U.S. patent application number 15/491742 was filed with the patent office on 2017-08-10 for immunoglobulin chimeric monomer-dimer hybrids.
The applicant listed for this patent is Bioverativ Therapeutics Inc.. Invention is credited to Alan J. Bitoni, Susan C. Low, Adam R. Mezo, Robert T. PETERS, Daniel S. Rivera.
Application Number | 20170226189 15/491742 |
Document ID | / |
Family ID | 33458764 |
Filed Date | 2017-08-10 |
United States Patent
Application |
20170226189 |
Kind Code |
A1 |
PETERS; Robert T. ; et
al. |
August 10, 2017 |
IMMUNOGLOBULIN CHIMERIC MONOMER-DIMER HYBRIDS
Abstract
The invention relates to a chimeric monomer-dimer hybrid protein
wherein the protein comprises a first and a second polypeptide
chain, the first polypeptide chain comprising at least a portion of
an immunoglobulin constant region and a biologically active
molecule, and the second polypeptide chain comprising at least a
portion of an immunoglobulin constant region without the
biologically active molecule of the first chain. The invention also
relates to methods of using and methods of making the chimeric
monomer-dimer hybrid protein of the invention.
Inventors: |
PETERS; Robert T.; (Needham,
MA) ; Mezo; Adam R.; (Waltham, MA) ; Rivera;
Daniel S.; (Providence, RI) ; Bitoni; Alan J.;
(Acton, MA) ; Low; Susan C.; (Pepperell,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Bioverativ Therapeutics Inc. |
Waltham |
MA |
US |
|
|
Family ID: |
33458764 |
Appl. No.: |
15/491742 |
Filed: |
April 19, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14530256 |
Oct 31, 2014 |
9636416 |
|
|
15491742 |
|
|
|
|
13667951 |
Nov 2, 2012 |
8932830 |
|
|
14530256 |
|
|
|
|
12952551 |
Nov 23, 2010 |
8329182 |
|
|
13667951 |
|
|
|
|
11588431 |
Oct 27, 2006 |
7862820 |
|
|
12952551 |
|
|
|
|
10841250 |
May 6, 2004 |
7404956 |
|
|
11588431 |
|
|
|
|
60539207 |
Jan 26, 2004 |
|
|
|
60487964 |
Jul 17, 2003 |
|
|
|
60469600 |
May 6, 2003 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 9/00 20180101; C07K
14/745 20130101; A61P 7/04 20180101; C12N 9/96 20130101; C12Y
304/21022 20130101; A61P 7/00 20180101; C07K 2319/00 20130101; C07K
2319/30 20130101; A61P 31/12 20180101; C07K 14/565 20130101; C07K
14/755 20130101; A61K 47/6811 20170801; A61K 38/00 20130101; C07K
14/59 20130101; A61K 47/68 20170801; A61K 47/642 20170801; C07K
14/505 20130101; C07K 14/70503 20130101; C07K 2317/52 20130101;
A61K 47/60 20170801; C07K 14/475 20130101; A61P 31/18 20180101;
A61P 43/00 20180101; A61P 31/00 20180101; C07K 14/555 20130101;
C12N 9/6437 20130101; C12N 9/644 20130101; C12Y 304/21021 20130101;
C12N 9/647 20130101; A61P 7/06 20180101; C07K 16/00 20130101; A61K
47/6835 20170801; A61K 47/6813 20170801; C07K 14/61 20130101; C07K
14/56 20130101; A61K 47/6803 20170801 |
International
Class: |
C07K 14/755 20060101
C07K014/755; C07K 14/61 20060101 C07K014/61; C07K 14/56 20060101
C07K014/56; C12N 9/96 20060101 C12N009/96; C07K 14/59 20060101
C07K014/59; C07K 14/565 20060101 C07K014/565; C12N 9/64 20060101
C12N009/64; C07K 14/705 20060101 C07K014/705; C07K 14/505 20060101
C07K014/505 |
Claims
1.-194. (canceled)
195. A pharmaceutical composition comprising (a) a chimeric protein
and (b) a pharmaceutically acceptable carrier, wherein the chimeric
protein comprises a first and second polypeptide chain, wherein the
first polypeptide chain comprises (i) a biologically active
molecule selected from a hormone, a cytokine, a growth factor, and
a cell surface receptor, and (ii) an immunoglobulin constant region
or a portion thereof; and wherein the second polypeptide chain
comprises an immunoglobulin constant region or a portion thereof
without a biologically active molecule.
196. The pharmaceutical composition of claim 195, wherein one of
the immunoglobulin constant regions or portions thereof is an Fc
fragment.
197. The pharmaceutical composition of claim 195, wherein the
immunoglobulin constant region or a portion thereof in the first
polypeptide chain and the immunoglobulin constant region or a
portion thereof in the second polypeptide chain are identical.
198. The pharmaceutical composition of claim 195, wherein the
biologically active molecule comprises a hormone.
199. The pharmaceutical composition of claim 198, wherein the
hormone is selected from human growth hormone (hGH), gonadotropin
releasing hormone (GnRH), leuprolide, follicle stimulating hormone,
progesterone, estrogen, and testosterone.
200. The pharmaceutical composition of claim 199, wherein the
hormone is hGH.
201. The pharmaceutical composition of claim 198, wherein the
hormone and the immunoglobulin constant region or the portion
thereof in the first polypeptide chain are connected by a
linker.
202. The pharmaceutical composition of claim 201, wherein the
linker comprises polyethylene glycol (PEG).
203. The pharmaceutical composition of claim 195, wherein the
biologically active molecule comprises a cytokine or growth
factor.
204. The pharmaceutical composition of claim 203, wherein the
cytokine or growth factor is selected from granulocyte macrophage
colony stimulating factor (GM-CSF), RANTES, MIP1.alpha.,
MIP1.beta., IL-2, IL-3, Interferon .alpha., Interferon .beta.,
tumor necrosis factor .alpha., and tumor necrosis factor
.beta..
205. The pharmaceutical composition of claim 204, wherein the
growth factor is GM-CSF.
206. The pharmaceutical composition of claim 203, wherein the
cytokine or growth factor and the immunoglobulin constant region or
the portion thereof in the first polypeptide chain are connected by
a linker.
207. The pharmaceutical composition of claim 206, wherein the
linker comprises polyethylene glycol (PEG).
208. The pharmaceutical composition of claim 195, wherein the
biologically active molecule comprises a cell surface receptor.
209. The pharmaceutical composition of claim 208, wherein the cell
surface receptor is selected from CD4, CCR5, CXCR4, CD21, CD46,
TNF.alpha. receptor, the erythropoietin receptor, CD25, CD122, and
CD132.
210. The pharmaceutical composition of claim 208, wherein the cell
surface receptor and the immunoglobulin constant region or the
portion thereof in the first polypeptide chain are connected by a
linker.
211. The pharmaceutical composition of claim 210, wherein the
linker comprises polyethylene glycol (PEG).
212. A chimeric protein comprising a first and second polypeptide
chain, wherein the first polypeptide chain comprises (i) a
biologically active molecule selected from a hormone, a cytokine, a
growth factor, and a cell surface receptor, and (ii) an
immunoglobulin constant region or a portion thereof; and wherein
the second polypeptide chain comprises an immunoglobulin constant
region or a portion thereof without a biologically active
molecule.
213. The chimeric protein of claim 212, wherein the biologically
active molecule comprises a hormone.
214. The chimeric protein of claim 213, wherein the hormone is
selected from human growth hormone (hGH), gonadotropin releasing
hormone (GnRH), leuprolide, follicle stimulating hormone,
progesterone, estrogen, and testosterone.
215. The chimeric protein of claim 212, wherein the biologically
active molecule comprises a cytokine or growth factor.
216. The chimeric protein of claim 215, wherein the cytokine or
growth factor is selected from granulocyte macrophage colony
stimulating factor (GM-CSF), RANTES, MIP 1.alpha., MIP1.beta.,
IL-2, IL-3, Interferon .alpha., Interferon .beta., tumor necrosis
factor .alpha., and tumor necrosis factor .beta..
217. The chimeric protein of claim 212, wherein the biologically
active molecule comprises a cell surface receptor.
218. The chimeric protein of claim 217, wherein the cell surface
receptor is selected from CD4, CCR5, CXCR4, CD21, CD46, TNF.alpha.
receptor, the erythropoietin receptor, CD25, CD122, and CD132.
219. The chimeric protein of claim 212, wherein the biologically
active molecule and the immunoglobulin constant region or a portion
thereof in the first polypeptide chain are connected by a
linker.
220. The chimeric protein of claim 219, wherein the linker
comprises polyethylene glycol (PEG).
221. The chimeric protein of claim 219, wherein the linker comprise
an amino acid.
222. A chimeric protein comprising a first and second polypeptide
chain, wherein the first polypeptide chain comprises (i) a
biologically active molecule selected from a hormone, a cytokine, a
growth factor, and a cell surface receptor, and (ii) an
immunoglobulin constant region or a portion thereof; and wherein
the second polypeptide chain comprises an immunoglobulin constant
region or a portion thereof without a biologically active molecule;
and wherein the biologically active molecule and the immunoglobulin
constant region or a portion thereof in the first polypeptide chain
are connected by a linker comprising polyethylene glycol (PEG) or
an amino acid.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 14/530,256, filed Oct. 31, 2014, which is a
divisional application of U.S. application Ser. No. 13/667,951,
filed Nov. 2, 2012, and issued Jan. 13, 2015 as U.S. Pat. No.
8,932,830, which is a divisional application of U.S. application
Ser. No. 12/952,551, filed Nov. 23, 2010 and issued Dec. 11, 2012
as U.S. Pat. No. 8,329,182, which is a divisional application of
U.S. application Ser. No. 11/588,431, filed Oct. 27, 2006 and
issued Jan. 4, 2011 as U.S. Pat. No. 7,862,820, which is a
continuation application of U.S. application Ser. No. 10/841,250,
filed May 6, 2004 and issued Jul. 29, 2008 as U.S. Pat. No.
7,404,956, which claims priority to U.S. Provisional Appl. No.
60/469,600 filed May 6, 2003, U.S. Provisional Appl. No. 60/487,964
filed Jul. 17, 2003, and U.S. Provisional Appl. No. 60/539,207
filed Jan. 26, 2004, all of which are incorporated by reference in
their entirety. The U.S. application Ser. No. 10/842,054
nonprovisional application entitled Methods for Chemically
Synthesizing Immunoglobulin Chimeric Proteins, filed concurrently
on May 6, 2004, is incorporated by reference.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The content of the electronically submitted sequence listing
(Name: 4159_240000E_SeqListing.txt, Size: 87,725 bytes; and Date of
Creation: Apr. 7, 2017) filed with the application is incorporated
by reference in its entirety.
FIELD OF THE INVENTION
[0003] The invention relates generally to therapeutic chimeric
proteins, comprised of two polypeptide chains, wherein the first
chain is comprised of a therapeutic biologically active molecule
and the second chain is not comprised of the therapeutic
biologically active molecule of the first chain. More specifically,
the invention relates to chimeric proteins, comprised of two
polypeptide chains, wherein both chains are comprised of at least a
portion of an immunoglobulin constant region wherein the first
chain is modified to further comprise a biologically active
molecule, and the second chain is not so modified. The invention,
thus relates to a chimeric protein that is a monomer-dimer hybrid,
i.e., a chimeric protein having a dimeric aspect and a monomeric
aspect, wherein the dimeric aspect relates to the fact that it is
comprised of two polypeptide chains each comprised of a portion of
an immunoglobulin constant region, and wherein the monomeric aspect
relates to the fact that only one of the two chains is comprised of
a therapeutic biologically active molecule. FIG. 1 illustrates one
example of a monomer-dimer hybrid wherein the biologically active
molecule is erythropoietin (EPO) and the portion of an
immunoglobulin constant region is an IgG Fc region.
BACKGROUND OF THE INVENTION
[0004] Immunoglobulins are comprised of four polypeptide chains,
two heavy chains and two light chains, which associate via
disulfide bonds to form tetramers. Each chain is further comprised
of one variable region and one constant region. The variable
regions mediate antigen recognition and binding, while the constant
regions, particularly the heavy chain constant regions, mediate a
variety of effector functions, e.g., complement binding and Fc
receptor binding (see, e.g., U.S. Pat. Nos. 6,086,875; 5,624,821;
5,116,964).
[0005] The constant region is further comprised of domains denoted
CH (constant heavy) domains (CHI, CH2, etc.). Depending on the
isotype, (i.e. IgG, IgM, IgA IgD, IgE) the constant region can be
comprised of three or four CH domains. Some isotypes (e.g. IgG)
constant regions also contain a hinge region Janeway et al. 2001,
Immunobiology, Garland Publishing, N.Y., N.Y.
[0006] The creation of chimeric proteins comprised of
immunoglobulin constant regions linked to a protein of interest, or
fragment thereof, has been described (see, e.g., U.S. Pat. Nos.
5,480,981 and 5,808,029; Gascoigne et al. 1987, Proc. Natl. Acad.
Sci. USA 84:2936; Capon et al. 1989, Nature 337:525; Traunecker et
al. 1989, Nature 339:68; Zettmeissl et al. 1990, DNA Cell Biol. USA
9:347; Byrn et al. 1990, Nature 344:667; Watson et al. 1990, J.
Cell Biol. 110:2221; Watson et al. 1991, Nature 349:164; Aruffo et
al. 1990, Cell 61:1303; Linsley et al. 1991, J. Exp. Med. 173:721;
Linsley et al. 1991, J. Exp. Med. 174:561; Stamenkovic et al.,
1991, Cell 66:1133; Ashkenazi et al. 1991, Proc. Natl. Acad. Sci.
USA 88:10535; Lesslauer et al. 1991, Eur. J. Immunol. 27:2883;
Peppel et al. 1991, J. Exp. Med 174:1483; Bennett et al. 1991, J.
Biol. Chem. 266:23060; Kurschner et al. 1992, J. Biol. Chem.
267:9354; Chalupny et al. 1992, Proc. Natl. Acad Sci. USA 89:10360;
Ridgway and Gorman, 1991, J. Cell Biol. 115, Abstract No. 1448;
Zheng et al. 1995, J. Immun. 154:5590). These molecules usually
possess both the biological activity associated with the linked
molecule of interest as well as the effector function, or some
other desired characteristic associated with the immunoglobulin
constant region (e.g. biological stability, cellular
secretion).
[0007] The Fc portion of an immunoglobulin constant region,
depending on the immunoglobulin isotype can include the CH2, CH3,
and CH4 domains, as well as the hinge region. Chimeric proteins
comprising an Fc portion of an immunoglobulin bestow several
desirable properties on a chimeric protein including increased
stability, increased serum half life (see Capon et al. 1989, Nature
337:525) as well as binding to Fc receptors such as the neonatal Fc
receptor (FcRn) (U.S. Pat. Nos. 6,086,875, 6,485,726, 6,030,613; WO
03/077834; US2003-0235536A1).
[0008] FcRn is active in adult epithelial tissue and expressed in
the lumen of the intestines, pulmonary airways, nasal surfaces,
vaginal surfaces, colon and rectal surfaces (U.S. Pat. No.
6,485,726). Chimeric proteins comprised of FcRn binding partners
(e.g. IgG, Fc fragments) can be effectively shuttled across
epithelial barriers by FcRn, thus providing a non-invasive means to
systemically administer a desired therapeutic molecule.
Additionally, chimeric proteins comprising an FcRn binding partner
are endocytosed by cells expressing the FcRn. But instead of being
marked for degradation, these chimeric proteins are recycled out
into circulation again, thus increasing the in vivo half life of
these proteins.
[0009] Portions of immunoglobulin constant regions, e.g., FcRn
binding partners typically associate, via disulfide bonds and other
non-specific interactions, with one another to form dimers and
higher order multimers. The instant invention is based in part upon
the surprising discovery that transcytosis of chimeric proteins
comprised of FcRn binding partners appears to be limited by the
molecular weight of the chimeric protein, with higher molecular
weight species being transported less efficiently.
[0010] Chimeric proteins comprised of biologically active
molecules, once administered, typically will interact with a target
molecule or cell. The instant invention is further based in part
upon the surprising discovery that monomer-dimer hybrids, with one
biologically active molecule, but two portions of an immunoglobulin
constant region, e.g., two FcRn binding partners, function and can
be transported more effectively than homodimers, also referred to
herein simply as "dimers" or higher order multimers with two or
more copies of the biologically active molecule. This is due in
part to the fact that chimeric proteins, comprised of two or more
biologically active molecules, which exist as dimers and higher
order multimers, can be sterically hindered from interacting with
their target molecule or cell, due to the presence of the two or
more biologically active molecules in close proximity to one
another and that the biologically active molecule can have a high
affinity for itself
[0011] Accordingly one aspect of the invention provides chimeric
proteins comprised of a biologically active molecule that is
transported across the epithelium barrier. An additional aspect of
the invention provides chimeric proteins comprised of at least one
biologically active molecule that is able to interact with its
target molecule or cell with little or no steric hindrance or self
aggregation.
[0012] The aspects of the invention provide for chimeric proteins
comprising a first and second polypeptide chain, the first chain
comprising at least a portion of immunoglobulin constant region,
wherein the portion of an immunoglobulin constant region has been
modified to include a biologically active molecule and the second
chain comprising at least a portion of immunoglobulin constant
region, wherein the portion of an immunoglobulin constant region
has not been so modified to include the biologically active
molecule of the first chain.
SUMMARY OF THE INVENTION
[0013] The invention relates to a chimeric protein comprising one
biologically active molecule and two molecules of at least a
portion of an immunoglobulin constant region. The chimeric protein
is capable of interacting with a target molecule or cell with less
steric hindrance compared to a chimeric protein comprised of at
least two biologically active molecules and at least a portion of
two immunoglobulin constant regions. The invention also relates to
a chimeric protein comprising at least one biologically active
molecule and two molecules of at least a portion of an
immunoglobulin constant region that is transported across an
epithelium barrier more efficiently than a corresponding homodimer,
i.e., wherein both chains are linked to the same biologically
active molecule. The invention, thus relates to a chimeric protein
comprising a first and a second polypeptide chain linked together,
wherein said first chain comprises a biologically active molecule
and at least a portion of an immunoglobulin constant region, and
said second chain comprises at least a portion of an immunoglobulin
constant region, but no immunoglobulin variable region and without
any biologically active molecule attached.
[0014] The invention relates to a chimeric protein comprising a
first and a second polypeptide chain linked together, wherein said
first chain comprises a biologically active molecule and at least a
portion of an immunoglobulin constant region, and said second chain
comprises at least a portion of an immunoglobulin constant region
without an immunoglobulin variable region or any biologically
active molecule and wherein said second chain is not covalently
bonded to any molecule having a molecular weight greater than 1 kD,
2 kD, 5 kD, 10 kD, or 20 kD. In one embodiment, the second chain is
not covalently bonded to any molecule having a molecular weight
greater than 0-2 kD. In one embodiment, the second chain is not
covalently bonded to any molecule having a molecular weight greater
than 5-10 kD. In one embodiment, the second chain is not covalently
bonded to any molecule having a molecular weight greater than 15-20
kD.
[0015] The invention relates to a chimeric protein comprising a
first and a second polypeptide chain linked together, wherein said
first chain comprises a biologically active molecule and at least a
portion of an immunoglobulin constant region, and said second chain
comprises at least a portion of an immunoglobulin constant region
not covalently linked to any other molecule except the portion of
an immunoglobulin of said first polypeptide chain.
[0016] The invention relates to a chimeric protein comprising a
first and a second polypeptide chain linked together, wherein said
first chain comprises a biologically active molecule and at least a
portion of an immunoglobulin constant region, and said second chain
consists of at least a portion of an immunoglobulin constant region
and optionally an affinity tag.
[0017] The invention relates to a chimeric protein comprising a
first and a second polypeptide chain linked together, wherein said
first chain comprises a biologically active molecule and at least a
portion of an immunoglobulin constant region, and said second chain
consists essentially of at least a portion of an immunoglobulin
constant region and optionally an affinity tag.
[0018] The invention relates to a chimeric protein comprising a
first and a second polypeptide chain linked together, wherein said
first chain comprises a biologically active molecule and at least a
portion of an immunoglobulin constant region, and said second chain
comprises at least a portion of an immunoglobulin constant region
without an immunoglobulin variable region or any biologically
active molecule and optionally a molecule with a molecular weight
less than 10 kD, 5 kD, 2 kD or 1 kD. In one embodiment, the second
chain comprises a molecule less than 15-20 kD. In one embodiment,
the second chain comprises a molecule less than 5-10 kD. In one
embodiment, the second chain comprises a molecule less than 1-2
kD.
[0019] The invention relates to a chimeric protein comprising a
first and second polypeptide chain, wherein said first chain
comprises a biologically active molecule, at least a portion of an
immunoglobulin constant region, and at least a first domain, said
first domain having at least one specific binding partner, and
wherein said second chain comprises at least a portion of an
immunoglobulin constant region, and at least a second domain,
wherein said second domain is a specific binding partner of said
first domain, without any immunoglobulin variable region or a
biologically active molecule.
[0020] The invention relates to a method of making a chimeric
protein comprising a first and second polypeptide chain, wherein
the first polypeptide chain and the second polypeptide chain are
not the same, said method comprising transfecting a cell with a
first DNA construct comprising a DNA molecule encoding a first
polypeptide chain comprising a biologically active molecule and at
least a portion of an immunoglobulin constant region and optionally
a linker, and a second DNA construct comprising a DNA molecule
encoding a second polypeptide chain comprising at least a portion
of an immunoglobulin constant region without any biologically
active molecule or an immunoglobulin variable region, and
optionally a linker, culturing the cells under conditions such that
the polypeptide chain encoded by the first DNA construct is
expressed and the polypeptide chain encoded by the second DNA
construct is expressed and isolating monomer-dimer hybrids
comprised of the polypeptide chain encoded by the first DNA
construct and the polypeptide chain encoded by the second DNA
construct.
[0021] The invention relates to a method of making a chimeric
protein comprising a first and second polypeptide chain, wherein
the first polypeptide chain and the second polypeptide chain are
not the same, and wherein said first polypeptide chain comprises a
biologically active molecule, at least a portion of an
immunoglobulin constant region, and at least a first domain, said
first domain, having at least one specific binding partner, and
wherein said second polypeptide chain comprises at least a portion
of an immunoglobulin constant region and a second domain, wherein
said second domain, is a specific binding partner of said first
domain, without any biologically active molecule or an
immunoglobulin variable region, said method comprising transfecting
a cell with a first DNA construct comprising a DNA molecule
encoding said first polypeptide chain and a second DNA construct
comprising a DNA molecule encoding, said second polypeptide chain,
culturing the cells under conditions such that the polypeptide
chain encoded by the first DNA construct is expressed and the
polypeptide chain encoded by the second DNA construct is expressed
and isolating monomer-dimer hybrids comprised of the polypeptide
chain encoded by the first DNA construct and polypeptide chain
encoded by the second DNA construct.
[0022] The invention relates to a method of making a chimeric
protein of the invention said method comprising transfecting a cell
with a first DNA construct comprising a DNA molecule encoding a
first polypeptide chain comprising a biologically active molecule
and at least a portion of an immunoglobulin constant region and
optionally a linker, culturing the cell under conditions such that
the polypeptide chain encoded by the first DNA construct is
expressed, isolating the polypeptide chain encoded by the first DNA
construct and transfecting a cell with a second DNA construct
comprising a DNA molecule encoding a second polypeptide chain
comprising at least a portion of an immunoglobulin constant region
without any biologically active molecule or immunoglobulin variable
region, culturing the cell under conditions such that the
polypeptide chain encoded by the second DNA construct is expressed,
isolating the polypeptide chain, encoded by the second DNA
construct, combining the polypeptide chain, encoded by the first
DNA construct and the polypeptide chain encoded by the second DNA
construct under conditions such that monomer-dimer hybrids
comprising the polypeptide chain encoded by the first DNA construct
and the polypeptide chain encoded by the second DNA construct form,
and isolating said monomer-dimer hybrids.
[0023] The invention relates to a method of making a chimeric
protein comprising a first and second polypeptide chain, wherein
the first polypeptide chain and the second polypeptide chain are
not the same, said method comprising transfecting a cell with a DNA
construct comprising a DNA molecule encoding a polypeptide chain
comprising at least a portion of an immunoglobulin constant region,
culturing the cells under conditions such that the polypeptide
chain encoded by the DNA construct is expressed with an N terminal
cysteine such that dimers of the polypeptide chain form and
isolating dimers comprised of two copies of the polypeptide chain
encoded by the DNA construct and chemically reacting the isolated
dimers with a biologically active molecule, wherein said
biologically active molecule has a C terminus thioester, under
conditions such that the biologically active molecule reacts
predominantly with only one polypeptide chain of the dimer thereby
forming a monomer-dimer hybrid.
[0024] The invention relates to a method of making a chimeric
protein comprising a first and second polypeptide chain, wherein
the first polypeptide chain and the second polypeptide chain are
not the same, said method comprising transfecting a cell with a DNA
construct comprising a DNA molecule encoding a polypeptide chain
comprising at least a portion of an immunoglobulin constant region,
culturing the cells under conditions such that the polypeptide
chain encoded by the DNA construct is expressed with an N terminal
cysteine such that dimers of the polypeptide chains form, and
isolating dimers comprised of two copies of the polypeptide chain
encoded by the DNA construct, and chemically reacting the isolated
dimers with a biologically active molecule, wherein said
biologically active molecule has a C terminus thioester, such that
the biologically active molecule is linked to each chain of the
dimer, denaturing the dimer comprised of the portion of the
immunoglobulin linked to the biologically active molecule such that
monomeric chains form, combining the monomeric chains with a
polypeptide chain comprising at least a portion of an
immunoglobulin constant region without a biologically active
molecule linked to it, such that monomer-dimer hybrids form, and
isolating the monomer-dimer hybrids.
[0025] The invention relates to a method of making a chimeric
protein comprising a first and second polypeptide chain, wherein
the first polypeptide chain and the second polypeptide chain are
not the same, said method comprising transfecting a cell with a DNA
construct comprising a DNA molecule encoding a polypeptide chain
comprising at least a portion of an immunoglobulin constant region,
culturing the cells under conditions such that the polypeptide
chain encoded by the DNA construct is expressed as a mixture of two
polypeptide chains, wherein the mixture comprises a polypeptide
with an N terminal cysteine, and a polypeptide with a cysteine in
close proximity to the N terminus, isolating dimers comprised of
the mixture of polypeptide chains encoded by the DNA construct and
chemically reacting the isolated dimers with a biologically active
molecule, wherein said biologically active molecule has an active
thioester, such that at least some monomer-dimer hybrid forms and
isolating the monomer-dimer hybrid from said mixture.
[0026] The invention relates to a method of treating a disease or
condition comprising administering a chimeric protein of the
invention thereby treating the disease or condition.
[0027] Additional objects and advantages of the invention will be
set forth in part in the description which follows, and in part
will be obvious from the description, or may be learned by practice
of the invention. The objects and advantages of the invention will
be realized and attained by means of the elements and combinations
particularly pointed out in the appended claims.
[0028] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 is a schematic diagram comparing the structure of an
EPO-Fc homodimer, or dimer, and the structure of an Epo-FC
monomer-dimer hybrid.
[0030] FIG. 2a is the amino acid sequence of the chimeric protein
Factor VII-Fc (SEQ ID NO: 6). Included in the sequence is the
signal peptide (underlined), which is cleaved by the cell and the
propeptide (bold), which is recognized by the vitamin K-dependent
.gamma. carboxylase which modifies the Factor VII to achieve full
activity. The sequence is subsequently cleaved by PACE to yield
Factor VII-Fc.
[0031] FIG. 2b is the amino acid sequence of the chimeric protein
Factor IX-Fc (SEQ ID NO: 8). Included in the sequence is the signal
peptide (underlined) which is cleaved by the cell and the
propeptide (bold) which is recognized by the vitamin K-dependent
.gamma. carboxylase which modifies the Factor IX to achieve full
activity. The sequence is subsequently cleaved by PACE to yield
Factor IX-Fc.
[0032] FIG. 2c is the amino acid sequence of the chimeric protein
IFN.alpha.-Fc (SEQ ID NO: 10). Included in the sequence is the
signal peptide (underlined), which is cleaved by the cell resulting
in the mature IFN.alpha.-Fc.
[0033] FIG. 2d is the amino acid sequence of the chimeric protein
IFN.alpha.-Fc .DELTA. linker (SEQ ID NO: 12). Included in the
sequence is the signal peptide (underlined) which is cleaved by the
cell resulting in the mature IFN.alpha.-Fc .DELTA. linker.
[0034] FIG. 2e is the amino acid sequence of the chimeric protein
Flag-Fc (SEQ ID NO: 14). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell resulting in the
mature Flag-Fc.
[0035] FIG. 2f is the amino acid sequence of the chimeric protein
Epo-CCA-Fc (SEQ ID NO: 16). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell resulting in the
mature Epo-CCA-Fc. Also shown in bold is the acidic coiled coil
domain.
[0036] FIG. 2g is the amino acid sequence of the chimeric protein
CCB-Fc (SEQ ID NO: 18). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell resulting in the
mature CCB-Fc. Also shown in bold is the basic coiled coil
domain.
[0037] FIG. 2h is the amino acid sequence of the chimeric protein
Cys-Fc (SEQ ID NO: 20). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell resulting in the
mature Cys-Fc. When this sequence is produced in CHO cells a
percentage of the molecules are incorrectly cleaved by the signal
peptidase such that two extra amino acids are left on the N
terminus, thus preventing the linkage of a biologically active
molecule with a C terminal thioester (e.g., via native ligation).
When these improperly cleaved species dimerize with the properly
cleaved Cys-Fc and are subsequently reacted with biologically
active molecules with C terminal thioesters, monomer-dimer hybrids
form.
[0038] FIG. 2i is the amino acid sequence of the chimeric protein
IFN.alpha.-GS15-Fc (SEQ ID NO: 22). Included in the sequence is the
signal peptide (underlined) which is cleaved by the cell resulting
in the mature IFN.alpha.-GS15-Fc.
[0039] FIG. 2j is the amino acid sequence of the chimeric protein
Epo-Fc (SEQ ID NO: 24). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell resulting in the
mature Epo-Fc. Also shown in bold is the 8 amino acid linker.
[0040] FIG. 3a is the nucleic acid sequence of the chimeric protein
Factor VII-Fc (SEQ ID NO: 7). Included in the sequence is the
signal peptide (underlined) and the propeptide (bold) which is
recognized by the vitamin K-dependent .gamma. carboxylase which
modifies the Factor VII to achieve full activity. The translated
sequence is subsequently cleaved by PACE to yield mature Factor
VII-Fc.
[0041] FIG. 3b is the nucleic acid sequence of the chimeric protein
Factor IX-Fc (SEQ ID NO: 9). Included in the sequence is the signal
peptide (underlined) and the propeptide (bold) which is recognized
by the vitamin K-dependent .gamma. carboxylase which modifies the
Factor IX to achieve full activity. The translated sequence is
subsequently cleaved by PACE to yield mature Factor IX-Fc.
[0042] FIG. 3c is the nucleic acid sequence of the chimeric protein
IFN.alpha.-Fc (SEQ ID NO: 11). Included in the sequence is the
signal peptide (underlined), which is cleaved by the cell after
translation resulting in the mature IFN.alpha.-Fc.
[0043] FIG. 3d is the nucleic acid sequence of the chimeric protein
IFN.alpha.-Fc .DELTA. linker (SEQ ID NO: 13). Included in the
sequence is the signal peptide (underlined) which is cleaved by the
cell after translation resulting in the mature IFN.alpha.-Fc
.DELTA. linker.
[0044] FIG. 3e is the amino acid sequence of the chimeric protein
Flag-Fc (SEQ ID NO: 15). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell after
translation resulting in the mature Flag-Fc.
[0045] FIG. 3f is the nucleic acid sequence of the chimeric protein
Epo-CCA-Fc (SEQ ID NO: 17). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell after
translation resulting in the mature Epo-CCA-Fc. Also shown in bold
is the acidic coiled coil domain.
[0046] FIG. 3g is the nucleic acid sequence of the chimeric protein
CCB-Fc (SEQ ID NO: 19). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell after
translation resulting in the mature CCB-Fc. Also shown in bold is
the basic coiled coil domain.
[0047] FIG. 3h is the nucleic acid sequence of the chimeric protein
Cys-Fc (SEQ ID NO: 21). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell after
translation resulting in the mature Cys-Fc.
[0048] FIG. 3i is the nucleic acid sequence of the chimeric protein
IFNa-GS15-Fc (SEQ ID NO: 23). Included in the sequence is the
signal peptide (underlined) which is cleaved by the cell after
translation resulting in the mature IFN.alpha.-GS15-Fc.
[0049] FIG. 3j is the nucleic acid sequence of the chimeric protein
Epo-Fc (SEQ ID NO: 25). Included in the sequence is the signal
peptide (underlined), which is cleaved by the cell after
translation resulting in the mature Epo-Fc. Also shown in bold is a
nucleic acid sequence encoding the 8 amino acid linker.
[0050] FIG. 4 demonstrates ways to form monomer-dimer hybrids
through native ligation. SVGCPPC, VGCPPC, STGCPPC and CPPC
disclosed as SEQ ID NOS 87-90, respectively.
[0051] FIG. 5a shows the amino acid sequence of Fc MESNA (SEQ ID
NO:4).
[0052] FIG. 5b shows the DNA sequence of Fc MESNA (SEQ ID
NO:5).
[0053] FIG. 6 compares antiviral activity of IFN.alpha. homo-dimer
(i.e. comprised of 2 IFN.alpha. molecules) with an IFN.alpha.
monomer-dimer hybrid (i.e. comprised of 1 IFN.alpha. molecule).
[0054] FIG. 7 is a comparison of clotting activity of a chimeric
monomer-dimer hybrid Factor VIIa-Fc (one Factor VII molecule) and a
chimeric homodimer Factor VIIa-Fc (two Factor VII molecules).
[0055] FIG. 8 compares oral dosing in neonatal rats of a chimeric
monomer-dimer hybrid Factor VIIa-Fc (one Factor VII molecule) and a
chimeric homodimer Factor VIIa-Fc (two Factor VII molecules).
[0056] FIG. 9 compares oral dosing in neonatal rats of a chimeric
monomer-dimer hybrid Factor IX-Fc (one Factor IX molecule) with a
chimeric homodimer.
[0057] FIG. 10 is a time course study comparing a chimeric
monomer-dimer hybrid Factor IX-Fc (one Factor IX molecule)
administered orally to neonatal rats with an orally administered
chimeric homodimer.
[0058] FIG. 11 demonstrates pharmokinetics of Epo-Fc dimer compared
to Epo-Fc monomer-dimer hybrid in cynomolgus monkeys after a single
pulmonary dose.
[0059] FIG. 12 compares serum concentration in monkeys of
subcutaneously administered Epo-Fc monomer-dimer hybrid with
subcutaneously administered Aranesp.RTM. (darbepoetin alfa).
[0060] FIG. 13 compares serum concentration in monkeys of
intravenously administered Epo-Fc monomer-dimer hybrid with
intravenously administered Aranesp.RTM. (darbepoetin alfa) and
Epogen.RTM. (epoetin alfa).
[0061] FIG. 14 shows a trace from a Mimetic Red 2.TM. column
(ProMetic LifeSciences, Inc., Wayne, N.J.) and an SDS-PAGE of
fractions from the column containing EpoFc monomer-dimer hybrid,
EpoFc dimer, and Fc. EpoFc monomer-dimer hybrid is found in
fractions 11, 12, 13, and 14. EpoFc dimer is found in fraction 18.
Fc is found in fractions 1/2.
[0062] FIG. 15 shows the pharmacokinetics of IFN.beta.Fc with an 8
amino acid linker in cynomolgus monkeys after a single pulmonary
dose.
[0063] FIG. 16 shows neopterin stimulation in response to the
IFN.beta.-Fc homodimer and the IFN.beta.-Fc N297A monomer-dimer
hybrid in cynomolgus monkeys.
[0064] FIG. 17a shows the nucleotide sequence of interferon
.beta.-Fc (SEQ ID NO: 98); FIG. 17b shows the amino acid sequence
of interferon .beta.-Fc (SEQ ID NO: 99).
[0065] FIG. 18a shows the amino acid sequence of T20(SEQ ID NO: 1);
FIG. 18b shows the amino acid sequence of T21(SEQ ID NO: 2) and
FIG. 18c shows the amino acid sequence of T1249(SEQ ID NO: 3).
DESCRIPTION OF THE EMBODIMENTS
A. Definitions
[0066] Affinity tag, as used herein, means a molecule attached to a
second molecule of interest, capable of interacting with a specific
binding partner for the purpose of isolating or identifying said
second molecule of interest.
[0067] Analogs of chimeric proteins of the invention, or proteins
or peptides substantially identical to the chimeric proteins of the
invention, as used herein, means that a relevant amino acid
sequence of a protein or a peptide is at least 70%, 75%, 80%, 85%,
90%, 95%, 97%, 98%, 99%, or 100% identical to a given sequence. By
way of example, such sequences may be variants derived from various
species, or they may be derived from the given sequence by
truncation, deletion, amino acid substitution or addition. Percent
identity between two amino acid sequences is determined by standard
alignment algorithms such as, for example, Basic Local Alignment
Tool (BLAST) described in Altschul et al. 1990, J. Mol. Biol.,
215:403-410, the algorithm of Needleman et al. 1970, J. Mol. Biol.,
48:444-453; the algorithm of Meyers et al. 1988, Comput. Appl.
Biosci., 4:11-17; or Tatusova et al. 1999, FEMS Microbiol. Lett.,
174:247-250, etc. Such algorithms are incorporated into the BLASTN,
BLASTP and "BLAST 2 Sequences" programs (see
www.ncbi.nlm.nih.gov/BLAST). When utilizing such programs, the
default parameters can be used. For example, for nucleotide
sequences the following settings can be used for "BLAST 2
Sequences": program BLASTN, reward for match 2, penalty for
mismatch -2, open gap and extension gap penalties 5 and 2
respectively, gap x_dropoff 50, expect 10, word size 11, filter ON.
For amino acid sequences the following settings can be used for
"BLAST 2 Sequences": program BLASTP, matrix BLOSUM62, open gap and
extension gap penalties 11 and 1 respectively, gap x_dropoff 50,
expect 10, word size 3, filter ON.
[0068] Bioavailability, as used herein, means the extent and rate
at which a substance is absorbed into a living system or is made
available at the site of physiological activity.
[0069] Biologically active molecule, as used herein, means a
non-immunoglobulin molecule or fragment thereof, capable of
treating a disease or condition or localizing or targeting a
molecule to a site of a disease or condition in the body by
performing a function or an action, or stimulating or responding to
a function, an action or a reaction, in a biological context (e.g.
in an organism, a cell, or an in vitro model thereof). Biologically
active molecules may comprise at least one of polypeptides, nucleic
acids, small molecules such as small organic or inorganic
molecules.
[0070] A chimeric protein, as used herein, refers to any protein
comprised of a first amino acid sequence derived from a first
source, bonded, covalently or non-covalently, to a second amino
acid sequence derived from a second source, wherein the first and
second source are not the same. A first source and a second source
that are not the same can include two different biological
entities, or two different proteins from the same biological
entity, or a biological entity and a non-biological entity. A
chimeric protein can include for example, a protein derived from at
least 2 different biological sources. A biological source can
include any non-synthetically produced nucleic acid or amino acid
sequence (e.g. a genomic or cDNA sequence, a plasmid or viral
vector, a native virion or a mutant or analog, as further described
herein, of any of the above). A synthetic source can include a
protein or nucleic acid sequence produced chemically and not by a
biological system (e.g. solid phase synthesis of amino acid
sequences). A chimeric protein can also include a protein derived
from at least 2 different synthetic sources or a protein derived
from at least one biological source and at least one synthetic
source. A chimeric protein may also comprise a first amino acid
sequence derived from a first source, covalently or non-covalently
linked to a nucleic acid, derived from any source or a small
organic or inorganic molecule derived from any source. The chimeric
protein may comprise a linker molecule between the first and second
amino acid sequence or between the first amino acid sequence and
the nucleic acid, or between the first amino acid sequence and the
small organic or inorganic molecule.
[0071] Clotting factor, as used herein, means any molecule, or
analog thereof, naturally occurring or recombinantly produced which
prevents or decreases the duration of a bleeding episode in a
subject with a hemostatic disorder. In other words, it means any
molecule having clotting activity.
[0072] Clotting activity, as used herein, means the ability to
participate in a cascade of biochemical reactions that culminates
in the formation of a fibrin clot and/or reduces the severity,
duration or frequency of hemorrhage or bleeding episode.
[0073] Dimer as used herein refers to a chimeric protein comprising
a first and second polypeptide chain, wherein the first and second
chains both comprise a biologically active molecule, and at least a
portion of an immunoglobulin constant region. A homodimer refers to
a dimer where both biologically active molecules are the same.
[0074] Dimerically linked monomer-dimer hybrid refers to a chimeric
protein comprised of at least a portion of an immunoglobulin
constant region, e.g. an Fc fragment of an immunoglobulin, a
biologically active molecule and a linker which links the two
together such that one biologically active molecule is bound to 2
polypeptide chains, each comprising a portion of an immunoglobulin
constant region. FIG. 4 shows an example of a dimerically linked
monomer-dimer hybrid.
[0075] DNA construct, as used herein, means a DNA molecule, or a
clone of such a molecule, either single- or double-stranded that
has been modified through human intervention to contain segments of
DNA combined in a manner that as a whole would not otherwise exist
in nature. DNA constructs contain the information necessary to
direct the expression of polypeptides of interest. DNA constructs
can include promoters, enhancers and transcription terminators. DNA
constructs containing the information necessary to direct the
secretion of a polypeptide will also contain at least one secretory
signal sequence.
[0076] Domain, as used herein, means a region of a polypeptide
(including proteins as that term is defined) having some
distinctive physical feature or role including for example an
independently folded structure composed of one section of a
polypeptide chain. A domain may contain the sequence of the
distinctive physical feature of the polypeptide or it may contain a
fragment of the physical feature which retains its binding
characteristics (i.e., it can bind to a second domain). A domain
may be associated with another domain. In other words, a first
domain may naturally bind to a second domain.
[0077] A fragment, as used herein, refers to a peptide or
polypeptide comprising an amino acid sequence of at least 2
contiguous amino acid residues, of at least 5 contiguous amino acid
residues, of at least 10 contiguous amino acid residues, of at
least 15 contiguous amino acid residues, of at least 20 contiguous
amino acid residues, of at least 25 contiguous amino acid residues,
of at least 40 contiguous amino acid residues, of at least 50
contiguous amino acid residues, of at least 100 contiguous amino
acid residues, or of at least 200 contiguous amino acid residues or
any deletion or truncation of a protein, peptide, or
polypeptide.
[0078] Hemostasis, as used herein, means the stoppage of bleeding
or hemorrhage; or the stoppage of blood flow through a blood vessel
or body part.
[0079] Hemostatic disorder, as used herein, means a genetically
inherited or acquired condition characterized by a tendency to
hemorrhage, either spontaneously or as a result of trauma, due to
an impaired ability or inability to form a fibrin clot.
[0080] Linked, as used herein, refers to a first nucleic acid
sequence covalently joined to a second nucleic acid sequence. The
first nucleic acid sequence can be directly joined or juxtaposed to
the second nucleic acid sequence or alternatively an intervening
sequence can covalently join the first sequence to the second
sequence. Linked as used herein can also refer to a first amino
acid sequence covalently, or non-covalently, joined to a second
amino acid sequence. The first amino acid sequence can be directly
joined or juxtaposed to the second amino acid sequence or
alternatively an intervening sequence can covalently join the first
amino acid sequence to the second amino acid sequence.
[0081] Operatively linked, as used herein, means a first nucleic
acid sequence linked to a second nucleic acid sequence such that
both sequences are capable of being expressed as a biologically
active protein or peptide.
[0082] Polypeptide, as used herein, refers to a polymer of amino
acids and does not refer to a specific length of the product; thus,
peptides, oligopeptides, and proteins are included within the
definition of polypeptide. This term does not exclude
post-expression modifications of the polypeptide, for example,
glycosylation, acetylation, phosphorylation, pegylation, addition
of a lipid moiety, or the addition of any organic or inorganic
molecule. Included within the definition, are for example,
polypeptides containing one or more analogs of an amino acid
(including, for example, unnatural amino acids) and polypeptides
with substituted linkages, as well as other modifications known in
the art, both naturally occurring and non-naturally occurring.
[0083] High stringency, as used herein, includes conditions readily
determined by the skilled artisan based on, for example, the length
of the DNA. Generally, such conditions are defined in Sambrook et
al. Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp.
1.101-104, Cold Spring Harbor Laboratory Press (1989), and include
use of a prewashing solution for the nitrocellulose filters
5.times. SSC, 0.5% SDS, 1.0 mM EDTA (PH 8.0), hybridization
conditions of 50% formamide, 6.times. SSC at 42.degree. C. (or
other similar hybridization solution, such as Stark's solution, in
50% formamide at 42.degree. C., and with washing at approximately
68.degree. C., 0.2.times. SSC, 0.1% SDS. The skilled artisan will
recognize that the temperature and wash solution salt concentration
can be adjusted as necessary according to factors such as the
length of the probe.
[0084] Moderate stringency, as used herein, include conditions that
can be readily determined by those having ordinary skill in the art
based on, for example, the length of the DNA. The basic conditions
are set forth by Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2d ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory
Press (1989), and include use of a prewashing solution for the
nitrocellulose filters 5.times. SSC, 0.5% SDS, 1.0 mM EDTA (pH
8.0), hybridization conditions of 50% formamide, 6.times. SSC at
42.degree. C. (or other similar hybridization solution, such as
Stark's solution, in 50% formamide at 42.degree. C.), and washing
conditions of 60.degree. C., 0.5.times. SSC, 0.1% SDS.
[0085] A small inorganic molecule, as used herein means a molecule
containing no carbon atoms and being no larger than 50 kD.
[0086] A small organic molecule, as used herein means a molecule
containing at least one carbon atom and being no larger than 50
kD.
[0087] Treat, treatment, treating, as used herein means, any of the
following: the reduction in severity of a disease or condition; the
reduction in the duration of a disease course; the amelioration of
one or more symptoms associated with a disease or condition; the
provision of beneficial effects to a subject with a disease or
condition, without necessarily curing the disease or condition, the
prophylaxis of one or more symptoms associated with a disease or
condition.
B. Improvements Offered by Certain Embodiments of the Invention
[0088] The invention provides for chimeric proteins (monomer-dimer
hybrids) comprising a first and a second polypeptide chain, wherein
said first chain comprises a biologically active molecule and at
least a portion of an immunoglobulin constant region, and said
second chain comprises at least a portion of an immunoglobulin
constant region without any biologically active molecule or
variable region of an immunoglobulin. FIG. 1 contrasts traditional
fusion protein dimers with one example of the monomer-dimer hybrid
of the invention. In this example, the biologically active molecule
is EPO and the portion of an immunoglobulin is IgG Fc region.
[0089] Like other chimeric proteins comprised of at least a portion
of an immunoglobulin constant region, the invention provides for
chimeric proteins which afford enhanced stability and increased
bioavailability of the chimeric protein compared to the
biologically active molecule alone. Additionally, however, because
only one of the two chains comprises the biologically active
molecule, the chimeric protein has a lower molecular weight than a
chimeric protein wherein all chains comprise a biologically active
molecule and while not wishing to be bound by any theory, this may
result in the chimeric protein being more readily transcytosed
across the epithelium barrier, e.g., by binding to the FcRn
receptor thereby increasing the half-life of the chimeric protein.
In one embodiment, the invention thus provides for an improved
non-invasive method (e.g. via any mucosal surface, such as, orally,
buccally, sublingually, nasally, rectally, vaginally, or via
pulmonary or occular route) of administering a therapeutic chimeric
protein of the invention. The invention thus provides methods of
attaining therapeutic levels of the chimeric proteins of the
invention using less frequent and lower doses compared to
previously described chimeric proteins (e.g. chimeric proteins
comprised of at least a portion of an immunoglobulin constant
region and a biologically active molecule, wherein all chains of
the chimeric protein comprise a biologically active molecule).
[0090] In another embodiment, the invention provides an invasive
method, e.g., subcutaneously, intravenously, of administering a
therapeutic chimeric protein of the invention. Invasive
administration of the therapeutic chimeric protein of the invention
provides for an increased half life of the therapeutic chimeric
protein which results in using less frequent and lower doses
compared to previously described chimeric proteins (e.g. chimeric
proteins comprised of at least a portion of an immunoglobulin
constant region and a biologically active molecule, wherein all
chains of the chimeric protein comprise a biologically active
molecule).
[0091] Yet another advantage of a chimeric protein wherein only one
of the chains comprises a biologically active molecule is the
enhanced accessibility of the biologically active molecule for its
target cell or molecule resulting from decreased steric hindrance,
decreased hydrophobic interactions, decreased ionic interactions,
or decreased molecular weight compared to a chimeric protein
wherein all chains are comprised of a biologically active
molecule.
C. Chimeric Proteins
[0092] The invention relates to chimeric proteins comprising one
biologically active molecule, at least a portion of an
immunoglobulin constant region, and optionally at least one linker.
The portion of an immunoglobulin will have both an N, or an amino
terminus, and a C, or carboxy terminus. The chimeric protein may
have the biologically active molecule linked to the N terminus of
the portion of an immunoglobulin. Alternatively, the biologically
active molecule may be linked to the C terminus of the portion of
an immunoglobulin. In one embodiment, the linkage is a covalent
bond. In another embodiment, the linkage is a non-covalent
bond.
[0093] The chimeric protein can optionally comprise at least one
linker; thus, the biologically active molecule does not have to be
directly linked to the portion of an immunoglobulin constant
region. The linker can intervene in between the biologically active
molecule and the portion of an immunoglobulin constant region. The
linker can be linked to the N terminus of the portion of an
immunoglobulin constant region, or the C terminus of the portion of
an immunoglobulin constant region. If the biologically active
molecule is comprised of at least one amino acid the biologically
active molecule will have an N terminus and a C terminus and the
linker can be linked to the N terminus of the biologically active
molecule, or the C terminus the biologically active molecule.
[0094] The invention relates to a chimeric protein of the formula
X-L.sub.a-F:F or F:F-L.sub.a-X, wherein X is a biologically active
molecule, L is an optional linker, F is at least a portion of an
immunoglobulin constant region and, a is any integer or zero. The
invention also relates to a chimeric protein of the formula
T.sub.a-X-L.sub.a-F:F or T.sub.a-F:F-L.sub.a-X, wherein X is a
biologically active molecule, L is an optional linker, F is at
least a portion of an immunoglobulin constant region, a is any
integer or zero, T is a second linker or alternatively a tag that
can be used to facilitate purification of the chimeric protein,
e.g., a FLAG tag, a histidine tag, a GST tag, a maltose binding
protein tag and (:) represents a chemical association, e.g. at
least one non-peptide bond. In certain embodiments, the chemical
association, i.e., (:) is a covalent bond. In other embodiments,
the chemical association, i.e., (:) is a non-covalent interaction,
e.g., an ionic interaction, a hydrophobic interaction, a
hydrophilic interaction, a Van der Waals interaction, a hydrogen
bond. It will be understood by the skilled artisan that when a
equals zero X will be directly linked to F. Thus, for example, a
may be 0, 1, 2, 3, 4, 5, or more than 5.
[0095] In one embodiment, the chimeric protein of the invention
comprises the amino acid sequence of FIG. 2a (SEQ ID NO:6). In one
embodiment, the chimeric protein of the invention comprises the
amino acid sequence of FIG. 2b (SEQ ID NO:8). In one embodiment,
the chimeric protein of the invention comprises the amino acid
sequence of FIG. 2c (SEQ ID NO:10). In one embodiment, the chimeric
protein of the invention comprises the amino acid sequence of FIG.
2d (SEQ ID NO:12). In one embodiment, the chimeric protein of the
invention comprises the amino acid sequence of FIG. 2e (SEQ ID
NO:14). In one embodiment, the chimeric protein of the invention
comprises the amino acid sequence of FIG. 2f (SEQ ID NO:16). In one
embodiment, the chimeric protein of the invention comprises the
amino acid sequence of FIG. 2g (SEQ ID NO:18). In one embodiment,
the chimeric protein of the invention comprises the amino acid
sequence of FIG. 2h (SEQ ID NO:20). In one embodiment, the chimeric
protein of the invention comprises the amino acid sequence of FIG.
2i (SEQ ID NO:22). In one embodiment, the chimeric protein of the
invention comprises the amino acid sequence of FIG. 2j (SEQ ID
NO:24). In one embodiment, the chimeric protein of the invention
comprises the amino acid sequence of FIG. 17b (SEQ ID NO: 99).
[0096] 1. Chimeric Protein Variants
[0097] Derivatives of the chimeric proteins of the invention,
antibodies against the chimeric proteins of the invention and
antibodies against binding partners of the chimeric proteins of the
invention are all contemplated, and can be made by altering their
amino acids sequences by substitutions, additions, and/or
deletions/truncations or by introducing chemical modification that
result in functionally equivalent molecules. It will be understood
by one of ordinary skill in the art that certain amino acids in a
sequence of any protein may be substituted for other amino acids
without adversely affecting the activity of the protein.
[0098] Various changes may be made in the amino acid sequences of
the chimeric proteins of the invention or DNA sequences encoding
therefore without appreciable loss of their biological activity,
function, or utility. Derivatives, analogs, or mutants resulting
from such changes and the use of such derivatives is within the
scope of the present invention. In a specific embodiment, the
derivative is functionally active, i.e., capable of exhibiting one
or more activities associated with the chimeric proteins of the
invention, e.g., FcRn binding, viral inhibition, hemostasis,
production of red blood cells. Many assays capable of testing the
activity of a chimeric protein comprising a biologically active
molecule are known in the art. Where the biologically active
molecule is an HIV inhibitor, activity can be tested by measuring
reverse transcriptase activity using known methods (see, e.g.,
Barre-Sinoussi et al. 1983, Science 220:868; Gallo et al. 1984,
Science 224:500). Alternatively, activity can be measured by
measuring fusogenic activity (see, e.g., Nussbaum et al. 1994, J.
Virol. 68(9):5411). Where the biological activity is hemostasis, a
StaCLot FVIIa-rTF assay can be performed to assess activity of
Factor VIIa derivatives (Johannessen et al. 2000, Blood Coagulation
and Fibrinolysis 11: S159).
[0099] Substitutes for an amino acid within the sequence may be
selected from other members of the class to which the amino acid
belongs (see Table 1). Furthermore, various amino acids are
commonly substituted with neutral amino acids, e.g., alanine,
leucine, isoleucine, valine, proline, phenylalanine, tryptophan,
and methionine (see, e.g., MacLennan et al. 1998, Acta Physiol.
Scand. Suppl. 643:55-67; Sasaki et al. 1998, Adv. Biophys.
35:1-24).
TABLE-US-00001 TABLE 1 Original Exemplary Typical Residues
Substitutions Substitutions Ala (A) Val, Leu, Ile Val Arg (R) Lys,
Gln, Asn Lys Asn (N) Gln Gln Asp (D) Glu Glu Cys (C) Ser, Ala Ser
Gln (Q) Asn Asn Gly (G) Pro, Ala Ala His (H) Asn, Gln, Lys, Arg Arg
Ile (I) Leu, Val, Met, Ala, Leu Phe, Norleucine Leu (L) Norleucine,
Ile, Val, Ile Met, Ala, Phe Lys (K) Arg, Arg 1,4-Diamino-butyric
Acid, Gln, Asn Met (M) Leu, Phe, Ile Leu Phe (F) Leu, Val, Ile,
Ala, Tyr Leu Pro (P) Ala Gly Ser (S) Thr, Ala, Cys Thr Thr (T) Ser
Ser Trp (W) Tyr, Phe Tyr Tyr (Y) Trp, Phe, Thr, Ser Phe Val (V)
Ile, Met, Leu, Phe, Ala, Leu Norleucine
[0100] 2. Biologically Active Molecules
[0101] The invention contemplates the use of any biologically
active molecule as the therapeutic molecule of the invention. The
biologically active molecule can be a polypeptide. The biologically
active molecule can be a single amino acid. The biologically active
molecule can include a modified polypeptide.
[0102] The biologically active molecule can include a lipid
molecule (e.g a steroid or cholesterol, a fatty acid, a
triacylglycerol, glycerophospholipid, or sphingolipid). The
biologically active molecule can include a sugar molecule (e.g
glucose, sucrose, mannose). The biologically active molecule can
include a nucleic acid molecule (e.g. DNA, RNA). The biologically
active molecule can include a small organic molecule or a small
inorganic molecule.
[0103] a. Cytokines and Growth Factors
[0104] In one embodiment, the biologically active molecule is a
growth factor, hormone or cytokine or analog or fragment thereof.
The biologically active molecule can be any agent capable of
inducing cell growth and proliferation. In a specific embodiment,
the biologically active molecule is any agent which can induce
erythrocytes to proliferate. Thus, one example of a biologically
active molecule contemplated by the invention is EPO. The
biologically active molecule can also include, but is not limited
to, RANTES, MIP1.alpha., MIP1.beta., IL-2, IL-3, GM-CSF, growth
hormone, tumor necrosis factor (e.g. TNF.alpha. or .beta.).
[0105] The biologically active molecule can include interferon
.alpha., whether synthetically or recombinantly produced, including
but not limited to, any one of the about twenty-five structurally
related subtypes, as for example interferon-.alpha.2a, now
commercially available for clinical use (ROFERON.RTM., Roche) and
interferon-.alpha.2b also approved for clinical use (INTRONO,
Schering) as well as genetically engineered versions of various
subtypes, including, but not limited to, commercially available
consensus interferon .alpha. (INFERGEN.RTM., Intermune, developed
by Amgen) and consensus human leukocyte interferon see, e.g., U.S.
Pat. Nos. 4,695,623; 4,897,471, interferon .beta., epidermal growth
factor, gonadotropin releasing hormone (GnRH), leuprolide, follicle
stimulating hormone, progesterone, estrogen, or testosterone.
[0106] A list of cytokines and growth factors which may be used in
the chimeric protein of the invention has been previously described
(see, e.g., U.S. Pat. Nos. 6,086,875, 6,485,726, 6,030,613; WO
03/077834; US2003-0235536A1).
[0107] b. Antiviral Agents
[0108] In one embodiment, the biologically active molecule is an
antiviral agent, including fragments and analogs thereof. An
antiviral agent can include any molecule that inhibits or prevents
viral replication, or inhibits or prevents viral entry into a cell,
or inhibits or prevents viral egress from a cell. In one
embodiment, the antiviral agent is a fusion inhibitor. In one
embodiment, the antiviral agent is a cytokine which inhibits viral
replication. In another embodiment, the antiviral agent is
interferon .alpha..
[0109] The viral fusion inhibitor for use in the chimeric protein
can be any molecule which decreases or prevents viral penetration
of a cellular membrane of a target cell. The viral fusion inhibitor
can be any molecule that decreases or prevents the formation of
syncytia between at least two susceptible cells. The viral fusion
inhibitor can be any molecule that decreases or prevents the
joining of a lipid bilayer membrane of a eukaryotic cell and a
lipid bilayer of an enveloped virus. Examples of enveloped virus
include, but are not limited to HIV-1, HIV-2, SIV, influenza,
parainfluenza, Epstein-Barr virus, CMV, herpes simplex 1, herpes
simplex 2 and respiratory syncytia virus.
[0110] The viral fusion inhibitor can be any molecule that
decreases or prevents viral fusion including, but not limited to, a
polypeptide, a small organic molecule or a small inorganic
molecule. In one embodiment, the fusion inhibitor is a polypeptide.
In one embodiment, the viral fusion inhibitor is a polypeptide of
3-36 amino acids. In another embodiment, the viral fusion inhibitor
is a polypeptide of 3-50 amino acids, 10-65 amino acids, 10-75
amino acids. The polypeptide can be comprised of a naturally
occurring amino acid sequence (e.g. a fragment of gp41) including
analogs and mutants thereof or the polypeptide can be comprised of
an amino acid sequence not found in nature, so long as the
polypeptide exhibits viral fusion inhibitory activity.
[0111] In one embodiment, the viral fusion inhibitor is a
polypeptide, identified as being a viral fusion inhibitor using at
least one computer algorithm, e.g., ALLMOTIS, 107.times.178.times.4
and PLZIP (see, e.g., U.S. Pat. Nos. 6,013,263; 6,015,881;
6,017,536; 6,020,459; 6,060,065; 6,068,973; 6,093,799; and
6,228,983).
[0112] In one embodiment, the viral fusion inhibitor is an HIV
fusion inhibitor. In one embodiment, HIV is HIV-1. In another
embodiment, HIV is HIV-2. In one embodiment, the HIV fusion
inhibitor is a polypeptide comprised of a fragment of the gp41
envelope protein of HIV-1. The HIV fusion inhibitor can comprise,
e.g., T20 (SEQ ID NO:1) or an analog thereof, T21 (SEQ ID NO:2) or
an analog thereof, T1249 (SEQ ID NO:3) or an analog thereof,
N.sub.ccGgp41 (Louis et al. 2001, J. Biol. Chem. 276:(31)29485) or
an analog thereof, or 5 helix (Root et al. 2001, Science 291:884)
or an analog thereof.
[0113] Assays known in the art can be used to test for viral fusion
inhibiting activity of a polypeptide, a small organic molecule, or
a small inorganic molecule. These assays include a reverse
transcriptase assay, a p24 assay, or syncytia formation assay (see,
e.g., U.S. Pat. No. 5,464,933).
[0114] A list of antiviral agents which may be used in the chimeric
protein of the invention has been previously described (see, e.g.,
U.S. Pat. Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834;
US2003-0235536A1).
[0115] c. Hemostatic Agents
[0116] In one embodiment, the biologically active molecule is a
clotting factor or other agent that promotes hemostasis, including
fragments and analogs thereof. The clotting factor can include any
molecule that has clotting activity or activates a molecule with
clotting activity. The clotting factor can be comprised of a
polypeptide. The clotting factor can be, as an example, but not
limited to Factor VIII, Factor IX, Factor XI, Factor XII,
fibrinogen, prothrombin, Factor V, Factor VII, Factor X, Factor
XIII or von Willebrand Factor. In one embodiment, the clotting
factor is Factor VII or Factor VIIa. The clotting factor can be a
factor that participates in the extrinsic pathway. The clotting
factor can be a factor that participates in the intrinsic pathway.
Alternatively, the clotting factor can be a factor that
participates in both the extrinsic and intrinsic pathway.
[0117] The clotting factor can be a human clotting factor or a
non-human clotting factor, e.g., derived from a non-human primate,
a pig or any mammal. The clotting factor can be chimeric clotting
factor, e.g., the clotting factor can comprise a portion of a human
clotting factor and a portion of a porcine clotting factor or a
portion of a first non-human clotting factor and a portion of a
second non-human clotting factor.
[0118] The clotting factor can be an activated clotting factor.
Alternatively, the clotting factor can be an inactive form of a
clotting factor, e.g., a zymogen. The inactive clotting factor can
undergo activation subsequent to being linked to at least a portion
of an immunoglobulin constant region. The inactive clotting factor
can be activated subsequent to administration to a subject.
Alternatively, the inactive clotting factor can be activated prior
to administration.
[0119] In certain embodiments an endopeptidase, e.g., paired basic
amino acid cleaving enzyme (PACE), or any PACE family member, such
as PCSK1-9, including truncated versions thereof, or its yeast
equivalent Kex2 from S. cerevisiae and truncated versions of Kex2
(Kex2 1-675) (see, e.g., U.S. Pat. Nos. 5,077,204; 5,162,220;
5,234,830; 5,885,821; 6,329,176) may be used to cleave a propetide
to form the mature chimeric protein of the invention (e.g. factor
VII, factor IX).
[0120] d. Other Proteinaceous Biologically Active Molecules
[0121] In one embodiment, the biologically active molecule is a
receptor or a fragment or analog thereof. The receptor can be
expressed on a cell surface, or alternatively the receptor can be
expressed on the interior of the cell. The receptor can be a viral
receptor, e.g., CD4, CCR5, CXCR4, CD21, CD46. The biologically
active molecule can be a bacterial receptor. The biologically
active molecule can be an extra-cellular matrix protein or fragment
or analog thereof, important in bacterial colonization and
infection (see, e.g., U.S. Pat. Nos. 5,648,240; 5,189,015;
5,175,096) or a bacterial surface protein important in adhesion and
infection (see, e.g., U.S. Pat. No. 5,648,240). The biologically
active molecule can be a growth factor, hormone or cytokine
receptor, or a fragment or analog thereof, e.g., TNF.alpha.
receptor, the erythropoietin receptor, CD25, CD122, or CD132.
[0122] A list of other proteinaceous molecules which may be used in
the chimeric protein of the invention has been previously described
(see, e.g., U.S. Pat. Nos. 6,086,875; 6,485,726; 6,030,613; WO
03/077834; U52003-0235536A1).
[0123] e. Nucleic Acids
[0124] In one embodiment, the biologically active molecule is a
nucleic acid, e.g., DNA, RNA. In one specific embodiment, the
biologically active molecule is a nucleic acid that can be used in
RNA interference (RNAi). The nucleic acid molecule can be as an
example, but not as a limitation, an anti-sense molecule or a
ribozyme or an aptamer.
[0125] Antisense RNA and DNA molecules act to directly block the
translation of mRNA by hybridizing to targeted mRNA and preventing
protein translation. Antisense approaches involve the design of
oligonucleotides that are complementary to a target gene mRNA. The
antisense oligonucleotides will bind to the complementary target
gene mRNA transcripts and prevent translation. Absolute
complementarily, is not required.
[0126] A sequence "complementary" to a portion of an RNA, as
referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a
stable duplex; in the case of double-stranded antisense nucleic
acids, a single strand of the duplex DNA may thus be tested, or
triplex formation may be assayed. The ability to hybridize will
depend on both the degree of complementarity and the length of the
antisense nucleic acid. Generally, the longer the hybridizing
nucleic acid, the more base mismatches with an RNA it may contain
and still form a stable duplex (or triplex, as the case may be).
One skilled in the art can ascertain a tolerable degree of mismatch
by use of standard procedures to determine the melting point of the
hybridized complex.
[0127] Antisense nucleic acids should be at least six nucleotides
in length, and are preferably oligonucleotides ranging from 6 to
about 50 nucleotides in length. In specific aspects, the
oligonucleotide is at least 10 nucleotides, at least 17
nucleotides, at least 25 nucleotides or at least 50
nucleotides.
[0128] The oligonucleotides can be DNA or RNA or chimeric mixtures
or derivatives or modified versions thereof, single-stranded or
double-stranded. The oligonucleotide can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, etc. The
oligonucleotide may include other appended groups such as
polypeptides (e.g for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al. 1989, Proc. Natl. Acad. Sci. USA 86:6553; Lemaitre
et al. 1987, Proc. Natl. Acad. Sci. USA 84:648; WO 88/09810,) or
the blood-brain barrier (see, e.g., WO 89/10134),
hybridization-triggered cleavage agents (see, e.g., Krol et al.
1988, BioTechniques 6:958) or intercalating agents (see, e.g., Zon
1988, Pharm. Res. 5:539). To this end, the oligonucleotide may be
conjugated to another molecule, e.g., a polypeptide, hybridization
triggered cross-linking agent, transport agent, or
hybridization-triggered cleavage agent.
[0129] Ribozyme molecules designed to catalytically cleave target
gene mRNA transcripts can also be used to prevent translation of
target gene mRNA and, therefore, expression of target gene product.
(See, e.g., WO 90/11364; Sarver et al. 1990, Science 247,
1222-1225).
[0130] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. (See Rossi 1994, Current Biology
4:469). The mechanism of ribozyme action involves sequence specific
hybridization of the ribozyme molecule to complementary target RNA,
followed by an endonucleolytic cleavage event. The composition of
ribozyme molecules must include one or more sequences complementary
to the target gene mRNA, and must include the well known catalytic
sequence responsible for mRNA cleavage. For this sequence, see,
e.g., U.S. Pat. No. 5,093,246.
[0131] In one embodiment, ribozymes that cleave mRNA at site
specific recognition sequences can be used to destroy target gene
mRNAs. In another embodiment, the use of hammerhead ribozymes is
contemplated. Hammerhead ribozymes cleave mRNAs at locations
dictated by flanking regions that form complementary base pairs
with the target mRNA. The sole requirement is that the target mRNA
have the following sequence of two bases: 5'-UG-3'. The
construction and production of hammerhead ribozymes is well known
in the art and is described more fully in Myers 1995, Molecular
Biology and Biotechnology: A Comprehensive Desk Reference, VCH
Publishers, New York, and in Haseloff and Gerlach 1988, Nature,
334:585.
[0132] f. Small Molecules
[0133] The invention also contemplates the use of any therapeutic
small molecule or drug as the biologically active molecule in the
chimeric protein of the invention. A list of small molecules and
drugs which may be used in the chimeric protein of the invention
has been previously described (see, e.g., U.S. Pat. Nos. 6,086,875;
6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1).
[0134] 2. Immunoglobulins
[0135] The chimeric proteins of the invention comprise at least a
portion of an immunoglobulin constant region. Immunoglobulins are
comprised of four protein chains that associate covalently-two
heavy chains and two light chains. Each chain is further comprised
of one variable region and one constant region. Depending upon the
immunoglobulin isotype, the heavy chain constant region is
comprised of 3 or 4 constant region domains (e.g. CH1, CH2, CH3,
CH4). Some isotypes are further comprised of a hinge region.
[0136] The portion of an immunoglobulin constant region can be
obtained from any mammal. The portion of an immunoglobulin constant
region can include a portion of a human immunoglobulin constant
region, a non-human primate immunoglobulin constant region, a
bovine immunoglobulin constant region, a porcine immunoglobulin
constant region, a murine immunoglobulin constant region, an ovine
immunoglobulin constant region or a rat immunoglobulin constant
region.
[0137] The portion of an immunoglobulin constant region can be
produced recombinantly or synthetically. The immunoglobulin can be
isolated from a cDNA library. The portion of an immunoglobulin
constant region can be isolated from a phage library (See, e.g.,
McCafferty et al. 1990, Nature 348:552, Kang et al. 1991, Proc.
Natl. Acad. Sci. USA 88:4363; EP 0 589 877 B1). The portion of an
immunoglobulin constant region can be obtained by gene shuffling of
known sequences (Mark et al. 1992, Bio/Technol. 10:779). The
portion of an immunoglobulin constant region can be isolated by in
vivo recombination (Waterhouse et al. 1993, Nucl. Acid Res.
21:2265). The immunoglobulin can be a humanized immunoglobulin
(U.S. Pat. No. 5,585,089, Jones et al. 1986, Nature 332:323).
[0138] The portion of an immunoglobulin constant region can include
a portion of an IgG, an IgA, an IgM, an IgD, or an IgE. In one
embodiment, the immunoglobulin is an IgG. In another embodiment,
the immunoglobulin is IgG1. In another embodiment, the
immunoglobulin is IgG2.
[0139] The portion of an immunoglobulin constant region can include
the entire heavy chain constant region, or a fragment or analog
thereof. In one embodiment, a heavy chain constant region can
comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a hinge
region. In another embodiment, a heavy chain constant region can
comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a CH4
domain.
[0140] The portion of an immunoglobulin constant region can include
an Fc fragment. An Fc fragment can be comprised of the CH2 and CH3
domains of an immunoglobulin and the hinge region of the
immunoglobulin. The Fc fragment can be the Fc fragment of an IgG1,
an IgG2, an IgG3 or an IgG4. In one specific embodiment, the
portion of an immunoglobulin constant region is an Fc fragment of
an IgG1. In another embodiment, the portion of an immunoglobulin
constant region is an Fc fragment of an IgG2.
[0141] In another embodiment, the portion of an immunoglobulin
constant region is an Fc neonatal receptor (FcRn) binding partner.
An FcRn binding partner is any molecule that can be specifically
bound by the FcRn receptor with consequent active transport by the
FcRn receptor of the FcRn binding partner. Specifically bound
refers to two molecules forming a complex that is relatively stable
under physiologic conditions. Specific binding is characterized by
a high affinity and a low to moderate capacity as distinguished
from nonspecific binding which usually has a low affinity with a
moderate to high capacity. Typically, binding is considered
specific when the affinity constant K.sub.A is higher than 10.sup.6
M.sup.-1, or more preferably higher than 10.sup.8 M.sup.-1. If
necessary, non-specific binding can be reduced without
substantially affecting specific binding by varying the binding
conditions. The appropriate binding conditions such as
concentration of the molecules, ionic strength of the solution,
temperature, time allowed for binding, concentration of a blocking
agent (e.g serum albumin, milk casein), etc., may be optimized by a
skilled artisan using routine techniques.
[0142] The FcRn receptor has been isolated from several mammalian
species including humans. The sequences of the human FcRn, monkey
FcRn rat FcRn, and mouse FcRn are known (Story et al. 1994, J. Exp.
Med. 180:2377). The FcRn receptor binds IgG (but not other
immunoglobulin classes such as IgA, IgM, IgD, and IgE) at
relatively low pH, actively transports the IgG transcellularly in a
luminal to serosal direction, and then releases the IgG at
relatively higher pH found in the interstitial fluids. It is
expressed in adult epithelial tissue (U.S. Pat. Nos. 6,485,726,
6,030,613, 6,086,875; WO 03/077834; US2003-0235536A1) including
lung and intestinal epithelium (Israel et al. 1997, Immunology
92:69) renal proximal tubular epithelium (Kobayashi et al. 2002,
Am. J. Physiol. Renal Physiol. 282:F358) as well as nasal
epithelium, vaginal surfaces, and biliary tree surfaces.
[0143] FcRn binding partners of the present invention encompass any
molecule that can be specifically bound by the FcRn receptor
including whole IgG, the Fc fragment of IgG, and other fragments
that include the complete binding region of the FcRn receptor. The
region of the Fc portion of IgG that binds to the FcRn receptor has
been described based on X-ray crystallography (Burmeister et al.
1994, Nature 372:379). The major contact area of the Fc with the
FcRn is near the junction of the CH2 and CH3 domains. Fc-FcRn
contacts are all within a single Ig heavy chain. The FcRn binding
partners include whole IgG, the Fc fragment of IgG, and other
fragments of IgG that include the complete binding region of FcRn.
The major contact sites include amino acid residues 248, 250-257,
272, 285, 288, 290-291, 308-311, and 314 of the CH2 domain and
amino acid residues 385-387, 428, and 433-436 of the CH3 domain.
References made to amino acid numbering of immunoglobulins or
immunoglobulin fragments, or regions, are all based on Kabat et al.
1991, Sequences of Proteins of Immunological Interest, U.S.
Department of Public Health, Bethesda, Md.
[0144] The Fc region of IgG can be modified according to well
recognized procedures such as site directed mutagenesis and the
like to yield modified IgG or Fc fragments or portions thereof that
will be bound by FcRn. Such modifications include modifications
remote from the FcRn contact sites as well as modifications within
the contact sites that preserve or even enhance binding to the
FcRn. For example, the following single amino acid residues in
human IgG1 Fc (Fc.gamma.1) can be substituted without significant
loss of Fc binding affinity for FcRn: P238A, S239A, K246A, K248A,
D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A, E269A,
D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A,
N286A, T289A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A,
S298A, Y300F, R301A, V303A, V305A, T307A, L309A, Q311A, D312A,
N315A, K317A, E318A, K320A, K322A, S324A, K326A, A327Q, P329A,
A330Q, P331A, E333A, K334A, T335A, S337A, K338A, K340A, Q342A,
R344A, E345A, Q347A, R355A, E356A, M358A, T359A, K360A, N361A,
Q362A, Y373A, S375A, D376A, A378Q, E380A, E382A, S383A, N384A,
Q386A, E388A, N389A, N390A, Y391F, K392A, L398A, S400A, D401A,
D413A, K414A, R416A, Q418A, 0419A, N421A, V422A, S424A, E430A,
N434A, T437A, Q438A, K439A, S440A, S444A, and K447A, where for
example P238A represents wildtype proline substituted by alanine at
position number 238. As an example, one specific embodiment,
incorporates the N297A mutation, removing a highly conserved
N-glycosylation site. In addition to alanine other amino acids may
be substituted for the wildtype amino acids at the positions
specified above. Mutations may be introduced singly into Fc giving
rise to more than one hundred FcRn binding partners distinct from
native Fc. Additionally, combinations of two, three, or more of
these individual mutations may be introduced together, giving rise
to hundreds more FcRn binding partners. Moreover, one of the FcRn
binding partners of the monomer-dimer hybrid may be mutated and the
other FcRn binding partner not mutated at all, or they both may be
mutated but with different mutations. Any of the mutations
described herein, including N297A, may be used to modify Fc,
regardless of the biologically active molecule (e.g., EPO, IFN,
Factor IX, T20).
[0145] Certain of the above mutations may confer new functionality
upon the FcRn binding partner. For example, one embodiment
incorporates N297A, removing a highly conserved N-glycosylation
site. The effect of this mutation is to reduce immunogenicity,
thereby enhancing circulating half life of the FcRn binding
partner, and to render the FcRn binding partner incapable of
binding to Fc.gamma.RI, Fc.gamma.RIIA, Fc.gamma.RIIB, and
Fc.gamma.RIIIA, without compromising affinity for FcRn (Routledge
et al. 1995, Transplantation 60:847; Friend et al. 1999,
Transplantation 68:1632; Shields et al. 1995, J. Biol. Chem.
276:6591). As a further example of new functionality arising from
mutations described above affinity for FcRn may be increased beyond
that of wild type in some instances. This increased affinity may
reflect an increased "on" rate, a decreased "off" rate or both an
increased "on" rate and a decreased "off" rate. Mutations believed
to impart an increased affinity for FcRn include T256A, T307A,
E380A, and N434A (Shields et al. 2001, J. Biol. Chem.
276:6591).
[0146] Additionally, at least three human Fc gamma receptors appear
to recognize a binding site on IgG within the lower hinge region,
generally amino acids 234-237. Therefore, another example of new
functionality and potential decreased immunogenicity may arise from
mutations of this region, as for example by replacing amino acids
233-236 of human IgG1"ELLG" (SEQ ID NO: 84) to the corresponding
sequence from IgG2"PVA" (with one amino acid deletion). It has been
shown that Fc.gamma.RI, Fc.gamma.RII, and Fc.gamma.RIII, which
mediate various effector functions will not bind to IgG1 when such
mutations have been introduced. Ward and Ghetie 1995, Therapeutic
Immunology 2:77 and Armour et al. 1999, Eur. J. Immunol.
29:2613.
[0147] In one embodiment, the FcRn binding partner is a polypeptide
including the sequence PKNSSMISNTP (SEQ ID NO:26) and optionally
further including a sequence selected from HQSLGTQ (SEQ ID NO:27),
HQNLSDGK (SEQ ID NO:28), HQNISDGK (SEQ ID NO:29), or VISSHLGQ (SEQ
ID NO:30) (U.S. Pat. No. 5,739,277).
[0148] Two FcRn receptors can bind a single Fc molecule.
Crystallographic data suggest that each FcRn molecule binds a
single polypeptide of the Fc homodimer. In one embodiment, linking
the FcRn binding partner, e.g., an Fc fragment of an IgG, to a
biologically active molecule provides a means of delivering the
biologically active molecule orally, buccally, sublingually,
rectally, vaginally, as an aerosol administered nasally or via a
pulmonary route, or via an ocular route. In another embodiment, the
chimeric protein can be administered invasively, e.g.,
subcutaneously, intravenously.
[0149] The skilled artisan will understand that portions of an
immunoglobulin constant region for use in the chimeric protein of
the invention can include mutants or analogs thereof, or can
include chemically modified immunoglobulin constant regions (e.g.
pegylated), or fragments thereof (see, e.g., Aslam and Dent 1998,
Bioconjugation: Protein Coupling Techniques For the Biomedical
Sciences Macmilan Reference, London). In one instance, a mutant can
provide for enhanced binding of an FcRn binding partner for the
FcRn. Also contemplated for use in the chimeric protein of the
invention are peptide mimetics of at least a portion of an
immunoglobulin constant region, e.g., a peptide mimetic of an Fc
fragment or a peptide mimetic of an FcRn binding partner. In one
embodiment, the peptide mimetic is identified using phage display
or via chemical library screening (see, e.g., McCafferty et al.
1990, Nature 348:552, Kang et al. 1991, Proc. Natl. Acad Sci. USA
88:4363; EP 0 589 877 B 1).
[0150] 3. Optional Linkers
[0151] The chimeric protein of the invention can optionally
comprise at least one linker molecule. The linker can be comprised
of any organic molecule. In one embodiment, the linker is
polyethylene glycol (PEG). In another embodiment, the linker is
comprised of amino acids. The linker can comprise 1-5 amino acids,
1-10 amino acids, 1-20 amino acids, 10-50 amino acids, 50-100 amino
acids, 100-200 amino acids. In one embodiment, the linker is the
eight amino acid linker EFAGAAAV (SEQ ID NO:31). Any of the linkers
described herein may be used in the chimeric protein of the
invention, e.g., a monomer-dimer hybrid, including EFAGAAAV (SEQ ID
NO: 31), regardless of the biologically active molecule (e.g. EPO,
IFN, Factor IX).
[0152] The linker can comprise the sequence G.sub.n (SEQ ID NO:
85). The linker can comprise the sequence (GA).sub.n (SEQ ID
NO:32). The linker can comprise the sequence (GGS).sub.n (SEQ ID
NO:33). The linker can comprise the sequence
(GGS).sub.n(GGGGS).sub.n (SEQ ID NO:34). In these instances, n may
be an integer from 1-10, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.
Examples of linkers include, but are not limited to, GGG (SEQ ID
NO:35), SGGSGGS (SEQ ID NO:36), GGSGGSGGSGGSGGG (SEQ ID NO:37),
GGSGGSGGGGSGGGGS (SEQ ID NO:38), GGSGGSGGSGGSGGSGGS (SEQ ID NO:39).
The linker does not eliminate or diminish the biological activity
of the chimeric protein. Optionally, the linker enhances the
biological activity of the chimeric protein, e.g., by further
diminishing the effects of steric hindrance and making the
biologically active molecule more accessible to its target binding
site.
[0153] In one specific embodiment, the linker for interferon
.alpha. is 15-25 amino acids long. In another specific embodiment,
the linker for interferon .alpha. is 15-20 amino acids long. In
another specific embodiment, the linker for interferon .alpha. is
10-25 amino acids long. In another specific embodiment, the linker
for interferon .alpha. is 15 amino acids long. In one embodiment,
the linker for interferon .alpha. is (GGGGS).sub.n (SEQ ID NO:40)
where G represents glycine, S represents serine and n is an integer
from 1-10. In a specific embodiment, n is 3 (SEQ ID NO: 60).
[0154] The linker may also incorporate a moiety capable of being
cleaved either chemically (e.g. hydrolysis of an ester bond),
enzymatically (i.e. incorporation of a protease cleavage sequence)
or photolytically (e.g.,a chromophore such as
3-amino-3-(2-nitrophenyl) proprionic acid (ANP)) in order to
release the biologically active molecule from the Fc protein.
[0155] 4. Chimeric Protein Dimerization Using Specific Binding
Partners
[0156] In one embodiment, the chimeric protein of the invention
comprises a first polypeptide chain comprising at least a first
domain, said first domain having at least one specific binding
partner, and a second polypeptide chain comprising at least a
second domain, wherein said second domain, is a specific binding
partner of said first domain. The chimeric protein thus comprises a
polypeptide capable of dimerizing with another polypeptide due to
the interaction of the first domain and the second domain. Methods
of dimerizing antibodies using heterologous domains are known in
the art (U.S. Pat. Nos. 5,807,706 and 5,910,573; Kostelny et al.
1992, J. Immunol. 148(5):1547).
[0157] Dimerization can occur by formation of a covalent bond, or
alternatively a non-covalent bond, e.g., hydrophobic interaction,
Van der Waal's forces, interdigitation of amphiphilic peptides such
as, but not limited to, alpha helices, charge-charge interactions
of amino acids bearing opposite charges, such as, but not limited
to, lysine and aspartic acid, arginine and glutamic acid. In one
embodiment, the domain is a helix bundle comprising a helix, a turn
and another helix. In another embodiment, the domain is a leucine
zipper comprising a peptide having several repeating amino acids in
which every seventh amino acid is a leucine residue. In one
embodiment, the specific binding partners are fos/jun. (see Branden
et al. 1991, Introduction To Protein Structure, Garland Publishing,
New York).
[0158] In another embodiment, binding is mediated by a chemical
linkage (see, e.g., Brennan et al. 1985, Science 229:81). In this
embodiment, intact immunoglobulins, or chimeric proteins comprised
of at least a portion of an immunoglobulin constant region are
cleaved to generate heavy chain fragments. These fragments are
reduced in the presence of the dithiol complexing agent sodium
arsenite to stabilize vicinal dithiols and prevent intermolecular
disulfide formation. The fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the TNB derivatives is
then reconverted to the heavy chain fragment thiol by reduction
with mercaptoethylamine and is then mixed with an equimolar amount
of the other TNB derivative to form a chimeric dimer.
D. Nucleic Acids
[0159] The invention relates to a first nucleic acid construct and
a second nucleic acid construct each comprising a nucleic acid
sequence encoding at least a portion of the chimeric protein of the
invention. In one embodiment, the first nucleic acid construct
comprises a nucleic acid sequence encoding a portion of an
immunoglobulin constant region operatively linked to a second DNA
sequence encoding a biologically active molecule, and said second
DNA construct comprises a DNA sequence encoding an immunoglobulin
constant region without the second DNA sequence encoding a
biologically active molecule.
[0160] The biologically active molecule can include, for example,
but not as a limitation, a viral fusion inhibitor, a clotting
factor, a growth factor or hormone, or a receptor, or analog, or
fragment of any of the preceding. The nucleic acid sequences can
also include additional sequences or elements known in the art
(e.g., promoters, enhancers, poly A sequences, affinity tags). In
one embodiment, the nucleic acid sequence of the second construct
can optionally include a nucleic acid sequence encoding a linker
placed between the nucleic acid sequence encoding the biologically
active molecule and the portion of the immunoglobulin constant
region. The nucleic acid sequence of the second DNA construct can
optionally include a linker sequence placed before or after the
nucleic acid sequence encoding the biologically active molecule
and/or the portion of the immunoglobulin constant region.
[0161] In one embodiment, the nucleic acid construct is comprised
of DNA. In another embodiment, the nucleic acid construct is
comprised of RNA. The nucleic acid construct can be a vector, e.g.,
a viral vector or a plasmid. Examples of viral vectors include, but
are not limited to adeno virus vector, an adeno associated virus
vector or a murine leukemia virus vector. Examples of plasmids
include but are not limited to pUC, pGEM and pGEX.
[0162] In one embodiment, the nucleic acid construct comprises the
nucleic acid sequence of FIG. 3a (SEQ ID NO:7). In one embodiment,
the nucleic acid construct comprises the nucleic acid sequence of
FIG. 3b (SEQ ID NO:9). In one embodiment, the nucleic acid
construct comprises the nucleic acid sequence of FIG. 3c (SEQ ID
NO:11). In one embodiment, the nucleic acid construct comprises the
nucleic acid sequence of FIG. 3d (SEQ ID NO:13). In one embodiment,
the nucleic acid construct comprises the nucleic acid sequence of
FIG. 3e (SEQ ID NO:15). In one embodiment, the nucleic acid
construct comprises the nucleic acid sequence of FIG. 3f (SEQ ID
NO:17). In one embodiment, the nucleic acid construct comprises the
nucleic acid sequence of FIG. 3g (SEQ ID NO:19). In one embodiment,
the nucleic acid construct comprises the nucleic acid sequence of
FIG. 3h (SEQ ID NO:21). In one embodiment, the nucleic acid
construct comprises the nucleic acid sequence of FIG. 3i (SEQ ID
NO:23). In one embodiment, the nucleic acid construct comprises the
nucleic acid sequence of FIG. 3j (SEQ ID NO:25). In one embodiment,
the nucleic acid construct comprises the nucleic acid sequence of
FIG. 17a (SEQ ID NO: 98).
[0163] Due to the known degeneracy of the genetic code, wherein
more than one codon can encode the same amino acid, a DNA sequence
can vary from that shown in SEQ ID NOS:7, 9, 11, 13, 15, 17, 19,
21, 23, 25 or 98 and still encode a polypeptide having the
corresponding amino acid sequence of SEQ ID NOS:6, 8, 10, 12, 14,
16, 18, 20, 22, 24 or 99 respectively. Such variant DNA sequences
can result from silent mutations (e.g occurring during PCR
amplification), or can be the product of deliberate mutagenesis of
a native sequence. The invention thus provides isolated DNA
sequences encoding polypeptides of the invention, chosen from: (a)
DNA comprising the nucleotide sequence of SEQ ID NOS:7, 9, 11, 13,
15, 17, 19, 21, 23, 25 or 98; (b) DNA encoding the polypeptides of
SEQ ID NOS:6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 99; (c) DNA
capable of hybridization to a DNA of (a) or (b) under conditions of
moderate stringency and which encodes polypeptides of the
invention; (d) DNA capable of hybridization to a DNA of (a) or (b)
under conditions of high stringency and which encodes polypeptides
of the invention, and (e) DNA which is degenerate as a result of
the genetic code to a DNA defined in (a), (b), (c), or (d) and
which encode polypeptides of the invention. Of course, polypeptides
encoded by such DNA sequences are encompassed by the invention.
[0164] In another embodiment, the nucleic acid molecules comprising
a sequence encoding the chimeric protein of the invention can also
comprise nucleotide sequences that are at least 80% identical to a
native sequence. Also contemplated are embodiments in which a
nucleic acid molecules comprising a sequence encoding the chimeric
protein of the invention comprises a sequence that is at least 90%
identical, at least 95% identical, at least 98% identical, at least
99% identical, or at least 99.9% identical to a native sequence. A
native sequence can include any DNA sequence not altered by the
human hand. The percent identity may be determined by visual
inspection and mathematical calculation. Alternatively, the percent
identity of two nucleic acid sequences can be determined by
comparing sequence information using the GAP computer program,
version 6.0 described by Devereux et al. 1984, Nucl. Acids Res.
12:387, and available from the University of Wisconsin Genetics
Computer Group (UWGCG). The preferred default parameters for the
GAP program include: (1) a unary comparison matrix (containing a
value of 1 for identities and 0 for non identities) for
nucleotides, and the weighted comparison matrix of Gribskov and
Burgess 1986, Nucl. Acids Res. 14:6745, as described by Schwartz
and Dayhoff, eds. 1979, Atlas of Protein Sequence and Structure,
National Biomedical Research Foundation, pp. 353-358; (2) a penalty
of 3.0 for each gap and an additional 0.10 penalty for each symbol
in each gap; and (3) no penalty for end gaps. Other programs used
by one skilled in the art of sequence comparison may also be
used.
E. Synthesis of Chimeric Proteins
[0165] Chimeric proteins comprising at least a portion of an
immunoglobulin constant region and a biologically active molecule
can be synthesized using techniques well known in the art. For
example, the chimeric proteins of the invention can be synthesized
recombinantly in cells (see, e.g., Sambrook et al. 1989, Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.
and Ausubel et al. 1989, Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, N.Y.).
Alternatively, the chimeric proteins of the invention can be
synthesized using known synthetic methods such as solid phase
synthesis. Synthetic techniques are well known in the art (see,
e.g., Merrifield, 1973, Chemical Polypeptides, (Katsoyannis and
Panayotis eds.) pp. 335-61; Merrifield 1963, J. Am. Chem. Soc.
85:2149; Davis et al. 1985, Biochem. Intl. 10:394; Finn et al.
1976, The Proteins (3d ed.) 2:105; Erikson et al. 1976, The
Proteins (3d ed.) 2:257; U.S. Pat. No. 3,941,763. Alternatively,
the chimeric proteins of the invention can be synthesized using a
combination of recombinant and synthetic methods. In certain
applications, it may be beneficial to use either a recombinant
method or a combination of recombinant and synthetic methods.
[0166] Nucleic acids encoding a biologically active molecule can be
readily synthesized using recombinant techniques well known in the
art. Alternatively, the peptides themselves can be chemically
synthesized. Nucleic acids of the invention may be synthesized by
standard methods known in the art, e.g., by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
1988, Nucl. Acids Res. 16:3209, methylphosphonate oligonucleotides
can be prepared by use of controlled pore glass polymer supports as
described in Sarin et al. 1988, Proc. Natl. Acad Sci. USA 85:7448.
Additional methods of nucleic acid synthesis are known in the art.
(see, e.g., U.S. Pat. Nos. 6,015,881; 6,281,331; 6,469,136).
[0167] DNA sequences encoding immunoglobulin constant regions, or
fragments thereof, may be cloned from a variety of genomic or cDNA
libraries known in the art. The techniques for isolating such DNA
sequences using probe-based methods are conventional techniques and
are well known to those skilled in the art. Probes for isolating
such DNA sequences may be based on published DNA sequences (see,
for example, Hieter et al. 1980, Cell 22:197-207). The polymerase
chain reaction (PCR) method disclosed by Mullis et al. (U.S. Pat.
No. 4,683,195) and Mullis (U.S. Pat. No. 4,683,202) may be used.
The choice of library and selection of probes for the isolation of
such DNA sequences is within the level of ordinary skill in the
art. Alternatively, DNA sequences encoding immunoglobulins or
fragments thereof can be obtained from vectors known in the art to
contain immunoglobulins or fragments thereof.
[0168] For recombinant production, a first polynucleotide sequence
encoding a portion of the chimeric protein of the invention (e.g a
portion of an immunoglobulin constant region) and a second
polynucleotide sequence encoding a portion of the chimeric protein
of the invention (e.g. a portion of an immunoglobulin constant
region and a biologically active molecule) are inserted into
appropriate expression vehicles, i.e. vectors which contains the
necessary elements for the transcription and translation of the
inserted coding sequence, or in the case of an RNA viral vector,
the necessary elements for replication and translation. The nucleic
acids encoding the chimeric protein are inserted into the vector in
proper reading frame.
[0169] The expression vehicles are then transfected or
co-transfected into a suitable target cell, which will express the
polypeptides. Transfection techniques known in the art include, but
are not limited to, calcium phosphate precipitation (Wigler et al.
1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO,
J. 1:841), and liposome based reagents. A variety of
host-expression vector systems may be utilized to express the
chimeric proteins described herein including both prokaryotic or
eukaryotic cells. These include, but are not limited to,
microorganisms such as bacteria (e.g. E. coli) transformed with
recombinant bacteriophage DNA or plasmid DNA expression vectors
containing an appropriate coding sequence; yeast or filamentous
fungi transformed with recombinant yeast or fungi expression
vectors containing an appropriate coding sequence; insect cell
systems infected with recombinant virus expression vectors (e.g.
baculovirus) containing an appropriate coding sequence; plant cell
systems infected with recombinant virus expression vectors (e.g
cauliflower mosaic virus or tobacco mosaic virus) or transformed
with recombinant plasmid expression vectors (e.g Ti plasmid)
containing an appropriate coding sequence; or animal cell systems,
including mammalian cells (e.g. CHO, Cos, HeLa cells).
[0170] When the chimeric protein of the invention is recombinantly
synthesized in a prokaryotic cell it may be desirable to refold the
chimeric protein. The chimeric protein produced by this method can
be refolded to a biologically active conformation using conditions
known in the art, e.g., denaturing under reducing conditions and
then dialyzed slowly into PBS.
[0171] Depending on the expression system used, the expressed
chimeric protein is then isolated by procedures well-established in
the art (e.g affinity chromatography, size exclusion
chromatography, ion exchange chromatography).
[0172] The expression vectors can encode for tags that permit for
easy purification of the recombinantly produced chimeric protein.
Examples include, but are not limited to vector pUR278 (Ruther et
al. 1983, EMBO J. 2:1791) in which the chimeric protein described
herein coding sequences may be ligated into the vector in frame
with the lac z coding region so that a hybrid protein is produced;
pGEX vectors may be used to express chimeric proteins of the
invention with a glutathione S-transferase (GST) tag. These
proteins are usually soluble and can easily be purified from cells
by adsorption to glutathione-agarose beads followed by elution in
the presence of free glutathione. The vectors include cleavage
sites (thrombin or Factor Xa protease or PreScission Protease.TM.
(Pharmacia, Peapack, N.J.)) for easy removal of the tag after
purification.
[0173] To increase efficiency of production, the polynucleotides
can be designed to encode multiple units of the chimeric protein of
the invention separated by enzymatic cleavage sites. The resulting
polypeptide can be cleaved (e.g. by treatment with the appropriate
enzyme) in order to recover the polypeptide units. This can
increase the yield of polypeptides driven by a single promoter.
When used in appropriate viral expression systems, the translation
of each polypeptide encoded by the mRNA is directed internally in
the transcript; e.g., by an internal ribosome entry site, IRES.
Thus, the polycistronic construct directs the transcription of a
single, large polycistronic mRNA which, in turn, directs the
translation of multiple, individual polypeptides. This approach
eliminates the production and enzymatic processing of polyproteins
and may significantly increase yield of polypeptide driven by a
single promoter.
[0174] Vectors used in transformation will usually contain a
selectable marker used to identify transformants. In bacterial
systems, this can include an antibiotic resistance gene such as
ampicillin or kanamycin. Selectable markers for use in cultured
mammalian cells include genes that confer resistance to drugs, such
as neomycin, hygromycin, and methotrexate. The selectable marker
may be an amplifiable selectable marker. One amplifiable selectable
marker is the DHFR gene. Another amplifiable marker is the DHFR
cDNA (Simonsen and Levinson 1983, Proc. Natl. Acad. Sci. USA
80:2495). Selectable markers are reviewed by Thilly (Mammalian Cell
Technology, Butterworth Publishers, Stoneham, Mass.) and the choice
of selectable markers is well within the level of ordinary skill in
the art.
[0175] Selectable markers may be introduced into the cell on a
separate plasmid at the same time as the gene of interest, or they
may be introduced on the same plasmid. If on the same plasmid, the
selectable marker and the gene of interest may be under the control
of different promoters or the same promoter, the latter arrangement
producing a dicistronic message. Constructs of this type are known
in the art (for example, U.S. Pat. No. 4,713,339).
[0176] The expression elements of the expression systems vary in
their strength and specificities. Depending on the host/vector
system utilized, any of a number of suitable transcription and
translation elements, including constitutive and inducible
promoters, may be used in the expression vector. For example, when
cloning in bacterial systems, inducible promoters such as pL of
bacteriophage .lamda., plac, ptrp, ptac (ptrp-lac hybrid promoter)
and the like may be used; when cloning in insect cell systems,
promoters such as the baculovirus polyhedron promoter may be used;
when cloning in plant cell systems, promoters derived from the
genome of plant cells (e.g. heat shock promoters; the promoter for
the small subunit of RUBISCO; the promoter for the chlorophyll a/b
binding protein) or from plant viruses (e.g. the 35S RNA promoter
of CaMV; the coat protein promoter of TMV) may be used; when
cloning in mammalian cell systems, promoters derived from the
genome of mammalian cells (e.g. metallothionein promoter) or from
mammalian viruses (e.g. the adenovirus late promoter; the vaccinia
virus 7.5 K promoter) may be used; when generating cell lines that
contain multiple copies of expression product, SV40-, BPV- and
EBV-based vectors may be used with an appropriate selectable
marker.
[0177] In cases where plant expression vectors are used, the
expression of sequences encoding linear or non-cyclized forms of
the chimeric proteins of the invention may be driven by any of a
number of promoters. For example, viral promoters such as the 35S
RNA and 19S RNA promoters of CaMV (Brisson et al. 1984, Nature
310:511-514), or the coat protein promoter of TMV (Takamatsu et al.
1987, EMBO J. 6:307-311) may be used; alternatively, plant
promoters such as the small subunit of RUBISCO (Coruzzi et al.
1984, EMBO J. 3:1671-1680; Broglie et al. 1984, Science
224:838-843) or heat shock promoters, e.g., soybean hsp17.5-E or
hsp17.3-B (Gurley et al. 1986, Mol. Cell. Biol. 6:559-565) may be
used. These constructs can be introduced into plant cells using Ti
plasmids, Ri plasmids, plant virus vectors, direct DNA
transformation, microinjection, electroporation, etc. For reviews
of such techniques see, e.g., Weissbach & Weissbach 1988,
Methods for Plant Molecular Biology, Academic Press, NY, Section
VIII, pp. 421-463; and Grierson & Corey 1988, Plant Molecular
Biology, 2d Ed., Blackie, London, Ch. 7-9.
[0178] In one insect expression system that may be used to produce
the chimeric proteins of the invention, Autographa califomica
nuclear polyhidrosis virus (AcNPV) is used as a vector to express
the foreign genes. The virus grows in Spodoptera frugiperda cells.
A coding sequence may be cloned into non-essential regions (for
example, the polyhedron gene) of the virus and placed under control
of an AcNPV promoter (for example, the polyhedron promoter).
Successful insertion of a coding sequence will result in
inactivation of the polyhedron gene and production of non-occluded
recombinant virus (i.e. virus lacking the proteinaceous coat coded
for by the polyhedron gene). These recombinant viruses are then
used to infect Spodoptera frupperda cells in which the inserted
gene is expressed. (see, e.g., Smith et al. 1983, J. Virol. 46:584;
U.S. Pat. No. 4,215,051). Further examples of this expression
system may be found in Ausubel et al., eds. 1989, Current Protocols
in Molecular Biology, Vol. 2, Greene Publish. Assoc. & Wiley
Interscience.
[0179] Another system which can be used to express the chimeric
proteins of the invention is the glutamine synthetase gene
expression system, also referred to as the "GS expression system"
(Lonza Biologics PLC, Berkshire UK). This expression system is
described in detail in U.S. Pat. No. 5,981,216.
[0180] In mammalian host cells, a number of viral based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, a coding sequence may be ligated to an
adenovirus transcription/translation control complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or in
vivo recombination. Insertion in a non-essential region of the
viral genome (e.g. region E1 or E3) will result in a recombinant
virus that is viable and capable of expressing peptide in infected
hosts (see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci.
USA 81:3655). Alternatively, the vaccinia 7.5 K promoter may be
used (see, e.g., Mackett et al. 1982, Proc. Natl. Acad. Sci. USA
79:7415; Mackett et al. 1984, J. Virol. 49:857; Panicali et al.
1982, Proc. Natl. Acad. Sci. USA 79:4927).
[0181] In cases where an adenovirus is used as an expression
vector, a coding sequence may be ligated to an adenovirus
transcription/translation control complex, e.g., the late promoter
and tripartite leader sequence. This chimeric gene may then be
inserted in the adenovirus genome by in vitro or in vivo
recombination. Insertion in a non-essential region of the viral
genome (e.g. region E1 or E3) will result in a recombinant virus
that is viable and capable of expressing peptide in infected hosts
(see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci. USA
81:3655). Alternatively, the vaccinia 7.5 K promoter may be used
(see, e.g., Mackett et al. 1982, Proc. Natl. Acad Sci. USA 79:7415;
Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc.
Natl. Acad. Sci. USA 79:4927).
[0182] Host cells containing DNA constructs of the chimeric protein
are grown in an appropriate growth medium. As used herein, the term
"appropriate growth medium" means a medium containing nutrients
required for the growth of cells. Nutrients required for cell
growth may include a carbon source, a nitrogen source, essential
amino acids, vitamins, minerals and growth factors. Optionally the
media can contain bovine calf serum or fetal calf serum. In one
embodiment, the media contains substantially no IgG. The growth
medium will generally select for cells containing the DNA construct
by, for example, drug selection or deficiency in an essential
nutrient which is complemented by the selectable marker on the DNA
construct or co-transfected with the DNA construct. Cultured
mammalian cells are generally grown in commercially available
serum-containing or serum-free media (e.g. MEM, DMEM). Selection of
a medium appropriate for the particular cell line used is within
the level of ordinary skill in the art.
[0183] The recombinantly produced chimeric protein of the invention
can be isolated from the culture media. The culture medium from
appropriately grown transformed or transfected host cells is
separated from the cell material, and the presence of chimeric
proteins is demonstrated. One method of detecting the chimeric
proteins, for example, is by the binding of the chimeric proteins
or portions of the chimeric proteins to a specific antibody
recognizing the chimeric protein of the invention. An anti-chimeric
protein antibody may be a monoclonal or polyclonal antibody raised
against the chimeric protein in question. For example, the chimeric
protein contains at least a portion of an immunoglobulin constant
region. Antibodies recognizing the constant region of many
immunoglobulins are known in the art and are commercially
available. An antibody can be used to perform an ELISA or a western
blot to detect the presence of the chimeric protein of the
invention.
[0184] The chimeric protein of the invention can be synthesized in
a transgenic animal, such as a rodent, cow, pig, sheep, or goat.
The term "transgenic animals" refers to non-human animals that have
incorporated a foreign gene into their genome. Because this gene is
present in germline tissues, it is passed from parent to offspring.
Exogenous genes are introduced into single-celled embryos (Brinster
et al. 1985, Proc. Natl. Acad. Sci. USA 82:4438). Methods of
producing transgenic animals are known in the art, including
transgenics that produce immunoglobulin molecules (Wagner et al.
1981, Proc. Natl. Acad. Sci. USA 78:6376; McKnight et al. 1983,
Cell 34:335; Brinster et al. 1983, Nature 306:332; Ritchie et al.
1984, Nature 312:517; Baldassarre et al. 2003, Theriogenology
59:831; Robl et al. 2003, Theriogenology 59:107; Malassagne et al.
2003, Xenotransplantation 10(3):267).
[0185] The chimeric protein of the invention can also be produced
by a combination of synthetic chemistry and recombinant techniques.
For example, the portion of an immunoglobulin constant region can
be expressed recombinantly as described above. The biologically
active molecule, can be produced using known chemical synthesis
techniques (e.g. solid phase synthesis).
[0186] The portion of an immunoglobulin constant region can be
ligated to the biologically active molecule using appropriate
ligation chemistry and then combined with a portion of an
immunoglobulin constant region that has not been ligated to a
biologically active molecule to form the chimeric protein of the
invention. In one embodiment, the portion of an immunoglobulin
constant region is an Fc fragment. The Fc fragment can be
recombinantly produced to form Cys-Fc and reacted with a
biologically active molecule expressing a thioester to make a
monomer-dimer hybrid. In another embodiment, an Fc-thioester is
made and reacted with a biologically active molecule expressing an
N terminus Cysteine (FIG. 4).
[0187] In one embodiment, the portion of an immunoglobulin constant
region ligated to the biologically active molecule will form
homodimers. The homodimers can be disrupted by exposing the
homodimers to denaturing and reducing conditions (e.g.
beta-mercaptoethanol and 8M urea) and then subsequently combined
with a portion of an immunoglobulin constant region not linked to a
biologically active molecule to form monomer-dimer hybrids. The
monomer-dimer hybrids are then renatured and refolded by dialyzing
into PBS and isolated, e.g., by size exclusion or affinity
chromatography.
[0188] In another embodiment, the portion of an immunoglobulin
constant region will form homodimers before being linked to a
biologically active molecule. In this embodiment, reaction
conditions for linking the biologically active molecule to the
homodimer can be adjusted such that linkage of the biologically
active molecule to only one chain of the homodimer is favored (e.g.
by adjusting the molar equivalents of each reactant).
[0189] The biologically active molecule can be chemically
synthesized with an N terminal cysteine. The sequence encoding a
portion of an immunoglobulin constant region can be sub-cloned into
a vector encoding intein linked to a chitin binding domain (New
England Biolabs, Beverly, Mass.). The intein can be linked to the C
terminus of the portion of an immunoglobulin constant region. In
one embodiment, the portion of the immunoglobulin with the intein
linked to its C terminus can be expressed in a prokaryotic cell. In
another embodiment, the portion of the immunoglobulin with the
intein linked to its C terminus can be expressed in a eukaryotic
cell. The portion of immunoglobulin constant region linked to
intein can be reacted with MESNA. In one embodiment, the portion of
an immunoglobulin constant region linked to intein is bound to a
column, e.g., a chitin column and then eluted with MESNA. The
biologically active molecule and portion of an immunoglobulin can
be reacted together such that nucleophilic rearrangement occurs and
the biologically active molecule is covalently linked to the
portion of an immunoglobulin via an amide bond. (Dawsen et al.
2000, Annu. Rev. Biochem. 69:923). The chimeric protein synthesized
this way can optionally include a linker peptide between the
portion of an immunoglobulin and the biologically active molecule.
The linker can for example be synthesized on the N terminus of the
biologically active molecule. Linkers can include peptides and/or
organic molecules (e.g. polyethylene glycol and/or short amino acid
sequences). This combined recombinant and chemical synthesis allows
for the rapid screening of biologically active molecules and
linkers to optimize desired properties of the chimeric protein of
the invention, e.g., viral inhibition, hemostasis, production of
red blood cells, biological half-life, stability, binding to serum
proteins or some other property of the chimeric protein. The method
also allows for the incorporation of non-natural amino acids into
the chimeric protein of the invention which may be useful for
optimizing a desired property of the chimeric protein of the
invention. If desired, the chimeric protein produced by this method
can be refolded to a biologically active conformation using
conditions known in the art, e.g, reducing conditions and then
dialyzed slowly into PBS.
[0190] Alternatively, the N-terminal cysteine can be on the portion
of an immunoglobulin constant region, e.g., an Fc fragment. An Fc
fragment can be generated with an N-terminal cysteine by taking
advantage of the fact that a native Fc has a cysteine at position
226 (see Kabat et al. 1991, Sequences of Proteins of Immunological
Interest, U.S. Department of Public Health, Bethesda, Md.).
[0191] To expose a terminal cysteine, an Fc fragment can be
recombinantly expressed. In one embodiment, the Fc fragment is
expressed in a prokaryotic cell, e.g., E. coli. The sequence
encoding the Fc portion beginning with Cys 226 (EU numbering) can
be placed immediately following a sequence endcoding a signal
peptide, e.g., OmpA, PhoA, STII. The prokaryotic cell can be
osmotically shocked to release the recombinant Fc fragment. In
another embodiment, the Fc fragment is produced in a eukaryotic
cell, e.g., a CHO cell, a BHK cell. The sequence encoding the Fc
portion fragment can be placed directly following a sequence
encoding a signal peptide, e.g., mouse Igk light chain or MHC class
I Kb signal sequence, such that when the recombinant chimeric
protein is synthesized by a eukaryotic cell, the signal sequence
will be cleaved, leaving an N terminal cysteine which can than be
isolated and chemically reacted with a molecule bearing a thioester
(e.g. a C terminal thioester if the molecule is comprised of amino
acids).
[0192] The N terminal cysteine on an Fc fragment can also be
generated using an enzyme that cleaves its substrate at its N
terminus, e.g., Factor X.sup.a, enterokinase, and the product
isolated and reacted with a molecule with a thioester.
[0193] The recombinantly expressed Fc fragment can be used to make
homodimers or monomer-dimer hybrids.
[0194] In a specific embodiment, an Fc fragment is expressed with
the human a interferon signal peptide adjacent to the Cys at
position 226. When a construct encoding this polypeptide is
expressed in CHO cells, the CHO cells cleave the signal peptide at
two distinct positions (at Cys 226 and at Val within the signal
peptide 2 amino acids upstream in the N terminus direction). This
generates a mixture of two species of Fc fragments (one with an
N-terminal Val and one with an N-terminal Cys). This in turn
results in a mixture of dimeric species (homodimers with terminal
Val, homodimers with terminal Cys and heterodimers where one chain
has a terminal Cys and the other chain has a terminal Val). The Fc
fragments can be reacted with a biologically active molecule having
a C terminal thioester and the resulting monomer-dimer hybrid can
be isolated from the mixture (e.g by size exclusion
chromatography). It is contemplated that when other signal peptide
sequences are used for expression of Fc fragments in CHO cells a
mixture of species of Fc fragments with at least two different N
termini will be generated.
[0195] In another embodiment, a recombinantly produced Cys-Fc can
form a homodimer. The homodimer can be reacted with peptide that
has a branched linker on the C terminus, wherein the branched
linker has two C terminal thioesters that can be reacted with the
Cys-Fc. In another embodiment, the biologically active molecule has
a single non-terminal thioester that can be reacted with Cys-Fc.
Alternatively, the branched linker can have two C terminal
cysteines that can be reacted with an Fc thioester. In another
embodiment, the branched linker has two functional groups that can
be reacted with the Fc thioester, e.g., 2-mercaptoamine. The
biologically active molecule may be comprised of amino acids. The
biologically active molecule may include a small organic molecule
or a small inorganic molecule.
F. Methods of Using Chimeric Proteins
[0196] The chimeric proteins of the invention have many uses as
will be recognized by one skilled in the art, including, but not
limited to methods of treating a subject with a disease or
condition. The disease or condition can include, but is not limited
to, a viral infection, a hemostatic disorder, anemia, cancer,
leukemia, an inflammatory condition or an autoimmune disease (e.g.
arthritis, psoriasis, lupus erythematosus, multiple sclerosis), or
a bacterial infection (see, e.g., U.S. Pat. Nos. 6,086,875,
6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1).
[0197] 1. Methods of Treating a Subject With a Red Blood Cell
Deficiency
[0198] The invention relates to a method of treating a subject
having a deficiency of red blood cells, e.g., anemia, comprising
administering a therapeutically effective amount of at least one
chimeric protein, wherein the chimeric protein comprises a first
and a second polypeptide chain, wherein the first chain comprises
at least a portion of an immunoglobulin constant region and at
least one agent capable of inducing proliferation of red blood
cells, e.g., EPO, and the second polypeptide chain comprises at
least a portion of an immunoglobulin without the agent capable of
inducing red blood cell proliferation of the first chain.
[0199] 2. Methods of Treating a Subject With a Viral Infection
[0200] The invention relates to a method of treating a subject
having a viral infection or exposed to a virus comprising
administering a therapeutically effective amount of at least one
chimeric protein, wherein the chimeric protein comprises a first
and a second polypeptide chain, wherein the first chain comprises
at least a portion of an immunoglobulin constant region and at
least one antiviral agent, e.g., a fusion inhibitor or interferon a
and the second polypeptide chain comprises at least a portion of an
immunoglobulin without the antiviral agent of the first chain. In
one embodiment, the subject is infected with a virus which can be
treated with IFN.alpha., e.g., hepatitis C virus. In one
embodiment, the subject is infected with HIV, such as HIV-1 or
HIV-2.
[0201] In one embodiment, the chimeric protein of the invention
inhibits viral replication. In one embodiment, the chimeric protein
of the invention prevents or inhibits viral entry into target
cells, thereby stopping, preventing, or limiting the spread of a
viral infection in a subject and decreasing the viral burden in an
infected subject. By linking a portion of an immunoglobulin to a
viral fusion inhibitor the invention provides a chimeric protein
with viral fusion inhibitory activity with greater stability and
greater bioavailability compared to viral fusion inhibitors alone,
e.g., T20, T21, T1249. Thus, in one embodiment, the viral fusion
inhibitor decreases or prevents HIV infection of a target cell,
e.g., HIV-1.
[0202] a. Conditions That May Be Treated
[0203] The chimeric protein of the invention can be used to inhibit
or prevent the infection of a target cell by a hepatitis virus,
e.g., hepatitis virus C. The chimeric protein may comprise an
anti-viral agent which inhibits viral replication.
[0204] In one embodiment, the chimeric protein of the invention
comprises a fusion inhibitor. The chimeric protein of the invention
can be used to inhibit or prevent the infection of any target cell
by any virus (see, e.g., U.S. Pat. Nos. 6,086,875, 6,030,613,
6,485,726; WO 03/077834; US2003-0235536A1). In one embodiment, the
virus is an enveloped virus such as, but not limited to HIV, SIV,
measles, influenza, Epstein-Barr virus, respiratory syncytia virus,
or parainfluenza virus. In another embodiment, the virus is a
non-enveloped virus such as rhino virus or polio virus
[0205] The chimeric protein of the invention can be used to treat a
subject already infected with a virus. The subject can be acutely
infected with a virus. Alternatively, the subject can be
chronically infected with a virus. The chimeric protein of the
invention can also be used to prophylactically treat a subject at
risk for contracting a viral infection, e.g., a subject known or
believed to in close contact with a virus or subject believed to be
infected or carrying a virus. The chimeric protein of the invention
can be used to treat a subject who may have been exposed to a
virus, but who has not yet been positively diagnosed.
[0206] In one embodiment, the invention relates to a method of
treating a subject infected with HCV comprising administering to
the subject a therapeutically effective amount of a chimeric
protein, wherein the chimeric protein comprises an Fc fragment of
an IgG and a cytokine, e.g., IFN.alpha..
[0207] In one embodiment, the invention relates to a method of
treating a subject infected with HIV comprising administering to
the subject a therapeutically effective amount of a chimeric
protein wherein the chimeric protein comprises an Fc fragment of an
IgG and the viral fusion inhibitor comprises T20.
[0208] 3. Methods of Treating a Subject Having a Hemostatic
Disorder
[0209] The invention relates to a method of treating a subject
having a hemostatic disorder comprising administering a
therapeutically effective amount of at least one chimeric protein,
wherein the chimeric protein comprises a first and a second chain,
wherein the first chain comprises at least one clotting factor and
at least a portion of an immunoglobulin constant region, and the
second chain comprises at least a portion of an immunoglobulin
constant region.
[0210] The chimeric protein of the invention treats or prevents a
hemostatic disorder by promoting the formation of a fibrin clot.
The chimeric protein of the invention can activate any member of a
coagulation cascade. The clotting factor can be a participant in
the extrinsic pathway, the intrinsic pathway or both. In one
embodiment, the clotting factor is Factor VII or Factor VIIa.
Factor VIIa can activate Factor X which interacts with Factor Va to
cleave prothrombin to thrombin, which in turn cleaves fibrinogen to
fibrin. In another embodiment, the clotting factor is Factor IX or
Factor IXa. In yet another embodiment, the clotting factor is
Factor VIII or Factor VIIIa. In yet another embodiment, the
clotting factor is von Willebrand Factor, Factor XI, Factor XII,
Factor V, Factor X or Factor XIII
[0211] a. Conditions That May Be Treated
[0212] The chimeric protein of the invention can be used to treat
any hemostatic disorder. The hemostatic disorders that may be
treated by administration of the chimeric protein of the invention
include, but are not limited to, hemophilia A, hemophilia B, von
Willebrand's disease, Factor XI deficiency (PTA deficiency), Factor
XII deficiency, as well as deficiencies or structural abnormalities
in fibrinogen, prothrombin, Factor V, Factor VII, Factor X, or
Factor XIII.
[0213] In one embodiment, the hemostatic disorder is an inherited
disorder. In one embodiment, the subject has hemophilia A, and the
chimeric protein comprises Factor VIII or Factor VIIIa. In another
embodiment, the subject has hemophilia A and the chimeric protein
comprises Factor VII or Factor VIIa. In another embodiment, the
subject has hemophilia B and the chimeric protein comprises Factor
IX or Factor IXa. In another embodiment, the subject has hemophilia
B and the chimeric protein comprises Factor VII or Factor VIIa. In
another embodiment, the subject has inhibitory antibodies to Factor
VIII or Factor VIIa and the chimeric protein comprises Factor VII
or Factor VIIa. In yet another embodiment, the subject has
inhibitory antibodies against Factor IX or Factor IXa and the
chimeric protein comprises Factor VII or Factor VIIa.
[0214] The chimeric protein of the invention can be used to
prophylactically treat a subject with a hemostatic disorder. The
chimeric protein of the invention can be used to treat an acute
bleeding episode in a subject with a hemostatic disorder
[0215] In one embodiment, the hemostatic disorder is the result of
a deficiency in a clotting factor, e.g., Factor IX, Factor VIII. In
another embodiment, the hemostatic disorder can be the result of a
defective clotting factor, e.g., von Willebrand's Factor.
[0216] In another embodiment, the hemostatic disorder can be an
acquired disorder. The acquired disorder can result from an
underlying secondary disease or condition. The unrelated condition
can be, as an example, but not as a limitation, cancer, an
autoimmune disease, or pregnancy. The acquired disorder can result
from old age or from medication to treat an underlying secondary
disorder (e.g. cancer chemotherapy).
[0217] 4. Methods of Treating a Subject in Need of a General
Hemostatic Agent
[0218] The invention also relates to methods of treating a subject
that does not have a hemostatic disorder or a secondary disease or
condition resulting in acquisition of a hemostatic disorder. The
invention thus relates to a method of treating a subject in need of
a general hemostatic agent comprising administering a
therapeutically effective amount of at least one chimeric protein,
wherein the chimeric protein comprises a first and a second
polypeptide chain wherein the first polypeptide chain comprises at
least a portion of an immunoglobulin constant region and at least
one clotting factor and the second chain comprises at least a
portion of an immunoglobulin constant region without the clotting
factor of the first polypeptide chain.
[0219] a. Conditions That May Be Treated
[0220] In one embodiment, the subject in need of a general
hemostatic agent is undergoing, or is about to undergo, surgery.
The chimeric protein of the invention can be administered prior to
or after surgery as a prophylactic. The chimeric protein of the
invention can be administered during or after surgery to control an
acute bleeding episode. The surgery can include, but is not limited
to, liver transplantation, liver resection, or stem cell
transplantation.
[0221] The chimeric protein of the invention can be used to treat a
subject having an acute bleeding episode who does not have a
hemostatic disorder. The acute bleeding episode can result from
severe trauma, e.g., surgery, an automobile accident, wound,
laceration gun shot, or any other traumatic event resulting in
uncontrolled bleeding.
[0222] 5. Treatment Modalities
[0223] The chimeric protein of the invention can be administered
intravenously, subcutaneously, intra-muscularly, or via any mucosal
surface, e.g., orally, sublingually, buccally, sublingually,
nasally, rectally, vaginally or via pulmonary route. The chimeric
protein can be implanted within or linked to a biopolymer solid
support that allows for the slow release of the chimeric protein to
the desired site.
[0224] The dose of the chimeric protein of the invention will vary
depending on the subject and upon the particular route of
administration used. Dosages can range from 0.1 to 100,000 .mu.g/kg
body weight. In one embodiment, the dosing range is 0.1-1,000
.mu.g/kg. The protein can be administered continuously or at
specific timed intervals. In vitro assays may be employed to
determine optimal dose ranges and/or schedules for administration.
Many in vitro assays that measure viral infectivity are known in
the art. For example, a reverse transcriptase assay, or an rt PCR
assay or branched DNA assay can be used to measure HIV
concentrations. A StaClot assay can be used to measure clotting
activity. Additionally, effective doses may be extrapolated from
dose-response curves obtained from animal models.
[0225] The invention also relates to a pharmaceutical composition
comprising a viral fusion inhibitor, at least a portion of an
immunoglobulin and a pharmaceutically acceptable carrier or
excipient. Examples of suitable pharmaceutical carriers are
described in Remington's Pharmaceutical Sciences by E. W. Martin.
Examples of excipients can include starch, glucose, lactose,
sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium
stearate, glycerol monostearate, talc, sodium chloride, dried skim
milk, glycerol, propylene, glycol, water, ethanol, and the like.
The composition can also contain pH buffering reagents, and wetting
or emulsifying agents.
[0226] For oral administration, the pharmaceutical composition can
take the form of tablets or capsules prepared by conventional
means. The composition can also be prepared as a liquid for example
a syrup or a suspension. The liquid can include suspending agents
(e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible
fats), emulsifying agents (lecithin or acacia), non-aqueous
vehicles (e.g. almond oil, oily esters, ethyl alcohol, or
fractionated vegetable oils), and preservatives (e.g. methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations can
also include flavoring, coloring and sweetening agents.
Alternatively, the composition can be presented as a dry product
for constitution with water or another suitable vehicle.
[0227] For buccal and sublingual administration the composition may
take the form of tablets, lozenges or fast dissolving films
according to conventional protocols.
[0228] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray from a pressurized pack or nebulizer
(e.g. in PBS), with a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoromethane, carbon dioxide or other suitable gas.
In the case of a pressurized aerosol the dosage unit can be
determined by providing a valve to deliver a metered amount.
Capsules and cartridges of, e.g., gelatin for use in an inhaler or
insufflator can be formulated containing a powder mix of the
compound and a suitable powder base such as lactose or starch.
[0229] The pharmaceutical composition can be formulated for
parenteral administration (i.e. intravenous or intramuscular) by
bolus injection. Formulations for injection can be presented in
unit dosage form, e.g., in ampoules or in multidose containers with
an added preservative. The compositions can take such forms as
suspensions, solutions, or emulsions in oily or aqueous vehicles,
and contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient can
be in powder form for constitution with a suitable vehicle, e.g.,
pyrogen free water.
[0230] The pharmaceutical composition can also be formulated for
rectal administration as a suppository or retention enema, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0231] 6. Combination Therapy
[0232] The chimeric protein of the invention can be used to treat a
subject with a disease or condition in combination with at least
one other known agent to treat said disease or condition.
[0233] In one embodiment, the invention relates to a method of
treating a subject infected with HIV comprising administering a
therapeutically effective amount of at least one chimeric protein
comprising a first and a second chain, wherein the first chain
comprises an HIV fusion inhibitor and at least a portion of an
immunoglobulin constant region and the second chain comprises at
least a portion of an immunoglobulin without an HIV fusion
inhibitor of the first chain, in combination with at least one
other anti-HIV agent. Said other anti-HIV agent can be any
therapeutic with demonstrated anti-HIV activity. Said other
anti-HIV agent can include, as an example, but not as a limitation,
a protease inhibitor (e.g. Amprenavie.RTM., Crixivan.RTM.,
Ritonivir.RTM.), a reverse transcriptase nucleoside analog (e.g.
AZT, DDI, D4T, 3TC, Ziagen.RTM.), a nonnucleoside analog reverse
transcriptase inhibitor (e.g. Sustiva.RTM.), another HIV fusion
inhibitor, a neutralizing antibody specific to HIV, an antibody
specific to CD4, a CD4 mimic, e.g., CD4-IgG2 fusion protein (U.S.
patent application Ser. No. 09/912,824) or an antibody specific to
CCR5, or CXCR4, or a specific binding partner of CCR5, or
CXCR4.
[0234] In another embodiment, the invention relates to a method of
treating a subject with a hemostatic disorder comprising
administering a therapeutically effective amount of at least one
chimeric protein comprising a first and a second chain, wherein the
first chain comprises at least one clotting factor and at least a
portion of an immunoglobulin constant region and the second chain
comprises at least a portion of an immunoglobulin constant region
without the clotting factor of the first chain, in combination with
at least one other clotting factor or agent that promotes
hemostasis. Said other clotting factor or agent that promotes
hemostasis can be any therapeutic with demonstrated clotting
activity. As an example, but not as a limitation, the clotting
factor or hemostatic agent can include Factor V, Factor VII, Factor
VIII, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII,
prothrombin, or fibrinogen or activated forms of any of the
preceding. The clotting factor of hemostatic agent can also include
anti-fibrinolytic drugs, e.g., epsilon-amino-caproic acid,
tranexamic acid.
[0235] 7. Methods of Inhibiting Viral Fusion With a Target Cell
[0236] The invention also relates to an in vitro method of
inhibiting HIV fusion with a mammalian cell comprising combining
the mammalian cell with at least one chimeric protein, wherein the
chimeric protein comprises a first and a second chain, wherein the
first chain comprises at least a portion of an immunoglobulin
constant region and an HIV inhibitor and the second chain comprises
at least a portion of an immunoglobulin constant region without the
HIV inhibitor of the first chain. The mammalian cell can include
any cell or cell line susceptible to infection by HIV including but
not limited to primary human CD4.sup.+ T cells or macrophages,
MOLT-4 cells, CEM cells, AA5 cells or HeLa cells which express CD4
on the cell surface.
G. Methods of Isolating Chimeric Proteins
[0237] Typically, when chimeric proteins of the invention are
produced they are contained in a mixture of other molecules such as
other proteins or protein fragments. The invention thus provides
for methods of isolating any of the chimeric proteins described
supra from a mixture containing the chimeric proteins. It has been
determined that the chimeric proteins of the invention bind to dye
ligands under suitable conditions and that altering those
conditions subsequent to binding can disrupt the bond between the
dye ligand and the chimeric protein, thereby providing a method of
isolating the chimeric protein. In some embodiments the mixture may
comprise a monomer-dimer hybrid, a dimer and at least a portion of
an immunoglobulin constant region, e.g., an Fc. Thus, in one
embodiment, the invention provides a method of isolating a
monomer-dimer hybrid. In another embodiment, the invention provides
a method of isolating a dimer.
[0238] Accordingly, in one embodiment, the invention provides a
method of isolating a monomer-dimer hybrid from a mixture, where
the mixture comprises [0239] a) the monomer-dimer hybrid comprising
a first and second polypeptide chain, wherein the first chain
comprises a biologically active molecule, and at least a portion of
an immunoglobulin constant region and wherein the second chain
comprises at least a portion of an immunoglobulin constant region
without a biologically active molecule or immunoglobulin variable
region; [0240] b) a dimer comprising a first and second polypeptide
chain, wherein the first and second chains both comprise a
biologically active molecule, and at least a portion of an
immunoglobulin constant region; and [0241] c) a portion of an
immunoglobulin constant region; said method comprising [0242] 1)
contacting the mixture with a dye ligand linked to a solid support
under suitable conditions such that both the monomer-dimer hybrid
and the dimer bind to the dye ligand; [0243] 2) removing the
unbound portion of an immunoglobulin constant region; [0244] 3)
altering the suitable conditions of 1) such that the binding
between the monomer-dimer hybrid and the dye ligand linked to the
solid support is disrupted; [0245] 4) isolating the monomer-dimer
hybrid. In some embodiments, prior to contacting the mixture with a
dye ligand, the mixture may be contacted with a chromatographic
substance such as protein A sepharose or the like. The mixture is
eluted from the chromatographic substance using an appropriate
elution buffer (e.g. a low pH buffer) and the eluate containing the
mixture is then contacted with the dye ligand.
[0246] Suitable conditions for contacting the mixture with the dye
ligand may include a buffer to maintain the mixture at an
appropriate pH. An appropriate pH may include a pH of from, 3-10,
4-9, 5-8. In one embodiment, the appropriate pH is 8.0. Any
buffering agent known in the art may be used so long as it
maintains the pH in the appropriate range, e.g., tris, HEPES,
PIPES, MOPS. Suitable conditions may also include a wash buffer to
elute unbound species from the dye ligand. The wash buffer may be
any buffer which does not disrupt binding of a bound species. For
example, the wash buffer can be the same buffer used in the
contacting step.
[0247] Once the chimeric protein is bound to the dye ligand, the
chimeric protein is isolated by altering the suitable conditions.
Altering the suitable conditions may include the addition of a salt
to the buffer. Any salt may be used, e.g., NaCl, KCl. The salt
should be added at a concentration that is high enough to disrupt
the binding between the dye ligand and the desired species, e.g., a
monomer-dimer hybrid.
[0248] In some embodiments where the mixture is comprised of an Fc,
a monomer-dimer hybrid, and a dimer, it has been found that the Fc
does not bind to the dye ligand and thus elutes with the flow
through. The dimer binds more tightly to the dye ligand than the
monomer-dimer hybrid. Thus a higher concentration of salt is
required to disrupt the bond (e.g. elute) between the dimer and the
dye ligand compared to the salt concentration required to disrupt
the bond between the dye ligand and the monomer-dimer hybrid.
[0249] In some embodiments NaCl may be used to isolate the
monomer-dimer hybrid from the mixture. In some embodiments the
appropriate concentration of salt which disrupts the bond between
the dye ligand and the monomer-dimer hybrid is from 200-700 mM,
300-600 mM, 400-500 mM. In one embodiment, the concentration of
NaCl required to disrupt the binding between the dye ligand the
monomer-dimer hybrid is 400 mM.
[0250] NaCl may also be used to isolate the dimer from the mixture.
Typically, the monomer-dimer hybrid is isolated from the mixture
before the dimer. The dimer is isolated by adding an appropriate
concentration of salt to the buffer, thereby disrupting the binding
between the dye ligand and the dimer. In some embodiments the
appropriate concentration of salt which disrupts the bond between
the dye ligand and the dimer is from 800 mM to 2 M, 900 mM to1.5 M,
950 mM to 1.2 M. In one specific embodiment, 1 M NaCl is used to
disrupt the binding between the dye ligand and the dimer.
[0251] The dye ligand may be a bio-mimetic. A bio- a human-made
substance, device, or system that imitates nature. Thus in some
embodiments the dye ligand imitates a molecule's naturally
occurring ligand. The dye ligand may be chosen from Mimetic
Red.TM., Mimetic Red 2.TM., Mimetic Orange 1.TM., Mimetic Orange
2.TM., Mimetic Orange 3.TM., Mimetic Yellow 1.TM., Mimetic Yellow
2.TM., Mimetic Green 1.TM., Mimetic Blue 1.TM., and Mimetic Blue
2.TM. (Prometic Biosciences (USA) Inc., Wayne, N.J.). In one
specific embodiment, the dye ligand is Mimetic Red 2.TM. (Prometic
Biosciences (USA) Inc., Wayne, N.J.). In certain embodiments the
dye ligand is linked to a solid support, e.g., from Mimetic Red
1A6XL.TM., Mimetic Red 2 A6XL.TM. Mimetic Orange 1 A6XL.TM.,
Mimetic Orange 2 A6XL.TM., Mimetic Orange 3 A6XL.TM., Mimetic
Yellow 1 A6XL.TM., Mimetic Yellow 2 A6XL.TM., Mimetic Green 1
A6XL.TM., Mimetic Blue 1 A6XL.TM., and Mimetic Blue 2 A6XL.TM.
(Prometic Biosciences (USA) Inc., Wayne, N.J.).
[0252] The dye ligand may be linked to a solid support. The solid
support may be any solid support known in the art (see, e.g.,
www.seperationsNOW.com). Examples of solid supports may include a
bead, a gel, a membrane, a nanoparticle, or a microsphere. The
solid support may comprise any material which can be linked to a
dye ligand (e.g. agarose, polystyrene, sepharose, sephadex). Solid
supports may comprise any synthetic organic polymer such as
polyacrylic, vinyl polymers, acrylate, polymethacrylate, and
polyacrylamide. Solid supports may also comprise a carbohydrate
polymer, e.g., agarose, cellulose, or dextran. Solid supports may
comprise inorganic oxides, such as silica, zirconia, titania,
ceria, alumina, magnesia (i.e., magnesium oxide), or calcium oxide.
Solid supports may also comprise combinations of some of the
above-mentioned supports including, but not limited to,
dextran-acrylamide.
EXAMPLES
Example 1
Molecular Weight Affects FcRn Mediated Trancvtosis
[0253] Chimeric proteins comprised of various proteins of interest
and IgG Fc were recombinantly produced (Sambrook et al. Molecular
Cloning: A Laboratory Manual, 2 ed., Cold Spring Harbor Laboratory
Press, (1989)) or in the case of contactin-Fc, MAB-.beta.-gal, (a
complex of a monoclonal antibody bound to 13-gal) (Biodesign
International, Saco, Me.) and MAB-GH (a complex of monoclonal
antibody and growth hormone)(Research Diagnostics, Inc. Flanders,
N.J.) were purchased commercially. Briefly, the genes encoding the
protein of interest were cloned by PCR, and then sub-cloned into an
Fc fusion expression plasmid. The plasmids were transfected into
DG44 CHO cells and stable transfectants were selected and amplified
with methotrexate. The chimeric protein homodimers were purified
over a protein A column. The proteins tested included interferon a,
growth hormone, erythropoietin, follicle stimulating hormone,
Factor IX, beta-galactosidase, contactin, and Factor VIII. Linking
the proteins to immunoglobulin portions, including the FcRn
receptor binding partner, or using commercially available whole
antibody (including the FcRn binding region)-antigen complexes
permitted the investigation of transcytosis as a function of
molecular weight (see U.S. Pat. No. 6,030,613). The chimeric
proteins were administered to rats orally and serum levels were
measured 2-4 hours post administration using an ELISA for
recombinantly produced chimeric proteins and both a western blot
and ELISA for commercially obtained antibody complexes and chimeric
proteins. Additionally, all of the commercially obtained proteins
or complexes as well as Factor Factor IX-Fc and Epo-Fc controls
were iodinated using IODO beads (Pierce, Pittsburgh, Pa.). The
results indicated serum levels of Fc and monoclonal antibody
chimeric proteins orally administered to rats are directly related
to the size of the protein. The apparent cutoff point for orally
administered Fc chimeric proteins is between 200-285 kD. (Table
2).
TABLE-US-00002 TABLE 2 Protein Size (kD) Transcytosis IFN.alpha.-Fc
92 ++++ GH-Fc 96 +++ Epo-Fc 120 +++ FSH-Fc 170 +++ MAB:GH 172-194
+++ FIX-Fc 200 + MAB:.beta.Gal 285-420 - Contactin-Fc 300 -
FVIII.DELTA.-Fc 380 -
Example 2
Cloning of pcDNA 3.1-Flaq-Fc
[0254] The sequence for the FLAG peptide
(Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys; SEQ ID NO: 91), a common affinity
tag used to identify or purify proteins, was cloned into the pcDNA
3.1-Fc plasmid, which contains the mouse Igk signal sequence
followed by the Fc fragment of human IgG1 (amino acids 221-447, EU
numbering). The construct was created by overlapping PCR using the
following primers:
TABLE-US-00003 FlagFc-F1: (SEQ ID NO: 41) 5'-GCTGGCTAGCCACCATGGA-3'
FlagFc-R1: (SEQ ID NO: 42) 5'-CTTGTCATCGTCGTCCTTGTAGTCGTCA
CCAGTGGAACCTGGAAC- 3' FlagFc-F2: (SEQ ID NO: 43) 5'-GACTACAAGG
ACGACGATGA CAAGGACAAA ACTCACACAT GCCCACCGTG CCCAGCTCCG GAACTCC-3'
FlagFc-R2: (SEQ ID NO: 44) 5'-TAGTGGATCCTCATTTACCCG-3'
[0255] The pcDNA 3.1-Fc template was then added to two separate PCR
reactions containing 50 pmol each of the primer pairs FlagFc-F1/R1
or FlagFc-F2/R2 in a 50 .mu.l reaction using Pfu Ultra DNA
polymerase (Stratagene, CA) according to manufacturer's standard
protocol in a MJ Thermocycler using the following cycles:
95.degree. C. 2 minutes; 30 cycles of (95.degree. C. 30 seconds,
52.degree. C. 30 seconds, 72.degree. C. 45 seconds), followed by
72.degree. C. for 10 minutes. The products of these two reactions
were then mixed in another PCR reaction (2 .mu.l each) with 50 pmol
of FlagFc-F1 and FlagFc-R2 primers in a 50 .mu.l reaction using Pfu
Ultra DNA polymerase (Stratagene, CA) according to manufacturer's
standard protocol in a MJ Thermocycler using the following cycles:
95.degree. C. 2 minutes; 30 cycles of (95QC 30 seconds, 52.degree.
C. 30 seconds, 72.degree. C. 45 seconds), followed by 72.degree. C.
for 10 minutes. The resulting fragment was gel purified, digested
and inserted into the pcDNA 3.1-Fc plasmid NheI-Bam HI. The
resulting plasmid contains contains the mouse Iv signal sequence
producing the FlagFc protein.
Example 3
Cloning of Factor VII-Fc Construct
[0256] The coding sequence for Factor VII, was obtained by RT-PCR
from human fetal liver RNA (Clontech, Palo Alto, Calif.). The
cloned region is comprised of the cDNA sequence from bp 36 to bp
1430 terminating just before the stop codon. A SbfI site was
introduced on the N-terminus. A BspEI site was introduced on the
C-terminus. The construct was cloned by PCR using the primers:
TABLE-US-00004 Downstream: (SEQ ID NO: 45) 5'
GCTACCTGCAGGCCACCATGGTCTCCCAGGCCCTCAGG 3' Upstream: (SEQ ID NO: 46)
5' CAGTTCCGGAGCTGGGCACGGCGGGCACGTGTGAGTTT TGTCGGGAAAT GG 3'
and the following conditions: 95.degree. C. for 5 minutes followed
by 30 cycles of 95.degree. C. for 30 seconds, 55.degree. C. for 30
seconds, 72.degree. C. for 1 minute and 45 seconds, and a final
extension cycle of 72.degree. C. for 10 minutes.
[0257] The fragment was digested SbfI-BspE I and inserted into
pED.dC-Fc a plasmid encoding for the Fc fragment of an IgG1.
Example 4
Cloning of Factor IX-Fc Construct
[0258] The human Factor IX coding sequence, including the
prepropeptide sequence, was obtained by RT-PCR amplification from
adult human liver RNA using the following primers:
TABLE-US-00005 natFIX-F: (SEQ ID NO: 47)
5'-TTACTGCAGAAGGTTATGCAGCGCGTGAACATG-3' F9-R: (SEQ ID NO: 48)
5'-TTTTTCGAATTCAGTGAGCTTTGTTTTTTCCTTAATCC-3'
[0259] 20 ng of adult human liver RNA (Clontech, Palo Alto, Calif.)
and 25 pmol each primer were added to a RT-PCR reaction using the
SuperScript..TM. One-Step RT-PCR with PLATINUM.RTM. Taq system
Onvitrogen, Carlsbad, Calif.) according to manufacturers protocol.
Reaction was carried out in a MJ Thermocycler using the following
cycles: 50.degree. C. 30 minutes; 94.degree. C. 2 minutes; 35
cycles of (94.degree. C. 30 seconds, 58.degree. C. 30 seconds,
72.degree. C. 1 minute), and a final 72.degree. C. 10 minutes. The
fragment was gel purified using Qiagen Gel Extraction Kit (Qiagen,
Valencia, Calif.), and digested with PstI-EcoRI, gel purified, and
cloned into the corresponding digest of the pED.dC.XFc plasmid.
Example 5
Cloning of PACE Construct
[0260] The coding sequence for human PACE (paired basic amino acid
cleaving enzyme), an endoprotease, was obtained by RT-PCR. The
following primers were used:
TABLE-US-00006 PACE-F1: (SEQ ID NO: 49)
5'-GGTAAGCTTGCCATGGAGCTGAGGCCCTGGTTGC-3' PACE-R1: (SEQ ID NO: 50)
5'-GTTTTCAATCTCTAGGACCCACTCGCC-3' PACE-F2: (SEQ ID NO: 51)
5'-GCCAGGCCACATGACTACTCCGC-3' PACE-R2: (SEQ ID NO: 52)
5'-GGTGAATTCTCACTCAGGCAGGTGTGAGGGCAGC-3'
[0261] The PACE-F1 primer adds a HindIII site to the 5' end of the
PACE sequence beginning with 3 nucleotides before the start codon,
while the PACE-R2 primer adds a stop codon after amino acid 715,
which occurs at the end of the extracellular domain of PACE, as
well as adding an EcoRI site to the 3' end of the stop codon. The
PACE-R1 and -F2 primers anneal on the 3' and 5' sides of an
internal BamHI site, respectively. Two RT-PCR reactions were then
set up using 25 pmol each of the primer pairs of PACE-F1/R1 or
PACE-F2/R2 with 20 ng of adult human liver RNA (Clontech; Palo
Alto, Calif.) in a 50 .mu.l RT-PCR reaction using the
SuperScript..TM. One-Step RT-PCR with PLATINUM.RTM. Taq system
(Invitrogen, Carlsbad, Calif.) according to manufacturers protocol.
The reaction was carried out in a MJ Thermocycler using the
following cycles: 50.degree. C. 30 minutes; 94.degree. C. 2
minutes; 30 cycles of (94.degree. C. 30 seconds, 58.degree. C. 30
seconds, 72.degree. C. 2 minutes), followed by 72.degree. C. 10
minutes. These fragments were each ligated into the vector pGEM
T-Easy (Promega, Madison, Wis.) and sequenced fully. The F2-R2
fragment was then subcloned into pcDNA6 V5/His (Invitrogen,
Carlsbad, Calif.) using the BamHI/EcoRI sites, and then the F1-R1
fragment was cloned into this construct using the HindIII/BamHI
sites. The final plasmid, pcDNA6-PACE, produces a soluble form of
PACE (amino acids 1-715), as the transmembrane region has been
deleted. The sequence of PACE in pcDNA6-PACE is essentially as
described in Harrison et al. 1998, Seminars in Hematology 35:4.
Example 6
Cloning of IFN.alpha.-Fc Eight Amino Acid Linker Construct
[0262] The human interferon .alpha. 2b (hIFN.alpha.) coding
sequence, including the signal sequence, was obtained by PCR from
human genomic DNA using the following primers:
TABLE-US-00007 IFNa-Sig-F: (SEQ ID NO: 53)
5'-GCTACTGCAGCCACCATGGCCTTGACCTTTGCTTTAC-3' IFNa-EcoR-R: (SEQ ID
NO: 54) 5'-CGTTGAATTCTTCCTTACTTCTTAAACTTTCTTGC-3'
[0263] Genomic DNA was prepared from 373MG human astrocytoma cell
line, according to standard methods (Sambrook et al. 1989,
Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor
Laboratory Press). Briefly, approximately 2.times.10.sup.5 cells
were pelleted by centrifugation, resuspended in 100 .mu.l phosphate
buffered saline pH 7.4, then mixed with an equal volume of lysis
buffer (100 mM Tris pH 8.0/200 mM NaCl/2% SDS/5 mM EDTA).
Proteinase K was added to a final concentration of 100 .mu.g/ml,
and the sample was digested at 37.degree. C. for 4 hours with
occasional gentle mixing. The sample was then extracted twice with
phenol:chloroform, the DNA precipitated by adding sodium acetate pH
7.0 to 100 mM and an equal volume of isopropanol, and pelleted by
centrifugation for 10 min at room temperature. The supernatant was
removed and the pellet was washed once with cold 70% ethanol and
allowed to air dry before resuspending in TE (10 mM Tris pH 8.0/1
mM EDTA).
[0264] 100 ng of this genomic DNA was then used in a 25 .mu.l PCR
reaction with 25 pmol of each primer using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, Ind.) according to
manufacturer's standard protocol in a MJ Thermocycler using the
following cycles: 94.degree. C. 2 minutes; 30 cycles of (94.degree.
C. 30 seconds, 50.degree. C. 30 seconds, 72.degree. C. 45 seconds),
and finally 72.degree. C. 10 minutes. The expected sized band
(.about.550 bp) was gel purified with a Gel Extraction kit (Qiagen,
Valencia, Calif.), digested with PstI/EcoRI, gel purified again,
and cloned into the PstI/EcoRI site of pED.dC.XFc, which contains
an 8 amino acid linker (EFAGAAAV; SEQ ID NO: 31) followed by the Fc
region of human IgG1.
Example 7
Cloning of IFN.alpha.Fc .DELTA. linker Construct
[0265] 1 .mu.g of purified pED.dC.native human IFN.alpha.Fc DNA,
from Example 6, was then used as a template in a 25 .mu.l PCR
reaction with 25 pmol of each primer IFNa-Sig-F and the following
primer:
TABLE-US-00008 hIFNaNoLinkFc-R: (SEQ ID NO: 55)
5'CAGTTCCGGAGCTGGGCACGGCGGGCACGTGTGAGITTIGTOTTCCTT
ACTTCTTAAACTTTTTGCAAGTTTG-3'
[0266] The PCR reaction was carried out using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, Ind.) according to the
manufacturer's standard protocol in a RapidCycler thermocycler
(Idaho Technology, Salt Lake City, Utah), denaturing at 94.degree.
C. for 2 minutes followed by 18 cycles of 95.degree. C. for 15
seconds, 55.degree. C. for 0 seconds, and 72.degree. C. for 1
minute with a slope of 6, followed by 72.degree. C. extension for
10 minutes. A PCR product of the correct size (.about.525 bp) was
gel purified using a Gel Extraction kit (Qiagen; Valencia, Calif.),
digested with the PstI and BspEI restriction enzymes, gel purified,
and sub cloned into the corresponding sites of a modified
pED.dC.XFc, where amino acids 231-233 of the Fc region were altered
using the degeneracy of the genetic code to incorporate a BspEI
site while maintaining the wild type amino acid sequence.
Example 8
Cloning of IFN.alpha.Fc GS15 Linker Construct
[0267] A new backbone vector was created using the Fc found in the
.DELTA.linker construct (containing BspEI and RsrII sites in the 5'
end using the degeneracy of the genetic code to maintain the amino
acid sequence), using this DNA as a template for a PCR reaction
with the following primers:
TABLE-US-00009 5' B2xGGGGS (SEQ ID NO: 86): (SEQ ID NO: 56) 5'
gtcaggatccggcggtggagggagcgacaaaactcacacgtgcc 3' 3' GGGGS (SEQ ID
NO: 81): (SEQ ID NO: 57) 5' tgacgcggccgctcatttacccggagacaggg 3'
[0268] A PCR reaction was carried out with 25 pmol of each primer
using Pfu Turbo enzyme (Stratagene, La Jolla, Calif.) according to
manufacturer's standard protocol in a MJ Thermocycler using the
following method: 95.degree. C. 2 minutes; 30 cycles of (95.degree.
C. 30 seconds, 54.degree. C. 30 seconds, 72.degree. C. 2 minutes),
72.degree. C. 10 minutes. The expected sized band (.about.730 bp)
was gel purified with a Gel Extraction kit (Qiagen, Valencia
Calif.), digested BamHI/NotI; gel purified again, and cloned into
the BamHI/NotI digested vector of pcDNA6 ID, a version of pcDNA6
with the IRES sequence and dhfr gene inserted into NotI/XbaI
site.
[0269] 500 ng of purified pED.dC.native human IFN.alpha.Fc DNA was
then used as a template in a 25 .mu.l PCR reaction with the
following primers:
TABLE-US-00010 5' IFNa for GGGGS (SEQ ID NO: 81): (SEQ ID NO: 58)
5' ccgctagcctgcaggccaccatggccttgacc 3' 3' IFNa for GGGGS (SEQ ID
NO: 81): (SEQ ID NO: 59) 5' ccggatccgccgccaccttccttactacgtaaac
3'
[0270] A PCR reaction was carried out with 25 pmol of each primer
using Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to manufacturer's standard protocol
in a MJ Thermocycler using the following cycles: 95.degree. C. 2
minutes; 14 cycles of (94.degree. C. 30 seconds, 48.degree. C. 30
seconds, 72.degree. C. 1 minute), 72.degree. C. 10 minutes. The
expected sized band (.about.600 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia Calif.), digested NheI/BamHI, gel
purified again, and cloned into the NheI/BamHI site of the pcDNA6
ID/Fc vector, above, to create an IFN.alpha. Fc fusion with a 10
amino acid Gly/Ser linker (2xGGGGS; SEQ ID NO: 86), pcDNA6
ID/IFN.alpha.-GS10-Fc.
[0271] A PCR reaction was then performed using 500 ng of this
pcDNA6 ID/IFN.alpha.-GS10-Fc with the following primers
TABLE-US-00011 (SEQ ID NO: 60) 5' B3XGGGGS: 5' (SEQ ID NO: 61)
gtcaggatccggtggaggcgggtccggcggtggagggagcgacaaaac tcacacgtgccc 3'
fcclv-R: (SEQ ID NO: 62) 5' atagaagcctttgaccaggc 3'
[0272] A PCR reaction was carried out with 25 pmol of each primer
using Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to manufacturer's standard protocol
in a MJ Thermocycler using the following cycles: 95.degree. C. 2
minutes; 14 cycles of (94.degree. C. 30 seconds, 48.degree. C. 30
seconds, 72.degree. C. 1 minute), 72.degree. C. 10 minutes. The
expected sized band (504 bp) was gel purified with a Gel Extraction
kit (Qiagen, Valencia Calif.), digested BamHI/BspEI, the 68 bp band
was gel purified, and cloned into the BamHI/BspEI site of the
pcDNA6 ID/IFN.alpha.-GS10-Fc vector, above, to create an IFN.alpha.
Fc fusion with a 15 amino acid Gly/Ser linker (3Xggggs; SEQ ID NO:
60), pcDNA6 ID/IFN.alpha.-GS15-Fc.
Example 9
Cloning of a Basic Peptide Construct
[0273] The hinge region of the human IgG1 Fc fragment from amino
acid 221-229 (EU numbering) was replaced with a basic peptide
(CCB).
[0274] Four overlapping oligos were used (IDT, Coralville,
Iowa):
TABLE-US-00012 1. CCB-Fc Sense 1: (SEQ ID NO: 63) 5' GCC GGC GAA
TTC GGT GGT GAG TAC CAG GCC CTG AAG AAG AAG GTG GCC CAG CTG AAG GCC
AAG AAC CAG GCC CTG AAG AAG AAG 3' 2. CCB-Fc Sense 2: (SEQ ID NO:
64) 5' GTG GCC CAG CTG AAG CAC AAG GGC GGC GGC CCC GCC CCA GAG CTC
CTG GGC GGA CCG A 3' 3. CCB-Fc Anti-Sense 1: (SEQ ID NO: 65) 5' CGG
TCC GCC CAG GAG CTC TGG GGC GGG GCC GCC GCC CTT GTG CTT CAG CTG GGC
CAC CTT CTT CTT CAG GGC CTG GTT CTT G 3' 4. CCB-Fc Anti-Sense 2:
(SEQ ID NO: 66) 5' GCC TTC AGC TGG GCC ACC TTC TTC TTC AGG GCC TGG
TAC TCA CCA CCG AAT TCG CCG GCA 3'
[0275] The oligos were reconstituted to a concentration of 50 .mu.M
with dH.sub.2O. 5 .mu.l of each oligo were annealed to each other
by combining in a thin walled PCR tube with 2.2 .mu.l of
restriction buffer #2 (i.e. final concentration of 10 mM Tris HCl
pH 7.9, 10 mM MgCl.sub.2, 50 mM Na CI, 1 mM dithiothreitol) (New
England Biolabs, Beverly, Mass.) and heated to 95.degree. C. for 30
seconds and then allowed to anneal by cooling slowly for 2 hours to
25.degree. C. 5 pmol of the now annealed oligos were ligated into a
pGEM T-Easy vector as directed in the kit manual. (Promega, Madison
Wis.). The ligation mixture was added to 50 .mu.l of DH5.alpha.
competent E. coli ceel's (Invitrogen, Carlsbad, Calif.) on ice for
2 minutes, incubated at 37.degree. C. for 5 minutes, incubated on
ice for 2 minutes, and then plated on LB+100 .mu.g/L ampicillin
agar plates and placed at 37.degree. C. for 14 hours. Individual
bacterial colonies were picked and placed in 5 ml of LB+100 .mu.g/L
ampicillin and allowed to grow for 14 hours. The tubes were spun
down at 2000.times. g, 4.degree. C. for 15 minutes and the vector
DNA was isolated using Qiagen miniprep kit (Qiagen, Valencia,
Calif.) as indicated in the kit manual. 2 .mu.g of DNA was digested
with NgoM IV-Rsr-II. The fragment was gel purified by the Qiaquick
method as instructed in the kit manual (Qiagen, Valencia, Calif.)
and ligated to pED.dcEpoFc with NgoM IV/Rsr II. The ligation was
transformed into DH5.alpha. competent E. coli cells and the DNA
prepared as described for the pGEM T-Easy vector.
Example 10
Cloning of the Erythropoietin-Acidic Peptide Fc Construct
[0276] The hinge region of the human IgG1 Fc fragment in FPO-Fc
from amino acid 221-229 (EU numbering) was replaced with an acidic
peptide (CCA). Four overlapping oligos were used (IDT, Coralville,
Iowa):
TABLE-US-00013 1. Epo-CCA-Fc Sense 1: (SEQ ID NO: 67) 5' CCG GTG
ACA GGG AAT TCG GTG GTG AGT ACC AGG CCC TGG AGA AGG AGG TGG CCC AGC
TGG AG 3' 2. Epo-CCA-Fc Sense 2: (SEQ ID NO: 68) 5' GCC GAG AAC CAG
GCC CTG GAG AAG GAG GTG GCC CAG CTG GAG CAC GAG GGT GGT GGT CCC GCT
CCA GAG CTG CTG GGC GGA CA 3' 3. Epo-CCA-Fc Anti-Sense 1: (SEQ ID
NO: 69) 5' GTC CGC CCA GCA GCT CTG GAG CGG GAC CAC CAC CCT CGT GCT
CCA GCT GGG CCA C 3' 4. Epo-CCA-Fc Anti-Sense 2: (SEQ ID NO: 70) 5'
CTC CTT CTC CAG GGC CTG GTT CTC GGC CTC CAG CTG GGC CAC CTC CTT CTC
CAG GGC CTG GTA CTC ACC ACC GAA TTC CCT GTC ACC GGA 3'
[0277] The oligos were reconstituted to a concentration of 50 pM
with dH.sub.2O. 5 .mu.l of each oligo were annealed to each other
by combining in a thin walled PCR tube with 2.2 .mu.l of
restriction buffer No. 2 (New England Biolabs, Beverly, Mass.) and
heated to 95.degree. C. for 30 seconds and then allowed to cool
slowly for 2 hours to 25.degree. C. 5 pmol of the now annealed
oligos were ligated into a pGEM T-Easy vector as directed in the
kit manual. (Promega, Madison, Wis.). The ligation mixture was
added to 50 .mu.l of DH5.alpha. competent E. coli cells
(Invitrogen, Carlsbad, Calif.) on ice for 2 minutes, incubated at
37.degree. C. 5 minutes, incubated on ice for 2 minutes, and then
plated on LB+100 .mu.g/L ampicillin agar plates and placed at
37.degree. C. for 14 hours. Individual bacterial colonies were
picked and placed in 5 ml of LB+100 .mu.g/L ampicillin and allowed
to grow for 14 hours. The tubes were spun down at 2000.times. g,
4.degree. C. for 15 minutes and the vector DNA was prepared using
Qiagen miniprep kit (Qiagen, Valencia, Calif.) as indicated in the
kit manual. 2 .mu.g of DNA was digested with Age I-Rsr-II. The
fragment was gel purified by the Qiaquick method as instructed in
the kit manual (Qiagen, Valencia, Calif.) and ligated into pED.Epo
Fc.1 Age I-Rsr II. The ligation was transformed into DH5.alpha.
competent E. coli cells and DNA prepped as described above.
Example 11
Cloning of Cvs-Fc Construct
[0278] Using PCR and standard molecular biology techniques
(Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual, 2nd
ed., Cold Spring Harbor Laboratory Press), a mammalian expression
construct was generated such that the coding sequence for the human
IFN.alpha. signal peptide was directly abutted against the coding
sequence of Fc beginning at the first cysteine residue (Cys 226, EU
Numbering). Upon signal peptidase cleavage and secretion from
mammalian cells, an Fc protein with an N-terminal cysteine residue
was thus generated.
[0279] Briefly, the primers
[0280] IFNa-Sig-F (IFNa-Sig-F: 5'-GCTACTGCAGCCACCATGGCCTTGACCTT
TGCTTTAC-3')(SEQ ID NO:71) and Cys-Fc-R
(5'-CAGTTCCGGAGCTGGGCACGGCGGA GAGCCCACAGAGCAGCTTG-3') (SEQ ID
NO:72) were used in a PCR reaction to create a fragment linking the
IFN.alpha. signal sequence with the N terminus of Fc, beginning
with Cys 226. 500 ng of pED.dC.native hIFN.alpha. .DELTA.linker was
added to 25 pmol of each primer in a PCR reaction with Expand High
Fidelity System (Boehringer Mannheim, Indianapolis, Ind.) according
to manufacturer's standard protocol. The reaction was carried out
in a MJ Thermocycler using the following cycles: 94.degree. C. 2
minutes; 30 cycles of (94.degree. C. 30 seconds, 50.degree. C. 30
seconds, 72.degree. C. 45 seconds), and finally 72.degree. C. 10
minutes. The expected sized band (.about.112 bp) was gel purified
with a Gel Extraction kit (Qiagen, Valencia Calif.), digested with
the PstI and BspEI restriction enzymes, gel purified, and subcloned
into the corresponding sites pED.dC.native hIFN.alpha.
.DELTA.linker to generate pED.dC.Cys-Fc (FIG. 5).
Example 12
Protein Expression and Preparation of Fc-MESNA
[0281] The coding sequence for Fc (the constant region of human
IgG1) was obtained by PCR amplification from an Fc-containing
plasmid using standard conditions and reagents, following the
manufacturer's recommended procedure to subclone the Fc coding
sequence NdeI/SapI. Briefly, the primers 5'-GTGGTCATA
TGGGCATTGAAGGCAGAGGCGCCGCTGCGGTCG-3' (SEQ ID NO:73) and
5'-GGTGGTTGCTCTTCCGCAAAAACCCGGAGACAGGGAGAGACTCTTCTGCG-3' (SEQ ID
NO:74)were used to amplify the Fc sequence from 500 ng of the
plasmid pED.dC.Epo-Fc using Expand High Fidelity System (Boehringer
Mannheim, Basel Switzerland) in a RapidCylcler thermocycler (Idaho
Technology Salt Lake City, Utah), denaturing at 95.degree. C. for 2
minutes followed by 18 cycles of 95.degree. C. for 0 sec,
55.degree. C. for 0 sec, and 72.degree. C. for 1 minute with a
slope of 4, followed by 72.degree. C. extension for 10 minutes. The
PCR product was subcloned into an intermediate cloning vector and
sequenced fully, and then subcloned using the NdeI and SapI sites
in the pTVVIN1 vector following standard procedures. Sambrook, J.,
Fritsch, E. F. and Maniatis, T. 1989, Molecular Cloning: A
Laboratory Manual, 2.sup.nd ed.; Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press. This plasmid was then transformed
into BL21(DE3) pLysS cells using standard methods. Id. A 1 liter
culture of cells was grown to an absorbance reading of 0.8 AU at
37.degree. C., induced with 1 mM isopropyl
beta-D-1-thiogalactopyranoside, and grown overnight at 25.degree.
C. Cells were pelleted by centrifugation, lysed in 20 mM Tris
8.8/r/o NP40/0.1 mM phenylmethanesulfonyl fluoride/1 .mu.g/ml
Benzonase (Novagen Madison, Wis.), and bound to chitin beads (New
England Biolabs; Beverly, Mass.) overnight at 42.degree. C. Beads
were then washed with several column volumes of 20 mM Tris 8.5/500
mM NaCV 1 mM EDTA, and then stored at -80.degree. C. Purified
Fc-MESNA was generated by eluting the protein from the beads in 20
mM Tris 8.5/500 mM NaCl/1 mM EDTA/500 mM 2-mercapto ethane sulfonic
acid (MESNA), and the eluate was used directly in the coupling
reaction, below.
Example 13
Factor VII-Fc Monomer-Dimer Hybrid Expression and Purification
[0282] CHO DG-44 cells expressing Factor VII-Fc were established.
CHO DG-44 cells were grown at 37.degree. C., 5% CO.sub.2, in MEM
Alpha plus nucleoside and ribonucleosides and supplemented with 5%
heat-inactivated fetal bovine serum until transfection.
[0283] DG44 cells were plated in 100 mm tissue culture petri dishes
and grown to a confluency of 50%-60%. A total of 10 .mu.g of DNA
was used to transfect one 100 mm dish: 7.5 .mu.g of
pED.dC.FVII-Fc+1.5 .mu.g pcDNA3/Flag-Fc+1 .mu.g of pcDNA6-PACE. The
cells were transfected as described in the Superfect transfection
reagent manual (Qiagen, Valencia, Calif.). The media was removed
from transfection after 48 hours and replaced with MEM Alpha
without nucleosides plus 5% dialyzed fetal bovine serum and 10
.mu.g/ml of Blasticidin (lnvitrogen, Carlsbad, Calif.) and 0.2
mg/ml geneticin (Invitrogen, Carlsbad, Calif.). After 10 days, the
cells were released from the plate with 0.25% trypsin and
transferred into T25 tissue culture flasks, and the selection was
continued for 10-14 days until the cells began to grow well as
stable cell lines were established. Protein expression was
subsequently amplified by the addition 25 nM methotrexate.
[0284] Approximately 2.times.10.sup.7 cells were used to inoculate
300 ml of growth medium in a 1700 cm2 roller bottle (Corning,
Corning, N.Y.) supplemented with 5 .mu.g/ml of vitamin K3
(menadione sodium bisulfite) (Sigma, St Louis, Mo.). The roller
bottles were incubated in a 5% CO.sub.2 at 37.degree. C. for 72
hours. Then the growth medium was exchanged with 300 ml serum-free
production medium (DMEM/F12 with 5 .mu.g/ml bovine insulin and 10
.mu.g/ml Gentamicin) supplemented with 5 .mu.g/L of vitamin
K.sub.3. The production medium (conditioned medium) was collected
every day for 10 days and stored at 4.degree. C. Fresh production
medium was added to the roller bottles after each collection and
the bottles were returned to the incubator. Pooled media was first
clarified using a Sartoclean glass fiber filter (3.0 .mu.m +0.2
.mu.m) (Sartorious Corp. Gottingen, Germany) followed by an
Acropack 500 filter (0.8 .mu.m +0.2 .mu.m) (Pall Corp., East Hills,
N.Y.). The clarified media was then concentrated approximately
20-fold using Pellicon Biomax tangential flow filtration cassettes
(10 kDa MWCO) (Millipore Corp., Billerica, Mass.).
[0285] Fc chimeras were then captured from the concentrated media
by passage over a Protein A Sepharose 4 Fast Flow Column (AP
Biotech, Piscataway, N.J.). A 5.times.5 cm (100 ml) column was
loaded with .ltoreq.5 mg Fc protein per ml column volume at a
linear flow rate of 100 cm/hour to achieve a residence time of
.gtoreq.3 minutes. The column was then washed with >5 column
volumes of 1.times. DPBS to remove non-specifically bound proteins.
The bound proteins were eluted with 100 mM Glycine pH 3.0. Elution
fractions containing the protein peak were then neutralized by
adding 1 part 1 M Tris-HCL, pH 8 to 10 parts elute fraction.
[0286] To remove FLAG-Fc homodimers (that is, chimeric Fc dimers
with FLAG peptide expressed as fusions with both Fc molecules) from
the preparation, the Protein A Sepharose 4 Fast Flow pool was
passed over a Unosphere S cation-exchange column (BioRad Corp.,
Richmond, Calif.). Under the operating conditions for the column,
the FLAG-Fc monomer-dimer hybrid is uncharged (FLAG-Fc theoretical
pI=6.19) and flows through the column while the hFVII-Fc constructs
are positively charged, and thus bind to the column and elute at
higher ionic strength. The Protein A Sepharose 4 Fast Flow pool was
first dialyzed into 20 mM MES, 20 mM NaCl, pH 6.1. The dialyzed
material was then loaded onto a 1.1.times.11 cm (9.9 ml) column at
150 cm/hour. During the wash and elution, the flow rate was
increased to 500 cm/hour. The column was washed sequentially with 8
column volumes of 20 mM MES, 20 mM NaCl, pH 6.1 and 8 column
volumes of 20 mM MES, 40 mM NaCl, pH 6.1. The bound protein was
eluted with 20 mM MES, 750 mM NaCl, pH 6.1. Elution fractions
containing the protein peak were pooled and sterile filtered
through a 0.2 .mu.m filter disc prior to storage at -80.degree.
C.
[0287] An anti-FLAG MAB affinity column was used to separate
chimeric Fc dimers with hFVII fused to both Fc molecules from those
with one FLAG peptide and one hFVII fusion. The Unosphere S Eluate
pool was diluted 1:1 with 20 mM Tris, 50 mM NaCl, 5 mM CaCl.sub.2,
pH 8 and loaded onto a 1.6.times.5 cm M2 anti-FLAG sepharose column
(Sigma Corp., St. Louis, Mo.) at a linear flow rate of 60 cm/hour.
Loading was targeted to <2.5 mg monomer-dimer hybrid/ml column
volume. After loading the column was washed with 5 column volumes
20 mM Tris, 50 mM NaCl, 5 mM CaCl.sub.2, pH 8.0, monomer-dimer
hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution
fractions containing the protein peak were then neutralized by
adding 1 part 1 M Tris-HCl, pH 8 to 10 parts eluate fraction. Pools
were stored at -80.degree. C.
Example 14
Factor IX-Fc Homodimer and Monomer-Dimer Hybrid Expression and
Purification
[0288] CHO DG-44 cells expressing Factor IX-Fc were established.
DG44 cells were plated in 100 mm tissue culture petri dishes and
grown to a confluency of 50%-60%. A total of 10 .mu.g of DNA was
used to transfect one 100 mm dish: for the homodimer transfection,
8 .mu.g of pED.dC.Factor IX-Fc+2 .mu.g of pcDNA6-PACE was used; for
the monomer-dimer hybrid transfection, 8 .mu.g of pED.dC.Factor
IX-Fc+1 .mu.g of pcDNA3-FlagFc+1 .mu.g pcDNA6-PACE was used. The
cells were transfected as described in the Superfect transfection
reagent manual (Qiagen, Valencia, Calif.). The media was removed
from transfection after 48 hours and replaced with MEM Alpha
without nucleosides plus 5% dialyzed fetal bovine serum and 10
.mu.g/ml of Blasticidin (Invitrogen, Carlsbad, Calif.) for both
transfections, while the monomer-dimer hybrid transfection was also
supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad,
Calif.). After 3 days, the cells were released from the plate with
0.25% trypsin and transferred into T25 tissue culture flasks, and
the selection was continued for 10-14 days until the cells began to
grow well as stable cell lines were established. Protein expression
was subsequently amplified by the addition 10 nM or 100 nM
methotrexate for the homodimer or monomer-dimer hybrid,
respectively.
[0289] For both cell lines, approximately 2.times.10.sup.7 cells
were used to inoculate 300 ml of growth medium in a 1700 cm.sup.2
roller bottle (Corning, Corning, N.Y.), supplemented with 5 .mu.g/L
of vitamin K.sub.3 (menadione sodium bisulfite) (Sigma, St. Louis,
Mo.). The roller bottles were incubated in a 5% CO.sub.2 at
37.degree. C. for approximately 72 hours. The growth medium was
exchanged with 300 ml serum-free production medium (DMEM/F12 with 5
.mu.g/ml bovine insulin and 10 .mu.g/ml Gentamicin), supplemented
with 5 .mu.g/L of vitamin K.sub.3. The production medium
(conditioned medium) was collected everyday for 10 days and stored
at 4.degree. C. Fresh production medium was added to the roller
bottles after each collection and the bottles were returned to the
incubator. Prior to chromatography, the medium was clarified using
a SuporCap-100 (0.8/0.2 .mu.m) filter (Pall Gelman Sciences, Ann
Arbor, Mich.). All of the following steps were performed at
4.degree. C. The clarified medium was applied to Protein A
Sepharose, washed with 5 column volumes of 1.times. PBS (10 mM
phosphate, pH 7.4, 2.7 mM KCl, and 137 mM NaCl), eluted with 0.1 M
glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M
Tris-HCl, pH 9.0. The protein was then dialyzed into PBS.
[0290] The monomer-dimer hybrid transfection protein sample was
subject to further purification, as it contained a mixture of
FIX-Fc:FIX-Fc homodimer, FIX-Fc:Flag-Fc monomer-dimer hybrid, and
Flag-Fc:Flag-Fc homodimer. Material was concentrated and applied to
a 2.6 cm.times.60 cm (318 ml) Superdex 200 Prep Grade column at a
flow rate of 4 ml/minute (36 cm/hour) and then eluted with 3 column
volumes of 1.times. PBS. Fractions corresponding to two peaks on
the UV detector were collected and analyzed by SDS-PAGE. Fractions
from the first peak contained either FIX-Fc:FIX-Fc homodimer or
FIX-Fc:FlagFc monomer-dimer hybrid, while the second peak contained
FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer
hybrid but no FlagFc homodimer were pooled and applied directly to
a 1.6.times.5 cm M2 anti-FLAG sepharose column (Sigma Corp., St.
Louis, Mo.) at a linear flow rate of 60 cm/hour. After loading, the
column was washed with 5 column volumes PBS. Monomer-dimer hybrids
were then eluted with 100 mM Glycine, pH 3.0. Elution fractions
containing the protein peak were then neutralized by adding 1/10
volume of 1 M Tris-HCl, and analyzed by reducing and nonreducing
SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1-5
mg/ml, and stored at -80.degree. C.
Example 15
IFN.alpha. Homodimer and Monomer-Dimer Hybrid Expression and
Purification
[0291] CHO DG-44 cells expressing hIFN.alpha. were established.
DG44 cells were plated in 100 mm tissue culture petri dishes and
grown to a confluency of 50%-60%. A total of 10 .mu.g of DNA was
used to transfect one 100 mm dish: for the homodimer transfection,
10 .mu.g of the hIFN.alpha.Fc constructs; for the monomer-dimer
hybrid transfection, 8 .mu.g of the hIFN.alpha.Fc constructs+2
.mu.g of pcDNA3-FlagFc. The cells were transfected as described in
the Superfect transfection reagent manual (Qiagen, Valencia,
Calif.). The media was removed from transfection after 48 hours and
replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal
bovine serum, while the monomer-dimer hybrid transfection was also
supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad,
Calif.). After 3 days, the cells were released from the plate with
0.25% trypsin and transferred into T25 tissue culture flasks, and
the selection was continued for 10-14 days until the cells began to
grow well and stable cell lines were established. Protein
expression was subsequently amplified by the addition methotrexate:
ranging from 10 to 50 nM.
[0292] For all cell lines, approximately 2.times.10.sup.7 cells
were used to inoculate 300 ml of growth medium in a 1700 cm.sup.2
roller bottle (Corning, Corning, N.Y.). The roller bottles were
incubated in a 5% CO.sub.2 at 372 C for approximately 72 hours.
Then the growth medium was exchanged with 300 ml serum-free
production medium (DMEM/F12 with 5 .mu.g/ml bovine insulin and 10
.mu.g/ml Gentamicin). The production medium (conditioned medium)
was collected every day for 10 days and stored at 4.degree. C.
Fresh production medium was added to the roller bottles after each
collection and the bottles were returned to the incubator. Prior to
chromatography, the medium was clarified using a SuporCap-100
(0.8/0.2 .mu.m) filter from Pall Gelman Sciences (Ann Arbor,
Mich.). All of the following steps were performed at 4.degree. C.
The clarified medium was applied to Protein A Sepharose, washed
with 5 column volumes of 1.times. PBS (10 mM phosphate, pH 7.4, 2.7
mM KCl, and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and
then neutralized with 1/10 volume of 1 M Tris-HCl, pH 9.0. The
protein was then dialyzed into PBS.
[0293] The monomer-dimer hybrid transfection protein samples were
then subject to further purification, as it contained a mixture of
IFN.alpha.Fc:IFN.alpha.Fc homodimer, IFN.alpha.Fc:FlagFc
monomer-dimer hybrid, and FlagFc:FlagFc homodimer (or .DELTA.linker
or GS15 linker). Material was concentrated and applied to a 2.6
cm.times.60 cm (318 ml) Superdex 200 Prep Grade column at a flow
rate of 4 ml/min (36 cm/hr) and then eluted with 3 column volumes
of 1.times. PBS. Fractions corresponding to two peaks on the UV
detector were collected and analyzed by SDS-PAGE. Fractions from
the first peak contained either IFN.alpha.Fc:IFN.alpha.Fc homodimer
or IFN.alpha.Fc:FlagFc monomer-dimer hybrid, while the second peak
contained FlagFc:FlagFc homodimer. All fractions containing the
monomer-dimer hybrid, but no FlagFc homodimer, were pooled and
applied directly to a 1.6.times.5 cm M2 anti-FLAG sepharose column
(Sigma Corp., St. Louis, Mo.) at a linear flow rate of 60 cm/hour.
After loading the column was washed with 5 column volumes PBS
monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0.
Elution fractions containing the protein peak were then neutralized
by adding 1/10 volume of 1 M Tris-HCl, and analyzed by reducing and
nonreducing SDS-PAGE. Fractions were dialyzed into PBS,
concentrated to 1-5 mg/ml, and stored at -80.degree. C.
Example 16
Coiled Coil Protein Expression and Purification
[0294] The plasmids, pED.dC Epo-CCA-Fc and pED.dC CCB-Fc will be
transfected either alone or together at a 1:1 ratio into CHO DG44
cells. The cells will be transfected as described in the Superfect
transfection reagent manual (Qiagen, Valencia, Calif.). The media
will be removed after 48 hours and replaced with MEM Alpha w/o
nucleosides plus 5% dialyzed fetal bovine serum. Purification will
be done by affinity chromatography over a protein A column
according to methods known in the art. Alternatively, purification
can be achieved using size exclusion chromatography.
Example 17
Cvs-Fc Expression and Purification
[0295] CHO DG-44 cells expressing Cys-Fc were established. The
pED.dC.Cys-Fc expression plasmid, which contains the mouse
dihydrofolate reductase (dhfr) gene, was transfected into CHO DG44
(dhfr deficient) cells using Superfect reagent (Qiagen; Valencia,
Calif.) according to manufacturer's protocol, followed by selection
for stable transfectants in aMEM (without nucleosides) tissue
culture media supplemented with 5% dialyzed FBS and
penicillin/streptomycin antibiotics (Invitrogen; Carlsbad, Calif.)
for 10 days. The resulting pool of stably transfected cells were
then amplified with 50 nM methotrexate to increase expression.
Approximately 2.times.10.sup.7 cells were used to inoculate 300 ml
of growth medium in a 1700 cm.sup.2 roller bottle (Corning,
Corning, N.Y.). The roller bottles were incubated in a 5% CO.sub.2
at 37-.sup.9-C for approximately 72 hours. The growth medium was
exchanged with 300 ml serum-free production medium (DMEIV1/F12 with
5 .mu.g/ml bovine insulin and 10 .mu.g/ml Gentamicin). The
production medium (conditioned medium) was collected every day for
10 days and stored at 4.degree. C. Fresh production medium was
added to the roller bottles after each collection and the bottles
were returned to the incubator. Prior to chromatography, the medium
was clarified using a SuporCap-100 (0.8/0.2 .mu.m) filter from Pall
Gelman Sciences (Ann Arbor, Mich.). All of the following steps were
performed at 4.degree. C. The clarified medium was applied to
Protein A Sepharose, washed with 5 column volumes of 1.times. PBS
(10 mM phosphate, pH 7.4, 2.7 mM KCl, and 137 mM NaCl), eluted with
0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M
Tris-HCl, pH 9.0. Protein was dialyzed into PBS and used directly
in conjugation reactions.
Example 18
Coupling of T20-thioesters to Cvs-Fc
[0296] Cys-Fc (4 mg, 3.2 mg/ml final concentration) and either
T20-thioester or T20-PEG-thioester (2 mg, approximately 5 molar
equivalents) were incubated for 16 hours at room temperature in 0.1
M Tris 8/10 mM MESNA. Analysis by SDS-PAGE (Tris-Gly gel) using
reducing sample buffer indicated the presence of a new band
approximately 5 kDa larger than the Fc control (>40-50%
conversion to the conjugate). Previous N-terminal sequencing of
Cys-Fc and unreacted Cys-Fc indicated that the signal peptide is
incorrectly processed in a fraction of the molecules, leaving a
mixture of (Cys)-Fc, which will react through native ligation with
peptide-thioesters, and (Val)-(Gly)-(Cys)-Fc, which will not. As
the reaction conditions are insufficient to disrupt the
dimerization of the Cys-Fc molecules, this reaction generated a
mixture of T20-Cys-Fc:T20-Cys-Fc homodimers, T20-Cys-Fc:Fc
monomer-dimer hybrids, and Cys-Fc:Cys-Fc Fc-dimers. This protein
was purified using size exclusion chromatography as indicated above
to separate the three species. The result was confirmed by SDS-PAGE
analysis under nonreducing conditions.
Example 19
Antiviral Assay for IFN.alpha. Activity
[0297] Antiviral activity (IU/ml) of IFN.alpha. fusion proteins was
determined using a CPE (cytopathic effect) assay. A549 cells were
plated in a 96 well tissue culture plate in growth media (RPMI 1640
supplemented with 10% fetal bovine serum (FBS) and 2 mM
L-glutamine) for 2 hours at 37.degree. C., 5% CO.sub.2. IFN.alpha.
standards and IFN.alpha. fusion proteins were diluted in growth
media and added to cells in triplicate for 20 hours at 37.degree.
C., 5% CO.sub.2. Following incubation, all media was removed from
wells, encephalomyocarditis virus (EMC) virus was diluted in growth
media and added (3000 pfu/well) to each well with the exception of
control wells. Plates were incubated at 37.degree. C., 5% CO.sub.2
for 28 hours. Living cells were fixed with 10% cold trichloroacetic
acid (TCA) and then stained with Sulforhodamine B (SRB) according
to published protocols (Rubinstein et al. 1990, J. Natl. Cancer
Inst. 82, 1113). The SRB dye was solubilized with 10 mM Tris pH
10.5 and read on a spectrophotometer at 490 nm. Samples were
analyzed by comparing activities to a known standard curve World
Health Organization IFN.alpha. 2b International Standard ranging
from 5 to 0.011 IU/ml. The results are presented below in Table 3
and FIG. 6 and demonstrate increased antiviral activity of
monomer-dimer hybrids.
TABLE-US-00014 TABLE 3 INTERFERON ANTIVIRAL ASSAY HOMODIMER V.
MONOMER-DIMER HYBRID Antiviral Activity Protein (IU/nmol) Std dev
IFNaFc 8aa linker homodimer 0.45 .times. 10.sup.5 0.29 .times.
10.sup.5 IFNaFc 8aa linker:FlagFc 4.5 .times. 10.sup.5 1.2 .times.
10.sup.5 monomer-dimer hybrid IFN.alpha.Fc .DELTA. linker homodimer
0.22 .times. 10.sup.5 0.07 .times. 10.sup.5 IFN.alpha.Fc .DELTA.
delta linker: FlagFc 2.4 .times. 10.sup.5 0.0005 .times. 10.sup.5
monomer-dimer hybrid IFN.alpha.Fc GS15 linker 2.3 .times. 10.sup.5
1.0 .times. 10.sup.5 homodimer IFN.alpha.Fc GS15 linker 5.3 .times.
10.sup.5 0.15 .times. 10.sup.5 monomer-dimer hybrid
Example 20
FVIIa Clotting Activity Analysis
[0298] The StaClot FVIIa-rTF assay kit was purchased from
Diagnostica Stago (Parsippany, N.J.) and modified as described in
Johannessen et al. 2000, Blood Coagulation and Fibrinolysis
11.S159. A standard curve was preformed with the FVIIa World Health
Organization standard 89/688. The assay was used to compare
clotting activity of monomer-dimer hybrids compared to homodimers.
The results showed the monomer-dimer hybrid had four times the
clotting activity compared to the homodimer (FIG. 7).
Example 21
FVIIa-Fc Oral Dosing in Day 10 Rats
[0299] 25 gram day 9 newborn Sprague Dawley rats were purchased
from Charles River (Wilmington, Mass.) and allowed to acclimate for
24 hours. The rats were dosed orally with FVIIaFc homodimer,
monomer-dimer hybrid or a 50:50 mix of the two. A volume of 200
.mu.l of a FVIIaFc solution for a dose of 1 mg/kg was administered.
The solution was composed of a Tris-HCl buffer pH 7.4 with 5 mg/ml
soybean trypsin inhibitor. The rats were euthanized with CO.sub.2
at several time points, and 200 .mu.l of blood was drawn by cardiac
puncture. Plasma was obtained by the addition of a 3.8% sodium
citrate solution and centrifugation at room temperature at a speed
of 1268.times. g. The plasma samples were either assayed fresh or
frozen at 20.degree. C. Orally dosed monomer-dimer hybrid resulted
in significantly higher maximum (C.sub.max) serum concentrations
compared to homodimeric Factor VII (FIG. 8).
Example 22
Factor IX-Fc Oral Closing of Neonatal Rats
[0300] Ten-day old neonatal Sprague-Dawley rats were dosed p.o.
with 200 .mu.l of FIX-Fc homodimer or FIX-Fc:FlagFc monomer-dimer
hybrid at approximately equimolar doses of 10 nmol/kg in 0.1 M
sodium phosphate buffer, pH 6.5 containing 5 mg/ml soybean trypsin
inhibitor and 0.9% NaCl. At 1, 2, 4, 8, 24, 48, and 72 hours post
injection, animals were euthanized with CO.sub.2, blood was drawn
via cardiac puncture and plasma was obtained by the addition of a
3.8% sodium citrate solution and centrifugation at room temperature
at a speed of 1268.times. g. Samples were then sedimented by
centrifugation, serum collected and frozen at -20.degree. C. until
analysis of the fusion proteins by ELISA.
Example 23
Factor IX-Fc ELISA
[0301] A 96-well lmmulon 4HBX ELISA plate (Thermo Lab Systems,
Vantaa, Finland) was coated with 100 .mu.l/well of goat anti-Factor
IX IgG (Affinity Biologicals, Ancaster, Canada) diluted 1:100 in 50
mM carbonate buffer, pH 9.6. The plates were incubated at ambient
temperature for 2 hours or overnight at 4.degree. C. sealed with
plastic film. The wells were washed 4 times with PBST, 300
.mu.l/well using the TECAN plate washer. The wells were blocked
with PBST+6% BSA, 200 .mu.l/well, and incubated 90 minutes at
ambient temperature. The wells were washed 4 times with PBST, 300
.mu.l/well using the TECAN plate washer. Standards and blood
samples from rats described in Example 18 were added to the wells,
(100 .mu.l/well), and incubated 90 minutes at ambient temperature.
Samples and standards were diluted in HBET buffer (HBET: 5.95 g
HEPES, 1.46 g NaCl, 0.93 g Na.sub.2EDTA, 2.5 g Bovine Serum
Albumin, 0.25 ml Tween-20, bring up to 250 ml with dH.sub.2O,
adjust pH to 7.2). Standard curve range was from 200 ng/ml to 0.78
ng/ml with 2 fold dilutions in between. Wells were washed 4 times
with PBST, 300 .mu.l/well using the TECAN plate washer. 100
.mu.l/well of conjugated goat anti-human IgG-Fc-HARP antibody
(Pierce, Rockford, Ill.) diluted in HBET 1:25,000 was added to each
well. The plates were incubated 90 minutes at ambient temperature.
The wells were washed 4 times with PBST, 300 .mu.l/well using the
TECAN plate washer. The plates were developed with 100 .mu.l/well
of tetramethylbenzidine peroxidase substrate (TMB) (Pierce,
Rockford, Ill.) was added according to the manufacturer's
instructions. The plates were incubated 5 minutes at ambient
temperature in the dark or until color developed. The reaction was
stopped with 100 .mu.l/well of 2 M sulfuric acid. Absorbance was
read at 450 nm on SpectraMax plusplate reader (Molecular Devices,
Sunnyvale, Calif.). Analysis of blood drawn at 4 hours indicated
more than a 10 fold difference in serum concentration between
Factor IX-Fc monomer-dimer hybrids compared to Factor IX Fc
homodimers (FIG. 9). The results indicated Factor IX-Fc
monomer-dimer hybrid levels were consistently higher than Factor
IX-Fc homodimers (FIG. 10).
Example 24
Cloning of Epo-Fc
[0302] The mature Epo coding region was obtained by PCR
amplification from a plasmid encoding the mature erythropoietin
coding sequence, originally obtained by RT-PCR from Hep G2 mRNA,
and primers hepoxba-F and hepoeco-R, indicated below. Primer
hepoxba-F contains an XbaI site, while primer hepoeco-R contains an
EcoRI site. PCR was carried out in the Idaho Technology RapidCycler
using Vent polymerase, denaturing at 95.degree. C. for 15 seconds,
followed by 28 cycles with a slope of 6.0 of 95.degree. C. for 0
seconds, 55.degree. C. for 0 seconds, and 72.degree. C. for 1
minute 20 seconds, followed by 3 minute extension at 72.degree. C.
An approximately 514 bp product was gel purified, digested with
XbaI and EcoRI, gel purified again and directionally subcloned into
an XbaI/EcoRI-digested, gel purified pED.dC.XFc vector, mentioned
above. This construct was named pED.dC.EpoFc.
[0303] The Epo sequence, containing both the endogenous signal
peptide and the mature sequence, was obtained by PCR amplification
using an adult kidney QUICK-clone cDNA preparation as the template
and primers Epo+Pep-Sbf-F and Epo+Pep-Sbf-R, described below. The
primer Epo+Pep-Sbf-F contains an SbfI site upstream of the start
codon, while the primer Epo+Pep-Sbf-R anneals downstream of the
endogenous SbfI site in the Epo sequence. The PCR reaction was
carried out in the PTC-200 MJ Thermocycler using Expand polymerase,
denaturing at 94.degree. C. for 2 minutes, followed by 32 cycles of
94.degree. C. for 30 seconds, 57.degree. C. for 30 seconds, and
72.degree. C. for 45 seconds, followed by a 10 minute extension at
72.degree. C. An approximately 603 bp product was gel isolated and
subcloned into the pGEM-T Easy vector. The correct coding sequence
was excised by SbfI digestion, gel purified, and cloned into the
Pstl-digested, shrimp alkaline phosphatase (SAP)-treated, gel
purified pED.dC.EpoFc plasmid. The plasmid with the insert in the
correct orientation was initially determined by KpnI digestion. A
XmnI and PvuII digestion of this construct was compared with
pED.dC.EpoFc and confirmed to be in the correct orientation. The
sequence was determined and the construct was named
pED.dC.natEpoFc.PCR Primers:
TABLE-US-00015 hepoxba-F (EPO-F): (SEQ ID NO: 75)
5'-AATCTAGAGCCCCACCACGCCTCATCTGTGAC-3' hepoeco-R (EPO-R) (SEQ ID
NO: 76) 5'-TTGAATTCTCTGTCCCCTGTCCTGCAGGCC-3' Epo+Pep-Sbf-F: (SEQ ID
NO: 77) 5'-GTACCTGCAGGCGGAGATGGGGGTGCA-3' Epo+Pep-Sbf-R: (SEQ ID
NO: 78) 5'-CCTGGTCATCTGTCCCCTGICC-3'
Example 25
Cloning of Epo-Fc
[0304] An alternative method of cloning EPO-Fc is described herein.
Primers were first designed to amplify the full length Epo coding
sequence, including the native signal sequence, as follows:
TABLE-US-00016 Epo-F: (SEQ ID NO: 79) 5'-GTCCAACCTG CAGGAAGCTTG
CCGCCACCAT GGGAGTGCAC GAATGTCCTG CCTGG-3' Epo-R: (SEQ ID NO: 80)
5'-GCCGAATTCA GTTTTGTCGA CCGCAGCGG CGCCGGCGAA CTCTCTGTCC CCTGTTCTGC
AGGCCTCC-3'
[0305] The forward primer incorporates an SbfI and HindIII site
upstream of a Kozak sequence, while the reverse primer removes the
internal SbfI site, and adds an 8 amino acid linker to the 3' end
of the coding sequence (EFAGAAAV) (SEQ ID NO: 31) as well as SalI
and EcoRI restriction sites. The Epo coding sequence was then
amplified from a kidney cDNA library (BD Biosciences Clontech, Palo
Alto, Calif.) using 25 pmol of these primers in a 25 .mu.l PCR
reaction using Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to manufacturer's standard protocol
in a MJ Thermocycler using the following cycles: 94.degree. C. 2
minutes; 30 cycles of (94.degree. C. 30 seconds, 58.degree. C. 30
seconds, 72.degree. C. 45 seconds), followed by 72.degree. C. for
10 minutes. The expected sized band (641 bp) was gel purified with
a Gel Extraction kit (Qiagen, Valencia, Calif.) and ligated into
the intermediate cloning vector pGEM T-Easy (Promega, Madison,
Wis.). DNA was transformed into DH5.alpha. cells (Invitrogen,
Carlsbad, Calif.) and miniprep cultures grown and purified with a
Plasmid Miniprep Kit (Qiagen, Valencia, Calif.) both according to
manufacturer's standard protocols. Once the sequence was confirmed,
this insert was digested out with SbfI/EcoRI restriction enzymes,
gel purified, and cloned into the PstI/EcoRI sites of the mammalian
expression vector pED.dC in a similar manner.
[0306] Primers were designed to amplify the coding sequence for the
constant region of human IgG1 (the Fc region, EU numbering 221-447)
as follows:
TABLE-US-00017 Fc-F: (SEQ ID NO: 82) 5'-GCTGCGGTCG ACAAAACTCA
CACATGCCCA CCGTGCCCAG CTCCGGAACT CCTGGGCGGA CCGTCAGTC-3' Fc-R (SEQ
ID NO: 83) 5'-ATTGGAATTC TCATTTACCC GGAGACAGGG AGAGGC-3'
The forward primer incorporates a SalI site at the linker-Fc
junction, as well as introducing BspEI and RsrII sites into the Fc
region without affecting the coding sequence, while the reverse
primer adds an EcoRI site after the stop codon. The Fc coding
sequence was then amplified from a leukocyte cDNA library (BD
Biosciences Clontech, Palo Alto, Calif.) using 25 pmol of these
primers in a 25 .mu.l PCR reaction using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, Ind.) according to
manufacturer's standard protocol in a MJ Thermocycler using the
following cycles: 94.degree. C. 2 minutes; 30 cycles of (94.degree.
C. 30 seconds, 58.degree. C. 30 seconds, 72.degree. C. 45 seconds),
followed by 72.degree. C. for 10 minutes. The expected sized band
(696 bp) was gel purified with a Gel Extraction kit (Qiagen,
Valencia, Calif.) and ligated into the intermediate cloning vector
pGEM T-Easy (Promega, Madison, Wis.). DNA was transformed into
DH5.alpha. cells (Invitrogen, Carlsbad, Calif.) and miniprep
cultures grown and purified with a Plasmid Miniprep Kit (Qiagen,
Valencia, Calif.), both according to manufacturer's standard
protocols. Once the sequence was confirmed, this insert was
digested out with Sal/EcoRI restriction enzymes, gel purified, and
cloned into the SalI/EcoRI sites of the plasmid pED.dC.Epo (above)
in a similar manner, to generate the mammalian expression plasmid
pED.dC.EpoFc. In another experiment this plasmid was also digested
with RsrII/XmaI, and the corresponding fragment from pSYN-Fc-002,
which contains the Asn 297 Ala mutation (EU numbering) was cloned
in to create pED.dC.EPO-Fc N297A (pSYN-EPO-004). Expression in
mammalian cells was as described in Example 26. The amino acid
sequence of EpoFc with an eight amino acid linker is provided in
FIG. 2j. During the process of this alternative cloning method,
although the exact EpoFc amino acid sequence was preserved (FIG.
2J), a number of non-coding changes were made at the nucleotide
level (FIG. 3J). These are G6A (G at nucleotide 6 changed to A)
(eliminate possible secondary structure in primer), G567A (removes
endogenous SbfI site from Epo), A582G (removes EcoRI site from
linker), A636T and T639G (adds unique BspEI site to Fc), and G651C
(adds unique RsrII site to Fc). The nucleotide sequence in FIG. 3J
is from the construct made in Example 25, which incorporates these
differences from the sequence of the construct from Example 24.
Example 26
EPO-Fc Homodimer and Monomer-Dimer Hybrid Expression and
Purification
[0307] DG44 cells were plated in 100 mm tissue culture petri dishes
and grown to a confluency of 50%-60%. A total of 10 .mu.g of DNA
was used to transfect one 100 mm dish: for the homodimer
transfection, 10 .mu.g of pED.dC.EPO-Fc; for the monomer-dimer
hybrid transfection, 8 .mu.g of pED.dC.EPO-Fc+2 .mu.g of
pcDNA3-FlagFc. The constructs used were cloned as described in
Example 24. The cloning method described in Example 25 could also
be used to obtain constructs for use in this example. The cells
were transfected as described in the Superfect transfection reagent
manual (Qiagen, Valencia, Calif.). Alternatively, pED.dC.EPO-Fc was
cotransfected with pSYN-Fc-016 to make an untagged monomer. The
media was removed from transfection after 48 hours and replaced
with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine
serum for both transfections, while the monomer-dimer hybrid
transfection was also supplemented with 0.2 mg/ml geneticin
(Invitrogen, Carlsbad, Calif.). After 3 days, the cells were
released from the plate with 0.25% trypsin and transferred into T25
tissue culture flasks, and the selection was continued for 10-14
days until the cells began to grow well as stable cell lines were
established. Protein expression was subsequently amplified by the
addition methotrexate.
[0308] For both cell lines, approximately 2.times.10.sup.7 cells
were used to inoculate 300 ml of growth medium in a 1700 cm.sup.2
roller bottle (Corning, Corning, N.Y.). The roller bottles were
incubated in a 5% CO.sub.2 at 37.degree. C. for approximately 72
hours. The growth medium was exchanged with 300 ml serum-free
production medium (DMEM/F12 with 5 .mu.g/ml bovine insulin and 10
.mu.g/ml Gentamicin). The production medium (conditioned medium)
was collected every day for 10 days and stored at 4.degree. C.
Fresh production medium was added to the roller bottles after each
collection and the bottles were returned to the incubator. Prior to
chromatography, the medium was clarified using a SuporCap-100
(0.8/0.2 .mu.m) filter from Pall Gelman Sciences (Ann Arbor,
Mich.). All of the following steps were performed at 4.degree. C.
The clarified medium was applied to Protein A Sepharose, washed
with 5 column volumes of 1.times. PBS (10 mM phosphate, pH 7.4, 2.7
mM KCl, and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and
then neutralized with 1/10 volume of 1 M Tris-HCl, pH 9.0. Protein
was then dialyzed into PBS.
[0309] The monomer-dimer hybrid transfection protein sample was
subject to further purification, as it contained a mixture of
EPO-Fc:FPO-Fc homodimer, FPO-Fc:Flag-Fc monomer-dimer hybrid, and
Flag-Fc:Flag-Fc homodimer. Material was concentrated and applied to
a 2.6 cm.times.60 cm (318 ml) Superdex 200 Prep Grade column at a
flow rate of 4 ml/min (36 cm/hour) and then eluted with 3 column
volumes of 1.times. PBS. Fractions corresponding to two peaks on
the UV detector were collected and analyzed by SDS-PAGE. Fractions
from the first peak contained either EPO-Fc:EPO-Fc homodimer or
EPO-Fc:FlagFc monomer-dimer hybrid, while the second peak contained
FlagFc:FlagFc homodimer. All fractions containing the
monomer-dinner hybrid but no FlagFc homodimer were pooled and
applied directly to a 1.6.times.5 cm M2 anti-FLAG sepharose column
(Sigma Corp.) at a linear flow rate of 60 cm/hour. After loading
the column was washed with 5 column volumes PBS. Monomer-dimer
hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution
fractions containing the protein peak were then neutralized by
adding 1/10 volume of 1 M Tris-HCl, and analyzed by reducing and
nonreducing SDS-PAGE. Fractions were dialyzed into PBS,
concentrated to 1-5 mg/ml, and stored at -80.degree. C.
[0310] Alternatively, fractions from first peak of the Superdex 200
were analyzed by SDS-PAGE, and only fractions containing a majority
of EpoFc monomer-dimer hybrid, with a minority of EpoFc homodimer,
were pooled. This pool, enriched for the monomer-dimer hybrid, was
then reapplied to a Superdex 200 column, and fractions containing
only EpoFc monomer-dimer hybrid were then pooled, dialyzed and
stored as purified protein. Note that this alternate purification
method could be used to purify non-tagged monomer-dimer hybrids as
well.
Example 27
Administration of EpoFc Dimer and Monomer-Dimer Hybrid With an
Eight Amino Acid Linker to Cynomolgus Monkeys
[0311] For pulmonary administration, aerosols of either EpoFc dimer
or EpoFc monomer-dimer hybrid proteins (both with the 8 amino acid
linker) in PBS, pH 7.4 were created with the Aeroneb Pro.TM.
(AeroGen, Mountain View, Calif.) nebulizer, in-line with a Bird
Mark 7A respirator, and administered to anesthetized naive
cynomolgus monkeys through endotracheal tubes (approximating normal
tidal breathing). Both proteins were also administered to naIve
cynomolgus monkeys by intravenous injection. Samples were taken at
various time points, and the amount of Epo-containing protein in
the resulting plasma was quantitated using the Quantikine IVD Human
Epo Immunoassay (R&D Systems, Minneapolis, Minn.).
Pharmacokinetic parameters were calculated using the software
WinNonLin. Table 4 presents the bioavailability results of
cynomolgus monkeys treated with EpoFc monomer-dimer hybrid or EpoFc
dimer.
TABLE-US-00018 TABLE 4 ADMINISTRATION OF EPOFC MONOMER-DIMER HYBRID
AND EPOFC DIMER TO MONKEYS Approx. Deposited Dose.sup.1 Cmax
t.sub.1/2 t.sub.1/2 avg Protein Monkey # Route (.mu.g/kg) Cmax
(ng/ml) (fmol/ml) (hr) (hr) EpoFc C06181 pulm 20 72.3 1014 23.6
25.2 monomer- C06214 pulm 20 50.1 703 23.5 dimer C07300 pulm 20 120
1684 36.2 hybrid C07332 pulm 20 100 1403 17.5 C07285 IV 25 749
10508 21.3 22.6 C07288 IV 25 566 7941 23 C07343 IV 25 551 1014 23.5
EpoFc DD026 pulm 15 10.7 120 11.5 22.1 dimer DD062 pulm 15 21.8 244
27.3 DD046 pulm 15 6.4 72 21.8 DD015 pulm 15 12.8 143 20.9 DD038
pulm 35 27 302 29 F4921 IV 150 3701 41454 15.1 14.6 96Z002 IV 150
3680 41219 15.3 1261CQ IV 150 2726 30533 23.6 127-107 IV 150 4230
47379 15.0 118-22 IV 150 4500 50403 8.7 126-60 IV 150 3531 39550
9.8 .sup.1Based on 15% deposition fraction or nebulized dose as
determined by gamma scintigraphy
[0312] The percent bioavailability (F) was calculated for the
pulmonary doses using the following equation:
F=(AUC pulmonary/Dose pulmonary)/(AUC IV/Dose IV)*100
TABLE-US-00019 TABLE 5 CALCULATION OF PERCENT BIOAVAILABILITY FOR
EPOFC MONOMER-DIMER HYBRID V. DIMER AFTER PULMONARY ADMINISTRATION
TO NAIVE CYNOMOLGUS MONKEYS Approx. Bioavail- Average Dose.sup.1
AUC ability.sup.2 Bioavail- Protein Monkey # (deposited) ng hr/mL
(F) abiity EpoFc C06181 20 .mu.g/kg 3810 25.2% 34.9% monomer-
C06214 20 .mu.g/kg 3072 20.3% dimer C07300 20 .mu.g/kg 9525 63.0%
hybrid C07332 20 .mu.g/kg 4708 31.1% EpoFc DD026 15 .mu.g/kg 361
5.1% 10.0% dimer DD062 15 .mu.g/kg 1392 19.6% DD046 15 .mu.g/kg 267
3.8% DD015 15 .mu.g/kg 647 9.1% DD038 35 .mu.g/kg 2062 12.4%
.sup.1Based on 15% deposition fraction of nebulized dose as
determined by gamma scintigraphy .sup.2Mean AUC for IV EpoFc
monomer-dimer hybrid = 18,913 ng hr/mL (n = 3 monkeys), dosed at 25
.mu.g/kg. Mean AUC for IV EpoFc dimer = 70,967 ng hr/mL (n = 6
monkeys), dosed at 150 .mu.g/kg
[0313] The pharmacokinetics of EpoFc with an 8 amino acid linker
administered to cynomolgus monkeys is presented in FIG. 11. The
figure compares the EpoFc dimer with the EpoFc monomer-dimer hybrid
in monkeys after administration of a single pulmonary dose. Based
on a molar comparison significantly higher serum levels were
obtained in monkeys treated with the monomer-dimer hybrid compared
to the dimer.
Example 28
Subcutaneous Administration of EPOFc Monomer-Dimer Hybrid
[0314] To compare serum concentrations of known erythropoietin
agents with EPOFc monomer-dimer hybrids, both EPOFc monomer-dimer
hybrid and Aranesp.RTM. (darbepoetin alfa), which is not a chimeric
fusion protein, were administered subcutaneously to different
monkeys and the serum concentration of both was measured over
time.
[0315] Cynomolgus monkeys (n=3 per group) were injected
subcutaneously with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood
samples were collected predose and at times up to 144 hours post
dose. Serum was prepared from the blood and stored frozen until
analysis by ELISA (Human Epo Quantikine Immunoassay) (R & D
Systems, Minneapolis, Minn.). Pharmacokinetic parameters were
determined using WinNonLina.RTM. software (Pharsight, Mountainview,
Calif.).
[0316] The results indicated the serum concentrations of both EPOFc
monomer-dimer hybrid and Aranesp.RTM. (darbepoetin alfa) were
equivalent over time, even though the administered molar dose of
Aranesp.RTM. (darbepoetin alfa) was slightly larger (Table 6) (FIG.
12).
TABLE-US-00020 TABLE 6 % Dose Dose Cmax AUC T.sub.1/2
Bioavailability Route (.mu.g/kg) (nmol/kg) (ng/mL) (ng hr
mL.sup.-1) (hr) (F) EpoFc Subcutaneous 25 0.3 133 .+-. 34 10,745
.+-. 3,144 26 .+-. 5 57 + 17 Monomer- Dimer hybrid Aranesp .RTM.
Subcutaneous 20 0.54 83 .+-. 11 5390 .+-. 747 22 .+-. 2 53 + 8
Example 29
Intravenous Administration of EPOFc Monomer-Dimer Hybrid
[0317] To compare serum concentrations of known erythropoietin
agents with EPOFc monomer-dimer hybrids, EPOFc monomer-dimer
hybrid, Aranesp.RTM. (darbepoetin alfa), and Epogen.RTM. (epoetin
alfa), neither of which is a chimeric fusion protein, were
administered intravenously to different monkeys and the serum
concentration of both was measured over time.
[0318] Cynomolgus monkeys (n=3 per group) were injected
intravenously with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood
samples were collected predose and at times up to 144 hours post
dose. Serum was prepared from the blood and stored frozen until
analysis by ELISA (Human Epo Quantikine Immunoassay) (R & D
Systems, Minneapolis, Minn.). Pharmacokinetic parameters were
determined using WinNonLina software (Pharsight, Mountainview,
Calif.).
[0319] The results indicated the serum concentration versus time
(AUC) of EPOFc monomer-dimer hybrid was greater than the
concentrations of either Epogen.RTM. (epoetin alfa) or Aranesp.RTM.
(darbepoetin alfa), even though the monkeys received larger molar
doses of both Epogen.RTM. (epoetin alfa) and Aranesp.RTM.
(darbepoetin alfa) (Table 7) (FIG. 13).
TABLE-US-00021 TABLE 7 Dose Dose Cmax AUC T.sub.1/2 Route
(.mu.g/kg) (nmol/kg) (ng/mL) (ng hr mL.sup.-1) (hr) EpoFc
Intravenous 25 0.3 622 .+-. 110 18,913 .+-. 3,022 23 .+-. 1
Monomer- Dimer hybrid Aranesp .RTM. Intravenous 20 0.54 521 .+-. 8
10,219 .+-. 298 20 .+-. 1 Epogen Intravenous 20 0.66 514 .+-. 172
3936 .+-. 636 6.3 .+-. 0.6
Example 30
Alternative Purification of EpoFc Monomer-Dimer Hybrid
[0320] Yet another alternative for purifying EPO-Fc is described
herein. A mixture containing Fc, EpoFc monomer-dimer hybrid, and
EpoFc dimer was applied to a Protein A Sepharose column (Amersham,
Uppsala, Sweden). The mixture was eluted according to the
manufacturer's instructions. The Protein A Sepharose eluate,
containing the mixture was buffer exchanged into 50 mM Tris-CI (pH
8.0). The protein mixture was loaded onto an 8 mL Mimetic Red 2 XL
column (ProMetic Life Sciences, Inc., Wayne, N.J.) that had been
equilibrated in 50 mM Tris-CI (pH 8.0). The column was then washed
with 50 mM Tris-CI (pH 8.0); 50 mM NaCl. This step removed the
majority of the Fc. EpoFc monomer-dimer hybrid was specifically
eluted from the column with 50 mM Tris-CI (pH 8.0); 400 mM NaCl.
EpoFc dimer can be eluted and the column regenerated with 5 column
volumes of 1 M NaOH. Eluted fractions from the column were analyzed
by SDS-PAGE (FIG. 14).
Example 31
Cloning of Igx Signal Sequence--Fc Construct for Making Untapped Fc
Alone
[0321] The coding sequence for the constant region of IgG1 (EU
#221-447; the Fc region) was obtained by PCR amplification from a
leukocyte cDNA library (Clontech, CA) using the following
primers:
TABLE-US-00022 rcFc-F (SEQ ID NO: 82)
5'-GCTGCGGTCGACAAAACTCACACATGCCCACCGTGCCCAGCTCC
GGAACTCCTGGGCGGACCGTCAGTC-3' rcFc-R (SEQ ID NO: 83)
5'-ATTGGAATTCTCATTTACCCGGAGACAGGGAGAGGC-3'
[0322] The forward primer adds three amino acids (AAV) and a SalI
cloning site before the beginning of the Fc region, and also
incorporates a BspEI restriction site at amino acids 231-233 and an
RsrII restriction site at amino acids 236-238 using the degeneracy
of the genetic code to preserve the correct amino acid sequence (EU
numbering). The reverse primer adds an EcoRI cloning site after the
stop codon of the Fc. A 25 .mu.l PCR reaction was carried out with
25 pmol of each primer using Expand High Fidelity System
(Boehringer Mannheim, Indianapolis, Ind.) according to the
manufacturer's standard protocol in a MJ Thermocycler using the
following cycles: 94.degree. C. 2 minutes; 30 cycles of (94.degree.
C. 30 seconds, 58.degree. C. 30 seconds, 72.degree. C. 45 seconds),
72.degree. C. 10 minutes. The expected sized band (.about.696 bp)
was gel purified with a Gel Extraction kit (Qiagen, Valencia
Calif.), and cloned into pGEM T-Easy (Promega, Madison, Wis.) to
produce an intermediate plasmid pSYN-Fc-001 (pGEM T-Easy/Fc).
[0323] The mouse Ig.kappa. signal sequence was added to the Fc CDS
using the following primers:
TABLE-US-00023 rc-Igk sig seq-F: (SEQ ID NO: 100)
5'-TTTAAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTA
TGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACAAAACT CACACATGCCCACCG-3'
Fc-noXma-GS-R: (SEQ ID NO: 101) 5'-GGTCAGCTCATCGCGGGATGGG-3'
Fc-noXma-GS-F: (SEQ ID NO: 102) 5'-CCCATCCCGCGATGAGCTGACC-3'
[0324] The rc-Ig.kappa. signal sequence-F primer adds a HindIII
restriction site to the 5'end of the molecule, followed by a Kozak
sequence (GCCGCCACC) (SEQ ID NO: 103) followed by the signal
sequence from the mouse Ig.kappa. light chain, directly abutted to
the beginning of the Fc sequence (EU #221). The Fc-noXma-GS-F and
-R primers remove the internal XmaI site from the Fc coding
sequence, using the degeneracy of the genetic code to preserve the
correct amino acid sequence. Two 25 .mu.l PCR reactions were
carried out with 25 pmol of either rc-Ig.kappa. signal sequence-F
and Fc-noXma-GS-R or Fc-noXma-GS-F and rcFc-R using Expand High
Fidelity System (Boehringer Mannheim, Indianapolis, Ind.) according
to the manufacturer's standard protocol in a MJ Thermocycler. The
first reaction was carried out with 500 ng of leukocyte cDNA
library (BD Biosciences Clontech, Palo Alto, Calif.) as a template
using the following cycles: 94.degree. C. 2 minutes; 30 cycles of
(94.degree. C. 30 seconds, 55.degree. C. 30 seconds, 72.degree. C.
45 seconds), 72.degree. C. 10 minutes. The second reaction was
carried out with 500 ng of pSYN-Fc-001 as a template (above) using
the following cycles: 94.degree. C. 2 minutes; 16 cycles of
(94.degree. C. 30 seconds, 58.degree. C. 30 seconds, 72.degree. C.
45 seconds), 72.degree. C. 10 minutes. The expected sized bands
(.about.495 and 299 bp, respectively) were gel purified with a Gel
Extraction kit (Qiagen, Valencia Calif.), then combined in a PCR
reaction with 25 pmol of rc-Ig.kappa. signal sequence-F and rcFc-R
primers and run as before, annealing at 58.degree. C. and
continuing for 16 cycles. The expected sized band (.about.772 bp)
was gel purified with a Gel Extraction kit (Qiagen, Valencia
Calif.) and cloned into pGEM T-Easy (Promega, Madison, Wis.) to
produce an intermediate plasmid pSYN-Fc-007 (pGEM T-Easy/Igk sig
seq-Fc). The entire Ig.kappa. signal sequence-Fc cassette was then
subcloned using the HindIII and EcoRI sites into either the pEE6.4
(Lonza, Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, Calif.)
mammalian expression vector, depending on the system to be used, to
generate pSYN-Fc-009 (pEE6.4/Ig.kappa. sig seq-Fc) and pSYN-Fc-015
(pcDNA3/Ig.kappa. sig seq-Fc).
Example 32
Cloning of lgic Signal Sequence--Fc N297A Construct for Making
Untagqed Fc N297A Alone
[0325] In order to mutate Asn 297 (EU numbering) of the Fc to an
Ala residue, the following primers were used:
TABLE-US-00024 N297A-F (SEQ ID NO: 104)
5'-GAGCAGTACGCTAGCACGTACCG-3' N297A-R (SEQ ID NO: 105)
5'-GGTACGTGCTAGCGTACTGCTCC-3'
[0326] Two PCR reactions were carried out with 25 pmol of either
rc-Ig.kappa. signal sequence-F and N297A-R or N297A-F and rcFc-R
using Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to the manufacturer's standard
protocol in a MJ Thermocycler. Both reactions were carried out
using 500 ng of pSYN-Fc-007 as a template using the following
cycles: 94.degree. C. 2 minutes; 16 cycles of (94.degree. C. 30
seconds, 48.degree. C. 30 seconds, 72.degree. C. 45 seconds),
72.degree. C. 10 minutes. The expected sized bands (.about.319 and
475 bp, respectively) were gel purified with a Gel Extraction kit
(Qiagen, Valencia Calif.), then combined in a PCR reaction with 25
pmol of rc-Ig.kappa. signal sequence-F and rcFc-R primers and run
as before, annealing at 589 C and continuing for 16 cycles. The
expected sized band (.about.772 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia Calif.) and cloned into pGEM
T-Easy (Promega, Madison, Wis.) to produce an intermediate plasmid
pSYN-Fc-008 (pGEM T-Easy/Ig.kappa. sig seq-Fc N297A). The entire
Ig.kappa. signal sequence-Fc alone cassette was then subcloned
using the HindIII and EcoRI sites into either the pEE6.4 (Lonza,
Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, Calif.) mammalian
expression vector, depending on the system to be used, to generate
pSYN-Fc-010 (pEE6.4/IgK sig seq-Fc N297A) and pSYN-Fc-016
pcDNA3/IgK sig seq-Fc N297A).
[0327] These same N297A primers were also used with rcFc-F and
rcFc-R primers and pSYN-Fc-001 as a template in a PCR reaction
followed by subcloning as indicated above to generate pSYN-Fc-002
(pGEM T Easy/Fc N297A).
Example 33
Cloning of EpoFc and Fc into Single Plasmid for Double Gene Vectors
for Making EpoFc Wildtype or N297A monomer-Dimer Hybrids, and
Expression
[0328] An alternative to transfecting the EpoFc and Fc constructs
on separate plasmids is to clone them into a single plasmid, also
called a double gene vector, such as used in the Lonza Biologics
(Slough, UK) system. The RsrII/EcoR1 fragment from pSYN-Fc-002 was
subcloned into the corresponding sites in pEF12.4 (Lonza Biologics,
Slough, UK) according to standard procedures to generate
pSYN-Fc-006 (pEE12.4/Fc N297A fragment). The pSYN-EPO-004 plasmid
was used as a template for a PCR reaction using Epo-F primer from
Example 25 and the following primer:
TABLE-US-00025 EpoRsr-R: (SEQ ID NO: 106)
5'-CTGACGGTCCGCCCAGGAGTTCCG GAGCTGGGCACGGTGGGCATG
TGTGAGITTIGTCGACCGCAGCGG-3'
[0329] A PCR reaction was carried out using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, Ind.) according to the
manufacturer's standard protocol in a MJ Thermocycler as indicated
above, for 16 cycles with 552 C annealing temperature. The expected
sized band (.about.689 bp) was gel purified with a Gel Extraction
kit (Qiagen, Valencia Calif.) and cloned into pSYN-Fc-006 using the
HindIII/RsrII restriction sites, to generate pSYN-EPO-005
(pEE12.4/EpoFc N297A). The double gene vector for the EpoFc N297A
monomer-dimer hybrid was then constructed by cloning the NotI/BamHI
fragment from pSYN-Fc-010 into the corresponding sites in
pSYN-EPO-005 to generate pSYN-EPO-008 (pEE12.4-6.4/EpoFc N297A/Fc
N297A).
[0330] The wild type construct was also made by subcloning the wild
type Fc sequence from pSYN-Fc-001 into pSYN-EPO-005 using the RsrII
and EcoRI sites, to generate pSYN-EPO-006 (pEE12.4/EpoFc). The
double gene vector for the EpoFc monomer-dimer hybrid was then
constructed by cloning the NotI/BamHI fragment from pSYN-Fc-009
into the corresponding sites in pSYN-EPO-006 to generate
pSYN-EPO-007 (pEE12.4-6.4/EpoFc/Fc).
[0331] Each plasmid was transfected into CHOK1SV cells and positive
clones identified and adapted to serum-free suspension, as
indicated in the Lonza Biologics Manual for Standard Operating
procedures (Lonza Biologics, Slough, UK), and purified as indicated
for the other monomer-dimer constructs.
Example 34
Cloning of Human IFN.beta.Fc, IFN.beta.-Fc N297A With Eight Amino
Acid Linkers and Igk-Fc-6His Constructs (6.times. His Tag Disclosed
as SEQ ID NO: 107)
[0332] 10 ng of a human genomic DNA library from Clontech (BD
Biosciences Clontech, Palo Alto, Calif.) was used as a template to
isolate human IFN.beta. with its native signal sequence using the
following primers:
TABLE-US-00026 IFN.beta.-F H3/SbfI: (SEQ ID NO: 92)
5'-CTAGCCTGCAGGAAGCTTGCCGCCACCATGACCA ACAAGTGTCTCCTC-3' IFN.beta.-R
(EFAG) Sal: (SEQ ID NO: 93) 5'TTTGTCGACCGCAGCGGCGCCGGCGAACTCGTTTCGG
AGGTAACCTGTAAG-3'
[0333] The reverse primer was also used to create an eight amino
acid linker sequence (EFAGAAAV) (SEQ ID NO: 31) on the 3' end of
the human IFN.beta. sequence. The PCR reaction was carried out
using the Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to the manufacturer's standard
protocol in a Rapid Cycler thermocycler (Idaho Technology, Salt
Lake City, Utah). A PCR product of the correct size (.about.607 bp)
was gel purified using a Gel Extraction kit (Qiagen; Valencia,
Calif.), cloned into TA cloning vector (Promega, Madison, Wis.) and
sequenced. This construct was named pSYN-IFN.beta.-002.
pSYN-IFN.beta.-002 was digested with SbfI and SalI and cloned into
pSP72 (Promega) at PstI and SalI sites to give
pSYN-IFN.beta.-005.
[0334] Purified pSYN-Fc-001 (0.6 .mu.g) was digested with SalI and
EcoRI and cloned into the corresponding sites of pSYN-IFN.beta.-005
to create the plasmid pSYN-IFN.beta.-006 which contains human
IFN.beta. linked to human Fc through an eight amino acid linker
sequence. pSYN-IFN.beta.-006 was then digested with SbfI and EcoRI
and the full-length IFN.beta.-Fc sequence cloned into the PstI and
EcoRI sites of pEDdC.sig to create plasmid pSYN-IFN.beta.-008.
[0335] pSYN-Fc-002 containing the human Fc DNA with a single amino
acid change from asparagine to alanine at position 297 (N297A; EU
numbering) was digested with BspEI and XmaI to isolate a DNA
fragment of .about.365 bp containing the N297A mutation. This DNA
fragment was cloned into the corresponding sites in
pSYN-IFN.beta.-008 to create plasmid pSYN-IFN.beta.-009 that
contains the IFN.beta.-Fc sequence with an eight amino acid linker
and an N297A mutation in Fc in the expression vector, pED.dC.
[0336] Cloning of Ig.kappa. signal sequence-Fc N297A-6His -(SEQ ID
NO: 107). The following primers were used to add a 6.times. His tag
(SEQ ID NO: 107) to the C terminus of the Fc N297A coding
sequence:
TABLE-US-00027 Fc GS-F: (SEQ ID NO: 94)
5'-GGCAAGCTTGCCGCCACCATGGAGACAGACACACTCC-3' Fc.6His-R: (SEQ ID NO:
95) 5'-TCAGTGGTGATGGTGATGATGTTTACCCGGAGACAGGGAG-3' Fc.6His-F (6xHis
tag disclosed as SEQ ID NO: 107): (SEQ ID NO: 96)
5'-GGTAAACATCATCACCATCACCACTGAGAATTCC AATATCACTAGTGAATTCG-3'
Sp6+T-R: (SEQ ID NO: 97) 5'-GCTATTTAGGTGACACTATAGAATACTCAAGC-3'
[0337] Two PCR reactions were carried out with 50 pmol of either Fc
GS-F and Fc.6His-R (6.times. His tag disclosed as SEQ ID NO: 107)
or Fc.6His-F (6.times. His tag disclosed as SEQ ID NO: 107) and
Sp6+T-R using the Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to the manufacturer's standard
protocol in a MJ Thermocycler. Both reactions were carried out
using 500 ng of pSYN-Fc-008 as a template in a 50 .mu.l reaction,
using standard cycling conditions. The expected sized bands
(.about.780 and 138 bp, respectively) were gel purified with a Gel
Extraction kit (Qiagen, Valencia Calif.), then combined in a 50
.mu.l PCR reaction with 50 pmol of Fc GS-F and Sp6+T-R primers and
run as before, using standard cycling conditions. The expected
sized band (.about.891 bp) was gel purified with a Gel Extraction
kit (Qiagen, Valencia Calif.) and cloned into pcDNA6 V5-His B using
the HindIII and EcoRI sites to generate pSYN-Fc-014 (pcDNA6/IgK sig
seq-Fc N297A-6 His).
Example 35
Expression and Purification of IFN.beta.Fc, IFN.beta.-Fc N297A
Homodimer and IFN.beta.-Fc N297A Monomer-Dimer Hybrid
[0338] CHO DG44 cells were plated in 100 mm tissue culture dishes
and grown to a confluency of 50%-60%. A total of 10 .mu.g of DNA
was used to transfect a single 100 mm dish. For the homodimer
transfection, 10 .mu.g of the pSYN-FN.beta.-008 or
pSYN-IFN.beta.-009 construct was used; for the monomer-dimer hybrid
transfection, 8 .mu.g of the pSYN-IFN.beta.-009 +2 .mu.g of
pSYN-Fc-014 construct was used. The cells were transfected using
Superfect transfection reagents (Oiagen, Valencia, Calif.)
according to the manufacturer's instructions. 48 to 72 hours
post-transfection, growth medium was removed and cells were
released from the plates with 0.25% trypsin and transferred to T75
tissue culture flasks in selection medium (MEM Alpha without
nucleosides plus 5% dialyzed fetal bovine serum). The selection
medium for the monomer-dimer hybrid transfection was supplemented
with 5 .mu.g/ml Blasticidin (Invitrogen, Carlsbad, Calif.).
Selection was continued for 10-14 days until the cells began to
grow well and stable cell lines were established. Protein
expression was subsequently amplified by the addition methotrexate:
ranging from 10 to 50 nM.
[0339] For all cell lines, approximately 2.times.10.sup.7 cells
were used to inoculate 300 ml of growth medium in a 1700 cm.sup.2
roller bottle (Corning, Corning, N.Y.). The roller bottles were
incubated in a 5% CO.sub.2 incubator at 37.degree. C. for
approximately 72 hours. The growth medium was then exchanged with
300 ml serum-free production medium (DMEM/F12 with 5 .mu.g/ml human
insulin). The production medium (conditioned medium) was collected
every day for 10 days and stored at 4.degree. C. Fresh production
medium was added to the roller bottles after each collection and
the bottles were returned to the incubator. Prior to
chromatography, the medium was clarified using a SuporCap-100
(0.8/0.2 .mu.m) filter from Pall Gelman Sciences (Ann Arbor,
Mich.). All of the following steps were performed at 4.degree. C.
The clarified medium was applied to Protein A Sepharose, washed
with 5 column volumes of 1.times. PBS (10 mM phosphate, pH 7.4, 2.7
mM KCl, and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and
then neutralized with 1/10 volume of 1 M Tris-HCl pH 8.0, 5 M NaCl.
The homodimer proteins were further purified over a Superdex 200
Prep Grade sizing column run and eluted in 50 mM sodium phosphate
pH 7.5, 500 mM NaCl, 10% glycerol.
[0340] The monomer-dimer hybrid protein was subject to further
purification since it contained a mixture of IFN.beta.Fc
N297A:IFN.beta.Fc N297A homodimer, IFN.beta.Fc N297A: Fc N297A His
monomer-dimer hybrid, and Fc N297A His: Fc N297A His homodimer.
Material was applied to a Nickel chelating column in 50 mM sodium
phosphate pH 7.5, 500 mM NaCl. After loading, the column was washed
with 50 mM imidazole in 50 mM sodium phosphate pH 7.5, 500 mM NaCl
and protein was eluted with a gradient of 50-500 mM imidazole in 50
mM sodium phosphate pH 7.5, 500 mM NaCl. Fractions corresponding to
elution peaks on a UV detector were collected and analyzed by
SDS-PAGE. Fractions from the first peak contained IFN.beta.Fc
N297A: Fc N297A His monomer-dimer hybrid, while the second peak
contained Fc N297A His: Fc N297A His homodimer. All fractions
containing the monomer-dimer hybrid, but no Fc homodimer, were
pooled and applied directly to a Superdex 200 Prep Grade sizing
column, run and eluted in 50 mM sodium phosphate pH 7.5, 500 mM
NaCl, 10% glycerol. Fractions containing IFN.beta.-Fc N297A:Fc
N297A His monomer-dimer hybrids were pooled and stored at
-80.degree. C.
Example 36
Antiviral Assay for IFN.beta. Activity
[0341] Antiviral activity (IU/ml) of IFN.beta. fusion proteins was
determined using a CPE (cytopathic effect) assay. A549 cells were
plated in a 96 well tissue culture plate in growth media (RPMI 1640
supplemented with 10% fetal bovine serum (FBS) and 2 mM
L-glutamine) for 2 hours at 37.degree. C., 5% CO.sub.2. IFN.beta.
standards and IFN.beta. fusion proteins were diluted in growth
media and added to cells in triplicate for 20 hours at 37.degree.
C., 5% CO.sub.2. Following incubation, all media was removed from
wells, encephalomyocarditis virus (EMCV) was diluted in growth
media and added (3000 pfu/well) to each well with the exception of
control wells. Plates were incubated at 37.degree. C., 5% CO.sub.2
for 28 hours. Living cells were fixed with 10% cold trichloroacetic
acid (TCA) and then stained with Sulforhodamine B (SRB) according
to published protocols (Rubinstein et al. 1990, J. Natl. Cancer
Inst. 82, 1113). The SRB dye was solubilized with 10 mM Tris pH
10.5 and read on a spectrophotometer at 490 nm. Samples were
analyzed by comparing activities to a known standard curve ranging
from 10 to 0.199 IU/ml. The results are presented below in Table 8
and demonstrate increased antiviral activity of monomer-dimer
hybrids.
TABLE-US-00028 TABLE 8 INTERFERON BETA ANTIVIRAL ASSAY HOMODIMER V.
MONOMER-DIMER HYBRID Antiviral Activity Protein (IU/nmol) Std dev
IFN.beta.-Fc 8aa linker homodimer 4.5 .times. 10.sup.5 0.72 .times.
10.sup.5 IFN.beta.Fc N297A 8aa linker homodimer 3.21 .times.
10.sup.5 0.48 .times. 10.sup.5 IFN.beta.Fc N297A 8aa linker: Fc His
12.2 .times. 10.sup.5 2 .times. 10.sup.5 monomer-dimer hybrid
Example 37
Administration of IFN.beta.Fc Homodimer and Monomer-Dimer Hybrid
With an Eight Amino Acid Linker to Cynomolqus Monkeys
[0342] For pulmonary administration, aerosols of either IFN.beta.Fc
homodimer or IFN.beta.Fc N297A monomer-dimer hybrid proteins (both
with the 8 amino acid linker) in PBS, pH 7.4, 0.25% HSA were
created with the Aeroneb Pro.TM. (AeroGen, Mountain View, Calif.)
nebulizer, in-line with a Bird Mark 7A respirator, and administered
to anesthetized naive cynomolgus monkeys through endotracheal tubes
(approximating normal tidal breathing). Blood samples were taken at
various time points, and the amount of IFN.beta.-containing protein
in the resulting serum was quantitated using a human IFN.beta.
Immunoassay (Biosource International, Camarillo, Calif.).
Pharmacokinetic parameters were calculated using the software
WinNonLin. Table 9 presents the results of cynomolgus monkeys
treated with IFN.beta.Fc N297A monomer-dimer hybrid or IFN.beta.Fc
homodimer.
TABLE-US-00029 TABLE 9 ADMINISTRATION OF IFN.beta.FC N297A
MONOMER-DIMER HYBRID AND IFN.beta.FC HOMODIMER TO MONKEYS Approx.
Deposited Dose.sup.1 C.sub.max AUC t.sub.1/2 t.sub.1/2 avg Protein
Monkey # Route (.mu.g/kg) (ng/ml) (ng hr mL.sup.-1 ) (hr) (hr)
IFN.beta.Fc C07308 pulm 20 23.3 987.9 27.6 27.1 N297A C07336 pulm
20 22.4 970.6 25.6 monomer- C07312 pulm 20 21.2 1002.7 28.0 dimer
hybrid IFN.beta.Fc C07326 pulm 20 2.6 94.6 11.1 11.4 homodimer
C07338 pulm 20 5.0 150.6 11.7 .sup.1Based on 15% deposition
fraction of nebulized dose as determined by gamma scintigraphy
[0343] The pharmacokinetics of IFN.beta.Fc with an 8 amino acid
linker administered to cynomolgus monkeys is presented in FIG. 15.
The figure compares the IFN.beta.Fc homodimer with the IFN.beta.Fc
N297A monomer-dimer hybrid in monkeys after administration of a
single pulmonary dose. Significantly higher serum levels were
obtained in monkeys treated with the monomer-dimer hybrid compared
to the homodimer.
[0344] Serum samples were also analyzed for neopterin levels (a
biomarker of IFN.beta. activity) using a neopterin immunoassay (MP
Biomedicals, Orangeburg, N.Y.). The results for this analysis are
shown in FIG. 16. The figure compares neopterin stimulation in
response to the IFN.beta.-Fc homodimer and the IFN.beta.-Fc N297A
monomer-dimer hybrid. It can be seen that significantly higher
neopterin levels were detected in monkeys treated with IFN.beta.-Fc
N297A monomer-dimer hybrid as compared to the IFN.beta.-Fc
homodimer.
[0345] All numbers expressing quantities of ingredients, reaction
conditions, and so forth used in the specification and claims are
to be understood as being modified in all instances by the term
"about." Accordingly, unless indicated to the contrary, the
numerical parameters set forth in the specification and attached
claims are approximations that may vary depending upon the desired
properties sought to be obtained by the present invention. At the
very least, and not as an attempt to limit the application of the
doctrine of equivalents to the scope of the claims, each numerical
parameter should be construed in light of the number of significant
digits and ordinary rounding approaches.
[0346] All references cited herein are incorporated herein by
reference in their entirety and for all purposes to the same extent
as if each individual publication or patent or patent application
was specifically and individually indicated to be incorporated by
reference in its entirety for all purposes. To the extent
publications and patents or patent applications incorporated by
reference contradict the disclosure contained in the specification,
the specification is intended to supercede and/or take precedence
over any such contradictory material.
[0347] Many modifications and variations of this invention can be
made without departing from its spirit and scope, as will be
apparent to those skilled in the art. The specific embodiments
described herein are offered by way of example only and are not
meant to be limiting in any way. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims.
Sequence CWU 1
1
107136PRTHuman immunodeficiency virus 1Tyr Thr Ser Leu Ile His Ser
Leu Ile Glu Glu Ser Gln Asn Gln Gln 1 5 10 15 Glu Lys Asn Glu Gln
Glu Leu Leu Glu Leu Asp Lys Trp Ala Ser Leu 20 25 30 Trp Asn Trp
Phe 35 237PRTHuman immunodeficiency virus 2Asn Asn Leu Arg Ala Ile
Glu Ala Gln Gln His Leu Leu Gln Leu Thr 1 5 10 15 Val Trp Gly Ile
Lys Gln Leu Gln Ala Arg Ile Leu Ala Val Glu Arg 20 25 30 Tyr Leu
Lys Asp Gln 35 339PRTHuman immunodeficiency virus 3Trp Gln Glu Trp
Glu Gln Lys Ile Thr Ala Leu Leu Glu Gln Ala Gln 1 5 10 15 Ile Gln
Gln Glu Lys Asn Glu Tyr Glu Leu Gln Lys Leu Asp Lys Trp 20 25 30
Ala Ser Leu Trp Glu Trp Phe 35 4238PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct 4Met
Gly Ile Glu Gly Arg Gly Ala Ala Ala Val Asp Thr Ser His Thr 1 5 10
15 Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe
20 25 30 Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
Thr Pro 35 40 45 Glu Val Thr Cys Val Val Val Asp Val Ser His Glu
Asp Pro Glu Val 50 55 60 Lys Phe Asn Trp Tyr Val Asp Gly Val Glu
Val His Asn Ala Lys Thr 65 70 75 80 Lys Pro Arg Glu Glu Gln Tyr Asn
Ser Thr Tyr Arg Val Val Ser Val 85 90 95 Leu Thr Val Leu His Gln
Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 100 105 110 Lys Val Ser Asn
Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser 115 120 125 Lys Ala
Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 130 135 140
Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val 145
150 155 160 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
Asn Gly 165 170 175 Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val
Leu Asp Ser Asp 180 185 190 Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
Val Asp Lys Ser Arg Trp 195 200 205 Gln Gln Gly Asn Val Phe Ser Cys
Ser Val Met His Glu Ala Leu His 210 215 220 Asn His Tyr Thr Gln Lys
Ser Leu Ser Leu Ser Pro Gly Phe 225 230 235 5714DNAArtificial
SequenceDescription of Artificial Sequence Synthetic construct
5atgggcattg aaggcagagg cgccgctgcg gtcgatacta gtcacacatg cccaccgtgc
60ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac
120accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt
gagccacgaa 180gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg
aggtgcataa tgccaagaca 240aagccgcggg aggagcagta caacagcacg
taccgtgtgg tcagcgtcct caccgtcctg 300caccaggact ggctgaatgg
caaggagtac aagtgcaagg tctccaacaa agccctccca 360gcccccatcg
agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac
420accctgcccc catcccggga tgagctgacc aagaaccagg tcagcctgac
ctgcctggtc 480aaaggcttct atcccagcga catcgccgtg gagtgggaga
gcaatgggca gccggagaac 540aactacaaga ccacgcctcc cgtgttggac
tccgacggct ccttcttcct ctacagcaag 600ctcaccgtgg acaagagcag
gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 660gaggctctgc
acaaccacta cacgcagaag agtctctccc tgtctccggg tttt
7146671PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 6Met Val Ser Gln Ala Leu Arg Leu Leu Cys Leu
Leu Leu Gly Leu Gln 1 5 10 15 Gly Cys Leu Ala Ala Val Phe Val Thr
Gln Glu Glu Ala His Gly Val 20 25 30 Leu His Arg Arg Arg Arg Ala
Asn Ala Phe Leu Glu Glu Leu Arg Pro 35 40 45 Gly Ser Leu Glu Arg
Glu Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu 50 55 60 Ala Arg Glu
Ile Phe Lys Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile 65 70 75 80 Ser
Tyr Ser Asp Gly Asp Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly 85 90
95 Gly Ser Cys Lys Asp Gln Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro
100 105 110 Ala Phe Glu Gly Arg Asn Cys Glu Thr His Lys Asp Asp Gln
Leu Ile 115 120 125 Cys Val Asn Glu Asn Gly Gly Cys Glu Gln Tyr Cys
Ser Asp His Thr 130 135 140 Gly Thr Lys Arg Ser Cys Arg Cys His Glu
Gly Tyr Ser Leu Leu Ala 145 150 155 160 Asp Gly Val Ser Cys Thr Pro
Thr Val Glu Tyr Pro Cys Gly Lys Ile 165 170 175 Pro Ile Leu Glu Lys
Arg Asn Ala Ser Lys Pro Gln Gly Arg Ile Val 180 185 190 Gly Gly Lys
Val Cys Pro Lys Gly Glu Cys Pro Trp Gln Val Leu Leu 195 200 205 Leu
Val Asn Gly Ala Gln Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile 210 215
220 Trp Val Val Ser Ala Ala His Cys Phe Asp Lys Ile Lys Asn Trp Arg
225 230 235 240 Asn Leu Ile Ala Val Leu Gly Glu His Asp Leu Ser Glu
His Asp Gly 245 250 255 Asp Glu Gln Ser Arg Arg Val Ala Gln Val Ile
Ile Pro Ser Thr Tyr 260 265 270 Val Pro Gly Thr Thr Asn His Asp Ile
Ala Leu Leu Arg Leu His Gln 275 280 285 Pro Val Val Leu Thr Asp His
Val Val Pro Leu Cys Leu Pro Glu Arg 290 295 300 Thr Phe Ser Glu Arg
Thr Leu Ala Phe Val Arg Phe Ser Leu Val Ser 305 310 315 320 Gly Trp
Gly Gln Leu Leu Asp Arg Gly Ala Thr Ala Leu Glu Leu Met 325 330 335
Val Leu Asn Val Pro Arg Leu Met Thr Gln Asp Cys Leu Gln Gln Ser 340
345 350 Arg Lys Val Gly Asp Ser Pro Asn Ile Thr Glu Tyr Met Phe Cys
Ala 355 360 365 Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys Lys Gly Asp
Ser Gly Gly 370 375 380 Pro His Ala Thr His Tyr Arg Gly Thr Trp Tyr
Leu Thr Gly Ile Val 385 390 395 400 Ser Trp Gly Gln Gly Cys Ala Thr
Val Gly His Phe Gly Val Tyr Thr 405 410 415 Arg Val Ser Gln Tyr Ile
Glu Trp Leu Gln Lys Leu Met Arg Ser Glu 420 425 430 Pro Arg Pro Gly
Val Leu Leu Arg Ala Pro Phe Pro Asp Lys Thr His 435 440 445 Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val 450 455 460
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 465
470 475 480 Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp
Pro Glu 485 490 495 Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val
His Asn Ala Lys 500 505 510 Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
Thr Tyr Arg Val Val Ser 515 520 525 Val Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys Glu Tyr Lys 530 535 540 Cys Lys Val Ser Asn Lys
Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile 545 550 555 560 Ser Lys Ala
Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 565 570 575 Pro
Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 580 585
590 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn
595 600 605 Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
Asp Ser 610 615 620 Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val
Asp Lys Ser Arg 625 630 635 640 Trp Gln Gln Gly Asn Val Phe Ser Cys
Ser Val Met His Glu Ala Leu 645 650 655 His Asn His Tyr Thr Gln Lys
Ser Leu Ser Leu Ser Pro Gly Lys 660 665 670 72016DNAArtificial
SequenceDescription of Artificial Sequence Synthetic construct
7atggtctccc aggccctcag gctcctctgc cttctgcttg ggcttcaggg ctgcctggct
60gcagtcttcg taacccagga ggaagcccac ggcgtcctgc accggcgccg gcgcgccaac
120gcgttcctgg aggagctgcg gccgggctcc ctggagaggg agtgcaagga
ggagcagtgc 180tccttcgagg aggcccggga gatcttcaag gacgcggaga
ggacgaagct gttctggatt 240tcttacagtg atggggacca gtgtgcctca
agtccatgcc agaatggggg ctcctgcaag 300gaccagctcc agtcctatat
ctgcttctgc ctccctgcct tcgagggccg gaactgtgag 360acgcacaagg
atgaccagct gatctgtgtg aacgagaacg gcggctgtga gcagtactgc
420agtgaccaca cgggcaccaa gcgctcctgt cggtgccacg aggggtactc
tctgctggca 480gacggggtgt cctgcacacc cacagttgaa tatccatgtg
gaaaaatacc tattctagaa 540aaaagaaatg ccagcaaacc ccaaggccga
attgtggggg gcaaggtgtg ccccaaaggg 600gagtgtccat ggcaggtcct
gttgttggtg aatggagctc agttgtgtgg ggggaccctg 660atcaacacca
tctgggtggt ctccgcggcc cactgtttcg acaaaatcaa gaactggagg
720aacctgatcg cggtgctggg cgagcacgac ctcagcgagc acgacgggga
tgagcagagc 780cggcgggtgg cgcaggtcat catccccagc acgtacgtcc
cgggcaccac caaccacgac 840atcgcgctgc tccgcctgca ccagcccgtg
gtcctcactg accatgtggt gcccctctgc 900ctgcccgaac ggacgttctc
tgagaggacg ctggccttcg tgcgcttctc attggtcagc 960ggctggggcc
agctgctgga ccgtggcgcc acggccctgg agctcatggt cctcaacgtg
1020ccccggctga tgacccagga ctgcctgcag cagtcacgga aggtgggaga
ctccccaaat 1080atcacggagt acatgttctg tgccggctac tcggatggca
gcaaggactc ctgcaagggg 1140gacagtggag gcccacatgc cacccactac
cggggcacgt ggtacctgac gggcatcgtc 1200agctggggcc agggctgcgc
aaccgtgggc cactttgggg tgtacaccag ggtctcccag 1260tacatcgagt
ggctgcaaaa gctcatgcgc tcagagccac gcccaggagt cctcctgcga
1320gccccatttc ccgacaaaac tcacacgtgc ccgccgtgcc cagctccgga
actgctgggc 1380ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca
ccctcatgat ctcccggacc 1440cctgaggtca catgcgtggt ggtggacgtg
agccacgaag accctgaggt caagttcaac 1500tggtacgtgg acggcgtgga
ggtgcataat gccaagacaa agccgcggga ggagcagtac 1560aacagcacgt
accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc
1620aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga
gaaaaccatc 1680tccaaagcca aagggcagcc ccgagaacca caggtgtaca
ccctgccccc atcccgggat 1740gagctgacca agaaccaggt cagcctgacc
tgcctggtca aaggcttcta tcccagcgac 1800atcgccgtgg agtgggagag
caatgggcag ccggagaaca actacaagac cacgcctccc 1860gtgttggact
ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg
1920tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca
caaccactac 1980acgcagaaga gcctctccct gtctccgggt aaatga
20168696PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 8Met Gln Arg Val Asn Met Ile Met Ala Glu Ser
Pro Gly Leu Ile Thr 1 5 10 15 Ile Cys Leu Leu Gly Tyr Leu Leu Ser
Ala Glu Cys Thr Val Phe Leu 20 25 30 Asp His Glu Asn Ala Asn Lys
Ile Leu Asn Arg Pro Lys Arg Tyr Asn 35 40 45 Ser Gly Lys Leu Glu
Glu Phe Val Gln Gly Asn Leu Glu Arg Glu Cys 50 55 60 Met Glu Glu
Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe Glu Asn 65 70 75 80 Thr
Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly Asp Gln 85 90
95 Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp Asp Ile
100 105 110 Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys
Asn Cys 115 120 125 Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg
Cys Glu Gln Phe 130 135 140 Cys Lys Asn Ser Ala Asp Asn Lys Val Val
Cys Ser Cys Thr Glu Gly 145 150 155 160 Tyr Arg Leu Ala Glu Asn Gln
Lys Ser Cys Glu Pro Ala Val Pro Phe 165 170 175 Pro Cys Gly Arg Val
Ser Val Ser Gln Thr Ser Lys Leu Thr Arg Ala 180 185 190 Glu Thr Val
Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu Ala Glu 195 200 205 Thr
Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn Asp Phe 210 215
220 Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe Pro Trp
225 230 235 240 Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly
Gly Ser Ile 245 250 255 Val Asn Glu Lys Trp Ile Val Thr Ala Ala His
Cys Val Glu Thr Gly 260 265 270 Val Lys Ile Thr Val Val Ala Gly Glu
His Asn Ile Glu Glu Thr Glu 275 280 285 His Thr Glu Gln Lys Arg Asn
Val Ile Arg Ile Ile Pro His His Asn 290 295 300 Tyr Asn Ala Ala Ile
Asn Lys Tyr Asn His Asp Ile Ala Leu Leu Glu 305 310 315 320 Leu Asp
Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile Cys Ile 325 330 335
Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser Gly Tyr 340
345 350 Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala Leu
Val 355 360 365 Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr
Cys Leu Arg 370 375 380 Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe
Cys Ala Gly Phe His 385 390 395 400 Glu Gly Gly Arg Asp Ser Cys Gln
Gly Asp Ser Gly Gly Pro His Val 405 410 415 Thr Glu Val Glu Gly Thr
Ser Phe Leu Thr Gly Ile Ile Ser Trp Gly 420 425 430 Glu Glu Cys Ala
Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys Val Ser 435 440 445 Arg Tyr
Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr Glu Phe Ala 450 455 460
Gly Ala Ala Ala Val Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 465
470 475 480 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro 485 490 495 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val 500 505 510 Val Asp Val Ser His Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val 515 520 525 Asp Gly Val Glu Val His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln 530 535 540 Tyr Asn Ser Thr Tyr Arg
Val Val Ser Val Leu Thr Val Leu His Gln 545 550 555 560 Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 565 570 575 Leu
Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 580 585
590 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr
595 600 605 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr
Pro Ser 610 615 620 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro
Glu Asn Asn Tyr 625 630 635 640 Lys Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly Ser Phe Phe Leu Tyr 645 650 655 Ser Lys Leu Thr Val Asp Lys
Ser Arg Trp Gln Gln Gly Asn Val Phe 660 665 670 Ser Cys Ser Val Met
His Glu Ala Leu His Asn His Tyr Thr Gln Lys 675 680 685 Ser Leu Ser
Leu Ser Pro Gly Lys 690 695 92091DNAArtificial SequenceDescription
of Artificial Sequence Synthetic construct 9atgcagcgcg tgaacatgat
catggcagaa tcaccaggcc tcatcaccat ctgcctttta 60ggatatctac tcagtgctga
atgtacagtt tttcttgatc atgaaaacgc caacaaaatt 120ctgaatcggc
caaagaggta taattcaggt aaattggaag agtttgttca agggaacctt
180gagagagaat gtatggaaga aaagtgtagt tttgaagaag cacgagaagt
ttttgaaaac 240actgaaagaa caactgaatt ttggaagcag tatgttgatg
gagatcagtg tgagtccaat 300ccatgtttaa atggcggcag ttgcaaggat
gacattaatt cctatgaatg ttggtgtccc 360tttggatttg aaggaaagaa
ctgtgaatta gatgtaacat gtaacattaa gaatggcaga 420tgcgagcagt
tttgtaaaaa tagtgctgat aacaaggtgg tttgctcctg tactgaggga
480tatcgacttg cagaaaacca gaagtcctgt gaaccagcag tgccatttcc
atgtggaaga 540gtttctgttt cacaaacttc taagctcacc cgtgctgaga
ctgtttttcc tgatgtggac 600tatgtaaatt ctactgaagc tgaaaccatt
ttggataaca tcactcaaag cacccaatca 660tttaatgact tcactcgggt
tgttggtgga gaagatgcca aaccaggtca attcccttgg 720caggttgttt
tgaatggtaa agttgatgca ttctgtggag gctctatcgt taatgaaaaa
780tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt
tgtcgcaggt 840gaacataata ttgaggagac agaacataca gagcaaaagc
gaaatgtgat tcgaattatt 900cctcaccaca actacaatgc agctattaat
aagtacaacc atgacattgc ccttctggaa 960ctggacgaac ccttagtgct
aaacagctac gttacaccta tttgcattgc tgacaaggaa 1020tacacgaaca
tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc
1080cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt
tgaccgagcc 1140acatgtcttc gatctacaaa gttcaccatc tataacaaca
tgttctgtgc tggcttccat 1200gaaggaggta gagattcatg tcaaggagat
agtgggggac cccatgttac tgaagtggaa 1260gggaccagtt tcttaactgg
aattattagc tggggtgaag agtgtgcaat gaaaggcaaa 1320tatggaatat
ataccaaggt atcccggtat gtcaactgga ttaaggaaaa aacaaagctc
1380actgaattcg ccggcgccgc tgcggtcgac aaaactcaca catgcccacc
gtgcccagca 1440cctgaactcc tggggggacc gtcagtcttc ctcttccccc
caaaacccaa ggacaccctc 1500atgatctccc ggacccctga ggtcacatgc
gtggtggtgg acgtgagcca cgaagaccct 1560gaggtcaagt tcaactggta
cgtggacggc gtggaggtgc ataatgccaa gacaaagccg 1620cgggaggagc
agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag
1680gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct
cccagccccc 1740atcgagaaaa ccatctccaa agccaaaggg cagccccgag
aaccacaggt gtacaccctg 1800cccccatccc gggatgagct gaccaagaac
caggtcagcc tgacctgcct ggtcaaaggc 1860ttctatccca gcgacatcgc
cgtggagtgg gagagcaatg ggcagccgga gaacaactac 1920aagaccacgc
ctcccgtgtt ggactccgac ggctccttct tcctctacag caagctcacc
1980gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat
gcatgaggct 2040ctgcacaacc actacacgca gaagagcctc tccctgtctc
cgggtaaatg a 209110423PRTArtificial SequenceDescription of
Artificial Sequence Synthetic construct 10Met Ala Leu Thr Phe Ala
Leu Leu Val Ala Leu Leu Val Leu Ser Cys 1 5 10 15 Lys Ser Ser Cys
Ser Val Gly Cys Asp Leu Pro Gln Thr His Ser Leu 20 25 30 Gly Ser
Arg Arg Thr Leu Met Leu Leu Ala Gln Met Arg Arg Ile Ser 35 40 45
Leu Phe Ser Cys Leu Lys Asp Arg His Asp Phe Gly Phe Pro Gln Glu 50
55 60 Glu Phe Gly Asn Gln Phe Gln Lys Ala Glu Thr Ile Pro Val Leu
His 65 70 75 80 Glu Met Ile Gln Gln Ile Phe Asn Leu Phe Ser Thr Lys
Asp Ser Ser 85 90 95 Ala Ala Trp Asp Glu Thr Leu Leu Asp Lys Phe
Tyr Thr Glu Leu Tyr 100 105 110 Gln Gln Leu Asn Asp Leu Glu Ala Cys
Val Ile Gln Gly Val Gly Val 115 120 125 Thr Glu Thr Pro Leu Met Lys
Glu Asp Ser Ile Leu Ala Val Arg Lys 130 135 140 Tyr Phe Gln Arg Ile
Thr Leu Tyr Leu Lys Glu Lys Lys Tyr Ser Pro 145 150 155 160 Cys Ala
Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser Phe Ser Leu 165 170 175
Ser Thr Asn Leu Gln Glu Ser Leu Arg Ser Lys Glu Glu Phe Ala Gly 180
185 190 Ala Ala Ala Val Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro 195 200 205 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys 210 215 220 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val 225 230 235 240 Asp Val Ser His Glu Asp Pro Glu
Val Lys Phe Asn Trp Tyr Val Asp 245 250 255 Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 260 265 270 Asn Ser Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 275 280 285 Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 290 295 300
Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 305
310 315 320 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu
Thr Lys 325 330 335 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp 340 345 350 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys 355 360 365 Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly Ser Phe Phe Leu Tyr Ser 370 375 380 Lys Leu Thr Val Asp Lys
Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 385 390 395 400 Cys Ser Val
Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser 405 410 415 Leu
Ser Leu Ser Pro Gly Lys 420 111272DNAArtificial SequenceDescription
of Artificial Sequence Synthetic construct 11atggccttga cctttgcttt
actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc 60tctgtgggct gtgatctgcc
tcaaacccac agcctgggta gcaggaggac cttgatgctc 120ctggcacaga
tgaggagaat ctctcttttc tcctgcttga aggacagaca tgactttgga
180tttccccagg aggagtttgg caaccagttc caaaaggctg aaaccatccc
tgtcctccat 240gagatgatcc agcagatctt caatctcttc agcacaaagg
actcatctgc tgcttgggat 300gagaccctcc tagacaaatt ctacactgaa
ctctaccagc agctgaatga cctggaagcc 360tgtgtgatac agggggtggg
ggtgacagag actcccctga tgaaggagga ctccattctg 420gctgtgagga
aatacttcca aagaatcact ctctatctga aagagaagaa atacagccct
480tgtgcctggg aggttgtcag agcagaaatc atgagatctt tttctttgtc
aacaaacttg 540caagaaagtt taagaagtaa ggaagaattc gccggcgccg
ctgcggtcga caaaactcac 600acatgcccac cgtgcccagc acctgaactc
ctggggggac cgtcagtctt cctcttcccc 660ccaaaaccca aggacaccct
catgatctcc cggacccctg aggtcacatg cgtggtggtg 720gacgtgagcc
acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg
780cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg
tgtggtcagc 840gtcctcaccg tcctgcacca ggactggctg aatggcaagg
agtacaagtg caaggtctcc 900aacaaagccc tcccagcccc catcgagaaa
accatctcca aagccaaagg gcagccccga 960gaaccacagg tgtacaccct
gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 1020ctgacctgcc
tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat
1080gggcagccgg agaacaacta caagaccacg cctcccgtgt tggactccga
cggctccttc 1140ttcctctaca gcaagctcac cgtggacaag agcaggtggc
agcaggggaa cgtcttctca 1200tgctccgtga tgcatgaggc tctgcacaac
cactacacgc agaagagcct ctccctgtct 1260ccgggtaaat ga
127212415PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 12Met Ala Leu Thr Phe Ala Leu Leu Val Ala Leu
Leu Val Leu Ser Cys 1 5 10 15 Lys Ser Ser Cys Ser Val Gly Cys Asp
Leu Pro Gln Thr His Ser Leu 20 25 30 Gly Ser Arg Arg Thr Leu Met
Leu Leu Ala Gln Met Arg Arg Ile Ser 35 40 45 Leu Phe Ser Cys Leu
Lys Asp Arg His Asp Phe Gly Phe Pro Gln Glu 50 55 60 Glu Phe Gly
Asn Gln Phe Gln Lys Ala Glu Thr Ile Pro Val Leu His 65 70 75 80 Glu
Met Ile Gln Gln Ile Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser 85 90
95 Ala Ala Trp Asp Glu Thr Leu Leu Asp Lys Phe Tyr Thr Glu Leu Tyr
100 105 110 Gln Gln Leu Asn Asp Leu Glu Ala Cys Val Ile Gln Gly Val
Gly Val 115 120 125 Thr Glu Thr Pro Leu Met Lys Glu Asp Ser Ile Leu
Ala Val Arg Lys 130 135 140 Tyr Phe Gln Arg Ile Thr Leu Tyr Leu Lys
Glu Lys Lys Tyr Ser Pro 145 150 155 160 Cys Ala Trp Glu Val Val Arg
Ala Glu Ile Met Arg Ser Phe Ser Leu 165 170 175 Ser Thr Asn Leu Gln
Glu Ser Leu Arg Ser Lys Glu Asp Lys Thr His 180 185 190 Thr Cys Pro
Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val 195 200 205 Phe
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 210 215
220 Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
225 230 235 240 Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala Lys 245 250 255 Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr Arg Val Val Ser 260 265 270 Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly Lys Glu Tyr Lys 275 280 285 Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu Lys Thr Ile 290 295 300 Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 305 310 315 320 Pro Ser
Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 325 330 335
Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 340
345 350 Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp
Ser 355 360 365 Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg 370 375 380 Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu 385 390 395 400 His Asn His Tyr Thr Gln Lys Ser
Leu Ser Leu Ser Pro Gly Lys 405 410 415 131248DNAArtificial
SequenceDescription of Artificial Sequence Synthetic construct
13atggccttga cctttgcttt actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc
60tctgtgggct gtgatctgcc tcaaacccac agcctgggta gcaggaggac cttgatgctc
120ctggcacaga tgaggagaat ctctcttttc tcctgcttga aggacagaca
tgactttgga 180tttccccagg aggagtttgg caaccagttc caaaaggctg
aaaccatccc tgtcctccat 240gagatgatcc agcagatctt caatctcttc
agcacaaagg actcatctgc tgcttgggat 300gagaccctcc tagacaaatt
ctacactgaa ctctaccagc agctgaatga cctggaagcc 360tgtgtgatac
agggggtggg ggtgacagag actcccctga tgaaggagga ctccattctg
420gctgtgagga aatacttcca aagaatcact ctctatctga aagagaagaa
atacagccct 480tgtgcctggg aggttgtcag agcagaaatc atgagatctt
tttctttgtc aacaaacttg 540caagaaagtt taagaagtaa ggaagacaaa
actcacacgt gcccgccgtg cccagctccg 600gaactgctgg gcggaccgtc
agtcttcctc ttccccccaa aacccaagga caccctcatg 660atctcccgga
cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag
720gtcaagttca actggtacgt ggacggcgtg gaggtgcata atgccaagac
aaagccgcgg 780gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc
tcaccgtcct gcaccaggac 840tggctgaatg gcaaggagta caagtgcaag
gtctccaaca aagccctccc agcccccatc 900gagaaaacca tctccaaagc
caaagggcag ccccgagaac cacaggtgta caccctgccc 960ccatcccggg
atgagctgac caagaaccag gtcagcctga cctgcctggt caaaggcttc
1020tatcccagcg acatcgccgt ggagtgggag agcaatgggc agccggagaa
caactacaag 1080accacgcctc ccgtgttgga ctccgacggc tccttcttcc
tctacagcaa gctcaccgtg 1140gacaagagca ggtggcagca ggggaacgtc
ttctcatgct ccgtgatgca tgaggctctg 1200cacaaccact acacgcagaa
gagcctctcc ctgtctccgg gtaaatga 124814256PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
14Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1
5 10 15 Gly Ser Thr Gly Asp Asp Tyr Lys Asp Asp Asp Asp Lys Asp Lys
Thr 20 25 30 His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly Pro Ser 35 40 45 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
Leu Met Ile Ser Arg 50 55 60 Thr Pro Glu Val Thr Cys Val Val Val
Asp Val Ser His Glu Asp Pro 65 70 75 80 Glu Val Lys Phe Asn Trp Tyr
Val Asp Gly Val Glu Val His Asn Ala 85 90 95 Lys Thr Lys Pro Arg
Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 100 105 110 Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 115 120 125 Lys
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 130 135
140 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
145 150 155 160 Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser
Leu Thr Cys 165 170 175 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala
Val Glu Trp Glu Ser 180 185 190 Asn Gly Gln Pro Glu Asn Asn Tyr Lys
Thr Thr Pro Pro Val Leu Asp 195 200 205 Ser Asp Gly Ser Phe Phe Leu
Tyr Ser Lys Leu Thr Val Asp Lys Ser 210 215 220 Arg Trp Gln Gln Gly
Asn Val Phe Ser Cys Ser Val Met His Glu Ala 225 230 235 240 Leu His
Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 245 250 255
15771DNAArtificial SequenceDescription of Artificial Sequence
Synthetic construct 15atggagacag acacactcct gctatgggta ctgctgctct
gggttccagg ttccactggt 60gacgactaca aggacgacga tgacaaggac aaaactcaca
catgcccacc gtgcccagct 120ccggaactcc tggggggacc gtcagtcttc
ctcttccccc caaaacccaa ggacaccctc 180atgatctccc ggacccctga
ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct 240gaggtcaagt
tcaactggta cgtggacggc gtggaggtgc ataatgccaa gacaaagccg
300cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt
cctgcaccag 360gactggctga atggcaagga gtacaagtgc aaggtctcca
acaaagccct cccagccccc 420atcgagaaaa ccatctccaa agccaaaggg
cagccccgag aaccacaggt gtacaccctg 480cccccatccc gggatgagct
gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc 540ttctatccca
gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac
600aagaccacgc ctcccgtgtt ggactccgac ggctccttct tcctctacag
caagctcacc 660gtggacaaga gcaggtggca gcaggggaac gtcttctcat
gctccgtgat gcatgaggct 720ctgcacaacc actacacgca gaagagcctc
tccctgtctc cgggtaaatg a 77116444PRTArtificial SequenceDescription
of Artificial Sequence Synthetic construct 16Met Val Pro Cys Thr
Leu Leu Leu Leu Leu Ala Ala Ala Leu Ala Pro 1 5 10 15 Thr Gln Thr
Arg Ala Gly Ser Arg Ala Pro Pro Arg Leu Ile Cys Asp 20 25 30 Ser
Arg Val Leu Gln Arg Tyr Leu Leu Glu Ala Lys Glu Ala Glu Asn 35 40
45 Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu Asn Ile Thr
50 55 60 Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg Met
Glu Val 65 70 75 80 Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala
Leu Leu Ser Glu 85 90 95 Ala Val Leu Arg Gly Gln Ala Leu Leu Val
Asn Ser Ser Gln Pro Trp 100 105 110 Glu Pro Leu Gln Leu His Val Asp
Lys Ala Val Ser Gly Leu Arg Ser 115 120 125 Leu Thr Thr Leu Leu Arg
Ala Leu Gly Ala Gln Lys Glu Ala Ile Ser 130 135 140 Pro Pro Asp Ala
Ala Ser Ala Ala Pro Leu Arg Thr Ile Thr Ala Asp 145 150 155 160 Thr
Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu Arg Gly Lys 165 170
175 Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp Arg Glu Phe
180 185 190 Gly Gly Glu Tyr Gln Ala Leu Glu Lys Glu Val Ala Gln Leu
Glu Ala 195 200 205 Glu Asn Gln Ala Leu Glu Lys Glu Val Ala Gln Leu
Glu His Glu Gly 210 215 220 Gly Gly Pro Ala Pro Glu Leu Leu Gly Gly
Pro Ser Val Phe Leu Phe 225 230 235 240 Pro Pro Lys Pro Lys Asp Thr
Leu Met Ile Ser Arg Thr Pro Glu Val 245 250 255 Thr Cys Val Val Val
Asp Val Ser His Glu Asp Pro Glu Val Lys Phe 260 265 270 Asn Trp Tyr
Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 275 280 285 Arg
Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr 290 295
300 Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
305 310 315 320 Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile
Ser Lys Ala 325 330 335 Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr
Leu Pro Pro Ser Arg 340 345 350 Asp Glu Leu Thr Lys Asn Gln Val Ser
Leu Thr Cys Leu Val Lys Gly 355 360 365 Phe Tyr Pro Ser Asp Ile
Ala
Val Glu Trp Glu Ser Asn Gly Gln Pro 370 375 380 Glu Asn Asn Tyr Lys
Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser 385 390 395 400 Phe Phe
Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln 405 410 415
Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His 420
425 430 Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435 440
171335DNAArtificial SequenceDescription of Artificial Sequence
Synthetic construct 17atggtaccgt gcacgctgct cctgctgttg gcggccgccc
tggctccgac tcagacccgc 60gccggctcta gagccccacc acgcctcatc tgtgacagcc
gagtcctgca gaggtacctc 120ttggaggcca aggaggccga gaatatcacg
acgggctgtg ctgaacactg cagcttgaat 180gagaatatca ctgtcccaga
caccaaagtt aatttctatg cctggaagag gatggaggtc 240gggcagcagg
ccgtagaagt ctggcagggc ctggccctgc tgtcggaagc tgtcctgcgg
300ggccaggccc tgttggtcaa ctcttcccag ccgtgggagc ccctgcagct
gcatgtggat 360aaagccgtca gtggccttcg cagcctcacc actctgcttc
gggctctggg agcccagaag 420gaagccatct cccctccaga tgcggcctca
gctgctccac tccgaacaat cactgctgac 480actttccgca aactcttccg
agtctactcc aatttcctcc ggggaaagct gaagctgtac 540acaggggagg
cctgcaggac cggtgacagg gaattcggtg gtgagtacca ggccctggag
600aaggaggtgg cccagctgga ggccgagaac caggccctgg agaaggaggt
ggcccagctg 660gagcacgagg gtggtggtcc cgcacccgag ctgctgggcg
gaccgtcagt cttcctcttc 720cccccaaaac ccaaggacac cctcatgatc
tcccggaccc ctgaggtcac atgcgtggtg 780gtggacgtga gccacgaaga
ccctgaggtc aagttcaact ggtacgtgga cggcgtggag 840gtgcataatg
ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc
900agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa
gtgcaaggtc 960tccaacaaag ccctcccagc ccccatcgag aaaaccatct
ccaaagccaa agggcagccc 1020cgagaaccac aggtgtacac cctgccccca
tcccgggatg agctgaccaa gaaccaggtc 1080agcctgacct gcctggtcaa
aggcttctat cccagcgaca tcgccgtgga gtgggagagc 1140aatgggcagc
cggagaacaa ctacaagacc acgcctcccg tgttggactc cgacggctcc
1200ttcttcctct acagcaagct caccgtggac aagagcaggt ggcagcaggg
gaacgtcttc 1260tcatgctccg tgatgcatga ggctctgcac aaccactaca
cgcagaagag cctctccctg 1320tctccgggta aatga 133518276PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
18Met Val Pro Cys Thr Leu Leu Leu Leu Leu Ala Ala Ala Leu Ala Pro 1
5 10 15 Thr Gln Thr Arg Ala Gly Glu Phe Gly Gly Glu Tyr Gln Ala Leu
Lys 20 25 30 Lys Lys Val Ala Gln Leu Lys Ala Lys Asn Gln Ala Leu
Lys Lys Lys 35 40 45 Val Ala Gln Leu Lys His Lys Gly Gly Gly Pro
Ala Pro Glu Leu Leu 50 55 60 Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr Leu 65 70 75 80 Met Ile Ser Arg Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser 85 90 95 His Glu Asp Pro Glu
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 100 105 110 Val His Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 115 120 125 Tyr
Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 130 135
140 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro
145 150 155 160 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln 165 170 175 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu
Thr Lys Asn Gln Val 180 185 190 Ser Leu Thr Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val 195 200 205 Glu Trp Glu Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys Thr Thr Pro 210 215 220 Pro Val Leu Asp Ser
Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 225 230 235 240 Val Asp
Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 245 250 255
Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 260
265 270 Ser Pro Gly Lys 275 19831DNAArtificial SequenceDescription
of Artificial Sequence Synthetic construct 19atggtaccgt gcacgctgct
cctgctgttg gcggccgccc tggctccgac tcagacccgc 60gccggcgaat tcggtggtga
gtaccaggcc ctgaagaaga aggtggccca gctgaaggcc 120aagaaccagg
ccctgaagaa gaaggtggcc cagctgaagc acaagggcgg cggccccgcc
180ccagagctcc tgggcggacc gtcagtcttc ctcttccccc caaaacccaa
ggacaccctc 240atgatctccc ggacccctga ggtcacatgc gtggtggtgg
acgtgagcca cgaagaccct 300gaggtcaagt tcaactggta cgtggacggc
gtggaggtgc ataatgccaa gacaaagccg 360cgggaggagc agtacaacag
cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag 420gactggctga
atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc
480atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt
gtacaccctg 540cccccatccc gggatgagct gaccaagaac caggtcagcc
tgacctgcct ggtcaaaggc 600ttctatccca gcgacatcgc cgtggagtgg
gagagcaatg ggcagccgga gaacaactac 660aagaccacgc ctcccgtgtt
ggactccgac ggctccttct tcctctacag caagctcacc 720gtggacaaga
gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct
780ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaatg a
83120245PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 20Met Ala Leu Thr Phe Ala Leu Leu Val Ala Leu
Leu Val Leu Ser Cys 1 5 10 15 Lys Ser Ser Cys Ser Val Gly Cys Pro
Pro Cys Pro Ala Pro Glu Leu 20 25 30 Leu Gly Gly Pro Ser Val Phe
Leu Phe Pro Pro Lys Pro Lys Asp Thr 35 40 45 Leu Met Ile Ser Arg
Thr Pro Glu Val Thr Cys Val Val Val Asp Val 50 55 60 Ser His Glu
Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 65 70 75 80 Glu
Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 85 90
95 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu
100 105 110 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu
Pro Ala 115 120 125 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln
Pro Arg Glu Pro 130 135 140 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp
Glu Leu Thr Lys Asn Gln 145 150 155 160 Val Ser Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170 175 Val Glu Trp Glu Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 180 185 190 Pro Pro Val
Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 195 200 205 Thr
Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 210 215
220 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser
225 230 235 240 Leu Ser Pro Gly Lys 245 21738DNAArtificial
SequenceDescription of Artificial Sequence Synthetic construct
21atggccttga cctttgcttt actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc
60tctgtgggct gcccgccgtg cccagctccg gaactgctgg gcggaccgtc agtcttcctc
120ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt
cacatgcgtg 180gtggtggacg tgagccacga agaccctgag gtcaagttca
actggtacgt ggacggcgtg 240gaggtgcata atgccaagac aaagccgcgg
gaggagcagt acaacagcac gtaccgtgtg 300gtcagcgtcc tcaccgtcct
gcaccaggac tggctgaatg gcaaggagta caagtgcaag 360gtctccaaca
aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag
420ccccgagaac cacaggtgta caccctgccc ccatcccggg atgagctgac
caagaaccag 480gtcagcctga cctgcctggt caaaggcttc tatcccagcg
acatcgccgt ggagtgggag 540agcaatgggc agccggagaa caactacaag
accacgcctc ccgtgttgga ctccgacggc 600tccttcttcc tctacagcaa
gctcaccgtg gacaagagca ggtggcagca ggggaacgtc 660ttctcatgct
ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc
720ctgtctccgg gtaaatga 73822430PRTArtificial SequenceDescription of
Artificial Sequence Synthetic construct 22Met Ala Leu Thr Phe Ala
Leu Leu Val Ala Leu Leu Val Leu Ser Cys 1 5 10 15 Lys Ser Ser Cys
Ser Val Gly Cys Asp Leu Pro Gln Thr His Ser Leu 20 25 30 Gly Ser
Arg Arg Thr Leu Met Leu Leu Ala Gln Met Arg Arg Ile Ser 35 40 45
Leu Phe Ser Cys Leu Lys Asp Arg His Asp Phe Gly Phe Pro Gln Glu 50
55 60 Glu Phe Gly Asn Gln Phe Gln Lys Ala Glu Thr Ile Pro Val Leu
His 65 70 75 80 Glu Met Ile Gln Gln Ile Phe Asn Leu Phe Ser Thr Lys
Asp Ser Ser 85 90 95 Ala Ala Trp Asp Glu Thr Leu Leu Asp Lys Phe
Tyr Thr Glu Leu Tyr 100 105 110 Gln Gln Leu Asn Asp Leu Glu Ala Cys
Val Ile Gln Gly Val Gly Val 115 120 125 Thr Glu Thr Pro Leu Met Lys
Glu Asp Ser Ile Leu Ala Val Arg Lys 130 135 140 Tyr Phe Gln Arg Ile
Thr Leu Tyr Leu Lys Glu Lys Lys Tyr Ser Pro 145 150 155 160 Cys Ala
Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser Phe Ser Leu 165 170 175
Ser Thr Asn Leu Gln Glu Ser Leu Arg Ser Lys Glu Gly Gly Gly Gly 180
185 190 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Lys Thr His
Thr 195 200 205 Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro
Ser Val Phe 210 215 220 Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
Ile Ser Arg Thr Pro 225 230 235 240 Glu Val Thr Cys Val Val Val Asp
Val Ser His Glu Asp Pro Glu Val 245 250 255 Lys Phe Asn Trp Tyr Val
Asp Gly Val Glu Val His Asn Ala Lys Thr 260 265 270 Lys Pro Arg Glu
Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val 275 280 285 Leu Thr
Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 290 295 300
Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser 305
310 315 320 Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
Pro Pro 325 330 335 Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu
Thr Cys Leu Val 340 345 350 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val
Glu Trp Glu Ser Asn Gly 355 360 365 Gln Pro Glu Asn Asn Tyr Lys Thr
Thr Pro Pro Val Leu Asp Ser Asp 370 375 380 Gly Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp 385 390 395 400 Gln Gln Gly
Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 405 410 415 Asn
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 420 425 430
231291DNAArtificial SequenceDescription of Artificial Sequence
Synthetic construct 23atggccttga cctttgcttt actggtggcc ctcctggtgc
tcagctgcaa gtcaagctgc 60tctgtgggct gtgatctgcc tcaaacccac agcctgggta
gcaggaggac cttgatgctc 120ctggcacaga tgaggagaat ctctcttttc
tcctgcttga aggacagaca tgactttgga 180tttccccagg aggagtttgg
caaccagttc caaaaggctg aaaccatccc tgtcctccat 240gagatgatcc
agcagatctt caatctcttc agcacaaagg actcatctgc tgcttgggat
300gagaccctcc tagacaaatt ctacactgaa ctctaccagc agctgaatga
cctggaggcc 360tgtgtgatac agggggtggg ggtgacagag actcccctga
tgaaggagga ctccattctg 420gctgtgagga aatacttcca aagaatcact
ctctatctga aagagaagaa atacagccct 480tgtgcctggg aggttgtcag
agcagaaatc atgagatctt tttctttgtc aacaaacttg 540caagaaagtt
tacgtagtaa ggaaggtggc ggcggatccg gtggaggcgg gtccggcggt
600ggagggagcg acaaaactca cacgtgcccg ccgtgcccag ctccggaact
gctgggcgga 660ccgtcagttt cctcttcccc ccaaaaccca aggacaccct
catgatctcc cggacccctg 720aggtcacatg cgtggtggtg gacgtgagcc
acgaagaccc tgaggtcaag ttcaactggt 780acgtggacgg cgtggaggtg
cataatgcca agacaaagcc gcgggaggag cagtacaaca 840gcacgtaccg
tgtggtcagc gtcctcaccg tcctgcacca ggactggctg aatggcaagg
900agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa
accatctcca 960aagcaaaggg cagccccgag aaccacaggt gtacaccctg
cccccatccc gggatgagct 1020gaccaagaac caggtcagcc tgacctgcct
ggtcaaaggc ttctatccca gcgacatcgc 1080cgtggagtgg gagagcaatg
ggcagccgga gaacaactac aagaccacgc ctcccgtgtt 1140ggactccgac
ggctccttct tcctctacag caagctcacc gtggacaaga gcaggtggca
1200gcaggggaac gtcttctcat gctccgtgat gcatgaggct ctgcacaacc
actacacgca 1260gaagagcctc tccctgtctc cgggtaaatg a
129124428PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 24Met Gly Val His Glu Cys Pro Ala Trp Leu Trp
Leu Leu Leu Ser Leu 1 5 10 15 Leu Ser Leu Pro Leu Gly Leu Pro Val
Leu Gly Ala Pro Pro Arg Leu 20 25 30 Ile Cys Asp Ser Arg Val Leu
Glu Arg Tyr Leu Leu Glu Ala Lys Glu 35 40 45 Ala Glu Asn Ile Thr
Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu 50 55 60 Asn Ile Thr
Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg 65 70 75 80 Met
Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu 85 90
95 Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser
100 105 110 Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val
Ser Gly 115 120 125 Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly
Ala Gln Lys Glu 130 135 140 Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala
Ala Pro Leu Arg Thr Ile 145 150 155 160 Thr Ala Asp Thr Phe Arg Lys
Leu Phe Arg Val Tyr Ser Asn Phe Leu 165 170 175 Arg Gly Lys Leu Lys
Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp 180 185 190 Arg Glu Phe
Ala Gly Ala Ala Ala Val Asp Lys Thr His Thr Cys Pro 195 200 205 Pro
Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe 210 215
220 Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
225 230 235 240 Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Lys Phe 245 250 255 Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro 260 265 270 Arg Glu Glu Gln Tyr Asn Ser Thr Tyr
Arg Val Val Ser Val Leu Thr 275 280 285 Val Leu His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys Val 290 295 300 Ser Asn Lys Ala Leu
Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala 305 310 315 320 Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg 325 330 335
Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly 340
345 350 Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
Pro 355 360 365 Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly Ser 370 375 380 Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser Arg Trp Gln Gln 385 390 395 400 Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn His 405 410 415 Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 420 425 251287DNAArtificial
SequenceDescription of Artificial Sequence Synthetic construct
25atgggagtgc acgaatgtcc tgcctggctg tggcttctcc tgtccctgct gtcgctccct
60ctgggcctcc cagtcctggg cgccccacca cgcctcatct gtgacagccg agtcctggag
120aggtacctct tggaggccaa ggaggccgag aatatcacga cgggctgtgc
tgaacactgc 180agcttgaatg agaatatcac tgtcccagac accaaagtta
atttctatgc ctggaagagg 240atggaggtcg ggcagcaggc cgtagaagtc
tggcagggcc tggccctgct gtcggaagct 300gtcctgcggg gccaggccct
gttggtcaac tcttcccagc cgtgggagcc cctgcagctg 360catgtggata
aagccgtcag tggccttcgc agcctcacca ctctgcttcg ggctctggga
420gcccagaagg aagccatctc ccctccagat gcggcctcag ctgctccact
ccgaacaatc 480actgctgaca ctttccgcaa actcttccga gtctactcca
atttcctccg gggaaagctg
540aagctgtaca caggggaggc ctgcagaaca ggggacagag agttcgccgg
cgccgctgcg 600gtcgacaaaa ctcacacatg cccaccgtgc ccagctccgg
aactcctggg cggaccgtca 660gtcttcctct tccccccaaa acccaaggac
accctcatga tctcccggac ccctgaggtc 720acatgcgtgg tggtggacgt
gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 780gacggcgtgg
aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg
840taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg
caaggagtac 900aagtgcaagg tctccaacaa agccctccca gcccccatcg
agaaaaccat ctccaaagcc 960aaagggcagc cccgagaacc acaggtgtac
accctgcccc catcccggga tgagctgacc 1020aagaaccagg tcagcctgac
ctgcctggtc aaaggcttct atcccagcga catcgccgtg 1080gagtgggaga
gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgttggac
1140tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag
gtggcagcag 1200gggaacgtct tctcatgctc cgtgatgcat gaggctctgc
acaaccacta cacgcagaag 1260agcctctccc tgtctccggg taaatga
12872611PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 26Pro Lys Asn Ser Ser Met Ile Ser Asn Thr Pro 1 5
10 277PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 27His Gln Ser Leu Gly Thr Gln 1 5
288PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 28His Gln Asn Leu Ser Asp Gly Lys 1 5
298PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 29His Gln Asn Ile Ser Asp Gly Lys 1 5
308PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 30Val Ile Ser Ser His Leu Gly Gln 1 5
318PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker peptide 31Glu Phe Ala Gly Ala Ala Ala Val 1 5
3220PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker peptide 32Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala
Gly Ala Gly Ala Gly Ala 1 5 10 15 Gly Ala Gly Ala 20
3330PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker peptide 33Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly 1 5 10 15 Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly Ser 20 25 30 3480PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker peptide
34Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 1
5 10 15 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly 20 25 30 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly 35 40 45 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly 50 55 60 Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser 65 70 75 80 353PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker peptide
35Gly Gly Gly 1 367PRTArtificial SequenceDescription of Artificial
Sequence Synthetic linker peptide 36Ser Gly Gly Ser Gly Gly Ser 1 5
3715PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker peptide 37Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Gly 1 5 10 15 3816PRTArtificial SequenceDescription
of Artificial Sequence Synthetic linker peptide 38Gly Gly Ser Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15
3918PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker peptide 39Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly 1 5 10 15 Gly Ser 4050PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker peptide
40Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1
5 10 15 Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly 20 25 30 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly 35 40 45 Gly Ser 50 4119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
41gctggctagc caccatgga 194245DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 42cttgtcatcg tcgtccttgt
agtcgtcacc agtggaacct ggaac 454367DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 43gactacaagg acgacgatga
caaggacaaa actcacacat gcccaccgtg cccagctccg 60gaactcc
674421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 44tagtggatcc tcatttaccc g 214538DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
45gctacctgca ggccaccatg gtctcccagg ccctcagg 384651DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46cagttccgga gctgggcacg gcgggcacgt gtgagttttg tcgggaaatg g
514733DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 47ttactgcaga aggttatgca gcgcgtgaac atg
334838DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 48tttttcgaat tcagtgagct ttgttttttc cttaatcc
384934DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 49ggtaagcttg ccatggagct gaggccctgg ttgc
345027DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 50gttttcaatc tctaggaccc actcgcc
275123DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 51gccaggccac atgactactc cgc 235234DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52ggtgaattct cactcaggca ggtgtgaggg cagc 345337DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53gctactgcag ccaccatggc cttgaccttt gctttac 375435DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
54cgttgaattc ttccttactt cttaaacttt cttgc 355573DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
55cagttccgga gctgggcacg gcgggcacgt gtgagttttg tcttccttac ttcttaaact
60ttttgcaagt ttg 735645DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 56gtcaggatcc ggcggtggag
ggagcgacaa aactcacacg tgccc 455732DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 57tgacgcggcc gctcatttac
ccggagacag gg 325832DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 58ccgctagcct gcaggccacc atggccttga cc
325934DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 59ccggatccgc cgccaccttc cttactacgt aaac
346015PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker peptide 60Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser 1 5 10 15 6160DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 61gtcaggatcc ggtggaggcg
ggtccggcgg tggagggagc gacaaaactc acacgtgccc 606220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
62atagaagcct ttgaccaggc 206384DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 63gccggcgaat
tcggtggtga gtaccaggcc ctgaagaaga aggtggccca gctgaaggcc 60aagaaccagg
ccctgaagaa gaag 846458DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 64gtggcccagc
tgaagcacaa gggcggcggc cccgccccag agctcctggg cggaccga
586582DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 65cggtccgccc aggagctctg gggcggggcc
gccgcccttg tgcttcagct gggccacctt 60cttcttcagg gcctggttct tg
826660DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 66gccttcagct gggccacctt cttcttcagg
gcctggtact caccaccgaa ttcgccggca 606762DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 67ccggtgacag ggaattcggt ggtgagtacc aggccctgga
gaaggaggtg gcccagctgg 60ag 626883DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 68gccgagaacc
aggccctgga gaaggaggtg gcccagctgg agcacgaggg tggtggtccc 60gctccagagc
tgctgggcgg aca 836955DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 69gtccgcccag
cagctctgga gcgggaccac caccctcgtg ctccagctgg gccac
557090DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 70ctccttctcc agggcctggt tctcggcctc
cagctgggcc acctccttct ccagggcctg 60gtactcacca ccgaattccc tgtcaccgga
907137DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 71gctactgcag ccaccatggc cttgaccttt gctttac
377244DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 72cagttccgga gctgggcacg gcggagagcc cacagagcag cttg
447342DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 73gtggtcatat gggcattgaa ggcagaggcg ccgctgcggt cg
427450DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 74ggtggttgct cttccgcaaa aacccggaga cagggagaga
ctcttctgcg 507532DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 75aatctagagc cccaccacgc ctcatctgtg ac
327630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 76ttgaattctc tgtcccctgt cctgcaggcc
307727DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 77gtacctgcag gcggagatgg gggtgca
277822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 78cctggtcatc tgtcccctgt cc 227956DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
79gtccaacctg caggaagctt gccgccacca tgggagtgca cgaatgtcct gcctgg
568067DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 80gccgaattca gttttgtcga ccgcagcggc gccggcgaac
tctctgtccc ctgttctgca 60ggcctcc 67815PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker peptide
81Gly Gly Gly Gly Ser 1 5 8269DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 82gctgcggtcg acaaaactca
cacatgccca ccgtgcccag ctccggaact cctgggcgga 60ccgtcagtc
698336DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 83attggaattc tcatttaccc ggagacaggg agaggc
36844PRTHomo sapiens 84Glu Leu Leu Gly 1 8510PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker peptide
85Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 1 5 10 8610PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker peptide
86Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 877PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide
fragment 87Ser Val Gly Cys Pro Pro Cys 1 5 886PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide
fragment 88Val Gly Cys Pro Pro Cys 1 5 897PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide
fragment 89Ser Thr Gly Cys Pro Pro Cys 1 5 904PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide
fragment 90Cys Pro Pro Cys 1 918PRTArtificial SequenceDescription
of Artificial Sequence Synthetic FLAG peptide 91Asp Tyr Lys Asp Asp
Asp Asp Lys 1 5 9248DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 92ctagcctgca ggaagcttgc cgccaccatg
accaacaagt gtctcctc 489351DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 93tttgtcgacc gcagcggcgc
cggcgaactc gtttcggagg taacctgtaa g 519437DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
94ggcaagcttg ccgccaccat ggagacagac acactcc 379540DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
95tcagtggtga tggtgatgat gtttacccgg agacagggag 409653DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
96ggtaaacatc atcaccatca ccactgagaa ttccaatatc actagtgaat tcg
539732DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 97gctatttagg tgacactata gaatactcaa gc
32981269DNAHomo sapiens 98atgaccaaca agtgtctcct ccaaattgct
ctcctgttgt gcttctccac tacagctctt 60tccatgagct acaacttgct tggattccta
caaagaagca gcaattttca gtgtcagaag 120ctcctgtggc aattgaatgg
gaggcttgaa tattgcctca aggacaggat gaactttgac 180atccctgagg
agattaagca gctgcagcag ttccagaagg aggacgccgc attgaccatc
240tatgagatgc tccagaacat ctttgctatt ttcagacaag attcatctag
cactggctgg 300aatgagacta ttgttgagaa cctcctggct aatgtctatc
atcagataaa ccatctgaag 360acagtcctgg aagaaaaact ggagaaagaa
gatttcacca ggggaaaact catgagcagt 420ctgcacctga aaagatatta
tgggaggatt ctgcattacc tgaaggccaa ggagtacagt 480cactgtgcct
ggaccatagt cagagtggaa atcctaagga acttttactt cattaacaga
540cttacaggtt acctccgaaa cgagttcgcc ggcgccgctg cggtcgacaa
aactcacaca 600tgcccaccgt gcccagctcc ggaactcctg ggcggaccgt
cagtcttcct cttcccccca 660aaacccaagg acaccctcat gatctcccgg
acccctgagg tcacatgcgt ggtggtggac 720gtgagccacg aagaccctga
ggtcaagttc aactggtacg tggacggcgt ggaggtgcat 780aatgccaaga
caaagccgcg ggaggagcag tacaacagca cgtaccgtgt ggtcagcgtc
840ctcaccgtcc tgcaccagga ctggctgaat ggcaaggagt acaagtgcaa
ggtctccaac 900aaagccctcc cagcccccat cgagaaaacc atctccaaag
ccaaagggca gccccgagaa 960ccacaggtgt acaccctgcc cccatcccgg
gatgagctga ccaagaacca ggtcagcctg 1020acctgcctgg tcaaaggctt
ctatcccagc gacatcgccg tggagtggga gagcaatggg 1080cagccggaga
acaactacaa gaccacgcct cccgtgttgg actccgacgg ctccttcttc
1140ctctacagca agctcaccgt ggacaagagc aggtggcagc aggggaacgt
cttctcatgc 1200tccgtgatgc atgaggctct gcacaaccac tacacgcaga
agagcctctc cctgtctccg 1260ggtaaatga 126999422PRTHomo sapiens 99Met
Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser 1 5 10
15 Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg
20 25 30 Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn
Gly Arg 35 40 45 Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp
Ile Pro Glu Glu 50 55 60 Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu
Asp Ala Ala Leu Thr Ile 65 70 75 80 Tyr Glu Met Leu Gln Asn Ile Phe
Ala Ile Phe Arg Gln Asp Ser Ser 85 90 95 Ser Thr Gly Trp Asn Glu
Thr Ile Val Glu Asn Leu Leu Ala Asn Val 100 105 110 Tyr His Gln Ile
Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu 115 120 125 Lys Glu
Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys 130 135 140
Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser 145
150 155 160 His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn
Phe Tyr 165 170 175 Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn Glu
Phe Ala Gly Ala 180 185 190 Ala Ala Val Asp Lys Thr His Thr Cys Pro
Pro Cys Pro Ala Pro Glu 195 200 205 Leu Leu Gly Gly Pro Ser Val Phe
Leu Phe Pro Pro Lys Pro Lys Asp 210 215 220 Thr Leu Met Ile Ser Arg
Thr Pro Glu Val Thr Cys Val Val Val Asp 225 230 235 240 Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly 245
250 255 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr
Asn 260 265 270 Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His
Gln Asp Trp 275 280 285 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser
Asn Lys Ala Leu Pro 290 295 300 Ala Pro Ile Glu Lys Thr Ile Ser Lys
Ala Lys Gly Gln Pro Arg Glu 305 310 315 320 Pro Gln Val Tyr Thr Leu
Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn 325 330 335 Gln Val Ser Leu
Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 340 345 350 Ala Val
Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr 355 360 365
Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys 370
375 380 Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser
Cys 385 390 395 400 Ser Val Met His Glu Ala Leu His Asn His Tyr Thr
Gln Lys Ser Leu 405 410 415 Ser Leu Ser Pro Gly Lys 420
100102DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 100tttaagcttg ccgccaccat ggagacagac acactcctgc
tatgggtact gctgctctgg 60gttccaggtt ccactggtga caaaactcac acatgcccac
cg 10210122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 101ggtcagctca tcgcgggatg gg 2210222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
102cccatcccgc gatgagctga cc 221039DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Kozak sequence 103gccgccacc
910423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 104gagcagtacg ctagcacgta ccg 2310523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
105ggtacgtgct agcgtactgc tcc 2310669DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
106ctgacggtcc gcccaggagt tccggagctg ggcacggtgg gcatgtgtga
gttttgtcga 60ccgcagcgg 691076PRTArtificial SequenceDescription of
Artificial Sequence Synthetic 6xHis tag 107His His His His His His
1 5
* * * * *
References