U.S. patent application number 15/519112 was filed with the patent office on 2017-08-17 for linker element and method of using same to construct sequencing library.
The applicant listed for this patent is BGI Shenzhen Co., Limited. Invention is credited to Andrei ALEXEEV, Radoje DRMANAC, Shujin FU, Chunyu GENG, Lingyu HE, Hui JIANG, Yuan JIANG, Yaqiao LI, Xiaoshan SU, Fanzi WU, Wenwei ZHANG, Xia ZHAO.
Application Number | 20170233728 15/519112 |
Document ID | / |
Family ID | 55745952 |
Filed Date | 2017-08-17 |
United States Patent
Application |
20170233728 |
Kind Code |
A1 |
JIANG; Yuan ; et
al. |
August 17, 2017 |
LINKER ELEMENT AND METHOD OF USING SAME TO CONSTRUCT SEQUENCING
LIBRARY
Abstract
Provided is a linker element and a method of using the linker
element to construct a sequencing library, wherein the linker
element consists of a linker A and a linker B, the linker A is
obtained through the complementary pairing of a long nucleic acid
strand and a short nucleic acid strand, the 5' end of the long
strand has a phosphoric acid modification, and the 3' end of the
short strand has an enclosed modification, with enzyme sites in the
short strand; and the linker B is a nucleic acid single strand, and
the 3' end thereof can be in a complementary pairing with the 5'
end of the long strand of the linker A. Using the linker element of
the present invention for constructing a sequencing library ensures
the linking directionality of the linkers while solving the
problems of fragment interlinking, linker self-linking and low
linking efficiency, and reducing the purification reaction between
steps, shortening the linking time and reducing costs.
Inventors: |
JIANG; Yuan; (Shenzhen,
CN) ; GENG; Chunyu; (Shenzhen, CN) ; ZHAO;
Xia; (Shenzhen, CN) ; FU; Shujin; (Shenzhen,
CN) ; HE; Lingyu; (Shenzhen, CN) ; LI;
Yaqiao; (Shenzhen, CN) ; SU; Xiaoshan;
(Shenzhen, CN) ; WU; Fanzi; (Shenzhen, CN)
; ZHANG; Wenwei; (Shenzhen, CN) ; JIANG; Hui;
(Shenzhen, CN) ; ALEXEEV; Andrei; (Woodland,
CA) ; DRMANAC; Radoje; (Mountain View, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BGI Shenzhen Co., Limited |
Shenzhen |
|
CN |
|
|
Family ID: |
55745952 |
Appl. No.: |
15/519112 |
Filed: |
October 14, 2014 |
PCT Filed: |
October 14, 2014 |
PCT NO: |
PCT/CN2014/088592 |
371 Date: |
April 13, 2017 |
Current U.S.
Class: |
506/26 |
Current CPC
Class: |
C12N 9/16 20130101; C12Q
1/68 20130101; C12Q 1/6855 20130101; C40B 50/06 20130101; C12N
15/1093 20130101; C12Q 1/6806 20130101; C12N 9/1205 20130101; C12Y
301/03001 20130101; C12N 9/1252 20130101; C12Q 1/6806 20130101;
C12N 15/11 20130101; C12Q 2563/131 20130101; C12Q 2525/186
20130101; C12Q 2521/531 20130101; C12Q 2525/186 20130101; C12Q
2525/155 20130101; C12Q 2537/162 20130101; C12Q 2525/307 20130101;
C12Q 2537/162 20130101; C40B 40/06 20130101; C12Y 207/07007
20130101; C12Q 2525/191 20130101; C12Q 1/6855 20130101; C12Y
207/01078 20130101; C12Q 2535/122 20130101; C12Q 2563/131 20130101;
C12Q 2525/155 20130101; C12Q 2535/122 20130101; C12Q 2525/191
20130101; C12Q 2525/191 20130101; C12Q 2521/531 20130101; C12Q
2525/307 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C12N 9/12 20060101 C12N009/12; C12N 9/16 20060101
C12N009/16 |
Claims
1. A linker element consisting of a linker A and a linker B,
wherein the linker A is generated from the complementary pairing of
a long strand of nucleic acid and a short strand of nucleic acid,
wherein the long strand has a phosphate modification at the 5'end
and the short strand has a blocking modification at the 3' end, and
has an enzyme active site in the short strand; and the linker B is
a single-stranded nucleic acid, and the 3' end thereof can be
complementary to the 5'end of the long strand of the linker A but
the rest part cannot be complementary to the linker A.
2. The linker element according to claim 1, wherein the long strand
of linker A has a length of 40-48 bp and the short strand of linker
A has a length of 9-14 bp.
3-6. (canceled)
7. A method for constructing a sequencing library, which uses the
linker element according to claim 1.
8. The method for constructing a sequencing library according to
claim 7, comprising the steps of: 1) fragmenting a DNA to be
tested; 2) dephosphorylating and blunt-end repairing the DNA
fragments obtained in step 1); 3) linker ligations: linker A
ligation: the linker A is added to both ends of the DNA fragments
obtained in Step 2) by a ligation reaction; enzyme treatment and
phosphorylation: depending on the enzyme active site in the short
strand of the A linker, the DNA fragments ligated with the linker A
are treated with the corresponding enzyme, and the unlinked 5'ends
of the fragments are phosphorylated; linker B ligation: through a
ligation reaction, the linker B is added to both ends of the DNA
fragments ligated with the linker A; 4) amplification of DNA
fragments: polymerase chain reaction is carried out using the DNA
fragments obtained in step 3) as a template and using
single-stranded nucleic acids C and D, which are complementary to
the long strand of the linker A and the nucleic acid strand of the
linker B, as primers; 5) hybridization capture: the product
obtained in step 4) is captured by hybridizing with an
oligonucleotide probe and in the enrichment step of the
hybridization product, a separation marker is introduced at the
5'end of one strand of the double-stranded nucleic acid and a
phosphate group modification is introduced at the 5' end of the
other strand; 6) separation and cyclization of single-stranded
nucleic acids: the product obtained in step 5) is separated by
utilizing the separation marker to obtain another nucleic acid
single strand without the separation marker; and a single strand
circular nucleic acid product is obtained by cyclizing the obtained
nucleic acid single strand, that is the sequencing library.
9. (canceled)
10. The method for constructing a sequencing library according to
claim 8, wherein in step 2), the dephosphorylation is carried out
by using shrimp alkaline phosphatase.
11. The method for constructing a sequencing library according to
claim 8, wherein in step 5), the oligonucleotide probe is a library
of oligonucleotide probes.
12-15. (canceled)
16. A sequencing library construction kit comprising the linker
element according to claim 1.
17. The kit according to claim 16, further comprising a
dephosphorylase; a DNA polymerase; a User enzyme; and a
phosphorylase.
18. The kit according to claim 17, wherein the dephosphorylase is
an alkaline phosphatase.
19. The kit according to claim 17, wherein the dephosphorylase is a
shrimp alkaline phosphatase.
20. The kit according to claim 17, wherein the DNA polymerase is a
T4 DNA polymerase.
21. The kit according to claim 17, wherein the phosphorylase is a
polynucleotide kinase.
22. The linker element according to claim 1, wherein in the linker
B, the length complementary to the long strand of the linker A is
6-12 bp, and the length not complementary to the long strand of the
linker A is 9-15 bp.
23. The linker element according to claim 1, wherein the blocking
modification is a dideoxy blocking modification.
24. The linker element according to claim 1, wherein the linker B
has a tag sequence.
25. The method for constructing a sequencing library according to
claim 8, wherein in step 2), the blunt-end repair is performed by
using T4 DNA polymerase.
26. The method for constructing a sequencing library according to
claim 8, wherein in step 5), the separation marker is a biotin
modification.
Description
TECHNICAL FIELD
[0001] The present invention relates to the field of biotechnology
and, in particular, to a linker element, a method of constructing a
sequencing library using the linker element, the constructed
sequencing library and application thereof.
BACKGROUND ART
[0002] High-throughput sequencing has become one of the foundations
for modern molecular biology, biotechnology, medicine and other
fields. In recent years, studies on rapid, accurate and economic
methods for determining gene expression level and nucleotide
sequence have achieved continuous innovation; the second generation
of high-throughput sequencing technology with sequencing by
synthesis as the basic principle has become mature. The major
sequencing companies have focused on the development of new
sequencing products, shortening the process of sequencing and cost
reduction. The currently existing sequencing products based on the
second-generation sequencing technology include whole genome
resequencing, whole transcriptome sequencing, and small-molecule
RNA sequencing and the like. In particular, the application derived
from the second-generation sequencing combined with microarray
technology--target sequence capture sequencing technology can use a
large number of oligonucleotide probes to complementarily bind to
specific regions in the genome to capture and enrich gene fragments
from the specific regions for sequencing; and for the detection,
diagnosis and research of disease genes.
[0003] Complete Genomics (CG) Corporation currently has an
independently developed second-generation sequencing technology
suitable for human whole genome sequencing. The process for its
library construction includes: genomic DNA disruption, the first
linker ligation, double-strand cyclization and digestion, the
second linker ligation, single-strand separation and cyclization,
wherein the two linker ligations are very important in the process
for library construction. The linker is a specially designed DNA
sequence and when fixed to both ends of the DNA fragment by
ligation or the like, can be identified during sequencing and used
as a starting site for sequencing to enable the instrument to read
the subsequent sequence information. In order to ensure that the
read sequence information is easy to analyze, it is necessary to
add two different linkers at both ends (5' and 3' ends) of a DNA
fragment; in order to achieve this particular directional ligation,
while avoiding the interconnection between the linkers, sticky end
can be used to link the linkers; however, this requires fragments
with sticky ends, which make it difficult to avoid the
interconnection between fragments. The Complete Genomics
Corporation uses multiple steps to add linkers to both ends
respectively for construction of a sequencing library. In order to
obtain a fragment with linkers at both ends, it is necessary to go
through the following five steps: ligating a linker to one end of a
DNA fragment; performing denaturation, annealing and extension;
then ligating a linker to the other end of the DNA fragment;
filling the vacancy; and performing a polymerase chain reaction.
However, the multiple extension reactions therein require expensive
reagents and multiple purification steps are required between the
steps, thus resulting in high overall costs and lack of
efficiency.
[0004] In order to solve the problems that too many steps are
required for linker ligation in the construction of the sequencing
platform library of Complete Genomics, the time for constructing
the whole library is too long and the cost is too high, the present
invention is proposed.
SUMMARY
[0005] In view of the above disadvantages of the prior art, it is
an object of the present invention to provide a linker element, a
method of constructing a sequencing library using the linker
element, the constructed sequencing library and application
thereof. The method for constructing the sequencing library of the
present invention avoids the conventional linker ligation method
that adds linkers to both ends respectively in multi-steps. By
means of a linker with a unique sequence configuration, and a novel
linker ligation method consisting of linker ligation plus single
strand replacement, the method for constructing the sequencing
library of the present invention ensures the directionality of the
linker ligation while solving the problems of fragment
interconnection, linker self-connection and low ligation
efficiency, and successfully reduces the whole linker ligation
process to four new steps and reduces the purification reactions
between steps, which greatly reduce the time required for ligating
the linkers, and significantly reduce costs. In addition, the
method of constructing a sequencing library also introduces the
nucleic acid probe capture technology to realize the sequencing of
the target genomic region, and succeeds in creating a target region
capture sequencing product based on a single strand circular
sequencing platform.
[0006] In a first aspect, the present invention provides a linker
element consisting of a linker A and a linker B, wherein the linker
A is generated from the complementary pairing of a long strand of
nucleic acid and a short strand of nucleic acid, wherein the long
strand has a phosphate modification at the 5'end and the short
strand has a blocking modification at the 3' end, and has an enzyme
active site in the short strand; and the linker B is a
single-stranded nucleic acid, and the 3' end thereof can be
complementary to the 5'end of the long strand of the linker A but
the rest part cannot be complementary to the linker A.
[0007] Preferably, in the linker A, the long strand has a length of
40-48 bp and the short strand has a length of 9-14 bp.
[0008] Preferably, in the linker B, the length complementary to the
long strand of the linker A is 6-12 bp, and the length not
complementary to the long strand of the linker A is 9-15 bp.
[0009] Preferably, the blocking modification is a dideoxy blocking
modification.
[0010] Preferably, the enzyme active site in the short strand is U
or dU, and the corresponding enzyme is User enzyme.
[0011] Preferably, the linker B has a tag sequence; due to the
presence of the tag sequence, in the subsequent steps, different
samples with different tags can be mixed and placed in the same
reaction system for reaction, further saving operating steps and
cost.
[0012] In one preferred embodiment, the sequence of the long strand
of the linker A is: /Phos/GTCTCCAGTCTCAACTGCCTGAAGCCCGATCGAGCTTGTCT
(i.e., SEQ ID NO: 1), the sequence of the short strand of the
linker A is GACUGGAGAC/ddC/(i.e., SEQ NO: 2), the sequence of the
linker B is TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 3), wherein the
group inside "II" represents terminal modified group, "Phos"
represents phosphorylation and "dd" represents dideoxy.
[0013] In a second aspect, the present invention provides a linker
ligation method, comprising ligating a linker element as described
in the first aspect to both ends of a DNA fragment to be
tested.
[0014] Preferably, the linker ligation method comprises the
following steps:
[0015] (1) the linker A is added to both ends of the DNA fragment
to be tested by a ligation reaction;
[0016] (2) the DNA fragment ligated with the linker A is treated
with a corresponding enzyme according to the enzyme active site in
the short strand;
[0017] (3) the linker B is added to both ends of the DNA fragment
ligated with the linker A and treated in the step (2) by a ligation
reaction.
[0018] Preferably, the steps of dephosphorylating and blunt-end
repairing the DNA fragment to be tested are further comprised
before ligating the linker element; in the step (2), it is further
preferred that the step of phosphorylating the unlinked 5'end of
the DNA fragment is further included, and it is further preferred
that the phosphorylation treatment is carried out using a
polynucleotide kinase.
[0019] In a third aspect, the present invention provides a method
for constructing a sequencing library, which uses the linker
element as described in the first aspect or the linker ligation
method as described in the second aspect to perform linker
ligation.
[0020] In a preferred embodiment, the method for constructing a
sequencing library comprises the steps of:
[0021] 1) fragmenting the DNA to be tested;
[0022] 2) dephosphorylating and blunt-end repairing the DNA
fragments obtained in step 1);
[0023] 3) linker ligations:
[0024] linker A ligation: the linker A is added to both ends of the
DNA fragments obtained in Step 2) by a ligation reaction;
[0025] enzyme treatment and phosphorylation: depending on the
enzyme active site in the short strand of the A linker, the DNA
fragments ligated with the linker A are treated with the
corresponding enzyme, and the unlinked 5'ends of the fragments are
phosphorylated; linker B ligation: through a ligation reaction, the
linker B is added to both ends of the DNA fragments ligated with
the linker A;
[0026] 4) amplification of DNA fragments: polymerase chain reaction
is carried out by using the DNA fragments obtained in step 3) as a
template and using single-stranded nucleic acids C and D, which are
complementary to the long strand of the linker A and the nucleic
acid strand of the linker B, as primers;
[0027] 5) hybridization capture: the product obtained in step 4) is
captured by hybridizing with an oligonucleotide probe and in the
enrichment step of the hybridization product, a separation marker
is introduced at the 5'end of one strand of the double-stranded
nucleic acid and a phosphate group modification is introduced at
the 5' end of the other strand;
[0028] 6) separation and cyclization of single-stranded nucleic
acids: the product obtained in step 8) is separated by utilizing
the separation marker to obtain another nucleic acid single strand
without the separation marker; and a single strand circular nucleic
acid product is obtained by cyclizing the obtained nucleic acid
single strand, that is the sequencing library.
[0029] Regarding the above method for constructing a sequencing
library:
[0030] In step 1), preferably, the DNA to be tested is genomic
DNA.
[0031] Preferably, the fragmentation is a random disruption of the
DNA to be tested using a physical or chemical method.
[0032] Preferably, the fragmentation of the DNA to be tested is
performed by using physical ultrasound or enzymatic reaction.
[0033] Preferably, the length of the DNA fragment is 150-250
bp.
[0034] In step 2), preferably, the dephosphorylation is carried out
by using alkaline phosphatase, preferably shrimp alkaline
phosphatase.
[0035] Preferably, the blunt-end repair is performed by using T4
DNA polymerase.
[0036] In a preferred embodiment, the sequence of the long strand
of the linker A in step 3) is
/Phos/GTCTCCAGTCTCAACTGCCTGAAGCCCGATCGAGCTTGTCT (i.e., SEQ ID NO:
1), the sequence of the short strand of the linker A is
GACUGGAGAC/ddC/ (i.e., SEQ ID NO: 2), and the sequence of the
linker B is TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 3), wherein the
group in "//" is a terminal modified group, "Phos" represents
phosphorylation, and "dd" represents dideoxy. In a further
preferred embodiment, in step (4), the sequence of the
single-stranded nucleic acid C is /Phos/AGACAAGCTCGATCGGGCTTC
(i.e., SEQ ID NO: 4), the sequence of the single-stranded nucleic
acid D is TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 5), wherein the
group in "//" is a terminal modified group, "Phos" represents
phosphorylation.
[0037] In step 5), preferably, the oligonucleotide probe is a
library of oligonucleotide probes; the hybridization capture step
using an oligonucleotide probe allows the sequencing library of the
present invention to achieve full exome sequencing. Further, by
changing the oligonucleotide probe used, other different sequencing
requirements can be met.
[0038] Preferably, the separation marker is a biotin
modification.
[0039] In step 6), preferably, the step of removing the remaining
uncyclized single strands by treatment with an exonuclease or the
like is also included after cyclization of the single-stranded
nucleic acid.
[0040] The single-stranded circular nucleic acid product obtained
by the above-mentioned construction method can be used directly in
the subsequent sequencing step in which the single-stranded
circular nucleic acids are subjected to rolling replication to form
nucleic acid nanospheres (DNB) for reading nucleic acid sequence
information.
[0041] In a fourth aspect, the present invention provides a
sequencing library, which is prepared by the construction method as
described in the third aspect.
[0042] In a fifth aspect, the present invention provides the use of
the sequencing library as described in the fourth aspect for
genomic sequencing, preferably for sequencing of a target genomic
region; preferably, the sequencing is performed by using a
single-stranded circular library sequencing platform; more
preferably, the sequencing is performed by using sequencing
platform of Complete Genomics.
[0043] In a sixth aspect, the present invention provides a nucleic
acid sequencing method comprising the step of sequencing the
sequencing library as described in the fourth aspect; preferably,
the sequencing is performed by using a single-stranded circular
library sequencing platform; further preferably, the sequencing is
performed by using sequencing platform of Complete Genomics;
preferably, the method further comprises the step of assembling
and/or splicing the sequencing results.
[0044] In a seventh aspect, the present invention provides a
sequencing library construction kit comprising a linker element as
described in the first aspect.
[0045] Preferably, the kit further comprises a dephosphorylase,
preferably an alkaline phosphatase, more preferably a shrimp
alkaline phosphatase; a DNA polymerase, preferably a T4 DNA
polymerase; a User enzyme; and a phosphorylase, preferably a
polynucleotide kinase.
Beneficial Effect
[0046] After the treatment in step 2), wherein the target nucleic
acid fragment undergoes the terminal-blocking treatment of
dephosphorylation, the fragmented DNA to be tested becomes a
blunt-end fragment with both ends blocked, so that the interaction
between the fragments is completely prevented, and thus the
utilization of DNA fragments prior to ligation is extremely highly
guaranteed.
[0047] The present invention introduces a phosphate group at the 5'
end of the long strand of the linker A and a blocking modification
at the 3' end of the short strand of the linker A. The blocked end
cannot be ligated with the target nucleic acid fragment due to the
presence of the blocking modification. Due to the special
construction of the long and short strands themselves, there is no
interconnection between the linkers, thus ensuring that the 5' end
of the long strand of the linker can be accurately attached to the
3' end of the target fragment. This design is very effective in
preventing the occurrence of linker interconnection, ensuring the
efficiency of the ligation reaction.
[0048] In the target fragment phosphorylation step as designed to
perform following the ligation of linker A, one end of the target
fragment which is not linked to linker is phosphorylated. The short
strand of the linker A is shortened and falls off during the
enzymatic treatment after the ligation of the linker A, so that the
linker B can be partially paired to the long strand of the linker
A. The above all make it possible to orientate the linker B, and
ensure the directionality of the linker ligation. In the
conventional linker ligation step of Complete Genomics, after the
ligation of linker A, denaturation, annealing and extension are
performed to avoid ligating the same linker to both ends (as shown
in FIG. 2, No. 1). Although this method also guarantees the
directionality of the linker ligation, it needs to use
high-fidelity hot-start enzyme, which incurs high cost, and long
reaction time. However, the treatment enzymes (such as the User
enzyme) used in the ligation method of the present invention are
relatively inexpensive and require mild enzymatic reaction
conditions, and the requirement to the reaction system is low, and
the purification treatment step can be omitted before the enzyme
treatment. Overall, the present invention reduces costs and
processing time.
[0049] In the ligation of B linker, the characteristics of the
short and long strands of linker A are also cleverly utilized.
Since after the enzyme treatment, there are less and unstably
bonded complementary pairing bases between the short stand and the
long strand, the short strand will be separated from the long
strand at relatively milder temperatures. The single strand of the
linker B having a longer complementary base pairing sequence and a
more dominant binding ability is simply complementary to the long
strand of the linker A so that make it precisely linked to the
vacant end of the target fragment. The other parts of the linker B
that is not complementary ensure the differences between linker A
and B. By subsequent polymerase chain reaction, the target fragment
with different terminal sequences (i.e., the long strand of the
linker A at one end, and the linker B at the other end) is
ultimately formed. This unique design, in combination with
polymerase chain reaction, solves the problems of cost-effective
introduction of different linkers at both ends of the fragment in
the blunt-end ligation. It also avoids the occurrence of
fragment/linker interactions resulting from the ligation at
cohesive end of the fragment produced by a step of introducing
adenylate at terminal.
[0050] Compared with the traditional ligation method with linker B
(shown in FIG. 2, No. 2) of Complete Genomics, this unique
partially base-paired single strand linker design allows the linker
ligation and vacancy fill-up to be replaced by a single step,
greatly reducing the process and saving cost.
[0051] Based on the traditional sequencing library construction
scheme of Complete Genomics, the present invention proposes a
sequencing library construction scheme based on novel linker
structure and linker ligation method, and introduces a probe
hybridization capture step, so as to develop a novel target region
capture library sequencing product based on the single-stranded
circular library sequencing platform, realizing small region
capture library sequencing based on the single-stranded circular
library sequencing platform from scratch.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] FIG. 1 illustrates a sequencing library construction scheme
of the present invention; 1 represents a disrupted DNA fragment, 2
represents a dephosphorylated, terminal-repaired fragment (each
terminal is a hydroxyl group), 3 represents the long and short
strands of the linker A, 4 represents the single strand of the
linker B, and 5 represents a library construction final product of
nucleic acid single strand loop.
[0053] FIG. 2 illustrates the conventional linker ligation method
of Complete Genomics; 1 represents the treatment step between the
ligations of linker A' and B'; 2 represents three steps related to
linker B' ligation.
DETAILED DESCRIPTION
[0054] In order to facilitate understanding of the present
invention, the present invention is exemplified as follows. It
should be apparent to those skilled in the art that the described
examples are merely to assist in understanding the present
invention and should not be construed as limiting the invention
thereto in any way.
Example 1 Construction of a Sequencing Library of the Present
Invention
[0055] 1. Disruption of genomic DNA: There are many ways for
genomic DNA disruption, such as physical ultrasound or enzymatic
reaction, either of which has very mature schemes on the market.
The present example employs a physical ultrasonic disruption
method.
[0056] A Teflon line and 1 .mu.g of genomic DNA were added into a
96-well PCR plate in turn, and then TE buffer solution or
enzyme-free water was added to make up 80 .mu.l. The plate was
sealed and placed on an E220 ultrasonic disruption instrument. The
conditions for disruption were set as follows:
TABLE-US-00001 Filling coefficient 20% Severe degree 5 Pulse
coefficient 200 Disruption time 60 s, 5 times
[0057] 2. Recovery of disrupted fragments: magnetic beads
purification method or gel recovery method can be used. Magnetic
bead purification method was used in this example.
[0058] 80 .mu.l of Ampure XP magnetic beads were added into the
disrupted DNA, and then mixed well and placed for 7-15 min; then
the mixture was put into a magnetic frame, and the supernatant was
collected and added 40 .mu.l of Ampure XP beads, and then mixed
well and placed for 7-15 min; then the mixture was put into the
magnetic frame, then the supernatant was removed, and the magnetic
beads were washed twice with 75% ethanol; after drying, the beads
was added 50 .mu.l of TE buffer solution or enzyme-free water, and
then mixed well and placed for 7-15 min to dissolve the recovered
product.
[0059] 3. Dephosphorylation reaction: a system was prepared
according the following table using the recovered products of the
previous step:
TABLE-US-00002 10x NEB Buffer 2 2.4 .mu.l Shrimp alkaline 2.4 .mu.l
phosphatase (1 U/ul) Total 4.8 .mu.l
[0060] 4.8 .mu.l of reaction system was added to the recovered
product of the previous step, mixed, and a reaction was carried out
under the conditions listed in the following table. The reaction
product was used directly for the next step.
TABLE-US-00003 37.degree. C. 45 min 65.degree. C. 10 min
[0061] 4. End repairing of fragments: a system was prepared
according to the following table:
TABLE-US-00004 Enzyme-free water 4.9 .mu.l 10x NEB Buffer 2 0.72
.mu.l 0.1M adenosine 0.32 .mu.l triphosphate 25 mM 0.32 .mu.l
deoxyribonucleoside triphosphate Bovine serum albumin 0.16 .mu.l T4
deoxyribonucleic acid 0.8 .mu.l polymerase (3 U/ul) Total 7.2
.mu.l
[0062] After mixing, the system was added to the product of the
previous step, mixed well and incubated at 12.degree. C. for 20 min
Purification was performed with 90 .mu.l of Ampure XP magnetic
beads and 18 .mu.l of TE buffer solution was used to dissolve the
recovered product. (There are many ways to purify the reaction
product, such as magnetic bead method, column purification method,
gel recovery method, etc. All the methods can be used
interchangeably. The present example was purified by a magnetic
bead method unless otherwise specified.)
[0063] 5. Linker A ligation: The linker-related sequences used in
this scheme were as follows (in the sequence, from left to right is
the 5' end to the 3' end, the group inside "II" is
terminal-modified group, "phos" represents phosphorylation, "dd"
represents dideoxy, and "bio" represents biotin):
[0064] Long strand of the linker A:
TABLE-US-00005 /Phos/GTCTCCAGTCTCAACTGCCTGAAGCCCGATCGAGCTTGTCT
(i.e., SEQ ID NO: 1);
[0065] Short strand of the linker A:
TABLE-US-00006 GACUGGAGAC/ddC/ (i.e., SEQ ID NO: 2);
[0066] The ligation buffer 1 used in this scheme was formulated as
follows:
TABLE-US-00007 Tris (hydroxymethyl) 150 mM
aminomethane-hydrochloric acid (pH 7.8) Polyethylene glycol 8000
15% Magnesium chloride 30 mM Ribonucleoside triphosphate 3 mM
[0067] A system was prepared as follows:
TABLE-US-00008 Enzyme-free water 11 .mu.l Linker A (100 uM) 1 .mu.l
Ligation buffer 1 13 .mu.l T4 DNA ligase (fast) (600 U/[mu] 1 .mu.l
1) (enzymatics, L6030-HC-L) Total 21.5 .mu.l
[0068] The above system and the previous product were mixed and
reacted according to the following table:
TABLE-US-00009 25.degree. C. 20 min 65.degree. C. 10 min
[0069] 6. Phosphorylation and uracil removal: a system was prepared
according to the following table:
TABLE-US-00010 User enzyme (1000 U/ml) 0.5 .mu.l Polynucleotide
kinase 0.5 .mu.l (10 U/uL) Total 1 .mu.l
[0070] The above system was added to the product of step 5, mixed
well and placed at 37.degree. C. for 15 min.
[0071] Purification was performed by using 60 .mu.l of Ampure XP
magnetic beads, and 62.5 .mu.l of enzyme-free water or TE buffer
solution was used for recovery.
[0072] 7. Linker B ligation:
[0073] The sequence of linker B was as follows:
TABLE-US-00011 TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 3)
[0074] A system was prepared as follows:
TABLE-US-00012 Ligation buffer 1 33 .mu.l T4 DNA ligase (fast) (600
U/ 1 .mu.l [mu] 1) (enzymatics, L6030-HC-L) Linker B (100 uM) 1.67
.mu.l Total 37 .mu.l
[0075] The above system was added to the recovered product in step
6 and mixed well and reacted for 20 min at 20.degree. C.
[0076] Purification was performed by using 120 .mu.l of Ampure XP
magnetic beads, and 45 .mu.l of TE buffer solution was used to
dissolve the recovered product.
[0077] 8. Polymerase chain reaction:
[0078] The sequence of primer C was as follows:
TABLE-US-00013 /phos/AGACAAGCTCGATCGGGCTTC (i.e., SEQ ID NO: 4)
[0079] The sequence of primer D was as follows:
TABLE-US-00014 TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 5)
[0080] A system was prepared as follows:
TABLE-US-00015 enzyme-free water 45 .mu.l 10x PfuTurbo Cx buffer
100 .mu.l (Agilent, 01.Agilent.600414) PfuTurbo Cx hot-start
nucleic 2 .mu.l acid polymerase (2.5 U/ul) (Agilent,
01.Agilent.600414) 20 uM primer C 4.0 .mu.l 20 uM primer D 4.0
.mu.l Total volumn 155.0 .mu.l
[0081] The recovered product in the previous step was added to the
above system, mixed well, and then reacted according to the
conditions listed in the following table:
TABLE-US-00016 95.degree. C. 3 min 95.degree. C. 30 s 56.degree. C.
30 s 72.degree. C. 90 s Steps 2-4 were repeated for 7 times
68.degree. C. 7 min
[0082] After completion of the reaction, 240 .mu.l of Ampure XP
magnetic beads were used for purification, and 25 .mu.l of
enzyme-free water was used to dissolve the recovered product.
[0083] 9. Hybridization capture: 500 ng-1 .mu.g of reaction product
of the previous step was concentrated and evaporated, and then
added to the following system 1 to dissolve:
TABLE-US-00017 Blocking Sequence 1: GAAGCCCGATCGAGCTTGTCT (i.e.,
SEQ ID NO: 6) Blocking sequence 2: GTCTCCAGTC (i.e., SEQ ID NO: 7)
Blocking Sequence 3: GTCTCCAGTGCGGTCTTAGGA (i.e., SEQ ID NO: 8)
TABLE-US-00018 Enzyme-free water 3.4 .mu.l SureSelect Block # 1 2.5
.mu.l (Agilent) SureSelect Block # 2 2.5 .mu.l (Agilent) Blocking
sequence 1 0.3 .mu.l Blocking sequence 2 0.3 .mu.l Blocking
sequence 3 0.3 .mu.l Total volume 9.3 .mu.l
[0084] The mixed reaction system 1 was allowed to react at
95.degree. C. for 5 minutes and kept at 65.degree. C.
[0085] System 2 was prepared as follows:
TABLE-US-00019 SureSelect Hyb # 1 8.3 .mu.l (Agilent) SureSelect
Hyb # 2 0.3 .mu.l (Agilent) SureSelect Hyb # 3 3.3 .mu.l (Agilent)
SureSelect Hyb # 4 4.3 .mu.l (Agilent) Total volume 16.3 .mu.l
[0086] System 2 was added to System 1 and kept at 65.degree. C.
[0087] System 3 was prepared as follows:
TABLE-US-00020 Enzyme-free water 1 .mu.l SureSelect RNase Block 1
.mu.l (Agilent) SureSelect Oligo Capture 5 .mu.l Library Total
volume 7 .mu.l
[0088] System 3 was added to the system 1 and 2, and reacted at
65.degree. C. for 20-24 h.
[0089] After completion of the reaction, streptavidin-coated
magnetic beads were used for binding, and the beads were dissolved
in 50 ul of enzyme-free water after completion of the binding.
[0090] The following reaction system was prepared:
[0091] The sequence of primer D with biotin-modification was as
follows:
TABLE-US-00021 /bio/TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 9)
TABLE-US-00022 Enzyme-free water 40 .mu.l 10x PfuTurbo Cx buffer
100.0 .mu.l (Agilen, 01.Agilent.600414) PfuTurbo Cx Hot Start 2
.mu.l Nucleic Acid Polymerase (2.5 U/ul) (Agilent,
01.Agilent.600414) 20 uM primer C 4 .mu.l 20 uM primer D 4 .mu.l
(biotin-modification) Total volumn 150 .mu.l
[0092] The dissolved magnetic beads were added to the reaction
system, mixed, and reacted according to the following table:
TABLE-US-00023 95.degree. C. 3 min 95.degree. C. 30 s 56.degree. C.
30 s 72.degree. C. 90 s 68.degree. C. 7 min
[0093] After completion of the reaction, 240 .mu.l of Ampure XP
beads were used for purification. 80 .mu.l of TE buffer solution or
enzyme-free water was used for dissolving the recovered
product.
[0094] 10. Separation of the single-stranded nucleic acids:
Streptavidin-coated beads were used to bind the biotin-containing
target fragments obtained in Step 9. The single-stranded nucleic
acids with no magnetic beads bound were separated by using 78 .mu.l
of 0.1 M sodium hydroxide, and the separated product was
neutralized by the addition of an acidic buffer. The total volume
of the neutralized product was 112 .mu.l.
[0095] 11. Cyclization of the single-strand nucleic acids: The
following reaction system 1 was prepared: wherein the nucleic acid
single strand E has a corresponding complementary sequence for
ligating to both ends of the single strand. The sequence of single
strand E was as follows:
TABLE-US-00024 TCGAGCTTGTCTTCCTAAGACCGC (i.e., SEQ ID NO: 10)
TABLE-US-00025 Enzyme-free water 43 .mu.l Nucleic acid single
strand E 20 .mu.l Total 63 .mu.l
[0096] Reaction system 1 was added to the single strand product of
step 10 and mixed.
[0097] Preparation of reaction system 2:
TABLE-US-00026 Enzyme-free water 153.3 .mu.l 10.times. TA buffer 35
.mu.l (epicenter) 100 mM Adenosine triphosphate 3.5 .mu.l T4 DNA
Ligase (fast) 1.2 .mu.l (600 U/ul) (enzymatics, L6030-HC-L) Total
175 .mu.l
[0098] The reaction system 2 was added to the reaction system 1,
mixed, and incubated at 37.degree. C. for 1.5 h.
[0099] 12. Treatment by Exonuclease 1 and Exonuclease 3:
[0100] Preparation of the following reaction buffer:
TABLE-US-00027 Enzyme-free water 1.5 .mu.l 10.times. TA buffer 3.7
.mu.l (Epicentre) Exonuclease 1 (20 U/ul) (NEB 11.1 .mu.l Company,
M0293S) Exonuclease 3 (100 U/ul) 7.4 .mu.l (NEB Company, M0206S)
Total 23.7 .mu.l
[0101] 23.7 .mu.l of the reaction buffer was added to 350 .mu.l of
the reaction product from Step 11, mixed well and incubated at
37.degree. C. for 30 min.
[0102] 15.4 .mu.l of 500 mM ethylenediaminetetraacetic acid was
added and mixed well. 800 .mu.l of Ampure XP magnetic beads were
used for purification and 40-80 .mu.l of enzyme-free water/TE
buffer was used for dissolving.
[0103] The concentrations and total amounts of the final products
of the present example were as follows:
TABLE-US-00028 Total concentration amount (ng/.mu.l) (ng) Product 1
0.40 16 Product 2 0.42 16.8 Product 3 0.48 19.2
[0104] Applicant declares that the present invention describes the
detailed process equipment and process flow of the present
invention by way of the above-described embodiments, however, the
present invention is not limited to the detailed process equipment
and process flow described above, that is to say, it does not imply
that the present invention must rely on the above-described
detailed process equipment and process flow. It should be apparent
to those skilled in the art that any modification of the invention,
equivalents of the ingredients of the product of the present
invention, the addition of auxiliary ingredients, selection of
specific modes, etc., fall within the disclosed scope and
protective scope of the present invention.
Sequence CWU 1
1
10141DNAArtificial SequenceSynthetic Constructmisc_feature1Terminal
phosphate group modification 1gtctccagtc tcaactgcct gaagcccgat
cgagcttgtc t 41211DNAArtificial SequenceSynthetic
Constructmisc_feature11n = dideoxycytidine 2gacuggagac n
11321DNAArtificial SequenceSynthetic Construct 3tcctaagacc
gcactggaga c 21421DNAArtificial SequenceSynthetic
Constructmisc_feature1Terminal phosphate group modification
4agacaagctc gatcgggctt c 21521DNAArtificial SequenceSynthetic
Construct 5tcctaagacc gcactggaga c 21621DNAArtificial
SequenceSynthetic Construct 6gaagcccgat cgagcttgtc t
21710DNAArtificial SequenceSynthetic Construct 7gtctccagtc
10821DNAArtificial SequenceSynthetic Construct 8gtctccagtg
cggtcttagg a 21921DNAArtificial SequenceSynthetic
Constructmisc_feature1Terminal biotin modification 9tcctaagacc
gcactggaga c 211024DNAArtificial SequenceSynthetic Construct
10tcgagcttgt cttcctaaga ccgc 24
* * * * *