U.S. patent application number 15/498344 was filed with the patent office on 2017-08-17 for nucleic acid detection system and method for detecting influenza.
The applicant listed for this patent is Los Alamos National Security, LLC. Invention is credited to Hong Cai, Jian Song.
Application Number | 20170233794 15/498344 |
Document ID | / |
Family ID | 52632209 |
Filed Date | 2017-08-17 |
United States Patent
Application |
20170233794 |
Kind Code |
A1 |
Cai; Hong ; et al. |
August 17, 2017 |
Nucleic Acid Detection System and Method for Detecting
Influenza
Abstract
The invention provides a rapid, sensitive and specific nucleic
acid detection system which utilizes isothermal nucleic acid
amplification in combination with a lateral flow chromatographic
device, or DNA dipstick, for DNA-hybridization detection. The
system of the invention requires no complex instrumentation or
electronic hardware, and provides a low cost nucleic acid detection
system suitable for highly sensitive pathogen detection.
Hybridization to single-stranded DNA amplification products using
the system of the invention provides a sensitive and specific means
by which assays can be multiplexed for the detection of multiple
target sequences.
Inventors: |
Cai; Hong; (Los Alamos,
NM) ; Song; Jian; (Gainesville, VA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Los Alamos National Security, LLC |
Los Alamos |
NM |
US |
|
|
Family ID: |
52632209 |
Appl. No.: |
15/498344 |
Filed: |
April 26, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14660773 |
Mar 17, 2015 |
|
|
|
15498344 |
|
|
|
|
11894908 |
Aug 22, 2007 |
8980561 |
|
|
14660773 |
|
|
|
|
60839537 |
Aug 22, 2006 |
|
|
|
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
C12Q 1/6853 20130101;
C12Q 2600/158 20130101; C12Q 2600/16 20130101; C12Q 1/701 20130101;
C12Q 1/6816 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12Q 1/70 20060101 C12Q001/70 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under
Contract No. DE-AC52-06NA25396, awarded by the United States
Department of Energy. The government has certain rights in this
invention.
Claims
1. A device for detecting the presence of one or more target
nucleic acids in a fluid sample, the device comprising: an
absorbent sample receiving zone for receiving the fluid sample; a
detection zone comprising immobilized capture oligonucleotides,
each capture oligonucleotide complementary to a capture sequence of
one of the target nucleic acids; and an absorbent material for
transporting the sample from said sample receiving zone to said
detection zone; wherein said detection zone produces a signal
visible by the unaided human eye without the use of instrumentation
in less than approximately 30 minutes, the signal having a
sensitivity comparable to that of a typical homogeneous
fluorescence assay.
2. The device of claim 1 wherein the signal is produced in
approximately 5 minutes.
3. The device of claim 2 wherein the signal is produced in
approximately 2 minutes
4. The device of claim 1 capable of detecting 20 fmoles of one of
the target nucleic acids.
5. The device of claim 1 wherein the target nucleic acids are
viral.
6. The device of claim 1 wherein said absorbent material comprises
visible detection particles conjugated to detection
oligonucleotides complementary to a detection sequence of one of
the target nucleic acids.
7. The device of claim 6 wherein said detection particles are
selected from the group consisting of dyed microspheres, dyed
polystyrene microspheres, dyed carboxyl-polystyrene microspheres,
dyed microbeads, quantum dots, nano-gold particles, and colloidal
gold particles.
8. The device of claim 6 wherein said detection oligonucleotides
comprise peptide nucleic acid (PNA) or locked nucleic acid
(LNA).
9. The device of claim 6 wherein said detection oligonucleotides
comprise an inactive 3'.
10. The device of claim 9 wherein said detection oligonucleotides
are modified by an inactive phosphate group or thiolated group
instead of an active 3' hydroxy group, and thus may not be used for
primer extension.
11. The device of claim 6 wherein a concentration of detection
particles is approximately 0.01% w/v per assay.
12. The device of claim 1 wherein said absorbent material comprises
a nitrocellulose membrane.
13. The device of claim 1 wherein said sample receiving zone and/or
said absorbent material been impregnated with a substance selected
from the group consisting of Triton-X100, SDS, BSA, ficol,
polyvinyl pyrolidone, and combinations thereof.
14. The device of claim 1 wherein said absorbent material comprises
a conjugate release pad.
15. The device of claim 1 wherein a length of said absorbent
material is 60 mm.
16. The device of claim 1 comprising a width of 300 mm.
17. The device of claim 1 wherein said detection zone comprises a
plurality of spots or shapes, each spot or shape comprising a
plurality of identical capture oligonucleotides complementary to a
capture sequence of one of the target nucleic acids.
18. The device of claim 17 wherein capture oligonucleotides present
at different spots or shapes bind to different capture sequences of
one or more of the target nucleic acids.
19. The device of claim 17 wherein said plurality of spots or
shapes comprises a microarray.
20. The device of claim 1 operable with a sample volume of less
than approximately 400 microliters.
21. The device of claim 20 operable with a sample volume of less
than approximately 200 microliters.
22. The device of claim 21 operable with a sample volume of less
than approximately 50 microliters.
23. The device of claim 22 operable with a sample volume of
approximately 20 microliters.
24. The device of claim 1 wherein said capture oligonucleotides
comprise peptide nucleic acid (PNA) or locked nucleic acid (LNA).
Description
RELATED APPLICATIONS
[0001] This patent application is a continuation application of
U.S. patent application Ser. No. 14/660,773, entitled "Nucleic Acid
Detection System and Method for Detecting Influenza", filed on Mar.
17, 2015, which patent application is a divisional application of
U.S. patent application Ser. No. 11/894,908, entitled "Nucleic Acid
Detection System and Method for Detecting Influenza", filed on Aug.
22, 2007 and issued on Mar. 17, 2015 as U.S. Pat. No. 8,980,561,
which application claims the benefit of the filing date of U.S.
Provisional patent application No. 60/839,537 filed Aug. 22, 2006
under 35 U.S.C. 119(e).
BACKGROUND OF THE INVENTION
[0003] I. Influenza Viruses:
[0004] Influenza viruses have a segmented genome of single-stranded
negative-sense RNA and belong to the family Orthomyxoviridae. They
have been isolated from a variety of animals, including humans,
pigs, horses, sea mammals, and birds. In humans, influenza viruses
cause a highly contagious acute respiratory disease that has been
responsible for epidemic and pandemic disease in humans for
centuries. In the 20.sup.th century, influenza virus has already
claimed millions of human lives in three different pandemics (40
million worldwide deaths during the Spanish flu by the influenza
H1N1 strain in 1918; 70,000 American deaths in 1957 by the
influenza H2N2 strain; and 34,000 American deaths in 1968 by the
influenza H3N2 strain). Infection with Influenza viruses can lead
to a wide spectrum of clinical disease from an asymptomatic
infection to an acute, self-limiting influenza syndrome to severe
sometimes fatal complications. The severity of disease depends
generally on the age and health of the patient with most
influenza-associated fatalities seen in the elderly or those who
have underlying pulmonary or cardiac diseases.
[0005] Influenza A and B are the two types of influenza viruses
that cause epidemic human disease. Influenza A viruses are further
categorized into subtypes on the basis of two surface antigens:
hemagglutinin and neuraminidase. Influenza B viruses are not
categorized into subtypes. Since 1977, influenza A (H1N1) viruses,
influenza A (H3N2) viruses, and influenza B viruses have circulated
globally. In 2001, influenza A (H1N2) viruses that probably emerged
after genetic reassortment between human A (H1N1) and A (H3N2)
viruses began circulating widely. Both influenza A and B viruses
are further separated into groups on the basis of antigenic
characteristics. New influenza virus variants result from frequent
antigenic change (i.e., antigenic drift) resulting from point
mutations that occur during viral replication. Influenza B viruses
undergo antigenic drift less rapidly than influenza A viruses.
[0006] Influenza A viruses are the major cause of human flu
epidemics. Influenza A can be classified into subtypes based on the
antigenic differences of two surface glycoproteins, hemagglutinin
(HA) and neuraminidase (NA). Among 15 distinct HA subtypes and 9 NA
subtypes discovered, only several of them (H1, H2, H3, N1, N2) are
responsible for significant human epidemics. One reason behind the
frequent epidemics is that Influenza A is subject to regular
antigenic changes, brought about either by point mutations (genetic
drift) in the genes coding for hemagglutinin or neuraminidase, or
by re-assortment of genes from two distinct types of influenza
(genetic shift). In both situations, prior immunity to influenza
might not prevent infection with the new type, leading to localized
epidemics or, in the case of genetic shift, a global pandemic of
influenza.
[0007] Influenza A is also responsible for all Avian flu. Of
particular interest are the highly pathogenic strains of avian
influenza virus (AIV), which cause severe disease in many bird
species, including domestic poultry. While most of avian flu is
mild, there are some extremely virulent viruses in poultry with a
mortality rate as high as 100% (Webby et al., 2003, Science 302:
1519). There have been 13 reported outbreaks of HPAI (Highly
Pathogenic Avian Influenza) due to subtype H7 and 12 outbreaks due
to subtype H5 since 1959. In early 2003, an outbreak of highly
pathogenic H7N7 in the Netherlands (spreading to Belgium and
Germany) resulted in the death or culling of about 30 million birds
which caused significant economic loss and social panic. However,
the biggest concern is the recent crossing of the species barrier
to infect humans. In 1996, an avian influenza virus
[A/England/268/96(H7N7)] was isolated from a woman with
conjunctivitis, and a virus of the same subtype was isolated from a
man with infectious hepatitis. The highly pathogenic H7N7 outbreak
in the Netherlands of 2003 resulted in one human fatality and
approximately 100 other confirmed human AIV infections. The most
significant transmission took place in Hong Kong where an out break
of HPAI subtype H5N1 occurred in chickens resulting in high
mortality for infected birds in 1997 (Webster et al., 2003, Amer
Scientists 91: 122; Palese et al., 2002, J. Clin. Invest. 110: 9).
The same virus was then isolated from 18 individuals in Hong Kong,
six of whom died. This was the first reported instance of an avian
influenza virus H5N1 directly crossing the species barrier and
infecting humans.
[0008] Since then, cases of influenza A (H5N1) infection have been
reported in Cambodia, China, Indonesia, Thailand, Vietnam, and most
recently, several cases in Turkey. As of Feb. 6, 2006, the WHO had
confirmed 150 human H5N1 cases of which more than half have died
(>50% mortality rate). Experts predict that another influenza
pandemic is inevitable and possibly imminent due to the rapid
evolution of emerging and re-emerging influenza strains. The
severity of the next pandemic cannot be predicted, but modeling
studies suggest that the impact of a pandemic on the United States
could be substantial. In the absence of any control measures
(vaccination or drugs), it has been estimated that in the United
States a "medium-level" pandemic could cause 89,000 to 207,000
deaths, 314,000 and 734,000 hospitalizations, 18 to 42 million
outpatient visits, and another 20 to 47 million people being sick.
Between 15% and 35% of the U.S. population could be affected by an
influenza pandemic, and the economic impact could range between
$71.3 and $166.5 billion (http://www.cdc.gov/flu). The estimation
on worldwide impact can easily be ten times the US figures.
[0009] Influenza B also causes frequent epidemics, though it is
generally less virulent than Influenza A. Humans are the sole host
of Influenza B. There are no distinguishable surface antigen
markers for subtypes of Influenza B due to a lack of genetic shift.
However, Influenza B does undergo antigenic changes, although at a
much slower rate than Influenza A, via other insertion-deletion and
reassortment mechanisms among circulation strains.
[0010] Annual immunization remains the best way to prevent
infection in populations. Each year the influenza circulating
strains are monitored by a global surveillance program to determine
the vaccine composition for that year. Minor genetic drift
occurring in the circulating viruses can reduce the effectiveness
of the vaccine in preventing illness but, even then, partial
immunity afforded by the vaccine will often attenuate the
infection, reducing the occurrence of severe illness and
complications (Kilbourne et al., 2002, Proc. Natl. Acad. Sci. USA
99: 10748; Palese et al., 2002, supra; Nicholson et al., 2003,
Lancet (NA Ed.) 362: 1733). As for H5N1 pandemic prevention, the
United States is unlikely to have access to the H5N1 vaccine until
the 2008 flu season despite the recent effort of expediting the
vaccine development and production.
[0011] To treat a regular influenza infection, four different
antiviral medications (amantadine, rimantadine, oseltamivir and
zanamivir are approved by the U.S. Food and Drug Administration
(FDA). Amantadine and rimantadine belong to a group of
neuraminidase inhibitors that are capable of blocking the ability
of the virus to cleave itself from the host cell preventing further
infection of neighboring cells. To prepare for a possible H5N1
pandemic, the US government is planning to spend .about.$2 billion
to stock sufficient Tamiflu.TM. dosages to cover 25% US population
by 2010 (Gani et al., 2005, Emerging Infectious Diseases 11: 1355).
These drugs usually work against influenza A viruses effectively if
administrated within 48 hours of symptom onset (Stiver, 2003,
Canadian Med. Assoc. J. 168: 827). However, these drugs may not
always be effective, as influenza virus strains can become
resistant to one or more of these medications. For example, some of
the 2004 H5N1 viruses isolated from poultry and humans are
resistant to amantadine and rimantadine (de Jong et al., 2005, New
England J. Med. 353: 2667; Ilyushina et al., 2005, Virology 341:
102). More recently, testing of seasonal influenza A (H3N2)
isolates from individuals in the United States during the 2005-06
influenza season has shown that a high percentage of circulating
viruses are resistant to amantadine and rimantadine (Bright et al.,
2005, Lancet (NA Ed.) 366: 1175; Fauci, 2006, Avian Influenza
Update, Nature Reviews Microbiol. 4: 9; Ilyushina et al., 2005,
supra).
[0012] The fact that antivirals must be administered within 48
hours of symptom onset, combined with the rapid development of new
drug-resistant strains and the inability of governments to meet
population anti-viral needs in a pandemic situation, together
highlight the urgent need for rapid and accurate point of care
diagnosis in order to enable effective treatment and prevention of
influenza. Towards this end, numerous laboratories have focused on
facile methods for the rapid and sensitive detection of influenza
viruses. Standard detection methodologies include virus isolation,
culturing and serotyping. Unfortunately, these techniques often
take days or weeks to complete, which is often far too late for
therapeutic intervention. Alternative strategies which are employed
include viral antigen detection and shell vial culturing, which
give rapid results but are far less sensitive than conventional
cell culturing (Dawson et al., 2007, Analytical Chemistry 79:
378-384.).
[0013] II. Nucleic Acid-Based Assays
[0014] Nucleic acid-based assays for pathogen detection and
identification are unparalleled with respect to providing
sensitivity, specificity and resolution. Nonetheless, technologies
for nucleic acid detection continue to be relatively elaborate and
often costly, limiting their utility for point of care diagnostics
and deployment under field conditions where a supporting laboratory
infrastructure is absent. Reliance on polymerase chain reaction
(PCR) and fluorescent detection of amplified nucleic acids has
contributed significantly to the complexity and cost of nucleic
acid diagnostics. Retaining assay sensitivity while circumventing
requirements for thermocyclers and fluorescence detection hardware
remains a significant challenge.
[0015] In contrast to DNA-based assays, immunoassays have found
widespread acceptance in low cost, easily used formats, perhaps the
most notable of which is the chromatographic lateral flow
immunoassay (Andreotti et al., 2003, Biotechniques 35(4): 850-859).
Lateral flow assays, also known as hand-held assays or dipstick
assays, are used for a broad range of applications where rapid
antigen detection is required in an easily used, low cost format.
Lateral flow immunoassays have been successfully employed for
pathogen identification, diagnostics, and environmental and
agriculture surveillance (Baeumner, 2003, Anal. Bioanal. Chem.
377(3): 434-435).
[0016] Several chromatographic lateral flow assays have been
described for the detection of nucleic acid sequences. Early work
made use of cumbersome enzymatic detection strategies that relied
on time consuming manipulations of dipsticks following introduction
of the sample (Reinhartz et al., 1993, Gene 136:221-226; Groody,
1996, Mol. Biotechnol. 6: 323-327). More recently, lateral
flow-based detection of PCR products has been reported using
standard immunological methods for lateral flow detection of
antigen-labeled amplicons (Kozwich et al., 2000, Appl. Environ.
Microbiol. 66(7): 2711-2717). Other lateral flow assays make use of
PCR amplification and colorimetric detection using nanogold
conjugates and biotin-streptavidin capture. While this approach
provides rapid single-plex detection of amplification products, it
remains linked to the hardware requirements of PCR (Glynou et al.,
2003, Anal. Chem. 75: 4155-4160; Kunkel & Boyce-Jacino, WO
00/29112).
[0017] The appeal of lateral flow detection in the context of a
PCR-based assay is limited by the fact that real-time PCR detection
would offer similar hardware complexity compared to
post-thermocycling introduction of PCR reactions onto a lateral
flow detector with single amplicon detection capacity. This scheme
requires each PCR reaction to be interrogated with a separate
dipstick thus increasing sample handling and decreasing throughput.
In addition to the hardware requirements of PCR, these devices have
employed schemes poorly suited to multiplexed detection, further
limiting their utility to single-plex PCR assays.
[0018] Strategies to eliminate PCR amplification have sought to
either detect unamplified nucleic acid targets or to employ
isothermal amplification techniques. Enabled by the use of
up-converting phosphor reporters, unamplified Streptococcus
pneumoniae DNA has been detected using a lateral flow assay format
(Zuiderwijk et al., 2003, Clin. Biochem. 36(5): 401-403).
Up-converting phosphor technology, while sensitive, remains
dependent upon hardware required to detect phosphor emission
(Zijlmans et al., 1999, Anal. Biochem. 267(1): 30-36).
[0019] The use of simple colorimetric detection schemes that
circumvent the requirements for complex instrumentation require an
upstream amplification strategy to attain suitable sensitivity.
Isothermal nucleic acid amplification coupled with lateral flow
detection has been reported for assays making use of cycling probe
technology (CPT) and nucleic acid sequence-based amplification
(NASBA), two isothermal amplification techniques (Fong et al.,
2000, J. Clin. Microbiol. 38(7): 2525-2529; Baeumner et al., 2002,
Anal. Chem. 74(6): 1442-1448; Hartley and Baeumner, 2003, Anal.
Bioanal. Chem. 376: 319-327; Baeumner et al., 2004, Anal. Chem. 76:
888-894). While the work by Fong et al., made use of a lateral flow
immunoassay for DNA detection, the NASBA amplified products
generated in the work from Baeumner et al. were detected using a
lateral flow system enabled by the use of liposome encapsulated dye
and a sandwich hybridization assay similar that reported by Rule et
al., 1996). Later refinements to the liposome detection scheme have
demonstrated the utility of this approach for multianalyte
detection (Zaytseva et al., 2004, Anal. Bioanal. Chem. 380:
46-53).
[0020] Numerous technologies for the amplification of nucleic acids
are known. The polymerase chain reaction (PCR) presently dominates
the field, and is supported by widespread use and a multiplicity of
commercial platforms and products. However, PCR presents inherent
limitations for applications in which simple, rapid nucleic acid
assays are desired. PCR requires the use of a thermocycler, an
expensive, electrified machine that is not easily adapted to
environments outside of laboratories with technically trained
personnel. In a typical reaction, a thermocycler can process a
total of 10-200 .mu.l reaction volumes, typically utilizing a 2-20
.mu.l sample input. Because of the small volume involved in the
reaction, micropipets, specialized PCR tubes, and special training
are needed to perform PCR. Thus, clinical PCR assays for the
detection of pathogenic agents are generally conducted by clinical
reference laboratories. PCR also requires on the order of 30
minutes to 4 hours to accomplish (depending on the types of PCR
instruments and reaction volume), the direct result of having to
cycle between radically different temperatures.
[0021] Various "isothermal" amplification methods, which can be
conducted at a constant temperature, have been developed and are in
use. While eliminating the need for thermocycling,
currently-available isothermal amplification technologies require
varying degrees of technical expertise and some rely on multiple
primers and other factors which negatively effect assay time,
expense, sensitivity and specificity. Many of the isothermal
amplification technologies described to date are slow, insensitive,
and unreliable. In addition, many of the viable isothermal
amplification technologies are run at temperatures far higher than
ambient temperatures, and therefore require heating.
[0022] Strand displacement amplification, or SDA (Walker et al.,
1992a, Nucl. Acids Res. 20: 1691-1696; Walker et al., 1992b, Proc.
Natl. Acad. Sci. USA 89: 392-396), is one commercially-available
isothermal amplification technology. SDA is based upon the ability
of a restriction enzyme to nick one strand of a
hemiphosphorothioated form of its double-stranded recognition site,
combined with the ability of a polymerase to initiate synthesis at
the nick and displace the downstream DNA strand. Although SDA has
been improved to work well at 60.degree. C., the reaction requires
several hours to perform at ambient temperatures. Furthermore, the
assay involves the incorporation of a thiated dNTP substrate into
newly synthesized strands, which sometimes impedes replication and
extension. Finally, the resulting amplification product is
double-stranded DNA, requiring denaturation prior to detection by
hybridization analysis.
[0023] Another recently described isothermal amplification
technology is the EXPAR system (Van Ness et al., 2003, Proc. Natl.
Acad. Sci USA 100(8): 4504-4509). Although this technology
initially held promise, it is extremely unreliable, nonspecific,
and difficult to use. Relying on thermophilic polymerases and
reaction conditions that must be perfectly controlled, this
technology is hampered by problems including spontaneous
primer-independent polymerization of non-specific amplification
products. More importantly, EXPAR requires that a specific nicking
agent recognition sequence be located on the target DNA in a way
that permits specific priming. Rarely is this the case in the
context of pathogen target detection, and therefore this technology
is fundamentally limited.
[0024] Helicase Dependent Amplification (HDA) is a recently
described isothermal nucleic acid amplification method which relies
on a helicase enzyme to open double stranded DNAs, thus obviating
the need for heat denaturation of double stranded targets (Vincent
et al., 2004, EMBO Report 5: 795; An et al., 2005, J. Biol. Chem.
280: 28952). Detailed information concerning the use of HDA to
detect DNA may be found in published United States Patent
Application No. 20040058378. Detailed information concerning the
use of HDA in detecting RNA species may be found in published
United States Patent Application No. 20060154286.
[0025] Other isothermal amplification technologies include the
Ligase Chain Reaction (LCR) (Landgren et al., 1988; Barany et al.,
1991), Transcription-based Amplification System (Kwoh et al.,
1989), Self-Sustained Sequence Replication (Guatelli et al., 1990),
NASBA (Nucleic Acid Based Amplification)(Kievitis et al., 1991;
commercially available from BioMerieux), and Q-beta Replicase
(Dobkin et al., 1979, Biochemistry 18: 2038-2044).
[0026] Methods for the amplification of RNA have also been
described. Principally, RNA amplification has relied upon the use
of reverse-transcriptase-PCR (RT-PCR). RT-PCR is widely used and is
supported by multiple commercial platforms and products. RT-PCR
works by generating a single stranded DNA copy which is then
exponentially amplified by PCR. However, RT-PCR is burdened by all
of the limitations inherent to PCR, including the requirement for
thermocycling and the double-stranded nature of the resulting
amplification product. Methodologies which attempt to overcome the
limitations of RT-PCR are generally based on the combined use of an
RNA-dependent, DNA polymerase, and a DNA-dependent DNA polymerase.
See, for example, U.S. application no. 20050014192, which describes
an isothermal strand displacement type of RNA amplification
methodology. HDA has also been adapted successfully for the
detection of RNA species by combining HDA with a reverse
transcriptase reaction to convert RNA into cDNA, which is then
exponentially amplified by HDA (RT-HDA; see published US Patent
Application 20060154286).
[0027] Therefore, there is a growing need for simpler, faster, more
cost effective nucleic acid amplification methodologies,
particularly those which may be conducted at ambient temperatures
without the need for electrified and other specialized equipment or
personnel. This need is acute with respect to the detection of
pathogenic organisms in the context of biological terrorism and
warfare, as well as in the context of clinical diagnosis of
infectious diseases which require immediate identification in order
to provide effective treatment to infected individuals. For
example, as previously mentioned, infections by the highly virulent
strains of the avian influenza virus must be treated within 48
hours of initial infection, thereby rendering useless any assay
technology that cannot be performed rapidly and with reliable
specificity and sensitivity. Similarly, there is a great need for
field-deployable nucleic acid assays, both on the battlefield and
in remote regions of the world. Here, too, the development of
simple and reliable isothermal amplification technologies is a
prerequisite to the development of such assays.
[0028] Ideally, a simple lateral flow device employing dry, stable
detection reagents compatible with a multiplexed
hybridization-based capture strategy would be coupled to an easily
used, rapid isothermal amplification scheme that generates
single-stranded DNAs suitable for direct hybridization to the
capture and detection oligonucleotides of a sandwich assay.
SUMMARY OF THE INVENTION
[0029] The invention provides a rapid, sensitive and specific
nucleic acid detection system which utilizes isothermal nucleic
acid amplification in combination with a lateral flow
chromatographic device, or DNA dipstick, for DNA-hybridization
detection. The system of the invention requires no complex
instrumentation or electronic hardware, and provides a low cost
nucleic acid detection system suitable for highly sensitive
pathogen detection. Hybridization to single-stranded DNA
amplification products using the system of the invention provides a
sensitive and specific means by which assays can be multiplexed for
the detection of multiple target sequences.
[0030] A principal aspect of the invention relates to the rapid
detection of infectious influenza and related flu-like viruses via
amplification and detection of signature genomic RNA sequences
using the nucleic acid detection system of the invention. The
system may be divided into three general components: (a) extraction
of target viral RNA from clinical specimens, (b) specific
amplification of viral target sequences, and (c) detection of the
amplified target sequences using a lateral flow DNA-hybridization,
visual read-out device.
[0031] In one aspect, the invention provides a method for detecting
the presence of an influenza virus target nucleic acid in a
clinical sample, comprising: (a) isolating influenza virus
particles which contain the target nucleic acid from the clinical
sample using magnetic affinity capture; (b) releasing total nucleic
acid from the influenza virus particles; (c) amplifying influenza
target nucleic acid using reverse transcriptase in combination with
helicase dependent amplification, using amplification primers
specific to the influenza target nucleic acid, to generate a
solution containing a DNA amplification product corresponding to
the influenza target nucleic acid sequence; (d) hybridizing a
detection oligonucleotide complementary to a first sequence of the
influenza target nucleic acid to the DNA amplification product,
which first sequence does not overlap with the amplification primer
binding regions on the influenza target nucleic acid, which
detection oligonucleotide is coupled to a detectable label, to
generate a solution containing labeled DNA amplification product;
(e) applying an aliquot of the solution containing the labeled DNA
amplification product to a sample receiving zone of a lateral flow
chromatographic device, wherein the lateral flow chromatographic
device comprises a lateral flow matrix which defines a flow path
and which comprises in series: (i) a sample receiving zone for
receiving an aliquot of a fluid sample; and, (ii) a capture zone in
lateral flow contact with said receiving zone, said capture zone
comprising a microporous membrane, at least a portion of which
contains at least one capture oligonucleotide immobilized thereto,
which capture oligonucleotide is complementary to a second and
distinct sequence of the influenza target nucleic acid; and, (f)
detecting the presence of the influenza target nucleic acid by
detecting the label at the site of the immobilized capture
oligonucleotide.
[0032] In another aspect, the invention provides a method for
detecting the presence of an influenza virus target nucleic acid in
a clinical sample, comprising: (a) isolating influenza virus
particles which contain the target nucleic acid from the clinical
sample using magnetic affinity capture; (b) releasing total nucleic
acid from the influenza virus particles; (c) amplifying influenza
target nucleic acid using reverse transcriptase in combination with
helicase dependant amplification, using amplification primers
specific to the influenza target nucleic acid, to generate a
solution containing a DNA amplification product corresponding to
the influenza target nucleic acid sequence; (d) applying an aliquot
of the solution containing the DNA amplification product to a
sample receiving zone of a lateral flow chromatographic device,
wherein the lateral flow chromatographic device comprises a lateral
flow matrix which defines a capillary flow path and which comprises
in series: (i) a sample receiving zone for receiving an aliquot of
a fluid sample; (ii) a labeling zone in lateral flow contact with
said sample receiving zone, wherein the labeling zone comprises a
porous material containing at least one detection oligonucleotide
diffusively bound thereto, which detection oligonucleotide is
complementary to a first sequence of the influenza target nucleic
acid and is coupled to a detectable label; and, (iii) a capture
zone in lateral flow contact with said labeling zone, said capture
zone comprising a microporous membrane, at least a portion of which
contains at least one capture oligonucleotide immobilized thereto,
which capture oligonucleotide is complementary to a second and
distinct sequence of the influenza target nucleic acid; (e)
allowing the solution to traverse through the labeling and capture
zones, under conditions sufficient to enable the hybridization of
the DNA amplification product to the detection and capture
oligonucleotides; and, (f) detecting the presence of the target
nucleic acid by detecting the label at the site of the immobilized
capture oligonucleotide.
[0033] In another aspect, the invention provides a method for
detecting the presence of a virus target nucleic acid in a clinical
sample, comprising: (a) isolating virus particles which contain the
target nucleic acid from the clinical sample by incubating the
clinical sample with magnetic beads functionalized with at least
one antibody capable of binding to the virus particles, and
separating magnetic bead-bound virus particles from other elements
present in the clinical sample by applying a magnetic field to the
sample; (b) releasing total nucleic acid from the virus particles
by (i) alkaline lysis followed by neutralization or (ii) heating;
(c) amplifying virus target nucleic acid using helicase dependant
amplification, in combination with reverse transcriptase where the
virus target nucleic acid is RNA, using amplification primers
specific to the virus target nucleic acid sequence, to generate a
solution containing a DNA amplification product corresponding to
the virus target nucleic acid sequence; (d) applying an aliquot of
the solution containing the DNA amplification product to a sample
receiving zone of a lateral flow chromatographic device, wherein
the lateral flow chromatographic device comprises a lateral flow
matrix which defines a capillary flow path and which comprises in
series: (i) a sample receiving zone for receiving an aliquot of a
fluid sample; (ii) a labeling zone in lateral flow contact with
said sample receiving zone, wherein the labeling zone comprises a
porous material containing at least one detection oligonucleotide
diffusively bound thereto, which detection oligonucleotide is
complementary to a first sequence of the virus target nucleic acid
and is coupled to a detectable label; and, (iii) a capture zone in
lateral flow contact with said labeling zone, said capture zone
comprising a microporous membrane, at least a portion of which
contains at least one capture oligonucleotide immobilized thereto,
which capture oligonucleotide is complementary to a second and
distinct sequence of the virus target nucleic acid; and, (f)
detecting the presence of the virus target nucleic acid by
detecting the label at the site of the immobilized capture
oligonucleotide.
[0034] The isolation of influenza virus particles may be achieved
by first incubating the clinical sample with magnetic beads
functionalized with at least one affinity ligand capable of binding
to the influenza A virus particles, followed by separating magnetic
bead-bound cells and/or particles from other elements present in
the clinical sample by applying a magnetic field to the sample.
Various affinity ligands are known and may be used in the practice
of the method of the invention. Typically, an antibody is used. One
or more wash steps may be added following the separation step.
Total nucleic acid from the influenza virus particles is preferably
achieved by alkaline lysis followed by neutralization, or by
heating to release nucleic acid. This provides an initial gateway
for establishing the specificity of the detection system, in that
RNA extracted from isolated virus substantially eliminates
contamination by genomic RNA (and DNA) from host cells or other
organisms which may be present in the clinical specimen. In
addition, these methods eliminate the need for centrifugation,
which typical in nucleic acid extraction methodologies, thereby
enabling highly simplified, downstream nucleic acid amplifications.
In order to improve the efficiency and yields of the amplification
reaction, in some embodiments primers incorporating a poly dA or
poly dT sequence of between 5 and 20 bases in length are be
used.
[0035] More specifically, in one embodiment, virion particles are
first isolated from a clinical specimen (i.e., nasopharyngeal
aspirate or wash) using immunomagnetic affinity capture. Briefly,
magnetic microbeads (microspheres) functionalized with a binding
ligand, such as an antibody, against one or more cell surface
markers of the target virus are incubated with the clinical
specimen. After target virus particles are bound to the beads, a
magnetic field is used to separate the bead-bound virus from other
elements present in the clinical sample (i.e., other viruses,
bacteria, human cells and debris). Typically, one or more washes
are performed to enhance the degree of purification (i.e., saline
washes). Immunomagnetically-isolated (or enriched) target virion
particles are then subjected to lysis using sodium hydroxide in
order to liberate viral RNA. Following lysis, the lysis solution is
neutralized. Alternatively, heat is used to lyse virus particles
and release genomic RNA. RNAse inhibitors are typically included.
These methods of lysing virion particles results in single stranded
target viral RNA ready for amplification. All of the foregoing
steps may be carried out in a single reaction chamber, an important
feature of the invention, thus achieving one the primary
requirements for POC and field applications.
[0036] Extracted RNA is then subjected to isothermal amplification.
In a preferred embodiment, RNA is converted to cDNA using reverse
transcripase (RT), and target sequences in the cDNA are amplified
by the helicase dependent amplification (HDA) method using
target-specific primers. In one embodiment, both the RT and HDA
reactions are carried out at the same time in a single reaction
vessel, in the presence of an RNase H. The reaction vessel may be
the same as the one utilized for RNA extraction, in which case, the
components necessary for the RT and HDA reactions are provided or
added to the extraction vessel. Alternatively, extracted RNA may be
added to a separate reaction vessel containing the components
necessary for the RT and HDA reactions.
[0037] Amplified DNA corresponding to target viral sequences is
then detected using the invention's sandwich oligonucleotide
lateral flow platform. Briefly, amplified target DNA is contacted
with a first hybridization oligonucleotide complementary to a part
of the amplified target DNA ("detection oligonucleotide" or
"detection probe"). The detection probe is functionalized with a
detectable marker, which in preferred applications is a dyed
microsphere. If amplified target nucleic acid is present, a
hybridization complex is formed between the target and the
detection probe-microsphere. Subsequently, this complex moves
across the lateral flow substrate material (i.e., nitrocellulose
membrane) until it reaches a zone onto which a second hybridization
oligonucleotide complementary to a distinct part of the amplified
target DNA has been immobilized. This "capture oligonucleotide" (or
"capture probe") will arrest the flow of the detection
probe-microsphere complex via hybridization to target DNA,
whereupon a visual, colorimetric indication is provided by the
localized concentration of labeled microsphere on the pre-deposited
capture probe zone.
[0038] In one embodiment, the amplified target DNA is added to a
solution containing the dyed microsphere/bead-functionalized first
hybridization oligonucleotide. Thereafter, the solution comprising
the bead-oligo captured target DNA is added to the lateral flow
device. Alternatively, a solution containing the amplified target
DNA is added to a component of the lateral flow device which
includes the bead-oligo complex in a pre-deposited, lyophilized
form. When added in this manner (i.e., to a conjugate release pad
or labeling zone component of the lateral flow device), the target
DNA-containing solution acts to rehydrate the bead-oligo complex,
whereupon the target DNA may be captured by the bead-detection
oligonucleotide complex. Lateral flow transmits the hybridized
target DNA-bead complexes to the immobilized capture
oligonucleotide(s) on the device.
[0039] In another alternative procedure, bead-functionalized
detection oligonucleotides are added to the RT/HDA reaction prior
to termination of the HDA reaction. This approach provides the
advantage of presenting the detection oligonucleotides to the
amplified target DNA as the latter is being produced, thereby
minimizing the extent to which amplified DNA can form duplexes or
secondary structures that could interfere with hybridization to the
detection oligo. Accordingly, this approach eliminates the need for
a separate denaturation step prior to hybridization to detection
oligo, and thus may be preferred for POC and field applications in
which performing a denaturation step is impractical.
[0040] The system of the invention provides unprecedented assay
speed and simplicity. The system neither requires thermocycling
equipment for the amplification of DNA, nor the use of
sophisticated instrumentation for obtaining assay results. The
amplification component of the system is run at constant
temperature and does not require small volume handling or technical
sophistication. The detection component runs automatically
following sample administration, and produces a visual result that
can be seen by the naked eye in a matter of minutes.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] FIG. 1. Schematic illustration of sequence of events in
nucleic acid assay of the invention (showing influenza example).
(A) influenza capture and isolation from clinical sample, (B) viral
genome extraction, (C) isothermal amplification, and (D) direct
detection on the dipstick.
[0042] FIG. 2. Schematic diagram of the lateral flow
chromatographic detection device used in one system of the
invention. Top panel: Top and side views of the device assembly.
Bottom panel: Depicts detection of a target sequence. Detection of
the single-stranded pathogen amplification products is achieved
with two target-specific oligonucleotide probes, (A) capture
oligonucleotide probe immobilized on a nitrocellulose membrane, and
(C) detection oligonucleotide probe conjugated to the surface of a
detectable label such as dyed polystyrene microspheres. When a
specific target sequence (B) is present, a sandwich complex is
formed among the capture probe, target sequence, and detection
probe resulting in a visible colored spot on the membrane.
[0043] FIG. 3. Schematic diagram showing the relationship of the
detection oligonucleotide-bead conjugates, capture oligonucleotides
and target sequence capture.
[0044] FIG. 4. Detection sensitivity of the assay described in
Example 1 on synthetic Pag target sequence. Each assay was
imprinted with four different gene capture probes, Cap B, Pag, Cya
and Positive control sequence (complementary to the pag
labeling/detection probe of the dyed microspheres). Hybridization
reaction mix containing varying concentration of Pag target (from 0
to 20 nM final concentration, from right to left) and pag
labeling/detecting probe tagged blue microspheres in 1.times.
hybridization buffer was applied on individual assay, respectively
(as described in Materials and Methods of Example 1).
[0045] FIG. 5. Detection of Ba HDA isothermal amplification
products using 8% nondenaturing acrylamide gel electrophoresis and
assay described in Example 1. For each assay detection set, four
capture probes were immobilized on the membranes, CapB, Pag, Cya
and Pag positive control for Top panel, and Flu, Cap, Cya and Cap
positive control for the bottom panel. Top panel for pag and bottom
panel for cap, respectively. In left gel image panels: M: 100 bp
DNA ladder (Promega); Lane 1: HDA amplicon of pag or cap,
respectively; Lane 2: HDA no-template negative control. Right assay
image panels: P: A positive amplification control (using synthetic
Pag and Cap target sequences); Lane 1', Assay detection of HDA
amplicons of pag or cap, respectively; Lane 2', Assay detection of
HDA no-template negative controls.
[0046] FIG. 6. Side-by-side comparison of gel electrophoresis-based
and NA assay-based detection of pag amplification products. A
serial dilution of Ba pag amplicon containing 200 (1.times.), 100
(2.times.), 50 (4.times.), 25 (8.times.), 12.5 (16.times.), 6.3
(32.times.), 3.2 (64.times.), 1.6 (128.times.), 0.8 (256.times.) ng
final products was prepared using the procedure described in
Materials and Methods of Example 1. Top panel: Image of 8%
nondenaturing acrylamide gel electrophoresis of pag amplification
product followed by Ethidium Bromide staining and UV image
analysis. Bottom panel: NA assay detection of pag amplification
products.
[0047] FIG. 7. Sensitivity assessment of HDA amplification and
subsequent NA assay detection. Gel electrophoresis (Top panel) and
assay detection (Bottom panel) of HDA amplicons amplified from
varying starting copies of Ba genomic DNA target. See Example
1.
[0048] FIG. 8. Detection of rare target copies from highly
heterogeneous sample mixture. In each mixture, the copy number of
Ba genomic DNA was 100, while that of Bt genomic DNA was 0, 100,
1000, 10000, 100000 and 1000000 times of excess of the target DNA.
Amplification target (30 .mu.l) was denatured and was analyzed
either by gel or assay detection. See Example 1.
[0049] FIG. 9. Multiplexed amplification products analyzed by gel
and NA assay. From Left, M: 100 bp DNA ladder (Promega); 1:
multiplex HDA product; 2: HDA negative control; PP: Assay positive
control for pag; CP: Assay positive control for cap; PCP: Assay
positive control for pag and cap (by mixing Pag and Cap synthetic
target sequences); HDA P&C: Assay test of HDA product of lane
1. See Example 1.
[0050] FIG. 10. Amplification plots of RT-PCR reactions on
influenza viral RNA extracted from immunomagnetically-captured
virions using NaOH lysis. See Example 2.
[0051] FIG. 11. SDS-PAGE analysis of RT-HDA reactions on influenza
A RNA. Lanes 1-3: virus+beads (5, 25 and 100 .mu.L virus,
respectively). Lanes 4-6: virus+lysis (5, 25 and 1004 virus,
respectively). Lane 7, positive control (RNeasy).
[0052] FIG. 12. rBst RT-HDA amplification, agarose gel showing
amplification products from: lane 1: Flu rBst RT & HDA negative
control; lanes 2, 3: Flu rBst RT 60 minutes; lane 4: Flu rBst RT 50
minutes; lane 5: Flu rBst RT 40 minutes; lane 6: Flu rBst RT 30
minutes; lane 7: Flu rBst RT 20 minutes; lane 8: Flu rBst RT 10
minutes.
[0053] FIG. 13. Shows results of detection of amplified influenza
RNA using combined RT-HDA reaction followed by capture with
detection oligonucleotide functionalized dyed microbeads and
detection on nitrocellulose lateral flow membrane printed with
influenza-specific capture oligonucleotides. Top circle:
influenza-specific, bottom circle, negative control.
[0054] FIG. 14. Gel analysis of one-step flu RT-HDA amplification
products using Thermoscript.TM. reverse transcriptase (RT) and HDA
enzymes (polymerases and helicases). Lane a: MP-2 primers, with
10.sup.4 copies of template RNA; b: MP-2 primers, with 10.sup.3
copies of template RNA; c: poly dT primers, with 10.sup.4 copies of
template RNA; d: poly dT primers, with 10.sup.3 copies of template
RNA; e: poly dl primers, with 10.sup.4 copies of template RNA; f:
poly dl primers, with 10.sup.3 copies of template RNA; g: positive
tHDA control primer and template set. The flu amplification product
bands are indicated by the arrow; lower bands are primers or primer
dimmers.
[0055] FIGS. 15A, 15B and 15C. Gel electrophoresis analysis of flu
RT-HDA amplification products using Superscript III (SS III,
Invitrogen) and rBst pol (Epicentre) as reverse transcriptase (RT)
together with HDA enzymes (polymerases and helicases). FIGS. 15A,
15B and 15C RT-HDA reaction using random flu primer set, regular
MP-2 primer set and poly dT primer sets as described in Example 5,
infra. The 100 bp size standards, positive, negative controls, the
RTs and the flu template RNA copies are labeled next to each lane.
The flu amplification product bands are indicated by the arrow;
lower bands are primers, primer dimmers, or non specific
amplification smears.
[0056] FIG. 16. Reduced assay time for one step RT-HDA reaction.
The gel electrophoresis analysis was performed for the one-step
RT-HDA reaction with poly dT flu primers and an rBst pol-based HDA
kit. The product band is indicated by the arrow. The positive and
negative control reactions, RT-HDA assay time and the copy numbers
of the flu RNA templates are marked.
[0057] FIG. 17. Detection sensitivity of the NA lateral flow assay
on synthetic Flu target sequences. Each lateral flow assay strip
was imprinted with four different gene capture probes, Cap B, Flu,
Cya and Positive control sequence (complementary to the Flu
detection probe of the dyed microspheres). Hybridization reaction
mix containing varying concentration of Flu target (from 0 to 2 nM
final concentration, from right to left) and Flu detection
oligonucleotide probe functionalized with blue microspheres in
1.times. hybridization buffer was applied on individual NA lateral
flow assay, respectively, as described in Example 6.
[0058] FIG. 18. Detection of Flu rBst RT-HDA products using 8%
nondenaturing acrylamide gel electrophoresis and NA lateral flow
detection. For each NA lateral flow assay strip, four capture
oligonucleotide probes were immobilized on the membranes, CapB,
Flu, Cya and Flu. In left gel image panels: M: 100 bp DNA ladder
(Promega); Lane 1: no-template negative control; Lane 2: Flu RNA
rBst RT-HAD amplification. Right NA lateral flow assay image
panels: Lane P: Flu dipstick positive control with 2 nM Flu
synthetic target synthetic target; Lane 1', NA lateral flow
detection of Flu rBst RT-HDA amplification products; Lane 2', NA
lateral flow detection of Flu rBst RT-HDA no-template negative
controls.
DETAILED DESCRIPTION OF THE INVENTION
[0059] Unless otherwise defined, all terms of art, notations and
other scientific terminology used herein are intended to have the
meanings commonly understood by those of skill in the art to which
this invention pertains, unless otherwise defined. In some cases,
terms with commonly understood meanings are defined herein for
clarity and/or for ready reference, and the inclusion of such
definitions herein should not necessarily be construed to represent
a substantial difference over what is generally understood in the
art. The techniques and procedures described or referenced herein
are generally well understood and commonly employed using
conventional methodologies by those skilled in the art, such as,
for example, the widely utilized molecular cloning methodologies
described in Sambrook et al., Molecular Cloning: A Laboratory
Manual 3rd. edition (2001) Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. and Current Protocols in Molecular Biology
(Ausbel et al., eds., John Wiley & Sons, Inc. 2001. As
appropriate, procedures involving the use of commercially available
kits and reagents are generally carried out in accordance with
manufacturer defined protocols and/or parameters unless otherwise
noted.
[0060] Overview of the System
[0061] The nucleic acid dipstick detection system of the invention
is designed to permit rapid assay of DNA or RNA signatures
indicative of the presence of a target pathogenic organism or spore
or disease condition or indicator. The system is rapid, sensitive,
specific and amenable to both clinical medical diagnostics and
field-based identification of biothreat agents. Various formats are
contemplated, depending upon whether the application is designed
for medical diagnosis or field identification.
[0062] The system has three primary components: (1) isolation of
target microorganisms or cells using immunoaffinity purification
and extraction of target nucleic acid therefrom, (2) rapid and
sensitive isothermal amplification of nucleic acids using helicase
dependent amplification (HDA), and (3) redundant capture of
amplified target using (a) a label, such as a detectable particles
(i.e., dyed microbeads) conjugated to an detection oligonucleotide
complementary to one of two signature sequences on the amplified
target ("detection oligonucleotide"), and (b) a
membrane-immobilized "capture oligonucleotide" complementary to the
other signature sequence on the target, such that capture of
amplified target by the membrane-immobilized and bead-bound
oligonucleotides brings labeled beads into contact with the
membrane, displaying a visual or machine-readable optical signal
generated by localized concentration of the label. Thus, the assay
is in a sandwich-type nucleic acid format. Positive hybridization
to two pathogen or other target signatures in order to produce a
localized signal produces very high assay specificity. Both
sensitivity and specificity are enhanced by the initial step of
immunomagnetically-isolating target virions.
[0063] A principal objective of the invention is to provide a
rapid, sensitive and specific assay for influenza and related
viruses, which may be performed without the need for thermocyclers,
centrifuges, and other technically demanding equipment, and which
may be performed by individuals lacking technical skills, thus
providing a platform that can be utilized in point of care
environments and in field-deployment situations. The preferred
assays of the invention utilize a combination of elements that
produce detectable results consistent with the foregoing
objectives.
[0064] In the first component of the detection system of the
invention, the target organism(s) of interest are isolated, in
order to provide for the extraction of an enriched or purified
nucleic acid sample for subsequent amplification. In one
embodiment, influenza virus is the target organism, and isolation
of influenza virions is accomplished using immunomagnetic affinity
purification methodologies known in the art. More specifically, as
an example, where the target organism is influenza type A, magnetic
microparticles are functionalized with antibody specific for a
surface marker of influenza A. Such a marker may be relatively
specific, but may result in the isolation of various strains of
influenza A, which are then differentiated in the lateral flow
nucleic acid component of the system. In some cases, depending upon
the specific target organism, it may be possible to use antibody
that is highly specific for the target, resulting in substantially
pure virus following the immunomagnetic affinity isolation step. In
other cases, species or strain-specific surface markers may not be
available, thus necessitating the use of antibodies that are cross
reactive for a number of related viruses or other pathogenic
organisms. Indeed, in some cases, it may be desirable to utilize
antibodies that are specific for a range of different yet related
viruses or other pathogenic organisms. As one example, where the
objective includes simultaneous detection and differentiation of a
number of related viruses (i.e., all sub-types of a certain virus),
polyclonal antibodies or antibodies which are otherwise broadly
cross-reactive with all members of the target class may be
employed. The use of such antibodies in an immunomagnetic affinity
protocol will result in the isolation of a group of related
viruses, which may then be distinguished on the basis of the
post-nucleic acid extraction components of the invention's
detection system, by virtue of various different primer pairs
targeted to various different signature sequences, in the context
of the specific sandwich oligonucleotide assay component of the
invention.
[0065] In the second component of the detection system of the
invention, amplification of target nucleic acid is achieved using
the isothermal nucleic acid amplification method HDA. Amplified DNA
is detected using a lateral flow chromatographic nucleic acid
sandwich assay, as further described infra. Where the target
microorganism contains an RNA genome, HDA is performed in
combination with reverse transcription of RNA to cDNA, which is
amplified by HDA. HDA is a recently described isothermal DNA
amplification method that has been successfully adapted to the
amplification of DNA and RNA target sequences, and is further
described below. This aspect of the procedure is described in more
detail by way of the Examples which follow.
[0066] The third component of the detection system of the invention
comprises a lateral-flow chromatographic device capable of
detecting amplified DNA using a combination of capture and
detection oligonucleotides complementary to the amplified DNA. The
lateral flow device is typically a multi-substrate chromatographic
strip, also referred to herein as a "DNA dipstick". Schematic
representations of such a device are shown in FIG. 2. The lateral
flow device is capable of transporting nucleic acids within a
liquid sample across different zones (substrates) within the
device. In a simplified illustration, one embodiment of the lateral
flow device is structurally organized into at least 3 zones,
comprising in linear orientation: (a) a sample pad constructed from
absorbent material onto which a liquid, nucleic acid-containing
sample is deposited, (b) a conjugate release pad containing a least
one oligonucleotide-fitted detection particle (e.g., microsphere,
bead, quantum dot), and (c) a detection zone comprising a
nitrocellulose or nylon membrane containing at least one
immobilized capture oligonucleotide. In preferred embodiments, a
fourth element comprises an absorbent material which is capable of
facilitating the lateral flow of the liquid sample from the sample
pad end of the device to and through the detection zone. In
alternative embodiments, the conjugate release pad element is
eliminated, and the amplified DNA sample to be assayed for the
presence of a target nucleic acid is mixed with the
oligonucleotide-fitted detection particle prior to placing the
sample onto the sample pad.
[0067] The redundant capture feature of the invention results from
the use of two oligonucleotides complementary to two different
sequences on the target nucleic acid (see FIG. 3). More
specifically, one oligonucleotide is complementary to one of two
"signature" sequences on the target nucleic acid. Termed the
"detection oligonucleotide" or "detection probe" herein, this
oligonucleotide is conjugated to small detection particles, such as
microspheres, microbeads and quantum dots that are detectably
labeled (i.e., with colorimetric dyes). The detection particles
display a visual or optically detectable, and localized, signal
indicative of the presence of the target nucleic acid. In some
embodiments, a dyed microbead-conjugated oligonucleotide is used to
populate the conjugate release pad of the device. In other
embodiments, a dyed microbead-conjugated oligonucleotide is mixed
with a liquid DNA sample to be assayed. A second oligonucleotide,
termed the "capture oligonucleotide" herein, is complementary to
another, distinct "signature" sequence on the target nucleic acid,
and is immobilized to the microporous membrane (i.e.,
nitrocellulose) of the device.
[0068] In the practice of a detection assay utilizing the system of
the invention, the capture of amplified target nucleic acids by the
membrane-immobilized and detection particle-bound oligonucleotides
brings the detection particles into contact with the membrane,
displaying a visual or machine-readable optical signal. Thus, the
assay is a sandwich-type nucleic acid format, requiring positive
hybridization to two distinct sequences on the target nucleic acid
in order to produce a localized signal, resulting in very high
assay specificity.
[0069] The system demonstrates exceptional assay sensitivity and
specificity characteristics. For example, embodiments utilizing a
lateral flow device containing oligonucleotide conjugated
microbeads and nitrocellulose membrane-immobilized capture
oligonucleotides, observed detection sensitivities are typically in
the nanomolar to sub-nanomolar range (see Examples, infra).
Embodiments utilizing*oligonucleotide conjugated quantum dots in
combination with nitrocellulose membrane-immobilized capture
oligonucleotides may demonstrate somewhat higher detection
sensitivities.
Components of the System and Detection Assays
[0070] The nucleic acid detection systems of the invention share a
common assay progression which begins with isolating influenza
virus particles which contain the target nucleic acid from the
clinical sample using magnetic affinity capture. As used herein,
the term "clinical sample" refers to a sample obtained from an
individual that may contain a pathogenic organism of interest
and/or a cell that may contain such a pathogenic organism of
interest, genomic nucleic acid of the pathogen of interest, mRNA
transcribed from such genomic nucleic acid, and/or proteins encoded
thereby. For typical clinical applications, the clinical sample may
be saliva, blood, nasal swab, throat swab, tear fluid, urine, or
any other body fluid or sample containing or potentially containing
a cell or spore harboring genetic material to be assessed. With
respect to influenza viruses, an appropriate clinical sample
includes without limitation nasal swab, nasopharyngeal aspirate or
nasopharyngeal wash sample.
[0071] Magnetic affinity capture refers to methods which utilize
the ability of a ligand binder-functionalized magnetic bead to bind
to the surface of a particle or cell, thereby permitting the
application of a magnetic filed to isolate the particle or cell of
interest from other contents in a sample containing such particles
or cells, and include for example immunomagnetic affinity capture
methodologies. For example, a particle may be a virus particle,
such as an influenza A virus particle, and the
ligand-functionalized magnetic bead is magnetic bead coated or
functionalized with an antibody which recognizes and binds to a
surface antigen on the influenza A virus particle. Examples of such
antibodies include polyclonal and monoclonal antibodies which
recognize and bind to an influenza A HA or NA antigen, including
those which are cross-reactive with HA and NA on multiple influenza
subtype strains.
[0072] Thus, a clinical sample is incubated with magnetic beads
functionalized with at least one affinity ligand capable of binding
to target virus particles. The affinity ligand is typically an
antibody capable of recognizing and binding to a surface antigen on
the virus of interest. Magnetic bead-bound virus particles are then
separated from other elements (i.e., other viruses, bacteria, human
cells and debris) present in the clinical sample by applying a
magnetic field to the sample. Typically, one or more washes are
performed to enhance the degree of purification (i.e., saline
washes).
[0073] An example of the use of immunomagnetic capture of influenza
A is presented in Examples 2 and 4, infra. Briefly, polyclonal
antibodies raised by standard immunization methods against
influenza A Texas 1/77 strain were used to functionalize a
suspension of magnetic beads coated with avidin. These
anti-influenza A functionalized beads successfully captured the
influenza A Sydney 5/97 strain. Isolated virion particles were
lysed using a NaOH solution in order to extract flu RNA, and
extracted RNA subjected to nucleic acid amplification,
demonstrating that the quality of the RNA so extracted is
sufficient for amplification and detection.
[0074] In addition to antibodies, various binding ligands known in
the art may be used to functionalize magnetic beads in order to
enable the functionalized beads to bind to a target cell or
particle of interest. For example, a modified sialic acid, capable
of recognizing and binding to an influenza HA surface antigen, may
be used to functionalize magnetic beads which are then used to
isolate influenza A particles.
[0075] Cells with may contain replicating virus, viral nucleic
acid, mRNA and/or viral proteins may also be isolated as a source
of amplifiable nucleic acid for conducting the assays of the
invention. Indeed, cells infected with certain viruses are commonly
known to contain cell-type specific or virally encoded surface
antigens, which may be used as targets for magnetic affinity
capture of such cells, which may then be used as a source of target
nucleic acid.
[0076] Immunomagnetically-isolated (or enriched) target virion
particles are then subjected to lysis using heat or alkaline
(sodium hydroxide) lysis in order to release viral RNA. Following
alkaline lysis, the lysis solution is neutralized. RNAse inhibitors
may be included. These method of lysing virion particles results in
single stranded target viral RNA ready for conversion to cDNA using
reverse transcriptase, and amplification of the cDNA using
helicase-dependent isothermal amplification (see infra). All of the
foregoing steps may be carried out in a single reaction chamber, an
important feature of the invention which enables simplified RNA
extraction without the need for heat or centrifugation. Thus, this
aspect of the invention achieves the needs of POC and field
applications.
[0077] Extracted nucleic acids may be purified prior to
amplification. A number of column type DNA and RNA purification
devices are commercially available and may be employed for this
purpose. Various other techniques for purifying DNA and RNA may be
employed, including without limitation, electrophoresis, gradient
separation, affinity purification, etc.
[0078] Following extraction of nucleic acids from samples of
interest, target sequences are then amplified using an isothermal
amplification protocol. As used herein, a "target sequence" is a
nucleotide sequence within a target nucleic acid molecule which is
to be amplified. Within the target sequence is a primer binding
portion or site, to which primers are designed to hybridize in
order to initiate DNA polymerization.
[0079] The selection of a particular target sequence for
amplification will relate to the assay objectives. For example,
where amplification is aimed at identifying a particular strain of
an organism, the target sequence should be one of the unique
genetic signatures which differentiates that strain from others to
which it may be related. In some cases, this may be a single
defining sequence. In other cases, a combination of target
sequences may be required to reliably identify and differentiate
the organism. The selection of target sequences which impart
specificity to assays utilizing amplified genetic material involves
considerations well known in the art, including for example, unique
pathogen-specific sequences, toxins genes, virulence factors or
specific signature sequence combinations.
[0080] In the practice of the invention, single or multiple target
sequences may be amplified in a single reaction. When multiple
target sequences are to be amplified, multiple artificial
amplification templates are employed, as further described infra.
As is well known, sequence analysis is used to avoid possible
nonspecific interactions among different oligonucleotide
amplification templates and amplification primers.
[0081] The use of isothermal amplification eliminates the need for
thermocycling instrumentation, technically sophisticated users, and
long amplification timeframes characteristic of PCR methods. In a
specific embodiment, for the detection of RNA targets, reverse
transcriptase (RT) conversion of RNA to cDNA is combined with HDA,
in a single reaction vessel, as further described by way of the
Examples which follow.
[0082] Detailed information concerning the use of HDA to detect DNA
may be found in published United States Patent Application No.
20040058378. Detailed information concerning the use of HDA, in
combination with RT, in detecting RNA species may be found in
published United States Patent Application No. 20060154286. A
thermophilic HDA kit is commercially available (tHDA Kit, New
England Biolabs, Beverly, Mass., Catalog # H0100S).
[0083] HDA amplifies target sequences using two sequence specific
primers flanking the fragment to be amplified and a mixture of
enzymes for DNA strand separation and polymerization. In the first
step of the HDA reaction, the helicase enzyme loads on to the
template and traverses along the target DNA, disrupting the
hydrogen bonds linking the two strands. Exposure of the
single-stranded target region by helicase allows primers to anneal.
The DNA polymerase then extends the 3' ends of each primer using
free deoxynucleotides (dNTPs) to produce two DNA replicates. The
two replicated DNAs independently enter the next cycle of HDA,
resulting in exponential amplification of the target sequence.
[0084] Helicases use energy generated by the hydrolysis of
nucleoside triphosphates (for example ATP) to break the hydrogen
bonds holding the strands together in duplex DNA and RNA. Helicases
are involved in every aspect of nucleic acid metabolism in the
cell, including DNA replication, repair, recombination,
transcription, and protein translation. Helicases can be grouped
into two classes based on the mechanism of unwinding: those that
translocate in a 5' to 3' direction and those that travel in the
opposite 3' to 5' direction. The 5' to 3' helicases usually form
hexameric ring structure and are mainly involved in DNA
replication.
[0085] The term "helicase" refers here to any enzyme capable of
unwinding a double stranded nucleic acid enzymatically. For
example, helicases are enzymes that are found in all organisms and
in all processes that involve nucleic acid such as replication,
recombination, repair, transcription, translation and RNA splicing.
(Kornberg and Baker, DNA Replication, W.H. Freeman and Company
(2.sup.nd ed. (1992)), especially chapter 11). Any helicase that
translocates along DNA or RNA in a 5' to 3' direction or in the
opposite 3' to 5' direction may be used to perform HDA. This
includes helicases obtained from prokaryotes, viruses, archaea, and
eukaryotes or recombinant forms of naturally occurring enzymes as
well as analogues or derivatives having the specified activity.
Examples of naturally occurring DNA helicases, described by
Kornberg and Baker in chapter 11 of their book, DNA Replication,
W.H. Freeman and Company (2.sup.nd ed. (1992)), include E. coli
helicase I, II, III, & IV, Rep, DnaB, PriA, PcrA, T4 Gp41
helicase, T4 Dda helicase, T7 Gp4 helicases, SV40 Large T antigen,
yeast RAD. Additional helicases that may be useful in HDA include
RecQ helicase (Harmon and Kowalczykowski, J. Biol. Chem.
276:232-243 (2001)), thermostable UvrD helicases from T.
tengcongensis (published United States Patent Application No.
20040058378) and T. thermophilus (Collins and McCarthy,
Extremophiles. 7:35-41. (2003)), thermostable DnaB helicase from T.
aquaticus (Kaplan and Steitz, J. Biol. Chem. 274:6889-6897 (1999)),
and MCM helicase from archaeal and eukaryotic organisms ((Grainge
et al., Nucleic Acids Res. 31:4888-4898 (2003)).
[0086] The characterization of a thermostable helicase used in the
tHDA kit (New England Biolabs) is described in An at el., 2005, J.
Biol. Chem 280: 28952. The thermostable UvrD helicase is from the
class of the 3' to 5' translocators. These proteins exist as
monomers or dimers and, unlike many other helicases, UvrD helicase
is able to melt fully duplex molecules (DNA fragment with blunt
ends) and nicked circular DNA molecules. UvrD is involved in the
two major DNA repair pathways: methyl-directed mismatch repair and
UvrABC-mediated nucleotide excision repair. In the methyl-directed
mismatch DNA repair pathway, UvrD is recruited to unwind the DNA
strand containing the DNA biosynthetic error.
[0087] Polymerases utilized in carrying out HDA are selected on the
basis of processivity and strand displacement activity. Subsequent
to melting and hybridization with a primer, the nucleic acid is
subjected to a polymerization step. A DNA polymerase is selected if
the nucleic acid to be amplified is DNA. When the initial target is
RNA, a reverse transcriptase is used first to copy the RNA target
into a cDNA molecule and the cDNA is then further amplified in HDA
by a selected DNA polymerase. The DNA polymerase acts on the target
nucleic acid to extend the primers hybridized to the nucleic acid
templates in the presence of four dNTPs to form primer extension
products complementary to the nucleotide sequence on the nucleic
acid template.
[0088] Examples of DNA polymerases suitable for carrying out HDA
include an exonuclease-deficient Klenow fragment of E. coli DNA
polymerase I, an exonuclease deficient T7 DNA polymerase
(Sequenase; USB, Cleveland, Ohio), Klenow fragment of E. coli DNA
polymerase I, Large fragment of Bst DNA polymerase, KlenTaq DNA
polymerase, T5 DNA polymerase (U.S. Pat. No. 5,716,819), and Pol
III DNA polymerase (U.S. Pat. No. 6,555,349). DNA polymerases
possessing strand-displacement activity, such as the
exonuclease-deficient Klenow fragment of E. coli DNA polymerase I,
Bst DNA polymerase Large fragment, and Sequenase, are preferred for
Helicase-Dependent Amplification. T7 polymerase is a high fidelity
polymerase having an error rate of 3.5.times.10.sup.5 which is
significantly less than Taq polymerase (Keohavong and Thilly, Proc.
Natl. Acad. Sci. USA 86, 9253-9257 (1989)). T7 polymerase is not
thermostable however and therefore is not optimal for use in
amplification systems that require thermocycling. In HDA, which can
be conducted isothermally, T7 Sequenase is a one of the preferred
polymerases for amplification of DNA.
[0089] Mesophilic helicases show improved activity in the presence
of single-strand binding proteins (SSB). In these circumstances,
the choice of SSB is generally not limited to a specific protein.
Examples of single strand binding proteins are T4 gene 32 protein,
E. coli SSB, T7 gp2.5 SSB, phage phi29 SSB (Kornberg and Baker,
supra (1992)) and truncated forms of the aforementioned.
[0090] In addition to salt and pH, other chemical reagents, such as
denaturation reagents including urea and dimethyl-sulfoxide (DMSO)
can be added to the HDA reaction to partially denature or
de-stabilize the duplex DNA. HDA reactions can be compared in
different concentrations of denaturation reagents with or without
SSB protein. In this way, chemical compounds can be identified
which increase HDA efficiency and/or substitute for SSB in
single-strand (ss) DNA stabilization. Most of the biomacromolecules
such as nucleic acids and proteins are designed to function and/or
form their native structures in a living cell at much high
concentrations than in vitro experimental conditions. Polyethylene
glycol (PEG) has been used to create an artificial molecular
crowding condition by excluding water and creating electrostatic
interaction with solute polycations (Miyoshi, et al., 2002,
Biochemistry 41:15017-15024). PEG has also been added into helicase
unwinding assays to increase the efficiency of the reaction (Dong,
et al., 1996, Proc. Natl. Acad. Sci. USA 93:14456-14461). PEG or
other molecular crowding reagents on HDA may increase the effective
concentrations of enzymes and nucleic acids in HDA reaction and
thus reduce the reaction time and amount of protein concentration
needed for the reaction.
[0091] Topoisomerase can be used in long HDA reactions to increase
the ability of HDA to amplify long target amplicons. When a very
long linear DNA duplex is separated by a helicase, the swivel
(relaxing) function of a topoisomerase removes the twist and
prevents over-winding (Kornberg and Baker, 1992). For example, E.
coli topoisomerase I (Fermentas, Vilnius, Lithuania) can be used to
relax negatively supercoiled DNA by introducing a nick into one DNA
strand. In contrast, E. coli DNA gyrase (topoisomerase II)
introduces a transient double-stranded break into DNA allowing DNA
strands to pass through one another.
[0092] To initiate a thermophillic HDA amplification reaction such
as that employed in the BioHelix tHDA kit, a primer oligonucleotide
which specifically hybridizes to the target sequence is employed,
as is well known. In the design of a primer for use in the
invention, standard considerations of primer design apply. When
comprising natural nucleotide residues, the primer oligonucleotide
is generally between about 20 and 35 nucleotides in length,
preferably about 25 to 27 nucleotides long, is single stranded, and
is contains a sequence complementary to the target sequence, such
that the primer is capable of achieving stable hybridization to the
target template while minimizing the potential for secondary
hybridization to non-target sites. In some embodiments, the entire
primer is complementary to the target sequence, while in other
embodiments, a portion of the primer contains a complementary
sequence. Amplicon length for HDA is preferably between 70 and 120
nucleotides. Amplicons containing a G+C content of approximately
40% are preferable. Primer Tm is preferably 60.degree.
C.-80.degree. C., and more preferably 68-72.degree. C.
[0093] As is known, primers should be designed to achieve stable
and specific hybridization to the target sequence while avoiding
the possibility of inter-primer hybridization, which may result in
the formation of primer dimers or primer oligomers. Also, the
potential formation of secondary structures within a primer should
be minimized. Palindromic sequences, therefore, should generally be
avoided as these sequences tend to form stable secondary structures
which preclude stable hybridization to the template strand.
Typically, stretches of identical bases should also be avoided.
With respect to the template, primers should be selected for their
ability to stably hybridize to the target region of the template,
and thus selection of a suitable target region to which an
acceptable primer may be designed should be taken into
consideration. In this regard, generally, primers should not be
designed to anneal to regions of secondary structure within the
target sequence having a higher melting point than the primer.
[0094] Methods and tools for the design and synthesis of
oligonucleotide primers are well known in the art. For example,
various software tools are widely available to assist in the design
of primers optimized for a particular set of circumstances,
including for example, Primer Express.TM. software (Applied
Biosystems, Foster City, Calif.), Primer3 (Whitehead Institute,
Cambridge, Mass.), and Consed (David Gordon, Univ. Washington).
Typical "primer picking" programs permit variable length and Tm
parameters, and assist in avoiding the design of primers with
palindromic sequences or other potential secondary structure
problems, primers with complementarity to non-target regions of the
template, etc.
[0095] Presented in Example 7, infra, is a step-wise approach for
generating compatible sets of amplification primers, detection
oligonucleotides and capture oligonucleotides for detecting various
influenza A target nucleic acid sequences using he methods of the
invention.
[0096] In a particular aspect of the invention, fork-generating
primers are provided for increasing helicase loading to
double-stranded DNA substrates. More specifically, primers
containing a target-specific sequence and a 5' poly dA or poly dT
sequence of between 5 and 40 bases in length are used to create a
low melting temperature region in amplified DNA duplexes. In
preferred embodiments, poly dT or dA sequences are 5 to 20 bases in
length. The inclusion of poly dT or poly dA sequences results in
localized melting of the A-T double strand in amplified ds DNA at
the HDA reaction temperature (i.e., 60.degree. C.), thereby
generating a symmetrical "fork" secondary structure. The fork
secondary structure, applicants have discovered, presents an ideal
substrate for helicase loading, resulting in improved HDA
efficiency and faster reaction times. These primers also enable the
use of variable reverse transcriptase enzymes, including
polymerases with RT activities. See Example 5, infra.
[0097] In performing an RT-HDA reaction, an enzyme which can digest
the RNA portion of an RNA/cDNA duplex is employed in the reaction
mixture. RNase H is an endoribonuclease that specifically
hydrolyzes the phosphodiester bonds of RNA hybridized to DNA, but
does not digest single or double-stranded RNA. Members of the RNase
H family can be found in nearly all organisms, from archaea and
prokaryota to eukaryota. RNase H cloned from E. coli may be
obtained from commercial sources (i.e., New England Biolabs). RNase
H activity is often associated with many naturally occurring
reverse transcriptases. The RNase H activity may be provided by a
separate enzyme, such as E. coli RNase H, or by an RNA-dependent
DNA polymerase (i.e., reverse transcriptase). In one embodiment,
RNase H (Ribonuclease H) is employed for this purpose. In
combination with a high temperature RT-HDA reaction, a thermostable
RNase H is used, such as Hybridase (EPICENTRE, Madison, Wis., USA).
The use of RNase H in the RT-HDA reaction achieves the objective of
producing single stranded template for subsequent amplification,
whereby the helicase in the HDA reaction achieves the unwinding of
polymerized DNA duplexes for exponential amplification.
[0098] Following amplification, a solution containing a DNA
amplification product is assayed for the presence of the target
nucleic acid using a lateral-flow chromatographic device which
comprises a combination of capture and detection oligonucleotides
complementary to specific targets in the amplified DNA.
[0099] The lateral flow chromatographic devices employed in the
nucleic acid detection system of the invention is similar to
devices in use for protein diagnostics such as home pregnancy kits.
Briefly, the device is composed of a series of absorbent substrates
which are used to transport DNA in a lateral manner to components
containing certain reagents or materials required for the detection
of amplified DNA (see schematic illustration in FIG. 2).
[0100] In a simplified illustration, one embodiment of the lateral
flow device is structurally organized into at least 3 zones,
comprising in linear orientation: (a) a sample pad or "sample
receiving zone" constructed from absorbent material onto which a
liquid, nucleic acid-containing sample is deposited (i.e., solution
containing the labeled DNA amplification product), (b) a conjugate
release pad or "labeling zone" containing a least one
oligonucleotide-fitted label such as a detectable particle (e.g.,
microsphere, bead, quantum dot), and (c) a capture zone comprising
a microporous membrane, such as a nitrocellulose or nylon membrane,
containing at least one immobilized capture oligonucleotide. In
preferred embodiments, a fourth element comprises an absorbent
material which is capable of facilitating the lateral flow of the
liquid sample from the sample pad end of the device to and through
the detection zone. In alternative embodiments, the conjugate
release pad element is eliminated, and the amplified DNA sample to
be assayed for the presence of a target nucleic acid is mixed with
the labeled detection oligonucleotide prior to placing the sample
onto the sample pad.
[0101] The first substrate, or sample pad, comprises an absorbent
material preferably composed of a matrix, with minimal nucleic acid
binding properties, that will permit unobstructed migration of the
nucleic acid analyte to subsequent stages of the apparatus without
depletion. In a specific embodiment, the sample pad is composed of
a cellulose fiber pad such as Millipore cellulose fiber sample pad
material (Cat# CFSP223000).
[0102] The sample pad is situated within the device such that it is
in physical contact with the conjugate release pad, a matrix
composed of a material with minimal nucleic acid binding capacity
and of a physical composition which allows dried detection
particles to be liberated into solution with minimal residual
binding to the matrix. Examples of such material are Millipore
glass fiber conjugate pad (cat# GFCP203000) and Schleicher &
Schuell Accuflow P polyester reagent release media. The Accuflow P
substrate is a particularly suitable reagent release material for
dyed microsphere-based detection. The sample pad may be laminated
to the conjugate release pad such that the two matrices are in
physical contact with a 1-2 mm overlap. The conjugate release pad
in turn is laminated to the microporous membrane, which contains
the capture zone, such that it overlaps and physically contacts the
proximal region of the microporous membrane by 1-2 mm. In one
embodiment, the microporous membrane is situated such that it is in
physical contact with an absorbent pad at the distal end to
facilitate sample transport through the microporous membrane should
the sample volume exceed the wicking capacity of the microporous
membrane itself.
[0103] In one embodiment, the microporous membrane is composed of a
supported nitrocellulose membrane of sufficiently large pore
structure to allow the unimpeded transport of detection reagent
through the membrane matrix. Examples of suitable nitrocellulose
materials for dyed microsphere mediated detection are Millipore
HiFlow Plus HF09004, HF13504, Schleicher & Schuell Prima 60,
Schleicher & Schuell Prima 85. The Millipore HF13504
nitrocellulose membrane has been demonstrated to provide rapid,
specific and sensitive detection when patterned with appropriate
detection oligonucleotides.
[0104] Microporous membranes are patterned with positive and
negative control reagents and capture reagents in an array such
that the physical position of each reagent is known. Positive
control reagents may, for example, be composed of oligonucleotides
complementary to detection oligonucleotides. For example, the use
of an oligonucleotide complementary to the labeled detection
oligonucleotide as a positive control allows direct hybridization
of the detection oligonucleotide/label complex following lateral
flow chromatography over the positive control. Negative controls
for hybridization specificity can be incorporated into the device
as is well known.
[0105] Capture oligonucleotides are composed of oligonucleotides
synthesized such that the sequence is complementary to a region of
the analyte target nucleic acid not overlapping with the region
complementary to the detection oligonucleotide. Ideally, the
predicted secondary structure of the analyte target nucleic acid is
examined to identify those regions exhibiting reduced likelihood of
participating in intramolecular hydrogen bonds. Such regions are
preferable sites for detection and capture oligonucleotide binding
(see, supra).
[0106] Negative and positive control reagents as well as capture
reagents are patterned on to the detection membrane using any of a
number of deposition techniques. Capture elements may take the form
of lines, stripes, dots or human readable icons, letters or other
forms or shapes deemed useful to the interpretation of device
read-out.
[0107] The lateral flow device is enabled by the use of two classes
of oligonucleotide referred to here as capture and detection
oligonucleotides. The detection oligonucleotide is linked by any of
a number of means to a label or detection reagent that, when
concentrated by capture through hybridization, renders the capture
zone optically distinguishable from the surrounding substrate and
from additional capture zones where the detection reagent has not
been sequestered. Examples of detection particles which provide an
easily detectable signal include dyed microspheres (i.e.,
polystyrene microspheres), colloidal gold, nano-gold, fluorescent
nanoparticles (e.g. Qdots.TM., QuantumDots, Inc.). In specific
embodiments exemplified in the Examples, infra,
carboxyl-polystyrene microspheres embedded with colorimetric dyes
are utilized. The detection oligonucleotide is designed such that
the melting temperature of the resulting oligonucleotide allows
hybridization to its cognate sequence on the analyte under ambient
conditions with sufficient rapidity to allow duplex formation to
occur during lateral flow. Detection oligonucleotides with Tm of
50-70.degree. C. have been shown to provide effective reagents for
the detection of relevant analytes (using approximately 20-mer
oligonucleotides).
[0108] Detection oligonucleotides are synthesized with suitable
modifications to allow the efficient linkage to appropriate
detection reagent. In some embodiments it is advantageous to
include a spacer sequence consisting of 9 to 15 T residues proximal
to the modified end of the oligonucleotide that will be coupled to
the detection reagent. Chemistries of known suitability for use in
the device include biotin/streptavidin through a biotin
incorporated onto either the 5' or 3' end of the detection
oligonucleotide and covalent cross-linking through a primary amine
incorporated into either the 3' of 5' end of the detection
oligonucleotide. Other methods that mediate the formation of a
stable complex between the detection reagent and the detection
oligonucleotide under assay conditions should also be suitable for
use in the fabrication of the device.
[0109] The second class of oligonucleotide used in the device is
the capture oligonucleotide. This reagent is immobilized on the
microporous membrane, which is typically a nitrocellulose or nylon
membrane, through the use of standard methods, including without
limitation drying followed by ultraviolet light cross-linking using
0.5 Joules UV. The capture oligonucleotide is preferably designed
such that the sequence is complementary to the analyte target
nucleic acid at a region predicted to have little or no secondary
structure. The length of the capture oligonucleotide is typically
approximately 20 to 30 bases in length. In some embodiments it is
advantageous to include a spacer sequence consisting of 9 to 15 T
residues. Several pairs of detection and capture oligonucleotides
useful in the detection of influenza A target sequences derived
from seven of the eight influenza A genes are provided in the
Examples, infra.
[0110] Detection and capture oligonucleotides can be synthesized
using well known DNA synthesis chemistries. The incorporation of
modified nucleic acids such as PNA (peptide nucleic acid) or LNA
(locked nucleic acid) may be useful for the enhanced hybridization
properties of these DNA derivatives. The use of PNA or LNA moieties
in the preparation of detection and/or capture oligonucleotides
will be useful in manipulating the desired melting temperature, and
so may allow shorter oligonucleotides to be employed for detection
and/or capture where sequence constraints preclude longer DNA
oligonucleotides. Exemplary pairs of detection and capture
oligonucleotides used in detecting various influenza A target
sequences are presented in Example 6, infra.
[0111] The lateral flow chromatographic device used in the practice
of the methods of the invention can make use of diverse detection
modalities, including visual detection signals resulting from the
capture and increased local concentration of an appropriate
detection particle or other label. When colorimetric detection
particles, such as dyed polystyrene microspheres, are used, the
resulting colorimetric signal can be visualized by eye.
Alternatively, for more quantitative and sensitive detection of
signal, an electronic instrument capable of detecting colorimetric
signals may be employed. Such instruments include standard flatbed
scanners, dedicated lateral flow chromatographic strip readers
(e.g. QuadScan, KGW Enterprises, Inc), or a simple CCD based
devices fabricated for the detection of colorimetric signals such
as those employed by commercially available immunochromatographic
test strips (e.g. Clearblue Easy Digital Pregnancy Test).
[0112] Visualization by eye can be aided by the fabrication of the
device in a manner that generates an easily recognized or
interpreted shape on the dipstick surface. One example would be the
patterning of a dipstick microarray with elements in a physical
configuration that results in the appearance of a letter or symbol
indicative of a positive or negative result (e.g. a "+" or "-"
symbol).
[0113] Embodiments that employ fluorescent detection reagents such
as fluorescent nanoparticles (e.g. Qdots, Quantum Dots, Inc.) offer
the potential increased sensitivity that results from the
application of fluorescence detection technology. Such embodiments
can be read using any of a number of ultraviolet light sources
including hand held UV lamps, UV emitting LEDs, and light sources
with sufficient emission in the UV to excite the nanoparticles. A
simple filter can be used to enhance the visualization of
nanoparticle fluorescence emissions. For example, a long pass
filter with a cut off below the emission wavelength of the
nanoparticle may be employed. In the case of excitation with a
white light source, an additional filter to limit excitation to UVA
and shorter wavelengths can be used (e.g., a 380 nm short pass
filter).
[0114] The microporous membrane of the lateral flow chromatographic
device may contain capture oligonucleotides printed monolithically
in order to produce virtually any colorimetric pattern that can be
visualized by the unaided human eye, such as bands, letters,
numbers, symbols, and the like. If the sample contains both the
first and second target sequences, colored beads with hybridized
detection oligonucleotide-target nucleic acid will then hybridize
to the immobilized capture oligonucleotide, and thereafter remain
stably immobilized to the membrane at that physical location. Such
"low density" components of the detection zone may be used to
provide a rapid indication of the presence of a target sequence or
sequences in the sample, visualized only be the unaided eye.
[0115] In addition, the detection zone may contain one or more
"high density" components, capable of providing high resolution
detail of the signatures of the sequences present in the sample
nucleic acid. For example, an array of a number of distinct second
detection oligonucleotides may be deposited in distinct physical
locations on the membrane (i.e., an array of spots), each of which
detection oligonucleotide is specifically complementary to a
distinct target sequence. Such high-density arrays may be used to
interrogate the sample for genotype signature sequences and the
like. These array components may be read by methods well known in
the art, including by scanning and computer assisted densitometry,
the use of CCD cameras, etc.
[0116] Assay devices of the invention comprising such low and high
density detection zones are termed "dual-density" systems, assays
and devices. The principal design element of such dual-density
devices is the provision of two levels of information obtained from
a single sample. The low density component provides instantaneous
visual information indicative of the presence or absence of a first
level target sequence, and may be used to provide fundamental
diagnostic information, such as the presence of a nucleic acid
sequence indicative of a virus or bacteria in the sample. Because
this information is provided by a colored band or other shape or
symbol, the user is able to identify the presence of a target
immediately and without the use of any instrumentation
whatsoever.
[0117] The high density components may be assayed using standard
instrumentation at any time following the assay. For example, the
device may be stored or shipped for high density array analysis
using appropriate instrumentation and/or expertise. Thus, as an
example, such dual-density devices may be used by a consumer
patient for determining whether a body fluid sample contains an
influenza virus. A positive result indicates the need for having
the high density component of the device analyzed by specialized
personnel, in order to determine the influenza strain, subtype, or
genotype, for example. The consumer patient is able to use the
device to determine the need for profession medical attention. The
medical professional is able to analyze the same device for more
specific diagnostic information.
[0118] The lateral flow chromatographic device is designed to be
useful for the detection of analyte target sequences amplified from
samples containing target nucleic acids. Typically, the analytes
are amplified, single-stranded DNAs corresponding to the target
sequences. If the DNA amplification product is not rendered
single-stranded before application to the device, heat may be used
within the device to denature double stranded DNAs. In some
embodiments, the amplified DNA is contacted with the detection
olignucleotide(s) during the HAD reaction, thereby obviating the
need for a separate denaturing step.
[0119] In one embodiment, a solution containing one or more target
sequences to be detected by the device is introduced to the sample
receiving zone of the device. This may be achieved by dipping the
sample receiving zone end into the solution, or by dropping a
quantity of the solution onto the sample receiving zone of the
lateral flow device. The device is sufficiently robust that the
composition of the buffer solution carrying the DNA amplification
product is not critical, however, several practical considerations
are taken into account to assure compatibility of the buffer with
the device. Most significantly, the ionic strength of the sample
buffer must be such that precipitation or aggregation of the
detection particles does not occur. Similarly, sufficient ionic
strength of the buffer is required to support hybridization during
lateral flow. Impregnation of the sample pad and/or conjugate
release pad with Triton-X100, SDS, BSA, ficol, and/or polyvinyl
pyrolidone, or introduction of these components to the sample
buffer itself, can stabilize the detection particles and block
non-specific interactions between the detection particles and the
detection membrane. While a range of concentrations of these
reagents can be used successfully, buffers of proven efficacy
include 0.1% ficol, 0.1% BSA, 1% Triton X-100, and 150 mM NaCl.
This particular buffer supports mono-disperse detection particle
suspensions. In one embodiment (see Example 1, infra), a buffer
containing 0.75.times.SSC, 0.1% Ficoll, 0.1% Gelatin, 1% triton
X-100 and 20 mM Na.sub.2PO.sub.4 gave the best signal with minimal
background, and the combination of Hi-Flow Plus membrane 90 and
0.39 um microspheres providing optimal sensitivity and reasonable
detection speed (.about.5 minutes).
[0120] Once on the sample pad, the analyte solution flows from the
proximal (sample) end towards the distal (detection) end of the
device. In one embodiment, detection oligonucleotide-functionalized
dyed microbeads are embedded into the conjugate release pad
component of the device, preferably in lyophilized form, ready to
be rehydrated as the analyte solution travels into this area of the
device. As the analyte solution moves across the conjugate release
pad, the microbeads are rehydrated and are available for detection
oligonucleotide hybridization to target sequences within the
sample. Target sequences, when present, will become hybridized to
the detection oligonucleotide and thus to the beads. This complex
continues lateral flow migration to the detection membrane, where
immobilized capture oligonucleotides hybridize to the target
sequence, thus capturing the target sequence-bead complex. See FIG.
3 illustration.
[0121] The system of the invention and its components are further
described by way of the following examples, none of which are
intended to be limiting.
Examples
Example 1: Amplification and Detection of Bacillus Target DNA Using
HDA and Lateral Flow Capture
[0122] This example evaluates the performance of HDA in combination
with the lateral flow detection platform of the invention, using
Bacillus anthracis (Ba) as a model target, and demonstrates the
feasibility, sensitivity and specificity of these component of the
detection system of the invention applied to bacterial DNA
targets.
[0123] Materials and Methods:
[0124] Conjugation of Labeling/Detecting Oligonucleotide Probes
onto Dyed Microspheres:
[0125] Carboxyl-polystyrene microspheres embedded with blue dyes,
with diameters from 0.08-0.39 .mu.M, were purchased from Spherotech
Inc. (Libertyville, Ill.). To label/detect target sequence
(amplification product or synthetic target template oligomer),
specific labeling/detecting probes carrying an amine modification
group at their 5' end (complementary to the target sequence) were
covalently conjugated to the carboxylated microspheres using a
standard EDAC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide
hydrochloride) crosslinking reaction. The gene-specific
labeling/detecting oligonucleotides used for covalent coupling
contained four components: (1) a 5' amine modification for amide
coupling to the carboxyl-polystyrene microspheres; (2) a 12 carbon
spacer to extend the oligonucleotide from the microspheres to
increase the accessibility of oligonucleotide to its hybridization
target; (3) an 12mer poly(dT) linker to further increase the
freedom of probe for better hybridization efficiency; and (4) a
20-23 base hybridization sequence complementary to the 5' end of
targets (e.g., Ba pag, protective antigen, or cap, capsid
gene).
[0126] Amine-modified oligonucleotides were synthesized by
Integrated DNA Technology Inc. (Coralville, Iowa). Before the
conjugation reaction, a desalting process was performed by
suspending the oligonucleotides in Milli-Q.RTM. water with the
final concentration of 100 .mu.M. Then the oligonucleotides were
injected into a Slide-A-Lyzer 10K (PIERCE, Rockford, Ill.). The
Slide-A-Lyzer containing oligonucleotide inside was placed into a
beaker with milli-Q water for dialysis for 4 hours with stirring
continuously at room temperature. After dialysis, 1.0M pH5.0
2-(N-morpholino) ethanesulfonic acid (MES; Sigma, St. Louis, Mo.)
was added in to adjust the final concentration to 0.1M. The
incubation continued by stirring overnight at room temperature.
Conjugation of the desalted oligonucleotides to microspheres was
carried out by mixing 40 .mu.l Carboxyl-polystyrene blue
microspheres at 5.0% (W/V) with 400 .mu.l of 10 .mu.M
oligonucleotides followed by brief sonication (1 minute with output
setting of 7) on a Sonifier Cell Disruptor 200 (Branson Ultrasonics
Corporation, Danbury Conn.). Then, the conjugation reaction was
initiated by adding .about.3 mg EDAC (Invitrogen, Carlsbad, Calif.)
to the microsphere/oligo mixture, followed by one hour incubation
at room temperature on a multi-purpose rotator (Model 151, Bohemia,
N.Y.). 4 .mu.l of 20% SDS solution was then added to prevent
microsphere aggregation. The unbound excess oligonucleotides were
removed from the microspheres by a brief centrifugation at 7000 rpm
(Eppendorf.RTM. 5415C, Eppendorf, Westbury, N.Y.) and discarding
the supernatant. The trace amount of residual oligonucleotides were
removed by two more subsequent washes with 0.1% SDS. Finally, the
microspheres were resuspended in 400 .mu.l of 0.1% SDS for
storage.
[0127] Assembly of Nucleic Acid Lateral Flow Assay Strip:
[0128] Nitrocellulose membrane cards with clear polyester material
backing, conjugation and absorption pads were purchased from
MILLIPORE Corp, MA. Hi-Flow Plus membranes with lateral-flow rates
of 65, 75, 90, 120, 135, 180, and 240 seconds across 4 centimeters
of membrane were purchased to evaluate the optimal detection
condition. As depicted in FIG. 1, lateral flow assay strip was
assembled under the manufacture's instruction with the three parts:
(1) sample pad (AP22) (20 mm.times.300 mm, B3HN43393); (2) hiflow
plus membrane cards (type 6 cm.times.30 cm, SHF0900225 for HF090 or
other membrane card with a different flow rate), and (3) absorbent
pad (AP22) (17 mm.times.300 mm, B4JN49233). The ends of three parts
were overlapped in order to ensure continuous flow of the
hybridization reaction from the sample pad to the absorbent pad. In
this example, four different gene capture probes were spotted on
the membrane (see Table 1, below).
[0129] Immobilization of Capture Probes onto the Membrane by UV
Crosslinking:
[0130] Capture oligonucleotides were synthesized with a 12mer poly
(dT) linker at 3' ends and a 20-23 mer hybridization sequence
complementary to the 3' end of target sequence (see Table 1).
Capture probes of 0.2 .mu.l at 200 .mu.M were spotted onto
nitrocellulose membrane strips using a P2 micropipetter onto
preassembled strips. After drying at room temperature for 10
minutes, the strip was UV cross linked at 5000 .mu.Jules.times.100
(UV Stratalinker 2400, Stratagene, La Jolla, Calif.).
[0131] NA Assay Detection of Synthetic Target Sequences and
Isothermal Amplification Products:
[0132] A hybridization mixture of 400 .mu.l containing 2.times.
hybridization buffer, 10 .mu.l labeled microspheres, and 2 .mu.l
synthetic target sequences or 30 .mu.l denatured HDA amplicons were
applied to the sample pad. The mixture migrated along the membrane
strip through capillary action. Upon passing the capture spot
immobilized with capture probes, a sandwich complex was formed
among labeling/detecting probe, target sequence, and capture probe
resulting in signals that can be visualized by eye or imaging. The
images scanned by Epson 2580 Photo Perfection scanner were
processed by Adobe.RTM. PhotoShop.RTM. image analysis software. The
visual detection of target sequence ranged from 2 minutes to 30
minutes depending on the particular membrane, microspheres and
concentration of target sequence. The typical assay used for the
detection of the HDA amplification product was .about.5
minutes.
[0133] Synthetic Target Sequences:
[0134] The synthetic target sequences used for optimization and
positive controls were synthesized and purified by Integrated DNA
Technology Inc. (see Table 1).
[0135] Bacillus anthracis (Ba) Genomic DNA Samples:
[0136] Genomic Ba DNA was provided by Dr. Richard A. Robison at
Brigham Young University. The cell culture and genomic DNA
purification was carried out in Dr. Robison's BSL-3 laboratory
using standard protocols. The DNA concentration was quantified by
standard UV absorption.
[0137] Helicase-Dependent DNA Amplification (HDA):
[0138] HDA reactions were conducted using the IsoAmp.RTM. tHDA kit
(New England Biolabs, Inc. Ipswich, Mass.) according to the
manufacturer's instructions.
[0139] Primers for HDA:
[0140] Specific primers to amplify Ba virulence genes pag and cap
were designed using Oligo 6 primer analysis software (Molecular
Biology Insights, Inc., Cascade, Colo.) (see Table 1) with
high-stringency parameters and sequence BLAST analysis to reduce
non-specific amplification in HDA. The reverse primers were labeled
with biotin at the 5' end and HPLC purified. The primers were
synthesized at Integrated DNA Technologies (IDT, Coralville, Iowa)
and dissolved in 1.times.TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).
The primer pairs generated amplicons with 93 bp in length for pag
and 103 bp for cap, respectively. The amplicons were confirmed by
8% acrylamide gel electrophoresis and assay detection.
[0141] Single-Plex HDA Reactions:
[0142] HDA reactions (25 .mu.l) containing 10.times. annealing
buffer, 200 nM each primer and amount of Ba genomic DNA were
denatured for 2 minutes at 95.degree. C. and promptly put on ice,
followed by addition of 25.0 .mu.l 2.times.tHDA master mix. The
amplification reaction was continually incubated at 65.degree. C.
for 75 minutes and then subjected to a thermal (94 degree for 1
minute) or enzymatic denaturation step (e.g. 1 .mu.l exonuclease
.lamda. for 20 minutes at room temperature) before application to
the lateral flow assay.
[0143] Multiplexed HDA Amplification:
[0144] HDA was performed exactly as above, except two amplification
primer pairs were added in the reaction. For further investigation
of the amplification efficiency and specificity of HDA, HDA
amplification of pag from Ba genomic DNA in excess of the
environmental near neighbor Bacillus thuringiensis (Bt) genomic DNA
at varying concentrations was performed.
TABLE-US-00001 TABLE 1 OLIGONUCLEOTIDES USED IN EXAMPLE 1 HDA
amplification primers Forward: HDAPagPF 5' -
CAGAAGTGCATGCGTCGTTCTTTG-3' [SEQ ID NO: 1] Reverse: HDAPagPR 5' -
Biotin/AGTGAATGATCAATTGCGACCGTACTT - 3' [SEQ ID NO: 2] Forward:
CapHDAP1F 5'- TACATGGTCTTCCCAGATAATGCATCGCTTG - 3' [SEQ ID NO: 3]
Reverse: CapHDAP2R 5' - Biotin/CCGGATGAGCATTCAACATACCACGG - 3' [SEQ
ID NO: 4] Oligonucleotides for microsphere conjugation Bead/HDAPag1
5' - NH.sub.2-C.sub.12/TTTTTTTTTTTT/ATATTGGTGGGAGTGTATCT - 3' [SEQ
ID NO: 5] Bead/HDACapCap2 5' -
NH.sub.2-C.sub.12/TTTTTTTTTTTT/CTTTAGCGGTAGCAGAGGCTCTT - 3' [SEQ ID
NO: 6] Oligonucleotides for membrane immobilization Pag capture
probe: 5' - GCAGGATTTAGTAATCGAATTT/TTTTTTTTTTTT - 3' [SEQ ID NO: 7]
Cap capture probe: 5' - GGGATTGATGAGGAAACAGCATT/TTTTTTTTTTTT - 3'
[SEQ ID NO: 8] Neg ctrl capture probe 1 (CapB) 5' -
TACATGGTCTTCCCAGATAA/TTTTTTTTTTTTTTT - 3' [SEQ ID NO: 9] Neg ctrl
capture probe 2 (Cya) 5' - TGCTAGAGAATTAAATACATATA/TTTTTTTTTTTTTTT
- 3' [SEQ ID NO: 10] Neg ctrl capture probe 3 (Flu) 5' -
GTGCCTTGAGAC/TTTTTTTTTTTTTTT - 3' [SEQ ID NO 11] Pos ctrl capture
probe 1 (Pag) 5' - TTCGAATTACTAAATCCTGCAGATACACTCCCACCAATAT - 3'
[SEQ ID NO: 12] Pos ctrl capture probe 2 (Cap) 5' -
GAATGCTGTTTCCTCATCAATCCCAAGAGCCTCTGCTACCGCTAAAG - 3' [SEQ ID NO:
13] Synthetic target sequences for assay characterization Pag
target sequence (FIG. 1) 5' -
TTCGAATTACTAAATCCTGCAGATACACTCCCACCAATAT - 3' [SEQ ID NO: 14] Cap
target sequence (FIG. 4) 5' -
GAATGCTGTTTCCTCATCAATCCCAAGAGCCTCTGCTACCGCTAAAG - 3' [SEQ ID NO:
15]
[0145] Results:
[0146] Optimization of Lateral Flow Detection Assay:
[0147] Different membrane and microsphere components were tested
for their sensitivity using the same synthetic model sequence Pag
target sequence (see Table 1, with bead/HDAPag1 labeling/detecting
probe and Pag capture probe) under several commonly used
hybridization buffer conditions. Results indicated that buffer
containing 0.75.times.SSC, 0.1% Ficoll, 0.1% Gelatin, 1% triton
X-100 and 20 mM Na.sub.2PO.sub.4 gave the best signal with minimal
background, and the combination of Hi-Flow.RTM. Plus membrane 90
and 0.39 um microspheres providing optimal sensitivity and
reasonable detection speed (.about.5 minutes). Under these optimal
hybridization conditions, the sensitivity of detection was measured
by applying hybridization reaction mix containing varying
concentrations of Pag target to assay. As shown in FIG. 4, as
little as 20 fmoles of Pag target (0.1 nM, 200 .mu.l) can be
detected using the NA assay, achieving comparable sensitivity
offered by a typical homogeneous fluorescence assay (e.g. Taqman
assay). As shown in FIG. 4, there was no visible signal detected on
the spots immobilized with CapB and Cya capture probes indicating
the lack of false positives.
[0148] NA Assay Detection of Isothermal Amplification Products:
[0149] To further evaluate the utility of the NA assay on the
direct detection of the crude amplification products, two HDA
amplifications that generate amplicons with the sizes of 93 bp or
103 bp fragments for pag or cap, respectively, were conducted. The
amplicons were divided into two aliquots with one aliquot applied
to 8% nondenaturing acrylamide gel electrophoresis (left panels,
FIG. 5) and the other aliquot applied to the NA assay (right
panels, FIG. 8).
[0150] As shown in FIG. 5, the NA assay provided clear visible
signals within 2 minutes (Lane 1's for pag and cap detection, right
panel) as agreed by parallel gel electrophoresis results (Lane 1s,
Left panel). In addition, no non-specific signals were observed in
negative controls and other non-target spots (Lane 2 and 2's in
FIG. 5) without further purification requirements.
[0151] A side-by-side comparison to demonstrate the relative
sensitivity of the NA assay vs. nondenaturing acrylamide gel
electrophoresis detection on Ba pag HDA amplicons was also
performed. For this comparison, an HDA amplification product
solution was diluted to different final concentrations and loaded
to gel and assay for side-by-side analysis (FIG. 6). Clear visual
signal was observed using assay detection even when the amplicons
were shown as a very faint band by gel analysis with a dilution
factor of 32 fold (FIG. 7). These results demonstrate that
comparable sensitivity is obtained with the NA assay.
[0152] Sensitivity Evaluation of HDA-Coupled NA Assay
Detection:
[0153] The amplification sensitivity of HDA on Ba genomic DNA was
investigated by carrying out HDA reactions with decreasing amounts
of starting Ba genomic DNA, from 3000 copies to 3 copies. The
amplification products were analyzed by gel electrophoresis and
assay detection. As shown in FIG. 7, the yield of amplification
product decreased as the starting genomic copy number was reduced,
indicating the sensitivity of the assay to the initial starting
material. The results also showed that as little as 30 copies of Ba
genomic DNA was efficiently amplified and detected using gel and
assay analysis (FIG. 7). These results were extremely reproducible
using the NA assay system.
[0154] To further demonstrate the specificity and sensitivity of
the HDA-coupled assay for rare target detection in a highly
heterogeneous field sample, a series of complex genomic DNA
mixtures were prepared by mixing 100 copies of Ba genomic DNA with
1 to 10000 times of excess Bt genomic DNA (a near neighbor of Ba),
and subjected to HDA reactions. The amplification products were
analyzed by both gel and assay detection. No significant signal
differences were observed among different sample mixtures on gel
and NA assay, suggesting that HDA-based NA assay detection was
highly efficient and specific for rare Ba target amplification, and
less sensitive to the varying amount Bt genomic background (FIG.
8).
[0155] Multiplexed HDA Amplification and NA Assay Detection:
[0156] To investigate the potential multiplexing capability of HDA
amplification and NA assay detection, two HDA primer pairs (the
same as used for amplifying pag and cap above) were tested in a
multiplexed HDA reaction. The HDA products were analyzed by 8%
nondenaturing gel electrophoresis and NA assay (FIG. 9). Because
the two amplicons were close in length, two discrete bands could
not be resolved by gel (FIG. 9, left panel). However, two amplicons
were clearly detected by the two positive signals appearing on Pag
and Cap capture spots in the lateral flow NA assay (FIG. 9, right
panel, HDA lane). The signal intensity difference of cap and pag in
the assay results reflected the differing amplification
efficiencies of cap and pag, as demonstrated by the single-plex
results discussed above (see FIG. 5). These results show that the
HDA-based NA assay system may be applied in multiplexed
situations.
Example 2: Extraction and Amplification of Influenza RNA from
Immunomagnetically Captured Virus
[0157] This example shows the effective extraction of amplifiable
RNA from influenza A virus using a combination of immunomagnetic
affinity capture of influenza A virus and NaOH lysis. Extracted RNA
was subjected to RT-PCR as an indicator of the quality of the RNA
so extracted.
[0158] Materials and Methods:
[0159] Influenza A strain, A/Sydney/5/97 (H3N2 strain). Negative
control, MDCK cells (not infected with virus). Positive control,
viral RNA extracted from partially purified A/Sydney/5/97 using
Qiagen kit RNeasy (.about.10.sup.6 pfu).
[0160] For the first set of experiments, the
bead-avidin/biotin-antiflu antibody system was used to isolate
virus from media, isolated virion preparation was stored at
-70.degree. C. Frozen virion preparation was purified by filtration
through a 0.2 .mu.m filter post-infection of MDCK cells, so the
samples contained a significant amount of cell debris. No other
handling of the virus was performed prior to addition to the bead
mixture.
[0161] 5, 25, and 100 .mu.L of .about.10.sup.6-10.sup.7 pfu/mL
A/Sydney/5/97 (H3N2) was added directly to 200 ng of anti-influenza
A (polyclonal from goat, raised against Influenza A/Texas/1/77
(H3N2)) in 500 .mu.L 10 mM PBS, pH 7.2 and rotated at room
temperature for 2 hours. To this solution was added 20 .mu.L of a
10 mg/mL suspension of magnetic beads-avidin and rotated overnight
at 4.degree. C. For the negative control throughout, the mock viral
culture was used in equal volumes and treated in an identical
manner.
[0162] The beads were then washed twice with 200 .mu.L of a 10 mM
PBS/BSA (0.1% w/v) then twice with 200 .mu.L of H.sub.2O, and
resuspended in 50 .mu.L water. To a PCR tube containing all the
components necessary for RT-PCR (using the Taqman.RTM. Kit) was
added 5 .mu.L of the bead suspension to final volume of 20 .mu.L.
The remaining 45 .mu.L of the bead-flu suspension was treated with
15 .mu.L of a 0.1 N NaOH solution at room temperature for 10
minutes then neutralized to pH 7.0 with 15 .mu.L of a 0.1 N HCl
solution. To a PCR tube containing all the components necessary for
RT-PCR was added 7.5 .mu.L of the lysed virus-bead solution (no
beads were added) to a final volume of 20 .mu.L. The mock was
treated in an identical manner for both the bead suspension and
NaOH lysis.
[0163] RT-PCR was performed with the Taqman.RTM. Kit (Applied
Biosystems Inc.) using the primers and probe approved by the CDC
for real-time reverse transcriptase-PCR of influenza A.
[0164] Results:
[0165] The results of the RT-PCR are shown in FIG. 10. PCR products
visualized by SDS-PAGE analysis are shown in FIG. 11.
[0166] A typical run consisted of one step at 48.degree. C. for 30
minutes, one step at 95.degree. C., then 40 cycles of 95.degree. C.
for 15 seconds and 60.degree. C. for one minute. When the beads
were added directly to the PCR tube, the initial heating step at
48.degree. C. was sufficient to release the vRNA into solution for
the RT-step (see FIG. 11, lanes 1-3). At approximately the same
viral load for both the heating and NaOH-lysis methods the
amplified product crossed the fluorescent signal threshold only
three cycles apart, indicating the initial concentration of vRNA
present for the RT-step were similar. Analysis of the amplified
products by SDS-PAGE indicate only the expected fragment at
.about.100 bp was observed, thus demonstrating the specificity of
the designed primers and the absence of non-specific sequence
amplification. The band observed at .about.50 bp is due to the
formation of primer-dimers.
Example 3: Amplification of Influenza RNA Using Isothermal RT-HDA
and Detection Using Lateral Flow Nucleic Acid Assay
[0167] This example demonstrates successful amplification and
detection of influenza A viral RNA using isothermal RT-HDA in
combination with lateral flow detection.
[0168] Materials and Methods:
[0169] Single-step RT-HDA reaction: A single reaction in a volume
of 20 .mu.l containing 10.times. HDA annealing buffer in
IsoAmp.RTM. tHDA kit (Biohelix.RTM., Beverly, Mass.), 100 nM
influenza A-specific primers, influenza A RNA, 500 mM dNTPmix
(Invitrogen, Carlsbad, Calif.), 5 mM MgCl.sub.2, 0.01M DTT, 40
units of RNaseOUT (Invitrogen, Carlsbad, Calif.), and 10 units of
rBst DNA polymerase, Large Fragment (IsoTherm.TM.) (EPICENTRE,
Madison, Wis., USA), was prepared and incubated at 65.degree. C.
for 10 minutes. Then, 5 units of Hybridase (Thermostable RNaseH)
(EPICENTRE, Madison, Wis., USA), was added to the reaction followed
by 20 minutes incubation at 65.degree. C. The HDA reaction was
initiated by adding 10.times.HDA annealing buffer in 25 .mu.l of
2.times.tHDA mastermix (both from Biohelix.RTM., Beverly, Mass.).
The total volume of the combined rBst RT and HDA reactions was 50
.mu.l. The rBst RT and HDA reaction was continually incubated at
65.degree. C. for 90 minutes before application to the lateral flow
assay strip. In one experiment, dyed microbeads functionalized with
capture oligonucleotide complementary to one part of the target
sequence were added directly to the combined RT-HDA reaction
mixture 10 minutes prior to the termination of the RT-HDA
incubation. After termination of the reaction, the mixture was
loaded onto a lateral flow detection strip printed with detection
oligonucleotide complementary to a unique region of the amplified
target nucleic acid.
[0170] Results:
[0171] The amplification results of the combined RT-HDA reactions
is presented in FIG. 12, showing effective amplification of the
target nucleic acid. The results of the lateral flow assay are
shown in FIG. 13, and demonstrate specific identification of the
target sequence.
Example 4: Immunomagnetic Capture of Influenza a Virions and Heat
Extraction of Viral RNA
[0172] This example shows the effective extraction of amplifiable
RNA from influenza A virus using a combination of immunomagnetic
affinity capture of influenza A virus and heat-lysis. Extracted RNA
was subjected to RT-PCR as an indicator of the quality of the RNA
so extracted.
[0173] Materials and Methods:
[0174] General Materials:
[0175] Carboxy-coated magnetic beads (1 .mu.m) were purchased from
BioClone, Inc. All antibodies were purchased from BioDesign, Int.
(Saco, Me.) and used without further purification. EDAC, S-NHS, and
buffer components were purchased from Fisher Scientific, Inc. The
PAb-coated magnetic beads were either transferred manually on a
magnetic holder or transferred automatically on an ABI KingFisher96
robot.
[0176] Immobilization of Anti-Flu Polyclonal Antibodies to Magnetic
Beads:
[0177] Anti-Influenza-A polyclonal antibodies (PAb) were
immobilized to carboxy-coated magnetic beads using a standard
two-step protocol for covalently attaching antibodies to the beads,
as follows. In order to assure surface saturation of the surface as
a single monolayer approximately 5-10 fold excess PAb was
necessary. Briefly, 10 mg of magnetic beads were washed twice with
MES, pH 6.0 and resuspended in the same buffer. To the suspension
were added EDAC and S-NHS, and the mixture was allowed to react in
the dark with rotation at room temperature for one hour, at which
time additional EDAC was added and allowed to react in a similar
manner. The supernatant was removed, beads washed twice with the
same buffer, then resuspended in phosphate buffer, pH 7.5.
Immediately thereafter, a PAb solution was added and allowed to
react overnight at room temperature in the dark with gentle
rotation. The following day, ethanolamine-HCl, pH 8.0 was added to
quench the reaction. The beads were washed extensively with
conjugation buffer then resuspended at a final concentration of 10
mg/mL in PBS/BSA and stored at 4.degree. C.
[0178] Capture of Virus Particles:
[0179] PAb-coated magnetic beads were added to blocking buffer
(PBS/Tween/BSA) and mixed by rotation. The beads were transferred
to the same buffer containing serial 10-fold dilutions of the
appropriate viral strain (either purified virus or virus diluted
into flu-negative human nasopharyngeal aspirate solution) and
allowed to bind to influenza virus particles for 30 minutes. The
beads were washed twice with PBS/Tween, twice in PBS/BSA, then
resuspended in 50 .mu.L ddH.sub.2O.
[0180] Extraction of Viral RNA:
[0181] Influenza viral RNA was extracted by heating the
virus-PAb-magnetic bead at 95.degree. C. for 3 min or 60.degree. C.
for 30 min. Either treatment was sufficient to release at least 90%
of the viral genome as determined by real time RT-PCR when compared
to total RNA isolation using commercial kits (Ambion.RTM., Inc.,
MagMax Viral Isolation Kit and Qiagen Total RNA Isolation Kit). The
reactions were performed and analyzed in a 7300 Real Time PCR
System (ABI) under the following conditions: 15 min at 45.degree.
C. and 10 min at 95.degree. C., followed by 50 cycles of 15 s at
95.degree. C. and 45 s at 60.degree. C.
[0182] For the quantitative assay, the threshold cycles of spiked
clinical samples were directly compared to a standard curve
generated by RT-PCR of known numbers of influenza A RNA
transcripts. The results are presented as influenza A copies (or
individual particles) per 10 .mu.L of the original serially diluted
virus stock. All samples were run in triplicate.
[0183] Results:
[0184] As few as 10 copies of matrix gene RNA was detected by
RT-PCR using the Ambion Flu M gene detection kit. The specificity
of influenza A towards the differentially coated PAb magnetic beads
was determined using 10-fold serial dilutions of partially purified
influenza spiked (both H3N2 and H1N1 strains) into either PBS or
human nasopharyngeal aspirates (NPA). The NPA samples were
previously determined to be negative for influenza A by both the
supplier and by our own analysis. The Pab-functionalized magnetic
beads were able to recognize both the H3N2 and H1N1 influenza A
strains. Minimization of non-specific binding of influenza A to
non-anti influenza A PAb-coated magnetic beads was accomplished
when a mild detergent was introduced into the blocking buffer in
the presence of high concentrations of BSA. Optimization led to a
complete sequence of blocking, binding, washing and elution.
[0185] The pulldown efficiency was determined by RT-PCR using a
commercial kit (Ambion, Inc.) against a standard of known quantity.
The standard was a ssRNA oligonucleotide identical to the target
sequence in influenza A, specifically a highly conserved .about.100
base region at the N-terminus of segment 7, which encodes the
matrix (M) gene. We assessed the efficiency of the pulldown based
on the total number of viral particles. This was necessary since
typical influenza A preparations often contain as much as 90%
non-infectious particles, which would be expected to be detected by
RT-PCR but not by the plaque assay. Based on our standard curve, a
positive result contained a threshold value (Ct) <35-36.
[0186] When 10-fold serial dilutions of influenza A were spiked
into either PBS or NPA, the PAb-functionalized magnetic beads were
able to recover, on average, approximately 3-9% of the total virus
originally spiked into the solution. This number represents the
lower limit of total viral particles that were recognized by the
PAb-coated magnetic beads. Since the standard of total viral
particles was based on total viral RNA present in the original
sample, it is very likely a large percentage of the virus was not
recognized by the PAb-coated magnetic beads due to free viral RNA
present in the original sample and/or incorrect folding of the
viral coat proteins. Of importance was the observation of very
little loss of sensitivity when tested on clinical samples, which
could cause problems due to increased viscosity and the presence of
potential inhibitors of the RT-PCR. Results of the pulldown are
presented in Table 2. The results are reported as total copies of
viral RNA/viral particles spiked into either PBS or NPA. Typically,
10 .mu.L of 10-fold serial dilutions were spiked into 50 .mu.L of
either PBS or NPA then added to 150 .mu.L of binding buffer. For
each extraction, 10 .mu.L of an approximate 10 mg/mL PAb-coated
magnetic beads were sufficient for maximizing virus isolation. For
% recovery, the value reported represents the average pulldown
efficiency of each virus strain for the clinical samples.
TABLE-US-00002 TABLE 2 INFLUENZA PARTICLE RECOVERY FROM NPA AND PBS
Initial copies of Output by RT- Output by RT- viral genomic PCR
H3N2 PCR H1N1 % Recovery RNA/extraction (PBS/NPA) (PBS/NPA)
(H3N2/H1N1) 10.sup.6 6 .times. 10.sup.4/5 .times. 10.sup.4 9
.times. 10.sup.4/6 .times. 10.sup.4 5%/6% 10.sup.5 8 .times.
10.sup.3/4 .times. 10.sup.3 4 .times. 10.sup.3/6 .times. 10.sup.3
4%/6% 10.sup.4 4 .times. 10.sup.2/3 .times. 10.sup.2 7 .times.
10.sup.2/5 .times. 10.sup.2 3%/5% 10.sup.3 7 .times. 10.sup.1/5
.times. 10.sup.1 8 .times. 10.sup.1/6 .times. 10.sup.1 5%/6%
Example 5: One-Step RT-HDA Amplification of Influenza A RNA Using
Poly dT Fork-Generating Primers
[0187] Materials and Methods:
[0188] General Materials: The enzymes and reagents for the HDA were
purchased from BioHelix, Inc (Beverly, Mass.). Isotherm DNA
polymerase (rBst) and Hybridase thermostable RNaseH for rBst RT
step were purchased from Epicentre (Madison, Wis.), and the other
reagents (MgCl.sub.2, DTT, dNTP mix and RNaseOUT) were purchased
from Invitrogen (Carlsbad, Calif.). Protein concentrations were
determined by the method of Bradford. RNA/DNA concentrations were
determined by absorbance at 260 nm. Viral stocks were grown on MDCK
cells and the number of infectious particles determined by plaque
assay (pfu/mL).
[0189] Primers:
[0190] Three sets of primers were used: [0191] 1) MP_2 primers:
TABLE-US-00003 [0191] [SEQ ID NO: 16]
5'-TCCTGTCACCTCTGACTAAGGGGATTT-3' [SEQ ID NO: 17]
5'-RAGGGCATTTTGGACAAAGCGTCTAC-3'
[0192] 2) poly dT primers:
TABLE-US-00004 [0192] [SEQ ID NO: 18]
5'-TTTTTTTTTTRAGGGCATTTTGGACAAAGCGTCTAC-3' [SEQ ID NO: 19]
5'-TTTTTTTTTTCCTGTCACCTCTGACTAAGGGGATTTTR-3'
[0193] 3) poly dl primers:
TABLE-US-00005 [0193] [SEQ ID NO: 20]
5'-IIIIIIIIIIRAGGGCATTTTGGACAAAGCGTCTAC-3' [SEQ ID NO: 21]
5'-IIIIIIIIIITCCTGTCACCTCTGACTAAGGGGATTTTR-3'
[0194] RT-HDA Reaction Mixtures and Protocol:
[0195] Each RT-HDA reaction contained the following reagents from
the Biohelix IsoAmp II tHDA kit: 5 .mu.L 10.times. Annealing
Buffer, 1.75 .mu.L MgSO.sub.4 (100 mM stock), 4 .mu.L NaCl, (500 mM
stock), 3.5 .mu.L dNTP mix, and 3.5 .mu.L enzyme mix. In addition,
each reaction contained 2 .mu.L Influenza-A RNA template (Puerto
Rico 8/34; 5.times.10.sup.5 copies/.mu.L stock), 5 .mu.L Fwd.
primer (1 .mu.M stock), 5 .mu.L Rev. primer (1 .mu.M stock), 0.5
Thermoscript.TM. reverse transcriptase (2 U/.mu.L, Invitrogen) or
otherwise stated, and nuclease-free H.sub.2O to a final volume of
50 .mu.L. Serial 10-fold dilutions of Influenza-A Puerto Rico
strain RNA were made in order to vary the copy number from
10.sup.3-10.sup.4 copies per reaction. Using a similar protocol, a
positive tHDA control was run alongside the RT-HDA reactions. This
reaction used a DNA template, and thus required no reverse
transcriptase. All reagents were added according to the above
protocol excepting the following discrepancies: 0.75 .mu.L of each
primer, 1 .mu.L DNA template, and 2 .mu.L MgSO.sub.4 (100 mM
stock). Positive DNA template and primers were included in IsoAmp
II tHDA kit and used as directed. These reactions were incubated at
65.degree. C. using a thermocycler for 90 min or otherwise stated.
Labeling of the amplification product were achieved An aliquot of
20 .mu.L from each reaction was loaded onto a 10% polyacrylamide
TBE gel and run for 100 min at 100 V.
[0196] Results:
[0197] Poly dT Fork-Generating Primers Result in High-Efficiency
RT-HDA:
[0198] The results of this study are presented in FIG. 14. The poly
dT primer sets supported a much more efficient amplification
reaction, as demonstrated by the significantly higher yields of
amplification product in Lane c and d, compared with amplification
supported by the unmodified primer set, which only yielded very
faint product bands and two other non-specific primer dimmer bands
(Lane a and b). These results clearly demonstrate that low melting
point, fork-generating primers facilitate more efficient
helicase-mediated amplification reactions, most likely due to more
efficient helicase loading at poly dT ends. Interestingly, the use
of 5' random sequence primer and poly I primer did not produce any
specific amplification products (FIG. 14. Lane c-f), in a good
agreement with the previous report that UvrD-like helicases do not
prefer primer substrates with 5' overhangs.
[0199] Poly dT Fork-Generating Primers Enable the Use of Variable
Reverse Transcriptases:
[0200] Thermoscript.TM. is suggested by BioHelix to be the
preferred reverse transcriptase to work with its commercial IsoAmp
II tHDA kits. To explore the compatibility of other RTs with RT-HDA
reaction, Superscript (SS III), and Bst (a strand displacement
polymerase that can also function as RT) were used as RT enzymes in
conjunction with different primer substrates in flu RT-HDA
reactions (FIGS. 15A-15C). Interestingly, the result show that when
the RT-HDA reaction is primed with Poly dT primers, both SS III and
Bst polymerases can be used, enabling good amplification from as
little as 10 copies of flu target RNA (FIG. 15C). In contrast, if
the RT-HDA reaction is primed using the standard MP-2 primer, then
Bst polymerases seemed to be a better RT than SS III, since SSS
III-HDA amplification had amplification sensitivity of 10 copies
(FIG. 4, Lane d, e, f, vs. a, b, c).
[0201] In terms of RT-HDA amplification efficiency, the use of poly
T primers yielded higher quality and quantity of amplified DNA
compared with the use of standard primers. This result again
demonstrated that RT-HDA amplification primed by poly dT,
fork-generating primers, dramatically improves the efficiency of
the overall RT-HDA reaction, essentially relaxing the requirement
for specific RT enzymes. More importantly, these results also
demonstrate that rBst polymerase can also be used as a RT enzyme,
therefore potentially reducing three enzymes, Thermopscript,
helicase and rBst pol for conventional RT-HDA to two enzyme-based
(helicase and rBst pol) RT-HDA.
[0202] Poly(t) Priming Results in Faster RT-HDA Reaction Times:
[0203] A time course study using poly dT primers, and rBst
polymerase as a RT, in a one-step RT-HDA reaction decreases assay
reaction times by between a third and a half (FIG. 16). Unlike
previous assays, which require a 90 minute reaction time (Example
3, supra), the new poly dT primer-rBst pol-HDA combination enabled
good amplification of as little as 10 flu RNA template copies in 60
minutes, whereas standard primer reactions yielded no discernable
amplification product within this shortened time frame (FIG. 16).
Moreover, based on preliminary data, it appears that a 45 minute
reaction may be sufficient for this one step RT-HDA protocol.
Example 6: Lateral Flow Capture of RT-HDA Amplified Influenza A
Target Sequences
[0204] Materials and Methods:
[0205] General Materials and Methods: Carboxy-coated blue
microspheres (0.39 .mu.m) were obtained from Spherotech, Inc (Lake
Forest, Ill.). Oligonucleotides were purchased from IDT
(Coralville, Iowa). EDAC, S-NHS, and buffer components were
purchased from Fisher Scientific, Inc. The enzymes and reagents for
the HDA were purchased from BioHelix, Inc (Beverly, Mass.). The
nitrocellulose membrane cards with clear polyester material
backing, conjugation and absorption pads were purchased from
MILLIPORE Corp. (Billerica, Mass.). Isotherm DNA polymerase (rBst)
and Hybridase thermostable RNaseH for rBst RT step were purchased
from Epicentre (Madison, Wis.), and the other reagents (MgCl.sub.2,
DTT, dNTP mix and RNaseOUT) were purchased from Invitrogen
(Carlsbad, Calif.). Protein concentrations were determined by the
method of Bradford. RNA/DNA concentrations were determined by
absorbance at 260 nm.
[0206] Primers, Capture and Detection Probes:
[0207] Shown in Table 3 are the oligonucleotides used in this
Example. A "+" precedes an LNA residue. "NH2" indicates a 5' amine
group modification, "Phos" indicates 3' phosphoryl.
TABLE-US-00006 TABLE 3 PRIMERS AND PROBES USED IN EXAMPLE 6 HDA
amplification primers Forward: FluFP 5 -
AGATGAGTCTTCTAACCGAGGTCG-3' [SEQ ID NO: 22] Reverse: FluRP 5' -
Biotin/TGCAAAAACATCTTCAAGTCTCTG - 3' [SEQ ID NO: 23]
Oligonucleotides for microsphere conjugation Bead/HDA fluJian 5' -
NH.sub.2C.sub.12/TTTTTTTTTTTT/TCTATCGTC + CCGTCAGGC + CC/3Phos/ -
3' [SEQ ID NO: 24] Oligonucleotides for membrane immobilization Flu
capture probe 5' - G + CCG + AGATCGCG/TTTTTTTTTTTT - 3' [SEQ ID NO:
25] Neg ctrl capture probe 1 (CapB) 5 -
TACATGGTCTTCCCAGATAA/TTTTTTTTTTTTTTT - 3' [SEQ ID NO: 26] Neg ctrl
capture probe 2 (Cya) 5' - TGCTAGAGAATTAAATACATATA/TTTTTTTTTTTTTTT
- 3' [SEQ ID NO: 27] Synthetic target sequences for dipstick
characterization Flu target sequence 5' -
CGCGATCTCGGCTTTGAGGGGGCCTGACGGAACGATAGAGAGAACATACGTT -3 [SEQ ID NO:
28]
[0208] Nucleic Acid Lateral Flow Assay:
[0209] The overall configuration of the sandwich-based NA lateral
flow assay is illustrated in FIG. 2. Two hybridization probes were
used to label and capture an influenza specific ssDNA sequence
previously reverse transcribed and amplified from viral genomic
RNA: one detection probe was conjugated to dyed microspheres and
the other a capture probe immobilized on the nitrocellulose
membrane.
[0210] Conjugation of Oligonucleotides onto Dyed Microspheres:
[0211] In this Example, a highly conserved .about.100 base region
at the N-terminus of segment 7, which encodes for the matrix (M)
gene of Type A Flu, was amplified. To detect the amplification
products using lateral flow dipstick assay, a pair of labeling and
membrane capture probes were designed to be complementary to the
amplified flu sequences. To label/detect the target sequence
(amplification product or synthetic target template oligomer), a
specific detection probe harboring an amine modification group at
the 5'-end (complementary to target sequence) was covalently
conjugated to the carboxylated microspheres using standard EDAC
(1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride)
chemistry. The gene-specific detection oligonucleotide used for
covalent coupling required four components: (1) a 5'-amine
modification for amide coupling to the carboxyl-polystyrene
microspheres; (2) a 12-carbon spacer to extend the oligonucleotide
from the microspheres to increase the accessibility of
oligonucleotide to its hybridization target; (3) a 12-mer poly(dT)
linker for additional flexibility of the probe to increase
hybridization efficiency; and (4) a 20-23 nt hybridization sequence
complementary to the 5'-end of the gene target. Briefly, a typical
conjugation reaction used the following protocol. Oligonucleotide
(100 .mu.M) was dialyzed against water for 4 h (Slide-A-Lyzer.RTM.,
10K) to remove residual salt, at which time the buffer was
exchanged with 0.1 M 2-(N-morpholino) ethanesulfonic acid, pH 5.0
(MES), and allowed to stir overnight at room temperature.
Conjugation of the desalted oligonucleotides to the microspheres
was carried out by mixing 40 .mu.l of 5.0% (w/v)
carboxylated-polystyrene blue microspheres with 400 .mu.l of 10
.mu.M oligonucleotides followed by a brief sonication (1 minute
with output setting of 7) using Sonifier.RTM. Cell Disruptor 200
from Branson Ultrasonics Corp. (Danbury Conn.). The conjugation
reaction was initiated by adding .about.3 mg EDAC to the
micropshere/oligonucleotide mixture, followed by a 1 h incubation
with gentle rotation at room temperature. The reaction was quenched
upon addition of 4 .mu.l of a 20% (w/v) SDS solution. Excess
oligonucleotides were removed by a brief centrifugation at 7000 rpm
(Eppendorf.RTM. 5415C, Eppendorf, Westbury, N.Y.), followed by two
subsequent washes with 0.1% (w/v) SDS. Finally, the microspheres
were resuspended in 400 .mu.l of 0.1% (w/v) SDS and stored at
4.degree. C.
[0212] Lateral Flow Device:
[0213] The lateral flow assay strip was assembled under the
manufacture's instruction and consisted of the three parts: (1)
sample pad (AP22) (20 mm.times.300 mm, B3HN43393); (2) hiflow plus
membrane cards (type 6 cm.times.30 cm, SHF0900225 for HF090 or
other membrane card with a different flow rate), and (3) absorbent
pad (AP22) (17 mm.times.300 mm, B4JN49233). The three components
overlapped in order to ensure continuous flow of the hybridization
reaction from the sample pad to the absorbent pad. In this paper,
four different gene capture probes were spotted on the membrane
(sequences will be reported elsewhere).
[0214] Immobilization of Capture Probes onto the Membrane by UV
Crosslinking:
[0215] Capture probes/oligonucleotides were designed with a 12-mer
poly (dT) linker at the 3'-end and a 20-23 nt hybridization
sequence complementary to the 3' end of target sequence. Capture
probes were spotted onto the nitrocellulose membrane of
preassembled strips dried at room temperature for 10 minutes, then
exposed to ultraviolet light (UV) to crosslink the capture probe to
the membrane (UV Stratalinker 2400, Stratagene, La Jolla, Calif.).
The strips were stored at room temperature for future use.
[0216] Labeling Amplification Products Prior to Lateral Flow
Detection:
[0217] Labeling of amplification products were achieved in several
ways prior to applying it lateral flow detection: (1) amplification
mixture was undergoing a thermal denaturation (94 degree for 1
minute), or (2) enzymatic degradation (e.g. using one
5'-phosphorylated amplification primer in HDA, and exonuclease A
for post-amplification digestion for 10 minutes at room
temperature) prior to application to the lateral flow assay strip.
(3) Labeling of amplification product can be carried out by adding
dyed microspheres bearing detection probes with an inactive 3'
(e.g. modified by an phosphate or thiolated group instead of a
active 3' hydroxy group for primer extension). The sequence of
probes had the same as described before except the primer bears an
inactive phosphate group. Microsphere bearing probes (5 .mu.l) was
added to isothermal amplification reaction (40 .mu.l).
[0218] Detection of Amplified Target Sequences:
[0219] Hybridization of the amplification product (30 .mu.l) or the
synthetic equivalent (2 .mu.l) was achieved by mixing 10 .mu.l of
labeled microspheres with 2.times. hybridization buffer
(1.5.times.SSC, 0.2% Ficoll, 0.2% Gelatin, 2% triton X-100 and 40
mM Na.sub.2HPO.sub.4, pH 7.4). Following a brief incubation period
at room temperature, the mixture was applied to the sample pad of
the lateral flow assay device. The blue solution was allowed to
migrate through the membrane via capillary action. Upon passing the
capture spot immobilized with capture probes, a sandwich complex
formed among detection probe, target sequence, and capture probe
resulting in a clear blue signal that was directly visualized by
eye. The images scanned by Epson 2580 Photo Perfection scanner were
processed by Adobe PhotoShop image analysis software. The
appearance of a signal ranged from 2 to 30 minutes, and was a
direct result of the particular membrane, the size and the number
of microspheres and concentration of target sequence. The typical
assay used for the detection of the HDA amplification product was
.about.5 minutes.
[0220] Results:
[0221] Several parameters of the lateral flow assay were optimized
for maximal sensitivity and specificity. The variables examined
were as follows: 1) nitrocellulose membranes with varying flow
rates; 2) dyed microspheres with different diameters; 3) buffer
conditions for hybridization of target sequence to both the
oligonucleotide-conjugated microspheres and capture probe on
membrane; 4) capture probe concentration on the membrane; and 5)
incubation time and temperature of the initial hybridization of the
target sequence to the labeled microspheres. The study indicated
that the hybridization buffer with 0.75.times.SSC, 0.1% Ficoll,
0.1% Gelatin, 1% Triton X-100 and 20 mM Na.sub.2HPO.sub.4 would
give the best hybridization signal with minimal background, and the
combination of Hi-Flow Plus membrane 90 and 0.39 um microspheres
provided optimal sensitivity and rapid (.about.5 min)
detection.
[0222] Initial determination of the sensitivity and specificity of
the device was accomplished with the synthetic Flu target sequence
which is the single-stranded version of the expected amplification
product from the rBst RT-HDA reaction (Note: the synthetic Flu
target sequence was designed to contain the region of hybridization
to both the detection probe and capture probe, i.e. there are no
5'- and 3'-overhangs. However, the synthetic Flu target sequence is
identical to the expected region of hybridization from the HDA
reaction). Under the optimal hybridization conditions, serial
dilutions of the synthetic Flu target sequence were hybridized with
the labeling/detecting probes and applied to the sample pad of the
lateral flow device. As a negative control, two gene sequences, Cya
and CapB, from the virulent bacterium Bacillus anthracis (Ba) were
chosen to provide direct evidence for the absence of
cross-reactivity with the target sequence. As depicted in FIG. 18,
as few as 20 fmoles of the Flu target sequence (0.1 nM, 200 .mu.l)
were visualized, thus achieving comparable sensitivity observed
from a typical homogeneous fluorescence assay (e.g. Taqman assay).
In addition, the 20 fmoles of Flu is equivalent to approximately
1.2.times.10.sup.10 copies, which was found to be an important
detection limit. These results demonstrate that HDA can amplify
cDNA over a billion-fold. There was no visible signal detected on
the spots immobilized with CapB and Cya capture probes indicating
the absence of cross-reactivity (high specificity) with the target
sequence.
[0223] To detect the flu RT-HDA amplification product, the rBst
RT-HDA reaction mixture was split into two aliquots and detected by
both dipstick and non-denaturing PAGE/ethidium bromide staining in
the presence of Flu RNA. In the absence of target RNA, only the
faint appearance of primer-dimer was observed. When the rBst RT-HDA
product was applied to the lateral flow device after hybridization
to the labeled microspheres, the expected signal was observed on
the device and, importantly, no cross-reactivity was observed with
the Cya and CapB capture probes (FIG. 19).
Example 7: RT-HDA Primer, Detection Oligonucleotide and Capture
Oligonucleotide Combinations for Influenza A
[0224] This example provides several sets of oligonucleotide
components useful in detecting the presence of seven different
influenza A genes using the assay method of the invention (i.e.,
viral capture and RNA extraction, one-step RT-HDA, and sandwich
hybridization capture of target using a lateral flow platform.
[0225] Materials and Methods:
[0226] Primers for use in the one-step RT-HDA reaction were
designed in combination with coordinate detection and capture
oligonucleotides using the following approach: [0227] a. Obtain all
available sequences from multiple sources (e.g., GenBank, The
Influenza Sequence Database at LANL). [0228] b. Perform multiple
sequence alignments and develop consensus sequences at different
taxa levels (e.g., different subtypes). [0229] c. Pick up all
possible primer/probe sets along the whole molecule using Primer3
according to a set of given requirements. [0230] d. Introduce
degenerate bases to maximize the coverage for all available
strains. [0231] e. Rank the degenerate primer/probe sets according
to multiple parameters (e.g., % coverage, degeneracy fold,
#degenerate bases, native coverage, false positive rate, etc).
[0232] f. Additional quality/robustness check on the highly ranked
primer/probe sets for presence of possible hairpins using mFold and
other secondary structures. [0233] g. Introduce locked nucleic acid
(LNA) and add poly-T linkers to the primers and probes.
[0234] Results:
[0235] For each of the seven different influenza A gene targets, a
set of amplification primers+capture and detection probes
(oligonucleotides) were designed using the approach outlined above.
Presented below are exemplary primer/probe sets for each of the
designated genes. Sequences incorporating degenerate bases are
shown using standard ambiguity codes. IN the capture and detection
probe sequences, a "+" proceeds any locked nucleic acid bases
(LNA).
[0236] 1. MP Gene Target:
[0237] Degenerate Primer Pair:
TABLE-US-00007 [SEQ ID NO: 29] 5'-RCMGATCTYGAGGCTCTCATGGARTGG-3'
[SEQ ID NO: 30] 5'-GAGCGTGAAYACAAAYCCYAARATC-3'
[0238] LNA Capture Probe Oligonucleotide:
TABLE-US-00008 [SEQ ID NO: 31] 5'-TT + CA + CG + CT +
CACTTTTTTTTTTTT-3'
[0239] LNA Detection Probe Oligonucleotide:
TABLE-US-00009 [SEQ ID NO: 32] 5'-TTTTTTTTTTTTCG + AG + GACTG +
CAGC-3'
[0240] 2. HA Gene Target:
[0241] Degenerate Primer Pair:
TABLE-US-00010 [SEQ ID NO: 33] 5'-GCRAAAGCAGGGGTHYRATC-3' [SEQ ID
NO: 34] 5'-CAGAGYTTYCCRTTRTGTG-3'
[0242] LNA Capture Probe Oligonucleotide:
TABLE-US-00011 [SEQ ID NO: 35] 5'-GA + CAG + AG + CA +
GGTTTTTTTTTTTTT-3'
[0243] LNA Detection Probe Oligonucleotide:
TABLE-US-00012 [SEQ ID NO: 36] 5'-TTTTTTTTTTTTC + CC + AAGA + CA +
TA + CT-3'
[0244] 3. NA Gene Target:
[0245] Degenerate Primer Pair:
TABLE-US-00013 [SEQ ID NO: 37] 5'-GGTGTYTGGATHGGRAGRAC-3' [SEQ ID
NO: 38] 5'-ACTCCCRCTRTATCCTGACCA-3'
[0246] LNA Capture Probe Oligonucleotide:
TABLE-US-00014 [SEQ ID NO: 39] 5'-T + GAAAT + GATT + TG +
GGATTTTTTTTTTTT-3'
[0247] LNA Detection Probe Oligonucleotide:
TABLE-US-00015 [SEQ ID NO: 40] 5'-TTTTTTTTTTTTTG + GAA + CG + GA +
CAG-3'
[0248] 4. NP Gene Target:
[0249] Degenerate Primer Pair:
TABLE-US-00016 [SEQ ID NO: 41] 5'-GGATCAAYGAYCGRAAYTTCTGGAGRG-3'
[SEQ ID NO: 42] 5'-YTYTGTGCWGCTGTTTGRAATTTYCCT-3'
[0250] LNA Capture Probe Oligonucleotide:
TABLE-US-00017 [SEQ ID NO: 43] 5'-A + GA + ATGTG + CAA +
CATTTTTTTTTTTT-3'
[0251] LNA Detection Probe Oligonucleotide:
TABLE-US-00018 [SEQ ID NO: 44] 5'-TTTTTTTTTTTTGG + CG + GA + AAA +
CA-3'
[0252] 5. NS Gene Target:
[0253] Degenerate Primer Pair:
TABLE-US-00019 [SEQ ID NO: 45] 5'-GATGTCAAAAATGCRRTTGGVRTCCT-3'
[SEQ ID NO: 46] 5'-YCTCATYACYGCYTCYCCAAGCGAATC-3'
[0254] LNA Capture Probe Oligonucleotide:
TABLE-US-00020 [SEQ ID NO: 47] 5'-G + GAG + GA + CT +
TGAATTTTTTTTTTTT-3'
[0255] LNA Detection Probe Oligonucleotide:
TABLE-US-00021 [SEQ ID NO: 48] 5'-TTTTTTTTTTTTA + CAGTTCG +
AGTCTCT-3'
[0256] 6. PB1 Gene Target:
[0257] Degenerate Primer Pair:
TABLE-US-00022 [SEQ ID NO: 49] 5'-ATGGAYACNGTCAACAGRACACAYCA-3'
[SEQ ID NO: 50] 5'-GGYARTGGYCCATCAATYGGGTTRAGT-3'
[0258] LNA Capture Probe Oligonucleotide:
TABLE-US-00023 [SEQ ID NO: 51] 5'-AA + AG + GGGAAG +
TGTTTTTTTTTTTT-3'
[0259] LNA Detection Probe Oligonucleotide:
TABLE-US-00024 [SEQ ID NO: 52] 5'-TTTTTTTTTTTTCAG + AAA + CTG +
GGG-3'
[0260] 7. PB2 Gene Target:
[0261] Degenerate Primer Pair:
TABLE-US-00025 [SEQ ID NO: 53] 5'-TAYGGRCCAGCAYTRAGYATCAATGAA-3'
[SEQ ID NO: 54] 5'-TCYCGTTTYCGTTTCATYACCARYAC-3'
[0262] LNA Capture Probe Oligonucleotide:
TABLE-US-00026 [SEQ ID NO: 55] 5'-AG + CT + AA + TG +
TGCTTTTTTTTTTTTT-3
[0263] LNA Detection Probe Oligonucleotide:
TABLE-US-00027 [SEQ ID NO: 56] 5'-TTTTTTTTTTTTAG + TAAC + CTTG +
CA-3'
[0264] All publications, patents, and patent applications cited in
this specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference, with
exception that U.S. Provisional Application 60/839,537, filed Aug.
22, 2006, is not specifically incorporated by reference herein.
[0265] The present invention is not to be limited in scope by the
embodiments disclosed herein, which are intended as single
illustrations of individual aspects of the invention, and any which
are functionally equivalent are within the scope of the invention.
Various modifications to the models and methods of the invention,
in addition to those described herein, will become apparent to
those skilled in the art from the foregoing description and
teachings, and are similarly intended to fall within the scope of
the invention. Such modifications or other embodiments can be
practiced without departing from the true scope and spirit of the
invention.
Sequence CWU 1
1
56124DNAArtificialSynthetic primer 1cagaagtgca tgcgtcgttc tttg
24227DNAArtificialSynthetic primer 2agtgaatgat caattgcgac cgtactt
27331DNAArtificialSynthetic primer 3tacatggtct tcccagataa
tgcatcgctt g 31426DNAArtificialSynthetic primer 4ccggatgagc
attcaacata ccacgg 26532DNAArtificialSynthetic oligonucleotide
5tttttttttt ttatattggt gggagtgtat ct 32635DNAArtificialSynthetic
oligonucleotide 6tttttttttt ttctttagcg gtagcagagg ctctt
35734DNAArtificialSynthetic oligonucleotide 7gcaggattta gtaatcgaat
tttttttttt tttt 34835DNAArtificialSynthetic oligonucleotide
8gggattgatg aggaaacagc attttttttt ttttt 35935DNAArtificialSynthetic
oligonucleotide 9tacatggtct tcccagataa tttttttttt ttttt
351038DNAArtificialSynthetic oligonucleotide 10tgctagagaa
ttaaatacat atattttttt tttttttt 381127DNAArtificialSynthetic
oligonucleotide 11gtgccttgag actttttttt ttttttt
271240DNAArtificialSynthetic oligonucleotide 12ttcgaattac
taaatcctgc agatacactc ccaccaatat 401347DNAArtificialSynthetic
oligonucleotide 13gaatgctgtt tcctcatcaa tcccaagagc ctctgctacc
gctaaag 471440DNAArtificialSynthetic oligonucleotide 14ttcgaattac
taaatcctgc agatacactc ccaccaatat 401547DNAArtificialSynthetic
oligonucleotide 15gaatgctgtt tcctcatcaa tcccaagagc ctctgctacc
gctaaag 471627DNAArtificialSynthetic primer 16tcctgtcacc tctgactaag
gggattt 271726DNAArtificialSynthetic primer 17ragggcattt tggacaaagc
gtctac 261836DNAArtificialSynthetic Primer 18tttttttttt ragggcattt
tggacaaagc gtctac 361938DNAArtificialSynthetic primer 19tttttttttt
cctgtcacct ctgactaagg ggattttr 382026DNAArtificialSynthetic primer
20ragggcattt tggacaaagc gtctac 262129DNAArtificialSynthetic primer
21tcctgtcacc tctgactaag gggattttr 292224DNAArtificialSynthetic
oligonucleotide 22agatgagtct tctaaccgag gtcg
242324DNAArtificialSynthetic primer 23tgcaaaaaca tcttcaagtc tctg
242432DNAArtificialSynthetic oligonucleotide 24tttttttttt
tttctatcgt cccgtcaggc cc 322524DNAArtificialSynthetic
oligonucleotide 25gccgagatcg cgtttttttt tttt
242635DNAArtificialSynthetic oligonucleotide 26tacatggtct
tcccagataa tttttttttt ttttt 352738DNAArtificialSynthetic
oligonucleotide 27tgctagagaa ttaaatacat atattttttt tttttttt
382852DNAArtificialSynthetic oligonucleotide 28cgcgatctcg
gctttgaggg ggcctgacgg aacgatagag agaacatacg tt
522927DNAArtificialSynthetic primer 29rcmgatctyg aggctctcat ggartgg
273025DNAArtificialSynthetic primer 30gagcgtgaay acaaayccya aratc
253123DNAArtificialSynthetic oligonucleotide 31ttcacgctca
cttttttttt ttt 233225DNAArtificialSynthetic oligonucleotide
32tttttttttt ttcgaggact gcagc 253320DNAArtificialSynthetic primer
33gcraaagcag gggthyratc 203419DNAArtificialSynthetic primer
34cagagyttyc crttrtgtg 193524DNAArtificialSynthetic oligonucleotide
35gacagagcag gttttttttt tttt 243625DNAArtificialSynthetic
oligonucleotide 36tttttttttt ttcccaagac atact
253720DNAArtificialSynthetic primer 37ggtgtytgga thggragrac
203821DNAArtificialSynthetic primer 38actcccrctr tatcctgacc a
213927DNAArtificialSynthetic oligonucleotide 39tgaaatgatt
tgggattttt ttttttt 274024DNAArtificialSynthetic oligonucleotide
40tttttttttt tttggaacgg acag 244127DNAArtificialSynthetic primer
41ggatcaayga ycgraayttc tggagrg 274227DNAArtificialSynthetic primer
42ytytgtgcwg ctgtttgraa tttycct 274325DNAArtificialSynthetic
oligonucleotide 43agaatgtgca acattttttt ttttt
254423DNAArtificialSynthetic oligonucleotide 44tttttttttt
ttggcggaaa aca 234526DNAArtificialSynthetic primer 45gatgtcaaaa
atgcrrttgg vrtcct 264627DNAArtificialSynthetic primer 46yctcatyacy
gcytcyccaa gcgaatc 274724DNAArtificialSynthetic oligonucleotide
47ggaggacttg aatttttttt tttt 244827DNAArtificialSynthetic
oligonucleotide 48tttttttttt ttacagttcg agtctct
274926DNAArtificialSynthetic primermisc_feature(9)..(9)n is a, c,
g, or t 49atggayacng tcaacagrac acayca 265027DNAArtificialSynthetic
primer 50ggyartggyc catcaatygg gttragt 275124DNAArtificialSynthetic
oligonucleotide 51aaaggggaag tgtttttttt tttt
245224DNAArtificialSynthetic oligonucleotide 52tttttttttt
ttcagaaact gggg 245327DNAArtificialSynthetic primer 53tayggrccag
caytragyat caatgaa 275426DNAArtificialSynthetic primer 54tcycgtttyc
gtttcatyac caryac 265524DNAArtificialSynthetic oligonucleotide
55agctaatgtg cttttttttt tttt 245624DNAArtificialSynthetic
oligonucleotide 56tttttttttt ttagtaacct tgca 24
* * * * *
References