## ##STR00881## 419.9 P-0248 ##STR00882## ##STR00883##
424.7 P-0249 ##STR00884## ##STR00885## 403.1 P-0250 ##STR00886##
##STR00887## 441.1 P-0251 ##STR00888## ##STR00889## 407.9 P-0252
##STR00890## ##STR00891## 475.1 P-0253 ##STR00892## ##STR00893##
459.9 P-0254 ##STR00894## ##STR00895## 457.1 P-0255 ##STR00896##
##STR00897## 404.3
[1712] Additional compounds were prepared following the protocol of
Scheme 196, replacing
5-(1-benzenesulfonyl-5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chlo-
ro-thiazol-2-ylamine 592 with
5-(1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-4-chloro-thiazo-
l-2-ylamine 593 (prepared as described in Example 66, Scheme 183)
in addition to replacing 6-methoxy-pyridine-3-carbaldehyde 618 with
a suitable aldehyde in Step 1. The following compounds were made
following this procedure: [1713]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2,4-dime-
thylthiazol-5-ylmethyl)-amine (P-0204), [1714]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2-ethyl--
5-methyl-3H-imidazol-4-ylmethyl)-amine (P-0205). [1715]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(5-fluoro-
-pyridin-2-ylmethyl)-amine (P-0206), [1716]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(5-methox-
y-pyridin-3-ylmethyl)-amine (P-0207), [1717]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4,5-dime-
thyl-thiophen-2-ylmethyl)-amine (P-1208), [1718]
[4-Chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(2,5-dime-
thyl-thiophen-3-ylmethyl)-amine (P-1209), The following table
indicates the aldehyde (Column 2) used in Step 1 of Scheme 196 to
provide the compounds (Column 3). Column 1 provides the compound
number and Column 4 the experimental mass spectrometry result.
TABLE-US-00019 [1718] MS (ESI) Compound [M + H.sup.+].sup.+ number
Aldehyde Compound observed P-0204 ##STR00898## ##STR00899## 390.3
P-0205 ##STR00900## ##STR00901## 387.1 P-0206 ##STR00902##
##STR00903## 373.9 P-0207 ##STR00904## ##STR00905## 386.3 P-0208
##STR00906## ##STR00907## 389.1 P-0209 ##STR00908## ##STR00909##
389.1
Example 80: Synthesis of
5-[1-(1H-pyrrolo[2,3-b]pyridin-3-yl)-ethyl]-pyridin-2-yl-(4-trifluorometh-
yl-benzyl)-amine P-0388
[1719]
5-[1-(1H-Pyrrolo[2,3-b]pyridin-3-yl)-ethyl]-pyridin-2-yl-(4-trifluo-
romethyl-benzyl)-amine P-0388 was synthesized from
(5-bromo-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine 17 as shown
in Scheme 197.
##STR00910## ##STR00911##
Step 1--Preparation of
1-[6-(4-trifluoromethyl-benzylamino)-pyridin-3-yl]-ethanone
(620)
[1720] (5-Bromo-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine (17,
3.00 g. 9.06 mmol, prepared as described in Example 10, Scheme 12)
was dissolved in tetrahydrofuran (80 mL). The reaction was cooled
at -78.degree. C. under an atmosphere of argon. 2.5 M
n-butyllithium in hexane (10.9 mL) was added. The reaction was
stirred at -78.degree. C. fir 60 minutes.
N-Methoxy-N-methylacetamide (1.93 mL, 18.1 mmol) was added to the
reaction, which was allowed to warm to room temperature. The
reaction was poured into 1M ammonium chloride and brine and
extracted with ethyl acetate. The organic portions were dried with
anhydrous sodium sulfate, filtered and the filtrate was adsorbed
onto silica. The mixture was purified by silica gel chromatography
(ethyl acetate:hexanes) to provide the desired compound as an oil
that crystallized to a white solid (620, 1.328 g, 50%), consistent
with the compound structure by .sup.1H-NMR and MS (ESI):
[M+H.sup.+].sup.+=295.3.
Step 2--Preparation of
(5-acetyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic Acid
Tert-Butyl Ester (621)
[1721] To
1-[6-(4-trifluoromethyl-benzylamino)-pyridin-3-yl]-ethanone (620,
1.30 g, 4.42 mmol) in tetrahydrofuran (15.0 mL) were added
di-tert-butyldicarbonate (1.10 g, 5.04 mmol),
4-dimethylaminopyridine (0.0259 g, 0.21 mmol) and
N,N-diisopropylethylamine (0.888 mL, 5.10 mmol) under an atmosphere
of nitrogen. The reaction was stirred at room temperature for 3
days. The mixture was extracted with ethyl acetate and saturated
sodium bicarbonate. The organic portions were dried with anhydrous
sodium sulfate, filtered and the filtrate was adsorbed onto silica.
The mixture was purified by silica gel chromatography (0-15% ethyl
acetate:hexanes) to provide the desired compound as an oil that
solidified to a white solid (621, 1.29 g, 74%), consistent with the
compound structure by .sup.1H-NMR.
Step 3--Preparation of
1-[6-(4-trifluoromethyl-benzylamino)-pyridin-3-yl]-1-(1-triisopropylsilan-
yl-1H-pyrrolo[2,3-b]pyridin-3-yl)-ethanol (622)
[1722] 3-Iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (96,
485.9 mg, 1.21 mmol) was dissolved in tetrahydrofuran (8 mL) at
-20.degree. C. under an atmosphere of nitrogen. 2.0 M
isopropylmagnesium chloride in tetrahydrofuran (0.655 mL) was
added. The reaction was stirred at -20.degree. C. for 1 hour. Into
the reaction was added
(5-acetyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (621, 300.0) mg, 0.76 mmol) in tetrahydrofuran (6
mL) The reaction was allowed to warm to room temperature overnight.
The mixture was extracted with ethyl acetate and saturated sodium
bicarbonate. The organic portions were dried with anhydrous sodium
sulfate, filtered and the filtrate was adsorbed onto silica. The
mixture was purified by silica gel chromatography on the (ethyl
acetate:hexanes), to provide the desired compound as an oil (622,
125 mg, 29%), consistent with the compound structure by
.sup.1H-NMR.
Step 4--Preparation of
5-[1-(1H-pyrrolo[2,3-b]pyridin-3-yl)-vinyl]-pyridin-2-yl-(4-trifluorometh-
yl-benzyl)-amine (623)
[1723]
1-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-yl]-1-(1-triisopropy-
lsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-ethanol (622, 125.0 mg,
0.22 mmol) was dissolved in acetonitrile (11.7 mL) and
trifluoroacetic acid (0.175 mL, 2.3 mmol) and triethylsilane (0.292
mL, 1.8 mmol) were added. The reaction was heated to reflux
overnight. The reaction was concentrated, then washed with ethyl
acetate and saturated sodium bicarbonate. The organic portions were
dried with anhydrous sodium sulfate, filtered and the filtrate was
adsorbed onto silica. The mixture was purified by silica gel
chromatography (0-60% ethyl acetate:hexanes) to provide the desired
compound (623, 43 mg, 50%), consistent with the compound structure
by .sup.1H-NMR.
Step 5--Preparation of
5-[1-(1H-pyrrolo[2,3-b]pyridin-3-yl)-ethyl]-pyridin-2-yl-(4-trifluorometh-
yl-benzyl)-amine (P-0388)
[1724]
5-[1-(1H-Pyrrolo[2,3-b]pyridin-3-yl)-vinyl]-pyridin-2-yl-(4-trifluo-
romethyl-benzyl)-anine (623, 0.043 g, 0.00011 mol) was dissolved in
tetrahydrofuran (10 mL) and methanol (10 mL). The reaction was
shaken under an atmosphere of hydrogen (30 psi) overnight. The
reaction was filtered through Celite and the filtrate adsorbed onto
silica and purified by silica gel column chromatography (ethyl
acetate:hexanes) to provide the desired compound as a white solid
(P-0388, 2.1 mg. 5%), consistent with compound structure by
.sup.1H-NMR and MS (ESI): [M+H.sup.+].sup.+=397.6.
Example 81: Synthesis of
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-
-benzyl)-amine P-0290
[1725]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4--
fluoro-benzyl)-amine P-0290 was synthesized in four steps from
(4-fluoro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester 624 as shown in Scheme 198.
##STR00912##
Step 1--Preparation of
(4-fluoro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic Acid
Tert-Butyl Ester (625)
[1726] To a solution of
(4-fluoro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester (624, 1 g, 2.70 mmol, prepared as described in
Example 44. Scheme 159. Step 2, where 4-(aminomethyl)pyridine 516
is replaced with p-fluorobenzylamine, i.e. intermediate in
preparing compound P-0156) in methanol (100 mL) was added Pd/C (100
mg, 50% water wet) and sodium acetate (660 mg, 8.09 mmol) and the
mixture was shaken under an atmosphere of hydrogen (50 psi)
overnight observing .about.50% conversion by LC/MS. The mixture was
filtered over a bed of Celite and the solvent was removed in vacuo
and the residue purified by silica gel chromatography (ethyl
acetate/heptane) to provide the desired compound as an off-white
solid (450 mg, 50%), consistent with compound structure by
.sup.1H-NMR.
Step 2--Preparation of
{5-[(5-chloro-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy--
methyl]-thiazol-2-yl}-(4-fluoro-benzyl)-carbamic Acid Tert-Butyl
Ester (627)
[1727] To a solution of
5-chloro-3-iodo-1-(triisopropylsilyl)-1H-pyrrolo[2,3-b]pyridine
(626, 300 mg, 0.69 mmol) in tetrahydrofuran (10 mL) at -20.degree.
C. was added dropwise isopropyl-magnesium chloride (2M in
tetrahydrofuran, 0.44 mL, 0.88 mmol). The reaction mixture was
allowed to warm to 0.degree. C. over 10 minutes and then cooled to
-40.degree. C. To this reaction mixture was added a solution of
(4-fluoro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester (625, 211 mg, 0.63 mmol) in tetrahydrofuran (5
mL). The reaction mixture was allowed to warm to 0.degree. C. over
30 minutes and then quenched with brine (50 mL). The mixture was
transferred to a separatory funnel and the layers were separated.
The organic layer was dried over sodium sulfate and evaporated in
vacuo to give the crude material which was purified by silica gel
column chromatography (0-30% ethyl acetate/heptane) to provide the
desired compound as a foam (120 mg. 30%), consistent with structure
by .sup.1H-NMR.
Step 3--Preparation of
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-
-benzyl)-carbamic Acid Tert-Butyl Ester (628)
[1728] To a solution of
{5-[(5-chloro-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydrox-
y-methyl]-thiazol-2-yl}-(4-fluoro-benzyl)-carbamic acid tert-butyl
ester (627, 120 mg. 0.186 mmol) in acetonitrile (3 mL) was added
trifluoroacetic acid (0.14 mL, 1.86 mmol) and triethylsilane (0.30
mL, 1.86 mmol). The resulting mixture was stirred for 2 hours at
40.degree. C. The solvent was then removed in vacuo and the residue
was used directly in the next step.
Step 4: Preparation of
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-4-fluoro--
benzyl)-amine (P-290)
[1729] To the solution of crude
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiazol-2-yl]-(4-fluoro-
-benzyl)-carbamic acid tert-butyl ester (628, 0.186 mmol theory) in
dichloromethane (5 mL) at room temperature was added
trifluoroacetic acid (1 mL) and the reaction was allowed to stir
overnight. The solvent was removed in vacuo and the residue taken
up in ethyl acetate and then washed with saturated aqueous
potassium carbonate making sure basicity was reached. The layers
were separated and the aqueous layer was back-extracted with ethyl
acetate. The combined organic layers were dried over sodium sulfate
and evaporated in vacuo to give the crude product which was
purified by silica gel chromatography (0-10% methanol/ethyl
acetate). The solvent was removed in vacuo and the material was
triturated with dichloromethane to give the desired compound as an
off-white solid (20 mg, 29% over 2 steps) consistent with compound
structure by .sup.1H-NMR and MS (ESI): [M+H.sup.+].sup.+=372.9.
[1730]
(4-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-amine
P-0389
##STR00913##
was synthesized following the protocol of Scheme 198, replacing
5-chloro-3-iodo-1-(triisopropylsilyl)-1H-pyrrolo[2,3-b]pyridine 626
with 3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine 96, to
provide the desired compound, consistent with structure by 1H-NMR
and MS (ESI): [M+H.sup.+].sup.+=339.0.
Example 82: Synthesis of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[2-ethyl-5-(4-fluoro-benzylamino-
)-2H-pyrazol-3-yl]-methanone P-0184
[1731]
(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[2-ethyl-5-(4-fluoro-benzy-
lamino)-2H-pyrazol-3-yl]-methanone P-0184 was synthesized from
5-chloro-1H-pyrrolo[2,3-b]pyridine 532 in 1 step as shown in Scheme
199.
##STR00914##
Step 1--Synthesis of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[2-ethyl-5-(4-fluoro-benzylamino-
)-2H-pyrazol-3-yl]-methanone (P-0184)
[1732] 5-Chloro-1H-pyrrolo[2,3-b]pyridine (532, 0.068 g, 0.44 mmol)
was combined with methanol (10 mL) and potassium hydroxide (0.16 g.
2.8 mmol). The mixture was stirred for 50 minutes, then
2-ethyl-5-(4-fluoro-benzylamino)-2H-pyrazole-3-carbaldehyde (530,
0.100 g, 0.40 mmol, prepared as described in Example 47, Scheme
162, Step 5) was added and the reaction was stirred overnight at
room temperature and then concentrated. Ethyl acetate was added and
the mixture was washed with sodium bicarbonate saturated solution
and brine. After drying over anhydrous sodium sulfate the solvent
was removed under reduced pressure. Purification with silica gel
column chromatography eluting with a gradient of ethyl acetate
(10-100%) in hexanes provided the desired compound (0.0033 g, 2%).
MS (ESI) [M+H.sup.+].sup.+=398.1.
Example 83: Synthesis of
[5-(5-chloro-1-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-ethyl-1H-pyrazol-3-yl]-
-(4-fluoro-benzyl)-amine P-0185
[1733]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-ethyl-1H-pyrazo-
l-3-yl]-(4-fluoro-benzyl)-amine P-0185 was synthesized from
5-chloro-3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine 629
in 2 steps as shown in Scheme 200.
##STR00915##
Step 1--Synthesis of
(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-[2-ethyl-5-(4-fluoro-benzylamino-
)-2H-pyrazol-3-yl]-methanol (630)
[1734]
5-Chloro-3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine
(629, 0.15 g, 0.34 mmol) was dissolved in tetrahydrofuran (3 mL, 40
mmol) and the solution was cooled to -20.degree. C. 2 M
isopropylmagnesium chloride in tetrahydrofuran (200 .mu.L) was
added dropwise and the reaction was stirred and allowed to warm to
-5.degree. C. After the reaction was cooled to -20.degree. C.
2-ethyl-5-(4-fluoro-benzylamino)-2H-pyrazole-3-carbaldehyde (530,
0.043 g, 0.17 mmol, prepared as described in Example 47, Scheme
162, Step 5) in tetrahydrofuran (4 mL) was added to the mixture.
The reaction was stirred to -5.degree. C., then concentrated, ethyl
acetate was added and the mixture was washed with sodium
bicarbonate saturated solution and brine. After drying over
anhydrous sodium sulfate, the solvent was removed under reduced
pressure. Purification with silica gel column chromatography
eluting with a gradient of ethyl acetate (5-80%) in hexanes gave
the desired compound (630, 0.038 g, 40%).
Step 2--Synthesis of
5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-ethyl-1H-pyrazol-3-yl]-
-(4-fluoro-benzyl)-amine (P-0185)
[1735]
(5-Chloro-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-[2-e-
thyl-5-(4-fluoro-benzylamino)-2H-pyrazol-3-yl]-methanol (630, 0.045
g, 0.081 mmol) was dissolved in acetonitrile (5 mL) and
triethylsilane (0.4 mL. 2.0 mmol) was added, followed by
trifluoroacetic acid (0.2 mL, 2.0 mmol). The reaction was stirred
at room temperature for 45 minutes, then stirred at 60.degree. C.
for 45 minutes. The solvent was removed under reduced pressure,
ethyl acetate was added and the organic was washed with sodium
bicarbonate saturated solution and brine. After drying over
anhydrous sodium sulfate, the solvent was evaporated to dryness.
Purification with silica gel column chromatography eluting with a
gradient of ethyl acetate (40-100%) in hexanes gave the isolation
of the desired compound (P-0185, 0.0068 g, 22%). MS (ESI)
[M+H.sup.+].sup.+=384.1.
Example 84: Synthesis of
3-2-Fluoro-6-[(5-fluoro-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmethyl-1H--
pyrrolo[2,3-b]pyridine-5-carbonitrile P-0415
[1736]
3-2-Fluoro-6-[(5-fluoro-pyridin-3-ylmethyl)-amino]-pyridin-3-ylmeth-
yl-1H-pyrrolo[2,3-b]pyridine-5-carbonitrile P-0415 was synthesized
in 5 steps from 1H-Pyrrolo[2,3-b]pyridine-5-carbonitrile 632 as
shown in Scheme 201.
##STR00916##
Step 1--Synthesis of
3-dimethylaminomethyl-1H-pyrrolo[2,3-b]pyridine-5-carbonitrile
(633)
[1737] To 1H-Pyrrolo[2,3-b]pyridine-5-carbonitrile (632, 3.00 g,
0.0210 mol) in isopropyl alcohol (120 mL) were added dimethylamine
hydrochloride (1.91 g, 0.0235 mol) and formaldehyde (0.708 g,
0.0236 mol). The reaction was heated to reflux overnight, then
concentrated, poured into water, and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 5% to 30% methanol in
dichloromethane containing 0.3% triethyl amine to give the desired
compound (633, 2.0 g, 48%).
Step 2--Synthesis of
S-cyano-3-dimethylaminomethyl-pyrrolo[2,3-b]pyridine-1-carboxylic
Acid Tert-Butyl Ester (634)
[1738] To
3-dimethylaminomethyl-1H-pyrrolo[2,3-b]pyridine-5-carbonitrile
(633, 2.0 g, 0.010 mol) in tetrahydrofuran (60.0 mL) were added
di-tert-butyldicarbonate (2.62 g, 0.0120 mol).
4-dimethylaminopyridine (0.12 g, 0.0010 mol) and triethylamine (4.0
mL, 0.029 mol). The reaction was stirred at 45.degree. C. over a
weekend, then concentrated, poured into aqueous potassium
carbonate, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 2% to 30% methanol in dichloromethane in hexane to
give the desired compound (634, 2.50 g, 83%).
Step 3--Synthesis of
3-chloromethyl-5-cyano-pyrrolo[2,3-b]pyridine-1-carboxylic Acid
Tert-Butyl Ester (635)
[1739] To
5-cyano-3-dimethylaminomethyl-pyrrolo[2,3-b]pyridine-1-carboxyli- c
acid tert-butyl ester (634, 2.60 g, 8.66 mmol) in toluene (60.0 mL)
under an atmosphere of nitrogen was added ethyl chloroformate
(0.828 mL, 8.66 mmol). The reaction was stirred at room temperature
for 3 hours, then poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 20% to 100% ethyl acetate in
hexane to give a white solid (635, 400 mg, 16%).
Step 4--Synthesis of
[5-(5-cyano-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fluoro-pyridin-2-yl]-(-
5-fluoro-pyridin-3-ylmethyl)-carbamic Acid Tert-Butyl Ester
(636)
[1740] To
(5-bromo-6-fluoro-pyridin-2-yl)-(5-fluoro-pyridin-3-ylmethyl)-ca-
rbamic acid tert-butyl ester (631, 0.600 g, 1.50 mmol, prepared as
described in Example 60) in tetrahydrofuran (10.0 mL) at
-25.degree. C. under an atmosphere of nitrogen, was added a
solution of isopropylmagnesium chloride (2.0 M in tetrahydrofuran,
0.730 mL). The reaction was allowed to warm to 5.degree. C. over 1
hour. The reaction was cooled to -35.degree. C., followed by
addition of a solution of CuCN.2LiCl (0.65 M in tetrahydrofuran,
2.4 mL). After 5 minutes,
3-chloromethyl-5-cyano-pyrrolo[2,3-b]pyridin-1-carboxylic acid
tert-butyl ester (635, 0.086 g, 0.29 mmol) in tetrahydrofuran (4.0
mL) was added to the reaction. The reaction was allowed to warm to
room temperature over 1 hour, then poured into a diluted ammonia
solution, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% to 100% ethyl acetate in hexane to give the
desired compound (636, 0.13 g, 92%). MS (ESI)
[M+H.sup.+].sup.+=477.4.
Step 5--Synthesis of
3-2-fluoro-6-[(5-fluoro-pyridin-3-ylmethyl)-amino]-pyridin-3-ylethyl-1H-p-
yrrolo[2,3-b]pyridine-5-carbonitrile (P-0415)
[1741] To
[5-(5-cyano-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-6-fluoro-pyridi-
n-2-yl]-(5-fluoro-pyridin-3-ylmethyl)-carbamic acid tert-butyl
ester (636, 0.130 g, 0.27 mmol) in dichloromethane (10.0 mL) was
added trifluoroacetic acid (1.00 mL, 0.0130 mol). The reaction was
stirred at room temperature overnight. The reaction was
concentrated, poured into aqueous potassium carbonate, and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 25% to 100% ethyl acetate in hexane to give a white
solid (P-0415, 85.6 mg, 83.4%). MS (ESI)
[M+H.sup.+].sup.+=377.0.
[1742]
(5-Fluoro-pyridin-3-ylmethyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-
-3-ylmethyl)-pyridin-2-yl]-amine P-0414
##STR00917##
was prepared following the protocol of Scheme 201, replacing
1H-Pyrrolo[2,3-b]pyridine-5-carbonitrile 632 with
1H-Pyrrolo[2,3-b]pyridine in Step 1. MS (ESI)
[M+H.sup.+].sup.+=352.5.
[1743]
3-[6-(4-Chloro-benzylamino)-2-fluoro-pyridin-3-ylmethyl]-1H-pyrrolo-
[2,3-b]pyridine-5-carbonitrile P-0432
##STR00918##
was prepared following the protocol of Scheme 201, replacing
5-bromo-6-fluoro-pyridin-2-yl)-(5-fluoro-pyridin-3-ylmethyl)-carbamic
acid tert-butyl ester 631 with
(5-Bromo-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-carbamic acid
tert-butyl ester 637 (prepared as described in Example 60) in Step
4. MS (ESI) [(M+H.sup.+].sup.+=391.9.
Example 85: Synthesis of
(3-chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-met-
hyl-1H-pyrazol-3-yl]-amine P40410
[1744] (3-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo
[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyrazol-3-yl]-amine P-0410
was synthesized in 11 steps from 1H-pyrazole-3,5-dicarboxylic acid
monohydrate 638 as shown in Scheme 202.
##STR00919## ##STR00920## ##STR00921##
Step 1--Preparation of 1H-pyrazole-3,5-dicarboxylic Acid Dimethyl
Ester (639)
[1745] 1H-Pyrazol-3,5-dicarboxylic acide monohydrate (638, 21.1 g,
121.0 mmol) was combined with methanol (350 mL) and hydrogen
chloride (10 mL). The reaction was stirred at reflux overnight and
then concentrated. The resulting solid was washed with ethyl
acetate and hexanes and dried under reduced pressure. The obtained
compound 639 was used without further purification. MS (ESI)
[M+H.sup.+].sup.+=185.0.
Step 2--Preparation of 1-methyl-1H-pyrazole-3,5-dicarboxylic acid
dimethyl ester (640)
[1746] 1H-Pyrazole-3,5-dicarboxylic acid dimethyl ester (639, 9.1
g, 49.0 mmol) was combined with acetone (400 mL) and potassium
carbonate (10.2 g, 74.1 mmol). The mixture was stirred for 40
minutes under an atmosphere of nitrogen. To the stirring
suspension, methyl iodide (3.4 mL, 54.0 mmol) was added dropwise.
The reaction was stirred at room temperature overnight and then the
solvent was evaporated under reduced pressure. The resulting solid
was washed with water and filtered. After toluene was added, the
solvent was removed under reduced pressure. The resulting compound
640 was used without further purification.
Step 3--Preparation of 1-methyl-H-pyrazole-3,5-dicarboxylic acid
5-methyl ester (641)
[1747] 1-Methyl-1H-pyrazole-3,5-dicarboxylic acid dimethyl ester
(640, 3.7 g, 19.0 mmol) was combined with 1,4-dioxane (20 mL) and
water (60 mL). Concentrated sulfuric acid (1.0 mL) in 2 mL of water
was added to the solution. After the reaction was stirred at reflux
overnight, it was cooled to room temperature and concentrated until
precipitation began. The obtained mixture was left standing
overnight. The resulting solid was filtered and dried under reduced
pressure. The collected aqueous fractions were extracted with ethyl
acetate. The organic portion was dried over anhydrous sodium
sulfate and concentrated. Additional solid was crystallized from
ethyl acetate to give the desired compound (641, 2.33 g, 68%). MS
(ESI) [M+H.sup.+].sup.+=185.0, melting point 175.degree. C.
Step 4--Preparation of
5-azidocarbonyl-2-methyl-2H-pyrazole-3-carboxylic acid methyl ester
(642)
[1748] 1-Methyl-1H-pyrazole-3,5-dicarboxylic acid 5-methyl ester
(641, 3.2 g, 17.0 mmol) was combined with thionyl chloride (5 mL).
The reaction was heated to reflux for 40 minutes and then
concentrated twice from toluene. The resulting solid was dried
under reduced pressure overnight. The product was dissolved into
acetone (20 mL) and sodium azide (3.5 g, 54.0 mmol) was added in
water (10 mL) rapidly at once. The obtained solution was stirred
for one minute and then poured into ice-water (50 mL). The
precipitate was filtered and dried under reduced pressure. The
final compound was used without further purification (642, 2.8 g,
77%).
[1749] Step 5--Preparation of
5-benzyloxycarbonylamino-2-methyl-2H-pyrazole-3-carboxylic acid
methyl ester (643):
[1750] 5-Azidocarbonyl-2-methyl-2H-pyrazole-3-carboxylic acid
methyl ester (642, 2.8 g. 13.0 mmol) was combined with toluene (35
mL) and benzyl alcohol (2.1 mL. 20.0 mmol). The reaction was heated
to reflux for 45 minutes and then the solvent was removed under
reduced pressure. The compound (643, 2.4 g, 62%) was washed with
methanol and dried under vacuum. MS (ESI)
[M+H.sup.+].sup.+=290.3.
Step 6--Preparation of 5-amino-2-methyl-2H-pyrazole-3-carboxylic
acid methyl ester (644)
[1751] 5-Benzyloxycarbonylamino-2-methyl-2H-pyrazole-3-carboxylic
acid methyl ester (643, 2.2 g, 7.6 mmol) was combined with methanol
(50 mL) and 10% palladium on carbon (500 mg). The mixture was
stirred under an atmosphere of hydrogen for three hours. The
mixture was filtered through Celite and the solvent was removed
under reduced pressure to give the desired compound (644, 1.2 g,
98%). (ESI) [M+H.sup.+].sup.+=156.1.
Step 7--Preparation of
5-(3-chloro-benzylamino)-2-methyl-2H-pyrazole-3-carboxylic Acid
Methyl Ester (646)
[1752] 5-Amino-2-methyl-2H-pyrazole-3-carboxylic acid methyl ester
(644, 1.3 g, 8.0 mmol) was combined with 3-chlorobenzaldehyde (645,
0.95 mL, 8.4 mmol) and acetonitrile (40 mL). Trifluoroacetic acid
(3.2 mL, 42.0 mmol) was added followed by triethylsilane (6.7 mL,
42.0 mmol). The reaction was heated to reflux overnight and then
concentrated. Ethyl acetate was added and the solution was washed
with 1N potassium carbonate. The organic portion was dried over
anhydrous sodium sulfate, filtered and concentrated. The compound
(646, 0.944 g, 42%) was crystallized from a mixture of ethyl
acetate: hexane.
Step 8--Preparation of
[5-(3-chloro-benzylamino)-2-methyl-2H-pyrazol-3-yl]-methanol
(647)
[1753] 5-(3-Chloro-benzylamino)-2-methyl-2H-pyrazole-3-carboxylic
acid methyl ester (646, 0.944 g, 3.37 mmol) was combined with
tetrahydrofuran (20 mL) and the solution was cooled to -40.degree.
C. 1.0 M lithium tetrahydroaluminate in tetrahydrofuran (3.7 mL)
was added and the reaction was stirred for 45 min at -20.degree. C.
1.0 M lithium tetrahydroaluminate in tetrahydrofuran (3.7 mL) was
added at -40.degree. C. and the reaction was stirred to 10.degree.
C. Sodium sulfate decahydrate was added in small portions and the
mixture was stirred for two hours at room temperature, then
filtered through Celite and concentrated. The resulting compound
(647, 0.821 g, 97%) was washed with a mixture of ethyl acetate:
hexanes and dried under reduced pressure.
Step 9--Preparation of
5-(3-chloro-benzylamino)-2-methyl-2H-pyrazole-3-carbaldehyde
(648)
[1754] [5-(3-Chloro-benzylamino)-2-methyl-2H-pyrazol-3-yl]-methanol
(647, 0.821 g, 3.26 mmol) was combined with dichloromethane (70 mL)
and manganese(IV) oxide (4 g). The reaction was stirred at room
temperature overnight under an atmosphere of nitrogen. The mixture
was filtered through Celite and concentrated. Purification by
silica gel column chromatography eluting with a gradient of ethyl
acetate (10-100%) in hexane gave the desired aldehyde (648, 0.482
g, 60%).
Step 10--Preparation of
[5-(3-chloro-benzylamino)-2-methyl-2H-pyrazol-3-yl]-(5-chloro-1-triisopro-
pylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (649)
[1755]
5-Chloro-3-iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine
(629, 0.19 g, 0.44 mmol) was dissolved in tetrahydrofuran (0.9 mL).
The solution was cooled to -20.degree. C. 2M isopropylmagnesium
chloride in tetrahydrofuran (200 .mu.L) was added dropwise to the
mixture, then stirred to -5.degree. C. After the reaction was
cooled to -20.degree. C.
5-(3-chloro-benzylamino)-2-methyl-2H-pyrazole-3-carbaldehyde (648,
0.050 g, 0.20 mmol) in 2 mL of tetrahydrofuran was added at once to
the mixture. The reaction was stirred to 0.degree. C. and then
concentrated. Ethyl acetate was added and the mixture was washed
with sodium bicarbonate saturated solution and brine. The organic
portion was dried over anhydrous sodium sulfate and concentrated.
Purification with silica gel column chromatography eluting with a
gradient of ethyl acetate (5-80%) in hexane gave the desired
compound (649, 0.033 g, 30%). (ESI) [M+H.sup.+].sup.+=558.3,
560.9.
Step 11--Preparation of
(3-chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-met-
hyl-1H-pyrazol-3-yl]-amine (P-0410)
[1756]
[5-(3-Chloro-benzylamino)-2-methyl-2H-pyrazol-3-yl]-(5-chloro-1-tri-
isopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (649,
0.033 g, 0.059 mmol) was combined with dichloromethane (5 mL, 0.08
mol) and triethylsilane (200 .mu.L, 1.0 mmol) was added, followed
by trifluoroacetic acid (100 .mu.L, 1.0 mmol). The reaction was
stirred at room temperature overnight and then concentrated. Ethyl
acetate was added and the organic portion was washed with 1 M
potassium carbonate, dried over anhydrous sodium sulfate and
concentrated. Purification with silica gel flash chromatography
eluting with a gradient of methanol (2-20%) and dichloromethane
followed by washes with a mixture of ethyl acetate:hexane gave the
desired compound (P-0410, 0.0039 g, 17%). (ESI)
[M+H.sup.+].sup.+=387.30.
[1757]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyraz-
ol-3-yl]-(2,5-difluoro-benzyl)-amine P-0411 and
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-1-methyl-1H-pyrazol-3-y-
l]-(2-fluoro-benzyl)-amine P-0413,
##STR00922##
respectively, were prepared following the protocol of Scheme 202,
replacing 3-chlorobenzaldehyde 645 with 2,5-difluorobenzaldehyde
and 2-fluorobenzaldehyde, respectively, in Step 7. (ESI)
[M+H.sup.+].sup.+=389.95 (P-0411) and 370.20 (P-0413).
Example 86 Additional Compounds
[1758] The following compounds of the invention were synthesized
following the methods of the Examples above, or similar methods
known to those of skill in the art: [1759]
3-(6-tert-Butoxy-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0020), [1760]
3-(6-Methoxy-pyridin-3-ylmethyl)-4-thiophen-3-yl-1H-pyrrolo[2,3-b]-
pyridine (P-0022). [1761] (6-Isobutyl
amino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol
(P-0029), [1762]
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyrid-
in-3-yl)-methanol (P-0034), [1763]
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanol (P-0035), [1764]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanol (P-0036), [1765]
[6-(4-Chloro-benzylamino)pyridino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanol (P-0037), [1766]
(4-Chloro-benzyl)-{5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-pyr-
idin-2-yl}-amine (P-0039), [1767]
(4-Chloro-3-trifluoromethyl-benzyl)-{(5-[methoxy-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methyl]-pyridin-2-yl}-amine (P-0040), [1768]
(4-Chloro-benzyl)-5-[methoxy-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-y-
l)-methyl]-pyridin-2-yl)-amine (P-0041), [1769]
[6-(4-Chloro-benzylamino)-2-methyl-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanol (P-0046), [1770]
[2,6-Bis-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone (P-0049), and [1771]
3-(2-Ethylsulfanyl-4,6-dimethyl-pyrimidin-5-ylmethyl)-1H-pyrrolo[2,3-b]py-
ridine (P-0052).
[1772] All patents and other references cited in the specification
are indicative of the level of skill of those skilled in the art to
which the invention pertains, and are incorporated by reference in
their entireties, including any tables and figures, to the same
extent as if each reference had been incorporated by reference in
its entirety individually.
[1773] One skilled in the art would readily appreciate that the
present invention is well adapted to obtain the ends and advantages
mentioned, as well as those inherent therein. The methods,
variances, and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[1774] It will be readily apparent to one skilled in the art that
varying substitutions and modifications may be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. For example, variations can be made to
provide additional compounds of Formulae I, II or III, and all
sub-embodiments thereof, and/or various methods of administration
can be used. Thus, such additional embodiments are within the scope
of the present invention and the following claims.
[1775] The invention illustratively described herein suitably may
be practiced in the absence of any element or elements, limitation
or limitations which is not specifically disclosed herein. The
terms and expressions which have been employed are used as terms of
description and not of limitation, and there is no intention that
in the use of such terms and expressions of excluding any
equivalents of the features shown and described or portions
thereof, but it is recognized that various modifications are
possible within the scope of the invention claimed. Thus, it should
be understood that although the present invention has been
specifically disclosed by preferred embodiments and optional
features, modification and variation of the concepts herein
disclosed may be resorted to by those skilled in the art, and that
such modifications and variations are considered to be within the
scope of this invention as defined by the appended claims.
[1776] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other
group.
[1777] Also, unless indicated to the contrary, where various
numerical values are provided for embodiments, additional
embodiments are described by taking any 2 different values as the
endpoints of a range. Such ranges are also within the scope of the
described invention.
[1778] Thus, additional embodiments are within the scope of the
invention and within the following claims.
TABLE-US-00020 SEQUENCE LISTING SEQ ID NO: 1 Sequence NP_000213 Met
Arg Gly Ala Arg Gly Ala Trp Asp Phe Leu Cys Val Leu Leu Leu Leu Leu
Arg Val Gln Thr Gly Ser Ser Gln Pro Ser Val Ser Pro Gly Glu Pro Scr
Pro Pro Ser Ile His Pro Gly Lys Ser Asp Leu Ile Val Arg Val Gly Asp
Glu Ile Arg Leu Leu Cys Thr Asp Pro Gly Phe Val Lys Trp Thr Phe Glu
Ile Leu Asp Glu Thr Asn Glu Asn Lys Gln Asn Glu Trp Ile Thr Glu Lys
Ala Glu Ala Thr Asn Thr Gly Lys Tyr Thr Cys Thr Asn Lys His Gly Leu
Ser Asn Ser Ile Tyr Val Phe Val Arg Asp Pro Ala Lys Leu Phe Leu Val
Asp Arg Ser Leu Tyr Gly Lys Glu Asp Asn Asp Thr Leu Val Arg Cys Pro
Leu Thr Asp Pro Glu Val Thr Asn Tyr Ser Leu Lys Gly Cys Gln Gly Lys
Pro Leu Pro Lys Asp Leu Arg Phe Ile Pro Asp Pro Lys Ala Gly Ile Met
Ile Lys Ser Val Lys Arg Ala Tyr His Arg Leu Cys Leu His Cys Ser Val
Asp Gln Glu Gly Lys Ser Val Leu Ser Glu Lys Phe Ile Leu Lys Val Arg
Pro Ala Phe Lys Ala Val Pro Val Ser Val Tyr Ser Lys Ala Ser Tyr Leu
Leu Arg Glu Gly Glu Glu Phe Thr Val Thr Cys Thr Ile Lys Asp Val Ser
Ser Ser Val Tyr Ser Thr Trp Lys Arg Glu Asn Ser Gln Thr Lys Leu Gln
Glu Lys Tyr Asn Ser Trp His His Gly Asp Phe Asn Tyr Glu Arg Gln Ala
Thr Leu Thr Ile Ser Ser Ala Arg Val Asn Asp Ser Gly Val Phe Met Cys
Tyr Ala Asn Asn Thr Phe Gly Ser Ala Asn Val Thr Thr Thr Leu Glu Val
Val Asp Lys Gly Phe Ile Asn Ile Pre Pro Met Ile Asn Thr Thr Val Phe
Val Asn Asp Gly Glu Asn Val Asp Leu Ile Val Glu Tyr Glu Ala Phe Pro
Lys Pro Glu His Gln Gln Trp Ile Tyr Met Asn Arg Thr Phe Thr Asp Lys
Trp Glu Asp Tyr Pro Lys Ser Glu Asn Glu Ser Asn Ile Arg Tyr Val Ser
Glu Leu His Leu Thr Arg Leu Lys Gly Thr Glu Gly Gly Thr Tyr Thr Phe
Leu Val Ser Asn Ser Asp Val Asn Ala Ala Ile Ala Phe Asn Val Tyr Val
Asn Thr Lys Pro Glu Ile Leu Thr Tyr Asp Arg Leu Val Asn Gly Met Leu
Gln Cys Val Ala Ala Gly Phe Pro Glu Pro Thr Ile Asp Trp Tyr Phe Cys
Pro Gly Thr Glu Gln Arg Cys Ser Ala Ser Val Leu Pro Val Asp Val Gln
Thr Leu Asn Ser Ser Gly Pro Pro Phe Gly Lys Leu Val Val Gln Ser Ser
Ile Asp Ser Ser Ala Phe Lys His Asn Gly Thr Val Glu Cys Lys Ala Tyr
Asn Asp Val Gly Lys Thr Ser Ala Tyr Phe Asn Phe Ala Phe Lys Gly Asn
Asn Lys Glu Gln Ile His Pro His Thr Leu Phe Thr Pro Leu Leu Ile Gly
Phe Val Ile Val Ala Gly Met Met Cys Ile Ile Val Met Ile Leu Thr Tyr
Lys Tyr Leu Gln Lys Pro Met Tyr Glu Val Gln Trp Lys Val Val Glu Glu
Ile Asn Gly Asn Asn Tyr Val Tyr Ile Asp Pro Thr Gln Leu Pro Tyr Asp
His Lys Trp Glu Phe Pro Arg Asn Arg Leu Ser Phe Gly Lys Thr Leu Gly
Ala Gly Ala Phe Gly Lys Val Val Glu Ala Thr Ala Tyr Gly Leu Ile Lys
Ser Asp Ala Ala Met Thr Val Ala Val Lys Met Leu Lys Pro Ser Ala His
Leu Thr Glu Arg Glu Ala Leu Met Ser Glu Leu Lys Val Leu Ser Tyr Leu
Gly Asn His Met Asn Ile Val Asn Leu Leu Gly Ala Cys Thr Ile Gly Gly
Pro Thr Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe
Leu Arg Arg Lys Arg Asp Ser Phe Ile Cys Ser Lys Gln Glu Asp His Ala
Glu Ala Ala Leu Tyr Lys Asn Leu Leu His Ser Lys Glu Ser Ser Cys Ser
Asp Ser Thr Asn Glu Tyr Met Asp Met Lys Pro Gly Val Ser Tyr Val Val
Pro Thr Lys Ala Asp Lys Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu
Arg Asp Val Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu
Glu Asp Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala Phe Leu
Ala Ser Lys Asn Cys Ile His Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu
Thr His Gly Arg Ile Thr Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile
Lys Asn Asp Ser Asn Tyr Val Val Lys Gly Asn Ala Arg Leu Pro Val Lys
Trp Met Ala Pro Glu Ser Ile Phe Asn Cys Val Tyr Thr Phe Glu Ser Asp
Val Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe Ser Leu Gly Ser Ser
Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe Tyr Lys Met Ile Lys Glu
Gly Phe Arg Met Leu Ser Pro Glu His Ala Pro Ala Glu Met Tyr Asp Ile
Met Lys Thr Cys Trp Asp Ala Asp Pro Leu Lys Arg Pro Thr Phe Lys Gln
Ile Val Gln Leu Ile Glu Lys Gln Ile Ser Glu Ser Thr Asn His Ile Tyr
Ser Asn Leu Ala Asn Cys Ser Pro Asn Arg Gln Lys Pro Val Val Asp His
Ser Val Arg Ile Asn Ser Val Gly Ser Thr Ala Ser Ser Ser Gln Pro Leu
Leu Val His Asp Asp Val SEQ ID NO: 2 Sequence NM_000222 1
gatcccatcg cagctaccgc gatgagaggc gctcgcggcg cctgggattt tctctgcgtt
61 ctgctcctac tgcttcgcgt ccagacaggc tcttctcaac catctgtgag
tccaggggaa 121 ccgtctccac catccatcca tccaggaaaa tcagacttaa
tagtccgcgt gggcgacgag 181 attaggctgt tatgcactga tccgggcttt
gtcaaatgga cttttgagat cctggatgaa 241 acgaatgaga ataagcagaa
tgaatggatc acggaaaagg cagaagccac caacaccggc 301 aaatacacgt
gcaccaacaa acacggctta agcaattcca tttatgtgtt tgttagagat 361
cctgccaagc ttttccttgt tgaccgctcc ttgtatggga aagaagacaa cgacacgctg
421 gtccgctgtc ctctcacaga cccagaagtg accaattatt ccctcaaggg
gtgccagggg 481 aagcctcttc ccaaggactt gaggtttatt cctgacccca
aggcgggcat catgatcaaa 541 agtgtgaaac gcgcctacca tcggctctgt
ctgcattgtt ctgtggacca ggagggcaag 601 tcagtgctgt cggaaaaatt
catcctgaaa gtgaggccag ccttcaaagc tgtgcctgtt 661 gtgtctgtgt
ccaaagcaag ctatcttctt agggaagggg aagaattcac agtgacgtgc 721
acaataaaag atgtgtctag ttctgtgtac tcaacgtgga aaagagaaaa cagtcagact
781 aaactacagg agaaatataa tagctggcat cacggtgact tcaattatga
acgtcaggca 841 acgttgacta tcagttcagc gagagttaat gattctggag
tgttcatgtg ttatgccaat 901 aatacttttg gatcagcaaa tgtcacaaca
accttggaag tagtagataa aggattcatt 961 aatatcttcc ccatgataaa
cactacagta tttgtaaacg atggagaaaa tgtagatttg 1021 attgttgaat
atgaagcatt ccccaaacct gaacaccagc agtggatcta tatgaacaga 1081
accttcactg ataaatggga agattatccc aagtctgaga atgaaagtaa tatcagatac
1141 gtaagtgaac ttcatctaac gagattaaaa ggcaccgaag gaggcactta
cacattccta 1201 gtgtccaatt ctgacgtcaa tgctgccata gcatttaatg
tttatgtgaa tacaaaacca 1261 gaaatcctga cttacgacag gctcgtgaat
ggcatgctcc aatgtgtggc agcaggattc 1321 ccagagccca caatagattg
gtatttttgt ccaggaactg agcagagatg ctctgcttct 1381 gtactgccag
tggatgtgca gacactaaac tcatctgggc caccgtttgg aaagctagtg 1441
gttcagagtt ctatagattc tagtgcattc aagcacaatg gcacggttga atgtaaggct
1501 tacaacgatg tgggcaagac ttctgcctat tttaactttg catttaaagg
taacaacaaa 1561 gagcaaatcc atccccacac cctgttcact cctctgctga
ttggtttcgt aatcgtagct 1621 ggcatgatgt gcattattgt gatgattctg
acctacaaat atctacagaa acccatgtat 1681 gaagtacagt ggaaggttgt
tgaggagata aatggaaaca attatgttta catagaccca 1741 acacaacttc
cttatgatca caaatgggag tttcccagaa acaggctgag ttttgggaaa 1801
accctgggtg ctggagcttt cgggaaggtt gttgaggcaa ctgcttatgg cttaatcaag
1861 tcagatgcgg ccatgactgt cgctgtaaag atgctcaagc cgagtgccca
tttgacagaa 1921 cgggaagccc tcatgtctga actcaaagtc ctgagttacc
ttggtaatca catgaatatt 1981 gtgaatctac ttggagcctg caccattgga
gggcccaccc tggtcattac agaatattgt 2041 tgctatggtg atcttttgaa
ttttttgaga agaaaacgtg attcatttat ttgttcaaag 2101 caggaagatc
atgcagaagc tgcactttat aagaatcttc tgcattcaaa ggagtcttcc 2161
tgcagcgata gtactaatga gtacatggac atgaaacctg gagtttctta tgttgtccca
2221 accaaggccg acaaaaggag atctgtgaga ataggctcat acatagaaag
agatgtgact 2281 cccgccatca tggaggatga cgagttggcc ctagacttag
aagacttgct gagcttttct 2341 taccaggtgg caaagggcat ggctttcctc
gcctccaaga attgtattca cagagacttg 2401 gcagccagaa atatcctcct
tactcatggt cggatcacaa agatttgtga ttttggtcta 2461 gccagagaca
ccaagaatga ttctaattat gtggttaaag gaaacgctcg actacctgtg 2521
aagtggatgg cacctgaaag cattttcaac tgtgtataca cgtttgaaag tgacgtctgg
2581 tcctatggga tttttctttg ggagctgttc tctttaggaa gcagccccta
tcctggaatg 2641 ccggtcgatt ctaagttcta caagatgatc aaggaaggct
tccggatgct cagccctgaa 2701 cacgcacctg ctgaaatgta tgacataatg
aagacttgct gggatgcaga tcccctaaaa 2761 agaccaacat tcaagcaaat
tgttcagcta attgagaagc agatttcaga gagcaccaat 2821 catatttact
ccaacttagc aaactgcagc cccaaccgac agaagcccgt ggtagaccat 2881
tctgtgcgga tcaattctgt cggcagcacc gcttcctcct cccagcctct gcttgtgcac
2941 gacgatgtct gagcagaatc agtgtttggg tcacccctcc aggaatgatc
tcttcttttg 3001 gcttccatga tggttatttt cttttctttc aacttgcatc
caactccagg atagtgggca 3061 ccccactgca atcctgtctt tctgagcaca
ctttagtggc cgatgatttt tgtcatcagc 3121 caccatccta ttgcaaaggt
tccaactgta tatattccca atagcaacgt agcttctacc 3161 atgaacagaa
aacattctga tttggaaaaa gagagggagg tatggactgg gggccagagt 3241
cctttccaag gcttctccaa ttctgcccaa aaatatggtt gatagtttac ccgaataaat
3301 ggtagtaatc acagttggcc ttcagaacca tccatagtag tatgatgata
caagattaga 3361 agctgaaaac ctaagtcctt tatgtggaaa acagaacatc
attagaacaa aggacagagt 3421 atgaacacct gggcttaaga aatctagtat
ttcatgctgg gaatgagaca taggccatga 3481 aaaaaatgat ccccaagtgt
gaacaaaaga tgctcttctg tggaccactg catgagcttt 3541 tatactaccg
acctggtttt taaatagagt ttgctattag agcattgaat tggagagaag 3601
gcctccctag ccagcacttg tatatacgca tctataaatt gtccgtgttc atacatttga
3661 ggggaaaaca ccataaggtt tcgtttctgt atacaaccct ggcattatgt
ccactgtgta 3721 tagaagtaga ttaagagcca tataagtttg aaggaaacag
ttaataccat tttttaagga 3781 aacaatataa ccacaaagca cagtttgaac
aaaatctcct cttttagctg atgaacttat 3841 tctgtagatt ctgtggaaca
agcctatcag cttcagaatg gcattgtact caatggattt 3901 gatgctgttt
gacaaagtta ctgattcact gcatggctcc cacaggagtg ggaaaacact 3961
gccatcttag tttggattct tatgtagcag gaaataaagt ataggtttag cctccttcgc
4021 aggcatgtcc tggacaccgg gccagtatct atatatgtgt atgtacgttt
gtatgtgtgt 4081 agacaaatat ttggaggggt atttttgccc tgagtccaag
agggtccttt agtacctgaa 4141 aagtaacttg gctttcatta ttagtactgc
tcttgtttct tttcacatag ctgtctagag 4201 tagcttacca gaagcttcca
tagtggtgca gaggaagtgg aaggcatcag tccctatgta 4261 tttgcagttc
acctgcactt aaggcactct gttatttaga ctcatcttac tgtacctgtt 4321
ccttagacct tccataatgc tactgtctca ctgaaacatt taaattttac cctttagact
4381 gtagcctgga tattattctt gtagtttacc tctttaaaaa caaaacaaaa
caaaacaaaa 4441 aactcccctt cctcactgcc caatataaaa ggcaaatgtg
tacatggcag agtttgtgtg 4501 ttgtcttgaa agattcaggt atgttgcctt
tatggtttcc cccttctaca tttcttagac 4561 tacatttaga gaactgtggc
cgttatctgg aagtaaccat ttgcactgga gttctatgct 4621 ctcgcacctt
tccaaagtta acagattttg gggttgtgtt gtcacccaag agattgttgt 4681
ttgccatact ttgtctgaaa aattcctttg tgtttctatt gacttcaatg atagtaagaa
4741 aagtggttgt tagttataga tgtctaggta cttcaggggc acttcattga
gagttttgtc 4801 ttgccatact ttgtctgaaa aattcctttg tgtttctatt
gacttcaatg atagtaagaa 4861 aagtggttgt tagttataga tgtctaggta
cttcaggggc acttcattga gagttttgtc 4921 aatgtctttt gaatattccc
aagcccatga gtccttgaaa atatttttta tatatacagt 4981 aactttatgt
gtaaatacat aagcggcgta agtttaaagg atgttggtgt tccacgtgtt 5041
ttattcctgt atgttgtcca attgttgaca gttctgaaga attc SEQ ID NO: 3
Sequence NP_5202 Met Gly Pro Gly Val Leu Leu Leu Leu Leu Val Ala
Thr Ala Trp His Gly Gln Gly Ile Pro Val Ile Glu Pro Ser Val Pro Glu
Leu Val Val Lys Pro Gly Ala Thr Val Thr Leu Arg Cys Val Gly Asn Gly
Ser Val Gln Trp Asp Gly Pro Pro Ser Pro His Trp Thr Leu Tyr Ser Asp
Gly Ser Ser Ser Ile Leu Ser Thr Asn Asn Ala Thr Phe Gln Asn Thr Gly
Thr Tyr Arg Cys Thr Glu Pro Gly Asp Pro Leu Gly Gly Ser Ala Ala Ile
His Leu Tyr Val Lys Asp Pro Ala Arg Pro Trp Asn Val Leu Ala Gln Gln
Val Val Val Phe Gln Asp Gln Asp Ala Leu Leu Pro Cys Leu Leu Thr Asp
Pro Val Leu Gln Ala Gly Val Ser Leu Val Arg Val Arg Gly Arg Pro Leu
Met Arg His Thr Asn Tyr Ser Phe Ser Pro Trp His Gly Phe Thr Ile His
Arg Ala Lys Phe Ile Gln Ser Gln Asp Tyr Gln Cvs Ser Ala Leu Met Gly
Gly Arg Lys Val Met Ser Ile Ser Ile Arg Leu Lys Val Gln Lys Val Ile
Pro Gly Pro Pro Ala Leu Thr Leu Val Pro Ala Glu Leu Val Arg Ile Arg
Gly Gln Ala Ala Gln Ile Val Cys Ser Ala Ser Ser Val Asp Val Asn Phe
Asp Val Phe Leu Gln His Asn Ass Thr Lys Leu Ala Ile Pro Gln Gln Ser
Asp Phe His Asn Asn Arg Tyr Gln Lys Val Leu Thr Leu Asn Leu Asp Gln
Val Asp Phe Gln His Ala Gly Asn Tyr Ser Cys Val Ala Ser Asn Val Gln
Gly Lys His Ser Thr Ser Met Phe Phe Arg Val Val Gln Ser Ala Tyr Leu
Asn Leu Ser Ser Gln Gln Asn Leu Ile Gln Glu Val Thr Val Gly Gln Gly
Leu Asn Leu Lys Val Met Val Glu Ala Tyr Pro Gly Leu Gln Gly Phe Asn
Trp Thr Tyr Leu Gly Pro Phe Ser Asp His Gln Pro Gln Pro Lye Leu Ala
Asn Ala Thr Thr Lys Asp Thr Tyr Arg His Thr Phe Thr Leu Ser Leu Pro
Arg Leu Lys Pro Ser Gln Ala Gly Arg Tyr Ser Phe Leu Ala Arg Asn Pro
Gly Gly Trp Arg Ala Leu Thr Phe Gln Leu Thr Leu Arq Tyr Pro Pro Glu
Val Ser Val Ile Trp Thr Phe Ile Asn Gly Ser Gly Thr Leu Leu Cys Ala
Ala Ser Gly Tyr Pro Gln Pro Asn Val Thr Trp Leu Gln Cys Ser Gly His
Thr Asp Arg Cys Asp Gln Ala Gln Val Leu Gln Val Trp Asp Asp Pro Tyr
Pro Gln Val Leu Ser Gln Gln Pro Phe His Lys Val Thr Val Gln Ser Leu
Leu Thr Val Gln Thr Leu Glu His Asn Gln Thr Tyr Gln Cys Arg Ala His
Asn Ser Val Gly Ser Gly Ser Trp Ala Phe Ile Pro Ile Ser Ala Gly Ala
His Thr His Pro Pro Asp Glu Phe Leu Phe Thr Pro Val Val Val Ala Cys
Met Ser Ile Met Ala Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Tyr Lys
Tyr Lys Gln Lys Pro Lys Tyr Gln Val Arg Trp Lys Ile Ile Glu Ser Tyr
Glu Gly Asn Ser Tyr Thr Phe Ile Asp Pro Thr Gln Leu Pro Tyr Asn Glu
Lys Trp Glu Phe Pro Arg Asn Asn Leu Gln Phe Gly Lys Thr Leu Gly Ala
Gly Ala Phe Gly Lys Val Val Glu Ala Thr Ala Phe Gly Leu Gly Lys Glu
Asp Ala Val Leu Lys Val Ala Val Lys Met Leu Lys Ser Thr Ala His Ala
Asp Glu Lys Glu Ala Leu Met Ser Glu Leu Lys Ile Met Ser His Leu Gly
Gln His Glu Asn Ile Val Asn Leu Leu Gly Ala Cys Thr His Gly Gly Pro
Val Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu
Arg Arg Lys Ala Glu Ala Met Leu Gly Pro Ser Leu Ser Pro Gly Gln Asp
Pro Glu Gly Gly Val Asp Tyr Lys Asn Ile His Leu Glu Lys Lys Tyr Val
Arg Arg Asp Ser Gly Phe Ser Ser Gln Gly Val Asp Thr Tyr Val Glu Met
Arg Pro Val Ser Thr Ser Ser Asn Asp Ser Phe Ser Glu Gln Asp Leu Asp
Lys Glu Asp Gly Arg Pro Leu Glu Leu Arg Asp Leu Leu His Phe Ser Ser
Gln Val Ala Gln Gly Met Ala Phe Leu Ala Ser Lys Asn Cys Ile His Arg
Asp Val Ala Ala Arg Asn Val Leu Leu Thr Asn Gly His Val Ala Lys Ile
Gly Asp Phe Gly Leu Ala Arg Asp Ile Met Asn Asp Ser Asn Tyr Ile Val
Lys Gly Asn Ala Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ser Ile Phe
Asp Cys Val Tyr Thr Val Gln Ser Asp Val Trp Ser Tyr Gly Ile Leu Leu
Trp Glu Ile Phe Ser Leu Gly Leu Asn Pro Tyr Pro Gly Ile Leu Val Asn
Ser Lys Phe Tyr Lys Leu Val Lys Asp Gly Tyr Gln Met Ala Gln Pro Ala
Phe Ala Pro Lys Asn Ile Tyr Ser Ile Met Gln Ala Cys Trp Ala Leu Glu
Pro Thr His Arg Pro Thr Phe Gln Gln Ile Cys Ser Phe Leu Gln Glu Gln
Ala Gln Glu Asp Arg Arg Glu Arg Asp Tyr Thr Asn Leu Pro Ser Ser Ser
Arg Ser Gly Gly Ser Gly Ser Ser Ser Ser Glu Leu Glu Glu Glu Ser Ser
Ser Glu His Leu Thr Cys Cys Glu Gln Gly Asp Ile Ala Gln Pro Leu Leu
Gln Pro Asn Asn Tyr Gln Phe Cys SEQ ID NO: 4 Sequence NM_005211 1
gaagggcaga cagagtgtcc aaaagcgtga gagcacgaag tgaggagaag gtggagaaga
61 gagaagagga agaggaagag gaagagagga agcggaggga actgcggcca
ggctaaaagg 121 ggaagaagag gatcagccca aggaggagga agaggaaaac
aagacaaaca gccagtgcag 181 aggagaggaa cgtgtgtcca gtgtcccgat
ccctgcggag ctagtagctg agagctctgt 241 gccctgggca ccttgcagcc
ctgcacctgc ctgccacttc cccaccgagg ccatgggccc 301 aggagttctg
ctgctcctgc tggtggccac agcttggcat ggtcagggaa tcccagtgat 361
agagcccagt gtccctgagc tggtcgtgaa gccaggagca acggtgacct tgcgatgtgt
421 gggcaatggc agcgtggaat gggatggccc cccatcacct cactggaccc
tgtactctga 481 tggctccagc agcatcctca gcaccaacaa cgctaccttc
caaaacacgg ggacctatcg 541 ctgcactgag cctggagacc ccctgggagg
cagcgccgcc atccacctct atgtcaaaga 601 ccctgcccgg ccctggaacg
tgctagcaca ggaggtggtc gtgttcgagg accaggacgc 661 actactgccc
tgtctgctca cagacccggt gctggaagca ggcgtctcgc tggtgcgtgt 721
gcgtggccgg cccctcatgc gccacaccaa ctactccttc tcgccctggc atggcttcac
781 catccacagg gccaagttca ttcagagcca ggactatcaa tgcagtgccc
tgatgggtgg 841 caggaaggtg atgtccatca gcatccggct gaaagtgcag
aaagtcatcc cagggccccc 901 agccttgaca ctggtgcctg cagagctggt
gcggattcga ggggaggctg cccagatcgt 961 gtgctcagcc agcagcgttg
atgttaactt tgatgtcttc ctccaacaca acaacaccaa 1021 gctcgcaatc
cctcaacaat ctgactttca taataaccgt taccaaaaag tcctgaccct 1081
caacctcgat caagtagatt tccaacatgc cggcaactac tcctgcgtgg ccagcaacgt
1141 gcagggcaag cactccacct ccatgttctt ccgggtggta gagagtgcct
acttgaactt 1201 gagctctgag cagaacctca tccaggaggt gaccgtgggg
gaggggctca acctcaaagt 1261 catggtggag gcctacccag gcctgcaagg
ttttaactgg acctacctgg gacccttttc 1321 tgaccaccag cctgagccca
agcttgctaa tgctaccacc aaggacacat acaggcacac
1381 cttcaccctc tctctgcccc gcctgaagcc ctctgaggct ggccgctact
ccttcctggc 1441 cagaaaccca ggaggctgga gagctctgac gtttgagctc
acccttcgat accccccaga 1501 ggtaagcgtc atatggacat tcatcaacgg
ctctggcacc cttttgtgtg ctgcctctgg 1561 gtacccccag cccaacgtga
catggctgca gtgcagtggc cacactgata ggtgtgatga 1621 ggcccaagtg
ctgcaggtct gggatgaccc ataccctgag gtcctgagcc aggagccctt 1681
ccacaaggtg acggtgcaga gcctgctgac tgttgagacc ttagagcaca accaaaccta
1741 cgagtgcagg gcccacaaca gcgtggggag tggctcctgg gccttcatac
ccatctctgc 1801 aggagcccac acgcatcccc cggatgagtt cctcttcaca
ccagtggtgg tcgcctgcat 1861 gtccatcatg gccttgctgc tgctgctgct
cctgctgcta ttgtacaagt ataagcagaa 1921 gcccaagtac caggtccgct
ggaagatcat cgagagctat gagggcaaca gttatacttt 1981 catcgacccc
acgcagctgc cttacaacga gaagtgggag ttcccccgga acaacctgca 2041
gtttggtaag accctcggag ctggagcctt tgggaaggtg gtggaggcca cggcctttgg
2101 tctgggcaag gaggatgctg tcctgaaggt ggctgtgaag atgctgaagt
ccacggccca 2161 tgctgatgag aaggaggccc tcatgtccga gctgaagatc
atgagccacc tgggccagca 2221 cgagaacatc gtcaaccttc tgggagcctg
tacccatgga ggccctgtac tggtcatcac 2281 ggagtactgt tgctatggcg
acctgctcaa cttcctgcga aggaaggctg aggccatgct 2341 gggacccagc
ctgagccccg gccaggaccc cgagggaggc gtcgactata agaacatcca 2401
cctcgagaag aaatatgtcc gcagggacag tggcttctcc agccagggtg tggacaccta
2461 tgtggagatg aggcctgtct ccacttcttc aaatgactcc ttctctgagc
aagacctgga 2521 caaggaggat ggacggcccc tggagctccg ggacctgctt
cacttctcca gccaagtagc 2581 ccagggcatg gccttcctcg cttccaagaa
ttgcatccac cgggacgtgg cagcgcgtaa 2641 cgtgctgttg accaatggtc
atgtggccaa gattggggac ttcgggctgg ctagggacat 2701 catgaatgac
tccaactaca ttgtcaaggg caatgcccgc ctgcctgtga agtggatggc 2761
cccagagagc atctttgact gtgtctacac ggttcagagc gacgtctggt cctatggcat
2821 cctcctctgg gagatcttct cacttgggct gaatccctac cctggcatcc
tggtgaacag 2881 caagttctat aaactggtga aggatggata ccaaatggcc
cagcctgcat ttgccccaaa 2941 gaatatatac agcatcatgc aggcctgctg
ggccttggag cccacccaca gacccacctt 3001 ccagcagatc tgctccttcc
ttcaggagca ggcccaagag gacaggagag agcgggacta 3061 taccaatctg
ccgagcagca gcagaagcgg tggcagcggc agcagcagca gcgagctgga 3121
ggaggagagc tctagtgagc acctgacctg ctgcgagcaa ggggatatcg cccagccctt
3181 gctgcagccc aacaactatc agttctgctg aggagttgac gacagggagt
accactctcc 3241 cctcctccaa acttcaactc ctccatggat ggggcgacac
ggggagaaca tacaaactct 3301 gccttcggtc atttcactca acagctcggc
ccagctctga aacttgggaa ggtgagggat 3361 tcaggggagg tcagaggatc
ccacttcctg agcatgggcc atcactgcca gtcaggggct 3421 gggggctgag
ccctcacccc cccctcccct actgttctca tggtgttggc ctcgtgtttg 3481
ctatgccaac tagtagaacc ttctttccta atccccttat cttcatggaa atggactgac
3541 tttatgccta tgaagtcccc aggagctaca ctgatactga gaaaaccagg
ctctttgggg 3601 ctagacagac tggcagagag tgagatctcc ctctctgaga
ggagcagcag atgctcacag 3661 accacactca gctcaggccc cttggagcag
gatggctcct ctaagaatct cacaggacct 3721 cttagtctct gccctatacg
ccgccttcac tccacagcct cacccctccc acccccatac 3781 tggtactgct
gtaatgagcc aagtggcagc taaaagttgg gggtgttctg cccagtcccg 3841
tcattctggg ctagaaggca ggggaccttg gcatgtggct ggccacacca agcaggaagc
3901 acaaactccc ccaagctgac tcatcctaac taacagtcac gccgtgggat
gtctctgtcc 3961 acattaaact aacagcatta atgca
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 66 <210> SEQ ID NO 1 <211> LENGTH: 976 <212>
TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE:
1 Met Arg Gly Ala Arg Gly Ala Trp Asp Phe Leu Cys Val Leu Leu Leu 1
5 10 15 Leu Leu Arg Val Gln Thr Gly Ser Ser Gln Pro Ser Val Ser Pro
Gly 20 25 30 Glu Pro Ser Pro Pro Ser Ile His Pro Gly Lys Ser Asp
Leu Ile Val 35 40 45 Arg Val Gly Asp Glu Ile Arg Leu Leu Cys Thr
Asp Pro Gly Phe Val 50 55 60 Lys Trp Thr Phe Glu Ile Leu Asp Glu
Thr Asn Glu Asn Lys Gln Asn 65 70 75 80 Glu Trp Ile Thr Glu Lys Ala
Glu Ala Thr Asn Thr Gly Lys Tyr Thr 85 90 95 Cys Thr Asn Lys His
Gly Leu Ser Asn Ser Ile Tyr Val Phe Val Arg 100 105 110 Asp Pro Ala
Lys Leu Phe Leu Val Asp Arg Ser Leu Tyr Gly Lys Glu 115 120 125 Asp
Asn Asp Thr Leu Val Arg Cys Pro Leu Thr Asp Pro Glu Val Thr 130 135
140 Asn Tyr Ser Leu Lys Gly Cys Gln Gly Lys Pro Leu Pro Lys Asp Leu
145 150 155 160 Arg Phe Ile Pro Asp Pro Lys Ala Gly Ile Met Ile Lys
Ser Val Lys 165 170 175 Arg Ala Tyr His Arg Leu Cys Leu His Cys Ser
Val Asp Gln Glu Gly 180 185 190 Lys Ser Val Leu Ser Glu Lys Phe Ile
Leu Lys Val Arg Pro Ala Phe 195 200 205 Lys Ala Val Pro Val Val Ser
Val Ser Lys Ala Ser Tyr Leu Leu Arg 210 215 220 Glu Gly Glu Glu Phe
Thr Val Thr Cys Thr Ile Lys Asp Val Ser Ser 225 230 235 240 Ser Val
Tyr Ser Thr Trp Lys Arg Glu Asn Ser Gln Thr Lys Leu Gln 245 250 255
Glu Lys Tyr Asn Ser Trp His His Gly Asp Phe Asn Tyr Glu Arg Gln 260
265 270 Ala Thr Leu Thr Ile Ser Ser Ala Arg Val Asn Asp Ser Gly Val
Phe 275 280 285 Met Cys Tyr Ala Asn Asn Thr Phe Gly Ser Ala Asn Val
Thr Thr Thr 290 295 300 Leu Glu Val Val Asp Lys Gly Phe Ile Asn Ile
Phe Pro Met Ile Asn 305 310 315 320 Thr Thr Val Phe Val Asn Asp Gly
Glu Asn Val Asp Leu Ile Val Glu 325 330 335 Tyr Glu Ala Phe Pro Lys
Pro Glu His Gln Gln Trp Ile Tyr Met Asn 340 345 350 Arg Thr Phe Thr
Asp Lys Trp Glu Asp Tyr Pro Lys Ser Glu Asn Glu 355 360 365 Ser Asn
Ile Arg Tyr Val Ser Glu Leu His Leu Thr Arg Leu Lys Gly 370 375 380
Thr Glu Gly Gly Thr Tyr Thr Phe Leu Val Ser Asn Ser Asp Val Asn 385
390 395 400 Ala Ala Ile Ala Phe Asn Val Tyr Val Asn Thr Lys Pro Glu
Ile Leu 405 410 415 Thr Tyr Asp Arg Leu Val Asn Gly Met Leu Gln Cys
Val Ala Ala Gly 420 425 430 Phe Pro Glu Pro Thr Ile Asp Trp Tyr Phe
Cys Pro Gly Thr Glu Gln 435 440 445 Arg Cys Ser Ala Ser Val Leu Pro
Val Asp Val Gln Thr Leu Asn Ser 450 455 460 Ser Gly Pro Pro Phe Gly
Lys Leu Val Val Gln Ser Ser Ile Asp Ser 465 470 475 480 Ser Ala Phe
Lys His Asn Gly Thr Val Glu Cys Lys Ala Tyr Asn Asp 485 490 495 Val
Gly Lys Thr Ser Ala Tyr Phe Asn Phe Ala Phe Lys Gly Asn Asn 500 505
510 Lys Glu Gln Ile His Pro His Thr Leu Phe Thr Pro Leu Leu Ile Gly
515 520 525 Phe Val Ile Val Ala Gly Met Met Cys Ile Ile Val Met Ile
Leu Thr 530 535 540 Tyr Lys Tyr Leu Gln Lys Pro Met Tyr Glu Val Gln
Trp Lys Val Val 545 550 555 560 Glu Glu Ile Asn Gly Asn Asn Tyr Val
Tyr Ile Asp Pro Thr Gln Leu 565 570 575 Pro Tyr Asp His Lys Trp Glu
Phe Pro Arg Asn Arg Leu Ser Phe Gly 580 585 590 Lys Thr Leu Gly Ala
Gly Ala Phe Gly Lys Val Val Glu Ala Thr Ala 595 600 605 Tyr Gly Leu
Ile Lys Ser Asp Ala Ala Met Thr Val Ala Val Lys Met 610 615 620 Leu
Lys Pro Ser Ala His Leu Thr Glu Arg Glu Ala Leu Met Ser Glu 625 630
635 640 Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met Asn Ile Val Asn
Leu 645 650 655 Leu Gly Ala Cys Thr Ile Gly Gly Pro Thr Leu Val Ile
Thr Glu Tyr 660 665 670 Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu Arg
Arg Lys Arg Asp Ser 675 680 685 Phe Ile Cys Ser Lys Gln Glu Asp His
Ala Glu Ala Ala Leu Tyr Lys 690 695 700 Asn Leu Leu His Ser Lys Glu
Ser Ser Cys Ser Asp Ser Thr Asn Glu 705 710 715 720 Tyr Met Asp Met
Lys Pro Gly Val Ser Tyr Val Val Pro Thr Lys Ala 725 730 735 Asp Lys
Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu Arg Asp Val 740 745 750
Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu Glu Asp 755
760 765 Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala Phe Leu
Ala 770 775 780 Ser Lys Asn Cys Ile His Arg Asp Leu Ala Ala Arg Asn
Ile Leu Leu 785 790 795 800 Thr His Gly Arg Ile Thr Lys Ile Cys Asp
Phe Gly Leu Ala Arg Asp 805 810 815 Ile Lys Asn Asp Ser Asn Tyr Val
Val Lys Gly Asn Ala Arg Leu Pro 820 825 830 Val Lys Trp Met Ala Pro
Glu Ser Ile Phe Asn Cys Val Tyr Thr Phe 835 840 845 Glu Ser Asp Val
Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe Ser 850 855 860 Leu Gly
Ser Ser Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe Tyr 865 870 875
880 Lys Met Ile Lys Glu Gly Phe Arg Met Leu Ser Pro Glu His Ala Pro
885 890 895 Ala Glu Met Tyr Asp Ile Met Lys Thr Cys Trp Asp Ala Asp
Pro Leu 900 905 910 Lys Arg Pro Thr Phe Lys Gln Ile Val Gln Leu Ile
Glu Lys Gln Ile 915 920 925 Ser Glu Ser Thr Asn His Ile Tyr Ser Asn
Leu Ala Asn Cys Ser Pro 930 935 940 Asn Arg Gln Lys Pro Val Val Asp
His Ser Val Arg Ile Asn Ser Val 945 950 955 960 Gly Ser Thr Ala Ser
Ser Ser Gln Pro Leu Leu Val His Asp Asp Val 965 970 975 <210>
SEQ ID NO 2 <211> LENGTH: 5084 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 2
gatcccatcg cagctaccgc gatgagaggc gctcgcggcg cctgggattt tctctgcgtt
60 ctgctcctac tgcttcgcgt ccagacaggc tcttctcaac catctgtgag
tccaggggaa 120 ccgtctccac catccatcca tccaggaaaa tcagacttaa
tagtccgcgt gggcgacgag 180 attaggctgt tatgcactga tccgggcttt
gtcaaatgga cttttgagat cctggatgaa 240 acgaatgaga ataagcagaa
tgaatggatc acggaaaagg cagaagccac caacaccggc 300 aaatacacgt
gcaccaacaa acacggctta agcaattcca tttatgtgtt tgttagagat 360
cctgccaagc ttttccttgt tgaccgctcc ttgtatggga aagaagacaa cgacacgctg
420 gtccgctgtc ctctcacaga cccagaagtg accaattatt ccctcaaggg
gtgccagggg 480 aagcctcttc ccaaggactt gaggtttatt cctgacccca
aggcgggcat catgatcaaa 540 agtgtgaaac gcgcctacca tcggctctgt
ctgcattgtt ctgtggacca ggagggcaag 600 tcagtgctgt cggaaaaatt
catcctgaaa gtgaggccag ccttcaaagc tgtgcctgtt 660 gtgtctgtgt
ccaaagcaag ctatcttctt agggaagggg aagaattcac agtgacgtgc 720
acaataaaag atgtgtctag ttctgtgtac tcaacgtgga aaagagaaaa cagtcagact
780 aaactacagg agaaatataa tagctggcat cacggtgact tcaattatga
acgtcaggca 840 acgttgacta tcagttcagc gagagttaat gattctggag
tgttcatgtg ttatgccaat 900 aatacttttg gatcagcaaa tgtcacaaca
accttggaag tagtagataa aggattcatt 960 aatatcttcc ccatgataaa
cactacagta tttgtaaacg atggagaaaa tgtagatttg 1020 attgttgaat
atgaagcatt ccccaaacct gaacaccagc agtggatcta tatgaacaga 1080
accttcactg ataaatggga agattatccc aagtctgaga atgaaagtaa tatcagatac
1140 gtaagtgaac ttcatctaac gagattaaaa ggcaccgaag gaggcactta
cacattccta 1200 gtgtccaatt ctgacgtcaa tgctgccata gcatttaatg
tttatgtgaa tacaaaacca 1260 gaaatcctga cttacgacag gctcgtgaat
ggcatgctcc aatgtgtggc agcaggattc 1320 ccagagccca caatagattg
gtatttttgt ccaggaactg agcagagatg ctctgcttct 1380 gtactgccag
tggatgtgca gacactaaac tcatctgggc caccgtttgg aaagctagtg 1440
gttcagagtt ctatagattc tagtgcattc aagcacaatg gcacggttga atgtaaggct
1500 tacaacgatg tgggcaagac ttctgcctat tttaactttg catttaaagg
taacaacaaa 1560 gagcaaatcc atccccacac cctgttcact cctttgctga
ttggtttcgt aatcgtagct 1620 ggcatgatgt gcattattgt gatgattctg
acctacaaat atttacagaa acccatgtat 1680 gaagtacagt ggaaggttgt
tgaggagata aatggaaaca attatgttta catagaccca 1740 acacaacttc
cttatgatca caaatgggag tttcccagaa acaggctgag ttttgggaaa 1800
accctgggtg ctggagcttt cgggaaggtt gttgaggcaa ctgcttatgg cttaattaag
1860 tcagatgcgg ccatgactgt cgctgtaaag atgctcaagc cgagtgccca
tttgacagaa 1920 cgggaagccc tcatgtctga actcaaagtc ctgagttacc
ttggtaatca catgaatatt 1980 gtgaatctac ttggagcctg caccattgga
gggcccaccc tggtcattac agaatattgt 2040 tgctatggtg atcttttgaa
ttttttgaga agaaaacgtg attcatttat ttgttcaaag 2100 caggaagatc
atgcagaagc tgcactttat aagaatcttc tgcattcaaa ggagtcttcc 2160
tgcagcgata gtactaatga gtacatggac atgaaacctg gagtttctta tgttgtccca
2220 accaaggccg acaaaaggag atctgtgaga ataggctcat acatagaaag
agatgtgact 2280 cccgccatca tggaggatga cgagttggcc ctagacttag
aagacttgct gagcttttct 2340 taccaggtgg caaagggcat ggctttcctc
gcctccaaga attgtattca cagagacttg 2400 gcagccagaa atatcctcct
tactcatggt cggatcacaa agatttgtga ttttggtcta 2460 gccagagaca
tcaagaatga ttctaattat gtggttaaag gaaacgctcg actacctgtg 2520
aagtggatgg cacctgaaag cattttcaac tgtgtataca cgtttgaaag tgacgtctgg
2580 tcctatggga tttttctttg ggagctgttc tctttaggaa gcagccccta
tcctggaatg 2640 ccggtcgatt ctaagttcta caagatgatc aaggaaggct
tccggatgct cagccctgaa 2700 cacgcacctg ctgaaatgta tgacataatg
aagacttgct gggatgcaga tcccctaaaa 2760 agaccaacat tcaagcaaat
tgttcagcta attgagaagc agatttcaga gagcaccaat 2820 catatttact
ccaacttagc aaactgcagc cccaaccgac agaagcccgt ggtagaccat 2880
tctgtgcgga tcaattctgt cggcagcacc gcttcctcct cccagcctct gcttgtgcac
2940 gacgatgtct gagcagaatc agtgtttggg tcacccctcc aggaatgatc
tcttcttttg 3000 gcttccatga tggttatttt cttttctttc aacttgcatc
caactccagg atagtgggca 3060 ccccactgca atcctgtctt tctgagcaca
ctttagtggc cgatgatttt tgtcatcagc 3120 caccatccta ttgcaaaggt
tccaactgta tatattccca atagcaacgt agcttctacc 3180 atgaacagaa
aacattctga tttggaaaaa gagagggagg tatggactgg gggccagagt 3240
cctttccaag gcttctccaa ttctgcccaa aaatatggtt gatagtttac ctgaataaat
3300 ggtagtaatc acagttggcc ttcagaacca tccatagtag tatgatgata
caagattaga 3360 agctgaaaac ctaagtcctt tatgtggaaa acagaacatc
attagaacaa aggacagagt 3420 atgaacacct gggcttaaga aatctagtat
ttcatgctgg gaatgagaca taggccatga 3480 aaaaaatgat ccccaagtgt
gaacaaaaga tgctcttctg tggaccactg catgagcttt 3540 tatactaccg
acctggtttt taaatagagt ttgctattag agcattgaat tggagagaag 3600
gcctccctag ccagcacttg tatatacgca tctataaatt gtccgtgttc atacatttga
3660 ggggaaaaca ccataaggtt tcgtttctgt atacaaccct ggcattatgt
ccactgtgta 3720 tagaagtaga ttaagagcca tataagtttg aaggaaacag
ttaataccat tttttaagga 3780 aacaatataa ccacaaagca cagtttgaac
aaaatctcct cttttagctg atgaacttat 3840 tctgtagatt ctgtggaaca
agcctatcag cttcagaatg gcattgtact caatggattt 3900 gatgctgttt
gacaaagtta ctgattcact gcatggctcc cacaggagtg ggaaaacact 3960
gccatcttag tttggattct tatgtagcag gaaataaagt ataggtttag cctccttcgc
4020 aggcatgtcc tggacaccgg gccagtatct atatatgtgt atgtacgttt
gtatgtgtgt 4080 agacaaatat ttggaggggt atttttgccc tgagtccaag
agggtccttt agtacctgaa 4140 aagtaacttg gctttcatta ttagtactgc
tcttgtttct tttcacatag ctgtctagag 4200 tagcttacca gaagcttcca
tagtggtgca gaggaagtgg aaggcatcag tccctatgta 4260 tttgcagttc
acctgcactt aaggcactct gttatttaga ctcatcttac tgtacctgtt 4320
ccttagacct tccataatgc tactgtctca ctgaaacatt taaattttac cctttagact
4380 gtagcctgga tattattctt gtagtttacc tctttaaaaa caaaacaaaa
caaaacaaaa 4440 aactcccctt cctcactgcc caatataaaa ggcaaatgtg
tacatggcag agtttgtgtg 4500 ttgtcttgaa agattcaggt atgttgcctt
tatggtttcc cccttctaca tttcttagac 4560 tacatttaga gaactgtggc
cgttatctgg aagtaaccat ttgcactgga gttctatgct 4620 ctcgcacctt
tccaaagtta acagattttg gggttgtgtt gtcacccaag agattgttgt 4680
ttgccatact ttgtctgaaa aattcctttg tgtttctatt gacttcaatg atagtaagaa
4740 aagtggttgt tagttataga tgtctaggta cttcaggggc acttcattga
gagttttgtc 4800 ttgccatact ttgtctgaaa aattcctttg tgtttctatt
gacttcaatg atagtaagaa 4860 aagtggttgt tagttataga tgtctaggta
cttcaggggc acttcattga gagttttgtc 4920 aatgtctttt gaatattccc
aagcccatga gtccttgaaa atatttttta tatatacagt 4980 aactttatgt
gtaaatacat aagcggcgta agtttaaagg atgttggtgt tccacgtgtt 5040
ttattcctgt atgttgtcca attgttgaca gttctgaaga attc 5084 <210>
SEQ ID NO 3 <211> LENGTH: 972 <212> TYPE: PRT
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 Met Gly
Pro Gly Val Leu Leu Leu Leu Leu Val Ala Thr Ala Trp His 1 5 10 15
Gly Gln Gly Ile Pro Val Ile Glu Pro Ser Val Pro Glu Leu Val Val 20
25 30 Lys Pro Gly Ala Thr Val Thr Leu Arg Cys Val Gly Asn Gly Ser
Val 35 40 45 Glu Trp Asp Gly Pro Pro Ser Pro His Trp Thr Leu Tyr
Ser Asp Gly 50 55 60 Ser Ser Ser Ile Leu Ser Thr Asn Asn Ala Thr
Phe Gln Asn Thr Gly 65 70 75 80 Thr Tyr Arg Cys Thr Glu Pro Gly Asp
Pro Leu Gly Gly Ser Ala Ala 85 90 95 Ile His Leu Tyr Val Lys Asp
Pro Ala Arg Pro Trp Asn Val Leu Ala 100 105 110 Gln Glu Val Val Val
Phe Glu Asp Gln Asp Ala Leu Leu Pro Cys Leu 115 120 125 Leu Thr Asp
Pro Val Leu Glu Ala Gly Val Ser Leu Val Arg Val Arg 130 135 140 Gly
Arg Pro Leu Met Arg His Thr Asn Tyr Ser Phe Ser Pro Trp His 145 150
155 160 Gly Phe Thr Ile His Arg Ala Lys Phe Ile Gln Ser Gln Asp Tyr
Gln 165 170 175 Cys Ser Ala Leu Met Gly Gly Arg Lys Val Met Ser Ile
Ser Ile Arg 180 185 190 Leu Lys Val Gln Lys Val Ile Pro Gly Pro Pro
Ala Leu Thr Leu Val 195 200 205 Pro Ala Glu Leu Val Arg Ile Arg Gly
Glu Ala Ala Gln Ile Val Cys 210 215 220 Ser Ala Ser Ser Val Asp Val
Asn Phe Asp Val Phe Leu Gln His Asn 225 230 235 240 Asn Thr Lys Leu
Ala Ile Pro Gln Gln Ser Asp Phe His Asn Asn Arg 245 250 255 Tyr Gln
Lys Val Leu Thr Leu Asn Leu Asp Gln Val Asp Phe Gln His 260 265 270
Ala Gly Asn Tyr Ser Cys Val Ala Ser Asn Val Gln Gly Lys His Ser 275
280 285 Thr Ser Met Phe Phe Arg Val Val Glu Ser Ala Tyr Leu Asn Leu
Ser 290 295 300 Ser Glu Gln Asn Leu Ile Gln Glu Val Thr Val Gly Glu
Gly Leu Asn 305 310 315 320 Leu Lys Val Met Val Glu Ala Tyr Pro Gly
Leu Gln Gly Phe Asn Trp 325 330 335 Thr Tyr Leu Gly Pro Phe Ser Asp
His Gln Pro Glu Pro Lys Leu Ala 340 345 350 Asn Ala Thr Thr Lys Asp
Thr Tyr Arg His Thr Phe Thr Leu Ser Leu 355 360 365 Pro Arg Leu Lys
Pro Ser Glu Ala Gly Arg Tyr Ser Phe Leu Ala Arg 370 375 380 Asn Pro
Gly Gly Trp Arg Ala Leu Thr Phe Glu Leu Thr Leu Arg Tyr 385 390 395
400 Pro Pro Glu Val Ser Val Ile Trp Thr Phe Ile Asn Gly Ser Gly Thr
405 410 415 Leu Leu Cys Ala Ala Ser Gly Tyr Pro Gln Pro Asn Val Thr
Trp Leu 420 425 430 Gln Cys Ser Gly His Thr Asp Arg Cys Asp Glu Ala
Gln Val Leu Gln 435 440 445 Val Trp Asp Asp Pro Tyr Pro Glu Val Leu
Ser Gln Glu Pro Phe His 450 455 460 Lys Val Thr Val Gln Ser Leu Leu
Thr Val Glu Thr Leu Glu His Asn 465 470 475 480 Gln Thr Tyr Glu Cys
Arg Ala His Asn Ser Val Gly Ser Gly Ser Trp 485 490 495 Ala Phe Ile
Pro Ile Ser Ala Gly Ala His Thr His Pro Pro Asp Glu 500 505 510 Phe
Leu Phe Thr Pro Val Val Val Ala Cys Met Ser Ile Met Ala Leu 515 520
525 Leu Leu Leu Leu Leu Leu Leu Leu Leu Tyr Lys Tyr Lys Gln Lys Pro
530 535 540 Lys Tyr Gln Val Arg Trp Lys Ile Ile Glu Ser Tyr Glu Gly
Asn Ser 545 550 555 560 Tyr Thr Phe Ile Asp Pro Thr Gln Leu Pro Tyr
Asn Glu Lys Trp Glu 565 570 575 Phe Pro Arg Asn Asn Leu Gln Phe Gly
Lys Thr Leu Gly Ala Gly Ala 580 585 590 Phe Gly Lys Val Val Glu Ala
Thr Ala Phe Gly Leu Gly Lys Glu Asp 595 600 605 Ala Val Leu Lys Val
Ala Val Lys Met Leu Lys Ser Thr Ala His Ala 610 615 620 Asp Glu Lys
Glu Ala Leu Met Ser Glu Leu Lys Ile Met Ser His Leu 625 630 635 640
Gly Gln His Glu Asn Ile Val Asn Leu Leu Gly Ala Cys Thr His Gly 645
650 655 Gly Pro Val Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu
Leu 660 665 670 Asn Phe Leu Arg Arg Lys Ala Glu Ala Met Leu Gly Pro
Ser Leu Ser 675 680 685 Pro Gly Gln Asp Pro Glu Gly Gly Val Asp Tyr
Lys Asn Ile His Leu 690 695 700 Glu Lys Lys Tyr Val Arg Arg Asp Ser
Gly Phe Ser Ser Gln Gly Val 705 710 715 720 Asp Thr Tyr Val Glu Met
Arg Pro Val Ser Thr Ser Ser Asn Asp Ser 725 730 735 Phe Ser Glu Gln
Asp Leu Asp Lys Glu Asp Gly Arg Pro Leu Glu Leu 740 745 750 Arg Asp
Leu Leu His Phe Ser Ser Gln Val Ala Gln Gly Met Ala Phe 755 760 765
Leu Ala Ser Lys Asn Cys Ile His Arg Asp Val Ala Ala Arg Asn Val 770
775 780 Leu Leu Thr Asn Gly His Val Ala Lys Ile Gly Asp Phe Gly Leu
Ala 785 790 795 800 Arg Asp Ile Met Asn Asp Ser Asn Tyr Ile Val Lys
Gly Asn Ala Arg 805 810 815 Leu Pro Val Lys Trp Met Ala Pro Glu Ser
Ile Phe Asp Cys Val Tyr 820 825 830 Thr Val Gln Ser Asp Val Trp Ser
Tyr Gly Ile Leu Leu Trp Glu Ile 835 840 845 Phe Ser Leu Gly Leu Asn
Pro Tyr Pro Gly Ile Leu Val Asn Ser Lys 850 855 860 Phe Tyr Lys Leu
Val Lys Asp Gly Tyr Gln Met Ala Gln Pro Ala Phe 865 870 875 880 Ala
Pro Lys Asn Ile Tyr Ser Ile Met Gln Ala Cys Trp Ala Leu Glu 885 890
895 Pro Thr His Arg Pro Thr Phe Gln Gln Ile Cys Ser Phe Leu Gln Glu
900 905 910 Gln Ala Gln Glu Asp Arg Arg Glu Arg Asp Tyr Thr Asn Leu
Pro Ser 915 920 925 Ser Ser Arg Ser Gly Gly Ser Gly Ser Ser Ser Ser
Glu Leu Glu Glu 930 935 940 Glu Ser Ser Ser Glu His Leu Thr Cys Cys
Glu Gln Gly Asp Ile Ala 945 950 955 960 Gln Pro Leu Leu Gln Pro Asn
Asn Tyr Gln Phe Cys 965 970 <210> SEQ ID NO 4 <211>
LENGTH: 3985 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 4 gaagggcaga cagagtgtcc aaaagcgtga
gagcacgaag tgaggagaag gtggagaaga 60 gagaagagga agaggaagag
gaagagagga agcggaggga actgcggcca ggctaaaagg 120 ggaagaagag
gatcagccca aggaggagga agaggaaaac aagacaaaca gccagtgcag 180
aggagaggaa cgtgtgtcca gtgtcccgat ccctgcggag ctagtagctg agagctctgt
240 gccctgggca ccttgcagcc ctgcacctgc ctgccacttc cccaccgagg
ccatgggccc 300 aggagttctg ctgctcctgc tggtggccac agcttggcat
ggtcagggaa tcccagtgat 360 agagcccagt gtccctgagc tggtcgtgaa
gccaggagca acggtgacct tgcgatgtgt 420 gggcaatggc agcgtggaat
gggatggccc cccatcacct cactggaccc tgtactctga 480 tggctccagc
agcatcctca gcaccaacaa cgctaccttc caaaacacgg ggacctatcg 540
ctgcactgag cctggagacc ccctgggagg cagcgccgcc atccacctct atgtcaaaga
600 ccctgcccgg ccctggaacg tgctagcaca ggaggtggtc gtgttcgagg
accaggacgc 660 actactgccc tgtctgctca cagacccggt gctggaagca
ggcgtctcgc tggtgcgtgt 720 gcgtggccgg cccctcatgc gccacaccaa
ctactccttc tcgccctggc atggcttcac 780 catccacagg gccaagttca
ttcagagcca ggactatcaa tgcagtgccc tgatgggtgg 840 caggaaggtg
atgtccatca gcatccggct gaaagtgcag aaagtcatcc cagggccccc 900
agccttgaca ctggtgcctg cagagctggt gcggattcga ggggaggctg cccagatcgt
960 gtgctcagcc agcagcgttg atgttaactt tgatgtcttc ctccaacaca
acaacaccaa 1020 gctcgcaatc cctcaacaat ctgactttca taataaccgt
taccaaaaag tcctgaccct 1080 caacctcgat caagtagatt tccaacatgc
cggcaactac tcctgcgtgg ccagcaacgt 1140 gcagggcaag cactccacct
ccatgttctt ccgggtggta gagagtgcct acttgaactt 1200 gagctctgag
cagaacctca tccaggaggt gaccgtgggg gaggggctca acctcaaagt 1260
catggtggag gcctacccag gcctgcaagg ttttaactgg acctacctgg gacccttttc
1320 tgaccaccag cctgagccca agcttgctaa tgctaccacc aaggacacat
acaggcacac 1380 cttcaccctc tctctgcccc gcctgaagcc ctctgaggct
ggccgctact ccttcctggc 1440 cagaaaccca ggaggctgga gagctctgac
gtttgagctc acccttcgat accccccaga 1500 ggtaagcgtc atatggacat
tcatcaacgg ctctggcacc cttttgtgtg ctgcctctgg 1560 gtacccccag
cccaacgtga catggctgca gtgcagtggc cacactgata ggtgtgatga 1620
ggcccaagtg ctgcaggtct gggatgaccc ataccctgag gtcctgagcc aggagccctt
1680 ccacaaggtg acggtgcaga gcctgctgac tgttgagacc ttagagcaca
accaaaccta 1740 cgagtgcagg gcccacaaca gcgtggggag tggctcctgg
gccttcatac ccatctctgc 1800 aggagcccac acgcatcccc cggatgagtt
cctcttcaca ccagtggtgg tcgcctgcat 1860 gtccatcatg gccttgctgc
tgctgctgct cctgctgcta ttgtacaagt ataagcagaa 1920 gcccaagtac
caggtccgct ggaagatcat cgagagctat gagggcaaca gttatacttt 1980
catcgacccc acgcagctgc cttacaacga gaagtgggag ttcccccgga acaacctgca
2040 gtttggtaag accctcggag ctggagcctt tgggaaggtg gtggaggcca
cggcctttgg 2100 tctgggcaag gaggatgctg tcctgaaggt ggctgtgaag
atgctgaagt ccacggccca 2160 tgctgatgag aaggaggccc tcatgtccga
gctgaagatc atgagccacc tgggccagca 2220 cgagaacatc gtcaaccttc
tgggagcctg tacccatgga ggccctgtac tggtcatcac 2280 ggagtactgt
tgctatggcg acctgctcaa ctttctgcga aggaaggctg aggccatgct 2340
gggacccagc ctgagccccg gccaggaccc cgagggaggc gtcgactata agaacatcca
2400 cctcgagaag aaatatgtcc gcagggacag tggcttctcc agccagggtg
tggacaccta 2460 tgtggagatg aggcctgtct ccacttcttc aaatgactcc
ttctctgagc aagacctgga 2520 caaggaggat ggacggcccc tggagctccg
ggacctgctt cacttctcca gccaagtagc 2580 ccagggcatg gccttcctcg
cttccaagaa ttgcatccac cgggacgtgg cagcgcgtaa 2640 cgtgctgttg
accaatggtc atgtggccaa gattggggac ttcgggctgg ctagggacat 2700
catgaatgac tccaactaca ttgtcaaggg caatgcccgc ctgcctgtga agtggatggc
2760 cccagagagc atctttgact gtgtctacac ggttcagagc gacgtctggt
cctatggcat 2820 cctcctctgg gagatcttct cacttgggct gaatccctac
cctggcatcc tggtgaacag 2880 caagttctat aaactggtga aggatggata
ccaaatggcc cagcctgcat ttgccccaaa 2940 gaatatatac agcatcatgc
aggcctgctg ggccttggag cccacccaca gacccacctt 3000 ccagcagatc
tgctccttcc ttcaggagca ggcccaagag gacaggagag agcgggacta 3060
taccaatctg ccgagcagca gcagaagcgg tggcagcggc agcagcagca gtgagctgga
3120 ggaggagagc tctagtgagc acctgacctg ctgcgagcaa ggggatatcg
cccagccctt 3180 gctgcagccc aacaactatc agttctgctg aggagttgac
gacagggagt accactctcc 3240 cctcctccaa acttcaactc ctccatggat
ggggcgacac ggggagaaca tacaaactct 3300 gccttcggtc atttcactca
acagctcggc ccagctctga aacttgggaa ggtgagggat 3360 tcaggggagg
tcagaggatc ccacttcctg agcatgggcc atcactgcca gtcaggggct 3420
gggggctgag ccctcacccc cccctcccct actgttctca tggtgttggc ctcgtgtttg
3480 ctatgccaac tagtagaacc ttctttccta atccccttat cttcatggaa
atggactgac 3540 tttatgccta tgaagtcccc aggagctaca ctgatactga
gaaaaccagg ctctttgggg 3600 ctagacagac tggcagagag tgagatctcc
ctctctgaga ggagcagcag atgctcacag 3660 accacactca gctcaggccc
cttggagcag gatggctcct ctaagaatct cacaggacct 3720 cttagtctct
gccctatacg ccgccttcac tccacagcct cacccctccc acccccatac 3780
tggtactgct gtaatgagcc aagtggcagc taaaagttgg gggtgttctg cccagtcccg
3840 tcattctggg ctagaaggca ggggaccttg gcatgtggct ggccacacca
agcaggaagc 3900 acaaactccc ccaagctgac tcatcctaac taacagtcac
gccgtgggat gtctctgtcc 3960 acattaaact aacagcatta atgca 3985
<210> SEQ ID NO 5 <211> LENGTH: 41 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 5 atgtacgaag ttcagtggaa
agttgttgaa gaaatcaacg g 41 <210> SEQ ID NO 6 <211>
LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 6 ggtcgatgta aacgtagttg ttaccgttga tttcttcaac aacttt 46
<210> SEQ ID NO 7 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 7 aacaactacg tttacatcga
cccgacccag ctgccgtacg ac 42 <210> SEQ ID NO 8 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 8 gttacgcggg aactcccatt tgtggtcgta cggcagctgg gtc 43
<210> SEQ ID NO 9 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 9 aaatgggagt tcccgcgtaa
ccgtctgtct ttcggtaaaa ccc 43 <210> SEQ ID NO 10 <211>
LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 10 accgaacgca cccgcaccca gggttttacc gaaagacaga c 41
<210> SEQ ID NO 11 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 11 ggtgcgggtg cgttcggtaa
agttgttgaa gcgaccgcgt acg 43 <210> SEQ ID NO 12 <211>
LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 12 gccgcgtcag atttgatcag accgtacgcg gtcgcttcaa c 41
<210> SEQ ID NO 13 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 13 ctgatcaaat ctgacgcggc
gatgaccgtt gcggttaaaa tgc 43 <210> SEQ ID NO 14 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 14 gtcaggtgcg cagacggttt cagcatttta accgcaacgg tca 43
<210> SEQ ID NO 15 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 15 aaaccgtctg cgcacctgac
cgaacgtgaa gcgctgatgt ctg 43 <210> SEQ ID NO 16 <211>
LENGTH: 44 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 16 ccaggtaaga cagaactttc agttcagaca tcagcgcttc acgt 44
<210> SEQ ID NO 17 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 17 ctgaaagttc tgtcttacct
gggtaaccac atgaacatcg ttaa 44 <210> SEQ ID NO 18 <211>
LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 18 ggtgcacgca cccagcaggt taacgatgtt catgtggtta c 41
<210> SEQ ID NO 19 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 19 ctgctgggtg cgtgcaccat
cggtggtccg accctggtta tca 43 <210> SEQ ID NO 20 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 20 gtcaccgtag cagcagtatt cggtgataac cagggtcgga cca 43
<210> SEQ ID NO 21 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 21 gaatactgct gctacggtga
cctgctgaac ttcctgcgtc gta 43 <210> SEQ ID NO 22 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 22 agagcagatg aaagagtcac gtttacgacg caggaagttc agc 43
<210> SEQ ID NO 23 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 23 cgtgactctt tcatctgctc
taaacaggaa gaccacgcgg aag 43 <210> SEQ ID NO 24 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 24 cagcaggttt ttgtacagcg ccgcttccgc gtggtcttcc tgt 43
<210> SEQ ID NO 25 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 25 gcgctgtaca aaaacctgct
gcactctaaa gaatcttctt gctc 44 <210> SEQ ID NO 26 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 26 ccatgtattc gttggtagag tcagagcaag aagattcttt agagt 45
<210> SEQ ID NO 27 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 27 gactctacca acgaatacat
ggacatgaaa ccgggtgttt ctta 44 <210> SEQ ID NO 28 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 28 tccgctttgg tcggaacaac gtaagaaaca cccggtttca tgt 43
<210> SEQ ID NO 29 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 29 gttgttccga ccaaagcgga
caaacgtcgt tctgttcgta tcg 43 <210> SEQ ID NO 30 <211>
LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 30 taacgtcacg ttcgatgtaa gaaccgatac gaacagaacg acgttt 46
<210> SEQ ID NO 31 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 31 tcttacatcg aacgtgacgt
taccccggcg atcatggaag acg 43 <210> SEQ ID NO 32 <211>
LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 32 ccaggtccag cgccagttcg tcgtcttcca tgatcgccgg 40
<210> SEQ ID NO 33 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 33 gaactggcgc tggacctgga
agacctgctg tctttctctt acc 43 <210> SEQ ID NO 34 <211>
LENGTH: 44 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 34 gaacgccata cctttcgcaa cctggtaaga gaaagacagc aggt 44
<210> SEQ ID NO 35 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 35 gttgcgaaag gtatggcgtt
cctggcgtct aaaaactgca tcca 44 <210> SEQ ID NO 36 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 36 cgcgccgcca ggtcacggtg gatgcagttt ttagacgcc 39
<210> SEQ ID NO 37 <211> LENGTH: 41 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 37 cgtgacctgg cggcgcgtaa
catcctgctg acccacggtc g 41 <210> SEQ ID NO 38 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 38 accgaagtcg cagattttgg tgatacgacc gtgggtcagc agg 43
<210> SEQ ID NO 39 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 39 accaaaatct gcgacttcgg
tctggcgcgt gacatcaaaa acg 43 <210> SEQ ID NO 40 <211>
LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 40 gttaccttta acaacgtagt tagagtcgtt tttgatgtca cgcgcc 46
<210> SEQ ID NO 41 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 41 tctaactacg ttgttaaagg
taacgcgcgt ctgccggtta aatg 44 <210> SEQ ID NO 42 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 42 gaagatagat tccggcgcca tccatttaac cggcagacgc gc 42
<210> SEQ ID NO 43 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 43 atggcgccgg aatctatctt
caactgcgtt tacaccttcg aatc 44 <210> SEQ ID NO 44 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 44 gataccgtaa gaccaaacgt cagattcgaa ggtgtaaacg cag 43
<210> SEQ ID NO 45 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 45 gacgtttggt cttacggtat
cttcctgtgg gaactgttct ctc 43 <210> SEQ ID NO 46 <211>
LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 46 cctgtgggaa ctgttctctc tgggttcttc tccgtacccg g 41
<210> SEQ ID NO 47 <211> LENGTH: 45 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 47 ggttcttctc cgtacccggg
tatgccggtt gactctaaat tctat 45 <210> SEQ ID NO 48 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 48 cggaaacctt ctttgatcat tttgtagaat ttagagtcaa ccggc 45
<210> SEQ ID NO 49 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 49 aaaatgatca aagaaggttt
ccgtatgctg tctccggaac acg 43 <210> SEQ ID NO 50 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 50 atgtcgtaca tttccgccgg cgcgtgttcc ggagacagca ta 42
<210> SEQ ID NO 51 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 51 ccggcggaaa tgtacgacat
catgaaaacc tgctgggacg cg 42 <210> SEQ ID NO 52 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 52 aaggtcggac gtttcagcgg gtccgcgtcc cagcaggttt tc 42
<210> SEQ ID NO 53 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 53 ccgctgaaac gtccgacctt
caaacagatc gttcagctga tcg 43 <210> SEQ ID NO 54 <211>
LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 54 ttggtagatt cagagatctg tttttcgatc agctgaacga tctgtt 46
<210> SEQ ID NO 55 <211> LENGTH: 44 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 55 aaacagatct ctgaatctac
caaccacatc tactctaacc tggc 44 <210> SEQ ID NO 56 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 56 tgacggttcg gagagcagtt cgccaggtta gagtagatgt gg 42
<210> SEQ ID NO 57 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 57 aactgctctc cgaaccgtca
gaaaccggtt gttgaccact ctg 43 <210> SEQ ID NO 58 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 58 gtagaaccaa cagagttgat acgaacagag tggtcaacaa ccggt 45
<210> SEQ ID NO 59 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 59 cgtatcaact ctgttggttc
taccgcgtct tcttctcagc cg 42 <210> SEQ ID NO 60 <211>
LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 60 aacgtcgtcg tgaaccagca gcggctgaga agaagacgcg 40
<210> SEQ ID NO 61 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 61 gttgtttcat atgtacgaag
ttcagtggaa ag 32 <210> SEQ ID NO 62 <211> LENGTH: 36
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 62
gttgtttgtc gactaaacgt cgtcgtgaac cagcag 36 <210> SEQ ID NO 63
<211> LENGTH: 34 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Description of Artificial Sequence: Synthetic primer
<400> SEQUENCE: 63 gttcttgtcg actatttctg acggttcgga gagc 34
<210> SEQ ID NO 64 <211> LENGTH: 1325 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic polynucleotide <220> FEATURE: <221> NAME/KEY:
CDS <222> LOCATION: (88)..(1302) <400> SEQUENCE: 64
taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gaaataattt
60 tgtttaactt taagaaggag atatacc atg ggt cac cac cat cac cat cat
atg 114 Met Gly His His His His His His Met 1 5 tac gaa gtt cag tgg
aaa gtt gtt gaa gaa atc aac ggt aac aac tac 162 Tyr Glu Val Gln Trp
Lys Val Val Glu Glu Ile Asn Gly Asn Asn Tyr 10 15 20 25 gtt tac atc
gac ccg acc cag ctg ccg tac gac cac aaa tgg gag ttc 210 Val Tyr Ile
Asp Pro Thr Gln Leu Pro Tyr Asp His Lys Trp Glu Phe 30 35 40 ccg
cgt aac cgt ctg tct ttc ggt aaa acc ctg ggt gcg ggt gcg ttc 258 Pro
Arg Asn Arg Leu Ser Phe Gly Lys Thr Leu Gly Ala Gly Ala Phe 45 50
55 ggt aaa gtt gtt gaa gcg acc gcg tac ggt ctg atc aaa tct gac gcg
306 Gly Lys Val Val Glu Ala Thr Ala Tyr Gly Leu Ile Lys Ser Asp Ala
60 65 70 gcg atg acc gtt gcg gtt aaa atg ctg aaa ccg tct gcg cac
ctg acc 354 Ala Met Thr Val Ala Val Lys Met Leu Lys Pro Ser Ala His
Leu Thr 75 80 85 gaa cgt gaa gcg ctg atg tct gaa ctg aaa gtt ctg
tct tac ctg ggt 402 Glu Arg Glu Ala Leu Met Ser Glu Leu Lys Val Leu
Ser Tyr Leu Gly 90 95 100 105 aac cac atg aac atc gtt aac ctg ctg
ggt gcg tgc acc atc ggt ggt 450 Asn His Met Asn Ile Val Asn Leu Leu
Gly Ala Cys Thr Ile Gly Gly 110 115 120 ccg acc ctg gtt atc acc gaa
tac tgc tgc tac ggt gac ctg ctg aac 498 Pro Thr Leu Val Ile Thr Glu
Tyr Cys Cys Tyr Gly Asp Leu Leu Asn 125 130 135 ttc ctg cgt cgt aaa
cgt gac tct ttc atc tgc tct aaa cag gaa gac 546 Phe Leu Arg Arg Lys
Arg Asp Ser Phe Ile Cys Ser Lys Gln Glu Asp 140 145 150 cac gcg gaa
gcg gcg ctg tac aaa aac ctg ctg cac tct aaa gaa tct 594 His Ala Glu
Ala Ala Leu Tyr Lys Asn Leu Leu His Ser Lys Glu Ser 155 160 165 tct
tgc tct gac tct acc aac gaa tac atg gac atg aaa ccg ggt gtt 642 Ser
Cys Ser Asp Ser Thr Asn Glu Tyr Met Asp Met Lys Pro Gly Val 170 175
180 185 tct tac gtt gtt ccg acc aaa gcg gac aaa cgt cgt tct gtt cgt
atc 690 Ser Tyr Val Val Pro Thr Lys Ala Asp Lys Arg Arg Ser Val Arg
Ile 190 195 200 ggt tct tac atc gaa cgt gac gtt acc ccg gcg atc atg
gaa gac gac 738 Gly Ser Tyr Ile Glu Arg Asp Val Thr Pro Ala Ile Met
Glu Asp Asp 205 210 215 gaa ctg gcg ctg gac ctg gaa gac ctg ctg tct
ttc tct tac cag gtt 786 Glu Leu Ala Leu Asp Leu Glu Asp Leu Leu Ser
Phe Ser Tyr Gln Val 220 225 230 gcg aaa ggt atg gcg ttc ctg gcg tct
aaa aac tgc atc cac cgt gac 834 Ala Lys Gly Met Ala Phe Leu Ala Ser
Lys Asn Cys Ile His Arg Asp 235 240 245 ctg gcg gcg cgt aac atc ctg
ctg acc cac ggt cgt atc acc aaa atc 882 Leu Ala Ala Arg Asn Ile Leu
Leu Thr His Gly Arg Ile Thr Lys Ile 250 255 260 265 tgc gac ttc ggt
ctg gcg cgt gac atc aaa aac gac tct aac tac gtt 930 Cys Asp Phe Gly
Leu Ala Arg Asp Ile Lys Asn Asp Ser Asn Tyr Val 270 275 280 gtt aaa
ggt aac gcg cgt ctg ccg gtt aaa tgg atg gcg ccg gaa tct 978 Val Lys
Gly Asn Ala Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ser 285 290 295
atc ttc aac tgc gtt tac acc ttc gaa tct gac gtt tgg tct tac ggt
1026 Ile Phe Asn Cys Val Tyr Thr Phe Glu Ser Asp Val Trp Ser Tyr
Gly 300 305 310 atc ttc ctg tgg gaa ctg ttc tct ctg ggt tct tct ccg
tac ccg ggt 1074 Ile Phe Leu Trp Glu Leu Phe Ser Leu Gly Ser Ser
Pro Tyr Pro Gly 315 320 325 atg ccg gtt gac tct aaa ttc tac aaa atg
atc aaa gaa ggt ttc cgt 1122 Met Pro Val Asp Ser Lys Phe Tyr Lys
Met Ile Lys Glu Gly Phe Arg 330 335 340 345 atg ctg tct ccg gaa cac
gcg ccg gcg gaa atg tac gac atc atg aaa 1170 Met Leu Ser Pro Glu
His Ala Pro Ala Glu Met Tyr Asp Ile Met Lys 350 355 360 acc tgc tgg
gac gcg gac ccg ctg aaa cgt ccg acc ttc aaa cag atc 1218 Thr Cys
Trp Asp Ala Asp Pro Leu Lys Arg Pro Thr Phe Lys Gln Ile 365 370 375
gtt cag ctg atc gaa aaa cag atc tct gaa tct acc aac cac atc tac
1266 Val Gln Leu Ile Glu Lys Gln Ile Ser Glu Ser Thr Asn His Ile
Tyr 380 385 390 tct aac ctg gcg aac tgc tct ccg aac cgt cag aaa
tagtcgactg 1312 Ser Asn Leu Ala Asn Cys Ser Pro Asn Arg Gln Lys 395
400 405 aaaaaggaag agt 1325 <210> SEQ ID NO 65 <211>
LENGTH: 405 <212> TYPE: PRT <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic polypeptide
<400> SEQUENCE: 65 Met Gly His His His His His His Met Tyr
Glu Val Gln Trp Lys Val 1 5 10 15 Val Glu Glu Ile Asn Gly Asn Asn
Tyr Val Tyr Ile Asp Pro Thr Gln 20 25 30 Leu Pro Tyr Asp His Lys
Trp Glu Phe Pro Arg Asn Arg Leu Ser Phe 35 40 45 Gly Lys Thr Leu
Gly Ala Gly Ala Phe Gly Lys Val Val Glu Ala Thr 50 55 60 Ala Tyr
Gly Leu Ile Lys Ser Asp Ala Ala Met Thr Val Ala Val Lys 65 70 75 80
Met Leu Lys Pro Ser Ala His Leu Thr Glu Arg Glu Ala Leu Met Ser 85
90 95 Glu Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met Asn Ile Val
Asn 100 105 110 Leu Leu Gly Ala Cys Thr Ile Gly Gly Pro Thr Leu Val
Ile Thr Glu 115 120 125 Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu
Arg Arg Lys Arg Asp 130 135 140 Ser Phe Ile Cys Ser Lys Gln Glu Asp
His Ala Glu Ala Ala Leu Tyr 145 150 155 160 Lys Asn Leu Leu His Ser
Lys Glu Ser Ser Cys Ser Asp Ser Thr Asn 165 170 175 Glu Tyr Met Asp
Met Lys Pro Gly Val Ser Tyr Val Val Pro Thr Lys 180 185 190 Ala Asp
Lys Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu Arg Asp 195 200 205
Val Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu Glu 210
215 220 Asp Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala Phe
Leu 225 230 235 240 Ala Ser Lys Asn Cys Ile His Arg Asp Leu Ala Ala
Arg Asn Ile Leu 245 250 255 Leu Thr His Gly Arg Ile Thr Lys Ile Cys
Asp Phe Gly Leu Ala Arg 260 265 270 Asp Ile Lys Asn Asp Ser Asn Tyr
Val Val Lys Gly Asn Ala Arg Leu 275 280 285 Pro Val Lys Trp Met Ala
Pro Glu Ser Ile Phe Asn Cys Val Tyr Thr 290 295 300 Phe Glu Ser Asp
Val Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe 305 310 315 320 Ser
Leu Gly Ser Ser Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe 325 330
335 Tyr Lys Met Ile Lys Glu Gly Phe Arg Met Leu Ser Pro Glu His Ala
340 345 350 Pro Ala Glu Met Tyr Asp Ile Met Lys Thr Cys Trp Asp Ala
Asp Pro 355 360 365 Leu Lys Arg Pro Thr Phe Lys Gln Ile Val Gln Leu
Ile Glu Lys Gln 370 375 380 Ile Ser Glu Ser Thr Asn His Ile Tyr Ser
Asn Leu Ala Asn Cys Ser 385 390 395 400 Pro Asn Arg Gln Lys 405
<210> SEQ ID NO 66 <211> LENGTH: 14 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic peptide <400> SEQUENCE: 66 Lys Lys Lys Ser Pro Gly
Glu Tyr Val Asn Ile Glu Phe Gly 1 5 10
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 66 <210>
SEQ ID NO 1 <211> LENGTH: 976 <212> TYPE: PRT
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 Met Arg
Gly Ala Arg Gly Ala Trp Asp Phe Leu Cys Val Leu Leu Leu 1 5 10 15
Leu Leu Arg Val Gln Thr Gly Ser Ser Gln Pro Ser Val Ser Pro Gly 20
25 30 Glu Pro Ser Pro Pro Ser Ile His Pro Gly Lys Ser Asp Leu Ile
Val 35 40 45 Arg Val Gly Asp Glu Ile Arg Leu Leu Cys Thr Asp Pro
Gly Phe Val 50 55 60 Lys Trp Thr Phe Glu Ile Leu Asp Glu Thr Asn
Glu Asn Lys Gln Asn 65 70 75 80 Glu Trp Ile Thr Glu Lys Ala Glu Ala
Thr Asn Thr Gly Lys Tyr Thr 85 90 95 Cys Thr Asn Lys His Gly Leu
Ser Asn Ser Ile Tyr Val Phe Val Arg 100 105 110 Asp Pro Ala Lys Leu
Phe Leu Val Asp Arg Ser Leu Tyr Gly Lys Glu 115 120 125 Asp Asn Asp
Thr Leu Val Arg Cys Pro Leu Thr Asp Pro Glu Val Thr 130 135 140 Asn
Tyr Ser Leu Lys Gly Cys Gln Gly Lys Pro Leu Pro Lys Asp Leu 145 150
155 160 Arg Phe Ile Pro Asp Pro Lys Ala Gly Ile Met Ile Lys Ser Val
Lys 165 170 175 Arg Ala Tyr His Arg Leu Cys Leu His Cys Ser Val Asp
Gln Glu Gly 180 185 190 Lys Ser Val Leu Ser Glu Lys Phe Ile Leu Lys
Val Arg Pro Ala Phe 195 200 205 Lys Ala Val Pro Val Val Ser Val Ser
Lys Ala Ser Tyr Leu Leu Arg 210 215 220 Glu Gly Glu Glu Phe Thr Val
Thr Cys Thr Ile Lys Asp Val Ser Ser 225 230 235 240 Ser Val Tyr Ser
Thr Trp Lys Arg Glu Asn Ser Gln Thr Lys Leu Gln 245 250 255 Glu Lys
Tyr Asn Ser Trp His His Gly Asp Phe Asn Tyr Glu Arg Gln 260 265 270
Ala Thr Leu Thr Ile Ser Ser Ala Arg Val Asn Asp Ser Gly Val Phe 275
280 285 Met Cys Tyr Ala Asn Asn Thr Phe Gly Ser Ala Asn Val Thr Thr
Thr 290 295 300 Leu Glu Val Val Asp Lys Gly Phe Ile Asn Ile Phe Pro
Met Ile Asn 305 310 315 320 Thr Thr Val Phe Val Asn Asp Gly Glu Asn
Val Asp Leu Ile Val Glu 325 330 335 Tyr Glu Ala Phe Pro Lys Pro Glu
His Gln Gln Trp Ile Tyr Met Asn 340 345 350 Arg Thr Phe Thr Asp Lys
Trp Glu Asp Tyr Pro Lys Ser Glu Asn Glu 355 360 365 Ser Asn Ile Arg
Tyr Val Ser Glu Leu His Leu Thr Arg Leu Lys Gly 370 375 380 Thr Glu
Gly Gly Thr Tyr Thr Phe Leu Val Ser Asn Ser Asp Val Asn 385 390 395
400 Ala Ala Ile Ala Phe Asn Val Tyr Val Asn Thr Lys Pro Glu Ile Leu
405 410 415 Thr Tyr Asp Arg Leu Val Asn Gly Met Leu Gln Cys Val Ala
Ala Gly 420 425 430 Phe Pro Glu Pro Thr Ile Asp Trp Tyr Phe Cys Pro
Gly Thr Glu Gln 435 440 445 Arg Cys Ser Ala Ser Val Leu Pro Val Asp
Val Gln Thr Leu Asn Ser 450 455 460 Ser Gly Pro Pro Phe Gly Lys Leu
Val Val Gln Ser Ser Ile Asp Ser 465 470 475 480 Ser Ala Phe Lys His
Asn Gly Thr Val Glu Cys Lys Ala Tyr Asn Asp 485 490 495 Val Gly Lys
Thr Ser Ala Tyr Phe Asn Phe Ala Phe Lys Gly Asn Asn 500 505 510 Lys
Glu Gln Ile His Pro His Thr Leu Phe Thr Pro Leu Leu Ile Gly 515 520
525 Phe Val Ile Val Ala Gly Met Met Cys Ile Ile Val Met Ile Leu Thr
530 535 540 Tyr Lys Tyr Leu Gln Lys Pro Met Tyr Glu Val Gln Trp Lys
Val Val 545 550 555 560 Glu Glu Ile Asn Gly Asn Asn Tyr Val Tyr Ile
Asp Pro Thr Gln Leu 565 570 575 Pro Tyr Asp His Lys Trp Glu Phe Pro
Arg Asn Arg Leu Ser Phe Gly 580 585 590 Lys Thr Leu Gly Ala Gly Ala
Phe Gly Lys Val Val Glu Ala Thr Ala 595 600 605 Tyr Gly Leu Ile Lys
Ser Asp Ala Ala Met Thr Val Ala Val Lys Met 610 615 620 Leu Lys Pro
Ser Ala His Leu Thr Glu Arg Glu Ala Leu Met Ser Glu 625 630 635 640
Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met Asn Ile Val Asn Leu 645
650 655 Leu Gly Ala Cys Thr Ile Gly Gly Pro Thr Leu Val Ile Thr Glu
Tyr 660 665 670 Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu Arg Arg Lys
Arg Asp Ser 675 680 685 Phe Ile Cys Ser Lys Gln Glu Asp His Ala Glu
Ala Ala Leu Tyr Lys 690 695 700 Asn Leu Leu His Ser Lys Glu Ser Ser
Cys Ser Asp Ser Thr Asn Glu 705 710 715 720 Tyr Met Asp Met Lys Pro
Gly Val Ser Tyr Val Val Pro Thr Lys Ala 725 730 735 Asp Lys Arg Arg
Ser Val Arg Ile Gly Ser Tyr Ile Glu Arg Asp Val 740 745 750 Thr Pro
Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu Glu Asp 755 760 765
Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala Phe Leu Ala 770
775 780 Ser Lys Asn Cys Ile His Arg Asp Leu Ala Ala Arg Asn Ile Leu
Leu 785 790 795 800 Thr His Gly Arg Ile Thr Lys Ile Cys Asp Phe Gly
Leu Ala Arg Asp 805 810 815 Ile Lys Asn Asp Ser Asn Tyr Val Val Lys
Gly Asn Ala Arg Leu Pro 820 825 830 Val Lys Trp Met Ala Pro Glu Ser
Ile Phe Asn Cys Val Tyr Thr Phe 835 840 845 Glu Ser Asp Val Trp Ser
Tyr Gly Ile Phe Leu Trp Glu Leu Phe Ser 850 855 860 Leu Gly Ser Ser
Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe Tyr 865 870 875 880 Lys
Met Ile Lys Glu Gly Phe Arg Met Leu Ser Pro Glu His Ala Pro 885 890
895 Ala Glu Met Tyr Asp Ile Met Lys Thr Cys Trp Asp Ala Asp Pro Leu
900 905 910 Lys Arg Pro Thr Phe Lys Gln Ile Val Gln Leu Ile Glu Lys
Gln Ile 915 920 925 Ser Glu Ser Thr Asn His Ile Tyr Ser Asn Leu Ala
Asn Cys Ser Pro 930 935 940 Asn Arg Gln Lys Pro Val Val Asp His Ser
Val Arg Ile Asn Ser Val 945 950 955 960 Gly Ser Thr Ala Ser Ser Ser
Gln Pro Leu Leu Val His Asp Asp Val 965 970 975 <210> SEQ ID
NO 2 <211> LENGTH: 5084 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 2 gatcccatcg
cagctaccgc gatgagaggc gctcgcggcg cctgggattt tctctgcgtt 60
ctgctcctac tgcttcgcgt ccagacaggc tcttctcaac catctgtgag tccaggggaa
120 ccgtctccac catccatcca tccaggaaaa tcagacttaa tagtccgcgt
gggcgacgag 180 attaggctgt tatgcactga tccgggcttt gtcaaatgga
cttttgagat cctggatgaa 240 acgaatgaga ataagcagaa tgaatggatc
acggaaaagg cagaagccac caacaccggc 300 aaatacacgt gcaccaacaa
acacggctta agcaattcca tttatgtgtt tgttagagat 360 cctgccaagc
ttttccttgt tgaccgctcc ttgtatggga aagaagacaa cgacacgctg 420
gtccgctgtc ctctcacaga cccagaagtg accaattatt ccctcaaggg gtgccagggg
480 aagcctcttc ccaaggactt gaggtttatt cctgacccca aggcgggcat
catgatcaaa 540 agtgtgaaac gcgcctacca tcggctctgt ctgcattgtt
ctgtggacca ggagggcaag 600 tcagtgctgt cggaaaaatt catcctgaaa
gtgaggccag ccttcaaagc tgtgcctgtt 660 gtgtctgtgt ccaaagcaag
ctatcttctt agggaagggg aagaattcac agtgacgtgc 720 acaataaaag
atgtgtctag ttctgtgtac tcaacgtgga aaagagaaaa cagtcagact 780
aaactacagg agaaatataa tagctggcat cacggtgact tcaattatga acgtcaggca
840 acgttgacta tcagttcagc gagagttaat gattctggag tgttcatgtg
ttatgccaat 900 aatacttttg gatcagcaaa tgtcacaaca accttggaag
tagtagataa aggattcatt 960 aatatcttcc ccatgataaa cactacagta
tttgtaaacg atggagaaaa tgtagatttg 1020 attgttgaat atgaagcatt
ccccaaacct gaacaccagc agtggatcta tatgaacaga 1080 accttcactg
ataaatggga agattatccc aagtctgaga atgaaagtaa tatcagatac 1140
gtaagtgaac ttcatctaac gagattaaaa ggcaccgaag gaggcactta cacattccta
1200 gtgtccaatt ctgacgtcaa tgctgccata gcatttaatg tttatgtgaa
tacaaaacca 1260 gaaatcctga cttacgacag gctcgtgaat ggcatgctcc
aatgtgtggc agcaggattc 1320 ccagagccca caatagattg gtatttttgt
ccaggaactg agcagagatg ctctgcttct 1380
gtactgccag tggatgtgca gacactaaac tcatctgggc caccgtttgg aaagctagtg
1440 gttcagagtt ctatagattc tagtgcattc aagcacaatg gcacggttga
atgtaaggct 1500 tacaacgatg tgggcaagac ttctgcctat tttaactttg
catttaaagg taacaacaaa 1560 gagcaaatcc atccccacac cctgttcact
cctttgctga ttggtttcgt aatcgtagct 1620 ggcatgatgt gcattattgt
gatgattctg acctacaaat atttacagaa acccatgtat 1680 gaagtacagt
ggaaggttgt tgaggagata aatggaaaca attatgttta catagaccca 1740
acacaacttc cttatgatca caaatgggag tttcccagaa acaggctgag ttttgggaaa
1800 accctgggtg ctggagcttt cgggaaggtt gttgaggcaa ctgcttatgg
cttaattaag 1860 tcagatgcgg ccatgactgt cgctgtaaag atgctcaagc
cgagtgccca tttgacagaa 1920 cgggaagccc tcatgtctga actcaaagtc
ctgagttacc ttggtaatca catgaatatt 1980 gtgaatctac ttggagcctg
caccattgga gggcccaccc tggtcattac agaatattgt 2040 tgctatggtg
atcttttgaa ttttttgaga agaaaacgtg attcatttat ttgttcaaag 2100
caggaagatc atgcagaagc tgcactttat aagaatcttc tgcattcaaa ggagtcttcc
2160 tgcagcgata gtactaatga gtacatggac atgaaacctg gagtttctta
tgttgtccca 2220 accaaggccg acaaaaggag atctgtgaga ataggctcat
acatagaaag agatgtgact 2280 cccgccatca tggaggatga cgagttggcc
ctagacttag aagacttgct gagcttttct 2340 taccaggtgg caaagggcat
ggctttcctc gcctccaaga attgtattca cagagacttg 2400 gcagccagaa
atatcctcct tactcatggt cggatcacaa agatttgtga ttttggtcta 2460
gccagagaca tcaagaatga ttctaattat gtggttaaag gaaacgctcg actacctgtg
2520 aagtggatgg cacctgaaag cattttcaac tgtgtataca cgtttgaaag
tgacgtctgg 2580 tcctatggga tttttctttg ggagctgttc tctttaggaa
gcagccccta tcctggaatg 2640 ccggtcgatt ctaagttcta caagatgatc
aaggaaggct tccggatgct cagccctgaa 2700 cacgcacctg ctgaaatgta
tgacataatg aagacttgct gggatgcaga tcccctaaaa 2760 agaccaacat
tcaagcaaat tgttcagcta attgagaagc agatttcaga gagcaccaat 2820
catatttact ccaacttagc aaactgcagc cccaaccgac agaagcccgt ggtagaccat
2880 tctgtgcgga tcaattctgt cggcagcacc gcttcctcct cccagcctct
gcttgtgcac 2940 gacgatgtct gagcagaatc agtgtttggg tcacccctcc
aggaatgatc tcttcttttg 3000 gcttccatga tggttatttt cttttctttc
aacttgcatc caactccagg atagtgggca 3060 ccccactgca atcctgtctt
tctgagcaca ctttagtggc cgatgatttt tgtcatcagc 3120 caccatccta
ttgcaaaggt tccaactgta tatattccca atagcaacgt agcttctacc 3180
atgaacagaa aacattctga tttggaaaaa gagagggagg tatggactgg gggccagagt
3240 cctttccaag gcttctccaa ttctgcccaa aaatatggtt gatagtttac
ctgaataaat 3300 ggtagtaatc acagttggcc ttcagaacca tccatagtag
tatgatgata caagattaga 3360 agctgaaaac ctaagtcctt tatgtggaaa
acagaacatc attagaacaa aggacagagt 3420 atgaacacct gggcttaaga
aatctagtat ttcatgctgg gaatgagaca taggccatga 3480 aaaaaatgat
ccccaagtgt gaacaaaaga tgctcttctg tggaccactg catgagcttt 3540
tatactaccg acctggtttt taaatagagt ttgctattag agcattgaat tggagagaag
3600 gcctccctag ccagcacttg tatatacgca tctataaatt gtccgtgttc
atacatttga 3660 ggggaaaaca ccataaggtt tcgtttctgt atacaaccct
ggcattatgt ccactgtgta 3720 tagaagtaga ttaagagcca tataagtttg
aaggaaacag ttaataccat tttttaagga 3780 aacaatataa ccacaaagca
cagtttgaac aaaatctcct cttttagctg atgaacttat 3840 tctgtagatt
ctgtggaaca agcctatcag cttcagaatg gcattgtact caatggattt 3900
gatgctgttt gacaaagtta ctgattcact gcatggctcc cacaggagtg ggaaaacact
3960 gccatcttag tttggattct tatgtagcag gaaataaagt ataggtttag
cctccttcgc 4020 aggcatgtcc tggacaccgg gccagtatct atatatgtgt
atgtacgttt gtatgtgtgt 4080 agacaaatat ttggaggggt atttttgccc
tgagtccaag agggtccttt agtacctgaa 4140 aagtaacttg gctttcatta
ttagtactgc tcttgtttct tttcacatag ctgtctagag 4200 tagcttacca
gaagcttcca tagtggtgca gaggaagtgg aaggcatcag tccctatgta 4260
tttgcagttc acctgcactt aaggcactct gttatttaga ctcatcttac tgtacctgtt
4320 ccttagacct tccataatgc tactgtctca ctgaaacatt taaattttac
cctttagact 4380 gtagcctgga tattattctt gtagtttacc tctttaaaaa
caaaacaaaa caaaacaaaa 4440 aactcccctt cctcactgcc caatataaaa
ggcaaatgtg tacatggcag agtttgtgtg 4500 ttgtcttgaa agattcaggt
atgttgcctt tatggtttcc cccttctaca tttcttagac 4560 tacatttaga
gaactgtggc cgttatctgg aagtaaccat ttgcactgga gttctatgct 4620
ctcgcacctt tccaaagtta acagattttg gggttgtgtt gtcacccaag agattgttgt
4680 ttgccatact ttgtctgaaa aattcctttg tgtttctatt gacttcaatg
atagtaagaa 4740 aagtggttgt tagttataga tgtctaggta cttcaggggc
acttcattga gagttttgtc 4800 ttgccatact ttgtctgaaa aattcctttg
tgtttctatt gacttcaatg atagtaagaa 4860 aagtggttgt tagttataga
tgtctaggta cttcaggggc acttcattga gagttttgtc 4920 aatgtctttt
gaatattccc aagcccatga gtccttgaaa atatttttta tatatacagt 4980
aactttatgt gtaaatacat aagcggcgta agtttaaagg atgttggtgt tccacgtgtt
5040 ttattcctgt atgttgtcca attgttgaca gttctgaaga attc 5084
<210> SEQ ID NO 3 <211> LENGTH: 972 <212> TYPE:
PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 Met
Gly Pro Gly Val Leu Leu Leu Leu Leu Val Ala Thr Ala Trp His 1 5 10
15 Gly Gln Gly Ile Pro Val Ile Glu Pro Ser Val Pro Glu Leu Val Val
20 25 30 Lys Pro Gly Ala Thr Val Thr Leu Arg Cys Val Gly Asn Gly
Ser Val 35 40 45 Glu Trp Asp Gly Pro Pro Ser Pro His Trp Thr Leu
Tyr Ser Asp Gly 50 55 60 Ser Ser Ser Ile Leu Ser Thr Asn Asn Ala
Thr Phe Gln Asn Thr Gly 65 70 75 80 Thr Tyr Arg Cys Thr Glu Pro Gly
Asp Pro Leu Gly Gly Ser Ala Ala 85 90 95 Ile His Leu Tyr Val Lys
Asp Pro Ala Arg Pro Trp Asn Val Leu Ala 100 105 110 Gln Glu Val Val
Val Phe Glu Asp Gln Asp Ala Leu Leu Pro Cys Leu 115 120 125 Leu Thr
Asp Pro Val Leu Glu Ala Gly Val Ser Leu Val Arg Val Arg 130 135 140
Gly Arg Pro Leu Met Arg His Thr Asn Tyr Ser Phe Ser Pro Trp His 145
150 155 160 Gly Phe Thr Ile His Arg Ala Lys Phe Ile Gln Ser Gln Asp
Tyr Gln 165 170 175 Cys Ser Ala Leu Met Gly Gly Arg Lys Val Met Ser
Ile Ser Ile Arg 180 185 190 Leu Lys Val Gln Lys Val Ile Pro Gly Pro
Pro Ala Leu Thr Leu Val 195 200 205 Pro Ala Glu Leu Val Arg Ile Arg
Gly Glu Ala Ala Gln Ile Val Cys 210 215 220 Ser Ala Ser Ser Val Asp
Val Asn Phe Asp Val Phe Leu Gln His Asn 225 230 235 240 Asn Thr Lys
Leu Ala Ile Pro Gln Gln Ser Asp Phe His Asn Asn Arg 245 250 255 Tyr
Gln Lys Val Leu Thr Leu Asn Leu Asp Gln Val Asp Phe Gln His 260 265
270 Ala Gly Asn Tyr Ser Cys Val Ala Ser Asn Val Gln Gly Lys His Ser
275 280 285 Thr Ser Met Phe Phe Arg Val Val Glu Ser Ala Tyr Leu Asn
Leu Ser 290 295 300 Ser Glu Gln Asn Leu Ile Gln Glu Val Thr Val Gly
Glu Gly Leu Asn 305 310 315 320 Leu Lys Val Met Val Glu Ala Tyr Pro
Gly Leu Gln Gly Phe Asn Trp 325 330 335 Thr Tyr Leu Gly Pro Phe Ser
Asp His Gln Pro Glu Pro Lys Leu Ala 340 345 350 Asn Ala Thr Thr Lys
Asp Thr Tyr Arg His Thr Phe Thr Leu Ser Leu 355 360 365 Pro Arg Leu
Lys Pro Ser Glu Ala Gly Arg Tyr Ser Phe Leu Ala Arg 370 375 380 Asn
Pro Gly Gly Trp Arg Ala Leu Thr Phe Glu Leu Thr Leu Arg Tyr 385 390
395 400 Pro Pro Glu Val Ser Val Ile Trp Thr Phe Ile Asn Gly Ser Gly
Thr 405 410 415 Leu Leu Cys Ala Ala Ser Gly Tyr Pro Gln Pro Asn Val
Thr Trp Leu 420 425 430 Gln Cys Ser Gly His Thr Asp Arg Cys Asp Glu
Ala Gln Val Leu Gln 435 440 445 Val Trp Asp Asp Pro Tyr Pro Glu Val
Leu Ser Gln Glu Pro Phe His 450 455 460 Lys Val Thr Val Gln Ser Leu
Leu Thr Val Glu Thr Leu Glu His Asn 465 470 475 480 Gln Thr Tyr Glu
Cys Arg Ala His Asn Ser Val Gly Ser Gly Ser Trp 485 490 495 Ala Phe
Ile Pro Ile Ser Ala Gly Ala His Thr His Pro Pro Asp Glu 500 505 510
Phe Leu Phe Thr Pro Val Val Val Ala Cys Met Ser Ile Met Ala Leu 515
520 525 Leu Leu Leu Leu Leu Leu Leu Leu Leu Tyr Lys Tyr Lys Gln Lys
Pro 530 535 540 Lys Tyr Gln Val Arg Trp Lys Ile Ile Glu Ser Tyr Glu
Gly Asn Ser 545 550 555 560 Tyr Thr Phe Ile Asp Pro Thr Gln Leu Pro
Tyr Asn Glu Lys Trp Glu 565 570 575 Phe Pro Arg Asn Asn Leu Gln Phe
Gly Lys Thr Leu Gly Ala Gly Ala 580 585 590 Phe Gly Lys Val Val Glu
Ala Thr Ala Phe Gly Leu Gly Lys Glu Asp 595 600 605 Ala Val Leu Lys
Val Ala Val Lys Met Leu Lys Ser Thr Ala His Ala 610 615 620 Asp Glu
Lys Glu Ala Leu Met Ser Glu Leu Lys Ile Met Ser His Leu 625 630 635
640
Gly Gln His Glu Asn Ile Val Asn Leu Leu Gly Ala Cys Thr His Gly 645
650 655 Gly Pro Val Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu
Leu 660 665 670 Asn Phe Leu Arg Arg Lys Ala Glu Ala Met Leu Gly Pro
Ser Leu Ser 675 680 685 Pro Gly Gln Asp Pro Glu Gly Gly Val Asp Tyr
Lys Asn Ile His Leu 690 695 700 Glu Lys Lys Tyr Val Arg Arg Asp Ser
Gly Phe Ser Ser Gln Gly Val 705 710 715 720 Asp Thr Tyr Val Glu Met
Arg Pro Val Ser Thr Ser Ser Asn Asp Ser 725 730 735 Phe Ser Glu Gln
Asp Leu Asp Lys Glu Asp Gly Arg Pro Leu Glu Leu 740 745 750 Arg Asp
Leu Leu His Phe Ser Ser Gln Val Ala Gln Gly Met Ala Phe 755 760 765
Leu Ala Ser Lys Asn Cys Ile His Arg Asp Val Ala Ala Arg Asn Val 770
775 780 Leu Leu Thr Asn Gly His Val Ala Lys Ile Gly Asp Phe Gly Leu
Ala 785 790 795 800 Arg Asp Ile Met Asn Asp Ser Asn Tyr Ile Val Lys
Gly Asn Ala Arg 805 810 815 Leu Pro Val Lys Trp Met Ala Pro Glu Ser
Ile Phe Asp Cys Val Tyr 820 825 830 Thr Val Gln Ser Asp Val Trp Ser
Tyr Gly Ile Leu Leu Trp Glu Ile 835 840 845 Phe Ser Leu Gly Leu Asn
Pro Tyr Pro Gly Ile Leu Val Asn Ser Lys 850 855 860 Phe Tyr Lys Leu
Val Lys Asp Gly Tyr Gln Met Ala Gln Pro Ala Phe 865 870 875 880 Ala
Pro Lys Asn Ile Tyr Ser Ile Met Gln Ala Cys Trp Ala Leu Glu 885 890
895 Pro Thr His Arg Pro Thr Phe Gln Gln Ile Cys Ser Phe Leu Gln Glu
900 905 910 Gln Ala Gln Glu Asp Arg Arg Glu Arg Asp Tyr Thr Asn Leu
Pro Ser 915 920 925 Ser Ser Arg Ser Gly Gly Ser Gly Ser Ser Ser Ser
Glu Leu Glu Glu 930 935 940 Glu Ser Ser Ser Glu His Leu Thr Cys Cys
Glu Gln Gly Asp Ile Ala 945 950 955 960 Gln Pro Leu Leu Gln Pro Asn
Asn Tyr Gln Phe Cys 965 970 <210> SEQ ID NO 4 <211>
LENGTH: 3985 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 4 gaagggcaga cagagtgtcc aaaagcgtga
gagcacgaag tgaggagaag gtggagaaga 60 gagaagagga agaggaagag
gaagagagga agcggaggga actgcggcca ggctaaaagg 120 ggaagaagag
gatcagccca aggaggagga agaggaaaac aagacaaaca gccagtgcag 180
aggagaggaa cgtgtgtcca gtgtcccgat ccctgcggag ctagtagctg agagctctgt
240 gccctgggca ccttgcagcc ctgcacctgc ctgccacttc cccaccgagg
ccatgggccc 300 aggagttctg ctgctcctgc tggtggccac agcttggcat
ggtcagggaa tcccagtgat 360 agagcccagt gtccctgagc tggtcgtgaa
gccaggagca acggtgacct tgcgatgtgt 420 gggcaatggc agcgtggaat
gggatggccc cccatcacct cactggaccc tgtactctga 480 tggctccagc
agcatcctca gcaccaacaa cgctaccttc caaaacacgg ggacctatcg 540
ctgcactgag cctggagacc ccctgggagg cagcgccgcc atccacctct atgtcaaaga
600 ccctgcccgg ccctggaacg tgctagcaca ggaggtggtc gtgttcgagg
accaggacgc 660 actactgccc tgtctgctca cagacccggt gctggaagca
ggcgtctcgc tggtgcgtgt 720 gcgtggccgg cccctcatgc gccacaccaa
ctactccttc tcgccctggc atggcttcac 780 catccacagg gccaagttca
ttcagagcca ggactatcaa tgcagtgccc tgatgggtgg 840 caggaaggtg
atgtccatca gcatccggct gaaagtgcag aaagtcatcc cagggccccc 900
agccttgaca ctggtgcctg cagagctggt gcggattcga ggggaggctg cccagatcgt
960 gtgctcagcc agcagcgttg atgttaactt tgatgtcttc ctccaacaca
acaacaccaa 1020 gctcgcaatc cctcaacaat ctgactttca taataaccgt
taccaaaaag tcctgaccct 1080 caacctcgat caagtagatt tccaacatgc
cggcaactac tcctgcgtgg ccagcaacgt 1140 gcagggcaag cactccacct
ccatgttctt ccgggtggta gagagtgcct acttgaactt 1200 gagctctgag
cagaacctca tccaggaggt gaccgtgggg gaggggctca acctcaaagt 1260
catggtggag gcctacccag gcctgcaagg ttttaactgg acctacctgg gacccttttc
1320 tgaccaccag cctgagccca agcttgctaa tgctaccacc aaggacacat
acaggcacac 1380 cttcaccctc tctctgcccc gcctgaagcc ctctgaggct
ggccgctact ccttcctggc 1440 cagaaaccca ggaggctgga gagctctgac
gtttgagctc acccttcgat accccccaga 1500 ggtaagcgtc atatggacat
tcatcaacgg ctctggcacc cttttgtgtg ctgcctctgg 1560 gtacccccag
cccaacgtga catggctgca gtgcagtggc cacactgata ggtgtgatga 1620
ggcccaagtg ctgcaggtct gggatgaccc ataccctgag gtcctgagcc aggagccctt
1680 ccacaaggtg acggtgcaga gcctgctgac tgttgagacc ttagagcaca
accaaaccta 1740 cgagtgcagg gcccacaaca gcgtggggag tggctcctgg
gccttcatac ccatctctgc 1800 aggagcccac acgcatcccc cggatgagtt
cctcttcaca ccagtggtgg tcgcctgcat 1860 gtccatcatg gccttgctgc
tgctgctgct cctgctgcta ttgtacaagt ataagcagaa 1920 gcccaagtac
caggtccgct ggaagatcat cgagagctat gagggcaaca gttatacttt 1980
catcgacccc acgcagctgc cttacaacga gaagtgggag ttcccccgga acaacctgca
2040 gtttggtaag accctcggag ctggagcctt tgggaaggtg gtggaggcca
cggcctttgg 2100 tctgggcaag gaggatgctg tcctgaaggt ggctgtgaag
atgctgaagt ccacggccca 2160 tgctgatgag aaggaggccc tcatgtccga
gctgaagatc atgagccacc tgggccagca 2220 cgagaacatc gtcaaccttc
tgggagcctg tacccatgga ggccctgtac tggtcatcac 2280 ggagtactgt
tgctatggcg acctgctcaa ctttctgcga aggaaggctg aggccatgct 2340
gggacccagc ctgagccccg gccaggaccc cgagggaggc gtcgactata agaacatcca
2400 cctcgagaag aaatatgtcc gcagggacag tggcttctcc agccagggtg
tggacaccta 2460 tgtggagatg aggcctgtct ccacttcttc aaatgactcc
ttctctgagc aagacctgga 2520 caaggaggat ggacggcccc tggagctccg
ggacctgctt cacttctcca gccaagtagc 2580 ccagggcatg gccttcctcg
cttccaagaa ttgcatccac cgggacgtgg cagcgcgtaa 2640 cgtgctgttg
accaatggtc atgtggccaa gattggggac ttcgggctgg ctagggacat 2700
catgaatgac tccaactaca ttgtcaaggg caatgcccgc ctgcctgtga agtggatggc
2760 cccagagagc atctttgact gtgtctacac ggttcagagc gacgtctggt
cctatggcat 2820 cctcctctgg gagatcttct cacttgggct gaatccctac
cctggcatcc tggtgaacag 2880 caagttctat aaactggtga aggatggata
ccaaatggcc cagcctgcat ttgccccaaa 2940 gaatatatac agcatcatgc
aggcctgctg ggccttggag cccacccaca gacccacctt 3000 ccagcagatc
tgctccttcc ttcaggagca ggcccaagag gacaggagag agcgggacta 3060
taccaatctg ccgagcagca gcagaagcgg tggcagcggc agcagcagca gtgagctgga
3120 ggaggagagc tctagtgagc acctgacctg ctgcgagcaa ggggatatcg
cccagccctt 3180 gctgcagccc aacaactatc agttctgctg aggagttgac
gacagggagt accactctcc 3240 cctcctccaa acttcaactc ctccatggat
ggggcgacac ggggagaaca tacaaactct 3300 gccttcggtc atttcactca
acagctcggc ccagctctga aacttgggaa ggtgagggat 3360 tcaggggagg
tcagaggatc ccacttcctg agcatgggcc atcactgcca gtcaggggct 3420
gggggctgag ccctcacccc cccctcccct actgttctca tggtgttggc ctcgtgtttg
3480 ctatgccaac tagtagaacc ttctttccta atccccttat cttcatggaa
atggactgac 3540 tttatgccta tgaagtcccc aggagctaca ctgatactga
gaaaaccagg ctctttgggg 3600 ctagacagac tggcagagag tgagatctcc
ctctctgaga ggagcagcag atgctcacag 3660 accacactca gctcaggccc
cttggagcag gatggctcct ctaagaatct cacaggacct 3720 cttagtctct
gccctatacg ccgccttcac tccacagcct cacccctccc acccccatac 3780
tggtactgct gtaatgagcc aagtggcagc taaaagttgg gggtgttctg cccagtcccg
3840 tcattctggg ctagaaggca ggggaccttg gcatgtggct ggccacacca
agcaggaagc 3900 acaaactccc ccaagctgac tcatcctaac taacagtcac
gccgtgggat gtctctgtcc 3960 acattaaact aacagcatta atgca 3985
<210> SEQ ID NO 5 <211> LENGTH: 41 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 5 atgtacgaag ttcagtggaa
agttgttgaa gaaatcaacg g 41 <210> SEQ ID NO 6 <211>
LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 6 ggtcgatgta aacgtagttg ttaccgttga tttcttcaac aacttt 46
<210> SEQ ID NO 7 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 7 aacaactacg tttacatcga
cccgacccag ctgccgtacg ac 42 <210> SEQ ID NO 8 <211>
LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 8
gttacgcggg aactcccatt tgtggtcgta cggcagctgg gtc 43 <210> SEQ
ID NO 9 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 9 aaatgggagt tcccgcgtaa ccgtctgtct
ttcggtaaaa ccc 43 <210> SEQ ID NO 10 <211> LENGTH: 41
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 10
accgaacgca cccgcaccca gggttttacc gaaagacaga c 41 <210> SEQ ID
NO 11 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 11 ggtgcgggtg cgttcggtaa agttgttgaa
gcgaccgcgt acg 43 <210> SEQ ID NO 12 <211> LENGTH: 41
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 12
gccgcgtcag atttgatcag accgtacgcg gtcgcttcaa c 41 <210> SEQ ID
NO 13 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 13 ctgatcaaat ctgacgcggc gatgaccgtt
gcggttaaaa tgc 43 <210> SEQ ID NO 14 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 14
gtcaggtgcg cagacggttt cagcatttta accgcaacgg tca 43 <210> SEQ
ID NO 15 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 15 aaaccgtctg cgcacctgac cgaacgtgaa
gcgctgatgt ctg 43 <210> SEQ ID NO 16 <211> LENGTH: 44
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 16
ccaggtaaga cagaactttc agttcagaca tcagcgcttc acgt 44 <210> SEQ
ID NO 17 <211> LENGTH: 44 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 17 ctgaaagttc tgtcttacct gggtaaccac
atgaacatcg ttaa 44 <210> SEQ ID NO 18 <211> LENGTH: 41
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 18
ggtgcacgca cccagcaggt taacgatgtt catgtggtta c 41 <210> SEQ ID
NO 19 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 19 ctgctgggtg cgtgcaccat cggtggtccg
accctggtta tca 43 <210> SEQ ID NO 20 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 20
gtcaccgtag cagcagtatt cggtgataac cagggtcgga cca 43 <210> SEQ
ID NO 21 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 21 gaatactgct gctacggtga cctgctgaac
ttcctgcgtc gta 43 <210> SEQ ID NO 22 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 22
agagcagatg aaagagtcac gtttacgacg caggaagttc agc 43 <210> SEQ
ID NO 23 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 23 cgtgactctt tcatctgctc taaacaggaa
gaccacgcgg aag 43 <210> SEQ ID NO 24 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 24
cagcaggttt ttgtacagcg ccgcttccgc gtggtcttcc tgt 43 <210> SEQ
ID NO 25 <211> LENGTH: 44 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 25 gcgctgtaca aaaacctgct gcactctaaa
gaatcttctt gctc 44 <210> SEQ ID NO 26
<211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Description of Artificial Sequence: Synthetic primer
<400> SEQUENCE: 26 ccatgtattc gttggtagag tcagagcaag
aagattcttt agagt 45 <210> SEQ ID NO 27 <211> LENGTH: 44
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 27
gactctacca acgaatacat ggacatgaaa ccgggtgttt ctta 44 <210> SEQ
ID NO 28 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 28 tccgctttgg tcggaacaac gtaagaaaca
cccggtttca tgt 43 <210> SEQ ID NO 29 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 29
gttgttccga ccaaagcgga caaacgtcgt tctgttcgta tcg 43 <210> SEQ
ID NO 30 <211> LENGTH: 46 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 30 taacgtcacg ttcgatgtaa gaaccgatac
gaacagaacg acgttt 46 <210> SEQ ID NO 31 <211> LENGTH:
43 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 31
tcttacatcg aacgtgacgt taccccggcg atcatggaag acg 43 <210> SEQ
ID NO 32 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 32 ccaggtccag cgccagttcg tcgtcttcca
tgatcgccgg 40 <210> SEQ ID NO 33 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 33
gaactggcgc tggacctgga agacctgctg tctttctctt acc 43 <210> SEQ
ID NO 34 <211> LENGTH: 44 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 34 gaacgccata cctttcgcaa cctggtaaga
gaaagacagc aggt 44 <210> SEQ ID NO 35 <211> LENGTH: 44
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 35
gttgcgaaag gtatggcgtt cctggcgtct aaaaactgca tcca 44 <210> SEQ
ID NO 36 <211> LENGTH: 39 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 36 cgcgccgcca ggtcacggtg gatgcagttt
ttagacgcc 39 <210> SEQ ID NO 37 <211> LENGTH: 41
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 37
cgtgacctgg cggcgcgtaa catcctgctg acccacggtc g 41 <210> SEQ ID
NO 38 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 38 accgaagtcg cagattttgg tgatacgacc
gtgggtcagc agg 43 <210> SEQ ID NO 39 <211> LENGTH: 43
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 39
accaaaatct gcgacttcgg tctggcgcgt gacatcaaaa acg 43 <210> SEQ
ID NO 40 <211> LENGTH: 46 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 40 gttaccttta acaacgtagt tagagtcgtt
tttgatgtca cgcgcc 46 <210> SEQ ID NO 41 <211> LENGTH:
44 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 41
tctaactacg ttgttaaagg taacgcgcgt ctgccggtta aatg 44 <210> SEQ
ID NO 42 <211> LENGTH: 42 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 42 gaagatagat tccggcgcca tccatttaac
cggcagacgc gc 42 <210> SEQ ID NO 43 <211> LENGTH: 44
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 43
atggcgccgg aatctatctt caactgcgtt tacaccttcg aatc 44
<210> SEQ ID NO 44 <211> LENGTH: 43 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 44 gataccgtaa gaccaaacgt
cagattcgaa ggtgtaaacg cag 43 <210> SEQ ID NO 45 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 45 gacgtttggt cttacggtat cttcctgtgg gaactgttct ctc 43
<210> SEQ ID NO 46 <211> LENGTH: 41 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 46 cctgtgggaa ctgttctctc
tgggttcttc tccgtacccg g 41 <210> SEQ ID NO 47 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 47 ggttcttctc cgtacccggg tatgccggtt gactctaaat tctat 45
<210> SEQ ID NO 48 <211> LENGTH: 45 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 48 cggaaacctt ctttgatcat
tttgtagaat ttagagtcaa ccggc 45 <210> SEQ ID NO 49 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 49 aaaatgatca aagaaggttt ccgtatgctg tctccggaac acg 43
<210> SEQ ID NO 50 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 50 atgtcgtaca tttccgccgg
cgcgtgttcc ggagacagca ta 42 <210> SEQ ID NO 51 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 51 ccggcggaaa tgtacgacat catgaaaacc tgctgggacg cg 42
<210> SEQ ID NO 52 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 52 aaggtcggac gtttcagcgg
gtccgcgtcc cagcaggttt tc 42 <210> SEQ ID NO 53 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 53 ccgctgaaac gtccgacctt caaacagatc gttcagctga tcg 43
<210> SEQ ID NO 54 <211> LENGTH: 46 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 54 ttggtagatt cagagatctg
tttttcgatc agctgaacga tctgtt 46 <210> SEQ ID NO 55
<211> LENGTH: 44 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Description of Artificial Sequence: Synthetic primer
<400> SEQUENCE: 55 aaacagatct ctgaatctac caaccacatc
tactctaacc tggc 44 <210> SEQ ID NO 56 <211> LENGTH: 42
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 56
tgacggttcg gagagcagtt cgccaggtta gagtagatgt gg 42 <210> SEQ
ID NO 57 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
primer <400> SEQUENCE: 57 aactgctctc cgaaccgtca gaaaccggtt
gttgaccact ctg 43 <210> SEQ ID NO 58 <211> LENGTH: 45
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 58
gtagaaccaa cagagttgat acgaacagag tggtcaacaa ccggt 45 <210>
SEQ ID NO 59 <211> LENGTH: 42 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 59 cgtatcaact ctgttggttc
taccgcgtct tcttctcagc cg 42 <210> SEQ ID NO 60 <211>
LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic primer <400>
SEQUENCE: 60 aacgtcgtcg tgaaccagca gcggctgaga agaagacgcg 40
<210> SEQ ID NO 61 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 61 gttgtttcat atgtacgaag
ttcagtggaa ag 32
<210> SEQ ID NO 62 <211> LENGTH: 36 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic primer <400> SEQUENCE: 62 gttgtttgtc gactaaacgt
cgtcgtgaac cagcag 36 <210> SEQ ID NO 63 <211> LENGTH:
34 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial Sequence: Synthetic primer <400> SEQUENCE: 63
gttcttgtcg actatttctg acggttcgga gagc 34 <210> SEQ ID NO 64
<211> LENGTH: 1325 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
polynucleotide <220> FEATURE: <221> NAME/KEY: CDS
<222> LOCATION: (88)..(1302) <400> SEQUENCE: 64
taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gaaataattt
60 tgtttaactt taagaaggag atatacc atg ggt cac cac cat cac cat cat
atg 114 Met Gly His His His His His His Met 1 5 tac gaa gtt cag tgg
aaa gtt gtt gaa gaa atc aac ggt aac aac tac 162 Tyr Glu Val Gln Trp
Lys Val Val Glu Glu Ile Asn Gly Asn Asn Tyr 10 15 20 25 gtt tac atc
gac ccg acc cag ctg ccg tac gac cac aaa tgg gag ttc 210 Val Tyr Ile
Asp Pro Thr Gln Leu Pro Tyr Asp His Lys Trp Glu Phe 30 35 40 ccg
cgt aac cgt ctg tct ttc ggt aaa acc ctg ggt gcg ggt gcg ttc 258 Pro
Arg Asn Arg Leu Ser Phe Gly Lys Thr Leu Gly Ala Gly Ala Phe 45 50
55 ggt aaa gtt gtt gaa gcg acc gcg tac ggt ctg atc aaa tct gac gcg
306 Gly Lys Val Val Glu Ala Thr Ala Tyr Gly Leu Ile Lys Ser Asp Ala
60 65 70 gcg atg acc gtt gcg gtt aaa atg ctg aaa ccg tct gcg cac
ctg acc 354 Ala Met Thr Val Ala Val Lys Met Leu Lys Pro Ser Ala His
Leu Thr 75 80 85 gaa cgt gaa gcg ctg atg tct gaa ctg aaa gtt ctg
tct tac ctg ggt 402 Glu Arg Glu Ala Leu Met Ser Glu Leu Lys Val Leu
Ser Tyr Leu Gly 90 95 100 105 aac cac atg aac atc gtt aac ctg ctg
ggt gcg tgc acc atc ggt ggt 450 Asn His Met Asn Ile Val Asn Leu Leu
Gly Ala Cys Thr Ile Gly Gly 110 115 120 ccg acc ctg gtt atc acc gaa
tac tgc tgc tac ggt gac ctg ctg aac 498 Pro Thr Leu Val Ile Thr Glu
Tyr Cys Cys Tyr Gly Asp Leu Leu Asn 125 130 135 ttc ctg cgt cgt aaa
cgt gac tct ttc atc tgc tct aaa cag gaa gac 546 Phe Leu Arg Arg Lys
Arg Asp Ser Phe Ile Cys Ser Lys Gln Glu Asp 140 145 150 cac gcg gaa
gcg gcg ctg tac aaa aac ctg ctg cac tct aaa gaa tct 594 His Ala Glu
Ala Ala Leu Tyr Lys Asn Leu Leu His Ser Lys Glu Ser 155 160 165 tct
tgc tct gac tct acc aac gaa tac atg gac atg aaa ccg ggt gtt 642 Ser
Cys Ser Asp Ser Thr Asn Glu Tyr Met Asp Met Lys Pro Gly Val 170 175
180 185 tct tac gtt gtt ccg acc aaa gcg gac aaa cgt cgt tct gtt cgt
atc 690 Ser Tyr Val Val Pro Thr Lys Ala Asp Lys Arg Arg Ser Val Arg
Ile 190 195 200 ggt tct tac atc gaa cgt gac gtt acc ccg gcg atc atg
gaa gac gac 738 Gly Ser Tyr Ile Glu Arg Asp Val Thr Pro Ala Ile Met
Glu Asp Asp 205 210 215 gaa ctg gcg ctg gac ctg gaa gac ctg ctg tct
ttc tct tac cag gtt 786 Glu Leu Ala Leu Asp Leu Glu Asp Leu Leu Ser
Phe Ser Tyr Gln Val 220 225 230 gcg aaa ggt atg gcg ttc ctg gcg tct
aaa aac tgc atc cac cgt gac 834 Ala Lys Gly Met Ala Phe Leu Ala Ser
Lys Asn Cys Ile His Arg Asp 235 240 245 ctg gcg gcg cgt aac atc ctg
ctg acc cac ggt cgt atc acc aaa atc 882 Leu Ala Ala Arg Asn Ile Leu
Leu Thr His Gly Arg Ile Thr Lys Ile 250 255 260 265 tgc gac ttc ggt
ctg gcg cgt gac atc aaa aac gac tct aac tac gtt 930 Cys Asp Phe Gly
Leu Ala Arg Asp Ile Lys Asn Asp Ser Asn Tyr Val 270 275 280 gtt aaa
ggt aac gcg cgt ctg ccg gtt aaa tgg atg gcg ccg gaa tct 978 Val Lys
Gly Asn Ala Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ser 285 290 295
atc ttc aac tgc gtt tac acc ttc gaa tct gac gtt tgg tct tac ggt
1026 Ile Phe Asn Cys Val Tyr Thr Phe Glu Ser Asp Val Trp Ser Tyr
Gly 300 305 310 atc ttc ctg tgg gaa ctg ttc tct ctg ggt tct tct ccg
tac ccg ggt 1074 Ile Phe Leu Trp Glu Leu Phe Ser Leu Gly Ser Ser
Pro Tyr Pro Gly 315 320 325 atg ccg gtt gac tct aaa ttc tac aaa atg
atc aaa gaa ggt ttc cgt 1122 Met Pro Val Asp Ser Lys Phe Tyr Lys
Met Ile Lys Glu Gly Phe Arg 330 335 340 345 atg ctg tct ccg gaa cac
gcg ccg gcg gaa atg tac gac atc atg aaa 1170 Met Leu Ser Pro Glu
His Ala Pro Ala Glu Met Tyr Asp Ile Met Lys 350 355 360 acc tgc tgg
gac gcg gac ccg ctg aaa cgt ccg acc ttc aaa cag atc 1218 Thr Cys
Trp Asp Ala Asp Pro Leu Lys Arg Pro Thr Phe Lys Gln Ile 365 370 375
gtt cag ctg atc gaa aaa cag atc tct gaa tct acc aac cac atc tac
1266 Val Gln Leu Ile Glu Lys Gln Ile Ser Glu Ser Thr Asn His Ile
Tyr 380 385 390 tct aac ctg gcg aac tgc tct ccg aac cgt cag aaa
tagtcgactg 1312 Ser Asn Leu Ala Asn Cys Ser Pro Asn Arg Gln Lys 395
400 405 aaaaaggaag agt 1325 <210> SEQ ID NO 65 <211>
LENGTH: 405 <212> TYPE: PRT <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial Sequence: Synthetic polypeptide
<400> SEQUENCE: 65 Met Gly His His His His His His Met Tyr
Glu Val Gln Trp Lys Val 1 5 10 15 Val Glu Glu Ile Asn Gly Asn Asn
Tyr Val Tyr Ile Asp Pro Thr Gln 20 25 30 Leu Pro Tyr Asp His Lys
Trp Glu Phe Pro Arg Asn Arg Leu Ser Phe 35 40 45 Gly Lys Thr Leu
Gly Ala Gly Ala Phe Gly Lys Val Val Glu Ala Thr 50 55 60 Ala Tyr
Gly Leu Ile Lys Ser Asp Ala Ala Met Thr Val Ala Val Lys 65 70 75 80
Met Leu Lys Pro Ser Ala His Leu Thr Glu Arg Glu Ala Leu Met Ser 85
90 95 Glu Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met Asn Ile Val
Asn 100 105 110 Leu Leu Gly Ala Cys Thr Ile Gly Gly Pro Thr Leu Val
Ile Thr Glu 115 120 125 Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu
Arg Arg Lys Arg Asp 130 135 140 Ser Phe Ile Cys Ser Lys Gln Glu Asp
His Ala Glu Ala Ala Leu Tyr 145 150 155 160 Lys Asn Leu Leu His Ser
Lys Glu Ser Ser Cys Ser Asp Ser Thr Asn 165 170 175 Glu Tyr Met Asp
Met Lys Pro Gly Val Ser Tyr Val Val Pro Thr Lys 180 185 190 Ala Asp
Lys Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu Arg Asp 195 200 205
Val Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu Glu 210
215 220 Asp Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala Phe
Leu 225 230 235 240 Ala Ser Lys Asn Cys Ile His Arg Asp Leu Ala Ala
Arg Asn Ile Leu 245 250 255 Leu Thr His Gly Arg Ile Thr Lys Ile Cys
Asp Phe Gly Leu Ala Arg 260 265 270 Asp Ile Lys Asn Asp Ser Asn Tyr
Val Val Lys Gly Asn Ala Arg Leu 275 280 285 Pro Val Lys Trp Met Ala
Pro Glu Ser Ile Phe Asn Cys Val Tyr Thr 290 295 300 Phe Glu Ser Asp
Val Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe 305 310 315 320 Ser
Leu Gly Ser Ser Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe 325 330
335 Tyr Lys Met Ile Lys Glu Gly Phe Arg Met Leu Ser Pro Glu His Ala
340 345 350 Pro Ala Glu Met Tyr Asp Ile Met Lys Thr Cys Trp Asp Ala
Asp Pro 355 360 365 Leu Lys Arg Pro Thr Phe Lys Gln Ile Val Gln Leu
Ile Glu Lys Gln 370 375 380 Ile Ser Glu Ser Thr Asn His Ile Tyr Ser
Asn Leu Ala Asn Cys Ser 385 390 395 400 Pro Asn Arg Gln Lys 405
<210> SEQ ID NO 66 <211> LENGTH: 14 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial Sequence:
Synthetic peptide <400> SEQUENCE: 66
Lys Lys Lys Ser Pro Gly Glu Tyr Val Asn Ile Glu Phe Gly 1 5 10
* * * * *